content
stringlengths
4
1.04M
lang
stringclasses
358 values
score
int64
0
5
repo_name
stringlengths
5
114
repo_path
stringlengths
4
229
repo_licenses
listlengths
1
8
package { public class Test { } } /* NOTE: This is not the actual source to this test. * * This is just a tribute. The actual source is in test-0 and this file (as * well as the accompanying FLA) is provided purely for reference only. * * The AS3 compiler in modern versions of Adobe Animate does not allow * generating references to the package-internal specializations of Vector, so * this code will yield runtime errors if compiled normally. * * Instead, compile the test, disassemble the resulting ABC (using rabcasm), * and open the PackageInternalNs("__AS3__.vec") namespace in each access to * the Vector$... classes. After reassembling and running the movie you should * be able to get debug output (at least in Scout). */ trace("///Vector$int === Vector.<int>"); trace(Vector$int === Vector.<int>); trace("///Vector$uint === Vector.<uint>"); trace(Vector$uint === Vector.<uint>); trace("///Vector$double === Vector.<Number>"); trace(Vector$double === Vector.<Number>); trace("///Vector$object === Vector.<Object>"); trace(Vector$object === Vector.<Object>); trace("///Vector$object === Vector.<*>"); trace(Vector$object === Vector.<*>);
ActionScript
4
Sprak1/ruffle
tests/tests/swfs/avm2/vector_legacy/Test.as
[ "Apache-2.0", "Unlicense" ]
function fibR(n) { if (n < 2) return n; return (fibR(n-2) + fibR(n-1)); } local function fibI(n) { local last = 0; local cur = 1; n = n - 1; while(n) { --n; local tmp = cur; cur = last + cur; last = tmp; } return cur; } loadfile("profile.nut")() print("fibonacci loop: " + profile_it(20, function() {fibI(6511134)}) + "\n"); print("fibonacci recursive: " + profile_it(20, function() {fibR(31)}) + "\n");
Squirrel
3
profelis/daScript
examples/profile/tests/squirrel/fib.nut
[ "BSD-3-Clause" ]
create { source { git { repo: "https://r8.googlesource.com/r8" tag_pattern: "%s-dev" } patch_dir: "patches" } build { dep: "chromium/third_party/jdk" # gradle cannot be executed correctly under docker env no_docker_env: true } } upload { pkg_prefix: "chromium/third_party" universal: true }
PureBasic
3
zealoussnow/chromium
third_party/r8/3pp/3pp.pb
[ "BSD-3-Clause-No-Nuclear-License-2014", "BSD-3-Clause" ]
package com.baeldung.comparison.shiro; import java.sql.Connection; import java.sql.SQLException; import java.util.Arrays; import java.util.Collection; import java.util.HashMap; import java.util.HashSet; import java.util.Map; import java.util.Set; import org.apache.shiro.authc.AuthenticationException; import org.apache.shiro.authc.AuthenticationInfo; import org.apache.shiro.authc.AuthenticationToken; import org.apache.shiro.authc.SimpleAuthenticationInfo; import org.apache.shiro.authc.UnknownAccountException; import org.apache.shiro.authc.UsernamePasswordToken; import org.apache.shiro.authz.AuthorizationInfo; import org.apache.shiro.authz.SimpleAuthorizationInfo; import org.apache.shiro.realm.jdbc.JdbcRealm; import org.apache.shiro.subject.PrincipalCollection; import org.slf4j.Logger; import org.slf4j.LoggerFactory; public class CustomRealm extends JdbcRealm { private Logger logger = LoggerFactory.getLogger(CustomRealm.class); private Map<String, String> credentials = new HashMap<>(); private Map<String, Set<String>> roles = new HashMap<>(); private Map<String, Set<String>> permissions = new HashMap<>(); { credentials.put("Tom", "password"); credentials.put("Jerry", "password"); roles.put("Jerry", new HashSet<>(Arrays.asList("ADMIN"))); roles.put("Tom", new HashSet<>(Arrays.asList("USER"))); permissions.put("ADMIN", new HashSet<>(Arrays.asList("READ", "WRITE"))); permissions.put("USER", new HashSet<>(Arrays.asList("READ"))); } @Override protected AuthenticationInfo doGetAuthenticationInfo(AuthenticationToken token) throws AuthenticationException { UsernamePasswordToken userToken = (UsernamePasswordToken) token; if (userToken.getUsername() == null || userToken.getUsername() .isEmpty() || !credentials.containsKey(userToken.getUsername())) { throw new UnknownAccountException("User doesn't exist"); } return new SimpleAuthenticationInfo(userToken.getUsername(), credentials.get(userToken.getUsername()), getName()); } @Override protected AuthorizationInfo doGetAuthorizationInfo(PrincipalCollection principals) { Set<String> roles = new HashSet<>(); Set<String> permissions = new HashSet<>(); for (Object user : principals) { try { roles.addAll(getRoleNamesForUser(null, (String) user)); permissions.addAll(getPermissions(null, null, roles)); } catch (SQLException e) { logger.error(e.getMessage()); } } SimpleAuthorizationInfo authInfo = new SimpleAuthorizationInfo(roles); authInfo.setStringPermissions(permissions); return authInfo; } @Override protected Set<String> getRoleNamesForUser(Connection conn, String username) throws SQLException { if (!roles.containsKey(username)) { throw new SQLException("User doesn't exist"); } return roles.get(username); } @Override protected Set<String> getPermissions(Connection conn, String username, Collection<String> roles) throws SQLException { Set<String> userPermissions = new HashSet<>(); for (String role : roles) { if (!permissions.containsKey(role)) { throw new SQLException("Role doesn't exist"); } userPermissions.addAll(permissions.get(role)); } return userPermissions; } }
Java
4
DBatOWL/tutorials
apache-shiro/src/main/java/com/baeldung/comparison/shiro/CustomRealm.java
[ "MIT" ]
(defun parse-argv (args) (flet ((parse-int-value (option value) (handler-case (parse-integer value) (error (e) (error "Invalid value for ~S: ~S~% ~A" option value e))))) (loop for option = (pop args) for value = (pop args) while option if (not (starts-with option "--")) do (error "Invalid option: ~S" option) else if (equal option "--address") append (list :address value) else if (equal option "--port") append (list :port (parse-int-value option value)) else if (equal option "--worker") append (list :worker-num (parse-int-value option value)) else do (error "Unknown option: ~S" option))))
Common Lisp
4
xsoheilalizadeh/FrameworkBenchmarks
frameworks/Lisp/woo/helpers/parse-argv.lisp
[ "BSD-3-Clause" ]
/* Driver for the DS2411 unique ID chip. * * @author: Andreas Koepke <koepke@tkn.tu-berlin.de> * @author: Brad Campbell <bradjc@umich.edu> */ #include "ds2411.h" module Ds2411P { provides { interface ReadId48; } uses { interface OneWireReadWrite as OneWire; interface StdControl as PowerControl; } } implementation { bool haveId = FALSE; ds2411_serial_t ds2411id; // The CRC polynomial is X^8 + X^5 + X^4 + 1, // code is taken from http://linux.die.net/man/3/_crc_ccitt_update bool ds2411_check_crc (const ds2411_serial_t *id) { uint8_t crc = 0; uint8_t idx; for (idx = 0; idx < DS2411_DATA_LENGTH; idx++) { uint8_t i; crc = crc ^ (*id).data[idx]; for (i = 0; i < 8; i++) { if (crc & 0x01) { crc = (crc >> 1) ^ 0x8C; } else { crc >>= 1; } } } return crc == 0; } error_t readId () { error_t e; e = call PowerControl.start(); if (e != SUCCESS) return FAIL; e = call OneWire.read(DS2411_READ_ADDR, ds2411id.data, DS2411_DATA_LENGTH); call PowerControl.stop(); if (e == SUCCESS) { if (ds2411_check_crc(&ds2411id)) { haveId = TRUE; } else { e = EINVAL; } } return e; } command error_t ReadId48.read (uint8_t *id) { error_t e = SUCCESS; if (!haveId) { e = readId(); } if (haveId) { memcpy(id, ds2411id.serial, DS2411_SERIAL_LENGTH); } return e; } }
nesC
5
mtaghiza/tinyos-main-1
tos/chips/ds2411/Ds2411P.nc
[ "BSD-3-Clause" ]
/* Copyright 2021 The TensorFlow Authors. All Rights Reserved. Licensed under the Apache License, Version 2.0 (the "License"); you may not use this file except in compliance with the License. You may obtain a copy of the License at http://www.apache.org/licenses/LICENSE-2.0 Unless required by applicable law or agreed to in writing, software distributed under the License is distributed on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the License for the specific language governing permissions and limitations under the License. ==============================================================================*/ #include "tensorflow/core/profiler/utils/buffer_pool.h" #include "tensorflow/core/platform/test.h" namespace tensorflow { namespace profiler { namespace { TEST(BufferPoolTest, GetOrCreateBufferAlloc) { constexpr size_t kBufferSizeInBytes = 32 * 1024; BufferPool buffer_pool(kBufferSizeInBytes); uint8_t* first_buffer = buffer_pool.GetOrCreateBuffer(); EXPECT_NE(first_buffer, nullptr); // Checks that a second unique buffer is allocated. uint8_t* second_buffer = buffer_pool.GetOrCreateBuffer(); EXPECT_NE(second_buffer, first_buffer); for (size_t idx = 0; idx < kBufferSizeInBytes; ++idx) { // Check that buffer is writable, msan will warn if not. first_buffer[idx] = 0xAB; } // Clean up buffers held by the test. buffer_pool.ReclaimBuffer(first_buffer); buffer_pool.ReclaimBuffer(second_buffer); } TEST(BufferPoolTest, GetOrCreateBufferReuse) { constexpr size_t kBufferSizeInBytes = 32 * 1024; BufferPool buffer_pool(kBufferSizeInBytes); uint8_t* buffer = buffer_pool.GetOrCreateBuffer(); EXPECT_NE(buffer, nullptr); // Write a dummy value to the buffer. buffer[0] = 0xFF; uint8_t* previous_buffer = buffer; buffer_pool.ReclaimBuffer(buffer); // Check that we can retrieved a recently reclaimed buffer. uint8_t* reused_buffer = buffer_pool.GetOrCreateBuffer(); EXPECT_EQ(reused_buffer, previous_buffer); for (size_t idx = 0; idx < kBufferSizeInBytes; ++idx) { // Check that reused buffer is writable, msan will warn if not. reused_buffer[idx] = 0xCD; } // Clean up buffers held by the test. buffer_pool.ReclaimBuffer(reused_buffer); } TEST(BufferPoolTest, DestroyAllBuffers) { constexpr size_t kBufferSizeInBytes = 32 * 1024; BufferPool buffer_pool(kBufferSizeInBytes); uint8_t* first_buffer = buffer_pool.GetOrCreateBuffer(); EXPECT_NE(first_buffer, nullptr); // Check that first buffer (not reclaimed) is still writable after // DestroyAllBuffers. buffer_pool.DestroyAllBuffers(); for (size_t idx = 0; idx < kBufferSizeInBytes; ++idx) { first_buffer[idx] = 0xEF; } uint8_t* second_buffer = buffer_pool.GetOrCreateBuffer(); for (size_t idx = 0; idx < kBufferSizeInBytes; ++idx) { // Check that second buffer is writable. second_buffer[idx] = 0xAB; } // Clean up buffers held by the test. buffer_pool.ReclaimBuffer(first_buffer); buffer_pool.ReclaimBuffer(second_buffer); } } // namespace } // namespace profiler } // namespace tensorflow
C++
4
EricRemmerswaal/tensorflow
tensorflow/core/profiler/utils/buffer_pool_test.cc
[ "Apache-2.0" ]
# -*- coding: utf-8 -*- from sphinx import addnodes """ ``local_toctree``: A callable yielding the global TOC tree that contains list of all the content below the specified page. ``local_toctree`` need pagename specifying as like as ``{{ local_toctree(pagename) }}`` and optional keyword arguments are available: * maxdepth (defaults to the max depth selected in the toctree directive): the maximum depth of the tree; set it to -1 to allow unlimited depth """ def init_local_toctree(app): def _get_local_toctree(docname, **kwds): doctree = app.env.get_doctree(docname) if 'maxdepth' not in kwds: kwds['maxdepth'] = 0 toctrees = [] for toctreenode in doctree.traverse(addnodes.toctree): toctree = app.env.resolve_toctree( docname, app.builder, toctreenode, **kwds) toctrees.append(toctree) if not toctrees: return None result = toctrees[0] for toctree in toctrees[1:]: result.extend(toctree.children) return app.builder.render_partial(result)['fragment'] ctx = app.env.config['html_context'] if 'local_toctree' not in ctx: ctx['local_toctree'] = _get_local_toctree def setup(app): app.connect('builder-inited', init_local_toctree)
Python
5
gh-oss-contributor/graphql-engine-1
docs/_ext/local_toctree.py
[ "Apache-2.0", "MIT" ]
import * as React from 'react' export const fromJsx = <div />
JSX
3
bkucera2/cypress
npm/webpack-batteries-included-preprocessor/test/fixtures/file-types/jsx-file.jsx
[ "MIT" ]
.slide-up-enter opacity 0 transform translate(0, 50%) .slide-up-leave-to opacity 0 transform translate(0, -50%) .slide-down-enter, .slide-down-leave-to opacity 0 transform translate(0, -20px) @keyframes rotate 0% transform rotate(0deg) 100% transform rotate(360deg) @keyframes pulse 0% opacity 1 50% opacity .2 100% opacity 1
Stylus
4
ericnograles/vue-devtools
src/devtools/style/transitions.styl
[ "MIT" ]
[platform]=1 [LCDDriver]=0 [color]=0 [SizeX]=128 [SizeY]=64 [WindowIndex]=3 [ControlIndex]=5 [Compiler]=2 [FontGraphicFunction]=False [OnlySmallFont]=True [Control]=False [Cursor]=False [RichStyle]=False [RedrawInCallback]=True [NoLCDBuffer]=False [HaveDesktop]=True [Icon]=True [FreeRTOSSupport]=False [SerialCursorDebug]=False [HookFunction]=True [SourceFolder]=..\code [ProjectName]=example_KS010X [ProjectFolder]=.\ [DataFile]=example_KS010X.dat
Ecere Projects
2
hyller/GladiatorLibrary
EmbeddedGUI_0.6.2/0.6.2/designer/example_KS010X.epj
[ "Unlicense" ]
-- Options OptCaseSensitive=true -- End of options F=far.Flags color = far.AdvControl(F.ACTL_GETCOLOR, far.Colors.COL_EDITORTEXT) color.ForegroundColor, color.BackgroundColor = color.BackgroundColor, color.ForegroundColor colorguid=win.Uuid "507CFA2A-3BA3-4f2b-8A80-318F5A831235" words={} Macro area:"Editor" key:"F5" description:"Color Word Under Cursor" action:-> ei=editor.GetInfo! id=ei.EditorID if words[id] then words[id]=nil else pos=ei.CurPos line=editor.GetString!.StringText if pos<=line\len()+1 slab=pos>1 and line\sub(1,pos-1)\match('[%w_]+$') or "" tail=line\sub(pos)\match('^[%w_]+') or "" if slab~="" or tail~="" then words[id]=OptCaseSensitive and slab..tail or (slab..tail)\lower! Event group:"EditorEvent" action:(id,event,param)-> if event==F.EE_REDRAW if words[id] ei=editor.GetInfo id start,finish=ei.TopScreenLine,math.min ei.TopScreenLine+ei.WindowSizeY,ei.TotalLines for ii=start,finish line,pos=editor.GetString(id,ii).StringText,1 while true jj,kk,curr=line\cfind("([%w_]+)",pos) if not jj then break if not OptCaseSensitive then curr=curr\lower! if curr==words[id] then editor.AddColor id,ii,jj,kk,F.ECF_AUTODELETE,color,100,colorguid pos=kk+1 elseif event==F.EE_CLOSE then words[id]=nil
MoonScript
5
MKadaner/FarManager
extra/Addons/Macros/Editor.ColorWord.moon
[ "BSD-3-Clause" ]
<script>{%- include 'include-script-2.js' -%}</script>
Liquid
0
AleksandrHovhannisyan/eleventy
test/stubs-layout-cache/_includes/layout.liquid
[ "MIT" ]
package com.baeldung.jnosql.artemis; import de.flapdoodle.embed.mongo.MongodExecutable; import de.flapdoodle.embed.mongo.MongodProcess; import de.flapdoodle.embed.mongo.MongodStarter; import de.flapdoodle.embed.mongo.config.MongodConfigBuilder; import de.flapdoodle.embed.mongo.config.Net; import de.flapdoodle.embed.mongo.distribution.Version; import de.flapdoodle.embed.process.runtime.Network; import javax.enterprise.context.ApplicationScoped; import javax.enterprise.context.Destroyed; import javax.enterprise.context.Initialized; import javax.enterprise.event.Observes; import java.io.IOException; @ApplicationScoped public class EmbeddedMongoDBSetup { private static final String MONGODB_HOST = "localhost"; private static final int MONGODB_PORT = 27019; private static final MongodStarter starter = MongodStarter.getDefaultInstance(); private static MongodExecutable _mongodExe; private static MongodProcess _mongod; public void init(@Observes @Initialized(ApplicationScoped.class) Object init) { try { System.out.println("Starting Embedded MongoDB"); initdb(); System.out.println("Embedded MongoDB started"); } catch (IOException e) { System.out.println("Embedded MongoDB starting error !!"); e.printStackTrace(); } } private void initdb() throws IOException { _mongodExe = starter.prepare(new MongodConfigBuilder() .version(Version.Main.DEVELOPMENT) .net(new Net(MONGODB_HOST, MONGODB_PORT, Network.localhostIsIPv6())) .build()); _mongod = _mongodExe.start(); } public void destroy(@Observes @Destroyed(ApplicationScoped.class) Object init) { System.out.println("Stopping Embedded MongoDB"); _mongod.stop(); _mongodExe.stop(); System.out.println("Embedded MongoDB stopped !"); } }
Java
4
scharanreddy/tutorials
jnosql/jnosql-artemis/src/main/java/com/baeldung/jnosql/artemis/EmbeddedMongoDBSetup.java
[ "MIT" ]
<!-- * Copyright 2019 Google Inc. All Rights Reserved. * Licensed under the Apache License, Version 2.0 (the "License"); you may not use this file except in compliance with the License. You may obtain a copy of the License at http://www.apache.org/licenses/LICENSE-2.0 * Unless required by applicable law or agreed to in writing, software distributed under the License is distributed on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the License for the specific language governing permissions and limitations under the License. --> <!DOCTYPE html> <html lang="en"> <head> <meta charset="UTF-8"> <meta name="viewport" content="width=device-width, initial-scale=1.0"> <meta http-equiv="X-UA-Compatible" content="ie=edge"> <title>Source maps tester</title> </head> <body> <script> // Test that source maps work. //# sourceMappingURL=http://localhost:10200/source-map/script.js.map </script> <script> // Test that source maps work when on a different origin (CORS). //# sourceMappingURL=http://localhost:10503/source-map/script.js.map </script> map time map time! map time map time! 🎉 </body> </html>
HTML
3
martin-maunoury/lighthouse
lighthouse-cli/test/fixtures/source-map/source-map-tester.html
[ "Apache-2.0" ]
""" l = [1, 2, 3] assert((1 == l[0])) assert((2 == l[1])) assert(([1, 2] == l[:2])) assert(([1] == l[0:1])) assert(([1] == l[:1])) assert((3 == l[(-1)])) assert(([2, 3] == l[1:])) assert(([3, 2, 1] == l[::(-1)])) assert(([1, 2, 3] == l[:])) assert(([1, 3] == l[::2])) """ l = [1, 2, 3] assert((1 == l[0])) assert((2 == l[1])) assert(([1, 2] == l[:2])) assert(([1] == l[0:1])) assert(([1] == l[:1])) assert((3 == l[(-1)])) assert(([2, 3] == l[1:])) assert(([3, 2, 1] == l[::(-1)])) assert(([1, 2, 3] == l[:])) assert(([1, 3] == l[::2]))
Boo
3
popcatalin81/boo
tests/testcases/parser/wsa/slicing-1.boo
[ "BSD-3-Clause" ]
<?xml version="1.0"?> <rdf:RDF xmlns="http://purl.obolibrary.org/obo/geno.owl#" xml:base="http://purl.obolibrary.org/obo/geno.owl" xmlns:urigen-plugin="http://urigen-plugin/" xmlns:owl="http://www.w3.org/2002/07/owl#" xmlns:oboInOwl="http://www.geneontology.org/formats/oboInOwl#" xmlns:protege="http://protege.stanford.edu/plugins/owl/protege#" xmlns:xsd="http://www.w3.org/2001/XMLSchema#" xmlns:rdfs="http://www.w3.org/2000/01/rdf-schema#" xmlns:ont="http://www.co-ode.org/ontologies/ont.owl#" xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#" xmlns:terms="http://purl.org/dc/terms/" xmlns:genotype_model="http://www.lamhdi.org/obo/genotype_model/" xmlns:xml="http://www.w3.org/XML/1998/namespace" xmlns:obi="http://purl.obolibrary.org/obo/obi.owl#" xmlns:property="http://property/" xmlns:obo="http://purl.obolibrary.org/obo/" xmlns:dc="http://purl.org/dc/elements/1.1/"> <owl:Ontology rdf:about="http://purl.obolibrary.org/obo/geno.owl"> <owl:imports rdf:resource="http://purl.obolibrary.org/obo/iao/dev/ontology-metadata.owl"/> <owl:imports rdf:resource="https://raw.githubusercontent.com/monarch-initiative/GENO-ontology/develop/src/ontology/imports/oboInOwl.owl"/> <rdfs:comment>GENO is an OWL model of genotypes, their more fundamental sequence components, and links to related biological and experimental entities. At present many parts of the model are exploratory and set to undergo refactoring. In addition, many classes and properties have GENO URIs but are place holders for classes that will be imported from an external ontology (e.g. SO, ChEBI, OBI, etc). Furthermore, ongoing work will implement a model of genotype-to-phenotype associations. This will support description of asserted and inferred relationships between a genotypes, phenotypes, and environments, and the evidence/provenance behind these associations. Documentation is under development as well, and for now a slidedeck is available at http://www.slideshare.net/mhb120/brush-icbo-2013</rdfs:comment> </owl:Ontology> <!-- /////////////////////////////////////////////////////////////////////////////////////// // // Annotation properties // /////////////////////////////////////////////////////////////////////////////////////// --> <!-- http://purl.obolibrary.org/obo/GENO_0000834 --> <owl:AnnotationProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000834"> <obo:IAO_0000115>Used to annotation axioms that define identity criteria for instances of a class.</obo:IAO_0000115> <rdfs:label xml:lang="en">is_identity_criteria</rdfs:label> <rdfs:range rdf:resource="http://www.w3.org/2001/XMLSchema#boolean"/> </owl:AnnotationProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000867 --> <owl:AnnotationProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000867"> <rdfs:label xml:lang="en">proabalistic_quantifier</rdfs:label> </owl:AnnotationProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000905 --> <owl:AnnotationProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000905"> <rdfs:comment>Used to flag terms that are created for organizational purposes, e.g. to support groupings useful for defining GENO-based data models.</rdfs:comment> <rdfs:label xml:lang="en">mixin</rdfs:label> <rdfs:range rdf:resource="http://www.w3.org/2001/XMLSchema#boolean"/> </owl:AnnotationProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000909 --> <owl:AnnotationProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000909"> <rdfs:label xml:lang="en">gene symbol</rdfs:label> </owl:AnnotationProperty> <!-- http://purl.obolibrary.org/obo/IAO_alt_id --> <owl:AnnotationProperty rdf:about="http://purl.obolibrary.org/obo/IAO_alt_id"/> <!-- http://purl.obolibrary.org/obo/IAO_created_by --> <owl:AnnotationProperty rdf:about="http://purl.obolibrary.org/obo/IAO_created_by"/> <!-- http://purl.obolibrary.org/obo/IAO_creation_date --> <owl:AnnotationProperty rdf:about="http://purl.obolibrary.org/obo/IAO_creation_date"/> <!-- http://purl.obolibrary.org/obo/IAO_id --> <owl:AnnotationProperty rdf:about="http://purl.obolibrary.org/obo/IAO_id"/> <!-- http://purl.obolibrary.org/obo/IAO_subset --> <owl:AnnotationProperty rdf:about="http://purl.obolibrary.org/obo/IAO_subset"/> <!-- http://purl.obolibrary.org/obo/IAO_xref --> <owl:AnnotationProperty rdf:about="http://purl.obolibrary.org/obo/IAO_xref"/> <!-- /////////////////////////////////////////////////////////////////////////////////////// // // Object Properties // /////////////////////////////////////////////////////////////////////////////////////// --> <!-- http://biohackathon.org/resource/faldo#begin --> <owl:ObjectProperty rdf:about="http://biohackathon.org/resource/faldo#begin"> <rdfs:subPropertyOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000708"/> <rdfs:label xml:lang="en">begin</rdfs:label> </owl:ObjectProperty> <!-- http://biohackathon.org/resource/faldo#end --> <owl:ObjectProperty rdf:about="http://biohackathon.org/resource/faldo#end"> <rdfs:subPropertyOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000708"/> <rdfs:label xml:lang="en">end</rdfs:label> </owl:ObjectProperty> <!-- http://biohackathon.org/resource/faldo#location --> <owl:ObjectProperty rdf:about="http://biohackathon.org/resource/faldo#location"> <rdfs:subPropertyOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000708"/> <rdfs:label xml:lang="en">location</rdfs:label> </owl:ObjectProperty> <!-- http://biohackathon.org/resource/faldo#reference --> <owl:ObjectProperty rdf:about="http://biohackathon.org/resource/faldo#reference"> <rdfs:subPropertyOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000708"/> <obo:IAO_0000115>The reference is the resource that the position value is anchored to. For example, a contig or chromosome in a genome assembly.</obo:IAO_0000115> <rdfs:label>reference</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/BFO_0000050 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/BFO_0000050"> <rdfs:subPropertyOf rdf:resource="http://purl.obolibrary.org/obo/RO_0002131"/> <owl:inverseOf rdf:resource="http://purl.obolibrary.org/obo/BFO_0000051"/> <rdf:type rdf:resource="http://www.w3.org/2002/07/owl#TransitiveProperty"/> <rdfs:label>is part of</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/BFO_0000051 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/BFO_0000051"> <rdfs:subPropertyOf rdf:resource="http://purl.obolibrary.org/obo/RO_0002131"/> <rdf:type rdf:resource="http://www.w3.org/2002/07/owl#TransitiveProperty"/> <rdfs:label>has part</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000207 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000207"> <rdfs:subPropertyOf rdf:resource="http://www.w3.org/2002/07/owl#topObjectProperty"/> <rdfs:domain> <owl:Class> <owl:unionOf rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000701"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000702"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000713"/> </owl:unionOf> </owl:Class> </rdfs:domain> <obo:IAO_0000115>A relation used to link sequence entities (sequences, features, qualified features, and collections thereof) to their &apos;attributes&apos;.</obo:IAO_0000115> <obo:IAO_0000116>Used in lieu of RO/BFO has_quality as this relation is definend to apply to independent contiinuant bearers, wheras sequence entities are generically dependent continuants.</obo:IAO_0000116> <oboInOwl:hasDbXref>http://purl.obolibrary.org/obo/so_has_quality</oboInOwl:hasDbXref> <rdfs:label>has_sequence_attribute</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000211 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000211"> <owl:propertyChainAxiom rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/RO_0000053"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/RO_0000059"/> </owl:propertyChainAxiom> <obo:IAO_0000115>A relation between a material information bearer or material genetic sequence bearer and generically dependent continuant that carries information or sequence content that the bearer encodes</obo:IAO_0000115> <obo:IAO_0000118>materializes</obo:IAO_0000118> <rdfs:comment>Shortcut relation expanding to bearer_of some (concretizes some . . . ), linking a material information bearer or sequence macromolecule to some ICE or GDC sequence.</rdfs:comment> <rdfs:label>bears_concretization_of</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000220 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000220"> <owl:inverseOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000222"/> <rdfs:label>is_genotype_of</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000222 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000222"> <rdfs:domain> <owl:Class> <owl:unionOf rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000536"/> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/BFO_0000050"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/GENO_0000536"/> </owl:Restriction> </owl:unionOf> </owl:Class> </rdfs:domain> <obo:IAO_0000115>A relationship that holds between a biological entity and some level of genetic variation present in its genome.</obo:IAO_0000115> <obo:IAO_0000116>This relation aims to be equally as broad/inclusive as RO:0002200 ! has_phenotype.</obo:IAO_0000116> <rdfs:comment>The biological entity can be an organism, a group of organism that share common genotype, or organism-derived entities such as cell lines or biospecimens. The genotype can be any of the various flavors of genotypes/allelotypes defined in GENO (intrinsic genotype, extrinsic genotype, effective genotype), or any genetic variation component of a genotype including variant alleles or sequence alterations.</rdfs:comment> <rdfs:label>has_genotype</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000231 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000231"> <rdfs:subPropertyOf rdf:resource="http://purl.obolibrary.org/obo/BFO_0000051"/> <owl:inverseOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000248"/> <rdf:type rdf:resource="http://www.w3.org/2002/07/owl#TransitiveProperty"/> <obo:IAO_0000115>An antisymmetric, irreflexive (normally transitive) relation between a whole and a distinct part (source: SIO)</obo:IAO_0000115> <obo:IAO_0000116>No proper part relation anymore in RO/BFO?</obo:IAO_0000116> <oboInOwl:hasDbXref>http://semanticscience.org/resource/SIO_000053</oboInOwl:hasDbXref> <rdfs:label>has_proper_part</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000239 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000239"> <owl:inverseOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000251"/> <rdfs:range rdf:resource="http://purl.obolibrary.org/obo/GENO_0000702"/> <obo:IAO_0000115>A relationship between an entity that carries a sequence (e.g. a sequence feature or collection), and the sequence it bears.</obo:IAO_0000115> <obo:IAO_0000118>has_sequence_component</obo:IAO_0000118> <obo:IAO_0000118>has_state</obo:IAO_0000118> <oboInOwl:hasDbXref>VMC:state</oboInOwl:hasDbXref> <rdfs:comment>&apos;Sequence&apos; in the context of GENO is an abstract entity representing an ordered collection of monomeric units as carried in a biological macromolecule.</rdfs:comment> <rdfs:label>has_sequence</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000242 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000242"> <rdfs:subPropertyOf rdf:resource="http://www.geneontology.org/formats/oboInOwl#ObsoleteProperty"/> <owl:inverseOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000253"/> <obo:IAO_0000112>A geno:intrinnsic genotype &apos;specifies&apos; a SO:genome. A geno:karyotype &apos;specifies&apos; a geno:karyotype feature collection.</obo:IAO_0000112> <obo:IAO_0000115>A relationship between an information content entity representing a specification, and the entity it specifies.</obo:IAO_0000115> <rdfs:label>obsolete_specifies</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000243 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000243"> <rdfs:subPropertyOf rdf:resource="http://www.geneontology.org/formats/oboInOwl#ObsoleteProperty"/> <obo:IAO_0000116>Created subproperties &apos;approximates_sequence&apos; and &apos;resolves to sequence&apos;. Genotypes and other sequence variant artifacts are not always expected to completely specify a sequence, but rather provide some approximation based on available knowledge. The &apos;resolves_to_sequence&apos; property can be used when the sequence variant artifact is able to completely resolve a sequence, and the &apos;approximates_sequence&apos; property can be used when it does not. </obo:IAO_0000116> <rdfs:label>obsolete_approximates_sequence</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000244 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000244"> <rdfs:subPropertyOf rdf:resource="http://www.geneontology.org/formats/oboInOwl#ObsoleteProperty"/> <obo:IAO_0000116>Created subproperties &apos;approximates_sequence&apos; and &apos;resolves to sequence&apos;. Genotypes and other sequence variant artifacts are not always expected to completely specify a sequence, but rather provide some approximation based on available knowledge. The &apos;resolves_to_sequence&apos; property can be used when the sequence variant artifact is able to completely resolve a sequence, and the &apos;approximates_sequence&apos; property can be used when it does not. </obo:IAO_0000116> <rdfs:label>obsolete_resolves_to_sequence</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000248 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000248"> <rdfs:subPropertyOf rdf:resource="http://purl.obolibrary.org/obo/BFO_0000050"/> <obo:IAO_0000115>An asymmetric, irreflexive (normally transitive) relation between a part and its distinct whole.</obo:IAO_0000115> <oboInOwl:hasDbXref>http://semanticscience.org/resource/SIO_000093</oboInOwl:hasDbXref> <rdfs:label>is_proper_part_of</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000251 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000251"> <rdfs:domain rdf:resource="http://purl.obolibrary.org/obo/GENO_0000702"/> <rdfs:label>is_sequence_of</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000252 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000252"> <owl:inverseOf rdf:resource="http://purl.obolibrary.org/obo/IAO_0000136"/> <rdfs:label>is_subject_of</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000253 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000253"> <rdfs:subPropertyOf rdf:resource="http://www.geneontology.org/formats/oboInOwl#ObsoleteProperty"/> <rdfs:label>obsolete_is_specified_by</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000359 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000359"> <rdfs:subPropertyOf rdf:resource="http://www.geneontology.org/formats/oboInOwl#ObsoleteProperty"/> <rdfs:domain rdf:resource="http://purl.obolibrary.org/obo/UPHENO_0001001"/> <obo:IAO_0000115>shortcut relation used to link a phenotype directly to a genotype of an organism</obo:IAO_0000115> <obo:IAO_0000118>is_phenotype_of_organism_with_genotype</obo:IAO_0000118> <obo:IAO_0000118>is_phenotype_with_genotype</obo:IAO_0000118> <obo:IAO_0000118>phenotype_has_genotype</obo:IAO_0000118> <rdfs:comment>Might expand to something like: phenotype and (is_phenotype_of some (organism and (has_part some (&apos;material genome&apos; and (is_subject_of some (genome and (is_specified_by some genotype)))))))</rdfs:comment> <rdfs:label>obsolete_is_phenotype_of_genotype</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000368 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000368"> <rdfs:subPropertyOf rdf:resource="http://www.geneontology.org/formats/oboInOwl#ObsoleteProperty"/> <rdfs:range rdf:resource="http://purl.obolibrary.org/obo/GENO_0000141"/> <obo:IAO_0000115>A relation to link variant loci, phenotypes, or disease to the type of inheritance process they are involved in, based on how the genetic interactions between alleles at the causative locus determine the pattern of inheritance of a specific phenotype/disease from one generation to the next.</obo:IAO_0000115> <obo:IAO_0000116>Exploratory/temporary property, as we formalize our phenotypic inheritance model.</obo:IAO_0000116> <rdfs:label>obsolete_participates_in_inheritance_process</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000382 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000382"> <rdfs:subPropertyOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000654"/> <owl:inverseOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000383"/> <rdf:type rdf:resource="http://www.w3.org/2002/07/owl#TransitiveProperty"/> <obo:IAO_0000115>A relation between a sequence entity (i.e. a sequence, feature, or qualified feature) and a part of this entity that is variant in terms of its sequence, position, or expression.</obo:IAO_0000115> <rdfs:label xml:lang="en">has_variant_part</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000383 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000383"> <rdfs:subPropertyOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000655"/> <rdf:type rdf:resource="http://www.w3.org/2002/07/owl#TransitiveProperty"/> <rdfs:label xml:lang="en">is_variant_part_of</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000385 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000385"> <rdfs:subPropertyOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000654"/> <owl:inverseOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000387"/> <rdf:type rdf:resource="http://www.w3.org/2002/07/owl#TransitiveProperty"/> <obo:IAO_0000115>A relation between a sequence entity (i.e. a sequence, feature, or qualified feature) and a part of this entity that is not variant.</obo:IAO_0000115> <obo:IAO_0000118>has_reference_sequence_part</obo:IAO_0000118> <rdfs:label>has_reference_part</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000387 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000387"> <rdfs:subPropertyOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000655"/> <rdfs:label>is_reference_part_of</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000408 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000408"> <rdfs:subPropertyOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000418"/> <owl:inverseOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000413"/> <rdfs:domain rdf:resource="http://purl.obolibrary.org/obo/GENO_0000481"/> <obo:IAO_0000112>The allele instance &lt;fgf8a^ti282a&gt; is_allele_of the gene class &apos;danio rerio fgf8a&apos;. Note that the allele &lt;fgf8a^ti282a&gt; may not be an instance of the danio rerio fgf8a gene class, given that we adopt the SO definition of genes as &apos;producing a functional product&apos;. If the &lt;fgf8a^ti282a&gt; allele is nonfunctional or null, it is an allele_of the danio rerio fgf8a gene class, but not an instance (rdf:type) of this class. It is, however, an instance of the &apos;danio rerio fgf8a gene allele&apos; class, as being a &apos;gene allele&apos; as defined in GENO requires only occupying the genomic position where for a gene, but not necessarily producing a functional product.</obo:IAO_0000112> <obo:IAO_0000115>A relation linking an instance of a variable feature (aka an allele) to a class of genomic feature it is an instance of (typically a gene class).</obo:IAO_0000115> <obo:IAO_0000116>Domain = allele Range = punned gene class In owl models where alleles are instances of gene classes, this relation links an owl:Individual to an owl:Class, and thus &apos;puns&apos; the gene class IRI.</obo:IAO_0000116> <obo:IAO_0000118>is_sequence_variant_of</obo:IAO_0000118> <rdfs:label>is_allele_of</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000410 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000410"> <rdfs:subPropertyOf rdf:resource="http://www.geneontology.org/formats/oboInOwl#ObsoleteProperty"/> <owl:inverseOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000411"/> <obo:IAO_0000115>A relation used to link a variant locus instance to the gene class it is a variant of (in terms of its sequence or expression level).</obo:IAO_0000115> <obo:IAO_0000118>is_variant_instance_of</obo:IAO_0000118> <obo:IAO_0000231>formerly grouped is_allele_of and is_expression_variant_of proerpties under feature to class proeprty (now renmaed has_affected_locus)</obo:IAO_0000231> <rdfs:comment>Domain = genomic feature instance Range = punned gene class IRI</rdfs:comment> <rdfs:label>obsolete_is_genetic_variant_of</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000411 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000411"> <rdfs:subPropertyOf rdf:resource="http://www.geneontology.org/formats/oboInOwl#ObsoleteProperty"/> <obo:IAO_0000115>A relation linking a gene class to a sequence-varaint or expression-variant of the gene.</obo:IAO_0000115> <obo:IAO_0000118>has_variant_instance</obo:IAO_0000118> <obo:IAO_0000231>formerly grouped has_allele and has_expression_variant proerpties under cllass to feature property (now renamed locus_affected_by)</obo:IAO_0000231> <rdfs:comment>Domain = punned gene class Range = genomic feature</rdfs:comment> <rdfs:label>obsolete_has_genetic_variant</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000413 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000413"> <rdfs:subPropertyOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000445"/> <obo:IAO_0000115>A relation linking a gene class to one of its sequence-variant alleles.</obo:IAO_0000115> <obo:IAO_0000116>Domain = punned gene class Range = allele</obo:IAO_0000116> <obo:IAO_0000118>has_sequence_variant</obo:IAO_0000118> <rdfs:label>has_allele</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000414 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000414"> <rdfs:subPropertyOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000418"/> <owl:inverseOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000447"/> <obo:IAO_0000115>A relation between a gene targeting reagent (e.g. a morpholino or RNAi) and the class of gene it targets.</obo:IAO_0000115> <rdfs:comment>This is intended to be used as an instance-class relation, used for linking an instance of a gene targeting reagent to the class of gene whose instances it targets.</rdfs:comment> <rdfs:label>targets_gene</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000418 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000418"> <owl:inverseOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000445"/> <owl:propertyChainAxiom rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000382"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000418"/> </owl:propertyChainAxiom> <owl:propertyChainAxiom rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000383"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000418"/> </owl:propertyChainAxiom> <obo:IAO_0000115>A relation that holds between an instance of a genotype or variant sequence feature or collection, and a genomic feature class (typically a gene) that is affected in its sequence or expression.</obo:IAO_0000115> <rdfs:comment>This is an organizational grouping class to collect all relations used to link instances of sequence features or qualified sequence features to genomic feature classes. For example, is_allele_of links a gene allele instance to its gene class (genes are represented as classes in our OWL model). Such links support phenotype propagation from alleles to genes for Monarch Initiative use cases. Use of these properties effectively puns gene class IRIs into owl:individuals in a given rdf datset.</rdfs:comment> <rdfs:label>has_affected_feature</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000443 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000443"> <rdfs:subPropertyOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000418"/> <owl:inverseOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000449"/> <obo:IAO_0000115>A relation between an expression-variant gene (ie integrated transgenes or knockdown reagent targeted genes), and the class of gene it represents.</obo:IAO_0000115> <obo:IAO_0000116>Domain = expression variant feature. Range = punned gene class</obo:IAO_0000116> <rdfs:comment>This relation links an expression-variant gene instance (targeted or transgenic) to the class of gene that it preresents. For transient transgenes, this is the gene, the coding sequence need only to contain as part an expressed region from a given gene to stand in an is_expression_variant_of relation to the gene class.</rdfs:comment> <rdfs:label>is_expression_variant_of</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000445 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000445"> <obo:IAO_0000115>A relation between a genomic feature class (typically a gene class) and an instance of a sequence feature or qualified sequence feature that represents or affects some change in the sequence or expression of the genomic feature.</obo:IAO_0000115> <obo:IAO_0000118>class_to_feature_relation</obo:IAO_0000118> <rdfs:comment>This is an organizational grouping class to collect all relations used to link genomic feature classes (typically genes) to instance of a genomic feature sequence feature or qualified sequence feature. For example, linking a gene class IRI to an instance of an allele of that gene class. Such links support phenotype propagation from features/variants to genes (e.g. for Monarch Initiative use cases)</rdfs:comment> <rdfs:label>is_feature_affected_by</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000447 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000447"> <rdfs:subPropertyOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000445"/> <obo:IAO_0000115>A relation between a gene class and a gene targeting reagent that targets it.</obo:IAO_0000115> <obo:IAO_0000118>is_target_of</obo:IAO_0000118> <rdfs:comment>Domain = punned gene class Range = gene knockdown reagent</rdfs:comment> <rdfs:label>is_gene_target_of</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000449 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000449"> <rdfs:subPropertyOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000445"/> <obo:IAO_0000115>A relation linking a gene class to one of an expression-variant of that gene..</obo:IAO_0000115> <obo:IAO_0000116>Domain = punned gene class Range = expression variant feature</obo:IAO_0000116> <obo:IAO_0000118>has_expression_variant_instance</obo:IAO_0000118> <rdfs:label>has_expression_variant</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000486 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000486"> <rdfs:subPropertyOf rdf:resource="http://www.geneontology.org/formats/oboInOwl#ObsoleteProperty"/> <obo:IAO_0000115>A relation between two sequence features at a given genomic locus that vary in their sequence or level of expression.</obo:IAO_0000115> <obo:IAO_0000231>Decided there was no need for a contrasting is_expression_variant_with property, so removed it and this parent grouping property.</obo:IAO_0000231> <rdfs:comment>This proeprty is most commonly used to relate two different alleles of a given gene. It is not a relation between an allele and the gene it is a variant of.</rdfs:comment> <rdfs:label xml:lang="en">obsolete_is_variant_with</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000488 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000488"> <rdfs:subPropertyOf rdf:resource="http://www.geneontology.org/formats/oboInOwl#ObsoleteProperty"/> <obo:IAO_0000115>A relation between two instances of a given gene that vary in their level of expression as a result of external factors influencing expression (e.g. gnee-knockdown reagents, epigenetic modification, alteration of endogenous gene-regulation pathways).</obo:IAO_0000115> <rdfs:label xml:lang="en">obsolete_is_expression_variant_with</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000580 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000580"> <obo:IAO_0000115>A relation used to describe a context or conditions that define and/or identify an entity.</obo:IAO_0000115> <obo:IAO_0000116>Used in Monarch Data to link associations to qualifying contexts (e.g. environments or developmental stages) where the association applies. For example, a qualifying environment represents a context where genotype-phenotype associations apply - where the environment is an identity criteria for the association. Used in GENO to describe physical context of materialized sequence features that represent identifying criteria for instances of qualified sequence features.</obo:IAO_0000116> <obo:IAO_0000118>has_qualifying_context</obo:IAO_0000118> <rdfs:label>has_qualifier</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000608 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000608"> <rdfs:subPropertyOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000207"/> <rdfs:domain rdf:resource="http://purl.obolibrary.org/obo/GENO_0000516"/> <rdfs:range rdf:resource="http://purl.obolibrary.org/obo/GENO_0000133"/> <obo:IAO_0000115>a relation to link a single locus complement to its zygosity.</obo:IAO_0000115> <rdfs:label xml:lang="en">has_zygosity</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000610 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000610"> <rdfs:subPropertyOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000408"/> <rdfs:domain rdf:resource="http://purl.obolibrary.org/obo/GENO_0000036"/> <obo:IAO_0000115>A relationship between a reference locus/allele and the gene class it is an allele of.</obo:IAO_0000115> <rdfs:label xml:lang="en">is_reference_allele_of</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000626 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000626"> <rdfs:subPropertyOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000207"/> <obo:IAO_0000116>Consider obsoleting - it is likely sufficeint to use the parent has_sequence_attribute property - a separate proeprty to link to the staining intensity attribute is not really needed.</obo:IAO_0000116> <obo:IAO_0000118 xml:lang="en">has_color_value</obo:IAO_0000118> <rdfs:comment>Used to link a gross chromosomal sequence feature (chromosome part) to a color value quality that inheres in the sequence feature in virtue of the staining pattern of the chromosomal DNA in which the sequence is materialized.</rdfs:comment> <rdfs:label>has_staining_intensity</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000634 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000634"> <obo:IAO_0000112>Used to link a gene targeting reagent such as a morpholino, to an instance of a reagent targeted gene variant.</obo:IAO_0000112> <obo:IAO_0000115>relation between an molecular agent and its molecular target</obo:IAO_0000115> <rdfs:label xml:lang="en">is_targeted_by</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000639 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000639"> <rdfs:subPropertyOf rdf:resource="http://www.w3.org/2002/07/owl#topObjectProperty"/> <owl:propertyChainAxiom rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/BFO_0000051"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000639"/> </owl:propertyChainAxiom> <obo:IAO_0000112>1. Used to specify derivation of transgene components from a gene class, or a engineered construct instance. 2. Used to specify the genetic background/strain of origin of an allele (i.e. that an allele was originally isolated from a specific background strain, and propagated into new genetic backgrounds. 3. Used to indicate derivation of a variant mouse genotype from an ES cell line used in generating the modified mice (IMPC)</obo:IAO_0000112> <obo:IAO_0000115>Relationship between a sequence feature and a distinct, non-overlapping feature from which it derives part or all of its sequence.</obo:IAO_0000115> <rdfs:label xml:lang="en">sequence_derives_from</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000641 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000641"> <rdfs:subPropertyOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000408"/> <rdfs:domain rdf:resource="http://purl.obolibrary.org/obo/GENO_0000002"/> <obo:IAO_0000115>A relationship between a variant allele and the gene class it is an allele of.</obo:IAO_0000115> <rdfs:label xml:lang="en">is_variant_allele_of</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000650 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000650"> <rdfs:subPropertyOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000654"/> <owl:inverseOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000661"/> <obo:IAO_0000116>Relationship between a sex-qualified genotype and intrinsic genotype, created specifically to support propagation of phenotypes asserted on the former to the later for Monarch Initiative use cases.</obo:IAO_0000116> <rdfs:label xml:lang="en">has_sex_agnostic_part</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000651 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000651"> <rdfs:subPropertyOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000641"/> <rdfs:domain rdf:resource="http://purl.obolibrary.org/obo/GENO_0000491"/> <rdfs:comment>A relation between a mutant allele (ie rare variant present in less than 1% of a population, or an experimentally-altered variant such as a knocked-out gene in a model organism), and the gene it is a variant of.</rdfs:comment> <rdfs:label xml:lang="en">is_mutant_allele_of</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000652 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000652"> <rdfs:subPropertyOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000641"/> <rdfs:domain rdf:resource="http://purl.obolibrary.org/obo/GENO_0000497"/> <obo:IAO_0000115>A relationship between a polymorphic allele and the gene class it is an allele of.</obo:IAO_0000115> <rdfs:label xml:lang="en">is_polymorphic_allele_of</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000653 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000653"> <rdfs:subPropertyOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000408"/> <rdfs:domain rdf:resource="http://purl.obolibrary.org/obo/GENO_0000501"/> <obo:IAO_0000115>A relationship between a wild-type allele and the gene class it is an allele of.</obo:IAO_0000115> <rdfs:label xml:lang="en">is_wild_type_allele_of</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000654 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000654"> <rdfs:subPropertyOf rdf:resource="http://purl.obolibrary.org/obo/BFO_0000051"/> <owl:inverseOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000655"/> <obo:IAO_0000115>An organizational class to hold relations of parthood between sequences/features.</obo:IAO_0000115> <rdfs:label xml:lang="en">has_sequence_part</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000655 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000655"> <rdfs:subPropertyOf rdf:resource="http://purl.obolibrary.org/obo/BFO_0000050"/> <rdfs:label xml:lang="en">is_sequence_part_of</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000661 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000661"> <rdfs:subPropertyOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000655"/> <obo:IAO_0000115>Relationship between an intrinsic genotype and a sex-qualified genotype, created specifically to support propagation of phenotypes asserted on the latter to the former for Monarch Initiative use cases.</obo:IAO_0000115> <rdfs:label xml:lang="en">is_sex_agnostic_part_of</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000683 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000683"> <rdf:type rdf:resource="http://www.w3.org/2002/07/owl#SymmetricProperty"/> <obo:IAO_0000115>A relation between two sequence features at a particular genomic locus that vary in their sequence (in whole or in part).</obo:IAO_0000115> <rdfs:comment>This property is most commonly used to relate two different alleles of a given gene (e.g. a wt and mutant instance of the BRCA2 gene). It is not a relation between an allele and the class-level gene it is a variant of (for this use is_allele_of)</rdfs:comment> <rdfs:label xml:lang="en">varies_with</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000708 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000708"> <rdfs:comment>organizational property to hold imports from faldo.</rdfs:comment> <rdfs:label xml:lang="en">faldo properties</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000726 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000726"> <rdfs:domain> <owl:Class> <owl:unionOf rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000714"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000715"/> </owl:unionOf> </owl:Class> </rdfs:domain> <rdfs:range rdf:resource="http://purl.obolibrary.org/obo/SO_0000110"/> <obo:IAO_0000115>A relation linking a qualified sequence feature to its component sequence feature.</obo:IAO_0000115> <obo:IAO_0000118>has_sequence_feature_component</obo:IAO_0000118> <rdfs:comment>In GENO we define three levels of sequence artifacts: (1) biological sequences, (2) sequence features, and (3) qualified sequence features. The identify criteria for a &apos;biological sequence&apos; include only its inherent sequence (the ordered string of units that comprise it). The identity criteria for a &apos;sequence feature&apos; include its sequence and position (where it resides - i.e. its location based on how it maps to a reference or standard) The identity criteria for a &apos;qualified sequence feature&apos; include its component sequence feature (defined by its sequence and position), and the material context of its bearer in a cell or organism. This context can include direct epigenetic modification, or being targeted by gene knockdown reagents such as morpholinos or RNAi, or being transiently overexpressed from a transgenic construct in a cell or organism.</rdfs:comment> <rdfs:label xml:lang="en">has_sequence_feature</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000740 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000740"> <rdfs:subPropertyOf rdf:resource="http://purl.obolibrary.org/obo/RO_0002200"/> <owl:propertyChainAxiom rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000382"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000743"/> </owl:propertyChainAxiom> <owl:propertyChainAxiom rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000383"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000661"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000743"/> </owl:propertyChainAxiom> <owl:propertyChainAxiom rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000383"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000743"/> </owl:propertyChainAxiom> <owl:propertyChainAxiom rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000413"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000383"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000743"/> </owl:propertyChainAxiom> <owl:propertyChainAxiom rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000413"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000743"/> </owl:propertyChainAxiom> <owl:propertyChainAxiom rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000449"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000383"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000743"/> </owl:propertyChainAxiom> <owl:propertyChainAxiom rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000449"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000743"/> </owl:propertyChainAxiom> <owl:propertyChainAxiom rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000661"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000743"/> </owl:propertyChainAxiom> <rdfs:label xml:lang="en">has_inferred_phenotype</rdfs:label> </owl:ObjectProperty> <owl:Axiom> <owl:annotatedSource rdf:resource="http://purl.obolibrary.org/obo/GENO_0000740"/> <owl:annotatedProperty rdf:resource="http://www.w3.org/2002/07/owl#propertyChainAxiom"/> <owl:annotatedTarget rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000382"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000743"/> </owl:annotatedTarget> <rdfs:comment>Property chain to propagate inferred phenotype associations &apos;up&apos; a genotype partonomy in the direction of sequence alteration -&gt; VL -&gt; VSLC -&gt; GVC -&gt; genotype.</rdfs:comment> </owl:Axiom> <owl:Axiom> <owl:annotatedSource rdf:resource="http://purl.obolibrary.org/obo/GENO_0000740"/> <owl:annotatedProperty rdf:resource="http://www.w3.org/2002/07/owl#propertyChainAxiom"/> <owl:annotatedTarget rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000383"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000661"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000743"/> </owl:annotatedTarget> <rdfs:comment>Property chain to propagate inferred phenotype associations &apos;down&apos; a genotype partonomy from a sex-qualified intrinsic genotype to the components of a sex-agnostic intrinsic genotype.</rdfs:comment> </owl:Axiom> <owl:Axiom> <owl:annotatedSource rdf:resource="http://purl.obolibrary.org/obo/GENO_0000740"/> <owl:annotatedProperty rdf:resource="http://www.w3.org/2002/07/owl#propertyChainAxiom"/> <owl:annotatedTarget rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000383"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000743"/> </owl:annotatedTarget> <rdfs:comment>Property chain to propagate inferred phenotype associations &apos;down&apos; a genotype partonomy in the direction of genotype -&gt; GVC -&gt; VSLC -&gt; VL -&gt; sequence alteration.</rdfs:comment> </owl:Axiom> <owl:Axiom> <owl:annotatedSource rdf:resource="http://purl.obolibrary.org/obo/GENO_0000740"/> <owl:annotatedProperty rdf:resource="http://www.w3.org/2002/07/owl#propertyChainAxiom"/> <owl:annotatedTarget rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000413"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000383"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000743"/> </owl:annotatedTarget> <rdfs:comment>Property chain to propagate inferred phenotype associations from an intrinsic genotype component (e.g. a (sequence-)variant locus instance) to a gene class.</rdfs:comment> </owl:Axiom> <owl:Axiom> <owl:annotatedSource rdf:resource="http://purl.obolibrary.org/obo/GENO_0000740"/> <owl:annotatedProperty rdf:resource="http://www.w3.org/2002/07/owl#propertyChainAxiom"/> <owl:annotatedTarget rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000413"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000743"/> </owl:annotatedTarget> <rdfs:comment>Property chain to propagate inferred phenotype associations from a (sequence-)variant locus instance to a gene class (to support cases where the phenotype association is made at the level of the variant gene locus).</rdfs:comment> </owl:Axiom> <owl:Axiom> <owl:annotatedSource rdf:resource="http://purl.obolibrary.org/obo/GENO_0000740"/> <owl:annotatedProperty rdf:resource="http://www.w3.org/2002/07/owl#propertyChainAxiom"/> <owl:annotatedTarget rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000449"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000383"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000743"/> </owl:annotatedTarget> <rdfs:comment>Property chain to propagate inferred phenotype associations from an extrinnsic genotype component (e.g. a expression-variant gene instance) to a gene class.</rdfs:comment> </owl:Axiom> <owl:Axiom> <owl:annotatedSource rdf:resource="http://purl.obolibrary.org/obo/GENO_0000740"/> <owl:annotatedProperty rdf:resource="http://www.w3.org/2002/07/owl#propertyChainAxiom"/> <owl:annotatedTarget rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000449"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000743"/> </owl:annotatedTarget> <rdfs:comment>Property chain to propagate inferred phenotype associations from an expression-variant gene instance to a gene class (to support cases where the phenotype association is made at the level of the expression-variant gene).</rdfs:comment> </owl:Axiom> <owl:Axiom> <owl:annotatedSource rdf:resource="http://purl.obolibrary.org/obo/GENO_0000740"/> <owl:annotatedProperty rdf:resource="http://www.w3.org/2002/07/owl#propertyChainAxiom"/> <owl:annotatedTarget rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000661"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000743"/> </owl:annotatedTarget> <rdfs:comment>Property chain to propagate inferred phenotype associations &apos;down&apos; a genotype partonomy just from a sex-qualified intrinsic genotype to the immediate sex-agnostic intrinsic genotype. (An additional property chain is needed to then propagate to the intrinsic genotype components)</rdfs:comment> </owl:Axiom> <!-- http://purl.obolibrary.org/obo/GENO_0000741 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000741"> <rdfs:subPropertyOf rdf:resource="http://www.geneontology.org/formats/oboInOwl#ObsoleteProperty"/> <rdfs:comment>Proposal for a property linking variants to smaller components that are regulatory, and therefore should not inherit phenotypes.</rdfs:comment> <rdfs:label xml:lang="en">obsolete_has_regulatory_part</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000742 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000742"> <rdfs:subPropertyOf rdf:resource="http://www.geneontology.org/formats/oboInOwl#ObsoleteProperty"/> <owl:propertyChainAxiom rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000383"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000408"/> </owl:propertyChainAxiom> <obo:IAO_0000114 rdf:resource="http://purl.obolibrary.org/obo/GENO_0000484"/> <obo:IAO_0000115>A relation linking a sequence_alteration to the gene it alters.</obo:IAO_0000115> <obo:IAO_0000118>is_within_allele_of</obo:IAO_0000118> <rdfs:label xml:lang="en">obsolete_is_alteration_within</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000743 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000743"> <rdfs:subPropertyOf rdf:resource="http://purl.obolibrary.org/obo/RO_0002200"/> <rdfs:label xml:lang="en">has_asserted_phenotype</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000761 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000761"> <rdfs:subPropertyOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000655"/> <obo:IAO_0000116>Proposal for a property linking regulatory elements to larger features of which they are a part.</obo:IAO_0000116> <rdfs:label xml:lang="en">is_regulatory_part_of</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000767 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000767"> <rdfs:subPropertyOf rdf:resource="http://www.geneontology.org/formats/oboInOwl#ObsoleteProperty"/> <obo:IAO_0000115>A relation linking a sequence feature to its component Position that represents an identifying criteria for sequence feature instances.</obo:IAO_0000115> <obo:IAO_0000116>For representing positional data, we advocate use of the FALDO model, which links to positional information through an instance of a Region class that represents the mapping of the feature onto some reference sequence. The positional_component property in GENO is meant primarily to formalize the identity criteria or sequence features and qualified sequence features, to illustrate the distinction between them.</obo:IAO_0000116> <rdfs:label xml:lang="en">obsolete_has_position_component</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000783 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000783"> <rdfs:subPropertyOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000654"/> <obo:IAO_0000115>A relation between a nucleic acid or amino acid sequence or sequence feature, and one of its monomeric units (nucleotide or amino acid residues)</obo:IAO_0000115> <rdfs:label xml:lang="en">has_sequence_unit</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000784 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000784"> <rdfs:subPropertyOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000683"/> <rdf:type rdf:resource="http://www.w3.org/2002/07/owl#SymmetricProperty"/> <obo:IAO_0000115>A relation between two seqeunces or features that are considered variant with each other along their entire extents.</obo:IAO_0000115> <rdfs:label xml:lang="en">completely_varies_with</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000790 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000790"> <rdfs:label xml:lang="en">related_condition</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000791 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000791"> <rdfs:subPropertyOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000790"/> <owl:propertyChainAxiom rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000382"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000661"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/RO_0003303"/> </owl:propertyChainAxiom> <owl:propertyChainAxiom rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000382"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/RO_0003303"/> </owl:propertyChainAxiom> <owl:propertyChainAxiom rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000383"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000661"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000383"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/RO_0003303"/> </owl:propertyChainAxiom> <owl:propertyChainAxiom rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000383"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000661"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/RO_0003303"/> </owl:propertyChainAxiom> <owl:propertyChainAxiom rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000383"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/RO_0003303"/> </owl:propertyChainAxiom> <owl:propertyChainAxiom rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000413"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000383"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000661"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000383"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/RO_0003303"/> </owl:propertyChainAxiom> <owl:propertyChainAxiom rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000413"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000383"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000661"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/RO_0003303"/> </owl:propertyChainAxiom> <owl:propertyChainAxiom rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000445"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000382"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/RO_0003303"/> </owl:propertyChainAxiom> <owl:propertyChainAxiom rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000445"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000383"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/RO_0003303"/> </owl:propertyChainAxiom> <owl:propertyChainAxiom rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000445"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/RO_0003303"/> </owl:propertyChainAxiom> <owl:propertyChainAxiom rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000661"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000383"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/RO_0003303"/> </owl:propertyChainAxiom> <owl:propertyChainAxiom rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000661"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/RO_0003303"/> </owl:propertyChainAxiom> <obo:IAO_0000116>Note that we currently do not have a property chain to propagate phenotypes to genes across sequence_derives_from relation (e.g. in cases where a Tg insertion derives expressed sequence from some gene)</obo:IAO_0000116> <obo:IAO_0000116>The property chains below are defined as explicitly as possible, but many could be shortened if we used the inferred_to_cause_condition property to construct the property chains. Where this is the case, it is noted in the annotations on the property chains. Below are the different kinds/paths of propagation we desire: 1. Propagation &apos;down&apos; a genotype (from larger components to smaller ones) 2. Propagation &apos;up&apos; a genotype (from smaller components to larger ones) 3. From sex-qualified genotypes down to the sex-agnostic genotype and its components (but not &apos;up&apos; to a sex-qualified genotype). 4. From an effective genotype to its intrinsic and extrinsic components. 5. From genotype components to genes (note here that a separate chain is needed to propagate conditions asserted on a sequence alteration to the gene, because of the fact that the link to the gene is from the variant locus/allele). 6. (Exploratory). There are cases where we may also want inter-genotype propagation (i.e. propagation that extends beyond moving up or down a single genotype). For example, if a phenotype is asserted on a sex-qualified intrinsic genotype, we want it to infer down through its component sex-agnostic intrinsic genotype and then up to any effective genotypes of which this sex-agnostic intrinsic genotype is a part. Given the data in hand, however, the conditions for this will likely never occur, so probably ok not to implement a chain to support this. Note that we do not want to propagate phenotypes up from sex-agnostic genotyeps to sex-qualified ones (e.g.from shha&lt;tbx392&gt;/shha&lt;tbx392&gt; [AB] to shha&lt;tbx392&gt;/shha&lt;tbx392&gt; [AB](male)) - because it may not be the case that a phenotype assessed without consideratioon to sex will apply on a sex-specific background. So we would not create a property chain to propagate inferred condition associations from sex-agnaostic intrinsic genotypes and their parts to sex-qualified intrinsic genotypes and effective genotypes that contain them (such as: has_variant_part o has_sex_agnostic_part o has_variant_part o &apos;causes condition&apos;)</obo:IAO_0000116> <rdfs:label xml:lang="en">inferred_to_cause_condition</rdfs:label> </owl:ObjectProperty> <owl:Axiom> <owl:annotatedSource rdf:resource="http://purl.obolibrary.org/obo/GENO_0000791"/> <owl:annotatedProperty rdf:resource="http://www.w3.org/2002/07/owl#propertyChainAxiom"/> <owl:annotatedTarget rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000382"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000661"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/RO_0003303"/> </owl:annotatedTarget> <rdfs:comment>This is a case of inter-gneotype phenotype propagation, requiring propagation down oen genotype and then up another. Given the data in hand, however, the conditions for this will likely never occur, so probably ok not to have this chain. This property chain propagates a phenotype asserted on a sex-qualified intrinsic genotype, down to its sex-agnostic genotype part, and then up to a parent effective genotype that has it as a variant part. I think this is OK in all cases, so we can implement this as the one case where we can have inter-genotype pheno propagation. But as noted, there will likely be no data that actually meets criteria to use this chain, so we can probably leave it out.</rdfs:comment> </owl:Axiom> <owl:Axiom> <owl:annotatedSource rdf:resource="http://purl.obolibrary.org/obo/GENO_0000791"/> <owl:annotatedProperty rdf:resource="http://www.w3.org/2002/07/owl#propertyChainAxiom"/> <owl:annotatedTarget rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000382"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/RO_0003303"/> </owl:annotatedTarget> <rdfs:comment>Property chain to propagate inferred condition associations &apos;up&apos; a genotype partonomy in the direction of sequence alteration -&gt; VL -&gt; VSLC -&gt; GVC -&gt; genotype.</rdfs:comment> </owl:Axiom> <owl:Axiom> <owl:annotatedSource rdf:resource="http://purl.obolibrary.org/obo/GENO_0000791"/> <owl:annotatedProperty rdf:resource="http://www.w3.org/2002/07/owl#propertyChainAxiom"/> <owl:annotatedTarget rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000383"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000661"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000383"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/RO_0003303"/> </owl:annotatedTarget> <rdfs:comment>Property chain to propagate inferred condition associations from an effective genotype through a sex-qualified intrinsic genotype, through a sex-agnostic intrinsic genotype, to the coompnent variant parts of this sex-agnostic genotype.</rdfs:comment> </owl:Axiom> <owl:Axiom> <owl:annotatedSource rdf:resource="http://purl.obolibrary.org/obo/GENO_0000791"/> <owl:annotatedProperty rdf:resource="http://www.w3.org/2002/07/owl#propertyChainAxiom"/> <owl:annotatedTarget rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000383"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000661"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/RO_0003303"/> </owl:annotatedTarget> <rdfs:comment>Property chain to propagate inferred condition associations &apos;down&apos; a genotype partonomy from a sex-qualified intrinsic genotype to the components of a sex-agnostic intrinsic genotype. This chain in particuular is needed to get the conditions to move past the sex-agnostic genotype and down to its parts. The following shorter chain would also suffice here: is_variant_part_of o inferred_to_cause_condition</rdfs:comment> </owl:Axiom> <owl:Axiom> <owl:annotatedSource rdf:resource="http://purl.obolibrary.org/obo/GENO_0000791"/> <owl:annotatedProperty rdf:resource="http://www.w3.org/2002/07/owl#propertyChainAxiom"/> <owl:annotatedTarget rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000383"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/RO_0003303"/> </owl:annotatedTarget> <rdfs:comment>Property chain to propagate inferred condition associations &apos;down&apos; a genotype partonomy in the direction of genotype -&gt; GVC -&gt; VSLC -&gt; VL -&gt; sequence alteration.</rdfs:comment> </owl:Axiom> <owl:Axiom> <owl:annotatedSource rdf:resource="http://purl.obolibrary.org/obo/GENO_0000791"/> <owl:annotatedProperty rdf:resource="http://www.w3.org/2002/07/owl#propertyChainAxiom"/> <owl:annotatedTarget rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000413"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000383"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000661"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000383"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/RO_0003303"/> </owl:annotatedTarget> <rdfs:comment>Property chain to propagate inferred condition associations from an effective genotype through a sex-qualified intrinsic genotype, through a sex-agnostic intrinsic genotype, through the coompnent variant parts of this sex-agnostic genotype, and to the affected gene.</rdfs:comment> </owl:Axiom> <owl:Axiom> <owl:annotatedSource rdf:resource="http://purl.obolibrary.org/obo/GENO_0000791"/> <owl:annotatedProperty rdf:resource="http://www.w3.org/2002/07/owl#propertyChainAxiom"/> <owl:annotatedTarget rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000413"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000383"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000661"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/RO_0003303"/> </owl:annotatedTarget> <rdfs:comment>Property chain to propagate inferred condition associations &apos;down&apos; a genotype partonomy from a sex-qualified intrinsic genotype to the components of a sex-agnostic intrinsic genotype. This chain in particuular is needed to get the conditions to propagate to genes. The shorter chain below would also suffice for this propagation: has_allele o inferred_to_cause_condition</rdfs:comment> </owl:Axiom> <owl:Axiom> <owl:annotatedSource rdf:resource="http://purl.obolibrary.org/obo/GENO_0000791"/> <owl:annotatedProperty rdf:resource="http://www.w3.org/2002/07/owl#propertyChainAxiom"/> <owl:annotatedTarget rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000445"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000382"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/RO_0003303"/> </owl:annotatedTarget> <rdfs:comment>Property chain to propagate inferred condition associations from an sequence alteration through the variant locus to a gene class. (separate chains are needed to propagate from the variant locus to the gene class, and another to propagate from a genotype, GVC, or VSLC to the gene class). NOTE that i dont need this property chain if I have a property chain to infer a has_affected_locus link from a sequence alteration to a gene when the link is asserted from the variant locus to the gene: is_variant_part_of o has_affected_locus --&gt; has_affected_locus</rdfs:comment> </owl:Axiom> <owl:Axiom> <owl:annotatedSource rdf:resource="http://purl.obolibrary.org/obo/GENO_0000791"/> <owl:annotatedProperty rdf:resource="http://www.w3.org/2002/07/owl#propertyChainAxiom"/> <owl:annotatedTarget rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000445"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000383"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/RO_0003303"/> </owl:annotatedTarget> <rdfs:comment>Obsolete comment: Property chain to propagate inferred condition associations from an intrinsic genotype, GC, or VLSC to a gene class. (a separate chain is needed to propagate from the variant locus to the gene class, and another to propagate from a sequence alteration to the gene class). The following, shorter chain, would also suffice here: has_allele o inferred_to_cause_condition -&gt; inferred_to_cause_condition</rdfs:comment> <rdfs:comment>Property chain to propagate inferred condition associations from an intrinsic genotype, GVC, or VLSC to an affected gene class, or from an extrinsic gneotype or component to an affected gene class. The following, shorter chain, would also suffice here: has_affected_locus o inferred_to_cause_condition -&gt; inferred_to_cause_condition Note that a separate chain is needed to propagate from the variant locus to the gene class, and another to propagate from a sequence alteration to the gene class in cases where the link to gene is through the variant locus rather than the seq alteration).</rdfs:comment> </owl:Axiom> <owl:Axiom> <owl:annotatedSource rdf:resource="http://purl.obolibrary.org/obo/GENO_0000791"/> <owl:annotatedProperty rdf:resource="http://www.w3.org/2002/07/owl#propertyChainAxiom"/> <owl:annotatedTarget rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000445"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/RO_0003303"/> </owl:annotatedTarget> <rdfs:comment>Property chain to propagate inferred condition associations from a variant locus instance to a gene class (to support cases where the phenotype association is made directly at the level of the variant locus/allele).</rdfs:comment> </owl:Axiom> <owl:Axiom> <owl:annotatedSource rdf:resource="http://purl.obolibrary.org/obo/GENO_0000791"/> <owl:annotatedProperty rdf:resource="http://www.w3.org/2002/07/owl#propertyChainAxiom"/> <owl:annotatedTarget rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000661"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000383"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/RO_0003303"/> </owl:annotatedTarget> <rdfs:comment>Property chain to propagate inferred condition associations from an effective genotype through a sex-qualified intrinsic genotype to a sex-agnostic intrinsic genotype.</rdfs:comment> </owl:Axiom> <owl:Axiom> <owl:annotatedSource rdf:resource="http://purl.obolibrary.org/obo/GENO_0000791"/> <owl:annotatedProperty rdf:resource="http://www.w3.org/2002/07/owl#propertyChainAxiom"/> <owl:annotatedTarget rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000661"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/RO_0003303"/> </owl:annotatedTarget> <rdfs:comment>Property chain to propagate inferred condition associations &apos;down&apos; a genotype partonomy just from a sex-qualified intrinsic genotype to the immediate sex-agnostic intrinsic genotype. (An additional property chain is needed to then propagate to the intrinsic genotype components)</rdfs:comment> </owl:Axiom> <!-- http://purl.obolibrary.org/obo/GENO_0000793 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000793"> <rdfs:subPropertyOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000790"/> <rdfs:label xml:lang="en">inferred_to_contribute_to_condition</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000794 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000794"> <rdfs:subPropertyOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000790"/> <rdfs:label xml:lang="en">inferred_to_correlate_with_condition</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000840 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000840"> <rdfs:subPropertyOf rdf:resource="http://purl.obolibrary.org/obo/RO_0003303"/> <oboInOwl:hasDbXref>LOINC:LA6668-3</oboInOwl:hasDbXref> <rdfs:label xml:lang="en">pathogenic_for_condition</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000841 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000841"> <rdfs:subPropertyOf rdf:resource="http://purl.obolibrary.org/obo/RO_0003303"/> <oboInOwl:hasDbXref>LOINC:LA26332-9</oboInOwl:hasDbXref> <rdfs:label xml:lang="en">likely_pathogenic_for_condition</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000842 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000842"> <rdfs:subPropertyOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000790"/> <obo:IAO_0000115>Relation between an entity and a condition (disease, phenotype) which it does not cause or contribute to.</obo:IAO_0000115> <rdfs:label xml:lang="en">non-causal_for_condition</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000843 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000843"> <rdfs:subPropertyOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000842"/> <oboInOwl:hasDbXref>LOINC:LA6675-8</oboInOwl:hasDbXref> <rdfs:label xml:lang="en">benign_for_condition</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000844 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000844"> <rdfs:subPropertyOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000842"/> <oboInOwl:hasDbXref>LOINC:LA26334-5</oboInOwl:hasDbXref> <rdfs:label xml:lang="en">likely_benign_for_condition</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000845 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000845"> <rdfs:subPropertyOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000790"/> <oboInOwl:hasDbXref>LOINC:LA26333-7</oboInOwl:hasDbXref> <rdfs:label xml:lang="en">has_uncertain_significance_for_condition</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000846 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000846"> <rdfs:subPropertyOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000580"/> <obo:IAO_0000115>A relation used to describe a process contextualizing the identity of an entity.</obo:IAO_0000115> <rdfs:label xml:lang="en">has_qualifying_process</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000847 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000847"> <rdfs:subPropertyOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000580"/> <obo:IAO_0000115>A relation used to describe an environment contextualizing the identity of an entity.</obo:IAO_0000115> <rdfs:label xml:lang="en">has_qualifying_environment</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000849 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000849"> <rdfs:subPropertyOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000790"/> <rdfs:label xml:lang="en">is_candidate_variant_for</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000903 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000903"> <obo:IAO_0000115>A relation linking a sequence feature to the location it occupies on some reference sequence.</obo:IAO_0000115> <obo:IAO_0000118>occupies</obo:IAO_0000118> <rdfs:label xml:lang="en">has_location</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000906 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000906"> <rdfs:comment>Can be used to a genomic feature to the chromosomal strand it resides on in the genome (+ or - strand, or both strands). Commonly used to link a gene to the strand it is transcribed from.</rdfs:comment> <rdfs:label xml:lang="en">on strand</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/IAO_0000136 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/IAO_0000136"> <obo:IAO_0000115>is_about is a (currently) primitive relation that relates an information artifact to an entity.</obo:IAO_0000115> <rdfs:label>is about</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/IAO_0000219 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/IAO_0000219"> <rdfs:subPropertyOf rdf:resource="http://purl.obolibrary.org/obo/IAO_0000136"/> <obo:IAO_0000115>Denotes is a primitive, instance-level, relation obtaining between an information content entity and some portion of reality. Denotation is what happens when someone creates an information content entity E in order to specifically refer to something. The only relation between E and the thing is that E can be used to &apos;pick out&apos; the thing. This relation connects those two together. Freedictionary.com sense 3: To signify directly; refer to specifically</obo:IAO_0000115> <obo:IAO_0000116>Consdier if this is the best relation for linking genotypes to the genomic entities they specify. We could use the more generic &apos;is about&apos;, or define a new &apos;specifies&apos; relation that holds between ICEs and something it specifies the nature or creation of.</obo:IAO_0000116> <rdfs:label>denotes</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/OBI_0000293 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/OBI_0000293"> <rdfs:subPropertyOf rdf:resource="http://purl.obolibrary.org/obo/RO_0002233"/> <obo:IAO_0000115>A relation between a planned process and a continuant participating in that process that is not created during the process. The presence of the continuant during the process is explicitly specified in the plan specification which the process realizes the concretization of.</obo:IAO_0000115> <rdfs:label>has_specified_input</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/OBI_0000299 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/OBI_0000299"> <rdfs:subPropertyOf rdf:resource="http://purl.obolibrary.org/obo/RO_0002234"/> <obo:IAO_0000115>A relation between a planned process and a continuant participating in that process. The presence of the continuant at the end of the process is explicitly specified in the objective specification which the process realizes the concretization of.</obo:IAO_0000115> <rdfs:label>has_specified_output</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/RO_0000052 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/RO_0000052"> <obo:IAO_0000115>a relation between a specifically dependent continuant (the dependent) and an independent continuant (the bearer), in which the dependent specifically depends on the bearer for its existence</obo:IAO_0000115> <rdfs:label>inheres_in</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/RO_0000053 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/RO_0000053"> <obo:IAO_0000115>a relation between an independent continuant (the bearer) and a specifically dependent continuant (the dependent), in which the dependent specifically depends on the bearer for its existence</obo:IAO_0000115> <rdfs:label xml:lang="en">bearer of</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/RO_0000056 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/RO_0000056"> <owl:inverseOf rdf:resource="http://purl.obolibrary.org/obo/RO_0000057"/> <obo:IAO_0000115>a relation between a continuant and a process, in which the continuant is somehow involved in the process</obo:IAO_0000115> <rdfs:label>participates in</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/RO_0000057 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/RO_0000057"> <obo:IAO_0000115>a relation between a process and a continuant, in which the continuant is somehow involved in the process</obo:IAO_0000115> <rdfs:label>has participant</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/RO_0000059 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/RO_0000059"> <obo:IAO_0000112>A journal article is an information artifact that inheres in some number of printed journals. For each copy of the printed journal there is some quality that carries the journal article, such as a pattern of ink. The quality (a specifically dependent continuant) concretizes the journal article (a generically dependent continuant), and both depend on that copy of the printed journal (an independent continuant).</obo:IAO_0000112> <obo:IAO_0000115>A relationship between a specifically dependent continuant and a generically dependent continuant, in which the generically dependent continuant depends on some independent continuant in virtue of the fact that the specifically dependent continuant also depends on that same independent continuant. Multiple specifically dependent continuants can concretize the same generically dependent continuant.</obo:IAO_0000115> <rdfs:label xml:lang="en">concretizes</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/RO_0000086 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/RO_0000086"> <rdfs:subPropertyOf rdf:resource="http://purl.obolibrary.org/obo/RO_0000053"/> <obo:IAO_0000115>a relation between an independent continuant (the bearer) and a quality, in which the quality specifically depends on the bearer for its existence</obo:IAO_0000115> <rdfs:label>has quality</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/RO_0000087 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/RO_0000087"> <rdfs:subPropertyOf rdf:resource="http://purl.obolibrary.org/obo/RO_0000053"/> <rdfs:label>has_role</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/RO_0000091 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/RO_0000091"> <rdfs:subPropertyOf rdf:resource="http://purl.obolibrary.org/obo/RO_0000053"/> <obo:IAO_0000115>a relation between an independent continuant (the bearer) and a disposition, in which the disposition specifically depends on the bearer for its existence</obo:IAO_0000115> <rdfs:label>has disposition</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/RO_0001000 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/RO_0001000"> <rdfs:label>derives from</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/RO_0002091 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/RO_0002091"> <rdfs:subPropertyOf rdf:resource="http://purl.obolibrary.org/obo/RO_0002222"/> <rdfs:label>starts during</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/RO_0002093 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/RO_0002093"> <rdfs:subPropertyOf rdf:resource="http://purl.obolibrary.org/obo/RO_0002222"/> <rdfs:label>ends during</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/RO_0002131 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/RO_0002131"> <rdf:type rdf:resource="http://www.w3.org/2002/07/owl#SymmetricProperty"/> <obo:IAO_0000115>x overlaps y if and only if there exists some z such that x has part z and z part of y</obo:IAO_0000115> <rdfs:label xml:lang="en">overlaps</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/RO_0002162 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/RO_0002162"> <obo:IAO_0000115>x is in taxon y if an only if y is an organism, and the relationship between x and y is one of: part of (reflexive), developmentally preceded by, derives from, secreted by, expressed.</obo:IAO_0000115> <rdfs:label xml:lang="en">in taxon</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/RO_0002200 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/RO_0002200"> <owl:inverseOf rdf:resource="http://purl.obolibrary.org/obo/RO_0002201"/> <rdfs:range rdf:resource="http://purl.obolibrary.org/obo/UPHENO_0001001"/> <obo:IAO_0000115>A relationship that holds between a biological entity and a phenotype. Here a phenotype is construed broadly as any kind of quality of an organism part, a collection of these qualities, or a change in quality or qualities (e.g. abnormally increased temperature). The subject of this relationship can be an organism (where the organism has the phenotype, i.e. the qualities inhere in parts of this organism), a genomic entity such as a gene or genotype (if modifications of the gene or the genotype causes the phenotype), or a condition such as a disease (such that if the condition inheres in an organism, then the organism has the phenotype).</obo:IAO_0000115> <rdfs:label>has phenotype</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/RO_0002201 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/RO_0002201"> <rdfs:domain rdf:resource="http://purl.obolibrary.org/obo/UPHENO_0001001"/> <rdfs:label xml:lang="en">phenotype of</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/RO_0002222 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/RO_0002222"> <rdfs:label xml:lang="en">temporally related to</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/RO_0002233 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/RO_0002233"> <rdfs:subPropertyOf rdf:resource="http://purl.obolibrary.org/obo/RO_0000057"/> <obo:IAO_0000115>p has direct input c iff c is a participant in p, c is present at the start of p, and the state of c is modified during p.</obo:IAO_0000115> <rdfs:label xml:lang="en">has input</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/RO_0002234 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/RO_0002234"> <rdfs:subPropertyOf rdf:resource="http://purl.obolibrary.org/obo/RO_0000057"/> <owl:inverseOf rdf:resource="http://purl.obolibrary.org/obo/RO_0002353"/> <obo:IAO_0000115>p has output c iff c is a participant in p, c is present at the end of p, and c is not present at the beginning of p.</obo:IAO_0000115> <rdfs:label xml:lang="en">has output</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/RO_0002350 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/RO_0002350"> <rdfs:subPropertyOf rdf:resource="http://purl.obolibrary.org/obo/BFO_0000050"/> <owl:inverseOf rdf:resource="http://purl.obolibrary.org/obo/RO_0002351"/> <rdfs:label>is member of</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/RO_0002351 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/RO_0002351"> <rdfs:subPropertyOf rdf:resource="http://purl.obolibrary.org/obo/BFO_0000051"/> <obo:IAO_0000112>Example 1: a collection of sequences such as a genome being comprised of separate sequences of chromosomes Example 2: a collection of information entities such as a genotype being comprised of a background component and a variant component</obo:IAO_0000112> <obo:IAO_0000115>has member is a mereological relation between a collection and an item.</obo:IAO_0000115> <rdfs:label>has member</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/RO_0002352 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/RO_0002352"> <rdfs:subPropertyOf rdf:resource="http://purl.obolibrary.org/obo/RO_0000056"/> <rdfs:label xml:lang="en">input of</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/RO_0002353 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/RO_0002353"> <rdfs:subPropertyOf rdf:resource="http://purl.obolibrary.org/obo/RO_0000056"/> <rdfs:label xml:lang="en">output of</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/RO_0002354 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/RO_0002354"> <rdfs:subPropertyOf rdf:resource="http://www.geneontology.org/formats/oboInOwl#ObsoleteProperty"/> <rdfs:label xml:lang="en">obsolete_formed as result of</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/RO_000244 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/RO_000244"> <obo:IAO_0000115>Holds between molecular entities a and b when the execution of a activates or inhibits the activity of b</obo:IAO_0000115> <rdfs:label xml:lang="en">molecularly controls</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/RO_0002524 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/RO_0002524"> <rdfs:subPropertyOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000654"/> <owl:inverseOf rdf:resource="http://purl.obolibrary.org/obo/RO_0002525"/> <obo:IAO_0000115>x has subsequence y iff all of the sequence parts of x are sequence parts of y</obo:IAO_0000115> <rdfs:label xml:lang="en">has subsequence</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/RO_0002525 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/RO_0002525"> <rdfs:subPropertyOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000655"/> <rdfs:label xml:lang="en">is subsequence of</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/RO_0002528 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/RO_0002528"> <obo:IAO_0000115>inverse of downstream of sequence of</obo:IAO_0000115> <rdfs:label xml:lang="en">is upstream of sequence of</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/RO_0002529 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/RO_0002529"> <obo:IAO_0000115>x is downstream of the sequence of y iff either (1) x and y have sequence units, and all units of x are downstream of all units of y, or (2) x and y are sequence units, and x is either immediately downstream of y, or transitively downstream of y.</obo:IAO_0000115> <rdfs:label xml:lang="en">is downstream of sequence of</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/RO_0003301 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/RO_0003301"> <obo:IAO_0000115>Relation between a research artifact and an entity it is used to study, in virtue of its replicating or approximating features of the studied entity.</obo:IAO_0000115> <obo:IAO_0000116>To Do: decide on scope of this relation - inclusive of computational models in domain, or only physical models? Restricted to linking biological systems and phenomena? Inclusive of only diseases in range, or broader?</obo:IAO_0000116> <obo:IAO_0000117>Matthew Brush</obo:IAO_0000117> <rdfs:comment>The driving use case for this relation was to link a biological model system such as a cell line or model organism to a disease it is used to investigate, in virtue of the model system exhibiting features similar to that of the disease of interest.</rdfs:comment> <rdfs:label xml:lang="en">is model of</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/RO_0003302 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/RO_0003302"> <rdfs:subPropertyOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000790"/> <obo:IAO_0000112>The genetic variant &apos;NM_007294.3(BRCA1):c.110C&gt;A (p.Thr37Lys)&apos; casues or contributes to the disease &apos;familial breast-ovarian cancer&apos;. An environment of exposure to arsenic causes or contributes to the phenotype of patchy skin hyperpigmentation, and the disease &apos;skin cancer&apos;.</obo:IAO_0000112> <obo:IAO_0000115>A relationship between an entity (a genotype, genetic variation or environment) and a condition (a phenotype or disease) where the entity has some causal or contributing role that influences the condition.</obo:IAO_0000115> <obo:IAO_0000116>Note that relationships of phenotypes to organisms/strains that bear them, or diseases they are manifest in, should continue to use RO:0002200 ! &apos;has phenotype&apos; and RO:0002201 ! &apos;phenotype of&apos;.</obo:IAO_0000116> <rdfs:comment>Genetic variations can span any level of granularity from a full genome or genotype to an individual gene or sequence alteration. These variations can be represented at the physical level (DNA/RNA macromolecules or their parts, as in the ChEBI ontology and Molecular Sequence Ontology) or at the abstract level (generically dependent continuant sequence features that are carried by these macromolecules, as in the Sequence Ontology and Genotype Ontology). The causal relations in this hierarchy can be used in linking either physical or abstract genetic variations to phenotypes or diseases they cause or contribute to. Environments include natural environments or exposures, experimentally applied conditions, or clinical interventions.</rdfs:comment> <rdfs:label xml:lang="en">causes or contributes to condition</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/RO_0003303 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/RO_0003303"> <rdfs:subPropertyOf rdf:resource="http://purl.obolibrary.org/obo/RO_0003302"/> <obo:IAO_0000115>A relationship between an entity (a genotype, genetic variation or environment) and a condition (a phenotype or disease) where the entity has a causal role for the condition.</obo:IAO_0000115> <rdfs:label xml:lang="en">causes condition</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/RO_0003304 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/RO_0003304"> <rdfs:subPropertyOf rdf:resource="http://purl.obolibrary.org/obo/RO_0003302"/> <obo:IAO_0000115>A relationship between an entity (a genotype, genetic variation or environment) and a condition (a phenotype or disease) where the entity has some contributing role in the manifestation of the condition.</obo:IAO_0000115> <rdfs:label xml:lang="en">contributes to condition</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/RO_0003305 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/RO_0003305"> <rdfs:subPropertyOf rdf:resource="http://purl.obolibrary.org/obo/RO_0003304"/> <obo:IAO_0000115>A relationship between an entity (a genotype, genetic variation or environment) and a condition (a phenotype or disease) where the entity influences the severity with which a condition manifests in an individual.</obo:IAO_0000115> <obo:IAO_0000118>contributes to expressivity of condition</obo:IAO_0000118> <rdfs:label xml:lang="en">contributes to severity of condition</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/RO_0003306 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/RO_0003306"> <rdfs:subPropertyOf rdf:resource="http://purl.obolibrary.org/obo/RO_0003304"/> <obo:IAO_0000115>A relationship between an entity (a genotype, genetic variation or environment) and a condition (a phenotype or disease) where the entity influences the frequency of the condition in a population.</obo:IAO_0000115> <obo:IAO_0000118>contributes to penetrance of condition</obo:IAO_0000118> <rdfs:label xml:lang="en">contributes to frequency of condition</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/RO_0003307 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/RO_0003307"> <rdfs:subPropertyOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000790"/> <obo:IAO_0000115>A relationship between an entity (a genotype, genetic variation or environment) and a condition (a phenotype or disease) where the entity prevents or reduces the severity of a condition.</obo:IAO_0000115> <rdfs:comment>Genetic variations can span any level of granularity from a full genome or genotype to an individual gene or sequence alteration. These variations can be represented at the physical level (DNA/RNA macromolecules or their parts, as in the ChEBI ontology and Molecular Sequence Ontology) or at the abstract level (generically dependent continuant sequence features that are carried by these macromolecules, as in the Sequence Ontology and Genotype Ontology). The causal relations in this hierarchy can be used in linking either physical or abstract genetic variations to phenotypes or diseases they cause or contribute to. Environments include natural environments or exposures, experimentally applied conditions, or clinical interventions.</rdfs:comment> <rdfs:label xml:lang="en">is preventative for condition</rdfs:label> </owl:ObjectProperty> <!-- http://purl.obolibrary.org/obo/RO_0003308 --> <owl:ObjectProperty rdf:about="http://purl.obolibrary.org/obo/RO_0003308"> <rdfs:subPropertyOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000790"/> <obo:IAO_0000115>A relationship between an entity and a condition (phenotype or disease) with which it exhibits a statistical dependence relationship.</obo:IAO_0000115> <rdfs:label xml:lang="en">correlated with condition</rdfs:label> </owl:ObjectProperty> <!-- http://purl.org/oban/association_has_object --> <owl:ObjectProperty rdf:about="http://purl.org/oban/association_has_object"> <rdfs:label xml:lang="en">association has object</rdfs:label> </owl:ObjectProperty> <!-- http://purl.org/oban/association_has_predicate --> <owl:ObjectProperty rdf:about="http://purl.org/oban/association_has_predicate"> <rdfs:label xml:lang="en">association has predicate</rdfs:label> </owl:ObjectProperty> <!-- http://purl.org/oban/association_has_subject --> <owl:ObjectProperty rdf:about="http://purl.org/oban/association_has_subject"> <rdfs:label xml:lang="en">association has subject</rdfs:label> </owl:ObjectProperty> <!-- /////////////////////////////////////////////////////////////////////////////////////// // // Data properties // /////////////////////////////////////////////////////////////////////////////////////// --> <!-- http://biohackathon.org/resource/faldo#position --> <owl:DatatypeProperty rdf:about="http://biohackathon.org/resource/faldo#position"> <rdfs:comment>The position value is the offset along the reference where this position is found. Thus the only the position value in combination with the reference determines where a position is.</rdfs:comment> <rdfs:label xml:lang="en">position</rdfs:label> </owl:DatatypeProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000678 --> <owl:DatatypeProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000678"> <rdfs:range rdf:resource="http://www.w3.org/2001/XMLSchema#int"/> <obo:IAO_0000115>Property linking a sequence or sequence feature to an integer representing its length iin terms of the number of units in the sequence.</obo:IAO_0000115> <rdfs:label xml:lang="en">has_extent</rdfs:label> </owl:DatatypeProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000703 --> <owl:DatatypeProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000703"> <rdfs:domain rdf:resource="http://purl.obolibrary.org/obo/SO_0000110"/> <rdfs:range rdf:resource="http://www.w3.org/2001/XMLSchema#string"/> <obo:IAO_0000115>Shortcut relation linking a sequence feature directly to a string representing the &apos;state&apos; of its sequence - i.e. the ordering of units that comprise it (e.g. &apos;atgcagctagctaccgtcgatcg&apos;).</obo:IAO_0000115> <rdfs:label xml:lang="en">has_sequence_string</rdfs:label> </owl:DatatypeProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000712 --> <owl:DatatypeProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000712"> <rdfs:label xml:lang="en">ObsoleteDataProperty</rdfs:label> </owl:DatatypeProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000866 --> <owl:DatatypeProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000866"> <obo:IAO_0000112>The &apos;rank&apos; quantifier in Bgee gene-anatomy associations, that indicates the imporatnace/specificity of a gene expression in a given anatommy relative to expressionin other anatomies for the same gene.</obo:IAO_0000112> <obo:IAO_0000115>Property to link an assertion or association with some value quantifying its relevance or ranking.</obo:IAO_0000115> <rdfs:label xml:lang="en">has_quantifier</rdfs:label> </owl:DatatypeProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000894 --> <owl:DatatypeProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000894"> <obo:IAO_0000115>The starting position of a sequence region in 0-based coordinates.</obo:IAO_0000115> <obo:IAO_0000119>ClinGen Allele Model (http://datamodel.clinicalgenome.org/allele/)</obo:IAO_0000119> <rdfs:label>start_position</rdfs:label> </owl:DatatypeProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000895 --> <owl:DatatypeProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000895"> <obo:IAO_0000115>The ending position of a sequence region in 0-based coordinates.</obo:IAO_0000115> <obo:IAO_0000119>ClinGen Allele Model (http://datamodel.clinicalgenome.org/allele/)</obo:IAO_0000119> <rdfs:label>end_position</rdfs:label> </owl:DatatypeProperty> <!-- http://purl.obolibrary.org/obo/GENO_0000896 --> <owl:DatatypeProperty rdf:about="http://purl.obolibrary.org/obo/GENO_0000896"> <rdfs:domain rdf:resource="http://purl.obolibrary.org/obo/GENO_0000702"/> <rdfs:range rdf:resource="http://www.w3.org/2001/XMLSchema#string"/> <obo:IAO_0000115>Property linking a biological sequence to a string representing the ordered units that comprise the sequence (e.g. &apos;atgcagctagctaccgtcgatcg&apos;).</obo:IAO_0000115> <rdfs:label>has_string</rdfs:label> </owl:DatatypeProperty> <!-- /////////////////////////////////////////////////////////////////////////////////////// // // Classes // /////////////////////////////////////////////////////////////////////////////////////// --> <!-- http://biohackathon.org/resource/faldo#BothStrandsPosition --> <owl:Class rdf:about="http://biohackathon.org/resource/faldo#BothStrandsPosition"> <rdfs:subClassOf rdf:resource="http://biohackathon.org/resource/faldo#StrandedPosition"/> <rdfs:label xml:lang="en">Both strands</rdfs:label> </owl:Class> <!-- http://biohackathon.org/resource/faldo#ExactPosition --> <owl:Class rdf:about="http://biohackathon.org/resource/faldo#ExactPosition"> <rdfs:subClassOf rdf:resource="http://biohackathon.org/resource/faldo#Position"/> <obo:IAO_0000115>A position that is exactly known.</obo:IAO_0000115> <rdfs:label xml:lang="en">Exact position</rdfs:label> </owl:Class> <!-- http://biohackathon.org/resource/faldo#ForwardStrandPosition --> <owl:Class rdf:about="http://biohackathon.org/resource/faldo#ForwardStrandPosition"> <rdfs:subClassOf rdf:resource="http://biohackathon.org/resource/faldo#StrandedPosition"/> <rdfs:label xml:lang="en">Positive strand</rdfs:label> </owl:Class> <!-- http://biohackathon.org/resource/faldo#Position --> <owl:Class rdf:about="http://biohackathon.org/resource/faldo#Position"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000902"/> <obo:IAO_0000115>Superclass for the general concept of a position on a sequence. The sequence is designated with the reference predicate.</obo:IAO_0000115> <obo:IAO_0000116>Placing the FALDO:Position class under GENO:genomic locus, as it represents a type of genomic location with the same start and end coordinates (i.e. a single position as opposed to a location spanning a longer region)</obo:IAO_0000116> <rdfs:label xml:lang="en">Position</rdfs:label> </owl:Class> <!-- http://biohackathon.org/resource/faldo#Region --> <owl:Class rdf:about="http://biohackathon.org/resource/faldo#Region"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_0000110"/> <rdfs:subClassOf> <owl:Class> <owl:intersectionOf rdf:parseType="Collection"> <owl:Restriction> <owl:onProperty rdf:resource="http://biohackathon.org/resource/faldo#begin"/> <owl:qualifiedCardinality rdf:datatype="http://www.w3.org/2001/XMLSchema#nonNegativeInteger">1</owl:qualifiedCardinality> <owl:onClass rdf:resource="http://biohackathon.org/resource/faldo#Position"/> </owl:Restriction> <owl:Restriction> <owl:onProperty rdf:resource="http://biohackathon.org/resource/faldo#end"/> <owl:qualifiedCardinality rdf:datatype="http://www.w3.org/2001/XMLSchema#nonNegativeInteger">1</owl:qualifiedCardinality> <owl:onClass rdf:resource="http://biohackathon.org/resource/faldo#Position"/> </owl:Restriction> </owl:intersectionOf> </owl:Class> </rdfs:subClassOf> <obo:IAO_0000115>A region describes a length of sequence with a start position and end position that represents a feature on a sequence, e.g. a gene.</obo:IAO_0000115> <obo:IAO_0000116>From what I can tell, feature instances in data whose position is to be defined using FALDO are always mapped to a Region, and then the position of this Region is defined according to its location within some larger reference sequence. The exception may be feature instances that are explicitly part of the reference sequence on which its location is being defined (such that no &apos;mapping&apos; to a reference is required). This suggests that, conceptually, we can think of a FALDO:Region as a subregion of a reference sequence that is mapped to from a feature of interest, in order to define its position with respect to that reference sequence.</obo:IAO_0000116> <rdfs:label xml:lang="en">Region</rdfs:label> </owl:Class> <!-- http://biohackathon.org/resource/faldo#ReverseStrandPosition --> <owl:Class rdf:about="http://biohackathon.org/resource/faldo#ReverseStrandPosition"> <rdfs:subClassOf rdf:resource="http://biohackathon.org/resource/faldo#StrandedPosition"/> <rdfs:label xml:lang="en">Negative strand</rdfs:label> </owl:Class> <!-- http://biohackathon.org/resource/faldo#StrandedPosition --> <owl:Class rdf:about="http://biohackathon.org/resource/faldo#StrandedPosition"> <rdfs:subClassOf rdf:resource="http://biohackathon.org/resource/faldo#Position"/> <rdfs:comment>Part of the coordinate system denoting on which strand the feature can be found. If you do not yet know which stand the feature is on, you should tag the position with just this class. If you know more you should use one of the subclasses. This means a region described with a &apos;.&apos; in GFF3. A GFF3 unstranded position does not have this type in FALDO -- those are just a &apos;position&apos;.</rdfs:comment> <rdfs:label xml:lang="en">Stranded position</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/BFO_0000001 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/BFO_0000001"> <obo:IAO_0000112 xml:lang="en">Julius Caesar</obo:IAO_0000112> <obo:IAO_0000112 xml:lang="en">Verdi’s Requiem</obo:IAO_0000112> <obo:IAO_0000112 xml:lang="en">the Second World War</obo:IAO_0000112> <obo:IAO_0000112 xml:lang="en">your body mass index</obo:IAO_0000112> <obo:IAO_0000116 xml:lang="en">BFO 2 Reference: In all areas of empirical inquiry we encounter general terms of two sorts. First are general terms which refer to universals or types:animaltuberculosissurgical procedurediseaseSecond, are general terms used to refer to groups of entities which instantiate a given universal but do not correspond to the extension of any subuniversal of that universal because there is nothing intrinsic to the entities in question by virtue of which they – and only they – are counted as belonging to the given group. Examples are: animal purchased by the Emperortuberculosis diagnosed on a Wednesdaysurgical procedure performed on a patient from Stockholmperson identified as candidate for clinical trial #2056-555person who is signatory of Form 656-PPVpainting by Leonardo da VinciSuch terms, which represent what are called ‘specializations’ in [81</obo:IAO_0000116> <obo:IAO_0000116 xml:lang="en">Entity doesn&apos;t have a closure axiom because the subclasses don&apos;t necessarily exhaust all possibilites. For example Werner Ceusters &apos;portions of reality&apos; include 4 sorts, entities (as BFO construes them), universals, configurations, and relations. It is an open question as to whether entities as construed in BFO will at some point also include these other portions of reality. See, for example, &apos;How to track absolutely everything&apos; at http://www.referent-tracking.com/_RTU/papers/CeustersICbookRevised.pdf</obo:IAO_0000116> <obo:IAO_0000600 xml:lang="en">An entity is anything that exists or has existed or will exist. (axiom label in BFO2 Reference: [001-001])</obo:IAO_0000600> <rdfs:isDefinedBy rdf:resource="http://purl.obolibrary.org/obo/bfo.owl"/> <rdfs:label xml:lang="en">entity</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/BFO_0000002 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/BFO_0000002"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/BFO_0000001"/> <owl:disjointWith rdf:resource="http://purl.obolibrary.org/obo/BFO_0000003"/> <obo:IAO_0000116 xml:lang="en">BFO 2 Reference: Continuant entities are entities which can be sliced to yield parts only along the spatial dimension, yielding for example the parts of your table which we call its legs, its top, its nails. ‘My desk stretches from the window to the door. It has spatial parts, and can be sliced (in space) in two. With respect to time, however, a thing is a continuant.’ [60, p. 240</obo:IAO_0000116> <obo:IAO_0000116 xml:lang="en">Continuant doesn&apos;t have a closure axiom because the subclasses don&apos;t necessarily exhaust all possibilites. For example, in an expansion involving bringing in some of Ceuster&apos;s other portions of reality, questions are raised as to whether universals are continuants</obo:IAO_0000116> <obo:IAO_0000600 xml:lang="en">A continuant is an entity that persists, endures, or continues to exist through time while maintaining its identity. (axiom label in BFO2 Reference: [008-002])</obo:IAO_0000600> <rdfs:isDefinedBy rdf:resource="http://purl.obolibrary.org/obo/bfo.owl"/> <rdfs:label>continuant</rdfs:label> <rdfs:label xml:lang="en">continuant</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/BFO_0000003 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/BFO_0000003"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/BFO_0000001"/> <obo:IAO_0000116 xml:lang="en">BFO 2 Reference: every occurrent that is not a temporal or spatiotemporal region is s-dependent on some independent continuant that is not a spatial region</obo:IAO_0000116> <obo:IAO_0000116 xml:lang="en">BFO 2 Reference: s-dependence obtains between every process and its participants in the sense that, as a matter of necessity, this process could not have existed unless these or those participants existed also. A process may have a succession of participants at different phases of its unfolding. Thus there may be different players on the field at different times during the course of a football game; but the process which is the entire game s-depends_on all of these players nonetheless. Some temporal parts of this process will s-depend_on on only some of the players.</obo:IAO_0000116> <obo:IAO_0000116 xml:lang="en">Occurrent doesn&apos;t have a closure axiom because the subclasses don&apos;t necessarily exhaust all possibilites. An example would be the sum of a process and the process boundary of another process.</obo:IAO_0000116> <obo:IAO_0000116>Simons uses different terminology for relations of occurrents to regions: Denote the spatio-temporal location of a given occurrent e by &apos;spn[e]&apos; and call this region its span. We may say an occurrent is at its span, in any larger region, and covers any smaller region. Now suppose we have fixed a frame of reference so that we can speak not merely of spatio-temporal but also of spatial regions (places) and temporal regions (times). The spread of an occurrent, (relative to a frame of reference) is the space it exactly occupies, and its spell is likewise the time it exactly occupies. We write &apos;spr[e]&apos; and `spl[e]&apos; respectively for the spread and spell of e, omitting mention of the frame.</obo:IAO_0000116> <obo:IAO_0000600 xml:lang="en">An occurrent is an entity that unfolds itself in time or it is the instantaneous boundary of such an entity (for example a beginning or an ending) or it is a temporal or spatiotemporal region which such an entity occupies_temporal_region or occupies_spatiotemporal_region. (axiom label in BFO2 Reference: [077-002])</obo:IAO_0000600> <rdfs:isDefinedBy rdf:resource="http://purl.obolibrary.org/obo/bfo.owl"/> <rdfs:label>occurrent</rdfs:label> <rdfs:label xml:lang="en">occurrent</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/BFO_0000004 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/BFO_0000004"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/BFO_0000002"/> <obo:IAO_0000112 xml:lang="en">a chair</obo:IAO_0000112> <obo:IAO_0000112 xml:lang="en">a heart</obo:IAO_0000112> <obo:IAO_0000112 xml:lang="en">a leg</obo:IAO_0000112> <obo:IAO_0000112 xml:lang="en">a molecule</obo:IAO_0000112> <obo:IAO_0000112 xml:lang="en">a spatial region</obo:IAO_0000112> <obo:IAO_0000112 xml:lang="en">an atom</obo:IAO_0000112> <obo:IAO_0000112 xml:lang="en">an orchestra.</obo:IAO_0000112> <obo:IAO_0000112 xml:lang="en">an organism</obo:IAO_0000112> <obo:IAO_0000112 xml:lang="en">the bottom right portion of a human torso</obo:IAO_0000112> <obo:IAO_0000112 xml:lang="en">the interior of your mouth</obo:IAO_0000112> <obo:IAO_0000115 xml:lang="en">b is an independent continuant = Def. b is a continuant which is such that there is no c and no t such that b s-depends_on c at t. (axiom label in BFO2 Reference: [017-002])</obo:IAO_0000115> <rdfs:isDefinedBy rdf:resource="http://purl.obolibrary.org/obo/bfo.owl"/> <rdfs:label>independent continuant</rdfs:label> <rdfs:label xml:lang="en">independent continuant</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/BFO_0000015 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/BFO_0000015"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/BFO_0000003"/> <obo:IAO_0000112 xml:lang="en">a process of cell-division, \ a beating of the heart</obo:IAO_0000112> <obo:IAO_0000112 xml:lang="en">a process of meiosis</obo:IAO_0000112> <obo:IAO_0000112 xml:lang="en">a process of sleeping</obo:IAO_0000112> <obo:IAO_0000112 xml:lang="en">the course of a disease</obo:IAO_0000112> <obo:IAO_0000112 xml:lang="en">the flight of a bird</obo:IAO_0000112> <obo:IAO_0000112 xml:lang="en">the life of an organism</obo:IAO_0000112> <obo:IAO_0000112 xml:lang="en">your process of aging.</obo:IAO_0000112> <obo:IAO_0000115 xml:lang="en">p is a process = Def. p is an occurrent that has temporal proper parts and for some time t, p s-depends_on some material entity at t. (axiom label in BFO2 Reference: [083-003])</obo:IAO_0000115> <obo:IAO_0000116 xml:lang="en">BFO 2 Reference: The realm of occurrents is less pervasively marked by the presence of natural units than is the case in the realm of independent continuants. Thus there is here no counterpart of ‘object’. In BFO 1.0 ‘process’ served as such a counterpart. In BFO 2.0 ‘process’ is, rather, the occurrent counterpart of ‘material entity’. Those natural – as contrasted with engineered, which here means: deliberately executed – units which do exist in the realm of occurrents are typically either parasitic on the existence of natural units on the continuant side, or they are fiat in nature. Thus we can count lives; we can count football games; we can count chemical reactions performed in experiments or in chemical manufacturing. We cannot count the processes taking place, for instance, in an episode of insect mating behavior.Even where natural units are identifiable, for example cycles in a cyclical process such as the beating of a heart or an organism’s sleep/wake cycle, the processes in question form a sequence with no discontinuities (temporal gaps) of the sort that we find for instance where billiard balls or zebrafish or planets are separated by clear spatial gaps. Lives of organisms are process units, but they too unfold in a continuous series from other, prior processes such as fertilization, and they unfold in turn in continuous series of post-life processes such as post-mortem decay. Clear examples of boundaries of processes are almost always of the fiat sort (midnight, a time of death as declared in an operating theater or on a death certificate, the initiation of a state of war)</obo:IAO_0000116> <rdfs:isDefinedBy rdf:resource="http://purl.obolibrary.org/obo/bfo.owl"/> <rdfs:label>process</rdfs:label> <rdfs:label xml:lang="en">process</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/BFO_0000016 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/BFO_0000016"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/BFO_0000017"/> <owl:disjointWith rdf:resource="http://purl.obolibrary.org/obo/BFO_0000023"/> <obo:IAO_0000112 xml:lang="en">an atom of element X has the disposition to decay to an atom of element Y</obo:IAO_0000112> <obo:IAO_0000112 xml:lang="en">certain people have a predisposition to colon cancer</obo:IAO_0000112> <obo:IAO_0000112 xml:lang="en">children are innately disposed to categorize objects in certain ways.</obo:IAO_0000112> <obo:IAO_0000112 xml:lang="en">the cell wall is disposed to filter chemicals in endocitosis and exocitosis</obo:IAO_0000112> <obo:IAO_0000116 xml:lang="en">BFO 2 Reference: Dispositions exist along a strength continuum. Weaker forms of disposition are realized in only a fraction of triggering cases. These forms occur in a significant number of cases of a similar type [89</obo:IAO_0000116> <obo:IAO_0000600 xml:lang="en">b is a disposition means: b is a realizable entity &amp; b’s bearer is some material entity &amp; b is such that if it ceases to exist, then its bearer is physically changed, &amp; b’s realization occurs when and because this bearer is in some special physical circumstances, &amp; this realization occurs in virtue of the bearer’s physical make-up. (axiom label in BFO2 Reference: [062-002])</obo:IAO_0000600> <rdfs:isDefinedBy rdf:resource="http://purl.obolibrary.org/obo/bfo.owl"/> <rdfs:label>disposition</rdfs:label> <rdfs:label xml:lang="en">disposition</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/BFO_0000017 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/BFO_0000017"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/BFO_0000020"/> <owl:disjointWith rdf:resource="http://purl.obolibrary.org/obo/BFO_0000019"/> <obo:IAO_0000112 xml:lang="en">the disposition of this piece of metal to conduct electricity.</obo:IAO_0000112> <obo:IAO_0000112 xml:lang="en">the disposition of your blood to coagulate</obo:IAO_0000112> <obo:IAO_0000112 xml:lang="en">the function of your reproductive organs</obo:IAO_0000112> <obo:IAO_0000112 xml:lang="en">the role of being a doctor</obo:IAO_0000112> <obo:IAO_0000112 xml:lang="en">the role of this boundary to delineate where Utah and Colorado meet</obo:IAO_0000112> <obo:IAO_0000600 xml:lang="en">To say that b is a realizable entity is to say that b is a specifically dependent continuant that inheres in some independent continuant which is not a spatial region and is of a type instances of which are realized in processes of a correlated type. (axiom label in BFO2 Reference: [058-002])</obo:IAO_0000600> <rdfs:isDefinedBy rdf:resource="http://purl.obolibrary.org/obo/bfo.owl"/> <rdfs:label>realizable entity</rdfs:label> <rdfs:label xml:lang="en">realizable entity</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/BFO_0000019 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/BFO_0000019"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/BFO_0000020"/> <obo:IAO_0000112 xml:lang="en">the ambient temperature of this portion of air</obo:IAO_0000112> <obo:IAO_0000112 xml:lang="en">the color of a tomato</obo:IAO_0000112> <obo:IAO_0000112 xml:lang="en">the length of the circumference of your waist</obo:IAO_0000112> <obo:IAO_0000112 xml:lang="en">the mass of this piece of gold.</obo:IAO_0000112> <obo:IAO_0000112 xml:lang="en">the shape of your nose</obo:IAO_0000112> <obo:IAO_0000112 xml:lang="en">the shape of your nostril</obo:IAO_0000112> <obo:IAO_0000600 xml:lang="en">a quality is a specifically dependent continuant that, in contrast to roles and dispositions, does not require any further process in order to be realized. (axiom label in BFO2 Reference: [055-001])</obo:IAO_0000600> <rdfs:isDefinedBy rdf:resource="http://purl.obolibrary.org/obo/bfo.owl"/> <rdfs:label>quality</rdfs:label> <rdfs:label xml:lang="en">quality</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/BFO_0000020 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/BFO_0000020"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/BFO_0000002"/> <obo:IAO_0000112 xml:lang="en">Reciprocal specifically dependent continuants: the function of this key to open this lock and the mutually dependent disposition of this lock: to be opened by this key</obo:IAO_0000112> <obo:IAO_0000112 xml:lang="en">of one-sided specifically dependent continuants: the mass of this tomato</obo:IAO_0000112> <obo:IAO_0000112 xml:lang="en">of relational dependent continuants (multiple bearers): John’s love for Mary, the ownership relation between John and this statue, the relation of authority between John and his subordinates.</obo:IAO_0000112> <obo:IAO_0000112 xml:lang="en">the disposition of this fish to decay</obo:IAO_0000112> <obo:IAO_0000112 xml:lang="en">the function of this heart: to pump blood</obo:IAO_0000112> <obo:IAO_0000112 xml:lang="en">the mutual dependence of proton donors and acceptors in chemical reactions [79</obo:IAO_0000112> <obo:IAO_0000112 xml:lang="en">the mutual dependence of the role predator and the role prey as played by two organisms in a given interaction</obo:IAO_0000112> <obo:IAO_0000112 xml:lang="en">the pink color of a medium rare piece of grilled filet mignon at its center</obo:IAO_0000112> <obo:IAO_0000112 xml:lang="en">the role of being a doctor</obo:IAO_0000112> <obo:IAO_0000112 xml:lang="en">the shape of this hole.</obo:IAO_0000112> <obo:IAO_0000112 xml:lang="en">the smell of this portion of mozzarella</obo:IAO_0000112> <obo:IAO_0000115 xml:lang="en">b is a relational specifically dependent continuant = Def. b is a specifically dependent continuant and there are n &amp;gt; 1 independent continuants c1, … cn which are not spatial regions are such that for all 1 i &amp;lt; j n, ci and cj share no common parts, are such that for each 1 i n, b s-depends_on ci at every time t during the course of b’s existence (axiom label in BFO2 Reference: [131-004])</obo:IAO_0000115> <obo:IAO_0000115 xml:lang="en">b is a specifically dependent continuant = Def. b is a continuant &amp; there is some independent continuant c which is not a spatial region and which is such that b s-depends_on c at every time t during the course of b’s existence. (axiom label in BFO2 Reference: [050-003])</obo:IAO_0000115> <obo:IAO_0000116 xml:lang="en">Specifically dependent continuant doesn&apos;t have a closure axiom because the subclasses don&apos;t necessarily exhaust all possibilites. We&apos;re not sure what else will develop here, but for example there are questions such as what are promises, obligation, etc.</obo:IAO_0000116> <rdfs:isDefinedBy rdf:resource="http://purl.obolibrary.org/obo/bfo.owl"/> <rdfs:label>specifically dependent continuant</rdfs:label> <rdfs:label xml:lang="en">specifically dependent continuant</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/BFO_0000023 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/BFO_0000023"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/BFO_0000017"/> <obo:IAO_0000112 xml:lang="en">John’s role of husband to Mary is dependent on Mary’s role of wife to John, and both are dependent on the object aggregate comprising John and Mary as member parts joined together through the relational quality of being married.</obo:IAO_0000112> <obo:IAO_0000112 xml:lang="en">the priest role</obo:IAO_0000112> <obo:IAO_0000112 xml:lang="en">the role of a boundary to demarcate two neighboring administrative territories</obo:IAO_0000112> <obo:IAO_0000112 xml:lang="en">the role of a building in serving as a military target</obo:IAO_0000112> <obo:IAO_0000112 xml:lang="en">the role of a stone in marking a property boundary</obo:IAO_0000112> <obo:IAO_0000112 xml:lang="en">the role of subject in a clinical trial</obo:IAO_0000112> <obo:IAO_0000112 xml:lang="en">the student role</obo:IAO_0000112> <obo:IAO_0000116 xml:lang="en">BFO 2 Reference: One major family of examples of non-rigid universals involves roles, and ontologies developed for corresponding administrative purposes may consist entirely of representatives of entities of this sort. Thus ‘professor’, defined as follows,b instance_of professor at t =Def. there is some c, c instance_of professor role &amp; c inheres_in b at t.denotes a non-rigid universal and so also do ‘nurse’, ‘student’, ‘colonel’, ‘taxpayer’, and so forth. (These terms are all, in the jargon of philosophy, phase sortals.) By using role terms in definitions, we can create a BFO conformant treatment of such entities drawing on the fact that, while an instance of professor may be simultaneously an instance of trade union member, no instance of the type professor role is also (at any time) an instance of the type trade union member role (any more than any instance of the type color is at any time an instance of the type length).If an ontology of employment positions should be defined in terms of roles following the above pattern, this enables the ontology to do justice to the fact that individuals instantiate the corresponding universals – professor, sergeant, nurse – only during certain phases in their lives.</obo:IAO_0000116> <obo:IAO_0000600 xml:lang="en">b is a role means: b is a realizable entity and b exists because there is some single bearer that is in some special physical, social, or institutional set of circumstances in which this bearer does not have to be and b is not such that, if it ceases to exist, then the physical make-up of the bearer is thereby changed. (axiom label in BFO2 Reference: [061-001])</obo:IAO_0000600> <rdfs:isDefinedBy rdf:resource="http://purl.obolibrary.org/obo/bfo.owl"/> <rdfs:label>role</rdfs:label> <rdfs:label xml:lang="en">role</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/BFO_0000031 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/BFO_0000031"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/BFO_0000002"/> <obo:IAO_0000112 xml:lang="en">The entries in your database are patterns instantiated as quality instances in your hard drive. The database itself is an aggregate of such patterns. When you create the database you create a particular instance of the generically dependent continuant type database. Each entry in the database is an instance of the generically dependent continuant type IAO: information content entity.</obo:IAO_0000112> <obo:IAO_0000112 xml:lang="en">the pdf file on your laptop, the pdf file that is a copy thereof on my laptop</obo:IAO_0000112> <obo:IAO_0000112 xml:lang="en">the sequence of this protein molecule; the sequence that is a copy thereof in that protein molecule.</obo:IAO_0000112> <obo:IAO_0000115 xml:lang="en">b is a generically dependent continuant = Def. b is a continuant that g-depends_on one or more other entities. (axiom label in BFO2 Reference: [074-001])</obo:IAO_0000115> <rdfs:isDefinedBy rdf:resource="http://purl.obolibrary.org/obo/bfo.owl"/> <rdfs:label>generically dependent continuant</rdfs:label> <rdfs:label xml:lang="en">generically dependent continuant</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/BFO_0000034 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/BFO_0000034"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/BFO_0000016"/> <obo:IAO_0000112 xml:lang="en">the function of a hammer to drive in nails</obo:IAO_0000112> <obo:IAO_0000112 xml:lang="en">the function of a heart pacemaker to regulate the beating of a heart through electricity</obo:IAO_0000112> <obo:IAO_0000112 xml:lang="en">the function of amylase in saliva to break down starch into sugar</obo:IAO_0000112> <obo:IAO_0000116 xml:lang="en">BFO 2 Reference: In the past, we have distinguished two varieties of function, artifactual function and biological function. These are not asserted subtypes of BFO:function however, since the same function – for example: to pump, to transport – can exist both in artifacts and in biological entities. The asserted subtypes of function that would be needed in order to yield a separate monoheirarchy are not artifactual function, biological function, etc., but rather transporting function, pumping function, etc.</obo:IAO_0000116> <obo:IAO_0000600 xml:lang="en">A function is a disposition that exists in virtue of the bearer’s physical make-up and this physical make-up is something the bearer possesses because it came into being, either through evolution (in the case of natural biological entities) or through intentional design (in the case of artifacts), in order to realize processes of a certain sort. (axiom label in BFO2 Reference: [064-001])</obo:IAO_0000600> <rdfs:isDefinedBy rdf:resource="http://purl.obolibrary.org/obo/bfo.owl"/> <rdfs:label xml:lang="en">function</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/BFO_0000040 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/BFO_0000040"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/BFO_0000004"/> <obo:IAO_0000112 xml:lang="en">a flame</obo:IAO_0000112> <obo:IAO_0000112 xml:lang="en">a forest fire</obo:IAO_0000112> <obo:IAO_0000112 xml:lang="en">a human being</obo:IAO_0000112> <obo:IAO_0000112 xml:lang="en">a hurricane</obo:IAO_0000112> <obo:IAO_0000112 xml:lang="en">a photon</obo:IAO_0000112> <obo:IAO_0000112 xml:lang="en">a puff of smoke</obo:IAO_0000112> <obo:IAO_0000112 xml:lang="en">a sea wave</obo:IAO_0000112> <obo:IAO_0000112 xml:lang="en">a tornado</obo:IAO_0000112> <obo:IAO_0000112 xml:lang="en">an aggregate of human beings.</obo:IAO_0000112> <obo:IAO_0000112 xml:lang="en">an energy wave</obo:IAO_0000112> <obo:IAO_0000112 xml:lang="en">an epidemic</obo:IAO_0000112> <obo:IAO_0000112 xml:lang="en">the undetached arm of a human being</obo:IAO_0000112> <obo:IAO_0000116 xml:lang="en">BFO 2 Reference: Material entities (continuants) can preserve their identity even while gaining and losing material parts. Continuants are contrasted with occurrents, which unfold themselves in successive temporal parts or phases [60</obo:IAO_0000116> <obo:IAO_0000116 xml:lang="en">BFO 2 Reference: Object, Fiat Object Part and Object Aggregate are not intended to be exhaustive of Material Entity. Users are invited to propose new subcategories of Material Entity.</obo:IAO_0000116> <obo:IAO_0000116 xml:lang="en">BFO 2 Reference: ‘Matter’ is intended to encompass both mass and energy (we will address the ontological treatment of portions of energy in a later version of BFO). A portion of matter is anything that includes elementary particles among its proper or improper parts: quarks and leptons, including electrons, as the smallest particles thus far discovered; baryons (including protons and neutrons) at a higher level of granularity; atoms and molecules at still higher levels, forming the cells, organs, organisms and other material entities studied by biologists, the portions of rock studied by geologists, the fossils studied by paleontologists, and so on.Material entities are three-dimensional entities (entities extended in three spatial dimensions), as contrasted with the processes in which they participate, which are four-dimensional entities (entities extended also along the dimension of time).According to the FMA, material entities may have immaterial entities as parts – including the entities identified below as sites; for example the interior (or ‘lumen’) of your small intestine is a part of your body. BFO 2.0 embodies a decision to follow the FMA here.</obo:IAO_0000116> <obo:IAO_0000600 xml:lang="en">A material entity is an independent continuant that has some portion of matter as proper or improper continuant part. (axiom label in BFO2 Reference: [019-002])</obo:IAO_0000600> <rdfs:isDefinedBy rdf:resource="http://purl.obolibrary.org/obo/bfo.owl"/> <rdfs:label>material entity</rdfs:label> <rdfs:label xml:lang="en">material entity</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/CHEBI_23367 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/CHEBI_23367"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/BFO_0000040"/> <obo:IAO_0000116>Stub class to serve as root of hierarchy for imports of molecular entities from ChEBI ontology.</obo:IAO_0000116> <rdfs:label>molecular entity</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/CHEBI_33696 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/CHEBI_33696"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/CHEBI_23367"/> <rdfs:label>nucleic acid</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/CLO_0000031 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/CLO_0000031"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/BFO_0000040"/> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/RO_0001000"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/OBI_0100026"/> </owl:Restriction> </rdfs:subClassOf> <obo:IAO_0000115>A cultured cell population that represents a genetically stable and homogenous population of cultured cells that shares a common propagation history (i.e. has been successively passaged together in culture).</obo:IAO_0000115> <rdfs:label xml:lang="en">cell line</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/CL_0000000 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/CL_0000000"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/UBERON_0001062"/> <rdfs:comment>Stub class to serve as root of hierarchy for imports of cell types from CL or other cell terminologies.</rdfs:comment> <rdfs:label>cell</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/ENVO_01000254 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/ENVO_01000254"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/BFO_0000040"/> <obo:IAO_0000116>1. Stub class to serve as root of hierarchy for imports from an ontology of environment and experimental conditions. 2. Need to consdier how to model environments in a way that covers ENVO and XCO content in a consistent and coherent way. A couple classes under Exploratory Class are relvant here. Consider how we might approach environments/condisitons using an EQ aproach analogous to how phenotypes are defined (i.e. consider environments/coonditions as qualities inhereing in some entity).</obo:IAO_0000116> <rdfs:comment>In ENVO&apos;s alignment with the Basic Formal Ontology, this class is being considered as a subclass of a proposed BFO class &quot;system&quot;. The relation &quot;environed_by&quot; is also under development. Roughly, a system which includes a material entity (at least partially) within its site and causally influences that entity may be considered to environ it. Following the completion of this alignment, this class&apos; definition and the definitions of its subclasses will be revised.</rdfs:comment> <rdfs:label>environmental system</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/ERO_0000007 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/ERO_0000007"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/OBI_0000011"/> <obo:IAO_0000115>A technique is a planned process used to accomplish a specific activity or task.</obo:IAO_0000115> <rdfs:label xml:lang="en">technique</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/ERO_0002002 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/ERO_0002002"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/ERO_0002003"/> <obo:IAO_0000115>A stem cell line comprised of embryonic stem cells, totipotent cells cultured from an early embryo.</obo:IAO_0000115> <rdfs:label xml:lang="en">embryonic stem cell line</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/ERO_0002003 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/ERO_0002003"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/CLO_0000031"/> <obo:IAO_0000115>A cell line comprised of stem cells,relatively undifferentiated cells that retain the ability to divide and proliferate provide progenitor cells that can differentiate into specialized cell types.</obo:IAO_0000115> <rdfs:label xml:lang="en">stem cell line</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000000 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000000"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000899"/> <obo:IAO_0000112>Example zebrafish intrinsic genotype: Genotype = fgf8a&lt;ti282a/+&gt;; shha&lt;tb392/tb392&gt; (AB) reference component (genomic background) = AB variant component (&apos;genomic variation complement&apos;) = fgf8a&lt;ti282a/+&gt;; shha&lt;tb392/tb392&gt; . . . and within this variant component, there are two &apos;variant single locus complements&apos; represented: allele complement 1 = fgf8a&lt;ti282a/+&gt; allele complement 2 = shha&lt;tb392/tb392&gt; and within each of these &apos;variant single locus complements&apos; there is one or more variant gene locus member: in complement 1: fgf8a&lt;ti282a&gt; in complement 2: shha&lt;ttb392&gt;</obo:IAO_0000112> <obo:IAO_0000115>A genomic genotype that does not specify the sex determining chromosomal features of its bearer (i.e. does not indicate the background sex chromosome complement)</obo:IAO_0000115> <obo:IAO_0000116>This modeling approach allows use to create separate genotype instances for data sources that report sex-specific phenotypes to ensure that sex-specific G2P differences are accurately described. These sex-qualified genotypes can be linked to the more general sex-agnostic intrinsic genotype that is shared by make and female mice of the same strain, to aggregate associated phenotypes at this level, and allow aggregation with G2P association data about the same strains from sources that distinguish sex-specific phenotypes (e.g. IMPC) and those that do not (e.g. MGI). Conceptually, a sex-qualified phenotype represents a superset of sequence features relative to a sex-agnostic intirnsic genotype, in that if specifies the background sex-chromosome complement of the genome. Thus, in the genotype partonomy, a sex-qualified genotype has as part a sex-agnostic genotype. This allows for the propagation of phenotypes associated with a sex-qualified genotype to the intrinsic genotype.</obo:IAO_0000116> <obo:IAO_0000118>genotype</obo:IAO_0000118> <obo:IAO_0000118>organismal genotype</obo:IAO_0000118> <obo:IAO_0000118>sex-agnostic intrinsic genotype</obo:IAO_0000118> <rdfs:comment>In practice, most genotype instances classified as sex-agnostic genotypes because they are not sex-specific. When a genotype is indicated to be that of a male or female, it implies a known sex chromosome complement in the genomic background. This requires us to distinguish separate &apos;sex-qualified&apos; genotype instances for males and females that share a common &apos;sex-agnostic&apos; genotype. For example, male and female mice that of the same strain/background and containing the same set of genetic variations will have the same sex-agnostic intrinsic genotype, but different sex-qualified intrinsic genotypes (which take into account background sex chromosome sequence as identifying criteria for genotype instances).</rdfs:comment> <rdfs:label>genomic genotype (sex-agnostic)</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000002 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000002"> <owl:equivalentClass> <owl:Class> <owl:intersectionOf rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000512"/> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/GENO_0000683"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/GENO_0000036"/> </owl:Restriction> </owl:intersectionOf> </owl:Class> </owl:equivalentClass> <rdfs:subClassOf> <owl:Class> <owl:unionOf rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/SO_0001059"/> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/RO_0002524"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/SO_0001059"/> </owl:Restriction> </owl:unionOf> </owl:Class> </rdfs:subClassOf> <obo:IAO_0000115>An allele that varies in it sequence from what is considered the reference or canonical sequence at that locus. Note that what is considered the &apos;reference&apos; vs. &apos;variant&apos; sequence at a given locus may be context-dependent - so being &apos;variant&apos; is more a role played in a particular situation.</obo:IAO_0000115> <obo:IAO_0000116>The use of the descriptor &apos;variant&apos; here is consistent with naming recommendations from the ACMG Guidelines paper here: PMID:25741868. Generally, the descriptive labels chosen for subtypes of variant allele conform these recommendations as well, where &apos;variant&apos; is used to cover mutant and polymorphic alleles.</obo:IAO_0000116> <obo:IAO_0000118>alterante allele</obo:IAO_0000118> <obo:IAO_0000118>sequence-variant feature</obo:IAO_0000118> <obo:IAO_0000118>variant feature</obo:IAO_0000118> <rdfs:comment>1. A &apos;variant allele&apos; contains a &apos;sequence alteration&apos;, or is itself a &apos;sequence alteration&apos;, that makes it vary_with some other allele to which it is being compared. But in any comparison of alternative sequences at a particular genomic location, the choice of a &apos;reference&apos; vs the &apos;variant&apos; is context-dependent - as comparisons in other contexts might consider a different feature to be the reference. So being &apos;variant&apos; is more a role played in a particular situation - as an allele that is variant in one context/analysis may be considered reference in another. GENO classifies a feature as &apos;variant&apos; only in cases where we can be confident that the feature will *always* be considered to be variant with a reference feature. For example, exerimentally induced/generated varaitions in model organism genes that are created expressly to vary from an esablished reference. 2. A variant allele can be variant along its entire extent, in which case it is considered a &apos;sequence alteration&apos;, or it can span a broader extent of sequence contains sequence alteration(s) as part. And example of the former is a SNP, and an example of the latter is a variant gene allele that contains one or more point mutations in its sequence.</rdfs:comment> <rdfs:label>variant allele</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000009 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000009"> <owl:equivalentClass> <owl:Class> <owl:intersectionOf rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000660"/> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/GENO_0000382"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/GENO_0000030"/> </owl:Restriction> </owl:intersectionOf> </owl:Class> </owl:equivalentClass> <obo:IAO_0000115>A sequence collection comprised of all &apos;variant single locus complements&apos; in a single genome, which together constitute the variant component of an intrinsic genotype.</obo:IAO_0000115> <rdfs:comment>1. Note that even a reference feature (e.g. a wild-type gene) that is a member of a single locus complement that contains a variant allele is included in this &apos;genomic variation complement&apos;. Thus, the members of this &apos;genomic variation complement&apos; (which is a sequence collection) are &apos;single locus variant complements&apos;. Our axiom below uses has_part rather than has_member, however, to account for the fact that many &apos;genomic variation complements&apos; have only one &apos;single locus variant complement&apos; as members. So because has_member is not reflexive, it is not appropriate for these cases. 2. Most genotypes have only one altered locus (ie only one &apos;single-locus variant complement&apos;) that distinguish it from some reference background. For example, the genotype instance &apos;fgf8a&lt;t1282a/+&gt;(AB)&apos;) exhibits a mutation at only one locus. But some genotypes vary at more than one locus (e.g. a double mutant that has alterations in the fgf8a gene and the shh gene)).</rdfs:comment> <rdfs:label>genomic variation complement</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000010 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000010"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000914"/> <obo:IAO_0000112>The ZFIN background &apos;AB&apos; that serves as a reference as part of the genotype fgf8a^ti282a/+ (AB)</obo:IAO_0000112> <obo:IAO_0000115>A reference genome that represents the sequence of a genome from which a variant genome is derived (through the introduction of sequence alterations).</obo:IAO_0000115> <obo:IAO_0000116>Here, a &apos;genomic background&apos; would differ form a &apos;reference genome&apos; in that &apos;background&apos; implies a derivation of the variant from the background (which is the case for most MOD strains), whereas a reference is simply meant as a target for comparison. But in a sense all background genomes are by default reference, in that the derived variant genome is compared against it.</obo:IAO_0000116> <obo:IAO_0000118>genomic background</obo:IAO_0000118> <oboInOwl:hasDbXref>OBI:genetic population background information</oboInOwl:hasDbXref> <rdfs:label>background genome</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000014 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000014"> <owl:equivalentClass> <owl:Class> <owl:intersectionOf rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000915"/> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/GENO_0000683"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/SO_0000704"/> </owl:Restriction> </owl:intersectionOf> </owl:Class> </owl:equivalentClass> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/GENO_0000408"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/SO_0000704"/> </owl:Restriction> </rdfs:subClassOf> <obo:IAO_0000112>The reference/wild-type cd99l2 danio rerio gene allele spans bases 27,004,426-27,021,059 on Chromosome 7. The &quot;mn004Gt&quot; represents an experimentally-created allele of this gene, in which sequence from a gene trap construct containing an RFP marker has been inserted at the cd99l2 gene locus. The resulting gene allele includes sequence from this construct that make it longer than the reference gene sequence, and also alter its seqauence in a way that prevents it from producing a functional product. The sequence extent of this cd99l2 gene allele is determined based on how its sequence aligns with that of the canonical gene and surrounding sequence in a reference genome. http://useast.ensembl.org/Danio_rerio/Gene/Summary?g=ENSDARG00000056722 http://zfin.org/action/feature/feature-detail?zdbID=ZDB-ALT-111117-8</obo:IAO_0000112> <obo:IAO_0000115>A genomic feature that represents one of a set of versions of a gene (i.e. a haplotype whose extent is that of a gene)</obo:IAO_0000115> <obo:IAO_0000116>Regarding the distinction between a &apos;gene&apos; and a &apos;gene allele&apos;: Every zebrafish genome contains a &apos;gene allele&apos; for every zebrafish gene. Many will be &apos;wild-type&apos; or at least functional gene alleles. But some may be alleles that are mutated or truncated so as to lack functionality. According to current SO criteria defining genes, a &apos;gene&apos; no longer exists in the case of a non-functional or deleted variant. But the &apos;gene allele&apos; does exist - and its extent is that of the remaining/altered sequence based on alignment with a reference gene. Even for completely deleted genes, an allele of the gene exists (and here is equivalent to the junction corresponding to the where gene would live based on a reference alignment). This design allows us to classify genes and any variants of those genes (be they functional or not) as the same type of thing (ie a &apos;gene allele&apos;), since classification is based on genomic position rather than functional capacity. This is practical for representation of variant genotypes which often carry non-functional versions of a gene at a particular locus. What is important here is specifying what is present at a locus associated with a particular gene, whether or not it is a functional gene or not.</obo:IAO_0000116> <oboInOwl:hasDbXref>http://purl.obolibrary.org/obo/SO_0001023 ! allele</oboInOwl:hasDbXref> <rdfs:comment>In SO, the concept of a &apos;gene&apos; is functionally defined, in that a gene necessarily produces a functional product. By contrast, the concept of a &apos;gene allele&apos; here is positionally defined - representing the sequence present at the location a gene resides in a reference genome (based on sequence alignment). An Shh gene allele, for example, may be a fully functional wild-type version of the gene, a non-functional version carrying a deleterious point mutation, a truncated version of the gene, or even a complete deletion. In all these cases, an &apos;Shh gene allele&apos; exists at the position where the canonical gene resides in the reference genome - even if the extent of this allele different than the wild-type, or even zero in the case of the complete deletion. A genomic feature being an allele_of a gene is based on its location in a host genome - not on its sequence. This means, for example, that the insertion of the human SMN2 gene into the genome of a mouse (see http://www.informatics.jax.org/allele/MGI:3056903) DOES NOT represent an allele_of the human SMN2 gene according to the GENO model - because it is located in a mouse genome, not a human one. Rather, this is a transgenic insertion that derives_sequence_from the human SMN2 gene. If this human SMN2 gene is inserted within the mouse SMN2 gene locus (e.g. used to replace mouse SMN2 gene), the feature it creates is an allele_of the mouse SMN2 gene (one that happens to match the sequence of the human ortholog of the gene). But again, it is not an allele_of the human SMN2 gene.</rdfs:comment> <rdfs:label>gene allele</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000017 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000017"> <owl:equivalentClass> <owl:Class> <owl:intersectionOf rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000702"/> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/RO_0000087"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/GENO_0000152"/> </owl:Restriction> </owl:intersectionOf> </owl:Class> </owl:equivalentClass> <obo:IAO_0000115>A sequence that serves as a standard against which other sequences at the same location are compared.</obo:IAO_0000115> <obo:IAO_0000116>The notion of a &apos;reference&apos; in GENO is implemented at the level of &apos;biological sequence&apos; rather than at the level of a sequence feature - i.e. we define a class for &apos;reference sequence&apos; rather than reference sequence feature&apos;. This is because it is at the *sequence* level that features of interest are determined to be variant or not. It is taken for granted that the *location* of the feature of interest is the same as that of the reference sequence to which it is compared, becasue an alignment process establishing common location always precedes the sequence comparison that determines if the feature is variant.</obo:IAO_0000116> <obo:IAO_0000118>reference sequence</obo:IAO_0000118> <rdfs:comment>A reference sequence is one that serves as a standard against which &apos;variant&apos; versions of the feature are compared, or against which located sequence features within the reference region are aligned in order to assign position information. Being &apos;reference&apos; does not imply anything about the frequency or function of features bearing the sequence. Only that some agent has used it to serve a reference role in defining a variant or locating a sequence.</rdfs:comment> <rdfs:label>reference sequence</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000019 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000019"> <rdfs:subClassOf rdf:resource="http://www.geneontology.org/formats/oboInOwl#ObsoleteClass"/> <owl:disjointWith rdf:resource="http://purl.obolibrary.org/obo/SO_0000110"/> <obo:IAO_0000115>a collection more than one sequence features (ie a collection of discontinuous sequence features)</obo:IAO_0000115> <oboInOwl:hasDbXref>perhaps not same as SO:sequence collection, as here we explicitly include features that can have an extent of zero (and SO:sequence collection is a collection of regions that have an extent of at least one)</oboInOwl:hasDbXref> <rdfs:comment>1. Note that members of this class can be features with extents of zero (e.g. junctions). This is likely different than the SO:sequence feature class which has members that are regions.</rdfs:comment> <rdfs:label>obsolete_sequence feature collection</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000022 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000022"> <rdfs:subClassOf rdf:resource="http://www.geneontology.org/formats/oboInOwl#ObsoleteClass"/> <obo:IAO_0000115>A sequence feature collection comprised of discontiguous sequences from a single genome</obo:IAO_0000115> <obo:IAO_0000116>Previously called &apos;genetic locus collection&apos;. Difference between &apos;genetic&apos; and &apos;genomic&apos;, as used here, is that &apos;genomic&apos; implies a feature is a heritable part of some genome, while &apos;genetic&apos; implies that it is part of some feature that is capable of contributing to gene expression in a cell or other biological system.</obo:IAO_0000116> <obo:IAO_0000118>genomic feature collection</obo:IAO_0000118> <rdfs:comment>Conceptually, members of this collection are meant to be about the sum total genetic material in a single cell or organism. But these members need not be associated with an actual material in a real cell or organism individual. For example, things like a &apos;reference genome&apos; may not actually represent the material genome of any individual cell or organism in reality. Here, there may be no genomic material referents of the sequences in such a collection because the genome is tied to an idealized, hypothetical cell or organism instance. The key is that conceptually, they are still tied to the idea of being contained in a single genome. In the case of a genotype, the individual seqeunce members are not all about the genetic material of a singel cell or organism. Rather, it is the resolved sequence contained in the genotype that is meant to be about the total genomic sequence content of a genome - which we deem acceptable for classifying as a genetic locus collection.</rdfs:comment> <rdfs:label>obsolete_genomic feature collection</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000029 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000029"> <rdfs:subClassOf rdf:resource="http://www.geneontology.org/formats/oboInOwl#ObsoleteClass"/> <obo:IAO_0000115>A single locus complement that serves as a standard against which &apos;variant&apos; sequences are compared</obo:IAO_0000115> <obo:IAO_0000118>reference allelic complement</obo:IAO_0000118> <obo:IAO_0000118>reference single locus feature complement</obo:IAO_0000118> <obo:IAO_0000231>Not required at present for any specific use case, so marking as exploratory and obsoleting for simplicity. Eq Class axiom: &apos;single locus complement&apos; and (has_sequence_attribute some reference) SC axioms: &apos;has member&apos; exactly 0 &apos;variant allele&apos; &apos;has member&apos; only &apos;reference genomic feature&apos; &apos;has member&apos; some &apos;reference genomic feature&apos;</obo:IAO_0000231> <rdfs:label>obsolete_reference single locus complement</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000030 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000030"> <owl:equivalentClass> <owl:Class> <owl:intersectionOf rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000516"/> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/GENO_0000382"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/GENO_0000002"/> </owl:Restriction> </owl:intersectionOf> </owl:Class> </owl:equivalentClass> <obo:IAO_0000115>A single locus complement in which at least one member allele is considered variant, and/or the total number of features in the complement deviates from the normal poloidy of the reference genome (e.g. trisomy 13).</obo:IAO_0000115> <obo:IAO_0000118 xml:lang="en">variant allelic complement</obo:IAO_0000118> <obo:IAO_0000118>variant single locus feature complement</obo:IAO_0000118> <rdfs:comment>Instances of this class are collections comprised of all versions of some defined feature present in a genome (e.g. alleles of a specific gene), where at least one member is variant (non-reference). In diploid genomes this complement is typically the two alleles at the same locus on homologous chromosomes. This class also covers cases where deviant numbers of genes or chromosomes are present in a genome (e.g. trisomy of chromosome 21), even if their sequence is not variant.</rdfs:comment> <rdfs:label>variant single locus complement</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000033 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000033"> <owl:equivalentClass> <owl:Class> <owl:intersectionOf rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/SO_0001026"/> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/GENO_0000683"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/GENO_0000914"/> </owl:Restriction> </owl:intersectionOf> </owl:Class> </owl:equivalentClass> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/GENO_0000382"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/SO_0001059"/> </owl:Restriction> </rdfs:subClassOf> <obo:IAO_0000115>A genome that varies at one or more loci from the sequence of some reference genome.</obo:IAO_0000115> <oboInOwl:hasDbXref>http://purl.obolibrary.org/obo/SO_0001506 ! variant_genome (definition of SO term here is too vague to know if has same meaning as GENO class here)</oboInOwl:hasDbXref> <rdfs:label>variant genome</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000036 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000036"> <owl:equivalentClass> <owl:Class> <owl:intersectionOf rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000512"/> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/RO_0000087"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/GENO_0000152"/> </owl:Restriction> </owl:intersectionOf> </owl:Class> </owl:equivalentClass> <obo:IAO_0000115>An allele whose sequence matches what is consdiered to be the reference sequence at that location in the genome.</obo:IAO_0000115> <rdfs:comment>Being a &apos;reference allele&apos; is a role or status assigned in the context of a specific dataset or analysis. In human variation datasets, &apos;reference&apos; status is typically assigned based on factors such as being the most common in a population, being an ancestral allele, or being indentified first as a prototypical example of some feature or gene. For example, &apos;reference alleles&apos; in characterizing SNPs often represent the allele first characterized in a reference genome, or the most common allele in a population. In model organism datasets, &apos;reference&apos; alleles are typically (but not always) the &apos;wild-type&apos; variant at a given locus, representing a functional and unaltered version of the feature that is part of a defined genomic background, and against which natural or experimentally-induced alterations are compared.</rdfs:comment> <rdfs:label>reference allele</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000037 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000037"> <rdfs:subClassOf rdf:resource="http://www.geneontology.org/formats/oboInOwl#ObsoleteClass"/> <obo:IAO_0000114 rdf:resource="http://purl.obolibrary.org/obo/GENO_0000484"/> <obo:IAO_0000115>A genomic feature known to exist, but remaining uncharacterized with respect to its identity (e.g. which allele exists at a given gene locus).</obo:IAO_0000115> <obo:IAO_0000116>Uses as a term of convenience for describing data reporting unspecified alleles in a genotype (i.e. in cases where zygosoty for a given locus is not known). Typlically recorded in genotype syntaxes as a &apos; /? &apos;.</obo:IAO_0000116> <obo:IAO_0000231>Not required at present for any specific use case, so marking as exploratory and obsoleting for simplicity. Eq Class def: &apos;genomic feature&apos; and (has_sequence_attribute some unspecified)</obo:IAO_0000231> <rdfs:comment>An unspecified feature is known to exist as the partner of a characterized allele when the zygosity at that locus is not known. Its specific sequence/identity, however, is unknown (ie whether it is a reference or variant allele).</rdfs:comment> <rdfs:label>obsolete_unspecified feature</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000042 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000042"> <rdfs:subClassOf rdf:resource="http://www.geneontology.org/formats/oboInOwl#ObsoleteClass"/> <obo:IAO_0000115>A junction found at a chromosomal position where an insertion has occurred on the homologous chromosome, such that the junction represents the reference feature paired with the hemizygously inserted feature.</obo:IAO_0000115> <obo:IAO_0000118>hemizygous reference junction</obo:IAO_0000118> <obo:IAO_0000231>Eliminating unecessary defined/organizational classes. Former logical def: junction and (has_sequence_attribute some reference) Subclass axiom: is_variant_with some insertion</obo:IAO_0000231> <rdfs:comment>In the case of a transgenic insertion that creates a hemizygous locus, the refernce locus that this insertion is variant_with is the junction on the homologous chromosome at the same position where the insertion occurred. This is the &apos;hemizygous reference&apos; junction. The junction-insertion pair represents the allelic complement at that locus, which is considered to be hemizygous. Most genotype syntaxes represent this hemizygous state with a &apos; /0&apos; notation.</rdfs:comment> <rdfs:label>obsolete_reference junction</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000047 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000047"> <owl:equivalentClass> <owl:Class> <owl:intersectionOf rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/SO_0000704"/> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/RO_0002162"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/NCBITaxon_7955"/> </owl:Restriction> </owl:intersectionOf> </owl:Class> </owl:equivalentClass> <obo:IAO_0000115>A gene that originates from the genome of a danio rerio.</obo:IAO_0000115> <rdfs:label>danio rerio gene</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000054 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000054"> <owl:equivalentClass> <owl:Class> <owl:intersectionOf rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/SO_0000704"/> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/RO_0002162"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/NCBITaxon_9606"/> </owl:Restriction> </owl:intersectionOf> </owl:Class> </owl:equivalentClass> <obo:IAO_0000115>A gene that originates from the genome of a homo sapiens.</obo:IAO_0000115> <rdfs:label>homo sapiens gene</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000057 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000057"> <owl:equivalentClass> <owl:Class> <owl:intersectionOf rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/SO_0000704"/> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/RO_0002162"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/NCBITaxon_10090"/> </owl:Restriction> </owl:intersectionOf> </owl:Class> </owl:equivalentClass> <obo:IAO_0000115>A gene that originates from the genome of a mus musculus.</obo:IAO_0000115> <rdfs:label>mus musculus gene</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000060 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000060"> <rdfs:subClassOf rdf:resource="http://www.geneontology.org/formats/oboInOwl#ObsoleteClass"/> <obo:IAO_0000112>A reference human sonic hedgehog (shh) gene spans bases 155,592,680-155,604,967 on Chromosome 7, according to genome build GRCh37, and produces a primary funcitonal transcript that is 4454 bp in length and produces a 462 amino acid protein involved in cell signaling events behind various aspects of cell differentiation and development. http://useast.ensembl.org/Homo_sapiens/Gene/Summary?g=ENSG00000164690 Note that this may be slightly different than the extend described in other gene databases, such as Entrez Gene:http://www.ncbi.nlm.nih.gov/gene/6469</obo:IAO_0000112> <obo:IAO_0000115>A version/allele of a gene that serves as a standard against which variant genes are compared.</obo:IAO_0000115> <obo:IAO_0000118>reference gene</obo:IAO_0000118> <obo:IAO_0000231>Not required at present for any specific use case, so marking as exploratory and obsoleting for simplicity. Eq Class axiom: &apos;gene allele&apos; and (has_sequence_attribute some reference) SC axioms: is_variant_with some &apos;gene allele&apos; is_reference_allele_of some gene</obo:IAO_0000231> <rdfs:comment>Being a &apos;reference gene&apos; is a role or status assigned in the context of a specific dataset or analysis. In human variation datasets, &apos;reference&apos; status is typically assigned based on factors such as being the most common version/allele in a population, being an ancestral allele, or being indentified first as a prototypical example of a gene. In model organism datasets, &apos;reference&apos; genes are typically the &apos;wild-type&apos; allele for a given gene, representing a functional and unaltered version of the gene that is part of a defined genomic background, and against which natural or experimentally-induced versions are compared.</rdfs:comment> <rdfs:label>obsolete_reference gene allele</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000091 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000091"> <rdfs:subClassOf rdf:resource="http://www.geneontology.org/formats/oboInOwl#ObsoleteClass"/> <rdfs:label>obsolete_experimental insertion</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000092 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000092"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_0000667"/> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/RO_0002353"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/GENO_0000172"/> </owl:Restriction> </rdfs:subClassOf> <rdfs:label>gene trap insertion</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000093 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000093"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_0000902"/> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/BFO_0000050"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/SO_0001218"/> </owl:Restriction> </rdfs:subClassOf> <obo:IAO_0000115>A transgene that has been integrated into a chrromosome in the host genome.</obo:IAO_0000115> <rdfs:comment>An integrated transgene differs from a transgenic insertion in that a transgenic insertion may contain single transgene, a partial transgene that needs endognous sequences from the host genome to become functional (e.g. an enhancer trap), or multiple transgenes (i.e. be polycistronic). Fiurthermore, the transgenic insertion may contain sequences in addition to its transgene(s - e.g. sequences flanking the transgene reqired for integration or replicaiton/maintenance in the host genome. The term &apos;integrated transgene&apos; covers individual transgenes that were delivered in whole or in part by a transgenic insertion. An &apos;integrated transgene&apos; differs from its parent &apos;transgene&apos; in that transgenes can include genes introduced into a cell/organism on an extra-chromosomal plasmid that is never integrated into the host genome.</rdfs:comment> <rdfs:label>integrated transgene</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000106 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000106"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000482"/> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/BFO_0000050"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/GENO_0000108"/> </owl:Restriction> </rdfs:subClassOf> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/GENO_0000248"/> <owl:someValuesFrom> <owl:Class> <owl:unionOf rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/CL_0000000"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/NCBITaxon_10239"/> </owl:unionOf> </owl:Class> </owl:someValuesFrom> </owl:Restriction> </rdfs:subClassOf> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/RO_0000091"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/GENO_0000139"/> </owl:Restriction> </rdfs:subClassOf> <obo:IAO_0000114 rdf:resource="http://purl.obolibrary.org/obo/GENO_0000484"/> <obo:IAO_0000115>A nucleic acid macromolecule that is part of a cell or virion and has been inherited from an ancestor cell or virion, and/or is capable of being replicated and inherited through successive generations of progeny.</obo:IAO_0000115> <obo:IAO_0000116>1. Note that at present, a material genome and genetic material are necessarily part of some cell or virion. So a genomic library is not considered a material genome/genomic material - rather, we could say that this genomic library is a &apos;genomic material sample&apos; that bears the concretization of some genome. 2. A challenging edge case is experimentally delivered DNA into a terminally differentiated cell that will never divide. Such material does technically meet our definition - since we are careful to say that the material must be *capable of* being stably inherited through subsequent generations. Thus, we would say that *if* the cell were resume replication, the material would be heritable in this way.</obo:IAO_0000116> <rdfs:comment>1. Genomic material here is considered as a DNA or RNA molecule that is found in a cell or virus, and capable of being replicated and inherited by progeny cells or virus. As such, this nucleic acid is either chromosomal DNA, or some replicative epi-chromosomal plasmid or transposon. Genetic material is necessarily part of some &apos;material genome&apos;, and both are necessarily part of some cell or virion. So a genomic library is not considered a material genome/genetic material - rather, we could say that this genomic library is a &apos;genomic material sample&apos; that bears the concretization of some genome. 2. Genomic material need not be inherited from an immediate ancestor cell or organism (e.g. a replicative plasmid or transposon acquired through some experimental modification), but such cases must be capable of being inherited by progeny cells or organisms.</rdfs:comment> <rdfs:label>genomic material</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000108 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000108"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/BFO_0000040"/> <obo:IAO_0000115>A material entity that represents all genetic material in a cell or virion. The material genome is typically molecular aggregate of all the chromosomal DNA and epi-chromosomal DNA that represents all sequences that are heritable by progeny of a cell or virion.</obo:IAO_0000115> <obo:IAO_0000118>physical genome</obo:IAO_0000118> <rdfs:comment>A genome is the collection of all nucleic acids in a cell or virus, representing all of an organism&apos;s hereditary information. It is typically DNA, but many viruses have RNA genomes. The genome includes both nuclear chromosomes (ie nuclear and micronucleus chromosomes) and cytoplasmic chromosomes stored in various organelles (e.g. mitochondrial or chloroplast chromosomes), and can in addition contain non-chromosomal elements such as replicative viruses, plasmids, and transposable elements. Note that at present, a material genome and genetic material are necessarily part of some cell or virion. So a genomic library is not considered a material genome/genetic material - rather, we could say that this genomic library is a &apos;genomic material sample&apos; that bears the concretization of some SO:genome.</rdfs:comment> <rdfs:label>material genome</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000111 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000111"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/OBI_0000181"/> <obo:IAO_0000115>a population of homo sapiens grouped together in virtue of their sharing some commonality (either an inherent attribute or an externally assigned role)</obo:IAO_0000115> <obo:IAO_0000116>Consider http://semanticscience.org/resource/SIO_001062 ! human population (&quot;A human population refers to a collection of human beings&quot;).</obo:IAO_0000116> <obo:IAO_0000118>homo sapiens population</obo:IAO_0000118> <rdfs:label>human population</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000112 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000112"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000113"/> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/RO_0002162"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/OBI_0100026"/> </owl:Restriction> </rdfs:subClassOf> <obo:IAO_0000115>A maximal collection of organisms of a single species that have been bred or experimentally manipulated with the goal of being genetically identical.</obo:IAO_0000115> <obo:IAO_0000118>organism strain or breed</obo:IAO_0000118> <rdfs:comment>Two mice colonies with the same genotype information, but maintained in different labs, are different strains (many examples of this in MGI/IMSR)</rdfs:comment> <rdfs:label>strain or breed</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000113 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000113"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/PCO_0000000"/> <obo:IAO_0000116>A group comprised of organisms from a single taxonomic group (e.g. family, order, genus, species, or a strain or breed within a given taxon)</obo:IAO_0000116> <rdfs:label>taxonomic group</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000118 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000118"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000112"/> <rdfs:label>mus musculus strain</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000119 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000119"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000112"/> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/RO_0002351"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/NCBITaxon_7955"/> </owl:Restriction> </rdfs:subClassOf> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/RO_0002351"/> <owl:allValuesFrom rdf:resource="http://purl.obolibrary.org/obo/NCBITaxon_7955"/> </owl:Restriction> </rdfs:subClassOf> <rdfs:label>danio rerio strain</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000125 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000125"> <rdfs:subClassOf rdf:resource="http://www.geneontology.org/formats/oboInOwl#ObsoleteClass"/> <obo:IAO_0000115>sequence attribute that can inhere only in a collection of more than one sequence features</obo:IAO_0000115> <rdfs:label>obsolete_sequence feature collection attribute</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000131 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000131"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000886"/> <obo:IAO_0000115>A quality inhering in a collection of discontinuous sequence features in a single genome that reside on the same macromolecule (eg the same chromosomes).</obo:IAO_0000115> <rdfs:label>in cis</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000132 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000132"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000886"/> <obo:IAO_0000115>A quality inhering in a collection of discontinuous sequence features in a single genome that reside on different macromolecules (e.g. different chromosomes).</obo:IAO_0000115> <rdfs:label>in trans</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000133 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000133"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000875"/> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/RO_0000052"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/GENO_0000516"/> </owl:Restriction> </rdfs:subClassOf> <obo:IAO_0000115>An allelic state that describes the degree of similarity of features at a particular locus in the genome (i.e. whether the alleles or haplotypes are the same or different).</obo:IAO_0000115> <obo:IAO_0000118>allelic state</obo:IAO_0000118> <obo:IAO_0000119>derived from https://en.wikipedia.org/wiki/Zygosity</obo:IAO_0000119> <oboInOwl:hasDbXref>http://semanticscience.org/resource/SIO_001263</oboInOwl:hasDbXref> <rdfs:label>zygosity</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000134 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000134"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000391"/> <rdfs:label>hemizygous</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000135 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000135"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000391"/> <rdfs:label>heterozygous</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000136 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000136"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000391"/> <rdfs:label>homozygous</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000137 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000137"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000133"/> <obo:IAO_0000118>indeterminite zygosity</obo:IAO_0000118> <obo:IAO_0000118>no-call zygosity</obo:IAO_0000118> <obo:IAO_0000118>unknown zygosity</obo:IAO_0000118> <rdfs:label>unspecified zygosity</rdfs:label> </owl:Class> <owl:Axiom> <owl:annotatedSource rdf:resource="http://purl.obolibrary.org/obo/GENO_0000137"/> <owl:annotatedProperty rdf:resource="http://purl.obolibrary.org/obo/IAO_0000118"/> <owl:annotatedTarget>indeterminite zygosity</owl:annotatedTarget> <rdfs:comment>MGI uses this term when zygosity is not known.</rdfs:comment> </owl:Axiom> <owl:Axiom> <owl:annotatedSource rdf:resource="http://purl.obolibrary.org/obo/GENO_0000137"/> <owl:annotatedProperty rdf:resource="http://purl.obolibrary.org/obo/IAO_0000118"/> <owl:annotatedTarget>no-call zygosity</owl:annotatedTarget> <rdfs:comment>(this is how the GVF10 format/standard refers to loci without enough data to make an accurate call . . . see http://www.sequenceontology.org/resources/gvf.html#quick_gvf_examples)</rdfs:comment> </owl:Axiom> <!-- http://purl.obolibrary.org/obo/GENO_0000138 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000138"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/BFO_0000016"/> <obo:IAO_0000115>The disposition of an entity to be transmitted to subsequent generations following a genetic replication or organismal reproduction event.</obo:IAO_0000115> <rdfs:comment>We can use these terms to describe the heritability of genetic matieral or sequence features - e.g. chromosomal DNA or genes are heritable in that they are passed on to child cells/organisms). Such genetic material has a heritable disposition in a cell or virion, in virtue of its being replicated in its cellular host and inherited by progeny cells (such that the sequence content it encodes is stably propagated in the genetic material of subsequence generations of cells). We can also use these terms to describe the heritability of phenotypes/conditions - e.g. the passage of a particular trait or disease across generations of reproducing cells/organisms.</rdfs:comment> <rdfs:label>heritabililty</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000139 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000139"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000138"/> <rdfs:label>heritable</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000140 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000140"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000138"/> <rdfs:label>non-heritable</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000141 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000141"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/BFO_0000016"/> <obo:IAO_0000115>The disposition of a genetic variant to cause a particular phenotype or disease based on its allelic state (e.g. heterozygous vs homozygous)</obo:IAO_0000115> <obo:IAO_0000116>Considering alternate definitions: - a disposition related to the phenotypic effect of a particular allele based on its inherited allelic state (i.e., the complement of alleles present at a particular locus) - the disposition of an allele in a particular allelic state (e.g. heterozygouse vs homozygous) to cause a particular phenotype.</obo:IAO_0000116> <obo:IAO_0000118>phenotypic heritability</obo:IAO_0000118> <obo:IAO_0000118>phenotypic inheritance pattern</obo:IAO_0000118> <rdfs:label>condition inheritance</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000142 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000142"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000141"/> <obo:IAO_0000115>disposition inhering in a genetic locus variant that is realized in its inheritance by some offspring such that at least a partial variant-associated phenotype is apparent in heterozygotes</obo:IAO_0000115> <rdfs:label>dominant inheritance</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000143 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000143"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000142"/> <obo:IAO_0000115>A mode of inheritance whereby a heterozygous individual expresses distinct traits or conditions associated with both alleles (e.g. an individual with an AB blood type).</obo:IAO_0000115> <rdfs:comment>Alt: A disposition inhering in a variant of a genetic locus that is realized in an inheritance pattern whereby two different variants are phenotypically expressed in a heterozygous individual (e.g. an individual with an AB blood type)</rdfs:comment> <rdfs:label>co-dominant inheritance</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000144 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000144"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000142"/> <obo:IAO_0000118>pure dominant inheritance</obo:IAO_0000118> <rdfs:label>complete dominant inheritance</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000145 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000145"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000142"/> <obo:IAO_0000115>disposition inhering in a genetic locus variant that is realized in its inheritance by some offspring such that it&apos;s associated phenotype is partially expressed in heterozygotes (ie the observed phenotype is intermediate between that of the two distinct loci)</obo:IAO_0000115> <obo:IAO_0000118>incomplete dominant inheritance</obo:IAO_0000118> <rdfs:label>semi-dominant inheritance</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000146 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000146"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000144"/> <obo:IAO_0000118>X-linked dominant inheritance</obo:IAO_0000118> <rdfs:label>allosomal dominant inheritance</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000147 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000147"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000144"/> <rdfs:label>autosomal dominant iniheritance</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000148 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000148"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000141"/> <obo:IAO_0000115>disposition inhering in a genetic locus variant that is realized in its inheritance by some offspring such that no variant-associated phenotype is apparent in heterozygotes</obo:IAO_0000115> <rdfs:label>recessive inheritance</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000149 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000149"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000148"/> <obo:IAO_0000118>X-linked recessive inheritance</obo:IAO_0000118> <rdfs:label>allosomal recessive inheritance</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000150 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000150"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000148"/> <rdfs:label>autosomal recessive inheritance</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000152 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000152"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000773"/> <obo:IAO_0000115>An attribute inhering in a feature that is designated to serve as a standard against which &apos;variant&apos; versions of the same locus are compared.</obo:IAO_0000115> <rdfs:comment>Being &apos;reference&apos; is a role or status assigned in the context of a data set or analysis framework. A given allele can be reference on one context and variant in another.</rdfs:comment> <rdfs:label>reference</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000160 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000160"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/UBERON_0000105"/> <rdfs:label>unspecified life cycle stage</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000164 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000164"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/OBI_0600043"/> <rdfs:comment>objective is to insert some specified sequence into the genome of a cell or virus</rdfs:comment> <rdfs:label>genetic insertion technique</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000165 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000165"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/OBI_0600043"/> <rdfs:label>mutagen treatment technique</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000166 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000166"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/OBI_0600043"/> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/OBI_0000299"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/GENO_0000515"/> </owl:Restriction> </rdfs:subClassOf> <obo:IAO_0000115>a genetic alteration technique that creates a variant/allele of a known gene - either by prospective targeting of a specific the gene through homologous recombination, or by retrospective sequence analysis to determine the insertion locus of a randomly integrated transgene (e.g. as done in gene trapping).</obo:IAO_0000115> <rdfs:comment>This is represented axiomatically by the requirement that a &apos;gene variant&apos; (ie an allele/variant of a known gene) is the specified_output of this technique. This is contrasted to non-targted/random insertions/alterations where the altered locus is not known, and therefore no variant allele of a gene is created.</rdfs:comment> <rdfs:label>targeted gene mutation technique</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000169 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000169"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000164"/> <rdfs:comment>Is considered to be &apos;non-targeted&apos; in the sense that the insertion occurs randomly and not through homologous recombination.</rdfs:comment> <rdfs:label>random genetic insertion technique</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000170 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000170"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000164"/> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/OBI_0000299"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/GENO_0000515"/> </owl:Restriction> </rdfs:subClassOf> <rdfs:label>targeted genetic insertion technique</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000171 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000171"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000170"/> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/OBI_0000299"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/GENO_0000515"/> </owl:Restriction> </rdfs:subClassOf> <rdfs:label>enhancer trapping technique</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000172 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000172"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000170"/> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/OBI_0000299"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/GENO_0000515"/> </owl:Restriction> </rdfs:subClassOf> <rdfs:label>gene trapping technique</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000173 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000173"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000170"/> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/OBI_0000299"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/GENO_0000515"/> </owl:Restriction> </rdfs:subClassOf> <rdfs:label>promoter trapping technique</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000174 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000174"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000170"/> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/OBI_0000299"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/GENO_0000515"/> </owl:Restriction> </rdfs:subClassOf> <rdfs:label>targeted knock-in technique</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000175 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000175"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000169"/> <rdfs:label>random transgene insertion technique</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000324 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000324"> <rdfs:subClassOf rdf:resource="http://www.geneontology.org/formats/oboInOwl#ObsoleteClass"/> <obo:IAO_0000115>A single locus complement that represents the collection of all chromosome sequences for a given chromosome in a single genome</obo:IAO_0000115> <rdfs:label>obsolete_chromosome complement</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000338 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000338"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000346"/> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/GENO_0000207"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/GENO_0000685"/> </owl:Restriction> </rdfs:subClassOf> <obo:IAO_0000114 rdf:resource="http://purl.obolibrary.org/obo/GENO_0000484"/> <obo:IAO_0000115>A complete chromosome that has been abnormally duplicated in a genome, typically as the result of a meiotic non-disjunction event or unbalanced translocation</obo:IAO_0000115> <obo:IAO_0000118>duplicate chromosome</obo:IAO_0000118> <rdfs:comment>This &apos;gained&apos; chromosome is conceptually an &apos;insertion&apos; in a genome that received two copies of a chromosome in a cell division following a non-disjunction event. As such, it qualifies as a type of sequence_alteration, and as a &apos;extra&apos; chromosome.</rdfs:comment> <rdfs:label>gained aneusomic chromosome</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000339 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000339"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000346"/> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/GENO_0000678"/> <owl:hasValue rdf:datatype="http://www.w3.org/2001/XMLSchema#integer">0</owl:hasValue> </owl:Restriction> </rdfs:subClassOf> <obo:IAO_0000114 rdf:resource="http://purl.obolibrary.org/obo/GENO_0000484"/> <obo:IAO_0000115>A &apos;deletion&apos; resulting from the loss of a complete chromosome, typically as the result of a meiotic non-disjunction event or unbalanced translocation.</obo:IAO_0000115> <obo:IAO_0000116>This &apos;lost&apos; chromosome is conceptually a &apos;deletion&apos; in a genome that received zero copies of a chromosome in a cell division following a non-disjunction event. As such, it qualifies as a type of sequence_alteration. But it doesn&apos;t classify under SO:deletion because this class is defined as &quot;the point at which one or more contiguous nucleotides were excised&quot;.</obo:IAO_0000116> <obo:IAO_0000118>absent aneusomic chromosome</obo:IAO_0000118> <rdfs:label>lost aneusomic chromosome</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000343 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000343"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_0001059"/> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/GENO_0000207"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/GENO_0000513"/> </owl:Restriction> </rdfs:subClassOf> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/GENO_0000248"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/SO_0000340"/> </owl:Restriction> </rdfs:subClassOf> <obo:IAO_0000114 rdf:resource="http://purl.obolibrary.org/obo/GENO_0000484"/> <obo:IAO_0000115>A large deletion or terminal addition of part of some non-homologous chromsosome, as the result of an unbalanced translocation.</obo:IAO_0000115> <obo:IAO_0000116>Novel sequence features gained in a genome are considered to be sequence alterations, including aneusomic chromosome segments gained through unbalanced translocation events, entire aneusomic chromosomes gained through a non-disjunction event during replication, or extrachromosomal replicons that becoome part of the heritable genome of a cell or organism.</obo:IAO_0000116> <obo:IAO_0000118>aneuploid chromosomal segment</obo:IAO_0000118> <obo:IAO_0000118>aneusomic chromosomal subregion/segment</obo:IAO_0000118> <obo:IAO_0000118>partial aneusomic chromosomal element</obo:IAO_0000118> <rdfs:comment>Aneusomic chromosomal parts are examples of &quot;partial aneuploidy&quot; as described in http://en.wikipedia.org/wiki/Aneuploidy: &quot;The terms &quot;partial monosomy&quot; and &quot;partial trisomy&quot; are used to describe an imbalance of genetic material caused by loss or gain of part of a chromosome. In particular, these terms would be used in the situation of an unbalanced translocation, where an individual carries a derivative chromosome formed through the breakage and fusion of two different chromosomes. In this situation, the individual would have three copies of part of one chromosome (two normal copies and the portion that exists on the derivative chromosome) and only one copy of part of the other chromosome involved in the derivative chromosome.&quot;</rdfs:comment> <rdfs:label>aneusomic chromosomal part</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000344 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000344"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000343"/> <obo:IAO_0000114 rdf:resource="http://purl.obolibrary.org/obo/GENO_0000484"/> <obo:IAO_0000115>A part of some non-homologous chromosome that has been gained as the result of an unbalanced translocation event.</obo:IAO_0000115> <obo:IAO_0000118>duplicate partial aneuploid chromosomal element</obo:IAO_0000118> <obo:IAO_0000118>translocated duplicate chromosomal element</obo:IAO_0000118> <obo:IAO_0000118>translocated duplicate chromosomal segment</obo:IAO_0000118> <rdfs:comment>Such additions of translocated chromosomal parts confer a trisomic condition to the duplicated region of the chromsome, and are thus considered to be &apos;variant single locus complements&apos; in virtue of an abnormal number of features at a particular locus, rather than abnormal sequence within the locus.</rdfs:comment> <rdfs:label>gained aneusomic chromosomal segment</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000345 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000345"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000343"/> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/GENO_0000678"/> <owl:hasValue rdf:datatype="http://www.w3.org/2001/XMLSchema#integer">0</owl:hasValue> </owl:Restriction> </rdfs:subClassOf> <obo:IAO_0000114 rdf:resource="http://purl.obolibrary.org/obo/GENO_0000484"/> <obo:IAO_0000115>A deletion of a terminal portion of a chromosome resulting from an unbalanced translocation to another chromosome.</obo:IAO_0000115> <obo:IAO_0000116>In our model, we consider this chromosomal region to be monosomic, and thus a variant single locus complement</obo:IAO_0000116> <obo:IAO_0000118>dropped partial anneuploid chromosomal element</obo:IAO_0000118> <obo:IAO_0000118>translocated absent chromosomal segment</obo:IAO_0000118> <obo:IAO_0000118>truncated chromosome terminus</obo:IAO_0000118> <rdfs:comment>This is not a deletion in the sense defined by the Sequence Ontology in that it is not the result of an &apos;excision&apos; of nucleotides, but an unbalanced translocation event. The allelic complement that results is comprised of the terminus or junction represented by this lost chromosomal segment, and the remaining normal segment in the homologous chromosome. The lost aneusommic chromosomal segment is typically accommpanied by a gained aneusomic chromosomal segment from another chromosome. Loss of translocated chromosomal parts can confer a monosomic condition to a region of the chromsome. This results in a &apos;variant single locus complement&apos; - in virtue of an abnormal number of features at a particular locus, rather than abnormal sequence within the locus.</rdfs:comment> <rdfs:label>lost aneusomic chromosomal segment</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000346 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000346"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_0000340"/> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_0001059"/> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/GENO_0000207"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/GENO_0000513"/> </owl:Restriction> </rdfs:subClassOf> <obo:IAO_0000114 rdf:resource="http://purl.obolibrary.org/obo/GENO_0000484"/> <obo:IAO_0000115>A complete chromosome that has been abnormally duplicated, or the absense of a chromosome that has been lost, typically as the result of a non-disjunction event or unbalanced translocation</obo:IAO_0000115> <obo:IAO_0000118>complete aneusomic chromosome</obo:IAO_0000118> <rdfs:comment>Large sequence features gained in a genome are considered to be sequence alterations (akin to insertions), including aneusomic chromosome segments gained through unbalanced translocation events, entrie aneusomic chromosomes gained through a non-disjunction event during replication, or extrachromosomal replicons that become part of the heritable gneme of a cell or organism. Similarly, large sequence features lost from genome are akin to deletions and therefore also considered sequence alterations. This includes the loss of chromosomal segments through unbalanced translocation events, and the loss of entire chromosomes through a non-disjunction event during replication.</rdfs:comment> <rdfs:label>aneusomic chromosome</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000351 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000351"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/BFO_0000015"/> <obo:IAO_0000116>Stub class to serve as root of hierarchy for imports of biological processes from GO-BP.</obo:IAO_0000116> <rdfs:label>biological process</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000391 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000391"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000133"/> <rdfs:label>disomic zygosity</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000392 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000392"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000133"/> <rdfs:label>aneusomic zygosity</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000393 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000393"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000392"/> <rdfs:label>trisomic homozygous</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000394 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000394"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000392"/> <rdfs:label>trisomic heterozygous</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000402 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000402"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000135"/> <obo:IAO_0000115>A heterozygous quality inhering in a single locus complement comprised of two different varaint alleles and no wild type locus. (e.g.fgf8a&lt;ti282a&gt;/fgf8a&lt;x15&gt;)</obo:IAO_0000115> <obo:IAO_0000118>trans-heterozygous</obo:IAO_0000118> <rdfs:label>compound heterozygous</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000415 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000415"> <rdfs:subClassOf rdf:resource="http://www.geneontology.org/formats/oboInOwl#ObsoleteClass"/> <obo:IAO_0000115>A sequence feature that references some biological macromolecule applied as a reagent in an experiment or technique (e.g. a morpholino expression plasmid, or oligonucleotide probe)</obo:IAO_0000115> <obo:IAO_0000116>replaced with SO:engineered_region</obo:IAO_0000116> <obo:IAO_0000118>extra-genomic sequence</obo:IAO_0000118> <rdfs:label>obsolete_reagent sequence feature</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000458 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000458"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000135"/> <rdfs:comment>a heterozygous quality inhering in a single locus complement comprised of one variant allele and one wild-type/reference allele (e.g.fgf8a&lt;ti282a/+&gt;)</rdfs:comment> <rdfs:label>simple heterozygous</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000460 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000460"> <owl:equivalentClass> <owl:Class> <owl:intersectionOf rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000666"/> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/RO_0002525"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/SO_0000902"/> </owl:Restriction> </owl:intersectionOf> </owl:Class> </owl:equivalentClass> <obo:IAO_0000115>A structurally or functionally defined component of a transgene (e.g. a promoter, a region coding for a fluorescent protein tag, etc)</obo:IAO_0000115> <rdfs:label>transgene part</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000476 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000476"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000773"/> <obo:IAO_0000115>An attribute inhering in a locus that varies from some designated reference in virtue of alterations in its sequence or expression level</obo:IAO_0000115> <rdfs:label xml:lang="en">variant</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000477 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000477"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000773"/> <obo:IAO_0000115>An attribute inhereing in a locus for which there is more than one version fixed in a population at some significant percentage (typically 1% or greater), where the locus is not considered to be either reference or a variant.</obo:IAO_0000115> <rdfs:label xml:lang="en">polymorphic</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000480 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000480"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000773"/> <obo:IAO_0000115>An attribute inhering in a feature bearing a sequence alteration that is present at very low levels in a given population (typically less than 1%), or that has been experimentally generated to alter the feature with respect to some reference sequence.</obo:IAO_0000115> <rdfs:label xml:lang="en">mutant</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000481 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000481"> <owl:equivalentClass> <owl:Class> <owl:intersectionOf rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/SO_0000110"/> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/BFO_0000050"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/SO_0001026"/> </owl:Restriction> </owl:intersectionOf> </owl:Class> </owl:equivalentClass> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/GENO_0000903"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/GENO_0000902"/> </owl:Restriction> </rdfs:subClassOf> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/RO_0002162"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/OBI_0100026"/> </owl:Restriction> </rdfs:subClassOf> <obo:IAO_0000115>A sequence feature (continuous extent of located biological sequence) that is located in the heritable genome of a cell or organism.</obo:IAO_0000115> <obo:IAO_0000116>This class was created largely as a modeling cnvenience to support organizing data for schema definitions. We may consider obsoleting it if it ends up causing confusion or complicating classification of terms in the ontology.</obo:IAO_0000116> <rdfs:comment>1. A genomic feature is a continuous extent of sequence at a particular location in a genome, which can span any size from a complete chromosome, to a chromosomal band or region, to a gene, to a single base pair or even junction between base pairs (this would be a sequence feature with an extent of zero). 2. A feature being &apos;located in&apos; a genome here means only that the abstract sequence they contain can be positioned in the genome of some organism by alignment with some reference genomic sequence. In this way, we can distinguish features that can be associated with a particular taxa and assigned genomic coordinates. 3. As sequence features, instances of genomic features are identified by both their inherent *sequence* and their *position* in a genome - as determined by an alignment with some reference sequence. Accordingly, the &apos;ATG&apos; start codon in the coding DNA sequence of the human AKT gene and the &apos;ATG&apos; start codon in the human SHH gene represent two distinct genomic features despite having he same sequence, in virtue of their different positions in the genome.</rdfs:comment> <rdfs:label xml:lang="en">genomic feature</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000482 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000482"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/CHEBI_33696"/> <obo:IAO_0000114 rdf:resource="http://purl.obolibrary.org/obo/GENO_0000484"/> <obo:IAO_0000115>A nucleic acid molecule that contains one or more sequences serving as a template for gene expression in a biological system (ie a cell or virion).</obo:IAO_0000115> <rdfs:comment>This class is different from genomic material in that genomic material is necessarily heritable, while genetic material includes genomic material, as well as any additional nucleic acids that participate in gene expression resulting in a cellular or organismal phenotype. So things like transiently transfected expression constructs would qualify as &apos;genetic material but not &apos;genomic material&apos;. Things like siRNAs and morpholinos affect gene expression indirectly, (ie are not templates for gene expression), and therefore do not qualify as genetic material.</rdfs:comment> <rdfs:label xml:lang="en">genetic material</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000491 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000491"> <rdfs:subClassOf rdf:resource="http://www.geneontology.org/formats/oboInOwl#ObsoleteClass"/> <obo:IAO_0000114 rdf:resource="http://purl.obolibrary.org/obo/GENO_0000484"/> <obo:IAO_0000115>An allele that is variant with respect to some wild-type allele, in virtue of its being very rare in a population (typically &lt;1%), or being an experimentally-induced alteration that derives from a wild-type feature in a given strain.</obo:IAO_0000115> <obo:IAO_0000119>Based on use of &apos;mutant&apos; as described in PMID: 25741868 ACMG Guidelines</obo:IAO_0000119> <obo:IAO_0000231>Not required for any specific use case at this point so removed for simplicity. Formely asserted as allele and inferred as varaint allele. Eq class definition: allele and (mutation or (&apos;has subsequence&apos; some mutation))</obo:IAO_0000231> <rdfs:comment>&apos;Mutant&apos; is typically contrasted with &apos;wild-type&apos;, where &apos;mutant&apos; indicates a natural but very rare allele in a population (typically &lt;1%), or an experimentally-induced variation that derives from a wild-type background locus for a given strain, which can be selected for in establishing a mutant line.</rdfs:comment> <rdfs:label>obsolete_mutant allele</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000492 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000492"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_0001059"/> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/GENO_0000683"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/GENO_0000501"/> </owl:Restriction> </rdfs:subClassOf> <obo:IAO_0000115>A sequence alteration that is very rare allele in a population (typically &lt;1%), or an experimentally-induced variation that derives from a wild-type feature in a given strain.</obo:IAO_0000115> <rdfs:label xml:lang="en">mutation</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000494 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000494"> <owl:equivalentClass> <owl:Class> <owl:intersectionOf rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000481"/> <owl:Class> <owl:complementOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/GENO_0000248"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/SO_0000340"/> </owl:Restriction> </owl:complementOf> </owl:Class> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/GENO_0000207"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/GENO_0000139"/> </owl:Restriction> </owl:intersectionOf> </owl:Class> </owl:equivalentClass> <obo:IAO_0000115>A genetic feature that is not part of the chromosomal genome of a cell or virion, but rather a stable and heritable element that is replilcated and passed on to progeny (e.g. a replicative plasmid or transposon)</obo:IAO_0000115> <obo:IAO_0000116>Consider replacing with SO_0001038 ! extrachromosomal_mobile_genetic_element</obo:IAO_0000116> <obo:IAO_0000118>episomal replicon</obo:IAO_0000118> <obo:IAO_0000231>Extrachromosomal replicons are replicated and passed on to descendents, and thus part of the heritable genome of a cell or organism. In cases where the presence of such a replicon is novel or aberrant (i.e. not included in the reference for that genome), the replicon is considered a &apos;sequence alteration&apos;.</obo:IAO_0000231> <rdfs:label xml:lang="en">extrachromosomal replicon</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000495 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000495"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000856"/> <obo:IAO_0000118>expression construct feature</obo:IAO_0000118> <rdfs:label xml:lang="en">expression construct</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000497 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000497"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000512"/> <obo:IAO_0000115>An allele that is fixed in a population at some stable level, typically &gt; 1%. Polymorphic alleles reside at loci where more than one version exists at some signifcant frequency in a population.</obo:IAO_0000115> <obo:IAO_0000119>PMID: 25741868 ACMG Guidelines</obo:IAO_0000119> <rdfs:comment>Polymorphic alleles are contrasted with mutant alleles (extremely rare variants that exist in &lt;1% of a population), and &apos;wild-type alleles&apos; (extremenly common variants present in &gt;99% of a population). Polymorphic alleles exist in equilibrium in a given population somewhere between these two extremes (i.e. &gt;1% and &lt;99%).</rdfs:comment> <rdfs:label>polymorphic allele</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000498 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000498"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000497"/> <obo:IAO_0000115>A polymorphic allele that is present at the highest frequency relative to other polymorphic variants at the same locus.</obo:IAO_0000115> <obo:IAO_0000118 xml:lang="en">major allele</obo:IAO_0000118> <rdfs:label>major polymorphic allele</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000499 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000499"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000497"/> <obo:IAO_0000115>A polymorphic allele that is not present at the highest frequency among all fixed variants at the locus (i.e. not the major polymorphic allele at a given locus).</obo:IAO_0000115> <obo:IAO_0000118 xml:lang="en">minor allele</obo:IAO_0000118> <rdfs:label>minor polymorphic allele</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000500 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000500"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000497"/> <obo:IAO_0000115>A polymorphic allele that is determined from the sequence of a recent ancestor in a phylogentic tree.</obo:IAO_0000115> <obo:IAO_0000118 xml:lang="en">ancestral allele</obo:IAO_0000118> <rdfs:label>ancestral polymorphic allele</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000501 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000501"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000512"/> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/GENO_0000683"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/GENO_0000481"/> </owl:Restriction> </rdfs:subClassOf> <obo:IAO_0000115>An allele representing a highly common varaint (typically &gt;99% in a population), that typically exhibits canonical function, and against which rare and/or non-functional mutant alleles are often compared.</obo:IAO_0000115> <obo:IAO_0000118>wild-type allele</obo:IAO_0000118> <rdfs:comment>&apos;Wild-type&apos; is typically contrasted with &apos;mutant&apos;, where &apos;wild-type&apos; indicates a highly prevalent allele in a population (typically &gt;99%), and/or some prototypical allele in a background genome that serves as a basis for some experimental alteration to generate a mutant allele, which can be selected for in establishing a mutant strain. The notion of wild-type alleles is more common in model organism databases, where specific mutations are generated against a wild-type reference feature. Wild-type alleles are typically but not always used as reference alleles in sequence comparison/analysis applications. More than one wild-type sequence can exist for a given feature, but typically only one allele is deemed wild-type iin the context of a single dataset or analysis.</rdfs:comment> <rdfs:label>wild-type allele</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000502 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000502"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000501"/> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_0000704"/> <obo:IAO_0000118 xml:lang="en">wild-type gene allele</obo:IAO_0000118> <rdfs:comment>A gene allele representing the most common varaint in a population (typically &gt;99% frequency), that exhibits canonical function, and against which rare and/or non-functional mutant gene alleles are compared in characterizing the phenotypic consequences of genetic variation.</rdfs:comment> <rdfs:label>wild-type gene</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000504 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000504"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000529"/> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/GENO_0000231"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/GENO_0000534"/> </owl:Restriction> </rdfs:subClassOf> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/GENO_0000447"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/GENO_0000533"/> </owl:Restriction> </rdfs:subClassOf> <obo:IAO_0000115>A gene altered in its expression level in the context of some experiment as a result of being targeted by gene-knockdown reagent(s) such as a morpholino or RNAi.</obo:IAO_0000115> <rdfs:comment>The identity of a given instance of a reagent-targeted gene is dependent on the experimental context of its knock-down - specifically what reagent was used and at what level. For example, the wild-type shha zebrafish gene targeted in epxeriment 1 by morpholino1 annd in experiment 2 by morpholino 2 represent two distinct instances of a &apos;reagent-targeted gene&apos;, despite sharing the same sequence and position.</rdfs:comment> <rdfs:label xml:lang="en">reagent targeted gene</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000506 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000506"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000529"/> <obo:IAO_0000115>A transgene that is delivered as part of a DNA expression construct into a cell or organism in order to transiently express a specified product (i.e. it has not integrated into the host genome).</obo:IAO_0000115> <obo:IAO_0000118>experimentally-expressed transgene</obo:IAO_0000118> <obo:IAO_0000118 xml:lang="en">extrinsic transgene</obo:IAO_0000118> <rdfs:label>transiently-expressed transgene</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000511 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000511"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000773"/> <obo:IAO_0000115>An allele attribute describing a highly common variant (typically &gt;99% in a population), that typically exhibits canonical function, and against which rare and/or non-functional mutant alleles are compared.</obo:IAO_0000115> <rdfs:label xml:lang="en">wild-type</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000512 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000512"> <owl:equivalentClass> <owl:Class> <owl:intersectionOf rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000481"/> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/GENO_0000683"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/GENO_0000481"/> </owl:Restriction> </owl:intersectionOf> </owl:Class> </owl:equivalentClass> <obo:IAO_0000115>One of a set of sequence features that exist at a particular genomic locus.</obo:IAO_0000115> <obo:IAO_0000116>The notion of an &apos;allele&apos; defined here is distinct from that of a genetic &apos;variant&apos; - as &apos;allele&apos; includes features considered to be the &apos;reference&apos; at a particular locus. The notion of an &apos;allele&apos; captures the state of the sequence found at a genetic locus, be it variant or reference. The notion of a &apos;variant&apos; implies a state that differs from some &apos;reference&apos; sequence at that location. What is considered the &apos;reference&apos; state at a particular locus may vary, depending on the context/goal of a particular analysis.</obo:IAO_0000116> <obo:IAO_0000118 xml:lang="en">variable feature</obo:IAO_0000118> <rdfs:comment>An allele is a continuous extent of genomic sequence that spans a locus where variation is known to occur (i.e. where &gt;1 version is known to exist). The minimal extent of an allele is the variable sequence itself (i.e. a &apos;sequence alteration&apos;), but the notion of an allele includes larger regions that contain as proper parts one or more such alterations (e.g. a &apos;haplotype&apos;). Our landsacpe analysis found mostly gene-centric definitions of &apos;allele&apos; that represented a particular version of a gene, or variation within a gene sequence [1][2][3][4][5][6]. But we also found &apos;allele&apos; used to refer to other types and extents of variation - including single nucleotide polymorphisms, repeat regions, and copy number variations [7][8][9][10][11]. where such variations don&apos;t neccessarily impact a gene. To be maximally accommodating of how this term is used across research communities, GENO defines &apos;allele&apos; broadly and allow alleles can span any locus or extent of sequence. While &apos;alleles&apos; encountered in public datases typically overlap a gene, GENO allows for alleles that do not. But we do define the subtype &apos;gene allele&apos; that refers more specifically to a particular version of a gene. [1] https://isogg.org/wiki/Allele (retrieved 2018-03-17) [2] http://semanticscience.org/resource/allele (retrieved 2018-03-17) [3] https://en.wikipedia.org/wiki/Allele (retrieved 2018-03-17) [4] https://www.cancer.gov/publications/dictionaries/genetics-dictionary/def/allele (retrieved 2018-03-17) [5] http://purl.obolibrary.org/obo/SO_0001023 (retrieved 2018-03-17) [6] http://purl.obolibrary.org/obo/NCIT_C16277 (retrieved 2018-03-17) [7] https://www.snpedia.com/index.php/Allele (retrieved 2018-03-17) [8] https://en.wikipedia.org/wiki/Single-nucleotide_polymorphism (retrieved 2018-03-17) [9] http://purl.obolibrary.org/obo/OGI_0000008 (retrieved 2018-03-17) [10] http://purl.obolibrary.org/obo/OBI_0001352 (retrieved 2018-03-17) [11] http://purl.phyloviz.net/ontology/typon#Allele (retrieved 2018-03-17)</rdfs:comment> <rdfs:label>allele</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000513 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000513"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000773"/> <obo:IAO_0000114 rdf:resource="http://purl.obolibrary.org/obo/GENO_0000484"/> <obo:IAO_0000115>a sequence attribute of a chromosome or chromosomal region that has been abnormally duplicated or lost, as the result of a non-disjunction event or unbalanced translocation.</obo:IAO_0000115> <rdfs:label xml:lang="en">aneusomic</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000515 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000515"> <owl:equivalentClass> <owl:Class> <owl:intersectionOf rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000014"/> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/GENO_0000683"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/GENO_0000036"/> </owl:Restriction> </owl:intersectionOf> </owl:Class> </owl:equivalentClass> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/GENO_0000382"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/SO_0001059"/> </owl:Restriction> </rdfs:subClassOf> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/GENO_0000641"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/SO_0000704"/> </owl:Restriction> </rdfs:subClassOf> <obo:IAO_0000115>An allele of a gene that contains some sequence alteration.</obo:IAO_0000115> <rdfs:comment>A gene allele is &apos;variant&apos; in virtue of its containing a sequence alteration that varies from some reference gene standard. But note that a gene allele that is variant in one context/dataset can be considered a reference in another context/dataset.</rdfs:comment> <rdfs:label>variant gene allele</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000516 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000516"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000660"/> <obo:IAO_0000112>The set of both shha gene alleles in a diiploid zebrafish genome, e.g. fgf8a&lt;ti282a/+&gt;. The collection of the individual base-pairs present at the position 24126737 in both copies of chromosome 5 in a diploid human genome.</obo:IAO_0000112> <obo:IAO_0000115>The set of all sequence features occupying a particular genomic location across all homologous chromosomes in a genome.</obo:IAO_0000115> <obo:IAO_0000116>TO DO: show a VCF representation of this example.</obo:IAO_0000116> <obo:IAO_0000118>allelic complement</obo:IAO_0000118> <obo:IAO_0000118>single locus feature complement</obo:IAO_0000118> <rdfs:comment>- A genomic feature is any located feature in the genome, be it a junction, a single nucleotide, a gene, or an entire chromosome. - The notion of a &quot;complement&quot; describes the collection of all elements in some defined set. - The notion of &quot;homologous&quot; genomic features describes those that occupy the same locus on homologous chromosomes. - Therefore, we use the term &quot;single locus complement&quot; to describe the set of all homologous features present at a particular genomic locus. - This complement is typically a pair of two features in a diploid genome (with two copies of each chromosome). E.g. a gene pair, a QTL pair, a nucleotide pair for a SNP, or a pair of entire chromosomes.</rdfs:comment> <rdfs:label>single locus complement</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000524 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000524"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000536"/> <obo:IAO_0000112>In an experiment where shha is targeted by MO1 and shhb is overexpressed from a transgenic expression construct, the extrinsic genotype captures the altered expression status of these two genes. A notation for representing such a genotype might describe this scenario as: shha&lt;MO1-1ng/ul&gt;; shhb&lt;pFLAG-mmusShhb&gt; This notation parallels those used for more traditional &apos;intrinsic&apos; genotypes, where the affected gene is presented with its alteration in angled brackets &lt; &gt;. In the extrinsic genotype shown here, the variation in shha is affected by a specific concentration of an shha-targeting morpholino (instead of a mutation in the shha gene). And the variation in shhb is affected by its overexpression from a pFLAG Shhb expression construct.</obo:IAO_0000112> <obo:IAO_0000115>A specification of the known state of gene expression across a genome, and how it varies from some baseline/reference state.</obo:IAO_0000115> <obo:IAO_0000116>We acknowledge that this is not a &apos;genotype&apos; in the traditional sense, but this terminological choice highlights similarities that play out in parallel modeling of intrinsic and extrinsic genotype partonomies, and parallel syntactic formats for labeling instances of these genotypes. Our rationale here is that what we care about from perspective of G2P associations is identifying genomic features that impact phenotype - where experimental approaches include permanent introduction of intrinsic modifications to genomic sequence, and transient introduction of extrinsic factors that modify expression of specific genes. As the former is described by the traditional notion of a genotype, it seems a rational leap to consider the latter akin to an &apos;extrinsic genotype&apos; wherein the alterations are externally applied rather than inherent to the genome. Finally, there is some precedent to thinking about such extrinsic modifications in terms of a genotype, in the EFO:0000513 ! genotype: &quot;The total sum of the genetic information of an organism that is known and relevant to the experiment being performed, including chromosomal, plasmid, viral or other genetic material which has been introduced into the organism either prior to or during the experiment.&quot;</obo:IAO_0000116> <obo:IAO_0000118>experimental genotype</obo:IAO_0000118> <obo:IAO_0000118>expression genotype</obo:IAO_0000118> <rdfs:comment>An extrinsic genotype describes variation in the &apos;expression level&apos; of genes in a cell or organism, as mediated by transient, gene-specific experimental interventions such as RNAi, morpholinos, TALENS CRISPR, or construct overexpression. This concept is relevant primarily for model organisms and systems that are subjected to such interventions to determine how altered expression of specific genes may impact organismal or cellular phenotypes in the context of a particular experiment. The &apos;extrinsic genotype&apos; concept is contrasted with the more familiar notion of an &apos;intrinsic genotype&apos;, describing variation in the inherent genomic sequence (i.e. &apos;allelic state&apos;). In G2P research, interventions affecting both genomic sequence and gene expression are commonly applied in order to assess the impact specific genomic features can have on phenotype and disease. It is in this context that we chose to model &apos;extrinsic&apos; alterations in expression as genotypes - to support parallel conceptualization and representation of these different types of genetic variation that inform the discovery of G2P associations.</rdfs:comment> <rdfs:label xml:lang="en">extrinsic genotype</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000525 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000525"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000536"/> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/BFO_0000051"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/GENO_0000524"/> </owl:Restriction> </rdfs:subClassOf> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/BFO_0000051"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/GENO_0000719"/> </owl:Restriction> </rdfs:subClassOf> <obo:IAO_0000115>A genotype that describes the total intrinsic and extrinsic variation across a genome at the time of a phenotypic assessment (where &apos;intrinsic&apos; refers to variation in genomic sequence, as mediated by sequence alterations, and &apos;extrinsic&apos; refers to variation in gene expression, as mediated through transient gene-specific interventions such as gene knockdown reagents or overexpression constructs).</obo:IAO_0000115> <obo:IAO_0000116>Closest concept/definition we could find for this concept was for EFO:0000513 ! genotype: &quot;The total sum of the genetic information of an organism that is known and relevant to the experiment being performed, including chromosomal, plasmid, viral or other genetic material which has been introduced into the organism either prior to or during the experiment.&quot;</obo:IAO_0000116> <rdfs:comment>An effective genotype is meant to summarize all factors related to genes and their expression that influence an observed phenotype - including &apos;intrinsic&apos; alterations in genomic sequence, and gene-specific &apos;extrinsic&apos; alterations in expression transiently introduced at the time of the phenotypic assessment.</rdfs:comment> <rdfs:label xml:lang="en">effective genotype</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000527 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000527"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000715"/> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/RO_0002351"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/GENO_0000504"/> </owl:Restriction> </rdfs:subClassOf> <obo:IAO_0000115>A set of all targeted genes in a single genome in the context of a given experiment (e.g. both copies of the WT shha gene in a zebrafish exposed to shha-targeting morpholinos)</obo:IAO_0000115> <obo:IAO_0000118>reagent-targeted gene complement</obo:IAO_0000118> <rdfs:label xml:lang="en">reagent-targeted gene complement</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000528 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000528"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000715"/> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/GENO_0000382"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/GENO_0000506"/> </owl:Restriction> </rdfs:subClassOf> <obo:IAO_0000115>The set of all transgenes trransiently expressed in a biological system in the context of a given experiment.</obo:IAO_0000115> <obo:IAO_0000118 xml:lang="en">experimental transgene complement</obo:IAO_0000118> <rdfs:label>transiently-expressed transgene complement</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000529 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000529"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000737"/> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/GENO_0000443"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/SO_0000704"/> </owl:Restriction> </rdfs:subClassOf> <obo:IAO_0000112>Consider wild-type zebrafish shha gene in the context of being targeted by morpholino1 vs morpholino 2 in separate experiments. These shha genes share identical sequence and position, but represent distinct instances of a &apos;expression-variant genes&apos; because of their different external context. This is important because these qualified features could have distinct phenotypes associated with them (just as two different sequence variants of the same gene can have potentially different associated phenotypes).</obo:IAO_0000112> <obo:IAO_0000115>A gene altered in its expression level relative to some baseline of normal expression in the system under investigation (e.g. a cell line or model organism).</obo:IAO_0000115> <obo:IAO_0000116>See SO classes under &apos;silenced gene&apos; (e.g. &apos;gene silenced by RNA interference&apos;). These seem to represent the concept of a qualified feature as I define it here, in that they are defined by alterations extrinsic to the sequence and position of the gene itself.</obo:IAO_0000116> <obo:IAO_0000118>expression allele</obo:IAO_0000118> <rdfs:comment>Expression-variant genes are altered in their expression level through some modification or intervention external to its sequence and position. These may include endogenous mechanisms (e.g. direct epigentic modification that impact expression level, or altered regulatory networks controlling gene expression), or experimental interventions (e.g. targeting by a gene-knockdown reagent, or being transiently expressed as part of a transgenic construct in a host cell or organism). The identity of a given instance of a experssion-variant gene is dependent on how its level of expression is manipulated in a biological system (i.e. via targeting by gene-knockdown reagents, or being transiently overexpressed). So expression-variant genes have the additional identity criteria of a genetic context of its material bearer (external to its sequence and position) that impacts its level of expression in a biological system.</rdfs:comment> <rdfs:label xml:lang="en">expression-variant gene</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000533 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000533"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_0000804"/> <obo:IAO_0000118>gene targeting reagent</obo:IAO_0000118> <obo:IAO_0000118>sequence targeting reagent</obo:IAO_0000118> <rdfs:label xml:lang="en">gene knockdown reagent</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000534 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000534"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000737"/> <obo:IAO_0000115>A region within a gene that is specifically targeted by a gene knockdown reagent, typically in virtue of bearing sequence complementary to the reagent.</obo:IAO_0000115> <obo:IAO_0000118 xml:lang="en">targeted gene segment</obo:IAO_0000118> <rdfs:label>reagent-targeted gene subregion</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000536 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000536"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/IAO_0000030"/> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/IAO_0000219"/> <owl:someValuesFrom> <owl:Class> <owl:unionOf rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000660"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000715"/> </owl:unionOf> </owl:Class> </owl:someValuesFrom> </owl:Restriction> </rdfs:subClassOf> <obo:IAO_0000115>A specification of the genetic state of an organism, whether complete (defined over the whole genome) or incomplete (defined over a subset of the genome). Genotypes typically describe this genetic state as a diff between some variant component and a canonical reference.</obo:IAO_0000115> <obo:IAO_0000116>As information artifacts, genotypes specify the state of a genome be defining a diff between some canonical reference and a variant or alternate sequence that replaces the corresponding portion of the reference. We can consider a genotype then as a collection of these reference and variant features, along with some rule for operating on them and resolve a final single sequence. This is valid ontologically because we commit only to sequence features being GDCs - which allows for their concretization in either biological or informational patterns. Accordingly, a particular gene allele, such as shh&lt;tbx292&gt;, can be part of a genome in a biological sense and part of a genotype in an informational sense. This idea underpins the &apos;genotype partonomy&apos; at the core of the GENO model that decomposes a complete genotype into its more fundamental parts, including alleles and allele complements, as described in the comment above.</obo:IAO_0000116> <obo:IAO_0000119>Core definition above adapted from the GA4GH VMC data model definition here: https://docs.google.com/document/d/12E8WbQlvfZWk5NrxwLytmympPby6vsv60RxCeD5wc1E/edit#heading=h.4e32jj4jtmsl (retrieved 2018-04-09). Note however that the VMC genotype concept likely is not intended to cover &apos;effective&apos; and &apos;extrinsic&apos; genotype concepts defined in GENO.</obo:IAO_0000119> <rdfs:comment>1. Scope of &apos;Genetic State&apos;: &apos;Genetic state&apos; is considered quite broadly in GENO to describe two general kinds of &apos;states&apos;. First, is traditional notion of &apos;allelic state&apos; - defined as the complement of alleles present at a particular locus ofr loci in a genome (i.e. across all homologous chromosomes containing this locus). Here, a genotype can describe allelic state at a specific locus in a genome (an &apos;allelic genotype&apos;), or describe the allelic state across the entire genome (&apos;genomic genotype&apos;). Second, this concept can also describe states of genomic features &apos;extrinsic&apos; to their intrinsic sequence, such as the expression status of a gene as a result of being specifically targeted by experimental interventions such as RNAi, morpholinos, or CRISPRs. 2. Genotype Subtypes: In GENO, we use the term &apos;intrinsic&apos; for genotypes describing variation in genomic sequence, and &apos;extrinsic&apos; for genotypes describing variation in gene expression (e.g. resulting from the targeted experimental knock-down or over-expression of endogenous genes). We use the term &apos;effective genotype&apos; to describe the total intrinsic and extrinsic variation in a cell or organism at the time a phenotypic assessment is performed. Two more precise conccepts are subsumed by the notion of an &apos;intrinsic genotype&apos;: (1) &apos;allelic genotypes&apos;, which specify allelic state at a single genomic locus; and (2) &apos;genomic genotypes&apos;, which specify allelic state across an entire genome. In both cases, allelic state is typically specified in terms of a differential between a reference and a set of 1 or more known variant features. 3. The Genotype Partonomy: &apos;Genomic genotypes&apos; describing sequence variation across an entire genome are &apos;decomposed&apos; in GENO into a partonomy of more granular levels of variation. These levels are defined to be meaningful to biologists in their attempts to relate genetic variation to phenotypic features. They include &apos;genomic variation complement&apos; (GVC), &apos;variant single locus complement&apos; (VSLC), &apos;allele&apos;, &apos;haplotype&apos;, &apos;sequence alteration&apos;, and &apos;genomic background&apos; classes. For example, the components of the zebrafish genotype &quot;fgf8a&lt;ti282a/ti282a&gt;; fgf3&lt;t24149/+&gt;[AB]&quot;, described at zfin.org/ZDB-FISH-150901-9362, include the following elements: - GVC: fgf8a&lt;ti282a/ti282a&gt;; fgf3&lt;t24149/+&gt; (total intrinsic variation in the genome) - Genomic Background: AB (the reference against which the GVC is variant) - VSLC1: fgf8a&lt;ti282a/ti282a&gt; (homozygous complement of gene alleles at one known variant locus) - VSLC2: fgf3&lt;t24149/+&gt; (heterozygous complement of gene alleles at another known variant locus) - Allele 1: fgf8a&lt;ti282a&gt; (variant version of the fgf8a gene, present in two copies) - Allele 2: fgf3&lt;t24149&gt; (variant version of the fgf3 gene, present in one copy) - Allele 3: fgf3&lt;+&gt; (wild-type version of the fgf3 gene, present in one copy) - Sequence Alteration1: &lt;ti282a&gt; (the specific mutation within the fgf8a gene that makes it variant) - Sequence Alteration2: &lt;t24149&gt; (the specific mutation within the fgf3 gene that makes it variant) A graphical representation of this decomposition that maps each element to a visual depiction of the portion of a genome it denotes can be found here: https://github.com/monarch-initiative/GENO-ontology/blob/develop/README.md One reason that explicit representation of these levels is important is because it is at these levels that phenotypic features are annotated to genetic variations in different clinical and model organism databases For example, ZFIN typically annotates phenotypes to effective genotypes, MGI to intrinsic genotypes, Wormbase to variant alleles, and ClinVar to haplotypes and sequence alterations. The ability to decompose a genotype into representations at these levels allows us to &quot;propagate phenotypes&quot; up or down the partonomy (e.g. infer associations of phenotypes annotated to a genotype to its more granular levels of variation and the gene(s) affected). This helps to supporting integrated analysis of G2P data.</rdfs:comment> <rdfs:label xml:lang="en">genotype</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000575 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000575"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/UPHENO_0001001"/> <rdfs:comment>ZFIN do not annotate with a pre-composed phenotype ontology - all annotations compose phenotypes on-the-fly using a combination of PATO, ZFA, GO and other ontologies. So while there is no manually curated zebrafish phenotype ontology, the Upheno pipeline generates one automatically here: http://purl.obolibrary.org/obo/upheno/zp.owl This ontology does not have a root &apos;phenotype&apos; class, however, and so we generate our own in GENO as a stub placeholder for import of needed zebrafish phenotype classes.</rdfs:comment> <rdfs:label>zebrafish phenotype</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000602 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000602"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000875"/> <obo:IAO_0000115>an allelic state where a single allele exists at a particular locus in the organellar genome (mitochondrial or plastid) of a cell/organism.</obo:IAO_0000115> <rdfs:label xml:lang="en">homoplasmic</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000603 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000603"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000875"/> <obo:IAO_0000115>an allelic state where more than one type of allele exists at a particular locus in the organellar genome (mitochondrial or plastid) of a cell/organism.</obo:IAO_0000115> <rdfs:label xml:lang="en">heteroplasmic</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000604 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000604"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000134"/> <rdfs:label xml:lang="en">hemizygous X-linked</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000605 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000605"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000134"/> <rdfs:label xml:lang="en">hemizygous Y-linked</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000606 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000606"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000134"/> <rdfs:label xml:lang="en">hemizygous insertion-linked</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000611 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000611"> <owl:equivalentClass> <owl:Class> <owl:intersectionOf rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000899"/> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/RO_0000087"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/GENO_0000152"/> </owl:Restriction> </owl:intersectionOf> </owl:Class> </owl:equivalentClass> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/IAO_0000219"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/GENO_0000010"/> </owl:Restriction> </rdfs:subClassOf> <obo:IAO_0000115>A genomic genotype that specifies the baseline sequence of a genome from which a variant genome is derived (through the introduction of sequence alterations).</obo:IAO_0000115> <obo:IAO_0000116>Being a &apos;background genotype&apos; implies the derivation of some variant from this background (which is the case for most model organism database genotypes/strains). This is a subtly different notion than being a &apos;reference genotype&apos; , which can be any genotype that serves as a basis for comparison. But in a sense all background genotypes are by default reference genotypes, in that the derived variant genotype is compared against it.</obo:IAO_0000116> <obo:IAO_0000118>reference genotype</obo:IAO_0000118> <rdfs:label xml:lang="en">background genotype</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000614 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000614"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_0000830"/> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/BFO_0000050"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/SO_0000105"/> </owl:Restriction> </rdfs:subClassOf> <obo:IAO_0000112>The descriptor 1p22.3 = chromosome 1, short arm, region 2, band 2, sub-band 3. This is read as &quot;one q two-two point three&quot;, not &quot;one q twenty-two point three&quot;.</obo:IAO_0000112> <obo:IAO_0000115>An extended part of a chromosome representing a term of convenience in order to hierarchically organize morphologically defined chromosome features: chromosome &gt; arm &gt; region &gt; band &gt; sub-band.</obo:IAO_0000115> <obo:IAO_0000116>New term request for SO.</obo:IAO_0000116> <obo:IAO_0000119>http://ghr.nlm.nih.gov/handbook/howgeneswork/genelocation and http://people.rit.edu/rhrsbi/GeneticsPages/Handouts/ChromosomeNomenclature.pdf, both of which define the nomenclature for the banding hierarchy we use here: chromosome &gt; arm &gt; region &gt; band &gt; sub-band Note that an alternate nomenclature for this hierarchy is here (http://www.ncbi.nlm.nih.gov/Class/MLACourse/Original8Hour/Genetics/chrombanding.html): chromosome &gt; arm &gt; band &gt; sub-band &gt; sub-sub-band</obo:IAO_0000119> <rdfs:label xml:lang="en">chromosomal region</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000616 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000616"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_0000830"/> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/BFO_0000050"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/SO_0000341"/> </owl:Restriction> </rdfs:subClassOf> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/GENO_0000207"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/GENO_0000618"/> </owl:Restriction> </rdfs:subClassOf> <obo:IAO_0000112>The descriptor 1p22.3 = chromosome 1, short arm, region 2, band 2, sub-band 3. This is read as &quot;one q two-two point three&quot;, not &quot;one q twenty-two point three&quot;.</obo:IAO_0000112> <obo:IAO_0000119>http://ghr.nlm.nih.gov/handbook/howgeneswork/genelocation and http://people.rit.edu/rhrsbi/GeneticsPages/Handouts/ChromosomeNomenclature.pdf, both of which define the nomenclature for the banding hierarchy we use here: chromosome &gt; arm &gt; region &gt; band &gt; sub-band Note that an alternate nomenclature for this hierarchy is here (http://www.ncbi.nlm.nih.gov/Class/MLACourse/Original8Hour/Genetics/chrombanding.html): chromosome &gt; arm &gt; band &gt; sub-band &gt; sub-sub-band</obo:IAO_0000119> <rdfs:label xml:lang="en">chromosome sub-band</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000618 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000618"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000788"/> <obo:IAO_0000118>chromosomal band brightness</obo:IAO_0000118> <rdfs:label xml:lang="en">chromosomal band intensity</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000619 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000619"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000618"/> <rdfs:label xml:lang="en">gpos</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000620 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000620"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000618"/> <rdfs:label xml:lang="en">gneg</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000621 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000621"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000618"/> <rdfs:label xml:lang="en">gvar</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000622 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000622"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000619"/> <rdfs:label xml:lang="en">gpos100</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000623 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000623"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000619"/> <rdfs:label xml:lang="en">gpos75</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000624 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000624"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000619"/> <rdfs:label xml:lang="en">gpos50</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000625 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000625"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000619"/> <rdfs:label xml:lang="en">gpos25</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000628 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000628"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_0000105"/> <obo:IAO_0000115>A chromosome arm that is the shorter of the two arms of a given chromosome.</obo:IAO_0000115> <obo:IAO_0000118>p-arm</obo:IAO_0000118> <obo:IAO_0000118>stalk</obo:IAO_0000118> <rdfs:label xml:lang="en">short chromosome arm</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000629 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000629"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_0000105"/> <obo:IAO_0000115>A chromosome arm that is the longer of the two arms of a given chromosome.</obo:IAO_0000115> <obo:IAO_0000118>q-arm</obo:IAO_0000118> <rdfs:label xml:lang="en">long chromosome arm</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000632 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000632"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000619"/> <rdfs:label>gpos66</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000633 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000633"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000619"/> <rdfs:label>gpos33</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000637 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000637"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_0005836"/> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/RO_0002525"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/SO_0000902"/> </owl:Restriction> </rdfs:subClassOf> <obo:IAO_0000115>A transgene part whose sequence regulates the synthesis of a functional product, but which is not itself transcribed.</obo:IAO_0000115> <rdfs:label xml:lang="en">regulatory transgene region</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000638 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000638"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000460"/> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/RO_0002525"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/SO_0000902"/> </owl:Restriction> </rdfs:subClassOf> <obo:IAO_0000115>A transgene part whose sequence is expressed in a gene product through transcription and/or translation.</obo:IAO_0000115> <obo:IAO_0000118>coding transgene feature</obo:IAO_0000118> <rdfs:label xml:lang="en">expressed transgene region</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000640 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000640"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000638"/> <rdfs:label xml:lang="en">reporter region</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000642 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000642"> <owl:equivalentClass> <owl:Class> <owl:intersectionOf rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/SO_0000902"/> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/RO_0000087"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/GENO_0000911"/> </owl:Restriction> </owl:intersectionOf> </owl:Class> </owl:equivalentClass> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/GENO_0000207"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/SO_0000783"/> </owl:Restriction> </rdfs:subClassOf> <obo:IAO_0000115>A transgene whose product is used as a selectable marker.</obo:IAO_0000115> <rdfs:label xml:lang="en">selectable marker transgene</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000644 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000644"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000899"/> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/IAO_0000219"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/SO_0001026"/> </owl:Restriction> </rdfs:subClassOf> <obo:IAO_0000115>A genotype that describes what is known about variation in a genome at a gross structural level, in terms of the number and appearance of chromosomes in the nucleus of a eukaryootic cell.</obo:IAO_0000115> <obo:IAO_0000119>Derived from http://en.wikipedia.org/wiki/Karyotype (accessed 2017-03-28)</obo:IAO_0000119> <rdfs:comment>Karyotypes describe structural variation across a genome at the level of chromosomal morphology and banding patterns detectable in stained chromosomal spreads. This coarser level does not capture more granular levels of variation commonly represented in other forms of genotypes (e.g. specific alleles and sequence alterations). A base karyotype representing a genome with no known structural variation can be as simple as &apos;46XY&apos;, but karyotypes typically contains some gross variant component (such as a chromosome duplication or translocation).</rdfs:comment> <rdfs:label xml:lang="en">karyotype</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000645 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000645"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000899"/> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/GENO_0000650"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/GENO_0000000"/> </owl:Restriction> </rdfs:subClassOf> <obo:IAO_0000115>A genomic genotype where the genomic background specifies a male or female sex chromosome complement.</obo:IAO_0000115> <obo:IAO_0000116>This modeling approach enables creation separate genotype instances for data sources that report sex-specific phenotypes to ensure that sex-specific G2P differences are accurately described. These sex specific genotypes can be linked to the broader intrinsic genotype that is shared by male and female mice of the same strain, to aggregate associated phenotypes at this level, and allow aggregation with G2P association data about the same strains from sources that distinguish sex-specific phenotypes (e.g. IMPC) and those that do not (e.g. MGI). In the genotype partonomy, a sex qualified genotype has as part a sex-agnostic genotype. This allows for the propagation of phenotypes associated with a sex-qualified genotype to the intrinsic genotype. Ontologically, this parthood is based on the fact that the background component of a sex-qualified genotype specifies the sex chromosomes while that of the sex-agnostic genotype does not. Thus, the sequence content of the sex-qualified genotype is a superset of that of the intrinsic genotype, with the latter being a proper part of the former.</obo:IAO_0000116> <obo:IAO_0000118>intrinsic genotype (sex-specific)</obo:IAO_0000118> <obo:IAO_0000118>sex-qualified genotype</obo:IAO_0000118> <obo:IAO_0000118>sex-qualified intrinsic genotype</obo:IAO_0000118> <rdfs:comment>We distinguish the notion of a sex-agnostic intrinsic genotype, which does not specify whether the portion of the genome defining organismal sex is male or female, from the notion of a sex-qualified intrinsic genotype, which does. Male and female mice that contain the same background and genetic variation complement will have the same &apos;sex-agnostic intrinsic genotype&apos;, despite their genomes varying in their sex-chromosome complement. By contrast, these two mice would have different &apos;sex-qualified intrinsic genotypes&apos;, as this class takes background sex chromosome sequences into account in the identity criteria for its instances. Conceptually, a sex-qualified phenotype represents a superset of sequence features relative to a sex-agnostic intirnsic genotype, in that if specifies the background sex-chromosome complement of the genome.</rdfs:comment> <rdfs:label xml:lang="en">genomic genotype (sex-qualified)</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000646 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000646"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000645"/> <obo:IAO_0000115>A genomic genotype here the genomic background specifies a male sex chromosome complement.</obo:IAO_0000115> <rdfs:label xml:lang="en">male intrinsic genotype</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000647 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000647"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000645"/> <obo:IAO_0000115>A genomic genotype here the genomic background specifies a female sex chromosome complement.</obo:IAO_0000115> <rdfs:label xml:lang="en">female intrinsic genotype</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000649 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000649"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000611"/> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/GENO_0000207"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/GENO_0000772"/> </owl:Restriction> </rdfs:subClassOf> <obo:IAO_0000115>A background genotype whose sequence or identity is not known or specified.</obo:IAO_0000115> <rdfs:label xml:lang="en">unspecified background genotype</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000659 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000659"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000701"/> <obo:IAO_0000115>An exhaustive collection of all genetic entities of a specified type present as part of some larger genetic entity (e.g. all chromosomes in a genome, all variant alleles in a genome, all copies of a particular gene or allele in a genome, all allleles defined in a haplotype).</obo:IAO_0000115> <rdfs:comment>Not all sequence feature complements will be collections - i.e. in some cases the complement of all features of type X will consist of a single feature. For example, a &apos;single locus complement&apos; for an X-linked locus in a XY male.</rdfs:comment> <rdfs:label xml:lang="en">sequence feature complement</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000660 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000660"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000659"/> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/BFO_0000051"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/GENO_0000481"/> </owl:Restriction> </rdfs:subClassOf> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/RO_0002162"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/OBI_0100026"/> </owl:Restriction> </rdfs:subClassOf> <obo:IAO_0000115>An exhaustive collection of all features of a specified type in a single genome (e.g. all chromosomes in a genome, all variant features in a genome, all copies of a given gene or allele in a genome).</obo:IAO_0000115> <obo:IAO_0000116>In some cases there may be zero or only one member of such a complement, which is why this class is not defened to necessarily have some &apos;genomic feature&apos; as a member.</obo:IAO_0000116> <obo:IAO_0000118>genomic locus complement</obo:IAO_0000118> <rdfs:comment>A genomic feature is any located sequence feature in the genome, from a single nucleotide to a gene into an entire chromosome. A complement is the collection of all elements in a set (i.e. &quot;the full number of things in a set&quot;). Here, a &apos;genomic feature complement&apos; is here the set of all features in a single genome of a specified type (according to some defined inclusion criteria).</rdfs:comment> <rdfs:label xml:lang="en">genomic feature complement</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000666 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000666"> <owl:equivalentClass> <owl:Class> <owl:intersectionOf rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000481"/> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/RO_0002525"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/GENO_0000014"/> </owl:Restriction> </owl:intersectionOf> </owl:Class> </owl:equivalentClass> <obo:IAO_0000115>A genomic feature that is part of a gene, and delineated by some functional or structural function or role it serves (e.g.a promoter element, coding region, etc).</obo:IAO_0000115> <obo:IAO_0000118>defined gene part</obo:IAO_0000118> <rdfs:label>gene part</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000667 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000667"> <owl:equivalentClass> <owl:Class> <owl:intersectionOf rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/SO_0000902"/> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/RO_0000087"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/GENO_0000910"/> </owl:Restriction> </owl:intersectionOf> </owl:Class> </owl:equivalentClass> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/BFO_0000051"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/GENO_0000640"/> </owl:Restriction> </rdfs:subClassOf> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/GENO_0000207"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/SO_0000783"/> </owl:Restriction> </rdfs:subClassOf> <obo:IAO_0000115>A transgene that codes for a product used as a reporter of gene expression or activity.</obo:IAO_0000115> <rdfs:label xml:lang="en">reporter transgene</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000680 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000680"> <rdfs:subClassOf rdf:resource="http://www.geneontology.org/formats/oboInOwl#ObsoleteClass"/> <obo:IAO_0000112>A junction between bases, a deletion variant, a terminus at the end of a chromosome.</obo:IAO_0000112> <obo:IAO_0000115>A genomic feature that has an extent of zero.</obo:IAO_0000115> <obo:IAO_0000116>Former logical def: &apos;genomic feature&apos; and (has_extent value 0)</obo:IAO_0000116> <rdfs:label xml:lang="en">obsolete_null feature</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000681 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000681"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000684"/> <rdfs:subClassOf> <owl:Class> <owl:complementOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/GENO_0000248"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/SO_0000340"/> </owl:Restriction> </owl:complementOf> </owl:Class> </rdfs:subClassOf> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/GENO_0000207"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/GENO_0000139"/> </owl:Restriction> </rdfs:subClassOf> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/GENO_0000207"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/GENO_0000685"/> </owl:Restriction> </rdfs:subClassOf> <obo:IAO_0000115>An extrachromosomal replicon that is variant in a genome in virtue of its being a novel addition to the genome - i.e. it is not present in the reference for the genome in which it is found.</obo:IAO_0000115> <obo:IAO_0000118>aberrant extrachromosomal replicon</obo:IAO_0000118> <obo:IAO_0000118>exogenous extrachromosomal replicon</obo:IAO_0000118> <obo:IAO_0000118 xml:lang="en">transgenic extrachromosomal replicon</obo:IAO_0000118> <rdfs:comment>Extrachromosomal replicons are replicated and passed on to descendents, and thus part of the heritable genome of a cell or organism. In cases where the presence of such a replicon is exogenous or aberrant (i.e. not included in the reference for that genome), the replicon is considered a &apos;variant locus&apos; and a &apos;sequence alteration&apos;.</rdfs:comment> <rdfs:label>novel extrachromosomal replicon</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000684 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000684"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_0001059"/> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/GENO_0000207"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/GENO_0000685"/> </owl:Restriction> </rdfs:subClassOf> <obo:IAO_0000114 rdf:resource="http://purl.obolibrary.org/obo/GENO_0000484"/> <obo:IAO_0000115>A genomic feature that represents an entirely new replicon in the genome, e.g. an extrachromosomal replicon or an extra copy of a chromosome.</obo:IAO_0000115> <obo:IAO_0000116>This class is defined so as to support classification of things like novel extrachromosomal replicons and aneusomic chromosomes as being variant alleles in a genome. These represent entirely new features in the genome - not variants of an existing feature.</obo:IAO_0000116> <rdfs:comment>Novel replicons are considered as an &apos;insertion&apos; in a genome, and as such, qualify as types of sequence_alterations and variant alleles. There is no pre-existing locus that it modifies, however, and thus it is not really an &apos;allele of&apos; a named locus. But conceptually, we still consider these to represent genetic variants and classify them as variant alleles.</rdfs:comment> <rdfs:label xml:lang="en">novel replicon</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000685 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000685"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000773"/> <obo:IAO_0000115>An attribute of a genomic feature that represents a feature not previously found in a given genome, e.g. an extrachromosomal replicon or aneusomic third copy of a chromosome.</obo:IAO_0000115> <rdfs:label xml:lang="en">novel</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000688 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000688"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_0000110"/> <obo:IAO_0000115>A sequence feature representing the end of a sequence that is bounded only on one side (e.g. at the end of an chromosome or oligonucleotide).</obo:IAO_0000115> <rdfs:label xml:lang="en">terminus</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000701 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000701"> <owl:equivalentClass> <owl:Class> <owl:unionOf rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000701"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/SO_0000110"/> </owl:unionOf> </owl:Class> </owl:equivalentClass> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/BFO_0000031"/> <obo:IAO_0000115>An extent of biological sequence, or a collection of such extents, whose identity is dependent on both its sequence and its position.</obo:IAO_0000115> <rdfs:comment>GENO defines three levels of sequence-related artifacts, which are distinguished by their identity criteria. 1. &apos;Biological sequence&apos; identity is dependent only on the ordering of units that comprise the sequence. 2. &apos;Sequence feature&apos; identity is dependent on its sequence and the genomic position if the sequence (aligns with definition of &apos;sequence feature&apos; in the Sequence Ontology). 3. &apos;Qualified sequence feature&apos; identity is additionally dependent on some aspect of the physical context of the genetic material bearing the feature, extrinsic to its sequence and its genomic position. For example, its being targeted by gene knockdown reagents, its being transgenically expressed in a foreign cell from a recombinant expression construct, its having been epigenetically modified in a way that alters its expression level or pattern, or its being located in a specific cellular or anatomical location.</rdfs:comment> <rdfs:label xml:lang="en">sequence feature or collection</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000702 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000702"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/BFO_0000031"/> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/GENO_0000896"/> <owl:someValuesFrom rdf:resource="http://www.w3.org/2001/XMLSchema#string"/> </owl:Restriction> </rdfs:subClassOf> <obo:IAO_0000115>An ordered collection units representing successive monomers of a biological macromolecule.</obo:IAO_0000115> <obo:IAO_0000116>GENO defines three levels of sequence-related artifacts, which are distinguished by their identity criteria. 1. &apos;Biological sequence&apos; identity is dependent only on the ordering of units that comprise the sequence. 2. &apos;Sequence feature&apos; identity is dependent on its sequence and the genomic position if the sequence (aligns with definition of &apos;sequence feature&apos; in the Sequence Ontology). 3. &apos;Qualified sequence feature&apos; identity is additionally dependent on some aspect of the physical context of the genetic material bearing the feature, extrinsic to its sequence and its genomic position. For example, its being targeted by gene knockdown reagents, its being transgenically expressed in a foreign cell from a recombinant expression construct, its having been epigenetically modified in a way that alters its expression level or pattern, or its being located in a specific cellular or anatomical location.</obo:IAO_0000116> <obo:IAO_0000118>biomacromolecular sequence</obo:IAO_0000118> <obo:IAO_0000118>state</obo:IAO_0000118> <oboInOwl:hasDbXref>VMC:State</oboInOwl:hasDbXref> <rdfs:comment>&apos;Sequences&apos; differ from &apos;sequence features&apos; in that instances are distinguished only by their inherent ordering of units, and not by any positional aspect related to alignment with some reference sequence. Accordingly, the &apos;ATG&apos; translational start codon of the human AKT gene is the same *sequence* as the &apos;ATG&apos; start codon of the human SHH gene, but these represent two distinct *sequence features* in virtue of their different positions in the genome.</rdfs:comment> <rdfs:label xml:lang="en">biological sequence</rdfs:label> </owl:Class> <owl:Axiom> <owl:annotatedSource rdf:resource="http://purl.obolibrary.org/obo/GENO_0000702"/> <owl:annotatedProperty rdf:resource="http://www.w3.org/2000/01/rdf-schema#subClassOf"/> <owl:annotatedTarget> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/GENO_0000896"/> <owl:someValuesFrom rdf:resource="http://www.w3.org/2001/XMLSchema#string"/> </owl:Restriction> </owl:annotatedTarget> <obo:GENO_0000834 rdf:datatype="http://www.w3.org/2001/XMLSchema#boolean">true</obo:GENO_0000834> </owl:Axiom> <owl:Axiom> <owl:annotatedSource rdf:resource="http://purl.obolibrary.org/obo/GENO_0000702"/> <owl:annotatedProperty rdf:resource="http://purl.obolibrary.org/obo/IAO_0000118"/> <owl:annotatedTarget>state</owl:annotatedTarget> <obo:IAO_0000116>In the VMC model, the notion of a GENO:biological sequence is called the &apos;state&apos; of an allele.</obo:IAO_0000116> </owl:Axiom> <!-- http://purl.obolibrary.org/obo/GENO_0000713 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000713"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/BFO_0000031"/> <obo:IAO_0000115>A sequence feature (or collection of features) whose identity is dependent on the context or state of its material bearer (in addition to its sequence an position). This context/state describes factors external to its inherent sequence and position that can influences its expression, such as being targeted by gene-knockdown reagents, or an epigenetic modification.</obo:IAO_0000115> <rdfs:comment>GENO defines three levels of sequence-related artifacts, which are distinguished by their identity criteria. 1. &apos;Biological sequence&apos; identity is dependent only on the ordering of units that comprise the sequence. 2. &apos;Sequence feature&apos; identity is dependent on its sequence and the genomic position if the sequence (aligns with definition of &apos;sequence feature&apos; in the Sequence Ontology). 3. &apos;Qualified sequence feature&apos; identity is additionally dependent on some aspect of the physical context of the genetic material bearing the feature, extrinsic to its sequence and its genomic position. For example, its being targeted by gene knockdown reagents, its being transgenically expressed in a foreign cell from a recombinant expression construct, its having been epigenetically modified in a way that alters its expression level or pattern, or its being located in a specific cellular or anatomical location.</rdfs:comment> <rdfs:label xml:lang="en">qualified sequence feature or collection</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000714 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000714"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000713"/> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/GENO_0000580"/> <owl:someValuesFrom rdf:resource="http://www.w3.org/2002/07/owl#Thing"/> </owl:Restriction> </rdfs:subClassOf> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/GENO_0000726"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/GENO_0000481"/> </owl:Restriction> </rdfs:subClassOf> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/RO_0002162"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/OBI_0100026"/> </owl:Restriction> </rdfs:subClassOf> <obo:IAO_0000112>Consider wild-type zebrafish shha gene in the context of being targeted by morpholino1 vs morpholino 2 in separate experiments. These shha genes share identical sequence and position, but represent distinct instances of a &apos;qualified sequence feature&apos; because of their different external context. This is important because these qualified features could have distinct phenotypes associated with them (just as two different sequence variants of the same gene can have potentially different associated phenotypes).</obo:IAO_0000112> <obo:IAO_0000115>A sequence feature whose identity is dependent on the context or state of its material bearer (in addition to its sequence and position). This context describes factors external to its inherent sequence and position. Examples include the context of being targeted by gene-knockdown reagents, or the context of being the target of an epigenetic modification.</obo:IAO_0000115> <rdfs:comment>GENO defines three levels of sequence-related artifacts, which are distinguished by their identity criteria. 1. &apos;Biological sequence&apos; identity is dependent only on the ordering of units that comprise the sequence. 2. &apos;Sequence feature&apos; identity is dependent on its sequence and the genomic position if the sequence (aligns with definition of &apos;sequence feature&apos; in the Sequence Ontology). 3. &apos;Qualified sequence feature&apos; identity is additionally dependent on some aspect of the physical context of the genetic material bearing the feature, extrinsic to its sequence and its genomic position. For example, its being targeted by gene knockdown reagents, its being transgenically expressed in a foreign cell from a recombinant expression construct, its having been epigenetically modified in a way that alters its expression level or pattern, or its being located in a specific cellular or anatomical location. Modeling sequence entities at this &apos;qualified&apos; level useful when it is important to distinguish features with identical sequence and position as separate instances - based on their material bearers being found in different contexts. For example, a situation where the shha gene is targeted by two different morpholinos and phenotypes assessed for each. This is analogous to two different alleles of the shha gene at the sequence feature level, and similarly worthy of being distinguished when considering how the resulting alteration in gene expression impacts the measured phenotypes of the host zebrafish.</rdfs:comment> <rdfs:label xml:lang="en">qualified genomic feature</rdfs:label> </owl:Class> <owl:Axiom> <owl:annotatedSource rdf:resource="http://purl.obolibrary.org/obo/GENO_0000714"/> <owl:annotatedProperty rdf:resource="http://www.w3.org/2000/01/rdf-schema#subClassOf"/> <owl:annotatedTarget> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/GENO_0000580"/> <owl:someValuesFrom rdf:resource="http://www.w3.org/2002/07/owl#Thing"/> </owl:Restriction> </owl:annotatedTarget> <obo:GENO_0000834 rdf:datatype="http://www.w3.org/2001/XMLSchema#boolean">true</obo:GENO_0000834> <rdfs:comment>This axiom is an initial attempt to formalize the identity criteria of an extrinnsic context that separates qualified sequence features from sequence features (i.e. the context of its material bearer). As we further develop our efforts here this will get refined and more precise.</rdfs:comment> </owl:Axiom> <owl:Axiom> <owl:annotatedSource rdf:resource="http://purl.obolibrary.org/obo/GENO_0000714"/> <owl:annotatedProperty rdf:resource="http://www.w3.org/2000/01/rdf-schema#subClassOf"/> <owl:annotatedTarget> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/GENO_0000726"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/GENO_0000481"/> </owl:Restriction> </owl:annotatedTarget> <obo:GENO_0000834 rdf:datatype="http://www.w3.org/2001/XMLSchema#boolean">true</obo:GENO_0000834> <rdfs:comment>Formalizes one identity criteria of the sequence feature component of a qualified sequence feature (which itself is identified by its sequence and its genomic position).</rdfs:comment> </owl:Axiom> <!-- http://purl.obolibrary.org/obo/GENO_0000715 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000715"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000713"/> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/BFO_0000051"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/GENO_0000714"/> </owl:Restriction> </rdfs:subClassOf> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/GENO_0000726"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/GENO_0000660"/> </owl:Restriction> </rdfs:subClassOf> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/RO_0002162"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/OBI_0100026"/> </owl:Restriction> </rdfs:subClassOf> <obo:IAO_0000115>A set of all qualified sequence features of a specified type in a single genome.</obo:IAO_0000115> <obo:IAO_0000116>In some cases there may be zero or only one member of such a complement, which is why this class is not defened to necessarily have some &apos;qualified genomic feature&apos; as a member.</obo:IAO_0000116> <rdfs:label xml:lang="en">qualified genomic feature complement</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000719 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000719"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000536"/> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/IAO_0000219"/> <owl:someValuesFrom> <owl:Class> <owl:unionOf rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000516"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/SO_0001026"/> </owl:unionOf> </owl:Class> </owl:someValuesFrom> </owl:Restriction> </rdfs:subClassOf> <obo:IAO_0000115>A genotype that describes the total variation in heritable genomic sequence of a cell or organism, typically in terms of alterations from some reference or background genotype.</obo:IAO_0000115> <obo:IAO_0000116>Genotype vs Genome in GENO: An (intrinsic) genotype is an information artifact representing an indirect syntax for specifying a genome sequence. This syntax has reference and variant components - a &apos;background genotype&apos; and &apos;genomic variation complement&apos; - that must be operated on to resolve a specifie genome sequence. Specifically, the genome sequence is resolved by substituting all sequences specified by the &apos;genomic variation complement&apos; for the corresponding sequences in the &apos;reference genome&apos;. So, while the total sequence content represented in a genotype may be greater than that in a genome, the intended resolution of these sequences is to arrive at a single genome sequence. It is this end-point that we consider when holding that a genotype &apos;specifies&apos; a genome.</obo:IAO_0000116> <rdfs:comment>1. A genomic genotype is a short-hand specification of a genome that uses a representational syntax comprised of information about a reference genome (&apos;genomic background&apos;), and all specific variants from this reference (the &apos;genomic variation complement&apos;). Conceptually, this variant genome sequence can be resolved by substituting all sequences specified by the &apos;genomic variation complement&apos; for the corresponding sequences in the reference &apos;genomic background&apos; sequence. 2. &apos;Heritable&apos; genomic sequence is that which is passed on to subsequent generations of cells/organisms, and includes all chromosomal sequences, the mitochondrial genome, and any transmissable extrachromosomal replicons.</rdfs:comment> <rdfs:label xml:lang="en">intrinsic genotype</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000720 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000720"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000702"/> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/GENO_0000783"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/GENO_0000780"/> </owl:Restriction> </rdfs:subClassOf> <rdfs:label xml:lang="en">DNA sequence</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000721 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000721"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000702"/> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/GENO_0000783"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/GENO_0000781"/> </owl:Restriction> </rdfs:subClassOf> <rdfs:label xml:lang="en">RNA sequence</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000722 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000722"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000702"/> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/GENO_0000783"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/GENO_0000782"/> </owl:Restriction> </rdfs:subClassOf> <rdfs:label xml:lang="en">amino acid sequence</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000724 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000724"> <rdfs:subClassOf rdf:resource="http://www.geneontology.org/formats/oboInOwl#ObsoleteClass"/> <rdfs:label xml:lang="en">obsolete_biological sequence or collection</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000725 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000725"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000724"/> <rdfs:label xml:lang="en">obsolete_biological sequence collection</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000736 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000736"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000714"/> <obo:IAO_0000114 rdf:resource="http://purl.obolibrary.org/obo/GENO_0000484"/> <obo:IAO_0000115>A sequence feature whose identity is additionally dependent on the cellular or anatomical location of the genetic material bearing the feature.</obo:IAO_0000115> <rdfs:comment>As a qualified sequence feature, the BRCA1c.5096G&gt;A variant as materialized in a somatic breast epithelial cell could be distinguished as a separate entity from a BRCA1c.5096G&gt;A variant in a different cell type or location (e.g. germline BRCA1 varaint in a sperm cell).</rdfs:comment> <rdfs:label xml:lang="en">location-qualified sequence feature</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000737 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000737"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000714"/> <obo:IAO_0000115>A sequence feature whose identity is additionally dependent on factors specifically influencing its level of expression in the context of a biological system (e.g. being targeted by gene-knockdown reagents, or driven from exogneous expression system like recombinant construct)</obo:IAO_0000115> <rdfs:label xml:lang="en">expression-qualified sequence feature</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000768 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000768"> <rdfs:subClassOf rdf:resource="http://www.geneontology.org/formats/oboInOwl#ObsoleteClass"/> <obo:IAO_0000115>A sequence feature position based on a genomic coordinate system, where the position specifies start and end coordinates based on its alignment with some reference genomic sequence.</obo:IAO_0000115> <obo:IAO_0000116>This &apos;genomic position&apos; concept differs from the faldo:Position concecpt in that the former describes the start AND end points/coordinates of a feature, while the latter describes a single point/coordinate at the beginning OR end of a feature.</obo:IAO_0000116> <obo:IAO_0000118 xml:lang="en">genomic coordinates</obo:IAO_0000118> <obo:IAO_0000231>remodeling notion of sequence feature position around the idea of a &apos;genomic locus&apos;</obo:IAO_0000231> <rdfs:label>obsolete_genomic position</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000770 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000770"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000351"/> <rdfs:label xml:lang="en">phenotypic inheritance process</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000772 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000772"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000788"/> <obo:IAO_0000115>A sequence attribute inhering in a feature whose identity is not specified.</obo:IAO_0000115> <rdfs:label xml:lang="en">unspecified</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000773 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000773"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000788"/> <obo:IAO_0000115>An attribute describing a type of variation inhering in a sequence feature or collection.</obo:IAO_0000115> <obo:IAO_0000118>allele attribute</obo:IAO_0000118> <rdfs:label xml:lang="en">variation attribute</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000777 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000777"> <owl:equivalentClass> <owl:Class> <owl:intersectionOf rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000899"/> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/IAO_0000219"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/GENO_0000033"/> </owl:Restriction> </owl:intersectionOf> </owl:Class> </owl:equivalentClass> <obo:IAO_0000115>An intrinsic genotype that specifies variation from a reference or background.</obo:IAO_0000115> <rdfs:label xml:lang="en">variant genomic genotype</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000778 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000778"> <rdfs:subClassOf rdf:resource="http://www.geneontology.org/formats/oboInOwl#ObsoleteClass"/> <obo:IAO_0000115>An information entity that is intented to represent some biological sequence, sequence feature, qualified sequence feature, or a collection of one or more of these entities.</obo:IAO_0000115> <obo:IAO_0000231>eliminating classes that are not necessary or add uneeded complexity.</obo:IAO_0000231> <rdfs:label xml:lang="en">obsolete_sequence information entity</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000779 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000779"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000702"/> <obo:IAO_0000118>biological sequence residue</obo:IAO_0000118> <obo:IAO_0000118>monomeric residue</obo:IAO_0000118> <rdfs:label xml:lang="en">biological sequence unit</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000780 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000780"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000779"/> <obo:IAO_0000118>deoxyribonucleic acid residue</obo:IAO_0000118> <rdfs:label xml:lang="en">DNA residue</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000781 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000781"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000779"/> <obo:IAO_0000118>ribonucleic acid residue</obo:IAO_0000118> <rdfs:label xml:lang="en">RNA residue</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000782 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000782"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000779"/> <rdfs:label xml:lang="en">amino acid residue</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000788 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000788"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/BFO_0000020"/> <obo:IAO_0000115>An attribute, quality, or state of a sequence or sequence feature.</obo:IAO_0000115> <obo:IAO_0000116>Sequence feature attributes can be based on qualities of the material bearers of the feature, for example, the staining intensity of a chromosomal band feature.</obo:IAO_0000116> <oboInOwl:hasDbXref>http://purl.obolibrary.org/obo/SO_0000400</oboInOwl:hasDbXref> <rdfs:label>sequence feature attribute</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000815 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000815"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/BFO_0000002"/> <obo:IAO_0000115>The location of a sequence feature as defined by its start and end position on some reference coordinate system.</obo:IAO_0000115> <rdfs:comment>1. The notion of a sequence feature location in the realm of biological sequences is analogous to a BFO:spatiotemporal region in the realm of physical entities. A spatiotemporal region can be &apos;occupied by&apos; physical objects, while a location is &apos;occupied by&apos; sequence features. Just as a spatiotemporal region is distinct from an object that occupies it, so too a location is distinct from a sequence feature that occupies it. A more concrete analogy can be drawn to the distinction between a street address (the location) and the building that occupies it (the sequence feature). 2. A sequence feature location is defined by its begin and end coordinates on a reference sequence, but it is not identified by a particular sequence that may reside there. The same location, defined by a alignment to some reference, may be occupied by different sequences in the genome of organism 1 vs that of organism 2.</rdfs:comment> <rdfs:label xml:lang="en">sequence feature location</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000818 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000818"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000714"/> <obo:IAO_0000114 rdf:resource="http://purl.obolibrary.org/obo/GENO_0000484"/> <obo:IAO_0000115>A sequence feature whose identity is additionally dependent on a chemical modification made to the genetic material bearing the feature (e.g. binding of transcriptional regulators, or epigenetic modifications including direct DNA methylation, or modification of histones associated with a feature)</obo:IAO_0000115> <rdfs:label xml:lang="en">modification-qualified sequence feature</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000823 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000823"> <owl:equivalentClass> <owl:Class> <owl:intersectionOf rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000719"/> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/IAO_0000219"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/GENO_0000516"/> </owl:Restriction> </owl:intersectionOf> </owl:Class> </owl:equivalentClass> <obo:IAO_0000112>1. The zebrafish &quot;fgf8a&lt;ti282a&gt;/fgf8a&lt;+&gt;&quot; allelic genotype describes the combination of gene alleles present at a specific gene locus (the fgf8a locus - which here has a heterozygous state). 2. The human allelic genotypes in the VCF records describes below describe the set of SNPs present at specific positions on Chromosome 20 in the human genome. The first record describes a heterozygouse C/T allelic genotype at Chr20:2300608, and the second describes a homozygous G/G allelic genotype at Chr20:2301308. ##fileformat=VCFv4.2 ##FORMAT=&lt;ID=GT, Description=&quot;Genotype, 0=REF, 1=ALT&quot;&gt; #CHROM POS REF ALT FILTER FORMAT SAMP001 20 2300608 C T PASS GT 0/1 20 2301308 T G PASS GT 1/1 (derived from https://faculty.washington.edu/browning/beagle/intro-to-vcf.html) 3. Some allelic genotype formats encode the genotype as a single string - e.g. &quot;GRCh38 Chr12:258635(A;T)&quot; describes a heterozygous A/T allelic genotype of SNPs present at a specific position 258635 on human chromosome 12.</obo:IAO_0000112> <obo:IAO_0000115>A genotype that specifies the &apos;allelic state&apos; at a particular locus in the genome - i.e. the set of alleles present at this locus across all homologous chromosomes.</obo:IAO_0000115> <obo:IAO_0000118>single locus genotype</obo:IAO_0000118> <rdfs:comment>An &apos;allelic genotype&apos; describes the set of alleles present at a particular locus (&apos;allelic genotype&apos;) in the genome. This use of the term &apos;genotype&apos; reflects its use in clinical genetics where variation has historically been assessed at a specific locus, and a genotype describes the allelic state at that particular location. This contrasts to the use of the term &apos;genotype in model orgnaism communities where it commonly describes the allelic state at all loci in a genome known to vary from an established reference or background.</rdfs:comment> <rdfs:label xml:lang="en">allelic genotype</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000833 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000833"> <rdfs:subClassOf rdf:resource="http://purl.org/oban/association"/> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/GENO_0000580"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/ENVO_01000254"/> </owl:Restriction> </rdfs:subClassOf> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/GENO_0000580"/> <owl:someValuesFrom> <owl:Class> <owl:intersectionOf rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GO_0032502"/> <owl:Class> <owl:intersectionOf rdf:parseType="Collection"> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/RO_0002091"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/UBERON_0000105"/> </owl:Restriction> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/RO_0002093"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/UBERON_0000105"/> </owl:Restriction> </owl:intersectionOf> </owl:Class> </owl:intersectionOf> </owl:Class> </owl:someValuesFrom> </owl:Restriction> </rdfs:subClassOf> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.org/oban/association_has_object"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/UPHENO_0001001"/> </owl:Restriction> </rdfs:subClassOf> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.org/oban/association_has_subject"/> <owl:someValuesFrom> <owl:Class> <owl:unionOf rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000536"/> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/BFO_0000050"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/GENO_0000536"/> </owl:Restriction> </owl:unionOf> </owl:Class> </owl:someValuesFrom> </owl:Restriction> </rdfs:subClassOf> <obo:IAO_0000114 rdf:resource="http://purl.obolibrary.org/obo/GENO_0000484"/> <obo:IAO_0000116>Exploratory class looking at creating more specific subtypes of associatiosn, and defining identity criteria for each.</obo:IAO_0000116> <rdfs:label xml:lang="en">genotype-phenotype association</rdfs:label> </owl:Class> <owl:Axiom> <owl:annotatedSource rdf:resource="http://purl.obolibrary.org/obo/GENO_0000833"/> <owl:annotatedProperty rdf:resource="http://www.w3.org/2000/01/rdf-schema#subClassOf"/> <owl:annotatedTarget> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/GENO_0000580"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/ENVO_01000254"/> </owl:Restriction> </owl:annotatedTarget> <obo:GENO_0000834 rdf:datatype="http://www.w3.org/2001/XMLSchema#boolean">true</obo:GENO_0000834> </owl:Axiom> <owl:Axiom> <owl:annotatedSource rdf:resource="http://purl.obolibrary.org/obo/GENO_0000833"/> <owl:annotatedProperty rdf:resource="http://www.w3.org/2000/01/rdf-schema#subClassOf"/> <owl:annotatedTarget> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/GENO_0000580"/> <owl:someValuesFrom> <owl:Class> <owl:intersectionOf rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GO_0032502"/> <owl:Class> <owl:intersectionOf rdf:parseType="Collection"> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/RO_0002091"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/UBERON_0000105"/> </owl:Restriction> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/RO_0002093"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/UBERON_0000105"/> </owl:Restriction> </owl:intersectionOf> </owl:Class> </owl:intersectionOf> </owl:Class> </owl:someValuesFrom> </owl:Restriction> </owl:annotatedTarget> <obo:GENO_0000834 rdf:datatype="http://www.w3.org/2001/XMLSchema#boolean">true</obo:GENO_0000834> </owl:Axiom> <owl:Axiom> <owl:annotatedSource rdf:resource="http://purl.obolibrary.org/obo/GENO_0000833"/> <owl:annotatedProperty rdf:resource="http://www.w3.org/2000/01/rdf-schema#subClassOf"/> <owl:annotatedTarget> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.org/oban/association_has_object"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/UPHENO_0001001"/> </owl:Restriction> </owl:annotatedTarget> <obo:GENO_0000834 rdf:datatype="http://www.w3.org/2001/XMLSchema#boolean">true</obo:GENO_0000834> </owl:Axiom> <owl:Axiom> <owl:annotatedSource rdf:resource="http://purl.obolibrary.org/obo/GENO_0000833"/> <owl:annotatedProperty rdf:resource="http://www.w3.org/2000/01/rdf-schema#subClassOf"/> <owl:annotatedTarget> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.org/oban/association_has_subject"/> <owl:someValuesFrom> <owl:Class> <owl:unionOf rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000536"/> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/BFO_0000050"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/GENO_0000536"/> </owl:Restriction> </owl:unionOf> </owl:Class> </owl:someValuesFrom> </owl:Restriction> </owl:annotatedTarget> <obo:GENO_0000834 rdf:datatype="http://www.w3.org/2001/XMLSchema#boolean">true</obo:GENO_0000834> </owl:Axiom> <!-- http://purl.obolibrary.org/obo/GENO_0000839 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000839"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000527"/> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/GENO_0000382"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/GENO_0000504"/> </owl:Restriction> </rdfs:subClassOf> <rdfs:label xml:lang="en">knockdown reagent targeted gene complement</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000848 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000848"> <rdfs:subClassOf rdf:resource="http://www.geneontology.org/formats/oboInOwl#ObsoleteClass"/> <obo:IAO_0000114 rdf:resource="http://purl.obolibrary.org/obo/GENO_0000484"/> <obo:IAO_0000115>A sequence alteration within the coding sequence of a gene.</obo:IAO_0000115> <obo:IAO_0000231>Not required at this poitn, so marked exploratory and obsoleted. Asserted under sequence_alteration.</obo:IAO_0000231> <rdfs:label xml:lang="en">obsolete_coding sequence alteration</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000850 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000850"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000856"/> <obo:IAO_0000115>A construct that contains a mobile P-element, holding sequences to be delivered to a target cell or genome.</obo:IAO_0000115> <rdfs:label xml:lang="en">P-element construct</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000856 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000856"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_0000804"/> <obo:IAO_0000115>An engineered region that is used to transfer foreign genetic material into a host cell.</obo:IAO_0000115> <obo:IAO_0000118>engineered_genetic_vector</obo:IAO_0000118> <rdfs:comment>Constructs can be engineered to carry inserts of DNA from external sources, for purposes of cloning and propagation or gene expression in host cells. Constructs are typically packaged as part of delivery systems such as plasmids or viral vectors.</rdfs:comment> <rdfs:label xml:lang="en">engineered genetic construct</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000861 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000861"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_0000902"/> <obo:IAO_0000115>A transgene that is not chromosomally integrated in the host genome, but instead exists as part of an extra-chromosomal construct.</obo:IAO_0000115> <obo:IAO_0000118>non-integrated transgene</obo:IAO_0000118> <rdfs:label xml:lang="en">extra-chromosomal transgene</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000870 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000870"> <rdfs:subClassOf rdf:resource="http://www.geneontology.org/formats/oboInOwl#ObsoleteClass"/> <obo:IAO_0000115>A collection of more than one sequence feature.</obo:IAO_0000115> <oboInOwl:hasDbXref>http://purl.obolibrary.org/obo/SO_0001260 ! sequence_collection</oboInOwl:hasDbXref> <rdfs:label xml:lang="en">obsolete_sequence feature collection</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000871 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000871"> <rdfs:subClassOf rdf:resource="http://www.geneontology.org/formats/oboInOwl#ObsoleteClass"/> <obo:IAO_0000115>A set of genetically-linked alleles, that reside at different locations on the same chromosomal strand and are typically inherited/transmitted together.</obo:IAO_0000115> <obo:IAO_0000231>reconsiderd defintion of haplotype to better align with SO and GA4GH/VMC definitions. Former SC axiom: has_member some allele.</obo:IAO_0000231> <terms:source>Informed by https://isogg.org/wiki/Haplotype and https://en.wikipedia.org/wiki/Haplotype.</terms:source> <rdfs:comment>Haplotypes are &apos;complements&apos; in that they include the set of all alleles in a defined region of the genome. Because they are genetically linked, the alleles comprising a haplotype are likely to be co-inherited and survive descent across many generations of reproduction. Haplotypes are located within &apos;haplotype blocks&apos; - regions of DNA where no recombination occurs between alleles on the same chromosomal strand. The &apos;haplotype&apos; within a &apos;haplotype block&apos; may be comprised of any number of distinct alleles. As described at https://en.wikipedia.org/wiki/Haplotype, the term &apos;haplotype&apos; is commonly used to describe three specific cases of genetically-linked alleles within a haplotype block: 1. The first is a set of linked &apos;gene alleles&apos; - specific versions of entire genes that reside in tightly linked clusters on a single chromosome. 2. The second is a set of linked &apos;single nucleotide polymorphism&apos; (SNP) alleles that tend to occur together (i.e. be statistically associated). 3. A third and less common use is describing individual collections of specific mutations within a given genetic segment - typically short tandem repeats. Each of these more specific definition serves a purpose for a particular type of genetic analysis or use case - e.g. &apos;SNP allele&apos; haplotypes are identified and analysed in studies to uncover the genetic basis of common disease by efforts like the International HapMap Project. The GENO definition is broadly inclusive of these and any other scenarios where distinct &apos;alleles&apos; of any kind on the same chromosomal strand are genetically linked and thus tend to be co-inherited across successive generations.</rdfs:comment> <rdfs:label xml:lang="en">obsolete_haplotype</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000872 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000872"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000876"/> <obo:IAO_0000115>A attribute describing the number of copies of a feature present in a genome.</obo:IAO_0000115> <rdfs:label xml:lang="en">copy number</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000873 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000873"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000874"/> <obo:IAO_0000115>A relation used to describe an environment contextualizing the identity of an entity.</obo:IAO_0000115> <rdfs:label xml:lang="en">microsatellite alteration</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000874 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000874"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_0001059"/> <obo:IAO_0000115>A relation used to describe a process contextualizing the identity of an entity.</obo:IAO_0000115> <rdfs:label xml:lang="en">repeat region alteration</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000875 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000875"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000876"/> <obo:IAO_0000115>A quality inhering in an &apos;allelic complement&apos; (aka a &apos;single locus complement&apos;) that describes the allelic variability found at a particular locus in the genome of a single cell/organism</obo:IAO_0000115> <rdfs:label xml:lang="en">allelic state</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000876 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000876"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000788"/> <obo:IAO_0000118>allelic dosage</obo:IAO_0000118> <obo:IAO_0000118>an attribute inhering in a feature based on the total number or relative stoichiometry of copies present in a particular genome.</obo:IAO_0000118> <obo:IAO_0000118>gene dosage</obo:IAO_0000118> <rdfs:label xml:lang="en">genetic dosage</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000877 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000877"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000788"/> <obo:IAO_0000115>A quality inhering in an allele based on its source/origin - typically the parent from which it was inherited.</obo:IAO_0000115> <rdfs:label xml:lang="en">allele origin</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000878 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000878"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000888"/> <obo:IAO_0000115>a quality of an allele in virtue of its having been inherited from a female parent.</obo:IAO_0000115> <rdfs:label xml:lang="en">maternal allele origin</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000879 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000879"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000888"/> <obo:IAO_0000115>a quality of an allele in virtue of its having been inherited from a male parent.</obo:IAO_0000115> <rdfs:label xml:lang="en">paternal allele origin</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000880 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000880"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000877"/> <obo:IAO_0000115>a quality of an allele in virtue of its having occurred through a de novo mutaiton, rather than inherited from a parent..</obo:IAO_0000115> <rdfs:label xml:lang="en">de novo allele origin</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000881 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000881"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000877"/> <obo:IAO_0000115>a quality of an allele in virtue of its origin not being known.</obo:IAO_0000115> <rdfs:label xml:lang="en">unknown allele origin</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000882 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000882"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000901"/> <obo:IAO_0000115>A quality inhering in a particular allele in virtue of its presence only in the genome of non-germ cells in an organism, and therefore not inherited by subsequent generations.</obo:IAO_0000115> <rdfs:label xml:lang="en">somatic</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000883 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000883"> <rdfs:subClassOf rdf:resource="http://www.geneontology.org/formats/oboInOwl#ObsoleteClass"/> <obo:IAO_0000115>a quality inhering in a feature in virtue of its presence only in the genome of gametes (germ cells).</obo:IAO_0000115> <obo:IAO_0000118>germ-line</obo:IAO_0000118> <obo:IAO_0000231>replaced by GENO:0000900 ! &apos;germline&apos;</obo:IAO_0000231> <rdfs:label xml:lang="en">obsolete_gametic</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000885 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000885"> <owl:equivalentClass> <owl:Class> <owl:intersectionOf rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000823"/> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/IAO_0000219"/> <owl:someValuesFrom> <owl:Class> <owl:intersectionOf rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000516"/> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/RO_0002351"/> <owl:qualifiedCardinality rdf:datatype="http://www.w3.org/2001/XMLSchema#nonNegativeInteger">2</owl:qualifiedCardinality> <owl:onClass rdf:resource="http://purl.obolibrary.org/obo/GENO_0000512"/> </owl:Restriction> </owl:intersectionOf> </owl:Class> </owl:someValuesFrom> </owl:Restriction> </owl:intersectionOf> </owl:Class> </owl:equivalentClass> <obo:IAO_0000115>An allelic genotype specifying the set of two alleles present at a locus in a diploid genome (i.e., a diploid &apos;single locus complement&apos;) Alt: A sequence feature complement comprised of two haplotypes at a particular locus on paired homologous chromosomes in a diploid genome.</obo:IAO_0000115> <rdfs:comment>&quot;Humans are diploid organisms; they have paired homologous chromosomes in their somatic cells, which contain two copies of each gene. An allele is one member of a pair of genes occupying a specific spot on a chromosome (called locus). Two alleles at the same locus on homologous chromosomes make up the individual’s genotype. A haplotype (a contraction of the term ‘haploid genotype’) is a combination of alleles at multiple loci that are transmitted together on the same chromosome. Haplotype may refer to as few as two loci or to an entire chromosome depending on the number of recombination events that have occurred between a given set of loci. Genewise haplotypes are established with markers within a gene; familywise haplotypes are established with markers within members of a gene family; and regionwise haplotypes are established within different genes in a region at the same chromosome. Finally, a diplotype is a matched pair of haplotypes on homologous chromosomes.&quot; From https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4118015/ https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4118015/figure/sap-26-03-165-g002/</rdfs:comment> <rdfs:label xml:lang="en">diplotype</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000886 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000886"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000788"/> <obo:IAO_0000115>A quality inhering in a collection of discontinuous sequence features in a single genome in virtue of their relative position on the same or separate chromosomes.</obo:IAO_0000115> <rdfs:label>allelic phase</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000887 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000887"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000112"/> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/RO_0002351"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/NCBITaxon_8090"/> </owl:Restriction> </rdfs:subClassOf> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/RO_0002351"/> <owl:allValuesFrom rdf:resource="http://purl.obolibrary.org/obo/NCBITaxon_8090"/> </owl:Restriction> </rdfs:subClassOf> <rdfs:label>oryzias latipes strain</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000888 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000888"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000877"/> <obo:IAO_0000115>a quality of an allele in virtue of its having been inherited from either parent.</obo:IAO_0000115> <rdfs:label>parental allele origin</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000889 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000889"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000141"/> <rdfs:label>unknown inheritance</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000890 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000890"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000701"/> <obo:IAO_0000112>The canonical allele that represents a single nucleotide variation in the BRCA2 gene, which can be described by various contextual alleles such as “NC_000013.11:g.32319070T&gt;A” and “NG_012772.3:g.8591T&gt;A”.</obo:IAO_0000112> <obo:IAO_0000115>One of a set of sequence features or haplotypes that exist at a particular genetic locus. &lt;see ClinGen Allele Model&gt;</obo:IAO_0000115> <obo:IAO_0000116>The notion of a &apos;canonical allele&apos; is taken from the ClinGen Allele model (http://datamodel.clinicalgenome.org/allele/). It is implemented in GENO to provide an ontological representation of this concept that will support data integration efforts, but may be replaced by should an IRI become available from the ClinGen model.</obo:IAO_0000116> <obo:IAO_0000119>http://datamodel.clinicalgenome.org/allele/resource/canonical_allele/</obo:IAO_0000119> <terms:source>ClinGen Allele Model (http://datamodel.clinicalgenome.org/allele/)</terms:source> <rdfs:comment>As a &apos;sequence feature or collection&apos; (sensu SO), a &apos;canonical allele&apos; is considered here as an extent of biological sequence encoded in nucleic acid molecules of a cell or organism (as opposed to an information artifact that is about such a sequence). Canonical alleles can include haplotypes that contain more than one discontinuous sequence alteration that exist in cis on the same chromosomal strand. In the ClinGen allele model, &apos;canonical alleles are contrasted with &apos;contextual alleles&apos;. Contextual alleles are informational representation that describe a canonical allele using a particular reference sequence. A single canonical allele can be described by many contextual alleles that each use a different reference sequence in their representation (e.g. different chromosomal or transcript references)</rdfs:comment> <rdfs:label>canonical allele</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000891 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000891"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/IAO_0000030"/> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/IAO_0000219"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/GENO_0000890"/> </owl:Restriction> </rdfs:subClassOf> <obo:IAO_0000115>An informational artifact that describes a canonical allele by defining its sequence and position relative to a particular reference sequence.</obo:IAO_0000115> <obo:IAO_0000116>The notion of a &apos;contextual allele&apos; is taken from the ClinGen Allele model (http://datamodel.clinicalgenome.org/allele/). It is implemented in GENO to provide an ontological representation of this concept that will support data integration efforts, but may be replaced by should an IRI become available from the ClinGen model.</obo:IAO_0000116> <obo:IAO_0000119>http://datamodel.clinicalgenome.org/allele/resource/contextual_allele/</obo:IAO_0000119> <terms:source>ClinGen Allele Model (http://datamodel.clinicalgenome.org/allele/)</terms:source> <rdfs:comment>The notion of a &apos;contextual allele&apos; derives from the ClinGen Allele model. Here, each genetic allele in a patient corresponds to a single &apos;canonical allele&apos;, which in turn may aggregate any number of &apos;contextual allele&apos; representations that are may be defined against different reference sequences. Accordingly, many contextual alleles can describe a single canonical allele. For example, the contextual alleles “NC_000013.11:g.32319070T&gt;A” and “NG_012772.3:g.8591T&gt;A” both describe the same underlying canonical allele, a single nucleotide variation, in the BRCA2 gene.</rdfs:comment> <rdfs:label>contextual allele</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000892 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000892"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000141"/> <obo:IAO_0000115>A mode of inheritance whereby manifestation of a trait or condition occurs only when both affected and unaffected mitochondria are inherited (i.e. some mitochondria that do and some that do not contain the causative allele).</obo:IAO_0000115> <rdfs:label>heteroplasmic mitochondrial inheritance</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000893 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000893"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000141"/> <obo:IAO_0000115>A mode of inheritance whereby manifestation of a trait or condition occurs only when affected mitochondria are inherited (i.e. mitochondria containing the causative allele)</obo:IAO_0000115> <rdfs:label>homoplasmic mitochondrial inheritance</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000897 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000897"> <owl:equivalentClass> <owl:Class> <owl:unionOf rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000481"/> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/BFO_0000051"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/GENO_0000481"/> </owl:Restriction> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/GENO_0000726"/> <owl:someValuesFrom> <owl:Class> <owl:unionOf rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000481"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000660"/> </owl:unionOf> </owl:Class> </owl:someValuesFrom> </owl:Restriction> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/IAO_0000219"/> <owl:someValuesFrom> <owl:Class> <owl:unionOf rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000481"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000660"/> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000715"/> </owl:unionOf> </owl:Class> </owl:someValuesFrom> </owl:Restriction> </owl:unionOf> </owl:Class> </owl:equivalentClass> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/BFO_0000031"/> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/RO_0002162"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/OBI_0100026"/> </owl:Restriction> </rdfs:subClassOf> <obo:GENO_0000905 rdf:datatype="http://www.w3.org/2001/XMLSchema#boolean">true</obo:GENO_0000905> <obo:IAO_0000115>An generically dependent continuant that carries biological sequence that is part of or derived from a genome.</obo:IAO_0000115> <obo:IAO_0000116>An abstract/organizational class to support data modeling, that includes genomic features, genomic feature complements, qualified genomic features and their complements, as well as genotypes that denote such entities.</obo:IAO_0000116> <rdfs:label xml:lang="en">genomic entity</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000898 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000898"> <rdfs:subClassOf rdf:resource="http://www.geneontology.org/formats/oboInOwl#ObsoleteClass"/> <obo:IAO_0000115>A sequence feature representing a region of the genome over which there is little evidence for historical recombination, such that sequences it contain are typically co-inherited/transmitted across generations.</obo:IAO_0000115> <obo:IAO_0000116>Consider http://purl.obolibrary.org/obo/SO_0000355 ! haplotype_block. And consider whether, as a defined region of genomic sequence where variation is known to occur, a haplotype block should be classified as a subtype of allele.</obo:IAO_0000116> <obo:IAO_0000119>From DOI: 10.1126/science.1069424</obo:IAO_0000119> <obo:IAO_0000231>reconsiderd defintion of haplotype to better align with SO and GA4GH/VMC definitions. Former SC axiom: has_part some haplotype</obo:IAO_0000231> <rdfs:comment>A &apos;haplotype block&apos; is a continuous region of sequence that contains &apos;haplotypes&apos; - sets of discontinuous, genetically-linked sequence alterations on the same chromosomal strand that are typically co-inherited within this haplotype block. The boundaries of haplotype blocks are defined in efforts to identify haplotypes that exist in organisms or populations. A haplotype block may span one sequence alteration or several, and may cover small or large chromosomal regions - depending on the number of recombination events that have occurred between the alterations defining the haplotype.</rdfs:comment> <rdfs:label xml:lang="en">obsolete_haplotype block</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000899 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000899"> <owl:equivalentClass> <owl:Class> <owl:intersectionOf rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000719"/> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/IAO_0000219"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/SO_0001026"/> </owl:Restriction> </owl:intersectionOf> </owl:Class> </owl:equivalentClass> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/GENO_0000385"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/GENO_0000611"/> </owl:Restriction> </rdfs:subClassOf> <obo:IAO_0000115>A genotype that describes the total variation in heritable genomic sequence of a cell or organism, typically in terms of alterations from some reference or background genotype.</obo:IAO_0000115> <obo:IAO_0000116>&apos;Genomic Genotype&apos; vs &apos;Genome&apos; in GENO: A genomic genotype is an information artifact with a representational syntax that can specify what is known about the complete sequence of a genome. This syntax describes &apos;reference&apos; and &apos;variant&apos; components - namely a &apos;background genotype&apos; and &apos;genomic variation complement&apos; - that must be operated on to resolve the genome sequence. Specifically, the genome sequence is determined by substituting all sequences specified by the &apos;genomic variation complement&apos; for the corresponding sequences in the reference &apos;background genotype&apos;. So, while the total sequence content described in a genotype may exceed that of a single a genome (in that it includes a reference genome and variatoin complement), the intended resolution of these sequences is to arrive at a single genome sequence. It is this end-point that we consider when asserting that a genotype &apos;specifies&apos; a genome.</obo:IAO_0000116> <rdfs:comment>1. A genomic genotype is a short-hand specification of a genome that uses a representational syntax comprised of information about a reference genome (&apos;genomic background&apos;), and all specific variants from this reference (the &apos;genomic variation complement&apos;). Conceptually, this variant genome sequence can be resolved by substituting all sequences specified by the &apos;genomic variation complement&apos; for the corresponding sequences in the reference &apos;genomic background&apos; sequence. 2. &apos;Heritable&apos; genomic sequence is that which is passed on to subsequent generations of cells/organisms, and includes all chromosomal sequences, the mitochondrial genome, and any transmissable extrachromosomal replicons.</rdfs:comment> <rdfs:label xml:lang="en">genomic genotype</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000900 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000900"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000901"/> <obo:IAO_0000118>gametic</obo:IAO_0000118> <rdfs:comment>A quality inhering in a particular allele in virtue of its presence in the genome of germ cells in an organism, and therefore having the potential to be inherited by subsequent generations.</rdfs:comment> <rdfs:label xml:lang="en">germline</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000901 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000901"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000788"/> <obo:IAO_0000115>A quality inhering in a particular allele in virtue of its presence only in a particular type of cell in an organism (e.g. somatic vs germ cells)</obo:IAO_0000115> <rdfs:comment>Cellular context of an allele is typically defined in the context of evaluating an individual organism, as alleles that are somatic in one organism can be germline in others.</rdfs:comment> <rdfs:label>allele cellular context</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000902 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000902"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000815"/> <obo:IAO_0000115>The location of a sequence feature in a genome, defined by its start and end position on some reference genomic coordinate system</obo:IAO_0000115> <obo:IAO_0000116>In GENO, the notion of a Genomic Locus plays the same role as that of a FALDO:Region in the design pattern for describing the location of a feature of interest. We define this specific GENO class because the ontological semantics FALDO:Region class are not clear, nor is how it fits into the GENO model. We will work to resolve these questions and ideally converge these concepts in the future. We don&apos;t link a Genomic Locus to a specific reference sequence because in the FALDO model (which GENO adopts with the exception of swapping GENO:Genomic Locus for FALDO:Region), allows the start and end positions of a region to be defined on separate reference sequences. So while a given locus is conceptually associated with a single reference, in practice it can be pragmatic to define start and stop on different references sequences.</obo:IAO_0000116> <obo:IAO_0000116>In practice, GENO advocates describing biology at the level of genomic features - i.e. define specific terms for genes as genomic features, and not duplicate representation of the loci where each gene resides. So we would have a class representing the human Shh gene as a &apos;genomic feature&apos;, but not parallel this with a &apos;human Shh gene locus&apos; class. The utility of the &apos;genomic locus&apos; class in the ontology is primarily to be clear about the distinction, but we would only use it in modeling data if absolutely needed. For example, we would define an &apos;HLA gene block&apos; as a subclass of &apos;genomic feature&apos;, and assert that HLA-A, HLA-B, and HLA-C genes are part/subsequences of this HLA gene block (as opposed to modeling this as an &apos;HLA locus&apos; and asserting that the HLA-A, HLA-B, and HLA-C genes occupy this locus).</obo:IAO_0000116> <obo:IAO_0000118>genomic location</obo:IAO_0000118> <oboInOwl:hasDbXref>VMC:Location</oboInOwl:hasDbXref> <rdfs:comment>1. A genomic locus is defined by its begin and end coordinates on a reference genome, but it is not identified by a particular sequence that may reside there. In GENO, we say that a genomic locus is *occupied_by* a sequence feature. This sequence feature is identified by its sequence and its position in the genome (i.e. the locus it occupies). So the ATG sequence beginning the ORF of the human Shh gene shares the same sequence as the ATG beginning the ORF of the human Akt gene. But these are distinct sequence features because they occupy different loci in the genome. We call sequence features that are located in a genome &apos;genomic features&apos;. 2. A particular locus (e.g. the human Shh gene locus) may be occupied by different sequence features (e.g. different &apos;alleles&apos; of the Shh gene). Within the genome of a single (diploid) organism, there is potential for two sequence features to exit at such a locus (i.e. two different Shh alleles). Across the genomes of all cells comprising members of a species, many more alleles of the Shh gene may exist. These alleles occupy the same genomic locus with different sequences (or no sequence at all in the case of a complete Shh deletion). 3. The notion of a genomic locus in the realm of biological sequences is analogous to a BFO:spatiotemporal region in the realm of physical entities. A spatiotemporal region can be occupied_by physical objects, while a genomic locus is occupied_by sequence features. Just as a spatiotemporal region is distinct from an object that occupies it, so too a genomic locus is distinct from a sequence feature that occupies it. A more concrete analogy can be drawn to the distinction between a street address (the locus) and the building that occupies it (the sequence feature).</rdfs:comment> <rdfs:label xml:lang="en">genomic locus</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000904 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000904"> <owl:equivalentClass> <owl:Class> <owl:unionOf rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/OBI_0100026"/> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/RO_0001000"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/OBI_0100026"/> </owl:Restriction> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/RO_0002351"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/OBI_0100026"/> </owl:Restriction> </owl:unionOf> </owl:Class> </owl:equivalentClass> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/BFO_0000040"/> <obo:GENO_0000905 rdf:datatype="http://www.w3.org/2001/XMLSchema#boolean">true</obo:GENO_0000905> <obo:IAO_0000115>A material entity that is an organism, derived from an organism, or composed of organisms (e.g. a cell line, biosample, tissue culture, population, etc).</obo:IAO_0000115> <obo:IAO_0000116>useful organizational term to collect entities that have genomes/genotypes.</obo:IAO_0000116> <rdfs:label xml:lang="en">organismal entity</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000907 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000907"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_0000110"/> <obo:IAO_0000115>The molecular product resulting from transcription of a single gene (either a protein or RNA molecule)</obo:IAO_0000115> <rdfs:label xml:lang="en">gene product</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000910 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000910"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/OBI_0000086"/> <rdfs:label xml:lang="en">reporter role</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000911 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000911"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/OBI_0000086"/> <rdfs:label xml:lang="en">selectable marker role</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000912 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000912"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000638"/> <rdfs:label xml:lang="en">selectable marker region</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000914 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000914"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_0001026"/> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/GENO_0000239"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/SO_0001505"/> </owl:Restriction> </rdfs:subClassOf> <obo:IAO_0000115>A genome whose sequence is identical to that of a genome sequence considered to be the reference.</obo:IAO_0000115> <rdfs:label xml:lang="en">reference genome</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000915 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000915"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000512"/> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/BFO_0000051"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/SO_0001059"/> </owl:Restriction> </rdfs:subClassOf> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/GENO_0000408"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/GENO_0000916"/> </owl:Restriction> </rdfs:subClassOf> <obo:IAO_0000115>A haplotype is an allele that represents one of many possible versions of a &apos;haplotype block&apos;, which defines a region of genomic sequence that is typically &apos;co-inherited&apos; across generations due to a lack of historically observed recombination within it.</obo:IAO_0000115> <obo:IAO_0000119>Informed by https://isogg.org/wiki/Haplotype and https://en.wikipedia.org/wiki/Haplotype and http://purl.obolibrary.org/obo/SO_0001024 ! haplotype.</obo:IAO_0000119> <rdfs:comment>1. Haplotypes typically contain &apos;genetically-linked&apos; sequence alterations that are likely to be co-inherited and survive descent across many generations of reproduction. A common use of &apos;haplotype&apos; is in phasing of patient WGS or WES data, where theis term refers to sequence containing two or more alterations that are beleived to be &apos;in cis&apos; on the same chromosomal strand. GENO&apos;s definition is consistent with but more inclusive than this view, allowing for haplotypes with one or zero established alterations as long as there is a low probability of recombination within the region it spans (such that alterations found in cis are likely to remain in cis across successive generations). As a result, GENO considers any allele that spans an extent greater than that of a single sequence alteration to represent a haplotype, if there is an expectation of low recombination frequency within the allele. For example, a &apos;gene allele&apos; is a particular version of a gene that contains one or more sequence alterations, and represents a haplotype that spans the extent of a gene. 2. The relationship between &apos;haplotype&apos; and &apos;haplotype block&apos; is analogous to the relationship between &apos;gene allele&apos; and &apos;gene&apos; - a &apos;gene allele&apos; is one of many possible instances of a &apos;gene&apos;, while a &apos;haplotype&apos; is one of many possible instances of a &apos;haplotype block&apos;. In this sense, a gene allele can be considered to be a haplotype whose extent is that of a gene (if it is the case that there is a lack of historic recombination within the extent of the gene) 3. As described at https://en.wikipedia.org/wiki/Haplotype, the term &apos;haplotype&apos; is commonly used to describe three specific cases of genetically-linked alleles within a haplotype block: a. The first is a set of linked &apos;gene alleles&apos; - specific versions of entire genes that reside in tightly linked clusters on a single chromosome. b. The second is a region containing linked &apos;single nucleotide polymorphism&apos; (SNP) alleles that tend to occur together on a chromosomal strand (i.e. be statistically associated). c. A third and less common use is describing individual collections of specific mutations within a given genetic segment - typically short tandem repeats. Each of these more specific definition serves a purpose for a particular type of genetic analysis or use case - e.g. &apos;SNP allele&apos; haplotypes are identified and analysed in studies to uncover the genetic basis of common disease by efforts like the International HapMap Project. The GENO definition of haplotype is broadly inclusive of these and any other scenarios where distinct &apos;alleles&apos; of any kind on the same chromosomal strand are genetically linked and thus tend to be co-inherited across successive generations. This typically covers the case of a &apos;gene allele&apos; (a particular version of a gene) - as most genes span regions of a size that there is little chance of recombination events moving cis alterations onto separate chromosomes.</rdfs:comment> <rdfs:label xml:lang="en">haplotype</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GENO_0000916 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GENO_0000916"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000481"/> <obo:IAO_0000115>A sequence feature representing a region of the genome over which there is little evidence for historical recombination, such that sequences it contain are typically co-inherited/transmitted across generations.</obo:IAO_0000115> <obo:IAO_0000119>Derived from DOI: 10.1126/science.1069424 and http://purl.obolibrary.org/obo/SO_0000355 ! haplotype_block.</obo:IAO_0000119> <rdfs:comment>A haplotype block is a class of genomic sequence defined by a lack of evidence for historical recombination, such that sequence alterations within it tend to be co-inherited across successive generations. A haplotype is considered to be one of many possible versions of a &apos;haplotype block&apos; - defined by the set of co-inherited alterations it contains. In this sense, the relationship between &apos;haplotype&apos; and &apos;haplotype block&apos; is analogous to the relationship between &apos;gene allele&apos; and &apos;gene&apos; - a &apos;gene allele&apos; is one of many possible instances of a &apos;gene&apos;, while a &apos;haplotype&apos; is one of many possible instances of a &apos;haplotype block&apos;. The boundaries of haplotype blocks are defined in efforts to identify haplotypes that exist in organisms or populations. A haplotype block may span one sequence alteration or several, and may cover small or large chromosomal regions - depending on the number of recombination events that have occurred between the alterations defining the haplotype.</rdfs:comment> <rdfs:label xml:lang="en">haplotype block</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GO_0003674 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GO_0003674"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/BFO_0000034"/> <rdfs:label>molecular function</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/GO_0032502 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/GO_0032502"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000351"/> <obo:IAO_0000115>A biological process whose specific outcome is the progression of an integrated living unit: an anatomical structure (which may be a subcellular structure, cell, tissue, or organ), or organism over time from an initial condition to a later condition. [database_cross_reference: GOC:isa_complete]</obo:IAO_0000115> <rdfs:label xml:lang="en">developmental process</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/HP_0000118 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/HP_0000118"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/UPHENO_0001001"/> <rdfs:comment rdf:datatype="http://www.w3.org/2001/XMLSchema#string">pulling in HP &apos;phenotypic abnormality&apos; root here</rdfs:comment> <rdfs:label rdf:datatype="http://www.w3.org/2001/XMLSchema#string">human phenotypic abnormality</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/HsapDv_0000000 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/HsapDv_0000000"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000351"/> <obo:IAO_0000116>Stub class to serve as root of hierarchy for imports of human developmental stages from the Human Developmental Stages Ontology.</obo:IAO_0000116> <obo:IAO_0000119>A spatiotemporal region encompassing some part of the life cycle of an organism.</obo:IAO_0000119> <rdfs:label xml:lang="en">human life cycle stage</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/IAO_0000030 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/IAO_0000030"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/BFO_0000031"/> <obo:IAO_0000111 xml:lang="en">information content entity</obo:IAO_0000111> <obo:IAO_0000112 xml:lang="en">Examples of information content entites include journal articles, data, graphical layouts, and graphs.</obo:IAO_0000112> <obo:IAO_0000114 rdf:resource="http://purl.obolibrary.org/obo/IAO_0000125"/> <obo:IAO_0000115 xml:lang="en">an information content entity is an entity that is generically dependent on some artifact and stands in relation of aboutness to some entity</obo:IAO_0000115> <obo:IAO_0000116 xml:lang="en">information_content_entity &apos;is_encoded_in&apos; some digital_entity in obi before split (040907). information_content_entity &apos;is_encoded_in&apos; some physical_document in obi before split (040907). Previous. An information content entity is a non-realizable information entity that &apos;is encoded in&apos; some digital or physical entity.</obo:IAO_0000116> <obo:IAO_0000117 xml:lang="en">PERSON: Chris Stoeckert</obo:IAO_0000117> <obo:IAO_0000119 xml:lang="en">OBI_0000142</obo:IAO_0000119> <rdfs:label>information content entity</rdfs:label> <rdfs:label xml:lang="en">information content entity</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/IAO_0000102 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/IAO_0000102"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/IAO_0000030"/> <obo:IAO_0000118>ontology metadata</obo:IAO_0000118> <rdfs:label>data about an ontology part</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/MP_0000001 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/MP_0000001"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/UPHENO_0001001"/> <rdfs:comment>where to place this depends on if we take the organismal view or the quality centric view.</rdfs:comment> <rdfs:label rdf:datatype="http://www.w3.org/2001/XMLSchema#string">mammalian phenotype</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/NCBITaxon_10090 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/NCBITaxon_10090"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/OBI_0100026"/> <rdfs:label>Mus musculus</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/NCBITaxon_10239 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/NCBITaxon_10239"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/OBI_0100026"/> <rdfs:comment>Stub class to serve as root of hierarchy for imports of virus types from relevant ontologies or terminologies.</rdfs:comment> <rdfs:label>Viruses</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/NCBITaxon_7955 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/NCBITaxon_7955"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/OBI_0100026"/> <rdfs:label>Danio rerio</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/NCBITaxon_8090 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/NCBITaxon_8090"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/OBI_0100026"/> <rdfs:label>Oryzias latipes</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/NCBITaxon_9606 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/NCBITaxon_9606"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/OBI_0100026"/> <rdfs:label>Homo sapiens</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/OBI_0000011 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/OBI_0000011"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/BFO_0000015"/> <obo:IAO_0000115>A processual entity that realizes a plan which is the concretization of a plan specification.</obo:IAO_0000115> <obo:IAO_0000116>Stub class to serve as root of hierarchy for experimental techniques and processes, defined in GENO or imported from ontologies such as OBI and ERO.</obo:IAO_0000116> <rdfs:label>planned process</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/OBI_0000086 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/OBI_0000086"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/BFO_0000023"/> <rdfs:label xml:lang="en">reagent role</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/OBI_0000181 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/OBI_0000181"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000113"/> <obo:IAO_0000115>a population is a collection of individuals from the same taxonomic class living, counted or sampled at a particular site or in a particular area</obo:IAO_0000115> <rdfs:label xml:lang="en">population</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/OBI_0000435 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/OBI_0000435"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/ERO_0000007"/> <obo:IAO_0000115>An assay which generates data about a genotype from a specimen of genomic DNA. A variety of techniques and instruments can be used to produce information about sequence variation at particular genomic positions.</obo:IAO_0000115> <rdfs:label>genotyping assay</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/OBI_0001148 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/OBI_0001148"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000166"/> <obo:IAO_0000115>A genetic transformation that renders a gene non-functional, e.g. due to a point mutation, or the removal of all, or part of, the gene using recombinant methods.</obo:IAO_0000115> <rdfs:comment>A genetic transformation that involves the insertion of a protein coding cDNA sequence at a particular locus in an organism&apos;s chromosome. Typically, this is done in mice since the technology for this process is more refined, and because mouse embryonic stem cells are easily manipulated. The difference between knock-in technology and transgenic technology is that a knock-in involves a gene inserted into a specific locus, and is a &quot;targeted&quot; insertion.</rdfs:comment> <rdfs:label>targeted gene knock-out technique</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/OBI_0001149 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/OBI_0001149"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000166"/> <rdfs:label xml:lang="en">targeted gene knock-in technique</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/OBI_0100026 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/OBI_0100026"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/BFO_0000040"/> <obo:IAO_0000116>Stub class to serve as root of hierarchy for imports from NCBI Taxonomy.</obo:IAO_0000116> <rdfs:label>organism</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/OBI_0600043 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/OBI_0600043"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/ERO_0000007"/> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/OBI_0000299"/> <owl:someValuesFrom> <owl:Class> <owl:intersectionOf rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000106"/> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/GENO_0000211"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/GENO_0000002"/> </owl:Restriction> </owl:intersectionOf> </owl:Class> </owl:someValuesFrom> </owl:Restriction> </rdfs:subClassOf> <obo:IAO_0000115>the introduction. alteration or integration of genetic material into a cell or organism</obo:IAO_0000115> <rdfs:label>genetic modification technique</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/PATO_0000016 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/PATO_0000016"> <rdfs:subClassOf rdf:resource="http://www.geneontology.org/formats/oboInOwl#ObsoleteClass"/> <obo:IAO_0000116>&apos;Value&apos; label chosen here according to http://www.uwgb.edu/heuerc/2D/ColorTerms.html</obo:IAO_0000116> <obo:IAO_0000116>Was parent of chromosomal band intensity before moving this class to live as a sequence feature attribute.</obo:IAO_0000116> <obo:IAO_0000118>color value</obo:IAO_0000118> <rdfs:label xml:lang="en">obsolete_color brightness</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/PATO_0000383 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/PATO_0000383"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/PATO_0001894"/> <rdfs:label>female</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/PATO_0000384 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/PATO_0000384"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/PATO_0001894"/> <rdfs:label>male</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/PATO_0001894 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/PATO_0001894"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/BFO_0000019"/> <rdfs:label xml:lang="en">phenotypic sex</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/PCO_0000000 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/PCO_0000000"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/BFO_0000040"/> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/RO_0002351"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/OBI_0100026"/> </owl:Restriction> </rdfs:subClassOf> <obo:IAO_0000115>A material entity that consists of two or more organisms, viruses, or viroids.</obo:IAO_0000115> <rdfs:comment>A group of organisms of the same taxonomic group grouped together in virtue of their sharing some commonality (either an inherent attribute or an externally assigned role).</rdfs:comment> <rdfs:label>collection of organisms</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/PCO_0000020 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/PCO_0000020"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/PCO_0000000"/> <obo:IAO_0000115>A domestic group, or a number of domestic groups linked through descent (demonstrated or stipulated) from a common ancestor, marriage, or adoption.</obo:IAO_0000115> <rdfs:label>family</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/SO_0000034 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/SO_0000034"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000533"/> <obo:IAO_0000115>Morpholino oligos are synthesized from four different Morpholino subunits, each of which contains one of the four genetic bases (A, C, G, T) linked to a 6-membered morpholine ring. Eighteen to 25 subunits of these four subunit types are joined in a specific order by non-ionic phosphorodiamidate intersubunit linkages to give a Morpholino.</obo:IAO_0000115> <rdfs:label>morpholino_oligo</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/SO_0000105 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/SO_0000105"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_0000830"/> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/BFO_0000050"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/SO_0000830"/> </owl:Restriction> </rdfs:subClassOf> <obo:IAO_0000112>The descriptor 1p22.3 = chromosome 1, short arm, region 2, band 2, sub-band 3. This is read as &quot;one q two-two point three&quot;, not &quot;one q twenty-two point three&quot;.</obo:IAO_0000112> <obo:IAO_0000115>A region of the chromosome between the centromere and the telomere. Human chromosomes have two arms, the p arm (short) and the q arm (long) which are separated from each other by the centromere.</obo:IAO_0000115> <obo:IAO_0000116>Formerly http://purl.obolibrary.org/obo/GENO_0000613, replaced by SO term.</obo:IAO_0000116> <obo:IAO_0000119>http://ghr.nlm.nih.gov/handbook/howgeneswork/genelocation and http://people.rit.edu/rhrsbi/GeneticsPages/Handouts/ChromosomeNomenclature.pdf, both of which define the nomenclature for the banding hierarchy we use here: chromosome &gt; arm &gt; region &gt; band &gt; sub-band Note that an alternate nomenclature for this hierarchy is here (http://www.ncbi.nlm.nih.gov/Class/MLACourse/Original8Hour/Genetics/chrombanding.html): chromosome &gt; arm &gt; band &gt; sub-band &gt; sub-sub-band</obo:IAO_0000119> <rdfs:label xml:lang="en">chromosome arm</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/SO_0000110 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/SO_0000110"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000701"/> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/GENO_0000239"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/GENO_0000702"/> </owl:Restriction> </rdfs:subClassOf> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/GENO_0000903"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/GENO_0000815"/> </owl:Restriction> </rdfs:subClassOf> <obo:IAO_0000115>Any extent of continuous biological sequence.</obo:IAO_0000115> <obo:IAO_0000116>GENO defines three levels of sequence-related artifacts, which are distinguished by their identity criteria. 1. &apos;Biological sequence&apos; identity is dependent only on the ordering of units that comprise the sequence. 2. &apos;Sequence feature&apos; identity is dependent on its sequence and the genomic position if the sequence (aligns with definition of &apos;sequence feature&apos; in the Sequence Ontology). 3. &apos;Qualified sequence feature&apos; identity is additionally dependent on some aspect of the physical context of the genetic material bearing the feature, extrinsic to its sequence and its genomic position. For example, its being targeted by gene knockdown reagents, its being transgenically expressed in a foreign cell from a recombinant expression construct, its having been epigenetically modified in a way that alters its expression level or pattern, or its being located in a specific cellular or anatomical location.</obo:IAO_0000116> <rdfs:comment>A sequence feature is an extent of biological sequence. An instance of a sequence feature is identified by both its sequence (inherent ordering of units representing nucleic acid or animo acid monomers) and its position (start and stop coordinates based on alignment with some reference feature). By contrast, &apos;biological sequences&apos; are identified and distinguished only by their inehrent sequence, and not their position. Accordingly, the &apos;ATG&apos; start codon in the coding DNA sequence of the human AKT gene is the same &apos;sequence&apos; as the &apos;ATG&apos; start codon in the human SHH gene, but these represent two distinct &apos;sequence features&apos; in virtue of their different positions in the genome.</rdfs:comment> <rdfs:label>sequence_feature</rdfs:label> </owl:Class> <owl:Axiom> <owl:annotatedSource rdf:resource="http://purl.obolibrary.org/obo/SO_0000110"/> <owl:annotatedProperty rdf:resource="http://www.w3.org/2000/01/rdf-schema#subClassOf"/> <owl:annotatedTarget> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/GENO_0000239"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/GENO_0000702"/> </owl:Restriction> </owl:annotatedTarget> <obo:GENO_0000834 rdf:datatype="http://www.w3.org/2001/XMLSchema#boolean">true</obo:GENO_0000834> <rdfs:comment>Formalizes the first identity criteria for a sequence feature of its sequence.</rdfs:comment> </owl:Axiom> <owl:Axiom> <owl:annotatedSource rdf:resource="http://purl.obolibrary.org/obo/SO_0000110"/> <owl:annotatedProperty rdf:resource="http://www.w3.org/2000/01/rdf-schema#subClassOf"/> <owl:annotatedTarget> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/GENO_0000903"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/GENO_0000815"/> </owl:Restriction> </owl:annotatedTarget> <obo:GENO_0000834 rdf:datatype="http://www.w3.org/2001/XMLSchema#boolean">true</obo:GENO_0000834> <rdfs:comment>Formalizes the second identify criteiria for a sequence feature of its genomic position. We use the FALDO model to represent positional information, which links features to positional information through an instance of a Region class that represents the mapping of the feature onto some reference sequence. (But features can also be linked to Positions directly through the location property).</rdfs:comment> </owl:Axiom> <!-- http://purl.obolibrary.org/obo/SO_0000143 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/SO_0000143"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_0001410"/> <obo:IAO_0000115>A region of known length which may be used to manufacture a longer region.</obo:IAO_0000115> <rdfs:label xml:lang="en">assembly_component</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/SO_0000149 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/SO_0000149"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_0000143"/> <obo:IAO_0000115>A contiguous sequence derived from sequence assembly. Has no gaps, but may contain N&apos;s from unavailable bases.</obo:IAO_0000115> <rdfs:label xml:lang="en">contig</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/SO_0000159 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/SO_0000159"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_0001059"/> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/GENO_0000678"/> <owl:hasValue rdf:datatype="http://www.w3.org/2001/XMLSchema#integer">0</owl:hasValue> </owl:Restriction> </rdfs:subClassOf> <obo:IAO_0000115 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">The point at which one or more contiguous nucleotides were excised.</obo:IAO_0000115> <obo:IAO_0000118 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">deleted_sequence</obo:IAO_0000118> <obo:IAO_0000118 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">nucleotide deletion</obo:IAO_0000118> <obo:IAO_0000118 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">nucleotide_deletion</obo:IAO_0000118> <obo:IAO_0000412 rdf:resource="http://purl.obolibrary.org/obo/so.owl"/> <obo:IAO_alt_id rdf:datatype="http://www.w3.org/2001/XMLSchema#string">SO:1000033</obo:IAO_alt_id> <obo:IAO_id rdf:datatype="http://www.w3.org/2001/XMLSchema#string">SO:0000159</obo:IAO_id> <obo:IAO_subset rdf:datatype="http://www.w3.org/2001/XMLSchema#string">SOFA</obo:IAO_subset> <obo:IAO_xref rdf:datatype="http://www.w3.org/2001/XMLSchema#string">http://en.wikipedia.org/wiki/Nucleotide_deletion</obo:IAO_xref> <rdfs:label rdf:datatype="http://www.w3.org/2001/XMLSchema#string">deletion</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/SO_0000165 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/SO_0000165"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_0005836"/> <rdfs:label>enhancer</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/SO_0000167 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/SO_0000167"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_0005836"/> <obo:IAO_0000115>A regulatory_region composed of the TSS(s) and binding sites for TF_complexes of the basal transcription machinery.</obo:IAO_0000115> <rdfs:label>promoter</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/SO_0000199 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/SO_0000199"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_0001059"/> <obo:IAO_0000115 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">A region of nucleotide sequence that has translocated to a new position.</obo:IAO_0000115> <obo:IAO_0000118 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">transchr</obo:IAO_0000118> <obo:IAO_0000118 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">translocated sequence</obo:IAO_0000118> <obo:IAO_0000412 rdf:resource="http://purl.obolibrary.org/obo/so.owl"/> <obo:IAO_id rdf:datatype="http://www.w3.org/2001/XMLSchema#string">SO:0000199</obo:IAO_id> <obo:IAO_subset rdf:datatype="http://www.w3.org/2001/XMLSchema#string">DBVAR</obo:IAO_subset> <rdfs:label rdf:datatype="http://www.w3.org/2001/XMLSchema#string">translocation</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/SO_0000207 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/SO_0000207"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_0000248"/> <obo:IAO_0000118 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">SSLP</obo:IAO_0000118> <obo:IAO_0000118 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">simple sequence length polymorphism</obo:IAO_0000118> <obo:IAO_0000118 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">simple sequence length variation</obo:IAO_0000118> <obo:IAO_0000412 rdf:resource="http://purl.obolibrary.org/obo/so.owl"/> <obo:IAO_id rdf:datatype="http://www.w3.org/2001/XMLSchema#string">SO:0000207</obo:IAO_id> <rdfs:label rdf:datatype="http://www.w3.org/2001/XMLSchema#string">simple_sequence_length_variation</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/SO_0000248 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/SO_0000248"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_1000002"/> <obo:IAO_0000118 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">sequence length variation</obo:IAO_0000118> <obo:IAO_0000412 rdf:resource="http://purl.obolibrary.org/obo/so.owl"/> <obo:IAO_id rdf:datatype="http://www.w3.org/2001/XMLSchema#string">SO:0000248</obo:IAO_id> <rdfs:label rdf:datatype="http://www.w3.org/2001/XMLSchema#string">sequence_length_variation</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/SO_0000281 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/SO_0000281"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_0000704"/> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/GENO_0000207"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/SO_0000783"/> </owl:Restriction> </rdfs:subClassOf> <obo:IAO_0000116>See here for a list of engineered regions in ZFIN: http://zfin.org/cgi-bin/webdriver?MIval=aa-markerselect.apg&amp;marker_type=REGION&amp;query_results=t&amp;compare=contains&amp;WINSIZE=25. Includes things like loxP sites, inducible promoters, ires elements, etc.</obo:IAO_0000116> <rdfs:label>engineered_foreign_gene</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/SO_0000289 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/SO_0000289"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000481"/> <obo:IAO_0000115>A repeat_region containing repeat_units of 2 to 10 bp repeated in tandem.</obo:IAO_0000115> <obo:IAO_0000119>http://en.wikipedia.org/wiki/Microsatellite_%28genetics%29</obo:IAO_0000119> <rdfs:comment>A defined feature that includes any type of VNTR or SSLP locus.</rdfs:comment> <rdfs:label>microsatellite</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/SO_0000337 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/SO_0000337"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000533"/> <rdfs:label xml:lang="en">RNAi_reagent</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/SO_0000340 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/SO_0000340"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000481"/> <obo:IAO_0000115>Structural unit composed of a nucleic acid molecule which controls its own replication through the interaction of specific proteins at one or more origins of replication.</obo:IAO_0000115> <rdfs:comment>A complete chromosome sequence.</rdfs:comment> <rdfs:label>chromosome</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/SO_0000341 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/SO_0000341"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_0000830"/> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/BFO_0000050"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/GENO_0000614"/> </owl:Restriction> </rdfs:subClassOf> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/GENO_0000207"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/GENO_0000618"/> </owl:Restriction> </rdfs:subClassOf> <obo:IAO_0000112>The descriptor 1p22.3 = chromosome 1, short arm, region 2, band 2, sub-band 3. This is read as &quot;one q two-two point three&quot;, not &quot;one q twenty-two point three&quot;.</obo:IAO_0000112> <obo:IAO_0000115>A cytologically distinguishable feature of a chromosome, often made visible by staining, and usually alternating light and dark.</obo:IAO_0000115> <obo:IAO_0000119>http://ghr.nlm.nih.gov/handbook/howgeneswork/genelocation and http://people.rit.edu/rhrsbi/GeneticsPages/Handouts/ChromosomeNomenclature.pdf, both of which define the nomenclature for the banding hierarchy we use here: chromosome &gt; arm &gt; region &gt; band &gt; sub-band Note that an alternate nomenclature for this hierarchy is here (http://www.ncbi.nlm.nih.gov/Class/MLACourse/Original8Hour/Genetics/chrombanding.html): chromosome &gt; arm &gt; band &gt; sub-band &gt; sub-sub-band </obo:IAO_0000119> <rdfs:comment>&quot;Band&apos; is a term of convenience in order to hierarchically organize morphologically defined chromosome features: chromosome &gt; arm &gt; region &gt; band &gt; sub-band.</rdfs:comment> <rdfs:label xml:lang="en">chromosome band</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/SO_0000577 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/SO_0000577"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_0000830"/> <rdfs:label xml:lang="en">centromere</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/SO_0000637 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/SO_0000637"> <rdfs:subClassOf rdf:resource="http://www.geneontology.org/formats/oboInOwl#ObsoleteClass"/> <obo:IAO_0000116>Obsoleted as we didnt want to commit to constructs being plasmids - but rather wanted a classification of more general types of engineered regions used to replicate and deliver sequence to target cells/genomes. Replaced by GENO:0000856 ! engineered genetic construct.</obo:IAO_0000116> <rdfs:label xml:lang="en">obsolete_engineered_plasmid</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/SO_0000667 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/SO_0000667"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_0001059"/> <obo:IAO_0000115 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">The sequence of one or more nucleotides added between two adjacent nucleotides in the sequence.</obo:IAO_0000115> <obo:IAO_0000118 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">insertion</obo:IAO_0000118> <obo:IAO_0000118 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">nucleotide insertion</obo:IAO_0000118> <obo:IAO_0000118 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">nucleotide_insertion</obo:IAO_0000118> <obo:IAO_0000412 rdf:resource="http://purl.obolibrary.org/obo/so.owl"/> <obo:IAO_alt_id rdf:datatype="http://www.w3.org/2001/XMLSchema#string">SO:1000034</obo:IAO_alt_id> <obo:IAO_id rdf:datatype="http://www.w3.org/2001/XMLSchema#string">SO:0000667</obo:IAO_id> <obo:IAO_subset rdf:datatype="http://www.w3.org/2001/XMLSchema#string">DBVAR</obo:IAO_subset> <obo:IAO_subset rdf:datatype="http://www.w3.org/2001/XMLSchema#string">SOFA</obo:IAO_subset> <rdfs:label rdf:datatype="http://www.w3.org/2001/XMLSchema#string">insertion</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/SO_0000694 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/SO_0000694"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_0001483"/> <obo:IAO_0000115 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">SNPs are single base pair positions in genomic DNA at which different sequence alternatives exist in normal individuals in some population(s), wherein the least frequent variant has an abundance of 1% or greater.</obo:IAO_0000115> <obo:IAO_0000118 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">single nucleotide polymorphism</obo:IAO_0000118> <obo:IAO_0000412 rdf:resource="http://purl.obolibrary.org/obo/so.owl"/> <obo:IAO_id rdf:datatype="http://www.w3.org/2001/XMLSchema#string">SO:0000694</obo:IAO_id> <obo:IAO_subset rdf:datatype="http://www.w3.org/2001/XMLSchema#string">SOFA</obo:IAO_subset> <rdfs:label rdf:datatype="http://www.w3.org/2001/XMLSchema#string">SNP</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/SO_0000699 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/SO_0000699"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_0000110"/> <rdfs:comment>A junction is a boundary between regions. A boundary has an extent of zero.</rdfs:comment> <rdfs:label xml:lang="en">junction</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/SO_0000704 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/SO_0000704"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000481"/> <obo:IAO_0000115>A region (or regions) that includes all of the sequence elements necessary to encode a functional transcript. A gene may include regulatory regions, transcribed regions and/or other functional sequence regions.</obo:IAO_0000115> <obo:IAO_0000116>Regarding the distinction between a &apos;gene&apos; and a &apos;gene allele&apos;: Every zebrafish genome contains a &apos;gene allele&apos; for every zebrafish gene. Many will be &apos;wild-type&apos; or at least functional gene alleles. But some may be alleles that are mutated or truncated so as to lack functionality. According to current SO criteria defining genes, a &apos;gene&apos; no longer exists in the case of a non-functional or deleted variant. But the &apos;gene allele&apos; does exist - and its extent is that of the remaining/altered sequence based on alignment with a reference gene. Even for completely deleted genes, an allele of the gene exists (and here is equivalent to the junction corresponding to the where gene would live based on a reference alignment).</obo:IAO_0000116> <rdfs:comment>A gene is any &apos;gene allele&apos; that produces a functional transcript (ie one capable of translation into a protein, or independent functioning as an RNA), when encoded in the genome of some cell or virion.</rdfs:comment> <rdfs:label>gene</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/SO_0000771 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/SO_0000771"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000481"/> <obo:IAO_0000115>A quantitative trait locus (QTL) is a polymorphic locus which contains alleles that differentially affect the expression of a continuously distributed phenotypic trait. Usually it is a marker described by statistical association to quantitative variation in the particular phenotypic trait that is thought to be controlled by the cumulative action of alleles at multiple loci.</obo:IAO_0000115> <obo:IAO_0000118>quantitative trait locus</obo:IAO_0000118> <rdfs:label>QTL</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/SO_0000783 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/SO_0000783"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000788"/> <obo:IAO_0000115>An attribute to describe a region that was modified in vitro.</obo:IAO_0000115> <rdfs:label>engineered</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/SO_0000804 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/SO_0000804"> <owl:equivalentClass> <owl:Class> <owl:intersectionOf rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/SO_0000110"/> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/GENO_0000207"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/SO_0000783"/> </owl:Restriction> </owl:intersectionOf> </owl:Class> </owl:equivalentClass> <obo:IAO_0000118>construct</obo:IAO_0000118> <rdfs:label xml:lang="en">engineered_region</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/SO_0000830 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/SO_0000830"> <owl:equivalentClass> <owl:Class> <owl:intersectionOf rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000481"/> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/GENO_0000248"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/SO_0000340"/> </owl:Restriction> </owl:intersectionOf> </owl:Class> </owl:equivalentClass> <obo:IAO_0000115>An extended region of sequence corresponding to a defined feature that is a proper part of a chromosome, e.g. a chromosomal &apos;arm&apos;, &apos;region&apos;, or &apos;band&apos;.</obo:IAO_0000115> <obo:IAO_0000118>chromosomal feature</obo:IAO_0000118> <obo:IAO_0000118>gross chromosomal part</obo:IAO_0000118> <rdfs:label>chromosome part</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/SO_0000902 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/SO_0000902"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_0000704"/> <obo:IAO_0000115>A gene that has been transferred naturally or by any of a number of genetic engineering techniques into a cell or organism where it is foreign (i.e. does not belong to the host genome).</obo:IAO_0000115> <rdfs:comment>Transgenes can exist as integrated into the host genome, or extra-chromosomally on replicons or transiently carried/expressed vectors. What matters is that they are active in the context of a foreign biological system (typically a cell or organism). Note that transgenes as defined here are not necessarily from a different taxon than that of the host genome. For example, a Mus musculus gene over-expressed from a chromosomally-integrated expression construct in a Mus musculus genome qualifies as a transgene because it is exogenous to the host genome.</rdfs:comment> <rdfs:label xml:lang="en">transgene</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/SO_0001013 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/SO_0001013"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_1000002"/> <obo:IAO_0000115 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">A multiple nucleotide polymorphism with alleles of common length &gt; 1, for example AAA/TTT.</obo:IAO_0000115> <obo:IAO_0000118 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">multiple nucleotide polymorphism</obo:IAO_0000118> <obo:IAO_0000412 rdf:resource="http://purl.obolibrary.org/obo/so.owl"/> <obo:IAO_id rdf:datatype="http://www.w3.org/2001/XMLSchema#string">SO:0001013</obo:IAO_id> <rdfs:label rdf:datatype="http://www.w3.org/2001/XMLSchema#string">MNP</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/SO_0001019 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/SO_0001019"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_0001059"/> <obo:IAO_0000115 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">A variation that increases or decreases the copy number of a given region.</obo:IAO_0000115> <obo:IAO_0000118 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">CNP</obo:IAO_0000118> <obo:IAO_0000118 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">CNV</obo:IAO_0000118> <obo:IAO_0000118 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">copy number polymorphism</obo:IAO_0000118> <obo:IAO_0000118 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">copy number variation</obo:IAO_0000118> <obo:IAO_0000412 rdf:resource="http://purl.obolibrary.org/obo/so.owl"/> <obo:IAO_id rdf:datatype="http://www.w3.org/2001/XMLSchema#string">SO:0001019</obo:IAO_id> <obo:IAO_subset rdf:datatype="http://www.w3.org/2001/XMLSchema#string">SOFA</obo:IAO_subset> <obo:IAO_xref rdf:datatype="http://www.w3.org/2001/XMLSchema#string">http://en.wikipedia.org/wiki/Copy_number_variation</obo:IAO_xref> <rdfs:label rdf:datatype="http://www.w3.org/2001/XMLSchema#string">copy_number_variation</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/SO_0001026 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/SO_0001026"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000660"/> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/RO_0002162"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/OBI_0100026"/> </owl:Restriction> </rdfs:subClassOf> <obo:IAO_0000115>A collection of sequence features (typically a collection of chromosomes) that covers the sum genetic material within a cell or virion (where &apos;genetic material&apos; refers to any nucleic acid that is part of a cell or virion and has been inherited from an ancestor cell or virion, and/or can be replicated and inherited by its progeny)</obo:IAO_0000115> <obo:IAO_0000116>Genotype vs Genome in GENO: An (intrinsic) genotype is an information artifact representing an indirect syntax for specifying a genome sequence. This syntax has reference and variant components - a &apos;referrence genome&apos; and &apos;genomic variation complement&apos; - that must be operated on to resolve a specifie genome sequence. Specifically, the genome sequence is resolved by substituting all sequences specified by the &apos;genomic variation complement&apos; for the corresponding sequences in the &apos;reference genome&apos;. So, while the total sequence content represented in a genotype may be greater than that in a genome, the intended resolution of these sequences is to arrive at a single genome sequence.</obo:IAO_0000116> <obo:IAO_0000118>&apos;genome sequence&apos;</obo:IAO_0000118> <rdfs:comment>A genome is considered the complement of all heritable sequence features in a given cell or organism (chromosomal or extrachromosomal). This is typically a collection of chromosomes, but in some organisms (e.g. bacteria) it may be a single chromosomal entity. For this reason &apos;genome&apos; classifies under &apos;sequence feature complement&apos; rather than &apos;sequence feature collection&apos;.</rdfs:comment> <rdfs:label>genome</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/SO_0001059 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/SO_0001059"> <owl:equivalentClass> <owl:Class> <owl:intersectionOf rdf:parseType="Collection"> <rdf:Description rdf:about="http://purl.obolibrary.org/obo/GENO_0000512"/> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/GENO_0000784"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/GENO_0000481"/> </owl:Restriction> </owl:intersectionOf> </owl:Class> </owl:equivalentClass> <obo:IAO_0000112>A few examples highlighting the distinction of &apos;sequence alterations&apos; from their parent &apos;variant allele&apos;: 1. Consider NM_000059.3(BRCA2):c.631G&gt;A variation in the BRCA2 gene. This mutation of a single nucleotide creates a gene allele whose extent is that of the entire BRCA2 gene. This version of the full BRCA2 gene is a &apos;variant allele&apos;, while the extent of sequence spanning just the single altered base is a &apos;sequence alteration&apos;. See https://www.ncbi.nlm.nih.gov/snp/80358871. 2. Consider the NM_000059.3(BRCA2):c.132_133ins8 variation in the BRCA2 gene. This 8 bp insertion creates a gene allele whose extent is that of the entire BRCA2 gene. This version of the full BRCA2 gene is a &apos;variant allele&apos;, while the extent of sequence spanning just the 8 bp insertion is a &apos;sequence alteration&apos;. See https://www.ncbi.nlm.nih.gov/snp/483353112. 3. Consider the NM_000059.3(BRCA2):c.22_23delAG variation in the BRCA2 gene. This 2 bp deletion creates a gene allele whose extent is that of the entire BRCA2 gene. This version of the full BRCA2 gene is a &apos;variant allele&apos;, while the junction where the deletion occured is a &apos;sequence alteration&apos; with an extent of zero. See https://www.ncbi.nlm.nih.gov/snp/483353112.</obo:IAO_0000112> <obo:IAO_0000115 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">A sequence_alteration is a sequence_feature whose extent is the deviation from another sequence.</obo:IAO_0000115> <obo:IAO_0000118 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">sequence variation</obo:IAO_0000118> <obo:IAO_0000412 rdf:resource="http://purl.obolibrary.org/obo/so.owl"/> <obo:IAO_alt_id rdf:datatype="http://www.w3.org/2001/XMLSchema#string">SO:1000004</obo:IAO_alt_id> <obo:IAO_alt_id rdf:datatype="http://www.w3.org/2001/XMLSchema#string">SO:1000007</obo:IAO_alt_id> <obo:IAO_id rdf:datatype="http://www.w3.org/2001/XMLSchema#string">SO:0001059</obo:IAO_id> <obo:IAO_subset rdf:datatype="http://www.w3.org/2001/XMLSchema#string">SOFA</obo:IAO_subset> <rdfs:comment>1. A &apos;sequence alteration&apos; is an allele whose sequence deviates in its entirety from that of other features found at the same genomic location (i.e. it deviates along its entire extent). In this sense, &apos;sequence alterations&apos; represent the minimal extent an allele can take - i.e. that which is variable with some other feature along its entire sequence). An example is a SNP or insertion. Alleles whose extent goes beyond the specific sequence that is known to be variable are not sequence alterations. These are alleles that represent alternate versions of some larger, named feature. The classic example here is a &apos;gene allele&apos;, which spans the extent of an entire gene, and contains one or more sequence alterations (regions known to vary) as part. 2. Sequence alterations are not necessarily &apos;variant&apos; in the sense defined in GENO (i.e. being &apos;variant with&apos; some reference sequence). In any comparison of alleles at a particular location, the choice of a &apos;reference&apos; is context-dependent - as comparisons in other contexts might consider a different allele to be the reference. So while sequence alterations are usually considered &apos;variant&apos; in the context in which they are considered, this variant status may not hold at all times. For this reason, the &apos;sequence alteration&apos; class is not made an rdfs:subClassOf &apos;variant allele&apos;. For a particular instance of a sequence alteration, howver, we may in some cases be able to rdf:type it as a &apos;varaint allele&apos; and a &apos;sequence alteration&apos;, in situations where we can be confident that the feature will *never* be considered a reference. For example, experimentally generated mutations in model organism genes that are created expressly to vary from an established reference. 3. Note that we consider novel features gained in a genome to be sequence alterations, including aneusomic chromosomes gained through a non-disjunction event during replication, or extrachromosomal replicons that become part of the heritable genome of a cell or organism.</rdfs:comment> <rdfs:label rdf:datatype="http://www.w3.org/2001/XMLSchema#string">sequence_alteration</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/SO_0001218 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/SO_0001218"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_0000667"/> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/BFO_0000051"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/GENO_0000093"/> </owl:Restriction> </rdfs:subClassOf> <obo:IAO_0000115 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">An insertion that derives from another organism, via the use of recombinant DNA technology.</obo:IAO_0000115> <obo:IAO_0000118 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">transgenic insertion</obo:IAO_0000118> <obo:IAO_0000412 rdf:resource="http://purl.obolibrary.org/obo/so.owl"/> <obo:IAO_id rdf:datatype="http://www.w3.org/2001/XMLSchema#string">SO:0001218</obo:IAO_id> <rdfs:label rdf:datatype="http://www.w3.org/2001/XMLSchema#string">transgenic_insertion</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/SO_0001410 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/SO_0001410"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_0000110"/> <obo:IAO_0000115>A region which is the result of some arbitrary experimental procedure. The procedure may be carried out with biological material or inside a computer.</obo:IAO_0000115> <rdfs:label xml:lang="en">experimental_feature</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/SO_0001477 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/SO_0001477"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000856"/> <obo:IAO_0000115>A construct which is designed to integrate into a genome and produce a fusion transcript between exons of the gene into which it inserts and a reporter element in the construct. Gene traps contain a splice acceptor, do not contain promoter elements for the reporter, and are mutagenic. Gene traps may be bicistronic with the second cassette containing a promoter driving an a selectable marker.</obo:IAO_0000115> <rdfs:label xml:lang="en">gene_trap_construct</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/SO_0001478 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/SO_0001478"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000856"/> <obo:IAO_0000115>A construct which is designed to integrate into a genome and express a reporter when inserted in close proximity to a promoter element. Promoter traps typically do not contain promoter elements and are mutagenic.</obo:IAO_0000115> <rdfs:label xml:lang="en">promoter_trap_construct</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/SO_0001479 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/SO_0001479"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000856"/> <obo:IAO_0000115>A construct which is designed to integrate into a genome and express a reporter when the expression from a basic minimal promoter is enhanced by genomic enhancer elements. Enhancer traps contain promoter elements and are not usually mutagenic.</obo:IAO_0000115> <rdfs:label xml:lang="en">enhancer_trap_construct</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/SO_0001483 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/SO_0001483"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_1000002"/> <obo:IAO_0000115 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">SNVs are single base pair positions in genomic DNA at which different sequence alternatives exist.</obo:IAO_0000115> <obo:IAO_0000118 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">single nucleotide variant</obo:IAO_0000118> <obo:IAO_0000412 rdf:resource="http://purl.obolibrary.org/obo/so.owl"/> <obo:IAO_created_by rdf:datatype="http://www.w3.org/2001/XMLSchema#string">kareneilbeck</obo:IAO_created_by> <obo:IAO_creation_date rdf:datatype="http://www.w3.org/2001/XMLSchema#string">Thu Oct 08 11:37:49 PDT 2009</obo:IAO_creation_date> <obo:IAO_id rdf:datatype="http://www.w3.org/2001/XMLSchema#string">SO:0001483</obo:IAO_id> <obo:IAO_subset rdf:datatype="http://www.w3.org/2001/XMLSchema#string">SOFA</obo:IAO_subset> <rdfs:label rdf:datatype="http://www.w3.org/2001/XMLSchema#string">SNV</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/SO_0001500 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/SO_0001500"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000481"/> <obo:IAO_0000115>A biological_region characterized as a single heritable trait in a phenotype screen. The heritable phenotype may be mapped to a chromosome but generally has not been characterized to a specific gene locus.</obo:IAO_0000115> <rdfs:label xml:lang="en">heritable_phenotypic_marker</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/SO_0001505 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/SO_0001505"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000017"/> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/RO_0000087"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/GENO_0000152"/> </owl:Restriction> </rdfs:subClassOf> <obo:IAO_0000112>&apos;GRCh37.p10&apos; (a human reference genome build)</obo:IAO_0000112> <obo:IAO_0000115>A genome sequence that is used as a standard against which other genome sequences are compared, or into which alterations are intentionally introduced.</obo:IAO_0000115> <rdfs:label>reference genome sequence</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/SO_0001742 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/SO_0001742"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_0001019"/> <obo:IAO_0000115 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">A sequence alteration whereby the copy number of a given regions is greater than the reference sequence.</obo:IAO_0000115> <obo:IAO_0000118 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">copy number gain</obo:IAO_0000118> <obo:IAO_0000118 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">gain</obo:IAO_0000118> <obo:IAO_0000412 rdf:resource="http://purl.obolibrary.org/obo/so.owl"/> <obo:IAO_created_by rdf:datatype="http://www.w3.org/2001/XMLSchema#string">kareneilbeck</obo:IAO_created_by> <obo:IAO_creation_date rdf:datatype="http://www.w3.org/2001/XMLSchema#string">Mon Feb 28 01:54:09 PST 2011</obo:IAO_creation_date> <obo:IAO_id rdf:datatype="http://www.w3.org/2001/XMLSchema#string">SO:0001742</obo:IAO_id> <obo:IAO_subset rdf:datatype="http://www.w3.org/2001/XMLSchema#string">DBVAR</obo:IAO_subset> <rdfs:label rdf:datatype="http://www.w3.org/2001/XMLSchema#string">copy_number_gain</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/SO_0001743 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/SO_0001743"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_0001019"/> <obo:IAO_0000115 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">A sequence alteration whereby the copy number of a given region is less than the reference sequence.</obo:IAO_0000115> <obo:IAO_0000118 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">copy number loss</obo:IAO_0000118> <obo:IAO_0000118 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">loss</obo:IAO_0000118> <obo:IAO_0000412 rdf:resource="http://purl.obolibrary.org/obo/so.owl"/> <obo:IAO_created_by rdf:datatype="http://www.w3.org/2001/XMLSchema#string">kareneilbeck</obo:IAO_created_by> <obo:IAO_creation_date rdf:datatype="http://www.w3.org/2001/XMLSchema#string">Mon Feb 28 01:55:02 PST 2011</obo:IAO_creation_date> <obo:IAO_id rdf:datatype="http://www.w3.org/2001/XMLSchema#string">SO:0001743</obo:IAO_id> <obo:IAO_subset rdf:datatype="http://www.w3.org/2001/XMLSchema#string">DBVAR</obo:IAO_subset> <rdfs:label rdf:datatype="http://www.w3.org/2001/XMLSchema#string">copy_number_loss</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/SO_0001744 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/SO_0001744"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_0001059"/> <obo:IAO_0000115 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">Uniparental disomy is a sequence_alteration where a diploid individual receives two copies for all or part of a chromosome from one parent and no copies of the same chromosome or region from the other parent.</obo:IAO_0000115> <obo:IAO_0000118 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">UPD</obo:IAO_0000118> <obo:IAO_0000118 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">uniparental disomy</obo:IAO_0000118> <obo:IAO_0000412 rdf:resource="http://purl.obolibrary.org/obo/so.owl"/> <obo:IAO_created_by rdf:datatype="http://www.w3.org/2001/XMLSchema#string">kareneilbeck</obo:IAO_created_by> <obo:IAO_creation_date rdf:datatype="http://www.w3.org/2001/XMLSchema#string">Mon Feb 28 02:01:05 PST 2011</obo:IAO_creation_date> <obo:IAO_id rdf:datatype="http://www.w3.org/2001/XMLSchema#string">SO:0001744</obo:IAO_id> <obo:IAO_subset rdf:datatype="http://www.w3.org/2001/XMLSchema#string">DBVAR</obo:IAO_subset> <obo:IAO_xref rdf:datatype="http://www.w3.org/2001/XMLSchema#string">http:http\://en.wikipedia.org/wiki/Uniparental_disomy</obo:IAO_xref> <rdfs:label rdf:datatype="http://www.w3.org/2001/XMLSchema#string">UPD</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/SO_0001745 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/SO_0001745"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_0001744"/> <obo:IAO_0000115 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">Uniparental disomy is a sequence_alteration where a diploid individual receives two copies for all or part of a chromosome from the mother and no copies of the same chromosome or region from the father.</obo:IAO_0000115> <obo:IAO_0000118 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">maternal uniparental disomy</obo:IAO_0000118> <obo:IAO_0000412 rdf:resource="http://purl.obolibrary.org/obo/so.owl"/> <obo:IAO_created_by rdf:datatype="http://www.w3.org/2001/XMLSchema#string">kareneilbeck</obo:IAO_created_by> <obo:IAO_creation_date rdf:datatype="http://www.w3.org/2001/XMLSchema#string">Mon Feb 28 02:03:01 PST 2011</obo:IAO_creation_date> <obo:IAO_id rdf:datatype="http://www.w3.org/2001/XMLSchema#string">SO:0001745</obo:IAO_id> <rdfs:label rdf:datatype="http://www.w3.org/2001/XMLSchema#string">maternal_uniparental_disomy</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/SO_0001746 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/SO_0001746"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_0001744"/> <obo:IAO_0000115 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">Uniparental disomy is a sequence_alteration where a diploid individual receives two copies for all or part of a chromosome from the father and no copies of the same chromosome or region from the mother.</obo:IAO_0000115> <obo:IAO_0000118 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">paternal uniparental disomy</obo:IAO_0000118> <obo:IAO_0000412 rdf:resource="http://purl.obolibrary.org/obo/so.owl"/> <obo:IAO_created_by rdf:datatype="http://www.w3.org/2001/XMLSchema#string">kareneilbeck</obo:IAO_created_by> <obo:IAO_creation_date rdf:datatype="http://www.w3.org/2001/XMLSchema#string">Mon Feb 28 02:03:30 PST 2011</obo:IAO_creation_date> <obo:IAO_id rdf:datatype="http://www.w3.org/2001/XMLSchema#string">SO:0001746</obo:IAO_id> <rdfs:label rdf:datatype="http://www.w3.org/2001/XMLSchema#string">paternal_uniparental_disomy</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/SO_0001784 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/SO_0001784"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_0001785"/> <obo:IAO_0000115 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">A structural sequence alteration where there are multiple equally plausible explanations for the change.</obo:IAO_0000115> <obo:IAO_0000118 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">complex</obo:IAO_0000118> <obo:IAO_0000412 rdf:resource="http://purl.obolibrary.org/obo/so.owl"/> <obo:IAO_created_by rdf:datatype="http://www.w3.org/2001/XMLSchema#string">kareneilbeck</obo:IAO_created_by> <obo:IAO_creation_date rdf:datatype="http://www.w3.org/2001/XMLSchema#string">Wed Mar 23 03:21:19 PDT 2011</obo:IAO_creation_date> <obo:IAO_id rdf:datatype="http://www.w3.org/2001/XMLSchema#string">SO:0001784</obo:IAO_id> <obo:IAO_subset rdf:datatype="http://www.w3.org/2001/XMLSchema#string">DBVAR</obo:IAO_subset> <rdfs:label rdf:datatype="http://www.w3.org/2001/XMLSchema#string">complex_structural_alteration</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/SO_0001785 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/SO_0001785"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_0001059"/> <obo:IAO_0000412 rdf:resource="http://purl.obolibrary.org/obo/so.owl"/> <obo:IAO_created_by rdf:datatype="http://www.w3.org/2001/XMLSchema#string">kareneilbeck</obo:IAO_created_by> <obo:IAO_creation_date rdf:datatype="http://www.w3.org/2001/XMLSchema#string">Fri Mar 25 02:27:41 PDT 2011</obo:IAO_creation_date> <obo:IAO_id rdf:datatype="http://www.w3.org/2001/XMLSchema#string">SO:0001785</obo:IAO_id> <obo:IAO_subset rdf:datatype="http://www.w3.org/2001/XMLSchema#string">DBVAR</obo:IAO_subset> <rdfs:label rdf:datatype="http://www.w3.org/2001/XMLSchema#string">structural_alteration</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/SO_0005836 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/SO_0005836"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000666"/> <obo:IAO_0000116>Formerly http://purl.obolibrary.org/obo/GENO_0000067, replaced with SO term.</obo:IAO_0000116> <obo:IAO_0000118>regulatory element</obo:IAO_0000118> <obo:IAO_0000118>regulatory gene region</obo:IAO_0000118> <rdfs:label>regulatory_region</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/SO_1000002 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/SO_1000002"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_0001059"/> <obo:IAO_0000115 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">Any change in genomic DNA caused by a single event.</obo:IAO_0000115> <obo:IAO_0000412 rdf:resource="http://purl.obolibrary.org/obo/so.owl"/> <obo:IAO_id rdf:datatype="http://www.w3.org/2001/XMLSchema#string">SO:1000002</obo:IAO_id> <obo:IAO_subset rdf:datatype="http://www.w3.org/2001/XMLSchema#string">SOFA</obo:IAO_subset> <rdfs:label rdf:datatype="http://www.w3.org/2001/XMLSchema#string">substitution</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/SO_1000005 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/SO_1000005"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_1000002"/> <obo:IAO_0000115 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">When no simple or well defined DNA mutation event describes the observed DNA change, the keyword \&quot;complex\&quot; should be used. Usually there are multiple equally plausible explanations for the change.</obo:IAO_0000115> <obo:IAO_0000118 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">complex substitution</obo:IAO_0000118> <obo:IAO_0000412 rdf:resource="http://purl.obolibrary.org/obo/so.owl"/> <obo:IAO_id rdf:datatype="http://www.w3.org/2001/XMLSchema#string">SO:1000005</obo:IAO_id> <obo:IAO_subset rdf:datatype="http://www.w3.org/2001/XMLSchema#string">SOFA</obo:IAO_subset> <rdfs:label rdf:datatype="http://www.w3.org/2001/XMLSchema#string">complex_substitution</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/SO_1000008 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/SO_1000008"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_0001483"/> <obo:IAO_0000115 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">A single nucleotide change which has occurred at the same position of a corresponding nucleotide in a reference sequence.</obo:IAO_0000115> <obo:IAO_0000118 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">point mutation</obo:IAO_0000118> <obo:IAO_0000412 rdf:resource="http://purl.obolibrary.org/obo/so.owl"/> <obo:IAO_id rdf:datatype="http://www.w3.org/2001/XMLSchema#string">SO:1000008</obo:IAO_id> <obo:IAO_subset rdf:datatype="http://www.w3.org/2001/XMLSchema#string">SOFA</obo:IAO_subset> <obo:IAO_xref rdf:datatype="http://www.w3.org/2001/XMLSchema#string">http://en.wikipedia.org/wiki/Point_mutation</obo:IAO_xref> <rdfs:label rdf:datatype="http://www.w3.org/2001/XMLSchema#string">point_mutation</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/SO_1000009 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/SO_1000009"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_0001483"/> <obo:IAO_0000115 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">Change of a pyrimidine nucleotide, C or T, into an other pyrimidine nucleotide, or change of a purine nucleotide, A or G, into an other purine nucleotide.</obo:IAO_0000115> <obo:IAO_0000412 rdf:resource="http://purl.obolibrary.org/obo/so.owl"/> <obo:IAO_id rdf:datatype="http://www.w3.org/2001/XMLSchema#string">SO:1000009</obo:IAO_id> <rdfs:label rdf:datatype="http://www.w3.org/2001/XMLSchema#string">transition</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/SO_1000010 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/SO_1000010"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_1000009"/> <obo:IAO_0000115 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">A substitution of a pyrimidine, C or T, for another pyrimidine.</obo:IAO_0000115> <obo:IAO_0000118 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">pyrimidine transition</obo:IAO_0000118> <obo:IAO_0000412 rdf:resource="http://purl.obolibrary.org/obo/so.owl"/> <obo:IAO_id rdf:datatype="http://www.w3.org/2001/XMLSchema#string">SO:1000010</obo:IAO_id> <rdfs:label rdf:datatype="http://www.w3.org/2001/XMLSchema#string">pyrimidine_transition</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/SO_1000011 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/SO_1000011"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_1000010"/> <obo:IAO_0000115 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">A transition of a cytidine to a thymine.</obo:IAO_0000115> <obo:IAO_0000118 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">C to T transition</obo:IAO_0000118> <obo:IAO_0000412 rdf:resource="http://purl.obolibrary.org/obo/so.owl"/> <obo:IAO_id rdf:datatype="http://www.w3.org/2001/XMLSchema#string">SO:1000011</obo:IAO_id> <rdfs:label rdf:datatype="http://www.w3.org/2001/XMLSchema#string">C_to_T_transition</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/SO_1000012 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/SO_1000012"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_1000011"/> <obo:IAO_0000115 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">The transition of cytidine to thymine occurring at a pCpG site as a consequence of the spontaneous deamination of 5&apos;-methylcytidine.</obo:IAO_0000115> <obo:IAO_0000118 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">C to T transition at pCpG site</obo:IAO_0000118> <obo:IAO_0000412 rdf:resource="http://purl.obolibrary.org/obo/so.owl"/> <obo:IAO_id rdf:datatype="http://www.w3.org/2001/XMLSchema#string">SO:1000012</obo:IAO_id> <rdfs:label rdf:datatype="http://www.w3.org/2001/XMLSchema#string">C_to_T_transition_at_pCpG_site</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/SO_1000013 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/SO_1000013"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_1000010"/> <obo:IAO_0000118 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">T to C transition</obo:IAO_0000118> <obo:IAO_0000412 rdf:resource="http://purl.obolibrary.org/obo/so.owl"/> <obo:IAO_id rdf:datatype="http://www.w3.org/2001/XMLSchema#string">SO:1000013</obo:IAO_id> <rdfs:label rdf:datatype="http://www.w3.org/2001/XMLSchema#string">T_to_C_transition</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/SO_1000014 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/SO_1000014"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_1000009"/> <obo:IAO_0000115 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">A substitution of a purine, A or G, for another purine.</obo:IAO_0000115> <obo:IAO_0000118 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">purine transition</obo:IAO_0000118> <obo:IAO_0000412 rdf:resource="http://purl.obolibrary.org/obo/so.owl"/> <obo:IAO_id rdf:datatype="http://www.w3.org/2001/XMLSchema#string">SO:1000014</obo:IAO_id> <rdfs:label rdf:datatype="http://www.w3.org/2001/XMLSchema#string">purine_transition</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/SO_1000015 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/SO_1000015"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_1000014"/> <obo:IAO_0000115 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">A transition of an adenine to a guanine.</obo:IAO_0000115> <obo:IAO_0000118 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">A to G transition</obo:IAO_0000118> <obo:IAO_0000412 rdf:resource="http://purl.obolibrary.org/obo/so.owl"/> <obo:IAO_id rdf:datatype="http://www.w3.org/2001/XMLSchema#string">SO:1000015</obo:IAO_id> <rdfs:label rdf:datatype="http://www.w3.org/2001/XMLSchema#string">A_to_G_transition</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/SO_1000016 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/SO_1000016"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_1000014"/> <obo:IAO_0000115 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">A transition of a guanine to an adenine.</obo:IAO_0000115> <obo:IAO_0000118 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">G to A transition</obo:IAO_0000118> <obo:IAO_0000412 rdf:resource="http://purl.obolibrary.org/obo/so.owl"/> <obo:IAO_id rdf:datatype="http://www.w3.org/2001/XMLSchema#string">SO:1000016</obo:IAO_id> <rdfs:label rdf:datatype="http://www.w3.org/2001/XMLSchema#string">G_to_A_transition</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/SO_1000017 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/SO_1000017"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_0001483"/> <obo:IAO_0000115 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">Change of a pyrimidine nucleotide, C or T, into a purine nucleotide, A or G, or vice versa.</obo:IAO_0000115> <obo:IAO_0000412 rdf:resource="http://purl.obolibrary.org/obo/so.owl"/> <obo:IAO_id rdf:datatype="http://www.w3.org/2001/XMLSchema#string">SO:1000017</obo:IAO_id> <obo:IAO_xref rdf:datatype="http://www.w3.org/2001/XMLSchema#string">http://en.wikipedia.org/wiki/Transversion</obo:IAO_xref> <rdfs:label rdf:datatype="http://www.w3.org/2001/XMLSchema#string">transversion</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/SO_1000018 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/SO_1000018"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_1000017"/> <obo:IAO_0000115 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">Change of a pyrimidine nucleotide, C or T, into a purine nucleotide, A or G.</obo:IAO_0000115> <obo:IAO_0000118 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">pyrimidine to purine transversion</obo:IAO_0000118> <obo:IAO_0000412 rdf:resource="http://purl.obolibrary.org/obo/so.owl"/> <obo:IAO_id rdf:datatype="http://www.w3.org/2001/XMLSchema#string">SO:1000018</obo:IAO_id> <rdfs:label rdf:datatype="http://www.w3.org/2001/XMLSchema#string">pyrimidine_to_purine_transversion</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/SO_1000019 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/SO_1000019"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_1000018"/> <obo:IAO_0000115 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">A transversion from cytidine to adenine.</obo:IAO_0000115> <obo:IAO_0000118 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">C to A transversion</obo:IAO_0000118> <obo:IAO_0000412 rdf:resource="http://purl.obolibrary.org/obo/so.owl"/> <obo:IAO_id rdf:datatype="http://www.w3.org/2001/XMLSchema#string">SO:1000019</obo:IAO_id> <rdfs:label rdf:datatype="http://www.w3.org/2001/XMLSchema#string">C_to_A_transversion</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/SO_1000020 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/SO_1000020"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_1000018"/> <obo:IAO_0000118 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">C to G transversion</obo:IAO_0000118> <obo:IAO_0000412 rdf:resource="http://purl.obolibrary.org/obo/so.owl"/> <obo:IAO_id rdf:datatype="http://www.w3.org/2001/XMLSchema#string">SO:1000020</obo:IAO_id> <rdfs:label rdf:datatype="http://www.w3.org/2001/XMLSchema#string">C_to_G_transversion</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/SO_1000021 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/SO_1000021"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_1000018"/> <obo:IAO_0000115 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">A transversion from T to A.</obo:IAO_0000115> <obo:IAO_0000118 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">T to A transversion</obo:IAO_0000118> <obo:IAO_0000412 rdf:resource="http://purl.obolibrary.org/obo/so.owl"/> <obo:IAO_id rdf:datatype="http://www.w3.org/2001/XMLSchema#string">SO:1000021</obo:IAO_id> <rdfs:label rdf:datatype="http://www.w3.org/2001/XMLSchema#string">T_to_A_transversion</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/SO_1000022 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/SO_1000022"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_1000018"/> <obo:IAO_0000115 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">A transversion from T to G.</obo:IAO_0000115> <obo:IAO_0000118 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">T to G transversion</obo:IAO_0000118> <obo:IAO_0000412 rdf:resource="http://purl.obolibrary.org/obo/so.owl"/> <obo:IAO_id rdf:datatype="http://www.w3.org/2001/XMLSchema#string">SO:1000022</obo:IAO_id> <rdfs:label rdf:datatype="http://www.w3.org/2001/XMLSchema#string">T_to_G_transversion</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/SO_1000023 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/SO_1000023"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_1000017"/> <obo:IAO_0000115 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">Change of a purine nucleotide, A or G , into a pyrimidine nucleotide C or T.</obo:IAO_0000115> <obo:IAO_0000118 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">purine to pyrimidine transversion</obo:IAO_0000118> <obo:IAO_0000412 rdf:resource="http://purl.obolibrary.org/obo/so.owl"/> <obo:IAO_id rdf:datatype="http://www.w3.org/2001/XMLSchema#string">SO:1000023</obo:IAO_id> <rdfs:label rdf:datatype="http://www.w3.org/2001/XMLSchema#string">purine_to_pyrimidine_transversion</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/SO_1000024 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/SO_1000024"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_1000023"/> <obo:IAO_0000115 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">A transversion from adenine to cytidine.</obo:IAO_0000115> <obo:IAO_0000118 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">A to C transversion</obo:IAO_0000118> <obo:IAO_0000412 rdf:resource="http://purl.obolibrary.org/obo/so.owl"/> <obo:IAO_id rdf:datatype="http://www.w3.org/2001/XMLSchema#string">SO:1000024</obo:IAO_id> <rdfs:label rdf:datatype="http://www.w3.org/2001/XMLSchema#string">A_to_C_transversion</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/SO_1000025 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/SO_1000025"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_1000023"/> <obo:IAO_0000115 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">A transversion from adenine to thymine.</obo:IAO_0000115> <obo:IAO_0000118 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">A to T transversion</obo:IAO_0000118> <obo:IAO_0000412 rdf:resource="http://purl.obolibrary.org/obo/so.owl"/> <obo:IAO_id rdf:datatype="http://www.w3.org/2001/XMLSchema#string">SO:1000025</obo:IAO_id> <rdfs:label rdf:datatype="http://www.w3.org/2001/XMLSchema#string">A_to_T_transversion</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/SO_1000026 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/SO_1000026"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_1000023"/> <obo:IAO_0000115 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">A transversion from guanine to cytidine.</obo:IAO_0000115> <obo:IAO_0000118 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">G to C transversion</obo:IAO_0000118> <obo:IAO_0000412 rdf:resource="http://purl.obolibrary.org/obo/so.owl"/> <obo:IAO_id rdf:datatype="http://www.w3.org/2001/XMLSchema#string">SO:1000026</obo:IAO_id> <rdfs:label rdf:datatype="http://www.w3.org/2001/XMLSchema#string">G_to_C_transversion</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/SO_1000027 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/SO_1000027"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_1000023"/> <obo:IAO_0000115 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">A transversion from guanine to thymine.</obo:IAO_0000115> <obo:IAO_0000118 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">G to T transversion</obo:IAO_0000118> <obo:IAO_0000412 rdf:resource="http://purl.obolibrary.org/obo/so.owl"/> <obo:IAO_id rdf:datatype="http://www.w3.org/2001/XMLSchema#string">SO:1000027</obo:IAO_id> <rdfs:label rdf:datatype="http://www.w3.org/2001/XMLSchema#string">G_to_T_transversion</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/SO_1000032 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/SO_1000032"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_0001059"/> <obo:IAO_0000115 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">A sequence alteration which included an insertion and a deletion, affecting 2 or more bases.</obo:IAO_0000115> <obo:IAO_0000412 rdf:resource="http://purl.obolibrary.org/obo/so.owl"/> <obo:IAO_id rdf:datatype="http://www.w3.org/2001/XMLSchema#string">SO:1000032</obo:IAO_id> <obo:IAO_xref rdf:datatype="http://www.w3.org/2001/XMLSchema#string">http://en.wikipedia.org/wiki/Indel</obo:IAO_xref> <rdfs:comment rdf:datatype="http://www.w3.org/2001/XMLSchema#string">Indels can have a different number of bases than the corresponding reference sequence.</rdfs:comment> <rdfs:label rdf:datatype="http://www.w3.org/2001/XMLSchema#string">indel</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/SO_1000035 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/SO_1000035"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_0000667"/> <obo:IAO_0000115 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">One or more nucleotides are added between two adjacent nucleotides in the sequence; the inserted sequence derives from, or is identical in sequence to, nucleotides adjacent to insertion point.</obo:IAO_0000115> <obo:IAO_0000118 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">nucleotide duplication</obo:IAO_0000118> <obo:IAO_0000118 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">nucleotide_duplication</obo:IAO_0000118> <obo:IAO_0000412 rdf:resource="http://purl.obolibrary.org/obo/so.owl"/> <obo:IAO_id rdf:datatype="http://www.w3.org/2001/XMLSchema#string">SO:1000035</obo:IAO_id> <rdfs:label rdf:datatype="http://www.w3.org/2001/XMLSchema#string">duplication</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/SO_1000036 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/SO_1000036"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_0001059"/> <obo:IAO_0000115 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">A continuous nucleotide sequence is inverted in the same position.</obo:IAO_0000115> <obo:IAO_0000118 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">inversion</obo:IAO_0000118> <obo:IAO_0000412 rdf:resource="http://purl.obolibrary.org/obo/so.owl"/> <obo:IAO_id rdf:datatype="http://www.w3.org/2001/XMLSchema#string">SO:1000036</obo:IAO_id> <obo:IAO_subset rdf:datatype="http://www.w3.org/2001/XMLSchema#string">DBVAR</obo:IAO_subset> <obo:IAO_subset rdf:datatype="http://www.w3.org/2001/XMLSchema#string">SOFA</obo:IAO_subset> <rdfs:label rdf:datatype="http://www.w3.org/2001/XMLSchema#string">inversion</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/SO_1000039 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/SO_1000039"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_1000173"/> <obo:IAO_0000115 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">A tandem duplication where the individual regions are in the same orientation.</obo:IAO_0000115> <obo:IAO_0000118 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">direct tandem duplication</obo:IAO_0000118> <obo:IAO_0000412 rdf:resource="http://purl.obolibrary.org/obo/so.owl"/> <obo:IAO_id rdf:datatype="http://www.w3.org/2001/XMLSchema#string">SO:1000039</obo:IAO_id> <rdfs:label rdf:datatype="http://www.w3.org/2001/XMLSchema#string">direct_tandem_duplication</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/SO_1000040 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/SO_1000040"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_1000173"/> <obo:IAO_0000115 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">A tandem duplication where the individual regions are not in the same orientation.</obo:IAO_0000115> <obo:IAO_0000118 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">inverted tandem duplication</obo:IAO_0000118> <obo:IAO_0000118 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">mirror duplication</obo:IAO_0000118> <obo:IAO_0000412 rdf:resource="http://purl.obolibrary.org/obo/so.owl"/> <obo:IAO_id rdf:datatype="http://www.w3.org/2001/XMLSchema#string">SO:1000040</obo:IAO_id> <rdfs:label rdf:datatype="http://www.w3.org/2001/XMLSchema#string">inverted_tandem_duplication</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/SO_1000173 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/SO_1000173"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_1000035"/> <obo:IAO_0000115 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">A duplication consisting of 2 identical adjacent regions.</obo:IAO_0000115> <obo:IAO_0000118 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">erverted</obo:IAO_0000118> <obo:IAO_0000118 rdf:datatype="http://www.w3.org/2001/XMLSchema#string">tandem duplication</obo:IAO_0000118> <obo:IAO_0000412 rdf:resource="http://purl.obolibrary.org/obo/so.owl"/> <obo:IAO_id rdf:datatype="http://www.w3.org/2001/XMLSchema#string">SO:1000173</obo:IAO_id> <obo:IAO_subset rdf:datatype="http://www.w3.org/2001/XMLSchema#string">DBVAR</obo:IAO_subset> <rdfs:label rdf:datatype="http://www.w3.org/2001/XMLSchema#string">tandem_duplication</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/UBERON_0000105 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/UBERON_0000105"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000351"/> <obo:IAO_0000116>Stub class to serve as root of hierarchy for imports of developmental stages from Uberon or taxon specific vocabularies such as ZFIN stages terms)</obo:IAO_0000116> <rdfs:label>life cycle stage</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/UBERON_0001062 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/UBERON_0001062"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/BFO_0000040"/> <rdfs:subClassOf> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/RO_0001000"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/OBI_0100026"/> </owl:Restriction> </rdfs:subClassOf> <obo:IAO_0000116>Stub class to serve as root of hierarchy for imports of anatomical entities from UBERON, CARO, or taxon-specific anatomy ontologies.</obo:IAO_0000116> <oboInOwl:hasDbXref>http://purl.obolibrary.org/obo/CARO_0000000</oboInOwl:hasDbXref> <rdfs:label rdf:datatype="http://www.w3.org/2001/XMLSchema#string">anatomical entity</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/UPHENO_0001001 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/UPHENO_0001001"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/BFO_0000020"/> <obo:IAO_0000116>Stub node that gathers root classes from various taxon-specific phenotype ontologies, as connectors to bringing classes from these ontolgies into the GENO framework.</obo:IAO_0000116> <rdfs:comment>1. From OGMS: A (combination of) quality(ies) of an organism determined by the interaction of its genetic make-up and environment that differentiates specific instances of a species from other instances of the same species (from OGMS, and used in OBI, but treatment as a quality is at odds with previous OBI discussions and their treatemnt of &apos;comparative phenotype assessment, where a phenotype is described as a quality or disposition) 2. From OBI calls: quality or disposition inheres in organism or part of an organism towards some growth environment</rdfs:comment> <rdfs:label>Phenotype</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/WBPhenotype_0000886 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/WBPhenotype_0000886"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/UPHENO_0001001"/> <obo:IAO_0000115>Animals exhibit variations compared to a given control.</obo:IAO_0000115> <obo:IAO_0000116>&apos;Variant&apos; is the given label of the root class in the Worm Phenotype ontology. Renamng it here to be consisent with our hierarchy of phenotype classes.</obo:IAO_0000116> <obo:IAO_0000118>Variant</obo:IAO_0000118> <obo:IAO_0000118>c. elegans phenotype</obo:IAO_0000118> <rdfs:label xml:lang="en">worm phenotype</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/ZP_0000199 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/ZP_0000199"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000575"/> <rdfs:label xml:lang="en">abnormal(ly) malformed endocardium cell</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/ZP_0000386 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/ZP_0000386"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000575"/> <rdfs:label xml:lang="en">abnormal(ly) absent dorso-rostral cluster</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/ZP_0000755 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/ZP_0000755"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000575"/> <rdfs:label xml:lang="en">abnormal(ly) disrupted diencephalon development</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/ZP_0005531 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/ZP_0005531"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000575"/> <rdfs:label xml:lang="en">abnormal(ly) disrupted neutrophil aggregation</rdfs:label> </owl:Class> <!-- http://purl.obolibrary.org/obo/ZP_0005692 --> <owl:Class rdf:about="http://purl.obolibrary.org/obo/ZP_0005692"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000575"/> <rdfs:label>abnormal(ly) absent adaxial cell</rdfs:label> </owl:Class> <!-- http://purl.org/oban/association --> <owl:Class rdf:about="http://purl.org/oban/association"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/IAO_0000030"/> <rdfs:label xml:lang="en">association</rdfs:label> </owl:Class> <!-- http://www.ncbi.nlm.nih.gov/gene/20423 --> <owl:Class rdf:about="http://www.ncbi.nlm.nih.gov/gene/20423"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000057"/> <obo:IAO_0000114 rdf:resource="http://purl.obolibrary.org/obo/GENO_0000514"/> <rdfs:comment>Equivalent to: http://www.informatics.jax.org/marker/MGI:98297</rdfs:comment> <rdfs:label>mus musculus shh gene</rdfs:label> </owl:Class> <!-- http://www.ncbi.nlm.nih.gov/gene/30269 --> <owl:Class rdf:about="http://www.ncbi.nlm.nih.gov/gene/30269"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000047"/> <obo:IAO_0000114 rdf:resource="http://purl.obolibrary.org/obo/GENO_0000514"/> <oboInOwl:hasDbXref>http://zfin.org/ZDB-GENE-980526-166</oboInOwl:hasDbXref> <rdfs:label>danio rerio shha gene</rdfs:label> </owl:Class> <!-- http://www.ncbi.nlm.nih.gov/gene/399483 --> <owl:Class rdf:about="http://www.ncbi.nlm.nih.gov/gene/399483"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000047"/> <obo:IAO_0000114 rdf:resource="http://purl.obolibrary.org/obo/GENO_0000514"/> <oboInOwl:hasDbXref>http://zfin.org/ZDB-GENE-040123-1</oboInOwl:hasDbXref> <rdfs:label>danio rerio cdkn1ca gene</rdfs:label> </owl:Class> <!-- http://www.ncbi.nlm.nih.gov/gene/6469 --> <owl:Class rdf:about="http://www.ncbi.nlm.nih.gov/gene/6469"> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/GENO_0000054"/> <obo:IAO_0000114 rdf:resource="http://purl.obolibrary.org/obo/GENO_0000514"/> <rdfs:comment>Equivalent to: http://www.ensembl.org/Gene/Summary?g=ENSG00000164690 Codes for: http://www.uniprot.org/uniprot/Q15465</rdfs:comment> <rdfs:label xml:lang="en">homo sapiens SHH gene</rdfs:label> </owl:Class> <!-- /////////////////////////////////////////////////////////////////////////////////////// // // Individuals // /////////////////////////////////////////////////////////////////////////////////////// --> <!-- http://purl.obolibrary.org/obo/GENO_0000484 --> <owl:NamedIndividual rdf:about="http://purl.obolibrary.org/obo/GENO_0000484"> <rdf:type rdf:resource="http://purl.obolibrary.org/obo/IAO_0000102"/> <rdfs:label xml:lang="en">exploratory term</rdfs:label> </owl:NamedIndividual> <!-- http://purl.obolibrary.org/obo/GENO_0000514 --> <owl:NamedIndividual rdf:about="http://purl.obolibrary.org/obo/GENO_0000514"> <rdf:type rdf:resource="http://purl.obolibrary.org/obo/IAO_0000102"/> <rdfs:label xml:lang="en">exemplar term</rdfs:label> </owl:NamedIndividual> <!-- /////////////////////////////////////////////////////////////////////////////////////// // // General axioms // /////////////////////////////////////////////////////////////////////////////////////// --> <owl:Axiom> <owl:annotatedSource> <owl:Restriction> <owl:onProperty rdf:resource="http://purl.obolibrary.org/obo/BFO_0000050"/> <owl:someValuesFrom rdf:resource="http://purl.obolibrary.org/obo/SO_0001059"/> <rdfs:subClassOf rdf:resource="http://purl.obolibrary.org/obo/SO_0001059"/> </owl:Restriction> </owl:annotatedSource> <owl:annotatedProperty rdf:resource="http://www.w3.org/2000/01/rdf-schema#subClassOf"/> <owl:annotatedTarget rdf:resource="http://purl.obolibrary.org/obo/SO_0001059"/> <rdfs:comment>Initially created such that integrated transgene infers as child of sequence_alteration.</rdfs:comment> </owl:Axiom> </rdf:RDF> <!-- Generated by the OWL API (version 4.2.8.20170104-2310) https://github.com/owlcs/owlapi -->
Web Ontology Language
5
cthoyt/HumanDiseaseOntology
src/ontology/imports/geno_full.owl
[ "CC0-1.0" ]
## Block (object) + blockNumber: 11109 (number, required), + newStateRoot: `0x61684c1bd4ac3f7843b6a20d4270d58dc4139d546ea4249424bc6c2ce0a48f92` (string, required), + blockSize: 110 (number, required), + commitTxHash: `0xc2541cf68c6f41a6bc55f9d6ba24816c79431942ca3762514f448540cfa475` (string, required, nullable), + verifyTxHash: `0x5e188571f82171b0dc313d9ff5433f10d03153a573e6c2ae5b4fbf683dd2a3` (string, required, nullable), + committedAt: `2020-10-12T12:05:03.123416742` (string, required) + finalizedAt: `2020-10-12T12:10:03.123416742` (string, required, nullable) + status: `committed` (string, required)
API Blueprint
3
smishraIOV/ri-aggregation
infrastructure/api-docs/blueprint/types/blocks.apib
[ "Apache-2.0", "MIT" ]
Procedure /// 関数 Function /// 関数
Ragel in Ruby Host
0
saurabhacellere/sakura
installer/sinst_src/keyword/uwsc.rl
[ "Zlib" ]
#!/bin/sh echo "error: something bad happened" >&2 echo /path/to/sdk false
Shell
3
lwhsu/swift
test/Driver/Inputs/xcrun-bad.sh
[ "Apache-2.0" ]
(kicad_pcb (version 20171130) (host pcbnew "(5.1.6)-1") (general (thickness 1.6) (drawings 15) (tracks 75) (zones 0) (modules 26) (nets 25) ) (page A4) (title_block (title "KCORES CSPS to ATX Converter") (date 2021-03-17) (rev 1.0) (company KCORES) (comment 1 "Author: AlphaArea") (comment 4 "License: KCORES Open Source License") ) (layers (0 F.Cu signal) (31 B.Cu signal) (32 B.Adhes user) (33 F.Adhes user) (34 B.Paste user) (35 F.Paste user) (36 B.SilkS user) (37 F.SilkS user) (38 B.Mask user) (39 F.Mask user) (40 Dwgs.User user) (41 Cmts.User user) (42 Eco1.User user) (43 Eco2.User user) (44 Edge.Cuts user) (45 Margin user) (46 B.CrtYd user) (47 F.CrtYd user) (48 B.Fab user) (49 F.Fab user) ) (setup (last_trace_width 0.254) (user_trace_width 0.1524) (user_trace_width 0.254) (user_trace_width 0.508) (user_trace_width 1.5) (user_trace_width 3) (trace_clearance 0.1524) (zone_clearance 0.254) (zone_45_only no) (trace_min 0.1524) (via_size 0.5) (via_drill 0.3) (via_min_size 0.5) (via_min_drill 0.3) (uvia_size 0.3) (uvia_drill 0.1) (uvias_allowed no) (uvia_min_size 0.2) (uvia_min_drill 0.1) (edge_width 0.05) (segment_width 0.2) (pcb_text_width 0.3) (pcb_text_size 1.5 1.5) (mod_edge_width 0.12) (mod_text_size 1 1) (mod_text_width 0.15) (pad_size 1.524 1.524) (pad_drill 0.762) (pad_to_mask_clearance 0.05) (aux_axis_origin 0 0) (grid_origin 172.2 79.8) (visible_elements 7FFFFFFF) (pcbplotparams (layerselection 0x010f0_ffffffff) (usegerberextensions true) (usegerberattributes true) (usegerberadvancedattributes true) (creategerberjobfile true) (excludeedgelayer true) (linewidth 0.100000) (plotframeref false) (viasonmask false) (mode 1) (useauxorigin false) (hpglpennumber 1) (hpglpenspeed 20) (hpglpendiameter 15.000000) (psnegative false) (psa4output false) (plotreference true) (plotvalue true) (plotinvisibletext false) (padsonsilk false) (subtractmaskfromsilk false) (outputformat 1) (mirror false) (drillshape 0) (scaleselection 1) (outputdirectory "Gerber/20210317/")) ) (net 0 "") (net 1 GND) (net 2 +5V) (net 3 +3V3) (net 4 /+5VSB) (net 5 /~ATX_PSON) (net 6 "Net-(C5-Pad1)") (net 7 +12V) (net 8 /SCL) (net 9 /SDA) (net 10 "Net-(J1-Pad29)") (net 11 "Net-(J1-Pad28)") (net 12 "Net-(J1-Pad27)") (net 13 "Net-(J1-Pad38)") (net 14 /+12VSB) (net 15 /~PRESENT) (net 16 /CSPS_PSOK) (net 17 "Net-(J1-Pad34)") (net 18 /~CSPS_PSON) (net 19 "Net-(J8-Pad4)") (net 20 "Net-(J9-Pad15)") (net 21 "Net-(J9-Pad19)") (net 22 /ATX_PWOK) (net 23 /~FPO) (net 24 "Net-(R2-Pad1)") (net_class Default "This is the default net class." (clearance 0.1524) (trace_width 0.254) (via_dia 0.5) (via_drill 0.3) (uvia_dia 0.3) (uvia_drill 0.1) (add_net +12V) (add_net +3V3) (add_net +5V) (add_net /+12VSB) (add_net /+5VSB) (add_net /ATX_PWOK) (add_net /CSPS_PSOK) (add_net /SCL) (add_net /SDA) (add_net /~ATX_PSON) (add_net /~CSPS_PSON) (add_net /~FPO) (add_net /~PRESENT) (add_net GND) (add_net "Net-(C5-Pad1)") (add_net "Net-(J1-Pad27)") (add_net "Net-(J1-Pad28)") (add_net "Net-(J1-Pad29)") (add_net "Net-(J1-Pad34)") (add_net "Net-(J1-Pad38)") (add_net "Net-(J8-Pad4)") (add_net "Net-(J9-Pad15)") (add_net "Net-(J9-Pad19)") (add_net "Net-(R2-Pad1)") ) (module Connector_PinHeader_2.54mm:PinHeader_1x04_P2.54mm_Vertical (layer F.Cu) (tedit 59FED5CC) (tstamp 604FCC50) (at 124.63 153.74 270) (descr "Through hole straight pin header, 1x04, 2.54mm pitch, single row") (tags "Through hole pin header THT 1x04 2.54mm single row") (path /604FC3D4) (fp_text reference J2 (at 0 -2.33 90) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value PMBUS (at 0 9.95 90) (layer F.Fab) (effects (font (size 1 1) (thickness 0.15))) ) (fp_text user %R (at 0 3.81) (layer F.Fab) (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -0.635 -1.27) (end 1.27 -1.27) (layer F.Fab) (width 0.1)) (fp_line (start 1.27 -1.27) (end 1.27 8.89) (layer F.Fab) (width 0.1)) (fp_line (start 1.27 8.89) (end -1.27 8.89) (layer F.Fab) (width 0.1)) (fp_line (start -1.27 8.89) (end -1.27 -0.635) (layer F.Fab) (width 0.1)) (fp_line (start -1.27 -0.635) (end -0.635 -1.27) (layer F.Fab) (width 0.1)) (fp_line (start -1.33 8.95) (end 1.33 8.95) (layer F.SilkS) (width 0.12)) (fp_line (start -1.33 1.27) (end -1.33 8.95) (layer F.SilkS) (width 0.12)) (fp_line (start 1.33 1.27) (end 1.33 8.95) (layer F.SilkS) (width 0.12)) (fp_line (start -1.33 1.27) (end 1.33 1.27) (layer F.SilkS) (width 0.12)) (fp_line (start -1.33 0) (end -1.33 -1.33) (layer F.SilkS) (width 0.12)) (fp_line (start -1.33 -1.33) (end 0 -1.33) (layer F.SilkS) (width 0.12)) (fp_line (start -1.8 -1.8) (end -1.8 9.4) (layer F.CrtYd) (width 0.05)) (fp_line (start -1.8 9.4) (end 1.8 9.4) (layer F.CrtYd) (width 0.05)) (fp_line (start 1.8 9.4) (end 1.8 -1.8) (layer F.CrtYd) (width 0.05)) (fp_line (start 1.8 -1.8) (end -1.8 -1.8) (layer F.CrtYd) (width 0.05)) (pad 4 thru_hole oval (at 0 7.62 270) (size 1.7 1.7) (drill 1) (layers *.Cu *.Mask) (net 9 /SDA)) (pad 3 thru_hole oval (at 0 5.08 270) (size 1.7 1.7) (drill 1) (layers *.Cu *.Mask) (net 8 /SCL)) (pad 2 thru_hole oval (at 0 2.54 270) (size 1.7 1.7) (drill 1) (layers *.Cu *.Mask) (net 1 GND)) (pad 1 thru_hole rect (at 0 0 270) (size 1.7 1.7) (drill 1) (layers *.Cu *.Mask) (net 18 /~CSPS_PSON)) (model ${KISYS3DMOD}/Connector_PinHeader_2.54mm.3dshapes/PinHeader_1x04_P2.54mm_Vertical.wrl (at (xyz 0 0 0)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 0)) ) ) (module KCORES_Connector_CSPS:CSPS_64P_2.54mm (layer F.Cu) (tedit 60520119) (tstamp 604FCC03) (at 92.4 119.7 270) (descr 10053363-201LF) (path /604F599D) (zone_connect 2) (fp_text reference J1 (at 0 -8.128 90) (layer F.SilkS) (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value CSPS (at 0 1.016 90) (layer F.Fab) (effects (font (size 1 1) (thickness 0.15))) ) (fp_text user "Card Edge" (at 0 -1.016 90) (layer Cmts.User) (effects (font (size 1 1) (thickness 0.15))) ) (fp_text user FCI (at 43.815 -17.145 90) (layer Dwgs.User) (effects (font (size 1 1) (thickness 0.15)) (justify right)) ) (fp_text user FCI (at 43.815 -17.145 90) (layer Dwgs.User) (effects (font (size 1 1) (thickness 0.15)) (justify right)) ) (fp_text user WingTAT (at 43.815 -15.24 90) (layer Dwgs.User) (effects (font (size 1 1) (thickness 0.15)) (justify right)) ) (fp_text user WingTAT (at 43.815 -15.24 90) (layer Dwgs.User) (effects (font (size 1 1) (thickness 0.15)) (justify right)) ) (fp_line (start -43.41 -21.844) (end 43.41 -21.844) (layer F.CrtYd) (width 0.12)) (fp_line (start -43.41 0) (end 43.41 0) (layer F.CrtYd) (width 0.12)) (fp_line (start 43.41 -21.844) (end 43.41 0) (layer F.CrtYd) (width 0.12)) (fp_line (start -43.41 0) (end -43.41 -21.844) (layer F.CrtYd) (width 0.12)) (fp_line (start 43.41 -21.844) (end 43.41 0) (layer F.SilkS) (width 0.12)) (fp_line (start -43.41 0) (end -43.41 -21.844) (layer F.SilkS) (width 0.12)) (pad 64 thru_hole oval (at -39.37 -20.67 270) (size 1.7 2.08) (drill oval 1.1 1.48) (layers *.Cu *.Mask) (net 7 +12V) (zone_connect 2)) (pad 63 thru_hole oval (at -36.83 -20.67 270) (size 1.7 2.08) (drill oval 1.1 1.48) (layers *.Cu *.Mask) (net 7 +12V) (zone_connect 2)) (pad 62 thru_hole oval (at -34.29 -20.67 270) (size 1.7 2.08) (drill oval 1.1 1.48) (layers *.Cu *.Mask) (net 7 +12V) (zone_connect 2)) (pad 61 thru_hole oval (at -31.75 -20.67 270) (size 1.7 2.08) (drill oval 1.1 1.48) (layers *.Cu *.Mask) (net 7 +12V) (zone_connect 2)) (pad 60 thru_hole oval (at -29.21 -20.67 270) (size 1.7 2.08) (drill oval 1.1 1.48) (layers *.Cu *.Mask) (net 7 +12V) (zone_connect 2)) (pad 59 thru_hole oval (at -26.67 -20.67 270) (size 1.7 2.08) (drill oval 1.1 1.48) (layers *.Cu *.Mask) (net 7 +12V) (zone_connect 2)) (pad 58 thru_hole oval (at -24.13 -20.67 270) (size 1.7 2.08) (drill oval 1.1 1.48) (layers *.Cu *.Mask) (net 7 +12V) (zone_connect 2)) (pad 57 thru_hole oval (at -21.59 -20.67 270) (size 1.7 2.08) (drill oval 1.1 1.48) (layers *.Cu *.Mask) (net 7 +12V) (zone_connect 2)) (pad 56 thru_hole oval (at -19.05 -20.67 270) (size 1.7 2.08) (drill oval 1.1 1.48) (layers *.Cu *.Mask) (net 7 +12V) (zone_connect 2)) (pad 55 thru_hole oval (at -16.51 -20.67 270) (size 1.7 2.08) (drill oval 1.1 1.48) (layers *.Cu *.Mask) (net 7 +12V) (zone_connect 2)) (pad 54 thru_hole oval (at -13.97 -20.67 270) (size 1.7 2.08) (drill oval 1.1 1.48) (layers *.Cu *.Mask) (net 7 +12V) (zone_connect 2)) (pad 53 thru_hole oval (at -11.43 -20.67 270) (size 1.7 2.08) (drill oval 1.1 1.48) (layers *.Cu *.Mask) (net 7 +12V) (zone_connect 2)) (pad 52 thru_hole oval (at -8.89 -20.67 270) (size 1.7 2.08) (drill oval 1.1 1.48) (layers *.Cu *.Mask) (net 7 +12V) (zone_connect 2)) (pad 51 thru_hole oval (at -6.35 -20.67 270) (size 1.7 2.08) (drill oval 1.1 1.48) (layers *.Cu *.Mask) (net 1 GND) (zone_connect 2)) (pad 50 thru_hole oval (at -3.81 -20.67 270) (size 1.7 2.08) (drill oval 1.1 1.48) (layers *.Cu *.Mask) (net 1 GND) (zone_connect 2)) (pad 49 thru_hole oval (at -1.27 -20.67 270) (size 1.7 2.08) (drill oval 1.1 1.48) (layers *.Cu *.Mask) (net 1 GND) (zone_connect 2)) (pad 48 thru_hole oval (at 1.27 -20.67 270) (size 1.7 2.08) (drill oval 1.1 1.48) (layers *.Cu *.Mask) (net 1 GND) (zone_connect 2)) (pad 47 thru_hole oval (at 3.81 -20.67 270) (size 1.7 2.08) (drill oval 1.1 1.48) (layers *.Cu *.Mask) (net 1 GND) (zone_connect 2)) (pad 46 thru_hole oval (at 6.35 -20.67 270) (size 1.7 2.08) (drill oval 1.1 1.48) (layers *.Cu *.Mask) (net 1 GND) (zone_connect 2)) (pad 45 thru_hole oval (at 8.89 -20.67 270) (size 1.7 2.08) (drill oval 1.1 1.48) (layers *.Cu *.Mask) (net 1 GND) (zone_connect 2)) (pad 44 thru_hole oval (at 11.43 -20.67 270) (size 1.7 2.08) (drill oval 1.1 1.48) (layers *.Cu *.Mask) (net 1 GND) (zone_connect 2)) (pad 43 thru_hole oval (at 13.97 -20.67 270) (size 1.7 2.08) (drill oval 1.1 1.48) (layers *.Cu *.Mask) (net 1 GND) (zone_connect 2)) (pad 42 thru_hole oval (at 16.51 -20.67 270) (size 1.7 2.08) (drill oval 1.1 1.48) (layers *.Cu *.Mask) (net 1 GND) (zone_connect 2)) (pad 41 thru_hole oval (at 19.05 -20.67 270) (size 1.7 2.08) (drill oval 1.1 1.48) (layers *.Cu *.Mask) (net 1 GND) (zone_connect 2)) (pad 40 thru_hole oval (at 21.59 -20.67 270) (size 1.7 2.08) (drill oval 1.1 1.48) (layers *.Cu *.Mask) (net 1 GND) (zone_connect 2)) (pad 39 thru_hole oval (at 24.13 -20.67 270) (size 1.7 2.08) (drill oval 1.1 1.48) (layers *.Cu *.Mask) (net 1 GND) (zone_connect 2)) (pad 38 thru_hole oval (at 26.67 -20.67 270) (size 1.7 2.08) (drill oval 1.1 1.48) (layers *.Cu *.Mask) (net 13 "Net-(J1-Pad38)") (zone_connect 2)) (pad 37 thru_hole oval (at 29.21 -20.67 270) (size 1.7 2.08) (drill oval 1.1 1.48) (layers *.Cu *.Mask) (net 14 /+12VSB) (zone_connect 2)) (pad 36 thru_hole oval (at 31.75 -20.67 270) (size 1.7 2.08) (drill oval 1.1 1.48) (layers *.Cu *.Mask) (net 15 /~PRESENT) (zone_connect 2)) (pad 35 thru_hole oval (at 34.29 -20.67 270) (size 1.7 2.08) (drill oval 1.1 1.48) (layers *.Cu *.Mask) (net 16 /CSPS_PSOK) (zone_connect 2)) (pad 34 thru_hole oval (at 36.83 -20.67 270) (size 1.7 2.08) (drill oval 1.1 1.48) (layers *.Cu *.Mask) (net 17 "Net-(J1-Pad34)") (zone_connect 2)) (pad 33 thru_hole oval (at 39.37 -20.67 270) (size 1.7 2.08) (drill oval 1.1 1.48) (layers *.Cu *.Mask) (net 18 /~CSPS_PSON) (zone_connect 2)) (pad 32 thru_hole circle (at 39.37 -15.4 270) (size 1.7 1.7) (drill 1) (layers *.Cu *.Mask) (net 8 /SCL) (zone_connect 2)) (pad 31 thru_hole circle (at 36.83 -15.4 270) (size 1.7 1.7) (drill 1) (layers *.Cu *.Mask) (net 9 /SDA) (zone_connect 2)) (pad 30 thru_hole circle (at 34.29 -15.4 270) (size 1.7 1.7) (drill 1) (layers *.Cu *.Mask) (net 1 GND) (zone_connect 2)) (pad 29 thru_hole circle (at 31.75 -15.4 270) (size 1.7 1.7) (drill 1) (layers *.Cu *.Mask) (net 10 "Net-(J1-Pad29)") (zone_connect 2)) (pad 28 thru_hole circle (at 29.21 -15.4 270) (size 1.7 1.7) (drill 1) (layers *.Cu *.Mask) (net 11 "Net-(J1-Pad28)") (zone_connect 2)) (pad 27 thru_hole circle (at 26.67 -15.4 270) (size 1.7 1.7) (drill 1) (layers *.Cu *.Mask) (net 12 "Net-(J1-Pad27)") (zone_connect 2)) (pad 26 thru_hole circle (at 24.13 -15.4 270) (size 1.7 1.7) (drill 1) (layers *.Cu *.Mask) (net 1 GND) (zone_connect 2)) (pad 25 thru_hole circle (at 21.59 -15.4 270) (size 1.7 1.7) (drill 1) (layers *.Cu *.Mask) (net 1 GND) (zone_connect 2)) (pad 24 thru_hole circle (at 19.05 -15.4 270) (size 1.7 1.7) (drill 1) (layers *.Cu *.Mask) (net 1 GND) (zone_connect 2)) (pad 23 thru_hole circle (at 16.51 -15.4 270) (size 1.7 1.7) (drill 1) (layers *.Cu *.Mask) (net 1 GND) (zone_connect 2)) (pad 22 thru_hole circle (at 13.97 -15.4 270) (size 1.7 1.7) (drill 1) (layers *.Cu *.Mask) (net 1 GND) (zone_connect 2)) (pad 21 thru_hole circle (at 11.43 -15.4 270) (size 1.7 1.7) (drill 1) (layers *.Cu *.Mask) (net 1 GND) (zone_connect 2)) (pad 20 thru_hole circle (at 8.89 -15.4 270) (size 1.7 1.7) (drill 1) (layers *.Cu *.Mask) (net 1 GND) (zone_connect 2)) (pad 19 thru_hole circle (at 6.35 -15.4 270) (size 1.7 1.7) (drill 1) (layers *.Cu *.Mask) (net 1 GND) (zone_connect 2)) (pad 18 thru_hole circle (at 3.81 -15.4 270) (size 1.7 1.7) (drill 1) (layers *.Cu *.Mask) (net 1 GND) (zone_connect 2)) (pad 17 thru_hole circle (at 1.27 -15.4 270) (size 1.7 1.7) (drill 1) (layers *.Cu *.Mask) (net 1 GND) (zone_connect 2)) (pad 16 thru_hole circle (at -1.27 -15.4 270) (size 1.7 1.7) (drill 1) (layers *.Cu *.Mask) (net 1 GND) (zone_connect 2)) (pad 15 thru_hole circle (at -3.81 -15.4 270) (size 1.7 1.7) (drill 1) (layers *.Cu *.Mask) (net 1 GND) (zone_connect 2)) (pad 14 thru_hole circle (at -6.35 -15.4 270) (size 1.7 1.7) (drill 1) (layers *.Cu *.Mask) (net 1 GND) (zone_connect 2)) (pad 13 thru_hole circle (at -8.89 -15.4 270) (size 1.7 1.7) (drill 1) (layers *.Cu *.Mask) (net 7 +12V) (zone_connect 2)) (pad 12 thru_hole circle (at -11.43 -15.4 270) (size 1.7 1.7) (drill 1) (layers *.Cu *.Mask) (net 7 +12V) (zone_connect 2)) (pad 11 thru_hole circle (at -13.97 -15.4 270) (size 1.7 1.7) (drill 1) (layers *.Cu *.Mask) (net 7 +12V) (zone_connect 2)) (pad 10 thru_hole circle (at -16.51 -15.4 270) (size 1.7 1.7) (drill 1) (layers *.Cu *.Mask) (net 7 +12V) (zone_connect 2)) (pad 9 thru_hole circle (at -19.05 -15.4 270) (size 1.7 1.7) (drill 1) (layers *.Cu *.Mask) (net 7 +12V) (zone_connect 2)) (pad 8 thru_hole circle (at -21.59 -15.4 270) (size 1.7 1.7) (drill 1) (layers *.Cu *.Mask) (net 7 +12V) (zone_connect 2)) (pad 7 thru_hole circle (at -24.13 -15.4 270) (size 1.7 1.7) (drill 1) (layers *.Cu *.Mask) (net 7 +12V) (zone_connect 2)) (pad 6 thru_hole circle (at -26.67 -15.4 270) (size 1.7 1.7) (drill 1) (layers *.Cu *.Mask) (net 7 +12V) (zone_connect 2)) (pad 5 thru_hole circle (at -29.21 -15.4 270) (size 1.7 1.7) (drill 1) (layers *.Cu *.Mask) (net 7 +12V) (zone_connect 2)) (pad 4 thru_hole circle (at -31.75 -15.4 270) (size 1.7 1.7) (drill 1) (layers *.Cu *.Mask) (net 7 +12V) (zone_connect 2)) (pad 3 thru_hole circle (at -34.29 -15.4 270) (size 1.7 1.7) (drill 1) (layers *.Cu *.Mask) (net 7 +12V) (zone_connect 2)) (pad 2 thru_hole circle (at -36.83 -15.4 270) (size 1.7 1.7) (drill 1) (layers *.Cu *.Mask) (net 7 +12V) (zone_connect 2)) (pad 32 thru_hole circle (at 39.37 -17.05 270) (size 1.7 1.7) (drill 1.1) (layers *.Cu *.Mask) (net 8 /SCL) (zone_connect 2)) (pad 31 thru_hole circle (at 36.83 -17.05 270) (size 1.7 1.7) (drill 1.1) (layers *.Cu *.Mask) (net 9 /SDA) (zone_connect 2)) (pad 30 thru_hole circle (at 34.29 -17.05 270) (size 1.7 1.7) (drill 1.1) (layers *.Cu *.Mask) (net 1 GND) (zone_connect 2)) (pad 29 thru_hole circle (at 31.75 -17.05 270) (size 1.7 1.7) (drill 1.1) (layers *.Cu *.Mask) (net 10 "Net-(J1-Pad29)") (zone_connect 2)) (pad 28 thru_hole circle (at 29.21 -17.05 270) (size 1.7 1.7) (drill 1.1) (layers *.Cu *.Mask) (net 11 "Net-(J1-Pad28)") (zone_connect 2)) (pad 27 thru_hole circle (at 26.67 -17.05 270) (size 1.7 1.7) (drill 1.1) (layers *.Cu *.Mask) (net 12 "Net-(J1-Pad27)") (zone_connect 2)) (pad 26 thru_hole circle (at 24.13 -17.05 270) (size 1.7 1.7) (drill 1.1) (layers *.Cu *.Mask) (net 1 GND) (zone_connect 2)) (pad 25 thru_hole circle (at 21.59 -17.05 270) (size 1.7 1.7) (drill 1.1) (layers *.Cu *.Mask) (net 1 GND) (zone_connect 2)) (pad 24 thru_hole circle (at 19.05 -17.05 270) (size 1.7 1.7) (drill 1.1) (layers *.Cu *.Mask) (net 1 GND) (zone_connect 2)) (pad 23 thru_hole circle (at 16.51 -17.05 270) (size 1.7 1.7) (drill 1.1) (layers *.Cu *.Mask) (net 1 GND) (zone_connect 2)) (pad 22 thru_hole circle (at 13.97 -17.05 270) (size 1.7 1.7) (drill 1.1) (layers *.Cu *.Mask) (net 1 GND) (zone_connect 2)) (pad 21 thru_hole circle (at 11.43 -17.05 270) (size 1.7 1.7) (drill 1.1) (layers *.Cu *.Mask) (net 1 GND) (zone_connect 2)) (pad 20 thru_hole circle (at 8.89 -17.05 270) (size 1.7 1.7) (drill 1.1) (layers *.Cu *.Mask) (net 1 GND) (zone_connect 2)) (pad 19 thru_hole circle (at 6.35 -17.05 270) (size 1.7 1.7) (drill 1.1) (layers *.Cu *.Mask) (net 1 GND) (zone_connect 2)) (pad 18 thru_hole circle (at 3.81 -17.05 270) (size 1.7 1.7) (drill 1.1) (layers *.Cu *.Mask) (net 1 GND) (zone_connect 2)) (pad 17 thru_hole circle (at 1.27 -17.05 270) (size 1.7 1.7) (drill 1.1) (layers *.Cu *.Mask) (net 1 GND) (zone_connect 2)) (pad 16 thru_hole circle (at -1.27 -17.05 270) (size 1.7 1.7) (drill 1.1) (layers *.Cu *.Mask) (net 1 GND) (zone_connect 2)) (pad 15 thru_hole circle (at -3.81 -17.05 270) (size 1.7 1.7) (drill 1.1) (layers *.Cu *.Mask) (net 1 GND) (zone_connect 2)) (pad 14 thru_hole circle (at -6.35 -17.05 270) (size 1.7 1.7) (drill 1.1) (layers *.Cu *.Mask) (net 1 GND) (zone_connect 2)) (pad 13 thru_hole circle (at -8.89 -17.05 270) (size 1.7 1.7) (drill 1.1) (layers *.Cu *.Mask) (net 7 +12V) (zone_connect 2)) (pad 12 thru_hole circle (at -11.43 -17.05 270) (size 1.7 1.7) (drill 1.1) (layers *.Cu *.Mask) (net 7 +12V) (zone_connect 2)) (pad 11 thru_hole circle (at -13.97 -17.05 270) (size 1.7 1.7) (drill 1.1) (layers *.Cu *.Mask) (net 7 +12V) (zone_connect 2)) (pad 10 thru_hole circle (at -16.51 -17.05 270) (size 1.7 1.7) (drill 1.1) (layers *.Cu *.Mask) (net 7 +12V) (zone_connect 2)) (pad 9 thru_hole circle (at -19.05 -17.05 270) (size 1.7 1.7) (drill 1.1) (layers *.Cu *.Mask) (net 7 +12V) (zone_connect 2)) (pad 8 thru_hole circle (at -21.59 -17.05 270) (size 1.7 1.7) (drill 1.1) (layers *.Cu *.Mask) (net 7 +12V) (zone_connect 2)) (pad 7 thru_hole circle (at -24.13 -17.05 270) (size 1.7 1.7) (drill 1.1) (layers *.Cu *.Mask) (net 7 +12V) (zone_connect 2)) (pad 6 thru_hole circle (at -26.67 -17.05 270) (size 1.7 1.7) (drill 1.1) (layers *.Cu *.Mask) (net 7 +12V) (zone_connect 2)) (pad 5 thru_hole circle (at -29.21 -17.05 270) (size 1.7 1.7) (drill 1.1) (layers *.Cu *.Mask) (net 7 +12V) (zone_connect 2)) (pad 4 thru_hole circle (at -31.75 -17.05 270) (size 1.7 1.7) (drill 1.1) (layers *.Cu *.Mask) (net 7 +12V) (zone_connect 2)) (pad 3 thru_hole circle (at -34.29 -17.05 270) (size 1.7 1.7) (drill 1.1) (layers *.Cu *.Mask) (net 7 +12V) (zone_connect 2)) (pad 2 thru_hole circle (at -36.83 -17.05 270) (size 1.7 1.7) (drill 1.1) (layers *.Cu *.Mask) (net 7 +12V) (zone_connect 2)) (pad "" np_thru_hole circle (at 31.52 -8.2 270) (size 2.6 2.6) (drill 2.6) (layers *.Cu *.Mask) (zone_connect 2)) (pad "" np_thru_hole circle (at -31.52 -8.2 270) (size 2.6 2.6) (drill 2.6) (layers *.Cu *.Mask) (zone_connect 2)) (pad 1 thru_hole circle (at -39.37 -15.4 270) (size 1.7 1.7) (drill 1) (layers *.Cu *.Mask) (net 7 +12V) (zone_connect 2)) (pad 1 thru_hole circle (at -39.37 -17.05 270) (size 1.7 1.7) (drill 1.1) (layers *.Cu *.Mask) (net 7 +12V) (zone_connect 2)) (model ${KIPRJMOD}/Packages3D/KCORES_Connector_CSPS/FCI_10053363-200LF.stp (offset (xyz 0 16.4 4.5)) (scale (xyz 1 1 1)) (rotate (xyz 180 0 0)) ) ) (module KCORES_Connector_ATX_Power:ATX_8Pin_P4.20mm_Vertical_4.20mm (layer F.Cu) (tedit 6050AB0D) (tstamp 604FCDD6) (at 172.2 79.8 270) (descr "ATX CPU Power Connector 实心针") (tags "connector Molex Mini-Fit_Jr side entry ATX CPU") (path /604FEBEF) (fp_text reference J7 (at 6.3 -4.1 90) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value GW_PCIe/CPU (at 6.3 -4.2 90) (layer F.SilkS) (effects (font (size 1 1) (thickness 0.15))) ) (fp_text user %R (at 6.3 -2.2 90) (layer F.Fab) (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start 15.8 -3.4) (end -3.2 -3.4) (layer F.CrtYd) (width 0.05)) (fp_line (start 15.8 8.6) (end 15.8 -3.4) (layer F.CrtYd) (width 0.05)) (fp_line (start -3.2 8.6) (end 15.8 8.6) (layer F.CrtYd) (width 0.05)) (fp_line (start -3.2 -3.4) (end -3.2 8.6) (layer F.CrtYd) (width 0.05)) (fp_line (start -3.05 -3.25) (end -3.05 -0.4) (layer F.Fab) (width 0.1)) (fp_line (start -0.2 -3.25) (end -3.05 -3.25) (layer F.Fab) (width 0.1)) (fp_line (start -3.05 -3.25) (end -3.05 -0.4) (layer F.SilkS) (width 0.12)) (fp_line (start -0.2 -3.25) (end -3.05 -3.25) (layer F.SilkS) (width 0.12)) (fp_line (start 8.11 8.21) (end 6.3 8.21) (layer F.SilkS) (width 0.12)) (fp_line (start 8.11 6.81) (end 8.11 8.21) (layer F.SilkS) (width 0.12)) (fp_line (start 15.41 6.81) (end 8.11 6.81) (layer F.SilkS) (width 0.12)) (fp_line (start 15.41 -3.01) (end 15.41 6.81) (layer F.SilkS) (width 0.12)) (fp_line (start 6.3 -3.01) (end 15.41 -3.01) (layer F.SilkS) (width 0.12)) (fp_line (start 4.49 8.21) (end 6.3 8.21) (layer F.SilkS) (width 0.12)) (fp_line (start 4.49 6.81) (end 4.49 8.21) (layer F.SilkS) (width 0.12)) (fp_line (start -2.81 6.81) (end 4.49 6.81) (layer F.SilkS) (width 0.12)) (fp_line (start -2.81 -3.01) (end -2.81 6.81) (layer F.SilkS) (width 0.12)) (fp_line (start 6.3 -3.01) (end -2.81 -3.01) (layer F.SilkS) (width 0.12)) (fp_line (start 14.25 5.85) (end 10.95 5.85) (layer F.Fab) (width 0.1)) (fp_line (start 14.25 3.375) (end 14.25 5.85) (layer F.Fab) (width 0.1)) (fp_line (start 13.425 2.55) (end 14.25 3.375) (layer F.Fab) (width 0.1)) (fp_line (start 11.775 2.55) (end 13.425 2.55) (layer F.Fab) (width 0.1)) (fp_line (start 10.95 3.375) (end 11.775 2.55) (layer F.Fab) (width 0.1)) (fp_line (start 10.95 5.85) (end 10.95 3.375) (layer F.Fab) (width 0.1)) (fp_line (start 14.25 -1.65) (end 10.95 -1.65) (layer F.Fab) (width 0.1)) (fp_line (start 14.25 1.65) (end 14.25 -1.65) (layer F.Fab) (width 0.1)) (fp_line (start 10.95 1.65) (end 14.25 1.65) (layer F.Fab) (width 0.1)) (fp_line (start 10.95 -1.65) (end 10.95 1.65) (layer F.Fab) (width 0.1)) (fp_line (start 10.05 1.65) (end 6.75 1.65) (layer F.Fab) (width 0.1)) (fp_line (start 10.05 -0.825) (end 10.05 1.65) (layer F.Fab) (width 0.1)) (fp_line (start 9.225 -1.65) (end 10.05 -0.825) (layer F.Fab) (width 0.1)) (fp_line (start 7.575 -1.65) (end 9.225 -1.65) (layer F.Fab) (width 0.1)) (fp_line (start 6.75 -0.825) (end 7.575 -1.65) (layer F.Fab) (width 0.1)) (fp_line (start 6.75 1.65) (end 6.75 -0.825) (layer F.Fab) (width 0.1)) (fp_line (start 10.05 2.55) (end 6.75 2.55) (layer F.Fab) (width 0.1)) (fp_line (start 10.05 5.85) (end 10.05 2.55) (layer F.Fab) (width 0.1)) (fp_line (start 6.75 5.85) (end 10.05 5.85) (layer F.Fab) (width 0.1)) (fp_line (start 6.75 2.55) (end 6.75 5.85) (layer F.Fab) (width 0.1)) (fp_line (start 5.85 1.65) (end 2.55 1.65) (layer F.Fab) (width 0.1)) (fp_line (start 5.85 -0.825) (end 5.85 1.65) (layer F.Fab) (width 0.1)) (fp_line (start 5.025 -1.65) (end 5.85 -0.825) (layer F.Fab) (width 0.1)) (fp_line (start 3.375 -1.65) (end 5.025 -1.65) (layer F.Fab) (width 0.1)) (fp_line (start 2.55 -0.825) (end 3.375 -1.65) (layer F.Fab) (width 0.1)) (fp_line (start 2.55 1.65) (end 2.55 -0.825) (layer F.Fab) (width 0.1)) (fp_line (start 5.85 2.55) (end 2.55 2.55) (layer F.Fab) (width 0.1)) (fp_line (start 5.85 5.85) (end 5.85 2.55) (layer F.Fab) (width 0.1)) (fp_line (start 2.55 5.85) (end 5.85 5.85) (layer F.Fab) (width 0.1)) (fp_line (start 2.55 2.55) (end 2.55 5.85) (layer F.Fab) (width 0.1)) (fp_line (start 1.65 5.85) (end -1.65 5.85) (layer F.Fab) (width 0.1)) (fp_line (start 1.65 3.375) (end 1.65 5.85) (layer F.Fab) (width 0.1)) (fp_line (start 0.825 2.55) (end 1.65 3.375) (layer F.Fab) (width 0.1)) (fp_line (start -0.825 2.55) (end 0.825 2.55) (layer F.Fab) (width 0.1)) (fp_line (start -1.65 3.375) (end -0.825 2.55) (layer F.Fab) (width 0.1)) (fp_line (start -1.65 5.85) (end -1.65 3.375) (layer F.Fab) (width 0.1)) (fp_line (start 1.65 -1.65) (end -1.65 -1.65) (layer F.Fab) (width 0.1)) (fp_line (start 1.65 1.65) (end 1.65 -1.65) (layer F.Fab) (width 0.1)) (fp_line (start -1.65 1.65) (end 1.65 1.65) (layer F.Fab) (width 0.1)) (fp_line (start -1.65 -1.65) (end -1.65 1.65) (layer F.Fab) (width 0.1)) (fp_line (start 8 8.1) (end 8 6.7) (layer F.Fab) (width 0.1)) (fp_line (start 4.6 8.1) (end 8 8.1) (layer F.Fab) (width 0.1)) (fp_line (start 4.6 6.7) (end 4.6 8.1) (layer F.Fab) (width 0.1)) (fp_line (start 15.3 -2.9) (end -2.7 -2.9) (layer F.Fab) (width 0.1)) (fp_line (start 15.3 6.7) (end 15.3 -2.9) (layer F.Fab) (width 0.1)) (fp_line (start -2.7 6.7) (end 15.3 6.7) (layer F.Fab) (width 0.1)) (fp_line (start -2.7 -2.9) (end -2.7 6.7) (layer F.Fab) (width 0.1)) (pad 8 thru_hole oval (at 12.6 4.2 270) (size 2.7 3.7) (drill 1.8) (layers *.Cu *.Mask) (net 1 GND)) (pad 7 thru_hole oval (at 8.4 4.2 270) (size 2.7 3.7) (drill 1.8) (layers *.Cu *.Mask) (net 1 GND)) (pad 6 thru_hole oval (at 4.2 4.2 270) (size 2.7 3.7) (drill 1.8) (layers *.Cu *.Mask) (net 1 GND)) (pad 5 thru_hole oval (at 0 4.2 270) (size 2.7 3.7) (drill 1.8) (layers *.Cu *.Mask) (net 1 GND)) (pad 4 thru_hole oval (at 12.6 0 270) (size 2.7 3.7) (drill 1.8) (layers *.Cu *.Mask) (net 7 +12V)) (pad 3 thru_hole oval (at 8.4 0 270) (size 2.7 3.7) (drill 1.8) (layers *.Cu *.Mask) (net 7 +12V)) (pad 1 thru_hole roundrect (at 0 0 270) (size 2.7 3.7) (drill 1.8) (layers *.Cu *.Mask) (roundrect_rratio 0.09300000000000001) (net 7 +12V)) (pad 2 thru_hole oval (at 4.2 0 270) (size 2.7 3.7) (drill 1.8) (layers *.Cu *.Mask) (net 7 +12V)) (model ${KIPRJMOD}/Packages3D/KCORES_Connector_ATX_Power/Molex_46207-1008.stp (offset (xyz 6.3 -1.9 13.6)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 180)) ) ) (module KCORES_Connector_ATX_Power:ATX_8Pin_P4.20mm_Vertical_4.20mm (layer F.Cu) (tedit 6050AB0D) (tstamp 604FCD88) (at 142.8 94.5) (descr "ATX CPU Power Connector 实心针") (tags "connector Molex Mini-Fit_Jr side entry ATX CPU") (path /60BA4448) (fp_text reference J6 (at 6.3 -4.1) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value GW_PCIe/CPU (at 16.8 2.1 90) (layer F.SilkS) (effects (font (size 1 1) (thickness 0.15))) ) (fp_text user %R (at 6.3 -2.2) (layer F.Fab) (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start 15.8 -3.4) (end -3.2 -3.4) (layer F.CrtYd) (width 0.05)) (fp_line (start 15.8 8.6) (end 15.8 -3.4) (layer F.CrtYd) (width 0.05)) (fp_line (start -3.2 8.6) (end 15.8 8.6) (layer F.CrtYd) (width 0.05)) (fp_line (start -3.2 -3.4) (end -3.2 8.6) (layer F.CrtYd) (width 0.05)) (fp_line (start -3.05 -3.25) (end -3.05 -0.4) (layer F.Fab) (width 0.1)) (fp_line (start -0.2 -3.25) (end -3.05 -3.25) (layer F.Fab) (width 0.1)) (fp_line (start -3.05 -3.25) (end -3.05 -0.4) (layer F.SilkS) (width 0.12)) (fp_line (start -0.2 -3.25) (end -3.05 -3.25) (layer F.SilkS) (width 0.12)) (fp_line (start 8.11 8.21) (end 6.3 8.21) (layer F.SilkS) (width 0.12)) (fp_line (start 8.11 6.81) (end 8.11 8.21) (layer F.SilkS) (width 0.12)) (fp_line (start 15.41 6.81) (end 8.11 6.81) (layer F.SilkS) (width 0.12)) (fp_line (start 15.41 -3.01) (end 15.41 6.81) (layer F.SilkS) (width 0.12)) (fp_line (start 6.3 -3.01) (end 15.41 -3.01) (layer F.SilkS) (width 0.12)) (fp_line (start 4.49 8.21) (end 6.3 8.21) (layer F.SilkS) (width 0.12)) (fp_line (start 4.49 6.81) (end 4.49 8.21) (layer F.SilkS) (width 0.12)) (fp_line (start -2.81 6.81) (end 4.49 6.81) (layer F.SilkS) (width 0.12)) (fp_line (start -2.81 -3.01) (end -2.81 6.81) (layer F.SilkS) (width 0.12)) (fp_line (start 6.3 -3.01) (end -2.81 -3.01) (layer F.SilkS) (width 0.12)) (fp_line (start 14.25 5.85) (end 10.95 5.85) (layer F.Fab) (width 0.1)) (fp_line (start 14.25 3.375) (end 14.25 5.85) (layer F.Fab) (width 0.1)) (fp_line (start 13.425 2.55) (end 14.25 3.375) (layer F.Fab) (width 0.1)) (fp_line (start 11.775 2.55) (end 13.425 2.55) (layer F.Fab) (width 0.1)) (fp_line (start 10.95 3.375) (end 11.775 2.55) (layer F.Fab) (width 0.1)) (fp_line (start 10.95 5.85) (end 10.95 3.375) (layer F.Fab) (width 0.1)) (fp_line (start 14.25 -1.65) (end 10.95 -1.65) (layer F.Fab) (width 0.1)) (fp_line (start 14.25 1.65) (end 14.25 -1.65) (layer F.Fab) (width 0.1)) (fp_line (start 10.95 1.65) (end 14.25 1.65) (layer F.Fab) (width 0.1)) (fp_line (start 10.95 -1.65) (end 10.95 1.65) (layer F.Fab) (width 0.1)) (fp_line (start 10.05 1.65) (end 6.75 1.65) (layer F.Fab) (width 0.1)) (fp_line (start 10.05 -0.825) (end 10.05 1.65) (layer F.Fab) (width 0.1)) (fp_line (start 9.225 -1.65) (end 10.05 -0.825) (layer F.Fab) (width 0.1)) (fp_line (start 7.575 -1.65) (end 9.225 -1.65) (layer F.Fab) (width 0.1)) (fp_line (start 6.75 -0.825) (end 7.575 -1.65) (layer F.Fab) (width 0.1)) (fp_line (start 6.75 1.65) (end 6.75 -0.825) (layer F.Fab) (width 0.1)) (fp_line (start 10.05 2.55) (end 6.75 2.55) (layer F.Fab) (width 0.1)) (fp_line (start 10.05 5.85) (end 10.05 2.55) (layer F.Fab) (width 0.1)) (fp_line (start 6.75 5.85) (end 10.05 5.85) (layer F.Fab) (width 0.1)) (fp_line (start 6.75 2.55) (end 6.75 5.85) (layer F.Fab) (width 0.1)) (fp_line (start 5.85 1.65) (end 2.55 1.65) (layer F.Fab) (width 0.1)) (fp_line (start 5.85 -0.825) (end 5.85 1.65) (layer F.Fab) (width 0.1)) (fp_line (start 5.025 -1.65) (end 5.85 -0.825) (layer F.Fab) (width 0.1)) (fp_line (start 3.375 -1.65) (end 5.025 -1.65) (layer F.Fab) (width 0.1)) (fp_line (start 2.55 -0.825) (end 3.375 -1.65) (layer F.Fab) (width 0.1)) (fp_line (start 2.55 1.65) (end 2.55 -0.825) (layer F.Fab) (width 0.1)) (fp_line (start 5.85 2.55) (end 2.55 2.55) (layer F.Fab) (width 0.1)) (fp_line (start 5.85 5.85) (end 5.85 2.55) (layer F.Fab) (width 0.1)) (fp_line (start 2.55 5.85) (end 5.85 5.85) (layer F.Fab) (width 0.1)) (fp_line (start 2.55 2.55) (end 2.55 5.85) (layer F.Fab) (width 0.1)) (fp_line (start 1.65 5.85) (end -1.65 5.85) (layer F.Fab) (width 0.1)) (fp_line (start 1.65 3.375) (end 1.65 5.85) (layer F.Fab) (width 0.1)) (fp_line (start 0.825 2.55) (end 1.65 3.375) (layer F.Fab) (width 0.1)) (fp_line (start -0.825 2.55) (end 0.825 2.55) (layer F.Fab) (width 0.1)) (fp_line (start -1.65 3.375) (end -0.825 2.55) (layer F.Fab) (width 0.1)) (fp_line (start -1.65 5.85) (end -1.65 3.375) (layer F.Fab) (width 0.1)) (fp_line (start 1.65 -1.65) (end -1.65 -1.65) (layer F.Fab) (width 0.1)) (fp_line (start 1.65 1.65) (end 1.65 -1.65) (layer F.Fab) (width 0.1)) (fp_line (start -1.65 1.65) (end 1.65 1.65) (layer F.Fab) (width 0.1)) (fp_line (start -1.65 -1.65) (end -1.65 1.65) (layer F.Fab) (width 0.1)) (fp_line (start 8 8.1) (end 8 6.7) (layer F.Fab) (width 0.1)) (fp_line (start 4.6 8.1) (end 8 8.1) (layer F.Fab) (width 0.1)) (fp_line (start 4.6 6.7) (end 4.6 8.1) (layer F.Fab) (width 0.1)) (fp_line (start 15.3 -2.9) (end -2.7 -2.9) (layer F.Fab) (width 0.1)) (fp_line (start 15.3 6.7) (end 15.3 -2.9) (layer F.Fab) (width 0.1)) (fp_line (start -2.7 6.7) (end 15.3 6.7) (layer F.Fab) (width 0.1)) (fp_line (start -2.7 -2.9) (end -2.7 6.7) (layer F.Fab) (width 0.1)) (pad 8 thru_hole oval (at 12.6 4.2) (size 2.7 3.7) (drill 1.8) (layers *.Cu *.Mask) (net 1 GND)) (pad 7 thru_hole oval (at 8.4 4.2) (size 2.7 3.7) (drill 1.8) (layers *.Cu *.Mask) (net 1 GND)) (pad 6 thru_hole oval (at 4.2 4.2) (size 2.7 3.7) (drill 1.8) (layers *.Cu *.Mask) (net 1 GND)) (pad 5 thru_hole oval (at 0 4.2) (size 2.7 3.7) (drill 1.8) (layers *.Cu *.Mask) (net 1 GND)) (pad 4 thru_hole oval (at 12.6 0) (size 2.7 3.7) (drill 1.8) (layers *.Cu *.Mask) (net 7 +12V)) (pad 3 thru_hole oval (at 8.4 0) (size 2.7 3.7) (drill 1.8) (layers *.Cu *.Mask) (net 7 +12V)) (pad 1 thru_hole roundrect (at 0 0) (size 2.7 3.7) (drill 1.8) (layers *.Cu *.Mask) (roundrect_rratio 0.09300000000000001) (net 7 +12V)) (pad 2 thru_hole oval (at 4.2 0) (size 2.7 3.7) (drill 1.8) (layers *.Cu *.Mask) (net 7 +12V)) (model ${KIPRJMOD}/Packages3D/KCORES_Connector_ATX_Power/Molex_46207-1008.stp (offset (xyz 6.3 -1.9 13.6)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 180)) ) ) (module KCORES_Connector_ATX_Power:ATX_8Pin_P4.20mm_Vertical_4.20mm (layer F.Cu) (tedit 6050AB0D) (tstamp 604FCD3A) (at 155.4 84 180) (descr "ATX CPU Power Connector 实心针") (tags "connector Molex Mini-Fit_Jr side entry ATX CPU") (path /60B44341) (fp_text reference J5 (at 6.3 -4.1) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value GW_PCIe/CPU (at -4.2 2.1 90) (layer F.SilkS) (effects (font (size 1 1) (thickness 0.15))) ) (fp_text user %R (at 6.3 -2.2) (layer F.Fab) (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start 15.8 -3.4) (end -3.2 -3.4) (layer F.CrtYd) (width 0.05)) (fp_line (start 15.8 8.6) (end 15.8 -3.4) (layer F.CrtYd) (width 0.05)) (fp_line (start -3.2 8.6) (end 15.8 8.6) (layer F.CrtYd) (width 0.05)) (fp_line (start -3.2 -3.4) (end -3.2 8.6) (layer F.CrtYd) (width 0.05)) (fp_line (start -3.05 -3.25) (end -3.05 -0.4) (layer F.Fab) (width 0.1)) (fp_line (start -0.2 -3.25) (end -3.05 -3.25) (layer F.Fab) (width 0.1)) (fp_line (start -3.05 -3.25) (end -3.05 -0.4) (layer F.SilkS) (width 0.12)) (fp_line (start -0.2 -3.25) (end -3.05 -3.25) (layer F.SilkS) (width 0.12)) (fp_line (start 8.11 8.21) (end 6.3 8.21) (layer F.SilkS) (width 0.12)) (fp_line (start 8.11 6.81) (end 8.11 8.21) (layer F.SilkS) (width 0.12)) (fp_line (start 15.41 6.81) (end 8.11 6.81) (layer F.SilkS) (width 0.12)) (fp_line (start 15.41 -3.01) (end 15.41 6.81) (layer F.SilkS) (width 0.12)) (fp_line (start 6.3 -3.01) (end 15.41 -3.01) (layer F.SilkS) (width 0.12)) (fp_line (start 4.49 8.21) (end 6.3 8.21) (layer F.SilkS) (width 0.12)) (fp_line (start 4.49 6.81) (end 4.49 8.21) (layer F.SilkS) (width 0.12)) (fp_line (start -2.81 6.81) (end 4.49 6.81) (layer F.SilkS) (width 0.12)) (fp_line (start -2.81 -3.01) (end -2.81 6.81) (layer F.SilkS) (width 0.12)) (fp_line (start 6.3 -3.01) (end -2.81 -3.01) (layer F.SilkS) (width 0.12)) (fp_line (start 14.25 5.85) (end 10.95 5.85) (layer F.Fab) (width 0.1)) (fp_line (start 14.25 3.375) (end 14.25 5.85) (layer F.Fab) (width 0.1)) (fp_line (start 13.425 2.55) (end 14.25 3.375) (layer F.Fab) (width 0.1)) (fp_line (start 11.775 2.55) (end 13.425 2.55) (layer F.Fab) (width 0.1)) (fp_line (start 10.95 3.375) (end 11.775 2.55) (layer F.Fab) (width 0.1)) (fp_line (start 10.95 5.85) (end 10.95 3.375) (layer F.Fab) (width 0.1)) (fp_line (start 14.25 -1.65) (end 10.95 -1.65) (layer F.Fab) (width 0.1)) (fp_line (start 14.25 1.65) (end 14.25 -1.65) (layer F.Fab) (width 0.1)) (fp_line (start 10.95 1.65) (end 14.25 1.65) (layer F.Fab) (width 0.1)) (fp_line (start 10.95 -1.65) (end 10.95 1.65) (layer F.Fab) (width 0.1)) (fp_line (start 10.05 1.65) (end 6.75 1.65) (layer F.Fab) (width 0.1)) (fp_line (start 10.05 -0.825) (end 10.05 1.65) (layer F.Fab) (width 0.1)) (fp_line (start 9.225 -1.65) (end 10.05 -0.825) (layer F.Fab) (width 0.1)) (fp_line (start 7.575 -1.65) (end 9.225 -1.65) (layer F.Fab) (width 0.1)) (fp_line (start 6.75 -0.825) (end 7.575 -1.65) (layer F.Fab) (width 0.1)) (fp_line (start 6.75 1.65) (end 6.75 -0.825) (layer F.Fab) (width 0.1)) (fp_line (start 10.05 2.55) (end 6.75 2.55) (layer F.Fab) (width 0.1)) (fp_line (start 10.05 5.85) (end 10.05 2.55) (layer F.Fab) (width 0.1)) (fp_line (start 6.75 5.85) (end 10.05 5.85) (layer F.Fab) (width 0.1)) (fp_line (start 6.75 2.55) (end 6.75 5.85) (layer F.Fab) (width 0.1)) (fp_line (start 5.85 1.65) (end 2.55 1.65) (layer F.Fab) (width 0.1)) (fp_line (start 5.85 -0.825) (end 5.85 1.65) (layer F.Fab) (width 0.1)) (fp_line (start 5.025 -1.65) (end 5.85 -0.825) (layer F.Fab) (width 0.1)) (fp_line (start 3.375 -1.65) (end 5.025 -1.65) (layer F.Fab) (width 0.1)) (fp_line (start 2.55 -0.825) (end 3.375 -1.65) (layer F.Fab) (width 0.1)) (fp_line (start 2.55 1.65) (end 2.55 -0.825) (layer F.Fab) (width 0.1)) (fp_line (start 5.85 2.55) (end 2.55 2.55) (layer F.Fab) (width 0.1)) (fp_line (start 5.85 5.85) (end 5.85 2.55) (layer F.Fab) (width 0.1)) (fp_line (start 2.55 5.85) (end 5.85 5.85) (layer F.Fab) (width 0.1)) (fp_line (start 2.55 2.55) (end 2.55 5.85) (layer F.Fab) (width 0.1)) (fp_line (start 1.65 5.85) (end -1.65 5.85) (layer F.Fab) (width 0.1)) (fp_line (start 1.65 3.375) (end 1.65 5.85) (layer F.Fab) (width 0.1)) (fp_line (start 0.825 2.55) (end 1.65 3.375) (layer F.Fab) (width 0.1)) (fp_line (start -0.825 2.55) (end 0.825 2.55) (layer F.Fab) (width 0.1)) (fp_line (start -1.65 3.375) (end -0.825 2.55) (layer F.Fab) (width 0.1)) (fp_line (start -1.65 5.85) (end -1.65 3.375) (layer F.Fab) (width 0.1)) (fp_line (start 1.65 -1.65) (end -1.65 -1.65) (layer F.Fab) (width 0.1)) (fp_line (start 1.65 1.65) (end 1.65 -1.65) (layer F.Fab) (width 0.1)) (fp_line (start -1.65 1.65) (end 1.65 1.65) (layer F.Fab) (width 0.1)) (fp_line (start -1.65 -1.65) (end -1.65 1.65) (layer F.Fab) (width 0.1)) (fp_line (start 8 8.1) (end 8 6.7) (layer F.Fab) (width 0.1)) (fp_line (start 4.6 8.1) (end 8 8.1) (layer F.Fab) (width 0.1)) (fp_line (start 4.6 6.7) (end 4.6 8.1) (layer F.Fab) (width 0.1)) (fp_line (start 15.3 -2.9) (end -2.7 -2.9) (layer F.Fab) (width 0.1)) (fp_line (start 15.3 6.7) (end 15.3 -2.9) (layer F.Fab) (width 0.1)) (fp_line (start -2.7 6.7) (end 15.3 6.7) (layer F.Fab) (width 0.1)) (fp_line (start -2.7 -2.9) (end -2.7 6.7) (layer F.Fab) (width 0.1)) (pad 8 thru_hole oval (at 12.6 4.2 180) (size 2.7 3.7) (drill 1.8) (layers *.Cu *.Mask) (net 1 GND)) (pad 7 thru_hole oval (at 8.4 4.2 180) (size 2.7 3.7) (drill 1.8) (layers *.Cu *.Mask) (net 1 GND)) (pad 6 thru_hole oval (at 4.2 4.2 180) (size 2.7 3.7) (drill 1.8) (layers *.Cu *.Mask) (net 1 GND)) (pad 5 thru_hole oval (at 0 4.2 180) (size 2.7 3.7) (drill 1.8) (layers *.Cu *.Mask) (net 1 GND)) (pad 4 thru_hole oval (at 12.6 0 180) (size 2.7 3.7) (drill 1.8) (layers *.Cu *.Mask) (net 7 +12V)) (pad 3 thru_hole oval (at 8.4 0 180) (size 2.7 3.7) (drill 1.8) (layers *.Cu *.Mask) (net 7 +12V)) (pad 1 thru_hole roundrect (at 0 0 180) (size 2.7 3.7) (drill 1.8) (layers *.Cu *.Mask) (roundrect_rratio 0.09300000000000001) (net 7 +12V)) (pad 2 thru_hole oval (at 4.2 0 180) (size 2.7 3.7) (drill 1.8) (layers *.Cu *.Mask) (net 7 +12V)) (model ${KIPRJMOD}/Packages3D/KCORES_Connector_ATX_Power/Molex_46207-1008.stp (offset (xyz 6.3 -1.9 13.6)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 180)) ) ) (module KCORES_Connector_ATX_Power:ATX_8Pin_P4.20mm_Vertical_4.20mm (layer F.Cu) (tedit 6050AB0D) (tstamp 604FCCEC) (at 119.7 94.5) (descr "ATX CPU Power Connector 实心针") (tags "connector Molex Mini-Fit_Jr side entry ATX CPU") (path /60BA4414) (fp_text reference J4 (at 6.3 -4.1) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value GW_PCIe/CPU (at 16.8 2.1 90) (layer F.SilkS) (effects (font (size 1 1) (thickness 0.15))) ) (fp_text user %R (at 6.3 -2.2) (layer F.Fab) (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start 15.8 -3.4) (end -3.2 -3.4) (layer F.CrtYd) (width 0.05)) (fp_line (start 15.8 8.6) (end 15.8 -3.4) (layer F.CrtYd) (width 0.05)) (fp_line (start -3.2 8.6) (end 15.8 8.6) (layer F.CrtYd) (width 0.05)) (fp_line (start -3.2 -3.4) (end -3.2 8.6) (layer F.CrtYd) (width 0.05)) (fp_line (start -3.05 -3.25) (end -3.05 -0.4) (layer F.Fab) (width 0.1)) (fp_line (start -0.2 -3.25) (end -3.05 -3.25) (layer F.Fab) (width 0.1)) (fp_line (start -3.05 -3.25) (end -3.05 -0.4) (layer F.SilkS) (width 0.12)) (fp_line (start -0.2 -3.25) (end -3.05 -3.25) (layer F.SilkS) (width 0.12)) (fp_line (start 8.11 8.21) (end 6.3 8.21) (layer F.SilkS) (width 0.12)) (fp_line (start 8.11 6.81) (end 8.11 8.21) (layer F.SilkS) (width 0.12)) (fp_line (start 15.41 6.81) (end 8.11 6.81) (layer F.SilkS) (width 0.12)) (fp_line (start 15.41 -3.01) (end 15.41 6.81) (layer F.SilkS) (width 0.12)) (fp_line (start 6.3 -3.01) (end 15.41 -3.01) (layer F.SilkS) (width 0.12)) (fp_line (start 4.49 8.21) (end 6.3 8.21) (layer F.SilkS) (width 0.12)) (fp_line (start 4.49 6.81) (end 4.49 8.21) (layer F.SilkS) (width 0.12)) (fp_line (start -2.81 6.81) (end 4.49 6.81) (layer F.SilkS) (width 0.12)) (fp_line (start -2.81 -3.01) (end -2.81 6.81) (layer F.SilkS) (width 0.12)) (fp_line (start 6.3 -3.01) (end -2.81 -3.01) (layer F.SilkS) (width 0.12)) (fp_line (start 14.25 5.85) (end 10.95 5.85) (layer F.Fab) (width 0.1)) (fp_line (start 14.25 3.375) (end 14.25 5.85) (layer F.Fab) (width 0.1)) (fp_line (start 13.425 2.55) (end 14.25 3.375) (layer F.Fab) (width 0.1)) (fp_line (start 11.775 2.55) (end 13.425 2.55) (layer F.Fab) (width 0.1)) (fp_line (start 10.95 3.375) (end 11.775 2.55) (layer F.Fab) (width 0.1)) (fp_line (start 10.95 5.85) (end 10.95 3.375) (layer F.Fab) (width 0.1)) (fp_line (start 14.25 -1.65) (end 10.95 -1.65) (layer F.Fab) (width 0.1)) (fp_line (start 14.25 1.65) (end 14.25 -1.65) (layer F.Fab) (width 0.1)) (fp_line (start 10.95 1.65) (end 14.25 1.65) (layer F.Fab) (width 0.1)) (fp_line (start 10.95 -1.65) (end 10.95 1.65) (layer F.Fab) (width 0.1)) (fp_line (start 10.05 1.65) (end 6.75 1.65) (layer F.Fab) (width 0.1)) (fp_line (start 10.05 -0.825) (end 10.05 1.65) (layer F.Fab) (width 0.1)) (fp_line (start 9.225 -1.65) (end 10.05 -0.825) (layer F.Fab) (width 0.1)) (fp_line (start 7.575 -1.65) (end 9.225 -1.65) (layer F.Fab) (width 0.1)) (fp_line (start 6.75 -0.825) (end 7.575 -1.65) (layer F.Fab) (width 0.1)) (fp_line (start 6.75 1.65) (end 6.75 -0.825) (layer F.Fab) (width 0.1)) (fp_line (start 10.05 2.55) (end 6.75 2.55) (layer F.Fab) (width 0.1)) (fp_line (start 10.05 5.85) (end 10.05 2.55) (layer F.Fab) (width 0.1)) (fp_line (start 6.75 5.85) (end 10.05 5.85) (layer F.Fab) (width 0.1)) (fp_line (start 6.75 2.55) (end 6.75 5.85) (layer F.Fab) (width 0.1)) (fp_line (start 5.85 1.65) (end 2.55 1.65) (layer F.Fab) (width 0.1)) (fp_line (start 5.85 -0.825) (end 5.85 1.65) (layer F.Fab) (width 0.1)) (fp_line (start 5.025 -1.65) (end 5.85 -0.825) (layer F.Fab) (width 0.1)) (fp_line (start 3.375 -1.65) (end 5.025 -1.65) (layer F.Fab) (width 0.1)) (fp_line (start 2.55 -0.825) (end 3.375 -1.65) (layer F.Fab) (width 0.1)) (fp_line (start 2.55 1.65) (end 2.55 -0.825) (layer F.Fab) (width 0.1)) (fp_line (start 5.85 2.55) (end 2.55 2.55) (layer F.Fab) (width 0.1)) (fp_line (start 5.85 5.85) (end 5.85 2.55) (layer F.Fab) (width 0.1)) (fp_line (start 2.55 5.85) (end 5.85 5.85) (layer F.Fab) (width 0.1)) (fp_line (start 2.55 2.55) (end 2.55 5.85) (layer F.Fab) (width 0.1)) (fp_line (start 1.65 5.85) (end -1.65 5.85) (layer F.Fab) (width 0.1)) (fp_line (start 1.65 3.375) (end 1.65 5.85) (layer F.Fab) (width 0.1)) (fp_line (start 0.825 2.55) (end 1.65 3.375) (layer F.Fab) (width 0.1)) (fp_line (start -0.825 2.55) (end 0.825 2.55) (layer F.Fab) (width 0.1)) (fp_line (start -1.65 3.375) (end -0.825 2.55) (layer F.Fab) (width 0.1)) (fp_line (start -1.65 5.85) (end -1.65 3.375) (layer F.Fab) (width 0.1)) (fp_line (start 1.65 -1.65) (end -1.65 -1.65) (layer F.Fab) (width 0.1)) (fp_line (start 1.65 1.65) (end 1.65 -1.65) (layer F.Fab) (width 0.1)) (fp_line (start -1.65 1.65) (end 1.65 1.65) (layer F.Fab) (width 0.1)) (fp_line (start -1.65 -1.65) (end -1.65 1.65) (layer F.Fab) (width 0.1)) (fp_line (start 8 8.1) (end 8 6.7) (layer F.Fab) (width 0.1)) (fp_line (start 4.6 8.1) (end 8 8.1) (layer F.Fab) (width 0.1)) (fp_line (start 4.6 6.7) (end 4.6 8.1) (layer F.Fab) (width 0.1)) (fp_line (start 15.3 -2.9) (end -2.7 -2.9) (layer F.Fab) (width 0.1)) (fp_line (start 15.3 6.7) (end 15.3 -2.9) (layer F.Fab) (width 0.1)) (fp_line (start -2.7 6.7) (end 15.3 6.7) (layer F.Fab) (width 0.1)) (fp_line (start -2.7 -2.9) (end -2.7 6.7) (layer F.Fab) (width 0.1)) (pad 8 thru_hole oval (at 12.6 4.2) (size 2.7 3.7) (drill 1.8) (layers *.Cu *.Mask) (net 1 GND)) (pad 7 thru_hole oval (at 8.4 4.2) (size 2.7 3.7) (drill 1.8) (layers *.Cu *.Mask) (net 1 GND)) (pad 6 thru_hole oval (at 4.2 4.2) (size 2.7 3.7) (drill 1.8) (layers *.Cu *.Mask) (net 1 GND)) (pad 5 thru_hole oval (at 0 4.2) (size 2.7 3.7) (drill 1.8) (layers *.Cu *.Mask) (net 1 GND)) (pad 4 thru_hole oval (at 12.6 0) (size 2.7 3.7) (drill 1.8) (layers *.Cu *.Mask) (net 7 +12V)) (pad 3 thru_hole oval (at 8.4 0) (size 2.7 3.7) (drill 1.8) (layers *.Cu *.Mask) (net 7 +12V)) (pad 1 thru_hole roundrect (at 0 0) (size 2.7 3.7) (drill 1.8) (layers *.Cu *.Mask) (roundrect_rratio 0.09300000000000001) (net 7 +12V)) (pad 2 thru_hole oval (at 4.2 0) (size 2.7 3.7) (drill 1.8) (layers *.Cu *.Mask) (net 7 +12V)) (model ${KIPRJMOD}/Packages3D/KCORES_Connector_ATX_Power/Molex_46207-1008.stp (offset (xyz 6.3 -1.9 13.6)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 180)) ) ) (module KCORES_Connector_ATX_Power:ATX_8Pin_P4.20mm_Vertical_4.20mm (layer F.Cu) (tedit 6050AB0D) (tstamp 604FCC9E) (at 132.3 84 180) (descr "ATX CPU Power Connector 实心针") (tags "connector Molex Mini-Fit_Jr side entry ATX CPU") (path /60B0B1E3) (fp_text reference J3 (at 6.3 -4.1) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value GW_PCIe/CPU (at -4.2 2.1 90) (layer F.SilkS) (effects (font (size 1 1) (thickness 0.15))) ) (fp_text user %R (at 6.3 -2.2) (layer F.Fab) (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start 15.8 -3.4) (end -3.2 -3.4) (layer F.CrtYd) (width 0.05)) (fp_line (start 15.8 8.6) (end 15.8 -3.4) (layer F.CrtYd) (width 0.05)) (fp_line (start -3.2 8.6) (end 15.8 8.6) (layer F.CrtYd) (width 0.05)) (fp_line (start -3.2 -3.4) (end -3.2 8.6) (layer F.CrtYd) (width 0.05)) (fp_line (start -3.05 -3.25) (end -3.05 -0.4) (layer F.Fab) (width 0.1)) (fp_line (start -0.2 -3.25) (end -3.05 -3.25) (layer F.Fab) (width 0.1)) (fp_line (start -3.05 -3.25) (end -3.05 -0.4) (layer F.SilkS) (width 0.12)) (fp_line (start -0.2 -3.25) (end -3.05 -3.25) (layer F.SilkS) (width 0.12)) (fp_line (start 8.11 8.21) (end 6.3 8.21) (layer F.SilkS) (width 0.12)) (fp_line (start 8.11 6.81) (end 8.11 8.21) (layer F.SilkS) (width 0.12)) (fp_line (start 15.41 6.81) (end 8.11 6.81) (layer F.SilkS) (width 0.12)) (fp_line (start 15.41 -3.01) (end 15.41 6.81) (layer F.SilkS) (width 0.12)) (fp_line (start 6.3 -3.01) (end 15.41 -3.01) (layer F.SilkS) (width 0.12)) (fp_line (start 4.49 8.21) (end 6.3 8.21) (layer F.SilkS) (width 0.12)) (fp_line (start 4.49 6.81) (end 4.49 8.21) (layer F.SilkS) (width 0.12)) (fp_line (start -2.81 6.81) (end 4.49 6.81) (layer F.SilkS) (width 0.12)) (fp_line (start -2.81 -3.01) (end -2.81 6.81) (layer F.SilkS) (width 0.12)) (fp_line (start 6.3 -3.01) (end -2.81 -3.01) (layer F.SilkS) (width 0.12)) (fp_line (start 14.25 5.85) (end 10.95 5.85) (layer F.Fab) (width 0.1)) (fp_line (start 14.25 3.375) (end 14.25 5.85) (layer F.Fab) (width 0.1)) (fp_line (start 13.425 2.55) (end 14.25 3.375) (layer F.Fab) (width 0.1)) (fp_line (start 11.775 2.55) (end 13.425 2.55) (layer F.Fab) (width 0.1)) (fp_line (start 10.95 3.375) (end 11.775 2.55) (layer F.Fab) (width 0.1)) (fp_line (start 10.95 5.85) (end 10.95 3.375) (layer F.Fab) (width 0.1)) (fp_line (start 14.25 -1.65) (end 10.95 -1.65) (layer F.Fab) (width 0.1)) (fp_line (start 14.25 1.65) (end 14.25 -1.65) (layer F.Fab) (width 0.1)) (fp_line (start 10.95 1.65) (end 14.25 1.65) (layer F.Fab) (width 0.1)) (fp_line (start 10.95 -1.65) (end 10.95 1.65) (layer F.Fab) (width 0.1)) (fp_line (start 10.05 1.65) (end 6.75 1.65) (layer F.Fab) (width 0.1)) (fp_line (start 10.05 -0.825) (end 10.05 1.65) (layer F.Fab) (width 0.1)) (fp_line (start 9.225 -1.65) (end 10.05 -0.825) (layer F.Fab) (width 0.1)) (fp_line (start 7.575 -1.65) (end 9.225 -1.65) (layer F.Fab) (width 0.1)) (fp_line (start 6.75 -0.825) (end 7.575 -1.65) (layer F.Fab) (width 0.1)) (fp_line (start 6.75 1.65) (end 6.75 -0.825) (layer F.Fab) (width 0.1)) (fp_line (start 10.05 2.55) (end 6.75 2.55) (layer F.Fab) (width 0.1)) (fp_line (start 10.05 5.85) (end 10.05 2.55) (layer F.Fab) (width 0.1)) (fp_line (start 6.75 5.85) (end 10.05 5.85) (layer F.Fab) (width 0.1)) (fp_line (start 6.75 2.55) (end 6.75 5.85) (layer F.Fab) (width 0.1)) (fp_line (start 5.85 1.65) (end 2.55 1.65) (layer F.Fab) (width 0.1)) (fp_line (start 5.85 -0.825) (end 5.85 1.65) (layer F.Fab) (width 0.1)) (fp_line (start 5.025 -1.65) (end 5.85 -0.825) (layer F.Fab) (width 0.1)) (fp_line (start 3.375 -1.65) (end 5.025 -1.65) (layer F.Fab) (width 0.1)) (fp_line (start 2.55 -0.825) (end 3.375 -1.65) (layer F.Fab) (width 0.1)) (fp_line (start 2.55 1.65) (end 2.55 -0.825) (layer F.Fab) (width 0.1)) (fp_line (start 5.85 2.55) (end 2.55 2.55) (layer F.Fab) (width 0.1)) (fp_line (start 5.85 5.85) (end 5.85 2.55) (layer F.Fab) (width 0.1)) (fp_line (start 2.55 5.85) (end 5.85 5.85) (layer F.Fab) (width 0.1)) (fp_line (start 2.55 2.55) (end 2.55 5.85) (layer F.Fab) (width 0.1)) (fp_line (start 1.65 5.85) (end -1.65 5.85) (layer F.Fab) (width 0.1)) (fp_line (start 1.65 3.375) (end 1.65 5.85) (layer F.Fab) (width 0.1)) (fp_line (start 0.825 2.55) (end 1.65 3.375) (layer F.Fab) (width 0.1)) (fp_line (start -0.825 2.55) (end 0.825 2.55) (layer F.Fab) (width 0.1)) (fp_line (start -1.65 3.375) (end -0.825 2.55) (layer F.Fab) (width 0.1)) (fp_line (start -1.65 5.85) (end -1.65 3.375) (layer F.Fab) (width 0.1)) (fp_line (start 1.65 -1.65) (end -1.65 -1.65) (layer F.Fab) (width 0.1)) (fp_line (start 1.65 1.65) (end 1.65 -1.65) (layer F.Fab) (width 0.1)) (fp_line (start -1.65 1.65) (end 1.65 1.65) (layer F.Fab) (width 0.1)) (fp_line (start -1.65 -1.65) (end -1.65 1.65) (layer F.Fab) (width 0.1)) (fp_line (start 8 8.1) (end 8 6.7) (layer F.Fab) (width 0.1)) (fp_line (start 4.6 8.1) (end 8 8.1) (layer F.Fab) (width 0.1)) (fp_line (start 4.6 6.7) (end 4.6 8.1) (layer F.Fab) (width 0.1)) (fp_line (start 15.3 -2.9) (end -2.7 -2.9) (layer F.Fab) (width 0.1)) (fp_line (start 15.3 6.7) (end 15.3 -2.9) (layer F.Fab) (width 0.1)) (fp_line (start -2.7 6.7) (end 15.3 6.7) (layer F.Fab) (width 0.1)) (fp_line (start -2.7 -2.9) (end -2.7 6.7) (layer F.Fab) (width 0.1)) (pad 8 thru_hole oval (at 12.6 4.2 180) (size 2.7 3.7) (drill 1.8) (layers *.Cu *.Mask) (net 1 GND)) (pad 7 thru_hole oval (at 8.4 4.2 180) (size 2.7 3.7) (drill 1.8) (layers *.Cu *.Mask) (net 1 GND)) (pad 6 thru_hole oval (at 4.2 4.2 180) (size 2.7 3.7) (drill 1.8) (layers *.Cu *.Mask) (net 1 GND)) (pad 5 thru_hole oval (at 0 4.2 180) (size 2.7 3.7) (drill 1.8) (layers *.Cu *.Mask) (net 1 GND)) (pad 4 thru_hole oval (at 12.6 0 180) (size 2.7 3.7) (drill 1.8) (layers *.Cu *.Mask) (net 7 +12V)) (pad 3 thru_hole oval (at 8.4 0 180) (size 2.7 3.7) (drill 1.8) (layers *.Cu *.Mask) (net 7 +12V)) (pad 1 thru_hole roundrect (at 0 0 180) (size 2.7 3.7) (drill 1.8) (layers *.Cu *.Mask) (roundrect_rratio 0.09300000000000001) (net 7 +12V)) (pad 2 thru_hole oval (at 4.2 0 180) (size 2.7 3.7) (drill 1.8) (layers *.Cu *.Mask) (net 7 +12V)) (model ${KIPRJMOD}/Packages3D/KCORES_Connector_ATX_Power/Molex_46207-1008.stp (offset (xyz 6.3 -1.9 13.6)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 180)) ) ) (module KCORES_Connector_ATX_Power:ATX_24Pin_P4.20mm_Vertical_4.20mm (layer F.Cu) (tedit 60522667) (tstamp 604FCE4A) (at 172.2 113.4 270) (descr "Molex Mini-Fit Jr. Power Connectors, Row Spacing 4.20mm") (tags "connector Molex Mini-Fit_Jr side entry") (path /604FFFB5) (fp_text reference J9 (at 23.1 -3.45 90) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value GW_24P_ATX (at 23.1 -4.2 90) (layer F.SilkS) (effects (font (size 1 1) (thickness 0.15))) ) (fp_text user %R (at 23.1 -1.55 90) (layer F.Fab) (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start 49.4 -3.4) (end -3.2 -3.4) (layer F.CrtYd) (width 0.05)) (fp_line (start 49.4 8.6) (end 49.4 -3.4) (layer F.CrtYd) (width 0.05)) (fp_line (start -3.2 8.6) (end 49.4 8.6) (layer F.CrtYd) (width 0.05)) (fp_line (start -3.2 -3.4) (end -3.2 8.6) (layer F.CrtYd) (width 0.05)) (fp_line (start -3.05 -3.25) (end -3.05 -0.4) (layer F.Fab) (width 0.1)) (fp_line (start -0.2 -3.25) (end -3.05 -3.25) (layer F.Fab) (width 0.1)) (fp_line (start -3.05 -3.25) (end -3.05 -0.4) (layer F.SilkS) (width 0.12)) (fp_line (start -0.2 -3.25) (end -3.05 -3.25) (layer F.SilkS) (width 0.12)) (fp_line (start 24.91 8.21) (end 23.1 8.21) (layer F.SilkS) (width 0.12)) (fp_line (start 24.91 6.81) (end 24.91 8.21) (layer F.SilkS) (width 0.12)) (fp_line (start 49.01 6.81) (end 24.91 6.81) (layer F.SilkS) (width 0.12)) (fp_line (start 49.01 -3.01) (end 49.01 6.81) (layer F.SilkS) (width 0.12)) (fp_line (start 23.1 -3.01) (end 49.01 -3.01) (layer F.SilkS) (width 0.12)) (fp_line (start 21.29 8.21) (end 23.1 8.21) (layer F.SilkS) (width 0.12)) (fp_line (start 21.29 6.81) (end 21.29 8.21) (layer F.SilkS) (width 0.12)) (fp_line (start -2.81 6.81) (end 21.29 6.81) (layer F.SilkS) (width 0.12)) (fp_line (start -2.81 -3.01) (end -2.81 6.81) (layer F.SilkS) (width 0.12)) (fp_line (start 23.1 -3.01) (end -2.81 -3.01) (layer F.SilkS) (width 0.12)) (fp_line (start 47.85 5.85) (end 44.55 5.85) (layer F.Fab) (width 0.1)) (fp_line (start 47.85 3.375) (end 47.85 5.85) (layer F.Fab) (width 0.1)) (fp_line (start 47.025 2.55) (end 47.85 3.375) (layer F.Fab) (width 0.1)) (fp_line (start 45.375 2.55) (end 47.025 2.55) (layer F.Fab) (width 0.1)) (fp_line (start 44.55 3.375) (end 45.375 2.55) (layer F.Fab) (width 0.1)) (fp_line (start 44.55 5.85) (end 44.55 3.375) (layer F.Fab) (width 0.1)) (fp_line (start 47.85 -1.65) (end 44.55 -1.65) (layer F.Fab) (width 0.1)) (fp_line (start 47.85 1.65) (end 47.85 -1.65) (layer F.Fab) (width 0.1)) (fp_line (start 44.55 1.65) (end 47.85 1.65) (layer F.Fab) (width 0.1)) (fp_line (start 44.55 -1.65) (end 44.55 1.65) (layer F.Fab) (width 0.1)) (fp_line (start 43.65 1.65) (end 40.35 1.65) (layer F.Fab) (width 0.1)) (fp_line (start 43.65 -0.825) (end 43.65 1.65) (layer F.Fab) (width 0.1)) (fp_line (start 42.825 -1.65) (end 43.65 -0.825) (layer F.Fab) (width 0.1)) (fp_line (start 41.175 -1.65) (end 42.825 -1.65) (layer F.Fab) (width 0.1)) (fp_line (start 40.35 -0.825) (end 41.175 -1.65) (layer F.Fab) (width 0.1)) (fp_line (start 40.35 1.65) (end 40.35 -0.825) (layer F.Fab) (width 0.1)) (fp_line (start 43.65 2.55) (end 40.35 2.55) (layer F.Fab) (width 0.1)) (fp_line (start 43.65 5.85) (end 43.65 2.55) (layer F.Fab) (width 0.1)) (fp_line (start 40.35 5.85) (end 43.65 5.85) (layer F.Fab) (width 0.1)) (fp_line (start 40.35 2.55) (end 40.35 5.85) (layer F.Fab) (width 0.1)) (fp_line (start 39.45 1.65) (end 36.15 1.65) (layer F.Fab) (width 0.1)) (fp_line (start 39.45 -0.825) (end 39.45 1.65) (layer F.Fab) (width 0.1)) (fp_line (start 38.625 -1.65) (end 39.45 -0.825) (layer F.Fab) (width 0.1)) (fp_line (start 36.975 -1.65) (end 38.625 -1.65) (layer F.Fab) (width 0.1)) (fp_line (start 36.15 -0.825) (end 36.975 -1.65) (layer F.Fab) (width 0.1)) (fp_line (start 36.15 1.65) (end 36.15 -0.825) (layer F.Fab) (width 0.1)) (fp_line (start 39.45 2.55) (end 36.15 2.55) (layer F.Fab) (width 0.1)) (fp_line (start 39.45 5.85) (end 39.45 2.55) (layer F.Fab) (width 0.1)) (fp_line (start 36.15 5.85) (end 39.45 5.85) (layer F.Fab) (width 0.1)) (fp_line (start 36.15 2.55) (end 36.15 5.85) (layer F.Fab) (width 0.1)) (fp_line (start 35.25 5.85) (end 31.95 5.85) (layer F.Fab) (width 0.1)) (fp_line (start 35.25 3.375) (end 35.25 5.85) (layer F.Fab) (width 0.1)) (fp_line (start 34.425 2.55) (end 35.25 3.375) (layer F.Fab) (width 0.1)) (fp_line (start 32.775 2.55) (end 34.425 2.55) (layer F.Fab) (width 0.1)) (fp_line (start 31.95 3.375) (end 32.775 2.55) (layer F.Fab) (width 0.1)) (fp_line (start 31.95 5.85) (end 31.95 3.375) (layer F.Fab) (width 0.1)) (fp_line (start 35.25 -1.65) (end 31.95 -1.65) (layer F.Fab) (width 0.1)) (fp_line (start 35.25 1.65) (end 35.25 -1.65) (layer F.Fab) (width 0.1)) (fp_line (start 31.95 1.65) (end 35.25 1.65) (layer F.Fab) (width 0.1)) (fp_line (start 31.95 -1.65) (end 31.95 1.65) (layer F.Fab) (width 0.1)) (fp_line (start 31.05 5.85) (end 27.75 5.85) (layer F.Fab) (width 0.1)) (fp_line (start 31.05 3.375) (end 31.05 5.85) (layer F.Fab) (width 0.1)) (fp_line (start 30.225 2.55) (end 31.05 3.375) (layer F.Fab) (width 0.1)) (fp_line (start 28.575 2.55) (end 30.225 2.55) (layer F.Fab) (width 0.1)) (fp_line (start 27.75 3.375) (end 28.575 2.55) (layer F.Fab) (width 0.1)) (fp_line (start 27.75 5.85) (end 27.75 3.375) (layer F.Fab) (width 0.1)) (fp_line (start 31.05 -1.65) (end 27.75 -1.65) (layer F.Fab) (width 0.1)) (fp_line (start 31.05 1.65) (end 31.05 -1.65) (layer F.Fab) (width 0.1)) (fp_line (start 27.75 1.65) (end 31.05 1.65) (layer F.Fab) (width 0.1)) (fp_line (start 27.75 -1.65) (end 27.75 1.65) (layer F.Fab) (width 0.1)) (fp_line (start 26.85 1.65) (end 23.55 1.65) (layer F.Fab) (width 0.1)) (fp_line (start 26.85 -0.825) (end 26.85 1.65) (layer F.Fab) (width 0.1)) (fp_line (start 26.025 -1.65) (end 26.85 -0.825) (layer F.Fab) (width 0.1)) (fp_line (start 24.375 -1.65) (end 26.025 -1.65) (layer F.Fab) (width 0.1)) (fp_line (start 23.55 -0.825) (end 24.375 -1.65) (layer F.Fab) (width 0.1)) (fp_line (start 23.55 1.65) (end 23.55 -0.825) (layer F.Fab) (width 0.1)) (fp_line (start 26.85 2.55) (end 23.55 2.55) (layer F.Fab) (width 0.1)) (fp_line (start 26.85 5.85) (end 26.85 2.55) (layer F.Fab) (width 0.1)) (fp_line (start 23.55 5.85) (end 26.85 5.85) (layer F.Fab) (width 0.1)) (fp_line (start 23.55 2.55) (end 23.55 5.85) (layer F.Fab) (width 0.1)) (fp_line (start 22.65 1.65) (end 19.35 1.65) (layer F.Fab) (width 0.1)) (fp_line (start 22.65 -0.825) (end 22.65 1.65) (layer F.Fab) (width 0.1)) (fp_line (start 21.825 -1.65) (end 22.65 -0.825) (layer F.Fab) (width 0.1)) (fp_line (start 20.175 -1.65) (end 21.825 -1.65) (layer F.Fab) (width 0.1)) (fp_line (start 19.35 -0.825) (end 20.175 -1.65) (layer F.Fab) (width 0.1)) (fp_line (start 19.35 1.65) (end 19.35 -0.825) (layer F.Fab) (width 0.1)) (fp_line (start 22.65 2.55) (end 19.35 2.55) (layer F.Fab) (width 0.1)) (fp_line (start 22.65 5.85) (end 22.65 2.55) (layer F.Fab) (width 0.1)) (fp_line (start 19.35 5.85) (end 22.65 5.85) (layer F.Fab) (width 0.1)) (fp_line (start 19.35 2.55) (end 19.35 5.85) (layer F.Fab) (width 0.1)) (fp_line (start 18.45 5.85) (end 15.15 5.85) (layer F.Fab) (width 0.1)) (fp_line (start 18.45 3.375) (end 18.45 5.85) (layer F.Fab) (width 0.1)) (fp_line (start 17.625 2.55) (end 18.45 3.375) (layer F.Fab) (width 0.1)) (fp_line (start 15.975 2.55) (end 17.625 2.55) (layer F.Fab) (width 0.1)) (fp_line (start 15.15 3.375) (end 15.975 2.55) (layer F.Fab) (width 0.1)) (fp_line (start 15.15 5.85) (end 15.15 3.375) (layer F.Fab) (width 0.1)) (fp_line (start 18.45 -1.65) (end 15.15 -1.65) (layer F.Fab) (width 0.1)) (fp_line (start 18.45 1.65) (end 18.45 -1.65) (layer F.Fab) (width 0.1)) (fp_line (start 15.15 1.65) (end 18.45 1.65) (layer F.Fab) (width 0.1)) (fp_line (start 15.15 -1.65) (end 15.15 1.65) (layer F.Fab) (width 0.1)) (fp_line (start 14.25 5.85) (end 10.95 5.85) (layer F.Fab) (width 0.1)) (fp_line (start 14.25 3.375) (end 14.25 5.85) (layer F.Fab) (width 0.1)) (fp_line (start 13.425 2.55) (end 14.25 3.375) (layer F.Fab) (width 0.1)) (fp_line (start 11.775 2.55) (end 13.425 2.55) (layer F.Fab) (width 0.1)) (fp_line (start 10.95 3.375) (end 11.775 2.55) (layer F.Fab) (width 0.1)) (fp_line (start 10.95 5.85) (end 10.95 3.375) (layer F.Fab) (width 0.1)) (fp_line (start 14.25 -1.65) (end 10.95 -1.65) (layer F.Fab) (width 0.1)) (fp_line (start 14.25 1.65) (end 14.25 -1.65) (layer F.Fab) (width 0.1)) (fp_line (start 10.95 1.65) (end 14.25 1.65) (layer F.Fab) (width 0.1)) (fp_line (start 10.95 -1.65) (end 10.95 1.65) (layer F.Fab) (width 0.1)) (fp_line (start 10.05 1.65) (end 6.75 1.65) (layer F.Fab) (width 0.1)) (fp_line (start 10.05 -0.825) (end 10.05 1.65) (layer F.Fab) (width 0.1)) (fp_line (start 9.225 -1.65) (end 10.05 -0.825) (layer F.Fab) (width 0.1)) (fp_line (start 7.575 -1.65) (end 9.225 -1.65) (layer F.Fab) (width 0.1)) (fp_line (start 6.75 -0.825) (end 7.575 -1.65) (layer F.Fab) (width 0.1)) (fp_line (start 6.75 1.65) (end 6.75 -0.825) (layer F.Fab) (width 0.1)) (fp_line (start 10.05 2.55) (end 6.75 2.55) (layer F.Fab) (width 0.1)) (fp_line (start 10.05 5.85) (end 10.05 2.55) (layer F.Fab) (width 0.1)) (fp_line (start 6.75 5.85) (end 10.05 5.85) (layer F.Fab) (width 0.1)) (fp_line (start 6.75 2.55) (end 6.75 5.85) (layer F.Fab) (width 0.1)) (fp_line (start 5.85 1.65) (end 2.55 1.65) (layer F.Fab) (width 0.1)) (fp_line (start 5.85 -0.825) (end 5.85 1.65) (layer F.Fab) (width 0.1)) (fp_line (start 5.025 -1.65) (end 5.85 -0.825) (layer F.Fab) (width 0.1)) (fp_line (start 3.375 -1.65) (end 5.025 -1.65) (layer F.Fab) (width 0.1)) (fp_line (start 2.55 -0.825) (end 3.375 -1.65) (layer F.Fab) (width 0.1)) (fp_line (start 2.55 1.65) (end 2.55 -0.825) (layer F.Fab) (width 0.1)) (fp_line (start 5.85 2.55) (end 2.55 2.55) (layer F.Fab) (width 0.1)) (fp_line (start 5.85 5.85) (end 5.85 2.55) (layer F.Fab) (width 0.1)) (fp_line (start 2.55 5.85) (end 5.85 5.85) (layer F.Fab) (width 0.1)) (fp_line (start 2.55 2.55) (end 2.55 5.85) (layer F.Fab) (width 0.1)) (fp_line (start 1.65 5.85) (end -1.65 5.85) (layer F.Fab) (width 0.1)) (fp_line (start 1.65 3.375) (end 1.65 5.85) (layer F.Fab) (width 0.1)) (fp_line (start 0.825 2.55) (end 1.65 3.375) (layer F.Fab) (width 0.1)) (fp_line (start -0.825 2.55) (end 0.825 2.55) (layer F.Fab) (width 0.1)) (fp_line (start -1.65 3.375) (end -0.825 2.55) (layer F.Fab) (width 0.1)) (fp_line (start -1.65 5.85) (end -1.65 3.375) (layer F.Fab) (width 0.1)) (fp_line (start 1.65 -1.65) (end -1.65 -1.65) (layer F.Fab) (width 0.1)) (fp_line (start 1.65 1.65) (end 1.65 -1.65) (layer F.Fab) (width 0.1)) (fp_line (start -1.65 1.65) (end 1.65 1.65) (layer F.Fab) (width 0.1)) (fp_line (start -1.65 -1.65) (end -1.65 1.65) (layer F.Fab) (width 0.1)) (fp_line (start 24.8 8.1) (end 24.8 6.7) (layer F.Fab) (width 0.1)) (fp_line (start 21.4 8.1) (end 24.8 8.1) (layer F.Fab) (width 0.1)) (fp_line (start 21.4 6.7) (end 21.4 8.1) (layer F.Fab) (width 0.1)) (fp_line (start 48.9 -2.9) (end -2.7 -2.9) (layer F.Fab) (width 0.1)) (fp_line (start 48.9 6.7) (end 48.9 -2.9) (layer F.Fab) (width 0.1)) (fp_line (start -2.7 6.7) (end 48.9 6.7) (layer F.Fab) (width 0.1)) (fp_line (start -2.7 -2.9) (end -2.7 6.7) (layer F.Fab) (width 0.1)) (pad 24 thru_hole oval (at 46.2 4.2 270) (size 2.7 3.7) (drill 1.8) (layers *.Cu *.Mask) (net 7 +12V)) (pad 23 thru_hole oval (at 42 4.2 270) (size 2.7 3.7) (drill 1.8) (layers *.Cu *.Mask) (net 1 GND)) (pad 22 thru_hole oval (at 37.8 4.2 270) (size 2.7 3.7) (drill 1.8) (layers *.Cu *.Mask) (net 1 GND)) (pad 21 thru_hole oval (at 33.6 4.2 270) (size 2.7 3.7) (drill 1.8) (layers *.Cu *.Mask) (net 22 /ATX_PWOK)) (pad 20 thru_hole oval (at 29.4 4.2 270) (size 2.7 3.7) (drill 1.8) (layers *.Cu *.Mask) (net 5 /~ATX_PSON)) (pad 19 thru_hole oval (at 25.2 4.2 270) (size 2.7 3.7) (drill 1.8) (layers *.Cu *.Mask) (net 21 "Net-(J9-Pad19)")) (pad 18 thru_hole oval (at 21 4.2 270) (size 2.7 3.7) (drill 1.8) (layers *.Cu *.Mask) (net 4 /+5VSB)) (pad 17 thru_hole oval (at 16.8 4.2 270) (size 2.7 3.7) (drill 1.8) (layers *.Cu *.Mask) (net 3 +3V3)) (pad 16 thru_hole oval (at 12.6 4.2 270) (size 2.7 3.7) (drill 1.8) (layers *.Cu *.Mask) (net 3 +3V3)) (pad 15 thru_hole oval (at 8.4 4.2 270) (size 2.7 3.7) (drill 1.8) (layers *.Cu *.Mask) (net 20 "Net-(J9-Pad15)")) (pad 14 thru_hole oval (at 4.2 4.2 270) (size 2.7 3.7) (drill 1.8) (layers *.Cu *.Mask) (net 2 +5V)) (pad 13 thru_hole oval (at 0 4.2 270) (size 2.7 3.7) (drill 1.8) (layers *.Cu *.Mask) (net 2 +5V)) (pad 12 thru_hole oval (at 46.2 0 270) (size 2.7 3.7) (drill 1.8) (layers *.Cu *.Mask) (net 7 +12V)) (pad 11 thru_hole oval (at 42 0 270) (size 2.7 3.7) (drill 1.8) (layers *.Cu *.Mask) (net 1 GND)) (pad 10 thru_hole oval (at 37.8 0 270) (size 2.7 3.7) (drill 1.8) (layers *.Cu *.Mask) (net 1 GND)) (pad 9 thru_hole oval (at 33.6 0 270) (size 2.7 3.7) (drill 1.8) (layers *.Cu *.Mask) (net 1 GND)) (pad 8 thru_hole oval (at 29.4 0 270) (size 2.7 3.7) (drill 1.8) (layers *.Cu *.Mask) (net 1 GND)) (pad 7 thru_hole oval (at 25.2 0 270) (size 2.7 3.7) (drill 1.8) (layers *.Cu *.Mask) (net 1 GND)) (pad 6 thru_hole oval (at 21 0 270) (size 2.7 3.7) (drill 1.8) (layers *.Cu *.Mask) (net 1 GND)) (pad 5 thru_hole oval (at 16.8 0 270) (size 2.7 3.7) (drill 1.8) (layers *.Cu *.Mask) (net 3 +3V3)) (pad 4 thru_hole oval (at 12.6 0 270) (size 2.7 3.7) (drill 1.8) (layers *.Cu *.Mask) (net 3 +3V3)) (pad 3 thru_hole oval (at 8.4 0 270) (size 2.7 3.7) (drill 1.8) (layers *.Cu *.Mask) (net 2 +5V)) (pad 1 thru_hole roundrect (at 0 0 270) (size 2.7 3.7) (drill 1.8) (layers *.Cu *.Mask) (roundrect_rratio 0.09300000000000001) (net 2 +5V)) (pad 2 thru_hole oval (at 4.2 0 270) (size 2.7 3.7) (drill 1.8) (layers *.Cu *.Mask) (net 2 +5V)) (model ${KIPRJMOD}/Packages3D/KCORES_Connector_ATX_Power/Molex_46207-1024.stp (offset (xyz 23.1 -1.9 13.6)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 180)) ) ) (module KCORES_Connector_ATX_Power:ATX_4Pin_P4.20mm_Vertical_4.20mm (layer F.Cu) (tedit 60522651) (tstamp 604FCDF7) (at 172.2 100.8 270) (descr "Molex Mini-Fit Jr. Power Connectors, Row Spacing 4.20mm") (tags "connector Molex Mini-Fit_Jr side entry") (path /604FF852) (fp_text reference J8 (at 2.1 -3.45 90) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value IDE/SATA (at 2.1 -4.2 90) (layer F.SilkS) (effects (font (size 1 1) (thickness 0.15))) ) (fp_text user %R (at 2.1 -1.55 90) (layer F.Fab) (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -2.7 -2.9) (end -2.7 6.7) (layer F.Fab) (width 0.1)) (fp_line (start -2.7 6.7) (end 6.9 6.7) (layer F.Fab) (width 0.1)) (fp_line (start 6.9 6.7) (end 6.9 -2.9) (layer F.Fab) (width 0.1)) (fp_line (start 6.9 -2.9) (end -2.7 -2.9) (layer F.Fab) (width 0.1)) (fp_line (start 0.4 6.7) (end 0.4 8.1) (layer F.Fab) (width 0.1)) (fp_line (start 0.4 8.1) (end 3.8 8.1) (layer F.Fab) (width 0.1)) (fp_line (start 3.8 8.1) (end 3.8 6.7) (layer F.Fab) (width 0.1)) (fp_line (start -1.65 -1.65) (end -1.65 1.65) (layer F.Fab) (width 0.1)) (fp_line (start -1.65 1.65) (end 1.65 1.65) (layer F.Fab) (width 0.1)) (fp_line (start 1.65 1.65) (end 1.65 -1.65) (layer F.Fab) (width 0.1)) (fp_line (start 1.65 -1.65) (end -1.65 -1.65) (layer F.Fab) (width 0.1)) (fp_line (start -1.65 5.85) (end -1.65 3.375) (layer F.Fab) (width 0.1)) (fp_line (start -1.65 3.375) (end -0.825 2.55) (layer F.Fab) (width 0.1)) (fp_line (start -0.825 2.55) (end 0.825 2.55) (layer F.Fab) (width 0.1)) (fp_line (start 0.825 2.55) (end 1.65 3.375) (layer F.Fab) (width 0.1)) (fp_line (start 1.65 3.375) (end 1.65 5.85) (layer F.Fab) (width 0.1)) (fp_line (start 1.65 5.85) (end -1.65 5.85) (layer F.Fab) (width 0.1)) (fp_line (start 2.55 2.55) (end 2.55 5.85) (layer F.Fab) (width 0.1)) (fp_line (start 2.55 5.85) (end 5.85 5.85) (layer F.Fab) (width 0.1)) (fp_line (start 5.85 5.85) (end 5.85 2.55) (layer F.Fab) (width 0.1)) (fp_line (start 5.85 2.55) (end 2.55 2.55) (layer F.Fab) (width 0.1)) (fp_line (start 2.55 1.65) (end 2.55 -0.825) (layer F.Fab) (width 0.1)) (fp_line (start 2.55 -0.825) (end 3.375 -1.65) (layer F.Fab) (width 0.1)) (fp_line (start 3.375 -1.65) (end 5.025 -1.65) (layer F.Fab) (width 0.1)) (fp_line (start 5.025 -1.65) (end 5.85 -0.825) (layer F.Fab) (width 0.1)) (fp_line (start 5.85 -0.825) (end 5.85 1.65) (layer F.Fab) (width 0.1)) (fp_line (start 5.85 1.65) (end 2.55 1.65) (layer F.Fab) (width 0.1)) (fp_line (start 2.1 -3.01) (end -2.81 -3.01) (layer F.SilkS) (width 0.12)) (fp_line (start -2.81 -3.01) (end -2.81 6.81) (layer F.SilkS) (width 0.12)) (fp_line (start -2.81 6.81) (end 0.29 6.81) (layer F.SilkS) (width 0.12)) (fp_line (start 0.29 6.81) (end 0.29 8.21) (layer F.SilkS) (width 0.12)) (fp_line (start 0.29 8.21) (end 2.1 8.21) (layer F.SilkS) (width 0.12)) (fp_line (start 2.1 -3.01) (end 7.01 -3.01) (layer F.SilkS) (width 0.12)) (fp_line (start 7.01 -3.01) (end 7.01 6.81) (layer F.SilkS) (width 0.12)) (fp_line (start 7.01 6.81) (end 3.91 6.81) (layer F.SilkS) (width 0.12)) (fp_line (start 3.91 6.81) (end 3.91 8.21) (layer F.SilkS) (width 0.12)) (fp_line (start 3.91 8.21) (end 2.1 8.21) (layer F.SilkS) (width 0.12)) (fp_line (start -0.2 -3.25) (end -3.05 -3.25) (layer F.SilkS) (width 0.12)) (fp_line (start -3.05 -3.25) (end -3.05 -0.4) (layer F.SilkS) (width 0.12)) (fp_line (start -0.2 -3.25) (end -3.05 -3.25) (layer F.Fab) (width 0.1)) (fp_line (start -3.05 -3.25) (end -3.05 -0.4) (layer F.Fab) (width 0.1)) (fp_line (start -3.2 -3.4) (end -3.2 8.6) (layer F.CrtYd) (width 0.05)) (fp_line (start -3.2 8.6) (end 7.4 8.6) (layer F.CrtYd) (width 0.05)) (fp_line (start 7.4 8.6) (end 7.4 -3.4) (layer F.CrtYd) (width 0.05)) (fp_line (start 7.4 -3.4) (end -3.2 -3.4) (layer F.CrtYd) (width 0.05)) (pad 1 thru_hole roundrect (at 0 0 270) (size 2.7 3.7) (drill 1.8) (layers *.Cu *.Mask) (roundrect_rratio 0.09300000000000001) (net 1 GND)) (pad 2 thru_hole oval (at 4.2 0 270) (size 2.7 3.7) (drill 1.8) (layers *.Cu *.Mask) (net 7 +12V)) (pad 3 thru_hole oval (at 0 4.2 270) (size 2.7 3.7) (drill 1.8) (layers *.Cu *.Mask) (net 2 +5V)) (pad 4 thru_hole oval (at 4.2 4.2 270) (size 2.7 3.7) (drill 1.8) (layers *.Cu *.Mask) (net 19 "Net-(J8-Pad4)")) (model ${KIPRJMOD}/Packages3D/KCORES_Connector_ATX_Power/Molex_46207-1004.stp (offset (xyz 2.1 -1.9 13.6)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 180)) ) ) (module Resistor_THT:R_Axial_DIN0207_L6.3mm_D2.5mm_P7.62mm_Horizontal (layer F.Cu) (tedit 5AE5139B) (tstamp 604FCECB) (at 161.46 149.93 270) (descr "Resistor, Axial_DIN0207 series, Axial, Horizontal, pin pitch=7.62mm, 0.25W = 1/4W, length*diameter=6.3*2.5mm^2, http://cdn-reichelt.de/documents/datenblatt/B400/1_4W%23YAG.pdf") (tags "Resistor Axial_DIN0207 series Axial Horizontal pin pitch 7.62mm 0.25W = 1/4W length 6.3mm diameter 2.5mm") (path /605A4702) (fp_text reference R4 (at 3.81 0 90) (layer F.SilkS) (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value 3.3K (at 3.81 2.37 90) (layer F.Fab) (effects (font (size 1 1) (thickness 0.15))) ) (fp_text user %R (at 3.81 0 90) (layer F.Fab) (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start 0.66 -1.25) (end 0.66 1.25) (layer F.Fab) (width 0.1)) (fp_line (start 0.66 1.25) (end 6.96 1.25) (layer F.Fab) (width 0.1)) (fp_line (start 6.96 1.25) (end 6.96 -1.25) (layer F.Fab) (width 0.1)) (fp_line (start 6.96 -1.25) (end 0.66 -1.25) (layer F.Fab) (width 0.1)) (fp_line (start 0 0) (end 0.66 0) (layer F.Fab) (width 0.1)) (fp_line (start 7.62 0) (end 6.96 0) (layer F.Fab) (width 0.1)) (fp_line (start 0.54 -1.04) (end 0.54 -1.37) (layer F.SilkS) (width 0.12)) (fp_line (start 0.54 -1.37) (end 7.08 -1.37) (layer F.SilkS) (width 0.12)) (fp_line (start 7.08 -1.37) (end 7.08 -1.04) (layer F.SilkS) (width 0.12)) (fp_line (start 0.54 1.04) (end 0.54 1.37) (layer F.SilkS) (width 0.12)) (fp_line (start 0.54 1.37) (end 7.08 1.37) (layer F.SilkS) (width 0.12)) (fp_line (start 7.08 1.37) (end 7.08 1.04) (layer F.SilkS) (width 0.12)) (fp_line (start -1.05 -1.5) (end -1.05 1.5) (layer F.CrtYd) (width 0.05)) (fp_line (start -1.05 1.5) (end 8.67 1.5) (layer F.CrtYd) (width 0.05)) (fp_line (start 8.67 1.5) (end 8.67 -1.5) (layer F.CrtYd) (width 0.05)) (fp_line (start 8.67 -1.5) (end -1.05 -1.5) (layer F.CrtYd) (width 0.05)) (pad 2 thru_hole oval (at 7.62 0 270) (size 1.6 1.6) (drill 0.8) (layers *.Cu *.Mask) (net 2 +5V)) (pad 1 thru_hole circle (at 0 0 270) (size 1.6 1.6) (drill 0.8) (layers *.Cu *.Mask) (net 22 /ATX_PWOK)) (model ${KISYS3DMOD}/Resistor_THT.3dshapes/R_Axial_DIN0207_L6.3mm_D2.5mm_P7.62mm_Horizontal.wrl (at (xyz 0 0 0)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 0)) ) ) (module Package_DIP:DIP-8_W7.62mm (layer F.Cu) (tedit 5A02E8C5) (tstamp 604FCF3C) (at 138.6 151.2) (descr "8-lead though-hole mounted DIP package, row spacing 7.62 mm (300 mils)") (tags "THT DIP DIL PDIP 2.54mm 7.62mm 300mil") (path /60500D91) (fp_text reference U4 (at 3.81 3.81) (layer F.SilkS) (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value TPS3511 (at 3.81 9.95) (layer F.Fab) (effects (font (size 1 1) (thickness 0.15))) ) (fp_text user %R (at 3.81 3.81) (layer F.Fab) (effects (font (size 1 1) (thickness 0.15))) ) (fp_arc (start 3.81 -1.33) (end 2.81 -1.33) (angle -180) (layer F.SilkS) (width 0.12)) (fp_line (start 1.635 -1.27) (end 6.985 -1.27) (layer F.Fab) (width 0.1)) (fp_line (start 6.985 -1.27) (end 6.985 8.89) (layer F.Fab) (width 0.1)) (fp_line (start 6.985 8.89) (end 0.635 8.89) (layer F.Fab) (width 0.1)) (fp_line (start 0.635 8.89) (end 0.635 -0.27) (layer F.Fab) (width 0.1)) (fp_line (start 0.635 -0.27) (end 1.635 -1.27) (layer F.Fab) (width 0.1)) (fp_line (start 2.81 -1.33) (end 1.16 -1.33) (layer F.SilkS) (width 0.12)) (fp_line (start 1.16 -1.33) (end 1.16 8.95) (layer F.SilkS) (width 0.12)) (fp_line (start 1.16 8.95) (end 6.46 8.95) (layer F.SilkS) (width 0.12)) (fp_line (start 6.46 8.95) (end 6.46 -1.33) (layer F.SilkS) (width 0.12)) (fp_line (start 6.46 -1.33) (end 4.81 -1.33) (layer F.SilkS) (width 0.12)) (fp_line (start -1.1 -1.55) (end -1.1 9.15) (layer F.CrtYd) (width 0.05)) (fp_line (start -1.1 9.15) (end 8.7 9.15) (layer F.CrtYd) (width 0.05)) (fp_line (start 8.7 9.15) (end 8.7 -1.55) (layer F.CrtYd) (width 0.05)) (fp_line (start 8.7 -1.55) (end -1.1 -1.55) (layer F.CrtYd) (width 0.05)) (pad 8 thru_hole oval (at 7.62 0) (size 1.6 1.6) (drill 0.8) (layers *.Cu *.Mask) (net 22 /ATX_PWOK)) (pad 4 thru_hole oval (at 0 7.62) (size 1.6 1.6) (drill 0.8) (layers *.Cu *.Mask) (net 5 /~ATX_PSON)) (pad 7 thru_hole oval (at 7.62 2.54) (size 1.6 1.6) (drill 0.8) (layers *.Cu *.Mask) (net 6 "Net-(C5-Pad1)")) (pad 3 thru_hole oval (at 0 5.08) (size 1.6 1.6) (drill 0.8) (layers *.Cu *.Mask) (net 23 /~FPO)) (pad 6 thru_hole oval (at 7.62 5.08) (size 1.6 1.6) (drill 0.8) (layers *.Cu *.Mask) (net 2 +5V)) (pad 2 thru_hole oval (at 0 2.54) (size 1.6 1.6) (drill 0.8) (layers *.Cu *.Mask) (net 1 GND)) (pad 5 thru_hole oval (at 7.62 7.62) (size 1.6 1.6) (drill 0.8) (layers *.Cu *.Mask) (net 3 +3V3)) (pad 1 thru_hole rect (at 0 0) (size 1.6 1.6) (drill 0.8) (layers *.Cu *.Mask) (net 24 "Net-(R2-Pad1)")) (model ${KISYS3DMOD}/Package_DIP.3dshapes/DIP-8_W7.62mm.wrl (at (xyz 0 0 0)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 0)) ) ) (module KCORES_Converter_DCDC:Converter_DCDC_Mini_560 (layer F.Cu) (tedit 5FF15A64) (tstamp 604FCF22) (at 137.55 136.26) (path /604FD8F9) (fp_text reference U3 (at 0 10.16) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value "Mini560 5V" (at 0 -8) (layer F.SilkS) (effects (font (size 1 1) (thickness 0.15))) ) (fp_text user + (at 11 -6) (layer F.SilkS) (effects (font (size 1 1) (thickness 0.15))) ) (fp_text user + (at 11 -6) (layer F.SilkS) (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start 5 0) (end 3 2) (layer F.SilkS) (width 0.5)) (fp_line (start 5 0) (end 3 -2) (layer F.SilkS) (width 0.5)) (fp_line (start -5 0) (end 5 0) (layer F.SilkS) (width 0.5)) (fp_line (start -15 9) (end 15 9) (layer F.CrtYd) (width 0.12)) (fp_line (start 15 9) (end 15 -9) (layer F.CrtYd) (width 0.12)) (fp_line (start 15 -9) (end -15 -9) (layer F.CrtYd) (width 0.12)) (fp_line (start -15 -9) (end -15 9) (layer F.CrtYd) (width 0.12)) (fp_line (start -15 9) (end 15 9) (layer F.SilkS) (width 0.12)) (fp_line (start -15 -9) (end -15 9) (layer F.SilkS) (width 0.12)) (fp_line (start 15 9) (end 15 -9) (layer F.SilkS) (width 0.12)) (fp_line (start 15 -9) (end -15 -9) (layer F.SilkS) (width 0.12)) (pad 1 thru_hole circle (at -13 -6.985) (size 1.7 1.7) (drill 1) (layers *.Cu *.Mask) (net 14 /+12VSB)) (pad 1 thru_hole circle (at -13 -4.445) (size 1.7 1.7) (drill 1) (layers *.Cu *.Mask) (net 14 /+12VSB)) (pad 2 thru_hole circle (at -13 6.985) (size 1.7 1.7) (drill 1) (layers *.Cu *.Mask) (net 1 GND)) (pad 2 thru_hole circle (at -13 4.445) (size 1.7 1.7) (drill 1) (layers *.Cu *.Mask) (net 1 GND)) (pad 3 thru_hole circle (at 13 -6.985) (size 1.7 1.7) (drill 1) (layers *.Cu *.Mask) (net 4 /+5VSB)) (pad 2 thru_hole circle (at 13 4.445) (size 1.7 1.7) (drill 1) (layers *.Cu *.Mask) (net 1 GND)) (pad 3 thru_hole circle (at 13 -4.445) (size 1.7 1.7) (drill 1) (layers *.Cu *.Mask) (net 4 /+5VSB)) (pad 2 thru_hole circle (at 13 6.985) (size 1.7 1.7) (drill 1) (layers *.Cu *.Mask) (net 1 GND)) (pad 1 smd roundrect (at -14.27 -5.715) (size 5.08 5.08) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.25) (net 14 /+12VSB)) (pad 3 smd roundrect (at 14.27 -5.715) (size 5.08 5.08) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.25) (net 4 /+5VSB)) (pad 2 smd roundrect (at 14.27 5.715) (size 5.08 5.08) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.25) (net 1 GND)) (pad 2 smd roundrect (at -14.27 5.715) (size 5.08 5.08) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.25) (net 1 GND)) ) (module KCORES_Converter_DCDC:Converter_DCDC_Mini_560 (layer B.Cu) (tedit 5FF15A64) (tstamp 604FCF05) (at 137.55 119.115) (path /604FD7A4) (fp_text reference U2 (at 0 -10.16) (layer B.SilkS) hide (effects (font (size 1 1) (thickness 0.15)) (justify mirror)) ) (fp_text value "Mini560 3.3V" (at 0 8) (layer B.SilkS) (effects (font (size 1 1) (thickness 0.15)) (justify mirror)) ) (fp_text user + (at 11 6) (layer B.SilkS) (effects (font (size 1 1) (thickness 0.15)) (justify mirror)) ) (fp_text user + (at 11 6) (layer B.SilkS) (effects (font (size 1 1) (thickness 0.15)) (justify mirror)) ) (fp_line (start 5 0) (end 3 -2) (layer B.SilkS) (width 0.5)) (fp_line (start 5 0) (end 3 2) (layer B.SilkS) (width 0.5)) (fp_line (start -5 0) (end 5 0) (layer B.SilkS) (width 0.5)) (fp_line (start -15 -9) (end 15 -9) (layer B.CrtYd) (width 0.12)) (fp_line (start 15 -9) (end 15 9) (layer B.CrtYd) (width 0.12)) (fp_line (start 15 9) (end -15 9) (layer B.CrtYd) (width 0.12)) (fp_line (start -15 9) (end -15 -9) (layer B.CrtYd) (width 0.12)) (fp_line (start -15 -9) (end 15 -9) (layer B.SilkS) (width 0.12)) (fp_line (start -15 9) (end -15 -9) (layer B.SilkS) (width 0.12)) (fp_line (start 15 -9) (end 15 9) (layer B.SilkS) (width 0.12)) (fp_line (start 15 9) (end -15 9) (layer B.SilkS) (width 0.12)) (pad 1 thru_hole circle (at -13 6.985) (size 1.7 1.7) (drill 1) (layers *.Cu *.Mask) (net 7 +12V)) (pad 1 thru_hole circle (at -13 4.445) (size 1.7 1.7) (drill 1) (layers *.Cu *.Mask) (net 7 +12V)) (pad 2 thru_hole circle (at -13 -6.985) (size 1.7 1.7) (drill 1) (layers *.Cu *.Mask) (net 1 GND)) (pad 2 thru_hole circle (at -13 -4.445) (size 1.7 1.7) (drill 1) (layers *.Cu *.Mask) (net 1 GND)) (pad 3 thru_hole circle (at 13 6.985) (size 1.7 1.7) (drill 1) (layers *.Cu *.Mask) (net 3 +3V3)) (pad 2 thru_hole circle (at 13 -4.445) (size 1.7 1.7) (drill 1) (layers *.Cu *.Mask) (net 1 GND)) (pad 3 thru_hole circle (at 13 4.445) (size 1.7 1.7) (drill 1) (layers *.Cu *.Mask) (net 3 +3V3)) (pad 2 thru_hole circle (at 13 -6.985) (size 1.7 1.7) (drill 1) (layers *.Cu *.Mask) (net 1 GND)) (pad 1 smd roundrect (at -14.27 5.715) (size 5.08 5.08) (layers B.Cu B.Paste B.Mask) (roundrect_rratio 0.25) (net 7 +12V)) (pad 3 smd roundrect (at 14.27 5.715) (size 5.08 5.08) (layers B.Cu B.Paste B.Mask) (roundrect_rratio 0.25) (net 3 +3V3)) (pad 2 smd roundrect (at 14.27 -5.715) (size 5.08 5.08) (layers B.Cu B.Paste B.Mask) (roundrect_rratio 0.25) (net 1 GND)) (pad 2 smd roundrect (at -14.27 -5.715) (size 5.08 5.08) (layers B.Cu B.Paste B.Mask) (roundrect_rratio 0.25) (net 1 GND)) ) (module KCORES_Converter_DCDC:Converter_DCDC_Mini_560 (layer F.Cu) (tedit 5FF15A64) (tstamp 604FCEE8) (at 137.55 113.4) (path /604FD40C) (fp_text reference U1 (at 0 10.16) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value "Mini560 5V" (at 0 -8) (layer F.SilkS) (effects (font (size 1 1) (thickness 0.15))) ) (fp_text user + (at 11 -6) (layer F.SilkS) (effects (font (size 1 1) (thickness 0.15))) ) (fp_text user + (at 11 -6) (layer F.SilkS) (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start 5 0) (end 3 2) (layer F.SilkS) (width 0.5)) (fp_line (start 5 0) (end 3 -2) (layer F.SilkS) (width 0.5)) (fp_line (start -5 0) (end 5 0) (layer F.SilkS) (width 0.5)) (fp_line (start -15 9) (end 15 9) (layer F.CrtYd) (width 0.12)) (fp_line (start 15 9) (end 15 -9) (layer F.CrtYd) (width 0.12)) (fp_line (start 15 -9) (end -15 -9) (layer F.CrtYd) (width 0.12)) (fp_line (start -15 -9) (end -15 9) (layer F.CrtYd) (width 0.12)) (fp_line (start -15 9) (end 15 9) (layer F.SilkS) (width 0.12)) (fp_line (start -15 -9) (end -15 9) (layer F.SilkS) (width 0.12)) (fp_line (start 15 9) (end 15 -9) (layer F.SilkS) (width 0.12)) (fp_line (start 15 -9) (end -15 -9) (layer F.SilkS) (width 0.12)) (pad 1 thru_hole circle (at -13 -6.985) (size 1.7 1.7) (drill 1) (layers *.Cu *.Mask) (net 7 +12V)) (pad 1 thru_hole circle (at -13 -4.445) (size 1.7 1.7) (drill 1) (layers *.Cu *.Mask) (net 7 +12V)) (pad 2 thru_hole circle (at -13 6.985) (size 1.7 1.7) (drill 1) (layers *.Cu *.Mask) (net 1 GND)) (pad 2 thru_hole circle (at -13 4.445) (size 1.7 1.7) (drill 1) (layers *.Cu *.Mask) (net 1 GND)) (pad 3 thru_hole circle (at 13 -6.985) (size 1.7 1.7) (drill 1) (layers *.Cu *.Mask) (net 2 +5V)) (pad 2 thru_hole circle (at 13 4.445) (size 1.7 1.7) (drill 1) (layers *.Cu *.Mask) (net 1 GND)) (pad 3 thru_hole circle (at 13 -4.445) (size 1.7 1.7) (drill 1) (layers *.Cu *.Mask) (net 2 +5V)) (pad 2 thru_hole circle (at 13 6.985) (size 1.7 1.7) (drill 1) (layers *.Cu *.Mask) (net 1 GND)) (pad 1 smd roundrect (at -14.27 -5.715) (size 5.08 5.08) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.25) (net 7 +12V)) (pad 3 smd roundrect (at 14.27 -5.715) (size 5.08 5.08) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.25) (net 2 +5V)) (pad 2 smd roundrect (at 14.27 5.715) (size 5.08 5.08) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.25) (net 1 GND)) (pad 2 smd roundrect (at -14.27 5.715) (size 5.08 5.08) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.25) (net 1 GND)) ) (module Resistor_THT:R_Axial_DIN0207_L6.3mm_D2.5mm_P7.62mm_Horizontal (layer F.Cu) (tedit 5AE5139B) (tstamp 604FCEB4) (at 128.44 154.375) (descr "Resistor, Axial_DIN0207 series, Axial, Horizontal, pin pitch=7.62mm, 0.25W = 1/4W, length*diameter=6.3*2.5mm^2, http://cdn-reichelt.de/documents/datenblatt/B400/1_4W%23YAG.pdf") (tags "Resistor Axial_DIN0207 series Axial Horizontal pin pitch 7.62mm 0.25W = 1/4W length 6.3mm diameter 2.5mm") (path /6066F22D) (fp_text reference R3 (at 3.81 0) (layer F.SilkS) (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value 3.3K (at 3.81 2.37) (layer F.Fab) (effects (font (size 1 1) (thickness 0.15))) ) (fp_text user %R (at 3.81 0) (layer F.Fab) (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start 0.66 -1.25) (end 0.66 1.25) (layer F.Fab) (width 0.1)) (fp_line (start 0.66 1.25) (end 6.96 1.25) (layer F.Fab) (width 0.1)) (fp_line (start 6.96 1.25) (end 6.96 -1.25) (layer F.Fab) (width 0.1)) (fp_line (start 6.96 -1.25) (end 0.66 -1.25) (layer F.Fab) (width 0.1)) (fp_line (start 0 0) (end 0.66 0) (layer F.Fab) (width 0.1)) (fp_line (start 7.62 0) (end 6.96 0) (layer F.Fab) (width 0.1)) (fp_line (start 0.54 -1.04) (end 0.54 -1.37) (layer F.SilkS) (width 0.12)) (fp_line (start 0.54 -1.37) (end 7.08 -1.37) (layer F.SilkS) (width 0.12)) (fp_line (start 7.08 -1.37) (end 7.08 -1.04) (layer F.SilkS) (width 0.12)) (fp_line (start 0.54 1.04) (end 0.54 1.37) (layer F.SilkS) (width 0.12)) (fp_line (start 0.54 1.37) (end 7.08 1.37) (layer F.SilkS) (width 0.12)) (fp_line (start 7.08 1.37) (end 7.08 1.04) (layer F.SilkS) (width 0.12)) (fp_line (start -1.05 -1.5) (end -1.05 1.5) (layer F.CrtYd) (width 0.05)) (fp_line (start -1.05 1.5) (end 8.67 1.5) (layer F.CrtYd) (width 0.05)) (fp_line (start 8.67 1.5) (end 8.67 -1.5) (layer F.CrtYd) (width 0.05)) (fp_line (start 8.67 -1.5) (end -1.05 -1.5) (layer F.CrtYd) (width 0.05)) (pad 2 thru_hole oval (at 7.62 0) (size 1.6 1.6) (drill 0.8) (layers *.Cu *.Mask) (net 24 "Net-(R2-Pad1)")) (pad 1 thru_hole circle (at 0 0) (size 1.6 1.6) (drill 0.8) (layers *.Cu *.Mask) (net 1 GND)) (model ${KISYS3DMOD}/Resistor_THT.3dshapes/R_Axial_DIN0207_L6.3mm_D2.5mm_P7.62mm_Horizontal.wrl (at (xyz 0 0 0)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 0)) ) ) (module Resistor_THT:R_Axial_DIN0207_L6.3mm_D2.5mm_P7.62mm_Horizontal (layer F.Cu) (tedit 5AE5139B) (tstamp 604FCE9D) (at 136.06 151.2 180) (descr "Resistor, Axial_DIN0207 series, Axial, Horizontal, pin pitch=7.62mm, 0.25W = 1/4W, length*diameter=6.3*2.5mm^2, http://cdn-reichelt.de/documents/datenblatt/B400/1_4W%23YAG.pdf") (tags "Resistor Axial_DIN0207 series Axial Horizontal pin pitch 7.62mm 0.25W = 1/4W length 6.3mm diameter 2.5mm") (path /60683652) (fp_text reference R2 (at 3.81 0) (layer F.SilkS) (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value 22K (at 3.81 2.37) (layer F.Fab) (effects (font (size 1 1) (thickness 0.15))) ) (fp_text user %R (at 3.81 0) (layer F.Fab) (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start 0.66 -1.25) (end 0.66 1.25) (layer F.Fab) (width 0.1)) (fp_line (start 0.66 1.25) (end 6.96 1.25) (layer F.Fab) (width 0.1)) (fp_line (start 6.96 1.25) (end 6.96 -1.25) (layer F.Fab) (width 0.1)) (fp_line (start 6.96 -1.25) (end 0.66 -1.25) (layer F.Fab) (width 0.1)) (fp_line (start 0 0) (end 0.66 0) (layer F.Fab) (width 0.1)) (fp_line (start 7.62 0) (end 6.96 0) (layer F.Fab) (width 0.1)) (fp_line (start 0.54 -1.04) (end 0.54 -1.37) (layer F.SilkS) (width 0.12)) (fp_line (start 0.54 -1.37) (end 7.08 -1.37) (layer F.SilkS) (width 0.12)) (fp_line (start 7.08 -1.37) (end 7.08 -1.04) (layer F.SilkS) (width 0.12)) (fp_line (start 0.54 1.04) (end 0.54 1.37) (layer F.SilkS) (width 0.12)) (fp_line (start 0.54 1.37) (end 7.08 1.37) (layer F.SilkS) (width 0.12)) (fp_line (start 7.08 1.37) (end 7.08 1.04) (layer F.SilkS) (width 0.12)) (fp_line (start -1.05 -1.5) (end -1.05 1.5) (layer F.CrtYd) (width 0.05)) (fp_line (start -1.05 1.5) (end 8.67 1.5) (layer F.CrtYd) (width 0.05)) (fp_line (start 8.67 1.5) (end 8.67 -1.5) (layer F.CrtYd) (width 0.05)) (fp_line (start 8.67 -1.5) (end -1.05 -1.5) (layer F.CrtYd) (width 0.05)) (pad 2 thru_hole oval (at 7.62 0 180) (size 1.6 1.6) (drill 0.8) (layers *.Cu *.Mask) (net 7 +12V)) (pad 1 thru_hole circle (at 0 0 180) (size 1.6 1.6) (drill 0.8) (layers *.Cu *.Mask) (net 24 "Net-(R2-Pad1)")) (model ${KISYS3DMOD}/Resistor_THT.3dshapes/R_Axial_DIN0207_L6.3mm_D2.5mm_P7.62mm_Horizontal.wrl (at (xyz 0 0 0)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 0)) ) ) (module Resistor_THT:R_Axial_DIN0207_L6.3mm_D2.5mm_P7.62mm_Horizontal (layer F.Cu) (tedit 5AE5139B) (tstamp 604FCE86) (at 124.63 148.91 180) (descr "Resistor, Axial_DIN0207 series, Axial, Horizontal, pin pitch=7.62mm, 0.25W = 1/4W, length*diameter=6.3*2.5mm^2, http://cdn-reichelt.de/documents/datenblatt/B400/1_4W%23YAG.pdf") (tags "Resistor Axial_DIN0207 series Axial Horizontal pin pitch 7.62mm 0.25W = 1/4W length 6.3mm diameter 2.5mm") (path /604FBE3B) (fp_text reference R1 (at 3.81 0) (layer F.SilkS) (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value 22K (at 3.81 2.37) (layer F.Fab) (effects (font (size 1 1) (thickness 0.15))) ) (fp_text user %R (at 3.81 0) (layer F.Fab) (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start 0.66 -1.25) (end 0.66 1.25) (layer F.Fab) (width 0.1)) (fp_line (start 0.66 1.25) (end 6.96 1.25) (layer F.Fab) (width 0.1)) (fp_line (start 6.96 1.25) (end 6.96 -1.25) (layer F.Fab) (width 0.1)) (fp_line (start 6.96 -1.25) (end 0.66 -1.25) (layer F.Fab) (width 0.1)) (fp_line (start 0 0) (end 0.66 0) (layer F.Fab) (width 0.1)) (fp_line (start 7.62 0) (end 6.96 0) (layer F.Fab) (width 0.1)) (fp_line (start 0.54 -1.04) (end 0.54 -1.37) (layer F.SilkS) (width 0.12)) (fp_line (start 0.54 -1.37) (end 7.08 -1.37) (layer F.SilkS) (width 0.12)) (fp_line (start 7.08 -1.37) (end 7.08 -1.04) (layer F.SilkS) (width 0.12)) (fp_line (start 0.54 1.04) (end 0.54 1.37) (layer F.SilkS) (width 0.12)) (fp_line (start 0.54 1.37) (end 7.08 1.37) (layer F.SilkS) (width 0.12)) (fp_line (start 7.08 1.37) (end 7.08 1.04) (layer F.SilkS) (width 0.12)) (fp_line (start -1.05 -1.5) (end -1.05 1.5) (layer F.CrtYd) (width 0.05)) (fp_line (start -1.05 1.5) (end 8.67 1.5) (layer F.CrtYd) (width 0.05)) (fp_line (start 8.67 1.5) (end 8.67 -1.5) (layer F.CrtYd) (width 0.05)) (fp_line (start 8.67 -1.5) (end -1.05 -1.5) (layer F.CrtYd) (width 0.05)) (pad 2 thru_hole oval (at 7.62 0 180) (size 1.6 1.6) (drill 0.8) (layers *.Cu *.Mask) (net 14 /+12VSB)) (pad 1 thru_hole circle (at 0 0 180) (size 1.6 1.6) (drill 0.8) (layers *.Cu *.Mask) (net 15 /~PRESENT)) (model ${KISYS3DMOD}/Resistor_THT.3dshapes/R_Axial_DIN0207_L6.3mm_D2.5mm_P7.62mm_Horizontal.wrl (at (xyz 0 0 0)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 0)) ) ) (module Jumper:SolderJumper-2_P1.3mm_Open_RoundedPad1.0x1.5mm (layer B.Cu) (tedit 5B391E66) (tstamp 604FCE6F) (at 120.82 159.455) (descr "SMD Solder Jumper, 1x1.5mm, rounded Pads, 0.3mm gap, open") (tags "solder jumper open") (path /6069FF35) (attr virtual) (fp_text reference JP2 (at 0 1.905) (layer B.SilkS) (effects (font (size 1 1) (thickness 0.15)) (justify mirror)) ) (fp_text value ATX_PSON-CSPS_PSON (at 0 -1.9) (layer B.Fab) hide (effects (font (size 1 1) (thickness 0.15)) (justify mirror)) ) (fp_arc (start -0.7 0.3) (end -0.7 1) (angle 90) (layer B.SilkS) (width 0.12)) (fp_arc (start -0.7 -0.3) (end -1.4 -0.3) (angle 90) (layer B.SilkS) (width 0.12)) (fp_arc (start 0.7 -0.3) (end 0.7 -1) (angle 90) (layer B.SilkS) (width 0.12)) (fp_arc (start 0.7 0.3) (end 1.4 0.3) (angle 90) (layer B.SilkS) (width 0.12)) (fp_line (start -1.4 -0.3) (end -1.4 0.3) (layer B.SilkS) (width 0.12)) (fp_line (start 0.7 -1) (end -0.7 -1) (layer B.SilkS) (width 0.12)) (fp_line (start 1.4 0.3) (end 1.4 -0.3) (layer B.SilkS) (width 0.12)) (fp_line (start -0.7 1) (end 0.7 1) (layer B.SilkS) (width 0.12)) (fp_line (start -1.65 1.25) (end 1.65 1.25) (layer B.CrtYd) (width 0.05)) (fp_line (start -1.65 1.25) (end -1.65 -1.25) (layer B.CrtYd) (width 0.05)) (fp_line (start 1.65 -1.25) (end 1.65 1.25) (layer B.CrtYd) (width 0.05)) (fp_line (start 1.65 -1.25) (end -1.65 -1.25) (layer B.CrtYd) (width 0.05)) (pad 2 smd custom (at 0.65 0) (size 1 0.5) (layers B.Cu B.Mask) (net 5 /~ATX_PSON) (zone_connect 2) (options (clearance outline) (anchor rect)) (primitives (gr_circle (center 0 -0.25) (end 0.5 -0.25) (width 0)) (gr_circle (center 0 0.25) (end 0.5 0.25) (width 0)) (gr_poly (pts (xy 0 0.75) (xy -0.5 0.75) (xy -0.5 -0.75) (xy 0 -0.75)) (width 0)) )) (pad 1 smd custom (at -0.65 0) (size 1 0.5) (layers B.Cu B.Mask) (net 18 /~CSPS_PSON) (zone_connect 2) (options (clearance outline) (anchor rect)) (primitives (gr_circle (center 0 -0.25) (end 0.5 -0.25) (width 0)) (gr_circle (center 0 0.25) (end 0.5 0.25) (width 0)) (gr_poly (pts (xy 0 0.75) (xy 0.5 0.75) (xy 0.5 -0.75) (xy 0 -0.75)) (width 0)) )) ) (module Jumper:SolderJumper-2_P1.3mm_Bridged_RoundedPad1.0x1.5mm (layer B.Cu) (tedit 5C745284) (tstamp 604FCE5D) (at 120.82 156.915) (descr "SMD Solder Jumper, 1x1.5mm, rounded Pads, 0.3mm gap, bridged with 1 copper strip") (tags "solder jumper open") (path /6069F524) (attr virtual) (fp_text reference JP1 (at 0 -1.905) (layer B.SilkS) (effects (font (size 1 1) (thickness 0.15)) (justify mirror)) ) (fp_text value FPO-CSPS_PSON (at 0 -1.9) (layer B.Fab) hide (effects (font (size 1 1) (thickness 0.15)) (justify mirror)) ) (fp_arc (start -0.7 0.3) (end -0.7 1) (angle 90) (layer B.SilkS) (width 0.12)) (fp_arc (start -0.7 -0.3) (end -1.4 -0.3) (angle 90) (layer B.SilkS) (width 0.12)) (fp_arc (start 0.7 -0.3) (end 0.7 -1) (angle 90) (layer B.SilkS) (width 0.12)) (fp_arc (start 0.7 0.3) (end 1.4 0.3) (angle 90) (layer B.SilkS) (width 0.12)) (fp_line (start -1.4 -0.3) (end -1.4 0.3) (layer B.SilkS) (width 0.12)) (fp_line (start 0.7 -1) (end -0.7 -1) (layer B.SilkS) (width 0.12)) (fp_line (start 1.4 0.3) (end 1.4 -0.3) (layer B.SilkS) (width 0.12)) (fp_line (start -0.7 1) (end 0.7 1) (layer B.SilkS) (width 0.12)) (fp_line (start -1.65 1.25) (end 1.65 1.25) (layer B.CrtYd) (width 0.05)) (fp_line (start -1.65 1.25) (end -1.65 -1.25) (layer B.CrtYd) (width 0.05)) (fp_line (start 1.65 -1.25) (end 1.65 1.25) (layer B.CrtYd) (width 0.05)) (fp_line (start 1.65 -1.25) (end -1.65 -1.25) (layer B.CrtYd) (width 0.05)) (fp_poly (pts (xy 0.25 0.3) (xy -0.25 0.3) (xy -0.25 -0.3) (xy 0.25 -0.3)) (layer B.Cu) (width 0)) (pad 1 smd custom (at -0.65 0) (size 1 0.5) (layers B.Cu B.Mask) (net 18 /~CSPS_PSON) (zone_connect 2) (options (clearance outline) (anchor rect)) (primitives (gr_circle (center 0 -0.25) (end 0.5 -0.25) (width 0)) (gr_circle (center 0 0.25) (end 0.5 0.25) (width 0)) (gr_poly (pts (xy 0 0.75) (xy 0.5 0.75) (xy 0.5 -0.75) (xy 0 -0.75)) (width 0)) )) (pad 2 smd custom (at 0.65 0) (size 1 0.5) (layers B.Cu B.Mask) (net 23 /~FPO) (zone_connect 2) (options (clearance outline) (anchor rect)) (primitives (gr_circle (center 0 -0.25) (end 0.5 -0.25) (width 0)) (gr_circle (center 0 0.25) (end 0.5 0.25) (width 0)) (gr_poly (pts (xy 0 0.75) (xy -0.5 0.75) (xy -0.5 -0.75) (xy 0 -0.75)) (width 0)) )) ) (module Diode_THT:D_DO-41_SOD81_P7.62mm_Horizontal (layer F.Cu) (tedit 5AE50CD5) (tstamp 604FCB72) (at 150.03 154.375) (descr "Diode, DO-41_SOD81 series, Axial, Horizontal, pin pitch=7.62mm, , length*diameter=5.2*2.7mm^2, , http://www.diodes.com/_files/packages/DO-41%20(Plastic).pdf") (tags "Diode DO-41_SOD81 series Axial Horizontal pin pitch 7.62mm length 5.2mm diameter 2.7mm") (path /605A4DEC) (fp_text reference D2 (at 3.81 0) (layer F.SilkS) (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value 1N4001 (at 3.81 2.47) (layer F.Fab) (effects (font (size 1 1) (thickness 0.15))) ) (fp_text user K (at 0 -2.1) (layer F.Fab) (effects (font (size 1 1) (thickness 0.15))) ) (fp_text user K (at 0 -2.1) (layer F.Fab) (effects (font (size 1 1) (thickness 0.15))) ) (fp_text user %R (at 4.2 0) (layer F.Fab) (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start 1.21 -1.35) (end 1.21 1.35) (layer F.Fab) (width 0.1)) (fp_line (start 1.21 1.35) (end 6.41 1.35) (layer F.Fab) (width 0.1)) (fp_line (start 6.41 1.35) (end 6.41 -1.35) (layer F.Fab) (width 0.1)) (fp_line (start 6.41 -1.35) (end 1.21 -1.35) (layer F.Fab) (width 0.1)) (fp_line (start 0 0) (end 1.21 0) (layer F.Fab) (width 0.1)) (fp_line (start 7.62 0) (end 6.41 0) (layer F.Fab) (width 0.1)) (fp_line (start 1.99 -1.35) (end 1.99 1.35) (layer F.Fab) (width 0.1)) (fp_line (start 2.09 -1.35) (end 2.09 1.35) (layer F.Fab) (width 0.1)) (fp_line (start 1.89 -1.35) (end 1.89 1.35) (layer F.Fab) (width 0.1)) (fp_line (start 1.09 -1.34) (end 1.09 -1.47) (layer F.SilkS) (width 0.12)) (fp_line (start 1.09 -1.47) (end 6.53 -1.47) (layer F.SilkS) (width 0.12)) (fp_line (start 6.53 -1.47) (end 6.53 -1.34) (layer F.SilkS) (width 0.12)) (fp_line (start 1.09 1.34) (end 1.09 1.47) (layer F.SilkS) (width 0.12)) (fp_line (start 1.09 1.47) (end 6.53 1.47) (layer F.SilkS) (width 0.12)) (fp_line (start 6.53 1.47) (end 6.53 1.34) (layer F.SilkS) (width 0.12)) (fp_line (start 1.99 -1.47) (end 1.99 1.47) (layer F.SilkS) (width 0.12)) (fp_line (start 2.11 -1.47) (end 2.11 1.47) (layer F.SilkS) (width 0.12)) (fp_line (start 1.87 -1.47) (end 1.87 1.47) (layer F.SilkS) (width 0.12)) (fp_line (start -1.35 -1.6) (end -1.35 1.6) (layer F.CrtYd) (width 0.05)) (fp_line (start -1.35 1.6) (end 8.97 1.6) (layer F.CrtYd) (width 0.05)) (fp_line (start 8.97 1.6) (end 8.97 -1.6) (layer F.CrtYd) (width 0.05)) (fp_line (start 8.97 -1.6) (end -1.35 -1.6) (layer F.CrtYd) (width 0.05)) (pad 2 thru_hole oval (at 7.62 0) (size 2.2 2.2) (drill 1.1) (layers *.Cu *.Mask) (net 7 +12V)) (pad 1 thru_hole rect (at 0 0) (size 2.2 2.2) (drill 1.1) (layers *.Cu *.Mask) (net 6 "Net-(C5-Pad1)")) (model ${KISYS3DMOD}/Diode_THT.3dshapes/D_DO-41_SOD81_P7.62mm_Horizontal.wrl (at (xyz 0 0 0)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 0)) ) ) (module Diode_THT:D_DO-41_SOD81_P7.62mm_Horizontal (layer F.Cu) (tedit 5AE50CD5) (tstamp 604FCB53) (at 150.03 151.2) (descr "Diode, DO-41_SOD81 series, Axial, Horizontal, pin pitch=7.62mm, , length*diameter=5.2*2.7mm^2, , http://www.diodes.com/_files/packages/DO-41%20(Plastic).pdf") (tags "Diode DO-41_SOD81 series Axial Horizontal pin pitch 7.62mm length 5.2mm diameter 2.7mm") (path /606076DC) (fp_text reference D1 (at 3.81 0) (layer F.SilkS) (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value 1N4001 (at 3.81 2.47) (layer F.Fab) (effects (font (size 1 1) (thickness 0.15))) ) (fp_text user K (at 0 -2.1) (layer F.Fab) (effects (font (size 1 1) (thickness 0.15))) ) (fp_text user K (at 0 -2.1) (layer F.Fab) (effects (font (size 1 1) (thickness 0.15))) ) (fp_text user %R (at 4.2 0) (layer F.Fab) (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start 1.21 -1.35) (end 1.21 1.35) (layer F.Fab) (width 0.1)) (fp_line (start 1.21 1.35) (end 6.41 1.35) (layer F.Fab) (width 0.1)) (fp_line (start 6.41 1.35) (end 6.41 -1.35) (layer F.Fab) (width 0.1)) (fp_line (start 6.41 -1.35) (end 1.21 -1.35) (layer F.Fab) (width 0.1)) (fp_line (start 0 0) (end 1.21 0) (layer F.Fab) (width 0.1)) (fp_line (start 7.62 0) (end 6.41 0) (layer F.Fab) (width 0.1)) (fp_line (start 1.99 -1.35) (end 1.99 1.35) (layer F.Fab) (width 0.1)) (fp_line (start 2.09 -1.35) (end 2.09 1.35) (layer F.Fab) (width 0.1)) (fp_line (start 1.89 -1.35) (end 1.89 1.35) (layer F.Fab) (width 0.1)) (fp_line (start 1.09 -1.34) (end 1.09 -1.47) (layer F.SilkS) (width 0.12)) (fp_line (start 1.09 -1.47) (end 6.53 -1.47) (layer F.SilkS) (width 0.12)) (fp_line (start 6.53 -1.47) (end 6.53 -1.34) (layer F.SilkS) (width 0.12)) (fp_line (start 1.09 1.34) (end 1.09 1.47) (layer F.SilkS) (width 0.12)) (fp_line (start 1.09 1.47) (end 6.53 1.47) (layer F.SilkS) (width 0.12)) (fp_line (start 6.53 1.47) (end 6.53 1.34) (layer F.SilkS) (width 0.12)) (fp_line (start 1.99 -1.47) (end 1.99 1.47) (layer F.SilkS) (width 0.12)) (fp_line (start 2.11 -1.47) (end 2.11 1.47) (layer F.SilkS) (width 0.12)) (fp_line (start 1.87 -1.47) (end 1.87 1.47) (layer F.SilkS) (width 0.12)) (fp_line (start -1.35 -1.6) (end -1.35 1.6) (layer F.CrtYd) (width 0.05)) (fp_line (start -1.35 1.6) (end 8.97 1.6) (layer F.CrtYd) (width 0.05)) (fp_line (start 8.97 1.6) (end 8.97 -1.6) (layer F.CrtYd) (width 0.05)) (fp_line (start 8.97 -1.6) (end -1.35 -1.6) (layer F.CrtYd) (width 0.05)) (pad 2 thru_hole oval (at 7.62 0) (size 2.2 2.2) (drill 1.1) (layers *.Cu *.Mask) (net 4 /+5VSB)) (pad 1 thru_hole rect (at 0 0) (size 2.2 2.2) (drill 1.1) (layers *.Cu *.Mask) (net 6 "Net-(C5-Pad1)")) (model ${KISYS3DMOD}/Diode_THT.3dshapes/D_DO-41_SOD81_P7.62mm_Horizontal.wrl (at (xyz 0 0 0)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 0)) ) ) (module Capacitor_THT:C_Disc_D5.0mm_W2.5mm_P2.50mm (layer F.Cu) (tedit 5AE50EF0) (tstamp 604FCB34) (at 150.03 157.55) (descr "C, Disc series, Radial, pin pitch=2.50mm, , diameter*width=5*2.5mm^2, Capacitor, http://cdn-reichelt.de/documents/datenblatt/B300/DS_KERKO_TC.pdf") (tags "C Disc series Radial pin pitch 2.50mm diameter 5mm width 2.5mm Capacitor") (path /60648D9C) (fp_text reference C5 (at 1.27 2.54) (layer F.SilkS) (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value 100nF (at 1.25 2.5) (layer F.Fab) (effects (font (size 1 1) (thickness 0.15))) ) (fp_text user %R (at 1.25 0) (layer F.Fab) (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -1.25 -1.25) (end -1.25 1.25) (layer F.Fab) (width 0.1)) (fp_line (start -1.25 1.25) (end 3.75 1.25) (layer F.Fab) (width 0.1)) (fp_line (start 3.75 1.25) (end 3.75 -1.25) (layer F.Fab) (width 0.1)) (fp_line (start 3.75 -1.25) (end -1.25 -1.25) (layer F.Fab) (width 0.1)) (fp_line (start -1.37 -1.37) (end 3.87 -1.37) (layer F.SilkS) (width 0.12)) (fp_line (start -1.37 1.37) (end 3.87 1.37) (layer F.SilkS) (width 0.12)) (fp_line (start -1.37 -1.37) (end -1.37 1.37) (layer F.SilkS) (width 0.12)) (fp_line (start 3.87 -1.37) (end 3.87 1.37) (layer F.SilkS) (width 0.12)) (fp_line (start -1.5 -1.5) (end -1.5 1.5) (layer F.CrtYd) (width 0.05)) (fp_line (start -1.5 1.5) (end 4 1.5) (layer F.CrtYd) (width 0.05)) (fp_line (start 4 1.5) (end 4 -1.5) (layer F.CrtYd) (width 0.05)) (fp_line (start 4 -1.5) (end -1.5 -1.5) (layer F.CrtYd) (width 0.05)) (pad 2 thru_hole circle (at 2.5 0) (size 1.6 1.6) (drill 0.8) (layers *.Cu *.Mask) (net 1 GND)) (pad 1 thru_hole circle (at 0 0) (size 1.6 1.6) (drill 0.8) (layers *.Cu *.Mask) (net 6 "Net-(C5-Pad1)")) (model ${KISYS3DMOD}/Capacitor_THT.3dshapes/C_Disc_D5.0mm_W2.5mm_P2.50mm.wrl (at (xyz 0 0 0)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 0)) ) ) (module Capacitor_THT:C_Disc_D5.0mm_W2.5mm_P2.50mm (layer F.Cu) (tedit 5AE50EF0) (tstamp 604FCB21) (at 132.925 157.55) (descr "C, Disc series, Radial, pin pitch=2.50mm, , diameter*width=5*2.5mm^2, Capacitor, http://cdn-reichelt.de/documents/datenblatt/B300/DS_KERKO_TC.pdf") (tags "C Disc series Radial pin pitch 2.50mm diameter 5mm width 2.5mm Capacitor") (path /605A40C1) (fp_text reference C4 (at 1.25 2.54) (layer F.SilkS) (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value 100nF (at 1.25 2.5) (layer F.Fab) (effects (font (size 1 1) (thickness 0.15))) ) (fp_text user %R (at 1.25 0) (layer F.Fab) (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -1.25 -1.25) (end -1.25 1.25) (layer F.Fab) (width 0.1)) (fp_line (start -1.25 1.25) (end 3.75 1.25) (layer F.Fab) (width 0.1)) (fp_line (start 3.75 1.25) (end 3.75 -1.25) (layer F.Fab) (width 0.1)) (fp_line (start 3.75 -1.25) (end -1.25 -1.25) (layer F.Fab) (width 0.1)) (fp_line (start -1.37 -1.37) (end 3.87 -1.37) (layer F.SilkS) (width 0.12)) (fp_line (start -1.37 1.37) (end 3.87 1.37) (layer F.SilkS) (width 0.12)) (fp_line (start -1.37 -1.37) (end -1.37 1.37) (layer F.SilkS) (width 0.12)) (fp_line (start 3.87 -1.37) (end 3.87 1.37) (layer F.SilkS) (width 0.12)) (fp_line (start -1.5 -1.5) (end -1.5 1.5) (layer F.CrtYd) (width 0.05)) (fp_line (start -1.5 1.5) (end 4 1.5) (layer F.CrtYd) (width 0.05)) (fp_line (start 4 1.5) (end 4 -1.5) (layer F.CrtYd) (width 0.05)) (fp_line (start 4 -1.5) (end -1.5 -1.5) (layer F.CrtYd) (width 0.05)) (pad 2 thru_hole circle (at 2.5 0) (size 1.6 1.6) (drill 0.8) (layers *.Cu *.Mask) (net 5 /~ATX_PSON)) (pad 1 thru_hole circle (at 0 0) (size 1.6 1.6) (drill 0.8) (layers *.Cu *.Mask) (net 1 GND)) (model ${KISYS3DMOD}/Capacitor_THT.3dshapes/C_Disc_D5.0mm_W2.5mm_P2.50mm.wrl (at (xyz 0 0 0)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 0)) ) ) (module Capacitor_Tantalum_SMD:CP_EIA-7343-31_Kemet-D_Pad2.25x2.55mm_HandSolder (layer F.Cu) (tedit 5B301BBE) (tstamp 604FCB0E) (at 159.6 137.55 270) (descr "Tantalum Capacitor SMD Kemet-D (7343-31 Metric), IPC_7351 nominal, (Body size from: http://www.kemet.com/Lists/ProductCatalog/Attachments/253/KEM_TC101_STD.pdf), generated with kicad-footprint-generator") (tags "capacitor tantalum") (path /604FE5A5) (attr smd) (fp_text reference C3 (at 0 0.045 90) (layer F.SilkS) (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value 100uF (at 0 3.1 90) (layer F.Fab) (effects (font (size 1 1) (thickness 0.15))) ) (fp_text user %R (at 0 0 90) (layer F.Fab) (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start 3.65 -2.15) (end -2.65 -2.15) (layer F.Fab) (width 0.1)) (fp_line (start -2.65 -2.15) (end -3.65 -1.15) (layer F.Fab) (width 0.1)) (fp_line (start -3.65 -1.15) (end -3.65 2.15) (layer F.Fab) (width 0.1)) (fp_line (start -3.65 2.15) (end 3.65 2.15) (layer F.Fab) (width 0.1)) (fp_line (start 3.65 2.15) (end 3.65 -2.15) (layer F.Fab) (width 0.1)) (fp_line (start 3.65 -2.26) (end -4.585 -2.26) (layer F.SilkS) (width 0.12)) (fp_line (start -4.585 -2.26) (end -4.585 2.26) (layer F.SilkS) (width 0.12)) (fp_line (start -4.585 2.26) (end 3.65 2.26) (layer F.SilkS) (width 0.12)) (fp_line (start -4.58 2.4) (end -4.58 -2.4) (layer F.CrtYd) (width 0.05)) (fp_line (start -4.58 -2.4) (end 4.58 -2.4) (layer F.CrtYd) (width 0.05)) (fp_line (start 4.58 -2.4) (end 4.58 2.4) (layer F.CrtYd) (width 0.05)) (fp_line (start 4.58 2.4) (end -4.58 2.4) (layer F.CrtYd) (width 0.05)) (pad 2 smd roundrect (at 3.2 0 270) (size 2.25 2.55) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.111111) (net 1 GND)) (pad 1 smd roundrect (at -3.2 0 270) (size 2.25 2.55) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.111111) (net 4 /+5VSB)) (model ${KISYS3DMOD}/Capacitor_Tantalum_SMD.3dshapes/CP_EIA-7343-31_Kemet-D.wrl (at (xyz 0 0 0)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 0)) ) ) (module Capacitor_Tantalum_SMD:CP_EIA-7343-31_Kemet-D_Pad2.25x2.55mm_HandSolder (layer B.Cu) (tedit 5B301BBE) (tstamp 604FCAFB) (at 159.6 130.2 270) (descr "Tantalum Capacitor SMD Kemet-D (7343-31 Metric), IPC_7351 nominal, (Body size from: http://www.kemet.com/Lists/ProductCatalog/Attachments/253/KEM_TC101_STD.pdf), generated with kicad-footprint-generator") (tags "capacitor tantalum") (path /604FE29A) (attr smd) (fp_text reference C2 (at 0 0.045 270) (layer B.SilkS) (effects (font (size 1 1) (thickness 0.15)) (justify mirror)) ) (fp_text value 100uF (at 0 -3.1 270) (layer B.Fab) (effects (font (size 1 1) (thickness 0.15)) (justify mirror)) ) (fp_text user %R (at 0 0 270) (layer B.Fab) (effects (font (size 1 1) (thickness 0.15)) (justify mirror)) ) (fp_line (start 3.65 2.15) (end -2.65 2.15) (layer B.Fab) (width 0.1)) (fp_line (start -2.65 2.15) (end -3.65 1.15) (layer B.Fab) (width 0.1)) (fp_line (start -3.65 1.15) (end -3.65 -2.15) (layer B.Fab) (width 0.1)) (fp_line (start -3.65 -2.15) (end 3.65 -2.15) (layer B.Fab) (width 0.1)) (fp_line (start 3.65 -2.15) (end 3.65 2.15) (layer B.Fab) (width 0.1)) (fp_line (start 3.65 2.26) (end -4.585 2.26) (layer B.SilkS) (width 0.12)) (fp_line (start -4.585 2.26) (end -4.585 -2.26) (layer B.SilkS) (width 0.12)) (fp_line (start -4.585 -2.26) (end 3.65 -2.26) (layer B.SilkS) (width 0.12)) (fp_line (start -4.58 -2.4) (end -4.58 2.4) (layer B.CrtYd) (width 0.05)) (fp_line (start -4.58 2.4) (end 4.58 2.4) (layer B.CrtYd) (width 0.05)) (fp_line (start 4.58 2.4) (end 4.58 -2.4) (layer B.CrtYd) (width 0.05)) (fp_line (start 4.58 -2.4) (end -4.58 -2.4) (layer B.CrtYd) (width 0.05)) (pad 2 smd roundrect (at 3.2 0 270) (size 2.25 2.55) (layers B.Cu B.Paste B.Mask) (roundrect_rratio 0.111111) (net 1 GND)) (pad 1 smd roundrect (at -3.2 0 270) (size 2.25 2.55) (layers B.Cu B.Paste B.Mask) (roundrect_rratio 0.111111) (net 3 +3V3)) (model ${KISYS3DMOD}/Capacitor_Tantalum_SMD.3dshapes/CP_EIA-7343-31_Kemet-D.wrl (at (xyz 0 0 0)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 0)) ) ) (module Capacitor_Tantalum_SMD:CP_EIA-7343-31_Kemet-D_Pad2.25x2.55mm_HandSolder (layer F.Cu) (tedit 5B301BBE) (tstamp 604FCAE8) (at 159.6 116.55 270) (descr "Tantalum Capacitor SMD Kemet-D (7343-31 Metric), IPC_7351 nominal, (Body size from: http://www.kemet.com/Lists/ProductCatalog/Attachments/253/KEM_TC101_STD.pdf), generated with kicad-footprint-generator") (tags "capacitor tantalum") (path /6055B507) (attr smd) (fp_text reference C1 (at 0 0.045 90) (layer F.SilkS) (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value 100uF (at 0 3.1 90) (layer F.Fab) (effects (font (size 1 1) (thickness 0.15))) ) (fp_text user %R (at 0 0 90) (layer F.Fab) (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start 3.65 -2.15) (end -2.65 -2.15) (layer F.Fab) (width 0.1)) (fp_line (start -2.65 -2.15) (end -3.65 -1.15) (layer F.Fab) (width 0.1)) (fp_line (start -3.65 -1.15) (end -3.65 2.15) (layer F.Fab) (width 0.1)) (fp_line (start -3.65 2.15) (end 3.65 2.15) (layer F.Fab) (width 0.1)) (fp_line (start 3.65 2.15) (end 3.65 -2.15) (layer F.Fab) (width 0.1)) (fp_line (start 3.65 -2.26) (end -4.585 -2.26) (layer F.SilkS) (width 0.12)) (fp_line (start -4.585 -2.26) (end -4.585 2.26) (layer F.SilkS) (width 0.12)) (fp_line (start -4.585 2.26) (end 3.65 2.26) (layer F.SilkS) (width 0.12)) (fp_line (start -4.58 2.4) (end -4.58 -2.4) (layer F.CrtYd) (width 0.05)) (fp_line (start -4.58 -2.4) (end 4.58 -2.4) (layer F.CrtYd) (width 0.05)) (fp_line (start 4.58 -2.4) (end 4.58 2.4) (layer F.CrtYd) (width 0.05)) (fp_line (start 4.58 2.4) (end -4.58 2.4) (layer F.CrtYd) (width 0.05)) (pad 2 smd roundrect (at 3.2 0 270) (size 2.25 2.55) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.111111) (net 1 GND)) (pad 1 smd roundrect (at -3.2 0 270) (size 2.25 2.55) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.111111) (net 2 +5V)) (model ${KISYS3DMOD}/Capacitor_Tantalum_SMD.3dshapes/CP_EIA-7343-31_Kemet-D.wrl (at (xyz 0 0 0)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 0)) ) ) (gr_text ~ON (at 124.63 156.28) (layer F.SilkS) (effects (font (size 1 1) (thickness 0.15))) ) (gr_text - (at 122.09 156.28) (layer F.SilkS) (effects (font (size 1 1) (thickness 0.15))) ) (gr_text C (at 119.55 156.28) (layer F.SilkS) (effects (font (size 1 1) (thickness 0.15))) ) (gr_text "Contributor:\nAlphaArea\nUbiq" (at 143.85 137.55) (layer B.Mask) (effects (font (size 1.5 1.5) (thickness 0.2)) (justify left mirror)) ) (gr_text "20210317 v1.0" (at 176.4 161.7 90) (layer F.SilkS) (effects (font (size 1 1) (thickness 0.15)) (justify left)) ) (gr_text "CSPS to ATX Converter" (at 119.07 123.9 90) (layer F.Mask) (effects (font (size 1 1) (thickness 0.15))) ) (gr_text KCORES (at 116.55 123.9 90) (layer F.Mask) (effects (font (size 2.5 2.5) (thickness 0.3))) ) (gr_text D (at 117.01 156.28) (layer F.SilkS) (effects (font (size 1 1) (thickness 0.15))) ) (gr_line (start 164.85 96.6) (end 176.4 96.6) (layer F.Mask) (width 4.2)) (gr_line (start 157.5 89.25) (end 164.85 96.6) (layer F.Mask) (width 4.2)) (gr_line (start 92.4 162.75) (end 92.4 76.65) (layer Edge.Cuts) (width 0.05) (tstamp 605209ED)) (gr_line (start 178.5 76.65) (end 92.4 76.65) (layer Edge.Cuts) (width 0.05)) (gr_line (start 178.5 162.75) (end 178.5 76.65) (layer Edge.Cuts) (width 0.05)) (gr_line (start 178.5 162.75) (end 92.4 162.75) (layer Edge.Cuts) (width 0.05)) (gr_line (start 108.15 89.25) (end 157.5 89.25) (layer F.Mask) (width 4.2)) (segment (start 107.8 153.99) (end 109.45 153.99) (width 1.5) (layer F.Cu) (net 1)) (segment (start 164.85 100.8) (end 168 100.8) (width 1.5) (layer F.Cu) (net 2)) (segment (start 150.55 106.415) (end 159.235 106.415) (width 1.5) (layer F.Cu) (net 2)) (segment (start 159.235 106.415) (end 164.85 100.8) (width 1.5) (layer F.Cu) (net 2)) (segment (start 160.19 156.28) (end 161.46 157.55) (width 0.254) (layer B.Cu) (net 2)) (segment (start 146.22 156.28) (end 160.19 156.28) (width 0.254) (layer B.Cu) (net 2)) (segment (start 146.22 156.28) (end 144.315 154.375) (width 0.254) (layer F.Cu) (net 2)) (segment (start 144.315 115.19) (end 150.55 108.955) (width 0.254) (layer F.Cu) (net 2)) (segment (start 144.315 154.375) (end 144.315 115.19) (width 0.254) (layer F.Cu) (net 2)) (via (at 143.68 126.1) (size 0.5) (drill 0.3) (layers F.Cu B.Cu) (net 3)) (segment (start 146.22 158.82) (end 143.68 156.28) (width 0.254) (layer F.Cu) (net 3)) (segment (start 143.68 156.28) (end 143.68 132.15) (width 0.254) (layer F.Cu) (net 3)) (segment (start 149.73 126.1) (end 150.55 126.1) (width 0.254) (layer B.Cu) (net 3)) (segment (start 143.68 132.15) (end 143.68 126.1) (width 0.254) (layer F.Cu) (net 3)) (segment (start 143.68 126.1) (end 150.55 126.1) (width 0.254) (layer B.Cu) (net 3)) (segment (start 155.675 134.4) (end 168 134.4) (width 1.5) (layer F.Cu) (net 4)) (segment (start 151.82 130.545) (end 155.675 134.4) (width 1.5) (layer F.Cu) (net 4)) (segment (start 157.65 136.375) (end 155.675 134.4) (width 0.254) (layer F.Cu) (net 4)) (segment (start 157.65 151.2) (end 157.65 136.375) (width 0.254) (layer F.Cu) (net 4)) (segment (start 133.52 159.455) (end 135.425 157.55) (width 0.254) (layer B.Cu) (net 5)) (segment (start 121.47 159.455) (end 133.52 159.455) (width 0.254) (layer B.Cu) (net 5)) (segment (start 136.695 158.82) (end 135.425 157.55) (width 0.254) (layer F.Cu) (net 5)) (segment (start 138.6 158.82) (end 136.695 158.82) (width 0.254) (layer F.Cu) (net 5)) (segment (start 162.14 148.66) (end 168 142.8) (width 0.254) (layer B.Cu) (net 5)) (segment (start 146.855 148.66) (end 162.14 148.66) (width 0.254) (layer B.Cu) (net 5)) (segment (start 140.505 155.01) (end 146.855 148.66) (width 0.254) (layer B.Cu) (net 5)) (segment (start 138.6 158.82) (end 140.505 156.915) (width 0.254) (layer B.Cu) (net 5)) (segment (start 140.505 156.915) (end 140.505 155.01) (width 0.254) (layer B.Cu) (net 5)) (segment (start 150.03 151.2) (end 150.03 154.375) (width 1.5) (layer F.Cu) (net 6)) (segment (start 150.03 154.375) (end 150.03 157.55) (width 1.5) (layer F.Cu) (net 6)) (segment (start 149.395 153.74) (end 150.03 154.375) (width 1.5) (layer F.Cu) (net 6)) (segment (start 146.22 153.74) (end 149.395 153.74) (width 1.5) (layer F.Cu) (net 6)) (segment (start 168 159.6) (end 172.2 159.6) (width 3) (layer F.Cu) (net 7)) (segment (start 176.4 109.2) (end 172.2 105) (width 3) (layer F.Cu) (net 7)) (segment (start 176.4 156.723024) (end 176.4 109.2) (width 3) (layer F.Cu) (net 7)) (segment (start 172.2 159.6) (end 173.523024 159.6) (width 3) (layer F.Cu) (net 7)) (segment (start 173.523024 159.6) (end 176.4 156.723024) (width 3) (layer F.Cu) (net 7)) (segment (start 162.775 154.375) (end 168 159.6) (width 0.254) (layer F.Cu) (net 7)) (segment (start 157.65 154.375) (end 162.775 154.375) (width 0.254) (layer F.Cu) (net 7)) (segment (start 128.44 129.99) (end 124.55 126.1) (width 0.254) (layer F.Cu) (net 7)) (segment (start 128.44 151.2) (end 128.44 129.99) (width 0.254) (layer F.Cu) (net 7)) (segment (start 107.8 159.07) (end 109.45 159.07) (width 1.5) (layer F.Cu) (net 8)) (segment (start 115.44 157.85) (end 119.55 153.74) (width 0.254) (layer F.Cu) (net 8)) (segment (start 109.45 159.07) (end 110.67 157.85) (width 0.254) (layer F.Cu) (net 8)) (segment (start 110.67 157.85) (end 115.44 157.85) (width 0.254) (layer F.Cu) (net 8)) (segment (start 107.8 156.53) (end 109.45 156.53) (width 1.5) (layer F.Cu) (net 9)) (segment (start 115.35 155.4) (end 117.01 153.74) (width 0.254) (layer F.Cu) (net 9)) (segment (start 109.45 156.53) (end 110.58 155.4) (width 0.254) (layer F.Cu) (net 9)) (segment (start 110.58 155.4) (end 115.35 155.4) (width 0.254) (layer F.Cu) (net 9)) (segment (start 107.8 151.45) (end 109.45 151.45) (width 1.5) (layer F.Cu) (net 10)) (segment (start 107.8 148.91) (end 109.45 148.91) (width 1.5) (layer F.Cu) (net 11)) (segment (start 107.8 146.37) (end 109.45 146.37) (width 1.5) (layer F.Cu) (net 12)) (segment (start 113.07 148.91) (end 117.01 148.91) (width 1.5) (layer F.Cu) (net 14)) (segment (start 118.65 135.175) (end 123.28 130.545) (width 1.5) (layer F.Cu) (net 14)) (segment (start 117.01 148.91) (end 118.65 147.27) (width 1.5) (layer F.Cu) (net 14)) (segment (start 118.65 147.27) (end 118.65 135.175) (width 1.5) (layer F.Cu) (net 14)) (segment (start 122.975 150.565) (end 124.63 148.91) (width 0.254) (layer F.Cu) (net 15)) (segment (start 113.07 151.45) (end 113.955 150.565) (width 0.254) (layer F.Cu) (net 15)) (segment (start 113.955 150.565) (end 122.975 150.565) (width 0.254) (layer F.Cu) (net 15)) (segment (start 120.17 156.915) (end 120.17 159.455) (width 0.254) (layer B.Cu) (net 18)) (segment (start 119.785 159.07) (end 120.17 159.455) (width 0.254) (layer B.Cu) (net 18)) (segment (start 113.07 159.07) (end 119.785 159.07) (width 0.254) (layer B.Cu) (net 18)) (segment (start 120.756204 155.01) (end 123.36 155.01) (width 0.254) (layer B.Cu) (net 18)) (segment (start 120.17 156.915) (end 120.17 155.596204) (width 0.254) (layer B.Cu) (net 18)) (segment (start 123.36 155.01) (end 124.63 153.74) (width 0.254) (layer B.Cu) (net 18)) (segment (start 120.17 155.596204) (end 120.756204 155.01) (width 0.254) (layer B.Cu) (net 18)) (segment (start 164.39 147) (end 161.46 149.93) (width 0.254) (layer F.Cu) (net 22)) (segment (start 168 147) (end 164.39 147) (width 0.254) (layer F.Cu) (net 22)) (segment (start 146.22 151.2) (end 148.125 149.295) (width 0.254) (layer B.Cu) (net 22)) (segment (start 160.825 149.295) (end 161.46 149.93) (width 0.254) (layer B.Cu) (net 22)) (segment (start 148.125 149.295) (end 160.825 149.295) (width 0.254) (layer B.Cu) (net 22)) (segment (start 122.105 156.28) (end 121.47 156.915) (width 0.254) (layer B.Cu) (net 23)) (segment (start 138.6 156.28) (end 122.105 156.28) (width 0.254) (layer B.Cu) (net 23)) (segment (start 138.6 151.2) (end 136.06 151.2) (width 1.5) (layer F.Cu) (net 24)) (segment (start 136.06 151.2) (end 136.06 154.375) (width 1.5) (layer F.Cu) (net 24)) (zone (net 1) (net_name GND) (layer B.Cu) (tstamp 6053136F) (hatch edge 0.508) (connect_pads yes (clearance 0.254)) (min_thickness 0.254) (fill yes (arc_segments 32) (thermal_gap 1.27) (thermal_bridge_width 1.27) (smoothing fillet) (radius 1.27)) (polygon (pts (xy 180.6 163.8) (xy 86.1 163.8) (xy 86.1 74.55) (xy 180.6 74.55) ) ) (filled_polygon (pts (xy 178.094 162.344) (xy 92.806 162.344) (xy 92.806 158.948757) (xy 106.569 158.948757) (xy 106.569 159.191243) (xy 106.616307 159.429069) (xy 106.709102 159.653097) (xy 106.84382 159.854717) (xy 107.015283 160.02618) (xy 107.216903 160.160898) (xy 107.440931 160.253693) (xy 107.678757 160.301) (xy 107.921243 160.301) (xy 108.159069 160.253693) (xy 108.383097 160.160898) (xy 108.584717 160.02618) (xy 108.625 159.985897) (xy 108.665283 160.02618) (xy 108.866903 160.160898) (xy 109.090931 160.253693) (xy 109.328757 160.301) (xy 109.571243 160.301) (xy 109.809069 160.253693) (xy 110.033097 160.160898) (xy 110.234717 160.02618) (xy 110.40618 159.854717) (xy 110.540898 159.653097) (xy 110.633693 159.429069) (xy 110.681 159.191243) (xy 110.681 159.07) (xy 111.643044 159.07) (xy 111.666812 159.311318) (xy 111.737202 159.543363) (xy 111.851509 159.757216) (xy 112.00534 159.94466) (xy 112.192784 160.098491) (xy 112.406637 160.212798) (xy 112.638682 160.283188) (xy 112.819528 160.301) (xy 113.320472 160.301) (xy 113.501318 160.283188) (xy 113.733363 160.212798) (xy 113.947216 160.098491) (xy 114.13466 159.94466) (xy 114.288491 159.757216) (xy 114.384284 159.578) (xy 119.287157 159.578) (xy 119.287157 159.705) (xy 119.289565 159.72945) (xy 119.289565 159.754009) (xy 119.296921 159.828698) (xy 119.316043 159.924831) (xy 119.337828 159.996648) (xy 119.375337 160.087204) (xy 119.410717 160.153394) (xy 119.465173 160.234893) (xy 119.512784 160.292908) (xy 119.582092 160.362216) (xy 119.640107 160.409827) (xy 119.721606 160.464283) (xy 119.787796 160.499663) (xy 119.878352 160.537172) (xy 119.950169 160.558957) (xy 120.046302 160.578079) (xy 120.120991 160.585435) (xy 120.14555 160.585435) (xy 120.17 160.587843) (xy 120.67 160.587843) (xy 120.744689 160.580487) (xy 120.816508 160.558701) (xy 120.82 160.556834) (xy 120.823492 160.558701) (xy 120.895311 160.580487) (xy 120.97 160.587843) (xy 121.47 160.587843) (xy 121.49445 160.585435) (xy 121.519009 160.585435) (xy 121.593698 160.578079) (xy 121.689831 160.558957) (xy 121.761648 160.537172) (xy 121.852204 160.499663) (xy 121.918394 160.464283) (xy 121.999893 160.409827) (xy 122.057908 160.362216) (xy 122.127216 160.292908) (xy 122.174827 160.234893) (xy 122.229283 160.153394) (xy 122.264663 160.087204) (xy 122.302172 159.996648) (xy 122.312379 159.963) (xy 133.495056 159.963) (xy 133.52 159.965457) (xy 133.544944 159.963) (xy 133.544947 159.963) (xy 133.619585 159.955649) (xy 133.715343 159.926601) (xy 133.803595 159.879429) (xy 133.880948 159.815948) (xy 133.896855 159.796565) (xy 135.029102 158.664318) (xy 135.080515 158.685614) (xy 135.308682 158.731) (xy 135.541318 158.731) (xy 135.678652 158.703682) (xy 137.419 158.703682) (xy 137.419 158.936318) (xy 137.464386 159.164485) (xy 137.553412 159.379413) (xy 137.682658 159.572843) (xy 137.847157 159.737342) (xy 138.040587 159.866588) (xy 138.255515 159.955614) (xy 138.483682 160.001) (xy 138.716318 160.001) (xy 138.944485 159.955614) (xy 139.159413 159.866588) (xy 139.352843 159.737342) (xy 139.517342 159.572843) (xy 139.646588 159.379413) (xy 139.735614 159.164485) (xy 139.781 158.936318) (xy 139.781 158.703682) (xy 145.039 158.703682) (xy 145.039 158.936318) (xy 145.084386 159.164485) (xy 145.173412 159.379413) (xy 145.302658 159.572843) (xy 145.467157 159.737342) (xy 145.660587 159.866588) (xy 145.875515 159.955614) (xy 146.103682 160.001) (xy 146.336318 160.001) (xy 146.564485 159.955614) (xy 146.779413 159.866588) (xy 146.972843 159.737342) (xy 147.110185 159.6) (xy 165.760625 159.6) (xy 165.794047 159.939335) (xy 165.893027 160.26563) (xy 166.053763 160.566345) (xy 166.270076 160.829924) (xy 166.533655 161.046237) (xy 166.83437 161.206973) (xy 167.160665 161.305953) (xy 167.414968 161.331) (xy 168.585032 161.331) (xy 168.839335 161.305953) (xy 169.16563 161.206973) (xy 169.466345 161.046237) (xy 169.729924 160.829924) (xy 169.946237 160.566345) (xy 170.1 160.278676) (xy 170.253763 160.566345) (xy 170.470076 160.829924) (xy 170.733655 161.046237) (xy 171.03437 161.206973) (xy 171.360665 161.305953) (xy 171.614968 161.331) (xy 172.785032 161.331) (xy 173.039335 161.305953) (xy 173.36563 161.206973) (xy 173.666345 161.046237) (xy 173.929924 160.829924) (xy 174.146237 160.566345) (xy 174.306973 160.26563) (xy 174.405953 159.939335) (xy 174.439375 159.6) (xy 174.405953 159.260665) (xy 174.306973 158.93437) (xy 174.146237 158.633655) (xy 173.929924 158.370076) (xy 173.666345 158.153763) (xy 173.36563 157.993027) (xy 173.039335 157.894047) (xy 172.785032 157.869) (xy 171.614968 157.869) (xy 171.360665 157.894047) (xy 171.03437 157.993027) (xy 170.733655 158.153763) (xy 170.470076 158.370076) (xy 170.253763 158.633655) (xy 170.1 158.921324) (xy 169.946237 158.633655) (xy 169.729924 158.370076) (xy 169.466345 158.153763) (xy 169.16563 157.993027) (xy 168.839335 157.894047) (xy 168.585032 157.869) (xy 167.414968 157.869) (xy 167.160665 157.894047) (xy 166.83437 157.993027) (xy 166.533655 158.153763) (xy 166.270076 158.370076) (xy 166.053763 158.633655) (xy 165.893027 158.93437) (xy 165.794047 159.260665) (xy 165.760625 159.6) (xy 147.110185 159.6) (xy 147.137342 159.572843) (xy 147.266588 159.379413) (xy 147.355614 159.164485) (xy 147.401 158.936318) (xy 147.401 158.703682) (xy 147.355614 158.475515) (xy 147.266588 158.260587) (xy 147.137342 158.067157) (xy 146.972843 157.902658) (xy 146.779413 157.773412) (xy 146.564485 157.684386) (xy 146.336318 157.639) (xy 146.103682 157.639) (xy 145.875515 157.684386) (xy 145.660587 157.773412) (xy 145.467157 157.902658) (xy 145.302658 158.067157) (xy 145.173412 158.260587) (xy 145.084386 158.475515) (xy 145.039 158.703682) (xy 139.781 158.703682) (xy 139.735614 158.475515) (xy 139.714318 158.424102) (xy 140.846565 157.291855) (xy 140.865948 157.275948) (xy 140.929429 157.198595) (xy 140.976601 157.110343) (xy 141.005649 157.014585) (xy 141.013 156.939947) (xy 141.013 156.939944) (xy 141.015457 156.915) (xy 141.013 156.890053) (xy 141.013 156.163682) (xy 145.039 156.163682) (xy 145.039 156.396318) (xy 145.084386 156.624485) (xy 145.173412 156.839413) (xy 145.302658 157.032843) (xy 145.467157 157.197342) (xy 145.660587 157.326588) (xy 145.875515 157.415614) (xy 146.103682 157.461) (xy 146.336318 157.461) (xy 146.564485 157.415614) (xy 146.779413 157.326588) (xy 146.972843 157.197342) (xy 147.137342 157.032843) (xy 147.266588 156.839413) (xy 147.287884 156.788) (xy 149.121815 156.788) (xy 149.112658 156.797157) (xy 148.983412 156.990587) (xy 148.894386 157.205515) (xy 148.849 157.433682) (xy 148.849 157.666318) (xy 148.894386 157.894485) (xy 148.983412 158.109413) (xy 149.112658 158.302843) (xy 149.277157 158.467342) (xy 149.470587 158.596588) (xy 149.685515 158.685614) (xy 149.913682 158.731) (xy 150.146318 158.731) (xy 150.374485 158.685614) (xy 150.589413 158.596588) (xy 150.782843 158.467342) (xy 150.947342 158.302843) (xy 151.076588 158.109413) (xy 151.165614 157.894485) (xy 151.211 157.666318) (xy 151.211 157.433682) (xy 151.165614 157.205515) (xy 151.076588 156.990587) (xy 150.947342 156.797157) (xy 150.938185 156.788) (xy 159.97958 156.788) (xy 160.345682 157.154102) (xy 160.324386 157.205515) (xy 160.279 157.433682) (xy 160.279 157.666318) (xy 160.324386 157.894485) (xy 160.413412 158.109413) (xy 160.542658 158.302843) (xy 160.707157 158.467342) (xy 160.900587 158.596588) (xy 161.115515 158.685614) (xy 161.343682 158.731) (xy 161.576318 158.731) (xy 161.804485 158.685614) (xy 162.019413 158.596588) (xy 162.212843 158.467342) (xy 162.377342 158.302843) (xy 162.506588 158.109413) (xy 162.595614 157.894485) (xy 162.641 157.666318) (xy 162.641 157.433682) (xy 162.595614 157.205515) (xy 162.506588 156.990587) (xy 162.377342 156.797157) (xy 162.212843 156.632658) (xy 162.019413 156.503412) (xy 161.804485 156.414386) (xy 161.576318 156.369) (xy 161.343682 156.369) (xy 161.115515 156.414386) (xy 161.064102 156.435682) (xy 160.566855 155.938435) (xy 160.550948 155.919052) (xy 160.473595 155.855571) (xy 160.385343 155.808399) (xy 160.289585 155.779351) (xy 160.214947 155.772) (xy 160.214944 155.772) (xy 160.19 155.769543) (xy 160.165056 155.772) (xy 158.147383 155.772) (xy 158.351517 155.687445) (xy 158.594083 155.525368) (xy 158.800368 155.319083) (xy 158.962445 155.076517) (xy 159.074086 154.806992) (xy 159.131 154.520866) (xy 159.131 154.229134) (xy 159.074086 153.943008) (xy 158.962445 153.673483) (xy 158.800368 153.430917) (xy 158.594083 153.224632) (xy 158.351517 153.062555) (xy 158.081992 152.950914) (xy 157.795866 152.894) (xy 157.504134 152.894) (xy 157.218008 152.950914) (xy 156.948483 153.062555) (xy 156.705917 153.224632) (xy 156.499632 153.430917) (xy 156.337555 153.673483) (xy 156.225914 153.943008) (xy 156.169 154.229134) (xy 156.169 154.520866) (xy 156.225914 154.806992) (xy 156.337555 155.076517) (xy 156.499632 155.319083) (xy 156.705917 155.525368) (xy 156.948483 155.687445) (xy 157.152617 155.772) (xy 151.368677 155.772) (xy 151.400711 155.745711) (xy 151.448322 155.687696) (xy 151.483701 155.621508) (xy 151.505487 155.549689) (xy 151.512843 155.475) (xy 151.512843 153.275) (xy 151.505487 153.200311) (xy 151.483701 153.128492) (xy 151.448322 153.062304) (xy 151.400711 153.004289) (xy 151.342696 152.956678) (xy 151.276508 152.921299) (xy 151.204689 152.899513) (xy 151.13 152.892157) (xy 148.93 152.892157) (xy 148.855311 152.899513) (xy 148.783492 152.921299) (xy 148.717304 152.956678) (xy 148.659289 153.004289) (xy 148.611678 153.062304) (xy 148.576299 153.128492) (xy 148.554513 153.200311) (xy 148.547157 153.275) (xy 148.547157 155.475) (xy 148.554513 155.549689) (xy 148.576299 155.621508) (xy 148.611678 155.687696) (xy 148.659289 155.745711) (xy 148.691323 155.772) (xy 147.287884 155.772) (xy 147.266588 155.720587) (xy 147.137342 155.527157) (xy 146.972843 155.362658) (xy 146.779413 155.233412) (xy 146.564485 155.144386) (xy 146.336318 155.099) (xy 146.103682 155.099) (xy 145.875515 155.144386) (xy 145.660587 155.233412) (xy 145.467157 155.362658) (xy 145.302658 155.527157) (xy 145.173412 155.720587) (xy 145.084386 155.935515) (xy 145.039 156.163682) (xy 141.013 156.163682) (xy 141.013 155.22042) (xy 142.609738 153.623682) (xy 145.039 153.623682) (xy 145.039 153.856318) (xy 145.084386 154.084485) (xy 145.173412 154.299413) (xy 145.302658 154.492843) (xy 145.467157 154.657342) (xy 145.660587 154.786588) (xy 145.875515 154.875614) (xy 146.103682 154.921) (xy 146.336318 154.921) (xy 146.564485 154.875614) (xy 146.779413 154.786588) (xy 146.972843 154.657342) (xy 147.137342 154.492843) (xy 147.266588 154.299413) (xy 147.355614 154.084485) (xy 147.401 153.856318) (xy 147.401 153.623682) (xy 147.355614 153.395515) (xy 147.266588 153.180587) (xy 147.137342 152.987157) (xy 146.972843 152.822658) (xy 146.779413 152.693412) (xy 146.564485 152.604386) (xy 146.336318 152.559) (xy 146.103682 152.559) (xy 145.875515 152.604386) (xy 145.660587 152.693412) (xy 145.467157 152.822658) (xy 145.302658 152.987157) (xy 145.173412 153.180587) (xy 145.084386 153.395515) (xy 145.039 153.623682) (xy 142.609738 153.623682) (xy 145.039 151.194421) (xy 145.039 151.316318) (xy 145.084386 151.544485) (xy 145.173412 151.759413) (xy 145.302658 151.952843) (xy 145.467157 152.117342) (xy 145.660587 152.246588) (xy 145.875515 152.335614) (xy 146.103682 152.381) (xy 146.336318 152.381) (xy 146.564485 152.335614) (xy 146.779413 152.246588) (xy 146.972843 152.117342) (xy 147.137342 151.952843) (xy 147.266588 151.759413) (xy 147.355614 151.544485) (xy 147.401 151.316318) (xy 147.401 151.083682) (xy 147.355614 150.855515) (xy 147.334318 150.804102) (xy 148.33542 149.803) (xy 148.691323 149.803) (xy 148.659289 149.829289) (xy 148.611678 149.887304) (xy 148.576299 149.953492) (xy 148.554513 150.025311) (xy 148.547157 150.1) (xy 148.547157 152.3) (xy 148.554513 152.374689) (xy 148.576299 152.446508) (xy 148.611678 152.512696) (xy 148.659289 152.570711) (xy 148.717304 152.618322) (xy 148.783492 152.653701) (xy 148.855311 152.675487) (xy 148.93 152.682843) (xy 151.13 152.682843) (xy 151.204689 152.675487) (xy 151.276508 152.653701) (xy 151.342696 152.618322) (xy 151.400711 152.570711) (xy 151.448322 152.512696) (xy 151.483701 152.446508) (xy 151.505487 152.374689) (xy 151.512843 152.3) (xy 151.512843 150.1) (xy 151.505487 150.025311) (xy 151.483701 149.953492) (xy 151.448322 149.887304) (xy 151.400711 149.829289) (xy 151.368677 149.803) (xy 157.152617 149.803) (xy 156.948483 149.887555) (xy 156.705917 150.049632) (xy 156.499632 150.255917) (xy 156.337555 150.498483) (xy 156.225914 150.768008) (xy 156.169 151.054134) (xy 156.169 151.345866) (xy 156.225914 151.631992) (xy 156.337555 151.901517) (xy 156.499632 152.144083) (xy 156.705917 152.350368) (xy 156.948483 152.512445) (xy 157.218008 152.624086) (xy 157.504134 152.681) (xy 157.795866 152.681) (xy 158.081992 152.624086) (xy 158.351517 152.512445) (xy 158.594083 152.350368) (xy 158.800368 152.144083) (xy 158.962445 151.901517) (xy 159.074086 151.631992) (xy 159.131 151.345866) (xy 159.131 151.054134) (xy 159.074086 150.768008) (xy 158.962445 150.498483) (xy 158.800368 150.255917) (xy 158.594083 150.049632) (xy 158.351517 149.887555) (xy 158.147383 149.803) (xy 160.281125 149.803) (xy 160.279 149.813682) (xy 160.279 150.046318) (xy 160.324386 150.274485) (xy 160.413412 150.489413) (xy 160.542658 150.682843) (xy 160.707157 150.847342) (xy 160.900587 150.976588) (xy 161.115515 151.065614) (xy 161.343682 151.111) (xy 161.576318 151.111) (xy 161.804485 151.065614) (xy 162.019413 150.976588) (xy 162.212843 150.847342) (xy 162.377342 150.682843) (xy 162.506588 150.489413) (xy 162.595614 150.274485) (xy 162.641 150.046318) (xy 162.641 149.813682) (xy 162.595614 149.585515) (xy 162.506588 149.370587) (xy 162.377342 149.177157) (xy 162.332614 149.132429) (xy 162.335343 149.131601) (xy 162.423595 149.084429) (xy 162.500948 149.020948) (xy 162.516855 149.001565) (xy 164.51842 147) (xy 165.760625 147) (xy 165.794047 147.339335) (xy 165.893027 147.66563) (xy 166.053763 147.966345) (xy 166.270076 148.229924) (xy 166.533655 148.446237) (xy 166.83437 148.606973) (xy 167.160665 148.705953) (xy 167.414968 148.731) (xy 168.585032 148.731) (xy 168.839335 148.705953) (xy 169.16563 148.606973) (xy 169.466345 148.446237) (xy 169.729924 148.229924) (xy 169.946237 147.966345) (xy 170.106973 147.66563) (xy 170.205953 147.339335) (xy 170.239375 147) (xy 170.205953 146.660665) (xy 170.106973 146.33437) (xy 169.946237 146.033655) (xy 169.729924 145.770076) (xy 169.466345 145.553763) (xy 169.16563 145.393027) (xy 168.839335 145.294047) (xy 168.585032 145.269) (xy 167.414968 145.269) (xy 167.160665 145.294047) (xy 166.83437 145.393027) (xy 166.533655 145.553763) (xy 166.270076 145.770076) (xy 166.053763 146.033655) (xy 165.893027 146.33437) (xy 165.794047 146.660665) (xy 165.760625 147) (xy 164.51842 147) (xy 167.04696 144.471461) (xy 167.160665 144.505953) (xy 167.414968 144.531) (xy 168.585032 144.531) (xy 168.839335 144.505953) (xy 169.16563 144.406973) (xy 169.466345 144.246237) (xy 169.729924 144.029924) (xy 169.946237 143.766345) (xy 170.106973 143.46563) (xy 170.205953 143.139335) (xy 170.239375 142.8) (xy 170.205953 142.460665) (xy 170.106973 142.13437) (xy 169.946237 141.833655) (xy 169.729924 141.570076) (xy 169.466345 141.353763) (xy 169.16563 141.193027) (xy 168.839335 141.094047) (xy 168.585032 141.069) (xy 167.414968 141.069) (xy 167.160665 141.094047) (xy 166.83437 141.193027) (xy 166.533655 141.353763) (xy 166.270076 141.570076) (xy 166.053763 141.833655) (xy 165.893027 142.13437) (xy 165.794047 142.460665) (xy 165.760625 142.8) (xy 165.794047 143.139335) (xy 165.893027 143.46563) (xy 166.053763 143.766345) (xy 166.171622 143.909957) (xy 161.92958 148.152) (xy 146.879943 148.152) (xy 146.854999 148.149543) (xy 146.830055 148.152) (xy 146.830053 148.152) (xy 146.755415 148.159351) (xy 146.659657 148.188399) (xy 146.618576 148.210357) (xy 146.571404 148.235571) (xy 146.51681 148.280376) (xy 146.494052 148.299052) (xy 146.47815 148.318429) (xy 140.16343 154.63315) (xy 140.144053 154.649052) (xy 140.128151 154.668429) (xy 140.12815 154.66843) (xy 140.080571 154.726405) (xy 140.0334 154.814657) (xy 140.004352 154.910416) (xy 139.994543 155.01) (xy 139.997001 155.034954) (xy 139.997 156.70458) (xy 138.995898 157.705682) (xy 138.944485 157.684386) (xy 138.716318 157.639) (xy 138.483682 157.639) (xy 138.255515 157.684386) (xy 138.040587 157.773412) (xy 137.847157 157.902658) (xy 137.682658 158.067157) (xy 137.553412 158.260587) (xy 137.464386 158.475515) (xy 137.419 158.703682) (xy 135.678652 158.703682) (xy 135.769485 158.685614) (xy 135.984413 158.596588) (xy 136.177843 158.467342) (xy 136.342342 158.302843) (xy 136.471588 158.109413) (xy 136.560614 157.894485) (xy 136.606 157.666318) (xy 136.606 157.433682) (xy 136.560614 157.205515) (xy 136.471588 156.990587) (xy 136.342342 156.797157) (xy 136.333185 156.788) (xy 137.532116 156.788) (xy 137.553412 156.839413) (xy 137.682658 157.032843) (xy 137.847157 157.197342) (xy 138.040587 157.326588) (xy 138.255515 157.415614) (xy 138.483682 157.461) (xy 138.716318 157.461) (xy 138.944485 157.415614) (xy 139.159413 157.326588) (xy 139.352843 157.197342) (xy 139.517342 157.032843) (xy 139.646588 156.839413) (xy 139.735614 156.624485) (xy 139.781 156.396318) (xy 139.781 156.163682) (xy 139.735614 155.935515) (xy 139.646588 155.720587) (xy 139.517342 155.527157) (xy 139.352843 155.362658) (xy 139.159413 155.233412) (xy 138.944485 155.144386) (xy 138.716318 155.099) (xy 138.483682 155.099) (xy 138.255515 155.144386) (xy 138.040587 155.233412) (xy 137.847157 155.362658) (xy 137.682658 155.527157) (xy 137.553412 155.720587) (xy 137.532116 155.772) (xy 122.129944 155.772) (xy 122.105 155.769543) (xy 122.080056 155.772) (xy 122.080053 155.772) (xy 122.005415 155.779351) (xy 121.909657 155.808399) (xy 121.821405 155.855571) (xy 121.819778 155.856906) (xy 121.761648 155.832828) (xy 121.689831 155.811043) (xy 121.593698 155.791921) (xy 121.519009 155.784565) (xy 121.49445 155.784565) (xy 121.47 155.782157) (xy 120.97 155.782157) (xy 120.895311 155.789513) (xy 120.823492 155.811299) (xy 120.82 155.813166) (xy 120.816508 155.811299) (xy 120.744689 155.789513) (xy 120.699556 155.785068) (xy 120.966624 155.518) (xy 123.335056 155.518) (xy 123.36 155.520457) (xy 123.384944 155.518) (xy 123.384947 155.518) (xy 123.459585 155.510649) (xy 123.555343 155.481601) (xy 123.643595 155.434429) (xy 123.720948 155.370948) (xy 123.736855 155.351565) (xy 124.115577 154.972843) (xy 125.48 154.972843) (xy 125.554689 154.965487) (xy 125.626508 154.943701) (xy 125.692696 154.908322) (xy 125.750711 154.860711) (xy 125.798322 154.802696) (xy 125.833701 154.736508) (xy 125.855487 154.664689) (xy 125.862843 154.59) (xy 125.862843 154.258682) (xy 134.879 154.258682) (xy 134.879 154.491318) (xy 134.924386 154.719485) (xy 135.013412 154.934413) (xy 135.142658 155.127843) (xy 135.307157 155.292342) (xy 135.500587 155.421588) (xy 135.715515 155.510614) (xy 135.943682 155.556) (xy 136.176318 155.556) (xy 136.404485 155.510614) (xy 136.619413 155.421588) (xy 136.812843 155.292342) (xy 136.977342 155.127843) (xy 137.106588 154.934413) (xy 137.195614 154.719485) (xy 137.241 154.491318) (xy 137.241 154.258682) (xy 137.195614 154.030515) (xy 137.106588 153.815587) (xy 136.977342 153.622157) (xy 136.812843 153.457658) (xy 136.619413 153.328412) (xy 136.404485 153.239386) (xy 136.176318 153.194) (xy 135.943682 153.194) (xy 135.715515 153.239386) (xy 135.500587 153.328412) (xy 135.307157 153.457658) (xy 135.142658 153.622157) (xy 135.013412 153.815587) (xy 134.924386 154.030515) (xy 134.879 154.258682) (xy 125.862843 154.258682) (xy 125.862843 152.89) (xy 125.855487 152.815311) (xy 125.833701 152.743492) (xy 125.798322 152.677304) (xy 125.750711 152.619289) (xy 125.692696 152.571678) (xy 125.626508 152.536299) (xy 125.554689 152.514513) (xy 125.48 152.507157) (xy 123.78 152.507157) (xy 123.705311 152.514513) (xy 123.633492 152.536299) (xy 123.567304 152.571678) (xy 123.509289 152.619289) (xy 123.461678 152.677304) (xy 123.426299 152.743492) (xy 123.404513 152.815311) (xy 123.397157 152.89) (xy 123.397157 154.254423) (xy 123.14958 154.502) (xy 120.781148 154.502) (xy 120.756204 154.499543) (xy 120.73126 154.502) (xy 120.731257 154.502) (xy 120.656619 154.509351) (xy 120.560861 154.538399) (xy 120.472609 154.585571) (xy 120.395256 154.649052) (xy 120.379349 154.668435) (xy 119.82843 155.219354) (xy 119.809053 155.235256) (xy 119.793151 155.254633) (xy 119.79315 155.254634) (xy 119.745571 155.312609) (xy 119.6984 155.400861) (xy 119.669352 155.49662) (xy 119.659543 155.596204) (xy 119.662001 155.621158) (xy 119.662001 155.945544) (xy 119.640107 155.960173) (xy 119.582092 156.007784) (xy 119.512784 156.077092) (xy 119.465173 156.135107) (xy 119.410717 156.216606) (xy 119.375337 156.282796) (xy 119.337828 156.373352) (xy 119.316043 156.445169) (xy 119.296921 156.541302) (xy 119.289565 156.615991) (xy 119.289565 156.64055) (xy 119.287157 156.665) (xy 119.287157 157.165) (xy 119.289565 157.18945) (xy 119.289565 157.214009) (xy 119.296921 157.288698) (xy 119.316043 157.384831) (xy 119.337828 157.456648) (xy 119.375337 157.547204) (xy 119.410717 157.613394) (xy 119.465173 157.694893) (xy 119.512784 157.752908) (xy 119.582092 157.822216) (xy 119.640107 157.869827) (xy 119.662 157.884456) (xy 119.662001 158.485544) (xy 119.640107 158.500173) (xy 119.582092 158.547784) (xy 119.567876 158.562) (xy 114.384284 158.562) (xy 114.288491 158.382784) (xy 114.13466 158.19534) (xy 113.947216 158.041509) (xy 113.733363 157.927202) (xy 113.501318 157.856812) (xy 113.320472 157.839) (xy 112.819528 157.839) (xy 112.638682 157.856812) (xy 112.406637 157.927202) (xy 112.192784 158.041509) (xy 112.00534 158.19534) (xy 111.851509 158.382784) (xy 111.737202 158.596637) (xy 111.666812 158.828682) (xy 111.643044 159.07) (xy 110.681 159.07) (xy 110.681 158.948757) (xy 110.633693 158.710931) (xy 110.540898 158.486903) (xy 110.40618 158.285283) (xy 110.234717 158.11382) (xy 110.033097 157.979102) (xy 109.809069 157.886307) (xy 109.571243 157.839) (xy 109.328757 157.839) (xy 109.090931 157.886307) (xy 108.866903 157.979102) (xy 108.665283 158.11382) (xy 108.625 158.154103) (xy 108.584717 158.11382) (xy 108.383097 157.979102) (xy 108.159069 157.886307) (xy 107.921243 157.839) (xy 107.678757 157.839) (xy 107.440931 157.886307) (xy 107.216903 157.979102) (xy 107.015283 158.11382) (xy 106.84382 158.285283) (xy 106.709102 158.486903) (xy 106.616307 158.710931) (xy 106.569 158.948757) (xy 92.806 158.948757) (xy 92.806 156.408757) (xy 106.569 156.408757) (xy 106.569 156.651243) (xy 106.616307 156.889069) (xy 106.709102 157.113097) (xy 106.84382 157.314717) (xy 107.015283 157.48618) (xy 107.216903 157.620898) (xy 107.440931 157.713693) (xy 107.678757 157.761) (xy 107.921243 157.761) (xy 108.159069 157.713693) (xy 108.383097 157.620898) (xy 108.584717 157.48618) (xy 108.625 157.445897) (xy 108.665283 157.48618) (xy 108.866903 157.620898) (xy 109.090931 157.713693) (xy 109.328757 157.761) (xy 109.571243 157.761) (xy 109.809069 157.713693) (xy 110.033097 157.620898) (xy 110.234717 157.48618) (xy 110.40618 157.314717) (xy 110.540898 157.113097) (xy 110.633693 156.889069) (xy 110.681 156.651243) (xy 110.681 156.53) (xy 111.643044 156.53) (xy 111.666812 156.771318) (xy 111.737202 157.003363) (xy 111.851509 157.217216) (xy 112.00534 157.40466) (xy 112.192784 157.558491) (xy 112.406637 157.672798) (xy 112.638682 157.743188) (xy 112.819528 157.761) (xy 113.320472 157.761) (xy 113.501318 157.743188) (xy 113.733363 157.672798) (xy 113.947216 157.558491) (xy 114.13466 157.40466) (xy 114.288491 157.217216) (xy 114.402798 157.003363) (xy 114.473188 156.771318) (xy 114.496956 156.53) (xy 114.473188 156.288682) (xy 114.402798 156.056637) (xy 114.288491 155.842784) (xy 114.13466 155.65534) (xy 113.947216 155.501509) (xy 113.733363 155.387202) (xy 113.501318 155.316812) (xy 113.320472 155.299) (xy 112.819528 155.299) (xy 112.638682 155.316812) (xy 112.406637 155.387202) (xy 112.192784 155.501509) (xy 112.00534 155.65534) (xy 111.851509 155.842784) (xy 111.737202 156.056637) (xy 111.666812 156.288682) (xy 111.643044 156.53) (xy 110.681 156.53) (xy 110.681 156.408757) (xy 110.633693 156.170931) (xy 110.540898 155.946903) (xy 110.40618 155.745283) (xy 110.234717 155.57382) (xy 110.033097 155.439102) (xy 109.809069 155.346307) (xy 109.571243 155.299) (xy 109.328757 155.299) (xy 109.090931 155.346307) (xy 108.866903 155.439102) (xy 108.665283 155.57382) (xy 108.625 155.614103) (xy 108.584717 155.57382) (xy 108.383097 155.439102) (xy 108.159069 155.346307) (xy 107.921243 155.299) (xy 107.678757 155.299) (xy 107.440931 155.346307) (xy 107.216903 155.439102) (xy 107.015283 155.57382) (xy 106.84382 155.745283) (xy 106.709102 155.946903) (xy 106.616307 156.170931) (xy 106.569 156.408757) (xy 92.806 156.408757) (xy 92.806 153.99) (xy 111.643044 153.99) (xy 111.666812 154.231318) (xy 111.737202 154.463363) (xy 111.851509 154.677216) (xy 112.00534 154.86466) (xy 112.192784 155.018491) (xy 112.406637 155.132798) (xy 112.638682 155.203188) (xy 112.819528 155.221) (xy 113.320472 155.221) (xy 113.501318 155.203188) (xy 113.733363 155.132798) (xy 113.947216 155.018491) (xy 114.13466 154.86466) (xy 114.288491 154.677216) (xy 114.402798 154.463363) (xy 114.473188 154.231318) (xy 114.496956 153.99) (xy 114.473188 153.748682) (xy 114.433776 153.618757) (xy 115.779 153.618757) (xy 115.779 153.861243) (xy 115.826307 154.099069) (xy 115.919102 154.323097) (xy 116.05382 154.524717) (xy 116.225283 154.69618) (xy 116.426903 154.830898) (xy 116.650931 154.923693) (xy 116.888757 154.971) (xy 117.131243 154.971) (xy 117.369069 154.923693) (xy 117.593097 154.830898) (xy 117.794717 154.69618) (xy 117.96618 154.524717) (xy 118.100898 154.323097) (xy 118.193693 154.099069) (xy 118.241 153.861243) (xy 118.241 153.618757) (xy 118.319 153.618757) (xy 118.319 153.861243) (xy 118.366307 154.099069) (xy 118.459102 154.323097) (xy 118.59382 154.524717) (xy 118.765283 154.69618) (xy 118.966903 154.830898) (xy 119.190931 154.923693) (xy 119.428757 154.971) (xy 119.671243 154.971) (xy 119.909069 154.923693) (xy 120.133097 154.830898) (xy 120.334717 154.69618) (xy 120.50618 154.524717) (xy 120.640898 154.323097) (xy 120.733693 154.099069) (xy 120.781 153.861243) (xy 120.781 153.618757) (xy 120.733693 153.380931) (xy 120.640898 153.156903) (xy 120.50618 152.955283) (xy 120.334717 152.78382) (xy 120.133097 152.649102) (xy 119.909069 152.556307) (xy 119.671243 152.509) (xy 119.428757 152.509) (xy 119.190931 152.556307) (xy 118.966903 152.649102) (xy 118.765283 152.78382) (xy 118.59382 152.955283) (xy 118.459102 153.156903) (xy 118.366307 153.380931) (xy 118.319 153.618757) (xy 118.241 153.618757) (xy 118.193693 153.380931) (xy 118.100898 153.156903) (xy 117.96618 152.955283) (xy 117.794717 152.78382) (xy 117.593097 152.649102) (xy 117.369069 152.556307) (xy 117.131243 152.509) (xy 116.888757 152.509) (xy 116.650931 152.556307) (xy 116.426903 152.649102) (xy 116.225283 152.78382) (xy 116.05382 152.955283) (xy 115.919102 153.156903) (xy 115.826307 153.380931) (xy 115.779 153.618757) (xy 114.433776 153.618757) (xy 114.402798 153.516637) (xy 114.288491 153.302784) (xy 114.13466 153.11534) (xy 113.947216 152.961509) (xy 113.733363 152.847202) (xy 113.501318 152.776812) (xy 113.320472 152.759) (xy 112.819528 152.759) (xy 112.638682 152.776812) (xy 112.406637 152.847202) (xy 112.192784 152.961509) (xy 112.00534 153.11534) (xy 111.851509 153.302784) (xy 111.737202 153.516637) (xy 111.666812 153.748682) (xy 111.643044 153.99) (xy 92.806 153.99) (xy 92.806 151.054436) (xy 98.919 151.054436) (xy 98.919 151.385564) (xy 98.9836 151.71033) (xy 99.110317 152.016252) (xy 99.294282 152.291575) (xy 99.528425 152.525718) (xy 99.803748 152.709683) (xy 100.10967 152.8364) (xy 100.434436 152.901) (xy 100.765564 152.901) (xy 101.09033 152.8364) (xy 101.396252 152.709683) (xy 101.671575 152.525718) (xy 101.905718 152.291575) (xy 102.089683 152.016252) (xy 102.2164 151.71033) (xy 102.281 151.385564) (xy 102.281 151.328757) (xy 106.569 151.328757) (xy 106.569 151.571243) (xy 106.616307 151.809069) (xy 106.709102 152.033097) (xy 106.84382 152.234717) (xy 107.015283 152.40618) (xy 107.216903 152.540898) (xy 107.440931 152.633693) (xy 107.678757 152.681) (xy 107.921243 152.681) (xy 108.159069 152.633693) (xy 108.383097 152.540898) (xy 108.584717 152.40618) (xy 108.625 152.365897) (xy 108.665283 152.40618) (xy 108.866903 152.540898) (xy 109.090931 152.633693) (xy 109.328757 152.681) (xy 109.571243 152.681) (xy 109.809069 152.633693) (xy 110.033097 152.540898) (xy 110.234717 152.40618) (xy 110.40618 152.234717) (xy 110.540898 152.033097) (xy 110.633693 151.809069) (xy 110.681 151.571243) (xy 110.681 151.45) (xy 111.643044 151.45) (xy 111.666812 151.691318) (xy 111.737202 151.923363) (xy 111.851509 152.137216) (xy 112.00534 152.32466) (xy 112.192784 152.478491) (xy 112.406637 152.592798) (xy 112.638682 152.663188) (xy 112.819528 152.681) (xy 113.320472 152.681) (xy 113.501318 152.663188) (xy 113.733363 152.592798) (xy 113.947216 152.478491) (xy 114.13466 152.32466) (xy 114.288491 152.137216) (xy 114.402798 151.923363) (xy 114.473188 151.691318) (xy 114.496956 151.45) (xy 114.473188 151.208682) (xy 114.43527 151.083682) (xy 127.259 151.083682) (xy 127.259 151.316318) (xy 127.304386 151.544485) (xy 127.393412 151.759413) (xy 127.522658 151.952843) (xy 127.687157 152.117342) (xy 127.880587 152.246588) (xy 128.095515 152.335614) (xy 128.323682 152.381) (xy 128.556318 152.381) (xy 128.784485 152.335614) (xy 128.999413 152.246588) (xy 129.192843 152.117342) (xy 129.357342 151.952843) (xy 129.486588 151.759413) (xy 129.575614 151.544485) (xy 129.621 151.316318) (xy 129.621 151.083682) (xy 134.879 151.083682) (xy 134.879 151.316318) (xy 134.924386 151.544485) (xy 135.013412 151.759413) (xy 135.142658 151.952843) (xy 135.307157 152.117342) (xy 135.500587 152.246588) (xy 135.715515 152.335614) (xy 135.943682 152.381) (xy 136.176318 152.381) (xy 136.404485 152.335614) (xy 136.619413 152.246588) (xy 136.812843 152.117342) (xy 136.977342 151.952843) (xy 137.106588 151.759413) (xy 137.195614 151.544485) (xy 137.241 151.316318) (xy 137.241 151.083682) (xy 137.195614 150.855515) (xy 137.106588 150.640587) (xy 136.977342 150.447157) (xy 136.930185 150.4) (xy 137.417157 150.4) (xy 137.417157 152) (xy 137.424513 152.074689) (xy 137.446299 152.146508) (xy 137.481678 152.212696) (xy 137.529289 152.270711) (xy 137.587304 152.318322) (xy 137.653492 152.353701) (xy 137.725311 152.375487) (xy 137.8 152.382843) (xy 139.4 152.382843) (xy 139.474689 152.375487) (xy 139.546508 152.353701) (xy 139.612696 152.318322) (xy 139.670711 152.270711) (xy 139.718322 152.212696) (xy 139.753701 152.146508) (xy 139.775487 152.074689) (xy 139.782843 152) (xy 139.782843 150.4) (xy 139.775487 150.325311) (xy 139.753701 150.253492) (xy 139.718322 150.187304) (xy 139.670711 150.129289) (xy 139.612696 150.081678) (xy 139.546508 150.046299) (xy 139.474689 150.024513) (xy 139.4 150.017157) (xy 137.8 150.017157) (xy 137.725311 150.024513) (xy 137.653492 150.046299) (xy 137.587304 150.081678) (xy 137.529289 150.129289) (xy 137.481678 150.187304) (xy 137.446299 150.253492) (xy 137.424513 150.325311) (xy 137.417157 150.4) (xy 136.930185 150.4) (xy 136.812843 150.282658) (xy 136.619413 150.153412) (xy 136.404485 150.064386) (xy 136.176318 150.019) (xy 135.943682 150.019) (xy 135.715515 150.064386) (xy 135.500587 150.153412) (xy 135.307157 150.282658) (xy 135.142658 150.447157) (xy 135.013412 150.640587) (xy 134.924386 150.855515) (xy 134.879 151.083682) (xy 129.621 151.083682) (xy 129.575614 150.855515) (xy 129.486588 150.640587) (xy 129.357342 150.447157) (xy 129.192843 150.282658) (xy 128.999413 150.153412) (xy 128.784485 150.064386) (xy 128.556318 150.019) (xy 128.323682 150.019) (xy 128.095515 150.064386) (xy 127.880587 150.153412) (xy 127.687157 150.282658) (xy 127.522658 150.447157) (xy 127.393412 150.640587) (xy 127.304386 150.855515) (xy 127.259 151.083682) (xy 114.43527 151.083682) (xy 114.402798 150.976637) (xy 114.288491 150.762784) (xy 114.13466 150.57534) (xy 113.947216 150.421509) (xy 113.733363 150.307202) (xy 113.501318 150.236812) (xy 113.320472 150.219) (xy 112.819528 150.219) (xy 112.638682 150.236812) (xy 112.406637 150.307202) (xy 112.192784 150.421509) (xy 112.00534 150.57534) (xy 111.851509 150.762784) (xy 111.737202 150.976637) (xy 111.666812 151.208682) (xy 111.643044 151.45) (xy 110.681 151.45) (xy 110.681 151.328757) (xy 110.633693 151.090931) (xy 110.540898 150.866903) (xy 110.40618 150.665283) (xy 110.234717 150.49382) (xy 110.033097 150.359102) (xy 109.809069 150.266307) (xy 109.571243 150.219) (xy 109.328757 150.219) (xy 109.090931 150.266307) (xy 108.866903 150.359102) (xy 108.665283 150.49382) (xy 108.625 150.534103) (xy 108.584717 150.49382) (xy 108.383097 150.359102) (xy 108.159069 150.266307) (xy 107.921243 150.219) (xy 107.678757 150.219) (xy 107.440931 150.266307) (xy 107.216903 150.359102) (xy 107.015283 150.49382) (xy 106.84382 150.665283) (xy 106.709102 150.866903) (xy 106.616307 151.090931) (xy 106.569 151.328757) (xy 102.281 151.328757) (xy 102.281 151.054436) (xy 102.2164 150.72967) (xy 102.089683 150.423748) (xy 101.905718 150.148425) (xy 101.671575 149.914282) (xy 101.396252 149.730317) (xy 101.09033 149.6036) (xy 100.765564 149.539) (xy 100.434436 149.539) (xy 100.10967 149.6036) (xy 99.803748 149.730317) (xy 99.528425 149.914282) (xy 99.294282 150.148425) (xy 99.110317 150.423748) (xy 98.9836 150.72967) (xy 98.919 151.054436) (xy 92.806 151.054436) (xy 92.806 148.788757) (xy 106.569 148.788757) (xy 106.569 149.031243) (xy 106.616307 149.269069) (xy 106.709102 149.493097) (xy 106.84382 149.694717) (xy 107.015283 149.86618) (xy 107.216903 150.000898) (xy 107.440931 150.093693) (xy 107.678757 150.141) (xy 107.921243 150.141) (xy 108.159069 150.093693) (xy 108.383097 150.000898) (xy 108.584717 149.86618) (xy 108.625 149.825897) (xy 108.665283 149.86618) (xy 108.866903 150.000898) (xy 109.090931 150.093693) (xy 109.328757 150.141) (xy 109.571243 150.141) (xy 109.809069 150.093693) (xy 110.033097 150.000898) (xy 110.234717 149.86618) (xy 110.40618 149.694717) (xy 110.540898 149.493097) (xy 110.633693 149.269069) (xy 110.681 149.031243) (xy 110.681 148.91) (xy 111.643044 148.91) (xy 111.666812 149.151318) (xy 111.737202 149.383363) (xy 111.851509 149.597216) (xy 112.00534 149.78466) (xy 112.192784 149.938491) (xy 112.406637 150.052798) (xy 112.638682 150.123188) (xy 112.819528 150.141) (xy 113.320472 150.141) (xy 113.501318 150.123188) (xy 113.733363 150.052798) (xy 113.947216 149.938491) (xy 114.13466 149.78466) (xy 114.288491 149.597216) (xy 114.402798 149.383363) (xy 114.473188 149.151318) (xy 114.496956 148.91) (xy 114.4855 148.793682) (xy 115.829 148.793682) (xy 115.829 149.026318) (xy 115.874386 149.254485) (xy 115.963412 149.469413) (xy 116.092658 149.662843) (xy 116.257157 149.827342) (xy 116.450587 149.956588) (xy 116.665515 150.045614) (xy 116.893682 150.091) (xy 117.126318 150.091) (xy 117.354485 150.045614) (xy 117.569413 149.956588) (xy 117.762843 149.827342) (xy 117.927342 149.662843) (xy 118.056588 149.469413) (xy 118.145614 149.254485) (xy 118.191 149.026318) (xy 118.191 148.793682) (xy 123.449 148.793682) (xy 123.449 149.026318) (xy 123.494386 149.254485) (xy 123.583412 149.469413) (xy 123.712658 149.662843) (xy 123.877157 149.827342) (xy 124.070587 149.956588) (xy 124.285515 150.045614) (xy 124.513682 150.091) (xy 124.746318 150.091) (xy 124.974485 150.045614) (xy 125.189413 149.956588) (xy 125.382843 149.827342) (xy 125.547342 149.662843) (xy 125.676588 149.469413) (xy 125.765614 149.254485) (xy 125.811 149.026318) (xy 125.811 148.793682) (xy 125.765614 148.565515) (xy 125.676588 148.350587) (xy 125.547342 148.157157) (xy 125.382843 147.992658) (xy 125.189413 147.863412) (xy 124.974485 147.774386) (xy 124.746318 147.729) (xy 124.513682 147.729) (xy 124.285515 147.774386) (xy 124.070587 147.863412) (xy 123.877157 147.992658) (xy 123.712658 148.157157) (xy 123.583412 148.350587) (xy 123.494386 148.565515) (xy 123.449 148.793682) (xy 118.191 148.793682) (xy 118.145614 148.565515) (xy 118.056588 148.350587) (xy 117.927342 148.157157) (xy 117.762843 147.992658) (xy 117.569413 147.863412) (xy 117.354485 147.774386) (xy 117.126318 147.729) (xy 116.893682 147.729) (xy 116.665515 147.774386) (xy 116.450587 147.863412) (xy 116.257157 147.992658) (xy 116.092658 148.157157) (xy 115.963412 148.350587) (xy 115.874386 148.565515) (xy 115.829 148.793682) (xy 114.4855 148.793682) (xy 114.473188 148.668682) (xy 114.402798 148.436637) (xy 114.288491 148.222784) (xy 114.13466 148.03534) (xy 113.947216 147.881509) (xy 113.733363 147.767202) (xy 113.501318 147.696812) (xy 113.320472 147.679) (xy 112.819528 147.679) (xy 112.638682 147.696812) (xy 112.406637 147.767202) (xy 112.192784 147.881509) (xy 112.00534 148.03534) (xy 111.851509 148.222784) (xy 111.737202 148.436637) (xy 111.666812 148.668682) (xy 111.643044 148.91) (xy 110.681 148.91) (xy 110.681 148.788757) (xy 110.633693 148.550931) (xy 110.540898 148.326903) (xy 110.40618 148.125283) (xy 110.234717 147.95382) (xy 110.033097 147.819102) (xy 109.809069 147.726307) (xy 109.571243 147.679) (xy 109.328757 147.679) (xy 109.090931 147.726307) (xy 108.866903 147.819102) (xy 108.665283 147.95382) (xy 108.625 147.994103) (xy 108.584717 147.95382) (xy 108.383097 147.819102) (xy 108.159069 147.726307) (xy 107.921243 147.679) (xy 107.678757 147.679) (xy 107.440931 147.726307) (xy 107.216903 147.819102) (xy 107.015283 147.95382) (xy 106.84382 148.125283) (xy 106.709102 148.326903) (xy 106.616307 148.550931) (xy 106.569 148.788757) (xy 92.806 148.788757) (xy 92.806 146.248757) (xy 106.569 146.248757) (xy 106.569 146.491243) (xy 106.616307 146.729069) (xy 106.709102 146.953097) (xy 106.84382 147.154717) (xy 107.015283 147.32618) (xy 107.216903 147.460898) (xy 107.440931 147.553693) (xy 107.678757 147.601) (xy 107.921243 147.601) (xy 108.159069 147.553693) (xy 108.383097 147.460898) (xy 108.584717 147.32618) (xy 108.625 147.285897) (xy 108.665283 147.32618) (xy 108.866903 147.460898) (xy 109.090931 147.553693) (xy 109.328757 147.601) (xy 109.571243 147.601) (xy 109.809069 147.553693) (xy 110.033097 147.460898) (xy 110.234717 147.32618) (xy 110.40618 147.154717) (xy 110.540898 146.953097) (xy 110.633693 146.729069) (xy 110.681 146.491243) (xy 110.681 146.37) (xy 111.643044 146.37) (xy 111.666812 146.611318) (xy 111.737202 146.843363) (xy 111.851509 147.057216) (xy 112.00534 147.24466) (xy 112.192784 147.398491) (xy 112.406637 147.512798) (xy 112.638682 147.583188) (xy 112.819528 147.601) (xy 113.320472 147.601) (xy 113.501318 147.583188) (xy 113.733363 147.512798) (xy 113.947216 147.398491) (xy 114.13466 147.24466) (xy 114.288491 147.057216) (xy 114.402798 146.843363) (xy 114.473188 146.611318) (xy 114.496956 146.37) (xy 114.473188 146.128682) (xy 114.402798 145.896637) (xy 114.288491 145.682784) (xy 114.13466 145.49534) (xy 113.947216 145.341509) (xy 113.733363 145.227202) (xy 113.501318 145.156812) (xy 113.320472 145.139) (xy 112.819528 145.139) (xy 112.638682 145.156812) (xy 112.406637 145.227202) (xy 112.192784 145.341509) (xy 112.00534 145.49534) (xy 111.851509 145.682784) (xy 111.737202 145.896637) (xy 111.666812 146.128682) (xy 111.643044 146.37) (xy 110.681 146.37) (xy 110.681 146.248757) (xy 110.633693 146.010931) (xy 110.540898 145.786903) (xy 110.40618 145.585283) (xy 110.234717 145.41382) (xy 110.033097 145.279102) (xy 109.809069 145.186307) (xy 109.571243 145.139) (xy 109.328757 145.139) (xy 109.090931 145.186307) (xy 108.866903 145.279102) (xy 108.665283 145.41382) (xy 108.625 145.454103) (xy 108.584717 145.41382) (xy 108.383097 145.279102) (xy 108.159069 145.186307) (xy 107.921243 145.139) (xy 107.678757 145.139) (xy 107.440931 145.186307) (xy 107.216903 145.279102) (xy 107.015283 145.41382) (xy 106.84382 145.585283) (xy 106.709102 145.786903) (xy 106.616307 146.010931) (xy 106.569 146.248757) (xy 92.806 146.248757) (xy 92.806 138.6) (xy 165.760625 138.6) (xy 165.794047 138.939335) (xy 165.893027 139.26563) (xy 166.053763 139.566345) (xy 166.270076 139.829924) (xy 166.533655 140.046237) (xy 166.83437 140.206973) (xy 167.160665 140.305953) (xy 167.414968 140.331) (xy 168.585032 140.331) (xy 168.839335 140.305953) (xy 169.16563 140.206973) (xy 169.466345 140.046237) (xy 169.729924 139.829924) (xy 169.946237 139.566345) (xy 170.106973 139.26563) (xy 170.205953 138.939335) (xy 170.239375 138.6) (xy 170.205953 138.260665) (xy 170.106973 137.93437) (xy 169.946237 137.633655) (xy 169.729924 137.370076) (xy 169.466345 137.153763) (xy 169.16563 136.993027) (xy 168.839335 136.894047) (xy 168.585032 136.869) (xy 167.414968 136.869) (xy 167.160665 136.894047) (xy 166.83437 136.993027) (xy 166.533655 137.153763) (xy 166.270076 137.370076) (xy 166.053763 137.633655) (xy 165.893027 137.93437) (xy 165.794047 138.260665) (xy 165.760625 138.6) (xy 92.806 138.6) (xy 92.806 134.4) (xy 165.760625 134.4) (xy 165.794047 134.739335) (xy 165.893027 135.06563) (xy 166.053763 135.366345) (xy 166.270076 135.629924) (xy 166.533655 135.846237) (xy 166.83437 136.006973) (xy 167.160665 136.105953) (xy 167.414968 136.131) (xy 168.585032 136.131) (xy 168.839335 136.105953) (xy 169.16563 136.006973) (xy 169.466345 135.846237) (xy 169.729924 135.629924) (xy 169.946237 135.366345) (xy 170.106973 135.06563) (xy 170.205953 134.739335) (xy 170.239375 134.4) (xy 170.205953 134.060665) (xy 170.106973 133.73437) (xy 169.946237 133.433655) (xy 169.729924 133.170076) (xy 169.466345 132.953763) (xy 169.16563 132.793027) (xy 168.839335 132.694047) (xy 168.585032 132.669) (xy 167.414968 132.669) (xy 167.160665 132.694047) (xy 166.83437 132.793027) (xy 166.533655 132.953763) (xy 166.270076 133.170076) (xy 166.053763 133.433655) (xy 165.893027 133.73437) (xy 165.794047 134.060665) (xy 165.760625 134.4) (xy 92.806 134.4) (xy 92.806 131.693757) (xy 123.319 131.693757) (xy 123.319 131.936243) (xy 123.366307 132.174069) (xy 123.459102 132.398097) (xy 123.59382 132.599717) (xy 123.765283 132.77118) (xy 123.966903 132.905898) (xy 124.190931 132.998693) (xy 124.428757 133.046) (xy 124.671243 133.046) (xy 124.909069 132.998693) (xy 125.133097 132.905898) (xy 125.334717 132.77118) (xy 125.50618 132.599717) (xy 125.640898 132.398097) (xy 125.733693 132.174069) (xy 125.781 131.936243) (xy 125.781 131.693757) (xy 149.319 131.693757) (xy 149.319 131.936243) (xy 149.366307 132.174069) (xy 149.459102 132.398097) (xy 149.59382 132.599717) (xy 149.765283 132.77118) (xy 149.966903 132.905898) (xy 150.190931 132.998693) (xy 150.428757 133.046) (xy 150.671243 133.046) (xy 150.909069 132.998693) (xy 151.133097 132.905898) (xy 151.334717 132.77118) (xy 151.50618 132.599717) (xy 151.640898 132.398097) (xy 151.733693 132.174069) (xy 151.781 131.936243) (xy 151.781 131.693757) (xy 151.733693 131.455931) (xy 151.640898 131.231903) (xy 151.50618 131.030283) (xy 151.334717 130.85882) (xy 151.133097 130.724102) (xy 150.909069 130.631307) (xy 150.671243 130.584) (xy 150.428757 130.584) (xy 150.190931 130.631307) (xy 149.966903 130.724102) (xy 149.765283 130.85882) (xy 149.59382 131.030283) (xy 149.459102 131.231903) (xy 149.366307 131.455931) (xy 149.319 131.693757) (xy 125.781 131.693757) (xy 125.733693 131.455931) (xy 125.640898 131.231903) (xy 125.50618 131.030283) (xy 125.334717 130.85882) (xy 125.133097 130.724102) (xy 124.909069 130.631307) (xy 124.671243 130.584) (xy 124.428757 130.584) (xy 124.190931 130.631307) (xy 123.966903 130.724102) (xy 123.765283 130.85882) (xy 123.59382 131.030283) (xy 123.459102 131.231903) (xy 123.366307 131.455931) (xy 123.319 131.693757) (xy 92.806 131.693757) (xy 92.806 129.153757) (xy 123.319 129.153757) (xy 123.319 129.396243) (xy 123.366307 129.634069) (xy 123.459102 129.858097) (xy 123.59382 130.059717) (xy 123.765283 130.23118) (xy 123.966903 130.365898) (xy 124.190931 130.458693) (xy 124.428757 130.506) (xy 124.671243 130.506) (xy 124.909069 130.458693) (xy 125.133097 130.365898) (xy 125.334717 130.23118) (xy 125.50618 130.059717) (xy 125.640898 129.858097) (xy 125.733693 129.634069) (xy 125.781 129.396243) (xy 125.781 129.153757) (xy 149.319 129.153757) (xy 149.319 129.396243) (xy 149.366307 129.634069) (xy 149.459102 129.858097) (xy 149.59382 130.059717) (xy 149.765283 130.23118) (xy 149.966903 130.365898) (xy 150.190931 130.458693) (xy 150.428757 130.506) (xy 150.671243 130.506) (xy 150.909069 130.458693) (xy 151.133097 130.365898) (xy 151.334717 130.23118) (xy 151.50618 130.059717) (xy 151.640898 129.858097) (xy 151.733693 129.634069) (xy 151.781 129.396243) (xy 151.781 129.153757) (xy 151.733693 128.915931) (xy 151.640898 128.691903) (xy 151.50618 128.490283) (xy 151.334717 128.31882) (xy 151.133097 128.184102) (xy 150.909069 128.091307) (xy 150.671243 128.044) (xy 150.428757 128.044) (xy 150.190931 128.091307) (xy 149.966903 128.184102) (xy 149.765283 128.31882) (xy 149.59382 128.490283) (xy 149.459102 128.691903) (xy 149.366307 128.915931) (xy 149.319 129.153757) (xy 125.781 129.153757) (xy 125.733693 128.915931) (xy 125.640898 128.691903) (xy 125.50618 128.490283) (xy 125.334717 128.31882) (xy 125.133097 128.184102) (xy 124.909069 128.091307) (xy 124.671243 128.044) (xy 124.428757 128.044) (xy 124.190931 128.091307) (xy 123.966903 128.184102) (xy 123.765283 128.31882) (xy 123.59382 128.490283) (xy 123.459102 128.691903) (xy 123.366307 128.915931) (xy 123.319 129.153757) (xy 92.806 129.153757) (xy 92.806 123.56) (xy 120.357157 123.56) (xy 120.357157 126.1) (xy 120.388916 126.422454) (xy 120.482972 126.732516) (xy 120.635711 127.01827) (xy 120.841264 127.268736) (xy 121.09173 127.474289) (xy 121.377484 127.627028) (xy 121.687546 127.721084) (xy 122.01 127.752843) (xy 124.55 127.752843) (xy 124.872454 127.721084) (xy 125.182516 127.627028) (xy 125.46827 127.474289) (xy 125.718736 127.268736) (xy 125.924289 127.01827) (xy 126.077028 126.732516) (xy 126.171084 126.422454) (xy 126.202843 126.1) (xy 126.202843 126.037852) (xy 143.049 126.037852) (xy 143.049 126.162148) (xy 143.073249 126.284056) (xy 143.120815 126.398891) (xy 143.18987 126.502239) (xy 143.277761 126.59013) (xy 143.381109 126.659185) (xy 143.495944 126.706751) (xy 143.617852 126.731) (xy 143.742148 126.731) (xy 143.864056 126.706751) (xy 143.978891 126.659185) (xy 144.055495 126.608) (xy 148.985201 126.608) (xy 149.022972 126.732516) (xy 149.175711 127.01827) (xy 149.381264 127.268736) (xy 149.63173 127.474289) (xy 149.917484 127.627028) (xy 150.227546 127.721084) (xy 150.55 127.752843) (xy 153.09 127.752843) (xy 153.17689 127.744285) (xy 153.26683 127.792359) (xy 153.415794 127.91461) (xy 157.278618 131.777434) (xy 157.306323 131.802543) (xy 157.498774 131.960483) (xy 157.560874 132.001978) (xy 157.78044 132.119339) (xy 157.849445 132.147921) (xy 158.087689 132.220191) (xy 158.160942 132.234762) (xy 158.408706 132.259165) (xy 158.446051 132.261) (xy 172.61 132.261) (xy 172.643206 132.25955) (xy 172.863739 132.240256) (xy 172.929142 132.228724) (xy 173.142975 132.171428) (xy 173.205385 132.148713) (xy 173.406019 132.055155) (xy 173.463533 132.021949) (xy 173.644873 131.894973) (xy 173.695748 131.852284) (xy 173.852284 131.695748) (xy 173.894973 131.644873) (xy 174.021949 131.463533) (xy 174.055155 131.406019) (xy 174.148713 131.205385) (xy 174.171428 131.142975) (xy 174.184193 131.095334) (xy 174.306973 130.86563) (xy 174.405953 130.539335) (xy 174.439375 130.2) (xy 174.405953 129.860665) (xy 174.306973 129.53437) (xy 174.261 129.448361) (xy 174.261 126.751639) (xy 174.306973 126.66563) (xy 174.405953 126.339335) (xy 174.439375 126) (xy 174.405953 125.660665) (xy 174.306973 125.33437) (xy 174.184193 125.104666) (xy 174.171428 125.057025) (xy 174.148713 124.994615) (xy 174.055155 124.793981) (xy 174.021949 124.736467) (xy 173.894973 124.555127) (xy 173.852284 124.504252) (xy 173.695748 124.347716) (xy 173.644873 124.305027) (xy 173.463533 124.178051) (xy 173.406019 124.144845) (xy 173.205385 124.051287) (xy 173.142975 124.028572) (xy 172.929142 123.971276) (xy 172.863739 123.959744) (xy 172.643206 123.94045) (xy 172.61 123.939) (xy 166.864765 123.939) (xy 166.672976 123.92011) (xy 166.506555 123.869627) (xy 166.35317 123.787641) (xy 166.204206 123.66539) (xy 165.281382 122.742566) (xy 165.253677 122.717457) (xy 165.061226 122.559517) (xy 164.999126 122.518022) (xy 164.77956 122.400661) (xy 164.710555 122.372079) (xy 164.472311 122.299809) (xy 164.399058 122.285238) (xy 164.151294 122.260835) (xy 164.113949 122.259) (xy 154.097573 122.259) (xy 154.00827 122.185711) (xy 153.722516 122.032972) (xy 153.412454 121.938916) (xy 153.09 121.907157) (xy 150.55 121.907157) (xy 150.227546 121.938916) (xy 149.917484 122.032972) (xy 149.63173 122.185711) (xy 149.381264 122.391264) (xy 149.175711 122.64173) (xy 149.022972 122.927484) (xy 148.928916 123.237546) (xy 148.897157 123.56) (xy 148.897157 125.592) (xy 144.055495 125.592) (xy 143.978891 125.540815) (xy 143.864056 125.493249) (xy 143.742148 125.469) (xy 143.617852 125.469) (xy 143.495944 125.493249) (xy 143.381109 125.540815) (xy 143.277761 125.60987) (xy 143.18987 125.697761) (xy 143.120815 125.801109) (xy 143.073249 125.915944) (xy 143.049 126.037852) (xy 126.202843 126.037852) (xy 126.202843 123.56) (xy 126.171084 123.237546) (xy 126.077028 122.927484) (xy 125.924289 122.64173) (xy 125.718736 122.391264) (xy 125.46827 122.185711) (xy 125.182516 122.032972) (xy 124.872454 121.938916) (xy 124.55 121.907157) (xy 122.01 121.907157) (xy 121.687546 121.938916) (xy 121.377484 122.032972) (xy 121.09173 122.185711) (xy 120.841264 122.391264) (xy 120.635711 122.64173) (xy 120.482972 122.927484) (xy 120.388916 123.237546) (xy 120.357157 123.56) (xy 92.806 123.56) (xy 92.806 121.8) (xy 165.760625 121.8) (xy 165.794047 122.139335) (xy 165.893027 122.46563) (xy 166.053763 122.766345) (xy 166.270076 123.029924) (xy 166.533655 123.246237) (xy 166.83437 123.406973) (xy 167.160665 123.505953) (xy 167.414968 123.531) (xy 168.585032 123.531) (xy 168.839335 123.505953) (xy 169.16563 123.406973) (xy 169.466345 123.246237) (xy 169.729924 123.029924) (xy 169.946237 122.766345) (xy 170.1 122.478676) (xy 170.253763 122.766345) (xy 170.470076 123.029924) (xy 170.733655 123.246237) (xy 171.03437 123.406973) (xy 171.360665 123.505953) (xy 171.614968 123.531) (xy 172.785032 123.531) (xy 173.039335 123.505953) (xy 173.36563 123.406973) (xy 173.666345 123.246237) (xy 173.929924 123.029924) (xy 174.146237 122.766345) (xy 174.306973 122.46563) (xy 174.405953 122.139335) (xy 174.439375 121.8) (xy 174.405953 121.460665) (xy 174.306973 121.13437) (xy 174.146237 120.833655) (xy 173.929924 120.570076) (xy 173.666345 120.353763) (xy 173.36563 120.193027) (xy 173.039335 120.094047) (xy 172.785032 120.069) (xy 171.614968 120.069) (xy 171.360665 120.094047) (xy 171.03437 120.193027) (xy 170.733655 120.353763) (xy 170.470076 120.570076) (xy 170.253763 120.833655) (xy 170.1 121.121324) (xy 169.946237 120.833655) (xy 169.729924 120.570076) (xy 169.466345 120.353763) (xy 169.16563 120.193027) (xy 168.839335 120.094047) (xy 168.585032 120.069) (xy 167.414968 120.069) (xy 167.160665 120.094047) (xy 166.83437 120.193027) (xy 166.533655 120.353763) (xy 166.270076 120.570076) (xy 166.053763 120.833655) (xy 165.893027 121.13437) (xy 165.794047 121.460665) (xy 165.760625 121.8) (xy 92.806 121.8) (xy 92.806 117.6) (xy 165.760625 117.6) (xy 165.794047 117.939335) (xy 165.893027 118.26563) (xy 166.053763 118.566345) (xy 166.270076 118.829924) (xy 166.533655 119.046237) (xy 166.83437 119.206973) (xy 167.160665 119.305953) (xy 167.414968 119.331) (xy 168.585032 119.331) (xy 168.839335 119.305953) (xy 169.16563 119.206973) (xy 169.466345 119.046237) (xy 169.729924 118.829924) (xy 169.946237 118.566345) (xy 170.1 118.278676) (xy 170.253763 118.566345) (xy 170.470076 118.829924) (xy 170.733655 119.046237) (xy 171.03437 119.206973) (xy 171.360665 119.305953) (xy 171.614968 119.331) (xy 172.785032 119.331) (xy 173.039335 119.305953) (xy 173.36563 119.206973) (xy 173.666345 119.046237) (xy 173.929924 118.829924) (xy 174.146237 118.566345) (xy 174.306973 118.26563) (xy 174.405953 117.939335) (xy 174.439375 117.6) (xy 174.405953 117.260665) (xy 174.306973 116.93437) (xy 174.146237 116.633655) (xy 173.929924 116.370076) (xy 173.666345 116.153763) (xy 173.36563 115.993027) (xy 173.039335 115.894047) (xy 172.785032 115.869) (xy 171.614968 115.869) (xy 171.360665 115.894047) (xy 171.03437 115.993027) (xy 170.733655 116.153763) (xy 170.470076 116.370076) (xy 170.253763 116.633655) (xy 170.1 116.921324) (xy 169.946237 116.633655) (xy 169.729924 116.370076) (xy 169.466345 116.153763) (xy 169.16563 115.993027) (xy 168.839335 115.894047) (xy 168.585032 115.869) (xy 167.414968 115.869) (xy 167.160665 115.894047) (xy 166.83437 115.993027) (xy 166.533655 116.153763) (xy 166.270076 116.370076) (xy 166.053763 116.633655) (xy 165.893027 116.93437) (xy 165.794047 117.260665) (xy 165.760625 117.6) (xy 92.806 117.6) (xy 92.806 113.4) (xy 165.760625 113.4) (xy 165.794047 113.739335) (xy 165.893027 114.06563) (xy 166.053763 114.366345) (xy 166.270076 114.629924) (xy 166.533655 114.846237) (xy 166.83437 115.006973) (xy 167.160665 115.105953) (xy 167.414968 115.131) (xy 168.585032 115.131) (xy 168.839335 115.105953) (xy 169.16563 115.006973) (xy 169.466345 114.846237) (xy 169.729924 114.629924) (xy 169.946237 114.366345) (xy 169.967157 114.327207) (xy 169.967157 114.4989) (xy 169.979338 114.622576) (xy 170.015413 114.741499) (xy 170.073996 114.8511) (xy 170.152835 114.947165) (xy 170.2489 115.026004) (xy 170.358501 115.084587) (xy 170.477424 115.120662) (xy 170.6011 115.132843) (xy 173.7989 115.132843) (xy 173.922576 115.120662) (xy 174.041499 115.084587) (xy 174.1511 115.026004) (xy 174.247165 114.947165) (xy 174.326004 114.8511) (xy 174.384587 114.741499) (xy 174.420662 114.622576) (xy 174.432843 114.4989) (xy 174.432843 112.3011) (xy 174.420662 112.177424) (xy 174.384587 112.058501) (xy 174.326004 111.9489) (xy 174.247165 111.852835) (xy 174.1511 111.773996) (xy 174.041499 111.715413) (xy 173.922576 111.679338) (xy 173.7989 111.667157) (xy 170.6011 111.667157) (xy 170.477424 111.679338) (xy 170.358501 111.715413) (xy 170.2489 111.773996) (xy 170.152835 111.852835) (xy 170.073996 111.9489) (xy 170.015413 112.058501) (xy 169.979338 112.177424) (xy 169.967157 112.3011) (xy 169.967157 112.472793) (xy 169.946237 112.433655) (xy 169.729924 112.170076) (xy 169.466345 111.953763) (xy 169.16563 111.793027) (xy 168.839335 111.694047) (xy 168.585032 111.669) (xy 167.414968 111.669) (xy 167.160665 111.694047) (xy 166.83437 111.793027) (xy 166.533655 111.953763) (xy 166.270076 112.170076) (xy 166.053763 112.433655) (xy 165.893027 112.73437) (xy 165.794047 113.060665) (xy 165.760625 113.4) (xy 92.806 113.4) (xy 92.806 110.688757) (xy 106.569 110.688757) (xy 106.569 110.931243) (xy 106.616307 111.169069) (xy 106.709102 111.393097) (xy 106.84382 111.594717) (xy 107.015283 111.76618) (xy 107.216903 111.900898) (xy 107.440931 111.993693) (xy 107.678757 112.041) (xy 107.921243 112.041) (xy 108.159069 111.993693) (xy 108.383097 111.900898) (xy 108.584717 111.76618) (xy 108.625 111.725897) (xy 108.665283 111.76618) (xy 108.866903 111.900898) (xy 109.090931 111.993693) (xy 109.328757 112.041) (xy 109.571243 112.041) (xy 109.809069 111.993693) (xy 110.033097 111.900898) (xy 110.234717 111.76618) (xy 110.40618 111.594717) (xy 110.540898 111.393097) (xy 110.633693 111.169069) (xy 110.681 110.931243) (xy 110.681 110.81) (xy 111.643044 110.81) (xy 111.666812 111.051318) (xy 111.737202 111.283363) (xy 111.851509 111.497216) (xy 112.00534 111.68466) (xy 112.192784 111.838491) (xy 112.406637 111.952798) (xy 112.638682 112.023188) (xy 112.819528 112.041) (xy 113.320472 112.041) (xy 113.501318 112.023188) (xy 113.733363 111.952798) (xy 113.947216 111.838491) (xy 114.13466 111.68466) (xy 114.288491 111.497216) (xy 114.402798 111.283363) (xy 114.473188 111.051318) (xy 114.496956 110.81) (xy 114.473188 110.568682) (xy 114.402798 110.336637) (xy 114.288491 110.122784) (xy 114.13466 109.93534) (xy 113.947216 109.781509) (xy 113.733363 109.667202) (xy 113.501318 109.596812) (xy 113.320472 109.579) (xy 112.819528 109.579) (xy 112.638682 109.596812) (xy 112.406637 109.667202) (xy 112.192784 109.781509) (xy 112.00534 109.93534) (xy 111.851509 110.122784) (xy 111.737202 110.336637) (xy 111.666812 110.568682) (xy 111.643044 110.81) (xy 110.681 110.81) (xy 110.681 110.688757) (xy 110.633693 110.450931) (xy 110.540898 110.226903) (xy 110.40618 110.025283) (xy 110.234717 109.85382) (xy 110.033097 109.719102) (xy 109.809069 109.626307) (xy 109.571243 109.579) (xy 109.328757 109.579) (xy 109.090931 109.626307) (xy 108.866903 109.719102) (xy 108.665283 109.85382) (xy 108.625 109.894103) (xy 108.584717 109.85382) (xy 108.383097 109.719102) (xy 108.159069 109.626307) (xy 107.921243 109.579) (xy 107.678757 109.579) (xy 107.440931 109.626307) (xy 107.216903 109.719102) (xy 107.015283 109.85382) (xy 106.84382 110.025283) (xy 106.709102 110.226903) (xy 106.616307 110.450931) (xy 106.569 110.688757) (xy 92.806 110.688757) (xy 92.806 108.148757) (xy 106.569 108.148757) (xy 106.569 108.391243) (xy 106.616307 108.629069) (xy 106.709102 108.853097) (xy 106.84382 109.054717) (xy 107.015283 109.22618) (xy 107.216903 109.360898) (xy 107.440931 109.453693) (xy 107.678757 109.501) (xy 107.921243 109.501) (xy 108.159069 109.453693) (xy 108.383097 109.360898) (xy 108.584717 109.22618) (xy 108.625 109.185897) (xy 108.665283 109.22618) (xy 108.866903 109.360898) (xy 109.090931 109.453693) (xy 109.328757 109.501) (xy 109.571243 109.501) (xy 109.809069 109.453693) (xy 110.033097 109.360898) (xy 110.234717 109.22618) (xy 110.40618 109.054717) (xy 110.540898 108.853097) (xy 110.633693 108.629069) (xy 110.681 108.391243) (xy 110.681 108.27) (xy 111.643044 108.27) (xy 111.666812 108.511318) (xy 111.737202 108.743363) (xy 111.851509 108.957216) (xy 112.00534 109.14466) (xy 112.192784 109.298491) (xy 112.406637 109.412798) (xy 112.638682 109.483188) (xy 112.819528 109.501) (xy 113.320472 109.501) (xy 113.501318 109.483188) (xy 113.733363 109.412798) (xy 113.947216 109.298491) (xy 114.13466 109.14466) (xy 114.288491 108.957216) (xy 114.354481 108.833757) (xy 123.319 108.833757) (xy 123.319 109.076243) (xy 123.366307 109.314069) (xy 123.459102 109.538097) (xy 123.59382 109.739717) (xy 123.765283 109.91118) (xy 123.966903 110.045898) (xy 124.190931 110.138693) (xy 124.428757 110.186) (xy 124.671243 110.186) (xy 124.909069 110.138693) (xy 125.133097 110.045898) (xy 125.334717 109.91118) (xy 125.50618 109.739717) (xy 125.640898 109.538097) (xy 125.733693 109.314069) (xy 125.781 109.076243) (xy 125.781 108.833757) (xy 149.319 108.833757) (xy 149.319 109.076243) (xy 149.366307 109.314069) (xy 149.459102 109.538097) (xy 149.59382 109.739717) (xy 149.765283 109.91118) (xy 149.966903 110.045898) (xy 150.190931 110.138693) (xy 150.428757 110.186) (xy 150.671243 110.186) (xy 150.909069 110.138693) (xy 151.133097 110.045898) (xy 151.334717 109.91118) (xy 151.50618 109.739717) (xy 151.640898 109.538097) (xy 151.733693 109.314069) (xy 151.781 109.076243) (xy 151.781 108.833757) (xy 151.733693 108.595931) (xy 151.640898 108.371903) (xy 151.50618 108.170283) (xy 151.334717 107.99882) (xy 151.133097 107.864102) (xy 150.909069 107.771307) (xy 150.671243 107.724) (xy 150.428757 107.724) (xy 150.190931 107.771307) (xy 149.966903 107.864102) (xy 149.765283 107.99882) (xy 149.59382 108.170283) (xy 149.459102 108.371903) (xy 149.366307 108.595931) (xy 149.319 108.833757) (xy 125.781 108.833757) (xy 125.733693 108.595931) (xy 125.640898 108.371903) (xy 125.50618 108.170283) (xy 125.334717 107.99882) (xy 125.133097 107.864102) (xy 124.909069 107.771307) (xy 124.671243 107.724) (xy 124.428757 107.724) (xy 124.190931 107.771307) (xy 123.966903 107.864102) (xy 123.765283 107.99882) (xy 123.59382 108.170283) (xy 123.459102 108.371903) (xy 123.366307 108.595931) (xy 123.319 108.833757) (xy 114.354481 108.833757) (xy 114.402798 108.743363) (xy 114.473188 108.511318) (xy 114.496956 108.27) (xy 114.473188 108.028682) (xy 114.402798 107.796637) (xy 114.288491 107.582784) (xy 114.13466 107.39534) (xy 113.947216 107.241509) (xy 113.733363 107.127202) (xy 113.501318 107.056812) (xy 113.320472 107.039) (xy 112.819528 107.039) (xy 112.638682 107.056812) (xy 112.406637 107.127202) (xy 112.192784 107.241509) (xy 112.00534 107.39534) (xy 111.851509 107.582784) (xy 111.737202 107.796637) (xy 111.666812 108.028682) (xy 111.643044 108.27) (xy 110.681 108.27) (xy 110.681 108.148757) (xy 110.633693 107.910931) (xy 110.540898 107.686903) (xy 110.40618 107.485283) (xy 110.234717 107.31382) (xy 110.033097 107.179102) (xy 109.809069 107.086307) (xy 109.571243 107.039) (xy 109.328757 107.039) (xy 109.090931 107.086307) (xy 108.866903 107.179102) (xy 108.665283 107.31382) (xy 108.625 107.354103) (xy 108.584717 107.31382) (xy 108.383097 107.179102) (xy 108.159069 107.086307) (xy 107.921243 107.039) (xy 107.678757 107.039) (xy 107.440931 107.086307) (xy 107.216903 107.179102) (xy 107.015283 107.31382) (xy 106.84382 107.485283) (xy 106.709102 107.686903) (xy 106.616307 107.910931) (xy 106.569 108.148757) (xy 92.806 108.148757) (xy 92.806 105.608757) (xy 106.569 105.608757) (xy 106.569 105.851243) (xy 106.616307 106.089069) (xy 106.709102 106.313097) (xy 106.84382 106.514717) (xy 107.015283 106.68618) (xy 107.216903 106.820898) (xy 107.440931 106.913693) (xy 107.678757 106.961) (xy 107.921243 106.961) (xy 108.159069 106.913693) (xy 108.383097 106.820898) (xy 108.584717 106.68618) (xy 108.625 106.645897) (xy 108.665283 106.68618) (xy 108.866903 106.820898) (xy 109.090931 106.913693) (xy 109.328757 106.961) (xy 109.571243 106.961) (xy 109.809069 106.913693) (xy 110.033097 106.820898) (xy 110.234717 106.68618) (xy 110.40618 106.514717) (xy 110.540898 106.313097) (xy 110.633693 106.089069) (xy 110.681 105.851243) (xy 110.681 105.73) (xy 111.643044 105.73) (xy 111.666812 105.971318) (xy 111.737202 106.203363) (xy 111.851509 106.417216) (xy 112.00534 106.60466) (xy 112.192784 106.758491) (xy 112.406637 106.872798) (xy 112.638682 106.943188) (xy 112.819528 106.961) (xy 113.320472 106.961) (xy 113.501318 106.943188) (xy 113.733363 106.872798) (xy 113.947216 106.758491) (xy 114.13466 106.60466) (xy 114.288491 106.417216) (xy 114.354481 106.293757) (xy 123.319 106.293757) (xy 123.319 106.536243) (xy 123.366307 106.774069) (xy 123.459102 106.998097) (xy 123.59382 107.199717) (xy 123.765283 107.37118) (xy 123.966903 107.505898) (xy 124.190931 107.598693) (xy 124.428757 107.646) (xy 124.671243 107.646) (xy 124.909069 107.598693) (xy 125.133097 107.505898) (xy 125.334717 107.37118) (xy 125.50618 107.199717) (xy 125.640898 106.998097) (xy 125.733693 106.774069) (xy 125.781 106.536243) (xy 125.781 106.293757) (xy 149.319 106.293757) (xy 149.319 106.536243) (xy 149.366307 106.774069) (xy 149.459102 106.998097) (xy 149.59382 107.199717) (xy 149.765283 107.37118) (xy 149.966903 107.505898) (xy 150.190931 107.598693) (xy 150.428757 107.646) (xy 150.671243 107.646) (xy 150.909069 107.598693) (xy 151.133097 107.505898) (xy 151.334717 107.37118) (xy 151.50618 107.199717) (xy 151.640898 106.998097) (xy 151.733693 106.774069) (xy 151.781 106.536243) (xy 151.781 106.293757) (xy 151.733693 106.055931) (xy 151.640898 105.831903) (xy 151.50618 105.630283) (xy 151.334717 105.45882) (xy 151.133097 105.324102) (xy 150.909069 105.231307) (xy 150.671243 105.184) (xy 150.428757 105.184) (xy 150.190931 105.231307) (xy 149.966903 105.324102) (xy 149.765283 105.45882) (xy 149.59382 105.630283) (xy 149.459102 105.831903) (xy 149.366307 106.055931) (xy 149.319 106.293757) (xy 125.781 106.293757) (xy 125.733693 106.055931) (xy 125.640898 105.831903) (xy 125.50618 105.630283) (xy 125.334717 105.45882) (xy 125.133097 105.324102) (xy 124.909069 105.231307) (xy 124.671243 105.184) (xy 124.428757 105.184) (xy 124.190931 105.231307) (xy 123.966903 105.324102) (xy 123.765283 105.45882) (xy 123.59382 105.630283) (xy 123.459102 105.831903) (xy 123.366307 106.055931) (xy 123.319 106.293757) (xy 114.354481 106.293757) (xy 114.402798 106.203363) (xy 114.473188 105.971318) (xy 114.496956 105.73) (xy 114.473188 105.488682) (xy 114.402798 105.256637) (xy 114.288491 105.042784) (xy 114.25338 105) (xy 165.760625 105) (xy 165.794047 105.339335) (xy 165.893027 105.66563) (xy 166.053763 105.966345) (xy 166.270076 106.229924) (xy 166.533655 106.446237) (xy 166.83437 106.606973) (xy 167.160665 106.705953) (xy 167.414968 106.731) (xy 168.585032 106.731) (xy 168.839335 106.705953) (xy 169.16563 106.606973) (xy 169.466345 106.446237) (xy 169.729924 106.229924) (xy 169.946237 105.966345) (xy 170.1 105.678676) (xy 170.253763 105.966345) (xy 170.470076 106.229924) (xy 170.733655 106.446237) (xy 171.03437 106.606973) (xy 171.360665 106.705953) (xy 171.614968 106.731) (xy 172.785032 106.731) (xy 173.039335 106.705953) (xy 173.36563 106.606973) (xy 173.666345 106.446237) (xy 173.929924 106.229924) (xy 174.146237 105.966345) (xy 174.306973 105.66563) (xy 174.405953 105.339335) (xy 174.439375 105) (xy 174.405953 104.660665) (xy 174.306973 104.33437) (xy 174.146237 104.033655) (xy 173.929924 103.770076) (xy 173.666345 103.553763) (xy 173.36563 103.393027) (xy 173.039335 103.294047) (xy 172.785032 103.269) (xy 171.614968 103.269) (xy 171.360665 103.294047) (xy 171.03437 103.393027) (xy 170.733655 103.553763) (xy 170.470076 103.770076) (xy 170.253763 104.033655) (xy 170.1 104.321324) (xy 169.946237 104.033655) (xy 169.729924 103.770076) (xy 169.466345 103.553763) (xy 169.16563 103.393027) (xy 168.839335 103.294047) (xy 168.585032 103.269) (xy 167.414968 103.269) (xy 167.160665 103.294047) (xy 166.83437 103.393027) (xy 166.533655 103.553763) (xy 166.270076 103.770076) (xy 166.053763 104.033655) (xy 165.893027 104.33437) (xy 165.794047 104.660665) (xy 165.760625 105) (xy 114.25338 105) (xy 114.13466 104.85534) (xy 113.947216 104.701509) (xy 113.733363 104.587202) (xy 113.501318 104.516812) (xy 113.320472 104.499) (xy 112.819528 104.499) (xy 112.638682 104.516812) (xy 112.406637 104.587202) (xy 112.192784 104.701509) (xy 112.00534 104.85534) (xy 111.851509 105.042784) (xy 111.737202 105.256637) (xy 111.666812 105.488682) (xy 111.643044 105.73) (xy 110.681 105.73) (xy 110.681 105.608757) (xy 110.633693 105.370931) (xy 110.540898 105.146903) (xy 110.40618 104.945283) (xy 110.234717 104.77382) (xy 110.033097 104.639102) (xy 109.809069 104.546307) (xy 109.571243 104.499) (xy 109.328757 104.499) (xy 109.090931 104.546307) (xy 108.866903 104.639102) (xy 108.665283 104.77382) (xy 108.625 104.814103) (xy 108.584717 104.77382) (xy 108.383097 104.639102) (xy 108.159069 104.546307) (xy 107.921243 104.499) (xy 107.678757 104.499) (xy 107.440931 104.546307) (xy 107.216903 104.639102) (xy 107.015283 104.77382) (xy 106.84382 104.945283) (xy 106.709102 105.146903) (xy 106.616307 105.370931) (xy 106.569 105.608757) (xy 92.806 105.608757) (xy 92.806 103.068757) (xy 106.569 103.068757) (xy 106.569 103.311243) (xy 106.616307 103.549069) (xy 106.709102 103.773097) (xy 106.84382 103.974717) (xy 107.015283 104.14618) (xy 107.216903 104.280898) (xy 107.440931 104.373693) (xy 107.678757 104.421) (xy 107.921243 104.421) (xy 108.159069 104.373693) (xy 108.383097 104.280898) (xy 108.584717 104.14618) (xy 108.625 104.105897) (xy 108.665283 104.14618) (xy 108.866903 104.280898) (xy 109.090931 104.373693) (xy 109.328757 104.421) (xy 109.571243 104.421) (xy 109.809069 104.373693) (xy 110.033097 104.280898) (xy 110.234717 104.14618) (xy 110.40618 103.974717) (xy 110.540898 103.773097) (xy 110.633693 103.549069) (xy 110.681 103.311243) (xy 110.681 103.19) (xy 111.643044 103.19) (xy 111.666812 103.431318) (xy 111.737202 103.663363) (xy 111.851509 103.877216) (xy 112.00534 104.06466) (xy 112.192784 104.218491) (xy 112.406637 104.332798) (xy 112.638682 104.403188) (xy 112.819528 104.421) (xy 113.320472 104.421) (xy 113.501318 104.403188) (xy 113.733363 104.332798) (xy 113.947216 104.218491) (xy 114.13466 104.06466) (xy 114.288491 103.877216) (xy 114.402798 103.663363) (xy 114.473188 103.431318) (xy 114.496956 103.19) (xy 114.473188 102.948682) (xy 114.402798 102.716637) (xy 114.288491 102.502784) (xy 114.13466 102.31534) (xy 113.947216 102.161509) (xy 113.733363 102.047202) (xy 113.501318 101.976812) (xy 113.320472 101.959) (xy 112.819528 101.959) (xy 112.638682 101.976812) (xy 112.406637 102.047202) (xy 112.192784 102.161509) (xy 112.00534 102.31534) (xy 111.851509 102.502784) (xy 111.737202 102.716637) (xy 111.666812 102.948682) (xy 111.643044 103.19) (xy 110.681 103.19) (xy 110.681 103.068757) (xy 110.633693 102.830931) (xy 110.540898 102.606903) (xy 110.40618 102.405283) (xy 110.234717 102.23382) (xy 110.033097 102.099102) (xy 109.809069 102.006307) (xy 109.571243 101.959) (xy 109.328757 101.959) (xy 109.090931 102.006307) (xy 108.866903 102.099102) (xy 108.665283 102.23382) (xy 108.625 102.274103) (xy 108.584717 102.23382) (xy 108.383097 102.099102) (xy 108.159069 102.006307) (xy 107.921243 101.959) (xy 107.678757 101.959) (xy 107.440931 102.006307) (xy 107.216903 102.099102) (xy 107.015283 102.23382) (xy 106.84382 102.405283) (xy 106.709102 102.606903) (xy 106.616307 102.830931) (xy 106.569 103.068757) (xy 92.806 103.068757) (xy 92.806 100.528757) (xy 106.569 100.528757) (xy 106.569 100.771243) (xy 106.616307 101.009069) (xy 106.709102 101.233097) (xy 106.84382 101.434717) (xy 107.015283 101.60618) (xy 107.216903 101.740898) (xy 107.440931 101.833693) (xy 107.678757 101.881) (xy 107.921243 101.881) (xy 108.159069 101.833693) (xy 108.383097 101.740898) (xy 108.584717 101.60618) (xy 108.625 101.565897) (xy 108.665283 101.60618) (xy 108.866903 101.740898) (xy 109.090931 101.833693) (xy 109.328757 101.881) (xy 109.571243 101.881) (xy 109.809069 101.833693) (xy 110.033097 101.740898) (xy 110.234717 101.60618) (xy 110.40618 101.434717) (xy 110.540898 101.233097) (xy 110.633693 101.009069) (xy 110.681 100.771243) (xy 110.681 100.65) (xy 111.643044 100.65) (xy 111.666812 100.891318) (xy 111.737202 101.123363) (xy 111.851509 101.337216) (xy 112.00534 101.52466) (xy 112.192784 101.678491) (xy 112.406637 101.792798) (xy 112.638682 101.863188) (xy 112.819528 101.881) (xy 113.320472 101.881) (xy 113.501318 101.863188) (xy 113.733363 101.792798) (xy 113.947216 101.678491) (xy 114.13466 101.52466) (xy 114.288491 101.337216) (xy 114.402798 101.123363) (xy 114.473188 100.891318) (xy 114.482182 100.8) (xy 165.760625 100.8) (xy 165.794047 101.139335) (xy 165.893027 101.46563) (xy 166.053763 101.766345) (xy 166.270076 102.029924) (xy 166.533655 102.246237) (xy 166.83437 102.406973) (xy 167.160665 102.505953) (xy 167.414968 102.531) (xy 168.585032 102.531) (xy 168.839335 102.505953) (xy 169.16563 102.406973) (xy 169.466345 102.246237) (xy 169.729924 102.029924) (xy 169.946237 101.766345) (xy 170.106973 101.46563) (xy 170.205953 101.139335) (xy 170.239375 100.8) (xy 170.205953 100.460665) (xy 170.106973 100.13437) (xy 169.946237 99.833655) (xy 169.729924 99.570076) (xy 169.466345 99.353763) (xy 169.16563 99.193027) (xy 168.839335 99.094047) (xy 168.585032 99.069) (xy 167.414968 99.069) (xy 167.160665 99.094047) (xy 166.83437 99.193027) (xy 166.533655 99.353763) (xy 166.270076 99.570076) (xy 166.053763 99.833655) (xy 165.893027 100.13437) (xy 165.794047 100.460665) (xy 165.760625 100.8) (xy 114.482182 100.8) (xy 114.496956 100.65) (xy 114.473188 100.408682) (xy 114.402798 100.176637) (xy 114.288491 99.962784) (xy 114.13466 99.77534) (xy 113.947216 99.621509) (xy 113.733363 99.507202) (xy 113.501318 99.436812) (xy 113.320472 99.419) (xy 112.819528 99.419) (xy 112.638682 99.436812) (xy 112.406637 99.507202) (xy 112.192784 99.621509) (xy 112.00534 99.77534) (xy 111.851509 99.962784) (xy 111.737202 100.176637) (xy 111.666812 100.408682) (xy 111.643044 100.65) (xy 110.681 100.65) (xy 110.681 100.528757) (xy 110.633693 100.290931) (xy 110.540898 100.066903) (xy 110.40618 99.865283) (xy 110.234717 99.69382) (xy 110.033097 99.559102) (xy 109.809069 99.466307) (xy 109.571243 99.419) (xy 109.328757 99.419) (xy 109.090931 99.466307) (xy 108.866903 99.559102) (xy 108.665283 99.69382) (xy 108.625 99.734103) (xy 108.584717 99.69382) (xy 108.383097 99.559102) (xy 108.159069 99.466307) (xy 107.921243 99.419) (xy 107.678757 99.419) (xy 107.440931 99.466307) (xy 107.216903 99.559102) (xy 107.015283 99.69382) (xy 106.84382 99.865283) (xy 106.709102 100.066903) (xy 106.616307 100.290931) (xy 106.569 100.528757) (xy 92.806 100.528757) (xy 92.806 97.988757) (xy 106.569 97.988757) (xy 106.569 98.231243) (xy 106.616307 98.469069) (xy 106.709102 98.693097) (xy 106.84382 98.894717) (xy 107.015283 99.06618) (xy 107.216903 99.200898) (xy 107.440931 99.293693) (xy 107.678757 99.341) (xy 107.921243 99.341) (xy 108.159069 99.293693) (xy 108.383097 99.200898) (xy 108.584717 99.06618) (xy 108.625 99.025897) (xy 108.665283 99.06618) (xy 108.866903 99.200898) (xy 109.090931 99.293693) (xy 109.328757 99.341) (xy 109.571243 99.341) (xy 109.809069 99.293693) (xy 110.033097 99.200898) (xy 110.234717 99.06618) (xy 110.40618 98.894717) (xy 110.540898 98.693097) (xy 110.633693 98.469069) (xy 110.681 98.231243) (xy 110.681 98.11) (xy 111.643044 98.11) (xy 111.666812 98.351318) (xy 111.737202 98.583363) (xy 111.851509 98.797216) (xy 112.00534 98.98466) (xy 112.192784 99.138491) (xy 112.406637 99.252798) (xy 112.638682 99.323188) (xy 112.819528 99.341) (xy 113.320472 99.341) (xy 113.501318 99.323188) (xy 113.733363 99.252798) (xy 113.947216 99.138491) (xy 114.13466 98.98466) (xy 114.288491 98.797216) (xy 114.402798 98.583363) (xy 114.473188 98.351318) (xy 114.496956 98.11) (xy 114.473188 97.868682) (xy 114.402798 97.636637) (xy 114.288491 97.422784) (xy 114.13466 97.23534) (xy 113.947216 97.081509) (xy 113.733363 96.967202) (xy 113.501318 96.896812) (xy 113.320472 96.879) (xy 112.819528 96.879) (xy 112.638682 96.896812) (xy 112.406637 96.967202) (xy 112.192784 97.081509) (xy 112.00534 97.23534) (xy 111.851509 97.422784) (xy 111.737202 97.636637) (xy 111.666812 97.868682) (xy 111.643044 98.11) (xy 110.681 98.11) (xy 110.681 97.988757) (xy 110.633693 97.750931) (xy 110.540898 97.526903) (xy 110.40618 97.325283) (xy 110.234717 97.15382) (xy 110.033097 97.019102) (xy 109.809069 96.926307) (xy 109.571243 96.879) (xy 109.328757 96.879) (xy 109.090931 96.926307) (xy 108.866903 97.019102) (xy 108.665283 97.15382) (xy 108.625 97.194103) (xy 108.584717 97.15382) (xy 108.383097 97.019102) (xy 108.159069 96.926307) (xy 107.921243 96.879) (xy 107.678757 96.879) (xy 107.440931 96.926307) (xy 107.216903 97.019102) (xy 107.015283 97.15382) (xy 106.84382 97.325283) (xy 106.709102 97.526903) (xy 106.616307 97.750931) (xy 106.569 97.988757) (xy 92.806 97.988757) (xy 92.806 95.448757) (xy 106.569 95.448757) (xy 106.569 95.691243) (xy 106.616307 95.929069) (xy 106.709102 96.153097) (xy 106.84382 96.354717) (xy 107.015283 96.52618) (xy 107.216903 96.660898) (xy 107.440931 96.753693) (xy 107.678757 96.801) (xy 107.921243 96.801) (xy 108.159069 96.753693) (xy 108.383097 96.660898) (xy 108.584717 96.52618) (xy 108.625 96.485897) (xy 108.665283 96.52618) (xy 108.866903 96.660898) (xy 109.090931 96.753693) (xy 109.328757 96.801) (xy 109.571243 96.801) (xy 109.809069 96.753693) (xy 110.033097 96.660898) (xy 110.234717 96.52618) (xy 110.40618 96.354717) (xy 110.540898 96.153097) (xy 110.633693 95.929069) (xy 110.681 95.691243) (xy 110.681 95.57) (xy 111.643044 95.57) (xy 111.666812 95.811318) (xy 111.737202 96.043363) (xy 111.851509 96.257216) (xy 112.00534 96.44466) (xy 112.192784 96.598491) (xy 112.406637 96.712798) (xy 112.638682 96.783188) (xy 112.819528 96.801) (xy 113.320472 96.801) (xy 113.501318 96.783188) (xy 113.733363 96.712798) (xy 113.947216 96.598491) (xy 114.13466 96.44466) (xy 114.288491 96.257216) (xy 114.402798 96.043363) (xy 114.473188 95.811318) (xy 114.496956 95.57) (xy 114.473188 95.328682) (xy 114.402798 95.096637) (xy 114.288491 94.882784) (xy 114.13466 94.69534) (xy 113.947216 94.541509) (xy 113.733363 94.427202) (xy 113.501318 94.356812) (xy 113.320472 94.339) (xy 112.819528 94.339) (xy 112.638682 94.356812) (xy 112.406637 94.427202) (xy 112.192784 94.541509) (xy 112.00534 94.69534) (xy 111.851509 94.882784) (xy 111.737202 95.096637) (xy 111.666812 95.328682) (xy 111.643044 95.57) (xy 110.681 95.57) (xy 110.681 95.448757) (xy 110.633693 95.210931) (xy 110.540898 94.986903) (xy 110.40618 94.785283) (xy 110.234717 94.61382) (xy 110.033097 94.479102) (xy 109.809069 94.386307) (xy 109.571243 94.339) (xy 109.328757 94.339) (xy 109.090931 94.386307) (xy 108.866903 94.479102) (xy 108.665283 94.61382) (xy 108.625 94.654103) (xy 108.584717 94.61382) (xy 108.383097 94.479102) (xy 108.159069 94.386307) (xy 107.921243 94.339) (xy 107.678757 94.339) (xy 107.440931 94.386307) (xy 107.216903 94.479102) (xy 107.015283 94.61382) (xy 106.84382 94.785283) (xy 106.709102 94.986903) (xy 106.616307 95.210931) (xy 106.569 95.448757) (xy 92.806 95.448757) (xy 92.806 92.908757) (xy 106.569 92.908757) (xy 106.569 93.151243) (xy 106.616307 93.389069) (xy 106.709102 93.613097) (xy 106.84382 93.814717) (xy 107.015283 93.98618) (xy 107.216903 94.120898) (xy 107.440931 94.213693) (xy 107.678757 94.261) (xy 107.921243 94.261) (xy 108.159069 94.213693) (xy 108.383097 94.120898) (xy 108.584717 93.98618) (xy 108.625 93.945897) (xy 108.665283 93.98618) (xy 108.866903 94.120898) (xy 109.090931 94.213693) (xy 109.328757 94.261) (xy 109.571243 94.261) (xy 109.809069 94.213693) (xy 110.033097 94.120898) (xy 110.234717 93.98618) (xy 110.40618 93.814717) (xy 110.540898 93.613097) (xy 110.633693 93.389069) (xy 110.681 93.151243) (xy 110.681 93.03) (xy 111.643044 93.03) (xy 111.666812 93.271318) (xy 111.737202 93.503363) (xy 111.851509 93.717216) (xy 112.00534 93.90466) (xy 112.192784 94.058491) (xy 112.406637 94.172798) (xy 112.638682 94.243188) (xy 112.819528 94.261) (xy 113.320472 94.261) (xy 113.501318 94.243188) (xy 113.733363 94.172798) (xy 113.947216 94.058491) (xy 114.13466 93.90466) (xy 114.288491 93.717216) (xy 114.402798 93.503363) (xy 114.473188 93.271318) (xy 114.496956 93.03) (xy 114.484261 92.9011) (xy 117.967157 92.9011) (xy 117.967157 96.0989) (xy 117.979338 96.222576) (xy 118.015413 96.341499) (xy 118.073996 96.4511) (xy 118.152835 96.547165) (xy 118.2489 96.626004) (xy 118.358501 96.684587) (xy 118.477424 96.720662) (xy 118.6011 96.732843) (xy 120.7989 96.732843) (xy 120.922576 96.720662) (xy 121.041499 96.684587) (xy 121.1511 96.626004) (xy 121.247165 96.547165) (xy 121.326004 96.4511) (xy 121.384587 96.341499) (xy 121.420662 96.222576) (xy 121.432843 96.0989) (xy 121.432843 93.914969) (xy 122.169 93.914969) (xy 122.169 95.085032) (xy 122.194047 95.339335) (xy 122.293027 95.66563) (xy 122.453764 95.966345) (xy 122.670077 96.229924) (xy 122.933656 96.446237) (xy 123.234371 96.606973) (xy 123.560666 96.705953) (xy 123.9 96.739375) (xy 124.239335 96.705953) (xy 124.56563 96.606973) (xy 124.866345 96.446237) (xy 125.129924 96.229924) (xy 125.346237 95.966345) (xy 125.506973 95.66563) (xy 125.605953 95.339335) (xy 125.631 95.085032) (xy 125.631 93.914969) (xy 126.369 93.914969) (xy 126.369 95.085032) (xy 126.394047 95.339335) (xy 126.493027 95.66563) (xy 126.653764 95.966345) (xy 126.870077 96.229924) (xy 127.133656 96.446237) (xy 127.434371 96.606973) (xy 127.760666 96.705953) (xy 128.1 96.739375) (xy 128.439335 96.705953) (xy 128.76563 96.606973) (xy 129.066345 96.446237) (xy 129.329924 96.229924) (xy 129.546237 95.966345) (xy 129.706973 95.66563) (xy 129.805953 95.339335) (xy 129.831 95.085032) (xy 129.831 93.914969) (xy 130.569 93.914969) (xy 130.569 95.085032) (xy 130.594047 95.339335) (xy 130.693027 95.66563) (xy 130.853764 95.966345) (xy 131.070077 96.229924) (xy 131.333656 96.446237) (xy 131.634371 96.606973) (xy 131.960666 96.705953) (xy 132.3 96.739375) (xy 132.639335 96.705953) (xy 132.96563 96.606973) (xy 133.266345 96.446237) (xy 133.529924 96.229924) (xy 133.746237 95.966345) (xy 133.906973 95.66563) (xy 134.005953 95.339335) (xy 134.031 95.085032) (xy 134.031 93.914968) (xy 134.005953 93.660665) (xy 133.906973 93.33437) (xy 133.746237 93.033655) (xy 133.637453 92.9011) (xy 141.067157 92.9011) (xy 141.067157 96.0989) (xy 141.079338 96.222576) (xy 141.115413 96.341499) (xy 141.173996 96.4511) (xy 141.252835 96.547165) (xy 141.3489 96.626004) (xy 141.458501 96.684587) (xy 141.577424 96.720662) (xy 141.7011 96.732843) (xy 143.8989 96.732843) (xy 144.022576 96.720662) (xy 144.141499 96.684587) (xy 144.2511 96.626004) (xy 144.347165 96.547165) (xy 144.426004 96.4511) (xy 144.484587 96.341499) (xy 144.520662 96.222576) (xy 144.532843 96.0989) (xy 144.532843 93.914969) (xy 145.269 93.914969) (xy 145.269 95.085032) (xy 145.294047 95.339335) (xy 145.393027 95.66563) (xy 145.553764 95.966345) (xy 145.770077 96.229924) (xy 146.033656 96.446237) (xy 146.334371 96.606973) (xy 146.660666 96.705953) (xy 147 96.739375) (xy 147.339335 96.705953) (xy 147.66563 96.606973) (xy 147.966345 96.446237) (xy 148.229924 96.229924) (xy 148.446237 95.966345) (xy 148.606973 95.66563) (xy 148.705953 95.339335) (xy 148.731 95.085032) (xy 148.731 93.914969) (xy 149.469 93.914969) (xy 149.469 95.085032) (xy 149.494047 95.339335) (xy 149.593027 95.66563) (xy 149.753764 95.966345) (xy 149.970077 96.229924) (xy 150.233656 96.446237) (xy 150.534371 96.606973) (xy 150.860666 96.705953) (xy 151.2 96.739375) (xy 151.539335 96.705953) (xy 151.86563 96.606973) (xy 152.166345 96.446237) (xy 152.429924 96.229924) (xy 152.646237 95.966345) (xy 152.806973 95.66563) (xy 152.905953 95.339335) (xy 152.931 95.085032) (xy 152.931 93.914969) (xy 153.669 93.914969) (xy 153.669 95.085032) (xy 153.694047 95.339335) (xy 153.793027 95.66563) (xy 153.953764 95.966345) (xy 154.170077 96.229924) (xy 154.433656 96.446237) (xy 154.734371 96.606973) (xy 155.060666 96.705953) (xy 155.4 96.739375) (xy 155.739335 96.705953) (xy 156.06563 96.606973) (xy 156.366345 96.446237) (xy 156.629924 96.229924) (xy 156.846237 95.966345) (xy 157.006973 95.66563) (xy 157.105953 95.339335) (xy 157.131 95.085032) (xy 157.131 93.914968) (xy 157.105953 93.660665) (xy 157.006973 93.33437) (xy 156.846237 93.033655) (xy 156.629924 92.770076) (xy 156.366344 92.553763) (xy 156.078675 92.4) (xy 169.960625 92.4) (xy 169.994047 92.739335) (xy 170.093027 93.06563) (xy 170.253763 93.366345) (xy 170.470076 93.629924) (xy 170.733655 93.846237) (xy 171.03437 94.006973) (xy 171.360665 94.105953) (xy 171.614968 94.131) (xy 172.785032 94.131) (xy 173.039335 94.105953) (xy 173.36563 94.006973) (xy 173.666345 93.846237) (xy 173.929924 93.629924) (xy 174.146237 93.366345) (xy 174.306973 93.06563) (xy 174.405953 92.739335) (xy 174.439375 92.4) (xy 174.405953 92.060665) (xy 174.306973 91.73437) (xy 174.146237 91.433655) (xy 173.929924 91.170076) (xy 173.666345 90.953763) (xy 173.36563 90.793027) (xy 173.039335 90.694047) (xy 172.785032 90.669) (xy 171.614968 90.669) (xy 171.360665 90.694047) (xy 171.03437 90.793027) (xy 170.733655 90.953763) (xy 170.470076 91.170076) (xy 170.253763 91.433655) (xy 170.093027 91.73437) (xy 169.994047 92.060665) (xy 169.960625 92.4) (xy 156.078675 92.4) (xy 156.065629 92.393027) (xy 155.739334 92.294047) (xy 155.4 92.260625) (xy 155.060665 92.294047) (xy 154.73437 92.393027) (xy 154.433655 92.553763) (xy 154.170076 92.770076) (xy 153.953763 93.033656) (xy 153.793027 93.334371) (xy 153.694047 93.660666) (xy 153.669 93.914969) (xy 152.931 93.914969) (xy 152.931 93.914968) (xy 152.905953 93.660665) (xy 152.806973 93.33437) (xy 152.646237 93.033655) (xy 152.429924 92.770076) (xy 152.166344 92.553763) (xy 151.865629 92.393027) (xy 151.539334 92.294047) (xy 151.2 92.260625) (xy 150.860665 92.294047) (xy 150.53437 92.393027) (xy 150.233655 92.553763) (xy 149.970076 92.770076) (xy 149.753763 93.033656) (xy 149.593027 93.334371) (xy 149.494047 93.660666) (xy 149.469 93.914969) (xy 148.731 93.914969) (xy 148.731 93.914968) (xy 148.705953 93.660665) (xy 148.606973 93.33437) (xy 148.446237 93.033655) (xy 148.229924 92.770076) (xy 147.966344 92.553763) (xy 147.665629 92.393027) (xy 147.339334 92.294047) (xy 147 92.260625) (xy 146.660665 92.294047) (xy 146.33437 92.393027) (xy 146.033655 92.553763) (xy 145.770076 92.770076) (xy 145.553763 93.033656) (xy 145.393027 93.334371) (xy 145.294047 93.660666) (xy 145.269 93.914969) (xy 144.532843 93.914969) (xy 144.532843 92.9011) (xy 144.520662 92.777424) (xy 144.484587 92.658501) (xy 144.426004 92.5489) (xy 144.347165 92.452835) (xy 144.2511 92.373996) (xy 144.141499 92.315413) (xy 144.022576 92.279338) (xy 143.8989 92.267157) (xy 141.7011 92.267157) (xy 141.577424 92.279338) (xy 141.458501 92.315413) (xy 141.3489 92.373996) (xy 141.252835 92.452835) (xy 141.173996 92.5489) (xy 141.115413 92.658501) (xy 141.079338 92.777424) (xy 141.067157 92.9011) (xy 133.637453 92.9011) (xy 133.529924 92.770076) (xy 133.266344 92.553763) (xy 132.965629 92.393027) (xy 132.639334 92.294047) (xy 132.3 92.260625) (xy 131.960665 92.294047) (xy 131.63437 92.393027) (xy 131.333655 92.553763) (xy 131.070076 92.770076) (xy 130.853763 93.033656) (xy 130.693027 93.334371) (xy 130.594047 93.660666) (xy 130.569 93.914969) (xy 129.831 93.914969) (xy 129.831 93.914968) (xy 129.805953 93.660665) (xy 129.706973 93.33437) (xy 129.546237 93.033655) (xy 129.329924 92.770076) (xy 129.066344 92.553763) (xy 128.765629 92.393027) (xy 128.439334 92.294047) (xy 128.1 92.260625) (xy 127.760665 92.294047) (xy 127.43437 92.393027) (xy 127.133655 92.553763) (xy 126.870076 92.770076) (xy 126.653763 93.033656) (xy 126.493027 93.334371) (xy 126.394047 93.660666) (xy 126.369 93.914969) (xy 125.631 93.914969) (xy 125.631 93.914968) (xy 125.605953 93.660665) (xy 125.506973 93.33437) (xy 125.346237 93.033655) (xy 125.129924 92.770076) (xy 124.866344 92.553763) (xy 124.565629 92.393027) (xy 124.239334 92.294047) (xy 123.9 92.260625) (xy 123.560665 92.294047) (xy 123.23437 92.393027) (xy 122.933655 92.553763) (xy 122.670076 92.770076) (xy 122.453763 93.033656) (xy 122.293027 93.334371) (xy 122.194047 93.660666) (xy 122.169 93.914969) (xy 121.432843 93.914969) (xy 121.432843 92.9011) (xy 121.420662 92.777424) (xy 121.384587 92.658501) (xy 121.326004 92.5489) (xy 121.247165 92.452835) (xy 121.1511 92.373996) (xy 121.041499 92.315413) (xy 120.922576 92.279338) (xy 120.7989 92.267157) (xy 118.6011 92.267157) (xy 118.477424 92.279338) (xy 118.358501 92.315413) (xy 118.2489 92.373996) (xy 118.152835 92.452835) (xy 118.073996 92.5489) (xy 118.015413 92.658501) (xy 117.979338 92.777424) (xy 117.967157 92.9011) (xy 114.484261 92.9011) (xy 114.473188 92.788682) (xy 114.402798 92.556637) (xy 114.288491 92.342784) (xy 114.13466 92.15534) (xy 113.947216 92.001509) (xy 113.733363 91.887202) (xy 113.501318 91.816812) (xy 113.320472 91.799) (xy 112.819528 91.799) (xy 112.638682 91.816812) (xy 112.406637 91.887202) (xy 112.192784 92.001509) (xy 112.00534 92.15534) (xy 111.851509 92.342784) (xy 111.737202 92.556637) (xy 111.666812 92.788682) (xy 111.643044 93.03) (xy 110.681 93.03) (xy 110.681 92.908757) (xy 110.633693 92.670931) (xy 110.540898 92.446903) (xy 110.40618 92.245283) (xy 110.234717 92.07382) (xy 110.033097 91.939102) (xy 109.809069 91.846307) (xy 109.571243 91.799) (xy 109.328757 91.799) (xy 109.090931 91.846307) (xy 108.866903 91.939102) (xy 108.665283 92.07382) (xy 108.625 92.114103) (xy 108.584717 92.07382) (xy 108.383097 91.939102) (xy 108.159069 91.846307) (xy 107.921243 91.799) (xy 107.678757 91.799) (xy 107.440931 91.846307) (xy 107.216903 91.939102) (xy 107.015283 92.07382) (xy 106.84382 92.245283) (xy 106.709102 92.446903) (xy 106.616307 92.670931) (xy 106.569 92.908757) (xy 92.806 92.908757) (xy 92.806 90.368757) (xy 106.569 90.368757) (xy 106.569 90.611243) (xy 106.616307 90.849069) (xy 106.709102 91.073097) (xy 106.84382 91.274717) (xy 107.015283 91.44618) (xy 107.216903 91.580898) (xy 107.440931 91.673693) (xy 107.678757 91.721) (xy 107.921243 91.721) (xy 108.159069 91.673693) (xy 108.383097 91.580898) (xy 108.584717 91.44618) (xy 108.625 91.405897) (xy 108.665283 91.44618) (xy 108.866903 91.580898) (xy 109.090931 91.673693) (xy 109.328757 91.721) (xy 109.571243 91.721) (xy 109.809069 91.673693) (xy 110.033097 91.580898) (xy 110.234717 91.44618) (xy 110.40618 91.274717) (xy 110.540898 91.073097) (xy 110.633693 90.849069) (xy 110.681 90.611243) (xy 110.681 90.49) (xy 111.643044 90.49) (xy 111.666812 90.731318) (xy 111.737202 90.963363) (xy 111.851509 91.177216) (xy 112.00534 91.36466) (xy 112.192784 91.518491) (xy 112.406637 91.632798) (xy 112.638682 91.703188) (xy 112.819528 91.721) (xy 113.320472 91.721) (xy 113.501318 91.703188) (xy 113.733363 91.632798) (xy 113.947216 91.518491) (xy 114.13466 91.36466) (xy 114.288491 91.177216) (xy 114.402798 90.963363) (xy 114.473188 90.731318) (xy 114.496956 90.49) (xy 114.473188 90.248682) (xy 114.402798 90.016637) (xy 114.288491 89.802784) (xy 114.13466 89.61534) (xy 113.947216 89.461509) (xy 113.733363 89.347202) (xy 113.501318 89.276812) (xy 113.320472 89.259) (xy 112.819528 89.259) (xy 112.638682 89.276812) (xy 112.406637 89.347202) (xy 112.192784 89.461509) (xy 112.00534 89.61534) (xy 111.851509 89.802784) (xy 111.737202 90.016637) (xy 111.666812 90.248682) (xy 111.643044 90.49) (xy 110.681 90.49) (xy 110.681 90.368757) (xy 110.633693 90.130931) (xy 110.540898 89.906903) (xy 110.40618 89.705283) (xy 110.234717 89.53382) (xy 110.033097 89.399102) (xy 109.809069 89.306307) (xy 109.571243 89.259) (xy 109.328757 89.259) (xy 109.090931 89.306307) (xy 108.866903 89.399102) (xy 108.665283 89.53382) (xy 108.625 89.574103) (xy 108.584717 89.53382) (xy 108.383097 89.399102) (xy 108.159069 89.306307) (xy 107.921243 89.259) (xy 107.678757 89.259) (xy 107.440931 89.306307) (xy 107.216903 89.399102) (xy 107.015283 89.53382) (xy 106.84382 89.705283) (xy 106.709102 89.906903) (xy 106.616307 90.130931) (xy 106.569 90.368757) (xy 92.806 90.368757) (xy 92.806 88.014436) (xy 98.919 88.014436) (xy 98.919 88.345564) (xy 98.9836 88.67033) (xy 99.110317 88.976252) (xy 99.294282 89.251575) (xy 99.528425 89.485718) (xy 99.803748 89.669683) (xy 100.10967 89.7964) (xy 100.434436 89.861) (xy 100.765564 89.861) (xy 101.09033 89.7964) (xy 101.396252 89.669683) (xy 101.671575 89.485718) (xy 101.905718 89.251575) (xy 102.089683 88.976252) (xy 102.2164 88.67033) (xy 102.281 88.345564) (xy 102.281 88.014436) (xy 102.244067 87.828757) (xy 106.569 87.828757) (xy 106.569 88.071243) (xy 106.616307 88.309069) (xy 106.709102 88.533097) (xy 106.84382 88.734717) (xy 107.015283 88.90618) (xy 107.216903 89.040898) (xy 107.440931 89.133693) (xy 107.678757 89.181) (xy 107.921243 89.181) (xy 108.159069 89.133693) (xy 108.383097 89.040898) (xy 108.584717 88.90618) (xy 108.625 88.865897) (xy 108.665283 88.90618) (xy 108.866903 89.040898) (xy 109.090931 89.133693) (xy 109.328757 89.181) (xy 109.571243 89.181) (xy 109.809069 89.133693) (xy 110.033097 89.040898) (xy 110.234717 88.90618) (xy 110.40618 88.734717) (xy 110.540898 88.533097) (xy 110.633693 88.309069) (xy 110.681 88.071243) (xy 110.681 87.95) (xy 111.643044 87.95) (xy 111.666812 88.191318) (xy 111.737202 88.423363) (xy 111.851509 88.637216) (xy 112.00534 88.82466) (xy 112.192784 88.978491) (xy 112.406637 89.092798) (xy 112.638682 89.163188) (xy 112.819528 89.181) (xy 113.320472 89.181) (xy 113.501318 89.163188) (xy 113.733363 89.092798) (xy 113.947216 88.978491) (xy 114.13466 88.82466) (xy 114.288491 88.637216) (xy 114.402798 88.423363) (xy 114.470554 88.2) (xy 169.960625 88.2) (xy 169.994047 88.539335) (xy 170.093027 88.86563) (xy 170.253763 89.166345) (xy 170.470076 89.429924) (xy 170.733655 89.646237) (xy 171.03437 89.806973) (xy 171.360665 89.905953) (xy 171.614968 89.931) (xy 172.785032 89.931) (xy 173.039335 89.905953) (xy 173.36563 89.806973) (xy 173.666345 89.646237) (xy 173.929924 89.429924) (xy 174.146237 89.166345) (xy 174.306973 88.86563) (xy 174.405953 88.539335) (xy 174.439375 88.2) (xy 174.405953 87.860665) (xy 174.306973 87.53437) (xy 174.146237 87.233655) (xy 173.929924 86.970076) (xy 173.666345 86.753763) (xy 173.36563 86.593027) (xy 173.039335 86.494047) (xy 172.785032 86.469) (xy 171.614968 86.469) (xy 171.360665 86.494047) (xy 171.03437 86.593027) (xy 170.733655 86.753763) (xy 170.470076 86.970076) (xy 170.253763 87.233655) (xy 170.093027 87.53437) (xy 169.994047 87.860665) (xy 169.960625 88.2) (xy 114.470554 88.2) (xy 114.473188 88.191318) (xy 114.496956 87.95) (xy 114.473188 87.708682) (xy 114.402798 87.476637) (xy 114.288491 87.262784) (xy 114.13466 87.07534) (xy 113.947216 86.921509) (xy 113.733363 86.807202) (xy 113.501318 86.736812) (xy 113.320472 86.719) (xy 112.819528 86.719) (xy 112.638682 86.736812) (xy 112.406637 86.807202) (xy 112.192784 86.921509) (xy 112.00534 87.07534) (xy 111.851509 87.262784) (xy 111.737202 87.476637) (xy 111.666812 87.708682) (xy 111.643044 87.95) (xy 110.681 87.95) (xy 110.681 87.828757) (xy 110.633693 87.590931) (xy 110.540898 87.366903) (xy 110.40618 87.165283) (xy 110.234717 86.99382) (xy 110.033097 86.859102) (xy 109.809069 86.766307) (xy 109.571243 86.719) (xy 109.328757 86.719) (xy 109.090931 86.766307) (xy 108.866903 86.859102) (xy 108.665283 86.99382) (xy 108.625 87.034103) (xy 108.584717 86.99382) (xy 108.383097 86.859102) (xy 108.159069 86.766307) (xy 107.921243 86.719) (xy 107.678757 86.719) (xy 107.440931 86.766307) (xy 107.216903 86.859102) (xy 107.015283 86.99382) (xy 106.84382 87.165283) (xy 106.709102 87.366903) (xy 106.616307 87.590931) (xy 106.569 87.828757) (xy 102.244067 87.828757) (xy 102.2164 87.68967) (xy 102.089683 87.383748) (xy 101.905718 87.108425) (xy 101.671575 86.874282) (xy 101.396252 86.690317) (xy 101.09033 86.5636) (xy 100.765564 86.499) (xy 100.434436 86.499) (xy 100.10967 86.5636) (xy 99.803748 86.690317) (xy 99.528425 86.874282) (xy 99.294282 87.108425) (xy 99.110317 87.383748) (xy 98.9836 87.68967) (xy 98.919 88.014436) (xy 92.806 88.014436) (xy 92.806 85.288757) (xy 106.569 85.288757) (xy 106.569 85.531243) (xy 106.616307 85.769069) (xy 106.709102 85.993097) (xy 106.84382 86.194717) (xy 107.015283 86.36618) (xy 107.216903 86.500898) (xy 107.440931 86.593693) (xy 107.678757 86.641) (xy 107.921243 86.641) (xy 108.159069 86.593693) (xy 108.383097 86.500898) (xy 108.584717 86.36618) (xy 108.625 86.325897) (xy 108.665283 86.36618) (xy 108.866903 86.500898) (xy 109.090931 86.593693) (xy 109.328757 86.641) (xy 109.571243 86.641) (xy 109.809069 86.593693) (xy 110.033097 86.500898) (xy 110.234717 86.36618) (xy 110.40618 86.194717) (xy 110.540898 85.993097) (xy 110.633693 85.769069) (xy 110.681 85.531243) (xy 110.681 85.41) (xy 111.643044 85.41) (xy 111.666812 85.651318) (xy 111.737202 85.883363) (xy 111.851509 86.097216) (xy 112.00534 86.28466) (xy 112.192784 86.438491) (xy 112.406637 86.552798) (xy 112.638682 86.623188) (xy 112.819528 86.641) (xy 113.320472 86.641) (xy 113.501318 86.623188) (xy 113.733363 86.552798) (xy 113.947216 86.438491) (xy 114.13466 86.28466) (xy 114.288491 86.097216) (xy 114.402798 85.883363) (xy 114.473188 85.651318) (xy 114.496956 85.41) (xy 114.473188 85.168682) (xy 114.402798 84.936637) (xy 114.288491 84.722784) (xy 114.13466 84.53534) (xy 113.947216 84.381509) (xy 113.733363 84.267202) (xy 113.501318 84.196812) (xy 113.320472 84.179) (xy 112.819528 84.179) (xy 112.638682 84.196812) (xy 112.406637 84.267202) (xy 112.192784 84.381509) (xy 112.00534 84.53534) (xy 111.851509 84.722784) (xy 111.737202 84.936637) (xy 111.666812 85.168682) (xy 111.643044 85.41) (xy 110.681 85.41) (xy 110.681 85.288757) (xy 110.633693 85.050931) (xy 110.540898 84.826903) (xy 110.40618 84.625283) (xy 110.234717 84.45382) (xy 110.033097 84.319102) (xy 109.809069 84.226307) (xy 109.571243 84.179) (xy 109.328757 84.179) (xy 109.090931 84.226307) (xy 108.866903 84.319102) (xy 108.665283 84.45382) (xy 108.625 84.494103) (xy 108.584717 84.45382) (xy 108.383097 84.319102) (xy 108.159069 84.226307) (xy 107.921243 84.179) (xy 107.678757 84.179) (xy 107.440931 84.226307) (xy 107.216903 84.319102) (xy 107.015283 84.45382) (xy 106.84382 84.625283) (xy 106.709102 84.826903) (xy 106.616307 85.050931) (xy 106.569 85.288757) (xy 92.806 85.288757) (xy 92.806 82.748757) (xy 106.569 82.748757) (xy 106.569 82.991243) (xy 106.616307 83.229069) (xy 106.709102 83.453097) (xy 106.84382 83.654717) (xy 107.015283 83.82618) (xy 107.216903 83.960898) (xy 107.440931 84.053693) (xy 107.678757 84.101) (xy 107.921243 84.101) (xy 108.159069 84.053693) (xy 108.383097 83.960898) (xy 108.584717 83.82618) (xy 108.625 83.785897) (xy 108.665283 83.82618) (xy 108.866903 83.960898) (xy 109.090931 84.053693) (xy 109.328757 84.101) (xy 109.571243 84.101) (xy 109.809069 84.053693) (xy 110.033097 83.960898) (xy 110.234717 83.82618) (xy 110.40618 83.654717) (xy 110.540898 83.453097) (xy 110.633693 83.229069) (xy 110.681 82.991243) (xy 110.681 82.87) (xy 111.643044 82.87) (xy 111.666812 83.111318) (xy 111.737202 83.343363) (xy 111.851509 83.557216) (xy 112.00534 83.74466) (xy 112.192784 83.898491) (xy 112.406637 84.012798) (xy 112.638682 84.083188) (xy 112.819528 84.101) (xy 113.320472 84.101) (xy 113.501318 84.083188) (xy 113.733363 84.012798) (xy 113.947216 83.898491) (xy 114.13466 83.74466) (xy 114.288491 83.557216) (xy 114.364524 83.414968) (xy 117.969 83.414968) (xy 117.969 84.585031) (xy 117.994047 84.839334) (xy 118.093027 85.165629) (xy 118.253763 85.466344) (xy 118.470076 85.729924) (xy 118.733655 85.946237) (xy 119.03437 86.106973) (xy 119.360665 86.205953) (xy 119.7 86.239375) (xy 120.039334 86.205953) (xy 120.365629 86.106973) (xy 120.666344 85.946237) (xy 120.929924 85.729924) (xy 121.146237 85.466345) (xy 121.306973 85.16563) (xy 121.405953 84.839335) (xy 121.431 84.585032) (xy 121.431 83.414968) (xy 122.169 83.414968) (xy 122.169 84.585031) (xy 122.194047 84.839334) (xy 122.293027 85.165629) (xy 122.453763 85.466344) (xy 122.670076 85.729924) (xy 122.933655 85.946237) (xy 123.23437 86.106973) (xy 123.560665 86.205953) (xy 123.9 86.239375) (xy 124.239334 86.205953) (xy 124.565629 86.106973) (xy 124.866344 85.946237) (xy 125.129924 85.729924) (xy 125.346237 85.466345) (xy 125.506973 85.16563) (xy 125.605953 84.839335) (xy 125.631 84.585032) (xy 125.631 83.414968) (xy 126.369 83.414968) (xy 126.369 84.585031) (xy 126.394047 84.839334) (xy 126.493027 85.165629) (xy 126.653763 85.466344) (xy 126.870076 85.729924) (xy 127.133655 85.946237) (xy 127.43437 86.106973) (xy 127.760665 86.205953) (xy 128.1 86.239375) (xy 128.439334 86.205953) (xy 128.765629 86.106973) (xy 129.066344 85.946237) (xy 129.329924 85.729924) (xy 129.546237 85.466345) (xy 129.706973 85.16563) (xy 129.805953 84.839335) (xy 129.831 84.585032) (xy 129.831 83.414968) (xy 129.805953 83.160665) (xy 129.706973 82.83437) (xy 129.546237 82.533655) (xy 129.437453 82.4011) (xy 130.567157 82.4011) (xy 130.567157 85.5989) (xy 130.579338 85.722576) (xy 130.615413 85.841499) (xy 130.673996 85.9511) (xy 130.752835 86.047165) (xy 130.8489 86.126004) (xy 130.958501 86.184587) (xy 131.077424 86.220662) (xy 131.2011 86.232843) (xy 133.3989 86.232843) (xy 133.522576 86.220662) (xy 133.641499 86.184587) (xy 133.7511 86.126004) (xy 133.847165 86.047165) (xy 133.926004 85.9511) (xy 133.984587 85.841499) (xy 134.020662 85.722576) (xy 134.032843 85.5989) (xy 134.032843 83.414968) (xy 141.069 83.414968) (xy 141.069 84.585031) (xy 141.094047 84.839334) (xy 141.193027 85.165629) (xy 141.353763 85.466344) (xy 141.570076 85.729924) (xy 141.833655 85.946237) (xy 142.13437 86.106973) (xy 142.460665 86.205953) (xy 142.8 86.239375) (xy 143.139334 86.205953) (xy 143.465629 86.106973) (xy 143.766344 85.946237) (xy 144.029924 85.729924) (xy 144.246237 85.466345) (xy 144.406973 85.16563) (xy 144.505953 84.839335) (xy 144.531 84.585032) (xy 144.531 83.414968) (xy 145.269 83.414968) (xy 145.269 84.585031) (xy 145.294047 84.839334) (xy 145.393027 85.165629) (xy 145.553763 85.466344) (xy 145.770076 85.729924) (xy 146.033655 85.946237) (xy 146.33437 86.106973) (xy 146.660665 86.205953) (xy 147 86.239375) (xy 147.339334 86.205953) (xy 147.665629 86.106973) (xy 147.966344 85.946237) (xy 148.229924 85.729924) (xy 148.446237 85.466345) (xy 148.606973 85.16563) (xy 148.705953 84.839335) (xy 148.731 84.585032) (xy 148.731 83.414968) (xy 149.469 83.414968) (xy 149.469 84.585031) (xy 149.494047 84.839334) (xy 149.593027 85.165629) (xy 149.753763 85.466344) (xy 149.970076 85.729924) (xy 150.233655 85.946237) (xy 150.53437 86.106973) (xy 150.860665 86.205953) (xy 151.2 86.239375) (xy 151.539334 86.205953) (xy 151.865629 86.106973) (xy 152.166344 85.946237) (xy 152.429924 85.729924) (xy 152.646237 85.466345) (xy 152.806973 85.16563) (xy 152.905953 84.839335) (xy 152.931 84.585032) (xy 152.931 83.414968) (xy 152.905953 83.160665) (xy 152.806973 82.83437) (xy 152.646237 82.533655) (xy 152.537453 82.4011) (xy 153.667157 82.4011) (xy 153.667157 85.5989) (xy 153.679338 85.722576) (xy 153.715413 85.841499) (xy 153.773996 85.9511) (xy 153.852835 86.047165) (xy 153.9489 86.126004) (xy 154.058501 86.184587) (xy 154.177424 86.220662) (xy 154.3011 86.232843) (xy 156.4989 86.232843) (xy 156.622576 86.220662) (xy 156.741499 86.184587) (xy 156.8511 86.126004) (xy 156.947165 86.047165) (xy 157.026004 85.9511) (xy 157.084587 85.841499) (xy 157.120662 85.722576) (xy 157.132843 85.5989) (xy 157.132843 84) (xy 169.960625 84) (xy 169.994047 84.339335) (xy 170.093027 84.66563) (xy 170.253763 84.966345) (xy 170.470076 85.229924) (xy 170.733655 85.446237) (xy 171.03437 85.606973) (xy 171.360665 85.705953) (xy 171.614968 85.731) (xy 172.785032 85.731) (xy 173.039335 85.705953) (xy 173.36563 85.606973) (xy 173.666345 85.446237) (xy 173.929924 85.229924) (xy 174.146237 84.966345) (xy 174.306973 84.66563) (xy 174.405953 84.339335) (xy 174.439375 84) (xy 174.405953 83.660665) (xy 174.306973 83.33437) (xy 174.146237 83.033655) (xy 173.929924 82.770076) (xy 173.666345 82.553763) (xy 173.36563 82.393027) (xy 173.039335 82.294047) (xy 172.785032 82.269) (xy 171.614968 82.269) (xy 171.360665 82.294047) (xy 171.03437 82.393027) (xy 170.733655 82.553763) (xy 170.470076 82.770076) (xy 170.253763 83.033655) (xy 170.093027 83.33437) (xy 169.994047 83.660665) (xy 169.960625 84) (xy 157.132843 84) (xy 157.132843 82.4011) (xy 157.120662 82.277424) (xy 157.084587 82.158501) (xy 157.026004 82.0489) (xy 156.947165 81.952835) (xy 156.8511 81.873996) (xy 156.741499 81.815413) (xy 156.622576 81.779338) (xy 156.4989 81.767157) (xy 154.3011 81.767157) (xy 154.177424 81.779338) (xy 154.058501 81.815413) (xy 153.9489 81.873996) (xy 153.852835 81.952835) (xy 153.773996 82.0489) (xy 153.715413 82.158501) (xy 153.679338 82.277424) (xy 153.667157 82.4011) (xy 152.537453 82.4011) (xy 152.429924 82.270076) (xy 152.166345 82.053763) (xy 151.86563 81.893027) (xy 151.539335 81.794047) (xy 151.2 81.760625) (xy 150.860666 81.794047) (xy 150.534371 81.893027) (xy 150.233656 82.053763) (xy 149.970077 82.270076) (xy 149.753764 82.533655) (xy 149.593027 82.83437) (xy 149.494047 83.160665) (xy 149.469 83.414968) (xy 148.731 83.414968) (xy 148.705953 83.160665) (xy 148.606973 82.83437) (xy 148.446237 82.533655) (xy 148.229924 82.270076) (xy 147.966345 82.053763) (xy 147.66563 81.893027) (xy 147.339335 81.794047) (xy 147 81.760625) (xy 146.660666 81.794047) (xy 146.334371 81.893027) (xy 146.033656 82.053763) (xy 145.770077 82.270076) (xy 145.553764 82.533655) (xy 145.393027 82.83437) (xy 145.294047 83.160665) (xy 145.269 83.414968) (xy 144.531 83.414968) (xy 144.505953 83.160665) (xy 144.406973 82.83437) (xy 144.246237 82.533655) (xy 144.029924 82.270076) (xy 143.766345 82.053763) (xy 143.46563 81.893027) (xy 143.139335 81.794047) (xy 142.8 81.760625) (xy 142.460666 81.794047) (xy 142.134371 81.893027) (xy 141.833656 82.053763) (xy 141.570077 82.270076) (xy 141.353764 82.533655) (xy 141.193027 82.83437) (xy 141.094047 83.160665) (xy 141.069 83.414968) (xy 134.032843 83.414968) (xy 134.032843 82.4011) (xy 134.020662 82.277424) (xy 133.984587 82.158501) (xy 133.926004 82.0489) (xy 133.847165 81.952835) (xy 133.7511 81.873996) (xy 133.641499 81.815413) (xy 133.522576 81.779338) (xy 133.3989 81.767157) (xy 131.2011 81.767157) (xy 131.077424 81.779338) (xy 130.958501 81.815413) (xy 130.8489 81.873996) (xy 130.752835 81.952835) (xy 130.673996 82.0489) (xy 130.615413 82.158501) (xy 130.579338 82.277424) (xy 130.567157 82.4011) (xy 129.437453 82.4011) (xy 129.329924 82.270076) (xy 129.066345 82.053763) (xy 128.76563 81.893027) (xy 128.439335 81.794047) (xy 128.1 81.760625) (xy 127.760666 81.794047) (xy 127.434371 81.893027) (xy 127.133656 82.053763) (xy 126.870077 82.270076) (xy 126.653764 82.533655) (xy 126.493027 82.83437) (xy 126.394047 83.160665) (xy 126.369 83.414968) (xy 125.631 83.414968) (xy 125.605953 83.160665) (xy 125.506973 82.83437) (xy 125.346237 82.533655) (xy 125.129924 82.270076) (xy 124.866345 82.053763) (xy 124.56563 81.893027) (xy 124.239335 81.794047) (xy 123.9 81.760625) (xy 123.560666 81.794047) (xy 123.234371 81.893027) (xy 122.933656 82.053763) (xy 122.670077 82.270076) (xy 122.453764 82.533655) (xy 122.293027 82.83437) (xy 122.194047 83.160665) (xy 122.169 83.414968) (xy 121.431 83.414968) (xy 121.405953 83.160665) (xy 121.306973 82.83437) (xy 121.146237 82.533655) (xy 120.929924 82.270076) (xy 120.666345 82.053763) (xy 120.36563 81.893027) (xy 120.039335 81.794047) (xy 119.7 81.760625) (xy 119.360666 81.794047) (xy 119.034371 81.893027) (xy 118.733656 82.053763) (xy 118.470077 82.270076) (xy 118.253764 82.533655) (xy 118.093027 82.83437) (xy 117.994047 83.160665) (xy 117.969 83.414968) (xy 114.364524 83.414968) (xy 114.402798 83.343363) (xy 114.473188 83.111318) (xy 114.496956 82.87) (xy 114.473188 82.628682) (xy 114.402798 82.396637) (xy 114.288491 82.182784) (xy 114.13466 81.99534) (xy 113.947216 81.841509) (xy 113.733363 81.727202) (xy 113.501318 81.656812) (xy 113.320472 81.639) (xy 112.819528 81.639) (xy 112.638682 81.656812) (xy 112.406637 81.727202) (xy 112.192784 81.841509) (xy 112.00534 81.99534) (xy 111.851509 82.182784) (xy 111.737202 82.396637) (xy 111.666812 82.628682) (xy 111.643044 82.87) (xy 110.681 82.87) (xy 110.681 82.748757) (xy 110.633693 82.510931) (xy 110.540898 82.286903) (xy 110.40618 82.085283) (xy 110.234717 81.91382) (xy 110.033097 81.779102) (xy 109.809069 81.686307) (xy 109.571243 81.639) (xy 109.328757 81.639) (xy 109.090931 81.686307) (xy 108.866903 81.779102) (xy 108.665283 81.91382) (xy 108.625 81.954103) (xy 108.584717 81.91382) (xy 108.383097 81.779102) (xy 108.159069 81.686307) (xy 107.921243 81.639) (xy 107.678757 81.639) (xy 107.440931 81.686307) (xy 107.216903 81.779102) (xy 107.015283 81.91382) (xy 106.84382 82.085283) (xy 106.709102 82.286903) (xy 106.616307 82.510931) (xy 106.569 82.748757) (xy 92.806 82.748757) (xy 92.806 80.208757) (xy 106.569 80.208757) (xy 106.569 80.451243) (xy 106.616307 80.689069) (xy 106.709102 80.913097) (xy 106.84382 81.114717) (xy 107.015283 81.28618) (xy 107.216903 81.420898) (xy 107.440931 81.513693) (xy 107.678757 81.561) (xy 107.921243 81.561) (xy 108.159069 81.513693) (xy 108.383097 81.420898) (xy 108.584717 81.28618) (xy 108.625 81.245897) (xy 108.665283 81.28618) (xy 108.866903 81.420898) (xy 109.090931 81.513693) (xy 109.328757 81.561) (xy 109.571243 81.561) (xy 109.809069 81.513693) (xy 110.033097 81.420898) (xy 110.234717 81.28618) (xy 110.40618 81.114717) (xy 110.540898 80.913097) (xy 110.633693 80.689069) (xy 110.681 80.451243) (xy 110.681 80.33) (xy 111.643044 80.33) (xy 111.666812 80.571318) (xy 111.737202 80.803363) (xy 111.851509 81.017216) (xy 112.00534 81.20466) (xy 112.192784 81.358491) (xy 112.406637 81.472798) (xy 112.638682 81.543188) (xy 112.819528 81.561) (xy 113.320472 81.561) (xy 113.501318 81.543188) (xy 113.733363 81.472798) (xy 113.947216 81.358491) (xy 114.13466 81.20466) (xy 114.288491 81.017216) (xy 114.402798 80.803363) (xy 114.473188 80.571318) (xy 114.496956 80.33) (xy 114.473188 80.088682) (xy 114.402798 79.856637) (xy 114.288491 79.642784) (xy 114.13466 79.45534) (xy 113.947216 79.301509) (xy 113.733363 79.187202) (xy 113.501318 79.116812) (xy 113.320472 79.099) (xy 112.819528 79.099) (xy 112.638682 79.116812) (xy 112.406637 79.187202) (xy 112.192784 79.301509) (xy 112.00534 79.45534) (xy 111.851509 79.642784) (xy 111.737202 79.856637) (xy 111.666812 80.088682) (xy 111.643044 80.33) (xy 110.681 80.33) (xy 110.681 80.208757) (xy 110.633693 79.970931) (xy 110.540898 79.746903) (xy 110.40618 79.545283) (xy 110.234717 79.37382) (xy 110.033097 79.239102) (xy 109.809069 79.146307) (xy 109.571243 79.099) (xy 109.328757 79.099) (xy 109.090931 79.146307) (xy 108.866903 79.239102) (xy 108.665283 79.37382) (xy 108.625 79.414103) (xy 108.584717 79.37382) (xy 108.383097 79.239102) (xy 108.159069 79.146307) (xy 107.921243 79.099) (xy 107.678757 79.099) (xy 107.440931 79.146307) (xy 107.216903 79.239102) (xy 107.015283 79.37382) (xy 106.84382 79.545283) (xy 106.709102 79.746903) (xy 106.616307 79.970931) (xy 106.569 80.208757) (xy 92.806 80.208757) (xy 92.806 78.7011) (xy 169.967157 78.7011) (xy 169.967157 80.8989) (xy 169.979338 81.022576) (xy 170.015413 81.141499) (xy 170.073996 81.2511) (xy 170.152835 81.347165) (xy 170.2489 81.426004) (xy 170.358501 81.484587) (xy 170.477424 81.520662) (xy 170.6011 81.532843) (xy 173.7989 81.532843) (xy 173.922576 81.520662) (xy 174.041499 81.484587) (xy 174.1511 81.426004) (xy 174.247165 81.347165) (xy 174.326004 81.2511) (xy 174.384587 81.141499) (xy 174.420662 81.022576) (xy 174.432843 80.8989) (xy 174.432843 78.7011) (xy 174.420662 78.577424) (xy 174.384587 78.458501) (xy 174.326004 78.3489) (xy 174.247165 78.252835) (xy 174.1511 78.173996) (xy 174.041499 78.115413) (xy 173.922576 78.079338) (xy 173.7989 78.067157) (xy 170.6011 78.067157) (xy 170.477424 78.079338) (xy 170.358501 78.115413) (xy 170.2489 78.173996) (xy 170.152835 78.252835) (xy 170.073996 78.3489) (xy 170.015413 78.458501) (xy 169.979338 78.577424) (xy 169.967157 78.7011) (xy 92.806 78.7011) (xy 92.806 77.056) (xy 178.094001 77.056) ) ) (filled_polygon (pts (xy 134.507658 156.797157) (xy 134.378412 156.990587) (xy 134.289386 157.205515) (xy 134.244 157.433682) (xy 134.244 157.666318) (xy 134.289386 157.894485) (xy 134.310682 157.945898) (xy 133.30958 158.947) (xy 122.312379 158.947) (xy 122.302172 158.913352) (xy 122.264663 158.822796) (xy 122.229283 158.756606) (xy 122.174827 158.675107) (xy 122.127216 158.617092) (xy 122.057908 158.547784) (xy 121.999893 158.500173) (xy 121.918394 158.445717) (xy 121.852204 158.410337) (xy 121.761648 158.372828) (xy 121.689831 158.351043) (xy 121.593698 158.331921) (xy 121.519009 158.324565) (xy 121.49445 158.324565) (xy 121.47 158.322157) (xy 120.97 158.322157) (xy 120.895311 158.329513) (xy 120.823492 158.351299) (xy 120.82 158.353166) (xy 120.816508 158.351299) (xy 120.744689 158.329513) (xy 120.678 158.322945) (xy 120.678 158.047055) (xy 120.744689 158.040487) (xy 120.816508 158.018701) (xy 120.82 158.016834) (xy 120.823492 158.018701) (xy 120.895311 158.040487) (xy 120.97 158.047843) (xy 121.47 158.047843) (xy 121.49445 158.045435) (xy 121.519009 158.045435) (xy 121.593698 158.038079) (xy 121.689831 158.018957) (xy 121.761648 157.997172) (xy 121.852204 157.959663) (xy 121.918394 157.924283) (xy 121.999893 157.869827) (xy 122.057908 157.822216) (xy 122.127216 157.752908) (xy 122.174827 157.694893) (xy 122.229283 157.613394) (xy 122.264663 157.547204) (xy 122.302172 157.456648) (xy 122.323957 157.384831) (xy 122.343079 157.288698) (xy 122.350435 157.214009) (xy 122.350435 157.18945) (xy 122.352843 157.165) (xy 122.352843 156.788) (xy 134.516815 156.788) ) ) ) (zone (net 2) (net_name +5V) (layer F.Cu) (tstamp 6053136C) (hatch edge 0.508) (priority 2) (connect_pads yes (clearance 0.254)) (min_thickness 0.254) (fill yes (arc_segments 32) (thermal_gap 0.508) (thermal_bridge_width 0.508) (smoothing fillet) (radius 1.27)) (polygon (pts (xy 166.32 111.72) (xy 173.88 111.72) (xy 173.88 123.48) (xy 170.1 123.48) (xy 170.1 119.7) (xy 163.38 119.7) (xy 153.825 110.25) (xy 151.2 110.25) (xy 151.2 105.42) (xy 160.02 105.42) ) ) (filled_polygon (pts (xy 159.716817 105.569565) (xy 159.931118 105.634572) (xy 160.128626 105.740143) (xy 160.306577 105.886183) (xy 165.858223 111.437829) (xy 165.867458 111.446198) (xy 166.059909 111.604138) (xy 166.080609 111.61797) (xy 166.300175 111.735331) (xy 166.323177 111.744858) (xy 166.561421 111.817128) (xy 166.585839 111.821985) (xy 166.833603 111.846388) (xy 166.846051 111.847) (xy 172.604452 111.847) (xy 172.808395 111.864843) (xy 173.000765 111.916388) (xy 173.18126 112.000555) (xy 173.34439 112.11478) (xy 173.48522 112.25561) (xy 173.599445 112.41874) (xy 173.683612 112.599235) (xy 173.735157 112.791605) (xy 173.753 112.995548) (xy 173.753 122.204452) (xy 173.735157 122.408395) (xy 173.683612 122.600765) (xy 173.599445 122.78126) (xy 173.48522 122.94439) (xy 173.34439 123.08522) (xy 173.18126 123.199445) (xy 173.000765 123.283612) (xy 172.808395 123.335157) (xy 172.604452 123.353) (xy 171.375548 123.353) (xy 171.171605 123.335157) (xy 170.979235 123.283612) (xy 170.79874 123.199445) (xy 170.63561 123.08522) (xy 170.49478 122.94439) (xy 170.380555 122.78126) (xy 170.296388 122.600765) (xy 170.244843 122.408395) (xy 170.227 122.204452) (xy 170.227 121.925644) (xy 170.239375 121.8) (xy 170.227 121.674356) (xy 170.227 120.97) (xy 170.226517 120.958931) (xy 170.207223 120.738398) (xy 170.203379 120.716597) (xy 170.146083 120.502764) (xy 170.138511 120.481961) (xy 170.044953 120.281327) (xy 170.033884 120.262156) (xy 169.906908 120.080816) (xy 169.892679 120.063857) (xy 169.736143 119.907321) (xy 169.719184 119.893092) (xy 169.537844 119.766116) (xy 169.518673 119.755047) (xy 169.318039 119.661489) (xy 169.297236 119.653917) (xy 169.083403 119.596621) (xy 169.061602 119.592777) (xy 168.841069 119.573483) (xy 168.83 119.573) (xy 163.908141 119.573) (xy 163.680626 119.55075) (xy 163.467685 119.486637) (xy 163.271207 119.382488) (xy 163.093793 119.238318) (xy 154.28541 110.52673) (xy 154.276197 110.518466) (xy 154.084339 110.362558) (xy 154.063727 110.348909) (xy 153.845299 110.233125) (xy 153.822433 110.223727) (xy 153.585712 110.152454) (xy 153.561459 110.147665) (xy 153.315415 110.123603) (xy 153.303054 110.123) (xy 152.475548 110.123) (xy 152.271605 110.105157) (xy 152.079235 110.053612) (xy 151.89874 109.969445) (xy 151.73561 109.85522) (xy 151.59478 109.71439) (xy 151.480555 109.55126) (xy 151.396388 109.370765) (xy 151.344843 109.178395) (xy 151.327 108.974452) (xy 151.327 106.695548) (xy 151.344843 106.491605) (xy 151.396388 106.299235) (xy 151.480555 106.11874) (xy 151.59478 105.95561) (xy 151.73561 105.81478) (xy 151.89874 105.700555) (xy 152.079235 105.616388) (xy 152.271605 105.564843) (xy 152.475548 105.547) (xy 159.487715 105.547) ) ) ) (zone (net 3) (net_name +3V3) (layer B.Cu) (tstamp 60531369) (hatch edge 0.508) (priority 2) (connect_pads yes (clearance 0.254)) (min_thickness 0.254) (fill yes (arc_segments 32) (thermal_gap 0.508) (thermal_bridge_width 0.508) (smoothing fillet) (radius 1.27)) (polygon (pts (xy 166.32 124.32) (xy 173.88 124.32) (xy 173.88 131.88) (xy 157.92 131.88) (xy 153.3 127.26) (xy 150.36 127.26) (xy 150.36 122.64) (xy 164.64 122.64) ) ) (filled_polygon (pts (xy 164.336817 122.789565) (xy 164.551118 122.854572) (xy 164.748626 122.960143) (xy 164.926577 123.106183) (xy 165.858223 124.037829) (xy 165.867458 124.046198) (xy 166.059909 124.204138) (xy 166.080609 124.21797) (xy 166.300175 124.335331) (xy 166.323177 124.344858) (xy 166.561421 124.417128) (xy 166.585839 124.421985) (xy 166.833603 124.446388) (xy 166.846051 124.447) (xy 172.604452 124.447) (xy 172.808395 124.464843) (xy 173.000765 124.516388) (xy 173.18126 124.600555) (xy 173.34439 124.71478) (xy 173.48522 124.85561) (xy 173.599445 125.01874) (xy 173.683612 125.199235) (xy 173.735157 125.391605) (xy 173.753 125.595548) (xy 173.753 130.604452) (xy 173.735157 130.808395) (xy 173.683612 131.000765) (xy 173.599445 131.18126) (xy 173.48522 131.34439) (xy 173.34439 131.48522) (xy 173.18126 131.599445) (xy 173.000765 131.683612) (xy 172.808395 131.735157) (xy 172.604452 131.753) (xy 158.452285 131.753) (xy 158.223183 131.730435) (xy 158.008882 131.665428) (xy 157.811374 131.559857) (xy 157.633423 131.413817) (xy 153.761777 127.542171) (xy 153.752542 127.533802) (xy 153.560091 127.375862) (xy 153.539391 127.36203) (xy 153.319825 127.244669) (xy 153.296823 127.235142) (xy 153.058579 127.162872) (xy 153.034161 127.158015) (xy 152.786397 127.133612) (xy 152.773949 127.133) (xy 151.635548 127.133) (xy 151.431605 127.115157) (xy 151.239235 127.063612) (xy 151.05874 126.979445) (xy 150.89561 126.86522) (xy 150.75478 126.72439) (xy 150.640555 126.56126) (xy 150.556388 126.380765) (xy 150.504843 126.188395) (xy 150.487 125.984452) (xy 150.487 123.915548) (xy 150.504843 123.711605) (xy 150.556388 123.519235) (xy 150.640555 123.33874) (xy 150.75478 123.17561) (xy 150.89561 123.03478) (xy 151.05874 122.920555) (xy 151.239235 122.836388) (xy 151.431605 122.784843) (xy 151.635548 122.767) (xy 164.107715 122.767) ) ) ) (zone (net 7) (net_name +12V) (layer F.Cu) (tstamp 60531366) (hatch edge 0.508) (priority 1) (connect_pads yes (clearance 0.254)) (min_thickness 0.254) (fill yes (arc_segments 32) (thermal_gap 0.508) (thermal_bridge_width 0.508) (smoothing fillet) (radius 1.27)) (polygon (pts (xy 130.62 123.48) (xy 126.84 127.26) (xy 123.06 127.26) (xy 123.06 122.22) (xy 125.58 122.22) (xy 126.42 121.38) (xy 126.42 109.2) (xy 130.62 109.2) ) ) (filled_polygon (pts (xy 129.548395 109.344843) (xy 129.740765 109.396388) (xy 129.92126 109.480555) (xy 130.08439 109.59478) (xy 130.22522 109.73561) (xy 130.339445 109.89874) (xy 130.423612 110.079235) (xy 130.475157 110.271605) (xy 130.493 110.475548) (xy 130.493 122.947715) (xy 130.470435 123.176817) (xy 130.405428 123.391118) (xy 130.299857 123.588626) (xy 130.153817 123.766577) (xy 127.126577 126.793817) (xy 126.948626 126.939857) (xy 126.751118 127.045428) (xy 126.536817 127.110435) (xy 126.307715 127.133) (xy 124.335548 127.133) (xy 124.131605 127.115157) (xy 123.939235 127.063612) (xy 123.75874 126.979445) (xy 123.59561 126.86522) (xy 123.45478 126.72439) (xy 123.340555 126.56126) (xy 123.256388 126.380765) (xy 123.204843 126.188395) (xy 123.187 125.984452) (xy 123.187 123.485548) (xy 123.204691 123.283341) (xy 123.255785 123.092656) (xy 123.339215 122.91374) (xy 123.45244 122.752038) (xy 123.592038 122.61244) (xy 123.75374 122.499215) (xy 123.932656 122.415785) (xy 124.123341 122.364691) (xy 124.325548 122.347) (xy 125.053949 122.347) (xy 125.066397 122.346388) (xy 125.314161 122.321985) (xy 125.338579 122.317128) (xy 125.576823 122.244858) (xy 125.599825 122.235331) (xy 125.819391 122.11797) (xy 125.840091 122.104138) (xy 126.032542 121.946198) (xy 126.041777 121.937829) (xy 126.137829 121.841777) (xy 126.146198 121.832542) (xy 126.304138 121.640091) (xy 126.31797 121.619391) (xy 126.435331 121.399825) (xy 126.444858 121.376823) (xy 126.517128 121.138579) (xy 126.521985 121.114161) (xy 126.546388 120.866397) (xy 126.547 120.853949) (xy 126.547 110.475548) (xy 126.564843 110.271605) (xy 126.616388 110.079235) (xy 126.700555 109.89874) (xy 126.81478 109.73561) (xy 126.95561 109.59478) (xy 127.11874 109.480555) (xy 127.299235 109.396388) (xy 127.491605 109.344843) (xy 127.695548 109.327) (xy 129.344452 109.327) ) ) ) (zone (net 1) (net_name GND) (layer F.Cu) (tstamp 60531363) (hatch edge 0.508) (connect_pads yes (clearance 0.254)) (min_thickness 0.508) (fill yes (arc_segments 32) (thermal_gap 2.54) (thermal_bridge_width 2.54) (smoothing fillet) (radius 1.27)) (polygon (pts (xy 180.6 164.85) (xy 86.1 164.85) (xy 86.1 74.55) (xy 180.6 74.55) ) ) (filled_polygon (pts (xy 149.868649 110.599928) (xy 150.20265 110.701246) (xy 150.55 110.735457) (xy 152.197728 110.735457) (xy 152.205192 110.736773) (xy 152.425725 110.756067) (xy 152.47 110.758) (xy 153.278274 110.758) (xy 153.450212 110.774815) (xy 153.591793 110.817443) (xy 153.722432 110.886692) (xy 153.856504 110.995642) (xy 162.651675 119.694162) (xy 162.688525 119.727215) (xy 162.880383 119.883123) (xy 162.962832 119.937721) (xy 163.18126 120.053505) (xy 163.272724 120.091095) (xy 163.509445 120.162368) (xy 163.606458 120.181526) (xy 163.852502 120.205588) (xy 163.901946 120.208) (xy 166.536945 120.208) (xy 166.462756 120.247655) (xy 166.179839 120.479839) (xy 165.947655 120.762756) (xy 165.775126 121.085534) (xy 165.668884 121.435768) (xy 165.63301 121.8) (xy 165.668884 122.164232) (xy 165.775126 122.514466) (xy 165.947655 122.837244) (xy 166.179839 123.120161) (xy 166.462756 123.352345) (xy 166.785534 123.524874) (xy 167.135768 123.631116) (xy 167.408724 123.658) (xy 168.591276 123.658) (xy 168.864232 123.631116) (xy 169.214466 123.524874) (xy 169.537244 123.352345) (xy 169.820161 123.120161) (xy 169.83454 123.10264) (xy 169.854019 123.136377) (xy 169.980995 123.317717) (xy 170.037914 123.38555) (xy 170.19445 123.542086) (xy 170.262283 123.599005) (xy 170.443623 123.725981) (xy 170.520308 123.770256) (xy 170.720942 123.863814) (xy 170.804155 123.894101) (xy 171.017988 123.951397) (xy 171.105192 123.966773) (xy 171.325725 123.986067) (xy 171.37 123.988) (xy 172.61 123.988) (xy 172.654275 123.986067) (xy 172.874808 123.966773) (xy 172.962012 123.951397) (xy 173.175845 123.894101) (xy 173.259058 123.863814) (xy 173.459692 123.770256) (xy 173.536377 123.725981) (xy 173.717717 123.599005) (xy 173.78555 123.542086) (xy 173.942086 123.38555) (xy 173.999005 123.317717) (xy 174.125981 123.136377) (xy 174.170256 123.059692) (xy 174.263814 122.859058) (xy 174.294101 122.775845) (xy 174.303085 122.742317) (xy 174.392001 122.575967) (xy 174.392001 125.224033) (xy 174.252345 124.962756) (xy 174.020161 124.679839) (xy 173.737244 124.447655) (xy 173.414466 124.275126) (xy 173.064232 124.168884) (xy 172.791276 124.142) (xy 171.608724 124.142) (xy 171.335768 124.168884) (xy 170.985534 124.275126) (xy 170.662756 124.447655) (xy 170.379839 124.679839) (xy 170.147655 124.962756) (xy 170.1 125.051912) (xy 170.052345 124.962756) (xy 169.820161 124.679839) (xy 169.537244 124.447655) (xy 169.214466 124.275126) (xy 168.864232 124.168884) (xy 168.591276 124.142) (xy 167.408724 124.142) (xy 167.135768 124.168884) (xy 166.785534 124.275126) (xy 166.462756 124.447655) (xy 166.179839 124.679839) (xy 165.947655 124.962756) (xy 165.775126 125.285534) (xy 165.668884 125.635768) (xy 165.63301 126) (xy 165.668884 126.364232) (xy 165.775126 126.714466) (xy 165.947655 127.037244) (xy 166.179839 127.320161) (xy 166.462756 127.552345) (xy 166.785534 127.724874) (xy 167.135768 127.831116) (xy 167.408724 127.858) (xy 168.591276 127.858) (xy 168.864232 127.831116) (xy 169.214466 127.724874) (xy 169.537244 127.552345) (xy 169.820161 127.320161) (xy 170.052345 127.037244) (xy 170.1 126.948088) (xy 170.147655 127.037244) (xy 170.379839 127.320161) (xy 170.662756 127.552345) (xy 170.985534 127.724874) (xy 171.335768 127.831116) (xy 171.608724 127.858) (xy 172.791276 127.858) (xy 173.064232 127.831116) (xy 173.414466 127.724874) (xy 173.737244 127.552345) (xy 174.020161 127.320161) (xy 174.252345 127.037244) (xy 174.392001 126.775968) (xy 174.392001 129.424032) (xy 174.252345 129.162756) (xy 174.020161 128.879839) (xy 173.737244 128.647655) (xy 173.414466 128.475126) (xy 173.064232 128.368884) (xy 172.791276 128.342) (xy 171.608724 128.342) (xy 171.335768 128.368884) (xy 170.985534 128.475126) (xy 170.662756 128.647655) (xy 170.379839 128.879839) (xy 170.147655 129.162756) (xy 170.1 129.251912) (xy 170.052345 129.162756) (xy 169.820161 128.879839) (xy 169.537244 128.647655) (xy 169.214466 128.475126) (xy 168.864232 128.368884) (xy 168.591276 128.342) (xy 167.408724 128.342) (xy 167.135768 128.368884) (xy 166.785534 128.475126) (xy 166.462756 128.647655) (xy 166.179839 128.879839) (xy 165.947655 129.162756) (xy 165.775126 129.485534) (xy 165.668884 129.835768) (xy 165.63301 130.2) (xy 165.668884 130.564232) (xy 165.775126 130.914466) (xy 165.947655 131.237244) (xy 166.179839 131.520161) (xy 166.462756 131.752345) (xy 166.785534 131.924874) (xy 167.135768 132.031116) (xy 167.408724 132.058) (xy 168.591276 132.058) (xy 168.864232 132.031116) (xy 169.214466 131.924874) (xy 169.537244 131.752345) (xy 169.820161 131.520161) (xy 170.052345 131.237244) (xy 170.1 131.148088) (xy 170.147655 131.237244) (xy 170.379839 131.520161) (xy 170.662756 131.752345) (xy 170.985534 131.924874) (xy 171.335768 132.031116) (xy 171.608724 132.058) (xy 172.791276 132.058) (xy 173.064232 132.031116) (xy 173.414466 131.924874) (xy 173.737244 131.752345) (xy 174.020161 131.520161) (xy 174.252345 131.237244) (xy 174.392001 130.975968) (xy 174.392 155.891283) (xy 172.691284 157.592) (xy 167.901362 157.592) (xy 167.606363 157.621055) (xy 167.227854 157.735874) (xy 167.172948 157.765222) (xy 167.135768 157.768884) (xy 167.082935 157.784911) (xy 163.246074 153.94805) (xy 163.226185 153.923815) (xy 163.129494 153.844463) (xy 163.01918 153.785498) (xy 162.899482 153.749188) (xy 162.806192 153.74) (xy 162.806181 153.74) (xy 162.775 153.736929) (xy 162.743819 153.74) (xy 159.127461 153.74) (xy 159.074991 153.613327) (xy 158.899015 153.34996) (xy 158.67504 153.125985) (xy 158.411673 152.950009) (xy 158.119036 152.828795) (xy 157.911434 152.7875) (xy 158.119036 152.746205) (xy 158.411673 152.624991) (xy 158.67504 152.449015) (xy 158.899015 152.22504) (xy 159.074991 151.961673) (xy 159.196205 151.669036) (xy 159.258 151.358374) (xy 159.258 151.041626) (xy 159.196205 150.730964) (xy 159.074991 150.438327) (xy 158.899015 150.17496) (xy 158.67504 149.950985) (xy 158.450831 149.801173) (xy 160.152 149.801173) (xy 160.152 150.058827) (xy 160.202266 150.31153) (xy 160.300865 150.54957) (xy 160.44401 150.763801) (xy 160.626199 150.94599) (xy 160.84043 151.089135) (xy 161.07847 151.187734) (xy 161.331173 151.238) (xy 161.588827 151.238) (xy 161.84153 151.187734) (xy 162.07957 151.089135) (xy 162.293801 150.94599) (xy 162.47599 150.763801) (xy 162.619135 150.54957) (xy 162.717734 150.31153) (xy 162.768 150.058827) (xy 162.768 149.801173) (xy 162.721354 149.56667) (xy 164.653026 147.635) (xy 165.75102 147.635) (xy 165.775126 147.714466) (xy 165.947655 148.037244) (xy 166.179839 148.320161) (xy 166.462756 148.552345) (xy 166.785534 148.724874) (xy 167.135768 148.831116) (xy 167.408724 148.858) (xy 168.591276 148.858) (xy 168.864232 148.831116) (xy 169.214466 148.724874) (xy 169.537244 148.552345) (xy 169.820161 148.320161) (xy 170.052345 148.037244) (xy 170.224874 147.714466) (xy 170.331116 147.364232) (xy 170.36699 147) (xy 170.331116 146.635768) (xy 170.224874 146.285534) (xy 170.052345 145.962756) (xy 169.820161 145.679839) (xy 169.537244 145.447655) (xy 169.214466 145.275126) (xy 168.864232 145.168884) (xy 168.591276 145.142) (xy 167.408724 145.142) (xy 167.135768 145.168884) (xy 166.785534 145.275126) (xy 166.462756 145.447655) (xy 166.179839 145.679839) (xy 165.947655 145.962756) (xy 165.775126 146.285534) (xy 165.75102 146.365) (xy 164.421189 146.365) (xy 164.39 146.361928) (xy 164.358811 146.365) (xy 164.358808 146.365) (xy 164.265518 146.374188) (xy 164.14582 146.410498) (xy 164.035506 146.469462) (xy 163.963043 146.528931) (xy 163.963039 146.528935) (xy 163.938815 146.548815) (xy 163.918935 146.573039) (xy 161.82333 148.668646) (xy 161.588827 148.622) (xy 161.331173 148.622) (xy 161.07847 148.672266) (xy 160.84043 148.770865) (xy 160.626199 148.91401) (xy 160.44401 149.096199) (xy 160.300865 149.31043) (xy 160.202266 149.54847) (xy 160.152 149.801173) (xy 158.450831 149.801173) (xy 158.411673 149.775009) (xy 158.285 149.722539) (xy 158.285 142.8) (xy 165.63301 142.8) (xy 165.668884 143.164232) (xy 165.775126 143.514466) (xy 165.947655 143.837244) (xy 166.179839 144.120161) (xy 166.462756 144.352345) (xy 166.785534 144.524874) (xy 167.135768 144.631116) (xy 167.408724 144.658) (xy 168.591276 144.658) (xy 168.864232 144.631116) (xy 169.214466 144.524874) (xy 169.537244 144.352345) (xy 169.820161 144.120161) (xy 170.052345 143.837244) (xy 170.224874 143.514466) (xy 170.331116 143.164232) (xy 170.36699 142.8) (xy 170.331116 142.435768) (xy 170.224874 142.085534) (xy 170.052345 141.762756) (xy 169.820161 141.479839) (xy 169.537244 141.247655) (xy 169.214466 141.075126) (xy 168.864232 140.968884) (xy 168.591276 140.942) (xy 167.408724 140.942) (xy 167.135768 140.968884) (xy 166.785534 141.075126) (xy 166.462756 141.247655) (xy 166.179839 141.479839) (xy 165.947655 141.762756) (xy 165.775126 142.085534) (xy 165.668884 142.435768) (xy 165.63301 142.8) (xy 158.285 142.8) (xy 158.285 138.6) (xy 165.63301 138.6) (xy 165.668884 138.964232) (xy 165.775126 139.314466) (xy 165.947655 139.637244) (xy 166.179839 139.920161) (xy 166.462756 140.152345) (xy 166.785534 140.324874) (xy 167.135768 140.431116) (xy 167.408724 140.458) (xy 168.591276 140.458) (xy 168.864232 140.431116) (xy 169.214466 140.324874) (xy 169.537244 140.152345) (xy 169.820161 139.920161) (xy 170.052345 139.637244) (xy 170.224874 139.314466) (xy 170.331116 138.964232) (xy 170.36699 138.6) (xy 170.331116 138.235768) (xy 170.224874 137.885534) (xy 170.052345 137.562756) (xy 169.820161 137.279839) (xy 169.537244 137.047655) (xy 169.214466 136.875126) (xy 168.864232 136.768884) (xy 168.591276 136.742) (xy 167.408724 136.742) (xy 167.135768 136.768884) (xy 166.785534 136.875126) (xy 166.462756 137.047655) (xy 166.179839 137.279839) (xy 165.947655 137.562756) (xy 165.775126 137.885534) (xy 165.668884 138.235768) (xy 165.63301 138.6) (xy 158.285 138.6) (xy 158.285 136.406189) (xy 158.288072 136.375) (xy 158.284907 136.342863) (xy 158.275812 136.250518) (xy 158.239502 136.13082) (xy 158.227429 136.108233) (xy 158.180538 136.020506) (xy 158.121069 135.948043) (xy 158.121065 135.948039) (xy 158.101185 135.923815) (xy 158.07696 135.903934) (xy 157.831026 135.658) (xy 157.95133 135.658) (xy 158.037275 135.762725) (xy 158.152512 135.857297) (xy 158.283985 135.927571) (xy 158.426641 135.970845) (xy 158.574999 135.985457) (xy 160.625001 135.985457) (xy 160.773359 135.970845) (xy 160.916015 135.927571) (xy 161.047488 135.857297) (xy 161.162725 135.762725) (xy 161.24867 135.658) (xy 166.128825 135.658) (xy 166.179839 135.720161) (xy 166.462756 135.952345) (xy 166.785534 136.124874) (xy 167.135768 136.231116) (xy 167.408724 136.258) (xy 168.591276 136.258) (xy 168.864232 136.231116) (xy 169.214466 136.124874) (xy 169.537244 135.952345) (xy 169.820161 135.720161) (xy 170.052345 135.437244) (xy 170.224874 135.114466) (xy 170.331116 134.764232) (xy 170.36699 134.4) (xy 170.331116 134.035768) (xy 170.224874 133.685534) (xy 170.052345 133.362756) (xy 169.820161 133.079839) (xy 169.537244 132.847655) (xy 169.214466 132.675126) (xy 168.864232 132.568884) (xy 168.591276 132.542) (xy 167.408724 132.542) (xy 167.135768 132.568884) (xy 166.785534 132.675126) (xy 166.462756 132.847655) (xy 166.179839 133.079839) (xy 166.128825 133.142) (xy 161.305129 133.142) (xy 161.257297 133.052512) (xy 161.162725 132.937275) (xy 161.047488 132.842703) (xy 160.916015 132.772429) (xy 160.773359 132.729155) (xy 160.625001 132.714543) (xy 158.574999 132.714543) (xy 158.426641 132.729155) (xy 158.283985 132.772429) (xy 158.152512 132.842703) (xy 158.037275 132.937275) (xy 157.942703 133.052512) (xy 157.894871 133.142) (xy 156.19608 133.142) (xy 154.870333 131.816254) (xy 154.870457 131.815) (xy 154.870457 129.275) (xy 154.836246 128.92765) (xy 154.734928 128.593649) (xy 154.570396 128.285831) (xy 154.348973 128.016027) (xy 154.079169 127.794604) (xy 153.771351 127.630072) (xy 153.43735 127.528754) (xy 153.09 127.494543) (xy 150.55 127.494543) (xy 150.20265 127.528754) (xy 149.868649 127.630072) (xy 149.560831 127.794604) (xy 149.291027 128.016027) (xy 149.069604 128.285831) (xy 148.905072 128.593649) (xy 148.803754 128.92765) (xy 148.769543 129.275) (xy 148.769543 131.815) (xy 148.803754 132.16235) (xy 148.905072 132.496351) (xy 149.069604 132.804169) (xy 149.291027 133.073973) (xy 149.560831 133.295396) (xy 149.868649 133.459928) (xy 150.20265 133.561246) (xy 150.55 133.595457) (xy 153.09 133.595457) (xy 153.091254 133.595333) (xy 154.741761 135.245841) (xy 154.781156 135.293844) (xy 154.972711 135.451049) (xy 155.191255 135.567863) (xy 155.428389 135.639797) (xy 155.613208 135.658) (xy 155.613209 135.658) (xy 155.674999 135.664086) (xy 155.736789 135.658) (xy 156.034975 135.658) (xy 157.015001 136.638027) (xy 157.015 149.722539) (xy 156.888327 149.775009) (xy 156.62496 149.950985) (xy 156.400985 150.17496) (xy 156.225009 150.438327) (xy 156.103795 150.730964) (xy 156.042 151.041626) (xy 156.042 151.358374) (xy 156.103795 151.669036) (xy 156.225009 151.961673) (xy 156.400985 152.22504) (xy 156.62496 152.449015) (xy 156.888327 152.624991) (xy 157.180964 152.746205) (xy 157.388566 152.7875) (xy 157.180964 152.828795) (xy 156.888327 152.950009) (xy 156.62496 153.125985) (xy 156.400985 153.34996) (xy 156.225009 153.613327) (xy 156.103795 153.905964) (xy 156.042 154.216626) (xy 156.042 154.533374) (xy 156.103795 154.844036) (xy 156.225009 155.136673) (xy 156.400985 155.40004) (xy 156.62496 155.624015) (xy 156.888327 155.799991) (xy 157.180964 155.921205) (xy 157.491626 155.983) (xy 157.808374 155.983) (xy 158.119036 155.921205) (xy 158.411673 155.799991) (xy 158.67504 155.624015) (xy 158.899015 155.40004) (xy 159.074991 155.136673) (xy 159.127461 155.01) (xy 162.511976 155.01) (xy 166.000428 158.498452) (xy 165.947655 158.562756) (xy 165.775126 158.885534) (xy 165.668884 159.235768) (xy 165.63301 159.6) (xy 165.668884 159.964232) (xy 165.775126 160.314466) (xy 165.947655 160.637244) (xy 166.179839 160.920161) (xy 166.462756 161.152345) (xy 166.785534 161.324874) (xy 167.135768 161.431116) (xy 167.172948 161.434778) (xy 167.227854 161.464126) (xy 167.606363 161.578945) (xy 167.901362 161.608) (xy 173.424386 161.608) (xy 173.523024 161.617715) (xy 173.916661 161.578945) (xy 174.29517 161.464126) (xy 174.644006 161.277669) (xy 174.949764 161.02674) (xy 175.012646 160.950118) (xy 177.750123 158.212642) (xy 177.82674 158.149764) (xy 177.967 157.978857) (xy 177.967 162.217) (xy 92.933 162.217) (xy 92.933 151.041928) (xy 98.792 151.041928) (xy 98.792 151.398072) (xy 98.861481 151.747374) (xy 98.997771 152.076409) (xy 99.195635 152.372533) (xy 99.447467 152.624365) (xy 99.743591 152.822229) (xy 100.072626 152.958519) (xy 100.421928 153.028) (xy 100.778072 153.028) (xy 101.127374 152.958519) (xy 101.456409 152.822229) (xy 101.752533 152.624365) (xy 102.004365 152.372533) (xy 102.202229 152.076409) (xy 102.338519 151.747374) (xy 102.408 151.398072) (xy 102.408 151.041928) (xy 102.338519 150.692626) (xy 102.202229 150.363591) (xy 102.004365 150.067467) (xy 101.752533 149.815635) (xy 101.456409 149.617771) (xy 101.127374 149.481481) (xy 100.778072 149.412) (xy 100.421928 149.412) (xy 100.072626 149.481481) (xy 99.743591 149.617771) (xy 99.447467 149.815635) (xy 99.195635 150.067467) (xy 98.997771 150.363591) (xy 98.861481 150.692626) (xy 98.792 151.041928) (xy 92.933 151.041928) (xy 92.933 146.236249) (xy 106.442 146.236249) (xy 106.442 146.503751) (xy 106.494187 146.766114) (xy 106.596556 147.013254) (xy 106.745172 147.235675) (xy 106.934325 147.424828) (xy 107.156746 147.573444) (xy 107.317426 147.64) (xy 107.156746 147.706556) (xy 106.934325 147.855172) (xy 106.745172 148.044325) (xy 106.596556 148.266746) (xy 106.494187 148.513886) (xy 106.442 148.776249) (xy 106.442 149.043751) (xy 106.494187 149.306114) (xy 106.596556 149.553254) (xy 106.745172 149.775675) (xy 106.934325 149.964828) (xy 107.156746 150.113444) (xy 107.317426 150.18) (xy 107.156746 150.246556) (xy 106.934325 150.395172) (xy 106.745172 150.584325) (xy 106.596556 150.806746) (xy 106.494187 151.053886) (xy 106.442 151.316249) (xy 106.442 151.583751) (xy 106.494187 151.846114) (xy 106.596556 152.093254) (xy 106.745172 152.315675) (xy 106.934325 152.504828) (xy 107.156746 152.653444) (xy 107.403886 152.755813) (xy 107.666249 152.808) (xy 107.933751 152.808) (xy 108.196114 152.755813) (xy 108.311544 152.708) (xy 108.938456 152.708) (xy 109.053886 152.755813) (xy 109.316249 152.808) (xy 109.583751 152.808) (xy 109.846114 152.755813) (xy 110.093254 152.653444) (xy 110.315675 152.504828) (xy 110.504828 152.315675) (xy 110.653444 152.093254) (xy 110.755813 151.846114) (xy 110.808 151.583751) (xy 110.808 151.316249) (xy 110.755813 151.053886) (xy 110.653444 150.806746) (xy 110.504828 150.584325) (xy 110.315675 150.395172) (xy 110.093254 150.246556) (xy 109.932574 150.18) (xy 110.093254 150.113444) (xy 110.315675 149.964828) (xy 110.504828 149.775675) (xy 110.653444 149.553254) (xy 110.755813 149.306114) (xy 110.808 149.043751) (xy 110.808 148.776249) (xy 110.755813 148.513886) (xy 110.653444 148.266746) (xy 110.504828 148.044325) (xy 110.315675 147.855172) (xy 110.093254 147.706556) (xy 109.932574 147.64) (xy 110.093254 147.573444) (xy 110.315675 147.424828) (xy 110.504828 147.235675) (xy 110.653444 147.013254) (xy 110.755813 146.766114) (xy 110.808 146.503751) (xy 110.808 146.236249) (xy 110.755813 145.973886) (xy 110.653444 145.726746) (xy 110.504828 145.504325) (xy 110.315675 145.315172) (xy 110.093254 145.166556) (xy 109.846114 145.064187) (xy 109.583751 145.012) (xy 109.316249 145.012) (xy 109.053886 145.064187) (xy 108.938456 145.112) (xy 108.311544 145.112) (xy 108.196114 145.064187) (xy 107.933751 145.012) (xy 107.666249 145.012) (xy 107.403886 145.064187) (xy 107.156746 145.166556) (xy 106.934325 145.315172) (xy 106.745172 145.504325) (xy 106.596556 145.726746) (xy 106.494187 145.973886) (xy 106.442 146.236249) (xy 92.933 146.236249) (xy 92.933 112.858) (xy 125.912 112.858) (xy 125.912 120.82899) (xy 125.894947 121.002128) (xy 125.851725 121.144613) (xy 125.781535 121.275928) (xy 125.671166 121.410414) (xy 125.610414 121.471166) (xy 125.475928 121.581535) (xy 125.344613 121.651725) (xy 125.202128 121.694947) (xy 125.02899 121.712) (xy 124.32 121.712) (xy 124.275725 121.713933) (xy 124.056928 121.733075) (xy 123.969723 121.748452) (xy 123.757575 121.805297) (xy 123.674365 121.835583) (xy 123.47531 121.928404) (xy 123.398623 121.972679) (xy 123.218711 122.098655) (xy 123.150878 122.155574) (xy 122.995574 122.310878) (xy 122.938655 122.378711) (xy 122.812679 122.558623) (xy 122.768404 122.63531) (xy 122.675583 122.834365) (xy 122.645297 122.917575) (xy 122.588452 123.129723) (xy 122.573075 123.216928) (xy 122.553933 123.435725) (xy 122.552 123.48) (xy 122.552 125.99) (xy 122.553933 126.034275) (xy 122.573227 126.254808) (xy 122.588603 126.342012) (xy 122.645899 126.555845) (xy 122.676186 126.639058) (xy 122.769744 126.839692) (xy 122.814019 126.916377) (xy 122.940995 127.097717) (xy 122.997914 127.16555) (xy 123.15445 127.322086) (xy 123.222283 127.379005) (xy 123.387288 127.494543) (xy 122.01 127.494543) (xy 121.66265 127.528754) (xy 121.328649 127.630072) (xy 121.020831 127.794604) (xy 120.751027 128.016027) (xy 120.529604 128.285831) (xy 120.365072 128.593649) (xy 120.263754 128.92765) (xy 120.229543 129.275) (xy 120.229543 131.815) (xy 120.229666 131.816253) (xy 117.80416 134.241761) (xy 117.756157 134.281156) (xy 117.618362 134.44906) (xy 117.598951 134.472712) (xy 117.482137 134.691256) (xy 117.410203 134.92839) (xy 117.385914 135.175) (xy 117.392001 135.236802) (xy 117.392 146.74892) (xy 116.488921 147.652) (xy 113.787246 147.652) (xy 113.782198 147.649302) (xy 113.751533 147.64) (xy 113.782198 147.630698) (xy 114.018114 147.504598) (xy 114.224897 147.334897) (xy 114.394598 147.128114) (xy 114.520698 146.892198) (xy 114.59835 146.636214) (xy 114.62457 146.37) (xy 114.59835 146.103786) (xy 114.520698 145.847802) (xy 114.394598 145.611886) (xy 114.224897 145.405103) (xy 114.018114 145.235402) (xy 113.782198 145.109302) (xy 113.526214 145.03165) (xy 113.326706 145.012) (xy 112.813294 145.012) (xy 112.613786 145.03165) (xy 112.357802 145.109302) (xy 112.121886 145.235402) (xy 111.915103 145.405103) (xy 111.745402 145.611886) (xy 111.619302 145.847802) (xy 111.54165 146.103786) (xy 111.51543 146.37) (xy 111.54165 146.636214) (xy 111.619302 146.892198) (xy 111.745402 147.128114) (xy 111.915103 147.334897) (xy 112.121886 147.504598) (xy 112.357802 147.630698) (xy 112.388467 147.64) (xy 112.357802 147.649302) (xy 112.121886 147.775402) (xy 111.915103 147.945103) (xy 111.745402 148.151886) (xy 111.619302 148.387802) (xy 111.54165 148.643786) (xy 111.51543 148.91) (xy 111.54165 149.176214) (xy 111.619302 149.432198) (xy 111.745402 149.668114) (xy 111.915103 149.874897) (xy 112.121886 150.044598) (xy 112.357802 150.170698) (xy 112.388467 150.18) (xy 112.357802 150.189302) (xy 112.121886 150.315402) (xy 111.915103 150.485103) (xy 111.745402 150.691886) (xy 111.619302 150.927802) (xy 111.54165 151.183786) (xy 111.51543 151.45) (xy 111.54165 151.716214) (xy 111.619302 151.972198) (xy 111.745402 152.208114) (xy 111.915103 152.414897) (xy 112.121886 152.584598) (xy 112.357802 152.710698) (xy 112.388467 152.72) (xy 112.357802 152.729302) (xy 112.121886 152.855402) (xy 111.915103 153.025103) (xy 111.745402 153.231886) (xy 111.619302 153.467802) (xy 111.54165 153.723786) (xy 111.51543 153.99) (xy 111.54165 154.256214) (xy 111.619302 154.512198) (xy 111.745402 154.748114) (xy 111.75926 154.765) (xy 110.61118 154.765) (xy 110.579999 154.761929) (xy 110.548818 154.765) (xy 110.548808 154.765) (xy 110.455518 154.774188) (xy 110.33582 154.810498) (xy 110.273076 154.844036) (xy 110.225505 154.869463) (xy 110.178715 154.907863) (xy 110.128815 154.948815) (xy 110.108931 154.973044) (xy 109.854369 155.227606) (xy 109.846114 155.224187) (xy 109.583751 155.172) (xy 109.316249 155.172) (xy 109.053886 155.224187) (xy 108.938456 155.272) (xy 108.311544 155.272) (xy 108.196114 155.224187) (xy 107.933751 155.172) (xy 107.666249 155.172) (xy 107.403886 155.224187) (xy 107.156746 155.326556) (xy 106.934325 155.475172) (xy 106.745172 155.664325) (xy 106.596556 155.886746) (xy 106.494187 156.133886) (xy 106.442 156.396249) (xy 106.442 156.663751) (xy 106.494187 156.926114) (xy 106.596556 157.173254) (xy 106.745172 157.395675) (xy 106.934325 157.584828) (xy 107.156746 157.733444) (xy 107.317426 157.8) (xy 107.156746 157.866556) (xy 106.934325 158.015172) (xy 106.745172 158.204325) (xy 106.596556 158.426746) (xy 106.494187 158.673886) (xy 106.442 158.936249) (xy 106.442 159.203751) (xy 106.494187 159.466114) (xy 106.596556 159.713254) (xy 106.745172 159.935675) (xy 106.934325 160.124828) (xy 107.156746 160.273444) (xy 107.403886 160.375813) (xy 107.666249 160.428) (xy 107.933751 160.428) (xy 108.196114 160.375813) (xy 108.311544 160.328) (xy 108.938456 160.328) (xy 109.053886 160.375813) (xy 109.316249 160.428) (xy 109.583751 160.428) (xy 109.846114 160.375813) (xy 110.093254 160.273444) (xy 110.315675 160.124828) (xy 110.504828 159.935675) (xy 110.653444 159.713254) (xy 110.755813 159.466114) (xy 110.808 159.203751) (xy 110.808 158.936249) (xy 110.755813 158.673886) (xy 110.752394 158.665632) (xy 110.933026 158.485) (xy 111.65287 158.485) (xy 111.619302 158.547802) (xy 111.54165 158.803786) (xy 111.51543 159.07) (xy 111.54165 159.336214) (xy 111.619302 159.592198) (xy 111.745402 159.828114) (xy 111.915103 160.034897) (xy 112.121886 160.204598) (xy 112.357802 160.330698) (xy 112.613786 160.40835) (xy 112.813294 160.428) (xy 113.326706 160.428) (xy 113.526214 160.40835) (xy 113.782198 160.330698) (xy 114.018114 160.204598) (xy 114.224897 160.034897) (xy 114.394598 159.828114) (xy 114.520698 159.592198) (xy 114.59835 159.336214) (xy 114.62457 159.07) (xy 114.59835 158.803786) (xy 114.520698 158.547802) (xy 114.48713 158.485) (xy 115.408819 158.485) (xy 115.44 158.488071) (xy 115.471181 158.485) (xy 115.471192 158.485) (xy 115.564482 158.475812) (xy 115.68418 158.439502) (xy 115.794494 158.380537) (xy 115.891185 158.301185) (xy 115.911074 158.27695) (xy 116.766851 157.421173) (xy 134.117 157.421173) (xy 134.117 157.678827) (xy 134.167266 157.93153) (xy 134.265865 158.16957) (xy 134.40901 158.383801) (xy 134.591199 158.56599) (xy 134.80543 158.709135) (xy 135.04347 158.807734) (xy 135.296173 158.858) (xy 135.553827 158.858) (xy 135.78833 158.811354) (xy 136.22393 159.246955) (xy 136.243815 159.271185) (xy 136.268043 159.291068) (xy 136.340505 159.350537) (xy 136.450818 159.409501) (xy 136.45082 159.409502) (xy 136.570518 159.445812) (xy 136.663808 159.455) (xy 136.663818 159.455) (xy 136.694999 159.458071) (xy 136.72618 159.455) (xy 137.451175 159.455) (xy 137.58401 159.653801) (xy 137.766199 159.83599) (xy 137.98043 159.979135) (xy 138.21847 160.077734) (xy 138.471173 160.128) (xy 138.728827 160.128) (xy 138.98153 160.077734) (xy 139.21957 159.979135) (xy 139.433801 159.83599) (xy 139.61599 159.653801) (xy 139.759135 159.43957) (xy 139.857734 159.20153) (xy 139.908 158.948827) (xy 139.908 158.691173) (xy 139.857734 158.43847) (xy 139.759135 158.20043) (xy 139.61599 157.986199) (xy 139.433801 157.80401) (xy 139.21957 157.660865) (xy 138.98153 157.562266) (xy 138.919865 157.55) (xy 138.98153 157.537734) (xy 139.21957 157.439135) (xy 139.433801 157.29599) (xy 139.61599 157.113801) (xy 139.759135 156.89957) (xy 139.857734 156.66153) (xy 139.908 156.408827) (xy 139.908 156.151173) (xy 139.857734 155.89847) (xy 139.759135 155.66043) (xy 139.61599 155.446199) (xy 139.433801 155.26401) (xy 139.21957 155.120865) (xy 138.98153 155.022266) (xy 138.728827 154.972) (xy 138.471173 154.972) (xy 138.21847 155.022266) (xy 137.98043 155.120865) (xy 137.766199 155.26401) (xy 137.58401 155.446199) (xy 137.440865 155.66043) (xy 137.342266 155.89847) (xy 137.292 156.151173) (xy 137.292 156.408827) (xy 137.342266 156.66153) (xy 137.440865 156.89957) (xy 137.58401 157.113801) (xy 137.766199 157.29599) (xy 137.98043 157.439135) (xy 138.21847 157.537734) (xy 138.280135 157.55) (xy 138.21847 157.562266) (xy 137.98043 157.660865) (xy 137.766199 157.80401) (xy 137.58401 157.986199) (xy 137.451175 158.185) (xy 136.958025 158.185) (xy 136.686354 157.91333) (xy 136.733 157.678827) (xy 136.733 157.421173) (xy 136.682734 157.16847) (xy 136.584135 156.93043) (xy 136.44099 156.716199) (xy 136.258801 156.53401) (xy 136.04457 156.390865) (xy 135.80653 156.292266) (xy 135.553827 156.242) (xy 135.296173 156.242) (xy 135.04347 156.292266) (xy 134.80543 156.390865) (xy 134.591199 156.53401) (xy 134.40901 156.716199) (xy 134.265865 156.93043) (xy 134.167266 157.16847) (xy 134.117 157.421173) (xy 116.766851 157.421173) (xy 119.145632 155.042394) (xy 119.153886 155.045813) (xy 119.416249 155.098) (xy 119.683751 155.098) (xy 119.946114 155.045813) (xy 120.193254 154.943444) (xy 120.415675 154.794828) (xy 120.604828 154.605675) (xy 120.753444 154.383254) (xy 120.855813 154.136114) (xy 120.908 153.873751) (xy 120.908 153.606249) (xy 120.855813 153.343886) (xy 120.753444 153.096746) (xy 120.615302 152.89) (xy 123.269543 152.89) (xy 123.269543 154.59) (xy 123.279351 154.689585) (xy 123.308399 154.785343) (xy 123.355571 154.873595) (xy 123.419052 154.950948) (xy 123.496405 155.014429) (xy 123.584657 155.061601) (xy 123.680415 155.090649) (xy 123.78 155.100457) (xy 125.48 155.100457) (xy 125.579585 155.090649) (xy 125.675343 155.061601) (xy 125.763595 155.014429) (xy 125.840948 154.950948) (xy 125.904429 154.873595) (xy 125.951601 154.785343) (xy 125.980649 154.689585) (xy 125.990457 154.59) (xy 125.990457 152.89) (xy 125.980649 152.790415) (xy 125.951601 152.694657) (xy 125.904429 152.606405) (xy 125.840948 152.529052) (xy 125.763595 152.465571) (xy 125.675343 152.418399) (xy 125.579585 152.389351) (xy 125.48 152.379543) (xy 123.78 152.379543) (xy 123.680415 152.389351) (xy 123.584657 152.418399) (xy 123.496405 152.465571) (xy 123.419052 152.529052) (xy 123.355571 152.606405) (xy 123.308399 152.694657) (xy 123.279351 152.790415) (xy 123.269543 152.89) (xy 120.615302 152.89) (xy 120.604828 152.874325) (xy 120.415675 152.685172) (xy 120.193254 152.536556) (xy 119.946114 152.434187) (xy 119.683751 152.382) (xy 119.416249 152.382) (xy 119.153886 152.434187) (xy 118.906746 152.536556) (xy 118.684325 152.685172) (xy 118.495172 152.874325) (xy 118.346556 153.096746) (xy 118.28 153.257426) (xy 118.213444 153.096746) (xy 118.064828 152.874325) (xy 117.875675 152.685172) (xy 117.653254 152.536556) (xy 117.406114 152.434187) (xy 117.143751 152.382) (xy 116.876249 152.382) (xy 116.613886 152.434187) (xy 116.366746 152.536556) (xy 116.144325 152.685172) (xy 115.955172 152.874325) (xy 115.806556 153.096746) (xy 115.704187 153.343886) (xy 115.652 153.606249) (xy 115.652 153.873751) (xy 115.704187 154.136114) (xy 115.707606 154.144369) (xy 115.086976 154.765) (xy 114.38074 154.765) (xy 114.394598 154.748114) (xy 114.520698 154.512198) (xy 114.59835 154.256214) (xy 114.62457 153.99) (xy 114.59835 153.723786) (xy 114.520698 153.467802) (xy 114.394598 153.231886) (xy 114.224897 153.025103) (xy 114.018114 152.855402) (xy 113.782198 152.729302) (xy 113.751533 152.72) (xy 113.782198 152.710698) (xy 114.018114 152.584598) (xy 114.224897 152.414897) (xy 114.394598 152.208114) (xy 114.520698 151.972198) (xy 114.59835 151.716214) (xy 114.62457 151.45) (xy 114.599947 151.2) (xy 122.943819 151.2) (xy 122.975 151.203071) (xy 123.006181 151.2) (xy 123.006192 151.2) (xy 123.099482 151.190812) (xy 123.21918 151.154502) (xy 123.329494 151.095537) (xy 123.426185 151.016185) (xy 123.446074 150.99195) (xy 124.266671 150.171354) (xy 124.501173 150.218) (xy 124.758827 150.218) (xy 125.01153 150.167734) (xy 125.24957 150.069135) (xy 125.463801 149.92599) (xy 125.64599 149.743801) (xy 125.789135 149.52957) (xy 125.887734 149.29153) (xy 125.938 149.038827) (xy 125.938 148.781173) (xy 125.887734 148.52847) (xy 125.789135 148.29043) (xy 125.64599 148.076199) (xy 125.463801 147.89401) (xy 125.24957 147.750865) (xy 125.01153 147.652266) (xy 124.758827 147.602) (xy 124.501173 147.602) (xy 124.24847 147.652266) (xy 124.01043 147.750865) (xy 123.796199 147.89401) (xy 123.61401 148.076199) (xy 123.470865 148.29043) (xy 123.372266 148.52847) (xy 123.322 148.781173) (xy 123.322 149.038827) (xy 123.368646 149.273329) (xy 122.711976 149.93) (xy 117.8378 149.93) (xy 117.843801 149.92599) (xy 118.02599 149.743801) (xy 118.168382 149.530698) (xy 119.495842 148.203238) (xy 119.543844 148.163844) (xy 119.701049 147.972289) (xy 119.817863 147.753745) (xy 119.889797 147.516611) (xy 119.908 147.331792) (xy 119.908 147.331791) (xy 119.914086 147.270001) (xy 119.908 147.208209) (xy 119.908 135.696079) (xy 122.008747 133.595334) (xy 122.01 133.595457) (xy 124.55 133.595457) (xy 124.89735 133.561246) (xy 125.231351 133.459928) (xy 125.539169 133.295396) (xy 125.808973 133.073973) (xy 126.030396 132.804169) (xy 126.194928 132.496351) (xy 126.296246 132.16235) (xy 126.330457 131.815) (xy 126.330457 129.275) (xy 126.296246 128.92765) (xy 126.216397 128.664422) (xy 127.805001 130.253027) (xy 127.805 150.051175) (xy 127.606199 150.18401) (xy 127.42401 150.366199) (xy 127.280865 150.58043) (xy 127.182266 150.81847) (xy 127.132 151.071173) (xy 127.132 151.328827) (xy 127.182266 151.58153) (xy 127.280865 151.81957) (xy 127.42401 152.033801) (xy 127.606199 152.21599) (xy 127.82043 152.359135) (xy 128.05847 152.457734) (xy 128.311173 152.508) (xy 128.568827 152.508) (xy 128.82153 152.457734) (xy 129.05957 152.359135) (xy 129.273801 152.21599) (xy 129.45599 152.033801) (xy 129.599135 151.81957) (xy 129.697734 151.58153) (xy 129.748 151.328827) (xy 129.748 151.071173) (xy 134.752 151.071173) (xy 134.752 151.328827) (xy 134.802 151.580193) (xy 134.802001 153.994803) (xy 134.752 154.246173) (xy 134.752 154.503827) (xy 134.802266 154.75653) (xy 134.900865 154.99457) (xy 135.04401 155.208801) (xy 135.226199 155.39099) (xy 135.44043 155.534135) (xy 135.67847 155.632734) (xy 135.931173 155.683) (xy 136.188827 155.683) (xy 136.44153 155.632734) (xy 136.67957 155.534135) (xy 136.893801 155.39099) (xy 137.07599 155.208801) (xy 137.219135 154.99457) (xy 137.317734 154.75653) (xy 137.368 154.503827) (xy 137.368 154.246173) (xy 137.318 153.994807) (xy 137.318 152.458) (xy 137.579211 152.458) (xy 137.604657 152.471601) (xy 137.700415 152.500649) (xy 137.8 152.510457) (xy 139.4 152.510457) (xy 139.499585 152.500649) (xy 139.595343 152.471601) (xy 139.683595 152.424429) (xy 139.760948 152.360948) (xy 139.824429 152.283595) (xy 139.871601 152.195343) (xy 139.900649 152.099585) (xy 139.910457 152) (xy 139.910457 150.4) (xy 139.900649 150.300415) (xy 139.871601 150.204657) (xy 139.824429 150.116405) (xy 139.760948 150.039052) (xy 139.683595 149.975571) (xy 139.595343 149.928399) (xy 139.499585 149.899351) (xy 139.4 149.889543) (xy 137.8 149.889543) (xy 137.700415 149.899351) (xy 137.604657 149.928399) (xy 137.579211 149.942) (xy 136.440193 149.942) (xy 136.188827 149.892) (xy 135.931173 149.892) (xy 135.67847 149.942266) (xy 135.44043 150.040865) (xy 135.226199 150.18401) (xy 135.04401 150.366199) (xy 134.900865 150.58043) (xy 134.802266 150.81847) (xy 134.752 151.071173) (xy 129.748 151.071173) (xy 129.697734 150.81847) (xy 129.599135 150.58043) (xy 129.45599 150.366199) (xy 129.273801 150.18401) (xy 129.075 150.051175) (xy 129.075 130.021189) (xy 129.078072 129.99) (xy 129.075 129.958808) (xy 129.065812 129.865518) (xy 129.029502 129.74582) (xy 128.970538 129.635506) (xy 128.911069 129.563043) (xy 128.911065 129.563039) (xy 128.891185 129.538815) (xy 128.866961 129.518935) (xy 126.982817 127.634792) (xy 127.039427 127.611343) (xy 127.258993 127.493982) (xy 127.341794 127.438656) (xy 127.534245 127.280716) (xy 127.571184 127.247236) (xy 130.607236 124.211184) (xy 130.640716 124.174245) (xy 130.798656 123.981794) (xy 130.853982 123.898993) (xy 130.971343 123.679427) (xy 131.009453 123.587421) (xy 131.081723 123.349177) (xy 131.101151 123.251506) (xy 131.125554 123.003742) (xy 131.128 122.953949) (xy 131.128 112.858) (xy 145.748975 112.858) (xy 143.888046 114.71893) (xy 143.863816 114.738815) (xy 143.843932 114.763044) (xy 143.784463 114.835507) (xy 143.725498 114.945821) (xy 143.689189 115.065519) (xy 143.676929 115.19) (xy 143.680001 115.221191) (xy 143.680001 125.342) (xy 143.605343 125.342) (xy 143.458899 125.371129) (xy 143.320952 125.428269) (xy 143.196803 125.511223) (xy 143.091223 125.616803) (xy 143.008269 125.740952) (xy 142.951129 125.878899) (xy 142.922 126.025343) (xy 142.922 126.174657) (xy 142.951129 126.321101) (xy 143.008269 126.459048) (xy 143.045001 126.514021) (xy 143.045 132.181191) (xy 143.045001 132.181201) (xy 143.045 156.248819) (xy 143.041929 156.28) (xy 143.045 156.311181) (xy 143.045 156.311191) (xy 143.054188 156.404481) (xy 143.090498 156.524179) (xy 143.149463 156.634493) (xy 143.228815 156.731185) (xy 143.25305 156.751074) (xy 144.958646 158.456671) (xy 144.912 158.691173) (xy 144.912 158.948827) (xy 144.962266 159.20153) (xy 145.060865 159.43957) (xy 145.20401 159.653801) (xy 145.386199 159.83599) (xy 145.60043 159.979135) (xy 145.83847 160.077734) (xy 146.091173 160.128) (xy 146.348827 160.128) (xy 146.60153 160.077734) (xy 146.83957 159.979135) (xy 147.053801 159.83599) (xy 147.23599 159.653801) (xy 147.379135 159.43957) (xy 147.477734 159.20153) (xy 147.528 158.948827) (xy 147.528 158.691173) (xy 147.477734 158.43847) (xy 147.379135 158.20043) (xy 147.23599 157.986199) (xy 147.053801 157.80401) (xy 146.83957 157.660865) (xy 146.60153 157.562266) (xy 146.539865 157.55) (xy 146.60153 157.537734) (xy 146.83957 157.439135) (xy 147.053801 157.29599) (xy 147.23599 157.113801) (xy 147.379135 156.89957) (xy 147.477734 156.66153) (xy 147.528 156.408827) (xy 147.528 156.151173) (xy 147.477734 155.89847) (xy 147.379135 155.66043) (xy 147.23599 155.446199) (xy 147.053801 155.26401) (xy 146.83957 155.120865) (xy 146.60153 155.022266) (xy 146.539865 155.01) (xy 146.600193 154.998) (xy 148.419543 154.998) (xy 148.419543 155.475) (xy 148.429351 155.574585) (xy 148.458399 155.670343) (xy 148.505571 155.758595) (xy 148.569052 155.835948) (xy 148.646405 155.899429) (xy 148.734657 155.946601) (xy 148.772 155.957929) (xy 148.772001 157.169803) (xy 148.722 157.421173) (xy 148.722 157.678827) (xy 148.772266 157.93153) (xy 148.870865 158.16957) (xy 149.01401 158.383801) (xy 149.196199 158.56599) (xy 149.41043 158.709135) (xy 149.64847 158.807734) (xy 149.901173 158.858) (xy 150.158827 158.858) (xy 150.41153 158.807734) (xy 150.64957 158.709135) (xy 150.863801 158.56599) (xy 151.04599 158.383801) (xy 151.189135 158.16957) (xy 151.287734 157.93153) (xy 151.338 157.678827) (xy 151.338 157.421173) (xy 160.152 157.421173) (xy 160.152 157.678827) (xy 160.202266 157.93153) (xy 160.300865 158.16957) (xy 160.44401 158.383801) (xy 160.626199 158.56599) (xy 160.84043 158.709135) (xy 161.07847 158.807734) (xy 161.331173 158.858) (xy 161.588827 158.858) (xy 161.84153 158.807734) (xy 162.07957 158.709135) (xy 162.293801 158.56599) (xy 162.47599 158.383801) (xy 162.619135 158.16957) (xy 162.717734 157.93153) (xy 162.768 157.678827) (xy 162.768 157.421173) (xy 162.717734 157.16847) (xy 162.619135 156.93043) (xy 162.47599 156.716199) (xy 162.293801 156.53401) (xy 162.07957 156.390865) (xy 161.84153 156.292266) (xy 161.588827 156.242) (xy 161.331173 156.242) (xy 161.07847 156.292266) (xy 160.84043 156.390865) (xy 160.626199 156.53401) (xy 160.44401 156.716199) (xy 160.300865 156.93043) (xy 160.202266 157.16847) (xy 160.152 157.421173) (xy 151.338 157.421173) (xy 151.288 157.169807) (xy 151.288 155.957929) (xy 151.325343 155.946601) (xy 151.413595 155.899429) (xy 151.490948 155.835948) (xy 151.554429 155.758595) (xy 151.601601 155.670343) (xy 151.630649 155.574585) (xy 151.640457 155.475) (xy 151.640457 153.275) (xy 151.630649 153.175415) (xy 151.601601 153.079657) (xy 151.554429 152.991405) (xy 151.490948 152.914052) (xy 151.413595 152.850571) (xy 151.325343 152.803399) (xy 151.288 152.792071) (xy 151.288 152.782929) (xy 151.325343 152.771601) (xy 151.413595 152.724429) (xy 151.490948 152.660948) (xy 151.554429 152.583595) (xy 151.601601 152.495343) (xy 151.630649 152.399585) (xy 151.640457 152.3) (xy 151.640457 150.1) (xy 151.630649 150.000415) (xy 151.601601 149.904657) (xy 151.554429 149.816405) (xy 151.490948 149.739052) (xy 151.413595 149.675571) (xy 151.325343 149.628399) (xy 151.229585 149.599351) (xy 151.13 149.589543) (xy 148.93 149.589543) (xy 148.830415 149.599351) (xy 148.734657 149.628399) (xy 148.646405 149.675571) (xy 148.569052 149.739052) (xy 148.505571 149.816405) (xy 148.458399 149.904657) (xy 148.429351 150.000415) (xy 148.419543 150.1) (xy 148.419543 152.3) (xy 148.429351 152.399585) (xy 148.454351 152.482) (xy 146.600193 152.482) (xy 146.539865 152.47) (xy 146.60153 152.457734) (xy 146.83957 152.359135) (xy 147.053801 152.21599) (xy 147.23599 152.033801) (xy 147.379135 151.81957) (xy 147.477734 151.58153) (xy 147.528 151.328827) (xy 147.528 151.071173) (xy 147.477734 150.81847) (xy 147.379135 150.58043) (xy 147.23599 150.366199) (xy 147.053801 150.18401) (xy 146.83957 150.040865) (xy 146.60153 149.942266) (xy 146.348827 149.892) (xy 146.091173 149.892) (xy 145.83847 149.942266) (xy 145.60043 150.040865) (xy 145.386199 150.18401) (xy 145.20401 150.366199) (xy 145.060865 150.58043) (xy 144.962266 150.81847) (xy 144.95 150.880135) (xy 144.95 123.426249) (xy 149.192 123.426249) (xy 149.192 123.693751) (xy 149.244187 123.956114) (xy 149.346556 124.203254) (xy 149.495172 124.425675) (xy 149.684325 124.614828) (xy 149.906746 124.763444) (xy 150.067426 124.83) (xy 149.906746 124.896556) (xy 149.684325 125.045172) (xy 149.495172 125.234325) (xy 149.346556 125.456746) (xy 149.244187 125.703886) (xy 149.192 125.966249) (xy 149.192 126.233751) (xy 149.244187 126.496114) (xy 149.346556 126.743254) (xy 149.495172 126.965675) (xy 149.684325 127.154828) (xy 149.906746 127.303444) (xy 150.153886 127.405813) (xy 150.416249 127.458) (xy 150.683751 127.458) (xy 150.946114 127.405813) (xy 151.193254 127.303444) (xy 151.415675 127.154828) (xy 151.604828 126.965675) (xy 151.753444 126.743254) (xy 151.855813 126.496114) (xy 151.908 126.233751) (xy 151.908 125.966249) (xy 151.855813 125.703886) (xy 151.753444 125.456746) (xy 151.604828 125.234325) (xy 151.415675 125.045172) (xy 151.193254 124.896556) (xy 151.032574 124.83) (xy 151.193254 124.763444) (xy 151.415675 124.614828) (xy 151.604828 124.425675) (xy 151.753444 124.203254) (xy 151.855813 123.956114) (xy 151.908 123.693751) (xy 151.908 123.426249) (xy 151.855813 123.163886) (xy 151.753444 122.916746) (xy 151.604828 122.694325) (xy 151.415675 122.505172) (xy 151.193254 122.356556) (xy 150.946114 122.254187) (xy 150.683751 122.202) (xy 150.416249 122.202) (xy 150.153886 122.254187) (xy 149.906746 122.356556) (xy 149.684325 122.505172) (xy 149.495172 122.694325) (xy 149.346556 122.916746) (xy 149.244187 123.163886) (xy 149.192 123.426249) (xy 144.95 123.426249) (xy 144.95 115.453024) (xy 149.825931 110.577095) ) ) ) (zone (net 7) (net_name +12V) (layer F.Cu) (tstamp 60531360) (hatch edge 0.508) (priority 1) (connect_pads yes (clearance 0.254)) (min_thickness 0.508) (fill yes (arc_segments 32) (thermal_gap 2.54) (thermal_bridge_width 2.54) (smoothing fillet) (radius 1.27)) (polygon (pts (xy 180.6 74.55) (xy 180.6 111.3) (xy 156.45 111.3) (xy 154.35 109.2) (xy 150.15 109.2) (xy 147 112.35) (xy 86.1 112.35) (xy 86.1 74.55) ) ) (filled_polygon (pts (xy 177.967001 111.046) (xy 166.380772 111.046) (xy 166.289586 110.971166) (xy 161.37375 106.05533) (xy 162.42908 105) (xy 165.63301 105) (xy 165.668884 105.364232) (xy 165.775126 105.714466) (xy 165.947655 106.037244) (xy 166.179839 106.320161) (xy 166.462756 106.552345) (xy 166.785534 106.724874) (xy 167.135768 106.831116) (xy 167.408724 106.858) (xy 168.591276 106.858) (xy 168.864232 106.831116) (xy 169.214466 106.724874) (xy 169.537244 106.552345) (xy 169.820161 106.320161) (xy 170.052345 106.037244) (xy 170.224874 105.714466) (xy 170.331116 105.364232) (xy 170.36699 105) (xy 170.331116 104.635768) (xy 170.224874 104.285534) (xy 170.052345 103.962756) (xy 169.820161 103.679839) (xy 169.537244 103.447655) (xy 169.214466 103.275126) (xy 168.864232 103.168884) (xy 168.591276 103.142) (xy 167.408724 103.142) (xy 167.135768 103.168884) (xy 166.785534 103.275126) (xy 166.462756 103.447655) (xy 166.179839 103.679839) (xy 165.947655 103.962756) (xy 165.775126 104.285534) (xy 165.668884 104.635768) (xy 165.63301 105) (xy 162.42908 105) (xy 165.37108 102.058) (xy 166.128825 102.058) (xy 166.179839 102.120161) (xy 166.462756 102.352345) (xy 166.785534 102.524874) (xy 167.135768 102.631116) (xy 167.408724 102.658) (xy 168.591276 102.658) (xy 168.864232 102.631116) (xy 169.214466 102.524874) (xy 169.537244 102.352345) (xy 169.820161 102.120161) (xy 169.861095 102.070282) (xy 169.897513 102.190335) (xy 169.967888 102.321998) (xy 170.062598 102.437402) (xy 170.178002 102.532112) (xy 170.309665 102.602487) (xy 170.452528 102.645824) (xy 170.6011 102.660457) (xy 173.7989 102.660457) (xy 173.947472 102.645824) (xy 174.090335 102.602487) (xy 174.221998 102.532112) (xy 174.337402 102.437402) (xy 174.432112 102.321998) (xy 174.502487 102.190335) (xy 174.545824 102.047472) (xy 174.560457 101.8989) (xy 174.560457 99.7011) (xy 174.545824 99.552528) (xy 174.502487 99.409665) (xy 174.432112 99.278002) (xy 174.337402 99.162598) (xy 174.221998 99.067888) (xy 174.090335 98.997513) (xy 173.947472 98.954176) (xy 173.7989 98.939543) (xy 170.6011 98.939543) (xy 170.452528 98.954176) (xy 170.309665 98.997513) (xy 170.178002 99.067888) (xy 170.062598 99.162598) (xy 169.967888 99.278002) (xy 169.897513 99.409665) (xy 169.861095 99.529718) (xy 169.820161 99.479839) (xy 169.537244 99.247655) (xy 169.214466 99.075126) (xy 168.864232 98.968884) (xy 168.591276 98.942) (xy 167.408724 98.942) (xy 167.135768 98.968884) (xy 166.785534 99.075126) (xy 166.462756 99.247655) (xy 166.179839 99.479839) (xy 166.128825 99.542) (xy 164.911791 99.542) (xy 164.849999 99.535914) (xy 164.603389 99.560203) (xy 164.366255 99.632137) (xy 164.147711 99.748951) (xy 163.956156 99.906156) (xy 163.916761 99.954159) (xy 158.958921 104.912) (xy 154.03688 104.912) (xy 153.771351 104.770072) (xy 153.43735 104.668754) (xy 153.09 104.634543) (xy 150.55 104.634543) (xy 150.20265 104.668754) (xy 149.868649 104.770072) (xy 149.560831 104.934604) (xy 149.291027 105.156027) (xy 149.069604 105.425831) (xy 148.905072 105.733649) (xy 148.803754 106.06765) (xy 148.769543 106.415) (xy 148.769543 108.955) (xy 148.803754 109.30235) (xy 148.905072 109.636351) (xy 148.927905 109.679069) (xy 146.516384 112.090591) (xy 146.461469 112.096) (xy 125.908 112.096) (xy 125.908 111.996249) (xy 125.855813 111.733886) (xy 125.753444 111.486746) (xy 125.604828 111.264325) (xy 125.415675 111.075172) (xy 125.193254 110.926556) (xy 124.946114 110.824187) (xy 124.683751 110.772) (xy 124.416249 110.772) (xy 124.153886 110.824187) (xy 123.906746 110.926556) (xy 123.684325 111.075172) (xy 123.495172 111.264325) (xy 123.346556 111.486746) (xy 123.244187 111.733886) (xy 123.192 111.996249) (xy 123.192 112.096) (xy 113.794729 112.096) (xy 113.782198 112.089302) (xy 113.526214 112.01165) (xy 113.326706 111.992) (xy 112.813294 111.992) (xy 112.613786 112.01165) (xy 112.357802 112.089302) (xy 112.345271 112.096) (xy 109.971201 112.096) (xy 109.846114 112.044187) (xy 109.583751 111.992) (xy 109.316249 111.992) (xy 109.053886 112.044187) (xy 108.928799 112.096) (xy 108.321201 112.096) (xy 108.196114 112.044187) (xy 107.933751 111.992) (xy 107.666249 111.992) (xy 107.403886 112.044187) (xy 107.278799 112.096) (xy 92.933 112.096) (xy 92.933 98.108725) (xy 117.842 98.108725) (xy 117.842 99.291276) (xy 117.868884 99.564232) (xy 117.975126 99.914466) (xy 118.147656 100.237244) (xy 118.37984 100.520161) (xy 118.662757 100.752345) (xy 118.985535 100.924874) (xy 119.335769 101.031116) (xy 119.7 101.06699) (xy 120.064232 101.031116) (xy 120.414466 100.924874) (xy 120.737244 100.752345) (xy 121.020161 100.520161) (xy 121.252345 100.237244) (xy 121.424874 99.914466) (xy 121.531116 99.564232) (xy 121.558 99.291276) (xy 121.558 98.108725) (xy 122.042 98.108725) (xy 122.042 99.291276) (xy 122.068884 99.564232) (xy 122.175126 99.914466) (xy 122.347656 100.237244) (xy 122.57984 100.520161) (xy 122.862757 100.752345) (xy 123.185535 100.924874) (xy 123.535769 101.031116) (xy 123.9 101.06699) (xy 124.264232 101.031116) (xy 124.614466 100.924874) (xy 124.937244 100.752345) (xy 125.220161 100.520161) (xy 125.452345 100.237244) (xy 125.624874 99.914466) (xy 125.731116 99.564232) (xy 125.758 99.291276) (xy 125.758 98.108725) (xy 126.242 98.108725) (xy 126.242 99.291276) (xy 126.268884 99.564232) (xy 126.375126 99.914466) (xy 126.547656 100.237244) (xy 126.77984 100.520161) (xy 127.062757 100.752345) (xy 127.385535 100.924874) (xy 127.735769 101.031116) (xy 128.1 101.06699) (xy 128.464232 101.031116) (xy 128.814466 100.924874) (xy 129.137244 100.752345) (xy 129.420161 100.520161) (xy 129.652345 100.237244) (xy 129.824874 99.914466) (xy 129.931116 99.564232) (xy 129.958 99.291276) (xy 129.958 98.108725) (xy 130.442 98.108725) (xy 130.442 99.291276) (xy 130.468884 99.564232) (xy 130.575126 99.914466) (xy 130.747656 100.237244) (xy 130.97984 100.520161) (xy 131.262757 100.752345) (xy 131.585535 100.924874) (xy 131.935769 101.031116) (xy 132.3 101.06699) (xy 132.664232 101.031116) (xy 133.014466 100.924874) (xy 133.337244 100.752345) (xy 133.620161 100.520161) (xy 133.852345 100.237244) (xy 134.024874 99.914466) (xy 134.131116 99.564232) (xy 134.158 99.291276) (xy 134.158 98.108725) (xy 140.942 98.108725) (xy 140.942 99.291276) (xy 140.968884 99.564232) (xy 141.075126 99.914466) (xy 141.247656 100.237244) (xy 141.47984 100.520161) (xy 141.762757 100.752345) (xy 142.085535 100.924874) (xy 142.435769 101.031116) (xy 142.8 101.06699) (xy 143.164232 101.031116) (xy 143.514466 100.924874) (xy 143.837244 100.752345) (xy 144.120161 100.520161) (xy 144.352345 100.237244) (xy 144.524874 99.914466) (xy 144.631116 99.564232) (xy 144.658 99.291276) (xy 144.658 98.108725) (xy 145.142 98.108725) (xy 145.142 99.291276) (xy 145.168884 99.564232) (xy 145.275126 99.914466) (xy 145.447656 100.237244) (xy 145.67984 100.520161) (xy 145.962757 100.752345) (xy 146.285535 100.924874) (xy 146.635769 101.031116) (xy 147 101.06699) (xy 147.364232 101.031116) (xy 147.714466 100.924874) (xy 148.037244 100.752345) (xy 148.320161 100.520161) (xy 148.552345 100.237244) (xy 148.724874 99.914466) (xy 148.831116 99.564232) (xy 148.858 99.291276) (xy 148.858 98.108725) (xy 149.342 98.108725) (xy 149.342 99.291276) (xy 149.368884 99.564232) (xy 149.475126 99.914466) (xy 149.647656 100.237244) (xy 149.87984 100.520161) (xy 150.162757 100.752345) (xy 150.485535 100.924874) (xy 150.835769 101.031116) (xy 151.2 101.06699) (xy 151.564232 101.031116) (xy 151.914466 100.924874) (xy 152.237244 100.752345) (xy 152.520161 100.520161) (xy 152.752345 100.237244) (xy 152.924874 99.914466) (xy 153.031116 99.564232) (xy 153.058 99.291276) (xy 153.058 98.108725) (xy 153.542 98.108725) (xy 153.542 99.291276) (xy 153.568884 99.564232) (xy 153.675126 99.914466) (xy 153.847656 100.237244) (xy 154.07984 100.520161) (xy 154.362757 100.752345) (xy 154.685535 100.924874) (xy 155.035769 101.031116) (xy 155.4 101.06699) (xy 155.764232 101.031116) (xy 156.114466 100.924874) (xy 156.437244 100.752345) (xy 156.720161 100.520161) (xy 156.952345 100.237244) (xy 157.124874 99.914466) (xy 157.231116 99.564232) (xy 157.258 99.291276) (xy 157.258 98.108724) (xy 157.231116 97.835768) (xy 157.124874 97.485534) (xy 156.952345 97.162756) (xy 156.720161 96.879839) (xy 156.437243 96.647655) (xy 156.114465 96.475126) (xy 155.764231 96.368884) (xy 155.4 96.33301) (xy 155.035768 96.368884) (xy 154.685534 96.475126) (xy 154.362756 96.647655) (xy 154.079839 96.879839) (xy 153.847655 97.162757) (xy 153.675126 97.485535) (xy 153.568884 97.835769) (xy 153.542 98.108725) (xy 153.058 98.108725) (xy 153.058 98.108724) (xy 153.031116 97.835768) (xy 152.924874 97.485534) (xy 152.752345 97.162756) (xy 152.520161 96.879839) (xy 152.237243 96.647655) (xy 151.914465 96.475126) (xy 151.564231 96.368884) (xy 151.2 96.33301) (xy 150.835768 96.368884) (xy 150.485534 96.475126) (xy 150.162756 96.647655) (xy 149.879839 96.879839) (xy 149.647655 97.162757) (xy 149.475126 97.485535) (xy 149.368884 97.835769) (xy 149.342 98.108725) (xy 148.858 98.108725) (xy 148.858 98.108724) (xy 148.831116 97.835768) (xy 148.724874 97.485534) (xy 148.552345 97.162756) (xy 148.320161 96.879839) (xy 148.037243 96.647655) (xy 147.714465 96.475126) (xy 147.364231 96.368884) (xy 147 96.33301) (xy 146.635768 96.368884) (xy 146.285534 96.475126) (xy 145.962756 96.647655) (xy 145.679839 96.879839) (xy 145.447655 97.162757) (xy 145.275126 97.485535) (xy 145.168884 97.835769) (xy 145.142 98.108725) (xy 144.658 98.108725) (xy 144.658 98.108724) (xy 144.631116 97.835768) (xy 144.524874 97.485534) (xy 144.352345 97.162756) (xy 144.120161 96.879839) (xy 143.837243 96.647655) (xy 143.514465 96.475126) (xy 143.164231 96.368884) (xy 142.8 96.33301) (xy 142.435768 96.368884) (xy 142.085534 96.475126) (xy 141.762756 96.647655) (xy 141.479839 96.879839) (xy 141.247655 97.162757) (xy 141.075126 97.485535) (xy 140.968884 97.835769) (xy 140.942 98.108725) (xy 134.158 98.108725) (xy 134.158 98.108724) (xy 134.131116 97.835768) (xy 134.024874 97.485534) (xy 133.852345 97.162756) (xy 133.620161 96.879839) (xy 133.337243 96.647655) (xy 133.014465 96.475126) (xy 132.664231 96.368884) (xy 132.3 96.33301) (xy 131.935768 96.368884) (xy 131.585534 96.475126) (xy 131.262756 96.647655) (xy 130.979839 96.879839) (xy 130.747655 97.162757) (xy 130.575126 97.485535) (xy 130.468884 97.835769) (xy 130.442 98.108725) (xy 129.958 98.108725) (xy 129.958 98.108724) (xy 129.931116 97.835768) (xy 129.824874 97.485534) (xy 129.652345 97.162756) (xy 129.420161 96.879839) (xy 129.137243 96.647655) (xy 128.814465 96.475126) (xy 128.464231 96.368884) (xy 128.1 96.33301) (xy 127.735768 96.368884) (xy 127.385534 96.475126) (xy 127.062756 96.647655) (xy 126.779839 96.879839) (xy 126.547655 97.162757) (xy 126.375126 97.485535) (xy 126.268884 97.835769) (xy 126.242 98.108725) (xy 125.758 98.108725) (xy 125.758 98.108724) (xy 125.731116 97.835768) (xy 125.624874 97.485534) (xy 125.452345 97.162756) (xy 125.220161 96.879839) (xy 124.937243 96.647655) (xy 124.614465 96.475126) (xy 124.264231 96.368884) (xy 123.9 96.33301) (xy 123.535768 96.368884) (xy 123.185534 96.475126) (xy 122.862756 96.647655) (xy 122.579839 96.879839) (xy 122.347655 97.162757) (xy 122.175126 97.485535) (xy 122.068884 97.835769) (xy 122.042 98.108725) (xy 121.558 98.108725) (xy 121.558 98.108724) (xy 121.531116 97.835768) (xy 121.424874 97.485534) (xy 121.252345 97.162756) (xy 121.020161 96.879839) (xy 120.737243 96.647655) (xy 120.414465 96.475126) (xy 120.064231 96.368884) (xy 119.7 96.33301) (xy 119.335768 96.368884) (xy 118.985534 96.475126) (xy 118.662756 96.647655) (xy 118.379839 96.879839) (xy 118.147655 97.162757) (xy 117.975126 97.485535) (xy 117.868884 97.835769) (xy 117.842 98.108725) (xy 92.933 98.108725) (xy 92.933 92.4) (xy 165.63301 92.4) (xy 165.668884 92.764232) (xy 165.775126 93.114466) (xy 165.947655 93.437244) (xy 166.179839 93.720161) (xy 166.462756 93.952345) (xy 166.785534 94.124874) (xy 167.135768 94.231116) (xy 167.408724 94.258) (xy 168.591276 94.258) (xy 168.864232 94.231116) (xy 169.214466 94.124874) (xy 169.537244 93.952345) (xy 169.820161 93.720161) (xy 170.052345 93.437244) (xy 170.224874 93.114466) (xy 170.331116 92.764232) (xy 170.36699 92.4) (xy 170.331116 92.035768) (xy 170.224874 91.685534) (xy 170.052345 91.362756) (xy 169.820161 91.079839) (xy 169.537244 90.847655) (xy 169.214466 90.675126) (xy 168.864232 90.568884) (xy 168.591276 90.542) (xy 167.408724 90.542) (xy 167.135768 90.568884) (xy 166.785534 90.675126) (xy 166.462756 90.847655) (xy 166.179839 91.079839) (xy 165.947655 91.362756) (xy 165.775126 91.685534) (xy 165.668884 92.035768) (xy 165.63301 92.4) (xy 92.933 92.4) (xy 92.933 88.001928) (xy 98.792 88.001928) (xy 98.792 88.358072) (xy 98.861481 88.707374) (xy 98.997771 89.036409) (xy 99.195635 89.332533) (xy 99.447467 89.584365) (xy 99.743591 89.782229) (xy 100.072626 89.918519) (xy 100.421928 89.988) (xy 100.778072 89.988) (xy 101.127374 89.918519) (xy 101.456409 89.782229) (xy 101.752533 89.584365) (xy 102.004365 89.332533) (xy 102.202229 89.036409) (xy 102.338519 88.707374) (xy 102.408 88.358072) (xy 102.408 88.2) (xy 165.63301 88.2) (xy 165.668884 88.564232) (xy 165.775126 88.914466) (xy 165.947655 89.237244) (xy 166.179839 89.520161) (xy 166.462756 89.752345) (xy 166.785534 89.924874) (xy 167.135768 90.031116) (xy 167.408724 90.058) (xy 168.591276 90.058) (xy 168.864232 90.031116) (xy 169.214466 89.924874) (xy 169.537244 89.752345) (xy 169.820161 89.520161) (xy 170.052345 89.237244) (xy 170.224874 88.914466) (xy 170.331116 88.564232) (xy 170.36699 88.2) (xy 170.331116 87.835768) (xy 170.224874 87.485534) (xy 170.052345 87.162756) (xy 169.820161 86.879839) (xy 169.537244 86.647655) (xy 169.214466 86.475126) (xy 168.864232 86.368884) (xy 168.591276 86.342) (xy 167.408724 86.342) (xy 167.135768 86.368884) (xy 166.785534 86.475126) (xy 166.462756 86.647655) (xy 166.179839 86.879839) (xy 165.947655 87.162756) (xy 165.775126 87.485534) (xy 165.668884 87.835768) (xy 165.63301 88.2) (xy 102.408 88.2) (xy 102.408 88.001928) (xy 102.338519 87.652626) (xy 102.202229 87.323591) (xy 102.004365 87.027467) (xy 101.752533 86.775635) (xy 101.456409 86.577771) (xy 101.127374 86.441481) (xy 100.778072 86.372) (xy 100.421928 86.372) (xy 100.072626 86.441481) (xy 99.743591 86.577771) (xy 99.447467 86.775635) (xy 99.195635 87.027467) (xy 98.997771 87.323591) (xy 98.861481 87.652626) (xy 98.792 88.001928) (xy 92.933 88.001928) (xy 92.933 84) (xy 165.63301 84) (xy 165.668884 84.364232) (xy 165.775126 84.714466) (xy 165.947655 85.037244) (xy 166.179839 85.320161) (xy 166.462756 85.552345) (xy 166.785534 85.724874) (xy 167.135768 85.831116) (xy 167.408724 85.858) (xy 168.591276 85.858) (xy 168.864232 85.831116) (xy 169.214466 85.724874) (xy 169.537244 85.552345) (xy 169.820161 85.320161) (xy 170.052345 85.037244) (xy 170.224874 84.714466) (xy 170.331116 84.364232) (xy 170.36699 84) (xy 170.331116 83.635768) (xy 170.224874 83.285534) (xy 170.052345 82.962756) (xy 169.820161 82.679839) (xy 169.537244 82.447655) (xy 169.214466 82.275126) (xy 168.864232 82.168884) (xy 168.591276 82.142) (xy 167.408724 82.142) (xy 167.135768 82.168884) (xy 166.785534 82.275126) (xy 166.462756 82.447655) (xy 166.179839 82.679839) (xy 165.947655 82.962756) (xy 165.775126 83.285534) (xy 165.668884 83.635768) (xy 165.63301 84) (xy 92.933 84) (xy 92.933 79.208724) (xy 117.842 79.208724) (xy 117.842 80.391275) (xy 117.868884 80.664231) (xy 117.975126 81.014465) (xy 118.147655 81.337243) (xy 118.379839 81.620161) (xy 118.662756 81.852345) (xy 118.985534 82.024874) (xy 119.335768 82.131116) (xy 119.7 82.16699) (xy 120.064231 82.131116) (xy 120.414465 82.024874) (xy 120.737243 81.852345) (xy 121.020161 81.620161) (xy 121.252345 81.337244) (xy 121.424874 81.014466) (xy 121.531116 80.664232) (xy 121.558 80.391276) (xy 121.558 79.208724) (xy 122.042 79.208724) (xy 122.042 80.391275) (xy 122.068884 80.664231) (xy 122.175126 81.014465) (xy 122.347655 81.337243) (xy 122.579839 81.620161) (xy 122.862756 81.852345) (xy 123.185534 82.024874) (xy 123.535768 82.131116) (xy 123.9 82.16699) (xy 124.264231 82.131116) (xy 124.614465 82.024874) (xy 124.937243 81.852345) (xy 125.220161 81.620161) (xy 125.452345 81.337244) (xy 125.624874 81.014466) (xy 125.731116 80.664232) (xy 125.758 80.391276) (xy 125.758 79.208724) (xy 126.242 79.208724) (xy 126.242 80.391275) (xy 126.268884 80.664231) (xy 126.375126 81.014465) (xy 126.547655 81.337243) (xy 126.779839 81.620161) (xy 127.062756 81.852345) (xy 127.385534 82.024874) (xy 127.735768 82.131116) (xy 128.1 82.16699) (xy 128.464231 82.131116) (xy 128.814465 82.024874) (xy 129.137243 81.852345) (xy 129.420161 81.620161) (xy 129.652345 81.337244) (xy 129.824874 81.014466) (xy 129.931116 80.664232) (xy 129.958 80.391276) (xy 129.958 79.208724) (xy 130.442 79.208724) (xy 130.442 80.391275) (xy 130.468884 80.664231) (xy 130.575126 81.014465) (xy 130.747655 81.337243) (xy 130.979839 81.620161) (xy 131.262756 81.852345) (xy 131.585534 82.024874) (xy 131.935768 82.131116) (xy 132.3 82.16699) (xy 132.664231 82.131116) (xy 133.014465 82.024874) (xy 133.337243 81.852345) (xy 133.620161 81.620161) (xy 133.852345 81.337244) (xy 134.024874 81.014466) (xy 134.131116 80.664232) (xy 134.158 80.391276) (xy 134.158 79.208724) (xy 140.942 79.208724) (xy 140.942 80.391275) (xy 140.968884 80.664231) (xy 141.075126 81.014465) (xy 141.247655 81.337243) (xy 141.479839 81.620161) (xy 141.762756 81.852345) (xy 142.085534 82.024874) (xy 142.435768 82.131116) (xy 142.8 82.16699) (xy 143.164231 82.131116) (xy 143.514465 82.024874) (xy 143.837243 81.852345) (xy 144.120161 81.620161) (xy 144.352345 81.337244) (xy 144.524874 81.014466) (xy 144.631116 80.664232) (xy 144.658 80.391276) (xy 144.658 79.208724) (xy 145.142 79.208724) (xy 145.142 80.391275) (xy 145.168884 80.664231) (xy 145.275126 81.014465) (xy 145.447655 81.337243) (xy 145.679839 81.620161) (xy 145.962756 81.852345) (xy 146.285534 82.024874) (xy 146.635768 82.131116) (xy 147 82.16699) (xy 147.364231 82.131116) (xy 147.714465 82.024874) (xy 148.037243 81.852345) (xy 148.320161 81.620161) (xy 148.552345 81.337244) (xy 148.724874 81.014466) (xy 148.831116 80.664232) (xy 148.858 80.391276) (xy 148.858 79.208724) (xy 149.342 79.208724) (xy 149.342 80.391275) (xy 149.368884 80.664231) (xy 149.475126 81.014465) (xy 149.647655 81.337243) (xy 149.879839 81.620161) (xy 150.162756 81.852345) (xy 150.485534 82.024874) (xy 150.835768 82.131116) (xy 151.2 82.16699) (xy 151.564231 82.131116) (xy 151.914465 82.024874) (xy 152.237243 81.852345) (xy 152.520161 81.620161) (xy 152.752345 81.337244) (xy 152.924874 81.014466) (xy 153.031116 80.664232) (xy 153.058 80.391276) (xy 153.058 79.208724) (xy 153.542 79.208724) (xy 153.542 80.391275) (xy 153.568884 80.664231) (xy 153.675126 81.014465) (xy 153.847655 81.337243) (xy 154.079839 81.620161) (xy 154.362756 81.852345) (xy 154.685534 82.024874) (xy 155.035768 82.131116) (xy 155.4 82.16699) (xy 155.764231 82.131116) (xy 156.114465 82.024874) (xy 156.437243 81.852345) (xy 156.720161 81.620161) (xy 156.952345 81.337244) (xy 157.124874 81.014466) (xy 157.231116 80.664232) (xy 157.258 80.391276) (xy 157.258 79.8) (xy 165.63301 79.8) (xy 165.668884 80.164232) (xy 165.775126 80.514466) (xy 165.947655 80.837244) (xy 166.179839 81.120161) (xy 166.462756 81.352345) (xy 166.785534 81.524874) (xy 167.135768 81.631116) (xy 167.408724 81.658) (xy 168.591276 81.658) (xy 168.864232 81.631116) (xy 169.214466 81.524874) (xy 169.537244 81.352345) (xy 169.820161 81.120161) (xy 170.052345 80.837244) (xy 170.224874 80.514466) (xy 170.331116 80.164232) (xy 170.36699 79.8) (xy 170.331116 79.435768) (xy 170.224874 79.085534) (xy 170.052345 78.762756) (xy 169.820161 78.479839) (xy 169.537244 78.247655) (xy 169.214466 78.075126) (xy 168.864232 77.968884) (xy 168.591276 77.942) (xy 167.408724 77.942) (xy 167.135768 77.968884) (xy 166.785534 78.075126) (xy 166.462756 78.247655) (xy 166.179839 78.479839) (xy 165.947655 78.762756) (xy 165.775126 79.085534) (xy 165.668884 79.435768) (xy 165.63301 79.8) (xy 157.258 79.8) (xy 157.258 79.208724) (xy 157.231116 78.935768) (xy 157.124874 78.585534) (xy 156.952345 78.262756) (xy 156.720161 77.979839) (xy 156.437244 77.747655) (xy 156.114466 77.575126) (xy 155.764232 77.468884) (xy 155.4 77.43301) (xy 155.035769 77.468884) (xy 154.685535 77.575126) (xy 154.362757 77.747655) (xy 154.07984 77.979839) (xy 153.847656 78.262756) (xy 153.675126 78.585534) (xy 153.568884 78.935768) (xy 153.542 79.208724) (xy 153.058 79.208724) (xy 153.031116 78.935768) (xy 152.924874 78.585534) (xy 152.752345 78.262756) (xy 152.520161 77.979839) (xy 152.237244 77.747655) (xy 151.914466 77.575126) (xy 151.564232 77.468884) (xy 151.2 77.43301) (xy 150.835769 77.468884) (xy 150.485535 77.575126) (xy 150.162757 77.747655) (xy 149.87984 77.979839) (xy 149.647656 78.262756) (xy 149.475126 78.585534) (xy 149.368884 78.935768) (xy 149.342 79.208724) (xy 148.858 79.208724) (xy 148.831116 78.935768) (xy 148.724874 78.585534) (xy 148.552345 78.262756) (xy 148.320161 77.979839) (xy 148.037244 77.747655) (xy 147.714466 77.575126) (xy 147.364232 77.468884) (xy 147 77.43301) (xy 146.635769 77.468884) (xy 146.285535 77.575126) (xy 145.962757 77.747655) (xy 145.67984 77.979839) (xy 145.447656 78.262756) (xy 145.275126 78.585534) (xy 145.168884 78.935768) (xy 145.142 79.208724) (xy 144.658 79.208724) (xy 144.631116 78.935768) (xy 144.524874 78.585534) (xy 144.352345 78.262756) (xy 144.120161 77.979839) (xy 143.837244 77.747655) (xy 143.514466 77.575126) (xy 143.164232 77.468884) (xy 142.8 77.43301) (xy 142.435769 77.468884) (xy 142.085535 77.575126) (xy 141.762757 77.747655) (xy 141.47984 77.979839) (xy 141.247656 78.262756) (xy 141.075126 78.585534) (xy 140.968884 78.935768) (xy 140.942 79.208724) (xy 134.158 79.208724) (xy 134.131116 78.935768) (xy 134.024874 78.585534) (xy 133.852345 78.262756) (xy 133.620161 77.979839) (xy 133.337244 77.747655) (xy 133.014466 77.575126) (xy 132.664232 77.468884) (xy 132.3 77.43301) (xy 131.935769 77.468884) (xy 131.585535 77.575126) (xy 131.262757 77.747655) (xy 130.97984 77.979839) (xy 130.747656 78.262756) (xy 130.575126 78.585534) (xy 130.468884 78.935768) (xy 130.442 79.208724) (xy 129.958 79.208724) (xy 129.931116 78.935768) (xy 129.824874 78.585534) (xy 129.652345 78.262756) (xy 129.420161 77.979839) (xy 129.137244 77.747655) (xy 128.814466 77.575126) (xy 128.464232 77.468884) (xy 128.1 77.43301) (xy 127.735769 77.468884) (xy 127.385535 77.575126) (xy 127.062757 77.747655) (xy 126.77984 77.979839) (xy 126.547656 78.262756) (xy 126.375126 78.585534) (xy 126.268884 78.935768) (xy 126.242 79.208724) (xy 125.758 79.208724) (xy 125.731116 78.935768) (xy 125.624874 78.585534) (xy 125.452345 78.262756) (xy 125.220161 77.979839) (xy 124.937244 77.747655) (xy 124.614466 77.575126) (xy 124.264232 77.468884) (xy 123.9 77.43301) (xy 123.535769 77.468884) (xy 123.185535 77.575126) (xy 122.862757 77.747655) (xy 122.57984 77.979839) (xy 122.347656 78.262756) (xy 122.175126 78.585534) (xy 122.068884 78.935768) (xy 122.042 79.208724) (xy 121.558 79.208724) (xy 121.531116 78.935768) (xy 121.424874 78.585534) (xy 121.252345 78.262756) (xy 121.020161 77.979839) (xy 120.737244 77.747655) (xy 120.414466 77.575126) (xy 120.064232 77.468884) (xy 119.7 77.43301) (xy 119.335769 77.468884) (xy 118.985535 77.575126) (xy 118.662757 77.747655) (xy 118.37984 77.979839) (xy 118.147656 78.262756) (xy 117.975126 78.585534) (xy 117.868884 78.935768) (xy 117.842 79.208724) (xy 92.933 79.208724) (xy 92.933 77.183) (xy 177.967001 77.183) ) ) ) )
KiCad
5
Indexyz/KCORES-CSPS-to-ATX-Converter
Electrical/KCORES CSPS to ATX Converter/KCORES CSPS to ATX Converter.kicad_pcb
[ "RSA-MD" ]
ruleset io.picolabs.schedule { meta { shares getLog, listScheduled } global { getLog = function(){ ent:log; } listScheduled = function(){ schedule:list(); } } rule clear_log { select when schedule clear_log send_directive("clear_log"); fired { ent:log := [] } } rule push_log { select when schedule push_log send_directive("push_log"); fired { ent:log := ent:log.append(event:attrs) } } rule in_5min { select when schedule in_5min send_directive("in_5min"); fired { schedule schedule event "push_log" at time:add(time:now(), {"minutes": 5}) attributes { "from": "in_5min", "name": event:attrs{"name"} } setting(foo); ent:log := ent:log.append({"scheduled in_5min": foo}) } } rule every_1min { select when schedule every_1min send_directive("every_1min"); fired { schedule schedule event "push_log" repeat "* */1 * * * *" attributes { "from": "every_1min", "name": event:attrs{"name"} } setting(foo); ent:log := ent:log.append({"scheduled every_1min": foo}) } } rule rm_from_schedule { select when schedule rm_from_schedule schedule:remove(event:attrs{"id"}); } rule dynamic_at { select when schedule dynamic_at fired { schedule event event:attrs{"dn"} at event:attrs{"at"} attributes { "from": "dynamic_at", "name": event:attrs{"name"} } setting(foo); ent:log := ent:log.append({"scheduled dynamic_at": foo}) } } rule dynamic_repeat { select when schedule dynamic_repeat fired { schedule event event:attrs{"dn"} repeat event:attrs{"timespec"} attributes { "from": "dynamic_repeat", "name": event:attrs{"name"} } setting(foo); ent:log := ent:log.append({"scheduled dynamic_repeat": foo}) } } }
KRL
4
CambodianCoder/pico-engine
test-rulesets/schedule.krl
[ "MIT" ]
# flake8: noqa # There's no way to ignore "F401 '...' imported but unused" warnings in this # module, but to preserve other warnings. So, don't check this module at all. # Copyright 2020 The HuggingFace Team. All rights reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. from typing import TYPE_CHECKING from ...file_utils import ( _LazyModule, is_sentencepiece_available, is_tf_available, is_tokenizers_available, is_torch_available, ) _import_structure = { "configuration_camembert": ["CAMEMBERT_PRETRAINED_CONFIG_ARCHIVE_MAP", "CamembertConfig"], } if is_sentencepiece_available(): _import_structure["tokenization_camembert"] = ["CamembertTokenizer"] if is_tokenizers_available(): _import_structure["tokenization_camembert_fast"] = ["CamembertTokenizerFast"] if is_torch_available(): _import_structure["modeling_camembert"] = [ "CAMEMBERT_PRETRAINED_MODEL_ARCHIVE_LIST", "CamembertForCausalLM", "CamembertForMaskedLM", "CamembertForMultipleChoice", "CamembertForQuestionAnswering", "CamembertForSequenceClassification", "CamembertForTokenClassification", "CamembertModel", ] if is_tf_available(): _import_structure["modeling_tf_camembert"] = [ "TF_CAMEMBERT_PRETRAINED_MODEL_ARCHIVE_LIST", "TFCamembertForMaskedLM", "TFCamembertForMultipleChoice", "TFCamembertForQuestionAnswering", "TFCamembertForSequenceClassification", "TFCamembertForTokenClassification", "TFCamembertModel", ] if TYPE_CHECKING: from .configuration_camembert import CAMEMBERT_PRETRAINED_CONFIG_ARCHIVE_MAP, CamembertConfig if is_sentencepiece_available(): from .tokenization_camembert import CamembertTokenizer if is_tokenizers_available(): from .tokenization_camembert_fast import CamembertTokenizerFast if is_torch_available(): from .modeling_camembert import ( CAMEMBERT_PRETRAINED_MODEL_ARCHIVE_LIST, CamembertForCausalLM, CamembertForMaskedLM, CamembertForMultipleChoice, CamembertForQuestionAnswering, CamembertForSequenceClassification, CamembertForTokenClassification, CamembertModel, ) if is_tf_available(): from .modeling_tf_camembert import ( TF_CAMEMBERT_PRETRAINED_MODEL_ARCHIVE_LIST, TFCamembertForMaskedLM, TFCamembertForMultipleChoice, TFCamembertForQuestionAnswering, TFCamembertForSequenceClassification, TFCamembertForTokenClassification, TFCamembertModel, ) else: import sys sys.modules[__name__] = _LazyModule(__name__, globals()["__file__"], _import_structure)
Python
4
arunraja-hub/transformers
src/transformers/models/camembert/__init__.py
[ "Apache-2.0" ]
/** * Licensed to the Apache Software Foundation (ASF) under one * or more contributor license agreements. See the NOTICE file * distributed with this work for additional information * regarding copyright ownership. The ASF licenses this file * to you under the Apache License, Version 2.0 (the * "License"); you may not use this file except in compliance * with the License. You may obtain a copy of the License at * * http://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package org.apache.hadoop.hdfs; import java.util.ArrayList; import org.apache.commons.logging.Log; import org.apache.commons.logging.LogFactory; import org.apache.hadoop.test.system.DaemonProtocol; import org.apache.hadoop.hdfs.test.system.DNProtocol; import org.apache.hadoop.hdfs.test.system.NNProtocol; import org.apache.hadoop.security.authorize.Service; import org.apache.hadoop.security.authorize.ServiceAuthorizationManager; /** * This aspect adds two HDFS Herriot specific protocols tp the list of 'authorized' * Herriot protocols. * Protocol descriptors i.e. 'security.nn.protocol.acl' have to be added to * <code>hadoop-policy.xml</code> if present */ public privileged aspect HDFSPolicyProviderAspect { private static final Log LOG = LogFactory .getLog(HDFSPolicyProviderAspect.class); ArrayList<Service> herriotHDFSServices = null; pointcut updateHDFSServices() : execution (public Service[] HDFSPolicyProvider.getServices()); Service[] around() : updateHDFSServices () { herriotHDFSServices = new ArrayList<Service>(); for (Service s : HDFSPolicyProvider.hdfsServices) { LOG.debug("Copying configured protocol to " + s.getProtocol().getCanonicalName()); herriotHDFSServices.add(s); } herriotHDFSServices.add(new Service("security.daemon.protocol.acl", DaemonProtocol.class)); herriotHDFSServices.add(new Service("security.nn.protocol.acl", NNProtocol.class)); herriotHDFSServices.add(new Service("security.dn.protocol.acl", DNProtocol.class)); final Service[] retArray = herriotHDFSServices .toArray(new Service[herriotHDFSServices.size()]); LOG.debug("Number of configured protocols to return: " + retArray.length); return retArray; } }
AspectJ
4
hoppinghippo/HadoopMapReduce
src/test/system/aop/org/apache/hadoop/hdfs/HDFSPolicyProviderAspect.aj
[ "Apache-2.0" ]
libflightplan(3) "github.com/mitchellh/libflightplan" "Library Functions Manual" # NAME libflightplan - library used to read and write aviation flight plans # DESCRIPTION *libflightplan* is a library for reading and writing flight plans in various formats. Flight plans are used in aviation to save properties of one or more flights such as route (waypoints), altitude, source and departure airport, etc. This library is available as a native C library as well as Zig. The man pages focus on the C API currently. # API NOTES - fpl_cleanup(3) should be called when all users of the library are done. This cleans up any global state associatd with the library. - The library may allocate global state on the heap to store error information (accessible via fpl_last_error(3)). - The library is not threadsafe. Global error state is stored in thread local variables. # EXAMPLE The example below shows how the C API can be used to parse a ForeFlight flight plan and read route information about it. ``` #include <stddef.h> #include <stdio.h> #include <flightplan.h> int main() { // Parse our flight plan from an FPL file out of ForeFlight. flightplan *fpl = fpl_parse_garmin("./test/basic.fpl"); if (fpl == NULL) { // We can get a more detailed error. flightplan_error *err = fpl_last_error(); printf("error: %s\n", fpl_error_message(err)); fpl_cleanup(); return 1; } // Iterate and output the full ordered route. int max = fpl_route_points_count(fpl); printf("\nroute: \"%s\" (points: %d)\n", fpl_route_name(fpl), max); for (int i = 0; i < max; i++) { flightplan_route_point *point = fpl_route_points_get(fpl, i); printf(" %s\n", fpl_route_point_identifier(point)); } fpl_free(fpl); fpl_cleanup(); return 0; } ``` # AUTHORS Mitchell Hashimoto (xmitchx@gmail.com) and any open source contributors. See <https://github.com/mitchellh/libflightplan>.
SuperCollider
4
06kellyjac/libflightplan
doc/libflightplan.3.scd
[ "MIT" ]
from typing import List from fastapi import FastAPI from fastapi.testclient import TestClient from pydantic import BaseModel app = FastAPI() class RecursiveItem(BaseModel): sub_items: List["RecursiveItem"] = [] name: str RecursiveItem.update_forward_refs() class RecursiveSubitemInSubmodel(BaseModel): sub_items2: List["RecursiveItemViaSubmodel"] = [] name: str class RecursiveItemViaSubmodel(BaseModel): sub_items1: List[RecursiveSubitemInSubmodel] = [] name: str RecursiveSubitemInSubmodel.update_forward_refs() @app.get("/items/recursive", response_model=RecursiveItem) def get_recursive(): return {"name": "item", "sub_items": [{"name": "subitem", "sub_items": []}]} @app.get("/items/recursive-submodel", response_model=RecursiveItemViaSubmodel) def get_recursive_submodel(): return { "name": "item", "sub_items1": [ { "name": "subitem", "sub_items2": [ { "name": "subsubitem", "sub_items1": [{"name": "subsubsubitem", "sub_items2": []}], } ], } ], } client = TestClient(app) def test_recursive(): response = client.get("/items/recursive") assert response.status_code == 200, response.text assert response.json() == { "sub_items": [{"name": "subitem", "sub_items": []}], "name": "item", } response = client.get("/items/recursive-submodel") assert response.status_code == 200, response.text assert response.json() == { "name": "item", "sub_items1": [ { "name": "subitem", "sub_items2": [ { "name": "subsubitem", "sub_items1": [{"name": "subsubsubitem", "sub_items2": []}], } ], } ], }
Python
4
Aryabhata-Rootspring/fastapi
tests/test_validate_response_recursive.py
[ "MIT" ]
P Y ####T#### # H # # O # ####N # # # #########
Mask
0
kai-pischke/python-constraint
examples/crosswords/python.mask
[ "BSD-2-Clause" ]
let s = "hello world" let n : int = 87 let id x = x let add x y = x + y let add' x y =  let left = x in  let right = y in  x + y let add'' : int -> int -> int = fun x -> fun y -> x + y let unwrap_option default opt =  match opt with  | None -> default  | Some v -> v let string_of_bool = function true -> "true" | false -> "false" let is_a c =  if c = 'a' then true  else false let _ = Printf.printf "%s" "hello" let () = Printf.printf "%s\n" "world" let x = ref 0 let _ = x := 1 type my_bool = True | False type shape = Circle of float | Square of float | Rectangle of (float * float) type user = {  login : string;  password : string; } type 'a my_ref = { mutable ref_value : 'a } let (:=) r v = r.ref_value <- v let (+) 2 2 = 5 exception Bad_value of string let bad_value_error () = raise (Bad_value "your value is bad and you should feel bad") let () =  try bad_value_error ()  with Bad_value _ -> () let () =  try bad_value_error ()  with  | Bad_value _ -> ()  | Not_found -> () module type FOO = sig  val foo : 'a -> 'a end module Foo : FOO = struct  let foo x = x end let greeter = object  val greeting = "Hello"  method greet name = Printf.sprintf "%s, %s!" greeting name  end let greeting = greeter#greet "world" class greeter_factory greeting_text = object (self)  val greeting = greeting_text  method greet name = Printf.sprintf "%s, %s!" greeting name  initializer Printf.printf "Objects will greet the user with \"%s\"\n" greeting end let g = new greeter_factory "Hi"
OCaml
5
JesseVermeulen123/bat
tests/syntax-tests/highlighted/OCaml/syntax-test.ml
[ "Apache-2.0", "MIT" ]
scriptname _Frost_ExposureMeterInterfaceHandler extends CommonMeterInterfaceHandler import CampUtil function RegisterForEvents() if !GetSKSELoaded() return endif RegisterForModEvent("Frostfall_ForceExposureMeterDisplay", "ForceMeterDisplay") RegisterForModEvent("Frostfall_RemoveExposureMeter", "RemoveMeter") RegisterForModEvent("Frostfall_UpdateExposureMeter", "UpdateMeterDelegate") RegisterForModEvent("Frostfall_CheckMeterRequirements", "CheckMeterRequirements") ; Special Frostfall indicator element RegisterForModEvent("Frostfall_UpdateExposureMeterIndicator", "UpdateMeterIndicator") ; Special Frostfall glow RegisterForModEvent("Frostfall_SetExposureMeterGlow", "SetExposureMeterGlow") endFunction Event UpdateMeterIndicator(float percent) (Meter as _Frost_Meter).SetIndicatorPercent(percent) endEvent Event SetExposureMeterGlow(float percent) (Meter as _Frost_Meter).SetGlow(percent) endEvent
Papyrus
4
chesko256/Campfire
Scripts/Source/_Frost_ExposureMeterInterfaceHandler.psc
[ "MIT" ]
CREATE TABLE `tb_epubreeayc` ( `col_embnqthyuu` double NOT NULL, `col_shqnxczemy` binary(149) DEFAULT NULL, `col_gyjfdfpemu` longtext CHARACTER SET utf8, PRIMARY KEY (`col_embnqthyuu`) ) ENGINE=InnoDB DEFAULT CHARSET=utf8mb4; CREATE TABLE `tb_uafierhjhg` ( `col_rvdpillohr` smallint(51) unsigned NOT NULL, `col_wjvgjpqbgz` smallint(5) unsigned zerofill DEFAULT NULL, PRIMARY KEY (`col_rvdpillohr`), UNIQUE KEY `uk_aqetlmillq` (`col_wjvgjpqbgz`) ) ENGINE=InnoDB DEFAULT CHARSET=utf8;
SQL
3
yuanweikang2020/canal
parse/src/test/resources/ddl/alter/mysql_55.sql
[ "Apache-2.0" ]
; CLW file contains information for the MFC ClassWizard [General Info] Version=1 LastClass=CD4dTestDlg LastTemplate=CDialog NewFileInclude1=#include "stdafx.h" NewFileInclude2=#include "D4dTest.h" ClassCount=3 Class1=CD4dTestApp Class2=CD4dTestDlg Class3=CAboutDlg ResourceCount=5 Resource1=IDD_ABOUTBOX Resource2=IDR_MAINFRAME Resource3=IDD_D4DTEST_DIALOG Resource4=IDD_ABOUTBOX (English (U.S.)) Resource5=IDD_D4DTEST_DIALOG (English (U.S.)) [CLS:CD4dTestApp] Type=0 HeaderFile=D4dTest.h ImplementationFile=D4dTest.cpp Filter=N [CLS:CD4dTestDlg] Type=0 HeaderFile=D4dTestDlg.h ImplementationFile=D4dTestDlg.cpp Filter=D BaseClass=CDialog VirtualFilter=dWC LastObject=CD4dTestDlg [CLS:CAboutDlg] Type=0 HeaderFile=D4dTestDlg.h ImplementationFile=D4dTestDlg.cpp Filter=D [DLG:IDD_ABOUTBOX] Type=1 ControlCount=4 Control1=IDC_STATIC,static,1342177283 Control2=IDC_STATIC,static,1342308352 Control3=IDC_STATIC,static,1342308352 Control4=IDOK,button,1342373889 Class=CAboutDlg [DLG:IDD_D4DTEST_DIALOG] Type=1 ControlCount=3 Control1=IDOK,button,1342242817 Control2=IDCANCEL,button,1342242816 Control3=IDC_STATIC,static,1342308352 Class=CD4dTestDlg [DLG:IDD_D4DTEST_DIALOG (English (U.S.))] Type=1 Class=CD4dTestDlg ControlCount=9 Control1=IDCANCEL,button,1342242816 Control2=IDC_LIST_INFO,listbox,1352728833 Control3=IDB_ASSIGN,button,1342242816 Control4=IDC_EDIT_INTEGER,edit,1350631552 Control5=IDB_TRACE,button,1342242816 Control6=IDB_STACKTRACE,button,1342242816 Control7=IDB_COPY,button,1342242816 Control8=IDB_CLEAR,button,1342242816 Control9=IDB_FAST_TRACE,button,1342242816 [DLG:IDD_ABOUTBOX (English (U.S.))] Type=1 Class=? ControlCount=4 Control1=IDC_STATIC,static,1342177283 Control2=IDC_STATIC,static,1342308480 Control3=IDC_STATIC,static,1342308352 Control4=IDOK,button,1342373889
Clarion
3
oudream/ccxx
test/dump/swdbgbk_src/chap27/D4D/D4dTest/D4dTest.clw
[ "MIT" ]
#!/bin/bash set -e -u echo "Publishing Javadoc and JDiff..." cd $HOME git clone -q -b gh-pages "https://x-access-token:${GITHUB_TOKEN}@github.com/google/guava.git" gh-pages > /dev/null cd gh-pages git config --global user.name "$GITHUB_ACTOR" git config --global user.email "$GITHUB_ACTOR@users.noreply.github.com" ./updaterelease.sh snapshot git push -fq origin gh-pages > /dev/null echo "Javadoc and JDiff published to gh-pages."
Shell
4
ksodhi2/guava
util/update_snapshot_docs.sh
[ "Apache-2.0" ]
/* * ESP32S2 ROM address table * Generated for ROM with MD5sum: 0a2c7ec5109c17884606d23b47045796 */ PROVIDE (ets_update_cpu_frequency = 0x4000d8a4); PROVIDE (MD5Final = 0x4000530c); PROVIDE (MD5Init = 0x4000526c); PROVIDE (MD5Update = 0x4000528c); /* bootloader will use following functions from xtensa hal library */ xthal_get_ccount = 0x4001aa90; xthal_get_ccompare = 0x4001aabc; xthal_set_ccompare = 0x4001aa98;
Linker Script
3
DCNick3/esp-idf
components/bootloader/subproject/main/ld/esp32s2/bootloader.rom.ld
[ "Apache-2.0" ]
module CompletionSpec where exampleValue :: Int exampleValue = 42 exampleFunction :: Int -> Int exampleFunction _ = 1 exampleInferredString = "" infixl 5 exampleFunction as \°/ data ExampleTypeConstructor a b = ExampleTypeConstructor a b infixl 5 type ExampleTypeConstructor as \°/ class ExampleClass where exampleMember :: Int
PureScript
3
andys8/purescript
tests/support/pscide/src/CompletionSpec.purs
[ "BSD-3-Clause" ]
static const uint32_t in_val_decim[1980] = { 0x3d9aeafc, 0x3f800000, 0xbf1bcebc, 0x3d288e27, 0xbf800000, 0xbe63a3ff, 0xbe6f74f1, 0x3f800000, 0x3f002294, 0xbf800000, 0x3f40d559, 0x3d7a1587, 0xbf800000, 0xbe538644, 0x3e3bd6b3, 0xbf4b0178, 0x3f800000, 0x3f3d911e, 0x3d8caa90, 0x3e705d9e, 0x3f800000, 0x3e0724d1, 0xbca52a4b, 0xbf065f5f, 0x3f1c89fb, 0x3efe135f, 0x3e162b52, 0xbe927bd0, 0x3f800000, 0x3f1271bb, 0x3f3ba3cc, 0x3f098db1, 0x3e064429, 0xbf40bd64, 0x3f66ad5b, 0xbe7961df, 0x3e74de85, 0xbf0400c9, 0xbf2c4e2d, 0xbf061416, 0xbe610e9e, 0x3f800000, 0xbe101e01, 0x3d0f114c, 0xbe802694, 0xbe4c6010, 0x3f299ea7, 0x3e51656e, 0xbe5ab3ec, 0x3f800000, 0xbd3ab888, 0xbd558484, 0x3ee2d9b7, 0xbdea06f1, 0xbddb5aa8, 0xbed18c18, 0xbeef3841, 0xbf800000, 0x3f3c6900, 0xbf6c73ae, 0x3d9a8d22, 0x3ef39448, 0xbf800000, 0xbd16c2b4, 0x3e947029, 0xbd7fce40, 0xbf800000, 0xbebfb8fd, 0xbe2e8b3c, 0x3f0767e1, 0x3ec2ef01, 0xbe73ddd7, 0x3f00229a, 0x3ed73812, 0xbdee9c9a, 0x3da02d3c, 0xbe809e2a, 0xbe39ce59, 0x3e0fa22c, 0xbf10003b, 0x3bc28bfe, 0xbe84827b, 0xbeca08c5, 0x3f5a1e79, 0xbeb2ee78, 0x3e438e8c, 0xbe96407a, 0x3f800000, 0xbf800000, 0xbd5d0e1b, 0xbe950cc8, 0x3a92100a, 0x3d893ac0, 0x3f434c20, 0xbed102ec, 0x3cec74e5, 0x3e17fb76, 0x3e22a494, 0xbe53cf97, 0xbc11e7ac, 0x3f6b0a9b, 0x3f800000, 0xbe28f639, 0xbd41e0da, 0xbe9e50bc, 0x3e4d370e, 0x3f1e74b7, 0xbe6428a1, 0xbf186938, 0x3f038d93, 0xbf4fe3d8, 0x3dbe8fb0, 0x3f3a8a44, 0x3f800000, 0x3cf68aa1, 0xbecf3f3b, 0xbe88be59, 0x3f637e89, 0x3e3c40ce, 0xbdf0a33a, 0x3e7145ef, 0x3b982713, 0x3de43f73, 0xbf0f23b6, 0x3c53dff7, 0xbe83ab74, 0xbf6753e8, 0xbee8734d, 0xbf10a5c4, 0xbdcdafda, 0xbf800000, 0xbeb471f1, 0x3f43daae, 0xbf1f844f, 0xbcef123f, 0xbefc4ce2, 0xbf077673, 0xbf800000, 0xbf800000, 0x3f4465ac, 0xbee48948, 0x3cf0cc07, 0x3f2901d2, 0xbecdf851, 0x3e496a3c, 0xbf800000, 0x3f17c6d1, 0x3da5562b, 0xbf41b167, 0x3f005ced, 0xbedf5ce2, 0xbf0560ba, 0xbf046e97, 0xbf800000, 0x3db8f83e, 0xbe226e7e, 0xbe5e2abe, 0xbf3ce3dc, 0x3e6e000f, 0x3da956cf, 0x3e825a90, 0x3f800000, 0x3f16f98e, 0xbebd491a, 0x3f800000, 0x3ed0bc7a, 0xbdbcd94c, 0x3dbef1c8, 0xbd5415e2, 0x3dffbd3a, 0x3f66714e, 0x3ee69a51, 0x3e626fc5, 0xbf800000, 0xbec9437e, 0x3c7d7ff5, 0x3ee0a4fb, 0xbe52e1d2, 0x3e4b0e0c, 0x3e6bd5b7, 0xbe047b0f, 0x3da6abd5, 0xbd54c6b8, 0xbe97e9bf, 0xbe64a77c, 0xbe742405, 0xbe0672ce, 0xbeba8060, 0xbe1e1bb1, 0xbeba9ba4, 0xbe75100b, 0xbf7fc74f, 0x3f5aa9f3, 0xbdd7b3d6, 0x3f460a5c, 0x3e85bf74, 0x3ef0d7a8, 0xbf800000, 0xbf4a3815, 0x3e8bf866, 0xbef9d1b5, 0xbf3edd9f, 0x3ebe217e, 0x3f012626, 0x3f2171c9, 0x3f30a7f9, 0x3f0cd82a, 0xbf0a6c07, 0xbf089ec5, 0x3ed14430, 0x3f800000, 0x3e80dd0c, 0x3cb613aa, 0xbc62cf5a, 0x3e5a3796, 0x3f290ef3, 0xbf1c3462, 0xbf0781bc, 0xbdd71c71, 0x3f800000, 0x3f48d1b8, 0xbf10aa61, 0x3f4d7c82, 0xbe1f087a, 0x3eb0283e, 0x3f2bf09f, 0x3e6e71de, 0xbf64d4b1, 0xbe2d09a9, 0x3e905224, 0x3eb17c90, 0xbea14b46, 0xbe957d5c, 0x3f5b6623, 0x3dbc587d, 0xbee9f6fd, 0xbea17e1e, 0xbf800000, 0x3f17893e, 0x3e78394c, 0xbf147c77, 0x3ef576f1, 0x3f4f634b, 0x3efff38e, 0x3dbd0995, 0x3f0e2643, 0xbea2ecc2, 0x3eb211a6, 0x3ee31b23, 0x3f800000, 0xbeed64d9, 0xbe875891, 0xbe8109a0, 0x3ef9850e, 0xbf329842, 0x3ea0ddb0, 0xbf3fd673, 0xbe9dd12e, 0x3f3840ae, 0x3eda740c, 0xbf27967c, 0xbf32a9a6, 0xbd4af668, 0x3f6902f4, 0xbf1aab6d, 0xbf18e055, 0xbec0e769, 0x3f06e823, 0xbe8f4b22, 0xbe84baed, 0x3edb8b47, 0x3f00b01e, 0x3e9eea21, 0xbc6199e9, 0xbc993e39, 0x3e88831a, 0x3b6a6c84, 0xbf800000, 0x3ec0f628, 0xbee94be9, 0xbe80886e, 0x3d5135c1, 0xbe081611, 0xbbde1f71, 0x3e95462e, 0xbf638a5b, 0x3e6a4622, 0x3e3bae2f, 0xbf10eec1, 0x3e9acb53, 0x3e2b9f65, 0x3e996741, 0x3eecd359, 0xbe793ecf, 0xbebfc649, 0xbf110cf9, 0x3ed0f21f, 0x3d646e55, 0xbf15d211, 0xbe6be701, 0x3ee87297, 0x3d8f1aa4, 0x3ef321d2, 0x3f800000, 0xbef86140, 0x3f2b05a2, 0x3f42c95d, 0xbe50c4f2, 0x3f2cb4b0, 0x3c09bcdc, 0xbe72bb0b, 0xbca9084c, 0xbd8d095b, 0x3e0a2739, 0xbdf82e6a, 0xbedcd03a, 0x3adbfbda, 0x3c6375e8, 0x3ea1fe67, 0xbf800000, 0x3e01d22c, 0xbe57530e, 0x3d8c042d, 0x3e097701, 0xbe22d0ae, 0x3dd28b86, 0x3e77c774, 0xbe596573, 0x3ecc05ce, 0x3e1e297b, 0xbf2a452d, 0xbed97301, 0xbf36e2ab, 0xbea24e79, 0x3ef6cf3d, 0xbf1d2450, 0x3f3c4e0b, 0x3e87dfbb, 0x3eb7d4fe, 0x3df3670c, 0x3dd61ab6, 0x3f1952dc, 0xbed25ced, 0xbd06fa2c, 0x3f24bd66, 0x3e80c704, 0x3ef1c4a2, 0x3e17690e, 0xbf800000, 0x3ee4ae14, 0xbdff0a29, 0xbe36ff1e, 0xbf5013fb, 0x3e107cce, 0xbf2e9144, 0x3ed2c13a, 0xbed3c76e, 0x3f4d7913, 0xbeb1f014, 0x3f1f16b4, 0xbf32238d, 0xbf48e3fd, 0x3f48a160, 0xbf23d361, 0xbe91b43d, 0xbe915296, 0xbf1d952a, 0xbd47803e, 0x3e536c16, 0x3e2b8b26, 0xbf39495b, 0x3f800000, 0x3e641cb4, 0x3f231672, 0xbe1c3c4a, 0x3ec7456f, 0x3e6bf4ac, 0xbf0a3de9, 0x3e911276, 0xbf019535, 0xbeab4fa1, 0xbe4db21b, 0x3eb346d6, 0xbd221e4a, 0x3f2007e2, 0x3eb15429, 0x3d27e5eb, 0x3e468564, 0xbf01af45, 0x3ea06503, 0xbf299233, 0xbe8b6ab6, 0xbf800000, 0x3e4cc71f, 0x3ce4cb0e, 0x3eb0c12c, 0x3f13436e, 0x3e756ca8, 0x3eed299f, 0xbf2a6c30, 0xbe1bf45a, 0x3f800000, 0xbe1f5a8a, 0x3f703363, 0x3d8995aa, 0xbf3fbebc, 0x3ec36b35, 0xbf5189de, 0xbed63d54, 0xbf4b9c08, 0x3dfc59aa, 0xbf800000, 0x3db3f4a1, 0xbe80e58c, 0xbe7389e0, 0x3f035e9a, 0x3e9a30c4, 0xbe9342ac, 0xbed82f26, 0xbc8526ec, 0xbf10d3af, 0xbe789fd5, 0x3f2c7331, 0x3ece7cc7, 0x3f27912c, 0xbf2779ba, 0x3f7d6374, 0xbf800000, 0x3e8b7c39, 0xbe7d2bec, 0x3f1e5004, 0x3f6d4c5b, 0x3f800000, 0xbecffbaf, 0xbef7457e, 0x3dadda13, 0xbf484d6a, 0x3f5e244c, 0xbde9e672, 0x3f155caf, 0x3d824847, 0x3f0f23eb, 0x3f3e6e2e, 0x3d5a79ca, 0xbee58a3b, 0xbf800000, 0xbf5d5eb0, 0xbd5812f3, 0x3ca61aec, 0x3f28aa44, 0xbdb4ad97, 0x3ecbab58, 0x3e37026a, 0x3ce1d543, 0xbec2c193, 0xbe46b0a1, 0xbf50098c, 0xbd3803b8, 0x3efa7a69, 0xbd45a3c0, 0x3f800000, 0x3ed2f731, 0x3f553abf, 0x3edb4c05, 0x3cfcf83c, 0x3e263c30, 0xbf523c82, 0x3ed49e06, 0xbe88969f, 0xbf0413bd, 0x3e1dc97f, 0x3e2d3cdc, 0xbf11ee35, 0xbe339340, 0x3ddf6856, 0xbe37743f, 0xbe0b7c1f, 0xbeb64008, 0xbf7fd4c9, 0xbe1678e3, 0x3deaba8c, 0x3ebe0237, 0x3dd6b83a, 0xbe20f781, 0xbee27fbb, 0x3e55186e, 0x3ecfa254, 0xbe61ebc0, 0x3f800000, 0xbeacb8bf, 0x3ee36ec8, 0xbf54fdef, 0x3e9a7054, 0xbe98fa11, 0x3f26f7ef, 0xbe6c45fb, 0x3eafcb7b, 0x3ebb5010, 0x3ed9938a, 0x3e3a68a1, 0x3d16d519, 0xbcbfc3c6, 0xbeeba502, 0x3f1180f7, 0x3df76099, 0xbc658c37, 0x3e0fc3e5, 0xbe8845c6, 0x3f0f086c, 0x3f786535, 0x3eadafb2, 0xbd9fb56d, 0x3f2f56ea, 0xbe69f921, 0x3e5da08a, 0x3f23c30b, 0xbdfaa05f, 0x3ee7489e, 0xbf0e63a3, 0x3ec73fd4, 0x3ddcb8d1, 0xbe80c68b, 0x3f20880e, 0xbe988ec1, 0x3e194950, 0xbe5b2d95, 0x3e93ad72, 0xbee20114, 0x3f800000, 0x3eb9123a, 0xbeae6615, 0x3e3c72b9, 0xbe999fa9, 0x3f22de35, 0x3ed93aad, 0x3ec6c3d8, 0xbf095f25, 0x3e446b3f, 0x3c81d249, 0xbbb94d97, 0x3ebd3fbd, 0xbe1bbbd7, 0x3e4b52cd, 0xbf800000, 0xbe1d10dd, 0x3e3bed8b, 0xbe990dcf, 0x3f37274b, 0xbe5c15c9, 0xbf30e052, 0x3f49ecd2, 0xbe51d5e9, 0xbf232b8e, 0x3e02b1ee, 0xbf263fc6, 0x3e9d9bf4, 0x3df639ad, 0xbf6a0262, 0x3edc352c, 0xbd39bc04, 0xbf09ffd1, 0xbe94af07, 0x3f37d207, 0xbdd70dd3, 0x3e26dfa5, 0xbea96b6f, 0xbeb2f4fe, 0x3f5df03a, 0xbed082a7, 0xbe6ac9f0, 0x3de726da, 0xbf800000, 0x3da6ef8d, 0xbe98afa9, 0xbe214760, 0x3f3b4c0b, 0x3e3425d6, 0xbe82d225, 0x3ed96686, 0x3efdc759, 0x3b9cd7e3, 0x3f259f82, 0xbf08d8c5, 0xbb189dcb, 0x3ef4c867, 0x3eb56309, 0xbf370146, 0xbf79b033, 0xbdb3c392, 0xbe0984b1, 0x3daaac07, 0x3eb581aa, 0xbe0feb84, 0x3e6d4f86, 0x3ed98d00, 0xbd909c42, 0xbd9efd0a, 0xbf800000, 0x3ee3e231, 0x3f48988e, 0xbe854b0b, 0x3ebf158b, 0x3dc8ebe7, 0xbeed2980, 0x3d9b327c, 0xbe1a24bc, 0xbe9454c4, 0xbe5e8928, 0xbe65c304, 0xbf2a7ce8, 0xbf5c4fb7, 0x3ebdf7ff, 0xbd0648bd, 0x3f65ac28, 0x3f09c587, 0xbeb65751, 0x3d642c79, 0x3d0dbecf, 0x3e1c033c, 0x3e777363, 0x3ec0d180, 0xbf7f147d, 0x3dcf2046, 0x3ed1ce6c, 0x3e215134, 0xbd97ead7, 0x3e819e0d, 0xbf09754d, 0x3e6ca9c8, 0xbd3423d2, 0xbd1571e9, 0x3d24f8e3, 0x3ebc8578, 0xbe8bc361, 0x3ed3cc7f, 0xbec612ea, 0x3e369adf, 0xbebaa638, 0xbdca0c29, 0xbe76efd8, 0xbf04ee9b, 0x3f0b90dc, 0x3de3f5e1, 0x3d4253c5, 0xbe7ca45c, 0xbf800000, 0xbe35004b, 0x3e18d074, 0xbda55913, 0xbd101d69, 0xbd93c0a7, 0xbdd5b112, 0x3e985e4f, 0xbe1a053a, 0x3ebadb45, 0xbef7b4ae, 0xbe685e4e, 0xbef8b25d, 0x3ef6d0ae, 0xbd8c19ed, 0xbb02e749, 0x3e8ad8e5, 0xbf037329, 0xbea17713, 0xbe3dc677, 0xbf1bf1e4, 0x3dfb597e, 0x3ee45dd8, 0x3f800000, 0x3e8a90ab, 0x3e66e45c, 0x3e8d6d35, 0x3eabde4b, 0x3ef2586f, 0xbf469304, 0x3f19a7e3, 0xbdd30286, 0x3e71cabe, 0x3f239c52, 0xbe686ea0, 0x3f029293, 0x3ef5377a, 0x3daf6315, 0x3f322a18, 0x3f005f12, 0x3d6386a2, 0xbe827137, 0x3e8cb844, 0x3f0cf9b1, 0xbef8a868, 0x3dd98e4b, 0x3f06a2b3, 0xbb1607ff, 0xbeab47bc, 0xbda44e87, 0x3d08d0cf, 0xbb195031, 0x3ec97065, 0x3ec8cc2e, 0xbdc08c4b, 0xbeb6478e, 0xbf3db0bd, 0xbdd9bc4e, 0x3de900f1, 0x3f1ba486, 0x3ea595ae, 0xbd2d167c, 0x3ea9f0d5, 0x3ed75949, 0xbf034cb1, 0xbed02747, 0xbe28f8d4, 0x3e8fb68f, 0x3f1199a4, 0x3eef13ff, 0xbf6f5dcb, 0x3e0eae76, 0xbde0e770, 0x3ee880b3, 0xbdaf80ed, 0x3e3db76e, 0xbe182515, 0x3ecf9e64, 0x3e3325a2, 0xbe03dca6, 0x3e114ea3, 0x3d3f9e3a, 0xbe6419c2, 0x3f800000, 0x3f17dbb1, 0x3dc5c212, 0x3dd375ef, 0x3dad21e6, 0x3f30c4ae, 0x3ea4db29, 0xbf21ca14, 0x3e35d5b8, 0x3ce8f023, 0x3f03ac8e, 0xbe966c5e, 0x3f2a0142, 0x3e976834, 0x3f1cf7ee, 0xbdf32756, 0xbd9413c2, 0xbd9b0850, 0x3eb05fd0, 0x3ec17acb, 0x3f0adda3, 0xbecb1c2d, 0xbf05da2a, 0x3cf002d8, 0xbe7bc287, 0x3e920c76, 0xbded0954, 0xbeae3379, 0xbe5e1b04, 0xbd3a2d45, 0xbdff1c6d, 0xbe3ba409, 0x3ede378c, 0x3e223aba, 0xbe4f4931, 0x3e98286c, 0x3d008e33, 0x3e8293a1, 0xbe0eb219, 0xbe32879f, 0x3e6dfb97, 0xbf13c3d7, 0x3df45028, 0x3e8148cf, 0x3f229250, 0xbf3fa0d8, 0xbe4c7f3f, 0xbe8af169, 0x3ccd54a9, 0xbde97c54, 0xbee06c1e, 0xbf57b3ad, 0x3e72b64e, 0x3e4689e3, 0xbe1ee093, 0xbf0b6c5b, 0xbecedbe7, 0x3ef37205, 0x3c92ccd9, 0xbe9b9995, 0xbdc9a77c, 0xbf800000, 0xbdf9b1a7, 0xbe1e2094, 0x3e62464e, 0x3ebeee87, 0x3d1f099e, 0x3e4b6170, 0xbda888b2, 0x3f283ebc, 0x3f511a60, 0xbd56b475, 0x3ef55bde, 0x3da15fb7, 0x3ee7afcf, 0x3dcf401f, 0xbd20801d, 0xbf786ebf, 0x3ed985c6, 0x3ed39204, 0x3d596463, 0xbe12f50f, 0x3f2d7ecb, 0x3d9e9138, 0x3e969288, 0x3d0ebe61, 0x3f7c682c, 0x3e294963, 0x3e9214e3, 0xbe30ad9d, 0x3b73c4c8, 0x3e47e04f, 0xbf362580, 0x3f15a564, 0xbe19bc64, 0xbeea8d84, 0xbf5cab13, 0xbd6b18b6, 0xbf800000, 0x3eb04ab7, 0xbef4c81f, 0xbf50b8f8, 0xbe732507, 0x3f2453f3, 0x3f7d3a38, 0x38e1b101, 0x3f217b61, 0x3ea02d93, 0xbe6c7eb0, 0x3ea5e499, 0x3ea6ca3b, 0x3dcba9eb, 0x3e080151, 0xbf01ff50, 0xbf14dc41, 0x3f29bfc1, 0xbecb7235, 0x3f800000, 0x3e06a60d, 0x3e886e27, 0xbf609099, 0x3ee788a6, 0xbec1de02, 0x3ed75f47, 0xbef2804f, 0xbf3112e3, 0x3e971f77, 0xbd379480, 0xbe87dfd5, 0xbe78b2ef, 0xbeae163a, 0x3f44ce7c, 0xbf2d58e5, 0x3ed6e503, 0xbf290128, 0x3f168023, 0xbebfc292, 0xbe877d58, 0x3f110ff9, 0xbdd8032a, 0x3efb4b65, 0xbde5b7ef, 0x3ee35371, 0xbdca97a2, 0x3d5d8602, 0xbea9ec06, 0xbe120707, 0x3e871c50, 0xbf04b4ac, 0x3b1abdcf, 0xbe466ec8, 0x3ccbfbf7, 0x3e0b7d36, 0xbe957ef1, 0x3eb5eef3, 0xbe8b7aef, 0x3d22be08, 0x3e47d030, 0xbe784dbe, 0x3e65e7d9, 0xbe887074, 0xbd95de9d, 0xbe38d9b2, 0xbd8408d7, 0xbe2dbdf8, 0xbef5506b, 0x3d3f5eb9, 0xbdb605fb, 0xbebc29ab, 0xbe3e03bd, 0x3e792fb6, 0x3e96e4c1, 0x3e5fcc29, 0x3dfdf44a, 0x3ebcf7e5, 0x3f800000, 0xbf20f3a7, 0xbe08a1bf, 0xbed981c0, 0xbe1f629c, 0x3ea0e335, 0x3eaa4e89, 0xbb5ed9ab, 0xbd87724a, 0x3e52c452, 0xbd893420, 0xbe288cf8, 0x3e8fcab0, 0x3e0f29f2, 0x3e646d29, 0x3c52982f, 0xbebb361c, 0x3ed4bf74, 0x3dcdf6c6, 0x3eb3ab78, 0x3f35fde5, 0x3e04ef07, 0x3eb0e616, 0x3df39ed8, 0xbe7179a0, 0xbe67904a, 0x3cf74673, 0xbf058ae4, 0x3e83c12e, 0x3e6a64c5, 0x3f1b17c7, 0x3eead084, 0x3ed3e85e, 0x3f498206, 0x3e82b655, 0x3dd59a9a, 0xbe6bfa16, 0x3ef58827, 0xbf800000, 0xbee70318, 0x3f1ce358, 0xbe57d631, 0x3d0d4db1, 0x3eab6d89, 0x3e9b4fbf, 0xbef3c109, 0x3dbe766e, 0xbc816c98, 0xbeee9a60, 0xbe827392, 0xbe4acddf, 0x3f466add, 0xbf3917fe, 0xbe5af06d, 0xbe779dc9, 0xbce79225, 0x3ca29f07, 0xbf800000, 0xbec07726, 0xbf1711e7, 0xbe4a37b3, 0xbe098318, 0x3f5c1b57, 0x3e9d1c8d, 0x3ea7ca1d, 0xbf5781b3, 0x3e1402bb, 0x3e57349d, 0x3dab7751, 0x3efac01a, 0xbf7c1bb3, 0xbf51f279, 0x3d9002ae, 0xbd45e888, 0x3ef06685, 0xbf4d340c, 0xbedb03ae, 0xbc32a78d, 0xbf69c782, 0x3e127e2c, 0xbf800000, 0xbed5a087, 0x3e2fb460, 0xbcab7c09, 0xbf72ea83, 0x3e7fc281, 0x3ed16956, 0x3df1b0af, 0xbe9b75de, 0xbe5558b1, 0xbed9283b, 0xbed4f8df, 0xbf19d131, 0xbe59442d, 0xbee7f62b, 0xbe6cd0d5, 0x3e141956, 0xbd956d39, 0x3b55c23a, 0xbd3eaf8e, 0x3e5d9d7b, 0x3e76c644, 0x3ea2e1fb, 0xbf4eb01b, 0x3ec7776e, 0xbe9efb2c, 0xbee1b35e, 0xbe981818, 0x3e6771ec, 0xbeeb74d2, 0xbe1d75c0, 0x3ef46ab4, 0xbf800000, 0x3e693373, 0xbdc6ad0f, 0xbe8cd2e0, 0xbe359031, 0x3eac29a8, 0x3d58fc2f, 0xbf800000, 0xbd2f51c2, 0xbd81f94f, 0x3db7c1ea, 0xbcf5162b, 0xbf04db11, 0x3ea563d0, 0xbe61ff4c, 0xbdc81ee4, 0xbf2a75cf, 0x3ea441b2, 0x3eafd3e7, 0x3d9cd757, 0xbe3482e8, 0xbe9c397b, 0x3ece940d, 0xbe4742a5, 0x3d6426b0, 0x3e8e97b0, 0x3e437dfe, 0xbe14172d, 0xbe2c6456, 0x3da97a30, 0xbf1a1701, 0xbe690d20, 0x3e4ba434, 0xbe6b37f9, 0x3dc74fb4, 0xbe3b508e, 0xbdbff130, 0xbe9624dc, 0x3e805247, 0xbeeb6231, 0xbf800000, 0xbe3b4d14, 0x3edcada5, 0xbe747535, 0xbe1ec954, 0xbf2ab415, 0x3e4a3ffa, 0xbe0e6515, 0x3f3f8d3e, 0x3e5e863b, 0x3f66c0a8, 0x3dc5bff6, 0x3e789a6e, 0x3e22a59a, 0x3f611652, 0xbe8ef0c5, 0xbe933ac7, 0xbf5391fc, 0x3f075dcd, 0xbe16acd3, 0xbf3d26cb, 0xbf356adb, 0x3f3d2194, 0x3f2088c2, 0x3e085be2, 0x3e866cbf, 0xbf400229, 0xbf588bbc, 0x3f800000, 0x3e95d89a, 0x3e71eb78, 0xbf28f3e3, 0xbeabbf26, 0xbe66924d, 0x3ed7c2e1, 0x3c8ee709, 0x3e46ab39, 0x3e860ddd, 0xbed2d95f, 0xbe8a62c9, 0x3f26ca64, 0x3e26adcf, 0xbe4f0043, 0xbf66a2be, 0xbec59e1f, 0xbdee80bc, 0xbdfd4ca3, 0x3e7c5cf9, 0xbf105c21, 0xbe40e1c7, 0x3ec4a263, 0xbf256b53, 0x3da15d57, 0xbf212135, 0xbe2eaf70, 0x3f1f39d9, 0xbd05e236, 0x3e3a113a, 0xbeff8b9d, 0x3ec9043f, 0xbf565c36, 0xbdb67a32, 0x3dd61560, 0x3da1e25d, 0xbda3f534, 0x3e021a61, 0x3ea1cd59, 0xbf269b3e, 0xbe50eb78, 0xbe59bccf, 0xbe3bb501, 0xbf59e049, 0x3c840fdb, 0xbbec697d, 0x3eeb2431, 0x3f131532, 0xbf0e1914, 0x3e504e41, 0x3d080f1f, 0xbd15fb18, 0xbcc2b9f7, 0x3e6e3e1f, 0xbbad58d7, 0x3eaee8cc, 0xbeebf0d3, 0xbef5022b, 0x3ca1d00f, 0x3efdd25e, 0x3f148434, 0xbf800000, 0x3de4eee7, 0x3eae057d, 0x3cf85922, 0x3eb375b7, 0xbf07967f, 0x3c8db33a, 0xbd6bb439, 0xbe7aabf0, 0xbf405085, 0xbefd6742, 0xbccee33c, 0x3ef1d692, 0xbe6f2276, 0x3d0f9dbf, 0x3dcc0c28, 0x3eb59202, 0x3c205808, 0x3ce3c09c, 0x3ebd670c, 0xbec21dbe, 0x3eecc344, 0x3e759785, 0xbf00093c, 0xbc8e7eea, 0xbece9d2a, 0xbe655a8b, 0xbe135669, 0x3d907aad, 0xbe66eca8, 0x3ead16fa, 0x3e49dd11, 0x3ce0523c, 0x3f024e09, 0xbddebe0e, 0x3ba69170, 0xbd2f1add, 0xbe473569, 0xbf3d1ff9, 0x3db8f029, 0x3eee4029, 0xbe6508b3, 0xbe59aa26, 0xbc135c06, 0x3d84eba8, 0xbf0423d1, 0x3edeb7f4, 0xbf049db5, 0x3e1d88cb, 0xbe76f4b8, 0x3e8b2d84, 0x3f222e16, 0x3dfdbaa3, 0xbe335a78, 0xbd90c38b, 0x3ef789b3, 0xbe1b7e53, 0x3eeef3d9, 0xbf483781, 0xbe2c8f04, 0x3e17c774, 0xbf3a5e4d, 0x3d5a251a, 0xbf5c005a, 0xbf418f93, 0x3dfd73e8, 0xbd7b561e, 0xbf179d88, 0xbecedd4e, 0xbf77f6db, 0xbf1428e7, 0x3f5673fb, 0x3e80078a, 0xbe9b922b, 0xbdbfc2e8, 0x3e935e15, 0xbdc8b52c, 0xbd7dfe08, 0xbf0387e4, 0xbf6bd7a7, 0xbececfac, 0xbe8de9a7, 0x3f800000, 0xbe951a7a, 0x3e937c97, 0xbc056d36, 0xbeb6a924, 0x3f0ee341, 0xbdecfb2e, 0xbe168e89, 0x3e44b84e, 0x3e5bc17e, 0x3f1792d0, 0xbf2f3086, 0xbedc8caf, 0x3ea264e1, 0x3da79e37, 0xbc82019d, 0x3efe8ea5, 0x3e43882b, 0x3e5ae78b, 0xbf548208, 0xbeed32a9, 0x3ecbf12c, 0x3e80e091, 0x3ed2fe00, 0xbe5fc425, 0xbf6bdeda, 0xbb43450a, 0xbcfe965f, 0x3df02554, 0x3f1bc24c, 0x3eded785, 0x3edae27c, 0x3d6fe100, 0xbea64619, 0x3e03814c, 0x3ed982c3, 0xbf217f18, 0x3d862719, 0xbdc20573, 0xbe319f2c, 0x3f800000, 0x3e27dfc9, 0x3d6be241, 0xbe325e58, 0x3ce8491b, 0xbf32966a, 0xbc984647, 0x3e82095b, 0x3ecfa302, 0xbe1e586f, 0x3ef19b1b, 0x3f0ac3f0, 0xbe50539f, 0xbeb71cbb, 0x3ef568d8, 0xbedc08b0, 0xbe96763c, 0x3e0d1960, 0x3ecb08d8, 0x3f5b6c69, 0xbdec3e67, 0xbdaaeeb0, 0xbe2eaf4f, 0x3ebc913a, 0x3d9b9728, 0xbf0bf764, 0x3e1d7f0c, 0x3d9218f8, 0x3f2ff927, 0xbed229a1, 0xbf44578b, 0xbe5c3803, 0x3e51132e, 0xbe765d3b, 0xbf4e9ece, 0x3ecb83f8, 0xbe4292e2, 0xbdaa6146, 0xbf0c46f9, 0xbe38b07d, 0xbedb1e76, 0x3ed95083, 0xbde0dce8, 0x3f0ed9c1, 0x3e532678, 0x3f2e85ee, 0xbe7dd495, 0xbea83eda, 0x3d925250, 0x3df05141, 0x3eb59957, 0x3e9c26d2, 0xbf1e8de6, 0x3e236301, 0xbd911947, 0x3f78a297, 0xbe83f92e, 0x3e6872e3, 0xbf1a3aae, 0xbe8f4f32, 0x3c8030a5, 0x3e90e465, 0xbf44c604, 0x3d54c51d, 0xbcf6cd50, 0xbead4829, 0xbedb4ce3, 0x3f062359, 0x3cb02c08, 0x3ebef08d, 0xbea942e9, 0x3e7d88f5, 0xbf5c99bb, 0x3e837727, 0x3dbfac28, 0xbf532711, 0xbe3e2f58, 0xbd265514, 0x3e75c265, 0x3f2e0e67, 0x3f3579d7, 0x3ed6e5fd, 0x3eb90609, 0x3e8fbf36, 0x3ef11bcb, 0xbe887aa6, 0xbdb136f5, 0xbf145fb5, 0xbee99f4d, 0x3ef681f0, 0xbe5503d7, 0x3e8f41a9, 0x3ed83c07, 0x3e87c6ac, 0x3f066e0b, 0x3e239449, 0xbe440d1d, 0xbce2b98e, 0xbdb28d61, 0x3d1572d1, 0xbe49aaa3, 0xbf800000, 0x3f00eee8, 0xbf2e5b84, 0x3e32d9ae, 0xbec79c35, 0x3e1a00f8, 0x3d02b5bc, 0x3e39bb97, 0x3e18705f, 0xbf74f517, 0xbd1f7657, 0xbd2a78c1, 0x3e40b93a, 0xbe61a727, 0xbe9dcec9, 0x3ecc2fb6, 0x3e40fd61, 0x3e53bc63, 0xbe8e14e6, 0x3f06f503, 0x3f11fca7, 0xbf448ee1, 0x3ea06804, 0x3f27a2d7, 0x3e9ad6ab, 0xbf0fda39, 0x3e8f581b, 0x3e47452a, 0xbd3e5a96, 0x3e291ffd, 0x3eaf9a07, 0x3e07e2e2, 0x3d8f474a, 0xbe7c6ca0, 0xbcdd5961, 0xbdce1bb4, 0xbe9b70ef, 0xbcb46650, 0xbdb97088, 0x3e9e6481, 0x3e4d9feb, 0xbf23c5cc, 0x3ea4dcad, 0xbe806f3c, 0xbdcfd2b0, 0xbe8b78d8, 0xbe841014, 0x3e12bdfe, 0xbd4ac247, 0xbf064349, 0xbe1148a3, 0x3e60cb5f, 0x3ccdad9a, 0xbf5d0a67, 0x3d1e8358, 0xbef4ba4a, 0xbebfb9a0, 0x3e72e8a4, 0xbdf8c09d, 0x3e34bef7, 0x3c8dcc54, 0x3d841048, 0x3ebbc2f3, 0xbf10016f, 0x3d553741, 0x3ee40bc8, 0x3e0307c5, 0xbe19672b, 0x3ef594d3, 0x3d4338fc, 0xbdd5104b, 0xbdda83e6, 0xbedaca7c, 0x3f07f627, 0xbea1f735, 0xbed6bf10, 0x3e853663, 0x3dfa7d8e, 0xbea6ad6c, 0x3f800000, 0x3f1726cd, 0xbe97561e, 0x3ef025c8, 0x3e45a1b2, 0x3e479dc3, 0xbe238e80, 0x3f02310c, 0x3d6da084, 0xbde38eb7, 0xbcb8169a, 0xbe0d24ea, 0xbed4e51c, 0x3f047b5a, 0xbe93dd5d, 0xbd535140, 0x3e8c81a6, 0x3e8dfd1d, 0xbe5c1831, 0x3e13b59c, 0x3f62ed36, 0xbeeef5ee, 0x3e490c92, 0xbedec01a, 0xbe561ca6, 0x3c579622, 0x3f1f4536, 0x3cfb571a, 0x3e9e466c, 0xbd6ac422, 0x3d9a7cf8, 0x3e33927f, 0x3ed43263, 0x3dde5247, 0x3e895b85, 0x3d534be7, 0xbe85bca9, 0x3e0a98fb, 0xbf14e647, 0xbeeb3e72, 0x3de97443, 0x3f00fec3, 0xbf1279b0, 0xbe7b7b44, 0xbd907f6b, 0xbf800000, 0x3ebcc52f, 0x3f043581, 0xbe90c19a, 0x3e1dd044, 0xbeb8ecde, 0xbf1e9804, 0x3e118491, 0x3d982d2b, 0xbddb503a, 0x3ee37546, 0xbb2a88ab, 0x3e2da9fc, 0xbedcff52, 0xbea73def, 0x3f0ef856, 0xbd818f86, 0xbeb73cc2, 0xbd8c70d2, 0x3e0b0eca, 0xbd4df4bd, 0x3eebc112, 0x3e148265, 0xbe6bbdff, 0xbd6c4544, 0x3e246078, 0xbd13a7a6, 0xbe16c93a, 0xbe8317d5, 0x3ea5b98e, 0x3e43c4b0, 0x3e92f4b7, 0x3cb3643d, 0x3e9392b6, 0x3f1b005b, 0x3e1696a1, 0xbbf9c324, 0x3e837d2b, 0x3ddb037d, 0xbf39b885, 0xbe6c705f, 0x3e306d0a, 0xbe9c0954, 0xbddba52d, 0xbe97bd78, 0x3d203fd3, 0xbd9091ed, 0x3e71c49d, 0xbdd7e0ef, 0x3b8c37e5, 0xbbe3bb18, 0xbf6a682a, 0x3dadd654, 0x3ea9ee3e, 0x3f33ca7f, 0x3d8b467f, 0xbd24459f, 0xbf0435fa, 0x3eceb6c6, 0xbed22ea0, 0xbf04e774, 0xbec0a001, 0x3f32a8f1, 0x3f27b7c4, 0x3ead2cf2, 0x3d05b071, 0xbed9d648, 0x3cac09a0, 0xbd0cc0a4, 0x3e45a208, 0x3ec336e1, 0x3e06473d, 0x3e50b977, 0xbd177f55, 0x3edccb41, 0x3eefacdd, 0xbe1ce17f, 0xbd4229b8, 0x3e2f67d2, 0xbf0641af, 0xbe11540b, 0xbf03577a, 0x3eb508b6, 0x3e91d69b, 0x3e9b0c17, 0x3f488b32, 0xbf2cd92e, 0x3b057da6, 0xbd1d73da, 0x3f6099b0, 0x3f1e3263, 0xbd5cdb9a, 0x3e310315, 0x3e449522, 0x3dbd7104, 0x3ea2c7fd, 0xbed7b2b4, 0x3c30e512, 0xbdfc24bc, 0x3f4b0eed, 0x3e53b3f0, 0x3b8dcb82, 0x3effd804, 0xbf800000, 0x3e11254d, 0xbef3e0ac, 0xbd84cb6b, 0x3e7fff25, 0x3ec198df, 0x3e0b5663, 0xbee4e1f2, 0x3e8e4ad8, 0xbe0fa4e1, 0xbedcac93, 0xbe8e9bb2, 0xbebcacc7, 0x3e8f9a75, 0xbeb5e618, 0xbe2def7a, 0xbf35d262, 0xbe50332d, 0x3d1941ec, 0x3f219d56, 0x3e5bf0d7, 0x3dc74983, 0x3ca1f01f, 0xbecdc74d, 0x3e2c64d6, 0xbf0aad54, 0xbd1b18aa, 0x3f035e23, 0xbd2030fc, 0xbd138736, 0x3ea544d9, 0x3f218e8a, 0x3e33e80d, 0xbece90e7, 0xbec58b69, 0xbd688be9, 0xbf2c5fca, 0xbd625f22, 0xbebe7d1d, 0x3e29347f, 0xbe73b7b6, 0x3ea2672e, 0x3e52e892, 0x3ec7738d, 0xbea06553, 0x3f038fe0, 0xbe2a3f90, 0x3de68aa0, 0xbf1a2402, 0xbdc45c50, 0xbf32f6bc, 0x3e9a5951, 0x3c8bd7da, 0xbda8bf2d, 0xbc8e6449, 0xbdf4ce2f, 0x3d283307, 0xbdee603c, 0x3dd64ade, 0x3d4d027b, 0x3e79aa68, 0x3dc54600, 0xbefe855a, 0x3f800000, 0x3e3fcaf6, 0xbddfc308, 0xbc9438cc, 0x3d8d02df, 0x3e37fa1f, 0xbebc13da, 0x3ebc60a0, 0x3e1a55c9, 0xbe912d2a, 0x3d02093d, 0x3edcf733, 0xbdb577cb, 0xbe607b8e, 0x3e708504, 0x3efb43df, 0xbe378dd3, 0x3df688ca, 0xbf3c456e, 0xbd8e875f, 0x3ae0f8ed, 0x3ed48be3, 0xbefde4e0, 0xbd2cd62f, 0xbefb7c53, 0x3f117c90, 0x3ec0e974, 0xbf69973e, 0x3d94ce3d, 0xbef4e49e, 0x3e5ca6a0, 0xbe9c0a45, 0x3f385f4d, 0x3f133f56, 0x3c350836, 0x3d616893, 0xbedec009, 0x3e61b8ca, 0xbe753923, 0xbca8cf3c, 0x3da07f7c, 0xbeb14f73, 0x3ddb6941, 0xbe0995b7, 0xbeac82ee, 0x3e581e4f, 0x3e1c94c9, 0xbef01ada, 0xbefa340c, 0x3eb29b10, 0x3df09414, 0x3eb0c697, 0x3d1757e9, 0xbefd6276, 0xbd1d3bb2, 0x3f285294, 0x3c2e79f2, 0xbc109b48, 0x3e856249, 0xbcb98b71, 0xbf4f4344, 0xbc87053c, 0x3e9babd8, 0x3e8cf9e3, 0xbdfa1a9b, 0x3cd60580, 0xbcf3eab9, 0x3f1cd2a2, 0x3d8602fd, 0xbca0ff83, 0x3dca746e, 0xbe74103b, 0xbe9343e6, 0x3ecfb610, 0x3e4ead92, 0xbe821d93, 0x3e71d6b9, 0xbf068750, 0xbedf0ff1, 0x3e8af15e, 0x3eccacae, 0xbe8bee84, 0x3e8bca8f, 0xbef4a01a, 0xbeab6dc3, 0xbed10c4d, 0xbc0fe30c, 0xbe1ad88a, 0xbecb7c13, 0xbf015d24, 0xbed8c923, 0xbc0e132b, 0xbdb9e5f6, 0xbea56300, 0x3dcc8f39, 0x3eb7f0d4, 0xbee5c6cd, 0x3e8fdff8, 0x3ddbc636, 0xbe22fbb4, 0x3f1d8e51, 0xbcf7001c, 0x3ea26e06, 0x3f1321a5, 0xbcc01a68, 0xbd8b8219, 0x3e67c96a, 0x3f07f1ec, 0x3e44fe5e, 0x3f0b4634, 0xbdc24617, 0xbeb4ffcd, 0xbf800000, 0xbdff1121, 0xbea281d0, 0xbecfea1f, 0x3e195b8d, 0xbf063280, 0x3e185510, 0x3ddd1bd8, 0xbf2f5970, 0x3da88c70, 0x3e830234, 0x3e6770ed, 0x3eeb6c3f, 0x3e964747, 0xbc6a8adc, 0x3edc95b9, 0xbf5c0e9d, 0xbe3860ca, 0x3e5e2c66, 0x3e1c746e, 0xbeb27ca0, 0x3e13bc81, 0x3f050da9, 0xbe0ce80f, 0x3ef4ec13, 0xbe68a5f3, 0xbf4299de, 0x3dcfc728, 0x3d55bcaa, 0xbf1a2dab, 0xbbf41e50, 0xbec3733b, 0x3eea6690, 0xbea55ac4, 0x3edb45e2, 0xbde1ba61, 0x3edef1b5, 0x3dff66be, 0xbdb24bf7, 0xbec4bf78, 0x3d10bec0, 0x3f58f04a, 0xbf1e0d88, 0xbdd22003, 0x3e81d11f, 0xbe38757b, 0xbe25b0b6, 0x3dea4f49, 0x3f278b3d, 0x3e88e56f, 0xbd71cffe, 0xbeb4dd3c, 0x3e80f29d, 0x3ec96896, 0xbe2a11bf, 0x3e2aebbe, 0xbf47cdad, 0xbf1a9d57, 0xbf1a3a49, 0x3e0fecc9, 0xbf24bc8b, 0x3d5aac17, 0xbe85ede4, 0x3da6fb86, 0xbf343f67, 0x3f2fc61c, 0x3e271f88, 0xbe94d8c7, 0x3dc875ad, 0x3d86e23f, 0xbde6e6a4, 0xbed512ee, 0xbe4d52af, 0x3edbec70, 0xbf1f441c, 0x3e3cd321, 0xbeb3d563, 0xbe99e71c, 0x3e188fc2, 0x3e9764fc, 0x3e856460, 0x3d9fb475, 0x3df4aabf, 0x3f064018, 0xbd23f845, 0x3e524736, 0xbef5443b, 0xbe7ef173, 0xbef391a9, 0xbe9c4db0, 0xbf11bb51, 0x3db4fc37, 0xbf186079, 0xbeb38d44, 0x3da17449, 0xbe142287, 0x3f800000, 0xbec50939, 0xbdb00dfc, 0xbc02838e, 0xbf03a369, 0xbdf77093, 0xbf4cabd3, 0x3f21b621, 0xbe85114c, 0xbd373df3, 0x3e880e92, 0x3e28d5ce, 0xbe23172f, 0xbedbbf24, 0xbcfd2c77, 0x3e64f051, 0x3f05ab0b, 0xbe00a8e8, 0x3e6d1d55, 0x3d81105c, 0x3ef490d9, 0x3ee326df, 0x3d89d749, 0x3e457285, 0x3f3a0490, 0xbc519eb6, 0xbe8e724a, 0xbddf8b78, 0x3dd0a271, 0xbf02a72b, 0x3dba05b0, 0xbe990e78, 0xbd23f944, 0xbe94cf80, 0x3e3d2d9d, 0xbe3754cf, 0xbe6d034b, 0x3e090bc4, 0xbf25366d, 0x3ed08531, 0xbe91686c, 0xbd4bd717, 0x3dcf6ed9, 0xbe94e9cf, 0xbf1e1aa2, 0xbef3f99c, 0x3d4f7796, 0x3ef6e188, 0xbd3e8636, 0x3e1671c6, 0xbe90b782, 0x3f466789, 0xbdf36074, 0xbd6202ab, 0xbec321ff, 0x3d400b28, 0x3e9978ce, 0xbe4882d7, 0x3e1bb0e9, 0xbe664070, 0x3e016312, 0xbe9146f7, 0x3f21ffa9, 0x3ec5095f, 0x3eee7527, 0x3cc7cc3c, 0x3e3d84c4, 0x3e065736, 0xbebbb9c3, 0xbef920d5, 0x3ce58cc4, 0xbea2c5f9, 0x3e85ebdf, 0x3f0a31da, 0xbf120a45, 0xbeb1f1fd, 0x3dfb8604, 0x3e72e40a, 0xbf5cef81, 0xbf141695, 0x3e8b6b1b, 0x3e69c2ca, 0xbe3365c2, 0xbf0c852d, 0x3e9225f1, 0x3e947687, 0x3e8a06e2, 0x3ddfb90d, 0xbe73e96c, 0x3d90f3ac, 0x3e205a49, 0x3e0f690d, 0xbe3745bb, 0x3f800000, 0x3dc84f2e, 0x3d67ae33, 0x3e5ece9a, 0xbcecbe18, 0xbe81f976, 0xbdb8322b, 0x3e5cb61e, 0x3e1637b4, 0x3f454049, 0x3c561fc4, 0xbe749a02, 0x3c9f61d2, 0x3d829baa, 0x3e62c254, 0xbedb21fd, 0xbc95e954, 0xbec7a559, 0x3f25bc46, 0x3dcc4c30, 0xbe947320, 0x3e6cbc35 }; static const uint32_t in_coeff_decim[564] = { 0x3e4ccccd, 0x3e088889, 0x3d888889, 0x3e888889, 0x3e6eeeef, 0x3e4ccccd, 0x3e2aaaab, 0x3e088889, 0x3dcccccd, 0x3d888889, 0x3d088889, 0x3e906907, 0x3e834835, 0x3e6c4ec5, 0x3e520d21, 0x3e37cb7d, 0x3e1d89d9, 0x3e034835, 0x3dd20d21, 0x3d9d89d9, 0x3d520d21, 0x3cd20d21, 0x3e638e39, 0x3e2aaaab, 0x3de38e39, 0x3d638e39, 0x3e8ba2e9, 0x3e783e10, 0x3e59364e, 0x3e3a2e8c, 0x3e1b26ca, 0x3df83e10, 0x3dba2e8c, 0x3d783e10, 0x3cf83e10, 0x3e924925, 0x3e861862, 0x3e73cf3d, 0x3e5b6db7, 0x3e430c31, 0x3e2aaaab, 0x3e124925, 0x3df3cf3d, 0x3dc30c31, 0x3d924925, 0x3d430c31, 0x3cc30c31, 0x3e4ccccd, 0x3e088889, 0x3d888889, 0x3e888889, 0x3e6eeeef, 0x3e4ccccd, 0x3e2aaaab, 0x3e088889, 0x3dcccccd, 0x3d888889, 0x3d088889, 0x3e906907, 0x3e834835, 0x3e6c4ec5, 0x3e520d21, 0x3e37cb7d, 0x3e1d89d9, 0x3e034835, 0x3dd20d21, 0x3d9d89d9, 0x3d520d21, 0x3cd20d21, 0x3e638e39, 0x3e2aaaab, 0x3de38e39, 0x3d638e39, 0x3e8ba2e9, 0x3e783e10, 0x3e59364e, 0x3e3a2e8c, 0x3e1b26ca, 0x3df83e10, 0x3dba2e8c, 0x3d783e10, 0x3cf83e10, 0x3e924925, 0x3e861862, 0x3e73cf3d, 0x3e5b6db7, 0x3e430c31, 0x3e2aaaab, 0x3e124925, 0x3df3cf3d, 0x3dc30c31, 0x3d924925, 0x3d430c31, 0x3cc30c31, 0x3e4ccccd, 0x3e088889, 0x3d888889, 0x3e888889, 0x3e6eeeef, 0x3e4ccccd, 0x3e2aaaab, 0x3e088889, 0x3dcccccd, 0x3d888889, 0x3d088889, 0x3e906907, 0x3e834835, 0x3e6c4ec5, 0x3e520d21, 0x3e37cb7d, 0x3e1d89d9, 0x3e034835, 0x3dd20d21, 0x3d9d89d9, 0x3d520d21, 0x3cd20d21, 0x3e638e39, 0x3e2aaaab, 0x3de38e39, 0x3d638e39, 0x3e8ba2e9, 0x3e783e10, 0x3e59364e, 0x3e3a2e8c, 0x3e1b26ca, 0x3df83e10, 0x3dba2e8c, 0x3d783e10, 0x3cf83e10, 0x3e924925, 0x3e861862, 0x3e73cf3d, 0x3e5b6db7, 0x3e430c31, 0x3e2aaaab, 0x3e124925, 0x3df3cf3d, 0x3dc30c31, 0x3d924925, 0x3d430c31, 0x3cc30c31, 0x3e4ccccd, 0x3e088889, 0x3d888889, 0x3e888889, 0x3e6eeeef, 0x3e4ccccd, 0x3e2aaaab, 0x3e088889, 0x3dcccccd, 0x3d888889, 0x3d088889, 0x3e906907, 0x3e834835, 0x3e6c4ec5, 0x3e520d21, 0x3e37cb7d, 0x3e1d89d9, 0x3e034835, 0x3dd20d21, 0x3d9d89d9, 0x3d520d21, 0x3cd20d21, 0x3e638e39, 0x3e2aaaab, 0x3de38e39, 0x3d638e39, 0x3e8ba2e9, 0x3e783e10, 0x3e59364e, 0x3e3a2e8c, 0x3e1b26ca, 0x3df83e10, 0x3dba2e8c, 0x3d783e10, 0x3cf83e10, 0x3e924925, 0x3e861862, 0x3e73cf3d, 0x3e5b6db7, 0x3e430c31, 0x3e2aaaab, 0x3e124925, 0x3df3cf3d, 0x3dc30c31, 0x3d924925, 0x3d430c31, 0x3cc30c31, 0x3e4ccccd, 0x3e088889, 0x3d888889, 0x3e888889, 0x3e6eeeef, 0x3e4ccccd, 0x3e2aaaab, 0x3e088889, 0x3dcccccd, 0x3d888889, 0x3d088889, 0x3e906907, 0x3e834835, 0x3e6c4ec5, 0x3e520d21, 0x3e37cb7d, 0x3e1d89d9, 0x3e034835, 0x3dd20d21, 0x3d9d89d9, 0x3d520d21, 0x3cd20d21, 0x3e638e39, 0x3e2aaaab, 0x3de38e39, 0x3d638e39, 0x3e8ba2e9, 0x3e783e10, 0x3e59364e, 0x3e3a2e8c, 0x3e1b26ca, 0x3df83e10, 0x3dba2e8c, 0x3d783e10, 0x3cf83e10, 0x3e924925, 0x3e861862, 0x3e73cf3d, 0x3e5b6db7, 0x3e430c31, 0x3e2aaaab, 0x3e124925, 0x3df3cf3d, 0x3dc30c31, 0x3d924925, 0x3d430c31, 0x3cc30c31, 0x3e4ccccd, 0x3e088889, 0x3d888889, 0x3e888889, 0x3e6eeeef, 0x3e4ccccd, 0x3e2aaaab, 0x3e088889, 0x3dcccccd, 0x3d888889, 0x3d088889, 0x3e906907, 0x3e834835, 0x3e6c4ec5, 0x3e520d21, 0x3e37cb7d, 0x3e1d89d9, 0x3e034835, 0x3dd20d21, 0x3d9d89d9, 0x3d520d21, 0x3cd20d21, 0x3e638e39, 0x3e2aaaab, 0x3de38e39, 0x3d638e39, 0x3e8ba2e9, 0x3e783e10, 0x3e59364e, 0x3e3a2e8c, 0x3e1b26ca, 0x3df83e10, 0x3dba2e8c, 0x3d783e10, 0x3cf83e10, 0x3e924925, 0x3e861862, 0x3e73cf3d, 0x3e5b6db7, 0x3e430c31, 0x3e2aaaab, 0x3e124925, 0x3df3cf3d, 0x3dc30c31, 0x3d924925, 0x3d430c31, 0x3cc30c31, 0x3e4ccccd, 0x3e088889, 0x3d888889, 0x3e888889, 0x3e6eeeef, 0x3e4ccccd, 0x3e2aaaab, 0x3e088889, 0x3dcccccd, 0x3d888889, 0x3d088889, 0x3e906907, 0x3e834835, 0x3e6c4ec5, 0x3e520d21, 0x3e37cb7d, 0x3e1d89d9, 0x3e034835, 0x3dd20d21, 0x3d9d89d9, 0x3d520d21, 0x3cd20d21, 0x3e638e39, 0x3e2aaaab, 0x3de38e39, 0x3d638e39, 0x3e8ba2e9, 0x3e783e10, 0x3e59364e, 0x3e3a2e8c, 0x3e1b26ca, 0x3df83e10, 0x3dba2e8c, 0x3d783e10, 0x3cf83e10, 0x3e924925, 0x3e861862, 0x3e73cf3d, 0x3e5b6db7, 0x3e430c31, 0x3e2aaaab, 0x3e124925, 0x3df3cf3d, 0x3dc30c31, 0x3d924925, 0x3d430c31, 0x3cc30c31, 0x3e4ccccd, 0x3e088889, 0x3d888889, 0x3e888889, 0x3e6eeeef, 0x3e4ccccd, 0x3e2aaaab, 0x3e088889, 0x3dcccccd, 0x3d888889, 0x3d088889, 0x3e906907, 0x3e834835, 0x3e6c4ec5, 0x3e520d21, 0x3e37cb7d, 0x3e1d89d9, 0x3e034835, 0x3dd20d21, 0x3d9d89d9, 0x3d520d21, 0x3cd20d21, 0x3e638e39, 0x3e2aaaab, 0x3de38e39, 0x3d638e39, 0x3e8ba2e9, 0x3e783e10, 0x3e59364e, 0x3e3a2e8c, 0x3e1b26ca, 0x3df83e10, 0x3dba2e8c, 0x3d783e10, 0x3cf83e10, 0x3e924925, 0x3e861862, 0x3e73cf3d, 0x3e5b6db7, 0x3e430c31, 0x3e2aaaab, 0x3e124925, 0x3df3cf3d, 0x3dc30c31, 0x3d924925, 0x3d430c31, 0x3cc30c31, 0x3e4ccccd, 0x3e088889, 0x3d888889, 0x3e888889, 0x3e6eeeef, 0x3e4ccccd, 0x3e2aaaab, 0x3e088889, 0x3dcccccd, 0x3d888889, 0x3d088889, 0x3e906907, 0x3e834835, 0x3e6c4ec5, 0x3e520d21, 0x3e37cb7d, 0x3e1d89d9, 0x3e034835, 0x3dd20d21, 0x3d9d89d9, 0x3d520d21, 0x3cd20d21, 0x3e638e39, 0x3e2aaaab, 0x3de38e39, 0x3d638e39, 0x3e8ba2e9, 0x3e783e10, 0x3e59364e, 0x3e3a2e8c, 0x3e1b26ca, 0x3df83e10, 0x3dba2e8c, 0x3d783e10, 0x3cf83e10, 0x3e924925, 0x3e861862, 0x3e73cf3d, 0x3e5b6db7, 0x3e430c31, 0x3e2aaaab, 0x3e124925, 0x3df3cf3d, 0x3dc30c31, 0x3d924925, 0x3d430c31, 0x3cc30c31, 0x3e4ccccd, 0x3e088889, 0x3d888889, 0x3e888889, 0x3e6eeeef, 0x3e4ccccd, 0x3e2aaaab, 0x3e088889, 0x3dcccccd, 0x3d888889, 0x3d088889, 0x3e906907, 0x3e834835, 0x3e6c4ec5, 0x3e520d21, 0x3e37cb7d, 0x3e1d89d9, 0x3e034835, 0x3dd20d21, 0x3d9d89d9, 0x3d520d21, 0x3cd20d21, 0x3e638e39, 0x3e2aaaab, 0x3de38e39, 0x3d638e39, 0x3e8ba2e9, 0x3e783e10, 0x3e59364e, 0x3e3a2e8c, 0x3e1b26ca, 0x3df83e10, 0x3dba2e8c, 0x3d783e10, 0x3cf83e10, 0x3e924925, 0x3e861862, 0x3e73cf3d, 0x3e5b6db7, 0x3e430c31, 0x3e2aaaab, 0x3e124925, 0x3df3cf3d, 0x3dc30c31, 0x3d924925, 0x3d430c31, 0x3cc30c31, 0x3e4ccccd, 0x3e088889, 0x3d888889, 0x3e888889, 0x3e6eeeef, 0x3e4ccccd, 0x3e2aaaab, 0x3e088889, 0x3dcccccd, 0x3d888889, 0x3d088889, 0x3e906907, 0x3e834835, 0x3e6c4ec5, 0x3e520d21, 0x3e37cb7d, 0x3e1d89d9, 0x3e034835, 0x3dd20d21, 0x3d9d89d9, 0x3d520d21, 0x3cd20d21, 0x3e638e39, 0x3e2aaaab, 0x3de38e39, 0x3d638e39, 0x3e8ba2e9, 0x3e783e10, 0x3e59364e, 0x3e3a2e8c, 0x3e1b26ca, 0x3df83e10, 0x3dba2e8c, 0x3d783e10, 0x3cf83e10, 0x3e924925, 0x3e861862, 0x3e73cf3d, 0x3e5b6db7, 0x3e430c31, 0x3e2aaaab, 0x3e124925, 0x3df3cf3d, 0x3dc30c31, 0x3d924925, 0x3d430c31, 0x3cc30c31, 0x3e4ccccd, 0x3e088889, 0x3d888889, 0x3e888889, 0x3e6eeeef, 0x3e4ccccd, 0x3e2aaaab, 0x3e088889, 0x3dcccccd, 0x3d888889, 0x3d088889, 0x3e906907, 0x3e834835, 0x3e6c4ec5, 0x3e520d21, 0x3e37cb7d, 0x3e1d89d9, 0x3e034835, 0x3dd20d21, 0x3d9d89d9, 0x3d520d21, 0x3cd20d21, 0x3e638e39, 0x3e2aaaab, 0x3de38e39, 0x3d638e39, 0x3e8ba2e9, 0x3e783e10, 0x3e59364e, 0x3e3a2e8c, 0x3e1b26ca, 0x3df83e10, 0x3dba2e8c, 0x3d783e10, 0x3cf83e10, 0x3e924925, 0x3e861862, 0x3e73cf3d, 0x3e5b6db7, 0x3e430c31, 0x3e2aaaab, 0x3e124925, 0x3df3cf3d, 0x3dc30c31, 0x3d924925, 0x3d430c31, 0x3cc30c31 }; static const uint32_t in_config_decim[288] = { 0x00000001, 0x00000003, 0x00000003, 0x00000003, 0x00000001, 0x00000008, 0x00000003, 0x00000003, 0x00000001, 0x0000000B, 0x00000003, 0x00000003, 0x00000001, 0x00000004, 0x00000003, 0x00000003, 0x00000001, 0x00000009, 0x00000003, 0x00000003, 0x00000001, 0x0000000C, 0x00000003, 0x00000003, 0x00000001, 0x00000003, 0x00000008, 0x00000008, 0x00000001, 0x00000008, 0x00000008, 0x00000008, 0x00000001, 0x0000000B, 0x00000008, 0x00000008, 0x00000001, 0x00000004, 0x00000008, 0x00000008, 0x00000001, 0x00000009, 0x00000008, 0x00000008, 0x00000001, 0x0000000C, 0x00000008, 0x00000008, 0x00000001, 0x00000003, 0x0000000B, 0x0000000B, 0x00000001, 0x00000008, 0x0000000B, 0x0000000B, 0x00000001, 0x0000000B, 0x0000000B, 0x0000000B, 0x00000001, 0x00000004, 0x0000000B, 0x0000000B, 0x00000001, 0x00000009, 0x0000000B, 0x0000000B, 0x00000001, 0x0000000C, 0x0000000B, 0x0000000B, 0x00000002, 0x00000003, 0x00000006, 0x00000003, 0x00000002, 0x00000008, 0x00000006, 0x00000003, 0x00000002, 0x0000000B, 0x00000006, 0x00000003, 0x00000002, 0x00000004, 0x00000006, 0x00000003, 0x00000002, 0x00000009, 0x00000006, 0x00000003, 0x00000002, 0x0000000C, 0x00000006, 0x00000003, 0x00000002, 0x00000003, 0x00000010, 0x00000008, 0x00000002, 0x00000008, 0x00000010, 0x00000008, 0x00000002, 0x0000000B, 0x00000010, 0x00000008, 0x00000002, 0x00000004, 0x00000010, 0x00000008, 0x00000002, 0x00000009, 0x00000010, 0x00000008, 0x00000002, 0x0000000C, 0x00000010, 0x00000008, 0x00000002, 0x00000003, 0x00000016, 0x0000000B, 0x00000002, 0x00000008, 0x00000016, 0x0000000B, 0x00000002, 0x0000000B, 0x00000016, 0x0000000B, 0x00000002, 0x00000004, 0x00000016, 0x0000000B, 0x00000002, 0x00000009, 0x00000016, 0x0000000B, 0x00000002, 0x0000000C, 0x00000016, 0x0000000B, 0x00000004, 0x00000003, 0x0000000C, 0x00000003, 0x00000004, 0x00000008, 0x0000000C, 0x00000003, 0x00000004, 0x0000000B, 0x0000000C, 0x00000003, 0x00000004, 0x00000004, 0x0000000C, 0x00000003, 0x00000004, 0x00000009, 0x0000000C, 0x00000003, 0x00000004, 0x0000000C, 0x0000000C, 0x00000003, 0x00000004, 0x00000003, 0x00000020, 0x00000008, 0x00000004, 0x00000008, 0x00000020, 0x00000008, 0x00000004, 0x0000000B, 0x00000020, 0x00000008, 0x00000004, 0x00000004, 0x00000020, 0x00000008, 0x00000004, 0x00000009, 0x00000020, 0x00000008, 0x00000004, 0x0000000C, 0x00000020, 0x00000008, 0x00000004, 0x00000003, 0x0000002C, 0x0000000B, 0x00000004, 0x00000008, 0x0000002C, 0x0000000B, 0x00000004, 0x0000000B, 0x0000002C, 0x0000000B, 0x00000004, 0x00000004, 0x0000002C, 0x0000000B, 0x00000004, 0x00000009, 0x0000002C, 0x0000000B, 0x00000004, 0x0000000C, 0x0000002C, 0x0000000B, 0x00000008, 0x00000003, 0x00000018, 0x00000003, 0x00000008, 0x00000008, 0x00000018, 0x00000003, 0x00000008, 0x0000000B, 0x00000018, 0x00000003, 0x00000008, 0x00000004, 0x00000018, 0x00000003, 0x00000008, 0x00000009, 0x00000018, 0x00000003, 0x00000008, 0x0000000C, 0x00000018, 0x00000003, 0x00000008, 0x00000003, 0x00000040, 0x00000008, 0x00000008, 0x00000008, 0x00000040, 0x00000008, 0x00000008, 0x0000000B, 0x00000040, 0x00000008, 0x00000008, 0x00000004, 0x00000040, 0x00000008, 0x00000008, 0x00000009, 0x00000040, 0x00000008, 0x00000008, 0x0000000C, 0x00000040, 0x00000008, 0x00000008, 0x00000003, 0x00000058, 0x0000000B, 0x00000008, 0x00000008, 0x00000058, 0x0000000B, 0x00000008, 0x0000000B, 0x00000058, 0x0000000B, 0x00000008, 0x00000004, 0x00000058, 0x0000000B, 0x00000008, 0x00000009, 0x00000058, 0x0000000B, 0x00000008, 0x0000000C, 0x00000058, 0x0000000B }; static const uint32_t in_val_interp[264] = { 0x3f3394bb, 0xbf800000, 0x3f0e7ea0, 0x3ca3f4b8, 0x3f800000, 0x3eb97421, 0x3e7ca010, 0xbec29f0b, 0xbe9d549a, 0xbf444ebd, 0xbd798b2b, 0x3e82e097, 0xbf59344e, 0xbf800000, 0x3ebe5c80, 0xbe2a7142, 0xbc359fcf, 0xbf800000, 0x3e8c3bb3, 0xbeed5808, 0x3ce1b788, 0xbd5a455d, 0xbf0a2f7c, 0x3f3a15f0, 0x3f06c912, 0xbf800000, 0x3ee4fd50, 0xbecc75a4, 0xbf2ff39d, 0x3e54554b, 0x3f05da0f, 0xbf564b3a, 0x3e93ca61, 0x3e54f412, 0xbf800000, 0xbdd74be8, 0xbf081c0d, 0x3f1d3b6d, 0xbf54d3e9, 0x3e6da069, 0xbdb5f015, 0xbf18cd8b, 0xbf16e70a, 0x3f0c9dd4, 0x3e1db9f3, 0x3f16d684, 0xbf800000, 0xbf800000, 0xbe08a36b, 0xbf1d67d3, 0x3e6cb3b0, 0x3b9cee2e, 0x3e9903ad, 0xbe59e4dc, 0xbf3f0641, 0xbed73b84, 0x3f800000, 0x3e6ad633, 0x3e52634c, 0xbf38a327, 0xbf800000, 0xbe9f4b58, 0x3f2263e4, 0xbf1e8507, 0x3e93899c, 0xbf68a14d, 0xbf800000, 0xbf65d985, 0xbf44b8c6, 0xbe7efc4c, 0x3ec30ba6, 0x3ec1f8c8, 0xbdab5e89, 0x3e54d5fe, 0xbdaa32db, 0x3f024b22, 0xbedc013a, 0xbf334be7, 0x3f5ed3eb, 0x3e8b51a6, 0xbe9f6446, 0xbf4b1e71, 0x3e6c6ccc, 0x3f800000, 0xbe224ad8, 0x3ed317fc, 0x3c9b4cd0, 0xbe9f3940, 0xbebbb6f0, 0x3e83bee4, 0xbf800000, 0x3f4d6539, 0x3f267094, 0x3f800000, 0xbea936cc, 0x3ead1793, 0x3f088a4f, 0xbedb2211, 0x3f800000, 0x3cff10c1, 0x3dcf2324, 0xbe54a399, 0x3e8b57b7, 0xbf4748ca, 0xbe8860a9, 0xbf1306de, 0xbf800000, 0xbe1e689e, 0x3e363957, 0xbee0bd83, 0x3f2dec40, 0xbed73cae, 0xbf17d851, 0xbf30bf09, 0x3e881dc6, 0x3f5fbe29, 0x3d91c614, 0x3f622e8a, 0x3ec933b1, 0x3f800000, 0xbee56006, 0x3f2926e4, 0xbf800000, 0xbf286213, 0x3f1684d5, 0xbe87b1d2, 0x3e834878, 0x3eec0080, 0x3edf0f0b, 0x3f0a24d5, 0x3eadfa1c, 0x3ef86e55, 0x3e5b4b00, 0x3ece6eed, 0xbf800000, 0x3f363b47, 0xbf800000, 0x3f3e8673, 0xbeb86f35, 0xbf117e64, 0x3f2d5044, 0xbeb7fca9, 0xbf800000, 0x3ef2c6bf, 0x3f259da0, 0x3ea51a36, 0x3d6e037f, 0x3f800000, 0x3df35a60, 0x3f1d51ea, 0xbeb7a1ad, 0x3ea93620, 0xbf7ad862, 0xbea26ad7, 0xbe9b480c, 0xbe8de8e9, 0xbe3c97ad, 0xbe3455f8, 0x3da251a0, 0x3d810ba8, 0x3e718beb, 0xbeb13416, 0xbdd64f20, 0xbf800000, 0x3e91b72c, 0xbf5e43d7, 0x3f0b3bc9, 0xbf16e4c6, 0x3db57f0f, 0x3f14bc5e, 0x3f726c84, 0x3f800000, 0x3f6f5f64, 0x3dfc1f47, 0x3efe9f9d, 0xbe3ee9dc, 0x3f800000, 0x3eac88d2, 0x3f5386c3, 0xbe7758fd, 0x3f800000, 0x3da34e54, 0x3ebf7e27, 0xbe7a58bc, 0x3f094c60, 0x3d7500a6, 0x3f800000, 0xbef2b12d, 0xbf28e296, 0xbe978a2c, 0xbe019d4e, 0xbf7a8feb, 0x3e8ccbce, 0x3c653371, 0x3f2cfb71, 0x3ba52232, 0xbf29b88e, 0xbf800000, 0x3e24f9e8, 0xbd368bf0, 0x3f800000, 0x3e195c68, 0xbe8334f0, 0x3f1d13ec, 0x3dadf096, 0x3e66ab9b, 0x3f08f07b, 0x3f46bbac, 0xbf065a3f, 0xbd929abd, 0xbf7f45f0, 0xbe6a59c8, 0xbf7444fd, 0xbf72b2d1, 0x3efb3b29, 0x3db1e1ea, 0xbda18a5b, 0x3ed0a0b5, 0xbf800000, 0xbe8bdad3, 0x3ea9ff26, 0x3f800000, 0xbe89a04b, 0x3e3909b9, 0xbf800000, 0xbd75538d, 0x3e6ccdb3, 0xbf800000, 0xbe9ee089, 0xbe2a38bc, 0x3dd6d514, 0xbe25d57e, 0xbf6a10ef, 0xbf28dba7, 0xbf2926bd, 0x3e5fdfc7, 0x3eb810c9, 0x3f396f3f, 0x3ef31591, 0xbe5a3d65, 0x3e71d603, 0xbf800000, 0x3f166eb8, 0x3f800000, 0xbed54670, 0xbc6e88ca, 0xbe188f3a, 0xbe7a251f, 0x3eb20de0, 0xbf506bae, 0xbea36937, 0x3f67b208, 0xbf09c1cd, 0xbe91ef4f, 0xbe71e734, 0xbddd7d1e, 0x3cbfa90d, 0x3ee47516, 0x3df27640, 0x3dabb48d, 0x3eb52c66, 0x3e742218, 0x3f800000, 0x3e99e6e4 }; static const uint32_t in_coeff_interp[1044] = { 0x3e638e39, 0x3e2aaaab, 0x3de38e39, 0x3d638e39, 0x3e888889, 0x3e6eeeef, 0x3e4ccccd, 0x3e2aaaab, 0x3e088889, 0x3dcccccd, 0x3d888889, 0x3d088889, 0x3e638e39, 0x3e2aaaab, 0x3de38e39, 0x3d638e39, 0x3e888889, 0x3e6eeeef, 0x3e4ccccd, 0x3e2aaaab, 0x3e088889, 0x3dcccccd, 0x3d888889, 0x3d088889, 0x3e638e39, 0x3e2aaaab, 0x3de38e39, 0x3d638e39, 0x3e888889, 0x3e6eeeef, 0x3e4ccccd, 0x3e2aaaab, 0x3e088889, 0x3dcccccd, 0x3d888889, 0x3d088889, 0x3e888889, 0x3e6eeeef, 0x3e4ccccd, 0x3e2aaaab, 0x3e088889, 0x3dcccccd, 0x3d888889, 0x3d088889, 0x3e97b426, 0x3e8e38e4, 0x3e84bda1, 0x3e7684be, 0x3e638e39, 0x3e5097b4, 0x3e3da12f, 0x3e2aaaab, 0x3e17b426, 0x3e04bda1, 0x3de38e39, 0x3dbda12f, 0x3d97b426, 0x3d638e39, 0x3d17b426, 0x3c97b426, 0x3e888889, 0x3e6eeeef, 0x3e4ccccd, 0x3e2aaaab, 0x3e088889, 0x3dcccccd, 0x3d888889, 0x3d088889, 0x3e97b426, 0x3e8e38e4, 0x3e84bda1, 0x3e7684be, 0x3e638e39, 0x3e5097b4, 0x3e3da12f, 0x3e2aaaab, 0x3e17b426, 0x3e04bda1, 0x3de38e39, 0x3dbda12f, 0x3d97b426, 0x3d638e39, 0x3d17b426, 0x3c97b426, 0x3e888889, 0x3e6eeeef, 0x3e4ccccd, 0x3e2aaaab, 0x3e088889, 0x3dcccccd, 0x3d888889, 0x3d088889, 0x3e97b426, 0x3e8e38e4, 0x3e84bda1, 0x3e7684be, 0x3e638e39, 0x3e5097b4, 0x3e3da12f, 0x3e2aaaab, 0x3e17b426, 0x3e04bda1, 0x3de38e39, 0x3dbda12f, 0x3d97b426, 0x3d638e39, 0x3d17b426, 0x3c97b426, 0x3e97b426, 0x3e8e38e4, 0x3e84bda1, 0x3e7684be, 0x3e638e39, 0x3e5097b4, 0x3e3da12f, 0x3e2aaaab, 0x3e17b426, 0x3e04bda1, 0x3de38e39, 0x3dbda12f, 0x3d97b426, 0x3d638e39, 0x3d17b426, 0x3c97b426, 0x3ea0a0a1, 0x3e9b9b9c, 0x3e969697, 0x3e919192, 0x3e8c8c8d, 0x3e878788, 0x3e828283, 0x3e7afafb, 0x3e70f0f1, 0x3e66e6e7, 0x3e5cdcdd, 0x3e52d2d3, 0x3e48c8c9, 0x3e3ebebf, 0x3e34b4b5, 0x3e2aaaab, 0x3e20a0a1, 0x3e169697, 0x3e0c8c8d, 0x3e028283, 0x3df0f0f1, 0x3ddcdcdd, 0x3dc8c8c9, 0x3db4b4b5, 0x3da0a0a1, 0x3d8c8c8d, 0x3d70f0f1, 0x3d48c8c9, 0x3d20a0a1, 0x3cf0f0f1, 0x3ca0a0a1, 0x3c20a0a1, 0x3e97b426, 0x3e8e38e4, 0x3e84bda1, 0x3e7684be, 0x3e638e39, 0x3e5097b4, 0x3e3da12f, 0x3e2aaaab, 0x3e17b426, 0x3e04bda1, 0x3de38e39, 0x3dbda12f, 0x3d97b426, 0x3d638e39, 0x3d17b426, 0x3c97b426, 0x3ea0a0a1, 0x3e9b9b9c, 0x3e969697, 0x3e919192, 0x3e8c8c8d, 0x3e878788, 0x3e828283, 0x3e7afafb, 0x3e70f0f1, 0x3e66e6e7, 0x3e5cdcdd, 0x3e52d2d3, 0x3e48c8c9, 0x3e3ebebf, 0x3e34b4b5, 0x3e2aaaab, 0x3e20a0a1, 0x3e169697, 0x3e0c8c8d, 0x3e028283, 0x3df0f0f1, 0x3ddcdcdd, 0x3dc8c8c9, 0x3db4b4b5, 0x3da0a0a1, 0x3d8c8c8d, 0x3d70f0f1, 0x3d48c8c9, 0x3d20a0a1, 0x3cf0f0f1, 0x3ca0a0a1, 0x3c20a0a1, 0x3e97b426, 0x3e8e38e4, 0x3e84bda1, 0x3e7684be, 0x3e638e39, 0x3e5097b4, 0x3e3da12f, 0x3e2aaaab, 0x3e17b426, 0x3e04bda1, 0x3de38e39, 0x3dbda12f, 0x3d97b426, 0x3d638e39, 0x3d17b426, 0x3c97b426, 0x3ea0a0a1, 0x3e9b9b9c, 0x3e969697, 0x3e919192, 0x3e8c8c8d, 0x3e878788, 0x3e828283, 0x3e7afafb, 0x3e70f0f1, 0x3e66e6e7, 0x3e5cdcdd, 0x3e52d2d3, 0x3e48c8c9, 0x3e3ebebf, 0x3e34b4b5, 0x3e2aaaab, 0x3e20a0a1, 0x3e169697, 0x3e0c8c8d, 0x3e028283, 0x3df0f0f1, 0x3ddcdcdd, 0x3dc8c8c9, 0x3db4b4b5, 0x3da0a0a1, 0x3d8c8c8d, 0x3d70f0f1, 0x3d48c8c9, 0x3d20a0a1, 0x3cf0f0f1, 0x3ca0a0a1, 0x3c20a0a1, 0x3e9b26ca, 0x3e9364d9, 0x3e8ba2e9, 0x3e83e0f8, 0x3e783e10, 0x3e68ba2f, 0x3e59364e, 0x3e49b26d, 0x3e3a2e8c, 0x3e2aaaab, 0x3e1b26ca, 0x3e0ba2e9, 0x3df83e10, 0x3dd9364e, 0x3dba2e8c, 0x3d9b26ca, 0x3d783e10, 0x3d3a2e8c, 0x3cf83e10, 0x3c783e10, 0x3ea28a29, 0x3e9e79e8, 0x3e9a69a7, 0x3e965966, 0x3e924925, 0x3e8e38e4, 0x3e8a28a3, 0x3e861862, 0x3e820821, 0x3e7befbf, 0x3e73cf3d, 0x3e6baebb, 0x3e638e39, 0x3e5b6db7, 0x3e534d35, 0x3e4b2cb3, 0x3e430c31, 0x3e3aebaf, 0x3e32cb2d, 0x3e2aaaab, 0x3e228a29, 0x3e1a69a7, 0x3e124925, 0x3e0a28a3, 0x3e020821, 0x3df3cf3d, 0x3de38e39, 0x3dd34d35, 0x3dc30c31, 0x3db2cb2d, 0x3da28a29, 0x3d924925, 0x3d820821, 0x3d638e39, 0x3d430c31, 0x3d228a29, 0x3d020821, 0x3cc30c31, 0x3c820821, 0x3c020821, 0x3e9b26ca, 0x3e9364d9, 0x3e8ba2e9, 0x3e83e0f8, 0x3e783e10, 0x3e68ba2f, 0x3e59364e, 0x3e49b26d, 0x3e3a2e8c, 0x3e2aaaab, 0x3e1b26ca, 0x3e0ba2e9, 0x3df83e10, 0x3dd9364e, 0x3dba2e8c, 0x3d9b26ca, 0x3d783e10, 0x3d3a2e8c, 0x3cf83e10, 0x3c783e10, 0x3ea28a29, 0x3e9e79e8, 0x3e9a69a7, 0x3e965966, 0x3e924925, 0x3e8e38e4, 0x3e8a28a3, 0x3e861862, 0x3e820821, 0x3e7befbf, 0x3e73cf3d, 0x3e6baebb, 0x3e638e39, 0x3e5b6db7, 0x3e534d35, 0x3e4b2cb3, 0x3e430c31, 0x3e3aebaf, 0x3e32cb2d, 0x3e2aaaab, 0x3e228a29, 0x3e1a69a7, 0x3e124925, 0x3e0a28a3, 0x3e020821, 0x3df3cf3d, 0x3de38e39, 0x3dd34d35, 0x3dc30c31, 0x3db2cb2d, 0x3da28a29, 0x3d924925, 0x3d820821, 0x3d638e39, 0x3d430c31, 0x3d228a29, 0x3d020821, 0x3cc30c31, 0x3c820821, 0x3c020821, 0x3e9b26ca, 0x3e9364d9, 0x3e8ba2e9, 0x3e83e0f8, 0x3e783e10, 0x3e68ba2f, 0x3e59364e, 0x3e49b26d, 0x3e3a2e8c, 0x3e2aaaab, 0x3e1b26ca, 0x3e0ba2e9, 0x3df83e10, 0x3dd9364e, 0x3dba2e8c, 0x3d9b26ca, 0x3d783e10, 0x3d3a2e8c, 0x3cf83e10, 0x3c783e10, 0x3ea28a29, 0x3e9e79e8, 0x3e9a69a7, 0x3e965966, 0x3e924925, 0x3e8e38e4, 0x3e8a28a3, 0x3e861862, 0x3e820821, 0x3e7befbf, 0x3e73cf3d, 0x3e6baebb, 0x3e638e39, 0x3e5b6db7, 0x3e534d35, 0x3e4b2cb3, 0x3e430c31, 0x3e3aebaf, 0x3e32cb2d, 0x3e2aaaab, 0x3e228a29, 0x3e1a69a7, 0x3e124925, 0x3e0a28a3, 0x3e020821, 0x3df3cf3d, 0x3de38e39, 0x3dd34d35, 0x3dc30c31, 0x3db2cb2d, 0x3da28a29, 0x3d924925, 0x3d820821, 0x3d638e39, 0x3d430c31, 0x3d228a29, 0x3d020821, 0x3cc30c31, 0x3c820821, 0x3c020821, 0x3ea0a0a1, 0x3e9b9b9c, 0x3e969697, 0x3e919192, 0x3e8c8c8d, 0x3e878788, 0x3e828283, 0x3e7afafb, 0x3e70f0f1, 0x3e66e6e7, 0x3e5cdcdd, 0x3e52d2d3, 0x3e48c8c9, 0x3e3ebebf, 0x3e34b4b5, 0x3e2aaaab, 0x3e20a0a1, 0x3e169697, 0x3e0c8c8d, 0x3e028283, 0x3df0f0f1, 0x3ddcdcdd, 0x3dc8c8c9, 0x3db4b4b5, 0x3da0a0a1, 0x3d8c8c8d, 0x3d70f0f1, 0x3d48c8c9, 0x3d20a0a1, 0x3cf0f0f1, 0x3ca0a0a1, 0x3c20a0a1, 0x3ea57eb5, 0x3ea2e8ba, 0x3ea052bf, 0x3e9dbcc5, 0x3e9b26ca, 0x3e9890cf, 0x3e95fad4, 0x3e9364d9, 0x3e90cede, 0x3e8e38e4, 0x3e8ba2e9, 0x3e890cee, 0x3e8676f3, 0x3e83e0f8, 0x3e814afd, 0x3e7d6a05, 0x3e783e10, 0x3e73121a, 0x3e6de624, 0x3e68ba2f, 0x3e638e39, 0x3e5e6243, 0x3e59364e, 0x3e540a58, 0x3e4ede62, 0x3e49b26d, 0x3e448677, 0x3e3f5a81, 0x3e3a2e8c, 0x3e350296, 0x3e2fd6a0, 0x3e2aaaab, 0x3e257eb5, 0x3e2052bf, 0x3e1b26ca, 0x3e15fad4, 0x3e10cede, 0x3e0ba2e9, 0x3e0676f3, 0x3e014afd, 0x3df83e10, 0x3dede624, 0x3de38e39, 0x3dd9364e, 0x3dcede62, 0x3dc48677, 0x3dba2e8c, 0x3dafd6a0, 0x3da57eb5, 0x3d9b26ca, 0x3d90cede, 0x3d8676f3, 0x3d783e10, 0x3d638e39, 0x3d4ede62, 0x3d3a2e8c, 0x3d257eb5, 0x3d10cede, 0x3cf83e10, 0x3ccede62, 0x3ca57eb5, 0x3c783e10, 0x3c257eb5, 0x3ba57eb5, 0x3ea0a0a1, 0x3e9b9b9c, 0x3e969697, 0x3e919192, 0x3e8c8c8d, 0x3e878788, 0x3e828283, 0x3e7afafb, 0x3e70f0f1, 0x3e66e6e7, 0x3e5cdcdd, 0x3e52d2d3, 0x3e48c8c9, 0x3e3ebebf, 0x3e34b4b5, 0x3e2aaaab, 0x3e20a0a1, 0x3e169697, 0x3e0c8c8d, 0x3e028283, 0x3df0f0f1, 0x3ddcdcdd, 0x3dc8c8c9, 0x3db4b4b5, 0x3da0a0a1, 0x3d8c8c8d, 0x3d70f0f1, 0x3d48c8c9, 0x3d20a0a1, 0x3cf0f0f1, 0x3ca0a0a1, 0x3c20a0a1, 0x3ea57eb5, 0x3ea2e8ba, 0x3ea052bf, 0x3e9dbcc5, 0x3e9b26ca, 0x3e9890cf, 0x3e95fad4, 0x3e9364d9, 0x3e90cede, 0x3e8e38e4, 0x3e8ba2e9, 0x3e890cee, 0x3e8676f3, 0x3e83e0f8, 0x3e814afd, 0x3e7d6a05, 0x3e783e10, 0x3e73121a, 0x3e6de624, 0x3e68ba2f, 0x3e638e39, 0x3e5e6243, 0x3e59364e, 0x3e540a58, 0x3e4ede62, 0x3e49b26d, 0x3e448677, 0x3e3f5a81, 0x3e3a2e8c, 0x3e350296, 0x3e2fd6a0, 0x3e2aaaab, 0x3e257eb5, 0x3e2052bf, 0x3e1b26ca, 0x3e15fad4, 0x3e10cede, 0x3e0ba2e9, 0x3e0676f3, 0x3e014afd, 0x3df83e10, 0x3dede624, 0x3de38e39, 0x3dd9364e, 0x3dcede62, 0x3dc48677, 0x3dba2e8c, 0x3dafd6a0, 0x3da57eb5, 0x3d9b26ca, 0x3d90cede, 0x3d8676f3, 0x3d783e10, 0x3d638e39, 0x3d4ede62, 0x3d3a2e8c, 0x3d257eb5, 0x3d10cede, 0x3cf83e10, 0x3ccede62, 0x3ca57eb5, 0x3c783e10, 0x3c257eb5, 0x3ba57eb5, 0x3ea0a0a1, 0x3e9b9b9c, 0x3e969697, 0x3e919192, 0x3e8c8c8d, 0x3e878788, 0x3e828283, 0x3e7afafb, 0x3e70f0f1, 0x3e66e6e7, 0x3e5cdcdd, 0x3e52d2d3, 0x3e48c8c9, 0x3e3ebebf, 0x3e34b4b5, 0x3e2aaaab, 0x3e20a0a1, 0x3e169697, 0x3e0c8c8d, 0x3e028283, 0x3df0f0f1, 0x3ddcdcdd, 0x3dc8c8c9, 0x3db4b4b5, 0x3da0a0a1, 0x3d8c8c8d, 0x3d70f0f1, 0x3d48c8c9, 0x3d20a0a1, 0x3cf0f0f1, 0x3ca0a0a1, 0x3c20a0a1, 0x3ea57eb5, 0x3ea2e8ba, 0x3ea052bf, 0x3e9dbcc5, 0x3e9b26ca, 0x3e9890cf, 0x3e95fad4, 0x3e9364d9, 0x3e90cede, 0x3e8e38e4, 0x3e8ba2e9, 0x3e890cee, 0x3e8676f3, 0x3e83e0f8, 0x3e814afd, 0x3e7d6a05, 0x3e783e10, 0x3e73121a, 0x3e6de624, 0x3e68ba2f, 0x3e638e39, 0x3e5e6243, 0x3e59364e, 0x3e540a58, 0x3e4ede62, 0x3e49b26d, 0x3e448677, 0x3e3f5a81, 0x3e3a2e8c, 0x3e350296, 0x3e2fd6a0, 0x3e2aaaab, 0x3e257eb5, 0x3e2052bf, 0x3e1b26ca, 0x3e15fad4, 0x3e10cede, 0x3e0ba2e9, 0x3e0676f3, 0x3e014afd, 0x3df83e10, 0x3dede624, 0x3de38e39, 0x3dd9364e, 0x3dcede62, 0x3dc48677, 0x3dba2e8c, 0x3dafd6a0, 0x3da57eb5, 0x3d9b26ca, 0x3d90cede, 0x3d8676f3, 0x3d783e10, 0x3d638e39, 0x3d4ede62, 0x3d3a2e8c, 0x3d257eb5, 0x3d10cede, 0x3cf83e10, 0x3ccede62, 0x3ca57eb5, 0x3c783e10, 0x3c257eb5, 0x3ba57eb5, 0x3ea1af28, 0x3e9d3167, 0x3e98b3a6, 0x3e9435e5, 0x3e8fb824, 0x3e8b3a63, 0x3e86bca2, 0x3e823ee1, 0x3e7b823f, 0x3e7286bd, 0x3e698b3a, 0x3e608fb8, 0x3e579436, 0x3e4e98b4, 0x3e459d31, 0x3e3ca1af, 0x3e33a62d, 0x3e2aaaab, 0x3e21af28, 0x3e18b3a6, 0x3e0fb824, 0x3e06bca2, 0x3dfb823f, 0x3de98b3a, 0x3dd79436, 0x3dc59d31, 0x3db3a62d, 0x3da1af28, 0x3d8fb824, 0x3d7b823f, 0x3d579436, 0x3d33a62d, 0x3d0fb824, 0x3cd79436, 0x3c8fb824, 0x3c0fb824, 0x3ea60dd6, 0x3ea3bf6c, 0x3ea17102, 0x3e9f2298, 0x3e9cd42e, 0x3e9a85c4, 0x3e98375a, 0x3e95e8f0, 0x3e939a86, 0x3e914c1c, 0x3e8efdb2, 0x3e8caf47, 0x3e8a60dd, 0x3e881273, 0x3e85c409, 0x3e83759f, 0x3e812735, 0x3e7db196, 0x3e7914c2, 0x3e7477ee, 0x3e6fdb19, 0x3e6b3e45, 0x3e66a171, 0x3e62049d, 0x3e5d67c9, 0x3e58caf4, 0x3e542e20, 0x3e4f914c, 0x3e4af478, 0x3e4657a4, 0x3e41bad0, 0x3e3d1dfb, 0x3e388127, 0x3e33e453, 0x3e2f477f, 0x3e2aaaab, 0x3e260dd6, 0x3e217102, 0x3e1cd42e, 0x3e18375a, 0x3e139a86, 0x3e0efdb2, 0x3e0a60dd, 0x3e05c409, 0x3e012735, 0x3df914c2, 0x3defdb19, 0x3de6a171, 0x3ddd67c9, 0x3dd42e20, 0x3dcaf478, 0x3dc1bad0, 0x3db88127, 0x3daf477f, 0x3da60dd6, 0x3d9cd42e, 0x3d939a86, 0x3d8a60dd, 0x3d812735, 0x3d6fdb19, 0x3d5d67c9, 0x3d4af478, 0x3d388127, 0x3d260dd6, 0x3d139a86, 0x3d012735, 0x3cdd67c9, 0x3cb88127, 0x3c939a86, 0x3c5d67c9, 0x3c139a86, 0x3b939a86, 0x3ea1af28, 0x3e9d3167, 0x3e98b3a6, 0x3e9435e5, 0x3e8fb824, 0x3e8b3a63, 0x3e86bca2, 0x3e823ee1, 0x3e7b823f, 0x3e7286bd, 0x3e698b3a, 0x3e608fb8, 0x3e579436, 0x3e4e98b4, 0x3e459d31, 0x3e3ca1af, 0x3e33a62d, 0x3e2aaaab, 0x3e21af28, 0x3e18b3a6, 0x3e0fb824, 0x3e06bca2, 0x3dfb823f, 0x3de98b3a, 0x3dd79436, 0x3dc59d31, 0x3db3a62d, 0x3da1af28, 0x3d8fb824, 0x3d7b823f, 0x3d579436, 0x3d33a62d, 0x3d0fb824, 0x3cd79436, 0x3c8fb824, 0x3c0fb824, 0x3ea60dd6, 0x3ea3bf6c, 0x3ea17102, 0x3e9f2298, 0x3e9cd42e, 0x3e9a85c4, 0x3e98375a, 0x3e95e8f0, 0x3e939a86, 0x3e914c1c, 0x3e8efdb2, 0x3e8caf47, 0x3e8a60dd, 0x3e881273, 0x3e85c409, 0x3e83759f, 0x3e812735, 0x3e7db196, 0x3e7914c2, 0x3e7477ee, 0x3e6fdb19, 0x3e6b3e45, 0x3e66a171, 0x3e62049d, 0x3e5d67c9, 0x3e58caf4, 0x3e542e20, 0x3e4f914c, 0x3e4af478, 0x3e4657a4, 0x3e41bad0, 0x3e3d1dfb, 0x3e388127, 0x3e33e453, 0x3e2f477f, 0x3e2aaaab, 0x3e260dd6, 0x3e217102, 0x3e1cd42e, 0x3e18375a, 0x3e139a86, 0x3e0efdb2, 0x3e0a60dd, 0x3e05c409, 0x3e012735, 0x3df914c2, 0x3defdb19, 0x3de6a171, 0x3ddd67c9, 0x3dd42e20, 0x3dcaf478, 0x3dc1bad0, 0x3db88127, 0x3daf477f, 0x3da60dd6, 0x3d9cd42e, 0x3d939a86, 0x3d8a60dd, 0x3d812735, 0x3d6fdb19, 0x3d5d67c9, 0x3d4af478, 0x3d388127, 0x3d260dd6, 0x3d139a86, 0x3d012735, 0x3cdd67c9, 0x3cb88127, 0x3c939a86, 0x3c5d67c9, 0x3c139a86, 0x3b939a86, 0x3ea1af28, 0x3e9d3167, 0x3e98b3a6, 0x3e9435e5, 0x3e8fb824, 0x3e8b3a63, 0x3e86bca2, 0x3e823ee1, 0x3e7b823f, 0x3e7286bd, 0x3e698b3a, 0x3e608fb8, 0x3e579436, 0x3e4e98b4, 0x3e459d31, 0x3e3ca1af, 0x3e33a62d, 0x3e2aaaab, 0x3e21af28, 0x3e18b3a6, 0x3e0fb824, 0x3e06bca2, 0x3dfb823f, 0x3de98b3a, 0x3dd79436, 0x3dc59d31, 0x3db3a62d, 0x3da1af28, 0x3d8fb824, 0x3d7b823f, 0x3d579436, 0x3d33a62d, 0x3d0fb824, 0x3cd79436, 0x3c8fb824, 0x3c0fb824, 0x3ea60dd6, 0x3ea3bf6c, 0x3ea17102, 0x3e9f2298, 0x3e9cd42e, 0x3e9a85c4, 0x3e98375a, 0x3e95e8f0, 0x3e939a86, 0x3e914c1c, 0x3e8efdb2, 0x3e8caf47, 0x3e8a60dd, 0x3e881273, 0x3e85c409, 0x3e83759f, 0x3e812735, 0x3e7db196, 0x3e7914c2, 0x3e7477ee, 0x3e6fdb19, 0x3e6b3e45, 0x3e66a171, 0x3e62049d, 0x3e5d67c9, 0x3e58caf4, 0x3e542e20, 0x3e4f914c, 0x3e4af478, 0x3e4657a4, 0x3e41bad0, 0x3e3d1dfb, 0x3e388127, 0x3e33e453, 0x3e2f477f, 0x3e2aaaab, 0x3e260dd6, 0x3e217102, 0x3e1cd42e, 0x3e18375a, 0x3e139a86, 0x3e0efdb2, 0x3e0a60dd, 0x3e05c409, 0x3e012735, 0x3df914c2, 0x3defdb19, 0x3de6a171, 0x3ddd67c9, 0x3dd42e20, 0x3dcaf478, 0x3dc1bad0, 0x3db88127, 0x3daf477f, 0x3da60dd6, 0x3d9cd42e, 0x3d939a86, 0x3d8a60dd, 0x3d812735, 0x3d6fdb19, 0x3d5d67c9, 0x3d4af478, 0x3d388127, 0x3d260dd6, 0x3d139a86, 0x3d012735, 0x3cdd67c9, 0x3cb88127, 0x3c939a86, 0x3c5d67c9, 0x3c139a86, 0x3b939a86 }; static const uint32_t in_config_interp[144] = { 0x00000001, 0x00000004, 0x00000003, 0x00000003, 0x00000001, 0x00000008, 0x00000003, 0x00000003, 0x00000001, 0x00000004, 0x00000008, 0x00000008, 0x00000001, 0x00000008, 0x00000008, 0x00000008, 0x00000001, 0x00000004, 0x0000000B, 0x0000000B, 0x00000001, 0x00000008, 0x0000000B, 0x0000000B, 0x00000002, 0x00000008, 0x00000003, 0x00000006, 0x00000002, 0x00000010, 0x00000003, 0x00000006, 0x00000002, 0x00000008, 0x00000008, 0x00000010, 0x00000002, 0x00000010, 0x00000008, 0x00000010, 0x00000002, 0x00000008, 0x0000000B, 0x00000016, 0x00000002, 0x00000010, 0x0000000B, 0x00000016, 0x00000004, 0x00000010, 0x00000003, 0x0000000C, 0x00000004, 0x00000020, 0x00000003, 0x0000000C, 0x00000004, 0x00000010, 0x00000008, 0x00000020, 0x00000004, 0x00000020, 0x00000008, 0x00000020, 0x00000004, 0x00000010, 0x0000000B, 0x0000002C, 0x00000004, 0x00000020, 0x0000000B, 0x0000002C, 0x00000005, 0x00000014, 0x00000003, 0x0000000F, 0x00000005, 0x00000028, 0x00000003, 0x0000000F, 0x00000005, 0x00000014, 0x00000008, 0x00000028, 0x00000005, 0x00000028, 0x00000008, 0x00000028, 0x00000005, 0x00000014, 0x0000000B, 0x00000037, 0x00000005, 0x00000028, 0x0000000B, 0x00000037, 0x00000008, 0x00000020, 0x00000003, 0x00000018, 0x00000008, 0x00000040, 0x00000003, 0x00000018, 0x00000008, 0x00000020, 0x00000008, 0x00000040, 0x00000008, 0x00000040, 0x00000008, 0x00000040, 0x00000008, 0x00000020, 0x0000000B, 0x00000058, 0x00000008, 0x00000040, 0x0000000B, 0x00000058, 0x00000009, 0x00000024, 0x00000003, 0x0000001B, 0x00000009, 0x00000048, 0x00000003, 0x0000001B, 0x00000009, 0x00000024, 0x00000008, 0x00000048, 0x00000009, 0x00000048, 0x00000008, 0x00000048, 0x00000009, 0x00000024, 0x0000000B, 0x00000063, 0x00000009, 0x00000048, 0x0000000B, 0x00000063 }; static const uint32_t ref_decim[528] = { 0x3ba53eeb, 0x3d9d3066, 0x3ddcf3f0, 0x3ab3cad4, 0xbcfa97b7, 0xbd8f4818, 0xbbc47a35, 0x3c5fa00c, 0x3d3cf0c5, 0xbd638e39, 0xbd8dda12, 0xbda2faa6, 0xbcf83e10, 0xbd88f0dd, 0xbdc86fde, 0xbc9aabc9, 0xbc6496c2, 0x3c0d0730, 0x3b960b45, 0x3ccb3790, 0x3de4c39c, 0x3e419db6, 0x3e5d715b, 0xbc38e81c, 0xbd0833fa, 0x3c1ddbdf, 0x3ba02e35, 0x397b9a35, 0x3cecf3ed, 0x3d9d096c, 0x3e186fb4, 0x3e74b1db, 0x3eaab6e0, 0x3ece3b65, 0x3cbd4609, 0x3d23b226, 0x3d80ef56, 0x3d94f1be, 0x3d859be8, 0x3d358a78, 0x3c918fdc, 0x3c8a17ea, 0xbc001aab, 0xbc606a62, 0xbd09233a, 0xbd83cb45, 0xbc9e4534, 0xbb7feb54, 0x3d9d8ef2, 0x3e5a42d4, 0xbab51008, 0xbb8e4b0d, 0x3bc8a1b8, 0x3c570b61, 0x3c8a4c53, 0x3c06f366, 0xbc6eaa57, 0xbd8a9886, 0x3c8f8cf4, 0x3c55e510, 0x3c2a206f, 0x3c9bf8ad, 0x3b7ea78f, 0xbc46f942, 0xbcae41f4, 0xbd029ad5, 0xbd888889, 0xbe2218aa, 0xbe85c7f9, 0xbd7f69d4, 0x3d7d31f6, 0x3e100c95, 0x3d9f412b, 0x3d410b96, 0x3e17f237, 0x3d9709ed, 0xbcf2a777, 0xbbc63170, 0xbbf32d5b, 0xbce1a42b, 0xbd426efb, 0xbd9bb0f0, 0xbdf11a7c, 0xbe062ce3, 0xbe1fba4c, 0xbdf60a19, 0xbe3cf783, 0xbc1ad625, 0xbcd20d21, 0xbd57b828, 0xbdb27e64, 0xbdf911b9, 0xbe1e1022, 0xbe2b8f99, 0xbe43c701, 0xbe5b3c66, 0xbe6ecc2a, 0xbe7e3053, 0xbe89816b, 0xba01b17d, 0x3d4cdf6f, 0x3e1fd4f7, 0x3e818788, 0x3eb31024, 0x3e306b4d, 0xbd8acfb6, 0xbbb0eb2a, 0x3cacb749, 0x3db80a84, 0x3d80a358, 0xbcc9971f, 0xbd3e0a89, 0xbd3cd7ed, 0xbc7e1925, 0x3c830f46, 0x3d1057af, 0x3d3e0158, 0x3dacfbef, 0x3e032ffd, 0x3ed41cc4, 0x3eea74a4, 0x38e7da05, 0x3b3c64d4, 0xbbfb76a7, 0xbc92c237, 0xbd0c67da, 0xbd93c748, 0xbdf77dff, 0xbe3b6100, 0xbe7d75dc, 0xbeabf61f, 0xbedd7d2b, 0x3d50e942, 0x3d8b3b1e, 0xbddac2b1, 0xbd088889, 0xbd8286bf, 0xbdae2cfa, 0x3ba54379, 0xbcab9ec7, 0xbd40845b, 0xbcc68b74, 0xbe2329a3, 0xbe9dbe2f, 0xbbd76f44, 0xbd6b1b09, 0xbdb5273b, 0x3c660e8f, 0x3d45f52a, 0x3dfd39b1, 0xbb62397a, 0x3d87caf0, 0x3e8278d3, 0xbdec298f, 0xbd41c2ef, 0x3d968de7, 0x3d7ce4f0, 0xbc9772ae, 0xbbf3e5d9, 0xbd2e7e0a, 0xbde47c79, 0xbe5f2ee8, 0xbe9b5fc7, 0xbe8cca54, 0xbde9a78b, 0x3cf28b1f, 0xbc4cfad6, 0xbd87abb4, 0xbd8c1e09, 0xbba14e6d, 0x3d001066, 0x3dcd8f70, 0x3f19c3c3, 0x3eff3323, 0xbd0ad93a, 0xbe2a5642, 0x3ca0391b, 0x3eab66c5, 0x3c24d4f1, 0x3de2160b, 0x3da28560, 0xbe3473e8, 0xbc10f5ae, 0x3ce6e42b, 0x3cfbeaf4, 0xbc9ae55c, 0xbd5b335b, 0xbe5b9fb1, 0xbda79bce, 0x3eccd696, 0x3c2d087c, 0x3d8bcd63, 0x3dc54c09, 0x3e000188, 0x3e09679e, 0x3e030d0a, 0x3bcfff00, 0xbe74aa79, 0xbd24fb1f, 0xbe66fd81, 0xbcc28968, 0xbd7dc21f, 0x3e31a3cb, 0x3d71a29b, 0x3d0343f1, 0xbddc2526, 0xbb0a97c5, 0xbd560c34, 0xbc03d51e, 0x3bf9e469, 0x3c84ebab, 0x3d01d39b, 0x3db485b2, 0x3d805746, 0x3e26913b, 0x3cd68ec1, 0xbe7ee576, 0xbddb503a, 0x3c792ade, 0x3e95adc1, 0x3c8db514, 0x3d3d6e72, 0x3d87c601, 0x3db50555, 0x3daeb299, 0x3dba8911, 0xbe2e9d03, 0xbe23f24a, 0xbe717e16, 0xbded5b72, 0xbe0f61c3, 0xbd1759ef, 0xbe4a7a0b, 0xbe63366a, 0xbc8ee4bd, 0x3d11e653, 0x3e0d22ae, 0x3db3505a, 0x3dc60d69, 0x3e1dcee2, 0x3dc38439, 0xbdba92ba, 0xbcc9c5cc, 0xbdb0229e, 0xbe1f5cc6, 0xbe4c76fa, 0xbe73607a, 0xbdbd3869, 0xbd640b56, 0xbe828aaf, 0xbeebad05, 0xbe150ae4, 0xbe6e493f, 0xbb6e12ba, 0x3c56fc04, 0x3c864c83, 0xbbb9663e, 0xbd172983, 0xbd3fc1db, 0x3cbb31f7, 0xbe19f5d4, 0xbd94b92e, 0x3e14413d, 0x3d995b27, 0x3d1d14ba, 0xbbcd9159, 0x3dc9a51b, 0xbc6485af, 0xbe68a7a2, 0xbec37b0e, 0xbc6daa25, 0xbc05812c, 0x3d51f43a, 0x3d638e39, 0xbe51b6c7, 0x3e77f842, 0xbc5e958f, 0xbe8a6929, 0xbee813a1, 0xbc9e812e, 0xbd368b3f, 0x3e0600eb, 0xbc91b1bb, 0x3c7bdb14, 0xbc36b352, 0xbe58e754, 0xbcf18566, 0x3df26522, 0xbb01f809, 0x3dfb05a0, 0x3aa0e34e, 0xba8ee470, 0x3d0817bc, 0x3e7fd5de, 0x3eeeb1e5, 0x3e0668cc, 0x3dce60b5, 0x3d47f096, 0xbbfc19b2, 0x3d864984, 0x3e2239a4, 0x3e03a1a1, 0xbd5c22cf, 0xbe534ab2, 0xbda7a474, 0xbda714d0, 0x3c145504, 0xbd6de9fb, 0xbe0e0da6, 0xbabe96cd, 0x3d8dfbcb, 0x3da5d84f, 0xbe1d5a5b, 0x3c8004a3, 0xbb1a2bac, 0xbd58b9d5, 0xbd1ac072, 0xbdc6ab75, 0xbe9395f3, 0xbe51d70a, 0x3e9ef9ea, 0x3d997167, 0x3bb45098, 0x3d00a16f, 0x3d979c64, 0xbc85c736, 0xbe190690, 0xbe9a664c, 0xbd91f656, 0xbea8489c, 0xb90ba15f, 0xbe20de72, 0x3e1a4ca4, 0x3dd59daa, 0xbda7e2fb, 0x3e06b786, 0x3e12cac7, 0x3cb788d3, 0x3dbacf53, 0xbc407a48, 0x3d2cb6d8, 0x3ca604d4, 0x3e349b19, 0x3dd14434, 0xbe1cafe7, 0x3e0324fd, 0x3df2bcbc, 0x3de28567, 0x3e89e49c, 0x3e9b6573, 0x3e6185d5, 0x3e8a3566, 0x3c63e1dd, 0xbc846b96, 0xbda33f4b, 0xbe80d4af, 0xbe21397d, 0x3d9c7991, 0x3d12c526, 0xbde66ce7, 0xbd863466, 0xbeb41a6d, 0xbec0d28b, 0x3c49220c, 0x3ddacd8d, 0x3e9b2029, 0x3dd0e360, 0xbdc492ae, 0x3dd91781, 0x3e533e0e, 0xbd639507, 0x3bc78bfb, 0xbe2bbfe5, 0xbdc17ee6, 0xbbe5540f, 0x3d34026b, 0x3d15e80f, 0xbcde4fb8, 0x3ddf44bd, 0xbe8bc3bb, 0xbea23e2c, 0xbe1aaee7, 0xbe1460ec, 0x3d010621, 0x3e0d7688, 0x3b548e08, 0x3ae72496, 0x3b8a446d, 0xbd9cd4ab, 0xbe0f79f9, 0xbe76a6de, 0xbda4b0dd, 0x3e73968b, 0x3e401b79, 0xbd2ee2f0, 0x3e1d68fb, 0x3c0dcbc3, 0xbd604afe, 0x3cb51338, 0xbc82008d, 0xbdf34500, 0xbeb89a06, 0x3c4dbe71, 0xbe88d990, 0xbf3bc918, 0xbc412028, 0x3cf90b6c, 0xbe177484, 0x3c26f218, 0xbe0dcd5e, 0xbcf5331e, 0x3b012025, 0xbe189ab6, 0xbe989844, 0x3c2d7d71, 0xbe3364d1, 0xbc85ca75, 0x3d3fbe15, 0xbe75281e, 0xbe248bb1, 0xbd20016b, 0xbe2fa82e, 0x3bde3156, 0x3cad0555, 0x3e081727, 0xbea67435, 0x3d28210b, 0xbbe884d3, 0x3df2f9df, 0xbe366e60, 0x3b50301c, 0x3c916cda, 0xbf219b51, 0xbedc3d11, 0xbe6e51aa, 0x3e9c3247, 0x3e0ead98, 0x3d688da0, 0x3be9c96b, 0x3e191fbf, 0x3e0841e7, 0xbddb6b63, 0x3d2d43aa, 0xbdaec321, 0xbd901259, 0xbce86df5, 0xbc958e3c, 0xbea5c703, 0x3b27ac62, 0xbad1d8ee, 0x3dedb8c6, 0x3e6786bb, 0xbe7dea3e, 0xbd0d2551, 0xbc95c231, 0x3cbb6148, 0x3e4b66cc, 0xbdfb841a, 0xbe2c37f8, 0xbe83312d, 0x3dbb5c67, 0x3d2a21b2, 0xbc2e75de, 0xbd08dd7d, 0x3e0338c2, 0x3d728953, 0xbd95717b, 0xbdfba0a3, 0x3cff8178, 0x3da29d33, 0xbd30433d, 0x3da2e5b4, 0xbe285710, 0x391590f5, 0xbd8053ef, 0x3ce1a8c7, 0xbbe3f230, 0x3e049f79, 0x3e93d5ad, 0x3e70d20e, 0x3e1e3954, 0x3daba5b0, 0xbe89e908, 0x3e2b1a5b, 0xbc22167e, 0xbe83ddf6, 0x3daf33dd, 0xbea2e161, 0x3df9a8e1, 0x3d831549, 0x3ca948ba, 0xbe40c5ad, 0x3db76927, 0x3d938ea6, 0xbe35b692, 0xbaa4edba, 0x3c021982, 0x3c44af42, 0x3d40d3a3, 0xbe61591d, 0xbd4c09cb, 0x3d1c0242, 0xbe9a0341, 0xbdc7b2f4, 0xbe40f546, 0xbc2a35dd, 0xbb5ae347, 0x3d8cb0b5, 0x3d94916a, 0xbe0dd631, 0xbe275091, 0xbe11eefc, 0x3d0fa6bf, 0xbd857e18, 0xbdf89c8f, 0xbe5dc720, 0x3c3a7c0b, 0xbb2a51e2, 0xbe06db7a, 0xbe3874d9, 0xbe81eac5, 0x3d749abd, 0x3e460b58, 0x3d60ceac, 0xbdd21942, 0x3e00a51b, 0x3e33b2b1, 0x3e0e4d44 }; static const uint32_t ref_interp[1276] = { 0x3d1fa0a6, 0x3cb76626, 0x3d166ef1, 0x3a2ee2e6, 0x3d0dffa0, 0x3da55c00, 0x3c608e47, 0x3bce3c84, 0xbc95024e, 0xbdaea460, 0xbe65a7d1, 0xbe412fac, 0xbe4c13ba, 0xbdf752e5, 0x3c4b0d56, 0x3c9d99cc, 0x3cd2a600, 0xba95edd7, 0xbc9a9939, 0xbd553478, 0xbdacaca2, 0xbdf26252, 0xbcf5a9c0, 0xbca081d6, 0x3ca4446d, 0x3b87b8f7, 0x3e26ee94, 0xbcb5822f, 0xbe6bc2f4, 0xbd032353, 0xbe1ad5a6, 0xbdda4999, 0x3d666584, 0x3be3267a, 0xbc9f7dd4, 0xbd4a3d08, 0xbdc6a952, 0xbdfe466a, 0xbe375246, 0xbe679598, 0xbe8d7097, 0xbed137a2, 0xbe521f55, 0xbe5fd55f, 0x3ba83dd0, 0x3c283dd0, 0x3d0f8997, 0x3d7503b9, 0x3d51f554, 0x3d2ee6ee, 0xbc97b426, 0xbd17b426, 0xbd6dad4a, 0xbda1d337, 0xbde4218a, 0xbe1337ee, 0x3bfc7b67, 0x3c7c7b67, 0x3cbeab56, 0x3cff18f9, 0x3d489115, 0x3d88cad7, 0x3d9ec66a, 0x3db4c1fe, 0x3b9c78d2, 0xbc8bd4c0, 0xbd5eab96, 0xbdb918d5, 0xbe3b1ace, 0xbe480da3, 0xbe0bce45, 0xbe09a9cc, 0x3b79593e, 0x3bf9593e, 0xbafe8b31, 0xbc3c4f6b, 0xbd220d6f, 0xbd8a8382, 0xbdcfccfd, 0xbe0a8b3c, 0xbe212894, 0xbe37c5eb, 0xbe5a2143, 0xbe7c7c9b, 0xbe8cb089, 0xbe9b22c5, 0xbeb232af, 0xbec94299, 0xbd088889, 0xbd888889, 0xbe050bf0, 0xbe45d39b, 0xbe906b06, 0xbebdec3e, 0xbeefad66, 0xbf10b747, 0xbeb315ba, 0xbecd456e, 0xbe2e29fd, 0xbe36f568, 0x3d25d3b5, 0x3d60246a, 0x3e1a345e, 0x3e38609f, 0x3dbd5f69, 0x3dda0a00, 0x3cc2bc9e, 0x3d2c7716, 0x3d91db98, 0x3d9fc8d7, 0xbc547fe2, 0xbcd47fe2, 0xbcbab405, 0xbca0e829, 0xbc3ba965, 0xbb5609e4, 0xba5cfdc2, 0x3acf1606, 0xbc2f266b, 0xbcbc17cc, 0xbcfd95bf, 0xbd1f89d9, 0xbce8dd7f, 0xbc92a74c, 0xbc28f85f, 0xbb328898, 0x3e6e949c, 0x3e85b9bd, 0x3c80aa46, 0x3ce6759c, 0xbd5056d5, 0xbd49abab, 0xbbde7a00, 0xbc5e7a00, 0xbca6db80, 0xbcde7a00, 0xbcef0f59, 0xbcffa4b2, 0xbd081d06, 0xbd1067b2, 0xbd648c71, 0xbd9c5898, 0xbdc66af8, 0xbdf07d58, 0x3c00e024, 0x3c80e024, 0x3cc15036, 0x3d00e024, 0x3d3b33e0, 0x3d75879c, 0x3d97edac, 0x3db5178a, 0x3de6557c, 0x3e0bc9b7, 0x3e2468b0, 0x3e3d07a9, 0xbbc88ccc, 0xbc488ccc, 0xbc966999, 0xbcc88ccc, 0xbcc766a3, 0xbcc6407b, 0xbcc51a53, 0xbcc3f42b, 0xbc63c8b3, 0xbb7ea43b, 0x3bc8ed2a, 0x3c844b1c, 0x3c956d48, 0x3ca68f73, 0x3cb7b19f, 0x3cc8d3ca, 0x3e18c010, 0x3e341f40, 0x3e4f7e71, 0x3e6adda1, 0x3e19d817, 0x3e2f6542, 0x3e44f26e, 0x3e5a7f99, 0x3d8c0e74, 0x3da6c45d, 0x3dc17a45, 0x3ddc302e, 0x3e80bdfe, 0x3e89824a, 0x3e924696, 0x3e9b0ae2, 0x3b2edc82, 0x3baedc82, 0x3c032561, 0x3c2edc82, 0x3bbb1233, 0x3a435b13, 0xbb8a3b6e, 0xbc16711f, 0xbc8946c3, 0xbcc754f6, 0xbd02b194, 0xbd21b8ae, 0xbd57cfea, 0xbd86f393, 0xbda1ff31, 0xbdbd0ad0, 0xbdec2a82, 0xbe0da51a, 0xbe2534f3, 0xbe3cc4cc, 0xbe55e238, 0xbe6effa5, 0xbe840e88, 0xbe909d3f, 0xbe9c4748, 0xbea7f152, 0xbeb39b5c, 0xbebf4566, 0xbecd237d, 0xbedb0195, 0xbee8dfac, 0xbef6bdc4, 0x3c4e217c, 0x3cce217c, 0x3d1a991d, 0x3d4e217c, 0x3d61c6ca, 0x3d756c19, 0x3d8488b4, 0x3d8e5b5b, 0x3d81af26, 0x3d6a05e1, 0x3d50ad76, 0x3d37550c, 0x3cd33c34, 0x3bdf3941, 0xbc473f27, 0xbcff0d78, 0xbe84a435, 0xbe9246d4, 0xbe9fe973, 0xbead8c13, 0xbe5e458b, 0xbe60ff32, 0xbe63b8d9, 0xbe667280, 0xbd227128, 0xbcf5e7c9, 0xbca6ed41, 0xbc2fe571, 0x3e6e33cd, 0x3e8af5ea, 0x3e9ed1ed, 0x3eb2adf0, 0x3e9f69d5, 0x3eb47a66, 0x3ec98af7, 0x3ede9b88, 0x3e608eaa, 0x3e8689bf, 0x3e9ccc28, 0x3eb30e92, 0x3eb99881, 0x3ecaeebd, 0x3edc44fa, 0x3eed9b36, 0x3bd444e2, 0x3c5444e2, 0x3c9f33aa, 0x3cd444e2, 0x3cb905cb, 0x3c9dc6b3, 0x3c82879b, 0x3c4e9107, 0x3b39af94, 0xbbe3727a, 0xbc88ef30, 0xbcd901c1, 0xbcf9db96, 0xbd0d5ab6, 0xbd1dc7a1, 0xbd2e348c, 0xbd494600, 0xbd645774, 0xbd7f68e7, 0xbd8d3d2e, 0xbd959fed, 0xbd9e02ac, 0xbda6656b, 0xbdaec82b, 0xbdade9a4, 0xbdad0b1d, 0xbdac2c96, 0xbdab4e0f, 0xbda1b032, 0xbd981255, 0xbd8e7478, 0xbd84d69c, 0xbe898c47, 0xbe87c076, 0xbe85f4a4, 0xbe8428d3, 0x3d93f527, 0x3db60b17, 0x3dd82108, 0x3dfa36f9, 0x3eb676e8, 0x3ec4b91f, 0x3ed2fb56, 0x3ee13d8d, 0x3b54a5d1, 0x3bd4a5d1, 0x3c1f7c5d, 0x3c54a5d1, 0x3c84e7a3, 0x3cd187bd, 0x3d0f13ec, 0x3d3563f9, 0x3d5bb406, 0x3d81020a, 0x3d6a449d, 0x3d528526, 0x3d3ac5af, 0x3d230639, 0x3d0b46c2, 0x3bb91fc6, 0x3c391fc6, 0x3c8ad7d5, 0x3cb91fc6, 0x3ce767b8, 0x3cd4ab99, 0x3cc1ef7a, 0x3caf335c, 0x3c9c773d, 0x3c89bb1e, 0x3ca76229, 0x3cc50934, 0x3ce2b03e, 0x3d002ba5, 0x3d0eff2a, 0xbbb2d871, 0xbc32d871, 0xbc862255, 0xbcb2d871, 0xbcdf8e8d, 0xbd2967c2, 0xbd63083e, 0xbd8e545d, 0xbdab249b, 0xbdc7f4d9, 0xbdcfc31e, 0xbdd79163, 0xbddf5fa8, 0xbde72dee, 0xbdeefc33, 0xbe00f887, 0xbe0a72f4, 0xbe13ed62, 0xbe1d67cf, 0xbe26e23d, 0xbd950502, 0xbdbbd418, 0xbde2a32e, 0xbe04b922, 0xbe1820ad, 0x3ca7fd18, 0x3c8e2675, 0x3c689fa3, 0x3c34f25d, 0x3c014516, 0xbe4db1a9, 0xbe5163ec, 0xbe551630, 0xbe58c873, 0xbe5c7ab6, 0xbdcc2e11, 0xbdbe6a6b, 0xbdb0a6c4, 0xbda2e31e, 0xbd951f78, 0x39f1caaa, 0x3a71caaa, 0x3ab557ff, 0x3af1caaa, 0x3b171eaa, 0x3c2f5e20, 0x3c9c7a4b, 0x3ce14586, 0x3d130860, 0x3d356dfe, 0x3d5bb078, 0x3d80f979, 0x3d941ab7, 0x3da73bf4, 0x3dba5d31, 0x3dd77b81, 0x3df499d1, 0x3e08dc11, 0x3e176b39, 0x3e25fa61, 0x3e319f59, 0x3e3d4452, 0x3e48e94b, 0x3e548e43, 0x3e60333c, 0x3e6e87cb, 0x3e7cdc5b, 0x3e859875, 0x3e8cc2bd, 0x3e93ed05, 0x3e971bfd, 0x3e9a4af6, 0x3e9d79ef, 0x3ea0a8e8, 0x3ea3d7e1, 0x3ea5bcdd, 0x3ea7a1d8, 0x3ea986d3, 0x3eab6bcf, 0x3ead50ca, 0xbb969370, 0xbc169370, 0xbc61dd29, 0xbc969370, 0xbcbc384d, 0xbd022215, 0xbd262805, 0xbd4a2df4, 0xbd6e33e3, 0xbd891ce9, 0xbda0d6e6, 0xbdb890e3, 0xbdd04ae0, 0xbde804dc, 0xbdffbed9, 0xbe0e77e7, 0xbe1d1061, 0xbe2ba8dc, 0xbe3a4156, 0xbe48d9d1, 0xbde6cd79, 0xbdf81f9d, 0xbe04b8e1, 0xbe0d61f3, 0xbe160b05, 0xbd86d6d7, 0xbd8d9ab1, 0xbd945e8a, 0xbd9b2263, 0xbda1e63c, 0xbca5535c, 0xbc8c3f68, 0xbc6656ea, 0xbc342f04, 0xbc02071e, 0x3d3c1235, 0x3d3e0f72, 0x3d400cae, 0x3d4209ea, 0x3d440726, 0x3cb0754d, 0x3c9d9c55, 0x3c8ac35d, 0x3c6fd4ca, 0x3c4a22da, 0xbcce23f4, 0xbd32770e, 0xbd7ddc23, 0xbda4a09c, 0xbdca5326, 0xbe407382, 0xbe528b4a, 0xbe64a311, 0xbe76bad8, 0xbe846950, 0xbbe1cb03, 0xbc61cb03, 0xbca95842, 0xbce1cb03, 0xbd0d1ee2, 0xbd17aa10, 0xbd22353f, 0xbd2cc06d, 0xbd374b9c, 0xbd41d6ca, 0xbd5f8b36, 0xbd7d3fa2, 0xbd8d7a07, 0xbd9c543d, 0xbdab2e73, 0xbdb897e8, 0xbdc6015d, 0xbdd36ad2, 0xbde0d447, 0xbdee3dbc, 0xbdf235a5, 0xbdf62d8e, 0xbdfa2577, 0xbdfe1d60, 0xbe010aa4, 0xbdf6a8d8, 0xbdeb3c67, 0xbddfcff6, 0xbdd46385, 0xbdc8f715, 0xbdad49a0, 0xbd919c2b, 0xbd6bdd6c, 0xbd348283, 0xbcfa4f32, 0xbc1d9cb3, 0x3c3964fe, 0x3d0419ac, 0x3d59da18, 0x3d97cd42, 0x3ec1d17c, 0x3ed090c5, 0x3edf500f, 0x3eee0f58, 0x3efccea2, 0x3eb2f680, 0x3ec18557, 0x3ed0142f, 0x3edea307, 0x3eed31df, 0x3f2e9911, 0x3f36b218, 0x3f3ecb1e, 0x3f46e425, 0x3f4efd2c, 0x3c20a0a1, 0x3ca0a0a1, 0x3cf0f0f1, 0x3d20a0a1, 0x3d48c8c9, 0x3d70f0f1, 0x3d8c8c8d, 0x3da0a0a1, 0x3dbb78d1, 0x3dd65101, 0x3df12932, 0x3e0600b1, 0x3e136cc9, 0x3e20d8e1, 0x3e2e44fa, 0x3e3bb112, 0x3e5168b9, 0x3e672061, 0x3e7cd808, 0x3e8947d8, 0x3e9423ab, 0x3e9eff7f, 0x3ea9db53, 0x3eb4b726, 0xba9fe6c8, 0xbb1fe6c8, 0xbb6fda2c, 0xbb9fe6c8, 0xbbc7e07a, 0xbbefda2c, 0xbc0be9ef, 0xbc1fe6c8, 0xbbc2488c, 0xbb098712, 0x3ae305e8, 0x3bb6467d, 0x3c19e5c0, 0x3c58a842, 0x3c8bb562, 0x3cab16a2, 0x3ccdc476, 0x3cf07249, 0x3d09900e, 0x3d1ae6f8, 0x3d2c3de1, 0x3d3d94cb, 0x3d4eebb5, 0x3d60429e, 0x3b704dff, 0x3bf04dff, 0x3c343a7f, 0x3c704dff, 0x3c9630bf, 0x3cb43a7f, 0x3cd2443f, 0x3cf04dff, 0x3cfab52e, 0x3d028e2e, 0x3d07c1c5, 0x3d0cf55d, 0x3d1228f4, 0x3d175c8b, 0x3d1c9023, 0x3d21c3ba, 0x3d3c80ca, 0x3d573dda, 0x3d71faea, 0x3d865bfd, 0x3d93ba85, 0x3da1190d, 0x3dae7794, 0x3dbbd61c, 0x3dca6819, 0x3dd8fa15, 0x3de78c11, 0x3df61e0d, 0x3e025805, 0x3e09a103, 0x3e10ea01, 0x3e1832ff, 0x3d36773e, 0x3d6cbe7f, 0x3d9182e0, 0x3daca680, 0x3dc7ca20, 0x3de2edc0, 0x3dfe1161, 0x3e0c9a81, 0x3e6668b0, 0x3e71ac9a, 0x3e7cf084, 0x3e841a37, 0x3e89bc2c, 0x3e8f5e21, 0x3e950016, 0x3e9aa20c, 0x3e083a66, 0x3e077c78, 0x3e06be8b, 0x3e06009e, 0x3e0542b1, 0x3e0484c3, 0x3e03c6d6, 0x3e0308e9, 0x3dd702a3, 0x3dce61fd, 0x3dc5c157, 0x3dbd20b1, 0x3db4800c, 0x3dabdf66, 0x3da33ec0, 0x3d9a9e1a, 0xba279515, 0xbaa79515, 0xbafb5f9f, 0xbb279515, 0xbb517a5a, 0xbb7b5f9f, 0xbb92a272, 0xbba79515, 0xbc2f413f, 0xbc855bfa, 0xbcb31754, 0xbce0d2ae, 0xbd074704, 0xbd1e24b1, 0xbd35025f, 0xbd4be00c, 0xbd5d0d68, 0xbd6e3ac5, 0xbd7f6821, 0xbd884abf, 0xbd90e16d, 0xbd99781b, 0xbda20ec9, 0xbdaaa577, 0xbdb3171b, 0xbdbb88be, 0xbdc3fa61, 0xbdcc6c05, 0xbdd4dda8, 0xbddd4f4b, 0xbde5c0ef, 0xbdee3292, 0xbdefa6fa, 0xbdf11b63, 0xbdf28fcb, 0xbdf40434, 0xbdf5789c, 0xbdf6ed04, 0xbdf8616d, 0xbdf9d5d5, 0xbdfb3ce6, 0xbdfca3f6, 0xbdfe0b06, 0xbdff7217, 0xbe006c93, 0xbe01201c, 0xbe01d3a4, 0xbe02872c, 0xbe06a874, 0xbe0ac9bc, 0xbe0eeb03, 0xbe130c4b, 0xbe172d93, 0xbe1b4edb, 0xbe1f7023, 0xbe23916a, 0xbe2cdea8, 0xbe362be5, 0xbe3f7923, 0xbe48c660, 0xbe52139e, 0xbe5b60db, 0xbe64ae19, 0xbe6dfb56, 0x3acf0769, 0x3b4f0769, 0x3b9b458f, 0x3bcf0769, 0x3c0164a2, 0x3c1b458f, 0x3c35267c, 0x3c4f0769, 0x3c61bfb7, 0x3c747804, 0x3c839828, 0x3c8cf44f, 0x3c965076, 0x3c9fac9c, 0x3ca908c3, 0x3cb264e9, 0x3d0608b0, 0x3d32deec, 0x3d5fb527, 0x3d8645b1, 0x3d9cb0cf, 0x3db31bed, 0x3dc9870a, 0x3ddff228, 0x3df95f16, 0x3e096602, 0x3e161c78, 0x3e22d2ef, 0x3e2f8966, 0x3e3c3fdd, 0x3e48f654, 0x3e55acca, 0x3e2a70bd, 0x3e32f689, 0x3e3b7c56, 0x3e440223, 0x3e4c87ef, 0x3e550dbc, 0x3e5d9389, 0x3e661955, 0x3e81c5ee, 0x3e895692, 0x3e90e735, 0x3e9877d8, 0x3ea0087c, 0x3ea7991f, 0x3eaf29c3, 0x3eb6ba66, 0x3d48943a, 0x3d605a49, 0x3d782058, 0x3d87f334, 0x3d93d63b, 0x3d9fb943, 0x3dab9c4a, 0x3db77f52, 0x3d4958dd, 0x3d64270c, 0x3d7ef53c, 0x3d8ce1b5, 0x3d9a48cd, 0x3da7afe5, 0x3db516fc, 0x3dc27e14, 0x3e42375e, 0x3e50dc49, 0x3e5f8133, 0x3e6e261e, 0x3e7ccb09, 0x3e85b7fa, 0x3e8d0a6f, 0x3e945ce4, 0x3de7c5bc, 0x3e0429f9, 0x3e147113, 0x3e24b82d, 0x3e34ff48, 0x3e454662, 0x3e558d7c, 0x3e65d497, 0x3e54b3be, 0x3e5edbc7, 0x3e6903cf, 0x3e732bd7, 0x3e7d53df, 0x3e83bdf3, 0x3e88d1f7, 0x3e8de5fc, 0xb9bd8c97, 0xba3d8c97, 0xba8e2971, 0xbabd8c97, 0xbaecefbd, 0xbb0e2971, 0xbb25db04, 0xbb3d8c97, 0xbc07d2c1, 0xbc60425c, 0xbc9c58fb, 0xbcc890c9, 0xbcf4c897, 0xbd108032, 0xbd269c19, 0xbd3cb800, 0xbd578fe5, 0xbd7267cb, 0xbd869fd8, 0xbd940bcb, 0xbda177be, 0xbdaee3b1, 0xbdbc4fa4, 0xbdc9bb96, 0xbde1061f, 0xbdf850a8, 0xbe07cd98, 0xbe1372dd, 0xbe1f1821, 0xbe2abd65, 0xbe3662aa, 0xbe4207ee, 0xbe52945d, 0xbe6320cd, 0xbe73ad3c, 0xbe821cd6, 0xbe8a630d, 0xbe92a945, 0xbe9aef7d, 0xbea335b4, 0xbeaa3719, 0xbeb1387e, 0xbeb839e3, 0xbebf3b47, 0xbec63cac, 0xbecd3e11, 0xbed43f75, 0xbedb40da, 0xbee208bf, 0xbee8d0a5, 0xbeef988a, 0xbef66070, 0xbefd2855, 0xbf01f81d, 0xbf055c10, 0xbf08c003, 0xbf0c3e11, 0xbf0fbc1f, 0xbf133a2d, 0xbf16b83c, 0xbf1a364a, 0xbf1db458, 0xbf213266, 0xbf24b074, 0xbf21a38e, 0xbf24830b, 0xbf276289, 0xbf2a4207, 0xbf2d2185, 0xbf300103, 0xbf32e080, 0xbf35bffe, 0xbecc3a6d, 0xbed1fb49, 0xbed7bc26, 0xbedd7d03, 0xbee33de0, 0xbee8febc, 0xbeeebf99, 0xbef48076, 0xbed47eae, 0xbeda5cde, 0xbee03b0d, 0xbee6193c, 0xbeebf76c, 0xbef1d59b, 0xbef7b3cb, 0xbefd91fa, 0x3b3edf9b, 0x3bbedf9b, 0x3c0f27b5, 0x3c3edf9b, 0x3c6e9782, 0x3c8f27b5, 0x3ca703a8, 0x3cbedf9b, 0x3cd6bb8f, 0x3d1b39ca, 0x3d4b15cd, 0x3d7af1d0, 0x3d9566e9, 0x3dad54ea, 0x3dc542ec, 0x3ddd30ed, 0x3df51eef, 0x3e068678, 0x3e10135c, 0x3e19a041, 0x3e232d25, 0x3e2cba0a, 0x3e3646ee, 0x3e3fd3d2, 0x3e4960b7, 0x3e52ed9b, 0x3e5c7a80, 0x3a55608c, 0x3ad5608c, 0x3b200869, 0x3b55608c, 0x3b855c57, 0x3ba00869, 0x3bbab47a, 0x3bd5608c, 0x3bf00c9d, 0x3b6e3c52, 0xb868259c, 0xbb757d7f, 0xbbf3ad34, 0xbc364dd4, 0xbc72c50e, 0xbc979e24, 0xbcb5d9c1, 0xbcd4155e, 0xbcf486c8, 0xbd0a7c18, 0xbd1ab4cd, 0xbd2aed82, 0xbd3b2636, 0xbd4b5eeb, 0xbd5b97a0, 0xbd6bd054, 0xbd7c0909, 0x3b04f13c, 0x3b84f13c, 0x3bc769da, 0x3c04f13c, 0x3c262d8b, 0x3c4769da, 0x3c68a629, 0x3c84f13c, 0x3c958f63, 0x3c3ca2f2, 0x3b9c4e39, 0xbb0152e1, 0xbc0ed08d, 0xbc7d4c62, 0xbcb5e41c, 0xbced2206, 0xbd122ff8, 0xbd2dceee, 0xbd549419, 0xbd7b5945, 0xbd910f38, 0xbda471ce, 0xbdb7d464, 0xbdcb36fa, 0xbdde9990, 0xbdf1fc26, 0xbe02af5e, 0xbe0ddee9, 0xbe190e75, 0xbe243e00, 0xbe2f6d8c, 0xbe3a9d17, 0xbe45cca3, 0xbe50fc2e, 0xbe5c2bba, 0xbe675b45, 0xbe9f3a88, 0xbea56395, 0xbeab8ca1, 0xbeb1b5ae, 0xbeb7debb, 0xbebe07c7, 0xbec430d4, 0xbeca59e1, 0xbed082ed, 0xbdc4e50e, 0xbdce7b08, 0xbdd81103, 0xbde1a6fd, 0xbdeb3cf7, 0xbdf4d2f2, 0xbdfe68ec, 0xbe03ff73, 0xbe08ca71, 0xbd3aa9ca, 0xbd63897d, 0xbd863498, 0xbd9aa471, 0xbdaf144b, 0xbdc38424, 0xbdd7f3fe, 0xbdec63d7, 0xbe0069d8, 0xbdb29e68, 0xbdcfeb45, 0xbded3823, 0xbe054280, 0xbe13e8ef, 0xbe228f5d, 0xbe3135cc, 0xbe3fdc3b, 0xbe4e82a9, 0xbb430eb0, 0xbbc30eb0, 0xbc124b04, 0xbc430eb0, 0xbc73d25c, 0xbc924b04, 0xbcaaacda, 0xbcc30eb0, 0xbcdb7086, 0xbcebc112, 0xbcfc119e, 0xbd063115, 0xbd0e595b, 0xbd1681a1, 0xbd1ea9e7, 0xbd26d22d, 0xbd2efa73, 0xbd3722b9, 0xbd38a8f3, 0xbd3a2f2d, 0xbd3bb567, 0xbd3d3ba1, 0xbd3ec1db, 0xbd404815, 0xbd41ce4f, 0xbd435489, 0xbd44dac4, 0xbd3903a4, 0xbd2d2c84, 0xbd215564, 0xbd157e44, 0xbd09a725, 0xbcfba00a, 0xbce3f1ca, 0xbccc438a, 0xbcb4954b, 0xbc8b6208, 0xbc445d89, 0xbbe3ee06, 0xbafc83e7, 0x3b4b5825, 0x3c053c8f, 0x3c57a316, 0x3c9504ce, 0x3cbe3811, 0x3cdf8e04, 0x3d0071fc, 0x3d111cf6, 0x3d21c7ef, 0x3d3272e9, 0x3d431de3, 0x3d53c8dc, 0x3d6473d6, 0x3d751ed0, 0x3d8512a4, 0x3d8f95e0, 0x3d9a191d, 0x3da49c59, 0x3daf1f95, 0x3db9a2d1, 0x3dc4260e, 0x3dcea94a, 0x3dd92c86, 0x3dda761a, 0x3ddbbfae, 0x3ddd0942, 0x3dde52d6, 0x3ddf9c6a, 0x3de0e5fe, 0x3de22f92, 0x3de37926, 0x3de4c2ba, 0x3ba8e81b, 0x3c28e81b, 0x3c7d5c28, 0x3ca8e81b, 0x3cd32222, 0x3cfd5c28, 0x3d13cb18, 0x3d28e81b, 0x3d3e051e, 0x3d77102b, 0x3d980d9b, 0x3db49322, 0x3dd118a8, 0x3ded9e2e, 0x3e0511da, 0x3e13549d, 0x3e219760, 0x3e2fda23, 0x3e3a5f08, 0x3e44e3ed, 0x3e4f68d2, 0x3e59edb8, 0x3e64729d, 0x3e6ef782, 0x3e797c67, 0x3e8200a6, 0x3e874318, 0x3e8c74ce, 0x3e91a683, 0x3e96d838, 0x3e9c09ed, 0x3ea13ba3, 0x3ea66d58, 0x3eab9f0d, 0x3eb0d0c3, 0x3eb60278, 0x3e31c564, 0x3e358af7, 0x3e39508a, 0x3e3d161c, 0x3e40dbaf, 0x3e44a142, 0x3e4866d5, 0x3e4c2c67, 0x3e4ff1fa, 0xbdf5a802, 0xbe023bab, 0xbe09a355, 0xbe110aff, 0xbe1872aa, 0xbe1fda54, 0xbe2741fe, 0xbe2ea9a8, 0xbe361152, 0xbd3fa0d9, 0xbd41c94f, 0xbd43f1c5, 0xbd461a3c, 0xbd4842b2, 0xbd4a6b28, 0xbd4c939e, 0xbd4ebc14, 0xbd50e48a, 0xbd5cf2b3, 0xbd7bd5c3, 0xbd8d5c6a, 0xbd9ccdf2, 0xbdac3f7a, 0xbdbbb102, 0xbdcb228a, 0xbdda9413, 0xbdea059b, 0xbd9c2b54, 0xbdaeab84, 0xbdc12bb3, 0xbdd3abe2, 0xbde62c11, 0xbdf8ac41, 0xbe059638, 0xbe0ed650, 0xbe181667, 0xbd900aa5, 0xbd8de4fc, 0xbd8bbf52, 0xbd8999a9, 0xbd877400, 0xbd854e56, 0xbd8328ad, 0xbd810303, 0xbd7dbab3, 0xbe36c57a, 0xbe3da7b9, 0xbe4489f8, 0xbe4b6c38, 0xbe524e77, 0xbe5930b6, 0xbe6012f6, 0xbe66f535, 0xbe6dd775, 0xbaa84902, 0xbb284902, 0xbb7c6d82, 0xbba84902, 0xbbd25b42, 0xbbfc6d82, 0xbc133fe1, 0xbc284902, 0xbc3d5222, 0xbc63ca7b, 0xbc85216a, 0xbc985d96, 0xbcab99c3, 0xbcbed5ef, 0xbcd2121c, 0xbce54e48, 0xbcf88a75, 0xbd05e351, 0xbd118039, 0xbd1d1d21, 0xbd28ba0a, 0xbd3456f2, 0xbd3ff3db, 0xbd4b90c3, 0xbd572dab, 0xbd62ca94, 0xbd6e677c, 0xbd7995e3, 0xbd826225, 0xbd87f958, 0xbd8d908b, 0xbd9327bf, 0xbd98bef2, 0xbd9e5625, 0xbda3ed59, 0xbda9848c, 0xbdaafdf6, 0xbdac7761, 0xbdadf0cb, 0xbdaf6a35, 0xbdb0e39f, 0xbdb25d0a, 0xbdb3d674, 0xbdb54fde, 0xbdb6c948, 0xbdb72b1a, 0xbdb78cec, 0xbdb7eebe, 0xbdb85090, 0xbdb8b261, 0xbdb91433, 0xbdb97605, 0xbdb9d7d7, 0xbdba39a8, 0xbdb9d57a, 0xbdb9714b, 0xbdb90d1c, 0xbdb8a8ed, 0xbdb844be, 0xbdb7e08f, 0xbdb77c60, 0xbdb71832, 0xbdb6b403, 0xbdb30c25, 0xbdaf6447, 0xbdabbc6a, 0xbda8148c, 0xbda46cae, 0xbda0c4d1, 0xbd9d1cf3, 0xbd997515, 0xbd95cd38, 0x3cc003de, 0x3ce1f414, 0x3d01f225, 0x3d12ea40, 0x3d23e25b, 0x3d34da76, 0x3d45d290, 0x3d56caab, 0x3d67c2c6, 0x3e125700, 0x3e1c48ce, 0x3e263a9c, 0x3e302c6b, 0x3e3a1e39, 0x3e441008, 0x3e4e01d6, 0x3e57f3a5, 0x3e61e573, 0x3e88d257, 0x3e8ebc92, 0x3e94a6cc, 0x3e9a9107, 0x3ea07b41, 0x3ea6657c, 0x3eac4fb6, 0x3eb239f0, 0x3eb8242b };
Max
2
psychogenic/zephyr
tests/lib/cmsis_dsp/filtering/src/decim_f32.pat
[ "Apache-2.0" ]
<p class="for-paddle-users">is your card about to expire, or got a new paypal account? you can update your payment method here.</p> <p class="for-stripe-users">is your card about to expire, or got a new bank account? you can update your payment method here.</p> <p>&nbsp;</p> <button id="update-payment-method-button" class="bold" onclick="updatePaymentMethod();">update payment method</button>
Kit
2
pws1453/web-client
source/imports/app/account-tab-plan-payments-payment-method.kit
[ "MIT" ]
# =========================================================================== # http://www.gnu.org/software/autoconf-archive/ax_generate_changelog.html # =========================================================================== # # SYNOPSIS # # AX_GENERATE_CHANGELOG() # # DESCRIPTION # # Builds a rule for generating a ChangeLog file from version control # system commit messages. Currently, the only supported VCS is git, but # support for others could be added in future. # # Defines GENERATE_CHANGELOG_RULES which should be substituted in your # Makefile. # # Usage example: # # configure.ac: # # AX_GENERATE_CHANGELOG # # Makefile.am: # # @GENERATE_CHANGELOG_RULES@ # CHANGELOG_START = 0.2.3^ # dist-hook: dist-ChangeLog # # ChangeLog (stub committed to VCS): # # The ChangeLog is auto-generated when releasing. # If you are seeing this, use 'git log' for a detailed list of changes. # # This results in a "dist-ChangeLog" rule being added to the Makefile. # When run, "dist-ChangeLog" will generate a ChangeLog in the # $(top_distdir), using $(CHANGELOG_GIT_FLAGS) to format the output from # "git log" being run in $(CHANGELOG_GIT_DIR). # # Unless Automake is initialised with the 'foreign' option, a dummy # ChangeLog file must be committed to VCS in $(top_srcdir), containing the # text above (for example). It will be substituted by the automatically # generated ChangeLog during "make dist". # # LICENSE # # Copyright (c) 2015 David King <amigadave@amigadave.com> # Copyright (c) 2015 Philip Withnall <philip.withnall@collabora.co.uk> # # Copying and distribution of this file, with or without modification, are # permitted in any medium without royalty provided the copyright notice # and this notice are preserved. This file is offered as-is, without any # warranty. #serial 1 AC_DEFUN([AX_GENERATE_CHANGELOG],[ # Find git, defaulting to the 'missing' script so the user gets a nice # message if git is missing, rather than a plain 'command not found'. AC_PATH_PROG([GIT],[git],[${am_missing_run}git]) AC_SUBST([GIT]) # Build the ChangeLog rules. m4_pattern_allow([AM_V_GEN]) GENERATE_CHANGELOG_RULES=' # Generate ChangeLog # # Optional: # - CHANGELOG_START: git commit ID or tag name to output changelogs from # (exclusive). (Default: include all commits) # - CHANGELOG_GIT_FLAGS: General flags to pass to git-log when generating the # ChangeLog. (Default: various) # - CHANGELOG_GIT_DIR: .git directory to use. (Default: $(top_srcdir)/.git) # git-specific CHANGELOG_GIT_FLAGS ?= --stat -M -C --name-status --no-color CHANGELOG_GIT_DIR ?= $(top_srcdir)/.git ifeq ($(CHANGELOG_START),) CHANGELOG_GIT_RANGE = else CHANGELOG_GIT_RANGE = $(CHANGELOG_START).. endif # Generate a ChangeLog in $(top_distdir) dist-ChangeLog: $(AM_V_GEN)if $(GIT) \ --git-dir=$(CHANGELOG_GIT_DIR) --work-tree=$(top_srcdir) log \ $(CHANGELOG_GIT_FLAGS) $(CHANGELOG_GIT_RANGE) \ | fmt --split-only >.ChangeLog.tmp; \ then mv -f .ChangeLog.tmp "$(top_distdir)/ChangeLog"; \ else rm -f .ChangeLog.tmp; exit 1; fi .PHONY: dist-ChangeLog ' AC_SUBST([GENERATE_CHANGELOG_RULES]) m4_ifdef([_AM_SUBST_NOTMAKE], [_AM_SUBST_NOTMAKE([GENERATE_CHANGELOG_RULES])]) ])
M4
4
cssl-unist/tweezer
Docker/gperftools/m4/ax_generate_changelog.m4
[ "MIT" ]
%require "3.5" %{ #define YYDEBUG 1 %} %code requires { #include "parser-util.h" #include "debug/pront.h" #include <malloc.h> #include <string.h> extern int yylex (parser_ctx_t *ctx); extern void yyerror(parser_ctx_t *ctx, char *msg); } %param { parser_ctx_t *ctx }; %union { pos_t pos; ival_t ival; strval_t strval; ident_t ident; idents_t idents; funcdef_t func; expr_t expr; exprs_t exprs; stmt_t stmt; stmts_t stmts; strval_t garbage; } %token <pos> TKN_AUTO "auto" TKN_FUNC "func" %token <pos> TKN_IF "if" TKN_ELSE "else" TKN_WHILE "while" TKN_RETURN "return" TKN_ASM "asm" %token TKN_THEN "then" %token <pos> TKN_LPAR "(" TKN_RPAR ")" TKN_LBRAC "{" TKN_RBRAC "}" TKN_LSBRAC "[" TKN_RSBRAC "]" %token <pos> TKN_SEMI ";" TKN_COLON ":" TKN_COMMA "," %token <ival> TKN_IVAL %token <strval> TKN_STRVAL %token <ident> TKN_IDENT %token <garbage> TKN_GARBAGE %token <pos> TKN_ADD "+" TKN_SUB "-" TKN_ASSIGN "=" TKN_AMP "&" %token <pos> TKN_MUL "*" TKN_DIV "/" TKN_REM "%" %token <pos> TKN_NOT "!" TKN_INV "~" TKN_XOR "^" TKN_OR "|" %token <pos> TKN_SHL "<<" TKN_SHR ">>" %token <pos> TKN_LT "<" TKN_LE "<=" TKN_GT ">" TKN_GE ">=" TKN_EQ "==" TKN_NE "!=" %type <idents> opt_idents %type <idents> idents %type <func> funcdef %type <expr> expr %type <exprs> opt_exprs %type <exprs> exprs %type <stmts> stmts %type <stmt> stmt %type <stmt> inline_asm %type <idents> vardecls // Precedence: lowest. %right "=" %left "||" %left "&&" %left "|" %left "^" //%left "&" %left "==" "!=" %left "<" ">" "<=" ">=" %left "<<" ">>" %left "+" //"-" %left "%" "/" //"*" %right "!" "~" "*" "&" "-" %precedence "(" "[" %precedence "then" %precedence "else" // Precedence: highest. %% library: global library | %empty; global: funcdef {function_added(ctx, &$1);} | vardecls; funcdef: "func" TKN_IDENT "(" opt_idents ")" "{" stmts "}" {$$=funcdef_decl(&$2, &$4, &$7);}; vardecls: "auto" idents ";" {$$=$2;}; opt_idents: idents {$$=$1;} | %empty {$$=idents_empty();}; idents: idents "," TKN_IDENT {$$=idents_cat (&$1, &$3);} | TKN_IDENT {$$=idents_one (&$1);}; stmts: stmts stmt {$$=stmts_cat (&$1, &$2);} | %empty {$$=stmts_empty ();}; stmt: "{" stmts "}" {$$=stmt_multi (&$2);} | "if" "(" expr ")" stmt %prec "then" {$$=stmt_if (&$3, &$5, NULL);} | "if" "(" expr ")" stmt "else" stmt {$$=stmt_if (&$3, &$5, &$7);} | "while" "(" expr ")" stmt {$$=stmt_while (&$3, &$5);} | "return" ";" {$$=stmt_ret (NULL);} | "return" expr ";" {$$=stmt_ret (&$2);} | vardecls {$$=stmt_var (&$1);} | expr ";" {$$=stmt_expr (&$1);} | inline_asm ";" {$$=$1;}; opt_exprs: exprs | %empty; exprs: expr "," exprs | expr; expr: TKN_IVAL {$$=expr_icnst(&$1);} | TKN_STRVAL {$$=expr_scnst(&$1);} | TKN_IDENT {$$=expr_ident(&$1);} | expr "(" opt_exprs ")" {$$=expr_call (&$1, &$3);} | expr "[" expr "]" {$$=expr_math2(OP_INDEX, &$1, &$3);} | "(" expr ")" {$$=$2;} | "-" expr {$$=expr_math1(OP_0_MINUS, &$2);} | "!" expr {$$=expr_math1(OP_LOGIC_NOT, &$2);} | "~" expr {$$=expr_math1(OP_BIT_NOT, &$2);} | "&" expr {$$=expr_math1(OP_ADROF, &$2);} | "*" expr {$$=expr_math1(OP_DEREF, &$2);} | expr "*" expr {$$=expr_math2(OP_MUL, &$1, &$3);} | expr "/" expr %prec "*" {$$=expr_math2(OP_DIV, &$1, &$3);} | expr "%" expr %prec "*" {$$=expr_math2(OP_MOD, &$1, &$3);} | expr "+" expr {$$=expr_math2(OP_ADD, &$1, &$3);} | expr "-" expr %prec "+" {$$=expr_math2(OP_SUB, &$1, &$3);} | expr "<" expr {$$=expr_math2(OP_LT, &$1, &$3);} | expr "<=" expr %prec "<" {$$=expr_math2(OP_LE, &$1, &$3);} | expr ">" expr %prec "<" {$$=expr_math2(OP_GT, &$1, &$3);} | expr ">=" expr %prec "<" {$$=expr_math2(OP_GE, &$1, &$3);} | expr "==" expr {$$=expr_math2(OP_NE, &$1, &$3);} | expr "!=" expr %prec "==" {$$=expr_math2(OP_EQ, &$1, &$3);} | expr "&" expr {$$=expr_math2(OP_BIT_AND, &$1, &$3);} | expr "^" expr {$$=expr_math2(OP_BIT_XOR, &$1, &$3);} | expr "|" expr {$$=expr_math2(OP_BIT_OR, &$1, &$3);} | expr "<<" expr {$$=expr_math2(OP_SHIFT_L, &$1, &$3);} | expr ">>" expr %prec "<<" {$$=expr_math2(OP_SHIFT_R, &$1, &$3);} | expr "&&" expr {$$=expr_math2(OP_LOGIC_AND, &$1, &$3);} | expr "||" expr {$$=expr_math2(OP_LOGIC_OR, &$1, &$3);} | expr "=" expr {$$=expr_math2(OP_ASSIGN, &$1, &$3);}; inline_asm: "asm" "(" TKN_STRVAL ":" opt_asm_regs ":" opt_asm_regs ":" opt_asm_strs ")" | "asm" "(" TKN_STRVAL ":" opt_asm_regs ":" opt_asm_regs ")" | "asm" "(" TKN_STRVAL ":" opt_asm_regs ")" | "asm" "(" TKN_STRVAL ")" {$$=stmt_iasm(&$3, NULL, NULL, NULL);}; opt_asm_strs: asm_strs | %empty; asm_strs: TKN_STRVAL "," asm_strs | TKN_STRVAL; opt_asm_regs: asm_regs | %empty; asm_regs: TKN_STRVAL "(" expr ")" "," asm_regs | TKN_STRVAL "(" expr ")"; %% void *make_copy(void *mem, size_t size) { if (!mem) return NULL; void *copy = malloc(size); memcpy(copy, mem, size); return copy; }
Bison
5
robotman2412/lilly-c
src/parser.bison
[ "MIT" ]
(test (= (try _ 42) 42)) (test (= (try ((foo(x) (+ x 35))) (call (restart 'foo) 7)) 42)) (test (= (try ((foo(x) (+ x 35))) (try _ (call (restart 'foo) 7))) 42)) (test (= (try ((foo() 'bar)) (try ((foo() 'baz)) (call (restart 'foo)))) 'baz)) (test (= (catch ((_ (restart 'done 21))) (try ((done(n) (* 2 n))) (throw 'foo))) 42)) (test (= (catch (((Int e) (restart 'done e))) (try ((done(n) (* 2 n))) (throw 21))) 42)) (test (= (catch (((EUnknown _) (restart 'use-val 42))) (try _ not-found)) 42))
Grammatical Framework
3
daota2/fffff
v1/test/restart.gf
[ "MIT" ]
#![crate_type = "dylib"] extern crate m1; pub fn m2() { m1::m1() }
Rust
2
Eric-Arellano/rust
src/test/run-make-fulldeps/dylib-chain/m2.rs
[ "ECL-2.0", "Apache-2.0", "MIT-0", "MIT" ]
new function pairwiseSort(array, f, l, g = 1) { if f == l - g { return; } for b = f + g; b < l; b += 2 * g { compSwap(array, b - g, b); } if ((l - f) // g) % 2 == 0 { pairwiseSort(array, f, l, g * 2); pairwiseSort(array, f + g, l + g, g * 2); } else { pairwiseSort(array, f, l + g, g * 2); pairwiseSort(array, f + g, l, g * 2); } for a = 1; a < (l - f) // g; a = (a * 2) + 1 {} for b = f + g; b + g < l; b += 2 * g { new int c = a; while c > 1 { c //= 2; if b + (c * g) < l { compSwap(array, b, b + (c * g)); } } } } @Sort( "Concurrent Sorts", "Pairwise Sorting Network", "Pairwise" ); new function pairwiseSortRun(array) { pairwiseSort(array, 0, len(array)); }
Opal
3
thatsOven/sorting-visualizer
sorts/PairwiseSortingNetwork.opal
[ "MIT" ]
"* The Computer Language Benchmarks Game http://benchmarksgame.alioth.debian.org/ contributed by Andres Valloud *"! !SequenceableCollection methodsFor: 'computer language shootout'! substringFrequencies5: aLength using: aDictionary | buffer | buffer := String new: aLength. 1 to: self size - aLength + 1 do: [:i | | answer | buffer replaceFrom: 1 to: aLength with: self startingAt: i. answer := aDictionary at: buffer putValueOf: [:sum | sum + 1] ifAbsentPutValueOf: 1. answer = 1 ifTrue: [buffer := String new: aLength]. ]. ^aDictionary! ! !Dictionary methodsFor: 'computer language shootout'! at: key putValueOf: putBlock ifAbsentPutValueOf: absentBlock "* Set the value at key to be the value of evaluating putBlock with the existing value. If key is not found, create a new entry for key and set is value to the evaluation of absentBlock. Answer the result of evaluating either block. *" | index element anObject | key == nil ifTrue: [^self subscriptBoundsErrorFor: #at:putValueOf:ifAbsentPutValueOf: index: key value: absentBlock value]. index := self findKeyOrNil: key. element := self basicAt: index. element == nil ifTrue: [self atNewIndex: index put: (self createKey: key value: (anObject := absentBlock value))] ifFalse: [element value: (anObject := putBlock value: element value)]. ^anObject ! ! !Tests class methodsFor: 'benchmarking'! readFasta: sequenceName from: input | prefix newline buffer description line char | prefix := '>',sequenceName. newline := Character lf. "* find start of particular fasta sequence *" [(input atEnd) or: [ (input peek = $>) ifTrue: [((line := input upTo: newline) indexOfSubCollection: prefix startingAt: 1) = 1] ifFalse: [input skipThrough: newline. false]] ] whileFalse. "* line-by-line read - it would be a lot faster to block read *" description := line. buffer := ReadWriteStream on: (String new: 1028). [(input atEnd) or: [(char := input peek) = $>]] whileFalse: [ (char = $;) ifTrue: [input upTo: newline] ifFalse: [buffer nextPutAll: (input upTo: newline)] ]. ^Association key: description value: buffer contents ! ! !Tests class methodsFor: 'benchmarking'! knucleotide5From: input to: output "Same as av3, but create less strings while updating the frequencies" | sequence writeFrequencies writeCount | sequence := (self readFasta: 'THREE' from: input) value asUppercase. writeFrequencies := [:k | | frequencies count | frequencies := SortedCollection sortBlock: [:a :b| (a value = b value) ifTrue: [b key < a key] ifFalse: [b value < a value]]. count := 0.0. (sequence substringFrequencies5: k using: (Dictionary new: 1024)) associationsDo: [:each| frequencies add: each. count := count + each value]. frequencies do: [:each | | percentage | percentage := (each value / count) * 100.0. output nextPutAll: each key; space; print: percentage digits: 3; nl]]. writeCount := [:nucleotideFragment | | frequencies count | frequencies := sequence substringFrequencies5: nucleotideFragment size using: (Dictionary new: 1024). count := frequencies at: nucleotideFragment ifAbsent: [0]. output print: count; tab; nextPutAll: nucleotideFragment; nl]. writeFrequencies value: 1. output nl. writeFrequencies value: 2. output nl. writeCount value: 'GGT'. writeCount value: 'GGTA'. writeCount value: 'GGTATT'. writeCount value: 'GGTATTTTAATT'. writeCount value: 'GGTATTTTAATTTATAGT'.! ! !Tests class methodsFor: 'benchmark scripts'! knucleotide5 self knucleotide5From: self stdinSpecial to: self stdout. ^''! !
Gosu
4
danglotb/Energy-Languages
Smalltalk/k-nucleotide/knucleotide5.gst
[ "MIT" ]
\section{IDS types} \begin{code} {-# LANGUAGE MagicHash #-} module Types where import GHC.Exts data F a = FN | F1 a | F2 a a | F3 a a a | F4 a a a a | F5 a a a a a (F a) data FI = FIN | FI1 Int# | FI2 Int# Int# | FI3 Int# Int# Int# | FI4 Int# Int# Int# Int# | FI5 Int# Int# Int# Int# Int# FI data FC = FCN | FC1 Char# | FC2 Char# Char# | FC3 Char# Char# Char# | FC4 Char# Char# Char# Char# | FC5 Char# Char# Char# Char# Char# FC \end{code} \begin{code} data F2 a b = F2N | F21 a b | F22 a b a b | F23 a b a b a b | F24 a b a b a b a b | F25 a b a b a b a b a b (F2 a b) data F3 a b c = F3N | F31 a b c | F32 a b c a b c | F33 a b c a b c a b c | F34 a b c a b c a b c a b c | F35 a b c a b c a b c a b c a b c (F3 a b c) data F3I = F3IN | F3I1 Int# Int# Int# | F3I2 Int# Int# Int# Int# Int# Int# | F3I3 Int# Int# Int# Int# Int# Int# Int# Int# Int# | F3I4 Int# Int# Int# Int# Int# Int# Int# Int# Int# Int# Int# Int# | F3I5 Int# Int# Int# Int# Int# Int# Int# Int# Int# Int# Int# Int# Int# Int# Int# F3I \end{code} \begin{code} data S a = SN | S1 a (S a) | S2 a a (S a) | S3 a a a (S a) | S4 a a a a (S a) | S5 a a a a a (S a) data SI = SIN | SI1 Int# SI | SI2 Int# Int# SI | SI3 Int# Int# Int# SI | SI4 Int# Int# Int# Int# SI | SI5 Int# Int# Int# Int# Int# SI data SC = SCN | SC1 Char# SC | SC2 Char# Char# SC | SC3 Char# Char# Char# SC | SC4 Char# Char# Char# Char# SC | SC5 Char# Char# Char# Char# Char# SC \end{code}
Literate Haskell
3
ocharles/ghc
testsuite/tests/programs/cvh_unboxing/Types.lhs
[ "BSD-3-Clause" ]
package com.serverless; import com.amazonaws.services.lambda.runtime.Context; import com.amazonaws.services.lambda.runtime.RequestHandler; import com.amazonaws.services.lambda.runtime.events.S3Event; import com.fasterxml.jackson.core.JsonProcessingException; import com.fasterxml.jackson.databind.ObjectMapper; public class RequestHandlerS3Event implements RequestHandler<S3Event, Object> { static S3Event input; @Override public Object handleRequest(S3Event event, Context context) { input = event; ObjectMapper objectMapper = new ObjectMapper().findAndRegisterModules(); try { System.out.println("Input received:" + objectMapper.writeValueAsString(input)); } catch (JsonProcessingException e) { System.out.println("Input received:" + input.toString()); throw new RuntimeException("Failed to convert to JSON.", e); } return "RequestHandlerS3Event invoke Complete."; } }
Java
3
Arun-kc/serverless
lib/plugins/aws/invokeLocal/runtimeWrappers/java/src/test/java/com/serverless/RequestHandlerS3Event.java
[ "MIT" ]
#![feature(associated_type_defaults)] #![feature(generic_associated_types)] trait Trait1 { fn foo(); } trait Trait2 { type Associated: Trait1 = Self; //~^ ERROR: the trait bound `Self: Trait1` is not satisfied //~| the size for values of type `Self` cannot be known } impl Trait2 for () {} fn call_foo<T: Trait2>() { T::Associated::foo() } fn main() { call_foo::<()>() }
Rust
4
mbc-git/rust
src/test/ui/generic-associated-types/issue-74816.rs
[ "ECL-2.0", "Apache-2.0", "MIT-0", "MIT" ]
@prefix ia: <http://lv2plug.in/ns/ext/instance-access#> . @prefix lv2: <http://lv2plug.in/ns/lv2core#> . @prefix rdfs: <http://www.w3.org/2000/01/rdf-schema#> . <http://lv2plug.in/ns/ext/instance-access> a lv2:Feature ; rdfs:seeAlso <instance-access.h> , <lv2-instance-access.doap.ttl> ; lv2:documentation """ <p>This extension defines a feature which allows plugin UIs to get a direct handle to an LV2 plugin instance (LV2_Handle), if possible.</p> <p>Note that the use of this extension by UIs violates the important principle of UI/plugin separation, and is potentially a source of many problems. Accordingly, <strong>use of this extension is highly discouraged</strong>, and plugins should not expect hosts to support it, since it is often impossible to do so.</p> <p>To support this feature the host must pass an LV2_Feature struct to the UI instantiate method with URI LV2_INSTANCE_ACCESS_URI and data pointed directly to the LV2_Handle of the plugin instance.</p> """ .
Turtle
4
joshrose/audacity
lib-src/lv2/lv2/lv2/instance-access/instance-access.ttl
[ "CC-BY-3.0" ]
class_name Pawn extends Node2D enum CellType { ACTOR, OBSTACLE, OBJECT } #warning-ignore:unused_class_variable export(CellType) var type = CellType.ACTOR var active = true setget set_active func set_active(value): active = value set_process(value) set_process_input(value)
GDScript
4
jonbonazza/godot-demo-projects
2d/role_playing_game/grid_movement/pawns/Pawn.gd
[ "MIT" ]
FIVE ;List and count the months between 1/1900 and 12/2100 that have 5 full weekends ;Extra credit - list and count years with no months with five full weekends ;Using the test that the 31st of a month is on a Sunday ;Uses the VA's public domain routine %DTC (Part of the Kernel) named here DIDTC NEW YEAR,MONTH,X,Y,CNTMON,NOT,NOTLIST ; YEAR is the year we're testing ; MONTH is the month we're testing ; X is the date in "internal" format, as an input to DOW^DIDTC ; Y is the day of the week (0=Sunday, 1=Monday...) output from DOW^DIDTC ; CNTMON is a count of the months that have 5 full weekends ; NOT is a flag if there were no months with 5 full weekends yet that year ; NOTLIST is a list of years that do not have any months with 5 full weekends SET CNTMON=0,NOTLIST="" WRITE !!,"The following months have five full weekends:" FOR YEAR=200:1:400 DO ;years since 12/31/1700 epoch . SET NOT=0 . FOR MONTH="01","03","05","07","08","10","12" DO . . SET X=YEAR_MONTH_"31" . . DO DOW^DIDTC . . IF (Y=0) DO . . . SET NOT=NOT+1,CNTMON=CNTMON+1 . . . WRITE !,MONTH_"-"_(YEAR+1700) . SET:(NOT=0) NOTLIST=NOTLIST_$SELECT($LENGTH(NOTLIST)>1:",",1:"")_(YEAR+1700) WRITE !,"For a total of "_CNTMON_" months." WRITE !!,"There are "_$LENGTH(NOTLIST,",")_" years with no five full weekends in any month." WRITE !,"They are: "_NOTLIST KILL YEAR,MONTH,X,Y,CNTMON,NOT,NOTLIST QUIT F ;Same logic as the main entry point, shortened format N R,M,X,Y,C,N,L S C=0,L="" W !!,"The following months have five full weekends:" F R=200:1:400 D . S N=0 F M="01","03","05","07","08","10","12" S X=R_M_"31" D DOW^DIDTC I 'Y S N=N+1,C=C+1 W !,M_"-"_(R+1700) . S:'N L=L_$S($L(L):",",1:"")_(R+1700) W !,"For a total of "_C_" months.",!!,"There are "_$L(L,",")_" years with no five full weekends in any month.",!,"They are: "_L Q
M
4
LaudateCorpus1/RosettaCodeData
Task/Five-weekends/MUMPS/five-weekends.mumps
[ "Info-ZIP" ]
#/** @file # This is a very simple shell script to test how the interpreter parses the parameters. # # Copyright (c) 2015, Intel Corporation. All rights reserved.<BR> # This program and the accompanying materials # are licensed and made available under the terms and conditions of the BSD License # which accompanies this distribution. The full text of the license may be found at # http://opensource.org/licenses/bsd-license.php # # THE PROGRAM IS DISTRIBUTED UNDER THE BSD LICENSE ON AN "AS IS" BASIS, # WITHOUT WARRANTIES OR REPRESENTATIONS OF ANY KIND, EITHER EXPRESS OR IMPLIED. # #**/ echo -on set Var_EFCF356F_228C_47C2_AD0C_3B5DAC9A8CFA ValueOfGuid set Sharp_E8528E46_A008_4221_8DE0_D5AB42A9C580 ^# set Quote_E95DEE8B_E3AA_4155_9ED5_6916394104FC ^" set Var_ShellCTestApp_EE6E8BC6_71A6_44A5_BED3_D8F901105CDE ShellCTestApp_EE6E8BC6_71A6_44A5_BED3_D8F901105CDE alias ShellCTestApp_EE6E8BC6_71A6_44A5_BED3_D8F901105CDE ShellCTestApp # # '^' should escape all special characters (including space) # but has no impact to non-special characters # ShellCTestApp ^^ ShellCTestApp ^# ShellCTestApp ^%Var_EFCF356F_228C_47C2_AD0C_3B5DAC9A8CFA% ShellCTestApp ^" ShellCTestApp ^ 1 ShellCTestApp ^ ShellCTestApp ^1 ShellCTestApp ^^^" ShellCTestApp ^^^ # # '#' should be processed before %% replacement, and inside '"' # ShellCTestApp #%Var_EFCF356F_228C_47C2_AD0C_3B5DAC9A8CFA% #ShellCTestApp "#" ShellCTestApp %Sharp_E8528E46_A008_4221_8DE0_D5AB42A9C580% # # '%' should be processed before grouping parameters # ShellCTestApp "%Var_EFCF356F_228C_47C2_AD0C_3B5DAC9A8CFA% 2%Quote_E95DEE8B_E3AA_4155_9ED5_6916394104FC% # # alias should be processed after %% replacement # %Var_ShellCTestApp_EE6E8BC6_71A6_44A5_BED3_D8F901105CDE% # # '"' should be stripped, space inside '"' should be kept, # ShellCTestApp "p 1" ShellCTestApp "p"1 ShellCTestApp "p 1"e"x""" set -d Var_EFCF356F_228C_47C2_AD0C_3B5DAC9A8CFA set -d Sharp_E8528E46_A008_4221_8DE0_D5AB42A9C580 set -d Quote_E95DEE8B_E3AA_4155_9ED5_6916394104FC set -d Var_ShellCTestApp_EE6E8BC6_71A6_44A5_BED3_D8F901105CDE alias -d ShellCTestApp_EE6E8BC6_71A6_44A5_BED3_D8F901105CDE echo -off
NSIS
4
CEOALT1/RefindPlusUDK
ShellPkg/Application/ShellCTestApp/TestArgv.nsh
[ "BSD-2-Clause" ]
#%RAML 0.8 title: Kafka Web Console API version: 1.0 baseUri: http://{hostname}:{port} mediaType: application/json /zookeepers.json/{group}: get: /zookeepers.json: put: body: schema: !include zookeeper.json /zookeepers.json/{name}: delete: /topics.json: get: /topics.json/{topic}/{zookeeper}: get: /brokers.json: get: /consumergroups.json/{consumerGroup}/{topic}/{zookeeper}: get: /offsethistory.json/{consumerGroup}/{topic}/{zookeeper}: get: /settings.json: get: post: body: schema: !include settings.json
RAML
3
cfchou/try-kafka-web-console
public/api-console/kafka-web-console.raml
[ "Apache-2.0" ]
/* Copyright 2015 The TensorFlow Authors. All Rights Reserved. Licensed under the Apache License, Version 2.0 (the "License"); you may not use this file except in compliance with the License. You may obtain a copy of the License at http://www.apache.org/licenses/LICENSE-2.0 Unless required by applicable law or agreed to in writing, software distributed under the License is distributed on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the License for the specific language governing permissions and limitations under the License. ==============================================================================*/ #include <condition_variable> #include "tensorflow/core/platform/cpu_info.h" #include "tensorflow/core/platform/env_time.h" #include "tensorflow/core/platform/mem.h" #include "tensorflow/core/platform/mutex.h" #include "tensorflow/core/platform/test.h" #include "tensorflow/core/platform/threadpool.h" namespace tensorflow { namespace port { TEST(Port, AlignedMalloc) { for (size_t alignment = 1; alignment <= 1 << 20; alignment <<= 1) { void* p = AlignedMalloc(1, alignment); ASSERT_TRUE(p != nullptr) << "AlignedMalloc(1, " << alignment << ")"; uintptr_t pval = reinterpret_cast<uintptr_t>(p); EXPECT_EQ(pval % alignment, 0); AlignedFree(p); } } TEST(Port, GetCurrentCPU) { const int cpu = GetCurrentCPU(); #if !defined(__APPLE__) // GetCurrentCPU does not currently work on MacOS. EXPECT_GE(cpu, 0); EXPECT_LT(cpu, NumTotalCPUs()); #endif } TEST(ConditionVariable, WaitForMilliseconds_Timeout) { mutex m; mutex_lock l(m); condition_variable cv; ConditionResult result = kCond_MaybeNotified; time_t start = time(nullptr); // Condition variables are subject to spurious wakeups on some platforms, // so need to check for a timeout within a loop. while (result == kCond_MaybeNotified) { result = WaitForMilliseconds(&l, &cv, 3000); } EXPECT_EQ(result, kCond_Timeout); time_t finish = time(nullptr); EXPECT_GE(finish - start, 3); } TEST(ConditionVariable, WaitForMilliseconds_Signalled) { thread::ThreadPool pool(Env::Default(), "test", 1); mutex m; mutex_lock l(m); condition_variable cv; time_t start = time(nullptr); // Sleep for just 1 second then notify. We have a timeout of 3 secs, // so the condition variable will notice the cv signal before the timeout. pool.Schedule([&m, &cv]() { Env::Default()->SleepForMicroseconds(1 * 1000 * 1000); mutex_lock l(m); cv.notify_all(); }); EXPECT_EQ(WaitForMilliseconds(&l, &cv, 3000), kCond_MaybeNotified); time_t finish = time(nullptr); EXPECT_LT(finish - start, 3); } TEST(ConditionalCriticalSections, AwaitWithDeadline_Timeout) { bool always_false = false; mutex m; m.lock(); time_t start = time(nullptr); bool result = m.AwaitWithDeadline(Condition(&always_false), EnvTime::NowNanos() + 3 * EnvTime::kSecondsToNanos); time_t finish = time(nullptr); m.unlock(); EXPECT_EQ(result, false); EXPECT_GE(finish - start, 3); } TEST(ConditionalCriticalSections, AwaitWithDeadline_Woken) { thread::ThreadPool pool(Env::Default(), "test", 1); bool woken = false; mutex m; m.lock(); time_t start = time(nullptr); // Sleep for just 1 second then set the boolean. We have a timeout of 3 // secs, so the mutex implementation will notice the boolean state change // before the timeout. pool.Schedule([&m, &woken]() { Env::Default()->SleepForMicroseconds(1 * 1000 * 1000); m.lock(); woken = true; m.unlock(); }); bool result = m.AwaitWithDeadline( Condition(&woken), EnvTime::NowNanos() + 3 * EnvTime::kSecondsToNanos); time_t finish = time(nullptr); m.unlock(); EXPECT_EQ(result, true); EXPECT_LT(finish - start, 3); } // Return the negation of *b. Used as an Await() predicate. static bool Invert(bool* b) { return !*b; } // The Value() method inverts the value of the boolean specified in // the constructor. class InvertClass { public: explicit InvertClass(bool* value) : value_(value) {} bool Value() { return !*this->value_; } private: InvertClass(); bool* value_; }; TEST(ConditionalCriticalSections, Await_PingPong) { thread::ThreadPool pool(Env::Default(), "test", 1); bool ping_pong = false; bool done = false; mutex m; pool.Schedule([&m, &ping_pong, &done]() { m.lock(); for (int i = 0; i != 1000; i++) { m.Await(Condition(&ping_pong)); ping_pong = false; } done = true; m.unlock(); }); m.lock(); InvertClass invert(&ping_pong); for (int i = 0; i != 1000; i++) { m.Await(Condition(&Invert, &ping_pong)); ping_pong = true; } m.Await(Condition(&done)); m.unlock(); } TEST(ConditionalCriticalSections, Await_PingPongMethod) { thread::ThreadPool pool(Env::Default(), "test", 1); bool ping_pong = false; bool done = false; mutex m; pool.Schedule([&m, &ping_pong, &done]() { m.lock(); for (int i = 0; i != 1000; i++) { m.Await(Condition(&ping_pong)); ping_pong = false; } done = true; m.unlock(); }); m.lock(); InvertClass invert(&ping_pong); for (int i = 0; i != 1000; i++) { m.Await(Condition(&invert, &InvertClass::Value)); ping_pong = true; } m.Await(Condition(&done)); m.unlock(); } TEST(TestCPUFeature, TestFeature) { // We don't know what the result should be on this platform, so just make // sure it's callable. const bool has_avx = TestCPUFeature(CPUFeature::AVX); LOG(INFO) << "has_avx = " << has_avx; const bool has_avx2 = TestCPUFeature(CPUFeature::AVX2); LOG(INFO) << "has_avx2 = " << has_avx2; } } // namespace port } // namespace tensorflow
C++
4
yage99/tensorflow
tensorflow/core/platform/port_test.cc
[ "Apache-2.0" ]
package com.alibaba.json.bvt.issue_1200; import com.alibaba.fastjson.JSON; import com.alibaba.fastjson.annotation.JSONField; import junit.framework.TestCase; import java.io.Serializable; import java.util.List; /** * Created by wenshao on 01/07/2017. */ public class Issue1299 extends TestCase { public void test_for_issue() throws Exception { String jsonStr = "{\"code\":201,\"data\":{\"materials\":[{\"material\":\"locale\",\"success\":true," + "\"material_id\":356,\"id\":\"5099\"}],\"unitInfo\":{\"languages\":[\"'en_US'\",\"ru_RU\"]," + "\"unitName\":\"PC_ROCKBROS\",\"sceneKey\":\"shop_activity_page\",\"domain\":\"shopcdp.aliexpress" + ".com\",\"format\":\"HTML\",\"unitId\":\"1625\",\"id\":1761,\"rootPath\":\"shopcdp\"," + "\"userId\":\"jianqing.zengjq\",\"platforms\":[\"pc\",\"mobile\"],\"status\":2}},\"success\":true}"; UnitsSaveResponse response = JSON.parseObject(jsonStr, UnitsSaveResponse.class); Class<?> dataClass = response.getData().getClass(); System.out.println(dataClass); } public static class ServiceResult<T> extends BaseResultDo implements Serializable { @JSONField( name = "data" ) private T data; public ServiceResult() { } public T getData() { return this.data; } public void setData(T data) { this.data = data; } } public static class UnitsSaveResponse extends ServiceResult<UnitSave> { } public static class UnitSave implements Serializable { private SaveUnitInfo unitInfo; private List materials; public SaveUnitInfo getUnitInfo() { return unitInfo; } public void setUnitInfo(SaveUnitInfo unitInfo) { this.unitInfo = unitInfo; } public List getMaterials() { return materials; } public void setMaterials(List materials) { this.materials = materials; } } public static class SaveUnitInfo { } public static class BaseResultDo{ } }
Java
3
Czarek93/fastjson
src/test/java/com/alibaba/json/bvt/issue_1200/Issue1299.java
[ "Apache-2.0" ]
t ia2 -3a 1 1 0 1 t ia2 -ca enable t ia2 -adj ae t ia2 -ae on
AGS Script
0
waltersgrey/autoexechack
CA/1/autoexec.ash
[ "MIT" ]
<% from rllab.misc.mako_utils import compute_rect_vertices link_len = opts['link_len'] link_width = 0.1 %> <box2d> <world timestep="0.01" velitr="20" positr="20"> <body name="link1" type="dynamic" position="0,0"> <fixture density="5.0" group="-1" shape="polygon" vertices="${compute_rect_vertices([0,0], [0, -link_len], link_width/2)}" /> </body> <body name="link2" type="dynamic" position="0,${-link_len}"> <fixture density="5.0" group="-1" shape="polygon" vertices="${compute_rect_vertices([0,0], [0,-link_len], link_width/2)}" /> </body> <body name="track" type="static" position="0,-0.1"> <fixture group="-1" shape="polygon" box="100,0.1"/> </body> <joint type="revolute" name="link_joint_1" bodyA="track" bodyB="link1" anchor="0,0"/> <joint type="revolute" name="link_joint_2" bodyA="link1" bodyB="link2" anchor="0,${-link_len}"/> <!-- <control type="torque" joint="link_joint_1" ctrllimit="-3,3"/> --> <control type="torque" joint="link_joint_2" ctrllimit="-50,50" /> <state type="apos" body="link1" transform="sin"/> <state type="apos" body="link1" transform="cos"/> <state type="avel" body="link1"/> <state type="apos" body="link2" transform="sin"/> <state type="apos" body="link2" transform="cos"/> <state type="avel" body="link2"/> </world> </box2d>
Mako
3
RussellM2020/maml_gps
rllab/envs/box2d/models/double_pendulum.xml.mako
[ "MIT" ]
import ../Coro version(windows) { include windows CoroWin32: class extends Coro { fiber: Pointer parent: Pointer init: func initializeMainCoro: func { isMain = true if(GetCurrentFiber() == 0x1e00 as Pointer) { ConvertThreadToFiber(this) } fiber = GetCurrentFiber() } startCoro: func(other: Coro, callback: Func) { other setup(this, || callback() other switchTo(this) ) switchTo(other) } switchTo: func(next: Coro) { SwitchToFiber(next as This fiber) } yield: func { if(isMain) { raise("Scheduler error: yielded from main coro") } SwitchToFiber(parent) } setup: func(coro: Coro, callback: Func) { if(fiber != null && !isMain) { DeleteFiber(fiber) } fiber = CreateFiber(DEFAULT_STACK_SIZE, callback as Closure thunk, callback as Closure context) if(!fiber) { raise("Could not create fiber") } parent = coro as This fiber } // Freeing a main fiber results in exiting the thread it was executed in free: func { if(fiber) { DeleteFiber(fiber) } } } DeleteFiber: extern func(Pointer) SwitchToFiber: extern func(Pointer) CreateFiber: extern func(Int, Pointer, Pointer) -> Pointer GetCurrentFiber: extern func -> Pointer ConvertThreadToFiber: extern func(Pointer) }
ooc
4
fredrikbryntesson/launchtest
sdk/os/native/CoroWin32.ooc
[ "MIT" ]
package opal: import *; package random: import randint, uniform; new <Vector> RESOLUTION = Vector(1280, 720); new int FIREWORK_SIZE = 4, PARTICLE_SIZE = 2, MIN_PARTICLE_QTY = 80, MAX_PARTICLE_QTY = 120, LIFESPAN_DECREASE = 3, ALPHA_CHANGE = 25, ROCKET_FREQ_PERC = 10; new float PARTICLE_VELOCITY_MULTIPLIER = 0.98, PARTICLE_MAX_INIT_VELOCITY = 5, ROCKET_MAX_INIT_VELOCITY = 17, ROCKET_MIN_INIT_VELOCITY = 8; new bool RAINBOW_EXPLOSION = False; new <Vector> GRAVITY = Vector(0, 0.2); new <Graphics> graphics = Graphics(RESOLUTION, caption = "Fireworks"); new class Particle { new method __init__(pos, color = (255, 255, 255), exploder = False) { this.pos = pos; this.acceleration = Vector(); if exploder { this.velocity = Vector(uniform(-1, 1), uniform(-1, 1)); this.velocity *= uniform(1, PARTICLE_MAX_INIT_VELOCITY); } else { this.velocity = Vector(0, uniform(-ROCKET_MAX_INIT_VELOCITY, -ROCKET_MIN_INIT_VELOCITY)); } this.color = color; this.lifeSpan = 255; this.alive = True; this.exploder = exploder; } new method applyForce(f) { this.acceleration += f; } new method update() { if this.exploder { this.velocity *= PARTICLE_VELOCITY_MULTIPLIER; this.lifeSpan -= LIFESPAN_DECREASE; } this.velocity += this.acceleration; this.pos += this.velocity; this.acceleration *= 0; if this.pos.y >= RESOLUTION.y or this.pos.x < 0 or this.pos.x >= RESOLUTION.x { this.alive = False; } } new method isAlive() { return this.lifeSpan >= 0 and this.alive; } new method show() { if this.exploder { graphics.circle(this.pos, PARTICLE_SIZE, this.color, this.lifeSpan); } else { graphics.fastCircle(this.pos, FIREWORK_SIZE, this.color); } } } new class Explosion { new method __init__(pos, color = None) { this.pos = pos; if color is None { this.color = (randint(0, 255), randint(0, 255), randint(0, 255)); } else { this.color = color; } this.particles = []; } new method explode(pos = None) { if pos is not None { this.pos = pos; } if RAINBOW_EXPLOSION { repeat randint(MIN_PARTICLE_QTY, MAX_PARTICLE_QTY) { this.particles.append(Particle(this.pos, (randint(0, 255), randint(0, 255), randint(0, 255)), True)); } } else { repeat randint(MIN_PARTICLE_QTY, MAX_PARTICLE_QTY) { this.particles.append(Particle(this.pos, this.color, True)); } } } new method update() { for particle in this.particles { particle.applyForce(GRAVITY); particle.update(); } this.particles = [particle for particle in this.particles if particle.isAlive()]; } new method isAlive() { return len(this.particles) > 0; } new method show() { for particle in this.particles { particle.show(); } } } new class Firework { new method __init__(pos = None) { this.color = (randint(0, 255), randint(0, 255), randint(0, 255)); if pos is None { this.rocket = Particle(Vector(randint(0, RESOLUTION.x), RESOLUTION.y), this.color); } else { this.rocket = Particle(pos, this.color); } this.explosion = Explosion(this.rocket.pos, this.color); this.exploded = False; } new method update() { if not this.exploded { this.rocket.applyForce(GRAVITY); this.rocket.update(); if this.rocket.velocity.y >= 0 { this.exploded = True; this.explosion.explode(this.rocket.pos); } } if this.exploded { this.explosion.update(); } } new method isAlive() { return this.explosion.isAlive() or not this.exploded; } new method show() { if not this.exploded { this.rocket.show(); } else { this.explosion.show(); } } } new list fireworks = [], explosions = []; @graphics.event(MOUSEBUTTONDOWN); new function click(event) { global fireworks, explosions; match event.button { case 1 { fireworks.append(Firework(graphics.getMousePos())); } case 3 { explosions.append(Explosion(graphics.getMousePos())); explosions[-1].explode(); } } } @graphics.update; new function draw() { global fireworks, explosions; if randint(0, 100) < ROCKET_FREQ_PERC { fireworks.append(Firework()); } graphics.fillAlpha((0, 0, 0), ALPHA_CHANGE); for firework in fireworks { firework.update(); firework.show(); } for explosion in explosions { explosion.update(); explosion.show(); } fireworks = [ firework for firework in fireworks if firework.isAlive()]; explosions = [explosion for explosion in explosions if explosion.isAlive()]; } main { graphics.run(drawBackground = False); }
Opal
5
thatsOven/opal-lang
examples/fireworks.opal
[ "MIT" ]
Hi! I'm Jennifer Dewalt and I taught myself to code by making 180 websites in 180 days. You can check out the project at https://jenniferdewalt.com.
RDoc
1
nadiaschutz/jennifer_dewalt
README.rdoc
[ "MIT" ]
package com.baeldung.di.aspectj; import org.springframework.stereotype.Service; @Service public class IdService { private static int count; int generateId() { return ++count; } }
Java
3
DBatOWL/tutorials
spring-di-2/src/main/java/com/baeldung/di/aspectj/IdService.java
[ "MIT" ]
// Whitney music box in one line - by Nathaniel Virgo play{mean({|i|99**(-1-LFSaw.kr(i+1/180,1))*SinOsc.ar(i+1*55)}!48)!2} // Explanations by Jim B: // {|i| i.postln; }!10; // basic iterator // Envelope generation: // {LFSaw.kr(2,1)}.plot(1); // produces ascending ramp from -1 to 1 // {-1 - LFSaw.kr(2,1)}.plot(1); // produces descending ramp from 0 - -2 // {99**(-1-LFSaw.kr(2,1))}.plot(1); // Produces a nice envelope from 1 to 0 at the desired rate // 99 ** 0 is 1 99 ** -2 is a small value // mean() is used to mix all the signals so we don't have to explicitly sent amplitude to 1/n // !2 is for the stereo channels
SuperCollider
4
Haroenv/Whitney-Music-Box-Examples
supercollider/whitney_oneliner.scd
[ "AAL" ]
server { server_name homestead.app; root /var/www/default; index index.php; client_max_body_size 100M; fastcgi_read_timeout 1800; location / { try_files $uri $uri/ /index.php; } location ~* \.(js|css|png|jpg|jpeg|gif|ico)$ { expires max; log_not_found off; access_log off; } sendfile off; location ~ \.php$ { try_files $uri =404; include fastcgi_params; fastcgi_index index.php; fastcgi_param SCRIPT_FILENAME $document_root$fastcgi_script_name; #fastcgi_pass unix:/var/run/php5-fpm.sock; #UNCOMMENT TO USING PHP-FPM fastcgi_pass unix:/var/run/hhvm/hhvm.sock; #UNCOMMENT TO USING HHVM fastcgi_intercept_errors off; fastcgi_buffer_size 16k; fastcgi_buffers 4 16k; fastcgi_connect_timeout 300; fastcgi_send_timeout 300; fastcgi_read_timeout 300; } }
ApacheConf
4
tanlinhnd/docker-fullstack-php
sites/homestead.app.vhost
[ "MIT" ]
def each_line1(file) File.read_lines(file).each_with_index do |line, index0| yield line, index0 + 1 end end repo_base_dir = "#{__DIR__}/../../" tmp_build_dir = File.join(repo_base_dir, ".build") Dir.mkdir_p(tmp_build_dir) input = ARGV[0] bin = File.join(tmp_build_dir, "debug_test_case") debugger_script = File.join(tmp_build_dir, "./debugger.script") Process.run(ENV["CRYSTAL_SPEC_COMPILER_BIN"]? || "#{repo_base_dir}/bin/crystal", ["build", "--debug", input, "-o", bin]) File.open(debugger_script, "w") do |script| lldb_crystal_formatters = File.expand_path(File.join(repo_base_dir, "etc", "lldb", "crystal_formatters.py")) script.puts "version" script.puts "command script import #{lldb_crystal_formatters}" each_line1(input) do |line, line_number| if line.match(/# break\b/) script.puts "breakpoint set --file #{input} --line #{line_number}" end end script.puts "run" each_line1(input) do |line| if md = line.match(/# lldb-command: (.*)/) script.puts md[1] end end end session_output_dir = File.join(repo_base_dir, "tmp", "debug") Dir.mkdir_p(session_output_dir) session_log = File.join(session_output_dir, File.basename(input, File.extname(input)) + ".lldb-session") session_assert = File.join(session_output_dir, File.basename(input, File.extname(input)) + ".lldb-assert") File.open(session_assert, "w") do |assert| each_line1(input) do |line| if md = line.match(/# lldb-command: (.*)/) assert.puts "CHECK: (lldb) #{md[1]}" elsif md = line.match(/# lldb-check: (.*)/) assert.puts "CHECK-NEXT: #{md[1]}" end end end `/usr/bin/lldb -b --source #{debugger_script} #{bin} > #{session_log}` `FileCheck #{session_assert} < #{session_log}` exit $?.exit_code
Crystal
3
jessedoyle/crystal
spec/debug/driver.cr
[ "Apache-2.0" ]
<%= "evaluated string" %>
Gosu
0
tcmoore32/sheer-madness
gosu-test/src/test/gosu/gw/internal/gosu/template/NoArgEval.gst
[ "Apache-2.0" ]
Button { background-color: transparent; border-color: transparent; border-width: 1; text-transform: capitalize; android-elevation: 0; android-dynamic-elevation-offset: 0; padding: 0; margin: 0; } .component-label{ margin-left: 12; min-width: 100; } .component-select-fix{ padding-top: 6; text-align: right; vertical-align: middle; padding-right: 8; } .header{ font-size: 20px; font-weight: bold; } .code-text-view-fix{ font-size: 15px; } .go-back{ font-family: "ns-playground-font"; font-size: 30; color: #3350ff; } .header-label{ padding-top: 8%; padding-left: 40%; font-size: 20px; color: black; } .components-header-label{ padding-top: 8%; text-align: center; font-size: 20px; color: black; } .components-link{ color: #3350ff; font-size: 20px; padding-top: 8%; margin-left: -25px; } .navigation-bar{ background-color: #f4f4f5; height: 5%; max-height: 3; } .navigation-bar-components{ background-color: #f4f4f5; height: 8%; } .segmented-bar{ background-color: #f4f4f5; padding-bottom: 10% } .custom-segmented-bar-root-fix{ padding-top: 15%; } .custom-segmented-bar-border-fix{ border-radius: 15px; border-width: 5px; } .selected-segment{ color: #f4f4f5; padding-top: 5%; background-color: #3350ff; text-align: center; } .unselected-segment{ color: #3350ff; padding-top: 5%; background-color: #f4f4f5; text-align: center; } .action-item-details{ color: #007aff; font-size: 20px; padding-right: 15; } .listview-separator{ margin-left: 66; background-color: #949494; height: 1px; } .icon-around{ background-color: #3350ff; height: 42; width: 42; border-radius: 3; vertical-align: middle; text-align: center; } .list-view-row{ padding: 6 0 6 12; } .list-group{ background-color: white; padding-top: 6; }
CSS
3
tralves/NativeScript
apps/toolbox/src/app-platform.android.css
[ "Apache-2.0" ]
.non-selectable user-select: none !important .scroll overflow: auto .scroll, .scroll-x, .scroll-y -webkit-overflow-scrolling: touch will-change: scroll-position .scroll-x overflow-x: auto .scroll-y overflow-y: auto .no-scroll overflow: hidden !important .no-pointer-events, .no-pointer-events--children, .no-pointer-events--children * pointer-events: none !important .all-pointer-events pointer-events: all !important .cursor &-pointer cursor: pointer !important &-not-allowed cursor: not-allowed !important &-inherit cursor: inherit !important &-none cursor: none !important [aria-busy='true'] cursor: progress [aria-controls] cursor: pointer [aria-disabled] cursor: default
Sass
3
ygyg70/quasar
ui/src/css/core/mouse.sass
[ "MIT" ]
<cfcomponent> <cffunction name="myFunction" hint="My function"> <cftry> <!--- do something ---> <cfcatch type="any"> <cfreturn "Error: #CFCATCH.Message#"> </cfcatch> </cftry> <cfreturn "Success"> </cffunction> <cfcomponent>
ColdFusion CFC
4
tonym128/CFLint
src/test/resources/com/cflint/tests/GlobalVarChecker/cfcatch_tag.cfc
[ "BSD-3-Clause" ]
# This is a decimal. <s> <p> -123.0 .
Turtle
0
joshrose/audacity
lib-src/lv2/serd/tests/TurtleTests/turtle-syntax-number-06.ttl
[ "CC-BY-3.0" ]
i 00001 00 010 2000 00 011 0000 i 00002 00 27 00013 00 010 2000 i 00003 00 011 2000 00 012 2000 i 00004 00 27 00013 00 010 2001 i 00005 00 011 2001 00 012 2001 i 00006 00 27 00013 00 010 2001 i 00007 00 011 2002 00 27 00013 i 00010 00 010 2001 00 015 2002 i 00011 00 012 2000 00 27 00013 i 00012 06 33 12345 00 22 00000 i 00013 02 33 76543 00 22 00000 d 02000 7777 7777 7777 7777 d 02001 5252 5252 5252 5252 d 02002 2525 2525 2525 2525
Octave
1
besm6/mesm6
test/aax_aox_aex/aax_aox_aex.oct
[ "MIT" ]
diff --git a/include/git2/cert.h b/include/git2/cert.h index e8cd2d180..54293cd31 100644 --- a/include/git2/cert.h +++ b/include/git2/cert.h @@ -111,6 +111,14 @@ typedef struct { * have the SHA-256 hash of the hostkey. */ unsigned char hash_sha256[32]; + + /** + * Hostkey itself. + */ + int hostkey_type; + size_t hostkey_len; + unsigned char hostkey[1024]; + } git_cert_hostkey; /** diff --git a/src/transports/ssh.c b/src/transports/ssh.c index f4ed05bb1..ec6366a5f 100644 --- a/src/transports/ssh.c +++ b/src/transports/ssh.c @@ -523,6 +523,7 @@ static int _git_ssh_setup_conn( git_credential *cred = NULL; LIBSSH2_SESSION* session=NULL; LIBSSH2_CHANNEL* channel=NULL; + char *host_and_port; t->current_stream = NULL; @@ -566,6 +567,12 @@ post_extract: cert.parent.cert_type = GIT_CERT_HOSTKEY_LIBSSH2; + key = libssh2_session_hostkey(session, &cert.hostkey_len, &cert.hostkey_type); + bzero(&cert.hostkey, sizeof(cert.hostkey)); + if (cert.hostkey_len > sizeof(cert.hostkey)) + cert.hostkey_len = sizeof(cert.hostkey); + memcpy(&cert.hostkey, key, cert.hostkey_len); + #ifdef LIBSSH2_HOSTKEY_HASH_SHA256 key = libssh2_hostkey_hash(session, LIBSSH2_HOSTKEY_HASH_SHA256); if (key != NULL) { @@ -597,7 +604,15 @@ post_extract: cert_ptr = &cert; - error = t->owner->certificate_check_cb((git_cert *) cert_ptr, 0, urldata.host, t->owner->message_cb_payload); + if (atoi(urldata.port) == SSH_DEFAULT_PORT) { + host_and_port = urldata.host; + } else { + size_t n = strlen(urldata.host) + strlen(urldata.port) + 2; + host_and_port = alloca(n); + sprintf(host_and_port, "%s:%s", urldata.host, urldata.port); + } + + error = t->owner->certificate_check_cb((git_cert *) cert_ptr, 0, host_and_port, t->owner->message_cb_payload); if (error < 0 && error != GIT_PASSTHROUGH) { if (!git_error_last())
Diff
3
jonas-schulze/julia
deps/patches/libgit2-hostkey.patch
[ "MIT" ]
#[warn(clippy::double_neg)] #[allow(clippy::no_effect)] fn main() { let x = 1; -x; -(-x); --x; }
Rust
1
ohno418/rust
src/tools/clippy/tests/ui/double_neg.rs
[ "ECL-2.0", "Apache-2.0", "MIT-0", "MIT" ]
tell application "Finder" if not (exists window 1) then make new Finder window set target of front window to path to home folder as string end if activate end tell
AppleScript
3
FedorZaytsev/MTMR
MTMR/AppleScripts/Finder.scpt
[ "MIT" ]
#world { line-width: 2; line-color: #024; }
CartoCSS
0
nimix/carto
test/rendering/issue_394.mss
[ "Apache-2.0" ]
<GameProjectFile> <PropertyGroup Type="Node" Name="BagItem" ID="fcd1fab6-83ff-4cfc-84f4-2d8df7a5f1ce" Version="2.0.0.0" /> <Content ctype="GameProjectContent"> <Content> <Animation Duration="0" Speed="1" /> <ObjectData Name="Node" CanEdit="False" ctype="SingleNodeObjectData"> <Position X="0" Y="0" /> <Scale ScaleX="1" ScaleY="1" /> <AnchorPoint /> <CColor A="255" R="255" G="255" B="255" /> <Size X="0" Y="0" /> <PrePosition X="0" Y="0" /> <PreSize X="0" Y="0" /> <Children> <NodeObjectData Name="Sprite_1" ActionTag="1045408199" Tag="61" ObjectIndex="1" ctype="SpriteObjectData"> <Position X="0" Y="0" /> <Scale ScaleX="1" ScaleY="1" /> <AnchorPoint /> <CColor A="255" R="255" G="255" B="255" /> <Size X="105" Y="131" /> <PrePosition X="0" Y="0" /> <PreSize X="0" Y="0" /> <FileData Type="Normal" Path="Inventory/rolebg.png" /> </NodeObjectData> <NodeObjectData Name="Sprite_2" ActionTag="1045408200" Tag="62" ObjectIndex="2" ctype="SpriteObjectData"> <Position X="57.35335" Y="62.94159" /> <Scale ScaleX="1" ScaleY="1" /> <AnchorPoint ScaleX="0.5" ScaleY="0.5" /> <CColor A="255" R="255" G="255" B="255" /> <Size X="112" Y="72" /> <PrePosition X="0" Y="0" /> <PreSize X="0" Y="0" /> <FileData Type="Normal" Path="Inventory/ic_egyviper_blue.png" /> </NodeObjectData> <NodeObjectData Name="Sprite_3" ActionTag="1045408201" Tag="63" ObjectIndex="3" ctype="SpriteObjectData"> <Position X="45.5882" Y="24.70599" /> <Scale ScaleX="1" ScaleY="1" /> <AnchorPoint ScaleX="0.5" ScaleY="0.5" /> <CColor A="255" R="255" G="255" B="255" /> <Size X="23" Y="25" /> <PrePosition X="0" Y="0" /> <PreSize X="0" Y="0" /> <FileData Type="PlistSubImage" Path="fx_starshining_cell-xingxing.png" Plist="MissionSelect/fx_starshining.plist" /> </NodeObjectData> <NodeObjectData Name="Sprite_3_Copy" ActionTag="1045408202" Tag="64" ObjectIndex="4" ctype="SpriteObjectData"> <Position X="56.56863" Y="24.70599" /> <Scale ScaleX="1" ScaleY="1" /> <AnchorPoint ScaleX="0.5" ScaleY="0.5" /> <CColor A="255" R="255" G="255" B="255" /> <Size X="23" Y="25" /> <PrePosition X="0" Y="0" /> <PreSize X="0" Y="0" /> <FileData Type="PlistSubImage" Path="fx_starshining_cell-xingxing.png" Plist="MissionSelect/fx_starshining.plist" /> </NodeObjectData> <NodeObjectData Name="Sprite_3_Copy_Copy" ActionTag="1045408203" Tag="65" ObjectIndex="5" ctype="SpriteObjectData"> <Position X="67.54906" Y="24.70599" /> <Scale ScaleX="1" ScaleY="1" /> <AnchorPoint ScaleX="0.5" ScaleY="0.5" /> <CColor A="255" R="255" G="255" B="255" /> <Size X="23" Y="25" /> <PrePosition X="0" Y="0" /> <PreSize X="0" Y="0" /> <FileData Type="PlistSubImage" Path="fx_starshining_cell-xingxing.png" Plist="MissionSelect/fx_starshining.plist" /> </NodeObjectData> <NodeObjectData Name="Sprite_3_Copy_Copy_0" ActionTag="1045408204" Tag="66" ObjectIndex="6" ctype="SpriteObjectData"> <Position X="78.5295" Y="24.70599" /> <Scale ScaleX="1" ScaleY="1" /> <AnchorPoint ScaleX="0.5" ScaleY="0.5" /> <CColor A="255" R="255" G="255" B="255" /> <Size X="23" Y="25" /> <PrePosition X="0" Y="0" /> <PreSize X="0" Y="0" /> <FileData Type="PlistSubImage" Path="fx_starshining_cell-xingxing.png" Plist="MissionSelect/fx_starshining.plist" /> </NodeObjectData> </Children> </ObjectData> </Content> </Content> </GameProjectFile>
Csound
3
chukong/CocosStudioSamples
DemoMicroCardGame/CocosStudioResources/cocosstudio/InventoryItem.csd
[ "MIT" ]
// run-pass #![feature(generic_const_exprs)] #![allow(incomplete_features)] struct Foo<const B: bool>; fn test<const N: usize>() -> Foo<{ !(N > 10) }> where Foo<{ !(N > 10) }>: Sized { Foo } fn main() { let _: Foo<false> = test::<12>(); let _: Foo<true> = test::<9>(); }
Rust
3
mbc-git/rust
src/test/ui/const-generics/generic_const_exprs/unop.rs
[ "ECL-2.0", "Apache-2.0", "MIT-0", "MIT" ]
-module(bif1). %% Other set of warnings due to removed of functions from %% erl_bif_types. -export([ets_rename/0, string_chars/0]). ets_rename() -> A = ets:new(fipp, []), true = not is_atom(A), ets:rename(A, fopp). % No warning string_chars() -> L2 = bif1_adt:opaque_string(), S = $A, string:chars(S, 10, L2). % Warning
Erlang
3
jjhoo/otp
lib/dialyzer/test/small_SUITE_data/src/bif1/bif1.erl
[ "Apache-2.0" ]
- dashboard: error_overivew title: Error Overivew layout: newspaper elements: - name: Top Assumed User Types title: Top Assumed User Types model: aws_athena_cloudtrail explore: cloudtrail_logs type: looker_column fields: - cloudtrail_logs.total_errors - cloudtrail_logs.assumed_user_name filters: sorts: - cloudtrail_logs.total_errors desc limit: 10 column_limit: 50 stacking: '' show_value_labels: false label_density: 25 legend_position: center x_axis_gridlines: false y_axis_gridlines: true show_view_names: false limit_displayed_rows: false y_axis_combined: true show_y_axis_labels: true show_y_axis_ticks: true y_axis_tick_density: default y_axis_tick_density_custom: 5 show_x_axis_label: true show_x_axis_ticks: true x_axis_scale: auto y_axis_scale_mode: linear ordering: none show_null_labels: false show_totals_labels: false show_silhouette: false totals_color: "#808080" series_colors: cloudtrail_logs.total_errors: "#1f3e5a" x_axis_label_rotation: -30 colors: - 'palette: Looker Classic' series_types: errors_as_a_percent_of_events: line hidden_series: [] y_axes: - label: '' maxValue: minValue: orientation: left showLabels: true showValues: true tickDensity: default tickDensityCustom: 5 type: linear unpinAxis: false valueFormat: series: - id: errors_as_a_percent_of_events name: Errors as a Percent of Events __FILE: aws_athena_cloudtrail/error_overview.dashboard.lookml __LINE_NUM: 180 __FILE: aws_athena_cloudtrail/error_overview.dashboard.lookml __LINE_NUM: 168 - label: maxValue: minValue: orientation: right showLabels: true showValues: true tickDensity: default tickDensityCustom: 5 type: linear unpinAxis: false valueFormat: series: - id: total_errors name: Total Errors __FILE: aws_athena_cloudtrail/error_overview.dashboard.lookml __LINE_NUM: 194 __FILE: aws_athena_cloudtrail/error_overview.dashboard.lookml __LINE_NUM: 182 listen: Date: cloudtrail_logs.event_time_date row: 8 col: 15 width: 9 height: 7 - name: Errors by User Type title: Errors by User Type model: aws_athena_cloudtrail explore: cloudtrail_logs type: looker_pie fields: - cloudtrail_logs.total_errors - cloudtrail_logs.user_type filters: sorts: - cloudtrail_logs.total_errors desc limit: 10 column_limit: 50 value_labels: legend label_type: labPer stacking: '' show_value_labels: false label_density: 25 legend_position: center x_axis_gridlines: false y_axis_gridlines: true show_view_names: true limit_displayed_rows: false y_axis_combined: true show_y_axis_labels: true show_y_axis_ticks: true y_axis_tick_density: default y_axis_tick_density_custom: 5 show_x_axis_label: true show_x_axis_ticks: true x_axis_scale: auto y_axis_scale_mode: linear ordering: none show_null_labels: false show_totals_labels: false show_silhouette: false totals_color: "#808080" show_row_numbers: true truncate_column_names: false hide_totals: false hide_row_totals: false table_theme: gray enable_conditional_formatting: false conditional_formatting_ignored_fields: [] conditional_formatting_include_totals: false conditional_formatting_include_nulls: false series_types: {} series_colors: cloudtrail_logs.total_errors: "#1f3e5a" AssumedRole: "#1f3e5a" x_axis_label_rotation: -30 inner_radius: 45 listen: Date: cloudtrail_logs.event_time_date row: 8 col: 0 width: 9 height: 7 - name: Errors by Source title: Errors by Source model: aws_athena_cloudtrail explore: cloudtrail_logs type: table fields: - cloudtrail_logs.total_errors - cloudtrail_logs.event_source filters: cloudtrail_logs.total_errors: ">0" sorts: - cloudtrail_logs.total_errors desc limit: 500 column_limit: 50 show_view_names: true show_row_numbers: true truncate_column_names: false hide_totals: false hide_row_totals: false table_theme: gray limit_displayed_rows: false enable_conditional_formatting: false conditional_formatting_ignored_fields: [] conditional_formatting_include_totals: false conditional_formatting_include_nulls: false stacking: '' show_value_labels: false label_density: 25 legend_position: center x_axis_gridlines: false y_axis_gridlines: true y_axis_combined: true show_y_axis_labels: true show_y_axis_ticks: true y_axis_tick_density: default y_axis_tick_density_custom: 5 show_x_axis_label: true show_x_axis_ticks: true x_axis_scale: auto y_axis_scale_mode: linear ordering: none show_null_labels: false show_totals_labels: false show_silhouette: false totals_color: "#808080" series_types: {} listen: Date: cloudtrail_logs.event_time_date row: 8 col: 9 width: 6 height: 7 - name: Errors and Events Over Time title: Errors and Events Over Time model: aws_athena_cloudtrail explore: cloudtrail_logs type: looker_column fields: - cloudtrail_logs.errors_percent_events - cloudtrail_logs.total_errors - cloudtrail_logs.count - cloudtrail_logs.event_time_minute30 fill_fields: - cloudtrail_logs.event_time_minute30 sorts: - cloudtrail_logs.event_time_minute30 limit: 500 column_limit: 50 query_timezone: America/Los_Angeles stacking: '' show_value_labels: false label_density: 25 legend_position: center x_axis_gridlines: false y_axis_gridlines: true show_view_names: false limit_displayed_rows: false y_axis_combined: true show_y_axis_labels: true show_y_axis_ticks: true y_axis_tick_density: default y_axis_tick_density_custom: 5 show_x_axis_label: true show_x_axis_ticks: true x_axis_scale: auto y_axis_scale_mode: linear ordering: none show_null_labels: false show_totals_labels: false show_silhouette: false totals_color: "#808080" show_row_numbers: true truncate_column_names: false hide_totals: false hide_row_totals: false table_theme: editable enable_conditional_formatting: false conditional_formatting_ignored_fields: [] conditional_formatting_include_totals: false conditional_formatting_include_nulls: false show_null_points: true point_style: none interpolation: linear series_types: errors_as_a_percent_of_events: line cloudtrail_logs.errors_percent_events: line series_colors: errors_as_a_percent_of_events: "#a9c574" total_errors: "#1f3e5a" cloudtrail_logs.total_errors: "#1f3e5a" cloudtrail_logs.errors_percent_events: "#a9c574" cloudtrail_logs.count: "#1f3e5a" hidden_fields: - cloudtrail_logs.total_errors y_axes: - label: maxValue: minValue: orientation: left showLabels: true showValues: true tickDensity: default tickDensityCustom: type: linear unpinAxis: false valueFormat: series: - id: cloudtrail_logs.errors_percent_events name: Errors As A Percent Of Events __FILE: aws_athena_cloudtrail/error_overview.dashboard.lookml __LINE_NUM: 280 __FILE: aws_athena_cloudtrail/error_overview.dashboard.lookml __LINE_NUM: 268 - label: maxValue: minValue: orientation: right showLabels: true showValues: true tickDensity: default tickDensityCustom: type: linear unpinAxis: false valueFormat: series: - id: cloudtrail_logs.count name: Total Events __FILE: aws_athena_cloudtrail/error_overview.dashboard.lookml __LINE_NUM: 294 __FILE: aws_athena_cloudtrail/error_overview.dashboard.lookml __LINE_NUM: 282 hidden_series: [] colors: - 'palette: Looker Classic' listen: Date: cloudtrail_logs.event_time_date row: 0 col: 0 width: 24 height: 8 - name: Top Events with Errors title: Top Events with Errors model: aws_athena_cloudtrail explore: cloudtrail_logs type: looker_bar fields: - cloudtrail_logs.count - cloudtrail_logs.event_name filters: cloudtrail_logs.errorcode: "-NULL" cloudtrail_logs.errormessage: "-NULL" sorts: - cloudtrail_logs.count desc limit: 10 column_limit: 50 stacking: '' show_value_labels: false label_density: 25 legend_position: center x_axis_gridlines: false y_axis_gridlines: true show_view_names: false limit_displayed_rows: false y_axis_combined: true show_y_axis_labels: true show_y_axis_ticks: true y_axis_tick_density: default y_axis_tick_density_custom: 5 show_x_axis_label: true show_x_axis_ticks: true x_axis_scale: auto y_axis_scale_mode: linear ordering: none show_null_labels: false show_totals_labels: false show_silhouette: false totals_color: "#808080" label: Top AWS Event Errors show_row_numbers: true truncate_column_names: false hide_totals: false hide_row_totals: false table_theme: gray enable_conditional_formatting: false conditional_formatting_ignored_fields: [] conditional_formatting_include_totals: false conditional_formatting_include_nulls: false series_types: {} series_colors: cloudtrail_logs.count: "#1f3e5a" x_axis_label_rotation: -45 listen: Date: cloudtrail_logs.event_time_date row: 15 col: 0 width: 12 height: 10 - name: Top Error Codes title: Top Error Codes model: aws_athena_cloudtrail explore: cloudtrail_logs type: looker_bar fields: - cloudtrail_logs.count - cloudtrail_logs.errorcode filters: cloudtrail_logs.errorcode: "-NULL" cloudtrail_logs.errormessage: "-NULL" sorts: - cloudtrail_logs.count desc limit: 10 column_limit: 50 stacking: '' show_value_labels: false label_density: 25 legend_position: center x_axis_gridlines: false y_axis_gridlines: true show_view_names: false limit_displayed_rows: false y_axis_combined: true show_y_axis_labels: true show_y_axis_ticks: true y_axis_tick_density: default y_axis_tick_density_custom: 5 show_x_axis_label: true show_x_axis_ticks: true x_axis_scale: auto y_axis_scale_mode: linear ordering: none show_null_labels: false show_totals_labels: false show_silhouette: false totals_color: "#808080" label: Top AWS Event Errors show_row_numbers: true truncate_column_names: false hide_totals: false hide_row_totals: false table_theme: gray enable_conditional_formatting: false conditional_formatting_ignored_fields: [] conditional_formatting_include_totals: false conditional_formatting_include_nulls: false series_types: {} series_colors: cloudtrail_logs.count: "#1f3e5a" x_axis_label_rotation: -45 listen: Date: cloudtrail_logs.event_time_date row: 15 col: 12 width: 12 height: 10 - name: Assumed IAM User Errors (Full Detail) title: Assumed IAM User Errors (Full Detail) model: aws_athena_cloudtrail explore: cloudtrail_logs type: table fields: - cloudtrail_logs.assumed_user_name - cloudtrail_logs.event_name - cloudtrail_logs.errorcode - cloudtrail_logs.errormessage - cloudtrail_logs.count - cloudtrail_logs.event_source filters: cloudtrail_logs.errorcode: "-NULL" cloudtrail_logs.count: ">1" sorts: - cloudtrail_logs.count desc limit: 500 column_limit: 50 label: Top AWS Event Errors show_view_names: false show_row_numbers: true truncate_column_names: false hide_totals: false hide_row_totals: false table_theme: gray limit_displayed_rows: false enable_conditional_formatting: false conditional_formatting_ignored_fields: [] conditional_formatting_include_totals: false conditional_formatting_include_nulls: false listen: Date: cloudtrail_logs.event_time_date row: 25 col: 0 width: 24 height: 8 filters: - name: Date title: Date type: date_filter default_value: 48 hours model: explore: field: listens_to_filters: [] allow_multiple_values: true
LookML
4
voltagebots/aws_cloudtrail_block
error_overview.dashboard.lookml
[ "MIT" ]
<%= render(SharedView, "_drift_js.html") %> <article class="sponsor_story"> <div class="sponsor_story-content richtext"> <h1>Podcast sponsorship styles</h1> <h3>Endorsement</h3> <p>This is our most popular ad style and is read by a member of our ad team. We will take care of all the creative writing based on the goals and strategy we set with you. We can focus on different aspects of the service, a big promotion, an upcoming event you're hosting — or work together to come up with ideas on how to direct people to your current marketing goals and funnels. We like to get creative!</p> <h3>Insider Story</h3> <p>Talking to someone inside your company really helps to humanize who you are and allows you tell the developer world who you are in your own words. This prodution is created by having our ad team speak with someone inside your company — an engineer, developer, support, design — really anyone who can speak to the product or service, the work they do, and how that might help the listener to learn more and why they should give it a try. The call to record the initial conversation is around 20-40 minutes.</p> <h3>Customer Story / Endorsement</h3> <p>Customer stories are powerful and we are experts at getting your customers talking and sharing details that get the listeners attention. This is a chance to have a future customer hear from one of their peers on why they choose your product or service and why it works for them. This is also a great example of social proof.</p> <p>This prodution is created by having our ad team speak with one of your customers or users. The person we speak with should be well spoken and can be anyone that is in charge of decisions or someone who's directly impacted by the product or service. The call to record the initial conversation is around 20-40 minutes.</p> <h3>Team Culture / Hiring</h3> <p>We're helping engineering teams to tell their story and attract the best talent. We'll work closely with you to determine what the developer community needs to know about your teams and point them in the right direction to learn more and take the first step.</p> <hr> </div> <div class="sponsor_story-examples"> <h3>Sponsorship Examples</h3> <div class="grid_table"> <div class="grid_table-header"> <div class="grid_table-header-column"><p>Campaign type</p></div> <div class="grid_table-header-column"><p>Campaign name</p></div> <div class="grid_table-header-column"><p>Campaign production</p></div> </div> <%= for example <- Changelog.SponsorStyle.all() do %> <div class="grid_table-row"> <div class="grid_table-row-column"><p><%= example.type %></p></div> <div class="grid_table-row-column"><p><%= example.name %></p></div> <div class="grid_table-row-column"> <%= render(SharedView, "_mini_player.html", title: example.name, audio: example.audio, duration: example.duration) %> </div> </div> <% end %> </div> </div> </article>
HTML+EEX
3
PsOverflow/changelog.com
lib/changelog_web/templates/page/sponsor_styles.html.eex
[ "MIT" ]
const std = @import("std"); pub fn main() anyerror!void { std.log.info("All your codebase are belong to us.", .{}); } test "basic test" { try std.testing.expectEqual(10, 3 + 7); }
Zig
3
lukekras/zig
lib/std/special/init-exe/src/main.zig
[ "MIT" ]
require "spec" describe "GC" do it "compiles GC.stats" do typeof(GC.stats).should eq(GC::Stats) end it "raises if calling enable when not disabled" do expect_raises(Exception, "GC is not disabled") do GC.enable end end end
Crystal
3
n00p3/crystal
spec/std/gc_spec.cr
[ "Apache-2.0" ]
module.exports (terms) = moduleTerm = terms.term { constructor (statements, global: false, returnLastStatement: false, bodyStatements: nil) = self.statements = statements self.isModule = true self.global = global self.bodyStatements = (bodyStatements || statements) generateModule () = scope = new (terms.SymbolScope (nil)) self.code ( self.statements.generateStatements (scope, global: self.global, inClosure: true) ) } module (statements, inScope: true, global: false, returnLastStatement: false, bodyStatements: bodyStatements) = if (returnLastStatement) statements.rewriteLastStatementToReturn (async: false) if (inScope) scope = terms.closure ([], statements, returnLastStatement: returnLastStatement, redefinesSelf: true, definesModuleConstants: true) args = [terms.variable (['this'])] methodCall = terms.methodCall (terms.subExpression (scope), ['call'], args) call = if (statements.isAsync) methodCall else methodCall moduleTerm (terms.statements [call], bodyStatements: statements, global: global) else moduleTerm (statements, global: global, returnLastStatement: returnLastStatement, bodyStatements: bodyStatements)
PogoScript
4
Sotrek/Alexa
Alexa_Cookbook/Workshop/StatePop/4_IOT/tests/node_modules/aws-sdk/node_modules/cucumber/node_modules/pogo/lib/terms/module.pogo
[ "MIT" ]
DROP TABLE IF EXISTS `t_user`; CREATE TABLE `t_user` ( `id` int(11) NOT NULL AUTO_INCREMENT COMMENT '主键', `username` varchar(32) NOT NULL COMMENT '用户名', `password` varchar(32) NOT NULL COMMENT '加密后的密码', `salt` varchar(32) NOT NULL COMMENT '加密使用的盐', `email` varchar(32) NOT NULL COMMENT '邮箱', `phone_number` varchar(15) NOT NULL COMMENT '手机号码', `status` int(2) NOT NULL DEFAULT '1' COMMENT '状态,-1:逻辑删除,0:禁用,1:启用', `create_time` datetime NOT NULL DEFAULT CURRENT_TIMESTAMP COMMENT '创建时间', `last_login_time` datetime DEFAULT NULL COMMENT '上次登录时间', `last_update_time` datetime NOT NULL DEFAULT CURRENT_TIMESTAMP COMMENT '上次更新时间', PRIMARY KEY (`id`), UNIQUE KEY `username` (`username`), UNIQUE KEY `email` (`email`), UNIQUE KEY `phone_number` (`phone_number`) ) ENGINE=InnoDB AUTO_INCREMENT=3 DEFAULT CHARSET=utf8 COMMENT='1.0-用户表';
SQL
4
zcy2095/spring-boot-demo
demo-flyway/src/main/resources/db/migration/V1_0__INIT.sql
[ "MIT" ]
(* Count Messages in All Mailboxes Copyright 2002-2012 Apple Inc. All rights reserved. You may incorporate this Apple sample code into your program(s) without restriction. This Apple sample code has been provided "AS IS" and the responsibility for its operation is yours. You are not permitted to redistribute this Apple sample code as "Apple sample code" after having made changes. If you're going to redistribute the code, we require that you make it clear that the code was descended from Apple sample code, but that you've made changes. *) (* This script goes through each mailbox, gets the total message count and the unread count, then displays the final output in a new email message. *) tell application "Mail" set localMailboxes to every mailbox if (count of localMailboxes) is greater than 0 then set messageCountDisplay to "Local mailboxes (On My Mac)" & return & my getMessageCountsForMailboxes(localMailboxes) else set messageCountDisplay to "" end if set everyAccount to every account repeat with eachAccount in everyAccount set accountMailboxes to every mailbox of eachAccount if (count of accountMailboxes) is greater than 0 then set messageCountDisplay to messageCountDisplay & return & "Mailboxes for Account: " & name of eachAccount & return & my getMessageCountsForMailboxes(accountMailboxes) end if end repeat set outputMessage to make new outgoing message with properties {content:messageCountDisplay, subject:"Message counts for all my mailboxes", visible:true} tell outputMessage set font to "Courier" set size to 12 end tell end tell on getMessageCountsForMailboxes(theMailboxes) -- (list of mailboxes) -- returns string set displayString to "" tell application "Mail" repeat with eachMailbox in theMailboxes set mailboxName to name of eachMailbox set messageCount to (count of (messages of eachMailbox)) as string set unreadCount to unread count of eachMailbox as string set displayString to displayString & " " & my padString(mailboxName, 40) & " " & messageCount & " (" & unreadCount & " unread)" & return end repeat end tell return displayString end getMessageCountsForMailboxes on padString(theString, fieldLength) -- (string, integer) -- returns string set stringLength to length of theString if stringLength is greater than fieldLength then set paddedString to (text from character 1 to character (fieldLength - 3) of theString) & "..." else -- stringLength is less than or equal to fieldLength set paddedString to theString set paddingLength to fieldLength - stringLength repeat paddingLength times set paddedString to paddedString & space end repeat end if return paddedString end padString
AppleScript
5
JavascriptID/sourcerer-app
src/test/resources/samples/langs/AppleScript/Count Messages in All Mailboxes.applescript
[ "MIT" ]
package com.baeldung.propertyeditor; import org.springframework.boot.SpringApplication; import org.springframework.boot.autoconfigure.SpringBootApplication; @SpringBootApplication public class PropertyEditorApplication { public static void main(String[] args) { SpringApplication.run(PropertyEditorApplication.class, args); } }
Java
3
zeesh49/tutorials
spring-rest/src/main/java/com/baeldung/propertyeditor/PropertyEditorApplication.java
[ "MIT" ]
/* The characters 'ı' and 'ſ' have lengths 2 */; /* but their upper case 'I' and 'S" have length 1 */; /* Code that relies on indices extracted from ToUpper will fail on this table*/; CREATE TABLE `ı` ( `ſ` varchar(5) NOT NULL ) ENGINE=InnoDB;
SQL
3
imtbkcat/tidb-lightning
lightning/mydump/examples/mocker_test.i-schema.sql
[ "Apache-2.0" ]
fs=${1%.fs} # let's *not* delete this directory; it's okay if previously-downloaded # excess packages hang around in case we need them later. #rm -rf "$fs" mkdir -p "$fs" redo-ifchange debootstrap.options debootstrap \ --download-only \ --keep-debootstrap-dir \ $(cat debootstrap.options) \ "$fs" >&2 redo-ifchange "$fs/debootstrap/debootstrap.log"
Stata
4
BlameJohnny/redo
docs/cookbook/container/debdownload.fs.do
[ "Apache-2.0" ]
/*M/////////////////////////////////////////////////////////////////////////////////////// // // IMPORTANT: READ BEFORE DOWNLOADING, COPYING, INSTALLING OR USING. // // By downloading, copying, installing or using the software you agree to this license. // If you do not agree to this license, do not download, install, // copy or use the software. // // // License Agreement // For Open Source Computer Vision Library // // Copyright (C) 2018 Ya-Chiu Wu, all rights reserved. // Third party copyrights are property of their respective owners. // // @Authors // Ya-Chiu Wu, yacwu@cs.nctu.edu.tw // // Redistribution and use in source and binary forms, with or without modification, // are permitted provided that the following conditions are met: // // * Redistribution's of source code must retain the above copyright notice, // this list of conditions and the following disclaimer. // // * Redistribution's in binary form must reproduce the above copyright notice, // this list of conditions and the following disclaimer in the documentation // and/or other materials provided with the distribution. // // * The name of the copyright holders may not be used to endorse or promote products // derived from this software without specific prior written permission. // // This software is provided by the copyright holders and contributors "as is" and // any express or implied warranties, including, but not limited to, the implied // warranties of merchantability and fitness for a particular purpose are disclaimed. // In no event shall the Intel Corporation or contributors be liable for any direct, // indirect, incidental, special, exemplary, or consequential damages // (including, but not limited to, procurement of substitute goods or services; // loss of use, data, or profits; or business interruption) however caused // and on any theory of liability, whether in contract, strict liability, // or tort (including negligence or otherwise) arising in any way out of // the use of this software, even if advised of the possibility of such damage. // //M*/ #if CN==1 #define T_MEAN float #define F_ZERO (0.0f) #define frameToMean(a, b) (b) = *(a); #define meanToFrame(a, b) *b = convert_uchar_sat(a); #else #define T_MEAN float4 #define F_ZERO (0.0f, 0.0f, 0.0f, 0.0f) #define meanToFrame(a, b)\ b[0] = convert_uchar_sat(a.x); \ b[1] = convert_uchar_sat(a.y); \ b[2] = convert_uchar_sat(a.z); #define frameToMean(a, b)\ b.x = a[0]; \ b.y = a[1]; \ b.z = a[2]; \ b.w = 0.0f; #endif __kernel void knn_kernel(__global const uchar* frame, int frame_step, int frame_offset, int frame_row, int frame_col, __global const uchar* nNextLongUpdate, __global const uchar* nNextMidUpdate, __global const uchar* nNextShortUpdate, __global uchar* aModelIndexLong, __global uchar* aModelIndexMid, __global uchar* aModelIndexShort, __global uchar* flag, __global uchar* sample, __global uchar* fgmask, int fgmask_step, int fgmask_offset, int nLongCounter, int nMidCounter, int nShortCounter, float c_Tb, int c_nkNN, float c_tau #ifdef SHADOW_DETECT , uchar c_shadowVal #endif ) { int x = get_global_id(0); int y = get_global_id(1); if( x < frame_col && y < frame_row) { __global const uchar* _frame = (frame + mad24(y, frame_step, mad24(x, CN, frame_offset))); T_MEAN pix; frameToMean(_frame, pix); uchar foreground = 255; // 0 - the pixel classified as background int Pbf = 0; int Pb = 0; uchar include = 0; int pt_idx = mad24(y, frame_col, x); int idx_step = frame_row * frame_col; __global T_MEAN* _sample = (__global T_MEAN*)(sample); for (uchar n = 0; n < (NSAMPLES) * 3 ; ++n) { int n_idx = mad24(n, idx_step, pt_idx); T_MEAN c_mean = _sample[n_idx]; uchar c_flag = flag[n_idx]; T_MEAN diff = c_mean - pix; float dist2 = dot(diff, diff); if (dist2 < c_Tb) { Pbf++; if (c_flag) { Pb++; if (Pb >= c_nkNN) { include = 1; foreground = 0; break; } } } } if (Pbf >= c_nkNN) { include = 1; } #ifdef SHADOW_DETECT if (foreground) { int Ps = 0; for (uchar n = 0; n < (NSAMPLES) * 3 ; ++n) { int n_idx = mad24(n, idx_step, pt_idx); uchar c_flag = flag[n_idx]; if (c_flag) { T_MEAN c_mean = _sample[n_idx]; float numerator = dot(pix, c_mean); float denominator = dot(c_mean, c_mean); if (denominator == 0) break; if (numerator <= denominator && numerator >= c_tau * denominator) { float a = numerator / denominator; T_MEAN dD = mad(a, c_mean, -pix); if (dot(dD, dD) < c_Tb * a * a) { Ps++; if (Ps >= c_nkNN) { foreground = c_shadowVal; break; } } } } } } #endif __global uchar* _fgmask = fgmask + mad24(y, fgmask_step, x + fgmask_offset); *_fgmask = (uchar)foreground; __global const uchar* _nNextLongUpdate = nNextLongUpdate + pt_idx; __global const uchar* _nNextMidUpdate = nNextMidUpdate + pt_idx; __global const uchar* _nNextShortUpdate = nNextShortUpdate + pt_idx; __global uchar* _aModelIndexLong = aModelIndexLong + pt_idx; __global uchar* _aModelIndexMid = aModelIndexMid + pt_idx; __global uchar* _aModelIndexShort = aModelIndexShort + pt_idx; uchar nextLongUpdate = _nNextLongUpdate[0]; uchar nextMidUpdate = _nNextMidUpdate[0]; uchar nextShortUpdate = _nNextShortUpdate[0]; uchar modelIndexLong = _aModelIndexLong[0]; uchar modelIndexMid = _aModelIndexMid[0]; uchar modelIndexShort = _aModelIndexShort[0]; int offsetLong = mad24(mad24(2, (NSAMPLES), modelIndexLong), idx_step, pt_idx); int offsetMid = mad24((NSAMPLES)+modelIndexMid, idx_step, pt_idx); int offsetShort = mad24(modelIndexShort, idx_step, pt_idx); if (nextLongUpdate == nLongCounter) { _sample[offsetLong] = _sample[offsetMid]; flag[offsetLong] = flag[offsetMid]; _aModelIndexLong[0] = (modelIndexLong >= ((NSAMPLES)-1)) ? 0 : (modelIndexLong + 1); } if (nextMidUpdate == nMidCounter) { _sample[offsetMid] = _sample[offsetShort]; flag[offsetMid] = flag[offsetShort]; _aModelIndexMid[0] = (modelIndexMid >= ((NSAMPLES)-1)) ? 0 : (modelIndexMid + 1); } if (nextShortUpdate == nShortCounter) { _sample[offsetShort] = pix; flag[offsetShort] = include; _aModelIndexShort[0] = (modelIndexShort >= ((NSAMPLES)-1)) ? 0 : (modelIndexShort + 1); } } } __kernel void getBackgroundImage2_kernel(__global const uchar* flag, __global const uchar* sample, __global uchar* dst, int dst_step, int dst_offset, int dst_row, int dst_col) { int x = get_global_id(0); int y = get_global_id(1); if(x < dst_col && y < dst_row) { int pt_idx = mad24(y, dst_col, x); T_MEAN meanVal = (T_MEAN)F_ZERO; __global T_MEAN* _sample = (__global T_MEAN*)(sample); int idx_step = dst_row * dst_col; for (uchar n = 0; n < (NSAMPLES) * 3 ; ++n) { int n_idx = mad24(n, idx_step, pt_idx); uchar c_flag = flag[n_idx]; if(c_flag) { meanVal = _sample[n_idx]; break; } } __global uchar* _dst = dst + mad24(y, dst_step, mad24(x, CN, dst_offset)); meanToFrame(meanVal, _dst); } }
OpenCL
4
thisisgopalmandal/opencv
modules/video/src/opencl/bgfg_knn.cl
[ "BSD-3-Clause" ]
D:/gitee/open/tinyriscv/tests/riscv-compliance/build_generated/rv32i/I-ECALL-01.elf: file format elf32-littleriscv Disassembly of section .text.init: 00000000 <_start>: 0: 04c0006f j 4c <reset_vector> 00000004 <trap_vector>: 4: 34202f73 csrr t5,mcause 8: 00800f93 li t6,8 c: 03ff0a63 beq t5,t6,40 <write_tohost> 10: 00900f93 li t6,9 14: 03ff0663 beq t5,t6,40 <write_tohost> 18: 00b00f93 li t6,11 1c: 03ff0263 beq t5,t6,40 <write_tohost> 20: 00000f17 auipc t5,0x0 24: fe0f0f13 addi t5,t5,-32 # 0 <_start> 28: 000f0463 beqz t5,30 <trap_vector+0x2c> 2c: 000f0067 jr t5 30: 34202f73 csrr t5,mcause 34: 000f5463 bgez t5,3c <handle_exception> 38: 0040006f j 3c <handle_exception> 0000003c <handle_exception>: 3c: 5391e193 ori gp,gp,1337 00000040 <write_tohost>: 40: 00001f17 auipc t5,0x1 44: fc3f2023 sw gp,-64(t5) # 1000 <tohost> 48: ff9ff06f j 40 <write_tohost> 0000004c <reset_vector>: 4c: 00000193 li gp,0 50: 00000297 auipc t0,0x0 54: fb428293 addi t0,t0,-76 # 4 <trap_vector> 58: 30529073 csrw mtvec,t0 5c: 30005073 csrwi mstatus,0 60: 00000297 auipc t0,0x0 64: 02028293 addi t0,t0,32 # 80 <begin_testcode> 68: 34129073 csrw mepc,t0 6c: 00000293 li t0,0 70: 10000337 lui t1,0x10000 74: 01030313 addi t1,t1,16 # 10000010 <_end+0xfffde0c> 78: 00532023 sw t0,0(t1) 7c: 30200073 mret 00000080 <begin_testcode>: 80: 00000097 auipc ra,0x0 84: 02c08093 addi ra,ra,44 # ac <_trap_handler> 88: 30509ff3 csrrw t6,mtvec,ra 8c: 00002097 auipc ra,0x2 90: f7408093 addi ra,ra,-140 # 2000 <begin_signature> 94: 11111137 lui sp,0x11111 98: 11110113 addi sp,sp,273 # 11111111 <_end+0x1110ef0d> 9c: 00000073 ecall a0: 0000a023 sw zero,0(ra) a4: 305f9073 csrw mtvec,t6 a8: 0280006f j d0 <test_end> 000000ac <_trap_handler>: ac: 34102f73 csrr t5,mepc b0: 004f0f13 addi t5,t5,4 b4: 341f1073 csrw mepc,t5 b8: 34202f73 csrr t5,mcause bc: 01e0a023 sw t5,0(ra) c0: 0020a223 sw sp,4(ra) c4: 0000a423 sw zero,8(ra) c8: 00c08093 addi ra,ra,12 cc: 30200073 mret 000000d0 <test_end>: d0: 00002297 auipc t0,0x2 d4: f3028293 addi t0,t0,-208 # 2000 <begin_signature> d8: 10000337 lui t1,0x10000 dc: 00830313 addi t1,t1,8 # 10000008 <_end+0xfffde04> e0: 00532023 sw t0,0(t1) e4: 00002297 auipc t0,0x2 e8: f2c28293 addi t0,t0,-212 # 2010 <end_signature> ec: 10000337 lui t1,0x10000 f0: 00c30313 addi t1,t1,12 # 1000000c <_end+0xfffde08> f4: 00532023 sw t0,0(t1) f8: 00100293 li t0,1 fc: 10000337 lui t1,0x10000 100: 01030313 addi t1,t1,16 # 10000010 <_end+0xfffde0c> 104: 00532023 sw t0,0(t1) 108: 00000013 nop 10c: 00100193 li gp,1 110: 00000073 ecall 00000114 <end_testcode>: 114: c0001073 unimp ... Disassembly of section .tohost: 00001000 <tohost>: ... 00001100 <fromhost>: ... Disassembly of section .data: 00002000 <begin_signature>: 2000: ffff 0xffff 2002: ffff 0xffff 2004: ffff 0xffff 2006: ffff 0xffff 2008: ffff 0xffff 200a: ffff 0xffff 200c: ffff 0xffff 200e: ffff 0xffff 00002010 <end_signature>: ... 00002100 <begin_regstate>: 2100: 0080 addi s0,sp,64 ... 00002200 <end_regstate>: 2200: 0004 0x4 ...
ObjDump
3
DuBirdFly/TinyRISCV_Learn
tests/riscv-compliance/build_generated/rv32i/I-ECALL-01.elf.objdump
[ "Apache-2.0" ]
a:after { content: '\invalid' }
CSS
0
vjpr/swc
css/parser/tests/fixture/esbuild/misc/Q_wA-fPw3o2m3R7gyWNxbQ/input.css
[ "Apache-2.0", "MIT" ]
POST /upload HTTP/1.1 Host: localhost:8080 Content-Type: multipart/form-data; boundary=----TLV0SrKD4z1TRxRhAPUvZ Content-Length: 31 ------TLV0SrKD4z1TRxRhAPUvZ--
HTTP
2
xifeiwu/node-formidable
test/fixture/http/misc/empty-multipart2.http
[ "MIT" ]
# Package 'sri24-atlas' is not installed, so not removed # Package 'libatlas-cpp-0.6-0-dev' is not installed, so not removed # Package 'libatlas.so.3gf' is not installed, so not removed # Package 'matlab-dev' is not installed, so not removed # Package 'matlab-spm8' is not installed, so not removed # Package 'fsl-atlases' is not installed, so not removed # Package 'libatlas3gf-sse' is not installed, so not removed # Package 'libatlas3gf-sse2' is not installed, so not removed # Package 'libatlas3gf-3dnow' is not installed, so not removed # Package 'libatlas-sse-dev' is not installed, so not removed # Package 'libatlas-sse2-dev' is not installed, so not removed # Package 'libatlas-3dnow-dev' is not installed, so not removed # Package 'matlab' is not installed, so not removed # Package 'gtkatlantic' is not installed, so not removed # Package 'libatlas-cpp-0.6-1' is not installed, so not removed # Package 'libatlas-cpp-0.6-1-dbg' is not installed, so not removed # Package 'libatlas-cpp-0.6-dev' # # # This file provides configuration information about non-Python dependencies for # numpy.distutils-using packages. Create a file like this called "site.cfg" next # to your package's setup.py file and fill in the appropriate sections. Not all # packages will use all sections so you should leave out sections that your # package does not use. # To assist automatic installation like easy_install, the user's home directory # will also be checked for the file ~/.numpy-site.cfg . # The format of the file is that of the standard library's ConfigParser module. # # http://www.python.org/doc/current/lib/module-ConfigParser.html # # Each section defines settings that apply to one particular dependency. Some of # the settings are general and apply to nearly any section and are defined here. # Settings specific to a particular section will be defined near their section. # # libraries # Comma-separated list of library names to add to compile the extension # with. Note that these should be just the names, not the filenames. For # example, the file "libfoo.so" would become simply "foo". # libraries = lapack,f77blas,cblas,atlas # # library_dirs # List of directories to add to the library search path when compiling # extensions with this dependency. Use the character given by os.pathsep # to separate the items in the list. Note that this character is known to # vary on some unix-like systems; if a colon does not work, try a comma. # This also applies to include_dirs and src_dirs (see below). # On UN*X-type systems (OS X, most BSD and Linux systems): # library_dirs = /usr/lib:/usr/local/lib # On Windows: # library_dirs = c:\mingw\lib,c:\atlas\lib # On some BSD and Linux systems: # library_dirs = /usr/lib,/usr/local/lib # # include_dirs # List of directories to add to the header file earch path. # include_dirs = /usr/include:/usr/local/include # # src_dirs # List of directories that contain extracted source code for the # dependency. For some dependenciPackage 'sri24-atlas' is not installed, so not removed Package 'libatlas-cpp-0.6-0-dev' is not installed, so not removed Package 'libatlas.so.3gf' is not installed, so not removed Package 'matlab-dev' is not installed, so not removed Package 'matlab-spm8' is not installed, so not removed Package 'fsl-atlases' is not installed, so not removed Package 'libatlas3gf-sse' is not installed, so not removed Package 'libatlas3gf-sse2' is not installed, so not removed Package 'libatlas3gf-3dnow' is not installed, so not removed Package 'libatlas-sse-dev' is not installed, so not removed Package 'libatlas-sse2-dev' is not installed, so not removed Package 'libatlas-3dnow-dev' is not installed, so not removed Package 'matlab' is not installed, so not removed Package 'gtkatlantic' is not installed, so not removed Package 'libatlas-cpp-0.6-1' is not installed, so not removed Package 'libatlas-cpp-0.6-1-dbg' is not installed, so not removed Package 'libatlas-cpp-0.6-dev' es, numpy.distutils will be able to build # them from source if binaries cannot be found. The FORTRAN BLAS and # LAPACK libraries are one example. However, most dependencies are more # complicated and require actual installation that you need to do # yourself. # src_dirs = /home/rkern/src/BLAS_SRC:/home/rkern/src/LAPACK_SRC # # search_static_first # Boolean (one of (0, false, no, off) for False or (1, true, yes, on) for # True) to tell numpy.distutils to prefer static libraries (.a) over # shared libraries (.so). It is turned off by default. # search_static_first = false # Defaults # ======== # The settings given here will apply to all other sections if not overridden. # This is a good place to add general library and include directories like # /usr/local/{lib,include} # [DEFAULT] library_dirs = /usr/local/atlas/lib include_dirs = /usr/local/atlas/include [atlas] search_static_first = true libraries = lapack,ptf77blas,ptcblas,atlas,satlas,tatlas,atlas,cblas,f77blas,lapack,ptf77blas,ptcblas library_dirs = /usr/local/atlas/lib include_dirs = /usr/local/atlas/include # OpenBLAS # -------- # OpenBLAS is another open source optimized implementation of BLAS and Lapack # and can be seen as an alternative to Atlas. To build numpy against OpenBLAS # instead of Atlas, use this section instead of the above, adjusting as needed # for your configuration (in the following example we installed OpenBLAS with # ``make install PREFIX=/opt/OpenBLAS``. # # **Warning**: OpenBLAS, by default, is built in multithreaded mode. Due to the # way Python's multiprocessing is implemented, a multithreaded OpenBLAS can # cause programs using both to hang as soon as a worker process is forked on # POSIX systems (Linux, Mac). # This is fixed in Openblas 0.2.9 for the pthread build, the OpenMP build using # GNU openmp is as of gcc-4.9 not fixed yet. # Python 3.4 will introduce a new feature in multiprocessing, called the # "forkserver", which solves this problem. For older versions, make sure # OpenBLAS is built using pthreads or use Python threads instead of # multiprocessing. # (This problem does not exist with multithreaded ATLAS.) # # http://docs.python.org/3.4/library/multiprocessing.html#contexts-and-start-methods # https://github.com/xianyi/OpenBLAS/issues/294 # #[openblas] #search_static_first = false #libraries = openblas #library_dirs = /opt/openblas/lib #include_dirs = /opt/openblas/include # # MKL #---- # MKL is Intel's very optimized yet proprietary implementation of BLAS and # Lapack. # For recent (9.0.21, for example) mkl, you need to change the names of the # lapack library. Assuming you installed the mkl in /opt, for a 32 bits cpu: # [mkl] # library_dirs = /opt/intel/mkl/9.1.023/lib/32/ # lapack_libs = mkl_lapack # # For 10.*, on 32 bits machines: #[mkl] #library_dirs = /opt/intel/mkl/lib/intel64 #include_dirs = /opt/intel/mkl/include #lapack_libs = mkl_lapack #blas_libs = mkl_blas95, mkl_blas #mkl_libs = mkl # UMFPACK # ------- # The UMFPACK library is used in scikits.umfpack to factor large sparse matrices. # It, in turn, depends on the AMD library for reordering the matrices for # better performance. Note that the AMD library has nothing to do with AMD # (Advanced Micro Devices), the CPU company. # # UMFPACK is not used by numpy. # # http://www.cise.ufl.edu/research/sparse/umfpack/ # http://www.cise.ufl.edu/research/sparse/amd/ # http://scikits.appspot.com/umfpack # #[amd] #amd_libs = amd # #[umfpack] #umfpack_libs = umfpack # FFT libraries # ------------- # There are two FFT libraries that we can configure here: FFTW (2 and 3) and djbfft. # Note that these libraries are not used by for numpy or scipy. # # http://fftw.org/ # http://cr.yp.to/djbfft.html # # Given only this section, numpy.distutils will try to figure out which version # of FFTW you are using. #[fftw] #libraries = fftw3 # # For djbfft, numpy.distutils will look for either djbfft.a or libdjbfft.a . #[djbfft] #include_dirs = /usr/local/djbfft/include #library_dirs = /usr/local/djbfft/lib
NumPy
4
JoeSuber/OpenCV-Max-Build-Package-
vital.config/site.cfg.numpy
[ "Intel" ]
Complete the :pep:`654` implementation: add ``except*``.
reStructuredText
5
lostbeta/cpython
Misc/NEWS.d/next/Core and Builtins/2021-11-22-13-05-32.bpo-45292.pfEouJ.rst
[ "0BSD" ]
--- title: "rgdal - vector tutorial" author: "Paulo Arevalo" date: "January 25, 2016" output: html_document --- ##Objectives The objective of this tutorial is to show some basic functionality of the rgdal package to deal with vector data in R. This tutorial assumes that GDAL is properly installed in the system. For options depending on which OS you are using, you can check [here](https://trac.osgeo.org/gdal/wiki/DownloadingGdalBinaries) ##Installing and loading the library The package can be installled and loaded using the following commands. Note that the CRAN mirror is used as an example, but you might want to change it depending on your location. ```{r, message=FALSE} #install.packages("rgdal", repos='http://cran.us.r-project.org') library(rgdal) ``` ##Loading an example dataset and obtaining information This layer contains polygons with multiple land cover classes. They could be used as training data for land cover classification. We can use the following commands to download the file from Github: ```{r} if (file.exists('training_data.shp') == F) { download.file(url = 'https://raw.githubusercontent.com/parevalo/EF_Activities/master/rgdal-vector_tutorial_shp.zip', destfile = 'rgdal-vector_tutorial_shp.zip', method = 'auto') unzip('rgdal-vector_tutorial_shp.zip') } ``` In order to read the dataset, we use the `readOGR` function. ```{r} training <- readOGR('training_data.shp', layer='training_data') ``` The function `summary` shows detailed information about the object we just read into R: ```{r} summary(training) ``` The file has three fields, corresponding to "id" (sequential number), "class" (which is numerical, for now) and "Comment", which is a string field. You can also see the extent coordinates and the spatial projection. If we only want to see information contained in the attribute table we could use: ```{r} head(training@data) ``` We can also see the overall structure of the file, if we need to use other information from it: ```{r} str(training, max.level = 2) ``` ##Modifying data We can alter the attribute table almost the same way we would with a regular dataframe: ```{r} lut <- data.frame(classes=c(1,2,3,4,5,6), labels=c("Forest", "Grasslands", "Shrublands", "Croplands", "Secondary", "Water")) training@data$label <- lut$labels[match(training@data$Class,lut$classes)] head(training@data) ``` In this case we created a new column, and assign it the string values using a lookup table. ## Reprojection We can use the function `spTransform` in order to reproject our shapefile to a different coordinate system. In our case, we can reproject from a plane cordinate system to a geographic (lat-long) coordinate system ```{r} training@proj4string # We check the proj. system training_wgs84 <- spTransform(training, CRS("+proj=longlat +datum=WGS84")) # Reprojection training_wgs84@proj4string # We check the proj. system again ``` ## Plotting Plotting is very simple, we can use the `plot` command, and color the polygons according to the class they belong to: ```{r} plot(training, col=unique(training@data$Class)) ``` We could manually modify the fill color and other graphic properties using additional options in the plot function. We can also plot the file along with other datasets, such as a raster stack. In order to do that, we will download an example raster and then we will do the plotting on top of it. These two files are in the same projection, but reprojection would be needed otherwise. ```{r} library(raster) if (file.exists('LE70070592003004_clip.tif') == F) { download.file(url='https://www.dropbox.com/s/odoeqge9277io6i/LE70070592003004_clip.tif?dl=1', destfile='LE70070592003004_clip.tif', method='auto', mode='wb') } example_raster <- brick('LE70070592003004_clip.tif') plotRGB(example_raster, stretch="lin") plot(training, col=unique(training@data$Class), add=T) ``` ## Conversion between formats Conversion to another file format (e.g. KML) is done using the function `writeOGR`: ```{r} writeOGR(training_wgs84, dsn = "training_wgs84.kml", layer = "training_wgs84", driver = "KML") ```
RMarkdown
5
klreinl/EF_Course
tutorials/rgdal-vector_tutorial.rmd
[ "MIT" ]
⍝ Standard way to calculate the Euclidean distance ⍝ (As the sqrt of the sum of the square difference) euclidean_distance ← { (+/(⍺ - ⍵) * 2) * ÷ 2 } ⍝ Using the Euclidean Norm to calculate the distance. ⍝ Since the distance between 2 Points is only the length of the difference. euclidean_distance_via_norm ← { euclidean_norm ⍺ - ⍵ } ⍝ This function is only used in one calculation of the euclidean distance ⍝ You can find it here: https://github.com/kennyledet/Algorithm-Implementations/blob/master/Euclidean_Norm/APL/jcla1/euclidean_norm.apl euclidean_norm ← { (+/⍵ × ⍵) * ÷ 2 }
APL
4
Mynogs/Algorithm-Implementations
Euclidean_distance/APL/jcla1/euclidean_distance.apl
[ "MIT" ]
size: 2048px 1024px; dpi: 240; limit-x: 1404278100 1404299700; axes { label-format-left: scientific(); title-left: "Value"; title-font-size-left: 14pt; label-format-right: scientific(); title-right: "Value"; title-rotate-right: 90; title-font-size-right: 14pt; label-format-top: datetime("%H:%M"); title-top: "Time"; title-font-size-top: 14pt; label-format-bottom: datetime("%H:%M"); title-bottom: "Time"; title-font-size-bottom: 14pt; } lines { data-x: csv("test/testdata/measurement.csv" time); data-y: csv("test/testdata/measurement.csv" value1); }
CLIPS
3
asmuth-archive/travistest
test/examples/charts_custom_axis_titles.clp
[ "Apache-2.0" ]
/*--------------------------------------------------------------------------------------------- * Copyright (c) Microsoft Corporation. All rights reserved. * Licensed under the MIT License. See License.txt in the project root for license information. *--------------------------------------------------------------------------------------------*/ declare module 'vscode' { // https://github.com/microsoft/vscode/issues/145307 export interface Extension<T> { /** * `true` when the extension is associated to another extension host. * * *Note* that an extension from another extension host cannot export * API, e.g {@link Extension.exports its exports} are always `undefined`. */ readonly isFromDifferentExtensionHost: boolean; } export namespace extensions { /** * Get an extension by its full identifier in the form of: `publisher.name`. * * @param extensionId An extension identifier. * @param includeDifferentExtensionHosts Include extensions from different extension host * @return An extension or `undefined`. */ export function getExtension<T = any>(extensionId: string, includeDifferentExtensionHosts: boolean): Extension<T> | undefined; /** * All extensions across all extension hosts. * * @see {@link Extension.isFromDifferentExtensionHost} */ export const allAcrossExtensionHosts: readonly Extension<void>[]; } }
TypeScript
4
w0lramD/vscode
src/vscode-dts/vscode.proposed.extensionsAny.d.ts
[ "MIT" ]
<div class="capability-element"> <h4 class="capability-title">{{ c-title }}</h4> <div class="capability-copy">{{ c-copy }}</div> </div>
Liquid
1
noahcb/lit
website/src/_includes/partials/capability-element.liquid
[ "Apache-2.0" ]
package { import GZ.Gfx.Shape; import GZ.Gfx.Object; import GZ.File.RcImg; public class GpuObject { public function GpuObject( ):Void; public function fIniRender():Void; public function fFinishRender():Void; public function fDraw( _oSource : Object, _nX_Start : Int, _nX_End : Int, _nY_Start : Int, _nY_End : Int):Void; static public function fLoadImg(_aImg : CArray<Int, 1>, _nWidth : Int, _nHeight : Int):UInt32; } }
Redcode
4
VLiance/GZE
src/SubLib_System/Lib_GzWeb_Emsc/WebGL/Sys/GpuObj/GpuObject.cw
[ "Apache-2.0" ]
import "m2" as x; def f: 42 | x::g;
JSONiq
1
Abhibob/gojq
cli/testdata/m1/m1.jq
[ "MIT" ]
module openconfig-sampling-sflow { yang-version "1"; // namespace namespace "http://openconfig.net/yang/sampling/sflow"; prefix "oc-sflow"; // import some basic types import openconfig-extensions { prefix oc-ext; } import openconfig-inet-types { prefix oc-inet; } import openconfig-interfaces { prefix oc-if; } import openconfig-yang-types { prefix oc-yang; } import openconfig-network-instance { prefix oc-netinst; } // meta organization "OpenConfig working group"; contact "OpenConfig working group www.openconfig.net"; description "This module defines configuration and operational state data related to data plane traffic sampling based on sFlow. RFC 3176 - InMon Corporation's sFlow: A Method for Monitoring Traffic in Switched and Routed Networks"; oc-ext:openconfig-version "0.1.0"; revision "2020-06-26" { description "Initial revision"; reference "0.1.0"; } grouping sflow-interfaces-config { description "Configuration data for sFlow data on interfaces."; leaf name { type oc-if:base-interface-ref; description "Reference to the interface for sFlow configuration and state."; } leaf enabled { type boolean; description "Enables or disables sFlow on the interface. If sFlow is globally disabled, this leaf is ignored. If sFlow is globally enabled, this leaf may be used to disable it for a specific interface."; } leaf sampling-rate { type uint32; description "If sFlow is enabled on the interface, this leaf may be used to override the global sampling rate for a specific interface. The sampling rate semantics are the same as the system-wide leaf."; } } grouping sflow-interfaces-state { description "Operational state data for sFlow data on interfaces"; leaf packets-sampled { type oc-yang:counter64; description "Total number of packets sampled from the interface."; } } grouping sflow-interfaces-top { description "Top-level grouping for sFlow data on an interface."; container interfaces { description "Enclosing container for list of sFlow interfaces."; list interface { key "name"; description "List of interfaces with sFlow data."; leaf name { type leafref { path "../config/name"; } description "Reference to list key."; } container config { description "Configuration data for sFlow data on interfaces."; uses sflow-interfaces-config; } container state { config false; description "Operational state data for sFlow data on interfaces."; uses sflow-interfaces-config; uses sflow-interfaces-state; } } } } grouping sflow-collectors-config { description "Configuration data for sFlow collectors."; leaf address { type oc-inet:ip-address; description "IP address of the sFlow collector."; } leaf port { type oc-inet:port-number; default 6343; description "UDP port number for the sFlow collector."; } leaf network-instance { type oc-netinst:network-instance-ref; description "Reference to the network instance used to reach the sFlow collector. If uspecified, the collector destination is reachable in the default network instance."; } } grouping sflow-collectors-state { description "Operational state data for sFlow collectors."; leaf packets-sent { type oc-yang:counter64; description "The total number of packets sampled and sent to the collector."; } } grouping sflow-collectors-top { description "Top-level grouping for data related to sFlow collectors."; container collectors { description "Enclosing container for list of sFlow collectors."; list collector { key "address port"; description "List of sFlow collectors to send sampling data. Packet samples are sent to all collectors specified."; leaf address { type leafref { path "../config/address"; } description "Reference to address list key."; } leaf port { type leafref { path "../config/port"; } description "Reference to port list key."; } container config { description "Configuration data for sFlow collectors."; uses sflow-collectors-config; } container state { config false; description "Operational state data for sFlow collectors."; uses sflow-collectors-config; uses sflow-collectors-state; } } } } grouping sflow-global-config { description "Configuration data for global sflow"; leaf enabled { type boolean; default false; description "Enables or disables sFlow sampling for the device."; } leaf source-address { type oc-inet:ip-address; description "Sets the source IP address for sFlow datagrams sent to sFlow collectors."; } leaf sampling-rate { type uint32; description "Sets the global packet sampling rate. The rate is is expressed as an integer N, where the intended sampling rate is 1/N packets. An implementation may implement the sampling rate as a statistical average, rather than a strict periodic sampling. The allowable sampling rate range is generally a property of the system, e.g., determined by the capability of the hardware."; } leaf sample-size { type uint16; units bytes; default 128; description "Sets the maximum number of bytes to be copied from a sampled packet."; reference "RFC 3176 - InMon Corporation's sFlow: A Method for Monitoring Traffic in Switched and Routed Networks"; } } grouping sflow-global-state { description "Operational state data for global sFlow."; } grouping sflow-global-top { description "Top-level grouping for global sFlow"; container sflow { description "Top-level container for sFlow data."; container config { description "Configuration data for global sFlow."; uses sflow-global-config; } container state { config false; description "Operational state data for global sFlow."; uses sflow-global-config; uses sflow-global-state; } uses sflow-collectors-top; uses sflow-interfaces-top; } } grouping sampling-top { description "Top-level grouping for traffic sampling data."; container sampling { description "Top-level container for data related to traffic sampling protocols."; uses sflow-global-top; } } // data definition statements uses sampling-top; }
YANG
5
wenovus/public
release/models/sampling/openconfig-sampling-sflow.yang
[ "Apache-2.0" ]
Add Trove classifier and create binary wheels for 3.10. -- :user:`hugovk`.
Cucumber
1
loven-doo/aiohttp
CHANGES/6079.feature
[ "Apache-2.0" ]
pub trait Array { type Element; } pub trait Visit { fn visit() {} } impl Array for () { type Element = (); } impl<'a> Visit for () where (): Array<Element=&'a ()>, {} fn main() { <() as Visit>::visit(); //~ ERROR: type mismatch resolving }
Rust
4
Eric-Arellano/rust
src/test/ui/associated-types/issue-44153.rs
[ "ECL-2.0", "Apache-2.0", "MIT-0", "MIT" ]