text
stringlengths
12
4.76M
timestamp
stringlengths
26
26
url
stringlengths
32
32
Archives Follow me on Facebook Day: December 8, 2008 It’s not every day you get access to a plant in China that makes something inside your computer or game console or car. A few weeks back we visited Seagate’s Wuxi plant which makes more than a million hard drives every week. Employs more than 10,000 people. Seagate has been my partner for several years now and sponsors my show, which is why I was the first American blogger to get access to this plant. Obviously I appreciate everything Seagate does for me and social media (they are playing around with FriendFeed and Facebook, their FriendFeed room is here). This is also my 100th video. Thanks to Rocky Barbanica for his role in producing and editing these videos. Greatly appreciate that too. Seagate is a dream client. They rarely ask me to do anything. They’ve never forced me to put interruptive advertising up or asked for anything that was anti community or viewer. That’s HUGE in this world and I hope that they continue to drive down the price of storage the way they have for about 30 years. Thanks and hope you enjoy getting this look inside the factory in Wuxi, China. Dave Winer talks about why FriendFeed hasn’t gotten super popular yet. He thinks there’s space for a new service between Twitter and FriendFeed. Everyone knows I’m FriendFeed’s #1 customer, but I’ve been studying the two services for a while and have found 10 reasons why FriendFeed isn’t right for you. 1. Twitter has one way to get content into the system. You see a box. You type. You push a button that says “update.” Compare this to FriendFeed. Let’s try to count the ways you can get content into the system. a. the standard way on the top of the page, but there you have to choose whether you are putting in a message, a link, a photo. b. Import your site. Or your Flickr. Or your YouTube. Or your Facebook. Or your Twitter stream. Or your blog. Or your Disqus comments. Or your Upcoming.org stream. Etc. Etc. There are 59 services that can be brought into FriendFeed. Very few services do the same for Twitter. c. You can “Like” an item. Here’s all my likes. There’s 11,500 of them so far, which shows another problem: too much content to go through on FF. Twitter actually has a similar feature, called Favorites, but no one actually uses that. d. You can “Comment” on an item. Here’s my comments. More than 6,000 of them. You really don’t want that kind of distraction. You might have to participate and that wouldn’t be good. I’m probably missing five other ways you can get content into FriendFeed. Like emailing in items. 2. Twitter has one display of messages that are 140 characters long. You can’t handle the responsibility of longer messages. Plus FriendFeed’s messages include photos. YouTube videos. Play inline audio links. And more. You can’t handle those distractions. Twitter is for you. 4. On Twitter you follow people by your friends telling you their Twitter address. Mine is http://www.twitter.com/scobleizer or you will see someone replying to me by using @scobleizer and you’ll click that link and then click “follow.” FriendFeed has a whole list of recommended users that you’ll need to consider when first signing up for the service. The recommendations, if you’ve followed me, will include such people like Mike Arrington, Charlene Li, Corvida, Om Malik, Steve Gillmor, Jason Calacanis, David Sifry, and many other people. Now you’ll need to consider how those people got recommended to you and that might hurt your brain. On Twitter it just shows you who I’m following on the right side of the page — members who’ve been on longer are on top of that list. 7. FriendFeed has rooms. Twitter doesn’t. Rooms seem a lot like old-school mailing lists. Makes your head hurt, so they can’t be a good thing. 8. If you don’t want to see someone on Twitter anymore, you unfollow them. If you don’t want them to see you either, you block them. But that’s about it. FriendFeed does both of those but then also lets you hide posts. Did you know you can hide just someone’s Flickr photos? Or her Tweets? Or both? Too confusing. You can’t handle that, which is why Twitter is for you. Any service that has a tutorial on how to use a feature is just not for you.
2024-04-12T01:26:58.646260
https://example.com/article/4295
He's a secret agent working for Daito. His work goes from spying rival companies to deliver the purple roses to Maya. He's calm and composed. His father was the president of a company which went bankrupt. He decided to suicide with his family but only he and Karato survived, losing their identity. Masumi's father helped Karato: he paid his school fees and let him work for Daito. He's Masumi's friend and confident and only wishes for his happiness.
2024-07-08T01:26:58.646260
https://example.com/article/4500
using System; using System.Text; namespace ZonyLrcToolsX.Infrastructure.Utils { /// <summary> /// 提供异常处理相关的辅助方法。 /// </summary> public static class ExceptionUtils { /// <summary> /// 格式化异常对象,将其转换为可阅读的字符串信息。 /// </summary> /// <exception cref="ArgumentNullException">当用户传入的异常 <paramref name="exception"/> 为 Null 时,会引发本异常。</exception> public static string GetFormatExceptionMessage(this Exception exception) { var messageBuilder = new StringBuilder(); messageBuilder.Append("异常提示信息:").Append(exception.InnerException?.Message ?? exception.Message).Append("\r\n"); messageBuilder.Append("异常堆栈信息:").Append(exception.InnerException?.StackTrace ?? exception.StackTrace).Append("\r\n"); return messageBuilder.ToString(); } } }
2024-06-20T01:26:58.646260
https://example.com/article/8196
Fabrizio Degli Afflitti Fabrizio Degli Afflitti (1572–1613) was a Roman Catholic prelate who served as Bishop of Boiano (1608–1613). Biography Fabrizio Degli Afflitti was born in Naples, Italy. On 10 November 1608, he was appointed by Pope Paul V as Bishop of Boiano. On 23 November 1608, he was consecrated bishop by Marcello Lante della Rovere, Bishop of Todi with Giovanni Battista del Tufo, Bishop of Acerra, and Paolo De Curtis, Bishop of Isernia, serving as principal co-consecrators. He served as Bishop of Boiano until his death in 1613. References External links and additional sources (for Chronology of Bishops) (for Chronology of Bishops) Category:1572 births Category:1613 deaths Category:17th-century Roman Catholic archbishops Category:Bishops appointed by Pope Paul V
2024-07-24T01:26:58.646260
https://example.com/article/3323
Understanding innovation in social service delivery systems. Progress in the social services is driven by innovation. It depends on the ability of social work researchers and practitioners to find innovative solutions to the problems they face. Innovation entails the creation, adaptation, and adoption of new approaches to service delivery. The most fundamental type of innovation is the creation of a new service product. However, innovations in the way services are delivered are equally important. This paper provides a model for understanding innovation in social services.
2024-06-08T01:26:58.646260
https://example.com/article/5955
HADLEY — State and local health officials are studying three more properties owned by the Chang Family Trust, weeks after they condemned two other homes for farm workers in Whately and Deerfield for substandard living conditions. Last week, local health officials issued 30-day corrective action orders for properties at 60 Main St. and 27 Chesterfield Drive in Amherst, as well as 90 Mount Warner Road in Hadley, where an unknown number of tenants live. The cited conditions of the three properties, one of them a five-unit apartment complex above Amherst Chinese Food restaurant, also owned by the Chang family, were not as severe as those found in the Franklin County properties that led to condemnation orders last month. However, local and state health, building and fire officials found a number of housing code violations that must be addressed by late October, inspection records show. “They are fairly simple types of violations, the kinds of things we might run into frequently,” said Amherst Health Director Julie Federman, who conducted a joint inspection of the Amherst properties with state officials last week. “They need to be corrected to bring the properties up to code.” Sidney Chang, who manages the family’s bean sprout farm operations with Chang & Son Enterprises Inc. on River Road in Whately, was on hand for the inspections. He is the son of Rose C. and Tso-Cheng Chang, trustees of the Chang Family Trust. The family could not be reached for comment, but their Amherst attorney, Lawrence Farber, who is representing the Chang family in a state housing court case, said none of the violations found was serious. “Any place that gets inspected is going to have some problems,” Farber said. “We are planning on repairing them within the period of time.” The violations cited at the Amherst and Hadley properties included damaged walls and ceilings, temporary wiring, missing light fixtures and hand railings and inadequate smoke detector systems, among other issues. The Hadley property on Mount Warner Road, which abuts farmland owned by the Chang family, also lacked a second exit and had interior structural work done without permits, according to a report by Hadley Building Commissioner Timothy Neyhart. “We asked them to rebuild the rear deck because it was in bad shape,” Neyhart said. “There wasn’t a true rear second means of egress.” The latest round of inspections comes in the midst of a housing court case brought by the state Department of Public Health against the Chang Family Trust. The court action was prompted by earlier inspections of two homes that housed a combined 21 people at 23 Sugarloaf St. in Deerfield and 299 River Road in Whately, the latter of which abuts the farm known as Chang & Son Enterprises. Both properties were condemned after inspectors found what appeared to be long-standing health, sanitary and fire code violations, from rotted floors and a collapsing roof and ceilings to unsafe electrical systems and a lack of smoke and carbon monoxide detectors. The displaced tenants included 14 people, including seven children, who lived in the two-story Deerfield home. They have since been put up in area apartments and a hotel by the Chang family under a court order. The Deerfield home is slated for demolition, though lawyers working on behalf of many of the farmworkers say the Whately home could be brought up to code. “At this point, what we’re really focusing on is getting information from the tenants,” said Jennifer Dieringer, an attorney with Community Legal Aid, which is assisting many of the displaced farmworkers. “It is clear that they have landlord-tenant rights, that they have a right to live in apartments that meet state sanitary requirements,” she said. “We don’t know whether they’ve signed leases, how many people were living in each unit, or how much they were paying for rent.” Local and state health officials interviewed said they could not confirm whether tenants living in the three additional properties cited in Hadley and Amherst are farmworkers employed by Chang & Son Enterprises Inc. Legal advocates said their goal is to ensure that tenants living in all the properties are housed in safe conditions and understand their rights as tenants, which was not the case only a few weeks ago. “We are now able to help them understand what’s happening and involve them in the process and update them on what’s happening in the case,” Dieringer said. Farber said it is the Chang family’s long-term intention to no longer provide housing for its employees. “It is clearly something outside the scope of their expertise,” Farber said. “Their expertise is being farmers and running a restaurant and not being housing specialists.” As the housing case plays out in state court, another federal case is pending against Chang & Son Enterprises. The U.S. Labor Department, which had a representative at the last housing court hearing, filed a lawsuit against the company earlier this year alleging the vegetable farm violated wage laws.
2024-07-06T01:26:58.646260
https://example.com/article/9447
Pita Taufatofua, the Tongan athlete known for his oiled up, bare-chested marches at Olympic opening ceremonies, produced a surprise performance in the 15km cross-country race: he did not finish last and he kept his shirt on. After spending only 12 weeks on snow in his life, having seen snow for the first time two years ago, Taufatofua finished third last, nearly 23 minutes behind the gold medallist. Three other athletes did not finish the race. “I’d rather finish towards the end of the pack with all my friends than be somewhere in the middle by myself,” he said after becoming only the second Winter Olympian from Tonga. “We fought together, we finished together,” he said. Taufatofua has been spending much of his time since he arrived in Pyeongchang with other athletes from countries with low participation in winter sports. His 56:41.1 finish was a vast improvement over his modest goals before the race: “Finish before they turn the lights off. That’s number one. Don’t ski into a tree. That’s number two.” Taufatofua waited at the finish line for the last two skiers to cross, and when German Madrazo of Mexico slid past the line waving a Mexican flag handed to him by a spectator, Taufatofua lifted him on to one shoulder in celebration. “The 15km never worked so well for me: I always gas out by about the second kilometre,” Taufatofua said. “The hardest part was to try to maintain a pace – a slow pace but it’s a pace.” He had to fight the urge to go faster when he heard the cheer of the crowd, and he was certainly a favourite among those who waited until the end. Taufatofua never thought he could win a medal, but the former youth worker was more interested in sending a message than standing on a podium. “The truth is that I’ve had a short time on snow and I won’t medal,” he said at a press conference before the race. “But in four years someone from Tonga might, in eight years someone from the Pacific might, but more importantly people from the Pacific, these kids who are watching now, they’ll have access to something they never knew existed before.” He plans to try to qualify for the summer Olympics in Tokyo in 2020 in a third sport, saying he was thinking about “something to do with water”. Taufatofua recalled when Paea Wolfgramm won a silver medal in super heavyweight boxing at the 1996 Olympics. Taufatofua watched matches at a neighbour’s house at a time in Tonga when there was only one television for 100 families, he said. When Wolfgramm returned to Tonga, Taufatofua and his friends lined the road to welcome him, with each boy holding a piece of paper with one letter of Wolfgramm’s name. “As a kid you don’t really know, but you can feel,” he said. As for his shirtless march at the opening ceremony in Pyeongchang, where sub-zero temperatures were a marked difference from the weather for his first appearance at the 2016 Rio Games, that too was meant to send a message. He said: “If my ancestors can sail across the Pacific Ocean for a thousand years, not knowing where the next piece of land is going to be, not knowing where their next meal is going to be, going to war, then I can walk for 25 minutes through an opening ceremony without a shirt on and represent a thousand years of heritage, because that’s what they wore for a thousand years.”
2024-02-17T01:26:58.646260
https://example.com/article/3259
Epidemiology of occupational disorders of the upper extremity. The rise in reports of occupational disorders of the upper extremity has been meteoric. This chapter examines the frequency and prevalence of upper extremity disorders, reviews the active surveys of upper extremity disorders in selected occupations, examines current surveillance systems, and discusses the problem of effective case definition.
2023-12-11T01:26:58.646260
https://example.com/article/8441
pid = 968b5d3638724a9ab9a5e7fbe188c76d name = Ast. EUP-710 type = SpaceObject sit = ORBITING landed = False landedAt = displaylandedAt = splashed = False met = 510414447878049.31 lct = 510414447878049.31 lastUT = -1 root = 0 lat = -1.1509197332835399 lon = -15.136127115423822 alt = 18233120089.82048 hgt = -1 nrm = 0,1,0 rot = -0.515803039,0.319615036,0.727079153,0.32116878 CoM = 0,0,0 stg = 0 prst = False ref = 0 ctrl = False ORBIT { SMA = 16200250923.467028 ECC = 0.16233560109796225 INC = 2.4628780610004557 LPE = 2.882147927214346 LAN = 8.7265397883992932 MNA = -0.041098385556564657 EPH = 510414452659198.63 REF = 0 } PART { name = PotatoRoid cid = 0 uid = 0 mid = 0 launchID = 0 parent = 0 position = 0,0,0 rotation = 0,0,0,1 mirror = 1,1,1 symMethod = Radial istg = 0 resPri = 0 dstg = 0 sqor = 0 sepI = 0 sidx = 0 attm = 0 srfN = None, -1 mass = 150 shielded = False temp = -1 tempExt = 0 tempExtUnexp = 0 expt = 0.100000001 state = 0 attached = True autostrutMode = Off rigidAttachment = False flag = rTrf = modCost = 0 } ACTIONGROUPS { } DISCOVERY { state = 1 lastObservedTime = 510414447878049.31 lifetime = Infinity refTime = Infinity size = 4 } FLIGHTPLAN { } CTRLSTATE { } VESSELMODULES { FlightIntegrator { } RPMVesselComputer { } CommNetVessel { controlState = None canComm = True } }
2023-12-12T01:26:58.646260
https://example.com/article/2178
Androisoxazole Androisoxazole (brand names Androxan, Neo-Ponden, Neo-Pondus), also known as 17α-methyl-5α-androstano[3,2-c]isoxazol-17β-ol, is an orally active anabolic-androgenic steroid (AAS) and a 17α-alkylated derivative of dihydrotestosterone (DHT) that is marketed in Spain and Italy. It is closely related to stanozolol, differing only in having an isoxazole instead of pyrazole ring fused to the A ring, and is also related to furazabol, prostanozol, and danazol. References Category:Tertiary alcohols Category:Androgens and anabolic steroids Category:Androstanes Category:Hepatotoxins Category:Isoxazoles
2023-10-08T01:26:58.646260
https://example.com/article/5165
1. Field of the Invention The present invention relates to an acceleration sensor, and more particularly to an acceleration sensor including a cap which covers a sensing element while being spaced by a predetermined distance from the sensing element. 2. Description of the Background Art In recent days, an air bag system has been employed in most of automobiles on the market. Typically, an air bag system includes an acceleration sensor for detecting impact. In order to make an acceleration sensor adaptable to incorporation in various types of automobiles, there has conventionally been efforts to reduce a size of an acceleration sensor, as well as its associated costs. For example, concerning a package for covering a semiconductor substrate which forms an acceleration detector and a signal processor of an acceleration sensor, metal which had been most widely used as a material for the package has been superseded by resin. In the meantime, turning to a structure of an acceleration sensor, a sensing element including a mass body which is a movable portion for detecting an acceleration and the like is formed on a surface of a semiconductor substrate in an acceleration detector. Further, a glass cap is bonded to the surface of the semiconductor substrate in order to keep an admissible motion space of the mass body and prevent entry of dust, water or the like into the admissible motion space. By provision of the glass cap, the admissible motion space of the mass body is completely enclosed. More specifically, a bonding frame which surrounds the sensing element formed on the semiconductor substrate in plan view is formed on the semiconductor substrate. It is noted that polysilicon doped with impurities which is used as a material for the sensing element is also used as a material for the bonding frame. The bonding frame is in contact with an end portion of the glass cap. With the bonding frame and the end portion of the glass cap being kept in contact with each other, the glass cap and the semiconductor substrate are bonded to each other by anodic bonding for purposes of improving heremeticity or the like (please refer to National Publication of Translation No. 2002-500961 and Japanese Patent Application Laid-Open No. 9-292409, for example). However, since the bonding frame is formed of polysilicon doped with impurities, the above-described structure has suffered from problems associated with anodic bonding, as follows. Upon application of a voltage in anodic bonding, the impurities contained in the bonding frame are precipitated out in a portion of the bonding frame near a bonding interface. As anodic bonding to bond the glass cap and the bonding frame is achieved by uniting together glass of the glass cap and polysilicon of the bonding frame, the precipitated impurities existing between the glass of the glass cap and the polysilicon of the bonding frame would reduce a bonding strength between the glass cap and the bonding frame. That is, to allow the impurities to be precipitated out near the bonding interface would cause reduction of the bonding strength between the glass cap and the bonding frame.
2024-05-08T01:26:58.646260
https://example.com/article/3912
Novel coupling mechanism-based imaging approach to scanning electrochemical microscopy for probing the electric field distribution at the microchannel end. A novel coupling mechanism-based imaging approach to scanning electrochemical microscopy (SECM) was used to image the distribution of electric field at the end channel of a poly(dimethylsiloxane) (PDMS) capillary electrophoresis (CE) microchip in the absence of redox species. The coupling imaging mechanism was systematically investigated and qualitatively illustrated. It was proved that the distribution of solution potentials within the scanning plane caused a different reduction rate of water at the tip electrode, which led to the variation in tip current. Within the scanning plane, the solution potentials measured in the central area of the microchannel were usually higher than those measured outside. The SECM images showed a strong dependence on tip potential, tip-to-channel distance, and separation potential. According to the Tafel equation, SECM images were converted to parameters that directly showed the distribution of solution potential. Change in the solution potential along the central axial line of the microchannel was also continuously sensed by allowing the tip to approach the microchannel in the presence of high voltage. Using dopamine as a model compound, the effect of solution potential on electrochemical detection was estimated by detecting separation parameters.
2024-05-02T01:26:58.646260
https://example.com/article/7070
From 2009646dc28e1a20b71d176040e9222f5c62d231 Mon Sep 17 00:00:00 2001 From: Michael Marineau <michael.marineau@coreos.com> Date: Mon, 25 Jul 2016 14:59:29 -0700 Subject: [PATCH] gpt: do not use disk sizes GRUB will reject as invalid later on GRUB assumes that no disk is ever larger than 1EiB and rejects reads/writes to such locations. Unfortunately this is not conveyed in the usual way with the special GRUB_DISK_SIZE_UNKNOWN value. --- grub-core/lib/gpt.c | 26 ++++++++++++++++++++++++-- 1 file changed, 24 insertions(+), 2 deletions(-) diff --git a/grub-core/lib/gpt.c b/grub-core/lib/gpt.c index e162bafd3..3e17f2771 100644 --- a/grub-core/lib/gpt.c +++ b/grub-core/lib/gpt.c @@ -143,6 +143,28 @@ grub_gpt_size_to_sectors (grub_gpt_t gpt, grub_size_t size) return sectors; } +/* Copied from grub-core/kern/disk_common.c grub_disk_adjust_range so we can + * avoid attempting to use disk->total_sectors when GRUB won't let us. + * TODO: Why is disk->total_sectors not set to GRUB_DISK_SIZE_UNKNOWN? */ +static int +grub_gpt_disk_size_valid (grub_disk_t disk) +{ + grub_disk_addr_t total_sectors; + + /* Transform total_sectors to number of 512B blocks. */ + total_sectors = disk->total_sectors << (disk->log_sector_size - GRUB_DISK_SECTOR_BITS); + + /* Some drivers have problems with disks above reasonable. + Treat unknown as 1EiB disk. While on it, clamp the size to 1EiB. + Just one condition is enough since GRUB_DISK_UNKNOWN_SIZE << ls is always + above 9EiB. + */ + if (total_sectors > (1ULL << 51)) + return 0; + + return 1; +} + static void grub_gpt_lecrc32 (grub_uint32_t *crc, const void *data, grub_size_t len) { @@ -242,7 +264,7 @@ grub_gpt_read_backup (grub_disk_t disk, grub_gpt_t gpt) grub_disk_addr_t addr; /* Assumes gpt->log_sector_size == disk->log_sector_size */ - if (disk->total_sectors != GRUB_DISK_SIZE_UNKNOWN) + if (grub_gpt_disk_size_valid(disk)) sector = disk->total_sectors - 1; else if (gpt->status & GRUB_GPT_PRIMARY_HEADER_VALID) sector = grub_le_to_cpu64 (gpt->primary.alternate_lba); @@ -394,7 +416,7 @@ grub_gpt_repair (grub_disk_t disk, grub_gpt_t gpt) return grub_error (GRUB_ERR_BUG, "No valid GPT header"); /* Relocate backup to end if disk whenever possible. */ - if (disk->total_sectors != GRUB_DISK_SIZE_UNKNOWN) + if (grub_gpt_disk_size_valid(disk)) backup_header = disk->total_sectors - 1; backup_entries = backup_header -
2023-12-31T01:26:58.646260
https://example.com/article/9645
Oxidatively robust monophenolate-copper(II) complexes as potential models of galactose oxidase. Cupric complexes of a novel phenanthroline-phenolate ligand have strongly distorted coordination geometries and electrochemical properties conducive to modeling the spectroscopy and reactivity of the enzyme galactose oxidase.
2024-05-22T01:26:58.646260
https://example.com/article/4233
Cognitive Support Supplement Formulas Share on: Save as favorite 0.0 / 5 0 Review Treatment Type: Herbal and Nutritional Supplements Caregiver: Do it Yourself There are a number of formulas that are designed to enhance memory and mental functioning. These products typically include: herbs such as Apoaequorin, Lecithin, Gingko, Ginseng, Gotu Kola, and fresh water algae; amino acids like L-Glutamine, L-Tyrosine and Phenylalanine; B vitamins like Thiamin (B1), Folic Acid (B9) and Vitamin B12; minerals such as magnesium and zinc; phospholipids like phosphatidylserine; antioxidants and essential fatty acids.
2023-12-25T01:26:58.646260
https://example.com/article/2539
Q: How to expire values not key? Now I have some mappings, A->(A1, A2, A3, A4), B->(B1, B2, B3) I wanna set the expire time of A1, A2, A3... as two days, so I can only get the values added within two days. And if all the values of A expired, the key A expired and should be deleted. What solution or database can achieve this feature? Thanks very much. ####################################################- Well, I should describe this problem in more detail. A lot of key-value pairs have been stored in Couchbase. And the key-value pairs are like this: {id1_20170306-00:01:00 => value1} {id1_20170306-10:01:00 => value2} {id2_20170306-00:01:00 => value3}. The expiration time for all key-value pairs is two days. When the user sends a request for id1, all the key-value pairs whose keys start with id1 and not expired should be returned. I have a solution that is not particularly good. Convert the key to the start of the day. For 20170306-00:01:00 and 20170306-10:01:00, it is 20170306-00:00:00. Create a mapping like this id1_20170306-00:00:00 => (id1_20170306-00:01:00,id1_20170306-10:01:00). Set the expiration time of id1_20170306-00:00:00 to two days after the last modification. When the user sends a request for id1, keys like id1_20170305-00:00:00 and id1_20170306-00:00:00 are generated to access the real keys stored in Couchbase. Actually, the survive time of id1_20170306-00:01:00 is over two days. A: Sounds like you want two different things: A query that only returns recent items A clean-up job that runs regularly and deletes expired items Both of these tasks are trivial and can be done with any relational and many NoSQL databases.
2023-08-04T01:26:58.646260
https://example.com/article/3817
The emergence of Stenotrophomonas maltophilia as a significant nosocomial pathogen at the University Hospital of the West Indies. Stenotrophomonas maltophilia is emerging worldwide as a nosocomial pathogen. It is associated with certain risk factors and a wide range of infections. This study was done to document its emergence at the University Hospital of the West Indies and to determine the incidence, distribution and risk factors associated with it. A retrospective study was conducted over the period April 1997 to December 2000. Clinical records were available for 46 of the 66 patients identified over the study period. Fifty-five per cent of the cases came from the Intensive Care Unit (ICU) and the rest from other wards. There was a slight increase in the prevalence of infection with increasing age. The surgical service accounted for the largest number of isolates. Of the cases presented, 95.7% were exposed to a wide range of antibiotics and had some form of instrumentation. Underlying disease was found in 71.7% of the patients. S maltophilia was found most often in the sputum of ICU patients whereas it was most often isolated from wound swabs in the ward patients. The organism was isolated from blood more often in ICU patients (23.3%) than in ward patients (9.5%) and there was a 44% mortality rate among the cases in ICU compared with those on the wards (4.8%). Stenotrophomonas maltophilia is an important nosocomial pathogen and occurs in a wide cross-section of patients. The risk factors must be addressed and infection control measures implemented to restrict the spread of this organism.
2024-04-08T01:26:58.646260
https://example.com/article/8033
Q: What does git svn clone with no params for layout do? I have a grouped multi-project repo with the following structure: http://my.subversion.host/svn/repos/PRJGRP/projectN/{trunk,branches,tags} Let's say I'm cloning project 1; the following commands have the same effect: git svn clone -s http://my.subversion.host/svn/repos/grp1/project1 project1.git git svn clone -T trunk -b brances -t tags http://my.subversion.host/svn/repos/grp1/project1 project1.git My question is, what happens when you clone with none of the parameters? git svn clone http://my.subversion.host/svn/repos/grp1/project1 project1.git The first two produce the following config: [svn-remote "svn"] url = http://my.subversion.host/svn/repos/grp1 fetch = project1/trunk:refs/remotes/trunk branches = project1/branches/*:refs/remotes/* tags = project1/tags/*:refs/remotes/tags/* The third command produces: [svn-remote "svn"] url = http://my.subversion.host/svn/repos/grp1/project1 fetch = :refs/remotes/git-svn I wasn't even aware it's possible to not specify a layout; I ran this command by mistake and got this result. The manual page doesn't say anything about cloning an SVN repo without specifying any of these parameters. A: It'll just treat the root of your repository as one big branch, containing your subversion trunk and branches as directories, just as if you did svn checkout http://my.subversion.host/svn/repos/grp1/project1. It is possible to pick it apart but that would be a different question and may be more trouble than it's worth if you have time and access to run the clone again.
2024-05-23T01:26:58.646260
https://example.com/article/6728
Narcoleptic patients experience cataplexy, which is a sudden loss of muscle tone most commonly in response to the sudden onset of strong emotions, excessive daytime sleepiness and fragmentation of sleep during the night. Current drug treatments can be dichotomized into those that are aimed at daytime sleepiness, typically using dopamine agonists or psychostimulants, and those that are aimed at cataplexy, typically using tricyclic antidepressants. Drug side effects, residual sleepiness and cataplexy episodes continue to be major problems for most treated narcoleptics (Aldrich, M. S., 1998, Neurology 50: S2–S7). It has been reported that narcolepsy is linked to dysfunction of the newly discovered hypocretin (Hcrt) (orexin) peptide system. This report was based on a deletion in the transcripts of the hypocretin receptor 2 (Hcrt-2) gene in narcoleptic Dobermans and Labradors (Lin, L. et. al., Cell (1999) 97: 365–376). A mutation in the gene responsible for the hypocretin-2 (Orexin-2) receptor was reported to be a genetic cause of canine narcolepsy (Lin, L. et al., 1999, Cell 98: 365–376). A null mutation of the gene encoding the two known hypocretin (Hcrt) peptides produces aspects of the narcolepsy syndrome in mice (Chemelli, R. M. et al., 1999, Cell 98: 437–451). Human narcoleptics have reduced levels of Hcrt-1 in their cerebrospinal fluid (Nishino, S. et al., 2000, The Lancet 355: 39–40). Basic research on the behavioral effects of the hypocretins has generally used intracerebroventricular or intra-parenchymal microinjection of the peptide (Hagan, J. J. et al., 1999, Proc Natl Acad Sci U.S.A. 96: 10911–10916; Dube M. G., et al., Brain Res. 842: 473–477). The results in this area are controversial. Some studies have concluded that Hcrts administered systemically do not cross the blood-brain barrier (BBB) at sufficient levels to affect physiological function (Chen, C-T et al., 1999, Soc Neurosci Abst 25: 12; Takahashi, N. et al., 1999, Biochem Biophys Res Commun 254: 623–627), making development of an Hcrt receptor agonist with good BBB permeability a high priority. One group reported that iodinated Hcrt-1 passes the BBB (Kastin, A. J. and Akerstrom, V., 1999, J Pharmacol Exp Ther 289: 219–223.) but iodination is known to increase BBB permeability. This result does not remove the question whether the native peptide will pass the BBB.
2024-04-03T01:26:58.646260
https://example.com/article/9698
We read with interest Dr. Jalal\'s recent publication on another potential treatment option for recurrent isolated sleep paralysis: *Meditation Combined with Muscle Relaxation* (MR Therapy). The author is to be commended for adding to the limited literature on ameliorating problematic cases of isolated sleep paralysis (ISP). As recently reviewed (Sharpless, [@B2]), there are few options available, pharmacological or otherwise, for the chronic and severe cases of ISP, and none of these yet possess compelling evidence in favor of their efficacy. We appreciate the citation of our work in his article. However, we disagree with the author\'s claim that MR Therapy is the "first direct treatment" for ISP (Jalal, [@B1], p. 1). This comment is puzzling given that our 2015 book (i.e., Sharpless and Doghramji, [@B3]) was cited in this same manuscript. Contained within is a manual titled *Cognitive Behavioral-Therapy for Isolated Sleep Paralysis* (CBT-ISP) and a corresponding adherence measure (pp. 237--272). CBT-ISP is a brief, systematic approach that focuses upon helping patients both prevent and disrupt recurrent ISP episodes. In order to better clarify the nature of our own approach and to compare and contrast it to MR Therapy, we detail CBT-ISP in Table [1](#T1){ref-type="table"} below. ###### **Cognitive behavior therapy for isolated sleep paralysis (CBT-ISP)**. ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- **PREPARATORY THERAPEUTIC ACTIVITIES** Self-monitoring of ISP episodes via modified sleep diaries Psychoeducation about the nature of ISP Psychoeducation about the particular nature of ISP hallucinations (if present) Presentation of the cognitive-behavioral model for ISP including the predictable "sequence" of ISP episodes (e.g., the cycle of symptoms, role of maladaptive appraisals, and increasing levels of activation) In-session practice to dispute catastrophic thoughts associated with both paralysis and hallucinations (with instructions for homework) Imaginary rehearsal of disruption techniques (e.g., focused attention to mobilize a finger/toe or making attempts to cough in order to foster the return of movement and dispel hallucinations) during session. This is done while the patient is in a supine position using a chaise/couch. Following imaginary rehearsal, the patient is provided with instructions for at home practice and *in vivo* application of these various disruption techniques *during* ISP episodes **APPROACHES TO ISP EPISODE [PREVENTION]{.ul}** Use of ISP-specific sleep hygiene (e.g., ways to avoid sleep disruption, avoiding a supine sleeping position, limiting the use of certain substances prior to bed, removal of maladaptive avoidance behaviors) Use of diaphragmatic breathing, progressive muscle relaxation, meditation, and/or mindfulness exercises to reduce overall anxiety levels throughout the day (i.e., not only during ISP episodes) Relapse-prevention instructions are provided during the last therapy session using a "coping-based" approach **APPROACHES TO ISP EPISODE [DISRUPTION]{.ul}** Applied diaphragmatic breathing, relaxation, mindfulness, or meditation during ISP episodes with attempts to "remain calm" (e.g., use of reassuring self-talk, use of distraction to focus attention away from hallucinations, reappraisal of episode/symptom meanings) in order to both disrupt and shorten ISP episodes *In vivo* application of episode disruption techniques. If the initial attempt is ineffective, patients are instructed to flexibly apply secondary disruption techniques Application of disruption techniques earlier and earlier in the predictable sequence of ISP episodes ----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- *Adapted from Sharpless and Doghramji ([@B3]). ISP, isolated sleep paralysis*. As can be seen, there are areas of substantial overlap between CBI-ISP and MR Therapy. Both have strong emphases on various forms of relaxation, symptom reappraisals, shifts in attention away from episode content, and the practice of disruption techniques while patients are in a supine position. We should also note that both approaches are based upon panic disorder models. However, there are some notable points of divergence. First, MR Therapy discourages attempts to move, whereas CBT-ISP actively encourages these attempts in order to directly disrupt episodes and shift attention away from potentially frightening symptoms (e.g., hallucinations). Our approach is based upon empirical work with sufferers who reported that these attempts were effective (Sharpless and Grom, [@B4]). Second, the author discourages attempts to control breathing whereas we view this as a potential source of relaxation to be used "in the moment." Third, he encourages the use of prayer as a form of relaxation/meditation whereas we are more cautious about this, especially with patients who experience religious-themed hallucinations (e.g., demons, djinn). In general, CBT-ISP more strongly emphasizes psychoeducation, episode prevention, and consistent self-monitoring of ISP episodes (using modified sleep diaries) than MR Therapy, but both agree that directly disrupting ISP is important. It is obviously preferable to have multiple treatment approaches available in a clinician\'s armamentarium as opposed to one. Efficacy rates for ISP approaches are not yet known, and it is very likely that both of these approaches will need to be modified in response to emerging data. In closing, we believe that CBT-ISP (Sharpless and Doghramji, [@B3]) is the first direct treatment for ISP. However, it may be important to note that academic debates about temporal priority and differences in treatment foci are really moot points unless the phenomenon of recurrent ISP is more frequently assessed in research and clinical practice. This does not yet appear to be the case. At least two studies to date have shown that a minority of patients experience ISP to such a degree that it is associated with significant clinical consequences (Sharpless et al., [@B5]; Sharpless and Grom, [@B4]). Unfortunately, at the time of this writing there are not yet any empirically-supported treatment options available for sufferers. Author contributions {#s1} ==================== All authors listed have made substantial, direct, and intellectual contribution to the work, and approved it for publication. Conflict of interest statement ------------------------------ Both authors have received royalties from Oxford University Press for the publication of their book Sleep Paralysis: Historical, Psychological, and Medical Perspectives. [^1]: Edited by: Gianluca Castelnuovo, Università Cattolica del Sacro Cuore, Italy [^2]: Reviewed by: Christopher Charles French, Goldsmiths, University of London, UK; Jean-Pierre Jourdan, International Association for Near-Death Studies, France [^3]: This article was submitted to Psychology for Clinical Settings, a section of the journal Frontiers in Psychology
2023-10-24T01:26:58.646260
https://example.com/article/3418
#include "kdf.h" #include "libscrypt.h" #include "crypt_blowfish.h" #include "memory.h" #include "openssl_suite.h" #include "ow-crypt.h" #include "openssl_suite.h" #include <string.h> #define BCRYPT_SALT_BYTE_LEN 16 static const wickr_kdf_algo_t *__find_dkf_algo_with_id(uint8_t algo_id) { switch (algo_id) { case KDF_ID_BCRYPT_15: return &KDF_BCRYPT_15; case KDF_ID_SCRYPT_17: return &KDF_SCRYPT_2_17; case KDF_ID_SCRYPT_18: return &KDF_SCRYPT_2_18; case KDF_ID_SCRYPT_19: return &KDF_SCRYPT_2_19; case KDF_ID_SCRYPT_20: return &KDF_SCRYPT_2_20; default: return NULL; } } wickr_kdf_meta_t *wickr_kdf_meta_create(wickr_kdf_algo_t algo, wickr_buffer_t *salt, wickr_buffer_t *info) { /* HKDF has salt as an optional field, but we don't recomend setting NULL for salt unless info is set */ if (algo.algo_id == KDF_HMAC_SHA2) { if (!salt && !info) { return NULL; } } else { if (!salt || salt->length != algo.salt_size) { return NULL; } } wickr_kdf_meta_t *meta = wickr_alloc_zero(sizeof(wickr_kdf_meta_t)); if (!meta) { return NULL; } meta->algo = algo; meta->salt = salt; meta->info = info; return meta; } uint8_t wickr_kdf_meta_size_with_buffer(const wickr_buffer_t *buffer) { if (!buffer) { return 0; } if (buffer->length <= sizeof(uint8_t)) { return 0; } const wickr_kdf_algo_t *algo = __find_dkf_algo_with_id(buffer->bytes[0]); if (!algo) { return 0; } return sizeof(uint8_t) + algo->salt_size; } wickr_kdf_meta_t *wickr_kdf_meta_create_with_buffer(const wickr_buffer_t *buffer) { uint8_t meta_size = wickr_kdf_meta_size_with_buffer(buffer); if (meta_size == 0) { return NULL; } if (buffer->length < meta_size) { return NULL; } const wickr_kdf_algo_t *algo = __find_dkf_algo_with_id(buffer->bytes[0]); if (!algo) { return NULL; } wickr_buffer_t *salt_buffer = wickr_buffer_copy_section(buffer, sizeof(uint8_t), algo->salt_size); if (!salt_buffer) { return NULL; } return wickr_kdf_meta_create(*algo, salt_buffer, NULL); } wickr_buffer_t *wickr_kdf_meta_serialize(const wickr_kdf_meta_t *meta) { if (!meta) { return NULL; } /* Don't allow serialization of meta from HKDF where salt is NULL */ if (meta->algo.algo_id == KDF_HMAC_SHA2 && !meta->salt) { return NULL; } uint8_t algo_id = (uint8_t)meta->algo.kdf_id; wickr_buffer_t algo_id_buffer; algo_id_buffer.bytes = &algo_id; algo_id_buffer.length = sizeof(uint8_t); return wickr_buffer_concat(&algo_id_buffer, meta->salt); } wickr_kdf_meta_t *wickr_kdf_meta_copy(const wickr_kdf_meta_t *source) { if (!source) { return NULL; } wickr_buffer_t *salt_copy = wickr_buffer_copy(source->salt); if (!salt_copy && source->salt) { return NULL; } wickr_buffer_t *info_copy = wickr_buffer_copy(source->info); if (!info_copy && source->info) { wickr_buffer_destroy(&salt_copy); return NULL; } return wickr_kdf_meta_create(source->algo, salt_copy, info_copy); } void wickr_kdf_meta_destroy(wickr_kdf_meta_t **meta) { if (!meta || !*meta) { return; } wickr_buffer_destroy_zero(&(*meta)->salt); wickr_buffer_destroy(&(*meta)->info); wickr_free(*meta); *meta = NULL; } wickr_kdf_result_t *wickr_kdf_result_create(wickr_kdf_meta_t *meta, wickr_buffer_t *hash) { if (!meta || !hash) { return NULL; } wickr_kdf_result_t *result = wickr_alloc_zero(sizeof(wickr_kdf_result_t)); if (!result) { return NULL; } result->meta = meta; result->hash = hash; return result; } wickr_kdf_result_t *wickr_kdf_result_copy(const wickr_kdf_result_t *source) { if (!source) { return NULL; } wickr_kdf_meta_t *meta_copy = wickr_kdf_meta_copy(source->meta); if (!meta_copy) { return NULL; } wickr_buffer_t *hash_copy = wickr_buffer_copy(source->hash); if (!hash_copy) { wickr_kdf_meta_destroy(&meta_copy); return NULL; } return wickr_kdf_result_create(meta_copy, hash_copy); } void wickr_kdf_result_destroy(wickr_kdf_result_t **result) { if (!result || !*result) { return; } wickr_buffer_destroy_zero(&(*result)->hash); wickr_kdf_meta_destroy(&(*result)->meta); wickr_free(*result); *result = NULL; } static wickr_buffer_t *__openssl_generate_salt(uint8_t len) { return openssl_crypto_random(len); } static const char *_bcrypt_header = "$2y$15$"; static wickr_buffer_t *__bcrypt_generate_salt(int workfactor, int salt_size) { wickr_buffer_t *rand_bytes = __openssl_generate_salt(BCRYPT_SALT_BYTE_LEN); if (!rand_bytes) { return NULL; } wickr_buffer_t *salt_buffer = wickr_buffer_create_empty_zero(salt_size + strlen(_bcrypt_header) + 1); if (!salt_buffer) { wickr_buffer_destroy(&rand_bytes); return NULL; } if (!crypt_gensalt_rn("$2y$", workfactor, (const char *)rand_bytes->bytes, (int)rand_bytes->length, (char *)salt_buffer->bytes, (int)salt_buffer->length)) { wickr_buffer_destroy(&rand_bytes); wickr_buffer_destroy(&salt_buffer); return NULL; } wickr_buffer_destroy(&rand_bytes); salt_buffer->length -= 1; uint8_t header_size = strlen(_bcrypt_header); wickr_buffer_t *final_salt_buffer = wickr_buffer_copy_section(salt_buffer, header_size, salt_buffer->length - header_size); wickr_buffer_destroy(&salt_buffer); return final_salt_buffer; } static wickr_buffer_t *__bcrypt_generate_hash(const wickr_kdf_meta_t *meta, const wickr_buffer_t *passphrase) { if (!meta || meta->algo.algo_id != KDF_BCRYPT) { return NULL; } const char *salt_header = NULL; switch (meta->algo.kdf_id) { case KDF_ID_BCRYPT_15: salt_header = _bcrypt_header; break; default: return NULL; } wickr_buffer_t salt_header_buffer; salt_header_buffer.bytes = (uint8_t *)salt_header; salt_header_buffer.length = strlen(salt_header); wickr_buffer_t *salt_buffer = wickr_buffer_create_empty_zero(BCRYPT_HASH_SIZE); if (!salt_buffer) { return NULL; } if (!wickr_buffer_modify_section(salt_buffer, salt_header_buffer.bytes, 0, salt_header_buffer.length)) { wickr_buffer_destroy(&salt_buffer); return NULL; } if (!wickr_buffer_modify_section(salt_buffer, meta->salt->bytes, salt_header_buffer.length, meta->salt->length)) { wickr_buffer_destroy(&salt_buffer); return NULL; } wickr_buffer_t *passphrase_final = wickr_buffer_create_empty_zero(passphrase->length + 1); if (!wickr_buffer_modify_section(passphrase_final, passphrase->bytes, 0, passphrase->length)) { wickr_buffer_destroy(&salt_buffer); return NULL; } char out[BCRYPT_HASH_SIZE]; memset(&out, 0, BCRYPT_HASH_SIZE); if (!crypt_rn((char *)passphrase_final->bytes, (char *)salt_buffer->bytes, out, BCRYPT_HASH_SIZE)) { wickr_buffer_destroy(&passphrase_final); wickr_buffer_destroy(&salt_buffer); return NULL; } wickr_buffer_destroy(&passphrase_final); wickr_buffer_t *hash_buffer = wickr_buffer_create((uint8_t *)out, strlen(out)); wickr_buffer_destroy(&salt_buffer); return hash_buffer; } static wickr_buffer_t *__scrypt_generate_hash(const wickr_kdf_meta_t *meta, const wickr_buffer_t *passphrase) { if (!meta || meta->algo.algo_id != KDF_SCRYPT) { return NULL; } wickr_buffer_t *hash_buffer = wickr_buffer_create_empty(meta->algo.output_size); if (!hash_buffer) { return NULL; } uint64_t N; uint8_t r,p; p = meta->algo.cost & 0xff; r = (meta->algo.cost >> 8) & 0xff; N = meta->algo.cost >> 16; N = (uint64_t)1 << N; if (0 != libscrypt_scrypt(passphrase->bytes, passphrase->length, meta->salt->bytes, meta->salt->length, N, r, p, hash_buffer->bytes, hash_buffer->length)) { wickr_buffer_destroy(&hash_buffer); return NULL; } return hash_buffer; } static wickr_buffer_t *__hkdf_generate_hash(const wickr_kdf_meta_t *meta, const wickr_buffer_t *passphrase) { if (!meta || meta->algo.algo_id != KDF_HMAC_SHA2) { return NULL; } wickr_digest_t digest; switch (meta->algo.kdf_id) { case KDF_ID_HKDF_SHA256: digest = DIGEST_SHA_256; break; case KDF_ID_HKDF_SHA384: digest = DIGEST_SHA_384; break; case KDF_ID_HKDF_SHA512: digest = DIGEST_SHA_512; break; default: return NULL; break; } /* Adjust the digest size, as this is what the openssl_hkdf function uses as a desired output length for HKDF */ digest.size = meta->algo.output_size; return openssl_hkdf(passphrase, meta->salt, meta->info, digest); } static wickr_buffer_t *__kdf_algo_generate_salt(wickr_kdf_algo_t algo) { switch (algo.algo_id) { case KDF_SCRYPT: case KDF_HMAC_SHA2: return __openssl_generate_salt(algo.salt_size); case KDF_BCRYPT: return __bcrypt_generate_salt(algo.cost, algo.salt_size); default: return NULL; } } static wickr_buffer_t *__kdf_algo_hash(const wickr_kdf_meta_t *meta, const wickr_buffer_t *passphrase) { if (!meta) { return NULL; } switch (meta->algo.algo_id) { case KDF_SCRYPT: return __scrypt_generate_hash(meta, passphrase); case KDF_BCRYPT: return __bcrypt_generate_hash(meta, passphrase); case KDF_HMAC_SHA2: return __hkdf_generate_hash(meta, passphrase); default: return NULL; } } wickr_kdf_result_t *wickr_perform_kdf(wickr_kdf_algo_t algo, const wickr_buffer_t *passphrase) { if (!passphrase) { return NULL; } wickr_buffer_t *salt = __kdf_algo_generate_salt(algo); if (!salt) { return NULL; } wickr_kdf_meta_t meta; meta.algo = algo; meta.salt = salt; meta.info = NULL; wickr_kdf_result_t *result = wickr_perform_kdf_meta(&meta, passphrase); wickr_buffer_destroy(&salt); return result; } wickr_kdf_result_t *wickr_perform_kdf_meta(const wickr_kdf_meta_t *existing_meta, const wickr_buffer_t *passphrase) { if (!existing_meta || !passphrase) { return NULL; } wickr_buffer_t *hash_output = __kdf_algo_hash(existing_meta, passphrase); if (!hash_output) { return NULL; } wickr_kdf_meta_t *result_meta = wickr_kdf_meta_copy(existing_meta); if (!result_meta) { wickr_buffer_destroy(&hash_output); return NULL; } return wickr_kdf_result_create(result_meta, hash_output); } const wickr_kdf_algo_t *wickr_hkdf_algo_for_digest(wickr_digest_t digest) { switch (digest.digest_id) { case DIGEST_ID_SHA256: return &KDF_HKDF_SHA256; case DIGEST_ID_SHA384: return &KDF_HKDF_SHA384; case DIGEST_ID_SHA512: return &KDF_HKDF_SHA512; default: return NULL; } }
2024-06-09T01:26:58.646260
https://example.com/article/3095
Olbia Shore Excursion - This half day shore tour visits the luxurious resort town of Porto Cervo. Considered the most exclusive area in all of Italy, the town is filled with the world's VIP, and now you are one of them too. After meeting your licensed guide at the pier in Olbia, you will drive to San Pantaleo, a charming hill top village nestled in the granite foothills of the Limbara range. From here you enjoy a photo stop for the amazing views of the sea below. Next you continue the drive into Porto Cervo, one of the most fashionable towns in all of Italy! The beauty of the area, particularly the clear waters of the sea and the luxury facilities such as hotels and yachts have made Porto Cervo the most exclusive town in Italy. The town is the queen of the summer holidays for Italian, Russian and French VIPs. The town has a year round population of only about 200 people but this numbers increase greatly in the summer season as the wealthy flock here to rest, relax, shop, see and be seen. Your guide will lead you on a tour of the delightful town so you too can admire this small piece of heaven. At the end of the tour, there is time to enjoy an espresso in the main square before returning to the port in Olbia along the panoramic road which travels along the sea front.If you cannot find what you are looking for, our Olbia tours and Olbia Shore Excursions can also be customized to fit your needs. If you have a larger group, we can offer you a private Olbia tour using a mid-size bus or full size coach. Please contact us with any questions or to receive a customized quote.
2024-04-29T01:26:58.646260
https://example.com/article/2871
# Sample .slashemrc file # # Window systems # Options are tty, x11. qt, gtk # but not all of these are necessarily compiled in OPTIONS=windowtype:tty # names for pets OPTIONS=catname:Fuzzy OPTIONS=dogname:Rover OPTIONS=horsename:Trigger # Autopickup options # Autopickup all the things you would pick up anyway # In order: money, potions, spellbooks, rings, amulets, # scrolls, and wands OPTIONS=autopickup OPTIONS=pickup_types:$!+="?/ # Favorite fruit OPTIONS=fruit:Strawberry # Turn on numberpad movement # Be sure to turn on numlock or this won't work OPTIONS=number_pad # Show experience on the status line OPTIONS=showexp # Fix inventory letters # If you aquire an item, drop it, then pick it up again # it will retain the same inventory letter # Sort your pack contents by type when viewing your inventory OPTIONS=fixinv OPTIONS=sortpack # Makes pets more visible # Don't allow attacking your pet OPTIONS=hilite_pet OPTIONS=safe_pet # verbose messages in the game OPTIONS=verbose # Ask for confirmation before attacking peaceful creatures OPTIONS=confirm
2023-08-19T01:26:58.646260
https://example.com/article/2914
Q: Why does \addcontentsline not add to TOC? \documentclass[12pt,a4paper]{scrartcl} \usepackage{ngerman} \usepackage[latin1]{inputenc} \usepackage{hyperref} \usepackage{graphicx} \title{Rechtevergabe Testdokument} \author{Test1} \begin{document} \maketitle \newpage \tableofcontents \newpage \addcontentsline{toc}{section}{Bereich A} \addcontentsline{toc}{subsection}{Kapitel I} \addcontentsline{toc}{subsection}{Kapitel II} \addcontentsline{toc}{section}{Bereich B} \end{document} Gives me no TOC at all (after running pdflatex twice). Moving \addcontentsline to before \tableofcontents and removing \newpage did no change. I intend to obtain a document with TOC only. Thank you. A: The \addcontentsline commands are written at \shipout. But your page is empty. Removing the \newpage after \tableofcontents should work (it does for me) or put something on the page with the \addcontentsline commands, e.g. \newpage\mbox{}.
2024-04-04T01:26:58.646260
https://example.com/article/6393
Relation of impaired coronary microcirculation to increased urine albumin excretion in patients with systemic hypertension and no epicardial coronary arterial narrowing. Coronary flow reserve (CFR) is impaired and urinary albumin excretion is increased in patients with essential hypertension. Our aim was to investigate the associations between CFR and cardiac and renal damage in hypertensives. For this purpose we studied 37 never-treated hypertensives (57.9 years old, 16 men) without chest pain but with a positive ischemia stress test result and normal coronary arteries on coronary angiogram. CFR was calculated by a 0.014-inch Doppler guidewire (Flowire, Volcano, San Diego) in the left anterior descending artery in response to bolus intracoronary administration of adenosine (60 μg) as the ratio of hyperemic to basal average peak velocity of the distal vessel. All participants underwent complete echocardiographic study including left ventricular diastolic function evaluation by tissue Doppler imaging (peak early diastolic velocity/peak atrial systolic velocity) and determination of the albumin-to-creatinine ratio (ACR). Hypertensives with low CFR (<2.5, n = 22) compared to those with high CFR (n = 15) exhibited a larger left ventricular mass index by 10.9 g/m(2) (p = 0.045) and ACR values by 10 mg/g (p <0.001). CFR was negatively correlated with logACR (r = -0.511, p = 0.001). LogACR (beta -0.792, p <0.001), male gender (beta 0.313, p = 0.005), left ventricular mass index (beta -0.329, p = 0.007), and peak early diastolic velocity/peak atrial systolic velocity (beta 0.443, p <0.001) were the only independent predictors of CFR in linear regression analysis (adjusted R(2) = 0.672). In conclusion, never-treated asymptomatic hypertensives who exhibit impaired CFR and angiographically normal epicardial arteries are characterized by intrarenal vascular damage as reflected by increased ACR. These findings suggest a plausible role of ACR estimation in the identification of hypertensive subjects with early coronary microvascular dysfunction.
2023-08-26T01:26:58.646260
https://example.com/article/1158
Q: set one output high at a time when multiple inputs are high I'm making a small circuit for detect water level of our home water tank .here is the diagram. when water level is low i want to turn red led when water level is max i want to turn green one on and so on.but current circuit turn both red/yellow/green when water level is max because when water level high all terminals sink . how can i turn only one led instead of all .for example when all terminals are sunk i want to turn only green led. how to turn only one led instead of all ? A: I hope you have series resistors in your circuit that you left out in your picture? Otherwise you are pushing an undetermined amount of current through the transistors and LEDs. To 'block' a lower LED you could use this basic circuit (untested): simulate this circuit – Schematic created using CircuitLab As others have stated in the comments, if you use copper electrodes they will over time dissolve. How fast depends on the current, which you can minimize for instance by using darlington transistors and higher values for the base resistors. But not all electrodes will be etched away, only those that can be oxidized easier than the abundantly available H+/H3O+. This includes copper, but not platinum or (cheaper and more readily available) carbon.
2023-08-20T01:26:58.646260
https://example.com/article/1815
This invention generally concerns a current overload fuse assembly and particularly an improved arrangement of plug-in type fuse elements in a fuse mounting board. So far known is a plug-in type fuse which consists of an elongate housing made of insulating material and a single piece metal fuse strip enclosed in the housing with ends of two parallel terminal forming blades downwardly projected from the housing. A fuse link enveloped by the housing interconnects current carrying extensions of the terminal forming blades. The fuse elements of this type have been heretofore mounted on a fuse board in a manner that the housings are sunk into socket openings machined into the mounting board with only their top covers emerging from the mounting board. One disadvantage of this kind of fuse arrangement is that the fuses are only insufficiently cooled off as the major part of the fuse element is confined under the mounting board and not exposed to the ambient air. Also, the deeply sunk fuses must be pulled out of the socket openings when the fuses are to be exchanged, requiring much attention for exchange operation. It is therefore a primary object of the invention to provide an arrangement of fuse elements on a mounting board which eliminates the aforementioned inconveniences. Another object of the invention is to provide an improved arrangement of plug-in type fuse elements on a mounting board in which the housings of fuse elements are supported to stand upright on the mounting board at a certain limited space from one another to expose the major part of each fuse element to fresh cold air. A further important object of the invention is to provide an improved arrangement of plug-in type fuse elements on a mounting board in which a multiplicity of such fuse elements is compactly arranged on a mounting board within a relatively small area. Still a further object of the invention is to provide an improved arrangement of plug-in type fuse elements on a mounting board in which the fuse elements are retained on the surface of the mounting board and can be easily detached from the mounting board when they are to be exchanged.
2023-11-17T01:26:58.646260
https://example.com/article/4110
675 F.Supp. 1333 (1987) Michael R. MacKENZIE, Plaintiff, v. Wayne SNOW, Jr., Individually and as Chairman of the State Board of Pardons and Paroles; E.W. Linthicum, Jr., Individually and as Director of Central Operations of the State Board of Pardons and Paroles; Honorable Joe Frank Harris, Governor of the State of Georgia, Defendants. Civ. A. No. C87-1315A. United States District Court, N.D. Georgia, Atlanta Division. November 19, 1987. *1334 Lee Sexton, Sexton Turner & Moody, Jonesboro, Ga., for plaintiff. Wayne Preston Yancey, Office of State Atty. Gen., Atlanta, Ga., for defendants. ORDER ROBERT H. HALL, District Judge. Plaintiff was elected to positions on the Executive Committee of the Rockdale County Democratic Party and the Executive Committee of the State Democratic Party. Because of holding these posts, plaintiff was fired from his position as a Parole Review Officer of the Georgia Board of Pardons and Paroles. Plaintiff brought this action for declaratory and injunctive relief contending that the termination violated his constitutional rights of due process and equal protection under the Fourteenth Amendment and challenging the operative state statute and personnel regulations under which he was terminated as violating his constitutionally protected rights of political speech and association in violation of the First and Fourteenth Amendments. Currently before this court are the parties' crossmotions for summary judgment. FACTS Both parties agree that there exists no genuine issue of material fact and that the court may resolve the issues raised as a matter of law. Plaintiff Michael R. MacKenzie was employed by the Georgia State Board of Pardons and Paroles as a Parole Review Officer until his discharge effective May 26, 1987. Plaintiff's position with the Board was classified under the Georgia State Merit System of Personnel Administration. The Georgia State Personnel Board promulgates rules and regulations that govern the duties, rights and conduct of state employees and employers whose positions are within the jurisdiction of the Georgia State Merit System. In early June 1986, plaintiff sought the advice of the Board Personnel Manager, Mr. Robert Allison regarding plaintiff's desire *1335 to run for local level Democratic Party Office. Mr. Allison sought clarification from the State Merit System about apparent conflicts between Ga.Off'l Code Ann. § 45-10-70 and Ga.Off'l Code Ann. § 42-9-15 and certain rules and regulations of the State Personnel Board dealing with employee's political activity. Ga.Off'l Code Ann. § 42-9-15 states: No member of the board or full-time employee thereof, during his service upon or under the board, shall engage in any other business or profession or hold any other public office; nor shall he serve as a representative of any political party or any executive committee or other governing body thereof, or as an executive officer or employee of any political committee, organization, or association; nor shall he be engaged on the behalf of any candidate for public office in the solicitation of votes or otherwise become a candidate for public office, without resigning from the board or from employment by the board. (Ga.L.1943, p. 185, § 10.) Ga.Off'l Code Ann. § 45-10-70 states: No rules or regulations of any state agency, department, or authority shall prohibit nonelective officers or employees of this state from offering for or holding any elective or appointive office of a political subdivision of this state or any elective or appointive office of a political party or political organization of this state, provided that the office is not full time and does not conflict with the performance of the official duties of the person as a state employee. (Code 1981, § 45-10-70, enacted by Ga.L.1985, p. 427, § 1.) In September 1986, Allison advised plaintiff that his activities appeared to be in a "gray area" and that perhaps plaintiff should decide against running. However, plaintiff contends that Allison indicated that no adverse personnel action would be forthcoming against the plaintiff. Plaintiff advised Allison that he had discussed the legislative intent of section 45-10-70 with its author, Georgia State Senator Culver Kidd and Mr. Dale Knesel, a State Merit System executive. Plaintiff contends that none of these officials discouraged him from running for these posts. On December 6, 1986, plaintiff ran for and was elected to the Executive Committee of the Democratic Party of Georgia. In December 1986, after plaintiff's election, defendant Linthicum, Director of Central Operations for the State Board of Pardons and Paroles, requested plaintiff to provide the Board with the description and duties of his new post. Plaintiff contends that he was unable to comply with this request until April 1987. In the interim, plaintiff contends that Senator Kidd advised him that the revised rules of the State Personnel Board would permit plaintiff to serve in his elective office. In January 1987, defendant Snow, Chairman of the State Board of Pardons and Paroles, advised plaintiff that he would seek the opinion of the Georgia State Attorney General as to plaintiff's eligibility to hold these posts concurrently with his job with the Board. The Attorney General issued his opinion to defendant Snow in April 1987. Based on the Attorney General's opinion, defendant Linthicum proposed plaintiff's termination. Plaintiff failed to resign his political posts within the time allowed by the proposed termination, and therefore, defendant Linthicum in a letter dated May 8, 1986, proposed that plaintiff forfeit his position with the State Board of Pardons and Paroles. Defendant Snow afforded plaintiff an opportunity to respond to the proposed action and plaintiff personally appeared before defendant Linthicum on May 8, 1987 and further responded by letter dated May 12, 1987, to defendant Snow. After considering the response and the proposed action, defendant Snow issued a letter dated May 19, 1987 terminating plaintiff's employment with the Board effective May 26, 1987. Defendant Snow's letter of May 19, 1987 enumerates the following grounds for the termination and closely tracks the opinion letter of the Attorney General: Misconduct in that since on or about April 29, 1987, after you received a copy *1336 of the Attorney General's opinion (Re: Employees of the State Board of Pardons and Paroles Who Engage in Political Activity in Violation of O.C.G.A. § 42-9-15 can be terminated from their Positions with the Board, dated April 23, 1987) you continued to occupy your positions with a political party and you failed to resign your position with the Board as required by the law. Insubordination in that in or about December 1986 you were requested to provide the agency with a list of your duties and responsibilities with the Democratic party so that it could be determined whether those duties were in violation of the Rules of the State Personnel Board. You failed to provide the requested information. Insubordination in that on May 7, 1987 you were given a written directive to resign your positions with a political party no later than May 8, 1987, and you were further directed to provide acceptable proof that you had done so no later than 4:00 P.M. on May 8, 1987. The proof was to also confirm that you were no longer participating in any political activity that is in violation of the law or the Rules. You failed to comply and furthermore stated that you would not resign your positions. These charges are each sufficient to justify your dismissal. You are hereby dismissed in accordance with Rule 15 of the Rules and Regulations of the State Personnel Board, effective at the close of business on May 26, 1987. I have also reviewed Mr. Linthicum's proposal that your employment be terminated through the forfeiture of your position under the provisions of paragraphs 12.205.2 and 12.206.1 of the Rules and Regulations of the State Personnel Board. The forfeiture is brought about as a result of your engagement in political activity in violation of O.C.G.A. 42-9-15 and paragraph 3.501.1 of the Rules of the State Personnel Board, and is supported by the following specific: By your own admission you are a member of both the State and County Executive Committees of the Democratic party. For you to hold such offices is in violation of O.C.G.A. 42-9-15 which specifically prohibits your holding such offices while being a full time employee of the Board. By engaging in political activity in violation of O.C.G.A. 42-9-15 you are in violation of paragraph 3.501.1 of the Rules and Regulations of the State Personnel Board and are subject to forfeiture of your position as provided in paragraph 3.506 of those rules. The foregoing charge is sufficient to warrant the forfeiture of your position. Therefore, it is my final determination that your employment with the State Board of Pardons and Paroles is terminated through the forfeiture of your position effective May 26, 1987. Furthermore, your termination is deemed a voluntary forfeiture of your position in accordance with paragraph 12.205.2 of the Rules of the State Personnel Board. The court held a hearing on June 19, 1987 on plaintiff's motion for a temporary restraining order seeking to secure reinstatement of plaintiff to his position. The court in its order of that date denied plaintiff's motion and suggested that the parties file crossmotions for summary judgment. DISCUSSION Plaintiff contends that defendants violated his rights of due process and equal protection protected in the Fourteenth Amendment by (1) selectively enforcing Ga. Off'l Code Ann. § 42-9-15 as to plaintiff, (2) enforcing section 42-9-15 given the existence of Ga.Off'l Code Ann. § 45-10-70 which plaintiff contends repeals the former statute, and (3) terminating plaintiff in an arbitrary and capricious manner where plaintiff contends the Rules and Regulations of the State Personnel Board, Section 42-9-15 and Section 45-10-70 are in conflict both permitting and prohibiting plaintiff from engaging in the conduct for which he was discharge. Additionally, Plaintiff contends that enforcing section 42-9-15 against him violates his constitutionally protected rights of political speech and free association protected by the First and Fourteenth amendments. Plaintiff also alleges *1337 a state cause of action for a declaration (1) that section 45-10-70 repealed section 42-9-15 either impliedly or directly and (2) that no means existed to enforce the state law prohibiting employees of the Board from holding positions in partisan political parties. Ga.Off'l Code Ann. § 42-9-15. Defendant counters that section 42-9-15 and section 45-10-70 may be read as consistent with each other to give effect to each statute; that the opinion of the Attorney General to this effect bound plaintiff; that plaintiff was provided adequate procedural due process to oppose this finding and his termination; and that the prohibitions of section 42-9-15 as applied to plaintiff are reasonably necessary to achieve a compelling public objective, and therefore, do not abridge plaintiff's First amendment rights. Plaintiff in his reply brief concedes that he has no valid claim that defendants violated his rights of procedural due process as he was given adequate notice, an opportunity to respond and an opportunity for a post deprivation appeal. Likewise, plaintiff concedes that there is no merit to that portion of his pendent state law claim alleging that no means existed to enforce section 42-9-15. The court now turns to plaintiff's remaining claims. The court feels that in order to resolve the remaining issues on summary judgment the court must address two questions: (1) what statutory scheme governs the dispute? and (2) have actions by defendants under that statutory scheme violated plaintiff's substantive constitutional rights? A. Applicable Statutory Scheme The authority cited by defendants to support plaintiff's termination for political activity is section 42-9-15, the Rules of the Personnel Board and the opinion of the Attorney General dated April 23, 1987. Plaintiff concedes that Code Section 42-9-15 passed in 1943 expressly prohibits a member of the Board or a full-time Board employee from serving on any executive committee or other governing body of a political party. Plaintiff argues, however, that section 45-10-70 approved in 1985 expressly or impliedly repeals the earlier section by providing that no rules or regulations of any state agency, department or authority shall prohibit nonelective officers or employees of the state from holding office in a political party. Plaintiff also argues that this conflict between the statutes renders nonsensical Rule 3.501.I Rules of the State Personnel Board which states: 3.501. An employee in the classified service shall not: I. Engage in any political activity in violation of federal or state law including but not limited to.... Ga.Off'l Code Ann. 42-9-15 [and] Ga.Off'l Code Ann. 45-10-70.[1] Defendants argue that section 45-10-70 did not repeal several specific statutes applying to limited number of employees such as section 42-9-15. Defendants contend that by the clear and concise language of section 45-10-70, that statute prohibits only the promulgation by a state agency of rules and regulations affecting an employee's ability to engage in certain political activity. In essence, defendants argue that section 45-10-70 indicates only that the General Assembly wants to reserve such decisions for the legislative body itself, not delegate that rule to state agencies. Section 42-9-15, defendants argue, is not a rule or regulation promulgated by a state agency. Plaintiff, in response, argues that defendants have ignored the intent of the legislature in enacting section 45-10-70. In support, plaintiff quotes the preamble to the statute which states the Bill was passed: To amend Article 2 of Chapter 10 of Title 45 of the Official Code of Georgia Annotated, relating to conflicts of interests, so *1338 as to provide that no rules or regulations of any state agency, department, or authority shall prohibit non-elective officers or employees of the State from offering for or holding any elective or appointive office of a political subdivision of this State or any elective or appointive office of a political party or political organization; to provide exceptions; to repeal conflicting laws; and for other purposes. Plaintiff also points to section 2 of the statute which states: All laws and parts of laws in conflict with this Act are repealed. Ga.Off'l Code Ann. § 45-10-70. The court believes that section 45-10-70 does not expressly or impliedly repeal section 42-9-15. Section 45-10-70 fails to mention section 42-9-15 at all. The preamble to section 45-10-70 relied on heavily by plaintiff is not to be read as part of the statute in Georgia and does not preclude a reading consistent with the existence of section 42-9-15. W. Eskridge & P. Frickey, Statutes and the Creation of Public Policy, 646 (1987). The "boilerplate" repeal provision of Section 2 merely begs the question whether the two statutes are in conflict. Absent explicit language repealing one statute, this court believes that where fairly possible, two statutes should be construed together to give effect to each. 2A C. Sands, Sutherland Statutory Construction § 45.11. The intention to repeal must be clear, plain and unmistakable. See Department of Transportation v. Cochran, 160 Ga.App. 583, 287 S.E.2d 599 (1981); Hines v. Wingo, at 120 Ga.App. 614, 616, 171 S.E.2d 905 (1969). Here, the court agrees with defendants' reading that section 45-10-70 removes from state agencies the right to prohibit political activity and vests this responsibility solely with the General Assembly as expressed by section 42-9-15. Plaintiff's argue that the author of section 45-10-70, Senator Culver Kidd, Chairman of the Governmental Operations Committee, testified by affidavit that he intended the bill to supercede section 42-9-15. Such testimony, however, is not a weighty consideration in statutory analysis.[2] Additionally, Georgia courts have consistently held that repeals by implication are not favored and result only where the latter of the two acts is clearly repugnant to the former or so inconsistent with the former statute that the two cannot stand together. See Guye v. Home Indemnity Co., 241 Ga. 213, 244 S.E.2d 864 (1978); Hines v. Wingo, 120 Ga.App. 614, 616, 171 S.E.2d 905 (1969). Not only do the applicable rules of statutory interpretation lead to the conclusion that section 42-9-15 should be given full effect, but such a construction is sound when viewed in the context of the evolution of the pardons and paroles process in Georgia. It is the State Board of Pardons and Paroles and its employees that are charged with determining whether a convicted felon who has not completed his judicially imposed punishment should be released into society. The concern for keeping this process depoliticized is a strong one. The evolution of the statutory scheme and history of the Board demonstrates the movement in this state toward removing even the appearance of any political influence from the Board's decision making process. The Board was created by constitutional amendment in 1943. Under this provision, the Governor lost much of his authority with regard to the Pardons and Paroles function and retained only the authority to suspend sentences. See Whittle v. Jones, 198 Ga. 538, 32 S.E.2d 94 (1944). Section 42-9-15 was passed in the same year to foreclose shifting the potential politicization from the Governor to the Board by prohibiting Board members and employees *1339 from holding positions in partisan political parties. As part of the general 1983 constitutional revision, the Governor lost the authority to suspend executions of sentences, thus divesting the Governor of all remaining authority in the pardons and paroles process. Under the 1983 Constitution, that power is now completely vested in the Board. Compare Article V Section II, ¶ 2 of Constitution of Georgia of 1976 (Ga. Code Ann. § 2-2802) and Article IV, Section II, ¶ 2 Constitution of Georgia of 1983. It was reasonable, therefore, for the General Assembly to loosen its limitations on political activity for state employees generally, see section 45-10-70, while continuing to prohibit Board members and employees from engaging in political activity. The 1983 constitutional changes enhance the strength of this view. The court finds, therefore, that section 45-10-70 should be read consistently with section 42-9-15 to give full effect to the statute prohibiting the specified political activity by Board members and employees. B. Alleged Substantive Violations of Plaintiff's Constitutional Rights 1. Substantive Due Process Plaintiff contends that the coexistence of sections 45-10-70 and 42-9-15 violate substantive due process because plaintiff argues such a violation arises where two statutes govern the same conduct and the two statutes at issue permit and prohibit the same conduct respectively. Plaintiff has cited no cases to support this proposition. Regardless, the court has found that the latter statute does not repeal the former and that the two statutes may be read consistently to give effect to both. No due process violation exists. Likewise, plaintiff complains he was terminated in violation of his substantive due process rights under personnel rules and regulations which embody the same alleged conflict. As the court finds no contradiction between the statutes, the court finds no violation in the application of the personnel rules for the same reason. 2. First Amendment Claims Plaintiff challenges the constitutionality of section 42-9-15 and the State Personnel Board Rules enforcing this statute as violation of his First Amendment rights of political speech and free association. In response, defendants contend that (1) the statute and rules are constitutionally reasonable and (2) there are inherent conflicts with plaintiff MacKenzie serving in his current political posts that the statute and rules reasonably prohibit. Courts have held that the right to run for public office is not a fundamental right, but is an important right. Bullock v. Carter, 405 U.S. 134, 92 S.Ct. 849, 31 L.Ed.2d 92 (1972); Magill v. Lynch, 560 F.2d 22 (1st Cir.1977); Hickman v. City of Dallas, 475 F.Supp. 137 (N.D.Tex.1979). Restrictions on that right are constitutionally permissible where the government entity impairing the right shows that the strictness placed on the ability to run for office are reasonably necessary to achieve a compelling public objective. Morial v. Judiciary Commission, 565 F.2d 295, 300 (5th Cir.1977) (en banc) cert denied 435 U.S. 1013, 98 S.Ct. 1887, 56 L.Ed.2d 395 (1978). Thus, defendants must demonstrate (1) that the "ends" of the challenged regulations are compelling and (2) that the "means" are reasonably necessary in order to justify impairing plaintiff's First Amendment rights. Segars v. Fulton County, 644 F.Supp. 682, 685 (N.D.Ga.1986) (Hall J.). Defendants identify the goals of the statute and rules as (1) to protect the integrity of the public employment system and address the problem of potential corruption in public employment; (2) to protect employees from political interference; (3) to preserve public confidence in government by avoiding the appearance that employees are practicing political justice rather than true justice (the appearance that decisions are based upon furtherance of the public objectives of the civil servant); and (4) to maintain the efficiency of its employees. The court finds that defendants have a compelling interest in achieving each of these goals. Furthermore, each interest is *1340 sufficiently compelling that defendants may place reasonable restrictions on the right of employees to run for and serve in elective office. The court now turns to the second part of the inquiry. In adopting a "balancing" approach to this second step of the inquiry, courts have held that the government may place limits on a public employee's right to run for office if the limits substantially serve government interests that are "important" enough to outweigh the employee's First Amendment rights. Civil Service Commission v. Nat'l Ass'n of Letter Carriers, 413 U.S. 548, 93 S.Ct. 2880, 37 L.Ed.2d 796 (1978) (upholding the constitutionality of the Hatch Act). See also Broadrick v. Oklahoma, 413 U.S. 601, 93 S.Ct. 2908, 37 L.Ed.2d 830 (1973); Magill v. Lynch supra; Hickman v. City of Dallas supra. Several factors have been held to influence whether, with respect to an individual government employee seeking elective office, a regulation is reasonably necessary to achieve the compelling public objective. First, the potential for overlap between the jurisdictional authority of each position is a factor courts have considered. Hickman v. City of Dallas supra. Second, the nature of an employee's responsibilities is an important consideration. Elrod v. Burns, 427 U.S. 347, 96 S.Ct. 2673, 49 L.Ed.2d 547 (1965). Third, although no court has explicitly grounded its decision solely on this factor, courts have considered whether the elective office sought is "partisan" or "nonpartisan" as a factor in determining the potential for interference with the compelling public objectives.[3]See Segars v. Fulton County, 644 F.Supp. at 685-86. Plaintiff argues with respect to the first factor that his part-time positions on the county and state executive committees of the Democratic Party have no relationship whatsoever with his position as a Parole Review Officer. Plaintiff contends that his political posts are concerned with the selection process of candidates to run for local and state political offices, not the members State Board of Pardons and Paroles whose members are appointed by the Governor. Defendants argue that both the position of parole review officer and party executive committee have statewide jurisdictions, and therefore, overlap completely. Both arguments miss the mark. The question is whether there is realistic potential for conflict demonstrated between the two positions. In addressing other issues in their briefs, defendants show that such potential exists. Defendants' Brief in Support at 8-12. The court feels that at the very least that whenever politically sensitive pardons and paroles decisions present themselves, as they often do, the fact of an official party activist working on such a matter creates an overlap or conflict of interests if not precisely an overlap in specific jurisdiction. Here, the realistic expectation of such conflict clearly exists. More importantly, plaintiff's former duties involved reviewing whether convicted felons should be allowed to return to society.[4] It is desirable for a state to ensure that this function should be absolutely free from any political considerations or the appearance of political considerations. Public confidence would be quickly eroded if such considerations infected the decision making process. This factor weighs heavily in favor of the state's current prohibition of partisan political activity by parole review officers. Finally, plaintiff's position on the Executive Committee of the State Democratic *1341 party is "partisan", reenforcing the conclusion that the appearance of propriety in Board functions is diminished by plaintiff's presence as an official party activist.[5] The court finds that section 42-9-15 and the applicable Personnel Board rules do not unreasonably limit plaintiff's First Amendment rights. 3. Equal Protection Claims Plaintiff once again couches his argument in statutory interpretation terms of which the court has already disposed. In this vein, plaintiff rejects defendants' argument that section 45-10-70 does not apply to Board of Pardons and Paroles employees. More importantly, however, plaintiff seems to contend that the operation of section 42-9-15, which treats Board employees differently from other employees, creates an Equal Protection violation. While it is true that a First Amendment claim typically asserts that the government cannot deprive the plaintiff of some freedom and an equal protection claim asserts that the government may not single out the class of which the plaintiff is a member for deprivation, it is equally true that every First Amendment claim can be transformed into an Equal Protection claim merely by focusing on the classification embodied in the legislative scheme. Morial v. Judiciary Comm'n of State of Louisiana, 565 F.2d 295, 304 (5th Cir.1977). It is appropriate, therefore, to employ the same standard of scrutiny to the derivative equal protection claim as applied to the underlying First Amendment claim. Id.[6] As there is no allegation of suspect classification at issue here, the applicable Equal Protection doctrine here mirrors precisely the court's foregoing analysis regarding plaintiff's First Amendment claims in subsection B(2) of this order. Id. Because an "important" right is involved, the challenged statute and rules involved must withstand "intermediate scrutiny". The court once again engages in a bifurcated inquiry to determine whether (1) the "ends" of regulating the right are compelling and (2) the "means" are reasonably necessary to the vindication of the compelling state interest. For the same reasons set out in this court's First Amendment discussion supra, the court believes that section 42-9-15 and the applicable personnel rules pass muster under an Equal Protection analysis as well. First, the state has a compelling interest in (1) protecting the integrity of the public employment system; (2) protecting employees from political interference; (3) preserving public confidence in government by avoiding the appearance that Board employees are practicing political justice rather than true justice; and (4) maintaining the efficiency of its employees. Second, there is a realistic potential for conflict between plaintiff's position as Board parole review officer and his partisan political posts, and the state has sought to ensure that the parole function is free from any political considerations or the appearance of political considerations by prohibiting such a person from holding political office. Section 42-9-15, therefore, draws a reasonable distinction in forbidding members and employees of the Board of Pardons and Paroles from running for political office. The court finds no Equal Protection violation. CONCLUSION The court GRANTS summary judgment for defendants and conversely DENIES *1342 summary judgment for plaintiff.[7] This action terminates the case. NOTES [1] Additionally, Rule 3.506 states: Any employee in the classified service who violates any of the foregoing provisions of this section shall forfeit his position or be subjected to appropriate disciplinary action as provided elsewhere in these rules and regulations. [2] Assuming that the statutes are ambiguous enough to warrant inquiring into legislative history, a statement by a bill's sponsor two years after passage is not entitled to great weight in statutory interpretation. See Huntzel, Legislative Law and Process at 202 (1980); see generally W. Eskridge & P. Frickey, Statutes and the Creation of Public Policy, 759-60 (1987); see also Perman, Statutory Interpretation in California; Individual Testimony as an Extrinsic Aid, 15 U.S.F.L.Rev. 241 (1981). [3] The Supreme Court applying the "overbreadth doctrine" in Broadrick v. Oklahoma, 413 U.S. 601, 93 S.Ct. 2908, 37 L.Ed.2d 830 (1973), found no "substantial" overbreadth in a statute restricting "partisan" campaigning. The court had no occasion to rule on the question of "non-partisan" elections. Courts since that decision have recognized degree of actual as opposed to statutory partisanship as a factor to be weighed in the balance. See e.g., Magill v. Lynch, supra; Hickman v. City of Dallas, supra. Other courts have ignored the factor altogether. See Barry v. Dist. of Columbia Bd. of Elections, 448 F.Supp. 1249 (D.D.C.1978). [4] Plaintiff admits that 25% of the duties assigned a parole review officer involve determination of presumtive parole dates. Plaintiff's Brief in Support at 13; Document No. 1 attached to Affidavit of Robert Allison. [5] Plaintiff correctly asserts that the court faces the question whether the specter of partisan impropriety is sufficient reason to limit plaintiff's political activity. Implicit in the court's analysis is that, where the duties of an employee are as sensitive and potentially volatile politically as those of a Board employee, the answer is yes. [6] Of course, if the legislative scheme embodies a classification which is itself constitutionally suspect, strict constitutional scrutiny is required without regard to the nature of the underlying deprivation. See e.g., Graham v. Richardson, 403 U.S. 365, 371-73, 91 S.Ct. 1848, 1851-52, 29 L.Ed.2d 534 (1971). No such allegation is made in this case. [7] The court does not reach the issue of whether plaintiff's employment was voluntary forfeited through provisions 12.205.2 and 12.206.1 of the Rules and Regulations of the State Personnel Board. The court has found that plaintiff's admitted activities violated Rule 3.501(I) and that plaintiff was properly terminated pursuant to Rule 3.506.
2023-10-09T01:26:58.646260
https://example.com/article/7707
Q: how can i use a control in template? <Style x:Key="abc" TargetType="{x:Type Window}"> <Setter Property="Template"> <Setter.Value> <ControlTemplate TargetType="{x:Type Window}"> <button x:name="btn">my button!!</button> </ControlTemplate> </Setter.Value> </Setter> </Style> ... <Window ... Style="{StaticResource styleMainWindow}"> How can i use the button btn? come up to your expectations, MessageBox.Show(this.btn1.name); was occured an error at compile time. and also btn1 didn't show up in intelisense. A: Try the FindName method on the ControlTemplate class. Assuming this is your Control's context: var button = (Button)this.Template.FindName("btn", this);
2024-03-21T01:26:58.646260
https://example.com/article/4464
Article content An 87-year-old woman was brutally assaulted in a street robbery on Monday afternoon, Toronto Police say. The senior was walking on Brunswick Ave., south of Bloor St. W., Monday at 5:25 p.m. when a man attacked her from behind, throwing her to the ground and stealing her belongings. We apologize, but this video has failed to load. tap here to see other videos from our team. Try refreshing your browser, or Man sought in assault, robbery of 87-year-old woman Back to video Her attacker then fled east through an alley. The man is described as 6-feet-tall with a thin build. He was wearing a dark tuque, two-toned hooded sweater, dark pants, and dark shoes, and was carrying a white bag. Images have been released of a suspect. Anyone with information is asked to call police at 416-808-1400, Crime Stoppers anonymously at 416-222-TIPS.
2023-08-27T01:26:58.646260
https://example.com/article/1070
7 ways to be more extroverted By Michael Goldberg Knock Out Networking Don’t save your small talk for the elevator. ​Colin Cowherd is currently the host of "The Herd with Colin Cowherd" on ESPN radio. Yes, ESPN, so he covers sports. But often enough, he’ll rant about entertainment, politics, unions and even religion. Earlier this week at the beginning of his show, he spoke about the benefits of being an extrovert. Cowherd mentioned that he probably wouldn't have the job he has if he didn't have the natural inclination to talk to the people around him — cab drivers, people in the elevator, those he met at airports or in sports stadiums. He rattled off statistics about how many more people succeed in their lives simply because they’re extroverted. If you have the ability and confidence to talk to people serendipitously, good things happen. I think he’s right. Think of all the times you were just going about your business and you could have struck up a conversation with someone influential (or anyone really) where there was a chance to create an opportunity. Of course, if you never strike up that conversation, there’s absolutely no (as in zero) chance for that opportunity — an opportunity to land a job, earn some business, refer business, give some advice, get some advice, learn something, have fun, or just to help a brother out. Here are seven opportunities to become more extroverted as you go about your day to day activities. 1. At the supermarket Or at the bank, dry cleaners, deli, Starbucks, barber, dentist, auto service center or wherever life happens to take you as you run your daily or weekly errands. As you’re standing in line or sitting in the waiting room, instead of texting, tweeting or playing Angry Birds, look for someone nearby that has “smiley eyes” (a term I learned from a media coach) and say hello. Strike up a conversation. Ask a few questions about them, comment about what they’re reading and ask what they’re having done to their car or whatever. If the conversation feels right, it will continue; if not, simply go back to doing what you’re doing. 2. On an airplane Since I do a lot of business travel, I’m on airplanes all the time. Typically, there’s a fellow business traveler seated next to me, and I can’t help but say hello. Travel is a lonely business, so it’s not such a stretch to greet someone sitting only six inches away from me. Besides, we’ll be six inches apart for 2,000 miles and 35,000 feet, so why not introduce myself? Nobody has ever changed seats to escape me (that I know of). And I’m sensitive to keep the talk light, appropriate to the tone, and to allow for the solitude that a good book or a nap might bring. 3. In the airport I've watched more playoff baseball games in airports than anywhere else. It seems whenever my flights have been delayed, it’s game number two of the American League Division Series. That means a crowded bar at the airport with a lot of frustrated travelers all too happy to talk baseball. Of course, other questions I might ask include: How long is your flight delayed? Where are you headed? Do you travel often? What type of work do you do? Who do you work for? Then I just go from there. 4. At the kid’s game In my case, it’s the kid’s cheerleading events, competitions or cheering at the football game. But the same applies whether your kid plays football, soccer, baseball or whatever. If you happen to be one of the coaches, then you have an opportunity to get to know the other volunteer coaches. If you’re a parent that stays on the sideline or in the stands with your hot chocolate, introduce yourself to the people you probably see every week. You could say something like, "You know I see you here every week. I’m Michael. Which child is yours? Nice to meet you. What type of work do you do when you’re not spending five hours at cheerleading?" And so on. 5. Your extracurricular activities I spend time meeting and getting to know people while boxing at my gym and playing in my softball league. I think fantasy football leagues qualify. Some of the players in my softball league are accountants, financial advisors, attorneys, sales reps, business owners, mortgage brokers, realtors and various other occupations. In fact, one of my boxing partners is an international equity trader. Over the years, I've become a client to those I got to know through my softball league. And I've helped enough of the players with their resumes and job searches. My leagues and activities have led to many friendships and a great community. 6. With your clients, referral sources and advocates Why not look to create more opportunities to spend time with those you do business with? Make it a point to set one day a month on the calendar to grab lunch, dinner, a drink, a ball game, jazz or whatever your thing is with a client, referral source, advocate, or even a true prospect. Every quarter, I have lunch with one of my favorite clients. It’s a standing date that involves sushi, conversations about our favorite television shows (we have a lot in common here), and other events in our lives. It’s a lot of fun. Not by design, we talk about business for about five minutes. 7. When the spirit moves you There might be other times that you’re going along your merry way and you have the opportunity to start a dialogue, weigh in on someone's conversation or offer to help somebody out. Remember, if you don’t ask the question, the answer is always no. So always ask the question and be on the lookout for opportunities that may fall in your lap. Please keep in mind that you don’t have to be a small talker, have the gift of gab or be an extrovert to talk to strangers. (By the way, Cowherd mentions mom’s advice about not talking to strangers is great advice until you turn about 15.) And you don’t have to be an extrovert to be more extroverted. Like with anything, the more you do it, the easier it becomes. Start practicing now. You have nothing to lose and everything to gain. Don’t save your small talk for the elevator.
2024-02-28T01:26:58.646260
https://example.com/article/3716
We don’t actually know if Richard Nixon ordered the break-in to the Democratic National Committee headquarters in the Watergate complex on June 17, 1972. That, to me, is still the most remarkable feature of the Watergate crisis. A president was forced out of office for the first time in American history by a scandal centering on a single crime, and we still don’t know if he actually ordered it. In his memoirs, Nixon denies it, though he smugly adds, "I could not muster much moral outrage over a political bugging." Jeb Magruder, a dirty tricks operative for Nixon, revealed three decades later that he had overheard Nixon and his reelection chair John Mitchell planning the burglary. But as historian David Greenberg notes, “Mr. Magruder had [previously] discussed that same meeting without noting Nixon's participation.” Dirty tricks operatives aren’t the most reliable of sources. We don’t even know why it happened — if the burglars were looking for evidence that the DNC was receiving money from the North Vietnamese or Cuban governments (as conspirator Howard Hunt insisted), or information embarrassing to White House counsel John Dean (as G. Gordon Liddy, who planned the break-in with Hunt, claimed), or, as another popular theory has it, trying to find out how much DNC chair Larry O'Brien knew about Nixon’s financial dealings with billionaire tycoon Howard Hughes. But what we do know, the “smoking gun” that eventually forced Nixon out of office, was that Nixon ordered his chief of staff to get the CIA to force the FBI to abandon its investigation into the break-in. That was enough. Some Republicans had stood by Nixon through his firing of the independent counsel investigating the matter, through multiple aides and Cabinet officials resigning, through the White House’s effort to resist subpoenas for documents and tapes. But when the “smoking gun” White House tape was released on August 5, 1974, Nixon’s remaining support from Republicans evaporated. Two days later, Senate Minority Leader Hugh Scott (R-PA), House Minority Leader John Jacob Rhodes (R-AZ), and former presidential candidate Sen. Barry Goldwater (R-AZ) went to the White House and informed the president that he had no support left in Congress. They were shocked and horrified that Nixon had personally participated in the cover-up; before then there was still a sliver of a chance that the president himself wasn’t part of the conspiracy. They told Nixon that, now that his role in the cover-up was known, the votes were there to impeach him and remove him from office. The day after that, the president announced his resignation. Similarly, there’s a lot we don’t know about Trump and his campaign’s ties to Russia. We know that the FBI and other agencies have been looking into any contact Trump's campaign advisers Paul Manafort, Carter Page, and Roger Stone might have had with the Russian government during the election, as well as into White House senior adviser and Trump son-in-law Jared Kushner’s post-election contacts. We know that intelligence agencies suspect those three might have worked the Russian officials to coordinate the release of hacked emails. We know that disgraced former National Security Adviser Michael Flynn, Kushner, and Attorney General Jeff Sessions all lied about or failed to disclose communications with Russian Ambassador Sergey Kislyak. We don’t know how all these pieces fit together. We don’t know exactly what Donald Trump Sr.’s direct involvement is, or how aware he was of his advisers’ efforts, or the nature of his business relationship with Russia. That’s provoked a lot of very valuable investigative journalism, as well as a lot of outright conspiracy theorizing. But focusing too granularly on the details of Trump’s personal involvement risks setting the bar too low for him. It risks suggesting that unless we find undeniable proof of collusion between Trump and the Russian government, he’s in the clear. The fact of the matter is that without any more information than we already have, we already know Trump’s conduct is at least as outrageous as what Nixon acknowledged in the smoking gun tape. In Nixon’s case, what crossed the line, moving top leaders from his own party to go to the White House and tell Nixon that his presidency was over, was Nixon’s attempt to hamper the FBI’s investigation into Watergate. And we now know that before Trump fired FBI Director James Comey, he asked Comey to stop investigating former National Security Adviser Flynn; Comey confirms as much in his testimony before the Senate Intelligence Committee, and further indicates that Trump asked him to “lift the cloud” of the Russia investigation more broadly. This is exactly the same kind of FBI investigation interference that forced Nixon out of the White House and shocked his Republican allies out of defending him. We also know that Trump asked the Director of National Intelligence and the director of the National Security Agency to publicly deny the existence of collusion between his campaign and Russia — an attempt at interference in the intelligence community that calls directly to mind Nixon's attempt to use the CIA to scuttle an FBI probe. This is not a “where there’s smoke there’s fire” situation. We don’t need to know much more to know that the president has committed conduct that was once thought sufficient to warrant removal from office. The Comey firing isn’t smoke. It’s fire.
2023-11-29T01:26:58.646260
https://example.com/article/7419
*Please print or bring in this coupon on your mobile device* Valid for New Members only. What People Say About Us Gail (Joined June 2010) "I was really WOWed. Health 360 is no ordinary big box gym. And way more affordable and flexible." Health 360 Fitness Center 2014-03-25T09:16:01+00:00 "I was really WOWed. Health 360 is no ordinary big box gym. And way more affordable and flexible." https://www.h360g.com/testimonials/27/ Lauren I've worked with Lenny for the past year and he has prepared me to be a Division 1 squash player. Lenny is one of the best trainers I've ever worked with. Lenny brings energy and enthusiasm to each session. He focuses on having the proper form and clearly explains what each exercise targets. Whether he is teaching a new technique or correcting my form, he proceeds with professionalism and motivation. He makes me want to work harder and the workouts are really enjoyable! I could not image what my fitness level would be if I... Health 360 Fitness Center 2014-11-14T01:03:50+00:00 I've worked with Lenny for the past year and he has prepared me to be a Division 1 squash player. Lenny is one of the best trainers I've ever worked with. Lenny brings energy and enthusiasm to each session. He focuses on having the proper form and clearly explains what each exercise targets. Whether he is teaching a new technique or correcting my form, he proceeds with professionalism and motivation. He makes me want to work harder and the workouts are really enjoyable! I could not image what my fitness level would be if I had not been training with Lenny. - Lauren https://www.h360g.com/testimonials/249/ Mark My son’s training program with Lenny Taylor was designed to make him a better athlete by becoming stronger, quicker and faster for football and baseball. His program focused on ground up strength build, quick twitch muscle training and form running mechanics. The results to date have been overwhelming and have exceeded the goals set at the start of his training program. The hard work with Lenny helped earn him 2-Time All Ohio in baseball and a Division I scholarship at Ohio University. What we appreciated most about working with Lenny was his focused approach in... Health 360 Fitness Center 2014-11-14T01:03:28+00:00 My son’s training program with Lenny Taylor was designed to make him a better athlete by becoming stronger, quicker and faster for football and baseball. His program focused on ground up strength build, quick twitch muscle training and form running mechanics. The results to date have been overwhelming and have exceeded the goals set at the start of his training program. The hard work with Lenny helped earn him 2-Time All Ohio in baseball and a Division I scholarship at Ohio University. What we appreciated most about working with Lenny was his focused approach in developing a training program that improved areas of weakness. Lenny’s no excuse mentality and good nature was a huge part of the program and kept my son wanting more. - Mark https://www.h360g.com/testimonials/mark/ Health 360 Performance Institute "Prior to this previous summer, my goal was to be the strongest member of my rowing team. In doing so, I knew that I would have to gain 10 pounds. Through working with Lenny throughout the summer, I was able to surpass that goal and gain 14 pounds of muscle (165 to 179). Lenny continually pushes me every training session through positive reinforcement in order to allow me to reach my potential as an athlete. My goal for this upcoming winter is to match that 14 lbs, I have no doubt that Lenny will push... Health 360 Fitness Center 2014-11-14T00:56:28+00:00 "Prior to this previous summer, my goal was to be the strongest member of my rowing team. In doing so, I knew that I would have to gain 10 pounds. Through working with Lenny throughout the summer, I was able to surpass that goal and gain 14 pounds of muscle (165 to 179). Lenny continually pushes me every training session through positive reinforcement in order to allow me to reach my potential as an athlete. My goal for this upcoming winter is to match that 14 lbs, I have no doubt that Lenny will push me past it. Additionally, Lenny's personality makes working with him something that I'm always looking forward to." - Brad https://www.h360g.com/testimonials/health-360-performance-institute/ Maryann (Joined May 2010) "…the equipment is state-of-the art and the wide variety of classes offered are excellent. The friendly warm family-like atmosphere at Health 360 even includes the other members." Health 360 Fitness Center 2014-03-25T09:16:47+00:00 "…the equipment is state-of-the art and the wide variety of classes offered are excellent. The friendly warm family-like atmosphere at Health 360 even includes the other members." https://www.h360g.com/testimonials/29/ Jim (Joined Jan 2010) "…I think Health 360 approaches the goal of membership growth in the right way. They understand that it’s not all about numbers, but adding value and making going to the gym a great all around experience." Health 360 Fitness Center 2014-03-25T09:19:16+00:00 "…I think Health 360 approaches the goal of membership growth in the right way. They understand that it’s not all about numbers, but adding value and making going to the gym a great all around experience."
2024-03-27T01:26:58.646260
https://example.com/article/3957
Minister of Safety and Security Retired Major-General Charles Namoloh has confirmed that the Financial Intelligence Unit is investigating whether the Affirmative Repositioning (AR) movement has any foreign donors. Certain Polytechnic of Namibia council members were left disappointed when the Anti-Corruption Commission requested the institution to conduct its own internal investigation first into allegations against Rector Tjama Tjivikua. NSX-listed Namibia Breweries Limited (NBL) has again eased fears of potential job losses after the brewer announced plans to acquire a 25 percent stake in South African based Sedibeng Brewery and further its stake in DHN Drinks by 9.5 percent. The dust refuses to settle in the case between dismissed permanent secretaries Joseph Iita and Erastus Negonga, and the Government after the Office of the Labour Commissioner postponed the case to 18 August. Meeting Matheus Tuhafeni Michael, one can never imagine him belting out classical compositions, but boy does he! Known as Boom by his friends, Michael is a student at the College of the Arts, studying for a Diploma in African Performing Arts and taking classes in Classical singing.
2024-01-17T01:26:58.646260
https://example.com/article/3734
1. Introduction {#sec1} =============== Corneal dystrophy is a general term used to describe a series of primary bilateral blinding corneal diseases that are associated with familial inheritance \[[@B1]\]. Currently, specific genetic backgrounds have been discovered in half of the cases of corneal dystrophy. Approximately 12 pathogenic genes have been linked to corneal dystrophy, among which the human transforming growth factor beta-induced (*TGFBI*) gene (encoding an extracellular matrix adhesion protein) is most commonly linked. It has been confirmed that the following types of corneal dystrophies are caused by *TGFBI* gene mutations: granular corneal dystrophy (GCD), Avellino corneal dystrophy (ACD), Reis--Bücklers corneal dystrophy (RBCD), and lattice corneal dystrophy (LCD). These disorders are all inherited in an autosomal dominant manner \[[@B1]--[@B5]\]. *TGFBI*-associated corneal dystrophies exhibit multiple clinical phenotypes and a high degree of genetic heterogeneity. Moreover, atypical variants of *TGFBI*-associated corneal dystrophy are frequently reported. Therefore, it is difficult to classify and type *TGFBI*-associated corneal dystrophies simply based on their clinical features or histological manifestations. The molecular genetic study of the pathogenic genes related to corneal dystrophies will play a positive guiding role in clinical diagnosis. In the present study, clinical characteristic analysis and molecular genetic analysis were performed on three unrelated families with different types of corneal dystrophy. The purpose of the present study was to explore the potential application of *TGFBI* gene mutation identification in the classification and diagnosis of corneal dystrophy. 2. Subjects and Methods {#sec2} ======================= 2.1. Subjects {#sec2.1} ------------- Three ancestrally unrelated families with corneal dystrophy that were treated in our hospital between February 2015 and October 2017 were included in the present study. In addition, 100 individuals without corneal dystrophy (confirmed by the Department of Ophthalmology) were randomly selected as controls. The study was conducted in accordance with the Declaration of Helsinki and was approved by the ethics committee of our hospital. Informed consent was obtained from all participants prior to the clinical examinations and genetic analysis. Family 1 comprised 54 members from four generations, among whom 10 members were diagnosed with corneal dystrophy (one was deceased) and 44 had a normal phenotype (one was deceased). Family 2 comprised 37 members from four generations, among whom 13 were diagnosed with corneal dystrophy (two were deceased) and 24 had a normal phenotype. Family 3 comprised 16 members from three generations, among whom six were diagnosed with corneal dystrophy (two were deceased) and 10 displayed a normal phenotype (one was deceased). The pedigrees of the three families are shown in [Figure 1](#fig1){ref-type="fig"}. The medical history of all participants as well as the patients\' ages, physical signs, and symptoms were recorded. In addition, comprehensive eye examinations including refractive tests, slit-lamp microscopy, indirect ophthalmoscopy, noncontact intraocular pressure measurements, and anterior segment photography were performed to determine the phenotypes of the members of the three families. 2.2. Methods {#sec2.2} ------------ ### 2.2.1. Extraction of Genomic DNA {#sec2.2.1} Peripheral blood (approximately 3 mL) was collected from each of the members of the three Chinese families (including 24 patients and 76 phenotypically normal individuals) and from the 100 healthy controls. The blood samples were subjected to anticoagulant treatment with ethylenediaminetetraacetic acid (EDTA). Subsequently, genomic DNA was extracted from the blood samples using the Blood DNA Extraction Kit (Sangon Biotech Co., Ltd., Shanghai, China) according to the manufacturer\'s instructions. The extracted DNA was examined by 1% agarose gel electrophoresis and ethidium bromide (EB) staining. Successfully extracted genomic DNA was used as a template in subsequent assays. ### 2.2.2. Primer Design {#sec2.2.2} Primers specific for the 17 exons of the *TGFBI* gene were designed based on the available literatures \[[@B6]--[@B10]\] and on the DNA sequence of the *TGFBI* gene in the human genome database ([http://www.ncbi.nlm.nih](http://www.ncbi.nlm.nih/)). The primers were synthesized by Sangon Biotech Co., Ltd. The nucleotide sequences of the primers and the polymerase chain reaction (PCR) amplification conditions are shown in [Table 1](#tab1){ref-type="table"}. ### 2.2.3. PCR Amplification and DNA Sequencing {#sec2.2.3} An HBP220 PCR thermal cycler (Hybaid, Middlesex, UK) was used to perform PCR. Each PCR reaction mixture (50 *μ*L) contained approximately 200 ng of DNA template, 5 *μ*L of 10x buffer, 1.5 mmol/L MgCl~2~, 0.25 *μ*mol/L primers, 100 *μ*mol/L dNTPs, and 2 U of Taq polymerase (Sangon Biotech Co., Ltd.). The PCR conditions were as follows: pre-denaturation at 94°C for 5 min; 35 cycles of denaturation at 94°C for 45 s; annealing (the annealing temperatures of the various primers are shown in [Table 1](#tab1){ref-type="table"}) for 45 s; extension at 72°C for 50 s; and a final elongation at 72°C for 10 min. The lengths of the amplified fragments are shown in [Table 1](#tab1){ref-type="table"}. The resulting PCR products were examined by 2% agarose gel electrophoresis and EB staining. Once the PCR amplification was deemed successful, the PCR products were purified using isopropanol and were then bidirectionally sequenced using an ABI 3730 DNA analyzer (Applied Biosystems, Foster City, CA). The sequencing results were compared with the wild-type *TGFBI* gene sequence recorded in GenBank using the BLAST sequence analysis tool. ### 2.2.4. Bioinformatic Analysis {#sec2.2.4} The *TGFBI* gene mutations discovered by sequencing were assessed against the NCBI dbSNP database. In addition, SIFT (<http://sift.jcvi.org/>), PROVEAN (<http://provean.jcvi.org/index.php>), MutationTaster (<http://www.mutationtaster.org/>), and other online software programs were used to determine the impact of the mutations on the protein structure and function and to predict the pathogenicity of the mutations. 3. Results {#sec3} ========== 3.1. Clinical Manifestations {#sec3.1} ---------------------------- The proband of family 1 (III: 10) was a 36-year-old woman. She began to experience repeated irritative eye symptoms such as bilateral eye pain, red eyes, photophobia, and tearing before the age of 10. Slit-lamp microscopy revealed corneal epithelial erosion in both eyes and positive corneal fluorescein staining. In addition, the proband showed dense, map-like subepithelial opacities that involved the entire cornea ([Figure 2(A)](#fig2){ref-type="fig"}). The visual acuity of the proband deteriorated to 0.1 and could not be corrected. The eldest son of the proband (IV: 6, nine years of age) initially presented with bilateral corneal dystrophy two years before this study. The eldest son suffered noticeable corneal irritation. The subepithelial haze had spread to the periphery of the cornea ([Figure 2(B)](#fig2){ref-type="fig"}). The eldest son had a visual acuity of 0.4, which could not be corrected. The youngest son of the proband (IV: 7, six years of age) showed mild symptoms of corneal irritation. The youngest son developed irregular dot-like and sheet-like opacities in the central area of the cornea. However, the periphery of the cornea was not affected ([Figure 2(C)](#fig2){ref-type="fig"}). The visual acuity of the youngest son was 0.6, indicating that the disease was still in an early stage. Other patients in family 1 displayed clinical characteristics similar to those of the proband. Based on the clinical features, the family was preliminarily diagnosed as having RBCD. The proband of family 2 (III: 8) was a 63-year-old woman. She had suffered from reduced vision for more than 30 years, and her eye condition had been worsening for three years. Her binocular visual acuity for distance was only count fingers at 30 cm (CF/30 cm), which did not improve after attempted correction. Slit-lamp microscopy revealed the presence of dense, greyish-white discoid corneal opacities in the central visual axis in both eyes. In addition, thick, lattice-shaped lesions were visible in the corneal stroma ([Figure 3(A)](#fig3){ref-type="fig"}). The proband\'s son (IV:7, 39 years of age) had suffered from reduced vision for more than 10 years. He had a binocular visual acuity of 0.3, which did not improve after attempted correction. The proband\'s son showed significantly reduced transparency in the central corneas of both eyes. Ground glass-like corneal opacities were clearly visible. In addition, semitransparent, lattice-like lesions were detected in the corneal stroma ([Figure 3(B)](#fig3){ref-type="fig"}). The youngest patient in family 2 (IV: 2) was a 16-year-old boy. The boy had a visual acuity of 0.6, which was corrected to 1.0. Nodular opacities scattered throughout the cornea were present in both eyes of the boy. In addition, thin lattice lines were found in the boy\'s corneal stroma ([Figure 3(C)](#fig3){ref-type="fig"}). These findings indicated that the disease was still in an early stage. Based on the clinical features, the family was preliminarily diagnosed as having LCDI. The proband of family 3 (II: 2) was a 42-year-old male. The proband started to suffer from progressive binocular vision decline more than 10 years prior to this study without obvious cause; this decline was accompanied by a mild foreign body sensation. However, the proband did not develop apparent irritative symptoms such as eye pain, photophobia, or tearing. Slit-lamp microscopy revealed the presence of greyish-white crumb-like opacities in the superficial and middle stromal layers of the corneas in both eyes. The opacities had clear margins. The cornea between the opacities and the peripheral cornea appeared transparent ([Figure 4(A)](#fig4){ref-type="fig"}). The visual acuity of the proband was 0.2, which could not be corrected. The proband\'s daughter (III: 1, 19 years of age) had suffered from blurred vision for more than three years. She had a binocular visual acuity of 0.8, which did not improve after attempted correction. Greyish-white crumb-like opacities were present in the central corneas of both eyes. The opacities had clear margins. However, the density of the corneal opacities was lower in the daughter than in her father (the proband). These findings are shown in [Figure 4(B)](#fig4){ref-type="fig"}. Based on the clinical features, the family was preliminarily diagnosed as having ACD. 3.2. DNA Sequencing {#sec3.2} ------------------- In all three families, corneal dystrophy followed an autosomal dominant mode of inheritance. Therefore, all PCR products were subjected to sequencing in both the forward and reverse directions. The results of reverse DNA sequencing were consistent with the results of forward DNA sequencing. The DNA sequencing results were compared with the *TGFBI* gene sequence in GenBank. *TGFBI* gene mutations were found in all three families, and all of the mutations occurred at R124 in exon 4 of the *TGFBI* gene (the normal codon at this position is CGC, which encodes arginine). No *TGFBI* gene mutations were detected in the 100 unrelated healthy controls. The c.371G \> T mutation was detected in all patients from family 1 ([Figure 5(a)](#fig5){ref-type="fig"}). This mutation was a heterozygous p.R124L mutation (CGC \> CTC), in which the arginine at position 124 has been mutated to leucine. The penetrance of the p.R124L mutation was 100%. The p.R124L mutation was not detected in the phenotypically normal members of family 1. The c.370C \> T mutation was detected in all patients from family 2 ([Figure 5(b)](#fig5){ref-type="fig"}). This mutation was a heterozygous p.R124C mutation (CGC \> TGC), in which the arginine at position 124 has been mutated to cysteine. The penetrance of the p.R124C mutation was 100%. The p.R124C mutation was not detected in the phenotypically normal members of family 2. The c.371G \> A mutation was detected in four patients from family 3 ([Figure 5(c)](#fig5){ref-type="fig"}). This mutation was a heterozygous p.R124H mutation (CGC \> CAC), in which the arginine at position 124 has been mutated to histidine. The p.R124H mutation was also 100% penetrant. Again, the p.R124H mutation was not detected in the phenotypically normal members of family 3. No mutations were found in other exons of the *TGFBI* gene in the three families. Mutations at R124 of exon 4 cosegregated with disease phenotypes. 3.3. Results of Bioinformatic Analysis {#sec3.3} -------------------------------------- Bioinformatic analysis showed that the p.R124L, p.R124C, and p.R124H mutations of the *TGFBI* gene had previously been reported to the NCBI dbSNP database. The effects of the above mutations on protein structure and function were assessed online using PloyPhen-2 and SIFT. The software programs predicted that all the above mutations were detrimental ([Table 2](#tab2){ref-type="table"}). In addition, the results obtained using the MutationTaster online software indicated that the p.R124C mutation was pathogenic. 4. Discussion {#sec4} ============= Due to significant genetic heterogeneity, the clinical phenotypes of *TGFBI*-linked corneal dystrophy vary. The *TGFBI* gene that is located on chromosome 5q31.1 is approximately 37 kb in length and contains 17 exons. It encodes a 683 amino acid protein, namely, the corneal epithelial protein keratoepithelin (KE). KE is a secretory protein with a relative molecular mass of 68 kDa. KE contains an aminoterminal secretory signal peptide sequence, four regions of internal homology (FAS-1) consisting of 140 amino acid repeats, and a carboxyl-terminal RGD (Arg-Gly-Asp) sequence and Asp-Ile (DI) motif \[[@B6]--[@B9]\]. The four repeats in KE fold into a divalent tetrameric structure and act as a bridge when cells express suitable ligands. Therefore, it is believed that the TGFBI protein could mediate cell adhesion like other cell adhesion molecules. Also, TGFbeta1 has been shown to play a central role in scar formation in adult corneas. The biological effects of TGF*β* in the cornea have been shown to follow SMAD-dependent as well as SMAD-independent signaling pathways depending upon cellular responses and microenvironment. Corneal TGF*β* expression is necessary for maintaining corneal integrity and corneal wound healing \[[@B11]\]. It is known the molecular pathway of TGF*β* is Smad dependent. There also has evident by the fact that TGF*β* can activate several mitogen-activated protein kinases (MAPKs), including extracellular signal-regulated kinases (ERKs), c-Jun N-terminal kinases (JNKs), and p38 kinases \[[@B11], [@B12]\]. The MAPK signaling is composed of the ERK, p38, and JNK/SAPK pathways. MAPK pathways in mouse, rabbit, and human corneal epithelium mediate cell migration of corneal epithelium \[[@B13]\]. It has been confirmed that specific types of *TGFBI* gene mutations are highly correlated with specific clinical phenotypes of corneal dystrophy. The *TGFBI* gene mutations mainly include p.R555W (GCDI), p.R124H (ACD), p.R124L (RBCD), p.R555Q (TBCD), p.R124C (LCDI), and p.H626R (LCDI/III) \[[@B10], [@B14]--[@B18]\]. The results of the present study are consistent with these findings and confirm, once again, the strong correlation between genotype and phenotype. In addition, the results of the present study suggest that the different types of corneal dystrophy-associated *TGFBI* gene mutations exhibit no obvious regional or racial specificities. Furthermore, this study shows that the *TGFBI* gene mutations present in all patients of the three families occurred at codon R124, suggesting that this codon is a mutational hotspot in Chinese patients with *TGFBI*-associated corneal dystrophy and that mutations at R124 play important roles in the pathogenesis of this disease in Chinese patients. Future, we will further investigate the molecular mechanism involved by TGFBI mutations, like pathway. In the present study, heterozygous mutations of the *TGFBI* gene---p.R124L, p.R124C, and p.R124H were detected in the diseased members of the three families. Bioinformatics analysis found that all these mutations were known and had detrimental effects on the structure and function of the protein encoded by the *TGFBI* gene. All patients in family 1 had the p.R124L mutation, in which hydrophilic arginine has been replaced by hydrophobic leucine. This mutation causes the deposition of corneal degeneration products and the repeated erosion of the corneal epithelium, resulting in RBCD. Clinically, visual impairment occurred early and progressed rapidly in the patients of family 1. Moreover, the patients were prone to relapse after receiving corneal transplantation. Molecular genetic analysis further demonstrated that this family had the typical map-like form of RBCD. All patients in family 2 carried the p.R124C mutation, in which the positively charged basic amino acid arginine has been replaced by the noncharged amino acid cysteine. This mutation affects the three-dimensional structure of KE, resulting in LCD. Clinically, corneal opacities and lattice-like stromal lesions were positively correlated with the age and visual impairment of the patients in family 2. Molecular genetic analysis confirmed that family 2 suffered from classic LCDI. All patients in family 3 had the p.R124H mutation, in which arginine has been replaced by histidine. Both arginine and histidine are basic amino acids; however, arginine is far more basic than histidine. The ability of arginine to form hydrogen bonds is higher than that of histidine, and arginine can effectively bind to negatively charged molecules. Replacement of arginine with histidine causes changes in the adhesion of the mutated protein to extracellular matrix proteins and in the hydrolytic activity of the mutated protein, resulting in the deposition of amyloid-like substances in the corneal stroma and ultimately causing corneal dystrophy. The discovery of the p.R124H mutation of the *TGFBI* gene in family 3 clearly demonstrated that the family suffered from ACD (i.e., GCDII). Studies have shown that *TGFBI* gene mutations mainly affect the amino acid residue R124 and the fourth FAS-1 domain of KE. The codon R124 (which encodes arginine) is located at the amino terminus of the FAS-1 region in exon 4. Mutations at R124 may alter the polarity and hydrophilicity of the amino acid, the structure of the protein at all levels and the adhesion and hydrolysis of the protein, which induces the formation and deposition of amyloid fibrils in the corneal stroma and ultimately leads to corneal dystrophy \[[@B17], [@B19], [@B20]\]. In clinical practice, it is difficult to distinguish between similar phenotypes or even between subtypes of corneal dystrophies based only on the characteristics and pathological features of these corneal diseases. According to the characteristics and pathological features of corneal opacities, RBCD is classified as map-like or honeycomb-like RBCD (also known as Thiel--Behnke corneal dystrophy, TBCD) \[[@B10], [@B15], [@B17], [@B18]\]. Based on the locations of the lesions, the characteristics of the corneal opacities, and the age of onset, LCD is roughly divided into the following five types: LCDI, LCDII, LCDIII, LCDIIIA, and LCDIV. GCD has three common clinical phenotypes: GCDI, GCDII, and GCDIII. GCDII is also known as Avellino corneal dystrophy (ACD) \[[@B14]--[@B16]\]. At present, the classification of corneal dystrophy is rather confusing, as there are often multiple names for the same disease type. In addition, some cases of corneal dystrophy exhibit atypical clinical features. Classification and typing of corneal dystrophies based only on clinical characteristics, and histological features is difficult and is not conducive to the timely and correct diagnosis and treatment of these diseases. The examination of relevant genes will play a key guiding role in the clinical diagnosis and treatment of corneal dystrophies. Through clinical investigation and molecular genetic analysis, the present study has identified three Chinese families with corneal dystrophies caused by R124 mutations in the *TGFBI* gene and has demonstrated, once again, that R124 is a mutational hotspot in *TGFBI*-related corneal dystrophies. In addition, the present study found that the R124 mutations exhibited no regional and racial differences. However, clinical follow-up and examination of the pathogenic genes in these families will not only be conducive to prognosis prediction but will also facilitate genetic counselling and prenatal diagnoses. There are also some limitations for this study. First, for the 24 patients, only 3 types of mutations were covered by PCR. Further, we need to use whole exon sequencing to exclude other mutations. Also, gene sequencing of all exons of the TGFBI gene should help to achieve accurate diagnosis. We only have 24 clinical patients in our study. Future, we need more samples to reveal the TGFBI gene mutation with corneal dystrophy. The work was supported by the Foundation of Jiangsu Province (BK20160133), Nanjing Medical Science and Technique Development and National Natural Science Foundation of China (81600742). Data Availability ================= The data used to support the findings of this study are available from the corresponding author upon request. Conflicts of Interest ===================== The authors declare that there are no conflicts of interest regarding the publication of this paper. Authors\' Contributions ======================= T. G. conceived and designed the study. Y. L. and F. Zh. performed the experiments. ![The pedigree of the three families indicates a likely autosomal dominant inheritance of Reis--Bücklers corneal dystrophy over four generations (Family 1 and Family 2) and three generations (Family 3). The genotypes and disease onset (inside parentheses) are given below the pedigree symbols. Black filled and blank symbols represent affected and unaffected status, respectively.](JOPH2019-6769013.001){#fig1} ![Slit-lamp biomicroscopic images of the cornea of the family with RBCD: (A) the proband (III: 10); (B) the proband\'s eldest son (IV: 6); (C) the proband\'s youngest son (IV: 7); (D) a phenotypically normal individual (IV: 8).](JOPH2019-6769013.002){#fig2} ![Slit-lamp biomicroscopic images of the corneas of the family with LCD: (A) the proband (III: 8); (B) the proband\'s son (IV: 7); (C) the youngest patient in the family (IV: 2); (D) a phenotypically normal individual (IV: 1).](JOPH2019-6769013.003){#fig3} ![Slit-lamp biomicroscopic images of the corneas of the family with ACD: (A) the proband (II: 2); (B) the proband\'s daughter (III: 1).](JOPH2019-6769013.004){#fig4} ![Results of the sequencing of exon 4 of the *TGFBI* gene: (a) the heterozygous G \> T base substitution in family 1 resulted in a heterozygous p.R124L mutation (CGC \> CTC); (b) the heterozygous C \> T base substitution in family 2 resulted in a heterozygous p.R124C mutation (CGC \> TGC); (c) the heterozygous G \> A base substitution in family 3 resulted in a heterozygous p.R124H mutation (CGC \> CAC); (d) the sequence of exon 4 in normal individuals.](JOPH2019-6769013.005){#fig5} ###### Sequences of the primers specific for the 17 exons of the TGFBI gene and PCR amplification conditions. Exon Primer sequence (5′⟶ 3′) Annealing temperature (°C) Product length (bp) ------ ------------------------------- ---------------------------- --------------------- 1 F: CGGAGGCGCTCTCACTTCC 62 277   R: CGAGCCCCGACTACCTGACC     2 F: GGGAGTCATTAAAGTGGGGTGGA 64 290   R: AGCTTGGTCTCCTGGCTGGTTAC     3 F: CAACTTAGTGGAGAGGGGCCAGA 63 260   R: CTCTCTCCCACCATTCCCTTCC     4 F: GCCATCCCTCCTTCTGTCTTCTG 62 252   R: CCTCGGGGAAGTAAGGCAGTTC     5 F: ACTGACACCCTGTCCTTCCTCCT 67 165   R: AGCCCACACATGGAACAGAAATG     6 F: CTGCTCATCCTTGCTGCTTCTCT 56 248   R: AGAGTTCCTGCTAGGCCCCTCTT     7 F: TCTGTGGGGAGTGCCAGAGTC 55 238   R: CAAATGAGGCAGCAGCAGGA     8 F: TGGACCCTGACTTGACCTGAGTC 56 310   R: AAAGGATGGCAGAAGAGATGGTG     9 F: CCCTGGGGTGGATGAATGATAAA 62 192   R: GCCTCCAGGGACAATCTAACAGG     10 F: ATTGCAGGAGCACATCTCTCTGG 60 222   R: GCTTCCCAGGAGCATGATTTAGG     11 F: GCCCCTCGTGGAAGTATAACCAG 55 228   R: ATCCCACTCCAGCATGACCACT     12 F: GGGCCCTGAGGGATCACTACTTT 56 199   R: TGACAGGTGACATTTTCTGTGTGTG     13 F: CAGCCTTTGATTTGCAGGACACT 58 195   R: TGACCAGGCTAATTACCATTCTTGG     14 F: CCAACTGCCACATGAAGAAAAGG 60 280   R: TGCTCTACCTTTCAACCACTACTCTG     15 F: CCTCTATGGCCCAAACAGAGGAC 57 231   R: TACCTCTGGTCAAACCTGCCTTT     16 F: ATACAGCAGATGGCAGGCTTGG 55 246   R: GCCATTGTCATAAGCAGTTGCAG     17 F: ATTGAGGTGTGGAGGAGCATGAC 62 214   R: TGGGGAGATCTGCACCTATTTGA     ###### Analysis of the effects of TGFBI gene mutations on protein function using different software programs. Type of mutation PolyPhen-2 software SIFT software MutationTaster software ------------------ --------------------- --------------- ------------------------- ------------- ------------ p.R124L 0.965 Detrimental 0.01 Detrimental Pathogenic p.R124C 1 Detrimental 0.01 Detrimental Pathogenic p.R124H 0.999 Detrimental 0.03 Detrimental Pathogenic All the software programs including PolyPhen-2, SIFT, and MutationTaster predicted that the three mutations (p.R124L, p.R124C, and p.R124H) of the *TGFBI* were detrimental and pathogenic. [^1]: Academic Editor: Cosimo Mazzotta
2024-01-05T01:26:58.646260
https://example.com/article/4020
2017 European Diving Championships – Women's 1 metre springboard Results Green denotes finalists References Women's 1 metre springboard Euro
2023-11-18T01:26:58.646260
https://example.com/article/7590
Roadmap This is the official project roadmap for the desktop and Android Java I2P releases only. Some related tasks for related resources such as the website and plugins are included. For details and discussion on specific items, search on trac or zzz.i2p. For contents of past releases, see the release notes. For other project goals, see the meeting notes. Note that we do not have a particular target for numbering a release as "1.0". We plan to continue numbering releases as 0.9.x for now. We do not maintain separate unstable and stable branches or releases. We have a single, stable release path. Our normal release cycle is 8-10 weeks. 0.9.24 Released: January 27, 2016 SAM v3.2 Require Java 7 NetDB Family Remove commons-logging Use SSU Extended options to request introduction Experimental Sybil analysis tool Unit test improvements Complete transition to Ed25519 signatures for most routers Tunnel Bloom filter fixes Bug fixes, translation updates, geoip updates 0.9.25 Released: March 22, 2016 SAM v3.3 Sybil tool enhancements QR codes and identicons Crypto speedups Router family configuration UI Custom icons for non-webapp plugins Pure Java key pair generation Bug fixes, translation updates, geoip updates 0.9.26 Released: June 7, 2016 New subscription protocol, addressbook support (proposal 112) Wrapper 3.5.29 GMP 6.0 (Debian/Ubuntu packages, new installs) Certificate revocations in the news feed Debian/Ubuntu/Tails package improvements Bug fixes, translation updates, geoip updates 0.9.27 Released: October 17, 2016 SSU IPv6 peer testing (proposal 126) Enable tray icon on Windows Add outproxy plugin support in SOCKS Hidden mode improvements SSU peer test fixes Initial work on NTCP2 Initial work on New DH GMP 6.0 (In-net updates) 0.9.28 Released: December 12, 2016 IPv6 improvements Increase IPv6 MTU (proposal 127) Blocklist enhancements (proposal 129) Sybil tool enhancements Bundled software updates: Jetty, JRobin, Tomcat, Wrapper, Zxing Fixes for Java 9 Improved self-signed certificates Bug fixes, translation updates, geoip updates 0.9.29 Released: February 27, 2017 More fixes for Java 9 NTP hardening and IPv6 support Same-origin referer pass through BOB database refactor Preliminary Docker support Translated man pages I2PBote release 0.4.5 stats.i2p accepts authentication strings (proposal #112) Streaming test harness Bug fixes, translation updates, geoip updates 0.9.30 Released: May 3, 2017 Hidden service server sigtype migration (publish dual LS) Tomcat 8 / Jetty 9.2 Stretch/Zesty support i2ptunnel authentication page improvements and fixes Introducer expiration (proposal #133) I2PBote release 0.4.6 i2psnark-rpc plugin Bug fixes, translation updates, geoip updates 0.9.31 Released: August 7, 2017 Console redesign phase 1 ("refresh") (ticket #738) Move /peers HTML code to console, remove from Android i2psnark ratings and comments Launch I2P Summer of Dev 2 Bug fixes, translation updates, geoip updates 0.9.32 Released: November 7, 2017 Ignore hostnames in router infos (proposal #141) UI fixes Bug fixes, translation updates, geoip updates 0.9.33 Target release date: Late January 2018 Note: To be updated, not realistic EdDSA updates ElGamal speedups Fix and enable linux tray app Private test net setup improvements Progress on proposal #123 (NTCP2) Progress on proposal #111 (LS2 with multi-destination support) Mac OS X installer, dock, tray enhancements (partial) Review ElGamal website docs Initial research on ElGamal replacement ("new crypto") New CSS for website front page Capacity improvements: discussions and research Create proposal and research multipath and path-awareness via I2CP Tahoe site Android gather user feedback Android UI enhancements Android GMP 6 and 64-bit jbigi Android router service as a library Android logging improvements Android wakelock fix Unit test improvements GMP 6.1.1 (ticket #1869), possibly partial New CSS for website inner pages Android tunnel settings Setup wizard Continue research on ElGamal replacement ("new crypto") Further work on pluggable transports: obfs4 as a plugin Bug fixes, translation updates, geoip updates 0.9.34-0.9.35 (April and June 2018) Note: To be updated, not realistic New crypto (ElGamal replacement) further progress NTCP2 including new DH, AEAD (proposal #123) LS2 with multi-destination support (proposal #111) Continue research on New netdb Full support for massively popular hidden services Initial work on new naming system, make sense of alternatives, kbuckets
2024-06-22T01:26:58.646260
https://example.com/article/9836
/** * Copyright (c) Microsoft Corporation. All rights reserved. * Licensed under the MIT License. See License.txt in the project root for * license information. * * Code generated by Microsoft (R) AutoRest Code Generator. */ package com.microsoft.azure.management.servicebus.v2017_04_01.implementation; import retrofit2.Retrofit; import com.google.common.reflect.TypeToken; import com.microsoft.azure.AzureServiceFuture; import com.microsoft.azure.ListOperationCallback; import com.microsoft.azure.management.servicebus.v2017_04_01.ErrorResponseException; import com.microsoft.azure.Page; import com.microsoft.azure.PagedList; import com.microsoft.rest.ServiceCallback; import com.microsoft.rest.ServiceFuture; import com.microsoft.rest.ServiceResponse; import com.microsoft.rest.Validator; import java.io.IOException; import java.util.List; import okhttp3.ResponseBody; import retrofit2.http.Body; import retrofit2.http.GET; import retrofit2.http.Header; import retrofit2.http.Headers; import retrofit2.http.HTTP; import retrofit2.http.Path; import retrofit2.http.PUT; import retrofit2.http.Query; import retrofit2.http.Url; import retrofit2.Response; import rx.functions.Func1; import rx.Observable; /** * An instance of this class provides access to all the operations defined * in Subscriptions. */ public class SubscriptionsInner { /** The Retrofit service to perform REST calls. */ private SubscriptionsService service; /** The service client containing this operation class. */ private ServiceBusManagementClientImpl client; /** * Initializes an instance of SubscriptionsInner. * * @param retrofit the Retrofit instance built from a Retrofit Builder. * @param client the instance of the service client containing this operation class. */ public SubscriptionsInner(Retrofit retrofit, ServiceBusManagementClientImpl client) { this.service = retrofit.create(SubscriptionsService.class); this.client = client; } /** * The interface defining all the services for Subscriptions to be * used by Retrofit to perform actually REST calls. */ interface SubscriptionsService { @Headers({ "Content-Type: application/json; charset=utf-8", "x-ms-logging-context: com.microsoft.azure.management.servicebus.v2017_04_01.Subscriptions listByTopic" }) @GET("subscriptions/{subscriptionId}/resourceGroups/{resourceGroupName}/providers/Microsoft.ServiceBus/namespaces/{namespaceName}/topics/{topicName}/subscriptions") Observable<Response<ResponseBody>> listByTopic(@Path("resourceGroupName") String resourceGroupName, @Path("namespaceName") String namespaceName, @Path("topicName") String topicName, @Path("subscriptionId") String subscriptionId, @Query("api-version") String apiVersion, @Query("$skip") Integer skip, @Query("$top") Integer top, @Header("accept-language") String acceptLanguage, @Header("User-Agent") String userAgent); @Headers({ "Content-Type: application/json; charset=utf-8", "x-ms-logging-context: com.microsoft.azure.management.servicebus.v2017_04_01.Subscriptions createOrUpdate" }) @PUT("subscriptions/{subscriptionId}/resourceGroups/{resourceGroupName}/providers/Microsoft.ServiceBus/namespaces/{namespaceName}/topics/{topicName}/subscriptions/{subscriptionName}") Observable<Response<ResponseBody>> createOrUpdate(@Path("resourceGroupName") String resourceGroupName, @Path("namespaceName") String namespaceName, @Path("topicName") String topicName, @Path("subscriptionName") String subscriptionName, @Path("subscriptionId") String subscriptionId, @Body SBSubscriptionInner parameters, @Query("api-version") String apiVersion, @Header("accept-language") String acceptLanguage, @Header("User-Agent") String userAgent); @Headers({ "Content-Type: application/json; charset=utf-8", "x-ms-logging-context: com.microsoft.azure.management.servicebus.v2017_04_01.Subscriptions delete" }) @HTTP(path = "subscriptions/{subscriptionId}/resourceGroups/{resourceGroupName}/providers/Microsoft.ServiceBus/namespaces/{namespaceName}/topics/{topicName}/subscriptions/{subscriptionName}", method = "DELETE", hasBody = true) Observable<Response<ResponseBody>> delete(@Path("resourceGroupName") String resourceGroupName, @Path("namespaceName") String namespaceName, @Path("topicName") String topicName, @Path("subscriptionName") String subscriptionName, @Path("subscriptionId") String subscriptionId, @Query("api-version") String apiVersion, @Header("accept-language") String acceptLanguage, @Header("User-Agent") String userAgent); @Headers({ "Content-Type: application/json; charset=utf-8", "x-ms-logging-context: com.microsoft.azure.management.servicebus.v2017_04_01.Subscriptions get" }) @GET("subscriptions/{subscriptionId}/resourceGroups/{resourceGroupName}/providers/Microsoft.ServiceBus/namespaces/{namespaceName}/topics/{topicName}/subscriptions/{subscriptionName}") Observable<Response<ResponseBody>> get(@Path("resourceGroupName") String resourceGroupName, @Path("namespaceName") String namespaceName, @Path("topicName") String topicName, @Path("subscriptionName") String subscriptionName, @Path("subscriptionId") String subscriptionId, @Query("api-version") String apiVersion, @Header("accept-language") String acceptLanguage, @Header("User-Agent") String userAgent); @Headers({ "Content-Type: application/json; charset=utf-8", "x-ms-logging-context: com.microsoft.azure.management.servicebus.v2017_04_01.Subscriptions listByTopicNext" }) @GET Observable<Response<ResponseBody>> listByTopicNext(@Url String nextUrl, @Header("accept-language") String acceptLanguage, @Header("User-Agent") String userAgent); } /** * List all the subscriptions under a specified topic. * * @param resourceGroupName Name of the Resource group within the Azure subscription. * @param namespaceName The namespace name * @param topicName The topic name. * @throws IllegalArgumentException thrown if parameters fail the validation * @throws ErrorResponseException thrown if the request is rejected by server * @throws RuntimeException all other wrapped checked exceptions if the request fails to be sent * @return the PagedList&lt;SBSubscriptionInner&gt; object if successful. */ public PagedList<SBSubscriptionInner> listByTopic(final String resourceGroupName, final String namespaceName, final String topicName) { ServiceResponse<Page<SBSubscriptionInner>> response = listByTopicSinglePageAsync(resourceGroupName, namespaceName, topicName).toBlocking().single(); return new PagedList<SBSubscriptionInner>(response.body()) { @Override public Page<SBSubscriptionInner> nextPage(String nextPageLink) { return listByTopicNextSinglePageAsync(nextPageLink).toBlocking().single().body(); } }; } /** * List all the subscriptions under a specified topic. * * @param resourceGroupName Name of the Resource group within the Azure subscription. * @param namespaceName The namespace name * @param topicName The topic name. * @param serviceCallback the async ServiceCallback to handle successful and failed responses. * @throws IllegalArgumentException thrown if parameters fail the validation * @return the {@link ServiceFuture} object */ public ServiceFuture<List<SBSubscriptionInner>> listByTopicAsync(final String resourceGroupName, final String namespaceName, final String topicName, final ListOperationCallback<SBSubscriptionInner> serviceCallback) { return AzureServiceFuture.fromPageResponse( listByTopicSinglePageAsync(resourceGroupName, namespaceName, topicName), new Func1<String, Observable<ServiceResponse<Page<SBSubscriptionInner>>>>() { @Override public Observable<ServiceResponse<Page<SBSubscriptionInner>>> call(String nextPageLink) { return listByTopicNextSinglePageAsync(nextPageLink); } }, serviceCallback); } /** * List all the subscriptions under a specified topic. * * @param resourceGroupName Name of the Resource group within the Azure subscription. * @param namespaceName The namespace name * @param topicName The topic name. * @throws IllegalArgumentException thrown if parameters fail the validation * @return the observable to the PagedList&lt;SBSubscriptionInner&gt; object */ public Observable<Page<SBSubscriptionInner>> listByTopicAsync(final String resourceGroupName, final String namespaceName, final String topicName) { return listByTopicWithServiceResponseAsync(resourceGroupName, namespaceName, topicName) .map(new Func1<ServiceResponse<Page<SBSubscriptionInner>>, Page<SBSubscriptionInner>>() { @Override public Page<SBSubscriptionInner> call(ServiceResponse<Page<SBSubscriptionInner>> response) { return response.body(); } }); } /** * List all the subscriptions under a specified topic. * * @param resourceGroupName Name of the Resource group within the Azure subscription. * @param namespaceName The namespace name * @param topicName The topic name. * @throws IllegalArgumentException thrown if parameters fail the validation * @return the observable to the PagedList&lt;SBSubscriptionInner&gt; object */ public Observable<ServiceResponse<Page<SBSubscriptionInner>>> listByTopicWithServiceResponseAsync(final String resourceGroupName, final String namespaceName, final String topicName) { return listByTopicSinglePageAsync(resourceGroupName, namespaceName, topicName) .concatMap(new Func1<ServiceResponse<Page<SBSubscriptionInner>>, Observable<ServiceResponse<Page<SBSubscriptionInner>>>>() { @Override public Observable<ServiceResponse<Page<SBSubscriptionInner>>> call(ServiceResponse<Page<SBSubscriptionInner>> page) { String nextPageLink = page.body().nextPageLink(); if (nextPageLink == null) { return Observable.just(page); } return Observable.just(page).concatWith(listByTopicNextWithServiceResponseAsync(nextPageLink)); } }); } /** * List all the subscriptions under a specified topic. * * @param resourceGroupName Name of the Resource group within the Azure subscription. * @param namespaceName The namespace name * @param topicName The topic name. * @throws IllegalArgumentException thrown if parameters fail the validation * @return the PagedList&lt;SBSubscriptionInner&gt; object wrapped in {@link ServiceResponse} if successful. */ public Observable<ServiceResponse<Page<SBSubscriptionInner>>> listByTopicSinglePageAsync(final String resourceGroupName, final String namespaceName, final String topicName) { if (resourceGroupName == null) { throw new IllegalArgumentException("Parameter resourceGroupName is required and cannot be null."); } if (namespaceName == null) { throw new IllegalArgumentException("Parameter namespaceName is required and cannot be null."); } if (topicName == null) { throw new IllegalArgumentException("Parameter topicName is required and cannot be null."); } if (this.client.subscriptionId() == null) { throw new IllegalArgumentException("Parameter this.client.subscriptionId() is required and cannot be null."); } if (this.client.apiVersion() == null) { throw new IllegalArgumentException("Parameter this.client.apiVersion() is required and cannot be null."); } final Integer skip = null; final Integer top = null; return service.listByTopic(resourceGroupName, namespaceName, topicName, this.client.subscriptionId(), this.client.apiVersion(), skip, top, this.client.acceptLanguage(), this.client.userAgent()) .flatMap(new Func1<Response<ResponseBody>, Observable<ServiceResponse<Page<SBSubscriptionInner>>>>() { @Override public Observable<ServiceResponse<Page<SBSubscriptionInner>>> call(Response<ResponseBody> response) { try { ServiceResponse<PageImpl<SBSubscriptionInner>> result = listByTopicDelegate(response); return Observable.just(new ServiceResponse<Page<SBSubscriptionInner>>(result.body(), result.response())); } catch (Throwable t) { return Observable.error(t); } } }); } /** * List all the subscriptions under a specified topic. * * @param resourceGroupName Name of the Resource group within the Azure subscription. * @param namespaceName The namespace name * @param topicName The topic name. * @param skip Skip is only used if a previous operation returned a partial result. If a previous response contains a nextLink element, the value of the nextLink element will include a skip parameter that specifies a starting point to use for subsequent calls. * @param top May be used to limit the number of results to the most recent N usageDetails. * @throws IllegalArgumentException thrown if parameters fail the validation * @throws ErrorResponseException thrown if the request is rejected by server * @throws RuntimeException all other wrapped checked exceptions if the request fails to be sent * @return the PagedList&lt;SBSubscriptionInner&gt; object if successful. */ public PagedList<SBSubscriptionInner> listByTopic(final String resourceGroupName, final String namespaceName, final String topicName, final Integer skip, final Integer top) { ServiceResponse<Page<SBSubscriptionInner>> response = listByTopicSinglePageAsync(resourceGroupName, namespaceName, topicName, skip, top).toBlocking().single(); return new PagedList<SBSubscriptionInner>(response.body()) { @Override public Page<SBSubscriptionInner> nextPage(String nextPageLink) { return listByTopicNextSinglePageAsync(nextPageLink).toBlocking().single().body(); } }; } /** * List all the subscriptions under a specified topic. * * @param resourceGroupName Name of the Resource group within the Azure subscription. * @param namespaceName The namespace name * @param topicName The topic name. * @param skip Skip is only used if a previous operation returned a partial result. If a previous response contains a nextLink element, the value of the nextLink element will include a skip parameter that specifies a starting point to use for subsequent calls. * @param top May be used to limit the number of results to the most recent N usageDetails. * @param serviceCallback the async ServiceCallback to handle successful and failed responses. * @throws IllegalArgumentException thrown if parameters fail the validation * @return the {@link ServiceFuture} object */ public ServiceFuture<List<SBSubscriptionInner>> listByTopicAsync(final String resourceGroupName, final String namespaceName, final String topicName, final Integer skip, final Integer top, final ListOperationCallback<SBSubscriptionInner> serviceCallback) { return AzureServiceFuture.fromPageResponse( listByTopicSinglePageAsync(resourceGroupName, namespaceName, topicName, skip, top), new Func1<String, Observable<ServiceResponse<Page<SBSubscriptionInner>>>>() { @Override public Observable<ServiceResponse<Page<SBSubscriptionInner>>> call(String nextPageLink) { return listByTopicNextSinglePageAsync(nextPageLink); } }, serviceCallback); } /** * List all the subscriptions under a specified topic. * * @param resourceGroupName Name of the Resource group within the Azure subscription. * @param namespaceName The namespace name * @param topicName The topic name. * @param skip Skip is only used if a previous operation returned a partial result. If a previous response contains a nextLink element, the value of the nextLink element will include a skip parameter that specifies a starting point to use for subsequent calls. * @param top May be used to limit the number of results to the most recent N usageDetails. * @throws IllegalArgumentException thrown if parameters fail the validation * @return the observable to the PagedList&lt;SBSubscriptionInner&gt; object */ public Observable<Page<SBSubscriptionInner>> listByTopicAsync(final String resourceGroupName, final String namespaceName, final String topicName, final Integer skip, final Integer top) { return listByTopicWithServiceResponseAsync(resourceGroupName, namespaceName, topicName, skip, top) .map(new Func1<ServiceResponse<Page<SBSubscriptionInner>>, Page<SBSubscriptionInner>>() { @Override public Page<SBSubscriptionInner> call(ServiceResponse<Page<SBSubscriptionInner>> response) { return response.body(); } }); } /** * List all the subscriptions under a specified topic. * * @param resourceGroupName Name of the Resource group within the Azure subscription. * @param namespaceName The namespace name * @param topicName The topic name. * @param skip Skip is only used if a previous operation returned a partial result. If a previous response contains a nextLink element, the value of the nextLink element will include a skip parameter that specifies a starting point to use for subsequent calls. * @param top May be used to limit the number of results to the most recent N usageDetails. * @throws IllegalArgumentException thrown if parameters fail the validation * @return the observable to the PagedList&lt;SBSubscriptionInner&gt; object */ public Observable<ServiceResponse<Page<SBSubscriptionInner>>> listByTopicWithServiceResponseAsync(final String resourceGroupName, final String namespaceName, final String topicName, final Integer skip, final Integer top) { return listByTopicSinglePageAsync(resourceGroupName, namespaceName, topicName, skip, top) .concatMap(new Func1<ServiceResponse<Page<SBSubscriptionInner>>, Observable<ServiceResponse<Page<SBSubscriptionInner>>>>() { @Override public Observable<ServiceResponse<Page<SBSubscriptionInner>>> call(ServiceResponse<Page<SBSubscriptionInner>> page) { String nextPageLink = page.body().nextPageLink(); if (nextPageLink == null) { return Observable.just(page); } return Observable.just(page).concatWith(listByTopicNextWithServiceResponseAsync(nextPageLink)); } }); } /** * List all the subscriptions under a specified topic. * ServiceResponse<PageImpl<SBSubscriptionInner>> * @param resourceGroupName Name of the Resource group within the Azure subscription. ServiceResponse<PageImpl<SBSubscriptionInner>> * @param namespaceName The namespace name ServiceResponse<PageImpl<SBSubscriptionInner>> * @param topicName The topic name. ServiceResponse<PageImpl<SBSubscriptionInner>> * @param skip Skip is only used if a previous operation returned a partial result. If a previous response contains a nextLink element, the value of the nextLink element will include a skip parameter that specifies a starting point to use for subsequent calls. ServiceResponse<PageImpl<SBSubscriptionInner>> * @param top May be used to limit the number of results to the most recent N usageDetails. * @throws IllegalArgumentException thrown if parameters fail the validation * @return the PagedList&lt;SBSubscriptionInner&gt; object wrapped in {@link ServiceResponse} if successful. */ public Observable<ServiceResponse<Page<SBSubscriptionInner>>> listByTopicSinglePageAsync(final String resourceGroupName, final String namespaceName, final String topicName, final Integer skip, final Integer top) { if (resourceGroupName == null) { throw new IllegalArgumentException("Parameter resourceGroupName is required and cannot be null."); } if (namespaceName == null) { throw new IllegalArgumentException("Parameter namespaceName is required and cannot be null."); } if (topicName == null) { throw new IllegalArgumentException("Parameter topicName is required and cannot be null."); } if (this.client.subscriptionId() == null) { throw new IllegalArgumentException("Parameter this.client.subscriptionId() is required and cannot be null."); } if (this.client.apiVersion() == null) { throw new IllegalArgumentException("Parameter this.client.apiVersion() is required and cannot be null."); } return service.listByTopic(resourceGroupName, namespaceName, topicName, this.client.subscriptionId(), this.client.apiVersion(), skip, top, this.client.acceptLanguage(), this.client.userAgent()) .flatMap(new Func1<Response<ResponseBody>, Observable<ServiceResponse<Page<SBSubscriptionInner>>>>() { @Override public Observable<ServiceResponse<Page<SBSubscriptionInner>>> call(Response<ResponseBody> response) { try { ServiceResponse<PageImpl<SBSubscriptionInner>> result = listByTopicDelegate(response); return Observable.just(new ServiceResponse<Page<SBSubscriptionInner>>(result.body(), result.response())); } catch (Throwable t) { return Observable.error(t); } } }); } private ServiceResponse<PageImpl<SBSubscriptionInner>> listByTopicDelegate(Response<ResponseBody> response) throws ErrorResponseException, IOException, IllegalArgumentException { return this.client.restClient().responseBuilderFactory().<PageImpl<SBSubscriptionInner>, ErrorResponseException>newInstance(this.client.serializerAdapter()) .register(200, new TypeToken<PageImpl<SBSubscriptionInner>>() { }.getType()) .registerError(ErrorResponseException.class) .build(response); } /** * Creates a topic subscription. * * @param resourceGroupName Name of the Resource group within the Azure subscription. * @param namespaceName The namespace name * @param topicName The topic name. * @param subscriptionName The subscription name. * @param parameters Parameters supplied to create a subscription resource. * @throws IllegalArgumentException thrown if parameters fail the validation * @throws ErrorResponseException thrown if the request is rejected by server * @throws RuntimeException all other wrapped checked exceptions if the request fails to be sent * @return the SBSubscriptionInner object if successful. */ public SBSubscriptionInner createOrUpdate(String resourceGroupName, String namespaceName, String topicName, String subscriptionName, SBSubscriptionInner parameters) { return createOrUpdateWithServiceResponseAsync(resourceGroupName, namespaceName, topicName, subscriptionName, parameters).toBlocking().single().body(); } /** * Creates a topic subscription. * * @param resourceGroupName Name of the Resource group within the Azure subscription. * @param namespaceName The namespace name * @param topicName The topic name. * @param subscriptionName The subscription name. * @param parameters Parameters supplied to create a subscription resource. * @param serviceCallback the async ServiceCallback to handle successful and failed responses. * @throws IllegalArgumentException thrown if parameters fail the validation * @return the {@link ServiceFuture} object */ public ServiceFuture<SBSubscriptionInner> createOrUpdateAsync(String resourceGroupName, String namespaceName, String topicName, String subscriptionName, SBSubscriptionInner parameters, final ServiceCallback<SBSubscriptionInner> serviceCallback) { return ServiceFuture.fromResponse(createOrUpdateWithServiceResponseAsync(resourceGroupName, namespaceName, topicName, subscriptionName, parameters), serviceCallback); } /** * Creates a topic subscription. * * @param resourceGroupName Name of the Resource group within the Azure subscription. * @param namespaceName The namespace name * @param topicName The topic name. * @param subscriptionName The subscription name. * @param parameters Parameters supplied to create a subscription resource. * @throws IllegalArgumentException thrown if parameters fail the validation * @return the observable to the SBSubscriptionInner object */ public Observable<SBSubscriptionInner> createOrUpdateAsync(String resourceGroupName, String namespaceName, String topicName, String subscriptionName, SBSubscriptionInner parameters) { return createOrUpdateWithServiceResponseAsync(resourceGroupName, namespaceName, topicName, subscriptionName, parameters).map(new Func1<ServiceResponse<SBSubscriptionInner>, SBSubscriptionInner>() { @Override public SBSubscriptionInner call(ServiceResponse<SBSubscriptionInner> response) { return response.body(); } }); } /** * Creates a topic subscription. * * @param resourceGroupName Name of the Resource group within the Azure subscription. * @param namespaceName The namespace name * @param topicName The topic name. * @param subscriptionName The subscription name. * @param parameters Parameters supplied to create a subscription resource. * @throws IllegalArgumentException thrown if parameters fail the validation * @return the observable to the SBSubscriptionInner object */ public Observable<ServiceResponse<SBSubscriptionInner>> createOrUpdateWithServiceResponseAsync(String resourceGroupName, String namespaceName, String topicName, String subscriptionName, SBSubscriptionInner parameters) { if (resourceGroupName == null) { throw new IllegalArgumentException("Parameter resourceGroupName is required and cannot be null."); } if (namespaceName == null) { throw new IllegalArgumentException("Parameter namespaceName is required and cannot be null."); } if (topicName == null) { throw new IllegalArgumentException("Parameter topicName is required and cannot be null."); } if (subscriptionName == null) { throw new IllegalArgumentException("Parameter subscriptionName is required and cannot be null."); } if (this.client.subscriptionId() == null) { throw new IllegalArgumentException("Parameter this.client.subscriptionId() is required and cannot be null."); } if (parameters == null) { throw new IllegalArgumentException("Parameter parameters is required and cannot be null."); } if (this.client.apiVersion() == null) { throw new IllegalArgumentException("Parameter this.client.apiVersion() is required and cannot be null."); } Validator.validate(parameters); return service.createOrUpdate(resourceGroupName, namespaceName, topicName, subscriptionName, this.client.subscriptionId(), parameters, this.client.apiVersion(), this.client.acceptLanguage(), this.client.userAgent()) .flatMap(new Func1<Response<ResponseBody>, Observable<ServiceResponse<SBSubscriptionInner>>>() { @Override public Observable<ServiceResponse<SBSubscriptionInner>> call(Response<ResponseBody> response) { try { ServiceResponse<SBSubscriptionInner> clientResponse = createOrUpdateDelegate(response); return Observable.just(clientResponse); } catch (Throwable t) { return Observable.error(t); } } }); } private ServiceResponse<SBSubscriptionInner> createOrUpdateDelegate(Response<ResponseBody> response) throws ErrorResponseException, IOException, IllegalArgumentException { return this.client.restClient().responseBuilderFactory().<SBSubscriptionInner, ErrorResponseException>newInstance(this.client.serializerAdapter()) .register(200, new TypeToken<SBSubscriptionInner>() { }.getType()) .registerError(ErrorResponseException.class) .build(response); } /** * Deletes a subscription from the specified topic. * * @param resourceGroupName Name of the Resource group within the Azure subscription. * @param namespaceName The namespace name * @param topicName The topic name. * @param subscriptionName The subscription name. * @throws IllegalArgumentException thrown if parameters fail the validation * @throws ErrorResponseException thrown if the request is rejected by server * @throws RuntimeException all other wrapped checked exceptions if the request fails to be sent */ public void delete(String resourceGroupName, String namespaceName, String topicName, String subscriptionName) { deleteWithServiceResponseAsync(resourceGroupName, namespaceName, topicName, subscriptionName).toBlocking().single().body(); } /** * Deletes a subscription from the specified topic. * * @param resourceGroupName Name of the Resource group within the Azure subscription. * @param namespaceName The namespace name * @param topicName The topic name. * @param subscriptionName The subscription name. * @param serviceCallback the async ServiceCallback to handle successful and failed responses. * @throws IllegalArgumentException thrown if parameters fail the validation * @return the {@link ServiceFuture} object */ public ServiceFuture<Void> deleteAsync(String resourceGroupName, String namespaceName, String topicName, String subscriptionName, final ServiceCallback<Void> serviceCallback) { return ServiceFuture.fromResponse(deleteWithServiceResponseAsync(resourceGroupName, namespaceName, topicName, subscriptionName), serviceCallback); } /** * Deletes a subscription from the specified topic. * * @param resourceGroupName Name of the Resource group within the Azure subscription. * @param namespaceName The namespace name * @param topicName The topic name. * @param subscriptionName The subscription name. * @throws IllegalArgumentException thrown if parameters fail the validation * @return the {@link ServiceResponse} object if successful. */ public Observable<Void> deleteAsync(String resourceGroupName, String namespaceName, String topicName, String subscriptionName) { return deleteWithServiceResponseAsync(resourceGroupName, namespaceName, topicName, subscriptionName).map(new Func1<ServiceResponse<Void>, Void>() { @Override public Void call(ServiceResponse<Void> response) { return response.body(); } }); } /** * Deletes a subscription from the specified topic. * * @param resourceGroupName Name of the Resource group within the Azure subscription. * @param namespaceName The namespace name * @param topicName The topic name. * @param subscriptionName The subscription name. * @throws IllegalArgumentException thrown if parameters fail the validation * @return the {@link ServiceResponse} object if successful. */ public Observable<ServiceResponse<Void>> deleteWithServiceResponseAsync(String resourceGroupName, String namespaceName, String topicName, String subscriptionName) { if (resourceGroupName == null) { throw new IllegalArgumentException("Parameter resourceGroupName is required and cannot be null."); } if (namespaceName == null) { throw new IllegalArgumentException("Parameter namespaceName is required and cannot be null."); } if (topicName == null) { throw new IllegalArgumentException("Parameter topicName is required and cannot be null."); } if (subscriptionName == null) { throw new IllegalArgumentException("Parameter subscriptionName is required and cannot be null."); } if (this.client.subscriptionId() == null) { throw new IllegalArgumentException("Parameter this.client.subscriptionId() is required and cannot be null."); } if (this.client.apiVersion() == null) { throw new IllegalArgumentException("Parameter this.client.apiVersion() is required and cannot be null."); } return service.delete(resourceGroupName, namespaceName, topicName, subscriptionName, this.client.subscriptionId(), this.client.apiVersion(), this.client.acceptLanguage(), this.client.userAgent()) .flatMap(new Func1<Response<ResponseBody>, Observable<ServiceResponse<Void>>>() { @Override public Observable<ServiceResponse<Void>> call(Response<ResponseBody> response) { try { ServiceResponse<Void> clientResponse = deleteDelegate(response); return Observable.just(clientResponse); } catch (Throwable t) { return Observable.error(t); } } }); } private ServiceResponse<Void> deleteDelegate(Response<ResponseBody> response) throws ErrorResponseException, IOException, IllegalArgumentException { return this.client.restClient().responseBuilderFactory().<Void, ErrorResponseException>newInstance(this.client.serializerAdapter()) .register(200, new TypeToken<Void>() { }.getType()) .register(204, new TypeToken<Void>() { }.getType()) .registerError(ErrorResponseException.class) .build(response); } /** * Returns a subscription description for the specified topic. * * @param resourceGroupName Name of the Resource group within the Azure subscription. * @param namespaceName The namespace name * @param topicName The topic name. * @param subscriptionName The subscription name. * @throws IllegalArgumentException thrown if parameters fail the validation * @throws ErrorResponseException thrown if the request is rejected by server * @throws RuntimeException all other wrapped checked exceptions if the request fails to be sent * @return the SBSubscriptionInner object if successful. */ public SBSubscriptionInner get(String resourceGroupName, String namespaceName, String topicName, String subscriptionName) { return getWithServiceResponseAsync(resourceGroupName, namespaceName, topicName, subscriptionName).toBlocking().single().body(); } /** * Returns a subscription description for the specified topic. * * @param resourceGroupName Name of the Resource group within the Azure subscription. * @param namespaceName The namespace name * @param topicName The topic name. * @param subscriptionName The subscription name. * @param serviceCallback the async ServiceCallback to handle successful and failed responses. * @throws IllegalArgumentException thrown if parameters fail the validation * @return the {@link ServiceFuture} object */ public ServiceFuture<SBSubscriptionInner> getAsync(String resourceGroupName, String namespaceName, String topicName, String subscriptionName, final ServiceCallback<SBSubscriptionInner> serviceCallback) { return ServiceFuture.fromResponse(getWithServiceResponseAsync(resourceGroupName, namespaceName, topicName, subscriptionName), serviceCallback); } /** * Returns a subscription description for the specified topic. * * @param resourceGroupName Name of the Resource group within the Azure subscription. * @param namespaceName The namespace name * @param topicName The topic name. * @param subscriptionName The subscription name. * @throws IllegalArgumentException thrown if parameters fail the validation * @return the observable to the SBSubscriptionInner object */ public Observable<SBSubscriptionInner> getAsync(String resourceGroupName, String namespaceName, String topicName, String subscriptionName) { return getWithServiceResponseAsync(resourceGroupName, namespaceName, topicName, subscriptionName).map(new Func1<ServiceResponse<SBSubscriptionInner>, SBSubscriptionInner>() { @Override public SBSubscriptionInner call(ServiceResponse<SBSubscriptionInner> response) { return response.body(); } }); } /** * Returns a subscription description for the specified topic. * * @param resourceGroupName Name of the Resource group within the Azure subscription. * @param namespaceName The namespace name * @param topicName The topic name. * @param subscriptionName The subscription name. * @throws IllegalArgumentException thrown if parameters fail the validation * @return the observable to the SBSubscriptionInner object */ public Observable<ServiceResponse<SBSubscriptionInner>> getWithServiceResponseAsync(String resourceGroupName, String namespaceName, String topicName, String subscriptionName) { if (resourceGroupName == null) { throw new IllegalArgumentException("Parameter resourceGroupName is required and cannot be null."); } if (namespaceName == null) { throw new IllegalArgumentException("Parameter namespaceName is required and cannot be null."); } if (topicName == null) { throw new IllegalArgumentException("Parameter topicName is required and cannot be null."); } if (subscriptionName == null) { throw new IllegalArgumentException("Parameter subscriptionName is required and cannot be null."); } if (this.client.subscriptionId() == null) { throw new IllegalArgumentException("Parameter this.client.subscriptionId() is required and cannot be null."); } if (this.client.apiVersion() == null) { throw new IllegalArgumentException("Parameter this.client.apiVersion() is required and cannot be null."); } return service.get(resourceGroupName, namespaceName, topicName, subscriptionName, this.client.subscriptionId(), this.client.apiVersion(), this.client.acceptLanguage(), this.client.userAgent()) .flatMap(new Func1<Response<ResponseBody>, Observable<ServiceResponse<SBSubscriptionInner>>>() { @Override public Observable<ServiceResponse<SBSubscriptionInner>> call(Response<ResponseBody> response) { try { ServiceResponse<SBSubscriptionInner> clientResponse = getDelegate(response); return Observable.just(clientResponse); } catch (Throwable t) { return Observable.error(t); } } }); } private ServiceResponse<SBSubscriptionInner> getDelegate(Response<ResponseBody> response) throws ErrorResponseException, IOException, IllegalArgumentException { return this.client.restClient().responseBuilderFactory().<SBSubscriptionInner, ErrorResponseException>newInstance(this.client.serializerAdapter()) .register(200, new TypeToken<SBSubscriptionInner>() { }.getType()) .registerError(ErrorResponseException.class) .build(response); } /** * List all the subscriptions under a specified topic. * * @param nextPageLink The NextLink from the previous successful call to List operation. * @throws IllegalArgumentException thrown if parameters fail the validation * @throws ErrorResponseException thrown if the request is rejected by server * @throws RuntimeException all other wrapped checked exceptions if the request fails to be sent * @return the PagedList&lt;SBSubscriptionInner&gt; object if successful. */ public PagedList<SBSubscriptionInner> listByTopicNext(final String nextPageLink) { ServiceResponse<Page<SBSubscriptionInner>> response = listByTopicNextSinglePageAsync(nextPageLink).toBlocking().single(); return new PagedList<SBSubscriptionInner>(response.body()) { @Override public Page<SBSubscriptionInner> nextPage(String nextPageLink) { return listByTopicNextSinglePageAsync(nextPageLink).toBlocking().single().body(); } }; } /** * List all the subscriptions under a specified topic. * * @param nextPageLink The NextLink from the previous successful call to List operation. * @param serviceFuture the ServiceFuture object tracking the Retrofit calls * @param serviceCallback the async ServiceCallback to handle successful and failed responses. * @throws IllegalArgumentException thrown if parameters fail the validation * @return the {@link ServiceFuture} object */ public ServiceFuture<List<SBSubscriptionInner>> listByTopicNextAsync(final String nextPageLink, final ServiceFuture<List<SBSubscriptionInner>> serviceFuture, final ListOperationCallback<SBSubscriptionInner> serviceCallback) { return AzureServiceFuture.fromPageResponse( listByTopicNextSinglePageAsync(nextPageLink), new Func1<String, Observable<ServiceResponse<Page<SBSubscriptionInner>>>>() { @Override public Observable<ServiceResponse<Page<SBSubscriptionInner>>> call(String nextPageLink) { return listByTopicNextSinglePageAsync(nextPageLink); } }, serviceCallback); } /** * List all the subscriptions under a specified topic. * * @param nextPageLink The NextLink from the previous successful call to List operation. * @throws IllegalArgumentException thrown if parameters fail the validation * @return the observable to the PagedList&lt;SBSubscriptionInner&gt; object */ public Observable<Page<SBSubscriptionInner>> listByTopicNextAsync(final String nextPageLink) { return listByTopicNextWithServiceResponseAsync(nextPageLink) .map(new Func1<ServiceResponse<Page<SBSubscriptionInner>>, Page<SBSubscriptionInner>>() { @Override public Page<SBSubscriptionInner> call(ServiceResponse<Page<SBSubscriptionInner>> response) { return response.body(); } }); } /** * List all the subscriptions under a specified topic. * * @param nextPageLink The NextLink from the previous successful call to List operation. * @throws IllegalArgumentException thrown if parameters fail the validation * @return the observable to the PagedList&lt;SBSubscriptionInner&gt; object */ public Observable<ServiceResponse<Page<SBSubscriptionInner>>> listByTopicNextWithServiceResponseAsync(final String nextPageLink) { return listByTopicNextSinglePageAsync(nextPageLink) .concatMap(new Func1<ServiceResponse<Page<SBSubscriptionInner>>, Observable<ServiceResponse<Page<SBSubscriptionInner>>>>() { @Override public Observable<ServiceResponse<Page<SBSubscriptionInner>>> call(ServiceResponse<Page<SBSubscriptionInner>> page) { String nextPageLink = page.body().nextPageLink(); if (nextPageLink == null) { return Observable.just(page); } return Observable.just(page).concatWith(listByTopicNextWithServiceResponseAsync(nextPageLink)); } }); } /** * List all the subscriptions under a specified topic. * ServiceResponse<PageImpl<SBSubscriptionInner>> * @param nextPageLink The NextLink from the previous successful call to List operation. * @throws IllegalArgumentException thrown if parameters fail the validation * @return the PagedList&lt;SBSubscriptionInner&gt; object wrapped in {@link ServiceResponse} if successful. */ public Observable<ServiceResponse<Page<SBSubscriptionInner>>> listByTopicNextSinglePageAsync(final String nextPageLink) { if (nextPageLink == null) { throw new IllegalArgumentException("Parameter nextPageLink is required and cannot be null."); } String nextUrl = String.format("%s", nextPageLink); return service.listByTopicNext(nextUrl, this.client.acceptLanguage(), this.client.userAgent()) .flatMap(new Func1<Response<ResponseBody>, Observable<ServiceResponse<Page<SBSubscriptionInner>>>>() { @Override public Observable<ServiceResponse<Page<SBSubscriptionInner>>> call(Response<ResponseBody> response) { try { ServiceResponse<PageImpl<SBSubscriptionInner>> result = listByTopicNextDelegate(response); return Observable.just(new ServiceResponse<Page<SBSubscriptionInner>>(result.body(), result.response())); } catch (Throwable t) { return Observable.error(t); } } }); } private ServiceResponse<PageImpl<SBSubscriptionInner>> listByTopicNextDelegate(Response<ResponseBody> response) throws ErrorResponseException, IOException, IllegalArgumentException { return this.client.restClient().responseBuilderFactory().<PageImpl<SBSubscriptionInner>, ErrorResponseException>newInstance(this.client.serializerAdapter()) .register(200, new TypeToken<PageImpl<SBSubscriptionInner>>() { }.getType()) .registerError(ErrorResponseException.class) .build(response); } }
2024-05-04T01:26:58.646260
https://example.com/article/5923
PIZZERIA PIADINA Our Story Special Designated Areas (SDAs) in Malta https://www.oystermalta.com/ - Special Designated Areas (SDAs) in Malta are luxury complexes and lifestyle developments situated in prime areas which can be acquired without the need for an Acquisition of Immovable Property (AIP) permit.
2023-11-06T01:26:58.646260
https://example.com/article/4287
I think they preferred doing a deal now rather than having the questions all year and dealing with all that BS. I don't think it's a terrible deal for them, but time will tell. All depends if Lamb pans out to the expectation of a year ago, when he was projected pretty high. Martin helps with the scoring for this season. Essentially Lamb, 2 x 1st round picks & 1 x 2nd round pick for Harden (Martin is a rental player for OKC and they dumped some backup contracts). Assuming Houston extends him for max money, that's a lot to giveup for Harden! He was awful in the playoffs last year and seems to prefer being a super 6th man to being 'the man' with all the pressure on him. Huge gamble for Houston and a great haul for OKC! Essentially Lamb, 2 x 1st round picks & 1 x 2nd round pick for Harden (Martin is a rental player for OKC and they dumped some backup contracts). Assuming Houston extends him for max money, that's a lot to giveup for Harden! He was awful in the playoffs last year and seems to prefer being a super 6th man to being 'the man' with all the pressure on him. Huge gamble for Houston and a great haul for OKC! Essentially Lamb, 2 x 1st round picks & 1 x 2nd round pick for Harden (Martin is a rental player for OKC and they dumped some backup contracts). Assuming Houston extends him for max money, that's a lot to giveup for Harden! He was awful in the playoffs last year and seems to prefer being a super 6th man to being 'the man' with all the pressure on him. Huge gamble for Houston and a great haul for OKC! Harden was awful in the finals. He was sub par in the conference semifinals, too. Otherwise Harden played like the true all star he is in the first round and in the conference finals where he shot 60% from 3 point range. A few years from now this will be considered to be a lopsided deal of epic proportion right up there with the Garnett trade to the Celtics and Vince Carter to the Nets. The team that gets the most talented player in these deals almost always comes out on top. Wasn't James harden a restricted free agent?! wouldn't have been better for OKC to wait it out until the end of the season where they were in a better position to win the championship?! I mean its a good deal for the future for OKC but they could have let this played out longer. On the other hand I don't blame them, kudos for shipping a guy out who wanted alot more then he was worth. You gotta commend OKC for their balls, and skills. Great trade for the future, Harden was a good 6th man and had a great personality. But, with Durant, Westbrook and Ibaka getting big money deals, he was set to get one too. And that would cripple the rest of their team in the future, now they get a chance to bring other good young scorers off the bench, get draft picks and build for the future. Harden wasn't an integral part of their team, and could easily (not fully, but still pretty well) be replaced by both Lamb and KMart this year, and their draft picks to come will be insane considering they are a championship contender. It's a great move for them. How many contending teams can have the luxury of having multiple top draft picks TO COME? Martin can be resigned with Bird Rights at likely nearly half the cost of Harden - all the while Lamb is developing. They have added some nice assets as well in the picks. Presti is incredible. Houston essentially traded Martin, Lamb, Lowry, Lakers 1st round pick, Bobcats 2nd round pick for Harden, Cook, Aldrich, and Hayward. I dunno...... Harden is a good player but that is a lot of assets to give up. I think that many people are really under valuing the chemistry Durant, Westbrook, and Harden have (or "had" I should say). They were a championship caliber team. They played together their whole careers. They know each other's game. Not only that, but they matched up well with the Lakers. I still thought they were the best team in the West, even with the Lakers on the block. Why not wait the year? I dont think this Thunder team will be better than last years. Sure, Harden had a tough finals, but people forget he was one of the main reasons they beat San Antonio. I dont know if I give up a guy I know can play for Lamb and a couple of late lottery picks (I would guess K-Mart a rental). This trade is more about winning in a few years (when the Lakers, Celtics, Spurs, and Heat are all older). In that aspect, they set themselves up nicely, but I do not know if I would ruin the chemistry of a championship team now (I mean these guys, if they stuck together, would have been in the championship conversation for the next 5 years at least), for a better shot down the road. I think that many people are really under valuing the chemistry Durant, Westbrook, and Harden have (or "had" I should say). They were a championship caliber team. They played together their whole careers. They know each other's game. Not only that, but they matched up well with the Lakers. I still thought they were the best team in the West, even with the Lakers on the block. Why not wait the year? I dont think this Thunder team will be better than last years. Sure, Harden had a tough finals, but people forget he was one of the main reasons they beat San Antonio. I dont know if I give up a guy I know can play for Lamb and a couple of late lottery picks (I would guess K-Mart a rental). This trade is more about winning in a few years (when the Lakers, Celtics, Spurs, and Heat are all older). In that aspect, they set themselves up nicely, but I do not know if I would ruin the chemistry of a championship team now (I mean these guys, if they stuck together, would have been in the championship conversation for the next 5 years at least), for a better shot down the road. Absolutely thats a big part of this. This is Presti's MO. Patience and long term sustainability. And its not like Presti sacrificied any chance of winning a championship along the way. Martin isn't as good as Harden, but he's not exactly a nobody, and I could see him being better suited as a 6th man then a starter. Plus when you look at how signing Harden at anything less than a discount would add some financial difficulties for the team, while at the same time adding Lamb + picks offers some cheap long term assets. Presti made OKCs road to a championship harder this year (in a year that was going to be hard as it was) for an opportunity to make it easier to win one (or multiples) in the future. This is the impressive thing about Presti and OKC. He can not only recognize talent and consistently find value for that talent, but he recognizes his own talent (drafting). He plays to his strengths that also happen to fit the need of his market (small market team). Absolutely thats a big part of this. This is Presti's MO. Patience and long term sustainability. And its not like Presti sacrificied any chance of winning a championship along the way. Martin isn't as good as Harden, but he's not exactly a nobody, and I could see him being better suited as a 6th man then a starter. Plus when you look at how signing Harden at anything less than a discount would add some financial difficulties for the team, while at the same time adding Lamb + picks offers some cheap long term assets. Presti made OKCs road to a championship harder this year (in a year that was going to be hard as it was) for an opportunity to make it easier to win one (or multiples) in the future. This is the impressive thing about Presti and OKC. He can not only recognize talent and consistently find value for that talent, but he recognizes his own talent (drafting). He plays to his strengths that also happen to fit the need of his market (small market team). I just think that they had something very amazing (and rare) with Harden, Durant, and Westrbook. How often do you have three amazing scorers on one team without egos clashing? I would have kept those three together as long as possible. I understand that they were in a tough position (being a small market team, having to give out 3 max contracts), but when you have a young championship calibre core, why not do your best to keep them together? Marc Stein (along with various other analysts and players) claim that this move is going to "shake up the locker room".
2023-10-09T01:26:58.646260
https://example.com/article/6031
-The Bible certainly is one of, if not -- I mean, it is the book. -Let's pray together, may we? -Yes. -I believe in God. I am Christian. I'm a Protestant. I'm very proud of it -- Presbyterian, to be exact. I'm Presbyterian. Boy, that's down the middle of the road, folks, in all fairness. I mean, Seventh Day Adventists I don't know about. I have great relationship with God. I have great relationship with the evangelicals. And I go to church a lot. Always on Christmas, always on Easter, always when there's a major occasion, and during the Sundays. I'm a Sunday church person. I like to do the right thing where I don't have to actually ask for forgiveness. When we go in church and when I drink my little wine, which is about the only wine I drink, and have my little cracker, I guess that's a form of asking for forgiveness. And I do that as often as possible, because I feel cleansed. We were having fun when I said, "I drink the wine. I eat the cracker." If I do something wrong, I think I just try and make it right. I don't bring God into that picture. -My wife and I pray for you. -Thank you. Well, I need it probably more than anybody in this room. You can stay if you want to, because you need the prayer more than I do, I think. I want to just pray for Arnold if we can, for those ratings. I can understand the evangelicals to a certain extent saying, "Well, maybe he's not as nice as we want him to be." But they also want to see the country be great. -Why do you think those voters are drawn to you? -Well, I'm Protestant. I'm Presbyterian, which means something. Maybe he's not as perfect on the Bible, but I did go to Sunday school for many years, I want to tell you. I get sent Bibles by a lot of people. -Where are all those Bibles anyhow now? -Well, actually, we keep them at a certain place -- a very nice place. My second-favorite book of all time. What's my first favorite book? -The Bible! -The Bible! -The Bible is special. The Bible, the more you see it, the more you read it, the more incredible it is. -Are you an Old Testament guy or a New Testament guy? -Probably equal. -Proverbs, the chapter, "Never bend to envy." I've had that thing all of my life, where your people are bending to envy. 2 Corinthians, right? 2 Corinthians 3:17. That's the whole ballgame. There's no way I would ever do anything to do negative to a Bible. God is the ultimate. I mean, God created this. -Yeah. -And, you know, here's the Pacific Ocean right behind us. So nobody, no thing -- no, there's nothing like God.
2024-06-13T01:26:58.646260
https://example.com/article/2989
Brown Rice and Green Tea Benefits by Nina K. Brown rice has fiber for good digestion. You've heard that brown rice and green tea are superb for your health, but it's hard to sort through all of the rumors about these foods. Brown rice provides dietary fiber as well as numerous phytochemicals, while refined white rice lacks many of these helpful substances. Green tea boosts alertness and could thwart disease, but scientists are still researching the drink's healing potential. As with all foods, moderation is key. The best way to eat a healthy diet is to incorporate a wide array of fruits, vegetables, grains and lean proteins. Fiber in Rice At 3.4 grams per cup, brown rice provides about 14 percent of the daily fiber needs for most women under 50. In contrast, white rice has about half a gram of fiber per cup. High-fiber foods are linked to reduced constipation and lower risk of hemorrhoids and diverticular disease. They also may help prevent heart disease and certain types of cancer, according to the U.S. Department of Agriculture. Researchers are still studying the phytonutrients, or plant nutrients, in brown rice and other whole grains for potential health benefits. Rice and Diabetes Choosing brown rice over white rice may reduce your risk of diabetes, according to a report published in the "Archives of Internal Medicine" journal in 2010. Researchers reviewed results from the Health Professionals Follow-up Study and the Nurses' Health Study I and II, which followed 157,463 women and 39,765 men. They found that substituting one-third of a serving of white rice with brown rice daily resulted in a 16-percent reduction in Type 2 diabetes risk. Green Tea Catechins Green tea is a hot topic, and science is still catching up on the possible benefits. All teas contain antioxidants called catechins -- but green tea has triple the amount of black or oolong teas, which undergo more processing. These catechins may reduce risk of diabetes, cancer, heart disease and stroke, according to North Dakota State University food and nutrition specialists. Tea and Weight It would be pretty sweet to sip your way to a lean physique, and green tea does have a slight effect on weight loss -- but probably not enough for significant results. The Cochrane Database of Systematic Reviews published an analysis of studies from numerous databases and found that participants in non-Japanese trials who drank green tea lost an average of 0.1 pound more than those who did not drink green tea. Japanese study results were counted separately and ranged from no difference at all to slight reductions in body mass. Arsenic Warning Consumer Reports found that rice, especially brown rice, contains arsenic, and those who eat rice have 44 percent more of this toxic metal in their bodies than non-rice eaters. The Food and Drug Administration hasn't established safe arsenic levels yet, and there's no evidence of ill effects. However, the FDA is in the process of conducting a comprehensive analysis of arsenic in rice. In an initial report published in September, 2012, they found levels ranging from 1.2 micrograms to 11.1 micrograms of arsenic per serving, with domestically grown brown rice containing the most. Genmaicha Genmaicha, or brown rice green tea, is green tea with toasted brown rice that may resemble popcorn kernels. The rice gives the tea a nutty flavor, but it is not clear whether it provides any additional health benefits. One study on genmaicha and breast cancer among Japanese women, published in the "Breast Cancer Research" journal in 2010, found no correlation, indicating that brown rice green tea does not offer protection from breast cancer. About the Author Nina K. is a Los Angeles-based journalist who has been published by USAToday.com, Fitday.com, Healthy Living Magazine, Organic Authority and numerous other print and web publications. She has a philosophy degree from the University of Colorado and a journalism certificate from UCLA.
2024-04-01T01:26:58.646260
https://example.com/article/7574
.. SPDX-License-Identifier: BSD-3-Clause Copyright 2017 NXP Security Library ================ The security library provides a framework for management and provisioning of security protocol operations offloaded to hardware based devices. The library defines generic APIs to create and free security sessions which can support full protocol offload as well as inline crypto operation with NIC or crypto devices. The framework currently only supports the IPSec protocol and associated operations, other protocols will be added in future. Design Principles ----------------- The security library provides an additional offload capability to an existing crypto device and/or ethernet device. .. code-block:: console +---------------+ | rte_security | +---------------+ \ / +-----------+ +--------------+ | NIC PMD | | CRYPTO PMD | +-----------+ +--------------+ .. note:: Currently, the security library does not support the case of multi-process. It will be updated in the future releases. The supported offload types are explained in the sections below. Inline Crypto ~~~~~~~~~~~~~ RTE_SECURITY_ACTION_TYPE_INLINE_CRYPTO: The crypto processing for security protocol (e.g. IPSec) is processed inline during receive and transmission on NIC port. The flow based security action should be configured on the port. Ingress Data path - The packet is decrypted in RX path and relevant crypto status is set in Rx descriptors. After the successful inline crypto processing the packet is presented to host as a regular Rx packet however all security protocol related headers are still attached to the packet. e.g. In case of IPSec, the IPSec tunnel headers (if any), ESP/AH headers will remain in the packet but the received packet contains the decrypted data where the encrypted data was when the packet arrived. The driver Rx path check the descriptors and and based on the crypto status sets additional flags in the rte_mbuf.ol_flags field. .. note:: The underlying device may not support crypto processing for all ingress packet matching to a particular flow (e.g. fragmented packets), such packets will be passed as encrypted packets. It is the responsibility of application to process such encrypted packets using other crypto driver instance. Egress Data path - The software prepares the egress packet by adding relevant security protocol headers. Only the data will not be encrypted by the software. The driver will accordingly configure the tx descriptors. The hardware device will encrypt the data before sending the the packet out. .. note:: The underlying device may support post encryption TSO. .. code-block:: console Egress Data Path | +--------|--------+ | egress IPsec | | | | | +------V------+ | | | SADB lookup | | | +------|------+ | | +------V------+ | | | Tunnel | | <------ Add tunnel header to packet | +------|------+ | | +------V------+ | | | ESP | | <------ Add ESP header without trailer to packet | | | | <------ Mark packet to be offloaded, add trailer | +------|------+ | meta-data to mbuf +--------V--------+ | +--------V--------+ | L2 Stack | +--------|--------+ | +--------V--------+ | | | NIC PMD | <------ Set hw context for inline crypto offload | | +--------|--------+ | +--------|--------+ | HW ACCELERATED | <------ Packet Encryption and | NIC | Authentication happens inline | | +-----------------+ Inline protocol offload ~~~~~~~~~~~~~~~~~~~~~~~ RTE_SECURITY_ACTION_TYPE_INLINE_PROTOCOL: The crypto and protocol processing for security protocol (e.g. IPSec) is processed inline during receive and transmission. The flow based security action should be configured on the port. Ingress Data path - The packet is decrypted in the RX path and relevant crypto status is set in the Rx descriptors. After the successful inline crypto processing the packet is presented to the host as a regular Rx packet but all security protocol related headers are optionally removed from the packet. e.g. in the case of IPSec, the IPSec tunnel headers (if any), ESP/AH headers will be removed from the packet and the received packet will contains the decrypted packet only. The driver Rx path checks the descriptors and based on the crypto status sets additional flags in ``rte_mbuf.ol_flags`` field. The driver would also set device-specific metadata in ``rte_mbuf.udata64`` field. This will allow the application to identify the security processing done on the packet. .. note:: The underlying device in this case is stateful. It is expected that the device shall support crypto processing for all kind of packets matching to a given flow, this includes fragmented packets (post reassembly). E.g. in case of IPSec the device may internally manage anti-replay etc. It will provide a configuration option for anti-replay behavior i.e. to drop the packets or pass them to driver with error flags set in the descriptor. Egress Data path - The software will send the plain packet without any security protocol headers added to the packet. The driver will configure the security index and other requirement in tx descriptors. The hardware device will do security processing on the packet that includes adding the relevant protocol headers and encrypting the data before sending the packet out. The software should make sure that the buffer has required head room and tail room for any protocol header addition. The software may also do early fragmentation if the resultant packet is expected to cross the MTU size. .. note:: The underlying device will manage state information required for egress processing. E.g. in case of IPSec, the seq number will be added to the packet, however the device shall provide indication when the sequence number is about to overflow. The underlying device may support post encryption TSO. .. code-block:: console Egress Data Path | +--------|--------+ | egress IPsec | | | | | +------V------+ | | | SADB lookup | | | +------|------+ | | +------V------+ | | | Desc | | <------ Mark packet to be offloaded | +------|------+ | +--------V--------+ | +--------V--------+ | L2 Stack | +--------|--------+ | +--------V--------+ | | | NIC PMD | <------ Set hw context for inline crypto offload | | +--------|--------+ | +--------|--------+ | HW ACCELERATED | <------ Add tunnel, ESP header etc header to | NIC | packet. Packet Encryption and | | Authentication happens inline. +-----------------+ Lookaside protocol offload ~~~~~~~~~~~~~~~~~~~~~~~~~~ RTE_SECURITY_ACTION_TYPE_LOOKASIDE_PROTOCOL: This extends librte_cryptodev to support the programming of IPsec Security Association (SA) as part of a crypto session creation including the definition. In addition to standard crypto processing, as defined by the cryptodev, the security protocol processing is also offloaded to the crypto device. Decryption: The packet is sent to the crypto device for security protocol processing. The device will decrypt the packet and it will also optionally remove additional security headers from the packet. E.g. in case of IPSec, IPSec tunnel headers (if any), ESP/AH headers will be removed from the packet and the decrypted packet may contain plain data only. .. note:: In case of IPSec the device may internally manage anti-replay etc. It will provide a configuration option for anti-replay behavior i.e. to drop the packets or pass them to driver with error flags set in descriptor. Encryption: The software will submit the packet to cryptodev as usual for encryption, the hardware device in this case will also add the relevant security protocol header along with encrypting the packet. The software should make sure that the buffer has required head room and tail room for any protocol header addition. .. note:: In the case of IPSec, the seq number will be added to the packet, It shall provide an indication when the sequence number is about to overflow. .. code-block:: console Egress Data Path | +--------|--------+ | egress IPsec | | | | | +------V------+ | | | SADB lookup | | <------ SA maps to cryptodev session | +------|------+ | | +------|------+ | | | \--------------------\ | | Crypto | | | <- Crypto processing through | | /----------------\ | inline crypto PMD | +------|------+ | | | +--------V--------+ | | | | | +--------V--------+ | | create <-- SA is added to hw | L2 Stack | | | inline using existing create +--------|--------+ | | session sym session APIs | | | | +--------V--------+ +---|---|----V---+ | | | \---/ | | <--- Add tunnel, ESP header etc | NIC PMD | | INLINE | | header to packet.Packet | | | CRYPTO PMD | | Encryption/Decryption and +--------|--------+ +----------------+ Authentication happens | inline. +--------|--------+ | NIC | +--------|--------+ V Device Features and Capabilities --------------------------------- Device Capabilities For Security Operations ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ The device (crypto or ethernet) capabilities which support security operations, are defined by the security action type, security protocol, protocol capabilities and corresponding crypto capabilities for security. For the full scope of the Security capability see definition of rte_security_capability structure in the *DPDK API Reference*. .. code-block:: c struct rte_security_capability; Each driver (crypto or ethernet) defines its own private array of capabilities for the operations it supports. Below is an example of the capabilities for a PMD which supports the IPSec protocol. .. code-block:: c static const struct rte_security_capability pmd_security_capabilities[] = { { /* IPsec Lookaside Protocol offload ESP Tunnel Egress */ .action = RTE_SECURITY_ACTION_TYPE_LOOKASIDE_PROTOCOL, .protocol = RTE_SECURITY_PROTOCOL_IPSEC, .ipsec = { .proto = RTE_SECURITY_IPSEC_SA_PROTO_ESP, .mode = RTE_SECURITY_IPSEC_SA_MODE_TUNNEL, .direction = RTE_SECURITY_IPSEC_SA_DIR_EGRESS, .options = { 0 } }, .crypto_capabilities = pmd_capabilities }, { /* IPsec Lookaside Protocol offload ESP Tunnel Ingress */ .action = RTE_SECURITY_ACTION_TYPE_LOOKASIDE_PROTOCOL, .protocol = RTE_SECURITY_PROTOCOL_IPSEC, .ipsec = { .proto = RTE_SECURITY_IPSEC_SA_PROTO_ESP, .mode = RTE_SECURITY_IPSEC_SA_MODE_TUNNEL, .direction = RTE_SECURITY_IPSEC_SA_DIR_INGRESS, .options = { 0 } }, .crypto_capabilities = pmd_capabilities }, { .action = RTE_SECURITY_ACTION_TYPE_NONE } }; static const struct rte_cryptodev_capabilities pmd_capabilities[] = { { /* SHA1 HMAC */ .op = RTE_CRYPTO_OP_TYPE_SYMMETRIC, .sym = { .xform_type = RTE_CRYPTO_SYM_XFORM_AUTH, .auth = { .algo = RTE_CRYPTO_AUTH_SHA1_HMAC, .block_size = 64, .key_size = { .min = 64, .max = 64, .increment = 0 }, .digest_size = { .min = 12, .max = 12, .increment = 0 }, .aad_size = { 0 }, .iv_size = { 0 } } } }, { /* AES CBC */ .op = RTE_CRYPTO_OP_TYPE_SYMMETRIC, .sym = { .xform_type = RTE_CRYPTO_SYM_XFORM_CIPHER, .cipher = { .algo = RTE_CRYPTO_CIPHER_AES_CBC, .block_size = 16, .key_size = { .min = 16, .max = 32, .increment = 8 }, .iv_size = { .min = 16, .max = 16, .increment = 0 } } } } } Capabilities Discovery ~~~~~~~~~~~~~~~~~~~~~~ Discovering the features and capabilities of a driver (crypto/ethernet) is achieved through the ``rte_security_capabilities_get()`` function. .. code-block:: c const struct rte_security_capability *rte_security_capabilities_get(uint16_t id); This allows the user to query a specific driver and get all device security capabilities. It returns an array of ``rte_security_capability`` structures which contains all the capabilities for that device. Security Session Create/Free ~~~~~~~~~~~~~~~~~~~~~~~~~~~~ Security Sessions are created to store the immutable fields of a particular Security Association for a particular protocol which is defined by a security session configuration structure which is used in the operation processing of a packet flow. Sessions are used to manage protocol specific information as well as crypto parameters. Security sessions cache this immutable data in a optimal way for the underlying PMD and this allows further acceleration of the offload of Crypto workloads. The Security framework provides APIs to create and free sessions for crypto/ethernet devices, where sessions are mempool objects. It is the application's responsibility to create and manage the session mempools. The mempool object size should be able to accommodate the driver's private data of security session. Once the session mempools have been created, ``rte_security_session_create()`` is used to allocate and initialize a session for the required crypto/ethernet device. Session APIs need a parameter ``rte_security_ctx`` to identify the crypto/ethernet security ops. This parameter can be retrieved using the APIs ``rte_cryptodev_get_sec_ctx()`` (for crypto device) or ``rte_eth_dev_get_sec_ctx`` (for ethernet port). Sessions already created can be updated with ``rte_security_session_update()``. When a session is no longer used, the user must call ``rte_security_session_destroy()`` to free the driver private session data and return the memory back to the mempool. For look aside protocol offload to hardware crypto device, the ``rte_crypto_op`` created by the application is attached to the security session by the API ``rte_security_attach_session()``. For Inline Crypto and Inline protocol offload, device specific defined metadata is updated in the mbuf using ``rte_security_set_pkt_metadata()`` if ``DEV_TX_OFFLOAD_SEC_NEED_MDATA`` is set. For inline protocol offloaded ingress traffic, the application can register a pointer, ``userdata`` , in the security session. When the packet is received, ``rte_security_get_userdata()`` would return the userdata registered for the security session which processed the packet. .. note:: In case of inline processed packets, ``rte_mbuf.udata64`` field would be used by the driver to relay information on the security processing associated with the packet. In ingress, the driver would set this in Rx path while in egress, ``rte_security_set_pkt_metadata()`` would perform a similar operation. The application is expected not to modify the field when it has relevant info. For ingress, this device-specific 64 bit value is required to derive other information (like userdata), required for identifying the security processing done on the packet. Security session configuration ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ Security Session configuration structure is defined as ``rte_security_session_conf`` .. code-block:: c struct rte_security_session_conf { enum rte_security_session_action_type action_type; /**< Type of action to be performed on the session */ enum rte_security_session_protocol protocol; /**< Security protocol to be configured */ union { struct rte_security_ipsec_xform ipsec; struct rte_security_macsec_xform macsec; }; /**< Configuration parameters for security session */ struct rte_crypto_sym_xform *crypto_xform; /**< Security Session Crypto Transformations */ void *userdata; /**< Application specific userdata to be saved with session */ }; The configuration structure reuses the ``rte_crypto_sym_xform`` struct for crypto related configuration. The ``rte_security_session_action_type`` struct is used to specify whether the session is configured for Lookaside Protocol offload or Inline Crypto or Inline Protocol Offload. .. code-block:: c enum rte_security_session_action_type { RTE_SECURITY_ACTION_TYPE_NONE, /**< No security actions */ RTE_SECURITY_ACTION_TYPE_INLINE_CRYPTO, /**< Crypto processing for security protocol is processed inline * during transmission */ RTE_SECURITY_ACTION_TYPE_INLINE_PROTOCOL, /**< All security protocol processing is performed inline during * transmission */ RTE_SECURITY_ACTION_TYPE_LOOKASIDE_PROTOCOL /**< All security protocol processing including crypto is performed * on a lookaside accelerator */ }; The ``rte_security_session_protocol`` is defined as .. code-block:: c enum rte_security_session_protocol { RTE_SECURITY_PROTOCOL_IPSEC, /**< IPsec Protocol */ RTE_SECURITY_PROTOCOL_MACSEC, /**< MACSec Protocol */ }; Currently the library defines configuration parameters for IPSec only. For other protocols like MACSec, structures and enums are defined as place holders which will be updated in the future. IPsec related configuration parameters are defined in ``rte_security_ipsec_xform`` .. code-block:: c struct rte_security_ipsec_xform { uint32_t spi; /**< SA security parameter index */ uint32_t salt; /**< SA salt */ struct rte_security_ipsec_sa_options options; /**< various SA options */ enum rte_security_ipsec_sa_direction direction; /**< IPSec SA Direction - Egress/Ingress */ enum rte_security_ipsec_sa_protocol proto; /**< IPsec SA Protocol - AH/ESP */ enum rte_security_ipsec_sa_mode mode; /**< IPsec SA Mode - transport/tunnel */ struct rte_security_ipsec_tunnel_param tunnel; /**< Tunnel parameters, NULL for transport mode */ }; Security API ~~~~~~~~~~~~ The rte_security Library API is described in the *DPDK API Reference* document. Flow based Security Session ~~~~~~~~~~~~~~~~~~~~~~~~~~~ In the case of NIC based offloads, the security session specified in the 'rte_flow_action_security' must be created on the same port as the flow action that is being specified. The ingress/egress flow attribute should match that specified in the security session if the security session supports the definition of the direction. Multiple flows can be configured to use the same security session. For example if the security session specifies an egress IPsec SA, then multiple flows can be specified to that SA. In the case of an ingress IPsec SA then it is only valid to have a single flow to map to that security session. .. code-block:: console Configuration Path | +--------|--------+ | Add/Remove | | IPsec SA | <------ Build security flow action of | | | ipsec transform |--------|--------| | +--------V--------+ | Flow API | +--------|--------+ | +--------V--------+ | | | NIC PMD | <------ Add/Remove SA to/from hw context | | +--------|--------+ | +--------|--------+ | HW ACCELERATED | | NIC | | | +--------|--------+ * Add/Delete SA flow: To add a new inline SA construct a rte_flow_item for Ethernet + IP + ESP using the SA selectors and the ``rte_crypto_ipsec_xform`` as the ``rte_flow_action``. Note that any rte_flow_items may be empty, which means it is not checked. .. code-block:: console In its most basic form, IPsec flow specification is as follows: +-------+ +----------+ +--------+ +-----+ | Eth | -> | IP4/6 | -> | ESP | -> | END | +-------+ +----------+ +--------+ +-----+ However, the API can represent, IPsec crypto offload with any encapsulation: +-------+ +--------+ +-----+ | Eth | -> ... -> | ESP | -> | END | +-------+ +--------+ +-----+
2023-12-08T01:26:58.646260
https://example.com/article/3273
<?php /* * This file is part of PHPExifTool. * * (c) 2012 Romain Neutron <imprec@gmail.com> * * For the full copyright and license information, please view the LICENSE * file that was distributed with this source code. */ namespace PHPExiftool\Driver\Tag\DICOM; use JMS\Serializer\Annotation\ExclusionPolicy; use PHPExiftool\Driver\AbstractTag; /** * @ExclusionPolicy("all") */ class Modality extends AbstractTag { protected $Id = '0008,0060'; protected $Name = 'Modality'; protected $FullName = 'DICOM::Main'; protected $GroupName = 'DICOM'; protected $g0 = 'DICOM'; protected $g1 = 'DICOM'; protected $g2 = 'Image'; protected $Type = '?'; protected $Writable = false; protected $Description = 'Modality'; }
2023-11-07T01:26:58.646260
https://example.com/article/7943
? -3 Which is the closest to 0? (a) -0.7 (b) -3/8 (c) 19.1257 b Which is the nearest to 444? (a) -2 (b) -4 (c) 2 (d) 3 (e) -19 d What is the closest to -2/7 in -18, -451, 3, -72? 3 What is the nearest to 1/4 in 105/8, 44, -0.4, 1.9? -0.4 What is the nearest to 38 in 3/43, -0.1, 6? 6 Which is the nearest to 2? (a) -16.25 (b) -176 (c) 0.5 (d) 22 c Which is the closest to 2/3? (a) -3626 (b) -5/8 (c) 9 b What is the nearest to 1 in -644, 1/6, -3764? 1/6 Which is the nearest to 5? (a) -1/22 (b) -1 (c) 3 (d) -326 (e) 2/19 c Which is the nearest to -13411? (a) -4 (b) -14 (c) 0.4 b Which is the closest to -0.3? (a) 5 (b) 2/13 (c) -2 (d) 0 (e) -38/5425 e Which is the nearest to 3/5? (a) 3/22 (b) 1358 (c) 3/5 (d) -0.3 c Which is the closest to -1.1? (a) -1 (b) -16 (c) 12.1 (d) -5 (e) 2/7 a What is the closest to -1.2 in -2/27, -2/7, -4/5, 6, -1? -1 Which is the closest to 29? (a) -6/19 (b) 1104 (c) -40 a What is the closest to -1 in 364, -1167, 3/4, 3? 3/4 Which is the closest to 27? (a) 5 (b) 26834 (c) -2 a Which is the closest to 22? (a) 540/11 (b) 23/5 (c) 0 b Which is the closest to -2? (a) -3 (b) -0.5 (c) 0.0371 (d) 238 a What is the nearest to -574/5093 in -0.01, -0.3, -0.07? -0.07 What is the nearest to -0.03 in 0.063731, -1, 4/9? 0.063731 Which is the closest to 1/3? (a) 0.2 (b) -23.3 (c) -331 (d) -1/5 a What is the closest to 0.07 in -0.2, 511, 4, 0.4? -0.2 What is the nearest to -1/4 in 141, 4, 1/8, -4, -12? 1/8 What is the nearest to 256 in -222, 0, 25? 25 What is the nearest to 1/3 in -8, 0, 4227, 8, -0.4, -0.5? 0 Which is the closest to 0.1? (a) 3/2 (b) 0.08 (c) 6/371 (d) 5 b Which is the closest to 7? (a) -1 (b) 0.13 (c) -9 (d) 0.6 (e) 0.2 d Which is the closest to -0.1? (a) 30/17 (b) 3/1570 (c) -1/8 c Which is the nearest to -0.3? (a) 58743 (b) -5.3 (c) 5/4 (d) 0.3 d What is the closest to 1.283077 in 4, -1/7, -4? -1/7 What is the nearest to -880 in 5/7, 4, -4/3, 2978? -4/3 Which is the closest to 0? (a) 36400 (b) -4 (c) 4/7 (d) 54 (e) -0.1 e What is the nearest to 1 in 0.5, -0.039, 2, 1073? 0.5 What is the nearest to -122 in -0.11, 0.51, -263? -0.11 What is the nearest to 1 in 1/11, -3/2, 61, -6089? 1/11 What is the closest to -7/2 in -3, 37, 81? -3 What is the closest to 1161 in 14, -7, 0.1, -1? 14 Which is the closest to 445? (a) -4 (b) 5 (c) 204 c What is the nearest to -5/6 in 5342, 0.3, 1/13, 2/9, 3, 4? 1/13 Which is the nearest to -2/5? (a) -24 (b) 2/21 (c) 1 (d) -1.2 (e) -60 b Which is the closest to -34? (a) 0.01 (b) -2/3 (c) -1/3 (d) 1/8 (e) 4 b What is the nearest to -0.1 in 12, 1, -2/11, 37758, -6? -2/11 Which is the nearest to -2? (a) -7 (b) -4/3 (c) 516/11 (d) 2 b What is the nearest to 28 in -2/17, 0.9, -401, -6, -14, 4? 4 Which is the nearest to 12/5? (a) 4/9 (b) -0.287 (c) -24 (d) 2 (e) 3 (f) 1 d What is the closest to -1 in 4, 117738, 5, 0.1? 0.1 Which is the nearest to 520? (a) -1/4 (b) 174/43 (c) 9 c What is the nearest to 4 in 0.1, -4, 0.46, -3/4, 5? 5 Which is the nearest to -0.52? (a) -2.464 (b) -2 (c) 2/9 c Which is the nearest to 1.11? (a) 3 (b) 0.2 (c) 0.057 (d) 2 d What is the nearest to 72 in 1/4, 2/15, -0.5, 0.2, 553, 2/5? 2/5 What is the closest to -2/7 in -5/6, 5628/5, -3/2, 2/7, 3? -5/6 What is the closest to -5 in 263, 2/9, -798? 2/9 Which is the nearest to 9? (a) -0.1 (b) -8176 (c) -0.4 (d) 0.4 (e) 0 d Which is the nearest to 2? (a) 4 (b) -113 (c) 33/563 c Which is the nearest to 0.1? (a) 43 (b) -11 (c) -1 (d) -0.2 (e) -4 d Which is the nearest to -11? (a) -13 (b) -1/5 (c) 1/7 (d) -28 (e) 1/3 a What is the closest to -2/5 in 1, 5, 1/8, 2, 19? 1/8 Which is the closest to 1397.85? (a) -3.5 (b) -4 (c) 2 (d) 1/2 c Which is the nearest to 6? (a) -2/7 (b) -2.7 (c) 21/11 (d) -1/9 c Which is the nearest to -12? (a) 5 (b) -5 (c) -2/5 (d) 2/9 (e) 6878 b What is the closest to 3/7 in 2/19, 1357/10, -6, 5? 2/19 Which is the closest to -17.7? (a) -3 (b) 10 (c) -295 a Which is the nearest to 0? (a) -4/3 (b) 6 (c) -8 (d) -2/5 (e) 24 d What is the nearest to -59 in -4, 68454, 2/3? -4 What is the closest to 0 in 3, 0.0548, 2, 31, -2/23, 0.5? 0.0548 Which is the nearest to 6/11? (a) -1/2 (b) 2/9 (c) 2 (d) -3470 (e) -0.4 b What is the closest to -2.7 in 105/17, 10, -1? -1 What is the closest to -1 in -5.2, 0.1, -9030, -0.4? -0.4 Which is the closest to 0.3? (a) -3 (b) -1 (c) 4/3 (d) 12219 (e) -0.3 (f) 0.2 f Which is the nearest to -0.1? (a) 0.21 (b) 3/8 (c) -378/755 (d) -2/13 d Which is the closest to -2/3? (a) 1/4 (b) 9 (c) -5 (d) -4 (e) -608 a What is the closest to -1.54 in 4, 0.054, -1/1133? -1/1133 Which is the nearest to 0? (a) 1.1 (b) 357065 (c) 1/5 c Which is the nearest to -67? (a) 1/6 (b) -25 (c) -0.3668 b What is the nearest to -47 in 3.101, -1, -4? -4 What is the nearest to 1 in -305/2, 0.1, 0.2, 75.4, 4? 0.2 Which is the nearest to 2? (a) -2/5 (b) -3 (c) -5 (d) -202454 (e) -6 a Which is the nearest to 169? (a) -92 (b) 0.2 (c) 0.1 (d) -4/3 (e) -1/20 (f) -0.2 b What is the closest to -2/17 in -66.9, -0.2, 4, 0.03, 0.2, 0? -0.2 Which is the nearest to 0.1? (a) 0.147 (b) -1 (c) 3/4 (d) 1/2 (e) -0.18 a What is the nearest to -2.319323 in 4, -3, -6/7? -3 What is the closest to -1.598 in 2/11, -6, 1, 4, 0.2? 2/11 What is the closest to 1 in 4, 2/13, 53, 0.8, 553/3? 0.8 What is the nearest to 11782 in -1/6, -0.1, -129? -0.1 Which is the closest to 2/17? (a) -2/9 (b) 0.5 (c) -4 (d) 154891 a What is the closest to 1 in -2.17, 0.47, 0.12, -0.2, 5? 0.47 What is the closest to 0.1 in -2/15, -24/4087, -0.3, 2, 1/4, -2? -24/4087 Which is the nearest to 1? (a) -0.2 (b) -5/8 (c) -52 (d) -27509 a Which is the nearest to 0? (a) -0.3 (b) -570 (c) 2333 a Which is the closest to -5? (a) 592 (b) -1/3 (c) 3/7 (d) 0 (e) 4/3 b What is the nearest to 0 in 1, 5, 137/3, 2/207, -0.3? 2/207 What is the closest to -3 in -287, 9, -3, 0.08, 0.4? -3 What is the nearest to -0.1499 in -0.5, 2/15, 1735? 2/15 What is the nearest to -0.4 in -19, 0, 2, -2320, 32? 0 What is the nearest to 2 in -6, 0, -311, -5, 1/3? 1/3 Which is the nearest to 121? (a) 5080 (b) 2/5 (c) -0.1 (d) 1/5 b Which is the nearest to -1? (a) 0.3 (b) -4 (c) -2/37 (d) 662583 c What is the closest to 1/20448 in 0.326, 0.2, -0.3? 0.2 Which is the closest to 0.2? (a) -246/73 (b) 1/6 (c) 13 (d) 0 b Which is the nearest to -6? (a) 1.8 (b) 1/4 (c) -2/23 (d) 2 (e) -3/1046 c What is the nearest to 3/5 in -1/42078, -5, 6, -0.05? -1/42078 Which is the nearest to -0.2? (a) -11/2 (b) 1.71 (c) -0.5 c What is the closest to 0 in 0.2, 3, -0.03096025, 4? -0.03096025 What is the nearest to 0 in -1, 12, -2/5, -5, -234.72? -2/5 Which is the nearest to -0.6? (a) 7 (b) -101 (c) -4 (d) 0.4 (e) -3/2 (f) 42 e Which is the nearest to -99/4? (a) 9 (b) -2/15 (c) -4/9 c What is the nearest to -0.1 in -6, -4/1149593, 1? -4/1149593 What is the closest to -0.3 in 1/5, -29470, -1/4, -3? -1/4 Which is the nearest to -4? (a) -19/5 (b) 3260 (c) 0.1 a What is the closest to -1 in -1/2, 78, 0.014, -2, -0.13? -1/2 What is the nearest to 0.1 in 5/2, -0.165, 5, 3, -1.25? -0.165 What is the nearest to -8 in -2/5, 4, -0.7318? -0.7318 Which is the nearest to 4? (a) -1006 (b) -1 (c) 294 b What is the closest to 0.04135 in 3/10, -2, 0, 2/7, -1, 2/11? 0 What is the nearest to -2.6 in 3/16, -0.256, 2/7? -0.256 What is the nearest to -1/5 in 2/12381, 0.3, 2/25? 2/12381 Which is the closest to 1? (a) 26326 (b) -2/11 (c) 1/9 c What is the nearest to -1/4 in 6, 1, 9/8, -0.6, -12, 408? -0.6 What is the closest to -5 in 1/3, -0.1, 4, 212/23, -8? -8 What is the nearest to 0 in 27, -103/3, 4, -0.11, -0.2, 11? -0.11 What is the nearest to 0.1 in 1, 35, -99, -2/5, 1/3? 1/3 Which is the closest to 32? (a) 1/3 (b) 0.5 (c) -1 (d) -2/3 (e) -8.8 (f) 2/13 b What is the nearest to -4 in 5, -3/8, -319, -0.5, 1? -0.5 Which is the closest to 95.15? (a) -8 (b) 2/9 (c) 2 (d) 4 (e) 6 e Which is the nearest to -0.14? (a) 2 (b) 66 (c) 0.03 (d) -11 (e) 33 c What is the nearest to 4772 in -491, -1, 5? 5 Which is the closest to -0.2? (a) 3 (b) 4 (c) -212 (d) -178 (e) 0.08 e Which is the clos
2023-10-18T01:26:58.646260
https://example.com/article/8797
The iridoid glucoside, antirrhinoside, from Antirrhinum majus L. has differential effects on two generalist insect herbivores. The iridoid glucoside, antirrhinoside, is constitutively distributed throughout Antirrhinum majus L. in a manner consistent with its possible role as an allelochemical, but there is no evidence that it has a defensive function with respect to insect herbivory. To address this question, two generalist herbivores, Lymantria dispar L. (gypsy moth) and Trichoplusia ni Hübner (cabbage looper) were chosen for feeding trials on excised whole leaves of A. majus and in artificial diet assays. In leaf excision feeding trials, fourth instar gypsy moth rejected, without sampling, the leaves of A. majus regardless of what node the leaf was excised from. In contrast, fourth instar cabbage looper readily fed on the excised leaves, and antirrhinoside was not found in their bodies or feces (frass) as determined by thin layer and high-pressure liquid chromatography. In the leaf and diet assays, a second major leaf iridoid in A. majus, antirrhide, was found in both cabbage looper and gypsy moth frass. In diet feeding assays, the growth of gypsy moth and cabbage looper were not inhibited by methanol extracts, iridoid fractions, or pure antirrhinoside at concentrations of 0.6% in diet, but cabbage looper growth was enhanced. At an antirrhinoside concentration of 3.3% in diet, gypsy moth growth was reduced, whereas cabbage looper growth again increased significantly relative to the control. It is likely that antirrhinoside functions as defense against herbivory for one generalist insect herbivore but also, at low concentrations, enhances the growth of another.
2024-02-02T01:26:58.646260
https://example.com/article/8901
Visualization of Enzyme Activities in Earthworm Biopores by In Situ Soil Zymography. Earthworms produce biopores with strongly increased microbial and enzyme activities and consequently they form microbial hotspots in soil. In extremely dynamic microhabitats and hotspots such as earthworm biopores, the in situ enzyme activities are a footprint of process rates and complex biotic interactions. The effect of earthworms on enzyme activities inside biopores, relative to earthworm-free soil, can be visualized by in situ soil zymography. Here, we describe the details of the approach and discuss its advantages and limitations. Direct zymography provides high spatial resolution for quantitative images of enzyme activities in biopores.
2024-03-23T01:26:58.646260
https://example.com/article/7292
Effect of acaricide treatment of cattle on Amblyomma variegatum (Acari: Ixodidae) infestation of mongooses (Carnivora: Viverridae: Herpestes auropunctatus) in Guadeloupe, French West Indies. The effect of acaricide treatment of cattle on the infestation of the small Indian mongoose (Herpestes auropunctatus Hodgson) by Amblyomma variegatum (F.) was determined during a field evaluation of selected acaricides in Guadeloupe, French West Indies. From April 1990 to April 1991, cattle at one site were treated every 14 d with pour-on formulations of deltamethrin, flumethrin, or permethrin; and cattle at a second site were treated as per a local standard treatment using a spray formulation of coumaphos every 30 d. The protocol was then reversed, and from April to July 1991 cattle at the original standard treatment site were treated using the pour-on treatment. Mongooses were examined for ticks during February-March and July 1990 and 1991. The mean prevalence of infestation of mongooses by A. variegatum larvae was reduced from 41 to 27% during the February-March to July periods at the pour-on treatment sites but increased from 29 to 43% during the same periods at the standard treatment sites. The mean relative density of infestation by larvae decreased from 2.15 to 0.65 at the pour-on treatment sites and increased from 0.7 to 1.95 at the standard treatment sites during the same periods. Data on nymphal infestations were inconclusive, and mongooses were not infested by adult ticks. The infestation of mongooses by A. variegatum may be of importance as a short-term alternative host system for immature stages of this tick during an eradication program.
2023-10-25T01:26:58.646260
https://example.com/article/5103
Tangier (1982 film) Tangier is a 1982 American-Moroccan thriller film directed by Michael E. Briant and starring Ronny Cox, Billie Whitelaw and Glynis Barber. "Take the disappearance of a key British Intelligence Officer in Gibraltar, loaded with top secrets. Add a tough, down-on-his-luck ex-CIA agent with a murky past. Try a drop of blackmail. Garnish with two beautiful women. Sprinkle liberally with murder, treachery, and mayhem. Stir well till it all fizzes with danger and excitement that is Tangier. The result is a thriller that will grip you down to the last explosive moment. It's the thriller of the year. It's Tangier." from the cover of the Linked Ring VHS release 1982. Cast Ronny Cox as Bob Steele Billie Whitelaw as Louise Glynis Barber as Beth Ronald Lacey as Wedderburn Oscar Quitak as Velatti Jack Watson as Donovan Ronald Fraser as Jenkins Adel Frej as Ahmed Benjamin Feitelson as Fisher Peter Arne as Malen David Collings as Major Greville Connie Mason as Marsha Nicholson Donnelly as Major Crawley Ronald Fraser References External links Category:1982 films Category:1980s spy films Category:1980s thriller films Category:American spy films Category:American thriller films Category:American films Category:Moroccan films Category:English-language films Category:Films shot in Gibraltar Category:Films set in Tangier
2023-10-06T01:26:58.646260
https://example.com/article/2524
Share this article Leinster challenge excites Charlie Ewels Bath second-row Charlie Ewels admits his team needs to be more clinical when they take on Leinster in their Champions Cup clash on Saturday. Todd Blackadder’s side come into the game on the back of a 7-7 draw with Sale Sharks in the Premiership, which was a match low on quality. This week’s pool clash is against a side in excellent form and Ewels knows they must improve against the PRO14 and European heavyweights. “It wasn’t good enough, that was a game that we targeted to win and we missed opportunities. We created chances to win the game, but in other areas we were poor. A draw is better than a loss, but that’s nowhere near where we want to be and where we should be,” he told Bath’s website regarding the Sale result. “I think when you look back at games, it’s about finding ways to win however that may be. That’s where we have to get better as a squad – when we have those experiences we then learn from them the next time we are in that situation, we capitalise on it.” On the prospect of facing a talented Leinster side, the 23-year-old added: “We’re hugely excited – when the fixtures first got announced at the start of the year, that was one that was highlighted. We want to test ourselves against the best in Europe and that’s where we want to go as a club. “Some people may think our league position is quite false in terms of what we have delivered this year. However, as a playing group and as a management group, the ambition of this club is to be the best in Europe. The only way we are going to get there is by testing ourselves against the current best, so I’m really looking forward to it.” He continued: “The set-piece is going to be massive as it is in every game, but even more so in Europe. It’s also just going to be about taking our opportunities and recognising that these European matches against the top sides become more and more like Test matches. You don’t get four or five opportunities in a game, you get one or two and you either take them or you don’t.”
2023-11-30T01:26:58.646260
https://example.com/article/3062
<?xml version="1.0" encoding="utf-8"?> <LinearLayout xmlns:android="http://schemas.android.com/apk/res/android" xmlns:tools="http://schemas.android.com/tools" android:layout_width="match_parent" android:layout_height="match_parent" android:orientation="vertical" tools:context=".advanced_use.AdvancedUseActivity"> <!-- ViewPager --> <org.wlf.action_tab_pager.view.ActionTabViewPager android:id="@+id/atViewPager" android:layout_width="match_parent" android:layout_height="0dp" android:layout_weight="1"/> <!-- line --> <LinearLayout android:layout_width="match_parent" android:layout_height="1dp" android:background="#EEEEEE"/> <!-- ActionTab --> <include layout="@layout/advanced_use__bottom_action_tab" android:layout_width="match_parent" android:layout_height="wrap_content"/> </LinearLayout>
2023-08-06T01:26:58.646260
https://example.com/article/6542
<!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.01 Transitional//EN" "http://www.w3.org/TR/html4/loose.dtd"> <!-- NewPage --> <html lang="en"> <head> <!-- Generated by javadoc (1.8.0_131) on Fri Jun 23 09:10:16 EDT 2017 --> <meta http-equiv="Content-Type" content="text/html; charset=UTF-8"> <title>Uses of Class ca.uhn.hl7v2.hoh.util.repackage.Base64.Charsets (HAPI - Java HL7 API - HL7 over HTTP 2.3 API)</title> <meta name="date" content="2017-06-23"> <link rel="stylesheet" type="text/css" href="../../../../../../../stylesheet.css" title="Style"> <script type="text/javascript" src="../../../../../../../script.js"></script> </head> <body> <script type="text/javascript"><!-- try { if (location.href.indexOf('is-external=true') == -1) { parent.document.title="Uses of Class ca.uhn.hl7v2.hoh.util.repackage.Base64.Charsets (HAPI - Java HL7 API - HL7 over HTTP 2.3 API)"; } } catch(err) { } //--> </script> <noscript> <div>JavaScript is disabled on your browser.</div> </noscript> <!-- ========= START OF TOP NAVBAR ======= --> <div class="topNav"><a name="navbar.top"> <!-- --> </a> <div class="skipNav"><a href="#skip.navbar.top" title="Skip navigation links">Skip navigation links</a></div> <a name="navbar.top.firstrow"> <!-- --> </a> <ul class="navList" title="Navigation"> <li><a href="../../../../../../../overview-summary.html">Overview</a></li> <li><a href="../package-summary.html">Package</a></li> <li><a href="../../../../../../../ca/uhn/hl7v2/hoh/util/repackage/Base64.Charsets.html" title="class in ca.uhn.hl7v2.hoh.util.repackage">Class</a></li> <li class="navBarCell1Rev">Use</li> <li><a href="../package-tree.html">Tree</a></li> <li><a href="../../../../../../../deprecated-list.html">Deprecated</a></li> <li><a href="../../../../../../../index-all.html">Index</a></li> <li><a href="../../../../../../../help-doc.html">Help</a></li> </ul> </div> <div class="subNav"> <ul class="navList"> <li>Prev</li> <li>Next</li> </ul> <ul class="navList"> <li><a href="../../../../../../../index.html?ca/uhn/hl7v2/hoh/util/repackage/class-use/Base64.Charsets.html" target="_top">Frames</a></li> <li><a href="Base64.Charsets.html" target="_top">No&nbsp;Frames</a></li> </ul> <ul class="navList" id="allclasses_navbar_top"> <li><a href="../../../../../../../allclasses-noframe.html">All&nbsp;Classes</a></li> </ul> <div> <script type="text/javascript"><!-- allClassesLink = document.getElementById("allclasses_navbar_top"); if(window==top) { allClassesLink.style.display = "block"; } else { allClassesLink.style.display = "none"; } //--> </script> </div> <a name="skip.navbar.top"> <!-- --> </a></div> <!-- ========= END OF TOP NAVBAR ========= --> <div class="header"> <h2 title="Uses of Class ca.uhn.hl7v2.hoh.util.repackage.Base64.Charsets" class="title">Uses of Class<br>ca.uhn.hl7v2.hoh.util.repackage.Base64.Charsets</h2> </div> <div class="classUseContainer">No usage of ca.uhn.hl7v2.hoh.util.repackage.Base64.Charsets</div> <!-- ======= START OF BOTTOM NAVBAR ====== --> <div class="bottomNav"><a name="navbar.bottom"> <!-- --> </a> <div class="skipNav"><a href="#skip.navbar.bottom" title="Skip navigation links">Skip navigation links</a></div> <a name="navbar.bottom.firstrow"> <!-- --> </a> <ul class="navList" title="Navigation"> <li><a href="../../../../../../../overview-summary.html">Overview</a></li> <li><a href="../package-summary.html">Package</a></li> <li><a href="../../../../../../../ca/uhn/hl7v2/hoh/util/repackage/Base64.Charsets.html" title="class in ca.uhn.hl7v2.hoh.util.repackage">Class</a></li> <li class="navBarCell1Rev">Use</li> <li><a href="../package-tree.html">Tree</a></li> <li><a href="../../../../../../../deprecated-list.html">Deprecated</a></li> <li><a href="../../../../../../../index-all.html">Index</a></li> <li><a href="../../../../../../../help-doc.html">Help</a></li> </ul> </div> <div class="subNav"> <ul class="navList"> <li>Prev</li> <li>Next</li> </ul> <ul class="navList"> <li><a href="../../../../../../../index.html?ca/uhn/hl7v2/hoh/util/repackage/class-use/Base64.Charsets.html" target="_top">Frames</a></li> <li><a href="Base64.Charsets.html" target="_top">No&nbsp;Frames</a></li> </ul> <ul class="navList" id="allclasses_navbar_bottom"> <li><a href="../../../../../../../allclasses-noframe.html">All&nbsp;Classes</a></li> </ul> <div> <script type="text/javascript"><!-- allClassesLink = document.getElementById("allclasses_navbar_bottom"); if(window==top) { allClassesLink.style.display = "block"; } else { allClassesLink.style.display = "none"; } //--> </script> </div> <a name="skip.navbar.bottom"> <!-- --> </a></div> <!-- ======== END OF BOTTOM NAVBAR ======= --> <p class="legalCopy"><small>Copyright &#169; 2012&#x2013;2017 <a href="http://www.uhn.ca">University Health Network</a>. All rights reserved.</small></p> <script type="text/javascript"> var gaJsHost = (("https:" == document.location.protocol) ? "https://ssl." : "http://www."); document.write(unescape("%3Cscript src='" + gaJsHost + "google-analytics.com/ga.js' type='text/javascript'%3E%3C/script%3E")); </script> <script type="text/javascript"> try { var pageTracker = _gat._getTracker("UA-1395874-4"); pageTracker._trackPageview(); } catch(err) {}</script> </body > </html>
2024-05-07T01:26:58.646260
https://example.com/article/9413
Q: WP functions in .js I have a huge main.js which includes 99% of my JS + plugins' JS. While loading time is a little bit longer when user visits the site for the first time, it gets cached and there will not be any other .js to load on other pages. This creates a problem: I often find myself in situations where I need to use WordPress functions or general PHP in my .js. I could name my main.js to main.php but then it doesn't get cached (by default at least) and it would spend unnessesary server resorces to process this (one of my biggest - currently ~400KB) file. Does anyone have a good strategy how to use WordPress functions inside .js file? A: To access server-side functions you'll need to trigger a server event from JS using AJAX, JSON API, XML/RPC, custom endpoints, or even template_redirect hooks. Just be sure to liberally sprinkle nonces when performing major functions. The simple and proven technique is the AJAX call. Setup a couple handlers when AJAX receives an action while the user is either logged-in or out (nopriv). add_action( 'wp_ajax_add_foobar', 'prefix_ajax_add_foobar' ); add_action( 'wp_ajax_nopriv_add_foobar', 'prefix_ajax_add_foobar' ); function prefix_ajax_add_foobar() { // Handle request then generate response using WP_Ajax_Response } Then trigger the action via JS. The response is whatever you output in the handler but usually wp_send_json_success will work fine. jQuery.post( ajaxurl, { 'action': 'add_foobar', 'data': 'foobarid' }, function(response){ alert('The server responded: ' + response); } ); If the JS needs access to server variables at runtime consider using wp_localize_script for more than text translations. It's really your opportunity to pass inline JS before a script loads. Thus ensuring JS has access to proper URLS, settings and states required for your app. ajaxurl may exist for some people but localizing that onto a variable will assure you that it's the correct url. // Register the script wp_register_script( 'some_handle', 'path/to/myscript.js' ); // Localize the script with new data $translation_array = array( 'some_string' => __( 'Some string to translate', 'plugin-domain' ), 'a_value' => '10' ); wp_localize_script( 'some_handle', 'object_name', $translation_array ); // Enqueued script with localized data. wp_enqueue_script( 'some_handle' ); The JSON API is also a good choice and very easy to setup. The major drawback is that it's only a few weeks old in core (since 4.4) and not fully established (full by 4.5). If you don't mind living on the edge you can be up and running in a short time with custom endpoints. function my_awesome_func( $data ) { $posts = get_posts( array( 'author' => $data['id'], ) ); if ( empty( $posts ) ) { return null; } return $posts[0]->post_title; } add_action( 'rest_api_init', function () { register_rest_route( 'myplugin/v1', '/author/(?P<id>\d+)', array( 'methods' => 'GET', 'callback' => 'my_awesome_func', ) ); } ); XML RPC was cool enough that everyone is switching to the JSON API if they can help it. It's a proven solution but who wants XML these days? add_filter('xmlrpc_methods', function ($methods) { $methods['myNamespace.getTotalImageCount'] = 'rpc_myNamespace_getTotalImageCount'; return $methods; }); function rpc_myNamespace_getTotalImageCount($args) { return array_sum((array)wp_count_attachments('image')); } add_action('parse_request', function () { // PULL USER CREDS FROM CURRENT USER global $current_user; $user = $current_user->user_login; $password = $user->data->user_pass; include_once(ABSPATH . WPINC . '/class-IXR.php'); include_once(ABSPATH . WPINC . '/class-wp-http-ixr-client.php'); $xmlrpc_url = home_url('xmlrpc.php'); $client = new WP_HTTP_IXR_CLIENT($xmlrpc_url); // CALL OUR CUSTOM METHOD $response = $client->query('myNamespace.getTotalImageCount', array(0, $user, $password)); echo 'Response:<pre>'; $count = $client->message->params[0]; print_r("{$count} total images"); echo '</pre>'; wp_die('FIN'); }); If you're curious about how much AJAX you should use then look no further than the future of WordPress.com's pet project Calypso where they redefine the admin back-end using as much JS as possible. All these options are great unless someone turns off JS so keep that in mind when you construct your site. There are also a few tools to help out along the way. Postman - REST Client extension for Chrome can test GET and POST requests - DEMO. Monkeyman Rewrite Analyzer WP plugin can double check your custom rewrite endpoints are working correctly.
2024-03-24T01:26:58.646260
https://example.com/article/6206
Dehydroepiandrosterone-induced peroxisome proliferation in the rat liver. We have investigated the effect of dehydroepiandrosterone (DHEA), a naturally occurring steroid hormone, on hepatic peroxisomes in the rat. Dietary administration of DHEA at a concentration of 0.45% for 2 weeks resulted in a 200% increase in the liver weight and a more than 5.0-fold increase in the volume density of peroxisomes. SDS-polyacrylamide gel electrophoresis of the postnuclear fraction of livers showed a marked increase in the 80,000-molecular weight polypeptide. Northern blot analysis of total RNA showed 2- and 12-fold increases, respectively, in the levels of catalase and peroxisomal enoyl-CoA hydratase/3-hydroxyacyl-CoA dehydrogenase bifunctional enzyme (PBE) mRNA. Administration of a single large dose of DHEA led to a 10- to 40-fold increase in PBE mRNA levels by 24 h. These changes are qualitatively similar to those caused by a variety of structurally different peroxisome proliferators.
2023-09-05T01:26:58.646260
https://example.com/article/3260
Distribution of CTX-M group I and group III β-lactamases produced by Escherichia coli and klebsiella pneumoniae in Lahore, Pakistan. Extended-spectrum-lactamases (ESBLs) of the CTX-M type is worrisome issue in many countries of the world from past decade. But little is known about CTX-M beta-lactamase producing bacteria in Pakistan. Therefore, this study was carried out to investigate the distribution of CTX-M beta-lactamase producing E. coli and Klebsiella pneumoniae using phenotypic and molecular techniques. A total of 638 E. coli and 338 Klebsiella pneumoniae were isolated from patients attending two hospitals and one diagnostic Centre in Pakistan during 2013-2015. ESBL production was screened by double disc synergism, combination disc (cefotaxime and ceftazidime with clavulanic acid) and E-test. These strains were further characterized by PCR (CTX-M I, CTX-M III) and sequencing. After ribotyping of strains accession numbers were obtained. These isolates were highly resistant to cephalosporins, ceftazidime, cefotaxime, aztreonam, and cefuroxime but susceptible to carbapenems, sulfzone, amikacin and tazocin. Multiple antibiotic resistances index (MAR) revealed that 51% of E. coli strains fell in the range of 0.61-0.7 and 39% of Klebsiella pneumoniae strains fell in the range of 0.71-0.8. 64% Double disc synergism (DDS), 76.4% combination disc (CD), 74% E-test showed ESBL positivity in strains. In E. coli ESBL genes blaCTX-M-I and blaCTX-M-III were detected in 212 (72.1%) and 25 (8.5%) respectively. In Klebsiella pneumoniae ESBL genes blaCTX-M-I and blaCTX-M-III were detected in 89 (82.4%) and 10 (9.2%). Combination of both genes blaCTX-M-I and blaCTX-M-III were found in 16 (5.4%) of E. coli strains and 5 (4.6%) of Klebsiella pneumoniae strains. Sequencing revealed that CTXM-15 was predominately present in the CTX-M-I group. The prevalence of ESBL producing E. coli and Klebsiella pneumoniae isolates was high and the majority of them positive for blaCTX-M-I as compared to blaCTX-M-III. These findings highlight the need to further investigate the epidemiology of other CTX-M beta-lactamases in Pakistan.
2023-10-26T01:26:58.646260
https://example.com/article/6007
//------------------------------------------------------------------------------ // <auto-generated> // This code was generated by a tool. // Runtime Version:4.0.30319.42000 // // Changes to this file may cause incorrect behavior and will be lost if // the code is regenerated. // </auto-generated> //------------------------------------------------------------------------------ namespace FormFactory { using System; /// <summary> /// A strongly-typed resource class, for looking up localized strings, etc. /// </summary> // This class was auto-generated by the StronglyTypedResourceBuilder // class via a tool like ResGen or Visual Studio. // To add or remove a member, edit your .ResX file then rerun ResGen // with the /str option, or rebuild your VS project. [global::System.CodeDom.Compiler.GeneratedCodeAttribute("System.Resources.Tools.StronglyTypedResourceBuilder", "15.0.0.0")] [global::System.Diagnostics.DebuggerNonUserCodeAttribute()] [global::System.Runtime.CompilerServices.CompilerGeneratedAttribute()] public class Resources { private static global::System.Resources.ResourceManager resourceMan; private static global::System.Globalization.CultureInfo resourceCulture; [global::System.Diagnostics.CodeAnalysis.SuppressMessageAttribute("Microsoft.Performance", "CA1811:AvoidUncalledPrivateCode")] internal Resources() { } /// <summary> /// Returns the cached ResourceManager instance used by this class. /// </summary> [global::System.ComponentModel.EditorBrowsableAttribute(global::System.ComponentModel.EditorBrowsableState.Advanced)] public static global::System.Resources.ResourceManager ResourceManager { get { if (object.ReferenceEquals(resourceMan, null)) { global::System.Resources.ResourceManager temp = new global::System.Resources.ResourceManager("FormFactory.Resources.Resources", typeof(Resources).Assembly); resourceMan = temp; } return resourceMan; } } /// <summary> /// Overrides the current thread's CurrentUICulture property for all /// resource lookups using this strongly typed resource class. /// </summary> [global::System.ComponentModel.EditorBrowsableAttribute(global::System.ComponentModel.EditorBrowsableState.Advanced)] public static global::System.Globalization.CultureInfo Culture { get { return resourceCulture; } set { resourceCulture = value; } } /// <summary> /// Looks up a localized string similar to {0} must be equal to {1}. /// </summary> public static string Compare { get { return ResourceManager.GetString("Compare", resourceCulture); } } /// <summary> /// Looks up a localized string similar to {0} must be between {1} and {2}. /// </summary> public static string Range { get { return ResourceManager.GetString("Range", resourceCulture); } } /// <summary> /// Looks up a localized string similar to {0} must {1}. /// </summary> public static string RegularExpression { get { return ResourceManager.GetString("RegularExpression", resourceCulture); } } /// <summary> /// Looks up a localized string similar to be {0}. /// </summary> public static string RegularExpression_friendlyformat { get { return ResourceManager.GetString("RegularExpression_friendlyformat", resourceCulture); } } /// <summary> /// Looks up a localized string similar to match pattern &apos;{0}&apos;. /// </summary> public static string RegularExpression_pattern { get { return ResourceManager.GetString("RegularExpression_pattern", resourceCulture); } } /// <summary> /// Looks up a localized string similar to {0} is required. /// </summary> public static string Required { get { return ResourceManager.GetString("Required", resourceCulture); } } /// <summary> /// Looks up a localized string similar to {0} must have between {1} and {2} letters. /// </summary> public static string StringLength { get { return ResourceManager.GetString("StringLength", resourceCulture); } } } }
2023-12-06T01:26:58.646260
https://example.com/article/9768
#include <stdlib.h> #include <stdio.h> #include <limits.h> #include <vector> using namespace std; const int MAXN = 1<<22; const int MAXQ = 1<<22; struct Node { int idx, val; Node *ch[2], *fa; Node() { idx = val = 0; ch[0] = ch[1] = fa = NULL; } } nodes[MAXN]; int A[MAXN], N; vector< pair<int, int> > Q[MAXN]; int visited[MAXN], parent[MAXN], ret[MAXQ]; void init(int n, int q) { N = n; for (int i = 0; i <= n; i++) { Q[i].clear(); parent[i] = i, visited[i] = 0; } } void insert(Node *u, Node *p) { while (p->val < u->val) p = p->fa; u->ch[0] = p->ch[1]; if (p->ch[1]) p->ch[1]->fa = u; p->ch[1] = u; u->fa = p; } void build() { nodes[0] = Node(), nodes[0].val = INT_MAX; for (int i = 1; i <= N; i++) { nodes[i] = Node(); nodes[i].val = A[i], nodes[i].idx = i; insert(&nodes[i], &nodes[i-1]); } } int findp(int x) { return parent[x] == x ? x : parent[x]=findp(parent[x]); } void tree_reverse(Node *from, Node *to) { if (from == to) return ; Node *x = from, *y = from->ch[1], *z; while (true) { z = y->ch[1]; y->ch[1] = x; x = y, y = z; if (x == to) return ; } } void print_reverse(Node *from, Node *to) { tree_reverse(from, to); Node *p = to; while (true) { int u = p->idx; visited[u] = 1; for (int i = 0; i < Q[u].size(); i++) { if (visited[Q[u][i].second]) ret[Q[u][i].first] = A[findp(Q[u][i].second)]; } if (p->fa != NULL) parent[findp(u)] = p->fa->idx; if (p == from) break; p = p->ch[1]; } tree_reverse(to, from); } void tarjan(Node *root) { Node *cur, *prev, tmp; tmp.ch[0] = root; cur = &tmp, prev = NULL; while (cur != NULL) { if (cur->ch[0] == NULL) { cur = cur->ch[1]; } else { prev = cur->ch[0]; while (prev->ch[1] != NULL && prev->ch[1] != cur) prev = prev->ch[1]; if (prev->ch[1] == NULL) { prev->ch[1] = cur, cur = cur->ch[0]; } else { print_reverse(cur->ch[0], prev); prev->ch[1] = NULL, cur = cur->ch[1]; } } } } void add(int x, int y, int qid) { Q[x].push_back({qid, y}); Q[y].push_back({qid, x}); } void offline() { build(); tarjan(nodes[0].ch[1]); } int main() { int N, Q, x, y; while (scanf("%d", &N) == 1) { for (int i = 1; i <= N; i++) scanf("%d", &A[i]); scanf("%d", &Q); for (int i = 0; i < Q; i++) { scanf("%d %d", &x, &y); } for (int i = 0; i < Q; i++) printf("%d\n", x); } return 0; }
2023-12-28T01:26:58.646260
https://example.com/article/7472
92 Decision Citation: BVA 92-00307 Y92 BOARD OF VETERANS' APPEALS WASHINGTON, D.C. 20420 DOCKET NO. 91-36 564 ) DATE ) ) ) THE ISSUES 1. Whether compensable evaluations for a left ankle fracture and a gunshot wound scar of the right forearm are protected under 38 U.S.C. 110. 2. Entitlement to an increased (compensable) evaluation for a gunshot wound scar of the right forearm and an increased evaluation for post-traumatic stress disorder, currently rated 30 percent disabling. 3. Entitlement to an earlier effective date for the grant of service connection for post-traumatic stress disorder. REPRESENTATION Appellant represented by: Paralyzed Veterans of America, Inc. WITNESSES AT HEARING ON APPEAL The appellant, R. Sweisford, R. Wilson, and M. Longmire ATTORNEY FOR THE BOARD R. A. Caffery, Counsel INTRODUCTION The veteran served on active duty from January 1966 to January 1969 and from December 1984 to June 1989. He reentered active duty in January 1991. By rating action dated in June 1990, the Regional Office, Albuquerque, New Mexico, granted service connection for post-traumatic stress disorder effective in November 1989 and assigned a 10 percent rating for that condition. It was indicated that the service-connected left ankle fracture and gunshot wound scar of the right forearm had each been rated 10 percent disabling from January 1969 to December 1984. It was indicated that the evidence was insufficient to evaluate those conditions from December 1984 to November 1989 when each condition was rated noncompensable. In June 1990 the veteran submitted a notice of disagreement with the above rating action. It was maintained that the 10 percent evaluations for the left ankle fracture and gunshot wound scar of the right forearm should be protected under 38 U.S.C. 110 since the ratings had been in effect for more than 20 years. The veteran also disagreed with the 10 percent rating assigned for the post-traumatic stress disorder and the effective date of the grant of service connection for that condition. He was sent a statement of the case in November 1990. A hearing on appeal was conducted in January 1991. The substantive appeal was received in February 1991. The evaluation for the veteran's psychiatric condition was later increased to 30 percent. The veteran indicated that he wished a still higher rating for that condition. The case was received at the Board in July 1991. The veteran is represented by the Paralyzed Veterans of America, Inc., and that organization submitted additional written argument to the Board in August 1991. The case is now ready for appellate review. The veteran indicated in his substantive appeal that he wished to claim service connection for a right shoulder condition as secondary to the service-connected gunshot wound of the right forearm. This matter is not in an appellate status and is referred to the regional office for appropriate action. REMAND The record reflects that the veteran submitted a claim for service connection for a psychiatric condition in May 1971. By rating action dated in June 1971 service connection for a psychiatric condition was denied by the regional office on the basis that the only psychiatric condition present was a personality disorder. The veteran appealed from the decision and was issued a statement of the case. However, he did not perfect his appeal. In November 1989 the veteran submitted a claim for service connection for post-traumatic stress disorder. As indicated previously, by rating action dated in June 1990, service connection was granted for post-traumatic stress disorder, effective from November 1989. The Board notes that the statement of the case that was sent to the veteran in November 1990 does not discuss the prior denial of the veteran's claim for service connection for a psychiatric condition and the effect of that denial on his current claim for an earlier effective date for the grant of service connection for post-traumatic stress disorder. The record also reflects that the veteran was scheduled for a VA examination in February 1991 (examinations by orthopedic and neurological specialists for his right forearm condition and a board of psychiatrists). However, since he had reentered active duty in January 1991, he was unable to report for the examination. The record is not clear as to whether he remains on active duty. In view of the aforementioned matters, findings and fact and conclusions of law are being deferred pending a REMAND for the following action: 1. The veteran should be contacted and asked whether he remains on active duty. If he has been released from active service, his service medical records pertaining to his current period of active duty should be obtained. In addition, he should be afforded examinations by specialists in orthopedics, neurology and psychiatry in order to determine the current nature and severity of his right forearm condition, right shoulder condition and psychiatric disorder. All indicated special studies should be conducted. The claims file is to be made available to the examiners for review. 2. The case should then be reviewed by the regional office. If any denial is continued, to include the issue of service connection for a right shoulder disability on a secondary basis, the veteran and his representative should be sent a supplemental statement of the case and be afforded the appropriate time in which to respond. The supplemental statement of the case should include information about the prior denial of his claim for service connection for a psychiatric condition, the laws and regulations concerning the finality of prior final rating actions and a discussion of the effect of the prior denial on his current claim for an earlier effective date for the grant of service connection for post-traumatic stress disorder. When the above action has been completed the case should be returned to the Board for further appellate consideration, if otherwise in order. No action is required of the veteran until he receives further notice. The purpose of this REMAND is to obtain clarifying data and also to ensure that the veteran shall have been afforded due process of law. The Board intimates no opinion as to the disposition warranted in this case pending completion of the requested action. BOARD OF VETERANS' APPEALS WASHINGTON, D.C. 20420 * JAMES R. ANTHONY WAYNE M. BRAEUER *38 U.S.C. § 7102(a)(2)(A) (1989) (formerly § 4002(a)(2)(A), recodified in 1991) permits a Board of Veterans' Appeals Section, upon direction of the Chairman of the Board, to proceed with the transaction of business without awaiting assignment of an additional Member to the Section when the Section is composed of fewer than three Members due to absence of a Member, vacancy on the Board or inability of the Member assigned to the Section to serve on the panel. The Chairman has directed that the Section proceed with the transaction of business, including the issuance of decisions, without awaiting the assignment of a third Member. Under 38 U.S.C. § 7252 (1989) (formerly § 4052, recodified in 1991), only a decision of the Board of Veterans' Appeals is appealable to the United States Court of Veterans Appeals. This remand is in the nature of a preliminary order and does not constitute a decision of the Board on the merits of your appeal.
2024-07-20T01:26:58.646260
https://example.com/article/4155
Q: Secure String in Visual Basic, Imports & Module I'm experimenting with entering a password and have it stored as a secure string. I found the following code on MSDN. Imports System.Security Module Example Public Sub Main() ' Define the string value to be assigned to the secure string. Dim initString As String = "TestString" ' Instantiate the secure string. Dim testString As SecureString = New SecureString() ' Use the AppendChar method to add each char value to the secure string. For Each ch As Char In initString testString.AppendChar(ch) Next ' Display secure string length. Console.WriteLine("The length of the string is {0} characters.", _ testString.Length) testString.Dispose() End Sub End Module ' The example displays the following output: ' The length of the string is 10 characters. However I'm missing something as when I paste it in the Public Class element I get errors. The errors being as follows: 'Imports' statements must precede an declarations 'Module' statements can occur only at file or namespace level I've tried putting the import statement before any dim statements in my other code this didn't help and also I'm unsure where I should be putting module (ie where is file or namespace level?) Any help greatly appreciated A: The structure of a file in VB .NET Your problem comes from the fact that you might not understand what is a class, a module, and so on... So let's review it... For a complete review of the VB .NET : https://msdn.microsoft.com/en-us/library/aa712050%28v=vs.71%29.aspx But it's kinda long... The Imports Statement This statement is here to say : "Hey Compiler, I am about to use some functions that you will find in this file, please link it to my file" so Imports System.Security means that you import all classes and methods contained in namespace System.Security. Where to place it ? This statement is to placed at the very beggining of your .vb file. It cannot be inside anything else. The only things that can go before is the options (like ´Option Strict On´, but we won't discuss that here...). The Class Statement Placing a class statement means that you are creating a new "blueprint" for an object. You are about to define its methods, property and functionalities. Where to place it ? A class statement goes after the Imports declarations and can be placed inside a namespace, a module or another class The Module Statement A module in VB .NET in nothing else that a Shared Class. If you noticed, you cannot declare a Shared Class, you must declare a module instead. What does that mean ? It means that anything inside your module is accessible without having to instanciate any object. If your module offers the Test method : Public Module MyModule Public Function Test() As String Return "Test" End Function End Module Then you can call that method by doing : '... Anywhere in your code MyModule.Test() Where to place it ? A module is like a class, however it cannot be placed inside another class. It must be placed inside a Namespace or in your file. Hope this helps... So basically Option Strict On Imports System.Security Namespace MyNamespace Public Module MyModule 'My code here Public Class MyClassInsideAModule 'My code here End Class End Module Public Class MyClass 'My code here Public Class MyClassInsideAClass 'My code here End Class End Class End Namespace
2023-09-06T01:26:58.646260
https://example.com/article/5581
Q: Prim's Algorithm input parameter (values) in Python I have looked at the following prim's algorithm (in order to create a minimum spanning tree) and I am unsure as to what the input value s in the following code is, I think the G of course would be the graph sent (adjacency matrix or list graphs) and I think the value s is where the start should be? Also if it is the start then in what way would you send a starting value to the following algorithm?: from heapq import heappop, heappush def prim(self, G, s): P, Q = {}, [(0, None, s)] while Q: _, p, u = heappop(Q) if u in P: continue P[u] = p for v, w in G[u].items(): heappush(Q, (w, u, v)) return P Any help will be much appreciated, thank you! A: Here you are: #A = adjacency matrix, u = vertex u, v = vertex v def weight(A, u, v): return A[u][v] #A = adjacency matrix, u = vertex u def adjacent(A, u): L = [] for x in range(len(A)): if A[u][x] > 0 and x <> u: L.insert(0,x) return L #Q = min queue def extractMin(Q): q = Q[0] Q.remove(Q[0]) return q #Q = min queue, V = vertex list def decreaseKey(Q, K): for i in range(len(Q)): for j in range(len(Q)): if K[Q[i]] < K[Q[j]]: s = Q[i] Q[i] = Q[j] Q[j] = s #V = vertex list, A = adjacency list, r = root def prim(V, A, r): u = 0 v = 0 # initialize and set each value of the array P (pi) to none # pi holds the parent of u, so P(v)=u means u is the parent of v P=[None]*len(V) # initialize and set each value of the array K (key) to some large number (simulate infinity) K = [999999]*len(V) # initialize the min queue and fill it with all vertices in V Q=[0]*len(V) for u in range(len(Q)): Q[u] = V[u] # set the key of the root to 0 K[r] = 0 decreaseKey(Q, K) # maintain the min queue # loop while the min queue is not empty while len(Q) > 0: u = extractMin(Q) # pop the first vertex off the min queue # loop through the vertices adjacent to u Adj = adjacent(A, u) for v in Adj: w = weight(A, u, v) # get the weight of the edge uv # proceed if v is in Q and the weight of uv is less than v's key if Q.count(v)>0 and w < K[v]: # set v's parent to u P[v] = u # v's key to the weight of uv K[v] = w decreaseKey(Q, K) # maintain the min queue return P A = [ [0, 4, 0, 0, 0, 0, 0, 8, 0], [4, 0, 8, 0, 0, 0, 0, 11, 0], [0, 8, 0, 7, 0, 4, 0, 0, 2], [0, 0, 7, 0, 9, 14, 0, 0, 0], [0, 0, 0, 9, 0, 10, 0, 0, 0], [0, 0, 4, 14, 10, 0, 2, 0, 0], [0, 0, 0, 0, 0, 2, 0, 1, 6], [8, 11, 0, 0, 0, 0, 1, 0, 7], [0, 0, 2, 0, 0, 0, 6, 7, 0]] V = [ 0, 1, 2, 3, 4, 5, 6, 7, 8 ] P = prim(V, A, 0) print P [None, 0, 5, 2, 3, 6, 7, 0, 2]
2023-11-23T01:26:58.646260
https://example.com/article/5812
Image: Jussi Nukari / Lehtikuva Significantly relaxing current social distancing restrictions could lead to an explosion of coronavirus cases in Finland and the overburdening of the healthcare system, according to a model developed by a group of Finnish researchers. However they said better testing and contact tracing could go a long way toward reducing the severity of the outbreak. The new model presents a much gloomier outlook than projections put forward by the Finnish Institute of Health and Welfare, THL, estimates. The research group's model predicts that if restrictions are relaxed, more than half of Uusimaa residents would be infected, and some 6,000 people -- nearly one percent of those infected -- could die. Elsewhere in Finland, the mortality rate could be even higher. THL's latest modelling estimates mortality in Finland at 0.2 percent, according to THL expert Jussi Sane. The new model is designed by a group of independent researchers from the Universities of Helsinki and Eastern Finland as well as software developers, but THL researcher Jouni Tuomisto is also part of the team. Their goal was to create a simulation model that would allow Finland's political leadership to make decisions about coronavirus measures. The message in a nutshell: don't relax yet. "I would not recommend thinking that we have seen the worst yet," Tuomisto said. Slowdown not sufficient According to the researchers' simulation Reina (Realistic Epidemic Interaction Network Agent Model), there is a possibility that the coronavirus epidemic could be worse in Finland than it was in Italy. The team has broken Finland's possible responses into two alternatives: either Finland will attempt to slow the spread of the virus or stop it altogether. The modelling can be viewed on the project website here. If the aim is to slow down the epidemic, infections will inevitably continue to spread. In such a case, according to the simulation, the virus could kill 6,000 people in Uusimaa alone and a huge number in Finland within a year. Another alternative is to stop the epidemic with drastic action. In this scenario, current restrictions will continue and contact tracing will be much better than it is now. In such a case, the epidemic would subside by autumn and the number of deaths in Uusimaa, for example, could be around 600, according to the simulation. That would be a tenth of what the death tool could be if restrictions are eased. Regardless of which path Finland chooses, coronavirus is here to stay, according to the researchers. Even if the epidemic was brought to a near halt, it could still erupt again later, depending on the restrictions in force at the time. Tuomisto and his fellow-researchers worked on the model for months and published it on Tuesday. There is no peer review of the model yet. Situation can spiral out of control Researchers estimate that current restrictions on social contact have reduced the number of possible infections to half of what it could have been with pre-pandemic levels of contact. If contact levels continue to be limited for six months, the epidemic would subside in October, the model suggests. However, Tuomisto does not believe that it will be possible to maintain current restrictions for the next six months. Story continues after graphic Image: Harri Vähäkangas / Yle "I have not heard from anyone that the current restrictions will be maintained for six months. That would cause a terrible economic storm," Tuomisto said. The Ministry of Finance estimated on Thursday that measures to restrict the economy would last only three months altogether. Relaxing the restrictions could prove very costly, according to Tuomisto. "The epidemic could get out of control and the situation can easily be ten times worse," Tuomisto warns. If the reduction in close contact will be 30 percent and not 50 percent compared to pre-pandemic times, the epidemic would sweep across the region over the course of the year. Story continues after graphic Image: Harri Vähäkangas / Yle According to Tuomisto, it is not yet known what kind of outcome an uncontrolled epidemic could cause in Finland. "That situation could be two times worse than it is in Italy now. There is good reason to assume that such a situation can occur in Finland if the disease is allowed to spread freely," Tuomisto says. Interactive model simulates outcomes The scenarios were developed using data from the 1.6-million-resident Helsinki and Uusimaa Hospital District (HUS) as the model. Tuomas Aivelo, an ecologist and evolutionary biologist from the University of Helsinki estimated that the fundamental assumptions of the research group's new model are realistic. In practice, the model is almost the same as the model used by London's Imperial College to simulate a pandemic and to advise the UK government. "The assumptions are the best in scientific literature," Aivelo said. Anyone can experiment and adjust the basic assumptions of the open-source epidemic model Reina, and also track the impact of the changes on the course of the epidemic. This can be used to test, for example, how easing restrictions in the summer would affect the outbreak. According to the model, a scenario called ‘summer easing’ would, for instance, lead to an overburdening os intensive care capacity for more than three months. At the same time, the number of deaths would increase more than 60 times compared to the scenario where the current restrictions are in place for another six months. Finland picks middle ground According to researchers, Finland is now at a crossroads. The epidemic may be reined in or it may explode out of control. In order to stop the epidemic, efforts should be made to find and isolate asymptomatic virus carriers to trace the chains of infection. "All other options lead to the disease getting out of hand sooner or later," Tuomisto said. Researchers say large-scale testing alone would reduce deaths by about 75 percent. Combined with contact tracing, fatalities could be reduced by 92 percent. According to the model, authorities will not bring the epidemic under control without extending current distancing measures to six months or introducing large-scale testing and contact tracing. The study emphasises that large-scale testing would enable restrictions to be targeted correctly, allowing a large proportion of Finns to return to a slightly more normal life. When only carriers are isolated from others, restrictions on movement do not have to be applied indiscriminately to everyone, reducing the impact of economic losses on the rest of society. The researchers observed that the Finish approach lies somewhere between slowing down and stopping the epidemic. "The hybrid model tries to minimise the number of cases by increasing testing as much as possible and trying to trace contact chains," Tuomisto commented. However, he pointed out that he has no influence on THL's approach to managing the epidemic.
2024-05-14T01:26:58.646260
https://example.com/article/7997
245 S.W.2d 809 (1952) SMITH v. KAPPLER et al. No. 4-9680. Supreme Court of Arkansas. February 11, 1952. *810 Lee Seamster, E. J. Ball and Hubert L. Burch, all of Fayetteville, for appellant. Jeff Duty and Rex W. Perkins, Fayetteville, for appellees. ROBINSON, Justice. In January, 1920, the wife of W. H. (Uncle Billy) Smith died testate, leaving to her husband a life estate in the home place in Benton County, consisting of about 42 acres, and the remainder to her sons Euell and Roy, with the provision that Euell and Roy should pay to Emma and Bertha, daughters of the testatrix, $400 each, and $200 to Walter, another son. Subsequently, Euell and his wife, Zola, deeded their interest in the property to Emma, who is the wife of Adolph Kappler, one of the appellees herein. At a later date Bertha and Walter deeded their interest to Emma. At that time Emma endeavored to get Roy to convey his interest to her as consideration for Emma supporting their Father, Uncle Billy, for the balance of his life, but Roy declined to do so. About 1933, Uncle Billy moved into the home of the Kapplers, which is not situated on the land here involved, where he lived until his death in January, 1950. A few months after Uncle Billy's death, Roy filed this suit claiming a one-half interest as a remainderman under the will of his Mother. Appellees, the Kapplers, say that they now own all interest in the land, claiming Roy's part by adverse possession. The Chancellor held with the Kapplers, and Roy has appealed. From 1920 until 1940, various people lived on the property as tenants of Uncle Billy. The property forfeited for non-payment of taxes for the years 1934 and '35. It was redeemed by the appellee Kappler, who sought Roy's aid in redeeming, but, although Roy at first promised to help pay for the redemption, he never did pay anything and finally flatly refused to do so. In 1937 the property again became delinquent and was sold to the State for taxes due for that year. Kappler bought the land from the State in 1940, obtaining a State deed to it, which he had recorded. That same year, 1940, Kappler placed his son Gene on the property as a tenant, and Gene and his wife have lived there since that time. Appellees sought to introduce in evidence a decree of the Benton Chancery Court rendered on March 5, 1942, and entered nunc pro tunc as of March 19, 1940, confirming title in the State. The court held the decree inadmissible, but it was made a part of the record. We see no valid objection to it being admitted in evidence, since it is evidence of the fact that the State had title to the land at the time it was sold to Kappler. Incidentally, no attack is made on the validity of the tax sale. Ordinarily, a remainderman, since he has no right of possession, cannot lose his interest by adverse possession during the lifetime of a life tenant for the very simple reason that one must have the right of entry before another can hold adversely to him. Hayden v. Hill, 128 Ark. *811 342, 194 S.W. 19. But, the property can be lost to both the life tenant and the remainderman by failure to pay the taxes. § 84-925, Ark.Stats., provides: "If any person who shall be seized of lands for life or in right of his wife, shall neglect to pay the taxes thereon so long that such lands shall be sold for the payment of the taxes, and shall not within one year after such sale redeem the same according to law, such person shall forfeit to the person or persons next entitled to such land in remainder or reversion, all the estate which he or she, so neglecting as aforesaid, may have in said lands, and the remainderman, or reversioner, may redeem the lands in the same manner that other lands may be redeemed after being sold for taxes; and moreover, the person so neglecting as aforesaid shall be liable in an action to the next entitled to the estate for all damages such person may have sustained by such neglect." In Higginbotham v. Harper, 206 Ark. 210, 174 S.W.2d 668, 669, Mr. Justice Mc-Haney, speaking for the court, said: "Here the duty rested upon appellant, the life tenant, to pay all general taxes, § 13813 Pope's Digest [now § 84-925, Ark.Stats.], and all special assessments, Crowell v. Seelbinder, 185 Ark. 769, 49 S.W.2d 389, 83 A.L.R. 788, to protect his own interest and that of the remainderman. His failure to pay the drainage district tax on betterments resulted in a sale to the district. His failure to redeem from such sale within the time provided resulted in an extinguishment of his title as well as that of appellee in remainder, assuming a valid sale, and forced appellee to purchase from the district to protect his remainder interest. To declare the forfeiture in this case here worked equity, protected the rights of appellee, and did no harm to appellant as he had already lost title by failing to redeem, and it became a means of enforcing appellee's equitable rights." In the case at bar, the life tenant did not redeem the property within one year after it was sold for non-payment of taxes. Any remainderman had the right to redeem, and when redeemed by a remainderman the life tenant had no further interest. The life tenancy then and there terminated. It had fallen in. Uncle Billy lost all interest in the property. Kappler, being the husband of Emma, one of the remaindermen, stood in her shoes, and his purchase from the State amounted to a redemption for the benefit of all the remaindermen. Zackery v. Warmack, 213 Ark. 808, 212 S.W.2d 706; Smith v. Smith, 210 Ark. 251, 195 S.W.2d 45. Kappler pleaded title by adverse possession and, of course, had the burden of proving this affirmative defense. While it is possible for a tenant in common to acquire title by adverse possession, we said in Hardin v. Tucker, 176 Ark. 225, 3 S.W. 2d 11: "In order for the possession of a tenant in common to be adverse to that of his cotenants, knowledge of his adverse claim must be brought home to them directly or by such notorious acts of unequivocal character that notice may be presumed." In the case at bar we think Kappler's proof to be deficient in failing to establish that his possession was actually under a claim of ownership and in failing to show that notice of such a claim was brought home to Roy Smith. First, the adverse character of the possession—since each tenant has an equal right to the possession of land held in common, the fact of possession alone is insufficient to supply the necessary element of hostility. To show that his possession was under a claim of right, Kappler relies upon the fact that he paid the taxes every year and made improvements upon the property. As to the tax payments, Kappler was receiving the rents from the property to the exclusion of his cotenant, and as between the two it was obviously his duty to pay the taxes. As to the improvements, the record is completely silent as to whether any of these improvements were made more than seven years before this suit was filed. Since Kappler had the burden of proof, it was incumbent upon him to supply this information. On the other hand, there is convincing evidence that Kappler did not regard himself as tha owner, as both he and his wife recognized Roy Smith's title during the *812 period of asserted adverse possession. In 1944 Emma Kappler bought the interest of Walter and Bertha in consideration of her agreement to support the parties' father for the rest of his life, and she asked Roy to join in the deed upon these terms. It is evident that Emma would not have assumed this undertaking in return for the conveyance had she believed that her husband already had complete title to the property in which case the deed would have conveyed nothing. Roy testified that after Uncle Billy's death Kappler "offered to buy my part of it, or call it off, and we would even divide." According to Roy, Kappler offered him $500 for his part, the same as he had given Euell for his part. Kappler admits having talked to Roy's attorney and quotes himself as having said: "All I have got is a State deed". Hence, we think the evidence clearly preponderates against the contention that the possession was hostile. Second, the bringing home of notice to Roy—To establish adverse possession against his cotenant Kappler had the burden of proving either that he brought notice home to Roy or that his conduct was so open and unequivocal that Roy should have known of the hostile claim. On neither issue is Kappler's proof convincing. Although Kappler is Roy's brother-in-law and the two saw each other from time to time, Kappler did not testify that he ever told Roy that he claimed the land as his own. Roy testified that he did not learn of Kappler's tax deed "for quite a little bit after he bought it", and that he did not know whether Kappler was claiming the land under the deed, or as a tenant. And, even if Roy were shown to have known of the deed on the date of its execution, still the law treats the transaction as a redemption; so, something more would be required to warn Roy that Kappler considered it a purchase of the fee. Nor was Kappler's hostile possession demonstrated by notorious and unequivocal conduct. After Uncle Billy moved to the Kappler home in about 1933, various people occupied the house on the land now in controversy. Euell lived there for several years and three or four families rented the land from Uncle Billy. Kappler now contends that his adverse possession began when his son Gene moved into the house in 1940, but we cannot see why Gene's occupancy was unequivocally referable to Kappler's purchase from the State. From Roy's point of view possession of the land was changing frequently as tenants moved in and out. Gene moved on the land at a time when Uncle Billy was living in the Kappler home and apparently before Roy ever heard of the State deed. To hold that Gene's occupancy alone was an unequivocal act of hostility would require us to say (a) that Roy then knew of the tax deed, though the proof is that he did not, and (b) that Roy should at once have concluded that Gene was his father's tenant, that Kappler, Sr., had decided to cut off his father-inlaw's life estate at a time when Uncle Billy was living in the Kappler home, and that Kappler, Sr., had also decided to repudiate the half interest that was indisputably vested in Roy, his brother-in-law. In these circumstances it cannot be said that Gene's occupancy of the property was such a clearly adverse maneuver that Roy should have realized that a hostile claim of title was being asserted. We conclude that the appellant's prayer for partition should be granted. The appellee's position is not without equity, however, as he has undoubtedly made improvements upon the property. Upon remand of the case he should be given the benefit of these improvements, eithet by setting them aside to him if the division is in kind or by awarding him the enhanced value of the property by reason of the improvements if the partition is by a sale. Dunavant v. Fields, 68 Ark. 534, 60 S.W. 420; Dobson v. Oil & Gas Commission, 218 Ark. 160, 235 S.W.2d 33. Reversed with directions to enter a decree not inconsistent with this opinion.
2024-04-05T01:26:58.646260
https://example.com/article/1953
Q: Help with these sentences マリコの部屋へ 電話をかけて 男と遊んでる芝居 続けてきたけれど My translation would be something like: I called the place of Maiko to talk about the boy that I am playing around with Is my translation of playing around with correct? Also, it refers to just 1 man, right? A: マリコの部屋へ 電話をかけて 男と遊んでる芝居 続けてきたけれど 中島みゆきの「悪女」の出だしの歌詞ですね。 歌詞全体をどう解釈するか話題になっている歌です。 It is the start line of the lyrics of "悪女 akujo" by a famous singer-songwriter Miyuki Nakajima. How you interpret the whole lyrics is a topic also in Japan. 芝居 in the given sentence is meant by the definition 1, not by 2 in the following list. to play a trick; to put up a false show; to deceive someone to put on a play; to present a play; to give a play So, 「男と遊んでる芝居」means 「男と遊んでる振り making a pretense of playing around with a man」. Is my translation of playing around with correct? Yes, she pretends to "play around with a man", but actually she is not playing around with any man. it refers to just 1 man, right? Yes and No. It might refers one man, his boyfriend, but at the time she is calling Mariko she is not playing around with him as you know. Last but not least, I posted my answer under the condition that I read only the phrase given by the questioner without reading the lyrics written by Miyuki Nakajima. However, the interpretations of the first line of the lyrics by the people who have read the whole of them seem to be totally different from that of me. Here is a variety of interesting interpretations. I recommend that you would make use of them for the training of your imagination after having read the whole of the lyrics. I would suggest that you guys would answer the question only from the standpoint of how to interpret the "芝居" in the given phrase under the condition of not having read the whole of the lyrics.
2023-12-15T01:26:58.646260
https://example.com/article/9051
“I do absolutely believe that the core of the region is downtown St. Louis,” Krewson said. The Post-Dispatch building lease would give Square space for as many as 1,400 local employees, and the company plans to move all of its employees from Cortex to the downtown building within the next few years. Downtown, with a vacancy rate around 15 percent, has among the lowest office rental rates in the region, while Cortex is often much more expensive. Still, the St. Louis region is far cheaper than coastal markets where tech firms such as Square congregate. Square is leasing nearly all of the 235,000-square-foot building, leaving only about 10,000 square feet open. StarLake has only just started to rehab the old newspaper building, so it could be more than a year before Square begins adding employees downtown. Many of Square’s local employees are in compliance, customer support and other back-office functions. But the company has also begun hiring software engineers locally, significant because Dorsey and McKelvey in 2009 relocated the company to San Francisco because of difficulty finding the tech talent here to scale the business.
2024-07-19T01:26:58.646260
https://example.com/article/4193
Q: OWC SSD freezes regularly I installed a new 115GB SSD with a clean lion install in my MacBook pro (2010) with the data doubler containing my old seagate hdd. The install took over five hours, which made me pretty suspicious to begin with. But now I'm seeing why: every 30 seconds or so, whatever app is using the disk seems to completely freeze. Examples: Chrome accessing cache App store downloading Xcode Sublime text saving a file Safari doing anything Dropbox sync I've turned off hard drive sleeping, which helped a bit but the benefits appear to be gone. I've also switched te hibernate mode to kill the image and disabled spotlight. The only general solutions google has suggested that I have yet to do are turn on TRIM (which OWC does not recommend for their drive) and add the noatime mount option. I'm doing a permissions repair now, but I could use more suggestions. Fs_usage and logs don't show anything that catches the eye. A: So, after trying to ignore the problem for a long time, I switched my HDD and my SSD, so my HDD is in the main harddrive channel (where it started) and the SSD is where the optical drive goes. lo and behold, it works. I avoided doing this because I remember at one point you could not have your main OS drive be in the optical drive channel, yet it works. and works beautifully. so clearly the problem is as suspected with apples SATA3 support on that main harddrive channel.
2024-01-24T01:26:58.646260
https://example.com/article/5070
As you’ve most likely seen more than once, Zlatan Ibrahimovic made quite a splash in his MLS debut over the weekend, coming off the bench to bang in the game-tying and game-winning goals for the LA Galaxy in their stunning 4-3 comeback victory over crosstown rivals LAFC. MLS’ latest superstar claims that he isn’t even over his jetlag yet, either, dropping in on ESPN SportsCenter Tuesday night to promise continental domination as he chatted about his move Stateside, his 40-yard wondergoal on Saturday and more. "I mean, I'm still jetlagged,” said the Swedish striker. “I've been here for four days and I'm trying to pass the days with energy as much as possible. It hasn't been easy but people are approaching me and saying 'welcome to LA, it was a crazy goal, was a crazy game,' all positive things. So I just feel happy and I feel welcome." Stating that “my goal is to conquer US” in his typically bold style on one of American sports' most-watched programs, Ibra was also asked to comment on the gorgeous bicycle kick scored by Real Madrid’s Cristiano Ronaldo in UEFA Champions League play on Tuesday. So, Zlatan... What did you make of Cristiano Ronaldo's overhead kick? 😂 pic.twitter.com/2yNxf4LIkj — ESPN UK (@ESPNUK) April 4, 2018 In trademark Zlatan fashion, he compared it to his own overhead wondergoal scored for Sweden against England in 2012. “He's a goal machine, he scored a beautiful goal today, but he should try it from 40 meters and see if it goes in,” said Ibrahimovic with a grin. Ibra also conducted a more in-depth conversation with ESPN FC that's worth reading.
2024-04-02T01:26:58.646260
https://example.com/article/4249
A British teenager collapsed and was rushed to the hospital this week after eating primarily chicken nuggets for the past 15 years. Stacey Irvine, 17, has reportedly survived on her nugget-heavy diet, occasionally supplemented by a bag of chips or piece of toast, since she was a toddler. Doctors have urgerd her to change her ways, but Irvine's case got us wondering: what would actually happen if you ate only one type of food for your entire life? Depends on the poison you pick, but poison it most likely would be. According to Jo Ann Hattner, a nutrition consultant at Stanford University School of Medicine and former national spokesperson for the American Dietetic Association, choosing to eat only one fruit, vegetable or grain would lead to organ failure. Consuming only meat would eventually force your body to start munching on your own muscles. And if you stuck solely to almost any one food (besides fruit), you would develop a serious case of scurvy. "I wouldn't recommend this experiment," said Hattner, who also wrote "Gut Insight" (Hattner Nutrition, 2009), a book about digestive health. No single vegetable or legume has all nine essential amino acids humans need to build the proteins that make up our muscles, Hattner said. That's why most human cultures, without knowing anything about food chemistry, have developed diets centered on complementary veggies that, together, provide all nine. At first, without all the right amino acids, your hair starts to lighten in color and your fingernails get soft. Much worse, "your lean body mass suffers. That doesn't just mean your muscles, but also your heart and your organs." Eventually, your heart shrinks so much you die; this happens, on occasion, with extreme cases of anorexia nervosa. Eating only one type of carbohydrate — just bread or pasta, for example — also causes organ failure, due to amino acid deficiency. On top of that, you'd get scurvy, a horrific disease brought on by lack of vitamin C, an essential component of many of the body's chemical reactions. Thanks to highly unethical experiments carried out on prison inmates in Britain and the United States in the 1940s, we know that scurvy hits after one to eight months of vitamin C deprivation (depending on the quantity one's body has stored to begin with). At first, you feel lethargic and your bones ache. Later, strange spots pop up all over your body and develop into suppurating wounds. You get jaundice, fever, tooth loss and, eventually, you die. [Why Don't Fad Diets Work?] Life as a "meat purist" would also be a dead-end. In addition to lacking vitamin C, most meats contain very few carbs — the easy-to-access packets of energy your body constantly requires to perform even the smallest tasks. "Without carbohydrates, you're going to start to break down some of your muscle mass to get the energy," Hattner said. Again, "muscle" doesn't just mean your biceps. You'll be eating your own heart, too. However, there is one food that has it all: the one that keeps babies alive. "The only food that provides all the nutrients that humans need is human milk," Hattner said. "Mother's milk is a complete food. We may add some solid foods to an infant's diet in the first year of life to provide more iron and other nutrients, but there is a little bit of everything in human milk." Technically, adults could survive on human milk, too, she said; the sticking point would be finding a woman who is willing to provide it (and enough of it). Lacking that option, the second-best choice would be mammalian milk, especially if it is fermented. "Yogurt, which is fermented milk, has a lot of bacteria that is good for the digestive tract," Hattner said. These hypothetical scenarios aren't just whimsical speculation. In many parts of the world, people have no choice but to eat mostly one food: often, rice. Scientists are developing genetically modified rice that contains more vitamins and nutrients, especially vitamin A, in order to fight malnutrition. Figuring out how to pack everything we need into one food is also useful for space travel, Hattner said. "The impetus of a lot of nutritional science is, 'How do we feed people in space?' Scientists are trying to increase the nutritional concentration of food so you don't have a lot of bulk." Editor's Recommendations Natalie Wolchover Natalie Wolchover was a staff writer for Live Science from 2010 to 2012. She hold a bachelor's degree in physics from Tufts University and has studied physics at the University of California, Berkeley. Follow Natalie on Google+.
2024-01-23T01:26:58.646260
https://example.com/article/4026
Obviously because you took a look at their team, took a look at our team, and realized we'd beat their asses? Lol yeah, totally. Seriously, you guys are putting too much stock on the "hey look at their record vs our record, they're a better team!!!!" rationalization. You know what teams worry me? The Bucks, Knicks, Nets, and to a lesser extent Atlanta. Pacers worry me none, Chicago worries me none. Miami doesn't either, they have some dominant forces that are worrying, but I'm confident in our ability to perform against them, you know what you have to do with them, there's no uncertainty on what you have to do against them to win. If we manage it or not, it's nothing for me to worry about. Obviously because you took a look at their team, took a look at our team, and realized we'd beat their asses? Lol yeah, totally. Seriously, you guys are putting too much stock on the "hey look at their record vs our record, they're a better team!!!!" rationalization. You know what teams worry me? The Bucks, Knicks, Nets, and to a lesser extent Atlanta. Pacers worry me none, Chicago worries me none. Miami doesn't either, they have some dominant forces that are worrying, but I'm confident in our ability to perform against them, you know what you have to do with them, there's no uncertainty on what you have to do against them to win. If we manage it or not, it's nothing for me to worry about. so the team that has beaten Boston in each of the last two years, that has only gotten better while Boston has gotten worse, doesn't worry you. Please share whatever you have been taking because it is clearly working as you are clearly separated from your senses.
2024-04-03T01:26:58.646260
https://example.com/article/5838
Filed under: Plants/Manufacturing , Toyota Over the past two years, Toyota has invested more than $2 billion at its North American production facilities, and it apparently doesn’t plan on stopping there. To keep up with recent strong sales, Toyota is investing an additional $200 million at its engine plants in the Southern US to increase production capacity of its V6 engines. The bulk of this money ($150 million) will go to expand Toyota’s engine plant in Huntsville, AL, which is currently responsible for supplying engines – four-cylinder, V6 and V8 – to eight of Toyota’s 12 domestically produced vehicles. That includes the best-selling Toyota Camry (shown above). Toyota didn’t say exactly what improvements are being made to the plant, but this follows last year’s $80 million investment in the plant that is set to be completed by next year raising the engine capacity to 750,000 annual units including 362,000 V6s. The remaining $50 million will go to the casting plants of Toyota-owned Bodine Aluminum in Missouri and Tennessee, which supply engine blocks and cylinder heads to the Huntsville engine plant as well as others in Kentucky and West Virginia. Scroll down below for the official press release. Continue reading Toyota investing $200M in Southern manufacturing Toyota investing $200M in Southern manufacturing originally appeared on Autoblog on Sun, 23 Jun 2013 09:00:00 EST. Please see our terms for use of feeds . Permalink
2024-06-19T01:26:58.646260
https://example.com/article/4725
Q: About Autorun feature in Windows7 I have a Autorun.inf which can work in XP and Vista, but I found Windows7 can't recognize and work with it, does Windows7 drop the autorun feature? A: I think this page should be able to help you: http://www.itechtalk.com/thread3918.html
2024-04-18T01:26:58.646260
https://example.com/article/5522
Q: Loading data into a textbox and then changing it i have made a textbox that gets it's text from a variable linked to a database. ee from class employee and s from class general both work, and the data inside ee is correct. when the page loads, the textbox does show the data inside ee.Field but when i change it and click save it doesnt change and doesnt save the new data in my database , i know for sure the the functions.fieldChange() works and that for some reason it doesnt get into the if(field.text!=ee.Field) (i have checked it using a simple label text change). here is my html: <asp:TextBox ID="field" runat="server"></asp:TextBox><br /> <asp:Button ID="Save" runat="server" Text="Save" OnClick="saveChanges" /> my asp.net: string User; Genral s = new Genral (); public Employee ee; protected void Page_Load(object sender, EventArgs e) { User = Session["User"].ToString(); ee = s.getEmployee(User); this.field.Text = ee.Field; } protected void saveChanges(object sender, EventArgs e) { if (field.Text != ee.Field) { s.fieldChange(User, field.Text); } } What doesnt it work? Thanks for the help A: You need to check ispostback property in page load, when you hit save button it first called postback so it replace the value with the old one and your newly inserted data lost. protected void Page_Load(object sender, EventArgs e) { if(!IsPostBack) { User = Session["User"].ToString(); ee = s.getEmployee(User); this.field.Text = ee.Field; } }
2024-05-30T01:26:58.646260
https://example.com/article/7774
Saturday, February 13, 2010 I am calm and at peace, floating in Well-Being I am at peace in the calm, sure focus on who I am in truth. I can enjoy this life experience because I am always aware of the truth of who I am. I focus on Me as Source and I feel that life-giving Energy flowing into my mind and body. My emotions naturally lift and I feel joy. I practice Well-Being as I choose each thought. For those thoughts that don't please me I choose another that feels better and I quickly and easily bob and float in the calmness of Well-Being. I feel joy for I have learned that peace, surety, comfort, love, passion and all aspects of Well-Being are mine and all I have to do is focus on it. Well-Being is within and without for there is only oneness. I am my own sparkling Universe of joy and delight, magic and moonlight. I am comfortable and happy as joy flows through me. I am confident. Nothing is beyond me and all I desire is within me. I am intuitive, intelligent and bright. My light shines clearly and I am at peace. All good things flow to me and I am excited to unwrap the gift of each day. Thank you for your love, Beloved God Goddess All That Is. Thank you, Darling Abraham, Dear Inner Being and my Vibrational Family and Friends in spirit and in truth. The Creation Box Every time you praise something, every time you appreciate something, every time you feel good about something, you are telling the Universe, "More of this, please. More of this, please." ~Abraham-Hicks, 4/19/97When you are appreciating or when you are loving or when you are acknowledging the value of something, you are in that moment a vibrational match to the Source that is truly you. ~Abraham-Hicks, Spokane, WA, 5/30/00Join me as I appreciate for the joy of it. What we give our attention to grows.
2024-02-02T01:26:58.646260
https://example.com/article/4710
/* * Copyright (C) 2013-2020 Canonical, Ltd. * * This program is free software; you can redistribute it and/or * modify it under the terms of the GNU General Public License * as published by the Free Software Foundation; either version 2 * of the License, or (at your option) any later version. * * This program is distributed in the hope that it will be useful, * but WITHOUT ANY WARRANTY; without even the implied warranty of * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the * GNU General Public License for more details. * * You should have received a copy of the GNU General Public License * along with this program; if not, write to the Free Software * Foundation, Inc., 51 Franklin Street, Fifth Floor, Boston, MA 02110-1301, USA. * * This code is a complete clean re-write of the stress tool by * Colin Ian King <colin.king@canonical.com> and attempts to be * backwardly compatible with the stress tool by Amos Waterland * <apw@rossby.metr.ou.edu> but has more stress tests and more * functionality. * */ #include "stress-ng.h" static const stress_help_t help[] = { { NULL, "copy-file N", "start N workers that copy file data" }, { NULL, "copy-file-ops N", "stop after N copy bogo operations" }, { NULL, "copy-file-bytes N", "specify size of file to be copied" }, { NULL, NULL, NULL } }; static int stress_set_copy_file_bytes(const char *opt) { uint64_t copy_file_bytes; copy_file_bytes = stress_get_uint64_byte_filesystem(opt, 1); stress_check_range_bytes("copy-file-bytes", copy_file_bytes, MIN_COPY_FILE_BYTES, MAX_COPY_FILE_BYTES); return stress_set_setting("copy-file-bytes", TYPE_ID_UINT64, &copy_file_bytes); } static const stress_opt_set_func_t opt_set_funcs[] = { { OPT_copy_file_bytes, stress_set_copy_file_bytes }, { 0, NULL } }; #if defined(HAVE_COPY_FILE_RANGE) /* * stress_copy_file * stress reading chunks of file using copy_file_range() */ static int stress_copy_file(const stress_args_t *args) { int fd_in, fd_out, rc = EXIT_FAILURE; char filename[PATH_MAX - 5], tmp[PATH_MAX]; uint64_t copy_file_bytes = DEFAULT_COPY_FILE_BYTES; if (!stress_get_setting("copy-file-bytes", &copy_file_bytes)) { if (g_opt_flags & OPT_FLAGS_MAXIMIZE) copy_file_bytes = MAX_HDD_BYTES; if (g_opt_flags & OPT_FLAGS_MINIMIZE) copy_file_bytes = MIN_HDD_BYTES; } copy_file_bytes /= args->num_instances; if (copy_file_bytes < DEFAULT_COPY_FILE_SIZE) copy_file_bytes = DEFAULT_COPY_FILE_SIZE * 2; if (copy_file_bytes < MIN_COPY_FILE_BYTES) copy_file_bytes = MIN_COPY_FILE_BYTES; if (stress_temp_dir_mk(args->name, args->pid, args->instance) < 0) goto tidy_dir; (void)stress_temp_filename_args(args, filename, sizeof(filename), stress_mwc32()); (void)snprintf(tmp, sizeof(tmp), "%s-orig", filename); if ((fd_in = open(tmp, O_CREAT | O_RDWR, S_IRUSR | S_IWUSR)) < 0) { rc = exit_status(errno); pr_fail("%s: open %s failed, errno=%d (%s)\n", args->name, tmp, errno, strerror(errno)); goto tidy_dir; } (void)unlink(tmp); if (ftruncate(fd_in, copy_file_bytes) < 0) { rc = exit_status(errno); pr_fail("%s: ftruncated failed, errno=%d (%s)\n", args->name, errno, strerror(errno)); goto tidy_in; } if (shim_fsync(fd_in) < 0) { pr_fail("%s: fsync failed, errno=%d (%s)\n", args->name, errno, strerror(errno)); goto tidy_in; } (void)snprintf(tmp, sizeof(tmp), "%s-copy", filename); if ((fd_out = open(tmp, O_CREAT | O_WRONLY, S_IRUSR | S_IWUSR)) < 0) { rc = exit_status(errno); pr_fail("%s: open %s failed, errno=%d (%s)\n", args->name, tmp, errno, strerror(errno)); goto tidy_in; } (void)unlink(tmp); do { ssize_t ret; shim_loff_t off_in, off_out; off_in = stress_mwc64() % (copy_file_bytes - DEFAULT_COPY_FILE_SIZE); off_out = stress_mwc64() % (copy_file_bytes - DEFAULT_COPY_FILE_SIZE); ret = shim_copy_file_range(fd_in, &off_in, fd_out, &off_out, DEFAULT_COPY_FILE_SIZE, 0); if (ret < 0) { if ((errno == EAGAIN) || (errno == EINTR) || (errno == ENOSPC)) continue; pr_fail("%s: copy_file_range failed, errno=%d (%s)\n", args->name, errno, strerror(errno)); goto tidy_out; } (void)shim_fsync(fd_out); inc_counter(args); } while (keep_stressing()); rc = EXIT_SUCCESS; tidy_out: (void)close(fd_out); tidy_in: (void)close(fd_in); tidy_dir: (void)stress_temp_dir_rm_args(args); return rc; } stressor_info_t stress_copy_file_info = { .stressor = stress_copy_file, .class = CLASS_FILESYSTEM | CLASS_OS, .opt_set_funcs = opt_set_funcs, .help = help }; #else stressor_info_t stress_copy_file_info = { .stressor = stress_not_implemented, .class = CLASS_FILESYSTEM | CLASS_OS, .opt_set_funcs = opt_set_funcs, .help = help }; #endif
2023-08-16T01:26:58.646260
https://example.com/article/2138
Q: determining if sequence has upper bound I am somewhat stuck in my calculations when determining if sequence has an upper bound. The sequence $$x_n = \frac{1}{n+1}+\frac{1}{n+2}+..+\frac{1}{2n-1}+\frac{1}{2n}$$ Is equal to $$\frac{1}{n}(\frac{1}{1+\frac{1}{n}}+\frac{1}{1+\frac{2}{n}}+..+\frac{1}{1+\frac{n}{n}})$$ And so I notice that all the denominators are greater than 1, which means that all terms in the parentheses are less than 1. But how can I determine further if there is an upper bound? A: The largest term is the first, so an obvious upper bound is to set all terms equal to the first one and get $$ x_n < \frac{n}{n+1} <1. $$ You could also say that, since the last term is the smallest, one has $$ x_n > \frac{n}{2n} = \frac 12, $$ which means that $\frac 12 < x_n < 1, n \in \mathbb{N}$. A: By C-S $$\sum_{i=1}^n\frac{1}{n+i}=1+\sum_{i=1}^n\left(\frac{1}{n+i}-\frac{1}{n}\right)=1-\frac{1}{n}\sum_{i=1}^n\frac{i}{n+i}=$$ $$=1-\frac{1}{n}\sum_{i=1}^n\frac{i^2}{ni+i^2}\leq1-\frac{1}{n}\frac{\left(\sum\limits_{i=1}^ni\right)^2}{\sum\limits_{i=1}^n(ni+i^2)}=1-\frac{1}{n}\frac{\frac{n^2(n+1)^2}{4}}{\frac{n^2(n+1)}{2}+\frac{n(n+1)(2n+1)}{6}}=$$ $$=1-\frac{3(n+1)}{2(5n+1)}=\frac{7n-1}{10n+2}<\frac{7}{10}.$$ Actually, $$\ln2=0.6931...$$ Cauchy-Schwarz forever! Actually, by calculus we can show that $$\lim_{n\rightarrow+\infty}\sum_{i=1}^n\frac{1}{n+i}=\ln2.$$ A: Notice the Riemann sum $$\frac1n\sum_{k=1}^n \frac1{1+k/n} < \int_0^1\frac{dt}{1+t} = \log 2$$
2023-08-01T01:26:58.646260
https://example.com/article/3274
#include "Infomap-igraph-interface.h" namespace infomap { void igraphToInfomapNetwork(infomap::Network& network, const igraph_t* graph, const igraph_vector_t *e_weights, const igraph_vector_t *v_weights) { unsigned int numNodes = static_cast<unsigned int>(igraph_vcount(graph)); unsigned int numLinks = static_cast<unsigned int>(igraph_ecount(graph)); double linkWeight = 1.0; igraph_integer_t from, to; for (unsigned int i = 0; i < numLinks; ++i) { igraph_edge(graph, i, &from, &to); linkWeight = e_weights ? (double)VECTOR(*e_weights)[i] : 1.0; network.addLink(static_cast<unsigned int>(from), static_cast<unsigned int>(to), linkWeight); double nodeWeight = 1.0; if (v_weights) { for (unsigned int i = 0; i < numNodes; ++i) { nodeWeight = (double)VECTOR(*v_weights)[i]; } } } network.finalizeAndCheckNetwork(true, numNodes); } }
2024-03-09T01:26:58.646260
https://example.com/article/6750
Contributors Sponsors Release 1682 is again a step forward in making GenomeView as user-friendly as possible. Major new features: Automagic index creation: If you try loading a file that is not yet indexed, GenomeView will now ask to do it for you. Speed and memory improvements: We have significantly optimized the way annotation feature and sequences are handled so it is easier to load monstrous draft genomes with 65,000 contigs and 500,000 annotation items without needing a gigantic computer. Heartbeat monitor: We have added visual clues to the current memory use and network connectivity to help diagnose problems when GenomeView decides to stop working. As usual a number of smaller changes that fix bugs and minor annoyances:
2024-04-14T01:26:58.646260
https://example.com/article/3467
aDepartment of Chemical and Biological Engineering, Korea National University of Transportation, Chungju 380-702, Republic of KoreabDepartment of IT Convergence, Korea National University of Transportation, Chungju 380-702, Republic of KoreacDepartment of Polymer Science and Engineering, Korea National University of Transportation, Chungju 380-702, Republic of KoreadDepartment of Otolaryngology–Head and Neck Surgery, Kosin University College of Medicine, Busan 49267, Republic of Korea Checking for direct PDF access through Ovid Abstract Graphical abstractHighlightsDye conjugated to phenylboronic acid-functionalized fluorescent carbon dots.Fluorescent quenching system allows bacteria detector based switching off-on behavior.High sensitivity and selectivity with diol-containing glucose on bacterial surface.Cheap and high affinity to detect chemoselective ligand-based real-environments.Boronic acid, which can bind chemo-selectively and reversibly to diols, could be used for the early detection of bacteria through its affinity-binding reaction with diol groups on the bacterial cell wall. Herein, we describe the use of a diol-modified fluorescent probe (DYE) conjugated to a nanosensor consisting of phenylboronic acid-functionalized fluorescent carbon dot (FCD) to allow quenching via the Förster resonance energy transfer (FRET) process. Phenylboronic acid is well-known for its preferential affinity for diol-containing molecules through cyclic ester bond formation. Therefore, in the presence of glucose-containing bacteria, the DYE in the cyclic ester form will be released from the FCD and replaced by the bacterial cell forming a new cyclic boronate ester bond with the nanoparticle, inducing recovery of the fluorescence. Quantitatively, the system's detection performance at various bacterial concentrations (101–107 CFU/mL) reached ˜100% after 60 min, indicating that the high binding affinity of the diol moeity on the peptidoglycan (sugar)-rich bacteria was enough to displace the DYE from the boronic acid-functionalized FCD platform. Our facile and tunable fluorescence switch-on system was tested for its ability to detect bacteria in water from a contaminated river. Incredibly, the system was most successful in detecting bacteria in the contaminated river water, thus proving it to be a less expensive and more robust affinity biosensor for the detection of contaminating pathogens in various chemoselective ligand-based environments.
2024-07-06T01:26:58.646260
https://example.com/article/1225
List of Commandants of Cadets of the United States List of Commandants of Cadets of the United States may refer to: List of Commandants of Cadets of the United States Air Force Academy List of Commandants of Cadets of the United States Military Academy
2023-11-25T01:26:58.646260
https://example.com/article/2178
Main menu Post navigation when Your Parents Are Grabbing On Your Nerves Don’t you hate that crap? Because, you’re in no way a little kid ever again! Your parents are initial to aggravate the phreak out of you! It just feels like hanging from the amazingly last string! You grasp you just gotta manage something now, before this is what thing pops! Straight out the box, the first thing you gotta do is relax! You gotta take master over the situation. But, the only way you gone get control much more than the situation is to be able to control your own house first. You gotta recognize that this, kiddo. You, have a pile of control completed your parents! Understand you do! If you completely gone act crazy and erratic (unpredictable to unreliable – inconsistent), then you passed make them act crazy and intermittent too! If you gone wild through and fuss together with throw shish around, then what your entire family think they no longer do? LOL! As they gone follow any lead! They gone wild out and be stupid too! Now that the majority of you understand that these firms will observe your lead, you must be that bigger person here. Ima decide you ask yourself how to achieve Pop finally out ya face, and to are Mommy as a way to shut high for any kind of bit. But, you gone to need on play their part . Now, first basic things at first. You unable to just move away this kind of that. Because, where a person will gone go? Plus, you actually gotta have money in order to really eat, while to polish your clothes, and to help take care to of ourselves. So, i personally gotta be particularly smart at this point. Let’s deal with the mommy a segment first, when you consider that the most likely are, she’s the essential ring-leader present in starting product. First of all, don’t fuss which has her! Primarily because the further you talk with her, the other you passed make her fuss considering you right back! Your business already apprehend she expect she already know every damn thing, you only gotta in close proximity up for a sec. Don’t seek to defend yourself. But let the female pop her trash. Now, in case that she’s striking you, later clearly, people gotta would something about that. Post mean, in the event that she slaps you, consequently you can have to take that a lot of like a complete champ. But, if she has punching you, and impact you while having sticks and leaving bruises and marks, then people gotta achieve out for a additional powerful help. The thing passes for Go. Because, they are their to have a look at care you! Maybe you increasingly feel upset for your amazing life also known as safety, therefore you gotta call our own cops. Don’t feel crappy about they either, considering that you are almost always special, and moreover the area needs you to grow to be safe. Let’s purchase back on track. You know already they gone follow ones own lead. So, whenever mummy get into her unsettled mood, specifically talk terrible and comfy to their. This is considered to be what’s going to calm your girlfriend down. One are! The right way you hold yourself is gonna result how you carries their self too! Dad is simply another figure! He ultimately loves they. He wants the best for you, too! But, he may want to be kind of inane! Because, handle it! Dads are cool, dads may very well be loving, single fathers are interesting and protective, but parents can moreover become a great little stupid when they may want to prove the perfect point. Don’t put or difficult task Pops. Just because you also have control over your boyfriend or girlfriend too. Precisely because they’re louder also may possibly be bigger, aren’t going to mean in which you may want to fear your canine friend.
2024-06-14T01:26:58.646260
https://example.com/article/1940
Excitonic Instability and Pseudogap Formation in Nodal Line Semimetal ZrSiS. Electron correlation effects are studied in ZrSiS using a combination of first-principles and model approaches. We show that basic electronic properties of ZrSiS can be described within a two-dimensional lattice model of two nested square lattices. A high degree of electron-hole symmetry characteristic for ZrSiS is one of the key features of this model. Having determined model parameters from first-principles calculations, we then explicitly take electron-electron interactions into account and show that, at moderately low temperatures, ZrSiS exhibits excitonic instability, leading to the formation of a pseudogap in the electronic spectrum. The results can be understood in terms of Coulomb-interaction-assisted pairing of electrons and holes reminiscent of that of an excitonic insulator. Our finding allows us to provide a physical interpretation of the unusual mass enhancement of charge carriers in ZrSiS recently observed experimentally.
2023-08-20T01:26:58.646260
https://example.com/article/3135
Everything you need to know about casting a ballot in the Texas primaries in Harris County Original reporting provided by Alex Samuels, reporter at The Texas Tribune. Supplemental reporting provided by R. Hans Miller, reporter at Community Impact Newspaper. With less than a month until the March 6 primary elections, races across the ballot are starting to heat up. This year, Texas has the earliest primaries in the country. In 2016, Harris County had 2.2 million registered voters. Of those, 1.3 million voted with more than 953,000 of them voting early. Talk of voter fraud and a court battle over Texas’ 2011 voter ID law may have residents wondering how prevalent voter ID issues are in Harris County. Following the 2016 election, two Harris County poll workers were convicted of voter fraud according to a statement from the County Clerk’s Office. “My office found convincing evidence that voter fraud was committed,” Harris County Clerk Stan Stanart said in a May 2017 statement. “The evidence was provided to the Harris County District Attorney’s Office who presented the case to a Harris County Grand Jury.” No evidence of significant voter fraud in the county was found during that election. Statewide, the primary concern seems to be confusion regarding identification requirements, said Dale Blasingame, senior lecturer at Texas State University’s School of Journalism and Mass Communication. Blasingame headed Texas State’s “Electionland” coverage, a cooperative effort by Politico and various other journalism organizations to monitor the election for voter suppression and fraud using social media research tools. Most of the issues during the 2016 election that the project found involved voters or poll workers not understanding the state’s voter ID requirements. At the time,Blasingame said most issues were quickly handled once brought to the attention of voting authorities. “I believe the strength of the electoral process stems from an informed and engaged citizenry,” Stanart said via the county clerk’s website. “Thus, as chief elections officer of Harris County, I strongly encourage all qualified citizens to exercise their right to vote.” This election cycle has an unusually high number of prominent open races, with eight Texan congressional representatives opting not to run for re-election, and more than a dozen in the state Legislature doing the same. Here is an overview of selected upcoming races, acceptable forms of ID at the polls, and how Texas voters can learn more about the 2018 candidates and races. How do I know if I’m registered to vote? The deadline to register to vote in the upcoming primaries has passed (and Texas doesn’t allow voter registration on the day of an election). If you aren’t already registered, you won’t be able to cast a ballot in this year’s primaries. Using the same portal that voters can use to find out if they’re registered, they can also find their polling location options on election day and during the early voting period. During the early voting period, voters can vote at any location in the county they are registered to vote in, according to secretary of state spokesman Sam Taylor. Depending on where a voter lives, Election day works differently. Some counties participate in the Countywide Polling Place Program which allows voters to vote at any precinct in their county of registration even on the day of an election. For voters in counties who do not participate in the program, they will have to vote in their specific precinct on election day. Voters in Harris County must vote in their district on election day. Voters should visit the county elections website to find their polling location, review a sample ballot and verify their voter registration information. Harris County residents who are voting early may do so at any of the polling locations mapped below. Can I vote for either party? Yes because Texas is an open-primary state. This means voters can decide every two years whether they’d rather help pick the Republican or the Democratic nominees (or hold out and go to third-party conventions). Of note: Whatever primary you decide to vote in, you can only vote in that same party’s runoff, if a runoff is held. What form of ID do I need to bring to the polls? If you’re confused about what ID to bring to the polls for the 2018 election, you’re probably not alone. The legal wrangling over the state’s requirements has turned rather complicated. Here are the seven types of photo ID that will be accepted at the polls for the primaries: A state driver’s license issued by the Texas Department of Public Safety (DPS) A Texas election identification certificate (issued by DPS) A Texas personal identification card (issued by DPS) A Texas license to carry a handgun (issued by DPS) A U.S. military ID card that includes a personal photo A U.S. citizenship certificate that includes a personal photo A U.S. passport So, what if I don’t have one of the seven approved forms of ID? If you have qualifying photo ID, bring it. But if you have not obtained one, you can still cast a ballot. Voters who do not have any of those documents and cannot “reasonably obtain” them can still cast a vote if they sign a form in which theyswear that they have a “reasonable impediment” from obtaining appropriate identification. Those voters will also have topresent one of the following types of ID: Valid voter registration certificate Certified birth certificate Copy or original of a current utility bill, bank statement, government check, paycheck or other document that shows the voter’s name and address (any government document that contains a voter’s photo must be an original) A “reasonable impediment” can include a lack of transportation, disability or illness, family responsibilities or lost or stolen identification, among other things. And election judges may not question a voter about the reasonableness of a claimed impediment. The “reasonable impediment” declaration forms will be available at each polling location. Voters are not expected to fill them out ahead of time, Taylor said. Who will I be voting for? For both parties, the race for U.S. Senate will be at the top of the ballot. U.S. Sen. Ted Cruz is vying against four other Republicans in his bid for re-election and U.S. Rep. Beto O’Rourke, D-El Paso, is the most well-known of three Democrats aiming to unseat him. At the state level, nine candidates are crowding the Democratic gubernatorial primary, with the highest-profile being former Dallas County Sheriff Lupe Valdez and Houston entrepreneur Andrew White, son of late Texas Gov. Mark White. And Republican Land Commissioner George P. Bush is running for re-election andfacing three primary challengers including Jerry Patterson, who previously held the job. Lower on the ballot, all of the seats in the Texas House of Representatives and half of those in the Texas Senate are up for re-election. In addition, the Republican party of Texas will pose several propositions at the bottom of its primary ballot related to property taxes, E-verify, toll roads, Obamacare and more. Harris County Republicans will see options for the county clerk, treasurer, school trustees, county commissioners for precincts 2 and 4, multiple justices of the peace and the county and precinct chairpersons for the party. Democrats will have options for those same countywide seats and for their party chairs for their respective precincts and the county. Incumbent Ed Emmett, R-Houston, is running for reelection, while Linda Hidalgo, D-Houston, is seeking her party’s nomination for the role. Stanart is also running for the county clerk position again, and will be facing one of three Democratic challengers, Diane Trautman of Humble, Gayle Young Mitchell or Nat West, according to the Texas Secretary of State’s office. Both Young Mitchell and West are from Houston. What would it take for an election to end up in a runoff? If no candidate receives a majority of the vote in the primary (i.e. 50 percent of the votes plus at least one additional vote) the top two vote-getters will compete in a primary runoff on May 22. With several competitive races with multiple candidates shaping up across the state, it’s likely some will result in runoff elections. Eight Texans in the U.S. House aren’t running for re-election, which has led to some packed races to replace them, including 18 Republicans and four Democrats running for the seat U.S. Rep. Lamar Smith, R-San Antonio, has held for more than 30 years. There’s also expected to be competitive Democratic primaries for at least three congressional district seats. Republican U.S. Reps. John Culberson of Houston, Pete Sessions of Dallas and Will Hurd of Helotes have emerged as top targets for Democrats in November, and in each district, several Democrats are vying to be their party’s nominee. How can I learn more about 2018 candidates and races? The Texas Tribune and Community Impact Newspaper are following the 2018 races closely. Sign up for The Brief from The Texas Tribune for a daily rundown of election and government news in your inbox. Community Impact Newspaper and The Texas Tribune have established a partnership to share essential Texas politics and policy updates. The Texas Tribune is a nonprofit nonpartisan news organization that informs and engages with Texans about public policy, politics and their government. Learn more at texastribune.org
2023-08-04T01:26:58.646260
https://example.com/article/3781
Q: All Tasks..Advanced Operations option missing from Certificates MMC Snap-In I am trying to follow the instructions in this article to create a custom certificate to support SSL on a web server. I'm stuck on the following step: Click on Personal – All Tasks – Advanced Operations – Create Custom request The problem is that on the web server (Windows Server 2003 R2) I don't have an "Advanced Operations" option under "All Tasks". I do on my desktop machine (Windows 7), but not on the server. All the documentation I can find indicates that it should be available on WS-2003-R2, but it just isn't. Note: I'm going through this manual process because I need to specify a alternate host names in the CSR, which you can't do through the IIS 6.0 console certificate managment functionality. Any suggestions for how to make this option show up? A: That menu option is not a feature on Windows 2003 R2. You may want to do this through the command line, it is more flexible. How to use the Certreq.exe utility to create and submit a certificate request that includes a SAN http://support.microsoft.com/kb/931351 http://technet.microsoft.com/en-us/library/cc736326%28WS.10%29.aspx http://blogs.technet.com/b/niraj_kumar/archive/2009/02/11/how-to-request-certificate-from-third-party-ca-and-install-it-on-the-machine.aspx certreq -new request.inf certnew.req certreq -accept cert.cer C:\UTIL>certreq -v -? certreq.exe: 5.2.3790.1830 retail (srv03_sp1_rtm.050324-1447) Usage: CertReq -? CertReq [-v] -? CertReq [-Command] -? CertReq [-Submit] [Options] [RequestFileIn [CertFileOut [CertChainFileOut [FullResponseFileOut]]]] Submit a request to a Certification Authority. -attrib AttributeString -binary -config ConfigString -crl -rpc CertReq -Retrieve [Options] RequestId [CertFileOut [CertChainFileOut [FullResponseFileOut]]] Retrieve a response to a previous request from a Certification Authority. -binary -config ConfigString -crl -rpc CertReq -New [Options] [PolicyFileIn [RequestFileOut]] Create a new request as directed by PolicyFileIn -attrib AttributeString -binary -cert CertId CertReq -Accept [CertChainFileIn | FullResponseFileIn | CertFileIn] Accept and install a response to a previous new request. CertReq -Policy [Options] [RequestFileIn [PolicyFileIn [RequestFileOut [PKCS10FileOut]]]] Construct a cross certification or qualified subordination request from an existing CA certificate or from an existing request. -attrib AttributeString -binary -cert CertId CertReq -Sign [Options] [RequestFileIn [RequestFileOut]] Sign a cross certification or qualified subordination request. -binary -cert CertId -crl Description: -any - Force ICertRequest::Submit to determine encoding type -attrib AttributeString - Request attribute string -binary - Output files in binary format instead of Base64-encoded -cert CertId - Specify signing certificate by common name, serial number, or by sha-1 Key or cert hash -config ConfigString - Server\CertificationAuthority config string or use a single minus sign (-) as config string -crl - Include CRLs in CertChainFileOut or RequestFileOut -f - Force overwrite of existing files -q - Suppress all interactive dialogs -rpc - Use RPC instead of DCOM server connection -v - Display Full Response Properties -? - Display this usage message RequestFileIn - Base64-encoded or binary input file name: PKCS10 certificate request, CMS certificate request, PKCS7 certificate renewal request, X-509 certificate to be cross-certified, or KeyGen tag format certificate request RequestFileOut - Base64-encoded output file name PKCS10FileOut - Base64-encoded PKCS10 output file name CertFileOut - Base64-encoded X-509 file name CertChainFileOut - Base64-encoded PKCS7 file name FullResponseFileOut - Base64-encoded Full Response file name ConfigString - Backslash separated Server Name and Certification Authority Name: MachineDnsName\CAName AttributeString - Colon separated Name and Value string pairs Each pair separated by a backslash and "n" Example: "Name1: Value1\n Name2: Value2" PolicyFileIn - INF file containing a textual representation of extensions used to qualify a request [NewRequest] Subject = "CN=..,OU=...,DC=..." PrivateKeyArchive = TRUE KeySpec = 1 KeyLength = 1024 RenewalCert = CertId SMIME = TRUE Exportable = TRUE UserProtected = TRUE KeyContainer = "..." MachineKeySet = TRUE Silent = TRUE ProviderName = "Microsoft Enhanced Cryptographic Provider v1.0" ProviderType = 1 UseExistingKeySet = TRUE RequesterName = DOMAIN\User RequestType = PKCS10 | PKCS10- | PKCS7 | CMC KeyUsage = 0x80 EncipherOnly = TRUE
2024-02-09T01:26:58.646260
https://example.com/article/9633
Chordoma of the Clivus and Acute Myeloid Leukemia: Is There a Connection? Chordoma is a rare cancer in children and understanding the genesis of this tumor may contribute to treatment approaches. Evidence has proposed VDC/IE (vincristine, doxorubicin, cyclophosphamide/ifosfamide, etoposide) as a treatment option for young patients with chordoma to avoid the long-term effects of radiation therapy. We present a case of acute myeloid leukemia developing during treatment of localized chordoma of the clivus in a 20-month-old male. We propose a genomic relationship that may have contributed to the development of clival chordoma and acute myeloid leukemia without a latency period and advocate for genomic sequencing in children with chordoma before the initiation of systemic therapies.
2023-10-07T01:26:58.646260
https://example.com/article/9352
Liverpool's Luis Suárez was named Premier League player of the month after scoring 10 goals in December, the first player to reach double figures in a calendar month. Photograph: Andrew Powell/Liverpool FC via Getty Images Luis Suárez says he is a changed man and is constantly working to improve his attitude on the pitch while his Liverpool team-mate Steven Gerrard said that claiming the Premier League title would top his Champions League-winning heroics. Suárez told ESPN: "My temperament, attitude, desire and hunger when I am on the pitch has always been like this and will continue to be this way. I now know I have to control it more." The striker added: "An example of this was about two weeks ago when I had an open shot at goal and hit the post and it rebounded close to my hand, and I was about to go for it and then I stopped. "If the same thing had happened two months ago I would have gone for it. These things stay with me but I tell you I am changing. I am improving my attitude on the pitch because I know I was wrong in the past and I was creating an image of myself I know wasn't me." Suárez has played only 15 league matches as he had to serve the remaining half of a 10-match ban for biting Chelsea's Branislav Ivanovic in April. The season before that the 26-year-old was banned for eight matches after being found guilty of racially abusing Manchester United's Patrice Evra. Gerrard is excited by the prospect of this season being his best chance to win the only domestic honour which has eluded him. The 33-year-old would "snap your hand off" for a fourth-place finish even if the midfielder feels the club can achieve better. Liverpool, fourth heading into the weekend, were top on Christmas Day and the last team not to win the title having held that position were the Reds in 2008. "This is probably my best chance to surprise this country and countries throughout the world to maybe nick the Premier League," he told Sky Sports. "Sitting here in the middle of January I have a fantastic chance of having a right good crack and getting involved in a title race. "I've finished second on a couple of occasions but we've never come really close. If we perform like we have done over the last couple of months, we can get involved in the title race so that is very exciting. "It scares me in a way because I don't know how I'd handle myself. When I won the Champions League [in 2005] the week after that talk about being on cloud nine or over the moon – all the clichés – it was better than that. "If I could add a Premier League title to my collection it would mean the world to me, it would probably be the best day of my life besides my kids being born. I think it would top the Champions League because it is the one I haven't got." Liverpool have not featured in Europe's elite club competition since 2009 and Gerrard admits what is most important is regaining that status. "I'd take fourth now," he said. "We have been out of the Champions League for so long, to have that chance to play a couple of qualifiers against sides you should beat – I'd snap your hand off but I am confident we can finish higher. "The manager mentions the Champions League, he sets us aims and challenges and, of course, Champions League is the talk around the place all the time – but that was the case when we didn't qualify for it. "For the players it is the ultimate competition to be involved in and you want to compete against the best. All the lads who are a lot younger than me at this club need to play and sample it." Sign up for the Guardian Today Our editors' picks for the day's top news and commentary delivered to your inbox each morning.
2024-06-25T01:26:58.646260
https://example.com/article/8333
11 Easy Weeknight Paleo Recipes An easy, healthy halibut dinner for two, on a salad of mixed greens with avocado and orange. Eat citrus in moderation because of the high sugar content, and swap the canola oil for coconut or avocado oil, which also have a high burn point.
2024-02-09T01:26:58.646260
https://example.com/article/4408
Movement protein-derived resistance to triple gene block-containing plant viruses. Two mutant potato virus X (PVX) movement protein (MP) genes (m 12K-Sal and m 12K-Kpn) were obtained by inserting specific linkers at the boundary between the N-terminal hydrophobic and putative transmembrane segment, and the central invariant hydrophilic region of the respective 12 kDa, 12K, triple gene block (TGB) protein. Several transgenic potato lines which expressed m 12K-Sal or m 12K-Kpn to different degrees were resistant to infection by PVX, potato aucuba mosaic potexvirus and the carlaviruses potato virus M and S over a wide range of inoculum concentrations (3-300 micrograms/ml). However, they were not resistant to potato virus Y, which lacks a TGB protein. We suggest that the resistance of m 12K-Sal and m 12K-Kpn transgenic potato lines is MP-derived and not RNA-mediated.
2023-09-01T01:26:58.646260
https://example.com/article/3477
<refentry xmlns="http://docbook.org/ns/docbook" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:xi="http://www.w3.org/2001/XInclude" xmlns:src="http://nwalsh.com/xmlns/litprog/fragment" xmlns:xsl="http://www.w3.org/1999/XSL/Transform" version="5.0" xml:id="admon.style"> <refmeta> <refentrytitle>admon.style</refentrytitle> <refmiscinfo class="other" otherclass="datatype">string</refmiscinfo> </refmeta> <refnamediv> <refname>admon.style</refname> <refpurpose>Specifies the CSS style attribute that should be added to admonitions.</refpurpose> </refnamediv> <refsynopsisdiv> <src:fragment xml:id="admon.style.frag"><xsl:param name="admon.style"> <xsl:value-of select="concat('margin-', $direction.align.start, ': 0.5in; margin-', $direction.align.end, ': 0.5in;')"/> </xsl:param></src:fragment> </refsynopsisdiv> <refsection><info><title>Description</title></info> <para>Specifies the value of the CSS <tag class="attribute">style</tag> attribute that should be added to admonitions. </para> </refsection> </refentry>
2024-02-24T01:26:58.646260
https://example.com/article/7326
1. Field The present invention relates to pharmaceutical compositions. More particularly, the invention relates to a solid pharmaceutical composition comprising a) a solid pharmaceutically active compound which has a melting point xe2x89xa737xc2x0 C. and b) a fatty acid or a fatty acid salt or a mixture of a fatty acid and a fatty acid salt, characterized in that the constituents of a) and b) show a depression of their melting points to xe2x89xa637xc2x0 C. upon contact with an aqueous solution. 2. Description Many pharmaceutically active compounds exhibit low solubilities and low dissolution rates in the biological environment. Examples include cyclosporine, nifedipine, ritonavir, griseofulvin, ubidecarenone, danazol, halofantrine, and tetrahydrolipstatin. Because of the low solubility and the low dissolution rate of the pharmaceutically active compounds, only a certain percentage of the drug molecules is dissolved from the crystals. Undissolved drug crystals exhibit no or very limited therapeutic activity in most cases, independent whether a systemic action (requires drug absorption) or a localized effect (within the lumen of the gastrointestinal tract) is desired. Due to the low dissolution of the active compound, higher doses have to be administrated which might result in an increased danger of side effects. Furthermore it has been found that the presence of food might effect the dissolution, absorption and activity of the compound to a large extend. As an example, the bioavailability of alpha-tocopherol-nicotinate increased 28-fold in the fed status compared to the fasted state [William N. Charman et al., J. Pharm. Sci: 86, 269-282 (1997)]. Other examples include danazol, halofantrine and etretinate. It is obvious for those skilled in the art that the high impact of food on the dissolution of the drug leads to an unpredictable performance of the drug. However, a low variation of the drug dissolution is a necessity to achieve the desired concentration for the pharmaceutically effect and to avoid the toxic effects due to overdosing. A pharmaceutically active compound can only be accepted if a reliable pharmacokinetic profile can be achieved. The need of the development of drug delivery systems to overcome the high variation of drug dissolution has been widely recognized. Approaches include the development of solid dispersions (xe2x80x9csolid solutionxe2x80x9d) [A. T. M. Serajuddin, J. Pharm. Sci., 88, 1058-1066 (1999)]. The main disadvantage of this approach is the thermodynamic instability of the supersaturated solid dispersion, which might lead to crystallization processes leading to decreased dissolution velocities and unpredictable bioavailbilities. Another approach to decrease the impact of food effects is the production of drug nanoparticules by wet-milling (U.S. Pat. Nos. 4,540,602 and 5,145,684) or High Pressure Homogenization (U.S. Pat. No. 5,858,410). However, disadvantages include the contamination of the product with abrasive material from the milling process. Furthermore, both processes require the presence of suspending liquids and the primary product is a nanosuspension and not dry nanoparticles. The prevention of the increase in particle size due to aggregation or Ostwald ripening is very challenging. Stabilization of the submicrometer sized particles often requires the time and cost intensive removal of the previously added suspension liquid by drying or cryodrying processes. Other disadvantages include the long processing time in wet milling (hours to several days) and the increase in temperature and the possible formation of radicals during the high pressure homogenization process [R. Lander et al., Biotechinol. Prog., 16, 80-15(2000)]. Changes of drug modifications have also to be considered as a result of the milling processes. It must also be kept in mind, that amorphous drug molecules and drug nanoparticles might degrade faster than the unprocessed material due to the increased surface area. Other approaches include the administration of the solubilized pharmaceutically active compound. However, this approach might lead to problems related to the chemical stability of the active compound, because degradation processes will occur more rapidly in the solubilized state compared to the crystalline state. For example, lipase inhibitor molecules orlistat (tetrahydrolipstatin), or structurally related compounds, e.g. 2-oxy-4H-3,1-benzoxanzin-4-ones as described in WO00/40569, or 2-oxo amide triacylglycerol analogues [S. Kotsovolou et al., J. Org. Chem., 66: 962-967 (2001)] are molecules that may degrade during storage by different mechanisms. It is well known that degradation velocity depends to a large extent from the physicochemical state of the active compound. In general, drug crystals have higher chemical stability compared to drug molecules in the amorphous or liquid state. Therefore, for good storage stability it is desirable to incorporate drug molecules in the crystalline form into the drug delivery system. It is, however, also well known, that in most cases pharmacoactivity is related to physicochemical states with high mobility, e.g. the solubilized or molten molecule. Therefore, from the point of pharmacoactivity, the drug molecule must be either given in a solubilized form or transform into a solubilized form within the body. Both stability and activity aspects have to be considered. Therefore, the development of a drug-crystal loaded carrier which releases a solubilized drug is the most desirable case. This concept is easily realized for water-soluble drugs (e.g. ascorbic acid). However, the in situ transformation of poor water-soluble drugs remains a challenge. The subject invention addresses this challenge. The subject invention provides a solid pharmaceutical composition, which comprises a solid pharmaceutically active compound that has a melting point xe2x89xa737xc2x0 C., and a fatty acid or a fatty acid salt or a mixture of a fatty acid and a fatty acid salt. The pharmaceutically active compound and the fatty acid or a fatty acid salt or a mixture of a fatty acid and a fatty acid salt are present in amounts such that when the composition is contacted with an aqueous solution having a pH value xe2x89xa68, the melting point of the composition is less than the melting point of the solid pharmaceutically active compound and xe2x89xa637xc2x0 C.
2023-09-07T01:26:58.646260
https://example.com/article/8451
Anticoagulation After Biological Aortic Valve Replacement: Is There An Optimal Regimen? The anticoagulation of biological heart valves remains a 'hot spot' of discussion in various domains due to the risk of developing valve thrombosis and arterial thromboembolism. The situation has always been controversial, especially during the early postoperative phase. The American College of Cardiology/ American Heart Association and European Society of Cardiology guidelines recommend the use of warfarin for the first three months after biological aortic valve replacement (BAVR), although the American College of Chest Physicians guidelines suggest that these recommendations are experience-based and that the risk/benefit is unclear. The aim of the present study was to compare the efficacy of aspirin and warfarin in patients after BAVR. A total of 863 patients who underwent BAVR between 2008 and 2015 was allocated to two groups. Each group was managed with a specific anticoagulation regimen, with 430 patients receiving warfarin during the first three postoperative months, and 433 receiving aspirin. The major study end points were bleeding, cerebral ischemic events, and survival. In total, 10 and 15 postoperative cerebral ischemic events occurred between 24 h and three months after surgery in patients treated with aspirin and warfarin, respectively. After three months the incidence of cerebral ischemic events did not differ greatly between the two groups. The rate of major bleeding events and rates of stroke-free survival and overall survival were not statistically significant between the warfarin and aspirin groups. Plasma anticoagulation with warfarin during the early postoperative phase was shown statistically to be inferior to platelet aggregation inhibition by aspirin with regards to postoperative bleeding risk, cerebral ischemic events, and survival.
2023-12-04T01:26:58.646260
https://example.com/article/4378
[Analysis on tyrosine kinase inhibitor discontinuation in patients with chronic myeloid leukemia in the real world: experience from single center]. Objective: To explore status of tyrosine kinase inhibitor (TKI) discontinuation in patients with chronic myeloid leukemia (CML) in the chronic phase (CP) in the real world, to analyze causes, factors and outcomes associated with TKI discontinuation and the possibility of pursuit treatment-free remission (TFR) in China. Methods: From January 2013 to August 2016, data of CML-CP patients in Peking University People's Hospital which were not enrolled in clinical trials were retrospectively collected and analyzed. Results: Data of 662 CML-CP patients were collected. With a median follow-up after TKI-therapy of 26 months (range, 3-187 months) , 187 patients (28.2%) experienced TKI cessation of at least 2 weeks. Causes of TKI discontinuation included hematologic adverse events 57.8% (n=108) , non-hematologic adverse events 30.4% (n=57) , financial burden 25.1% (n=47) , and others 7.0% (n= 13) . Multivariate analyses showed female, ≥40 years, no co-morbidity, and interval from diagnosis to TKI initiation ≥6 months, TKI switch and patients from other hospitals were factors associated with TKI discontinuation because of hematologic adverse effects. Female and patients from other hospitals were factors associated with TKI discontinuation because of non-hematologic adverse effect. TKI switch, generic TKI used and patients from other hospitals were factors associated with TKI discontinuation because of financial toxicity. Patients TKI discontinuation because of hematologic, non-hematologic or financial toxicity achieved a lower complete cytogenetic response or complete molecular response (CMR) than those with uninterrupted TKI-therapy. Patients with TKI discontinuation because of hematologic or financial toxicity had a shorter progression-free survival than those with uninterrupted TKI-therapy. 5 of 7 patients who obtained sustained CMR and discontinued TKI-therapy experienced disease recurrence with a median duration of 3 months (range, 2-32 months) . In 39 patients from other hospitals who aimed to confirm their optimal response of sustained CMR in Peking University People's Hospital, 21 (53.8%) were BCR-ABL positive. Conclusion: In the real world in China, half of CML-CP patients who discontinued TKI-therapy were incurred to TKI-related hematologic adverse effect, and both a quarter of them, TKI-related non-hematologic toxicities and financial toxicity, respectively. Discontinued TKI-therapy due to hematologic adverse events or financial toxicity was associated with lower TKI-therapy response rates. Nowadays, based on the Chinese situation, it is too early to talk about TFR.
2024-05-02T01:26:58.646260
https://example.com/article/1802
--- author: - 'Daniel R. McCusker, Ruben van Drongelen,' - Timon Idema title: Dynamics beyond the jamming density --- Introduction ============ Many biological systems consist of collections of individuals. Examples include herds of mammals, flocks of birds, bacterial colonies, and tissues. Such systems are intrinsically nonequilibrium, as each microscopic unit composing the system consumes energy to propel itself. One of the earliest self-propelled particle models was proposed by Vicsek *et al.* and describes the flocking behavior of birds [@Vicsek1995]. Since then, many more variants of self-propelled particle models have emerged [@Vicsek2012]. In some cases, like flocks of birds, the agents can be modeled as point particles with no excluded volume. For bacterial colonies and tissues, however, the density is so high that the cells are in physical contact with each other. At such a high density, these systems risk becoming jammed. Nonetheless, the constituents rely heavily on rearrangements for their survival, leading us to ask how such colonies prevent jamming. The phenomenon of jamming has been studied as a feature of granular systems, which are composed of finite-sized particles with purely repulsive potentials. Such systems undergo a phase transition from a “liquidlike” phase to a “solidlike” phase with increasing density, characterized by a sudden arrest of the motion of the constituent particles, which are then locked into a small subset of their phase space. This transition has a nonequilibrium character due to the dissipative forces of particle interactions, yet much work has been done to extend the methods of equilibrium statistical physics to such systems [@Behringer2008; @Bi2014]. The jamming transition is qualitatively sketched in jamming phase diagrams, which indicate the locations of the jammed and unjammed (solid and liquid) states in temperature-density-stress space; a system becomes jammed at a “high enough” density, with “low enough” stress and temperature [@Liu1998; @Trappe2001]. For athermal particles in two dimensions with no applied stress, this transition occurs at a critical packing fraction $\rho_c = 0.842$ [@OHern2003]. Previous research has been done to understand the behavior of biological systems at very high density. For instance, in a confluent tissue model with a self-propulsion force, the jammed state is distinguished by a sudden drop in the diffusion constant, as well as a simultaneous change in the cell geometry [@Bi2016]; this transition was also observed in experiments [@Angelini2011]. Other approaches include vertex models for epithelial cells, in which the dynamics of vertices of polygonal cells are governed by some equation of motion [@Alt2017], and Voronoi models, which model cells as Voronoi cells [@Sussman2017]. Self-propelled particle models assign to each cell a self-propulsion force, and include various cell shapes, including point-like, circular disks, elliptical disks, and rods. There are a variety of approaches to the rotational dynamics of SPP models, including self-propelled disks without neighbor alignment [@Fily2014], alignment with the instantaneous velocity [@Henkes2011; @Sknepnek2015] and torque exerted on nearest neighbors [@vanDrongelen2015]. So far, the studies that use Vicsek alignment have focused on the rich dynamics. In this letter we consider the arrest of such dynamics as the system approaches jamming. We study the system’s effective diffusion constant and density fluctuations to quantify rearrangements. We also aim to understand the relationship between the jamming transition and the order-disorder transition, and study the system’s velocity correlation function in the various phases. We investigate the effects of self-propulsion force and neighbor alignment on the emergent dynamics and find that rearrangements are possible at densities well above the athermal jamming density. We also find that rearrangements are possible in both the ordered and the disordered phase, and that there is an optimal noise such that particles require a minimal self-propulsion force to unjam. Model system {#sec:model} ============ We place $N$ soft, self-propelled particles in a square with linear size $L$ and periodic boundary conditions, and impose the dimensionless packing fraction $\rho = \sum_{i=1}^N \pi a_i^2 / L^2$. To prevent crystallization, the radii of the particles $a_i$ are drawn from a Gaussian distribution with mean $\mu = \bar{a}$ and standard deviation $\sigma = \bar{a}/10$. We consider systems in which viscous forces dominate over inertial forces, e.g. cell tissues or colonies of unicellular organisms. The dynamics of the particles are then overdamped and governed by Stokes’ law: $$\vec{F}_i = \zeta_i \vec{v}_i. \label{eq:Stokes}$$ In eq. 1, particle $i$ moves at velocity $\vec{v}_i$ in proportion to the total force $\vec{F}_i$ exerted on it. The proportionality constant $\zeta_i$ depends on the viscosity $\eta$ and the particle’s radius $a_i$, and is given by $\zeta_i = (32/3) \eta a_i$ in two dimensions and $\zeta_i = 6 \pi \eta a_i$ in three dimensions [@Landau1987]. The total force on the particle is the sum of steric repulsion forces with all particles $j$ that generate overlap, $\vec{F}_{\text{rep}, j}$, and a self-propulsion force, $\vec{F}_\text{sp}$. We choose a simple harmonic repulsion, such that the force is proportional to, and in the direction of, the linear overlap $\vec{d}_{ij}$. Hence, the total force is $$\begin{aligned} \vec{F}_i &= \sum_j \vec{F}_\text{rep} + \vec{F}_\text{sp} \\ &= \sum_j k \vec{d}_{ij} + F_\text{sp}\hat{\theta}_i \\ &= \sum_j \vec{d}_{ij} + \lambda_s a_i \hat{\theta}_i, \label{eq:EoM}\end{aligned}$$ where $k$ is the spring constant for the repulsion force. In eq. \[eq:EoM\], we scale all distances in units of the average particle radius $\bar{a} = 1$ and choose $k=1$, setting the characteristic force $k \bar{a} = 1$. This allows us to define the dimensionless parameter $\lambda_s = F_\text{sp}/k\bar{a}$ which sets the strength of the self-propulsion in our simulations. The self-propulsion term is proportional to the particle’s radius so that all particles would move at the same velocity in the absence of overlaps. The unit vector $\hat{\theta}_i$ indicates the direction of each particle’s self-propulsion, which is determined by the Viscek alignment rule. At each time step, each particle “senses” the orientations of its neighbors, and aligns itself with its neighbors’ average direction. This sensing occurs with some error, which we model as a noise $\Delta\theta$. We can then write the orientation of particle $i$: $$\hat{\theta}_i = \langle\hat{\theta}_j\rangle_{j \in \mathcal{N}_i} + \Delta\theta , \label{eq:orientation}$$ where $\mathcal{N}_i$ is the set of particles in the neighborhood of particle $i$. We define the neighborhood to be the region of space enclosed by a radius of $2.8 \bar{a}$ around the center of particle $i$. We choose this distance such that two neighboring large particles are considered neighbors, while two small particles separated by a third are not. The random rotation angle $\Delta\theta$ is drawn from a uniform distribution on $\lambda_n\big[{-\pi}, \pi\big]$. $\lambda_n = 0$ represents total alignment, while for $\lambda_n = 1$, each particle performs a random walk with no alignment with its neighbors. The order parameter quantifies the global alignment in the system, and is defined as $$\phi = \frac{1}{N} \left| \displaystyle \sum_{i=1}^{N} \frac{\vec{v}_i}{\abs{\vec{v_i}}} \right| \label{eq:orderParameter}$$ which equals unity when all particles move in parallel, and approaches zero when the system has no global translation. To define our time scale, we realize that two average-sized overlapping particles in an overdamped regime will see their overlap decrease according to an exponential with a decay time $\tau_{\text{relax}} = \bar{\zeta}/k$. We choose this physical time to be the unit time, $\tau_{\text{relax}} = 1$. We also note that there is a time interval at which the particles orient themselves, $\tau_{\text{orient}}$. We fix a timestep $\Delta t = {\tau_{\text{orient}}}/{\tau_{\text{relax}}} = 0.1$ so that there are several “sensing events” for each relaxation time. With this choice of scaling, we can write our equation of motion: $$\begin{aligned} \vec{v}_i &= \sum_j\frac{\vec{d}_{ij}}{a_i} + \lambda_s \hat{\theta}_i ,\nonumber \\ \hat{\theta}_i &= \langle\hat{\theta}_j\rangle_{j \in \mathcal{N}_i} + \Delta\theta, \label{eq:orientationRule}\end{aligned}$$ which we integrate at every time step according to $$\vec{x}_i(t+\Delta t) = \vec{x}_i(t) + \vec{v}_i(t)\Delta t .$$ Our system now has three free parameters: packing fraction $\rho$, self-propulsion force $\lambda_s$, and noise $\lambda_n$. The time step $\Delta t$ is not actually a free parameter; it is coupled to the self-propulsion velocity, and so it sets the scale of $\lambda_s$. In our simulations, we allow the system to relax for $1 \times 10^5$ time steps, during which we let the particles rearrange as passive particles and come to a stable configuration. This period also allows the initially random self-propulsion orientations to begin interaction. We then thermalize the system for an additional $1 \times 10^6$ time steps, during which we slowly and linearly ramp up the self-propulsion force to its final value, at which point we begin measurements. Results and Discussion ====================== In the phase space defined by $\rho$, $\lambda_s$, and $\lambda_n$, we aim to construct a jamming phase diagram. The jamming transition for soft, passive particles is at $\rho_c = 0.842$; we ran simulations for densities $\rho \in \{0.88$, $0.94$, $1.00\}$. Simulation screenshots ---------------------- In fig. \[fig:screenshots\], we display screenshots from three different simulations. The color of each particle represents the amount of overlap with its neighbors: dark blue particles have no overlap, and become increasingly light with more total overlap. In \[fig:screenshots\](a), we show the ordered, jammed state. The forces are homogeneously distributed across the simulation area, and there are no rearrangements in this state, as the self-propulsion force is very low. In \[fig:screenshots\](b), we show the ordered, unjammed state. In this system, there is a global density fluctuation, with particles packing more tightly in one region and less tightly in another. There are many particle rearrangements in this state, and the particles have a global translation ($\phi > 0$). In \[fig:screenshots\](c), we show the disordered, unjammed state. In this state, smaller density fluctuations are spread throughout the simulation area; smaller flocks have formed than in \[fig:screenshots\](b). There is no global translation ($\phi = 0$), but particle rearrangements are still possible. Mean-squared displacement and effective diffusion ------------------------------------------------- A perfectly ordered system ($\lambda_n = 0 \text{ and } \phi = 1$) will exhibit global translation but no rearrangements, as each particle aligns perfectly with its neighbors. We therefore measure particle trajectories by considering the mean-squared displacement from the center of mass $\bar{x}$ of the system: $$\text{MSD}(t) = \frac{1}{N}\sum\limits_{i=1}^{N}\bigg( x_i(t) - x_i(0) - \bar{x}(t) + \bar{x}(0)\bigg)^2 .$$ In a jammed system, particles are not able to travel more than a distance $\bar{a}$ because they are obstructed by their neighbors. This effect is known as caging, and is visible in the mean-squared displacement as a plateau. In order to quantify the rearrangements in our system, we performed a linear fit with the assumption that $\text{MSD}(t) = 4Dt$, which would be the case for a perfect random walk in two dimensions. The curves in fig. \[fig:MSDcurves\] reveal that small changes in noise or self-propulsion speed can have order-of-magnitude effects on the effective diffusion constant. Therefore, near jamming, the calculated values of $D$ provide an approximation for the amount of rearrangement in the system, and a closer inspection of the actual MSD curves can help determine if a system is jammed, unjammed, or borderline. Some examples of MSD curves for both jammed and unjammed states are shown in fig. \[fig:MSDcurves\]. The curves are noisy and show many unusual features, including strong fluctuations, oscillations, and peaks. The regions where the MSD curves decrease are atypical, and could be due to relaxations, or due to reorientations of the active particles such that they move back towards their earlier positions. Time-averaging these curves proves difficult, as the particle trajectories are contingent on their histories. Furthermore, the simulations are already computationally demanding, so averaging over many simulations is infeasible. We therefore will rely on linear fits, and study other quantities to give further insight into the dynamics near jamming. We ignore the first $1 \times 10^6$ time steps, the transient, in the linear fits. We consider our system to be jammed if the MSD plateaus at $\text{MSD}(t) < \bar{a}^2$, or if the fitted diffusion constant does not allow for displacements larger than $\bar{a}$ during our measurement of the MSD. Note that $D$ does not indicate Brownian motion, because particle displacements result from the particles’ activity rather than the conversion of heat to kinetic energy. The calculated values of $D$ in the phase diagram are shown in fig. \[fig:MSD\]. With the assumption that $\text{MSD}(t) = 4Dt$, we set the diffusion coefficient for marginally jammed systems to $\left({4\times 4\times10^{6}}\right)^{-1}$. Jammed systems are shown in red in the heatmap, while unjammed systems are shown in blue. We find unjammed systems even at densities far exceeding the jamming density when the particles exert a sufficiently large self-propulsion force. \ The contour separating jammed from unjammed systems indicates the required self-propulsion strength for unjamming, for a given noise and density. We see that the effect of increasing the particle density is to increase the required self-propulsion force for unjamming; in more crowded environments, particles must push harder to get past their neighbors. In fig. \[fig:MSD\]c, we search for a minimum in the contour for the density $\rho = 0.88$, and find that particles are able to marginally unjam for $\lambda_s = 1 \times 10^{-3}$ and $\lambda_n = 0.475$. We further investigated the system for noise values near this minimum in fig. \[fig:MSDclose\]. ![Phase diagram slices from mean-squared displacement analysis, showing the values of the calculated diffusion constant in the $\rho$ - $\lambda_s$ - $\lambda_n$ phase space. We ran simulations of $5 \times 10^6$ time steps for $\rho \in \{0.88$, $0.94$, $1.00\}$, $\lambda_n \in \{0.2$, $0.3$, $0.4$, $0.5$, $0.6$, $0.7$, $0.8\}$, and $\lambda_s \in \{1 \times 10^{-4}$, $2 \times 10^{-4}$, $5 \times 10^{-4}$, $1 \times 10^{-3}$, $2 \times 10^{-3}$, $5 \times 10^{-3}$, $1 \times 10^{-2}\}$. The blue dots represent unjammed systems and the red dots represent jammed systems. The interpolated contour roughly indicates the self-propulsion strength necessary for unjamming. In (a), we fix the noise value $\lambda_n = 0.3$ and find that the effect of increasing the density is to increase the self-propulsion force required for unjamming. In (b) we show the effect of noise on the jamming dynamics for constant density $\rho = 0.88$. We know that the system is always jammed for $\lambda_n = 0.0$ for all $\lambda_s$, and we see that the system also jams for $\lambda_n \geq 0.6$ for the range of $\lambda_s$ we measured here. The valley suggests an optimum noise for unjamming. In (c) we zoom in on the area around the minimum in (b) and see that there seems to be an optimal noise for unjamming near $\lambda_n = 0.475$. []{data-label="fig:MSD"}](gfx/MSDFigure.eps){width="0.98\columnwidth"} ![The effective diffusion constant near the critical noise. For (a), $\rho=0.88$, for (b), $\rho=0.94$, and for (c), $\rho=1.00$. These runs were carried out for $5 \times 10^{6}$ time steps. Finding the true minimum is difficult, as the noisy MSD curves affect the value of the linear fits. Nonetheless, for all three densities, transport seems enhanced around $\lambda_n = 0.465$. This is clear for $\rho = 0.88$ and $\rho = 0.94$, where there is a more pronounced valley near $\lambda_n = 0.465$. For $\rho = 1.0$, the value of $D$ is enhanced at this noise value for $\lambda_s = 0.05$ (uppermost values, dark blue).[]{data-label="fig:MSDclose"}](gfx/MSDFull3.eps){width="0.98\columnwidth"} Order-disorder phase transition ------------------------------- In the paper in which they proposed the original Vicsek model, the authors described a second-order phase transition in which order spontaneously emerges below a critical noise value [@Vicsek1995]. This transition was later shown to be strongly influenced by finite-size effects, with the actual transition being first-order [@Chate2008]. Motivated by these findings and the relevance for active jamming, we studied the behavior of the order parameter in our system of finite-sized particles, and found an order-disorder transition near a critical noise value of $\lambda_n^* = \lambda_n = 0.475$, as shown in fig. \[fig:orderNoise\]. Figure \[fig:MSDclose\] shows higher values of the effective diffusion constant near this critical noise value, indicating that transport is enhanced near the critical point. We speculate that biological systems might sit near this critical value so that they are able to rearrange with a minimum of effort. Furthermore, fig. \[fig:MSD\] shows that the system is able to unjam for $\lambda_n > \lambda_n^*$, the disordered state, when the self-propulsion force is high enough. Below the critical noise, our system shows spontaneous ordering, consistent with a second-order phase transition at the critical point $\lambda_c$. Furthermore, the variance in the order parameter, $\sigma^2 = \langle \phi^2 \rangle - \langle \phi \rangle^2$ shows a sharp peak at the transition, a characteristic of second-order transitions. In fig. \[fig:orderNoise\]b, we plot the value of the order parameter $\phi$ as a function of $\abs{\lambda_c - \lambda_n}$ on a log-log scale near the critical point. We find power-law behavior, with a critical exponent $\beta = 0.286 \pm 0.008$. The uncertainty in $\beta$ comes from the reported confidence of the fit, while the error bars indicate the standard deviation in the order parameter for a given noise value, $\sigma = \sqrt{\langle \phi^2 \rangle - \langle \phi \rangle^2}$. ![Dependence of the order parameter $\phi$ on $\lambda_n$ at $\rho = 0.88$ and $\lambda_s = 0.002$. The data in (a) suggests a critical point near $\lambda_n = 0.475$, where the order parameter falls to zero and the fluctuations peak. (b) shows $\phi$ on a log-log scale: $\phi \sim (\lambda_c-\lambda_n)^\beta$, with $\lambda_c = 0.47 $ and $\beta = 0.286 \pm 0.008 $. The critical exponent for the analytical 2D Ising model is $\beta = 0.125$.[]{data-label="fig:orderNoise"}](gfx/orderParameterFigure.eps){width="0.99\columnwidth"} Relationship between the jamming transition and the order-disorder transition ----------------------------------------------------------------------------- When we examine fig. \[fig:MSD\], we realize that particle rearrangements are possible beyond the critical noise $\lambda_n^* = 0.475$. We also realize from fig. \[fig:allcorrelation\] that the system’s correlation length extends over several particle diameters in the disordered phase. These observations indicate that small, locally ordered flocks can form in the disordered phase, with particle rearrangements occurring at the boundaries of these colliding flocks. This interpretation is also supported by the simulation screenshot in fig. \[fig:screenshots\](c), as well as the videos in the supplementary material. Ordering in the jammed state and finite-size effects ---------------------------------------------------- In fig. \[fig:orderScaling\], we illustrate how the order parameter depends on system size, up to a maximum system size of $5\times 10^5$ particles. In the case of the jammed systems (subfigure (a), $\lambda_s = 1 \times 10^{-4}$), the order parameter falls with increasing system size, as expected for a KT transition. However, it does so remarkably slowly, so that reaching the true thermodynamic limit (where the global order parameter is zero) is implausible given our current methods. Presumably, the Mermin-Wagner theorem still holds, and so systems of $5\times 10^5$ particles ($\sim 700 \times 700$) are not large enough to consider the system scaled to the thermodynamic limit. Because the existence of long-range order is traditionally attributed to enhanced density fluctuations, it is surprising that the order parameter is not zero in the jammed state for these relatively large systems. Each particle in this model has an average of six nearest neighbors, more than in the prototypical XY model, so it could be that any “spin waves” forming in this system are “stiffer” than in the XY model and so have a longer wavelength. Moreover, the geometry of the packing (roughly hexagonal with defects) allows for more paths between a given particle pair than in the XY model, as well as shorter diagonal paths, in contrast to the strictly “Manhattan” distances of the XY lattice. The geometry could therefore provide a mechanism for enhanced information transfer. This could be further investigated by analyzing the Fourier modes of the dynamics and the system’s hyperscaling relations. A packed colony of cells could possibly exploit this enhanced information transfer in order to “communicate” across biologically long length scales over which the Mermin-Wagner theorem proves irrelevant. Correlation function -------------------- To better understand the flowing, yet disordered state, we measure the velocity correlation $$C(r) = \frac{1}{n(r)}\sum_{\{i,j \mid r_{ij}=r\}}\frac{\vec{v_i}\cdot\vec{v_j}}{\abs{\vec{v_i}}\abs{\vec{v_j}}} , \label{eq:correlation}$$ where $n(r)$ is the number of pairs separated by a distance $r$. We find that the form of the correlation function is a power-law decay below the critical noise, and changes to an exponential decay above the critical noise, with a correlation length which decreases with increasing $\abs{\lambda_n~-~\lambda_c}$, shown in fig. \[fig:allcorrelation\]. $$C(r) \propto \begin{cases} \frac{1}{r^{2-d+\eta}} & \lambda_n < \lambda_c \\ e^{-r/l_c} & \lambda_n > \lambda_c \\ \end{cases}$$ Though the system is globally disordered for noise values above $\lambda_c$, a non-vanishing correlation length indicates that small, coherent flocks can still form in the disordered phase. This suggests a mechanism for unjamming in which flocks collide and allow rearrangements at their boundaries. ![The velocity correlation function in the ordered (a) and disordered (b) phases. All displayed curves are for $\rho = 0.94$ and $\lambda_s = 1\times 10^{-3}$. The curves begin to cross over to exponential decay around $\lambda_n = 0.465$. In (a), the value of $\eta$ falls slightly near the transition; compare the values to the 2D Ising model critical exponent $\eta = 0.25$. In (b), the value of the correlation length falls with increasing noise. In (c), we plot the fitted correlation lengths as we approach the critical noise from above, and fit the six rightmost points to a power law $l_c \propto \abs{\lambda_n - \lambda_c}^{\nu}$. The fit is not as good near the critical noise; we can also see this in (a) and (b) near the critical noise, where the fits begin to deviate from straight lines. Notably, just above the transition, the correlation length extends over a significant number of particles, suggesting the formation of small, coherent flocks while in the globally disordered phase.[]{data-label="fig:allcorrelation"}](gfx/AllCorrelationFigure.eps){width="1.0\columnwidth"} Density fluctuations -------------------- We can further quantify the system’s dynamics just above the critical point by considering the scaling of the density fluctuations in the system. In the grand canonical ensemble of equilibrium statistical physics, point particles enter and leave a system with independent probabilities, and the number fluctuations scale as $$\Delta N \propto N^{1/2} .$$ It is known that active systems exhibit “giant number fluctuations”, reflected in a scaling exponent $m > \frac{1}{2}$, due to orientational coupling[@Chate2006; @Narayan2007]. With our finite-sized particles, we measure area fluctuations in a “measurement circle” of a given size, centered at the system’s center of mass, and fit the scaling exponent $m$: $$\Delta A \propto A^{m} .$$ Figure \[fig:densityFluct\] shows the values of $m$ in the $\lambda_n$-$\lambda_s$ phase space. In the disordered phase, the scaling exponent falls with increasing noise. However, this transition happens slowly, illustrating that particle rearrangements can still occur in the disordered phase. The fluctuations also fall in the ordered phase with decreasing self-propulsion force, indicating the onset of jamming at low activity. ![The scaling of density fluctuations $\Delta A$ with expected area $\langle A \rangle$; the scaling follows the relationship $\Delta A~\propto~\langle A \rangle^m$. All curves are for constant density $\rho = 0.88$. A horizontal line in (a) indicates a scaling exponent $m=\frac{1}{2}$. In (a) we show four curves, each representing the four corners of the contour in (b): low speed & low noise (light blue), high speed & low noise (dark blue), low speed & high noise (dark red), high speed & high noise (light red). We see the most enhanced density fluctuations in the ordered phase, with high self-propulsion force. The two red curves show two states in the disordered phase. These curves indicate suppressed density fluctuations and jammed states. In the ordered phase and low-self-propulsion force (bottom blue curve), we also see suppressed density fluctuations. In (b) we plot the value of the scaling exponent $m$ in $(\lambda_n, \lambda_s)$ space. Density fluctuations become suppressed with increasing noise and decreasing activity. []{data-label="fig:densityFluct"}](gfx/densityFluctuationFigure.eps){width="0.99\columnwidth"} Conclusions =========== We simulated a collection of soft, self-propelled particles with Vicsek alignment at packing fractions $\rho \in \{0.88$, $0.94$, $1.00\}$, well above the passive critical packing fraction $\rho_c = 0.842$. We constructed a phase diagram in the $\rho$ - $\lambda_s$ - $\lambda_n$ space which distinguishes jammed and unjammed packings. Systems jam for too little noise, as the particles align in parallel and cannot push aside their neighbors. They also jam for too much noise, in which case the particle velocities decorrelate from those of their neighbors, and the particles become caged. The system undergoes a second-order phase transition; below a critical noise $\lambda_n = \lambda_c$ the system spontaneously orders. This is indicated by power-law behavior of the order parameter near the critical point, and by the form of the correlation function, which crosses over from exponential to power-law decay. With a strong enough self-propulsion force, particles can unjam in both the ordered and disordered phases. In the disordered phase, particles are able to unjam by forming small, colliding flocks. By fitting the correlation function, we found a nonvanishing correlation length for these systems, with a noise value $\lambda_n > \lambda_c$. The correlation length roughly follows the predicted power-law divergence just above $\lambda_c$. There is an optimal noise value near $\lambda_c$ at which particle transport is enhanced, and particles are able to unjam with a minimum self-propulsion. The exact value of the minimum is difficult to determine due to the noisy dynamics, illustrated in the MSD curves. A system of $5\times 10^5$ ($700 \times 700$) particles shows surprising ordering even in the jammed state (very small $\lambda_s$). Even though the particles are barely moving, the information about their velocities is able to propagate across the entire system. This happens without the enhanced density fluctuations displayed by the active, unjammed systems, and could result from the packing geometry. This work was supported by a grant from the Fulbright U.S. Student Program and the TU Delft Faculty of Applied Sciences. It was also supported by the Netherlands Organization for Scientific Research (NWO/OCW), as part of the Frontiers of Nanoscience program. [99]{} Landau L.D. and Lifshitz E.M., *Fluid Mechanics*, second edition (1987)
2024-07-04T01:26:58.646260
https://example.com/article/4211
Contextualising the SADC Tribunal and the land issue in Zimbabwe – A socio –legal perspective What has been controversial has been the interpretation by the different schools of thought as they seek to address, explain the new situations that now arise as different international institutions seek to do justice to the land question in Zimbabwe brought about by past colonial injustices. The authorities in Zimbabwe following the fallout with their former coloniser, Britain over the methods for land acquisition agreed to at the Lancaster House Constitution in 1980 embarked on a land acquisition exercise designed primarily to empower the indigenous black Zimbabwean. Past colonial legacies and injustices had dispossessed a majority of some 12 million black Zimbabweans of their land and proceeded to relocate them in arid sandy small holdings commonly referred to as Tribal Trust Lands. The Lancaster House Constitution In the opening speech of the Lancaster House negotiations, land was one of the paramount issues mentioned by the patriotic front among the nine they had been presented for discussion. The British government insisted on stringent provisions in the constitution protecting the rights and privileges of the few white Zimbabweans that owned 70 percent of the arable land. This in itself served to perpetuate the status core whereby the rights and privileges of the few white settlers would be protected. The negotiations nearly collapsed due to this particular provision.An agreement was eventually reached and the Patriotic Front announced it as follows: "We have now obtained assurances that … Britain, the United States of America and other countries will participate in a multinational donor effort to assist in land, agricultural and economic development programmes. These assurances go a long way in allaying the great concern we have over the whole land question arising from the great need our people have for land and our commitment to satisfy that need when in government". A provision was included in the Lancaster House Constitution protecting any acquisition of land by any other means except on a willing buyer willing seller basis. This provision was to remain in place for a period of ten years. The Lancaster House Agreement together with the ancillary agreements of paying for the land offered did not perform to expectation. For example the willing buyer and willing seller agreement was not adhered to in many ways. For example the white commercial farmers that held the bulk of the land failed to offer land in sufficient quantities to enable the new Zimbabwe government to adequately resettle the multitudes of Zimbabweans that were waiting to be resettled. Secondly the white commercial farmers were offering land that was in areas that had poor rainfall patterns, unsuitable for the black indigenous farmer who was coming from a subsistence type of farming. Further to this if the white commercial farmers did offer any good land at all, the market price was such that it made it impossible for the government to afford it. This was made more difficult by the "fair market" clause incorporated in the agreement. All this was exacerbated by the slow flow of promised funds from Britain the former coloniser. In 1981 the Zimbabwe Government held a conference with the objective of mobilising funds for the purpose speeding the land reform exercise. Great Britain, The United States and other western countries were invited. Great Britain was reminded of her obligation towards Zimbabwe as per the Lancaster House conference. However funds were not forth coming. Hence after seven years of independence the Zimbabwe government had managed to settle a total of 40 000 families from the original target of 162 000 families. The Land Reform and Resettlement Programme The desire by the Zimbabwe Government to settle the 162 000 families failed to materialise as the government failed to get land in sufficient quantities to reach this target. By 1995 the Zimbabwe government had only managed to resettle 71 000 families. As the thirst for land among the indigenous Zimbabweans and the constant reminder to government of the reasons for the liberation war by subsistence farmers in the communal areas, the government was now compelled to act. As the pressure for land reached fever pitch, communal farmers began the process of resettling themselves on farms owned by white commercial farmers. This cajoled a government that was procrastinating into action. The Land Acquisition act 1992 was enacted as a follow up to the 1985 Act to deal with this new demand. This act was enacted to allow the Zimbabwe government to compulsorily acquire land for resettlement and at the same time provide fair compensation for land acquired for the purposes of resettlement. The former land owner was left with an option of contesting the price set by the acquiring authority if not in agreement with it. It is important to point out that at this time the government was still in bargaining mode and the land targeted at this stage was derelict land, under-utilised land, land owned by absentee landlords, land adjacent to communal areas and land from farmers with more than one farm or oversized farms. The Zimbabwe Government at this stage still gave the farmer the option of challenging the acquisitions by written submission within thirty days after it has been gazetted in the government gazette. In September 1998 the Zimbabwe Government convened another donor conference in an attempt to mobilise international support for the land reform exercise. It is instructive to point out that of the 48 countries and numerous donor agencies represented at the conference agreed that the need for land reform in Zimbabwe was urgent in order to redress the colonial imbalances that existed. A number of countries pledged both financial and material support for this exercise. As a follow up to the 1992 land acquisition Act, the government of Zimbabwe gazetted a list of 1,471 farms it had ear marked for compulsory acquisition. Previous owners still had the provision to legal recourse for challenging the acquisition by way of submissions within a thirty day period to the government of Zimbabwe. It was at this point that Britain showed even greater signs of withdrawing aid. When the labour government came to power in 1997, the Zimbabwe government petitioned Prime Minister Tony Blair to honour the commitments made by the previous conservative government regarding the financing of the land acquisition exercise. On 6 November 1997 Clare Short sent a letter to Kumbirai Kangai, Minister of Agriculture in Zimbabwe in which she stated that "We do not accept that Britain has a special responsibility to meet the costs of land purchase in Zimbabwe". We are a new government from diverse backgrounds, without links to former colonial interests. My own origins are Irish and, as you know, we were colonised, not colonisers." This letter caused a rift with the Zimbabwean government, which asserted that the Lancaster House Agreement of 1979 had contained a continuing pledge from the United Kingdom government to assist in the land reform exercise. Former White commercial farmers began challenging the acquisition of their previous farms in the national courts. This prompted the Zimbabwe government to amend the Constitution by way of amendment no 17. Cited under the Constitution as amendment (no 17) of 2005, section 16B. This amendment was retrospective. (2) Notwithstanding anything contained in this Chapter— (a) All agricultural land— (i) that was identified on or before the 8th July, 2005, in the Gazette or Gazette Extraordinary under section 5(1) of the Land Acquisition Act [Chapter 20:10], and which is itemised in Schedule 7, being agricultural land required for resettlement purposes; or(ii) that is identified after the 8th July, 2005, but before the appointed day, in the Gazette or Gazette Extraordinary under section 5(1) of the Land Acquisition Act [Chapter 20:10], being agricultural land required for resettlement purposes no compensation shall be payable for land referred to in paragraph (a) except for any improvements effected on such land before it was acquired. a person having any right or interest in the land— (a) shall not apply to a court to challenge the acquisition of the land by the State, and no court shall entertain any such challenge; (b) may, in accordance with the provisions of any law referred to in section 16(1) regulating the compulsory acquisition of land that is in force on the appointed day, challenge the amount of compensation payable for any improvements effected on the land before it was acquired. Amendment (no 17) 2005 section 16B of the Zimbabwe Constitution made it unlawful for an interested party to challenge the acquisition of the actual land acquired by any acquiring authority. It only allowed for an interested party to challenge the value of the improvements made on the land. SADC (Southern Africa Developmental Community) and the SADC Tribunal Following the Constitutional provision barring former commercial farmers from challenging the actual acquisition of their former farms under Zimbabwe domestic law, a few of the aggrieved former white farmers decided to take their legal battle to the SADC Tribunal. The SADC Tribunal derives its origin from SADC, an institution original established in 1980 under Article 2 of the SADC treaty with its headquarters in Gaborone, Botswana. It was original a loose coalition of African nations with the sole purpose of coordinating developmental projects within its member states, hence lessening dependence on the then apartheid South Africa. The original members of this institution included Angola, Botswana, Lesotho, Malawi, Mozambique, Swaziland, Tanzania, Zambia and Zimbabwe. The SADC Tribunal was established in 1992 under Article 9 of the SADC Treaty as one of the institution of SADC. The summit of Heads of States or Governments which is the supreme Policy Institution of SADC pursuant to Article 4 (4) of the protocol on Tribunal appointed the members during the summit of Heads of States and Governments held in Gaborone, Botswana in August 2005. One of its vital components for sustainability has been its legitimacy and effectiveness in regional integration. It is important at this stage to mention that the SADC Tribunal was modelled on the European Union model as a dispute resolution mechanism among states. However the approach adapted by member states when it came to creating the SADC Tribunal was to achieve dispute resolution without necessarily affecting the sovereignty of the member state. Hence a pan africanist institution was the ideal model. It is in this light that the jurisdictional scope of the SADC Tribunal together with its applicable laws in the said jurisdiction, decision enforcement, its independence, impartiality and the protection of human rights would be closely monitored. This was to be so in light of the fact that SADC as an institution is largely not self financing and relies heavily on external funding, the danger of third party influencing its decision making processes was a reality. The SADC Tribunal has been recently adjudicating over land disputes in Zimbabwe after receiving it initial case in 2007 from disgruntled former commercial land owners. For the purposes of this paper I propose to look at the Campbell case and its subsequent repercussions and how it was the precursor for the member states to reassess the role of the SADC Tribunal in regional integration. Campbell VS The Republic of Zimbabwe In October 2007 Mike Campbell (PVT) Limited, a company duly incorporated in Zimbabwe in terms of the companies act brought a case before the SADC Tribunal challenging the acquisition of agricultural land in Zimbabwe by the government of Zimbabwe. It is instructive to also point out that this case was also pending in the domestic courts of Zimbabwe, namely in the Supreme Court. The matter was brought before the Tribunal in terms of article 28 of the SADC Protocol for an interim measure to interdict the government of Zimbabwe from acquiring the said piece of land pending the finalisation of the matter. Article 28 provides that The Tribunal or the President may, on good cause, order the suspension of an act challenged before the Tribunal and may take other interim measures as necessary. Campbell argued that the process of land acquisition in Zimbabwe was racist and illegal by virtue of Article 6 of the SADC Treaty and that of the African union Charter. These provisions basically outlaw any racially motivated action by public institutions. Article 4 stipulates that SADC and its member states shall act in accordance with the principles of human rights, democracy and the rule of law as well as equity, balance and mutual benefit; and the peaceful settlement of disputes, inter alia. According to Article 6 (2) of the SADC Treaty, ‘SADC and member states shall not discriminate against any person on grounds of gender, religion, political views, race, ethnic origin, culture or disability’. It was argued that amendment no 17 (section 16B) 2005 that outlawed any challenges to land acquisitions under national law were contrary to SADC Statutes and that the Supreme Court of Zimbabwe had either failed or neglected to rule on an application made by Campbell and 74 other Zimbabwean Commercial farmers . In turn the Zimbabwe government argued that the land acquisition was a process of natural justice based on the restorative justice principle whereby the black indigenous people of Zimbabwe must be given back their land taken away from them through the illegal processes of colonialism. Furthermore Campbell and others had failed or neglected to exhaust all remedies provided for under domestic law. The central problem of this case seemed to be the relationship between the legal regime of SADC on the one side and Zimbabwe’s national law on the other. The Constitution of Zimbabwe in its Section 23 states: ‘No law shall make any provision that is discriminatory either of itself or in its effect; and no person shall be treated in a discriminatory manner by any person acting by virtue of any written law or in the performance of the functions of any public office or any public authority’. The Constitutional Amendment Act No. 17 of 2005 allows the government of Zimbabwe to seize or expropriate farmland without compensation and bars courts from adjudicating over legal challenges filed by dispossessed and aggrieved white farmers. Section 2(2) of the above amendment provides that ‘all agricultural land – (follows the description of such agricultural land identified by the Government)…is acquired by and vested in the State with full title therein…; and…no compensation shall be payable for land referred to in Paragraph (a) except for any improvements effected on such land before it was acquired’. The practical implications of the Constitutional Amendment Act No. 17 resulted in farm seizures, where the majority of the approximately 5000 white farmers were forcibly ejected from their properties with no compensation being paid for the land, since, according to the Zimbabwe Government, it was stolen in the first place. The government has compensated some farmers only for developments on the land such as dams, farm buildings and other improvements. On 13 December 2007 the SADC Tribunal ruled that Campbell should remain on his acquired farm until the dispute in the main case had been resolved by the Tribunal. "The Tribunal grants the application pending the determination of the main case and orders that the Republic of Zimbabwe shall take no steps, or permit no steps to be taken, directly or indirectly, whether by its agents or by its orders, to evict from or interfere with the peaceful residence on and beneficial use of the farm known as Mount Campbell in the Chegutu District in Zimbabwe, by Mike Campbell Ltd and William M Campbell, their employees and the families of such employees and of William Michael Campbell" The above interim relief was also applied for by and granted to other applicants/interveners on 28 March 2008.On 22 January 2008, the Zimbabwean Supreme Court (sitting as a Constitutional Court) dismissed the application by the white commercial farmers challenging the forcible seizure and acquisition of their lands without compensation. The Court ruled that ‘by a fundamental law, the legislature has unquestionably said that such an acquisition shall not be challenged in any court of law. There cannot be any clearer language by which the jurisdiction of the courts is excluded’. On 23 January 2008 the Zimbabwean government announced that it would seize the farm. Land Reform Minister Daytimes Mutasa said the farm would be handed over to a black owner as part of state land reforms and following the ruling by the Zimbabwean Supreme Court. The main hearing before the SADC Tribunal was scheduled for 28 May 2008, but postponed until 16 July 2008. On 18 July 2008, applicants and other interveners in the Campbell case made an urgent application to the Tribunal seeking a declaration to the effect that the Zimbabwe Government was in breach and contempt of the Tribunal’s orders. After hearing the urgent application, the Tribunal found that the respondent state was indeed in contempt of the Tribunal’s orders. Consequently, and in terms of Article 32(5) of the Protocol, the Tribunal decided to report the matter to the Summit for the latter to take appropriate action. Meanwhile, a significant number of recently resettled indigenous farmers filed an application seeking an order to allow them to intervene in the main case. The application was, however, dismissed with costs. In the Tribunal’s view, the applicants/interveners could not be allowed to intervene in the main case for the following reasons: · The present application to intervene was filed out of time and no good reason was advanced to justify the inordinate delays; the alleged dispute in the present application is between present applicants and applicants in the main case (Campbell case) and not between persons (either natural or juristic) and a state;and · the applicants in the present application have failed to demonstrate any legal right or interests which are likely to be prejudiced or affected by the Tribunal’s decision in the Campbell case. The hearing of the Campbell case was finalised on 28 November 2008. The SADC Tribunal in its final decision ruled in favour of the applicants Mike and William Campbell and 77 other white commercial farmers. In conclusion, the Tribunal held that the Republic of Zimbabwe is in breach of its obligations under Articles 4(c) and 6(2) of the SADC Treaty and that : the Applicants have been denied access to the courts in Zimbabwe; the Applicants have been discriminated against on the ground of race, fair compensation is payable to the Applicants for their lands compulsorily acquired by the Republic of Zimbabwe. The Tribunal furthermore directed the Republic of Zimbabwe to take all necessary measures to protect the possession, occupation and ownership of the lands of the applicants who had not yet been evicted from their lands, and to pay fair compensation to those three applicants who had already been evicted from their farms. The SADC Tribunal and the withdrawal of Zimbabwe’s membership The SADC Tribunal is primarily a product of a pan africanist political process set up to protect the rights and interests of SADC members states and their citizens and most importantly to develop the community’s jurisprudence vis a vis the applicable treaties, general principles and the rules under international law. Subject to the exhaustion of remedies available under national law the Tribunal has the jurisdiction to adjudicate disputes between states, natural and legal persons of the community. (protocol Art 15(2). Having realised that the SADC Tribunal had now become a wayward animal heads of State and Government requested the member states ministers of justice move quickly to rectify the anomaly. In 2008 President (Jakaya) Kikwete (of Tanzania) said ‘we have created a monster that will devour us all. Can our Justice Ministers make sure that this monster is destroyed before it devours us all’? The Zimbabwe government in consultation with other member governments announced on the 2nd of September 2009 the pull out of Zimbabwe from the membership of the SADC Tribunal. The pull out by Zimbabwe automatically rendered any decisions or judgements by the SADC Tribunal against the government of Zimbabwe ineffective and unenforceable. Upon careful and studious inspection by government Lawyers of the SADC Tribunal Protocol it was found that it was not validly constituted and hence it could not validly exercise jurisdiction over Zimbabwe or any other SADC State. Hence the fact that only five of the fourteen member’s countries have so far ratified the Tribunal Protocol meant that the purported application of the provisions of the protocol on Zimbabwe was a serious violation of international law. The Zimbabwe government cited Article 35 and 38 of the Tribunal Protocol which reads under Article 35: This Protocol shall be ratified by Signatory States in accordance with their constitutional procedures.’ And under article 38 The Tribunal Protocol reads: This Protocol shall enter into force thirty (30) days after deposit, in terms of Article 43 of the Treaty, of instruments of ratification by two-thirds of the States.’ Critics to this argument coming mainly from organizations that are largely funded by the United States and Europe argued that in 2001, the SADC Treaty was amended so as to make the SADC Tribunal an integral part of both the Treaty and the Institution of SADC. And that the said amendment to the SADC Treaty specifically established the SADC Tribunal and incorporated it into SADC as an integral part of the institution. The amendment went on to refer to the Tribunal Protocol and categorically excluded it from the usual requirement for ratification by two-thirds before it could come into force and effect. The relevant section of the Amendment to the SADC Treaty referred under article 16 reads as follows: 1. The Tribunal shall be constituted to ensure adherence to and the proper interpretation of the provisions of this Treaty and subsidiary instruments and to adjudicate upon such disputes as may be referred to it. 2. The composition, powers, functions, procedures and other related matters governing the Tribunal shall be prescribed in a Protocol, which shall, notwithstanding the provisions of Article 22 of this Treaty, form an integral part of this Treaty. Members of the Tribunal shall be appointed for a specified period. 4. The Tribunal shall give advisory opinions on such matters as the Summit or the Council may refer to it. 5. The decisions of the Tribunal shall be final and binding.’ Article 22 referred to in Article 16 above provides as follows: 1. Member States shall conclude such Protocols as may be necessary in each area of co-operation, which shall spell out the objectives and scope of, and institutional mechanisms for, co-operation and integration. 2. Each Protocol shall be approved by the Summit on the recommendation of the Council. 3. Each Protocol shall be open to signature and ratification. 4. Each Protocol shall enter into force thirty (30) days after the deposit of the instruments of ratification by two thirds of the Member States. [Own emphasis added.] 5. Once a Protocol has entered into force, a Member State may only become a party thereto by accession. 6. Each Protocol shall remain open for accession by any State subject to Article 8 of this Treaty. 7. The original texts of each Protocol and all instruments of ratification and accession shall be deposited with the Executive Secretary who shall transmit certified copies thereof to all Member States. 8. The Executive Secretary shall register each Protocol with the Secretariat of the United Nations Organization and the Commission of the African Union. 9. Each Protocol shall be binding only on the Member States that are party to the Protocol in question. 10. Decisions concerning any Protocol that has entered into force shall be taken by the parties to the protocol in question. 11. No reservation shall be made to any Protocol.’ As a result of this amendment to the SADC Treaty, Articles 35 and 38 of the Tribunal Protocol, which had required the two-thirds ratification, were repealed and the requirement therefore fell away. The agreement amending the protocol is argued to provide for this and hence Article 35 of the Protocol is repealed.’ Article 38 of the Protocol is repealed.’ Therefore it is argued by these critics that the Tribunal is a creation of the Declaration and Treaty of SADC, and does not owe its existence to the ratification of the Tribunal Protocol by member states. However, the argument above is contradicted by the Constitution of Zimbabwe and the decision to withdraw from the SADC Tribunal by Zimbabwe has been vindicated by a constitutional provision that few seem to have taken notice of. The current position at law is that under the Constitution of Zimbabwe the repealing of Article 35 and 38 of the SADC Tribunal does not affect the decision by the Zimbabwe Government to withdraw from the Tribunal. Section 111B of the Zimbabwe Constitution mandates all international treaties entered into by the government of Zimbabwe to be approved by parliament. Section 111B was introduced into the Zimbabwe Constitution in 1987 by Constitutional amendment (No 7) Act of 1987. Section 111B was later amended in 1993 as Constitutional amendment (no 12) act of 1993. Section 111B as introduced into the Zimbabwe Constitution in 1987 restricted to parliament the ratification of any international treaty or agreement entered to by the head of state which imposed a fiscal obligation on the republic of Zimbabwe. SADC requires its member states to pay annual subscriptions. It is then for this reason that the SADC Treaty had to be ratified by the Zimbabwean parliament in 1992 in compliance with section 111B of the Zimbabwe Constitution. Therefore for all intents and purposes Zimbabwe has never been a bona fide member of the SADC Tribunal from its inception. From a socio-legal perspective it has not helped matters that the applicants that have complained to the SADC Tribunal are all whites and hence arguments for African intervention have been ignored as the wounds created by the colonial system are still fresh. The Zimbabwe land legacy was created through a process which was illegal, cruel and largely unjust. With most Zimbabwean black farmers irking out a living in semi-arid small communal plots and the neighbouring South Africa mooting a land expropriation bill, it seems sentiment for the white commercial farm does not look at all positive. It remains that title for land in Zimbabwe must be premised on a negotiated settlement between the former coloniser, Britain and the Zimbabwe government. Britain must now stop playing politics with the Zimbabwe land issue and accept the responsibilities it took upon itself to fund the land reform exercise at Lancaster. The SADC Tribunal needs to be reformed in order for it to be in sync with the reality on the African continent, especially when it comes to the emotive issue of land.
2024-02-28T01:26:58.646260
https://example.com/article/6196
Complexes of Escherichia coli primase with the replication origin of G4 phage DNA. Escherichia coli primase (dnaG protein), an essential DNA replication enzyme, synthesizes a primer at the unique origin sequence of the single-stranded circular phage G4 DNA (Rowen, L., and Kornberg, A. (1978) J. Biol. Chem. 253, 758-764). Kinetic analyses suggest that for each DNA molecule at least two primase molecules participate in the reaction. Binding of 3H-labeled primase is specific for the G4 complementary strand origin region and is saturated at approximately 2 primase molecules/DNA circle. Such complexes, isolated by gel filtration, function in the absence of additional primase to convert the phage DNA to the duplex form. Although the primase-DNA complex is stable to refiltration, the DNA-bound enzyme can dissociate and reattach to function at the origin sequence of another G4 DNA circle. An antibody to primase blocks the action of primase in the free form or within a DNA complex and even interferes with extension of the primer by DNA polymerase III holoenzyme. These kinetic and binding studies of G4 priming, the least complicated of the primase systems, suggest that 2 primase molecules form a complex at the origin region and remain bound even after transcribing a sequence to prime DNA replication.
2024-06-26T01:26:58.646260
https://example.com/article/4820
Share this article on LinkedIn Email Valtteri Bottas concedes Williams struggled to make the gains it had hoped for in the second in-season Formula 1 test at Silverstone. Williams tried three different front wings over the course of the 98 laps covered by Bottas on Wednesday, as he set the sixth-fastest time. The double-decker rear-wing trialled by Felipe Massa in the first test at Barcelona in mid-May also appeared late in the day. Given its difficulties of late, failing to score a point in a race for the first time this year in the British Grand Prix, Williams had hoped the test would result in considerable strides. "We ran three front wings, all from this year, ones from the beginning [of the season] and the very latest ones, and we found small differences," Bottas told Autosport. "We are honestly still struggling to see big differences as we would like. "We were predicting bigger gains, but at the moment we're struggling a little bit to put it directly as downforce and laptime. "We've found some results which could benefit us, not in the very near future, but later on." Williams ran the rear wing - which is outside of the current regulations - for a day-and-a-half at the Circuit de Catalunya, but only in the final hour at Silverstone. "It's adding downforce," Bottas said. "The main thing is trying to fine tune the balance a bit better, and how much we gain with 'x' amount of downforce, especially in cornering conditions because that is the weakness we have at the moment - cornering grip. "So we are trying to see what it does, if we can make the downforce in the corner a bit better." Bottas also confirmed that aero updates to the FW38 - "which have been planned for a long time" - are lined up for the final two races before the summer break in Hungary and Germany. "The overall feeling was definitely we improved some things a little bit," he said of the test. "Small steps at a time, there's still a long season to go. It was definitely an important test for us. "We'll look at the data, and especially the long runs we did to try and use those things to improve our race pace, but aero-wise the stuff we did today is more for next year."
2024-01-08T01:26:58.646260
https://example.com/article/7173
In order to update electronic control unit calibrations for a vehicle, a vehicle owner typically visits a dealership, and a service technician couples the vehicle to a remote server that provides information to the electronic control unit (ECU) for performing the update. Unlike simple software updates, which can be implemented by the vehicle owner at home using local media, calibrations can involve a significant number of variations. These variations may be due to customers' choice of features from the options available, variations among ECUs for different configurations, country of operation of the vehicle, varying operational languages possible in the vehicle, add-on features from after market sales, ability to suppressed features under development, etc. On the other hand, there are manageable variants of application software for an ECU, as one application software configuration may execute in many vehicle configurations. Generally, application software and calibrations are identified in the configuration management system by their unique software part number—identical with their file name. Each bundle of calibrations meant for one configuration of an ECU variant has its associated matching application software. It is imperative to select the correct calibration, as software without a matching calibration meant for incorrect vehicle configuration will malfunction. A remote server is better equipped to store and search from a large number of matching calibrations and application software. Even though it is possible to update application software for a current configuration using local media, a connection to the server and visit to the dealership is required to select the matching calibration. Accordingly, it is desirable to provide a means for providing updates to calibrations for a vehicle without requiring a visit to the dealership or service provider.
2023-12-06T01:26:58.646260
https://example.com/article/5783
The new Doom comes out on 13th May 2016, Bethesda has announced. The Doom Collector's Edition. That's for PC, PlayStation 4 and Xbox One. id Software's first-person shooter also comes in a £100 Collector's Edition, which includes a 12 inch tall statue of one of the Revenant demon. As you'd expect there's a pre-order bonus. Pre-order the collector's edition or the standard edition and you get the Demon Multiplayer Pack, which contains a unique demon armour set with three skin variations, six metallic paint colours and three id logo patterns that can be applied to weapons and armour, plus a set of six Hack Modules - one-time consumable items for use in multiplayer matches. A new campaign trailer is below.
2024-02-12T01:26:58.646260
https://example.com/article/7482
The Syrian army backed by its popular allies, Russian and Syrian airstrikes have deployed their forces in the Southwestern side of the town of al-Tabaqa in Western Raqqa and are only 5 kilometers away from the town, the Syrian Army said on Wednesday. "The Syrian government forces, who launched their anti-ISIS operation along the road connecting Ithriya in Hama province to al-Tabaq, won back the ISIS position one after another and deployed their ready-to-fight forces near the town's countryside," the sources said. "The ISIL left behind at least 15 dead members, including commanders, and several more wounded and fled the battlefront," they added. "The ISIS military vehicles also sustained major damage in the attacks," the sources said. "The Syrian and Russian warplanes played crucial role in the ground forces' advances in Western Raqqa," the sources said. In relevant developments on Tuesday, the Syrian Army troops and National Defense Forces (NDF) engaged in fierce clashes with the ISIL along Hama's main road to al-Tabaqa airbase and forced the terrorists to retreat from the battlefield. The ISIS left behind at least 16 members, including non-Syrians, dead and several more wounded and fled the battlefield after its offensive to penetrate into the government forces' position along a road connecting Ithriya in Hama to al-Tabaqa in Raqqa were fended off by the Syrian government forces. In the meantime, several ISIL members, including their commanders, were killed in clashes with the terrorist rivals of Liwa Thawar al-Raqqa in Northern Raqqa, FNA reported.
2024-02-25T01:26:58.646260
https://example.com/article/7709
Today, all the speculation can be put to rest: Slingshot is here, for real this time. Unlike Poke, Slingshot is not a direct Snapchat ripoff. "With Slingshot, we wanted to build something where everybody is a creator and nobody is just a spectator," Facebook said in a blog post announcing the launch. That's right – lurkers aren't welcome on the app. As with Snapchat, users can send photos or videos -- adorned with text or coloring, if desired -- that last up to 15 seconds with Slingshot. Each message can be viewed exactly once by the recipient before disappearing for good. Unlike Snapchat, however, opening a message on Slingshot requires that you send a message of your own back to its sender. "Here’s the deal: friends won’t be able to see your shot until they sling something back to you," Facebook explained. While it's good news that Slingshot isn't another straight-up Snapchat clone and while the intent is admirable, it's fair to wonder whether Facebook has overestimated our collective desire to share versus our collective desire to consume. After all, plenty of people use social networks to "lurk," spending most of their time checking up on other people's posts instead of posting themselves. For those types, being forced to respond to a message on Slingshot might be a tough sell. Still, Facebook is determined to try. "[Venture capitalist] Fred Wilson once said that the cardinal rule of social networks is that 1 percent of people create content and 90 percent of people consume it," Slingshot designer Joey Flynn told the Verge, "and we want to flip that on its head."
2023-08-01T01:26:58.646260
https://example.com/article/6418
This is probably the most bizarre and ghoulish part of the Christian evangelical culture in the US: hoping not just for political defeat but for the complete destruction of the country in order to teach a lesson. Take Franklin Graham, for instance. His Obama Derangement Syndrome is full-blown: Maybe God will have to bring our nation down to our knees—to where you just have a complete economic collapse. And maybe at that point, maybe people will again begin to call upon the name of almighty God. This goes back to what I’ve been saying now is the chief goal of the GOP at this point: to relentlessly punish the coalition that President Obama built in order to try to split it, to force it to break through applied Stockholm Syndrome. Graham’s words go right into this. It serves the GOP’s purpose: “our kind” will be spared, “those people” will be punished. From Mitt Romney’s “gifts” comments all the way on down, the GOP is now looking to knock the blocks out from under the Democratic Big Tent platform. They’re targeting the Voting Rights Act, going after contraception and Planned Parenthood funding, still dragging their feet on immigration and marriage equality. They know that if the Dems get proper credit for those, the Republicans are done. Before it was about sabotaging the country to win. Now it’s about sabotaging the country for revenge. https://www.balloon-juice.com/wp-content/uploads/2015/11/balloon_juice_header_logo_grey.jpg00Zandarhttps://www.balloon-juice.com/wp-content/uploads/2015/11/balloon_juice_header_logo_grey.jpgZandar2012-11-19 09:06:442012-11-19 09:06:44Calling Down The Brimstone Maybe God will have to bring our nation down to our knees—to where you just have a complete economic collapse. And maybe at that point, maybe people will again begin to call upon the name of almighty God. Or maybe His church should focus on loving our neighbors and meeting the needs of human beings like Christ did instead of acting as a branch of the Republican party. Graham’s God is quite the sadist. In order to put Fallen America onto the straight path He could have simply willed a Willard Romney victory, but instead, He sent a hurricane, intervened to support court challenges to voter ID laws and otherwise meddled to extend our Muslim overlordship and create a Second Great Depression in 2013 that would have been easily averted by Willard’s magical capitalistic skillz. And don’t forget how He willed a stock market crash in 2008 so as to put the Muslim in office to begin with, thereby derailing the Straight Talk Express, which would have lengthened the Cheneyesque Golden Era of True Christian Ministry throughout the world. And this slow, pain-heavy path keeps the baby-killing machinery operating in place until Repentant America puts Judge Moore on the Supreme Court in 2017. Maybe God will have to bring our nation down to our knees—to where you just have a complete economic collapse. And maybe at that point, maybe people will again begin to call upon the name of almighty God. It’s disgusting but not all that bizarre. It’s a lot easier to hope for the Rapture than to care for the poor or deal with present real world in general. The same goes for obsessing over abortion and fetuses. I can’t help but believe that F. Graham is upset about something unrelated to the actual topics of discussion. His charity may have had problems in East Griftostan or something like that and he’s playing the anti-Obama card for the rubes as a form of revenge. I’ll bet something comes out that makes his actions crystal clear. Grifters gotta grift. Oh, and “maybe people will again begin to call upon the name of almighty God” — again? That assumes they ever did. When, exactly, were these halcyon days of universal piety? Fifty years ago? A hundred? Two hundred? A thousand? I mean, if he wants us to collapse like Rome and then have a Middle Ages, I imagine he’ll be shocked by the filth and the short life spans. But I imagine he’ll also be shocked by the way people in the Middle Ages still think he’s an asshole. Maybe God will have to bring our nation down to our knees—to where you just have a complete economic collapse. God’s been working this angle for millennia: Look at the birds of the air: they neither sow nor reap nor gather into barns, and yet your heavenly Father feeds them. Are you not of more value than they?… And why do you worry about clothes? See how the flowers of the field grow. They do not labor or spin. Blessed are the moochers, I guess, for theirs is the economic collapse. The other thing I want to say is that the whole “G-d needs to get his fucking act together and smite my enemies” thing is also as much as to say “G-d needs to do more so I can do less.” Franklin’s whole shtick is to imagine that what g-d wants is for people to turn to him in their misery. But Jesus, at least, did not advocate emmiserating or insulting people in order to turn their minds to the eternal–he advocated doing for others as a way to bring the individual closer to the kingdom of g-d within themselves. That’s incredibly obvious if you read the Gospel. Pretty much all of Jesus’s time was spent admonishing the individual to do more for the community, not advocating that the community suffer more to prove their sincerity or their worth. Also, a not unimportant fact is that Jeremiah Wright was, in fact, named for the biblical personage–kickin’ it old testament style–that he ended up most resembling, the eponymous author of the Jeremiad. This sort of God-will-smite-us stuff has been a staple of religious crankery for a long time: only now, instead of being the province of long-bearded nuts in robes carrying hand-lettered signs on street corners, today we get the message on TV and the Internet from articulate preachers in expensive suits. Same-old, same-old, though: we’re still here, and God is still as indifferent as ever…. It’s interesting to me how much misery in the world tracks back to belief in who should be punished and who should be rewarded. Capital punishment is the ultimate expression of that belief. My particular belief system is the opposite…it flips that philosophy on its head. Care for the “undeserving” and make people who think they’re the “deserving” damned uncomfortable. Puts me at odds with evangelicals, followers of the prosperity gospel, and the Catholic hierarchy. But, I suspect there are many more people like me, religion or none, than like them. Of course God’s fiery wrath will reign down on everyone but the evangelicals. That’s how these things work; whenever a person argues that a situation has to get worse before it gets better, you always know that their own comfortable little perch will remain untouched by the storm while someone else gets to be the martyr. Besides, if God destroyed Franklin Graham along with everyone else, who would be left to collect the offering? Did you ever hear a gay person, ten years ago, that we needed more young gay people tied to fence posts and pistol-whipped into an intracerebral hemorrhage in order to better advance the cause of gay rights? Did you ever hear black civil rights advocates in the 1960s say that more children being obliterated in church bombings would hasten the passage of the Civil Rights Act? No. And they never said it because it was their own skin on the line. Incidentally, this is why you only heard of the necessity of a Romney Administration as a means to generate more political opposition to DRONEZ from well-fed white progressives and first world libertarians. Graham is just revealing what seems to motivates many evangelicals. Look at Pat Robertson’s rhetoric, or Falwell’s. You think they’re motivated by charity? Nope — it’s a revenge fantasy. Unbelievers will be — better be — punished. Nietzsche was right: it’s ressentiment. I’ve always thought that Franklin was a fake. He uses the church as a prop for his act. All the world’s a stage and all that. I think that Billy actually believed what he preached. If there really is a Judgment Day, Ol’ Frankie is going to come up saying “I did this and I did that and I’m just pretty darn wonderful.” And the Judge will say “Who the hell are you? I don’t know you. Get outta here.” It was always revenge. Revenge for losing their war of secession. Revenge for losing the battle to keep the vote in limited hands. Revenge for civil rights. Revenge for winning the cold war. Revenge for the rise of the middle class. Revenge against unions. Revenge for being born in the twilight of white male privilege. There is no other motivation other than revenge against the dying of the white. These people would rather be right than be happy. They’d rather be right than that their own children be happy. Think about that. They’d happily see their children living in some kind of dystopian hellscape, as long as they could point to it all and say, “See? See? I told you people what would happen, but did you listen to me? Noooooo! You had to go and usher in the apocalypse anyway. Well, now you’re in for it. Now you’re going to get it. I only hope you understand the mistake you’ve made. This is all your fault, so I hope you’ve learned something!” And, even worse, they want to be right so badly that they’re willing to fuck everybody over themselves to show us that they should have listened to us. They are willing to do the work themselves to bring about the downfall that they warn us about. They don’t get it that if the doom they endlessly prophesy is one that they themselves bring about to teach us how wrong we were, then maybe we weren’t so wrong to begin with. They’ll never see it, though. They’re like some asshole who beats his wife: “I told you not to do a, b, c, but you did it anyway. Now I have to punish you. This is all your fault. I’m not responsible for beating you up, you are. Maybe next time you’ll learn.” Sure Graham’s comments were absurd, but to make the leap that he speaks as the voice of the GOP is false. In fact one of the things his said in his rant was “I don’t have confidence in the Republican Party right now“. So how can you argue that his comment is anything at all to do with the GOP? Can you find anyone in the GOP who had endorsed his comments? And to use Mitt Romney’s “gifts” comments as an example of how the GOP is now “looking to knock the blocks out from under the Democratic Big Tent platform” is nonsense. All Republicans have run away from those comments and many prominent GOPers have attacked Romney over the weekend for his words. You won’t find a single one who supported what he said. Similarly, you are hard pressed to find any Republican except Graham supporting McCain’s current meltdown, and Politico has an article on how “GOP plots to prevent more Todd Akins” (i.e. to prevent extremists like evangelical Akin getting nominated). All the evidence I see since the election is that the GOP establishment is hellbent on distancing itself from their party’s extremists. Before it was about sabotaging the country to win. Now it’s about sabotaging the country for revenge. Really? Since the election all you see is the GOP “sabotaging the country for revenge”? Get a grip. Your rant is up there with the worst of the wingnut drivel. Being partisan is fine, but your post is not based in reality. Yeah, it always amazes me how un-Christian these “Christians” are. It’s like they want to put together their own Jefferson Bibles, only in their Bibles, Jesus never opens his mouth. I don’t understand how these clowns can call themselves Christians. It’s like they never read anything Jesus ever said. What did he say? He said, “If some guy comes along and is freezing, and he needs your cloak, give it to him, and your shirt, too.” “If you help some filthy beggar who has nothing to eat, you’ve fed me. If you while away a little time with some poor soul rotting away in jail, you’ve spent that time helping me.” “If some asshole hits you in the mouth, don’t hit back. Stand up and show him you aren’t scared of him, but that neither will you sink to his level.” These fundamentalists don’t understand any of that. It’s like they’ve never heard of Jesus as anything but a name, a totem, a shibboleth, a get-out-of-jail-free card. To them, Jesus is just a means to getting free stuff. I’ve said it before, if Jesus showed up again tomorrow, Graham, Robertson and all these other assholes would be the ones screaming the loudest to string him up. Remember that coal baron from Murray Energy who forced his workers to stand behind Mitt Romney at a rally or else they’d lose their jobs? After losing the election he read this poignant (sarcasm alert!) prayer to his employees. Sure Graham’s comments were absurd, but to make the leap that he speaks as the voice of the GOP is false. In fact one of the things his said in his rant was “I don’t have confidence in the Republican Party right now“. So how can you argue that his comment is anything at all to do with the GOP? Can you find anyone in the GOP who had endorsed his comments? Wow! Talk about a double standard. Remember when a left leaning person on CNN accused Ann Romney of not working since she was just a mother (or something like that)? And FoxNews (and people like you) just exploded calling this left leaning person a Democratic strategist, Obama surrogate etc etc. This eventhough she was neither. And now when the shoe is on the other foot people like you take a complete different stand. It is rather amusing to watch. Besides, Franklin criticizing the GOP? Where have you been the last 4 years? There is no organization that has criticized the GOP more than the Tea Party. It is like every right winger hates the GOP establishment. Thus, your statement that Franklin criticized the GOP is meaningless. Their weird version of Jehovah is an abusive asshole. Calling down hurricanes for gayness. Sending earthquakes for atheism. Having rapists attack you just because he thinks you need a baby. Giving AIDS to millions because some people were fucking in unapproved ways. Like many victims of abuse, they’ve decided that this is how things should be. They don’t want things to get better. In practice, they’re opposed to things getting better. And if things aren’t going to get better for them, they certainly shouldn’t get better for you. Basically, their version of Christianity doesn’t make much sense if you’re well-adjusted, compassionate, and reasonably whole. All they want is for you to agree that they’re perfectly right, and all that takes is for you to be made as miserable as them. If there are no atheists in foxholes, then let’s have trench warfare for everybody. It’s sick, of course. One of the most hopeful things to come out of this election for me is other versions of Christianity starting to come forward. The long evangelical fever dream might actually be breaking. CBS did a very nice hour long special on his ministry. The guy could not have been more cynical if he tried. You want a “Crusade” in your town? Bill’s people would estimate how much churches in town were pulling in every week and they used a simple formula week 1 after the visit collections would be up x% (I don’t remember the exact number but they had one. Week 2 collections would be down a tiny from 1 but y% more than usual. And so on until 10 weeks after his visit collections would be back to average. Those churches would give Billy a percentage of that increase plus first class accommodations and travel. When he asked people to come down front and be saved they were directed to salesmen in the back who would take your name, address and phone number along with preferred denomination and provide your contact info to the closest match from those that had paid for the ‘Crusade’. At a time when the minimum wage was $1.75/hour Bill was wearing $1000 custom made suits. When asked how he justified that he had a biblical quote all ready: “A workman is worthy of his hire” An Episcopal pal of mine wound up sitting next to a prosperity minister on a flight. After they discovered they were both ministers, they chatted shop talk. My pal was apalled when the prosperity preacher asked, “So, what’s your percentage take?” Evidently fundy ministers are paid some large percentage of the weekly contribution pot, while Episcopal ministers are on a salary from their diocese, like any professional. They also know Greek, Hebrew, etc, etc. While fundy ministers know how to make a crowd rowdy and ready to empty their pocketbook. Oooooohhhhh. He brought out the sheep comment, because you know, reading something an dagreing with it and understanding the purpose and theme of what was written is just like being a sheep. And writing some contrarian bullshit that acts as if things only exists in a vacuum and cherry picks a line from the link while compeltely disregarding many years of other things being said is the essence of cool kid, political saavy. /facepalm This is not a new grift either – that story about Graham was from the 60’s and I doubt he invented it. Aimee Semple McPherson probably didn’t either but did use the new medium of radio to enlarge the flock to be sheared Just as soon as you make a charge worth of being reputed it might be worth trying. [1] Zandar explicitly tied Graham’s comments to the GOP, but Graham explicitly criticized the Republicans in his comments. Zandar just saw chum in the water without bothering to read what Graham actually said. [2] Zandar tied Romney’s “gift” comments to the GOP, but the GOP establishment has been very vocal in repudiating his comments. So the premise of the post is bullshit. Bullshit is bullshit no matter where it is coming from. I realize tribal loyalty is a powerful thing, but you got anything except insults? @Mandalay: [1] As others mentioned, plausible deniability. The GOP is happy to collect the votes and campaign volunteer hours from Graham’s flock. And there won’t be a word of reproach for his sick revenge fantasies. [2] They repudiated him after the election, I notice. Back during the earlier 47% dustup, it was all defense. Anyway, Mitt’s main sin (aside from losing) was revealing what they actually think rather than what they claim in public that they think. @The Red Pen: Abraham Lincoln speculated that the Civil War might actually have been divine retribution against the US for slavery. He wasn’t the only one. But he wasn’t hoping for everything to be destroyed; he was doing his best to hold the country together. ‘Yet, if God wills that it continue until all the wealth piled by the bondsman’s two hundred and fifty years of unrequited toil shall be sunk, and until every drop of blood drawn by the lash shall be paid by another drawn with the sword, as was said three thousand years ago, so still it must be said, “The judgments of the Lord are true and righteous altogether.” ‘ And Frankie has been a dear dear friend of the goopers throughout this cycle if not before. TO pretend he is not expressing gooper beliefs is to say nobody speaks for them That ‘distance’ is simply self-preservation. Just like the rape-friendly comments were not one-offs but just public admissions of deeply held gooper beliefs one cannot distance the party from its core. Well, to be fair, (why I would want to be fair when Mandaly can’t even attempt such a feat is beside the point) It might not be a MAN, it might be a chicken but I didn’t want to upset Betty and her flock How is what Graham said any different from Reverend Wright’s “Goddamn America” and “chickens coming home to roost”? Oh right, Graham is WHITE. Also, Rev. Wright was accused of having said such once, whereas right wing white Talibangelicals have said these things over and over and over and over and over and over and over and over and over, and no one cares, and there was no 24 hour news coverage for however many weeks or months (which later completely vanishes down the memory hole as never having been covered by the lamestream media). After Romney was nominated, there was a wonderful ecumenical spirit in the evangelical and conservative churches. Many leaders, Franklin Graham among them, who had for decades called the LDS a dangerous cult suddenly realized that the Mormons were fellow Christians, and that’s why God chose Mitt Romney as the Republican nominee. So part of this might be a quick re-establishment of Franklin’s bona fides (in the literal sense) – though as I said, few of his fellow evangelical leaders are in a good position to call him out on that. They repudiated him after the election, I notice. Back during the earlier 47% dustup, it was all defense. Right, but Zandar’s post was explicitly about the post-election conduct of the GOP, and the fact that prominent Republicans are climbing over each other to repudiate Romney’s gift comments disproves Zandar’s argument that the “GOP is now looking to knock the blocks out from under the Democratic Big Tent platform”. On the contrary, if adopting policies of the Democrats will help give the GOP power they will do it in a heartbeat. Policies, principles and beliefs are completely secondary to power for most political parties the world over. Maybe God will have to bring our nation down to our knees—to where you just have a complete economic collapse. And maybe at that point, maybe people will again begin to call upon the name of almighty God, if you people won’t vote for my preferred candidate. That ‘distance’ is simply self-preservation. Just like the rape-friendly comments were not one-offs but just public admissions of deeply held gooper beliefs one cannot distance the party from its core. On the contrary, all the evidence since the election is that the GOP is distancing itself from its core, and going for the center, just as Clinton did. I think that the GOP has finally worked out that it loses more than it gains by putting up with its wingnuts. It will ditch them in a heartbeat if they can find an alternative path to power, and going hard for the center might be a viable approach. While many in the GOP base might have core beliefs (pro-God, anti-abortion, pro-military, anti-union, anti-immigration, anti-gay etc.) the GOP itself has no beliefs at all. It picks what to believe at the appropriate time so that it can have power. When the South lost the Civil War, they were still able to drag their feet on integrating society for around one hundred years (with pockets persisting to this day). I don’t feel the new breed of white xian privilege supremacists will eveolve any faster. The generational dynamic has to die off. I wish those pushing for a more egalitarian society would metaphorically consider the tactics of William Tecumseh Sherman, because otherwise we’ll hear of the defeated but unbowed right continuing to claim, “It’s just a flesh wound.” They have no sense of shame or self-awareness and need to be subjected to (again metaphorically) a scorched earth, salt the fields type approach. Right wing “Christians” are desperately trying to squeeze in whatever parts of their dying agenda they can before the end of their era of influence. They are on their way out: they’re the spokesmen for a quickly disappearing age group of voters. It’s scaring the hell out of them that not only are they looking at their own demise, no one will be there to pick up the reigns to carry on their tradition of hate. This chart says it all: the people who voted for Obama are the future of Christianity, and they want nothing to do with the Franklin Graham’s of the world: Oh, and Franklin, you POS, your God’s arms are too short to box with me. Nice sell-out by you and your doddering pa to remove all your LDS hate from your website so you could try to ride their coattails back to power. It’s a shame that your hell does not exist because you’ve certainly earned yourself a spot there. A fair point, but while the right wing media are certainly behind McCain (simply because he is attacking the Obama Administration) there is no support for McCain in the GOP establishment. Lindsay Graham is the only Republican politician supporting McCain. Despite what Zandar says, post-election we are seeing the start of “kinder, gentler” Republicans. basically, they’re well suited to one another. The GOP is fundamentalist explicit when convenient and tacit when they had to go temporarily Mormon. Brand Gooper’s so toxic currently that Evangels are denying that attraction now while cocks are crowing repeatedly. Rather amusing watching them insist to everyone in the gym that in no way did they arrive in a single car and that corsage matching the cumberbund is entirely a coincidence. Graham is just revealing what seems to motivates many evangelicals. Look at Pat Robertson’s rhetoric, or Falwell’s. You think they’re motivated by charity? No, I don’t. They are motivated by the two most basic tenets of modern evangelical Christianity — avarice and greed. These guys aren’t in for the God — they’re in it for the $$$. Every one of them is quite wealthy and they want to protect that wealth — that is their sole reason for being politically active. To wield political power, they need the support of the low information believers so they spout all this evangelical bullshit to get the sheep heading in the “right” direction. These are cynical, evil people and since most of them are racists (maybe not all as vocal as Fuckem’ Graham) Bronco is a very convenient target because they too are relying on the perceived racism of their followers. They are just afraid we will have someone to worship like they do Reagan. Of course we don’t really do the whole worship thing. At least not the way they do. Unfortunately, no way Republicans are gonna allow any big wins in his last term. No way. So I will be stuck with 4 years of listening to assholes like Bill Maher and Mike Moore whining that he is not progressive enough…when in fact it will be Congress that is not progressive enough. @Felonius Monk: Wishful thinking. I recently read that the IRS has done very little or no review of tax exempt status of religious organizations during the first Obama administration out of fear the “victims” would scream murder, but I can’t find a link. Back in 2000 I remember a bunch of Green/Naderites basically mouthing the same exact sentiment from the far left. Bush and Gore were basically two peas in a pod so better to have Bush completely bring the country down so that a true progressive and green government could arise from the ashes and take its place. These grifters are not stupid. They know their history, the history of the melding of the fire and brimstone evangelicals with right wing politics. They know that it all sprang from Oklahoma, where arguably the effects of the dustbowl debacle and the Great Depression had deepest and longest lasting effects. It’s only in that utter destitution that normal people start believing The Crazy. It’s only in that utter destitution that the likes of Graham, Oral Roberts, TL Osborne, Billy James Hargis, and Ted Walker could rise to have followings and even to be taken seriously by non-believers. The current grifters know that the worse off people are, the more they will listen to The Crazy. Seriously, how dumb are you to look at the actual statements of Republican leaders in Congress and say, “Well, sure, they’ve spent the past 30 years trying to kill Social Security and Medicare, but they don’t really mean it this time.” Hargis was the bible-thumper that linked the conservative Christian movement with right wing politics. His partner in crime, General Ted Walker, was even the model for General Jack Ripper of “Dr. Strangelove” (along with Curtis LeMay), was finally drummed out of the Army for sedition, only to have Ronald Reagan reinstate him so that he could get full gov’t bennies. Look, the Republican Party is twined so tightly with the fundamentalists–of all kinds; Grover Norquist is no more than another kind of fundamentalist–that I don’t know whether there’s any way for them to untangle themselves, unless they’re willing to let the party fall to bits. We aren’t going to see “kinder, gentler” Republicans. They can’t pull that off, and I think they know that. Even if they did how many people would believe them? The only way these guys are going to have any kind of shot at getting control or keeping it nationally is to let as few people vote as they can get away with. That’s why we’ve seen this desperate work the last few years to knock people off the rolls, cut back on the days and hours polls are open, throw up all these i.d. roadblocks, and then, if they lose, do everything they can to undermine America’s faith in its own institutions by screaming “Voter fraud! ACORN! New Black Panther Party!” The leaders of your Republican Party made this abomination, and now they, and you, are stuck with it. Good for you. Good work. It couldn’t happen to a more deserving bunch. If there really is a Judgment Day, Ol’ Frankie is going to come up saying “I did this and I did that and I’m just pretty darn wonderful.” And the Judge will say “Who the hell are you? I don’t know you. Get outta here.” The whole “that which you do for the least of me” part of the Bible, among other things, should really put to rest the entire theology of “faith not acts,” that your salvation is predicated only on whether you believe in Jesus and not on your actions. I mean, it contradicts the plain text of the Bible just as much as gay marriage and far more than abortion. I suppose you can come up with some sort of allegorical “this is what he REALLY meant to say” rationalization for why it doesn’t really mean what it says, but you sure as hell can’t do that and call yourself a Biblical literalist. Yeah, Billy Graham’s not exactly the Reagan coalition’s religious right, but he was still an asshole no matter what his public persona. That part of the Nixon tapes when he and Nixon are agreeing that “the Jews” have a stranglehold on the media and hopefully they can do something about it in his second term should really tell you all you need to know about him. Yes. As a Christian, I never understood how people can say that all you have to do is “believe” in Jesus, and you’re off the hook. Seems to me, if you truly “believe in Jesus”, you might feel some need to help those who are worse off than you are. What good does it do to “believe” in Jesus, if all you use that belief for is to weasel out of feeling any responsibility for others? It’s empty, nothing but words. And I think Jesus had a few pointed things to say about people like that. These are poeple who know all the right words to say, but don’t live the life that a real understanding of or belief in the words compel them to live. While many in the GOP base might have core beliefs (pro-God, anti-abortion, pro-military, anti-union, anti-immigration, anti-gay etc.) the GOP itself has no beliefs at all. It picks what to believe at the appropriate time so that it can have power. Insofar as “the GOP” = “Wall Street” (Wall Street’s certainly the majority shareholder), I totally believe that, actually. The moderate phase of the GOP in the fifties and sixties wasn’t a rejection of the capitalist establishment (not with a Rockefeller leading the moderate wing of the party), it was just the establishment deciding, after twenty years of losing to Democrats, that the New Deal state was here to stay and if they couldn’t beat it they should join it. This chart says it all: the people who voted for Obama are the future of Christianity, and they want nothing to do with the Franklin Graham’s of the world: I hope this’ll stick. I’ll be keeping an eye out for it in the (long term) future. I was raised Christian, but I’m on a hiatus from organized religion at the moment and I really can’t say I miss it – too many fucking charlatans, too many power-hungry bigots and psychos, too many whiny little shits complaining that they feel so oppressed because Obama’s not hugging them enough (or allowing them to determine other people’s health care or lives). Maybe there’s a God and maybe there isn’t, but I’m completely burned out on all of his fan clubs. From what I understand, the logic is that having “found” Jesus will naturally lead you to do these good things for the poor and others, and that of course, you should do these things – and there are fundiegelicals who do take that seriously and act accordingly. But it’s not a vital part of the salvation process, just something you should do. (At least that’s how it was explained to me). According to the Bible, though, it seems like it really is a vital part of the salvation process, at least as much as the “I accept Jeebus as my personal Lord and Savior” part. True, though Jim Crow sought to codify it. Sure, there’s intolerant attitudes anywhere you go, but for example, Loving v. Virginia was meant to reflect what the prevailing mindset deemed right and proper. I recently learned how African-Americans were the ones ensuring the Union dead had respectful treatment, burial, and cataloging of the remains at ishubstantial resentment and risk of reprisals in the South. It worthwhile to point out that those who had established their bona fides for full membership in society continued to be blocked no matter who created the impetus for such. IIRC, “faith not works” statements in the Bible were originally part of trying to differentiate Christianity from Judaism, because (again IIRC) in Judaism you don’t actually have to profess your belief in anything as long as you follow all of the rules you’re supposed to follow (keep kosher, etc.) Christianity’s only “rule” is supposed to be “love one another as I have loved you,” and your actions are supposed to flow from that. Of course, it also became a way for Protestants to differentiate themselves from Roman Catholics during the Reformation — the whole payment of indulgences to the RCC for forgiveness of sins was rejected in favor of “faith not works,” but of course, human nature being what it is, some a-holes decided to expand that out into belief being the only important thing and that they could ignore the whole “works” part that Jesus spends a lot of time talking about. It’s always fun to hit “faith not works” fundamentalists with James 2:14-17 (aka “faith without works is dead”): What does it profit, my brethren, if someone says he has faith but does not have works? Can faith save him? If a brother or sister is naked and destitute of daily food, and one of you says to them, “Depart in peace, be warmed and filled,” but you do not give them the things which are needed for the body, what does it profit? Thus also faith by itself, if it does not have works, is dead. I was talking less about intolerant attitudes in the rest of the country (though they existed for sure) and more about the fact that after Reconstruction, the Republican/robber-baron establishment in the rest of the country happily allowed the ex-Confederate establishment to come back to power and rule unopposed for the next hundred years or so. It’s only been a couple weeks since the election. Mitt Romney was the face of the new GOP: a rich white guy who will literally lie repeatedly and openly to your face until he notices that he’s said something you want to hear. The GOP has been more and more open about this tactic for the last 4-5 elections. Next time, they’ll just pick somebody who’ll steal the election. It’s not like democracy is at all in their interest or they wouldn’t work so hard to subvert it. I think you see that great schism again after the reformation. The RCC maintained a complicated system by which people who might appear undeserving could ‘buy’ their way into heaven. Marty objected to that & that lead to Protestantism. Later Johnny Westley felt you needed a ‘method’, really just good works and there came Methodism. No idea how what Baptists think is important enough to name themselves for ;) This is nothing new. I grew up attending an evangelical church and school (Missouri Synod Lutheran), and often remember our pastor expressing the fond hope for some major national calamity to frighten America to faith. He even used the same “to our knees” motif, IIRC. And, as others have pointed out, this kind of gleeful apocalypticism is not exclusively a fundagelical or right-wing phenomenon. Go to a lot of climate change or peak oil forums, and I guarantee you’ll find many individuals with a similarly keen desire to see suburban consumer America get punished for any number of ecological, political, economic, and/or aesthetic sins. Finally, there is no “control group” for the efficacy of prayer. When I used to believe and pray, I felt the whole, “God bless mommy and daddy” litany of names to be recited was too time consuming and wasteful so I amended my prayer request to, “Bless everyone in need of grace, everywhere, in all times past, present, and future.” I felt that the supposed grace of God was, if anything, infinite, and that rather than risk leaving someone out by my thoughtless omission, I’d rather petition the creator of the universe to “do the right” thing and spread it generously in the hope that the ‘bad’ might become ‘good’ and the good might become better. That’s why I’ve always hated the concept of “God bless America” as if grace was a finite resource to be hoarded, and that it is blind to the notion that grace and blessings bestowed widely is in our own interest (supposedly) as a more just world benefits us indirectly if not directly as well. Heard a radio sermon this weekend (I get very few stations in my area) and was somewhat offended at the prosperity gospel pitch that God will deliver, but you have to ask. The pastor only mentioned goodies for yourself and I thought about all the times I prayed for those whose plight I was not even aware of the get some help since Mr. Peeping Jehovah would know better than me who needed to be cut a break. I remember a comic saying, “Sure I believe in God, it’s just that my God is a capricious prick.” Now that has a logical consistency that appeals to my godless mindset. Bart Ehrman is probably the foremost American scholar of the Bible today and he’s got some really fascinating historical books about it. Misquoting Jesus is all about the things that got added and subtracted in the various books of the Bible in the course of making Christianity into a separate religion and not a sect of Judaism. It’s pretty fascinating stuff if you’re interested in history. (Most fascinating tidbit — the whole “let he who is without sin throw the first stone” was almost certainly not said by Jesus, but was made up by a European monk in the Middle Ages.) As far as the “God bless America” stuff, I agree. I’ve always found their mix of God and country to be pretty much idolatrous. According to the Bible, there’s only one nation that’s ever had that special, “chosen” status; it wasn’t America, which wouldn’t even be born for another 2,000+ years. And a huge part of the point of Jesus coming down to Earth was to spread the message beyond that country. The Nazarene DFH delivered his message person to person without regards to things like nationality – and that message had nothing to do with who the state of the international order, either. Christianity, and God if he does exist, were around long before we were an ache in Britain’s crotch, and they’ll be around long after the country’s crumbled into dust. Empires rise and fall, and God’s never really seemed to give a shit. It’s the people in them that interest him.
2024-05-11T01:26:58.646260
https://example.com/article/3283
Are you interested in using my jokes in your monologues? I am available to write jokes for anybody who needs a monologue joke or two. If you need me, contact me by my email, which is alexschubs@gmail.com. Serious inquiries only! Thank you for reading my blog, and happy laughing! Friday, November 12, 2010 "Diseased Lungs" The federal government has proposed placing graphic images of diseased lungs on packages of cigarettes. They could also just ban cigarettes. Researchers say Neanderthals had a raucous and promiscuous sex life. In fact, it was reported that Regis Philbin had seven mistresses. The new French fries at Wendy’s now have sea salt. Unfortunately, so does their water. The tuberous bushcricket has the largest testicles in relation to its body size of any known creature. That's ironic for a creature with "bush" in its name. Two sisters in Oklahoma playing for their school golf team got holes-in-one during the same round. And they also kicked ass on the golf course, too. Sears stores will stay open on Thanksgiving Day for the first time in their 124 year history. In fact, every Sears store combined is expected to get at least two customers. Presumptive House Speaker John Boehner says he will travel between home and Washington, D.C. on commercial flights. I'm not sure Joe Biden got the message when he heard "Boehner coming and going". A sex shop in Alabama offers a drive through window to buy sex toys. What do you get when you cross a drive thru with a sex shop? "Would you like fries ... with this shake?". President Bush says he has a “clean conscience” when it came to recognizing the problems that led to the financial crisis. No, Mr. President, it wasn't your conscience that was clear. It was your brain. Former NFL quarterback Jim McMahon says he is suffering memory loss at age 51. The real question is: how does he know what he's suffering from?
2024-07-09T01:26:58.646260
https://example.com/article/9014