content stringlengths 4 1.04M | lang stringclasses 358 values | score int64 0 5 | repo_name stringlengths 5 114 | repo_path stringlengths 4 229 | repo_licenses listlengths 1 8 |
|---|---|---|---|---|---|
fileFormatVersion: 2
guid: 3b8b241bab4a4ac9a22fcce9c64f1242
timeCreated: 1614334463 | Unity3D Asset | 0 | danyow/xLua | Assets/XLua/Src/Editor/LuaImporter.cs.meta | [
"BSD-3-Clause"
] |
; https://github.com/Lexikos/AutoHotkey_L-Docs.git
; AutoHotkey_L https://lexikos.github.io/v2/docs/AutoHotkey.htm
;! keywords ===========================================================
; https://lexikos.github.io/v2/docs/Concepts.htm#names
; https://lexikos.github.io/v2/docs/v2-changes.htm
as and
Contains
False
in is isset
not
or
True
unset
base
class
extends
get Global
Local
new
set super Static
this
;! Flow of Control ===========================================================
Break [LoopLabel]
Catch [ErrorClass] [as OutputVar]
Continue [LoopLabel]
Critical [OnOffNumeric]
Else Statement
Exit [ExitCode]
ExitApp [ExitCode]
Finally Statement
For Value1 [, Value2] in Expression
Goto Label
If (Expression)
Loop [Count]
Loop Files FilePattern [, Mode]
Loop Parse String [, Delimiters, OmitChars]
Loop Read InputFile [, OutputFile]
Loop Reg KeyName [, Mode]
OnError Function [, AddRemove]
OnExit Function [, AddRemove]
Pause [NewState]
Reload
Return [Expression]
SetTimer [Function, Period, Priority]
Sleep DelayInMilliseconds
Suspend [Mode]
Switch [SwitchValue, CaseSense]
Case CaseValue1:
Case CaseValue2a, CaseValue2b:
Default:
Thread SubFunction [, Value1, Value2]
Throw [Value]
Try Statement
Until Expression
While Expression
;! Directives ===========================================================
#ClipboardTimeout Milliseconds
#DllLoad [FileOrDirName]
#ErrorStdOut [Encoding]
#HotIf [Expression]
#HotIfTimeout Timeout
#Hotstring NoMouse
#Hotstring EndChars NewChars
#Hotstring NewOptions
#Include FileOrDirName
#Include <LibName>
#IncludeAgain FileOrDirName
#InputLevel [Level]
#MaxThreads Value
#MaxThreadsBuffer [Setting]
#MaxThreadsPerHotkey Value
#NoTrayIcon
#Requires Requirement
#SingleInstance [Force Ignore Prompt Off]
#UseHook [Setting]
#Warn [WarningType, WarningMode]
#WinActivateForce
;! Script Compiler Directives
; https://lexikos.github.io/v2/docs/misc/Ahk2ExeDirectives.htm
/*@Ahk2Exe-Keep */
/*@Ahk2Exe-IgnoreBegin */
/*@Ahk2Exe-IgnoreEnd */
/*@Ahk2Exe-AddResource FileName , ResourceName */
/*@Ahk2Exe-Bin [Path\]Name , [Exe_path\][Name], Codepage */
/*@Ahk2Exe-ConsoleApp */
/*@Ahk2Exe-Cont Text */
/*@Ahk2Exe-Debug Text */
/*@Ahk2Exe-ExeName [Path\][Name] */
/*@Ahk2Exe-Let Name = Value , Name = Value, ... */
/*@Ahk2Exe-Obey Name, CmdOrExp , Extra */
/*@Ahk2Exe-PostExec Program [parameters] , When, WorkingDir, Hidden, IgnoreErrors */
/*@Ahk2Exe-SetMainIcon IcoFile */
/*@Ahk2Exe-SetProp Value */
/*@Ahk2Exe-Set Prop, Value */
/*@Ahk2Exe-UpdateManifest RequireAdmin , Name, Version, UIAccess */
/*@Ahk2Exe-UseResourceLang LangCode */
;! Built-in Variables =======================================================
; https://lexikos.github.io/v2/docs/Variables.htm#BuiltIn
; Special Characters
A_Space
A_Tab
; Script Properties
A_Args
A_WorkingDir
A_InitialWorkingDir
A_ScriptDir
A_ScriptName
A_ScriptFullPath
A_ScriptHwnd
A_LineNumber
A_LineFile
A_ThisFunc
A_AhkVersion
A_AhkPath
A_IsCompiled
; Date and Time
A_YYYY
A_MM
A_DD
A_MMMM
A_MMM
A_DDDD
A_DDD
A_WDay
A_YDay
A_YWeek
A_Hour
A_Min
A_Sec
A_MSec
A_Now
A_NowUTC
A_TickCount
; Script Settings
A_IsSuspended
A_IsPaused
A_IsCritical
A_ListLines
A_TitleMatchMode
A_TitleMatchModeSpeed
A_DetectHiddenWindows
A_DetectHiddenText
A_FileEncoding
A_SendMode
A_SendLevel
A_StoreCapsLockMode
A_KeyDelay
A_KeyDuration
A_KeyDelayPlay
A_KeyDurationPlay
A_WinDelay
A_ControlDelay
A_MenuMaskKey
A_MouseDelay
A_MouseDelayPlay
A_DefaultMouseSpeed
A_CoordModeToolTip
A_CoordModePixel
A_CoordModeMouse
A_CoordModeCaret
A_CoordModeMenu
A_RegView
A_TrayMenu
A_AllowMainWindow
A_IconHidden
A_IconTip
A_IconFile
A_IconNumber
; User Idle Time
A_TimeIdle
A_TimeIdlePhysical
A_TimeIdleKeyboard
A_TimeIdleMouse
; Hotkeys, Hotstrings, and Custom Menu Items
A_ThisHotkey
A_PriorHotkey
A_PriorKey
A_TimeSinceThisHotkey
A_TimeSincePriorHotkey
A_EndChar
A_MaxHotkeysPerInterval
A_HotkeyInterval
A_HotkeyModifierTimeout
; Operating System and User Info
A_ComSpec
A_Temp
A_OSVersion
A_Is64bitOS
A_PtrSize
A_Language
A_ComputerName
A_UserName
A_WinDir
A_ProgramFiles
A_AppData
A_AppDataCommon
A_Desktop
A_DesktopCommon
A_StartMenu
A_StartMenuCommon
A_Programs
A_ProgramsCommon
A_Startup
A_StartupCommon
A_MyDocuments
A_IsAdmin
A_ScreenWidth
A_ScreenHeight
A_ScreenDPI
; Misc
A_Clipboard
A_Cursor
A_EventInfo
A_LastError
; Loop
A_Index
A_LoopFileName
A_LoopReadLine
A_LoopField
; https://lexikos.github.io/v2/docs/commands/LoopReg.htm
A_LoopRegName
A_LoopRegType
A_LoopRegKey
A_LoopRegTimeModified
; https://lexikos.github.io/v2/docs/commands/LoopFiles.htm
A_LoopFileName
A_LoopFileExt
A_LoopFilePath
A_LoopFileFullPath
A_LoopFileShortPath
A_LoopFileShortName
A_LoopFileDir
A_LoopFileTimeModified
A_LoopFileTimeCreated
A_LoopFileTimeAccessed
A_LoopFileAttrib
A_LoopFileSize
A_LoopFileSizeKB
A_LoopFileSizeMB
;! Keys ===========================================================
; https://lexikos.github.io/v2/docs/KeyList.htm
; Mouse
LButton RButton MButton
XButton1 XButton2
WheelDown WheelUp WheelLeft WheelRight
; Keyboard
; General Keys
CapsLock Space Tab Enter Escape Esc Backspace BS
; Cursor Control Keys
ScrollLock Delete Del Insert Ins Home End PgUp PgDn Up Down Left Right
; Numpad Keys
Numpad0 NumpadIns
Numpad1 NumpadEnd
Numpad2 NumpadDown
Numpad3 NumpadPgDn
Numpad4 NumpadLeft
Numpad5 NumpadClear
Numpad6 NumpadRight
Numpad7 NumpadHome
Numpad8 NumpadUp
Numpad9 NumpadPgUp
NumpadDot NumpadDel
NumLock
NumpadDiv
NumpadMult
NumpadAdd
NumpadSub
NumpadEnter
; Function Keys
; F1 - F24
; Modifier Keys
LWin
RWin
Control Ctrl
Alt
Shift
LControl LCtrl
RControl RCtrl
LShift RShift
LAlt RAlt
; Multimedia Keys
Browser_Back
Browser_Forward
Browser_Refresh
Browser_Stop
Browser_Search
Browser_Favorites
Browser_Home
Volume_Mute
Volume_Down
Volume_Up
Media_Next
Media_Prev
Media_Stop
Media_Play_Pause
Launch_Mail
Launch_Media
Launch_App1
Launch_App2
; Other Keys
AppsKey
PrintScreen
CtrlBreak
Pause
Help
Sleep
; SCnnn
; VKnn
; Joystick
; Joy1 - Joy32
JoyX JoyY JoyZ
JoyR JoyU JoyV
JoyPOV JoyName JoyButtons JoyAxes JoyInfo
; Multiple Joysticks
;! Functions ===========================================================
; Drive
; https://lexikos.github.io/v2/docs/commands/Drive.htm
DriveEject [Drive]
DriveRetract [Drive]
DriveGetCapacity(Path)
DriveGetFileSystem(Drive)
DriveGetLabel(Drive)
DriveGetList([Type])
DriveGetSerial(Drive)
DriveGetSpaceFree(Path)
DriveGetStatus(Path)
DriveGetStatusCD([Drive])
DriveLock Drive
DriveSetLabel Drive [, NewLabel]
DriveUnlock Drive
DriveGetType(Path)
; Environment
ClipboardAll([Data, Size])
ClipWait [Timeout, WaitForAnyData]
EnvGet(EnvVarName)
EnvSet EnvVar, Value
OnClipboardChange Function [, AddRemove]
SysGet(Property)
SysGetIPAddresses()
; External Libraries
CallbackCreate(Function [, Options := "", ParamCount := Function.MinParams])
DllCall("[DllFile\]Function" [, Type1, Arg1, Type2, Arg2, "Cdecl ReturnType"])
NumGet(Source, [Offset,] Type)
NumPut Type, Number, [Type2, Number2, ...] Target [, Offset]
StrGet(Source [, Length] [, Encoding := None])
StrPtr(Value)
StrPut String [, Encoding := None]
StrPut String, Target [, Length , Encoding := None]
VarSetStrCapacity(TargetVar [, RequestedCapacity])
; COM
ComObjActive(CLSID)
ComObjArray(VarType, Count1 [, Count2, ... Count8])
ComCall(Index, ComObj [, Type1, Arg1, Type2, Arg2, ReturnType])
ComObjConnect ComObj [, Prefix]
ComObjGet(Name)
ComObject(CLSID [, IID])
ComObjFlags(ComObj [, NewFlags, Mask])
ComObjFromPtr(DispPtr)
ComObjQuery(ComObj, [SID,] IID)
ComObjType(ComObj)
ComObjType(ComObj, "Name")
ComObjValue(ComObj)
ComValue(VarType, Value [, Flags])
ObjAddRef(Ptr)
ObjRelease(Ptr)
; File and Directory
DirCopy Source, Dest [, Overwrite]
DirCreate DirName
DirDelete DirName [, Recurse]
AttributeString := DirExist(FilePattern)
DirMove Source, Dest [, Flag]
SelectedFolder := DirSelect([StartingFolder, Options, Prompt])
FileAppend Text [, Filename, Options]
FileCopy SourcePattern, DestPattern [, Overwrite]
FileCreateShortcut Target, LinkFile [, WorkingDir, Args, Description, IconFile, ShortcutKey, IconNumber, RunState]
FileDelete FilePattern
FileEncoding [Encoding]
FileExist(FilePattern)
FileGetAttrib([Filename])
FileGetShortcut LinkFile [, OutTarget, OutDir, OutArgs, OutDescription, OutIcon, OutIconNum, OutRunState]
FileGetSize([Filename, Units])
FileGetTime([Filename, WhichTime])
FileGetVersion([Filename])
FileInstall Source, Dest [, Overwrite]
FileMove SourcePattern, DestPattern [, Overwrite]
FileOpen(Filename, Flags [, Encoding])
FileRead(Filename [, Options])
FileRecycle FilePattern
FileRecycleEmpty [DriveLetter]
FileSelect([Options, RootDir\Filename, Title, Filter])
FileSetAttrib Attributes [, FilePattern, Mode]
FileSetTime [YYYYMMDDHH24MISS, FilePattern, WhichTime, Mode]
IniDelete Filename, Section [, Key]
IniRead(Filename, Section, Key [, Default])
IniRead(Filename, Section)
IniRead(Filename)
IniWrite Value, Filename, Section, Key
IniWrite Pairs, Filename, Section
SetWorkingDir DirName
SplitPath Path [, OutFileName, OutDir, OutExtension, OutNameNoExt, OutDrive]
; GUI
DirSelect([StartingFolder, Options, Prompt])
FileSelect([Options, RootDir\Filename, Title, Filter])
GuiCtrlFromHwnd(Hwnd)
GuiFromHwnd(Hwnd [, RecurseParent := false])
InputBox([Prompt, Title, Options, Default])
LoadPicture(Filename [, Options, &ImageType])
MenuFromHandle(Handle)
MsgBox [Text, Title, Options]
MsgBox([Text, Title, Options])
OnMessage MsgNumber [, Function, MaxThreads]
ToolTip [Text, X, Y, WhichToolTip]
TraySetIcon([FileName, IconNumber, Freeze])
TrayTip [Text, Title, Options]
; Math
; https://lexikos.github.io/v2/docs/commands/Math.htm
Abs(Number)
Ceil(Number)
DateAdd(DateTime, Time, TimeUnits)
DateDiff(DateTime1, DateTime2, TimeUnits)
Exp(N)
Float(Value)
Floor(Number)
Integer(Value)
Log(Number)
Ln(Number)
Max(Number1 [, Number2, ...])
Min(Number1 [, Number2, ...])
Mod(Dividend, Divisor)
Number(Value)
Random([A, B])
Round(Number [, N])
Sqrt(Number)
Sin(Number)
Cos(Number)
Tan(Number)
ASin(Number)
ACos(Number)
ATan(Number)
; Monitor
; https://lexikos.github.io/v2/docs/commands/Monitor.htm
MonitorGet([N, Left, Top, Right, Bottom])
MonitorGetCount()
MonitorGetName([N])
MonitorGetPrimary()
MonitorGetWorkArea([N, Left, Top, Right, Bottom])
; Mouse and Keyboard
; https://lexikos.github.io/v2/docs/Hotkeys.htm
HotIf ["Expression"]
HotIf [Function]
Hotkey KeyName [, Action, Options]
Hotstring String [, Replacement, OnOffToggle]
Hotstring NewOptions
Hotstring("EndChars" [, NewValue])
Hotstring("MouseReset" [, NewValue])
Hotstring "Reset"
ListHotkeys
Suspend [Mode]
BlockInput OnOff
BlockInput SendMouse
BlockInput MouseMove
CaretGetPos([OutputVarX, OutputVarY])
Click [Options]
ControlClick [Control-or-Pos, WinTitle, WinText, WhichButton, ClickCount, Options, ExcludeTitle, ExcludeText]
ControlSend Keys [, Control, WinTitle, WinText, ExcludeTitle, ExcludeText]
ControlSendText Keys [, Control, WinTitle, WinText, ExcludeTitle, ExcludeText]
CoordMode TargetType [, RelativeTo]
GetKeyName(KeyName)
GetKeySC(KeyName)
GetKeyState(KeyName [, Mode])
GetKeyVK(KeyName)
KeyHistory [MaxEvents]
KeyWait KeyName [, Options]
InputHook([Options, EndKeys, MatchList])
InstallKeybdHook [Install, Force]
InstallMouseHook [Install, Force]
MouseClick [WhichButton, X, Y, ClickCount, Speed, DownOrUp, Relative]
MouseClickDrag WhichButton, X1, Y1, X2, Y2 [, Speed, Relative]
MouseGetPos [OutputVarX, OutputVarY, OutputVarWin, OutputVarControl, Flag]
MouseMove X, Y [, Speed, Relative]
; https://lexikos.github.io/v2/docs/commands/Send.htm
Send Keys
SendText Keys
SendInput Keys
SendPlay Keys
SendEvent Keys
SendLevel Level
SendMode Mode
SetCapsLockState [State]
SetNumLockState [State]
SetScrollLockState [State]
SetDefaultMouseSpeed Speed
SetKeyDelay [Delay, PressDuration, "Play"]
SetMouseDelay Delay [, "Play"]
SetStoreCapsLockMode Mode
; Misc
Download URL, Filename
Edit
GetMethod(Value [, Name, ParamCount])
HasBase(Value, BaseObj)
HasMethod(Value [, Name, ParamCount])
HasProp(Value, Name)
IsInteger(expression)
IsFloat(expression)
IsNumber(expression)
IsObject(ObjectValue)
IsLabel(LabelName)
IsSet(Var)
IsSetRef(Ref)
IsDigit(expression)
IsXDigit(expression)
IsAlpha(Value, "Locale")
IsUpper(Value, "Locale")
IsLower(Value, "Locale")
IsAlnum(expression)
IsSpace(expression)
IsTime(expression)
ListLines [Mode]
ListVars
OutputDebug Text
Persistent [Persist]
; Process
; https://lexikos.github.io/v2/docs/commands/Process.htm
ProcessClose PIDOrName
ProcessExist([PIDOrName])
ProcessSetPriority Level [, PIDOrName]
ProcessWait(PIDOrName [, Timeout])
ProcessWaitClose(PIDOrName [, Timeout])
Run Target [, WorkingDir, Options, OutputVarPID]
RunWait(Target [, WorkingDir, Options, OutputVarPID])
RunAs [User, Password, Domain]
Shutdown Flag
; Registry
RegDelete [KeyName, ValueName]
RegDeleteKey [KeyName]
RegRead([KeyName, ValueName, Default])
RegWrite Value, ValueType, KeyName [, ValueName]
RegWrite Value [, ValueType, , ValueName]
SetRegView RegView
; Screen
ImageSearch OutputVarX, OutputVarY, X1, Y1, X2, Y2, ImageFile
PixelGetColor(X, Y [, Mode])
PixelSearch OutputVarX, OutputVarY, X1, Y1, X2, Y2, ColorID [, Variation]
; Sound
; https://lexikos.github.io/v2/docs/commands/Sound.htm
SoundBeep [Frequency, Duration]
SoundGetInterface(IID [, Component, Device])
SoundGetMute([Component, Device])
SoundGetName([Component, Device])
SoundGetVolume([Component, Device])
SoundPlay Filename [, Wait]
SoundSetMute NewSetting [, Component, Device]
SoundSetVolume NewSetting [, Component, Device]
; String
Chr(Number)
Format(FormatStr [, Values...])
FormatTime([YYYYMMDDHH24MISS, Format])
InStr(Haystack, Needle [, CaseSense := false, StartingPos := 1, Occurrence := 1])
Ord(String)
RegExMatch(Haystack, NeedleRegEx [, OutputVar, StartingPos := 1])
RegExReplace(Haystack, NeedleRegEx [, Replacement := "", OutputVarCount := "", Limit := -1, StartingPos := 1])
Sort(String [, Options, Function])
StrCompare(String1, String2 [, CaseSense := false])
String(Value)
StrLower(String)
StrUpper(String)
StrTitle(String)
StrLen(String)
StrGet(Source [, Length] [, Encoding := None])
StrPut String [, Encoding := None]
StrPut String, Target [, Length] [, Encoding := None]
StrReplace(Haystack, Needle [, ReplaceText, CaseSense, OutputVarCount, Limit])
StrSplit(String [, Delimiters, OmitChars, MaxParts])
SubStr(String, StartingPos [, Length])
Trim(String [, OmitChars := " `t"])
LTrim(String [, OmitChars := " `t"])
RTrim(String [, OmitChars := " `t"])
VarSetStrCapacity(TargetVar [, RequestedCapacity])
VerCompare(VersionA, VersionB)
; Window
; https://lexikos.github.io/v2/docs/commands/Win.htm
GroupActivate(GroupName [, Mode])
GroupAdd GroupName [, WinTitle, WinText, ExcludeTitle, ExcludeText]
GroupClose GroupName [, Mode]
GroupDeactivate GroupName [, Mode]
DetectHiddenText Mode
DetectHiddenWindows Mode
SetTitleMatchMode MatchMode
SetTitleMatchMode Speed
SetWinDelay Delay
StatusBarGetText([Part#, WinTitle, WinText, ExcludeTitle, ExcludeText])
StatusBarWait [BarText, Timeout, Part#, WinTitle, WinText, Interval, ExcludeTitle, ExcludeText]
WinActivate [WinTitle, WinText, ExcludeTitle, ExcludeText]
WinActivateBottom [WinTitle, WinText, ExcludeTitle, ExcludeText]
WinActive([WinTitle, WinText, ExcludeTitle, ExcludeText])
WinClose [WinTitle, WinText, SecondsToWait, ExcludeTitle, ExcludeText]
WinExist([WinTitle, WinText, ExcludeTitle, ExcludeText])
WinGetClass([WinTitle, WinText, ExcludeTitle, ExcludeText])
WinGetClientPos [X, Y, Width, Height, WinTitle, WinText, ExcludeTitle, ExcludeText]
WinGetControls([WinTitle, WinText, ExcludeTitle, ExcludeText])
WinGetControlsHwnd([WinTitle, WinText, ExcludeTitle, ExcludeText])
WinGetCount([WinTitle, WinText, ExcludeTitle, ExcludeText])
WinGetID([WinTitle, WinText, ExcludeTitle, ExcludeText])
WinGetIDLast([WinTitle, WinText, ExcludeTitle, ExcludeText])
WinGetList([WinTitle, WinText, ExcludeTitle, ExcludeText])
WinGetMinMax([WinTitle, WinText, ExcludeTitle, ExcludeText])
WinGetPID([WinTitle, WinText, ExcludeTitle, ExcludeText])
WinGetPos [X, Y, Width, Height, WinTitle, WinText, ExcludeTitle, ExcludeText]
WinGetProcessName([WinTitle, WinText, ExcludeTitle, ExcludeText])
WinGetProcessPath([WinTitle, WinText, ExcludeTitle, ExcludeText])
WinGetStyle([WinTitle, WinText, ExcludeTitle, ExcludeText])
WinGetExStyle([WinTitle, WinText, ExcludeTitle, ExcludeText])
WinGetText([WinTitle, WinText, ExcludeTitle, ExcludeText])
WinGetTitle([WinTitle, WinText, ExcludeTitle, ExcludeText])
WinGetTransColor([WinTitle, WinText, ExcludeTitle, ExcludeText])
WinGetTransparent([WinTitle, WinText, ExcludeTitle, ExcludeText])
WinHide [WinTitle, WinText, ExcludeTitle, ExcludeText]
WinKill [WinTitle, WinText, SecondsToWait, ExcludeTitle, ExcludeText]
WinMaximize [WinTitle, WinText, ExcludeTitle, ExcludeText]
WinMinimize [WinTitle, WinText, ExcludeTitle, ExcludeText]
WinMinimizeAll
WinMinimizeAllUndo
WinMove X, Y [, Width, Height, WinTitle, WinText, ExcludeTitle, ExcludeText]
WinMoveBottom [WinTitle, WinText, ExcludeTitle, ExcludeText]
WinMoveTop [WinTitle, WinText, ExcludeTitle, ExcludeText]
WinRedraw [WinTitle, WinText, ExcludeTitle, ExcludeText]
WinRestore [WinTitle, WinText, ExcludeTitle, ExcludeText]
WinSetAlwaysOnTop [Value, WinTitle, WinText, ExcludeTitle, ExcludeText]
WinSetEnabled [Value , WinTitle, WinText, ExcludeTitle, ExcludeText]
WinSetRegion [Options, WinTitle, WinText, ExcludeTitle, ExcludeText]
WinSetStyle Value [, WinTitle, WinText, ExcludeTitle, ExcludeText]
WinSetExStyle Value [, WinTitle, WinText, ExcludeTitle, ExcludeText]
WinSetTitle NewTitle [, WinTitle, WinText, ExcludeTitle, ExcludeText]
WinSetTransColor Color [, WinTitle, WinText, ExcludeTitle, ExcludeText]
WinSetTransparent [N, WinTitle, WinText, ExcludeTitle, ExcludeText]
WinShow [WinTitle, WinText, ExcludeTitle, ExcludeText]
WinWait [WinTitle, WinText, Timeout, ExcludeTitle, ExcludeText]
WinWaitActive [WinTitle, WinText, Timeout, ExcludeTitle, ExcludeText]
WinWaitNotActive [WinTitle, WinText, Timeout, ExcludeTitle, ExcludeText]
WinWaitClose [WinTitle, WinText, Timeout, ExcludeTitle, ExcludeText]
; Control
; https://lexikos.github.io/v2/docs/commands/Control.htm
ControlAddItem String, Control [, WinTitle, WinText, ExcludeTitle, ExcludeText]
ControlChooseIndex N, Control [, WinTitle, WinText, ExcludeTitle, ExcludeText]
ControlChooseString String, Control [, WinTitle, WinText, ExcludeTitle, ExcludeText]
ControlClick [Control-or-Pos, WinTitle, WinText, WhichButton, ClickCount, Options, ExcludeTitle, ExcludeText]
ControlDeleteItem N, Control [, WinTitle, WinText, ExcludeTitle, ExcludeText]
ControlFindItem(String, Control [, WinTitle, WinText, ExcludeTitle, ExcludeText])
ControlFocus Control [, WinTitle, WinText, ExcludeTitle, ExcludeText]
ControlGetChecked(Control [, WinTitle, WinText, ExcludeTitle, ExcludeText])
ControlGetChoice(Control [, WinTitle, WinText, ExcludeTitle, ExcludeText])
ControlGetClassNN(Control [, WinTitle, WinText, ExcludeTitle, ExcludeText])
ControlGetEnabled(Control [, WinTitle, WinText, ExcludeTitle, ExcludeText])
ControlGetFocus([WinTitle, WinText, ExcludeTitle, ExcludeText])
ControlGetHwnd(Control [, WinTitle, WinText, ExcludeTitle, ExcludeText])
ControlGetIndex(Control [, WinTitle, WinText, ExcludeTitle, ExcludeText])
ControlGetItems(Control [, WinTitle, WinText, ExcludeTitle, ExcludeText])
ControlGetPos [X, Y, Width, Height, Control, WinTitle, WinText, ExcludeTitle, ExcludeText]
ControlGetStyle(Control [, WinTitle, WinText, ExcludeTitle, ExcludeText])
ControlGetExStyle(Control [, WinTitle, WinText, ExcludeTitle, ExcludeText])
ControlGetText(Control [, WinTitle, WinText, ExcludeTitle, ExcludeText])
ControlGetVisible(Control [, WinTitle, WinText, ExcludeTitle, ExcludeText])
ControlHide Control [, WinTitle, WinText, ExcludeTitle, ExcludeText]
ControlHideDropDown Control [, WinTitle, WinText, ExcludeTitle, ExcludeText]
ControlMove [X, Y, Width, Height, Control, WinTitle, WinText, ExcludeTitle, ExcludeText]
ControlSend Keys [, Control, WinTitle, WinText, ExcludeTitle, ExcludeText]
ControlSendText Keys [, Control, WinTitle, WinText, ExcludeTitle, ExcludeText]
ControlSetChecked Value, Control [, WinTitle, WinText, ExcludeTitle, ExcludeText]
ControlSetEnabled Value, Control [, WinTitle, WinText, ExcludeTitle, ExcludeText]
ControlSetStyle Value, Control [, WinTitle, WinText, ExcludeTitle, ExcludeText]
ControlSetExStyle Value, Control [, WinTitle, WinText, ExcludeTitle, ExcludeText]
ControlSetText NewText, Control [, WinTitle, WinText, ExcludeTitle, ExcludeText]
ControlShow Control [, WinTitle, WinText, ExcludeTitle, ExcludeText]
ControlShowDropDown Control [, WinTitle, WinText, ExcludeTitle, ExcludeText]
EditGetCurrentCol(Control [, WinTitle, WinText, ExcludeTitle, ExcludeText])
EditGetCurrentLine(Control [, WinTitle, WinText, ExcludeTitle, ExcludeText])
EditGetLine(N, Control [, WinTitle, WinText, ExcludeTitle, ExcludeText])
EditGetLineCount(Control [, WinTitle, WinText, ExcludeTitle, ExcludeText])
EditGetSelectedText(Control [, WinTitle, WinText, ExcludeTitle, ExcludeText])
EditPaste String, Control [, WinTitle, WinText, ExcludeTitle, ExcludeText]
ListViewGetContent([Options, Control, WinTitle, WinText, ExcludeTitle, ExcludeText])
MenuSelect WinTitle, WinText, Menu [, SubMenu1, SubMenu2, SubMenu3, SubMenu4, SubMenu5, SubMenu6, ExcludeTitle, ExcludeText]
PostMessage Msg [, wParam, lParam, Control, WinTitle, WinText, ExcludeTitle, ExcludeText]
SendMessage(Msg [, wParam, lParam, Control, WinTitle, WinText, ExcludeTitle, ExcludeText, Timeout])
SetControlDelay Delay
; Object Types
; https://lexikos.github.io/v2/docs/objects/index.htm
; https://lexikos.github.io/v2/docs/Objects.htm
__Enum(NumberOfVars)
__Item[name]
__New()
__Delete()
__Init()
__Get(Name, Params)
__Set(Name, Params, Value)
__Call(Name, Params)
Call(Params*)
; https://lexikos.github.io/v2/docs/objects/Any.htm
GetMethod(Name)
HasBase(BaseObj)
HasMethod(Name)
HasProp(Name)
ObjGetBase(Value)
; https://lexikos.github.io/v2/docs/objects/Object.htm
Clone()
DefineProp(Name, Desc)
DeleteProp(Name)
GetOwnPropDesc(Name)
HasOwnProp(Name)
OwnProps()
ObjSetBase(Obj, BaseObj)
ObjOwnPropCount(Obj)
ObjSetCapacity(Obj, MaxProps)
ObjGetCapacity(Obj)
; https://lexikos.github.io/v2/docs/objects/Array.htm
Delete(Index)
Has(Index)
InsertAt(Index, Value1 [, Value2, ... ValueN])
Pop()
Push([Value, Value2, ..., ValueN])
RemoveAt(Index [, Length])
; https://lexikos.github.io/v2/docs/objects/Map.htm
Clear()
Delete(Key)
Get(Key [, Default])
Has(Key)
Set([Key, Value, Key2, Value2, ...])
; https://lexikos.github.io/v2/docs/objects/File.htm
Read([Characters])
Write(String)
ReadLine()
WriteLine([String])
ReadNumType()
WriteNumType(Num)
RawRead(Buffer [, Bytes])
RawWrite(Data [, Bytes])
Seek(Distance [, Origin := 0])
Close()
; https://lexikos.github.io/v2/docs/objects/Func.htm
Bind(Param1, Param2, ...)
IsByRef([ParamIndex])
IsOptional([ParamIndex])
; https://lexikos.github.io/v2/docs/objects/Gui.htm
Add(ControlType [, Options, Text])
AddControlType([Options, Text])
Destroy()
Flash([Blink := true])
GetClientPos([X, Y, Width, Height])
GetPos([X, Y, Width, Height])
Hide()
Maximize()
Minimize()
Move([X, Y, Width, Height])
Restore()
OnEvent(EventName, Callback [, AddRemove := 1])
Opt(Options)
SetFont([Options, FontName])
Show([Options])
Submit([Hide := true])
; https://lexikos.github.io/v2/docs/objects/GuiControl.htm
Add(Items)
Choose(Value)
Delete([Value])
Focus()
GetPos([X, Y, Width, Height])
Move([X, Y, Width, Height])
OnEvent(EventName, Callback [, AddRemove := 1])
OnNotify(NotifyCode, Callback [, AddRemove := 1])
Opt(Options)
Redraw()
SetFont([Options, FontName])
SetFormat([Format])
UseTab([Value, ExactMatch := false])
; https://lexikos.github.io/v2/docs/objects/Menu.htm
Add([MenuItemName, Function-or-Submenu, Options])
Check(MenuItemName)
Delete([MenuItemName])
Disable(MenuItemName)
Enable(MenuItemName)
Insert([ItemToInsertBefore, NewItemName, Callback-or-Submenu, Options])
Rename(MenuItemName [, NewName])
SetColor([ColorValue, Submenus := true])
SetIcon(MenuItemName, FileName [, IconNumber, IconWidth])
Show([X, Y])
ToggleCheck(MenuItemName)
ToggleEnable(MenuItemName)
Uncheck(MenuItemName)
AddStandard()
;! Objects ===========================================================
; https://lexikos.github.io/v2/docs/objects/index.htm
Any
Object
Array
Buffer
ClipboardAll
Class
Error
IndexError
KeyError
MemberError
PropertyError
MethodError
MemoryError
OSError
TargetError
TimeoutError
TypeError
ValueError
ZeroDivisionError
File
Func
BoundFunc
Closure
Enumerator
Gui
Gui.Control
Gui.ActiveX
Gui.Button
Gui.CheckBox
Gui.Custom
Gui.DateTime
Gui.Edit
Gui.GroupBox
Gui.Hotkey
Gui.Link
Gui.List
Gui.ComboBox
Gui.DDL
Gui.ListBox
Gui.Tab
Gui.ListView
Gui.MonthCal
Gui.Pic
Gui.Progress
Gui.Radio
Gui.Slider
Gui.StatusBar
Gui.Text
Gui.TreeView
Gui.UpDown
InputHook
Map
Menu
MenuBar
RegExMatchInfo
Primitive
Number
Float
Integer
String
VarRef
ComValue
ComObjArray
ComObject
ComValueRef
;! Misc ===========================================================
; Properties
; Array
Length Capacity
; Buffer
Ptr Size
; Map
Count Capacity CaseSense Default
; File
Pos Length AtEOF Encoding Handle
; Func
Name IsBuiltIn IsVariadic MinParams MaxParams
; Gui
BackColor FocusedCtrl Hwnd MarginX MarginY MenuBar Name Title
; GuiControl
ClassNN Enabled Focused Gui Hwnd Name Text Type Value Visible
; Menu/MenuBar
ClickCount Default Handle
; Match
Pos Len Name Count Mark
; Continuation section
; https://lexikos.github.io/v2/docs/Scripts.htm#continuation-section
Join LTrim RTrim Comments Comment Com C
; Loop
Files Parse Read Reg
; Loop Reg
; https://lexikos.github.io/v2/docs/commands/LoopReg.htm
HKEY_LOCAL_MACHINE HKEY_USERS HKEY_CURRENT_USER HKEY_CLASSES_ROOT HKEY_CURRENT_CONFIG
HKLM HKCU
REG_SZ REG_EXPAND_SZ REG_MULTI_SZ REG_DWORD REG_QWORD REG_BINARY REG_LINK REG_RESOURCE_LIST REG_FULL_RESOURCE_DESCRIPTOR REG_RESOURCE_REQUIREMENTS_LIST REG_DWORD_BIG_ENDIAN
| AutoHotkey | 3 | Novodes/notepad2 | tools/lang/AutoHotkey_L.ahk | [
"MIT"
] |
/*
* Copyright 2000-2018 JetBrains s.r.o. Use of this source code is governed by the Apache 2.0 license
* that can be found in the license/LICENSE.txt file.
*/
package org.jetbrains.kotlin.daemon.common
import org.jetbrains.kotlin.cli.common.repl.ILineId
interface ReplStateFacadeAsync {
suspend fun getId(): Int
suspend fun getHistorySize(): Int
suspend fun historyGet(index: Int): ILineId
suspend fun historyReset(): List<ILineId>
suspend fun historyResetTo(id: ILineId): List<ILineId>
}
| Kotlin | 4 | Mu-L/kotlin | compiler/daemon/daemon-common/src/org/jetbrains/kotlin/daemon/common/ReplStateFacadeAsync.kt | [
"ECL-2.0",
"Apache-2.0"
] |
// Example of how to create basic boolean logic circuits. Starting with the
// definition of basic boolean operations we build a half-adder and then
// a 4-bit full adder using 4 registers: 2 summands, 1 sum, 1 carry
// https://dev.to/davidk01/some-more-fun-with-alloy-5d7h
// 0 or 1
let bits = { i: Int | 0 <= i && i <= 1 }
// Or
let bitOrTable = { i: bits, j: bits, k: sum[i + j] }
// And
let bitAndTable = { i: bits, j: bits, k: mul[i, j] }
// Not
let bitNotTable = { i: bits, j: minus[1, i] }
// Xor: https://en.wikipedia.org/wiki/Exclusive_or
let bitXorTable = {
i: bits,
j: bits,
k: bitAndTable[bitOrTable[i, j], bitNotTable[bitAndTable[i, j]]]
}
// Half adder: https://en.wikipedia.org/wiki/Adder_(electronics)#Half_adder
pred halfAdder(m: Int, n: Int, s: Int, c: Int) {
s = bitXorTable[m, n]
c = bitAndTable[m, n]
}
// https://en.wikipedia.org/wiki/Adder_(electronics)#/media/File:Full-adder_logic_diagram.svg
pred fullAdder(m: Int, n: Int, c: Int, s: Int, carry: Int) {
let xor = bitXorTable[m, n] {
s = bitXorTable[xor, c]
carry = bitOrTable[bitAndTable[m, n], bitAndTable[xor, c]]
}
}
// BitVector consists of 4 bits
abstract sig BitVector {
values: (0 + 1 + 2 + 3) -> one bits
}
// We want 4 vectors to perform a computation: 2 summands, sum, and carry
one sig A, B, C, S extends BitVector { }
// 4 bit adder with overflow
pred bitAddition(a: BitVector, b: BitVector, c: BitVector, s: BitVector) {
fullAdder[a.values[0], b.values[0], 0, s.values[0], c.values[0]]
fullAdder[a.values[1], b.values[1], c.values[0], s.values[1], c.values[1]]
fullAdder[a.values[2], b.values[2], c.values[1], s.values[2], c.values[2]]
fullAdder[a.values[3], b.values[3], c.values[2], s.values[3], c.values[3]]
}
// Run it to verify
run {
bitAddition[A, B, C, S]
}
| Alloy | 5 | c-luu/alloy-specs | simple-models/4-bit-adder/4-bit-adder.als | [
"Apache-2.0"
] |
/*
* Copyright 2018-2019 Jiří Janoušek <janousek.jiri@gmail.com>
*
* Redistribution and use in source and binary forms, with or without
* modification, are permitted provided that the following conditions are met:
*
* 1. Redistributions of source code must retain the above copyright notice, this
* list of conditions and the following disclaimer.
* 2. Redistributions in binary form must reproduce the above copyright notice,
* this list of conditions and the following disclaimer in the documentation
* and/or other materials provided with the distribution.
*
* THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS" AND
* ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE IMPLIED
* WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE
* DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT OWNER OR CONTRIBUTORS BE LIABLE FOR
* ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES
* (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES;
* LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND
* ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT
* (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF THIS
* SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE.
*/
namespace Nuvola {
public abstract class MainLoopAdaptor {
private MainLoopAdaptor? replacement = null;
protected MainLoopAdaptor() {
}
public abstract void run();
public abstract void quit();
public MainLoopAdaptor? get_replacement() {
return replacement;
}
public void replace(MainLoopAdaptor replacement) {
this.replacement = replacement;
quit();
}
}
} // namespace Nuvola
| Vala | 4 | xcffl/nuvolaruntime | src/nuvolakit-runner/core/MainLoopAdaptor.vala | [
"BSD-2-Clause"
] |
#declare Index1 = 0;
#while(Index1 <= 9)
#declare Index2 = 0;
#while(Index2 <= 19)
sphere { <Index1, Index2, 0>, .5 }
#declare Index2 = Index2 + 1;
#end
#declare Index1 = Index1 + 1;
#end
| POV-Ray SDL | 3 | btashton/pygments | tests/examplefiles/while.pov | [
"BSD-2-Clause"
] |
#warning "Test.h found in SDK"
extern int TestFrameworkFromSDK;
| C | 0 | lwhsu/swift | validation-test/ClangImporter/Inputs/explicit-system-framework-path/sdkroot/Library/Frameworks/Test.framework/Headers/Test.h | [
"Apache-2.0"
] |
/*
* Copyright (c) 2004, Technische Universitaet Berlin
* All rights reserved.
*
* Redistribution and use in source and binary forms, with or without
* modification, are permitted provided that the following conditions
* are met:
* - Redistributions of source code must retain the above copyright notice,
* this list of conditions and the following disclaimer.
* - Redistributions in binary form must reproduce the above copyright
* notice, this list of conditions and the following disclaimer in the
* documentation and/or other materials provided with the distribution.
* - Neither the name of the Technische Universitaet Berlin nor the names
* of its contributors may be used to endorse or promote products derived
* from this software without specific prior written permission.
*
* THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS
* "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT
* LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR
* A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT
* OWNER OR CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL,
* SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED
* TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA,
* OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY
* OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT
* (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE
* USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE.
*
* - Revision -------------------------------------------------------------
* $Revision: 1.5 $
* $Date: 2008-05-20 18:16:15 $
* @author: Jan Hauer <hauer@tkn.tu-berlin.de>
* ========================================================================
*/
/**
* Tests the AdcC subsystem and switches on leds 0, 1 and 2.
* if the test is successful:
* LED0 denotes a successful Read operation,
* LED1 denotes a successful ReadNow operation,
* LED2 denotes a successful ReadStream operation.
*
* @author Jan Hauer
*/
module TestAdcC
{
uses interface Read<uint16_t> as Read;
uses interface ReadNow<uint16_t> as ReadNow;
uses interface Resource as ReadNowResource;
uses interface ReadStream<uint16_t> as ReadStream;
uses interface Boot;
uses interface Leds;
}
implementation
{
#define BUF_SIZE 100
uint16_t buf[BUF_SIZE];
bool streamSuccess;
event void Boot.booted()
{
streamSuccess = FALSE;
call Read.read();
call ReadStream.postBuffer(buf, BUF_SIZE);
call ReadStream.read(10000);
call ReadNowResource.request();
}
event void Read.readDone(error_t result, uint16_t data)
{
if (result == SUCCESS)
call Leds.led0On();
}
event void ReadNowResource.granted()
{
call ReadNow.read();
}
async event void ReadNow.readDone(error_t result, uint16_t data)
{
if (result == SUCCESS)
call Leds.led1On();
call ReadNowResource.release();
}
event void ReadStream.bufferDone( error_t result,
uint16_t* buffer, uint16_t count )
{
streamSuccess = TRUE;
}
event void ReadStream.readDone(error_t result, uint32_t actualPeriod)
{
if (result == SUCCESS && streamSuccess)
call Leds.led2On();
}
}
| nesC | 4 | mtaghiza/tinyos-main-1 | apps/tests/TestAdc/TestAdcC.nc | [
"BSD-3-Clause"
] |
(function(exports) {
var invalidParamStr = 'Invalid parameter';
var missingParamStr = 'Missing parameter';
// app id
LYUAppId = [NSBundle mainBundle].bundleIdentifier;
// mainBundlePath
LYUAppPath = [NSBundle mainBundle].bundlePath;
// document path
LYUDocPath = NSSearchPathForDirectoriesInDomains(NSDocumentDirectory, NSUserDomainMask, YES)[0];
// caches path
LYUCachesPath = NSSearchPathForDirectoriesInDomains(NSCachesDirectory, NSUserDomainMask, YES)[0];
// 加载系统动态库
LYULoadFramework = function(name) {
var head = "/System/Library/";
var foot = "Frameworks/" + name + ".framework";
var bundle = [NSBundle bundleWithPath:head + foot] || [NSBundle bundleWithPath:head + "Private" + foot];
[bundle load];
return bundle;
};
// keyWindow
LYUKeyWin = function() {
return UIApp.keyWindow;
};
// 根控制器
LYURootVc = function() {
return UIApp.keyWindow.rootViewController;
};
// 找到显示在最前面的控制器
var _LYUFrontVc = function(vc) {
if (vc.presentedViewController) {
return _LYUFrontVc(vc.presentedViewController);
}else if ([vc isKindOfClass:[UITabBarController class]]) {
return _LYUFrontVc(vc.selectedViewController);
} else if ([vc isKindOfClass:[UINavigationController class]]) {
return _LYUFrontVc(vc.visibleViewController);
} else {
var count = vc.childViewControllers.count;
for (var i = count - 1; i >= 0; i--) {
var childVc = vc.childViewControllers[i];
if (childVc && childVc.view.window) {
vc = _LYUFrontVc(childVc);
break;
}
}
return vc;
}
};
LYUFrontVc = function() {
return _LYUFrontVc(UIApp.keyWindow.rootViewController);
};
// 递归打印UIViewController view的层级结构
LYUVcSubviews = function(vc) {
if (![vc isKindOfClass:[UIViewController class]]) throw new Error(invalidParamStr);
return vc.view.recursiveDescription().toString();
};
// 递归打印最上层UIViewController view的层级结构
LYUFrontVcSubViews = function() {
return LYUVcSubviews(_LYUFrontVc(UIApp.keyWindow.rootViewController));
};
// 获取按钮绑定的所有TouchUpInside事件的方法名
LYUBtnTouchUpEvent = function(btn) {
var events = [];
var allTargets = btn.allTargets().allObjects()
var count = allTargets.count;
for (var i = count - 1; i >= 0; i--) {
if (btn != allTargets[i]) {
var e = [btn actionsForTarget:allTargets[i] forControlEvent:UIControlEventTouchUpInside];
events.push(e);
}
}
return events;
};
// CG函数
LYUPointMake = function(x, y) {
return {0 : x, 1 : y};
};
LYUSizeMake = function(w, h) {
return {0 : w, 1 : h};
};
LYURectMake = function(x, y, w, h) {
return {0 : LYUPointMake(x, y), 1 : LYUSizeMake(w, h)};
};
// 递归打印controller的层级结构
LYUChildVcs = function(vc) {
if (![vc isKindOfClass:[UIViewController class]]) throw new Error(invalidParamStr);
return [vc _printHierarchy].toString();
};
// 递归打印view的层级结构
LYUSubviews = function(view) {
if (![view isKindOfClass:[UIView class]]) throw new Error(invalidParamStr);
return view.recursiveDescription().toString();
};
// 判断是否为字符串 "str" @"str"
LYUIsString = function(str) {
return typeof str == 'string' || str instanceof String;
};
// 判断是否为数组 []、@[]
LYUIsArray = function(arr) {
return arr instanceof Array;
};
// 判断是否为数字 666 @666
LYUIsNumber = function(num) {
return typeof num == 'number' || num instanceof Number;
};
var _LYUClass = function(className) {
if (!className) throw new Error(missingParamStr);
if (LYUIsString(className)) {
return NSClassFromString(className);
}
if (!className) throw new Error(invalidParamStr);
// 对象或者类
return className.class();
};
// 打印所有的子类
LYUSubclasses = function(className, reg) {
className = _LYUClass(className);
return [c for each (c in ObjectiveC.classes)
if (c != className
&& class_getSuperclass(c)
&& [c isSubclassOfClass:className]
&& (!reg || reg.test(c)))
];
};
// 打印所有的方法
var _LYUGetMethods = function(className, reg, clazz) {
className = _LYUClass(className);
var count = new new Type('I');
var classObj = clazz ? className.constructor : className;
var methodList = class_copyMethodList(classObj, count);
var methodsArray = [];
var methodNamesArray = [];
for(var i = 0; i < *count; i++) {
var method = methodList[i];
var selector = method_getName(method);
var name = sel_getName(selector);
if (reg && !reg.test(name)) continue;
methodsArray.push({
selector : selector,
type : method_getTypeEncoding(method)
});
methodNamesArray.push(name);
}
free(methodList);
return [methodsArray, methodNamesArray];
};
var _LYUMethods = function(className, reg, clazz) {
return _LYUGetMethods(className, reg, clazz)[0];
};
// 打印所有的方法名字
var _LYUMethodNames = function(className, reg, clazz) {
return _LYUGetMethods(className, reg, clazz)[1];
};
// 打印所有的对象方法
LYUInstanceMethods = function(className, reg) {
return _LYUMethods(className, reg);
};
// 打印所有的对象方法名字
LYUInstanceMethodNames = function(className, reg) {
return _LYUMethodNames(className, reg);
};
// 打印所有的类方法
LYUClassMethods = function(className, reg) {
return _LYUMethods(className, reg, true);
};
// 打印所有的类方法名字
LYUClassMethodNames = function(className, reg) {
return _LYUMethodNames(className, reg, true);
};
// 打印所有的成员变量
LYUIvars = function(obj, reg){
if (!obj) throw new Error(missingParamStr);
var x = {};
for(var i in *obj) {
try {
var value = (*obj)[i];
if (reg && !reg.test(i) && !reg.test(value)) continue;
x[i] = value;
} catch(e){}
}
return x;
};
// 打印所有的成员变量名字
LYUIvarNames = function(obj, reg) {
if (!obj) throw new Error(missingParamStr);
var array = [];
for(var name in *obj) {
if (reg && !reg.test(name)) continue;
array.push(name);
}
return array;
};
})(exports); | Cycript | 4 | smola/language-dataset | data/github.com/lvchenqiang/LYUCript/60f3a2750a79e31e3a4dc0f7f782ade9ca580f2b/lyucript.cy | [
"MIT"
] |
%%
%unicode 4.1
%public
%class UnicodeGeneralCategory_4_1
%type int
%standalone
%include ../../resources/common-unicode-all-enumerated-property-java
%%
<<EOF>> { printOutput(); return 1; }
\p{Cc} { setCurCharPropertyValue("Cc"); }
\p{Cf} { setCurCharPropertyValue("Cf"); }
\p{Cn} { setCurCharPropertyValue("Cn"); }
\p{Co} { setCurCharPropertyValue("Co"); }
\p{Ll} { setCurCharPropertyValue("Ll"); }
\p{Lm} { setCurCharPropertyValue("Lm"); }
\p{Lo} { setCurCharPropertyValue("Lo"); }
\p{Lt} { setCurCharPropertyValue("Lt"); }
\p{Lu} { setCurCharPropertyValue("Lu"); }
\p{Mc} { setCurCharPropertyValue("Mc"); }
\p{Me} { setCurCharPropertyValue("Me"); }
\p{Mn} { setCurCharPropertyValue("Mn"); }
\p{Nd} { setCurCharPropertyValue("Nd"); }
\p{Nl} { setCurCharPropertyValue("Nl"); }
\p{No} { setCurCharPropertyValue("No"); }
\p{Pc} { setCurCharPropertyValue("Pc"); }
\p{Pd} { setCurCharPropertyValue("Pd"); }
\p{Pe} { setCurCharPropertyValue("Pe"); }
\p{Pf} { setCurCharPropertyValue("Pf"); }
\p{Pi} { setCurCharPropertyValue("Pi"); }
\p{Po} { setCurCharPropertyValue("Po"); }
\p{Ps} { setCurCharPropertyValue("Ps"); }
\p{Sc} { setCurCharPropertyValue("Sc"); }
\p{Sk} { setCurCharPropertyValue("Sk"); }
\p{Sm} { setCurCharPropertyValue("Sm"); }
\p{So} { setCurCharPropertyValue("So"); }
\p{Zl} { setCurCharPropertyValue("Zl"); }
\p{Zp} { setCurCharPropertyValue("Zp"); }
\p{Zs} { setCurCharPropertyValue("Zs"); }
| JFlex | 3 | Mivik/jflex | testsuite/testcases/src/test/cases/unicode-general-category/UnicodeGeneralCategory_4_1.flex | [
"BSD-3-Clause"
] |
#!/usr/bin/env jq -f
{
"ulid": .ulid,
"minTime": (.minTime / 1000 | todateiso8601),
"maxTime": (.maxTime / 1000 | todateiso8601),
"stats": .stats,
"thanos": .thanos,
"compaction": {
"level": .compaction.level,
"sources": .compaction.sources,
"sourcesCount": .compaction.sources | length,
"parents": (if .compaction.parents? then [
.compaction.parents[] | {
"ulid": .ulid,
"minTime": (.minTime / 1000 | todateiso8601),
"maxTime": (.maxTime / 1000 | todateiso8601),
}
] else null end)
},
}
| JSONiq | 4 | kiefersmith/thanos | scripts/thanos-block.jq | [
"Apache-2.0"
] |
BEGIN {
# If dir is a slash, return a slash and exit
if (dir == "/") {
print "/"
exit
}
if (cwd !~ dir) {
exit
}
# pos is a position of dir in cwd
pos = rindex(cwd, dir)
# If it is not find the dir in the cwd, then exit
if (pos == 0) {
print cwd
exit
}
# convert the divided directory name to the absolute path
# that the directory name is contained
print erase(cwd, pos+length(dir))
}
# erase erases the part of the path
function erase(str, pos) {
return substr(str, 1, pos-1)
}
# rindex returns the index of the last instance of find in string,
# or 0 if find is not present
function rindex(string, find, k, ns, nf) {
ns = length(string)
nf = length(find)
for (k = ns+1-nf; k >= 1; k--) {
if (substr(string, k, nf) == find) {
if (k > 1 && substr(string, k-1, 1) == "/")
return k
else if (k == 1)
return k
}
}
}
| Awk | 4 | d3dave/enhancd | functions/enhancd/lib/to_abspath.awk | [
"MIT"
] |
; RUN: llc -march=hexagon < %s | FileCheck %s
; CHECK-LABEL: test0000:
; CHECK: v0.h = vasl(v0.h,r0)
define <32 x i16> @test0000(<32 x i16> %a0, i16 %a1) #0 {
%b0 = insertelement <32 x i16> zeroinitializer, i16 %a1, i32 0
%b1 = shufflevector <32 x i16> %b0, <32 x i16> undef, <32 x i32> zeroinitializer
%v0 = shl <32 x i16> %a0, %b1
ret <32 x i16> %v0
}
; CHECK-LABEL: test0001:
; CHECK: v0.h = vasr(v0.h,r0)
define <32 x i16> @test0001(<32 x i16> %a0, i16 %a1) #0 {
%b0 = insertelement <32 x i16> zeroinitializer, i16 %a1, i32 0
%b1 = shufflevector <32 x i16> %b0, <32 x i16> undef, <32 x i32> zeroinitializer
%v0 = ashr <32 x i16> %a0, %b1
ret <32 x i16> %v0
}
; CHECK-LABEL: test0002:
; CHECK: v0.uh = vlsr(v0.uh,r0)
define <32 x i16> @test0002(<32 x i16> %a0, i16 %a1) #0 {
%b0 = insertelement <32 x i16> zeroinitializer, i16 %a1, i32 0
%b1 = shufflevector <32 x i16> %b0, <32 x i16> undef, <32 x i32> zeroinitializer
%v0 = lshr <32 x i16> %a0, %b1
ret <32 x i16> %v0
}
; CHECK-LABEL: test0010:
; CHECK: v0.w = vasl(v0.w,r0)
define <16 x i32> @test0010(<16 x i32> %a0, i32 %a1) #0 {
%b0 = insertelement <16 x i32> zeroinitializer, i32 %a1, i32 0
%b1 = shufflevector <16 x i32> %b0, <16 x i32> undef, <16 x i32> zeroinitializer
%v0 = shl <16 x i32> %a0, %b1
ret <16 x i32> %v0
}
; CHECK-LABEL: test0011:
; CHECK: v0.w = vasr(v0.w,r0)
define <16 x i32> @test0011(<16 x i32> %a0, i32 %a1) #0 {
%b0 = insertelement <16 x i32> zeroinitializer, i32 %a1, i32 0
%b1 = shufflevector <16 x i32> %b0, <16 x i32> undef, <16 x i32> zeroinitializer
%v0 = ashr <16 x i32> %a0, %b1
ret <16 x i32> %v0
}
; CHECK-LABEL: test0012:
; CHECK: v0.uw = vlsr(v0.uw,r0)
define <16 x i32> @test0012(<16 x i32> %a0, i32 %a1) #0 {
%b0 = insertelement <16 x i32> zeroinitializer, i32 %a1, i32 0
%b1 = shufflevector <16 x i32> %b0, <16 x i32> undef, <16 x i32> zeroinitializer
%v0 = lshr <16 x i32> %a0, %b1
ret <16 x i32> %v0
}
; CHECK-LABEL: test0013:
; CHECK: v0.w += vasl(v1.w,r0)
define <16 x i32> @test0013(<16 x i32> %a0, <16 x i32> %a1, i32 %a2) #0 {
%b0 = insertelement <16 x i32> zeroinitializer, i32 %a2, i32 0
%b1 = shufflevector <16 x i32> %b0, <16 x i32> undef, <16 x i32> zeroinitializer
%v0 = shl <16 x i32> %a1, %b1
%v1 = add <16 x i32> %a0, %v0
ret <16 x i32> %v1
}
; CHECK-LABEL: test0014:
; CHECK: v0.w += vasr(v1.w,r0)
define <16 x i32> @test0014(<16 x i32> %a0, <16 x i32> %a1, i32 %a2) #0 {
%b0 = insertelement <16 x i32> zeroinitializer, i32 %a2, i32 0
%b1 = shufflevector <16 x i32> %b0, <16 x i32> undef, <16 x i32> zeroinitializer
%v0 = ashr <16 x i32> %a1, %b1
%v1 = add <16 x i32> %a0, %v0
ret <16 x i32> %v1
}
; CHECK-LABEL: test0020:
; CHECK: v0.h = vasl(v0.h,v1.h)
define <32 x i16> @test0020(<32 x i16> %a0, <32 x i16> %a1) #0 {
%v0 = shl <32 x i16> %a0, %a1
ret <32 x i16> %v0
}
; CHECK-LABEL: test0021:
; CHECK: v0.h = vasr(v0.h,v1.h)
define <32 x i16> @test0021(<32 x i16> %a0, <32 x i16> %a1) #0 {
%v0 = ashr <32 x i16> %a0, %a1
ret <32 x i16> %v0
}
; CHECK-LABEL: test0022:
; CHECK: v0.h = vlsr(v0.h,v1.h)
define <32 x i16> @test0022(<32 x i16> %a0, <32 x i16> %a1) #0 {
%v0 = lshr <32 x i16> %a0, %a1
ret <32 x i16> %v0
}
; CHECK-LABEL: test0030:
; CHECK: v0.w = vasl(v0.w,v1.w)
define <16 x i32> @test0030(<16 x i32> %a0, <16 x i32> %a1) #0 {
%v0 = shl <16 x i32> %a0, %a1
ret <16 x i32> %v0
}
; CHECK-LABEL: test0031:
; CHECK: v0.w = vasr(v0.w,v1.w)
define <16 x i32> @test0031(<16 x i32> %a0, <16 x i32> %a1) #0 {
%v0 = ashr <16 x i32> %a0, %a1
ret <16 x i32> %v0
}
; CHECK-LABEL: test0032:
; CHECK: v0.w = vlsr(v0.w,v1.w)
define <16 x i32> @test0032(<16 x i32> %a0, <16 x i32> %a1) #0 {
%v0 = lshr <16 x i32> %a0, %a1
ret <16 x i32> %v0
}
attributes #0 = { nounwind readnone "target-cpu"="hexagonv60" "target-features"="+hvx,+hvx-length64b" }
| LLVM | 3 | medismailben/llvm-project | llvm/test/CodeGen/Hexagon/autohvx/shift-64b.ll | [
"Apache-2.0"
] |
BlessJ< | PureBasic | 0 | HeliWang/onnx-fixed | onnx/backend/test/data/node/test_less/output_0.pb | [
"MIT"
] |
/*
* Copyright 2006-2007 Adrian Thurston <thurston@colm.net>
* Copyright 2011 Josef Goettgens
*
* Permission is hereby granted, free of charge, to any person obtaining a copy
* of this software and associated documentation files (the "Software"), to
* deal in the Software without restriction, including without limitation the
* rights to use, copy, modify, merge, publish, distribute, sublicense, and/or
* sell copies of the Software, and to permit persons to whom the Software is
* furnished to do so, subject to the following conditions:
*
* The above copyright notice and this permission notice shall be included in all
* copies or substantial portions of the Software.
*
* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
* IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
* FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
* AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
* LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
* OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE
* SOFTWARE.
*/
#include <iostream>
#include <fstream>
#include <string.h>
#include "ragel.h"
#include "rlscan.h"
#include "inputdata.h"
//#define LOG_TOKENS
using std::ifstream;
using std::istream;
using std::ostream;
using std::endl;
enum InlineBlockType
{
CurlyDelimited,
SemiTerminated
};
char *newTokdata( int toklen )
{
char *tokdata = new char[sizeof(TokHead) + toklen + 1];
return tokdata + sizeof(TokHead);
}
void deleteTokdata( char *tokdata )
{
if ( tokdata )
delete[] ( tokdata - sizeof(TokHead) );
}
void linkTokdata( Parser6 *parser, char *tokdata )
{
TokHead *head = (TokHead*)( tokdata - sizeof(TokHead) );
head->next = parser->tokHead;
parser->tokHead = head;
}
void clearTokdata( Parser6 *parser )
{
while ( parser->tokHead != 0 ) {
TokHead *next = parser->tokHead->next;
delete[] (char*)parser->tokHead;
parser->tokHead = next;
}
}
/*
* The Scanner for Importing
*/
%%{
machine inline_token_scan;
alphtype int;
access tok_;
# Import scanner tokens.
import "rlparse.h";
main := |*
# Define of number.
IMP_Define IMP_Word IMP_UInt => {
int base = tok_ts - token_data;
int nameOff = 1;
int numOff = 2;
directToParser( inclToParser, fileName, line, column, TK_Word,
token_strings[base+nameOff], token_lens[base+nameOff] );
directToParser( inclToParser, fileName, line, column, '=', 0, 0 );
directToParser( inclToParser, fileName, line, column, TK_UInt,
token_strings[base+numOff], token_lens[base+numOff] );
directToParser( inclToParser, fileName, line, column, ';', 0, 0 );
};
# Assignment of number.
IMP_Word '=' IMP_UInt => {
int base = tok_ts - token_data;
int nameOff = 0;
int numOff = 2;
directToParser( inclToParser, fileName, line, column, TK_Word,
token_strings[base+nameOff], token_lens[base+nameOff] );
directToParser( inclToParser, fileName, line, column, '=', 0, 0 );
directToParser( inclToParser, fileName, line, column, TK_UInt,
token_strings[base+numOff], token_lens[base+numOff] );
directToParser( inclToParser, fileName, line, column, ';', 0, 0 );
};
# Define of literal.
IMP_Define IMP_Word IMP_Literal => {
int base = tok_ts - token_data;
int nameOff = 1;
int litOff = 2;
directToParser( inclToParser, fileName, line, column, TK_Word,
token_strings[base+nameOff], token_lens[base+nameOff] );
directToParser( inclToParser, fileName, line, column, '=', 0, 0 );
directToParser( inclToParser, fileName, line, column, TK_Literal,
token_strings[base+litOff], token_lens[base+litOff] );
directToParser( inclToParser, fileName, line, column, ';', 0, 0 );
};
# Assignment of literal.
IMP_Word '=' IMP_Literal => {
int base = tok_ts - token_data;
int nameOff = 0;
int litOff = 2;
directToParser( inclToParser, fileName, line, column, TK_Word,
token_strings[base+nameOff], token_lens[base+nameOff] );
directToParser( inclToParser, fileName, line, column, '=', 0, 0 );
directToParser( inclToParser, fileName, line, column, TK_Literal,
token_strings[base+litOff], token_lens[base+litOff] );
directToParser( inclToParser, fileName, line, column, ';', 0, 0 );
};
# Catch everything else.
any;
*|;
}%%
%% write data;
void Scanner::flushImport()
{
int *p = token_data;
int *pe = token_data + cur_token;
int *eof = 0;
%%{
machine inline_token_scan;
write init;
write exec;
}%%
if ( tok_ts == 0 )
cur_token = 0;
else {
cur_token = pe - tok_ts;
int ts_offset = tok_ts - token_data;
memmove( token_data, token_data+ts_offset, cur_token*sizeof(token_data[0]) );
memmove( token_strings, token_strings+ts_offset, cur_token*sizeof(token_strings[0]) );
memmove( token_lens, token_lens+ts_offset, cur_token*sizeof(token_lens[0]) );
}
}
void Scanner::directToParser( Parser6 *toParser, const char *tokFileName, int tokLine,
int tokColumn, int type, char *tokdata, int toklen )
{
InputLoc loc;
#ifdef LOG_TOKENS
cerr << "scanner:" << tokLine << ":" << tokColumn <<
": sending token to the parser " << Parser6_lelNames[type];
cerr << " " << toklen;
if ( tokdata != 0 )
cerr << " " << tokdata;
cerr << endl;
#endif
loc.fileName = tokFileName;
loc.line = tokLine;
loc.col = tokColumn;
toParser->token( loc, type, tokdata, toklen );
}
void Scanner::importToken( int token, char *start, char *end )
{
if ( cur_token == max_tokens )
flushImport();
token_data[cur_token] = token;
if ( start == 0 ) {
token_strings[cur_token] = 0;
token_lens[cur_token] = 0;
}
else {
int toklen = end-start;
token_lens[cur_token] = toklen;
token_strings[cur_token] = new char[toklen+1];
memcpy( token_strings[cur_token], start, toklen );
token_strings[cur_token][toklen] = 0;
}
cur_token++;
}
void Scanner::pass()
{
if ( sectionPass )
return;
updateCol();
/* If no errors and we are at the bottom of the include stack (the
* source file listed on the command line) then write out the data. */
if ( includeDepth == 0 && id->machineSpec == 0 && id->machineName == 0 )
id->curItem->data.write( ts, te-ts );
}
void Scanner::pass( int token, char *start, char *end )
{
if ( sectionPass )
return;
if ( importMachines )
importToken( token, start, end );
pass();
}
/*
* The scanner for processing sections, includes, imports, etc.
*/
%%{
machine section_parse;
alphtype int;
write data;
}%%
void Scanner::init( )
{
%% write init;
}
bool Scanner::active()
{
if ( ignoreSection )
return false;
if ( parser == 0 && ! parserExistsError ) {
id->error(scan_loc()) << "this specification has no name, nor does any previous"
" specification" << endl;
parserExistsError = true;
}
if ( parser == 0 )
return false;
return true;
}
InputLoc Scanner::scan_loc()
{
return makeInputLoc( fileName, line, column );
}
void Scanner::updateCol()
{
char *from = lastnl;
if ( from == 0 )
from = ts;
column += te - from;
lastnl = 0;
}
void Scanner::handleMachine()
{
if ( sectionPass ) {
/* Assign a name to the machine. */
char *machine = word;
SectionDictEl *sdEl = id->sectionDict.find( machine );
if ( sdEl == 0 ) {
sdEl = new SectionDictEl( machine );
sdEl->value = new Section( machine );
id->sectionDict.insert( sdEl );
}
section = sdEl->value;
}
else {
/* Assign a name to the machine. */
char *machine = word;
if ( !importMachines && inclSectionTarg == 0 ) {
ignoreSection = false;
ParserDictEl *pdEl = id->parserDict.find( machine );
if ( pdEl == 0 ) {
pdEl = new ParserDictEl( machine );
pdEl->value = new Parser6( id, fileName, machine, sectionLoc,
id->hostLang, id->minimizeLevel, id->minimizeOpt );
pdEl->value->init();
id->parserDict.insert( pdEl );
id->parserList.append( pdEl->value );
/* Also into the parse data dict. This is the new style. */
ParseDataDictEl *pddEl = new ParseDataDictEl( machine );
pddEl->value = pdEl->value->pd;
id->parseDataDict.insert( pddEl );
id->parseDataList.append( pddEl->value );
}
parser = pdEl->value;
}
else if ( !importMachines && strcmp( inclSectionTarg, machine ) == 0 ) {
/* found include target */
ignoreSection = false;
parser = inclToParser;
}
else {
/* ignoring section */
ignoreSection = true;
parser = 0;
}
}
}
void Scanner::handleInclude()
{
if ( sectionPass )
return;
if ( active() ) {
char *inclSectionName = word;
const char **includeChecks = 0;
/* Implement defaults for the input file and section name. */
if ( inclSectionName == 0 )
inclSectionName = parser->sectionName;
if ( lit != 0 ) {
long length = 0;
bool caseInsensitive = false;
char *data = prepareLitString( id, InputLoc(), lit, lit_len, length, caseInsensitive );
includeChecks = parser->pd->id->makeIncludePathChecks( fileName, data );
}
else {
char *test = new char[strlen(fileName)+1];
strcpy( test, fileName );
includeChecks = new const char*[2];
includeChecks[0] = test;
includeChecks[1] = 0;
}
long found = 0;
ifstream *inFile = parser->pd->id->tryOpenInclude( includeChecks, found );
if ( inFile == 0 ) {
id->error(scan_loc()) << "include: failed to locate file" << endl;
const char **tried = includeChecks;
while ( *tried != 0 )
id->error(scan_loc()) << "include: attempted: \"" << *tried++ << '\"' << endl;
}
else {
/* Don't include anything that's already been included. */
if ( !parser->pd->duplicateInclude( includeChecks[found], inclSectionName ) ) {
parser->pd->includeHistory.push_back( IncludeHistoryItem(
includeChecks[found], inclSectionName ) );
Scanner scanner( id, includeChecks[found], *inFile, parser,
inclSectionName, includeDepth+1, false );
scanner.do_scan( );
}
delete inFile;
}
}
}
void Scanner::handleImport()
{
if ( sectionPass )
return;
if ( active() ) {
long length = 0;
bool caseInsensitive = false;
char *data = prepareLitString( id, InputLoc(), lit, lit_len, length, caseInsensitive );
const char **importChecks = parser->pd->id->makeIncludePathChecks( fileName, data );
/* Open the input file for reading. */
long found = 0;
ifstream *inFile = parser->pd->id->tryOpenInclude( importChecks, found );
if ( inFile == 0 ) {
id->error(scan_loc()) << "import: could not open import file " <<
"for reading" << endl;
const char **tried = importChecks;
while ( *tried != 0 )
id->error(scan_loc()) << "import: attempted: \"" << *tried++ << '\"' << endl;
}
Scanner scanner( id, importChecks[found], *inFile, parser,
0, includeDepth+1, true );
scanner.do_scan( );
scanner.importToken( 0, 0, 0 );
scanner.flushImport();
delete inFile;
}
}
%%{
machine section_parse;
# Need the defines representing tokens.
import "rlparse.h";
action clear_words { word = lit = 0; word_len = lit_len = 0; }
action store_word { word = tokdata; word_len = toklen; }
action store_lit { lit = tokdata; lit_len = toklen; }
action mach_err { id->error(scan_loc()) << "bad machine statement" << endl; }
action incl_err { id->error(scan_loc()) << "bad include statement" << endl; }
action import_err { id->error(scan_loc()) << "bad import statement" << endl; }
action write_err { id->error(scan_loc()) << "bad write statement" << endl; }
action handle_machine { handleMachine(); }
action handle_include { handleInclude(); }
action handle_import { handleImport(); }
machine_stmt =
( KW_Machine TK_Word @store_word ';' ) @handle_machine
<>err mach_err <>eof mach_err;
include_names = (
TK_Word @store_word ( TK_Literal @store_lit )? |
TK_Literal @store_lit
) >clear_words;
include_stmt =
( KW_Include include_names ';' ) @handle_include
<>err incl_err <>eof incl_err;
import_stmt =
( KW_Import TK_Literal @store_lit ';' ) @handle_import
<>err import_err <>eof import_err;
action write_command
{
if ( sectionPass ) {
InputItem *inputItem = new InputItem;
inputItem->type = InputItem::Write;
inputItem->loc.fileName = fileName;
inputItem->loc.line = line;
inputItem->loc.col = column;
inputItem->name = section->sectionName;
inputItem->section = section;
/* Track the last reference. */
inputItem->section->lastReference = inputItem;
id->inputItems.append( inputItem );
}
else {
if ( includeDepth == 0 && active() &&
id->machineSpec == 0 && id->machineName == 0 )
{
id->curItem = id->curItem->next;
id->curItem->pd = parser->pd;
id->curItem->parser = parser;
id->checkLastRef( id->curItem );
}
}
}
action write_arg
{
if ( sectionPass ) {
}
else {
if ( active() && id->machineSpec == 0 && id->machineName == 0 )
id->curItem->writeArgs.push_back( strdup(tokdata) );
}
}
action write_close
{
if ( sectionPass ) {
}
else {
/* if ( active() && id->machineSpec == 0 && id->machineName == 0 )
* id->curItem->writeArgs.append( 0 ); */
}
}
write_stmt =
( KW_Write @write_command
( TK_Word @write_arg )+ ';' @write_close )
<>err write_err <>eof write_err;
action handle_token
{
if ( sectionPass ) {
deleteTokdata( tokdata );
}
else {
/* Send the token off to the parser. */
if ( active() ) {
if ( tokdata != 0 ) {
linkTokdata( parser, tokdata );
}
directToParser( parser, fileName, line, column, type, tokdata, toklen );
}
else {
deleteTokdata( tokdata );
}
}
}
# Catch everything else.
everything_else =
^( KW_Machine | KW_Include | KW_Import | KW_Write ) @handle_token;
main := (
machine_stmt |
include_stmt |
import_stmt |
write_stmt |
everything_else
)*;
}%%
void Scanner::token( int type, char c )
{
token( type, &c, &c + 1 );
}
void Scanner::token( int type )
{
token( type, 0, 0 );
}
void Scanner::token( int type, char *start, char *end )
{
char *tokdata = 0;
int toklen = 0;
if ( start != 0 ) {
toklen = end-start;
tokdata = newTokdata( toklen + 1 );
memcpy( tokdata, start, toklen );
tokdata[toklen] = 0;
}
processToken( type, tokdata, toklen );
}
void Scanner::processToken( int type, char *tokdata, int toklen )
{
int *p, *pe, *eof;
if ( type < 0 )
p = pe = eof = 0;
else {
p = &type;
pe = &type + 1;
eof = 0;
}
%%{
machine section_parse;
write exec;
}%%
updateCol();
/* Record the last token for use in controlling the scan of subsequent
* tokens. */
lastToken = type;
}
void Scanner::startSection( )
{
parserExistsError = false;
sectionLoc.fileName = fileName;
sectionLoc.line = line;
sectionLoc.col = column;
}
void Scanner::endSection( )
{
/* Execute the eof actions for the section parser. */
processToken( -1, 0, 0 );
if ( sectionPass ) {
InputItem *inputItem = new InputItem;
inputItem->type = InputItem::EndSection;
inputItem->loc.fileName = fileName;
inputItem->loc.line = line;
inputItem->loc.col = column;
id->inputItems.append( inputItem );
if ( section != 0 ) {
inputItem->section = section;
section->lastReference = inputItem;
}
if ( includeDepth == 0 ) {
if ( id->machineSpec == 0 && id->machineName == 0 ) {
/* The end section may include a newline on the end, so
* we use the last line, which will count the newline. */
InputItem *inputItem = new InputItem;
inputItem->type = InputItem::HostData;
inputItem->loc.fileName = fileName;
inputItem->loc.line = line;
inputItem->loc.col = column;
id->inputItems.append( inputItem );
}
}
}
else {
/* Close off the section with the parser. */
if ( includeDepth == 0 && active() ) {
InputLoc loc;
loc.fileName = fileName;
loc.line = line;
loc.col = column;
parser->token( loc, TK_EndSection, 0, 0 );
id->curItem = id->curItem->next;
if ( parser != 0 ) {
id->curItem->pd = parser->pd;
id->curItem->parser = parser;
}
id->checkLastRef( id->curItem );
}
if ( includeDepth == 0 ) {
if ( id->machineSpec == 0 && id->machineName == 0 ) {
id->curItem = id->curItem->next;
id->checkLastRef( id->curItem );
}
}
}
}
%%{
machine rlscan;
# This is sent by the driver code.
EOF = 0;
action inc_nl {
lastnl = p;
column = 0;
line++;
}
NL = '\n' @inc_nl;
# Identifiers, numbers, commetns, and other common things.
ident = ( alpha | '_' ) ( alpha |digit |'_' )*;
ocaml_ident = ( alpha | '_' ) ( alpha |digit |'_' )* "'"?;
number = digit+;
hex_number = '0x' [0-9a-fA-F]+;
c_comment =
'/*' ( any | NL )* :>> '*/';
cpp_comment =
'//' [^\n]* NL;
c_cpp_comment = c_comment | cpp_comment;
ruby_comment = '#' [^\n]* NL;
# These literal forms are common to host code and ragel.
s_literal = "'" ([^'\\] | NL | '\\' (any | NL))* "'";
d_literal = '"' ([^"\\] | NL | '\\' (any | NL))* '"';
host_re_literal = '/' ([^/\\] | NL | '\\' (any | NL))* '/';
whitespace = [ \t] | NL;
pound_comment = '#' [^\n]* NL;
# An inline block of code for languages other than Ruby.
inline_code := |*
# Inline expression keywords.
"fpc" => { token( KW_PChar ); };
"fc" => { token( KW_Char ); };
"fcurs" => { token( KW_CurState ); };
"ftargs" => { token( KW_TargState ); };
"fentry" => {
whitespaceOn = false;
token( KW_Entry );
};
# Inline statement keywords.
"fhold" => {
whitespaceOn = false;
token( KW_Hold );
};
"fexec" => { token( KW_Exec, 0, 0 ); };
"fgoto" => {
whitespaceOn = false;
token( KW_Goto );
};
"fnext" => {
whitespaceOn = false;
token( KW_Next );
};
"fcall" => {
whitespaceOn = false;
token( KW_Call );
};
"fret" => {
whitespaceOn = false;
token( KW_Ret );
};
"fbreak" => {
whitespaceOn = false;
token( KW_Break );
};
"fncall" => {
whitespaceOn = false;
token( KW_Ncall );
};
"fnret" => {
whitespaceOn = false;
token( KW_Nret );
};
"fnbreak" => {
whitespaceOn = false;
token( KW_Nbreak );
};
ident => { token( TK_Word, ts, te ); };
number => { token( TK_UInt, ts, te ); };
hex_number => { token( TK_Hex, ts, te ); };
( s_literal | d_literal )
=> { token( IL_Literal, ts, te ); };
whitespace+ => {
if ( whitespaceOn )
token( IL_WhiteSpace, ts, te );
};
c_cpp_comment => { token( IL_Comment, ts, te ); };
"::" => { token( TK_NameSep, ts, te ); };
# Some symbols need to go to the parser as with their cardinal value as
# the token type (as opposed to being sent as anonymous symbols)
# because they are part of the sequences which we interpret. The * ) ;
# symbols cause whitespace parsing to come back on. This gets turned
# off by some keywords.
";" => {
whitespaceOn = true;
token( *ts, ts, te );
if ( inlineBlockType == SemiTerminated )
fret;
};
"$" [a-zA-Z_][a-zA-Z_0-9]* => {
if ( parser != 0 && parser->parseSubstitutions )
token( TK_SubstRef, ts+1, te );
else {
token( IL_Symbol, ts, ts+1 );
fexec ts+1;
}
};
[*)] => {
whitespaceOn = true;
token( *ts, ts, te );
};
[,(] => { token( *ts, ts, te ); };
'{' => {
token( IL_Symbol, ts, te );
curly_count += 1;
};
'}' => {
if ( --curly_count == 0 && inlineBlockType == CurlyDelimited ) {
/* Inline code block ends. */
token( '}' );
fret;
}
else {
/* Either a semi terminated inline block or only the closing
* brace of some inner scope, not the block's closing brace. */
token( IL_Symbol, ts, te );
}
};
EOF => {
id->error(scan_loc()) << "unterminated code block" << endl;
};
# Send every other character as a symbol.
any => { token( IL_Symbol, ts, te ); };
*|;
or_literal := |*
# Escape sequences in OR expressions.
'\\0' => { token( RE_Char, '\0' ); };
'\\a' => { token( RE_Char, '\a' ); };
'\\b' => { token( RE_Char, '\b' ); };
'\\t' => { token( RE_Char, '\t' ); };
'\\n' => { token( RE_Char, '\n' ); };
'\\v' => { token( RE_Char, '\v' ); };
'\\f' => { token( RE_Char, '\f' ); };
'\\r' => { token( RE_Char, '\r' ); };
'\\\n' => { updateCol(); };
'\\' any => { token( RE_Char, ts+1, te ); };
# Range dash in an OR expression.
'-' => { token( RE_Dash, 0, 0 ); };
# Terminate an OR expression.
']' => { token( RE_SqClose ); fret; };
EOF => {
id->error(scan_loc()) << "unterminated OR literal" << endl;
};
# Characters in an OR expression.
[^\]] => { token( RE_Char, ts, te ); };
*|;
ragel_re_literal := |*
# Escape sequences in regular expressions.
'\\0' => { token( RE_Char, '\0' ); };
'\\a' => { token( RE_Char, '\a' ); };
'\\b' => { token( RE_Char, '\b' ); };
'\\t' => { token( RE_Char, '\t' ); };
'\\n' => { token( RE_Char, '\n' ); };
'\\v' => { token( RE_Char, '\v' ); };
'\\f' => { token( RE_Char, '\f' ); };
'\\r' => { token( RE_Char, '\r' ); };
'\\\n' => { updateCol(); };
'\\' any => { token( RE_Char, ts+1, te ); };
# Terminate an OR expression.
'/' [i]? => {
token( RE_Slash, ts, te );
fgoto parser_def;
};
# Special characters.
'.' => { token( RE_Dot ); };
'*' => { token( RE_Star ); };
'[' => { token( RE_SqOpen ); fcall or_literal; };
'[^' => { token( RE_SqOpenNeg ); fcall or_literal; };
EOF => {
id->error(scan_loc()) << "unterminated regular expression" << endl;
};
# Characters in an OR expression.
[^\/] => { token( RE_Char, ts, te ); };
*|;
# We need a separate token space here to avoid the ragel keywords.
write_statement := |*
ident => { token( TK_Word, ts, te ); } ;
[ \t\n]+ => { updateCol(); };
';' => { token( ';' ); fgoto parser_def; };
EOF => {
id->error(scan_loc()) << "unterminated write statement" << endl;
};
*|;
# Parser definitions.
parser_def := |*
#'length_cond' => { token( KW_Length ); };
'machine' => { token( KW_Machine ); };
'include' => { token( KW_Include ); };
'import' => { token( KW_Import ); };
'write' => {
token( KW_Write );
fgoto write_statement;
};
'action' => { token( KW_Action ); };
'alphtype' => { token( KW_AlphType ); };
'prepush' => { token( KW_PrePush ); };
'postpop' => { token( KW_PostPop ); };
'nfaprepush' => { token( KW_NfaPrePush ); };
'nfapostpop' => { token( KW_NfaPostPop ); };
# FIXME: Enable this post 5.17.
# 'range' => { token( KW_Range ); };
'getkey' => {
token( KW_GetKey );
inlineBlockType = SemiTerminated;
fcall inline_code;
};
'access' => {
token( KW_Access );
inlineBlockType = SemiTerminated;
fcall inline_code;
};
'variable' => {
token( KW_Variable );
inlineBlockType = SemiTerminated;
fcall inline_code;
};
'when' => { token( KW_When ); };
'inwhen' => { token( KW_InWhen ); };
'outwhen' => { token( KW_OutWhen ); };
'eof' => { token( KW_Eof ); };
'err' => { token( KW_Err ); };
'lerr' => { token( KW_Lerr ); };
'to' => { token( KW_To ); };
'from' => { token( KW_From ); };
'export' => { token( KW_Export ); };
# Identifiers.
ident => { token( TK_Word, ts, te ); } ;
# Numbers
number => { token( TK_UInt, ts, te ); };
hex_number => { token( TK_Hex, ts, te ); };
# Literals, with optionals.
( s_literal | d_literal ) [i]?
=> { token( TK_Literal, ts, te ); };
'[' => { token( RE_SqOpen ); fcall or_literal; };
'[^' => { token( RE_SqOpenNeg ); fcall or_literal; };
'/' => { token( RE_Slash ); fgoto ragel_re_literal; };
# Ignore.
pound_comment => { updateCol(); };
':=' => { token( TK_ColonEquals ); };
'|=' => { token( TK_BarEquals ); };
# To State Actions.
">~" => { token( TK_StartToState ); };
"$~" => { token( TK_AllToState ); };
"%~" => { token( TK_FinalToState ); };
"<~" => { token( TK_NotStartToState ); };
"@~" => { token( TK_NotFinalToState ); };
"<>~" => { token( TK_MiddleToState ); };
# From State actions
">*" => { token( TK_StartFromState ); };
"$*" => { token( TK_AllFromState ); };
"%*" => { token( TK_FinalFromState ); };
"<*" => { token( TK_NotStartFromState ); };
"@*" => { token( TK_NotFinalFromState ); };
"<>*" => { token( TK_MiddleFromState ); };
# EOF Actions.
">/" => { token( TK_StartEOF ); };
"$/" => { token( TK_AllEOF ); };
"%/" => { token( TK_FinalEOF ); };
"</" => { token( TK_NotStartEOF ); };
"@/" => { token( TK_NotFinalEOF ); };
"<>/" => { token( TK_MiddleEOF ); };
# Global Error actions.
">!" => { token( TK_StartGblError ); };
"$!" => { token( TK_AllGblError ); };
"%!" => { token( TK_FinalGblError ); };
"<!" => { token( TK_NotStartGblError ); };
"@!" => { token( TK_NotFinalGblError ); };
"<>!" => { token( TK_MiddleGblError ); };
# Local error actions.
">^" => { token( TK_StartLocalError ); };
"$^" => { token( TK_AllLocalError ); };
"%^" => { token( TK_FinalLocalError ); };
"<^" => { token( TK_NotStartLocalError ); };
"@^" => { token( TK_NotFinalLocalError ); };
"<>^" => { token( TK_MiddleLocalError ); };
# Middle.
"<>" => { token( TK_Middle ); };
# Conditions.
'>?' => { token( TK_StartCond ); };
'$?' => { token( TK_AllCond ); };
'%?' => { token( TK_LeavingCond ); };
'..' => { token( TK_DotDot ); };
'../i' => { token( TK_DotDotIndep ); };
'**' => { token( TK_StarStar ); };
'--' => { token( TK_DashDash ); };
'->' => { token( TK_Arrow ); };
'=>' => { token( TK_DoubleArrow ); };
":>" => { token( TK_ColonGt ); };
":>>" => { token( TK_ColonGtGt ); };
"<:" => { token( TK_LtColon ); };
":nfa(" => { token( TK_ColonNfaOpen ); };
":cond(" => { token( TK_ColonCondOpen ); };
":condstar(" => { token( TK_ColonCondStarOpen ); };
":condplus(" => { token( TK_ColonCondPlusOpen ); };
":nomax(" => { token( TK_ColonNoMaxOpen ); };
"):" => { token( TK_CloseColon ); };
# Opening of longest match.
"|*" => { token( TK_BarStar ); };
# Separater for name references.
"::" => { token( TK_NameSep, ts, te ); };
'}%%' => {
updateCol();
endSection();
fret;
};
[ \t\r]+ => { updateCol(); };
# If we are in a single line machine then newline may end the spec.
NL => {
updateCol();
if ( singleLineSpec ) {
endSection();
fret;
}
};
'{' => {
if ( lastToken == KW_Export || lastToken == KW_Entry )
token( '{' );
else {
token( '{' );
curly_count = 1;
inlineBlockType = CurlyDelimited;
fcall inline_code;
}
};
EOF => {
id->error(scan_loc()) << "unterminated ragel section" << endl;
};
any => { token( *ts ); } ;
*|;
# Outside code scanner. These tokens get passed through.
main := |*
'define' => { pass( IMP_Define, 0, 0 ); };
ident => { pass( IMP_Word, ts, te ); };
number => { pass( IMP_UInt, ts, te ); };
c_cpp_comment => { pass(); };
( s_literal | d_literal ) => { pass( IMP_Literal, ts, te ); };
'%%{' => {
updateCol();
singleLineSpec = false;
startSection();
fcall parser_def;
};
'%%' => {
updateCol();
singleLineSpec = true;
startSection();
fcall parser_def;
};
whitespace+ => { pass(); };
EOF;
any => { pass( *ts, 0, 0 ); };
*|;
}%%
%% write data;
void Scanner::do_scan()
{
int bufsize = 8;
char *buf = new char[bufsize];
int cs, act, have = 0;
int top;
/* The stack is two deep, one level for going into ragel defs from the main
* machines which process outside code, and another for going into or literals
* from either a ragel spec, or a regular expression. */
int stack[2];
int curly_count = 0;
bool execute = true;
bool singleLineSpec = false;
InlineBlockType inlineBlockType = CurlyDelimited;
line = 1;
column = 1;
lastnl = 0;
/* Init the section parser and the character scanner. */
init();
%% write init;
/* Set up the start state. FIXME: After 5.20 is released the nocs write
* init option should be used, the main machine eliminated and this statement moved
* above the write init. */
cs = rlscan_en_main;
while ( execute ) {
char *p = buf + have;
int space = bufsize - have;
if ( space == 0 ) {
/* We filled up the buffer trying to scan a token. Grow it. */
bufsize = bufsize * 2;
char *newbuf = new char[bufsize];
/* Recompute p and space. */
p = newbuf + have;
space = bufsize - have;
/* Patch up pointers possibly in use. */
if ( ts != 0 )
ts = newbuf + ( ts - buf );
te = newbuf + ( te - buf );
/* Copy the new buffer in. */
memcpy( newbuf, buf, have );
delete[] buf;
buf = newbuf;
}
input.read( p, space );
int len = input.gcount();
char *pe = p + len;
/* If we see eof then append the eof var. */
char *eof = 0;
if ( len == 0 ) {
eof = pe;
execute = false;
}
%% write exec;
/* Check if we failed. */
if ( cs == rlscan_error ) {
/* Machine failed before finding a token. I'm not yet sure if this
* is reachable. */
id->error(scan_loc()) << "scanner error" << endl;
id->abortCompile( 1 );
}
/* Decide if we need to preserve anything. */
char *preserve = ts;
/* Now set up the prefix. */
if ( preserve == 0 )
have = 0;
else {
/* There is data that needs to be shifted over. */
have = pe - preserve;
memmove( buf, preserve, have );
unsigned int shiftback = preserve - buf;
if ( ts != 0 )
ts -= shiftback;
te -= shiftback;
preserve = buf;
}
}
delete[] buf;
}
| Ragel in Ruby Host | 4 | podsvirov/colm-suite | ragel/rlscan.rl | [
"MIT"
] |
# Copyright (c) Microsoft Corporation.
# Licensed under the MIT License.
Describe "Get-Uptime" -Tags "CI" {
BeforeAll {
$IsHighResolution = [system.diagnostics.stopwatch]::IsHighResolution
# Skip Get-Uptime test if IsHighResolution = false
# because stopwatch.GetTimestamp() return DateTime.UtcNow.Ticks
# instead of ticks from system startup
if ( ! $IsHighResolution )
{
$origDefaults = $PSDefaultParameterValues.Clone()
$PSDefaultParameterValues['it:skip'] = $true
}
}
AfterAll {
if ( ! $IsHighResolution ){
$global:PSDefaultParameterValues = $origDefaults
}
}
It "Get-Uptime return timespan (default -Timespan)" {
$upt = Get-Uptime
$upt | Should -BeOfType Timespan
}
It "Get-Uptime -Since return DateTime" {
$upt = Get-Uptime -Since
$upt | Should -BeOfType DateTime
}
It "Get-Uptime throw if IsHighResolution == false" {
# Enable the test hook
[system.management.automation.internal.internaltesthooks]::SetTestHook('StopwatchIsNotHighResolution', $true)
try {
{ Get-Uptime } | Should -Throw -ErrorId "GetUptimePlatformIsNotSupported,Microsoft.PowerShell.Commands.GetUptimeCommand"
} finally {
# Disable the test hook
[system.management.automation.internal.internaltesthooks]::SetTestHook('StopwatchIsHighResolutionIsFalse', $false)
}
}
}
| PowerShell | 5 | rdtechie/PowerShell | test/powershell/Modules/Microsoft.PowerShell.Utility/Get-Uptime.Tests.ps1 | [
"MIT"
] |
[[getting-started]]
= Getting Started
To use the Spring Boot Maven Plugin, include the appropriate XML in the `plugins` section of your `pom.xml`, as shown in the following example:
[source,xml,indent=0,subs="verbatim,attributes",tabsize=4]
----
include::../maven/getting-started/pom.xml[tags=getting-started]
----
If you use a milestone or snapshot release, you also need to add the appropriate `pluginRepository` elements, as shown in the following listing:
[source,xml,indent=0,subs="verbatim,attributes",tabsize=4]
----
include::../maven/getting-started/plugin-repositories-pom.xml[tags=plugin-repositories]
----
| AsciiDoc | 3 | techAi007/spring-boot | spring-boot-project/spring-boot-tools/spring-boot-maven-plugin/src/docs/asciidoc/getting-started.adoc | [
"Apache-2.0"
] |
--TEST--
Test vfprintf() function : basic functionality - bool format
--FILE--
<?php
echo "*** Testing vfprintf() : basic functionality - using bool format ***\n";
// Initialise all required variables
$format = "format";
$format1 = "%b";
$format2 = "%b %b";
$format3 = "%b %b %b";
$arg1 = array(TRUE);
$arg2 = array(TRUE,FALSE);
$arg3 = array(TRUE,FALSE,TRUE);
/* creating dumping file */
$data_file = __DIR__ . '/vfprintf_basic4.txt';
if (!($fp = fopen($data_file, 'wt')))
return;
vfprintf($fp, $format1,$arg1);
fprintf($fp, "\n");
vfprintf($fp, $format2,$arg2);
fprintf($fp, "\n");
vfprintf($fp, $format3,$arg3);
fprintf($fp, "\n");
fclose($fp);
print_r(file_get_contents($data_file));
unlink($data_file);
?>
--EXPECT--
*** Testing vfprintf() : basic functionality - using bool format ***
1
1 0
1 0 1
| PHP | 4 | NathanFreeman/php-src | ext/standard/tests/strings/vfprintf_basic4.phpt | [
"PHP-3.01"
] |
import itertools
from rich.style import Style
from rich.table import _Cell
from rich.tabulate import tabulate_mapping
def test_tabulate_mapping():
# TODO: tabulate_mapping may not be needed shortly
table = tabulate_mapping({"foo": "1", "bar": "2"})
assert len(table.columns) == 2
assert len(table.columns[0]._cells) == 2
assert len(table.columns[1]._cells) == 2
# add tests for title and caption justification
test_title = "Foo v. Bar"
test_caption = "approximate results"
for title_justify, caption_justify in itertools.product(
[None, "left", "center", "right"], repeat=2
):
table = tabulate_mapping(
{"foo": "1", "bar": "2"},
title=test_title,
caption=test_caption,
title_justify=title_justify,
caption_justify=caption_justify,
)
expected_title_justify = (
title_justify if title_justify is not None else "center"
)
expected_caption_justify = (
caption_justify if caption_justify is not None else "center"
)
assert expected_title_justify == table.title_justify
assert expected_caption_justify == table.caption_justify
| Python | 3 | traviscook21/rich | tests/test_tabulate.py | [
"MIT"
] |
CREATE DATABASE IF NOT EXISTS `appwrite` /*!40100 DEFAULT CHARACTER SET utf8mb4 */;
USE `appwrite`;
CREATE TABLE IF NOT EXISTS `template.abuse.abuse` (
`id` int(11) NOT NULL AUTO_INCREMENT,
`_key` varchar(255) NOT NULL,
`_time` varchar(45) NOT NULL,
`_count` int(11) NOT NULL DEFAULT '0',
PRIMARY KEY (`id`),
UNIQUE KEY `unique1` (`_key`,`_time`),
KEY `index1` (`_key`,`_time`)
) ENGINE=InnoDB DEFAULT CHARSET=utf8mb4;
CREATE TABLE IF NOT EXISTS `template.audit.audit` (
`id` int(11) NOT NULL AUTO_INCREMENT,
`userId` varchar(45) NOT NULL,
`userType` int(11) NOT NULL,
`event` varchar(45) NOT NULL,
`resource` varchar(45) DEFAULT NULL,
`userAgent` text NOT NULL,
`ip` varchar(45) NOT NULL,
`location` varchar(45) DEFAULT NULL,
`time` datetime NOT NULL,
`data` longtext DEFAULT NULL,
PRIMARY KEY (`id`),
UNIQUE KEY `id_UNIQUE` (`id`),
KEY `index_1` (`userId`,`userType`),
KEY `index_2` (`event`),
KEY `index_3` (`resource`)
) ENGINE=InnoDB DEFAULT CHARSET=utf8mb4;
CREATE TABLE IF NOT EXISTS `template.database.documents` (
`id` int(11) NOT NULL AUTO_INCREMENT COMMENT 'Unique ID for each node',
`uid` varchar(45) DEFAULT NULL,
`status` int(11) NOT NULL DEFAULT 0,
`createdAt` datetime DEFAULT NULL,
`updatedAt` datetime DEFAULT NULL,
`signature` varchar(32) NOT NULL,
`revision` varchar(45) NOT NULL,
`permissions` longtext CHARACTER SET utf8mb4 COLLATE utf8mb4_bin DEFAULT NULL,
PRIMARY KEY (`id`),
UNIQUE KEY `id_UNIQUE` (`id`),
UNIQUE KEY `index2` (`uid`),
KEY `index3` (`signature`,`uid`,`revision`)
) ENGINE=InnoDB DEFAULT CHARSET=utf8mb4;
CREATE TABLE IF NOT EXISTS `template.database.properties` (
`id` int(11) NOT NULL AUTO_INCREMENT COMMENT 'Primary Key',
`documentUid` varchar(45) NOT NULL COMMENT 'Unique UID foreign key',
`documentRevision` varchar(45) NOT NULL,
`key` varchar(32) NOT NULL COMMENT 'Property key name',
`value` text NOT NULL COMMENT 'Value of property',
`primitive` varchar(32) NOT NULL COMMENT 'Primitive type of property value',
`array` tinyint(4) NOT NULL DEFAULT 0,
`order` int(11) NOT NULL,
PRIMARY KEY (`id`),
KEY `index1` (`documentUid`),
KEY `index2` (`key`,`value`(5)),
FULLTEXT KEY `index3` (`value`)
) ENGINE=InnoDB DEFAULT CHARSET=utf8mb4;
CREATE TABLE IF NOT EXISTS `template.database.relationships` (
`id` int(11) NOT NULL AUTO_INCREMENT,
`revision` varchar(45) NOT NULL,
`start` varchar(45) NOT NULL COMMENT 'Unique UID foreign key',
`end` varchar(45) NOT NULL COMMENT 'Unique UID foreign key',
`key` varchar(256) NOT NULL,
`path` int(11) NOT NULL DEFAULT 0,
`array` tinyint(4) NOT NULL DEFAULT 0,
`order` int(11) NOT NULL DEFAULT 0,
PRIMARY KEY (`id`),
KEY `relationships_start_nodes_id_idx` (`start`),
KEY `relationships_end_nodes_id_idx` (`end`)
) ENGINE=InnoDB DEFAULT CHARSET=utf8mb4;
/* Default App */
CREATE TABLE IF NOT EXISTS `app_console.database.documents` LIKE `template.database.documents`;
CREATE TABLE IF NOT EXISTS `app_console.database.properties` LIKE `template.database.properties`;
CREATE TABLE IF NOT EXISTS `app_console.database.relationships` LIKE `template.database.relationships`;
CREATE TABLE IF NOT EXISTS `app_console.audit.audit` LIKE `template.audit.audit`;
CREATE TABLE IF NOT EXISTS `app_console.abuse.abuse` LIKE `template.abuse.abuse`; | SQL | 4 | nakshatrasinghh/appwrite | tests/resources/docker/mariadb/all.sql | [
"BSD-3-Clause"
] |
package com.alibaba.json.bvt.parser;
import java.io.StringReader;
import junit.framework.TestCase;
import org.junit.Assert;
import com.alibaba.fastjson.JSONReader;
public class JSONReaderScannerTest_enum extends TestCase {
public void test_e() throws Exception {
JSONReader reader = new JSONReader(new StringReader("{type:'AA'}"));
VO vo2 = reader.readObject(VO.class);
Assert.assertEquals(Type.AA, vo2.getType());
reader.close();
}
public static class VO {
private Type type;
public Type getType() {
return type;
}
public void setType(Type type) {
this.type = type;
}
}
public static enum Type {
AA, BB, CC
}
}
| Java | 4 | Czarek93/fastjson | src/test/java/com/alibaba/json/bvt/parser/JSONReaderScannerTest_enum.java | [
"Apache-2.0"
] |
;------------------- Loanding the Simulated Annealing Library -------------------
__includes ["SimulatedAnnealing.nls"]
; ----------- One extension for weighted random choices -----------------
extensions [rnd]
;------------------ Model Specific Procedures -----------------------------------
patches-own [
value
block
fails
]
globals [
Initial-state
]
; Create the world with NxN patches and draws the board
to setup
clear-all
ask patches [
set block (3 * int (pycor / 3)) + 1 + int (pxcor / 3)
set value 1 + pxcor
set plabel block
set pcolor scale-color black block -1 11
]
set Initial-state map [p -> [value] of p] (sort patches)
repeat 100 [
let i random 81
let j random 81
set Initial-state swap i j Initial-state
]
pass-to-patches Initial-state
update-view
end
to-report swap [i j s]
let temp item i s
let s1 replace-item i s (item j s)
let s2 replace-item j s1 temp
report s2
end
; Launch the Simulated Annealing search, and after having the solution,
; put the queens following that solution
to launch
let res AI:SimAnn Initial-state
tries-by-cycle
(10 ^ -6)
cooling-rate
true
update-view
end
;------------------------ Customzable procedures --------------------------------
; These three procedures (AI:...) must be customized for solving general
; problems
; One simple operator: change 2 values randomly
to-report AI:get-new-state2 [#state]
let i random 81
let j random 81
report swap i j #state
end
; One more complex operator: change 2 values among the ones with higher fails
to-report AI:get-new-state [#state]
pass-to-patches #state
compute-fails
let p1 rnd:weighted-one-of patches [fails + 1]
let p2 rnd:weighted-one-of patches [fails + 1]
let i position p1 (sort patches)
let j position p2 (sort patches)
report swap i j #state
end
; Energy state function: Sum of fails of cells
to-report AI:EnergyState [#state]
pass-to-patches #state
compute-fails
report sum [fails] of patches
end
; External Update to be executed in every cycle main loop
to AI:SimAnnExternalUpdates [params]
pass-to-patches params
update-view
plot AI:SimAnnGlobalEnergy
display
end
; ----------- Auxiliary procedures ------------------
; Put the state values on patches values
to pass-to-patches [#state]
(foreach #state (sort patches)[
[v p] ->
ask p [ set value v ]
])
end
; Show the values
to update-view
ask patches [set plabel value]
end
; Compute fails of every cell and color it by fitness
to compute-fails
ask patches [
set fails (same-in-row + same-in-column + same-in-block)
]
let M max [fails] of patches
ask patches [
set plabel-color ifelse-value (fails > 0) [scale-color red fails 0 (2 * M)] [black]
]
end
; Patch report: number of other patches with the same value in the same row
to-report same-in-row
let x pxcor
report -1 + length filter [ v -> v = value ] ([value] of patches with [pxcor = x])
end
; Patch report: number of other patches with the same value in the same column
to-report same-in-column
let y pycor
report -1 + length filter [ v -> v = value ] ([value] of patches with [pycor = y])
end
; Patch report: number of other patches with the same value in the same block
to-report same-in-block
let b block
report -1 + length filter [ v -> v = value ] ([value] of patches with [block = b])
end
@#$#@#$#@
GRAPHICS-WINDOW
210
10
434
235
-1
-1
24.0
1
24
1
1
1
0
1
1
1
0
8
0
8
1
1
1
ticks
30.0
BUTTON
13
10
103
43
NIL
setup
NIL
1
T
OBSERVER
NIL
NIL
NIL
NIL
1
BUTTON
108
10
198
43
NIL
launch
NIL
1
T
OBSERVER
NIL
NIL
NIL
NIL
1
SLIDER
13
100
193
133
cooling-rate
cooling-rate
0
50
1.0
0.1
1
%
HORIZONTAL
MONITOR
14
139
101
184
Temp
AI:SimAnnTemperature
10
1
11
MONITOR
112
140
192
185
Energy
AI:SimAnnGlobalEnergy
4
1
11
PLOT
12
190
192
340
Global Energy
time
energy
0.0
10.0
0.0
10.0
true
false
"" ""
PENS
"default" 1.0 0 -2674135 true "" ""
SLIDER
13
55
193
88
tries-by-cycle
tries-by-cycle
1
100
10.0
1
1
NIL
HORIZONTAL
@#$#@#$#@
@#$#@#$#@
default
true
0
Polygon -7500403 true true 150 5 40 250 150 205 260 250
airplane
true
0
Polygon -7500403 true true 150 0 135 15 120 60 120 105 15 165 15 195 120 180 135 240 105 270 120 285 150 270 180 285 210 270 165 240 180 180 285 195 285 165 180 105 180 60 165 15
arrow
true
0
Polygon -7500403 true true 150 0 0 150 105 150 105 293 195 293 195 150 300 150
box
false
0
Polygon -7500403 true true 150 285 285 225 285 75 150 135
Polygon -7500403 true true 150 135 15 75 150 15 285 75
Polygon -7500403 true true 15 75 15 225 150 285 150 135
Line -16777216 false 150 285 150 135
Line -16777216 false 150 135 15 75
Line -16777216 false 150 135 285 75
bug
true
0
Circle -7500403 true true 96 182 108
Circle -7500403 true true 110 127 80
Circle -7500403 true true 110 75 80
Line -7500403 true 150 100 80 30
Line -7500403 true 150 100 220 30
butterfly
true
0
Polygon -7500403 true true 150 165 209 199 225 225 225 255 195 270 165 255 150 240
Polygon -7500403 true true 150 165 89 198 75 225 75 255 105 270 135 255 150 240
Polygon -7500403 true true 139 148 100 105 55 90 25 90 10 105 10 135 25 180 40 195 85 194 139 163
Polygon -7500403 true true 162 150 200 105 245 90 275 90 290 105 290 135 275 180 260 195 215 195 162 165
Polygon -16777216 true false 150 255 135 225 120 150 135 120 150 105 165 120 180 150 165 225
Circle -16777216 true false 135 90 30
Line -16777216 false 150 105 195 60
Line -16777216 false 150 105 105 60
car
false
0
Polygon -7500403 true true 300 180 279 164 261 144 240 135 226 132 213 106 203 84 185 63 159 50 135 50 75 60 0 150 0 165 0 225 300 225 300 180
Circle -16777216 true false 180 180 90
Circle -16777216 true false 30 180 90
Polygon -16777216 true false 162 80 132 78 134 135 209 135 194 105 189 96 180 89
Circle -7500403 true true 47 195 58
Circle -7500403 true true 195 195 58
circle
false
0
Circle -7500403 true true 0 0 300
circle 2
false
0
Circle -7500403 true true 0 0 300
Circle -16777216 true false 30 30 240
cow
false
0
Polygon -7500403 true true 200 193 197 249 179 249 177 196 166 187 140 189 93 191 78 179 72 211 49 209 48 181 37 149 25 120 25 89 45 72 103 84 179 75 198 76 252 64 272 81 293 103 285 121 255 121 242 118 224 167
Polygon -7500403 true true 73 210 86 251 62 249 48 208
Polygon -7500403 true true 25 114 16 195 9 204 23 213 25 200 39 123
cylinder
false
0
Circle -7500403 true true 0 0 300
dot
false
0
Circle -7500403 true true 90 90 120
face happy
false
0
Circle -7500403 true true 8 8 285
Circle -16777216 true false 60 75 60
Circle -16777216 true false 180 75 60
Polygon -16777216 true false 150 255 90 239 62 213 47 191 67 179 90 203 109 218 150 225 192 218 210 203 227 181 251 194 236 217 212 240
face neutral
false
0
Circle -7500403 true true 8 7 285
Circle -16777216 true false 60 75 60
Circle -16777216 true false 180 75 60
Rectangle -16777216 true false 60 195 240 225
face sad
false
0
Circle -7500403 true true 8 8 285
Circle -16777216 true false 60 75 60
Circle -16777216 true false 180 75 60
Polygon -16777216 true false 150 168 90 184 62 210 47 232 67 244 90 220 109 205 150 198 192 205 210 220 227 242 251 229 236 206 212 183
fish
false
0
Polygon -1 true false 44 131 21 87 15 86 0 120 15 150 0 180 13 214 20 212 45 166
Polygon -1 true false 135 195 119 235 95 218 76 210 46 204 60 165
Polygon -1 true false 75 45 83 77 71 103 86 114 166 78 135 60
Polygon -7500403 true true 30 136 151 77 226 81 280 119 292 146 292 160 287 170 270 195 195 210 151 212 30 166
Circle -16777216 true false 215 106 30
flag
false
0
Rectangle -7500403 true true 60 15 75 300
Polygon -7500403 true true 90 150 270 90 90 30
Line -7500403 true 75 135 90 135
Line -7500403 true 75 45 90 45
flower
false
0
Polygon -10899396 true false 135 120 165 165 180 210 180 240 150 300 165 300 195 240 195 195 165 135
Circle -7500403 true true 85 132 38
Circle -7500403 true true 130 147 38
Circle -7500403 true true 192 85 38
Circle -7500403 true true 85 40 38
Circle -7500403 true true 177 40 38
Circle -7500403 true true 177 132 38
Circle -7500403 true true 70 85 38
Circle -7500403 true true 130 25 38
Circle -7500403 true true 96 51 108
Circle -16777216 true false 113 68 74
Polygon -10899396 true false 189 233 219 188 249 173 279 188 234 218
Polygon -10899396 true false 180 255 150 210 105 210 75 240 135 240
house
false
0
Rectangle -7500403 true true 45 120 255 285
Rectangle -16777216 true false 120 210 180 285
Polygon -7500403 true true 15 120 150 15 285 120
Line -16777216 false 30 120 270 120
leaf
false
0
Polygon -7500403 true true 150 210 135 195 120 210 60 210 30 195 60 180 60 165 15 135 30 120 15 105 40 104 45 90 60 90 90 105 105 120 120 120 105 60 120 60 135 30 150 15 165 30 180 60 195 60 180 120 195 120 210 105 240 90 255 90 263 104 285 105 270 120 285 135 240 165 240 180 270 195 240 210 180 210 165 195
Polygon -7500403 true true 135 195 135 240 120 255 105 255 105 285 135 285 165 240 165 195
line
true
0
Line -7500403 true 150 0 150 300
line half
true
0
Line -7500403 true 150 0 150 150
pentagon
false
0
Polygon -7500403 true true 150 15 15 120 60 285 240 285 285 120
person
false
0
Circle -7500403 true true 110 5 80
Polygon -7500403 true true 105 90 120 195 90 285 105 300 135 300 150 225 165 300 195 300 210 285 180 195 195 90
Rectangle -7500403 true true 127 79 172 94
Polygon -7500403 true true 195 90 240 150 225 180 165 105
Polygon -7500403 true true 105 90 60 150 75 180 135 105
plant
false
0
Rectangle -7500403 true true 135 90 165 300
Polygon -7500403 true true 135 255 90 210 45 195 75 255 135 285
Polygon -7500403 true true 165 255 210 210 255 195 225 255 165 285
Polygon -7500403 true true 135 180 90 135 45 120 75 180 135 210
Polygon -7500403 true true 165 180 165 210 225 180 255 120 210 135
Polygon -7500403 true true 135 105 90 60 45 45 75 105 135 135
Polygon -7500403 true true 165 105 165 135 225 105 255 45 210 60
Polygon -7500403 true true 135 90 120 45 150 15 180 45 165 90
square
false
0
Rectangle -7500403 true true 30 30 270 270
square 2
false
0
Rectangle -7500403 true true 30 30 270 270
Rectangle -16777216 true false 60 60 240 240
star
false
0
Polygon -7500403 true true 151 1 185 108 298 108 207 175 242 282 151 216 59 282 94 175 3 108 116 108
target
false
0
Circle -7500403 true true 0 0 300
Circle -16777216 true false 30 30 240
Circle -7500403 true true 60 60 180
Circle -16777216 true false 90 90 120
Circle -7500403 true true 120 120 60
tree
false
0
Circle -7500403 true true 118 3 94
Rectangle -6459832 true false 120 195 180 300
Circle -7500403 true true 65 21 108
Circle -7500403 true true 116 41 127
Circle -7500403 true true 45 90 120
Circle -7500403 true true 104 74 152
triangle
false
0
Polygon -7500403 true true 150 30 15 255 285 255
triangle 2
false
0
Polygon -7500403 true true 150 30 15 255 285 255
Polygon -16777216 true false 151 99 225 223 75 224
truck
false
0
Rectangle -7500403 true true 4 45 195 187
Polygon -7500403 true true 296 193 296 150 259 134 244 104 208 104 207 194
Rectangle -1 true false 195 60 195 105
Polygon -16777216 true false 238 112 252 141 219 141 218 112
Circle -16777216 true false 234 174 42
Rectangle -7500403 true true 181 185 214 194
Circle -16777216 true false 144 174 42
Circle -16777216 true false 24 174 42
Circle -7500403 false true 24 174 42
Circle -7500403 false true 144 174 42
Circle -7500403 false true 234 174 42
turtle
true
0
Polygon -10899396 true false 215 204 240 233 246 254 228 266 215 252 193 210
Polygon -10899396 true false 195 90 225 75 245 75 260 89 269 108 261 124 240 105 225 105 210 105
Polygon -10899396 true false 105 90 75 75 55 75 40 89 31 108 39 124 60 105 75 105 90 105
Polygon -10899396 true false 132 85 134 64 107 51 108 17 150 2 192 18 192 52 169 65 172 87
Polygon -10899396 true false 85 204 60 233 54 254 72 266 85 252 107 210
Polygon -7500403 true true 119 75 179 75 209 101 224 135 220 225 175 261 128 261 81 224 74 135 88 99
wheel
false
0
Circle -7500403 true true 3 3 294
Circle -16777216 true false 30 30 240
Line -7500403 true 150 285 150 15
Line -7500403 true 15 150 285 150
Circle -7500403 true true 120 120 60
Line -7500403 true 216 40 79 269
Line -7500403 true 40 84 269 221
Line -7500403 true 40 216 269 79
Line -7500403 true 84 40 221 269
x
false
0
Polygon -7500403 true true 270 75 225 30 30 225 75 270
Polygon -7500403 true true 30 75 75 30 270 225 225 270
@#$#@#$#@
NetLogo 6.0.4
@#$#@#$#@
@#$#@#$#@
@#$#@#$#@
@#$#@#$#@
@#$#@#$#@
default
0.0
-0.2 0 0.0 1.0
0.0 1 1.0 0.0
0.2 0 0.0 1.0
link direction
true
0
Line -7500403 true 150 150 90 180
Line -7500403 true 150 150 210 180
@#$#@#$#@
0
@#$#@#$#@
| NetLogo | 5 | fsancho/IA | 04. Local Search/Simulated Annealing Sudoku.nlogo | [
"MIT"
] |
BsizesJ | PureBasic | 0 | cnheider/onnx | onnx/backend/test/data/node/test_resize_upsample_sizes_nearest_round_prefer_ceil_asymmetric/test_data_set_0/input_3.pb | [
"MIT"
] |
<link rel="stylesheet" href="bootstrap/css/bootstrap.min.css"/>
<script src="js/jquery-3.0.0.min.js" type="text/javascript"></script>
<script src="js/jquery.form.min.js" type="text/javascript"></script>
<script src="bootstrap/js/bootstrap.min.js" type="text/javascript"></script>
<script src="js/watermark.js" type="text/javascript"></script>
<script src="js/base64.min.js" type="text/javascript"></script>
<script>
/**
* 初始化水印
*/
function initWaterMark() {
let watermarkTxt = '${watermarkTxt}';
if (watermarkTxt !== '') {
watermark.init({
watermark_txt: '${watermarkTxt}',
watermark_x: 0,
watermark_y: 0,
watermark_rows: 0,
watermark_cols: 0,
watermark_x_space: ${watermarkXSpace},
watermark_y_space: ${watermarkYSpace},
watermark_font: '${watermarkFont}',
watermark_fontsize: '${watermarkFontsize}',
watermark_color: '${watermarkColor}',
watermark_alpha: ${watermarkAlpha},
watermark_width: ${watermarkWidth},
watermark_height: ${watermarkHeight},
watermark_angle: ${watermarkAngle},
});
}
}
</script>
<style>
* {
margin: 0;
padding: 0;
}
html, body {
height: 100%;
width: 100%;
}
</style>
| FreeMarker | 4 | jerrykcode/kkFileView | server/src/main/resources/web/commonHeader.ftl | [
"Apache-2.0"
] |
<?xml version="1.0" encoding="UTF-8"?>
<!-- generated with COPASI 4.30 (Build 235) (http://www.copasi.org) at 2020-12-24T14:28:54Z -->
<?oxygen RNGSchema="http://www.copasi.org/static/schema/CopasiML.rng" type="xml"?>
<COPASI xmlns="http://www.copasi.org/static/schema" versionMajor="4" versionMinor="30" versionDevel="235" copasiSourcesModified="0">
<ListOfFunctions>
<Function key="Function_13" name="Mass action (irreversible)" type="MassAction" reversible="false">
<MiriamAnnotation>
<rdf:RDF xmlns:CopasiMT="http://www.copasi.org/RDF/MiriamTerms#" xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#">
<rdf:Description rdf:about="#Function_13">
<CopasiMT:is rdf:resource="urn:miriam:obo.sbo:SBO:0000163" />
</rdf:Description>
</rdf:RDF>
</MiriamAnnotation>
<Comment>
<body xmlns="http://www.w3.org/1999/xhtml">
<b>Mass action rate law for irreversible reactions</b>
<p>
Reaction scheme where the products are created from the reactants and the change of a product quantity is proportional to the product of reactant activities. The reaction scheme does not include any reverse process that creates the reactants from the products. The change of a product quantity is proportional to the quantity of one reactant.
</p>
</body>
</Comment>
<Expression>
k1*PRODUCT<substrate_i>
</Expression>
<ListOfParameterDescriptions>
<ParameterDescription key="FunctionParameter_80" name="k1" order="0" role="constant"/>
<ParameterDescription key="FunctionParameter_81" name="substrate" order="1" role="substrate"/>
</ListOfParameterDescriptions>
</Function>
</ListOfFunctions>
<Model key="Model_1" name="Verwer1994" simulationType="time" timeUnit="s" volumeUnit="ml" areaUnit="m²" lengthUnit="m" quantityUnit="mmol" type="deterministic" avogadroConstant="6.0221408570000002e+23">
<MiriamAnnotation>
<rdf:RDF
xmlns:CopasiMT="http://www.copasi.org/RDF/MiriamTerms#"
xmlns:dcterms="http://purl.org/dc/terms/"
xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#"
xmlns:vCard="http://www.w3.org/2001/vcard-rdf/3.0#">
<rdf:Description rdf:about="#Model_1">
<dcterms:bibliographicCitation>
<rdf:Description>
<dcterms:description>Gauss-Seidel Iteration for Stiff ODEs from Chemical Kinetics (1994)</dcterms:description>
<CopasiMT:isDescribedBy rdf:resource="urn:miriam:doi:doi=10.1.1.54.4916"/>
</rdf:Description>
</dcterms:bibliographicCitation>
<dcterms:created>
<rdf:Description>
<dcterms:W3CDTF>2018-11-22T10:17:29Z</dcterms:W3CDTF>
</rdf:Description>
</dcterms:created>
<dcterms:creator>
<rdf:Description>
<vCard:EMAIL>abgupta@uchc.edu</vCard:EMAIL>
<vCard:N>
<rdf:Description>
<vCard:Family>Gupta</vCard:Family>
<vCard:Given>Abhishekh</vCard:Given>
</rdf:Description>
</vCard:N>
<vCard:ORG>
<rdf:Description>
<vCard:Orgname>University of Connecticut Health Center</vCard:Orgname>
</rdf:Description>
</vCard:ORG>
</rdf:Description>
</dcterms:creator>
</rdf:Description>
</rdf:RDF>
</MiriamAnnotation>
<Comment>
<body xmlns="http://www.w3.org/1999/xhtml"><h1> Pollution Problem </h1>
<p> It is the chemical reaction part of the air pollution model developed at The Dutch National Institute of Public Health and Environmental Protection (RIVM) and it is described by Verwer [1].</p>
<p> [1] J.G. Verwer. Gauss-Seidel iteration for stiff ODEs from chemical kinetics. SIAM J. Sci. Comput., 15(5): 1243-1259,1994.</p></body>
</Comment>
<ListOfCompartments>
<Compartment key="Compartment_1" name="compartment" simulationType="fixed" dimensionality="3" addNoise="false">
<MiriamAnnotation>
<rdf:RDF xmlns:dcterms="http://purl.org/dc/terms/" xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#">
<rdf:Description rdf:about="#Compartment_1">
<dcterms:created>
<rdf:Description>
<dcterms:W3CDTF>2020-12-24T13:56:52Z</dcterms:W3CDTF>
</rdf:Description>
</dcterms:created>
</rdf:Description>
</rdf:RDF>
</MiriamAnnotation>
</Compartment>
</ListOfCompartments>
<ListOfMetabolites>
<Metabolite key="Metabolite_20" name="NO" simulationType="reactions" compartment="Compartment_1" addNoise="false">
<MiriamAnnotation>
<rdf:RDF xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#" />
</MiriamAnnotation>
</Metabolite>
<Metabolite key="Metabolite_21" name="NO2" simulationType="reactions" compartment="Compartment_1" addNoise="false">
<MiriamAnnotation>
<rdf:RDF xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#" />
</MiriamAnnotation>
</Metabolite>
<Metabolite key="Metabolite_22" name="O3" simulationType="reactions" compartment="Compartment_1" addNoise="false">
<MiriamAnnotation>
<rdf:RDF xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#" />
</MiriamAnnotation>
</Metabolite>
<Metabolite key="Metabolite_23" name="HO2" simulationType="reactions" compartment="Compartment_1" addNoise="false">
<MiriamAnnotation>
<rdf:RDF xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#" />
</MiriamAnnotation>
</Metabolite>
<Metabolite key="Metabolite_24" name="OH" simulationType="reactions" compartment="Compartment_1" addNoise="false">
<MiriamAnnotation>
<rdf:RDF xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#" />
</MiriamAnnotation>
</Metabolite>
<Metabolite key="Metabolite_25" name="CO" simulationType="reactions" compartment="Compartment_1" addNoise="false">
<MiriamAnnotation>
<rdf:RDF xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#" />
</MiriamAnnotation>
</Metabolite>
<Metabolite key="Metabolite_26" name="HCHO" simulationType="reactions" compartment="Compartment_1" addNoise="false">
<MiriamAnnotation>
<rdf:RDF xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#" />
</MiriamAnnotation>
</Metabolite>
<Metabolite key="Metabolite_27" name="ALD" simulationType="reactions" compartment="Compartment_1" addNoise="false">
<MiriamAnnotation>
<rdf:RDF xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#" />
</MiriamAnnotation>
</Metabolite>
<Metabolite key="Metabolite_28" name="MEO2" simulationType="reactions" compartment="Compartment_1" addNoise="false">
<MiriamAnnotation>
<rdf:RDF xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#" />
</MiriamAnnotation>
</Metabolite>
<Metabolite key="Metabolite_29" name="C2O3" simulationType="reactions" compartment="Compartment_1" addNoise="false">
<MiriamAnnotation>
<rdf:RDF xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#" />
</MiriamAnnotation>
</Metabolite>
<Metabolite key="Metabolite_30" name="CO2" simulationType="reactions" compartment="Compartment_1" addNoise="false">
<MiriamAnnotation>
<rdf:RDF xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#" />
</MiriamAnnotation>
</Metabolite>
<Metabolite key="Metabolite_31" name="PAN" simulationType="reactions" compartment="Compartment_1" addNoise="false">
<MiriamAnnotation>
<rdf:RDF xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#" />
</MiriamAnnotation>
</Metabolite>
<Metabolite key="Metabolite_32" name="CH3O" simulationType="reactions" compartment="Compartment_1" addNoise="false">
<MiriamAnnotation>
<rdf:RDF xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#" />
</MiriamAnnotation>
</Metabolite>
<Metabolite key="Metabolite_33" name="HNO3" simulationType="reactions" compartment="Compartment_1" addNoise="false">
<MiriamAnnotation>
<rdf:RDF xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#" />
</MiriamAnnotation>
</Metabolite>
<Metabolite key="Metabolite_34" name="O3P" simulationType="reactions" compartment="Compartment_1" addNoise="false">
<MiriamAnnotation>
<rdf:RDF xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#" />
</MiriamAnnotation>
</Metabolite>
<Metabolite key="Metabolite_35" name="O1D" simulationType="reactions" compartment="Compartment_1" addNoise="false">
<MiriamAnnotation>
<rdf:RDF xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#" />
</MiriamAnnotation>
</Metabolite>
<Metabolite key="Metabolite_36" name="SO2" simulationType="reactions" compartment="Compartment_1" addNoise="false">
<MiriamAnnotation>
<rdf:RDF xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#" />
</MiriamAnnotation>
</Metabolite>
<Metabolite key="Metabolite_37" name="SO4" simulationType="reactions" compartment="Compartment_1" addNoise="false">
<MiriamAnnotation>
<rdf:RDF xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#" />
</MiriamAnnotation>
</Metabolite>
<Metabolite key="Metabolite_38" name="NO3" simulationType="reactions" compartment="Compartment_1" addNoise="false">
<MiriamAnnotation>
<rdf:RDF xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#" />
</MiriamAnnotation>
</Metabolite>
<Metabolite key="Metabolite_39" name="N2O5" simulationType="reactions" compartment="Compartment_1" addNoise="false">
<MiriamAnnotation>
<rdf:RDF xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#" />
</MiriamAnnotation>
</Metabolite>
</ListOfMetabolites>
<ListOfModelValues>
<ModelValue key="ModelValue_25" name="k1" simulationType="fixed" addNoise="false">
<MiriamAnnotation>
<rdf:RDF xmlns:dcterms="http://purl.org/dc/terms/" xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#">
<rdf:Description rdf:about="#ModelValue_25">
<dcterms:created>
<rdf:Description>
<dcterms:W3CDTF>2020-12-24T13:56:52Z</dcterms:W3CDTF>
</rdf:Description>
</dcterms:created>
</rdf:Description>
</rdf:RDF>
</MiriamAnnotation>
</ModelValue>
<ModelValue key="ModelValue_26" name="k2" simulationType="fixed" addNoise="false">
<MiriamAnnotation>
<rdf:RDF xmlns:dcterms="http://purl.org/dc/terms/" xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#">
<rdf:Description rdf:about="#ModelValue_26">
<dcterms:created>
<rdf:Description>
<dcterms:W3CDTF>2020-12-24T13:56:52Z</dcterms:W3CDTF>
</rdf:Description>
</dcterms:created>
</rdf:Description>
</rdf:RDF>
</MiriamAnnotation>
</ModelValue>
<ModelValue key="ModelValue_27" name="k3" simulationType="fixed" addNoise="false">
<MiriamAnnotation>
<rdf:RDF xmlns:dcterms="http://purl.org/dc/terms/" xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#">
<rdf:Description rdf:about="#ModelValue_27">
<dcterms:created>
<rdf:Description>
<dcterms:W3CDTF>2020-12-24T13:56:52Z</dcterms:W3CDTF>
</rdf:Description>
</dcterms:created>
</rdf:Description>
</rdf:RDF>
</MiriamAnnotation>
</ModelValue>
<ModelValue key="ModelValue_28" name="k4" simulationType="fixed" addNoise="false">
<MiriamAnnotation>
<rdf:RDF xmlns:dcterms="http://purl.org/dc/terms/" xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#">
<rdf:Description rdf:about="#ModelValue_28">
<dcterms:created>
<rdf:Description>
<dcterms:W3CDTF>2020-12-24T13:56:52Z</dcterms:W3CDTF>
</rdf:Description>
</dcterms:created>
</rdf:Description>
</rdf:RDF>
</MiriamAnnotation>
</ModelValue>
<ModelValue key="ModelValue_29" name="k5" simulationType="fixed" addNoise="false">
<MiriamAnnotation>
<rdf:RDF xmlns:dcterms="http://purl.org/dc/terms/" xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#">
<rdf:Description rdf:about="#ModelValue_29">
<dcterms:created>
<rdf:Description>
<dcterms:W3CDTF>2020-12-24T13:56:52Z</dcterms:W3CDTF>
</rdf:Description>
</dcterms:created>
</rdf:Description>
</rdf:RDF>
</MiriamAnnotation>
</ModelValue>
<ModelValue key="ModelValue_30" name="k6" simulationType="fixed" addNoise="false">
<MiriamAnnotation>
<rdf:RDF xmlns:dcterms="http://purl.org/dc/terms/" xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#">
<rdf:Description rdf:about="#ModelValue_30">
<dcterms:created>
<rdf:Description>
<dcterms:W3CDTF>2020-12-24T13:56:52Z</dcterms:W3CDTF>
</rdf:Description>
</dcterms:created>
</rdf:Description>
</rdf:RDF>
</MiriamAnnotation>
</ModelValue>
<ModelValue key="ModelValue_31" name="k7" simulationType="fixed" addNoise="false">
<MiriamAnnotation>
<rdf:RDF xmlns:dcterms="http://purl.org/dc/terms/" xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#">
<rdf:Description rdf:about="#ModelValue_31">
<dcterms:created>
<rdf:Description>
<dcterms:W3CDTF>2020-12-24T13:56:52Z</dcterms:W3CDTF>
</rdf:Description>
</dcterms:created>
</rdf:Description>
</rdf:RDF>
</MiriamAnnotation>
</ModelValue>
<ModelValue key="ModelValue_32" name="k8" simulationType="fixed" addNoise="false">
<MiriamAnnotation>
<rdf:RDF xmlns:dcterms="http://purl.org/dc/terms/" xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#">
<rdf:Description rdf:about="#ModelValue_32">
<dcterms:created>
<rdf:Description>
<dcterms:W3CDTF>2020-12-24T13:56:52Z</dcterms:W3CDTF>
</rdf:Description>
</dcterms:created>
</rdf:Description>
</rdf:RDF>
</MiriamAnnotation>
</ModelValue>
<ModelValue key="ModelValue_33" name="k9" simulationType="fixed" addNoise="false">
<MiriamAnnotation>
<rdf:RDF xmlns:dcterms="http://purl.org/dc/terms/" xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#">
<rdf:Description rdf:about="#ModelValue_33">
<dcterms:created>
<rdf:Description>
<dcterms:W3CDTF>2020-12-24T13:56:52Z</dcterms:W3CDTF>
</rdf:Description>
</dcterms:created>
</rdf:Description>
</rdf:RDF>
</MiriamAnnotation>
</ModelValue>
<ModelValue key="ModelValue_34" name="k10" simulationType="fixed" addNoise="false">
<MiriamAnnotation>
<rdf:RDF xmlns:dcterms="http://purl.org/dc/terms/" xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#">
<rdf:Description rdf:about="#ModelValue_34">
<dcterms:created>
<rdf:Description>
<dcterms:W3CDTF>2020-12-24T13:56:52Z</dcterms:W3CDTF>
</rdf:Description>
</dcterms:created>
</rdf:Description>
</rdf:RDF>
</MiriamAnnotation>
</ModelValue>
<ModelValue key="ModelValue_35" name="k11" simulationType="fixed" addNoise="false">
<MiriamAnnotation>
<rdf:RDF xmlns:dcterms="http://purl.org/dc/terms/" xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#">
<rdf:Description rdf:about="#ModelValue_35">
<dcterms:created>
<rdf:Description>
<dcterms:W3CDTF>2020-12-24T13:56:52Z</dcterms:W3CDTF>
</rdf:Description>
</dcterms:created>
</rdf:Description>
</rdf:RDF>
</MiriamAnnotation>
</ModelValue>
<ModelValue key="ModelValue_36" name="k12" simulationType="fixed" addNoise="false">
<MiriamAnnotation>
<rdf:RDF xmlns:dcterms="http://purl.org/dc/terms/" xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#">
<rdf:Description rdf:about="#ModelValue_36">
<dcterms:created>
<rdf:Description>
<dcterms:W3CDTF>2020-12-24T13:56:52Z</dcterms:W3CDTF>
</rdf:Description>
</dcterms:created>
</rdf:Description>
</rdf:RDF>
</MiriamAnnotation>
</ModelValue>
<ModelValue key="ModelValue_37" name="k13" simulationType="fixed" addNoise="false">
<MiriamAnnotation>
<rdf:RDF xmlns:dcterms="http://purl.org/dc/terms/" xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#">
<rdf:Description rdf:about="#ModelValue_37">
<dcterms:created>
<rdf:Description>
<dcterms:W3CDTF>2020-12-24T13:56:52Z</dcterms:W3CDTF>
</rdf:Description>
</dcterms:created>
</rdf:Description>
</rdf:RDF>
</MiriamAnnotation>
</ModelValue>
<ModelValue key="ModelValue_38" name="k14" simulationType="fixed" addNoise="false">
<MiriamAnnotation>
<rdf:RDF xmlns:dcterms="http://purl.org/dc/terms/" xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#">
<rdf:Description rdf:about="#ModelValue_38">
<dcterms:created>
<rdf:Description>
<dcterms:W3CDTF>2020-12-24T13:56:52Z</dcterms:W3CDTF>
</rdf:Description>
</dcterms:created>
</rdf:Description>
</rdf:RDF>
</MiriamAnnotation>
</ModelValue>
<ModelValue key="ModelValue_39" name="k15" simulationType="fixed" addNoise="false">
<MiriamAnnotation>
<rdf:RDF xmlns:dcterms="http://purl.org/dc/terms/" xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#">
<rdf:Description rdf:about="#ModelValue_39">
<dcterms:created>
<rdf:Description>
<dcterms:W3CDTF>2020-12-24T13:56:52Z</dcterms:W3CDTF>
</rdf:Description>
</dcterms:created>
</rdf:Description>
</rdf:RDF>
</MiriamAnnotation>
</ModelValue>
<ModelValue key="ModelValue_40" name="k16" simulationType="fixed" addNoise="false">
<MiriamAnnotation>
<rdf:RDF xmlns:dcterms="http://purl.org/dc/terms/" xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#">
<rdf:Description rdf:about="#ModelValue_40">
<dcterms:created>
<rdf:Description>
<dcterms:W3CDTF>2020-12-24T13:56:52Z</dcterms:W3CDTF>
</rdf:Description>
</dcterms:created>
</rdf:Description>
</rdf:RDF>
</MiriamAnnotation>
</ModelValue>
<ModelValue key="ModelValue_41" name="k17" simulationType="fixed" addNoise="false">
<MiriamAnnotation>
<rdf:RDF xmlns:dcterms="http://purl.org/dc/terms/" xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#">
<rdf:Description rdf:about="#ModelValue_41">
<dcterms:created>
<rdf:Description>
<dcterms:W3CDTF>2020-12-24T13:56:52Z</dcterms:W3CDTF>
</rdf:Description>
</dcterms:created>
</rdf:Description>
</rdf:RDF>
</MiriamAnnotation>
</ModelValue>
<ModelValue key="ModelValue_42" name="k18" simulationType="fixed" addNoise="false">
<MiriamAnnotation>
<rdf:RDF xmlns:dcterms="http://purl.org/dc/terms/" xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#">
<rdf:Description rdf:about="#ModelValue_42">
<dcterms:created>
<rdf:Description>
<dcterms:W3CDTF>2020-12-24T13:56:52Z</dcterms:W3CDTF>
</rdf:Description>
</dcterms:created>
</rdf:Description>
</rdf:RDF>
</MiriamAnnotation>
</ModelValue>
<ModelValue key="ModelValue_43" name="k19" simulationType="fixed" addNoise="false">
<MiriamAnnotation>
<rdf:RDF xmlns:dcterms="http://purl.org/dc/terms/" xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#">
<rdf:Description rdf:about="#ModelValue_43">
<dcterms:created>
<rdf:Description>
<dcterms:W3CDTF>2020-12-24T13:56:52Z</dcterms:W3CDTF>
</rdf:Description>
</dcterms:created>
</rdf:Description>
</rdf:RDF>
</MiriamAnnotation>
</ModelValue>
<ModelValue key="ModelValue_44" name="k20" simulationType="fixed" addNoise="false">
<MiriamAnnotation>
<rdf:RDF xmlns:dcterms="http://purl.org/dc/terms/" xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#">
<rdf:Description rdf:about="#ModelValue_44">
<dcterms:created>
<rdf:Description>
<dcterms:W3CDTF>2020-12-24T13:56:52Z</dcterms:W3CDTF>
</rdf:Description>
</dcterms:created>
</rdf:Description>
</rdf:RDF>
</MiriamAnnotation>
</ModelValue>
<ModelValue key="ModelValue_45" name="k21" simulationType="fixed" addNoise="false">
<MiriamAnnotation>
<rdf:RDF xmlns:dcterms="http://purl.org/dc/terms/" xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#">
<rdf:Description rdf:about="#ModelValue_45">
<dcterms:created>
<rdf:Description>
<dcterms:W3CDTF>2020-12-24T13:56:52Z</dcterms:W3CDTF>
</rdf:Description>
</dcterms:created>
</rdf:Description>
</rdf:RDF>
</MiriamAnnotation>
</ModelValue>
<ModelValue key="ModelValue_46" name="k22" simulationType="fixed" addNoise="false">
<MiriamAnnotation>
<rdf:RDF xmlns:dcterms="http://purl.org/dc/terms/" xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#">
<rdf:Description rdf:about="#ModelValue_46">
<dcterms:created>
<rdf:Description>
<dcterms:W3CDTF>2020-12-24T13:56:52Z</dcterms:W3CDTF>
</rdf:Description>
</dcterms:created>
</rdf:Description>
</rdf:RDF>
</MiriamAnnotation>
</ModelValue>
<ModelValue key="ModelValue_47" name="k23" simulationType="fixed" addNoise="false">
<MiriamAnnotation>
<rdf:RDF xmlns:dcterms="http://purl.org/dc/terms/" xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#">
<rdf:Description rdf:about="#ModelValue_47">
<dcterms:created>
<rdf:Description>
<dcterms:W3CDTF>2020-12-24T13:56:52Z</dcterms:W3CDTF>
</rdf:Description>
</dcterms:created>
</rdf:Description>
</rdf:RDF>
</MiriamAnnotation>
</ModelValue>
<ModelValue key="ModelValue_48" name="k24" simulationType="fixed" addNoise="false">
<MiriamAnnotation>
<rdf:RDF xmlns:dcterms="http://purl.org/dc/terms/" xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#">
<rdf:Description rdf:about="#ModelValue_48">
<dcterms:created>
<rdf:Description>
<dcterms:W3CDTF>2020-12-24T13:56:52Z</dcterms:W3CDTF>
</rdf:Description>
</dcterms:created>
</rdf:Description>
</rdf:RDF>
</MiriamAnnotation>
</ModelValue>
<ModelValue key="ModelValue_49" name="k25" simulationType="fixed" addNoise="false">
<MiriamAnnotation>
<rdf:RDF xmlns:dcterms="http://purl.org/dc/terms/" xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#">
<rdf:Description rdf:about="#ModelValue_49">
<dcterms:created>
<rdf:Description>
<dcterms:W3CDTF>2020-12-24T13:56:52Z</dcterms:W3CDTF>
</rdf:Description>
</dcterms:created>
</rdf:Description>
</rdf:RDF>
</MiriamAnnotation>
</ModelValue>
</ListOfModelValues>
<ListOfReactions>
<Reaction key="Reaction_25" name="R1" reversible="false" fast="false" addNoise="false">
<MiriamAnnotation>
<rdf:RDF xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#" />
</MiriamAnnotation>
<ListOfSubstrates>
<Substrate metabolite="Metabolite_21" stoichiometry="1"/>
</ListOfSubstrates>
<ListOfProducts>
<Product metabolite="Metabolite_20" stoichiometry="1"/>
<Product metabolite="Metabolite_34" stoichiometry="1"/>
</ListOfProducts>
<ListOfConstants>
<Constant key="Parameter_4993" name="k1" value="0.35"/>
</ListOfConstants>
<KineticLaw function="Function_13" unitType="Default" scalingCompartment="CN=Root,Model=Verwer1994,Vector=Compartments[compartment]">
<ListOfCallParameters>
<CallParameter functionParameter="FunctionParameter_80">
<SourceParameter reference="ModelValue_25"/>
</CallParameter>
<CallParameter functionParameter="FunctionParameter_81">
<SourceParameter reference="Metabolite_21"/>
</CallParameter>
</ListOfCallParameters>
</KineticLaw>
</Reaction>
<Reaction key="Reaction_26" name="R2" reversible="false" fast="false" addNoise="false">
<MiriamAnnotation>
<rdf:RDF xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#" />
</MiriamAnnotation>
<ListOfSubstrates>
<Substrate metabolite="Metabolite_20" stoichiometry="1"/>
<Substrate metabolite="Metabolite_22" stoichiometry="1"/>
</ListOfSubstrates>
<ListOfProducts>
<Product metabolite="Metabolite_21" stoichiometry="1"/>
</ListOfProducts>
<ListOfConstants>
<Constant key="Parameter_7362" name="k1" value="26.6"/>
</ListOfConstants>
<KineticLaw function="Function_13" unitType="Default" scalingCompartment="CN=Root,Model=Verwer1994,Vector=Compartments[compartment]">
<ListOfCallParameters>
<CallParameter functionParameter="FunctionParameter_80">
<SourceParameter reference="ModelValue_26"/>
</CallParameter>
<CallParameter functionParameter="FunctionParameter_81">
<SourceParameter reference="Metabolite_20"/>
<SourceParameter reference="Metabolite_22"/>
</CallParameter>
</ListOfCallParameters>
</KineticLaw>
</Reaction>
<Reaction key="Reaction_27" name="R3" reversible="false" fast="false" addNoise="false">
<MiriamAnnotation>
<rdf:RDF xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#" />
</MiriamAnnotation>
<ListOfSubstrates>
<Substrate metabolite="Metabolite_23" stoichiometry="1"/>
<Substrate metabolite="Metabolite_20" stoichiometry="1"/>
</ListOfSubstrates>
<ListOfProducts>
<Product metabolite="Metabolite_21" stoichiometry="1"/>
<Product metabolite="Metabolite_24" stoichiometry="1"/>
</ListOfProducts>
<ListOfConstants>
<Constant key="Parameter_7293" name="k1" value="12300"/>
</ListOfConstants>
<KineticLaw function="Function_13" unitType="Default" scalingCompartment="CN=Root,Model=Verwer1994,Vector=Compartments[compartment]">
<ListOfCallParameters>
<CallParameter functionParameter="FunctionParameter_80">
<SourceParameter reference="ModelValue_27"/>
</CallParameter>
<CallParameter functionParameter="FunctionParameter_81">
<SourceParameter reference="Metabolite_23"/>
<SourceParameter reference="Metabolite_20"/>
</CallParameter>
</ListOfCallParameters>
</KineticLaw>
</Reaction>
<Reaction key="Reaction_28" name="R4" reversible="false" fast="false" addNoise="false">
<MiriamAnnotation>
<rdf:RDF xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#" />
</MiriamAnnotation>
<ListOfSubstrates>
<Substrate metabolite="Metabolite_26" stoichiometry="1"/>
</ListOfSubstrates>
<ListOfProducts>
<Product metabolite="Metabolite_23" stoichiometry="2"/>
<Product metabolite="Metabolite_25" stoichiometry="1"/>
</ListOfProducts>
<ListOfConstants>
<Constant key="Parameter_4963" name="k1" value="0.00086"/>
</ListOfConstants>
<KineticLaw function="Function_13" unitType="Default" scalingCompartment="CN=Root,Model=Verwer1994,Vector=Compartments[compartment]">
<ListOfCallParameters>
<CallParameter functionParameter="FunctionParameter_80">
<SourceParameter reference="ModelValue_28"/>
</CallParameter>
<CallParameter functionParameter="FunctionParameter_81">
<SourceParameter reference="Metabolite_26"/>
</CallParameter>
</ListOfCallParameters>
</KineticLaw>
</Reaction>
<Reaction key="Reaction_29" name="R5" reversible="false" fast="false" addNoise="false">
<MiriamAnnotation>
<rdf:RDF xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#" />
</MiriamAnnotation>
<ListOfSubstrates>
<Substrate metabolite="Metabolite_26" stoichiometry="1"/>
</ListOfSubstrates>
<ListOfProducts>
<Product metabolite="Metabolite_25" stoichiometry="1"/>
</ListOfProducts>
<ListOfConstants>
<Constant key="Parameter_7353" name="k1" value="0.00082"/>
</ListOfConstants>
<KineticLaw function="Function_13" unitType="Default" scalingCompartment="CN=Root,Model=Verwer1994,Vector=Compartments[compartment]">
<ListOfCallParameters>
<CallParameter functionParameter="FunctionParameter_80">
<SourceParameter reference="ModelValue_29"/>
</CallParameter>
<CallParameter functionParameter="FunctionParameter_81">
<SourceParameter reference="Metabolite_26"/>
</CallParameter>
</ListOfCallParameters>
</KineticLaw>
</Reaction>
<Reaction key="Reaction_30" name="R6" reversible="false" fast="false" addNoise="false">
<MiriamAnnotation>
<rdf:RDF xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#" />
</MiriamAnnotation>
<ListOfSubstrates>
<Substrate metabolite="Metabolite_26" stoichiometry="1"/>
<Substrate metabolite="Metabolite_24" stoichiometry="1"/>
</ListOfSubstrates>
<ListOfProducts>
<Product metabolite="Metabolite_23" stoichiometry="1"/>
<Product metabolite="Metabolite_25" stoichiometry="1"/>
</ListOfProducts>
<ListOfConstants>
<Constant key="Parameter_7332" name="k1" value="15000"/>
</ListOfConstants>
<KineticLaw function="Function_13" unitType="Default" scalingCompartment="CN=Root,Model=Verwer1994,Vector=Compartments[compartment]">
<ListOfCallParameters>
<CallParameter functionParameter="FunctionParameter_80">
<SourceParameter reference="ModelValue_30"/>
</CallParameter>
<CallParameter functionParameter="FunctionParameter_81">
<SourceParameter reference="Metabolite_26"/>
<SourceParameter reference="Metabolite_24"/>
</CallParameter>
</ListOfCallParameters>
</KineticLaw>
</Reaction>
<Reaction key="Reaction_31" name="R7" reversible="false" fast="false" addNoise="false">
<MiriamAnnotation>
<rdf:RDF xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#" />
</MiriamAnnotation>
<ListOfSubstrates>
<Substrate metabolite="Metabolite_27" stoichiometry="1"/>
</ListOfSubstrates>
<ListOfProducts>
<Product metabolite="Metabolite_28" stoichiometry="1"/>
<Product metabolite="Metabolite_23" stoichiometry="1"/>
<Product metabolite="Metabolite_25" stoichiometry="1"/>
</ListOfProducts>
<ListOfConstants>
<Constant key="Parameter_4958" name="k1" value="0.00013"/>
</ListOfConstants>
<KineticLaw function="Function_13" unitType="Default" scalingCompartment="CN=Root,Model=Verwer1994,Vector=Compartments[compartment]">
<ListOfCallParameters>
<CallParameter functionParameter="FunctionParameter_80">
<SourceParameter reference="ModelValue_31"/>
</CallParameter>
<CallParameter functionParameter="FunctionParameter_81">
<SourceParameter reference="Metabolite_27"/>
</CallParameter>
</ListOfCallParameters>
</KineticLaw>
</Reaction>
<Reaction key="Reaction_32" name="R8" reversible="false" fast="false" addNoise="false">
<MiriamAnnotation>
<rdf:RDF xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#" />
</MiriamAnnotation>
<ListOfSubstrates>
<Substrate metabolite="Metabolite_27" stoichiometry="1"/>
<Substrate metabolite="Metabolite_24" stoichiometry="1"/>
</ListOfSubstrates>
<ListOfProducts>
<Product metabolite="Metabolite_29" stoichiometry="1"/>
</ListOfProducts>
<ListOfConstants>
<Constant key="Parameter_4952" name="k1" value="24000"/>
</ListOfConstants>
<KineticLaw function="Function_13" unitType="Default" scalingCompartment="CN=Root,Model=Verwer1994,Vector=Compartments[compartment]">
<ListOfCallParameters>
<CallParameter functionParameter="FunctionParameter_80">
<SourceParameter reference="ModelValue_32"/>
</CallParameter>
<CallParameter functionParameter="FunctionParameter_81">
<SourceParameter reference="Metabolite_27"/>
<SourceParameter reference="Metabolite_24"/>
</CallParameter>
</ListOfCallParameters>
</KineticLaw>
</Reaction>
<Reaction key="Reaction_33" name="R9" reversible="false" fast="false" addNoise="false">
<MiriamAnnotation>
<rdf:RDF xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#" />
</MiriamAnnotation>
<ListOfSubstrates>
<Substrate metabolite="Metabolite_29" stoichiometry="1"/>
<Substrate metabolite="Metabolite_20" stoichiometry="1"/>
</ListOfSubstrates>
<ListOfProducts>
<Product metabolite="Metabolite_21" stoichiometry="1"/>
<Product metabolite="Metabolite_28" stoichiometry="1"/>
<Product metabolite="Metabolite_30" stoichiometry="1"/>
</ListOfProducts>
<ListOfConstants>
<Constant key="Parameter_4959" name="k1" value="16500"/>
</ListOfConstants>
<KineticLaw function="Function_13" unitType="Default" scalingCompartment="CN=Root,Model=Verwer1994,Vector=Compartments[compartment]">
<ListOfCallParameters>
<CallParameter functionParameter="FunctionParameter_80">
<SourceParameter reference="ModelValue_33"/>
</CallParameter>
<CallParameter functionParameter="FunctionParameter_81">
<SourceParameter reference="Metabolite_29"/>
<SourceParameter reference="Metabolite_20"/>
</CallParameter>
</ListOfCallParameters>
</KineticLaw>
</Reaction>
<Reaction key="Reaction_34" name="R10" reversible="false" fast="false" addNoise="false">
<MiriamAnnotation>
<rdf:RDF xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#" />
</MiriamAnnotation>
<ListOfSubstrates>
<Substrate metabolite="Metabolite_29" stoichiometry="1"/>
<Substrate metabolite="Metabolite_21" stoichiometry="1"/>
</ListOfSubstrates>
<ListOfProducts>
<Product metabolite="Metabolite_31" stoichiometry="1"/>
</ListOfProducts>
<ListOfConstants>
<Constant key="Parameter_4953" name="k1" value="9000"/>
</ListOfConstants>
<KineticLaw function="Function_13" unitType="Default" scalingCompartment="CN=Root,Model=Verwer1994,Vector=Compartments[compartment]">
<ListOfCallParameters>
<CallParameter functionParameter="FunctionParameter_80">
<SourceParameter reference="ModelValue_34"/>
</CallParameter>
<CallParameter functionParameter="FunctionParameter_81">
<SourceParameter reference="Metabolite_29"/>
<SourceParameter reference="Metabolite_21"/>
</CallParameter>
</ListOfCallParameters>
</KineticLaw>
</Reaction>
<Reaction key="Reaction_35" name="R11" reversible="false" fast="false" addNoise="false">
<MiriamAnnotation>
<rdf:RDF xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#" />
</MiriamAnnotation>
<ListOfSubstrates>
<Substrate metabolite="Metabolite_31" stoichiometry="1"/>
</ListOfSubstrates>
<ListOfProducts>
<Product metabolite="Metabolite_29" stoichiometry="1"/>
<Product metabolite="Metabolite_21" stoichiometry="1"/>
</ListOfProducts>
<ListOfConstants>
<Constant key="Parameter_4992" name="k1" value="0.022"/>
</ListOfConstants>
<KineticLaw function="Function_13" unitType="Default" scalingCompartment="CN=Root,Model=Verwer1994,Vector=Compartments[compartment]">
<ListOfCallParameters>
<CallParameter functionParameter="FunctionParameter_80">
<SourceParameter reference="ModelValue_35"/>
</CallParameter>
<CallParameter functionParameter="FunctionParameter_81">
<SourceParameter reference="Metabolite_31"/>
</CallParameter>
</ListOfCallParameters>
</KineticLaw>
</Reaction>
<Reaction key="Reaction_36" name="R12" reversible="false" fast="false" addNoise="false">
<MiriamAnnotation>
<rdf:RDF xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#" />
</MiriamAnnotation>
<ListOfSubstrates>
<Substrate metabolite="Metabolite_28" stoichiometry="1"/>
<Substrate metabolite="Metabolite_20" stoichiometry="1"/>
</ListOfSubstrates>
<ListOfProducts>
<Product metabolite="Metabolite_32" stoichiometry="1"/>
<Product metabolite="Metabolite_21" stoichiometry="1"/>
</ListOfProducts>
<ListOfConstants>
<Constant key="Parameter_4847" name="k1" value="12000"/>
</ListOfConstants>
<KineticLaw function="Function_13" unitType="Default" scalingCompartment="CN=Root,Model=Verwer1994,Vector=Compartments[compartment]">
<ListOfCallParameters>
<CallParameter functionParameter="FunctionParameter_80">
<SourceParameter reference="ModelValue_36"/>
</CallParameter>
<CallParameter functionParameter="FunctionParameter_81">
<SourceParameter reference="Metabolite_28"/>
<SourceParameter reference="Metabolite_20"/>
</CallParameter>
</ListOfCallParameters>
</KineticLaw>
</Reaction>
<Reaction key="Reaction_37" name="R13" reversible="false" fast="false" addNoise="false">
<MiriamAnnotation>
<rdf:RDF xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#" />
</MiriamAnnotation>
<ListOfSubstrates>
<Substrate metabolite="Metabolite_32" stoichiometry="1"/>
</ListOfSubstrates>
<ListOfProducts>
<Product metabolite="Metabolite_26" stoichiometry="1"/>
<Product metabolite="Metabolite_23" stoichiometry="1"/>
</ListOfProducts>
<ListOfConstants>
<Constant key="Parameter_4853" name="k1" value="1.88"/>
</ListOfConstants>
<KineticLaw function="Function_13" unitType="Default" scalingCompartment="CN=Root,Model=Verwer1994,Vector=Compartments[compartment]">
<ListOfCallParameters>
<CallParameter functionParameter="FunctionParameter_80">
<SourceParameter reference="ModelValue_37"/>
</CallParameter>
<CallParameter functionParameter="FunctionParameter_81">
<SourceParameter reference="Metabolite_32"/>
</CallParameter>
</ListOfCallParameters>
</KineticLaw>
</Reaction>
<Reaction key="Reaction_38" name="R14" reversible="false" fast="false" addNoise="false">
<MiriamAnnotation>
<rdf:RDF xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#" />
</MiriamAnnotation>
<ListOfSubstrates>
<Substrate metabolite="Metabolite_21" stoichiometry="1"/>
<Substrate metabolite="Metabolite_24" stoichiometry="1"/>
</ListOfSubstrates>
<ListOfProducts>
<Product metabolite="Metabolite_33" stoichiometry="1"/>
</ListOfProducts>
<ListOfConstants>
<Constant key="Parameter_4848" name="k1" value="16300"/>
</ListOfConstants>
<KineticLaw function="Function_13" unitType="Default" scalingCompartment="CN=Root,Model=Verwer1994,Vector=Compartments[compartment]">
<ListOfCallParameters>
<CallParameter functionParameter="FunctionParameter_80">
<SourceParameter reference="ModelValue_38"/>
</CallParameter>
<CallParameter functionParameter="FunctionParameter_81">
<SourceParameter reference="Metabolite_21"/>
<SourceParameter reference="Metabolite_24"/>
</CallParameter>
</ListOfCallParameters>
</KineticLaw>
</Reaction>
<Reaction key="Reaction_39" name="R15" reversible="false" fast="false" addNoise="false">
<MiriamAnnotation>
<rdf:RDF xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#" />
</MiriamAnnotation>
<ListOfSubstrates>
<Substrate metabolite="Metabolite_34" stoichiometry="1"/>
</ListOfSubstrates>
<ListOfProducts>
<Product metabolite="Metabolite_22" stoichiometry="1"/>
</ListOfProducts>
<ListOfConstants>
<Constant key="Parameter_4850" name="k1" value="4.8e+06"/>
</ListOfConstants>
<KineticLaw function="Function_13" unitType="Default" scalingCompartment="CN=Root,Model=Verwer1994,Vector=Compartments[compartment]">
<ListOfCallParameters>
<CallParameter functionParameter="FunctionParameter_80">
<SourceParameter reference="ModelValue_39"/>
</CallParameter>
<CallParameter functionParameter="FunctionParameter_81">
<SourceParameter reference="Metabolite_34"/>
</CallParameter>
</ListOfCallParameters>
</KineticLaw>
</Reaction>
<Reaction key="Reaction_40" name="R16" reversible="false" fast="false" addNoise="false">
<MiriamAnnotation>
<rdf:RDF xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#" />
</MiriamAnnotation>
<ListOfSubstrates>
<Substrate metabolite="Metabolite_22" stoichiometry="1"/>
</ListOfSubstrates>
<ListOfProducts>
<Product metabolite="Metabolite_35" stoichiometry="1"/>
</ListOfProducts>
<ListOfConstants>
<Constant key="Parameter_4852" name="k1" value="0.00035"/>
</ListOfConstants>
<KineticLaw function="Function_13" unitType="Default" scalingCompartment="CN=Root,Model=Verwer1994,Vector=Compartments[compartment]">
<ListOfCallParameters>
<CallParameter functionParameter="FunctionParameter_80">
<SourceParameter reference="ModelValue_40"/>
</CallParameter>
<CallParameter functionParameter="FunctionParameter_81">
<SourceParameter reference="Metabolite_22"/>
</CallParameter>
</ListOfCallParameters>
</KineticLaw>
</Reaction>
<Reaction key="Reaction_41" name="R17" reversible="false" fast="false" addNoise="false">
<MiriamAnnotation>
<rdf:RDF xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#" />
</MiriamAnnotation>
<ListOfSubstrates>
<Substrate metabolite="Metabolite_22" stoichiometry="1"/>
</ListOfSubstrates>
<ListOfProducts>
<Product metabolite="Metabolite_34" stoichiometry="1"/>
</ListOfProducts>
<ListOfConstants>
<Constant key="Parameter_4921" name="k1" value="0.0175"/>
</ListOfConstants>
<KineticLaw function="Function_13" unitType="Default" scalingCompartment="CN=Root,Model=Verwer1994,Vector=Compartments[compartment]">
<ListOfCallParameters>
<CallParameter functionParameter="FunctionParameter_80">
<SourceParameter reference="ModelValue_41"/>
</CallParameter>
<CallParameter functionParameter="FunctionParameter_81">
<SourceParameter reference="Metabolite_22"/>
</CallParameter>
</ListOfCallParameters>
</KineticLaw>
</Reaction>
<Reaction key="Reaction_42" name="R18" reversible="false" fast="false" addNoise="false">
<MiriamAnnotation>
<rdf:RDF xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#" />
</MiriamAnnotation>
<ListOfSubstrates>
<Substrate metabolite="Metabolite_35" stoichiometry="1"/>
</ListOfSubstrates>
<ListOfProducts>
<Product metabolite="Metabolite_24" stoichiometry="2"/>
</ListOfProducts>
<ListOfConstants>
<Constant key="Parameter_4916" name="k1" value="1e+08"/>
</ListOfConstants>
<KineticLaw function="Function_13" unitType="Default" scalingCompartment="CN=Root,Model=Verwer1994,Vector=Compartments[compartment]">
<ListOfCallParameters>
<CallParameter functionParameter="FunctionParameter_80">
<SourceParameter reference="ModelValue_42"/>
</CallParameter>
<CallParameter functionParameter="FunctionParameter_81">
<SourceParameter reference="Metabolite_35"/>
</CallParameter>
</ListOfCallParameters>
</KineticLaw>
</Reaction>
<Reaction key="Reaction_43" name="R19" reversible="false" fast="false" addNoise="false">
<MiriamAnnotation>
<rdf:RDF xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#" />
</MiriamAnnotation>
<ListOfSubstrates>
<Substrate metabolite="Metabolite_35" stoichiometry="1"/>
</ListOfSubstrates>
<ListOfProducts>
<Product metabolite="Metabolite_34" stoichiometry="1"/>
</ListOfProducts>
<ListOfConstants>
<Constant key="Parameter_4922" name="k1" value="4.44e+11"/>
</ListOfConstants>
<KineticLaw function="Function_13" unitType="Default" scalingCompartment="CN=Root,Model=Verwer1994,Vector=Compartments[compartment]">
<ListOfCallParameters>
<CallParameter functionParameter="FunctionParameter_80">
<SourceParameter reference="ModelValue_43"/>
</CallParameter>
<CallParameter functionParameter="FunctionParameter_81">
<SourceParameter reference="Metabolite_35"/>
</CallParameter>
</ListOfCallParameters>
</KineticLaw>
</Reaction>
<Reaction key="Reaction_44" name="R20" reversible="false" fast="false" addNoise="false">
<MiriamAnnotation>
<rdf:RDF xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#" />
</MiriamAnnotation>
<ListOfSubstrates>
<Substrate metabolite="Metabolite_36" stoichiometry="1"/>
<Substrate metabolite="Metabolite_24" stoichiometry="1"/>
</ListOfSubstrates>
<ListOfProducts>
<Product metabolite="Metabolite_37" stoichiometry="1"/>
<Product metabolite="Metabolite_23" stoichiometry="1"/>
</ListOfProducts>
<ListOfConstants>
<Constant key="Parameter_4899" name="k1" value="1240"/>
</ListOfConstants>
<KineticLaw function="Function_13" unitType="Default" scalingCompartment="CN=Root,Model=Verwer1994,Vector=Compartments[compartment]">
<ListOfCallParameters>
<CallParameter functionParameter="FunctionParameter_80">
<SourceParameter reference="ModelValue_44"/>
</CallParameter>
<CallParameter functionParameter="FunctionParameter_81">
<SourceParameter reference="Metabolite_36"/>
<SourceParameter reference="Metabolite_24"/>
</CallParameter>
</ListOfCallParameters>
</KineticLaw>
</Reaction>
<Reaction key="Reaction_45" name="R21" reversible="false" fast="false" addNoise="false">
<MiriamAnnotation>
<rdf:RDF xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#" />
</MiriamAnnotation>
<ListOfSubstrates>
<Substrate metabolite="Metabolite_38" stoichiometry="1"/>
</ListOfSubstrates>
<ListOfProducts>
<Product metabolite="Metabolite_20" stoichiometry="1"/>
</ListOfProducts>
<ListOfConstants>
<Constant key="Parameter_4923" name="k1" value="2.1"/>
</ListOfConstants>
<KineticLaw function="Function_13" unitType="Default" scalingCompartment="CN=Root,Model=Verwer1994,Vector=Compartments[compartment]">
<ListOfCallParameters>
<CallParameter functionParameter="FunctionParameter_80">
<SourceParameter reference="ModelValue_45"/>
</CallParameter>
<CallParameter functionParameter="FunctionParameter_81">
<SourceParameter reference="Metabolite_38"/>
</CallParameter>
</ListOfCallParameters>
</KineticLaw>
</Reaction>
<Reaction key="Reaction_46" name="R22" reversible="false" fast="false" addNoise="false">
<MiriamAnnotation>
<rdf:RDF xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#" />
</MiriamAnnotation>
<ListOfSubstrates>
<Substrate metabolite="Metabolite_38" stoichiometry="1"/>
</ListOfSubstrates>
<ListOfProducts>
<Product metabolite="Metabolite_21" stoichiometry="1"/>
<Product metabolite="Metabolite_34" stoichiometry="1"/>
</ListOfProducts>
<ListOfConstants>
<Constant key="Parameter_4882" name="k1" value="5.78"/>
</ListOfConstants>
<KineticLaw function="Function_13" unitType="Default" scalingCompartment="CN=Root,Model=Verwer1994,Vector=Compartments[compartment]">
<ListOfCallParameters>
<CallParameter functionParameter="FunctionParameter_80">
<SourceParameter reference="ModelValue_46"/>
</CallParameter>
<CallParameter functionParameter="FunctionParameter_81">
<SourceParameter reference="Metabolite_38"/>
</CallParameter>
</ListOfCallParameters>
</KineticLaw>
</Reaction>
<Reaction key="Reaction_47" name="R23" reversible="false" fast="false" addNoise="false">
<MiriamAnnotation>
<rdf:RDF xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#" />
</MiriamAnnotation>
<ListOfSubstrates>
<Substrate metabolite="Metabolite_21" stoichiometry="1"/>
<Substrate metabolite="Metabolite_22" stoichiometry="1"/>
</ListOfSubstrates>
<ListOfProducts>
<Product metabolite="Metabolite_38" stoichiometry="1"/>
</ListOfProducts>
<ListOfConstants>
<Constant key="Parameter_4880" name="k1" value="0.0474"/>
</ListOfConstants>
<KineticLaw function="Function_13" unitType="Default" scalingCompartment="CN=Root,Model=Verwer1994,Vector=Compartments[compartment]">
<ListOfCallParameters>
<CallParameter functionParameter="FunctionParameter_80">
<SourceParameter reference="ModelValue_47"/>
</CallParameter>
<CallParameter functionParameter="FunctionParameter_81">
<SourceParameter reference="Metabolite_21"/>
<SourceParameter reference="Metabolite_22"/>
</CallParameter>
</ListOfCallParameters>
</KineticLaw>
</Reaction>
<Reaction key="Reaction_48" name="R24" reversible="false" fast="false" addNoise="false">
<MiriamAnnotation>
<rdf:RDF xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#" />
</MiriamAnnotation>
<ListOfSubstrates>
<Substrate metabolite="Metabolite_38" stoichiometry="1"/>
<Substrate metabolite="Metabolite_21" stoichiometry="1"/>
</ListOfSubstrates>
<ListOfProducts>
<Product metabolite="Metabolite_39" stoichiometry="1"/>
</ListOfProducts>
<ListOfConstants>
<Constant key="Parameter_4896" name="k1" value="1780"/>
</ListOfConstants>
<KineticLaw function="Function_13" unitType="Default" scalingCompartment="CN=Root,Model=Verwer1994,Vector=Compartments[compartment]">
<ListOfCallParameters>
<CallParameter functionParameter="FunctionParameter_80">
<SourceParameter reference="ModelValue_48"/>
</CallParameter>
<CallParameter functionParameter="FunctionParameter_81">
<SourceParameter reference="Metabolite_38"/>
<SourceParameter reference="Metabolite_21"/>
</CallParameter>
</ListOfCallParameters>
</KineticLaw>
</Reaction>
<Reaction key="Reaction_49" name="R25" reversible="false" fast="false" addNoise="false">
<MiriamAnnotation>
<rdf:RDF xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#" />
</MiriamAnnotation>
<ListOfSubstrates>
<Substrate metabolite="Metabolite_39" stoichiometry="1"/>
</ListOfSubstrates>
<ListOfProducts>
<Product metabolite="Metabolite_38" stoichiometry="1"/>
<Product metabolite="Metabolite_21" stoichiometry="1"/>
</ListOfProducts>
<ListOfConstants>
<Constant key="Parameter_4918" name="k1" value="3.12"/>
</ListOfConstants>
<KineticLaw function="Function_13" unitType="Default" scalingCompartment="CN=Root,Model=Verwer1994,Vector=Compartments[compartment]">
<ListOfCallParameters>
<CallParameter functionParameter="FunctionParameter_80">
<SourceParameter reference="ModelValue_49"/>
</CallParameter>
<CallParameter functionParameter="FunctionParameter_81">
<SourceParameter reference="Metabolite_39"/>
</CallParameter>
</ListOfCallParameters>
</KineticLaw>
</Reaction>
</ListOfReactions>
<ListOfModelParameterSets activeSet="ModelParameterSet_1">
<ModelParameterSet key="ModelParameterSet_1" name="Initial State">
<MiriamAnnotation>
<rdf:RDF
xmlns:dcterms="http://purl.org/dc/terms/"
xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#">
<rdf:Description rdf:about="#ModelParameterSet_1">
<dcterms:created>
<rdf:Description>
<dcterms:W3CDTF>2020-12-24T14:28:35Z</dcterms:W3CDTF>
</rdf:Description>
</dcterms:created>
</rdf:Description>
</rdf:RDF>
</MiriamAnnotation>
<ModelParameterGroup cn="String=Initial Time" type="Group">
<ModelParameter cn="CN=Root,Model=Verwer1994" value="0" type="Model" simulationType="time"/>
</ModelParameterGroup>
<ModelParameterGroup cn="String=Initial Compartment Sizes" type="Group">
<ModelParameter cn="CN=Root,Model=Verwer1994,Vector=Compartments[compartment]" value="1" type="Compartment" simulationType="fixed"/>
</ModelParameterGroup>
<ModelParameterGroup cn="String=Initial Species Values" type="Group">
<ModelParameter cn="CN=Root,Model=Verwer1994,Vector=Compartments[compartment],Vector=Metabolites[NO]" value="1.2044281714000001e+20" type="Species" simulationType="reactions"/>
<ModelParameter cn="CN=Root,Model=Verwer1994,Vector=Compartments[compartment],Vector=Metabolites[NO2]" value="0" type="Species" simulationType="reactions"/>
<ModelParameter cn="CN=Root,Model=Verwer1994,Vector=Compartments[compartment],Vector=Metabolites[O3]" value="2.4088563428000002e+19" type="Species" simulationType="reactions"/>
<ModelParameter cn="CN=Root,Model=Verwer1994,Vector=Compartments[compartment],Vector=Metabolites[HO2]" value="0" type="Species" simulationType="reactions"/>
<ModelParameter cn="CN=Root,Model=Verwer1994,Vector=Compartments[compartment],Vector=Metabolites[OH]" value="0" type="Species" simulationType="reactions"/>
<ModelParameter cn="CN=Root,Model=Verwer1994,Vector=Compartments[compartment],Vector=Metabolites[CO]" value="1.8066422571000001e+20" type="Species" simulationType="reactions"/>
<ModelParameter cn="CN=Root,Model=Verwer1994,Vector=Compartments[compartment],Vector=Metabolites[HCHO]" value="6.0221408570000007e+19" type="Species" simulationType="reactions"/>
<ModelParameter cn="CN=Root,Model=Verwer1994,Vector=Compartments[compartment],Vector=Metabolites[ALD]" value="6.0221408570000005e+18" type="Species" simulationType="reactions"/>
<ModelParameter cn="CN=Root,Model=Verwer1994,Vector=Compartments[compartment],Vector=Metabolites[MEO2]" value="0" type="Species" simulationType="reactions"/>
<ModelParameter cn="CN=Root,Model=Verwer1994,Vector=Compartments[compartment],Vector=Metabolites[C2O3]" value="0" type="Species" simulationType="reactions"/>
<ModelParameter cn="CN=Root,Model=Verwer1994,Vector=Compartments[compartment],Vector=Metabolites[CO2]" value="0" type="Species" simulationType="reactions"/>
<ModelParameter cn="CN=Root,Model=Verwer1994,Vector=Compartments[compartment],Vector=Metabolites[PAN]" value="0" type="Species" simulationType="reactions"/>
<ModelParameter cn="CN=Root,Model=Verwer1994,Vector=Compartments[compartment],Vector=Metabolites[CH3O]" value="0" type="Species" simulationType="reactions"/>
<ModelParameter cn="CN=Root,Model=Verwer1994,Vector=Compartments[compartment],Vector=Metabolites[HNO3]" value="0" type="Species" simulationType="reactions"/>
<ModelParameter cn="CN=Root,Model=Verwer1994,Vector=Compartments[compartment],Vector=Metabolites[O3P]" value="0" type="Species" simulationType="reactions"/>
<ModelParameter cn="CN=Root,Model=Verwer1994,Vector=Compartments[compartment],Vector=Metabolites[O1D]" value="0" type="Species" simulationType="reactions"/>
<ModelParameter cn="CN=Root,Model=Verwer1994,Vector=Compartments[compartment],Vector=Metabolites[SO2]" value="4.2154985999000003e+18" type="Species" simulationType="reactions"/>
<ModelParameter cn="CN=Root,Model=Verwer1994,Vector=Compartments[compartment],Vector=Metabolites[SO4]" value="0" type="Species" simulationType="reactions"/>
<ModelParameter cn="CN=Root,Model=Verwer1994,Vector=Compartments[compartment],Vector=Metabolites[NO3]" value="0" type="Species" simulationType="reactions"/>
<ModelParameter cn="CN=Root,Model=Verwer1994,Vector=Compartments[compartment],Vector=Metabolites[N2O5]" value="0" type="Species" simulationType="reactions"/>
</ModelParameterGroup>
<ModelParameterGroup cn="String=Initial Global Quantities" type="Group">
<ModelParameter cn="CN=Root,Model=Verwer1994,Vector=Values[k1]" value="0.34999999999999998" type="ModelValue" simulationType="fixed"/>
<ModelParameter cn="CN=Root,Model=Verwer1994,Vector=Values[k2]" value="26.600000000000001" type="ModelValue" simulationType="fixed"/>
<ModelParameter cn="CN=Root,Model=Verwer1994,Vector=Values[k3]" value="12300" type="ModelValue" simulationType="fixed"/>
<ModelParameter cn="CN=Root,Model=Verwer1994,Vector=Values[k4]" value="0.00085999999999999998" type="ModelValue" simulationType="fixed"/>
<ModelParameter cn="CN=Root,Model=Verwer1994,Vector=Values[k5]" value="0.00081999999999999998" type="ModelValue" simulationType="fixed"/>
<ModelParameter cn="CN=Root,Model=Verwer1994,Vector=Values[k6]" value="15000" type="ModelValue" simulationType="fixed"/>
<ModelParameter cn="CN=Root,Model=Verwer1994,Vector=Values[k7]" value="0.00012999999999999999" type="ModelValue" simulationType="fixed"/>
<ModelParameter cn="CN=Root,Model=Verwer1994,Vector=Values[k8]" value="24000" type="ModelValue" simulationType="fixed"/>
<ModelParameter cn="CN=Root,Model=Verwer1994,Vector=Values[k9]" value="16500" type="ModelValue" simulationType="fixed"/>
<ModelParameter cn="CN=Root,Model=Verwer1994,Vector=Values[k10]" value="9000" type="ModelValue" simulationType="fixed"/>
<ModelParameter cn="CN=Root,Model=Verwer1994,Vector=Values[k11]" value="0.021999999999999999" type="ModelValue" simulationType="fixed"/>
<ModelParameter cn="CN=Root,Model=Verwer1994,Vector=Values[k12]" value="12000" type="ModelValue" simulationType="fixed"/>
<ModelParameter cn="CN=Root,Model=Verwer1994,Vector=Values[k13]" value="1.8799999999999999" type="ModelValue" simulationType="fixed"/>
<ModelParameter cn="CN=Root,Model=Verwer1994,Vector=Values[k14]" value="16300" type="ModelValue" simulationType="fixed"/>
<ModelParameter cn="CN=Root,Model=Verwer1994,Vector=Values[k15]" value="4800000" type="ModelValue" simulationType="fixed"/>
<ModelParameter cn="CN=Root,Model=Verwer1994,Vector=Values[k16]" value="0.00035" type="ModelValue" simulationType="fixed"/>
<ModelParameter cn="CN=Root,Model=Verwer1994,Vector=Values[k17]" value="0.017500000000000002" type="ModelValue" simulationType="fixed"/>
<ModelParameter cn="CN=Root,Model=Verwer1994,Vector=Values[k18]" value="100000000" type="ModelValue" simulationType="fixed"/>
<ModelParameter cn="CN=Root,Model=Verwer1994,Vector=Values[k19]" value="444000000000" type="ModelValue" simulationType="fixed"/>
<ModelParameter cn="CN=Root,Model=Verwer1994,Vector=Values[k20]" value="1240" type="ModelValue" simulationType="fixed"/>
<ModelParameter cn="CN=Root,Model=Verwer1994,Vector=Values[k21]" value="2.1000000000000001" type="ModelValue" simulationType="fixed"/>
<ModelParameter cn="CN=Root,Model=Verwer1994,Vector=Values[k22]" value="5.7800000000000002" type="ModelValue" simulationType="fixed"/>
<ModelParameter cn="CN=Root,Model=Verwer1994,Vector=Values[k23]" value="0.047399999999999998" type="ModelValue" simulationType="fixed"/>
<ModelParameter cn="CN=Root,Model=Verwer1994,Vector=Values[k24]" value="1780" type="ModelValue" simulationType="fixed"/>
<ModelParameter cn="CN=Root,Model=Verwer1994,Vector=Values[k25]" value="3.1200000000000001" type="ModelValue" simulationType="fixed"/>
</ModelParameterGroup>
<ModelParameterGroup cn="String=Kinetic Parameters" type="Group">
<ModelParameterGroup cn="CN=Root,Model=Verwer1994,Vector=Reactions[R1]" type="Reaction">
<ModelParameter cn="CN=Root,Model=Verwer1994,Vector=Reactions[R1],ParameterGroup=Parameters,Parameter=k1" value="0.34999999999999998" type="ReactionParameter" simulationType="assignment">
<InitialExpression>
<CN=Root,Model=Verwer1994,Vector=Values[k1],Reference=InitialValue>
</InitialExpression>
</ModelParameter>
</ModelParameterGroup>
<ModelParameterGroup cn="CN=Root,Model=Verwer1994,Vector=Reactions[R2]" type="Reaction">
<ModelParameter cn="CN=Root,Model=Verwer1994,Vector=Reactions[R2],ParameterGroup=Parameters,Parameter=k1" value="26.600000000000001" type="ReactionParameter" simulationType="assignment">
<InitialExpression>
<CN=Root,Model=Verwer1994,Vector=Values[k2],Reference=InitialValue>
</InitialExpression>
</ModelParameter>
</ModelParameterGroup>
<ModelParameterGroup cn="CN=Root,Model=Verwer1994,Vector=Reactions[R3]" type="Reaction">
<ModelParameter cn="CN=Root,Model=Verwer1994,Vector=Reactions[R3],ParameterGroup=Parameters,Parameter=k1" value="12300" type="ReactionParameter" simulationType="assignment">
<InitialExpression>
<CN=Root,Model=Verwer1994,Vector=Values[k3],Reference=InitialValue>
</InitialExpression>
</ModelParameter>
</ModelParameterGroup>
<ModelParameterGroup cn="CN=Root,Model=Verwer1994,Vector=Reactions[R4]" type="Reaction">
<ModelParameter cn="CN=Root,Model=Verwer1994,Vector=Reactions[R4],ParameterGroup=Parameters,Parameter=k1" value="0.00085999999999999998" type="ReactionParameter" simulationType="assignment">
<InitialExpression>
<CN=Root,Model=Verwer1994,Vector=Values[k4],Reference=InitialValue>
</InitialExpression>
</ModelParameter>
</ModelParameterGroup>
<ModelParameterGroup cn="CN=Root,Model=Verwer1994,Vector=Reactions[R5]" type="Reaction">
<ModelParameter cn="CN=Root,Model=Verwer1994,Vector=Reactions[R5],ParameterGroup=Parameters,Parameter=k1" value="0.00081999999999999998" type="ReactionParameter" simulationType="assignment">
<InitialExpression>
<CN=Root,Model=Verwer1994,Vector=Values[k5],Reference=InitialValue>
</InitialExpression>
</ModelParameter>
</ModelParameterGroup>
<ModelParameterGroup cn="CN=Root,Model=Verwer1994,Vector=Reactions[R6]" type="Reaction">
<ModelParameter cn="CN=Root,Model=Verwer1994,Vector=Reactions[R6],ParameterGroup=Parameters,Parameter=k1" value="15000" type="ReactionParameter" simulationType="assignment">
<InitialExpression>
<CN=Root,Model=Verwer1994,Vector=Values[k6],Reference=InitialValue>
</InitialExpression>
</ModelParameter>
</ModelParameterGroup>
<ModelParameterGroup cn="CN=Root,Model=Verwer1994,Vector=Reactions[R7]" type="Reaction">
<ModelParameter cn="CN=Root,Model=Verwer1994,Vector=Reactions[R7],ParameterGroup=Parameters,Parameter=k1" value="0.00012999999999999999" type="ReactionParameter" simulationType="assignment">
<InitialExpression>
<CN=Root,Model=Verwer1994,Vector=Values[k7],Reference=InitialValue>
</InitialExpression>
</ModelParameter>
</ModelParameterGroup>
<ModelParameterGroup cn="CN=Root,Model=Verwer1994,Vector=Reactions[R8]" type="Reaction">
<ModelParameter cn="CN=Root,Model=Verwer1994,Vector=Reactions[R8],ParameterGroup=Parameters,Parameter=k1" value="24000" type="ReactionParameter" simulationType="assignment">
<InitialExpression>
<CN=Root,Model=Verwer1994,Vector=Values[k8],Reference=InitialValue>
</InitialExpression>
</ModelParameter>
</ModelParameterGroup>
<ModelParameterGroup cn="CN=Root,Model=Verwer1994,Vector=Reactions[R9]" type="Reaction">
<ModelParameter cn="CN=Root,Model=Verwer1994,Vector=Reactions[R9],ParameterGroup=Parameters,Parameter=k1" value="16500" type="ReactionParameter" simulationType="assignment">
<InitialExpression>
<CN=Root,Model=Verwer1994,Vector=Values[k9],Reference=InitialValue>
</InitialExpression>
</ModelParameter>
</ModelParameterGroup>
<ModelParameterGroup cn="CN=Root,Model=Verwer1994,Vector=Reactions[R10]" type="Reaction">
<ModelParameter cn="CN=Root,Model=Verwer1994,Vector=Reactions[R10],ParameterGroup=Parameters,Parameter=k1" value="9000" type="ReactionParameter" simulationType="assignment">
<InitialExpression>
<CN=Root,Model=Verwer1994,Vector=Values[k10],Reference=InitialValue>
</InitialExpression>
</ModelParameter>
</ModelParameterGroup>
<ModelParameterGroup cn="CN=Root,Model=Verwer1994,Vector=Reactions[R11]" type="Reaction">
<ModelParameter cn="CN=Root,Model=Verwer1994,Vector=Reactions[R11],ParameterGroup=Parameters,Parameter=k1" value="0.021999999999999999" type="ReactionParameter" simulationType="assignment">
<InitialExpression>
<CN=Root,Model=Verwer1994,Vector=Values[k11],Reference=InitialValue>
</InitialExpression>
</ModelParameter>
</ModelParameterGroup>
<ModelParameterGroup cn="CN=Root,Model=Verwer1994,Vector=Reactions[R12]" type="Reaction">
<ModelParameter cn="CN=Root,Model=Verwer1994,Vector=Reactions[R12],ParameterGroup=Parameters,Parameter=k1" value="12000" type="ReactionParameter" simulationType="assignment">
<InitialExpression>
<CN=Root,Model=Verwer1994,Vector=Values[k12],Reference=InitialValue>
</InitialExpression>
</ModelParameter>
</ModelParameterGroup>
<ModelParameterGroup cn="CN=Root,Model=Verwer1994,Vector=Reactions[R13]" type="Reaction">
<ModelParameter cn="CN=Root,Model=Verwer1994,Vector=Reactions[R13],ParameterGroup=Parameters,Parameter=k1" value="1.8799999999999999" type="ReactionParameter" simulationType="assignment">
<InitialExpression>
<CN=Root,Model=Verwer1994,Vector=Values[k13],Reference=InitialValue>
</InitialExpression>
</ModelParameter>
</ModelParameterGroup>
<ModelParameterGroup cn="CN=Root,Model=Verwer1994,Vector=Reactions[R14]" type="Reaction">
<ModelParameter cn="CN=Root,Model=Verwer1994,Vector=Reactions[R14],ParameterGroup=Parameters,Parameter=k1" value="16300" type="ReactionParameter" simulationType="assignment">
<InitialExpression>
<CN=Root,Model=Verwer1994,Vector=Values[k14],Reference=InitialValue>
</InitialExpression>
</ModelParameter>
</ModelParameterGroup>
<ModelParameterGroup cn="CN=Root,Model=Verwer1994,Vector=Reactions[R15]" type="Reaction">
<ModelParameter cn="CN=Root,Model=Verwer1994,Vector=Reactions[R15],ParameterGroup=Parameters,Parameter=k1" value="4800000" type="ReactionParameter" simulationType="assignment">
<InitialExpression>
<CN=Root,Model=Verwer1994,Vector=Values[k15],Reference=InitialValue>
</InitialExpression>
</ModelParameter>
</ModelParameterGroup>
<ModelParameterGroup cn="CN=Root,Model=Verwer1994,Vector=Reactions[R16]" type="Reaction">
<ModelParameter cn="CN=Root,Model=Verwer1994,Vector=Reactions[R16],ParameterGroup=Parameters,Parameter=k1" value="0.00035" type="ReactionParameter" simulationType="assignment">
<InitialExpression>
<CN=Root,Model=Verwer1994,Vector=Values[k16],Reference=InitialValue>
</InitialExpression>
</ModelParameter>
</ModelParameterGroup>
<ModelParameterGroup cn="CN=Root,Model=Verwer1994,Vector=Reactions[R17]" type="Reaction">
<ModelParameter cn="CN=Root,Model=Verwer1994,Vector=Reactions[R17],ParameterGroup=Parameters,Parameter=k1" value="0.017500000000000002" type="ReactionParameter" simulationType="assignment">
<InitialExpression>
<CN=Root,Model=Verwer1994,Vector=Values[k17],Reference=InitialValue>
</InitialExpression>
</ModelParameter>
</ModelParameterGroup>
<ModelParameterGroup cn="CN=Root,Model=Verwer1994,Vector=Reactions[R18]" type="Reaction">
<ModelParameter cn="CN=Root,Model=Verwer1994,Vector=Reactions[R18],ParameterGroup=Parameters,Parameter=k1" value="100000000" type="ReactionParameter" simulationType="assignment">
<InitialExpression>
<CN=Root,Model=Verwer1994,Vector=Values[k18],Reference=InitialValue>
</InitialExpression>
</ModelParameter>
</ModelParameterGroup>
<ModelParameterGroup cn="CN=Root,Model=Verwer1994,Vector=Reactions[R19]" type="Reaction">
<ModelParameter cn="CN=Root,Model=Verwer1994,Vector=Reactions[R19],ParameterGroup=Parameters,Parameter=k1" value="444000000000" type="ReactionParameter" simulationType="assignment">
<InitialExpression>
<CN=Root,Model=Verwer1994,Vector=Values[k19],Reference=InitialValue>
</InitialExpression>
</ModelParameter>
</ModelParameterGroup>
<ModelParameterGroup cn="CN=Root,Model=Verwer1994,Vector=Reactions[R20]" type="Reaction">
<ModelParameter cn="CN=Root,Model=Verwer1994,Vector=Reactions[R20],ParameterGroup=Parameters,Parameter=k1" value="1240" type="ReactionParameter" simulationType="assignment">
<InitialExpression>
<CN=Root,Model=Verwer1994,Vector=Values[k20],Reference=InitialValue>
</InitialExpression>
</ModelParameter>
</ModelParameterGroup>
<ModelParameterGroup cn="CN=Root,Model=Verwer1994,Vector=Reactions[R21]" type="Reaction">
<ModelParameter cn="CN=Root,Model=Verwer1994,Vector=Reactions[R21],ParameterGroup=Parameters,Parameter=k1" value="2.1000000000000001" type="ReactionParameter" simulationType="assignment">
<InitialExpression>
<CN=Root,Model=Verwer1994,Vector=Values[k21],Reference=InitialValue>
</InitialExpression>
</ModelParameter>
</ModelParameterGroup>
<ModelParameterGroup cn="CN=Root,Model=Verwer1994,Vector=Reactions[R22]" type="Reaction">
<ModelParameter cn="CN=Root,Model=Verwer1994,Vector=Reactions[R22],ParameterGroup=Parameters,Parameter=k1" value="5.7800000000000002" type="ReactionParameter" simulationType="assignment">
<InitialExpression>
<CN=Root,Model=Verwer1994,Vector=Values[k22],Reference=InitialValue>
</InitialExpression>
</ModelParameter>
</ModelParameterGroup>
<ModelParameterGroup cn="CN=Root,Model=Verwer1994,Vector=Reactions[R23]" type="Reaction">
<ModelParameter cn="CN=Root,Model=Verwer1994,Vector=Reactions[R23],ParameterGroup=Parameters,Parameter=k1" value="0.047399999999999998" type="ReactionParameter" simulationType="assignment">
<InitialExpression>
<CN=Root,Model=Verwer1994,Vector=Values[k23],Reference=InitialValue>
</InitialExpression>
</ModelParameter>
</ModelParameterGroup>
<ModelParameterGroup cn="CN=Root,Model=Verwer1994,Vector=Reactions[R24]" type="Reaction">
<ModelParameter cn="CN=Root,Model=Verwer1994,Vector=Reactions[R24],ParameterGroup=Parameters,Parameter=k1" value="1780" type="ReactionParameter" simulationType="assignment">
<InitialExpression>
<CN=Root,Model=Verwer1994,Vector=Values[k24],Reference=InitialValue>
</InitialExpression>
</ModelParameter>
</ModelParameterGroup>
<ModelParameterGroup cn="CN=Root,Model=Verwer1994,Vector=Reactions[R25]" type="Reaction">
<ModelParameter cn="CN=Root,Model=Verwer1994,Vector=Reactions[R25],ParameterGroup=Parameters,Parameter=k1" value="3.1200000000000001" type="ReactionParameter" simulationType="assignment">
<InitialExpression>
<CN=Root,Model=Verwer1994,Vector=Values[k25],Reference=InitialValue>
</InitialExpression>
</ModelParameter>
</ModelParameterGroup>
</ModelParameterGroup>
</ModelParameterSet>
</ListOfModelParameterSets>
<StateTemplate>
<StateTemplateVariable objectReference="Model_1"/>
<StateTemplateVariable objectReference="Metabolite_21"/>
<StateTemplateVariable objectReference="Metabolite_23"/>
<StateTemplateVariable objectReference="Metabolite_24"/>
<StateTemplateVariable objectReference="Metabolite_22"/>
<StateTemplateVariable objectReference="Metabolite_38"/>
<StateTemplateVariable objectReference="Metabolite_34"/>
<StateTemplateVariable objectReference="Metabolite_29"/>
<StateTemplateVariable objectReference="Metabolite_26"/>
<StateTemplateVariable objectReference="Metabolite_20"/>
<StateTemplateVariable objectReference="Metabolite_28"/>
<StateTemplateVariable objectReference="Metabolite_35"/>
<StateTemplateVariable objectReference="Metabolite_32"/>
<StateTemplateVariable objectReference="Metabolite_27"/>
<StateTemplateVariable objectReference="Metabolite_36"/>
<StateTemplateVariable objectReference="Metabolite_33"/>
<StateTemplateVariable objectReference="Metabolite_25"/>
<StateTemplateVariable objectReference="Metabolite_30"/>
<StateTemplateVariable objectReference="Metabolite_31"/>
<StateTemplateVariable objectReference="Metabolite_39"/>
<StateTemplateVariable objectReference="Metabolite_37"/>
<StateTemplateVariable objectReference="Compartment_1"/>
<StateTemplateVariable objectReference="ModelValue_25"/>
<StateTemplateVariable objectReference="ModelValue_26"/>
<StateTemplateVariable objectReference="ModelValue_27"/>
<StateTemplateVariable objectReference="ModelValue_28"/>
<StateTemplateVariable objectReference="ModelValue_29"/>
<StateTemplateVariable objectReference="ModelValue_30"/>
<StateTemplateVariable objectReference="ModelValue_31"/>
<StateTemplateVariable objectReference="ModelValue_32"/>
<StateTemplateVariable objectReference="ModelValue_33"/>
<StateTemplateVariable objectReference="ModelValue_34"/>
<StateTemplateVariable objectReference="ModelValue_35"/>
<StateTemplateVariable objectReference="ModelValue_36"/>
<StateTemplateVariable objectReference="ModelValue_37"/>
<StateTemplateVariable objectReference="ModelValue_38"/>
<StateTemplateVariable objectReference="ModelValue_39"/>
<StateTemplateVariable objectReference="ModelValue_40"/>
<StateTemplateVariable objectReference="ModelValue_41"/>
<StateTemplateVariable objectReference="ModelValue_42"/>
<StateTemplateVariable objectReference="ModelValue_43"/>
<StateTemplateVariable objectReference="ModelValue_44"/>
<StateTemplateVariable objectReference="ModelValue_45"/>
<StateTemplateVariable objectReference="ModelValue_46"/>
<StateTemplateVariable objectReference="ModelValue_47"/>
<StateTemplateVariable objectReference="ModelValue_48"/>
<StateTemplateVariable objectReference="ModelValue_49"/>
</StateTemplate>
<InitialState type="initialState">
0 0 0 0 2.4088563428000002e+19 0 0 0 6.0221408570000007e+19 1.2044281714000001e+20 0 0 0 6.0221408570000005e+18 4.2154985999000003e+18 0 1.8066422571000001e+20 0 0 0 0 1 0.34999999999999998 26.600000000000001 12300 0.00085999999999999998 0.00081999999999999998 15000 0.00012999999999999999 24000 16500 9000 0.021999999999999999 12000 1.8799999999999999 16300 4800000 0.00035 0.017500000000000002 100000000 444000000000 1240 2.1000000000000001 5.7800000000000002 0.047399999999999998 1780 3.1200000000000001
</InitialState>
</Model>
<ListOfTasks>
<Task key="Task_29" name="Steady-State" type="steadyState" scheduled="false" updateModel="false">
<Report reference="Report_11" target="" append="1" confirmOverwrite="1"/>
<Problem>
<Parameter name="JacobianRequested" type="bool" value="1"/>
<Parameter name="StabilityAnalysisRequested" type="bool" value="1"/>
</Problem>
<Method name="Enhanced Newton" type="EnhancedNewton">
<Parameter name="Resolution" type="unsignedFloat" value="1.0000000000000001e-09"/>
<Parameter name="Derivation Factor" type="unsignedFloat" value="0.001"/>
<Parameter name="Use Newton" type="bool" value="1"/>
<Parameter name="Use Integration" type="bool" value="1"/>
<Parameter name="Use Back Integration" type="bool" value="1"/>
<Parameter name="Accept Negative Concentrations" type="bool" value="0"/>
<Parameter name="Iteration Limit" type="unsignedInteger" value="50"/>
<Parameter name="Maximum duration for forward integration" type="unsignedFloat" value="1000000000"/>
<Parameter name="Maximum duration for backward integration" type="unsignedFloat" value="1000000"/>
<Parameter name="Target Criterion" type="string" value="Distance and Rate"/>
</Method>
</Task>
<Task key="Task_16" name="Time-Course" type="timeCourse" scheduled="false" updateModel="false">
<Report reference="Report_21" target="" append="0" confirmOverwrite="0"/>
<Problem>
<Parameter name="AutomaticStepSize" type="bool" value="1"/>
<Parameter name="StepNumber" type="unsignedInteger" value="12002"/>
<Parameter name="StepSize" type="float" value="0.041663194729999999"/>
<Parameter name="Duration" type="float" value="500"/>
<Parameter name="TimeSeriesRequested" type="bool" value="1"/>
<Parameter name="OutputStartTime" type="float" value="0"/>
<Parameter name="Output Event" type="bool" value="0"/>
<Parameter name="Start in Steady State" type="bool" value="0"/>
<Parameter name="Use Values" type="bool" value="0"/>
<Parameter name="Values" type="string" value=""/>
</Problem>
<Method name="Deterministic (RADAU5)" type="Deterministic(RADAU5)">
<Parameter name="Integrate Reduced Model" type="bool" value="0"/>
<Parameter name="Relative Tolerance" type="unsignedFloat" value="0.0001"/>
<Parameter name="Absolute Tolerance" type="unsignedFloat" value="9.9999999999999995e-07"/>
<Parameter name="Max Internal Steps" type="unsignedInteger" value="1000000000"/>
<Parameter name="Initial Step Size" type="unsignedFloat" value="0.001"/>
</Method>
</Task>
<Task key="Task_17" name="Scan" type="scan" scheduled="true" updateModel="false">
<Report reference="Report_25" target="Pollution_radau5.out" append="1" confirmOverwrite="0"/>
<Problem>
<Parameter name="Subtask" type="unsignedInteger" value="1"/>
<ParameterGroup name="ScanItems">
<ParameterGroup name="ScanItem">
<Parameter name="Number of steps" type="unsignedInteger" value="100"/>
<Parameter name="Type" type="unsignedInteger" value="0"/>
<Parameter name="Object" type="cn" value=""/>
</ParameterGroup>
</ParameterGroup>
<Parameter name="Output in subtask" type="bool" value="0"/>
<Parameter name="Adjust initial conditions" type="bool" value="0"/>
<Parameter name="Continue on Error" type="bool" value="1"/>
</Problem>
<Method name="Scan Framework" type="ScanFramework">
</Method>
</Task>
<Task key="Task_18" name="Elementary Flux Modes" type="fluxMode" scheduled="false" updateModel="false">
<Report reference="Report_12" target="" append="1" confirmOverwrite="1"/>
<Problem>
</Problem>
<Method name="EFM Algorithm" type="EFMAlgorithm">
</Method>
</Task>
<Task key="Task_19" name="Optimization" type="optimization" scheduled="false" updateModel="false">
<Report reference="Report_13" target="" append="1" confirmOverwrite="1"/>
<Problem>
<Parameter name="Subtask" type="cn" value="CN=Root,Vector=TaskList[Steady-State]"/>
<ParameterText name="ObjectiveExpression" type="expression">
</ParameterText>
<Parameter name="Maximize" type="bool" value="0"/>
<Parameter name="Randomize Start Values" type="bool" value="0"/>
<Parameter name="Calculate Statistics" type="bool" value="1"/>
<ParameterGroup name="OptimizationItemList">
</ParameterGroup>
<ParameterGroup name="OptimizationConstraintList">
</ParameterGroup>
</Problem>
<Method name="Random Search" type="RandomSearch">
<Parameter name="Log Verbosity" type="unsignedInteger" value="0"/>
<Parameter name="Number of Iterations" type="unsignedInteger" value="100000"/>
<Parameter name="Random Number Generator" type="unsignedInteger" value="1"/>
<Parameter name="Seed" type="unsignedInteger" value="0"/>
</Method>
</Task>
<Task key="Task_20" name="Parameter Estimation" type="parameterFitting" scheduled="false" updateModel="false">
<Report reference="Report_14" target="" append="1" confirmOverwrite="1"/>
<Problem>
<Parameter name="Maximize" type="bool" value="0"/>
<Parameter name="Randomize Start Values" type="bool" value="0"/>
<Parameter name="Calculate Statistics" type="bool" value="1"/>
<ParameterGroup name="OptimizationItemList">
</ParameterGroup>
<ParameterGroup name="OptimizationConstraintList">
</ParameterGroup>
<Parameter name="Steady-State" type="cn" value="CN=Root,Vector=TaskList[Steady-State]"/>
<Parameter name="Time-Course" type="cn" value="CN=Root,Vector=TaskList[Time-Course]"/>
<Parameter name="Create Parameter Sets" type="bool" value="0"/>
<Parameter name="Use Time Sens" type="bool" value="0"/>
<Parameter name="Time-Sens" type="cn" value=""/>
<ParameterGroup name="Experiment Set">
</ParameterGroup>
<ParameterGroup name="Validation Set">
<Parameter name="Weight" type="unsignedFloat" value="1"/>
<Parameter name="Threshold" type="unsignedInteger" value="5"/>
</ParameterGroup>
</Problem>
<Method name="Evolutionary Programming" type="EvolutionaryProgram">
<Parameter name="Log Verbosity" type="unsignedInteger" value="0"/>
<Parameter name="Number of Generations" type="unsignedInteger" value="200"/>
<Parameter name="Population Size" type="unsignedInteger" value="20"/>
<Parameter name="Random Number Generator" type="unsignedInteger" value="1"/>
<Parameter name="Seed" type="unsignedInteger" value="0"/>
<Parameter name="Stop after # Stalled Generations" type="unsignedInteger" value="0"/>
</Method>
</Task>
<Task key="Task_21" name="Metabolic Control Analysis" type="metabolicControlAnalysis" scheduled="false" updateModel="false">
<Report reference="Report_15" target="" append="1" confirmOverwrite="1"/>
<Problem>
<Parameter name="Steady-State" type="key" value="Task_29"/>
</Problem>
<Method name="MCA Method (Reder)" type="MCAMethod(Reder)">
<Parameter name="Modulation Factor" type="unsignedFloat" value="1.0000000000000001e-09"/>
<Parameter name="Use Reder" type="bool" value="1"/>
<Parameter name="Use Smallbone" type="bool" value="1"/>
</Method>
</Task>
<Task key="Task_22" name="Lyapunov Exponents" type="lyapunovExponents" scheduled="false" updateModel="false">
<Report reference="Report_16" target="" append="1" confirmOverwrite="1"/>
<Problem>
<Parameter name="ExponentNumber" type="unsignedInteger" value="3"/>
<Parameter name="DivergenceRequested" type="bool" value="1"/>
<Parameter name="TransientTime" type="float" value="0"/>
</Problem>
<Method name="Wolf Method" type="WolfMethod">
<Parameter name="Orthonormalization Interval" type="unsignedFloat" value="1"/>
<Parameter name="Overall time" type="unsignedFloat" value="1000"/>
<Parameter name="Relative Tolerance" type="unsignedFloat" value="9.9999999999999995e-07"/>
<Parameter name="Absolute Tolerance" type="unsignedFloat" value="9.9999999999999998e-13"/>
<Parameter name="Max Internal Steps" type="unsignedInteger" value="10000"/>
</Method>
</Task>
<Task key="Task_23" name="Time Scale Separation Analysis" type="timeScaleSeparationAnalysis" scheduled="false" updateModel="false">
<Report reference="Report_17" target="" append="1" confirmOverwrite="1"/>
<Problem>
<Parameter name="StepNumber" type="unsignedInteger" value="100"/>
<Parameter name="StepSize" type="float" value="0.01"/>
<Parameter name="Duration" type="float" value="1"/>
<Parameter name="TimeSeriesRequested" type="bool" value="1"/>
<Parameter name="OutputStartTime" type="float" value="0"/>
</Problem>
<Method name="ILDM (LSODA,Deuflhard)" type="TimeScaleSeparation(ILDM,Deuflhard)">
<Parameter name="Deuflhard Tolerance" type="unsignedFloat" value="0.0001"/>
</Method>
</Task>
<Task key="Task_24" name="Sensitivities" type="sensitivities" scheduled="false" updateModel="false">
<Report reference="Report_18" target="" append="1" confirmOverwrite="1"/>
<Problem>
<Parameter name="SubtaskType" type="unsignedInteger" value="1"/>
<ParameterGroup name="TargetFunctions">
<Parameter name="SingleObject" type="cn" value=""/>
<Parameter name="ObjectListType" type="unsignedInteger" value="7"/>
</ParameterGroup>
<ParameterGroup name="ListOfVariables">
<ParameterGroup name="Variables">
<Parameter name="SingleObject" type="cn" value=""/>
<Parameter name="ObjectListType" type="unsignedInteger" value="41"/>
</ParameterGroup>
<ParameterGroup name="Variables">
<Parameter name="SingleObject" type="cn" value=""/>
<Parameter name="ObjectListType" type="unsignedInteger" value="0"/>
</ParameterGroup>
</ParameterGroup>
</Problem>
<Method name="Sensitivities Method" type="SensitivitiesMethod">
<Parameter name="Delta factor" type="unsignedFloat" value="0.001"/>
<Parameter name="Delta minimum" type="unsignedFloat" value="9.9999999999999998e-13"/>
</Method>
</Task>
<Task key="Task_25" name="Moieties" type="moieties" scheduled="false" updateModel="false">
<Report reference="Report_19" target="" append="1" confirmOverwrite="1"/>
<Problem>
</Problem>
<Method name="Householder Reduction" type="Householder">
</Method>
</Task>
<Task key="Task_26" name="Cross Section" type="crosssection" scheduled="false" updateModel="false">
<Problem>
<Parameter name="AutomaticStepSize" type="bool" value="0"/>
<Parameter name="StepNumber" type="unsignedInteger" value="100"/>
<Parameter name="StepSize" type="float" value="0.01"/>
<Parameter name="Duration" type="float" value="1"/>
<Parameter name="TimeSeriesRequested" type="bool" value="1"/>
<Parameter name="OutputStartTime" type="float" value="0"/>
<Parameter name="Output Event" type="bool" value="0"/>
<Parameter name="Start in Steady State" type="bool" value="0"/>
<Parameter name="Use Values" type="bool" value="0"/>
<Parameter name="Values" type="string" value=""/>
<Parameter name="LimitCrossings" type="bool" value="0"/>
<Parameter name="NumCrossingsLimit" type="unsignedInteger" value="0"/>
<Parameter name="LimitOutTime" type="bool" value="0"/>
<Parameter name="LimitOutCrossings" type="bool" value="0"/>
<Parameter name="PositiveDirection" type="bool" value="1"/>
<Parameter name="NumOutCrossingsLimit" type="unsignedInteger" value="0"/>
<Parameter name="LimitUntilConvergence" type="bool" value="0"/>
<Parameter name="ConvergenceTolerance" type="float" value="0"/>
<Parameter name="Threshold" type="float" value="0"/>
<Parameter name="DelayOutputUntilConvergence" type="bool" value="0"/>
<Parameter name="OutputConvergenceTolerance" type="float" value="0"/>
<ParameterText name="TriggerExpression" type="expression">
</ParameterText>
<Parameter name="SingleVariable" type="cn" value=""/>
</Problem>
<Method name="Deterministic (LSODA)" type="Deterministic(LSODA)">
<Parameter name="Integrate Reduced Model" type="bool" value="0"/>
<Parameter name="Relative Tolerance" type="unsignedFloat" value="9.9999999999999995e-07"/>
<Parameter name="Absolute Tolerance" type="unsignedFloat" value="9.9999999999999998e-13"/>
<Parameter name="Max Internal Steps" type="unsignedInteger" value="10000"/>
<Parameter name="Max Internal Step Size" type="unsignedFloat" value="0"/>
</Method>
</Task>
<Task key="Task_27" name="Linear Noise Approximation" type="linearNoiseApproximation" scheduled="false" updateModel="false">
<Report reference="Report_20" target="" append="1" confirmOverwrite="1"/>
<Problem>
<Parameter name="Steady-State" type="key" value="Task_29"/>
</Problem>
<Method name="Linear Noise Approximation" type="LinearNoiseApproximation">
</Method>
</Task>
<Task key="Task_15" name="Time-Course Sensitivities" type="timeSensitivities" scheduled="false" updateModel="false">
<Problem>
<Parameter name="AutomaticStepSize" type="bool" value="0"/>
<Parameter name="StepNumber" type="unsignedInteger" value="100"/>
<Parameter name="StepSize" type="float" value="0.01"/>
<Parameter name="Duration" type="float" value="1"/>
<Parameter name="TimeSeriesRequested" type="bool" value="1"/>
<Parameter name="OutputStartTime" type="float" value="0"/>
<Parameter name="Output Event" type="bool" value="0"/>
<Parameter name="Start in Steady State" type="bool" value="0"/>
<Parameter name="Use Values" type="bool" value="0"/>
<Parameter name="Values" type="string" value=""/>
<ParameterGroup name="ListOfParameters">
</ParameterGroup>
<ParameterGroup name="ListOfTargets">
</ParameterGroup>
</Problem>
<Method name="LSODA Sensitivities" type="Sensitivities(LSODA)">
<Parameter name="Integrate Reduced Model" type="bool" value="0"/>
<Parameter name="Relative Tolerance" type="unsignedFloat" value="9.9999999999999995e-07"/>
<Parameter name="Absolute Tolerance" type="unsignedFloat" value="9.9999999999999998e-13"/>
<Parameter name="Max Internal Steps" type="unsignedInteger" value="10000"/>
<Parameter name="Max Internal Step Size" type="unsignedFloat" value="0"/>
</Method>
</Task>
</ListOfTasks>
<ListOfReports>
<Report key="Report_11" name="Steady-State" taskType="steadyState" separator="	" precision="6">
<Comment>
Automatically generated report.
</Comment>
<Footer>
<Object cn="CN=Root,Vector=TaskList[Steady-State]"/>
</Footer>
</Report>
<Report key="Report_12" name="Elementary Flux Modes" taskType="fluxMode" separator="	" precision="6">
<Comment>
Automatically generated report.
</Comment>
<Footer>
<Object cn="CN=Root,Vector=TaskList[Elementary Flux Modes],Object=Result"/>
</Footer>
</Report>
<Report key="Report_13" name="Optimization" taskType="optimization" separator="	" precision="6">
<Comment>
Automatically generated report.
</Comment>
<Header>
<Object cn="CN=Root,Vector=TaskList[Optimization],Object=Description"/>
<Object cn="String=\[Function Evaluations\]"/>
<Object cn="Separator=	"/>
<Object cn="String=\[Best Value\]"/>
<Object cn="Separator=	"/>
<Object cn="String=\[Best Parameters\]"/>
</Header>
<Body>
<Object cn="CN=Root,Vector=TaskList[Optimization],Problem=Optimization,Reference=Function Evaluations"/>
<Object cn="Separator=	"/>
<Object cn="CN=Root,Vector=TaskList[Optimization],Problem=Optimization,Reference=Best Value"/>
<Object cn="Separator=	"/>
<Object cn="CN=Root,Vector=TaskList[Optimization],Problem=Optimization,Reference=Best Parameters"/>
</Body>
<Footer>
<Object cn="String=
"/>
<Object cn="CN=Root,Vector=TaskList[Optimization],Object=Result"/>
</Footer>
</Report>
<Report key="Report_14" name="Parameter Estimation" taskType="parameterFitting" separator="	" precision="6">
<Comment>
Automatically generated report.
</Comment>
<Header>
<Object cn="CN=Root,Vector=TaskList[Parameter Estimation],Object=Description"/>
<Object cn="String=\[Function Evaluations\]"/>
<Object cn="Separator=	"/>
<Object cn="String=\[Best Value\]"/>
<Object cn="Separator=	"/>
<Object cn="String=\[Best Parameters\]"/>
</Header>
<Body>
<Object cn="CN=Root,Vector=TaskList[Parameter Estimation],Problem=Parameter Estimation,Reference=Function Evaluations"/>
<Object cn="Separator=	"/>
<Object cn="CN=Root,Vector=TaskList[Parameter Estimation],Problem=Parameter Estimation,Reference=Best Value"/>
<Object cn="Separator=	"/>
<Object cn="CN=Root,Vector=TaskList[Parameter Estimation],Problem=Parameter Estimation,Reference=Best Parameters"/>
</Body>
<Footer>
<Object cn="String=
"/>
<Object cn="CN=Root,Vector=TaskList[Parameter Estimation],Object=Result"/>
</Footer>
</Report>
<Report key="Report_15" name="Metabolic Control Analysis" taskType="metabolicControlAnalysis" separator="	" precision="6">
<Comment>
Automatically generated report.
</Comment>
<Header>
<Object cn="CN=Root,Vector=TaskList[Metabolic Control Analysis],Object=Description"/>
</Header>
<Footer>
<Object cn="String=
"/>
<Object cn="CN=Root,Vector=TaskList[Metabolic Control Analysis],Object=Result"/>
</Footer>
</Report>
<Report key="Report_16" name="Lyapunov Exponents" taskType="lyapunovExponents" separator="	" precision="6">
<Comment>
Automatically generated report.
</Comment>
<Header>
<Object cn="CN=Root,Vector=TaskList[Lyapunov Exponents],Object=Description"/>
</Header>
<Footer>
<Object cn="String=
"/>
<Object cn="CN=Root,Vector=TaskList[Lyapunov Exponents],Object=Result"/>
</Footer>
</Report>
<Report key="Report_17" name="Time Scale Separation Analysis" taskType="timeScaleSeparationAnalysis" separator="	" precision="6">
<Comment>
Automatically generated report.
</Comment>
<Header>
<Object cn="CN=Root,Vector=TaskList[Time Scale Separation Analysis],Object=Description"/>
</Header>
<Footer>
<Object cn="String=
"/>
<Object cn="CN=Root,Vector=TaskList[Time Scale Separation Analysis],Object=Result"/>
</Footer>
</Report>
<Report key="Report_18" name="Sensitivities" taskType="sensitivities" separator="	" precision="6">
<Comment>
Automatically generated report.
</Comment>
<Header>
<Object cn="CN=Root,Vector=TaskList[Sensitivities],Object=Description"/>
</Header>
<Footer>
<Object cn="String=
"/>
<Object cn="CN=Root,Vector=TaskList[Sensitivities],Object=Result"/>
</Footer>
</Report>
<Report key="Report_19" name="Moieties" taskType="moieties" separator="	" precision="6">
<Comment>
Automatically generated report.
</Comment>
<Header>
<Object cn="CN=Root,Vector=TaskList[Moieties],Object=Description"/>
</Header>
<Footer>
<Object cn="String=
"/>
<Object cn="CN=Root,Vector=TaskList[Moieties],Object=Result"/>
</Footer>
</Report>
<Report key="Report_20" name="Linear Noise Approximation" taskType="linearNoiseApproximation" separator="	" precision="6">
<Comment>
Automatically generated report.
</Comment>
<Header>
<Object cn="CN=Root,Vector=TaskList[Linear Noise Approximation],Object=Description"/>
</Header>
<Footer>
<Object cn="String=
"/>
<Object cn="CN=Root,Vector=TaskList[Linear Noise Approximation],Object=Result"/>
</Footer>
</Report>
<Report key="Report_21" name="report" taskType="timeCourse" separator="	" precision="10">
<Comment>
</Comment>
<Footer>
<Object cn="CN=Root,Model=Verwer1994,Reference=Time"/>
<Object cn="Separator=	"/>
<Object cn="CN=Root,Model=Verwer1994,Vector=Compartments[compartment],Vector=Metabolites[NO2],Reference=Concentration"/>
<Object cn="Separator=	"/>
<Object cn="CN=Root,Model=Verwer1994,Vector=Compartments[compartment],Vector=Metabolites[NO],Reference=Concentration"/>
<Object cn="Separator=	"/>
<Object cn="CN=Root,Model=Verwer1994,Vector=Compartments[compartment],Vector=Metabolites[O3P],Reference=Concentration"/>
<Object cn="Separator=	"/>
<Object cn="CN=Root,Model=Verwer1994,Vector=Compartments[compartment],Vector=Metabolites[O3],Reference=Concentration"/>
<Object cn="Separator=	"/>
<Object cn="CN=Root,Model=Verwer1994,Vector=Compartments[compartment],Vector=Metabolites[HO2],Reference=Concentration"/>
<Object cn="Separator=	"/>
<Object cn="CN=Root,Model=Verwer1994,Vector=Compartments[compartment],Vector=Metabolites[OH],Reference=Concentration"/>
<Object cn="Separator=	"/>
<Object cn="CN=Root,Model=Verwer1994,Vector=Compartments[compartment],Vector=Metabolites[HCHO],Reference=Concentration"/>
<Object cn="Separator=	"/>
<Object cn="CN=Root,Model=Verwer1994,Vector=Compartments[compartment],Vector=Metabolites[CO],Reference=Concentration"/>
<Object cn="Separator=	"/>
<Object cn="CN=Root,Model=Verwer1994,Vector=Compartments[compartment],Vector=Metabolites[ALD],Reference=Concentration"/>
<Object cn="Separator=	"/>
<Object cn="CN=Root,Model=Verwer1994,Vector=Compartments[compartment],Vector=Metabolites[MEO2],Reference=Concentration"/>
<Object cn="Separator=	"/>
<Object cn="CN=Root,Model=Verwer1994,Vector=Compartments[compartment],Vector=Metabolites[C2O3],Reference=Concentration"/>
<Object cn="Separator=	"/>
<Object cn="CN=Root,Model=Verwer1994,Vector=Compartments[compartment],Vector=Metabolites[CO2],Reference=Concentration"/>
<Object cn="Separator=	"/>
<Object cn="CN=Root,Model=Verwer1994,Vector=Compartments[compartment],Vector=Metabolites[PAN],Reference=Concentration"/>
<Object cn="Separator=	"/>
<Object cn="CN=Root,Model=Verwer1994,Vector=Compartments[compartment],Vector=Metabolites[CH3O],Reference=Concentration"/>
<Object cn="Separator=	"/>
<Object cn="CN=Root,Model=Verwer1994,Vector=Compartments[compartment],Vector=Metabolites[HNO3],Reference=Concentration"/>
<Object cn="Separator=	"/>
<Object cn="CN=Root,Model=Verwer1994,Vector=Compartments[compartment],Vector=Metabolites[O1D],Reference=Concentration"/>
<Object cn="Separator=	"/>
<Object cn="CN=Root,Model=Verwer1994,Vector=Compartments[compartment],Vector=Metabolites[SO2],Reference=Concentration"/>
<Object cn="Separator=	"/>
<Object cn="CN=Root,Model=Verwer1994,Vector=Compartments[compartment],Vector=Metabolites[SO4],Reference=Concentration"/>
<Object cn="Separator=	"/>
<Object cn="CN=Root,Model=Verwer1994,Vector=Compartments[compartment],Vector=Metabolites[NO3],Reference=Concentration"/>
<Object cn="Separator=	"/>
<Object cn="CN=Root,Model=Verwer1994,Vector=Compartments[compartment],Vector=Metabolites[N2O5],Reference=Concentration"/>
</Footer>
</Report>
<Report key="Report_24" name="Time-Course" taskType="timeCourse" separator="	" precision="6">
<Comment>
Automatically generated report.
</Comment>
<Header>
<Object cn="CN=Root,Vector=TaskList[Time-Course],Object=Description"/>
</Header>
<Footer>
<Object cn="CN=Root,Vector=TaskList[Time-Course],Object=Result"/>
</Footer>
</Report>
<Report key="Report_25" name="Speed test (scan)" taskType="scan" separator="	" precision="8">
<Comment>
</Comment>
<Header>
<Object cn="CN=Root,CN=Information,String=COPASI Version"/>
<Object cn="Separator=	"/>
<Object cn="CN=Root,CN=Information,Timer=Current Date/Time"/>
</Header>
<Footer>
<Object cn="CN=Root,Timer=CPU Time"/>
</Footer>
</Report>
</ListOfReports>
<ListOfPlots>
<PlotSpecification name="Concentrations, Volumes, and Global Quantity Values" type="Plot2D" active="1" taskTypes="">
<Parameter name="log X" type="bool" value="0"/>
<Parameter name="log Y" type="bool" value="0"/>
<ListOfPlotItems>
<PlotItem name="[NO]" type="Curve2D">
<Parameter name="Line type" type="unsignedInteger" value="0"/>
<Parameter name="Line subtype" type="unsignedInteger" value="0"/>
<Parameter name="Line width" type="unsignedFloat" value="1"/>
<Parameter name="Symbol subtype" type="unsignedInteger" value="0"/>
<Parameter name="Color" type="string" value="auto"/>
<Parameter name="Recording Activity" type="string" value="during"/>
<ListOfChannels>
<ChannelSpec cn="CN=Root,Model=Verwer1994,Reference=Time"/>
<ChannelSpec cn="CN=Root,Model=Verwer1994,Vector=Compartments[compartment],Vector=Metabolites[NO],Reference=Concentration"/>
</ListOfChannels>
</PlotItem>
<PlotItem name="[NO2]" type="Curve2D">
<Parameter name="Line type" type="unsignedInteger" value="0"/>
<Parameter name="Line subtype" type="unsignedInteger" value="0"/>
<Parameter name="Line width" type="unsignedFloat" value="1"/>
<Parameter name="Symbol subtype" type="unsignedInteger" value="0"/>
<Parameter name="Color" type="string" value="auto"/>
<Parameter name="Recording Activity" type="string" value="during"/>
<ListOfChannels>
<ChannelSpec cn="CN=Root,Model=Verwer1994,Reference=Time"/>
<ChannelSpec cn="CN=Root,Model=Verwer1994,Vector=Compartments[compartment],Vector=Metabolites[NO2],Reference=Concentration"/>
</ListOfChannels>
</PlotItem>
<PlotItem name="[O3]" type="Curve2D">
<Parameter name="Line type" type="unsignedInteger" value="0"/>
<Parameter name="Line subtype" type="unsignedInteger" value="0"/>
<Parameter name="Line width" type="unsignedFloat" value="1"/>
<Parameter name="Symbol subtype" type="unsignedInteger" value="0"/>
<Parameter name="Color" type="string" value="auto"/>
<Parameter name="Recording Activity" type="string" value="during"/>
<ListOfChannels>
<ChannelSpec cn="CN=Root,Model=Verwer1994,Reference=Time"/>
<ChannelSpec cn="CN=Root,Model=Verwer1994,Vector=Compartments[compartment],Vector=Metabolites[O3],Reference=Concentration"/>
</ListOfChannels>
</PlotItem>
<PlotItem name="[HO2]" type="Curve2D">
<Parameter name="Line type" type="unsignedInteger" value="0"/>
<Parameter name="Line subtype" type="unsignedInteger" value="0"/>
<Parameter name="Line width" type="unsignedFloat" value="1"/>
<Parameter name="Symbol subtype" type="unsignedInteger" value="0"/>
<Parameter name="Color" type="string" value="auto"/>
<Parameter name="Recording Activity" type="string" value="during"/>
<ListOfChannels>
<ChannelSpec cn="CN=Root,Model=Verwer1994,Reference=Time"/>
<ChannelSpec cn="CN=Root,Model=Verwer1994,Vector=Compartments[compartment],Vector=Metabolites[HO2],Reference=Concentration"/>
</ListOfChannels>
</PlotItem>
<PlotItem name="[OH]" type="Curve2D">
<Parameter name="Line type" type="unsignedInteger" value="0"/>
<Parameter name="Line subtype" type="unsignedInteger" value="0"/>
<Parameter name="Line width" type="unsignedFloat" value="1"/>
<Parameter name="Symbol subtype" type="unsignedInteger" value="0"/>
<Parameter name="Color" type="string" value="auto"/>
<Parameter name="Recording Activity" type="string" value="during"/>
<ListOfChannels>
<ChannelSpec cn="CN=Root,Model=Verwer1994,Reference=Time"/>
<ChannelSpec cn="CN=Root,Model=Verwer1994,Vector=Compartments[compartment],Vector=Metabolites[OH],Reference=Concentration"/>
</ListOfChannels>
</PlotItem>
<PlotItem name="[CO]" type="Curve2D">
<Parameter name="Line type" type="unsignedInteger" value="0"/>
<Parameter name="Line subtype" type="unsignedInteger" value="0"/>
<Parameter name="Line width" type="unsignedFloat" value="1"/>
<Parameter name="Symbol subtype" type="unsignedInteger" value="0"/>
<Parameter name="Color" type="string" value="auto"/>
<Parameter name="Recording Activity" type="string" value="during"/>
<ListOfChannels>
<ChannelSpec cn="CN=Root,Model=Verwer1994,Reference=Time"/>
<ChannelSpec cn="CN=Root,Model=Verwer1994,Vector=Compartments[compartment],Vector=Metabolites[CO],Reference=Concentration"/>
</ListOfChannels>
</PlotItem>
<PlotItem name="[HCHO]" type="Curve2D">
<Parameter name="Line type" type="unsignedInteger" value="0"/>
<Parameter name="Line subtype" type="unsignedInteger" value="0"/>
<Parameter name="Line width" type="unsignedFloat" value="1"/>
<Parameter name="Symbol subtype" type="unsignedInteger" value="0"/>
<Parameter name="Color" type="string" value="auto"/>
<Parameter name="Recording Activity" type="string" value="during"/>
<ListOfChannels>
<ChannelSpec cn="CN=Root,Model=Verwer1994,Reference=Time"/>
<ChannelSpec cn="CN=Root,Model=Verwer1994,Vector=Compartments[compartment],Vector=Metabolites[HCHO],Reference=Concentration"/>
</ListOfChannels>
</PlotItem>
<PlotItem name="[ALD]" type="Curve2D">
<Parameter name="Line type" type="unsignedInteger" value="0"/>
<Parameter name="Line subtype" type="unsignedInteger" value="0"/>
<Parameter name="Line width" type="unsignedFloat" value="1"/>
<Parameter name="Symbol subtype" type="unsignedInteger" value="0"/>
<Parameter name="Color" type="string" value="auto"/>
<Parameter name="Recording Activity" type="string" value="during"/>
<ListOfChannels>
<ChannelSpec cn="CN=Root,Model=Verwer1994,Reference=Time"/>
<ChannelSpec cn="CN=Root,Model=Verwer1994,Vector=Compartments[compartment],Vector=Metabolites[ALD],Reference=Concentration"/>
</ListOfChannels>
</PlotItem>
<PlotItem name="[MEO2]" type="Curve2D">
<Parameter name="Line type" type="unsignedInteger" value="0"/>
<Parameter name="Line subtype" type="unsignedInteger" value="0"/>
<Parameter name="Line width" type="unsignedFloat" value="1"/>
<Parameter name="Symbol subtype" type="unsignedInteger" value="0"/>
<Parameter name="Color" type="string" value="auto"/>
<Parameter name="Recording Activity" type="string" value="during"/>
<ListOfChannels>
<ChannelSpec cn="CN=Root,Model=Verwer1994,Reference=Time"/>
<ChannelSpec cn="CN=Root,Model=Verwer1994,Vector=Compartments[compartment],Vector=Metabolites[MEO2],Reference=Concentration"/>
</ListOfChannels>
</PlotItem>
<PlotItem name="[C2O3]" type="Curve2D">
<Parameter name="Line type" type="unsignedInteger" value="0"/>
<Parameter name="Line subtype" type="unsignedInteger" value="0"/>
<Parameter name="Line width" type="unsignedFloat" value="1"/>
<Parameter name="Symbol subtype" type="unsignedInteger" value="0"/>
<Parameter name="Color" type="string" value="auto"/>
<Parameter name="Recording Activity" type="string" value="during"/>
<ListOfChannels>
<ChannelSpec cn="CN=Root,Model=Verwer1994,Reference=Time"/>
<ChannelSpec cn="CN=Root,Model=Verwer1994,Vector=Compartments[compartment],Vector=Metabolites[C2O3],Reference=Concentration"/>
</ListOfChannels>
</PlotItem>
<PlotItem name="[CO2]" type="Curve2D">
<Parameter name="Line type" type="unsignedInteger" value="0"/>
<Parameter name="Line subtype" type="unsignedInteger" value="0"/>
<Parameter name="Line width" type="unsignedFloat" value="1"/>
<Parameter name="Symbol subtype" type="unsignedInteger" value="0"/>
<Parameter name="Color" type="string" value="auto"/>
<Parameter name="Recording Activity" type="string" value="during"/>
<ListOfChannels>
<ChannelSpec cn="CN=Root,Model=Verwer1994,Reference=Time"/>
<ChannelSpec cn="CN=Root,Model=Verwer1994,Vector=Compartments[compartment],Vector=Metabolites[CO2],Reference=Concentration"/>
</ListOfChannels>
</PlotItem>
<PlotItem name="[PAN]" type="Curve2D">
<Parameter name="Line type" type="unsignedInteger" value="0"/>
<Parameter name="Line subtype" type="unsignedInteger" value="0"/>
<Parameter name="Line width" type="unsignedFloat" value="1"/>
<Parameter name="Symbol subtype" type="unsignedInteger" value="0"/>
<Parameter name="Color" type="string" value="auto"/>
<Parameter name="Recording Activity" type="string" value="during"/>
<ListOfChannels>
<ChannelSpec cn="CN=Root,Model=Verwer1994,Reference=Time"/>
<ChannelSpec cn="CN=Root,Model=Verwer1994,Vector=Compartments[compartment],Vector=Metabolites[PAN],Reference=Concentration"/>
</ListOfChannels>
</PlotItem>
<PlotItem name="[CH3O]" type="Curve2D">
<Parameter name="Line type" type="unsignedInteger" value="0"/>
<Parameter name="Line subtype" type="unsignedInteger" value="0"/>
<Parameter name="Line width" type="unsignedFloat" value="1"/>
<Parameter name="Symbol subtype" type="unsignedInteger" value="0"/>
<Parameter name="Color" type="string" value="auto"/>
<Parameter name="Recording Activity" type="string" value="during"/>
<ListOfChannels>
<ChannelSpec cn="CN=Root,Model=Verwer1994,Reference=Time"/>
<ChannelSpec cn="CN=Root,Model=Verwer1994,Vector=Compartments[compartment],Vector=Metabolites[CH3O],Reference=Concentration"/>
</ListOfChannels>
</PlotItem>
<PlotItem name="[HNO3]" type="Curve2D">
<Parameter name="Line type" type="unsignedInteger" value="0"/>
<Parameter name="Line subtype" type="unsignedInteger" value="0"/>
<Parameter name="Line width" type="unsignedFloat" value="1"/>
<Parameter name="Symbol subtype" type="unsignedInteger" value="0"/>
<Parameter name="Color" type="string" value="auto"/>
<Parameter name="Recording Activity" type="string" value="during"/>
<ListOfChannels>
<ChannelSpec cn="CN=Root,Model=Verwer1994,Reference=Time"/>
<ChannelSpec cn="CN=Root,Model=Verwer1994,Vector=Compartments[compartment],Vector=Metabolites[HNO3],Reference=Concentration"/>
</ListOfChannels>
</PlotItem>
<PlotItem name="[O3P]" type="Curve2D">
<Parameter name="Line type" type="unsignedInteger" value="0"/>
<Parameter name="Line subtype" type="unsignedInteger" value="0"/>
<Parameter name="Line width" type="unsignedFloat" value="1"/>
<Parameter name="Symbol subtype" type="unsignedInteger" value="0"/>
<Parameter name="Color" type="string" value="auto"/>
<Parameter name="Recording Activity" type="string" value="during"/>
<ListOfChannels>
<ChannelSpec cn="CN=Root,Model=Verwer1994,Reference=Time"/>
<ChannelSpec cn="CN=Root,Model=Verwer1994,Vector=Compartments[compartment],Vector=Metabolites[O3P],Reference=Concentration"/>
</ListOfChannels>
</PlotItem>
<PlotItem name="[O1D]" type="Curve2D">
<Parameter name="Line type" type="unsignedInteger" value="0"/>
<Parameter name="Line subtype" type="unsignedInteger" value="0"/>
<Parameter name="Line width" type="unsignedFloat" value="1"/>
<Parameter name="Symbol subtype" type="unsignedInteger" value="0"/>
<Parameter name="Color" type="string" value="auto"/>
<Parameter name="Recording Activity" type="string" value="during"/>
<ListOfChannels>
<ChannelSpec cn="CN=Root,Model=Verwer1994,Reference=Time"/>
<ChannelSpec cn="CN=Root,Model=Verwer1994,Vector=Compartments[compartment],Vector=Metabolites[O1D],Reference=Concentration"/>
</ListOfChannels>
</PlotItem>
<PlotItem name="[SO2]" type="Curve2D">
<Parameter name="Line type" type="unsignedInteger" value="0"/>
<Parameter name="Line subtype" type="unsignedInteger" value="0"/>
<Parameter name="Line width" type="unsignedFloat" value="1"/>
<Parameter name="Symbol subtype" type="unsignedInteger" value="0"/>
<Parameter name="Color" type="string" value="auto"/>
<Parameter name="Recording Activity" type="string" value="during"/>
<ListOfChannels>
<ChannelSpec cn="CN=Root,Model=Verwer1994,Reference=Time"/>
<ChannelSpec cn="CN=Root,Model=Verwer1994,Vector=Compartments[compartment],Vector=Metabolites[SO2],Reference=Concentration"/>
</ListOfChannels>
</PlotItem>
<PlotItem name="[SO4]" type="Curve2D">
<Parameter name="Line type" type="unsignedInteger" value="0"/>
<Parameter name="Line subtype" type="unsignedInteger" value="0"/>
<Parameter name="Line width" type="unsignedFloat" value="1"/>
<Parameter name="Symbol subtype" type="unsignedInteger" value="0"/>
<Parameter name="Color" type="string" value="auto"/>
<Parameter name="Recording Activity" type="string" value="during"/>
<ListOfChannels>
<ChannelSpec cn="CN=Root,Model=Verwer1994,Reference=Time"/>
<ChannelSpec cn="CN=Root,Model=Verwer1994,Vector=Compartments[compartment],Vector=Metabolites[SO4],Reference=Concentration"/>
</ListOfChannels>
</PlotItem>
<PlotItem name="[NO3]" type="Curve2D">
<Parameter name="Line type" type="unsignedInteger" value="0"/>
<Parameter name="Line subtype" type="unsignedInteger" value="0"/>
<Parameter name="Line width" type="unsignedFloat" value="1"/>
<Parameter name="Symbol subtype" type="unsignedInteger" value="0"/>
<Parameter name="Color" type="string" value="auto"/>
<Parameter name="Recording Activity" type="string" value="during"/>
<ListOfChannels>
<ChannelSpec cn="CN=Root,Model=Verwer1994,Reference=Time"/>
<ChannelSpec cn="CN=Root,Model=Verwer1994,Vector=Compartments[compartment],Vector=Metabolites[NO3],Reference=Concentration"/>
</ListOfChannels>
</PlotItem>
<PlotItem name="[N2O5]" type="Curve2D">
<Parameter name="Line type" type="unsignedInteger" value="0"/>
<Parameter name="Line subtype" type="unsignedInteger" value="0"/>
<Parameter name="Line width" type="unsignedFloat" value="1"/>
<Parameter name="Symbol subtype" type="unsignedInteger" value="0"/>
<Parameter name="Color" type="string" value="auto"/>
<Parameter name="Recording Activity" type="string" value="during"/>
<ListOfChannels>
<ChannelSpec cn="CN=Root,Model=Verwer1994,Reference=Time"/>
<ChannelSpec cn="CN=Root,Model=Verwer1994,Vector=Compartments[compartment],Vector=Metabolites[N2O5],Reference=Concentration"/>
</ListOfChannels>
</PlotItem>
</ListOfPlotItems>
</PlotSpecification>
</ListOfPlots>
<GUI>
</GUI>
<SBMLReference file="Pollution.xml">
<SBMLMap SBMLid="ALD" COPASIkey="Metabolite_27"/>
<SBMLMap SBMLid="C2O3" COPASIkey="Metabolite_29"/>
<SBMLMap SBMLid="CH3O" COPASIkey="Metabolite_32"/>
<SBMLMap SBMLid="CO" COPASIkey="Metabolite_25"/>
<SBMLMap SBMLid="CO2" COPASIkey="Metabolite_30"/>
<SBMLMap SBMLid="HCHO" COPASIkey="Metabolite_26"/>
<SBMLMap SBMLid="HNO3" COPASIkey="Metabolite_33"/>
<SBMLMap SBMLid="HO2" COPASIkey="Metabolite_23"/>
<SBMLMap SBMLid="MEO2" COPASIkey="Metabolite_28"/>
<SBMLMap SBMLid="N2O5" COPASIkey="Metabolite_39"/>
<SBMLMap SBMLid="NO" COPASIkey="Metabolite_20"/>
<SBMLMap SBMLid="NO2" COPASIkey="Metabolite_21"/>
<SBMLMap SBMLid="NO3" COPASIkey="Metabolite_38"/>
<SBMLMap SBMLid="O1D" COPASIkey="Metabolite_35"/>
<SBMLMap SBMLid="O3" COPASIkey="Metabolite_22"/>
<SBMLMap SBMLid="O3P" COPASIkey="Metabolite_34"/>
<SBMLMap SBMLid="OH" COPASIkey="Metabolite_24"/>
<SBMLMap SBMLid="PAN" COPASIkey="Metabolite_31"/>
<SBMLMap SBMLid="R1" COPASIkey="Reaction_25"/>
<SBMLMap SBMLid="R10" COPASIkey="Reaction_34"/>
<SBMLMap SBMLid="R11" COPASIkey="Reaction_35"/>
<SBMLMap SBMLid="R12" COPASIkey="Reaction_36"/>
<SBMLMap SBMLid="R13" COPASIkey="Reaction_37"/>
<SBMLMap SBMLid="R14" COPASIkey="Reaction_38"/>
<SBMLMap SBMLid="R15" COPASIkey="Reaction_39"/>
<SBMLMap SBMLid="R16" COPASIkey="Reaction_40"/>
<SBMLMap SBMLid="R17" COPASIkey="Reaction_41"/>
<SBMLMap SBMLid="R18" COPASIkey="Reaction_42"/>
<SBMLMap SBMLid="R19" COPASIkey="Reaction_43"/>
<SBMLMap SBMLid="R2" COPASIkey="Reaction_26"/>
<SBMLMap SBMLid="R20" COPASIkey="Reaction_44"/>
<SBMLMap SBMLid="R21" COPASIkey="Reaction_45"/>
<SBMLMap SBMLid="R22" COPASIkey="Reaction_46"/>
<SBMLMap SBMLid="R23" COPASIkey="Reaction_47"/>
<SBMLMap SBMLid="R24" COPASIkey="Reaction_48"/>
<SBMLMap SBMLid="R25" COPASIkey="Reaction_49"/>
<SBMLMap SBMLid="R3" COPASIkey="Reaction_27"/>
<SBMLMap SBMLid="R4" COPASIkey="Reaction_28"/>
<SBMLMap SBMLid="R5" COPASIkey="Reaction_29"/>
<SBMLMap SBMLid="R6" COPASIkey="Reaction_30"/>
<SBMLMap SBMLid="R7" COPASIkey="Reaction_31"/>
<SBMLMap SBMLid="R8" COPASIkey="Reaction_32"/>
<SBMLMap SBMLid="R9" COPASIkey="Reaction_33"/>
<SBMLMap SBMLid="SO2" COPASIkey="Metabolite_36"/>
<SBMLMap SBMLid="SO4" COPASIkey="Metabolite_37"/>
<SBMLMap SBMLid="compartment" COPASIkey="Compartment_1"/>
<SBMLMap SBMLid="k1" COPASIkey="ModelValue_25"/>
<SBMLMap SBMLid="k10" COPASIkey="ModelValue_34"/>
<SBMLMap SBMLid="k11" COPASIkey="ModelValue_35"/>
<SBMLMap SBMLid="k12" COPASIkey="ModelValue_36"/>
<SBMLMap SBMLid="k13" COPASIkey="ModelValue_37"/>
<SBMLMap SBMLid="k14" COPASIkey="ModelValue_38"/>
<SBMLMap SBMLid="k15" COPASIkey="ModelValue_39"/>
<SBMLMap SBMLid="k16" COPASIkey="ModelValue_40"/>
<SBMLMap SBMLid="k17" COPASIkey="ModelValue_41"/>
<SBMLMap SBMLid="k18" COPASIkey="ModelValue_42"/>
<SBMLMap SBMLid="k19" COPASIkey="ModelValue_43"/>
<SBMLMap SBMLid="k2" COPASIkey="ModelValue_26"/>
<SBMLMap SBMLid="k20" COPASIkey="ModelValue_44"/>
<SBMLMap SBMLid="k21" COPASIkey="ModelValue_45"/>
<SBMLMap SBMLid="k22" COPASIkey="ModelValue_46"/>
<SBMLMap SBMLid="k23" COPASIkey="ModelValue_47"/>
<SBMLMap SBMLid="k24" COPASIkey="ModelValue_48"/>
<SBMLMap SBMLid="k25" COPASIkey="ModelValue_49"/>
<SBMLMap SBMLid="k3" COPASIkey="ModelValue_27"/>
<SBMLMap SBMLid="k4" COPASIkey="ModelValue_28"/>
<SBMLMap SBMLid="k5" COPASIkey="ModelValue_29"/>
<SBMLMap SBMLid="k6" COPASIkey="ModelValue_30"/>
<SBMLMap SBMLid="k7" COPASIkey="ModelValue_31"/>
<SBMLMap SBMLid="k8" COPASIkey="ModelValue_32"/>
<SBMLMap SBMLid="k9" COPASIkey="ModelValue_33"/>
</SBMLReference>
<ListOfUnitDefinitions>
<UnitDefinition key="Unit_1" name="meter" symbol="m">
<MiriamAnnotation>
<rdf:RDF
xmlns:dcterms="http://purl.org/dc/terms/"
xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#">
<rdf:Description rdf:about="#Unit_0">
<dcterms:created>
<rdf:Description>
<dcterms:W3CDTF>2020-12-24T13:56:44Z</dcterms:W3CDTF>
</rdf:Description>
</dcterms:created>
</rdf:Description>
</rdf:RDF>
</MiriamAnnotation>
<Expression>
m
</Expression>
</UnitDefinition>
<UnitDefinition key="Unit_5" name="second" symbol="s">
<MiriamAnnotation>
<rdf:RDF
xmlns:dcterms="http://purl.org/dc/terms/"
xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#">
<rdf:Description rdf:about="#Unit_4">
<dcterms:created>
<rdf:Description>
<dcterms:W3CDTF>2020-12-24T13:56:44Z</dcterms:W3CDTF>
</rdf:Description>
</dcterms:created>
</rdf:Description>
</rdf:RDF>
</MiriamAnnotation>
<Expression>
s
</Expression>
</UnitDefinition>
<UnitDefinition key="Unit_13" name="Avogadro" symbol="Avogadro">
<MiriamAnnotation>
<rdf:RDF
xmlns:dcterms="http://purl.org/dc/terms/"
xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#">
<rdf:Description rdf:about="#Unit_12">
<dcterms:created>
<rdf:Description>
<dcterms:W3CDTF>2020-12-24T13:56:44Z</dcterms:W3CDTF>
</rdf:Description>
</dcterms:created>
</rdf:Description>
</rdf:RDF>
</MiriamAnnotation>
<Expression>
Avogadro
</Expression>
</UnitDefinition>
<UnitDefinition key="Unit_17" name="item" symbol="#">
<MiriamAnnotation>
<rdf:RDF
xmlns:dcterms="http://purl.org/dc/terms/"
xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#">
<rdf:Description rdf:about="#Unit_16">
<dcterms:created>
<rdf:Description>
<dcterms:W3CDTF>2020-12-24T13:56:44Z</dcterms:W3CDTF>
</rdf:Description>
</dcterms:created>
</rdf:Description>
</rdf:RDF>
</MiriamAnnotation>
<Expression>
#
</Expression>
</UnitDefinition>
<UnitDefinition key="Unit_35" name="liter" symbol="l">
<MiriamAnnotation>
<rdf:RDF
xmlns:dcterms="http://purl.org/dc/terms/"
xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#">
<rdf:Description rdf:about="#Unit_34">
<dcterms:created>
<rdf:Description>
<dcterms:W3CDTF>2020-12-24T13:56:44Z</dcterms:W3CDTF>
</rdf:Description>
</dcterms:created>
</rdf:Description>
</rdf:RDF>
</MiriamAnnotation>
<Expression>
0.001*m^3
</Expression>
</UnitDefinition>
<UnitDefinition key="Unit_41" name="mole" symbol="mol">
<MiriamAnnotation>
<rdf:RDF
xmlns:dcterms="http://purl.org/dc/terms/"
xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#">
<rdf:Description rdf:about="#Unit_40">
<dcterms:created>
<rdf:Description>
<dcterms:W3CDTF>2020-12-24T13:56:44Z</dcterms:W3CDTF>
</rdf:Description>
</dcterms:created>
</rdf:Description>
</rdf:RDF>
</MiriamAnnotation>
<Expression>
Avogadro*#
</Expression>
</UnitDefinition>
</ListOfUnitDefinitions>
</COPASI>
| Component Pascal | 4 | MedAnisse/COPASI | speed-test-suite/Pollution_radau5.cps | [
"Artistic-2.0"
] |
--TEST--
JIT MUL: 006 incorrect guard elimination
--INI--
opcache.enable=1
opcache.enable_cli=1
opcache.file_update_protection=0
opcache.jit_buffer_size=1M
opcache.protect_memory=1
--FILE--
<?php
for ($i = 0; $i<6; $i++) {
$a + -$a=&$a;
$a = 3*$a + 0xff000;
$a += $a;
}
?>
DONE
--EXPECT--
DONE | PHP | 2 | NathanFreeman/php-src | ext/opcache/tests/jit/mul_006.phpt | [
"PHP-3.01"
] |
package discriminant_specification is
type Buffer(Size : Integer := 100) is
record
Pos : Integer := 0;
Value : String(1 .. Size);
end record;
procedure append_ch(b : in out Buffer; ch : in character);
procedure remove_ch(b : in out Buffer; ch : out character);
function make_buf(size : in integer) return Buffer;
mini : Buffer(10);
end discriminant_specification;
| Ada | 3 | ouankou/rose | tests/nonsmoke/functional/CompileTests/experimental_ada_tests/tests/discriminant_specification.ads | [
"BSD-3-Clause"
] |
/*
Open Book Quotes Demo
Demonstrates basic usage of the Open Book Arduino library.
Displays four quotes in different languages on four pages. Navigate with the left/right or previous/next buttons.
Use the up and down buttons to demonstrate Babel's localized case mapping by turning the quotes to uppercase or lowercase.
Use with either a Feather M4 + eBook Wing, or the Open Book board.
*/
#include <OpenBook.h>
OpenBook *book;
void setup() {
Serial.begin(115200);
// while(!Serial);
// the OpenBook class provides an interface for the peripherals of either the Open Book or eBook Wing.
book = new OpenBook();
book->configureScreen();
// pause before initializing Babel; on the wing they share a bus and I've seen things get garbled if you don't give it a hot second.
delay(500);
// Babel requires a GD25Q16C chip flashed with the latest babel.bin file. See BurnBabelBurn for details: https://github.com/joeycastillo/babel/blob/master/examples/BurnBabelBurn/BurnBabelBurn.ino
book->configureBabel();
#if defined(ODDLY_SPECIFIC_OPEN_BOOK)
// the buttons on the Open Book board are on a shift register
book->configureShiftButtons();
#else // on the wing, they're on an I2C port expander.
book->configureI2CButtons();
#endif
book->getTypesetter()->setTextColor(EPD_BLACK);
book->getTypesetter()->setLayoutArea(16, 16, 264, 368);
book->getTypesetter()->setWordWrap(true);
book->getDisplay()->setRotation(0);
}
char *originals[] = {
"Voici mon secret. Il est très simple: on ne voit bien qu'avec le cœur. L'essentiel est invisible pour les yeux.\n\n",
"Бери́сь дру́жно, не бу́дет гру́зно.\n\n",
"La vida no es la que uno vivió, sino la que uno recuerda, y cómo la recuerda para contarla.\n\n",
"ἄνδρα μοι ἔννεπε, μοῦσα, πολύτροπον, ὃς μάλα πολλὰ πλάγχθη, ἐπεὶ Τροίης ἱερὸν πτολίεθρον ἔπερσεν.\n\n",
};
void loop() {
static int i = 0;
static bool firstRun = true;
uint8_t buttons = book->readButtons();
if (firstRun || buttons) {
firstRun = false;
if (buttons & OPENBOOK_BUTTONMASK_NEXT || buttons & OPENBOOK_BUTTONMASK_RIGHT) i++;
if (buttons & OPENBOOK_BUTTONMASK_PREVIOUS|| buttons & OPENBOOK_BUTTONMASK_LEFT) i--;
i = max(i, 0);
i = min(i, 3);
// the display is the Adafruit_GFX object we use to manipulate any pixels on the screen.
Adafruit_EPD *display = book->getDisplay();
// the Babel typesetter has its own reference to the display, which it uses to display multilingual text.
BabelTypesetter *typesetter = book->getTypesetter();
BabelDevice *babel = typesetter->getBabel();
// determine the number of codepoints in the string (utf-8 can have one codepoint per 1-6 bytes)
size_t len = babel->utf8_codepoint_length(originals[i]);
// allocate an appropriately sized buffer (codepoints outside the basic multilingual plane can be larger than a uint16_t, but for now Babel only supports the BMP)
BABEL_CODEPOINT *buf = (BABEL_CODEPOINT *)malloc(len);
// parse UTF-8 to codepoints
babel->utf8_parse(originals[i], buf);
// Localized case mapping demo. Converts buf in-place to uppercase or lowercase.
if (buttons & OPENBOOK_BUTTONMASK_UP) babel->to_uppercase(buf, len);
if (buttons & OPENBOOK_BUTTONMASK_DOWN) babel->to_lowercase(buf, len);
// finally. clear the screen and show some text.
display->clearBuffer();
typesetter->resetCursor();
typesetter->setBold(false);
typesetter->setItalic(false);
typesetter->writeCodepoints(buf, len);
typesetter->setItalic(true);
typesetter->writeCodepoints(buf, len);
typesetter->setItalic(false);
typesetter->setBold(true);
typesetter->writeCodepoints(buf, len);
typesetter->setItalic(true);
typesetter->writeCodepoints(buf, len);
display->display();
free(buf);
}
}
| Arduino | 5 | gvvynplaine/The-Open-Book | Examples/Open_Book_Quotes_Demo/Open_Book_Quotes_Demo.ino | [
"MIT"
] |
# Copyright (c) 2018-2021, Carnegie Mellon University
# See LICENSE for details
# Option Records
# ==============
# MP, BS, from 01/25/01, GAPv3.4.4
# general default search options
SEARCH_DEFAULTS :=
rec(
timeLimit := false,
globalUnrolling := false,
globalUnrollingMin := 8,
globalUnrollingMax := 64,
timeBaseCases := true
);
# default DP search options
DP_DEFAULTS :=
rec(
nBest := 1,
optimize := "minimize",
verbosity := 3,
DPVec := false,
DPVecVlen := 4
);
#F Search Options Record
#F ---------------------
#F Search options records keep search options that are not specific to any
#F particular search algorithm. These are options that cause the search
#F algorithms to search over different implementations instead of just how
#F the search algorithm progresses.
#F
#F These options get incorporated into a search algorithm's options record.
#F
#F PrintSpecSearchOptionsRecord()
#F prints the specification for the general search options
#F only to be called by specific search algorithm's PrintSpec
#F
PrintSpecSearchOptionsRecord := function()
Print(" timeLimit := false | <minutes>,\n");
Print(" globalUnrolling := true | false,\n");
Print(" globalUnrollingMin := <positive int>,\n");
Print(" globalUnrollingMax := <positive int>,\n");
end;
#F CheckSearchOptionsRecord( <search-options-record> )
#F checks whether <search-options-record> is a valid search options record
#F
CheckSearchOptionsRecord := function( R )
local r;
if not IsRec(R) then
Error("<R> must be an search options record");
fi;
# check fields
for r in RecFields(R) do
if r = "timeLimit" then
if not ( R.(r) = false or ( IsInt(R.(r)) and R.(r) > 0 ) ) then
Error( "timeLimit must be either false or a positive integer" );
fi;
elif r = "globalUnrolling" then
if not IsBool(R.(r)) then
Error( "Search option globalUnrolling must be true or false" );
fi;
elif r = "globalUnrollingMin" then
if not IsInt(R.(r)) then
Error( "globalUnrollingMin is not an integer" );
fi;
elif r = "globalUnrollingMax" then
if not IsInt(R.(r)) then
Error( "globalUnrollingMax is not an integer" );
fi;
elif r = "timeBaseCases" then
if not IsBool(R.(r)) then
Error( "Search option timeBaseCases must be true or false" );
fi;
fi;
od;
return true;
end;
#F MergeSearchOptionsRecord( <search-options-record> )
#F merges <search-options-record> with the default values
#F
MergeSearchOptionsRecord := function( R )
local OR, r;
CheckSearchOptionsRecord(R);
OR := ShallowCopy(R);
for r in RecFields(SEARCH_DEFAULTS) do
if not IsBound( OR.(r) ) then
OR.(r) := SEARCH_DEFAULTS.(r);
fi;
od;
if OR.globalUnrolling = true and
OR.globalUnrollingMin > OR.globalUnrollingMax then
Error( "globalUnrollingMin > globalUnrollingMax" );
fi;
return OR;
end;
#F DP Options Record
#F -----------------
#F The DP Options Records maintain options for the Dynamic Programming search
#F algorithm. This is a combination of both search options specific to DP
#F as well as general search options.
#F PrintSpecDPOptionsRecord()
#F prints the specification for the DP search options
#F
PrintSpecDPOptionsRecord := function()
Print("rec(\n");
PrintSpecSearchOptionsRecord();
Print(" nBest := <positive integer>,\n");
Print(" optimize := \"minimize\" | \"maximize\",\n");
Print(" hashTable := <hashTable>,\n");
Print(" verbosity := <non-negative integer>\n");
Print(");\n");
end;
#F CheckDPOptionsRecord( <DP-options-record> )
#F checks to see if DP-options-record is valid
#F
CheckDPOptionsRecord := function( R )
local r;
CheckSearchOptionsRecord(R);
for r in RecFields(R) do
if r = "nBest" then
if not ( IsInt(R.(r)) and R.(r) > 0 ) then
Error( "nBest must be a positive integer" );
fi;
elif r = "verbosity" then
if not ( IsInt(R.(r)) and R.(r) >= 0 ) then
Error( "verbosity must be a non-negative integer" );
fi;
elif r = "optimize" then
if not R.(r) in ["minimize","maximize"] then
Error( "optimize must be to minimize or maximize" );
fi;
elif r = "hashTable" then
if not IsHashTable( R.(r) ) then
Error( "hashTable must be a valid hashTable" );
fi;
elif r = "hashTableBases" then
if not IsHashTable( R.(r) ) then
Error( "hashTableBases must be a valid hashTable" );
fi;
elif r = "breakdownRules" then
if not IsRec( R.(r) ) then
Error( "breakdownRules must be a record" );
fi;
elif not r in RecFields(SEARCH_DEFAULTS) and r <> "DPVec" and r <> "measureFunction" and r <> "wrap"
and not IsSystemRecField(r) then
Error( "Unknown DPOptionsRecord field <r>" );
fi;
od;
end;
#F MergeDPOptionsRecord( <DP-options-record> )
#F merges <DP-options-record> with the defaults
#F
MergeDPOptionsRecord := function( R )
local OR, r;
CheckDPOptionsRecord(R);
OR := MergeSearchOptionsRecord(R);
for r in RecFields(DP_DEFAULTS) do
if not IsBound( OR.(r) ) then
OR.(r) := DP_DEFAULTS.(r);
fi;
od;
return OR;
end;
# Implement Options Record
# ------------------------
#F The Implement Options Records maintain options for timed search.
#F
# Utility for Search algorithms to check dataType in SPLOpts
# ----------------------------------------------------------
#F SearchCheckDataType( <spl>, <SPL-options-record> )
#F Checks to see that the dataType is set properly for the given spl.
#F Sets it if no default was given.
#F
SearchCheckDataType := function( spl, SPLOpts )
if not IsBound( SPLOpts.dataType ) then
Error( "SPLOpts.dataType not bound" );
fi;
if SPLOpts.dataType = "no default" then
if IsRealSPL(spl) then
SPLOpts.dataType := "real";
else
SPLOpts.dataType := "complex";
fi;
elif SPLOpts.dataType in ["real","complex"] then
;
# YEVGEN: This should not be too ambitious with error checking
# we currently use real datatype for complex transforms (RC operator is applied
# to get a real formula).
#if (not IsRealSPL(spl)) and SPLOpts.dataType = "real" then
# Error("Real data type specified but spl is complex");
#fi;
else
Error("SPLOpts.dataType is not \"real\" or \"complex\"");
fi;
end;
| GAP | 5 | sr7cb/spiral-software | namespaces/spiral/search/optrec.gi | [
"BSD-2-Clause-FreeBSD"
] |
namespace Ryujinx.HLE.HOS.Kernel.Ipc
{
enum ChannelState
{
NotInitialized,
Open,
ClientDisconnected,
ServerDisconnected
}
} | C# | 3 | BSoDGamingYT/Ryujinx | Ryujinx.HLE/HOS/Kernel/Ipc/ChannelState.cs | [
"MIT"
] |
#%RAML 1.0 Library
# This is the file /libraries/resourceTypes.raml
usage: This library defines the resource types for the API
uses:
myTraits: !include traits.raml
resourceTypes:
collection:
usage: Use this resourceType to represent a collection of items
description: A collection of <<resourcePathName|!uppercamelcase>>
get:
description: |
Get all <<resourcePathName|!uppercamelcase>>,
optionally filtered
is: [ myTraits.hasResponseCollection ]
post:
description: |
Create a new <<resourcePathName|!uppercamelcase|!singularize>>
is: [ myTraits.hasRequestItem ]
item:
usage: Use this resourceType to represent any single item
description: A single <<resourcePathName|!uppercamelcase|!singularize>>
get:
description: |
Get a <<resourcePathName|!uppercamelcase|!singularize>>
by <<resourcePathName|!uppercamelcase|!singularize>>Id
is: [ myTraits.hasResponseItem, myTraits.hasNotFound ]
put:
description: |
Update a <<resourcePathName|!uppercamelcase|!singularize>>
by <<resourcePathName|!singularize>>Id
is: [ myTraits.hasRequestItem, myTraits.hasResponseItem, myTraits.hasNotFound ]
delete:
description: |
Delete a <<resourcePathName|!uppercamelcase|!singularize>>
by <<resourcePathName|!singularize>>Id
is: [ myTraits.hasNotFound ]
responses:
204:
| RAML | 4 | zeesh49/tutorials | raml/annotations/libraries/resourceTypes.raml | [
"MIT"
] |
>gi|5817701|gb|AF142731.1|AF142731 Wisteria frutescens maturase-like protein (matK) gene, complete cds; chloroplast gene for chloroplast product
GCTCCATTTTTTACACATTTCTATGAACTAATTGGTTCATCCATACCATCGGTAGGGTTTGTAAGACCAC
GAGTGATCCAGAAAGGAATGAATGGAAAAAGCAGCATGTCGTATCAATGGCGAATTCTAAAAATATTTCA
TTCGTATTGGACCCGGCCTAAATTTTTGTTTGAATTCTTGGCTCGGAACAAAGGAATTCAGTTGGGTTGA
ATTAATAAAGGGATAGAGCTTGGCTGCTCCAATTATAGGGAAACAAAAAGCAACGAGCTTTCATTTTTAA
TTTGAATGATTACCCCATCTAATTCTATGTTAAAAAGAGATTAGTGCTTGCTGTGGAAAAAGTTTTTCCC
ACGAACGGATTATGGATTTTTGTTATGAGTCCTAACTATTAGCTATTTTCCATTATGTTATGGGGTAGCG
ATAAATGTGTAGAAGAAAGAGTATATTGATAAAGATATTTTTTTTTCCAAAATCAAAAGAGCGATTGGGC
AAAAAAATAAAGGATTTCTAACTAGCTTGTTGTCCTAGAACAATTAGATGGAACAAGCGAGGAGAGATAG
TCCATTGATAAGTTTTACTTGTTTTCTAGGTATCTATTCATATTCGTTTTTTATTTGAATTCGAATACTA
ATATATAATAGAGTACCCTGTGATGACTGTATCGCACTATGTATCATTTGATAATCCAATGAATCTCTGA
TCCTTTGACCAAATAGAATTTCTAAAATGAAGGAATATCAAGTATATTTAGAACGAGATAGATCTCGCCA
ACAGGACTTCCTATACCCACTTATTTTTCGGGAGTATATTTATGGACTTGCTTATAGTCATGATTTTAAT
AGATCCATTTTTGTGGAAAATGTAGGTTATGACAATAAATCTAGTTTACTAATTGTAAAACGTTTAATTA
CTCGAATGTATCAACAGAATCATTTGATCATTTCCGCTAATGATTCTAACAAAAATCCATTTTTGGGGTA
TAATAAGAATTTTTATTCTCAAATAATATCAGACGGTTTTGCCGTCGTTGTGGAAATTCCATTTTTCCTA
CAATTAAGCTCTTCCTTAGAGGAGGCAGAAATCGTAAAATCTTATCATAATTTGCGATCAATTCATTCCA
TTTTTCCCTTTTTGGAGGATAAATTTACATATTTAAATTATGTGTCAGATATACGAATACCCTATCCTAT
CCATCTGGAAATCTTAGTTCAAATCCTTCGATACTGGGTGAAAGATGCCTCCTTTTTTCATTTATTACGG
TTTTTTCTTTATCATTTTTCTAATAGGAATAGTCTTATTACTCCAAAAAAATCGATTTCTACCTTTTCAA
AAAGTAATCCAAGATTATTCTTGTTCCTCTATAATTTTTATGTATGTGAATATGAATCTATCTTCCGTTT
TCTACGTAACCAATCCTCTCATTTACGATTAAAATCTTTTAGCGTTTTTTTTGAGCGAATCTTTTTTTAT
GCAAAAAGAGAACATCTTGTAAAAGTTTTTCCTAAGGATTTTTCGTCTACCTTAACATTCTTCAAGGATC
CTTTCATTCATTATGTTAGATATCAAGGAAAATCCATTCTGGCTTCAAAGAATGCGCCTCTTTTGATGAA
TAAATGGAAACACTATTTTATCCATTTATGGCAATGTTTTTTTGATGTTTGGTCTCAACCAGGAACGATC
CATATAAACCAATTATCCGAACATTCATTTCACTTTTTAGGCTATTTTTCAAATGTGCGGCTAAATCGTT
CAGTGGTACGGAGTCAAATGCTGCAAAATACATTTCTAATCGAAATTGTTATCAAAAAGCTTGATATAAT
AGTTCCAATTATTCCTCTAATTAGATCATTGGCTAAAGCGAAATTTTGTAATGTATTAGGGCATCCCCTT
AGTAAGTCGGTCTGGGCCGATTCATCCGATTTTGATATTATTGACCGATTTTTGCGAATATGCAGAAATC
TTTCTCATTATTACAATGGATCCTCAAAAAAAAAAAATTTGTATCGAATAAAATATATACTTCGGCTTTC
TTGTATTAAAACTTTGGCTTGTAAACACAAAAGTACTGTACGCGCTTTTTTGAAAAAATCTGGTTCAGAA
GAATTATTGGAAGAATTCTTTACAGAGGAAGAAGAGATTCTTTCTTTGATTTTTCCAAGAACTTCTTCTA
CTTTGCAGAGATTACATAGAAATCGGATTTGGTATTTGGATATTCTTTTCAGCAACGATTTGGTCAATCA
TGAATGATTGGTTATGTTATGAGACTTTGTAAATGAGTAAATGGAAATTATCCTTAAATGAAGATAAGAA
AATTCATTCATTTCTATTAGTATTCTATATCTATAGGATTATGAAATGTTCATGTATGTAATAAGAGTGG
AGTTTCAAGATTCCTCAATTGAGTATTTAACTTTCTTATAGTCTTGTTCTGGGAAAGTAACTCAGGTTTA
GATGTATACATAGGGAAAGCCGTGTGCAATGAAAAATGCAAGCACGGCTTGGGGAGGGATTTTTTCTTGT
TTTATTTTTTAAATTTGATTAAACATGATGA
| Nu | 0 | lukasz-kozlowski/biopython | Tests/Fasta/wisteria.nu | [
"BSD-3-Clause"
] |
[Exposed=Window]
interface ValidityState {
readonly attribute boolean valueMissing;
readonly attribute boolean typeMismatch;
readonly attribute boolean patternMismatch;
readonly attribute boolean tooLong;
readonly attribute boolean tooShort;
readonly attribute boolean rangeUnderflow;
readonly attribute boolean rangeOverflow;
readonly attribute boolean stepMismatch;
readonly attribute boolean badInput;
readonly attribute boolean customError;
readonly attribute boolean valid;
};
| WebIDL | 3 | Bkucera/jsdom | lib/jsdom/living/constraint-validation/ValidityState.webidl | [
"MIT"
] |
<vector xmlns:android="http://schemas.android.com/apk/res/android"
android:width="20dp"
android:height="20dp"
android:viewportWidth="20"
android:viewportHeight="20"
android:tint="?attr/colorControlNormal">
<path
android:fillColor="@android:color/white"
android:pathData="M10,2L3.5,4.5v4.77c0,4.04 2.77,7.81 6.5,8.73c3.73,-0.92 6.5,-4.69 6.5,-8.73V4.5L10,2zM12.75,11.7l-1.05,1.05l-1.7,-1.7l-1.7,1.7L7.25,11.7l1.7,-1.7l-1.7,-1.7L8.3,7.25l1.7,1.7l1.7,-1.7l1.05,1.05l-1.7,1.7L12.75,11.7z"/>
</vector>
| XML | 4 | Imudassir77/material-design-icons | android/device/gpp_bad/materialiconssharp/black/res/drawable/sharp_gpp_bad_20.xml | [
"Apache-2.0"
] |
var qrt = (\dur:1);
var eth = (\dur:1/2);
SkoarTestRunner((
ppp: [
"ppp ) pp ) p ) mp )",
[(amp: 1/8), (amp: 2/8), (amp: 3/8), (amp: 4/8)]
],
pppiano: [
"pppiano ) ppiano ) piano ) mezzopiano ) mpiano )",
[(amp: 1/8), (amp: 2/8), (amp: 3/8), (amp: 4/8), (amp: 4/8)]
],
fff: [
"fff ) ff ) forte ) mf )",
[(amp: 1), (amp: 7/8), (amp: 6/8), (amp: 5/8)]
],
ffforte: [
"ffforte ) fforte ) forte ) mforte ) mezzoforte )",
[(amp: 1), (amp: 7/8), (amp: 6/8), (amp: 5/8), (amp: 5/8)]
],
hashbars_short: [
"[] =>@x) [ ] =>@x) [#] =>@x) [ ] =>@x) [# ] =>@x) [##] =>@x) [# ] =>@x) [## ] =>@x) [###] =>@x) ",
[(x: 0), (x: 0), (x: 1), (x: 0), (x: 1/2), (x: 1), (x: 1/3), (x: 2/3), (x: 1), ]
],
hashbars_longer: [
"[##### ] =>@x) [############################## ] =>@x) [############################################################ ] =>@x)",
[(x: 5/11), (x: 30/31), (x: 60/61), ]
],
));
| SuperCollider | 3 | sofakid/Skoarcery | SuperCollider/Testing/levels.scd | [
"Artistic-2.0"
] |
BlimitJ | PureBasic | 1 | cnheider/onnx | onnx/backend/test/data/node/test_range_int32_type_negative_delta_expanded/test_data_set_0/input_1.pb | [
"MIT"
] |
---
title: My index page
pagination:
data: collections.foos
size: 12
---
{% for foo in pagination.items -%}
{{ foo.data.title }}
{% endfor -%}
{% for bar in collections.bars -%}
{{ bar.data.title }}
{% endfor -%} | Liquid | 3 | binyamin/eleventy | test/stubs/issue-115/index.liquid | [
"MIT"
] |
<?xml version="1.0"?>
<!DOCTYPE rdf:RDF [
<!ENTITY owl "http://www.w3.org/2002/07/owl#" >
<!ENTITY swrl "http://www.w3.org/2003/11/swrl#" >
<!ENTITY swrlb "http://www.w3.org/2003/11/swrlb#" >
<!ENTITY xsd "http://www.w3.org/2001/XMLSchema#" >
<!ENTITY owl2xml "http://www.w3.org/2006/12/owl2-xml#" >
<!ENTITY rdfs "http://www.w3.org/2000/01/rdf-schema#" >
<!ENTITY rdf "http://www.w3.org/1999/02/22-rdf-syntax-ns#" >
<!ENTITY protege "http://protege.stanford.edu/plugins/owl/protege#" >
<!ENTITY xsp "http://www.owl-ontologies.com/2005/08/07/xsp.owl#" >
<!ENTITY amino-acid "http://www.co-ode.org/ontologies/amino-acid/2006/05/18/amino-acid.owl#" >
]>
<rdf:RDF xmlns="http://www.co-ode.org/ontologies/amino-acid/2006/05/18/amino-acid.owl#"
xml:base="http://www.co-ode.org/ontologies/amino-acid/2009/02/16/amino-acid.owl"
xmlns:owl2xml="http://www.w3.org/2006/12/owl2-xml#"
xmlns:amino-acid="http://www.co-ode.org/ontologies/amino-acid/2006/05/18/amino-acid.owl#"
xmlns:xsd="http://www.w3.org/2001/XMLSchema#"
xmlns:xsp="http://www.owl-ontologies.com/2005/08/07/xsp.owl#"
xmlns:swrl="http://www.w3.org/2003/11/swrl#"
xmlns:swrlb="http://www.w3.org/2003/11/swrlb#"
xmlns:protege="http://protege.stanford.edu/plugins/owl/protege#"
xmlns:rdfs="http://www.w3.org/2000/01/rdf-schema#"
xmlns:rdf="http://www.w3.org/1999/02/22-rdf-syntax-ns#"
xmlns:owl="http://www.w3.org/2002/07/owl#">
<owl:Ontology rdf:about="">
<owl:versionInfo rdf:datatype="&xsd;string"
>version 1.2, copyright The University of Manchester, Nick Drummond, Georgina Moulton, Robert Stevens, Phil Lord</owl:versionInfo>
<rdfs:comment xml:lang="en"
>Amino acids and their properties</rdfs:comment>
<owl:versionInfo xml:lang="en"
>version 1.3, Annotated by Lin Zhang, Bethune International Peace Hospital, Hebei, China.1</owl:versionInfo>
<rdfs:comment xml:lang="zh">氨基酸及其性质</rdfs:comment>
</owl:Ontology>
<!--
///////////////////////////////////////////////////////////////////////////////////////
//
// Annotation properties
//
///////////////////////////////////////////////////////////////////////////////////////
-->
<owl:AnnotationProperty rdf:about="&amino-acid;shortName"/>
<owl:AnnotationProperty rdf:about="&amino-acid;singleLetterName"/>
<owl:AnnotationProperty rdf:about="&amino-acid;preferredName"/>
<!--
///////////////////////////////////////////////////////////////////////////////////////
//
// Object Properties
//
///////////////////////////////////////////////////////////////////////////////////////
-->
<!-- http://www.co-ode.org/ontologies/amino-acid/2006/05/18/amino-acid.owl#hasCharge -->
<owl:ObjectProperty rdf:about="&amino-acid;hasCharge">
<rdf:type rdf:resource="&owl;FunctionalProperty"/>
<rdfs:label xml:lang="en">has Charge</rdfs:label>
<rdfs:label xml:lang="en">has_Charge</rdfs:label>
<rdfs:label xml:lang="zh">带电类型为</rdfs:label>
<rdfs:label xml:lang="zh">电荷类型为</rdfs:label>
<preferredName xml:lang="en">hasCharge</preferredName>
<preferredName xml:lang="zh">具有电荷</preferredName>
<rdfs:domain rdf:resource="&amino-acid;AminoAcid"/>
<rdfs:range rdf:resource="&amino-acid;Charge"/>
</owl:ObjectProperty>
<!-- http://www.co-ode.org/ontologies/amino-acid/2006/05/18/amino-acid.owl#hasHydrophobicity -->
<owl:ObjectProperty rdf:about="&amino-acid;hasHydrophobicity">
<rdf:type rdf:resource="&owl;FunctionalProperty"/>
<rdfs:label xml:lang="en"
>has Hydrophobicity</rdfs:label>
<rdfs:label xml:lang="en"
>has_Hydrophobicity</rdfs:label>
<preferredName xml:lang="en"
>hasHydrophobicity</preferredName>
<preferredName xml:lang="zh">具有疏水性</preferredName>
<rdfs:domain rdf:resource="&amino-acid;AminoAcid"/>
<rdfs:range rdf:resource="&amino-acid;Hydrophobicity"/>
</owl:ObjectProperty>
<!-- http://www.co-ode.org/ontologies/amino-acid/2006/05/18/amino-acid.owl#hasPolarity -->
<owl:ObjectProperty rdf:about="&amino-acid;hasPolarity">
<rdf:type rdf:resource="&owl;FunctionalProperty"/>
<rdfs:label xml:lang="en">has Polarity</rdfs:label>
<rdfs:label xml:lang="en">has_Polarity</rdfs:label>
<rdfs:label xml:lang="zh">极性类型为</rdfs:label>
<preferredName xml:lang="en">hasPolarity</preferredName>
<preferredName xml:lang="zh">具有极性</preferredName>
<rdfs:domain rdf:resource="&amino-acid;AminoAcid"/>
<rdfs:range rdf:resource="&amino-acid;Polarity"/>
</owl:ObjectProperty>
<!-- http://www.co-ode.org/ontologies/amino-acid/2006/05/18/amino-acid.owl#hasSideChainStructure -->
<owl:ObjectProperty rdf:about="&amino-acid;hasSideChainStructure">
<rdf:type rdf:resource="&owl;FunctionalProperty"/>
<rdfs:label xml:lang="en"
>has Side Chain Structure</rdfs:label>
<rdfs:label xml:lang="en"
>has_Side_Chain_Structure</rdfs:label>
<preferredName xml:lang="en"
>hasSideChainStructure</preferredName>
<preferredName xml:lang="zh">具有侧链结构</preferredName>
<rdfs:domain rdf:resource="&amino-acid;AminoAcid"/>
<rdfs:range rdf:resource="&amino-acid;SideChainStructure"/>
</owl:ObjectProperty>
<!-- http://www.co-ode.org/ontologies/amino-acid/2006/05/18/amino-acid.owl#hasSize -->
<owl:ObjectProperty rdf:about="&amino-acid;hasSize">
<rdf:type rdf:resource="&owl;FunctionalProperty"/>
<rdfs:label xml:lang="en">has Size</rdfs:label>
<rdfs:label xml:lang="en">has_Size</rdfs:label>
<preferredName xml:lang="en">hasSize</preferredName>
<preferredName xml:lang="zh">具有大小</preferredName>
<rdfs:domain rdf:resource="&amino-acid;AminoAcid"/>
<rdfs:range rdf:resource="&amino-acid;Size"/>
</owl:ObjectProperty>
<!--
///////////////////////////////////////////////////////////////////////////////////////
//
// Data properties
//
///////////////////////////////////////////////////////////////////////////////////////
-->
<!-- http://www.co-ode.org/ontologies/amino-acid/2006/05/18/amino-acid.owl#preferredName -->
<owl:DatatypeProperty rdf:about="&amino-acid;preferredName">
<rdf:type rdf:resource="&owl;AnnotationProperty"/>
<rdfs:label xml:lang="en">Preferred Name</rdfs:label>
<rdfs:label xml:lang="zh">首选命名</rdfs:label>
<rdfs:label xml:lang="zh">首选术语</rdfs:label>
<preferredName xml:lang="en">preferredName</preferredName>
<preferredName xml:lang="zh">首选名称</preferredName>
<rdfs:range rdf:resource="&xsd;string"/>
</owl:DatatypeProperty>
<!-- http://www.co-ode.org/ontologies/amino-acid/2006/05/18/amino-acid.owl#shortName -->
<owl:DatatypeProperty rdf:about="&amino-acid;shortName">
<rdf:type rdf:resource="&owl;AnnotationProperty"/>
<rdfs:label xml:lang="en">Abbreviation</rdfs:label>
<rdfs:label xml:lang="en">For short</rdfs:label>
<rdfs:label xml:lang="en">Short Name</rdfs:label>
<rdfs:label xml:lang="en">Shortened form</rdfs:label>
<preferredName xml:lang="en">shortName</preferredName>
<preferredName xml:lang="zh">简称</preferredName>
<rdfs:range rdf:resource="&xsd;string"/>
</owl:DatatypeProperty>
<!-- http://www.co-ode.org/ontologies/amino-acid/2006/05/18/amino-acid.owl#singleLetterName -->
<owl:DatatypeProperty rdf:about="&amino-acid;singleLetterName">
<rdf:type rdf:resource="&owl;AnnotationProperty"/>
<rdfs:label xml:lang="en"
>Single Letter Name</rdfs:label>
<rdfs:label xml:lang="zh">单字母缩写</rdfs:label>
<preferredName xml:lang="en"
>singleLetterName</preferredName>
<preferredName xml:lang="zh">单字母名称</preferredName>
<rdfs:range rdf:resource="&xsd;string"/>
</owl:DatatypeProperty>
<!--
///////////////////////////////////////////////////////////////////////////////////////
//
// Classes
//
///////////////////////////////////////////////////////////////////////////////////////
-->
<!-- http://www.co-ode.org/ontologies/amino-acid/2006/05/18/amino-acid.owl#A -->
<owl:Class rdf:about="&amino-acid;A">
<rdfs:label xml:lang="en">Alanine</rdfs:label>
<rdfs:label xml:lang="zh">丙氨酸</rdfs:label>
<rdfs:label xml:lang="zh">氨基丙酸</rdfs:label>
<rdfs:subClassOf rdf:resource="&amino-acid;SpecificAminoAcid"/>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasCharge"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Neutral"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasHydrophobicity"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Hydrophobic"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasPolarity"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Non-Polar"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSize"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Tiny"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasPolarity"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Non-Polar"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSideChainStructure"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Aliphatic"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasHydrophobicity"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Hydrophobic"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasCharge"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Neutral"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSideChainStructure"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Aliphatic"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSize"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Tiny"/>
</owl:Restriction>
</rdfs:subClassOf>
<owl:disjointWith rdf:resource="&amino-acid;C"/>
<owl:disjointWith rdf:resource="&amino-acid;D"/>
<owl:disjointWith rdf:resource="&amino-acid;E"/>
<owl:disjointWith rdf:resource="&amino-acid;F"/>
<owl:disjointWith rdf:resource="&amino-acid;G"/>
<owl:disjointWith rdf:resource="&amino-acid;H"/>
<owl:disjointWith rdf:resource="&amino-acid;I"/>
<owl:disjointWith rdf:resource="&amino-acid;K"/>
<owl:disjointWith rdf:resource="&amino-acid;L"/>
<owl:disjointWith rdf:resource="&amino-acid;M"/>
<owl:disjointWith rdf:resource="&amino-acid;N"/>
<owl:disjointWith rdf:resource="&amino-acid;P"/>
<owl:disjointWith rdf:resource="&amino-acid;Q"/>
<owl:disjointWith rdf:resource="&amino-acid;R"/>
<owl:disjointWith rdf:resource="&amino-acid;S"/>
<owl:disjointWith rdf:resource="&amino-acid;T"/>
<owl:disjointWith rdf:resource="&amino-acid;V"/>
<owl:disjointWith rdf:resource="&amino-acid;W"/>
<owl:disjointWith rdf:resource="&amino-acid;Y"/>
<singleLetterName xml:lang="en">A</singleLetterName>
<preferredName xml:lang="en">Alanine</preferredName>
<shortName xml:lang="en">ala</shortName>
<shortName xml:lang="zh">丙</shortName>
<preferredName xml:lang="zh">丙氨酸</preferredName>
</owl:Class>
<!-- http://www.co-ode.org/ontologies/amino-acid/2006/05/18/amino-acid.owl#Aliphatic -->
<owl:Class rdf:about="&amino-acid;Aliphatic">
<rdfs:label xml:lang="zh">脂肪族型</rdfs:label>
<rdfs:subClassOf rdf:resource="&amino-acid;SideChainStructure"/>
<owl:disjointWith rdf:resource="&amino-acid;Aromatic"/>
<preferredName xml:lang="en">Aliphatic</preferredName>
<preferredName xml:lang="zh">脂肪族侧链</preferredName>
</owl:Class>
<!-- http://www.co-ode.org/ontologies/amino-acid/2006/05/18/amino-acid.owl#AliphaticAminoAcid -->
<owl:Class rdf:about="&amino-acid;AliphaticAminoAcid">
<rdfs:label xml:lang="en"
>Aliphatic Amino Acids</rdfs:label>
<owl:equivalentClass>
<owl:Class>
<owl:intersectionOf rdf:parseType="Collection">
<rdf:Description rdf:about="&amino-acid;AminoAcid"/>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSideChainStructure"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Aliphatic"/>
</owl:Restriction>
</owl:intersectionOf>
</owl:Class>
</owl:equivalentClass>
<preferredName xml:lang="en"
>Aliphatic Amino Acid</preferredName>
<preferredName xml:lang="zh">脂肪族氨基酸</preferredName>
</owl:Class>
<!-- http://www.co-ode.org/ontologies/amino-acid/2006/05/18/amino-acid.owl#AminoAcid -->
<owl:Class rdf:about="&amino-acid;AminoAcid">
<rdfs:label xml:lang="en">Amino Acids</rdfs:label>
<rdfs:label xml:lang="zh">氨酸</rdfs:label>
<rdfs:label xml:lang="zh">胺</rdfs:label>
<rdfs:label xml:lang="zh">胺基酸</rdfs:label>
<rdfs:label xml:lang="zh">胺酸</rdfs:label>
<owl:equivalentClass>
<owl:Class>
<owl:unionOf rdf:parseType="Collection">
<rdf:Description rdf:about="&amino-acid;A"/>
<rdf:Description rdf:about="&amino-acid;C"/>
<rdf:Description rdf:about="&amino-acid;D"/>
<rdf:Description rdf:about="&amino-acid;E"/>
<rdf:Description rdf:about="&amino-acid;F"/>
<rdf:Description rdf:about="&amino-acid;G"/>
<rdf:Description rdf:about="&amino-acid;H"/>
<rdf:Description rdf:about="&amino-acid;I"/>
<rdf:Description rdf:about="&amino-acid;K"/>
<rdf:Description rdf:about="&amino-acid;L"/>
<rdf:Description rdf:about="&amino-acid;M"/>
<rdf:Description rdf:about="&amino-acid;N"/>
<rdf:Description rdf:about="&amino-acid;P"/>
<rdf:Description rdf:about="&amino-acid;Q"/>
<rdf:Description rdf:about="&amino-acid;R"/>
<rdf:Description rdf:about="&amino-acid;S"/>
<rdf:Description rdf:about="&amino-acid;T"/>
<rdf:Description rdf:about="&amino-acid;V"/>
<rdf:Description rdf:about="&amino-acid;W"/>
<rdf:Description rdf:about="&amino-acid;Y"/>
</owl:unionOf>
</owl:Class>
</owl:equivalentClass>
<shortName xml:lang="en">AA</shortName>
<shortName xml:lang="en">AAs</shortName>
<preferredName xml:lang="en">Amino Acid</preferredName>
<preferredName xml:lang="zh">氨基酸</preferredName>
</owl:Class>
<!-- http://www.co-ode.org/ontologies/amino-acid/2006/05/18/amino-acid.owl#Aromatic -->
<owl:Class rdf:about="&amino-acid;Aromatic">
<rdfs:label xml:lang="zh">芳香族型</rdfs:label>
<rdfs:subClassOf rdf:resource="&amino-acid;SideChainStructure"/>
<preferredName xml:lang="en">Aromatic</preferredName>
<preferredName xml:lang="zh">芳香族侧链</preferredName>
</owl:Class>
<!-- http://www.co-ode.org/ontologies/amino-acid/2006/05/18/amino-acid.owl#AromaticAminoAcid -->
<owl:Class rdf:about="&amino-acid;AromaticAminoAcid">
<rdfs:label xml:lang="en"
>Aromatic Amino Acids</rdfs:label>
<owl:equivalentClass>
<owl:Class>
<owl:intersectionOf rdf:parseType="Collection">
<rdf:Description rdf:about="&amino-acid;AminoAcid"/>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSideChainStructure"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Aromatic"/>
</owl:Restriction>
</owl:intersectionOf>
</owl:Class>
</owl:equivalentClass>
<preferredName xml:lang="en"
>Aromatic Amino Acid</preferredName>
<preferredName xml:lang="zh">芳香族氨基酸</preferredName>
</owl:Class>
<!-- http://www.co-ode.org/ontologies/amino-acid/2006/05/18/amino-acid.owl#C -->
<owl:Class rdf:about="&amino-acid;C">
<rdfs:label xml:lang="en">Cysteine</rdfs:label>
<rdfs:label xml:lang="zh">半胱氨酸</rdfs:label>
<rdfs:label xml:lang="zh">巯基丙氨酸</rdfs:label>
<rdfs:subClassOf rdf:resource="&amino-acid;SpecificAminoAcid"/>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasHydrophobicity"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Hydrophobic"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSize"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Small"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSideChainStructure"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Aliphatic"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasCharge"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Neutral"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasPolarity"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Polar"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSize"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Small"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasHydrophobicity"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Hydrophobic"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasPolarity"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Polar"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSideChainStructure"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Aliphatic"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasCharge"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Neutral"/>
</owl:Restriction>
</rdfs:subClassOf>
<owl:disjointWith rdf:resource="&amino-acid;D"/>
<owl:disjointWith rdf:resource="&amino-acid;E"/>
<owl:disjointWith rdf:resource="&amino-acid;F"/>
<owl:disjointWith rdf:resource="&amino-acid;G"/>
<owl:disjointWith rdf:resource="&amino-acid;H"/>
<owl:disjointWith rdf:resource="&amino-acid;I"/>
<owl:disjointWith rdf:resource="&amino-acid;K"/>
<owl:disjointWith rdf:resource="&amino-acid;L"/>
<owl:disjointWith rdf:resource="&amino-acid;M"/>
<owl:disjointWith rdf:resource="&amino-acid;N"/>
<owl:disjointWith rdf:resource="&amino-acid;P"/>
<owl:disjointWith rdf:resource="&amino-acid;Q"/>
<owl:disjointWith rdf:resource="&amino-acid;R"/>
<owl:disjointWith rdf:resource="&amino-acid;S"/>
<owl:disjointWith rdf:resource="&amino-acid;T"/>
<owl:disjointWith rdf:resource="&amino-acid;V"/>
<owl:disjointWith rdf:resource="&amino-acid;W"/>
<owl:disjointWith rdf:resource="&amino-acid;Y"/>
<singleLetterName xml:lang="en">C</singleLetterName>
<preferredName xml:lang="en">Cysteine</preferredName>
<shortName xml:lang="en">cys</shortName>
<shortName xml:lang="zh">半胱</shortName>
<preferredName xml:lang="zh">半胱氨酸</preferredName>
</owl:Class>
<!-- http://www.co-ode.org/ontologies/amino-acid/2006/05/18/amino-acid.owl#Charge -->
<owl:Class rdf:about="&amino-acid;Charge">
<rdfs:label xml:lang="zh">电荷</rdfs:label>
<rdfs:label xml:lang="zh">电荷类型</rdfs:label>
<owl:equivalentClass>
<owl:Class>
<owl:unionOf rdf:parseType="Collection">
<rdf:Description rdf:about="&amino-acid;Negative"/>
<rdf:Description rdf:about="&amino-acid;Neutral"/>
<rdf:Description rdf:about="&amino-acid;Positive"/>
</owl:unionOf>
</owl:Class>
</owl:equivalentClass>
<rdfs:subClassOf rdf:resource="&amino-acid;RefiningFeature"/>
<preferredName xml:lang="en">Charge</preferredName>
<preferredName xml:lang="zh">电荷特征</preferredName>
</owl:Class>
<!-- http://www.co-ode.org/ontologies/amino-acid/2006/05/18/amino-acid.owl#D -->
<owl:Class rdf:about="&amino-acid;D">
<rdfs:label xml:lang="en">Aspartate</rdfs:label>
<rdfs:label xml:lang="zh">天冬氨酸</rdfs:label>
<rdfs:label xml:lang="zh">天门冬氨酸</rdfs:label>
<rdfs:label xml:lang="zh">天门科素</rdfs:label>
<rdfs:label xml:lang="zh">氨羰丙氨酸</rdfs:label>
<rdfs:label xml:lang="zh">门冬氨酸</rdfs:label>
<rdfs:subClassOf rdf:resource="&amino-acid;SpecificAminoAcid"/>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSideChainStructure"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Aliphatic"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSize"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Small"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasPolarity"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Polar"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasCharge"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Negative"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasPolarity"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Polar"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSize"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Small"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasCharge"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Negative"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasHydrophobicity"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Hydrophilic"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSideChainStructure"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Aliphatic"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasHydrophobicity"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Hydrophilic"/>
</owl:Restriction>
</rdfs:subClassOf>
<owl:disjointWith rdf:resource="&amino-acid;E"/>
<owl:disjointWith rdf:resource="&amino-acid;F"/>
<owl:disjointWith rdf:resource="&amino-acid;G"/>
<owl:disjointWith rdf:resource="&amino-acid;H"/>
<owl:disjointWith rdf:resource="&amino-acid;I"/>
<owl:disjointWith rdf:resource="&amino-acid;K"/>
<owl:disjointWith rdf:resource="&amino-acid;L"/>
<owl:disjointWith rdf:resource="&amino-acid;M"/>
<owl:disjointWith rdf:resource="&amino-acid;N"/>
<owl:disjointWith rdf:resource="&amino-acid;P"/>
<owl:disjointWith rdf:resource="&amino-acid;Q"/>
<owl:disjointWith rdf:resource="&amino-acid;R"/>
<owl:disjointWith rdf:resource="&amino-acid;S"/>
<owl:disjointWith rdf:resource="&amino-acid;T"/>
<owl:disjointWith rdf:resource="&amino-acid;V"/>
<owl:disjointWith rdf:resource="&amino-acid;W"/>
<owl:disjointWith rdf:resource="&amino-acid;Y"/>
<owl:versionInfo rdf:datatype="&xsd;string"
>TODO: Aspartate?</owl:versionInfo>
<preferredName xml:lang="en">Aspartate</preferredName>
<singleLetterName xml:lang="en">D</singleLetterName>
<shortName xml:lang="en">asp</shortName>
<shortName xml:lang="zh">天冬</shortName>
<preferredName xml:lang="zh">天冬氨酸</preferredName>
<rdfs:comment xml:lang="zh">简称天冬？</rdfs:comment>
</owl:Class>
<!-- http://www.co-ode.org/ontologies/amino-acid/2006/05/18/amino-acid.owl#E -->
<owl:Class rdf:about="&amino-acid;E">
<rdfs:label xml:lang="en">Glutamate</rdfs:label>
<rdfs:label xml:lang="zh">谷氨酸</rdfs:label>
<rdfs:subClassOf rdf:resource="&amino-acid;SpecificAminoAcid"/>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSideChainStructure"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Aliphatic"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasHydrophobicity"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Hydrophilic"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasCharge"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Negative"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasPolarity"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Polar"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSideChainStructure"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Aliphatic"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSize"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Small"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasHydrophobicity"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Hydrophilic"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSize"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Small"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasCharge"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Negative"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasPolarity"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Polar"/>
</owl:Restriction>
</rdfs:subClassOf>
<owl:disjointWith rdf:resource="&amino-acid;F"/>
<owl:disjointWith rdf:resource="&amino-acid;G"/>
<owl:disjointWith rdf:resource="&amino-acid;H"/>
<owl:disjointWith rdf:resource="&amino-acid;I"/>
<owl:disjointWith rdf:resource="&amino-acid;K"/>
<owl:disjointWith rdf:resource="&amino-acid;L"/>
<owl:disjointWith rdf:resource="&amino-acid;M"/>
<owl:disjointWith rdf:resource="&amino-acid;N"/>
<owl:disjointWith rdf:resource="&amino-acid;P"/>
<owl:disjointWith rdf:resource="&amino-acid;Q"/>
<owl:disjointWith rdf:resource="&amino-acid;R"/>
<owl:disjointWith rdf:resource="&amino-acid;S"/>
<owl:disjointWith rdf:resource="&amino-acid;T"/>
<owl:disjointWith rdf:resource="&amino-acid;V"/>
<owl:disjointWith rdf:resource="&amino-acid;W"/>
<owl:disjointWith rdf:resource="&amino-acid;Y"/>
<singleLetterName xml:lang="en">E</singleLetterName>
<preferredName xml:lang="en">Glutamate</preferredName>
<shortName xml:lang="en">glu</shortName>
<shortName xml:lang="zh">谷</shortName>
<preferredName xml:lang="zh">谷氨酸</preferredName>
</owl:Class>
<!-- http://www.co-ode.org/ontologies/amino-acid/2006/05/18/amino-acid.owl#F -->
<owl:Class rdf:about="&amino-acid;F">
<rdfs:label xml:lang="en">Phenylalanine</rdfs:label>
<rdfs:label xml:lang="zh">苯丙氨酸</rdfs:label>
<rdfs:label xml:lang="zh">苯基丙氨酸</rdfs:label>
<rdfs:subClassOf rdf:resource="&amino-acid;SpecificAminoAcid"/>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSideChainStructure"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Aromatic"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSideChainStructure"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Aromatic"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasHydrophobicity"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Hydrophobic"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSize"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Large"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasPolarity"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Non-Polar"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasHydrophobicity"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Hydrophobic"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasCharge"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Neutral"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasCharge"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Neutral"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSize"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Large"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasPolarity"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Non-Polar"/>
</owl:Restriction>
</rdfs:subClassOf>
<owl:disjointWith rdf:resource="&amino-acid;G"/>
<owl:disjointWith rdf:resource="&amino-acid;H"/>
<owl:disjointWith rdf:resource="&amino-acid;I"/>
<owl:disjointWith rdf:resource="&amino-acid;K"/>
<owl:disjointWith rdf:resource="&amino-acid;L"/>
<owl:disjointWith rdf:resource="&amino-acid;M"/>
<owl:disjointWith rdf:resource="&amino-acid;N"/>
<owl:disjointWith rdf:resource="&amino-acid;P"/>
<owl:disjointWith rdf:resource="&amino-acid;Q"/>
<owl:disjointWith rdf:resource="&amino-acid;R"/>
<owl:disjointWith rdf:resource="&amino-acid;S"/>
<owl:disjointWith rdf:resource="&amino-acid;T"/>
<owl:disjointWith rdf:resource="&amino-acid;V"/>
<owl:disjointWith rdf:resource="&amino-acid;W"/>
<owl:disjointWith rdf:resource="&amino-acid;Y"/>
<singleLetterName xml:lang="en">F</singleLetterName>
<preferredName xml:lang="en">Phenylalanine</preferredName>
<shortName xml:lang="en">phe</shortName>
<shortName xml:lang="zh">苯丙</shortName>
<preferredName xml:lang="zh">苯丙氨酸</preferredName>
</owl:Class>
<!-- http://www.co-ode.org/ontologies/amino-acid/2006/05/18/amino-acid.owl#G -->
<owl:Class rdf:about="&amino-acid;G">
<rdfs:label xml:lang="en">Glycine</rdfs:label>
<rdfs:label xml:lang="zh">乙氨酸</rdfs:label>
<rdfs:label xml:lang="zh">氨基醋酸</rdfs:label>
<rdfs:label xml:lang="zh">甘氨酸</rdfs:label>
<rdfs:label xml:lang="zh">糖胶</rdfs:label>
<rdfs:label xml:lang="zh">革氨酸</rdfs:label>
<rdfs:subClassOf rdf:resource="&amino-acid;SpecificAminoAcid"/>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasCharge"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Neutral"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasPolarity"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Non-Polar"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSideChainStructure"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Aliphatic"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSideChainStructure"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Aliphatic"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasCharge"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Neutral"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSize"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Tiny"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSize"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Tiny"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasPolarity"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Non-Polar"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasHydrophobicity"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Hydrophobic"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasHydrophobicity"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Hydrophobic"/>
</owl:Restriction>
</rdfs:subClassOf>
<owl:disjointWith rdf:resource="&amino-acid;H"/>
<owl:disjointWith rdf:resource="&amino-acid;I"/>
<owl:disjointWith rdf:resource="&amino-acid;K"/>
<owl:disjointWith rdf:resource="&amino-acid;L"/>
<owl:disjointWith rdf:resource="&amino-acid;M"/>
<owl:disjointWith rdf:resource="&amino-acid;N"/>
<owl:disjointWith rdf:resource="&amino-acid;P"/>
<owl:disjointWith rdf:resource="&amino-acid;Q"/>
<owl:disjointWith rdf:resource="&amino-acid;R"/>
<owl:disjointWith rdf:resource="&amino-acid;S"/>
<owl:disjointWith rdf:resource="&amino-acid;T"/>
<owl:disjointWith rdf:resource="&amino-acid;V"/>
<owl:disjointWith rdf:resource="&amino-acid;W"/>
<owl:disjointWith rdf:resource="&amino-acid;Y"/>
<singleLetterName xml:lang="en">G</singleLetterName>
<preferredName xml:lang="en">Glycine</preferredName>
<shortName xml:lang="en">gly</shortName>
<shortName xml:lang="zh">甘</shortName>
<preferredName xml:lang="zh">甘氨酸</preferredName>
</owl:Class>
<!-- http://www.co-ode.org/ontologies/amino-acid/2006/05/18/amino-acid.owl#H -->
<owl:Class rdf:about="&amino-acid;H">
<rdfs:label xml:lang="en">Histidine</rdfs:label>
<rdfs:label xml:lang="zh">组氨酸</rdfs:label>
<rdfs:label xml:lang="zh">组织氨基酸</rdfs:label>
<rdfs:subClassOf rdf:resource="&amino-acid;SpecificAminoAcid"/>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSize"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Large"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasHydrophobicity"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Hydrophilic"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasCharge"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Positive"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasCharge"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Positive"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasHydrophobicity"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Hydrophilic"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSize"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Large"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSideChainStructure"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Aromatic"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSideChainStructure"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Aromatic"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasPolarity"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Polar"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasPolarity"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Polar"/>
</owl:Restriction>
</rdfs:subClassOf>
<owl:disjointWith rdf:resource="&amino-acid;I"/>
<owl:disjointWith rdf:resource="&amino-acid;K"/>
<owl:disjointWith rdf:resource="&amino-acid;L"/>
<owl:disjointWith rdf:resource="&amino-acid;M"/>
<owl:disjointWith rdf:resource="&amino-acid;N"/>
<owl:disjointWith rdf:resource="&amino-acid;P"/>
<owl:disjointWith rdf:resource="&amino-acid;Q"/>
<owl:disjointWith rdf:resource="&amino-acid;R"/>
<owl:disjointWith rdf:resource="&amino-acid;S"/>
<owl:disjointWith rdf:resource="&amino-acid;T"/>
<owl:disjointWith rdf:resource="&amino-acid;V"/>
<owl:disjointWith rdf:resource="&amino-acid;W"/>
<owl:disjointWith rdf:resource="&amino-acid;Y"/>
<singleLetterName xml:lang="en">H</singleLetterName>
<preferredName xml:lang="en">Histidine</preferredName>
<shortName xml:lang="en">his</shortName>
<shortName xml:lang="zh">组</shortName>
<preferredName xml:lang="zh">组氨酸</preferredName>
</owl:Class>
<!-- http://www.co-ode.org/ontologies/amino-acid/2006/05/18/amino-acid.owl#Hydrophilic -->
<owl:Class rdf:about="&amino-acid;Hydrophilic">
<rdfs:label xml:lang="zh">亲水</rdfs:label>
<rdfs:label xml:lang="zh">亲水性</rdfs:label>
<rdfs:subClassOf rdf:resource="&amino-acid;Hydrophobicity"/>
<owl:disjointWith rdf:resource="&amino-acid;Hydrophobic"/>
<preferredName xml:lang="en">Hydrophilic</preferredName>
<preferredName xml:lang="zh">亲水型</preferredName>
</owl:Class>
<!-- http://www.co-ode.org/ontologies/amino-acid/2006/05/18/amino-acid.owl#Hydrophobic -->
<owl:Class rdf:about="&amino-acid;Hydrophobic">
<rdfs:label xml:lang="zh">疏水</rdfs:label>
<rdfs:label xml:lang="zh">疏水型</rdfs:label>
<rdfs:subClassOf rdf:resource="&amino-acid;Hydrophobicity"/>
<preferredName xml:lang="en">Hydrophobic</preferredName>
<preferredName xml:lang="zh">疏水型</preferredName>
</owl:Class>
<!-- http://www.co-ode.org/ontologies/amino-acid/2006/05/18/amino-acid.owl#Hydrophobicity -->
<owl:Class rdf:about="&amino-acid;Hydrophobicity">
<rdfs:label xml:lang="zh">疏水性</rdfs:label>
<rdfs:label xml:lang="zh">疏水特性</rdfs:label>
<owl:equivalentClass>
<owl:Class>
<owl:unionOf rdf:parseType="Collection">
<rdf:Description rdf:about="&amino-acid;Hydrophilic"/>
<rdf:Description rdf:about="&amino-acid;Hydrophobic"/>
</owl:unionOf>
</owl:Class>
</owl:equivalentClass>
<rdfs:subClassOf rdf:resource="&amino-acid;RefiningFeature"/>
<preferredName xml:lang="en">Hydrophobicity</preferredName>
<preferredName xml:lang="zh">疏水性特征</preferredName>
</owl:Class>
<!-- http://www.co-ode.org/ontologies/amino-acid/2006/05/18/amino-acid.owl#I -->
<owl:Class rdf:about="&amino-acid;I">
<rdfs:label xml:lang="en">Isoleucine</rdfs:label>
<rdfs:label xml:lang="zh">异亮氨酸</rdfs:label>
<rdfs:label xml:lang="zh">异白氨酸</rdfs:label>
<rdfs:subClassOf rdf:resource="&amino-acid;SpecificAminoAcid"/>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasCharge"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Neutral"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasHydrophobicity"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Hydrophobic"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSize"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Large"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSideChainStructure"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Aliphatic"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasCharge"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Neutral"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasPolarity"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Non-Polar"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSideChainStructure"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Aliphatic"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasHydrophobicity"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Hydrophobic"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSize"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Large"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasPolarity"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Non-Polar"/>
</owl:Restriction>
</rdfs:subClassOf>
<owl:disjointWith rdf:resource="&amino-acid;K"/>
<owl:disjointWith rdf:resource="&amino-acid;L"/>
<owl:disjointWith rdf:resource="&amino-acid;M"/>
<owl:disjointWith rdf:resource="&amino-acid;N"/>
<owl:disjointWith rdf:resource="&amino-acid;P"/>
<owl:disjointWith rdf:resource="&amino-acid;Q"/>
<owl:disjointWith rdf:resource="&amino-acid;R"/>
<owl:disjointWith rdf:resource="&amino-acid;S"/>
<owl:disjointWith rdf:resource="&amino-acid;T"/>
<owl:disjointWith rdf:resource="&amino-acid;V"/>
<owl:disjointWith rdf:resource="&amino-acid;W"/>
<owl:disjointWith rdf:resource="&amino-acid;Y"/>
<singleLetterName xml:lang="en">I</singleLetterName>
<preferredName xml:lang="en">Isoleucine</preferredName>
<shortName xml:lang="en">ile</shortName>
<shortName xml:lang="zh">异亮</shortName>
<preferredName xml:lang="zh">异亮氨酸</preferredName>
</owl:Class>
<!-- http://www.co-ode.org/ontologies/amino-acid/2006/05/18/amino-acid.owl#K -->
<owl:Class rdf:about="&amino-acid;K">
<rdfs:label xml:lang="en">Lysine</rdfs:label>
<rdfs:label xml:lang="zh">2,6-二氨基已酸</rdfs:label>
<rdfs:label xml:lang="zh">氨基已氨酸</rdfs:label>
<rdfs:label xml:lang="zh">溶细胞素</rdfs:label>
<rdfs:label xml:lang="zh">赖氨酸</rdfs:label>
<rdfs:subClassOf rdf:resource="&amino-acid;SpecificAminoAcid"/>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSize"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Large"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasPolarity"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Polar"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasCharge"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Positive"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasCharge"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Positive"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSideChainStructure"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Aliphatic"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasHydrophobicity"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Hydrophilic"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasPolarity"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Polar"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSize"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Large"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasHydrophobicity"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Hydrophilic"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSideChainStructure"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Aliphatic"/>
</owl:Restriction>
</rdfs:subClassOf>
<owl:disjointWith rdf:resource="&amino-acid;L"/>
<owl:disjointWith rdf:resource="&amino-acid;M"/>
<owl:disjointWith rdf:resource="&amino-acid;N"/>
<owl:disjointWith rdf:resource="&amino-acid;P"/>
<owl:disjointWith rdf:resource="&amino-acid;Q"/>
<owl:disjointWith rdf:resource="&amino-acid;R"/>
<owl:disjointWith rdf:resource="&amino-acid;S"/>
<owl:disjointWith rdf:resource="&amino-acid;T"/>
<owl:disjointWith rdf:resource="&amino-acid;V"/>
<owl:disjointWith rdf:resource="&amino-acid;W"/>
<owl:disjointWith rdf:resource="&amino-acid;Y"/>
<singleLetterName xml:lang="en">K</singleLetterName>
<preferredName xml:lang="en">Lysine</preferredName>
<shortName xml:lang="en">lys</shortName>
<shortName xml:lang="zh">赖</shortName>
<preferredName xml:lang="zh">赖氨酸</preferredName>
</owl:Class>
<!-- http://www.co-ode.org/ontologies/amino-acid/2006/05/18/amino-acid.owl#L -->
<owl:Class rdf:about="&amino-acid;L">
<rdfs:label xml:lang="en">Leucine</rdfs:label>
<rdfs:label xml:lang="zh">亮氨酸</rdfs:label>
<rdfs:label xml:lang="zh">异已氨酸</rdfs:label>
<rdfs:label xml:lang="zh">白氨酸</rdfs:label>
<rdfs:subClassOf rdf:resource="&amino-acid;SpecificAminoAcid"/>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasPolarity"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Non-Polar"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasHydrophobicity"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Hydrophobic"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSize"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Large"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSideChainStructure"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Aliphatic"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasCharge"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Neutral"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasPolarity"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Non-Polar"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasCharge"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Neutral"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSideChainStructure"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Aliphatic"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSize"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Large"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasHydrophobicity"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Hydrophobic"/>
</owl:Restriction>
</rdfs:subClassOf>
<owl:disjointWith rdf:resource="&amino-acid;M"/>
<owl:disjointWith rdf:resource="&amino-acid;N"/>
<owl:disjointWith rdf:resource="&amino-acid;P"/>
<owl:disjointWith rdf:resource="&amino-acid;Q"/>
<owl:disjointWith rdf:resource="&amino-acid;R"/>
<owl:disjointWith rdf:resource="&amino-acid;S"/>
<owl:disjointWith rdf:resource="&amino-acid;T"/>
<owl:disjointWith rdf:resource="&amino-acid;V"/>
<owl:disjointWith rdf:resource="&amino-acid;W"/>
<owl:disjointWith rdf:resource="&amino-acid;Y"/>
<singleLetterName xml:lang="en">L</singleLetterName>
<preferredName xml:lang="en">Leucine</preferredName>
<shortName xml:lang="en">leu</shortName>
<shortName xml:lang="zh">亮</shortName>
<preferredName xml:lang="zh">亮氨酸</preferredName>
</owl:Class>
<!-- http://www.co-ode.org/ontologies/amino-acid/2006/05/18/amino-acid.owl#Large -->
<owl:Class rdf:about="&amino-acid;Large">
<rdfs:label xml:lang="zh">大</rdfs:label>
<rdfs:subClassOf rdf:resource="&amino-acid;Size"/>
<owl:disjointWith rdf:resource="&amino-acid;Small"/>
<owl:disjointWith rdf:resource="&amino-acid;Tiny"/>
<preferredName xml:lang="en">Large</preferredName>
<preferredName xml:lang="zh">大型</preferredName>
</owl:Class>
<!-- http://www.co-ode.org/ontologies/amino-acid/2006/05/18/amino-acid.owl#LargeAliphaticAminoAcid -->
<owl:Class rdf:about="&amino-acid;LargeAliphaticAminoAcid">
<rdfs:label xml:lang="en"
>Large Aliphatic Amino Acids</rdfs:label>
<owl:equivalentClass>
<owl:Class>
<owl:intersectionOf rdf:parseType="Collection">
<rdf:Description rdf:about="&amino-acid;AminoAcid"/>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSideChainStructure"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Aliphatic"/>
</owl:Restriction>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSize"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Large"/>
</owl:Restriction>
</owl:intersectionOf>
</owl:Class>
</owl:equivalentClass>
<preferredName xml:lang="en"
>Large Aliphatic Amino Acid</preferredName>
<preferredName xml:lang="zh">大型脂肪族氨基酸</preferredName>
</owl:Class>
<!-- http://www.co-ode.org/ontologies/amino-acid/2006/05/18/amino-acid.owl#M -->
<owl:Class rdf:about="&amino-acid;M">
<rdfs:label xml:lang="en">Methionine</rdfs:label>
<rdfs:label xml:lang="zh">甲硫基丁氨酸</rdfs:label>
<rdfs:label xml:lang="zh">甲硫氨酸</rdfs:label>
<rdfs:label xml:lang="zh">蛋氨酸</rdfs:label>
<rdfs:subClassOf rdf:resource="&amino-acid;SpecificAminoAcid"/>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSideChainStructure"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Aliphatic"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSideChainStructure"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Aliphatic"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasPolarity"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Non-Polar"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasCharge"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Neutral"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasPolarity"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Non-Polar"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSize"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Large"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasHydrophobicity"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Hydrophobic"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSize"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Large"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasCharge"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Neutral"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasHydrophobicity"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Hydrophobic"/>
</owl:Restriction>
</rdfs:subClassOf>
<owl:disjointWith rdf:resource="&amino-acid;N"/>
<owl:disjointWith rdf:resource="&amino-acid;P"/>
<owl:disjointWith rdf:resource="&amino-acid;Q"/>
<owl:disjointWith rdf:resource="&amino-acid;R"/>
<owl:disjointWith rdf:resource="&amino-acid;S"/>
<owl:disjointWith rdf:resource="&amino-acid;T"/>
<owl:disjointWith rdf:resource="&amino-acid;V"/>
<owl:disjointWith rdf:resource="&amino-acid;W"/>
<owl:disjointWith rdf:resource="&amino-acid;Y"/>
<singleLetterName xml:lang="en">M</singleLetterName>
<preferredName xml:lang="en">Methionine</preferredName>
<shortName xml:lang="en">met</shortName>
<shortName xml:lang="zh">蛋</shortName>
<preferredName xml:lang="zh">蛋氨酸</preferredName>
</owl:Class>
<!-- http://www.co-ode.org/ontologies/amino-acid/2006/05/18/amino-acid.owl#N -->
<owl:Class rdf:about="&amino-acid;N">
<rdfs:label xml:lang="en">Asparagine</rdfs:label>
<rdfs:label xml:lang="zh">天冬酰胺</rdfs:label>
<rdfs:label xml:lang="zh">天冬酰胺酸</rdfs:label>
<rdfs:label xml:lang="zh">天门冬氨</rdfs:label>
<rdfs:label xml:lang="zh">天门冬素</rdfs:label>
<rdfs:label xml:lang="zh">天门冬酰胺</rdfs:label>
<rdfs:label xml:lang="zh">天门科素</rdfs:label>
<rdfs:label xml:lang="zh">氨羰丙氨酸</rdfs:label>
<rdfs:subClassOf rdf:resource="&amino-acid;SpecificAminoAcid"/>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSideChainStructure"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Aliphatic"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSize"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Small"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasPolarity"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Polar"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasHydrophobicity"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Hydrophilic"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasCharge"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Neutral"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSideChainStructure"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Aliphatic"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasHydrophobicity"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Hydrophilic"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasCharge"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Neutral"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSize"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Small"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasPolarity"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Polar"/>
</owl:Restriction>
</rdfs:subClassOf>
<owl:disjointWith rdf:resource="&amino-acid;P"/>
<owl:disjointWith rdf:resource="&amino-acid;Q"/>
<owl:disjointWith rdf:resource="&amino-acid;R"/>
<owl:disjointWith rdf:resource="&amino-acid;S"/>
<owl:disjointWith rdf:resource="&amino-acid;T"/>
<owl:disjointWith rdf:resource="&amino-acid;V"/>
<owl:disjointWith rdf:resource="&amino-acid;W"/>
<owl:disjointWith rdf:resource="&amino-acid;Y"/>
<owl:versionInfo rdf:datatype="&xsd;string"
>TODO: Should this be Aliphatic?</owl:versionInfo>
<preferredName xml:lang="en">Asparagine</preferredName>
<singleLetterName xml:lang="en">N</singleLetterName>
<shortName xml:lang="en">asn</shortName>
<rdfs:comment xml:lang="zh">中文简称？</rdfs:comment>
<preferredName xml:lang="zh">天冬酰胺</preferredName>
</owl:Class>
<!-- http://www.co-ode.org/ontologies/amino-acid/2006/05/18/amino-acid.owl#Negative -->
<owl:Class rdf:about="&amino-acid;Negative">
<rdfs:label xml:lang="zh">负电</rdfs:label>
<rdfs:label xml:lang="zh">负电荷</rdfs:label>
<rdfs:subClassOf rdf:resource="&amino-acid;Charge"/>
<owl:disjointWith rdf:resource="&amino-acid;Neutral"/>
<owl:disjointWith rdf:resource="&amino-acid;Positive"/>
<preferredName xml:lang="en">Negative</preferredName>
<preferredName xml:lang="zh">负电性</preferredName>
</owl:Class>
<!-- http://www.co-ode.org/ontologies/amino-acid/2006/05/18/amino-acid.owl#NegativeChargedAminoAcid -->
<owl:Class rdf:about="&amino-acid;NegativeChargedAminoAcid">
<rdfs:label xml:lang="en"
>Negative Charged Amino Acids</rdfs:label>
<rdfs:label xml:lang="zh">负电型氨基酸</rdfs:label>
<rdfs:label xml:lang="zh">负电性氨基酸</rdfs:label>
<owl:equivalentClass>
<owl:Class>
<owl:intersectionOf rdf:parseType="Collection">
<rdf:Description rdf:about="&amino-acid;AminoAcid"/>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasCharge"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Negative"/>
</owl:Restriction>
</owl:intersectionOf>
</owl:Class>
</owl:equivalentClass>
<preferredName xml:lang="en"
>Negative Charged Amino Acid</preferredName>
<preferredName xml:lang="zh">负电荷型氨基酸</preferredName>
</owl:Class>
<!-- http://www.co-ode.org/ontologies/amino-acid/2006/05/18/amino-acid.owl#Neutral -->
<owl:Class rdf:about="&amino-acid;Neutral">
<rdfs:label xml:lang="zh">电中性</rdfs:label>
<rdfs:subClassOf rdf:resource="&amino-acid;Charge"/>
<owl:disjointWith rdf:resource="&amino-acid;Positive"/>
<preferredName xml:lang="en">Neutral</preferredName>
<preferredName xml:lang="zh">中性</preferredName>
</owl:Class>
<!-- http://www.co-ode.org/ontologies/amino-acid/2006/05/18/amino-acid.owl#Non-Polar -->
<owl:Class rdf:about="&amino-acid;Non-Polar">
<rdfs:subClassOf rdf:resource="&amino-acid;Polarity"/>
<owl:disjointWith rdf:resource="&amino-acid;Polar"/>
<preferredName xml:lang="en">Non-Polar</preferredName>
<preferredName xml:lang="zh">非极性</preferredName>
</owl:Class>
<!-- http://www.co-ode.org/ontologies/amino-acid/2006/05/18/amino-acid.owl#P -->
<owl:Class rdf:about="&amino-acid;P">
<rdfs:label xml:lang="en">Proline</rdfs:label>
<rdfs:label xml:lang="zh">脯氨酸</rdfs:label>
<rdfs:subClassOf rdf:resource="&amino-acid;SpecificAminoAcid"/>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasHydrophobicity"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Hydrophobic"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSize"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Small"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSideChainStructure"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Aliphatic"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasHydrophobicity"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Hydrophobic"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasCharge"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Neutral"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasPolarity"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Non-Polar"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSize"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Small"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSideChainStructure"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Aliphatic"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasPolarity"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Non-Polar"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasCharge"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Neutral"/>
</owl:Restriction>
</rdfs:subClassOf>
<owl:disjointWith rdf:resource="&amino-acid;Q"/>
<owl:disjointWith rdf:resource="&amino-acid;R"/>
<owl:disjointWith rdf:resource="&amino-acid;S"/>
<owl:disjointWith rdf:resource="&amino-acid;T"/>
<owl:disjointWith rdf:resource="&amino-acid;V"/>
<owl:disjointWith rdf:resource="&amino-acid;W"/>
<owl:disjointWith rdf:resource="&amino-acid;Y"/>
<singleLetterName xml:lang="en">P</singleLetterName>
<preferredName xml:lang="en">Proline</preferredName>
<shortName xml:lang="en">pro</shortName>
<shortName xml:lang="zh">脯</shortName>
<preferredName xml:lang="zh">脯氨酸</preferredName>
</owl:Class>
<!-- http://www.co-ode.org/ontologies/amino-acid/2006/05/18/amino-acid.owl#Polar -->
<owl:Class rdf:about="&amino-acid;Polar">
<rdfs:subClassOf rdf:resource="&amino-acid;Polarity"/>
<preferredName xml:lang="en">Polar</preferredName>
<preferredName xml:lang="zh">极性</preferredName>
</owl:Class>
<!-- http://www.co-ode.org/ontologies/amino-acid/2006/05/18/amino-acid.owl#Polarity -->
<owl:Class rdf:about="&amino-acid;Polarity">
<rdfs:label xml:lang="zh">极性</rdfs:label>
<rdfs:label xml:lang="zh">极性类别</rdfs:label>
<owl:equivalentClass>
<owl:Class>
<owl:unionOf rdf:parseType="Collection">
<rdf:Description rdf:about="&amino-acid;Non-Polar"/>
<rdf:Description rdf:about="&amino-acid;Polar"/>
</owl:unionOf>
</owl:Class>
</owl:equivalentClass>
<rdfs:subClassOf rdf:resource="&amino-acid;RefiningFeature"/>
<preferredName xml:lang="en">Polarity</preferredName>
<preferredName xml:lang="zh">极性特征</preferredName>
</owl:Class>
<!-- http://www.co-ode.org/ontologies/amino-acid/2006/05/18/amino-acid.owl#Positive -->
<owl:Class rdf:about="&amino-acid;Positive">
<rdfs:label xml:lang="zh">正电</rdfs:label>
<rdfs:label xml:lang="zh">正电荷</rdfs:label>
<rdfs:subClassOf rdf:resource="&amino-acid;Charge"/>
<preferredName xml:lang="en">Positive</preferredName>
<preferredName xml:lang="zh">正电性</preferredName>
</owl:Class>
<!-- http://www.co-ode.org/ontologies/amino-acid/2006/05/18/amino-acid.owl#PositiveChargedAminoAcid -->
<owl:Class rdf:about="&amino-acid;PositiveChargedAminoAcid">
<rdfs:label xml:lang="en"
>Positive Charged Amino Acids</rdfs:label>
<owl:equivalentClass>
<owl:Class>
<owl:intersectionOf rdf:parseType="Collection">
<rdf:Description rdf:about="&amino-acid;AminoAcid"/>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasCharge"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Positive"/>
</owl:Restriction>
</owl:intersectionOf>
</owl:Class>
</owl:equivalentClass>
<preferredName xml:lang="en"
>Positive Charged Amino Acid</preferredName>
<preferredName xml:lang="zh">正电荷型氨基酸</preferredName>
</owl:Class>
<!-- http://www.co-ode.org/ontologies/amino-acid/2006/05/18/amino-acid.owl#Q -->
<owl:Class rdf:about="&amino-acid;Q">
<rdfs:label xml:lang="en">Glutamine</rdfs:label>
<rdfs:label xml:lang="zh">戊氨二酸一酰胺</rdfs:label>
<rdfs:label xml:lang="zh">谷氨酰胺</rdfs:label>
<rdfs:label xml:lang="zh">谷酰胺</rdfs:label>
<rdfs:subClassOf rdf:resource="&amino-acid;SpecificAminoAcid"/>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasPolarity"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Polar"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasHydrophobicity"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Hydrophilic"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasCharge"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Neutral"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSize"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Large"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSideChainStructure"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Aliphatic"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasPolarity"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Polar"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSize"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Large"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasCharge"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Neutral"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasHydrophobicity"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Hydrophilic"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSideChainStructure"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Aliphatic"/>
</owl:Restriction>
</rdfs:subClassOf>
<owl:disjointWith rdf:resource="&amino-acid;R"/>
<owl:disjointWith rdf:resource="&amino-acid;S"/>
<owl:disjointWith rdf:resource="&amino-acid;T"/>
<owl:disjointWith rdf:resource="&amino-acid;V"/>
<owl:disjointWith rdf:resource="&amino-acid;W"/>
<owl:disjointWith rdf:resource="&amino-acid;Y"/>
<preferredName xml:lang="en">Glutamine</preferredName>
<singleLetterName xml:lang="en">Q</singleLetterName>
<shortName xml:lang="en">gln</shortName>
<rdfs:comment xml:lang="zh">中文简称？</rdfs:comment>
<preferredName xml:lang="zh">谷氨酰胺</preferredName>
</owl:Class>
<!-- http://www.co-ode.org/ontologies/amino-acid/2006/05/18/amino-acid.owl#R -->
<owl:Class rdf:about="&amino-acid;R">
<rdfs:label xml:lang="en">Arginine</rdfs:label>
<rdfs:label xml:lang="zh">2-氨基-5-胍基戊酸</rdfs:label>
<rdfs:label xml:lang="zh">精氨酸</rdfs:label>
<rdfs:label xml:lang="zh">胍基戊氨酸</rdfs:label>
<rdfs:subClassOf rdf:resource="&amino-acid;SpecificAminoAcid"/>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasPolarity"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Polar"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasCharge"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Positive"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSize"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Large"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasCharge"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Positive"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSideChainStructure"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Aliphatic"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSideChainStructure"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Aliphatic"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSize"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Large"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasHydrophobicity"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Hydrophilic"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasPolarity"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Polar"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasHydrophobicity"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Hydrophilic"/>
</owl:Restriction>
</rdfs:subClassOf>
<owl:disjointWith rdf:resource="&amino-acid;S"/>
<owl:disjointWith rdf:resource="&amino-acid;T"/>
<owl:disjointWith rdf:resource="&amino-acid;V"/>
<owl:disjointWith rdf:resource="&amino-acid;W"/>
<owl:disjointWith rdf:resource="&amino-acid;Y"/>
<preferredName xml:lang="en">Arginine</preferredName>
<singleLetterName xml:lang="en">R</singleLetterName>
<shortName xml:lang="en">arg</shortName>
<shortName xml:lang="zh">精</shortName>
<preferredName xml:lang="zh">精氨酸</preferredName>
</owl:Class>
<!-- http://www.co-ode.org/ontologies/amino-acid/2006/05/18/amino-acid.owl#RefiningFeature -->
<owl:Class rdf:about="&amino-acid;RefiningFeature">
<rdfs:label xml:lang="en"
>Refining Features</rdfs:label>
<rdfs:label xml:lang="zh">具体特征</rdfs:label>
<rdfs:label xml:lang="zh">精细特征</rdfs:label>
<preferredName xml:lang="en"
>Refining Feature</preferredName>
<preferredName xml:lang="zh">细化特征</preferredName>
</owl:Class>
<!-- http://www.co-ode.org/ontologies/amino-acid/2006/05/18/amino-acid.owl#S -->
<owl:Class rdf:about="&amino-acid;S">
<rdfs:label xml:lang="en">Serine</rdfs:label>
<rdfs:label xml:lang="zh">丝氨酸</rdfs:label>
<rdfs:label xml:lang="zh">羟基丙氨酸</rdfs:label>
<rdfs:subClassOf rdf:resource="&amino-acid;SpecificAminoAcid"/>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSize"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Tiny"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSideChainStructure"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Aliphatic"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSideChainStructure"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Aliphatic"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasPolarity"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Polar"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasHydrophobicity"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Hydrophilic"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasPolarity"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Polar"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasHydrophobicity"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Hydrophilic"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSize"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Tiny"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasCharge"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Neutral"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasCharge"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Neutral"/>
</owl:Restriction>
</rdfs:subClassOf>
<owl:disjointWith rdf:resource="&amino-acid;T"/>
<owl:disjointWith rdf:resource="&amino-acid;V"/>
<owl:disjointWith rdf:resource="&amino-acid;W"/>
<owl:disjointWith rdf:resource="&amino-acid;Y"/>
<singleLetterName xml:lang="en">S</singleLetterName>
<preferredName xml:lang="en">Serine</preferredName>
<shortName xml:lang="en">ser</shortName>
<shortName xml:lang="zh">丝</shortName>
<preferredName xml:lang="zh">丝氨酸</preferredName>
</owl:Class>
<!-- http://www.co-ode.org/ontologies/amino-acid/2006/05/18/amino-acid.owl#SideChainStructure -->
<owl:Class rdf:about="&amino-acid;SideChainStructure">
<rdfs:label xml:lang="en"
>Side Chain Structures</rdfs:label>
<rdfs:label xml:lang="zh">侧链类型</rdfs:label>
<rdfs:label xml:lang="zh">侧链结构</rdfs:label>
<rdfs:label xml:lang="zh">侧链结构类型</rdfs:label>
<owl:equivalentClass>
<owl:Class>
<owl:unionOf rdf:parseType="Collection">
<rdf:Description rdf:about="&amino-acid;Aliphatic"/>
<rdf:Description rdf:about="&amino-acid;Aromatic"/>
</owl:unionOf>
</owl:Class>
</owl:equivalentClass>
<rdfs:subClassOf rdf:resource="&amino-acid;RefiningFeature"/>
<preferredName xml:lang="en"
>Side Chain Structure</preferredName>
<preferredName xml:lang="zh">侧链结构特征</preferredName>
</owl:Class>
<!-- http://www.co-ode.org/ontologies/amino-acid/2006/05/18/amino-acid.owl#Size -->
<owl:Class rdf:about="&amino-acid;Size">
<rdfs:label xml:lang="zh">大小</rdfs:label>
<owl:equivalentClass>
<owl:Class>
<owl:unionOf rdf:parseType="Collection">
<rdf:Description rdf:about="&amino-acid;Large"/>
<rdf:Description rdf:about="&amino-acid;Small"/>
<rdf:Description rdf:about="&amino-acid;Tiny"/>
</owl:unionOf>
</owl:Class>
</owl:equivalentClass>
<rdfs:subClassOf rdf:resource="&amino-acid;RefiningFeature"/>
<preferredName xml:lang="en">Size</preferredName>
<preferredName xml:lang="zh">大小特征</preferredName>
</owl:Class>
<!-- http://www.co-ode.org/ontologies/amino-acid/2006/05/18/amino-acid.owl#Small -->
<owl:Class rdf:about="&amino-acid;Small">
<rdfs:label xml:lang="zh">小</rdfs:label>
<rdfs:subClassOf rdf:resource="&amino-acid;Size"/>
<owl:disjointWith rdf:resource="&amino-acid;Tiny"/>
<preferredName xml:lang="en">Small</preferredName>
<preferredName xml:lang="zh">小型</preferredName>
</owl:Class>
<!-- http://www.co-ode.org/ontologies/amino-acid/2006/05/18/amino-acid.owl#SpecificAminoAcid -->
<owl:Class rdf:about="&amino-acid;SpecificAminoAcid">
<rdfs:label xml:lang="zh">氨基酸</rdfs:label>
<rdfs:subClassOf rdf:resource="&amino-acid;AminoAcid"/>
<preferredName xml:lang="en"
>Specific Amino Acid</preferredName>
<preferredName xml:lang="zh">具体氨基酸</preferredName>
</owl:Class>
<!-- http://www.co-ode.org/ontologies/amino-acid/2006/05/18/amino-acid.owl#T -->
<owl:Class rdf:about="&amino-acid;T">
<rdfs:label xml:lang="en">Threonine</rdfs:label>
<rdfs:label xml:lang="zh">β-羟丁氨酸</rdfs:label>
<rdfs:label xml:lang="zh">羟丁酸</rdfs:label>
<rdfs:label xml:lang="zh">羟基丁氨酸</rdfs:label>
<rdfs:label xml:lang="zh">苏氨酸</rdfs:label>
<rdfs:subClassOf rdf:resource="&amino-acid;SpecificAminoAcid"/>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSize"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Tiny"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasHydrophobicity"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Hydrophilic"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasPolarity"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Polar"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSideChainStructure"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Aliphatic"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSideChainStructure"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Aliphatic"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSize"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Tiny"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasPolarity"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Polar"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasCharge"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Neutral"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasHydrophobicity"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Hydrophilic"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasCharge"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Neutral"/>
</owl:Restriction>
</rdfs:subClassOf>
<owl:disjointWith rdf:resource="&amino-acid;V"/>
<owl:disjointWith rdf:resource="&amino-acid;W"/>
<owl:disjointWith rdf:resource="&amino-acid;Y"/>
<singleLetterName xml:lang="en">T</singleLetterName>
<preferredName xml:lang="en">Threonine</preferredName>
<shortName xml:lang="en">thr</shortName>
<rdfs:comment xml:lang="zh">别名：羟丁酸?</rdfs:comment>
<shortName xml:lang="zh">苏</shortName>
<preferredName xml:lang="zh">苏氨酸</preferredName>
</owl:Class>
<!-- http://www.co-ode.org/ontologies/amino-acid/2006/05/18/amino-acid.owl#Tiny -->
<owl:Class rdf:about="&amino-acid;Tiny">
<rdfs:label xml:lang="zh">微</rdfs:label>
<rdfs:label xml:lang="zh">微小</rdfs:label>
<rdfs:subClassOf rdf:resource="&amino-acid;Size"/>
<preferredName xml:lang="en">Tiny</preferredName>
<preferredName xml:lang="zh">微型</preferredName>
</owl:Class>
<!-- http://www.co-ode.org/ontologies/amino-acid/2006/05/18/amino-acid.owl#TinyPolarAminoAcid -->
<owl:Class rdf:about="&amino-acid;TinyPolarAminoAcid">
<rdfs:label xml:lang="en"
>Tiny Polar Amino Acids</rdfs:label>
<owl:equivalentClass>
<owl:Class>
<owl:intersectionOf rdf:parseType="Collection">
<rdf:Description rdf:about="&amino-acid;AminoAcid"/>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasPolarity"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Polar"/>
</owl:Restriction>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSize"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Tiny"/>
</owl:Restriction>
</owl:intersectionOf>
</owl:Class>
</owl:equivalentClass>
<preferredName xml:lang="en"
>Tiny Polar Amino Acid</preferredName>
<preferredName xml:lang="zh">微型极性氨基酸</preferredName>
</owl:Class>
<!-- http://www.co-ode.org/ontologies/amino-acid/2006/05/18/amino-acid.owl#V -->
<owl:Class rdf:about="&amino-acid;V">
<rdfs:label xml:lang="en">Valine</rdfs:label>
<rdfs:label xml:lang="zh">α-氨基异戊酸</rdfs:label>
<rdfs:label xml:lang="zh">缬氨酸</rdfs:label>
<rdfs:subClassOf rdf:resource="&amino-acid;SpecificAminoAcid"/>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasHydrophobicity"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Hydrophobic"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasCharge"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Neutral"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSideChainStructure"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Aliphatic"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSize"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Small"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSideChainStructure"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Aliphatic"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasPolarity"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Non-Polar"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasPolarity"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Non-Polar"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasHydrophobicity"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Hydrophobic"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSize"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Small"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasCharge"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Neutral"/>
</owl:Restriction>
</rdfs:subClassOf>
<owl:disjointWith rdf:resource="&amino-acid;W"/>
<owl:disjointWith rdf:resource="&amino-acid;Y"/>
<singleLetterName xml:lang="en">V</singleLetterName>
<preferredName xml:lang="en">Valine</preferredName>
<shortName xml:lang="en">val</shortName>
<shortName xml:lang="zh">缬</shortName>
<preferredName xml:lang="zh">缬氨酸</preferredName>
</owl:Class>
<!-- http://www.co-ode.org/ontologies/amino-acid/2006/05/18/amino-acid.owl#W -->
<owl:Class rdf:about="&amino-acid;W">
<rdfs:label xml:lang="en">Tryptophan</rdfs:label>
<rdfs:label xml:lang="zh">β-吲哚基丙氨酸</rdfs:label>
<rdfs:label xml:lang="zh">色氨酸</rdfs:label>
<rdfs:subClassOf rdf:resource="&amino-acid;SpecificAminoAcid"/>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasPolarity"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Non-Polar"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSideChainStructure"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Aromatic"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasHydrophobicity"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Hydrophobic"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasCharge"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Neutral"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasHydrophobicity"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Hydrophobic"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSideChainStructure"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Aromatic"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasCharge"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Neutral"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasPolarity"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Non-Polar"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSize"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Large"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSize"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Large"/>
</owl:Restriction>
</rdfs:subClassOf>
<owl:disjointWith rdf:resource="&amino-acid;Y"/>
<preferredName xml:lang="en">Tryptophan</preferredName>
<singleLetterName xml:lang="en">W</singleLetterName>
<shortName xml:lang="en">trp</shortName>
<shortName xml:lang="zh">色</shortName>
<preferredName xml:lang="zh">色氨酸</preferredName>
</owl:Class>
<!-- http://www.co-ode.org/ontologies/amino-acid/2006/05/18/amino-acid.owl#Y -->
<owl:Class rdf:about="&amino-acid;Y">
<rdfs:label xml:lang="en">Tyrosine</rdfs:label>
<rdfs:label xml:lang="zh">3-对羟苯基丙氨酸</rdfs:label>
<rdfs:label xml:lang="zh">酪氨酸</rdfs:label>
<rdfs:subClassOf rdf:resource="&amino-acid;SpecificAminoAcid"/>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSideChainStructure"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Aromatic"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasHydrophobicity"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Hydrophobic"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasPolarity"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Polar"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasHydrophobicity"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Hydrophobic"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSideChainStructure"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Aromatic"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSize"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Large"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasSize"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Large"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasCharge"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Neutral"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasCharge"/>
<owl:allValuesFrom rdf:resource="&amino-acid;Neutral"/>
</owl:Restriction>
</rdfs:subClassOf>
<rdfs:subClassOf>
<owl:Restriction>
<owl:onProperty rdf:resource="&amino-acid;hasPolarity"/>
<owl:someValuesFrom rdf:resource="&amino-acid;Polar"/>
</owl:Restriction>
</rdfs:subClassOf>
<preferredName xml:lang="en">Tyrosine</preferredName>
<singleLetterName xml:lang="en">Y</singleLetterName>
<shortName xml:lang="en">tyr</shortName>
<shortName xml:lang="zh">酪</shortName>
<preferredName xml:lang="zh">酪氨酸</preferredName>
</owl:Class>
<!--
///////////////////////////////////////////////////////////////////////////////////////
//
// Individuals
//
///////////////////////////////////////////////////////////////////////////////////////
-->
<!-- http://www.w3.org/2002/07/owl#Thing -->
<rdf:Description rdf:about="&owl;Thing">
<rdfs:label xml:lang="en">Things</rdfs:label>
<preferredName xml:lang="en">Thing</preferredName>
<preferredName xml:lang="zh">事物</preferredName>
</rdf:Description>
</rdf:RDF>
<!-- Generated by the OWL API (version 2.2.1.974) http://owlapi.sourceforge.net -->
| Web Ontology Language | 5 | VishalS711/protege | protege-editor-owl/src/test/resources/ontologies/amino-acid.owl | [
"BSD-2-Clause"
] |
Rules useless in parser due to conflicts
20 type: IDENTIFIER
Stav 18 conflicts: 1 reduce/reduce
Gramatika
0 $accept: file $end
1 file: %empty
2 | statement file
3 statement: expression ';'
4 expression: expression '=' expression
5 | '(' type ')' expression
6 | '(' expression ')'
7 | IDENTIFIER
8 type: VOID
9 | AUTO
10 | BOOL
11 | BYTE
12 | SHORT
13 | INT
14 | LONG
15 | FLOAT
16 | DOUBLE
17 | SIGNED
18 | UNSIGNED
19 | STRING
20 | IDENTIFIER
Terminály s pravidly, ve kterých se objevují
$end (0) 0
'(' (40) 5 6
')' (41) 5 6
';' (59) 3
'=' (61) 4
error (256)
CAST (258)
AUTO (259) 9
BOOL (260) 10
BYTE (261) 11
DOUBLE (262) 16
FLOAT (263) 15
INT (264) 13
LONG (265) 14
SHORT (266) 12
SIGNED (267) 17
STRING (268) 19
UNSIGNED (269) 18
VOID (270) 8
IDENTIFIER (271) 7 20
Neterminály s pravidly, ve kterých se objevují
$accept (21)
vlevo: 0
file (22)
vlevo: 1 2, vpravo: 0 2
statement (23)
vlevo: 3, vpravo: 2
expression (24)
vlevo: 4 5 6 7, vpravo: 3 4 5 6
type (25)
vlevo: 8 9 10 11 12 13 14 15 16 17 18 19 20, vpravo: 5
State 0
0 $accept: . file $end
1 file: . %empty [$end]
2 | . statement file
3 statement: . expression ';'
4 expression: . expression '=' expression
5 | . '(' type ')' expression
6 | . '(' expression ')'
7 | . IDENTIFIER
'(' posunout a přejít do stavu 1
IDENTIFIER posunout a přejít do stavu 2
$výchozí reduce using rule 1 (file)
file přejít do stavu 3
statement přejít do stavu 4
expression přejít do stavu 5
State 1
4 expression: . expression '=' expression
5 | . '(' type ')' expression
5 | '(' . type ')' expression
6 | . '(' expression ')'
6 | '(' . expression ')'
7 | . IDENTIFIER
8 type: . VOID
9 | . AUTO
10 | . BOOL
11 | . BYTE
12 | . SHORT
13 | . INT
14 | . LONG
15 | . FLOAT
16 | . DOUBLE
17 | . SIGNED
18 | . UNSIGNED
19 | . STRING
20 | . IDENTIFIER
'(' posunout a přejít do stavu 1
AUTO posunout a přejít do stavu 6
BOOL posunout a přejít do stavu 7
BYTE posunout a přejít do stavu 8
DOUBLE posunout a přejít do stavu 9
FLOAT posunout a přejít do stavu 10
INT posunout a přejít do stavu 11
LONG posunout a přejít do stavu 12
SHORT posunout a přejít do stavu 13
SIGNED posunout a přejít do stavu 14
STRING posunout a přejít do stavu 15
UNSIGNED posunout a přejít do stavu 16
VOID posunout a přejít do stavu 17
IDENTIFIER posunout a přejít do stavu 18
expression přejít do stavu 19
type přejít do stavu 20
State 2
7 expression: IDENTIFIER .
$výchozí reduce using rule 7 (expression)
State 3
0 $accept: file . $end
$end posunout a přejít do stavu 21
State 4
1 file: . %empty [$end]
2 | . statement file
2 | statement . file
3 statement: . expression ';'
4 expression: . expression '=' expression
5 | . '(' type ')' expression
6 | . '(' expression ')'
7 | . IDENTIFIER
'(' posunout a přejít do stavu 1
IDENTIFIER posunout a přejít do stavu 2
$výchozí reduce using rule 1 (file)
file přejít do stavu 22
statement přejít do stavu 4
expression přejít do stavu 5
State 5
3 statement: expression . ';'
4 expression: expression . '=' expression
'=' posunout a přejít do stavu 23
';' posunout a přejít do stavu 24
State 6
9 type: AUTO .
$výchozí reduce using rule 9 (type)
State 7
10 type: BOOL .
$výchozí reduce using rule 10 (type)
State 8
11 type: BYTE .
$výchozí reduce using rule 11 (type)
State 9
16 type: DOUBLE .
$výchozí reduce using rule 16 (type)
State 10
15 type: FLOAT .
$výchozí reduce using rule 15 (type)
State 11
13 type: INT .
$výchozí reduce using rule 13 (type)
State 12
14 type: LONG .
$výchozí reduce using rule 14 (type)
State 13
12 type: SHORT .
$výchozí reduce using rule 12 (type)
State 14
17 type: SIGNED .
$výchozí reduce using rule 17 (type)
State 15
19 type: STRING .
$výchozí reduce using rule 19 (type)
State 16
18 type: UNSIGNED .
$výchozí reduce using rule 18 (type)
State 17
8 type: VOID .
$výchozí reduce using rule 8 (type)
State 18
7 expression: IDENTIFIER . ['=', ')']
20 type: IDENTIFIER . [')']
')' reduce using rule 7 (expression)
')' [reduce using rule 20 (type)]
$výchozí reduce using rule 7 (expression)
State 19
4 expression: expression . '=' expression
6 | '(' expression . ')'
'=' posunout a přejít do stavu 23
')' posunout a přejít do stavu 25
State 20
5 expression: '(' type . ')' expression
')' posunout a přejít do stavu 26
State 21
0 $accept: file $end .
$výchozí přijmout
State 22
2 file: statement file .
$výchozí reduce using rule 2 (file)
State 23
4 expression: . expression '=' expression
4 | expression '=' . expression
5 | . '(' type ')' expression
6 | . '(' expression ')'
7 | . IDENTIFIER
'(' posunout a přejít do stavu 1
IDENTIFIER posunout a přejít do stavu 2
expression přejít do stavu 27
State 24
3 statement: expression ';' .
$výchozí reduce using rule 3 (statement)
State 25
6 expression: '(' expression ')' .
$výchozí reduce using rule 6 (expression)
State 26
4 expression: . expression '=' expression
5 | . '(' type ')' expression
5 | '(' type ')' . expression
6 | . '(' expression ')'
7 | . IDENTIFIER
'(' posunout a přejít do stavu 1
IDENTIFIER posunout a přejít do stavu 2
expression přejít do stavu 28
State 27
4 expression: expression . '=' expression
4 | expression '=' expression . [';', ')']
'=' posunout a přejít do stavu 23
$výchozí reduce using rule 4 (expression)
Conflict between rule 4 and token '=' resolved as shift (%right '=').
State 28
4 expression: expression . '=' expression
5 | '(' type ')' expression . ['=', ';', ')']
$výchozí reduce using rule 5 (expression)
Conflict between rule 5 and token '=' resolved as reduce ('=' < CAST).
| Bison | 4 | YKG/y | testdata/dev/so2.y.bison | [
"BSD-3-Clause"
] |
= Command Line Interface
showoff [global options] command [command options] [arguments...]
- Use the command <tt>help</tt> to get a summary of commands
- Use the command <tt>help command_name</tt> to get a help for <tt>command_name</tt>
- Use <tt>--</tt> to stop command line argument processing; useful if your arguments have dashes in them
== Commands
[<tt>add</tt>] Add a new slide at the end in a given dir
[<tt>create</tt>] Create new showoff presentation
[<tt>skeleton</tt>] Generate a full presentation based on a <tt>showoff.json</tt> outline
[<tt>help</tt>] Shows list of commands or help for one command
[<tt>heroku</tt>] Setup your presentation to serve on Heroku
[<tt>github</tt>] Setup your presentation to serve on GitHub Pages
[<tt>serve</tt>] Serves the showoff presentation in the current directory (or a given dir)
[<tt>static</tt>] Generate static version of presentation
[<tt>validate</tt>] Validate the consistency of your presentation
== <tt>showoff help [command]</tt>
Shows list of commands or help for one command
== <tt>showoff add [title]</tt>
Add a new slide at the end in a given dir
[Aliases]
- <tt>new</tt>
Outputs or creates a new slide. With -d and -n, a new slide is created in the given dir, numbered to appear
as the last slide in that dir (use -u to avoid numbering). Without those, outputs the slide markdown to
stdout (useful for shelling out from your editor). You may also specify a source file to use for a code
slide.
Options are specified *after* the command.
[<tt>-d, --dir=dir</tt>] Slide dir (where to put a new slide file)
[<tt>-n, --name=basename</tt>] Slide name (name of the new slide file)
[<tt>-s, --source=path to file</tt>] Include code from the given file as the slide body
[<tt>-t, --style, --type=valid showoff style/type</tt>] Slide Type/Style <i>( default: <tt>title</tt>)</i>
[<tt>-u, --nonumber</tt>] Don't number the slide, use the given name verbatim
== <tt>showoff create dir_name</tt>
Create new showoff presentation
[Aliases]
- <tt>init</tt>
This command helps start a new Showoff presentation by setting up the proper directory
structure for you. It takes the directory name you would like Showoff to create for you.
Options are specified *after* the command.
[<tt>-d, --slidedir=arg</tt>]
sample slide directory name <i>( default: <tt>one</tt>)</i>. Pass a comma-separated
list to create multiple directories.
[<tt>-n, --nosamples</tt>]
Don't create sample slides
== <tt>showoff heroku heroku_name</tt>
Setup your presentation to serve on Heroku
Creates the configuration files needed to Herokuize a Showoff presentation and then deploy it for you.
This will register the new project on Heroku if needed and create the git remote for you.
Open your new presentation by running <tt>heroku open</tt>.
Requires the <tt>heroku</tt> and <tt>bundler</tt> gems to be installed properly.
== <tt>showoff github</tt>
Generates a static version of your site and puts it in a gh-pages branch for static serving on GitHub.
Options are specified *after* the command.
[<tt>-f, --force</tt>] force overwrite of existing Gemfile/.gems and config.ru files if they exist
[<tt>-g, --dotgems</tt>] Use older-style .gems file instead of bundler-style Gemfile
[<tt>-p, --password=arg</tt>] add password protection to your heroku site
== <tt>showoff serve</tt>
Serves the showoff presentation in the current directory
Options are specified *after* the command. More arguments can be seen by running <tt>showoff serve --help</tt>.
[<tt>-f, --pres_file=arg</tt>] Presentation file <i>(default: <tt>showoff.json</tt>)</i>
[<tt>-h, --host=arg</tt>] Host or ip to run on <i>( default: <tt>localhost</tt>)</i>
[<tt>-p, --port=arg</tt>] Port on which to run <i>( default: <tt>9090</tt>)</i>
[<tt>-u, --url=address</tt>] Git URL to a repository containing the presentation <i>( default: <tt>none</tt>)</i>
== <tt>showoff skeleton</tt>
Reads a <tt>showoff.json</tt> file and generates a skeleton presentation, with one
sample slide file for each entry in the <tt>showoff.json</tt>. Clearly this only
works when listing all slide files. If you're only listing sections, then it will
only create the directories for you.
Options are specified *after* the command.
[<tt>-f, --file=arg</tt>] Presentation file <i>(default: <tt>showoff.json</tt>)</i>
== <tt>showoff static [name]</tt>
Generate static version of presentation with an optional supplemental materials type.
== <tt>showoff validate</tt>
This will validate the consistency of a presentation. If a <tt>showoff.json</tt> file
is present, it will be used to determine the list of slide files. If not, it will use
shell globbing to identify the list.
Each missing file or section directory is identified, then validation scripts are run
against code blocks on each file. By default, validators are known for Perl, Puppet,
Python, Ruby, and Shell. See PRESENTATION.rdoc to define custom validators.
Options are specified *after* the command.
[<tt>-f, --file=arg</tt>] Presentation file <i>(default: <tt>showoff.json</tt>)</i>
== <tt>showoff pdf [name]</tt>
Generate PDF version of presentation with an optional output filename. This requires
the <tt>pdfkit</tt> gem and the <tt>wkhtmltopdf</tt> rendering engine installed into
your <tt>$PATH</tt>.
Note: It's sometimes easier to browse to the <tt>/print</tt> endpoint and print the
page using your browser's native print function or use <tt>showoff static</tt> and
using another tool to render the HTML files into a PDF.
= Shell Auto Completion
== ZSH completion
You can complete commands and options in ZSH, by installing a script:
mkdir -p $HOME/.zsh/Completion
cp script/_showoff $HOME/.zsh/Completion
echo 'fpath=(~/.zsh/Completion $fpath)' >> $HOME/.zshrc
== <tt>bash</tt> completion
You can complete commands for showoff by putting the following in your <tt>.bashrc</tt> (or whatever
you use when starting <tt>bash</tt>):
complete -F get_showoff_commands
function get_showoff_commands()
{
if [ -z $2 ] ; then
COMPREPLY=(`showoff help -c`)
else
COMPREPLY=(`showoff help -c $2`)
fi
}
You can also install that as an executable script such as <tt>/etc/bash_completion.d/showoff</tt>.
| RDoc | 3 | mehrdad-shokri/showoff | documentation/COMMANDLINE.rdoc | [
"MIT"
] |
2016-02-18 21:52:48 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-02-18 21:52:48 [21:52]
2016-02-18 21:52:48 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-02-18 21:52:48 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-02-18 21:52:48 - Channel #linuxvoice: 77 nicks (1 op, 0 voices, 76 normals)
2016-02-18 21:52:48 - Notice(asimov.freenode.net): [freenode-info] channel flooding and no channel staff around to help? Please check with freenode support: http://freenode.net/faq.shtml#gettinghelp
2016-02-18 21:52:50 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-02-18 21:58:00 [21:52]
2016-02-18 22:01:46 @degville Devilment: I loved Boyhood. Found it very moving, despite not having much in common with the 'boy'. Watched The Revenant last night. 10/10 for effort. 4/10 for the film itself.
2016-02-18 22:02:20 fs0ciety Something about Leo I just don't like
2016-02-18 22:02:26 fs0ciety I think he tries that little bit too hard
2016-02-18 22:03:07 @degville Yeah. I think he's well cast in Wolf of Wall Street. And also Django Unchained. Tom Hardy would have been better for the lead in The Revenant imo.
2016-02-18 22:04:51 fs0ciety Hardy's great. Legend was awesome.. I kept putting on the voice of Ronnie for days
2016-02-18 22:05:16 fs0ciety Walked around the house and speaking to my housemates like that. Haha they probably got irritated, but I amused myself :)
2016-02-18 22:06:41 fs0ciety i'd imagine Hardy would be a big contender for the next Bond actually
2016-02-18 22:06:55 > jaake (~h4ckm3@c-68-52-45-79.hsd1.tn.comcast.net) has joined #linuxvoice
2016-02-18 22:12:00 [22:06]
2016-02-18 22:12:09 < jaake (~h4ckm3@c-68-52-45-79.hsd1.tn.comcast.net) has quit (Ping timeout: 276 seconds)
2016-02-18 22:14:57 @degville Yeah, I think you're right, unless he decline the potential stereotype. He's one of those actors who seems to actually act, rather than relying on the cliche of menace.
2016-02-18 22:16:45 > mnavrati (milan@nat/redhat/x-ggrgoghxlgljsudt) has joined #linuxvoice
2016-02-18 22:22:00 [22:16]
2016-02-18 22:39:43 jherrmann I've heard that Tom Hardy might be the next Wolverine, too, now that Hugh Jackman's stepping down
2016-02-18 22:39:43 [22:39]
2016-02-18 22:51:40 - irc: disconnected from server
2016-02-18 22:52:29 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-02-18 22:52:29 [22:52]
2016-02-18 22:52:29 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-02-18 22:52:29 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-02-18 22:52:29 - Channel #linuxvoice: 78 nicks (1 op, 0 voices, 77 normals)
2016-02-18 22:52:39 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-02-18 22:58:00 [22:52]
2016-02-18 23:07:40 > jaake (~h4ckm3@c-68-52-45-79.hsd1.tn.comcast.net) has joined #linuxvoice
2016-02-18 23:12:19 < jaake (~h4ckm3@c-68-52-45-79.hsd1.tn.comcast.net) has quit (Ping timeout: 248 seconds)
2016-02-18 23:18:00 [23:12]
2016-02-18 23:21:51 - irc: disconnected from server
2016-02-18 23:22:13 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-02-18 23:22:13 [23:22]
2016-02-18 23:22:13 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-02-18 23:22:13 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-02-18 23:22:13 - Channel #linuxvoice: 78 nicks (1 op, 0 voices, 77 normals)
2016-02-18 23:22:23 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-02-18 23:28:00 [23:22]
2016-02-18 23:28:57 Devilment In Django Unchained, enforced method acting by Leo. He really did cut his hand on the glass
2016-02-18 23:29:36 Devilment It's why the rest of the actors are looking at each other shiftedly
2016-02-18 23:30:00 Devilment They were expecting QT to shout "Cut!" (No pun intended)
2016-02-18 23:30:45 > jaake (~h4ckm3@c-68-52-45-79.hsd1.tn.comcast.net) has joined #linuxvoice
2016-02-18 23:31:15 Devilment I wasn't a fan of Leo when I was younger, mainly because of the Titanic hype, but was won over by his performance in 'Catch Me If You Can'
2016-02-18 23:31:58 @degville I felt the same. Didn't know about the hand... and yes, Catch Me If You Can is good.
2016-02-18 23:36:00 < jaake (~h4ckm3@c-68-52-45-79.hsd1.tn.comcast.net) has quit (Ping timeout: 276 seconds)
2016-02-18 23:36:31 fs0ciety One actor who I found was terribly underated was Adrian Brody
2016-02-18 23:36:36 fs0ciety Watch Detachment
2016-02-18 23:36:44 fs0ciety probably one of the best films I've seen in the past decade
2016-02-18 23:42:00 [23:36]
2016-02-18 23:42:28 - irc: disconnected from server
2016-02-18 23:45:04 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-02-18 23:45:04 [23:45]
2016-02-18 23:45:04 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-02-18 23:45:04 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-02-18 23:45:04 - Channel #linuxvoice: 78 nicks (1 op, 0 voices, 77 normals)
2016-02-18 23:45:13 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-02-18 23:48:18 - irc: disconnected from server
2016-02-18 23:49:03 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-02-18 23:49:03 [23:49]
2016-02-18 23:49:03 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-02-18 23:49:03 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-02-18 23:49:03 - Channel #linuxvoice: 78 nicks (1 op, 0 voices, 77 normals)
2016-02-18 23:49:12 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-02-18 23:52:21 > TraceyC (~TraceyC@208.74.121.106) has joined #linuxvoice
2016-02-18 23:58:00 [23:52]
2016-02-19 00:08:29 - irc: disconnected from server
2016-02-19 00:11:04 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-02-19 00:11:04 [00:11]
2016-02-19 00:11:04 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-02-19 00:11:04 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-02-19 00:11:04 - Channel #linuxvoice: 78 nicks (1 op, 0 voices, 77 normals)
2016-02-19 00:11:14 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-02-19 00:12:55 > webpigeon (~quassel@kat.vps.livebytes.co.uk) has joined #linuxvoice
2016-02-19 00:13:01 - irc: disconnected from server
2016-02-19 00:14:31 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-02-19 00:14:31 [00:14]
2016-02-19 00:14:31 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-02-19 00:14:31 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-02-19 00:14:31 - Channel #linuxvoice: 79 nicks (1 op, 0 voices, 78 normals)
2016-02-19 00:14:41 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-02-19 00:20:00 [00:14]
2016-02-19 00:21:46 > jaake (~h4ckm3@129.59.122.17) has joined #linuxvoice
2016-02-19 00:27:00 [00:21]
2016-02-19 00:41:47 Devilment http://blog.dustinkirkland.com/2016/02/zfs-is-fs-for-containers-in-ubuntu-1604.html
2016-02-19 00:42:13 Devilment If I'm reading that right, Canonical have baked ZFS into their kernel versions
2016-02-19 00:42:13 [00:42]
2016-02-19 00:45:07 TraceyC neat
2016-02-19 00:51:00 [00:45]
2016-02-19 01:01:10 popey looks that way http://packages.ubuntu.com/search?searchon=contents&keywords=zfs.ko&mode=filename&suite=xenial&arch=any
2016-02-19 01:04:57 < Arthur_D (~magne@ti0024a400-1474.bb.online.no) has quit (Ping timeout: 250 seconds)
2016-02-19 01:07:04 > Arthur_D (~magne@ti0024a400-1474.bb.online.no) has joined #linuxvoice
2016-02-19 01:07:04 [01:07]
2016-02-19 01:16:03 mcphail That's an interesting one. Wonder how they are interpreting the licensing issues?
2016-02-19 01:19:51 popey This has been raised by a few individuals online, yes.
2016-02-19 01:23:00 mcphail I suspect this is all going to end in tears (or a bespoke licensing agreement between Canonical and Oracle)
2016-02-19 01:23:00 [01:23]
2016-02-19 01:24:21 popey maybe such an agreement exists?
2016-02-19 01:25:22 mcphail Got to hope so, although it would make me sad as it would make the Ubuntu kernel less free
2016-02-19 01:25:40 mcphail (potentially)
2016-02-19 01:26:00 mcphail Suppose the GPLv2 would still give protection there
2016-02-19 01:31:00 [01:26]
2016-02-19 01:57:32 < jherrmann (jirkah@nat/redhat/x-jwvaovkrntpmbgrn) has quit (Quit: Toodle pip!)
2016-02-19 01:57:32 [01:57]
2016-02-19 01:57:37 < mnavrati (milan@nat/redhat/x-ggrgoghxlgljsudt) has quit (Quit: Leaving)
2016-02-19 01:59:57 Cadair find of the day: `curl wttr.in`
2016-02-19 02:00:28 Cadair although it seems to have gone a little to viral
2016-02-19 02:02:53 > jimbotux (~jimbotux@fpc3-sgyl30-2-0-cust5.18-2.static.cable.virginm.net) has joined #linuxvoice
2016-02-19 02:03:01 > mnavrati (milan@nat/redhat/x-lslyncabqwzckbnt) has joined #linuxvoice
2016-02-19 02:09:00 [02:03]
2016-02-19 02:13:09 > jherrmann (jirkah@nat/redhat/x-syqjyupnefmitnws) has joined #linuxvoice
2016-02-19 02:19:00 [02:13]
2016-02-19 02:21:50 james_olympus That's cool, but if I didn't use it often I'd soon forget the address and parameters
2016-02-19 02:27:00 [02:21]
2016-02-19 02:38:04 < jaake (~h4ckm3@129.59.122.17) has quit (Ping timeout: 255 seconds)
2016-02-19 02:43:45 < jherrmann (jirkah@nat/redhat/x-syqjyupnefmitnws) has quit (Ping timeout: 250 seconds)
2016-02-19 02:43:45 [02:43]
2016-02-19 02:45:18 < TraceyC (~TraceyC@208.74.121.106) has quit (Quit: Off I go into the wild, blue yonder)
2016-02-19 02:51:00 [02:45]
2016-02-19 02:55:52 > jaake (~h4ckm3@129.59.122.17) has joined #linuxvoice
2016-02-19 02:56:47 > jherrmann (jirkah@nat/redhat/x-wegvualavjmdunzs) has joined #linuxvoice
2016-02-19 03:02:00 [02:56]
2016-02-19 03:11:36 < mnavrati (milan@nat/redhat/x-lslyncabqwzckbnt) has quit (Quit: Leaving)
2016-02-19 03:17:00 [03:11]
2016-02-19 03:21:14 > mnavrati (milan@nat/redhat/x-lplqsdqmqatjanhn) has joined #linuxvoice
2016-02-19 03:27:00 [03:21]
2016-02-19 03:37:29 < Arthur_D (~magne@ti0024a400-1474.bb.online.no) has quit (Ping timeout: 240 seconds)
2016-02-19 03:43:00 [03:37]
2016-02-19 03:43:48 > Arthur_D (~magne@ti0024a400-1474.bb.online.no) has joined #linuxvoice
2016-02-19 03:49:00 [03:43]
2016-02-19 03:49:51 < AdamDBrown (~Thunderbi@233.114-240-116.dynamic.dsl.pth.iprimus.net.au) has quit (Quit: AdamDBrown)
2016-02-19 03:55:00 [03:49]
2016-02-19 03:56:41 - foxhunt72 is now known as foxhunt_away
2016-02-19 04:01:48 < TwistedLucidity (~TwistedLu@cpc80671-stap13-2-0-cust118.12-2.cable.virginm.net) has quit (Quit: Konversation terminated!)
2016-02-19 04:04:41 < bdmc (bdmc@cl-745.bos-01.us.sixxs.net) has quit (Ping timeout: 268 seconds)
2016-02-19 04:06:13 > bdmc (bdmc@cl-745.bos-01.us.sixxs.net) has joined #linuxvoice
2016-02-19 04:07:35 > M1C4HTRON13 (~micah@bodhilinux/team/M1C4HTRON13) has joined #linuxvoice
2016-02-19 04:07:38 < Guest53111 (~Thunderbi@te6compton.te.rl.ac.uk) has quit (Ping timeout: 240 seconds)
2016-02-19 04:13:00 [04:07]
2016-02-19 04:15:16 - irc: disconnected from server
2016-02-19 04:15:41 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-02-19 04:15:41 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-02-19 04:15:41 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-02-19 04:15:41 - Channel #linuxvoice: 78 nicks (1 op, 0 voices, 77 normals)
2016-02-19 04:15:55 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-02-19 04:20:43 vertreko https://www.washingtonpost.com/posteverything/wp/2016/02/18/why-you-should-side-with-apple-not-the-fbi-in-the-san-bernardino-iphone-case/
2016-02-19 04:20:49 > writtenoff (~writtenof@of1.psych.ubc.ca) has joined #linuxvoice
2016-02-19 04:25:57 < andybalaam (andybalaam@nat/ibm/x-gntqdrdzknkkslpr) has quit (Remote host closed the connection)
2016-02-19 04:31:00 [04:25]
2016-02-19 04:46:42 < jaake (~h4ckm3@129.59.122.17) has quit (Ping timeout: 276 seconds)
2016-02-19 04:46:42 [04:46]
2016-02-19 05:03:25 < M1C4HTRON13 (~micah@bodhilinux/team/M1C4HTRON13) has quit (Ping timeout: 255 seconds)
2016-02-19 05:03:25 [05:03]
2016-02-19 05:13:20 > georgeowell (~georgeowe@95.149.192.154) has joined #linuxvoice
2016-02-19 05:19:00 [05:13]
2016-02-19 05:20:28 > asusk7m550 (~Thunderbi@2001:981:97b3:1:9d5d:720f:b004:bfd6) has joined #linuxvoice
2016-02-19 05:20:45 > jaake (~h4ckm3@129.59.122.17) has joined #linuxvoice
2016-02-19 05:24:33 < Arthur_D (~magne@ti0024a400-1474.bb.online.no) has quit (Ping timeout: 240 seconds)
2016-02-19 05:30:00 [05:24]
2016-02-19 05:35:13 > TraceyC (~TraceyC@208.74.121.106) has joined #linuxvoice
2016-02-19 05:40:08 > Arthur_D (~magne@ti0024a400-1474.bb.online.no) has joined #linuxvoice
2016-02-19 05:43:59 > M1C4HTRON13 (~micah@bodhilinux/team/M1C4HTRON13) has joined #linuxvoice
2016-02-19 05:48:09 mcphail Ooh - this looks nice: http://www.worldofspectrum.org/forums/discussion/52113/zx-spectrum-vega-plus
2016-02-19 05:48:09 [05:48]
2016-02-19 05:52:21 > towy71 (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has joined #linuxvoice
2016-02-19 05:54:49 < towy71_ (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has quit (Ping timeout: 240 seconds)
2016-02-19 06:00:00 [05:54]
2016-02-19 06:00:05 james_olympus There have been a couple of similar consoles, none Spectrum-specific though
2016-02-19 06:02:29 < johnlane (~john@212.159.104.145) has left #linuxvoice
2016-02-19 06:03:15 mcphail I love a bit of Rick Dickinson computer design
2016-02-19 06:09:00 [06:03]
2016-02-19 06:11:32 < blahdeblah (~quassel@unaffiliated/blahdeblah) has quit (Ping timeout: 248 seconds)
2016-02-19 06:13:01 < mnavrati (milan@nat/redhat/x-lplqsdqmqatjanhn) has quit (Quit: Leaving)
2016-02-19 06:13:44 > mnavrati (milan@nat/redhat/x-hhfjcqccylpamfsc) has joined #linuxvoice
2016-02-19 06:16:12 > blahdeblah (~quassel@unaffiliated/blahdeblah) has joined #linuxvoice
2016-02-19 06:22:00 [06:16]
2016-02-19 06:40:57 < Arthur_D (~magne@ti0024a400-1474.bb.online.no) has quit (Quit: Leaving)
2016-02-19 06:40:57 [06:40]
2016-02-19 07:09:39 > zmoylan-1i (~pi@109.79.84.168) has joined #linuxvoice
2016-02-19 07:09:39 [07:09]
2016-02-19 07:10:05 > theru_ (~theru@theru.org) has joined #linuxvoice
2016-02-19 07:10:18 > mnavrati_ (milan@nat/redhat/x-bkprdhxltvrgnjpj) has joined #linuxvoice
2016-02-19 07:12:02 < zmoylan-pi (~pi@109.79.84.168) has quit (Ping timeout: 255 seconds)
2016-02-19 07:12:02 < mnavrati (milan@nat/redhat/x-hhfjcqccylpamfsc) has quit (Ping timeout: 255 seconds)
2016-02-19 07:12:02 < theru (~theru@theru.org) has quit (Ping timeout: 255 seconds)
2016-02-19 07:18:00 [07:12]
2016-02-19 07:18:31 > SuperEngineer (~SuperEngi@host86-162-231-213.range86-162.btcentralplus.com) has joined #linuxvoice
2016-02-19 07:24:00 [07:18]
2016-02-19 07:43:39 > LauRoman (~LauRoman@5-14-39-31.residential.rdsnet.ro) has joined #linuxvoice
2016-02-19 07:43:39 [07:43]
2016-02-19 07:45:08 < jherrmann (jirkah@nat/redhat/x-wegvualavjmdunzs) has quit (Quit: Toodle pip!)
2016-02-19 07:46:07 > charlesay (~daro3@ip5f5bf53f.dynamic.kabel-deutschland.de) has joined #linuxvoice
2016-02-19 07:51:10 - zmoylan-1i is now known as zmoylan-pi
2016-02-19 07:55:30 > NYbill (~bill@104.236.1.137) has joined #linuxvoice
2016-02-19 08:01:00 [07:55]
2016-02-19 08:04:36 < TraceyC (~TraceyC@208.74.121.106) has quit (Quit: Off I go into the wild, blue yonder)
2016-02-19 08:07:17 < SuperEngineer (~SuperEngi@host86-162-231-213.range86-162.btcentralplus.com) has quit (Quit: bfn...my planet needs me back)
2016-02-19 08:08:40 < mnavrati_ (milan@nat/redhat/x-bkprdhxltvrgnjpj) has quit (Quit: Leaving)
2016-02-19 08:14:00 [08:08]
2016-02-19 08:16:03 < jaake (~h4ckm3@129.59.122.17) has quit (Ping timeout: 240 seconds)
2016-02-19 08:22:00 [08:16]
2016-02-19 08:29:21 > JoeRess (~yaaic@cpc16-mort6-2-0-cust250.19-2.cable.virginm.net) has joined #linuxvoice
2016-02-19 08:31:05 > JoeRess2 (~joe@cpc16-mort6-2-0-cust250.19-2.cable.virginm.net) has joined #linuxvoice
2016-02-19 08:31:23 < JoeRess (~yaaic@cpc16-mort6-2-0-cust250.19-2.cable.virginm.net) has quit (Client Quit)
2016-02-19 08:31:29 - JoeRess2 is now known as JoeRess
2016-02-19 08:31:36 JoeRess you here, degville?
2016-02-19 08:33:07 JoeRess Oh well. If you see this (or someone is kind enough to copy/paste) I've come to suggest that you go on Linux Unplugged
2016-02-19 08:34:04 JoeRess apart from being a fun an interesting experience where you get to talk to other Linux nerds it's also a great platform to promote Beep Beep Yarr
2016-02-19 08:34:51 JoeRess @wimpress on twitter can help you out with details of the Mumble server etc
2016-02-19 08:35:13 Ioangogo|sleep http://www.bbc.co.uk/news/uk-scotland-glasgow-west-35603675 Computer Misuse Act 1990 has become silly, it allows acusations with no proof
2016-02-19 08:35:33 zmoylan-pi how very cardassian
2016-02-19 08:37:28 < JoeRess (~joe@cpc16-mort6-2-0-cust250.19-2.cable.virginm.net) has quit (Quit: Leaving.)
2016-02-19 08:37:28 [08:37]
2016-02-19 09:00:07 < charlesay (~daro3@ip5f5bf53f.dynamic.kabel-deutschland.de) has quit (Quit: leaving)
2016-02-19 09:00:07 [09:00]
2016-02-19 09:02:23 > charlesay (~daro3@ip5f5bf53f.dynamic.kabel-deutschland.de) has joined #linuxvoice
2016-02-19 09:05:42 > anglic00 (~james____@81-86-151-146.dsl.pipex.com) has joined #linuxvoice
2016-02-19 09:11:00 [09:05]
2016-02-19 09:30:35 > BarcTecho (~BarcTecho@213.123.41.146) has joined #linuxvoice
2016-02-19 09:30:35 [09:30]
2016-02-19 09:33:25 @degville thanks JoeRess.
2016-02-19 09:34:39 Ioangogo|sleep Brought one of these http://rasp.io/gpioruler/
2016-02-19 09:40:00 [09:34]
2016-02-19 09:41:41 > B0rkedBear (~B0rkedBea@92.237.228.63) has joined #linuxvoice
2016-02-19 09:43:50 < B0rkedBear (~B0rkedBea@92.237.228.63) has left #linuxvoice
2016-02-19 09:44:51 < asusk7m550 (~Thunderbi@2001:981:97b3:1:9d5d:720f:b004:bfd6) has quit (Quit: asusk7m550)
2016-02-19 09:45:16 > mnavrati (~milan@ip-94-113-220-233.net.upcbroadband.cz) has joined #linuxvoice
2016-02-19 09:46:18 charlesay hi, does anyone know (where to read about) how to mount an encrypted volume in a live session to chroot into it?
2016-02-19 09:50:35 < BarcTecho (~BarcTecho@213.123.41.146) has quit (Ping timeout: 250 seconds)
2016-02-19 09:56:00 [09:50]
2016-02-19 10:00:19 < gb00s (~gb00s@c50-31.i07-13.onvol.net) has quit (Quit: Leaving)
2016-02-19 10:02:29 < M1C4HTRON13 (~micah@bodhilinux/team/M1C4HTRON13) has quit (Quit: Leaving)
2016-02-19 10:03:07 < anglic00 (~james____@81-86-151-146.dsl.pipex.com) has quit (Remote host closed the connection)
2016-02-19 10:07:42 < blahdeblah (~quassel@unaffiliated/blahdeblah) has quit (Read error: Connection reset by peer)
2016-02-19 10:13:00 [10:07]
2016-02-19 10:25:19 < ideasman42 (~cambo@124-170-60-116.dyn.iinet.net.au) has quit (Quit: Ex-Chat)
2016-02-19 10:31:00 [10:25]
2016-02-19 10:32:33 - irc: disconnected from server
2016-02-19 10:32:44 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-02-19 10:32:44 [10:32]
2016-02-19 10:32:44 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-02-19 10:32:44 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-02-19 10:32:44 - Channel #linuxvoice: 74 nicks (1 op, 0 voices, 73 normals)
2016-02-19 10:32:54 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-02-19 10:33:23 > blahdeblah (~quassel@unaffiliated/blahdeblah) has joined #linuxvoice
2016-02-19 10:39:00 [10:33]
2016-02-19 10:43:49 > Arthur_D (~magne@195.1.125.245) has joined #linuxvoice
2016-02-19 10:49:00 [10:43]
2016-02-19 11:09:33 < mavrix (~mavrix@unaffiliated/mavrix) has quit (Ping timeout: 276 seconds)
2016-02-19 11:09:33 [11:09]
2016-02-19 11:11:28 > mavrix (~mavrix@unaffiliated/mavrix) has joined #linuxvoice
2016-02-19 11:17:00 [11:11]
2016-02-19 11:28:22 > BarcTecho (~BarcTecho@213.123.41.146) has joined #linuxvoice
2016-02-19 11:34:00 [11:28]
2016-02-19 11:57:13 < BarcTecho (~BarcTecho@213.123.41.146) has quit (Ping timeout: 240 seconds)
2016-02-19 11:57:13 [11:57]
2016-02-19 12:02:28 > BarcTecho (~BarcTecho@213.123.41.146) has joined #linuxvoice
2016-02-19 12:08:00 [12:02]
2016-02-19 12:12:41 < BarcTecho (~BarcTecho@213.123.41.146) has quit (Ping timeout: 276 seconds)
2016-02-19 12:16:45 > BarcTecho (~BarcTecho@213.123.41.146) has joined #linuxvoice
2016-02-19 12:19:50 < writtenoff (~writtenof@of1.psych.ubc.ca) has quit (Quit: WeeChat 1.3)
2016-02-19 12:25:00 [12:19]
2016-02-19 12:43:46 > HEGX64 (~Scott@CPE-1-123-139-55.sml9.way.bigpond.net.au) has joined #linuxvoice
2016-02-19 12:43:46 [12:43]
2016-02-19 13:05:24 > jaake (~jaake@c-68-52-45-79.hsd1.tn.comcast.net) has joined #linuxvoice
2016-02-19 13:05:24 [13:05]
2016-02-19 13:56:11 > chemist69 (~apl@a89-182-60-153.net-htp.de) has joined #linuxvoice
2016-02-19 13:56:11 [13:56]
2016-02-19 13:59:19 < chemist69_ (~apl@a89-182-45-153.net-htp.de) has quit (Ping timeout: 250 seconds)
2016-02-19 14:02:40 < draake (~h4ckm3@68.52.45.79) has quit (Quit: WeeChat 1.4)
2016-02-19 14:08:00 [14:02]
2016-02-19 14:59:35 < jaake (~jaake@c-68-52-45-79.hsd1.tn.comcast.net) has quit (Quit: WeeChat 1.4)
2016-02-19 14:59:35 [14:59]
2016-02-19 15:15:37 < topcyde (~topcyde@2602:304:cdb8:9e40:9947:174:352e:d07c) has quit (Ping timeout: 240 seconds)
2016-02-19 15:15:37 [15:15]
2016-02-19 15:37:37 < mavrix (~mavrix@unaffiliated/mavrix) has quit (Ping timeout: 240 seconds)
2016-02-19 15:37:37 [15:37]
2016-02-19 15:38:47 > mavrix (~mavrix@unaffiliated/mavrix) has joined #linuxvoice
2016-02-19 15:44:00 [15:38]
2016-02-19 16:03:41 < zmoylan-pi (~pi@109.79.84.168) has quit (Ping timeout: 250 seconds)
2016-02-19 16:03:41 [16:03]
2016-02-19 16:08:17 > zmoylan-pi (~pi@109.79.178.47) has joined #linuxvoice
2016-02-19 16:14:00 [16:08]
2016-02-19 16:46:37 - irc: disconnected from server
2016-02-19 16:46:37 [16:46]
2016-02-19 17:58:37 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-02-19 17:58:37 [17:58]
2016-02-19 17:58:37 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-02-19 17:58:37 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-02-19 17:58:37 - Channel #linuxvoice: 73 nicks (1 op, 0 voices, 72 normals)
2016-02-19 17:58:47 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-02-19 17:58:53 - irc: disconnected from server
2016-02-20 00:57:09 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-02-20 00:57:09 [00:57]
2016-02-20 00:57:09 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-02-20 00:57:09 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-02-20 00:57:09 - Channel #linuxvoice: 77 nicks (1 op, 0 voices, 76 normals)
2016-02-20 00:57:18 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-02-20 00:57:28 > jaake (~h4ckm3@129.59.122.17) has joined #linuxvoice
2016-02-20 00:59:34 > Ian1 (~Thunderbi@te6compton.te.rl.ac.uk) has joined #linuxvoice
2016-02-20 01:00:01 anglic00 signed up for a few of the arch mailing lists this week
2016-02-20 01:01:03 * zmoylan-pi wonders if there's an os/2 user group still active... :-)
2016-02-20 01:06:51 < brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has quit (Quit: Konversation terminated!)
2016-02-20 01:10:26 Devilment zmoylan-pi: Probably a few Warped individuals...
2016-02-20 01:16:00 [01:10]
2016-02-20 01:28:46 zmoylan-pi i think there was a release post warp, klingon i think...
2016-02-20 01:28:56 anglic00 I know nothing of os/2 just that I would always see options for it in bios
2016-02-20 01:32:06 Devilment Half an OS
2016-02-20 01:32:06 [01:32]
2016-02-20 01:32:59 zmoylan-pi rock solid os that ran atms for ages as it was bulletproof ignored the malware written for all the popular oses...
2016-02-20 01:33:02 Devilment We used to use OS/2 Warp on our company's PCs back in 1995
2016-02-20 01:33:22 Devilment Then we switched over to Win95
2016-02-20 01:33:34 Devilment Or was it NT4
2016-02-20 01:34:53 zmoylan-pi probably 95 for the reliability... :-P
2016-02-20 01:40:00 [01:34]
2016-02-20 01:43:53 anglic00 i had a windows atm crash on me once and take my card when i was about 14
2016-02-20 01:46:38 zmoylan-pi wouldn't have happened on os/2, just drop you to a terminal, edit the config.sys... bing bang bosh a quick reboot and continue... :-)
2016-02-20 01:47:48 Devilment I'm surprised these days when Windows 7 BSoDs
2016-02-20 01:48:32 zmoylan-pi that doesn't happen, ms marketing said it doesn't...
2016-02-20 01:48:58 Devilment To be fair, a BSoD is a very rare event these days
2016-02-20 01:49:22 Devilment Usually faulty RAM
2016-02-20 01:49:26 zmoylan-pi well i use windows so rarely these days that part is easy... :-)
2016-02-20 01:50:45 Devilment A Colonel Panic on Linux is even rarer (outside of cutting edge development) but on the extremely rare occassions it happens, it's like being bitten by a aithful dog
2016-02-20 01:50:49 Devilment faithful
2016-02-20 01:51:07 anglic00 lol
2016-02-20 01:51:11 < anglic00 (~james____@mail2.gforces.co.uk) has quit (Quit: Leaving)
2016-02-20 01:57:00 [01:51]
2016-02-20 02:04:54 > asusk7m550 (~Thunderbi@2001:981:97b3:1:8c6b:46c9:e0cc:d889) has joined #linuxvoice
2016-02-20 02:05:33 < Arthur_D (~magne@195.1.125.245) has quit (Quit: Leaving)
2016-02-20 02:11:00 [02:05]
2016-02-20 02:19:10 < jaake (~h4ckm3@129.59.122.17) has quit (Ping timeout: 255 seconds)
2016-02-20 02:25:00 [02:19]
2016-02-20 02:27:07 < georgeowell (~georgeowe@95.149.192.154) has quit (Quit: Leaving)
2016-02-20 02:29:22 > zmoylan-1i (~pi@109.79.178.47) has joined #linuxvoice
2016-02-20 02:29:53 < HEGX64 (~Scott@CPE-1-123-139-55.sml9.way.bigpond.net.au) has quit (Quit: Leaving)
2016-02-20 02:31:34 < zmoylan-pi (~pi@109.79.178.47) has quit (Ping timeout: 240 seconds)
2016-02-20 02:32:34 > jaake (~h4ckm3@129.59.122.17) has joined #linuxvoice
2016-02-20 02:35:37 - zmoylan-1i is now known as zmoylan-pi
2016-02-20 02:41:00 [02:35]
2016-02-20 02:58:22 < mnavrati (milan@nat/redhat/x-ixtyptwpqxkrtkff) has quit (Quit: Leaving)
2016-02-20 02:58:22 [02:58]
2016-02-20 03:09:34 > B0rkedBear (~chris@92.237.228.63) has joined #linuxvoice
2016-02-20 03:15:00 [03:09]
2016-02-20 03:16:56 < B0rkedBear (~chris@92.237.228.63) has left #linuxvoice ("WeeChat 1.3")
2016-02-20 03:22:00 [03:16]
2016-02-20 03:27:59 > ideasman42 (~cambo@114-198-13-nwork.dyn.iinet.net.au) has joined #linuxvoice
2016-02-20 03:32:54 - foxhunt72 is now known as foxhunt_away
2016-02-20 03:35:44 > writtenoff (~writtenof@of1.psych.ubc.ca) has joined #linuxvoice
2016-02-20 03:41:00 [03:35]
2016-02-20 03:59:55 > bdmc (bdmc@cl-745.bos-01.us.sixxs.net) has joined #linuxvoice
2016-02-20 03:59:55 [03:59]
2016-02-20 04:00:28 < jherrmann (jirkah@nat/redhat/x-pwzrunxlqekrxhut) has quit (Quit: Toodle pip!)
2016-02-20 04:01:38 > swift110-phone (~swift110-@unaffiliated/swift110) has joined #linuxvoice
2016-02-20 04:01:42 swift110-phone Hey
2016-02-20 04:02:52 mcphail hi swift110-phone
2016-02-20 04:03:11 swift110-phone How r u mcphail
2016-02-20 04:03:29 mcphail swift110-phone: good. you?
2016-02-20 04:03:47 swift110-phone Good
2016-02-20 04:03:56 swift110-phone What ya up too
2016-02-20 04:04:30 mcphail Avoiding housework. Supposed to be cleaning the kitchen but ended up binging on Limmy's show sketches on youtube
2016-02-20 04:04:42 swift110-phone Oh ok
2016-02-20 04:06:16 swift110-phone I finally did another blog
2016-02-20 04:08:34 < jaake (~h4ckm3@129.59.122.17) has quit (Ping timeout: 240 seconds)
2016-02-20 04:10:26 Devilment 20 minutes to the weekend
2016-02-20 04:11:00 Devilment Where I have the exciting choice of cleaning or Spring cleaning
2016-02-20 04:13:01 < Ian1 (~Thunderbi@te6compton.te.rl.ac.uk) has quit (Ping timeout: 255 seconds)
2016-02-20 04:14:13 < Aikidokajeff (~Thunderbi@213.106.248.240) has quit (Quit: Aikidokajeff)
2016-02-20 04:14:43 < andybalaam (andybalaam@nat/ibm/x-szpmlkcjhrevqbje) has quit (Remote host closed the connection)
2016-02-20 04:20:00 [04:14]
2016-02-20 04:20:59 > Nitronium (~Dave@host109-156-178-255.range109-156.btcentralplus.com) has joined #linuxvoice
2016-02-20 04:26:00 [04:20]
2016-02-20 04:30:32 > jaake (~h4ckm3@129.59.122.17) has joined #linuxvoice
2016-02-20 04:33:17 < jimbotux (~jimbotux@fpc3-sgyl30-2-0-cust5.18-2.static.cable.virginm.net) has quit (Quit: Leaving)
2016-02-20 04:37:56 Devilment http://www.theregister.co.uk/2016/02/19/three_network_level_ads_blocking/
2016-02-20 04:43:00 [04:37]
2016-02-20 05:00:34 < jaake (~h4ckm3@129.59.122.17) has quit (Ping timeout: 240 seconds)
2016-02-20 05:00:34 [05:00]
2016-02-20 05:13:43 popey mcphail: here? :)
2016-02-20 05:13:59 mcphail popey: why not...!
2016-02-20 05:14:02 popey 😃
2016-02-20 05:14:11 mcphail http://insights.ubuntu.com/2016/02/18/zfs-licensing-and-linux/ - that is sailing pretty close to the wind. To state that a kernel object is not a derivative work of the kernel is _one_ interpretation
2016-02-20 05:16:53 mcphail Now, my understanding is it is the GPL, rather than the CDDL, which forbids ZFS as a kernel module. Nvidia attempt to bypass this by providing a shim which the user compiles themselves between non-GPL compliant code and the kernel. Is there going to be a similar dkms'ed shim layer here?
2016-02-20 05:16:53 [05:16]
2016-02-20 05:18:33 mcphail The google/oracle stushie already points to the header files falling under copyright (hence licence) of the original work, so using the kernel header files (to my mind) makes a module a derivative work
2016-02-20 05:21:04 * mcphail thinks that even if Canonical are correct here, there FUD surrounding the issue is not going to attract business
2016-02-20 05:25:34 < aptanet (~quassel@87-127-190-17.static.enta.net) has quit (*.net *.split)
2016-02-20 05:25:34 < Dave (~dave@freenode/staff/dave2) has quit (*.net *.split)
2016-02-20 05:25:35 < docapotamus (~pjuu@178.62.80.244) has quit (*.net *.split)
2016-02-20 05:25:35 < grifferz (~andy@bitfolk.com) has quit (*.net *.split)
2016-02-20 05:25:37 < matthew1471_ (~matthew14@194.74.188.133) has quit (*.net *.split)
2016-02-20 05:25:37 < FiftyOneFifty_ (~quassel@159.203.105.139) has quit (*.net *.split)
2016-02-20 05:25:37 < russor (~rw@188.166.11.128) has quit (*.net *.split)
2016-02-20 05:25:37 < rochelimit (~gcthomas@glencthomas.plus.com) has quit (*.net *.split)
2016-02-20 05:25:45 > FiftyOneFifty (~quassel@159.203.105.139) has joined #linuxvoice
2016-02-20 05:25:46 > grifferz (~andy@bitfolk.com) has joined #linuxvoice
2016-02-20 05:25:49 > aptanet (~quassel@humpback.aptanet.net) has joined #linuxvoice
2016-02-20 05:25:58 > russor (~rw@188.166.11.128) has joined #linuxvoice
2016-02-20 05:26:02 > docapotamus (~pjuu@cloudev.pjuu.net) has joined #linuxvoice
2016-02-20 05:26:08 > matthew1471_ (~matthew14@194.74.188.133) has joined #linuxvoice
2016-02-20 05:26:13 > Dave_____ (~dave@freenode/staff/dave2) has joined #linuxvoice
2016-02-20 05:26:13 > charlesay (~daro3@77.87.49.15) has joined #linuxvoice
2016-02-20 05:26:15 > rochelimit (~gcthomas@glencthomas.plus.com) has joined #linuxvoice
2016-02-20 05:26:32 mcphail degville: any chance you could ask Simon Phipps for his views on this for the mag? ^^
2016-02-20 05:27:27 < russor (~rw@188.166.11.128) has quit (*.net *.split)
2016-02-20 05:27:28 < amoe (~amoe@li195-121.members.linode.com) has quit (*.net *.split)
2016-02-20 05:27:28 < Devilment (~david@cpc1-jarr13-2-0-cust241.16-2.cable.virginm.net) has quit (*.net *.split)
2016-02-20 05:27:35 > Devilmen1 (~david@cpc1-jarr13-2-0-cust241.16-2.cable.virginm.net) has joined #linuxvoice
2016-02-20 05:27:39 > amoe (~amoe@li195-121.members.linode.com) has joined #linuxvoice
2016-02-20 05:27:49 > russor (~rw@188.166.11.128) has joined #linuxvoice
2016-02-20 05:28:34 popey mcphail: he commented on one of Dustin's posts on G+
2016-02-20 05:28:44 popey didn't give much of a reply, but a bit of one
2016-02-20 05:30:27 popey https://plus.google.com/u/0/+DustinKirkland/posts/ccaUAFZYL68
2016-02-20 05:31:44 mcphail popey: ta. I always struggle with the G+ interface. See he is playing his cards close to his chest
2016-02-20 05:31:51 popey yeah
2016-02-20 05:32:58 popey I have no idea what legal eagles Canonical spoke to. It's an interesting position.
2016-02-20 05:32:58 [05:32]
2016-02-20 05:33:25 mcphail I don't know why Canonical do these things. It always causes so much of a distraction, and diverts them from more useful work.
2016-02-20 05:33:35 popey these things?
2016-02-20 05:33:41 popey What our customers ask for 😖
2016-02-20 05:34:11 mcphail Actions which are questionable (at best) to the community.
2016-02-20 05:35:27 mcphail It is particulary sad, because the future of ZFS in any context is becoming fuzzy. It isn't clear how much impetus Oracle are putting behind it
2016-02-20 05:36:20 mcphail Technically, it is a good solution just now for certain cases. But growing/developing btrfs surely has to be the preferred option in the long run
2016-02-20 05:36:39 popey we already have btrfs, it's been in ubuntu for aeons
2016-02-20 05:36:44 popey but it's just not stable
2016-02-20 05:36:49 > callumd (~callumd@gmdltd.plus.com) has joined #linuxvoice
2016-02-20 05:36:50 popey Not a lot _we_ can do about that
2016-02-20 05:37:07 popey I mean, SUSE have it as the default FS on their installs, but they have staff who work on btrfs (AIUI)
2016-02-20 05:37:26 popey we don't have any btrfs skills in house (not that we have zfs skills AFAIK)
2016-02-20 05:38:03 popey I love btrfs, but it seems the wider free software community has spoken and zfs is the annointed one
2016-02-20 05:38:56 mcphail Well, I suspect this is going to be painful
2016-02-20 05:44:00 [05:38]
2016-02-20 05:44:56 < evilnickveitch (~evilnick@cpc83321-bath6-2-0-cust252.18-1.cable.virginm.net) has quit (Quit: Leaving)
2016-02-20 05:48:46 > jaake (~h4ckm3@129.59.122.17) has joined #linuxvoice
2016-02-20 05:54:00 [05:48]
2016-02-20 05:55:04 < callumd (~callumd@gmdltd.plus.com) has quit (Ping timeout: 240 seconds)
2016-02-20 06:01:00 [05:55]
2016-02-20 06:01:08 - Devilmen1 is now known as Devilment
2016-02-20 06:07:00 [06:01]
2016-02-20 06:30:12 < writtenoff (~writtenof@of1.psych.ubc.ca) has quit (Quit: WeeChat 1.3)
2016-02-20 06:30:12 [06:30]
2016-02-20 06:30:32 > writtenoff (~writtenof@of1.psych.ubc.ca) has joined #linuxvoice
2016-02-20 06:36:00 [06:30]
2016-02-20 06:39:43 < swift110-phone (~swift110-@unaffiliated/swift110) has quit (Ping timeout: 255 seconds)
2016-02-20 06:42:03 > swift110-phone (~swift110-@unaffiliated/swift110) has joined #linuxvoice
2016-02-20 06:44:45 < torwag (~torsten@DHCP156.juelich9.fh-aachen.de) has quit (Remote host closed the connection)
2016-02-20 06:46:27 < gregoriosw_vp (~gregorios@176.126.244.125) has quit (Quit: WeeChat 1.4)
2016-02-20 06:46:48 > gregoriosw_vp (~gregorios@176.126.244.125) has joined #linuxvoice
2016-02-20 06:47:08 > SuperEngineer (~SuperEngi@host86-162-231-213.range86-162.btcentralplus.com) has joined #linuxvoice
2016-02-20 06:47:22 < gregoriosw_vp (~gregorios@176.126.244.125) has quit (Client Quit)
2016-02-20 06:47:41 > gregoriosw_vp (~gregorios@176.126.244.125) has joined #linuxvoice
2016-02-20 06:49:57 < g0nz085 (~gonzo@cpc81199-farn9-2-0-cust619.6-2.cable.virginm.net) has quit (Ping timeout: 276 seconds)
2016-02-20 06:53:40 < chemist69 (~apl@a89-182-60-153.net-htp.de) has quit (Quit: WeeChat 1.4)
2016-02-20 06:53:40 [06:53]
2016-02-20 06:57:48 einonm A $(prev employer) used to have a load of proprietary drivers released under the 'other-os-developed' GPL exception. It's a massive pain, as you can't use a lot of kernel functionality within the other code. And it also has the side affect of no one other than the company that 'owns' the other code actually works on those kernels - which I assume is the state Canonical is already in, as there's bugger all 'community' development of ubuntu kernels anyway
2016-02-20 06:58:00 > chemist69 (~apl@a89-182-60-153.net-htp.de) has joined #linuxvoice
2016-02-20 07:00:22 einonm result is, kernels that are developed proprietary-style that are of poorer quality, because no one company can keep up with the pace of kernel development. Best of luck with that.
2016-02-20 07:06:00 [07:00]
2016-02-20 07:08:14 < gregoriosw_vp (~gregorios@176.126.244.125) has quit (Quit: WeeChat 1.4)
2016-02-20 07:08:29 > gregoriosw_vp (~gregorios@176.126.244.125) has joined #linuxvoice
2016-02-20 07:13:14 - Dave_____ is now known as Dave
2016-02-20 07:19:00 [07:13]
2016-02-20 07:42:57 swift110-phone Hey guys
2016-02-20 07:42:57 [07:42]
2016-02-20 07:45:07 > B0rkedBear (~chris@92.237.228.63) has joined #linuxvoice
2016-02-20 07:49:11 < B0rkedBear (~chris@92.237.228.63) has left #linuxvoice
2016-02-20 07:49:45 > LauRoman (~LauRoman@5-14-39-31.residential.rdsnet.ro) has joined #linuxvoice
2016-02-20 07:55:00 [07:49]
2016-02-20 07:55:34 < jaake (~h4ckm3@129.59.122.17) has quit (Ping timeout: 252 seconds)
2016-02-20 08:01:00 [07:55]
2016-02-20 08:08:47 - foxhunt_away is now known as foxhunt72
2016-02-20 08:14:00 [08:08]
2016-02-20 08:37:29 < charlesay (~daro3@77.87.49.15) has quit (Ping timeout: 240 seconds)
2016-02-20 08:37:29 [08:37]
2016-02-20 08:42:12 < SuperEngineer (~SuperEngi@host86-162-231-213.range86-162.btcentralplus.com) has quit (Quit: bfn...my planet needs me back)
2016-02-20 08:48:00 [08:42]
2016-02-20 08:49:32 > brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has joined #linuxvoice
2016-02-20 08:55:00 [08:49]
2016-02-20 08:55:40 > charlesay (~daro3@77.87.49.15) has joined #linuxvoice
2016-02-20 09:01:00 [08:55]
2016-02-20 09:05:25 < writtenoff (~writtenof@of1.psych.ubc.ca) has quit (Quit: WeeChat 1.3)
2016-02-20 09:05:44 > writtenoff (~writtenof@of1.psych.ubc.ca) has joined #linuxvoice
2016-02-20 09:11:00 [09:05]
2016-02-20 09:14:51 < Nitronium (~Dave@host109-156-178-255.range109-156.btcentralplus.com) has quit (Remote host closed the connection)
2016-02-20 09:17:28 < asusk7m550 (~Thunderbi@2001:981:97b3:1:8c6b:46c9:e0cc:d889) has quit (Quit: asusk7m550)
2016-02-20 09:20:41 < swift110-phone (~swift110-@unaffiliated/swift110) has quit (Quit: See you later)
2016-02-20 09:21:31 < charlesay (~daro3@77.87.49.15) has quit (Ping timeout: 250 seconds)
2016-02-20 09:27:00 [09:21]
2016-02-20 09:33:57 > charlesay (~daro3@77.87.49.15) has joined #linuxvoice
2016-02-20 09:39:00 [09:33]
2016-02-20 09:42:31 < charlesay (~daro3@77.87.49.15) has quit (Ping timeout: 244 seconds)
2016-02-20 09:43:46 < mavrix (~mavrix@unaffiliated/mavrix) has quit (Ping timeout: 255 seconds)
2016-02-20 09:45:43 > mavrix (~mavrix@unaffiliated/mavrix) has joined #linuxvoice
2016-02-20 09:51:00 [09:45]
2016-02-20 10:02:13 > charlesay (~daro3@77.87.49.95) has joined #linuxvoice
2016-02-20 10:08:00 [10:02]
2016-02-20 10:09:53 < gb00s (~gb00s@c50-31.i07-13.onvol.net) has quit (Quit: Leaving)
2016-02-20 10:11:00 - foxhunt72 is now known as foxhunt_away
2016-02-20 10:16:00 [10:11]
2016-02-20 10:16:00 < charlesay (~daro3@77.87.49.95) has quit (Ping timeout: 276 seconds)
2016-02-20 10:51:32 < Ioangogo|sleep (~quassel@huwloosley.plus.com) has quit (Ping timeout: 248 seconds)
2016-02-20 10:51:32 [10:51]
2016-02-20 10:53:13 > Ioangogo (~quassel@huwloosley.plus.com) has joined #linuxvoice
2016-02-20 10:59:00 [10:53]
2016-02-20 11:01:17 > charlesay (~daro3@ip5f5bf553.dynamic.kabel-deutschland.de) has joined #linuxvoice
2016-02-20 11:07:00 [11:01]
2016-02-20 11:09:46 > Ioangogo|sleep (~quassel@huwloosley.plus.com) has joined #linuxvoice
2016-02-20 11:09:51 < Ioangogo (~quassel@huwloosley.plus.com) has quit (Read error: Connection reset by peer)
2016-02-20 11:15:00 [11:09]
2016-02-20 11:26:54 < mavrix (~mavrix@unaffiliated/mavrix) has quit (Ping timeout: 252 seconds)
2016-02-20 11:32:00 [11:26]
2016-02-20 11:33:21 > mavrix (~mavrix@unaffiliated/mavrix) has joined #linuxvoice
2016-02-20 11:34:09 - irc: disconnected from server
2016-02-20 15:55:30 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-02-20 15:55:30 [15:55]
2016-02-20 15:55:30 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-02-20 15:55:30 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-02-20 15:55:30 - Channel #linuxvoice: 67 nicks (1 op, 0 voices, 66 normals)
2016-02-20 15:55:39 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-02-20 16:01:00 [15:55]
2016-02-20 16:04:24 < zmoylan-pi (~pi@109.79.178.47) has quit (Ping timeout: 276 seconds)
2016-02-20 16:08:18 > zmoylan-pi (~pi@109.78.197.116) has joined #linuxvoice
2016-02-20 16:14:00 [16:08]
2016-02-20 16:16:33 > ideasman42 (~cambo@203-206-123-225.dyn.iinet.net.au) has joined #linuxvoice
2016-02-20 16:22:00 [16:16]
2016-02-20 16:41:17 > writtenoff (~writtenof@d172-218-204-26.bchsia.telus.net) has joined #linuxvoice
2016-02-20 16:41:17 [16:41]
2016-02-20 16:43:31 < HEGX64 (~Scott@CPE-1-123-139-55.sml9.way.bigpond.net.au) has quit (Read error: Connection reset by peer)
2016-02-20 16:49:00 [16:43]
2016-02-20 18:09:20 > SuperEngineer (~SuperEngi@host86-162-231-213.range86-162.btcentralplus.com) has joined #linuxvoice
2016-02-20 18:09:20 [18:09]
2016-02-20 18:55:24 > HEGX64 (~Scott@CPE-1-123-139-55.sml9.way.bigpond.net.au) has joined #linuxvoice
2016-02-20 18:55:24 [18:55]
2016-02-20 19:11:21 > charlesay (~daro3@ip5f5bf553.dynamic.kabel-deutschland.de) has joined #linuxvoice
2016-02-20 19:11:21 [19:11]
2016-02-20 20:05:42 - irc: disconnected from server
2016-02-20 20:05:42 [20:05]
2016-02-20 20:05:54 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-02-20 20:05:54 [20:05]
2016-02-20 20:05:54 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-02-20 20:05:54 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-02-20 20:05:54 - Channel #linuxvoice: 71 nicks (1 op, 0 voices, 70 normals)
2016-02-20 20:06:04 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-02-20 20:10:52 > LauRoman (~LauRoman@5-14-39-31.residential.rdsnet.ro) has joined #linuxvoice
2016-02-20 20:11:40 < SuperEngineer (~SuperEngi@host86-162-231-213.range86-162.btcentralplus.com) has quit (Quit: bfn...my planet needs me back)
2016-02-20 20:13:28 - irc: disconnected from server
2016-02-20 20:13:47 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-02-20 20:13:47 [20:13]
2016-02-20 20:13:47 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-02-20 20:13:47 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-02-20 20:13:47 - Channel #linuxvoice: 71 nicks (1 op, 0 voices, 70 normals)
2016-02-20 20:13:57 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-02-20 20:14:25 - ideasman42 is now known as ideasman42afk
2016-02-20 20:20:00 [20:14]
2016-02-20 21:43:49 < HEGX64 (~Scott@CPE-1-123-139-55.sml9.way.bigpond.net.au) has quit (Quit: Leaving)
2016-02-20 21:43:49 [21:43]
2016-02-20 22:46:12 - foxhunt_away is now known as foxhunt72
2016-02-20 22:46:12 [22:46]
2016-02-20 23:13:50 - foxhunt72 is now known as foxhunt_away
2016-02-20 23:13:50 [23:13]
2016-02-20 23:22:28 < charlesay (~daro3@ip5f5bf553.dynamic.kabel-deutschland.de) has quit (Ping timeout: 244 seconds)
2016-02-20 23:28:00 [23:22]
2016-02-20 23:30:27 - ideasman42afk is now known as ideasman42
2016-02-20 23:36:00 [23:30]
2016-02-20 23:49:13 < ideasman42 (~cambo@203-206-123-225.dyn.iinet.net.au) has quit (Remote host closed the connection)
2016-02-20 23:50:55 < brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has quit (Quit: Konversation terminated!)
2016-02-20 23:56:00 [23:50]
2016-02-21 00:22:14 - theru_ is now known as theru
2016-02-21 00:22:14 [00:22]
2016-02-21 00:29:02 > AndChat|205625 (~gct@glencthomas.plus.com) has joined #linuxvoice
2016-02-21 00:29:29 < AndChat|205625 (~gct@glencthomas.plus.com) has left #linuxvoice
2016-02-21 00:31:53 > rochelimit_ (~gcthomas@glencthomas.plus.com) has joined #linuxvoice
2016-02-21 00:37:00 [00:31]
2016-02-21 00:45:07 - irc: disconnected from server
2016-02-21 00:45:28 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-02-21 00:45:28 [00:45]
2016-02-21 00:45:28 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-02-21 00:45:28 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-02-21 00:45:28 - Channel #linuxvoice: 68 nicks (1 op, 0 voices, 67 normals)
2016-02-21 00:45:38 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-02-21 00:51:00 [00:45]
2016-02-21 01:13:46 > rochelimit__ (~gcthomas@glencthomas.plus.com) has joined #linuxvoice
2016-02-21 01:13:46 [01:13]
2016-02-21 01:13:46 < rochelimit_ (~gcthomas@glencthomas.plus.com) has quit (Read error: Connection reset by peer)
2016-02-21 01:36:40 > charlesay (~daro3@ip5f5bf553.dynamic.kabel-deutschland.de) has joined #linuxvoice
2016-02-21 01:36:40 [01:36]
2016-02-21 01:44:12 > metasansana (~metasansa@190.213.225.135) has joined #linuxvoice
2016-02-21 01:44:12 < metasansana (~metasansa@190.213.225.135) has quit (Changing host)
2016-02-21 01:44:12 > metasansana (~metasansa@unaffiliated/metasansana) has joined #linuxvoice
2016-02-21 01:47:46 > SuperEngineer (~SuperEngi@host86-162-231-213.range86-162.btcentralplus.com) has joined #linuxvoice
2016-02-21 01:53:00 [01:47]
2016-02-21 02:16:17 - foxhunt_away is now known as foxhunt72
2016-02-21 02:16:17 [02:16]
2016-02-21 02:26:47 - foxhunt72 is now known as foxhunt_away
2016-02-21 02:32:00 [02:26]
2016-02-21 02:33:54 - foxhunt_away is now known as foxhunt72
2016-02-21 02:39:00 [02:33]
2016-02-21 03:17:20 - foxhunt72 is now known as foxhunt_away
2016-02-21 03:17:20 [03:17]
2016-02-21 03:26:10 - foxhunt_away is now known as foxhunt72
2016-02-21 03:32:00 [03:26]
2016-02-21 03:38:54 - foxhunt72 is now known as foxhunt_away
2016-02-21 03:44:00 [03:38]
2016-02-21 04:20:46 SuperEngineer thanks for all the away /not away notifies foxhunt_away / foxhunt72 [but really don't need to know]
2016-02-21 04:20:46 [04:20]
2016-02-21 04:22:02 * zmoylan-pi releases the hounds
2016-02-21 04:22:55 * SuperEngineer release the robots
2016-02-21 04:28:00 [04:22]
2016-02-21 04:34:07 Devilment I use autoaway.pl on irssi. It just sets me away, no nick change
2016-02-21 04:40:00 [04:34]
2016-02-21 04:43:25 SuperEngineer oh, if only all "offenders" did similar, Devilment
2016-02-21 04:46:05 SuperEngineer no names, no pack drill eh, foxhunt_away [& lcawte on #ubuntu-uk]... but no names, no pack drill. [/me chuckles]
2016-02-21 04:46:09 zmoylan-pi you can always mark them as ignored
2016-02-21 04:46:19 SuperEngineer [done!]
2016-02-21 04:48:54 SuperEngineer [but every now & then I "unignore"... & regret it!] ;-)
2016-02-21 04:49:30 Devilment I should use my hi-fi stack more often to listen to my music rather than my PC
2016-02-21 04:49:43 Devilment Been doing that this afternoon, far punchier
2016-02-21 04:50:16 Devilment Although, I'd accidentally turned the volume up to 11 when dusting
2016-02-21 04:50:33 Devilment It were a bit loud when the first track kicked in
2016-02-21 04:52:39 SuperEngineer So why turn it down? Temporary deafness is a very under rated result sometimes ;-)
2016-02-21 04:54:07 Devilment Amp is 68W, speakers are rated for 100W. Didn't want to clip and potentially damage driver coils
2016-02-21 04:54:40 Devilment Audiolab 8000S, very clean, very neutral amp
2016-02-21 04:55:20 zmoylan-pi my brother picked up an amp as a teenager that came with speakers the size of stools. when connected to his stereo and volume set to 3 it sounded like pub across road was having concert... :-)
2016-02-21 04:55:20 [04:55]
2016-02-21 04:56:58 Devilment My speakers are about 30 years old. Mission 762i
2016-02-21 04:57:13 Devilment They have the woofer over the tweeter
2016-02-21 04:57:25 Devilment Good bass on them
2016-02-21 04:57:48 * SuperEngineer keeps mouth shut & hides jealousy
2016-02-21 04:58:10 Devilment Over the amp or speakers?
2016-02-21 05:04:00 [04:58]
2016-02-21 05:12:16 SuperEngineer yes
2016-02-21 05:16:23 * SuperEngineer has speakers rated to 1000W [each], has an amp that begs to drive up to "fun" level... but doesn't live where it can be used
2016-02-21 05:19:11 SuperEngineer so puts up with mediocre 6 way home cinema player for all use... but... but...but...
2016-02-21 05:19:11 [05:19]
2016-02-21 05:19:25 SuperEngineer my poor unused speakers!
2016-02-21 05:20:32 gregoriosw_vp ccccccdcdkfvigdkbcehitebgngukihinfnicvhgdtdh
2016-02-21 05:20:44 gregoriosw_vp Sorry folks. Keyboard issue#
2016-02-21 05:20:49 gregoriosw_vp Ignore me!
2016-02-21 05:21:30 gregoriosw_vp Should now not reoccur.
2016-02-21 05:23:28 > callumd (~callumd@gmdltd.plus.com) has joined #linuxvoice
2016-02-21 05:23:40 SuperEngineer no prob, gregoriosw_vp dfp0njhbp'onj[#sbn #[frbm#eamb#a[pmr
2016-02-21 05:24:23 gregoriosw_vp :-P
2016-02-21 05:30:00 [05:24]
2016-02-21 05:43:23 - foxhunt_away is now known as foxhunt72
2016-02-21 05:49:00 [05:43]
2016-02-21 05:57:16 < LauRoman (~LauRoman@5-14-39-31.residential.rdsnet.ro) has quit (Read error: Connection reset by peer)
2016-02-21 06:02:42 > LauRoman (~LauRoman@5-14-39-31.residential.rdsnet.ro) has joined #linuxvoice
2016-02-21 06:08:00 [06:02]
2016-02-21 06:09:47 > JoeRess (~joe@cpc16-mort6-2-0-cust250.19-2.cable.virginm.net) has joined #linuxvoice
2016-02-21 06:11:23 JoeRess I don't suppose Ben is around?
2016-02-21 06:13:45 SuperEngineer Ben goes "bonnnggggg"
2016-02-21 06:13:59 SuperEngineer ....but e aint ere
2016-02-21 06:14:17 JoeRess fair enough
2016-02-21 06:14:24 SuperEngineer ...but he is Big
2016-02-21 06:14:31 SuperEngineer ;-)
2016-02-21 06:17:10 < JoeRess (~joe@cpc16-mort6-2-0-cust250.19-2.cable.virginm.net) has quit (Quit: Leaving.)
2016-02-21 06:22:29 > Nitronium (~Dave@host109-156-178-255.range109-156.btcentralplus.com) has joined #linuxvoice
2016-02-21 06:23:30 > Arthur_D (~magne@195.1.125.245) has joined #linuxvoice
2016-02-21 06:23:30 [06:23]
2016-02-21 06:25:59 < charlesay (~daro3@ip5f5bf553.dynamic.kabel-deutschland.de) has quit (Ping timeout: 240 seconds)
2016-02-21 06:31:00 [06:25]
2016-02-21 06:41:30 > m95lag (~m95lag@82-181-169-179.bb.dnainternet.fi) has joined #linuxvoice
2016-02-21 06:42:23 - foxhunt72 is now known as foxhunt_away
2016-02-21 06:48:00 [06:42]
2016-02-21 06:48:36 - foxhunt_away is now known as foxhunt72
2016-02-21 06:54:00 [06:48]
2016-02-21 06:57:43 < SuperEngineer (~SuperEngi@host86-162-231-213.range86-162.btcentralplus.com) has left #linuxvoice ("bbs...my planet wants me back")
2016-02-21 07:03:00 [06:57]
2016-02-21 07:17:55 - foxhunt72 is now known as foxhunt_away
2016-02-21 07:23:00 [07:17]
2016-02-21 07:30:39 < frankbell (~chatzilla@ip98-183-208-12.hr.hr.cox.net) has quit (Quit: ChatZilla 0.9.92 [SeaMonkey 2.39/20160127134954])
2016-02-21 07:36:00 [07:30]
2016-02-21 08:35:10 < Nitronium (~Dave@host109-156-178-255.range109-156.btcentralplus.com) has quit (Remote host closed the connection)
2016-02-21 08:35:10 [08:35]
2016-02-21 08:37:22 < m95lag (~m95lag@82-181-169-179.bb.dnainternet.fi) has quit (Quit: leaving)
2016-02-21 08:39:48 > Nitronium (~Dave@host109-156-178-255.range109-156.btcentralplus.com) has joined #linuxvoice
2016-02-21 08:45:00 [08:39]
2016-02-21 10:03:55 < rochelimit__ (~gcthomas@glencthomas.plus.com) has quit (Quit: Bye)
2016-02-21 10:03:55 [10:03]
2016-02-21 10:04:07 > charlesay (~daro3@ip5f5bd67b.dynamic.kabel-deutschland.de) has joined #linuxvoice
2016-02-21 10:04:51 > shadowfirebird (~shadowfir@host86-156-63-210.range86-156.btcentralplus.com) has joined #linuxvoice
2016-02-21 10:10:00 [10:04]
2016-02-21 10:22:18 < charlesay (~daro3@ip5f5bd67b.dynamic.kabel-deutschland.de) has quit (Quit: leaving)
2016-02-21 10:26:54 < shadowfirebird (~shadowfir@host86-156-63-210.range86-156.btcentralplus.com) has quit (Ping timeout: 244 seconds)
2016-02-21 10:26:54 [10:26]
2016-02-21 11:12:27 < LauRoman (~LauRoman@5-14-39-31.residential.rdsnet.ro) has quit (Read error: Connection reset by peer)
2016-02-21 11:12:27 [11:12]
2016-02-21 12:01:36 < Nitronium (~Dave@host109-156-178-255.range109-156.btcentralplus.com) has quit (Remote host closed the connection)
2016-02-21 12:01:36 [12:01]
2016-02-21 12:52:23 - irc: disconnected from server
2016-02-21 12:52:23 [12:52]
2016-02-21 17:51:29 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-02-21 17:51:29 [17:51]
2016-02-21 17:51:29 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-02-21 17:51:29 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-02-21 17:51:29 - Channel #linuxvoice: 72 nicks (1 op, 0 voices, 71 normals)
2016-02-21 17:51:38 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-02-21 17:57:00 [17:51]
2016-02-21 18:51:03 mavrix mavrix
2016-02-21 18:51:03 [18:51]
2016-02-21 19:14:31 > ideasman42 (~cambo@203-206-123-225.dyn.iinet.net.au) has joined #linuxvoice
2016-02-21 19:14:31 [19:14]
2016-02-21 19:49:01 > SuperEngineer (~SuperEngi@86.162.231.213) has joined #linuxvoice
2016-02-21 19:49:01 [19:49]
2016-02-21 20:10:03 > Nitronium (~Dave@host109-156-178-255.range109-156.btcentralplus.com) has joined #linuxvoice
2016-02-21 20:10:03 [20:10]
2016-02-21 20:45:40 > charlesay (~daro3@ip5f5bd67b.dynamic.kabel-deutschland.de) has joined #linuxvoice
2016-02-21 20:45:40 [20:45]
2016-02-21 20:57:07 Ioangogo|sleep gregoriosw_vp: that looks like a yubikey opt
2016-02-21 21:03:00 [20:57]
2016-02-21 21:11:58 < brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has quit (Quit: Konversation terminated!)
2016-02-21 21:14:37 charlesay on a scale from one to project ending, where is that linux mint compromise set?
2016-02-21 21:15:56 zmoylan-pi probably 2-3, a security cockup. but i'm glad it occurred and was caught
2016-02-21 21:18:07 mcphail what happened?
2016-02-21 21:18:07 [21:18]
2016-02-21 21:19:45 mcphail http://blog.linuxmint.com/?p=2994 - aargh. Nasty
2016-02-21 21:22:07 zmoylan-pi spring is here, the daily mail hacker is no longer wearing a hoodie... :-) http://i.dailymail.co.uk/i/pix/2016/02/18/12/0236EF8900000578-3452774-image-m-93_1455800012124.jpg
2016-02-21 21:22:12 mcphail Depressingly, they've published MD5 hashes under "How to check if your ISO is compromised?" rather than something signed with their GPG key. FFS
2016-02-21 21:22:53 zmoylan-pi more people would know how to use a hash probably
2016-02-21 21:23:40 mcphail zmoylan-pi: a hash is useless if the scumbags can rewrite your website and modify the MD5s
2016-02-21 21:24:11 zmoylan-pi the server they got access to is still down according to that blog
2016-02-21 21:24:52 mcphail Yes, but looks as if it had been kept up for a further 24h after the initial discovering, hosting a new compromised .ISO
2016-02-21 21:29:04 < LauRoman|Alt (~LauRoman@5-14-81-219.residential.rdsnet.ro) has quit (Read error: Connection reset by peer)
2016-02-21 21:29:31 charlesay what is the point of a linux distro: packaging linux and other stuff into something useful and deliver it to people. that is exactly what they fucked up enormously
2016-02-21 21:32:21 charlesay they should have signed the isos with gpg keys (that others aren't doing this either doesn't make it any better). they/we should use secure boot to mitigate this. they shouldn't host their isos on the same box/vm as their bloody wordpress. they shouldn't use md5. they shouldn't need to be told by people commenting on the blog that the site is still/again compromised...
2016-02-21 21:32:26 > LauRoman|Alt (~LauRoman@5-14-81-219.residential.rdsnet.ro) has joined #linuxvoice
2016-02-21 21:34:29 mcphail charlesay: looks as if they do publish proper sigs, but should really have put them in the blog post (rather than the naked hashes)
2016-02-21 21:34:29 [21:34]
2016-02-21 21:37:17 * mcphail is downloading manjaro, and notes they use naked hashes as well
2016-02-21 21:43:00 [21:37]
2016-02-21 21:55:25 - irc: disconnected from server
2016-02-22 09:20:56 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-02-22 09:20:56 [09:20]
2016-02-22 09:20:56 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-02-22 09:20:56 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-02-22 09:20:56 - Channel #linuxvoice: 70 nicks (1 op, 0 voices, 69 normals)
2016-02-22 09:21:05 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-02-22 09:27:00 [09:21]
2016-02-22 09:39:01 < Scary_Nitro (~Dave@host213-1-14-213.range213-1.btcentralplus.com) has quit (Remote host closed the connection)
2016-02-22 09:45:00 [09:39]
2016-02-22 09:46:25 - foxhunt72 is now known as foxhunt_away
2016-02-22 09:52:00 [09:46]
2016-02-22 10:43:33 > Arthur_D (~magne@195.1.125.245) has joined #linuxvoice
2016-02-22 10:43:33 [10:43]
2016-02-22 11:34:44 < mcphail (~mcphail@unaffiliated/mcphail) has quit (Ping timeout: 248 seconds)
2016-02-22 11:34:44 [11:34]
2016-02-22 11:36:36 > mcphail (~mcphail@unaffiliated/mcphail) has joined #linuxvoice
2016-02-22 11:42:00 [11:36]
2016-02-22 11:45:08 < georgeowell (~georgeowe@95.149.192.154) has quit (Excess Flood)
2016-02-22 11:45:39 > georgeowell (~georgeowe@95.149.192.154) has joined #linuxvoice
2016-02-22 11:51:00 [11:45]
2016-02-22 12:20:46 - irc: disconnected from server
2016-02-22 12:20:46 [12:20]
2016-02-22 12:21:02 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-02-22 12:21:02 [12:21]
2016-02-22 12:21:02 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-02-22 12:21:02 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-02-22 12:21:02 - Channel #linuxvoice: 70 nicks (1 op, 0 voices, 69 normals)
2016-02-22 12:21:12 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-02-22 12:27:00 [12:21]
2016-02-22 13:03:18 < georgeowell (~georgeowe@95.149.192.154) has quit (Quit: Leaving)
2016-02-22 13:03:18 [13:03]
2016-02-22 13:33:05 > swift110-phone (~swift110-@unaffiliated/swift110) has joined #linuxvoice
2016-02-22 13:33:05 [13:33]
2016-02-22 13:33:10 swift110-phone Hey
2016-02-22 13:39:00 [13:33]
2016-02-22 13:45:30 < metasansana (~metasansa@unaffiliated/metasansana) has quit (Quit: Leaving)
2016-02-22 13:51:00 [13:45]
2016-02-22 13:53:22 > chemist69_ (~apl@a89-182-48-251.net-htp.de) has joined #linuxvoice
2016-02-22 13:56:36 < chemist69 (~apl@a89-182-40-85.net-htp.de) has quit (Ping timeout: 248 seconds)
2016-02-22 14:02:00 [13:56]
2016-02-22 15:11:35 < jaake (~h4ckm3@c-68-52-45-79.hsd1.tn.comcast.net) has quit (Ping timeout: 250 seconds)
2016-02-22 15:11:35 [15:11]
2016-02-22 15:25:26 > zmoylan-1i (~pi@109.76.211.74) has joined #linuxvoice
2016-02-22 15:28:35 < zmoylan-pi (~pi@109.79.96.145) has quit (Ping timeout: 244 seconds)
2016-02-22 15:28:35 [15:28]
2016-02-22 16:01:46 > zmoylan-pi (~pi@109.76.171.237) has joined #linuxvoice
2016-02-22 16:01:46 [16:01]
2016-02-22 16:02:59 < zmoylan-1i (~pi@109.76.211.74) has quit (Ping timeout: 240 seconds)
2016-02-22 16:08:00 [16:02]
2016-02-22 16:28:58 - irc: disconnected from server
2016-02-22 16:28:58 [16:28]
2016-02-22 16:35:10 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-02-22 16:35:10 [16:35]
2016-02-22 16:35:10 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-02-22 16:35:10 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-02-22 16:35:10 - Channel #linuxvoice: 68 nicks (1 op, 0 voices, 67 normals)
2016-02-22 16:35:20 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-02-22 16:41:00 [16:35]
2016-02-22 16:44:02 - irc: disconnected from server
2016-02-23 01:39:47 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-02-23 01:39:47 [01:39]
2016-02-23 01:39:47 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-02-23 01:39:47 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-02-23 01:39:47 - Channel #linuxvoice: 78 nicks (1 op, 0 voices, 77 normals)
2016-02-23 01:39:57 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-02-23 01:40:16 Devilment But probably have to use that cash to replace the EU subsidies we get to certain sectors
2016-02-23 01:46:00 [01:40]
2016-02-23 01:46:29 < bdmc (bdmc@cl-745.bos-01.us.sixxs.net) has quit (Ping timeout: 240 seconds)
2016-02-23 01:47:29 towy71 Devilment: 7bn a year net is not that much really
2016-02-23 01:47:51 > bdmc (bdmc@cl-745.bos-01.us.sixxs.net) has joined #linuxvoice
2016-02-23 01:48:05 towy71 hardly enough to cover Vodaphone and Amazon's tax bill
2016-02-23 01:50:19 < arubislander (~ubuntuadm@86.93.93.218) has quit (Quit: Leaving.)
2016-02-23 01:51:39 > arubislander (~ubuntuadm@86.93.93.218) has joined #linuxvoice
2016-02-23 01:54:10 > Ian (~Thunderbi@vpn-3-194.rl.ac.uk) has joined #linuxvoice
2016-02-23 01:54:34 - Ian is now known as Guest32275
2016-02-23 01:55:36 Devilment I'm totally on the fence over the EU issue
2016-02-23 01:55:44 Devilment Pros and cons either way
2016-02-23 01:56:01 Devilment We've been in the EU for most of my life
2016-02-23 01:57:16 < mnavrati (milan@nat/redhat/x-liqsjryzqsgaewgf) has quit (Quit: Leaving)
2016-02-23 01:57:43 Devilment I was born Nov 1972 and we joined in Jan 1973
2016-02-23 02:00:10 > mnavrati (milan@nat/redhat/x-sgvuhrywvjwhxqpp) has joined #linuxvoice
2016-02-23 02:00:56 < jherrmann (jirkah@nat/redhat/x-korlvtrgghhbddte) has quit (Quit: Toodle pip!)
2016-02-23 02:00:59 < Guest32275 (~Thunderbi@vpn-3-194.rl.ac.uk) has quit (Ping timeout: 240 seconds)
2016-02-23 02:01:15 < mnavrati (milan@nat/redhat/x-sgvuhrywvjwhxqpp) has quit (Client Quit)
2016-02-23 02:01:15 [02:01]
2016-02-23 02:01:40 > mnavrati (milan@nat/redhat/x-plhycivarthpmwgc) has joined #linuxvoice
2016-02-23 02:01:45 towy71 I voted in 1975 and thought that was that, would be very upset if we vote to leave having worked in Germany and France back in the day
2016-02-23 02:07:00 [02:01]
2016-02-23 02:11:31 < bdmc (bdmc@cl-745.bos-01.us.sixxs.net) has quit (Quit: ZNC - http://znc.in)
2016-02-23 02:11:36 charlesay for the uk to leave now would be a clear signal against political integration and Europe taking up it's responsibility in the world, and add support to a racist agenda
2016-02-23 02:12:24 > bdmc (bdmc@cl-745.bos-01.us.sixxs.net) has joined #linuxvoice
2016-02-23 02:14:25 < swift110-phone (~swift110-@unaffiliated/swift110) has quit (Remote host closed the connection)
2016-02-23 02:14:42 @degville I have some sympathy with the no campaign but I too would be very dissappointed if the UK left the EU. I was also born in 1972, and have lived and worked in France. Knowing I can move/live around Europe is a huge part of what I consider my identity. Less integration takes us down an increasingly insular path, and I find that thought very depressing.
2016-02-23 02:15:52 > M1C4HTRON13 (~micah@bodhilinux/team/M1C4HTRON13) has joined #linuxvoice
2016-02-23 02:20:34 Devilment What effect, if any, would a Brexit have on selling LV to European readers and paying EU writers compared to now?
2016-02-23 02:21:32 < theru (~theru@theru.org) has quit (Quit: ZNC - http://znc.in)
2016-02-23 02:23:02 > theru (~theru@theru.org) has joined #linuxvoice
2016-02-23 02:23:02 [02:23]
2016-02-23 02:24:51 @degville I really don't know. The current state of VAT is horrible, so I'm not sure it would be worse.
2016-02-23 02:25:20 TraceyC I wonder if it would mean additional headaches for Saunders
2016-02-23 02:25:26 TraceyC IIRC he's now in Germany
2016-02-23 02:26:22 @degville It may. It's part of the reason why he's taken on the Document Foundation job, as that's based in Germany and could help if he needs to become a German citizen, as far as I know.
2016-02-23 02:27:58 Devilment German citizen. Does that involve having his sense of humour removed?
2016-02-23 02:28:42 TraceyC +5 to logic -2 to humor
2016-02-23 02:29:20 @degville hehehe.. Mike's from the home of Stan Laurel, I'm sure his humour will survive.
2016-02-23 02:29:42 Blackisle will chase out the interview mcphail :)
2016-02-23 02:29:44 Devilment Joke I've told before: How many Germans does it take to change a lightbulb? Just one, as they are efficient and have no sense of humour.
2016-02-23 02:29:49 < mnavrati (milan@nat/redhat/x-plhycivarthpmwgc) has quit (Quit: Leaving)
2016-02-23 02:30:53 Blackisle one of the usual opt-out issues is the huge amount of red-tape you need to go through to sell stuff in the EU. We manufacture machines so the vast majority oif the red-tape is to do with the CE mark
2016-02-23 02:31:12 Blackisle whether we're in or out, you still need a CE mark to sell in the EU
2016-02-23 02:31:42 Blackisle so it's idiotic not to be part of the EU and at least try to steer some of the standards decisions made
2016-02-23 02:33:10 Blackisle tis crazy to think that splitting with the EU, our largest trading partner, won't have a negative impact on industry
2016-02-23 02:34:44 Blackisle anyone fancy re-negotiating the EU trade deals (as well as all the other EU bound deals) prior to Brexit?
2016-02-23 02:35:04 @degville I might just join Mike.
2016-02-23 02:35:23 Blackisle in Marketing?
2016-02-23 02:35:27 @degville ahaha
2016-02-23 02:35:34 Blackisle ;)
2016-02-23 02:35:36 @degville True. I'm terrible at Marketing.
2016-02-23 02:36:05 TraceyC I keep thinking to the parallels to the cry of "States Rights!1!!!!!" in the US, which is most often used to justify racist, xenophobic rules & desires
2016-02-23 02:37:33 > mnavrati (milan@nat/redhat/x-qhmhdkiygbaewgrg) has joined #linuxvoice
2016-02-23 02:42:11 > jherrmann (jirkah@nat/redhat/x-gvzgqjfytibsenhi) has joined #linuxvoice
2016-02-23 02:42:11 [02:42]
2016-02-23 02:42:48 < writtenoff (~writtenof@d172-218-204-26.bchsia.telus.net) has quit (Quit: WeeChat 1.3)
2016-02-23 02:44:12 < bdmc (bdmc@cl-745.bos-01.us.sixxs.net) has quit (Quit: ZNC - http://znc.in)
2016-02-23 02:44:27 > bdmc_ (bdmc@cl-745.bos-01.us.sixxs.net) has joined #linuxvoice
2016-02-23 02:45:24 - bdmc_ is now known as bdmc
2016-02-23 02:51:00 [02:45]
2016-02-23 02:56:55 Ioangogo|sleep Roads are slower than walking with the ammout of people not driving correctly
2016-02-23 03:02:00 [02:56]
2016-02-23 03:03:59 mcphail degville: I thought Stan Laurel was a Glaswegian?
2016-02-23 03:05:10 mcphail He was certainly a resident at one of the music halls
2016-02-23 03:05:22 @degville I think he left Ulverston when he was very little.
2016-02-23 03:05:29 Devilment He was from Lancs, IIRC
2016-02-23 03:06:06 mcphail aah
2016-02-23 03:11:51 < hamgammon (~hamgammon@188.226.144.192) has quit (Quit: So long and thanks for all the fish!)
2016-02-23 03:12:17 > hamgammon (~hamgammon@188.226.144.192) has joined #linuxvoice
2016-02-23 03:14:23 < hamgammon (~hamgammon@188.226.144.192) has quit (Client Quit)
2016-02-23 03:16:19 > hamgammon (~hamgammon@188.226.144.192) has joined #linuxvoice
2016-02-23 03:22:00 [03:16]
2016-02-23 03:29:26 > Ian (~Thunderbi@vpn-3-168.rl.ac.uk) has joined #linuxvoice
2016-02-23 03:29:50 - Ian is now known as Guest92327
2016-02-23 03:32:13 > Delu (bc9203c3@gateway/web/freenode/ip.188.146.3.195) has joined #linuxvoice
2016-02-23 03:32:42 < Delu (bc9203c3@gateway/web/freenode/ip.188.146.3.195) has quit (Client Quit)
2016-02-23 03:33:19 < bdmc (bdmc@cl-745.bos-01.us.sixxs.net) has quit (Quit: ZNC - http://znc.in)
2016-02-23 03:33:31 > bdmc (bdmc@cl-745.bos-01.us.sixxs.net) has joined #linuxvoice
2016-02-23 03:39:00 [03:33]
2016-02-23 03:40:14 towy71 https://en.wikipedia.org/wiki/Stan_Laurel
2016-02-23 03:41:34 - foxhunt72 is now known as foxhunt_away
2016-02-23 03:47:00 [03:41]
2016-02-23 03:47:13 < Guest92327 (~Thunderbi@vpn-3-168.rl.ac.uk) has quit (Ping timeout: 252 seconds)
2016-02-23 03:50:59 < bdmc (bdmc@cl-745.bos-01.us.sixxs.net) has quit (Ping timeout: 240 seconds)
2016-02-23 03:53:35 Ioangogo|sleep https://www.youtube.com/watch?v=m5dXWJi4pIA
2016-02-23 03:54:32 > bdmc (bdmc@cl-745.bos-01.us.sixxs.net) has joined #linuxvoice
2016-02-23 04:00:00 [03:54]
2016-02-23 04:00:21 > swift110 (~swift110@pool-173-73-122-47.washdc.east.verizon.net) has joined #linuxvoice
2016-02-23 04:01:28 < swift110 (~swift110@pool-173-73-122-47.washdc.east.verizon.net) has quit (Changing host)
2016-02-23 04:01:28 > swift110 (~swift110@unaffiliated/swift110) has joined #linuxvoice
2016-02-23 04:07:00 [04:01]
2016-02-23 04:10:17 > pdq_ (~pdq@p20030045431B70002D2BB8C64C61C40A.dip0.t-ipconnect.de) has joined #linuxvoice
2016-02-23 04:13:13 - irc: disconnected from server
2016-02-23 04:13:39 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-02-23 04:13:39 [04:13]
2016-02-23 04:13:39 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-02-23 04:13:39 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-02-23 04:13:39 - Channel #linuxvoice: 79 nicks (1 op, 0 voices, 78 normals)
2016-02-23 04:13:49 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-02-23 04:13:58 < mnavrati (milan@nat/redhat/x-qhmhdkiygbaewgrg) has quit (Quit: Leaving)
2016-02-23 04:19:00 [04:13]
2016-02-23 04:20:07 > writtenoff (~writtenof@of1.psych.ubc.ca) has joined #linuxvoice
2016-02-23 04:21:34 < charlesay (~daro3@zecd5.pia.fu-berlin.de) has quit (Ping timeout: 255 seconds)
2016-02-23 04:22:59 < bdmc (bdmc@cl-745.bos-01.us.sixxs.net) has quit (Ping timeout: 240 seconds)
2016-02-23 04:24:05 > bdmc (bdmc@cl-745.bos-01.us.sixxs.net) has joined #linuxvoice
2016-02-23 04:30:00 [04:24]
2016-02-23 04:30:02 < TwistedLucidity (~TwistedLu@cpc80671-stap13-2-0-cust118.12-2.cable.virginm.net) has quit (Quit: Konversation terminated!)
2016-02-23 04:36:00 [04:30]
2016-02-23 04:50:47 < andybalaam (andybalaam@nat/ibm/x-hcuraukttlsleahi) has quit (Remote host closed the connection)
2016-02-23 04:56:00 [04:50]
2016-02-23 05:05:29 < bdmc (bdmc@cl-745.bos-01.us.sixxs.net) has quit (Ping timeout: 240 seconds)
2016-02-23 05:07:30 > CPrompt^ (~CPrompt^@cpe-45-36-163-153.triad.res.rr.com) has joined #linuxvoice
2016-02-23 05:07:38 > mnavrati (~milan@ip-94-113-220-233.net.upcbroadband.cz) has joined #linuxvoice
2016-02-23 05:09:35 > charlesay (~daro3@176.6.18.139) has joined #linuxvoice
2016-02-23 05:15:00 [05:09]
2016-02-23 05:27:07 > jaake (~h4ckm3@c-68-52-45-79.hsd1.tn.comcast.net) has joined #linuxvoice
2016-02-23 05:33:00 [05:27]
2016-02-23 05:37:03 < jaake (~h4ckm3@c-68-52-45-79.hsd1.tn.comcast.net) has quit (Ping timeout: 276 seconds)
2016-02-23 05:37:23 < charlesay (~daro3@176.6.18.139) has quit (Ping timeout: 250 seconds)
2016-02-23 05:41:47 > asusk7m550 (~Thunderbi@2001:981:97b3:1:1d90:60f0:7702:8f58) has joined #linuxvoice
2016-02-23 05:47:00 [05:41]
2016-02-23 05:51:37 - irc: disconnected from server
2016-02-23 05:51:56 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-02-23 05:51:56 [05:51]
2016-02-23 05:51:56 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-02-23 05:51:56 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-02-23 05:51:56 - Channel #linuxvoice: 78 nicks (1 op, 0 voices, 77 normals)
2016-02-23 05:52:06 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-02-23 05:54:56 < pdq_ (~pdq@p20030045431B70002D2BB8C64C61C40A.dip0.t-ipconnect.de) has quit (Remote host closed the connection)
2016-02-23 05:58:44 > bdmc (~bdmc@68.153.43.233) has joined #linuxvoice
2016-02-23 06:04:00 [05:58]
2016-02-23 06:20:04 > Ian (~Thunderbi@pb-d-128-141-238-41.cern.ch) has joined #linuxvoice
2016-02-23 06:20:04 [06:20]
2016-02-23 06:20:27 - Ian is now known as Guest11936
2016-02-23 06:25:29 < Guest11936 (~Thunderbi@pb-d-128-141-238-41.cern.ch) has quit (Ping timeout: 240 seconds)
2016-02-23 06:27:43 < jherrmann (jirkah@nat/redhat/x-gvzgqjfytibsenhi) has quit (Remote host closed the connection)
2016-02-23 06:33:00 [06:27]
2016-02-23 06:40:10 > towy71_ (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has joined #linuxvoice
2016-02-23 06:40:49 > charlesay (~daro3@ip5f5bd6cf.dynamic.kabel-deutschland.de) has joined #linuxvoice
2016-02-23 06:42:02 < towy71 (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has quit (Ping timeout: 244 seconds)
2016-02-23 06:44:47 Ioangogo|sleep rooting a nook
2016-02-23 06:45:20 TraceyC :D
2016-02-23 06:45:28 TraceyC Are you going to keep the Amazon OS on it?
2016-02-23 06:45:50 Ioangogo|sleep TraceyC: Nook isnt amazon
2016-02-23 06:46:12 TraceyC d'oh, it comes with Android?
2016-02-23 06:46:21 TraceyC I new Nook is B&N. I just was in a B&N yesterday....
2016-02-23 06:46:25 TraceyC knew*
2016-02-23 06:46:30 * TraceyC goes back to bed
2016-02-23 06:48:10 < swift110 (~swift110@unaffiliated/swift110) has quit (Ping timeout: 252 seconds)
2016-02-23 06:48:10 [06:48]
2016-02-23 07:06:57 - irc: disconnected from server
2016-02-23 07:06:57 [07:06]
2016-02-23 08:50:48 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-02-23 08:50:48 [08:50]
2016-02-23 08:50:48 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-02-23 08:50:48 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-02-23 08:50:48 - Channel #linuxvoice: 75 nicks (1 op, 0 voices, 74 normals)
2016-02-23 08:50:56 > swift110_ (~swift110@64.26.99.248) has joined #linuxvoice
2016-02-23 08:50:57 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-02-23 08:56:00 [08:50]
2016-02-23 08:59:07 - irc: disconnected from server
2016-02-23 08:59:16 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-02-23 08:59:16 [08:59]
2016-02-23 08:59:16 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-02-23 08:59:16 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-02-23 08:59:16 - Channel #linuxvoice: 76 nicks (1 op, 0 voices, 75 normals)
2016-02-23 08:59:26 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-02-23 09:05:00 [08:59]
2016-02-23 09:06:25 > Ian1 (~Thunderbi@vpn-3-186.rl.ac.uk) has joined #linuxvoice
2016-02-23 09:12:00 [09:06]
2016-02-23 09:14:31 < charlesay (~daro3@ip5f5bd6cf.dynamic.kabel-deutschland.de) has quit (Ping timeout: 255 seconds)
2016-02-23 09:20:00 [09:14]
2016-02-23 09:31:57 > charlesay (~daro3@ip5f5bd6cf.dynamic.kabel-deutschland.de) has joined #linuxvoice
2016-02-23 09:32:23 < charlesay (~daro3@ip5f5bd6cf.dynamic.kabel-deutschland.de) has quit (Client Quit)
2016-02-23 09:38:00 [09:32]
2016-02-23 09:41:33 - blahdeblah_ is now known as blahdeblah
2016-02-23 09:47:00 [09:41]
2016-02-23 09:53:22 < M1C4HTRON13 (~micah@bodhilinux/team/M1C4HTRON13) has quit (Remote host closed the connection)
2016-02-23 09:53:30 Ioangogo BBC 3 has become a bbc production name thing
2016-02-23 09:59:00 [09:53]
2016-02-23 10:00:41 < gb00s (~gb00s@c50-31.i07-13.onvol.net) has quit (Quit: Leaving)
2016-02-23 10:06:00 [10:00]
2016-02-23 10:06:39 < Ian1 (~Thunderbi@vpn-3-186.rl.ac.uk) has quit (Ping timeout: 244 seconds)
2016-02-23 10:07:48 Ioangogo This is one thing that had me Lauthing out loud https://www.youtube.com/watch?v=DMG-hMJhySk
2016-02-23 10:08:17 - mnavrati_afk is now known as mnavrati
2016-02-23 10:08:23 - irc: disconnected from server
2016-02-23 10:11:21 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-02-23 10:11:21 [10:11]
2016-02-23 10:11:21 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-02-23 10:11:21 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-02-23 10:11:21 - Channel #linuxvoice: 73 nicks (1 op, 0 voices, 72 normals)
2016-02-23 10:11:30 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-02-23 10:15:53 swift110 hey all
2016-02-23 10:21:00 [10:15]
2016-02-23 10:54:04 Ioangogo :( looks like beep beep yar wont make it
2016-02-23 10:54:04 [10:54]
2016-02-23 10:57:32 fs0ciety :(
2016-02-23 10:57:35 fs0ciety that is sad
2016-02-23 11:03:00 [10:57]
2016-02-23 11:03:29 - irc: disconnected from server
2016-02-23 11:03:44 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-02-23 11:03:44 [11:03]
2016-02-23 11:03:44 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-02-23 11:03:44 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-02-23 11:03:44 - Channel #linuxvoice: 73 nicks (1 op, 0 voices, 72 normals)
2016-02-23 11:03:54 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-02-23 11:09:00 [11:03]
2016-02-23 11:18:18 < mnavrati (~milan@ip-94-113-220-233.net.upcbroadband.cz) has quit (Quit: Leaving)
2016-02-23 11:24:00 [11:18]
2016-02-23 11:28:13 swift110 how are you Ioangogo
2016-02-23 11:34:00 [11:28]
2016-02-23 11:37:31 - irc: disconnected from server
2016-02-23 11:37:41 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-02-23 11:37:41 [11:37]
2016-02-23 11:37:41 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-02-23 11:37:41 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-02-23 11:37:41 - Channel #linuxvoice: 72 nicks (1 op, 0 voices, 71 normals)
2016-02-23 11:37:50 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-02-23 11:43:00 [11:37]
2016-02-23 11:56:05 > jaake (~h4ckm3@c-68-52-45-79.hsd1.tn.comcast.net) has joined #linuxvoice
2016-02-23 12:02:00 [11:56]
2016-02-23 12:36:37 < writtenoff (~writtenof@of1.psych.ubc.ca) has quit (Quit: WeeChat 1.3)
2016-02-23 12:36:37 [12:36]
2016-02-23 12:44:36 < jaake (~h4ckm3@c-68-52-45-79.hsd1.tn.comcast.net) has quit (Ping timeout: 248 seconds)
2016-02-23 12:44:45 < corsack (~pi@cpc21-hudd9-2-0-cust116.4-1.cable.virginm.net) has quit (Ping timeout: 276 seconds)
2016-02-23 12:47:29 < swift110 (~swift110@unaffiliated/swift110) has quit (Ping timeout: 240 seconds)
2016-02-23 12:51:01 > corsack (~pi@cpc21-hudd9-2-0-cust116.4-1.cable.virginm.net) has joined #linuxvoice
2016-02-23 12:57:00 [12:51]
2016-02-23 12:57:08 < swift110_ (~swift110@64.26.99.248) has quit (Ping timeout: 244 seconds)
2016-02-23 12:59:11 - irc: disconnected from server
2016-02-23 20:03:34 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-02-23 20:03:34 [20:03]
2016-02-23 20:03:34 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-02-23 20:03:34 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-02-23 20:03:34 - Channel #linuxvoice: 75 nicks (1 op, 0 voices, 74 normals)
2016-02-23 20:03:45 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-02-23 20:09:00 [20:03]
2016-02-23 20:21:42 Devilment http://www.bbc.co.uk/news/magazine-35560458
2016-02-23 20:22:36 zmoylan-pi i don't think it even comes close to worst video game
2016-02-23 20:23:37 zmoylan-pi atari who spent millions for rights to a game which they rushed out in 3 weeks with 1 programmer are to blame methinks
2016-02-23 20:28:28 Devilment In the 90s, I "played" a game called Pax <something> from a French software house. Set in the future, there was background radiation as a hazard. Said radiation killed my character within 5 minutes.
2016-02-23 20:28:28 [20:28]
2016-02-23 20:28:41 Devilment That was the worst game I ever played
2016-02-23 20:28:59 zmoylan-pi collywobbles on zx spectrum, a gauntlet clone, unplayable
2016-02-23 20:29:17 Devilment 4-5 cycles of "Start game. Die." and I uninstalled it
2016-02-23 20:30:19 zmoylan-pi i just pushed tape to back of shelf and never loaded it again...
2016-02-23 20:32:50 mcphail I think, to be properly bad, a game must have had some degree of hype and expectation which it spectacularly failed to meet. There are 1000s of back-bedroom Speccy games which were awful, but no-one would have expected them to be good
2016-02-23 20:33:54 zmoylan-pi well collywobbles had great looking graphics and synthisized speech and sound so effort HAD been put in
2016-02-23 20:34:08 zmoylan-pi but was ruined by bugs
2016-02-23 20:35:15 zmoylan-pi about a 1/3 of the games i had were never reviewed by magazines so you had no other way of knowing what to avoid for a lot of games
2016-02-23 20:35:36 zmoylan-pi no internet to check them out
2016-02-23 20:40:29 Devilment Daikatana, Duke Nukem Forever
2016-02-23 20:41:58 > ideasman42 (~cambo@203-206-123-225.dyn.iinet.net.au) has joined #linuxvoice
2016-02-23 20:43:27 mcphail I've been tempted to but Daikatana, to see if it is as bad as everyone says
2016-02-23 20:43:31 mcphail *buy
2016-02-23 20:43:31 [20:43]
2016-02-23 20:51:42 > towy71 (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has joined #linuxvoice
2016-02-23 20:54:12 Devilment I picked up a couple of LED "golfball" bulbs y'day from Poundland. Rated at 5W / 330lm.
2016-02-23 20:54:19 < towy71_ (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has quit (Ping timeout: 250 seconds)
2016-02-23 20:55:08 Devilment They're to be used in a couple of mood-lighting lamps, but I tried them in my wall lights first, just to see how they compared to the 8W CFLs I'm already using
2016-02-23 20:55:33 Devilment I was surprised they were just as bright, if not a touch brighter
2016-02-23 20:56:00 < towy71 (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has quit (Ping timeout: 240 seconds)
2016-02-23 20:56:19 Devilment At £1/bulb, it'll take a year for them to pay back their costs if I replaced them :)
2016-02-23 20:56:44 > towy71 (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has joined #linuxvoice
2016-02-23 20:57:29 mcphail CFLs need to die. Horrible horrible things
2016-02-23 20:58:08 james_olympus Sounds good. My kitchen has ten 20W halogens. I don't like to use the ceiling lights, they're close to gaming graphics card territory
2016-02-23 20:58:16 Devilment I've used low energy lighting since I got the house, so have no comparison to running lighting using incandescents
2016-02-23 20:58:41 Devilment Often wondered how much a reduction people who have swapped over see in their leccy bills
2016-02-23 20:58:41 [20:58]
2016-02-23 20:59:15 mcphail Devilment: they're nasty, and prone to explode. Wouldn't be so bad if they weren't full of mercury
2016-02-23 20:59:40 Devilment Prone to explode?
2016-02-23 20:59:57 Devilment And they're not full of mercury
2016-02-23 21:05:00 [20:59]
2016-02-23 21:11:06 Devilment http://earthtechling.com/2011/10/the-mercury-myth-how-much-mercury-do-cfls-actually-contain/
2016-02-23 21:11:23 mcphail Devilment: they fail with a bang. I had one pop like a gunshot a couple of months ago, followed by a foul cabbage smell. I'll admit "full of" is hyperbole, but they do contain mercury and they do explode
2016-02-23 21:11:47 * mcphail would like to stress the foul cabbage smell did not come from his trousers
2016-02-23 21:12:45 Devilment Well, I've never had one explode on me and that's from a house with one in nearly every fitting
2016-02-23 21:13:22 mcphail http://www.maine.gov/dep/homeowner/cflreport.html
2016-02-23 21:17:11 Devilment I still maintain the "ZOMG! Mercury!" risk is over-hyped for CFLs
2016-02-23 21:19:02 zmoylan-pi still sitting on those cfl manufacturers shares? :-)
2016-02-23 21:19:23 Devilment Nope
2016-02-23 21:19:49 Devilment I have buggy-whip manufacturer shares though :)
2016-02-23 21:21:11 zmoylan-pi http://www.buggywhip.org/products.html
2016-02-23 21:21:11 [21:21]
2016-02-23 21:21:37 < LauRoman (~LauRoman@5-14-81-219.residential.rdsnet.ro) has quit (Read error: Connection reset by peer)
2016-02-23 21:27:00 [21:21]
2016-02-23 21:30:50 > brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has joined #linuxvoice
2016-02-23 21:36:00 [21:30]
2016-02-23 21:41:58 > Ian (~Thunderbi@vpn-3-088.rl.ac.uk) has joined #linuxvoice
2016-02-23 21:42:22 - Ian is now known as Guest42382
2016-02-23 21:48:00 [21:42]
2016-02-23 21:57:43 < Guest42382 (~Thunderbi@vpn-3-088.rl.ac.uk) has quit (Ping timeout: 255 seconds)
2016-02-23 22:03:00 [21:57]
2016-02-23 22:16:31 < aptanet (~quassel@humpback.aptanet.net) has quit (Remote host closed the connection)
2016-02-23 22:18:03 > aptanet (~quassel@humpback.aptanet.net) has joined #linuxvoice
2016-02-23 22:18:03 [22:18]
2016-02-23 22:39:28 > felimwhiteley_ (~quassel@89.101.203.26) has joined #linuxvoice
2016-02-23 22:39:28 [22:39]
2016-02-23 22:42:35 > haircode (~haircode@46.101.17.241) has joined #linuxvoice
2016-02-23 22:48:00 [22:42]
2016-02-23 22:56:56 < haircode (~haircode@46.101.17.241) has quit (*.net *.split)
2016-02-23 22:58:42 > haircode (~haircode@46.101.17.241) has joined #linuxvoice
2016-02-23 22:59:38 > Ian (~Thunderbi@pb-d-128-141-156-23.cern.ch) has joined #linuxvoice
2016-02-23 23:00:01 - Ian is now known as Guest25011
2016-02-23 23:06:00 [23:00]
2016-02-23 23:06:59 < Guest25011 (~Thunderbi@pb-d-128-141-156-23.cern.ch) has quit (Ping timeout: 240 seconds)
2016-02-23 23:12:00 [23:06]
2016-02-23 23:15:15 > Ian (~Thunderbi@vpn-3-166.rl.ac.uk) has joined #linuxvoice
2016-02-23 23:15:38 - Ian is now known as Guest37850
2016-02-23 23:21:00 [23:15]
2016-02-23 23:26:56 < brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has quit (Quit: Konversation terminated!)
2016-02-23 23:28:38 < Guest37850 (~Thunderbi@vpn-3-166.rl.ac.uk) has quit (Ping timeout: 255 seconds)
2016-02-23 23:34:00 [23:28]
2016-02-24 00:01:20 < mnavrati (milan@nat/redhat/x-cdsmmknlarbxrzlp) has quit (Quit: Leaving)
2016-02-24 00:01:20 [00:01]
2016-02-24 00:02:24 < arubislander (~ubuntuadm@86.93.93.218) has quit (Quit: Leaving.)
2016-02-24 00:02:47 > mnavrati (milan@nat/redhat/x-nvjjuwkslgyfvzxj) has joined #linuxvoice
2016-02-24 00:03:49 > arubislander (~ubuntuadm@86.93.93.218) has joined #linuxvoice
2016-02-24 00:09:00 [00:03]
2016-02-24 00:12:54 > Ian (~Thunderbi@vpn-3-035.rl.ac.uk) has joined #linuxvoice
2016-02-24 00:13:18 - Ian is now known as Guest8637
2016-02-24 00:16:46 > TraceyC (~TraceyC@ng2.cptxoffice.net) has joined #linuxvoice
2016-02-24 00:20:05 > jaake (~h4ckm3@129.59.122.17) has joined #linuxvoice
2016-02-24 00:26:00 [00:20]
2016-02-24 00:27:47 * mcphail has an expired SSL certificate on his home server. Created it 10 years ago. /me is getting old :(
2016-02-24 00:28:37 zmoylan-pi pffffft. i'm sure if i made a few calls i could find code i wrote in 80s still in daily use :-)
2016-02-24 00:29:43 mcphail zmoylan-pi: the code I wote in the 80's went '10 PRINT "McPhail Rules OK" 20 GOTO 10'
2016-02-24 00:30:16 zmoylan-pi i wrote code in qbasic so not much different :-)
2016-02-24 00:30:21 mcphail :)
2016-02-24 00:30:51 zmoylan-pi initially gwbasic then qbasic and most was dragged kicking and screaming into visual basic...
2016-02-24 00:31:06 - irc: disconnected from server
2016-02-24 00:43:36 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-02-24 00:43:36 [00:43]
2016-02-24 00:43:36 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-02-24 00:43:36 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-02-24 00:43:36 - Channel #linuxvoice: 80 nicks (1 op, 0 voices, 79 normals)
2016-02-24 00:43:45 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-02-24 00:44:18 < Guest8637 (~Thunderbi@vpn-3-035.rl.ac.uk) has quit (Ping timeout: 276 seconds)
2016-02-24 00:47:42 - irc: disconnected from server
2016-02-24 00:50:32 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-02-24 00:50:32 [00:50]
2016-02-24 00:50:32 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-02-24 00:50:32 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-02-24 00:50:32 - Channel #linuxvoice: 79 nicks (1 op, 0 voices, 78 normals)
2016-02-24 00:50:35 - irc: disconnected from server
2016-02-24 01:18:18 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-02-24 01:18:18 [01:18]
2016-02-24 01:18:18 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-02-24 01:18:18 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-02-24 01:18:18 - Channel #linuxvoice: 78 nicks (1 op, 0 voices, 77 normals)
2016-02-24 01:18:29 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-02-24 01:22:18 Devilment Damn. Just heard that one of our consultants had a stroke y'day morning
2016-02-24 01:22:28 < jaake (~h4ckm3@129.59.122.17) has quit (Ping timeout: 252 seconds)
2016-02-24 01:22:44 zmoylan-pi age?
2016-02-24 01:22:45 TraceyC :( I hope they are on the mend
2016-02-24 01:22:49 Devilment 63
2016-02-24 01:23:20 Devilment Fortunately he was at home
2016-02-24 01:23:35 zmoylan-pi we work in a sedentary job environment and aren't the best at looking after our health...
2016-02-24 01:23:45 Devilment Could've been worse if he'd been on the road or in a hotel room
2016-02-24 01:23:46 zmoylan-pi fingers crossed he makes a full recovery
2016-02-24 01:25:59 * zmoylan-pi was listening this morning to radio interview from guy who had a stroke about charity that helps people deal with the aftermath of such health crisis
2016-02-24 01:29:12 Devilment He's lost his speech and mobility down one side
2016-02-24 01:31:19 zmoylan-pi not good... severe
2016-02-24 01:37:00 [01:31]
2016-02-24 01:42:33 > jaake (~h4ckm3@129.59.122.17) has joined #linuxvoice
2016-02-24 01:48:00 [01:42]
2016-02-24 01:58:06 < mnavrati (milan@nat/redhat/x-nvjjuwkslgyfvzxj) has quit (Quit: Leaving)
2016-02-24 01:58:13 < jherrmann (jirkah@nat/redhat/x-wjdzwbrartylqfyw) has quit (Quit: Toodle pip!)
2016-02-24 02:02:30 > mnavrati_mtg (milan@nat/redhat/x-ouxvihdqjqddiphr) has joined #linuxvoice
2016-02-24 02:07:00 > The_Farmer (~chatzilla@ip98-183-208-12.hr.hr.cox.net) has joined #linuxvoice
2016-02-24 02:07:00 [02:07]
2016-02-24 02:07:45 > dizzyliz1y (~aubrey@raech.net) has joined #linuxvoice
2016-02-24 02:07:50 < frankbell (~chatzilla@ip98-183-208-12.hr.hr.cox.net) has quit (Ping timeout: 240 seconds)
2016-02-24 02:07:50 < dizzylizzy (~aubrey@raech.net) has quit (Ping timeout: 240 seconds)
2016-02-24 02:07:50 < hamgammon (~hamgammon@188.226.144.192) has quit (Ping timeout: 240 seconds)
2016-02-24 02:07:58 > hamgammo1 (~hamgammon@188.226.144.192) has joined #linuxvoice
2016-02-24 02:07:58 - The_Farmer is now known as frankbell
2016-02-24 02:13:00 [02:07]
2016-02-24 02:14:43 > jherrmann (jirkah@nat/redhat/x-jvhouduepuqfsuwn) has joined #linuxvoice
2016-02-24 02:14:52 < TraceyC (~TraceyC@ng2.cptxoffice.net) has quit (Ping timeout: 244 seconds)
2016-02-24 02:20:00 [02:14]
2016-02-24 02:26:48 > TraceyC (~TraceyC@208.74.121.106) has joined #linuxvoice
2016-02-24 02:32:00 [02:26]
2016-02-24 02:40:49 < gb00s (~gb00s@c50-31.i07-13.onvol.net) has quit (Quit: Leaving)
2016-02-24 02:41:03 < writtenoff (~writtenof@172.218.204.26) has quit (Quit: WeeChat 1.3)
2016-02-24 02:47:00 [02:41]
2016-02-24 02:49:35 > Ian (~Thunderbi@80-254-78-160.dynamic.monzoon.net) has joined #linuxvoice
2016-02-24 02:49:58 - Ian is now known as Guest93304
2016-02-24 02:55:00 [02:49]
2016-02-24 02:59:53 < Guest93304 (~Thunderbi@80-254-78-160.dynamic.monzoon.net) has quit (Ping timeout: 244 seconds)
2016-02-24 07:23:01 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-02-24 07:23:01 [07:23]
2016-02-24 07:23:01 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-02-24 07:23:01 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-02-24 07:23:01 - Channel #linuxvoice: 76 nicks (1 op, 0 voices, 75 normals)
2016-02-24 07:23:11 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-02-24 07:29:00 [07:23]
2016-02-24 07:31:11 > mjtowell (~mjtowell@unaffiliated/mjtowell) has joined #linuxvoice
2016-02-24 07:35:26 > LauRoman (~LauRoman@5-14-81-219.residential.rdsnet.ro) has joined #linuxvoice
2016-02-24 07:41:00 [07:35]
2016-02-24 07:54:44 < TraceyC (~TraceyC@208.74.121.106) has quit (Quit: Off I go into the wild, blue yonder)
2016-02-24 07:55:36 > anglic00 (~james____@81-86-151-146.dsl.pipex.com) has joined #linuxvoice
2016-02-24 07:58:44 < mjtowell (~mjtowell@unaffiliated/mjtowell) has quit (Quit: Leaving)
2016-02-24 07:58:44 [07:58]
2016-02-24 08:13:38 - foxhunt72 is now known as foxhunt_away
2016-02-24 08:14:48 - foxhunt_away is now known as foxhunt72
2016-02-24 08:14:48 [08:14]
2016-02-24 08:19:29 < jaake (~h4ckm3@129.59.122.17) has quit (Ping timeout: 240 seconds)
2016-02-24 08:22:40 > mnavrati (~milan@ip-94-113-220-233.net.upcbroadband.cz) has joined #linuxvoice
2016-02-24 08:25:54 > Nitronium (~Dave@host213-1-14-213.range213-1.btcentralplus.com) has joined #linuxvoice
2016-02-24 08:31:00 [08:25]
2016-02-24 08:45:38 - foxhunt72 is now known as foxhunt_away
2016-02-24 08:51:00 [08:45]
2016-02-24 08:54:28 < asusk7m550 (~Thunderbi@2001:981:97b3:1:9984:d771:e1dc:3573) has quit (Quit: asusk7m550)
2016-02-24 08:59:13 anglic00 https://github.com/santinic/how2 pretty cool
2016-02-24 09:03:47 < Nitronium (~Dave@host213-1-14-213.range213-1.btcentralplus.com) has quit (Remote host closed the connection)
2016-02-24 09:04:13 > asusk7m550 (~Thunderbi@2001:981:97b3:1:9984:d771:e1dc:3573) has joined #linuxvoice
2016-02-24 09:10:00 [09:04]
2016-02-24 09:36:29 < asusk7m550 (~Thunderbi@2001:981:97b3:1:9984:d771:e1dc:3573) has quit (Quit: asusk7m550)
2016-02-24 09:36:29 [09:36]
2016-02-24 09:37:19 < M1C4HTRON13 (~micah@bodhilinux/team/M1C4HTRON13) has quit (Remote host closed the connection)
2016-02-24 09:43:00 [09:37]
2016-02-24 09:50:54 < slashd (~slashd@205.204.31.10) has quit (Remote host closed the connection)
2016-02-24 09:56:00 [09:50]
2016-02-24 09:58:08 < haircode (~haircode@46.101.17.241) has quit (*.net *.split)
2016-02-24 09:58:08 < Secret_Hamster (~pfft@pdpc/supporter/active/secret-hamster) has quit (*.net *.split)
2016-02-24 09:58:08 < russor (~rw@188.166.11.128) has quit (*.net *.split)
2016-02-24 09:58:09 < felimwhiteley_ (~quassel@89.101.203.26) has quit (*.net *.split)
2016-02-24 09:58:09 < popey (~alan@cpc81199-farn9-2-0-cust577.6-2.cable.virginm.net) has quit (*.net *.split)
2016-02-24 09:58:09 < evilnickveitch (~evilnick@cpc83321-bath6-2-0-cust252.18-1.cable.virginm.net) has quit (*.net *.split)
2016-02-24 09:58:09 < Arthur_D (~magne@195.1.125.245) has quit (*.net *.split)
2016-02-24 09:58:09 < towy71 (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has quit (*.net *.split)
2016-02-24 09:58:09 < dizzyliz1y (~aubrey@raech.net) has quit (*.net *.split)
2016-02-24 09:58:09 < zmoylan-pi (~pi@109.79.100.243) has quit (*.net *.split)
2016-02-24 09:58:09 < bdmc (~bdmc@68.153.43.233) has quit (*.net *.split)
2016-02-24 09:58:09 < blahdeblah (~quassel@unaffiliated/blahdeblah) has quit (*.net *.split)
2016-02-24 09:58:09 < nomad_dw (~nomad@maia.oucs.ox.ac.uk) has quit (*.net *.split)
2016-02-24 09:58:09 < exoplanet (~exoplanet@unaffiliated/exoplanet) has quit (*.net *.split)
2016-02-24 09:58:10 < amoe (~amoe@li195-121.members.linode.com) has quit (*.net *.split)
2016-02-24 09:58:10 < mnavrati (~milan@ip-94-113-220-233.net.upcbroadband.cz) has quit (*.net *.split)
2016-02-24 09:58:10 < anglic00 (~james____@81-86-151-146.dsl.pipex.com) has quit (*.net *.split)
2016-02-24 09:58:10 < aptanet (~quassel@humpback.aptanet.net) has quit (*.net *.split)
2016-02-24 09:58:10 < ideasman42 (~cambo@203-206-123-225.dyn.iinet.net.au) has quit (*.net *.split)
2016-02-24 09:58:10 < Ioangogo (~quassel@huwloosley.plus.com) has quit (*.net *.split)
2016-02-24 09:58:11 < mparm9202 (~mparm920@71.227.15.34) has quit (*.net *.split)
2016-02-24 09:58:11 < nsc (~nsc@tardis.chantrell.net) has quit (*.net *.split)
2016-02-24 09:58:11 < CPrompt^ (~CPrompt^@cpe-45-36-163-153.triad.res.rr.com) has quit (*.net *.split)
2016-02-24 09:58:11 < Cueball (~lee@2001:8b0:ffb3::c0:ff:ee) has quit (*.net *.split)
2016-02-24 09:58:11 < Stilvoid (stilvoid@offend.me.uk) has quit (*.net *.split)
2016-02-24 09:58:11 < pwaring (~pwaring@davros.xk7.net) has quit (*.net *.split)
2016-02-24 09:58:12 < swift110 (~swift110@unaffiliated/swift110) has quit (*.net *.split)
2016-02-24 09:58:12 < writtenoff (~writtenof@of1.psych.ubc.ca) has quit (*.net *.split)
2016-02-24 09:58:12 < corsack (~pi@cpc21-hudd9-2-0-cust116.4-1.cable.virginm.net) has quit (*.net *.split)
2016-02-24 09:58:12 < Blackisle (~Blackisle@kilchoman.blackisle.org.uk) has quit (*.net *.split)
2016-02-24 09:58:12 < mavrix (~mavrix@unaffiliated/mavrix) has quit (*.net *.split)
2016-02-24 09:58:12 < callumd (~callumd@gmdltd.plus.com) has quit (*.net *.split)
2016-02-24 09:58:12 < einonm (~einonm@81.174.139.2) has quit (*.net *.split)
2016-02-24 09:58:13 < foxhunt_away (~r.devos@vps2.zorro-online.nl) has quit (*.net *.split)
2016-02-24 09:58:13 < jampoole_ (~root@46.101.30.180) has quit (*.net *.split)
2016-02-24 09:58:13 < theru (~theru@theru.org) has quit (*.net *.split)
2016-02-24 09:58:14 < metasansana (~metasansa@unaffiliated/metasansana) has quit (*.net *.split)
2016-02-24 09:58:14 < hamgammon (~hamgammon@188.226.144.192) has quit (*.net *.split)
2016-02-24 09:58:14 < frankbell (~chatzilla@ip98-183-208-12.hr.hr.cox.net) has quit (*.net *.split)
2016-02-24 09:58:14 < chemist69 (~apl@89.182.180.160) has quit (*.net *.split)
2016-02-24 09:58:14 < quaisi_ (~simon@host-92-30-27-114.as13285.net) has quit (*.net *.split)
2016-02-24 09:58:14 < grifferz (~andy@85.119.80.223) has quit (*.net *.split)
2016-02-24 09:58:14 < gregoriosw_vp (~gregorios@176.126.244.125) has quit (*.net *.split)
2016-02-24 09:58:14 < matthew1471_ (~matthew14@194.74.188.133) has quit (*.net *.split)
2016-02-24 09:58:15 < Cadair (~Cadair@unaffiliated/cadair) has quit (*.net *.split)
2016-02-24 09:58:15 < opi (~opi@2001:41d0:52:800::49e) has quit (*.net *.split)
2016-02-24 09:58:15 < flexiondotorg_ (~flexiondo@2001:41d0:2:e3::) has quit (*.net *.split)
2016-02-24 09:58:15 < Theta159- (~Theta1594@unaffiliated/theta1594) has quit (*.net *.split)
2016-02-24 09:58:15 < anglisc (~aethelber@81-86-151-146.dsl.pipex.com) has quit (*.net *.split)
2016-02-24 09:58:15 < archie1 (~Archie@ces1700.keskus.post.ee) has quit (*.net *.split)
2016-02-24 09:58:15 < degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) has quit (*.net *.split)
2016-02-24 09:58:16 < webpigeon (~quassel@kat.vps.livebytes.co.uk) has quit (*.net *.split)
2016-02-24 09:58:16 < KCinJP (sid136901@gateway/web/irccloud.com/x-uasvzkwglipzgwjw) has quit (*.net *.split)
2016-02-24 09:58:16 < cardinalfink (~paul@178.62.20.157) has quit (*.net *.split)
2016-02-24 09:58:16 < SonikArc (~prayingma@203-7-33-136.dyn.iinet.net.au) has quit (*.net *.split)
2016-02-24 09:58:17 < LagerMon (~LagarMons@213.221.204.54) has quit (*.net *.split)
2016-02-24 09:58:17 < cromulon (~cromulon@45.62.227.43) has quit (*.net *.split)
2016-02-24 09:58:17 < mcphail (~mcphail@unaffiliated/mcphail) has quit (*.net *.split)
2016-02-24 09:58:17 < Devilment (~david@cpc1-jarr13-2-0-cust241.16-2.cable.virginm.net) has quit (*.net *.split)
2016-02-24 09:58:17 < docapotamus (~pjuu@cloudev.pjuu.net) has quit (*.net *.split)
2016-02-24 09:58:17 < NYbill (~bill@104.236.1.137) has quit (*.net *.split)
2016-02-24 09:58:18 < vertreko (~vertreko@172-4-34-97.lightspeed.sndgca.sbcglobal.net) has quit (*.net *.split)
2016-02-24 09:58:18 < EspadaV8 (~EspadaV8@unaffiliated/espadav8) has quit (*.net *.split)
2016-02-24 09:58:18 < skybert (user@2a01:7e00::f03c:91ff:fedf:9eed) has quit (*.net *.split)
2016-02-24 09:58:18 < brianhunter- (~brian@bhlm.net) has quit (*.net *.split)
2016-02-24 09:58:18 < petrichor (~znc@unaffiliated/petrichor) has quit (*.net *.split)
2016-02-24 09:58:19 < thesilentboatman (~thesilent@c83-248-87-13.bredband.comhem.se) has quit (*.net *.split)
2016-02-24 09:59:55 > amoe (~amoe@li195-121.members.linode.com) has joined #linuxvoice
2016-02-24 09:59:55 > exoplanet (~exoplanet@unaffiliated/exoplanet) has joined #linuxvoice
2016-02-24 09:59:55 > nomad_dw (~nomad@maia.oucs.ox.ac.uk) has joined #linuxvoice
2016-02-24 09:59:55 > blahdeblah (~quassel@unaffiliated/blahdeblah) has joined #linuxvoice
2016-02-24 09:59:55 > bdmc (~bdmc@68.153.43.233) has joined #linuxvoice
2016-02-24 09:59:55 > zmoylan-pi (~pi@109.79.100.243) has joined #linuxvoice
2016-02-24 09:59:55 > dizzyliz1y (~aubrey@raech.net) has joined #linuxvoice
2016-02-24 09:59:55 > towy71 (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has joined #linuxvoice
2016-02-24 09:59:55 > degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) has joined #linuxvoice
2016-02-24 09:59:55 > archie1 (~Archie@ces1700.keskus.post.ee) has joined #linuxvoice
2016-02-24 09:59:55 > anglisc (~aethelber@81-86-151-146.dsl.pipex.com) has joined #linuxvoice
2016-02-24 09:59:55 > Theta159- (~Theta1594@unaffiliated/theta1594) has joined #linuxvoice
2016-02-24 09:59:55 > flexiondotorg_ (~flexiondo@2001:41d0:2:e3::) has joined #linuxvoice
2016-02-24 09:59:55 > opi (~opi@2001:41d0:52:800::49e) has joined #linuxvoice
2016-02-24 09:59:55 > Cadair (~Cadair@unaffiliated/cadair) has joined #linuxvoice
2016-02-24 09:59:55 - Mode #linuxvoice [+o degville] by barjavel.freenode.net
2016-02-24 10:00:21 > skybert (user@2a01:7e00::f03c:91ff:fedf:9eed) has joined #linuxvoice
2016-02-24 10:00:21 > brianhunter- (~brian@bhlm.net) has joined #linuxvoice
2016-02-24 10:00:21 > petrichor (~znc@unaffiliated/petrichor) has joined #linuxvoice
2016-02-24 10:00:21 > thesilentboatman (~thesilent@c83-248-87-13.bredband.comhem.se) has joined #linuxvoice
2016-02-24 10:00:56 > mnavrati (~milan@ip-94-113-220-233.net.upcbroadband.cz) has joined #linuxvoice
2016-02-24 10:00:56 > anglic00 (~james____@81-86-151-146.dsl.pipex.com) has joined #linuxvoice
2016-02-24 10:00:56 > aptanet (~quassel@humpback.aptanet.net) has joined #linuxvoice
2016-02-24 10:00:56 > ideasman42 (~cambo@203-206-123-225.dyn.iinet.net.au) has joined #linuxvoice
2016-02-24 10:00:56 > Ioangogo (~quassel@huwloosley.plus.com) has joined #linuxvoice
2016-02-24 10:00:56 > mparm9202 (~mparm920@71.227.15.34) has joined #linuxvoice
2016-02-24 10:00:56 > nsc (~nsc@tardis.chantrell.net) has joined #linuxvoice
2016-02-24 10:00:56 > CPrompt^ (~CPrompt^@cpe-45-36-163-153.triad.res.rr.com) has joined #linuxvoice
2016-02-24 10:00:56 > Cueball (~lee@2001:8b0:ffb3::c0:ff:ee) has joined #linuxvoice
2016-02-24 10:00:56 > Stilvoid (stilvoid@offend.me.uk) has joined #linuxvoice
2016-02-24 10:00:56 > pwaring (~pwaring@davros.xk7.net) has joined #linuxvoice
2016-02-24 10:00:56 > haircode (~haircode@46.101.17.241) has joined #linuxvoice
2016-02-24 10:01:00 > Secret_Hamster (~pfft@pdpc/supporter/active/secret-hamster) has joined #linuxvoice
2016-02-24 10:01:00 > russor (~rw@188.166.11.128) has joined #linuxvoice
2016-02-24 10:01:08 > swift110 (~swift110@unaffiliated/swift110) has joined #linuxvoice
2016-02-24 10:01:08 > writtenoff (~writtenof@of1.psych.ubc.ca) has joined #linuxvoice
2016-02-24 10:01:08 > corsack (~pi@cpc21-hudd9-2-0-cust116.4-1.cable.virginm.net) has joined #linuxvoice
2016-02-24 10:01:08 > jampoole_ (~root@46.101.30.180) has joined #linuxvoice
2016-02-24 10:01:08 > foxhunt_away (~r.devos@vps2.zorro-online.nl) has joined #linuxvoice
2016-02-24 10:01:08 > theru (~theru@theru.org) has joined #linuxvoice
2016-02-24 10:01:08 > Blackisle (~Blackisle@kilchoman.blackisle.org.uk) has joined #linuxvoice
2016-02-24 10:01:08 > mavrix (~mavrix@unaffiliated/mavrix) has joined #linuxvoice
2016-02-24 10:01:08 > callumd (~callumd@gmdltd.plus.com) has joined #linuxvoice
2016-02-24 10:01:08 > einonm (~einonm@81.174.139.2) has joined #linuxvoice
2016-02-24 10:02:02 > felimwhiteley_ (~quassel@89.101.203.26) has joined #linuxvoice
2016-02-24 10:02:03 > popey (~alan@cpc81199-farn9-2-0-cust577.6-2.cable.virginm.net) has joined #linuxvoice
2016-02-24 10:02:03 > evilnickveitch (~evilnick@cpc83321-bath6-2-0-cust252.18-1.cable.virginm.net) has joined #linuxvoice
2016-02-24 10:02:03 > Arthur_D (~magne@195.1.125.245) has joined #linuxvoice
2016-02-24 10:02:57 > LagerMon (~LagarMons@213.221.204.54) has joined #linuxvoice
2016-02-24 10:02:57 > cromulon (~cromulon@45.62.227.43) has joined #linuxvoice
2016-02-24 10:02:57 > mcphail (~mcphail@unaffiliated/mcphail) has joined #linuxvoice
2016-02-24 10:02:57 > Devilment (~david@cpc1-jarr13-2-0-cust241.16-2.cable.virginm.net) has joined #linuxvoice
2016-02-24 10:02:57 > docapotamus (~pjuu@cloudev.pjuu.net) has joined #linuxvoice
2016-02-24 10:02:57 > NYbill (~bill@104.236.1.137) has joined #linuxvoice
2016-02-24 10:02:57 > vertreko (~vertreko@172-4-34-97.lightspeed.sndgca.sbcglobal.net) has joined #linuxvoice
2016-02-24 10:02:57 > EspadaV8 (~EspadaV8@unaffiliated/espadav8) has joined #linuxvoice
2016-02-24 10:03:04 > webpigeon (~quassel@kat.vps.livebytes.co.uk) has joined #linuxvoice
2016-02-24 10:03:04 > KCinJP (sid136901@gateway/web/irccloud.com/x-uasvzkwglipzgwjw) has joined #linuxvoice
2016-02-24 10:03:04 > cardinalfink (~paul@178.62.20.157) has joined #linuxvoice
2016-02-24 10:03:04 > SonikArc (~prayingma@203-7-33-136.dyn.iinet.net.au) has joined #linuxvoice
2016-02-24 10:03:04 < russor (~rw@188.166.11.128) has quit (Max SendQ exceeded)
2016-02-24 10:03:59 > quaisi (~simon@host-92-30-27-114.as13285.net) has joined #linuxvoice
2016-02-24 10:04:07 < anglic00 (~james____@81-86-151-146.dsl.pipex.com) has quit (Quit: Leaving)
2016-02-24 10:04:27 > anglic00 (~james____@81-86-151-146.dsl.pipex.com) has joined #linuxvoice
2016-02-24 10:04:51 > jaake (~h4ckm3@c-68-52-45-79.hsd1.tn.comcast.net) has joined #linuxvoice
2016-02-24 10:04:52 < anglic00 (~james____@81-86-151-146.dsl.pipex.com) has quit (Client Quit)
2016-02-24 10:07:01 > metasansana (~metasansa@unaffiliated/metasansana) has joined #linuxvoice
2016-02-24 10:07:01 > hamgammon (~hamgammon@188.226.144.192) has joined #linuxvoice
2016-02-24 10:07:01 > frankbell (~chatzilla@ip98-183-208-12.hr.hr.cox.net) has joined #linuxvoice
2016-02-24 10:07:01 > chemist69 (~apl@89.182.180.160) has joined #linuxvoice
2016-02-24 10:07:01 > quaisi_ (~simon@host-92-30-27-114.as13285.net) has joined #linuxvoice
2016-02-24 10:07:01 > grifferz (~andy@85.119.80.223) has joined #linuxvoice
2016-02-24 10:07:01 > gregoriosw_vp (~gregorios@176.126.244.125) has joined #linuxvoice
2016-02-24 10:07:01 > matthew1471_ (~matthew14@194.74.188.133) has joined #linuxvoice
2016-02-24 10:07:01 < metasansana (~metasansa@unaffiliated/metasansana) has quit (Max SendQ exceeded)
2016-02-24 10:07:02 < quaisi_ (~simon@host-92-30-27-114.as13285.net) has quit (Ping timeout: 255 seconds)
2016-02-24 10:07:08 > metasansana (~metasansa@190.213.225.135) has joined #linuxvoice
2016-02-24 10:07:08 < metasansana (~metasansa@190.213.225.135) has quit (Changing host)
2016-02-24 10:07:08 > metasansana (~metasansa@unaffiliated/metasansana) has joined #linuxvoice
2016-02-24 10:07:14 > russor (~rw@188.166.11.128) has joined #linuxvoice
2016-02-24 10:13:00 [10:07]
2016-02-24 10:29:28 > brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has joined #linuxvoice
2016-02-24 10:29:28 [10:29]
2016-02-24 10:38:25 < aptanet (~quassel@humpback.aptanet.net) has quit (Remote host closed the connection)
2016-02-24 10:39:53 > aptanet (~quassel@humpback.aptanet.net) has joined #linuxvoice
2016-02-24 10:45:00 [10:39]
2016-02-24 11:11:57 < anglisc (~aethelber@81-86-151-146.dsl.pipex.com) has quit (Remote host closed the connection)
2016-02-24 11:11:57 [11:11]
2016-02-24 11:27:55 < towy71 (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has quit (Ping timeout: 250 seconds)
2016-02-24 11:27:55 [11:27]
2016-02-24 11:28:24 > towy71 (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has joined #linuxvoice
2016-02-24 11:34:00 [11:28]
2016-02-24 11:50:52 < ideasman42 (~cambo@203-206-123-225.dyn.iinet.net.au) has quit (Quit: Ex-Chat)
2016-02-24 11:50:52 [11:50]
2016-02-24 11:55:06 < jaake (~h4ckm3@c-68-52-45-79.hsd1.tn.comcast.net) has quit (Ping timeout: 244 seconds)
2016-02-24 12:01:00 [11:55]
2016-02-24 12:16:18 < mnavrati (~milan@ip-94-113-220-233.net.upcbroadband.cz) has quit (Quit: Leaving)
2016-02-24 12:16:18 [12:16]
2016-02-24 12:19:59 < writtenoff (~writtenof@of1.psych.ubc.ca) has quit (Quit: WeeChat 1.3)
2016-02-24 12:25:00 [12:19]
2016-02-24 12:28:45 > georgeowell (~georgeowe@95.149.192.154) has joined #linuxvoice
2016-02-24 12:34:00 [12:28]
2016-02-24 12:45:29 swift110 I did this recently: http://www.hackerpublicradio.org/eps/hpr1970.ogg
2016-02-24 12:51:00 [12:45]
2016-02-24 13:01:45 < swift110 (~swift110@unaffiliated/swift110) has quit (Ping timeout: 244 seconds)
2016-02-24 13:07:00 [13:01]
2016-02-24 13:50:34 > chemist69_ (~apl@a89-182-43-233.net-htp.de) has joined #linuxvoice
2016-02-24 13:50:34 [13:50]
2016-02-24 13:53:31 < chemist69 (~apl@89.182.180.160) has quit (Ping timeout: 255 seconds)
2016-02-24 13:59:00 [13:53]
2016-02-24 14:40:50 > writtenoff (~writtenof@d172-218-204-26.bchsia.telus.net) has joined #linuxvoice
2016-02-24 14:40:50 [14:40]
2016-02-24 14:45:37 < frankbell (~chatzilla@ip98-183-208-12.hr.hr.cox.net) has left #linuxvoice
2016-02-24 14:51:00 [14:45]
2016-02-24 14:58:02 < writtenoff (~writtenof@d172-218-204-26.bchsia.telus.net) has quit (Quit: WeeChat 1.3)
2016-02-24 14:59:17 > writtenoff (~writtenof@d172-218-204-26.bchsia.telus.net) has joined #linuxvoice
2016-02-24 15:05:00 [14:59]
2016-02-24 15:35:35 > zmoylan-1i (~pi@109.76.234.109) has joined #linuxvoice
2016-02-24 15:35:35 [15:35]
2016-02-24 15:38:49 < zmoylan-pi (~pi@109.79.100.243) has quit (Ping timeout: 250 seconds)
2016-02-24 15:44:00 [15:38]
2016-02-24 16:01:06 > zmoylan-pi (~pi@109.79.164.4) has joined #linuxvoice
2016-02-24 16:01:06 [16:01]
2016-02-24 16:03:06 < zmoylan-1i (~pi@109.76.234.109) has quit (Ping timeout: 244 seconds)
2016-02-24 16:09:00 [16:03]
2016-02-24 17:30:25 < mavrix (~mavrix@unaffiliated/mavrix) has quit (Ping timeout: 244 seconds)
2016-02-24 17:30:25 [17:30]
2016-02-24 17:30:59 > mavrix (~mavrix@unaffiliated/mavrix) has joined #linuxvoice
2016-02-24 17:36:00 [17:30]
2016-02-24 17:46:17 > gb00s (~gb00s@c50-31.i07-13.onvol.net) has joined #linuxvoice
2016-02-24 17:47:04 < mavrix (~mavrix@unaffiliated/mavrix) has quit (Ping timeout: 255 seconds)
2016-02-24 17:48:31 > mavrix (~mavrix@unaffiliated/mavrix) has joined #linuxvoice
2016-02-24 17:54:00 [17:48]
2016-02-24 17:55:46 > TwistedLucidity (~TwistedLu@cpc80671-stap13-2-0-cust118.12-2.cable.virginm.net) has joined #linuxvoice
2016-02-24 18:01:00 [17:55]
2016-02-24 18:14:28 > HEGX64 (~Scott@CPE-121-214-211-228.lns6.fli.bigpond.net.au) has joined #linuxvoice
2016-02-24 18:20:00 [18:14]
2016-02-24 18:21:04 < popey (~alan@cpc81199-farn9-2-0-cust577.6-2.cable.virginm.net) has quit (Changing host)
2016-02-24 18:21:04 > popey (~alan@ubuntu/member/popey) has joined #linuxvoice
2016-02-24 18:23:31 < HEGX64 (~Scott@CPE-121-214-211-228.lns6.fli.bigpond.net.au) has quit (Ping timeout: 255 seconds)
2016-02-24 18:29:00 [18:23]
2016-02-24 18:31:43 > HEGX64 (~Scott@CPE-121-214-211-228.lns6.fli.bigpond.net.au) has joined #linuxvoice
2016-02-24 18:37:00 [18:31]
2016-02-24 18:55:33 < HEGX64 (~Scott@CPE-121-214-211-228.lns6.fli.bigpond.net.au) has quit (Remote host closed the connection)
2016-02-24 18:55:33 [18:55]
2016-02-24 19:01:21 - foxhunt_away is now known as foxhunt72
2016-02-24 19:01:34 > ideasman42 (~cambo@203-206-123-225.dyn.iinet.net.au) has joined #linuxvoice
2016-02-24 19:04:43 - irc: disconnected from server
2016-02-25 02:11:45 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-02-25 02:11:45 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-02-25 02:11:45 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-02-25 02:11:45 - Channel #linuxvoice: 77 nicks (1 op, 0 voices, 76 normals)
2016-02-25 02:11:55 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-02-25 02:12:33 - irc: disconnected from server
2016-02-25 11:00:28 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-02-25 11:00:28 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-02-25 11:00:28 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-02-25 11:00:28 - Channel #linuxvoice: 68 nicks (1 op, 0 voices, 67 normals)
2016-02-25 11:00:38 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-02-25 11:00:58 < mavrix (~mavrix@unaffiliated/mavrix) has quit (Ping timeout: 252 seconds)
2016-02-25 11:01:58 - irc: disconnected from server
2016-02-25 11:02:16 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-02-25 11:02:16 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-02-25 11:02:16 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-02-25 11:02:16 - Channel #linuxvoice: 67 nicks (1 op, 0 voices, 66 normals)
2016-02-25 11:02:26 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-02-25 11:05:15 > swift110 (~swift110@64.26.99.248) has joined #linuxvoice
2016-02-25 11:06:23 - irc: disconnected from server
2016-02-25 11:06:39 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-02-25 11:06:39 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-02-25 11:06:39 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-02-25 11:06:39 - Channel #linuxvoice: 68 nicks (1 op, 0 voices, 67 normals)
2016-02-25 11:06:49 < swift110 (~swift110@64.26.99.248) has quit (Changing host)
2016-02-25 11:06:50 > swift110 (~swift110@unaffiliated/swift110) has joined #linuxvoice
2016-02-25 11:06:50 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-02-25 11:13:39 - foxhunt_away is now known as foxhunt72
2016-02-25 11:18:19 > mavrix (~mavrix@unaffiliated/mavrix) has joined #linuxvoice
2016-02-25 11:35:53 < anglic00 (~james____@81-86-151-146.dsl.pipex.com) has quit (Remote host closed the connection)
2016-02-25 12:12:21 - foxhunt72 is now known as foxhunt_away
2016-02-25 12:20:56 < writtenoff (~writtenof@of1.psych.ubc.ca) has quit (Quit: WeeChat 1.3)
2016-02-25 12:31:09 < mavrix (~mavrix@unaffiliated/mavrix) has quit (Ping timeout: 250 seconds)
2016-02-25 12:56:22 < swift110 (~swift110@unaffiliated/swift110) has quit (Ping timeout: 255 seconds)
2016-02-25 13:10:00 swift110-phone Good
2016-02-25 13:10:21 swift110-phone I will do another one soon
2016-02-25 13:28:29 < swift110-phone (~swift110-@unaffiliated/swift110) has quit (Ping timeout: 240 seconds)
2016-02-25 13:49:50 > chemist69 (~apl@a89-182-176-14.net-htp.de) has joined #linuxvoice
2016-02-25 13:52:34 < chemist69_ (~apl@a89-182-43-233.net-htp.de) has quit (Ping timeout: 240 seconds)
2016-02-25 15:00:12 > mavrix (~mavrix@unaffiliated/mavrix) has joined #linuxvoice
2016-02-25 15:20:00 < Stilvoid (stilvoid@offend.me.uk) has quit (Ping timeout: 240 seconds)
2016-02-25 15:20:38 > Stilvoid (stilvoid@offend.me.uk) has joined #linuxvoice
2016-02-25 15:23:28 > zmoylan-1i (~pi@109.79.155.186) has joined #linuxvoice
2016-02-25 15:26:22 < zmoylan-pi (~pi@109.79.164.4) has quit (Ping timeout: 244 seconds)
2016-02-25 16:03:34 < zmoylan-1i (~pi@109.79.155.186) has quit (Ping timeout: 255 seconds)
2016-02-25 16:07:52 > zmoylan-pi (~pi@109.77.250.186) has joined #linuxvoice
2016-02-25 16:27:44 > writtenoff (~writtenof@172.218.204.26) has joined #linuxvoice
2016-02-25 17:26:04 > gb00s (~gb00s@c50-31.i07-13.onvol.net) has joined #linuxvoice
2016-02-25 17:34:07 < felimwhiteley_ (~quassel@89.101.203.26) has quit (Remote host closed the connection)
2016-02-25 17:40:28 > felimwhiteley_ (~quassel@89.101.203.26) has joined #linuxvoice
2016-02-25 17:46:55 > brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has joined #linuxvoice
2016-02-25 17:48:23 < brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has quit (Client Quit)
2016-02-25 18:13:20 > jherrmann (jirkah@nat/redhat/x-szjcsywzbxkqfvge) has joined #linuxvoice
2016-02-25 18:51:49 > arubislander (~ubuntuadm@86.93.93.218) has joined #linuxvoice
2016-02-25 19:23:13 > brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has joined #linuxvoice
2016-02-25 19:28:47 < ideasman42 (~cambo@203-206-123-225.dyn.iinet.net.au) has quit (Quit: Ex-Chat)
2016-02-25 19:29:03 > ideasman42 (~cambo@203-206-123-225.dyn.iinet.net.au) has joined #linuxvoice
2016-02-25 19:36:53 < arubislander (~ubuntuadm@86.93.93.218) has quit (Quit: Leaving.)
2016-02-25 19:37:57 > TwistedLucidity (~TwistedLu@cpc80671-stap13-2-0-cust118.12-2.cable.virginm.net) has joined #linuxvoice
2016-02-25 19:39:26 > arubislander (~ubuntuadm@86.93.93.218) has joined #linuxvoice
2016-02-25 19:48:10 < ideasman42 (~cambo@203-206-123-225.dyn.iinet.net.au) has quit (Quit: Ex-Chat)
2016-02-25 20:08:20 > mnavrati (~milan@94.113.220.233) has joined #linuxvoice
2016-02-25 20:15:11 > andybalaam (andybalaam@nat/ibm/x-kddjgfmonkfvehvv) has joined #linuxvoice
2016-02-25 20:23:48 > HEGX64 (~Scott@CPE-121-214-211-228.lns6.fli.bigpond.net.au) has joined #linuxvoice
2016-02-25 20:28:27 - foxhunt_away is now known as foxhunt72
2016-02-25 20:39:35 > towy71_ (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has joined #linuxvoice
2016-02-25 20:41:04 < towy71 (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has quit (Ping timeout: 240 seconds)
2016-02-25 20:51:56 - irc: disconnected from server
2016-02-25 21:51:26 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-02-25 21:51:26 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-02-25 21:51:26 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-02-25 21:51:26 - Channel #linuxvoice: 75 nicks (1 op, 0 voices, 74 normals)
2016-02-25 21:51:35 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-02-25 22:01:57 < M1C4HTRON13 (~micah@bodhilinux/team/M1C4HTRON13) has quit (Ping timeout: 276 seconds)
2016-02-25 22:07:01 > M1C4HTRON13 (~micah@bodhilinux/team/M1C4HTRON13) has joined #linuxvoice
2016-02-25 22:16:07 > AdamDBrown (~Thunderbi@4.112-240-116.dynamic.dsl.pth.iprimus.net.au) has joined #linuxvoice
2016-02-25 22:22:39 > AdamDBrown1 (~Thunderbi@4.151-142-203.dynamic.dsl.pth.iprimus.net.au) has joined #linuxvoice
2016-02-25 22:24:52 < AdamDBrown (~Thunderbi@4.112-240-116.dynamic.dsl.pth.iprimus.net.au) has quit (Ping timeout: 248 seconds)
2016-02-25 22:24:52 - AdamDBrown1 is now known as AdamDBrown
2016-02-25 22:25:29 < jherrmann (jirkah@nat/redhat/x-szjcsywzbxkqfvge) has quit (Quit: Toodle pip!)
2016-02-25 22:42:23 > jherrmann (jirkah@nat/redhat/x-unjyetobqmioyucp) has joined #linuxvoice
2016-02-25 22:42:39 > Aikidokajeff (~Thunderbi@213.106.248.240) has joined #linuxvoice
2016-02-25 22:54:53 < jherrmann (jirkah@nat/redhat/x-unjyetobqmioyucp) has quit (Quit: Toodle pip!)
2016-02-25 22:57:04 > jherrmann (jirkah@nat/redhat/x-nlsjejobvbmvdhaz) has joined #linuxvoice
2016-02-25 23:14:47 > charlesay (~daro3@zecd5.pia.fu-berlin.de) has joined #linuxvoice
2016-02-25 23:40:50 < AdamDBrown (~Thunderbi@4.151-142-203.dynamic.dsl.pth.iprimus.net.au) has quit (Quit: AdamDBrown)
2016-02-25 23:44:22 - irc: disconnected from server
2016-02-25 23:45:31 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-02-25 23:45:31 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-02-25 23:45:31 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-02-25 23:45:31 - Channel #linuxvoice: 77 nicks (1 op, 0 voices, 76 normals)
2016-02-25 23:45:41 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-02-25 23:46:37 < charlesay (~daro3@zecd5.pia.fu-berlin.de) has quit (Ping timeout: 255 seconds)
2016-02-26 00:01:53 - irc: disconnected from server
2016-02-26 00:02:47 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-02-26 00:02:47 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-02-26 00:02:47 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-02-26 00:02:47 - Channel #linuxvoice: 76 nicks (1 op, 0 voices, 75 normals)
2016-02-26 00:02:56 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-02-26 00:08:12 - foxhunt_away is now known as foxhunt72
2016-02-26 00:11:14 Ioangogo https://www.youtube.com/watch?v=QNZPQssir4E
2016-02-26 00:21:26 < callumd (~callumd@gmdltd.plus.com) has quit (Quit: leaving)
2016-02-26 00:24:05 > TraceyC (~TraceyC@ng2.cptxoffice.net) has joined #linuxvoice
2016-02-26 00:32:57 > CPrompt^ (~CPrompt^@cpe-45-36-163-153.triad.res.rr.com) has joined #linuxvoice
2016-02-26 00:45:38 Devilment 4 days and £7600 to go
2016-02-26 00:46:21 Devilment Can we get 5 people who want to have lunch with the LV team?
2016-02-26 00:46:27 @degville hehehe...
2016-02-26 00:46:40 TraceyC I would but it's quite a swim
2016-02-26 00:55:49 < gregoriosw_vp (~gregorios@176.126.244.125) has quit (Quit: WeeChat 1.4)
2016-02-26 00:56:04 pwaring I'll probably settle for a beer at Oggcamp :)
2016-02-26 00:56:06 > charlesay (~daro3@zecd5.pia.fu-berlin.de) has joined #linuxvoice
2016-02-26 00:56:08 > gregoriosw_vp (~gregorios@176.126.244.125) has joined #linuxvoice
2016-02-26 00:59:23 < brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has quit (Quit: Konversation terminated!)
2016-02-26 01:11:46 > vex21 (~vex@r1.danet.cz) has joined #linuxvoice
2016-02-26 01:23:05 > triviadave (~malvolio@cpc1-perr18-2-0-cust240.19-1.cable.virginm.net) has joined #linuxvoice
2016-02-26 01:38:47 > jaake (~h4ckm3@129.59.122.17) has joined #linuxvoice
2016-02-26 01:42:39 < vex21 (~vex@r1.danet.cz) has quit (Quit: Leaving.)
2016-02-26 01:54:22 < arubislander (~ubuntuadm@86.93.93.218) has quit (Quit: Leaving.)
2016-02-26 01:55:34 > arubislander (~ubuntuadm@86.93.93.218) has joined #linuxvoice
2016-02-26 02:12:52 > g0nz085 (~gonzo@cpc81199-farn9-2-0-cust619.6-2.cable.virginm.net) has joined #linuxvoice
2016-02-26 02:27:01 < blahdeblah (~quassel@unaffiliated/blahdeblah) has quit (Ping timeout: 240 seconds)
2016-02-26 02:28:00 < arubislander (~ubuntuadm@86.93.93.218) has quit (Quit: Leaving.)
2016-02-26 02:28:24 > blahdeblah (~quassel@unaffiliated/blahdeblah) has joined #linuxvoice
2016-02-26 02:30:15 > arubislander (~ubuntuadm@86.93.93.218) has joined #linuxvoice
2016-02-26 02:38:39 < HEGX64 (~Scott@CPE-121-214-211-228.lns6.fli.bigpond.net.au) has quit (Quit: Leaving)
2016-02-26 02:43:48 < arubislander (~ubuntuadm@86.93.93.218) has quit (Remote host closed the connection)
2016-02-26 02:45:32 > arubislander (~ubuntuadm@86.93.93.218) has joined #linuxvoice
2016-02-26 02:51:19 < gregoriosw_vp (~gregorios@176.126.244.125) has quit (Quit: WeeChat 1.4)
2016-02-26 02:51:20 < writtenoff (~writtenof@172.218.204.26) has quit (Quit: WeeChat 1.3)
2016-02-26 02:51:45 > gregoriosw_vp (~gregorios@176.126.244.125) has joined #linuxvoice
2016-02-26 02:53:59 < matthew1471_ (~matthew14@194.74.188.133) has quit (Quit: Leaving)
2016-02-26 03:02:22 < mnavrati (~milan@94.113.220.233) has quit (Ping timeout: 255 seconds)
2016-02-26 03:19:10 < charlesay (~daro3@zecd5.pia.fu-berlin.de) has quit (Quit: leaving)
2016-02-26 03:36:45 < jherrmann (jirkah@nat/redhat/x-nlsjejobvbmvdhaz) has quit (Quit: Toodle pip!)
2016-02-26 03:54:18 > mnavrati (~milan@ip-37-188-234-125.eurotel.cz) has joined #linuxvoice
2016-02-26 04:12:25 < arubislander (~ubuntuadm@86.93.93.218) has quit (Quit: Leaving.)
2016-02-26 04:18:00 > writtenoff (~writtenof@of1.psych.ubc.ca) has joined #linuxvoice
2016-02-26 04:24:40 < andybalaam (andybalaam@nat/ibm/x-kddjgfmonkfvehvv) has quit (Remote host closed the connection)
2016-02-26 04:28:33 < Aikidokajeff (~Thunderbi@213.106.248.240) has quit (Quit: Aikidokajeff)
2016-02-26 04:38:09 < TwistedLucidity (~TwistedLu@cpc80671-stap13-2-0-cust118.12-2.cable.virginm.net) has quit (Quit: Konversation terminated!)
2016-02-26 04:49:55 < M1C4HTRON13 (~micah@bodhilinux/team/M1C4HTRON13) has quit (Ping timeout: 248 seconds)
2016-02-26 04:50:17 > chemist69_ (~apl@a89-182-160-117.net-htp.de) has joined #linuxvoice
2016-02-26 04:53:24 < chemist69 (~apl@a89-182-176-14.net-htp.de) has quit (Ping timeout: 276 seconds)
2016-02-26 04:59:12 > M1C4HTRON13 (~micah@84.203.55.61) has joined #linuxvoice
2016-02-26 04:59:12 < M1C4HTRON13 (~micah@84.203.55.61) has quit (Changing host)
2016-02-26 04:59:12 > M1C4HTRON13 (~micah@bodhilinux/team/M1C4HTRON13) has joined #linuxvoice
2016-02-26 04:59:20 - foxhunt72 is now known as foxhunt_away
2016-02-26 05:05:54 < M1C4HTRON13 (~micah@bodhilinux/team/M1C4HTRON13) has quit (Quit: Leaving)
2016-02-26 05:07:34 < Guest3704 (~Thunderbi@te6compton.te.rl.ac.uk) has quit (Ping timeout: 240 seconds)
2016-02-26 05:22:27 < TraceyC (~TraceyC@ng2.cptxoffice.net) has quit (Ping timeout: 248 seconds)
2016-02-26 05:27:38 > jherrmann (~jirkah@ip4-83-240-20-19.cust.nbox.cz) has joined #linuxvoice
2016-02-26 05:35:30 > TraceyC (~TraceyC@2620:0:28a2:4020:dcee:cc06:482f:8281) has joined #linuxvoice
2016-02-26 05:46:20 > l0b0 (519cbfd7@gateway/web/freenode/ip.81.156.191.215) has joined #linuxvoice
2016-02-26 05:48:25 > iaoakes_ (sid64782@gateway/web/irccloud.com/x-bjlgilzlxpggygwo) has joined #linuxvoice
2016-02-26 05:49:17 iaoakes_ Hi
2016-02-26 05:49:28 TraceyC hiya
2016-02-26 05:49:43 iaoakes_ How goes?
2016-02-26 05:49:53 @degville I've just put the latest podcast up: https://www.linuxvoice.com/podcast-season-4-episode-4/
2016-02-26 05:50:02 l0b0 What should I do when my comment has been "awaiting moderation" for two days?
2016-02-26 05:50:04 mcphail listening now :)
2016-02-26 05:50:17 iaoakes_ Listening already
2016-02-26 05:50:24 iaoakes_ Lucky guess
2016-02-26 05:50:36 TraceyC yay podcast
2016-02-26 05:50:54 iaoakes_ I was like I wonder.... Yay
2016-02-26 05:51:03 @degville l0b0: on linuxvoice.com? O
2016-02-26 05:51:08 @degville I'll check...
2016-02-26 05:51:12 l0b0 Yes, last Voice of the Masses
2016-02-26 05:51:29 l0b0 I wrote a relatively long comment about Awesome WM
2016-02-26 05:51:31 @degville Just approved it.
2016-02-26 05:51:38 l0b0 :)
2016-02-26 05:51:41 @degville Sorry. Not sure why isn't wasn't checked.
2016-02-26 05:52:14 l0b0 PS: The link to the Voice of the Masses from the latest podcast just links to ... the podcast :)
2016-02-26 05:52:44 iaoakes_ What's voice of the masses
2016-02-26 05:53:14 l0b0 iaoakes_: https://www.linuxvoice.com/category/vom/
2016-02-26 05:53:32 @degville ugh, I"m so rubbish.
2016-02-26 05:53:39 @degville Fixed now, thanks.
2016-02-26 05:53:43 l0b0 NP
2016-02-26 05:55:32 > asusk7m550 (~Thunderbi@2001:981:97b3:1:48f:83e1:d220:502) has joined #linuxvoice
2016-02-26 05:57:46 iaoakes_ FBI didn't arrest someone...
2016-02-26 05:59:00 < mnavrati (~milan@ip-37-188-234-125.eurotel.cz) has quit (Quit: Leaving)
2016-02-26 05:59:24 mcphail we should have a coordinated podcast listening/irc session sometime
2016-02-26 06:00:13 iaoakes_ Yeah I was thinking that
2016-02-26 06:00:41 l0b0 +1
2016-02-26 06:00:42 iaoakes_ There's a mcphail Rd not too far from me
2016-02-26 06:00:47 @degville We should. It's a good idea. Or maybe something like mumble (I was on Linux Unplugged this week and it works well)
2016-02-26 06:00:51 TraceyC With audience participation?
2016-02-26 06:00:52 TraceyC :D
2016-02-26 06:01:02 TraceyC I've used mumble, solid software
2016-02-26 06:01:20 @degville yeah, why not. I can always edit it out :)
2016-02-26 06:01:32 iaoakes_ Or a conference on freeswitch
2016-02-26 06:01:41 - irc: disconnected from server
2016-02-26 06:49:07 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-02-26 06:49:07 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-02-26 06:49:07 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-02-26 06:49:07 - Channel #linuxvoice: 74 nicks (1 op, 0 voices, 73 normals)
2016-02-26 06:49:16 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-02-26 06:51:38 < jherrmann (~jirkah@ip4-83-240-20-19.cust.nbox.cz) has quit (Quit: Toodle pip!)
2016-02-26 06:51:52 > ideasman42 (~cambo@203-206-123-225.dyn.iinet.net.au) has joined #linuxvoice
2016-02-26 06:57:53 > Paddy_NI (~Patrick@host-92-14-224-66.as43234.net) has joined #linuxvoice
2016-02-26 07:14:59 < TraceyC (~TraceyC@2620:0:28a2:4020:dcee:cc06:482f:8281) has quit (Ping timeout: 240 seconds)
2016-02-26 07:17:43 < l0b0 (519cbfd7@gateway/web/freenode/ip.81.156.191.215) has quit (Quit: Page closed)
2016-02-26 07:23:50 > vex21 (~vex@ip-62-245-125-253.net.upcbroadband.cz) has joined #linuxvoice
2016-02-26 07:32:55 > TraceyC (~TraceyC@ng2.cptxoffice.net) has joined #linuxvoice
2016-02-26 07:41:50 < hamgammon (~hamgammon@188.226.144.192) has quit (Ping timeout: 255 seconds)
2016-02-26 07:42:16 > hamgammon (~hamgammon@188.226.144.192) has joined #linuxvoice
2016-02-26 07:49:02 > Rinux (5695ce5e@gateway/web/freenode/ip.86.149.206.94) has joined #linuxvoice
2016-02-26 08:04:16 > anglic00 (~james____@81-86-151-146.dsl.pipex.com) has joined #linuxvoice
2016-02-26 08:04:40 < TraceyC (~TraceyC@ng2.cptxoffice.net) has quit (Quit: Off I go into the wild, blue yonder)
2016-02-26 08:05:18 > blahdeblah_ (~quassel@unaffiliated/blahdeblah) has joined #linuxvoice
2016-02-26 08:06:43 < blahdeblah (~quassel@unaffiliated/blahdeblah) has quit (Ping timeout: 248 seconds)
2016-02-26 08:08:22 < jaake (~h4ckm3@129.59.122.17) has quit (Ping timeout: 255 seconds)
2016-02-26 08:11:16 < vex21 (~vex@ip-62-245-125-253.net.upcbroadband.cz) has left #linuxvoice
2016-02-26 08:25:57 < Rinux (5695ce5e@gateway/web/freenode/ip.86.149.206.94) has quit (Quit: Page closed)
2016-02-26 08:27:18 - foxhunt72 is now known as foxhunt_away
2016-02-26 08:38:56 mcphail https://sfconservancy.org/blog/2016/feb/25/zfs-and-linux/ - nice to see someone shares my concern about this
2016-02-26 08:50:59 < Paddy_NI (~Patrick@host-92-14-224-66.as43234.net) has quit (Ping timeout: 240 seconds)
2016-02-26 08:58:04 > swift110 (~swift110@64.26.99.248) has joined #linuxvoice
2016-02-26 08:59:12 < swift110 (~swift110@64.26.99.248) has quit (Changing host)
2016-02-26 08:59:13 > swift110 (~swift110@unaffiliated/swift110) has joined #linuxvoice
2016-02-26 09:04:01 > brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has joined #linuxvoice
2016-02-26 09:04:01 > Paddy_NI (~Patrick@104.238.169.107) has joined #linuxvoice
2016-02-26 09:22:49 < Paddy_NI (~Patrick@104.238.169.107) has quit (Quit: Leaving)
2016-02-26 09:28:20 < asusk7m550 (~Thunderbi@2001:981:97b3:1:48f:83e1:d220:502) has quit (Remote host closed the connection)
2016-02-26 09:33:05 - blahdeblah_ is now known as blahdeblah
2016-02-26 09:35:28 < gb00s (~gb00s@c50-31.i07-13.onvol.net) has quit (Quit: Leaving)
2016-02-26 09:51:40 < aptanet (~quassel@humpback.aptanet.net) has quit (Remote host closed the connection)
2016-02-26 09:53:14 > aptanet (~quassel@humpback.aptanet.net) has joined #linuxvoice
2016-02-26 10:46:31 > Arthur_D (~magne@195.1.125.245) has joined #linuxvoice
2016-02-26 11:17:28 - mnavrati is now known as mnavrati_afk
2016-02-26 11:25:07 > vex21 (~vex@ip-62-245-125-253.net.upcbroadband.cz) has joined #linuxvoice
2016-02-26 11:26:56 < anglic00 (~james____@81-86-151-146.dsl.pipex.com) has quit (Quit: Leaving)
2016-02-26 11:34:56 < vex21 (~vex@ip-62-245-125-253.net.upcbroadband.cz) has quit (Quit: Leaving.)
2016-02-26 11:42:06 < writtenoff (~writtenof@of1.psych.ubc.ca) has quit (Quit: WeeChat 1.3)
2016-02-26 12:19:37 > swift110_ (~swift110@64.26.99.248) has joined #linuxvoice
2016-02-26 12:31:32 > HEGX64 (~Scott@CPE-121-214-211-228.lns6.fli.bigpond.net.au) has joined #linuxvoice
2016-02-26 12:32:02 < swift110_ (~swift110@64.26.99.248) has quit (Remote host closed the connection)
2016-02-26 12:40:30 < swift110 (~swift110@unaffiliated/swift110) has quit (Read error: Connection reset by peer)
2016-02-26 13:26:27 > swift110-phone (~swift110-@unaffiliated/swift110) has joined #linuxvoice
2016-02-26 13:45:41 > zmoylan-1i (~pi@109.79.36.70) has joined #linuxvoice
2016-02-26 13:48:12 < zmoylan-pi (~pi@109.77.250.186) has quit (Ping timeout: 244 seconds)
2016-02-26 13:53:33 > chemist69 (~apl@a89-182-174-127.net-htp.de) has joined #linuxvoice
2016-02-26 13:56:35 < chemist69_ (~apl@a89-182-160-117.net-htp.de) has quit (Ping timeout: 248 seconds)
2016-02-26 14:01:35 < HEGX64 (~Scott@CPE-121-214-211-228.lns6.fli.bigpond.net.au) has quit (Quit: Leaving)
2016-02-26 15:32:53 < swift110-phone (~swift110-@unaffiliated/swift110) has quit (Remote host closed the connection)
2016-02-26 16:01:09 > zmoylan-pi (~pi@109.76.64.149) has joined #linuxvoice
2016-02-26 16:04:28 < zmoylan-1i (~pi@109.79.36.70) has quit (Ping timeout: 252 seconds)
2016-02-26 16:47:47 > gb00s (~gb00s@c50-31.i07-13.onvol.net) has joined #linuxvoice
2016-02-26 17:11:07 < mnavrati_afk (~milan@ip-94-113-220-233.net.upcbroadband.cz) has quit (Quit: Leaving)
2016-02-26 17:26:06 > HEGX64 (~Scott@CPE-121-214-211-228.lns6.fli.bigpond.net.au) has joined #linuxvoice
2016-02-26 17:37:59 > milosmilos (uid148607@gateway/web/irccloud.com/x-ovzhjqgpkhtuocbk) has joined #linuxvoice
2016-02-26 18:16:58 > vex21 (~vex@46.227.14.164) has joined #linuxvoice
2016-02-26 18:43:49 > swift110-phone (~swift110-@unaffiliated/swift110) has joined #linuxvoice
2016-02-26 18:43:51 swift110-phone Hey
2016-02-26 18:48:14 > ddeimeke (~dirk@moas.mhochzwei.net) has joined #linuxvoice
2016-02-26 18:59:03 - foxhunt_away is now known as foxhunt72
2016-02-26 18:59:15 > jherrmann (~jirkah@ip4-83-240-20-19.cust.nbox.cz) has joined #linuxvoice
2016-02-26 19:18:13 < vex21 (~vex@46.227.14.164) has left #linuxvoice
2016-02-26 19:36:22 > mnavrati (milan@nat/redhat/x-ukuxnyedwuftxvuu) has joined #linuxvoice
2016-02-26 19:36:23 > TwistedLucidity (~TwistedLu@cpc80671-stap13-2-0-cust118.12-2.cable.virginm.net) has joined #linuxvoice
2016-02-26 19:41:48 swift110-phone Hey foxhunt72
2016-02-26 19:52:37 > jimbotux (~jimbotux@fpc3-sgyl30-2-0-cust5.18-2.static.cable.virginm.net) has joined #linuxvoice
2016-02-26 19:55:09 > Mihaly (~chatzilla@pa49-182-129-73.pa.nsw.optusnet.com.au) has joined #linuxvoice
2016-02-26 19:57:45 Mihaly hey yeah... had a slight addition for your finds ... "du -Sh" will give a "human-readable" "Summary" showing only the essential result,
2016-02-26 19:58:06 @degville thanks Mihaly. I'll give it a go.
2016-02-26 19:58:42 Mihaly but the really clever bit is that if you "du -Sh *" it shows a listing of directories sizes - really handy occasionally. Thats the clever bit.
2016-02-26 20:01:45 swift110-phone Hmm
2016-02-26 20:03:40 Mihaly it will also show your dot directories... which may be a downside.... but if you're wondering where all that data usage exactly /is/ under your main CWD, that's the command that will show you.
2016-02-26 20:04:17 Mihaly it depends what your CWD is, of course...
2016-02-26 20:08:08 Mihaly am on Sydney time here. excuse me... sorry. Am catching up on latest podcats
2016-02-26 20:08:16 jimbotux morning :)
2016-02-26 20:08:38 Mihaly Andrew has just opened the packaging ....
2016-02-26 20:08:47 jimbotux http://www.theregister.co.uk/2016/02/26/canonical_in_zfsonlinux_gpl_violation_spat/
2016-02-26 20:08:52 Mihaly good evening
2016-02-26 20:10:28 jimbotux are canonical in the wrong here? I was under the assumption that ZFS couldnt be distributed with GPL software? So I think they are wrong.
2016-02-26 20:10:41 jimbotux But im no license expert...
2016-02-26 20:10:46 mcphail Mihaly: a useful added switch is "-t" which will only print out directories over the given size threshold, e.g. "du -Sh -t 100M ."
2016-02-26 20:10:49 Mihaly so who /may/ use ZFS, and is it a problem? Surely ZFS isn't recquired, it;s optional? we could choose to use any FS
2016-02-26 20:11:03 jimbotux They are making it the default for containers
2016-02-26 20:11:21 jimbotux So when you rev up a ubuntu lxc i think its the default fs
2016-02-26 20:11:26 Mihaly ah,noce touch Mcphail! is it +t or -t?
2016-02-26 20:11:42 mcphail jimbotux: I think Canonical are straying into territory which is only going to distract them from more useful things
2016-02-26 20:12:10 mcphail Mihaly: I think you can add a + or - to the size itself for "bigger or smaller than"
2016-02-26 20:12:32 jimbotux ZFS is great tho! I really want it to come to Linux properly without this whole external repos etc
2016-02-26 20:13:00 jimbotux So as much as i dislike canonical this could be really good!
2016-02-26 20:13:12 Mihaly I suppose I usually would have used some form of post-cmd filter, or the sort , but I'm no command libne guru.
2016-02-26 20:13:31 mcphail jimbotux: even if they "win" the legal argument, they're going to be left maintaining a filesystem which has been largely abandoned upstream and will never reach kernel support. Just crazy
2016-02-26 20:14:32 > andybalaam (andybalaam@nat/ibm/x-wtubnkapybeznbqb) has joined #linuxvoice
2016-02-26 20:14:47 Mihaly say something like "du -Sh -t100M *" to show only directories >100M in size? but I was only trying to just be clever, and I'm not nearly that
2016-02-26 20:15:30 Mihaly and wouldn't you have to specifiy Mb or whatever to fit with the -h delimiter format?
2016-02-26 20:16:10 Mihaly BTW how common in actual /usage/ is ZFS?
2016-02-26 20:16:40 mcphail Mihaly: you've specified 100M - you don't need anything fancier to further specify the size. Good to go already
2016-02-26 20:19:03 Mihaly I guess I was simply using what I would use, and I daren't go too much further, so if I needed to I would scroll back, but yeah you're right specifying size with the t option would add to the ability to hone in on certain directories. I don't actually use the command frequent;y enough
2016-02-26 20:19:31 mcphail Mihaly: I use it to track down disk-hogs on my phone
2016-02-26 20:23:32 Mihaly something just to the left of that website mentioned zfs above - Euro Patent office heads rapidly toward meltdown .... WTF?!!
2016-02-26 20:24:13 jimbotux mcphail, i dont think its abandoned at all? https://github.com/zfsonlinux/zfs/graphs/contributors
2016-02-26 20:24:18 Mihaly argghh! Just noticed the other headline as well ... huge licencing fees??
2016-02-26 20:25:13 jimbotux Looks fairly active. Also joyent run ZFS on smartOS and it backs their whole cloud. So i really dont think its abandoned
2016-02-26 20:25:21 Mihaly I just stopped when you could basically get your head around efs3/4 - journalling useful for sysadmins, fine, but for home users?
2016-02-26 20:25:35 Mihaly and what about BTRFS?
2016-02-26 20:27:55 Mihaly thats all the weather for now - value for money - i agree wholeheartedly. and you will stay in the eu. I tried to support you with PayPal, but you wouldn't accept my payment, so I just bought two copies of issue 24 LinuxVoice.
2016-02-26 20:28:32 Mihaly hmmm, nice ending music. like it.
2016-02-26 20:29:55 Mihaly Beep Beep Yargh - hope it does well. Best wishes honestly.
2016-02-26 20:30:34 @degville thanks :) the ending music is there because I didn't have the right mix of Brad Sucks handy, but I had the music I did for the Beep Beep Yarr video.
2016-02-26 20:31:07 @degville we had lots of technical issues with that podcast and I couldn't spend any more time on it.
2016-02-26 20:32:01 Mihaly it turned out fine as far as I could tell -I only buy it for the articles as you know :)
2016-02-26 20:34:16 Mihaly have to sign off for the moment, Silent Witness coming on TV now. Will catch up later?
2016-02-26 20:34:23 @degville Speak to you later!
2016-02-26 20:34:35 Mihaly cheers!
2016-02-26 20:34:54 < Mihaly (~chatzilla@pa49-182-129-73.pa.nsw.optusnet.com.au) has quit (Quit: ChatZilla 0.9.92 [Firefox 41.0.2/20151014143721])
2016-02-26 20:35:01 < towy71 (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has quit (Ping timeout: 240 seconds)
2016-02-26 20:35:03 > towy71_ (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has joined #linuxvoice
2016-02-26 20:45:56 > Aikidokajeff (~Thunderbi@213.106.248.240) has joined #linuxvoice
2016-02-26 21:06:19 < felimwhiteley_ (~quassel@89.101.203.26) has quit (Remote host closed the connection)
2016-02-26 21:11:54 < swift110-phone (~swift110-@unaffiliated/swift110) has quit (Remote host closed the connection)
2016-02-26 21:19:04 < towy71_ (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has quit (Ping timeout: 240 seconds)
2016-02-26 21:21:22 > towy71 (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has joined #linuxvoice
2016-02-26 21:22:31 > arubislander (~ubuntuadm@86.93.93.218) has joined #linuxvoice
2016-02-26 21:23:21 < gregoriosw_vp (~gregorios@176.126.244.125) has quit (Quit: WeeChat 1.4)
2016-02-26 21:23:40 > gregoriosw_vp (~gregorios@176.126.244.125) has joined #linuxvoice
2016-02-26 21:29:04 > Paddy_NI (~Patrick@104.238.169.142) has joined #linuxvoice
2016-02-26 21:33:07 > swift110-phone (~swift110-@unaffiliated/swift110) has joined #linuxvoice
2016-02-26 22:37:01 Devilment The Book People dropped off their latest selection of discounted books at our office. I was looking down the order form and one title caught my eye. "Gramer for Grown-ups."
2016-02-26 22:37:42 zmoylan-pi i like the look of the new ladybird books for adults...
2016-02-26 22:53:27 Devilment The Ladybird book on Cooking Meth by W White
2016-02-26 23:00:50 < jimbotux (~jimbotux@fpc3-sgyl30-2-0-cust5.18-2.static.cable.virginm.net) has quit (Ping timeout: 252 seconds)
2016-02-26 23:03:07 > towy71_ (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has joined #linuxvoice
2016-02-26 23:05:23 < towy71 (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has quit (Ping timeout: 248 seconds)
2016-02-26 23:06:43 LagerMon I was quite looking forward to ZFS, but there is a chance it just will not happen:
2016-02-26 23:07:00 LagerMon http://linux.slashdot.org/story/16/02/25/1846230/software-freedom-conservancy-distributing-linux-with-zfs-is-illegal
2016-02-26 23:12:01 < aptanet (~quassel@humpback.aptanet.net) has quit (Ping timeout: 250 seconds)
2016-02-26 23:14:27 > jimbotux (~jimbotux@wrightchris46.plus.com) has joined #linuxvoice
2016-02-26 23:15:13 < ideasman42 (~cambo@203-206-123-225.dyn.iinet.net.au) has quit (Remote host closed the connection)
2016-02-26 23:20:15 einonm LagerMon: I can't see any reason why you can't use ZFS with Linux - it's just the distribution that's an issue?
2016-02-26 23:26:06 < Paddy_NI (~Patrick@104.238.169.142) has quit (Quit: Leaving)
2016-02-26 23:26:17 > Paddy_NI (~Patrick@104.238.169.142) has joined #linuxvoice
2016-02-26 23:26:53 < Paddy_NI (~Patrick@104.238.169.142) has quit (Remote host closed the connection)
2016-02-26 23:34:15 LagerMon einonm: True, but it would be nice to have it as an install option. And if I have to install a not included FS I will not do it to my primary machine.
2016-02-26 23:45:43 < mnavrati (milan@nat/redhat/x-ukuxnyedwuftxvuu) has quit (Ping timeout: 255 seconds)
2016-02-26 23:46:59 < jimbotux (~jimbotux@wrightchris46.plus.com) has quit (Ping timeout: 248 seconds)
2016-02-26 23:56:34 < blahdeblah (~quassel@unaffiliated/blahdeblah) has quit (Ping timeout: 240 seconds)
2016-02-26 23:57:55 - foxhunt72 is now known as foxhunt_away
2016-02-26 23:58:03 > mnavrati (milan@nat/redhat/x-xgusmepszoaobrap) has joined #linuxvoice
2016-02-27 00:00:28 > jimbotux (~jimbotux@94.173.174.150) has joined #linuxvoice
2016-02-27 00:32:26 < Aikidokajeff (~Thunderbi@213.106.248.240) has quit (Ping timeout: 244 seconds)
2016-02-27 00:35:48 > blahdeblah (~quassel@unaffiliated/blahdeblah) has joined #linuxvoice
2016-02-27 00:36:51 > Aikidokajeff (~Thunderbi@primary.bertrams.com) has joined #linuxvoice
2016-02-27 00:42:08 > jaake (~h4ckm3@129.59.122.17) has joined #linuxvoice
2016-02-27 00:43:27 < Aikidokajeff (~Thunderbi@primary.bertrams.com) has quit (Ping timeout: 250 seconds)
2016-02-27 00:44:50 > georgeowell (~georgeowe@95.149.192.154) has joined #linuxvoice
2016-02-27 00:47:36 > Aikidokajeff (~Thunderbi@primary.bertrams.com) has joined #linuxvoice
2016-02-27 00:48:58 < HEGX64 (~Scott@CPE-121-214-211-228.lns6.fli.bigpond.net.au) has quit (Ping timeout: 244 seconds)
2016-02-27 00:52:40 < Aikidokajeff (~Thunderbi@primary.bertrams.com) has quit (Quit: Aikidokajeff)
2016-02-27 00:59:13 > Aikidokajeff (~Thunderbi@primary.bertrams.com) has joined #linuxvoice
2016-02-27 01:24:01 < brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has quit (Quit: Konversation terminated!)
2016-02-27 01:40:35 < jaake (~h4ckm3@129.59.122.17) has quit (Ping timeout: 248 seconds)
2016-02-27 01:44:03 > jaake (~h4ckm3@129.59.122.17) has joined #linuxvoice
2016-02-27 01:49:34 - foxhunt_away is now known as foxhunt72
2016-02-27 02:08:40 < mnavrati (milan@nat/redhat/x-xgusmepszoaobrap) has quit (Quit: Leaving)
2016-02-27 02:39:54 swift110-phone Hey guys
2016-02-27 02:43:56 > M1C4HTRON13 (~micah@84.203.55.61) has joined #linuxvoice
2016-02-27 02:43:56 < M1C4HTRON13 (~micah@84.203.55.61) has quit (Changing host)
2016-02-27 02:43:56 > M1C4HTRON13 (~micah@bodhilinux/team/M1C4HTRON13) has joined #linuxvoice
2016-02-27 02:49:33 < jaake (~h4ckm3@129.59.122.17) has quit (Ping timeout: 250 seconds)
2016-02-27 02:56:46 < arubislander (~ubuntuadm@86.93.93.218) has quit (Quit: Leaving.)
2016-02-27 03:00:27 < jherrmann (~jirkah@ip4-83-240-20-19.cust.nbox.cz) has quit (Quit: Toodle pip!)
2016-02-27 03:04:22 > jaake (~h4ckm3@129.59.122.17) has joined #linuxvoice
2016-02-27 03:05:46 > Nitronium (~Dave@host213-1-14-213.range213-1.btcentralplus.com) has joined #linuxvoice
2016-02-27 03:06:38 - foxhunt72 is now known as foxhunt_away
2016-02-27 03:07:23 > mnavrati (~milan@ip-94-113-220-233.net.upcbroadband.cz) has joined #linuxvoice
2016-02-27 03:31:19 - mnavrati is now known as mnavrati_afk
2016-02-27 03:36:53 < M1C4HTRON13 (~micah@bodhilinux/team/M1C4HTRON13) has quit (Ping timeout: 244 seconds)
2016-02-27 03:45:13 < SonikArc (~prayingma@203-7-33-136.dyn.iinet.net.au) has quit (Ping timeout: 240 seconds)
2016-02-27 03:48:57 < Arthur_D (~magne@195.1.125.245) has quit (Quit: Leaving)
2016-02-27 04:09:30 > writtenoff (~writtenof@of1.psych.ubc.ca) has joined #linuxvoice
2016-02-27 04:27:52 - irc: disconnected from server
2016-02-27 04:28:21 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-02-27 04:28:21 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-02-27 04:28:21 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-02-27 04:28:21 - Channel #linuxvoice: 74 nicks (1 op, 0 voices, 73 normals)
2016-02-27 04:28:35 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-02-27 04:31:00 > arubislander (~ubuntuadm@86.93.93.218) has joined #linuxvoice
2016-02-27 04:33:11 Ioangogo http://liamja.co.uk/Prebake/
2016-02-27 04:33:52 < arubislander (~ubuntuadm@86.93.93.218) has quit (Read error: Connection reset by peer)
2016-02-27 04:34:14 > arubislander (~ubuntuadm@86.93.93.218) has joined #linuxvoice
2016-02-27 04:34:34 < jaake (~h4ckm3@129.59.122.17) has quit (Ping timeout: 240 seconds)
2016-02-27 04:42:06 < arubislander (~ubuntuadm@86.93.93.218) has quit (Ping timeout: 276 seconds)
2016-02-27 04:54:40 > pdq_ (~pdq@p200300454319660054C715119CC10DA1.dip0.t-ipconnect.de) has joined #linuxvoice
2016-02-27 04:59:55 > jaake (~h4ckm3@129.59.122.17) has joined #linuxvoice
2016-02-27 05:00:25 < TwistedLucidity (~TwistedLu@cpc80671-stap13-2-0-cust118.12-2.cable.virginm.net) has quit (Quit: Konversation terminated!)
2016-02-27 05:05:29 < andybalaam (andybalaam@nat/ibm/x-wtubnkapybeznbqb) has quit (Remote host closed the connection)
2016-02-27 05:27:18 - NYbill is now known as peikkosphere
2016-02-27 05:27:54 - peikkosphere is now known as nybill
2016-02-27 05:43:01 > jherrmann (~jirkah@ip4-83-240-20-19.cust.nbox.cz) has joined #linuxvoice
2016-02-27 06:26:51 > Ian1 (~Thunderbi@host86-157-26-205.range86-157.btcentralplus.com) has joined #linuxvoice
2016-02-27 06:30:52 < mnavrati_afk (~milan@ip-94-113-220-233.net.upcbroadband.cz) has quit (Quit: Leaving)
2016-02-27 06:33:54 < Ian1 (~Thunderbi@host86-157-26-205.range86-157.btcentralplus.com) has quit (Ping timeout: 276 seconds)
2016-02-27 06:54:25 < evilnickveitch (~evilnick@cpc83321-bath6-2-0-cust252.18-1.cable.virginm.net) has quit (Quit: Leaving)
2016-02-27 06:55:27 > asusk7m550 (~Thunderbi@2001:981:97b3:1:5457:3e9:1207:bb2e) has joined #linuxvoice
2016-02-27 07:03:40 > dankeast (~dan@host86-183-174-170.range86-183.btcentralplus.com) has joined #linuxvoice
2016-02-27 07:22:55 < pdq_ (~pdq@p200300454319660054C715119CC10DA1.dip0.t-ipconnect.de) has quit (Remote host closed the connection)
2016-02-27 07:25:02 theru this might bring a few to the kickstarter :) https://boingboing.net/2016/02/26/kickstarting-a-pirate-themed-p.html
2016-02-27 07:42:55 - vertreko_ is now known as vertreko
2016-02-27 07:46:02 - foxhunt_away is now known as foxhunt72
2016-02-27 08:08:40 - nybill is now known as NYbill
2016-02-27 08:10:45 < jaake (~h4ckm3@129.59.122.17) has quit (Ping timeout: 276 seconds)
2016-02-27 08:17:02 > swift110 (~swift110@107.19.190.5) has joined #linuxvoice
2016-02-27 08:17:50 < swift110 (~swift110@107.19.190.5) has quit (Changing host)
2016-02-27 08:17:51 > swift110 (~swift110@unaffiliated/swift110) has joined #linuxvoice
2016-02-27 08:28:31 - Devilmen1 is now known as Devilment
2016-02-27 08:31:40 > gamerchick02 (~gamerchic@c-68-36-7-43.hsd1.mi.comcast.net) has joined #linuxvoice
2016-02-27 08:34:37 Devilment http://www.theregister.co.uk/2016/02/26/raspberry_pi_3/
2016-02-27 08:34:55 Devilment Well, there's LV and LXF's front pages for the next few issues
2016-02-27 08:35:53 dankeast wifi and bluetooth?
2016-02-27 08:36:59 dankeast unix lost out on the microcomputer market early on because it was considered too low powerful. dos filled that market, which destroyed the minicomputers...
2016-02-27 08:37:45 dankeast sounds like the reverse is happening since the unix oses are the only things that will fit on these tiny things
2016-02-27 08:38:14 dankeast hdmi+wifi+bluetooth = hassle free desktop computer
2016-02-27 08:38:41 swift110 hey all
2016-02-27 08:40:04 dankeast heya
2016-02-27 08:47:59 > user03 (~user03@ip72-200-42-41.no.no.cox.net) has joined #linuxvoice
2016-02-27 08:51:21 - foxhunt72 is now known as foxhunt_away
2016-02-27 08:51:23 < georgeowell (~georgeowe@95.149.192.154) has quit (Quit: Leaving)
2016-02-27 08:55:22 < user03 (~user03@ip72-200-42-41.no.no.cox.net) has quit (Quit: Leaving)
2016-02-27 09:05:29 < asusk7m550 (~Thunderbi@2001:981:97b3:1:5457:3e9:1207:bb2e) has quit (Remote host closed the connection)
2016-02-27 09:06:43 swift110 how are dankeast
2016-02-27 09:14:55 corsack looks like RPi 3 will save us a couple of USB ports as we won't be needing Wifi and bluetooth dongles - nice one
2016-02-27 09:16:19 swift110 cool
2016-02-27 09:18:10 mcphail_ If the wifi is decoupled from that awful USB/ethernet abomination, it may finally be the Pi I have been waiting for
2016-02-27 09:19:14 swift110 sounds great
2016-02-27 09:20:22 < mavrix (~mavrix@unaffiliated/mavrix) has quit (Ping timeout: 255 seconds)
2016-02-27 09:22:33 > mavrix (~mavrix@unaffiliated/mavrix) has joined #linuxvoice
2016-02-27 09:22:35 mcphail_ I'll finally be able to lay my Sheevaplug to rest
2016-02-27 09:29:22 < mavrix (~mavrix@unaffiliated/mavrix) has quit (Ping timeout: 255 seconds)
2016-02-27 09:32:33 > mavrix (~mavrix@unaffiliated/mavrix) has joined #linuxvoice
2016-02-27 09:37:43 > towy71_ (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has joined #linuxvoice
2016-02-27 09:39:29 < mavrix (~mavrix@unaffiliated/mavrix) has quit (Ping timeout: 240 seconds)
2016-02-27 09:39:29 < towy71 (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has quit (Ping timeout: 240 seconds)
2016-02-27 09:41:02 > brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has joined #linuxvoice
2016-02-27 09:48:49 > mavrix (~mavrix@unaffiliated/mavrix) has joined #linuxvoice
2016-02-27 09:54:07 > LVbot (~iBot@huwloosley.plus.com) has joined #linuxvoice
2016-02-27 09:54:21 Ioangogo LVbot is back
2016-02-27 09:54:42 dankeast sorry, good thanks
2016-02-27 09:54:52 dankeast watching the first episode of mr. robot
2016-02-27 09:55:00 Ioangogo !help
2016-02-27 09:55:04 dankeast ... actually has fairly accurate tech
2016-02-27 09:55:22 dankeast references tor/gnome/kde/exit node
2016-02-27 09:55:37 Ioangogo Badly apparently
2016-02-27 09:55:48 > ideasman42 (~cambo@203-206-123-225.dyn.iinet.net.au) has joined #linuxvoice
2016-02-27 09:56:50 Ioangogo !readslinks
2016-02-27 10:00:42 < Nitronium (~Dave@host213-1-14-213.range213-1.btcentralplus.com) has quit (Remote host closed the connection)
2016-02-27 10:11:27 Ioangogo https://www.youtube.com/watch?v=yY96hTb8WgI
2016-02-27 10:11:29 LVbot ^ It's not you. Bad doors are everywhere. YouTube
2016-02-27 10:16:49 > SonikArc (~prayingma@203-7-33-136.dyn.iinet.net.au) has joined #linuxvoice
2016-02-27 10:40:02 < dankeast (~dan@host86-183-174-170.range86-183.btcentralplus.com) has quit (Ping timeout: 244 seconds)
2016-02-27 10:46:50 - irc: disconnected from server
2016-02-27 10:47:02 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-02-27 10:47:02 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-02-27 10:47:02 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-02-27 10:47:02 - Channel #linuxvoice: 74 nicks (1 op, 0 voices, 73 normals)
2016-02-27 10:47:12 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-02-27 10:48:20 < jherrmann (~jirkah@ip4-83-240-20-19.cust.nbox.cz) has quit (Remote host closed the connection)
2016-02-27 11:12:27 < swift110 (~swift110@unaffiliated/swift110) has quit (Ping timeout: 260 seconds)
2016-02-27 11:29:16 < gb00s (~gb00s@c50-31.i07-13.onvol.net) has quit (Quit: Leaving)
2016-02-27 11:53:51 < writtenoff (~writtenof@of1.psych.ubc.ca) has quit (Quit: WeeChat 1.3)
2016-02-27 19:55:35 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-02-27 19:55:35 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-02-27 19:55:35 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-02-27 19:55:35 - Channel #linuxvoice: 68 nicks (1 op, 0 voices, 67 normals)
2016-02-27 19:55:46 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-02-27 20:36:14 < dankeast (~dan@host86-183-174-170.range86-183.btcentralplus.com) has quit (Ping timeout: 268 seconds)
2016-02-27 20:50:51 > dankeast (~dan@host86-183-174-170.range86-183.btcentralplus.com) has joined #linuxvoice
2016-02-27 21:00:36 < ddeimeke (~dirk@moas.mhochzwei.net) has quit (Quit: leaving)
2016-02-27 21:01:34 < dankeast (~dan@host86-183-174-170.range86-183.btcentralplus.com) has quit (Ping timeout: 240 seconds)
2016-02-27 21:04:24 > HEGX64 (~Scott@CPE-121-214-211-228.lns6.fli.bigpond.net.au) has joined #linuxvoice
2016-02-27 22:18:54 < HEGX64 (~Scott@CPE-121-214-211-228.lns6.fli.bigpond.net.au) has quit (Quit: Leaving)
2016-02-27 22:19:14 > Nitronium (~Dave@host213-1-14-213.range213-1.btcentralplus.com) has joined #linuxvoice
2016-02-27 22:25:15 - mcphail_ is now known as mcphail
2016-02-27 22:34:55 > buono (~dave@host-92-3-37-182.as43234.net) has joined #linuxvoice
2016-02-27 22:42:29 > mjtowell (~mjtowell@unaffiliated/mjtowell) has joined #linuxvoice
2016-02-27 22:42:59 < buono (~dave@host-92-3-37-182.as43234.net) has quit (Ping timeout: 240 seconds)
2016-02-27 22:44:09 > buono (~dave@host-92-3-37-182.as43234.net) has joined #linuxvoice
2016-02-27 22:58:12 < mjtowell (~mjtowell@unaffiliated/mjtowell) has quit (Quit: Leaving)
2016-02-27 23:01:16 < corsack (~pi@cpc21-hudd9-2-0-cust116.4-1.cable.virginm.net) has quit (Ping timeout: 252 seconds)
2016-02-28 00:01:01 < brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has quit (Quit: Konversation terminated!)
2016-02-28 00:23:34 > SuperEngineer (~SuperEngi@host86-162-231-235.range86-162.btcentralplus.com) has joined #linuxvoice
2016-02-28 00:51:51 > corsack (~pi@cpc21-hudd9-2-0-cust116.4-1.cable.virginm.net) has joined #linuxvoice
2016-02-28 01:31:21 < SuperEngineer (~SuperEngi@host86-162-231-235.range86-162.btcentralplus.com) has quit (Quit: bfn...my planet needs me back)
2016-02-28 01:32:04 > Extremulus (~Extremulu@2001:470:b:1fb:a62:66ff:fec8:c5ca) has joined #linuxvoice
2016-02-28 01:42:31 < Extremulus (~Extremulu@2001:470:b:1fb:a62:66ff:fec8:c5ca) has quit (Remote host closed the connection)
2016-02-28 01:46:24 Devilment james_olympus: Do a few more swaps between Chrome and FF, see how many iterations you can get :)
2016-02-28 01:54:04 Ioangogo http://www.bbc.co.uk/news/magazine-23694438
2016-02-28 01:54:07 LVbot ^ Is there any such thing as road tax'? BBC News
2016-02-28 01:57:27 Ioangogo http://bbc.in/1QirKLc
2016-02-28 01:57:29 LVbot ^ Hampshire school calls police after pupil looks at UKIP website BBC News
2016-02-28 01:58:34 < frankbell (~The_Farme@ip98-183-208-12.hr.hr.cox.net) has quit (Quit: Leaving)
2016-02-28 01:58:36 Devilment /ignore LVbot
2016-02-28 01:58:38 Ioangogo even though Idont like Ukip, thats was a lapse of common sence by the school
2016-02-28 01:58:49 Ioangogo Devilment: Why
2016-02-28 01:59:12 Devilment Because I find IRCbots fscking annoying
2016-02-28 02:00:40 Ioangogo Hmm, if a few more people moan, ill turn the link reading off
2016-02-28 02:06:11 > Extremulus (~Extremulu@2001:470:b:1fb:deaf::d259) has joined #linuxvoice
2016-02-28 02:32:08 > ideasman42 (~cambo@203-206-123-225.dyn.iinet.net.au) has joined #linuxvoice
2016-02-28 02:39:01 corsack I don't mind it, at least I know where I'd end up before clicking on the link
2016-02-28 03:02:48 > frankbell (~The_Farme@ip98-183-208-12.hr.hr.cox.net) has joined #linuxvoice
2016-02-28 03:29:56 Ioangogo Wow, Mimic(And the orignal code) is a impresive voice engine
2016-02-28 03:36:49 - foxhunt_away is now known as foxhunt72
2016-02-28 03:40:28 < Nitronium (~Dave@host213-1-14-213.range213-1.btcentralplus.com) has quit (Remote host closed the connection)
2016-02-28 03:52:20 > dankeast (~dan@host86-183-174-170.range86-183.btcentralplus.com) has joined #linuxvoice
2016-02-28 04:15:16 < dankeast (~dan@host86-183-174-170.range86-183.btcentralplus.com) has quit (Ping timeout: 248 seconds)
2016-02-28 04:29:20 - foxhunt72 is now known as foxhunt_away
2016-02-28 04:41:14 - foxhunt_away is now known as foxhunt72
2016-02-28 04:50:16 > dankeast (~dan@host86-183-174-170.range86-183.btcentralplus.com) has joined #linuxvoice
2016-02-28 05:24:04 < dankeast (~dan@host86-183-174-170.range86-183.btcentralplus.com) has quit (Ping timeout: 252 seconds)
2016-02-28 05:28:50 > dankeast (~dan@host86-183-174-170.range86-183.btcentralplus.com) has joined #linuxvoice
2016-02-28 05:45:15 < buono (~dave@host-92-3-37-182.as43234.net) has quit (Remote host closed the connection)
2016-02-28 05:45:41 > buono (~dave@host-92-3-37-182.as43234.net) has joined #linuxvoice
2016-02-28 05:56:22 > gamerchick02 (~gamerchic@c-68-36-7-43.hsd1.mi.comcast.net) has joined #linuxvoice
2016-02-28 06:00:30 - foxhunt72 is now known as foxhunt_away
2016-02-28 06:06:39 - foxhunt_away is now known as foxhunt72
2016-02-28 06:22:41 < buono (~dave@host-92-3-37-182.as43234.net) has quit (Remote host closed the connection)
2016-02-28 06:23:07 > buono (~dave@host-92-3-37-182.as43234.net) has joined #linuxvoice
2016-02-28 06:24:54 - foxhunt72 is now known as foxhunt_away
2016-02-28 06:42:33 > asusk7m550 (~Thunderbi@2001:981:97b3:1:2c0d:160d:5ff8:959c) has joined #linuxvoice
2016-02-28 06:47:16 < buono (~dave@host-92-3-37-182.as43234.net) has quit (Quit: Konversation terminated!)
2016-02-28 07:04:14 < frankbell (~The_Farme@ip98-183-208-12.hr.hr.cox.net) has quit (Quit: Leaving)
2016-03-01 08:57:53 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-03-01 08:57:53 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-03-01 08:57:53 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-03-01 08:57:53 - Channel #linuxvoice: 75 nicks (1 op, 0 voices, 74 normals)
2016-03-01 08:58:03 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-03-01 08:58:36 > siamese (~cc@cpc70015-sand12-2-0-cust221.16-1.cable.virginm.net) has joined #linuxvoice
2016-03-01 09:06:05 < swift110-phone (~swift110-@unaffiliated/swift110) has quit (Read error: Connection reset by peer)
2016-03-01 09:11:19 < Arthur_D (~magne@195.1.125.245) has quit (Quit: Leaving)
2016-03-01 09:18:11 < quaisi (~simon@host-92-30-27-114.as13285.net) has quit (Ping timeout: 248 seconds)
2016-03-01 09:19:14 > quaisi (~simon@host-92-30-27-114.as13285.net) has joined #linuxvoice
2016-03-01 09:22:17 < mnavrati (~milan@ip-94-113-220-233.net.upcbroadband.cz) has quit (Quit: Leaving)
2016-03-01 09:24:10 < Paddy_NI (~patrick@104.238.169.12) has quit (Quit: Konversation terminated!)
2016-03-01 09:26:00 < quaisi (~simon@host-92-30-27-114.as13285.net) has quit (Ping timeout: 246 seconds)
2016-03-01 09:27:09 > quaisi (~simon@host-92-30-27-114.as13285.net) has joined #linuxvoice
2016-03-01 09:27:29 > mnavrati (~milan@ip-94-113-220-233.net.upcbroadband.cz) has joined #linuxvoice
2016-03-01 09:35:06 < quaisi (~simon@host-92-30-27-114.as13285.net) has quit (Ping timeout: 246 seconds)
2016-03-01 09:36:04 > quaisi (~simon@host-92-30-27-114.as13285.net) has joined #linuxvoice
2016-03-01 09:38:58 < gb00s (~gb00s@c50-31.i07-13.onvol.net) has quit (Quit: Leaving)
2016-03-01 09:45:06 > gamerchick02 (~gamerchic@c-68-36-7-43.hsd1.mi.comcast.net) has joined #linuxvoice
2016-03-01 09:51:07 - NIX0uT1aW is now known as nix0ut1aw
2016-03-01 09:53:47 < Nitronium (~Dave@host213-1-14-213.range213-1.btcentralplus.com) has quit (Remote host closed the connection)
2016-03-01 10:21:39 < M1C4HTRON13 (~micah@bodhilinux/team/M1C4HTRON13) has quit (Quit: Leaving)
2016-03-01 10:36:28 < siamese (~cc@cpc70015-sand12-2-0-cust221.16-1.cable.virginm.net) has quit (Quit: Leaving)
2016-03-01 10:37:19 < mnavrati (~milan@ip-94-113-220-233.net.upcbroadband.cz) has quit (Quit: Leaving)
2016-03-01 10:40:24 < nix0ut1aw (~andy@5ec25cad.skybroadband.com) has quit (Quit: Leaving)
2016-03-01 10:41:51 > user03 (~user03@ip72-200-42-41.no.no.cox.net) has joined #linuxvoice
2016-03-01 10:56:17 < gamerchick02 (~gamerchic@c-68-36-7-43.hsd1.mi.comcast.net) has quit (Quit: Leaving)
2016-03-01 11:03:04 < user03 (~user03@ip72-200-42-41.no.no.cox.net) has quit (Quit: Leaving)
2016-03-01 11:03:13 > jrullo (~jr1@cpe-66-8-141-28.hawaii.res.rr.com) has joined #linuxvoice
2016-03-01 11:19:48 < mcphail (~mcphail@unaffiliated/mcphail) has quit (Ping timeout: 276 seconds)
2016-03-01 11:22:09 > mcphail (~mcphail@unaffiliated/mcphail) has joined #linuxvoice
2016-03-01 11:55:23 < writtenoff (~writtenof@of1.psych.ubc.ca) has quit (Quit: WeeChat 1.3)
2016-03-01 12:06:38 < jrullo (~jr1@cpe-66-8-141-28.hawaii.res.rr.com) has quit (Ping timeout: 248 seconds)
2016-03-01 12:23:53 > aptanet (~quassel@humpback.aptanet.net) has joined #linuxvoice
2016-03-01 12:56:00 < swift110 (~swift110@unaffiliated/swift110) has quit (Ping timeout: 276 seconds)
2016-03-01 13:49:01 > chemist69_ (~apl@a89-182-207-138.net-htp.de) has joined #linuxvoice
2016-03-01 13:52:01 < chemist69 (~apl@a89-182-159-1.net-htp.de) has quit (Ping timeout: 250 seconds)
2016-03-01 14:21:55 < blahdeblah (~quassel@unaffiliated/blahdeblah) has quit (Ping timeout: 250 seconds)
2016-03-01 14:45:53 > standen (~joe@123.51.68.3) has joined #linuxvoice
2016-03-01 14:47:42 < standen (~joe@123.51.68.3) has left #linuxvoice
2016-03-01 15:11:54 > blahdeblah (~quassel@unaffiliated/blahdeblah) has joined #linuxvoice
2016-03-01 15:15:24 > zmoylan-1i (~pi@109.77.134.18) has joined #linuxvoice
2016-03-01 15:19:01 < zmoylan-pi (~pi@109.77.106.78) has quit (Ping timeout: 268 seconds)
2016-03-01 15:26:49 < georgeowell (~georgeowe@95.149.192.184) has quit (Quit: Leaving)
2016-03-01 15:40:28 zmoylan-1i !weather dublin
2016-03-01 16:03:51 < zmoylan-1i (~pi@109.77.134.18) has quit (Ping timeout: 276 seconds)
2016-03-01 16:08:04 > zmoylan-pi (~pi@109.76.156.102) has joined #linuxvoice
2016-03-01 16:08:59 > jrullo (~jr1@cpe-98-155-48-56.hawaii.res.rr.com) has joined #linuxvoice
2016-03-01 16:15:01 > prayingmantis (~prayingma@203-7-33-136.dyn.iinet.net.au) has joined #linuxvoice
2016-03-01 16:20:12 < jrullo (~jr1@cpe-98-155-48-56.hawaii.res.rr.com) has quit (Quit: be excellent to each other)
2016-03-01 16:40:27 < mavrix (~mavrix@unaffiliated/mavrix) has quit (Ping timeout: 260 seconds)
2016-03-01 16:41:56 > mavrix (~mavrix@unaffiliated/mavrix) has joined #linuxvoice
2016-03-01 16:49:09 > gb00s (~gb00s@c50-31.i07-13.onvol.net) has joined #linuxvoice
2016-03-01 17:55:40 < CPrompt^ (~CPrompt^@cpe-45-36-163-153.triad.res.rr.com) has quit (Ping timeout: 276 seconds)
2016-03-01 17:56:51 > CPrompt^ (~CPrompt^@cpe-45-36-163-153.triad.res.rr.com) has joined #linuxvoice
2016-03-01 18:43:36 james_olympus Happy Saint David's Day!
2016-03-01 18:46:02 esprimo Happy hug-a-librarian-day
2016-03-01 18:46:25 blahdeblah What if they don't like hugs?
2016-03-01 18:46:36 esprimo HUG THEM
2016-03-01 18:46:38 * blahdeblah is glad his wife is a librarian today :-)
2016-03-01 19:01:13 - Andy__ is now known as nix0ut1aw
2016-03-01 19:02:03 < nix0ut1aw (~Andy@91.244.229.42) has quit (Quit: Leaving)
2016-03-01 19:02:21 > NIX0uT1aW (~Andy@91.244.229.42) has joined #linuxvoice
2016-03-01 19:02:43 < NIX0uT1aW (~Andy@91.244.229.42) has quit (Client Quit)
2016-03-01 19:03:01 > nix0ut1aw (~Andy@91.244.229.42) has joined #linuxvoice
2016-03-01 19:05:43 - foxhunt_away is now known as foxhunt72
2016-03-01 19:13:08 > TwistedLucidity (~TwistedLu@cpc80671-stap13-2-0-cust118.12-2.cable.virginm.net) has joined #linuxvoice
2016-03-01 19:26:46 > AdamDBrown (~Thunderbi@68.148-142-203.dynamic.dsl.pth.iprimus.net.au) has joined #linuxvoice
2016-03-01 19:32:27 > m95lag (~m95lag@82-181-169-179.bb.dnainternet.fi) has joined #linuxvoice
2016-03-01 19:35:09 > mnavrati (milan@nat/redhat/x-nkgmemkcfrgvbamv) has joined #linuxvoice
2016-03-01 19:48:31 < AdamDBrown (~Thunderbi@68.148-142-203.dynamic.dsl.pth.iprimus.net.au) has quit (Quit: AdamDBrown)
2016-03-01 19:51:59 > mrdvent (uid143946@gateway/web/irccloud.com/x-hydbnxwpkyfgtvdh) has joined #linuxvoice
2016-03-01 20:01:56 < mcphail (~mcphail@unaffiliated/mcphail) has left #linuxvoice
2016-03-01 20:03:18 > Aikidokajeff (~Thunderbi@primary.bertrams.com) has joined #linuxvoice
2016-03-01 20:04:28 > Burghmuir (~Burghmuir@cpc70577-croy22-2-0-cust178.19-2.cable.virginm.net) has joined #linuxvoice
2016-03-01 20:11:05 > jimbotux (~jimbotux@fpc3-sgyl30-2-0-cust5.18-2.static.cable.virginm.net) has joined #linuxvoice
2016-03-01 20:11:17 jimbotux morning all :)
2016-03-01 20:12:10 > andybalaam (andybalaam@nat/ibm/x-roodkrhcbvifeqcd) has joined #linuxvoice
2016-03-01 20:12:18 nix0ut1aw Morning!
2016-03-01 20:29:39 > LLL (~lars@gore.copyleft.no) has joined #linuxvoice
2016-03-01 20:37:45 > HEGX64 (~Scott@CPE-121-220-209-30.lns5.way.bigpond.net.au) has joined #linuxvoice
2016-03-01 20:39:34 < LauRoman (~LauRoman@5-14-36-100.residential.rdsnet.ro) has quit (Read error: Connection reset by peer)
2016-03-01 20:42:47 > LauRoman (~LauRoman@5-14-36-100.residential.rdsnet.ro) has joined #linuxvoice
2016-03-01 20:59:07 Devilment Hurm. Allegedly R-Pi3 will have PXE boot
2016-03-01 20:59:21 Devilment And a firmware u/g to allow R-Pi2 to do same
2016-03-01 21:00:35 james_olympus Oh, that is cool
2016-03-01 21:01:48 > blahdeblah_ (~quassel@unaffiliated/blahdeblah) has joined #linuxvoice
2016-03-01 21:02:43 < ideasman42 (~cambo@203-206-123-225.dyn.iinet.net.au) has quit (Quit: Ex-Chat)
2016-03-01 21:04:36 < blahdeblah (~quassel@unaffiliated/blahdeblah) has quit (Ping timeout: 246 seconds)
2016-03-01 21:06:40 > kanodonkey (55852bfa@gateway/web/freenode/ip.85.133.43.250) has joined #linuxvoice
2016-03-01 21:13:11 > jherrmann (jirkah@nat/redhat/x-xtxbtllckokybqqv) has joined #linuxvoice
2016-03-01 21:18:09 pwaring Devilment: Does it have hardware virtualisation support?
2016-03-01 21:18:22 pwaring The RPi 2 did, but you had to engage in some technical trickery to get it to work
2016-03-01 21:24:57 einonm_ PXE boot on ARM? That sounds a bit ominous - that probably means there's now something like a firmware BIOS lurking on the board?
2016-03-01 21:41:53 Devilment pwaring: I don't know about the virt. support. Just a chap at work is getting some R-Pi3s and is happy they have PXE
2016-03-01 21:51:41 * popey is sitting within eye-shot of the door so I can listen out for my Pi3 deliveries!
2016-03-01 22:04:28 james_olympus Have there been any supply problems this time?
2016-03-02 01:39:49 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-03-02 01:39:49 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-03-02 01:39:49 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-03-02 01:39:49 - Channel #linuxvoice: 74 nicks (1 op, 0 voices, 73 normals)
2016-03-02 01:39:59 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-03-02 01:48:27 > TraceyC (~TraceyC@2620:0:28a2:4020:11fc:a822:ed20:8ca) has joined #linuxvoice
2016-03-02 02:00:28 < mnavrati_mtg (milan@nat/redhat/x-zyylxkvtgbksqjmb) has quit (Quit: Leaving)
2016-03-02 02:02:11 > Ian (~Thunderbi@vpn-3-080.rl.ac.uk) has joined #linuxvoice
2016-03-02 02:02:35 - Ian is now known as Guest5474
2016-03-02 02:03:02 > mnavrati_mtg (milan@nat/redhat/x-gbdqwyfqqkpqjefg) has joined #linuxvoice
2016-03-02 02:05:45 < jherrmann (jirkah@nat/redhat/x-eqhvjzoypbhcutqo) has quit (Ping timeout: 276 seconds)
2016-03-02 02:19:20 > jherrmann (jirkah@nat/redhat/x-gnasbvjfztozsqlt) has joined #linuxvoice
2016-03-02 02:19:31 < jaake (~h4ckm3@129.59.122.17) has quit (Ping timeout: 250 seconds)
2016-03-02 02:27:10 kanodonkey MIcrosoft is selling linux... http://www.microsoftstore.com/store/msusa/en_US/pdp/productID.334851400
2016-03-02 02:34:27 < gb00s (~gb00s@c50-31.i07-13.onvol.net) has quit (Quit: Leaving)
2016-03-02 02:45:09 < Guest5474 (~Thunderbi@vpn-3-080.rl.ac.uk) has quit (Ping timeout: 246 seconds)
2016-03-02 02:57:23 < jherrmann (jirkah@nat/redhat/x-gnasbvjfztozsqlt) has quit (Ping timeout: 248 seconds)
2016-03-02 02:59:58 > gareppa (~gareppa@151.31.13.116) has joined #linuxvoice
2016-03-02 03:00:11 > jherrmann (jirkah@nat/redhat/x-jqmedvlhuztelreo) has joined #linuxvoice
2016-03-02 03:08:57 < mnavrati_mtg (milan@nat/redhat/x-gbdqwyfqqkpqjefg) has quit (Ping timeout: 246 seconds)
2016-03-02 03:11:20 < gareppa (~gareppa@151.31.13.116) has quit (Quit: Leaving)
2016-03-02 03:16:14 > jaake (~h4ckm3@129.59.122.17) has joined #linuxvoice
2016-03-02 03:36:46 < jaake (~h4ckm3@129.59.122.17) has quit (Ping timeout: 248 seconds)
2016-03-02 03:47:40 > jaake (~h4ckm3@129.59.122.17) has joined #linuxvoice
2016-03-02 03:55:45 - irc: disconnected from server
2016-03-02 03:58:20 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-03-02 03:58:20 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-03-02 03:58:20 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-03-02 03:58:20 - Channel #linuxvoice: 73 nicks (1 op, 0 voices, 72 normals)
2016-03-02 03:58:24 - irc: disconnected from server
2016-03-02 03:58:39 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-03-02 03:58:39 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-03-02 03:58:39 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-03-02 03:58:39 - Channel #linuxvoice: 73 nicks (1 op, 0 voices, 72 normals)
2016-03-02 03:58:53 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-03-02 04:00:41 - irc: disconnected from server
2016-03-02 07:33:16 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-03-02 07:33:16 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-03-02 07:33:16 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-03-02 07:33:16 - Channel #linuxvoice: 73 nicks (1 op, 0 voices, 72 normals)
2016-03-02 07:33:26 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-03-02 07:38:27 < quaisi (~simon@host-92-30-27-114.as13285.net) has quit (Ping timeout: 250 seconds)
2016-03-02 07:39:10 > quaisi (~simon@host-92-30-27-114.as13285.net) has joined #linuxvoice
2016-03-02 07:39:35 - ideasman42 is now known as ideasman42afk
2016-03-02 07:44:18 > Bl4ckD34tH (~kvirc@unaffiliated/bl4ckd34th) has joined #linuxvoice
2016-03-02 07:53:24 < quaisi (~simon@host-92-30-27-114.as13285.net) has quit (Ping timeout: 248 seconds)
2016-03-02 07:54:12 > quaisi (~simon@host-92-30-27-114.as13285.net) has joined #linuxvoice
2016-03-02 07:59:51 < Nitronium (~Dave@host213-1-14-213.range213-1.btcentralplus.com) has quit (Remote host closed the connection)
2016-03-02 08:01:55 < jaake (~h4ckm3@129.59.122.17) has quit (Ping timeout: 248 seconds)
2016-03-02 08:09:15 - ideasman42afk is now known as ideasman42
2016-03-02 08:25:05 > Ian1 (~Thunderbi@198.128.205.151) has joined #linuxvoice
2016-03-02 08:27:23 - ideasman42 is now known as ideasman42walkdo
2016-03-02 08:27:34 - ideasman42walkdo is now known as ideasman4walkdog
2016-03-02 08:29:07 < Ian1 (~Thunderbi@198.128.205.151) has quit (Ping timeout: 248 seconds)
2016-03-02 08:30:10 > SuperEngineer (~SuperEngi@host86-162-231-235.range86-162.btcentralplus.com) has joined #linuxvoice
2016-03-02 08:30:24 < Bl4ckD34tH (~kvirc@unaffiliated/bl4ckd34th) has quit (Quit: KVIrc 4.9.1 Aria http://www.kvirc.net/)
2016-03-02 08:32:19 < SuperEngineer (~SuperEngi@host86-162-231-235.range86-162.btcentralplus.com) has left #linuxvoice
2016-03-02 08:37:17 > georgeowell (~georgeowe@95.149.192.184) has joined #linuxvoice
2016-03-02 08:44:48 > Paddy_NI (~patrick@104.238.169.136) has joined #linuxvoice
2016-03-02 08:54:05 - foxhunt_away is now known as foxhunt72
2016-03-02 08:57:37 - ideasman4walkdog is now known as ideasman42
2016-03-02 08:57:55 < asusk7m550 (~Thunderbi@2001:981:97b3:1:1938:871a:8528:9c9e) has quit (Quit: asusk7m550)
2016-03-02 08:59:17 < quaisi (~simon@host-92-30-27-114.as13285.net) has quit (Ping timeout: 260 seconds)
2016-03-02 08:59:22 - foxhunt72 is now known as foxhunt_away
2016-03-02 09:00:01 > quaisi (~simon@host-92-30-27-114.as13285.net) has joined #linuxvoice
2016-03-02 09:09:58 > gamerchick02 (~gamerchic@c-68-36-7-43.hsd1.mi.comcast.net) has joined #linuxvoice
2016-03-02 09:20:42 < kanodonkey (55852bfa@gateway/web/freenode/ip.85.133.43.250) has quit (Ping timeout: 252 seconds)
2016-03-02 09:22:33 < blahdeblah (~quassel@unaffiliated/blahdeblah) has quit (Ping timeout: 276 seconds)
2016-03-02 09:34:01 < mavrix (~mavrix@unaffiliated/mavrix) has quit (Ping timeout: 252 seconds)
2016-03-02 09:36:47 > mavrix (~mavrix@unaffiliated/mavrix) has joined #linuxvoice
2016-03-02 10:01:37 < Paddy_NI (~patrick@104.238.169.136) has quit (Quit: Konversation terminated!)
2016-03-02 10:08:56 > Paddy_NI (~patrick@104.238.169.136) has joined #linuxvoice
2016-03-02 10:23:31 < Paddy_NI (~patrick@104.238.169.136) has quit (Quit: Konversation terminated!)
2016-03-02 10:40:54 < ideasman42 (~cambo@203-206-123-225.dyn.iinet.net.au) has quit (Quit: Ex-Chat)
2016-03-02 10:41:10 > ideasman42 (~cambo@203-206-123-225.dyn.iinet.net.au) has joined #linuxvoice
2016-03-02 11:06:01 < gamerchick02 (~gamerchic@c-68-36-7-43.hsd1.mi.comcast.net) has quit (Ping timeout: 250 seconds)
2016-03-02 11:09:53 > blahdeblah (~quassel@unaffiliated/blahdeblah) has joined #linuxvoice
2016-03-02 11:14:19 < LauRoman (~LauRoman@5-14-36-100.residential.rdsnet.ro) has quit (Read error: Connection reset by peer)
2016-03-02 11:18:40 > Arthur_D (~magne@195.1.125.245) has joined #linuxvoice
2016-03-02 11:19:59 > ioangogo-ipad (~ioangogo-@huwloosley.plus.com) has joined #linuxvoice
2016-03-02 11:20:27 ioangogo-ipad Schools urged to ban tackling in rugby by doctors http://www.bbc.co.uk/news/education-35696238
2016-03-02 11:20:28 LVbot ^ Schools urged to ban tackling in rugby by doctors BBC News
2016-03-02 11:21:22 ioangogo-ipad No, the only reason they will be injured is inadequate teaching or someone misbehaving
2016-03-02 11:33:50 < georgeowell (~georgeowe@95.149.192.184) has quit (Quit: Leaving)
2016-03-02 11:34:21 < ioangogo-ipad (~ioangogo-@huwloosley.plus.com) has quit (Remote host closed the connection)
2016-03-02 11:56:53 > swift110 (~swift110@205.201.255.5) has joined #linuxvoice
2016-03-02 11:57:41 < swift110 (~swift110@205.201.255.5) has quit (Changing host)
2016-03-02 11:57:42 > swift110 (~swift110@unaffiliated/swift110) has joined #linuxvoice
2016-03-02 12:12:39 < writtenoff (~writtenof@of1.psych.ubc.ca) has quit (Quit: WeeChat 1.3)
2016-03-02 12:20:09 mcphail Ioangogo: http://www.independent.co.uk/life-style/health-and-families/features/is-rugby-too-dangerous-for-children-to-play-9778518.html
2016-03-02 12:20:10 LVbot ^ Is rugby too dangerous for children to play? Features Lifestyle The Independent
2016-03-02 12:25:12 swift110 hey all
2016-03-02 12:29:03 mcphail hi swift110
2016-03-02 12:29:40 swift110 how are you mcphail
2016-03-02 12:30:15 mcphail swift110: good. Finished work and having a bite of supper before bed. You?
2016-03-02 12:33:13 swift110 mcphail: just relaxing for now
2016-03-02 12:33:21 swift110 Tired from work
2016-03-02 12:33:25 swift110 would love a nice meal
2016-03-02 12:38:58 < mnavrati (~milan@ip-94-113-220-233.net.upcbroadband.cz) has quit (Quit: Leaving)
2016-03-02 12:44:10 < CPrompt^ (~CPrompt^@cpe-45-36-163-153.triad.res.rr.com) has quit (Remote host closed the connection)
2016-03-02 13:00:57 < swift110 (~swift110@unaffiliated/swift110) has quit (Ping timeout: 276 seconds)
2016-03-02 13:48:15 > chemist69 (~apl@a89-182-26-105.net-htp.de) has joined #linuxvoice
2016-03-02 13:48:35 < mavrix (~mavrix@unaffiliated/mavrix) has quit (Ping timeout: 248 seconds)
2016-03-02 13:50:07 > mavrix (~mavrix@unaffiliated/mavrix) has joined #linuxvoice
2016-03-02 13:51:32 < chemist69_ (~apl@a89-182-207-138.net-htp.de) has quit (Ping timeout: 260 seconds)
2016-03-02 14:09:23 > writtenoff (~writtenof@d172-218-204-26.bchsia.telus.net) has joined #linuxvoice
2016-03-02 14:37:34 > zmoylan-1i (~pi@109.77.254.165) has joined #linuxvoice
2016-03-02 14:41:07 < zmoylan-pi (~pi@109.76.156.102) has quit (Ping timeout: 260 seconds)
2016-03-02 15:19:01 > swift110-phone (~swift110-@unaffiliated/swift110) has joined #linuxvoice
2016-03-02 15:19:03 swift110-phone Hey
2016-03-02 15:25:28 < ddeimeke (~ddeimeke@moas.mhochzwei.net) has quit (Quit: WeeChat 1.4)
2016-03-02 15:26:03 > ddeimeke (~ddeimeke@moas.mhochzwei.net) has joined #linuxvoice
2016-03-02 16:01:25 > zmoylan-pi (~pi@109.79.159.14) has joined #linuxvoice
2016-03-02 16:03:31 < zmoylan-1i (~pi@109.77.254.165) has quit (Ping timeout: 248 seconds)
2016-03-02 17:13:05 > opi (~opi@2001:41d0:52:800::49e) has joined #linuxvoice
2016-03-02 17:43:59 > brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has joined #linuxvoice
2016-03-02 17:56:59 - irc: disconnected from server
2016-03-02 19:58:25 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-03-02 19:58:25 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-03-02 19:58:25 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-03-02 19:58:25 - Channel #linuxvoice: 73 nicks (1 op, 0 voices, 72 normals)
2016-03-02 19:58:35 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-03-02 20:01:22 < quaisi (~simon@host-92-30-27-114.as13285.net) has quit (Ping timeout: 260 seconds)
2016-03-02 20:01:52 > quaisi (~simon@host-92-30-27-114.as13285.net) has joined #linuxvoice
2016-03-02 20:02:54 > andybalaam (andybalaam@nat/ibm/x-cjrbfzdijcpcxogr) has joined #linuxvoice
2016-03-02 20:14:06 > jherrmann (jirkah@nat/redhat/x-vprzmmbqaivazcxa) has joined #linuxvoice
2016-03-02 20:19:35 Devilment Seems that the R-Pi3 could potentially cook itself
2016-03-02 20:20:07 Devilment The temp sensor in the CPU+GPU is located next to the GPU bits
2016-03-02 20:20:21 < quaisi (~simon@host-92-30-27-114.as13285.net) has quit (Ping timeout: 276 seconds)
2016-03-02 20:20:51 Devilment If you're doing CPU intensive stuff, the temp sensor isn't picking up on how hot the CPU bits are getting
2016-03-02 20:21:00 > quaisi (~simon@host-92-30-27-114.as13285.net) has joined #linuxvoice
2016-03-02 20:21:14 Devilment External reading of the CPU 100C. Internal sensor 70C
2016-03-02 20:22:29 TwistedLucidity Hrm...my laptop regulary runs at 90+°C; worrying
2016-03-02 20:23:00 TwistedLucidity Surely one could stick a heat sink on the Pi though? Or drop it into a bucket of mineral oil?
2016-03-02 20:27:12 Devilment Yeah, stick an aluminium hedgehog on it
2016-03-02 20:31:16 < quaisi (~simon@host-92-30-27-114.as13285.net) has quit (Ping timeout: 252 seconds)
2016-03-02 20:31:57 > quaisi (~simon@host-92-30-27-114.as13285.net) has joined #linuxvoice
2016-03-02 20:33:47 TwistedLucidity I was watching a YouTube vid where someone had plumbed-in all the liquid cooling for their PCs almost like central heating.
2016-03-02 20:34:24 TwistedLucidity On the one hand it seemed awesome, if you could figure out how to put the recovered heat to work, and also rather useless.
2016-03-02 20:34:41 TwistedLucidity Neat quick-release connectors though; didn't know they were a thing.
2016-03-02 20:35:10 Devilment Never been convinced at having water close to my PC components
2016-03-02 20:36:30 Devilment http://images.bit-tech.net/content_images/2004/06/orac3_part5/Front800wWMk.jpg
2016-03-02 20:36:40 Devilment That was the coolest case mod I ever saw
2016-03-02 20:41:19 TwistedLucidity Devilment: They did have problems with contamination in the water. I might have gone for oil to reduce the corrosion issue, but biological remains an issue.
2016-03-02 20:41:31 TwistedLucidity Much more quiet and efficient though.
2016-03-02 20:42:10 pwaring I just got someone to build me an efficient PC
2016-03-02 20:42:18 pwaring Draws very little power, runs quietly
2016-03-02 20:42:42 pwaring Not *quite* quietly enough to have it on at night in my room though
2016-03-02 20:43:30 TwistedLucidity Quiet and efficient is easy until you load up "Dark Ninja Exterme Mega Kill 3 : Revenge of the Mutant Samurai Zombies"
2016-03-02 20:43:42 pwaring heh
2016-03-02 20:43:46 pwaring yeah, I'm not a gamer
2016-03-02 20:47:03 - irc: disconnected from server
2016-03-02 21:00:29 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-03-02 21:00:29 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-03-02 21:00:29 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-03-02 21:00:29 - Channel #linuxvoice: 75 nicks (1 op, 0 voices, 74 normals)
2016-03-02 21:00:39 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-03-02 21:03:54 < quaisi (~simon@host-92-30-27-114.as13285.net) has quit (Ping timeout: 276 seconds)
2016-03-02 21:04:04 > quaisi (~simon@host-92-30-27-114.as13285.net) has joined #linuxvoice
2016-03-02 21:05:42 Ioangogo http://www.bbc.co.uk/news/technology-35639549
2016-03-02 21:05:44 LVbot ^ Is your smartphone listening to you? BBC News
2016-03-02 21:06:54 zmoylan-pi wait till they find out the new car standard that puts a microphone in every car to be activated in crashes...
2016-03-02 21:13:57 < quaisi (~simon@host-92-30-27-114.as13285.net) has quit (Ping timeout: 246 seconds)
2016-03-02 21:15:04 > quaisi (~simon@host-92-30-27-114.as13285.net) has joined #linuxvoice
2016-03-02 21:18:06 > Paddy_NI (~patrick@host-92-14-224-66.as43234.net) has joined #linuxvoice
2016-03-02 21:24:49 < LauRoman (~LauRoman@5-14-36-100.residential.rdsnet.ro) has quit (Read error: Connection reset by peer)
2016-03-02 21:26:17 jimbotux anyone seen this take the tackle out of rugby article on BBC...?
2016-03-02 21:26:45 james_olympus It was in the ten o'clock news on the radio
2016-03-02 21:28:15 jimbotux more than 70 doctors and academics signed the letter so its a fairly large thing. Really hope nothing comes of this
2016-03-02 21:28:32 jimbotux I have played it since i was at school. And im ok.....i think?
2016-03-02 21:32:43 < ideasman42 (~cambo@203-206-123-225.dyn.iinet.net.au) has quit (Remote host closed the connection)
2016-03-02 21:32:45 Ioangogo jimbotux: i shared it last night
2016-03-02 21:32:58 Ioangogo "No, the only reason they will be injured is inadequate teaching or someone misbehaving" was my comment on it
2016-03-02 21:35:58 einonm_ It's only because England's performance is slipping, I'd wager. Dirty tricks to stop Wales & Scotland from learning to play properly in future. :P
2016-03-02 21:36:49 pwaring I'm not a fan of compulsory rugby
2016-03-02 21:37:07 pwaring But then I'm of a build that makes rugby a 'lets crush pwaring' sport
2016-03-02 21:38:22 < quaisi (~simon@host-92-30-27-114.as13285.net) has quit (Ping timeout: 252 seconds)
2016-03-02 21:39:15 > quaisi (~simon@host-92-30-27-114.as13285.net) has joined #linuxvoice
2016-03-02 21:39:51 jimbotux haha Ioangogo, yep can see it now above! Didnt clock the link. Need a client that highlights links..
2016-03-02 21:46:18 Blackisle heh, https://test.drownattack.com/?site=bbc.co.uk bit worrying that the bbc password reset site is susceptible to MITM/Drown attack :)
2016-03-02 21:46:21 LVbot ^ DROWN Attack bbc.co.uk
2016-03-02 21:53:59 Ioangogo http://www.theguardian.com/world/2016/mar/01/home-office-publishes-revised-draft-snoopers-charter
2016-03-02 21:54:00 LVbot ^ Home Office to publish revised draft of snooper's charter World news The Guardian
2016-03-02 21:54:03 Devilment It's probably a consequence of the new Will Smith film, 'Concussion'
2016-03-02 21:55:03 Ioangogo I like how it was stoped for being to extream, and now its become worse
2016-03-02 21:55:15 < Paddy_NI (~patrick@host-92-14-224-66.as43234.net) has quit (Quit: Konversation terminated!)
2016-03-02 21:59:19 mcphail Ioangogo: to suggest school rugby is a dangerous sport. No point denying that - it is well documented. I'm happy for kids to be allowed to play rugby, but _compulsory_ full-contact rugby is scandalous. Sports with high risks of life changing (and life threatening) injuries should be opt-in only
2016-03-02 22:00:15 mcphail Sam goes for horse riding and rock climbing. The function of a PE class is to promote fitness, and that doesn't require dangerous sporting activity
2016-03-02 22:01:03 zmoylan-pi but for horse riding helmets are required?
2016-03-02 22:01:14 zmoylan-pi ditto rock climbinb?
2016-03-02 22:01:53 Devilment Camping needs to be banned as an extreme sport. It's in tents
2016-03-02 22:01:58 zmoylan-pi they could make helmets mandatory for rugby but new evidence is suggesting that helmets might make sports like american football *more* dangerous as riskier tackles are done
2016-03-02 22:03:54 Devilment It's like boxing should go back to bare knuckles
2016-03-02 22:04:09 mcphail zmoylan-pi: it is hard to pick apart the confounding factors of increased injuries in rugby and American football. The widespread abuse of anabolic steroids has coincided with the introduction of helmets etc. Players are heavier and travelling quicker, making injuries more likely
2016-03-02 22:04:50 Devilment Let's add more mass and protection to a boxer's hand. That will stop them from hitting as hard. Oh, wait...
2016-03-02 22:05:27 zmoylan-pi it's also a he'll be grand, the helmet will take the impact from my kneecap
2016-03-02 22:06:34 Devilment It's funny how additions to make things safer can have the opposite effect
2016-03-02 22:07:00 zmoylan-pi if you make things safer people take more risks
2016-03-02 22:07:14 Devilment All the safety improvements to road cars means people are more likely to speed on the motorway
2016-03-02 22:07:42 zmoylan-pi they'll walk away from a crash, pity about those nuns crossing the road...
2016-03-02 22:08:04 Devilment Strip back the padding in American Football, go back to the 1930s/1940s style
2016-03-02 22:08:43 Devilment If it's going to hurt you when you go in for the tackle, you're not going to hit as hard
2016-03-02 22:09:22 zmoylan-pi and add a few sensors so that you can calulate the force used to that you can penalised for overtackling
2016-03-02 22:09:47 zmoylan-pi the difference between getting the ball and removing their best player from the match
2016-03-02 22:09:52 mcphail Devilment: padding has the advantage of making players slower. Kinetic energy increases by velocity^2, so slowing players is a good idea to prevent injuries. Better to make the padding heavier, as the relationship between kinetic energy and mass is linear
2016-03-02 22:10:09 Devilment There were concerns about footballers getting cumulative brain damage from heading the ball. Yes, make your own jokes about brain-dead footballers
2016-03-02 22:10:33 zmoylan-pi doesn't need to be heavy to do that, just make it inflexible and bulky to reduce their movement
2016-03-02 22:10:41 mcphail zmoylan-pi: ineed
2016-03-02 22:10:43 Devilment I can imagine heading a football from the 1950s/60s hurting a lot
2016-03-02 22:11:19 zmoylan-pi and there's a movie at the mo about tackles in american football causing permanent brain damage
2016-03-02 22:11:28 Devilment 10:54 < Devilment> It's probably a consequence of the new Will Smith film, 'Concussion'
2016-03-02 22:11:30 < jherrmann (jirkah@nat/redhat/x-vprzmmbqaivazcxa) has quit (Ping timeout: 276 seconds)
2016-03-02 22:11:42 zmoylan-pi didn't know the name of it
2016-03-02 22:12:33 mcphail Devilment: no - Allison Pollock has been campaigning against school rugby for about 10 years now. This isn't a new thing. See the "Independent" link I posted last night
2016-03-02 22:14:18 Devilment My nephew has had to give up his rugby
2016-03-02 22:14:33 Devilment It was bringing on intense headaches
2016-03-02 22:14:45 Devilment Even if he wasn't being tackled in a match
2016-03-02 22:15:05 zmoylan-pi that's not a good sign... should get a medical
2016-03-02 22:23:31 > jherrmann (jirkah@nat/redhat/x-eybtnspoiskvbzhh) has joined #linuxvoice
2016-03-02 22:29:06 Devilment Oh, he has, he has
2016-03-02 22:29:17 Devilment Docs cannot get to the bottom of it
2016-03-02 22:29:45 Devilment Blood test, scans etc
2016-03-02 22:30:24 zmoylan-pi borrow a fitbit or its ilk and play a game while wearing it... might get some info
2016-03-02 22:34:01 > CPrompt^ (~CPrompt^@cpe-45-36-163-153.triad.res.rr.com) has joined #linuxvoice
2016-03-02 22:35:22 < quaisi (~simon@host-92-30-27-114.as13285.net) has quit (Ping timeout: 260 seconds)
2016-03-02 22:35:57 > quaisi (~simon@host-92-30-27-114.as13285.net) has joined #linuxvoice
2016-03-02 22:44:31 TwistedLucidity zmoylan-pi: Why were the nuns on the motorway in the first place?
2016-03-02 22:45:25 zmoylan-pi 7 nuns on a honda 50... the normal reason...
2016-03-02 22:45:50 > Aikidokajeff (~Thunderbi@primary.bertrams.com) has joined #linuxvoice
2016-03-02 22:46:02 TwistedLucidity Add to this the outrage a few years ago against MMA. Yet in MMA some think blows to the head are less common as the rest of the body is a target and joint locks etc can be employed.
2016-03-02 22:46:27 TwistedLucidity Also, the ring could be safer due to it being an actual cage. Insufficient data just now though.
2016-03-02 22:46:47 TwistedLucidity The cage isn't just for looks, it stop the poor buggers falling out!
2016-03-02 22:47:21 < andybalaam (andybalaam@nat/ibm/x-cjrbfzdijcpcxogr) has quit (Remote host closed the connection)
2016-03-02 22:47:25 zmoylan-pi they brought in mandatory helmets into hurley. just makes them look like wimps...
2016-03-02 22:47:37 zmoylan-pi no longer a cross between hockey and murder...
2016-03-02 22:47:49 TwistedLucidity Well, hurely does have a small, hard object travelling at high velocity.....
2016-03-02 22:47:53 TwistedLucidity LOL
2016-03-02 22:48:12 zmoylan-pi and very occasional deaths. thinning the herd...
2016-03-02 22:48:36 TwistedLucidity Or thinning the unlucky.
2016-03-02 22:48:54 zmoylan-pi they're part of the herd...
2016-03-02 22:49:08 TwistedLucidity I don't see an issue with batsmen and the like wearing helmets. A bad bounce could be the end of it.
2016-03-02 22:49:14 zmoylan-pi did you learn nothing from stargate sg:1??
2016-03-02 22:49:17 TwistedLucidity Football should still be outlawed though
2016-03-02 22:49:33 TwistedLucidity Not on grounds of safety, purely because I can't stand the bloody game
2016-03-02 22:49:41 TwistedLucidity zmoylan-pi: Never really watched it
2016-03-02 22:50:13 zmoylan-pi a great show... some brilliant lines... you blow up *one* sun and people think you're a miracle worker...
2016-03-02 22:50:41 TwistedLucidity Is that Stargate or HHGTTG? :-)
2016-03-02 22:53:35 < arubislander (~ubuntuadm@86.93.93.218) has quit (Remote host closed the connection)
2016-03-02 22:53:45 < quaisi (~simon@host-92-30-27-114.as13285.net) has quit (Ping timeout: 276 seconds)
2016-03-02 22:53:59 > quaisi (~simon@host-92-30-27-114.as13285.net) has joined #linuxvoice
2016-03-02 22:55:13 > arubislander (~ubuntuadm@86.93.93.218) has joined #linuxvoice
2016-03-03 01:46:35 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-03-03 01:46:35 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-03-03 01:46:35 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-03-03 01:46:35 - Channel #linuxvoice: 76 nicks (1 op, 0 voices, 75 normals)
2016-03-03 01:46:45 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-03-03 01:59:54 < jherrmann (jirkah@nat/redhat/x-yughejrejeeaztfq) has quit (Quit: Toodle pip!)
2016-03-03 02:00:16 > mnavrati (milan@nat/redhat/x-vhjomwthdzwmkvkg) has joined #linuxvoice
2016-03-03 02:02:05 < draake (~h4ckm3@172.56.20.34) has quit (Ping timeout: 244 seconds)
2016-03-03 02:04:58 < Aikidokajeff (~Thunderbi@primary.bertrams.com) has quit (Quit: Aikidokajeff)
2016-03-03 02:15:17 < brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has quit (Quit: Konversation terminated!)
2016-03-03 02:19:16 > jherrmann (jirkah@nat/redhat/x-wwjjrefsmjsxjznu) has joined #linuxvoice
2016-03-03 02:25:51 > draake (~h4ckm3@172.56.20.34) has joined #linuxvoice
2016-03-03 02:39:57 < draake (~h4ckm3@172.56.20.34) has quit (Ping timeout: 276 seconds)
2016-03-03 02:43:13 > georgeowell (~georgeowe@95.149.192.184) has joined #linuxvoice
2016-03-03 02:44:37 > draake (~h4ckm3@172.56.20.34) has joined #linuxvoice
2016-03-03 02:44:45 < georgeowell (~georgeowe@95.149.192.184) has quit (Client Quit)
2016-03-03 02:46:11 < jherrmann (jirkah@nat/redhat/x-wwjjrefsmjsxjznu) has quit (Ping timeout: 248 seconds)
2016-03-03 02:54:33 < writtenoff (~writtenof@d172-218-204-26.bchsia.telus.net) has quit (Quit: WeeChat 1.3)
2016-03-03 02:58:48 > jherrmann (jirkah@nat/redhat/x-iaxpkbryrawxlpmx) has joined #linuxvoice
2016-03-03 03:09:38 < mnavrati (milan@nat/redhat/x-vhjomwthdzwmkvkg) has quit (Quit: Leaving)
2016-03-03 03:11:04 < draake (~h4ckm3@172.56.20.34) has quit (Ping timeout: 260 seconds)
2016-03-03 03:12:53 > draake (~h4ckm3@172.56.20.34) has joined #linuxvoice
2016-03-03 03:15:34 < quaisi (~simon@host-92-30-27-114.as13285.net) has quit (Ping timeout: 264 seconds)
2016-03-03 03:15:54 > quaisi (~simon@host-92-30-27-114.as13285.net) has joined #linuxvoice
2016-03-03 03:18:43 > mnavrati (milan@nat/redhat/x-dahippqlseujulfl) has joined #linuxvoice
2016-03-03 03:25:25 < draake (~h4ckm3@172.56.20.34) has quit (Ping timeout: 252 seconds)
2016-03-03 03:32:43 - foxhunt72 is now known as foxhunt_away
2016-03-03 03:44:15 Ioangogo Ive noticed a lot of youtubers doing reflow in a oven recently, like linus: https://www.youtube.com/watch?v=8Xanr4jkmEc and LGR: https://youtu.be/TfhmBcBPNyc?t=12m31s
2016-03-03 03:44:18 LVbot ^ Bring your video card back from the dead! Oven method YouTube
2016-03-03 03:44:21 LVbot ^ LGR Repairing The Barbie Computer YouTube
2016-03-03 03:50:42 Devilment That's usually a last throw of the dice trick
2016-03-03 03:53:43 > pdq_ (~pdq@p20030045431A4D00D0C271CD79837F26.dip0.t-ipconnect.de) has joined #linuxvoice
2016-03-03 04:00:35 > draake (~h4ckm3@172.56.20.34) has joined #linuxvoice
2016-03-03 04:19:18 < swift110-phone (~swift110-@unaffiliated/swift110) has quit (Remote host closed the connection)
2016-03-03 04:26:16 < draake (~h4ckm3@172.56.20.34) has quit (Ping timeout: 264 seconds)
2016-03-03 04:27:51 > writtenoff (~writtenof@of1.psych.ubc.ca) has joined #linuxvoice
2016-03-03 04:36:27 > draake (~h4ckm3@172.56.20.34) has joined #linuxvoice
2016-03-03 04:40:18 < TwistedLucidity (~TwistedLu@cpc80671-stap13-2-0-cust118.12-2.cable.virginm.net) has quit (Quit: Konversation terminated!)
2016-03-03 04:54:56 < andybalaam (~andybalaa@70.210.114.87.dyn.plus.net) has quit (Read error: No route to host)
2016-03-03 05:01:46 - draake is now known as jaake
2016-03-03 05:19:20 - jaake is now known as draake
2016-03-03 05:35:23 - draake is now known as jaake
2016-03-03 05:59:48 < jaake (~h4ckm3@172.56.20.34) has quit (Ping timeout: 244 seconds)
2016-03-03 06:14:07 > ideasman42 (~cambo@203-206-123-225.dyn.iinet.net.au) has joined #linuxvoice
2016-03-03 06:23:39 < mnavrati (milan@nat/redhat/x-dahippqlseujulfl) has quit (Quit: Leaving)
2016-03-03 06:37:05 > slashd (~slashd@modemcable157.191-130-66.mc.videotron.ca) has joined #linuxvoice
2016-03-03 06:37:22 < slashd (~slashd@modemcable157.191-130-66.mc.videotron.ca) has quit (Changing host)
2016-03-03 06:37:22 > slashd (~slashd@ubuntu/member/slashd) has joined #linuxvoice
2016-03-03 06:38:49 > asusk7m550 (~Thunderbi@2001:981:97b3:1:c440:50c4:436d:75d4) has joined #linuxvoice
2016-03-03 06:39:03 < pdq_ (~pdq@p20030045431A4D00D0C271CD79837F26.dip0.t-ipconnect.de) has quit (Remote host closed the connection)
2016-03-03 06:41:58 < jherrmann (jirkah@nat/redhat/x-iaxpkbryrawxlpmx) has quit (Quit: Toodle pip!)
2016-03-03 07:01:48 > Nitronium (~Dave@host213-1-14-213.range213-1.btcentralplus.com) has joined #linuxvoice
2016-03-03 07:44:36 - foxhunt_away is now known as foxhunt72
2016-03-03 07:55:02 > LauRoman (~LauRoman@5-14-36-100.residential.rdsnet.ro) has joined #linuxvoice
2016-03-03 08:01:53 Ioangogo http://www.theguardian.com/technology/2016/mar/01/microsoft-to-unify-pc-and-xbox-one-platforms-ending-fixed-console-hardware
2016-03-03 08:01:54 LVbot ^ Microsoft to unify PC and Xbox One platforms, ending fixed console hardware Technology The Guardian
2016-03-03 08:02:51 < quaisi (~simon@host-92-30-27-114.as13285.net) has quit (Ping timeout: 246 seconds)
2016-03-03 08:03:21 < TraceyC (~TraceyC@2620:0:28a2:4020:b548:2adf:ea31:162) has quit (Quit: Off I go into the wild, blue yonder)
2016-03-03 08:04:02 > quaisi (~simon@host-92-30-27-114.as13285.net) has joined #linuxvoice
2016-03-03 08:05:34 - foxhunt72 is now known as foxhunt_away
2016-03-03 08:18:40 < Nitronium (~Dave@host213-1-14-213.range213-1.btcentralplus.com) has quit (Remote host closed the connection)
2016-03-03 08:28:25 < asusk7m550 (~Thunderbi@2001:981:97b3:1:c440:50c4:436d:75d4) has quit (Quit: asusk7m550)
2016-03-03 08:29:15 Ioangogo A question for the Pi people in here, what whould you say is the maximum length of wire for connecting a push button
2016-03-03 08:53:08 popey 12
2016-03-03 08:56:32 mcphail http://www.theguardian.com/media/2016/mar/02/adblocking-protection-racket-john-whittingdale - who would have thought a government minister would be an industry shill? I hope we do have the "adpocalypse". Beyond the Google search page, I can't think of a webite I'd be sad to see go if it collapsed due to lack of ad revenue
2016-03-03 08:56:34 LVbot ^ Adblocking is a modern-day protection racket', says culture secretary Media The Guardian
2016-03-03 09:03:13 < mavrix (~mavrix@unaffiliated/mavrix) has quit (Ping timeout: 240 seconds)
2016-03-03 09:06:07 > mavrix (~mavrix@unaffiliated/mavrix) has joined #linuxvoice
2016-03-03 09:06:26 > brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has joined #linuxvoice
2016-03-03 09:10:16 > gamerchick02 (~gamerchic@c-68-36-7-43.hsd1.mi.comcast.net) has joined #linuxvoice
2016-03-03 10:12:41 > mnavrati (~milan@ip-94-113-220-233.net.upcbroadband.cz) has joined #linuxvoice
2016-03-03 10:14:34 > swift110 (~swift110@64.26.99.248) has joined #linuxvoice
2016-03-03 10:17:36 < swift110 (~swift110@64.26.99.248) has quit (Changing host)
2016-03-03 10:17:37 > swift110 (~swift110@unaffiliated/swift110) has joined #linuxvoice
2016-03-03 10:28:06 < brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has quit (Ping timeout: 246 seconds)
2016-03-03 10:32:36 > brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has joined #linuxvoice
2016-03-03 10:45:30 < grifferz (~andy@bitfolk.com) has quit (Ping timeout: 276 seconds)
2016-03-03 10:52:36 < ideasman42 (~cambo@203-206-123-225.dyn.iinet.net.au) has quit (Quit: Ex-Chat)
2016-03-03 10:52:52 > ideasman42 (~cambo@203-206-123-225.dyn.iinet.net.au) has joined #linuxvoice
2016-03-03 10:53:56 < gamerchick02 (~gamerchic@c-68-36-7-43.hsd1.mi.comcast.net) has quit (Quit: Leaving)
2016-03-03 11:03:46 < aptanet (~quassel@humpback.aptanet.net) has quit (Quit: http://quassel-irc.org - Chat comfortably. Anywhere.)
2016-03-03 11:04:56 > aptanet (~quassel@humpback.aptanet.net) has joined #linuxvoice
2016-03-03 11:22:36 - ideasman42 is now known as ideasman4dogwalk
2016-03-03 11:35:35 > grifferz (~andy@bitfolk.com) has joined #linuxvoice
2016-03-03 11:46:11 > jaake (~h4ckm3@172.56.20.34) has joined #linuxvoice
2016-03-03 11:54:38 - ideasman4dogwalk is now known as ideasman42
2016-03-03 12:01:05 > Ian (~Thunderbi@TE6COMPTON.dhcp.lbnl.us) has joined #linuxvoice
2016-03-03 12:01:28 - Ian is now known as Guest87551
2016-03-03 12:05:37 < Guest87551 (~Thunderbi@TE6COMPTON.dhcp.lbnl.us) has quit (Ping timeout: 260 seconds)
2016-03-03 12:14:38 < writtenoff (~writtenof@of1.psych.ubc.ca) has quit (Quit: WeeChat 1.3)
2016-03-03 12:15:54 < jaake (~h4ckm3@172.56.20.34) has quit (Ping timeout: 246 seconds)
2016-03-03 12:23:17 < mnavrati (~milan@ip-94-113-220-233.net.upcbroadband.cz) has quit (Quit: Leaving)
2016-03-03 12:44:35 > HEGX64 (~Scott@129.127.146.165) has joined #linuxvoice
2016-03-03 12:54:45 < prayingmantis (~prayingma@203-7-33-136.dyn.iinet.net.au) has quit (Ping timeout: 250 seconds)
2016-03-03 12:56:46 > prayingmantis (~prayingma@203-7-33-136.dyn.iinet.net.au) has joined #linuxvoice
2016-03-03 13:03:57 < swift110 (~swift110@unaffiliated/swift110) has quit (Ping timeout: 276 seconds)
2016-03-03 13:04:46 < aptanet (~quassel@humpback.aptanet.net) has quit (Remote host closed the connection)
2016-03-03 13:06:15 > aptanet (~quassel@humpback.aptanet.net) has joined #linuxvoice
2016-03-03 13:18:47 > popey_ (~alan@cpc81199-farn9-2-0-cust577.6-2.cable.virginm.net) has joined #linuxvoice
2016-03-03 13:19:06 > corsack_ (~pi@cpc21-hudd9-2-0-cust116.4-1.cable.virginm.net) has joined #linuxvoice
2016-03-03 13:19:36 > cromulon_ (~cromulon@45.62.227.43) has joined #linuxvoice
2016-03-03 13:19:38 > zmoylan-1i (~pi@109.79.159.14) has joined #linuxvoice
2016-03-03 13:20:59 > Cadair_ (~Cadair@unaffiliated/cadair) has joined #linuxvoice
2016-03-03 13:22:55 > cipherrot (~znc@unaffiliated/petrichor) has joined #linuxvoice
2016-03-03 13:23:47 < Cadair (~Cadair@unaffiliated/cadair) has quit (Ping timeout: 248 seconds)
2016-03-03 13:23:48 < popey (~alan@ubuntu/member/popey) has quit (Ping timeout: 248 seconds)
2016-03-03 13:23:48 < corsack (~pi@cpc21-hudd9-2-0-cust116.4-1.cable.virginm.net) has quit (Ping timeout: 248 seconds)
2016-03-03 13:23:48 < zmoylan-pi (~pi@109.79.159.14) has quit (Ping timeout: 248 seconds)
2016-03-03 13:23:48 < Arthur_D (~magne@195.1.125.245) has quit (Ping timeout: 248 seconds)
2016-03-03 13:23:49 < brianhunter- (~brian@bhlm.net) has quit (Ping timeout: 248 seconds)
2016-03-03 13:23:49 < cromulon (~cromulon@45.62.227.43) has quit (Ping timeout: 248 seconds)
2016-03-03 13:23:49 < petrichor (~znc@unaffiliated/petrichor) has quit (Ping timeout: 248 seconds)
2016-03-03 13:23:53 - cipherrot is now known as petrichor
2016-03-03 13:23:57 - Cadair_ is now known as Cadair
2016-03-03 13:24:34 > brianhunter- (~brian@bhlm.net) has joined #linuxvoice
2016-03-03 13:24:37 > Arthur_D (~magne@195.1.125.245) has joined #linuxvoice
2016-03-03 13:26:01 < brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has quit (Ping timeout: 252 seconds)
2016-03-03 13:30:05 < LauRoman (~LauRoman@5-14-36-100.residential.rdsnet.ro) has quit (Read error: Connection reset by peer)
2016-03-03 13:31:41 < HEGX64 (~Scott@129.127.146.165) has quit (Quit: Leaving)
2016-03-03 13:34:56 < mavrix (~mavrix@unaffiliated/mavrix) has quit (Ping timeout: 244 seconds)
2016-03-03 13:36:39 > mavrix (~mavrix@unaffiliated/mavrix) has joined #linuxvoice
2016-03-03 13:46:29 > chemist69_ (~apl@a89-182-68-190.net-htp.de) has joined #linuxvoice
2016-03-03 13:49:21 < chemist69 (~apl@a89-182-26-105.net-htp.de) has quit (Ping timeout: 246 seconds)
2016-03-03 14:25:30 > corsack (~pi@cpc21-hudd9-2-0-cust116.4-1.cable.virginm.net) has joined #linuxvoice
2016-03-03 14:25:54 > amoe_ (~amoe@visarend.solasistim.net) has joined #linuxvoice
2016-03-03 14:26:23 > Cadair_ (~Cadair@unaffiliated/cadair) has joined #linuxvoice
2016-03-03 14:26:27 < theru (~theru@theru.org) has quit (Ping timeout: 260 seconds)
2016-03-03 14:26:27 < corsack_ (~pi@cpc21-hudd9-2-0-cust116.4-1.cable.virginm.net) has quit (Ping timeout: 260 seconds)
2016-03-03 14:26:28 < Stilvoid (stilvoid@offend.me.uk) has quit (Ping timeout: 260 seconds)
2016-03-03 14:26:28 < chemist69_ (~apl@a89-182-68-190.net-htp.de) has quit (Ping timeout: 260 seconds)
2016-03-03 14:26:28 < Cadair (~Cadair@unaffiliated/cadair) has quit (Ping timeout: 260 seconds)
2016-03-03 14:26:29 < amoe (~amoe@visarend.solasistim.net) has quit (Ping timeout: 260 seconds)
2016-03-03 14:26:42 - Cadair_ is now known as Cadair
2016-03-03 14:27:15 > chemist69_ (~apl@a89-182-68-190.net-htp.de) has joined #linuxvoice
2016-03-03 14:27:16 > theru (~theru@theru.org) has joined #linuxvoice
2016-03-03 14:30:18 > Stilvoid (stilvoid@offend.me.uk) has joined #linuxvoice
2016-03-03 14:32:00 < slashd (~slashd@ubuntu/member/slashd) has quit (Quit: Leaving)
2016-03-03 14:36:54 < Blackisle (~Blackisle@kilchoman.blackisle.org.uk) has quit (Ping timeout: 276 seconds)
2016-03-03 14:37:15 > Blackisle (~Blackisle@kilchoman.blackisle.org.uk) has joined #linuxvoice
2016-03-03 15:15:54 < einonm_ (~einonm@81.174.139.2) has quit (Ping timeout: 276 seconds)
2016-03-03 15:18:12 > kurtmc__ (~kurt@103-52-206-170.dynamic.unlimitedinternet.co.nz) has joined #linuxvoice
2016-03-03 15:29:05 < kurtmc__ (~kurt@103-52-206-170.dynamic.unlimitedinternet.co.nz) has quit (Quit: leaving)
2016-03-03 15:38:11 > einonm (~einonm@81.174.139.2) has joined #linuxvoice
2016-03-03 15:43:10 > zmoylan-pi (~pi@109.79.163.29) has joined #linuxvoice
2016-03-03 15:46:21 < zmoylan-1i (~pi@109.79.159.14) has quit (Ping timeout: 250 seconds)
2016-03-03 16:03:45 > HEGX64 (~Scott@129.127.147.17) has joined #linuxvoice
2016-03-03 16:03:59 < zmoylan-pi (~pi@109.79.163.29) has quit (Ping timeout: 260 seconds)
2016-03-03 16:08:11 > zmoylan-pi (~pi@109.78.210.61) has joined #linuxvoice
2016-03-03 17:30:04 < opi (~opi@2001:41d0:52:800::49e) has quit (Quit: ZNC - http://znc.in)
2016-03-03 17:34:03 < HEGX64 (~Scott@129.127.147.17) has quit (Quit: Leaving)
2016-03-03 17:50:51 > brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has joined #linuxvoice
2016-03-03 18:35:44 > opi (~opi@2001:41d0:52:800::49e) has joined #linuxvoice
2016-03-03 18:45:06 > jrullo (~jr1@cpe-72-130-92-41.hawaii.res.rr.com) has joined #linuxvoice
2016-03-03 18:51:49 < jrullo (~jr1@cpe-72-130-92-41.hawaii.res.rr.com) has quit (Quit: be excellent to each other)
2016-03-03 18:52:11 > jrullo (~jr1@cpe-72-130-92-41.hawaii.res.rr.com) has joined #linuxvoice
2016-03-03 18:56:27 > LLL (~lars@gore.copyleft.no) has joined #linuxvoice
2016-03-03 19:08:26 > andybalaam (~andybalaa@123.147.208.46.dyn.plus.net) has joined #linuxvoice
2016-03-03 19:13:18 < bdmc (bdmc@cl-745.bos-01.us.sixxs.net) has quit (Ping timeout: 248 seconds)
2016-03-03 19:19:37 < webpigeon (~quassel@kat.vps.livebytes.co.uk) has quit (Ping timeout: 240 seconds)
2016-03-03 19:19:49 > bdmc (bdmc@cl-745.bos-01.us.sixxs.net) has joined #linuxvoice
2016-03-03 19:20:33 - foxhunt_away is now known as foxhunt72
2016-03-03 19:22:54 > webpigeon (~quassel@kat.vps.livebytes.co.uk) has joined #linuxvoice
2016-03-03 19:23:31 > jherrmann (jirkah@nat/redhat/x-qllwctftqtlorngh) has joined #linuxvoice
2016-03-03 19:30:13 > asusk7m550 (~Thunderbi@2001:981:97b3:1:f4f0:7669:4348:4e81) has joined #linuxvoice
2016-03-03 19:37:24 > mnavrati (milan@nat/redhat/x-opgvrceptxmuhjef) has joined #linuxvoice
2016-03-03 19:38:30 - mnavrati is now known as mnavrati_trng
2016-03-03 19:38:40 > TwistedLucidity (~TwistedLu@cpc80671-stap13-2-0-cust118.12-2.cable.virginm.net) has joined #linuxvoice
2016-03-03 19:41:18 < arubislander (~ubuntuadm@86.93.93.218) has quit (Quit: Leaving.)
2016-03-03 19:43:27 > arubislander (~ubuntuadm@86.93.93.218) has joined #linuxvoice
2016-03-03 19:49:02 < prayingmantis (~prayingma@203-7-33-136.dyn.iinet.net.au) has quit (Ping timeout: 248 seconds)
2016-03-03 19:50:14 - popey_ is now known as popey
2016-03-03 19:50:22 < popey (~alan@cpc81199-farn9-2-0-cust577.6-2.cable.virginm.net) has quit (Changing host)
2016-03-03 19:50:22 > popey (~alan@ubuntu/member/popey) has joined #linuxvoice
2016-03-03 20:13:23 > Aikidokajeff (~Thunderbi@primary.bertrams.com) has joined #linuxvoice
2016-03-03 20:19:42 > LauRoman (~LauRoman@5-14-36-100.residential.rdsnet.ro) has joined #linuxvoice
2016-03-03 20:43:26 < 18WAAARLB (~lee@2001:8b0:ffb3::c0:ff:ee) has quit (Quit: WeeChat 1.5-dev)
2016-03-03 20:43:52 > Cueball (~lee@2001:8b0:ffb3::c0:ff:ee) has joined #linuxvoice
2016-03-03 20:45:28 < jrullo (~jr1@cpe-72-130-92-41.hawaii.res.rr.com) has quit (Ping timeout: 252 seconds)
2016-03-03 21:16:19 < brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has quit (Quit: Konversation terminated!)
2016-03-03 21:45:39 - foxhunt72 is now known as foxhunt_away
2016-03-03 21:54:54 < cromulon_ (~cromulon@45.62.227.43) has quit (Quit: leaving)
2016-03-03 22:02:31 > cromulon (~cromulon@45.62.227.43) has joined #linuxvoice
2016-03-03 22:27:40 < ideasman42 (~cambo@203-206-123-225.dyn.iinet.net.au) has quit (Remote host closed the connection)
2016-03-03 22:40:07 < mnavrati_trng (milan@nat/redhat/x-opgvrceptxmuhjef) has quit (Quit: Leaving)
2016-03-03 22:53:54 > Paddy_NI (~patrick@host-92-14-224-66.as43234.net) has joined #linuxvoice
2016-03-03 22:55:42 > mnavrati (milan@nat/redhat/x-wyxmpstelmnsebqq) has joined #linuxvoice
2016-03-03 23:03:43 < mnavrati (milan@nat/redhat/x-wyxmpstelmnsebqq) has quit (Quit: Leaving)
2016-03-03 23:04:00 > mnavrati (milan@nat/redhat/x-yqgwwkjrakdobahh) has joined #linuxvoice
2016-03-03 23:17:32 mcphail Does anyone know of a decent server-side EPUB to HTML converter? I'd like to dig into my library via my browser when I get a chance to snatch some lunch.
2016-03-03 23:19:11 mcphail I mean something I run on my server to show me my library, rather than relying on someone else's computer
2016-03-03 23:25:59 < LLL (~lars@gore.copyleft.no) has quit (Remote host closed the connection)
2016-03-03 23:32:29 mcphail I can unzip the epub and read the xhtml files, but something automatic would be nicer
2016-03-03 23:59:10 einonm mcphail: I assume you're aware of calibre?
2016-03-03 23:59:55 < arubislander (~ubuntuadm@86.93.93.218) has quit (Ping timeout: 250 seconds)
2016-03-04 00:00:08 einonm calibre also has a command line interface
2016-03-04 00:00:55 < Paddy_NI (~patrick@host-92-14-224-66.as43234.net) has quit (Quit: Konversation terminated!)
2016-03-04 00:15:16 > arubislander (~ubuntuadm@52D9EFE5.cm-11-1d.dynamic.ziggo.nl) has joined #linuxvoice
2016-03-04 00:19:51 < arubislander (~ubuntuadm@52D9EFE5.cm-11-1d.dynamic.ziggo.nl) has quit (Ping timeout: 250 seconds)
2016-03-04 00:22:33 james_olympus Calibre is brilliant once you disable the giant icons
2016-03-04 00:22:43 > M1C4HTRON13 (~micah@bodhilinux/team/M1C4HTRON13) has joined #linuxvoice
2016-03-04 00:25:33 - foxhunt_away is now known as foxhunt72
2016-03-04 00:35:32 > arubislander (~ubuntuadm@86.93.93.218) has joined #linuxvoice
2016-03-04 00:36:26 > jaake (~h4ckm3@129.59.122.17) has joined #linuxvoice
2016-03-04 00:51:07 < mnavrati (milan@nat/redhat/x-yqgwwkjrakdobahh) has quit (Quit: Leaving)
2016-03-04 00:55:46 < jherrmann (jirkah@nat/redhat/x-qllwctftqtlorngh) has quit (Quit: Toodle pip!)
2016-03-04 01:07:47 mcphail einonm: yes, I use calibre. But I'm looking for something I can just point a browser at from anywhere, and it will let me access my library and display my epubs as htlm. I don't think calibre can do that?
2016-03-04 01:08:43 < Ioangogo (~forty2@huwloosley.plus.com) has quit (Quit: Merrrrr)
2016-03-04 01:09:00 > Ioangogo (~64bit@huwloosley.plus.com) has joined #linuxvoice
2016-03-04 01:13:14 - foxhunt72 is now known as foxhunt_away
2016-03-04 01:21:10 > mnavrati (milan@nat/redhat/x-kyyuiykwigbunndb) has joined #linuxvoice
2016-03-04 01:26:47 einonm mcphail: with a command line interface, you should be able to script anything
2016-03-04 01:27:41 james_olympus There is a module for Owncloud that displays Epubs in a browser
2016-03-04 01:28:05 james_olympus A lot of work for just that feature, though
2016-03-04 01:35:40 mcphail Thanks chaps
2016-03-04 01:35:45 > slashd (~slashd@modemcable157.191-130-66.mc.videotron.ca) has joined #linuxvoice
2016-03-04 01:47:16 james_olympus Hmm, I've downloaded a file with a | character in the file name. This will be fun
2016-03-04 01:48:17 Stilvoid quotes
2016-03-04 01:48:18 Stilvoid :)
2016-03-04 01:48:58 - foxhunt_away is now known as foxhunt72
2016-03-04 02:05:13 LagerMon \|
2016-03-04 02:12:25 pwaring One of our 'tests' for new CS students used to be 'how would you remove a file called -'
2016-03-04 02:14:10 james_olympus I've been using Linux for years and don't know off the top of my head
2016-03-04 02:14:53 james_olympus Ah yes, 'man rm' has at least one answer
2016-03-04 02:15:11 pwaring Actually 'rm -' works on Ubuntu
2016-03-04 02:15:31 pwaring But we were trying to get them to read the man page (and the stuff we'd given them)
2016-03-04 02:16:12 Stilvoid rm ./-
2016-03-04 02:16:14 Stilvoid safe enough
2016-03-04 02:16:41 james_olympus I had something similar in a job interview; I couldn't remember if destructors in C++ were virtual by default
2016-03-04 02:16:49 Stilvoid and -- works for most things
2016-03-04 02:17:19 james_olympus My answer was "I don't know, I'd look it up", which is about as good as knowing it
2016-03-04 02:17:26 Stilvoid definitely
2016-03-04 02:17:29 pwaring yes, I'd always accept that answer
2016-03-04 02:17:38 pwaring In fact, I'd prefer someone who looks it up just to check
2016-03-04 02:17:43 pwaring Rather than assuming they know
2016-03-04 02:17:53 Stilvoid a) stackoverflow b) stackoverflow c) stackoverflow d) stackoverflow
2016-03-04 02:17:54 Stilvoid 100%
2016-03-04 02:17:56 pwaring heh
2016-03-04 02:18:10 pwaring I was asked how I would learn a new programming language
2016-03-04 02:18:19 pwaring My answer was "buy the O'Reilly animal book and read it"
2016-03-04 02:18:20 Stilvoid wikipedia and learnxinyminutes.com
2016-03-04 02:18:37 pwaring I've found websites quite a poor choice for learning new things
2016-03-04 02:18:48 pwaring Books have a structure and consistency which websites often lack
2016-03-04 02:18:57 james_olympus pwaring: I've had that a couple of times, but my answer is to start programming as quickly as possible
2016-03-04 02:19:12 pwaring james_olympus: yeah, I would be programming whilst I was readingthe book
2016-03-04 02:19:22 pwaring i.e. read a bit, try it, read a bit etc.
2016-03-04 02:19:24 Stilvoid ah I just find books a bit slow-going
2016-03-04 02:19:32 Stilvoid usually the bit I actually want to know is about 2/3 of the way in
2016-03-04 02:19:33 < jaake (~h4ckm3@129.59.122.17) has quit (Ping timeout: 276 seconds)
2016-03-04 02:19:38 Stilvoid but you wouldn't know that until you got there
2016-03-04 02:19:47 pwaring books aren't great if you want to know 'how do I do X'
2016-03-04 02:19:48 Stilvoid I prefer a one-pager cheat sheet and some mucking about :)
2016-03-04 02:19:55 pwaring Though the cookbooks go some way towards that
2016-03-04 02:20:21 pwaring Some authors also write the book and then never touch it again
2016-03-04 02:20:25 pwaring Never fixing the errata
2016-03-04 02:22:54 > Paddy_NI (~patrick@host-92-14-224-66.as43234.net) has joined #linuxvoice
2016-03-04 02:29:11 < arubislander (~ubuntuadm@86.93.93.218) has quit (Quit: Leaving.)
2016-03-04 02:31:54 > arubislander (~ubuntuadm@86.93.93.218) has joined #linuxvoice
2016-03-04 02:34:53 Devilment Having a file called - in a directory can be a useful brake on rm *, IIRC
2016-03-04 02:36:18 Devilment Nope, just bust it
2016-03-04 02:36:55 pwaring heh
2016-03-04 02:37:08 pwaring Every year there would be at least one student who ran rm -rf ${HOME}
2016-03-04 02:37:22 pwaring or equivalent
2016-03-04 02:38:12 james_olympus Were any of them running Steam illicitly?
2016-03-04 02:38:13 Devilment I'm sure in the past I've managed to create a trap file to prevent rm *
2016-03-04 02:39:42 pwaring james_olympus: unlikely, we only gave them 2GB of quota which I doubt would be enough to install Steam + any modern game
2016-03-04 02:39:59 pwaring There was a big fanfare this year when quotas were increased to 5GB
2016-03-04 02:40:03 pwaring FIVE GIGABYTES
2016-03-04 02:40:50 zmoylan-pi wow, i had 64k on pdp 11 at college
2016-03-04 02:43:12 pwaring We had about 200MB
2016-03-04 02:43:37 pwaring I remember having to justify getting more when I was working on a research project
2016-03-04 02:43:37 Devilment Trying to think how much we had at university
2016-03-04 02:44:16 Devilment Using Risc iX on Acorn R260 machines
2016-03-04 02:44:17 zmoylan-pi i printed programs out and retyped them when i needed them to save space... did help with my final typing test... :-)
2016-03-04 02:44:48 Devilment n07t8 was my university network sign-on
2016-03-04 02:45:01 Devilment Funny the things you remember
2016-03-04 02:45:18 zmoylan-pi atarist was my password
2016-03-04 02:45:44 zmoylan-pi account 10,21
2016-03-04 02:45:54 * TwistedLucidity adds to word list....
2016-03-04 02:46:16 zmoylan-pi it was a trick, i really wanted an amiga... :-)
2016-03-04 02:46:35 zmoylan-pi or if the gods were willing an archimedes
2016-03-04 02:47:18 TwistedLucidity Huh....I wonder how a RasPi stacks up against and Archimedes?
2016-03-04 02:47:33 Devilment Much, much faster
2016-03-04 02:47:34 zmoylan-pi it blows it away
2016-03-04 02:47:40 zmoylan-pi and that was with the pi2
2016-03-04 02:47:47 Stilvoid u9929118
2016-03-04 02:47:51 Stilvoid was my uni username
2016-03-04 02:47:54 > charlesay (~daro3@ip5f5bf557.dynamic.kabel-deutschland.de) has joined #linuxvoice
2016-03-04 02:47:55 zmoylan-pi the pi3 will run riscos like a flippin demon
2016-03-04 02:48:07 Stilvoid and my random day-one password was y345556n
2016-03-04 02:48:10 TwistedLucidity Kinda thought it would, just wonder what the actual difference is
2016-03-04 02:48:10 Devilment Acorn A5000, ARM3 either 25MHz or 33MHz
2016-03-04 02:48:14 Stilvoid why the hell I remember those I have no idea
2016-03-04 02:48:19 Stilvoid because I had to change the password right away
2016-03-04 02:48:40 Devilment Acorn StrongARM RiscPC, 233MHz
2016-03-04 02:49:28 Devilment What's the clock on the R-Pi2? 900MHz?
2016-03-04 02:49:51 Stilvoid Worrying that my 14MHz Amiga often feels faster than my 1.3GHz desktop machine
2016-03-04 02:49:57 Stilvoid tbf though, I'm about to retire that :)
2016-03-04 02:50:35 Devilment Problem with RISC OS is it being CMT not PMT
2016-03-04 02:51:07 Devilment 4 cores in an R-Pi2 running RISC OS means 4 hourglasses :)
2016-03-04 02:51:36 Devilment I was an Acorn user back in the day but I got better
2016-03-04 02:52:18 pwaring When I was working at the uni, we *gave* every student a RPi 2
2016-03-04 02:52:35 pwaring I'm assuming they'll get an RPi 3 this year
2016-03-04 02:52:53 TwistedLucidity pwaring: Don't forget the heatsinks....
2016-03-04 02:53:06 mcphail How are the RPi3's working out?
2016-03-04 02:53:13 pwaring Not got one yet
2016-03-04 02:53:22 pwaring Still haven't played with my MIPS CI20 board
2016-03-04 02:53:56 Devilment pwaring: For paying your £9000 tutition fees, have this £25 computer
2016-03-04 02:54:15 Devilment Sounds like a fair trade
2016-03-04 02:54:17 pwaring heh
2016-03-04 02:54:49 pwaring yeah, the quota thing was a big issue: "we're paying £9k, can't we have more than that?"
2016-03-04 02:55:17 Devilment "OK, we'll throw in a micro-USB cable."
2016-03-04 02:55:18 pwaring Even was I was a student, it was embarrassing that the CS file server was less well-specced and fell over more than the computer society one
2016-03-04 02:55:32 pwaring Devilment: They do get an Element14 box with a power supply and a case!
2016-03-04 02:56:19 TwistedLucidity pwaring: The CompSoc server had more "staff" willing to do overtime.....
2016-03-04 02:56:36 < Paddy_NI (~patrick@host-92-14-224-66.as43234.net) has quit (Quit: Konversation terminated!)
2016-03-04 02:56:53 pwaring TwistedLucidity: CS at Manchester had 5+ sysadmin staff
2016-03-04 02:57:05 pwaring CompSoc had three students :)
2016-03-04 02:57:12 TwistedLucidity Ah
2016-03-04 02:57:28 TwistedLucidity Maybe they should have exchanged roles? :-P
2016-03-04 02:57:29 pwaring The sysadmin staff have gone now though, everything has been centralised, cut back and outsourced
2016-03-04 02:57:48 pwaring In a complete coincidence, service levels have fallen drastically
2016-03-04 02:57:56 TwistedLucidity I'm dealing with outsourced cloud-y bullshit right now
2016-03-04 02:58:09 TwistedLucidity "We will use da clowds to save the monies!
2016-03-04 02:58:16 TwistedLucidity Which is then followed by
2016-03-04 02:58:23 pwaring Manchester got rid of their IT Director recently, it was on the Register
2016-03-04 02:58:32 TwistedLucidity "No, you cannot have a copy of production as it's too expensive."
2016-03-04 02:58:38 pwaring He tried to outsource everything in a Grand Plan and it went horribly wrong
2016-03-04 02:59:52 zmoylan-pi everything in the cloud to save money and then when the internet keeps going down it gets to be fun... :-)
2016-03-04 02:59:58 TwistedLucidity To be fair, there is a balance. If you don't need something all the time, or it's not core/vital to your business, outsource it. Otherwise....
2016-03-04 03:00:40 pwaring sure
2016-03-04 03:00:48 pwaring He planned to outsource most stuff though
2016-03-04 03:01:17 pwaring Also, it's hard to outsource some things because few companies will meet the specialist requirements of academia
2016-03-04 03:01:50 TwistedLucidity The other problem with outsourcing is you set the relationship in stone. Any variance, no matter how minor, is a cost. As NHS trusts etc are finding out, but are still compelled to use PFI etc
2016-03-04 03:02:15 mcphail Being completely ignorant of these things, what is the biggest expense in keeping something in house? Electricity? Cooling?
2016-03-04 03:02:50 zmoylan-pi space used
2016-03-04 03:03:04 zmoylan-pi insurance on top of that
2016-03-04 03:03:05 TwistedLucidity mcphail: Depends on the "thing"
2016-03-04 03:04:10 mcphail Well, take pwaring's University situation. Where are the finincial gains in outsourcing coming from?
2016-03-04 03:04:40 zmoylan-pi lower upkeep costs probably
2016-03-04 03:05:30 Stilvoid By the way, shameless time, if any of you folks have AWS (or any other cloud provider) skills and fancy a change of job... PM me ;)
2016-03-04 03:05:38 Stilvoid We are *heavily* recruiting
2016-03-04 03:06:25 zmoylan-pi i'm irish, it's natural for me to avoid clouds... :-D
2016-03-04 03:06:26 mcphail Stilvoid: still building that botnet? ;)
2016-03-04 03:06:31 Stilvoid :D
2016-03-04 03:06:45 Stilvoid haha yes that's AWS's secret plan :D
2016-03-04 03:06:45 esprimo Stilvoid: I'm not really interested atn but where do you work?
2016-03-04 03:06:56 Stilvoid AWS
2016-03-04 03:07:00 esprimo Oh!
2016-03-04 03:07:19 esprimo Where?
2016-03-04 03:07:22 Stilvoid Sorry, didn't make that terrible clear!
2016-03-04 03:08:12 pwaring mcphail: I think if you outsource you convert capital expenditure into operating expenditure and that is 'good' (in accounting terms)
2016-03-04 03:08:19 pwaring I don't think it saves you money
2016-03-04 03:08:40 Stilvoid The office is in London but I work from home usually 3 days a week and drop in to the office for a couple of hours on mondays and thursdays
2016-03-04 03:08:49 esprimo Cool
2016-03-04 03:08:50 pwaring Stilvoid: Do you consider freelancers?
2016-03-04 03:09:01 esprimo Sounds nice
2016-03-04 03:09:04 Stilvoid don't think so
2016-03-04 03:09:12 pwaring fair enough
2016-03-04 03:09:15 pwaring Worth asking :)
2016-03-04 03:09:35 TwistedLucidity I have virtual AWS skills; does that count?
2016-03-04 03:09:40 Stilvoid (I live in Norwich)
2016-03-04 03:09:58 Stilvoid heh
2016-03-04 03:10:05 Stilvoid we could virtually employ you ;)
2016-03-04 03:10:08 Stilvoid pay you virtual money
2016-03-04 03:10:21 zmoylan-pi bitcoin \o/
2016-03-04 03:10:22 TwistedLucidity And I'll do virtually no work!
2016-03-04 03:11:06 pwaring I suggested we should do that for homeopathy consultants on the NHS
2016-03-04 03:11:19 pwaring Water down their pay
2016-03-04 03:12:21 Ioangogo http://bbc.in/1RoKeGs
2016-03-04 03:12:24 LVbot ^ BBC iPlayer loophole' to be closed soon, says culture secretary BBC News
2016-03-04 03:12:50 Ioangogo I dont get that, Its the bbc's choice as it is their content not the goverments
2016-03-04 03:13:52 TwistedLucidity Ioangogo: Government wants more sheckles for the BBC so they can cut central funding. Then turn the BBC private.
2016-03-04 03:14:01 zmoylan-pi government is allergic to giving stuff away for free
2016-03-04 03:14:15 TwistedLucidity In fairness, iPlayer is probably the single best catch-up service available.
2016-03-04 03:14:29 Ioangogo That sounds silly though, its uninforcable
2016-03-04 03:14:53 TwistedLucidity The other companies were stupid to not get on-board with the BBC's plans. The offerings from All4 etc are horrendous.
2016-03-04 03:15:00 zmoylan-pi bittorrent is a bit better as it just works everywhere... which is sad really as i'd like to get a lot of stuff legit
2016-03-04 03:15:11 TwistedLucidity Where they exist...not available on Panasonic for instance
2016-03-04 03:15:14 Ioangogo Just use intigo an no one will know
2016-03-04 03:15:47 pwaring Ioangogo: It's not the BBC's choice as the TV Licensing rules are set out in legislation (Communications Act 2003)
2016-03-04 03:16:10 pwaring So the BBC can't just decide whether you need a TV license for something
2016-03-04 03:17:20 TwistedLucidity The BBC might need to think about switching to something more like PBS in the USA. And halve its funding. And firing 50% of all managers.
2016-03-04 03:17:43 * pwaring would prefer it was just paid from taxation
2016-03-04 03:18:01 TwistedLucidity pwaring: Can you imagine the rage from the Sun etc?
2016-03-04 03:18:05 mcphail Well, that is 2 stories in 2 days which make me want to have a "stern word" with John Whittingdale
2016-03-04 03:18:09 zmoylan-pi and within 10 years it'll be as bad as itv
2016-03-04 03:18:57 pwaring TwistedLucidity: The Sun will complain until the BBC is shutdown
2016-03-04 03:19:15 TwistedLucidity I can see large sections of the TV industry going to the wall soon. We have little need for broadcast channels of old, but we still need good editors etc to curate content.
2016-03-04 03:19:22 TwistedLucidity Otherwise you get ITV....
2016-03-04 03:19:39 zmoylan-pi i can see the fox version of dr. who now when they buy the rights
2016-03-04 03:19:48 > jaake (~h4ckm3@129.59.122.17) has joined #linuxvoice
2016-03-04 03:20:34 zmoylan-pi they'll replace the police call box with a yellow cab
2016-03-04 03:20:44 TwistedLucidity BBC News, BBC 1+2, Channel 4, Film 4, W...I think those are the only channels we use.
2016-03-04 03:21:03 TwistedLucidity As in, actively use. We might record off others. Dunno.
2016-03-04 03:21:41 < mnavrati (milan@nat/redhat/x-kyyuiykwigbunndb) has quit (Quit: Leaving)
2016-03-04 03:22:18 mcphail TwistedLucidity: you should have another look at ITN news. BBC news is awful these days, merely parroting press releases and government spin. ITN are surprisingly good, and not as pedestrian as C4
2016-03-04 03:22:42 james_olympus Most of my television viewing is BBC documentaries. There's one on tonight about Pompeii
2016-03-04 03:23:00 TwistedLucidity I've been watching "The Brain". Fascinating.
2016-03-04 03:23:14 Stilvoid meh, I already pay for a TV license but only watch live content maybe twice a year
2016-03-04 03:23:20 mcphail james_olympus: I'm reading the Mary Beard Pompeii book just now. Is she presenting it?
2016-03-04 03:23:27 james_olympus mcphail: Yes
2016-03-04 03:23:28 TwistedLucidity I'm not in control of myself, I merely write a narrative to join together decisions/actions already made.
2016-03-04 03:23:32 mcphail nice
2016-03-04 03:23:34 Stilvoid happy to pay though given how much CBeebies my son watches and how much radio 4/6 I listen to
2016-03-04 03:24:05 TwistedLucidity Planet Rock for us. |..|,
2016-03-04 03:24:10 james_olympus It's not expensive for the volume and quality of content
2016-03-04 03:24:20 Stilvoid yeah
2016-03-04 03:24:36 james_olympus If you'll need a licence for the Iplayer, will there be a black and white version?
2016-03-04 03:24:37 Stilvoid I'd love planet rock if it weren't for the adverts
2016-03-04 03:24:44 Stilvoid commercial radio is horrible :(
2016-03-04 03:25:06 TwistedLucidity I'd rather throw money in a pot and then when I watch something, the creator get a pit of the pot. Kinda like Flattr I guess.
2016-03-04 03:25:26 TwistedLucidity I hate having to pay for crap I don't watch. e.g. NatGeo. Urgh, what a waste of electorns.
2016-03-04 03:25:40 > mnavrati (milan@nat/redhat/x-ovhuqlzjfbhtdxwi) has joined #linuxvoice
2016-03-04 03:25:42 mcphail For work, I have 6 different addresses. Most of those don't have a TV aerial, never mind a TV licence. But I don't see why I should pay for a licence at each address to watch catch-up on iplayer, when I already pay at my main house
2016-03-04 03:26:59 mcphail And if the licence is extended to iplayer, no reason they wouldn't extend it to cover netflix or youtube
2016-03-04 03:27:05 zmoylan-pi i'm sure the queen has a similar argument mcphail
2016-03-04 03:27:45 mcphail zmoylan-pi: I'll ask her. She has a house near me :)
2016-03-04 03:27:59 james_olympus There's still the 'battery loophole'. If the television is powered by batteries, you are covered by your home licence
2016-03-04 03:31:08 < mnavrati (milan@nat/redhat/x-ovhuqlzjfbhtdxwi) has quit (Quit: Leaving)
2016-03-04 03:32:23 - foxhunt72 is now known as foxhunt_away
2016-03-04 03:34:01 < quaisi (~simon@host-92-30-27-114.as13285.net) has quit (Ping timeout: 240 seconds)
2016-03-04 03:35:04 > quaisi (~simon@host-92-30-27-114.as13285.net) has joined #linuxvoice
2016-03-04 03:39:58 brianhunter- i don't have a telly so don't have a license
2016-03-04 03:40:08 brianhunter- do have netflix and amazon prime video though
2016-03-04 03:40:27 brianhunter- don't watch iplayer, but I do download a bbc podcast once a week
2016-03-04 03:41:35 < arubislander (~ubuntuadm@86.93.93.218) has quit (Quit: Leaving.)
2016-03-04 03:42:19 < jaake (~h4ckm3@129.59.122.17) has quit (Ping timeout: 244 seconds)
2016-03-04 03:42:33 < quaisi (~simon@host-92-30-27-114.as13285.net) has quit (Ping timeout: 268 seconds)
2016-03-04 03:42:59 > quaisi (~simon@host-92-30-27-114.as13285.net) has joined #linuxvoice
2016-03-04 03:45:08 > writtenoff (~writtenof@of1.psych.ubc.ca) has joined #linuxvoice
2016-03-04 03:46:38 > okovko (~okovko@65.79.1.34) has joined #linuxvoice
2016-03-04 03:47:53 Ioangogo http://www.bbc.co.uk/news/education-35716523
2016-03-04 03:47:54 LVbot ^ 'Cheating watches' warning for exams BBC News
2016-03-04 03:48:53 Ioangogo brianhunter-: A tv licence "Inforcer" may disagree
2016-03-04 03:54:01 < quaisi (~simon@host-92-30-27-114.as13285.net) has quit (Ping timeout: 240 seconds)
2016-03-04 03:54:58 > quaisi (~simon@host-92-30-27-114.as13285.net) has joined #linuxvoice
2016-03-04 04:00:24 < okovko (~okovko@65.79.1.34) has quit (Ping timeout: 244 seconds)
2016-03-04 04:02:50 < Aikidokajeff (~Thunderbi@primary.bertrams.com) has quit (Quit: Aikidokajeff)
2016-03-04 04:12:16 > jaake (~h4ckm3@129.59.122.17) has joined #linuxvoice
2016-03-04 04:15:54 < quaisi (~simon@host-92-30-27-114.as13285.net) has quit (Ping timeout: 276 seconds)
2016-03-04 04:16:08 > quaisi (~simon@host-92-30-27-114.as13285.net) has joined #linuxvoice
2016-03-04 04:24:24 > okovko (~okovko@65.79.1.34) has joined #linuxvoice
2016-03-04 04:32:26 < quaisi (~simon@host-92-30-27-114.as13285.net) has quit (Ping timeout: 244 seconds)
2016-03-04 04:33:15 > quaisi (~simon@host-92-30-27-114.as13285.net) has joined #linuxvoice
2016-03-04 04:35:32 < TwistedLucidity (~TwistedLu@cpc80671-stap13-2-0-cust118.12-2.cable.virginm.net) has quit (Quit: Konversation terminated!)
2016-03-04 04:36:44 < LauRoman (~LauRoman@5-14-36-100.residential.rdsnet.ro) has quit (Quit: Leaving)
2016-03-04 04:40:09 < quaisi (~simon@host-92-30-27-114.as13285.net) has quit (Ping timeout: 244 seconds)
2016-03-04 04:41:10 > quaisi (~simon@host-92-30-27-114.as13285.net) has joined #linuxvoice
2016-03-04 04:47:46 > LauRoman (~LauRoman@5-14-36-100.residential.rdsnet.ro) has joined #linuxvoice
2016-03-04 04:53:03 < quaisi (~simon@host-92-30-27-114.as13285.net) has quit (Ping timeout: 244 seconds)
2016-03-04 04:54:09 > quaisi (~simon@host-92-30-27-114.as13285.net) has joined #linuxvoice
2016-03-04 04:56:23 Ioangogo Im sure that the only freedoms in the uk are caused by police not liking paperwork (There are some that do exsit outside of this)
2016-03-04 05:00:28 zmoylan-pi there's also the too bloody late to be bothered act of 1974
2016-03-04 05:02:39 zmoylan-pi the i'd have to touch you to arrest you clause of which is why a mate of mine wasn't arrested while taking a whizz on government buildings at 0300 drunk out of his skull in dublin where he managed to whizz on the garda who tried to tell him to stop
2016-03-04 05:03:06 < andybalaam (~andybalaa@123.147.208.46.dyn.plus.net) has quit (Remote host closed the connection)
2016-03-04 05:03:24 Ioangogo Hmm, just going to side track https://www.reddit.com/r/linux/comments/48sgnk/email_from_bmw_australia_refusing_to_comply_with/
2016-03-04 05:03:26 LVbot ^ Email from BMW Australia refusing to comply with terms of GNU Public License linux
2016-03-04 05:04:19 < quaisi (~simon@host-92-30-27-114.as13285.net) has quit (Ping timeout: 248 seconds)
2016-03-04 05:05:08 > quaisi (~simon@host-92-30-27-114.as13285.net) has joined #linuxvoice
2016-03-04 05:11:03 < quaisi (~simon@host-92-30-27-114.as13285.net) has quit (Ping timeout: 240 seconds)
2016-03-04 05:12:03 > quaisi (~simon@host-92-30-27-114.as13285.net) has joined #linuxvoice
2016-03-04 05:15:49 Ioangogo https://i.imgur.com/F7y5sLO.jpg
2016-03-04 05:19:36 < Arthur_D (~magne@195.1.125.245) has quit (Quit: Leaving)
2016-03-04 05:19:40 > Nitronium (~Dave@host213-1-14-213.range213-1.btcentralplus.com) has joined #linuxvoice
2016-03-04 05:21:22 < okovko (~okovko@65.79.1.34) has quit (Ping timeout: 252 seconds)
2016-03-04 05:21:29 < M1C4HTRON13 (~micah@bodhilinux/team/M1C4HTRON13) has quit (Ping timeout: 244 seconds)
2016-03-04 05:22:51 < quaisi (~simon@host-92-30-27-114.as13285.net) has quit (Ping timeout: 276 seconds)
2016-03-04 05:23:04 > quaisi (~simon@host-92-30-27-114.as13285.net) has joined #linuxvoice
2016-03-04 05:30:01 < quaisi (~simon@host-92-30-27-114.as13285.net) has quit (Ping timeout: 240 seconds)
2016-03-04 05:31:00 > quaisi (~simon@host-92-30-27-114.as13285.net) has joined #linuxvoice
2016-03-04 05:37:57 < quaisi (~simon@host-92-30-27-114.as13285.net) has quit (Ping timeout: 260 seconds)
2016-03-04 05:38:55 > quaisi (~simon@host-92-30-27-114.as13285.net) has joined #linuxvoice
2016-03-04 05:48:45 < jaake (~h4ckm3@129.59.122.17) has quit (Ping timeout: 250 seconds)
2016-03-04 06:10:03 < quaisi (~simon@host-92-30-27-114.as13285.net) has quit (Ping timeout: 244 seconds)
2016-03-04 06:11:15 > quaisi (~simon@host-92-30-27-114.as13285.net) has joined #linuxvoice
2016-03-04 06:17:03 > charlesa1 (~daro3@ip5f5bf557.dynamic.kabel-deutschland.de) has joined #linuxvoice
2016-03-04 06:20:49 < charlesay (~daro3@ip5f5bf557.dynamic.kabel-deutschland.de) has quit (Ping timeout: 250 seconds)
2016-03-04 06:26:22 < quaisi (~simon@host-92-30-27-114.as13285.net) has quit (Ping timeout: 248 seconds)
2016-03-04 06:27:19 > quaisi (~simon@host-92-30-27-114.as13285.net) has joined #linuxvoice
2016-03-04 06:56:11 < quaisi (~simon@host-92-30-27-114.as13285.net) has quit (Ping timeout: 268 seconds)
2016-03-04 06:56:35 > quaisi (~simon@host-92-30-27-114.as13285.net) has joined #linuxvoice
2016-03-04 07:02:57 < Nitronium (~Dave@host213-1-14-213.range213-1.btcentralplus.com) has quit (Remote host closed the connection)
2016-03-04 07:04:19 > jaake (~h4ckm3@129.59.122.17) has joined #linuxvoice
2016-03-04 07:21:03 < quaisi (~simon@host-92-30-27-114.as13285.net) has quit (Ping timeout: 250 seconds)
2016-03-04 07:21:48 > quaisi (~simon@host-92-30-27-114.as13285.net) has joined #linuxvoice
2016-03-04 07:29:36 < quaisi (~simon@host-92-30-27-114.as13285.net) has quit (Ping timeout: 276 seconds)
2016-03-04 07:29:46 > quaisi_ (~simon@host-92-30-27-114.as13285.net) has joined #linuxvoice
2016-03-04 07:30:04 > sheldonc (~will@172.244.125.91.dyn.plus.net) has joined #linuxvoice
2016-03-04 07:36:03 < sheldonc (~will@172.244.125.91.dyn.plus.net) has left #linuxvoice
2016-03-04 07:41:40 < quaisi_ (~simon@host-92-30-27-114.as13285.net) has quit (Ping timeout: 248 seconds)
2016-03-04 07:42:50 > quaisi (~simon@host-92-30-27-114.as13285.net) has joined #linuxvoice
2016-03-04 07:43:51 > basshead (~basshead@228.28.112.87.dyn.plus.net) has joined #linuxvoice
2016-03-04 07:46:57 > Landru (~hiphiphip@unaffiliated/chibapet) has joined #linuxvoice
2016-03-04 07:47:12 Landru This seems like the place.
2016-03-04 07:48:33 Landru So, what's the most reasonable way for Muricans to get the magazine? It seemed a bit pricey at Barnes and Noble, but I'm not unwilling to get it there. My only concern is that I bought the only copy they had.
2016-03-04 07:48:51 Landru I deprived someone of their fix, or someone will deprive me of mine next month, I fear.
2016-03-04 07:52:04 < quaisi (~simon@host-92-30-27-114.as13285.net) has quit (Ping timeout: 252 seconds)
2016-03-04 07:52:50 > quaisi (~simon@host-92-30-27-114.as13285.net) has joined #linuxvoice
2016-03-04 07:57:33 mcphail Yay - a new popeycast!
2016-03-04 07:57:44 popey :)
2016-03-04 07:57:49 > sheldonc (~will@172.244.125.91.dyn.plus.net) has joined #linuxvoice
2016-03-04 07:58:00 < sheldonc (~will@172.244.125.91.dyn.plus.net) has left #linuxvoice
2016-03-04 07:58:14 Landru popeycast?
2016-03-04 07:58:23 popey http://ubuntupodcast.org/ 😃
2016-03-04 07:58:24 LVbot ^ Ubuntu Podcast
2016-03-04 07:59:28 Landru Ah, that. Already listened to that, on my way into work. :P
2016-03-04 07:59:57 Landru I loved the ZFS bits, with the Software Freedom Conservancy at the Software Freedom Law Center's neck, and vice versa.
2016-03-04 08:00:04 popey :)
2016-03-04 08:00:06 popey thanks :)
2016-03-04 08:00:18 Landru popey: Ah, which are you? :)
2016-03-04 08:00:28 popey I'm popey
2016-03-04 08:00:32 popey (alan)
2016-03-04 08:01:10 Landru I have to say, I hadn't heard of the Ubuntu podcast until this past December, and I grabbed the latest podcast and quite enjoyed it. And then there was this three month lag where I thought it had died, and I was bitter. But now it's back.
2016-03-04 08:01:20 popey hehe
2016-03-04 08:01:26 popey We have a break after xmas every year
2016-03-04 08:01:33 Landru popey: I will expect that henceforth.
2016-03-04 08:02:23 Landru Anyway, these two podcasts are my only free-software podcasts at the moment. Maybe it's my anglophilia, but all the American podcasts seem a bit tacky by comparison.
2016-03-04 08:03:04 < quaisi (~simon@host-92-30-27-114.as13285.net) has quit (Ping timeout: 252 seconds)
2016-03-04 08:03:49 > quaisi (~simon@host-92-30-27-114.as13285.net) has joined #linuxvoice
2016-03-04 08:04:03 popey Have you listened to Linux Luddites?
2016-03-04 08:04:09 popey It's quite well done.
2016-03-04 08:04:16 Landru No. I'll add it to my list.
2016-03-04 08:05:34 Landru Added and syncing.
2016-03-04 08:07:09 popey I like to hear their perspectives on things, because it differs from mine sometimes. Nice to hear the other side
2016-03-04 08:07:55 Landru Which other side is this?
2016-03-04 08:08:53 Landru Other side of the Atlantic? GPL-haters?
2016-03-04 08:10:56 popey Their strapline is based on prefering older stuff to new stuff
2016-03-04 08:11:03 popey (yet they spend a lot of time reviewing new stuff)
2016-03-04 08:11:19 popey Joe is of the opinion that everyone should stop writing new code, and should instead fix all the old stuff first.
2016-03-04 08:11:25 popey So, opposite of that.
2016-03-04 08:11:46 Landru Ah. I'll enjoy that then. I'm often a dinosaur.
2016-03-04 08:13:00 < quaisi (~simon@host-92-30-27-114.as13285.net) has quit (Ping timeout: 244 seconds)
2016-03-04 08:13:30 Landru I've listened to FLOSS Weekly off and on over the years, and I stuck with BSD Now for a good year or more, but so far you Brits feel the most comfortable.
2016-03-04 08:13:48 > quaisi (~simon@host-92-30-27-114.as13285.net) has joined #linuxvoice
2016-03-04 08:13:51 Landru (Could just be that I'm a wayward colonial with racial memories of the empire.)
2016-03-04 08:15:06 Devilment Landru: You could get a digital sub to the magazine
2016-03-04 08:15:27 charlesa1 Linux Luddites are GPL Haters though
2016-03-04 08:15:37 Devilment Means you wouldn't have to wait for your 96 pages of Linux goodness
2016-03-04 08:16:26 Landru I quite like the paper copy. Have people had good experiences having it shipped to America?
2016-03-04 08:17:13 Landru It reminds me of the computer enthusiast magazines from when I was a kid - news, reviews, programming tutorials, stuff.
2016-03-04 08:20:14 bdmc Landru: I get mine that way very regularly.
2016-03-04 08:22:52 < quaisi (~simon@host-92-30-27-114.as13285.net) has quit (Ping timeout: 244 seconds)
2016-03-04 08:23:44 > quaisi (~simon@host-92-30-27-114.as13285.net) has joined #linuxvoice
2016-03-04 08:23:56 > ideasman42 (~cambo@203-206-123-225.dyn.iinet.net.au) has joined #linuxvoice
2016-03-04 08:24:51 < jaake (~h4ckm3@129.59.122.17) has quit (Ping timeout: 276 seconds)
2016-03-04 08:26:50 < asusk7m550 (~Thunderbi@2001:981:97b3:1:f4f0:7669:4348:4e81) has quit (Remote host closed the connection)
2016-03-04 08:30:24 > dankeast (~dan@host86-183-174-170.range86-183.btcentralplus.com) has joined #linuxvoice
2016-03-04 08:38:53 Ioangogo popey: mind if i make the bot call the ubunty podcast the popeycast
2016-03-04 08:38:58 Ioangogo *call
2016-03-04 08:40:34 < quaisi (~simon@host-92-30-27-114.as13285.net) has quit (Ping timeout: 240 seconds)
2016-03-04 08:41:49 > quaisi (~simon@host-92-30-27-114.as13285.net) has joined #linuxvoice
2016-03-04 08:48:55 popey Ioangogo: I'd rather not tbh
2016-03-04 08:49:14 Ioangogo hmm
2016-03-04 08:53:05 popey It's a team effort.
2016-03-04 08:53:49 Ioangogo the alamms podcast
2016-03-04 08:54:35 Ioangogo the lamms podcast
2016-03-04 08:54:48 Ioangogo I could make a welsh work with that
2016-03-04 08:54:54 Ioangogo *word
2016-03-04 08:55:09 Ioangogo Also Am i the only one tempted to draw a Inappropriate Mustache on Theresa May
2016-03-04 08:55:28 Ioangogo Like one the WW2 dictator had
2016-03-04 08:57:13 Landru Ioangogo: I think so, yes.
2016-03-04 08:59:35 > lv-lover (c434144e@gateway/web/freenode/ip.196.52.20.78) has joined #linuxvoice
2016-03-04 09:01:01 lv-lover Just wanted to say - great mag!
2016-03-04 09:02:51 lv-lover Byeee!
2016-03-04 09:03:07 < dankeast (~dan@host86-183-174-170.range86-183.btcentralplus.com) has quit (Ping timeout: 244 seconds)
2016-03-04 09:03:19 < lv-lover (c434144e@gateway/web/freenode/ip.196.52.20.78) has left #linuxvoice
2016-03-04 09:09:18 Ioangogo https://geon.github.io/programming/2016/03/03/dsxyliea
2016-03-04 09:09:20 LVbot ^ Dsxyliea
2016-03-04 09:15:49 < basshead (~basshead@228.28.112.87.dyn.plus.net) has quit (Remote host closed the connection)
2016-03-04 09:24:44 > Evernest1967 (~Evernest@5419B3FB.cm-5-2c.dynamic.ziggo.nl) has joined #linuxvoice
2016-03-04 09:27:02 charlesa1 i was just perusing the grub tutorial (https://www.linuxvoice.com/grub-2-heal-your-bootloader/) to, unsurprisingly, help me repair grub.
2016-03-04 09:28:04 charlesa1 somewhat strangely, i can install grub on my drive from a chroot, but fail to update-grub the config file, as that command looks at the wrong /dev/
2016-03-04 09:28:21 charlesa1 does anyone happen to have an idea what to do there?
2016-03-04 09:33:48 > Paddy_NI (~patrick@host-92-14-224-66.as43234.net) has joined #linuxvoice
2016-03-04 09:36:09 Ioangogo Is it a UEFI computer
2016-03-04 09:36:46 Ioangogo as refind will work better as it checks on boot
2016-03-04 09:39:39 - Landru is now known as ChibaPet
2016-03-04 09:40:27 ChibaPet charlesa1: Run your update-grub with /dev bound into the chroot.
2016-03-04 09:40:31 < milosmilos (uid148607@gateway/web/irccloud.com/x-rmsydfvzaxyuucev) has quit (Quit: Connection closed for inactivity)
2016-03-04 09:40:33 ChibaPet and /sys and /proc
2016-03-04 09:44:31 charlesa1 ChibaPet: i had those mounted
2016-03-04 09:45:31 ChibaPet Hrm. That's a bit odd then.
2016-03-04 09:45:50 charlesa1 i think what was wrong was (me being stupid and having) /boot not mounted when i installed a kernel, so there was nothing there for grub to find and put in its config
2016-03-04 09:45:53 ChibaPet RAID involved? Sometimes RAID will spin up as, say, md127 when you really want md0.
2016-03-04 09:46:00 ChibaPet ah
2016-03-04 09:46:04 ChibaPet That'd do it. I've done that.
2016-03-04 09:46:28 charlesa1 i guess i'll find out when i turn the machine on now
2016-03-04 09:48:12 charlesa1 i have never been happier to read 'no key available with this passphrase'
2016-03-04 09:49:02 ChibaPet heh
2016-03-04 09:49:10 charlesa1 because that means that cryptsetup is actually running on my machine, which it hasn't in weeks
2016-03-04 09:49:43 charlesa1 because of some joint fuck up of the kernel and cryptsetup that rendered my machine unusable
2016-03-04 09:50:28 charlesa1 i had hoped to boot my real machine by midnight, so got there by 11 min..
2016-03-04 09:51:41 charlesa1 in the meantime i found out that i don't like gnome out of the box, esp on fedora
2016-03-04 09:55:31 > brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has joined #linuxvoice
2016-03-04 10:00:50 < charlesa1 (~daro3@ip5f5bf557.dynamic.kabel-deutschland.de) has quit (Quit: leaving)
2016-03-04 10:05:48 ChibaPet I'm not a fan of it.
2016-03-04 10:05:58 ChibaPet Wasteful of screen real estate.
2016-03-04 10:06:51 ChibaPet Openbox with the Onyx theme is much less wasteful.
2016-03-04 10:07:45 > M1C4HTRON13 (~micah@bodhilinux/team/M1C4HTRON13) has joined #linuxvoice
2016-03-04 10:19:54 < M1C4HTRON13 (~micah@bodhilinux/team/M1C4HTRON13) has quit (Remote host closed the connection)
2016-03-04 10:22:29 > topcyde (~topcyde@2602:304:cdb8:9e40:ed7f:90d3:edad:3e05) has joined #linuxvoice
2016-03-04 10:26:56 < Evernest1967 (~Evernest@5419B3FB.cm-5-2c.dynamic.ziggo.nl) has quit (Quit: Leaving)
2016-03-04 10:30:36 > okovko (~okovko@c-24-15-233-102.hsd1.il.comcast.net) has joined #linuxvoice
2016-03-04 10:32:08 < Paddy_NI (~patrick@host-92-14-224-66.as43234.net) has quit (Quit: Konversation terminated!)
2016-03-04 10:45:22 < okovko (~okovko@c-24-15-233-102.hsd1.il.comcast.net) has quit (Remote host closed the connection)
2016-03-04 10:46:50 > okovko (~okovko@c-24-15-233-102.hsd1.il.comcast.net) has joined #linuxvoice
2016-03-04 11:49:35 > swift110 (~swift110@205.201.255.5) has joined #linuxvoice
2016-03-04 11:51:43 < swift110 (~swift110@205.201.255.5) has quit (Changing host)
2016-03-04 11:51:43 > swift110 (~swift110@unaffiliated/swift110) has joined #linuxvoice
2016-03-04 12:03:37 < slashd (~slashd@modemcable157.191-130-66.mc.videotron.ca) has quit (Quit: Leaving)
2016-03-04 12:17:14 < writtenoff (~writtenof@of1.psych.ubc.ca) has quit (Quit: WeeChat 1.3)
2016-03-04 12:20:28 < LauRoman (~LauRoman@5-14-36-100.residential.rdsnet.ro) has quit (Read error: Connection reset by peer)
2016-03-04 12:23:29 swift110 hey all
2016-03-04 12:32:40 ChibaPet o/ swift110
2016-03-04 12:38:12 < ideasman42 (~cambo@203-206-123-225.dyn.iinet.net.au) has quit (Quit: Ex-Chat)
2016-03-04 12:43:01 < topcyde (~topcyde@2602:304:cdb8:9e40:ed7f:90d3:edad:3e05) has quit (Ping timeout: 250 seconds)
2016-03-04 12:49:21 > topcyde (~topcyde@2602:304:cdb8:9e40:18f7:a510:7758:173a) has joined #linuxvoice
2016-03-04 12:51:34 swift110 hey ChibaPet how are you?
2016-03-04 12:52:09 ChibaPet Doing well.
2016-03-04 12:52:26 ChibaPet I've got to fire up an Ubuntu box when I get home from work and explore funny status messages.
2016-03-04 12:52:42 ChibaPet Should be a fun exercise. It's root-on-ZFS.
2016-03-04 12:53:07 swift110 good to heaer
2016-03-04 12:55:19 ChibaPet How about you?
2016-03-04 12:55:51 ChibaPet Oh, and on the way home, I'll listen to Linux Luddites for the first time, as recommended here.
2016-03-04 13:00:00 ChibaPet taking off - I'll be back! o/
2016-03-04 13:01:33 < swift110 (~swift110@unaffiliated/swift110) has quit (Ping timeout: 240 seconds)
2016-03-04 13:45:29 > chemist69 (~apl@a89-182-1-112.net-htp.de) has joined #linuxvoice
2016-03-04 13:48:12 < chemist69_ (~apl@a89-182-68-190.net-htp.de) has quit (Ping timeout: 246 seconds)
2016-03-04 14:36:49 > swift110-phone2 (~swift110-@unaffiliated/swift110) has joined #linuxvoice
2016-03-04 14:38:34 ChibaPet popey: Excellent recommendation. I'm halfway through the most recent episode of Luddites.
2016-03-04 14:39:41 > swift110-phone (~swift110-@unaffiliated/swift110) has joined #linuxvoice
2016-03-04 14:39:45 swift110-phone Hey
2016-03-04 14:41:30 < swift110-phone (~swift110-@unaffiliated/swift110) has quit (Remote host closed the connection)
2016-03-04 15:14:39 > swift110-phone (~swift110-@unaffiliated/swift110) has joined #linuxvoice
2016-03-04 15:14:41 swift110-phone Hey
2016-03-04 15:26:18 < brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has quit (Quit: Konversation terminated!)
2016-03-04 15:28:25 < chemist69 (~apl@a89-182-1-112.net-htp.de) has quit (Ping timeout: 240 seconds)
2016-03-04 15:30:21 > brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has joined #linuxvoice
2016-03-04 15:31:06 < petrichor (~znc@unaffiliated/petrichor) has quit (Ping timeout: 268 seconds)
2016-03-04 15:34:02 < grifferz (~andy@bitfolk.com) has quit (Remote host closed the connection)
2016-03-04 15:34:08 > grifferz (~andy@bitfolk.com) has joined #linuxvoice
2016-03-04 15:39:22 > petrichor (~znc@unaffiliated/petrichor) has joined #linuxvoice
2016-03-04 15:55:45 > chemist69 (~apl@a89-182-1-112.net-htp.de) has joined #linuxvoice
2016-03-04 16:01:43 < ddeimeke (~ddeimeke@moas.mhochzwei.net) has left #linuxvoice ("Bye")
2016-03-04 16:04:19 < zmoylan-pi (~pi@109.78.210.61) has quit (Ping timeout: 252 seconds)
2016-03-04 16:08:18 > zmoylan-pi (~pi@109.76.242.168) has joined #linuxvoice
2016-03-04 16:22:07 > ideasman42 (~cambo@203-206-123-225.dyn.iinet.net.au) has joined #linuxvoice
2016-03-04 17:29:34 < okovko (~okovko@c-24-15-233-102.hsd1.il.comcast.net) has quit (Ping timeout: 240 seconds)
2016-03-04 17:44:38 > prayingmantis (~prayingma@203-7-33-136.dyn.iinet.net.au) has joined #linuxvoice
2016-03-04 17:53:19 < brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has quit (Quit: Konversation terminated!)
2016-03-04 18:25:23 > brillig (~brillig@pool-71-174-142-27.bstnma.east.verizon.net) has joined #linuxvoice
2016-03-04 18:29:51 > LauRoman (~LauRoman@5-14-36-100.residential.rdsnet.ro) has joined #linuxvoice
2016-03-04 18:53:18 < ideasman42 (~cambo@203-206-123-225.dyn.iinet.net.au) has quit (Remote host closed the connection)
2016-03-04 18:59:34 < quaisi (~simon@host-92-30-27-114.as13285.net) has quit (Ping timeout: 240 seconds)
2016-03-04 19:00:48 > quaisi (~simon@host-92-30-27-114.as13285.net) has joined #linuxvoice
2016-03-04 19:07:49 < quaisi (~simon@host-92-30-27-114.as13285.net) has quit (Ping timeout: 250 seconds)
2016-03-04 19:08:42 > quaisi (~simon@host-92-30-27-114.as13285.net) has joined #linuxvoice
2016-03-04 19:09:17 > arubislander (~ubuntuadm@86.93.93.218) has joined #linuxvoice
2016-03-04 19:12:46 - foxhunt_away is now known as foxhunt72
2016-03-04 19:17:47 < quaisi (~simon@host-92-30-27-114.as13285.net) has quit (Ping timeout: 250 seconds)
2016-03-04 19:18:38 > quaisi (~simon@host-92-30-27-114.as13285.net) has joined #linuxvoice
2016-03-04 19:25:35 < quaisi (~simon@host-92-30-27-114.as13285.net) has quit (Ping timeout: 250 seconds)
2016-03-04 19:26:34 > quaisi (~simon@host-92-30-27-114.as13285.net) has joined #linuxvoice
2016-03-04 19:33:39 < quaisi (~simon@host-92-30-27-114.as13285.net) has quit (Ping timeout: 260 seconds)
2016-03-04 19:34:30 > quaisi (~simon@host-92-30-27-114.as13285.net) has joined #linuxvoice
2016-03-04 19:37:00 > TwistedLucidity (~TwistedLu@cpc80671-stap13-2-0-cust118.12-2.cable.virginm.net) has joined #linuxvoice
2016-03-04 19:38:39 > HEGX64 (~Scott@CPE-121-220-209-30.lns5.way.bigpond.net.au) has joined #linuxvoice
2016-03-04 19:44:42 > johnlane (~john@212.159.104.145) has joined #linuxvoice
2016-03-04 19:50:27 < johnlane (~john@212.159.104.145) has quit (Remote host closed the connection)
2016-03-04 20:06:35 > andybalaam (andybalaam@nat/ibm/x-ldbvbhcmllsqgezq) has joined #linuxvoice
2016-03-04 23:09:10 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-03-04 23:09:10 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-03-04 23:09:10 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-03-04 23:09:10 - Channel #linuxvoice: 76 nicks (1 op, 0 voices, 75 normals)
2016-03-04 23:09:19 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-03-04 23:12:10 mcphail Devilment: what do you drive? Most bulbs are easier than the handbook suggests. Keen to send you towards dealerships for trivial tasks.
2016-03-04 23:17:49 > HEGX64 (~Scott@CPE-121-220-209-30.lns5.way.bigpond.net.au) has joined #linuxvoice
2016-03-04 23:27:19 popey I took wifeys car to Halfords, they fitted the lamps (I used to get chastised by a co-worker for calling them bulbs) for me
2016-03-04 23:27:34 popey meant I didn't have to get dirty or break my wrist to get to the housing
2016-03-04 23:35:05 mcphail popey: "Taking it to Halfords" is the final surrender of masculinity ;p
2016-03-04 23:35:35 popey hah
2016-03-04 23:48:49 > SuperEngineer (~SuperEngi@host86-172-107-35.range86-172.btcentralplus.com) has joined #linuxvoice
2016-03-04 23:49:28 > okovko (~okovko@c-24-15-233-102.hsd1.il.comcast.net) has joined #linuxvoice
2016-03-04 23:49:40 < okovko (~okovko@c-24-15-233-102.hsd1.il.comcast.net) has quit (Read error: Connection reset by peer)
2016-03-04 23:50:10 swift110-phone Hey popey how r u
2016-03-04 23:50:26 popey tickety boo :)
2016-03-04 23:50:27 popey hows you?
2016-03-04 23:51:57 swift110-phone Im great
2016-03-04 23:52:06 swift110-phone What are you up to popey
2016-03-04 23:52:22 popey work :)
2016-03-04 23:54:25 < HEGX64 (~Scott@CPE-121-220-209-30.lns5.way.bigpond.net.au) has quit (Ping timeout: 240 seconds)
2016-03-04 23:56:51 swift110-phone Ok
2016-03-05 00:07:54 > HEGX64 (~Scott@CPE-121-220-209-30.lns5.way.bigpond.net.au) has joined #linuxvoice
2016-03-05 00:10:25 < jherrmann (~jirkah@ip4-83-240-20-19.cust.nbox.cz) has quit (Quit: Toodle pip!)
2016-03-05 00:22:26 > jaake (~h4ckm3@129.59.122.17) has joined #linuxvoice
2016-03-05 00:29:41 < SuperEngineer (~SuperEngi@host86-172-107-35.range86-172.btcentralplus.com) has quit (Quit: bfn...my planet needs me back)
2016-03-05 00:36:56 Devilment mcphail: Corsa D 2011 face-lifted version
2016-03-05 00:38:26 Devilment Cost me £13 at Eurocarparts for 2 H7 new bulbs. Halfrauds would charge twice that and probably £5-£10 fitting
2016-03-05 01:02:29 > jherrmann (~jirkah@ip4-83-240-20-19.cust.nbox.cz) has joined #linuxvoice
2016-03-05 01:07:24 < HEGX64 (~Scott@CPE-121-220-209-30.lns5.way.bigpond.net.au) has quit (Quit: Leaving)
2016-03-05 01:28:20 < chemist69 (~apl@a89-182-1-112.net-htp.de) has quit (Quit: WeeChat 1.4)
2016-03-05 01:34:50 > gareppa (~gareppa@151.31.13.116) has joined #linuxvoice
2016-03-05 01:35:04 < gareppa (~gareppa@151.31.13.116) has quit (Remote host closed the connection)
2016-03-05 02:24:06 < mnavrati (milan@nat/redhat/x-uovicppvpgxtyrsd) has quit (Quit: Leaving)
2016-03-05 02:36:44 < nix0ut1aw (~Andy@91.244.229.42) has quit (Quit: Leaving)
2016-03-05 02:59:16 < Aikidokajeff (~Thunderbi@primary.bertrams.com) has quit (Quit: Aikidokajeff)
2016-03-05 03:04:56 < swift110-phone (~swift110-@unaffiliated/swift110) has quit (Remote host closed the connection)
2016-03-05 03:09:56 > mnavrati (~milan@ip-94-113-220-233.net.upcbroadband.cz) has joined #linuxvoice
2016-03-05 03:19:23 < brillig (~brillig@pool-71-174-142-27.bstnma.east.verizon.net) has quit
2016-03-05 03:35:37 - foxhunt72 is now known as foxhunt_away
2016-03-05 03:36:22 < arubislander (~ubuntuadm@86.93.93.218) has quit (Quit: Leaving.)
2016-03-05 03:42:39 mcphail Devilment: never had to fit a corsa bulb, but having a pair of angled long-nose pliers handy is usually a good idea
2016-03-05 03:49:25 < quaisi (~simon@host-92-30-27-114.as13285.net) has quit (Ping timeout: 252 seconds)
2016-03-05 03:50:24 > quaisi (~simon@host-92-30-27-114.as13285.net) has joined #linuxvoice
2016-03-05 04:00:23 < quaisi (~simon@host-92-30-27-114.as13285.net) has quit (Ping timeout: 250 seconds)
2016-03-05 04:01:22 > quaisi (~simon@host-92-30-27-114.as13285.net) has joined #linuxvoice
2016-03-05 04:06:55 > towy71 (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has joined #linuxvoice
2016-03-05 04:07:17 > writtenoff (~writtenof@d172-218-204-26.bchsia.telus.net) has joined #linuxvoice
2016-03-05 04:08:30 < towy71_ (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has quit (Ping timeout: 276 seconds)
2016-03-05 04:11:52 < quaisi (~simon@host-92-30-27-114.as13285.net) has quit (Ping timeout: 264 seconds)
2016-03-05 04:12:20 > quaisi (~simon@host-92-30-27-114.as13285.net) has joined #linuxvoice
2016-03-05 04:19:20 Devilment mcphail: Watching You Tube videos on how to do it. Seems driver's side is easy, passenger's side requires you to dismantle half the front of the car.
2016-03-05 04:19:28 Devilment Guess which one I need to replace
2016-03-05 04:21:43 < TwistedLucidity (~TwistedLu@cpc80671-stap13-2-0-cust118.12-2.cable.virginm.net) has quit (Quit: Konversation terminated!)
2016-03-05 04:37:41 < andybalaam (andybalaam@nat/ibm/x-ldbvbhcmllsqgezq) has quit (Remote host closed the connection)
2016-03-05 05:00:17 < mnavrati (~milan@ip-94-113-220-233.net.upcbroadband.cz) has quit (Quit: Leaving)
2016-03-05 05:11:38 < swift110-phone2 (~swift110-@unaffiliated/swift110) has quit (Remote host closed the connection)
2016-03-05 05:30:43 < quaisi (~simon@host-92-30-27-114.as13285.net) has quit (Ping timeout: 244 seconds)
2016-03-05 05:31:29 > quaisi (~simon@host-92-30-27-114.as13285.net) has joined #linuxvoice
2016-03-05 05:39:01 < quaisi (~simon@host-92-30-27-114.as13285.net) has quit (Ping timeout: 268 seconds)
2016-03-05 05:39:24 > quaisi (~simon@host-92-30-27-114.as13285.net) has joined #linuxvoice
2016-03-05 06:03:13 > gareppa (~gareppa@151.31.13.116) has joined #linuxvoice
2016-03-05 06:09:57 < quaisi (~simon@host-92-30-27-114.as13285.net) has quit (Ping timeout: 250 seconds)
2016-03-05 06:10:41 > quaisi (~simon@host-92-30-27-114.as13285.net) has joined #linuxvoice
2016-03-05 06:16:23 < gareppa (~gareppa@151.31.13.116) has quit (Quit: Leaving)
2016-03-05 06:17:10 < evilnickveitch (~evilnick@cpc83321-bath6-2-0-cust252.18-1.cable.virginm.net) has quit (Quit: Leaving)
2016-03-05 06:38:40 towy71 re tricky replacement of stuff I believe that Citroen mechanics have two or three elbows and wrists
2016-03-05 06:39:40 zmoylan-pi probably built their manufacturing plant next to nuclear power station
2016-03-05 06:48:30 ChibaPet popey: I listened to the second half of that Luddites episode on my way in today. Well. I listened to most of it. I had to fast-forward through the convergence bits.
2016-03-05 06:49:03 popey :)
2016-03-05 07:29:05 < quaisi (~simon@host-92-30-27-114.as13285.net) has quit (Ping timeout: 244 seconds)
2016-03-05 07:29:50 > quaisi (~simon@host-92-30-27-114.as13285.net) has joined #linuxvoice
2016-03-05 07:33:22 > anglisc (~aethelber@81-86-151-146.dsl.pipex.com) has joined #linuxvoice
2016-03-05 07:34:53 > asusk7m550 (~Thunderbi@2001:981:97b3:1:7cd2:fc79:66f9:288f) has joined #linuxvoice
2016-03-05 07:41:31 < johnlane (~john@212.159.104.145) has quit (Remote host closed the connection)
2016-03-05 07:44:51 < quaisi (~simon@host-92-30-27-114.as13285.net) has quit (Ping timeout: 248 seconds)
2016-03-05 07:45:55 > quaisi (~simon@host-92-30-27-114.as13285.net) has joined #linuxvoice
2016-03-05 07:52:51 < quaisi (~simon@host-92-30-27-114.as13285.net) has quit (Ping timeout: 248 seconds)
2016-03-05 07:53:50 > quaisi (~simon@host-92-30-27-114.as13285.net) has joined #linuxvoice
2016-03-05 08:03:37 < quaisi (~simon@host-92-30-27-114.as13285.net) has quit (Ping timeout: 240 seconds)
2016-03-05 08:04:48 > quaisi (~simon@host-92-30-27-114.as13285.net) has joined #linuxvoice
2016-03-05 08:11:34 < quaisi (~simon@host-92-30-27-114.as13285.net) has quit (Ping timeout: 240 seconds)
2016-03-05 08:12:47 > quaisi (~simon@host-92-30-27-114.as13285.net) has joined #linuxvoice
2016-03-05 08:19:24 < jaake (~h4ckm3@129.59.122.17) has quit (Ping timeout: 276 seconds)
2016-03-05 08:29:55 < quaisi (~simon@host-92-30-27-114.as13285.net) has quit (Ping timeout: 250 seconds)
2016-03-05 08:30:53 > quaisi (~simon@host-92-30-27-114.as13285.net) has joined #linuxvoice
2016-03-05 08:32:56 > dankeast (~dan@host86-183-174-170.range86-183.btcentralplus.com) has joined #linuxvoice
2016-03-05 08:44:42 < jherrmann (~jirkah@ip4-83-240-20-19.cust.nbox.cz) has quit (Quit: Toodle pip!)
2016-03-05 09:02:03 < quaisi (~simon@host-92-30-27-114.as13285.net) has quit (Ping timeout: 240 seconds)
2016-03-05 09:03:14 > quaisi (~simon@host-92-30-27-114.as13285.net) has joined #linuxvoice
2016-03-05 09:15:58 > metasansana (~metasansa@unaffiliated/metasansana) has joined #linuxvoice
2016-03-05 09:25:00 < LVbot (~iBot@huwloosley.plus.com) has quit (Remote host closed the connection)
2016-03-05 09:38:42 < dankeast (~dan@host86-183-174-170.range86-183.btcentralplus.com) has quit (Ping timeout: 276 seconds)
2016-03-05 09:52:02 < asusk7m550 (~Thunderbi@2001:981:97b3:1:7cd2:fc79:66f9:288f) has quit (Quit: asusk7m550)
2016-03-05 10:01:53 > brillig (~brillig@pool-71-174-142-27.bstnma.east.verizon.net) has joined #linuxvoice
2016-03-05 10:13:02 > brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has joined #linuxvoice
2016-03-05 10:38:40 > zmoylan-1i (~pi@109.76.242.168) has joined #linuxvoice
2016-03-05 10:40:21 < zmoylan-pi (~pi@109.76.242.168) has quit (Ping timeout: 250 seconds)
2016-03-05 11:01:37 < brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has quit (Ping timeout: 240 seconds)
2016-03-05 11:05:54 > brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has joined #linuxvoice
2016-03-05 11:23:10 > gamerchick02 (~gamerchic@adsl-108-68-76-9.dsl.sgnwmi.sbcglobal.net) has joined #linuxvoice
2016-03-05 11:35:51 < gamerchick02 (~gamerchic@adsl-108-68-76-9.dsl.sgnwmi.sbcglobal.net) has quit (Quit: Leaving)
2016-03-05 11:43:01 > gamerchick02 (~gamerchic@adsl-108-68-76-9.dsl.sgnwmi.sbcglobal.net) has joined #linuxvoice
2016-03-05 11:44:51 < gamerchick02 (~gamerchic@adsl-108-68-76-9.dsl.sgnwmi.sbcglobal.net) has quit (Client Quit)
2016-03-05 11:48:35 > gamerchick02 (~gamerchic@adsl-108-68-78-179.dsl.sgnwmi.sbcglobal.net) has joined #linuxvoice
2016-03-05 11:49:12 > HEGX64 (~Scott@CPE-121-220-209-30.lns5.way.bigpond.net.au) has joined #linuxvoice
2016-03-05 12:08:34 < gamerchick02 (~gamerchic@adsl-108-68-78-179.dsl.sgnwmi.sbcglobal.net) has quit (Quit: Leaving)
2016-03-05 12:25:49 Devilment Want! http://cdn.lamborghini.com/content/company_news/Centenario_07_High.jpg
2016-03-05 13:04:14 < HEGX64 (~Scott@CPE-121-220-209-30.lns5.way.bigpond.net.au) has quit (Ping timeout: 260 seconds)
2016-03-05 13:56:06 < brillig (~brillig@pool-71-174-142-27.bstnma.east.verizon.net) has quit (Ping timeout: 276 seconds)
2016-03-05 13:58:06 > brillig_borogrov (~brillig@pool-98-110-172-41.bstnma.fios.verizon.net) has joined #linuxvoice
2016-03-05 13:58:39 < brillig_borogrov (~brillig@pool-98-110-172-41.bstnma.fios.verizon.net) has quit (Client Quit)
2016-03-05 14:10:22 > zmoylan-pi (~pi@109.77.100.168) has joined #linuxvoice
2016-03-05 14:13:33 < zmoylan-1i (~pi@109.76.242.168) has quit (Ping timeout: 250 seconds)
2016-03-05 14:13:37 ChibaPet Want! http://autovisie.nl/wp-content/uploads/2015/10/1989_daihatsu_hijet_dumbo.jpg
2016-03-05 15:33:37 > HEGX64 (~Scott@CPE-121-220-209-30.lns5.way.bigpond.net.au) has joined #linuxvoice
2016-03-05 15:48:33 < mcphail (~mcphail@unaffiliated/mcphail) has quit (Ping timeout: 276 seconds)
2016-03-05 15:49:56 > mcphail (~mcphail@host86-147-175-1.range86-147.btcentralplus.com) has joined #linuxvoice
2016-03-05 15:49:57 < mcphail (~mcphail@host86-147-175-1.range86-147.btcentralplus.com) has quit (Changing host)
2016-03-05 15:49:57 > mcphail (~mcphail@unaffiliated/mcphail) has joined #linuxvoice
2016-03-05 16:03:41 < zmoylan-pi (~pi@109.77.100.168) has quit (Ping timeout: 244 seconds)
2016-03-05 16:05:27 < mcphail (~mcphail@unaffiliated/mcphail) has quit (Ping timeout: 276 seconds)
2016-03-05 16:06:43 > mcphail (~mcphail@host86-182-19-65.range86-182.btcentralplus.com) has joined #linuxvoice
2016-03-05 16:06:43 < mcphail (~mcphail@host86-182-19-65.range86-182.btcentralplus.com) has quit (Changing host)
2016-03-05 16:06:43 > mcphail (~mcphail@unaffiliated/mcphail) has joined #linuxvoice
2016-03-05 16:07:57 > zmoylan-pi (~pi@109.79.65.238) has joined #linuxvoice
2016-03-05 16:22:38 < mcphail (~mcphail@unaffiliated/mcphail) has quit (Ping timeout: 248 seconds)
2016-03-05 16:24:26 > mcphail (~mcphail@host86-176-74-179.range86-176.btcentralplus.com) has joined #linuxvoice
2016-03-05 16:24:26 < mcphail (~mcphail@host86-176-74-179.range86-176.btcentralplus.com) has quit (Changing host)
2016-03-05 16:24:26 > mcphail (~mcphail@unaffiliated/mcphail) has joined #linuxvoice
2016-03-05 16:44:58 > swift110-phone (~swift110-@unaffiliated/swift110) has joined #linuxvoice
2016-03-05 16:46:37 < swift110-phone (~swift110-@unaffiliated/swift110) has quit (Remote host closed the connection)
2016-03-05 16:47:43 > swift110-phone (~swift110-@unaffiliated/swift110) has joined #linuxvoice
2016-03-05 16:47:44 < swift110-phone (~swift110-@unaffiliated/swift110) has quit (Excess Flood)
2016-03-05 16:54:58 < writtenoff (~writtenof@d172-218-204-26.bchsia.telus.net) has quit (Quit: WeeChat 1.3)
2016-03-05 16:57:34 > writtenoff (~writtenof@d172-218-204-26.bchsia.telus.net) has joined #linuxvoice
2016-03-05 18:03:36 < writtenoff (~writtenof@d172-218-204-26.bchsia.telus.net) has quit (Ping timeout: 246 seconds)
2016-03-05 18:08:03 < brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has quit (Quit: Konversation terminated!)
2016-03-05 18:10:59 > swift110-phone (~swift110-@unaffiliated/swift110) has joined #linuxvoice
2016-03-05 18:11:36 > brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has joined #linuxvoice
2016-03-05 18:15:15 < swift110-phone (~swift110-@unaffiliated/swift110) has quit (Remote host closed the connection)
2016-03-05 18:44:04 > writtenoff (~writtenof@d172-218-204-26.bchsia.telus.net) has joined #linuxvoice
2016-03-05 18:54:25 < mavrix (~mavrix@unaffiliated/mavrix) has quit (Ping timeout: 240 seconds)
2016-03-05 18:56:15 > mavrix (~mavrix@unaffiliated/mavrix) has joined #linuxvoice
2016-03-05 19:38:44 > dankeast (~dan@host86-183-174-170.range86-183.btcentralplus.com) has joined #linuxvoice
2016-03-05 20:11:07 < dankeast (~dan@host86-183-174-170.range86-183.btcentralplus.com) has quit (Ping timeout: 244 seconds)
2016-03-05 20:18:44 > dankeast (~dan@host86-183-174-170.range86-183.btcentralplus.com) has joined #linuxvoice
2016-03-05 20:41:49 < dankeast (~dan@host86-183-174-170.range86-183.btcentralplus.com) has quit (Ping timeout: 250 seconds)
2016-03-05 20:48:15 > Paddy_NI (~patrick@host-92-14-224-66.as43234.net) has joined #linuxvoice
2016-03-05 20:51:30 > Arthur_D (~magne@195.1.125.245) has joined #linuxvoice
2016-03-05 20:56:31 < Paddy_NI (~patrick@host-92-14-224-66.as43234.net) has quit (Remote host closed the connection)
2016-03-05 21:04:33 < towy71 (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has quit (Ping timeout: 240 seconds)
2016-03-05 21:15:23 < brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has quit (Quit: Konversation terminated!)
2016-03-05 21:19:23 < LauRoman (~LauRoman@5-14-36-100.residential.rdsnet.ro) has quit (Read error: Connection reset by peer)
2016-03-05 21:27:51 > towy71 (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has joined #linuxvoice
2016-03-05 22:17:05 > Nitronium (~Dave@host213-1-14-213.range213-1.btcentralplus.com) has joined #linuxvoice
2016-03-05 22:44:56 > johnlane (~john@212.159.104.145) has joined #linuxvoice
2016-03-05 22:57:16 > M1C4HTRON13 (~micah@bodhilinux/team/M1C4HTRON13) has joined #linuxvoice
2016-03-05 22:57:50 > SuperEngineer (~SuperEngi@host86-151-248-172.range86-151.btcentralplus.com) has joined #linuxvoice
2016-03-05 23:39:42 < blahdeblah (~quassel@unaffiliated/blahdeblah) has quit (Ping timeout: 260 seconds)
2016-03-05 23:55:46 > dankeast (~dan@host86-183-174-170.range86-183.btcentralplus.com) has joined #linuxvoice
2016-03-06 00:05:51 < dankeast (~dan@host86-183-174-170.range86-183.btcentralplus.com) has quit (Ping timeout: 246 seconds)
2016-03-06 00:18:45 > blahdeblah (~quassel@unaffiliated/blahdeblah) has joined #linuxvoice
2016-03-06 00:20:43 < HEGX64 (~Scott@CPE-121-220-209-30.lns5.way.bigpond.net.au) has quit (Quit: Leaving)
2016-03-06 00:22:33 > dankeast (~dan@host86-183-174-170.range86-183.btcentralplus.com) has joined #linuxvoice
2016-03-06 00:45:14 > gareppa (~gareppa@151.31.13.116) has joined #linuxvoice
2016-03-06 00:45:23 < SuperEngineer (~SuperEngi@host86-151-248-172.range86-151.btcentralplus.com) has left #linuxvoice ("bbs...my planet wants me back")
2016-03-06 01:04:49 LagerMon http://www.gizmag.com/wintergatan-musical-marble-machine/42157/?li_source=LI&li_medium=default-widget
2016-03-06 01:20:23 < M1C4HTRON13 (~micah@bodhilinux/team/M1C4HTRON13) has quit (Remote host closed the connection)
2016-03-06 01:48:02 < dankeast (~dan@host86-183-174-170.range86-183.btcentralplus.com) has quit (Ping timeout: 260 seconds)
2016-03-06 02:17:34 > dankeast (~dan@host86-183-174-170.range86-183.btcentralplus.com) has joined #linuxvoice
2016-03-06 02:26:15 > gamerchick02 (~gamerchic@adsl-108-68-78-179.dsl.sgnwmi.sbcglobal.net) has joined #linuxvoice
2016-03-06 03:03:10 < dankeast (~dan@host86-183-174-170.range86-183.btcentralplus.com) has quit (Ping timeout: 248 seconds)
2016-03-06 03:15:43 < Nitronium (~Dave@host213-1-14-213.range213-1.btcentralplus.com) has quit (Remote host closed the connection)
2016-03-06 03:20:37 < gareppa (~gareppa@151.31.13.116) has quit (Quit: Leaving)
2016-03-06 03:32:46 > dankeast (~dan@host86-183-174-170.range86-183.btcentralplus.com) has joined #linuxvoice
2016-03-06 03:53:34 > gareppa (~gareppa@151.31.13.116) has joined #linuxvoice
2016-03-06 03:53:58 < gareppa (~gareppa@151.31.13.116) has quit (Remote host closed the connection)
2016-03-06 03:58:09 towy71 LagerMon: excellent thank you ;-)
2016-03-06 04:13:37 < dankeast (~dan@host86-183-174-170.range86-183.btcentralplus.com) has quit (Ping timeout: 240 seconds)
2016-03-06 04:18:51 > Nitronium (~Dave@host213-1-14-213.range213-1.btcentralplus.com) has joined #linuxvoice
2016-03-06 04:49:49 < Nitronium (~Dave@host213-1-14-213.range213-1.btcentralplus.com) has quit (Remote host closed the connection)
2016-03-06 04:51:55 > jaake (~h4ckm3@c-68-52-45-79.hsd1.tn.comcast.net) has joined #linuxvoice
2016-03-06 04:54:25 > Paddy_NI (~patrick@host-92-14-224-66.as43234.net) has joined #linuxvoice
2016-03-06 04:57:16 > dankeast (~dan@host86-183-174-170.range86-183.btcentralplus.com) has joined #linuxvoice
2016-03-06 05:09:04 < dankeast (~dan@host86-183-174-170.range86-183.btcentralplus.com) has quit (Read error: Connection reset by peer)
2016-03-06 05:37:49 < Paddy_NI (~patrick@host-92-14-224-66.as43234.net) has quit (Quit: Konversation terminated!)
2016-03-06 05:39:24 > Paddy_NI (~patrick@host-92-14-224-66.as43234.net) has joined #linuxvoice
2016-03-06 05:48:46 < Paddy_NI (~patrick@host-92-14-224-66.as43234.net) has quit (Quit: Konversation terminated!)
2016-03-06 05:51:50 > Paddy_NI (~patrick@host-92-14-224-66.as43234.net) has joined #linuxvoice
2016-03-06 06:04:45 > asusk7m550 (~Thunderbi@2001:981:97b3:1:fd32:e2d7:b98e:f13f) has joined #linuxvoice
2016-03-06 06:07:05 > Extremulus (~Extremulu@2001:470:b:1fb:a62:66ff:fec8:c5ca) has joined #linuxvoice
2016-03-06 06:09:04 < jaake (~h4ckm3@c-68-52-45-79.hsd1.tn.comcast.net) has quit (Quit: WeeChat 1.4)
2016-03-06 06:38:40 > towy71_ (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has joined #linuxvoice
2016-03-06 06:41:07 < towy71 (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has quit (Ping timeout: 250 seconds)
2016-03-06 06:55:55 < Arthur_D (~magne@195.1.125.245) has quit (Quit: Leaving)
2016-03-06 07:03:09 < Paddy_NI (~patrick@host-92-14-224-66.as43234.net) has quit (Quit: Konversation terminated!)
2016-03-06 07:16:11 > Paddy_NI (~patrick@host-92-14-224-66.as43234.net) has joined #linuxvoice
2016-03-06 07:33:34 < gamerchick02 (~gamerchic@adsl-108-68-78-179.dsl.sgnwmi.sbcglobal.net) has quit (Ping timeout: 240 seconds)
2016-03-06 07:54:03 > LauRoman (~LauRoman@5-14-36-100.residential.rdsnet.ro) has joined #linuxvoice
2016-03-06 07:58:02 < Paddy_NI (~patrick@host-92-14-224-66.as43234.net) has quit (Quit: Konversation terminated!)
2016-03-06 07:59:19 > Paddy_NI (~patrick@host-92-14-224-66.as43234.net) has joined #linuxvoice
2016-03-06 08:10:18 > status402 (~status402@176.22.128.94) has joined #linuxvoice
2016-03-06 08:16:52 < johnlane (~john@212.159.104.145) has quit (Remote host closed the connection)
2016-03-06 08:18:09 > hammerron (~hammerron@96-32-57-238.dhcp.nwtn.ct.charter.com) has joined #linuxvoice
2016-03-06 08:23:19 < quaisi (~simon@host-92-30-27-114.as13285.net) has quit (Ping timeout: 260 seconds)
2016-03-06 08:24:03 > quaisi (~simon@host-92-30-27-114.as13285.net) has joined #linuxvoice
2016-03-06 08:43:03 < quaisi (~simon@host-92-30-27-114.as13285.net) has quit (Ping timeout: 240 seconds)
2016-03-06 08:44:09 > quaisi (~simon@host-92-30-27-114.as13285.net) has joined #linuxvoice
2016-03-06 08:52:08 < status402 (~status402@176.22.128.94) has quit (Quit: Leaving)
2016-03-06 08:57:37 < Paddy_NI (~patrick@host-92-14-224-66.as43234.net) has quit (Quit: Konversation terminated!)
2016-03-06 09:08:38 < hammerron (~hammerron@96-32-57-238.dhcp.nwtn.ct.charter.com) has quit (Quit: Leaving)
2016-03-06 09:11:36 < asusk7m550 (~Thunderbi@2001:981:97b3:1:fd32:e2d7:b98e:f13f) has quit (Quit: asusk7m550)
2016-03-06 10:13:15 > Arthur_D (~magne@195.1.125.245) has joined #linuxvoice
2016-03-06 11:39:36 < Dave (~dave@freenode/staff/dave2) has quit (Remote host closed the connection)
2016-03-06 11:41:15 > Dave (~dave@freenode/staff/dave2) has joined #linuxvoice
2016-03-06 11:44:27 > status402 (~status402@176.22.128.94) has joined #linuxvoice
2016-03-06 12:07:53 < LauRoman (~LauRoman@5-14-36-100.residential.rdsnet.ro) has quit (Read error: Connection reset by peer)
2016-03-06 12:11:06 < Dave (~dave@freenode/staff/dave2) has quit (Read error: Connection reset by peer)
2016-03-06 12:25:22 - irc: disconnected from server
2016-03-06 17:28:06 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-03-06 17:28:06 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-03-06 17:28:06 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-03-06 17:28:06 - Channel #linuxvoice: 65 nicks (1 op, 0 voices, 64 normals)
2016-03-06 17:28:17 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-03-07 00:22:36 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-03-07 00:22:36 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-03-07 00:22:36 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-03-07 00:22:36 - Channel #linuxvoice: 65 nicks (1 op, 0 voices, 64 normals)
2016-03-07 00:22:46 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-03-07 01:19:41 > jherrmann (~jirkah@ip4-83-240-20-19.cust.nbox.cz) has joined #linuxvoice
2016-03-07 02:14:13 > gamerchick02 (~gamerchic@108.68.78.179) has joined #linuxvoice
2016-03-07 02:25:05 > M1C4HTRON13 (~micah@84.203.75.6) has joined #linuxvoice
2016-03-07 02:25:05 < M1C4HTRON13 (~micah@84.203.75.6) has quit (Changing host)
2016-03-07 02:25:05 > M1C4HTRON13 (~micah@bodhilinux/team/M1C4HTRON13) has joined #linuxvoice
2016-03-07 02:26:56 > nix0ut1aw (~andy@97e0f514.skybroadband.com) has joined #linuxvoice
2016-03-07 02:29:41 - foxhunt72 is now known as foxhunt_away
2016-03-07 02:31:36 > status402 (~status402@176.22.128.94) has joined #linuxvoice
2016-03-07 04:09:03 > gareppa (~gareppa@151.31.13.116) has joined #linuxvoice
2016-03-07 04:11:18 < gareppa (~gareppa@151.31.13.116) has quit (Remote host closed the connection)
2016-03-07 04:26:51 < M1C4HTRON13 (~micah@bodhilinux/team/M1C4HTRON13) has quit (Quit: Leaving)
2016-03-07 04:59:52 > metasansana (~metasansa@unaffiliated/metasansana) has joined #linuxvoice
2016-03-07 05:10:47 > sjoos_ (~sjoos@a111225.upc-a.chello.nl) has joined #linuxvoice
2016-03-07 05:11:53 > benoliver999 (~ben@198.50.245.34) has joined #linuxvoice
2016-03-07 05:13:58 < sjoos_ (~sjoos@a111225.upc-a.chello.nl) has quit (Remote host closed the connection)
2016-03-07 05:40:58 > andyedin (d49f4606@gateway/web/freenode/ip.212.159.70.6) has joined #linuxvoice
2016-03-07 06:01:52 < status402 (~status402@176.22.128.94) has quit (Quit: Leaving)
2016-03-07 06:15:10 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-03-07 06:15:10 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-03-07 06:15:10 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-03-07 06:15:10 - Channel #linuxvoice: 71 nicks (1 op, 0 voices, 70 normals)
2016-03-07 06:15:19 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-03-07 06:34:47 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-03-07 06:34:47 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-03-07 06:34:47 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-03-07 06:34:47 - Channel #linuxvoice: 71 nicks (1 op, 0 voices, 70 normals)
2016-03-07 06:34:57 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-03-07 06:55:41 < Arthur_D (~magne@195.1.125.245) has quit (Quit: Leaving)
2016-03-07 06:56:39 < g0nz085 (~gonzo@cpc81199-farn9-2-0-cust619.6-2.cable.virginm.net) has quit (Ping timeout: 246 seconds)
2016-03-07 07:03:57 > g0nz085 (~gonzo@cpc81199-farn9-2-0-cust619.6-2.cable.virginm.net) has joined #linuxvoice
2016-03-07 07:09:07 > swift110 (~swift110@64.26.99.248) has joined #linuxvoice
2016-03-07 07:16:08 < swift110 (~swift110@64.26.99.248) has quit (Changing host)
2016-03-07 07:16:08 > swift110 (~swift110@unaffiliated/swift110) has joined #linuxvoice
2016-03-07 07:29:45 - foxhunt_away is now known as foxhunt72
2016-03-07 07:34:05 > Extremulus (~Extremulu@2001:470:b:1fb:deaf::d259) has joined #linuxvoice
2016-03-07 07:38:36 < Cadair (~Cadair@unaffiliated/cadair) has quit (Quit: ZNC - http://znc.in)
2016-03-07 07:39:35 > Cadair (~Cadair@unaffiliated/cadair) has joined #linuxvoice
2016-03-07 07:40:47 > LauRoman (~LauRoman@5-14-36-100.residential.rdsnet.ro) has joined #linuxvoice
2016-03-07 07:52:24 < Extremulus (~Extremulu@2001:470:b:1fb:deaf::d259) has quit (Remote host closed the connection)
2016-03-07 08:04:06 > mnavrati (~milan@ip-94-113-220-233.net.upcbroadband.cz) has joined #linuxvoice
2016-03-07 08:05:14 < Cadair (~Cadair@unaffiliated/cadair) has quit (Quit: ZNC - http://znc.in)
2016-03-07 08:06:16 > Cadair (~Cadair@unaffiliated/cadair) has joined #linuxvoice
2016-03-07 08:11:42 > towy71_ (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has joined #linuxvoice
2016-03-07 08:14:06 < towy71 (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has quit (Ping timeout: 248 seconds)
2016-03-07 08:26:12 - foxhunt72 is now known as foxhunt_away
2016-03-07 08:40:27 > sjoos_ (~sjoos@a111225.upc-a.chello.nl) has joined #linuxvoice
2016-03-07 08:51:11 < sjoos_ (~sjoos@a111225.upc-a.chello.nl) has quit (Remote host closed the connection)
2016-03-07 09:00:03 < swift110 (~swift110@unaffiliated/swift110) has quit (Ping timeout: 248 seconds)
2016-03-07 09:07:40 > Nitronium (~Dave@host109-158-29-46.range109-158.btcentralplus.com) has joined #linuxvoice
2016-03-07 09:12:10 > Extremulus (~Extremulu@2001:470:b:1fb:deaf::d259) has joined #linuxvoice
2016-03-07 09:19:12 < Nitronium (~Dave@host109-158-29-46.range109-158.btcentralplus.com) has quit (Remote host closed the connection)
2016-03-07 09:38:03 < post (~david@ip5f5b2b0f.dynamic.kabel-deutschland.de) has quit (Quit: Leaving)
2016-03-07 09:46:02 < gamerchick02 (~gamerchic@108.68.78.179) has quit (Quit: Leaving)
2016-03-07 09:47:54 < nix0ut1aw (~andy@97e0f514.skybroadband.com) has quit (Quit: Leaving)
2016-03-07 09:48:27 > nix0ut1aw (~andy@97e0f514.skybroadband.com) has joined #linuxvoice
2016-03-07 09:49:08 < nix0ut1aw (~andy@97e0f514.skybroadband.com) has quit (Client Quit)
2016-03-07 09:49:25 > nix0ut1aw (~andy@97e0f514.skybroadband.com) has joined #linuxvoice
2016-03-07 09:50:44 < nix0ut1aw (~andy@97e0f514.skybroadband.com) has quit (Client Quit)
2016-03-07 09:51:06 > nix0ut1aw (~andy@97e0f514.skybroadband.com) has joined #linuxvoice
2016-03-07 09:53:34 < nix0ut1aw (~andy@97e0f514.skybroadband.com) has quit (Client Quit)
2016-03-07 10:09:50 < jherrmann (~jirkah@ip4-83-240-20-19.cust.nbox.cz) has quit (Remote host closed the connection)
2016-03-07 10:10:44 Ioangogo Im still chousing google play music over amazon mp3 if i Have to buy digital music
2016-03-07 10:10:44 Ioangogo If you buy a album with tracks missing and you report it, they will refund you and depending on something else they will fix the isssue and give you the music
2016-03-07 10:10:56 Ioangogo Also downloading on linux is easlyer
2016-03-07 11:50:53 < andyedin (d49f4606@gateway/web/freenode/ip.212.159.70.6) has quit (Quit: Page closed)
2016-03-07 12:02:54 < mavrix (~mavrix@unaffiliated/mavrix) has quit (Ping timeout: 248 seconds)
2016-03-07 12:04:34 > mavrix (~mavrix@unaffiliated/mavrix) has joined #linuxvoice
2016-03-07 12:05:36 < LauRoman (~LauRoman@5-14-36-100.residential.rdsnet.ro) has quit (Read error: Connection reset by peer)
2016-03-07 12:33:27 > zmoylan-1i (~pi@109.76.137.188) has joined #linuxvoice
2016-03-07 12:36:09 < zmoylan-pi (~pi@109.76.238.156) has quit (Ping timeout: 246 seconds)
2016-03-07 12:54:24 > towy71 (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has joined #linuxvoice
2016-03-07 12:56:51 < towy71_ (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has quit (Ping timeout: 248 seconds)
2016-03-07 14:20:10 < frankbell (~The_Farme@ip98-183-208-12.hr.hr.cox.net) has quit (Quit: Leaving)
2016-03-07 16:01:06 > zmoylan-pi (~pi@109.76.202.43) has joined #linuxvoice
2016-03-07 16:04:03 < zmoylan-1i (~pi@109.76.137.188) has quit (Ping timeout: 248 seconds)
2016-03-07 17:11:22 > asusk7m550 (~Thunderbi@2001:981:97b3:1:f4f5:279c:edb8:9432) has joined #linuxvoice
2016-03-07 17:11:25 < asusk7m550 (~Thunderbi@2001:981:97b3:1:f4f5:279c:edb8:9432) has quit (Client Quit)
2016-03-07 17:52:03 > ideasman42 (~cambo@203-206-123-225.dyn.iinet.net.au) has joined #linuxvoice
2016-03-07 18:11:11 > jherrmann (jirkah@nat/redhat/x-jxsvvyaaizfyhjmk) has joined #linuxvoice
2016-03-07 18:31:48 > LauRoman (~LauRoman@5-14-36-100.residential.rdsnet.ro) has joined #linuxvoice
2016-03-07 18:51:27 < LauRoman (~LauRoman@5-14-36-100.residential.rdsnet.ro) has quit (Read error: Connection reset by peer)
2016-03-07 18:55:10 > LauRoman (~LauRoman@5-14-36-100.residential.rdsnet.ro) has joined #linuxvoice
2016-03-07 19:09:25 - foxhunt_away is now known as foxhunt72
2016-03-07 19:10:36 > arubislander (~ubuntuadm@86.93.93.218) has joined #linuxvoice
2016-03-07 19:16:51 - irc: disconnected from server
2016-03-08 08:34:07 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-03-08 08:34:07 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-03-08 08:34:07 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-03-08 08:34:07 - Channel #linuxvoice: 72 nicks (1 op, 0 voices, 71 normals)
2016-03-08 08:34:17 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-03-08 08:37:06 Devilment http://www.theregister.co.uk/2016/03/07/microsoft_sql_server_linux/
2016-03-08 08:40:12 dankeast pigs might fly
2016-03-08 08:40:24 dankeast no idea why you'd install it over postgres on a linux box, but still
2016-03-08 08:41:00 dankeast interesting to compare with the other stuff i've been reading about ms today: http://venturebeat.com/2016/03/05/why-epics-tim-sweeney-blasted-micrsooft-in-bid-to-keep-windows-10-open/
2016-03-08 08:43:25 zmoylan-pi a pig flying would be more reliable than sql on linux...
2016-03-08 08:46:33 dankeast ms sql, or just sql in general?
2016-03-08 08:48:11 dankeast does ms have a document based db?
2016-03-08 08:52:26 post office 365 ;)
2016-03-08 08:53:25 dankeast hah :)
2016-03-08 08:59:10 dankeast i wish instead of ms word people were used to git + markdown
2016-03-08 08:59:51 zmoylan-pi but is there a single defined standard of markdown or lots of variants...
2016-03-08 09:00:03 dankeast yeah, that's the downside
2016-03-08 09:00:07 dankeast definitely the second
2016-03-08 09:00:19 post also latex seems a bit messy. but wasn't word once like markdown, on msdos ...
2016-03-08 09:00:20 dankeast is there a single defined standard of ms documents though?
2016-03-08 09:00:30 zmoylan-pi and does it cover all bases or is it missing features...
2016-03-08 09:01:10 dankeast depends on the use case. the vast majority of the documents i end up having to trawl through are headings paragraphs, images and links
2016-03-08 09:01:17 zmoylan-pi coz i did look at markdown recently and it was missing a page break which would have been nice
2016-03-08 09:01:34 dankeast something i'd like to see a git history for, and be able to grep
2016-03-08 09:02:30 dankeast yeah, for actual type setting it's not enough. it's rare that's actually the case... and that's something you could apply to the file
2016-03-08 09:04:27 dankeast for a project i've started on at work i've been given a document describing an interface
2016-03-08 09:04:53 dankeast with xsd schemas nested inside
2016-03-08 09:05:10 dankeast copy & paste and you get all the numbered page breaks too
2016-03-08 09:05:23 dankeast there's a data definition. i can't grep it
2016-03-08 09:05:41 dankeast s/definition/dictionary/
2016-03-08 09:06:20 dankeast the text describing it all are just that
2016-03-08 09:06:56 dankeast maybe it's not even markdown + git. maybe it's just not straight away reaching for the office tools
2016-03-08 09:08:41 post i like pandoc
2016-03-08 09:09:03 < gb00s (~gb00s@c50-31.i07-13.onvol.net) has quit (Quit: Leaving)
2016-03-08 09:09:17 zmoylan-pi over the years i've kinda settled on 7bit ascii so i know it'll open in anything
2016-03-08 09:10:16 dankeast yeah, i installed pandoc the other day. i like it alot
2016-03-08 09:10:32 dankeast yeah. plain text all the way
2016-03-08 09:13:50 zmoylan-pi you just have to get 'creative' with *bold* /italic/ and _underline_ plus line breaks and indents
2016-03-08 09:16:41 dankeast i guess with something like pandoc you can actually get page breaks
2016-03-08 09:16:47 dankeast make each section a separate file
2016-03-08 09:20:25 dankeast html has it right with the separation of content and style, it's just that it's xml
2016-03-08 09:20:33 dankeast well, sort of
2016-03-08 09:22:59 < post (~dayf@ip5f5b0a40.dynamic.kabel-deutschland.de) has left #linuxvoice ("Left.")
2016-03-08 09:24:11 zmoylan-pi if html had page breaks to suggest were to break when it's printed on paper it would do 100% of what i want. without a page break it's no good for documentation or reports
2016-03-08 09:24:44 dankeast i'm pretty sure css3 now supports pagination
2016-03-08 09:27:10 < Nitronium (~Dave@host109-158-29-46.range109-158.btcentralplus.com) has quit (Remote host closed the connection)
2016-03-08 09:27:40 < mnavrati (~milan@ip-94-113-220-233.net.upcbroadband.cz) has quit (Quit: Leaving)
2016-03-08 09:41:03 > gamerchick02 (~gamerchic@c-68-36-7-43.hsd1.mi.comcast.net) has joined #linuxvoice
2016-03-08 09:43:03 < dankeast (~dan@86.183.174.170) has quit (Ping timeout: 240 seconds)
2016-03-08 09:52:28 < notarobert (d49f4606@gateway/web/freenode/ip.212.159.70.6) has quit (Quit: Page closed)
2016-03-08 12:27:48 < writtenoff (~writtenof@of1.psych.ubc.ca) has quit (Quit: WeeChat 1.3)
2016-03-08 13:10:06 > ideasman42 (~cambo@203-206-123-225.dyn.iinet.net.au) has joined #linuxvoice
2016-03-08 13:26:05 < gamerchick02 (~gamerchic@c-68-36-7-43.hsd1.mi.comcast.net) has quit (Quit: Leaving)
2016-03-08 15:01:39 < evilnickveitch (~evilnick@cpc83321-bath6-2-0-cust252.18-1.cable.virginm.net) has quit (Ping timeout: 248 seconds)
2016-03-08 15:10:51 < slashd (~slashd@modemcable157.191-130-66.mc.videotron.ca) has quit (Remote host closed the connection)
2016-03-08 15:44:58 > frankbell (~The_Farme@ip98-183-208-12.hr.hr.cox.net) has joined #linuxvoice
2016-03-08 16:01:07 > zmoylan-1i (~pi@109.79.89.44) has joined #linuxvoice
2016-03-08 16:04:17 < zmoylan-pi (~pi@109.77.248.119) has quit (Ping timeout: 260 seconds)
2016-03-08 16:05:32 < Extremulus (~Extremulu@2001:470:b:1fb:a62:66ff:fec8:c5ca) has quit (Remote host closed the connection)
2016-03-08 17:33:29 - zmoylan-1i is now known as zmoylan-pi
2016-03-08 17:47:46 < ideasman42 (~cambo@203-206-123-225.dyn.iinet.net.au) has quit (Remote host closed the connection)
2016-03-08 18:45:00 > ideasman42 (~cambo@203-206-123-225.dyn.iinet.net.au) has joined #linuxvoice
2016-03-08 18:52:42 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-03-08 18:52:42 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-03-08 18:52:42 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-03-08 18:52:42 - Channel #linuxvoice: 64 nicks (1 op, 0 voices, 63 normals)
2016-03-08 18:52:52 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-03-08 19:02:28 > evilnickveitch (~evilnick@cpc83321-bath6-2-0-cust252.18-1.cable.virginm.net) has joined #linuxvoice
2016-03-08 19:36:40 - foxhunt_away is now known as foxhunt72
2016-03-08 19:45:04 > mnavrati (milan@nat/redhat/x-rxpcssdyimirxzty) has joined #linuxvoice
2016-03-08 19:49:32 > dano (~dano@2601:242:8202:53c0::2) has joined #linuxvoice
2016-03-08 19:56:23 < dano (~dano@2601:242:8202:53c0::2) has quit (Quit: Leaving)
2016-03-08 20:02:14 > arubislander (~ubuntuadm@86.93.93.218) has joined #linuxvoice
2016-03-08 20:02:50 > andybalaam (andybalaam@nat/ibm/x-tyhccajmuekebaiw) has joined #linuxvoice
2016-03-08 20:05:47 > ryuslash (~slash@2a02:1812:2518:ce00:f24d:a2ff:fede:451c) has joined #linuxvoice
2016-03-08 20:21:44 > TwistedLucidity (~TwistedLu@cpc80671-stap13-2-0-cust118.12-2.cable.virginm.net) has joined #linuxvoice
2016-03-08 20:22:52 jimbotux morning! Not a very nice day today in not so sunny Scotland
2016-03-08 20:23:42 james_olympus A bit cloudy here also. At least it's not raining
2016-03-08 20:25:12 jimbotux very true, yesterday was magic i had lunch outside and went for a walk in sun.
2016-03-08 20:25:33 jimbotux today back to standard. dull, cloudy windy
2016-03-08 20:25:52 zmoylan-pi looks grand... [Glasgow, United Kingdom] Condition: Light Rain | Temp: 6C/43F/279K/502R | Humidity: 93% | Wind Speed 15mph/24kmph
2016-03-08 20:27:29 jimbotux haha
2016-03-08 20:28:08 jimbotux Im in edinburgh. But its very similar..
2016-03-08 20:28:56 zmoylan-pi [Edinburgh, United Kingdom] Condition: Mostly Cloudy | Temp: 5C/41F/278K/500R | Humidity: 87% | Wind Speed 20mph/32kmph
2016-03-08 20:29:34 > jherrmann (jirkah@nat/redhat/x-vnccwiuefakrcfyp) has joined #linuxvoice
2016-03-08 20:29:54 zmoylan-pi was gonna do edinburgh but glasgow is easier to spell this time of morning... :-)
2016-03-08 20:32:13 mcphail jimbotux: blue sky here in Inversneckie
2016-03-08 20:32:17 james_olympus I know. ':edit src/' in vim just became ':eric'. Don't know who Eric is
2016-03-08 20:35:06 Devilment zmoylan-pi: The irony of someone from RoI complaining about spelling :)
2016-03-08 20:35:45 Devilment Although the Welsh really take the cake in that regard
2016-03-08 20:36:19 zmoylan-pi thy do hav an l of a tim
2016-03-08 20:51:07 > m95lag (~m95lag@82-181-169-179.bb.dnainternet.fi) has joined #linuxvoice
2016-03-08 21:02:34 < arubislander (~ubuntuadm@86.93.93.218) has quit (Ping timeout: 240 seconds)
2016-03-08 21:03:45 > arubislander (~ubuntuadm@86.93.93.218) has joined #linuxvoice
2016-03-08 21:24:56 < LauRoman (~LauRoman@5-14-36-100.residential.rdsnet.ro) has quit (Read error: Connection reset by peer)
2016-03-08 21:29:54 cromulon Morning all
2016-03-08 21:32:46 - irc: disconnected from server
2016-03-09 08:24:32 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-03-09 08:24:32 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-03-09 08:24:32 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-03-09 08:24:32 - Channel #linuxvoice: 69 nicks (1 op, 0 voices, 68 normals)
2016-03-09 08:24:41 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-03-09 08:24:52 mcphail swift110: good. Having a brief chill-out away from along night at work. You up to anything exciting?
2016-03-09 08:26:07 > dankeast (~dan@host86-183-174-170.range86-183.btcentralplus.com) has joined #linuxvoice
2016-03-09 08:30:43 swift110 not really
2016-03-09 08:30:59 swift110 about to listen to a podcast and hopefully I can contribute via mumble
2016-03-09 08:31:44 @degville Those Linux Unplugged episodes come around quickly!
2016-03-09 08:33:40 swift110 yes
2016-03-09 08:33:51 swift110 degville: how did you know which one I was talking abiut
2016-03-09 08:34:21 @degville When I was on a few weeks ago, I saw you on the mumble server and guessed it would be the same this week.
2016-03-09 08:35:29 swift110 oh thats cool
2016-03-09 08:35:54 @degville It was good. I enjoyed being on the show. Mumble works really well.
2016-03-09 08:49:58 dankeast I've been watching the tv program Mr. Robot...
2016-03-09 08:50:08 dankeast it features characters discussing gnome vs kde
2016-03-09 08:50:51 dankeast there's a freenode irc channel shown quickly that actually turns out to exist
2016-03-09 08:51:18 dankeast has people hacking stuff... and it's done way too quickly, but most of it is pretty accurate
2016-03-09 08:51:59 dankeast not sure what i think about the program, but it's quite shocking for it not to be flashy nonsense when people hack
2016-03-09 08:52:43 @degville That is rare. It's such a difficult thing to portray accurately, both for the viewer and for the production team.
2016-03-09 08:54:47 dankeast Absolutely... the flashy stuff is nonsense, but i can completely see why it's that way. it can't be easy to show text on a terminal as exciting
2016-03-09 09:01:00 swift110 thats awesome degville
2016-03-09 09:03:09 < mavrix (~mavrix@unaffiliated/mavrix) has quit (Ping timeout: 260 seconds)
2016-03-09 09:09:38 > mavrix (~mavrix@unaffiliated/mavrix) has joined #linuxvoice
2016-03-09 09:10:24 < dankeast (~dan@host86-183-174-170.range86-183.btcentralplus.com) has quit (Ping timeout: 276 seconds)
2016-03-09 09:11:45 > dankeast (~dan@host86-183-174-170.range86-183.btcentralplus.com) has joined #linuxvoice
2016-03-09 09:14:16 < mavrix (~mavrix@unaffiliated/mavrix) has quit (Ping timeout: 264 seconds)
2016-03-09 09:22:18 > mavrix (~mavrix@unaffiliated/mavrix) has joined #linuxvoice
2016-03-09 09:35:16 < mavrix (~mavrix@unaffiliated/mavrix) has quit (Ping timeout: 264 seconds)
2016-03-09 09:35:40 > mavrix (~mavrix@unaffiliated/mavrix) has joined #linuxvoice
2016-03-09 09:42:27 < LauRoman (~LauRoman@5-14-36-100.residential.rdsnet.ro) has quit (Read error: Connection reset by peer)
2016-03-09 09:55:03 < dankeast (~dan@host86-183-174-170.range86-183.btcentralplus.com) has quit (Ping timeout: 244 seconds)
2016-03-09 10:08:54 < Nitronium (~Dave@host109-158-29-46.range109-158.btcentralplus.com) has quit (Remote host closed the connection)
2016-03-09 11:14:46 < evilnickveitch (~evilnick@cpc83321-bath6-2-0-cust252.18-1.cable.virginm.net) has quit (Ping timeout: 268 seconds)
2016-03-09 11:15:38 > swift110-phone (~swift110-@unaffiliated/swift110) has joined #linuxvoice
2016-03-09 11:21:28 < swift110 (~swift110@unaffiliated/swift110) has quit (Ping timeout: 264 seconds)
2016-03-09 11:23:08 < swift110-phone (~swift110-@unaffiliated/swift110) has quit (Read error: Connection reset by peer)
2016-03-09 11:27:27 > evilnickveitch (~evilnick@cpc83321-bath6-2-0-cust252.18-1.cable.virginm.net) has joined #linuxvoice
2016-03-09 12:30:12 < writtenoff (~writtenof@of1.psych.ubc.ca) has quit (Quit: WeeChat 1.3)
2016-03-09 12:36:39 < ryuslash (~slash@2a02:1812:2518:ce00:f24d:a2ff:fede:451c) has quit (Remote host closed the connection)
2016-03-09 13:06:12 < slashd (~slashd@ubuntu/member/slashd) has quit (Remote host closed the connection)
2016-03-09 13:20:50 > towy71_ (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has joined #linuxvoice
2016-03-09 13:23:19 < towy71 (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has quit (Ping timeout: 260 seconds)
2016-03-09 13:34:44 > zmoylan-1i (~pi@93.107.127.234) has joined #linuxvoice
2016-03-09 13:37:45 < zmoylan-pi (~pi@109.79.89.44) has quit (Ping timeout: 244 seconds)
2016-03-09 13:56:15 > towy71 (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has joined #linuxvoice
2016-03-09 13:58:11 < towy71_ (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has quit (Ping timeout: 268 seconds)
2016-03-09 14:54:35 > writtenoff (~writtenof@d172-218-204-26.bchsia.telus.net) has joined #linuxvoice
2016-03-09 15:44:01 > ideasman42 (~cambo@203-206-123-225.dyn.iinet.net.au) has joined #linuxvoice
2016-03-09 16:03:48 < zmoylan-1i (~pi@93.107.127.234) has quit (Ping timeout: 276 seconds)
2016-03-09 16:07:55 > zmoylan-pi (~pi@93.107.153.186) has joined #linuxvoice
2016-03-09 16:15:50 < zmoylan-pi (~pi@93.107.153.186) has quit (Read error: Connection timed out)
2016-03-09 16:16:04 > zmoylan-pi (~pi@93.107.153.186) has joined #linuxvoice
2016-03-09 16:38:47 < NYbill (~bill@104.236.1.137) has quit (Remote host closed the connection)
2016-03-09 16:47:16 < frankbell (~The_Farme@ip98-183-208-12.hr.hr.cox.net) has quit (Ping timeout: 264 seconds)
2016-03-09 16:47:57 > frankbell (~The_Farme@ip98-183-208-12.hr.hr.cox.net) has joined #linuxvoice
2016-03-09 17:32:21 Blackisle mcphail: I was wondering why chrome/google seemed to have fooked my apt-gets
2016-03-09 17:52:44 > chrisenf (~chris@S01060023beda582a.vf.shawcable.net) has joined #linuxvoice
2016-03-09 17:58:47 > LauRoman (~LauRoman@5-14-36-100.residential.rdsnet.ro) has joined #linuxvoice
2016-03-09 18:08:47 > vex21 (~vex@46.227.14.164) has joined #linuxvoice
2016-03-09 18:21:42 > jherrmann (jirkah@nat/redhat/x-pevbzmfaelvgepki) has joined #linuxvoice
2016-03-09 18:48:49 - irc: disconnected from server
2016-03-09 21:26:07 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-03-09 21:26:07 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-03-09 21:26:07 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-03-09 21:26:07 - Channel #linuxvoice: 71 nicks (1 op, 0 voices, 70 normals)
2016-03-09 21:26:17 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-03-09 21:35:13 > NYbill (~bill@104.236.1.137) has joined #linuxvoice
2016-03-09 21:43:44 Ioangogo Hmm why isnt media tomb apearing on my dlna apps
2016-03-09 21:45:02 > jherrmann (jirkah@nat/redhat/x-vxtkwlcsqlhzxcxi) has joined #linuxvoice
2016-03-09 21:48:43 > matthew1471 (~matthew14@194.74.188.133) has joined #linuxvoice
2016-03-09 21:50:30 - irc: disconnected from server
2016-03-09 23:29:59 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-03-09 23:29:59 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-03-09 23:29:59 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-03-09 23:29:59 - Channel #linuxvoice: 73 nicks (1 op, 0 voices, 72 normals)
2016-03-09 23:30:09 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-03-09 23:32:13 > bdmc (bdmc@cl-745.bos-01.us.sixxs.net) has joined #linuxvoice
2016-03-09 23:32:18 - zmoylan-1i is now known as zmoylan-pi
2016-03-09 23:34:12 - foxhunt72 is now known as foxhunt_away
2016-03-09 23:36:14 Ioangogo Anyone in here know any thing about changing the image sent to a dlna to a dlna device in minidlna
2016-03-09 23:36:26 Ioangogo Currently is show a debian logo
2016-03-09 23:36:45 Ioangogo or is in done on the other device
2016-03-09 23:38:02 - irc: disconnected from server
2016-03-09 23:38:14 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-03-09 23:38:14 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-03-09 23:38:14 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-03-09 23:38:14 - Channel #linuxvoice: 74 nicks (1 op, 0 voices, 73 normals)
2016-03-09 23:38:23 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-03-09 23:40:18 - irc: disconnected from server
2016-03-09 23:40:28 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-03-09 23:40:28 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-03-09 23:40:28 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-03-09 23:40:28 - Channel #linuxvoice: 74 nicks (1 op, 0 voices, 73 normals)
2016-03-09 23:40:36 > topcyde (~topcyde@2602:304:cdb8:9e40:250f:81c8:36ae:dae6) has joined #linuxvoice
2016-03-09 23:40:37 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-03-09 23:40:43 - irc: disconnected from server
2016-03-09 23:41:23 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-03-09 23:41:23 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-03-09 23:41:23 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-03-09 23:41:23 - Channel #linuxvoice: 75 nicks (1 op, 0 voices, 74 normals)
2016-03-09 23:41:33 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-03-09 23:47:41 mcphail Grr. Why do finance have to send me a plain-text summary report as an Excel spreadsheet???
2016-03-09 23:49:59 Ioangogo Becues excel is epic \s
2016-03-09 23:51:44 zmoylan-pi send back response as stone tablet with hyroglyphs... urinating dog urinating dog... :-P
2016-03-09 23:52:29 Ioangogo mcphail: wont it open in libre office calc
2016-03-09 23:53:18 Ioangogo The sun has been told off by the palace
2016-03-09 23:53:36 Ioangogo http://www.bbc.co.uk/news/uk-politics-35762443
2016-03-09 23:54:34 zmoylan-pi well... she is biased... she doesn't want to need a passport everytime she heads to the holiday bungalow castle in scotland
2016-03-09 23:54:59 mcphail Ioangogo: no problem opening it, but a 200 word summary is occupying 1MB in my cramped Inbox
2016-03-09 23:55:22 zmoylan-pi how small is your mailbox?
2016-03-09 23:55:31 mcphail zmoylan-pi: 400MB
2016-03-09 23:55:59 mcphail zmoylan-pi: I had to put in a special request for one so large
2016-03-09 23:56:17 zmoylan-pi move it out to a gmail email address and delete it from your inbox?
2016-03-09 23:57:46 mcphail zmoylan-pi: nope, because "policies"
2016-03-09 23:58:30 zmoylan-pi then move it to a local file and delete it from email? or delete attachment after moving it and save email?
2016-03-09 23:59:52 mcphail zmoylan-pi: yeah. Tis the only way. Unfortunately I work at 6 geographically remote locations, without any shared drive infrastructure between them. Email is the only shared resource
2016-03-10 00:00:17 mcphail so 400MB gets eaten up quickly
2016-03-10 00:00:40 zmoylan-pi then some bot on your system that will intercept email requests and email you files so that you can request the email send itself to you?
2016-03-10 00:01:59 mcphail zmoylan-pi: heh. I'll run that one past IT ;)
2016-03-10 00:02:31 zmoylan-pi i made a program yonks back that did essentially that with outlook express (shows how long ago) for something similar...
2016-03-10 00:03:20 zmoylan-pi not in the office? need a file? send an email and it would be sent to you... as long as it came from the right email address. and it would only send it back to that email address...
2016-03-10 00:06:29 < brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has quit (Quit: Konversation terminated!)
2016-03-10 00:06:49 mcphail zmoylan-pi: rather sad there's still a need for hacks like this is 2016. Should be a solved problem in the civilised world. But roaming profiles don't cut the mustard over long distances of copper wire to the back of beyond
2016-03-10 00:06:49 zmoylan-pi or the alternate is to email it to i.t. people at those 6 locations and tell them you need that file when you are in the location. the make it someone elses problem solution... :-)
2016-03-10 00:07:55 zmoylan-pi the shenanigans i did to have access to files in weird locations... i came so close to writing a program to send files via sms at stupid levels of cost per file :-D
2016-03-10 00:08:15 mcphail ha!
2016-03-10 00:08:34 zmoylan-pi 10p per 140 characters of 7 bit ascii to send a 4-5mb zip was just silly expensive :-)
2016-03-10 00:08:58 mcphail zmoylan-pi: probably cheaper to hire a courier
2016-03-10 00:09:50 zmoylan-pi often but sometimes not. when the recipient was in arse end of ireland it would take courier over a day to get there. and no modems nearby to connect to at glacial speeds of 4800 if you were lucky as phone lines were terrible
2016-03-10 00:10:01 > jaake (~h4ckm3@c-68-52-45-79.hsd1.tn.comcast.net) has joined #linuxvoice
2016-03-10 00:11:40 mcphail I'm off to Caithness this evening, and there's still huge expanses of land where you can't get any mobile signal at all. So even the SMS service would fall down :(
2016-03-10 00:11:58 zmoylan-pi fallback at that point is pigeon based...
2016-03-10 00:12:27 zmoylan-pi though i did send a lot of updates on aol floppies when they were around... :-)
2016-03-10 00:14:00 * mcphail better get off to his meeting
2016-03-10 00:14:22 zmoylan-pi o/
2016-03-10 00:23:36 > mnavrati (milan@nat/redhat/x-hbkakswehqzexqky) has joined #linuxvoice
2016-03-10 00:27:16 Blackisle heh mcphail - spent my first 10yrs in Brora :) you'd be as well bouncing a laser off the moon for comms up in Caithness :)
2016-03-10 00:28:17 zmoylan-pi laser of the moon... allow for freq... use it as pulse... delay in turnaround... that would work :-)
2016-03-10 00:28:35 zmoylan-pi 300bps at least :-)
2016-03-10 00:30:13 Blackisle there is already a mirror on the moon - they use it to accurately measure the distance between us/moon
2016-03-10 00:30:19 Blackisle iirc
2016-03-10 00:30:41 zmoylan-pi and when there's no moon fall back to... https://en.wikipedia.org/wiki/Meteor_burst_communications
2016-03-10 00:31:35 Blackisle that's pretty cool :)
2016-03-10 00:32:04 zmoylan-pi read about it on very isolated weather station in artic circle and it stuck with me for some reason... :-)
2016-03-10 00:36:14 Blackisle fairly sure that is the method used within our company - even though we're all based in the same office
2016-03-10 01:44:09 < nix0ut1aw (~Andy@91.244.229.42) has quit (Read error: Connection reset by peer)
2016-03-10 01:44:35 > nix0ut1aw (~Andy@91.244.229.42) has joined #linuxvoice
2016-03-10 01:47:07 Blackisle Kodi getting a facelift: https://kodi.tv/a-brand-new-look-for-future-kodi-versions/
2016-03-10 02:05:34 < jherrmann (jirkah@nat/redhat/x-lplnlbbpgxfqxbkn) has quit (Ping timeout: 240 seconds)
2016-03-10 02:13:50 Devilment The Wachowski Brothers then the Wachowski Siblings are now the Wachowski Sisters
2016-03-10 02:14:13 Devilment (Matrix writers/directors)
2016-03-10 02:16:01 hamgammon annoying how a daily fail reporter seemed to out her..
2016-03-10 02:20:47 > jherrmann (jirkah@nat/redhat/x-gpcpghmobufoyfcd) has joined #linuxvoice
2016-03-10 02:27:10 Blackisle didn't realise the 2nd sibling had also made the transition
2016-03-10 02:36:56 < writtenoff (~writtenof@d172-218-204-26.bchsia.telus.net) has quit (Quit: WeeChat 1.3)
2016-03-10 03:00:47 < blahdeblah (~quassel@unaffiliated/blahdeblah) has quit (Ping timeout: 260 seconds)
2016-03-10 03:03:14 < jherrmann (jirkah@nat/redhat/x-gpcpghmobufoyfcd) has quit (Ping timeout: 244 seconds)
2016-03-10 03:07:41 > vex21 (~vex@ip-62-245-125-253.net.upcbroadband.cz) has joined #linuxvoice
2016-03-10 03:07:51 - foxhunt72 is now known as foxhunt_away
2016-03-10 03:08:17 < vex21 (~vex@ip-62-245-125-253.net.upcbroadband.cz) has left #linuxvoice
2016-03-10 03:15:28 > jherrmann (jirkah@nat/redhat/x-uxwdfqjhlwsgeizw) has joined #linuxvoice
2016-03-10 03:16:47 > blahdeblah (~quassel@unaffiliated/blahdeblah) has joined #linuxvoice
2016-03-10 03:30:04 mcphail I wish I was a Go player. Would love to be following the current match with anything other than bewilderment
2016-03-10 03:45:00 andybalaam mcphail, I play a tiny bit. I am watching the match with delighted bewilderment
2016-03-10 03:45:45 mcphail andybalaam: I meant to try to learn before this one, but didn't find the time. Feel I'm missing a bit of history
2016-03-10 03:45:48 andybalaam Actually, I play every day on dragongoserver.net I'm just not very good
2016-03-10 03:46:06 andybalaam I love it
2016-03-10 03:46:10 andybalaam it just looks so good
2016-03-10 03:47:07 mcphail Is it newbie friendly?
2016-03-10 03:47:18 andybalaam the game or the web site?
2016-03-10 03:47:29 mcphail the latter, but really both :)
2016-03-10 03:47:36 andybalaam If you play against me, it is :-)
2016-03-10 03:47:53 andybalaam the game: when I started I found it utterly counterintuitive
2016-03-10 03:47:56 mcphail ha!
2016-03-10 03:48:04 andybalaam that was one of the things that really attracted me
2016-03-10 03:48:26 andybalaam if anyone wants to play, I am andybalaam on dragongoserver.net - just invite me to a game
2016-03-10 03:48:53 andybalaam it's a correspondance version on that site
2016-03-10 03:48:57 mcphail I tried playing the gnome go (or whatever) version a few years ago, but would not know where to begin with strategy or tactics
2016-03-10 03:48:59 andybalaam so you play a couple of moves a day
2016-03-10 03:49:27 mcphail andybalaam: I'll try to learn the rules then will attempt to give you a challenge :)
2016-03-10 03:49:35 andybalaam This page is ok: http://senseis.xmp.net/?BasicRulesOfGo
2016-03-10 03:50:01 andybalaam if you buy a physical set it might have the rules in it too
2016-03-10 03:50:46 andybalaam on the pc I like http://home.gna.org/quarry/ as a board
2016-03-10 03:50:51 andybalaam you can play GNU Go
2016-03-10 03:51:00 andybalaam it's not very good, but gives me a strong challenge
2016-03-10 03:51:07 andybalaam because I'm not very good :-)
2016-03-10 03:51:15 andybalaam very different from playing a human
2016-03-10 03:51:24 andybalaam extremely frustrating to lose to
2016-03-10 03:51:29 andybalaam it kind of takes you apart
2016-03-10 03:51:50 mcphail Yes - that's the problem, isn't it? I think you really need to play against humans to learn a board game
2016-03-10 03:51:56 andybalaam yep
2016-03-10 03:52:03 andybalaam I learnt with someone a lot better than me
2016-03-10 03:52:07 andybalaam we played every lunch time
2016-03-10 03:52:11 andybalaam it was exhausting
2016-03-10 03:52:15 andybalaam but great
2016-03-10 03:52:20 mcphail how long does a normal game take?
2016-03-10 03:52:27 andybalaam every game, we re-played afterwards and talked it through
2016-03-10 03:52:38 andybalaam a 19x19 game could be 1hr
2016-03-10 03:52:42 andybalaam or much longer
2016-03-10 03:52:52 andybalaam a 9x9 game could be half an hour or an hour
2016-03-10 03:53:02 mcphail do you play with a clock, like chess?
2016-03-10 03:53:02 andybalaam definitely start with 9x9
2016-03-10 03:53:07 andybalaam yes, in tournaments
2016-03-10 03:53:19 > quaisi (~simon@host-92-30-27-114.as13285.net) has joined #linuxvoice
2016-03-10 03:53:35 andybalaam if you try 19x19, even though it looks fun, if you don't know the basics it's just a waste of time
2016-03-10 03:58:55 < arubislander (~ubuntuadm@86.93.93.218) has quit (Quit: Leaving.)
2016-03-10 03:59:50 > ideasman42 (~cambo@203-206-123-225.dyn.iinet.net.au) has joined #linuxvoice
2016-03-10 04:08:46 < ideasman42 (~cambo@203-206-123-225.dyn.iinet.net.au) has quit (Remote host closed the connection)
2016-03-10 04:11:27 > writtenoff (~writtenof@of1.psych.ubc.ca) has joined #linuxvoice
2016-03-10 04:15:03 < Guest91215 (~Thunderbi@te6compton.te.rl.ac.uk) has quit (Ping timeout: 276 seconds)
2016-03-10 04:15:06 < andybalaam (andybalaam@nat/ibm/x-cflivpzdyqqmsilr) has quit (Remote host closed the connection)
2016-03-10 05:07:40 < TwistedLucidity (~TwistedLu@cpc80671-stap13-2-0-cust118.12-2.cable.virginm.net) has quit (Quit: Konversation terminated!)
2016-03-10 05:24:19 ChibaPet You Go, guys.
2016-03-10 05:25:10 ChibaPet So, apologies if this has already come up, but http://pandanet-igs.com/communities/pandanet is a vast, popular Internet Go Server with a native Linux client.
2016-03-10 05:25:33 @degville That's a great find!
2016-03-10 05:25:59 ChibaPet I found it ages ago, and I play there occasionally. ♥go♥
2016-03-10 05:26:31 ChibaPet 9x9 shouldn't take half an hour, but fifteen line boards are good short-game boards once you are comfortable with the rules.
2016-03-10 05:26:46 zmoylan-pi do bots have to log in as famous computers now? hal9000, ed209? :-)
2016-03-10 05:27:02 ChibaPet When I first teach people to play, we play a variant called the Capture Game, where it's normal Go except that the winner is the first to capture any stone.
2016-03-10 05:27:03 > ideasman42 (~cambo@203-206-123-225.dyn.iinet.net.au) has joined #linuxvoice
2016-03-10 05:28:32 ChibaPet A nifty thing about Go is that players of vastly different skill levels can play fun games, as there's an excellent handicap system that shifts organically to keep the games even and hence fun.
2016-03-10 05:39:10 > traceyc (~traceyc@c-98-194-48-190.hsd1.tx.comcast.net) has joined #linuxvoice
2016-03-10 05:39:46 traceyc Yay I have successfully set this thing up on KVirc
2016-03-10 05:39:51 ChibaPet \o/
2016-03-10 05:40:13 traceyc I usually use hexchat, decided to do something different on the home box
2016-03-10 05:40:19 zmoylan-pi any reason to change irc client?
2016-03-10 05:40:31 zmoylan-pi beat me to it... :-)
2016-03-10 05:40:33 traceyc It's Linux, trying something different is tradition :D
2016-03-10 05:40:39 @degville Cool. I use WeeChat and Konversation
2016-03-10 05:40:50 traceyc I've liked Konversation for general chat
2016-03-10 05:40:52 zmoylan-pi obviously not a vim user then... :-P
2016-03-10 05:41:22 traceyc Actually, I am
2016-03-10 05:41:30 traceyc It's my preferred cli text editor
2016-03-10 05:42:15 @degville I must admit, the more times goes on the more command line stuff I seem to be using and experimenting with. I like the lack of distraction.
2016-03-10 05:42:17 ChibaPet Try something different! Use Emacs for a week.
2016-03-10 05:42:35 traceyc I don't need an operating system in an operating system, thanks ;)
2016-03-10 05:42:43 zmoylan-pi is the week to load it? :-)
2016-03-10 05:42:48 traceyc ha
2016-03-10 05:44:30 zmoylan-pi i use nano for quick editing, newsbeuter for rss, ttytter for twitter and irssi for irc
2016-03-10 05:44:35 ChibaPet I don't think vim fans have much ground for attack here. :P
2016-03-10 05:44:50 zmoylan-pi still looking for easy useful email and spread sheets in console to use under tmux
2016-03-10 05:45:07 ChibaPet Email's easy. Spreadsheet, probably a lost cause.
2016-03-10 05:45:59 * traceyc fondly remembers WordPerfect
2016-03-10 05:46:17 zmoylan-pi i preferred wordstar.... :-)
2016-03-10 05:46:32 zmoylan-pi the dot commands were useful
2016-03-10 06:00:24 Devilment There are IRC clients other than irssi?
2016-03-10 06:03:17 zmoylan-pi so the legends tell us...
2016-03-10 06:04:07 popey the legends lie
2016-03-10 06:04:07 > Nitronium (~Dave@host109-158-29-46.range109-158.btcentralplus.com) has joined #linuxvoice
2016-03-10 06:16:11 > swift110 (~swift110@50.242.210.163) has joined #linuxvoice
2016-03-10 06:16:15 < jherrmann (jirkah@nat/redhat/x-uxwdfqjhlwsgeizw) has quit (Remote host closed the connection)
2016-03-10 06:17:51 swift110 hey all
2016-03-10 06:23:19 corsack hey swift110
2016-03-10 06:25:12 swift110 how are you corsack
2016-03-10 06:27:31 corsack not too bad, yourself?
2016-03-10 06:28:55 ChibaPet ircII
2016-03-10 06:30:02 < swift110 (~swift110@50.242.210.163) has quit (Changing host)
2016-03-10 06:30:02 > swift110 (~swift110@unaffiliated/swift110) has joined #linuxvoice
2016-03-10 06:30:44 swift110 im good corsack
2016-03-10 06:30:46 swift110 and you ChibaPet
2016-03-10 06:30:52 swift110 ch ch ch chiba
2016-03-10 06:31:26 * ChibaPet sprouts with joy.
2016-03-10 06:36:16 corsack good to hear swift110
2016-03-10 06:37:42 swift110 lol
2016-03-10 06:37:46 swift110 thanks corsack
2016-03-10 06:42:29 corsack for any Tron fans out there, I came across this https://github.com/zachlatta/sshtron
2016-03-10 06:43:11 < mnavrati (milan@nat/redhat/x-hbkakswehqzexqky) has quit (Quit: Leaving)
2016-03-10 06:43:44 james_olympus That's a good find
2016-03-10 06:45:57 swift110 hey james_olympus
2016-03-10 06:46:13 swift110 guys I invite you to #forthenerds
2016-03-10 06:46:25 swift110 thats my channel and I am trying to grow it
2016-03-10 06:47:24 james_olympus My high score is 113.
2016-03-10 06:47:50 corsack then you're better than me, my high score was 101 james_olympus
2016-03-10 06:50:22 james_olympus I used to play a 3D version. The graphics were a bit basic, like BZFlag
2016-03-10 06:54:04 corsack that's nice
2016-03-10 07:14:19 < jaake (~h4ckm3@c-68-52-45-79.hsd1.tn.comcast.net) has quit (Ping timeout: 244 seconds)
2016-03-10 07:22:24 > georgeowell (~georgeowe@95.149.192.133) has joined #linuxvoice
2016-03-10 07:33:27 > Exp0xff (~Exp0xff@49.32.0.36) has joined #linuxvoice
2016-03-10 07:35:35 > anglisc (~aethelber@81-86-151-146.dsl.pipex.com) has joined #linuxvoice
2016-03-10 07:37:08 Devilment http://www.theregister.co.uk/2016/03/09/microsoft_sonic_debian/
2016-03-10 07:37:21 Devilment SQL Server for Linux y'day
2016-03-10 07:37:31 Devilment It's the End of Days
2016-03-10 07:38:17 corsack indeed, it's upon us
2016-03-10 07:38:36 corsack I read this just now - http://www.theregister.co.uk/2016/03/09/microsoft_sonic_debian/?mt=1457553349532
2016-03-10 07:39:02 corsack sorry, didn't pay attention to the link you just posted
2016-03-10 07:40:06 james_olympus Yes, I'd trust them with my network infrastructure
2016-03-10 07:40:10 < Exp0xff (~Exp0xff@49.32.0.36) has quit (Quit: Leaving)
2016-03-10 07:46:56 traceyc right?
2016-03-10 07:47:56 traceyc Also saw a relatively new Linux distro writeup on El Reg. Solus. http://www.theregister.co.uk/2016/03/08/solus_linux_review/
2016-03-10 07:48:09 traceyc They seemed to be mostly fascinated by the flat look, which is... ok
2016-03-10 07:48:34 traceyc On the plus side, it's supposed to be lightweight and speedy. On the iffy side, new package management system
2016-03-10 07:49:53 zmoylan-pi probably a good way to test os performance divorced for sql server performance if you have an alternate sql server other than ms sql server on it... :-)
2016-03-10 08:07:43 Ioangogo :P finaly got the automated station done
2016-03-10 08:08:29 < asusk7m550 (~Thunderbi@2001:981:97b3:1:f1e7:57c6:8e91:7ea0) has quit (Quit: asusk7m550)
2016-03-10 08:27:21 swift110 hey Ioangogo
2016-03-10 08:27:26 swift110 hey zmoylan-pi
2016-03-10 08:27:30 swift110 hey traceyc
2016-03-10 08:28:54 james_olympus Ioangogo: Are you playing Minecraft?
2016-03-10 08:29:04 Ioangogo james_olympus: some time
2016-03-10 08:29:09 Ioangogo *times
2016-03-10 08:29:24 james_olympus You mentioned an automated station
2016-03-10 08:29:40 Ioangogo The station automaticly sends the cart off
2016-03-10 08:30:17 Ioangogo dropper latch and painful timing
2016-03-10 08:31:33 < corsack (~pi@cpc21-hudd9-2-0-cust116.4-1.cable.virginm.net) has quit (Remote host closed the connection)
2016-03-10 08:31:33 swift110 i like minetest
2016-03-10 08:31:37 james_olympus Cool. Right now I'm writing a servo controller, possibly for automated model stations
2016-03-10 08:32:15 > asusk7m550 (~Thunderbi@2001:981:97b3:1:f1e7:57c6:8e91:7ea0) has joined #linuxvoice
2016-03-10 08:32:17 Ioangogo IRL?
2016-03-10 08:32:21 < asusk7m550 (~Thunderbi@2001:981:97b3:1:f1e7:57c6:8e91:7ea0) has quit (Client Quit)
2016-03-10 08:32:25 james_olympus Yes
2016-03-10 08:32:55 Ioangogo That could be implemented with a digital train system
2016-03-10 08:34:02 > corsack (~pi@cpc21-hudd9-2-0-cust116.4-1.cable.virginm.net) has joined #linuxvoice
2016-03-10 08:35:03 Ioangogo http://opendcc.sourceforge.net/
2016-03-10 08:35:29 james_olympus Yes, like that
2016-03-10 08:35:31 < corsack (~pi@cpc21-hudd9-2-0-cust116.4-1.cable.virginm.net) has quit (Client Quit)
2016-03-10 08:35:49 > corsack (~pi@cpc21-hudd9-2-0-cust116.4-1.cable.virginm.net) has joined #linuxvoice
2016-03-10 08:36:28 Ioangogo Could you put a IR led by the station and a sensor on the train
2016-03-10 08:37:51 james_olympus It might be easier to build a 'light gate' with an LED on one side of the track and a sensor on the other
2016-03-10 08:52:37 < Nitronium (~Dave@host109-158-29-46.range109-158.btcentralplus.com) has quit (Remote host closed the connection)
2016-03-10 08:56:15 > brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has joined #linuxvoice
2016-03-10 08:57:03 < swift110 (~swift110@unaffiliated/swift110) has quit (Ping timeout: 250 seconds)
2016-03-10 09:06:41 < traceyc (~traceyc@c-98-194-48-190.hsd1.tx.comcast.net) has quit (Quit: I'm off)
2016-03-10 09:52:12 - irc: disconnected from server
2016-03-10 11:10:56 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-03-10 11:10:56 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-03-10 11:10:56 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-03-10 11:10:56 - Channel #linuxvoice: 73 nicks (1 op, 0 voices, 72 normals)
2016-03-10 11:11:06 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-03-10 11:48:22 > popey_ (~alan@cpc81199-farn9-2-0-cust577.6-2.cable.virginm.net) has joined #linuxvoice
2016-03-10 11:48:36 > g0nz085_ (~gonzo@cpc81199-farn9-2-0-cust619.6-2.cable.virginm.net) has joined #linuxvoice
2016-03-10 11:49:07 < ideasman42 (~cambo@203-206-123-225.dyn.iinet.net.au) has quit (Ping timeout: 248 seconds)
2016-03-10 11:49:07 < bdmc (bdmc@cl-745.bos-01.us.sixxs.net) has quit (Ping timeout: 248 seconds)
2016-03-10 11:49:08 < g0nz085 (~gonzo@cpc81199-farn9-2-0-cust619.6-2.cable.virginm.net) has quit (Ping timeout: 248 seconds)
2016-03-10 11:49:09 < popey (~alan@ubuntu/member/popey) has quit (Ping timeout: 248 seconds)
2016-03-10 11:49:11 < frankbell (~The_Farme@ip98-183-208-12.hr.hr.cox.net) has quit (Ping timeout: 248 seconds)
2016-03-10 11:49:12 > bdmc (bdmc@cl-745.bos-01.us.sixxs.net) has joined #linuxvoice
2016-03-10 11:50:27 > ideasman42 (~cambo@203-206-123-225.dyn.iinet.net.au) has joined #linuxvoice
2016-03-10 11:50:36 > frankbell (~The_Farme@ip98-183-208-12.hr.hr.cox.net) has joined #linuxvoice
2016-03-10 12:09:38 < chrisenf (~chris@S01060023beda582a.vf.shawcable.net) has quit (Quit: Leaving)
2016-03-10 12:10:21 < ryuslash (~slash@2a02:1812:2518:ce00:f24d:a2ff:fede:451c) has quit (Remote host closed the connection)
2016-03-10 12:17:36 < swift110 (~swift110@unaffiliated/swift110) has quit (Ping timeout: 244 seconds)
2016-03-10 12:26:53 < writtenoff (~writtenof@of1.psych.ubc.ca) has quit (Quit: WeeChat 1.3)
2016-03-10 12:27:38 < ideasman42 (~cambo@203-206-123-225.dyn.iinet.net.au) has quit (Quit: Ex-Chat)
2016-03-10 13:06:39 > swift110-phone (~swift110-@unaffiliated/swift110) has joined #linuxvoice
2016-03-10 13:07:50 < georgeowell (~georgeowe@95.149.192.133) has quit (Quit: Leaving)
2016-03-10 13:59:17 > zmoylan-1i (~pi@109.76.233.151) has joined #linuxvoice
2016-03-10 13:59:25 < hamgammon (~hamgammon@188.226.144.192) has quit (Ping timeout: 252 seconds)
2016-03-10 14:02:39 < zmoylan-pi (~pi@93.107.153.186) has quit (Ping timeout: 276 seconds)
2016-03-10 14:14:29 > brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has joined #linuxvoice
2016-03-10 14:26:14 > hamgammon (~hamgammon@188.226.144.192) has joined #linuxvoice
2016-03-10 15:10:39 < swift110-phone (~swift110-@unaffiliated/swift110) has quit (Remote host closed the connection)
2016-03-10 15:46:36 > ideasman42 (~cambo@203-206-123-225.dyn.iinet.net.au) has joined #linuxvoice
2016-03-10 16:03:24 < zmoylan-1i (~pi@109.76.233.151) has quit (Ping timeout: 246 seconds)
2016-03-10 16:08:00 > zmoylan-pi (~pi@109.79.41.212) has joined #linuxvoice
2016-03-10 16:13:46 < zmoylan-pi (~pi@109.79.41.212) has quit (Ping timeout: 268 seconds)
2016-03-10 16:14:02 > zmoylan-pi (~pi@109.79.41.212) has joined #linuxvoice
2016-03-10 16:17:33 > writtenoff (~writtenof@d172-218-204-26.bchsia.telus.net) has joined #linuxvoice
2016-03-10 16:31:23 > ddeimeke (~ddeimeke@moas.mhochzwei.net) has joined #linuxvoice
2016-03-10 16:40:26 < popey_ (~alan@cpc81199-farn9-2-0-cust577.6-2.cable.virginm.net) has quit (*.net *.split)
2016-03-10 16:45:47 > popey (~alan@cpc81199-farn9-2-0-cust577.6-2.cable.virginm.net) has joined #linuxvoice
2016-03-10 16:56:19 < zmoylan-pi (~pi@109.79.41.212) has quit (Ping timeout: 268 seconds)
2016-03-10 16:57:10 > zmoylan-pi (~pi@109.79.41.212) has joined #linuxvoice
2016-03-10 21:10:08 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-03-10 21:10:08 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-03-10 21:10:08 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-03-10 21:10:08 - Channel #linuxvoice: 73 nicks (1 op, 0 voices, 72 normals)
2016-03-10 21:10:18 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-03-10 21:14:04 > ryuslash (~slash@2a02:1812:2518:ce00:f24d:a2ff:fede:451c) has joined #linuxvoice
2016-03-10 21:19:09 > jherrmann (jirkah@nat/redhat/x-njucctexegkqrfpx) has joined #linuxvoice
2016-03-10 21:23:24 > evilnick__ (~evilnick@cpc83321-bath6-2-0-cust252.18-1.cable.virginm.net) has joined #linuxvoice
2016-03-10 21:23:28 < evilnick__ (~evilnick@cpc83321-bath6-2-0-cust252.18-1.cable.virginm.net) has quit (Remote host closed the connection)
2016-03-10 21:24:29 > mnavrati (milan@nat/redhat/x-rsgdskrnxmcmejws) has joined #linuxvoice
2016-03-10 21:35:54 < LagerMon (~LagarMons@213.221.204.54) has quit (Ping timeout: 246 seconds)
2016-03-10 21:51:49 < mnavrati (milan@nat/redhat/x-rsgdskrnxmcmejws) has quit (Quit: Leaving)
2016-03-10 21:54:35 < brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has quit (Quit: Konversation terminated!)
2016-03-10 21:59:21 > mnavrati (milan@nat/redhat/x-ubbjxlnruqogywen) has joined #linuxvoice
2016-03-10 22:04:43 > AdamDBrown (~Thunderbi@205.003.dsl.wa.iprimus.net.au) has joined #linuxvoice
2016-03-10 22:06:41 Blackisle anyone know about SIP/IP Phones/FreePBX/Asterisk?
2016-03-10 22:55:21 > LauRoman (~LauRoman@5-14-92-161.residential.rdsnet.ro) has joined #linuxvoice
2016-03-10 23:16:07 > jaake (~h4ckm3@c-68-52-45-79.hsd1.tn.comcast.net) has joined #linuxvoice
2016-03-10 23:27:54 < jaake (~h4ckm3@c-68-52-45-79.hsd1.tn.comcast.net) has quit (Ping timeout: 268 seconds)
2016-03-10 23:47:36 Blackisle erm, Mike is still in Munich isn't he? Looks goof for 52 mind you! http://www.theregister.co.uk/2016/03/10/german_ring_/ (kinda NSFW)
2016-03-10 23:47:41 Blackisle *good
2016-03-11 00:03:52 > TraceyC (~TraceyC@2620:0:28a2:4020:60b9:30e7:2771:e06c) has joined #linuxvoice
2016-03-11 00:15:45 < ideasman42 (~cambo@203-206-123-225.dyn.iinet.net.au) has quit (Remote host closed the connection)
2016-03-11 00:19:36 > jaake (~h4ckm3@129.59.122.17) has joined #linuxvoice
2016-03-11 00:32:32 > slashd (~slashd@modemcable157.191-130-66.mc.videotron.ca) has joined #linuxvoice
2016-03-11 00:46:51 < slashd (~slashd@modemcable157.191-130-66.mc.videotron.ca) has quit (Changing host)
2016-03-11 00:46:51 > slashd (~slashd@ubuntu/member/slashd) has joined #linuxvoice
2016-03-11 00:54:14 < TraceyC (~TraceyC@2620:0:28a2:4020:60b9:30e7:2771:e06c) has quit (Ping timeout: 268 seconds)
2016-03-11 00:59:08 > TraceyC (~TraceyC@2620:0:28a2:4020:60b9:30e7:2771:e06c) has joined #linuxvoice
2016-03-11 00:59:36 Blackisle you broken your git repo mcphail ?
2016-03-11 01:16:26 Devilment Blackisle: Only 13 rings?
2016-03-11 01:20:06 Blackisle lol HulaHoop sized ? ;)
2016-03-11 01:24:11 < TraceyC (~TraceyC@2620:0:28a2:4020:60b9:30e7:2771:e06c) has quit (Ping timeout: 250 seconds)
2016-03-11 01:36:10 > TraceyC (~TraceyC@ng2.cptxoffice.net) has joined #linuxvoice
2016-03-11 01:39:04 < ryuslash (~slash@2a02:1812:2518:ce00:f24d:a2ff:fede:451c) has quit (Remote host closed the connection)
2016-03-11 01:41:04 > ryuslash (~slash@2a02:1812:2518:ce00:f24d:a2ff:fede:451c) has joined #linuxvoice
2016-03-11 01:57:34 < ddeimeke (~ddeimeke@moas.mhochzwei.net) has quit (Quit: WeeChat 1.4)
2016-03-11 02:01:43 > AndroUser (~androirc@94.197.121.54.threembb.co.uk) has joined #linuxvoice
2016-03-11 02:18:38 < AdamDBrown (~Thunderbi@205.003.dsl.wa.iprimus.net.au) has quit (Quit: AdamDBrown)
2016-03-11 02:25:05 < writtenoff (~writtenof@d172-218-204-26.bchsia.telus.net) has quit (Quit: WeeChat 1.3)
2016-03-11 02:32:12 > Paddy_NI (~patrick@host-92-14-224-66.as43234.net) has joined #linuxvoice
2016-03-11 03:05:08 < Paddy_NI (~patrick@host-92-14-224-66.as43234.net) has quit (Remote host closed the connection)
2016-03-11 03:08:48 * zmoylan-pi checks for flying pigs... http://www.theregister.co.uk/2016/03/09/microsoft_sonic_debian/
2016-03-11 03:18:39 < AndroUser (~androirc@94.197.121.54.threembb.co.uk) has quit (Read error: Connection reset by peer)
2016-03-11 03:20:41 > M1C4HTRON13 (~micah@bodhilinux/team/M1C4HTRON13) has joined #linuxvoice
2016-03-11 03:21:34 < arubislander (~ubuntuadm@86.93.93.218) has quit (Quit: Leaving.)
2016-03-11 03:23:33 > arubislander (~ubuntuadm@86.93.93.218) has joined #linuxvoice
2016-03-11 03:28:01 > xplora1a (~stuart@81.144.225.214) has joined #linuxvoice
2016-03-11 03:28:43 < xplora1a (~stuart@81.144.225.214) has quit (Quit: Bye Bye)
2016-03-11 03:29:38 > xplora1a (~stuart@81.144.225.214) has joined #linuxvoice
2016-03-11 03:32:21 - foxhunt72 is now known as foxhunt_away
2016-03-11 03:35:11 < xplora1a (~stuart@81.144.225.214) has quit (Quit: Bye Bye)
2016-03-11 03:35:31 Devilment zmoylan-pi: I think it's a long set-up to an April Fool's prank
2016-03-11 03:35:47 < matthew1471 (~matthew14@194.74.188.133) has quit (Remote host closed the connection)
2016-03-11 03:40:35 < M1C4HTRON13 (~micah@bodhilinux/team/M1C4HTRON13) has quit (Quit: Leaving)
2016-03-11 03:41:03 < arubislander (~ubuntuadm@86.93.93.218) has quit (Quit: Leaving.)
2016-03-11 03:57:59 > Nitronium (~Dave@host213-1-15-155.range213-1.btcentralplus.com) has joined #linuxvoice
2016-03-11 04:04:37 > writtenoff (~writtenof@of1.psych.ubc.ca) has joined #linuxvoice
2016-03-11 04:25:13 < andybalaam (andybalaam@nat/ibm/x-hjbivbrjxiejhlhc) has quit (Remote host closed the connection)
2016-03-11 04:30:47 > okovko (~okovko@65.79.1.34) has joined #linuxvoice
2016-03-11 04:31:42 < okovko (~okovko@65.79.1.34) has quit (Remote host closed the connection)
2016-03-11 04:34:34 > okovko (~okovko@65.79.1.34) has joined #linuxvoice
2016-03-11 04:44:02 < TwistedLucidity (~TwistedLu@cpc80671-stap13-2-0-cust118.12-2.cable.virginm.net) has quit (Quit: Konversation terminated!)
2016-03-11 05:21:59 < okovko (~okovko@65.79.1.34) has quit (Ping timeout: 260 seconds)
2016-03-11 05:25:39 < jimbotux (~jimbotux@fpc3-sgyl30-2-0-cust5.18-2.static.cable.virginm.net) has quit (Ping timeout: 248 seconds)
2016-03-11 05:28:25 > okovko (~okovko@65.79.1.34) has joined #linuxvoice
2016-03-11 05:43:51 < okovko (~okovko@65.79.1.34) has quit (Ping timeout: 244 seconds)
2016-03-11 05:56:47 Ioangogo http://www.bbc.co.uk/news/uk-england-nottinghamshire-35755480
2016-03-11 05:56:54 Ioangogo Ill get the bot back
2016-03-11 05:58:09 > jimbotux (~jimbotux@fpc3-sgyl30-2-0-cust5.18-2.static.cable.virginm.net) has joined #linuxvoice
2016-03-11 05:58:19 > LVbot (~iBot@huwloosley.plus.com) has joined #linuxvoice
2016-03-11 06:04:03 < jimbotux (~jimbotux@fpc3-sgyl30-2-0-cust5.18-2.static.cable.virginm.net) has quit (Ping timeout: 244 seconds)
2016-03-11 06:04:52 TraceyC merci
2016-03-11 06:09:40 < mnavrati (milan@nat/redhat/x-ubbjxlnruqogywen) has quit (Quit: Leaving)
2016-03-11 06:21:53 < mavrix (~mavrix@unaffiliated/mavrix) has quit (Ping timeout: 250 seconds)
2016-03-11 06:22:48 > mavrix (~mavrix@unaffiliated/mavrix) has joined #linuxvoice
2016-03-11 06:35:42 > swift110 (~swift110@205.201.255.5) has joined #linuxvoice
2016-03-11 06:36:31 > jimbotux (~jimbotux@fpc3-sgyl30-2-0-cust5.18-2.static.cable.virginm.net) has joined #linuxvoice
2016-03-11 06:36:59 < swift110 (~swift110@205.201.255.5) has quit (Changing host)
2016-03-11 06:36:59 > swift110 (~swift110@unaffiliated/swift110) has joined #linuxvoice
2016-03-11 06:45:24 < jimbotux (~jimbotux@fpc3-sgyl30-2-0-cust5.18-2.static.cable.virginm.net) has quit (Ping timeout: 246 seconds)
2016-03-11 07:07:30 > asusk7m550 (~Thunderbi@2001:981:97b3:1:4541:e663:f82d:c81) has joined #linuxvoice
2016-03-11 07:07:52 > Lager_Monster (~LagerMon@213.221.204.54) has joined #linuxvoice
2016-03-11 07:08:15 - Lager_Monster is now known as LargerMon
2016-03-11 07:18:08 > jimbotux (~jimbotux@fpc3-sgyl30-2-0-cust5.18-2.static.cable.virginm.net) has joined #linuxvoice
2016-03-11 07:22:33 < jimbotux (~jimbotux@fpc3-sgyl30-2-0-cust5.18-2.static.cable.virginm.net) has quit (Ping timeout: 240 seconds)
2016-03-11 07:32:32 ChibaPet I listened to Ubuntu Voice this morning. Made me wonder what other folks use to normalize volume between speakers. One of the fellows required consistent volume-raising, followed by volume-lowering when anyone else would speak.
2016-03-11 07:33:31 swift110 hey all
2016-03-11 07:33:37 TraceyC That's a good question. You'd have to use gain control in whatever software you use to play the podcast
2016-03-11 07:33:49 TraceyC which I really wish I had on my Android for when I listen to the LV podcast
2016-03-11 07:33:52 TraceyC I should look into it
2016-03-11 07:34:20 swift110 hey TraceyC
2016-03-11 07:34:25 TraceyC hiya
2016-03-11 07:34:30 swift110 how are you]
2016-03-11 07:34:34 TraceyC good thanks. You?
2016-03-11 07:39:02 swift110 im great
2016-03-11 07:39:06 swift110 TraceyC: what are you up too
2016-03-11 07:40:52 ChibaPet TraceyC: No, wrong end. The issue wasn't that I wanted easier raising and lowering of my volume, it's that the different folks speaking were at radically different volumes.
2016-03-11 07:41:06 ChibaPet They should all be the same, or close.
2016-03-11 07:41:24 ChibaPet Linux Voice, for instance, tends to have everyone at the same decibel level.
2016-03-11 07:46:05 < jherrmann (jirkah@nat/redhat/x-njucctexegkqrfpx) has quit (Quit: Toodle pip!)
2016-03-11 07:52:57 TraceyC Yes, that's what I understood :)
2016-03-11 07:53:05 TraceyC LV is good about it most episodes
2016-03-11 07:53:29 ChibaPet Ironically, the BBC World News is awful with keeping a consistent volume.
2016-03-11 07:53:52 TraceyC What a gain control filter does is limit all output to a certain level. So you turn up the volume to your preferred level for the lowest voiced speaker, for instance, turn on gain control and nothing goes over a certain volume
2016-03-11 07:54:06 TraceyC You'd think the BBC would know about audio recording ;)
2016-03-11 07:54:11 TraceyC Work, swift110
2016-03-11 07:54:17 ChibaPet Oh. Right. I see. A solution on my end after all.
2016-03-11 07:54:33 TraceyC <-went to audio recording school ages ago
2016-03-11 07:54:50 swift110 cool TraceyC
2016-03-11 07:55:19 > jimbotux (~jimbotux@fpc3-sgyl30-2-0-cust5.18-2.static.cable.virginm.net) has joined #linuxvoice
2016-03-11 08:00:41 < jimbotux (~jimbotux@fpc3-sgyl30-2-0-cust5.18-2.static.cable.virginm.net) has quit (Ping timeout: 250 seconds)
2016-03-11 08:06:58 < LauRoman (~LauRoman@5-14-92-161.residential.rdsnet.ro) has quit (Read error: Connection reset by peer)
2016-03-11 08:07:28 > okovko (~okovko@65.79.1.34) has joined #linuxvoice
2016-03-11 08:08:16 < TraceyC (~TraceyC@ng2.cptxoffice.net) has quit (Ping timeout: 264 seconds)
2016-03-11 08:11:12 > LauRoman (~LauRoman@5-14-92-161.residential.rdsnet.ro) has joined #linuxvoice
2016-03-11 08:14:29 < asusk7m550 (~Thunderbi@2001:981:97b3:1:4541:e663:f82d:c81) has quit (Quit: asusk7m550)
2016-03-11 08:17:13 < okovko (~okovko@65.79.1.34) has quit (Ping timeout: 252 seconds)
2016-03-11 08:19:12 < jaake (~h4ckm3@129.59.122.17) has quit (Ping timeout: 276 seconds)
2016-03-11 08:33:05 > jimbotux (~jimbotux@fpc3-sgyl30-2-0-cust5.18-2.static.cable.virginm.net) has joined #linuxvoice
2016-03-11 08:38:34 < jimbotux (~jimbotux@fpc3-sgyl30-2-0-cust5.18-2.static.cable.virginm.net) has quit (Ping timeout: 260 seconds)
2016-03-11 08:40:00 > Paddy_NI (~patrick@host-92-14-224-66.as43234.net) has joined #linuxvoice
2016-03-11 09:10:20 > jimbotux (~jimbotux@fpc3-sgyl30-2-0-cust5.18-2.static.cable.virginm.net) has joined #linuxvoice
2016-03-11 09:15:09 > okovko (~okovko@c-24-15-233-102.hsd1.il.comcast.net) has joined #linuxvoice
2016-03-11 09:17:19 > towy71 (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has joined #linuxvoice
2016-03-11 09:18:09 > brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has joined #linuxvoice
2016-03-11 09:20:19 < towy71_ (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has quit (Ping timeout: 248 seconds)
2016-03-11 09:22:16 > towy71_ (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has joined #linuxvoice
2016-03-11 09:23:29 < towy71 (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has quit (Ping timeout: 244 seconds)
2016-03-11 09:36:52 Ioangogo http://turnoff.us/geek/sql-server-on-linux/
2016-03-11 09:36:54 LVbot ^ SQL Server on Linux
2016-03-11 09:38:03 @degville hahah... excellent.
2016-03-11 09:49:09 < swift110 (~swift110@unaffiliated/swift110) has quit (Ping timeout: 260 seconds)
2016-03-11 09:57:01 > mnavrati (~milan@ip-94-113-220-233.net.upcbroadband.cz) has joined #linuxvoice
2016-03-11 10:01:45 < okovko (~okovko@c-24-15-233-102.hsd1.il.comcast.net) has quit (Remote host closed the connection)
2016-03-11 10:10:56 < Nitronium (~Dave@host213-1-15-155.range213-1.btcentralplus.com) has quit (Remote host closed the connection)
2016-03-11 10:19:05 < Paddy_NI (~patrick@host-92-14-224-66.as43234.net) has quit (Quit: Konversation terminated!)
2016-03-11 10:36:30 - mnavrati is now known as mnavrati_afk
2016-03-11 10:37:42 > TraceyC (~TraceyC@c-98-194-48-190.hsd1.tx.comcast.net) has joined #linuxvoice
2016-03-11 11:36:07 > AdamDBrown (~Thunderbi@205.003.dsl.wa.iprimus.net.au) has joined #linuxvoice
2016-03-11 11:36:37 < AdamDBrown (~Thunderbi@205.003.dsl.wa.iprimus.net.au) has quit (Client Quit)
2016-03-11 11:44:18 < ryuslash (~slash@2a02:1812:2518:ce00:f24d:a2ff:fede:451c) has quit (Ping timeout: 246 seconds)
2016-03-11 11:55:10 > ideasman42 (~cambo@203-206-123-225.dyn.iinet.net.au) has joined #linuxvoice
2016-03-11 12:14:50 < writtenoff (~writtenof@of1.psych.ubc.ca) has quit (Quit: WeeChat 1.3)
2016-03-11 12:24:43 < slashd (~slashd@ubuntu/member/slashd) has quit (Quit: Leaving)
2016-03-11 12:32:21 < ideasman42 (~cambo@203-206-123-225.dyn.iinet.net.au) has quit (Remote host closed the connection)
2016-03-11 13:03:03 < LauRoman (~LauRoman@5-14-92-161.residential.rdsnet.ro) has quit (Quit: Leaving)
2016-03-11 14:21:27 > NIX0uT1aW_ (~Andy@91.244.229.42) has joined #linuxvoice
2016-03-11 14:23:33 < TraceyC (~TraceyC@c-98-194-48-190.hsd1.tx.comcast.net) has quit (Quit: Off I go into the wild, blue yonder)
2016-03-11 14:30:13 < nix0ut1aw (~Andy@91.244.229.42) has quit (Ping timeout: 260 seconds)
2016-03-11 15:08:22 > zmoylan-1i (~pi@109.79.180.147) has joined #linuxvoice
2016-03-11 15:11:34 < zmoylan-pi (~pi@109.79.41.212) has quit (Ping timeout: 240 seconds)
2016-03-11 15:33:14 > writtenoff (~writtenof@d172-218-204-26.bchsia.telus.net) has joined #linuxvoice
2016-03-11 15:50:11 > ideasman42 (~cambo@203-206-123-225.dyn.iinet.net.au) has joined #linuxvoice
2016-03-11 16:03:39 < zmoylan-1i (~pi@109.79.180.147) has quit (Ping timeout: 260 seconds)
2016-03-11 16:08:02 > zmoylan-pi (~pi@109.76.241.230) has joined #linuxvoice
2016-03-11 16:27:52 < LargerMon (~LagerMon@213.221.204.54) has quit (Ping timeout: 268 seconds)
2016-03-11 16:50:13 < jimbotux (~jimbotux@fpc3-sgyl30-2-0-cust5.18-2.static.cable.virginm.net) has quit (Ping timeout: 250 seconds)
2016-03-11 16:50:39 > jimbotux (~jimbotux@fpc3-sgyl30-2-0-cust5.18-2.static.cable.virginm.net) has joined #linuxvoice
2016-03-11 17:16:14 < mnavrati_afk (~milan@ip-94-113-220-233.net.upcbroadband.cz) has quit (Quit: Leaving)
2016-03-11 18:36:03 > dm13dv1b (9183b039@gateway/web/freenode/ip.145.131.176.57) has joined #linuxvoice
2016-03-11 18:39:03 < dm13dv1b (9183b039@gateway/web/freenode/ip.145.131.176.57) has left #linuxvoice
2016-03-11 18:45:18 < ideasman42 (~cambo@203-206-123-225.dyn.iinet.net.au) has quit (Quit: Ex-Chat)
2016-03-11 19:10:34 Ioangogo Umm - http://www.bbc.co.uk/news/uk-england-bristol-35781898
2016-03-11 19:10:36 LVbot ^ 'Human remains' found near Bristol BBC News
2016-03-11 19:37:50 - foxhunt_away is now known as foxhunt72
2016-03-11 19:41:42 > arubislander (~ubuntuadm@86.93.93.218) has joined #linuxvoice
2016-03-11 19:43:28 > mnavrati (milan@nat/redhat/x-lnznanonflyltbib) has joined #linuxvoice
2016-03-11 19:43:49 Devilment https://xkcd.com/1654/#
2016-03-11 19:43:52 < LVbot (~iBot@huwloosley.plus.com) has quit (Remote host closed the connection)
2016-03-11 19:45:56 > jherrmann (~jirkah@ip4-83-240-20-19.cust.nbox.cz) has joined #linuxvoice
2016-03-11 19:46:51 > LauRoman (~LauRoman@5-14-92-161.residential.rdsnet.ro) has joined #linuxvoice
2016-03-11 20:01:46 > andybalaam (andybalaam@nat/ibm/x-mnskdsqdxgadhkax) has joined #linuxvoice
2016-03-11 20:05:08 < jherrmann (~jirkah@ip4-83-240-20-19.cust.nbox.cz) has quit (Read error: Connection timed out)
2016-03-11 20:05:45 > jherrmann (~jirkah@ip4-83-240-20-19.cust.nbox.cz) has joined #linuxvoice
2016-03-11 20:13:24 < jherrmann (~jirkah@ip4-83-240-20-19.cust.nbox.cz) has quit (Quit: Toodle pip!)
2016-03-11 20:17:57 < g0nz085_ (~gonzo@cpc81199-farn9-2-0-cust619.6-2.cable.virginm.net) has quit (Quit: leaving)
2016-03-11 20:18:16 > g0nz085 (~gonzo@cpc81199-farn9-2-0-cust619.6-2.cable.virginm.net) has joined #linuxvoice
2016-03-11 20:20:15 > ideasman42 (~cambo@203-206-123-225.dyn.iinet.net.au) has joined #linuxvoice
2016-03-11 20:24:21 < grifferz (~andy@bitfolk.com) has quit (Quit: brb)
2016-03-11 20:25:22 > grifferz (~andy@bitfolk.com) has joined #linuxvoice
2016-03-11 20:37:11 < NIX0uT1aW_ (~Andy@91.244.229.42) has quit (Quit: Leaving)
2016-03-11 20:37:35 > nix0ut1aw (~Andy@91.244.229.42) has joined #linuxvoice
2016-03-11 21:14:57 jimbotux lol love that xkcd
2016-03-11 21:29:09 - irc: disconnected from server
2016-03-12 15:24:09 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-03-12 15:24:09 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-03-12 15:24:09 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-03-12 15:24:09 - Channel #linuxvoice: 66 nicks (1 op, 0 voices, 65 normals)
2016-03-12 15:24:19 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-03-12 16:01:04 > zmoylan-pi (~pi@109.76.182.80) has joined #linuxvoice
2016-03-12 16:02:05 < draake (~h4ckm3@c-68-52-45-79.hsd1.tn.comcast.net) has quit (Ping timeout: 250 seconds)
2016-03-12 16:04:07 < zmoylan-1i (~pi@109.76.235.74) has quit (Ping timeout: 260 seconds)
2016-03-12 16:10:57 > writtenoff (~writtenof@d172-218-204-26.bchsia.telus.net) has joined #linuxvoice
2016-03-12 16:18:49 < bdmc (bdmc@cl-745.bos-01.us.sixxs.net) has quit (Ping timeout: 240 seconds)
2016-03-12 16:24:50 > draake (~h4ckm3@c-68-52-45-79.hsd1.tn.comcast.net) has joined #linuxvoice
2016-03-12 16:29:09 > bdmc (bdmc@cl-745.bos-01.us.sixxs.net) has joined #linuxvoice
2016-03-12 16:51:03 < bdmc (bdmc@cl-745.bos-01.us.sixxs.net) has quit (Ping timeout: 250 seconds)
2016-03-12 16:52:41 > bdmc (bdmc@cl-745.bos-01.us.sixxs.net) has joined #linuxvoice
2016-03-12 17:11:01 > pdq_ (~pdq@p200300454327990085D7253B398FF5DC.dip0.t-ipconnect.de) has joined #linuxvoice
2016-03-12 18:13:42 < draake (~h4ckm3@c-68-52-45-79.hsd1.tn.comcast.net) has quit (Ping timeout: 276 seconds)
2016-03-12 18:20:49 < bdmc (bdmc@cl-745.bos-01.us.sixxs.net) has quit (Ping timeout: 240 seconds)
2016-03-12 18:30:51 > bdmc (bdmc@cl-745.bos-01.us.sixxs.net) has joined #linuxvoice
2016-03-12 19:40:11 < bdmc (bdmc@cl-745.bos-01.us.sixxs.net) has quit (Ping timeout: 268 seconds)
2016-03-12 19:44:58 > bdmc (bdmc@cl-745.bos-01.us.sixxs.net) has joined #linuxvoice
2016-03-12 21:49:41 > Nitronium (~Dave@host213-1-15-155.range213-1.btcentralplus.com) has joined #linuxvoice
2016-03-12 22:04:47 < bdmc (bdmc@cl-745.bos-01.us.sixxs.net) has quit (Ping timeout: 250 seconds)
2016-03-12 22:08:41 > asusk7m550 (~Thunderbi@2001:981:97b3:1:1d34:8bd7:2f47:e43a) has joined #linuxvoice
2016-03-12 22:13:41 > bdmc (bdmc@cl-745.bos-01.us.sixxs.net) has joined #linuxvoice
2016-03-12 22:40:16 < brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has quit (Quit: Konversation terminated!)
2016-03-12 23:35:01 < metasansana (~metasansa@unaffiliated/metasansana) has quit (Remote host closed the connection)
2016-03-13 00:31:32 > LauRoman (~LauRoman@5-14-92-161.residential.rdsnet.ro) has joined #linuxvoice
2016-03-13 01:22:25 > draake (~h4ckm3@c-68-52-45-79.hsd1.tn.comcast.net) has joined #linuxvoice
2016-03-13 01:34:02 < asusk7m550 (~Thunderbi@2001:981:97b3:1:1d34:8bd7:2f47:e43a) has quit (Quit: asusk7m550)
2016-03-13 02:30:06 < popey (~alan@ubuntu/member/popey) has quit (Ping timeout: 252 seconds)
2016-03-13 02:31:29 > popey (~alan@cpc81199-farn9-2-0-cust577.6-2.cable.virginm.net) has joined #linuxvoice
2016-03-13 03:07:35 > LauRoman|Alt (~LauRoman@5-14-92-161.residential.rdsnet.ro) has joined #linuxvoice
2016-03-13 03:10:14 > brianhunter_ (~brian@bhlm.net) has joined #linuxvoice
2016-03-13 03:11:38 > NYbill_ (~bill@104.236.1.137) has joined #linuxvoice
2016-03-13 03:12:13 > TwistedFruit (~hiphiphip@unaffiliated/chibapet) has joined #linuxvoice
2016-03-13 03:12:20 < brianhunter- (~brian@bhlm.net) has quit (Ping timeout: 246 seconds)
2016-03-13 03:12:21 < LauRoman (~LauRoman@5-14-92-161.residential.rdsnet.ro) has quit (Ping timeout: 246 seconds)
2016-03-13 03:12:23 < ChibaPet (~hiphiphip@unaffiliated/chibapet) has quit (Ping timeout: 246 seconds)
2016-03-13 03:12:25 < NYbill (~bill@104.236.1.137) has quit (Ping timeout: 246 seconds)
2016-03-13 03:17:08 - NYbill_ is now known as NYbill
2016-03-13 03:45:49 Ioangogo Anyone in here done a GPIO remote blaster on a raspberry pi
2016-03-13 04:48:23 > xplora1a (~stuart@2001:8b0:1679:ea38:9898:b13:4f47:f0de) has joined #linuxvoice
2016-03-13 05:04:59 < jaake (~h4ckm3@c-68-52-45-79.hsd1.tn.comcast.net) has quit (Ping timeout: 260 seconds)
2016-03-13 05:05:00 < draake (~h4ckm3@c-68-52-45-79.hsd1.tn.comcast.net) has quit (Ping timeout: 276 seconds)
2016-03-13 05:13:00 > SuperEngineer (~SuperEngi@host86-172-111-54.range86-172.btcentralplus.com) has joined #linuxvoice
2016-03-13 05:19:48 - TwistedFruit is now known as ChibaPet
2016-03-13 05:29:29 > Extremulus (~Extremulu@2001:470:b:1fb:deaf::d259) has joined #linuxvoice
2016-03-13 05:30:33 < SuperEngineer (~SuperEngi@host86-172-111-54.range86-172.btcentralplus.com) has quit (Quit: bfn...my planet needs me back)
2016-03-13 05:57:06 > SuperEngineer (~SuperEngi@host86-172-111-54.range86-172.btcentralplus.com) has joined #linuxvoice
2016-03-13 06:00:53 > draake (~h4ckm3@c-68-52-45-79.hsd1.tn.comcast.net) has joined #linuxvoice
2016-03-13 06:12:39 < draake (~h4ckm3@c-68-52-45-79.hsd1.tn.comcast.net) has quit (Ping timeout: 246 seconds)
2016-03-13 06:37:35 > crayon (~crayon@2a02:c7d:b91a:3400:d051:e50d:25b4:dfa1) has joined #linuxvoice
2016-03-13 07:15:18 < crayon (~crayon@2a02:c7d:b91a:3400:d051:e50d:25b4:dfa1) has quit (Ping timeout: 246 seconds)
2016-03-13 07:16:38 < SuperEngineer (~SuperEngi@host86-172-111-54.range86-172.btcentralplus.com) has quit (Quit: bfn...my planet needs me back)
2016-03-13 07:22:09 > metasansana (~metasansa@unaffiliated/metasansana) has joined #linuxvoice
2016-03-13 07:49:43 > HonSec (~HonTheUni@104.152.214.35) has joined #linuxvoice
2016-03-13 07:52:23 > quaisi_ (~simon@host-92-30-19-107.as13285.net) has joined #linuxvoice
2016-03-13 07:53:58 < quaisi (~simon@host-92-30-27-114.as13285.net) has quit (Ping timeout: 244 seconds)
2016-03-13 07:54:29 < HonSec (~HonTheUni@104.152.214.35) has quit (Ping timeout: 244 seconds)
2016-03-13 08:10:28 < Nitronium (~Dave@host213-1-15-155.range213-1.btcentralplus.com) has quit (Remote host closed the connection)
2016-03-13 08:11:48 < pdq_ (~pdq@p200300454327990085D7253B398FF5DC.dip0.t-ipconnect.de) has quit (Quit: Ex-Chat)
2016-03-13 08:28:12 > HonSec (~HonTheUni@104.152.214.35) has joined #linuxvoice
2016-03-13 09:03:14 < CPrompt^ (~CPrompt^@cpe-45-36-163-153.triad.res.rr.com) has quit (Remote host closed the connection)
2016-03-13 09:05:21 > CPrompt^ (~CPrompt^@cpe-45-36-163-153.triad.res.rr.com) has joined #linuxvoice
2016-03-13 09:21:48 < HonSec (~HonTheUni@104.152.214.35) has quit (Ping timeout: 244 seconds)
2016-03-13 09:30:59 > HonSec (~HonTheUni@h5-152-210-242.host.redstation.co.uk) has joined #linuxvoice
2016-03-13 10:20:20 > swift110 (~swift110@96.241.23.114) has joined #linuxvoice
2016-03-13 10:23:36 < swift110 (~swift110@96.241.23.114) has quit (Changing host)
2016-03-13 10:23:36 > swift110 (~swift110@unaffiliated/swift110) has joined #linuxvoice
2016-03-13 10:46:20 Ioangogo Urgh BBC, "Go is thought to date back to several thousand years ago in China." its just over 2000 years old, stop using the word several pointlessly
2016-03-13 10:47:02 HonSec ha
2016-03-13 10:56:25 swift110 hey all
2016-03-13 10:57:13 HonSec hey :) I was begining to think this channel was full of bots and campers..
2016-03-13 10:58:45 Ioangogo Nah, its just a very British sitting room, quiet
2016-03-13 10:58:57 swift110 lol
2016-03-13 10:59:10 swift110 people talk in here...rarely but it does happen
2016-03-13 10:59:19 Ioangogo Unless there is a new mag or podcast
2016-03-13 10:59:22 Ioangogo Out
2016-03-13 10:59:32 HonSec Ha I can imagine old sofas, pipe smoking and broadsheets
2016-03-13 10:59:35 swift110 HonSec: how are you?
2016-03-13 10:59:40 swift110 how are you Ioangogo
2016-03-13 10:59:52 Ioangogo Good
2016-03-13 11:00:01 HonSec Very good thanks
2016-03-13 11:00:21 Ioangogo Got angry at LED'S for most of the day
2016-03-13 11:01:42 swift110 good to hear Ioangogo I dont see you in my channel much
2016-03-13 11:01:46 swift110 HonSec: good to hear
2016-03-13 11:02:04 swift110 I just got the rest of the parts to set up my raspberry pi zero today
2016-03-13 12:22:12 > zmoylan-1i (~pi@109.77.195.90) has joined #linuxvoice
2016-03-13 12:25:40 < zmoylan-pi (~pi@109.76.182.80) has quit (Ping timeout: 264 seconds)
2016-03-13 13:05:52 < swift110 (~swift110@unaffiliated/swift110) has quit (Ping timeout: 264 seconds)
2016-03-13 13:25:48 > kloinka (~eric@CPE-121-216-133-135.lnse2.ken.bigpond.net.au) has joined #linuxvoice
2016-03-13 13:38:20 ChibaPet Ioangogo: Several thousand is more accurate as far as I understand it.
2016-03-13 13:39:10 ChibaPet 3000 according to Wikipedia
2016-03-13 14:32:46 < mavrix (~mavrix@unaffiliated/mavrix) has quit (Ping timeout: 248 seconds)
2016-03-13 14:33:48 < LauRoman|Alt (~LauRoman@5-14-92-161.residential.rdsnet.ro) has quit (Read error: Connection reset by peer)
2016-03-13 14:34:59 > mavrix (~mavrix@unaffiliated/mavrix) has joined #linuxvoice
2016-03-13 15:20:27 < xplora1a (~stuart@2001:8b0:1679:ea38:9898:b13:4f47:f0de) has quit (Ping timeout: 250 seconds)
2016-03-13 15:20:29 < Cueball (~lee@2001:8b0:ffb3::c0:ff:ee) has quit (Ping timeout: 268 seconds)
2016-03-13 15:31:32 > Cueball (~lee@coffee.lb3.co.uk) has joined #linuxvoice
2016-03-13 15:35:18 > swift110-phone (~swift110-@unaffiliated/swift110) has joined #linuxvoice
2016-03-13 15:35:44 swift110-phone Hey
2016-03-13 16:01:06 > zmoylan-pi (~pi@109.76.189.189) has joined #linuxvoice
2016-03-13 16:04:19 < zmoylan-1i (~pi@109.77.195.90) has quit (Ping timeout: 244 seconds)
2016-03-13 16:42:16 < kloinka (~eric@CPE-121-216-133-135.lnse2.ken.bigpond.net.au) has quit (Quit: Leaving)
2016-03-13 16:59:22 > pdq_ (~pdq@p20030045431D070044C7A89FCBDFE0DA.dip0.t-ipconnect.de) has joined #linuxvoice
2016-03-13 17:03:35 < Arthur_D (~bouncer@pspodcasting.net) has quit (Quit: ZNC 1.6.2+deb2+wheezy0 - http://znc.in)
2016-03-13 17:08:20 > Arthur_D (~bouncer@pspodcasting.net) has joined #linuxvoice
2016-03-13 17:17:55 < Arthur_D (~bouncer@pspodcasting.net) has quit (Changing host)
2016-03-13 17:17:56 > Arthur_D (~bouncer@supertuxkart/tester/Arthur) has joined #linuxvoice
2016-03-13 17:23:41 - irc: disconnected from server
2016-03-14 00:36:28 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-03-14 00:36:28 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-03-14 00:36:28 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-03-14 00:36:28 - Channel #linuxvoice: 68 nicks (1 op, 0 voices, 67 normals)
2016-03-14 00:36:39 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-03-14 00:39:17 - irc: disconnected from server
2016-03-14 14:29:36 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-03-14 14:29:36 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-03-14 14:29:36 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-03-14 14:29:36 - Channel #linuxvoice: 67 nicks (1 op, 0 voices, 66 normals)
2016-03-14 14:29:47 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-03-14 23:18:26 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-03-14 23:18:26 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-03-14 23:18:26 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-03-14 23:18:26 - Channel #linuxvoice: 75 nicks (1 op, 0 voices, 74 normals)
2016-03-14 23:18:36 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-03-14 23:21:04 > writtenoff (~writtenof@d172-218-204-26.bchsia.telus.net) has joined #linuxvoice
2016-03-14 23:26:06 < writtenoff (~writtenof@d172-218-204-26.bchsia.telus.net) has quit (Ping timeout: 248 seconds)
2016-03-14 23:33:58 > draake (~h4ckm3@129.59.122.17) has joined #linuxvoice
2016-03-14 23:52:03 - draake is now known as jaake
2016-03-15 00:04:46 TraceyC I have a silly question. Is there a Linux windows manager, aside from KDE, that actually remembers the position of windows from session to session?
2016-03-15 00:05:19 zmoylan-pi the tiling eindow manager does that doesn't it?
2016-03-15 00:05:49 zmoylan-pi i3... was trying to remember the name
2016-03-15 00:07:57 TraceyC Thanks, looking at their website
2016-03-15 00:08:30 TraceyC Every morning, when I have to re-position my windows in Cinnamon, I experience that wee little bit of aggravation & desire to fix
2016-03-15 00:08:44 esprimo zmoylan-pi: i3 can do it but i think you manually have to save the layout
2016-03-15 00:09:05 esprimo But i3 is tiling so it might not be what you want
2016-03-15 00:09:47 TraceyC hahaah it looks like KDE1
2016-03-15 00:09:58 TraceyC Yeah, I admit liking my GUI and mouse
2016-03-15 00:10:13 > andybalaam (andybalaam@nat/ibm/x-mdpqckogqggdqook) has joined #linuxvoice
2016-03-15 00:10:23 zmoylan-pi dem's fighting words... :-)
2016-03-15 00:10:36 TraceyC It's OK, I have my mouse
2016-03-15 00:22:05 > writtenoff (~writtenof@d172-218-204-26.bchsia.telus.net) has joined #linuxvoice
2016-03-15 00:26:57 < writtenoff (~writtenof@d172-218-204-26.bchsia.telus.net) has quit (Ping timeout: 276 seconds)
2016-03-15 00:29:01 > towy71_ (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has joined #linuxvoice
2016-03-15 00:31:07 < towy71 (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has quit (Ping timeout: 244 seconds)
2016-03-15 00:36:22 < popey (~alan@cpc81199-farn9-2-0-cust577.6-2.cable.virginm.net) has quit (Changing host)
2016-03-15 00:36:23 > popey (~alan@ubuntu/member/popey) has joined #linuxvoice
2016-03-15 00:53:01 < Cadair (~Cadair@unaffiliated/cadair) has left #linuxvoice
2016-03-15 00:54:04 > Cadair (~Cadair@unaffiliated/cadair) has joined #linuxvoice
2016-03-15 00:54:22 mcphail esprimo: the BBCR4 "In our time" podcast is good. Wide range of topics. Something for everyone there
2016-03-15 00:54:42 esprimo mcphail: Thank you! I'll check it out
2016-03-15 01:00:02 < ideasman42 (~cambo@203-206-123-225.dyn.iinet.net.au) has quit (Quit: Ex-Chat)
2016-03-15 01:08:01 < jaake (~h4ckm3@129.59.122.17) has quit (Ping timeout: 240 seconds)
2016-03-15 01:16:17 > M1C4HTRON13 (~micah@bodhilinux/team/M1C4HTRON13) has joined #linuxvoice
2016-03-15 01:17:57 < evilnickveitch (~evilnick@cpc83321-bath6-2-0-cust252.18-1.cable.virginm.net) has quit (Ping timeout: 268 seconds)
2016-03-15 01:19:30 Devilment Window manager? You mean that thing used to launch a terminal emulator?
2016-03-15 01:20:33 ryuslash terminal emulator? don't you mean Emacs?
2016-03-15 01:21:10 > towy71 (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has joined #linuxvoice
2016-03-15 01:21:34 james_olympus Emacs? Don't you mean all software?
2016-03-15 01:21:50 ryuslash Isn't Emacs all software?
2016-03-15 01:22:57 > writtenoff (~writtenof@d172-218-204-26.bchsia.telus.net) has joined #linuxvoice
2016-03-15 01:23:09 james_olympus There was a lecturer at university who would give programming demonstrations without leaving Emacs
2016-03-15 01:23:14 < towy71_ (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has quit (Ping timeout: 260 seconds)
2016-03-15 01:24:18 ryuslash hehe, cool
2016-03-15 01:25:24 mcphail james_olympus: must have been looking for early retirement due to RSI
2016-03-15 01:25:49 zmoylan-pi or wanting a keyboard with more buttons...
2016-03-15 01:27:54 < writtenoff (~writtenof@d172-218-204-26.bchsia.telus.net) has quit (Ping timeout: 260 seconds)
2016-03-15 01:30:01 < AdamDBrown (~Thunderbi@205.003.dsl.wa.iprimus.net.au) has quit (Quit: AdamDBrown)
2016-03-15 01:30:27 > evilnickveitch (~evilnick@cpc83321-bath6-2-0-cust252.18-1.cable.virginm.net) has joined #linuxvoice
2016-03-15 01:33:42 < 5EXAAD3FM (~lars@gore.copyleft.no) has quit (Quit: Konversation terminated!)
2016-03-15 01:36:13 > jaake (~h4ckm3@129.59.122.17) has joined #linuxvoice
2016-03-15 01:38:11 > xplora1a (~stuart@host109-150-108-119.range109-150.btcentralplus.com) has joined #linuxvoice
2016-03-15 02:04:35 < jherrmann (jirkah@nat/redhat/x-suwldigzkyzxkqfd) has quit (Ping timeout: 244 seconds)
2016-03-15 02:05:30 > johnlane (~john@212.159.104.145) has joined #linuxvoice
2016-03-15 02:13:02 > LauRoman|Phone (~yaaic@213.233.85.236) has joined #linuxvoice
2016-03-15 02:20:05 > jherrmann (jirkah@nat/redhat/x-ghvhunqigrhgvkna) has joined #linuxvoice
2016-03-15 02:23:42 > writtenoff (~writtenof@d172-218-204-26.bchsia.telus.net) has joined #linuxvoice
2016-03-15 02:28:22 < writtenoff (~writtenof@d172-218-204-26.bchsia.telus.net) has quit (Ping timeout: 244 seconds)
2016-03-15 02:54:31 < jaake (~h4ckm3@129.59.122.17) has quit (Ping timeout: 252 seconds)
2016-03-15 02:56:25 < mnavrati (milan@nat/redhat/x-qviekijhksmkddke) has quit (Quit: Leaving)
2016-03-15 02:59:29 > mnavrati (milan@nat/redhat/x-iqozlrbzbgvlincd) has joined #linuxvoice
2016-03-15 03:03:36 < mcphail (~mcphail@unaffiliated/mcphail) has quit (Ping timeout: 276 seconds)
2016-03-15 03:05:03 > mcphail (~mcphail@host86-182-19-53.range86-182.btcentralplus.com) has joined #linuxvoice
2016-03-15 03:05:03 < mcphail (~mcphail@host86-182-19-53.range86-182.btcentralplus.com) has quit (Changing host)
2016-03-15 03:05:03 > mcphail (~mcphail@unaffiliated/mcphail) has joined #linuxvoice
2016-03-15 03:06:45 - mnavrati is now known as mnavrati_mtg
2016-03-15 03:14:39 > jherrmann_ (jirkah@nat/redhat/x-ltnqfgbwdrlqeszg) has joined #linuxvoice
2016-03-15 03:16:36 < jherrmann (jirkah@nat/redhat/x-ghvhunqigrhgvkna) has quit (Ping timeout: 276 seconds)
2016-03-15 03:22:16 > jaake (~h4ckm3@129.59.122.17) has joined #linuxvoice
2016-03-15 03:30:37 - foxhunt72 is now known as foxhunt_away
2016-03-15 03:41:29 < LauRoman|Phone (~yaaic@213.233.85.236) has quit (Quit: Yaaic - Yet another Android IRC client - http://www.yaaic.org)
2016-03-15 03:48:50 > writtenoff (~writtenof@of1.psych.ubc.ca) has joined #linuxvoice
2016-03-15 03:55:08 Blackisle I am quite looking forward to today @ work ending
2016-03-15 03:56:02 Blackisle I was rather full of the drink after watching the rugby in Murrayfield then celebrating Ross County's cup win :)
2016-03-15 03:57:03 Blackisle passed out onj the sofa some time around 10 if my is to be believed
2016-03-15 03:57:38 Ioangogo People still cant drive, people are still ignoring yellow boxes
2016-03-15 04:05:27 > swift110 (~swift110@64.26.99.248) has joined #linuxvoice
2016-03-15 04:05:58 < arubislander (~ubuntuadm@86.93.93.218) has quit (Remote host closed the connection)
2016-03-15 04:06:59 - TwistedFruit is now known as ChibaPet
2016-03-15 04:11:15 < swift110 (~swift110@64.26.99.248) has quit (Changing host)
2016-03-15 04:11:15 > swift110 (~swift110@unaffiliated/swift110) has joined #linuxvoice
2016-03-15 04:26:25 < TwistedLucidity (~TwistedLu@cpc80671-stap13-2-0-cust118.12-2.cable.virginm.net) has quit (Quit: Konversation terminated!)
2016-03-15 04:28:34 < andybalaam (andybalaam@nat/ibm/x-mdpqckogqggdqook) has quit (Remote host closed the connection)
2016-03-15 04:33:23 < jaake (~h4ckm3@129.59.122.17) has quit (Ping timeout: 248 seconds)
2016-03-15 04:37:39 < xplora1a (~stuart@host109-150-108-119.range109-150.btcentralplus.com) has quit (Quit: Bye Bye)
2016-03-15 04:45:43 > jaake (~h4ckm3@129.59.122.17) has joined #linuxvoice
2016-03-15 04:48:30 > towy71_ (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has joined #linuxvoice
2016-03-15 04:51:00 < towy71 (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has quit (Ping timeout: 244 seconds)
2016-03-15 04:51:35 > gareppa (~gareppa@151.31.13.116) has joined #linuxvoice
2016-03-15 04:51:52 < gareppa (~gareppa@151.31.13.116) has quit (Remote host closed the connection)
2016-03-15 04:53:53 < TraceyC (~TraceyC@2620:0:28a2:4020:dc6f:9c32:1e67:cd76) has quit (Quit: Off I go into the wild, blue yonder)
2016-03-15 05:24:58 > xplora1a (~stuart@82-132-218-163.dab.02.net) has joined #linuxvoice
2016-03-15 05:35:18 < xplora1a (~stuart@82-132-218-163.dab.02.net) has quit (Remote host closed the connection)
2016-03-15 05:39:15 - mnavrati_mtg is now known as mnavrati
2016-03-15 06:02:33 - foxhunt_away is now known as foxhunt72
2016-03-15 06:09:04 < swift110 (~swift110@unaffiliated/swift110) has quit (Ping timeout: 260 seconds)
2016-03-15 06:09:33 > swift110 (~swift110@64.26.99.248) has joined #linuxvoice
2016-03-15 06:11:09 < swift110 (~swift110@64.26.99.248) has quit (Excess Flood)
2016-03-15 06:11:29 > towy71 (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has joined #linuxvoice
2016-03-15 06:11:48 > swift110 (~swift110@64.26.99.248) has joined #linuxvoice
2016-03-15 06:14:04 < towy71_ (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has quit (Ping timeout: 240 seconds)
2016-03-15 06:17:17 < swift110 (~swift110@64.26.99.248) has quit (Ping timeout: 244 seconds)
2016-03-15 06:24:43 < mnavrati (milan@nat/redhat/x-iqozlrbzbgvlincd) has quit (Quit: Leaving)
2016-03-15 06:27:01 - foxhunt72 is now known as foxhunt_away
2016-03-15 06:28:42 > swift110 (~swift110@64.26.99.248) has joined #linuxvoice
2016-03-15 06:29:30 < swift110 (~swift110@64.26.99.248) has quit (Changing host)
2016-03-15 06:29:30 > swift110 (~swift110@unaffiliated/swift110) has joined #linuxvoice
2016-03-15 06:31:20 > asusk7m550 (~Thunderbi@2001:981:97b3:1:c568:8a31:f257:ea78) has joined #linuxvoice
2016-03-15 06:44:35 - foxhunt_away is now known as foxhunt72
2016-03-15 06:48:22 < swift110 (~swift110@unaffiliated/swift110) has quit (Ping timeout: 260 seconds)
2016-03-15 07:03:46 > swift110 (~swift110@64.26.99.248) has joined #linuxvoice
2016-03-15 07:03:55 < swift110 (~swift110@64.26.99.248) has quit (Changing host)
2016-03-15 07:03:55 > swift110 (~swift110@unaffiliated/swift110) has joined #linuxvoice
2016-03-15 07:10:06 mcphail Anyone played this one: http://www.gog.com/game/tis100 ? My finger is hovering over the buy button
2016-03-15 07:20:52 < jaake (~h4ckm3@129.59.122.17) has quit (Ping timeout: 264 seconds)
2016-03-15 07:25:06 < jherrmann_ (jirkah@nat/redhat/x-ltnqfgbwdrlqeszg) has quit (Quit: Toodle pip!)
2016-03-15 07:29:29 < ChibaPet (~hiphiphip@unaffiliated/chibapet) has quit (Quit: leaving)
2016-03-15 07:32:16 < M1C4HTRON13 (~micah@bodhilinux/team/M1C4HTRON13) has quit (Ping timeout: 268 seconds)
2016-03-15 07:34:04 > ChibaPet (~hiphiphip@unaffiliated/chibapet) has joined #linuxvoice
2016-03-15 07:36:01 james_olympus You can buy a 314GB USB hard drive for £27 today (that's $31.41)
2016-03-15 07:38:12 > M1C4HTRON13 (~micah@84.203.75.6) has joined #linuxvoice
2016-03-15 07:38:13 < M1C4HTRON13 (~micah@84.203.75.6) has quit (Changing host)
2016-03-15 07:38:13 > M1C4HTRON13 (~micah@bodhilinux/team/M1C4HTRON13) has joined #linuxvoice
2016-03-15 07:42:09 < anglisc (~aethelber@81-86-151-146.dsl.pipex.com) has quit (Remote host closed the connection)
2016-03-15 07:46:16 > brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has joined #linuxvoice
2016-03-15 08:03:48 zmoylan-pi i think they're already out of stock
2016-03-15 08:04:17 zmoylan-pi great for a home made tablet or pda though
2016-03-15 08:15:34 < johnlane (~john@212.159.104.145) has quit (Remote host closed the connection)
2016-03-15 08:19:05 > H4Z3 (~HAZ3@46.166.188.230) has joined #linuxvoice
2016-03-15 08:26:37 zmoylan-pi i had just been looking at the old ibm microdrives a few weeks back. nice to see the idea of a different capacity/format appearing again
2016-03-15 08:28:57 james_olympus I have one of those in my museum
2016-03-15 08:29:23 zmoylan-pi a museum in the shape of a bottom drawer? :-)
2016-03-15 08:29:50 zmoylan-pi hardware that is useless but too cool/useful/neat to throw away
2016-03-15 08:30:30 james_olympus Top drawer, but yes
2016-03-15 08:31:03 james_olympus It contains two Psions, a Handspring Visor and a few calculators
2016-03-15 08:31:26 zmoylan-pi had, had, and had. and still have....
2016-03-15 08:32:04 zmoylan-pi a psion 3a, a 3c and a psion 5, 5mx and a visor neo with mmc card reader for slot
2016-03-15 08:33:06 james_olympus I have a 3a and a Revo
2016-03-15 08:34:54 < asusk7m550 (~Thunderbi@2001:981:97b3:1:c568:8a31:f257:ea78) has quit (Quit: asusk7m550)
2016-03-15 08:35:32 zmoylan-pi i honestly think the 3a had a better keyboard than the 5. the way the battery in hinge moves down to raise the keyboard made it possible to grip the psion while walking so you couldn't drop it and type at 30wpm
2016-03-15 08:36:18 james_olympus It's similar to some calculators
2016-03-15 08:37:10 zmoylan-pi i really wish they still made them. a psion with wifi and a beefier processor would be very nice
2016-03-15 08:38:09 zmoylan-pi still haven't seen software on pc or cloud like agenda that would allow me to set up repeating appointments on 3rd friday of every 2nd month
2016-03-15 08:39:26 james_olympus I wonder what the 'DragonBox Pyra' will be like; it's the successor to the Open Pandora
2016-03-15 08:39:46 zmoylan-pi it does look nice even if the buttons look ick
2016-03-15 08:49:04 james_olympus http://practicalphysics.org/images/Connector%20box_1759.jpg school physics experiment?
2016-03-15 08:54:49 < M1C4HTRON13 (~micah@bodhilinux/team/M1C4HTRON13) has quit (Quit: Leaving)
2016-03-15 08:57:32 - foxhunt72 is now known as foxhunt_away
2016-03-15 09:01:21 zmoylan-pi very old diagram. reminds me of diagrams from books in early 20th century
2016-03-15 09:01:33 zmoylan-pi but mentions plastic
2016-03-15 09:02:30 < H4Z3 (~HAZ3@46.166.188.230) has left #linuxvoice
2016-03-15 09:09:00 james_olympus I don't like to be too close to mains electricity
2016-03-15 09:18:13 ChibaPet popey: How did you get that lego-ized image you use here? http://pbs.twimg.com/profile_images/670242207845056513/IaGHFKeQ.png
2016-03-15 09:20:55 popey ChibaPet: https://github.com/Wildhoney/Legofy
2016-03-15 09:21:00 ChibaPet popey: ty
2016-03-15 09:21:05 popey np
2016-03-15 09:21:56 Ioangogo Any one heard of this https://joindiaspora.com/
2016-03-15 09:22:49 ChibaPet popey: Any chance it can be constrained to a limited set of colours? It'd be nifty to use it as a guide for constructing a real-world LegoⓇ portrait.
2016-03-15 09:23:31 popey no idea
2016-03-15 09:23:37 popey Ioangogo: yes, many years ago
2016-03-15 09:23:52 popey I have an account and only login when people mention it
2016-03-15 09:23:57 popey which is maybe once every few months
2016-03-15 09:24:04 ChibaPet Diaspora died long ago I think.
2016-03-15 09:24:19 ChibaPet They made a big noise and begged for a bunch of money and ended up not actually having any software.
2016-03-15 09:24:21 popey they put a release out last week
2016-03-15 09:24:28 popey no, the software exists
2016-03-15 09:24:38 ChibaPet Hrm. That's interesting then.
2016-03-15 09:24:47 popey https://en.wikipedia.org/wiki/Diaspora_(software)
2016-03-15 09:25:18 Ioangogo ChibaPet: Its got a bit better reciently, a person signed up 2 days ago on my node who had python in their intrests
2016-03-15 09:25:30 popey heh
2016-03-15 09:25:33 popey "a person"
2016-03-15 09:25:37 Ioangogo I might remove the intrests though
2016-03-15 09:25:39 popey vs facebook - billion or so
2016-03-15 09:25:43 Ioangogo Just gets spammy
2016-03-15 09:26:30 Ioangogo popey: I think it is a neat idea, just need people who will use
2016-03-15 09:26:31 Ioangogo it
2016-03-15 09:26:36 ChibaPet Alright, that wikipedia entry shows a sufficiently vigorous release cycle.
2016-03-15 09:26:55 Ioangogo shared it with a bunch or reditors scared of facebook spying
2016-03-15 09:26:58 popey diaspora lost out to those with deep pockets and first-mover advantage
2016-03-15 09:27:45 Ioangogo The wikipedia page need a bit of care
2016-03-15 09:28:41 ChibaPet For a time I was working out ideas for a distributed point-to-point social network that'd support privacy (anonymity and encryption) but then I realized that email was sufficient.
2016-03-15 09:30:00 Ioangogo Its old and broken though
2016-03-15 09:30:10 Ioangogo Though more people have it
2016-03-15 09:30:52 ChibaPet Bah, it's not broken.
2016-03-15 09:31:12 Ioangogo spoofing
2016-03-15 09:31:17 ChibaPet TLS
2016-03-15 09:31:29 Ioangogo https://en.wikipedia.org/wiki/Email#Problems
2016-03-15 09:32:37 ChibaPet Privacy concerns are valid with everyone using Google.
2016-03-15 09:32:55 ChibaPet It would be a healthier world if many, many more people had private mail servers.
2016-03-15 09:33:58 Ioangogo I like the twitter like feel of diaspora
2016-03-15 09:35:21 ChibaPet Bah, I'm not remembering the name of the FSF-backed software now...
2016-03-15 09:35:37 Ioangogo Urgh, I still havent worked out how to use PGP effecently
2016-03-15 09:35:56 ChibaPet I can use it efficiently but I don't. I need to start again.
2016-03-15 09:36:36 Ioangogo Well, i use open key chain on my phone, but havent found a good tool for my desktop
2016-03-15 09:37:55 ChibaPet Found it. http://www.indenti.ca/
2016-03-15 09:38:41 ChibaPet (and https://www.fsf.org/blogs/community/fsf-identica-groups)
2016-03-15 09:39:12 ChibaPet Hm, and http://status.fsf.org/ (status.net) is evidently still alive.
2016-03-15 09:39:58 Ioangogo I had a look at that once, But does it work between diffrent sites
2016-03-15 09:40:10 Ioangogo :P
2016-03-15 09:40:31 swift110 hey Ioangogo and ChibaPet
2016-03-15 09:40:36 ChibaPet o/
2016-03-15 09:41:00 Ioangogo ChibaPet: Does GNU Social have a way to talk between instances
2016-03-15 09:41:02 ChibaPet In other news, I'm mostly giving up on high-DPI support on my MacBook running Ubuntu.
2016-03-15 09:41:39 ChibaPet Ioangogo: I *believe* so. It's based on status.net.
2016-03-15 09:42:03 Ioangogo Yeah, i have a account on load advrage
2016-03-15 09:42:24 ChibaPet So, I'm cheating now: xrandr --output eDP1 --mode 1280x800
2016-03-15 09:42:37 Ioangogo Ohh, i rembered my login
2016-03-15 09:43:21 ChibaPet I think I need to try Unity again, and see if I can stomach it.
2016-03-15 09:43:27 Ioangogo Yeah, it does support diffrent ones
2016-03-15 09:43:31 Ioangogo I like gnome 3
2016-03-15 09:43:48 ChibaPet Gnome 3 uses a TON of vertical space. Those titlebars!
2016-03-15 09:44:07 Ioangogo ChibaPet: whats your screen size?
2016-03-15 09:44:22 ChibaPet Ioangogo: native 2560x1600, it's a macbook11,1
2016-03-15 09:44:23 blahdeblah ChibaPet: Make sure you install Unity Tweak Tool and Compiz Config Settings Manager; between those two I managed to get Unity to a point where I prefer it to GNOME 2, which I never thought I would say.
2016-03-15 09:44:44 ChibaPet blahdeblah: Can I reclaim my alt key for my own use?
2016-03-15 09:45:21 ChibaPet I'm running Openbox now, but I'm willing to try to be open-minded, just a little.
2016-03-15 09:45:21 blahdeblah ChibaPet: I don't know about that specifically (I haven't tried), but there's quite a lot of keyboard customisation that can be done.
2016-03-15 09:46:51 - irc: disconnected from server
2016-03-15 09:47:02 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-03-15 09:47:02 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-03-15 09:47:02 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-03-15 09:47:02 - Channel #linuxvoice: 69 nicks (1 op, 0 voices, 68 normals)
2016-03-15 09:47:13 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-03-15 09:58:59 Ioangogo Hmm, JB has a gnusocail account
2016-03-15 10:00:50 * mcphail is binge-watching the AlphaGo matches at 2x speed on Youtube. It all seems very impressive
2016-03-15 10:01:20 Ioangogo mcphail: they use a opensource gui for it
2016-03-15 10:01:24 Ioangogo Gogui
2016-03-15 10:02:02 mcphail I wonder what kind of machinery they have behind the screen? What do you need to run this kind of software?
2016-03-15 10:04:40 > brucemuggins_ (~brucemint@95.41.233.220.static.exetel.com.au) has joined #linuxvoice
2016-03-15 10:08:23 Ioangogo mcphail: they probaly have a rest api
2016-03-15 10:08:26 Ioangogo or not much
2016-03-15 10:08:28 < brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has quit (Ping timeout: 252 seconds)
2016-03-15 10:11:25 > ideasman42 (~cambo@203-206-123-225.dyn.iinet.net.au) has joined #linuxvoice
2016-03-15 10:17:29 Ioangogo I wont use gnu socail
2016-03-15 10:18:41 Ioangogo Nope, that was a badly maintained wikipedia artical
2016-03-15 10:30:23 - irc: disconnected from server
2016-03-15 10:30:32 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-03-15 10:30:32 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-03-15 10:30:32 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-03-15 10:30:32 - Channel #linuxvoice: 70 nicks (1 op, 0 voices, 69 normals)
2016-03-15 10:30:42 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-03-15 10:30:45 < swift110 (~swift110@unaffiliated/swift110) has quit (Ping timeout: 246 seconds)
2016-03-15 10:32:46 > towy71_ (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has joined #linuxvoice
2016-03-15 10:35:15 < towy71 (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has quit (Ping timeout: 250 seconds)
2016-03-15 10:58:08 > traceyc (~traceyc@c-98-194-48-190.hsd1.tx.comcast.net) has joined #linuxvoice
2016-03-15 11:04:54 > georgeowell_ (~georgeowe@95.149.192.232) has joined #linuxvoice
2016-03-15 11:22:31 < ryuslash (~slash@2a02:1812:2518:ce00:f24d:a2ff:fede:451c) has quit (Remote host closed the connection)
2016-03-15 11:52:48 < writtenoff (~writtenof@of1.psych.ubc.ca) has quit (Quit: WeeChat 1.3)
2016-03-15 11:57:33 > gamerchick02 (~gamerchic@c-68-36-7-43.hsd1.mi.comcast.net) has joined #linuxvoice
2016-03-15 12:02:40 < traceyc (~traceyc@c-98-194-48-190.hsd1.tx.comcast.net) has quit (Quit: I'm off)
2016-03-15 12:02:56 < brucemuggins_ (~brucemint@95.41.233.220.static.exetel.com.au) has quit (Quit: Konversation terminated!)
2016-03-15 12:03:10 > brucemuggins_ (~brucemint@95.41.233.220.static.exetel.com.au) has joined #linuxvoice
2016-03-15 12:04:41 < brucemuggins_ (~brucemint@95.41.233.220.static.exetel.com.au) has quit (Client Quit)
2016-03-15 12:04:53 > brucemuggins_ (~brucemint@95.41.233.220.static.exetel.com.au) has joined #linuxvoice
2016-03-15 12:05:22 > anglic00 (~james____@81-86-151-146.dsl.pipex.com) has joined #linuxvoice
2016-03-15 12:05:26 < anglic00 (~james____@81-86-151-146.dsl.pipex.com) has quit (Client Quit)
2016-03-15 12:25:49 > towy71 (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has joined #linuxvoice
2016-03-15 12:26:14 < ideasman42 (~cambo@203-206-123-225.dyn.iinet.net.au) has quit (Quit: Ex-Chat)
2016-03-15 12:29:30 < towy71_ (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has quit (Ping timeout: 268 seconds)
2016-03-15 12:44:25 < gamerchick02 (~gamerchic@c-68-36-7-43.hsd1.mi.comcast.net) has quit (Ping timeout: 240 seconds)
2016-03-15 13:15:50 > brucemuggins__ (~brucemint@95.41.233.220.static.exetel.com.au) has joined #linuxvoice
2016-03-15 13:18:13 < brucemuggins_ (~brucemint@95.41.233.220.static.exetel.com.au) has quit (Ping timeout: 268 seconds)
2016-03-15 13:57:27 ChibaPet Trying to add a desktop launcher for Minecraft on my brother-in-law's Gnome 3 machine makes me want to shoot myself in the head.
2016-03-15 14:06:09 > writtenoff (~writtenof@d172-218-204-26.bchsia.telus.net) has joined #linuxvoice
2016-03-15 14:06:50 < writtenoff (~writtenof@d172-218-204-26.bchsia.telus.net) has quit (Client Quit)
2016-03-15 14:08:32 > writtenoff (~writtenof@d172-218-204-26.bchsia.telus.net) has joined #linuxvoice
2016-03-15 14:53:10 > zmoylan-1i (~pi@109.77.215.62) has joined #linuxvoice
2016-03-15 14:56:01 < zmoylan-pi (~pi@109.79.190.195) has quit (Ping timeout: 240 seconds)
2016-03-15 15:34:34 < popey (~alan@ubuntu/member/popey) has quit (Ping timeout: 240 seconds)
2016-03-15 16:03:42 < zmoylan-1i (~pi@109.77.215.62) has quit (Ping timeout: 244 seconds)
2016-03-15 16:20:30 > zmoylan-pi (~pi@109.76.87.21) has joined #linuxvoice
2016-03-15 17:43:33 > jherrmann (jirkah@nat/redhat/x-vpqloesezzinrvgw) has joined #linuxvoice
2016-03-15 17:55:03 > Nitronium (~Dave@host213-1-15-155.range213-1.btcentralplus.com) has joined #linuxvoice
2016-03-15 18:03:18 < Nitronium (~Dave@host213-1-15-155.range213-1.btcentralplus.com) has quit (Remote host closed the connection)
2016-03-16 06:23:55 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-03-16 06:23:55 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-03-16 06:23:55 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-03-16 06:23:55 - Channel #linuxvoice: 78 nicks (1 op, 0 voices, 77 normals)
2016-03-16 06:24:06 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-03-16 06:27:26 > badders (~rob@host86-131-90-148.range86-131.btcentralplus.com) has joined #linuxvoice
2016-03-16 06:31:16 > M1C4HTRON13 (~micah@84.203.75.6) has joined #linuxvoice
2016-03-16 06:31:16 < M1C4HTRON13 (~micah@84.203.75.6) has quit (Changing host)
2016-03-16 06:31:16 > M1C4HTRON13 (~micah@bodhilinux/team/M1C4HTRON13) has joined #linuxvoice
2016-03-16 06:33:41 badders clear
2016-03-16 06:36:09 * zmoylan-pi applies electrodes to the channel...
2016-03-16 06:36:23 zmoylan-pi *WHUMP*
2016-03-16 06:39:48 badders better than my wrong-window-focus, I guess!
2016-03-16 06:43:33 < TraceyC (~TraceyC@2620:0:28a2:4020:b91e:7be8:d679:6d61) has quit (Quit: Off I go into the wild, blue yonder)
2016-03-16 06:47:07 < badders (~rob@host86-131-90-148.range86-131.btcentralplus.com) has quit (Quit: Ex-Chat)
2016-03-16 06:47:21 swift110 https://anthonyvenable110.wordpress.com/2012/07/13/dont-you-wish-your-laptop-was-hot-like-this/
2016-03-16 07:03:50 > asusk7m550 (~Thunderbi@2001:981:97b3:1:5cf7:ce27:df94:12c7) has joined #linuxvoice
2016-03-16 07:14:54 < mnavrati (milan@nat/redhat/x-cznxkjpgipcbdxqq) has quit (Ping timeout: 248 seconds)
2016-03-16 07:17:58 - irc: disconnected from server
2016-03-16 07:18:09 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-03-16 07:18:09 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-03-16 07:18:09 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-03-16 07:18:09 - Channel #linuxvoice: 78 nicks (1 op, 0 voices, 77 normals)
2016-03-16 07:18:19 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-03-16 07:20:52 < jaake (~h4ckm3@129.59.122.17) has quit (Ping timeout: 248 seconds)
2016-03-16 07:25:52 > basshead (~basshead@84.51.140.131) has joined #linuxvoice
2016-03-16 07:27:37 > mnavrati (milan@nat/redhat/x-ougxhfpeosdqjxca) has joined #linuxvoice
2016-03-16 07:27:40 < Gejt (~Gejt@cpc82082-leic19-2-0-cust372.8-1.cable.virginm.net) has quit (Quit: Leaving)
2016-03-16 07:34:01 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-03-16 07:34:01 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-03-16 07:34:01 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-03-16 07:34:01 - Channel #linuxvoice: 78 nicks (1 op, 0 voices, 77 normals)
2016-03-16 07:34:11 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-03-16 07:41:55 > LauRoman (~LauRoman@5-14-92-161.residential.rdsnet.ro) has joined #linuxvoice
2016-03-16 08:01:49 < xplora1a (~stuart@2001:8b0:1360:0:3102:a245:4712:2ec3) has quit (Ping timeout: 250 seconds)
2016-03-16 08:02:10 < andybalaam (~andybalaa@15.111.199.146.dyn.plus.net) has quit (Remote host closed the connection)
2016-03-16 08:04:51 < mavrix (~mavrix@unaffiliated/mavrix) has quit (Ping timeout: 250 seconds)
2016-03-16 08:05:56 > mavrix (~mavrix@unaffiliated/mavrix) has joined #linuxvoice
2016-03-16 08:19:32 < mavrix (~mavrix@unaffiliated/mavrix) has quit (Ping timeout: 248 seconds)
2016-03-16 08:21:41 > badders (~rob@host86-131-90-148.range86-131.btcentralplus.com) has joined #linuxvoice
2016-03-16 08:23:56 > mavrix (~mavrix@unaffiliated/mavrix) has joined #linuxvoice
2016-03-16 08:30:00 < basshead (~basshead@84.51.140.131) has quit (Quit: Leaving)
2016-03-16 08:30:28 < mavrix (~mavrix@unaffiliated/mavrix) has quit (Ping timeout: 252 seconds)
2016-03-16 08:32:58 > mavrix (~mavrix@unaffiliated/mavrix) has joined #linuxvoice
2016-03-16 08:35:31 > xplora1a (~stuart@2001:8b0:1360:0:3102:a245:4712:2ec3) has joined #linuxvoice
2016-03-16 08:37:22 < mnavrati (milan@nat/redhat/x-ougxhfpeosdqjxca) has quit (Quit: Leaving)
2016-03-16 08:39:23 < Nitronium (~Dave@host213-1-15-155.range213-1.btcentralplus.com) has quit (Remote host closed the connection)
2016-03-16 08:45:31 < asusk7m550 (~Thunderbi@2001:981:97b3:1:5cf7:ce27:df94:12c7) has quit (Quit: asusk7m550)
2016-03-16 08:49:29 > towy71_ (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has joined #linuxvoice
2016-03-16 08:50:04 < towy71 (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has quit (Ping timeout: 240 seconds)
2016-03-16 08:53:42 < mavrix (~mavrix@unaffiliated/mavrix) has quit (Ping timeout: 276 seconds)
2016-03-16 08:53:43 mcphail I've squeezed the last drop from the Macallan Gold bottle. On my shelf is a Tomatin Legacy, a Benromach, a Royal Lochnagar and an Old Pulteney. Which one gets opened?
2016-03-16 08:55:00 > huw (~manjaro-k@81.17.20.66) has joined #linuxvoice
2016-03-16 08:55:52 > mavrix (~mavrix@unaffiliated/mavrix) has joined #linuxvoice
2016-03-16 08:56:02 badders Whiskys?
2016-03-16 08:56:13 mcphail indeed
2016-03-16 08:57:02 mcphail Haven't tried any of the above, and can't decide which one to crack open
2016-03-16 08:58:40 Ioangogo Wow, the new minecraft combat mechanics are powerful
2016-03-16 08:58:53 badders my experience begins and ends with Glenfiddich unfortunately
2016-03-16 08:59:58 mcphail I accumulate Malts much faster than I can drink them
2016-03-16 09:00:59 < Paddy_NI (~patrick@104.238.169.127) has quit (Ping timeout: 244 seconds)
2016-03-16 09:01:30 < mavrix (~mavrix@unaffiliated/mavrix) has quit (Ping timeout: 244 seconds)
2016-03-16 09:04:19 > mavrix (~mavrix@unaffiliated/mavrix) has joined #linuxvoice
2016-03-16 09:04:53 badders nice for some - I can't seem to keep ales around for more than a few hours at a time, it seems
2016-03-16 09:05:49 mcphail Buy in bulk. It is the only way to be safe.
2016-03-16 09:06:34 huw there's always gin in my cupboard \o/
2016-03-16 09:06:55 mcphail Gin? Best place for it
2016-03-16 09:07:26 huw better than whisky
2016-03-16 09:09:19 mcphail I jest. Gin is fine. Apparently Scotland is producing more gin than single malt these days
2016-03-16 09:11:41 mcphail Was given this in a posh restaurant recently - http://www.nbgin.com/ - quite a nice drop
2016-03-16 09:12:01 huw apparently it's on the rise, yeah
2016-03-16 09:12:14 huw personally i drink it because it's the only spirit i can really stomach any more
2016-03-16 09:12:29 huw got fed up of nothing but beer all the time :)
2016-03-16 09:13:41 mcphail I know what you mean. I have to treat the whisky with a bit of respect these days
2016-03-16 09:14:28 huw i *wish* i could drink whisky, but i just can't any more. just the smell of it makes me queasy :(
2016-03-16 09:17:02 mcphail Try a small measure of a decent malt in a Glencairn glass with a couple of drops of water to kill the evapourating alcohol (which carries some of the rougher smells). You might change your mind
2016-03-16 09:17:34 < mavrix (~mavrix@unaffiliated/mavrix) has quit (Ping timeout: 248 seconds)
2016-03-16 09:18:58 < badders (~rob@host86-131-90-148.range86-131.btcentralplus.com) has quit (Quit: Ex-Chat)
2016-03-16 09:20:52 > mavrix (~mavrix@unaffiliated/mavrix) has joined #linuxvoice
2016-03-16 09:21:38 > draake (~h4ckm3@c-68-52-45-79.hsd1.tn.comcast.net) has joined #linuxvoice
2016-03-16 09:25:01 huw mcphail: i might just try that at some point, thanks
2016-03-16 09:25:40 < mavrix (~mavrix@unaffiliated/mavrix) has quit (Ping timeout: 264 seconds)
2016-03-16 09:27:02 > mavrix (~mavrix@unaffiliated/mavrix) has joined #linuxvoice
2016-03-16 09:29:15 < draake (~h4ckm3@c-68-52-45-79.hsd1.tn.comcast.net) has quit (Quit: Bye)
2016-03-16 09:34:04 < mavrix (~mavrix@unaffiliated/mavrix) has quit (Ping timeout: 264 seconds)
2016-03-16 09:35:02 > mavrix (~mavrix@unaffiliated/mavrix) has joined #linuxvoice
2016-03-16 09:36:17 < xplora1a (~stuart@2001:8b0:1360:0:3102:a245:4712:2ec3) has quit (Ping timeout: 250 seconds)
2016-03-16 09:46:17 - foxhunt72 is now known as foxhunt_away
2016-03-16 09:50:47 < M1C4HTRON13 (~micah@bodhilinux/team/M1C4HTRON13) has quit (Remote host closed the connection)
2016-03-16 10:08:54 > mnavrati (~milan@fleda.faster.cz) has joined #linuxvoice
2016-03-16 10:22:08 < g0nz085 (~gonzo@cpc81199-farn9-2-0-cust619.6-2.cable.virginm.net) has quit (Remote host closed the connection)
2016-03-16 10:30:02 < mnavrati (~milan@fleda.faster.cz) has quit (Quit: Leaving)
2016-03-16 10:35:14 < huw (~manjaro-k@81.17.20.66) has quit (Quit: Manjaro-KDE user leaving!)
2016-03-16 10:36:09 Extremulus mcphail: Old Pulteney is usually nice, depends on the bottling
2016-03-16 10:39:18 mcphail Extremulus: I have heard good things. I've just got the bog-standard 12yo. I opened the Tomatin instead: surprisingly nice drop but lacks a bit of finish
2016-03-16 10:43:22 Extremulus I've been working on a Aberlour A'Bunadh and an Aberlour 18yo, prefer the A'Bunadh. Age isn't everything
2016-03-16 10:47:11 mcphail The A'Bunadh looks cracking. I'll bet it mists up beautifully with a bit of water
2016-03-16 10:48:37 > ideasman42 (~cambo@203-206-123-225.dyn.iinet.net.au) has joined #linuxvoice
2016-03-16 10:51:14 > xplora1a (~stuart@2001:8b0:1679:ea38:224:d7ff:feec:e7ec) has joined #linuxvoice
2016-03-16 11:00:59 > okovko (~okovko@c-24-15-233-102.hsd1.il.comcast.net) has joined #linuxvoice
2016-03-16 11:06:42 > georgeowell (~georgeowe@95.149.192.232) has joined #linuxvoice
2016-03-16 11:08:57 Extremulus it's open source to boot. Water, peat, barley
2016-03-16 11:15:24 swift110 wow
2016-03-16 11:23:45 < xplora1a (~stuart@2001:8b0:1679:ea38:224:d7ff:feec:e7ec) has quit (Ping timeout: 250 seconds)
2016-03-16 11:35:52 < ryuslash (~slash@2a02:1812:2518:ce00:f24d:a2ff:fede:451c) has quit (Remote host closed the connection)
2016-03-16 11:43:39 - irc: disconnected from server
2016-03-16 11:43:51 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-03-16 11:43:51 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-03-16 11:43:51 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-03-16 11:43:51 - Channel #linuxvoice: 72 nicks (1 op, 0 voices, 71 normals)
2016-03-16 11:44:00 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-03-16 11:47:52 < swift110 (~swift110@unaffiliated/swift110) has quit (Ping timeout: 264 seconds)
2016-03-16 11:56:32 < slashd (~slashd@ubuntu/member/slashd) has quit (Quit: Leaving)
2016-03-16 11:57:33 < topcyde (~topcyde@2602:304:cdb8:9e40:250f:81c8:36ae:dae6) has quit (Ping timeout: 250 seconds)
2016-03-16 12:10:01 > topcyde (~topcyde@2602:304:cdb8:9e40:8180:deb2:26af:ea78) has joined #linuxvoice
2016-03-16 12:47:03 < ideasman42 (~cambo@203-206-123-225.dyn.iinet.net.au) has quit (Remote host closed the connection)
2016-03-16 13:12:57 < Extremulus (~Extremulu@2001:470:b:1fb:deaf::d259) has quit (Remote host closed the connection)
2016-03-16 13:14:21 > swift110 (~swift110@unaffiliated/swift110) has joined #linuxvoice
2016-03-16 13:21:11 < chemist69 (~apl@2a02:560:4143:fc00:73bc:53d1:2ed6:efae) has quit (Ping timeout: 250 seconds)
2016-03-16 13:34:29 > chemist69 (~apl@2a02:560:415f:ee00:dc0d:12dd:7624:7a29) has joined #linuxvoice
2016-03-16 13:40:35 < mavrix (~mavrix@unaffiliated/mavrix) has quit (Ping timeout: 248 seconds)
2016-03-16 13:43:22 > mavrix (~mavrix@unaffiliated/mavrix) has joined #linuxvoice
2016-03-16 15:09:42 < mavrix (~mavrix@unaffiliated/mavrix) has quit (Ping timeout: 260 seconds)
2016-03-16 15:11:00 > mavrix (~mavrix@unaffiliated/mavrix) has joined #linuxvoice
2016-03-16 15:23:03 < swift110 (~swift110@unaffiliated/swift110) has quit (Ping timeout: 276 seconds)
2016-03-16 15:29:55 > swift110 (~swift110@unaffiliated/swift110) has joined #linuxvoice
2016-03-16 15:55:31 swift110 feel free to join my channel at #forthenerds
2016-03-16 16:04:04 < zmoylan-pi (~pi@109.77.182.19) has quit (Ping timeout: 264 seconds)
2016-03-16 16:07:59 > zmoylan-pi (~pi@109.77.209.240) has joined #linuxvoice
2016-03-16 16:08:46 < okovko (~okovko@c-24-15-233-102.hsd1.il.comcast.net) has quit (Remote host closed the connection)
2016-03-16 16:13:06 < swift110 (~swift110@unaffiliated/swift110) has quit (Remote host closed the connection)
2016-03-16 17:34:25 > towy71 (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has joined #linuxvoice
2016-03-16 17:34:40 < towy71_ (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has quit (Ping timeout: 264 seconds)
2016-03-16 18:11:49 < mavrix (~mavrix@unaffiliated/mavrix) has quit (Ping timeout: 252 seconds)
2016-03-16 18:12:45 > mavrix (~mavrix@unaffiliated/mavrix) has joined #linuxvoice
2016-03-16 18:43:50 - foxhunt_away is now known as foxhunt72
2016-03-16 19:37:37 > TwistedLucidity (~TwistedLu@cpc80671-stap13-2-0-cust118.12-2.cable.virginm.net) has joined #linuxvoice
2016-03-16 19:48:58 > andybalaam (andybalaam@nat/ibm/x-enbwxnudmgfrfmju) has joined #linuxvoice
2016-03-16 19:53:32 > Ian (~Thunderbi@te6compton.te.rl.ac.uk) has joined #linuxvoice
2016-03-16 19:53:55 - Ian is now known as Guest18015
2016-03-16 20:09:06 > brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has joined #linuxvoice
2016-03-16 20:09:30 > ryuslash (~slash@2a02:1812:2518:ce00:f24d:a2ff:fede:451c) has joined #linuxvoice
2016-03-16 20:22:11 > johnlane (~john@212.159.104.145) has joined #linuxvoice
2016-03-16 20:28:24 > vev (~vev@67.95.148.77.rev.sfr.net) has joined #linuxvoice
2016-03-16 20:28:26 - irc: disconnected from server
2016-03-16 20:28:41 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-03-16 20:28:41 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-03-16 20:28:41 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-03-16 20:28:41 - Channel #linuxvoice: 74 nicks (1 op, 0 voices, 73 normals)
2016-03-16 20:28:50 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-03-16 20:34:03 @degville Morning - last minute as usual, but we're just about to record a podcast if you want to share any Finds/Discoveries.
2016-03-16 20:34:23 popey :)
2016-03-16 20:36:12 popey degville: I discovered this week that if you run your system with no swap, and memory pressure gets too much, kswapd will eat your cpu alive as it tries to "swap" and make your computer completely unusable! :)
2016-03-16 20:36:23 popey (rather than the OOM killer come in and kill things)
2016-03-16 20:36:27 popey (which sucks)
2016-03-16 20:36:40 @degville ooh, thanks! I often forget about swap.
2016-03-16 20:36:41 - irc: disconnected from server
2016-03-17 02:36:33 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-03-17 02:36:33 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-03-17 02:36:33 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-03-17 02:36:33 - Channel #linuxvoice: 76 nicks (1 op, 0 voices, 75 normals)
2016-03-17 02:36:42 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-03-17 02:37:08 > jaake (~h4ckm3@c-68-52-45-79.hsd1.tn.comcast.net) has joined #linuxvoice
2016-03-17 02:44:54 < ideasman42 (~cambo@203-206-123-225.dyn.iinet.net.au) has quit (Quit: Ex-Chat)
2016-03-17 02:58:14 < nix0ut1aw (~Andy@91.244.229.42) has quit (Quit: Leaving)
2016-03-17 03:15:01 jimbotux TwistedLucidity, I watched the house of commons stream there was a very vocal SNP MP arguing pretty much all points. very disappointed and angry if they abstained. I mailed my MP twice regarding this Bill and have yet to hear anything from him. He is SNP also..
2016-03-17 03:21:24 jimbotux Joanna Cherry was the MP who really stood up and asked the serious questions imo. But as you say they abstained. To me that just reeks of them wanting the bill to pass while acting as if they wan the opposite
2016-03-17 03:22:04 mcphail They have an eye on the Scottish elections
2016-03-17 03:22:24 > writtenoff (~writtenof@of1.psych.ubc.ca) has joined #linuxvoice
2016-03-17 03:46:35 < xplora1a (~stuart@host86-180-62-215.range86-180.btcentralplus.com) has quit (Quit: Bye Bye)
2016-03-17 03:48:52 > badders (~rob@host86-131-90-148.range86-131.btcentralplus.com) has joined #linuxvoice
2016-03-17 04:02:01 < Guest18015 (~Thunderbi@te6compton.te.rl.ac.uk) has quit (Ping timeout: 240 seconds)
2016-03-17 04:15:15 < badders (~rob@host86-131-90-148.range86-131.btcentralplus.com) has quit (Ping timeout: 276 seconds)
2016-03-17 04:15:23 < andybalaam (andybalaam@nat/ibm/x-qflvahwvdmkhnyfv) has quit (Remote host closed the connection)
2016-03-17 04:23:55 < TwistedLucidity (~TwistedLu@cpc80671-stap13-2-0-cust118.12-2.cable.virginm.net) has quit (Quit: Konversation terminated!)
2016-03-17 04:30:01 < jherrmann (jirkah@nat/redhat/x-zxabthjraturpudv) has quit (Quit: Toodle pip!)
2016-03-17 04:30:24 Ioangogo https://www.youtube.com/watch?v=xZbcwi7SfZE&user=Kurzgesagt
2016-03-17 04:34:07 > Nitronium (~Dave@host213-1-15-155.range213-1.btcentralplus.com) has joined #linuxvoice
2016-03-17 04:36:35 - foxhunt72 is now known as foxhunt_away
2016-03-17 04:37:00 < evilnickveitch (~evilnick@cpc83321-bath6-2-0-cust252.18-1.cable.virginm.net) has quit (Quit: Leaving)
2016-03-17 04:45:48 < arubislander (~ubuntuadm@86.93.93.218) has quit (Quit: Leaving.)
2016-03-17 04:53:42 > arubislander (~ArubIslan@86.93.93.218) has joined #linuxvoice
2016-03-17 04:55:44 > xplora1a (~stuart@host86-180-62-215.range86-180.btcentralplus.com) has joined #linuxvoice
2016-03-17 05:02:16 < xplora1a (~stuart@host86-180-62-215.range86-180.btcentralplus.com) has quit (Ping timeout: 244 seconds)
2016-03-17 05:11:34 < arubislander (~ArubIslan@86.93.93.218) has quit (Quit: Leaving.)
2016-03-17 05:21:31 > HonSec (~HonTheUni@h5-152-210-245.host.redstation.co.uk) has joined #linuxvoice
2016-03-17 05:39:19 > badders (~rob@host86-131-90-148.range86-131.btcentralplus.com) has joined #linuxvoice
2016-03-17 06:30:23 > g0nz085 (~gonzo@cpc81199-farn9-2-0-cust619.6-2.cable.virginm.net) has joined #linuxvoice
2016-03-17 06:48:13 - foxhunt_away is now known as foxhunt72
2016-03-17 07:13:37 < TraceyC (~TraceyC@2620:0:28a2:4020:b9dd:dfa0:b232:a21d) has quit (Ping timeout: 240 seconds)
2016-03-17 07:18:25 < degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) has left #linuxvoice ("Konversation terminated!")
2016-03-17 07:31:11 > asusk7m550 (~Thunderbi@2001:981:97b3:1:b9ba:4601:616b:bcf7) has joined #linuxvoice
2016-03-17 07:39:28 > xplora1a (~stuart@2001:8b0:1679:ea38:224:d7ff:feec:e7ec) has joined #linuxvoice
2016-03-17 07:58:53 > towy71_ (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has joined #linuxvoice
2016-03-17 08:00:29 < towy71 (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has quit (Ping timeout: 250 seconds)
2016-03-17 08:19:57 < Nitronium (~Dave@host213-1-15-155.range213-1.btcentralplus.com) has quit (Remote host closed the connection)
2016-03-17 08:27:44 > huw (~manjaro-k@179.43.169.130) has joined #linuxvoice
2016-03-17 08:45:06 < johnlane (~john@212.159.104.145) has quit (Remote host closed the connection)
2016-03-17 08:53:22 < asusk7m550 (~Thunderbi@2001:981:97b3:1:b9ba:4601:616b:bcf7) has quit (Remote host closed the connection)
2016-03-17 09:15:45 < russor (~rw@188.166.11.128) has quit (Read error: Connection reset by peer)
2016-03-17 09:18:14 > russor (~rw@188.166.11.128) has joined #linuxvoice
2016-03-17 09:29:12 < badders (~rob@host86-131-90-148.range86-131.btcentralplus.com) has quit (Ping timeout: 276 seconds)
2016-03-17 09:40:27 - foxhunt72 is now known as foxhunt_away
2016-03-17 10:00:44 < LauRoman (~LauRoman@5-14-92-161.residential.rdsnet.ro) has quit (Read error: Connection reset by peer)
2016-03-17 10:08:01 < huw (~manjaro-k@179.43.169.130) has quit (Quit: Manjaro-KDE user leaving!)
2016-03-17 10:20:24 > georgeowell (~georgeowe@95.149.192.232) has joined #linuxvoice
2016-03-17 10:36:29 < xplora1a (~stuart@2001:8b0:1679:ea38:224:d7ff:feec:e7ec) has quit (Ping timeout: 250 seconds)
2016-03-17 10:36:55 > xplora1a (~stuart@178.80.187.81.in-addr.arpa) has joined #linuxvoice
2016-03-17 10:45:20 < xplora1a (~stuart@178.80.187.81.in-addr.arpa) has quit (Ping timeout: 244 seconds)
2016-03-17 10:56:09 < writtenoff (~writtenof@of1.psych.ubc.ca) has quit (Quit: WeeChat 1.3)
2016-03-17 11:56:04 < mavrix (~mavrix@unaffiliated/mavrix) has quit (Ping timeout: 260 seconds)
2016-03-17 11:58:10 > mavrix (~mavrix@unaffiliated/mavrix) has joined #linuxvoice
2016-03-17 12:06:49 < HonSec (~HonTheUni@h5-152-210-245.host.redstation.co.uk) has quit (Quit: WeeChat 0.4.2)
2016-03-17 12:10:19 > Extremulus (~Extremulu@2001:470:b:1fb:deaf::d259) has joined #linuxvoice
2016-03-17 12:21:27 < mavrix (~mavrix@unaffiliated/mavrix) has quit (Ping timeout: 276 seconds)
2016-03-17 12:23:12 > mavrix (~mavrix@unaffiliated/mavrix) has joined #linuxvoice
2016-03-17 12:37:15 < Extremulus (~Extremulu@2001:470:b:1fb:deaf::d259) has quit (Remote host closed the connection)
2016-03-17 13:01:12 < ryuslash (~slash@2a02:1812:2518:ce00:f24d:a2ff:fede:451c) has quit (Remote host closed the connection)
2016-03-17 13:19:40 < mnavrati (~milan@ip-94-113-220-233.net.upcbroadband.cz) has quit (*.net *.split)
2016-03-17 13:19:40 < chemist69 (~apl@2a02:560:415f:ee00:dc0d:12dd:7624:7a29) has quit (*.net *.split)
2016-03-17 13:19:40 < topcyde (~topcyde@2602:304:cdb8:9e40:8180:deb2:26af:ea78) has quit (*.net *.split)
2016-03-17 13:25:11 > mnavrati (~milan@ip-94-113-220-233.net.upcbroadband.cz) has joined #linuxvoice
2016-03-17 13:25:11 > topcyde (~topcyde@2602:304:cdb8:9e40:8180:deb2:26af:ea78) has joined #linuxvoice
2016-03-17 13:34:00 > chemist69 (~apl@2a02:560:417c:6c00:fc27:8dd1:328c:8630) has joined #linuxvoice
2016-03-17 13:52:51 < mavrix (~mavrix@unaffiliated/mavrix) has quit (Ping timeout: 244 seconds)
2016-03-17 13:56:32 > towy71 (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has joined #linuxvoice
2016-03-17 13:59:04 < towy71_ (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has quit (Ping timeout: 240 seconds)
2016-03-17 14:23:42 < Cueball (~lee@coffee.lb3.co.uk) has quit (Ping timeout: 248 seconds)
2016-03-17 14:27:19 > Cueball (~lee@2001:8b0:ffb3::c0:ff:ee) has joined #linuxvoice
2016-03-17 14:40:04 < Cueball (~lee@2001:8b0:ffb3::c0:ff:ee) has quit (Ping timeout: 264 seconds)
2016-03-17 14:40:09 > towy71_ (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has joined #linuxvoice
2016-03-17 14:41:07 > Cueball (~lee@coffee.lb3.co.uk) has joined #linuxvoice
2016-03-17 14:42:32 < towy71 (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has quit (Ping timeout: 260 seconds)
2016-03-17 14:50:29 < Cueball (~lee@coffee.lb3.co.uk) has quit (Ping timeout: 260 seconds)
2016-03-17 15:21:04 > zmoylan-1i (~pi@109.77.150.99) has joined #linuxvoice
2016-03-17 15:24:20 < zmoylan-pi (~pi@109.77.209.240) has quit (Ping timeout: 244 seconds)
2016-03-17 15:29:18 < cromulon (~cromulon@45.62.227.43) has quit (Ping timeout: 276 seconds)
2016-03-17 15:49:29 > Cueball (~lee@2001:8b0:ffb3::c0:ff:ee) has joined #linuxvoice
2016-03-17 15:50:33 - irc: disconnected from server
2016-03-17 19:44:36 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-03-17 19:44:36 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-03-17 19:44:36 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-03-17 19:44:36 - Channel #linuxvoice: 67 nicks (0 ops, 0 voices, 67 normals)
2016-03-17 19:44:45 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-03-17 19:48:34 < mavrix (~mavrix@unaffiliated/mavrix) has quit (Ping timeout: 240 seconds)
2016-03-17 19:50:20 > mavrix (~mavrix@unaffiliated/mavrix) has joined #linuxvoice
2016-03-17 19:54:25 > andybalaam (andybalaam@nat/ibm/x-swptvsfdkvzcvafa) has joined #linuxvoice
2016-03-17 19:57:41 > ideasman42 (~cambo@203-206-123-225.dyn.iinet.net.au) has joined #linuxvoice
2016-03-17 20:04:15 > xplora1a (~stuart@host86-180-62-215.range86-180.btcentralplus.com) has joined #linuxvoice
2016-03-17 20:05:11 > Ian1 (~Thunderbi@te6compton.te.rl.ac.uk) has joined #linuxvoice
2016-03-17 20:05:27 > mnavrati (milan@nat/redhat/x-qzrzwshovjmjstcr) has joined #linuxvoice
2016-03-17 20:07:23 > towy71 (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has joined #linuxvoice
2016-03-17 20:09:55 < towy71_ (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has quit (Ping timeout: 248 seconds)
2016-03-17 20:22:38 > degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) has joined #linuxvoice
2016-03-17 20:22:38 - Mode #linuxvoice [+o degville] by ChanServ
2016-03-17 20:31:58 < mavrix (~mavrix@unaffiliated/mavrix) has quit (Ping timeout: 252 seconds)
2016-03-17 20:34:23 > mavrix (~mavrix@unaffiliated/mavrix) has joined #linuxvoice
2016-03-17 20:35:18 > jherrmann (jirkah@nat/redhat/x-bhbxxktsookhtvev) has joined #linuxvoice
2016-03-17 20:53:17 Devilment Paul Daniels has died
2016-03-17 20:53:32 Devilment I wonder if they'll saw the coffin in two at the funeral?
2016-03-17 20:57:45 Stilvoid start the service with: you'll like this... not a lot
2016-03-17 20:58:31 zmoylan-pi no magicians have a ritual were they break the wand of the magician over the grave at their funerals. sounds quite nice tbh
2016-03-17 20:59:38 Devilment Will they close the coffin lid, reopen it to find he's disappeared then open another coffin with him in it?
2016-03-17 21:01:58 Devilment What's the lead time these days on a celebrity dying and accusations of improper behaviour?
2016-03-17 21:02:26 zmoylan-pi depends if they worked for the bbc or not i think
2016-03-17 21:02:52 @degville (i'm at least trying hard not to laugh )
2016-03-17 21:03:51 einonm The family have asked not to recieve flowers - but they may be in for a few surprises there
2016-03-17 21:06:22 > aSheepie (~phil@i-83-67-88-165.freedom2surf.net) has joined #linuxvoice
2016-03-17 21:12:03 < Ian1 (~Thunderbi@te6compton.te.rl.ac.uk) has quit (Ping timeout: 244 seconds)
2016-03-17 21:27:37 > ryuslash (~slash@2a02:1812:2518:ce00:f24d:a2ff:fede:451c) has joined #linuxvoice
2016-03-17 22:11:24 > LLL (~lars@gore.copyleft.no) has joined #linuxvoice
2016-03-17 22:19:17 mcphail Can anyone recommend a self-hosted open source online presentation framework?
2016-03-17 22:19:32 mcphail An html5 powerpoint/impress thingy
2016-03-17 22:25:51 > Ian1 (~Thunderbi@vpn-3-146.rl.ac.uk) has joined #linuxvoice
2016-03-17 22:42:05 popey mcphail: http://www.lornajane.net/ has used some nice simple ones. I recall her giving a talk about getting started with github a while back...
2016-03-17 22:42:08 popey trying to find it
2016-03-17 22:45:56 > TraceyC (~TraceyC@2620:0:28a2:4020:c195:4ca1:bf17:c53e) has joined #linuxvoice
2016-03-17 22:46:02 mcphail reveal,js looks nice, but (ideally) I'm looking for a GUI so it can be made quickly. I can always fall back on latex/beamer but I'm getting bored writing repeated markup for slides
2016-03-17 22:50:54 < TraceyC (~TraceyC@2620:0:28a2:4020:c195:4ca1:bf17:c53e) has quit (Ping timeout: 248 seconds)
2016-03-17 22:52:13 > cromulon (~cromulon@45.62.227.43) has joined #linuxvoice
2016-03-17 22:54:25 > TraceyC (~TraceyC@2620:0:28a2:4020:6c45:dcff:785:ad22) has joined #linuxvoice
2016-03-17 23:03:21 > M1C4HTRON13 (~micah@bodhilinux/team/M1C4HTRON13) has joined #linuxvoice
2016-03-17 23:04:34 > Paddy_NI (~patrick@host-92-14-224-66.as43234.net) has joined #linuxvoice
2016-03-17 23:08:33 aSheepie Don't know if it's what you want, but Shower was mentioned in LV22
2016-03-17 23:16:46 < LLL (~lars@gore.copyleft.no) has quit (Quit: Konversation terminated!)
2016-03-17 23:19:46 mcphail aSheepie: thanks. I'll take a look
2016-03-17 23:25:51 > towy71_ (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has joined #linuxvoice
2016-03-17 23:29:04 < towy71 (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has quit (Ping timeout: 240 seconds)
2016-03-17 23:30:19 popey mcphail: response from @sil is "libreoffice or slides.js"
2016-03-17 23:30:54 < Paddy_NI (~patrick@host-92-14-224-66.as43234.net) has quit (Quit: Konversation terminated!)
2016-03-17 23:37:03 mcphail popey: cheers. Looks as if I'm stuck with markup just now, unless html export has been jazzed up in latest libreoffice?
2016-03-17 23:42:21 > AdamDBrown (~Thunderbi@205.003.dsl.wa.iprimus.net.au) has joined #linuxvoice
2016-03-17 23:45:44 @degville Latest podcast is now up! https://www.linuxvoice.com/podcast-season-4-episode-5/
2016-03-17 23:47:04 mcphail degville: ta!
2016-03-17 23:47:47 TraceyC yay, I can listen to it on the drive home :D
2016-03-17 23:48:17 TraceyC Hearing all the informative news & the giggling makes the drive more pleasant
2016-03-17 23:48:46 einonm degville: Thanks! I think the website is alittle wrong though - it's advertising season 2, ep. 16 at the top of the front page
2016-03-17 23:49:14 einonm ..and the picture link is to 2.15
2016-03-17 23:50:07 einonm no..wait...the link is 2.16, but the picture link on 2.16 is to 2.15...
2016-03-17 23:50:09 @degville not the RSS? Just linuxvoice.com? Weird.
2016-03-17 23:50:34 einonm yes, RSS looks fine, the frontpage doesn't
2016-03-17 23:50:43 @degville I'm sure it looks ok to me, but I could be missing something. Unless it's cloudflare.
2016-03-17 23:51:25 einonm ah..wait...turned on some more javascript - it now works, but that's a subtle error!
2016-03-17 23:52:03 TraceyC BUG
2016-03-17 23:52:22 @degville ok, thanks. Mmm.. may have to look into what's happening.
2016-03-17 23:52:34 TraceyC blame the javascript
2016-03-17 23:53:11 * mcphail appreciates the irony he has to switch off PrivacyBadger to complete the ESTA form on the dhs.gov website
2016-03-17 23:53:22 TraceyC lol
2016-03-17 23:53:42 einonm degville: Actually, the image link still looks wrong?
2016-03-17 23:53:49 TraceyC Your gov't and mine are in a race to see who can get to Total Police and Surveillance State first
2016-03-17 23:53:58 einonm pointing at https://www.linuxvoice.com/podcast-season-2-episode-16/ for me
2016-03-17 23:54:21 mcphail TraceyC: I think we're winning that one. At least your country seems to care about privacy
2016-03-17 23:54:26 zmoylan-pi england killed a queen by intercepting and decoding her mail back in 16th century so uk wins
2016-03-17 23:54:47 TraceyC I'm seeing S4 Ep 5 on the home page
2016-03-17 23:54:55 zmoylan-pi you think they stopped after that?
2016-03-17 23:55:03 TraceyC Try clearing cache, that's usually the cause when I see old stuff on a page and others see the new stuff
2016-03-17 23:55:04 @degville einonm: it's a weird problem. I'm seeing S4 Ep 5 too.
2016-03-17 23:55:15 TraceyC (Chromium here)
2016-03-17 23:56:03 TraceyC and I see the link https://www.linuxvoice.com/podcast-season-4-episode-5/
2016-03-17 23:56:35 einonm on FF, stealth mode, all JS on gives 2.16
2016-03-17 23:58:00 einonm ...as does chrome
2016-03-17 23:58:14 @degville I've tried them all here, and stealth mode.
2016-03-17 23:58:27 einonm simple solution - get rid of the picture link? :)
2016-03-17 23:58:51 Stilvoid 04e5 for me on the homepage
2016-03-17 23:59:24 @degville Found the problem
2016-03-17 23:59:27 @degville thanks einonm.
2016-03-17 23:59:33 @degville There was some old html in there.
2016-03-17 23:59:39 einonm no worries :)
2016-03-18 00:00:05 TraceyC w00t
2016-03-18 00:00:09 @degville I don't know why it was affecting your landing page though.
2016-03-18 00:00:17 Stilvoid You also appear to have a picture of Jason Statham on the homepage
2016-03-18 00:00:36 @degville He wasn't feeling well that day. I felt guilty taking photos.
2016-03-18 00:00:58 mcphail All the "Latest issue" pics have the "Encrypt everything" cover. Isn't the "Trap a hacker" one newer?
2016-03-18 00:01:21 Stilvoid Happy Pick Apart the LV Website Day everyone!
2016-03-18 00:01:50 @degville mcphail: I know. It's bad - Mike's not had a chance to put the issue on the shop for people to buy, so we've not put it there.
2016-03-18 00:02:13 @degville We really should do better with this online malarky.
2016-03-18 00:02:28 mcphail ha!
2016-03-18 00:02:28 TraceyC given the subject matter ... ;)
2016-03-18 00:02:55 - foxhunt72 is now known as foxhunt_away
2016-03-18 00:03:15 zmoylan-pi lv should do a different animal on every cover like o'reilly. so this months is a badger, next a crocodile, then a deer etc. make it easier to recognise new issues
2016-03-18 00:03:24 AdamDBrown A mechanic's car never works :p
2016-03-18 00:04:58 @degville AdamDBrown: that could be our new tagline!
2016-03-18 00:11:09 AdamDBrown haha, go for it! :p
2016-03-18 00:11:51 einonm Probably becasue of this! http://opengarages.org/handbook/
2016-03-18 00:12:33 > evilnickveitch (~evilnick@cpc83321-bath6-2-0-cust252.18-1.cable.virginm.net) has joined #linuxvoice
2016-03-18 00:12:35 einonm degville: Great, thanks - fixed for me now
2016-03-18 00:12:59 @degville einonm: thanks for letting me know :)
2016-03-18 00:13:27 @degville I've forgotten to synergise the podcast with twitter.
2016-03-18 00:13:44 > m95lag (~m95lag@82-181-169-179.bb.dnainternet.fi) has joined #linuxvoice
2016-03-18 00:13:51 mcphail zmoylan-pi: badger, crocodile, deer? Surely badger, drake, eft?
2016-03-18 00:14:40 einonm degville: it's always a good idea to align your synergies
2016-03-18 00:15:00 zmoylan-pi something like that. just the dates of the mags on the shelfs are a little odd when you're buying jan mag in dec. throw a small carciature of an animal near the date and people would remember
2016-03-18 00:15:04 < Ian1 (~Thunderbi@vpn-3-146.rl.ac.uk) has quit (Ping timeout: 240 seconds)
2016-03-18 00:15:47 < quaisi_ (~simon@host-92-30-24-217.as13285.net) has quit (Read error: Connection reset by peer)
2016-03-18 00:16:18 > quaisi (~simon@host-92-30-22-161.as13285.net) has joined #linuxvoice
2016-03-18 00:16:50 TraceyC Yesterday in a meeting, one of my team mates actually said "It's great because we all leveraged our strengths to come together to deliver a features our customers love"
2016-03-18 00:16:53 TraceyC I wanted to weep
2016-03-18 00:16:55 TraceyC He's a techie
2016-03-18 00:17:23 mcphail TraceyC: he's aiming for a management job
2016-03-18 00:17:30 TraceyC I honestly think he is
2016-03-18 00:17:34 > towy71 (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has joined #linuxvoice
2016-03-18 00:17:37 mcphail TraceyC: that would be a real paradigm shift
2016-03-18 00:17:37 zmoylan-pi slap him with an o'reillys manual and cast out the marketing demon! :-)
2016-03-18 00:17:38 einonm TraceyC: probably not for long, they'll be shooting up that corporate ladder before you know it
2016-03-18 00:17:41 TraceyC He certainly acts bossy enough
2016-03-18 00:17:57 TraceyC good idea zmoylan-pi
2016-03-18 00:17:58 * TraceyC notes
2016-03-18 00:18:06 * TraceyC grabs the sed and awk manual
2016-03-18 00:18:22 zmoylan-pi if the o'reilly doesn't work bring out the big guns and get a *BIG* perl manual
2016-03-18 00:18:36 * TraceyC grabs the Advanced Perl manual
2016-03-18 00:18:56 zmoylan-pi if that doesn't do it, it will leave the brain damage needed for management...
2016-03-18 00:19:02 TraceyC hahahah
2016-03-18 00:20:05 < towy71_ (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has quit (Ping timeout: 244 seconds)
2016-03-18 00:21:05 mcphail As a "customer" rather than developer, I don't think I have ever fallen in love with a software feature. I might strecth to "like", but "love" is a step too far
2016-03-18 00:21:40 mcphail otoh, "hate" is a common emotion
2016-03-18 00:21:41 zmoylan-pi no i have used software that i loved. because i knew how much time it saved me or how much i could trust it
2016-03-18 00:22:06 TraceyC That part was actually the least stretched part of the sentence
2016-03-18 00:22:21 TraceyC We had demo'ed the feature to customers last week and they did express a lot of enthusiasm
2016-03-18 00:22:25 zmoylan-pi once searched a 2gb log file for 3 instances of a very specific error in vim. saved me a lot of time
2016-03-18 00:22:38 < mavrix (~mavrix@unaffiliated/mavrix) has quit (Ping timeout: 248 seconds)
2016-03-18 00:22:51 TraceyC These are large ISPs / server hosting people and the feature will help them keep *their* customers. They had asked for the feature. So it's understandable
2016-03-18 00:27:40 aSheepie TraceyC: Bloody hell, that's an abomination of a statement, wouldn't "we pulled together well as a team to deliver a great new feature" have done?
2016-03-18 00:27:56 TraceyC right?
2016-03-18 00:28:40 TraceyC I now have Pink Floyd going through my head
2016-03-18 00:28:45 TraceyC Ridin the Gravy Traiiiiiiiiiiiiin
2016-03-18 00:28:49 mcphail He could have got away with the original statement if it ended "...and here's your bonuses"
2016-03-18 00:28:57 TraceyC hahaha
2016-03-18 00:34:13 aSheepie My only slightly mgmnt-speak phrase has been (and I'm still somewhat ashamed of it) "don't think of it as a problem, think of it as an opportunity for improvement"
2016-03-18 00:35:12 aSheepie _in my defence_ it was to try to steer people away from blame to "we probably actually have a training/equipment issue" and I stand by it, but I still feel a bit dirty
2016-03-18 00:35:31 aSheepie and I didn't say it in a meeting, only to someone else in my dept
2016-03-18 00:37:02 < TraceyC (~TraceyC@2620:0:28a2:4020:6c45:dcff:785:ad22) has quit (Ping timeout: 248 seconds)
2016-03-18 00:44:41 < opi (~opi@2001:41d0:52:800::49e) has quit (Quit: ZNC - http://znc.in)
2016-03-18 00:44:46 > slashd (~slashd@modemcable157.191-130-66.mc.videotron.ca) has joined #linuxvoice
2016-03-18 00:45:14 < slashd (~slashd@modemcable157.191-130-66.mc.videotron.ca) has quit (Changing host)
2016-03-18 00:45:14 > slashd (~slashd@ubuntu/member/slashd) has joined #linuxvoice
2016-03-18 00:50:44 > TraceyC (~TraceyC@ng2.cptxoffice.net) has joined #linuxvoice
2016-03-18 00:53:54 > mavrix (~mavrix@unaffiliated/mavrix) has joined #linuxvoice
2016-03-18 01:10:10 * Devilment catches up
2016-03-18 01:10:48 TraceyC I just got a call from a guy saying he works in "Windows technical support" calling because he said "we are receiving warnings about a virus coming from your PC". Too bad I don't have time to play with him.
2016-03-18 01:10:49 Devilment Shirley, Badger, Badger, Badger, Badger, Badger, Mushroom, Mushroom, Snake would be the order for the covers
2016-03-18 01:13:40 zmoylan-pi or pics of ancient computers if the rotating animals is too ubuntu, acer, benq, compaq... https://en.wikipedia.org/wiki/List_of_computer_system_manufacturers
2016-03-18 01:14:48 Devilment e-Ink cover. Changes from saying "This is the latest issue" after a certain date
2016-03-18 01:15:09 zmoylan-pi nah use cheap ink that fades to blank after 30 days... :-)
2016-03-18 01:16:02 Devilment Or a "Best Before" date
2016-03-18 01:17:21 * Ioangogo is going to fix LVbot
2016-03-18 01:18:43 < georgeowell (~georgeowe@95.149.192.232) has quit (Quit: Leaving)
2016-03-18 01:18:44 zmoylan-pi is it humping people legs again? :-P
2016-03-18 01:18:52 Devilment Wait, what. Ben has a find from a dead Irish comedian?
2016-03-18 01:19:35 > LVbot (~iBot@huwloosley.plus.com) has joined #linuxvoice
2016-03-18 01:19:38 einonm the dead ones are funnier than the live ones? :?
2016-03-18 01:20:11 zmoylan-pi well dave allen was pretty funny...
2016-03-18 01:20:47 Ioangogo !beer
2016-03-18 01:20:49 * LVbot gives Ioangogo foaming pint of beer.
2016-03-18 01:20:58 zmoylan-pi https://www.youtube.com/watch?v=mal_A4Op6mE
2016-03-18 01:21:00 LVbot ^ Dave Allen Death Race YouTube
2016-03-18 01:22:17 Ioangogo Fire who ever was incharge of the laughting track, they started to early
2016-03-18 01:23:12 zmoylan-pi well it was initially after a commentary of him describing the ancient irish custom of how first funeral had precedent in ireland for some reason
2016-03-18 01:24:47 Ioangogo wait, is it suggestion time
2016-03-18 01:25:54 * zmoylan-pi waits for an answer before putting away hammer...
2016-03-18 01:26:19 - foxhunt_away is now known as foxhunt72
2016-03-18 01:30:58 < AdamDBrown (~Thunderbi@205.003.dsl.wa.iprimus.net.au) has quit (Quit: AdamDBrown)
2016-03-18 01:31:28 > AdamDBrown (~Thunderbi@205.003.dsl.wa.iprimus.net.au) has joined #linuxvoice
2016-03-18 01:50:55 < TraceyC (~TraceyC@ng2.cptxoffice.net) has quit (Quit: Off I go into the wild, blue yonder)
2016-03-18 02:00:04 < ideasman42 (~cambo@203-206-123-225.dyn.iinet.net.au) has quit (Quit: Ex-Chat)
2016-03-18 02:03:00 > opi (~opi@2001:41d0:52:800::49e) has joined #linuxvoice
2016-03-18 02:03:03 < towy71 (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has quit (Ping timeout: 276 seconds)
2016-03-18 02:10:20 Ioangogo I dont think it is
2016-03-18 02:23:38 Ioangogo https://www.youtube.com/watch?v=V28SDigCLek
2016-03-18 02:23:40 LVbot ^ Inside Raqqa: Women's secret films from within closed city of terrorist sect ISIS YouTube
2016-03-18 02:39:54 Ioangogo degville: Whitch one of you was the person in ep 4 was talking about the PS4 being false information
2016-03-18 02:40:11 @degville I think it may have been me.
2016-03-18 02:40:18 @degville In reference to the Paris attacks?
2016-03-18 02:40:52 Ioangogo Because They used SMS to communicate
2016-03-18 02:41:24 Ioangogo The enctyption hype was so high every one ignored that fact
2016-03-18 02:41:44 @degville I think we mentioned it was SMS before, but yes, I was refering to this: http://www.theverge.com/2015/11/16/9745216/playstation-4-paris-attacks-reporting-error
2016-03-18 02:41:46 LVbot ^ A reporting error linked the PlayStation 4 to Paris attacks The Verge
2016-03-18 02:41:52 @degville Although I didn't do a very good job of referring to it.
2016-03-18 02:51:10 > imnotarobot (b24fac71@gateway/web/freenode/ip.178.79.172.113) has joined #linuxvoice
2016-03-18 02:51:47 > towy71 (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has joined #linuxvoice
2016-03-18 02:58:26 < imnotarobot (b24fac71@gateway/web/freenode/ip.178.79.172.113) has quit (Quit: Page closed)
2016-03-18 03:14:55 - foxhunt72 is now known as foxhunt_away
2016-03-18 03:16:09 > badders (~rob@host86-131-90-148.range86-131.btcentralplus.com) has joined #linuxvoice
2016-03-18 03:16:13 > writtenoff (~writtenof@of1.psych.ubc.ca) has joined #linuxvoice
2016-03-18 03:17:01 < badders (~rob@host86-131-90-148.range86-131.btcentralplus.com) has quit (Client Quit)
2016-03-18 03:23:12 - foxhunt_away is now known as foxhunt72
2016-03-18 03:24:18 < docapotamus (~pjuu@cloudev.pjuu.net) has quit (Ping timeout: 276 seconds)
2016-03-18 03:24:25 < mavrix (~mavrix@unaffiliated/mavrix) has quit (Ping timeout: 240 seconds)
2016-03-18 03:25:10 > towy71_ (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has joined #linuxvoice
2016-03-18 03:25:35 > mavrix (~mavrix@unaffiliated/mavrix) has joined #linuxvoice
2016-03-18 03:27:27 < towy71 (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has quit (Ping timeout: 250 seconds)
2016-03-18 03:28:36 > draake (~h4ckm3@c-68-52-45-79.hsd1.tn.comcast.net) has joined #linuxvoice
2016-03-18 03:31:08 < jaake (~h4ckm3@c-68-52-45-79.hsd1.tn.comcast.net) has quit (Quit: WeeChat 1.4)
2016-03-18 03:31:12 - draake is now known as jaake
2016-03-18 03:32:15 * popey chuckles at the podcast
2016-03-18 03:32:24 popey Ben getting annoyed about RCJ
2016-03-18 03:44:23 - foxhunt72 is now known as foxhunt_away
2016-03-18 03:50:34 < TwistedLucidity (~TwistedLu@cpc80671-stap13-2-0-cust118.12-2.cable.virginm.net) has quit (Quit: Konversation terminated!)
2016-03-18 03:53:56 Ioangogo The real reason why DRM is BAD http://www.ibtimes.co.uk/ios-trojan-malware-acedeceiver-targets-non-jailbroken-iphones-exploiting-apples-drm-flaw-mitm-1549993
2016-03-18 03:53:58 LVbot ^ iOS Trojan malware AceDeceiver targets non-jailbroken iPhones exploiting Apple's DRM flaw with MITM technique
2016-03-18 04:04:18 < opi (~opi@2001:41d0:52:800::49e) has quit (Quit: ZNC - http://znc.in)
2016-03-18 04:05:20 < andybalaam (andybalaam@nat/ibm/x-swptvsfdkvzcvafa) has quit (Remote host closed the connection)
2016-03-18 04:06:20 < arubislander (~ArubIslan@86.93.93.218) has quit (Quit: Leaving.)
2016-03-18 04:27:46 > opi (~opi@2001:41d0:52:800::49e) has joined #linuxvoice
2016-03-18 04:41:43 Devilment zmoylan-pi: http://www.theregister.co.uk/2016/03/17/irish_turn_to_wine/
2016-03-18 04:41:44 LVbot ^ Irish shun beer, whiskey, in favour of wine The Register
2016-03-18 04:41:59 < xplora1a (~stuart@host86-180-62-215.range86-180.btcentralplus.com) has quit (Quit: Bye Bye)
2016-03-18 05:00:04 - foxhunt_away is now known as foxhunt72
2016-03-18 05:00:33 < M1C4HTRON13 (~micah@bodhilinux/team/M1C4HTRON13) has quit (Remote host closed the connection)
2016-03-18 05:32:23 > towy71 (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has joined #linuxvoice
2016-03-18 05:34:25 < towy71_ (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has quit (Ping timeout: 250 seconds)
2016-03-18 05:43:44 > TraceyC (~TraceyC@2620:0:28a2:4020:7512:bed:1a2d:4f6d) has joined #linuxvoice
2016-03-18 05:48:45 > Mihaly (~chatzilla@pa49-182-131-71.pa.nsw.optusnet.com.au) has joined #linuxvoice
2016-03-18 05:49:10 Mihaly hey I have joined after all. Hello everybody
2016-03-18 05:49:24 zmoylan-pi o/
2016-03-18 05:50:00 Mihaly just recieved issues 23 24 - usually australia post is quickuicker but arggh
2016-03-18 05:51:07 TraceyC Hallo
2016-03-18 05:52:05 Mihaly it did seem to take substantially longerthan I was used to... think they are possibly degrading the service deliberatley to make privatisatoion seem inevitable. Hello Tracey\
2016-03-18 05:55:31 Mihaly I seem to be attracting females tonight - there's a huntsman spider sitting not far from my corner just above me. I keep looking up
2016-03-18 05:55:58 Mihaly expecting it to vanish and then I willgo argh -where did it go>
2016-03-18 06:00:35 Mihaly but it just is sitting there, I noticed it outside earlier, tried to tell it to stay outside, but somehow I just knew it would come into my room. is it following me or the fleas?
2016-03-18 06:03:10 Mihaly its about 10 cm from leg to leg, and i don't know why I find it so scary, but it's odd i think that I didn;t notice it creeping up on me
2016-03-18 06:03:27 TraceyC spiders are ninjas
2016-03-18 06:03:43 Mihaly serious thats true
2016-03-18 06:03:47 mcphail If you can hear a spider's footsteps, it is too big
2016-03-18 06:03:54 > mjtowell (~mjtowell@unaffiliated/mjtowell) has joined #linuxvoice
2016-03-18 06:04:26 Mihaly i suspect it was a nearly silent noise that aroused me to it's presence....
2016-03-18 06:04:48 zmoylan-pi you could feel 8 eyes watching you...
2016-03-18 06:05:11 Mihaly it's not a barking spider, but i don't usually tilt my head up at that angle. so i must have been alerted to it
2016-03-18 06:07:40 < opi (~opi@2001:41d0:52:800::49e) has quit (Quit: ZNC - http://znc.in)
2016-03-18 06:08:12 > opi (~opi@2001:41d0:52:800::49e) has joined #linuxvoice
2016-03-18 06:08:44 > Paddy_NI (~patrick@host-92-14-224-66.as43234.net) has joined #linuxvoice
2016-03-18 06:08:50 Mihaly the larger eyes are presumably designed, but why o why have another 4?!
2016-03-18 06:10:52 zmoylan-pi to freak you out... :-)
2016-03-18 06:12:05 Mihaly can u imagine a sedurity device with as much silent creeping?
2016-03-18 06:12:39 > LauRoman|Alt (~LauRoman@5-14-92-161.residential.rdsnet.ro) has joined #linuxvoice
2016-03-18 06:13:34 < LauRoman (~LauRoman@5-14-92-161.residential.rdsnet.ro) has quit (Ping timeout: 248 seconds)
2016-03-18 06:13:42 TraceyC True story - one evening, I was sitting in the kitchen with my boyfriend and we heard this weird scraping sound. We identified it as some bug / spider leg scratching through the wee crack around the cover for the light fixture (where it attaches to the ceiling)
2016-03-18 06:14:02 Mihaly anyway, as dawn approaches it is likely to just hang there
2016-03-18 06:14:03 TraceyC The spider was in the ceiling, trying to scrape a leg through to the other side
2016-03-18 06:14:51 Mihaly they do scrape presumably to ensure cleanliness of their leg spideriness. was it ahuntsman?
2016-03-18 06:16:23 Mihaly also maybe the loudness was due to accoustic reflections in the light fixture
2016-03-18 06:18:47 Mihaly ok give me a few moments, I'll transfer the image of it as is
2016-03-18 06:21:03 Mihaly did that work?
2016-03-18 06:21:58 zmoylan-pi some irc clients accept transfers, others do not. best bet is to post on imgur and post link
2016-03-18 06:23:03 Mihaly Yeah, it's ok. never mind, I should post it on my facebook. Whats imgur? sounds like a mediteranian
2016-03-18 06:23:36 zmoylan-pi quick way of sharing images... http://imgur.com/
2016-03-18 06:23:37 LVbot ^ Imgur: The most awesome images on the Internet
2016-03-18 06:23:55 Mihaly checking it now .... brb
2016-03-18 06:25:11 Mihaly hmmm
2016-03-18 06:26:19 Mihaly somehow I figure a post of a huntsman spider in the corner of the roof just wont; cut it
2016-03-18 06:27:47 Mihaly argggghhh
2016-03-18 06:27:52 Mihaly it's gone/
2016-03-18 06:28:39 Mihaly now i'll panic about where the hell it is/
2016-03-18 06:29:38 zmoylan-pi gone to get it's mates...
2016-03-18 06:30:30 Mihaly no, it isn't here to seek for mates, it's here to seek somewhere where someone won't spray it or squash it.
2016-03-18 06:30:46 Mihaly but haha of course, yeah
2016-03-18 06:35:14 Mihaly there's the entire place it could go, but it followed to me, my room. arggh why
2016-03-18 06:35:45 zmoylan-pi to settle down and have 10,000 kids...
2016-03-18 06:36:23 Mihaly he's sorry she's hiding behind a poster now. And not to have a family, i'm not expecting. not their behaviour
2016-03-18 06:37:16 mcphail https://www.youtube.com/watch?v=JWpz2OYf1QU
2016-03-18 06:37:18 LVbot ^ The Who Boris the Spider YouTube
2016-03-18 06:38:13 TraceyC :D
2016-03-18 06:40:57 > asusk7m550 (~Thunderbi@2001:981:97b3:1:91c4:494d:dd83:f837) has joined #linuxvoice
2016-03-18 06:47:29 Mihaly hey look it's way too early over here. what time is it over there?
2016-03-18 06:47:55 zmoylan-pi 1947 in ireland
2016-03-18 06:48:07 TraceyC lol
2016-03-18 06:48:18 TraceyC near 3p in central US
2016-03-18 06:48:49 TraceyC There are those trying to get us back to 1947 but they haven't succeeded yet
2016-03-18 06:51:46 zmoylan-pi well you have all the time in the world to perfect your time machine...
2016-03-18 06:51:54 TraceyC right?
2016-03-18 06:52:06 TraceyC What do we want? Time travel! When do we want it? Irrelevant!
2016-03-18 06:52:44 zmoylan-pi i believe the correct grammar is 'when willen we want it?'
2016-03-18 06:54:23 TraceyC lol
2016-03-18 06:56:01 zmoylan-pi if hitch hikers and life of brian has done nothing, it has taught us valuable lessons in grammar :-)
2016-03-18 06:56:05 Mihaly I willen would have wanted it when it was near but now it's here I only watch antiques roadshow like caspar last
2016-03-18 06:57:10 Mihaly saying I KNOW how you managed to get that piece of furniture from 1640 here right now.
2016-03-18 06:59:10 Mihaly absolutely vale doug adams and thanks for the fishing consequences, the cafe where a simple ticket takes you bistromath, but heart ofgold also
2016-03-18 07:13:13 < TraceyC (~TraceyC@2620:0:28a2:4020:7512:bed:1a2d:4f6d) has quit (Ping timeout: 240 seconds)
2016-03-18 07:13:39 > TraceyC (~TraceyC@2620:0:28a2:4020:7512:bed:1a2d:4f6d) has joined #linuxvoice
2016-03-18 07:13:58 - foxhunt72 is now known as foxhunt_away
2016-03-18 07:18:06 < TraceyC (~TraceyC@2620:0:28a2:4020:7512:bed:1a2d:4f6d) has quit (Ping timeout: 248 seconds)
2016-03-18 07:19:53 < jherrmann (jirkah@nat/redhat/x-bhbxxktsookhtvev) has quit (Remote host closed the connection)
2016-03-18 07:20:12 > dvdyzag (~dvdyzag@159.203.39.49) has joined #linuxvoice
2016-03-18 07:24:40 Arthur_D didn't get my old Raspberry Pi model B working today either, so yeah it wasn't just a fluke those years back. Oh well
2016-03-18 07:25:05 Arthur_D probably faulty hardware from the get-go
2016-03-18 07:26:43 Arthur_D I guess I could try getting a RPi 3 but I don't really have much to do with it
2016-03-18 07:28:08 Mihaly still trying to actually work out why those circuit boards are worth getting into?
2016-03-18 07:29:13 Arthur_D sorta
2016-03-18 07:29:37 Arthur_D I mean I have two desktop computers already :)
2016-03-18 07:29:46 * zmoylan-pi has a pi b running a couple of years now. great little machine. use it for irc/rss and a few other tasks about the house
2016-03-18 07:30:25 Mihaly i still recall uni days - we used to laugh about calling it a BBQ, but I acknowledge we burnt some expensive 64000
2016-03-18 07:30:30 zmoylan-pi a little box running on a phone charger in the kitchen i can log into from any machine in the house so i'm on irc 24x7 instead of expensive power hungry beast
2016-03-18 07:30:35 Arthur_D yep, could use it for irc, but I just set up znc on my VPS a few days ago
2016-03-18 07:31:09 < mjtowell (~mjtowell@unaffiliated/mjtowell) has quit (Quit: Leaving)
2016-03-18 07:31:11 zmoylan-pi i keep meaning to add a camera to it for security about the house
2016-03-18 07:31:13 Mihaly are ARM chips anything like a 64000 chip? assembly wise?
2016-03-18 07:31:35 Mihaly i should say 68000 :}\\
2016-03-18 07:34:26 Mihaly i still have my old uni book assembler 68040 -n
2016-03-18 07:35:06 Arthur_D naw man you use Python nowadays ;)
2016-03-18 07:36:19 Mihaly it's wierd though, I really wanted to actually pass that course - we used forth, ànd baked the chip every time
2016-03-18 07:36:47 Arthur_D baked chip cookies? Yum
2016-03-18 07:37:45 Mihaly it always seemed we realeased the magic smoke, test to destruction. No wonder I failed - consistently
2016-03-18 07:38:22 Arthur_D speaking of, I heard the RPi 3 gets quite hot
2016-03-18 07:39:05 Arthur_D presumably under high load, so if it runs something light it wouldn't matter
2016-03-18 07:39:20 Mihaly wouldn't know - though I would like to get my hands on one, or even an earlier version]
2016-03-18 07:47:54 popey I have had a Pi3 in my PiCade, been playing games and other things that would cause it to get hot, and it's been fine
2016-03-18 07:47:59 popey no cooling in that box either
2016-03-18 07:49:13 Arthur_D ok, sounds like not an issue then, good :)
2016-03-18 07:55:09 < m95lag (~m95lag@82-181-169-179.bb.dnainternet.fi) has quit (Quit: leaving)
2016-03-18 07:56:53 popey bugger issue for me is power consumption
2016-03-18 07:56:57 popey needs more power
2016-03-18 07:57:28 mcphail got the wifi working well yet?
2016-03-18 08:00:42 popey no, i tend to use wired
2016-03-18 08:04:54 popey I'm told if you turn off wifi power saving it's better
2016-03-18 08:07:11 > JoeRess (~yaaic@cpc16-mort6-2-0-cust250.19-2.cable.virginm.net) has joined #linuxvoice
2016-03-18 08:07:45 JoeRess Is degville here?
2016-03-18 08:18:09 < Mihaly (~chatzilla@pa49-182-131-71.pa.nsw.optusnet.com.au) has quit (Quit: ChatZilla 0.9.92 [Firefox 41.0.2/20151014143721])
2016-03-18 08:21:05 < mavrix (~mavrix@unaffiliated/mavrix) has quit (Ping timeout: 244 seconds)
2016-03-18 08:21:53 * popey tickles JoeRess
2016-03-18 08:22:06 * JoeRess runs away
2016-03-18 08:22:38 < JoeRess (~yaaic@cpc16-mort6-2-0-cust250.19-2.cable.virginm.net) has quit (Quit: maybe tomorrow)
2016-03-18 08:23:28 > mavrix (~mavrix@unaffiliated/mavrix) has joined #linuxvoice
2016-03-18 08:34:57 Ioangogo Does pybonjor still exist
2016-03-18 08:37:08 < asusk7m550 (~Thunderbi@2001:981:97b3:1:91c4:494d:dd83:f837) has quit (Quit: asusk7m550)
2016-03-18 08:45:59 Blackisle ProtonMail back in open signups again
2016-03-18 08:46:01 Blackisle http://www.theregister.co.uk/2016/03/17/protonmail_launches_open_registrations_ahead_of_snoopers_charter/
2016-03-18 08:46:03 LVbot ^ Secure email bods ProtonMail open signup floodgates to world+dog The Register
2016-03-18 08:46:46 Blackisle have inline encryption working with RainLoop webmail without any issues
2016-03-18 08:46:57 Blackisle but, tis only text body that gets encrypted
2016-03-18 08:47:10 Blackisle not the whole message
2016-03-18 08:47:19 < johnlane (~john@johnlane.plus.com) has quit (Remote host closed the connection)
2016-03-18 08:49:11 < aSheepie (~phil@i-83-67-88-165.freedom2surf.net) has quit (Quit: WeeChat 0.3.7)
2016-03-18 09:03:16 < mnavrati (milan@nat/redhat/x-qzrzwshovjmjstcr) has quit (Quit: Leaving)
2016-03-18 09:48:13 > mnavrati (~milan@ip-94-113-220-233.net.upcbroadband.cz) has joined #linuxvoice
2016-03-18 10:10:49 < mavrix (~mavrix@unaffiliated/mavrix) has quit (Ping timeout: 240 seconds)
2016-03-18 10:13:38 > mavrix (~mavrix@unaffiliated/mavrix) has joined #linuxvoice
2016-03-18 10:40:13 < ryuslash (~slash@2a02:1812:2518:ce00:f24d:a2ff:fede:451c) has quit (Remote host closed the connection)
2016-03-18 10:54:09 < LauRoman|Alt (~LauRoman@5-14-92-161.residential.rdsnet.ro) has quit (Read error: Connection reset by peer)
2016-03-18 10:59:24 < writtenoff (~writtenof@of1.psych.ubc.ca) has quit (Quit: WeeChat 1.3)
2016-03-18 11:02:18 < Paddy_NI (~patrick@host-92-14-224-66.as43234.net) has quit (Remote host closed the connection)
2016-03-18 11:27:04 < mnavrati (~milan@ip-94-113-220-233.net.upcbroadband.cz) has quit (Quit: Leaving)
2016-03-18 11:44:54 < slashd (~slashd@ubuntu/member/slashd) has quit (Quit: Leaving)
2016-03-18 11:57:40 > georgeowell (~georgeowe@95.149.192.232) has joined #linuxvoice
2016-03-18 12:08:04 < mavrix (~mavrix@unaffiliated/mavrix) has quit (Ping timeout: 240 seconds)
2016-03-18 12:10:16 > mavrix (~mavrix@unaffiliated/mavrix) has joined #linuxvoice
2016-03-18 12:22:20 > zmoylan-1i (~pi@109.77.110.110) has joined #linuxvoice
2016-03-18 12:25:34 < zmoylan-pi (~pi@109.78.208.251) has quit (Ping timeout: 240 seconds)
2016-03-18 12:26:57 < aptanet (~quassel@humpback.aptanet.net) has quit (Ping timeout: 250 seconds)
2016-03-18 12:30:31 > aptanet (~quassel@humpback.aptanet.net) has joined #linuxvoice
2016-03-18 13:19:40 < chemist69 (~apl@2a02:560:417c:6c00:fc27:8dd1:328c:8630) has quit (Ping timeout: 264 seconds)
2016-03-18 13:23:42 < mavrix (~mavrix@unaffiliated/mavrix) has quit (Ping timeout: 246 seconds)
2016-03-18 13:25:18 > writtenoff (~writtenof@d172-218-204-26.bchsia.telus.net) has joined #linuxvoice
2016-03-18 13:26:23 > mavrix (~mavrix@unaffiliated/mavrix) has joined #linuxvoice
2016-03-18 13:32:43 > chemist69 (~apl@2a02:560:419a:1600:7a23:41bf:5bf8:8abf) has joined #linuxvoice
2016-03-18 14:01:37 < mavrix (~mavrix@unaffiliated/mavrix) has quit (Ping timeout: 240 seconds)
2016-03-18 14:04:26 > mavrix (~mavrix@unaffiliated/mavrix) has joined #linuxvoice
2016-03-18 14:26:25 < mavrix (~mavrix@unaffiliated/mavrix) has quit (Ping timeout: 268 seconds)
2016-03-18 14:36:42 > ideasman42 (~cambo@203-206-123-225.dyn.iinet.net.au) has joined #linuxvoice
2016-03-18 14:51:56 < georgeowell (~georgeowe@95.149.192.232) has quit (Quit: Leaving)
2016-03-18 15:50:01 > writteno1 (~writtenof@d172-218-204-26.bchsia.telus.net) has joined #linuxvoice
2016-03-18 15:51:42 < writtenoff (~writtenof@d172-218-204-26.bchsia.telus.net) has quit (Ping timeout: 248 seconds)
2016-03-18 15:53:03 < FiftyOneFifty (~quassel@159.203.105.139) has quit (Quit: No Ping reply in 180 seconds.)
2016-03-18 15:54:13 < dvdyzag (~dvdyzag@159.203.39.49) has quit (Ping timeout: 244 seconds)
2016-03-18 15:54:19 > FiftyOneFifty (~quassel@159.203.105.139) has joined #linuxvoice
2016-03-18 15:56:21 < NYbill (~bill@104.236.1.137) has quit (Ping timeout: 276 seconds)
2016-03-18 15:56:57 > NYbill (~bill@104.236.1.137) has joined #linuxvoice
2016-03-18 16:01:09 > zmoylan-pi (~pi@109.76.181.202) has joined #linuxvoice
2016-03-18 16:04:48 < zmoylan-1i (~pi@109.77.110.110) has quit (Ping timeout: 276 seconds)
2016-03-18 16:05:11 < NYbill (~bill@104.236.1.137) has quit (Remote host closed the connection)
2016-03-18 16:05:28 > NYbill (~bill@104.236.1.137) has joined #linuxvoice
2016-03-18 18:44:32 > vex21 (~vex@ip-62-245-125-253.net.upcbroadband.cz) has joined #linuxvoice
2016-03-18 18:51:26 > arubislander (~ArubIslan@86.93.93.218) has joined #linuxvoice
2016-03-18 18:58:21 < towy71 (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has quit (Ping timeout: 276 seconds)
2016-03-18 18:59:45 < vex21 (~vex@ip-62-245-125-253.net.upcbroadband.cz) has quit (Quit: Leaving.)
2016-03-18 19:00:12 > towy71 (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has joined #linuxvoice
2016-03-18 19:09:49 > LauRoman (~LauRoman@5-14-92-161.residential.rdsnet.ro) has joined #linuxvoice
2016-03-18 19:14:06 > torwag (~torsten@DHCP156.juelich9.fh-aachen.de) has joined #linuxvoice
2016-03-18 19:29:47 - foxhunt_away is now known as foxhunt72
2016-03-18 19:36:20 > mavrix (~mavrix@unaffiliated/mavrix) has joined #linuxvoice
2016-03-18 19:51:19 > mnavrati (milan@nat/redhat/x-dkmrnojplxsnicyb) has joined #linuxvoice
2016-03-18 19:55:41 > TwistedLucidity (~TwistedLu@cpc80671-stap13-2-0-cust118.12-2.cable.virginm.net) has joined #linuxvoice
2016-03-18 19:55:54 > andybalaam (andybalaam@nat/ibm/x-zzuaycluqodkdags) has joined #linuxvoice
2016-03-18 20:02:59 > brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has joined #linuxvoice
2016-03-18 20:03:55 - irc: disconnected from server
2016-03-19 07:19:34 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-03-19 07:19:34 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-03-19 07:19:34 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-03-19 07:19:34 - Channel #linuxvoice: 72 nicks (1 op, 0 voices, 71 normals)
2016-03-19 07:19:44 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-03-19 07:21:30 > gamerchick02 (~gamerchic@c-68-36-7-43.hsd1.mi.comcast.net) has joined #linuxvoice
2016-03-19 07:24:31 < Nitronium (~Dave@host213-1-15-155.range213-1.btcentralplus.com) has quit (Remote host closed the connection)
2016-03-19 07:25:57 < m95lag (~m95lag@82-181-169-179.bb.dnainternet.fi) has quit (Quit: leaving)
2016-03-19 07:28:46 < gamerchick02 (~gamerchic@c-68-36-7-43.hsd1.mi.comcast.net) has quit (Quit: Leaving)
2016-03-19 07:30:08 > gamerchick02 (~gamerchic@c-68-36-7-43.hsd1.mi.comcast.net) has joined #linuxvoice
2016-03-19 08:27:42 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-03-19 08:27:42 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-03-19 08:27:42 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-03-19 08:27:42 - Channel #linuxvoice: 69 nicks (1 op, 0 voices, 68 normals)
2016-03-19 08:27:53 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-03-19 08:34:06 < swift110 (~swift110@unaffiliated/swift110) has quit (Ping timeout: 276 seconds)
2016-03-19 08:37:56 > _hanhart (~hanhart@static.101.25.4.46.clients.your-server.de) has joined #linuxvoice
2016-03-19 09:00:09 > Nitronium (~Dave@host213-1-15-155.range213-1.btcentralplus.com) has joined #linuxvoice
2016-03-19 09:00:15 - foxhunt72 is now known as foxhunt_away
2016-03-19 09:09:13 < towy71 (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has quit (Ping timeout: 252 seconds)
2016-03-19 09:10:24 < mnavrati (~milan@ip-94-112-188-159.net.upcbroadband.cz) has quit (Quit: Leaving)
2016-03-19 09:11:04 > towy71 (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has joined #linuxvoice
2016-03-19 09:19:54 Ioangogo Wow, the gates foundation is dobbeling sports relief fundrasing
2016-03-19 09:24:14 > brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has joined #linuxvoice
2016-03-19 09:24:37 mcphail Wow. The Tories are exploding. Shame this couldn't have happened a few days ago
2016-03-19 09:31:18 Ioangogo mcphail: ?
2016-03-19 09:31:22 Ioangogo Link
2016-03-19 09:32:04 mcphail Ioangogo: http://www.bbc.co.uk/news/uk-politics-35848891
2016-03-19 09:32:07 LVbot ^ In full: Iain Duncan Smith resignation letter BBC News
2016-03-19 09:32:19 Ioangogo Ohh
2016-03-19 09:33:04 mcphail Ioangogo: paras 5--7 in particular
2016-03-19 09:34:00 mcphail Can't see Osborne as leader now
2016-03-19 09:35:36 Ioangogo I can't see the Tories being voted in the next elections
2016-03-19 09:36:27 mcphail Ioangogo: they're certain to get back in. Labour are too divided, SNP rule scotland and Lib Dems haven't shown any sign of a comeback
2016-03-19 09:45:02 ChibaPet First paragraph of his letter is awesome. Let me paraphrase: "We've squeezed the poor to the benefit of big business, forcing substandard jobs on the desperate to increase the wealth of my keepers."
2016-03-19 09:46:28 ChibaPet Right-wing "incentive structures" start and end with "starvation".
2016-03-19 09:46:41 ChibaPet Going back to this test install. =twich=
2016-03-19 09:47:27 < asusk7m550 (~Thunderbi@2001:981:97b3:1:2c54:d7dc:ee71:ec36) has quit (Quit: asusk7m550)
2016-03-19 10:06:03 < Nitronium (~Dave@host213-1-15-155.range213-1.btcentralplus.com) has quit (Remote host closed the connection)
2016-03-19 10:09:49 < mavrix (~mavrix@unaffiliated/mavrix) has quit (Ping timeout: 260 seconds)
2016-03-19 10:12:28 > mavrix (~mavrix@unaffiliated/mavrix) has joined #linuxvoice
2016-03-19 10:20:03 ChibaPet Since I needed to look this up for someone else, might as well mention it here: https://tjaalton.wordpress.com/2016/03/11/no-catalystfglrx-video-driver-in-ubuntu-16-04/
2016-03-19 10:20:06 LVbot ^ No Catalyst/fglrx video driver in Ubuntu 16.04 Timo Aaltonen's Weblog
2016-03-19 10:30:10 ChibaPet The bit that was missing from the podcast was "There's going to be a hybrid solution in August for current fglrx users - wait until then to upgrade".
2016-03-19 10:33:37 < mavrix (~mavrix@unaffiliated/mavrix) has quit (Ping timeout: 240 seconds)
2016-03-19 10:35:01 > mavrix (~mavrix@unaffiliated/mavrix) has joined #linuxvoice
2016-03-19 10:37:27 < gamerchick02 (~gamerchic@c-68-36-7-43.hsd1.mi.comcast.net) has quit (Quit: Leaving)
2016-03-19 11:11:39 < LauRoman (~LauRoman@5-14-92-161.residential.rdsnet.ro) has quit (Read error: Connection reset by peer)
2016-03-19 11:21:45 < ryuslash (~slash@2a02:1812:2518:ce00:f24d:a2ff:fede:451c) has quit (Remote host closed the connection)
2016-03-19 11:38:55 > Extremulus (~Extremulu@2001:470:b:1fb:deaf::d259) has joined #linuxvoice
2016-03-19 11:42:44 Ioangogo http://turnoff.us/geek/dont-sigkill/
2016-03-19 11:42:46 LVbot ^ The Real Reason to Not Use SIGKILL
2016-03-19 12:16:35 Devilment That annoys me at work
2016-03-19 12:16:41 < mavrix (~mavrix@unaffiliated/mavrix) has quit (Ping timeout: 244 seconds)
2016-03-19 12:16:51 Devilment Me: Just kill off the process
2016-03-19 12:17:38 Devilment Person whose shoulder I'm standing over types 'kill -9'
2016-03-19 12:18:00 Devilment Me slaps person verbally
2016-03-19 12:19:12 Devilment Then there's the people whose muscle memory gets them to type 'ls -ltr' when they just want 'ls -l'
2016-03-19 12:19:25 Devilment Every. Single. Time.
2016-03-19 12:20:03 Devilment Then they ask how to get the long format in alphabetic order
2016-03-19 13:33:39 > zmoylan-1i (~pi@109.77.199.45) has joined #linuxvoice
2016-03-19 13:37:00 < zmoylan-pi (~pi@109.76.181.202) has quit (Ping timeout: 276 seconds)
2016-03-19 13:51:50 ChibaPet hah
2016-03-19 13:53:02 < chemist69 (~apl@2a02:560:41ab:c500:d1ea:1c03:d9aa:c73c) has quit (Ping timeout: 268 seconds)
2016-03-19 13:55:34 > AdamDBrown (~Thunderbi@205.003.dsl.wa.iprimus.net.au) has joined #linuxvoice
2016-03-19 14:03:49 < AdamDBrown (~Thunderbi@205.003.dsl.wa.iprimus.net.au) has quit (Quit: AdamDBrown)
2016-03-19 14:05:55 > chemist69 (~apl@2a02:560:41c0:e800:3d84:7d0f:4ca:883a) has joined #linuxvoice
2016-03-19 16:03:28 < zmoylan-1i (~pi@109.77.199.45) has quit (Ping timeout: 264 seconds)
2016-03-19 16:07:59 > zmoylan-pi (~pi@109.76.219.173) has joined #linuxvoice
2016-03-19 18:16:21 > LauRoman (~LauRoman@5-14-92-161.residential.rdsnet.ro) has joined #linuxvoice
2016-03-19 18:24:01 < Extremulus (~Extremulu@2001:470:b:1fb:deaf::d259) has quit (Remote host closed the connection)
2016-03-19 19:34:06 < g0nz085 (~gonzo@cpc81199-farn9-2-0-cust619.6-2.cable.virginm.net) has quit (Ping timeout: 248 seconds)
2016-03-19 19:35:08 > g0nz085 (~gonzo@cpc81199-farn9-2-0-cust619.6-2.cable.virginm.net) has joined #linuxvoice
2016-03-19 19:54:05 > Nitronium (~Dave@host213-1-15-155.range213-1.btcentralplus.com) has joined #linuxvoice
2016-03-19 20:55:20 > brucemuggins_ (~brucemint@95.41.233.220.static.exetel.com.au) has joined #linuxvoice
2016-03-19 20:59:30 < brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has quit (Ping timeout: 244 seconds)
2016-03-19 21:15:35 < Nitronium (~Dave@host213-1-15-155.range213-1.btcentralplus.com) has quit (Remote host closed the connection)
2016-03-19 21:26:05 > Nitronium (~Dave@host213-1-15-155.range213-1.btcentralplus.com) has joined #linuxvoice
2016-03-19 21:31:37 > ideasman42 (~cambo@203-206-123-225.dyn.iinet.net.au) has joined #linuxvoice
2016-03-19 22:59:48 - foxhunt_away is now known as foxhunt72
2016-03-19 23:06:59 > hammerron (~hammerron@96-32-57-238.dhcp.nwtn.ct.charter.com) has joined #linuxvoice
2016-03-19 23:38:24 > SuperEngineer (~SuperEngi@host86-172-108-164.range86-172.btcentralplus.com) has joined #linuxvoice
2016-03-19 23:43:15 < ideasman42 (~cambo@203-206-123-225.dyn.iinet.net.au) has quit (Quit: Ex-Chat)
2016-03-19 23:52:23 > ideasman42 (~cambo@203-206-123-225.dyn.iinet.net.au) has joined #linuxvoice
2016-03-19 23:58:20 < LauRoman (~LauRoman@5-14-92-161.residential.rdsnet.ro) has quit (Read error: Connection reset by peer)
2016-03-20 00:00:03 Ioangogo I should not use -9
2016-03-20 00:10:13 < brucemuggins_ (~brucemint@95.41.233.220.static.exetel.com.au) has quit (Quit: Konversation terminated!)
2016-03-20 00:23:30 > LauRoman (~LauRoman@5-14-46-12.residential.rdsnet.ro) has joined #linuxvoice
2016-03-20 00:24:40 SuperEngineer [try using +11-2 instead]
2016-03-20 00:24:54 SuperEngineer =(
2016-03-20 00:29:07 Ioangogo https://twitter.com/wikileaks/status/710884889797722112
2016-03-20 00:29:09 LVbot ^ WikiLeaks on Twitter: Dear Facebook: stop censoring our Hillary Clinton email release. No, really. Stop it. There is no technical excuse. https://t.co/AMbIUiPkid"
2016-03-20 00:41:56 < LargerMon (~Lager_Mon@213.221.204.54) has quit (Ping timeout: 248 seconds)
2016-03-20 00:48:55 > LargerMon (~Lager_Mon@213.221.204.54) has joined #linuxvoice
2016-03-20 00:52:55 - foxhunt72 is now known as foxhunt_away
2016-03-20 01:47:20 < SuperEngineer (~SuperEngi@host86-172-108-164.range86-172.btcentralplus.com) has quit (Remote host closed the connection)
2016-03-20 01:51:49 < topcyde (~topcyde@2602:304:cdb8:9e40:8180:deb2:26af:ea78) has quit (Quit: Leaving)
2016-03-20 02:48:46 < chemist69 (~apl@2a02:560:41c0:e800:3d84:7d0f:4ca:883a) has quit (Ping timeout: 248 seconds)
2016-03-20 02:49:28 < opi (~opi@2001:41d0:52:800::49e) has quit (Quit: ZNC - http://znc.in)
2016-03-20 02:50:08 > opi (~opi@2001:41d0:52:800::49e) has joined #linuxvoice
2016-03-20 03:04:08 > chemist69 (~apl@a89-182-107-110.net-htp.de) has joined #linuxvoice
2016-03-20 03:13:53 > mnavrati (~milan@ip-94-113-220-233.net.upcbroadband.cz) has joined #linuxvoice
2016-03-20 03:19:30 - foxhunt_away is now known as foxhunt72
2016-03-20 04:07:11 mcphail It will be my Ubuntu phone's birthday this week. I have been android-free for 360 days!
2016-03-20 04:13:30 - foxhunt72 is now known as foxhunt_away
2016-03-20 04:18:04 < ideasman42 (~cambo@203-206-123-225.dyn.iinet.net.au) has quit (Quit: Ex-Chat)
2016-03-20 04:28:03 > Extremulus (~Extremulu@2001:470:b:1fb:deaf::d259) has joined #linuxvoice
2016-03-20 04:48:55 < mnavrati (~milan@ip-94-113-220-233.net.upcbroadband.cz) has quit (Quit: Leaving)
2016-03-20 04:50:44 < hamgammon (~hamgammon@188.226.144.192) has quit (Quit: So long and thanks for all the fish!)
2016-03-20 05:03:29 Ioangogo Writing a letter to a community farm about their wifi channel choice
2016-03-20 05:08:56 Extremulus Seems like a good use of time
2016-03-20 05:22:08 < vertreko (~vertreko@172-4-34-97.lightspeed.sndgca.sbcglobal.net) has quit (Quit: WeeChat 1.3)
2016-03-20 05:23:37 > traceyc (~traceyc@c-98-194-48-190.hsd1.tx.comcast.net) has joined #linuxvoice
2016-03-20 05:57:22 ChibaPet mcphail: I've been off Android for longer! =hugs his BlackBerry=
2016-03-20 05:57:32 ChibaPet That said, I might give up and go back sometime.
2016-03-20 05:57:46 ChibaPet There are a couple work apps that work poorly in emulation.
2016-03-20 06:01:43 > vertreko (~vertreko@172-4-34-97.lightspeed.sndgca.sbcglobal.net) has joined #linuxvoice
2016-03-20 06:38:48 > asusk7m550 (~Thunderbi@2001:981:97b3:1:e9af:7cc7:95b2:e562) has joined #linuxvoice
2016-03-20 06:41:02 < asusk7m550 (~Thunderbi@2001:981:97b3:1:e9af:7cc7:95b2:e562) has quit (Client Quit)
2016-03-20 06:41:16 > asusk7m550 (~Thunderbi@2001:981:97b3:1:e9af:7cc7:95b2:e562) has joined #linuxvoice
2016-03-20 06:42:03 mcphail ChibaPet: yes - will be interesting to see if I go another year ;)
2016-03-20 06:42:55 ChibaPet I'd love a phone OS where I can log in and have administrative access / fine-grained updates without having to go through some dodgy rooting process and voiding my warranty.
2016-03-20 06:43:54 zmoylan-pi your best bet is a rasp pi running on a battery connected to a 7" screen. connecting via wifi to a mobile ap for mobile data...
2016-03-20 06:44:07 ChibaPet :P
2016-03-20 06:44:19 zmoylan-pi it's not like we make voice calls anymore...
2016-03-20 06:47:07 zmoylan-pi and it means only open source code is running on the rasp pi (mostly) compared to the black box that is code on a modern mobile os
2016-03-20 07:00:57 < asusk7m550 (~Thunderbi@2001:981:97b3:1:e9af:7cc7:95b2:e562) has quit (Remote host closed the connection)
2016-03-20 07:01:11 > asusk7m550 (~Thunderbi@2001:981:97b3:1:e9af:7cc7:95b2:e562) has joined #linuxvoice
2016-03-20 07:05:03 < asusk7m550 (~Thunderbi@2001:981:97b3:1:e9af:7cc7:95b2:e562) has quit (Client Quit)
2016-03-20 07:05:16 > asusk7m550 (~Thunderbi@2001:981:97b3:1:e9af:7cc7:95b2:e562) has joined #linuxvoice
2016-03-20 07:05:28 < asusk7m550 (~Thunderbi@2001:981:97b3:1:e9af:7cc7:95b2:e562) has quit (Client Quit)
2016-03-20 07:05:35 - foxhunt_away is now known as foxhunt72
2016-03-20 07:05:43 > asusk7m550 (~Thunderbi@2001:981:97b3:1:e9af:7cc7:95b2:e562) has joined #linuxvoice
2016-03-20 07:05:47 < asusk7m550 (~Thunderbi@2001:981:97b3:1:e9af:7cc7:95b2:e562) has quit (Client Quit)
2016-03-20 07:06:00 > asusk7m550 (~Thunderbi@2001:981:97b3:1:e9af:7cc7:95b2:e562) has joined #linuxvoice
2016-03-20 08:47:57 < CPrompt^ (~CPrompt^@cpe-45-36-163-153.triad.res.rr.com) has quit (Remote host closed the connection)
2016-03-20 08:49:12 > CPrompt^ (~CPrompt^@cpe-45-36-163-153.triad.res.rr.com) has joined #linuxvoice
2016-03-20 09:02:35 < asusk7m550 (~Thunderbi@2001:981:97b3:1:e9af:7cc7:95b2:e562) has quit (Quit: asusk7m550)
2016-03-20 09:29:27 > hamgammon (~hamgammon@46.101.181.55) has joined #linuxvoice
2016-03-20 09:35:12 < hamgammon (~hamgammon@46.101.181.55) has quit (Quit: So long and thanks for all the fish!)
2016-03-20 09:36:05 > hamgammon (~hamgammon@46.101.181.55) has joined #linuxvoice
2016-03-20 09:50:55 > swift110 (~swift110@c-50-190-75-64.hsd1.md.comcast.net) has joined #linuxvoice
2016-03-20 09:52:21 < swift110 (~swift110@c-50-190-75-64.hsd1.md.comcast.net) has quit (Changing host)
2016-03-20 09:52:21 > swift110 (~swift110@unaffiliated/swift110) has joined #linuxvoice
2016-03-20 10:05:40 < hamgammon (~hamgammon@46.101.181.55) has quit (Quit: So long and thanks for all the fish!)
2016-03-20 10:06:22 > hamgammon (~hamgammon@46.101.181.55) has joined #linuxvoice
2016-03-20 10:22:05 > draake (~h4ckm3@c-68-52-45-79.hsd1.tn.comcast.net) has joined #linuxvoice
2016-03-20 10:22:34 < draake (~h4ckm3@c-68-52-45-79.hsd1.tn.comcast.net) has quit (Client Quit)
2016-03-20 10:45:04 < traceyc (~traceyc@c-98-194-48-190.hsd1.tx.comcast.net) has quit (Quit: I'm off)
2016-03-20 10:52:18 > zeldovich (~matthew@cpc4-pmth11-2-0-cust783.6-1.cable.virginm.net) has joined #linuxvoice
2016-03-20 11:04:21 < Nitronium (~Dave@host213-1-15-155.range213-1.btcentralplus.com) has quit (Remote host closed the connection)
2016-03-20 11:09:18 < zeldovich (~matthew@cpc4-pmth11-2-0-cust783.6-1.cable.virginm.net) has quit (Quit: zeldovich)
2016-03-20 11:26:44 < Extremulus (~Extremulu@2001:470:b:1fb:deaf::d259) has quit (Remote host closed the connection)
2016-03-20 11:28:40 < LauRoman (~LauRoman@5-14-46-12.residential.rdsnet.ro) has quit (Read error: Connection reset by peer)
2016-03-20 11:31:09 > towy71_ (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has joined #linuxvoice
2016-03-20 11:34:18 < towy71 (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has quit (Ping timeout: 246 seconds)
2016-03-20 11:38:00 - foxhunt72 is now known as foxhunt_away
2016-03-20 11:40:24 < swift110 (~swift110@unaffiliated/swift110) has quit (Ping timeout: 276 seconds)
2016-03-20 11:54:56 < Arthur_D (~bouncer@supertuxkart/tester/Arthur) has quit (Remote host closed the connection)
2016-03-20 11:57:32 > Arthur_D (~bouncer@pspodcasting.net) has joined #linuxvoice
2016-03-20 13:52:48 > chemist69_ (~apl@a89-182-117-112.net-htp.de) has joined #linuxvoice
2016-03-20 13:56:16 < chemist69 (~apl@a89-182-107-110.net-htp.de) has quit (Ping timeout: 264 seconds)
2016-03-20 14:00:45 > zmoylan-1i (~pi@109.79.33.214) has joined #linuxvoice
2016-03-20 14:03:55 < zmoylan-pi (~pi@109.76.219.173) has quit (Ping timeout: 252 seconds)
2016-03-20 14:27:56 > swift110-phone (~swift110-@unaffiliated/swift110) has joined #linuxvoice
2016-03-20 14:27:58 swift110-phone Hey
2016-03-20 14:35:07 < hammerron (~hammerron@96-32-57-238.dhcp.nwtn.ct.charter.com) has quit (Ping timeout: 260 seconds)
2016-03-20 15:30:43 < swift110-phone (~swift110-@unaffiliated/swift110) has quit (Read error: Connection reset by peer)
2016-03-20 15:56:51 > swift110-phone (~swift110-@unaffiliated/swift110) has joined #linuxvoice
2016-03-20 15:57:31 swift110-phone Hey
2016-03-20 16:03:55 < zmoylan-1i (~pi@109.79.33.214) has quit (Ping timeout: 244 seconds)
2016-03-20 16:08:05 > zmoylan-pi (~pi@109.77.97.68) has joined #linuxvoice
2016-03-20 16:30:37 > brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has joined #linuxvoice
2016-03-20 16:42:52 < _hanhart (~hanhart@static.101.25.4.46.clients.your-server.de) has quit (Remote host closed the connection)
2016-03-20 16:49:51 > Extremulus (~Extremulu@2001:470:b:1fb:deaf::d259) has joined #linuxvoice
2016-03-20 17:20:26 > pdq_ (~pdq@p20030045431A2F00B551E1405A6DDB1C.dip0.t-ipconnect.de) has joined #linuxvoice
2016-03-20 18:01:11 < Extremulus (~Extremulu@2001:470:b:1fb:deaf::d259) has quit (Remote host closed the connection)
2016-03-20 18:34:54 > LauRoman (~LauRoman@5-14-46-12.residential.rdsnet.ro) has joined #linuxvoice
2016-03-20 19:14:41 > LauRoman|Alt (~LauRoman@5-14-154-214.residential.rdsnet.ro) has joined #linuxvoice
2016-03-20 19:14:51 < LauRoman (~LauRoman@5-14-46-12.residential.rdsnet.ro) has quit (Ping timeout: 268 seconds)
2016-03-20 19:16:02 > SuperEngineer (~SuperEngi@host86-172-108-164.range86-172.btcentralplus.com) has joined #linuxvoice
2016-03-20 19:29:04 > standen (~joe@123.51.56.48) has joined #linuxvoice
2016-03-20 19:30:16 < standen (~joe@123.51.56.48) has quit (Client Quit)
2016-03-20 19:41:52 > standen (~joe@123.51.56.48) has joined #linuxvoice
2016-03-20 19:43:46 < standen (~joe@123.51.56.48) has quit (Quit: Leaving)
2016-03-20 20:42:36 > Nitronium (~Dave@host213-1-15-155.range213-1.btcentralplus.com) has joined #linuxvoice
2016-03-20 21:11:26 < brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has quit (Quit: Konversation terminated!)
2016-03-20 21:17:58 > ideasman42 (~cambo@203-206-123-225.dyn.iinet.net.au) has joined #linuxvoice
2016-03-20 21:21:45 - foxhunt_away is now known as foxhunt72
2016-03-20 21:31:35 < chemist69_ (~apl@a89-182-117-112.net-htp.de) has quit (Quit: WeeChat 1.4)
2016-03-20 21:42:18 > chemist69 (~apl@a89-182-117-112.net-htp.de) has joined #linuxvoice
2016-03-20 22:06:06 < opi (~opi@2001:41d0:52:800::49e) has quit (Quit: ZNC - http://znc.in)
2016-03-20 22:06:48 > opi (~opi@2001:41d0:52:800::49e) has joined #linuxvoice
2016-03-20 22:14:39 < opi (~opi@2001:41d0:52:800::49e) has quit (Quit: ZNC - http://znc.in)
2016-03-20 22:15:20 > opi (~opi@2001:41d0:52:800::49e) has joined #linuxvoice
2016-03-20 22:39:20 < opi (~opi@2001:41d0:52:800::49e) has quit (Quit: ZNC - http://znc.in)
2016-03-20 22:40:00 > opi (~opi@2001:41d0:52:800::49e) has joined #linuxvoice
2016-03-20 23:09:12 < ideasman42 (~cambo@203-206-123-225.dyn.iinet.net.au) has quit (Quit: Ex-Chat)
2016-03-20 23:09:32 > ideasman42 (~cambo@203-206-123-225.dyn.iinet.net.au) has joined #linuxvoice
2016-03-20 23:29:19 < Nitronium (~Dave@host213-1-15-155.range213-1.btcentralplus.com) has quit (Remote host closed the connection)
2016-03-20 23:32:04 > Nitronium (~Dave@host213-1-15-155.range213-1.btcentralplus.com) has joined #linuxvoice
2016-03-21 00:02:59 < SuperEngineer (~SuperEngi@host86-172-108-164.range86-172.btcentralplus.com) has quit (Quit: bfn...my planet needs me back)
2016-03-21 00:22:26 < Nitronium (~Dave@host213-1-15-155.range213-1.btcentralplus.com) has quit (Remote host closed the connection)
2016-03-21 00:29:07 > metasansana (~metasansa@unaffiliated/metasansana) has joined #linuxvoice
2016-03-21 00:36:07 - foxhunt72 is now known as foxhunt_away
2016-03-21 00:51:44 > Nitronium (~Dave@host213-1-15-155.range213-1.btcentralplus.com) has joined #linuxvoice
2016-03-21 00:54:27 < LauRoman|Alt (~LauRoman@5-14-154-214.residential.rdsnet.ro) has quit (Quit: Leaving)
2016-03-21 01:01:11 < ideasman42 (~cambo@203-206-123-225.dyn.iinet.net.au) has quit (Quit: Ex-Chat)
2016-03-21 01:02:02 > LauRoman (~LauRoman@5-14-154-214.residential.rdsnet.ro) has joined #linuxvoice
2016-03-21 01:21:52 < Nitronium (~Dave@host213-1-15-155.range213-1.btcentralplus.com) has quit (Remote host closed the connection)
2016-03-21 01:24:48 < CPrompt^ (~CPrompt^@cpe-45-36-163-153.triad.res.rr.com) has quit (Quit: leaving)
2016-03-21 01:25:12 > CPrompt^ (~CPrompt^@cpe-45-36-163-153.triad.res.rr.com) has joined #linuxvoice
2016-03-21 02:24:35 < CPrompt^ (~CPrompt^@cpe-45-36-163-153.triad.res.rr.com) has quit (Quit: leaving)
2016-03-21 02:30:11 > CPrompt^ (~CPrompt^@cpe-45-36-163-153.triad.res.rr.com) has joined #linuxvoice
2016-03-21 02:37:16 > ryuslash (~slash@2a02:1812:2518:ce00:f24d:a2ff:fede:451c) has joined #linuxvoice
2016-03-21 02:42:10 < chemist69 (~apl@a89-182-117-112.net-htp.de) has quit (Quit: WeeChat 1.4)
2016-03-21 02:46:06 > chemist69 (~apl@2a02:560:41e1:1900:546b:3c36:cbc0:38c7) has joined #linuxvoice
2016-03-21 02:55:04 < CPrompt^ (~CPrompt^@cpe-45-36-163-153.triad.res.rr.com) has quit (Quit: leaving)
2016-03-21 03:09:54 > Paddy_NI (~patrick@104.238.169.38) has joined #linuxvoice
2016-03-21 03:13:08 > CPrompt^ (~CPrompt^@cpe-45-36-163-153.triad.res.rr.com) has joined #linuxvoice
2016-03-21 03:20:37 > Nitronium (~Dave@host213-1-15-155.range213-1.btcentralplus.com) has joined #linuxvoice
2016-03-21 03:24:25 < swift110-phone (~swift110-@unaffiliated/swift110) has quit (Ping timeout: 244 seconds)
2016-03-21 03:25:59 < CPrompt^ (~CPrompt^@cpe-45-36-163-153.triad.res.rr.com) has quit (Quit: Lost terminal)
2016-03-21 04:15:10 > CPrompt^ (~CPrompt^@cpe-45-36-163-153.triad.res.rr.com) has joined #linuxvoice
2016-03-21 04:17:54 > Extremulus (~Extremulu@2001:470:b:1fb:deaf::d259) has joined #linuxvoice
2016-03-21 04:34:10 Devilment Well, I spent a couple of hours rearranging my hi-fi/media stand
2016-03-21 04:34:29 Devilment Using cable clips and whatnot to neaten up the cables
2016-03-21 04:34:56 Devilment Yet in 6 months time they will have mysteriously tangled themselves into a rat's nest
2016-03-21 04:36:25 < Paddy_NI (~patrick@104.238.169.38) has quit (Quit: Konversation terminated!)
2016-03-21 04:56:13 Extremulus If you ever solve this problem please CC license it. The world needs to eliminate dust bunny habitat
2016-03-21 04:58:27 Ioangogo <popey> I discovered this week that if you run your system with no swap, and memory pressure gets too much, kswapd will eat your cpu alive as it tries to “swap” and make your computer completely unusable! :)
2016-03-21 04:58:34 Ioangogo Oops
2016-03-21 04:58:36 Ioangogo https://www.youtube.com/watch?v=IANBoybVApQ
2016-03-21 04:58:38 LVbot ^ Mind-Blowing Magic Magnets Smarter Every Day 153 YouTube
2016-03-21 05:01:22 - foxhunt_away is now known as foxhunt72
2016-03-21 06:20:33 > swift110 (~swift110@23.30.27.229) has joined #linuxvoice
2016-03-21 06:49:14 > hammerron (~hammerron@96-32-57-238.dhcp.nwtn.ct.charter.com) has joined #linuxvoice
2016-03-21 06:51:52 < hammerron (~hammerron@96-32-57-238.dhcp.nwtn.ct.charter.com) has quit (Client Quit)
2016-03-21 06:57:41 > M1C4HTRON13 (~micah@bodhilinux/team/M1C4HTRON13) has joined #linuxvoice
2016-03-21 06:57:59 < swift110 (~swift110@23.30.27.229) has quit (Changing host)
2016-03-21 06:57:59 > swift110 (~swift110@unaffiliated/swift110) has joined #linuxvoice
2016-03-21 07:15:57 - irc: disconnected from server
2016-03-21 07:55:35 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-03-21 07:55:35 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-03-21 07:55:35 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-03-21 07:55:35 - Channel #linuxvoice: 67 nicks (1 op, 0 voices, 66 normals)
2016-03-21 07:55:45 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-03-21 07:56:27 > hammerron (~hammerron@96-32-57-238.dhcp.nwtn.ct.charter.com) has joined #linuxvoice
2016-03-21 08:07:55 > jherrmann (~jirkah@ip4-83-240-20-19.cust.nbox.cz) has joined #linuxvoice
2016-03-21 08:10:56 < hammerron (~hammerron@96-32-57-238.dhcp.nwtn.ct.charter.com) has quit (Quit: Leaving)
2016-03-21 08:27:31 < jherrmann (~jirkah@ip4-83-240-20-19.cust.nbox.cz) has quit (Remote host closed the connection)
2016-03-21 08:33:57 < M1C4HTRON13 (~micah@bodhilinux/team/M1C4HTRON13) has quit (Ping timeout: 246 seconds)
2016-03-21 08:44:16 > ryuslash (~slash@2a02:1812:2518:ce00:f24d:a2ff:fede:451c) has joined #linuxvoice
2016-03-21 09:21:33 < Nitronium (~Dave@host213-1-15-155.range213-1.btcentralplus.com) has quit (Remote host closed the connection)
2016-03-21 09:28:43 Ioangogo Why do all australian actors start in home and away or neighbours, They all seem to come from the programs
2016-03-21 09:30:02 zmoylan-pi probably a testing ground to see if their accents pass international muster...
2016-03-21 09:33:53 > M1C4HTRON13 (~micah@84.203.64.47) has joined #linuxvoice
2016-03-21 09:33:53 < M1C4HTRON13 (~micah@84.203.64.47) has quit (Changing host)
2016-03-21 09:33:53 > M1C4HTRON13 (~micah@bodhilinux/team/M1C4HTRON13) has joined #linuxvoice
2016-03-21 09:34:57 > trilby (0543196c@gateway/web/freenode/ip.5.67.25.108) has joined #linuxvoice
2016-03-21 09:37:46 < trilby (0543196c@gateway/web/freenode/ip.5.67.25.108) has quit (Client Quit)
2016-03-21 09:40:10 > mtweedie (~Mark@0543196c.skybroadband.com) has joined #linuxvoice
2016-03-21 09:49:28 < mtweedie (~Mark@0543196c.skybroadband.com) has quit (Quit: Leaving)
2016-03-21 09:55:57 < swift110 (~swift110@unaffiliated/swift110) has quit (Ping timeout: 260 seconds)
2016-03-21 09:56:15 > mtweedie (~Mark@0543196c.skybroadband.com) has joined #linuxvoice
2016-03-21 09:56:40 < mtweedie (~Mark@0543196c.skybroadband.com) has quit (Client Quit)
2016-03-21 09:56:59 - foxhunt72 is now known as foxhunt_away
2016-03-21 09:57:01 > trilby (~Mark@0543196c.skybroadband.com) has joined #linuxvoice
2016-03-21 09:58:39 < trilby (~Mark@0543196c.skybroadband.com) has quit (Client Quit)
2016-03-21 10:03:38 fs0ciety Ioangogo: Coming from AU - there are a lot of AU actors that dont start in AU soap operas
2016-03-21 10:03:48 fs0ciety Ioangogo: Hugo Weaving, Cate Blanchett for example
2016-03-21 10:04:02 fs0ciety Ioangogo: Eric Bana is another
2016-03-21 10:06:01 < exoplanet (~exoplanet@unaffiliated/exoplanet) has quit (Ping timeout: 250 seconds)
2016-03-21 10:11:26 > exoplanet (~exoplanet@unaffiliated/exoplanet) has joined #linuxvoice
2016-03-21 10:11:36 < ryuslash (~slash@2a02:1812:2518:ce00:f24d:a2ff:fede:451c) has quit (Ping timeout: 246 seconds)
2016-03-21 10:22:49 < M1C4HTRON13 (~micah@bodhilinux/team/M1C4HTRON13) has quit (Remote host closed the connection)
2016-03-21 10:23:52 < ChibaPet (~hiphiphip@unaffiliated/chibapet) has left #linuxvoice
2016-03-21 10:31:41 > ryuslash (~slash@2a02:1812:2518:ce00:f24d:a2ff:fede:451c) has joined #linuxvoice
2016-03-21 11:16:11 < ryuslash (~slash@2a02:1812:2518:ce00:f24d:a2ff:fede:451c) has quit (Remote host closed the connection)
2016-03-21 12:28:41 < Extremulus (~Extremulu@2001:470:b:1fb:deaf::d259) has quit (Remote host closed the connection)
2016-03-21 13:25:44 < opi (~opi@2001:41d0:52:800::49e) has quit (Quit: ZNC - http://znc.in)
2016-03-21 13:26:24 > opi (~opi@2001:41d0:52:800::49e) has joined #linuxvoice
2016-03-21 13:45:40 > Extremulus (~Extremulu@2001:470:b:1fb:deaf::d259) has joined #linuxvoice
2016-03-21 13:54:23 < chemist69 (~apl@2a02:560:41e1:1900:546b:3c36:cbc0:38c7) has quit (Ping timeout: 250 seconds)
2016-03-21 14:05:58 > zmoylan-1i (~pi@109.77.16.65) has joined #linuxvoice
2016-03-21 14:07:47 > chemist69 (~apl@2a02:560:41ff:5200:7dd3:fad2:ddfd:3c6a) has joined #linuxvoice
2016-03-21 14:08:51 < zmoylan-pi (~pi@109.77.97.68) has quit (Ping timeout: 248 seconds)
2016-03-21 14:46:28 < LauRoman (~LauRoman@5-14-154-214.residential.rdsnet.ro) has quit (Read error: Connection reset by peer)
2016-03-21 15:42:23 > swift110-phone (~swift110-@unaffiliated/swift110) has joined #linuxvoice
2016-03-21 15:42:25 swift110-phone Hey
2016-03-21 16:01:13 > zmoylan-pi (~pi@109.79.141.47) has joined #linuxvoice
2016-03-21 16:04:23 < zmoylan-1i (~pi@109.77.16.65) has quit (Ping timeout: 250 seconds)
2016-03-21 16:21:11 > _hanhart (~hanhart@static.101.25.4.46.clients.your-server.de) has joined #linuxvoice
2016-03-21 17:45:00 < _hanhart (~hanhart@static.101.25.4.46.clients.your-server.de) has quit (Remote host closed the connection)
2016-03-21 17:57:00 > _hanhart (~hanhart@static.101.25.4.46.clients.your-server.de) has joined #linuxvoice
2016-03-21 17:57:11 > LauRoman (~LauRoman@5-14-154-214.residential.rdsnet.ro) has joined #linuxvoice
2016-03-21 17:58:03 > ideasman42 (~cambo@203-206-123-225.dyn.iinet.net.au) has joined #linuxvoice
2016-03-21 18:27:26 < bdmc (bdmc@cl-745.bos-01.us.sixxs.net) has quit (Ping timeout: 248 seconds)
2016-03-21 18:29:14 > bdmc (bdmc@cl-745.bos-01.us.sixxs.net) has joined #linuxvoice
2016-03-21 19:06:45 - foxhunt_away is now known as foxhunt72
2016-03-21 19:09:47 > ryuslash (~slash@2a02:1812:2518:ce00:f24d:a2ff:fede:451c) has joined #linuxvoice
2016-03-21 19:16:20 > TwistedLucidity (~TwistedLu@cpc80671-stap13-2-0-cust118.12-2.cable.virginm.net) has joined #linuxvoice
2016-03-21 19:51:53 < bdmc (bdmc@cl-745.bos-01.us.sixxs.net) has quit (Ping timeout: 250 seconds)
2016-03-21 19:53:51 < ideasman42 (~cambo@203-206-123-225.dyn.iinet.net.au) has quit (Quit: Ex-Chat)
2016-03-21 19:58:24 > bdmc (bdmc@cl-745.bos-01.us.sixxs.net) has joined #linuxvoice
2016-03-21 20:07:59 > arubislander (~ArubIslan@86.93.93.218) has joined #linuxvoice
2016-03-21 20:12:24 > brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has joined #linuxvoice
2016-03-21 20:15:11 > jherrmann (jirkah@nat/redhat/x-oxhojjtvabypehiz) has joined #linuxvoice
2016-03-21 20:27:37 > towy71 (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has joined #linuxvoice
2016-03-21 20:30:01 < towy71_ (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has quit (Ping timeout: 250 seconds)
2016-03-21 20:39:42 > mavrix (~mavrix@unaffiliated/mavrix) has joined #linuxvoice
2016-03-21 20:47:08 < brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has quit (Quit: Konversation terminated!)
2016-03-21 20:47:57 > Burghmuir (~Burghmuir@cpc70577-croy22-2-0-cust178.19-2.cable.virginm.net) has joined #linuxvoice
2016-03-21 20:48:23 < Burghmuir (~Burghmuir@cpc70577-croy22-2-0-cust178.19-2.cable.virginm.net) has quit (Client Quit)
2016-03-21 20:48:41 > Burghmuir (~Burghmuir@cpc70577-croy22-2-0-cust178.19-2.cable.virginm.net) has joined #linuxvoice
2016-03-21 20:53:17 < arubislander (~ArubIslan@86.93.93.218) has quit (Quit: Leaving.)
2016-03-21 20:54:32 > arubislander (~ArubIslan@86.93.93.218) has joined #linuxvoice
2016-03-21 20:56:18 < arubislander (~ArubIslan@86.93.93.218) has quit (Remote host closed the connection)
2016-03-21 20:57:50 > arubislander (~ArubIslan@86.93.93.218) has joined #linuxvoice
2016-03-21 20:59:56 > arubislander1 (~ArubIslan@86.93.93.218) has joined #linuxvoice
2016-03-21 20:59:56 < arubislander (~ArubIslan@86.93.93.218) has quit (Read error: Connection reset by peer)
2016-03-21 21:01:10 < arubislander1 (~ArubIslan@86.93.93.218) has quit (Remote host closed the connection)
2016-03-21 21:07:46 > arubislander (~ArubIslan@86.93.93.218) has joined #linuxvoice
2016-03-21 21:16:24 > ideasman42 (~cambo@203-206-123-225.dyn.iinet.net.au) has joined #linuxvoice
2016-03-21 21:21:29 Devilment Damn, I'm tired this morning
2016-03-21 21:25:24 > towy71_ (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has joined #linuxvoice
2016-03-21 21:27:47 < towy71 (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has quit (Ping timeout: 248 seconds)
2016-03-21 21:39:10 james_olympus Funny, I was just thinking the same
2016-03-21 21:40:08 zmoylan-pi it's a monday. a day scientifically designed to crush your spirit
2016-03-21 21:41:04 james_olympus Yes. Mondays are never very productive
2016-03-21 21:50:45 Devilment I always give 100% on Mondays
2016-03-21 21:50:57 Devilment 50% in the morning and 50% in the afternoon
2016-03-21 21:56:55 zmoylan-pi leaving time of course for tea/coffee with a good biccie...
2016-03-21 21:58:27 < jherrmann (jirkah@nat/redhat/x-oxhojjtvabypehiz) has quit (Quit: Toodle pip!)
2016-03-21 22:00:50 > jherrmann (jirkah@nat/redhat/x-gkmfsluplmsbeawz) has joined #linuxvoice
2016-03-21 22:19:04 > CopyLion (~copylion@pool-64-222-228-144.port.east.myfairpoint.net) has joined #linuxvoice
2016-03-21 22:25:16 > evilnickveitch (~evilnick@cpc83321-bath6-2-0-cust252.18-1.cable.virginm.net) has joined #linuxvoice
2016-03-21 22:30:47 * zmoylan-pi cracks open the gingernuts now that the great gingernut shortage of 2016 is over...
2016-03-21 22:33:05 > mnavrati (milan@nat/redhat/x-bgddjgnusvcowaxb) has joined #linuxvoice
2016-03-21 22:53:32 < jherrmann (jirkah@nat/redhat/x-gkmfsluplmsbeawz) has quit (Ping timeout: 260 seconds)
2016-03-21 22:59:13 > AdamDBrown (~Thunderbi@6.117-240-116.dynamic.dsl.pth.iprimus.net.au) has joined #linuxvoice
2016-03-21 23:00:23 Ioangogo http://www.theregister.co.uk/2016/03/21/zero_day_apple_grapple_dredges_imessage_photos_videos_in_ios_9 oh good, the FBI can shut up now
2016-03-21 23:00:25 LVbot ^ iOS zero-day can decrypt iMessages, access iThing photos The Register
2016-03-21 23:01:28 zmoylan-pi so more celeb nekkid pics to come?
2016-03-21 23:02:46 swift110-phone Lol
2016-03-21 23:03:33 zmoylan-pi now we bet on the ugliest male celeb who's pics make it to front of daily mail...
2016-03-21 23:04:29 Ioangogo http://www.bbc.co.uk/news/technology-35860814
2016-03-21 23:04:30 LVbot ^ Powa: The start-up that fell to earth BBC News
2016-03-21 23:05:37 > TraceyC (~TraceyC@2620:0:28a2:4020:d441:95d0:3b4f:9c1c) has joined #linuxvoice
2016-03-21 23:05:59 > jherrmann (jirkah@nat/redhat/x-wxdwiovlglmcyzga) has joined #linuxvoice
2016-03-21 23:45:34 > M1C4HTRON13 (~micah@bodhilinux/team/M1C4HTRON13) has joined #linuxvoice
2016-03-21 23:51:24 < M1C4HTRON13 (~micah@bodhilinux/team/M1C4HTRON13) has quit (Quit: Leaving)
2016-03-21 23:55:05 > M1C4HTRON13 (~micah@bodhilinux/team/M1C4HTRON13) has joined #linuxvoice
2016-03-22 00:14:53 - foxhunt72 is now known as foxhunt_away
2016-03-22 00:35:36 < towy71_ (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has quit (Ping timeout: 276 seconds)
2016-03-22 01:02:02 < metasansana (~metasansa@unaffiliated/metasansana) has quit (Quit: Leaving)
2016-03-22 01:04:38 < AdamDBrown (~Thunderbi@6.117-240-116.dynamic.dsl.pth.iprimus.net.au) has quit (Quit: AdamDBrown)
2016-03-22 01:16:40 - foxhunt_away is now known as foxhunt72
2016-03-22 01:17:27 < swift110-phone (~swift110-@unaffiliated/swift110) has quit (Read error: Connection reset by peer)
2016-03-22 01:22:30 > swift110-phone (~swift110-@unaffiliated/swift110) has joined #linuxvoice
2016-03-22 01:34:52 Devilment zmoylan-pi: I am partial to a ginger nut
2016-03-22 01:39:27 TraceyC <- is a ginger nut
2016-03-22 01:56:24 Devilment NOOOOO!
2016-03-22 01:57:20 * Devilment has a thing for redheads
2016-03-22 02:02:31 zmoylan-pi come to ireland. we have shedloads of them... biccies and redheads...
2016-03-22 02:10:06 TraceyC I seriously got asked for directions both in England and Ireland
2016-03-22 02:10:16 TraceyC I had to admit "I have no idea, I'm just a tourist from America"
2016-03-22 02:12:10 zmoylan-pi the correct phrase in irish is 'ní higum mé on chest' to cause maximum confusion... 'i don't understand the question'
2016-03-22 02:12:51 zmoylan-pi it's one of 2-3 phrases i learned after 12 years of irish in school. that and 'can i go to the toilet please'...
2016-03-22 02:13:30 TraceyC Well, as long as you learned the important ones
2016-03-22 02:14:16 zmoylan-pi it's funniest when you hear bill bailey say it in black books after they stagger into an airport and they don't know were they are...
2016-03-22 02:15:13 < writtenoff (~writtenof@d172-218-204-26.bchsia.telus.net) has quit (Quit: WeeChat 1.3)
2016-03-22 02:18:23 < arubislander (~ArubIslan@86.93.93.218) has quit (Remote host closed the connection)
2016-03-22 02:18:54 swift110-phone Too much rain
2016-03-22 02:23:35 > arubislander (~ArubIslan@86.93.93.218) has joined #linuxvoice
2016-03-22 02:25:21 Devilment Black Books was a fantastic show
2016-03-22 02:25:42 Devilment Some of the out-takes on the DVD are brilliant
2016-03-22 02:25:55 Devilment "This is my roof... and I like it!"
2016-03-22 02:30:45 zmoylan-pi https://img.buzzfeed.com/buzzfeed-static/static/2014-09/18/6/enhanced/webdr11/longform-original-7271-1411035816-29.png
2016-03-22 02:38:43 < swift110-phone (~swift110-@unaffiliated/swift110) has quit (Ping timeout: 248 seconds)
2016-03-22 02:39:19 < Burghmuir (~Burghmuir@cpc70577-croy22-2-0-cust178.19-2.cable.virginm.net) has left #linuxvoice
2016-03-22 02:40:15 Devilment BTW, I like today's XKCD
2016-03-22 02:40:36 Devilment I keep a set of gaming dice on my desk for estimate purposes
2016-03-22 02:41:28 Devilment "Oooo, natural 1. Project has failed already."
2016-03-22 02:42:03 TraceyC lol
2016-03-22 02:42:44 TraceyC <3 living with a gaming nerd. When he goes to get a glass from the cupboard & accidentally whacks his hand on the counter
2016-03-22 02:42:53 TraceyC "The GM asked you to make a dex check and you rolled a one"
2016-03-22 02:44:37 zmoylan-pi just wait till you step on a d4 at 3am...
2016-03-22 02:45:17 zmoylan-pi THEN you test your dex...
2016-03-22 02:45:30 zmoylan-pi and acrobatics
2016-03-22 02:45:35 > swift110-phone (~swift110-@unaffiliated/swift110) has joined #linuxvoice
2016-03-22 02:46:10 TraceyC and ability to keep quiet lest you wake up everyone in the house
2016-03-22 02:46:28 zmoylan-pi that's stealth
2016-03-22 02:46:56 TraceyC yep
2016-03-22 02:47:15 TraceyC Also d20s make great cat toys
2016-03-22 02:47:27 zmoylan-pi unless you have wooden floors and want to sleep at night
2016-03-22 02:47:56 TraceyC I wound up with way too many after a gaming con where they let you grab one handful of dice for an entry fee. A bunch of friends and I went in, pooled the dice & shared the pool
2016-03-22 02:48:04 TraceyC point
2016-03-22 02:48:50 * zmoylan-pi has many fond memories of having to get up at 2am and taking the cats marbles which made a staggering amount of noise when whacked by cat on wooden floor till it hit radiators and glass in door and umbrella stand
2016-03-22 02:49:01 TraceyC lol
2016-03-22 02:49:29 zmoylan-pi then half an hour later having to do it again as the cat had a stash we never found...
2016-03-22 02:53:30 Devilment THis is whY i don't have cats
2016-03-22 02:54:54 Ioangogo Why whould smoking be in heven, it gives you cancer
2016-03-22 02:55:25 < Extremulus (~Extremulu@2001:470:b:1fb:deaf::d259) has quit (Ping timeout: 268 seconds)
2016-03-22 02:55:28 TraceyC good question
2016-03-22 02:55:40 Devilment Did you know that 100% of smokers die?
2016-03-22 02:55:52 TraceyC So do 100% of heroine users
2016-03-22 02:55:55 Devilment Same ratio for non-smokers
2016-03-22 02:55:56 zmoylan-pi if you got cancer then god gave you cancer... duh...
2016-03-22 02:55:59 Ioangogo yes, but how meny of lung cance
2016-03-22 02:56:14 Ioangogo zmoylan-pi: thats not.. thats not how it works
2016-03-22 02:56:27 TraceyC It is too, just ask certain Amuricans
2016-03-22 02:56:33 zmoylan-pi ^see
2016-03-22 02:56:44 Devilment Heroine users? Abusing Wonder Woman and Supergirl?
2016-03-22 02:56:51 TraceyC lol
2016-03-22 02:57:55 zmoylan-pi where would wonder woman find a needle...
2016-03-22 02:58:19 zmoylan-pi supergirl just needs a kryptonite one...
2016-03-22 03:02:41 < swift110-phone (~swift110-@unaffiliated/swift110) has quit (Remote host closed the connection)
2016-03-22 03:06:14 > Extremulus (~Extremulu@2001:470:b:1fb:a62:66ff:fec8:c5ca) has joined #linuxvoice
2016-03-22 03:18:36 TwistedLucidity It's hydroxylic acid you have to watch out for.
2016-03-22 03:20:40 > gb00s (~gb00s@c50-31.i07-13.onvol.net) has joined #linuxvoice
2016-03-22 03:23:35 > writtenoff (~writtenof@of1.psych.ubc.ca) has joined #linuxvoice
2016-03-22 03:41:02 < TraceyC (~TraceyC@2620:0:28a2:4020:d441:95d0:3b4f:9c1c) has quit (Ping timeout: 248 seconds)
2016-03-22 03:41:17 < arubislander (~ArubIslan@86.93.93.218) has quit (Quit: Leaving.)
2016-03-22 03:41:29 > TraceyC (~TraceyC@2620:0:28a2:4020:cd44:a6c4:afcb:e158) has joined #linuxvoice
2016-03-22 03:48:36 < M1C4HTRON13 (~micah@bodhilinux/team/M1C4HTRON13) has quit (Ping timeout: 244 seconds)
2016-03-22 03:49:58 > M1C4HTRON13 (~micah@84.203.64.47) has joined #linuxvoice
2016-03-22 03:49:58 < M1C4HTRON13 (~micah@84.203.64.47) has quit (Changing host)
2016-03-22 03:49:58 > M1C4HTRON13 (~micah@bodhilinux/team/M1C4HTRON13) has joined #linuxvoice
2016-03-22 03:50:36 < mnavrati (milan@nat/redhat/x-bgddjgnusvcowaxb) has quit (Quit: Leaving)
2016-03-22 04:35:34 < M1C4HTRON13 (~micah@bodhilinux/team/M1C4HTRON13) has quit (Ping timeout: 240 seconds)
2016-03-22 04:36:53 > M1C4HTRON13 (~micah@bodhilinux/team/M1C4HTRON13) has joined #linuxvoice
2016-03-22 04:44:56 - foxhunt72 is now known as foxhunt_away
2016-03-22 04:50:54 < mavrix (~mavrix@unaffiliated/mavrix) has quit (Ping timeout: 260 seconds)
2016-03-22 04:52:39 > mavrix (~mavrix@unaffiliated/mavrix) has joined #linuxvoice
2016-03-22 04:52:53 < TwistedLucidity (~TwistedLu@cpc80671-stap13-2-0-cust118.12-2.cable.virginm.net) has quit (Quit: Konversation terminated!)
2016-03-22 04:57:50 < M1C4HTRON13 (~micah@bodhilinux/team/M1C4HTRON13) has quit (Ping timeout: 248 seconds)
2016-03-22 05:15:16 > Nitronium (~Dave@host213-1-15-155.range213-1.btcentralplus.com) has joined #linuxvoice
2016-03-22 05:15:24 < ideasman42 (~cambo@203-206-123-225.dyn.iinet.net.au) has quit (Remote host closed the connection)
2016-03-22 05:25:58 > M1C4HTRON13 (~micah@84.203.64.47) has joined #linuxvoice
2016-03-22 05:25:58 < M1C4HTRON13 (~micah@84.203.64.47) has quit (Changing host)
2016-03-22 05:25:58 > M1C4HTRON13 (~micah@bodhilinux/team/M1C4HTRON13) has joined #linuxvoice
2016-03-22 05:42:35 > m95lag (~m95lag@82-181-169-179.bb.dnainternet.fi) has joined #linuxvoice
2016-03-22 05:46:43 mcphail gog.com are the DFS of the gaming industry. Yet another sale!
2016-03-22 05:52:30 > xplora1a (~stuart@dab-hlw1-h-26-3.dab.02.net) has joined #linuxvoice
2016-03-22 05:55:29 < xplora1a (~stuart@dab-hlw1-h-26-3.dab.02.net) has quit (Remote host closed the connection)
2016-03-22 06:46:26 popey mcphail: audiobooksnow are the same for audio books http://i.imgur.com/y74ErJ0.png
2016-03-22 06:51:10 mcphail I tend to add these to the junk mail filter. I allow 1 or 2 emails/week at most. T'wife used to get emailed by some clothes sites 5 times per day. Just annoying
2016-03-22 07:01:32 popey yeah, I don't mind now that gmail moves them all over to a separate category that i can choose to look at or not
2016-03-22 07:02:01 > niamh (~niamh@56.159.125.91.dyn.plus.net) has joined #linuxvoice
2016-03-22 07:02:57 < niamh (~niamh@56.159.125.91.dyn.plus.net) has quit (Client Quit)
2016-03-22 07:06:58 < opi (~opi@2001:41d0:52:800::49e) has quit (Quit: ZNC - http://znc.in)
2016-03-22 07:07:21 > opi (~opi@2001:41d0:52:800::49e) has joined #linuxvoice
2016-03-22 07:10:18 - foxhunt_away is now known as foxhunt72
2016-03-22 07:15:21 < TraceyC (~TraceyC@2620:0:28a2:4020:cd44:a6c4:afcb:e158) has quit (Quit: Off I go into the wild, blue yonder)
2016-03-22 07:16:56 < Ioangogo (~Quassel@huwloosley.plus.com) has quit (Quit: Merrrrr)
2016-03-22 07:17:10 > asusk7m550 (~Thunderbi@2001:981:97b3:1:a48f:906c:24be:113b) has joined #linuxvoice
2016-03-22 07:19:03 < jherrmann (jirkah@nat/redhat/x-wxdwiovlglmcyzga) has quit (Quit: Toodle pip!)
2016-03-22 07:25:09 > xplora1a (~stuart@2001:8b0:1679:ea38:224:d7ff:feec:e7ec) has joined #linuxvoice
2016-03-22 07:31:43 < xplora1a (~stuart@2001:8b0:1679:ea38:224:d7ff:feec:e7ec) has quit (Ping timeout: 250 seconds)
2016-03-22 07:32:26 > trilby (~Mark@0543196c.skybroadband.com) has joined #linuxvoice
2016-03-22 07:54:37 > mnavrati (~milan@ip-94-113-220-233.net.upcbroadband.cz) has joined #linuxvoice
2016-03-22 08:09:58 > Ioangogo (~Quassel@huwloosley.plus.com) has joined #linuxvoice
2016-03-22 08:14:03 > ChibaPet (~hiphiphip@unaffiliated/chibapet) has joined #linuxvoice
2016-03-22 08:14:39 ChibaPet So, I'm in the middle of the latest Linux Luddites. A little convergence, a little CDDL FUD from a disgruntled repackager...
2016-03-22 08:16:42 popey heh
2016-03-22 08:23:49 ChibaPet He doesn't want to be a pirate by using free software with other free software.
2016-03-22 08:23:55 ChibaPet "A pirate."
2016-03-22 08:24:03 popey Spoilers!
2016-03-22 08:24:06 * popey is listening now
2016-03-22 08:24:11 popey ep 74, right?
2016-03-22 08:24:12 ChibaPet Ah, sorry sorry.
2016-03-22 08:24:20 ChibaPet yes
2016-03-22 08:24:33 ChibaPet I've actually enjoyed it more than the last few episodes.
2016-03-22 08:25:06 popey :)
2016-03-22 08:25:10 ChibaPet I won't spoil it, but there'll be a quiz afterwards to see if you catch all the different ways the concept of piracy shows up in different parts of the show. :P
2016-03-22 08:33:57 < gb00s (~gb00s@c50-31.i07-13.onvol.net) has quit (Quit: Leaving)
2016-03-22 08:46:04 popey heh
2016-03-22 08:55:34 < asusk7m550 (~Thunderbi@2001:981:97b3:1:a48f:906c:24be:113b) has quit (Quit: asusk7m550)
2016-03-22 09:12:54 > zeldovich (~matthew@cpc4-pmth11-2-0-cust783.6-1.cable.virginm.net) has joined #linuxvoice
2016-03-22 09:26:10 flexiondotorg ChibaPet, I sent more or less the same message earlier :-)
2016-03-22 09:27:00 ChibaPet Ah, I missed it. Heh.
2016-03-22 09:27:33 > zeldovich_ (~matthew@cpc4-pmth11-2-0-cust783.6-1.cable.virginm.net) has joined #linuxvoice
2016-03-22 09:28:20 < zeldovich (~matthew@cpc4-pmth11-2-0-cust783.6-1.cable.virginm.net) has quit (Ping timeout: 248 seconds)
2016-03-22 09:28:34 > amattwithers (~matthew@cpc4-pmth11-2-0-cust783.6-1.cable.virginm.net) has joined #linuxvoice
2016-03-22 09:28:54 < trilby (~Mark@0543196c.skybroadband.com) has quit (Quit: Leaving)
2016-03-22 09:32:09 < amattwithers (~matthew@cpc4-pmth11-2-0-cust783.6-1.cable.virginm.net) has quit (Client Quit)
2016-03-22 09:32:41 < zeldovich_ (~matthew@cpc4-pmth11-2-0-cust783.6-1.cable.virginm.net) has quit (Quit: zeldovich_)
2016-03-22 09:33:03 > amattwithers (~matthew@cpc4-pmth11-2-0-cust783.6-1.cable.virginm.net) has joined #linuxvoice
2016-03-22 09:34:10 < amattwithers (~matthew@cpc4-pmth11-2-0-cust783.6-1.cable.virginm.net) has quit (Client Quit)
2016-03-22 09:34:24 > amattwithers (~matthew@cpc4-pmth11-2-0-cust783.6-1.cable.virginm.net) has joined #linuxvoice
2016-03-22 09:38:05 > borg_ (~AelDL3SeX@68-185-132-13.dhcp.jcsn.tn.charter.com) has joined #linuxvoice
2016-03-22 09:38:21 popey stil not got to that bit yet :)
2016-03-22 09:39:56 < amattwithers (~matthew@cpc4-pmth11-2-0-cust783.6-1.cable.virginm.net) has quit (Quit: Leaving)
2016-03-22 09:41:19 - foxhunt72 is now known as foxhunt_away
2016-03-22 09:41:33 > xplora1a (~stuart@2001:8b0:1679:ea38:224:d7ff:feec:e7ec) has joined #linuxvoice
2016-03-22 09:41:42 > swift110 (~swift110@c-73-163-166-253.hsd1.dc.comcast.net) has joined #linuxvoice
2016-03-22 09:42:56 < swift110 (~swift110@c-73-163-166-253.hsd1.dc.comcast.net) has quit (Changing host)
2016-03-22 09:42:57 > swift110 (~swift110@unaffiliated/swift110) has joined #linuxvoice
2016-03-22 09:44:30 > zeldovich (~zeldovich@cpc4-pmth11-2-0-cust783.6-1.cable.virginm.net) has joined #linuxvoice
2016-03-22 09:46:00 > zeldovich_ (~matthew@cpc4-pmth11-2-0-cust783.6-1.cable.virginm.net) has joined #linuxvoice
2016-03-22 09:49:24 < zeldovich_ (~matthew@cpc4-pmth11-2-0-cust783.6-1.cable.virginm.net) has quit (Client Quit)
2016-03-22 09:52:11 < zeldovich (~zeldovich@cpc4-pmth11-2-0-cust783.6-1.cable.virginm.net) has quit (Quit: Leaving)
2016-03-22 09:52:31 < M1C4HTRON13 (~micah@bodhilinux/team/M1C4HTRON13) has quit (Remote host closed the connection)
2016-03-22 09:52:33 > zeldovich (~zeldovich@cpc4-pmth11-2-0-cust783.6-1.cable.virginm.net) has joined #linuxvoice
2016-03-22 09:54:57 < zeldovich (~zeldovich@cpc4-pmth11-2-0-cust783.6-1.cable.virginm.net) has quit (Client Quit)
2016-03-22 09:55:16 > zeldovich (~zeldovich@cpc4-pmth11-2-0-cust783.6-1.cable.virginm.net) has joined #linuxvoice
2016-03-22 09:55:50 < zeldovich (~zeldovich@cpc4-pmth11-2-0-cust783.6-1.cable.virginm.net) has quit (Client Quit)
2016-03-22 09:56:12 > zeldovich (~zeldovich@cpc4-pmth11-2-0-cust783.6-1.cable.virginm.net) has joined #linuxvoice
2016-03-22 10:00:14 < zeldovich (~zeldovich@cpc4-pmth11-2-0-cust783.6-1.cable.virginm.net) has quit (Client Quit)
2016-03-22 10:00:37 > zeldovich (~zeldovich@cpc4-pmth11-2-0-cust783.6-1.cable.virginm.net) has joined #linuxvoice
2016-03-22 10:04:00 > zeldovich_ (~matthew@cpc4-pmth11-2-0-cust783.6-1.cable.virginm.net) has joined #linuxvoice
2016-03-22 10:04:20 < zeldovich_ (~matthew@cpc4-pmth11-2-0-cust783.6-1.cable.virginm.net) has quit (Remote host closed the connection)
2016-03-22 10:09:59 > towy71 (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has joined #linuxvoice
2016-03-22 10:34:34 < zeldovich (~zeldovich@cpc4-pmth11-2-0-cust783.6-1.cable.virginm.net) has quit (Ping timeout: 240 seconds)
2016-03-22 10:40:13 < xplora1a (~stuart@2001:8b0:1679:ea38:224:d7ff:feec:e7ec) has quit (Ping timeout: 250 seconds)
2016-03-22 10:53:22 < swift110 (~swift110@unaffiliated/swift110) has quit (Ping timeout: 260 seconds)
2016-03-22 11:00:19 < Nitronium (~Dave@host213-1-15-155.range213-1.btcentralplus.com) has quit (Remote host closed the connection)
2016-03-22 11:05:41 > swift110 (~swift110@205.201.255.5) has joined #linuxvoice
2016-03-22 11:17:02 < swift110 (~swift110@205.201.255.5) has quit (Ping timeout: 248 seconds)
2016-03-22 11:44:06 < writtenoff (~writtenof@of1.psych.ubc.ca) has quit (Quit: WeeChat 1.3)
2016-03-22 12:19:00 < ryuslash (~slash@2a02:1812:2518:ce00:f24d:a2ff:fede:451c) has quit (Remote host closed the connection)
2016-03-22 12:28:37 > LauRoman|Alt (~LauRoman@5-14-7-240.residential.rdsnet.ro) has joined #linuxvoice
2016-03-22 12:29:04 < LauRoman|Alt (~LauRoman@5-14-7-240.residential.rdsnet.ro) has quit (Read error: Connection reset by peer)
2016-03-22 12:29:52 < LauRoman (~LauRoman@5-14-154-214.residential.rdsnet.ro) has quit (Ping timeout: 264 seconds)
2016-03-22 12:49:43 > LauRoman (~LauRoman@5-14-7-240.residential.rdsnet.ro) has joined #linuxvoice
2016-03-22 13:06:10 > swift110-phone (~swift110-@unaffiliated/swift110) has joined #linuxvoice
2016-03-22 13:06:13 swift110-phone Hey
2016-03-22 13:07:16 > zmoylan-1i (~pi@109.79.202.124) has joined #linuxvoice
2016-03-22 13:10:54 < zmoylan-pi (~pi@109.79.141.47) has quit (Ping timeout: 276 seconds)
2016-03-22 13:28:34 < LauRoman (~LauRoman@5-14-7-240.residential.rdsnet.ro) has quit (Quit: Leaving)
2016-03-22 13:32:32 > LauRoman (~LauRoman@5-14-7-240.residential.rdsnet.ro) has joined #linuxvoice
2016-03-22 13:52:49 < chemist69 (~apl@2a02:560:41ff:5200:7dd3:fad2:ddfd:3c6a) has quit (Ping timeout: 240 seconds)
2016-03-22 14:06:28 > chemist69 (~apl@2a02:560:411e:5e00:5ddc:7f5a:e6a4:3ad7) has joined #linuxvoice
2016-03-22 14:33:38 < swift110-phone (~swift110-@unaffiliated/swift110) has quit (Quit: See you later)
2016-03-22 14:35:30 > swift110 (~swift110@unaffiliated/swift110) has joined #linuxvoice
2016-03-22 14:56:51 < mavrix (~mavrix@unaffiliated/mavrix) has quit (Ping timeout: 248 seconds)
2016-03-22 14:59:26 > mavrix (~mavrix@unaffiliated/mavrix) has joined #linuxvoice
2016-03-22 15:12:27 < swift110 (~swift110@unaffiliated/swift110) has quit (Ping timeout: 276 seconds)
2016-03-22 15:31:11 > ideasman42 (~cambo@203-206-123-225.dyn.iinet.net.au) has joined #linuxvoice
2016-03-22 15:47:09 > swift110-phone (~swift110-@unaffiliated/swift110) has joined #linuxvoice
2016-03-22 15:47:11 swift110-phone Hry
2016-03-22 15:47:58 < mnavrati (~milan@ip-94-113-220-233.net.upcbroadband.cz) has quit (Remote host closed the connection)
2016-03-22 16:03:15 < zmoylan-1i (~pi@109.79.202.124) has quit (Ping timeout: 246 seconds)
2016-03-22 16:07:59 > zmoylan-pi (~pi@109.79.156.171) has joined #linuxvoice
2016-03-22 17:58:20 < m95lag (~m95lag@82-181-169-179.bb.dnainternet.fi) has quit (Read error: Connection reset by peer)
2016-03-22 18:58:25 < Extremulus (~Extremulu@2001:470:b:1fb:a62:66ff:fec8:c5ca) has quit (Ping timeout: 240 seconds)
2016-03-22 19:08:49 - foxhunt_away is now known as foxhunt72
2016-03-22 19:09:39 > arubislander (~ArubIslan@86.93.93.218) has joined #linuxvoice
2016-03-22 19:10:02 Ioangogo I think i just saw some street art that refrenced the latest blender foundation movie
2016-03-22 19:19:50 > ryuslash (~slash@2a02:1812:2518:ce00:f24d:a2ff:fede:451c) has joined #linuxvoice
2016-03-22 19:24:38 > TwistedLucidity (~TwistedLu@cpc80671-stap13-2-0-cust118.12-2.cable.virginm.net) has joined #linuxvoice
2016-03-22 19:33:04 < arubislander (~ArubIslan@86.93.93.218) has quit (Quit: Leaving.)
2016-03-22 19:33:53 > brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has joined #linuxvoice
2016-03-22 19:34:52 > arubislander (~ArubIslan@86.93.93.218) has joined #linuxvoice
2016-03-22 19:59:07 > jherrmann (jirkah@nat/redhat/x-wxxfdenofmwesiau) has joined #linuxvoice
2016-03-22 20:05:27 mcphail Ioangogo: the one with the suicidal sheep?
2016-03-22 20:11:06 > mnavrati (milan@nat/redhat/x-lxtchgjvkoehmmym) has joined #linuxvoice
2016-03-22 20:28:23 > Ian (~Thunderbi@te6compton.te.rl.ac.uk) has joined #linuxvoice
2016-03-22 20:28:46 - Ian is now known as Guest1915
2016-03-22 20:39:23 > andybalaam (andybalaam@nat/ibm/x-oaqwdxrbixtcaxju) has joined #linuxvoice
2016-03-24 00:11:09 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-03-24 00:11:09 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-03-24 00:11:09 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-03-24 00:11:09 - Channel #linuxvoice: 80 nicks (1 op, 0 voices, 79 normals)
2016-03-24 00:11:19 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-03-24 00:31:04 Devilment Red Hat are now a $2bn company
2016-03-24 00:31:10 Devilment http://www.theregister.co.uk/2016/03/23/red_hat_2_billion_revenue_q4_fy_2016_results/
2016-03-24 00:31:11 LVbot ^ Enterprise revenues power Red Hat past 2bn barrier The Register
2016-03-24 00:32:02 < Paddy_NI (~patrick@host-92-14-224-66.as43234.net) has quit (Quit: Konversation terminated!)
2016-03-24 00:39:22 TraceyC Wow. Good for them
2016-03-24 00:53:03 < mnavrati_mtg (milan@nat/redhat/x-fxccjhuhuckzadef) has quit (Ping timeout: 246 seconds)
2016-03-24 00:56:27 james_olympus http://www.whatismymovie.com/ I wonder how this works
2016-03-24 00:56:29 LVbot ^ What is my movie? Describe and find movies
2016-03-24 00:56:58 < jherrmann_ (jirkah@nat/redhat/x-larxeswbqphpfznb) has quit (Quit: Toodle pip!)
2016-03-24 00:59:49 > mnavrati_mtg (milan@nat/redhat/x-fqkrlgvzepkwgydr) has joined #linuxvoice
2016-03-24 01:02:31 Devilment james_olympus: API to IMDb?
2016-03-24 01:04:30 james_olympus Maybe. It seems good at ordering results
2016-03-24 01:07:45 > jherrmann (jirkah@nat/redhat/x-ueaiiizpmzdvqfza) has joined #linuxvoice
2016-03-24 01:12:29 < nomad_dw (~nomad@maia.oucs.ox.ac.uk) has quit (Ping timeout: 250 seconds)
2016-03-24 01:13:00 > nomad_dw (~nomad@maia.oucs.ox.ac.uk) has joined #linuxvoice
2016-03-24 01:29:39 Ioangogo https://www.reddit.com/r/unitedkingdom/comments/4bm8gi/the_bbc_have_just_been_told_to_stop_filming_in/
2016-03-24 01:29:41 LVbot ^ The BBC have just been told to stop filming in Westminster due to protestors. unitedkingdom
2016-03-24 01:49:11 < brianhunter (~brian@bhlm.net) has quit (Quit: WeeChat 1.0.1)
2016-03-24 01:49:22 > brianhunter (~brian@bhlm.net) has joined #linuxvoice
2016-03-24 01:53:50 > jherrmann_ (jirkah@nat/redhat/x-dbgdvgpwuyzwitfm) has joined #linuxvoice
2016-03-24 01:54:11 aSheepie @james_olympus it probably just aggregates film keywords and review keywords
2016-03-24 01:54:31 aSheepie @james_olympus it's not that great "a girl and two boys skip school and go out in a sports car for a day off" didn't give me Ferris
2016-03-24 01:56:04 james_olympus Could be. It's difficult to describe a film without using key words
2016-03-24 01:56:40 < jherrmann (jirkah@nat/redhat/x-ueaiiizpmzdvqfza) has quit (Ping timeout: 268 seconds)
2016-03-24 01:57:06 < brianhunter (~brian@bhlm.net) has quit (Quit: WeeChat 1.0.1)
2016-03-24 01:57:15 > brianhunter (~brian@bhlm.net) has joined #linuxvoice
2016-03-24 01:58:40 < brianhunter (~brian@bhlm.net) has quit (Client Quit)
2016-03-24 01:59:58 > brianhunter (~brian@bhlm.net) has joined #linuxvoice
2016-03-24 02:00:59 < jherrmann_ (jirkah@nat/redhat/x-dbgdvgpwuyzwitfm) has quit (Ping timeout: 268 seconds)
2016-03-24 02:02:58 Ioangogo james_olympus: it can find doctor who, i dont like it
2016-03-24 02:04:40 Ioangogo http://www.whatismymovie.com/results?text=Show+me+movies+about+linux&qid=b567cad0-5505-4cdd-858c-de9c072f85d8 it looks like its matching keywords about a word
2016-03-24 02:04:42 LVbot ^ What is my movie? Results
2016-03-24 02:13:12 > jherrmann_ (jirkah@nat/redhat/x-nltvnmfveadqrhjg) has joined #linuxvoice
2016-03-24 02:14:32 TwistedLucidity Ioangogo: The Etonian old-boys can't let the great unwashed have a voice. Democracy isn't something they accept
2016-03-24 02:15:34 < mnavrati_mtg (milan@nat/redhat/x-fqkrlgvzepkwgydr) has quit (Ping timeout: 240 seconds)
2016-03-24 02:16:00 Ioangogo TwistedLucidity: ?
2016-03-24 02:16:40 Ioangogo Mrs. Tweedy is in parliment https://vid.me/B1v6#0m12s
2016-03-24 02:16:43 LVbot ^ BBC told to stop filming vidme
2016-03-24 02:21:40 TwistedLucidity Ioangogo: The BBC censorship
2016-03-24 02:22:12 Ioangogo TwistedLucidity: nah, its a MP getting the bbc to stop filming a protest, they just did it badly
2016-03-24 02:22:43 TwistedLucidity Exactly, democracy must be stamped down
2016-03-24 02:22:49 Ioangogo the bbc where fine to talk about the protest, but Mrs. Tweedy wanted them to stop
2016-03-24 02:22:52 TwistedLucidity How dare the great unwashed have a voice!
2016-03-24 02:23:16 TraceyC They will be implementing "free speech zones" where protesters can go, 20 miles from location, US style
2016-03-24 02:23:18 Ioangogo they need to be put in the pie machine
2016-03-24 02:29:11 > mnavrati_mtg (milan@nat/redhat/x-kakdseerpypingfx) has joined #linuxvoice
2016-03-24 02:33:27 > Paddy_NI (~patrick@host-92-14-224-66.as43234.net) has joined #linuxvoice
2016-03-24 02:37:40 < jherrmann_ (jirkah@nat/redhat/x-nltvnmfveadqrhjg) has quit (Ping timeout: 264 seconds)
2016-03-24 02:46:51 > jherrmann (jirkah@nat/redhat/x-vgxrndefchyksnwl) has joined #linuxvoice
2016-03-24 02:49:04 < jherrmann (jirkah@nat/redhat/x-vgxrndefchyksnwl) has quit (Remote host closed the connection)
2016-03-24 02:54:01 > jherrmann (jirkah@nat/redhat/x-gqauatbjplclgfah) has joined #linuxvoice
2016-03-24 03:35:19 < Paddy_NI (~patrick@host-92-14-224-66.as43234.net) has quit (Quit: Konversation terminated!)
2016-03-24 03:49:18 > slashd (~slashd@modemcable157.191-130-66.mc.videotron.ca) has joined #linuxvoice
2016-03-24 03:49:34 < slashd (~slashd@modemcable157.191-130-66.mc.videotron.ca) has quit (Changing host)
2016-03-24 03:49:34 > slashd (~slashd@ubuntu/member/slashd) has joined #linuxvoice
2016-03-24 03:50:21 - foxhunt72 is now known as foxhunt_away
2016-03-24 03:55:21 > writtenoff (~writtenof@of1.psych.ubc.ca) has joined #linuxvoice
2016-03-24 04:00:43 < blahdeblah (~quassel@unaffiliated/blahdeblah) has quit (Ping timeout: 252 seconds)
2016-03-24 04:02:00 > blahdeblah (~quassel@unaffiliated/blahdeblah) has joined #linuxvoice
2016-03-24 04:04:47 < jherrmann (jirkah@nat/redhat/x-gqauatbjplclgfah) has quit (Quit: Toodle pip!)
2016-03-24 04:09:17 < TraceyC (~TraceyC@2620:0:28a2:4020:f57a:bdc2:1a59:97f2) has quit (Ping timeout: 250 seconds)
2016-03-24 04:10:50 < TwistedLucidity (~TwistedLu@cpc80671-stap13-2-0-cust118.12-2.cable.virginm.net) has quit (Quit: Konversation terminated!)
2016-03-24 04:12:13 > The-Compiler (~compiler@qutebrowser/dev/The-Compiler) has joined #linuxvoice
2016-03-24 04:13:18 The-Compiler degville: hey! I don't know if you remember me, I'm the author of qutebrowser which was featured in LinuxVoice some months ago :)
2016-03-24 04:13:40 < Ian1 (~Thunderbi@te6compton.te.rl.ac.uk) has quit (Ping timeout: 264 seconds)
2016-03-24 04:22:18 > TraceyC (~TraceyC@2620:0:28a2:4020:d495:7641:9a31:30c2) has joined #linuxvoice
2016-03-24 04:25:14 < andybalaam (andybalaam@nat/ibm/x-qicmaywteavzegnj) has quit (Remote host closed the connection)
2016-03-24 05:22:35 > fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-03-24 05:22:35 - Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-03-24 05:22:35 - Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-03-24 05:22:35 - Channel #linuxvoice: 77 nicks (1 op, 0 voices, 76 normals)
2016-03-24 05:22:44 - Channel created on Tue, 12 Nov 2013 01:19:50
2016-03-24 05:43:10 < aSheepie (~phil@i-83-67-88-165.freedom2surf.net) has quit (Quit: WeeChat 0.3.7)
2016-03-24 05:53:27 < g0nz085 (~gonzo@cpc81199-farn9-2-0-cust619.6-2.cable.virginm.net) has quit (Ping timeout: 260 seconds)
2016-03-24 05:53:32 > Tonix (53ff1362@gateway/web/freenode/ip.83.255.19.98) has joined #linuxvoice
2016-03-24 05:54:33 Devilment So that's what A. Pope looks like. I expected him to be wearing a funny hat
2016-03-24 05:54:36 < thesilentboatman (~thesilent@c83-248-87-13.bredband.comhem.se) has quit (Ping timeout: 250 seconds)
2016-03-24 05:54:54 > thesilentboatman (~thesilent@c83-248-87-13.bredband.comhem.se) has joined #linuxvoice
2016-03-24 05:55:11 > g0nz085 (~gonzo@cpc81199-farn9-2-0-cust619.6-2.cable.virginm.net) has joined #linuxvoice
2016-03-24 05:59:52 zmoylan-pi he must be been hunted by the police. the subject is hatless, repeat hatless... :-P
2016-03-24 06:01:56 < LauRoman (~LauRoman@5-14-7-240.residential.rdsnet.ro) has quit (Read error: Connection reset by peer)
2016-03-24 06:02:24 > LauRoman (~LauRoman@5-14-7-240.residential.rdsnet.ro) has joined #linuxvoice
2016-03-24 06:06:26 < Tonix (53ff1362@gateway/web/freenode/ip.83.255.19.98) has quit (Quit: Page closed)
2016-03-24 06:32:20 < Ioangogo (~Quassel@huwloosley.plus.com) has quit (Read error: Connection reset by peer)
2016-03-24 06:34:23 < LVbot (~iBot@huwloosley.plus.com) has quit (Read error: Connection reset by peer)
2016-03-24 06:35:11 > Ioangogo (~Quassel@huwloosley.plus.com) has joined #linuxvoice
2016-03-24 06:36:50 - foxhunt_away is now known as foxhunt72
2016-03-24 06:41:07 > xraynorm (~xraynorm@169.7.200.146.dyn.plus.net) has joined #linuxvoice
2016-03-24 06:55:48 > techmo (~h4ckm3@2607:fb90:5833:8f63:e858:96a4:be63:c439) has joined #linuxvoice
2016-03-24 06:56:10 < techmo (~h4ckm3@2607:fb90:5833:8f63:e858:96a4:be63:c439) has quit (Client Quit)
2016-03-24 06:59:27 > LVbot (~iBot@huwloosley.plus.com) has joined #linuxvoice
2016-03-24 07:02:40 Ioangogo Hi
2016-03-24 07:04:14 < TraceyC (~TraceyC@2620:0:28a2:4020:d495:7641:9a31:30c2) has quit (Quit: Off I go into the wild, blue yonder)
2016-03-24 07:04:22 < jaake (~h4ckm3@129.59.122.24) has quit (Ping timeout: 244 seconds)
2016-03-24 07:08:13 > asusk7m550 (~Thunderbi@2001:981:97b3:1:24b5:96db:e20a:8dcc) has joined #linuxvoice
2016-03-24 07:09:27 < m95lag (~m95lag@82-181-169-179.bb.dnainternet.fi) has quit (Quit: leaving)
2016-03-24 07:13:12 < sjoos (~sjoos@82-171-0-111.ip.telfort.nl) has quit (Remote host closed the connection)
2016-03-24 07:40:47 > schmidttrigger (~Mutter@b2b-94-79-152-238.unitymedia.biz) has joined #linuxvoice
2016-03-24 07:41:07 > mnavrati (~milan@ip-94-112-188-159.net.upcbroadband.cz) has joined #linuxvoice
2016-03-24 07:48:45 > brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has joined #linuxvoice
2016-03-24 08:03:58 < schmidttrigger (~Mutter@b2b-94-79-152-238.unitymedia.biz) has quit (Remote host closed the connection)
2016-03-24 08:04:54 < brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has quit (Ping timeout: 276 seconds)
2016-03-24 08:06:27 > brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has joined #linuxvoice
2016-03-24 08:22:55 > schmidttrigger (~Mutter@2a01:598:9981:457e:2101:e7d:8cff:3c55) has joined #linuxvoice
2016-03-24 08:25:36 < schmidttrigger (~Mutter@2a01:598:9981:457e:2101:e7d:8cff:3c55) has quit (Remote host closed the connection)
2016-03-24 08:30:46 > dankeast (~dan@host86-133-97-101.range86-133.btcentralplus.com) has joined #linuxvoice
2016-03-24 08:36:42 < johnlane (~john@212.159.104.145) has quit (Remote host closed the connection)
2016-03-24 08:37:07 Nitronium james_olympus , your find in the last podcast, fatsort, inspired, thanks!
2016-03-24 08:41:11 < asusk7m550 (~Thunderbi@2001:981:97b3:1:24b5:96db:e20a:8dcc) has quit (Quit: asusk7m550)
2016-03-24 08:43:06 james_olympus Nitronium: Great, glad someone found it useful
2016-03-24 08:46:43 Nitronium I just tested it in my car and it works perfectly
2016-03-24 08:47:04 Nitronium I just figured it was my car being crap and not reading the filenames properly, I never bothered to investigate further
2016-03-24 08:54:25 zmoylan-pi it's a bit sad in this day and age that it is needed mind
2016-03-24 08:54:57 zmoylan-pi but at least someone made the software to fix it
2016-03-24 08:55:24 Nitronium indeed
2016-03-24 08:55:33 Nitronium right, night all :-)
2016-03-24 08:55:38 Nitronium it's been a pleasure
2016-03-24 08:55:53 < Nitronium (~Dave@host213-1-15-155.range213-1.btcentralplus.com) has quit (Remote host closed the connection)
2016-03-24 08:58:41 james_olympus I'm working outdoors tomorrow. Weather forecast is rain for the first time in two weeks.
2016-03-24 09:00:03 < slashd (~slashd@ubuntu/member/slashd) has quit (Quit: Leaving)
2016-03-24 09:20:40 > jaake (~h4ckm3@129.59.122.24) has joined #linuxvoice
2016-03-24 09:20:53 > zeldovich (~zeldovich@213.104.151.16) has joined #linuxvoice
2016-03-24 09:28:04 < dankeast (~dan@host86-133-97-101.range86-133.btcentralplus.com) has quit (Ping timeout: 268 seconds)
2016-03-24 09:36:22 < brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has quit (Quit: Konversation terminated!)
2016-03-24 10:00:03 < zeldovich (~zeldovich@213.104.151.16) has quit (Remote host closed the connection)
2016-03-24 10:10:04 Ioangogo Im just going to throw this in here and suggest it when finds are asked for https://github.com/bastimeyer/livestreamer-twitch-gui
2016-03-24 10:10:06 LVbot ^ GitHub bastimeyer/livestreamer-twitch-gui: A multi platform Twitch.tv browser for Livestreamer
2016-03-24 10:12:51 < jaake (~h4ckm3@129.59.122.24) has quit (Ping timeout: 250 seconds)
2016-03-24 10:18:18 < popey (~alan@ubuntu/member/popey) has quit (Ping timeout: 246 seconds)
2016-03-24 10:18:20 - foxhunt72 is now known as foxhunt_away
2016-03-24 10:19:03 Ioangogo foxhunt_away: why is your nick constantly changing
2016-03-24 10:19:36 zmoylan-pi probably his system suspending
2016-03-24 10:19:52 blahdeblah lots of clients do that automatically (or can, if configured to do so)
2016-03-24 10:39:53 < LauRoman (~LauRoman@5-14-7-240.residential.rdsnet.ro) has quit (Read error: Connection reset by peer)
2016-03-24 10:59:36 < writtenoff (~writtenof@of1.psych.ubc.ca) has quit (Quit: WeeChat 1.3)
2016-03-24 11:06:32 > ryuslash (~slash@2a02:1812:2518:ce00:f24d:a2ff:fede:451c) has joined #linuxvoice
2016-03-24 11:17:27 < mnavrati (~milan@ip-94-112-188-159.net.upcbroadband.cz) has quit (Quit: Leaving)
2016-03-24 12:15:54 < ryuslash (~slash@2a02:1812:2518:ce00:f24d:a2ff:fede:451c) has quit (Ping timeout: 246 seconds)
2016-03-24 12:28:37 > topcyde (~topcyde@2602:304:cdb8:9e40:5c0:f18c:25f0:1490) has joined #linuxvoice
2016-03-24 12:45:04 - irc: disconnected from server
2016-03-24 12:46:11 - fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-03-24 12:46:11 Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-03-24 12:46:11 Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-03-24 12:46:11 Channel #linuxvoice: 68 nicks (1 op, 0 voices, 67 normals)
2016-03-24 12:46:22 Channel created on Tue, 12 Nov 2013 01:19:50
2016-03-24 13:05:08 - brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has joined #linuxvoice
2016-03-24 13:17:37 mavrix (~mavrix@unaffiliated/mavrix) has quit (Ping timeout: 240 seconds)
2016-03-24 13:18:38 - mavrix (~mavrix@unaffiliated/mavrix) has joined #linuxvoice
2016-03-24 13:23:52 Cueball (~lee@2001:8b0:ffb3::c0:ff:ee) has quit (Ping timeout: 264 seconds)
2016-03-24 13:50:46 chemist69 (~apl@2a02:560:413d:b900:3022:7801:bd12:958e) has quit (Ping timeout: 268 seconds)
2016-03-24 14:03:57 - chemist69 (~apl@2a02:560:415d:cb00:e65:1928:9ec6:ecfa) has joined #linuxvoice
2016-03-24 14:31:51 - swift110-phone (~swift110-@unaffiliated/swift110) has joined #linuxvoice
2016-03-24 14:56:57 swift110-phone Hdy
2016-03-24 14:56:59 swift110-phone Hey
2016-03-24 15:14:38 irc: disconnected from server
2016-03-24 15:14:54 - fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-03-24 15:14:54 Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-03-24 15:14:54 Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-03-24 15:14:54 Channel #linuxvoice: 69 nicks (1 op, 0 voices, 68 normals)
2016-03-24 15:15:04 Channel created on Tue, 12 Nov 2013 01:19:50
2016-03-24 15:34:26 - Cueball (lee@11.21.169.217.in-addr.arpa) has joined #linuxvoice
2016-03-24 15:35:51 - zmoylan-1i (~pi@109.79.41.204) has joined #linuxvoice
2016-03-24 15:39:07 zmoylan-pi (~pi@109.77.200.224) has quit (Ping timeout: 260 seconds)
2016-03-24 16:03:33 zmoylan-1i (~pi@109.79.41.204) has quit (Ping timeout: 240 seconds)
2016-03-24 16:08:01 - zmoylan-pi (~pi@109.76.84.186) has joined #linuxvoice
2016-03-24 17:13:40 brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has quit (Ping timeout: 264 seconds)
2016-03-24 17:41:49 opi (~opi@2001:41d0:52:800::49e) has quit (Quit: ZNC - http://znc.in)
2016-03-24 17:42:10 - opi (~opi@2001:41d0:52:800::49e) has joined #linuxvoice
2016-03-24 17:51:22 - ideasman42 (~cambo@203-206-123-225.dyn.iinet.net.au) has joined #linuxvoice
2016-03-24 17:54:23 - m95lag (~m95lag@82-181-169-179.bb.dnainternet.fi) has joined #linuxvoice
2016-03-24 18:16:32 ideasman42 (~cambo@203-206-123-225.dyn.iinet.net.au) has quit (Remote host closed the connection)
2016-03-24 18:26:46 - popey (~alan@cpc81199-farn9-2-0-cust577.6-2.cable.virginm.net) has joined #linuxvoice
2016-03-24 18:56:35 - LauRoman (~LauRoman@5-14-7-240.residential.rdsnet.ro) has joined #linuxvoice
2016-03-24 19:12:06 - ryuslash (~slash@2a02:1812:2518:ce00:f24d:a2ff:fede:451c) has joined #linuxvoice
2016-03-24 19:30:41 - xplora1a (~stuart@81.144.225.214) has joined #linuxvoice
2016-03-24 19:38:49 foxhunt_away is now known as foxhunt72
2016-03-24 19:44:17 - TwistedLucidity (~TwistedLu@cpc80671-stap13-2-0-cust118.12-2.cable.virginm.net) has joined #linuxvoice
2016-03-24 19:54:46 foxhunt72 is now known as foxhunt_away
2016-03-24 19:58:01 - andybalaam (andybalaam@nat/ibm/x-fkembxeduksbktjr) has joined #linuxvoice
2016-03-24 19:58:16 Blackisle https://www.blackisle.org.uk/owncloud/index.php/s/iZ3JgSvP0WT1HL4
2016-03-24 19:58:18 LVbot ^ ownCloud
2016-03-24 19:58:18 Blackisle There, I fixed it! \o/
2016-03-24 20:01:19 Blackisle low profile grfx card + tin snips = slightly mangled case
2016-03-24 20:01:54 foxhunt_away is now known as foxhunt72
2016-03-24 20:28:31 - johnlane (~john@johnlane.plus.com) has joined #linuxvoice
2016-03-24 20:35:18 TwistedLucidity Urgh...Firefox just ate all my tabs and uninstalled every addon. There was no warning it was going to do data destruction.
2016-03-24 20:35:49 TwistedLucidity I must have had ~30 tabs open for various things, now I have to restore them all.
2016-03-24 20:36:08 TwistedLucidity Mozilla have *really* taken their eye off the ball of late
2016-03-24 20:39:01 - AdamDBrown (~Thunderbi@6.117-240-116.dynamic.dsl.pth.iprimus.net.au) has joined #linuxvoice
2016-03-24 20:39:41 johnlane if you haven't restarted firefox, look in the profile directory. I think it backs up its state in 'sessionstore' files...
2016-03-24 20:42:35 swift110-phone (~swift110-@unaffiliated/swift110) has quit (Quit: You'll miss me while i'm gone)
2016-03-24 20:43:07 johnlane I think it was a .js file but I just looked in my profile and things appear to be different to what I remember. The last update to FF moved the tab group feature out to an extension.
2016-03-24 20:44:35 TwistedLucidity I opened it and it gave me the choice of "Safe mode" or "Refresh".
2016-03-24 20:44:41 TwistedLucidity No mention of data destruction
2016-03-24 20:44:53 johnlane yes it used to be sessionstore.js but see https://support.mozilla.org/en-US/questions/1050588#answer-700114
2016-03-24 20:44:58 LVbot ^ Can no longer find sessionstore.js in profile. Have refreshed Firefox. Where is it? Screenshots attached Firefox Support Forum Mozilla Support
2016-03-24 20:45:07 * pwaring switched to Chromium two years ago, much better
2016-03-24 20:45:26 johnlane try sessionstore-backups/previous.js or sessionstore-backups/recovery.js
2016-03-24 20:46:34 TwistedLucidity Will do (once I figure out the URL). Rather annoyed though - if you are doing data destruction you WARN and you DOUBLE CONFIRM!
2016-03-24 20:48:45 TwistedLucidity Found the file, just no idea how to use it
2016-03-24 20:49:50 johnlane you used to be able to just rename it to sessionstore.js and put it in the root of the profile then restart firefox. But it appears things have changed, so I am not sure now...
2016-03-24 20:50:45 TwistedLucidity Looking through Moz help just now. Cheers for this tip, didn't know it was a thing
2016-03-24 20:51:34 johnlane that's ok :) I've lost count of the number of times I have nearly lost my tabs...
2016-03-24 20:54:00 TwistedLucidity Nah, tabs can't be restored. Everything is gone
2016-03-24 20:54:24 TwistedLucidity Maybe it's time to find a new browser?
2016-03-24 20:55:27 johnlane I've thought the same thing. I have Chromium but my desire for Pentadavtyl keeps me coming back.
2016-03-24 20:56:13 TwistedLucidity I'm going to log a bug, data destruction with no warning is unforgivable
2016-03-24 21:04:40 The-Compiler *cough* qutebrowser *cough* ;)
2016-03-24 21:04:54 The-Compiler (though it doesn't have crash recovery currently either)
2016-03-24 21:05:21 TwistedLucidity It has my history at least. Why they had to delete all my tabs is beyond me
2016-03-24 21:06:44 - ideasman42 (~cambo@203-206-123-225.dyn.iinet.net.au) has joined #linuxvoice
2016-03-24 21:07:01 popey (~alan@cpc81199-farn9-2-0-cust577.6-2.cable.virginm.net) has quit (Changing host)
2016-03-24 21:07:01 - popey (~alan@ubuntu/member/popey) has joined #linuxvoice
2016-03-24 21:10:20 TwistedLucidity In the good news department, I got autossh to start at boot using systemd. \o/ Top-tip: don't use the "-f" switch, it will break.
2016-03-24 21:10:30 TwistedLucidity No idea whu
2016-03-24 21:10:32 TwistedLucidity why
2016-03-24 21:10:48 Blackisle http://www.haneycodes.net/npm-left-pad-have-we-forgotten-how-to-program/
2016-03-24 21:10:50 Blackisle heh
2016-03-24 21:10:50 LVbot ^ NPM left-pad: Have We Forgotten How To Program? Haney Codes NET
2016-03-24 21:12:16 TwistedLucidity Ehhhh...don't reinvent the wheel?
2016-03-24 21:13:05 TwistedLucidity Our stack uses (or has created) loads of simple, 1-4 line methods.
2016-03-24 21:14:01 TwistedLucidity "StringUtils.isEmpty(foo)" or "foo==null || foo.length==0"? One will get rejected during code review....
2016-03-24 21:19:47 TwistedLucidity As to NPM...it's just javascript, not real programming
2016-03-24 21:19:52 * TwistedLucidity runs away laughing
2016-03-24 21:20:44 - Ian (~Thunderbi@te6compton.te.rl.ac.uk) has joined #linuxvoice
2016-03-24 21:21:07 Ian is now known as Guest6252
2016-03-24 21:28:28 Stilvoid in two minds about that post
2016-03-24 21:28:41 Stilvoid follow it to its conclusion and we're statically linking everything ;)
2016-03-24 21:28:44 Stilvoid maybe that's not a bad thing
2016-03-24 21:28:47 Stilvoid works fine for Go
2016-03-24 21:28:57 Stilvoid disk space is cheap eh
2016-03-24 21:33:06 TwistedLucidity Take any solution far enough and you cause problems. The main skill in any job is knowing when to stop.
2016-03-24 21:33:51 TwistedLucidity This is also intersting (got it from one of our JS devs when I mentioned the other NPM story): https://medium.com/@azerbike/i-ve-just-liberated-my-modules-9045c06be67c
2016-03-24 21:33:53 LVbot ^ I’ve Just Liberated My Modules Medium
2016-03-24 21:41:57 Stilvoid that sounds like he failed at talking to the npm guys about it
2016-03-24 21:42:25 Stilvoid there's no way there's a trademark violation there and sounds like npm chaps just got scared because they're not legal types which is sadly all too common
2016-03-24 21:42:30 Stilvoid and I guess why we have the FSF et al
2016-03-24 21:45:49 TwistedLucidity Indeed, indeed. Even if a company called "kiK" existed, trademarks are limited and even then; they have to lead to confusion for there to be a problem.
2016-03-24 21:56:38 Blackisle http://left-pad.io/
2016-03-24 21:56:39 Blackisle lol
2016-03-24 21:59:44 Stilvoid brilliant :D
2016-03-24 21:59:54 TwistedLucidity Blackisle: Saas? Sarcasm as a Service?
2016-03-24 22:02:11 Blackisle lol :)
2016-03-24 22:02:13 - jrullo (~jr1@cpe-76-173-2-194.hawaii.res.rr.com) has joined #linuxvoice
2016-03-24 22:23:15 - M1C4HTRON13 (~micah@bodhilinux/team/M1C4HTRON13) has joined #linuxvoice
2016-03-24 23:03:22 Ioangogo https://www.twitch.tv/bwatanabe deer playing GTA 5
2016-03-24 23:03:24 LVbot ^ Twitch
2016-03-24 23:03:28 Ioangogo a ai deer
2016-03-24 23:04:30 hamgammon haha my boss told me about that
2016-03-24 23:04:59 hamgammon i was like "i watched it get chased by a police helicopter the other night" he just looked at me
2016-03-24 23:07:58 zmoylan-pi not a very good ai. it doesn't forage, it walks very close to humans
2016-03-24 23:08:28 zmoylan-pi only needs 2-3 rules to make it behave much more like real deer
2016-03-24 23:11:45 TwistedLucidity Flash....urgh....
2016-03-24 23:12:16 - slashd (~slashd@modemcable157.191-130-66.mc.videotron.ca) has joined #linuxvoice
2016-03-24 23:12:45 slashd (~slashd@modemcable157.191-130-66.mc.videotron.ca) has quit (Changing host)
2016-03-24 23:12:46 - slashd (~slashd@ubuntu/member/slashd) has joined #linuxvoice
2016-03-24 23:15:06 TwistedLucidity Rats, can't see video. Oh well.
2016-03-24 23:27:09 Blackisle https://www.youtube.com/watch?v=3XQOO6kvHFY
2016-03-24 23:27:11 LVbot ^ Bipedal Robotic Running on DURUS-2D YouTube
2016-03-24 23:37:05 - jaake (~h4ckm3@129.59.122.24) has joined #linuxvoice
2016-03-24 23:37:34 Ioangogo zmoylan-pi: i want him to opensource the hook script to allow people to make a better ai
2016-03-24 23:39:04 mavrix (~mavrix@unaffiliated/mavrix) has quit (Ping timeout: 268 seconds)
2016-03-24 23:40:30 - mavrix (~mavrix@unaffiliated/mavrix) has joined #linuxvoice
2016-03-24 23:41:07 jrullo (~jr1@cpe-76-173-2-194.hawaii.res.rr.com) has quit (Quit: be excellent to each other)
2016-03-24 23:43:43 foxhunt72 is now known as foxhunt_away
2016-03-24 23:44:27 Ioangogo TwistedLucidity: get livestreamer and livestreamer-twitch-gui
2016-03-24 23:47:18 Ioangogo I might see if i can get the sugest command working
2016-03-24 23:47:22 TwistedLucidity Ioangogo: Probably will once I move to 16.04; I go on Twitch so rarely
2016-03-24 23:47:59 Ioangogo TwistedLucidity: just get livestreamer them, it has more sites than twitch
2016-03-24 23:48:29 m95lag (~m95lag@82-181-169-179.bb.dnainternet.fi) has quit (Quit: leaving)
2016-03-24 23:48:56 Ioangogo http://www.theregister.co.uk/2016/03/24/water_utility_hacked/?utm_source=dlvr.it&utm_medium=facebook
2016-03-24 23:48:58 LVbot ^ Hacktivists caught tampering with water treatment plant The Register
2016-03-25 00:07:47 TwistedLucidity Why were those controls ever attached to a public network?
2016-03-25 00:08:47 TwistedLucidity Not defending the the attackers, but time and again we see stuff that has no business being publicly accessible being on the public Internet.
2016-03-25 00:12:08 zmoylan-pi yeah, if a 12yo can break into your system the person who decided to make it vulnerable should be punished
2016-03-25 00:13:18 Ioangogo TwistedLucidity: Becuse of the rise of working from homw
2016-03-25 00:13:23 Ioangogo *home
2016-03-25 00:13:55 zmoylan-pi and when they say working they mean been on call at 3am to fix things
2016-03-25 00:14:55 TwistedLucidity Ioangogo: At the very least, such systems should only be connected to the corporate/local LAN and only accessble via a VPN (or similar)
2016-03-25 00:15:03 TwistedLucidity Based on this: login credentials for the AS/400 were stored on the front-end web server
2016-03-25 00:15:13 Ioangogo The device being behind a firewall only accsessable with a VPN
2016-03-25 00:15:16 TwistedLucidity I assume those details were public
2016-03-25 00:15:34 Ioangogo its silly
2016-03-25 00:15:45 TwistedLucidity Also, you can just tell some people "Tough, no telecommuting for you!"
2016-03-25 00:16:30 TwistedLucidity Soon they'll have IoT light bulbs that run their own DHCP and gateways.....
2016-03-25 00:16:37 TwistedLucidity (I am not making that up)
2016-03-25 00:17:13 zmoylan-pi and the admin password 'password' will be hardcoded in firmware
2016-03-25 00:17:27 TwistedLucidity Actually, it was if memory serves
2016-03-25 00:17:40 Ioangogo Thats why i like the DIY IoT, you control the implentstion
2016-03-25 00:17:51 TwistedLucidity The compnay said as the product was no longer sold, they did not have to supply security updates or release the GPL code
2016-03-25 00:18:24 TwistedLucidity Ioangogo: Yeah, I have no issue with the fridge (or whatever) speaking to *my* server. Just not out to Samsung's etc
2016-03-25 00:19:11 Ioangogo I want to set up openhab with thoes lightbubls that talk only with a usb device pluged into the server
2016-03-25 00:19:31 jaake (~h4ckm3@129.59.122.24) has quit (Ping timeout: 252 seconds)
2016-03-25 00:20:11 TwistedLucidity Let me find the lightbulb article...it's a good horror story
2016-03-25 00:20:16 zmoylan-pi a usb dongle for light bulbs... that sounds horrible
2016-03-25 00:20:22 Ioangogo or build a arduino/pi controler
2016-03-25 00:20:42 TwistedLucidity https://mjg59.dreamwidth.org/40397.html
2016-03-25 00:20:47 LVbot ^ mjg59 I bought some awful light bulbs so you don't have to
2016-03-25 00:20:56 zmoylan-pi i used to write software protected by dongle plugged into parallel port. nothing but trouble talking to the dongle
2016-03-25 00:21:24 TwistedLucidity I quite like the idea of one (two?) RasPis with an e-ink display for stuff like that.
2016-03-25 00:21:33 Ioangogo I might just make a controler
2016-03-25 00:21:52 TwistedLucidity Maybe a few solar-powered ones (battery back-up) in the garden to monitor moisture, control watering and report back.
2016-03-25 00:21:58 TwistedLucidity But I simply don't have the time/skill to do such a thing.
2016-03-25 00:22:31 TwistedLucidity zmoylan-pi: I remember dongles. The rage. The pure, incandescent rage!
2016-03-25 00:22:48 Ioangogo I have a IoT thermostat and weather sation that the web part mainly allows the user to control from phone, see usage and probably do math
2016-03-25 00:23:09 Ioangogo It will still work with no wifi or the servers going down
2016-03-25 00:23:31 zmoylan-pi that you pc stuck out 2 inches from the wall because of the dongle screwed in which was bloody annoying and damaging to the port if handled wrong
2016-03-25 00:25:21 Ioangogo Im building a IoT Raspberry PI IR blaster
2016-03-25 00:26:23 Stilvoid heh I was thinking about doing that
2016-03-25 00:27:02 Ioangogo I might write a small document on making it
2016-03-25 00:28:08 Ioangogo I need better software for making the SVG remote images
2016-03-25 00:28:25 Ioangogo inkscape it a pain
2016-03-25 00:32:57 - jherrmann (jirkah@nat/redhat/x-iosnnbzmjsotahxx) has joined #linuxvoice
2016-03-25 00:33:55 - schmidttrigger (~Mutter@193.17.11.30) has joined #linuxvoice
2016-03-25 00:34:02 - jaake (~h4ckm3@129.59.122.24) has joined #linuxvoice
2016-03-25 00:36:17 schmidttrigger (~Mutter@193.17.11.30) has quit (Client Quit)
2016-03-25 00:39:37 Stilvoid inkscape is awful
2016-03-25 00:39:43 Stilvoid I tend to use graphviz for most things
2016-03-25 00:40:00 jherrmann (jirkah@nat/redhat/x-iosnnbzmjsotahxx) has quit (Remote host closed the connection)
2016-03-25 00:40:01 Stilvoid or draw.io if I want something simple
2016-03-25 00:41:39 - jherrmann (jirkah@nat/redhat/x-qakjcsupnwesjlic) has joined #linuxvoice
2016-03-25 00:43:08 foxhunt_away is now known as foxhunt72
2016-03-25 00:46:56 TwistedLucidity LOL-overflow
2016-03-25 00:46:58 TwistedLucidity http://www.telegraph.co.uk/technology/2016/03/24/microsofts-teen-girl-ai-turns-into-a-hitler-loving-sex-robot-wit/
2016-03-25 00:46:59 LVbot ^ Microsoft's teen girl' AI turns into a Hitler-loving sex robot within 24 hours
2016-03-25 00:47:48 - JackJames (~ident@45.114.116.124) has joined #linuxvoice
2016-03-25 00:51:46 Ioangogo TwistedLucidity: i like how every one is like "AI IS EVIL" and im like, Its us, the ai is just learning from evil people called trolls
2016-03-25 01:03:45 Devilment http://www.bbc.co.uk/news/technology-34312697
2016-03-25 01:03:45 TwistedLucidity We know we are evil, but we don't care. We could solve world hunger tomorrow (just about), but we' rather spend a few trillion $£€ bombing them instead, because that dirverts cash to the elites
2016-03-25 01:03:47 LVbot ^ Do you have the brains for cybersecurity? BBC News
2016-03-25 01:05:53 TwistedLucidity Actually, we could solve just about any problem if we took the resources we wasted oppressing each other and put them to good use.
2016-03-25 01:06:06 TwistedLucidity Agent Smith was right. :-(
2016-03-25 01:23:16 JackJames (~ident@45.114.116.124) has quit (Read error: Connection reset by peer)
2016-03-25 01:23:37 - JackJames (~ident@26.06.01a8.ip4.static.sl-reverse.com) has joined #linuxvoice
2016-03-25 01:24:01 - Paddy_NI (~patrick@host-92-14-224-66.as43234.net) has joined #linuxvoice
2016-03-25 01:26:55 - Jack-James (~ident@45.114.116.124) has joined #linuxvoice
2016-03-25 01:28:48 JackJames (~ident@26.06.01a8.ip4.static.sl-reverse.com) has quit (Ping timeout: 276 seconds)
2016-03-25 01:31:24 - gareppa (~gareppa@151.31.42.3) has joined #linuxvoice
2016-03-25 01:56:08 - TraceyC (~TraceyC@c-98-194-48-190.hsd1.tx.comcast.net) has joined #linuxvoice
2016-03-25 01:58:34 Paddy_NI (~patrick@host-92-14-224-66.as43234.net) has quit (Remote host closed the connection)
2016-03-25 02:08:55 - Paddy_NI (~patrick@host-92-14-224-66.as43234.net) has joined #linuxvoice
2016-03-25 02:13:13 zmoylan-pi (~pi@109.76.84.186) has quit (*.net *.split)
2016-03-25 02:13:13 thesilentboatman (~thesilent@c83-248-87-13.bredband.comhem.se) has quit (*.net *.split)
2016-03-25 02:13:13 xraynorm (~xraynorm@169.7.200.146.dyn.plus.net) has quit (*.net *.split)
2016-03-25 02:13:14 draake (~h4ckm3@c-68-52-45-79.hsd1.tn.comcast.net) has quit (*.net *.split)
2016-03-25 02:13:14 corsack (~pi@cpc21-hudd9-2-0-cust116.4-1.cable.virginm.net) has quit (*.net *.split)
2016-03-25 02:17:58 - zeldovich (~zeldovich@eri-197-75.d.port.ac.uk) has joined #linuxvoice
2016-03-25 02:18:29 - mnavrati (milan@nat/redhat/x-tuktnpmnwwhmhggs) has joined #linuxvoice
2016-03-25 02:24:06 Paddy_NI (~patrick@host-92-14-224-66.as43234.net) has quit (Quit: Konversation terminated!)
2016-03-25 02:25:33 - draake (~h4ckm3@c-68-52-45-79.hsd1.tn.comcast.net) has joined #linuxvoice
2016-03-25 02:29:39 - zmoylan-pi (~pi@109.76.84.186) has joined #linuxvoice
2016-03-25 02:29:39 - xraynorm (~xraynorm@169.7.200.146.dyn.plus.net) has joined #linuxvoice
2016-03-25 02:29:39 - thesilentboatman (~thesilent@c83-248-87-13.bredband.comhem.se) has joined #linuxvoice
2016-03-25 02:29:39 - corsack (~pi@cpc21-hudd9-2-0-cust116.4-1.cable.virginm.net) has joined #linuxvoice
2016-03-25 02:31:36 arubislander (~ArubIslan@86.93.93.218) has quit (Remote host closed the connection)
2016-03-25 02:36:20 - arubislander (~ArubIslan@86.93.93.218) has joined #linuxvoice
2016-03-25 02:37:03 jaake (~h4ckm3@129.59.122.24) has quit (Ping timeout: 276 seconds)
2016-03-25 02:39:53 - jaake (~h4ckm3@129.59.122.24) has joined #linuxvoice
2016-03-25 02:52:02 mnavrati (milan@nat/redhat/x-tuktnpmnwwhmhggs) has quit (Quit: Leaving)
2016-03-25 02:58:28 mavrix (~mavrix@unaffiliated/mavrix) has quit (Ping timeout: 252 seconds)
2016-03-25 03:00:14 - mavrix (~mavrix@unaffiliated/mavrix) has joined #linuxvoice
2016-03-25 03:11:02 Jack-James (~ident@45.114.116.124) has quit (Read error: Connection reset by peer)
2016-03-25 03:25:43 - schmidttrigger (~Mutter@tmo-108-242.customers.d1-online.com) has joined #linuxvoice
2016-03-25 03:28:33 schmidttrigger (~Mutter@tmo-108-242.customers.d1-online.com) has quit (Client Quit)
2016-03-25 03:31:48 - writtenoff (~writtenof@of1.psych.ubc.ca) has joined #linuxvoice
2016-03-25 03:34:17 zeldovich (~zeldovich@eri-197-75.d.port.ac.uk) has quit (Ping timeout: 260 seconds)
2016-03-25 03:46:14 andybalaam Just for the record, I really like Inkscape
2016-03-25 03:55:13 - zeldovich (~zeldovich@eri-197-75.d.port.ac.uk) has joined #linuxvoice
2016-03-25 03:58:36 gareppa (~gareppa@151.31.42.3) has quit (Quit: Leaving)
2016-03-25 04:08:47 Stilvoid andybalaam: I guess you also love RSI? ;)
2016-03-25 04:09:30 andybalaam Stilvoid, it is heavy on the mouse, but I guess I see no alternative for drawing
2016-03-25 04:09:53 andybalaam I have mostly used it for hand-drawing cartoon-like figures
2016-03-25 04:10:10 Stilvoid ah yeah ok, for that I can see it being actually pretty good
2016-03-25 04:10:18 Stilvoid it's architectural diagrams etc. that made me hate it
2016-03-25 04:10:24 Stilvoid and love graphviz :)
2016-03-25 04:10:34 foxhunt72 is now known as foxhunt_away
2016-03-25 04:14:11 andybalaam Yeah, for diagrams I don't think I'd choose it
2016-03-25 04:14:27 andybalaam although I get very frustrated with LibreOffice Impress
2016-03-25 04:14:40 andybalaam so I have been known to switch to Inkscape
2016-03-25 04:14:52 andybalaam but "connectors" in Inkscape seem very buggy
2016-03-25 04:25:13 andybalaam (andybalaam@nat/ibm/x-fkembxeduksbktjr) has quit (Remote host closed the connection)
2016-03-25 04:32:39 TwistedLucidity (~TwistedLu@cpc80671-stap13-2-0-cust118.12-2.cable.virginm.net) has quit (Quit: Konversation terminated!)
2016-03-25 04:34:02 Guest6252 (~Thunderbi@te6compton.te.rl.ac.uk) has quit (Quit: Guest6252)
2016-03-25 04:44:16 xplora1a (~stuart@81.144.225.214) has quit (Ping timeout: 264 seconds)
2016-03-25 04:46:34 M1C4HTRON13 (~micah@bodhilinux/team/M1C4HTRON13) has quit (Ping timeout: 240 seconds)
2016-03-25 04:58:16 - M1C4HTRON13 (~micah@bodhilinux/team/M1C4HTRON13) has joined #linuxvoice
2016-03-25 04:59:17 arubislander (~ArubIslan@86.93.93.218) has quit (Quit: Leaving.)
2016-03-25 05:01:26 M1C4HTRON13 (~micah@bodhilinux/team/M1C4HTRON13) has quit (Remote host closed the connection)
2016-03-25 05:10:31 - Nitronium (~Dave@host213-123-9-170.range213-123.btcentralplus.com) has joined #linuxvoice
2016-03-25 05:13:01 zeldovich (~zeldovich@eri-197-75.d.port.ac.uk) has quit (Remote host closed the connection)
2016-03-25 05:43:34 jaake (~h4ckm3@129.59.122.24) has quit (Ping timeout: 260 seconds)
2016-03-25 06:19:38 ideasman42 (~cambo@203-206-123-225.dyn.iinet.net.au) has quit (Quit: Ex-Chat)
2016-03-25 06:27:48 frankbell (~The_Farme@ip98-183-208-12.hr.hr.cox.net) has quit (Ping timeout: 276 seconds)
2016-03-25 06:30:25 - frankbell (~The_Farme@ip98-183-208-12.hr.hr.cox.net) has joined #linuxvoice
2016-03-25 06:53:48 ryuslash (~slash@2a02:1812:2518:ce00:f24d:a2ff:fede:451c) has quit (Ping timeout: 246 seconds)
2016-03-25 07:00:05 - asusk7m550 (~Thunderbi@2001:981:97b3:1:bc21:82d8:bd9b:d256) has joined #linuxvoice
2016-03-25 07:01:51 - dankeast (~dan@host86-133-97-101.range86-133.btcentralplus.com) has joined #linuxvoice
2016-03-25 07:03:03 - mnavrati (~milan@ip-94-112-188-159.net.upcbroadband.cz) has joined #linuxvoice
2016-03-25 07:03:33 TraceyC (~TraceyC@c-98-194-48-190.hsd1.tx.comcast.net) has quit (Ping timeout: 276 seconds)
2016-03-25 07:04:36 - swift110-phone (~swift110-@unaffiliated/swift110) has joined #linuxvoice
2016-03-25 07:06:02 swift110-phone Hey
2016-03-25 07:07:56 swift110-phone (~swift110-@unaffiliated/swift110) has quit (Client Quit)
2016-03-25 07:08:49 dankeast (~dan@host86-133-97-101.range86-133.btcentralplus.com) has quit (Ping timeout: 240 seconds)
2016-03-25 07:14:33 - swift110-phone (~swift110-@unaffiliated/swift110) has joined #linuxvoice
2016-03-25 07:14:36 swift110-phone (~swift110-@unaffiliated/swift110) has quit (Max SendQ exceeded)
2016-03-25 07:16:21 - dankeast (~dan@host86-133-97-101.range86-133.btcentralplus.com) has joined #linuxvoice
2016-03-25 07:16:53 - swift110-phone (~swift110-@unaffiliated/swift110) has joined #linuxvoice
2016-03-25 07:16:55 swift110-phone (~swift110-@unaffiliated/swift110) has quit (Excess Flood)
2016-03-25 07:17:41 - swift110-phone (~swift110-@unaffiliated/swift110) has joined #linuxvoice
2016-03-25 07:30:15 Ioangogo hi
2016-03-25 07:57:45 johnlane (~john@johnlane.plus.com) has quit (Remote host closed the connection)
2016-03-25 08:02:22 asusk7m550 (~Thunderbi@2001:981:97b3:1:bc21:82d8:bd9b:d256) has quit (Remote host closed the connection)
2016-03-25 08:08:02 aptanet (~quassel@humpback.aptanet.net) has quit (Ping timeout: 240 seconds)
2016-03-25 08:08:15 - aptanet (~quassel@humpback.aptanet.net) has joined #linuxvoice
2016-03-25 08:11:36 jherrmann (jirkah@nat/redhat/x-qakjcsupnwesjlic) has quit (Quit: Toodle pip!)
2016-03-25 08:17:27 swift110-phone How are you ioangogo
2016-03-25 08:17:53 - JackJames (~ident@120.29.49.16) has joined #linuxvoice
2016-03-25 08:24:26 Ioangogo good
2016-03-25 08:24:38 Ioangogo watching techsnap
2016-03-25 08:34:12 aptanet (~quassel@humpback.aptanet.net) has quit (Remote host closed the connection)
2016-03-25 08:34:49 topcyde (~topcyde@2602:304:cdb8:9e40:5c0:f18c:25f0:1490) has quit (Ping timeout: 240 seconds)
2016-03-25 08:37:06 - aptanet (~quassel@humpback.aptanet.net) has joined #linuxvoice
2016-03-25 08:39:19 james_olympus I've just been playing a new Spectrum game called 'DARK CASTLE'
2016-03-25 08:39:40 james_olympus Some dedicated programmers are still writing Spectrum games!
2016-03-25 08:40:10 Ioangogo i bet there is some opesource game for the sprectrum
2016-03-25 08:41:05 - topcyde (~topcyde@2602:304:cdb8:9e40:5c0:f18c:25f0:1490) has joined #linuxvoice
2016-03-25 08:43:56 james_olympus Probably open source development tools now
2016-03-25 08:44:33 james_olympus It should be easier to write software on a modern computer and 'compile' it for a Spectrum
2016-03-25 08:44:44 zmoylan-pi (~pi@109.76.84.186) has quit (*.net *.split)
2016-03-25 08:44:44 thesilentboatman (~thesilent@c83-248-87-13.bredband.comhem.se) has quit (*.net *.split)
2016-03-25 08:44:44 xraynorm (~xraynorm@169.7.200.146.dyn.plus.net) has quit (*.net *.split)
2016-03-25 08:44:44 corsack (~pi@cpc21-hudd9-2-0-cust116.4-1.cable.virginm.net) has quit (*.net *.split)
2016-03-25 09:00:22 swift110-phone (~swift110-@unaffiliated/swift110) has quit (Ping timeout: 252 seconds)
2016-03-25 09:00:40 - zmoylan-pi (~pi@109.76.84.186) has joined #linuxvoice
2016-03-25 09:00:40 - thesilentboatman (~thesilent@c83-248-87-13.bredband.comhem.se) has joined #linuxvoice
2016-03-25 09:00:40 - corsack (~pi@cpc21-hudd9-2-0-cust116.4-1.cable.virginm.net) has joined #linuxvoice
2016-03-25 09:01:18 corsack (~pi@cpc21-hudd9-2-0-cust116.4-1.cable.virginm.net) has quit (Read error: Connection reset by peer)
2016-03-25 09:01:32 - corsack (~pi@cpc21-hudd9-2-0-cust116.4-1.cable.virginm.net) has joined #linuxvoice
2016-03-25 09:27:59 dankeast (~dan@host86-133-97-101.range86-133.btcentralplus.com) has quit (Ping timeout: 268 seconds)
2016-03-25 09:32:47 - ryuslash (~slash@2a02:1812:2518:ce00:f24d:a2ff:fede:451c) has joined #linuxvoice
2016-03-25 09:43:33 ryuslash (~slash@2a02:1812:2518:ce00:f24d:a2ff:fede:451c) has quit (Ping timeout: 246 seconds)
2016-03-25 09:50:16 - georgeowell (~georgeowe@95.149.192.174) has joined #linuxvoice
2016-03-25 09:53:50 Nitronium (~Dave@host213-123-9-170.range213-123.btcentralplus.com) has quit (Remote host closed the connection)
2016-03-25 11:04:56 writtenoff (~writtenof@of1.psych.ubc.ca) has quit (Quit: WeeChat 1.3)
2016-03-25 11:16:50 - jaake (~h4ckm3@c-68-52-45-79.hsd1.tn.comcast.net) has joined #linuxvoice
2016-03-25 11:33:41 LauRoman (~LauRoman@5-14-7-240.residential.rdsnet.ro) has quit (Read error: Connection reset by peer)
2016-03-25 12:32:49 jaake (~h4ckm3@c-68-52-45-79.hsd1.tn.comcast.net) has quit (Ping timeout: 240 seconds)
2016-03-25 12:48:44 - jaake (~h4ckm3@c-68-52-45-79.hsd1.tn.comcast.net) has joined #linuxvoice
2016-03-25 12:52:54 - writtenoff (~writtenof@d172-218-204-26.bchsia.telus.net) has joined #linuxvoice
2016-03-25 12:53:07 jaake (~h4ckm3@c-68-52-45-79.hsd1.tn.comcast.net) has quit (Ping timeout: 248 seconds)
2016-03-25 13:26:29 - towy71_ (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has joined #linuxvoice
2016-03-25 13:28:42 towy71 (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has quit (Ping timeout: 260 seconds)
2016-03-25 13:46:11 - brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has joined #linuxvoice
2016-03-25 13:50:16 chemist69 (~apl@2a02:560:415d:cb00:e65:1928:9ec6:ecfa) has quit (Ping timeout: 264 seconds)
2016-03-25 13:52:04 slashd (~slashd@ubuntu/member/slashd) has quit (Quit: Leaving)
2016-03-25 13:58:16 - zmoylan-1i (~pi@109.79.217.248) has joined #linuxvoice
2016-03-25 14:00:51 zmoylan-pi (~pi@109.76.84.186) has quit (Ping timeout: 248 seconds)
2016-03-25 14:03:52 - chemist69 (~apl@2a02:560:417e:7000:76a1:6ae1:a582:e6a9) has joined #linuxvoice
2016-03-25 14:25:52 - jaake (~h4ckm3@c-68-52-45-79.hsd1.tn.comcast.net) has joined #linuxvoice
2016-03-25 14:33:50 brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has quit (Ping timeout: 248 seconds)
2016-03-25 14:41:33 - brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has joined #linuxvoice
2016-03-25 16:03:37 zmoylan-1i (~pi@109.79.217.248) has quit (Ping timeout: 240 seconds)
2016-03-25 16:08:00 - zmoylan-pi (~pi@93.107.255.177) has joined #linuxvoice
2016-03-25 17:13:18 - swift110-phone (~swift110-@unaffiliated/swift110) has joined #linuxvoice
2016-03-25 17:30:36 swift110-phone (~swift110-@unaffiliated/swift110) has quit (Read error: Connection reset by peer)
2016-03-25 17:54:39 - LauRoman (~LauRoman@5-14-7-240.residential.rdsnet.ro) has joined #linuxvoice
2016-03-25 18:03:49 - swift110-phone (~swift110-@unaffiliated/swift110) has joined #linuxvoice
2016-03-25 18:05:26 swift110-phone Hey
2016-03-25 18:32:06 - schmidttrigger (~Mutter@p54A5CAA9.dip0.t-ipconnect.de) has joined #linuxvoice
2016-03-25 18:35:05 schmidttrigger (~Mutter@p54A5CAA9.dip0.t-ipconnect.de) has quit (Remote host closed the connection)
2016-03-25 18:48:29 JackJames (~ident@120.29.49.16) has quit (Quit: ZNC 1.6.3 - http://znc.in)
2016-03-25 18:51:20 - arubislander (~ArubIslan@86.93.93.218) has joined #linuxvoice
2016-03-25 19:03:27 foxhunt_away is now known as foxhunt72
2016-03-25 19:30:49 - TwistedLucidity (~TwistedLu@cpc80671-stap13-2-0-cust118.12-2.cable.virginm.net) has joined #linuxvoice
2016-03-25 19:51:08 - dankeast (~dan@host86-133-97-101.range86-133.btcentralplus.com) has joined #linuxvoice
2016-03-25 20:14:07 jimbotux (~jimbotux@fpc3-sgyl30-2-0-cust5.18-2.static.cable.virginm.net) has quit (Ping timeout: 252 seconds)
2016-03-25 20:17:51 TwistedLucidity Now there is a very curious thing. VM are sending me a new SuperHub and they don't want the old one back; I wonder what uses that can be put to?
2016-03-25 20:17:58 brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has quit (Remote host closed the connection)
2016-03-25 20:18:21 - brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has joined #linuxvoice
2016-03-25 20:26:00 - jimbotux (~jimbotux@fpc3-sgyl30-2-0-cust5.18-2.static.cable.virginm.net) has joined #linuxvoice
2016-03-25 20:26:50 - johnlane (~john@212.159.104.145) has joined #linuxvoice
2016-03-25 20:28:06 - ryuslash (~slash@2a02:1812:2518:ce00:f24d:a2ff:fede:451c) has joined #linuxvoice
2016-03-25 20:29:26 brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has quit (Remote host closed the connection)
2016-03-25 20:29:53 - brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has joined #linuxvoice
2016-03-25 20:36:03 Devilment TwistedLucidity: A doorstop
2016-03-25 20:36:45 TwistedLucidity Devilment: LOL! Was thinking it could maybe be flashed and turned into something quasi-useful. Or gutted and turned into a Pi case.
2016-03-25 20:36:59 TwistedLucidity Actaully, that's not a bad idea. Wonder if the antenna can be attached?
2016-03-25 20:39:11 - foxhunt1972 (~r.devos@vps2.zorro-online.nl) has joined #linuxvoice
2016-03-25 20:39:50 foxhunt72 (~r.devos@vps2.zorro-online.nl) has quit (Ping timeout: 240 seconds)
2016-03-25 20:39:50 writtenoff (~writtenof@d172-218-204-26.bchsia.telus.net) has quit (Ping timeout: 240 seconds)
2016-03-25 20:40:29 - writtenoff (~writtenof@d172-218-204-26.bchsia.telus.net) has joined #linuxvoice
2016-03-25 20:42:27 dankeast (~dan@host86-133-97-101.range86-133.btcentralplus.com) has quit (Ping timeout: 250 seconds)
2016-03-25 20:42:57 - Nitronium (~Dave@host213-123-9-170.range213-123.btcentralplus.com) has joined #linuxvoice
2016-03-25 20:44:34 Devilment I think they're too locked down to be reflashable
2016-03-25 20:44:50 Devilment But a R-Pi case would be interesting
2016-03-25 20:45:03 Devilment It'd have decent OS inside it for once
2016-03-25 21:02:12 ryuslash (~slash@2a02:1812:2518:ce00:f24d:a2ff:fede:451c) has quit (Ping timeout: 246 seconds)
2016-03-25 21:09:06 TwistedLucidity Devilment: Probably right, and I could never attach it to VM again. But if it was flashable (say with OpenWRT) I could use it to experiment on without fear.
2016-03-25 21:09:34 TwistedLucidity If that fails, I 'll go down to the Hackspace and attach it with a Dremel (other grinding tools are available)
2016-03-25 21:25:35 - ryuslash (~slash@2a02:1812:2518:ce00:f24d:a2ff:fede:451c) has joined #linuxvoice
2016-03-25 21:31:49 - M1C4HTRON13 (~micah@bodhilinux/team/M1C4HTRON13) has joined #linuxvoice
2016-03-25 21:51:47 brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has quit (Ping timeout: 248 seconds)
2016-03-25 22:21:50 chemist69 (~apl@2a02:560:417e:7000:76a1:6ae1:a582:e6a9) has quit (Quit: WeeChat 1.4)
2016-03-25 22:43:53 - schmidttrigger (~Mutter@p54A5CAA9.dip0.t-ipconnect.de) has joined #linuxvoice
2016-03-25 22:46:33 - TraceyC (~TraceyC@2620:0:28a2:4020:28eb:c02d:2b29:346c) has joined #linuxvoice
2016-03-25 22:47:45 schmidttrigger (~Mutter@p54A5CAA9.dip0.t-ipconnect.de) has quit (Client Quit)
2016-03-25 23:26:49 - Paddy_NI (~patrick@host-92-14-224-66.as43234.net) has joined #linuxvoice
2016-03-25 23:44:02 - chemist69 (~apl@2a02:560:417e:7000:c23f:d5ff:fe65:b192) has joined #linuxvoice
2016-03-25 23:49:08 Ioangogo !coffee
2016-03-25 23:49:10 * LVbot grabs the coffee funnel and advances toward Ioangogo
2016-03-25 23:50:00 * TraceyC raises a mug
2016-03-25 23:50:21 * zmoylan-pi puts on waffles and chicken nuggests...
2016-03-25 23:50:49 TraceyC Are you from the south of US by any chance? I never heard of fried chicken & pancakes until talking to southerners
2016-03-25 23:51:36 zmoylan-pi potato waffles...
2016-03-25 23:51:48 TraceyC aka latkes
2016-03-25 23:51:49 TraceyC :D
2016-03-25 23:51:50 TraceyC good stuff
2016-03-26 00:05:21 zmoylan-pi smartphoneitis: compulsion to charge phones not at 100%...
2016-03-26 00:05:56 zmoylan-pi my dumbphone is at 75% since last night when i forgot to charge it and although i know it's grand i keep wanting to charge it to 100%...
2016-03-26 00:10:45 TraceyC I can relate
2016-03-26 00:11:05 TraceyC For me it partially stems from the days when you had to charge your dumb phone 2 - 3 times a day to keep it alive
2016-03-26 00:11:20 * TraceyC does not miss having to have a car charger
2016-03-26 00:11:40 zmoylan-pi my god, what sort of crappy phones were you using? motorola?
2016-03-26 00:11:49 TraceyC One of them was, yes
2016-03-26 00:12:06 TraceyC Later on I had a small samsung flip phone that could keep a charge for about 3 - 5 days
2016-03-26 00:12:11 zmoylan-pi american phones... ick...
2016-03-26 00:12:15 TraceyC yeah
2016-03-26 00:12:45 TraceyC I've read stories that had a theme of "Hey you in the US, look at the type of phones they have in Japan and realize that what you have is what they tossed in the skip years ago"
2016-03-26 00:12:54 zmoylan-pi a mate had a motorola smart tac... battery life of minutes... i had a nokia 3310 then... almost indestructible... and great battery
2016-03-26 00:13:24 corsack and most importantly you could play snake :)
2016-03-26 00:13:31 TraceyC they were solid. Only issue I ever saw was the Nokia freezing from time to time, necessitating yanking the battery
2016-03-26 00:13:34 zmoylan-pi forever and ever...
2016-03-26 00:13:58 zmoylan-pi i have a great sudoku java app for current dumbphones...
2016-03-26 00:17:07 swift110-phone Hey
2016-03-26 00:42:01 Paddy_NI (~patrick@host-92-14-224-66.as43234.net) has quit (Quit: Konversation terminated!)
2016-03-26 00:50:56 - Paddy_NI (~patrick@host-92-14-224-66.as43234.net) has joined #linuxvoice
2016-03-26 00:58:31 mnavrati is now known as mnavrati_afk
2016-03-26 00:58:44 Nitronium (~Dave@host213-123-9-170.range213-123.btcentralplus.com) has quit (Remote host closed the connection)
2016-03-26 00:59:05 - slashd (~slashd@modemcable157.191-130-66.mc.videotron.ca) has joined #linuxvoice
2016-03-26 01:00:21 - gamerchick02 (~gamerchic@108.208.17.172) has joined #linuxvoice
2016-03-26 01:14:17 Paddy_NI (~patrick@host-92-14-224-66.as43234.net) has quit (Quit: Konversation terminated!)
2016-03-26 01:33:45 gamerchick02 (~gamerchic@108.208.17.172) has quit (Ping timeout: 276 seconds)
2016-03-26 01:56:41 - Nitronium (~Dave@host213-123-9-170.range213-123.btcentralplus.com) has joined #linuxvoice
2016-03-26 02:06:40 - gamerchick02 (~gamerchic@adsl-108-208-17-172.dsl.sgnwmi.sbcglobal.net) has joined #linuxvoice
2016-03-26 02:07:01 mnavrati_afk is now known as mnavrati
2016-03-26 02:15:59 foxhunt1972 is now known as foxhunt_away
2016-03-26 02:44:00 - ideasman42 (~cambo@203-206-123-225.dyn.iinet.net.au) has joined #linuxvoice
2016-03-26 02:54:25 - schmidttrigger (~Mutter@2a01:598:99c0:45ae:d19f:2d76:b30b:7126) has joined #linuxvoice
2016-03-26 02:55:41 schmidttrigger ...
2016-03-26 02:56:16 TraceyC ,
2016-03-26 03:02:49 schmidttrigger (~Mutter@2a01:598:99c0:45ae:d19f:2d76:b30b:7126) has quit (Ping timeout: 260 seconds)
2016-03-26 03:37:36 arubislander (~ArubIslan@86.93.93.218) has quit (Ping timeout: 244 seconds)
2016-03-26 03:48:54 Devilment https://plus.google.com/+NikCollection/posts/AFGsG2Di7EK
2016-03-26 03:48:57 LVbot ^ Today we’re making the Nik Collection available to everyone, for free.Photo…
2016-03-26 03:49:07 Devilment Google's $149 Nik Photo Editing Suite Goes Free
2016-03-26 03:51:16 corsack first bindiff and now this - they seem to be in a generous mood
2016-03-26 03:59:14 ideasman42 (~cambo@203-206-123-225.dyn.iinet.net.au) has quit (Quit: Ex-Chat)
2016-03-26 04:04:55 TraceyC (~TraceyC@2620:0:28a2:4020:28eb:c02d:2b29:346c) has quit (Quit: Off I go into the wild, blue yonder)
2016-03-26 04:15:05 The-Compiler (~compiler@qutebrowser/dev/The-Compiler) has left #linuxvoice ("WeeChat 1.4-dev")
2016-03-26 04:18:20 swift110-phone (~swift110-@unaffiliated/swift110) has quit (Ping timeout: 268 seconds)
2016-03-26 04:21:58 - swift110-phone (~swift110-@unaffiliated/swift110) has joined #linuxvoice
2016-03-26 04:22:12 swift110-phone (~swift110-@unaffiliated/swift110) has quit (Max SendQ exceeded)
2016-03-26 04:23:07 TwistedLucidity (~TwistedLu@cpc80671-stap13-2-0-cust118.12-2.cable.virginm.net) has quit (Quit: Konversation terminated!)
2016-03-26 04:29:16 gamerchick02 (~gamerchic@adsl-108-208-17-172.dsl.sgnwmi.sbcglobal.net) has quit (Ping timeout: 244 seconds)
2016-03-26 04:30:02 mnavrati (~milan@ip-94-112-188-159.net.upcbroadband.cz) has quit (Quit: Leaving)
2016-03-26 04:53:47 - swift110 (~swift110@205.201.255.5) has joined #linuxvoice
2016-03-26 05:12:22 swift110 (~swift110@205.201.255.5) has quit (Changing host)
2016-03-26 05:12:22 - swift110 (~swift110@unaffiliated/swift110) has joined #linuxvoice
2016-03-26 05:18:01 - Extremulus (~Extremulu@2001:470:b:1fb:deaf::d259) has joined #linuxvoice
2016-03-26 05:26:09 brianhunter (~brian@bhlm.net) has quit (Quit: WeeChat 1.0.1)
2016-03-26 05:26:23 - brianhunter (~brian@bhlm.net) has joined #linuxvoice
2016-03-26 05:43:40 swift110 (~swift110@unaffiliated/swift110) has quit (Ping timeout: 244 seconds)
2016-03-26 05:49:06 - gareppa (~gareppa@151.31.42.3) has joined #linuxvoice
2016-03-26 06:00:13 - gamerchick02 (~gamerchic@108.208.17.172) has joined #linuxvoice
2016-03-26 06:04:09 - dankeast (~dan@host86-133-97-101.range86-133.btcentralplus.com) has joined #linuxvoice
2016-03-26 06:14:45 gamerchick02 (~gamerchic@108.208.17.172) has quit (Quit: Leaving)
2016-03-26 06:20:31 dankeast (~dan@host86-133-97-101.range86-133.btcentralplus.com) has quit (Ping timeout: 250 seconds)
2016-03-26 06:21:38 - dankeast (~dan@host86-133-97-101.range86-133.btcentralplus.com) has joined #linuxvoice
2016-03-26 06:41:49 - gamerchick02 (~gamerchic@adsl-108-208-17-172.dsl.sgnwmi.sbcglobal.net) has joined #linuxvoice
2016-03-26 06:53:33 g0nz085 (~gonzo@cpc81199-farn9-2-0-cust619.6-2.cable.virginm.net) has quit (Ping timeout: 276 seconds)
2016-03-26 06:54:58 dankeast (~dan@host86-133-97-101.range86-133.btcentralplus.com) has quit (Ping timeout: 244 seconds)
2016-03-26 07:08:38 gareppa (~gareppa@151.31.42.3) has quit (Quit: Leaving)
2016-03-26 07:59:55 petrichor (~znc@unaffiliated/petrichor) has quit (Quit: ZNC - 1.6.0 - http://znc.in)
2016-03-26 08:02:36 - petrichor (~znc@unaffiliated/petrichor) has joined #linuxvoice
2016-03-26 08:05:08 petrichor (~znc@unaffiliated/petrichor) has quit (Client Quit)
2016-03-26 08:06:19 johnlane (~john@212.159.104.145) has quit (Remote host closed the connection)
2016-03-26 08:06:19 - petrichor (~znc@unaffiliated/petrichor) has joined #linuxvoice
2016-03-26 08:12:33 Nitronium (~Dave@host213-123-9-170.range213-123.btcentralplus.com) has quit (Remote host closed the connection)
2016-03-26 08:17:22 foxhunt_away is now known as foxhunt72
2016-03-26 08:27:40 - dankeast (~dan@host86-133-97-101.range86-133.btcentralplus.com) has joined #linuxvoice
2016-03-26 08:28:32 - jrullo (~jonas@cpe-66-8-141-28.hawaii.res.rr.com) has joined #linuxvoice
2016-03-26 08:35:03 slashd (~slashd@modemcable157.191-130-66.mc.videotron.ca) has quit (Quit: Leaving)
2016-03-26 08:36:57 dankeast (~dan@host86-133-97-101.range86-133.btcentralplus.com) has quit (Ping timeout: 246 seconds)
2016-03-26 08:56:25 - schmidttrigger (~Mutter@p54B3ED4D.dip0.t-ipconnect.de) has joined #linuxvoice
2016-03-26 08:59:53 schmidttrigger (~Mutter@p54B3ED4D.dip0.t-ipconnect.de) has quit (Client Quit)
2016-03-26 09:21:18 - dankeast (~dan@host86-133-97-101.range86-133.btcentralplus.com) has joined #linuxvoice
2016-03-26 09:27:01 dankeast (~dan@host86-133-97-101.range86-133.btcentralplus.com) has quit (Quit: Leaving)
2016-03-26 10:07:59 - brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has joined #linuxvoice
2016-03-26 10:20:12 brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has quit (Ping timeout: 246 seconds)
2016-03-26 10:21:20 ryuslash (~slash@2a02:1812:2518:ce00:f24d:a2ff:fede:451c) has quit (Remote host closed the connection)
2016-03-26 10:21:28 mavrix (~mavrix@unaffiliated/mavrix) has quit (Ping timeout: 264 seconds)
2016-03-26 10:21:43 - brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has joined #linuxvoice
2016-03-26 10:22:28 brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has quit (Client Quit)
2016-03-26 10:22:43 - brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has joined #linuxvoice
2016-03-26 10:23:17 - mavrix (~mavrix@unaffiliated/mavrix) has joined #linuxvoice
2016-03-26 10:27:15 M1C4HTRON13 (~micah@bodhilinux/team/M1C4HTRON13) has quit (Remote host closed the connection)
2016-03-26 10:30:31 gamerchick02 (~gamerchic@adsl-108-208-17-172.dsl.sgnwmi.sbcglobal.net) has quit (Quit: Leaving)
2016-03-26 10:39:56 foxhunt72 is now known as foxhunt_away
2016-03-26 10:50:29 brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has quit (Ping timeout: 250 seconds)
2016-03-26 11:06:44 - brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has joined #linuxvoice
2016-03-26 11:25:32 LauRoman (~LauRoman@5-14-7-240.residential.rdsnet.ro) has quit (Read error: Connection reset by peer)
2016-03-26 11:39:32 brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has quit (Quit: Konversation terminated!)
2016-03-26 12:02:59 thesilentboatman (~thesilent@c83-248-87-13.bredband.comhem.se) has quit (Ping timeout: 248 seconds)
2016-03-26 12:08:04 - thesilentboatman (~thesilent@c83-248-87-13.bredband.comhem.se) has joined #linuxvoice
2016-03-26 13:10:02 - zmoylan-1i (~pi@109.79.96.109) has joined #linuxvoice
2016-03-26 13:13:04 zmoylan-pi (~pi@93.107.255.177) has quit (Ping timeout: 240 seconds)
2016-03-26 13:16:11 - dvdyzag (~dvdyzag@159.203.39.49) has joined #linuxvoice
2016-03-26 13:49:04 chemist69 (~apl@2a02:560:417e:7000:c23f:d5ff:fe65:b192) has quit (Ping timeout: 264 seconds)
2016-03-26 14:01:52 - chemist69 (~apl@2a02:560:419e:9d00:c23f:d5ff:fe65:b192) has joined #linuxvoice
2016-03-26 14:09:34 mavrix (~mavrix@unaffiliated/mavrix) has quit (Ping timeout: 260 seconds)
2016-03-26 14:11:06 - mavrix (~mavrix@unaffiliated/mavrix) has joined #linuxvoice
2016-03-26 15:41:53 jrullo (~jonas@cpe-66-8-141-28.hawaii.res.rr.com) has quit (Remote host closed the connection)
2016-03-26 16:01:06 - zmoylan-pi (~pi@93.107.157.110) has joined #linuxvoice
2016-03-26 16:04:13 zmoylan-1i (~pi@109.79.96.109) has quit (Ping timeout: 250 seconds)
2016-03-26 16:23:49 - swift110 (~swift110@unaffiliated/swift110) has joined #linuxvoice
2016-03-26 16:29:18 swift110 hey all
2016-03-26 17:16:34 Extremulus (~Extremulu@2001:470:b:1fb:deaf::d259) has quit (Ping timeout: 268 seconds)
2016-03-26 17:29:37 - Extremulus (~Extremulu@2001:470:b:1fb:a62:66ff:fec8:c5ca) has joined #linuxvoice
2016-03-26 17:46:51 swift110 hey Extremulus
2016-03-26 17:53:28 - LauRoman (~LauRoman@5-14-7-240.residential.rdsnet.ro) has joined #linuxvoice
2016-03-26 17:53:36 - schmidttrigger (~Mutter@p54B3FE08.dip0.t-ipconnect.de) has joined #linuxvoice
2016-03-26 17:55:23 Extremulus (~Extremulu@2001:470:b:1fb:a62:66ff:fec8:c5ca) has quit (Remote host closed the connection)
2016-03-26 18:01:50 schmidttrigger (~Mutter@p54B3FE08.dip0.t-ipconnect.de) has quit (Ping timeout: 248 seconds)
2016-03-26 18:06:25 - pdq_ (~pdq@p20030045431D72002D95AA86E56A70CF.dip0.t-ipconnect.de) has joined #linuxvoice
2016-03-26 18:10:26 swift110 (~swift110@unaffiliated/swift110) has quit (Remote host closed the connection)
2016-03-26 18:22:10 - swift110-phone (~swift110-@unaffiliated/swift110) has joined #linuxvoice
2016-03-26 18:22:11 swift110-phone (~swift110-@unaffiliated/swift110) has quit (Excess Flood)
2016-03-26 18:29:17 - ideasman42 (~cambo@203-206-123-225.dyn.iinet.net.au) has joined #linuxvoice
2016-03-26 19:03:26 - brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has joined #linuxvoice
2016-03-26 20:29:03 foxhunt_away is now known as foxhunt72
2016-03-26 20:43:58 zmoylan-pi (~pi@93.107.157.110) has quit (Ping timeout: 248 seconds)
2016-03-26 20:45:11 foxhunt72 is now known as foxhunt_away
2016-03-26 21:47:50 - M1C4HTRON13 (~micah@bodhilinux/team/M1C4HTRON13) has joined #linuxvoice
2016-03-26 21:48:37 irc: disconnected from server
2016-03-29 06:22:05 - fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-03-29 06:22:05 Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-03-29 06:22:05 Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-03-29 06:22:05 Channel #linuxvoice: 75 nicks (1 op, 0 voices, 74 normals)
2016-03-29 06:22:14 Channel created on Tue, 12 Nov 2013 01:19:50
2016-03-29 06:22:16 zmoylan-pi and i've seen moves from good players that have stunned the dm when they honestly didn't know if such a ploy would/could/should work
2016-03-29 06:23:18 zmoylan-pi if it were a version that could be processed by a computer i think it might be too limited a version
2016-03-29 06:24:34 zmoylan-pi that been said it was only 10 years ago that they were saying that go might never be mastered by computer
2016-03-29 06:25:20 irc: disconnected from server
2016-03-29 06:25:29 - fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-03-29 06:25:29 Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-03-29 06:25:29 Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-03-29 06:25:29 Channel #linuxvoice: 75 nicks (1 op, 0 voices, 74 normals)
2016-03-29 06:25:40 Channel created on Tue, 12 Nov 2013 01:19:50
2016-03-29 06:30:24 foxhunt_away is now known as foxhunt72
2016-03-29 06:31:38 irc: disconnected from server
2016-03-29 06:31:47 - fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-03-29 06:31:47 Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-03-29 06:31:47 Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-03-29 06:31:47 Channel #linuxvoice: 75 nicks (1 op, 0 voices, 74 normals)
2016-03-29 06:31:57 Channel created on Tue, 12 Nov 2013 01:19:50
2016-03-29 06:33:28 irc: disconnected from server
2016-03-29 06:33:38 - fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-03-29 06:33:38 Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-03-29 06:33:38 Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-03-29 06:33:38 Channel #linuxvoice: 75 nicks (1 op, 0 voices, 74 normals)
2016-03-29 06:33:47 Channel created on Tue, 12 Nov 2013 01:19:50
2016-03-29 06:34:14 irc: disconnected from server
2016-03-29 06:34:24 - fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-03-29 06:34:24 Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-03-29 06:34:24 Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-03-29 06:34:24 Channel #linuxvoice: 75 nicks (1 op, 0 voices, 74 normals)
2016-03-29 06:34:35 Channel created on Tue, 12 Nov 2013 01:19:50
2016-03-29 06:35:32 irc: disconnected from server
2016-03-29 06:35:40 - fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-03-29 06:35:40 Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-03-29 06:35:40 Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-03-29 06:35:40 Channel #linuxvoice: 75 nicks (1 op, 0 voices, 74 normals)
2016-03-29 06:35:51 Channel created on Tue, 12 Nov 2013 01:19:50
2016-03-29 06:49:46 TraceyC (~TraceyC@ng2.cptxoffice.net) has quit (Quit: Off I go into the wild, blue yonder)
2016-03-29 07:00:48 foxhunt72 is now known as foxhunt_away
2016-03-29 07:03:48 einonm This is something I'm genuinely excited about - the software suite that studio ghibli use for 2D animation has just been open sourced, and on github https://github.com/opentoonz/opentoonz
2016-03-29 07:04:30 einonm no linux version yet, but there looks to be plenty of people trying to port it
2016-03-29 07:05:13 Ioangogo Im going to read one of my pairents old books on operating system conspets
2016-03-29 07:05:47 Ioangogo einonm: im downloading it on my windows gaming machine
2016-03-29 07:07:18 Ioangogo thats strange, it wanted fire wall accsess
2016-03-29 07:08:23 Ioangogo and it installs to c:\opentoonz stuff\
2016-03-29 07:10:33 einonm I don;t have a windows machine, but I'm not too bothered about that - I also have no drawings to scan :) but I think it's great for open source
2016-03-29 07:10:58 M1C4HTRON13 looks like ideasman42 (blender dev) is working on the post
2016-03-29 07:12:41 M1C4HTRON13 Krita getting animation as well means there's gona be a bunch of 2D options on linux now
2016-03-29 07:15:03 einonm Ioangogo: Tannenbaum?
2016-03-29 07:15:17 Ioangogo einonm: ?
2016-03-29 07:15:40 james_olympus At university, we used to call it 'The Book'
2016-03-29 07:15:46 einonm operating system books. Usually the one most people use
2016-03-29 07:17:11 james_olympus Actually, to avoid ambiguity with the other Tanenbaum, we called it 'The Other Book', 'Structured Computer Organisation' was 'The Book'
2016-03-29 07:17:11 gb00s (~gb00s@c50-31.i07-13.onvol.net) has quit (Quit: Leaving)
2016-03-29 07:19:00 Ioangogo einonm: i dunno, the isbn of it is 02015483739
2016-03-29 07:19:37 Ioangogo I might make LVbo understand those number
2016-03-29 07:19:57 Ioangogo *bot
2016-03-29 07:22:42 jaake (~h4ckm3@129.59.122.24) has quit (Ping timeout: 276 seconds)
2016-03-29 07:23:39 einonm Ioangogo: unofortunately even the mighty google doesn't understand that number, so you may have problems with your bot too
2016-03-29 07:24:19 Ioangogo einonm: remove the 0
2016-03-29 07:25:58 einonm still doesn't work for me
2016-03-29 07:29:02 Ioangogo einonm: heres the barcode number9780201548730
2016-03-29 07:30:04 johnlane (~john@212.159.104.145) has quit (Remote host closed the connection)
2016-03-29 07:37:50 einonm looks good, I've not read it myself though
2016-03-29 07:43:35 - jherrmann (~jirkah@ip4-83-240-20-58.cust.nbox.cz) has joined #linuxvoice
2016-03-29 08:03:01 jherrmann (~jirkah@ip4-83-240-20-58.cust.nbox.cz) has quit (Ping timeout: 244 seconds)
2016-03-29 08:03:41 mnavrati (~milan@ip-94-113-220-233.net.upcbroadband.cz) has quit (Quit: Leaving)
2016-03-29 08:22:47 - asusk7m550 (~Thunderbi@2001:981:97b3:1:d0f2:4abf:34d1:55f2) has joined #linuxvoice
2016-03-29 08:22:53 asusk7m550 (~Thunderbi@2001:981:97b3:1:d0f2:4abf:34d1:55f2) has quit (Client Quit)
2016-03-29 08:33:10 M1C4HTRON13 (~micah@bodhilinux/team/M1C4HTRON13) has quit (Quit: Leaving)
2016-03-29 08:55:27 Nitronium (~Dave@host213-123-9-170.range213-123.btcentralplus.com) has quit (Remote host closed the connection)
2016-03-29 09:45:37 - swift110 (~swift110@64.26.99.248) has joined #linuxvoice
2016-03-29 09:46:29 Ioangogo TIL that electronic artist avicii coproduced A Sky Full of Stars with cold play
2016-03-29 09:46:47 Ioangogo *Electronic music
2016-03-29 09:47:59 swift110 (~swift110@64.26.99.248) has quit (Changing host)
2016-03-29 09:47:59 - swift110 (~swift110@unaffiliated/swift110) has joined #linuxvoice
2016-03-29 09:59:59 Ioangogo http://www.theregister.co.uk/2016/03/28/apple_ios_93_freezes_safari/ wow apple, wow
2016-03-29 10:25:31 swift110 hey all
2016-03-29 10:27:24 NYbill (~bill@104.236.1.137) has quit (Remote host closed the connection)
2016-03-29 10:51:38 swift110 (~swift110@unaffiliated/swift110) has quit (Read error: Connection reset by peer)
2016-03-29 11:07:43 - swift110 (~swift110@64.26.99.248) has joined #linuxvoice
2016-03-29 12:04:17 Extremulus (~Extremulu@2001:470:b:1fb:deaf::d259) has quit (Ping timeout: 268 seconds)
2016-03-29 12:04:47 swift110 (~swift110@64.26.99.248) has quit (Ping timeout: 244 seconds)
2016-03-29 12:08:40 - towy71 (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has joined #linuxvoice
2016-03-29 12:11:57 towy71_ (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has quit (Ping timeout: 276 seconds)
2016-03-29 12:49:33 chemist69 (~apl@2a02:560:41e3:2800:c23f:d5ff:fe65:b192) has quit (Ping timeout: 250 seconds)
2016-03-29 13:02:51 - chemist69 (~apl@a89-182-185-3.net-htp.de) has joined #linuxvoice
2016-03-29 13:20:44 metasansana (~metasansa@unaffiliated/metasansana) has quit (Ping timeout: 260 seconds)
2016-03-29 13:23:04 - metasansana (~metasansa@unaffiliated/metasansana) has joined #linuxvoice
2016-03-29 13:23:25 - Extremulus (~Extremulu@2001:470:b:1fb:deaf::d259) has joined #linuxvoice
2016-03-29 13:34:43 - brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has joined #linuxvoice
2016-03-29 13:39:45 irc: disconnected from server
2016-03-29 13:52:21 - fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-03-29 13:52:21 Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-03-29 13:52:21 Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-03-29 13:52:21 Channel #linuxvoice: 68 nicks (1 op, 0 voices, 67 normals)
2016-03-29 13:52:32 Channel created on Tue, 12 Nov 2013 01:19:50
2016-03-29 14:33:27 irc: disconnected from server
2016-03-29 14:33:37 - fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-03-29 14:33:37 Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-03-29 14:33:37 Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-03-29 14:33:37 Channel #linuxvoice: 68 nicks (1 op, 0 voices, 67 normals)
2016-03-29 14:33:47 Channel created on Tue, 12 Nov 2013 01:19:50
2016-03-29 14:51:42 - zmoylan-1i (~pi@109.76.186.248) has joined #linuxvoice
2016-03-29 14:54:48 zmoylan-pi (~pi@109.77.31.123) has quit (Ping timeout: 244 seconds)
2016-03-29 15:01:08 - zmoylan-pi (~pi@109.79.155.46) has joined #linuxvoice
2016-03-29 15:04:51 zmoylan-1i (~pi@109.76.186.248) has quit (Ping timeout: 276 seconds)
2016-03-29 15:15:11 - okovko (~okovko@c-24-15-233-102.hsd1.il.comcast.net) has joined #linuxvoice
2016-03-29 15:35:45 irc: disconnected from server
2016-03-29 15:35:53 - fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-03-29 15:35:53 Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-03-29 15:35:53 Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-03-29 15:35:53 Channel #linuxvoice: 69 nicks (1 op, 0 voices, 68 normals)
2016-03-29 15:36:04 Channel created on Tue, 12 Nov 2013 01:19:50
2016-03-29 16:18:51 okovko (~okovko@c-24-15-233-102.hsd1.il.comcast.net) has quit (Remote host closed the connection)
2016-03-29 16:34:28 CPrompt^ (~CPrompt^@cpe-45-36-163-153.triad.res.rr.com) has quit (Ping timeout: 244 seconds)
2016-03-29 16:54:08 - CPrompt^ (~CPrompt^@cpe-45-36-163-153.triad.res.rr.com) has joined #linuxvoice
2016-03-29 18:07:53 foxhunt_away is now known as foxhunt72
2016-03-29 18:23:51 - Korruptor (~Korruptor@dsl-espbrasgw1-50dfb8-221.dhcp.inet.fi) has joined #linuxvoice
2016-03-29 18:28:34 Korruptor (~Korruptor@dsl-espbrasgw1-50dfb8-221.dhcp.inet.fi) has quit (Client Quit)
2016-03-29 18:29:01 - jherrmann (jirkah@nat/redhat/x-omqozrhvurpaqenw) has joined #linuxvoice
2016-03-29 18:29:02 - Korruptor (~Korruptor@dsl-espbrasgw1-50dfb8-221.dhcp.inet.fi) has joined #linuxvoice
2016-03-29 18:30:01 - TwistedLucidity (~TwistedLu@cpc80671-stap13-2-0-cust118.12-2.cable.virginm.net) has joined #linuxvoice
2016-03-29 18:33:56 - arubislander (~ArubIslan@86.93.93.218) has joined #linuxvoice
2016-03-29 18:49:15 - LLL (~lars@gore.copyleft.no) has joined #linuxvoice
2016-03-29 18:49:22 arubislander I preordered the M10 Ubuntu tabled from Meizu yesterday as soon as I received the e-mail.
2016-03-29 18:49:42 arubislander Anyone else going to give it a spin?
2016-03-29 18:53:21 Korruptor so very very tempted, if I had the cash I would
2016-03-29 18:54:50 james_olympus If I wanted a tablet, it would be a very good choice
2016-03-29 18:57:03 - towy71_ (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has joined #linuxvoice
2016-03-29 18:57:12 Korruptor it's a nice looking bit of kit, I'll say that for it
2016-03-29 18:57:54 james_olympus The clock is set to 16:04 in the marketing material, coincidence?
2016-03-29 18:58:24 arubislander I hadn't even noticed that... Surely it is not a coincidence...
2016-03-29 18:58:24 arubislander I have an aged first generation iPad I received as a gift many years ago... I still serves me well, but no more updates, and no more apps (it is stuck on iOS 5.something-or-the-other). All I really truly need is a document viewer and a webbrowser... Anything extra is a welcome bonus :o)
2016-03-29 18:59:30 towy71 (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has quit (Ping timeout: 276 seconds)
2016-03-29 18:59:35 james_olympus Similar situation with my 2012 Nexus 7, I had to forcefully downgrade to Android 4 to get it to work properly
2016-03-29 19:00:15 Korruptor I'd like something for when I'm giving lectures, just plug it in for the presentation, use the convergence aspects on the train to do a bit of work, not have a heavy bag to carry around
2016-03-29 19:00:41 Korruptor wish it had a slightly meatier gpu tho
2016-03-29 19:01:48 arubislander Hold out for the next gen tablet then I suppose. If the phones are anything to go by, the next one out will have better specs.
2016-03-29 19:01:58 Korruptor that's what I was thinking
2016-03-29 19:02:41 Korruptor but if I had the cash I'd probably get this just to support the idea of linux on a tablet
2016-03-29 19:03:03 - mnavrati (milan@nat/redhat/x-xldjjfxxavrhljrp) has joined #linuxvoice
2016-03-29 19:05:41 mcphail arubislander: I don't have the spare cash at the moment, but would love to play with one. If it had a bespoke keyboard dock it would be perfect
2016-03-29 19:07:10 arubislander BQ seams like a good company. I bought the Aquaris E4.5 Ubuntu Edition from them. And it was interesting to see the OS progress with every update...
2016-03-29 19:08:07 - ideasman42 (~cambo@203-206-123-225.dyn.iinet.net.au) has joined #linuxvoice
2016-03-29 19:08:35 mcphail I have the 4.5 as well. Although it looks and feels a bit cheap, it has served me well and has not got a scratch on it, despite being my daily driver for 1 year. I'd buy bq again
2016-03-29 19:09:38 Korruptor I've not seen Unbuntu on the phone in the wild yet
2016-03-29 19:10:15 arubislander Other than my own, neither have I
2016-03-29 19:10:31 - andybalaam (andybalaam@nat/ibm/x-zkjomevoxyvlqrwo) has joined #linuxvoice
2016-03-29 19:11:10 zmoylan-pi i'm not sure i'd recognise it if i did see it
2016-03-29 19:12:28 mcphail zmoylan-pi: you can recognise it by the users' faces. Rapid alternation from joy to extreme frustration and back again ;)
2016-03-29 19:12:49 zmoylan-pi sounds like every other mobile os then.. :-)
2016-03-29 19:13:17 arubislander :-D
2016-03-29 19:14:10 zmoylan-pi well... of course except for windows mobile os which leaves out the happy part... :-P
2016-03-29 19:15:07 TwistedLucidity arubislander: Going to wait for a few reviews...it's a lot of money to through at something unknown.
2016-03-29 19:15:37 mcphail My wife's laptop managed to trick her into "upgrading" to windows 10 last week. It is hard to believe a modern operating system could be worse than Windows 8, but, credit to MS, they have achieved it
2016-03-29 19:16:24 mcphail Using windows on a phone must be excruciating
2016-03-29 19:17:01 zmoylan-pi an accountant was complaining to me over the weekend that she went into work last week and found windows 10 waiting for her with no indication or prompt... she wasted over a day rolling back to previous os
2016-03-29 19:18:13 arubislander This also will pass... the next iteration of Windows will surely be a Linux distro given the way MS is going... Maybe that is their strategy. Slowly morph the OS into Linux without alerting the user...
2016-03-29 19:18:14 mcphail T'wife can't remember actually accepting the Win10 upgrade. I think it might have been bundled with the routine upgrades this time (i.e. you'd have to check what was queued and opt-out)
2016-03-29 19:19:06 zmoylan-pi they made windows 10 'recommended' which installed it on a lot of systems for people who didn't want it
2016-03-29 19:20:21 mcphail that'll be it, then. Evil behaviour
2016-03-29 19:20:23 zmoylan-pi and ms cannot sell a linux distro. opens them to lawsuits as they signed a deal when they sold xenix never to sell unix again
2016-03-29 19:21:50 arubislander Really? I was not aware of that...
2016-03-29 19:22:24 Korruptor sell or distribute?
2016-03-29 19:22:42 Korruptor they're not really selling win10 at this point, just ramming it down people's face holes.
2016-03-29 19:23:06 zmoylan-pi either way lawyers would be all over them
2016-03-29 19:24:21 TwistedLucidity mcphail: Win10 is auto-opt-in. It also destroys data; check that every application still works and that no files/details have been lost.
2016-03-29 19:25:02 TwistedLucidity zmoylan-pi: Luckily Linux is not Unix. And neither is GNU!
2016-03-29 19:25:32 zmoylan-pi well it isn't and it also is...
2016-03-29 19:25:34 mcphail TwistedLucidity: happily, the laptop is only really used for watching netflix and DVDs.
2016-03-29 19:26:16 zmoylan-pi the unix market back then was so fragmented that it was all about posix compatibility... isn't linux posix compliant?
2016-03-29 19:29:15 Devilment Nope, Linux is not POSIX compliant
2016-03-29 19:29:47 Korruptor quick question, does anyone here play games through steam? If so are you 32bit linux or 64bit linux?
2016-03-29 19:30:04 Devilment IIRC, you can pass switches to various GNU utilities to make them POSIX-y
2016-03-29 19:31:30 Devilment I installed Steam on my 64-bix CentOS desktop. I was able to play Prison Architect
2016-03-29 19:31:41 Devilment But that's the extent of my testing
2016-03-29 19:31:55 Korruptor yeah, I'm on 64bit linux as well
2016-03-29 19:32:17 Korruptor I'm just polling to see how necessary it is to deliver a 32bit version of Lumo over steam (because I can't test it)
2016-03-29 19:32:20 LauRoman (~LauRoman@5-14-40-51.residential.rdsnet.ro) has quit (Read error: Connection reset by peer)
2016-03-29 19:34:10 mcphail Korruptor: 32 bit games run fine on supported 64 bit steam platforms (steam os and Ubuntu)
2016-03-29 19:34:26 Korruptor nah, Lumo's 64bit atm
2016-03-29 19:34:58 Korruptor I can build 32bit but can't test it on 32bit iyswim
2016-03-29 19:35:25 Korruptor just curious if anyone running 32bit actually plays new games :D
2016-03-29 19:37:14 mcphail Korruptor: I'm sure I have seen some grumbling about 64bit-only games on IRC, but suspect those are a vocal minority
2016-03-29 19:37:53 Korruptor honestly not sure what the best option is, might put out a universal and just hope it works on 32bit
2016-03-29 19:37:55 TwistedLucidity Korruptor: 64bit here. Tend not to launch via Steam, just use that to grab updates.
2016-03-29 19:38:17 Korruptor TwistedLucidity, yeah, that's kinda what I do as well
2016-03-29 19:38:25 popey Korruptor: i use steam on 64-bit but I have the 32-bit libs installed
2016-03-29 19:38:40 popey you have to as steam is 32-bit as are the vast majority of games
2016-03-29 19:39:05 einonm Linus is pretty much POSIX compliant as far as I know, it just doesn't have the POSIX accreditation, 'cos that costs money.
2016-03-29 19:39:08 einonm ..Linux
2016-03-29 19:39:09 mcphail popey: the steam runtime provides the libs anyway, and most games use the steam runtime
2016-03-29 19:39:26 popey no, i mean the steam UI itself
2016-03-29 19:39:29 Korruptor popey, yeah, steam ui is 32bit
2016-03-29 19:39:36 TwistedLucidity Korruptor: You could always release the 32bit as "best effort". Would mean having to deal with any bugs people raise though. Biggest issue I've had with 32bits is people not linking libraries properly and hiding the details on what version so what libraries are needed.
2016-03-29 19:39:55 TwistedLucidity Usually you can find the answers in the forums related to the game/supplier though.
2016-03-29 19:40:02 mcphail Korruptor: is your game made on Unity? I thought all Unity games were 32bit?
2016-03-29 19:40:11 Korruptor it's an odd one because Unity's linux support is god awful
2016-03-29 19:40:12 popey unity can spit out 32 and 64-bit binaries
2016-03-29 19:40:17 Korruptor 64bit is stable
2016-03-29 19:40:19 mcphail aah
2016-03-29 19:40:26 Korruptor 32bit looks basically unsupported at this stage
2016-03-29 19:40:46 Korruptor OpenGL core has numerous crashes in and probably needs to be launched via a custom launcher, which I don't want to do
2016-03-29 19:40:54 popey Korruptor: why can't you test 32-bit version of Lumo?
2016-03-29 19:41:17 Korruptor I can test it on a 64bit install of Ubuntu, but I don't have a machine to sacrifice to test it on a 32bit install of Ubuntu
2016-03-29 19:41:58 popey i know liam from gaming on linux often tests stuff for people :)
2016-03-29 19:42:00 Korruptor so I'm just sniffing about to see what people tend to run, lazy option is to just ship 64bit, one I'm doing atm is to ship universal but cross fingers
2016-03-29 19:42:27 Korruptor ok, might give him a shout
2016-03-29 19:42:33 popey surely you could just boot a live 32-bit cd?
2016-03-29 19:42:38 popey and run it off that
2016-03-29 19:42:48 Korruptor that's not a solid enough test
2016-03-29 19:43:08 Korruptor tbh I'd need a bunch of setups
2016-03-29 19:43:25 Korruptor which I've done for the 64bit as everyone I know runs it :D
2016-03-29 19:44:01 popey haha, someone in the jolla channel received their tablet, and they're now being offered refunds.
2016-03-29 19:44:05 popey no wonder jolla have no money
2016-03-29 19:44:07 mcphail Korruptor: I think there was a phoronix or gamingonlinux poll recently which suggested 32bit users were rare beasts
2016-03-29 19:44:31 Korruptor oh, really? *goes to the googles*
2016-03-29 19:46:10 Extremulus (~Extremulu@2001:470:b:1fb:deaf::d259) has quit (Ping timeout: 268 seconds)
2016-03-29 19:46:23 Korruptor actually, steam's own survey puts 64bit at 56% of linux use, might have answered my question
2016-03-29 19:47:37 Korruptor Poor jolla, they're just down the road from me :(
2016-03-29 19:50:00 - ryuslash (~slash@2a02:1812:2518:ce00:f24d:a2ff:fede:451c) has joined #linuxvoice
2016-03-29 19:52:04 popey Anecdotally, my i386 16.04 beta 2 ISO has seeded more than my amd64 16.04 beta 2 ISO 😖
2016-03-29 19:52:19 mcphail I don't have much sympathy for them, tbh. Just another proprietary OS vendor
2016-03-29 19:52:50 Korruptor popey, gah :D
2016-03-29 19:53:08 Korruptor Don't tell anyone, I'm just going to cross my fingers :D
2016-03-29 19:53:27 Korruptor very very interested to see what percentage of sales Linux gets anyway
2016-03-29 19:54:20 mcphail Korruptor: If it plays as well as Head over Heels, count me in ;)
2016-03-29 19:54:48 Korruptor HoH is the king, I can't claim that ;D
2016-03-29 19:56:01 * mcphail used to cheat by tapping the "swap" key repeatedly, allowing Head to clear the fence in the first room to join up immediately
2016-03-29 19:56:45 Korruptor lol, forgot about that!
2016-03-29 19:57:43 Korruptor Jon Ritman let me use a couple of bits of art from HoH. Sent him this big long message about how much I loved his games, etc. etc. One word answer. Still, it made my day :D
2016-03-29 19:58:42 mcphail JR has always been one of the good guys, imho
2016-03-29 19:59:29 Korruptor Yeah. Defo.
2016-03-29 19:59:56 Korruptor Tbh, everyone I asked permission from to use something in Lumo said yes. Was very cool.
2016-03-29 20:00:04 mcphail Interestingly, his/Bernie's isometric Batman bears an uncanny resemblence to Ben Afflek's chubby batman in the new film
2016-03-29 20:00:43 Korruptor lol
2016-03-29 20:01:35 Korruptor is that new film as bad as everyone says?
2016-03-29 20:03:24 Devilment I haven't seen it yet, so no spoilers
2016-03-29 20:03:35 popey ahhhh HoH
2016-03-29 20:03:44 popey loved that game. and batman
2016-03-29 20:03:49 Devilment Empire magazine gave BvS 3 stars
2016-03-29 20:04:09 Korruptor popey, tried Monster Max? Last game they made together, on gameboy. Tis wonderful
2016-03-29 20:04:11 popey JR was excellent. I had Bear Bovver
2016-03-29 20:04:18 popey oooh, no
2016-03-29 20:04:24 Korruptor go grab the rom
2016-03-29 20:04:27 Korruptor it's worth your time
2016-03-29 20:04:30 popey i probably have it (ahem)
2016-03-29 20:04:34 * popey gets his picade
2016-03-29 20:04:35 Korruptor :D
2016-03-29 20:05:05 popey There are a few old 8 bit devs that I'd play _anything_ they made
2016-03-29 20:05:12 popey Ultimate / RARE, for sure.
2016-03-29 20:05:19 Korruptor aye
2016-03-29 20:05:21 popey Jonathan Smiff (Cobra)
2016-03-29 20:05:24 Korruptor Pickford Bros
2016-03-29 20:05:27 popey yup
2016-03-29 20:05:31 popey ZUB!
2016-03-29 20:05:31 Korruptor Minter
2016-03-29 20:05:45 Korruptor seen the new Zub they're making? I Sent My Monkey To The Moon
2016-03-29 20:05:45 popey I can take or leave Minter. I think I need to be on the same crack he is to play them
2016-03-29 20:06:00 Korruptor Weed, basically ;)
2016-03-29 20:06:03 popey oh, i saw some artwork, and thought it zub like
2016-03-29 20:06:07 popey didn't realise that was intentional
2016-03-29 20:06:11 Korruptor they don't own Zub
2016-03-29 20:06:15 popey ahhh
2016-03-29 20:06:16 popey shame
2016-03-29 20:06:17 Korruptor so they're remaking it with a little monkey
2016-03-29 20:06:25 Korruptor but it's Zub 2 basically
2016-03-29 20:06:26 popey i recall they changed it, was originally Zob
2016-03-29 20:06:38 Korruptor the original was never finished, so they're putting in all the stuff they wanted to the first time around
2016-03-29 20:06:42 popey the Speccy loading screen very clearly had the top of the O rubbed out to make it Zub
2016-03-29 20:06:58 Korruptor yeah, could well be
2016-03-29 20:07:28 popey Apparently Zob is a rude word somewhere, they found out at the llast minute :)
2016-03-29 20:07:36 popey so legend (and an article in Your Sinclair) said
2016-03-29 20:07:44 Korruptor lol
2016-03-29 20:07:47 Korruptor genius
2016-03-29 20:08:29 Korruptor I miss Your Sinclair :(
2016-03-29 20:09:01 popey yeah (me too - ed)
2016-03-29 20:09:08 Korruptor ffnar
2016-03-29 20:09:31 popey got the zub music stuck in my head now
2016-03-29 20:09:44 Korruptor if you look carefully, the door locks in lumo have "Crap in a funky skillo kinda way" written on them
2016-03-29 20:10:12 popey sorry, this is the first time I have heard of Lumo. where is it found?
2016-03-29 20:10:31 Korruptor play-lumo.com
2016-03-29 20:10:50 topcyde (~topcyde@2602:304:cdb8:9e40:157b:68ab:708e:5d6c) has quit (Ping timeout: 268 seconds)
2016-03-29 20:11:45 popey aw, that's pretty
2016-03-29 20:12:46 Korruptor cheers :)
2016-03-29 20:12:57 popey blimey there's a good 5 games in this
2016-03-29 20:13:07 Korruptor all your isometrics are belong to me
2016-03-29 20:13:11 Korruptor and Nebulus
2016-03-29 20:13:22 Korruptor and maybe Bounder
2016-03-29 20:13:44 - topcyde (~topcyde@2602:304:cdb8:9e40:a4e3:de93:c976:22f0) has joined #linuxvoice
2016-03-29 20:13:46 popey spindizzy / marble madness ?
2016-03-29 20:13:51 Korruptor oh yeah, and that
2016-03-29 20:13:54 Korruptor and Zaxxon
2016-03-29 20:14:00 popey yeah
2016-03-29 20:14:20 Korruptor well, if you're gonna make an isometric game, you might as well try as many as poss ;)
2016-03-29 20:14:47 popey needs a mailing list so i get told when it's out
2016-03-29 20:14:49 popey or I'll forget
2016-03-29 20:15:00 popey I'd sign up for a mailchip thing to let me know about updates etc
2016-03-29 20:15:07 Korruptor yeah, was thinking about that
2016-03-29 20:15:21 popey *chimp
2016-03-29 20:15:36 Korruptor tbh the site isn't even launched yet
2016-03-29 20:15:51 Korruptor I'd rather have the pre-order links in there
2016-03-29 20:16:00 popey hehe, "Manic" above the mine
2016-03-29 20:16:08 Korruptor well spotted :D
2016-03-29 20:17:36 - xplora1a (~stuart@81.144.225.214) has joined #linuxvoice
2016-03-29 20:36:55 mcphail My favourite speccy devs were JR, Ultimate and Julian Gollop. I'm still loving Chaos Reborn
2016-03-29 20:37:22 mcphail I never really liked the isometric Ultimate games, though
2016-03-29 20:37:27 Korruptor Chaos Reborn is brilliant, just wish more people bought it
2016-03-29 20:37:49 zmoylan-pi pete cook. tau ceti, room 10, juggarnaut
2016-03-29 20:38:26 mcphail I liked the Pete Cook games (esp ?Academy?), but I never got very far in them
2016-03-29 20:38:40 popey Tau Ceti!
2016-03-29 20:38:42 popey Room Ten!
2016-03-29 20:38:44 zmoylan-pi took me ages to beat tau ceti... but so worth it
2016-03-29 20:38:45 popey happy days
2016-03-29 20:39:09 Korruptor Deathchase
2016-03-29 20:39:12 popey I used to cart my CPC 464 over to a friends house and we'd play Rebelstar Raiders 2 player all day sunday
2016-03-29 20:39:12 Korruptor used to cane that
2016-03-29 20:39:58 popey I came up with an idea to play again with him, so I fired it up in an emulator, took my turn and then saved the snapshot and emailed it to my mate. He loaded it up in an emulator and took his turn...
2016-03-29 20:39:59 zmoylan-pi and on the cpc 464... grand prix simulator...
2016-03-29 20:40:14 popey we played for quite some time just emailing a ~48K game file back and forth
2016-03-29 20:40:16 Korruptor popey, lol play by mail!
2016-03-29 20:40:19 popey ya
2016-03-29 20:40:35 zmoylan-pi 2 people playing on th keyboard so trying to nudge the other person with elbow as they were corneing... brilliant... :-D
2016-03-29 20:40:38 Korruptor CPC gryzor was the one
2016-03-29 20:41:00 Korruptor looked amazing, on my greenscreen :( :D
2016-03-29 20:41:01 popey heh, Super Sprint 3 player on the ST after the pub was a fave here
2016-03-29 20:41:52 popey Now, 20 years later, my Son is sat next to me here, using my desktop PC to play online minecraft with people all around the world
2016-03-29 20:42:25 popey s/20/25ish)
2016-03-29 20:42:28 Korruptor future's amazing innit
2016-03-29 20:42:39 zmoylan-pi no jetpacks...
2016-03-29 20:45:43 irc: disconnected from server
2016-03-30 11:45:42 - fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-03-30 11:45:42 Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-03-30 11:45:42 Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-03-30 11:45:42 Channel #linuxvoice: 71 nicks (0 ops, 0 voices, 71 normals)
2016-03-30 11:45:52 Channel created on Tue, 12 Nov 2013 01:19:50
2016-03-30 11:53:38 ryuslash (~slash@2a02:1812:2518:ce00:f24d:a2ff:fede:451c) has quit (Remote host closed the connection)
2016-03-30 12:15:33 - AdamDBrown (~Thunderbi@6.117-240-116.dynamic.dsl.pth.iprimus.net.au) has joined #linuxvoice
2016-03-30 12:37:22 writtenoff (~writtenof@of1.psych.ubc.ca) has quit (Quit: WeeChat 1.3)
2016-03-30 12:45:06 - chemist69_ (~apl@2a02:560:4131:9e00:c23f:d5ff:fe65:b192) has joined #linuxvoice
2016-03-30 12:48:28 chemist69 (~apl@a89-182-185-3.net-htp.de) has quit (Ping timeout: 264 seconds)
2016-03-30 13:09:55 - AdamDBrown1 (~Thunderbi@188.100.dsl.pth.iprimus.net.au) has joined #linuxvoice
2016-03-30 13:12:19 AdamDBrown (~Thunderbi@6.117-240-116.dynamic.dsl.pth.iprimus.net.au) has quit (Ping timeout: 252 seconds)
2016-03-30 13:12:20 AdamDBrown1 is now known as AdamDBrown
2016-03-30 13:44:39 frankbell (~The_Farme@ip98-183-208-12.hr.hr.cox.net) has quit (Ping timeout: 276 seconds)
2016-03-30 13:51:09 - frankbell (~The_Farme@ip98-183-208-12.hr.hr.cox.net) has joined #linuxvoice
2016-03-30 14:13:42 Korruptor (~kor@dsl-espbrasgw1-50dfb8-221.dhcp.inet.fi) has quit (Ping timeout: 260 seconds)
2016-03-30 14:27:31 - metasansana (~metasansa@unaffiliated/metasansana) has joined #linuxvoice
2016-03-30 15:03:47 zmoylan-pi (~pi@109.77.129.243) has quit (Ping timeout: 248 seconds)
2016-03-30 15:04:35 metasansana (~metasansa@unaffiliated/metasansana) has quit (Quit: Leaving)
2016-03-30 15:07:55 - zmoylan-pi (~pi@109.76.195.248) has joined #linuxvoice
2016-03-30 16:43:01 - writtenoff (~writtenof@d172-218-204-26.bchsia.telus.net) has joined #linuxvoice
2016-03-30 16:43:33 Extremulus (~Extremulu@2001:470:b:1fb:deaf::d259) has quit (Ping timeout: 268 seconds)
2016-03-30 16:56:34 - brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has joined #linuxvoice
2016-03-30 17:08:28 swift110-phone (~swift110-@unaffiliated/swift110) has quit (Read error: Connection reset by peer)
2016-03-30 17:15:50 - LauRoman (~LauRoman@5-14-40-51.residential.rdsnet.ro) has joined #linuxvoice
2016-03-30 17:28:03 - peterhinch (~quassel@cpc19-macc3-2-0-cust174.1-3.cable.virginm.net) has joined #linuxvoice
2016-03-30 18:12:15 foxhunt_away is now known as foxhunt72
2016-03-30 18:34:06 irc: disconnected from server
2016-04-06 11:36:48 - fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-04-06 11:36:48 [11:36]
2016-04-06 11:36:48 Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-04-06 11:36:48 Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-04-06 11:36:48 Channel #linuxvoice: 65 nicks (0 ops, 0 voices, 65 normals)
2016-04-06 11:36:58 Channel created on Tue, 12 Nov 2013 01:19:50
2016-04-06 11:42:00 [11:36]
2016-04-06 11:52:30 chemist69 (~apl@2a02:560:412c:4500:c23f:d5ff:fe65:b192) has quit (Ping timeout: 260 seconds)
2016-04-06 11:58:00 [11:52]
2016-04-06 12:05:56 - chemist69 (~apl@a89-182-139-76.net-htp.de) has joined #linuxvoice
2016-04-06 12:11:00 [12:05]
2016-04-06 12:55:44 swift110-phone (~swift110-@unaffiliated/swift110) has quit (Ping timeout: 260 seconds)
2016-04-06 12:55:44 [12:55]
2016-04-06 13:02:22 mavrix (~mavrix@unaffiliated/mavrix) has quit (Ping timeout: 248 seconds)
2016-04-06 13:03:54 - mavrix (~mavrix@unaffiliated/mavrix) has joined #linuxvoice
2016-04-06 13:09:00 [13:03]
2016-04-06 13:10:00 - swift110-phone (~swift110-@unaffiliated/swift110) has joined #linuxvoice
2016-04-06 13:10:01 swift110-phone (~swift110-@unaffiliated/swift110) has quit (Max SendQ exceeded)
2016-04-06 13:12:50 - writtenoff (~writtenof@d172-218-204-26.bchsia.telus.net) has joined #linuxvoice
2016-04-06 13:15:35 - swift110-phone (~swift110-@unaffiliated/swift110) has joined #linuxvoice
2016-04-06 13:15:37 swift110-phone (~swift110-@unaffiliated/swift110) has quit (Excess Flood)
2016-04-06 13:19:46 - swift110-phone (~swift110-@unaffiliated/swift110) has joined #linuxvoice
2016-04-06 13:25:00 [13:19]
2016-04-06 14:02:36 zmoylan-pi (~pi@109.77.215.222) has quit (Ping timeout: 246 seconds)
2016-04-06 14:02:36 [14:02]
2016-04-06 14:06:54 - zmoylan-pi (~pi@93.107.124.136) has joined #linuxvoice
2016-04-06 14:12:00 [14:06]
2016-04-06 15:05:01 mavrix (~mavrix@unaffiliated/mavrix) has quit (Ping timeout: 260 seconds)
2016-04-06 15:05:01 [15:05]
2016-04-06 15:06:34 - mavrix (~mavrix@unaffiliated/mavrix) has joined #linuxvoice
2016-04-06 15:12:00 [15:06]
2016-04-06 15:54:59 - LauRoman (~LauRoman@5-14-92-160.residential.rdsnet.ro) has joined #linuxvoice
2016-04-06 15:54:59 [15:54]
2016-04-06 16:28:07 brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has quit (Quit: Konversation terminated!)
2016-04-06 16:28:07 [16:28]
2016-04-06 16:33:40 - Korruptor (~kor@dsl-espbrasgw1-50dfb8-221.dhcp.inet.fi) has joined #linuxvoice
2016-04-06 16:33:44 Korruptor morning!
2016-04-06 16:35:16 Korruptor Ars did another piece on the Win10/Linux stuff, http://arstechnica.com/information-technology/2016/04/why-microsoft-needed-to-make-windows-run-linux-software/
2016-04-06 16:39:04 swift110-phone Hey
2016-04-06 16:41:19 irc: disconnected from server
2016-04-07 06:58:15 - fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-04-07 06:58:15 [06:58]
2016-04-07 06:58:15 Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-04-07 06:58:15 Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-04-07 06:58:15 Channel #linuxvoice: 71 nicks (1 op, 0 voices, 70 normals)
2016-04-07 06:58:25 Channel created on Tue, 12 Nov 2013 01:19:50
2016-04-07 06:58:50 mcphail (~mcphail@unaffiliated/mcphail) has quit (Ping timeout: 264 seconds)
2016-04-07 07:00:12 - mcphail (~mcphail@host86-182-21-146.range86-182.btcentralplus.com) has joined #linuxvoice
2016-04-07 07:00:13 mcphail (~mcphail@host86-182-21-146.range86-182.btcentralplus.com) has quit (Changing host)
2016-04-07 07:00:13 - mcphail (~mcphail@unaffiliated/mcphail) has joined #linuxvoice
2016-04-07 07:06:00 [07:00]
2016-04-07 07:14:57 mcphail (~mcphail@unaffiliated/mcphail) has quit (Ping timeout: 244 seconds)
2016-04-07 07:17:04 - mcphail (~mcphail@host31-50-90-37.range31-50.btcentralplus.com) has joined #linuxvoice
2016-04-07 07:17:04 mcphail (~mcphail@host31-50-90-37.range31-50.btcentralplus.com) has quit (Changing host)
2016-04-07 07:17:04 - mcphail (~mcphail@unaffiliated/mcphail) has joined #linuxvoice
2016-04-07 07:23:00 [07:17]
2016-04-07 07:27:17 mcphail (~mcphail@unaffiliated/mcphail) has quit (Ping timeout: 268 seconds)
2016-04-07 07:28:51 - mcphail (~mcphail@host109-148-17-171.range109-148.btcentralplus.com) has joined #linuxvoice
2016-04-07 07:28:51 mcphail (~mcphail@host109-148-17-171.range109-148.btcentralplus.com) has quit (Changing host)
2016-04-07 07:28:51 - mcphail (~mcphail@unaffiliated/mcphail) has joined #linuxvoice
2016-04-07 07:34:00 [07:28]
2016-04-07 07:34:37 irc: disconnected from server
2016-04-07 07:57:00 - fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-04-07 07:57:00 [07:57]
2016-04-07 07:57:00 Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-04-07 07:57:00 Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-04-07 07:57:00 Channel #linuxvoice: 71 nicks (1 op, 0 voices, 70 normals)
2016-04-07 07:57:11 Channel created on Tue, 12 Nov 2013 01:19:50
2016-04-07 08:03:00 [07:57]
2016-04-07 08:06:34 swift110 (~swift110@unaffiliated/swift110) has quit (Ping timeout: 246 seconds)
2016-04-07 08:08:37 mcphail (~mcphail@unaffiliated/mcphail) has quit (Ping timeout: 276 seconds)
2016-04-07 08:10:01 - mcphail (~mcphail@unaffiliated/mcphail) has joined #linuxvoice
2016-04-07 08:13:11 M1C4HTRON13 (~micah@bodhilinux/team/M1C4HTRON13) has quit (Remote host closed the connection)
2016-04-07 08:19:00 [08:13]
2016-04-07 08:21:25 mnavrati is now known as mnavrati_afk
2016-04-07 08:23:53 mcphail (~mcphail@unaffiliated/mcphail) has quit (Ping timeout: 252 seconds)
2016-04-07 08:25:53 - mcphail (~mcphail@host86-171-130-194.range86-171.btcentralplus.com) has joined #linuxvoice
2016-04-07 08:25:53 mcphail (~mcphail@host86-171-130-194.range86-171.btcentralplus.com) has quit (Changing host)
2016-04-07 08:25:53 - mcphail (~mcphail@unaffiliated/mcphail) has joined #linuxvoice
2016-04-07 08:31:00 [08:25]
2016-04-07 08:31:24 mcphail (~mcphail@unaffiliated/mcphail) has quit (Ping timeout: 244 seconds)
2016-04-07 08:33:36 - mcphail (~mcphail@unaffiliated/mcphail) has joined #linuxvoice
2016-04-07 08:39:00 [08:33]
2016-04-07 08:48:08 - evilnickveitch (~evilnick@cpc83321-bath6-2-0-cust252.18-1.cable.virginm.net) has joined #linuxvoice
2016-04-07 08:49:29 - swift110 (~swift110@216-164-48-140.c3-0.slvr-ubr1.lnh-slvr.md.cable.rcn.com) has joined #linuxvoice
2016-04-07 08:51:04 swift110-phone (~swift110-@unaffiliated/swift110) has quit (Read error: Connection reset by peer)
2016-04-07 08:55:47 mcphail (~mcphail@unaffiliated/mcphail) has quit (Ping timeout: 252 seconds)
2016-04-07 08:55:47 [08:55]
2016-04-07 08:57:36 - mcphail (~mcphail@host31-54-168-250.range31-54.btcentralplus.com) has joined #linuxvoice
2016-04-07 08:57:36 mcphail (~mcphail@host31-54-168-250.range31-54.btcentralplus.com) has quit (Changing host)
2016-04-07 08:57:36 - mcphail (~mcphail@unaffiliated/mcphail) has joined #linuxvoice
2016-04-07 09:03:00 [08:57]
2016-04-07 09:09:02 mcphail (~mcphail@unaffiliated/mcphail) has quit (Ping timeout: 268 seconds)
2016-04-07 09:10:27 - mcphail (~mcphail@host86-159-231-91.range86-159.btcentralplus.com) has joined #linuxvoice
2016-04-07 09:10:27 mcphail (~mcphail@host86-159-231-91.range86-159.btcentralplus.com) has quit (Changing host)
2016-04-07 09:10:27 - mcphail (~mcphail@unaffiliated/mcphail) has joined #linuxvoice
2016-04-07 09:11:19 irc: disconnected from server
2016-04-07 09:37:08 - fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-04-07 09:37:08 [09:37]
2016-04-07 09:37:08 Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-04-07 09:37:08 Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-04-07 09:37:08 Channel #linuxvoice: 70 nicks (1 op, 0 voices, 69 normals)
2016-04-07 09:37:18 Channel created on Tue, 12 Nov 2013 01:19:50
2016-04-07 09:43:00 [09:37]
2016-04-07 09:50:21 mcphail (~mcphail@unaffiliated/mcphail) has quit (Ping timeout: 268 seconds)
2016-04-07 09:52:02 - mcphail (~mcphail@host86-176-74-128.range86-176.btcentralplus.com) has joined #linuxvoice
2016-04-07 09:52:02 mcphail (~mcphail@host86-176-74-128.range86-176.btcentralplus.com) has quit (Changing host)
2016-04-07 09:52:02 - mcphail (~mcphail@unaffiliated/mcphail) has joined #linuxvoice
2016-04-07 09:56:32 mcphail (~mcphail@unaffiliated/mcphail) has quit (Ping timeout: 240 seconds)
2016-04-07 09:58:43 - mcphail (~mcphail@host86-182-19-32.range86-182.btcentralplus.com) has joined #linuxvoice
2016-04-07 09:58:43 [09:58]
2016-04-07 09:58:44 mcphail (~mcphail@host86-182-19-32.range86-182.btcentralplus.com) has quit (Changing host)
2016-04-07 09:58:44 - mcphail (~mcphail@unaffiliated/mcphail) has joined #linuxvoice
2016-04-07 10:04:00 [09:58]
2016-04-07 10:08:57 mcphail (~mcphail@unaffiliated/mcphail) has quit (Ping timeout: 260 seconds)
2016-04-07 10:10:28 - mcphail (~mcphail@host86-171-131-98.range86-171.btcentralplus.com) has joined #linuxvoice
2016-04-07 10:10:28 mcphail (~mcphail@host86-171-131-98.range86-171.btcentralplus.com) has quit (Changing host)
2016-04-07 10:10:28 - mcphail (~mcphail@unaffiliated/mcphail) has joined #linuxvoice
2016-04-07 10:13:39 dizzylizzy (~aubrey@raech.net) has quit (Changing host)
2016-04-07 10:13:39 - dizzylizzy (~aubrey@fsf/member/dizzylizzy) has joined #linuxvoice
2016-04-07 10:36:57 - fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-04-07 10:36:57 [10:36]
2016-04-07 10:36:57 Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-04-07 10:36:57 Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-04-07 10:36:57 Channel #linuxvoice: 69 nicks (1 op, 0 voices, 68 normals)
2016-04-07 10:37:07 Channel created on Tue, 12 Nov 2013 01:19:50
2016-04-07 10:38:02 - mcphail (~mcphail@host31-54-168-196.range31-54.btcentralplus.com) has joined #linuxvoice
2016-04-07 10:38:03 mcphail (~mcphail@host31-54-168-196.range31-54.btcentralplus.com) has quit (Changing host)
2016-04-07 10:38:03 - mcphail (~mcphail@unaffiliated/mcphail) has joined #linuxvoice
2016-04-07 10:44:00 [10:38]
2016-04-07 10:44:05 swift110 (~swift110@216-164-48-140.c3-0.slvr-ubr1.lnh-slvr.md.cable.rcn.com) has quit (Ping timeout: 250 seconds)
2016-04-07 10:45:48 mcphail (~mcphail@unaffiliated/mcphail) has quit (Ping timeout: 252 seconds)
2016-04-07 10:47:47 - mcphail (~mcphail@host86-185-209-170.range86-185.btcentralplus.com) has joined #linuxvoice
2016-04-07 10:47:47 mcphail (~mcphail@host86-185-209-170.range86-185.btcentralplus.com) has quit (Changing host)
2016-04-07 10:47:47 - mcphail (~mcphail@unaffiliated/mcphail) has joined #linuxvoice
2016-04-07 10:53:00 [10:47]
2016-04-07 10:57:42 - swift110-phone (~swift110-@unaffiliated/swift110) has joined #linuxvoice
2016-04-07 11:00:38 mcphail (~mcphail@unaffiliated/mcphail) has quit (Ping timeout: 264 seconds)
2016-04-07 11:02:13 - mcphail (~mcphail@host86-182-17-10.range86-182.btcentralplus.com) has joined #linuxvoice
2016-04-07 11:02:13 mcphail (~mcphail@host86-182-17-10.range86-182.btcentralplus.com) has quit (Changing host)
2016-04-07 11:02:13 - mcphail (~mcphail@unaffiliated/mcphail) has joined #linuxvoice
2016-04-07 11:08:00 [11:02]
2016-04-07 11:12:18 brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has quit (Quit: Konversation terminated!)
2016-04-07 11:15:07 - brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has joined #linuxvoice
2016-04-07 11:17:26 mcphail (~mcphail@unaffiliated/mcphail) has quit (Ping timeout: 264 seconds)
2016-04-07 11:19:03 - mcphail (~mcphail@host31-49-159-51.range31-49.btcentralplus.com) has joined #linuxvoice
2016-04-07 11:19:03 mcphail (~mcphail@host31-49-159-51.range31-49.btcentralplus.com) has quit (Changing host)
2016-04-07 11:19:03 - mcphail (~mcphail@unaffiliated/mcphail) has joined #linuxvoice
2016-04-07 11:21:31 ryuslash (~slash@2a02:1812:2518:ce00:f24d:a2ff:fede:451c) has quit (Ping timeout: 246 seconds)
2016-04-07 11:27:00 [11:21]
2016-04-07 11:48:12 - chemist69_ (~apl@2a02:560:417e:100:44f1:9304:96da:e42f) has joined #linuxvoice
2016-04-07 11:48:12 [11:48]
2016-04-07 11:51:20 chemist69 (~apl@a89-182-139-76.net-htp.de) has quit (Ping timeout: 244 seconds)
2016-04-07 11:57:00 [11:51]
2016-04-07 12:18:13 - writtenoff (~writtenof@d172-218-204-26.bchsia.telus.net) has joined #linuxvoice
2016-04-07 12:18:13 [12:18]
2016-04-07 12:54:05 swift110-phone (~swift110-@unaffiliated/swift110) has quit (Remote host closed the connection)
2016-04-07 12:54:05 [12:54]
2016-04-07 13:01:45 zmoylan-pi (~pi@93.107.124.136) has quit (Ping timeout: 268 seconds)
2016-04-07 13:03:09 - zmoylan-pi (~pi@93.107.124.136) has joined #linuxvoice
2016-04-07 13:09:00 [13:03]
2016-04-07 13:34:31 irc: disconnected from server
2016-04-07 13:34:31 [13:34]
2016-04-07 13:34:50 - fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-04-07 13:34:50 Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-04-07 13:34:50 Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-04-07 13:34:50 Channel #linuxvoice: 69 nicks (1 op, 0 voices, 68 normals)
2016-04-07 13:34:58 Channel created on Tue, 12 Nov 2013 01:19:50
2016-04-07 13:37:32 - zmoylan-1i (~pi@109.76.220.52) has joined #linuxvoice
2016-04-07 13:41:25 zmoylan-pi (~pi@93.107.124.136) has quit (Ping timeout: 276 seconds)
2016-04-07 13:46:31 mnavrati_afk (~milan@ip-94-113-220-233.net.upcbroadband.cz) has quit (Ping timeout: 250 seconds)
2016-04-07 13:46:59 - mnavrati_afk (~milan@ip-94-113-220-233.net.upcbroadband.cz) has joined #linuxvoice
2016-04-07 13:52:00 [13:46]
2016-04-07 14:00:06 - zmoylan-pi (~pi@93.107.153.170) has joined #linuxvoice
2016-04-07 14:03:32 zmoylan-1i (~pi@109.76.220.52) has quit (Ping timeout: 276 seconds)
2016-04-07 14:09:00 [14:03]
2016-04-07 16:08:27 - xplora1a (~stuart@2001:8b0:1679:ea38:224:d7ff:feec:e7ec) has joined #linuxvoice
2016-04-07 16:08:27 [16:08]
2016-04-07 16:25:59 xplora1a (~stuart@2001:8b0:1679:ea38:224:d7ff:feec:e7ec) has quit (Ping timeout: 250 seconds)
2016-04-07 16:25:59 [16:25]
2016-04-07 16:26:35 - michaelis (~chatzilla@62.182.218.71) has joined #linuxvoice
2016-04-07 16:32:00 [16:26]
2016-04-07 16:32:51 chemist69_ (~apl@2a02:560:417e:100:44f1:9304:96da:e42f) has quit (Quit: WeeChat 1.4)
2016-04-07 16:38:00 [16:32]
2016-04-07 16:40:37 - ideasman42 (~cambo@220-253-82-5.dyn.iinet.net.au) has joined #linuxvoice
2016-04-07 16:46:00 [16:40]
2016-04-07 17:00:36 mnavrati_afk (~milan@ip-94-113-220-233.net.upcbroadband.cz) has quit (Quit: Leaving)
2016-04-07 17:05:36 bdmc (bdmc@cl-745.bos-01.us.sixxs.net) has quit (Ping timeout: 248 seconds)
2016-04-07 17:05:36 [17:05]
2016-04-07 17:10:26 - bdmc (bdmc@cl-745.bos-01.us.sixxs.net) has joined #linuxvoice
2016-04-07 17:10:31 - thepoodlesprivat (~thepoodle@89.101.144.126) has joined #linuxvoice
2016-04-07 17:16:00 [17:10]
2016-04-07 17:31:54 foxhunt_away is now known as foxhunt72
2016-04-07 17:31:54 [17:31]
2016-04-07 17:36:03 ideasman42 is now known as ideasman42afk
2016-04-07 17:40:03 - TwistedLucidity (~TwistedLu@cpc80671-stap13-2-0-cust118.12-2.cable.virginm.net) has joined #linuxvoice
2016-04-07 17:46:00 [17:40]
2016-04-07 17:51:15 ideasman42afk is now known as ideasman42
2016-04-07 17:55:19 - andybalaam (andybalaam@nat/ibm/x-rocqpkzyjvcfxleg) has joined #linuxvoice
2016-04-07 17:57:10 - mnavrati (milan@nat/redhat/x-fibcgqoshsouamaz) has joined #linuxvoice
2016-04-07 18:00:23 Devilment Well, that was annoying last night
2016-04-07 18:01:31 Devilment £340 bid on a Lenovo X250 laptop, starting price £244
2016-04-07 18:01:31 [18:01]
2016-04-07 18:01:39 Devilment Actually won it for £244
2016-04-07 18:02:00 Devilment Paid the seller only for him to refund me a couple of hours later
2016-04-07 18:02:16 - xplora1a (~stuart@81.144.225.214) has joined #linuxvoice
2016-04-07 18:02:40 Devilment His excuse was he'd installed Ubuntu Linux on it and had muffed up the Windows recovery partition
2016-04-07 18:02:52 Devilment And that he couldn't sell it in good faith
2016-04-07 18:03:03 Devilment Bollocks, says I
2016-04-07 18:03:22 Devilment Probably because he didn't get as much for it as he wanted
2016-04-07 18:04:04 Devilment I shot him a reply saying I was going to install Fedora Linux so lack of Windows recovery is not a problem
2016-04-07 18:04:48 Devilment He's getting negative feedback if he doesn't reply by this evening
2016-04-07 18:10:00 [18:04]
2016-04-07 18:15:23 james_olympus He should have set the starting bid or the reserve, then
2016-04-07 18:16:32 Devilment Yep
2016-04-07 18:32:06 - fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-04-07 18:32:06 [18:32]
2016-04-07 18:32:06 Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-04-07 18:32:06 Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-04-07 18:32:06 Channel #linuxvoice: 74 nicks (1 op, 0 voices, 73 normals)
2016-04-07 18:32:15 Channel created on Tue, 12 Nov 2013 01:19:50
2016-04-07 18:33:26 james_olympus So he's probably done you a favour by removing the recovery partition
2016-04-07 18:37:48 Devilment michaelis: That's a non-issue as far as I'm concerend
2016-04-07 18:38:47 michaelis Devilment: No, of course not. It's just a side track which I came to think of when I heard lenovo. Of course his excuse is bad.
2016-04-07 18:39:55 irc: disconnected from server
2016-04-07 22:03:28 - fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-04-07 22:03:28 [22:03]
2016-04-07 22:03:28 Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-04-07 22:03:28 Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-04-07 22:03:28 Channel #linuxvoice: 75 nicks (1 op, 0 voices, 74 normals)
2016-04-07 22:03:38 Channel created on Tue, 12 Nov 2013 01:19:50
2016-04-07 22:04:05 - TraceyC (~TraceyC@2620:0:28a2:4020:f4a7:4b9f:a51e:858c) has joined #linuxvoice
2016-04-07 22:10:00 [22:04]
2016-04-07 22:17:50 irc: disconnected from server
2016-04-07 23:09:16 - fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-04-07 23:09:16 [23:09]
2016-04-07 23:09:16 Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-04-07 23:09:16 Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-04-07 23:09:16 Channel #linuxvoice: 78 nicks (1 op, 0 voices, 77 normals)
2016-04-07 23:09:25 Channel created on Tue, 12 Nov 2013 01:19:50
2016-04-07 23:09:50 @degville Why are we so crap.
2016-04-07 23:10:01 Devilment I blame Mike
2016-04-07 23:10:08 @degville Can we all please blame Mike.
2016-04-07 23:10:18 @degville It was Mike's fault.
2016-04-07 23:10:22 JoeRess #blamepopey
2016-04-07 23:10:39 JoeRess Now there's a blast from the past
2016-04-07 23:10:42 @degville errr. I'll tweet it for now. And there's definitely an ad in the issue we're just finishing. but yeah, sorry.
2016-04-07 23:10:52 JoeRess It's OK
2016-04-07 23:10:57 Devilment Mike should've done it as his "Just one more thing(tm)"
2016-04-07 23:11:21 JoeRess As I said my concern is that it will sell out before your listeners hear about it
2016-04-07 23:11:22 popey wise
2016-04-07 23:11:58 popey JoeRess: sadly #blamepopey still has legs http://blamepopey.com/
2016-04-07 23:12:02 popey (not my website)
2016-04-07 23:12:14 * TraceyC blames mike
2016-04-07 23:13:04 JoeRess Is it normal to change the font colour in your terminal to green so it looks like the Matrix?
2016-04-07 23:13:19 popey in 2016, less so I think
2016-04-07 23:13:50 TraceyC that.. would only be the 2nd time in my life I've been genuinely RickRolled & didn't see it coming. Well played. (http://blamepopey.com/)
2016-04-07 23:13:56 popey hah
2016-04-07 23:14:09 zmoylan-pi my first terminal experince was green text on black then gold text on the fancy new terminals
2016-04-07 23:14:16 TraceyC Same
2016-04-07 23:14:37 popey amusingly the guy who made that site sent a mail about his broken mx4 to the ubuntu phone mailing list and the issues he's having. He posted the link and _nobody_ clicked it but continued to reply to his mail to help solve the problem :)
2016-04-07 23:14:51 TraceyC I learned 2 computer on my mom's TRS-80. She taught me word processing after having converted her company's donor list to a database
2016-04-07 23:15:15 popey https://lists.launchpad.net/ubuntu-phone/msg19253.html
2016-04-07 23:15:40 popey Yeah, first terminal I used was on a Pr1meOS mini-computer at Brooklands College in 1986
2016-04-07 23:15:43 popey was green.
2016-04-07 23:16:53 popey https://en.wikipedia.org/wiki/Prime_Computer#/media/File:Prime9950_kean.jpg
2016-04-07 23:16:55 popey happy memories
2016-04-07 23:17:36 popey learned COBOL on that.
2016-04-07 23:17:49 TwistedLucidity TraceyC: Took me an age to see it - evil Flash is blocked
2016-04-07 23:18:41 Devilment *Gasp* Another COBOL dinosaur in here
2016-04-07 23:19:01 * TwistedLucidity sticks hand up as part of COBOL massive
2016-04-07 23:19:15 TwistedLucidity I am really sorry if I screwed your current accounts or mortgagegs up....
2016-04-07 23:19:19 Devilment TwistedLucidity: Just like the programs
2016-04-07 23:19:38 Devilment There's no such thing as a short COBOL program
2016-04-07 23:20:18 Korruptor I learned COBOL at college as well, still recovering
2016-04-07 23:21:19 Devilment JoeRess: www.asty.org/cmatrix/ for the full effect
2016-04-07 23:21:42 TwistedLucidity Devilment: Good money in COBOL I'm told.
2016-04-07 23:22:02 Korruptor and ADA
2016-04-07 23:23:00 TwistedLucidity Isn't ADA for dropping bombs on people's heads? At least with COBOL you only defraud them
2016-04-07 23:23:22 Korruptor yeah, I think MOD are the main users
2016-04-07 23:23:28 Korruptor got taught that as well
2016-04-07 23:23:54 Korruptor but since there are like 3 people that can still write it, and lots of dodgy sw that needs porting there's a fair bit of cash in it
2016-04-07 23:24:40 popey COBOL was mostly responsible for wasting printer paper where I was. Not much productive.
2016-04-07 23:24:40 [23:24]
2016-04-07 23:25:14 Korruptor very verbose, I'll give it that
2016-04-07 23:25:33 Stilvoid Any AS/400 weirdos?
2016-04-07 23:25:47 james_olympus I have a lot of old paper with sprocket holes. Maybe I could open a chip shop
2016-04-07 23:26:25 Korruptor that the paper with the green and white stripes?
2016-04-07 23:26:31 james_olympus Yes
2016-04-07 23:26:39 Korruptor god I used to think I was NERD GOD printing out source to that
2016-04-07 23:27:30 Korruptor don't even own a printer now
2016-04-07 23:27:59 james_olympus I only use mine for postage labels (they used to be called 'stamps')
2016-04-07 23:28:42 Devilment Colour laser printers and syntax highlighting FTW
2016-04-07 23:28:53 * Korruptor looks at rogue one trailer
2016-04-07 23:29:05 Korruptor blimey, I'm almost excited by that
2016-04-07 23:30:01 Devilment Korruptor: Many Bothans died to bring you that trailer
2016-04-07 23:30:10 * Korruptor salutes them
2016-04-07 23:30:56 Korruptor I could get into this new Star Wars film every Xmas lark
2016-04-07 23:31:03 TraceyC My multifunciton printer sees a lot more use as a scanner than a printer. Also mostly use it for printing post labels
2016-04-07 23:31:57 ideasman42 (~cambo@220-253-82-5.dyn.iinet.net.au) has quit (Quit: Ex-Chat)
2016-04-07 23:32:10 james_olympus This 'Rogue One' is a spin off?
2016-04-07 23:32:19 Korruptor https://amp.twimg.com/v/a6ca9f94-c867-4979-9d31-569c3e114875
2016-04-07 23:32:27 Korruptor yeah, back story stuff
2016-04-07 23:32:44 Devilment It's how they got the Death Star plans IIRC
2016-04-07 23:32:59 Korruptor yup
2016-04-07 23:33:59 Devilment DS I or DS II?
2016-04-07 23:35:02 Devilment Ah, DS I
2016-04-07 23:41:00 [23:35]
2016-04-07 23:41:25 michaelis (~chatzilla@62.182.218.71) has quit (Quit: ChatZilla 0.9.92 [Firefox 45.0.1/20160315153207])
2016-04-07 23:47:00 [23:41]
2016-04-07 23:51:02 james_olympus Not sure what to make of it. The images are good but there's a lot of 'fluff' in the franchise now
2016-04-07 23:53:08 Korruptor willing to give it a go
2016-04-07 23:53:18 Korruptor even though the last one was a remake, I still enjoyed it a lot
2016-04-07 23:55:47 TwistedLucidity I mostly use the printer for tickets and travel insurance policies
2016-04-08 00:01:00 [23:55]
2016-04-08 00:01:56 - towy71_ (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has joined #linuxvoice
2016-04-08 00:05:03 towy71 (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has quit (Ping timeout: 244 seconds)
2016-04-08 00:05:45 Devilment I think Ep VII was JJ saying to the fan base, "We understand this."
2016-04-08 00:07:10 Korruptor or at least "Sorry for that shite Lucasarts made"
2016-04-08 00:07:38 Korruptor but tbh, it's hard to go wrong when you're merging the stories from the 3 good star wars and giving everything a decent lick of paint
2016-04-08 00:07:55 Korruptor Rey's going to kick ass though
2016-04-08 00:08:36 brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has quit (Quit: Konversation terminated!)
2016-04-08 00:11:27 Devilment But she's proejcting an unrealistic body image for young girls!
2016-04-08 00:12:26 Devilment They should've cast Rebel Wilson in the role
2016-04-08 00:13:06 Devilment I mean, she's called Rebel, so already a good fit for playing a member of the Rebel Alliance
2016-04-08 00:16:46 - swift110-phone (~swift110-@unaffiliated/swift110) has joined #linuxvoice
2016-04-08 00:16:46 [00:16]
2016-04-08 00:19:50 - mnavrati (milan@nat/redhat/x-wsdyiqfopstcldiu) has joined #linuxvoice
2016-04-08 00:24:20 TwistedLucidity Biggest issue for me was that it was episodes 4. For the third time.
2016-04-08 00:25:01 TwistedLucidity The characters were good though. But "Deathstar V3.0 - this time we're serious"?
2016-04-08 00:25:41 TwistedLucidity There were also a few too many nods to the proper films. One or two would have been OK, but towards the end I was wondering if he was capable of forming an original idea.
2016-04-08 00:25:51 Devilment Hold on, has everyone here who wants to see SW VII seen it yet before we delve too far into spoilers?
2016-04-08 00:26:19 TraceyC I agree, too many nods to the previous films. I did appreciate the lack of stupid characters tho
2016-04-08 00:27:00 TwistedLucidity Oooo....he could have killed JarJar. I'd have watched that on repeat
2016-04-08 00:27:09 Devilment OK, no-one objects. Plough on
2016-04-08 00:27:33 Devilment I liked that Kylo Ren looked like the school spanner
2016-04-08 00:27:48 TwistedLucidity Ex-US Marine apparently
2016-04-08 00:27:59 TwistedLucidity Bit of a career change
2016-04-08 00:28:13 TraceyC Pewp, have to go to a meeting. Of all the times :D
2016-04-08 00:28:14 TraceyC later
2016-04-08 00:28:18 TraceyC (~TraceyC@2620:0:28a2:4020:f4a7:4b9f:a51e:858c) has quit (Quit: Off I go into the wild, blue yonder)
2016-04-08 00:28:21 Devilment With the mask off, I thought "Dweeb"
2016-04-08 00:28:36 TwistedLucidity With the mask on I thought "Mutated Cyber Monkey"
2016-04-08 00:28:55 Devilment Which I thought worked well with the character, given his hang-up with his grandfather's achievements
2016-04-08 00:30:03 andybalaam (andybalaam@nat/ibm/x-rocqpkzyjvcfxleg) has quit (Quit: Leaving)
2016-04-08 00:30:05 Devilment Still think it was a missed opportunity for someone to ask Finn where he learnt to shoot like that
2016-04-08 00:30:34 TwistedLucidity When will we get the telnet version; that's what I want to know
2016-04-08 00:31:22 TwistedLucidity telnet towel.blinkenlights.nl
2016-04-08 00:33:05 swift110-phone Lol
2016-04-08 00:33:05 [00:33]
2016-04-08 00:38:01 writtenoff (~writtenof@d172-218-204-26.bchsia.telus.net) has quit (Quit: WeeChat 1.3)
2016-04-08 00:43:50 TwistedLucidity £9m splurged on EU leaflets. Yeesh
2016-04-08 00:48:26 Devilment SNP: Scotland needs its independence so we can control our own destiny
2016-04-08 00:48:26 [00:48]
2016-04-08 00:48:53 Devilment SNP: The UK needs to stay part of the EU because of the benefits it brings
2016-04-08 00:49:34 TwistedLucidity Nyes...bit of a puzzler that.
2016-04-08 00:49:48 TwistedLucidity FWIW, all the UK needs is a less London-centric worldview
2016-04-08 00:50:13 TwistedLucidity IM(ns)HO
2016-04-08 00:52:06 Devilment Darn. I thought I had some Lemsip in my office drawer
2016-04-08 00:52:38 TwistedLucidity Whiskey it is then
2016-04-08 00:52:55 TwistedLucidity Or Whisky, if you prefer
2016-04-08 00:54:00 Devilment Definitely not at work
2016-04-08 00:54:15 Devilment And I have to drive home
2016-04-08 00:54:42 * TwistedLucidity is home
2016-04-08 00:54:50 TwistedLucidity *Hic*
2016-04-08 00:54:52 TwistedLucidity :-P
2016-04-08 00:55:08 Devilment I have a very strict any drinking and no driving policy
2016-04-08 00:55:20 TwistedLucidity Me too as it happens.
2016-04-08 00:55:30 Devilment I won't even have a supermarket sample if I'm driving
2016-04-08 00:56:32 TwistedLucidity I'm not quite that strict...but I deffo will not have a pint and get behind the wheel. A half and then maybe a 2-3 hour gap
2016-04-08 00:57:56 TwistedLucidity Heck, I don't even like carrying car keys when on the bevvy. Just have to meet that one officer having a bad day and it's "Drunk in charge of a motor vehicle" or something.
2016-04-08 00:58:02 TwistedLucidity Also, I'd probably lose them....
2016-04-08 01:00:26 sjelly (~sjelly@116.87.34.221) has quit (Quit: Leaving)
2016-04-08 01:05:43 jimbotux classic SNP nonsense.
2016-04-08 01:05:43 [01:05]
2016-04-08 01:06:10 jimbotux https://www.youtube.com/watch?v=eVynXGj4eyA
2016-04-08 01:06:33 jimbotux enjoyed watching the fearless leader getting a good grilling other day
2016-04-08 01:07:50 Korruptor Scotland wasn't intending to leave the EU
2016-04-08 01:09:07 jimbotux i was just argreeing with Devilment post few mins ago. I know they werent, but if they do ever get independence then they might need to apply
2016-04-08 01:09:46 TwistedLucidity Which will be rejected because of Catalunya
2016-04-08 01:10:19 Korruptor may, EU had pretty much said they'd favour existing members staying
2016-04-08 01:10:50 Korruptor What was left of the UK would still have a veto though
2016-04-08 01:11:42 - swift110 (~swift110@96.231.222.51) has joined #linuxvoice
2016-04-08 01:17:00 [01:11]
2016-04-08 01:17:44 mcphail jimbotux: Jesus. Hadn't seen that interview. Nice to see her squeak
2016-04-08 01:18:59 jimbotux lol! at the end when he just tacks on. "You should be kind to them". I almost spat tea over my monitor
2016-04-08 01:22:19 TwistedLucidity Korruptor: See, that's the thing. Catalunya wants to split from Spain and would most likely seek EU membership. Madrid would want to block that and a stick to keep the Catalans in-line.
2016-04-08 01:22:36 Korruptor yeah, I know
2016-04-08 01:22:44 TwistedLucidity Allowing Scotland to join the EU after splitting would set a precedent Madrid would not want, so they'd try to block Scotland
2016-04-08 01:22:59 Korruptor but there's a very fuzzy line with the EU, it's technically illegal to leave, and both "have membership"
2016-04-08 01:23:02 TwistedLucidity How much power Madrid has in the EU....I dunno. They sure hold a lot of debt though!
2016-04-08 01:23:16 Korruptor yeah, it needs arbitration
2016-04-08 01:24:10 Korruptor I'm sure the EU courts will find in favour of their own interests, when ever they're tested
2016-04-08 01:27:02 mcphail This interview is just getting worse and worse. This would be almost career-ending for anyone who isn't coated in as much teflon as NS...
2016-04-08 01:27:25 Korruptor she makes me chuckle
2016-04-08 01:28:59 Devilment She's fan-dabby-dosy
2016-04-08 01:29:21 TwistedLucidity Just gonny no
2016-04-08 01:29:31 TwistedLucidity (Different show, just came to mind)
2016-04-08 01:29:56 Korruptor right, beer o'clock!
2016-04-08 01:30:07 TwistedLucidity Does PulseAudio do volume levelling? If so; how do I turn it off? I swear some videos get quieter/louder
2016-04-08 01:30:17 thepoodlesprivat (~thepoodle@89.101.144.126) has quit (Ping timeout: 246 seconds)
2016-04-08 01:33:28 TwistedLucidity As to Scotland, UK and the EU...just put me in charge of everything. I will make decisions based who pays me most, or gives me the best presents. Which makes me more honest than any other candidate!
2016-04-08 01:33:28 [01:33]
2016-04-08 01:33:47 jimbotux haha
2016-04-08 01:34:00 TwistedLucidity I will restore the Windows Tax, but not quite in the way people think
2016-04-08 01:34:06 * Devilment slips TwistedLucidity a couple of packets of Jaffa Cakes
2016-04-08 01:36:48 TwistedLucidity Oooo, dark chocolate ones too. They're hard to find. Nice. Very nice.
2016-04-08 01:37:13 Devilment 99p for a triple pack of dark choc Jaffa Cakes in B&M's
2016-04-08 01:37:39 * mcphail ups the ante with a 6 pack of Tunnock's Teacakes
2016-04-08 01:37:40 TwistedLucidity You're the reason I'm fat!
2016-04-08 01:37:54 TwistedLucidity mcphail: Caramel wafers.
2016-04-08 01:38:02 TwistedLucidity You can't top Tunnocks!
2016-04-08 01:38:10 Devilment mcphail: British or Scottish Tunnock's Teacakes? :)
2016-04-08 01:38:24 mcphail Devilment: http://www.telegraph.co.uk/news/2016/04/06/tunnocks-tea-cake-sales-rocket-despite-boycott-from-cybernats-an/
2016-04-08 01:38:46 mcphail Devilment: British, of course
2016-04-08 01:39:31 TwistedLucidity Heh, that whole things passed me by. See? Out-of-touch, quality of a true world leader!
2016-04-08 01:42:40 swift110 (~swift110@96.231.222.51) has quit (Ping timeout: 244 seconds)
2016-04-08 01:43:34 foxhunt72 is now known as foxhunt_away
2016-04-08 01:45:36 arubislander (~ArubIslan@86.93.93.218) has quit (Quit: Leaving.)
2016-04-08 01:51:00 [01:45]
2016-04-08 01:52:33 jimbotux playing with the 16.04 server beta
2016-04-08 01:52:41 jimbotux zfs wasnt an option for root install...
2016-04-08 01:53:14 jimbotux bit disappointing. Must just be for lxc/d
2016-04-08 01:54:03 Devilment lxcd? The web comic? ;)
2016-04-08 01:54:39 jimbotux ha!
2016-04-08 01:56:17 - towy71 (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has joined #linuxvoice
2016-04-08 01:57:29 jimbotux https://github.com/zfsonlinux/pkg-zfs/wiki/HOWTO-install-Ubuntu-16.04-to-a-Native-ZFS-Root-Filesystem
2016-04-08 01:57:49 jimbotux Looks like they are working on it. Would be nice to get that for release
2016-04-08 01:59:03 towy71_ (~dicky@82-71-2-15.dsl.in-addr.zen.co.uk) has quit (Ping timeout: 240 seconds)
2016-04-08 01:59:20 TwistedLucidity (~TwistedLu@cpc80671-stap13-2-0-cust118.12-2.cable.virginm.net) has quit (Quit: Konversation terminated!)
2016-04-08 02:00:45 jherrmann (jirkah@nat/redhat/x-rvndtvsnfgmpncsa) has quit (Quit: Toodle pip!)
2016-04-08 02:06:00 [02:00]
2016-04-08 02:08:27 - buono (~dave@host-92-8-206-203.as43234.net) has joined #linuxvoice
2016-04-08 02:12:26 - writtenoff (~writtenof@of1.psych.ubc.ca) has joined #linuxvoice
2016-04-08 02:13:36 swift110-phone (~swift110-@unaffiliated/swift110) has quit (Read error: Connection reset by peer)
2016-04-08 02:19:00 [02:13]
2016-04-08 02:29:27 - TraceyC (~TraceyC@2620:0:28a2:4020:f4a7:4b9f:a51e:858c) has joined #linuxvoice
2016-04-08 02:35:00 [02:29]
2016-04-08 02:35:33 xplora1a (~stuart@81.144.225.214) has quit (Ping timeout: 240 seconds)
2016-04-08 02:41:00 [02:35]
2016-04-08 03:17:01 JoeRess (~yaaic@cpc16-mort6-2-0-cust250.19-2.cable.virginm.net) has quit (Quit: Yaaic - Yet another Android IRC client - http://www.yaaic.org)
2016-04-08 03:17:01 [03:17]
2016-04-08 03:20:15 buono (~dave@host-92-8-206-203.as43234.net) has quit (Quit: Konversation terminated!)
2016-04-08 03:26:00 [03:20]
2016-04-08 03:32:27 * zmoylan-pi starts ripping ice cold in alex...
2016-04-08 03:34:24 james_olympus Oh, I remember that one
2016-04-08 03:34:45 zmoylan-pi thanks to an advert a few decades back... probably...
2016-04-08 03:40:00 [03:34]
2016-04-08 03:45:05 TraceyC (~TraceyC@2620:0:28a2:4020:f4a7:4b9f:a51e:858c) has quit (Ping timeout: 248 seconds)
2016-04-08 03:51:00 [03:45]
2016-04-08 03:52:53 zmoylan-pi one rip done... next up... lawrence of arabia...
2016-04-08 03:53:08 - asusk7m550 (~Thunderbi@2001:981:97b3:1:fc4f:2765:90c9:c119) has joined #linuxvoice
2016-04-08 03:57:35 james_olympus Haven't seen that one
2016-04-08 03:58:22 - TraceyC (~TraceyC@2620:0:28a2:4020:f953:27a9:11de:2c5) has joined #linuxvoice
2016-04-08 04:02:18 - x4j5 (~x4j5@cpc1-nrwh11-2-0-cust227.4-4.cable.virginm.net) has joined #linuxvoice
2016-04-08 04:08:00 [04:02]
2016-04-08 04:10:09 foxhunt_away is now known as foxhunt72
2016-04-08 04:16:00 [04:10]
2016-04-08 04:17:40 zmoylan-pi it's a classic, music and visuals...
2016-04-08 04:18:07 zmoylan-pi dvd is been annoying...
2016-04-08 04:24:00 [04:18]
2016-04-08 04:43:09 x4j5 (~x4j5@cpc1-nrwh11-2-0-cust227.4-4.cable.virginm.net) has quit (Ping timeout: 246 seconds)
2016-04-08 04:43:09 [04:43]
2016-04-08 04:51:16 mnavrati (milan@nat/redhat/x-wsdyiqfopstcldiu) has quit (Quit: Leaving)
2016-04-08 04:52:16 - swift110-phone (~swift110-@unaffiliated/swift110) has joined #linuxvoice
2016-04-08 04:52:19 swift110-phone (~swift110-@unaffiliated/swift110) has quit (Max SendQ exceeded)
2016-04-08 04:58:00 [04:52]
2016-04-08 05:57:12 jaake (~h4ckm3@129.59.122.24) has quit (Ping timeout: 250 seconds)
2016-04-08 05:57:12 [05:57]
2016-04-08 06:03:42 TraceyC (~TraceyC@2620:0:28a2:4020:f953:27a9:11de:2c5) has quit (Quit: Off I go into the wild, blue yonder)
2016-04-08 06:03:45 bdmc (bdmc@cl-745.bos-01.us.sixxs.net) has quit (Ping timeout: 248 seconds)
2016-04-08 06:07:06 - bdmc (bdmc@cl-745.bos-01.us.sixxs.net) has joined #linuxvoice
2016-04-08 06:11:18 writtenoff (~writtenof@of1.psych.ubc.ca) has quit (Quit: WeeChat 1.3)
2016-04-08 06:14:46 - writtenoff (~writtenof@of1.psych.ubc.ca) has joined #linuxvoice
2016-04-08 06:14:46 [06:14]
2016-04-08 06:34:02 zmoylan-pi worth waiting for... ;-0
2016-04-08 06:34:02 [06:34]
2016-04-08 06:34:05 zmoylan-pi :-)
2016-04-08 06:34:54 asusk7m550 (~Thunderbi@2001:981:97b3:1:fc4f:2765:90c9:c119) has quit (Quit: asusk7m550)
2016-04-08 06:36:34 Korruptor (~kor@dsl-espbrasgw1-50dfb8-221.dhcp.inet.fi) has quit (Ping timeout: 252 seconds)
2016-04-08 06:42:00 [06:36]
2016-04-08 06:42:37 - Korruptor (~kor@dsl-espbrasgw1-50dfb8-221.dhcp.inet.fi) has joined #linuxvoice
2016-04-08 06:48:00 [06:42]
2016-04-08 06:50:19 Korruptor (~kor@dsl-espbrasgw1-50dfb8-221.dhcp.inet.fi) has quit (Ping timeout: 252 seconds)
2016-04-08 06:56:00 [06:50]
2016-04-08 07:14:41 foxhunt72 is now known as foxhunt_away
2016-04-08 07:14:41 [07:14]
2016-04-08 07:27:17 - Nitronium (~Dave@host213-1-9-245.range213-1.btcentralplus.com) has joined #linuxvoice
2016-04-08 07:33:00 [07:27]
2016-04-08 07:35:08 Nitronium (~Dave@host213-1-9-245.range213-1.btcentralplus.com) has quit (Ping timeout: 250 seconds)
2016-04-08 07:41:00 [07:35]
2016-04-08 07:52:57 Ioangogo https://www.youtube.com/watch?v=RrrDLdeL2HQ
2016-04-08 07:53:30 Ioangogo In the reddit comments some one posted "I love the 2 horn blasts after they've come to a stop... "Moored... shift color"
2016-04-08 07:59:00 [07:53]
2016-04-08 08:23:31 - jaake (~h4ckm3@c-68-52-45-79.hsd1.tn.comcast.net) has joined #linuxvoice
2016-04-08 08:23:31 [08:23]
2016-04-08 08:29:27 - ideasman42 (~cambo@220-253-82-5.dyn.iinet.net.au) has joined #linuxvoice
2016-04-08 08:35:00 [08:29]
2016-04-08 08:44:10 jaake (~h4ckm3@c-68-52-45-79.hsd1.tn.comcast.net) has quit (Ping timeout: 252 seconds)
2016-04-08 08:50:00 [08:44]
2016-04-08 09:18:55 Ioangogo (~Quassel@huwloosley.plus.com) has quit (Read error: Connection reset by peer)
2016-04-08 09:18:55 [09:18]
2016-04-08 09:20:03 - Ioangogo (~Quassel@huwloosley.plus.com) has joined #linuxvoice
2016-04-08 09:21:18 - brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has joined #linuxvoice
2016-04-08 09:27:00 [09:21]
2016-04-08 09:34:16 bdmc (bdmc@cl-745.bos-01.us.sixxs.net) has quit (Ping timeout: 268 seconds)
2016-04-08 09:40:00 [09:34]
2016-04-08 09:41:41 evilnickveitch (~evilnick@cpc83321-bath6-2-0-cust252.18-1.cable.virginm.net) has quit (Ping timeout: 244 seconds)
2016-04-08 09:45:31 writtenoff (~writtenof@of1.psych.ubc.ca) has quit (Quit: WeeChat 1.3)
2016-04-08 09:46:08 LauRoman (~LauRoman@5-14-92-160.residential.rdsnet.ro) has quit (Quit: Leaving)
2016-04-08 09:52:00 [09:46]
2016-04-08 09:56:34 - evilnickveitch (~evilnick@cpc83321-bath6-2-0-cust252.18-1.cable.virginm.net) has joined #linuxvoice
2016-04-08 09:59:17 - swift110-phone (~swift110-@unaffiliated/swift110) has joined #linuxvoice
2016-04-08 09:59:20 swift110-phone (~swift110-@unaffiliated/swift110) has quit (Max SendQ exceeded)
2016-04-08 10:00:02 - swift110-phone (~swift110-@unaffiliated/swift110) has joined #linuxvoice
2016-04-08 10:00:04 swift110-phone (~swift110-@unaffiliated/swift110) has quit (Max SendQ exceeded)
2016-04-08 10:00:32 - swift110-phone (~swift110-@unaffiliated/swift110) has joined #linuxvoice
2016-04-08 10:00:34 swift110-phone (~swift110-@unaffiliated/swift110) has quit (Max SendQ exceeded)
2016-04-08 10:01:48 - swift110-phone (~swift110-@unaffiliated/swift110) has joined #linuxvoice
2016-04-08 10:01:56 swift110-phone (~swift110-@unaffiliated/swift110) has quit (Max SendQ exceeded)
2016-04-08 10:07:00 [10:01]
2016-04-08 10:42:22 - swift110-phone (~swift110-@unaffiliated/swift110) has joined #linuxvoice
2016-04-08 10:42:22 [10:42]
2016-04-08 10:42:28 swift110-phone (~swift110-@unaffiliated/swift110) has quit (Max SendQ exceeded)
2016-04-08 10:48:00 [10:42]
2016-04-08 10:51:33 brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has quit (Ping timeout: 276 seconds)
2016-04-08 10:52:58 - swift110-phone (~swift110-@unaffiliated/swift110) has joined #linuxvoice
2016-04-08 10:58:00 [10:52]
2016-04-08 11:05:54 swift110-phone Hey
2016-04-08 11:11:00 [11:05]
2016-04-08 11:28:07 - jaake (~h4ckm3@c-68-52-45-79.hsd1.tn.comcast.net) has joined #linuxvoice
2016-04-08 11:28:07 [11:28]
2016-04-08 12:04:22 - AdamDBrown1 (~Thunderbi@250.113-240-116.dynamic.dsl.pth.iprimus.net.au) has joined #linuxvoice
2016-04-08 12:04:22 [12:04]
2016-04-08 12:06:04 AdamDBrown (~Thunderbi@243.203-27-211.dynamic.dsl.pth.iprimus.net.au) has quit (Ping timeout: 240 seconds)
2016-04-08 12:06:05 AdamDBrown1 is now known as AdamDBrown
2016-04-08 12:12:00 [12:06]
2016-04-08 12:13:22 swift110-phone (~swift110-@unaffiliated/swift110) has quit (Ping timeout: 268 seconds)
2016-04-08 12:13:54 - AdamDBrown1 (~Thunderbi@250.113-240-116.dynamic.dsl.pth.iprimus.net.au) has joined #linuxvoice
2016-04-08 12:15:31 AdamDBrown (~Thunderbi@250.113-240-116.dynamic.dsl.pth.iprimus.net.au) has quit (Ping timeout: 250 seconds)
2016-04-08 12:15:32 AdamDBrown1 is now known as AdamDBrown
2016-04-08 12:16:23 ideasman42 (~cambo@220-253-82-5.dyn.iinet.net.au) has quit (Ping timeout: 250 seconds)
2016-04-08 12:22:00 [12:16]
2016-04-08 12:26:33 jaake (~h4ckm3@c-68-52-45-79.hsd1.tn.comcast.net) has quit (Ping timeout: 260 seconds)
2016-04-08 12:30:39 - bdmc (bdmc@cl-745.bos-01.us.sixxs.net) has joined #linuxvoice
2016-04-08 12:36:00 [12:30]
2016-04-08 13:06:23 - brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has joined #linuxvoice
2016-04-08 13:06:23 [13:06]
2016-04-08 13:40:51 irc: disconnected from server
2016-04-08 17:53:13 - fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-04-08 17:53:13 [17:53]
2016-04-08 17:53:13 Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-04-08 17:53:13 Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-04-08 17:53:13 Channel #linuxvoice: 69 nicks (1 op, 0 voices, 68 normals)
2016-04-08 17:53:23 Channel created on Tue, 12 Nov 2013 01:19:50
2016-04-08 17:53:52 - thepoodlesprivat (~thepoodle@89.101.144.126) has joined #linuxvoice
2016-04-08 17:54:44 - mnavrati (milan@nat/redhat/x-jjrvprecprzsvwnx) has joined #linuxvoice
2016-04-08 18:00:00 [17:54]
2016-04-08 18:20:09 - TwistedLucidity (~TwistedLu@cpc80671-stap13-2-0-cust118.12-2.cable.virginm.net) has joined #linuxvoice
2016-04-08 18:20:09 [18:20]
2016-04-08 18:32:58 TwistedLucidity I just made a fincovery. Scottish TV's website runs on Apache/Ubuntu.
2016-04-08 18:38:00 [18:32]
2016-04-08 18:39:06 - jherrmann (~jirkah@ip4-83-240-20-19.cust.nbox.cz) has joined #linuxvoice
2016-04-08 18:43:28 Blackisle fincovery :)
2016-04-08 18:45:26 jherrmann (~jirkah@ip4-83-240-20-19.cust.nbox.cz) has quit (Quit: Toodle pip!)
2016-04-08 18:51:00 [18:45]
2016-04-08 19:12:50 - jherrmann (~jirkah@ip4-83-240-20-19.cust.nbox.cz) has joined #linuxvoice
2016-04-08 19:12:50 [19:12]
2016-04-08 19:16:36 Devilment I hate the stage of a cold when one is going through more tissues than a teenage boy who has discovered the true purpose of the Internet
2016-04-08 19:22:00 [19:16]
2016-04-08 19:23:58 - ryuslash (~slash@2a02:1812:2518:ce00:f24d:a2ff:fede:451c) has joined #linuxvoice
2016-04-08 19:29:00 [19:23]
2016-04-08 19:29:30 zmoylan-pi but how many cat videos can one boy download...
2016-04-08 19:34:00 TwistedLucidity Devilment: Is your mind clear? That's what I hate. Body is sick but the mind is clear and very, very bored.
2016-04-08 19:34:41 TwistedLucidity My threshold for serious illness is "Do I find daytime TV entertaining?" Y - stay at home and try not to die. N - return to work next day.
2016-04-08 19:40:00 [19:34]
2016-04-08 19:47:56 Devilment I don't stay off work for most illnesses
2016-04-08 19:48:03 Devilment Death, maybe
2016-04-08 19:51:44 TwistedLucidity I do, I don't want to give it to others. Open plan offices are perfect transmission vectors.
2016-04-08 19:51:56 TwistedLucidity I will work from home whilst sick, but I won't go in.
2016-04-08 19:57:00 [19:51]
2016-04-08 20:14:27 - buono (~dave@host-92-8-206-203.as43234.net) has joined #linuxvoice
2016-04-08 20:14:27 [20:14]
2016-04-08 21:30:55 - michaelis (~chatzilla@62.182.218.71) has joined #linuxvoice
2016-04-08 21:30:55 [21:30]
2016-04-08 21:39:17 ideasman42 (~cambo@220-253-82-5.dyn.iinet.net.au) has quit (Remote host closed the connection)
2016-04-08 21:45:00 [21:39]
2016-04-08 21:58:42 - jaake (~h4ckm3@129.59.122.24) has joined #linuxvoice
2016-04-08 22:02:22 - M1C4HTRON13 (~micah@bodhilinux/team/M1C4HTRON13) has joined #linuxvoice
2016-04-08 22:02:22 [22:02]
2016-04-08 22:12:49 - TraceyC (~TraceyC@2620:0:28a2:4020:f953:27a9:11de:2c5) has joined #linuxvoice
2016-04-08 22:18:00 [22:12]
2016-04-08 22:20:38 michaelis (~chatzilla@62.182.218.71) has quit (Quit: ChatZilla 0.9.92 [Firefox 45.0.1/20160315153207])
2016-04-08 22:26:00 [22:20]
2016-04-08 22:55:08 bdmc (bdmc@cl-745.bos-01.us.sixxs.net) has quit (Ping timeout: 250 seconds)
2016-04-08 22:55:08 [22:55]
2016-04-08 22:58:27 Devilment Well, bugger me with a fish slice. One of the actors in Mad Men played Connor in Angel
2016-04-08 22:58:52 TraceyC hahahah
2016-04-08 23:02:20 Devilment Always thought he looked familiar
2016-04-08 23:08:00 [23:02]
2016-04-08 23:40:35 - sjelly (~sjelly@116.87.34.221) has joined #linuxvoice
2016-04-08 23:40:35 [23:40]
2016-04-08 23:45:56 jaake (~h4ckm3@129.59.122.24) has quit (Ping timeout: 244 seconds)
2016-04-08 23:51:00 [23:45]
2016-04-09 00:01:56 N3wbs (~steve@77.73.151.228) has quit (Quit: Leaving)
2016-04-09 00:07:00 [00:01]
2016-04-09 00:08:25 - jade-cat (~ident@188.146.8.83.nat.umts.dynamic.t-mobile.pl) has joined #linuxvoice
2016-04-09 00:12:49 jade-cat (~ident@188.146.8.83.nat.umts.dynamic.t-mobile.pl) has quit (Read error: Connection reset by peer)
2016-04-09 00:18:00 [00:12]
2016-04-09 00:28:51 - jaake (~h4ckm3@129.59.122.24) has joined #linuxvoice
2016-04-09 00:28:52 - slashd (~slashd@modemcable057.191-130-66.mc.videotron.ca) has joined #linuxvoice
2016-04-09 00:49:32 - fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-04-09 00:49:32 [00:49]
2016-04-09 00:49:32 Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-04-09 00:49:32 Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-04-09 00:49:32 Channel #linuxvoice: 77 nicks (1 op, 0 voices, 76 normals)
2016-04-09 00:49:42 Channel created on Tue, 12 Nov 2013 01:19:50
2016-04-09 00:55:00 [00:49]
2016-04-09 00:56:05 foxhunt72 is now known as foxhunt_away
2016-04-09 01:02:00 [00:56]
2016-04-09 01:04:35 - jade-cat (~ident@adrk73.neoplus.adsl.tpnet.pl) has joined #linuxvoice
2016-04-09 01:10:00 [01:04]
2016-04-09 01:31:45 jimbotux Nothing worse than somebody dragging themselves in for the morning only to announce that they are heading home ill
2016-04-09 01:31:45 [01:31]
2016-04-09 01:31:57 jimbotux Just enough time to spread it. Then off to bed!
2016-04-09 01:32:11 zmoylan-pi as long as they licked every spoon in the canteen before leaving...
2016-04-09 01:32:17 jimbotux haha
2016-04-09 01:38:00 [01:32]
2016-04-09 01:40:44 arubislander (~ArubIslan@86.93.93.218) has quit (Quit: Leaving.)
2016-04-09 01:46:00 [01:40]
2016-04-09 01:49:44 - swift110-phone (~swift110-@unaffiliated/swift110) has joined #linuxvoice
2016-04-09 01:55:00 [01:49]
2016-04-09 01:58:02 brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has quit (Quit: Konversation terminated!)
2016-04-09 01:59:48 sjelly (~sjelly@116.87.34.221) has quit (Quit: Leaving)
2016-04-09 02:05:00 [01:59]
2016-04-09 02:20:22 - charlesay (~daro3@dslb-088-066-041-242.088.066.pools.vodafone-ip.de) has joined #linuxvoice
2016-04-09 02:20:22 [02:20]
2016-04-09 02:22:02 thepoodlesprivat (~thepoodle@89.101.144.126) has quit (Ping timeout: 246 seconds)
2016-04-09 02:24:41 - writtenoff (~writtenof@of1.psych.ubc.ca) has joined #linuxvoice
2016-04-09 02:25:36 andybalaam (andybalaam@nat/ibm/x-guwhyuxiptoufpgp) has quit (Remote host closed the connection)
2016-04-09 02:31:00 [02:25]
2016-04-09 02:42:05 M1C4HTRON13 (~micah@bodhilinux/team/M1C4HTRON13) has quit (Ping timeout: 240 seconds)
2016-04-09 02:46:17 xplora1a (~stuart@81.144.225.214) has quit (Ping timeout: 264 seconds)
2016-04-09 02:46:17 [02:46]
2016-04-09 03:10:27 charlesay (~daro3@dslb-088-066-041-242.088.066.pools.vodafone-ip.de) has quit (Ping timeout: 248 seconds)
2016-04-09 03:10:27 [03:10]
2016-04-09 03:14:57 - andybalaam (~andybalaa@31.185.154.43) has joined #linuxvoice
2016-04-09 03:20:00 [03:14]
2016-04-09 03:59:01 - M1C4HTRON13 (~micah@84.203.64.47) has joined #linuxvoice
2016-04-09 03:59:01 [03:59]
2016-04-09 03:59:02 M1C4HTRON13 (~micah@84.203.64.47) has quit (Changing host)
2016-04-09 03:59:02 - M1C4HTRON13 (~micah@bodhilinux/team/M1C4HTRON13) has joined #linuxvoice
2016-04-09 04:05:00 [03:59]
2016-04-09 04:11:15 mnavrati (milan@nat/redhat/x-jjrvprecprzsvwnx) has quit (Quit: Leaving)
2016-04-09 04:17:00 [04:11]
2016-04-09 04:20:37 jherrmann (~jirkah@ip4-83-240-20-19.cust.nbox.cz) has quit (Quit: Toodle pip!)
2016-04-09 04:21:32 foxhunt_away is now known as foxhunt72
2016-04-09 04:27:00 [04:21]
2016-04-09 04:56:25 - Nitronium (~Dave@host213-1-9-245.range213-1.btcentralplus.com) has joined #linuxvoice
2016-04-09 04:56:25 [04:56]
2016-04-09 05:00:05 M1C4HTRON13 (~micah@bodhilinux/team/M1C4HTRON13) has quit (Remote host closed the connection)
2016-04-09 05:03:16 - x4j5 (~x4j5@cpc1-nrwh11-2-0-cust227.4-4.cable.virginm.net) has joined #linuxvoice
2016-04-09 05:06:52 - bdmc (bdmc@cl-745.bos-01.us.sixxs.net) has joined #linuxvoice
2016-04-09 05:06:59 - M1C4HTRON13 (~micah@bodhilinux/team/M1C4HTRON13) has joined #linuxvoice
2016-04-09 05:12:00 [05:06]
2016-04-09 05:12:35 bdmc (bdmc@cl-745.bos-01.us.sixxs.net) has quit (Ping timeout: 248 seconds)
2016-04-09 05:18:00 [05:12]
2016-04-09 05:24:34 foxhunt72 is now known as foxhunt_away
2016-04-09 05:30:00 [05:24]
2016-04-09 05:34:38 writtenoff (~writtenof@of1.psych.ubc.ca) has quit (Read error: Connection reset by peer)
2016-04-09 05:35:03 - writtenoff (~writtenof@of1.psych.ubc.ca) has joined #linuxvoice
2016-04-09 05:41:00 [05:35]
2016-04-09 05:42:14 - charlesay (~daro3@dslb-088-066-041-242.088.066.pools.vodafone-ip.de) has joined #linuxvoice
2016-04-09 05:44:09 x4j5 (~x4j5@cpc1-nrwh11-2-0-cust227.4-4.cable.virginm.net) has quit (Ping timeout: 248 seconds)
2016-04-09 05:45:22 TwistedLucidity (~TwistedLu@cpc80671-stap13-2-0-cust118.12-2.cable.virginm.net) has quit (Quit: Konversation terminated!)
2016-04-09 05:45:54 charlesay (~daro3@dslb-088-066-041-242.088.066.pools.vodafone-ip.de) has quit (Client Quit)
2016-04-09 05:46:25 - asusk7m550 (~Thunderbi@2001:981:97b3:1:5049:3b09:31e6:1241) has joined #linuxvoice
2016-04-09 05:46:55 asusk7m550 (~Thunderbi@2001:981:97b3:1:5049:3b09:31e6:1241) has quit (Client Quit)
2016-04-09 05:52:00 [05:46]
2016-04-09 05:53:14 jaake (~h4ckm3@129.59.122.24) has quit (Ping timeout: 244 seconds)
2016-04-09 05:59:00 [05:53]
2016-04-09 06:03:28 TraceyC (~TraceyC@2620:0:28a2:4020:f953:27a9:11de:2c5) has quit (Quit: Off I go into the wild, blue yonder)
2016-04-09 06:09:00 [06:03]
2016-04-09 06:10:58 buono (~dave@host-92-8-206-203.as43234.net) has quit (Remote host closed the connection)
2016-04-09 06:11:23 - buono (~dave@host-92-8-206-203.as43234.net) has joined #linuxvoice
2016-04-09 06:17:00 [06:11]
2016-04-09 06:57:31 * Ioangogo has decided windows is a bad laptop OS
2016-04-09 06:57:31 [06:57]
2016-04-09 06:59:57 LauRoman (~LauRoman@5-14-92-160.residential.rdsnet.ro) has quit (Read error: Connection reset by peer)
2016-04-09 06:59:58 zmoylan-pi lose the word laptop from that sentence and it still works
2016-04-09 07:00:34 james_olympus Did you wait for the hard disk light to go off?
2016-04-09 07:00:45 Nitronium (~Dave@host213-1-9-245.range213-1.btcentralplus.com) has quit (Remote host closed the connection)
2016-04-09 07:01:01 zmoylan-pi do modern laptops have hd leds?
2016-04-09 07:01:32 zmoylan-pi i have to listen to the chitter of the hd in my last 2 lenovos
2016-04-09 07:04:53 james_olympus Mine does.. oh, 'modern'
2016-04-09 07:07:06 Ioangogo james_olympus: Ive had work experince all week and have been dealing with a gigabyte u2442f, NO BIOS key and has a NVIDIA® GeForce® GT 650M that causes issues with windows 10
2016-04-09 07:07:47 zmoylan-pi ::cough:: pirate ::cough:: :-P
2016-04-09 07:08:06 Ioangogo zmoylan-pi: customer brought a licence
2016-04-09 07:09:11 Ioangogo Windows 8 had a no key sticker
2016-04-09 07:15:00 [07:09]
2016-04-09 07:46:41 buono (~dave@host-92-8-206-203.as43234.net) has quit (Quit: Konversation terminated!)
2016-04-09 07:46:41 [07:46]
2016-04-09 07:49:38 - georgeowell (~georgeowe@95.149.198.223) has joined #linuxvoice
2016-04-09 07:55:00 [07:49]
2016-04-09 08:05:29 - xplora1a (~stuart@2001:8b0:1679:ea38:224:d7ff:feec:e7ec) has joined #linuxvoice
2016-04-09 08:11:00 [08:05]
2016-04-09 08:24:34 - bdmc (bdmc@cl-745.bos-01.us.sixxs.net) has joined #linuxvoice
2016-04-09 08:30:00 [08:24]
2016-04-09 08:49:58 swift110-phone (~swift110-@unaffiliated/swift110) has quit (Ping timeout: 244 seconds)
2016-04-09 08:49:58 [08:49]
2016-04-09 09:16:50 M1C4HTRON13 (~micah@bodhilinux/team/M1C4HTRON13) has quit (Remote host closed the connection)
2016-04-09 09:16:50 [09:16]
2016-04-09 09:18:43 - evilnick__ (~evilnick@cpc83321-bath6-2-0-cust252.18-1.cable.virginm.net) has joined #linuxvoice
2016-04-09 09:21:30 evilnickveitch (~evilnick@cpc83321-bath6-2-0-cust252.18-1.cable.virginm.net) has quit (Ping timeout: 252 seconds)
2016-04-09 09:27:00 [09:21]
2016-04-09 09:31:45 - sjelly (~sjelly@116.87.34.221) has joined #linuxvoice
2016-04-09 09:37:00 [09:31]
2016-04-09 09:38:16 jade-cat (~ident@adrk73.neoplus.adsl.tpnet.pl) has quit (Quit: Yaaic - Yet another Android IRC client - http://www.yaaic.org)
2016-04-09 09:40:58 - Logan_X (~Logan_X@unaffiliated/logan-x/x-5482734) has joined #linuxvoice
2016-04-09 09:46:00 [09:40]
2016-04-09 10:05:18 Ioangogo Wow, ive used 381.42GB from the 20th of march
2016-04-09 10:05:18 [10:05]
2016-04-09 10:11:08 Ioangogo https://www.reddit.com/r/DataHoarder/comments/4dw34z/australian_isp_customers_use_2686_terabytes_of/
2016-04-09 10:17:00 [10:11]
2016-04-09 10:28:21 slashd (~slashd@ubuntu/member/slashd) has quit (Quit: Leaving)
2016-04-09 10:33:48 writtenoff (~writtenof@of1.psych.ubc.ca) has quit (Quit: WeeChat 1.3)
2016-04-09 10:33:48 [10:33]
2016-04-09 10:38:18 - brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has joined #linuxvoice
2016-04-09 10:44:00 [10:38]
2016-04-09 11:06:32 ryuslash (~slash@2a02:1812:2518:ce00:f24d:a2ff:fede:451c) has quit (Remote host closed the connection)
2016-04-09 11:06:32 [11:06]
2016-04-09 11:12:10 topcyde (~topcyde@2602:304:cdb8:9e40:ac31:fca8:fca8:c30a) has quit (Quit: Leaving)
2016-04-09 11:13:30 - topcyde (~topcyde@2602:304:cdb8:9e40:9dec:2c24:e6e3:a9fb) has joined #linuxvoice
2016-04-09 11:14:12 Logan_X (~Logan_X@unaffiliated/logan-x/x-5482734) has quit (Ping timeout: 248 seconds)
2016-04-09 11:20:00 [11:14]
2016-04-09 11:40:31 - zmoylan-1i (~pi@109.79.85.66) has joined #linuxvoice
2016-04-09 11:40:31 [11:40]
2016-04-09 11:43:26 zmoylan-pi (~pi@109.76.254.169) has quit (Ping timeout: 246 seconds)
2016-04-09 11:49:00 [11:43]
2016-04-09 12:05:17 - writtenoff (~writtenof@d172-218-204-26.bchsia.telus.net) has joined #linuxvoice
2016-04-09 12:05:17 [12:05]
2016-04-09 12:14:42 - LauRoman (~LauRoman@5-14-92-160.residential.rdsnet.ro) has joined #linuxvoice
2016-04-09 12:20:00 [12:14]
2016-04-09 12:20:44 - Logan_X (~Logan_X@unaffiliated/logan-x/x-5482734) has joined #linuxvoice
2016-04-09 12:26:00 [12:20]
2016-04-09 12:43:48 prayingmantis (~prayingma@203-7-33-136.dyn.iinet.net.au) has quit (Ping timeout: 276 seconds)
2016-04-09 12:43:48 [12:43]
2016-04-09 12:50:01 - prayingmantis (~prayingma@203-7-33-136.dyn.iinet.net.au) has joined #linuxvoice
2016-04-09 12:56:00 [12:50]
2016-04-09 13:04:10 georgeowell (~georgeowe@95.149.198.223) has quit (Ping timeout: 248 seconds)
2016-04-09 13:10:00 [13:04]
2016-04-09 13:13:04 sjelly (~sjelly@116.87.34.221) has quit (Read error: Connection reset by peer)
2016-04-09 13:19:00 [13:13]
2016-04-09 13:21:32 - sjelly (~sjelly@116.87.34.221) has joined #linuxvoice
2016-04-09 13:21:52 mavrix (~mavrix@unaffiliated/mavrix) has quit (Ping timeout: 252 seconds)
2016-04-09 13:24:14 - mavrix (~mavrix@unaffiliated/mavrix) has joined #linuxvoice
2016-04-09 13:30:00 [13:24]
2016-04-09 13:33:55 sjelly (~sjelly@116.87.34.221) has quit (Ping timeout: 260 seconds)
2016-04-09 13:39:00 [13:33]
2016-04-09 14:00:10 - zmoylan-pi (~pi@109.76.157.141) has joined #linuxvoice
2016-04-09 14:00:10 [14:00]
2016-04-09 14:03:42 zmoylan-1i (~pi@109.79.85.66) has quit (Ping timeout: 268 seconds)
2016-04-09 14:09:00 [14:03]
2016-04-09 15:59:27 Logan_X (~Logan_X@unaffiliated/logan-x/x-5482734) has quit (Ping timeout: 276 seconds)
2016-04-09 15:59:27 [15:59]
2016-04-09 16:33:13 - swift110-phone (~swift110-@unaffiliated/swift110) has joined #linuxvoice
2016-04-09 16:33:13 [16:33]
2016-04-09 17:03:21 - sjelly (~sjelly@116.87.34.221) has joined #linuxvoice
2016-04-09 17:03:21 [17:03]
2016-04-09 17:12:19 archie (~Archie@ces1700.keskus.post.ee) has quit (Read error: Connection reset by peer)
2016-04-09 17:18:00 [17:12]
2016-04-09 18:35:30 andybalaam (~andybalaa@31.185.154.43) has quit (Remote host closed the connection)
2016-04-09 18:35:30 [18:35]
2016-04-09 18:45:05 xplora1a (~stuart@2001:8b0:1679:ea38:224:d7ff:feec:e7ec) has quit (Ping timeout: 250 seconds)
2016-04-09 18:51:00 [18:45]
2016-04-09 18:52:18 swift110-phone (~swift110-@unaffiliated/swift110) has quit (Remote host closed the connection)
2016-04-09 18:58:00 [18:52]
2016-04-09 19:06:12 - Korruptor (~kor@dsl-espbrasgw1-50dfb8-221.dhcp.inet.fi) has joined #linuxvoice
2016-04-09 19:10:31 sjelly (~sjelly@116.87.34.221) has quit (Ping timeout: 244 seconds)
2016-04-09 19:14:14 - ideasman42 (~cambo@220-253-82-5.dyn.iinet.net.au) has joined #linuxvoice
2016-04-09 19:14:14 [19:14]
2016-04-09 19:14:28 ideasman42 hey, anyone from the LV podcast here?
2016-04-09 19:20:00 [19:14]
2016-04-09 19:25:29 james_olympus ideasman42: Weekends are usually quiet in this channel, degville is probably who you're looking for
2016-04-09 19:25:50 ideasman42 ah thx
2016-04-09 19:30:03 prayingmantis (~prayingma@203-7-33-136.dyn.iinet.net.au) has quit (Ping timeout: 276 seconds)
2016-04-09 19:36:00 [19:30]
2016-04-09 19:39:42 bdmc (bdmc@cl-745.bos-01.us.sixxs.net) has quit (Ping timeout: 250 seconds)
2016-04-09 19:40:35 - Nitronium (~Dave@host213-1-9-245.range213-1.btcentralplus.com) has joined #linuxvoice
2016-04-09 19:46:00 [19:40]
2016-04-09 19:46:06 - bdmc (bdmc@cl-745.bos-01.us.sixxs.net) has joined #linuxvoice
2016-04-09 19:52:00 [19:46]
2016-04-09 19:55:58 irc: disconnected from server
2016-04-11 10:21:46 - fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-04-11 10:21:46 [10:21]
2016-04-11 10:21:46 Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-04-11 10:21:46 Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-04-11 10:21:46 Channel #linuxvoice: 64 nicks (1 op, 0 voices, 63 normals)
2016-04-11 10:21:56 Channel created on Tue, 12 Nov 2013 01:19:50
2016-04-11 10:27:00 [10:21]
2016-04-11 10:27:48 [pm] (~pm@2.71.44.175.mobile.tre.se) has quit (Ping timeout: 260 seconds)
2016-04-11 10:33:00 [10:27]
2016-04-11 10:42:09 - [pm] (~pm@2.68.86.8.mobile.tre.se) has joined #linuxvoice
2016-04-11 10:48:00 [10:42]
2016-04-11 10:57:17 [pm] (~pm@2.68.86.8.mobile.tre.se) has quit (Ping timeout: 248 seconds)
2016-04-11 11:03:00 [10:57]
2016-04-11 11:09:39 - [pm] (~pm@2.68.69.250.mobile.tre.se) has joined #linuxvoice
2016-04-11 11:13:58 mnavrati_afk (~milan@ip-94-113-220-233.net.upcbroadband.cz) has quit (Ping timeout: 264 seconds)
2016-04-11 11:19:00 [11:13]
2016-04-11 11:38:21 mavrix (~mavrix@unaffiliated/mavrix) has quit (Ping timeout: 244 seconds)
2016-04-11 11:38:21 [11:38]
2016-04-11 11:39:36 - mavrix (~mavrix@unaffiliated/mavrix) has joined #linuxvoice
2016-04-11 11:45:00 [11:39]
2016-04-11 11:54:43 [pm] (~pm@2.68.69.250.mobile.tre.se) has quit (Ping timeout: 260 seconds)
2016-04-11 12:00:00 [11:54]
2016-04-11 12:05:52 - Extremulus (~Extremulu@2001:470:b:1fb:deaf::d259) has joined #linuxvoice
2016-04-11 12:06:52 - [pm] (~pm@2.69.134.93.mobile.tre.se) has joined #linuxvoice
2016-04-11 12:12:00 [12:06]
2016-04-11 13:47:01 mavrix (~mavrix@unaffiliated/mavrix) has quit (Ping timeout: 252 seconds)
2016-04-11 13:47:01 [13:47]
2016-04-11 13:49:47 - mavrix (~mavrix@unaffiliated/mavrix) has joined #linuxvoice
2016-04-11 13:55:00 [13:49]
2016-04-11 14:03:10 zmoylan-pi (~pi@109.76.81.172) has quit (Ping timeout: 264 seconds)
2016-04-11 14:07:03 - zmoylan-pi (~pi@109.76.211.47) has joined #linuxvoice
2016-04-11 14:13:00 [14:07]
2016-04-11 15:33:47 ChibaPet (~hiphiphip@unaffiliated/chibapet) has left #linuxvoice
2016-04-11 15:33:47 [15:33]
2016-04-11 15:47:49 bdmc (bdmc@cl-745.bos-01.us.sixxs.net) has quit (Ping timeout: 268 seconds)
2016-04-11 15:53:00 [15:47]
2016-04-11 16:09:42 - bdmc (bdmc@cl-745.bos-01.us.sixxs.net) has joined #linuxvoice
2016-04-11 16:09:42 [16:09]
2016-04-11 16:18:59 - Korruptor (~kor@dsl-espbrasgw1-50dfb8-221.dhcp.inet.fi) has joined #linuxvoice
2016-04-11 16:24:00 [16:18]
2016-04-11 16:32:05 Blackisle (~Blackisle@kilchoman.blackisle.org.uk) has quit (Quit: ZNC - http://znc.in)
2016-04-11 16:33:20 - Blackisle (~Blackisle@37.247.49.120) has joined #linuxvoice
2016-04-11 16:34:21 Korruptor (~kor@dsl-espbrasgw1-50dfb8-221.dhcp.inet.fi) has quit (Quit: Leaving)
2016-04-11 16:40:00 [16:34]
2016-04-11 17:21:13 foxhunt_away is now known as foxhunt72
2016-04-11 17:21:13 [17:21]
2016-04-11 17:35:15 - arubislander (~ArubIslan@86.93.93.218) has joined #linuxvoice
2016-04-11 17:41:00 [17:35]
2016-04-11 17:41:52 - ideasman42 (~cambo@220-253-82-5.dyn.iinet.net.au) has joined #linuxvoice
2016-04-11 17:47:00 [17:41]
2016-04-11 17:47:53 mcphail popey: degville: good interview in current issue. Enjoyed reading it
2016-04-11 17:53:00 [17:47]
2016-04-11 17:57:15 ideasman42 (~cambo@220-253-82-5.dyn.iinet.net.au) has quit (Remote host closed the connection)
2016-04-11 17:58:10 - michaelis (~chatzilla@62.182.218.71) has joined #linuxvoice
2016-04-11 17:59:38 - thepoodlesprivat (~thepoodle@89.101.144.126) has joined #linuxvoice
2016-04-11 18:01:12 - ryuslash (~slash@2a02:1812:2518:ce00:f24d:a2ff:fede:451c) has joined #linuxvoice
2016-04-11 18:01:58 - ideasman42 (~cambo@220-253-82-5.dyn.iinet.net.au) has joined #linuxvoice
2016-04-11 18:03:48 draake (~h4ckm3@c-68-52-45-79.hsd1.tn.comcast.net) has quit (Ping timeout: 276 seconds)
2016-04-11 18:05:37 - andybalaam (andybalaam@nat/ibm/x-bpsxoprmbtjprqja) has joined #linuxvoice
2016-04-11 18:09:31 - Ian1 (~Thunderbi@te6compton.te.rl.ac.uk) has joined #linuxvoice
2016-04-11 18:09:31 [18:09]
2016-04-11 18:14:04 - xplora1a (~stuart@81.144.225.214) has joined #linuxvoice
2016-04-11 18:16:16 - draake (~h4ckm3@c-68-52-45-79.hsd1.tn.comcast.net) has joined #linuxvoice
2016-04-11 18:19:05 popey thanks mcphail
2016-04-11 18:19:56 popey i rambled a bit :)
2016-04-11 18:20:45 bdmc (bdmc@cl-745.bos-01.us.sixxs.net) has quit (Ping timeout: 268 seconds)
2016-04-11 18:26:00 [18:20]
2016-04-11 18:29:24 - bdmc (bdmc@cl-745.bos-01.us.sixxs.net) has joined #linuxvoice
2016-04-11 18:29:29 mcphail popey: not at all. I appreciated the insight
2016-04-11 18:30:13 - johnlane (~john@212.159.104.145) has joined #linuxvoice
2016-04-11 18:36:00 [18:30]
2016-04-11 18:37:37 - Korruptor (~Korruptor@dsl-espbrasgw1-50dfb8-221.dhcp.inet.fi) has joined #linuxvoice
2016-04-11 18:37:48 Korruptor mornin'!
2016-04-11 18:43:00 [18:37]
2016-04-11 18:58:38 Ian1 (~Thunderbi@te6compton.te.rl.ac.uk) has quit (Quit: Ian1)
2016-04-11 18:58:38 [18:58]
2016-04-11 19:02:58 draake (~h4ckm3@c-68-52-45-79.hsd1.tn.comcast.net) has quit (Ping timeout: 276 seconds)
2016-04-11 19:04:23 @degville Morning. Thanks mcphail. I don't think you rambled popey.
2016-04-11 19:06:40 ideasman42 degville, \o, not sure if it was you who mentioned - but theres a WIP linux port of opentoonz
2016-04-11 19:07:11 ideasman42 https://github.com/opentoonz/opentoonz/pull/51
2016-04-11 19:07:36 @degville Excellent!! Thanks! I've not been able to check recently, but I'll give it a go now. Have you tried it?
2016-04-11 19:07:41 jimbotux (~jimbotux@wrightchris46.plus.com) has quit (Ping timeout: 252 seconds)
2016-04-11 19:07:51 ideasman42 I've been working on the port
2016-04-11 19:07:57 ideasman42 (thats my pr :) )
2016-04-11 19:08:00 @degville aha!!
2016-04-11 19:08:05 @degville awesome! Thanks!
2016-04-11 19:08:10 ideasman42 I've also been in contact with the original developers
2016-04-11 19:08:27 ideasman42 and they're going to be basing their commercial version on the open one
2016-04-11 19:08:43 ideasman42 Which was something not entirely clear from the press release
2016-04-11 19:09:22 ideasman42 So, its not totally clear what happens... But it seems like opentoonz will be working on Linux eventually
2016-04-11 19:09:34 ideasman42 (by next release at a guess)
2016-04-11 19:12:31 @degville That's really good news. We'll definitely cover this, especially for this next issue.
2016-04-11 19:13:21 ideasman42 degville, ok. ping me if you have any Q's - however current version - while it loads and you can draw... I dont think is really usable
2016-04-11 19:13:33 ideasman42 its more `alpha` level
2016-04-11 19:13:56 ideasman42 and I dont have time for really supporting it, was only weekend challange
2016-04-11 19:13:56 [19:13]
2016-04-11 19:14:20 @degville yep, that's ok. I understood the amount of work that needed to be done. I'll make sure we're clear.
2016-04-11 19:14:33 ideasman42 so hopefully community of more focused devs becomes active
2016-04-11 19:20:00 [19:14]
2016-04-11 19:21:36 - jimbotux (~jimbotux@fpc3-sgyl30-2-0-cust5.18-2.static.cable.virginm.net) has joined #linuxvoice
2016-04-11 19:27:00 [19:21]
2016-04-11 19:29:13 mcphail (~mcphail@unaffiliated/mcphail) has quit (Ping timeout: 248 seconds)
2016-04-11 19:30:49 - mcphail (~mcphail@host86-175-175-198.range86-175.btcentralplus.com) has joined #linuxvoice
2016-04-11 19:30:49 mcphail (~mcphail@host86-175-175-198.range86-175.btcentralplus.com) has quit (Changing host)
2016-04-11 19:30:49 - mcphail (~mcphail@unaffiliated/mcphail) has joined #linuxvoice
2016-04-11 19:32:21 foxhunt72 is now known as foxhunt_away
2016-04-11 19:38:00 [19:32]
2016-04-11 19:39:05 foxhunt_away is now known as foxhunt72
2016-04-11 19:39:41 bdmc (bdmc@cl-745.bos-01.us.sixxs.net) has quit (Ping timeout: 250 seconds)
2016-04-11 19:44:01 - bdmc (bdmc@cl-745.bos-01.us.sixxs.net) has joined #linuxvoice
2016-04-11 19:46:29 mcphail (~mcphail@unaffiliated/mcphail) has quit (Ping timeout: 268 seconds)
2016-04-11 19:47:42 - mcphail (~mcphail@host86-185-209-129.range86-185.btcentralplus.com) has joined #linuxvoice
2016-04-11 19:47:45 mcphail (~mcphail@host86-185-209-129.range86-185.btcentralplus.com) has quit (Changing host)
2016-04-11 19:47:45 - mcphail (~mcphail@unaffiliated/mcphail) has joined #linuxvoice
2016-04-11 19:53:00 [19:47]
2016-04-11 19:53:37 - Ian1 (~Thunderbi@te6compton.te.rl.ac.uk) has joined #linuxvoice
2016-04-11 19:59:00 [19:53]
2016-04-11 20:01:07 - draake (~h4ckm3@c-68-52-45-79.hsd1.tn.comcast.net) has joined #linuxvoice
2016-04-11 20:07:00 [20:01]
2016-04-11 20:14:38 mcphail (~mcphail@unaffiliated/mcphail) has quit (Ping timeout: 248 seconds)
2016-04-11 20:16:45 - mcphail (~mcphail@host86-175-175-198.range86-175.btcentralplus.com) has joined #linuxvoice
2016-04-11 20:16:46 mcphail (~mcphail@host86-175-175-198.range86-175.btcentralplus.com) has quit (Changing host)
2016-04-11 20:16:46 - mcphail (~mcphail@unaffiliated/mcphail) has joined #linuxvoice
2016-04-11 20:22:00 [20:16]
2016-04-11 20:31:26 Devilment Well, that was fun
2016-04-11 20:31:42 Devilment Strange noise from kitchen
2016-04-11 20:32:01 Devilment Opened the fridge to find an exploded can of Coke
2016-04-11 20:32:49 Devilment It had been pressed against the cold plate in the back of the fridge and we all know what water does when it starts to freeze
2016-04-11 20:34:30 - mnavrati (milan@nat/redhat/x-hudiccjcwmazkxov) has joined #linuxvoice
2016-04-11 20:34:42 Devilment Of course, not all the liquid had frozen before the can gave out
2016-04-11 20:35:00 Devilment Coke flavoured butter anyone?
2016-04-11 20:35:08 zmoylan-pi you only learn when you have to clean up afterwards
2016-04-11 20:41:00 [20:35]
2016-04-11 20:41:44 einonm_ Food always tastes better with a smatterign of coke - just ask George Osbourne
2016-04-11 20:47:00 [20:41]
2016-04-11 20:55:11 irc: disconnected from server
2016-04-11 21:51:21 - fs0ciety (~whoami@c27-253-43-52.thoms4.vic.optusnet.com.au) has joined #linuxvoice
2016-04-11 21:51:21 [21:51]
2016-04-11 21:51:21 Topic for #linuxvoice is "An exciting new IRC channel for an exciting new dawn of exciting Linux MAGAZINES. It's very exciting. In accordance with #linuxformat tradition, the topic title will never, ever be changed."
2016-04-11 21:51:21 Topic set by degville (~Graham@2001:41c8:51:1ac:feff:ff:fe00:3258) on Fri, 13 Mar 2015 09:17:53
2016-04-11 21:51:21 Channel #linuxvoice: 77 nicks (1 op, 0 voices, 76 normals)
2016-04-11 21:51:31 Channel created on Tue, 12 Nov 2013 01:19:50
2016-04-11 21:53:18 - TraceyC (~TraceyC@2620:0:28a2:4020:f953:27a9:11de:2c5) has joined #linuxvoice
2016-04-11 21:58:21 - slashd (~slashd@modemcable057.191-130-66.mc.videotron.ca) has joined #linuxvoice
2016-04-11 21:58:44 slashd (~slashd@modemcable057.191-130-66.mc.videotron.ca) has quit (Changing host)
2016-04-11 21:58:44 - slashd (~slashd@ubuntu/member/slashd) has joined #linuxvoice
2016-04-11 22:03:05 foxhunt72 is now known as foxhunt_away
2016-04-11 22:09:00 [22:03]
2016-04-11 22:28:54 - gareppa (~gareppa@151.31.42.3) has joined #linuxvoice
2016-04-11 22:28:54 [22:28]
2016-04-11 22:39:17 gareppa (~gareppa@151.31.42.3) has quit (Quit: Leaving)
2016-04-11 22:45:00 [22:39]
2016-04-11 22:46:26 towy71 degville: just listened to the podcast, have you tried talky.io for your meetups?
2016-04-11 22:48:19 @degville hello towy71 - no, I don't think so, although we tried something similar over a year ago. Is it WebRTC? We had found that it worked well for 2-3 but started to fall over at 4+ people.
2016-04-11 22:48:30 @degville We should give it a go though.
2016-04-11 22:54:00 [22:48]
2016-04-11 23:08:29 Devilment (~david@cpc1-jarr13-2-0-cust241.16-2.cable.virginm.net) has quit (Ping timeout: 260 seconds)
2016-04-11 23:13:09 towy71 degville: we tried it at a lug when six of us used our various devices, seemed to work quite well
2016-04-11 23:13:09 [23:13]
2016-04-11 23:16:52 foxhunt_away is now known as foxhunt72
2016-04-11 23:17:27 jaake (~h4ckm3@129.59.122.24) has quit (Ping timeout: 244 seconds)
2016-04-11 23:18:54 mcphail I found talky.io almost unacceptably poor with a 2 person conversation (firefox on Ubuntu to iphone). I think these things sometimes work and sometimes don't, for no discernable reason
2016-04-11 23:20:30 - Devilment (~david@cpc1-jarr13-2-0-cust241.16-2.cable.virginm.net) has joined #linuxvoice
2016-04-11 23:24:30 - jaake (~h4ckm3@129.59.122.24) has joined #linuxvoice
2016-04-11 23:30:00 [23:24]
2016-04-11 23:30:01 TraceyC Network latency would be my guess
2016-04-11 23:30:21 TraceyC the kind that doesn't make youtube skip (because buffering) but time sensitive audio makes clear
2016-04-11 23:36:00 [23:30]
2016-04-12 00:06:05 - swift110-phone (~swift110-@unaffiliated/swift110) has joined #linuxvoice
2016-04-12 00:06:05 [00:06]
2016-04-12 00:06:07 swift110-phone (~swift110-@unaffiliated/swift110) has quit (Max SendQ exceeded)
2016-04-12 00:09:45 Extremulus (~Extremulu@2001:470:b:1fb:deaf::d259) has quit (Ping timeout: 248 seconds)
2016-04-12 00:13:05 - swift110-phone (~swift110-@unaffiliated/swift110) has joined #linuxvoice
2016-04-12 00:13:07 swift110-phone (~swift110-@unaffiliated/swift110) has quit (Max SendQ exceeded)
2016-04-12 00:19:00 [00:13]
2016-04-12 00:23:21 - Extremulus (~Extremulu@2001:470:b:1fb:a62:66ff:fec8:c5ca) has joined #linuxvoice
2016-04-12 00:26:51 ideasman42 (~cambo@220-253-82-5.dyn.iinet.net.au) has quit (Remote host closed the connection)
2016-04-12 00:32:00 [00:26]
2016-04-12 00:59:49 writtenoff (~writtenof@d172-218-204-26.bchsia.telus.net) has quit (Quit: WeeChat 1.3)
2016-04-12 00:59:49 [00:59]
2016-04-12 01:20:05 - zmoylan-1i (~pi@109.76.180.211) has joined #linuxvoice
2016-04-12 01:20:05 [01:20]
2016-04-12 01:23:01 zmoylan-pi (~pi@109.76.211.47) has quit (Ping timeout: 244 seconds)
2016-04-12 01:24:13 zmoylan-1i is now known as zmoylan-pi
2016-04-12 01:30:00 [01:24]
2016-04-12 01:37:25 foxhunt72 is now known as foxhunt_away
2016-04-12 01:43:00 [01:37]
2016-04-12 01:45:03 mnavrati is now known as mnavrati_afk
2016-04-12 01:51:00 [01:45]
2016-04-12 02:14:03 mnavrati_afk is now known as mnavrati
2016-04-12 02:14:03 [02:14]
2016-04-12 02:19:22 thepoodlesprivat (~thepoodle@89.101.144.126) has quit (Ping timeout: 246 seconds)
2016-04-12 02:22:50 andybalaam (andybalaam@nat/ibm/x-bpsxoprmbtjprqja) has quit (Remote host closed the connection)
2016-04-12 02:25:29 Ian1 (~Thunderbi@te6compton.te.rl.ac.uk) has quit (Ping timeout: 244 seconds)
2016-04-12 02:26:11 - writtenoff (~writtenof@of1.psych.ubc.ca) has joined #linuxvoice
2016-04-12 02:29:13 - ideasman42 (~cambo@220-253-82-5.dyn.iinet.net.au) has joined #linuxvoice
2016-04-12 02:29:13 [02:29]
2016-04-12 02:44:32 michaelis (~chatzilla@62.182.218.71) has quit (Quit: ChatZilla 0.9.92 [Firefox 45.0.1/20160315153207])
2016-04-12 02:44:32 [02:44]
2016-04-12 03:23:33 - m95lag (~m95lag@82-181-169-179.bb.dnainternet.fi) has joined #linuxvoice
2016-04-12 03:23:33 [03:23]
2016-04-12 03:54:49 - charlesay (~daro3@ip5f5af792.dynamic.kabel-deutschland.de) has joined #linuxvoice
2016-04-12 03:54:49 [03:54]
2016-04-12 03:57:36 - x4j5 (~x4j5@cpc1-nrwh11-2-0-cust227.4-4.cable.virginm.net) has joined #linuxvoice
2016-04-12 04:02:15 aSheepie (~phil@i-83-67-88-165.freedom2surf.net) has quit (Quit: WeeChat 0.3.7)
2016-04-12 04:08:00 [04:02]
2016-04-12 04:10:40 xplora1a (~stuart@81.144.225.214) has quit (Ping timeout: 260 seconds)
2016-04-12 04:16:00 [04:10]
2016-04-12 04:29:53 - swift110-phone (~swift110-@unaffiliated/swift110) has joined #linuxvoice
2016-04-12 04:35:00 [04:29]
2016-04-12 04:39:31 x4j5 (~x4j5@cpc1-nrwh11-2-0-cust227.4-4.cable.virginm.net) has quit (Ping timeout: 276 seconds)
2016-04-12 04:45:00 [04:39]
2016-04-12 04:51:41 einonm_ Not sure if this is a findovery that is family podcastable, but there's a scientific journal dedicated to porn. http://www.tandfonline.com/action/journalInformation?show=aimsScope&journalCode=rprn20#.VwvxzXUrJE4
2016-04-12 04:54:00 m95lag (~m95lag@82-181-169-179.bb.dnainternet.fi) has quit (Read error: Connection reset by peer)
2016-04-12 04:54:48 foxhunt_away is now known as foxhunt72
2016-04-12 04:54:53 einonm_ and there's more than one scientific paper published on zombies, http://www.bmj.com/content/351/bmj.h6423
2016-04-12 04:55:51 einonm_ it's only a matter of time before there's some interdisciplinary work going on between those two fields, I'm sure.
2016-04-12 04:57:22 zmoylan-pi sexy zombie pinups?
2016-04-12 04:57:42 zmoylan-pi sure as buggery not searching for that...
2016-04-12 05:01:26 - x4j5 (~x4j5@cpc1-nrwh11-2-0-cust227.4-4.cable.virginm.net) has joined #linuxvoice
2016-04-12 05:01:26 [05:01]
2016-04-12 05:17:38 Korruptor (~Korruptor@dsl-espbrasgw1-50dfb8-221.dhcp.inet.fi) has quit (Read error: Connection reset by peer)
2016-04-12 05:17:38 [05:17]
2016-04-12 05:44:40 x4j5 (~x4j5@cpc1-nrwh11-2-0-cust227.4-4.cable.virginm.net) has quit (Ping timeout: 268 seconds)
2016-04-12 05:44:40 [05:44]
2016-04-12 05:53:23 foxhunt72 is now known as foxhunt_away
2016-04-12 05:55:08 foxhunt_away is now known as foxhunt72
2016-04-12 06:00:07 jaake (~h4ckm3@129.59.122.24) has quit (Ping timeout: 260 seconds)
2016-04-12 06:00:07 [06:00]
2016-04-12 06:06:58 foxhunt72 is now known as foxhunt_away
2016-04-12 06:12:00 [06:06]
2016-04-12 06:13:40 TraceyC (~TraceyC@2620:0:28a2:4020:f953:27a9:11de:2c5) has quit (Ping timeout: 250 seconds)
2016-04-12 06:18:14 johnlane (~john@212.159.104.145) has quit (Remote host closed the connection)
2016-04-12 06:24:00 [06:18]
2016-04-12 06:28:36 swift110-phone (~swift110-@unaffiliated/swift110) has quit (Ping timeout: 252 seconds)
2016-04-12 06:32:29 mnavrati (milan@nat/redhat/x-hudiccjcwmazkxov) has quit (Quit: Leaving)
2016-04-12 06:34:22 foxhunt_away is now known as foxhunt72
2016-04-12 06:40:00 [06:34]
2016-04-12 06:50:28 charlesay (~daro3@ip5f5af792.dynamic.kabel-deutschland.de) has quit (Quit: leaving)
2016-04-12 06:53:03 foxhunt72 is now known as foxhunt_away
2016-04-12 06:56:07 slashd (~slashd@ubuntu/member/slashd) has quit (Read error: Connection reset by peer)
2016-04-12 06:56:07 [06:56]
2016-04-12 07:05:33 M1C4HTRON13 (~micah@bodhilinux/team/M1C4HTRON13) has quit (Remote host closed the connection)
2016-04-12 07:11:00 [07:05]
2016-04-12 07:50:07 - asusk7m550 (~Thunderbi@2001:981:97b3:1:eda1:e0cd:a8f8:bff3) has joined #linuxvoice
2016-04-12 07:50:07 [07:50]
2016-04-12 07:50:30 asusk7m550 (~Thunderbi@2001:981:97b3:1:eda1:e0cd:a8f8:bff3) has quit (Client Quit)
2016-04-12 07:56:00 [07:50]
2016-04-12 08:18:09 - swift110 (~swift110@64.26.99.248) has joined #linuxvoice
2016-04-12 08:18:09 [08:18]
2016-04-12 08:19:11 swift110 (~swift110@64.26.99.248) has quit (Changing host)
2016-04-12 08:19:12 - swift110 (~swift110@unaffiliated/swift110) has joined #linuxvoice
2016-04-12 08:25:00 [08:19]
2016-04-12 08:27:40 swift110 (~swift110@unaffiliated/swift110) has quit (Excess Flood)
2016-04-12 08:28:03 - swift110 (~swift110@64.26.99.248) has joined #linuxvoice
2016-04-12 08:34:00 [08:28]
2016-04-12 08:36:10 Ioangogo http://www.commitstrip.com/en/2012/03/26/coders-day-out/
2016-04-12 08:41:46 swift110 hey all
2016-04-12 08:41:58 Ioangogo HIIII
2016-04-12 08:47:00 [08:41]
2016-04-12 08:48:22 swift110 hey Ioangogo
2016-04-12 08:53:20 - Jaczel (~Jaczel@78.121.233.220.static.exetel.com.au) has joined #linuxvoice
2016-04-12 08:59:00 [08:53]
2016-04-12 09:27:12 ryuslash (~slash@2a02:1812:2518:ce00:f24d:a2ff:fede:451c) has quit (Remote host closed the connection)
2016-04-12 09:27:12 [09:27]
2016-04-12 09:54:49 bdmc (bdmc@cl-745.bos-01.us.sixxs.net) has quit (Ping timeout: 248 seconds)
2016-04-12 09:54:49 [09:54]
2016-04-12 09:57:50 - bdmc (bdmc@cl-745.bos-01.us.sixxs.net) has joined #linuxvoice
2016-04-12 10:01:02 mavrix (~mavrix@unaffiliated/mavrix) has quit (Ping timeout: 260 seconds)
2016-04-12 10:01:54 - mavrix (~mavrix@unaffiliated/mavrix) has joined #linuxvoice
2016-04-12 10:07:00 [10:01]
2016-04-12 10:26:23 writtenoff (~writtenof@of1.psych.ubc.ca) has quit (Quit: WeeChat 1.3)
2016-04-12 10:26:23 [10:26]
2016-04-12 11:00:41 swift110 (~swift110@64.26.99.248) has quit (Ping timeout: 240 seconds)
2016-04-12 11:00:41 [11:00]
2016-04-12 11:06:00 cromulon (~cromulon@45.62.227.43) has quit (Ping timeout: 260 seconds)
2016-04-12 11:11:00 [11:06]
2016-04-12 11:30:03 - swift110-phone (~swift110-@unaffiliated/swift110) has joined #linuxvoice
2016-04-12 11:30:03 [11:30]
2016-04-12 11:30:09 swift110-phone (~swift110-@unaffiliated/swift110) has quit (Max SendQ exceeded)
2016-04-12 11:36:00 [11:30]
2016-04-12 11:41:35 - ]pm[ (~pm@2.71.98.193.mobile.tre.se) has joined #linuxvoice
2016-04-12 11:44:52 [pm] (~pm@2.69.134.93.mobile.tre.se) has quit (Ping timeout: 260 seconds)
2016-04-12 11:50:00 [11:44]
2016-04-12 12:11:40 ideasman42 (~cambo@220-253-82-5.dyn.iinet.net.au) has quit (Remote host closed the connection)
2016-04-12 12:11:40 [12:11]
2016-04-12 12:12:33 mcphail (~mcphail@unaffiliated/mcphail) has quit (Remote host closed the connection)
2016-04-12 12:12:51 - mcphail (~mcphail@host86-175-175-198.range86-175.btcentralplus.com) has joined #linuxvoice
2016-04-12 12:12:51 mcphail (~mcphail@host86-175-175-198.range86-175.btcentralplus.com) has quit (Changing host)
2016-04-12 12:12:51 - mcphail (~mcphail@unaffiliated/mcphail) has joined #linuxvoice
2016-04-12 12:14:50 mavrix (~mavrix@unaffiliated/mavrix) has quit (Ping timeout: 260 seconds)
2016-04-12 12:17:36 - mavrix (~mavrix@unaffiliated/mavrix) has joined #linuxvoice
2016-04-12 12:23:00 [12:17]
2016-04-12 12:30:16 - swift110-phone (~swift110-@unaffiliated/swift110) has joined #linuxvoice
2016-04-12 12:30:19 swift110-phone (~swift110-@unaffiliated/swift110) has quit (Max SendQ exceeded)
2016-04-12 12:35:20 mavrix (~mavrix@unaffiliated/mavrix) has quit (Ping timeout: 276 seconds)
2016-04-12 12:37:38 - mavrix (~mavrix@unaffiliated/mavrix) has joined #linuxvoice
2016-04-12 12:43:00 [12:37]
2016-04-12 14:02:54 zmoylan-pi (~pi@109.76.180.211) has quit (Ping timeout: 252 seconds)
2016-04-12 14:02:54 [14:02]
2016-04-12 14:07:09 - zmoylan-pi (~pi@109.77.227.39) has joined #linuxvoice
2016-04-12 14:13:00 [14:07]
2016-04-12 14:58:50 Extremulus (~Extremulu@2001:470:b:1fb:a62:66ff:fec8:c5ca) has quit (Ping timeout: 248 seconds)
2016-04-12 14:58:50 [14:58]
2016-04-12 16:37:54 Stilvoid Find of the day: mosh!
2016-04-12 16:37:54 [16:37]
2016-04-12 16:37:59 Stilvoid Thanks Linux Luddites for that one :)
2016-04-12 16:38:11 Stilvoid very useful on the train
2016-04-12 16:44:00 [16:38]
2016-04-12 16:48:42 - Korruptor (~Korruptor@dsl-espbrasgw1-50dfb8-221.dhcp.inet.fi) has joined #linuxvoice
2016-04-12 16:54:00 [16:48]
2016-04-12 17:01:30 - chemist69 (~apl@2a02:560:4143:5f00:f712:acd3:ce35:b9f1) has joined #linuxvoice
2016-04-12 17:04:05 Arthur_D I found hping, a tool where you can ping a specific port on a server rather than just the address
2016-04-12 17:06:01 Arthur_D actually its man page has this at the top:
2016-04-12 17:06:04 Arthur_D hping3 - send (almost) arbitrary TCP/IP packets to network hosts
2016-04-12 17:08:16 - asusk7m550 (~Thunderbi@2001:981:97b3:1:8d8:c02a:cac8:1a52) has joined #linuxvoice
2016-04-12 17:11:02 Arthur_D also I found that trying to configure a firewall to explicitly let network traffic through for some game testing did something so ENet is not able to do its thing, yay
2016-04-12 17:11:02 [17:11]
2016-04-12 17:11:33 Arthur_D not a proper find, just ranting
2016-04-12 17:12:16 - michaelis (~chatzilla@62.182.218.71) has joined #linuxvoice
2016-04-12 17:12:32 Arthur_D firewall is ufw configured through gufw, in case anyone has any idea
2016-04-12 17:12:33 - thepoodlesprivat (~thepoodle@89.101.144.126) has joined #linuxvoice
2016-04-12 17:17:15 mcphail I see RMS has pitched in with an opinion on the Ubuntu/ZFS licence controversy. I just can't see this ending well
2016-04-12 17:20:17 mcphail Stilvoid: mosh does look interesting. No use to me if it doesn't support screen, though. Hope that gets added
2016-04-12 17:24:51 james_olympus It doesn't support screen? It 'supports' tmux in that you just run tmux inside it
2016-04-12 17:25:02 - xplora1a (~stuart@81.144.225.214) has joined #linuxvoice
2016-04-12 17:31:00 [17:25]
2016-04-12 17:49:58 arubislander (~ArubIslan@86.93.93.218) has quit (Remote host closed the connection)
2016-04-12 17:49:58 [17:49]
2016-04-12 17:55:14 foxhunt_away is now known as foxhunt72
2016-04-12 18:01:00 [17:55]
2016-04-12 18:10:15 Stilvoid mcphail: well I used it this morning with tmux and that was fine
2016-04-12 18:10:40 Stilvoid tmux running on both ends, in fact
2016-04-12 18:12:40 mcphail Stilvoid: cool. The podcast had suggested screen and tmux didn't work. Good to know
2016-04-12 18:12:54 Stilvoid mcphail: yeah I thought that but decided to try anyway :D
2016-04-12 18:13:09 mcphail :)
2016-04-12 18:13:11 Stilvoid wondered in what way it would break ;)
2016-04-12 18:14:19 - johnlane (~john@212.159.104.145) has joined #linuxvoice
2016-04-12 18:15:56 mavrix (~mavrix@unaffiliated/mavrix) has quit (Ping timeout: 246 seconds)
2016-04-12 18:16:23 - andybalaam (andybalaam@nat/ibm/x-gqvflcedgamccwvu) has joined #linuxvoice
2016-04-12 18:16:23 [18:16]
2016-04-12 18:17:05 - mavrix (~mavrix@unaffiliated/mavrix) has joined #linuxvoice
2016-04-12 18:22:06 LargerMon Arthur_D: you may also like tcptraceroute. Tracing different protocols. Very handy.
2016-04-12 18:22:34 Arthur_D nice, does it work for udp as well?
2016-04-12 18:28:00 [18:22]
2016-04-12 18:36:07 - ideasman42 (~cambo@220-253-82-5.dyn.iinet.net.au) has joined #linuxvoice
2016-04-12 18:42:00 [18:36]
2016-04-12 18:53:42 - mnavrati (milan@nat/redhat/x-dihgvyvobbommsoc) has joined #linuxvoice
2016-04-12 18:59:00 [18:53]
2016-04-12 19:06:17 Arthur_D um, stupid question, but how do I assign the output of a command to a variable?
2016-04-12 19:07:20 Stilvoid in what?
2016-04-12 19:07:22 Stilvoid bash?
2016-04-12 19:07:25 Stilvoid foo=$(ls)
2016-04-12 19:07:53 Arthur_D yep, thanks, will try
2016-04-12 19:08:09 Stilvoid if you're just doing that on a command line, it'll only apply to that line
2016-04-12 19:08:10 pwaring you might also see foo=`` (but $() is better)
2016-04-12 19:08:12 Stilvoid unless you export it
2016-04-12 19:08:18 Stilvoid export foo=$(ls)
2016-04-12 19:08:33 Stilvoid in a script, you won't need to export
2016-04-12 19:08:59 - arubislander (~ArubIslan@86.93.93.218) has joined #linuxvoice
2016-04-12 19:09:22 Arthur_D yep, works, thanks a lot :)
2016-04-12 19:10:43 arubislander Have had an Aquaris 4.5 Ubuntu phone for a while now, but just recently started using it as my daily driver, only keeping my Android phone around to keep in touch with the extended fam via WhatsApp. (It really, really, really would be awesome to have a native WhatsApp client on the Ubuntu phone!)
2016-04-12 19:11:36 arubislander Anyhow... I have just downloaded Beru, the ebook reader app on the Ubuntu store. And I must say, reading the epub version of Linux Voice on it is a very pleasant experience...
2016-04-12 19:11:55 arubislander Even on a 4.5 inch screen...
2016-04-12 19:14:03 - jherrmann (jirkah@nat/redhat/x-vzgritwjdvsmzfni) has joined #linuxvoice
2016-04-12 19:14:03 [19:14]
2016-04-12 19:14:50 zmoylan-pi can ubuntu phone run java apps?
2016-04-12 19:15:21 zmoylan-pi cause there is a java whatsapp client for dumbphones that might work if they do
2016-04-12 19:17:12 arubislander Don't know for sure. Gut feeling says it should be able too, but I haven't heard of anyone who's tried yet. And I haven't. Will try to find the time to look into it.
2016-04-12 19:19:33 Arthur_D oh another stupid question if it's not too annoying: I have some lines that work fine if it's in the main script, but if I move it into its own file and then just reference that script by filename (it's set as executable), it does not appear to work
2016-04-12 19:20:27 - buono (~dave@host-92-8-206-203.as43234.net) has joined #linuxvoice
2016-04-12 19:21:56 mnavrati (milan@nat/redhat/x-dihgvyvobbommsoc) has quit (Quit: Leaving)
2016-04-12 19:22:06 Stilvoid Arthur_D: can you give some examples?
2016-04-12 19:22:14 - mnavrati (milan@nat/redhat/x-uieuddvtdmrtwmpe) has joined #linuxvoice
2016-04-12 19:22:38 mnavrati (milan@nat/redhat/x-uieuddvtdmrtwmpe) has quit (Client Quit)
2016-04-12 19:22:57 - mnavrati (milan@nat/redhat/x-ldbphykmkdigpxme) has joined #linuxvoice
2016-04-12 19:24:37 popey arubislander: yay. i like beru
2016-04-12 19:24:49 popey zmoylan-pi: it is possible to run java apps on ubuntu phone, yes
2016-04-12 19:24:57 popey would need porting though
2016-04-12 19:25:13 zmoylan-pi can't just dropa jar file on then...
2016-04-12 19:25:52 Arthur_D Stilvoid: Imma pastebin it, explaining would maybe be difficult
2016-04-12 19:29:49 arubislander popey: So do I! Can't wait to experience it on a 10 inch screen!
2016-04-12 19:29:49 [19:29]
2016-04-12 19:30:00 Arthur_D Stilvoid: err, false alarm, I forgot a folder
2016-04-12 19:30:06 popey zmoylan-pi: no
2016-04-12 19:30:06 Arthur_D sorry for the noise
2016-04-12 19:30:21 popey there's a bitcoin app in the store which is qml + python + c++ + java
2016-04-12 19:30:31 popey it ships with an entire jre inside the package
2016-04-12 19:30:37 popey because ubuntu phone doesn't ship with a jre :)
2016-04-12 19:31:31 arubislander anyone remember the days of the MIDP profile?
2016-04-12 19:32:11 popey heh
2016-04-12 19:32:18 popey wasn't _that_ long ago old man! :)
2016-04-12 19:32:45 arubislander haha.. I was indeed just thinking that gave away my age... =-O
2016-04-12 19:33:03 * zmoylan-pi still uses java apps on dumbphone...
2016-04-12 19:33:27 arubislander Installed it on my Palm III (something or other). Never really took off on that platform.
2016-04-12 19:33:52 arubislander Even Oracle did offer a database running on in, if I remember correctly.
2016-04-12 19:34:25 zmoylan-pi i miss palmos...
2016-04-12 19:34:38 zmoylan-pi i got a lot done on that platform
2016-04-12 19:35:20 Stilvoid Arthur_D: :D
2016-04-12 19:35:34 popey Yeah, I loved PalmOS
2016-04-12 19:35:43 popey Never seen a decent emulator for it which is surprising
2016-04-12 19:35:49 popey Everything else seems to get emulated, but not that
2016-04-12 19:36:20 Stilvoid sounds like you have a project lined up then ;)
2016-04-12 19:36:25 arubislander My last device was a Tungsten|T. Still have it lying in a drawer... Too bad the digitizer has gone bonkers...
2016-04-12 19:36:36 Stilvoid (wouldn't have a *clue* where to start writing an emulator for something)
2016-04-12 19:36:37 popey I have a Palm Tx
2016-04-12 19:36:41 popey me either
2016-04-12 19:36:50 * Stilvoid hands popey an 'n'
2016-04-12 19:36:51 popey well, I do. "Ask someone else"
2016-04-12 19:36:56 Stilvoid hah yes :)
2016-04-12 19:36:59 zmoylan-pi i have a palm e sitting in a drawer somewhere, battery won't charge...
2016-04-12 19:37:03 * popey hands Stilvoid a pedantry award
2016-04-12 19:37:16 Stilvoid I'll put it on the shelf with the other thousand or so
2016-04-12 19:38:28 popey \o/ Got MAME working on Ubuntu phone
2016-04-12 19:38:31 popey productivity--
2016-04-12 19:38:43 Stilvoid Nice
2016-04-12 19:38:55 Stilvoid Might try it on my N7 again sometime soon
2016-04-12 19:39:14 Stilvoid last time I tried Ubuntu was about 2 and a half years ago
2016-04-12 19:40:22 arubislander Whenever I see N7 I always think Nokia instead of Nexus... Why would that be?
2016-04-12 19:42:15 zmoylan-pi rememberance of a past love...
2016-04-12 19:42:25 popey First love was always the strongest...
2016-04-12 19:42:43 * popey fondly remembers his Nokias
2016-04-12 19:42:46 arubislander Think is I have never had a Nokia...
2016-04-12 19:42:47 zmoylan-pi i miss my psions...
2016-04-12 19:43:00 zmoylan-pi i still have my nokias... :-)
2016-04-12 19:43:59 zmoylan-pi that on the psion 3a i could organise a repeated event last saturday of every second month and no device since can...
2016-04-12 19:45:10 zmoylan-pi and that was in mid flippin 90s...
2016-04-12 19:45:10 [19:45]
2016-04-12 19:47:39 arubislander everything was better in the mid 90's... :-D
2016-04-12 19:48:03 popey except hair styles
2016-04-12 19:48:09 popey and ties
2016-04-12 19:49:33 arubislander O yeah, those were terrible...
2016-04-12 19:50:10 arubislander but then again, there was more hair, and less waistline... lol
2016-04-12 19:50:22 zmoylan-pi every decade has it's oh god what were we thinking
2016-04-12 19:51:02 arubislander I predict this one will be the sun shades...
2016-04-12 19:51:13 zmoylan-pi nah, obsession with iot
2016-04-12 19:52:07 arubislander speaking of which... anyone else not really excited about every appliance in the home potentially having it's own internet facing ipv6 address?
2016-04-12 19:52:07 zmoylan-pi every lightbulb with it's own web server...
2016-04-12 19:53:02 zmoylan-pi the idea of automation is good, people have been doing that since leccy was invented... but it's never worked /right/
2016-04-12 19:53:23 arubislander I was more thinking of the increased attach surface...
2016-04-12 19:54:00 arubislander * attack surface
2016-04-12 19:54:04 zmoylan-pi cause it'll be really funny when some hacker turns off the central heating of an entire countries homes when snow falls :-P
2016-04-12 19:54:53 arubislander well, no... but if everything would be connected to everything, then a vulnerability in one could compromise your whole home network, couldn't it?
2016-04-12 19:56:36 zmoylan-pi 50 million light bulbs all with the credentials admin admin... :-)
2016-04-12 19:58:15 arubislander O man, don't get me started on that!
2016-04-12 19:58:41 arubislander I actually experienced a whole neighborhood where every modem had the same password...
2016-04-12 19:59:48 zmoylan-pi in ireland at least they had some imagination for wifi ap... :-) http://www.bacik.ie/eircomwep/howto.html
2016-04-12 20:01:04 arubislander :)
2016-04-12 20:01:04 [20:01]
2016-04-12 20:13:31 - ryuslash (~slash@2a02:1812:2518:ce00:f24d:a2ff:fede:451c) has joined #linuxvoice
2016-04-12 20:19:00 [20:13]
2016-04-12 20:27:43 * arubislander has gone to lunch
2016-04-12 20:31:30 - brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has joined #linuxvoice
2016-04-12 20:37:00 [20:31]
2016-04-12 20:40:37 * arubislander has come back from lunch
2016-04-12 20:41:28 arubislander popey: is the Mame running on Ubuntu Phone a personal project or do you have something planned for that?
2016-04-12 20:42:09 zmoylan-pi i suspect just aiming to have a mame system that is his alone... :-P
2016-04-12 20:44:34 arubislander hehehe... I was hoping for a new upload to the ubuntu store :D
2016-04-12 20:45:47 brucemuggins (~brucemint@95.41.233.220.static.exetel.com.au) has quit (Quit: Konversation terminated!)
2016-04-12 20:48:51 popey arubislander: I'll put it in the store once I have tidied it up a bit
2016-04-12 20:49:03 popey need to make an ini file that allows user to put roms wherever they have write access
2016-04-12 20:49:10 popey which could be on device or on sd card
2016-04-12 20:49:28 arubislander or external usb drive...
2016-04-12 20:50:00 arubislander in the mean time I will be gathering my roms...
2016-04-12 20:50:16 arubislander This will be bad for the battery life of my phone... :-D
2016-04-12 20:55:00 - Ian1 (~Thunderbi@te6compton.te.rl.ac.uk) has joined #linuxvoice
2016-04-12 20:55:00 [20:55]
2016-04-12 20:55:22 amoe_ (~amoe@visarend.solasistim.net) has quit (Quit: leaving)
2016-04-12 20:55:42 - amoe (~amoe@visarend.solasistim.net) has joined #linuxvoice
2016-04-12 20:58:13 popey haha
2016-04-12 21:00:17 arubislander popey: what do you use to develop on? I am running 15.10 on my laptop, but I have never been able compile even one of the sample apps... :(
2016-04-12 21:01:16 popey I'm on 16.04 right now
2016-04-12 21:01:41 arubislander you'd recommend that for Ubuntu phone development?
2016-04-12 21:01:54 popey yeah
2016-04-12 21:02:05 popey I'd be interested to know what breaks for you, for phone dev
2016-04-12 21:02:08 popey need to fix it :)
2016-04-12 21:02:35 arubislander O, OK... will let you know exactly what I run into.
2016-04-12 21:04:35 popey thank you!
2016-04-12 21:07:46 arubislander I'm on GTM+1(DST) btw. I will upgrade this evening and try compiling one of the core apps (The music app as I want to either write a Subsonic client based on it, or else add the desired functionality to it)
2016-04-12 21:08:06 arubislander I meant UTC+1 (DST)
2016-04-12 21:14:00 [21:08]
2016-04-12 21:58:16 mnavrati (milan@nat/redhat/x-ldbphykmkdigpxme) has quit (Quit: Leaving)
2016-04-12 21:58:16 [21:58]
2016-04-12 21:58:25 Jaczel (~Jaczel@78.121.233.220.static.exetel.com.au) has quit (Quit: Jaczel)
2016-04-12 22:02:31 - mnavrati_mtg (milan@nat/redhat/x-rxujvmhqgchrmlvg) has joined #linuxvoice
2016-04-12 22:08:00 [22:02]
2016-04-12 22:11:18 Ioangogo Hmm, the super key on my keyboard is working but not doing anythign
2016-04-12 22:13:56 - jaake (~h4ckm3@129.59.122.24) has joined #linuxvoice
2016-04-12 22:19:00 [22:13]
2016-04-12 22:21:27 - TraceyC (~TraceyC@2620:0:28a2:4020:9ca6:54f9:81bb:85f3) has joined #linuxvoice
2016-04-12 22:25:46 TraceyC (~TraceyC@2620:0:28a2:4020:9ca6:54f9:81bb:85f3) has quit (Ping timeout: 248 seconds)
2016-04-12 22:26:12 - TraceyC (~TraceyC@2620:0:28a2:4020:9ca6:54f9:81bb:85f3) has joined #linuxvoice
2016-04-12 22:30:15 - slashd (~slashd@modemcable057.191-130-66.mc.videotron.ca) has joined #linuxvoice
2016-04-12 22:30:37 slashd (~slashd@modemcable057.191-130-66.mc.videotron.ca) has quit (Changing host)
2016-04-12 22:30:37 - slashd (~slashd@ubuntu/member/slashd) has joined #linuxvoice
2016-04-12 22:36:00 [22:30]
2016-04-12 22:46:36 mnavrati_mtg (milan@nat/redhat/x-rxujvmhqgchrmlvg) has quit (Ping timeout: 260 seconds)
2016-04-12 22:52:00 [22:46]
2016-04-12 22:58:41 - mnavrati_mtg (milan@nat/redhat/x-clscmezpkkmiqbyg) has joined #linuxvoice
2016-04-12 23:04:00 [22:58]
2016-04-12 23:33:14 - rdrowe (~rdrowe@host86-160-96-80.range86-160.btcentralplus.com) has joined #linuxvoice
2016-04-12 23:33:14 [23:33]
2016-04-12 23:56:21 Ioangogo Thats funny, the smb bug was found by the open source samba people not microsoft
2016-04-12 23:56:21 [23:56]
2016-04-13 00:12:13 jimbotux (~jimbotux@fpc3-sgyl30-2-0-cust5.18-2.static.cable.virginm.net) has quit (Ping timeout: 240 seconds)
2016-04-13 00:12:13 [00:12]
2016-04-13 00:17:43 TraceyC naturally
2016-04-13 00:23:00 [00:17]
2016-04-13 00:25:50 - jimbotux (~jimbotux@fpc3-sgyl30-2-0-cust5.18-2.static.cable.virginm.net) has joined #linuxvoice
2016-04-13 00:31:00 [00:25]
2016-04-13 00:36:38 rdrowe (~rdrowe@host86-160-96-80.range86-160.btcentralplus.com) has quit (Quit: rdrowe)
2016-04-13 00:37:37 * Stilvoid is tmuxxing with mosh
2016-04-13 00:37:40 Stilvoid ;)
2016-04-13 00:37:48 Stilvoid or moshing with tmux?
2016-04-13 00:43:00 [00:37]
2016-04-13 00:47:59 jimbotux (~jimbotux@fpc3-sgyl30-2-0-cust5.18-2.static.cable.virginm.net) has quit (Ping timeout: 268 seconds)
2016-04-13 00:49:51 zmoylan-pi well samba people did write the ms smb standard iirc :-)
2016-04-13 00:55:00 [00:49]
2016-04-13 01:01:04 - jimbotux (~jimbotux@fpc3-sgyl30-2-0-cust5.18-2.static.cable.virginm.net) has joined #linuxvoice
2016-04-13 01:05:58 thepoodlesprivat (~thepoodle@89.101.144.126) has quit (Quit: Nettalk6 - www.ntalk.de)
2016-04-13 01:09:30 - thepoodlesprivat (~thepoodle@89.101.144.41) has joined #linuxvoice
2016-04-13 01:15:00 [01:09]
2016-04-13 01:20:07 mnavrati_mtg (milan@nat/redhat/x-clscmezpkkmiqbyg) has quit (Quit: Leaving)
2016-04-13 01:24:45 TraceyC I tmux with mosh ever day :D
2016-04-13 01:25:22 Stilvoid :)
2016-04-13 01:27:07 * arubislander is surfing the System76 site on his Ubuntu phone.
2016-04-13 01:28:56 foxhunt72 is now known as foxhunt_away
2016-04-13 01:33:52 Ioangogo zmoylan-pi: wat
2016-04-13 01:33:52 [01:33]
2016-04-13 01:36:57 thepoodlesprivat (~thepoodle@89.101.144.41) has quit (Ping timeout: 246 seconds)
2016-04-13 01:42:00 [01:36]
2016-04-13 01:43:36 michaelis (~chatzilla@62.182.218.71) has quit (Quit: ChatZilla 0.9.92 [Firefox 45.0.1/20160315153207])
2016-04-13 01:45:44 jimbotux virgin dropping an outrageous 25% of my packets in mtr
2016-04-13 01:47:59 - mnavrati (~milan@severus.mzk.cz) has joined #linuxvoice
2016-04-13 01:48:00 Stilvoid well tell her to pay more attention
2016-04-13 01:53:00 [01:48]
2016-04-13 02:17:20 - writtenoff (~writtenof@of1.psych.ubc.ca) has joined #linuxvoice
2016-04-13 02:17:20 [02:17]
2016-04-13 02:19:52 Ian1 (~Thunderbi@te6compton.te.rl.ac.uk) has quit (Ping timeout: 268 seconds)
2016-04-13 02:25:00 [02:19]
2016-04-13 02:28:24 ]pm[ (~pm@2.71.98.193.mobile.tre.se) has quit (Ping timeout: 246 seconds)
2016-04-13 02:29:10 andybalaam (andybalaam@nat/ibm/x-gqvflcedgamccwvu) has quit (Remote host closed the connection)
2016-04-13 02:31:26 buono (~dave@host-92-8-206-203.as43234.net) has quit (Quit: Konversation terminated!)
2016-04-13 02:37:00 [02:31]
2016-04-13 02:40:40 - ]pm[ (~pm@173.195.0.39) has joined #linuxvoice
2016-04-13 02:42:31 popey (~alan@ubuntu/member/popey) has quit (Remote host closed the connection)
2016-04-13 02:48:00 [02:42]
2016-04-13 02:49:43 xplora1a (~stuart@81.144.225.214) has quit (Ping timeout: 240 seconds)
2016-04-13 02:54:37 - popey (~alan@ubuntu/member/popey) has joined #linuxvoice
2016-04-13 03:00:00 [02:54]
2016-04-13 03:07:33 Arthur_D (~bouncer@pspodcasting.net) has quit (Remote host closed the connection)
2016-04-13 03:08:41 - Extremulus (~Extremulu@2001:470:b:1fb:deaf::d259) has joined #linuxvoice
2016-04-13 03:08:45 - Arthur_D (~bouncer@pspodcasting.net) has joined #linuxvoice
2016-04-13 03:14:00 [03:08]
2016-04-13 03:20:20 Arthur_D (~bouncer@pspodcasting.net) has quit (Remote host closed the connection)
2016-04-13 03:20:59 - Arthur_D (~bouncer@pspodcasting.net) has joined #linuxvoice
2016-04-13 03:26:00 [03:20]
2016-04-13 03:50:35 ]pm[ (~pm@173.195.0.39) has quit (Ping timeout: 248 seconds)
2016-04-13 03:50:35 [03:50]
2016-04-13 03:59:08 - xplora1a (~stuart@2001:8b0:1679:ea38:5cb9:11ed:ab76:5253) has joined #linuxvoice
2016-04-13 04:05:00 [03:59]
2016-04-13 04:06:57 - ]pm[ (~pm@2.71.98.193.mobile.tre.se) has joined #linuxvoice
2016-04-13 04:12:00 [04:06]
2016-04-13 04:15:57 Ioangogo Badlock is out http://badlock.org/
2016-04-13 04:16:23 mnavrati (~milan@severus.mzk.cz) has quit (Quit: Leaving)
2016-04-13 04:22:00 [04:16]
2016-04-13 04:54:47 Ioangogo http://camera-on-camera-off.wtf/
2016-04-13 04:54:47 [04:54]
2016-04-13 05:23:43 foxhunt_away is now known as foxhunt72
2016-04-13 05:23:43 [05:23]
2016-04-13 05:26:53 Stilvoid Ioangogo: brilliant
2016-04-13 05:32:00 [05:26]
2016-04-13 05:34:39 jherrmann (jirkah@nat/redhat/x-vzgritwjdvsmzfni) has quit (Remote host closed the connection)
2016-04-13 05:40:00 [05:34]
2016-04-13 05:40:07 - mnavrati (~milan@static-84-42-243-100.net.upcbroadband.cz) has joined #linuxvoice
2016-04-13 05:46:00 [05:40]
2016-04-13 05:52:15 johnlane (~john@212.159.104.145) has quit (Remote host closed the connection)
2016-04-13 05:54:26 asusk7m550 (~Thunderbi@2001:981:97b3:1:8d8:c02a:cac8:1a52) has quit (Remote host closed the connection)
2016-04-13 06:00:00 [05:54]
2016-04-13 06:03:16 - Nitronium (~Dave@host213-1-9-245.range213-1.btcentralplus.com) has joined #linuxvoice
2016-04-13 06:03:39 Nitronium (~Dave@host213-1-9-245.range213-1.btcentralplus.com) has quit (Remote host closed the connection)
2016-04-13 06:04:00 jaake (~h4ckm3@129.59.122.24) has quit (Ping timeout: 246 seconds)
2016-04-13 06:04:22 TraceyC (~TraceyC@2620:0:28a2:4020:9ca6:54f9:81bb:85f3) has quit (Quit: Off I go into the wild, blue yonder)
2016-04-13 06:06:41 - Nitronium (~Dave@host213-1-9-245.range213-1.btcentralplus.com) has joined #linuxvoice
2016-04-13 06:12:00 [06:06]
2016-04-13 06:13:33 Ioangogo https://www.topcashback.co.uk/starwars-tm/
2016-04-13 06:17:38 Korruptor (~Korruptor@dsl-espbrasgw1-50dfb8-221.dhcp.inet.fi) has quit (Quit: Leaving)
2016-04-13 06:17:46 ]pm[ (~pm@2.71.98.193.mobile.tre.se) has quit (Remote host closed the connection)
2016-04-13 06:23:00 [06:17]
2016-04-13 06:38:59 mavrix (~mavrix@unaffiliated/mavrix) has quit (Ping timeout: 252 seconds)
2016-04-13 06:38:59 [06:38]
2016-04-13 06:39:36 - mavrix (~mavrix@unaffiliated/mavrix) has joined #linuxvoice
2016-04-13 06:45:00 [06:39]
2016-04-13 06:56:43 Nitronium (~Dave@host213-1-9-245.range213-1.btcentralplus.com) has quit (Ping timeout: 244 seconds)
2016-04-13 07:02:00 [06:56]
2016-04-13 07:26:54 - borg_ (~AelDL3SeX@68-185-132-13.dhcp.jcsn.tn.charter.com) has joined #linuxvoice
2016-04-13 07:26:54 [07:26]
2016-04-13 07:28:00 slashd (~slashd@ubuntu/member/slashd) has quit (Quit: Leaving)
2016-04-13 07:31:52 foxhunt72 is now known as foxhunt_away
2016-04-13 07:37:00 [07:31]
2016-04-13 08:09:13 - LauRoman|Alt (~LauRoman@5-14-92-160.residential.rdsnet.ro) has joined #linuxvoice
2016-04-13 08:09:13 [08:09]
2016-04-13 08:13:10 LauRoman (~LauRoman@5-14-92-160.residential.rdsnet.ro) has quit (Ping timeout: 276 seconds)
2016-04-13 08:19:00 [08:13]
| IRC log | 0 | 0x4b1dN/2016-dots | misc/weechat/logs/irc.freenode.#linuxvoice.weechatlog | [
"MIT"
] |
CLASS zcl_abapgit_data_config DEFINITION
PUBLIC
FINAL
CREATE PUBLIC .
PUBLIC SECTION.
INTERFACES zif_abapgit_data_config .
PROTECTED SECTION.
PRIVATE SECTION.
DATA mt_config TYPE zif_abapgit_data_config=>ty_config_tt .
METHODS dump
IMPORTING
!is_config TYPE zif_abapgit_data_config=>ty_config
RETURNING
VALUE(rv_json) TYPE string
RAISING
zcx_abapgit_exception .
ENDCLASS.
CLASS ZCL_ABAPGIT_DATA_CONFIG IMPLEMENTATION.
METHOD dump.
DATA lo_ajson TYPE REF TO zcl_abapgit_ajson.
DATA lx_ajson TYPE REF TO zcx_abapgit_ajson_error.
TRY.
lo_ajson = zcl_abapgit_ajson=>create_empty( ).
lo_ajson->zif_abapgit_ajson~set(
iv_path = '/'
iv_val = is_config ).
rv_json = zcl_abapgit_convert=>string_to_xstring_utf8( lo_ajson->stringify( 2 ) ).
CATCH zcx_abapgit_ajson_error INTO lx_ajson.
zcx_abapgit_exception=>raise( lx_ajson->get_text( ) ).
ENDTRY.
ENDMETHOD.
METHOD zif_abapgit_data_config~add_config.
ASSERT is_config-type IS NOT INITIAL.
ASSERT is_config-name IS NOT INITIAL.
ASSERT is_config-name = to_upper( is_config-name ).
INSERT is_config INTO TABLE mt_config.
IF sy-subrc <> 0.
zcx_abapgit_exception=>raise( 'Already in table' ).
ENDIF.
ENDMETHOD.
METHOD zif_abapgit_data_config~from_json.
DATA ls_file LIKE LINE OF it_files.
DATA ls_config TYPE zif_abapgit_data_config=>ty_config.
DATA lo_ajson TYPE REF TO zcl_abapgit_ajson.
DATA lx_ajson TYPE REF TO zcx_abapgit_ajson_error.
CLEAR mt_config.
LOOP AT it_files INTO ls_file
USING KEY file_path
WHERE path = zif_abapgit_data_config=>c_default_path
AND filename CP |*.{ zif_abapgit_data_config=>c_config }.{ zif_abapgit_data_config=>c_default_format }|.
TRY.
lo_ajson = zcl_abapgit_ajson=>parse( zcl_abapgit_convert=>xstring_to_string_utf8( ls_file-data ) ).
lo_ajson->zif_abapgit_ajson~to_abap( IMPORTING ev_container = ls_config ).
CATCH zcx_abapgit_ajson_error INTO lx_ajson.
zcx_abapgit_exception=>raise( lx_ajson->get_text( ) ).
ENDTRY.
zif_abapgit_data_config~add_config( ls_config ).
ENDLOOP.
ENDMETHOD.
METHOD zif_abapgit_data_config~get_configs.
rt_configs = mt_config.
ENDMETHOD.
METHOD zif_abapgit_data_config~remove_config.
ASSERT is_config-type IS NOT INITIAL.
ASSERT is_config-name IS NOT INITIAL.
ASSERT is_config-name = to_upper( is_config-name ).
DELETE mt_config WHERE name = is_config-name AND type = is_config-type.
IF sy-subrc <> 0.
zcx_abapgit_exception=>raise( 'Not found' ).
ENDIF.
ENDMETHOD.
METHOD zif_abapgit_data_config~to_json.
DATA ls_config LIKE LINE OF mt_config.
DATA ls_file LIKE LINE OF rt_files.
ls_file-path = zif_abapgit_data_config=>c_default_path.
LOOP AT mt_config INTO ls_config.
ls_file-data = dump( ls_config ).
ls_file-sha1 = zcl_abapgit_hash=>sha1_blob( ls_file-data ).
ls_config-type = zif_abapgit_data_config=>c_config.
ls_file-filename = zcl_abapgit_data_utils=>build_filename( ls_config ).
APPEND ls_file TO rt_files.
ENDLOOP.
ENDMETHOD.
METHOD zif_abapgit_data_config~update_config.
zif_abapgit_data_config~remove_config( is_config ).
zif_abapgit_data_config~add_config( is_config ).
ENDMETHOD.
ENDCLASS.
| ABAP | 4 | Manny27nyc/abapGit | src/data/zcl_abapgit_data_config.clas.abap | [
"MIT"
] |
/* https://jmblog.github.io/color-themes-for-google-code-prettify/themes/tomorrow.css */
pre.prettyprint .str { color: #718c00; } /* string */
pre.prettyprint .kwd { color: #8959a8; } /* keyword */
pre.prettyprint .com { color: #8e908c; } /* comment */
pre.prettyprint .typ { color: #4271ae; } /* type */
pre.prettyprint .lit { color: #f5871f; } /* literal */
pre.prettyprint .pun { color: #4d4d4c; } /* punctuation */
pre.prettyprint .pln { color: #4d4d4c; } /* plaintext */
pre.prettyprint .tag { color: #c82829 } /* html tag */
pre.prettyprint .atn { color: #f5871f } /* attribute name */
pre.prettyprint .atv { color: #3e999f } /* attribute value */
pre.prettyprint .dec { color: #f5871f; } /* decimal */
pre.prettyprint .var { color: #4271ae } /* variable name */
pre.prettyprint .fun { color: #4271ae } /* function name */
pre.prettyprint ul.modifiedlines {
list-style-type: none;
padding-left: 0;
}
pre.prettyprint ul.modifiedlines li.linemodified {
list-style-type: none;
background-color: #ffffff;
}
pre.prettyprint ul.modifiedlines li.linedeleted {
list-style-type: none;
background-color: #ffebe9;
}
pre.prettyprint ul.modifiedlines li.lineadded {
list-style-type: none;
background-color: #e6ffec;
}
pre.prettyprint, code.prettyprint, .dos {
background: #f5f5f5;
font-family: 'Roboto Mono', monospace;
font-size: calc(var(--font-size) - 1px);
line-height: calc(var(--line-height) - 1px);
margin: 16px calc(-1 * var(--page-padding));
padding: calc(var(--page-padding) - 6px) var(--page-padding);
overflow: auto;
white-space: pre-wrap;
box-sizing: border-box;
}
@media (prefers-color-scheme: dark) {
/* https://jmblog.github.io/color-themes-for-google-code-prettify/themes/tomorrow-night.css */
pre.prettyprint .str { color: #b5bd68; } /* string */
pre.prettyprint .kwd { color: #b294bb; } /* keyword */
pre.prettyprint .com { color: #969896; } /* comment */
pre.prettyprint .typ { color: #81a2be; } /* type */
pre.prettyprint .lit { color: #de935f; } /* literal */
pre.prettyprint .pun { color: #c5c8c6; } /* punctuation */
pre.prettyprint .pln { color: #c5c8c6; } /* plaintext */
pre.prettyprint .tag { color: #cc6666 } /* html tag */
pre.prettyprint .atn { color: #de935f } /* attribute name */
pre.prettyprint .atv { color: #8abeb7 } /* attribute value */
pre.prettyprint .dec { color: #de935f; } /* decimal */
pre.prettyprint .var { color: #cc6666 } /* variable name */
pre.prettyprint .fun { color: #81a2be } /* function name */
pre.prettyprint ul.modifiedlines li.linemodified {
background-color: #222222;
}
pre.prettyprint ul.modifiedlines li.linedeleted {
background-color: #412e32;
}
pre.prettyprint ul.modifiedlines li.lineadded {
background-color: #293832;
}
pre.prettyprint, code.prettyprint, .dos {
background: #333333;
}
}
| CSS | 3 | yangmengwei925/3d | manual/resources/lang.css | [
"MIT"
] |
(defproject jepsen.keeper "0.1.0-SNAPSHOT"
:injections [(.. System (setProperty "zookeeper.request.timeout" "10000"))]
:description "A jepsen tests for ClickHouse Keeper"
:url "https://clickhouse.com/"
:license {:name "EPL-2.0"
:url "https://www.eclipse.org/legal/epl-2.0/"}
:main jepsen.clickhouse-keeper.main
:plugins [[lein-cljfmt "0.7.0"]]
:dependencies [[org.clojure/clojure "1.10.1"]
[jepsen "0.2.6"]
[zookeeper-clj "0.9.4"]
[org.apache.zookeeper/zookeeper "3.6.1" :exclusions [org.slf4j/slf4j-log4j12]]]
:repl-options {:init-ns jepsen.clickhouse-keeper.main})
| Clojure | 3 | zzachimed/ClickHouse | tests/jepsen.clickhouse-keeper/project.clj | [
"Apache-2.0"
] |
import 'dart:io';
import 'package:analyzer/dart/ast/token.dart';
main() {
// save keywords to a text file
final txtFile = File(
'../../../modules/openapi-generator/src/main/resources/dart/dart-keywords.txt');
String txtString = '';
for (String keyword in Keyword.keywords.keys.toList()) {
txtString += keyword + '\n';
}
txtString =
txtString.substring(0, txtString.length - 1); // remove last newline
txtFile.writeAsStringSync(txtString);
}
| Dart | 4 | MalcolmScoffable/openapi-generator | bin/utils/dart-keywords/save-dart-keywords.dart | [
"Apache-2.0"
] |
# Copyright (c) Microsoft Corporation.
# Licensed under the MIT License.
Describe 'ProxyCommand Tests' -Tag 'CI' {
BeforeAll {
$testCases = @(
@{ Name = 'ValidateLengthAttribute'; ParamBlock = '[ValidateLength(1, 10)][int]${Parameter}' }
@{ Name = 'ValidateRangeAttribute with Minimum and Maximum'; ParamBlock = '[ValidateRange(1, 10)][int]${Parameter}' }
@{ Name = 'ValidateRangeAttribute with RangeKind'; ParamBlock = '[ValidateRange([System.Management.Automation.ValidateRangeKind]::Positive)][int]${Parameter}' }
@{ Name = 'AllowNullAttribute'; ParamBlock = '[AllowNull()][int]${Parameter}' }
@{ Name = 'AllowEmptyStringAttribute'; ParamBlock = '[AllowEmptyString()][int]${Parameter}' }
@{ Name = 'AllowEmptyCollectionAttribute'; ParamBlock = '[AllowEmptyCollection()][int]${Parameter}' }
@{ Name = 'ValidatePatternAttribute'; ParamBlock = '[ValidatePattern(''.*'')][int]${Parameter}' }
@{ Name = 'ValidateCountAttribute'; ParamBlock = '[ValidateCount(1, 10)][int]${Parameter}' }
@{ Name = 'ValidateNotNullAttribute'; ParamBlock = '[ValidateNotNull()][int]${Parameter}' }
@{ Name = 'ValidateNotNullOrEmptyAttribute'; ParamBlock = '[ValidateNotNullOrEmpty()][int]${Parameter}' }
@{ Name = 'ValidateSetAttribute with explicit set'; ParamBlock = '[ValidateSet(''1'',''10'')][int]${Parameter}' }
@{ Name = 'PSTypeNameAttribute'; ParamBlock = '[PSTypeName(''TypeName'')][int]${Parameter}' }
)
}
Context 'GetParamBlock method' {
AfterAll {
Remove-Item function:testProxyCommandFunction -ErrorAction SilentlyContinue
}
It 'Generates a param block when <Name> is used' -TestCases $testCases {
param (
$Name,
$ParamBlock
)
$functionDefinition = 'param ( {0} )' -f $ParamBlock
Set-Item -Path function:testProxyCommandFunction -Value $functionDefinition
$generatedParamBlock = [System.Management.Automation.ProxyCommand]::GetParamBlock(
(Get-Command testProxyCommandFunction)
)
$generatedParamBlock = $generatedParamBlock -split '\r?\n' -replace '^ *' -join ''
$generatedParamBlock | Should -Be $ParamBlock
}
It 'Generates a param block when ValidateScriptAttribute is used' {
param (
$Name,
$ParamBlock
)
$functionDefinition = 'param ( [ValidateScript({ $true })][int]${Parameter} )'
Set-Item -Path function:testProxyCommandFunction -Value $functionDefinition
$generatedParamBlock = [System.Management.Automation.ProxyCommand]::GetParamBlock(
(Get-Command testProxyCommandFunction)
)
$generatedParamBlock = $generatedParamBlock -split '\r?\n' -replace '^ *' -join ''
$generatedParamBlock | Should -Be '[ValidateScript({ $true })][int]${Parameter}'
}
}
}
| PowerShell | 4 | rdtechie/PowerShell | test/powershell/engine/Basic/ProxyCommand.tests.ps1 | [
"MIT"
] |
lexer grammar CPP14_lexer_common;
/* GJ20: covered by new Directive; see below.
MultiLineMacro:
'#' (~[\n]*? '\\' '\r'? '\n')+ ~ [\n]+ -> channel (HIDDEN);
*/
/* GJ20: covered by new Directive; see below.
Directive: '#' ~ [\n]* -> channel (HIDDEN);
*/
// GJ20: every preprocessor directive is treated a line comment.
Directive:
'#' (~[\\\r\n]* EscapeNewline)* ~[\r\n]* -> channel(HIDDEN);
/*Keywords*/
ALIGNAS: 'alignas';
ALIGNOF: 'alignof';
ASM: 'asm';
ASSERT: 'assert';
AUTO: 'auto';
BOOL: 'bool';
BREAK: 'break';
CASE: 'case';
CATCH: 'catch';
CHAR: 'char';
CHAR16_T: 'char16_t';
CHAR32_T: 'char32_t';
CLASS: 'class';
CONST: 'const';
CONSTEXPR: 'constexpr';
CONST_CAST: 'const_cast';
CONTINUE: 'continue';
DECLTYPE: 'decltype';
DEFAULT: 'default';
DELETE: 'delete';
DO: 'do';
DOUBLE: 'double';
DYNAMIC_CAST: 'dynamic_cast';
ELSE: 'else';
ENUM: 'enum';
EXPLICIT: 'explicit';
EXPORT: 'export';
EXTERN: 'extern';
FALSE: 'false';
FLOAT: 'float';
FOR: 'for';
FRIEND: 'friend';
GOTO: 'goto';
IF: 'if';
INLINE: 'inline';
INT: 'int';
LONG: 'long';
MUTABLE: 'mutable';
NAMESPACE: 'namespace';
NEW: 'new';
NOEXCEPT: 'noexcept';
NULLPTR: 'nullptr';
OPERATOR: 'operator';
PRIVATE: 'private';
PROTECTED: 'protected';
PUBLIC: 'public';
REGISTER: 'register';
REINTERPRET_CAST: 'reinterpret_cast';
RETURN: 'return';
SHORT: 'short';
SIGNED: 'signed';
SIZEOF: 'sizeof';
STATIC: 'static';
STATIC_ASSERT: 'static_assert';
STATIC_CAST: 'static_cast';
STRUCT: 'struct';
SWITCH: 'switch';
TEMPLATE: 'template';
THIS: 'this';
THREAD_LOCAL: 'thread_local';
THROW: 'throw';
TRUE: 'true';
TRY: 'try';
TYPEDEF: 'typedef';
TYPEID: 'typeid';
TYPENAME: 'typename';
UNION: 'union';
UNSIGNED: 'unsigned';
USING: 'using';
VIRTUAL: 'virtual';
VOID: 'void';
VOLATILE: 'volatile';
WCHAR_T: 'wchar_t';
WHILE: 'while';
// GJ20: ?
FINAL: 'final';
OVERRIDE: 'override';
// Operator and punctuation:
// Enclosing brackets:
LeftParen: '(';
RightParen: ')';
LeftBracket: '[' | LessColon { setText("["); };
RightBracket: ']' | ColonGreater { setText("]"); };
LeftBrace: '{' | LessPercent { setText("{"); };
RightBrace: '}' | PercentGreater { setText("}"); };
// Preprocessor-related symbols:
HashMark: '#' | PercentColon { setText("#"); };
DoubleHashMark: '##' | DoublePercentColon { setText("##"); };
// Alternatives:
LessColon: '<:'; // alt [
ColonGreater: ':>'; // alt ]
LessPercent: '<%'; // alt {
PercentGreater: '%>'; // alt }
PercentColon: '%:'; // alt #
DoublePercentColon: '%:%:'; // alt ##
// Punctuators:
Semi: ';';
Colon: ':';
DoubleColon: '::';
Ellipsis: '...';
Comma: ',';
Dot: '.';
// Operators:
// GJ20: alt are mapped to preferred symbol
Question: '?';
Plus: '+';
Minus: '-';
Star: '*';
Div: '/';
Mod: '%';
Caret: '^' | XOR { setText("^"); };
And: '&' | BITAND { setText("&"); };
Or: '|' | BITOR { setText("|"); };
Tilde: '~' | COMPL { setText("~"); };
Not: '!' | NOT { setText("!"); };
Assign: '=';
Less: '<';
Greater: '>';
PlusAssign: '+=';
MinusAssign: '-=';
StarAssign: '*=';
DivAssign: '/=';
ModAssign: '%=';
XorAssign: '^=' | XOR_EQ { setText("^="); };
AndAssign: '&=' | AND_EQ { setText("&="); };
OrAssign: '|=' | OR_EQ { setText("|="); };
//LeftShift: '<<'; // GJ20: problem with template <<
//RightShift: '>>'; // GJ20: problem with template << ... >>
LeftShiftAssign:'<<=';
RightShiftAssign:'>>=';
Equal: '==';
NotEqual: '!=' | NOT_EQ { setText("!="); };
LessEqual: '<=';
GreaterEqual: '>=';
AndAnd: '&&' | AND { setText("&&"); };
OrOr: '||' | OR { setText("||"); };
PlusPlus: '++';
MinusMinus: '--';
Arrow: '->';
ArrowStar: '->*';
DotStar: '.*';
// 2.11 Table 4 Alternative representations (also 2.5 Table 1)
// GJ20: treat as operators; not keywords
AND: 'and'; // alt &&
AND_EQ: 'and_eq'; // alt &=
BITAND: 'bitand'; // alt &
BITOR: 'bitor'; // alt |
COMPL: 'compl'; // alt ~
NOT: 'not'; // alt !
NOT_EQ: 'not_eq'; // alt !=
OR: 'or'; // alt ||
OR_EQ: 'or_eq'; // alt |=
XOR: 'xor'; // alt ^
XOR_EQ: 'xor_eq'; // alt ^=
fragment Hexquad:
HEXADECIMALDIGIT HEXADECIMALDIGIT HEXADECIMALDIGIT HEXADECIMALDIGIT;
fragment Universalcharactername:
'\\u' Hexquad
| '\\U' Hexquad Hexquad;
Identifier:
/*
Identifiernondigit | Identifier Identifiernondigit | Identifier DIGIT
*/
Identifiernondigit (Identifiernondigit | DIGIT)*;
fragment Identifiernondigit: NONDIGIT | Universalcharactername;
fragment NONDIGIT: [a-zA-Z_];
fragment DIGIT: [0-9];
IntegerLiteral:
DecimalLiteral Integersuffix?
| OctalLiteral Integersuffix?
| HexadecimalLiteral Integersuffix?
| BinaryLiteral Integersuffix?;
fragment DecimalLiteral: NONZERODIGIT ('\''? DIGIT)*;
OctalLiteral: '0' ('\''? OCTALDIGIT)*;
fragment HexadecimalLiteral: ('0x' | '0X') HEXADECIMALDIGIT (
'\''? HEXADECIMALDIGIT
)*;
fragment BinaryLiteral: ('0b' | '0B') BINARYDIGIT ('\''? BINARYDIGIT)*;
fragment NONZERODIGIT: [1-9];
fragment OCTALDIGIT: [0-7];
fragment HEXADECIMALDIGIT: [0-9a-fA-F];
fragment BINARYDIGIT: [01];
fragment Integersuffix:
Unsignedsuffix Longsuffix?
| Unsignedsuffix Longlongsuffix?
| Longsuffix Unsignedsuffix?
| Longlongsuffix Unsignedsuffix?;
fragment Unsignedsuffix: [uU];
fragment Longsuffix: [lL];
fragment Longlongsuffix: 'll' | 'LL';
CharacterLiteral:
'\'' Cchar+ '\''
| 'u' '\'' Cchar+ '\''
| 'U' '\'' Cchar+ '\''
| 'L' '\'' Cchar+ '\'';
fragment Cchar:
~ ['\\\r\n]
| Escapesequence
| Universalcharactername;
fragment Escapesequence:
Simpleescapesequence
| Octalescapesequence
| Hexadecimalescapesequence;
fragment Simpleescapesequence:
'\\\''
| '\\"'
| '\\?'
| '\\\\'
| '\\a'
| '\\b'
| '\\f'
| '\\n'
| '\\r'
| '\\t'
| '\\v';
fragment Octalescapesequence:
'\\' OCTALDIGIT
| '\\' OCTALDIGIT OCTALDIGIT
| '\\' OCTALDIGIT OCTALDIGIT OCTALDIGIT;
fragment Hexadecimalescapesequence: '\\x' HEXADECIMALDIGIT+;
FloatingLiteral:
Fractionalconstant Exponentpart? Floatingsuffix?
| Digitsequence Exponentpart Floatingsuffix?;
fragment Fractionalconstant:
Digitsequence? '.' Digitsequence
| Digitsequence '.';
fragment Exponentpart:
'e' SIGN? Digitsequence
| 'E' SIGN? Digitsequence;
fragment SIGN: [+-];
fragment Digitsequence: DIGIT ('\''? DIGIT)*;
fragment Floatingsuffix: [flFL];
StringLiteral:
Encodingprefix? '"' Schar* '"'
| Encodingprefix? 'R' Rawstring;
fragment Encodingprefix: 'u8' | 'u' | 'U' | 'L';
// GJ20: Handling of \ Newline is incorrect, but works somewhat.
fragment Schar:
~ ["\\\r\n]
| Escapesequence
| EscapeNewline
| Universalcharactername;
//fragment Rawstring: '"' .*? '(' .*? ')' .*? '"';
// GJ20:
fragment Rawstring: '"' DChars '(' RChars ')' DChars '"';
// GJ20: Must be max 16 chars and front and back must be the same!
fragment DChars: ~[ ()\\\t\u000B\f\r\n]*;
// GJ20: approximation
fragment RChars: ~[)]*;
BooleanLiteral: FALSE | TRUE;
PointerLiteral: NULLPTR;
UserDefinedLiteral:
UserDefinedIntegerLiteral
| UserDefinedFloatingLiteral
| UserDefinedStringLiteral
| UserDefinedCharacterLiteral;
fragment UserDefinedIntegerLiteral:
DecimalLiteral Udsuffix
| OctalLiteral Udsuffix
| HexadecimalLiteral Udsuffix
| BinaryLiteral Udsuffix;
fragment UserDefinedFloatingLiteral:
Fractionalconstant Exponentpart? Udsuffix
| Digitsequence Exponentpart Udsuffix;
UserDefinedStringLiteral: StringLiteral Udsuffix;
fragment UserDefinedCharacterLiteral: CharacterLiteral Udsuffix;
fragment Udsuffix: Identifier;
// GJ20: added vertical tab \v (^K) and formfeed \f (^L)
Whitespace: [ \t\u000B\f]+ -> skip;
// GJ20: this will create logical lines.
EscapeNewline: '\\' Newline -> skip;
Newline: ('\r' '\n'? | '\n') -> skip;
BlockComment: '/*' .*? '*/' -> skip;
//LineComment: '//' ~ [\r\n]* -> skip;
// GJ20: anticipate \ Newline
LineComment: '//' (~[\\\r\n]* EscapeNewline)* ~[\r\n]* -> skip;
| ANTLR | 5 | yingkitw/Project_CodeNet | tools/spt-generator/src/com/ibm/ai4code/parser/cpp_multi/CPP14_lexer_common.g4 | [
"Apache-2.0"
] |
// scalac: -feature -Xfatal-warnings
object O {
implicit var x: Int = 0
}
| Scala | 1 | jamesanto/scala | test/files/pos/setter-not-implicit.scala | [
"Apache-2.0"
] |
m4_define([m4_list_declare], [m4_do(
[m4_define([$1_GET], [m4_expand([m4_list_nth([$1], $][1)])])],
[m4_define([$1_FOREACH], [m4_foreach([item], [m4_dquote_elt(m4_list_contents([$1]))], m4_quote($][1))])],
)])
m4_define([m4_list_add], [m4_do(
[m4_pushdef([_LIST_NAME], [[_LIST_$1]])],
[m4_ifndef(_LIST_NAME,
[m4_define(_LIST_NAME, m4_dquote(m4_escape([$2])))],
[m4_define(_LIST_NAME, m4_dquote(m4_list_contents([$1]), m4_escape([$2])))],
)],
[m4_popdef([_LIST_NAME])],
)])
m4_define([m4_list_contents], [m4_do(
[m4_pushdef([_LIST_NAME], [[_LIST_$1]])],
[m4_ifndef(_LIST_NAME, [], m4_quote(_LIST_NAME))],
[m4_popdef([_LIST_NAME])],
)])
m4_define([m4_list_nth], [m4_argn([$2], m4_list_contents([$1]))])
m4_define([m4_list_pop_front], [m4_do(
[m4_pushdef([_LIST_NAME], [[_LIST_$1]])],
[m4_car(m4_unquote(_LIST_NAME))],
[m4_define(_LIST_NAME, m4_cdr(m4_unquote(_LIST_NAME)))],
[m4_popdef([_LIST_NAME])],
)])
m4_define([m4_list_pop_back], [m4_do(
[m4_pushdef([_LIST_NAME], [[_LIST_$1]])],
[m4_define(_LIST_NAME, m4_dquote(m4_reverse(m4_unquote(_LIST_NAME))))],
[m4_list_pop_front([$1])],
[m4_define(_LIST_NAME, m4_dquote(m4_reverse(m4_unquote(_LIST_NAME))))],
[m4_popdef([_LIST_NAME])],
)])
dnl
dnl $1: List name
dnl $2: What
dnl $3: If contains
dnl $4: If not
m4_define([m4_list_contains], [m4_do(
[m4_foreach([item], m4_list_contents([$1]), m4_if(item, [$2], [[$3]], [[$4]]))]
)])
| M4 | 3 | JavascriptID/sourcerer-app | src/test/resources/samples/langs/M4Sugar/list.m4 | [
"MIT"
] |
from tools.lib.url_file import URLFile
def FileReader(fn, debug=False):
if fn.startswith("http://") or fn.startswith("https://"):
return URLFile(fn, debug=debug)
return open(fn, "rb")
| Python | 4 | shoes22/openpilot | tools/lib/filereader.py | [
"MIT"
] |
// run-pass
use std::ops::Index;
fn bar() {}
static UNIT: () = ();
struct S;
impl Index<fn()> for S {
type Output = ();
fn index(&self, _: fn()) -> &() { &UNIT }
}
fn main() {
S.index(bar);
S[bar];
}
| Rust | 4 | Eric-Arellano/rust | src/test/ui/issues/issue-40085.rs | [
"ECL-2.0",
"Apache-2.0",
"MIT-0",
"MIT"
] |
"This is a simple top level function that does things."
shared void coin() {
}
"Random function for ducks"
void quack("Some string" String what, "Why not" Integer who, "Aww yeah" Float why) {
} | Ceylon | 0 | Kopilov/ceylon-ide-intellij | testdata/documentation/toplevelFunction.ceylon | [
"Apache-2.0"
] |
serverCode =: 0 : 0
//css_using MicroJ
//css_using System.IO
//css_using System.Collections.Generic
//css_using System.Linq
//css_using System.Text
//css_using System.Threading.Tasks
//css_using System.Net
//css_using System.Threading
//css_using System.Text.RegularExpressions
//css_ref System.Web.Extensions
ThreadStart proc = () => {
HttpListener listener = new HttpListener();
parser.Globals["HttpListener"] = listener;
listener.Prefixes.Add("http://localhost:8080/");
listener.Start();
var ser = new System.Web.Script.Serialization.JavaScriptSerializer();
ser.MaxJsonLength = int.MaxValue;
Console.WriteLine("Webserver running...");
while (listener.IsListening)
{
ThreadPool.QueueUserWorkItem((c) => {
var ctx = c as HttpListenerContext;
try
{
string rstr = "hello world";
var Request = ctx.Request;
var url = Request.RawUrl;
var pathSep = new string(new char[] { Path.DirectorySeparatorChar });
string file = url.Replace("/", pathSep);
rstr = file;
if (file.StartsWith(pathSep)) { file = "." + file; }
if (file.Contains("..")) { file = ""; }
if (System.IO.File.Exists(file)) {
rstr = File.ReadAllText(file);
}
else {
var newParser = new Parser();
//copy names from parent
foreach(var key in parser.Names.Keys) {
newParser.Names[key] = parser.Names[key];
}
newParser.SafeMode = true;
string json="";
using(var sr = new StreamReader(Request.InputStream)) {
json = sr.ReadToEnd();
}
var input = ser.DeserializeObject(json) as object[];
var sb = new System.Text.StringBuilder();
if (input != null) {
var lines = input.Select(x=>x.ToString()).ToArray();
for(var k = 0; k < lines.Length; k++ ) {
var line = lines[k];
newParser.ReadLine = () => {
Console.WriteLine("here");
k++;
return lines[k];
};
var cmd = line.ToString();
if (cmd == "") continue;
sb.AppendLine(" " + cmd);
if (cmd.StartsWith("NB.")) continue;
try {
Console.WriteLine(String.Format("{0}:{1} {2}", DateTime.Now, Request.RemoteEndPoint, cmd));
var ret = newParser.exec(line.ToString());
//sb.AppendLine(a.ToString());
if (ret.GetCount() > 1000) {
var formatter = new Formatter(ret.Shape);
for (var i = 0; i < ret.GetCount() && i < 1000; i++) {
formatter.Add(ret.GetString(i));
}
sb.AppendLine(formatter.ToString() + "...");
}
else {
sb.AppendLine(ret.ToString());
}
}
catch (Exception e)
{
sb.AppendLine(e.ToString());
}
//Console.WriteLine(line.ToString());
}
rstr = sb.ToString();
}
}
byte[] buf = Encoding.UTF8.GetBytes(rstr);
ctx.Response.ContentLength64 = buf.Length;
ctx.Response.OutputStream.Write(buf, 0, buf.Length);
}
catch (Exception e) { Console.WriteLine(e); }
finally
{
// always close the stream
ctx.Response.OutputStream.Close();
}
}, listener.GetContext());
}
listener.Start();
};
if (parser.Globals.ContainsKey("HttpListener")) {
var oldListener = parser.Globals["HttpListener"] as HttpListener;
oldListener.Stop();
}
if (parser.Globals.ContainsKey("HttpListenerThread")) {
var oldThread = parser.Globals["HttpListenerThread"] as Thread;
oldThread.Abort();
}
var thread = new Thread(proc);
thread.Start();
parser.Globals["HttpListenerThread"] = thread;
return new A<long>(0);
)
startServer =: (150!:0) & serverCode
startServer''
| J | 3 | joebo/microj | examples/webrepl/server.ijs | [
"MIT"
] |
<GameFile>
<PropertyGroup Name="billardsMainLayer" Type="Layer" ID="95e8d62c-fcf1-484e-b5e7-82c6bf296eb8" Version="3.10.0.0" />
<Content ctype="GameProjectContent">
<Content>
<Animation Duration="0" Speed="1.0000" />
<ObjectData Name="Layer" Tag="73" ctype="GameLayerObjectData">
<Size X="1136.0000" Y="640.0000" />
<Children>
<AbstractNodeData Name="desk" ActionTag="-423782001" Tag="100" IconVisible="False" LeftMargin="171.5039" RightMargin="169.4961" TopMargin="126.9990" BottomMargin="65.0010" LeftEage="105" RightEage="105" TopEage="105" BottomEage="105" Scale9OriginX="105" Scale9OriginY="105" Scale9Width="358" Scale9Height="110" ctype="ImageViewObjectData">
<Size X="795.0000" Y="448.0000" />
<AnchorPoint ScaleX="0.5000" ScaleY="0.5000" />
<Position X="569.0039" Y="289.0010" />
<Scale ScaleX="1.0000" ScaleY="1.0000" />
<CColor A="255" R="255" G="255" B="255" />
<PrePosition X="0.5009" Y="0.4516" />
<PreSize X="0.6998" Y="0.7000" />
<FileData Type="Normal" Path="gameBilliards/table_mask_169.png" Plist="" />
</AbstractNodeData>
<AbstractNodeData Name="Button_1" ActionTag="-509317167" Tag="101" IconVisible="False" LeftMargin="974.4871" RightMargin="-23.4871" TopMargin="583.5000" BottomMargin="-6.5000" TouchEnable="True" FontSize="30" ButtonText="TestButton" Scale9Enable="True" LeftEage="15" RightEage="15" TopEage="11" BottomEage="11" Scale9OriginX="15" Scale9OriginY="11" Scale9Width="155" Scale9Height="41" ShadowOffsetX="2.0000" ShadowOffsetY="-2.0000" ctype="ButtonObjectData">
<Size X="185.0000" Y="63.0000" />
<AnchorPoint ScaleX="0.5000" ScaleY="0.5000" />
<Position X="1066.9871" Y="25.0000" />
<Scale ScaleX="0.6700" ScaleY="0.7800" />
<CColor A="255" R="255" G="255" B="255" />
<PrePosition X="0.9392" Y="0.0391" />
<PreSize X="0.1629" Y="0.0984" />
<FontResource Type="Normal" Path="fonts/FZY4JW.TTF" Plist="" />
<TextColor A="255" R="255" G="255" B="255" />
<DisabledFileData Type="Default" Path="Default/Button_Disable.png" Plist="" />
<PressedFileData Type="Default" Path="Default/Button_Press.png" Plist="" />
<NormalFileData Type="Default" Path="Default/Button_Normal.png" Plist="" />
<OutlineColor A="255" R="255" G="0" B="0" />
<ShadowColor A="255" R="110" G="110" B="110" />
</AbstractNodeData>
<AbstractNodeData Name="Button_1_0" ActionTag="1247068206" Tag="102" IconVisible="False" LeftMargin="971.4956" RightMargin="-20.4956" TopMargin="528.5002" BottomMargin="48.4998" TouchEnable="True" FontSize="30" ButtonText="Reset" Scale9Enable="True" LeftEage="15" RightEage="15" TopEage="11" BottomEage="11" Scale9OriginX="15" Scale9OriginY="11" Scale9Width="155" Scale9Height="41" ShadowOffsetX="2.0000" ShadowOffsetY="-2.0000" ctype="ButtonObjectData">
<Size X="185.0000" Y="63.0000" />
<AnchorPoint ScaleX="0.5000" ScaleY="0.5000" />
<Position X="1063.9956" Y="79.9998" />
<Scale ScaleX="0.6649" ScaleY="0.7778" />
<CColor A="255" R="255" G="255" B="255" />
<PrePosition X="0.9366" Y="0.1250" />
<PreSize X="0.1629" Y="0.0984" />
<FontResource Type="Normal" Path="fonts/FZY4JW.TTF" Plist="" />
<TextColor A="255" R="255" G="255" B="255" />
<DisabledFileData Type="Default" Path="Default/Button_Disable.png" Plist="" />
<PressedFileData Type="Default" Path="Default/Button_Press.png" Plist="" />
<NormalFileData Type="Default" Path="Default/Button_Normal.png" Plist="" />
<OutlineColor A="255" R="255" G="0" B="0" />
<ShadowColor A="255" R="110" G="110" B="110" />
</AbstractNodeData>
<AbstractNodeData Name="cue" ActionTag="-477444320" Tag="50" IconVisible="False" LeftMargin="-1481.4199" RightMargin="2216.4199" TopMargin="329.9956" BottomMargin="300.0044" LeftEage="132" RightEage="132" TopEage="3" BottomEage="3" Scale9OriginX="132" Scale9OriginY="3" Scale9Width="137" Scale9Height="4" ctype="ImageViewObjectData">
<Size X="401.0000" Y="10.0000" />
<Children>
<AbstractNodeData Name="Image_2" ActionTag="-2087855338" Tag="51" IconVisible="False" LeftMargin="129.0537" RightMargin="255.9463" TopMargin="-3.1862" BottomMargin="-2.8138" LeftEage="5" RightEage="5" TopEage="5" BottomEage="5" Scale9OriginX="5" Scale9OriginY="5" Scale9Width="36" Scale9Height="36" ctype="ImageViewObjectData">
<Size X="16.0000" Y="16.0000" />
<AnchorPoint ScaleX="0.5000" ScaleY="0.5000" />
<Position X="137.0537" Y="5.1862" />
<Scale ScaleX="1.0000" ScaleY="1.0000" />
<CColor A="255" R="255" G="255" B="255" />
<PrePosition X="0.3418" Y="0.5186" />
<PreSize X="0.0399" Y="1.6000" />
<FileData Type="Default" Path="Default/ImageFile.png" Plist="" />
</AbstractNodeData>
</Children>
<AnchorPoint ScaleX="1.0000" ScaleY="0.5000" />
<Position X="-1080.4199" Y="305.0044" />
<Scale ScaleX="1.0000" ScaleY="1.0000" />
<CColor A="255" R="255" G="255" B="255" />
<PrePosition X="-0.9511" Y="0.4766" />
<PreSize X="0.3530" Y="0.0156" />
<FileData Type="Normal" Path="gameBilliards/cue.png" Plist="" />
</AbstractNodeData>
<AbstractNodeData Name="whiteBall" ActionTag="812394276" Tag="1000" IconVisible="False" LeftMargin="-335.7733" RightMargin="1338.7733" TopMargin="271.1842" BottomMargin="235.8158" ctype="SpriteObjectData">
<Size X="133.0000" Y="133.0000" />
<AnchorPoint ScaleX="0.5000" ScaleY="0.5000" />
<Position X="-269.2733" Y="302.3158" />
<Scale ScaleX="0.2000" ScaleY="0.2000" />
<CColor A="255" R="255" G="255" B="255" />
<PrePosition X="-0.2370" Y="0.4724" />
<PreSize X="0.1171" Y="0.2078" />
<FileData Type="Normal" Path="gameBilliards/image/ball_0.png" Plist="" />
<BlendFunc Src="1" Dst="771" />
</AbstractNodeData>
<AbstractNodeData Name="Panel_Ball" ActionTag="-332901850" Tag="110" IconVisible="False" LeftMargin="-410.2885" RightMargin="1446.2886" TopMargin="289.9248" BottomMargin="250.0752" TouchEnable="True" ClipAble="False" BackColorAlpha="102" ColorAngle="90.0000" Scale9Width="1" Scale9Height="1" ctype="PanelObjectData">
<Size X="100.0000" Y="100.0000" />
<Children>
<AbstractNodeData Name="ball_1" ActionTag="686756111" Tag="1" IconVisible="False" LeftMargin="-98.5000" RightMargin="65.5000" TopMargin="-18.5000" BottomMargin="-14.5000" ctype="SpriteObjectData">
<Size X="133.0000" Y="133.0000" />
<AnchorPoint ScaleX="0.5000" ScaleY="0.5000" />
<Position X="-32.0000" Y="52.0000" />
<Scale ScaleX="0.2000" ScaleY="0.2000" />
<CColor A="255" R="255" G="255" B="255" />
<PrePosition X="-0.3200" Y="0.5200" />
<PreSize X="1.3300" Y="1.3300" />
<FileData Type="Normal" Path="gameBilliards/image/ball_1.png" Plist="" />
<BlendFunc Src="1" Dst="771" />
</AbstractNodeData>
<AbstractNodeData Name="ball_2" ActionTag="414447646" Tag="2" IconVisible="False" LeftMargin="21.5000" RightMargin="-54.5000" TopMargin="11.5000" BottomMargin="-44.5000" ctype="SpriteObjectData">
<Size X="133.0000" Y="133.0000" />
<AnchorPoint ScaleX="0.5000" ScaleY="0.5000" />
<Position X="88.0000" Y="22.0000" />
<Scale ScaleX="0.2000" ScaleY="0.2000" />
<CColor A="255" R="255" G="255" B="255" />
<PrePosition X="0.8800" Y="0.2200" />
<PreSize X="1.3300" Y="1.3300" />
<FileData Type="Normal" Path="gameBilliards/image/ball_2.png" Plist="" />
<BlendFunc Src="1" Dst="771" />
</AbstractNodeData>
<AbstractNodeData Name="ball_3" ActionTag="1336708078" Tag="3" IconVisible="False" LeftMargin="21.5000" RightMargin="-54.5000" TopMargin="-48.5000" BottomMargin="15.5000" ctype="SpriteObjectData">
<Size X="133.0000" Y="133.0000" />
<AnchorPoint ScaleX="0.5000" ScaleY="0.5000" />
<Position X="88.0000" Y="82.0000" />
<Scale ScaleX="0.2000" ScaleY="0.2000" />
<CColor A="255" R="255" G="255" B="255" />
<PrePosition X="0.8800" Y="0.8200" />
<PreSize X="1.3300" Y="1.3300" />
<FileData Type="Normal" Path="gameBilliards/image/ball_3.png" Plist="" />
<BlendFunc Src="1" Dst="771" />
</AbstractNodeData>
<AbstractNodeData Name="ball_4" ActionTag="557369564" Tag="4" IconVisible="False" LeftMargin="-8.5000" RightMargin="-24.5000" TopMargin="-3.5000" BottomMargin="-29.5000" ctype="SpriteObjectData">
<Size X="133.0000" Y="133.0000" />
<AnchorPoint ScaleX="0.5000" ScaleY="0.5000" />
<Position X="58.0000" Y="37.0000" />
<Scale ScaleX="0.2000" ScaleY="0.2000" />
<CColor A="255" R="255" G="255" B="255" />
<PrePosition X="0.5800" Y="0.3700" />
<PreSize X="1.3300" Y="1.3300" />
<FileData Type="Normal" Path="gameBilliards/image/ball_4.png" Plist="" />
<BlendFunc Src="1" Dst="771" />
</AbstractNodeData>
<AbstractNodeData Name="ball_5" ActionTag="-399437171" Tag="5" IconVisible="False" LeftMargin="-38.5000" RightMargin="5.5000" TopMargin="-48.5000" BottomMargin="15.5000" ctype="SpriteObjectData">
<Size X="133.0000" Y="133.0000" />
<AnchorPoint ScaleX="0.5000" ScaleY="0.5000" />
<Position X="28.0000" Y="82.0000" />
<Scale ScaleX="0.2000" ScaleY="0.2000" />
<CColor A="255" R="255" G="255" B="255" />
<PrePosition X="0.2800" Y="0.8200" />
<PreSize X="1.3300" Y="1.3300" />
<FileData Type="Normal" Path="gameBilliards/image/ball_5.png" Plist="" />
<BlendFunc Src="1" Dst="771" />
</AbstractNodeData>
<AbstractNodeData Name="ball_6" ActionTag="458496112" Tag="6" IconVisible="False" LeftMargin="-8.5000" RightMargin="-24.5000" TopMargin="-33.5000" BottomMargin="0.5000" ctype="SpriteObjectData">
<Size X="133.0000" Y="133.0000" />
<AnchorPoint ScaleX="0.5000" ScaleY="0.5000" />
<Position X="58.0000" Y="67.0000" />
<Scale ScaleX="0.2000" ScaleY="0.2000" />
<CColor A="255" R="255" G="255" B="255" />
<PrePosition X="0.5800" Y="0.6700" />
<PreSize X="1.3300" Y="1.3300" />
<FileData Type="Normal" Path="gameBilliards/image/ball_6.png" Plist="" />
<BlendFunc Src="1" Dst="771" />
</AbstractNodeData>
<AbstractNodeData Name="ball_7" ActionTag="960066150" Tag="7" IconVisible="False" LeftMargin="-38.5000" RightMargin="5.5000" TopMargin="11.5000" BottomMargin="-44.5000" ctype="SpriteObjectData">
<Size X="133.0000" Y="133.0000" />
<AnchorPoint ScaleX="0.5000" ScaleY="0.5000" />
<Position X="28.0000" Y="22.0000" />
<Scale ScaleX="0.2000" ScaleY="0.2000" />
<CColor A="255" R="255" G="255" B="255" />
<PrePosition X="0.2800" Y="0.2200" />
<PreSize X="1.3300" Y="1.3300" />
<FileData Type="Normal" Path="gameBilliards/image/ball_7.png" Plist="" />
<BlendFunc Src="1" Dst="771" />
</AbstractNodeData>
<AbstractNodeData Name="ball_8" ActionTag="-492297582" Tag="8" IconVisible="False" LeftMargin="-38.5000" RightMargin="5.5000" TopMargin="-18.5000" BottomMargin="-14.5000" ctype="SpriteObjectData">
<Size X="133.0000" Y="133.0000" />
<AnchorPoint ScaleX="0.5000" ScaleY="0.5000" />
<Position X="28.0000" Y="52.0000" />
<Scale ScaleX="0.2000" ScaleY="0.2000" />
<CColor A="255" R="255" G="255" B="255" />
<PrePosition X="0.2800" Y="0.5200" />
<PreSize X="1.3300" Y="1.3300" />
<FileData Type="Normal" Path="gameBilliards/image/ball_8.png" Plist="" />
<BlendFunc Src="1" Dst="771" />
</AbstractNodeData>
<AbstractNodeData Name="ball_9" ActionTag="293338978" Tag="9" IconVisible="False" LeftMargin="-68.5000" RightMargin="35.5000" TopMargin="-33.5000" BottomMargin="0.5000" ctype="SpriteObjectData">
<Size X="133.0000" Y="133.0000" />
<AnchorPoint ScaleX="0.5000" ScaleY="0.5000" />
<Position X="-2.0000" Y="67.0000" />
<Scale ScaleX="0.2000" ScaleY="0.2000" />
<CColor A="255" R="255" G="255" B="255" />
<PrePosition X="-0.0200" Y="0.6700" />
<PreSize X="1.3300" Y="1.3300" />
<FileData Type="Normal" Path="gameBilliards/image/ball_9.png" Plist="" />
<BlendFunc Src="1" Dst="771" />
</AbstractNodeData>
<AbstractNodeData Name="ball_10" ActionTag="251600225" Tag="10" IconVisible="False" LeftMargin="-8.5000" RightMargin="-24.5000" TopMargin="26.5000" BottomMargin="-59.5000" ctype="SpriteObjectData">
<Size X="133.0000" Y="133.0000" />
<AnchorPoint ScaleX="0.5000" ScaleY="0.5000" />
<Position X="58.0000" Y="7.0000" />
<Scale ScaleX="0.2000" ScaleY="0.2000" />
<CColor A="255" R="255" G="255" B="255" />
<PrePosition X="0.5800" Y="0.0700" />
<PreSize X="1.3300" Y="1.3300" />
<FileData Type="Normal" Path="gameBilliards/image/ball_10.png" Plist="" />
<BlendFunc Src="1" Dst="771" />
</AbstractNodeData>
<AbstractNodeData Name="ball_11" ActionTag="1497430831" Tag="11" IconVisible="False" LeftMargin="21.5000" RightMargin="-54.5000" TopMargin="-78.5000" BottomMargin="45.5000" ctype="SpriteObjectData">
<Size X="133.0000" Y="133.0000" />
<AnchorPoint ScaleX="0.5000" ScaleY="0.5000" />
<Position X="88.0000" Y="112.0000" />
<Scale ScaleX="0.2000" ScaleY="0.2000" />
<CColor A="255" R="255" G="255" B="255" />
<PrePosition X="0.8800" Y="1.1200" />
<PreSize X="1.3300" Y="1.3300" />
<FileData Type="Normal" Path="gameBilliards/image/ball_11.png" Plist="" />
<BlendFunc Src="1" Dst="771" />
</AbstractNodeData>
<AbstractNodeData Name="ball_12" ActionTag="-1811715147" Tag="12" IconVisible="False" LeftMargin="21.5000" RightMargin="-54.5000" TopMargin="41.5000" BottomMargin="-74.5000" ctype="SpriteObjectData">
<Size X="133.0000" Y="133.0000" />
<AnchorPoint ScaleX="0.5000" ScaleY="0.5000" />
<Position X="88.0000" Y="-8.0000" />
<Scale ScaleX="0.2000" ScaleY="0.2000" />
<CColor A="255" R="255" G="255" B="255" />
<PrePosition X="0.8800" Y="-0.0800" />
<PreSize X="1.3300" Y="1.3300" />
<FileData Type="Normal" Path="gameBilliards/image/ball_12.png" Plist="" />
<BlendFunc Src="1" Dst="771" />
</AbstractNodeData>
<AbstractNodeData Name="ball_13" ActionTag="852369306" Tag="13" IconVisible="False" LeftMargin="21.5000" RightMargin="-54.5000" TopMargin="-18.5000" BottomMargin="-14.5000" ctype="SpriteObjectData">
<Size X="133.0000" Y="133.0000" />
<AnchorPoint ScaleX="0.5000" ScaleY="0.5000" />
<Position X="88.0000" Y="52.0000" />
<Scale ScaleX="0.2000" ScaleY="0.2000" />
<CColor A="255" R="255" G="255" B="255" />
<PrePosition X="0.8800" Y="0.5200" />
<PreSize X="1.3300" Y="1.3300" />
<FileData Type="Normal" Path="gameBilliards/image/ball_13.png" Plist="" />
<BlendFunc Src="1" Dst="771" />
</AbstractNodeData>
<AbstractNodeData Name="ball_14" ActionTag="-1827749790" Tag="14" IconVisible="False" LeftMargin="-8.5000" RightMargin="-24.5000" TopMargin="-63.5000" BottomMargin="30.5000" ctype="SpriteObjectData">
<Size X="133.0000" Y="133.0000" />
<AnchorPoint ScaleX="0.5000" ScaleY="0.5000" />
<Position X="58.0000" Y="97.0000" />
<Scale ScaleX="0.2000" ScaleY="0.2000" />
<CColor A="255" R="255" G="255" B="255" />
<PrePosition X="0.5800" Y="0.9700" />
<PreSize X="1.3300" Y="1.3300" />
<FileData Type="Normal" Path="gameBilliards/image/ball_14.png" Plist="" />
<BlendFunc Src="1" Dst="771" />
</AbstractNodeData>
<AbstractNodeData Name="ball_15" ActionTag="1249941562" Tag="15" IconVisible="False" LeftMargin="-68.5000" RightMargin="35.5000" TopMargin="-3.5000" BottomMargin="-29.5000" ctype="SpriteObjectData">
<Size X="133.0000" Y="133.0000" />
<AnchorPoint ScaleX="0.5000" ScaleY="0.5000" />
<Position X="-2.0000" Y="37.0000" />
<Scale ScaleX="0.2000" ScaleY="0.2000" />
<CColor A="255" R="255" G="255" B="255" />
<PrePosition X="-0.0200" Y="0.3700" />
<PreSize X="1.3300" Y="1.3300" />
<FileData Type="Normal" Path="gameBilliards/image/ball_15.png" Plist="" />
<BlendFunc Src="1" Dst="771" />
</AbstractNodeData>
</Children>
<AnchorPoint ScaleX="0.5000" ScaleY="0.5000" />
<Position X="-360.2885" Y="300.0752" />
<Scale ScaleX="1.0000" ScaleY="1.0000" />
<CColor A="255" R="255" G="255" B="255" />
<PrePosition X="-0.3172" Y="0.4689" />
<PreSize X="0.0880" Y="0.1563" />
<SingleColor A="255" R="150" G="200" B="255" />
<FirstColor A="255" R="150" G="200" B="255" />
<EndColor A="255" R="255" G="255" B="255" />
<ColorVector ScaleY="1.0000" />
</AbstractNodeData>
<AbstractNodeData Name="Panel_pull" ActionTag="-888699522" Tag="111" IconVisible="False" LeftMargin="1010.0000" RightMargin="30.0000" TopMargin="23.0000" BottomMargin="521.0000" LeftEage="31" RightEage="31" TopEage="31" BottomEage="31" Scale9OriginX="31" Scale9OriginY="31" Scale9Width="34" Scale9Height="34" ctype="ImageViewObjectData">
<Size X="96.0000" Y="96.0000" />
<Children>
<AbstractNodeData Name="Image_3" ActionTag="-591958357" Tag="26" IconVisible="False" LeftMargin="42.6825" RightMargin="40.3175" TopMargin="39.6821" BottomMargin="43.3179" LeftEage="4" RightEage="4" TopEage="4" BottomEage="4" Scale9OriginX="4" Scale9OriginY="4" Scale9Width="5" Scale9Height="5" ctype="ImageViewObjectData">
<Size X="13.0000" Y="13.0000" />
<AnchorPoint ScaleX="0.5000" ScaleY="0.5000" />
<Position X="49.1825" Y="49.8179" />
<Scale ScaleX="1.0000" ScaleY="1.0000" />
<CColor A="255" R="255" G="255" B="255" />
<PrePosition X="0.5123" Y="0.5189" />
<PreSize X="0.1354" Y="0.1354" />
<FileData Type="Normal" Path="gameBilliards/TEX_HitMarker.png" Plist="" />
</AbstractNodeData>
</Children>
<AnchorPoint ScaleX="0.5000" ScaleY="0.5000" />
<Position X="1058.0000" Y="569.0000" />
<Scale ScaleX="1.0000" ScaleY="1.0000" />
<CColor A="255" R="255" G="255" B="255" />
<PrePosition X="0.9313" Y="0.8891" />
<PreSize X="0.0845" Y="0.1500" />
<FileData Type="Normal" Path="gameBilliards/CueRegion.png" Plist="" />
</AbstractNodeData>
<AbstractNodeData Name="Panel_Test" ActionTag="-65054895" Tag="2000" IconVisible="False" LeftMargin="0.2421" RightMargin="935.7579" TopMargin="-142.9552" BottomMargin="582.9552" TouchEnable="True" ClipAble="False" BackColorAlpha="102" ComboBoxIndex="1" ColorAngle="90.0000" Scale9Width="1" Scale9Height="1" ctype="PanelObjectData">
<Size X="200.0000" Y="200.0000" />
<AnchorPoint />
<Position X="0.2421" Y="582.9552" />
<Scale ScaleX="0.2950" ScaleY="0.2750" />
<CColor A="255" R="255" G="255" B="255" />
<PrePosition X="0.0002" Y="0.9109" />
<PreSize X="0.1761" Y="0.3125" />
<SingleColor A="255" R="150" G="200" B="255" />
<FirstColor A="255" R="150" G="200" B="255" />
<EndColor A="255" R="255" G="255" B="255" />
<ColorVector ScaleY="1.0000" />
</AbstractNodeData>
<AbstractNodeData Name="Image_1" ActionTag="-379218392" Tag="179" IconVisible="False" LeftMargin="71.4973" RightMargin="1034.5027" TopMargin="14.5885" BottomMargin="595.4115" LeftEage="31" RightEage="31" TopEage="31" BottomEage="31" Scale9OriginX="15" Scale9OriginY="15" Scale9Width="16" Scale9Height="16" ctype="ImageViewObjectData">
<Size X="30.0000" Y="30.0000" />
<AnchorPoint ScaleX="0.5000" ScaleY="0.5000" />
<Position X="86.4973" Y="610.4115" />
<Scale ScaleX="1.0000" ScaleY="1.0000" />
<CColor A="255" R="255" G="255" B="255" />
<PrePosition X="0.0761" Y="0.9538" />
<PreSize X="0.0264" Y="0.0469" />
<FileData Type="Default" Path="Default/ImageFile.png" Plist="" />
</AbstractNodeData>
<AbstractNodeData Name="Slider_Cue" ActionTag="1352845770" Tag="103" RotationSkewX="90.0000" RotationSkewY="90.0000" IconVisible="False" LeftMargin="-90.9035" RightMargin="811.9034" TopMargin="314.4783" BottomMargin="243.5217" TouchEnable="True" PercentInfo="19" ctype="SliderObjectData">
<Size X="415.0000" Y="82.0000" />
<AnchorPoint ScaleX="0.5000" ScaleY="0.5000" />
<Position X="116.5965" Y="284.5217" />
<Scale ScaleX="1.0000" ScaleY="1.0000" />
<CColor A="255" R="255" G="255" B="255" />
<PrePosition X="0.1026" Y="0.4446" />
<PreSize X="0.3653" Y="0.1281" />
<BackGroundData Type="Normal" Path="gameBilliards/eightBall/eightBall_Sliderbar_Bg.png" Plist="" />
<ProgressBarData Type="PlistSubImage" Path="eightBall_SliderBar_Power.png" Plist="gameBilliards/plist/EightBall.plist" />
<BallNormalData Type="Normal" Path="gameBilliards/eightBall/eightBall_Cue_bar.png" Plist="" />
<BallPressedData Type="Normal" Path="gameBilliards/eightBall/eightBall_Cue_bar.png" Plist="" />
<BallDisabledData Type="Default" Path="Default/SliderNode_Disable.png" Plist="" />
</AbstractNodeData>
<AbstractNodeData Name="fineTurning" ActionTag="1138685192" Tag="130" IconVisible="False" LeftMargin="1070.2379" RightMargin="-0.2379" TopMargin="119.2914" BottomMargin="55.7086" LeftEage="21" RightEage="21" TopEage="153" BottomEage="153" Scale9OriginX="21" Scale9OriginY="153" Scale9Width="24" Scale9Height="159" ctype="ImageViewObjectData">
<Size X="66.0000" Y="465.0000" />
<Children>
<AbstractNodeData Name="Panel_2" ActionTag="1764577154" Tag="131" IconVisible="False" LeftMargin="10.7834" RightMargin="5.2166" TopMargin="29.9562" BottomMargin="35.0438" TouchEnable="True" ClipAble="True" BackColorAlpha="102" ColorAngle="90.0000" Scale9Width="1" Scale9Height="1" ctype="PanelObjectData">
<Size X="50.0000" Y="400.0000" />
<Children>
<AbstractNodeData Name="Image_15" ActionTag="1981134586" Tag="133" IconVisible="False" LeftMargin="14.5000" RightMargin="8.5000" TopMargin="-736.0071" BottomMargin="206.0070" LeftEage="10" RightEage="10" TopEage="142" BottomEage="142" Scale9OriginX="10" Scale9OriginY="142" Scale9Width="7" Scale9Height="646" ctype="ImageViewObjectData">
<Size X="27.0000" Y="930.0000" />
<AnchorPoint ScaleX="0.5000" ScaleY="0.5000" />
<Position X="28.0000" Y="671.0070" />
<Scale ScaleX="1.0000" ScaleY="1.0000" />
<CColor A="255" R="255" G="255" B="255" />
<PrePosition X="0.5600" Y="1.6775" />
<PreSize X="0.5400" Y="2.3250" />
<FileData Type="Normal" Path="gameBilliards/eightBall/eightBall_FineTurning_Scale.png" Plist="" />
</AbstractNodeData>
<AbstractNodeData Name="Image_15_0" ActionTag="-866752066" Tag="132" IconVisible="False" LeftMargin="14.6230" RightMargin="8.3770" TopMargin="193.6247" BottomMargin="-723.6247" LeftEage="10" RightEage="10" TopEage="142" BottomEage="142" Scale9OriginX="10" Scale9OriginY="142" Scale9Width="7" Scale9Height="646" ctype="ImageViewObjectData">
<Size X="27.0000" Y="930.0000" />
<AnchorPoint ScaleX="0.5000" ScaleY="0.5000" />
<Position X="28.1230" Y="-258.6247" />
<Scale ScaleX="1.0000" ScaleY="1.0000" />
<CColor A="255" R="255" G="255" B="255" />
<PrePosition X="0.5625" Y="-0.6466" />
<PreSize X="0.5400" Y="2.3250" />
<FileData Type="Normal" Path="gameBilliards/eightBall/eightBall_FineTurning_Scale.png" Plist="" />
</AbstractNodeData>
</Children>
<AnchorPoint ScaleX="0.5000" ScaleY="0.5000" />
<Position X="35.7834" Y="235.0438" />
<Scale ScaleX="1.0000" ScaleY="1.0000" />
<CColor A="255" R="255" G="255" B="255" />
<PrePosition X="0.5422" Y="0.5055" />
<PreSize X="0.7576" Y="0.8602" />
<SingleColor A="255" R="150" G="200" B="255" />
<FirstColor A="255" R="150" G="200" B="255" />
<EndColor A="255" R="255" G="255" B="255" />
<ColorVector ScaleY="1.0000" />
</AbstractNodeData>
</Children>
<AnchorPoint ScaleX="0.5000" ScaleY="0.5000" />
<Position X="1103.2379" Y="288.2086" />
<Scale ScaleX="1.0000" ScaleY="1.0000" />
<CColor A="255" R="255" G="255" B="255" />
<PrePosition X="0.9712" Y="0.4503" />
<PreSize X="0.0581" Y="0.7266" />
<FileData Type="Normal" Path="gameBilliards/eightBall/eightBall_FineTurning_Back2.png" Plist="" />
</AbstractNodeData>
</Children>
</ObjectData>
</Content>
</Content>
</GameFile> | Csound | 3 | zhake911/zhuoqiuStudio | CocosStudio/cocosstudio/UI/Billiards/billardsMainLayer.csd | [
"Apache-2.0"
] |
#!/bin/bash
# Copyright 2016 gRPC authors.
#
# Licensed under the Apache License, Version 2.0 (the "License");
# you may not use this file except in compliance with the License.
# You may obtain a copy of the License at
#
# http://www.apache.org/licenses/LICENSE-2.0
#
# Unless required by applicable law or agreed to in writing, software
# distributed under the License is distributed on an "AS IS" BASIS,
# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
# See the License for the specific language governing permissions and
# limitations under the License.
# change to root directory
cd $(dirname $0)/../..
function find_without_newline() {
find . -type f -not -path './third_party/*' -and \( \
-name '*.c' \
-or -name '*.cc' \
-or -name '*.proto' \
-or -name '*.rb' \
-or -name '*.py' \
-or -name '*.cs' \
-or -name '*.sh' \) -print0 \
| while IFS= read -r -d '' f; do
if [[ ! -z $f ]]; then
if [[ $(tail -c 1 "$f") != $NEWLINE ]]; then
echo "Error: file '$f' is missing a trailing newline character."
if $1; then # fix
sed -i -e '$a\' $f
echo 'Fixed!'
fi
fi
fi
done
}
if [[ $# == 1 && $1 == '--fix' ]]; then
FIX=true
else
FIX=false
fi
ERRORS=$(find_without_newline $FIX)
if [[ "$ERRORS" != '' ]]; then
echo "$ERRORS"
if ! $FIX; then
exit 1
fi
fi
| Shell | 4 | warlock135/grpc | tools/distrib/check_trailing_newlines.sh | [
"Apache-2.0"
] |
export { borders } from "./borders"
export { breakpoints, breakpointsArray } from "./breakpoints"
export { colors } from "./colors"
export { fonts, fontsLists } from "./fonts"
export { fontSizes, fontSizesPx, fontSizesRaw } from "./font-sizes"
export { fontWeights } from "./font-weights"
export { letterSpacings } from "./letter-spacings"
export { lineHeights } from "./line-heights"
export { mediaQueries } from "./media-queries"
export { radii } from "./radii"
export { shadows } from "./shadows"
export { space, spacePx, spaceRaw } from "./space"
export { transition } from "./transition"
| JavaScript | 3 | JQuinnie/gatsby | packages/gatsby-design-tokens/src/index.js | [
"MIT"
] |
[package]
name = "cargo-fmt-test"
version = "0.1.0"
authors = ["calebcartwright"]
edition = "2018"
[dependencies]
indexmap = "1.0.2"
[workspace]
members = [
"dependency-dir-name",
] | TOML | 2 | ohno418/rust | src/tools/rustfmt/tests/cargo-fmt/source/divergent-crate-dir-names/Cargo.toml | [
"ECL-2.0",
"Apache-2.0",
"MIT-0",
"MIT"
] |
--TEST--
Bug #75079 variation without traits
--FILE--
<?php
class Foo
{
private static $bar = 123;
static function test(){
return function(){
return function(){
return Foo::$bar;
};
};
}
}
$f = Foo::test();
var_dump($f()());
class A{}
$a = new A;
var_dump($f->bindTo($a, A::CLASS)()());
?>
--EXPECTF--
int(123)
Fatal error: Uncaught Error: Cannot access private property Foo::$bar in %s:%d
Stack trace:
#0 %s(%d): A->{closure}()
#1 {main}
thrown in %s on line %d
| PHP | 3 | thiagooak/php-src | Zend/tests/bug75079_2.phpt | [
"PHP-3.01"
] |
# This file is part of NIT ( http://www.nitlanguage.org ).
#
# Copyright 2013 Matthieu Lucas <lucasmatthieu@gmail.com>
#
# Licensed under the Apache License, Version 2.0 (the "License");
# you may not use this file except in compliance with the License.
# You may obtain a copy of the License at
#
# http://www.apache.org/licenses/LICENSE-2.0
#
# Unless required by applicable law or agreed to in writing, software
# distributed under the License is distributed on an "AS IS" BASIS,
# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
# See the License for the specific language governing permissions and
# limitations under the License.
# Sample of the Curl module.
module curl_http is
c_compiler_option("-I", "/usr/local/include/curl")
c_compiler_option("-L", "/usr/local/lib")
c_linker_option("-l", "curl")
end
import curl
# Small class to represent an Http Fetcher
class MyHttpFetcher
super CurlCallbacks
var curl: Curl
var our_body: String = ""
init(curl: Curl) do self.curl = curl
# Release curl object
fun destroy do self.curl.destroy
# Header callback
redef fun header_callback(line: String) do
# We keep this callback silent for testing purposes
#if not line.has_prefix("Date:") then print "Header_callback : {line}"
end
# Body callback
redef fun body_callback(line: String) do self.our_body = "{self.our_body}{line}"
# Stream callback - Cf : No one is registered
redef fun stream_callback(buffer: String, size: Int, count: Int) do print "Stream_callback : {buffer} - {size} - {count}"
end
# Program
if args.length < 2 then
print "Usage: curl_http <method wished [POST, GET, GET_FILE]> <target url>"
else
var curl = new Curl
var url = args[1]
var request = new CurlHTTPRequest(url, curl)
# HTTP Get Request
if args[0] == "GET" then
request.verbose = false
var getResponse = request.execute
if getResponse isa CurlResponseSuccess then
print "Status code : {getResponse.status_code}"
print "Body : {getResponse.body_str}"
else if getResponse isa CurlResponseFailed then
print "Error code : {getResponse.error_code}"
print "Error msg : {getResponse.error_msg}"
end
# HTTP Post Request
else if args[0] == "POST" then
var myHttpFetcher = new MyHttpFetcher(curl)
request.delegate = myHttpFetcher
var postDatas = new HeaderMap
postDatas["Bugs Bunny"] = "Daffy Duck"
postDatas["Batman"] = "Robin likes special characters @#ùà!è§'(\"é&://,;<>∞~*"
postDatas["Batman"] = "Yes you can set multiple identical keys, but APACHE will consider only once, the last one"
request.datas = postDatas
request.verbose = false
var postResponse = request.execute
print "Our body from the callback : {myHttpFetcher.our_body}"
if postResponse isa CurlResponseSuccess then
print "*** Answer ***"
print "Status code : {postResponse.status_code}"
print "Body should be empty, because we decided to manage callbacks : {postResponse.body_str.length}"
else if postResponse isa CurlResponseFailed then
print "Error code : {postResponse.error_code}"
print "Error msg : {postResponse.error_msg}"
end
# HTTP Get to file Request
else if args[0] == "GET_FILE" then
var headers = new HeaderMap
headers["Accept"] = "Moo"
request.headers = headers
request.verbose = false
var downloadResponse = request.download_to_file(null)
if downloadResponse isa CurlFileResponseSuccess then
print "*** Answer ***"
print "Status code : {downloadResponse.status_code}"
print "Size downloaded : {downloadResponse.size_download}"
else if downloadResponse isa CurlResponseFailed then
print "Error code : {downloadResponse.error_code}"
print "Error msg : {downloadResponse.error_msg}"
end
# Program logic
else
print "Usage : Method[POST, GET, GET_FILE]"
end
end
| Nit | 5 | irr/nit-labs | curl_http.nit | [
"Apache-2.0"
] |
import java.util.ArrayList;
import java.util.List;
import java.util.Random;
import org.opencv.core.*;
import org.opencv.calib3d.Calib3d;
import org.opencv.highgui.HighGui;
import org.opencv.imgcodecs.Imgcodecs;
import org.opencv.imgproc.Imgproc;
class PerspectiveCorrectionRun {
void perspectiveCorrection (String[] args) {
String img1Path = args[0], img2Path = args[1];
Mat img1 = Imgcodecs.imread(img1Path);
Mat img2 = Imgcodecs.imread(img2Path);
//! [find-corners]
MatOfPoint2f corners1 = new MatOfPoint2f(), corners2 = new MatOfPoint2f();
boolean found1 = Calib3d.findChessboardCorners(img1, new Size(9, 6), corners1 );
boolean found2 = Calib3d.findChessboardCorners(img2, new Size(9, 6), corners2 );
//! [find-corners]
if (!found1 || !found2) {
System.out.println("Error, cannot find the chessboard corners in both images.");
System.exit(-1);
}
//! [estimate-homography]
Mat H = new Mat();
H = Calib3d.findHomography(corners1, corners2);
System.out.println(H.dump());
//! [estimate-homography]
//! [warp-chessboard]
Mat img1_warp = new Mat();
Imgproc.warpPerspective(img1, img1_warp, H, img1.size());
//! [warp-chessboard]
Mat img_draw_warp = new Mat();
List<Mat> list1 = new ArrayList<>(), list2 = new ArrayList<>() ;
list1.add(img2);
list1.add(img1_warp);
Core.hconcat(list1, img_draw_warp);
HighGui.imshow("Desired chessboard view / Warped source chessboard view", img_draw_warp);
//! [compute-transformed-corners]
Mat img_draw_matches = new Mat();
list2.add(img1);
list2.add(img2);
Core.hconcat(list2, img_draw_matches);
Point []corners1Arr = corners1.toArray();
for (int i = 0 ; i < corners1Arr.length; i++) {
Mat pt1 = new Mat(3, 1, CvType.CV_64FC1), pt2 = new Mat();
pt1.put(0, 0, corners1Arr[i].x, corners1Arr[i].y, 1 );
Core.gemm(H, pt1, 1, new Mat(), 0, pt2);
double[] data = pt2.get(2, 0);
Core.divide(pt2, new Scalar(data[0]), pt2);
double[] data1 =pt2.get(0, 0);
double[] data2 = pt2.get(1, 0);
Point end = new Point((int)(img1.cols()+ data1[0]), (int)data2[0]);
Imgproc.line(img_draw_matches, corners1Arr[i], end, RandomColor(), 2);
}
HighGui.imshow("Draw matches", img_draw_matches);
HighGui.waitKey(0);
//! [compute-transformed-corners]
System.exit(0);
}
Scalar RandomColor () {
Random rng = new Random();
int r = rng.nextInt(256);
int g = rng.nextInt(256);
int b = rng.nextInt(256);
return new Scalar(r, g, b);
}
}
public class PerspectiveCorrection {
public static void main (String[] args) {
System.loadLibrary(Core.NATIVE_LIBRARY_NAME);
new PerspectiveCorrectionRun().perspectiveCorrection(args);
}
}
| Java | 5 | suryakantpandey/opencv | samples/java/tutorial_code/features2D/Homography/PerspectiveCorrection.java | [
"BSD-3-Clause"
] |
"""Constants for the Whirlpool Sixth Sense integration."""
DOMAIN = "whirlpool"
AUTH_INSTANCE_KEY = "auth"
| Python | 2 | MrDelik/core | homeassistant/components/whirlpool/const.py | [
"Apache-2.0"
] |
.. meta::
:description: Deploy Hasura GraphQL engine
:keywords: hasura, docs, deployment
.. _deployment:
Deploying Hasura GraphQL engine
===============================
.. contents:: Table of contents
:backlinks: none
:depth: 1
:local:
Deployment guides
-----------------
This section contains guides to deploy the Hasura GraphQL engine and connect it to a Postgres database.
If you're looking for quick deployment options, check out the following guides:
- :ref:`One-click deployment guides <one_click_deployment_guides>`
The following is a list of all deployment guides:
- :ref:`Deployment guides <all_deployment_guides>`
.. admonition:: Custom Docker images or binaries
If you need a custom Docker image or binary for GraphQL engine, please see :ref:`this page <custom_docker_image>`.
Configuration
-------------
By default, Hasura GraphQL engine runs in a very permissive mode for easier development. Check out the below pages
to configure the Hasura GraphQL engine for your production environment:
- :ref:`GraphQL engine server configuration <hge_flags>`
- :ref:`Postgres requirements <postgres_permissions>`
- :ref:`Securing the GraphQL endpoint <securing_graphql_endpoint>`
- :ref:`Enable HTTPS <enable_https>`
- :ref:`Allow-list of operations <allow_list>`
- :ref:`HTTP compression <http_compression>`
- :ref:`Updating GraphQL engine <update_hge>`
- :ref:`Downgrading GraphQL engine <downgrade_hge>`
Logs
----
For access to Hasura GraphQL engine logs, check the below page for details:
- :ref:`Logging <hge_logs>`
Production checklist
--------------------
If you're moving your Hasura GraphQL engine to production, consult the following guide:
- :ref:`Production checklist <production_checklist>`
.. toctree::
:maxdepth: 1
:titlesonly:
:hidden:
Deployment guides <deployment-guides/index>
Server configuration <graphql-engine-flags/index>
postgres-requirements
Securing GraphQL endpoint <securing-graphql-endpoint>
Server logs <logging>
Enable HTTPS <enable-https>
allow-list
HTTP Compression <compression>
Production checklist <production-checklist>
Custom Docker images or binaries <custom-docker-images>
Updating GraphQL engine <updating-graphql-engine>
Downgrading GraphQL engine <downgrading>
| reStructuredText | 4 | gh-oss-contributor/graphql-engine-1 | docs/graphql/core/deployment/index.rst | [
"Apache-2.0",
"MIT"
] |
-- OOA PARSER VALIDATION FUNCTIONS
.select many s_syncs from instances of S_SYNC where ( "$U_{selected.Descrip:ParserValidateFunction}" == "TRUE" )
.for each s_sync in s_syncs
INSERT INTO S_SYNC VALUES ( ${s_sync.Sync_ID}, ${s_sync.Dom_IDdeprecated}, '${s_sync.Name}', '', '', ${s_sync.DT_ID}, ${s_sync.Suc_Pars} );
.end for
.emit to file "sql/ooa_functions.sql" | Arc | 3 | FMAY-Software/bridgepoint | src/org.xtuml.bp.als/arc/ooa_functions.arc | [
"Apache-2.0"
] |
{:linters
{:unresolved-symbol
{:exclude [(compojure.api.sweet/defroutes)]}
:refer-all
{:exclude [clj-time.jdbc]}
}
}
| edn | 3 | esabol/super-linter | TEMPLATES/.clj-kondo/config.edn | [
"MIT"
] |
{
"patcher" : {
"fileversion" : 1,
"appversion" : {
"major" : 7,
"minor" : 3,
"revision" : 5,
"architecture" : "x64",
"modernui" : 1
}
,
"rect" : [ 143.0, 146.0, 1282.0, 485.0 ],
"bgcolor" : [ 0.0, 0.0, 0.0, 1.0 ],
"editing_bgcolor" : [ 0.239216, 0.254902, 0.278431, 1.0 ],
"bglocked" : 0,
"openinpresentation" : 1,
"default_fontsize" : 12.0,
"default_fontface" : 0,
"default_fontname" : "Arial",
"gridonopen" : 1,
"gridsize" : [ 15.0, 15.0 ],
"gridsnaponopen" : 1,
"objectsnaponopen" : 1,
"statusbarvisible" : 2,
"toolbarvisible" : 1,
"lefttoolbarpinned" : 0,
"toptoolbarpinned" : 0,
"righttoolbarpinned" : 0,
"bottomtoolbarpinned" : 1,
"toolbars_unpinned_last_save" : 0,
"tallnewobj" : 0,
"boxanimatetime" : 200,
"enablehscroll" : 1,
"enablevscroll" : 1,
"devicewidth" : 0.0,
"description" : "",
"digest" : "",
"tags" : "",
"style" : "",
"subpatcher_template" : "",
"boxes" : [ {
"box" : {
"bgcolor" : [ 0.290196, 0.309804, 0.301961, 0.0 ],
"bubblesize" : 12,
"id" : "obj-40",
"maxclass" : "preset",
"numinlets" : 1,
"numoutlets" : 4,
"outlettype" : [ "preset", "int", "preset", "int" ],
"patching_rect" : [ 1608.0, 105.0, 48.0, 134.0 ],
"presentation" : 1,
"presentation_rect" : [ 1203.5, 314.25, 44.0, 134.0 ],
"preset_data" : [ {
"number" : 1,
"data" : [ 20, "obj-14", "multislider", "list", 0, 0, 1, 0, 0, 0, -1, -1, -1, 0, 1, 1, 0, 0, -1, 0, 20, "obj-216", "multislider", "list", 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 20, "obj-182", "multislider", "list", 0, 7, 3, 0, 5, 0, 0, 0, 13, 0, 0, 0, 0, 12, 0, 0 ]
}
, {
"number" : 2,
"data" : [ 20, "obj-14", "multislider", "list", 0, 0, 1, 0, 0, 0, -1, -1, -1, 0, 1, 1, 0, 0, -1, 0, 20, "obj-216", "multislider", "list", 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 20, "obj-182", "multislider", "list", 0, 7, 3, 0, 5, 0, 0, 0, 13, 0, 0, 0, 0, 12, 0, 0 ]
}
],
"style" : ""
}
}
, {
"box" : {
"id" : "obj-28",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "float" ],
"patching_rect" : [ 1668.0, 515.5, 35.0, 22.0 ],
"style" : "",
"text" : "* 12."
}
}
, {
"box" : {
"id" : "obj-23",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "int" ],
"patching_rect" : [ 1668.0, 484.0, 29.5, 22.0 ],
"style" : "",
"text" : "+ 0"
}
}
, {
"box" : {
"bgcolor" : [ 0.376471, 0.384314, 0.4, 0.0 ],
"bgcolor2" : [ 0.376471, 0.384314, 0.4, 0.0 ],
"bgfillcolor_angle" : 270.0,
"bgfillcolor_autogradient" : 0.0,
"bgfillcolor_color" : [ 0.290196, 0.309804, 0.301961, 0.0 ],
"bgfillcolor_color1" : [ 0.376471, 0.384314, 0.4, 0.0 ],
"bgfillcolor_color2" : [ 0.290196, 0.309804, 0.301961, 1.0 ],
"bgfillcolor_proportion" : 0.39,
"bgfillcolor_type" : "color",
"fontface" : 1,
"gradient" : 1,
"id" : "obj-22",
"maxclass" : "message",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 1762.25, 399.0, 65.0, 22.0 ],
"presentation" : 1,
"presentation_linecount" : 2,
"presentation_rect" : [ 1158.0, 350.0, 35.0, 36.0 ],
"style" : "",
"text" : "oct.shift",
"textjustification" : 1
}
}
, {
"box" : {
"bgcolor" : [ 0.376471, 0.384314, 0.4, 0.0 ],
"bgcolor2" : [ 0.376471, 0.384314, 0.4, 0.0 ],
"bgfillcolor_angle" : 270.0,
"bgfillcolor_autogradient" : 0.0,
"bgfillcolor_color" : [ 0.290196, 0.309804, 0.301961, 0.0 ],
"bgfillcolor_color1" : [ 0.376471, 0.384314, 0.4, 0.0 ],
"bgfillcolor_color2" : [ 0.290196, 0.309804, 0.301961, 1.0 ],
"bgfillcolor_proportion" : 0.39,
"bgfillcolor_type" : "color",
"fontface" : 1,
"gradient" : 1,
"id" : "obj-20",
"maxclass" : "message",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 1559.0, 399.0, 65.0, 22.0 ],
"presentation" : 1,
"presentation_rect" : [ 1158.0, 391.25, 35.0, 22.0 ],
"style" : "",
"text" : "gate",
"textjustification" : 1
}
}
, {
"box" : {
"bgcolor" : [ 0.094118, 0.101961, 0.101961, 0.44 ],
"candicane2" : [ 0.65098, 0.666667, 0.662745, 1.0 ],
"candicane3" : [ 0.65098, 0.666667, 0.662745, 1.0 ],
"candicane4" : [ 0.65098, 0.666667, 0.662745, 1.0 ],
"candycane" : 4,
"id" : "obj-14",
"maxclass" : "multislider",
"numinlets" : 1,
"numoutlets" : 2,
"outlettype" : [ "", "" ],
"parameter_enable" : 0,
"patching_rect" : [ 1735.0, 263.5, 192.0, 128.5 ],
"presentation" : 1,
"presentation_rect" : [ 602.0, 345.75, 554.0, 34.5 ],
"settype" : 0,
"size" : 16,
"slidercolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"spacing" : 1,
"style" : "",
"varname" : "multislider[2]"
}
}
, {
"box" : {
"bgcolor" : [ 0.376471, 0.384314, 0.4, 0.0 ],
"bgcolor2" : [ 0.376471, 0.384314, 0.4, 0.0 ],
"bgfillcolor_angle" : 270.0,
"bgfillcolor_autogradient" : 0.0,
"bgfillcolor_color" : [ 0.290196, 0.309804, 0.301961, 0.0 ],
"bgfillcolor_color1" : [ 0.376471, 0.384314, 0.4, 0.0 ],
"bgfillcolor_color2" : [ 0.290196, 0.309804, 0.301961, 1.0 ],
"bgfillcolor_proportion" : 0.39,
"bgfillcolor_type" : "color",
"fontface" : 1,
"gradient" : 1,
"id" : "obj-144",
"linecount" : 3,
"maxclass" : "message",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 232.5, 29.0, 97.0, 50.0 ],
"presentation" : 1,
"presentation_rect" : [ 104.5, 199.125, 188.0, 22.0 ],
"style" : "",
"text" : "MULTI ENGINE - EDIT PARAMS",
"textjustification" : 1
}
}
, {
"box" : {
"id" : "obj-142",
"maxclass" : "newobj",
"numinlets" : 0,
"numoutlets" : 6,
"outlettype" : [ "", "", "", "", "", "" ],
"patcher" : {
"fileversion" : 1,
"appversion" : {
"major" : 7,
"minor" : 3,
"revision" : 5,
"architecture" : "x64",
"modernui" : 1
}
,
"rect" : [ 481.0, 216.0, 640.0, 480.0 ],
"bglocked" : 0,
"openinpresentation" : 0,
"default_fontsize" : 12.0,
"default_fontface" : 0,
"default_fontname" : "Arial",
"gridonopen" : 1,
"gridsize" : [ 15.0, 15.0 ],
"gridsnaponopen" : 1,
"objectsnaponopen" : 1,
"statusbarvisible" : 2,
"toolbarvisible" : 1,
"lefttoolbarpinned" : 0,
"toptoolbarpinned" : 0,
"righttoolbarpinned" : 0,
"bottomtoolbarpinned" : 0,
"toolbars_unpinned_last_save" : 0,
"tallnewobj" : 0,
"boxanimatetime" : 200,
"enablehscroll" : 1,
"enablevscroll" : 1,
"devicewidth" : 0.0,
"description" : "",
"digest" : "",
"tags" : "",
"style" : "",
"subpatcher_template" : "",
"boxes" : [ {
"box" : {
"comment" : "",
"id" : "obj-9",
"index" : 6,
"maxclass" : "outlet",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 392.0, 307.0, 30.0, 30.0 ],
"style" : ""
}
}
, {
"box" : {
"id" : "obj-10",
"maxclass" : "newobj",
"numinlets" : 0,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 392.0, 85.0, 59.0, 22.0 ],
"style" : "",
"text" : "r param6"
}
}
, {
"box" : {
"comment" : "",
"id" : "obj-11",
"index" : 5,
"maxclass" : "outlet",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 323.0, 307.0, 30.0, 30.0 ],
"style" : ""
}
}
, {
"box" : {
"id" : "obj-12",
"maxclass" : "newobj",
"numinlets" : 0,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 323.0, 85.0, 59.0, 22.0 ],
"style" : "",
"text" : "r param5"
}
}
, {
"box" : {
"comment" : "",
"id" : "obj-7",
"index" : 4,
"maxclass" : "outlet",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 253.0, 307.0, 30.0, 30.0 ],
"style" : ""
}
}
, {
"box" : {
"id" : "obj-8",
"maxclass" : "newobj",
"numinlets" : 0,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 253.0, 85.0, 59.0, 22.0 ],
"style" : "",
"text" : "r param4"
}
}
, {
"box" : {
"comment" : "",
"id" : "obj-4",
"index" : 3,
"maxclass" : "outlet",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 184.0, 307.0, 30.0, 30.0 ],
"style" : ""
}
}
, {
"box" : {
"id" : "obj-6",
"maxclass" : "newobj",
"numinlets" : 0,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 184.0, 85.0, 59.0, 22.0 ],
"style" : "",
"text" : "r param3"
}
}
, {
"box" : {
"comment" : "",
"id" : "obj-2",
"index" : 2,
"maxclass" : "outlet",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 114.0, 307.0, 30.0, 30.0 ],
"style" : ""
}
}
, {
"box" : {
"id" : "obj-3",
"maxclass" : "newobj",
"numinlets" : 0,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 114.0, 85.0, 59.0, 22.0 ],
"style" : "",
"text" : "r param2"
}
}
, {
"box" : {
"comment" : "",
"id" : "obj-5",
"index" : 1,
"maxclass" : "outlet",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 42.0, 307.0, 30.0, 30.0 ],
"style" : ""
}
}
, {
"box" : {
"id" : "obj-1",
"maxclass" : "newobj",
"numinlets" : 0,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 42.0, 85.0, 59.0, 22.0 ],
"style" : "",
"text" : "r param1"
}
}
],
"lines" : [ {
"patchline" : {
"destination" : [ "obj-5", 0 ],
"source" : [ "obj-1", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-9", 0 ],
"source" : [ "obj-10", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-11", 0 ],
"source" : [ "obj-12", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-2", 0 ],
"source" : [ "obj-3", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-4", 0 ],
"source" : [ "obj-6", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-7", 0 ],
"source" : [ "obj-8", 0 ]
}
}
]
}
,
"patching_rect" : [ 64.0, 275.0, 88.0, 22.0 ],
"saved_object_attributes" : {
"description" : "",
"digest" : "",
"globalpatchername" : "",
"style" : "",
"tags" : ""
}
,
"style" : "",
"text" : "p rec_multi_cc"
}
}
, {
"box" : {
"id" : "obj-141",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patcher" : {
"fileversion" : 1,
"appversion" : {
"major" : 7,
"minor" : 3,
"revision" : 5,
"architecture" : "x64",
"modernui" : 1
}
,
"rect" : [ 469.0, 165.0, 640.0, 480.0 ],
"bglocked" : 0,
"openinpresentation" : 0,
"default_fontsize" : 12.0,
"default_fontface" : 0,
"default_fontname" : "Arial",
"gridonopen" : 1,
"gridsize" : [ 15.0, 15.0 ],
"gridsnaponopen" : 1,
"objectsnaponopen" : 1,
"statusbarvisible" : 2,
"toolbarvisible" : 1,
"lefttoolbarpinned" : 0,
"toptoolbarpinned" : 0,
"righttoolbarpinned" : 0,
"bottomtoolbarpinned" : 0,
"toolbars_unpinned_last_save" : 0,
"tallnewobj" : 0,
"boxanimatetime" : 200,
"enablehscroll" : 1,
"enablevscroll" : 1,
"devicewidth" : 0.0,
"description" : "",
"digest" : "",
"tags" : "",
"style" : "",
"subpatcher_template" : "",
"boxes" : [ {
"box" : {
"id" : "obj-4",
"maxclass" : "newobj",
"numinlets" : 4,
"numoutlets" : 4,
"outlettype" : [ "", "", "", "" ],
"patching_rect" : [ 46.0, 57.0, 92.0, 22.0 ],
"style" : "",
"text" : "route b list float"
}
}
, {
"box" : {
"id" : "obj-7",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 2,
"outlettype" : [ "float", "int" ],
"patching_rect" : [ 70.333336, 101.0, 73.0, 22.0 ],
"style" : "",
"text" : "unpack 0. 0"
}
}
, {
"box" : {
"comment" : "",
"id" : "obj-3",
"index" : 1,
"maxclass" : "outlet",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 55.25, 365.0, 30.0, 30.0 ],
"style" : ""
}
}
, {
"box" : {
"id" : "obj-119",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 70.333336, 191.0, 41.0, 22.0 ],
"style" : "",
"text" : "round"
}
}
, {
"box" : {
"id" : "obj-118",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 2,
"outlettype" : [ "bang", "bang" ],
"patching_rect" : [ 55.25, 258.5, 29.5, 22.0 ],
"style" : "",
"text" : "b"
}
}
, {
"box" : {
"id" : "obj-114",
"maxclass" : "newobj",
"numinlets" : 3,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 55.25, 311.0, 79.0, 22.0 ],
"style" : "",
"text" : "pack 176 0 0"
}
}
, {
"box" : {
"id" : "obj-113",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "int" ],
"patching_rect" : [ 70.333336, 222.0, 33.0, 22.0 ],
"style" : "",
"text" : "int 0"
}
}
, {
"box" : {
"id" : "obj-112",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "float" ],
"patching_rect" : [ 70.333336, 154.0, 42.0, 22.0 ],
"style" : "",
"text" : "* 127."
}
}
, {
"box" : {
"comment" : "",
"id" : "obj-2",
"index" : 1,
"maxclass" : "inlet",
"numinlets" : 0,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 46.0, 9.0, 30.0, 30.0 ],
"style" : ""
}
}
],
"lines" : [ {
"patchline" : {
"destination" : [ "obj-119", 0 ],
"midpoints" : [ 79.833336, 177.0, 79.833336, 177.0 ],
"source" : [ "obj-112", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-114", 2 ],
"midpoints" : [ 79.833336, 255.0, 124.75, 255.0 ],
"order" : 0,
"source" : [ "obj-113", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-118", 0 ],
"midpoints" : [ 79.833336, 246.0, 66.0, 246.0, 66.0, 252.0, 64.75, 252.0 ],
"order" : 1,
"source" : [ "obj-113", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-3", 0 ],
"midpoints" : [ 64.75, 336.0, 64.75, 336.0 ],
"source" : [ "obj-114", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-114", 0 ],
"midpoints" : [ 64.75, 282.0, 64.75, 282.0 ],
"source" : [ "obj-118", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-113", 0 ],
"midpoints" : [ 79.833336, 216.0, 79.833336, 216.0 ],
"source" : [ "obj-119", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-4", 0 ],
"source" : [ "obj-2", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-112", 0 ],
"midpoints" : [ 104.166667, 81.0, 57.0, 81.0, 57.0, 141.0, 79.833336, 141.0 ],
"source" : [ "obj-4", 2 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-113", 0 ],
"midpoints" : [ 55.5, 216.0, 79.833336, 216.0 ],
"source" : [ "obj-4", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-7", 0 ],
"midpoints" : [ 79.833333, 81.0, 79.833336, 81.0 ],
"source" : [ "obj-4", 1 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-112", 0 ],
"midpoints" : [ 79.833336, 126.0, 79.833336, 126.0 ],
"source" : [ "obj-7", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-114", 1 ],
"midpoints" : [ 133.833336, 297.0, 94.75, 297.0 ],
"source" : [ "obj-7", 1 ]
}
}
]
}
,
"patching_rect" : [ 111.0, 490.0, 62.0, 22.0 ],
"saved_object_attributes" : {
"description" : "",
"digest" : "",
"globalpatchername" : "",
"style" : "",
"tags" : ""
}
,
"style" : "",
"text" : "p rawtocc"
}
}
, {
"box" : {
"id" : "obj-133",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 487.5, 447.0, 66.0, 22.0 ],
"style" : "",
"text" : "pack 0. 75"
}
}
, {
"box" : {
"activedialcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"activeneedlecolor" : [ 0.65098, 0.666667, 0.662745, 1.0 ],
"dialcolor" : [ 0.862745, 0.870588, 0.878431, 1.0 ],
"focusbordercolor" : [ 0.0, 0.0, 0.0, 1.0 ],
"id" : "obj-136",
"maxclass" : "live.dial",
"needlecolor" : [ 0.32549, 0.345098, 0.372549, 1.0 ],
"numinlets" : 1,
"numoutlets" : 2,
"outlettype" : [ "", "float" ],
"parameter_enable" : 1,
"patching_rect" : [ 462.5, 338.5, 44.0, 47.0 ],
"presentation" : 1,
"presentation_rect" : [ 308.0, 293.375, 44.0, 47.0 ],
"saved_attribute_attributes" : {
"valueof" : {
"parameter_linknames" : 1,
"parameter_longname" : "param6",
"parameter_shortname" : "param6",
"parameter_type" : 0,
"parameter_mmax" : 100.0,
"parameter_unitstyle" : 0
}
}
,
"textcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"tribordercolor" : [ 0.32549, 0.345098, 0.372549, 1.0 ],
"tricolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"varname" : "param6"
}
}
, {
"box" : {
"id" : "obj-137",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 410.5, 447.0, 66.0, 22.0 ],
"style" : "",
"text" : "pack 0. 74"
}
}
, {
"box" : {
"activedialcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"activeneedlecolor" : [ 0.65098, 0.666667, 0.662745, 1.0 ],
"dialcolor" : [ 0.862745, 0.870588, 0.878431, 1.0 ],
"focusbordercolor" : [ 0.0, 0.0, 0.0, 1.0 ],
"id" : "obj-139",
"maxclass" : "live.dial",
"needlecolor" : [ 0.32549, 0.345098, 0.372549, 1.0 ],
"numinlets" : 1,
"numoutlets" : 2,
"outlettype" : [ "", "float" ],
"parameter_enable" : 1,
"patching_rect" : [ 385.5, 338.5, 44.0, 47.0 ],
"presentation" : 1,
"presentation_rect" : [ 176.5, 293.375, 44.0, 47.0 ],
"saved_attribute_attributes" : {
"valueof" : {
"parameter_linknames" : 1,
"parameter_longname" : "param5",
"parameter_shortname" : "param5",
"parameter_type" : 0,
"parameter_mmax" : 100.0,
"parameter_unitstyle" : 0
}
}
,
"textcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"tribordercolor" : [ 0.32549, 0.345098, 0.372549, 1.0 ],
"tricolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"varname" : "param5"
}
}
, {
"box" : {
"id" : "obj-64",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 336.5, 447.0, 66.0, 22.0 ],
"style" : "",
"text" : "pack 0. 73"
}
}
, {
"box" : {
"activedialcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"activeneedlecolor" : [ 0.65098, 0.666667, 0.662745, 1.0 ],
"dialcolor" : [ 0.862745, 0.870588, 0.878431, 1.0 ],
"focusbordercolor" : [ 0.0, 0.0, 0.0, 1.0 ],
"id" : "obj-67",
"maxclass" : "live.dial",
"needlecolor" : [ 0.32549, 0.345098, 0.372549, 1.0 ],
"numinlets" : 1,
"numoutlets" : 2,
"outlettype" : [ "", "float" ],
"parameter_enable" : 1,
"patching_rect" : [ 311.5, 338.5, 44.0, 47.0 ],
"presentation" : 1,
"presentation_rect" : [ 46.0, 293.375, 44.0, 47.0 ],
"saved_attribute_attributes" : {
"valueof" : {
"parameter_linknames" : 1,
"parameter_longname" : "param4",
"parameter_shortname" : "param4",
"parameter_type" : 0,
"parameter_mmax" : 100.0,
"parameter_unitstyle" : 0
}
}
,
"textcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"tribordercolor" : [ 0.32549, 0.345098, 0.372549, 1.0 ],
"tricolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"varname" : "param4"
}
}
, {
"box" : {
"id" : "obj-129",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 259.5, 447.0, 66.0, 22.0 ],
"style" : "",
"text" : "pack 0. 72"
}
}
, {
"box" : {
"activedialcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"activeneedlecolor" : [ 0.65098, 0.666667, 0.662745, 1.0 ],
"dialcolor" : [ 0.862745, 0.870588, 0.878431, 1.0 ],
"focusbordercolor" : [ 0.0, 0.0, 0.0, 1.0 ],
"id" : "obj-132",
"maxclass" : "live.dial",
"needlecolor" : [ 0.32549, 0.345098, 0.372549, 1.0 ],
"numinlets" : 1,
"numoutlets" : 2,
"outlettype" : [ "", "float" ],
"parameter_enable" : 1,
"patching_rect" : [ 234.5, 338.5, 44.0, 47.0 ],
"presentation" : 1,
"presentation_rect" : [ 308.0, 227.75, 44.0, 47.0 ],
"saved_attribute_attributes" : {
"valueof" : {
"parameter_linknames" : 1,
"parameter_longname" : "param3",
"parameter_shortname" : "param3",
"parameter_type" : 0,
"parameter_mmax" : 100.0,
"parameter_unitstyle" : 0
}
}
,
"textcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"tribordercolor" : [ 0.32549, 0.345098, 0.372549, 1.0 ],
"tricolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"varname" : "param3"
}
}
, {
"box" : {
"id" : "obj-55",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 184.0, 447.0, 66.0, 22.0 ],
"style" : "",
"text" : "pack 0. 71"
}
}
, {
"box" : {
"activedialcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"activeneedlecolor" : [ 0.65098, 0.666667, 0.662745, 1.0 ],
"dialcolor" : [ 0.862745, 0.870588, 0.878431, 1.0 ],
"focusbordercolor" : [ 0.0, 0.0, 0.0, 1.0 ],
"id" : "obj-57",
"maxclass" : "live.dial",
"needlecolor" : [ 0.32549, 0.345098, 0.372549, 1.0 ],
"numinlets" : 1,
"numoutlets" : 2,
"outlettype" : [ "", "float" ],
"parameter_enable" : 1,
"patching_rect" : [ 159.0, 338.5, 44.0, 47.0 ],
"presentation" : 1,
"presentation_rect" : [ 176.5, 227.75, 44.0, 47.0 ],
"saved_attribute_attributes" : {
"valueof" : {
"parameter_linknames" : 1,
"parameter_longname" : "param2",
"parameter_shortname" : "param2",
"parameter_type" : 0,
"parameter_mmax" : 100.0,
"parameter_unitstyle" : 0
}
}
,
"textcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"tribordercolor" : [ 0.32549, 0.345098, 0.372549, 1.0 ],
"tricolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"varname" : "param2"
}
}
, {
"box" : {
"id" : "obj-30",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 111.0, 447.0, 66.0, 22.0 ],
"style" : "",
"text" : "pack 0. 70"
}
}
, {
"box" : {
"activedialcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"activeneedlecolor" : [ 0.65098, 0.666667, 0.662745, 1.0 ],
"dialcolor" : [ 0.862745, 0.870588, 0.878431, 1.0 ],
"focusbordercolor" : [ 0.0, 0.0, 0.0, 1.0 ],
"id" : "obj-10",
"maxclass" : "live.dial",
"needlecolor" : [ 0.32549, 0.345098, 0.372549, 1.0 ],
"numinlets" : 1,
"numoutlets" : 2,
"outlettype" : [ "", "float" ],
"parameter_enable" : 1,
"patching_rect" : [ 86.0, 338.5, 44.0, 47.0 ],
"presentation" : 1,
"presentation_rect" : [ 46.0, 227.75, 44.0, 47.0 ],
"saved_attribute_attributes" : {
"valueof" : {
"parameter_linknames" : 1,
"parameter_longname" : "param1",
"parameter_shortname" : "param1",
"parameter_type" : 0,
"parameter_mmax" : 100.0,
"parameter_unitstyle" : 0
}
}
,
"textcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"tribordercolor" : [ 0.32549, 0.345098, 0.372549, 1.0 ],
"tricolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"varname" : "param1"
}
}
, {
"box" : {
"angle" : 270.0,
"bgcolor" : [ 0.0, 0.0, 0.0, 1.0 ],
"border" : 1,
"bordercolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"id" : "obj-39",
"maxclass" : "panel",
"mode" : 0,
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 56.5, 303.0, 521.0, 118.0 ],
"presentation" : 1,
"presentation_rect" : [ 6.0, 181.5, 385.0, 182.5 ],
"proportion" : 0.39,
"rounded" : 16,
"style" : ""
}
}
, {
"box" : {
"id" : "obj-62",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "float" ],
"patching_rect" : [ 88.0, 1096.5, 29.5, 22.0 ],
"style" : "",
"text" : "* 2."
}
}
, {
"box" : {
"id" : "obj-61",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "float" ],
"patching_rect" : [ 88.0, 1068.0, 35.0, 22.0 ],
"style" : "",
"text" : "- 0.5"
}
}
, {
"box" : {
"id" : "obj-59",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "float" ],
"patching_rect" : [ 108.0, 785.0, 42.0, 22.0 ],
"style" : "",
"text" : "* 1.25"
}
}
, {
"box" : {
"id" : "obj-58",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "float" ],
"patching_rect" : [ 108.0, 747.0, 35.0, 22.0 ],
"style" : "",
"text" : "- 0.2"
}
}
, {
"box" : {
"id" : "obj-180",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patcher" : {
"fileversion" : 1,
"appversion" : {
"major" : 7,
"minor" : 3,
"revision" : 5,
"architecture" : "x64",
"modernui" : 1
}
,
"rect" : [ 469.0, 165.0, 640.0, 480.0 ],
"bglocked" : 0,
"openinpresentation" : 0,
"default_fontsize" : 12.0,
"default_fontface" : 0,
"default_fontname" : "Arial",
"gridonopen" : 1,
"gridsize" : [ 15.0, 15.0 ],
"gridsnaponopen" : 1,
"objectsnaponopen" : 1,
"statusbarvisible" : 2,
"toolbarvisible" : 1,
"lefttoolbarpinned" : 0,
"toptoolbarpinned" : 0,
"righttoolbarpinned" : 0,
"bottomtoolbarpinned" : 0,
"toolbars_unpinned_last_save" : 0,
"tallnewobj" : 0,
"boxanimatetime" : 200,
"enablehscroll" : 1,
"enablevscroll" : 1,
"devicewidth" : 0.0,
"description" : "",
"digest" : "",
"tags" : "",
"style" : "",
"subpatcher_template" : "",
"boxes" : [ {
"box" : {
"id" : "obj-4",
"maxclass" : "newobj",
"numinlets" : 4,
"numoutlets" : 4,
"outlettype" : [ "", "", "", "" ],
"patching_rect" : [ 46.0, 57.0, 92.0, 22.0 ],
"style" : "",
"text" : "route b list float"
}
}
, {
"box" : {
"id" : "obj-7",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 2,
"outlettype" : [ "float", "int" ],
"patching_rect" : [ 70.333336, 101.0, 73.0, 22.0 ],
"style" : "",
"text" : "unpack 0. 0"
}
}
, {
"box" : {
"comment" : "",
"id" : "obj-3",
"index" : 1,
"maxclass" : "outlet",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 55.25, 365.0, 30.0, 30.0 ],
"style" : ""
}
}
, {
"box" : {
"id" : "obj-119",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 70.333336, 191.0, 41.0, 22.0 ],
"style" : "",
"text" : "round"
}
}
, {
"box" : {
"id" : "obj-118",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 2,
"outlettype" : [ "bang", "bang" ],
"patching_rect" : [ 55.25, 258.5, 29.5, 22.0 ],
"style" : "",
"text" : "b"
}
}
, {
"box" : {
"id" : "obj-114",
"maxclass" : "newobj",
"numinlets" : 3,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 55.25, 311.0, 79.0, 22.0 ],
"style" : "",
"text" : "pack 176 0 0"
}
}
, {
"box" : {
"id" : "obj-113",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "int" ],
"patching_rect" : [ 70.333336, 222.0, 33.0, 22.0 ],
"style" : "",
"text" : "int 0"
}
}
, {
"box" : {
"id" : "obj-112",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "float" ],
"patching_rect" : [ 70.333336, 154.0, 42.0, 22.0 ],
"style" : "",
"text" : "* 127."
}
}
, {
"box" : {
"comment" : "",
"id" : "obj-2",
"index" : 1,
"maxclass" : "inlet",
"numinlets" : 0,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 46.0, 9.0, 30.0, 30.0 ],
"style" : ""
}
}
],
"lines" : [ {
"patchline" : {
"destination" : [ "obj-119", 0 ],
"midpoints" : [ 79.833336, 177.0, 79.833336, 177.0 ],
"source" : [ "obj-112", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-114", 2 ],
"midpoints" : [ 79.833336, 255.0, 124.75, 255.0 ],
"order" : 0,
"source" : [ "obj-113", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-118", 0 ],
"midpoints" : [ 79.833336, 246.0, 66.0, 246.0, 66.0, 252.0, 64.75, 252.0 ],
"order" : 1,
"source" : [ "obj-113", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-3", 0 ],
"midpoints" : [ 64.75, 336.0, 64.75, 336.0 ],
"source" : [ "obj-114", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-114", 0 ],
"midpoints" : [ 64.75, 282.0, 64.75, 282.0 ],
"source" : [ "obj-118", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-113", 0 ],
"midpoints" : [ 79.833336, 216.0, 79.833336, 216.0 ],
"source" : [ "obj-119", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-4", 0 ],
"source" : [ "obj-2", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-112", 0 ],
"midpoints" : [ 104.166667, 81.0, 57.0, 81.0, 57.0, 141.0, 79.833336, 141.0 ],
"source" : [ "obj-4", 2 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-113", 0 ],
"midpoints" : [ 55.5, 216.0, 79.833336, 216.0 ],
"source" : [ "obj-4", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-7", 0 ],
"midpoints" : [ 79.833333, 81.0, 79.833336, 81.0 ],
"source" : [ "obj-4", 1 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-112", 0 ],
"midpoints" : [ 79.833336, 126.0, 79.833336, 126.0 ],
"source" : [ "obj-7", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-114", 1 ],
"midpoints" : [ 133.833336, 297.0, 94.75, 297.0 ],
"source" : [ "obj-7", 1 ]
}
}
]
}
,
"patching_rect" : [ 17.0, 1153.5, 62.0, 22.0 ],
"saved_object_attributes" : {
"description" : "",
"digest" : "",
"globalpatchername" : "",
"style" : "",
"tags" : ""
}
,
"style" : "",
"text" : "p rawtocc"
}
}
, {
"box" : {
"id" : "obj-181",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 17.0, 1072.5, 66.0, 22.0 ],
"style" : "",
"text" : "pack 0. 94"
}
}
, {
"box" : {
"id" : "obj-179",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 2,
"outlettype" : [ "", "" ],
"patcher" : {
"fileversion" : 1,
"appversion" : {
"major" : 7,
"minor" : 3,
"revision" : 5,
"architecture" : "x64",
"modernui" : 1
}
,
"rect" : [ 418.0, 153.0, 640.0, 480.0 ],
"bglocked" : 0,
"openinpresentation" : 0,
"default_fontsize" : 12.0,
"default_fontface" : 0,
"default_fontname" : "Arial",
"gridonopen" : 1,
"gridsize" : [ 15.0, 15.0 ],
"gridsnaponopen" : 1,
"objectsnaponopen" : 1,
"statusbarvisible" : 2,
"toolbarvisible" : 1,
"lefttoolbarpinned" : 0,
"toptoolbarpinned" : 0,
"righttoolbarpinned" : 0,
"bottomtoolbarpinned" : 0,
"toolbars_unpinned_last_save" : 0,
"tallnewobj" : 0,
"boxanimatetime" : 200,
"enablehscroll" : 1,
"enablevscroll" : 1,
"devicewidth" : 0.0,
"description" : "",
"digest" : "",
"tags" : "",
"style" : "",
"subpatcher_template" : "",
"boxes" : [ {
"box" : {
"comment" : "",
"id" : "obj-3",
"index" : 1,
"maxclass" : "outlet",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 75.5, 397.0, 30.0, 30.0 ],
"style" : ""
}
}
, {
"box" : {
"comment" : "",
"id" : "obj-2",
"index" : 2,
"maxclass" : "outlet",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 177.5, 397.0, 30.0, 30.0 ],
"style" : ""
}
}
, {
"box" : {
"comment" : "",
"id" : "obj-1",
"index" : 1,
"maxclass" : "inlet",
"numinlets" : 0,
"numoutlets" : 1,
"outlettype" : [ "float" ],
"patching_rect" : [ 100.0, 92.0, 30.0, 30.0 ],
"style" : ""
}
}
, {
"box" : {
"id" : "obj-176",
"maxclass" : "message",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 200.75, 280.0, 29.5, 22.0 ],
"style" : "",
"text" : "0"
}
}
, {
"box" : {
"id" : "obj-175",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 75.5, 280.0, 104.0, 22.0 ],
"style" : "",
"text" : "if $f1 > 0 then $f1"
}
}
, {
"box" : {
"id" : "obj-171",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 3,
"outlettype" : [ "", "int", "int" ],
"patching_rect" : [ 122.5, 207.0, 63.0, 22.0 ],
"style" : "",
"text" : "change 0."
}
}
],
"lines" : [ {
"patchline" : {
"destination" : [ "obj-171", 0 ],
"source" : [ "obj-1", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-175", 0 ],
"source" : [ "obj-171", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-176", 0 ],
"source" : [ "obj-171", 2 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-3", 0 ],
"source" : [ "obj-171", 1 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-2", 0 ],
"source" : [ "obj-175", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-3", 0 ],
"source" : [ "obj-176", 0 ]
}
}
]
}
,
"patching_rect" : [ 17.0, 1040.25, 80.0, 22.0 ],
"saved_object_attributes" : {
"description" : "",
"digest" : "",
"globalpatchername" : "",
"style" : "",
"tags" : ""
}
,
"style" : "",
"text" : "p off_handler"
}
}
, {
"box" : {
"id" : "obj-178",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 2,
"outlettype" : [ "", "" ],
"patcher" : {
"fileversion" : 1,
"appversion" : {
"major" : 7,
"minor" : 3,
"revision" : 5,
"architecture" : "x64",
"modernui" : 1
}
,
"rect" : [ 418.0, 153.0, 640.0, 480.0 ],
"bglocked" : 0,
"openinpresentation" : 0,
"default_fontsize" : 12.0,
"default_fontface" : 0,
"default_fontname" : "Arial",
"gridonopen" : 1,
"gridsize" : [ 15.0, 15.0 ],
"gridsnaponopen" : 1,
"objectsnaponopen" : 1,
"statusbarvisible" : 2,
"toolbarvisible" : 1,
"lefttoolbarpinned" : 0,
"toptoolbarpinned" : 0,
"righttoolbarpinned" : 0,
"bottomtoolbarpinned" : 0,
"toolbars_unpinned_last_save" : 0,
"tallnewobj" : 0,
"boxanimatetime" : 200,
"enablehscroll" : 1,
"enablevscroll" : 1,
"devicewidth" : 0.0,
"description" : "",
"digest" : "",
"tags" : "",
"style" : "",
"subpatcher_template" : "",
"boxes" : [ {
"box" : {
"comment" : "",
"id" : "obj-3",
"index" : 1,
"maxclass" : "outlet",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 75.5, 397.0, 30.0, 30.0 ],
"style" : ""
}
}
, {
"box" : {
"comment" : "",
"id" : "obj-2",
"index" : 2,
"maxclass" : "outlet",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 177.5, 397.0, 30.0, 30.0 ],
"style" : ""
}
}
, {
"box" : {
"comment" : "",
"id" : "obj-1",
"index" : 1,
"maxclass" : "inlet",
"numinlets" : 0,
"numoutlets" : 1,
"outlettype" : [ "float" ],
"patching_rect" : [ 100.0, 92.0, 30.0, 30.0 ],
"style" : ""
}
}
, {
"box" : {
"id" : "obj-176",
"maxclass" : "message",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 200.75, 280.0, 29.5, 22.0 ],
"style" : "",
"text" : "0"
}
}
, {
"box" : {
"id" : "obj-175",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 75.5, 280.0, 104.0, 22.0 ],
"style" : "",
"text" : "if $f1 > 0 then $f1"
}
}
, {
"box" : {
"id" : "obj-171",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 3,
"outlettype" : [ "", "int", "int" ],
"patching_rect" : [ 122.5, 207.0, 63.0, 22.0 ],
"style" : "",
"text" : "change 0."
}
}
],
"lines" : [ {
"patchline" : {
"destination" : [ "obj-171", 0 ],
"source" : [ "obj-1", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-175", 0 ],
"source" : [ "obj-171", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-176", 0 ],
"source" : [ "obj-171", 2 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-3", 0 ],
"source" : [ "obj-171", 1 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-2", 0 ],
"source" : [ "obj-175", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-3", 0 ],
"source" : [ "obj-176", 0 ]
}
}
]
}
,
"patching_rect" : [ 28.0, 714.25, 80.0, 22.0 ],
"saved_object_attributes" : {
"description" : "",
"digest" : "",
"globalpatchername" : "",
"style" : "",
"tags" : ""
}
,
"style" : "",
"text" : "p off_handler"
}
}
, {
"box" : {
"id" : "obj-138",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patcher" : {
"fileversion" : 1,
"appversion" : {
"major" : 7,
"minor" : 3,
"revision" : 5,
"architecture" : "x64",
"modernui" : 1
}
,
"rect" : [ 469.0, 165.0, 640.0, 480.0 ],
"bglocked" : 0,
"openinpresentation" : 0,
"default_fontsize" : 12.0,
"default_fontface" : 0,
"default_fontname" : "Arial",
"gridonopen" : 1,
"gridsize" : [ 15.0, 15.0 ],
"gridsnaponopen" : 1,
"objectsnaponopen" : 1,
"statusbarvisible" : 2,
"toolbarvisible" : 1,
"lefttoolbarpinned" : 0,
"toptoolbarpinned" : 0,
"righttoolbarpinned" : 0,
"bottomtoolbarpinned" : 0,
"toolbars_unpinned_last_save" : 0,
"tallnewobj" : 0,
"boxanimatetime" : 200,
"enablehscroll" : 1,
"enablevscroll" : 1,
"devicewidth" : 0.0,
"description" : "",
"digest" : "",
"tags" : "",
"style" : "",
"subpatcher_template" : "",
"boxes" : [ {
"box" : {
"id" : "obj-4",
"maxclass" : "newobj",
"numinlets" : 4,
"numoutlets" : 4,
"outlettype" : [ "", "", "", "" ],
"patching_rect" : [ 46.0, 57.0, 92.0, 22.0 ],
"style" : "",
"text" : "route b list float"
}
}
, {
"box" : {
"id" : "obj-7",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 2,
"outlettype" : [ "float", "int" ],
"patching_rect" : [ 70.333336, 101.0, 73.0, 22.0 ],
"style" : "",
"text" : "unpack 0. 0"
}
}
, {
"box" : {
"comment" : "",
"id" : "obj-3",
"index" : 1,
"maxclass" : "outlet",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 55.25, 365.0, 30.0, 30.0 ],
"style" : ""
}
}
, {
"box" : {
"id" : "obj-119",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 70.333336, 191.0, 41.0, 22.0 ],
"style" : "",
"text" : "round"
}
}
, {
"box" : {
"id" : "obj-118",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 2,
"outlettype" : [ "bang", "bang" ],
"patching_rect" : [ 55.25, 258.5, 29.5, 22.0 ],
"style" : "",
"text" : "b"
}
}
, {
"box" : {
"id" : "obj-114",
"maxclass" : "newobj",
"numinlets" : 3,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 55.25, 311.0, 79.0, 22.0 ],
"style" : "",
"text" : "pack 176 0 0"
}
}
, {
"box" : {
"id" : "obj-113",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "int" ],
"patching_rect" : [ 70.333336, 222.0, 33.0, 22.0 ],
"style" : "",
"text" : "int 0"
}
}
, {
"box" : {
"id" : "obj-112",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "float" ],
"patching_rect" : [ 70.333336, 154.0, 42.0, 22.0 ],
"style" : "",
"text" : "* 127."
}
}
, {
"box" : {
"comment" : "",
"id" : "obj-2",
"index" : 1,
"maxclass" : "inlet",
"numinlets" : 0,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 46.0, 9.0, 30.0, 30.0 ],
"style" : ""
}
}
],
"lines" : [ {
"patchline" : {
"destination" : [ "obj-119", 0 ],
"midpoints" : [ 79.833336, 177.0, 79.833336, 177.0 ],
"source" : [ "obj-112", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-114", 2 ],
"midpoints" : [ 79.833336, 255.0, 124.75, 255.0 ],
"order" : 0,
"source" : [ "obj-113", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-118", 0 ],
"midpoints" : [ 79.833336, 246.0, 66.0, 246.0, 66.0, 252.0, 64.75, 252.0 ],
"order" : 1,
"source" : [ "obj-113", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-3", 0 ],
"midpoints" : [ 64.75, 336.0, 64.75, 336.0 ],
"source" : [ "obj-114", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-114", 0 ],
"midpoints" : [ 64.75, 282.0, 64.75, 282.0 ],
"source" : [ "obj-118", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-113", 0 ],
"midpoints" : [ 79.833336, 216.0, 79.833336, 216.0 ],
"source" : [ "obj-119", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-4", 0 ],
"source" : [ "obj-2", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-112", 0 ],
"midpoints" : [ 104.166667, 81.0, 57.0, 81.0, 57.0, 141.0, 79.833336, 141.0 ],
"source" : [ "obj-4", 2 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-113", 0 ],
"midpoints" : [ 55.5, 216.0, 79.833336, 216.0 ],
"source" : [ "obj-4", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-7", 0 ],
"midpoints" : [ 79.833333, 81.0, 79.833336, 81.0 ],
"source" : [ "obj-4", 1 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-112", 0 ],
"midpoints" : [ 79.833336, 126.0, 79.833336, 126.0 ],
"source" : [ "obj-7", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-114", 1 ],
"midpoints" : [ 133.833336, 297.0, 94.75, 297.0 ],
"source" : [ "obj-7", 1 ]
}
}
]
}
,
"patching_rect" : [ 28.0, 859.0, 62.0, 22.0 ],
"saved_object_attributes" : {
"description" : "",
"digest" : "",
"globalpatchername" : "",
"style" : "",
"tags" : ""
}
,
"style" : "",
"text" : "p rawtocc"
}
}
, {
"box" : {
"id" : "obj-84",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 28.0, 747.0, 66.0, 22.0 ],
"style" : "",
"text" : "pack 0. 92"
}
}
, {
"box" : {
"id" : "obj-83",
"maxclass" : "newobj",
"numinlets" : 0,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 490.0, -17.0, 97.0, 22.0 ],
"style" : "",
"text" : "r portamento_cc"
}
}
, {
"box" : {
"id" : "obj-68",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 525.0, 151.0, 59.0, 22.0 ],
"style" : "",
"text" : "pack 0. 5"
}
}
, {
"box" : {
"id" : "obj-34",
"maxclass" : "live.slider",
"modulationcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"numinlets" : 1,
"numoutlets" : 2,
"outlettype" : [ "", "float" ],
"parameter_enable" : 1,
"patching_rect" : [ 538.5, 23.0, 39.0, 95.0 ],
"presentation" : 1,
"presentation_rect" : [ 424.0, 227.75, 70.0, 133.0 ],
"saved_attribute_attributes" : {
"valueof" : {
"parameter_longname" : "portamento",
"parameter_shortname" : "portamento",
"parameter_type" : 1,
"parameter_unitstyle" : 0
}
}
,
"slidercolor" : [ 0.65098, 0.666667, 0.662745, 1.0 ],
"textcolor" : [ 0.862745, 0.870588, 0.878431, 1.0 ],
"tricolor" : [ 0.862745, 0.870588, 0.878431, 1.0 ],
"trioncolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"varname" : "portamento"
}
}
, {
"box" : {
"id" : "obj-258",
"maxclass" : "newobj",
"numinlets" : 0,
"numoutlets" : 5,
"outlettype" : [ "", "", "", "", "" ],
"patcher" : {
"fileversion" : 1,
"appversion" : {
"major" : 7,
"minor" : 3,
"revision" : 5,
"architecture" : "x64",
"modernui" : 1
}
,
"rect" : [ 567.0, 216.0, 640.0, 480.0 ],
"bglocked" : 0,
"openinpresentation" : 0,
"default_fontsize" : 12.0,
"default_fontface" : 0,
"default_fontname" : "Arial",
"gridonopen" : 1,
"gridsize" : [ 15.0, 15.0 ],
"gridsnaponopen" : 1,
"objectsnaponopen" : 1,
"statusbarvisible" : 2,
"toolbarvisible" : 1,
"lefttoolbarpinned" : 0,
"toptoolbarpinned" : 0,
"righttoolbarpinned" : 0,
"bottomtoolbarpinned" : 0,
"toolbars_unpinned_last_save" : 0,
"tallnewobj" : 0,
"boxanimatetime" : 200,
"enablehscroll" : 1,
"enablevscroll" : 1,
"devicewidth" : 0.0,
"description" : "",
"digest" : "",
"tags" : "",
"style" : "",
"subpatcher_template" : "",
"boxes" : [ {
"box" : {
"id" : "obj-17",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 529.0, 222.0, 41.0, 22.0 ],
"style" : "",
"text" : "round"
}
}
, {
"box" : {
"id" : "obj-18",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "float" ],
"patching_rect" : [ 529.0, 173.0, 29.5, 22.0 ],
"style" : "",
"text" : "* 2."
}
}
, {
"box" : {
"id" : "obj-19",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "float" ],
"patching_rect" : [ 529.0, 126.0, 41.0, 22.0 ],
"style" : "",
"text" : "/ 127."
}
}
, {
"box" : {
"id" : "obj-14",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 160.0, 237.0, 41.0, 22.0 ],
"style" : "",
"text" : "round"
}
}
, {
"box" : {
"id" : "obj-15",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "float" ],
"patching_rect" : [ 160.0, 188.0, 29.5, 22.0 ],
"style" : "",
"text" : "* 2."
}
}
, {
"box" : {
"id" : "obj-16",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "float" ],
"patching_rect" : [ 160.0, 141.0, 41.0, 22.0 ],
"style" : "",
"text" : "/ 127."
}
}
, {
"box" : {
"id" : "obj-13",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 42.0, 229.0, 41.0, 22.0 ],
"style" : "",
"text" : "round"
}
}
, {
"box" : {
"id" : "obj-12",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "float" ],
"patching_rect" : [ 42.0, 180.0, 29.5, 22.0 ],
"style" : "",
"text" : "* 2."
}
}
, {
"box" : {
"id" : "obj-11",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "float" ],
"patching_rect" : [ 42.0, 133.0, 41.0, 22.0 ],
"style" : "",
"text" : "/ 127."
}
}
, {
"box" : {
"comment" : "",
"id" : "obj-9",
"index" : 5,
"maxclass" : "outlet",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 529.0, 307.0, 30.0, 30.0 ],
"style" : ""
}
}
, {
"box" : {
"id" : "obj-10",
"maxclass" : "newobj",
"numinlets" : 0,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 529.0, 85.0, 87.0, 22.0 ],
"style" : "",
"text" : "r lfo_target_cc"
}
}
, {
"box" : {
"comment" : "",
"id" : "obj-8",
"index" : 4,
"maxclass" : "outlet",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 398.0, 307.0, 30.0, 30.0 ],
"style" : ""
}
}
, {
"box" : {
"comment" : "",
"id" : "obj-7",
"index" : 3,
"maxclass" : "outlet",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 279.0, 307.0, 30.0, 30.0 ],
"style" : ""
}
}
, {
"box" : {
"comment" : "",
"id" : "obj-6",
"index" : 2,
"maxclass" : "outlet",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 160.0, 307.0, 30.0, 30.0 ],
"style" : ""
}
}
, {
"box" : {
"comment" : "",
"id" : "obj-5",
"index" : 1,
"maxclass" : "outlet",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 42.0, 307.0, 30.0, 30.0 ],
"style" : ""
}
}
, {
"box" : {
"id" : "obj-4",
"maxclass" : "newobj",
"numinlets" : 0,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 398.0, 85.0, 69.0, 22.0 ],
"style" : "",
"text" : "r lfo_int_cc"
}
}
, {
"box" : {
"id" : "obj-3",
"maxclass" : "newobj",
"numinlets" : 0,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 279.0, 85.0, 77.0, 22.0 ],
"style" : "",
"text" : "r lfo_rate_cc"
}
}
, {
"box" : {
"id" : "obj-2",
"maxclass" : "newobj",
"numinlets" : 0,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 160.0, 85.0, 86.0, 22.0 ],
"style" : "",
"text" : "r lfo_mode_cc"
}
}
, {
"box" : {
"id" : "obj-1",
"maxclass" : "newobj",
"numinlets" : 0,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 42.0, 85.0, 84.0, 22.0 ],
"style" : "",
"text" : "r lfo_wave_cc"
}
}
],
"lines" : [ {
"patchline" : {
"destination" : [ "obj-11", 0 ],
"source" : [ "obj-1", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-19", 0 ],
"source" : [ "obj-10", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-12", 0 ],
"source" : [ "obj-11", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-13", 0 ],
"source" : [ "obj-12", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-5", 0 ],
"source" : [ "obj-13", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-6", 0 ],
"source" : [ "obj-14", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-14", 0 ],
"source" : [ "obj-15", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-15", 0 ],
"source" : [ "obj-16", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-9", 0 ],
"source" : [ "obj-17", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-17", 0 ],
"source" : [ "obj-18", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-18", 0 ],
"source" : [ "obj-19", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-16", 0 ],
"source" : [ "obj-2", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-7", 0 ],
"source" : [ "obj-3", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-8", 0 ],
"source" : [ "obj-4", 0 ]
}
}
]
}
,
"patching_rect" : [ 19.0, 1452.0, 75.0, 22.0 ],
"saved_object_attributes" : {
"description" : "",
"digest" : "",
"globalpatchername" : "",
"style" : "",
"tags" : ""
}
,
"style" : "",
"text" : "p rec_lfo_cc"
}
}
, {
"box" : {
"id" : "obj-257",
"maxclass" : "newobj",
"numinlets" : 0,
"numoutlets" : 4,
"outlettype" : [ "", "", "", "" ],
"patcher" : {
"fileversion" : 1,
"appversion" : {
"major" : 7,
"minor" : 3,
"revision" : 5,
"architecture" : "x64",
"modernui" : 1
}
,
"rect" : [ 567.0, 216.0, 640.0, 480.0 ],
"bglocked" : 0,
"openinpresentation" : 0,
"default_fontsize" : 12.0,
"default_fontface" : 0,
"default_fontname" : "Arial",
"gridonopen" : 1,
"gridsize" : [ 15.0, 15.0 ],
"gridsnaponopen" : 1,
"objectsnaponopen" : 1,
"statusbarvisible" : 2,
"toolbarvisible" : 1,
"lefttoolbarpinned" : 0,
"toptoolbarpinned" : 0,
"righttoolbarpinned" : 0,
"bottomtoolbarpinned" : 0,
"toolbars_unpinned_last_save" : 0,
"tallnewobj" : 0,
"boxanimatetime" : 200,
"enablehscroll" : 1,
"enablevscroll" : 1,
"devicewidth" : 0.0,
"description" : "",
"digest" : "",
"tags" : "",
"style" : "",
"subpatcher_template" : "",
"boxes" : [ {
"box" : {
"comment" : "",
"id" : "obj-8",
"index" : 4,
"maxclass" : "outlet",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 398.0, 307.0, 30.0, 30.0 ],
"style" : ""
}
}
, {
"box" : {
"comment" : "",
"id" : "obj-7",
"index" : 3,
"maxclass" : "outlet",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 279.0, 307.0, 30.0, 30.0 ],
"style" : ""
}
}
, {
"box" : {
"comment" : "",
"id" : "obj-6",
"index" : 2,
"maxclass" : "outlet",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 160.0, 307.0, 30.0, 30.0 ],
"style" : ""
}
}
, {
"box" : {
"comment" : "",
"id" : "obj-5",
"index" : 1,
"maxclass" : "outlet",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 42.0, 307.0, 30.0, 30.0 ],
"style" : ""
}
}
, {
"box" : {
"id" : "obj-4",
"maxclass" : "newobj",
"numinlets" : 0,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 398.0, 85.0, 119.0, 22.0 ],
"style" : "",
"text" : "r ampeg_release_cc"
}
}
, {
"box" : {
"id" : "obj-3",
"maxclass" : "newobj",
"numinlets" : 0,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 279.0, 85.0, 118.0, 22.0 ],
"style" : "",
"text" : "r ampeg_sustain_cc"
}
}
, {
"box" : {
"id" : "obj-2",
"maxclass" : "newobj",
"numinlets" : 0,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 160.0, 85.0, 112.0, 22.0 ],
"style" : "",
"text" : "r ampeg_decay_cc"
}
}
, {
"box" : {
"id" : "obj-1",
"maxclass" : "newobj",
"numinlets" : 0,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 42.0, 85.0, 112.0, 22.0 ],
"style" : "",
"text" : "r ampeg_attack_cc"
}
}
],
"lines" : [ {
"patchline" : {
"destination" : [ "obj-5", 0 ],
"source" : [ "obj-1", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-6", 0 ],
"source" : [ "obj-2", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-7", 0 ],
"source" : [ "obj-3", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-8", 0 ],
"source" : [ "obj-4", 0 ]
}
}
]
}
,
"patching_rect" : [ 27.0, 1194.0, 99.0, 22.0 ],
"saved_object_attributes" : {
"description" : "",
"digest" : "",
"globalpatchername" : "",
"style" : "",
"tags" : ""
}
,
"style" : "",
"text" : "p rec_ampeg_cc"
}
}
, {
"box" : {
"id" : "obj-256",
"maxclass" : "newobj",
"numinlets" : 0,
"numoutlets" : 4,
"outlettype" : [ "", "", "", "" ],
"patcher" : {
"fileversion" : 1,
"appversion" : {
"major" : 7,
"minor" : 3,
"revision" : 5,
"architecture" : "x64",
"modernui" : 1
}
,
"rect" : [ 567.0, 216.0, 640.0, 480.0 ],
"bglocked" : 0,
"openinpresentation" : 0,
"default_fontsize" : 12.0,
"default_fontface" : 0,
"default_fontname" : "Arial",
"gridonopen" : 1,
"gridsize" : [ 15.0, 15.0 ],
"gridsnaponopen" : 1,
"objectsnaponopen" : 1,
"statusbarvisible" : 2,
"toolbarvisible" : 1,
"lefttoolbarpinned" : 0,
"toptoolbarpinned" : 0,
"righttoolbarpinned" : 0,
"bottomtoolbarpinned" : 0,
"toolbars_unpinned_last_save" : 0,
"tallnewobj" : 0,
"boxanimatetime" : 200,
"enablehscroll" : 1,
"enablevscroll" : 1,
"devicewidth" : 0.0,
"description" : "",
"digest" : "",
"tags" : "",
"style" : "",
"subpatcher_template" : "",
"boxes" : [ {
"box" : {
"id" : "obj-12",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 150.0, 247.0, 41.0, 22.0 ],
"style" : "",
"text" : "round"
}
}
, {
"box" : {
"id" : "obj-13",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "float" ],
"patching_rect" : [ 150.0, 200.0, 35.0, 22.0 ],
"style" : "",
"text" : "* 20."
}
}
, {
"box" : {
"id" : "obj-14",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "float" ],
"patching_rect" : [ 150.0, 148.0, 41.0, 22.0 ],
"style" : "",
"text" : "/ 127."
}
}
, {
"box" : {
"id" : "obj-11",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 42.0, 252.0, 41.0, 22.0 ],
"style" : "",
"text" : "round"
}
}
, {
"box" : {
"id" : "obj-10",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "float" ],
"patching_rect" : [ 42.0, 205.0, 29.5, 22.0 ],
"style" : "",
"text" : "* 2."
}
}
, {
"box" : {
"id" : "obj-9",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "float" ],
"patching_rect" : [ 42.0, 153.0, 41.0, 22.0 ],
"style" : "",
"text" : "/ 127."
}
}
, {
"box" : {
"comment" : "",
"id" : "obj-8",
"index" : 4,
"maxclass" : "outlet",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 398.0, 307.0, 30.0, 30.0 ],
"style" : ""
}
}
, {
"box" : {
"comment" : "",
"id" : "obj-7",
"index" : 3,
"maxclass" : "outlet",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 279.0, 307.0, 30.0, 30.0 ],
"style" : ""
}
}
, {
"box" : {
"comment" : "",
"id" : "obj-6",
"index" : 2,
"maxclass" : "outlet",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 150.0, 307.0, 30.0, 30.0 ],
"style" : ""
}
}
, {
"box" : {
"comment" : "",
"id" : "obj-5",
"index" : 1,
"maxclass" : "outlet",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 42.0, 307.0, 30.0, 30.0 ],
"style" : ""
}
}
, {
"box" : {
"id" : "obj-4",
"maxclass" : "newobj",
"numinlets" : 0,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 398.0, 85.0, 106.0, 22.0 ],
"style" : "",
"text" : "r delrev_depth_cc"
}
}
, {
"box" : {
"id" : "obj-3",
"maxclass" : "newobj",
"numinlets" : 0,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 279.0, 85.0, 99.0, 22.0 ],
"style" : "",
"text" : "r delrev_time_cc"
}
}
, {
"box" : {
"id" : "obj-2",
"maxclass" : "newobj",
"numinlets" : 0,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 150.0, 85.0, 118.0, 22.0 ],
"style" : "",
"text" : "r delrev_subtype_cc"
}
}
, {
"box" : {
"id" : "obj-1",
"maxclass" : "newobj",
"numinlets" : 0,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 42.0, 85.0, 99.0, 22.0 ],
"style" : "",
"text" : "r delrev_type_cc"
}
}
],
"lines" : [ {
"patchline" : {
"destination" : [ "obj-9", 0 ],
"source" : [ "obj-1", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-11", 0 ],
"source" : [ "obj-10", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-5", 0 ],
"source" : [ "obj-11", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-6", 0 ],
"source" : [ "obj-12", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-12", 0 ],
"source" : [ "obj-13", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-13", 0 ],
"source" : [ "obj-14", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-14", 0 ],
"source" : [ "obj-2", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-7", 0 ],
"source" : [ "obj-3", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-8", 0 ],
"source" : [ "obj-4", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-10", 0 ],
"source" : [ "obj-9", 0 ]
}
}
]
}
,
"patching_rect" : [ 23.0, 897.0, 95.0, 22.0 ],
"saved_object_attributes" : {
"description" : "",
"digest" : "",
"globalpatchername" : "",
"style" : "",
"tags" : ""
}
,
"style" : "",
"text" : "p rec_delrev_cc"
}
}
, {
"box" : {
"id" : "obj-255",
"maxclass" : "newobj",
"numinlets" : 0,
"numoutlets" : 4,
"outlettype" : [ "", "", "", "" ],
"patcher" : {
"fileversion" : 1,
"appversion" : {
"major" : 7,
"minor" : 3,
"revision" : 5,
"architecture" : "x64",
"modernui" : 1
}
,
"rect" : [ 567.0, 216.0, 640.0, 480.0 ],
"bglocked" : 0,
"openinpresentation" : 0,
"default_fontsize" : 12.0,
"default_fontface" : 0,
"default_fontname" : "Arial",
"gridonopen" : 1,
"gridsize" : [ 15.0, 15.0 ],
"gridsnaponopen" : 1,
"objectsnaponopen" : 1,
"statusbarvisible" : 2,
"toolbarvisible" : 1,
"lefttoolbarpinned" : 0,
"toptoolbarpinned" : 0,
"righttoolbarpinned" : 0,
"bottomtoolbarpinned" : 0,
"toolbars_unpinned_last_save" : 0,
"tallnewobj" : 0,
"boxanimatetime" : 200,
"enablehscroll" : 1,
"enablevscroll" : 1,
"devicewidth" : 0.0,
"description" : "",
"digest" : "",
"tags" : "",
"style" : "",
"subpatcher_template" : "",
"boxes" : [ {
"box" : {
"id" : "obj-12",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 150.0, 247.0, 41.0, 22.0 ],
"style" : "",
"text" : "round"
}
}
, {
"box" : {
"id" : "obj-13",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "float" ],
"patching_rect" : [ 150.0, 200.0, 35.0, 22.0 ],
"style" : "",
"text" : "* 15."
}
}
, {
"box" : {
"id" : "obj-14",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "float" ],
"patching_rect" : [ 150.0, 148.0, 41.0, 22.0 ],
"style" : "",
"text" : "/ 127."
}
}
, {
"box" : {
"id" : "obj-11",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 42.0, 252.0, 41.0, 22.0 ],
"style" : "",
"text" : "round"
}
}
, {
"box" : {
"id" : "obj-10",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "float" ],
"patching_rect" : [ 42.0, 205.0, 29.5, 22.0 ],
"style" : "",
"text" : "* 6."
}
}
, {
"box" : {
"id" : "obj-9",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "float" ],
"patching_rect" : [ 42.0, 153.0, 41.0, 22.0 ],
"style" : "",
"text" : "/ 127."
}
}
, {
"box" : {
"comment" : "",
"id" : "obj-8",
"index" : 4,
"maxclass" : "outlet",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 398.0, 307.0, 30.0, 30.0 ],
"style" : ""
}
}
, {
"box" : {
"comment" : "",
"id" : "obj-7",
"index" : 3,
"maxclass" : "outlet",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 279.0, 307.0, 30.0, 30.0 ],
"style" : ""
}
}
, {
"box" : {
"comment" : "",
"id" : "obj-6",
"index" : 2,
"maxclass" : "outlet",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 150.0, 307.0, 30.0, 30.0 ],
"style" : ""
}
}
, {
"box" : {
"comment" : "",
"id" : "obj-5",
"index" : 1,
"maxclass" : "outlet",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 42.0, 307.0, 30.0, 30.0 ],
"style" : ""
}
}
, {
"box" : {
"id" : "obj-4",
"maxclass" : "newobj",
"numinlets" : 0,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 398.0, 85.0, 106.0, 22.0 ],
"style" : "",
"text" : "r modfx_depth_cc"
}
}
, {
"box" : {
"id" : "obj-3",
"maxclass" : "newobj",
"numinlets" : 0,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 279.0, 85.0, 109.0, 22.0 ],
"style" : "",
"text" : "r modfx_speed_cc"
}
}
, {
"box" : {
"id" : "obj-2",
"maxclass" : "newobj",
"numinlets" : 0,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 150.0, 85.0, 118.0, 22.0 ],
"style" : "",
"text" : "r modfx_subtype_cc"
}
}
, {
"box" : {
"id" : "obj-1",
"maxclass" : "newobj",
"numinlets" : 0,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 42.0, 85.0, 99.0, 22.0 ],
"style" : "",
"text" : "r modfx_type_cc"
}
}
],
"lines" : [ {
"patchline" : {
"destination" : [ "obj-9", 0 ],
"source" : [ "obj-1", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-11", 0 ],
"source" : [ "obj-10", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-5", 0 ],
"source" : [ "obj-11", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-6", 0 ],
"source" : [ "obj-12", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-12", 0 ],
"source" : [ "obj-13", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-13", 0 ],
"source" : [ "obj-14", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-14", 0 ],
"source" : [ "obj-2", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-7", 0 ],
"source" : [ "obj-3", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-8", 0 ],
"source" : [ "obj-4", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-10", 0 ],
"source" : [ "obj-9", 0 ]
}
}
]
}
,
"patching_rect" : [ 98.0, 541.0, 95.0, 22.0 ],
"saved_object_attributes" : {
"description" : "",
"digest" : "",
"globalpatchername" : "",
"style" : "",
"tags" : ""
}
,
"style" : "",
"text" : "p rec_modfx_cc"
}
}
, {
"box" : {
"id" : "obj-254",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 0,
"patcher" : {
"fileversion" : 1,
"appversion" : {
"major" : 7,
"minor" : 3,
"revision" : 5,
"architecture" : "x64",
"modernui" : 1
}
,
"rect" : [ 274.0, 122.0, 1505.0, 770.0 ],
"bglocked" : 0,
"openinpresentation" : 0,
"default_fontsize" : 12.0,
"default_fontface" : 0,
"default_fontname" : "Arial",
"gridonopen" : 1,
"gridsize" : [ 15.0, 15.0 ],
"gridsnaponopen" : 1,
"objectsnaponopen" : 1,
"statusbarvisible" : 2,
"toolbarvisible" : 1,
"lefttoolbarpinned" : 0,
"toptoolbarpinned" : 0,
"righttoolbarpinned" : 0,
"bottomtoolbarpinned" : 0,
"toolbars_unpinned_last_save" : 0,
"tallnewobj" : 0,
"boxanimatetime" : 200,
"enablehscroll" : 1,
"enablevscroll" : 1,
"devicewidth" : 0.0,
"description" : "",
"digest" : "",
"tags" : "",
"style" : "",
"subpatcher_template" : "",
"boxes" : [ {
"box" : {
"id" : "obj-29",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 1206.0, 255.0, 61.0, 22.0 ],
"style" : "",
"text" : "s param6"
}
}
, {
"box" : {
"id" : "obj-28",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 1141.0, 255.0, 61.0, 22.0 ],
"style" : "",
"text" : "s param5"
}
}
, {
"box" : {
"id" : "obj-27",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 1075.0, 255.0, 61.0, 22.0 ],
"style" : "",
"text" : "s param4"
}
}
, {
"box" : {
"id" : "obj-9",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 1007.5, 255.0, 61.0, 22.0 ],
"style" : "",
"text" : "s param3"
}
}
, {
"box" : {
"id" : "obj-7",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 940.5, 255.0, 61.0, 22.0 ],
"style" : "",
"text" : "s param2"
}
}
, {
"box" : {
"id" : "obj-3",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 876.0, 255.0, 61.0, 22.0 ],
"style" : "",
"text" : "s param1"
}
}
, {
"box" : {
"id" : "obj-62",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 116.0, 618.0, 99.0, 22.0 ],
"style" : "",
"text" : "s portamento_cc"
}
}
, {
"box" : {
"id" : "obj-61",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patcher" : {
"fileversion" : 1,
"appversion" : {
"major" : 7,
"minor" : 3,
"revision" : 5,
"architecture" : "x64",
"modernui" : 1
}
,
"rect" : [ 59.0, 103.0, 640.0, 480.0 ],
"bglocked" : 0,
"openinpresentation" : 0,
"default_fontsize" : 12.0,
"default_fontface" : 0,
"default_fontname" : "Arial",
"gridonopen" : 1,
"gridsize" : [ 15.0, 15.0 ],
"gridsnaponopen" : 1,
"objectsnaponopen" : 1,
"statusbarvisible" : 2,
"toolbarvisible" : 1,
"lefttoolbarpinned" : 0,
"toptoolbarpinned" : 0,
"righttoolbarpinned" : 0,
"bottomtoolbarpinned" : 0,
"toolbars_unpinned_last_save" : 0,
"tallnewobj" : 0,
"boxanimatetime" : 200,
"enablehscroll" : 1,
"enablevscroll" : 1,
"devicewidth" : 0.0,
"description" : "",
"digest" : "",
"tags" : "",
"style" : "",
"subpatcher_template" : "",
"boxes" : [ {
"box" : {
"id" : "obj-4",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 142.0, 233.0, 41.0, 22.0 ],
"style" : "",
"text" : "round"
}
}
, {
"box" : {
"id" : "obj-3",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 2,
"outlettype" : [ "", "" ],
"patching_rect" : [ 142.0, 105.0, 48.0, 22.0 ],
"style" : "",
"text" : "route b"
}
}
, {
"box" : {
"comment" : "",
"id" : "obj-2",
"index" : 1,
"maxclass" : "outlet",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 142.0, 276.0, 30.0, 30.0 ],
"style" : ""
}
}
, {
"box" : {
"id" : "obj-30",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 221.0, 218.0, 159.0, 22.0 ],
"style" : "",
"text" : "if $f1 > 127. then 0. else $f1"
}
}
, {
"box" : {
"id" : "obj-29",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "float" ],
"patching_rect" : [ 221.0, 184.0, 44.0, 22.0 ],
"style" : "",
"text" : "+ 63.5"
}
}
, {
"box" : {
"id" : "obj-28",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "float" ],
"patching_rect" : [ 142.0, 193.0, 43.0, 22.0 ],
"style" : "",
"text" : "float 0"
}
}
, {
"box" : {
"id" : "obj-27",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 142.0, 155.0, 113.0, 22.0 ],
"style" : "",
"text" : "if $i1 > 0 then bang"
}
}
, {
"box" : {
"comment" : "",
"id" : "obj-1",
"index" : 1,
"maxclass" : "inlet",
"numinlets" : 0,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 142.0, 56.0, 30.0, 30.0 ],
"style" : ""
}
}
],
"lines" : [ {
"patchline" : {
"destination" : [ "obj-3", 0 ],
"source" : [ "obj-1", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-28", 0 ],
"source" : [ "obj-27", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-29", 0 ],
"order" : 0,
"source" : [ "obj-28", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-4", 0 ],
"order" : 1,
"source" : [ "obj-28", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-30", 0 ],
"source" : [ "obj-29", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-27", 0 ],
"source" : [ "obj-3", 1 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-28", 0 ],
"source" : [ "obj-3", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-28", 1 ],
"source" : [ "obj-30", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-2", 0 ],
"source" : [ "obj-4", 0 ]
}
}
]
}
,
"patching_rect" : [ 839.5, 387.5, 55.0, 22.0 ],
"saved_object_attributes" : {
"description" : "",
"digest" : "",
"globalpatchername" : "",
"style" : "",
"tags" : ""
}
,
"style" : "",
"text" : "p cycle3"
}
}
, {
"box" : {
"id" : "obj-59",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 827.0, 559.0, 69.0, 22.0 ],
"style" : "",
"text" : "s seq_stop"
}
}
, {
"box" : {
"id" : "obj-58",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 724.0, 559.0, 69.0, 22.0 ],
"style" : "",
"text" : "s seq_start"
}
}
, {
"box" : {
"id" : "obj-56",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 1130.5, 449.5, 89.0, 22.0 ],
"style" : "",
"text" : "s lfo_target_cc"
}
}
, {
"box" : {
"id" : "obj-55",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patcher" : {
"fileversion" : 1,
"appversion" : {
"major" : 7,
"minor" : 3,
"revision" : 5,
"architecture" : "x64",
"modernui" : 1
}
,
"rect" : [ 59.0, 103.0, 640.0, 480.0 ],
"bglocked" : 0,
"openinpresentation" : 0,
"default_fontsize" : 12.0,
"default_fontface" : 0,
"default_fontname" : "Arial",
"gridonopen" : 1,
"gridsize" : [ 15.0, 15.0 ],
"gridsnaponopen" : 1,
"objectsnaponopen" : 1,
"statusbarvisible" : 2,
"toolbarvisible" : 1,
"lefttoolbarpinned" : 0,
"toptoolbarpinned" : 0,
"righttoolbarpinned" : 0,
"bottomtoolbarpinned" : 0,
"toolbars_unpinned_last_save" : 0,
"tallnewobj" : 0,
"boxanimatetime" : 200,
"enablehscroll" : 1,
"enablevscroll" : 1,
"devicewidth" : 0.0,
"description" : "",
"digest" : "",
"tags" : "",
"style" : "",
"subpatcher_template" : "",
"boxes" : [ {
"box" : {
"id" : "obj-4",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 142.0, 233.0, 41.0, 22.0 ],
"style" : "",
"text" : "round"
}
}
, {
"box" : {
"id" : "obj-3",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 2,
"outlettype" : [ "", "" ],
"patching_rect" : [ 142.0, 105.0, 48.0, 22.0 ],
"style" : "",
"text" : "route b"
}
}
, {
"box" : {
"comment" : "",
"id" : "obj-2",
"index" : 1,
"maxclass" : "outlet",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 142.0, 276.0, 30.0, 30.0 ],
"style" : ""
}
}
, {
"box" : {
"id" : "obj-30",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 221.0, 218.0, 159.0, 22.0 ],
"style" : "",
"text" : "if $f1 > 127. then 0. else $f1"
}
}
, {
"box" : {
"id" : "obj-29",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "float" ],
"patching_rect" : [ 221.0, 184.0, 44.0, 22.0 ],
"style" : "",
"text" : "+ 63.5"
}
}
, {
"box" : {
"id" : "obj-28",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "float" ],
"patching_rect" : [ 142.0, 193.0, 43.0, 22.0 ],
"style" : "",
"text" : "float 0"
}
}
, {
"box" : {
"id" : "obj-27",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 142.0, 155.0, 113.0, 22.0 ],
"style" : "",
"text" : "if $i1 > 0 then bang"
}
}
, {
"box" : {
"comment" : "",
"id" : "obj-1",
"index" : 1,
"maxclass" : "inlet",
"numinlets" : 0,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 142.0, 56.0, 30.0, 30.0 ],
"style" : ""
}
}
],
"lines" : [ {
"patchline" : {
"destination" : [ "obj-3", 0 ],
"source" : [ "obj-1", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-28", 0 ],
"source" : [ "obj-27", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-29", 0 ],
"order" : 0,
"source" : [ "obj-28", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-4", 0 ],
"order" : 1,
"source" : [ "obj-28", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-30", 0 ],
"source" : [ "obj-29", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-27", 0 ],
"source" : [ "obj-3", 1 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-28", 0 ],
"source" : [ "obj-3", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-28", 1 ],
"source" : [ "obj-30", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-2", 0 ],
"source" : [ "obj-4", 0 ]
}
}
]
}
,
"patching_rect" : [ 1130.5, 387.5, 55.0, 22.0 ],
"saved_object_attributes" : {
"description" : "",
"digest" : "",
"globalpatchername" : "",
"style" : "",
"tags" : ""
}
,
"style" : "",
"text" : "p cycle3"
}
}
, {
"box" : {
"id" : "obj-52",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "int" ],
"patching_rect" : [ 1156.0, 148.0, 31.0, 22.0 ],
"style" : "",
"text" : "- 24"
}
}
, {
"box" : {
"id" : "obj-53",
"maxclass" : "comment",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 1181.0, 87.5, 86.0, 20.0 ],
"style" : "",
"text" : "r switch"
}
}
, {
"box" : {
"id" : "obj-54",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 1156.0, 115.0, 175.0, 22.0 ],
"style" : "",
"text" : "if $i1 > 63 && $i1 < 72 then $i1"
}
}
, {
"box" : {
"id" : "obj-51",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 514.5, 482.5, 114.0, 22.0 ],
"style" : "",
"text" : "s ampeg_attack_cc"
}
}
, {
"box" : {
"id" : "obj-50",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 517.5, 449.5, 79.0, 22.0 ],
"style" : "",
"text" : "s lfo_rate_cc"
}
}
, {
"box" : {
"id" : "obj-49",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 1036.5, 449.5, 88.0, 22.0 ],
"style" : "",
"text" : "s lfo_mode_cc"
}
}
, {
"box" : {
"id" : "obj-48",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patcher" : {
"fileversion" : 1,
"appversion" : {
"major" : 7,
"minor" : 3,
"revision" : 5,
"architecture" : "x64",
"modernui" : 1
}
,
"rect" : [ 59.0, 103.0, 640.0, 480.0 ],
"bglocked" : 0,
"openinpresentation" : 0,
"default_fontsize" : 12.0,
"default_fontface" : 0,
"default_fontname" : "Arial",
"gridonopen" : 1,
"gridsize" : [ 15.0, 15.0 ],
"gridsnaponopen" : 1,
"objectsnaponopen" : 1,
"statusbarvisible" : 2,
"toolbarvisible" : 1,
"lefttoolbarpinned" : 0,
"toptoolbarpinned" : 0,
"righttoolbarpinned" : 0,
"bottomtoolbarpinned" : 0,
"toolbars_unpinned_last_save" : 0,
"tallnewobj" : 0,
"boxanimatetime" : 200,
"enablehscroll" : 1,
"enablevscroll" : 1,
"devicewidth" : 0.0,
"description" : "",
"digest" : "",
"tags" : "",
"style" : "",
"subpatcher_template" : "",
"boxes" : [ {
"box" : {
"id" : "obj-4",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 142.0, 233.0, 41.0, 22.0 ],
"style" : "",
"text" : "round"
}
}
, {
"box" : {
"id" : "obj-3",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 2,
"outlettype" : [ "", "" ],
"patching_rect" : [ 142.0, 105.0, 48.0, 22.0 ],
"style" : "",
"text" : "route b"
}
}
, {
"box" : {
"comment" : "",
"id" : "obj-2",
"index" : 1,
"maxclass" : "outlet",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 142.0, 276.0, 30.0, 30.0 ],
"style" : ""
}
}
, {
"box" : {
"id" : "obj-30",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 221.0, 218.0, 159.0, 22.0 ],
"style" : "",
"text" : "if $f1 > 127. then 0. else $f1"
}
}
, {
"box" : {
"id" : "obj-29",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "float" ],
"patching_rect" : [ 221.0, 184.0, 44.0, 22.0 ],
"style" : "",
"text" : "+ 63.5"
}
}
, {
"box" : {
"id" : "obj-28",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "float" ],
"patching_rect" : [ 142.0, 193.0, 43.0, 22.0 ],
"style" : "",
"text" : "float 0"
}
}
, {
"box" : {
"id" : "obj-27",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 142.0, 155.0, 113.0, 22.0 ],
"style" : "",
"text" : "if $i1 > 0 then bang"
}
}
, {
"box" : {
"comment" : "",
"id" : "obj-1",
"index" : 1,
"maxclass" : "inlet",
"numinlets" : 0,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 142.0, 56.0, 30.0, 30.0 ],
"style" : ""
}
}
],
"lines" : [ {
"patchline" : {
"destination" : [ "obj-3", 0 ],
"source" : [ "obj-1", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-28", 0 ],
"source" : [ "obj-27", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-29", 0 ],
"order" : 0,
"source" : [ "obj-28", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-4", 0 ],
"order" : 1,
"source" : [ "obj-28", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-30", 0 ],
"source" : [ "obj-29", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-27", 0 ],
"source" : [ "obj-3", 1 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-28", 0 ],
"source" : [ "obj-3", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-28", 1 ],
"source" : [ "obj-30", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-2", 0 ],
"source" : [ "obj-4", 0 ]
}
}
]
}
,
"patching_rect" : [ 1036.5, 387.5, 55.0, 22.0 ],
"saved_object_attributes" : {
"description" : "",
"digest" : "",
"globalpatchername" : "",
"style" : "",
"tags" : ""
}
,
"style" : "",
"text" : "p cycle3"
}
}
, {
"box" : {
"id" : "obj-44",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "int" ],
"patching_rect" : [ 970.0, 148.0, 31.0, 22.0 ],
"style" : "",
"text" : "- 16"
}
}
, {
"box" : {
"id" : "obj-45",
"maxclass" : "comment",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 995.0, 87.5, 86.0, 20.0 ],
"style" : "",
"text" : "m switch"
}
}
, {
"box" : {
"id" : "obj-46",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 970.0, 115.0, 175.0, 22.0 ],
"style" : "",
"text" : "if $i1 > 47 && $i1 < 56 then $i1"
}
}
, {
"box" : {
"id" : "obj-41",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "int" ],
"patching_rect" : [ 786.0, 148.0, 31.0, 22.0 ],
"style" : "",
"text" : "- 16"
}
}
, {
"box" : {
"id" : "obj-42",
"maxclass" : "comment",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 811.0, 87.5, 86.0, 20.0 ],
"style" : "",
"text" : "transport"
}
}
, {
"box" : {
"id" : "obj-43",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 786.0, 115.0, 175.0, 22.0 ],
"style" : "",
"text" : "if $i1 > 39 && $i1 < 48 then $i1"
}
}
, {
"box" : {
"id" : "obj-39",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patcher" : {
"fileversion" : 1,
"appversion" : {
"major" : 7,
"minor" : 3,
"revision" : 5,
"architecture" : "x64",
"modernui" : 1
}
,
"rect" : [ 59.0, 103.0, 640.0, 480.0 ],
"bglocked" : 0,
"openinpresentation" : 0,
"default_fontsize" : 12.0,
"default_fontface" : 0,
"default_fontname" : "Arial",
"gridonopen" : 1,
"gridsize" : [ 15.0, 15.0 ],
"gridsnaponopen" : 1,
"objectsnaponopen" : 1,
"statusbarvisible" : 2,
"toolbarvisible" : 1,
"lefttoolbarpinned" : 0,
"toptoolbarpinned" : 0,
"righttoolbarpinned" : 0,
"bottomtoolbarpinned" : 0,
"toolbars_unpinned_last_save" : 0,
"tallnewobj" : 0,
"boxanimatetime" : 200,
"enablehscroll" : 1,
"enablevscroll" : 1,
"devicewidth" : 0.0,
"description" : "",
"digest" : "",
"tags" : "",
"style" : "",
"subpatcher_template" : "",
"boxes" : [ {
"box" : {
"id" : "obj-4",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 142.0, 233.0, 41.0, 22.0 ],
"style" : "",
"text" : "round"
}
}
, {
"box" : {
"id" : "obj-3",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 2,
"outlettype" : [ "", "" ],
"patching_rect" : [ 142.0, 105.0, 48.0, 22.0 ],
"style" : "",
"text" : "route b"
}
}
, {
"box" : {
"comment" : "",
"id" : "obj-2",
"index" : 1,
"maxclass" : "outlet",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 142.0, 276.0, 30.0, 30.0 ],
"style" : ""
}
}
, {
"box" : {
"id" : "obj-30",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 221.0, 218.0, 159.0, 22.0 ],
"style" : "",
"text" : "if $f1 > 127. then 0. else $f1"
}
}
, {
"box" : {
"id" : "obj-29",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "float" ],
"patching_rect" : [ 221.0, 184.0, 44.0, 22.0 ],
"style" : "",
"text" : "+ 63.5"
}
}
, {
"box" : {
"id" : "obj-28",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "float" ],
"patching_rect" : [ 142.0, 193.0, 43.0, 22.0 ],
"style" : "",
"text" : "float 0"
}
}
, {
"box" : {
"id" : "obj-27",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 142.0, 155.0, 113.0, 22.0 ],
"style" : "",
"text" : "if $i1 > 0 then bang"
}
}
, {
"box" : {
"comment" : "",
"id" : "obj-1",
"index" : 1,
"maxclass" : "inlet",
"numinlets" : 0,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 142.0, 56.0, 30.0, 30.0 ],
"style" : ""
}
}
],
"lines" : [ {
"patchline" : {
"destination" : [ "obj-3", 0 ],
"source" : [ "obj-1", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-28", 0 ],
"source" : [ "obj-27", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-29", 0 ],
"order" : 0,
"source" : [ "obj-28", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-4", 0 ],
"order" : 1,
"source" : [ "obj-28", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-30", 0 ],
"source" : [ "obj-29", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-27", 0 ],
"source" : [ "obj-3", 1 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-28", 0 ],
"source" : [ "obj-3", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-28", 1 ],
"source" : [ "obj-30", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-2", 0 ],
"source" : [ "obj-4", 0 ]
}
}
]
}
,
"patching_rect" : [ 946.5, 387.5, 55.0, 22.0 ],
"saved_object_attributes" : {
"description" : "",
"digest" : "",
"globalpatchername" : "",
"style" : "",
"tags" : ""
}
,
"style" : "",
"text" : "p cycle3"
}
}
, {
"box" : {
"id" : "obj-40",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 946.5, 449.5, 86.0, 22.0 ],
"style" : "",
"text" : "s lfo_wave_cc"
}
}
, {
"box" : {
"id" : "obj-38",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 188.0, 482.5, 71.0, 22.0 ],
"style" : "",
"text" : "s lfo_int_cc"
}
}
, {
"box" : {
"id" : "obj-37",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 202.0, 449.5, 121.0, 22.0 ],
"style" : "",
"text" : "s ampeg_release_cc"
}
}
, {
"box" : {
"id" : "obj-31",
"maxclass" : "message",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 58.0, 238.0, 29.5, 22.0 ],
"style" : "",
"text" : "0"
}
}
, {
"box" : {
"id" : "obj-30",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 2,
"outlettype" : [ "bang", "bang" ],
"patching_rect" : [ 58.0, 208.0, 29.5, 22.0 ],
"style" : "",
"text" : "b"
}
}
, {
"box" : {
"id" : "obj-11",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 155.0, 521.5, 120.0, 22.0 ],
"style" : "",
"text" : "s delrev_subtype_cc"
}
}
, {
"box" : {
"id" : "obj-20",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 839.5, 449.5, 101.0, 22.0 ],
"style" : "",
"text" : "s delrev_type_cc"
}
}
, {
"box" : {
"id" : "obj-6",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patcher" : {
"fileversion" : 1,
"appversion" : {
"major" : 7,
"minor" : 3,
"revision" : 5,
"architecture" : "x64",
"modernui" : 1
}
,
"rect" : [ 59.0, 103.0, 640.0, 480.0 ],
"bglocked" : 0,
"openinpresentation" : 0,
"default_fontsize" : 12.0,
"default_fontface" : 0,
"default_fontname" : "Arial",
"gridonopen" : 1,
"gridsize" : [ 15.0, 15.0 ],
"gridsnaponopen" : 1,
"objectsnaponopen" : 1,
"statusbarvisible" : 2,
"toolbarvisible" : 1,
"lefttoolbarpinned" : 0,
"toptoolbarpinned" : 0,
"righttoolbarpinned" : 0,
"bottomtoolbarpinned" : 0,
"toolbars_unpinned_last_save" : 0,
"tallnewobj" : 0,
"boxanimatetime" : 200,
"enablehscroll" : 1,
"enablevscroll" : 1,
"devicewidth" : 0.0,
"description" : "",
"digest" : "",
"tags" : "",
"style" : "",
"subpatcher_template" : "",
"boxes" : [ {
"box" : {
"id" : "obj-4",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 142.0, 233.0, 41.0, 22.0 ],
"style" : "",
"text" : "round"
}
}
, {
"box" : {
"id" : "obj-3",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 2,
"outlettype" : [ "", "" ],
"patching_rect" : [ 142.0, 105.0, 48.0, 22.0 ],
"style" : "",
"text" : "route b"
}
}
, {
"box" : {
"comment" : "",
"id" : "obj-2",
"index" : 1,
"maxclass" : "outlet",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 142.0, 276.0, 30.0, 30.0 ],
"style" : ""
}
}
, {
"box" : {
"id" : "obj-30",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 221.0, 218.0, 159.0, 22.0 ],
"style" : "",
"text" : "if $f1 > 127. then 0. else $f1"
}
}
, {
"box" : {
"id" : "obj-29",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "float" ],
"patching_rect" : [ 221.0, 184.0, 78.0, 22.0 ],
"style" : "",
"text" : "+ 21.166666"
}
}
, {
"box" : {
"id" : "obj-28",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "float" ],
"patching_rect" : [ 142.0, 193.0, 43.0, 22.0 ],
"style" : "",
"text" : "float 0"
}
}
, {
"box" : {
"id" : "obj-27",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 142.0, 155.0, 113.0, 22.0 ],
"style" : "",
"text" : "if $i1 > 0 then bang"
}
}
, {
"box" : {
"comment" : "",
"id" : "obj-1",
"index" : 1,
"maxclass" : "inlet",
"numinlets" : 0,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 142.0, 56.0, 30.0, 30.0 ],
"style" : ""
}
}
],
"lines" : [ {
"patchline" : {
"destination" : [ "obj-3", 0 ],
"source" : [ "obj-1", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-28", 0 ],
"source" : [ "obj-27", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-29", 0 ],
"order" : 0,
"source" : [ "obj-28", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-4", 0 ],
"order" : 1,
"source" : [ "obj-28", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-30", 0 ],
"source" : [ "obj-29", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-27", 0 ],
"source" : [ "obj-3", 1 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-28", 0 ],
"source" : [ "obj-3", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-28", 1 ],
"source" : [ "obj-30", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-2", 0 ],
"source" : [ "obj-4", 0 ]
}
}
]
}
,
"patching_rect" : [ 735.0, 387.5, 55.0, 22.0 ],
"saved_object_attributes" : {
"description" : "",
"digest" : "",
"globalpatchername" : "",
"style" : "",
"tags" : ""
}
,
"style" : "",
"text" : "p cycle6"
}
}
, {
"box" : {
"id" : "obj-35",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patcher" : {
"fileversion" : 1,
"appversion" : {
"major" : 7,
"minor" : 3,
"revision" : 5,
"architecture" : "x64",
"modernui" : 1
}
,
"rect" : [ 59.0, 103.0, 640.0, 480.0 ],
"bglocked" : 0,
"openinpresentation" : 0,
"default_fontsize" : 12.0,
"default_fontface" : 0,
"default_fontname" : "Arial",
"gridonopen" : 1,
"gridsize" : [ 15.0, 15.0 ],
"gridsnaponopen" : 1,
"objectsnaponopen" : 1,
"statusbarvisible" : 2,
"toolbarvisible" : 1,
"lefttoolbarpinned" : 0,
"toptoolbarpinned" : 0,
"righttoolbarpinned" : 0,
"bottomtoolbarpinned" : 0,
"toolbars_unpinned_last_save" : 0,
"tallnewobj" : 0,
"boxanimatetime" : 200,
"enablehscroll" : 1,
"enablevscroll" : 1,
"devicewidth" : 0.0,
"description" : "",
"digest" : "",
"tags" : "",
"style" : "",
"subpatcher_template" : "",
"boxes" : [ {
"box" : {
"id" : "obj-4",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 142.0, 233.0, 41.0, 22.0 ],
"style" : "",
"text" : "round"
}
}
, {
"box" : {
"id" : "obj-3",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 2,
"outlettype" : [ "", "" ],
"patching_rect" : [ 142.0, 105.0, 48.0, 22.0 ],
"style" : "",
"text" : "route b"
}
}
, {
"box" : {
"comment" : "",
"id" : "obj-2",
"index" : 1,
"maxclass" : "outlet",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 142.0, 276.0, 30.0, 30.0 ],
"style" : ""
}
}
, {
"box" : {
"id" : "obj-30",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 221.0, 218.0, 159.0, 22.0 ],
"style" : "",
"text" : "if $f1 > 127. then 0. else $f1"
}
}
, {
"box" : {
"id" : "obj-29",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "float" ],
"patching_rect" : [ 221.0, 184.0, 44.0, 22.0 ],
"style" : "",
"text" : "+ 63.5"
}
}
, {
"box" : {
"id" : "obj-28",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "float" ],
"patching_rect" : [ 142.0, 193.0, 43.0, 22.0 ],
"style" : "",
"text" : "float 0"
}
}
, {
"box" : {
"id" : "obj-27",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 142.0, 155.0, 113.0, 22.0 ],
"style" : "",
"text" : "if $i1 > 0 then bang"
}
}
, {
"box" : {
"comment" : "",
"id" : "obj-1",
"index" : 1,
"maxclass" : "inlet",
"numinlets" : 0,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 142.0, 56.0, 30.0, 30.0 ],
"style" : ""
}
}
],
"lines" : [ {
"patchline" : {
"destination" : [ "obj-3", 0 ],
"source" : [ "obj-1", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-28", 0 ],
"source" : [ "obj-27", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-29", 0 ],
"order" : 0,
"source" : [ "obj-28", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-4", 0 ],
"order" : 1,
"source" : [ "obj-28", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-30", 0 ],
"source" : [ "obj-29", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-27", 0 ],
"source" : [ "obj-3", 1 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-28", 0 ],
"source" : [ "obj-3", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-28", 1 ],
"source" : [ "obj-30", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-2", 0 ],
"source" : [ "obj-4", 0 ]
}
}
]
}
,
"patching_rect" : [ 635.0, 387.5, 55.0, 22.0 ],
"saved_object_attributes" : {
"description" : "",
"digest" : "",
"globalpatchername" : "",
"style" : "",
"tags" : ""
}
,
"style" : "",
"text" : "p cycle3"
}
}
, {
"box" : {
"id" : "obj-32",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "int" ],
"patching_rect" : [ 609.0, 148.0, 31.0, 22.0 ],
"style" : "",
"text" : "- 16"
}
}
, {
"box" : {
"id" : "obj-33",
"maxclass" : "comment",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 623.0, 87.5, 51.0, 20.0 ],
"style" : "",
"text" : "s switch"
}
}
, {
"box" : {
"id" : "obj-34",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 609.0, 115.0, 175.0, 22.0 ],
"style" : "",
"text" : "if $i1 > 31 && $i1 < 40 then $i1"
}
}
, {
"box" : {
"id" : "obj-25",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 517.5, 387.5, 108.0, 22.0 ],
"style" : "",
"text" : "s delrev_depth_cc"
}
}
, {
"box" : {
"id" : "obj-26",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 486.5, 411.5, 101.0, 22.0 ],
"style" : "",
"text" : "s delrev_time_cc"
}
}
, {
"box" : {
"id" : "obj-21",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 390.5, 387.5, 108.0, 22.0 ],
"style" : "",
"text" : "s modfx_depth_cc"
}
}
, {
"box" : {
"id" : "obj-22",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 359.5, 411.5, 111.0, 22.0 ],
"style" : "",
"text" : "s modfx_speed_cc"
}
}
, {
"box" : {
"id" : "obj-23",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 134.0, 547.5, 120.0, 22.0 ],
"style" : "",
"text" : "s modfx_subtype_cc"
}
}
, {
"box" : {
"id" : "obj-24",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 735.0, 449.5, 101.0, 22.0 ],
"style" : "",
"text" : "s modfx_type_cc"
}
}
, {
"box" : {
"id" : "obj-19",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 251.0, 387.5, 132.0, 22.0 ],
"style" : "",
"text" : "s multi_shift_shape_cc"
}
}
, {
"box" : {
"id" : "obj-18",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 220.0, 411.5, 103.0, 22.0 ],
"style" : "",
"text" : "s multi_shape_cc"
}
}
, {
"box" : {
"id" : "obj-17",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 105.0, 574.5, 102.0, 22.0 ],
"style" : "",
"text" : "s multi_select_cc"
}
}
, {
"box" : {
"id" : "obj-16",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "int" ],
"patching_rect" : [ 134.0, 204.0, 29.5, 22.0 ],
"style" : "",
"text" : "+ 1"
}
}
, {
"box" : {
"id" : "obj-15",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "int" ],
"patching_rect" : [ 427.0, 148.0, 29.5, 22.0 ],
"style" : "",
"text" : "- 8"
}
}
, {
"box" : {
"id" : "obj-14",
"maxclass" : "comment",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 440.0, 93.0, 51.0, 20.0 ],
"style" : "",
"text" : "knobs"
}
}
, {
"box" : {
"id" : "obj-13",
"maxclass" : "comment",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 332.0, 93.0, 51.0, 20.0 ],
"style" : "",
"text" : "sliders"
}
}
, {
"box" : {
"id" : "obj-12",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 427.0, 115.0, 175.0, 22.0 ],
"style" : "",
"text" : "if $i1 > 15 && $i1 < 24 then $i1"
}
}
, {
"box" : {
"id" : "obj-10",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 317.0, 115.0, 102.0, 22.0 ],
"style" : "",
"text" : "if $i1 < 8 then $i1"
}
}
, {
"box" : {
"id" : "obj-8",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 48,
"outlettype" : [ "", "", "", "", "", "", "", "", "", "", "", "", "", "", "", "", "", "", "", "", "", "", "", "", "", "", "", "", "", "", "", "", "", "", "", "", "", "", "", "", "", "", "", "", "", "", "", "" ],
"patching_rect" : [ 134.0, 238.0, 512.5, 22.0 ],
"style" : "",
"text" : "gate 48"
}
}
, {
"box" : {
"id" : "obj-5",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "int" ],
"patching_rect" : [ 174.0, 87.5, 33.0, 22.0 ],
"style" : "",
"text" : "int 0"
}
}
, {
"box" : {
"comment" : "",
"id" : "obj-4",
"index" : 2,
"maxclass" : "inlet",
"numinlets" : 0,
"numoutlets" : 1,
"outlettype" : [ "int" ],
"patching_rect" : [ 327.0, 45.0, 30.0, 30.0 ],
"style" : ""
}
}
, {
"box" : {
"comment" : "",
"id" : "obj-1",
"index" : 1,
"maxclass" : "inlet",
"numinlets" : 0,
"numoutlets" : 1,
"outlettype" : [ "int" ],
"patching_rect" : [ 174.0, 45.0, 30.0, 30.0 ],
"style" : ""
}
}
, {
"box" : {
"id" : "obj-252",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 635.0, 449.5, 93.0, 22.0 ],
"style" : "",
"text" : "s multi_type_cc"
}
}
],
"lines" : [ {
"patchline" : {
"destination" : [ "obj-5", 0 ],
"source" : [ "obj-1", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-16", 0 ],
"source" : [ "obj-10", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-15", 0 ],
"source" : [ "obj-12", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-16", 0 ],
"source" : [ "obj-15", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-8", 0 ],
"source" : [ "obj-16", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-31", 0 ],
"source" : [ "obj-30", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-8", 0 ],
"source" : [ "obj-31", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-16", 0 ],
"source" : [ "obj-32", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-32", 0 ],
"source" : [ "obj-34", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-252", 0 ],
"source" : [ "obj-35", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-40", 0 ],
"source" : [ "obj-39", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-10", 0 ],
"order" : 5,
"source" : [ "obj-4", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-12", 0 ],
"order" : 4,
"source" : [ "obj-4", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-34", 0 ],
"order" : 3,
"source" : [ "obj-4", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-43", 0 ],
"order" : 2,
"source" : [ "obj-4", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-46", 0 ],
"order" : 1,
"source" : [ "obj-4", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-54", 0 ],
"order" : 0,
"source" : [ "obj-4", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-16", 0 ],
"source" : [ "obj-41", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-41", 0 ],
"source" : [ "obj-43", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-16", 0 ],
"source" : [ "obj-44", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-44", 0 ],
"source" : [ "obj-46", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-49", 0 ],
"source" : [ "obj-48", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-30", 0 ],
"order" : 1,
"source" : [ "obj-5", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-8", 1 ],
"order" : 0,
"source" : [ "obj-5", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-16", 0 ],
"source" : [ "obj-52", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-52", 0 ],
"source" : [ "obj-54", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-56", 0 ],
"source" : [ "obj-55", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-24", 0 ],
"source" : [ "obj-6", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-20", 0 ],
"source" : [ "obj-61", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-11", 0 ],
"source" : [ "obj-8", 4 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-17", 0 ],
"source" : [ "obj-8", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-18", 0 ],
"source" : [ "obj-8", 8 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-19", 0 ],
"source" : [ "obj-8", 9 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-21", 0 ],
"source" : [ "obj-8", 11 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-22", 0 ],
"source" : [ "obj-8", 10 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-23", 0 ],
"source" : [ "obj-8", 2 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-25", 0 ],
"source" : [ "obj-8", 13 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-26", 0 ],
"source" : [ "obj-8", 12 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-35", 0 ],
"source" : [ "obj-8", 16 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-37", 0 ],
"source" : [ "obj-8", 7 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-38", 0 ],
"source" : [ "obj-8", 6 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-39", 0 ],
"source" : [ "obj-8", 22 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-48", 0 ],
"source" : [ "obj-8", 38 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-50", 0 ],
"source" : [ "obj-8", 14 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-51", 0 ],
"source" : [ "obj-8", 15 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-55", 0 ],
"source" : [ "obj-8", 46 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-58", 0 ],
"source" : [ "obj-8", 25 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-59", 0 ],
"source" : [ "obj-8", 26 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-6", 0 ],
"source" : [ "obj-8", 18 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-61", 0 ],
"source" : [ "obj-8", 20 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-62", 0 ],
"source" : [ "obj-8", 1 ]
}
}
]
}
,
"patching_rect" : [ 640.0, 185.0, 84.0, 22.0 ],
"saved_object_attributes" : {
"description" : "",
"digest" : "",
"globalpatchername" : "",
"style" : "",
"tags" : ""
}
,
"style" : "",
"text" : "p dispatch_cc"
}
}
, {
"box" : {
"id" : "obj-253",
"maxclass" : "newobj",
"numinlets" : 0,
"numoutlets" : 4,
"outlettype" : [ "", "", "", "" ],
"patcher" : {
"fileversion" : 1,
"appversion" : {
"major" : 7,
"minor" : 3,
"revision" : 5,
"architecture" : "x64",
"modernui" : 1
}
,
"rect" : [ 481.0, 216.0, 640.0, 480.0 ],
"bglocked" : 0,
"openinpresentation" : 0,
"default_fontsize" : 12.0,
"default_fontface" : 0,
"default_fontname" : "Arial",
"gridonopen" : 1,
"gridsize" : [ 15.0, 15.0 ],
"gridsnaponopen" : 1,
"objectsnaponopen" : 1,
"statusbarvisible" : 2,
"toolbarvisible" : 1,
"lefttoolbarpinned" : 0,
"toptoolbarpinned" : 0,
"righttoolbarpinned" : 0,
"bottomtoolbarpinned" : 0,
"toolbars_unpinned_last_save" : 0,
"tallnewobj" : 0,
"boxanimatetime" : 200,
"enablehscroll" : 1,
"enablevscroll" : 1,
"devicewidth" : 0.0,
"description" : "",
"digest" : "",
"tags" : "",
"style" : "",
"subpatcher_template" : "",
"boxes" : [ {
"box" : {
"id" : "obj-12",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 150.0, 247.0, 41.0, 22.0 ],
"style" : "",
"text" : "round"
}
}
, {
"box" : {
"id" : "obj-13",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "float" ],
"patching_rect" : [ 150.0, 200.0, 35.0, 22.0 ],
"style" : "",
"text" : "* 15."
}
}
, {
"box" : {
"id" : "obj-14",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "float" ],
"patching_rect" : [ 150.0, 148.0, 41.0, 22.0 ],
"style" : "",
"text" : "/ 127."
}
}
, {
"box" : {
"id" : "obj-11",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 42.0, 252.0, 41.0, 22.0 ],
"style" : "",
"text" : "round"
}
}
, {
"box" : {
"id" : "obj-10",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "float" ],
"patching_rect" : [ 42.0, 205.0, 29.5, 22.0 ],
"style" : "",
"text" : "* 2."
}
}
, {
"box" : {
"id" : "obj-9",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "float" ],
"patching_rect" : [ 42.0, 153.0, 41.0, 22.0 ],
"style" : "",
"text" : "/ 127."
}
}
, {
"box" : {
"comment" : "",
"id" : "obj-8",
"index" : 4,
"maxclass" : "outlet",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 385.0, 307.0, 30.0, 30.0 ],
"style" : ""
}
}
, {
"box" : {
"comment" : "",
"id" : "obj-7",
"index" : 3,
"maxclass" : "outlet",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 266.0, 307.0, 30.0, 30.0 ],
"style" : ""
}
}
, {
"box" : {
"comment" : "",
"id" : "obj-6",
"index" : 2,
"maxclass" : "outlet",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 150.0, 307.0, 30.0, 30.0 ],
"style" : ""
}
}
, {
"box" : {
"comment" : "",
"id" : "obj-5",
"index" : 1,
"maxclass" : "outlet",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 42.0, 307.0, 30.0, 30.0 ],
"style" : ""
}
}
, {
"box" : {
"id" : "obj-4",
"maxclass" : "newobj",
"numinlets" : 0,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 385.0, 85.0, 130.0, 22.0 ],
"style" : "",
"text" : "r multi_shift_shape_cc"
}
}
, {
"box" : {
"id" : "obj-3",
"maxclass" : "newobj",
"numinlets" : 0,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 266.0, 85.0, 101.0, 22.0 ],
"style" : "",
"text" : "r multi_shape_cc"
}
}
, {
"box" : {
"id" : "obj-2",
"maxclass" : "newobj",
"numinlets" : 0,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 150.0, 85.0, 100.0, 22.0 ],
"style" : "",
"text" : "r multi_select_cc"
}
}
, {
"box" : {
"id" : "obj-1",
"maxclass" : "newobj",
"numinlets" : 0,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 42.0, 85.0, 91.0, 22.0 ],
"style" : "",
"text" : "r multi_type_cc"
}
}
],
"lines" : [ {
"patchline" : {
"destination" : [ "obj-9", 0 ],
"source" : [ "obj-1", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-11", 0 ],
"source" : [ "obj-10", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-5", 0 ],
"source" : [ "obj-11", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-6", 0 ],
"source" : [ "obj-12", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-12", 0 ],
"source" : [ "obj-13", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-13", 0 ],
"source" : [ "obj-14", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-14", 0 ],
"source" : [ "obj-2", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-7", 0 ],
"source" : [ "obj-3", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-8", 0 ],
"source" : [ "obj-4", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-10", 0 ],
"source" : [ "obj-9", 0 ]
}
}
]
}
,
"patching_rect" : [ 86.0, -17.0, 88.0, 22.0 ],
"saved_object_attributes" : {
"description" : "",
"digest" : "",
"globalpatchername" : "",
"style" : "",
"tags" : ""
}
,
"style" : "",
"text" : "p rec_multi_cc"
}
}
, {
"box" : {
"id" : "obj-249",
"maxclass" : "message",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 1266.5, 67.0, 29.5, 22.0 ],
"style" : "",
"text" : "1"
}
}
, {
"box" : {
"id" : "obj-248",
"maxclass" : "message",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 1314.0, 67.0, 29.5, 22.0 ],
"style" : "",
"text" : "0"
}
}
, {
"box" : {
"bgcolor" : [ 0.376471, 0.384314, 0.4, 0.0 ],
"bgcolor2" : [ 0.376471, 0.384314, 0.4, 0.0 ],
"bgfillcolor_angle" : 270.0,
"bgfillcolor_autogradient" : 0.0,
"bgfillcolor_color" : [ 0.290196, 0.309804, 0.301961, 0.0 ],
"bgfillcolor_color1" : [ 0.376471, 0.384314, 0.4, 0.0 ],
"bgfillcolor_color2" : [ 0.290196, 0.309804, 0.301961, 1.0 ],
"bgfillcolor_proportion" : 0.39,
"bgfillcolor_type" : "color",
"fontface" : 1,
"gradient" : 1,
"id" : "obj-247",
"maxclass" : "message",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 1241.0, 108.5, 65.0, 22.0 ],
"presentation" : 1,
"presentation_rect" : [ 1165.0, 193.125, 65.0, 22.0 ],
"style" : "",
"text" : "start/stop",
"textjustification" : 1
}
}
, {
"box" : {
"id" : "obj-246",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 984.916687, 263.5, 113.0, 22.0 ],
"style" : "",
"text" : "if $i1 > 0 then bang"
}
}
, {
"box" : {
"id" : "obj-245",
"maxclass" : "newobj",
"numinlets" : 0,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 946.0, 231.0, 67.0, 22.0 ],
"style" : "",
"text" : "r seq_stop"
}
}
, {
"box" : {
"id" : "obj-244",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 1041.166626, 188.5, 113.0, 22.0 ],
"style" : "",
"text" : "if $i1 > 0 then bang"
}
}
, {
"box" : {
"id" : "obj-243",
"maxclass" : "newobj",
"numinlets" : 0,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 1003.666626, 157.0, 67.0, 22.0 ],
"style" : "",
"text" : "r seq_start"
}
}
, {
"box" : {
"id" : "obj-242",
"maxclass" : "message",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 1071.0, 328.0, 33.0, 22.0 ],
"style" : "",
"text" : "stop"
}
}
, {
"box" : {
"id" : "obj-240",
"maxclass" : "button",
"numinlets" : 1,
"numoutlets" : 1,
"outlettype" : [ "bang" ],
"patching_rect" : [ 1071.0, 293.0, 24.0, 24.0 ],
"style" : ""
}
}
, {
"box" : {
"id" : "obj-239",
"maxclass" : "button",
"numinlets" : 1,
"numoutlets" : 1,
"outlettype" : [ "bang" ],
"patching_rect" : [ 1105.0, 219.5, 24.0, 24.0 ],
"style" : ""
}
}
, {
"box" : {
"id" : "obj-238",
"maxclass" : "message",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 697.5, 114.0, 50.0, 22.0 ],
"style" : "",
"text" : "43"
}
}
, {
"box" : {
"id" : "obj-237",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 3,
"outlettype" : [ "int", "int", "int" ],
"patching_rect" : [ 684.0, 47.0, 40.0, 22.0 ],
"presentation" : 1,
"presentation_rect" : [ 1045.733398, 55.5, 40.0, 22.0 ],
"style" : "",
"text" : "ctlin"
}
}
, {
"box" : {
"id" : "obj-235",
"maxclass" : "message",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 635.0, 114.0, 50.0, 22.0 ],
"style" : "",
"text" : "127"
}
}
, {
"box" : {
"id" : "obj-234",
"maxclass" : "comment",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 668.5, 23.0, 79.0, 20.0 ],
"presentation" : 1,
"presentation_rect" : [ 1022.233398, 31.5, 79.0, 20.0 ],
"style" : "",
"text" : "controller in",
"textcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"textjustification" : 1
}
}
, {
"box" : {
"id" : "obj-232",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "int" ],
"patching_rect" : [ 1336.0, 187.0, 29.5, 22.0 ],
"style" : "",
"text" : "+ 1"
}
}
, {
"box" : {
"bgcolor" : [ 0.376471, 0.384314, 0.4, 0.0 ],
"bgcolor2" : [ 0.376471, 0.384314, 0.4, 0.0 ],
"bgfillcolor_angle" : 270.0,
"bgfillcolor_autogradient" : 0.0,
"bgfillcolor_color" : [ 0.290196, 0.309804, 0.301961, 0.0 ],
"bgfillcolor_color1" : [ 0.376471, 0.384314, 0.4, 0.0 ],
"bgfillcolor_color2" : [ 0.290196, 0.309804, 0.301961, 1.0 ],
"bgfillcolor_proportion" : 0.39,
"bgfillcolor_type" : "color",
"fontface" : 1,
"gradient" : 1,
"id" : "obj-229",
"maxclass" : "message",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 946.0, 28.0, 133.0, 22.0 ],
"presentation" : 1,
"presentation_rect" : [ 832.25, 189.375, 87.0, 22.0 ],
"style" : "",
"text" : "SEQUENCER",
"textjustification" : 1
}
}
, {
"box" : {
"bgcolor" : [ 0.376471, 0.384314, 0.4, 0.0 ],
"bgcolor2" : [ 0.376471, 0.384314, 0.4, 0.0 ],
"bgfillcolor_angle" : 270.0,
"bgfillcolor_autogradient" : 0.0,
"bgfillcolor_color" : [ 0.32549, 0.345098, 0.372549, 0.62 ],
"bgfillcolor_color1" : [ 0.376471, 0.384314, 0.4, 0.0 ],
"bgfillcolor_color2" : [ 0.290196, 0.309804, 0.301961, 1.0 ],
"bgfillcolor_proportion" : 0.39,
"bgfillcolor_type" : "color",
"fontface" : 1,
"gradient" : 1,
"id" : "obj-227",
"maxclass" : "message",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 1055.0, 219.5, 39.0, 22.0 ],
"presentation" : 1,
"presentation_rect" : [ 1188.0, 223.875, 75.0, 22.0 ],
"style" : "",
"text" : "reset",
"textjustification" : 1
}
}
, {
"box" : {
"id" : "obj-226",
"maxclass" : "newobj",
"numinlets" : 3,
"numoutlets" : 0,
"patching_rect" : [ 1524.0, 637.0, 51.0, 22.0 ],
"presentation" : 1,
"presentation_rect" : [ 1183.5, 119.25, 51.0, 22.0 ],
"style" : "",
"text" : "noteout"
}
}
, {
"box" : {
"id" : "obj-223",
"maxclass" : "newobj",
"numinlets" : 0,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 1678.5, 443.0, 53.0, 22.0 ],
"style" : "",
"text" : "r octave"
}
}
, {
"box" : {
"id" : "obj-222",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 952.0, 475.0, 55.0, 22.0 ],
"style" : "",
"text" : "s octave"
}
}
, {
"box" : {
"id" : "obj-221",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "int" ],
"patching_rect" : [ 1539.0, 502.0, 29.5, 22.0 ],
"style" : "",
"text" : "+ 0"
}
}
, {
"box" : {
"id" : "obj-220",
"maxclass" : "newobj",
"numinlets" : 4,
"numoutlets" : 3,
"outlettype" : [ "float", "float", "float" ],
"patching_rect" : [ 1524.0, 585.0, 113.0, 22.0 ],
"style" : "",
"text" : "makenote 64 100 0"
}
}
, {
"box" : {
"bgcolor" : [ 0.094118, 0.101961, 0.101961, 0.36 ],
"candicane2" : [ 0.65098, 0.666667, 0.662745, 1.0 ],
"candicane3" : [ 0.65098, 0.666667, 0.662745, 1.0 ],
"candicane4" : [ 0.65098, 0.666667, 0.662745, 1.0 ],
"candycane" : 4,
"id" : "obj-216",
"maxclass" : "multislider",
"numinlets" : 1,
"numoutlets" : 2,
"outlettype" : [ "", "" ],
"parameter_enable" : 0,
"patching_rect" : [ 1533.0, 263.5, 192.0, 128.5 ],
"presentation" : 1,
"presentation_rect" : [ 602.0, 388.0, 554.0, 28.5 ],
"setminmax" : [ 0.0, 1.0 ],
"setstyle" : 1,
"settype" : 0,
"size" : 16,
"slidercolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"spacing" : 1,
"style" : "",
"varname" : "multislider[1]"
}
}
, {
"box" : {
"id" : "obj-207",
"maxclass" : "newobj",
"numinlets" : 17,
"numoutlets" : 17,
"outlettype" : [ "", "", "", "", "", "", "", "", "", "", "", "", "", "", "", "", "" ],
"patching_rect" : [ 1095.0, 443.0, 237.0, 22.0 ],
"style" : "",
"text" : "route 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15"
}
}
, {
"box" : {
"id" : "obj-206",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 1524.0, 541.0, 34.0, 22.0 ],
"style" : "",
"text" : "gate"
}
}
, {
"box" : {
"bgcolor" : [ 0.290196, 0.309804, 0.301961, 0.0 ],
"blinkcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"id" : "obj-196",
"ignoreclick" : 1,
"maxclass" : "button",
"numinlets" : 1,
"numoutlets" : 1,
"outlettype" : [ "bang" ],
"outlinecolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"patching_rect" : [ 1460.0, 529.5, 24.0, 24.0 ],
"presentation" : 1,
"presentation_rect" : [ 1127.633423, 418.5, 24.0, 24.0 ],
"style" : ""
}
}
, {
"box" : {
"bgcolor" : [ 0.290196, 0.309804, 0.301961, 0.0 ],
"blinkcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"id" : "obj-197",
"ignoreclick" : 1,
"maxclass" : "button",
"numinlets" : 1,
"numoutlets" : 1,
"outlettype" : [ "bang" ],
"outlinecolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"patching_rect" : [ 1434.0, 529.5, 24.0, 24.0 ],
"presentation" : 1,
"presentation_rect" : [ 1091.500122, 418.5, 24.0, 24.0 ],
"style" : ""
}
}
, {
"box" : {
"bgcolor" : [ 0.290196, 0.309804, 0.301961, 0.0 ],
"blinkcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"id" : "obj-198",
"ignoreclick" : 1,
"maxclass" : "button",
"numinlets" : 1,
"numoutlets" : 1,
"outlettype" : [ "bang" ],
"outlinecolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"patching_rect" : [ 1408.0, 529.5, 24.0, 24.0 ],
"presentation" : 1,
"presentation_rect" : [ 1057.366821, 418.5, 24.0, 24.0 ],
"style" : ""
}
}
, {
"box" : {
"bgcolor" : [ 0.290196, 0.309804, 0.301961, 0.0 ],
"blinkcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"id" : "obj-199",
"ignoreclick" : 1,
"maxclass" : "button",
"numinlets" : 1,
"numoutlets" : 1,
"outlettype" : [ "bang" ],
"outlinecolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"patching_rect" : [ 1382.0, 529.5, 24.0, 24.0 ],
"presentation" : 1,
"presentation_rect" : [ 1022.233398, 418.5, 24.0, 24.0 ],
"style" : ""
}
}
, {
"box" : {
"bgcolor" : [ 0.290196, 0.309804, 0.301961, 0.0 ],
"blinkcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"id" : "obj-200",
"ignoreclick" : 1,
"maxclass" : "button",
"numinlets" : 1,
"numoutlets" : 1,
"outlettype" : [ "bang" ],
"outlinecolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"patching_rect" : [ 1350.0, 529.5, 24.0, 24.0 ],
"presentation" : 1,
"presentation_rect" : [ 989.100098, 418.5, 24.0, 24.0 ],
"style" : ""
}
}
, {
"box" : {
"bgcolor" : [ 0.290196, 0.309804, 0.301961, 0.0 ],
"blinkcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"id" : "obj-201",
"ignoreclick" : 1,
"maxclass" : "button",
"numinlets" : 1,
"numoutlets" : 1,
"outlettype" : [ "bang" ],
"outlinecolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"patching_rect" : [ 1324.0, 529.5, 24.0, 24.0 ],
"presentation" : 1,
"presentation_rect" : [ 953.633423, 418.5, 24.0, 24.0 ],
"style" : ""
}
}
, {
"box" : {
"bgcolor" : [ 0.290196, 0.309804, 0.301961, 0.0 ],
"blinkcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"id" : "obj-202",
"ignoreclick" : 1,
"maxclass" : "button",
"numinlets" : 1,
"numoutlets" : 1,
"outlettype" : [ "bang" ],
"outlinecolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"patching_rect" : [ 1298.0, 529.5, 24.0, 24.0 ],
"presentation" : 1,
"presentation_rect" : [ 922.833374, 418.5, 24.0, 24.0 ],
"style" : ""
}
}
, {
"box" : {
"bgcolor" : [ 0.290196, 0.309804, 0.301961, 0.0 ],
"blinkcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"id" : "obj-203",
"ignoreclick" : 1,
"maxclass" : "button",
"numinlets" : 1,
"numoutlets" : 1,
"outlettype" : [ "bang" ],
"outlinecolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"patching_rect" : [ 1272.0, 529.5, 24.0, 24.0 ],
"presentation" : 1,
"presentation_rect" : [ 885.700073, 418.5, 24.0, 24.0 ],
"style" : ""
}
}
, {
"box" : {
"bgcolor" : [ 0.290196, 0.309804, 0.301961, 0.0 ],
"blinkcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"id" : "obj-192",
"ignoreclick" : 1,
"maxclass" : "button",
"numinlets" : 1,
"numoutlets" : 1,
"outlettype" : [ "bang" ],
"outlinecolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"patching_rect" : [ 1241.0, 529.5, 24.0, 24.0 ],
"presentation" : 1,
"presentation_rect" : [ 849.566772, 418.5, 24.0, 24.0 ],
"style" : ""
}
}
, {
"box" : {
"bgcolor" : [ 0.290196, 0.309804, 0.301961, 0.0 ],
"blinkcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"id" : "obj-193",
"ignoreclick" : 1,
"maxclass" : "button",
"numinlets" : 1,
"numoutlets" : 1,
"outlettype" : [ "bang" ],
"outlinecolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"patching_rect" : [ 1215.0, 529.5, 24.0, 24.0 ],
"presentation" : 1,
"presentation_rect" : [ 817.433411, 418.5, 24.0, 24.0 ],
"style" : ""
}
}
, {
"box" : {
"bgcolor" : [ 0.290196, 0.309804, 0.301961, 0.0 ],
"blinkcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"id" : "obj-194",
"ignoreclick" : 1,
"maxclass" : "button",
"numinlets" : 1,
"numoutlets" : 1,
"outlettype" : [ "bang" ],
"outlinecolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"patching_rect" : [ 1189.0, 529.5, 24.0, 24.0 ],
"presentation" : 1,
"presentation_rect" : [ 782.30011, 418.5, 24.0, 24.0 ],
"style" : ""
}
}
, {
"box" : {
"bgcolor" : [ 0.290196, 0.309804, 0.301961, 0.0 ],
"blinkcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"id" : "obj-195",
"ignoreclick" : 1,
"maxclass" : "button",
"numinlets" : 1,
"numoutlets" : 1,
"outlettype" : [ "bang" ],
"outlinecolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"patching_rect" : [ 1163.0, 529.5, 24.0, 24.0 ],
"presentation" : 1,
"presentation_rect" : [ 747.166748, 418.5, 24.0, 24.0 ],
"style" : ""
}
}
, {
"box" : {
"bgcolor" : [ 0.290196, 0.309804, 0.301961, 0.0 ],
"blinkcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"id" : "obj-190",
"ignoreclick" : 1,
"maxclass" : "button",
"numinlets" : 1,
"numoutlets" : 1,
"outlettype" : [ "bang" ],
"outlinecolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"patching_rect" : [ 1131.0, 529.5, 24.0, 24.0 ],
"presentation" : 1,
"presentation_rect" : [ 715.033447, 418.5, 24.0, 24.0 ],
"style" : ""
}
}
, {
"box" : {
"bgcolor" : [ 0.290196, 0.309804, 0.301961, 0.0 ],
"blinkcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"id" : "obj-191",
"ignoreclick" : 1,
"maxclass" : "button",
"numinlets" : 1,
"numoutlets" : 1,
"outlettype" : [ "bang" ],
"outlinecolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"patching_rect" : [ 1105.0, 529.5, 24.0, 24.0 ],
"presentation" : 1,
"presentation_rect" : [ 679.900085, 418.5, 24.0, 24.0 ],
"style" : ""
}
}
, {
"box" : {
"bgcolor" : [ 0.290196, 0.309804, 0.301961, 0.0 ],
"blinkcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"id" : "obj-189",
"ignoreclick" : 1,
"maxclass" : "button",
"numinlets" : 1,
"numoutlets" : 1,
"outlettype" : [ "bang" ],
"outlinecolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"patching_rect" : [ 1079.0, 529.5, 24.0, 24.0 ],
"presentation" : 1,
"presentation_rect" : [ 645.766785, 418.5, 24.0, 24.0 ],
"style" : ""
}
}
, {
"box" : {
"bgcolor" : [ 0.290196, 0.309804, 0.301961, 0.0 ],
"blinkcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"id" : "obj-188",
"ignoreclick" : 1,
"maxclass" : "button",
"numinlets" : 1,
"numoutlets" : 1,
"outlettype" : [ "bang" ],
"outlinecolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"patching_rect" : [ 1053.0, 529.5, 24.0, 24.0 ],
"presentation" : 1,
"presentation_rect" : [ 608.633423, 418.5, 24.0, 24.0 ],
"style" : ""
}
}
, {
"box" : {
"id" : "obj-186",
"maxclass" : "message",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 1336.0, 217.0, 53.0, 22.0 ],
"style" : "",
"text" : "fetch $1"
}
}
, {
"box" : {
"bgcolor" : [ 0.094118, 0.101961, 0.101961, 0.0 ],
"candicane2" : [ 0.65098, 0.666667, 0.662745, 1.0 ],
"candicane3" : [ 0.65098, 0.666667, 0.662745, 1.0 ],
"candicane4" : [ 0.65098, 0.666667, 0.662745, 1.0 ],
"candycane" : 4,
"ghostbar" : 5,
"id" : "obj-182",
"maxclass" : "multislider",
"numinlets" : 1,
"numoutlets" : 2,
"outlettype" : [ "", "" ],
"parameter_enable" : 0,
"patching_rect" : [ 1336.0, 263.5, 181.0, 128.5 ],
"presentation" : 1,
"presentation_rect" : [ 602.0, 223.875, 554.0, 116.5 ],
"setminmax" : [ 0.0, 23.0 ],
"settype" : 0,
"size" : 16,
"slidercolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"spacing" : 1,
"style" : "",
"thickness" : 7,
"varname" : "multislider"
}
}
, {
"box" : {
"bgcolor" : [ 0.290196, 0.309804, 0.301961, 0.48 ],
"checkedcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"id" : "obj-177",
"maxclass" : "toggle",
"numinlets" : 1,
"numoutlets" : 1,
"outlettype" : [ "int" ],
"parameter_enable" : 0,
"patching_rect" : [ 1314.0, 108.5, 24.0, 24.0 ],
"presentation" : 1,
"presentation_rect" : [ 1239.0, 193.125, 24.0, 24.0 ],
"style" : "",
"uncheckedcolor" : [ 0.65098, 0.666667, 0.662745, 1.0 ]
}
}
, {
"box" : {
"activedialcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"activeneedlecolor" : [ 0.65098, 0.666667, 0.662745, 1.0 ],
"dialcolor" : [ 0.862745, 0.870588, 0.878431, 1.0 ],
"focusbordercolor" : [ 0.0, 0.0, 0.0, 1.0 ],
"id" : "obj-173",
"maxclass" : "live.dial",
"needlecolor" : [ 0.32549, 0.345098, 0.372549, 1.0 ],
"numinlets" : 1,
"numoutlets" : 2,
"outlettype" : [ "", "float" ],
"panelcolor" : [ 0.65098, 0.666667, 0.662745, 1.0 ],
"parameter_enable" : 1,
"patching_rect" : [ 1361.0, 93.5, 60.0, 47.0 ],
"presentation" : 1,
"presentation_rect" : [ 1183.5, 254.625, 77.0, 47.0 ],
"saved_attribute_attributes" : {
"valueof" : {
"parameter_longname" : "tempo",
"parameter_shortname" : "tempo",
"parameter_type" : 0,
"parameter_mmin" : 36.0,
"parameter_mmax" : 255.0,
"parameter_unitstyle" : 9,
"parameter_units" : "bpm"
}
}
,
"textcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"tribordercolor" : [ 0.32549, 0.345098, 0.372549, 1.0 ],
"tricolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"varname" : "tempo"
}
}
, {
"box" : {
"id" : "obj-168",
"maxclass" : "newobj",
"numinlets" : 4,
"numoutlets" : 1,
"outlettype" : [ "int" ],
"patching_rect" : [ 1336.0, 159.0, 94.0, 22.0 ],
"style" : "",
"text" : "tempo 120 1 16"
}
}
, {
"box" : {
"id" : "obj-167",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 391.5, 1619.5, 66.0, 22.0 ],
"style" : "",
"text" : "pack 0. 56"
}
}
, {
"box" : {
"id" : "obj-159",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 313.5, 1619.5, 66.0, 22.0 ],
"style" : "",
"text" : "pack 0. 26"
}
}
, {
"box" : {
"id" : "obj-161",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 229.5, 1619.5, 66.0, 22.0 ],
"style" : "",
"text" : "pack 0. 24"
}
}
, {
"box" : {
"id" : "obj-163",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 145.5, 1619.5, 66.0, 22.0 ],
"style" : "",
"text" : "pack 0. 58"
}
}
, {
"box" : {
"id" : "obj-164",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 66.0, 1619.5, 66.0, 22.0 ],
"style" : "",
"text" : "pack 0. 57"
}
}
, {
"box" : {
"id" : "obj-165",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patcher" : {
"fileversion" : 1,
"appversion" : {
"major" : 7,
"minor" : 3,
"revision" : 5,
"architecture" : "x64",
"modernui" : 1
}
,
"rect" : [ 469.0, 165.0, 640.0, 480.0 ],
"bglocked" : 0,
"openinpresentation" : 0,
"default_fontsize" : 12.0,
"default_fontface" : 0,
"default_fontname" : "Arial",
"gridonopen" : 1,
"gridsize" : [ 15.0, 15.0 ],
"gridsnaponopen" : 1,
"objectsnaponopen" : 1,
"statusbarvisible" : 2,
"toolbarvisible" : 1,
"lefttoolbarpinned" : 0,
"toptoolbarpinned" : 0,
"righttoolbarpinned" : 0,
"bottomtoolbarpinned" : 0,
"toolbars_unpinned_last_save" : 0,
"tallnewobj" : 0,
"boxanimatetime" : 200,
"enablehscroll" : 1,
"enablevscroll" : 1,
"devicewidth" : 0.0,
"description" : "",
"digest" : "",
"tags" : "",
"style" : "",
"subpatcher_template" : "",
"boxes" : [ {
"box" : {
"id" : "obj-4",
"maxclass" : "newobj",
"numinlets" : 4,
"numoutlets" : 4,
"outlettype" : [ "", "", "", "" ],
"patching_rect" : [ 46.0, 57.0, 92.0, 22.0 ],
"style" : "",
"text" : "route b list float"
}
}
, {
"box" : {
"id" : "obj-7",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 2,
"outlettype" : [ "float", "int" ],
"patching_rect" : [ 70.333336, 101.0, 73.0, 22.0 ],
"style" : "",
"text" : "unpack 0. 0"
}
}
, {
"box" : {
"comment" : "",
"id" : "obj-3",
"index" : 1,
"maxclass" : "outlet",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 55.25, 365.0, 30.0, 30.0 ],
"style" : ""
}
}
, {
"box" : {
"id" : "obj-119",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 70.333336, 191.0, 41.0, 22.0 ],
"style" : "",
"text" : "round"
}
}
, {
"box" : {
"id" : "obj-118",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 2,
"outlettype" : [ "bang", "bang" ],
"patching_rect" : [ 55.25, 258.5, 29.5, 22.0 ],
"style" : "",
"text" : "b"
}
}
, {
"box" : {
"id" : "obj-114",
"maxclass" : "newobj",
"numinlets" : 3,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 55.25, 311.0, 79.0, 22.0 ],
"style" : "",
"text" : "pack 176 0 0"
}
}
, {
"box" : {
"id" : "obj-113",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "int" ],
"patching_rect" : [ 70.333336, 222.0, 33.0, 22.0 ],
"style" : "",
"text" : "int 0"
}
}
, {
"box" : {
"id" : "obj-112",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "float" ],
"patching_rect" : [ 70.333336, 154.0, 42.0, 22.0 ],
"style" : "",
"text" : "* 127."
}
}
, {
"box" : {
"comment" : "",
"id" : "obj-2",
"index" : 1,
"maxclass" : "inlet",
"numinlets" : 0,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 46.0, 9.0, 30.0, 30.0 ],
"style" : ""
}
}
],
"lines" : [ {
"patchline" : {
"destination" : [ "obj-119", 0 ],
"midpoints" : [ 79.833336, 177.0, 79.833336, 177.0 ],
"source" : [ "obj-112", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-114", 2 ],
"midpoints" : [ 79.833336, 255.0, 124.75, 255.0 ],
"order" : 0,
"source" : [ "obj-113", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-118", 0 ],
"midpoints" : [ 79.833336, 246.0, 66.0, 246.0, 66.0, 252.0, 64.75, 252.0 ],
"order" : 1,
"source" : [ "obj-113", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-3", 0 ],
"midpoints" : [ 64.75, 336.0, 64.75, 336.0 ],
"source" : [ "obj-114", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-114", 0 ],
"midpoints" : [ 64.75, 282.0, 64.75, 282.0 ],
"source" : [ "obj-118", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-113", 0 ],
"midpoints" : [ 79.833336, 216.0, 79.833336, 216.0 ],
"source" : [ "obj-119", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-4", 0 ],
"source" : [ "obj-2", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-112", 0 ],
"midpoints" : [ 104.166667, 81.0, 57.0, 81.0, 57.0, 141.0, 79.833336, 141.0 ],
"source" : [ "obj-4", 2 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-113", 0 ],
"midpoints" : [ 55.5, 216.0, 79.833336, 216.0 ],
"source" : [ "obj-4", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-7", 0 ],
"midpoints" : [ 79.833333, 81.0, 79.833336, 81.0 ],
"source" : [ "obj-4", 1 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-112", 0 ],
"midpoints" : [ 79.833336, 126.0, 79.833336, 126.0 ],
"source" : [ "obj-7", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-114", 1 ],
"midpoints" : [ 133.833336, 297.0, 94.75, 297.0 ],
"source" : [ "obj-7", 1 ]
}
}
]
}
,
"patching_rect" : [ 66.0, 1658.5, 62.0, 22.0 ],
"saved_object_attributes" : {
"description" : "",
"digest" : "",
"globalpatchername" : "",
"style" : "",
"tags" : ""
}
,
"style" : "",
"text" : "p rawtocc"
}
}
, {
"box" : {
"id" : "obj-151",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 342.5, 1359.5, 66.0, 22.0 ],
"style" : "",
"text" : "pack 0. 19"
}
}
, {
"box" : {
"id" : "obj-153",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 258.5, 1359.5, 66.0, 22.0 ],
"style" : "",
"text" : "pack 0. 18"
}
}
, {
"box" : {
"id" : "obj-155",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 174.5, 1359.5, 66.0, 22.0 ],
"style" : "",
"text" : "pack 0. 17"
}
}
, {
"box" : {
"id" : "obj-156",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 95.0, 1359.5, 66.0, 22.0 ],
"style" : "",
"text" : "pack 0. 16"
}
}
, {
"box" : {
"id" : "obj-157",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patcher" : {
"fileversion" : 1,
"appversion" : {
"major" : 7,
"minor" : 3,
"revision" : 5,
"architecture" : "x64",
"modernui" : 1
}
,
"rect" : [ 469.0, 165.0, 640.0, 480.0 ],
"bglocked" : 0,
"openinpresentation" : 0,
"default_fontsize" : 12.0,
"default_fontface" : 0,
"default_fontname" : "Arial",
"gridonopen" : 1,
"gridsize" : [ 15.0, 15.0 ],
"gridsnaponopen" : 1,
"objectsnaponopen" : 1,
"statusbarvisible" : 2,
"toolbarvisible" : 1,
"lefttoolbarpinned" : 0,
"toptoolbarpinned" : 0,
"righttoolbarpinned" : 0,
"bottomtoolbarpinned" : 0,
"toolbars_unpinned_last_save" : 0,
"tallnewobj" : 0,
"boxanimatetime" : 200,
"enablehscroll" : 1,
"enablevscroll" : 1,
"devicewidth" : 0.0,
"description" : "",
"digest" : "",
"tags" : "",
"style" : "",
"subpatcher_template" : "",
"boxes" : [ {
"box" : {
"id" : "obj-4",
"maxclass" : "newobj",
"numinlets" : 4,
"numoutlets" : 4,
"outlettype" : [ "", "", "", "" ],
"patching_rect" : [ 46.0, 57.0, 92.0, 22.0 ],
"style" : "",
"text" : "route b list float"
}
}
, {
"box" : {
"id" : "obj-7",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 2,
"outlettype" : [ "float", "int" ],
"patching_rect" : [ 70.333336, 101.0, 73.0, 22.0 ],
"style" : "",
"text" : "unpack 0. 0"
}
}
, {
"box" : {
"comment" : "",
"id" : "obj-3",
"index" : 1,
"maxclass" : "outlet",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 55.25, 365.0, 30.0, 30.0 ],
"style" : ""
}
}
, {
"box" : {
"id" : "obj-119",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 70.333336, 191.0, 41.0, 22.0 ],
"style" : "",
"text" : "round"
}
}
, {
"box" : {
"id" : "obj-118",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 2,
"outlettype" : [ "bang", "bang" ],
"patching_rect" : [ 55.25, 258.5, 29.5, 22.0 ],
"style" : "",
"text" : "b"
}
}
, {
"box" : {
"id" : "obj-114",
"maxclass" : "newobj",
"numinlets" : 3,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 55.25, 311.0, 79.0, 22.0 ],
"style" : "",
"text" : "pack 176 0 0"
}
}
, {
"box" : {
"id" : "obj-113",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "int" ],
"patching_rect" : [ 70.333336, 222.0, 33.0, 22.0 ],
"style" : "",
"text" : "int 0"
}
}
, {
"box" : {
"id" : "obj-112",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "float" ],
"patching_rect" : [ 70.333336, 154.0, 42.0, 22.0 ],
"style" : "",
"text" : "* 127."
}
}
, {
"box" : {
"comment" : "",
"id" : "obj-2",
"index" : 1,
"maxclass" : "inlet",
"numinlets" : 0,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 46.0, 9.0, 30.0, 30.0 ],
"style" : ""
}
}
],
"lines" : [ {
"patchline" : {
"destination" : [ "obj-119", 0 ],
"midpoints" : [ 79.833336, 177.0, 79.833336, 177.0 ],
"source" : [ "obj-112", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-114", 2 ],
"midpoints" : [ 79.833336, 255.0, 124.75, 255.0 ],
"order" : 0,
"source" : [ "obj-113", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-118", 0 ],
"midpoints" : [ 79.833336, 246.0, 66.0, 246.0, 66.0, 252.0, 64.75, 252.0 ],
"order" : 1,
"source" : [ "obj-113", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-3", 0 ],
"midpoints" : [ 64.75, 336.0, 64.75, 336.0 ],
"source" : [ "obj-114", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-114", 0 ],
"midpoints" : [ 64.75, 282.0, 64.75, 282.0 ],
"source" : [ "obj-118", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-113", 0 ],
"midpoints" : [ 79.833336, 216.0, 79.833336, 216.0 ],
"source" : [ "obj-119", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-4", 0 ],
"source" : [ "obj-2", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-112", 0 ],
"midpoints" : [ 104.166667, 81.0, 57.0, 81.0, 57.0, 141.0, 79.833336, 141.0 ],
"source" : [ "obj-4", 2 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-113", 0 ],
"midpoints" : [ 55.5, 216.0, 79.833336, 216.0 ],
"source" : [ "obj-4", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-7", 0 ],
"midpoints" : [ 79.833333, 81.0, 79.833336, 81.0 ],
"source" : [ "obj-4", 1 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-112", 0 ],
"midpoints" : [ 79.833336, 126.0, 79.833336, 126.0 ],
"source" : [ "obj-7", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-114", 1 ],
"midpoints" : [ 133.833336, 297.0, 94.75, 297.0 ],
"source" : [ "obj-7", 1 ]
}
}
]
}
,
"patching_rect" : [ 95.0, 1398.5, 62.0, 22.0 ],
"saved_object_attributes" : {
"description" : "",
"digest" : "",
"globalpatchername" : "",
"style" : "",
"tags" : ""
}
,
"style" : "",
"text" : "p rawtocc"
}
}
, {
"box" : {
"id" : "obj-143",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 336.5, 1072.5, 66.0, 22.0 ],
"style" : "",
"text" : "pack 0. 31"
}
}
, {
"box" : {
"id" : "obj-145",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 252.5, 1072.5, 66.0, 22.0 ],
"style" : "",
"text" : "pack 0. 30"
}
}
, {
"box" : {
"id" : "obj-147",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 168.5, 1072.5, 66.0, 22.0 ],
"style" : "",
"text" : "pack 0. 97"
}
}
, {
"box" : {
"id" : "obj-148",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 88.0, 1123.5, 66.0, 22.0 ],
"style" : "",
"text" : "pack 0. 89"
}
}
, {
"box" : {
"id" : "obj-140",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 0,
"patching_rect" : [ 1846.25, 597.0, 37.0, 22.0 ],
"style" : "",
"text" : "dac~"
}
}
, {
"box" : {
"id" : "obj-128",
"maxclass" : "meter~",
"numinlets" : 1,
"numoutlets" : 1,
"outlettype" : [ "float" ],
"patching_rect" : [ 1785.25, 590.0, 19.0, 65.0 ],
"style" : ""
}
}
, {
"box" : {
"id" : "obj-124",
"maxclass" : "meter~",
"numinlets" : 1,
"numoutlets" : 1,
"outlettype" : [ "float" ],
"patching_rect" : [ 1767.25, 590.0, 19.0, 65.0 ],
"style" : ""
}
}
, {
"box" : {
"id" : "obj-111",
"maxclass" : "toggle",
"numinlets" : 1,
"numoutlets" : 1,
"outlettype" : [ "int" ],
"parameter_enable" : 0,
"patching_rect" : [ 1767.25, 458.0, 24.0, 24.0 ],
"style" : ""
}
}
, {
"box" : {
"id" : "obj-21",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 2,
"outlettype" : [ "signal", "signal" ],
"patching_rect" : [ 1767.25, 500.0, 37.0, 22.0 ],
"style" : "",
"text" : "adc~"
}
}
, {
"box" : {
"id" : "obj-60",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 354.0, 747.0, 66.0, 22.0 ],
"style" : "",
"text" : "pack 0. 29"
}
}
, {
"box" : {
"id" : "obj-63",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 270.0, 747.0, 66.0, 22.0 ],
"style" : "",
"text" : "pack 0. 28"
}
}
, {
"box" : {
"id" : "obj-65",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 186.0, 747.0, 66.0, 22.0 ],
"style" : "",
"text" : "pack 0. 96"
}
}
, {
"box" : {
"id" : "obj-66",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 108.0, 818.0, 66.0, 22.0 ],
"style" : "",
"text" : "pack 0. 88"
}
}
, {
"box" : {
"id" : "obj-56",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 358.0, 151.0, 73.0, 22.0 ],
"style" : "",
"text" : "pack 0. 104"
}
}
, {
"box" : {
"id" : "obj-54",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 274.0, 151.0, 66.0, 22.0 ],
"style" : "",
"text" : "pack 0. 54"
}
}
, {
"box" : {
"id" : "obj-19",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 190.0, 151.0, 73.0, 22.0 ],
"style" : "",
"text" : "pack 0. 103"
}
}
, {
"box" : {
"id" : "obj-121",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 110.5, 151.0, 66.0, 22.0 ],
"style" : "",
"text" : "pack 0. 53"
}
}
, {
"box" : {
"id" : "obj-120",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patcher" : {
"fileversion" : 1,
"appversion" : {
"major" : 7,
"minor" : 3,
"revision" : 5,
"architecture" : "x64",
"modernui" : 1
}
,
"rect" : [ 469.0, 165.0, 640.0, 480.0 ],
"bglocked" : 0,
"openinpresentation" : 0,
"default_fontsize" : 12.0,
"default_fontface" : 0,
"default_fontname" : "Arial",
"gridonopen" : 1,
"gridsize" : [ 15.0, 15.0 ],
"gridsnaponopen" : 1,
"objectsnaponopen" : 1,
"statusbarvisible" : 2,
"toolbarvisible" : 1,
"lefttoolbarpinned" : 0,
"toptoolbarpinned" : 0,
"righttoolbarpinned" : 0,
"bottomtoolbarpinned" : 0,
"toolbars_unpinned_last_save" : 0,
"tallnewobj" : 0,
"boxanimatetime" : 200,
"enablehscroll" : 1,
"enablevscroll" : 1,
"devicewidth" : 0.0,
"description" : "",
"digest" : "",
"tags" : "",
"style" : "",
"subpatcher_template" : "",
"boxes" : [ {
"box" : {
"id" : "obj-4",
"maxclass" : "newobj",
"numinlets" : 4,
"numoutlets" : 4,
"outlettype" : [ "", "", "", "" ],
"patching_rect" : [ 46.0, 57.0, 92.0, 22.0 ],
"style" : "",
"text" : "route b list float"
}
}
, {
"box" : {
"id" : "obj-7",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 2,
"outlettype" : [ "float", "int" ],
"patching_rect" : [ 70.333336, 101.0, 73.0, 22.0 ],
"style" : "",
"text" : "unpack 0. 0"
}
}
, {
"box" : {
"comment" : "",
"id" : "obj-3",
"index" : 1,
"maxclass" : "outlet",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 55.25, 365.0, 30.0, 30.0 ],
"style" : ""
}
}
, {
"box" : {
"id" : "obj-119",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 70.333336, 191.0, 41.0, 22.0 ],
"style" : "",
"text" : "round"
}
}
, {
"box" : {
"id" : "obj-118",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 2,
"outlettype" : [ "bang", "bang" ],
"patching_rect" : [ 55.25, 258.5, 29.5, 22.0 ],
"style" : "",
"text" : "b"
}
}
, {
"box" : {
"id" : "obj-114",
"maxclass" : "newobj",
"numinlets" : 3,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 55.25, 311.0, 79.0, 22.0 ],
"style" : "",
"text" : "pack 176 0 0"
}
}
, {
"box" : {
"id" : "obj-113",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "int" ],
"patching_rect" : [ 70.333336, 222.0, 33.0, 22.0 ],
"style" : "",
"text" : "int 0"
}
}
, {
"box" : {
"id" : "obj-112",
"maxclass" : "newobj",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "float" ],
"patching_rect" : [ 70.333336, 154.0, 42.0, 22.0 ],
"style" : "",
"text" : "* 127."
}
}
, {
"box" : {
"comment" : "",
"id" : "obj-2",
"index" : 1,
"maxclass" : "inlet",
"numinlets" : 0,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 46.0, 9.0, 30.0, 30.0 ],
"style" : ""
}
}
],
"lines" : [ {
"patchline" : {
"destination" : [ "obj-119", 0 ],
"midpoints" : [ 79.833336, 177.0, 79.833336, 177.0 ],
"source" : [ "obj-112", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-114", 2 ],
"midpoints" : [ 79.833336, 255.0, 124.75, 255.0 ],
"order" : 0,
"source" : [ "obj-113", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-118", 0 ],
"midpoints" : [ 79.833336, 246.0, 66.0, 246.0, 66.0, 252.0, 64.75, 252.0 ],
"order" : 1,
"source" : [ "obj-113", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-3", 0 ],
"midpoints" : [ 64.75, 336.0, 64.75, 336.0 ],
"source" : [ "obj-114", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-114", 0 ],
"midpoints" : [ 64.75, 282.0, 64.75, 282.0 ],
"source" : [ "obj-118", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-113", 0 ],
"midpoints" : [ 79.833336, 216.0, 79.833336, 216.0 ],
"source" : [ "obj-119", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-4", 0 ],
"source" : [ "obj-2", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-112", 0 ],
"midpoints" : [ 104.166667, 81.0, 57.0, 81.0, 57.0, 141.0, 79.833336, 141.0 ],
"source" : [ "obj-4", 2 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-113", 0 ],
"midpoints" : [ 55.5, 216.0, 79.833336, 216.0 ],
"source" : [ "obj-4", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-7", 0 ],
"midpoints" : [ 79.833333, 81.0, 79.833336, 81.0 ],
"source" : [ "obj-4", 1 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-112", 0 ],
"midpoints" : [ 79.833336, 126.0, 79.833336, 126.0 ],
"source" : [ "obj-7", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-114", 1 ],
"midpoints" : [ 133.833336, 297.0, 94.75, 297.0 ],
"source" : [ "obj-7", 1 ]
}
}
]
}
,
"patching_rect" : [ 110.5, 190.0, 62.0, 22.0 ],
"saved_object_attributes" : {
"description" : "",
"digest" : "",
"globalpatchername" : "",
"style" : "",
"tags" : ""
}
,
"style" : "",
"text" : "p rawtocc"
}
}
, {
"box" : {
"id" : "obj-109",
"maxclass" : "comment",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 715.5, 804.0, 83.0, 20.0 ],
"presentation" : 1,
"presentation_rect" : [ 1138.0, 97.25, 83.0, 20.0 ],
"style" : "",
"text" : "dev board out",
"textcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"textjustification" : 1
}
}
, {
"box" : {
"id" : "obj-110",
"maxclass" : "comment",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 802.5, 804.0, 61.0, 20.0 ],
"presentation" : 1,
"presentation_rect" : [ 1035.233398, 97.25, 61.0, 20.0 ],
"style" : "",
"text" : "virtual out",
"textcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"textjustification" : 1
}
}
, {
"box" : {
"id" : "obj-108",
"maxclass" : "comment",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 824.5, 23.0, 83.0, 20.0 ],
"presentation" : 1,
"presentation_rect" : [ 1175.5, 31.5, 83.0, 20.0 ],
"style" : "",
"text" : "dev board in",
"textcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"textjustification" : 1
}
}
, {
"box" : {
"id" : "obj-107",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 1,
"outlettype" : [ "int" ],
"patching_rect" : [ 789.5, 47.0, 42.0, 22.0 ],
"presentation" : 1,
"presentation_rect" : [ 1116.0, 55.5, 42.0, 22.0 ],
"style" : "",
"text" : "midiin"
}
}
, {
"box" : {
"id" : "obj-106",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 808.5, 777.0, 49.0, 22.0 ],
"presentation" : 1,
"presentation_rect" : [ 1041.233398, 119.25, 49.0, 22.0 ],
"style" : "",
"text" : "midiout"
}
}
, {
"box" : {
"id" : "obj-105",
"maxclass" : "comment",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 758.5, 23.0, 53.0, 20.0 ],
"presentation" : 1,
"presentation_rect" : [ 1109.5, 31.5, 53.0, 20.0 ],
"style" : "",
"text" : "virtual in",
"textcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"textjustification" : 1
}
}
, {
"box" : {
"id" : "obj-103",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 1,
"outlettype" : [ "int" ],
"patching_rect" : [ 865.5, 47.0, 42.0, 22.0 ],
"presentation" : 1,
"presentation_rect" : [ 1197.0, 55.5, 42.0, 22.0 ],
"style" : "",
"text" : "midiin"
}
}
, {
"box" : {
"activedialcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"activeneedlecolor" : [ 0.65098, 0.666667, 0.662745, 1.0 ],
"dialcolor" : [ 0.862745, 0.870588, 0.878431, 1.0 ],
"focusbordercolor" : [ 0.0, 0.0, 0.0, 1.0 ],
"id" : "obj-102",
"maxclass" : "live.dial",
"needlecolor" : [ 0.32549, 0.345098, 0.372549, 1.0 ],
"numinlets" : 1,
"numoutlets" : 2,
"outlettype" : [ "", "float" ],
"panelcolor" : [ 0.65098, 0.666667, 0.662745, 1.0 ],
"parameter_enable" : 1,
"patching_rect" : [ 342.5, 1518.0, 44.0, 47.0 ],
"presentation" : 1,
"presentation_rect" : [ 931.0, 52.0, 44.0, 47.0 ],
"saved_attribute_attributes" : {
"valueof" : {
"parameter_longname" : "lfo target",
"parameter_shortname" : "target",
"parameter_type" : 2,
"parameter_enum" : [ "cutoff", "shape", "pitch" ],
"parameter_unitstyle" : 0,
"parameter_steps" : 3
}
}
,
"textcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"tribordercolor" : [ 0.32549, 0.345098, 0.372549, 1.0 ],
"tricolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"varname" : "lfo_target"
}
}
, {
"box" : {
"activedialcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"activeneedlecolor" : [ 0.65098, 0.666667, 0.662745, 1.0 ],
"dialcolor" : [ 0.862745, 0.870588, 0.878431, 1.0 ],
"focusbordercolor" : [ 0.0, 0.0, 0.0, 1.0 ],
"id" : "obj-96",
"maxclass" : "live.dial",
"needlecolor" : [ 0.32549, 0.345098, 0.372549, 1.0 ],
"numinlets" : 1,
"numoutlets" : 2,
"outlettype" : [ "", "float" ],
"panelcolor" : [ 0.65098, 0.666667, 0.662745, 1.0 ],
"parameter_enable" : 1,
"patching_rect" : [ 275.0, 1518.0, 44.0, 47.0 ],
"presentation" : 1,
"presentation_rect" : [ 867.0, 110.0, 44.0, 47.0 ],
"saved_attribute_attributes" : {
"valueof" : {
"parameter_longname" : "lfo int",
"parameter_shortname" : "lfo_int",
"parameter_type" : 1,
"parameter_unitstyle" : 0
}
}
,
"textcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"tribordercolor" : [ 0.32549, 0.345098, 0.372549, 1.0 ],
"tricolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"varname" : "lfo_int"
}
}
, {
"box" : {
"activedialcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"activeneedlecolor" : [ 0.65098, 0.666667, 0.662745, 1.0 ],
"dialcolor" : [ 0.862745, 0.870588, 0.878431, 1.0 ],
"focusbordercolor" : [ 0.0, 0.0, 0.0, 1.0 ],
"id" : "obj-97",
"maxclass" : "live.dial",
"needlecolor" : [ 0.32549, 0.345098, 0.372549, 1.0 ],
"numinlets" : 1,
"numoutlets" : 2,
"outlettype" : [ "", "float" ],
"panelcolor" : [ 0.65098, 0.666667, 0.662745, 1.0 ],
"parameter_enable" : 1,
"patching_rect" : [ 211.0, 1518.0, 44.0, 47.0 ],
"presentation" : 1,
"presentation_rect" : [ 867.0, 52.0, 44.0, 47.0 ],
"saved_attribute_attributes" : {
"valueof" : {
"parameter_longname" : "lfo rate",
"parameter_shortname" : "rate",
"parameter_type" : 1,
"parameter_unitstyle" : 0
}
}
,
"textcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"tribordercolor" : [ 0.32549, 0.345098, 0.372549, 1.0 ],
"tricolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"varname" : "lfo_rate"
}
}
, {
"box" : {
"activedialcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"activeneedlecolor" : [ 0.65098, 0.666667, 0.662745, 1.0 ],
"dialcolor" : [ 0.862745, 0.870588, 0.878431, 1.0 ],
"focusbordercolor" : [ 0.0, 0.0, 0.0, 1.0 ],
"id" : "obj-98",
"maxclass" : "live.dial",
"needlecolor" : [ 0.32549, 0.345098, 0.372549, 1.0 ],
"numinlets" : 1,
"numoutlets" : 2,
"outlettype" : [ "", "float" ],
"panelcolor" : [ 0.65098, 0.666667, 0.662745, 1.0 ],
"parameter_enable" : 1,
"patching_rect" : [ 145.5, 1518.0, 44.0, 47.0 ],
"presentation" : 1,
"presentation_rect" : [ 789.0, 110.0, 44.0, 47.0 ],
"saved_attribute_attributes" : {
"valueof" : {
"parameter_longname" : "lfo mode",
"parameter_shortname" : "mode",
"parameter_type" : 2,
"parameter_enum" : [ "bpm", "slow", "fast" ],
"parameter_unitstyle" : 0,
"parameter_steps" : 3
}
}
,
"textcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"tribordercolor" : [ 0.32549, 0.345098, 0.372549, 1.0 ],
"tricolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"varname" : "lfo_mode"
}
}
, {
"box" : {
"activedialcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"activeneedlecolor" : [ 0.65098, 0.666667, 0.662745, 1.0 ],
"dialcolor" : [ 0.862745, 0.870588, 0.878431, 1.0 ],
"focusbordercolor" : [ 0.0, 0.0, 0.0, 1.0 ],
"id" : "obj-99",
"maxclass" : "live.dial",
"needlecolor" : [ 0.32549, 0.345098, 0.372549, 1.0 ],
"numinlets" : 1,
"numoutlets" : 2,
"outlettype" : [ "", "float" ],
"panelcolor" : [ 0.65098, 0.666667, 0.662745, 1.0 ],
"parameter_enable" : 1,
"patching_rect" : [ 83.5, 1518.0, 44.0, 47.0 ],
"presentation" : 1,
"presentation_rect" : [ 789.0, 52.0, 44.0, 47.0 ],
"saved_attribute_attributes" : {
"valueof" : {
"parameter_longname" : "lfo wave",
"parameter_shortname" : "wave",
"parameter_type" : 2,
"parameter_enum" : [ "square", "triangle", "saw" ],
"parameter_unitstyle" : 0,
"parameter_steps" : 3
}
}
,
"textcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"tribordercolor" : [ 0.32549, 0.345098, 0.372549, 1.0 ],
"tricolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"varname" : "lfo_wave"
}
}
, {
"box" : {
"bgcolor" : [ 0.376471, 0.384314, 0.4, 0.0 ],
"bgcolor2" : [ 0.376471, 0.384314, 0.4, 0.0 ],
"bgfillcolor_angle" : 270.0,
"bgfillcolor_autogradient" : 0.0,
"bgfillcolor_color" : [ 0.290196, 0.309804, 0.301961, 0.0 ],
"bgfillcolor_color1" : [ 0.376471, 0.384314, 0.4, 0.0 ],
"bgfillcolor_color2" : [ 0.290196, 0.309804, 0.301961, 1.0 ],
"bgfillcolor_proportion" : 0.39,
"bgfillcolor_type" : "color",
"fontface" : 1,
"gradient" : 1,
"id" : "obj-100",
"maxclass" : "message",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 211.0, 1479.0, 34.0, 22.0 ],
"presentation" : 1,
"presentation_rect" : [ 837.5, 18.5, 103.0, 22.0 ],
"style" : "",
"text" : "LFO",
"textjustification" : 1
}
}
, {
"box" : {
"angle" : 270.0,
"bgcolor" : [ 0.0, 0.0, 0.0, 1.0 ],
"border" : 1,
"bordercolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"id" : "obj-101",
"maxclass" : "panel",
"mode" : 0,
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 58.0, 1479.0, 366.0, 117.0 ],
"presentation" : 1,
"presentation_rect" : [ 764.0, 4.5, 239.0, 171.5 ],
"proportion" : 0.39,
"rounded" : 16,
"style" : ""
}
}
, {
"box" : {
"activedialcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"activeneedlecolor" : [ 0.65098, 0.666667, 0.662745, 1.0 ],
"dialcolor" : [ 0.862745, 0.870588, 0.878431, 1.0 ],
"focusbordercolor" : [ 0.0, 0.0, 0.0, 1.0 ],
"id" : "obj-95",
"maxclass" : "live.dial",
"needlecolor" : [ 0.32549, 0.345098, 0.372549, 1.0 ],
"numinlets" : 1,
"numoutlets" : 2,
"outlettype" : [ "", "float" ],
"panelcolor" : [ 0.65098, 0.666667, 0.662745, 1.0 ],
"parameter_enable" : 1,
"patching_rect" : [ 285.0, 1257.0, 44.0, 47.0 ],
"presentation" : 1,
"presentation_rect" : [ 684.0, 110.0, 44.0, 47.0 ],
"saved_attribute_attributes" : {
"valueof" : {
"parameter_longname" : "eg release",
"parameter_shortname" : "release",
"parameter_type" : 1,
"parameter_unitstyle" : 0
}
}
,
"textcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"tribordercolor" : [ 0.32549, 0.345098, 0.372549, 1.0 ],
"tricolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"varname" : "eg_rel"
}
}
, {
"box" : {
"activedialcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"activeneedlecolor" : [ 0.65098, 0.666667, 0.662745, 1.0 ],
"dialcolor" : [ 0.862745, 0.870588, 0.878431, 1.0 ],
"focusbordercolor" : [ 0.0, 0.0, 0.0, 1.0 ],
"id" : "obj-94",
"maxclass" : "live.dial",
"needlecolor" : [ 0.32549, 0.345098, 0.372549, 1.0 ],
"numinlets" : 1,
"numoutlets" : 2,
"outlettype" : [ "", "float" ],
"panelcolor" : [ 0.65098, 0.666667, 0.662745, 1.0 ],
"parameter_enable" : 1,
"patching_rect" : [ 221.0, 1257.0, 44.0, 47.0 ],
"presentation" : 1,
"presentation_rect" : [ 684.0, 52.0, 44.0, 47.0 ],
"saved_attribute_attributes" : {
"valueof" : {
"parameter_longname" : "eg sustain",
"parameter_shortname" : "sustain",
"parameter_type" : 1,
"parameter_unitstyle" : 0
}
}
,
"textcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"tribordercolor" : [ 0.32549, 0.345098, 0.372549, 1.0 ],
"tricolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"varname" : "eg_sust"
}
}
, {
"box" : {
"activedialcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"activeneedlecolor" : [ 0.65098, 0.666667, 0.662745, 1.0 ],
"dialcolor" : [ 0.862745, 0.870588, 0.878431, 1.0 ],
"focusbordercolor" : [ 0.0, 0.0, 0.0, 1.0 ],
"id" : "obj-93",
"maxclass" : "live.dial",
"needlecolor" : [ 0.32549, 0.345098, 0.372549, 1.0 ],
"numinlets" : 1,
"numoutlets" : 2,
"outlettype" : [ "", "float" ],
"panelcolor" : [ 0.65098, 0.666667, 0.662745, 1.0 ],
"parameter_enable" : 1,
"patching_rect" : [ 155.5, 1257.0, 44.0, 47.0 ],
"presentation" : 1,
"presentation_rect" : [ 606.0, 110.0, 44.0, 47.0 ],
"saved_attribute_attributes" : {
"valueof" : {
"parameter_longname" : "eg decay",
"parameter_shortname" : "decay",
"parameter_type" : 1,
"parameter_unitstyle" : 0
}
}
,
"textcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"tribordercolor" : [ 0.32549, 0.345098, 0.372549, 1.0 ],
"tricolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"varname" : "eg_dec"
}
}
, {
"box" : {
"activedialcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"activeneedlecolor" : [ 0.65098, 0.666667, 0.662745, 1.0 ],
"dialcolor" : [ 0.862745, 0.870588, 0.878431, 1.0 ],
"focusbordercolor" : [ 0.0, 0.0, 0.0, 1.0 ],
"id" : "obj-92",
"maxclass" : "live.dial",
"needlecolor" : [ 0.32549, 0.345098, 0.372549, 1.0 ],
"numinlets" : 1,
"numoutlets" : 2,
"outlettype" : [ "", "float" ],
"panelcolor" : [ 0.65098, 0.666667, 0.662745, 1.0 ],
"parameter_enable" : 1,
"patching_rect" : [ 93.5, 1257.0, 44.0, 47.0 ],
"presentation" : 1,
"presentation_rect" : [ 606.0, 52.0, 44.0, 47.0 ],
"saved_attribute_attributes" : {
"valueof" : {
"parameter_longname" : "eg attack",
"parameter_shortname" : "attack",
"parameter_type" : 1,
"parameter_unitstyle" : 0
}
}
,
"textcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"tribordercolor" : [ 0.32549, 0.345098, 0.372549, 1.0 ],
"tricolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"varname" : "eg_att"
}
}
, {
"box" : {
"bgcolor" : [ 0.376471, 0.384314, 0.4, 0.0 ],
"bgcolor2" : [ 0.376471, 0.384314, 0.4, 0.0 ],
"bgfillcolor_angle" : 270.0,
"bgfillcolor_autogradient" : 0.0,
"bgfillcolor_color" : [ 0.290196, 0.309804, 0.301961, 0.0 ],
"bgfillcolor_color1" : [ 0.376471, 0.384314, 0.4, 0.0 ],
"bgfillcolor_color2" : [ 0.290196, 0.309804, 0.301961, 1.0 ],
"bgfillcolor_proportion" : 0.39,
"bgfillcolor_type" : "color",
"fontface" : 1,
"gradient" : 1,
"id" : "obj-90",
"maxclass" : "message",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 221.0, 1218.0, 60.0, 22.0 ],
"presentation" : 1,
"presentation_rect" : [ 616.5, 18.5, 103.0, 22.0 ],
"style" : "",
"text" : "AMP. EG",
"textjustification" : 1
}
}
, {
"box" : {
"angle" : 270.0,
"bgcolor" : [ 0.0, 0.0, 0.0, 1.0 ],
"border" : 1,
"bordercolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"id" : "obj-91",
"maxclass" : "panel",
"mode" : 0,
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 68.0, 1218.0, 366.0, 117.0 ],
"presentation" : 1,
"presentation_rect" : [ 581.0, 4.5, 178.0, 171.5 ],
"proportion" : 0.39,
"rounded" : 16,
"style" : ""
}
}
, {
"box" : {
"id" : "obj-87",
"maxclass" : "live.slider",
"modulationcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"numinlets" : 1,
"numoutlets" : 2,
"outlettype" : [ "", "float" ],
"parameter_enable" : 1,
"patching_rect" : [ 951.5, 351.0, 39.0, 95.0 ],
"presentation" : 1,
"presentation_rect" : [ 501.0, 227.75, 70.0, 133.0 ],
"saved_attribute_attributes" : {
"valueof" : {
"parameter_longname" : "octave",
"parameter_shortname" : "octave",
"parameter_type" : 1,
"parameter_mmin" : 1.0,
"parameter_mmax" : 6.0,
"parameter_unitstyle" : 0,
"parameter_steps" : 6
}
}
,
"slidercolor" : [ 0.65098, 0.666667, 0.662745, 1.0 ],
"textcolor" : [ 0.862745, 0.870588, 0.878431, 1.0 ],
"tricolor" : [ 0.862745, 0.870588, 0.878431, 1.0 ],
"trioncolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"varname" : "base"
}
}
, {
"box" : {
"id" : "obj-17",
"maxclass" : "newobj",
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 732.5, 777.0, 49.0, 22.0 ],
"presentation" : 1,
"presentation_rect" : [ 1123.0, 119.25, 49.0, 22.0 ],
"style" : "",
"text" : "midiout"
}
}
, {
"box" : {
"activedialcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"activeneedlecolor" : [ 0.65098, 0.666667, 0.662745, 1.0 ],
"dialcolor" : [ 0.862745, 0.870588, 0.878431, 1.0 ],
"focusbordercolor" : [ 0.0, 0.0, 0.0, 1.0 ],
"id" : "obj-8",
"maxclass" : "live.dial",
"needlecolor" : [ 0.32549, 0.345098, 0.372549, 1.0 ],
"numinlets" : 1,
"numoutlets" : 2,
"outlettype" : [ "", "float" ],
"panelcolor" : [ 0.65098, 0.666667, 0.662745, 1.0 ],
"parameter_enable" : 1,
"patching_rect" : [ 312.5, 965.0, 44.0, 47.0 ],
"presentation" : 1,
"presentation_rect" : [ 501.0, 110.0, 44.0, 47.0 ],
"saved_attribute_attributes" : {
"valueof" : {
"parameter_longname" : "sendfx depth",
"parameter_shortname" : "depth",
"parameter_type" : 1,
"parameter_unitstyle" : 0
}
}
,
"textcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"tribordercolor" : [ 0.32549, 0.345098, 0.372549, 1.0 ],
"tricolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"varname" : "sendfx_depth"
}
}
, {
"box" : {
"activedialcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"activeneedlecolor" : [ 0.65098, 0.666667, 0.662745, 1.0 ],
"dialcolor" : [ 0.862745, 0.870588, 0.878431, 1.0 ],
"focusbordercolor" : [ 0.0, 0.0, 0.0, 1.0 ],
"id" : "obj-13",
"maxclass" : "live.dial",
"needlecolor" : [ 0.32549, 0.345098, 0.372549, 1.0 ],
"numinlets" : 1,
"numoutlets" : 2,
"outlettype" : [ "", "float" ],
"panelcolor" : [ 0.65098, 0.666667, 0.662745, 1.0 ],
"parameter_enable" : 1,
"patching_rect" : [ 238.5, 965.0, 44.0, 47.0 ],
"presentation" : 1,
"presentation_rect" : [ 501.0, 52.0, 44.0, 47.0 ],
"saved_attribute_attributes" : {
"valueof" : {
"parameter_longname" : "sendfx time",
"parameter_shortname" : "time",
"parameter_type" : 1,
"parameter_unitstyle" : 0
}
}
,
"textcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"tribordercolor" : [ 0.32549, 0.345098, 0.372549, 1.0 ],
"tricolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"varname" : "sendfx_time"
}
}
, {
"box" : {
"activedialcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"activeneedlecolor" : [ 0.65098, 0.666667, 0.662745, 1.0 ],
"dialcolor" : [ 0.862745, 0.870588, 0.878431, 1.0 ],
"focusbordercolor" : [ 0.0, 0.0, 0.0, 1.0 ],
"id" : "obj-15",
"maxclass" : "live.dial",
"needlecolor" : [ 0.32549, 0.345098, 0.372549, 1.0 ],
"numinlets" : 1,
"numoutlets" : 2,
"outlettype" : [ "", "float" ],
"parameter_enable" : 1,
"patching_rect" : [ 164.0, 965.0, 44.0, 47.0 ],
"presentation" : 1,
"presentation_rect" : [ 424.0, 114.0, 44.0, 47.0 ],
"saved_attribute_attributes" : {
"valueof" : {
"parameter_longname" : "sendfx subtype",
"parameter_shortname" : "subtype",
"parameter_type" : 1,
"parameter_mmax" : 19.0,
"parameter_initial" : [ 0.0 ],
"parameter_unitstyle" : 0,
"parameter_steps" : 16
}
}
,
"textcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"tribordercolor" : [ 0.32549, 0.345098, 0.372549, 1.0 ],
"tricolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"varname" : "sendfx_subtype"
}
}
, {
"box" : {
"activedialcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"activeneedlecolor" : [ 0.65098, 0.666667, 0.662745, 1.0 ],
"dialcolor" : [ 0.862745, 0.870588, 0.878431, 1.0 ],
"focusbordercolor" : [ 0.0, 0.0, 0.0, 1.0 ],
"id" : "obj-16",
"maxclass" : "live.dial",
"needlecolor" : [ 0.32549, 0.345098, 0.372549, 1.0 ],
"numinlets" : 1,
"numoutlets" : 2,
"outlettype" : [ "", "float" ],
"parameter_enable" : 1,
"patching_rect" : [ 99.0, 965.0, 44.0, 47.0 ],
"presentation" : 1,
"presentation_rect" : [ 424.0, 52.0, 44.0, 47.0 ],
"saved_attribute_attributes" : {
"valueof" : {
"parameter_longname" : "sendfx type",
"parameter_shortname" : "type",
"parameter_type" : 2,
"parameter_enum" : [ "off", "delay", "reverb" ],
"parameter_initial" : [ 0.0 ],
"parameter_unitstyle" : 0,
"parameter_steps" : 3
}
}
,
"textcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"tribordercolor" : [ 0.32549, 0.345098, 0.372549, 1.0 ],
"tricolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"varname" : "sendfx_type"
}
}
, {
"box" : {
"activedialcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"activeneedlecolor" : [ 0.65098, 0.666667, 0.662745, 1.0 ],
"dialcolor" : [ 0.862745, 0.870588, 0.878431, 1.0 ],
"focusbordercolor" : [ 0.0, 0.0, 0.0, 1.0 ],
"id" : "obj-7",
"maxclass" : "live.dial",
"needlecolor" : [ 0.32549, 0.345098, 0.372549, 1.0 ],
"numinlets" : 1,
"numoutlets" : 2,
"outlettype" : [ "", "float" ],
"panelcolor" : [ 0.65098, 0.666667, 0.662745, 1.0 ],
"parameter_enable" : 1,
"patching_rect" : [ 311.5, 627.5, 44.0, 47.0 ],
"presentation" : 1,
"presentation_rect" : [ 308.0, 110.0, 44.0, 47.0 ],
"saved_attribute_attributes" : {
"valueof" : {
"parameter_longname" : "modfx depth",
"parameter_shortname" : "depth",
"parameter_type" : 1,
"parameter_unitstyle" : 0
}
}
,
"textcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"tribordercolor" : [ 0.32549, 0.345098, 0.372549, 1.0 ],
"tricolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"varname" : "modfx_depth"
}
}
, {
"box" : {
"activedialcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"activeneedlecolor" : [ 0.65098, 0.666667, 0.662745, 1.0 ],
"dialcolor" : [ 0.862745, 0.870588, 0.878431, 1.0 ],
"focusbordercolor" : [ 0.0, 0.0, 0.0, 1.0 ],
"id" : "obj-5",
"maxclass" : "live.dial",
"needlecolor" : [ 0.32549, 0.345098, 0.372549, 1.0 ],
"numinlets" : 1,
"numoutlets" : 2,
"outlettype" : [ "", "float" ],
"panelcolor" : [ 0.65098, 0.666667, 0.662745, 1.0 ],
"parameter_enable" : 1,
"patching_rect" : [ 237.5, 627.5, 44.0, 47.0 ],
"presentation" : 1,
"presentation_rect" : [ 308.0, 52.0, 44.0, 47.0 ],
"saved_attribute_attributes" : {
"valueof" : {
"parameter_longname" : "modfx speed",
"parameter_shortname" : "speed",
"parameter_type" : 1,
"parameter_unitstyle" : 0
}
}
,
"textcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"tribordercolor" : [ 0.32549, 0.345098, 0.372549, 1.0 ],
"tricolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"varname" : "modfx_speed"
}
}
, {
"box" : {
"activedialcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"activeneedlecolor" : [ 0.65098, 0.666667, 0.662745, 1.0 ],
"dialcolor" : [ 0.862745, 0.870588, 0.878431, 1.0 ],
"focusbordercolor" : [ 0.0, 0.0, 0.0, 1.0 ],
"id" : "obj-1",
"maxclass" : "live.dial",
"needlecolor" : [ 0.32549, 0.345098, 0.372549, 1.0 ],
"numinlets" : 1,
"numoutlets" : 2,
"outlettype" : [ "", "float" ],
"parameter_enable" : 1,
"patching_rect" : [ 163.0, 627.5, 44.0, 47.0 ],
"presentation" : 1,
"presentation_rect" : [ 229.0, 110.0, 44.0, 47.0 ],
"saved_attribute_attributes" : {
"valueof" : {
"parameter_longname" : "modfx subtype",
"parameter_shortname" : "subtype",
"parameter_type" : 1,
"parameter_mmax" : 15.0,
"parameter_initial" : [ 0.0 ],
"parameter_unitstyle" : 0,
"parameter_steps" : 16
}
}
,
"textcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"tribordercolor" : [ 0.32549, 0.345098, 0.372549, 1.0 ],
"tricolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"varname" : "modfx_subtype"
}
}
, {
"box" : {
"activedialcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"activeneedlecolor" : [ 0.65098, 0.666667, 0.662745, 1.0 ],
"dialcolor" : [ 0.862745, 0.870588, 0.878431, 1.0 ],
"focusbordercolor" : [ 0.0, 0.0, 0.0, 1.0 ],
"id" : "obj-27",
"maxclass" : "live.dial",
"needlecolor" : [ 0.32549, 0.345098, 0.372549, 1.0 ],
"numinlets" : 1,
"numoutlets" : 2,
"outlettype" : [ "", "float" ],
"parameter_enable" : 1,
"patching_rect" : [ 98.0, 627.5, 44.0, 47.0 ],
"presentation" : 1,
"presentation_rect" : [ 229.0, 52.0, 44.0, 47.0 ],
"saved_attribute_attributes" : {
"valueof" : {
"parameter_longname" : "modfx type",
"parameter_shortname" : "type",
"parameter_type" : 2,
"parameter_enum" : [ "off", "chorus", "ensemble", "phaser", "flanger", "user" ],
"parameter_initial" : [ 0.0 ],
"parameter_unitstyle" : 0,
"parameter_steps" : 6
}
}
,
"textcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"tribordercolor" : [ 0.32549, 0.345098, 0.372549, 1.0 ],
"tricolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"varname" : "modfx_type"
}
}
, {
"box" : {
"bgcolor" : [ 0.376471, 0.384314, 0.4, 0.0 ],
"bgcolor2" : [ 0.376471, 0.384314, 0.4, 0.0 ],
"bgfillcolor_angle" : 270.0,
"bgfillcolor_autogradient" : 0.0,
"bgfillcolor_color" : [ 0.290196, 0.309804, 0.301961, 0.0 ],
"bgfillcolor_color1" : [ 0.376471, 0.384314, 0.4, 0.0 ],
"bgfillcolor_color2" : [ 0.290196, 0.309804, 0.301961, 1.0 ],
"bgfillcolor_proportion" : 0.39,
"bgfillcolor_type" : "color",
"fontface" : 1,
"gradient" : 1,
"id" : "obj-26",
"maxclass" : "message",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 198.0, 930.0, 116.0, 22.0 ],
"presentation" : 1,
"presentation_rect" : [ 432.5, 18.5, 103.0, 22.0 ],
"style" : "",
"text" : "DELAY/REVERB",
"textjustification" : 1
}
}
, {
"box" : {
"bgcolor" : [ 0.376471, 0.384314, 0.4, 0.0 ],
"bgcolor2" : [ 0.376471, 0.384314, 0.4, 0.0 ],
"bgfillcolor_angle" : 270.0,
"bgfillcolor_autogradient" : 0.0,
"bgfillcolor_color" : [ 0.290196, 0.309804, 0.301961, 0.0 ],
"bgfillcolor_color1" : [ 0.376471, 0.384314, 0.4, 0.0 ],
"bgfillcolor_color2" : [ 0.290196, 0.309804, 0.301961, 1.0 ],
"bgfillcolor_proportion" : 0.39,
"bgfillcolor_type" : "color",
"fontface" : 1,
"gradient" : 1,
"id" : "obj-25",
"maxclass" : "message",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 184.5, 592.5, 97.0, 22.0 ],
"presentation" : 1,
"presentation_rect" : [ 265.5, 18.5, 57.0, 22.0 ],
"style" : "",
"text" : "MOD FX",
"textjustification" : 1
}
}
, {
"box" : {
"bgcolor" : [ 0.376471, 0.384314, 0.4, 0.0 ],
"bgcolor2" : [ 0.376471, 0.384314, 0.4, 0.0 ],
"bgfillcolor_angle" : 270.0,
"bgfillcolor_autogradient" : 0.0,
"bgfillcolor_color" : [ 0.290196, 0.309804, 0.301961, 0.0 ],
"bgfillcolor_color1" : [ 0.376471, 0.384314, 0.4, 0.0 ],
"bgfillcolor_color2" : [ 0.290196, 0.309804, 0.301961, 1.0 ],
"bgfillcolor_proportion" : 0.39,
"bgfillcolor_type" : "color",
"fontface" : 1,
"gradient" : 1,
"id" : "obj-24",
"maxclass" : "message",
"numinlets" : 2,
"numoutlets" : 1,
"outlettype" : [ "" ],
"patching_rect" : [ 217.5, 14.0, 97.0, 22.0 ],
"presentation" : 1,
"presentation_rect" : [ 51.5, 18.5, 97.0, 22.0 ],
"style" : "",
"text" : "MULTI ENGINE",
"textjustification" : 1
}
}
, {
"box" : {
"angle" : 270.0,
"bgcolor" : [ 0.0, 0.0, 0.0, 1.0 ],
"border" : 1,
"bordercolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"id" : "obj-12",
"maxclass" : "panel",
"mode" : 0,
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 73.0, 930.0, 366.0, 117.0 ],
"presentation" : 1,
"presentation_rect" : [ 397.0, 4.5, 178.0, 171.5 ],
"proportion" : 0.39,
"rounded" : 16,
"style" : ""
}
}
, {
"box" : {
"angle" : 270.0,
"bgcolor" : [ 0.0, 0.0, 0.0, 1.0 ],
"border" : 1,
"bordercolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"id" : "obj-11",
"maxclass" : "panel",
"mode" : 0,
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 80.0, 592.5, 370.0, 117.0 ],
"presentation" : 1,
"presentation_rect" : [ 204.0, 4.5, 187.0, 171.5 ],
"proportion" : 0.39,
"rounded" : 16,
"style" : ""
}
}
, {
"box" : {
"activedialcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"activeneedlecolor" : [ 0.65098, 0.666667, 0.662745, 1.0 ],
"dialcolor" : [ 0.862745, 0.870588, 0.878431, 1.0 ],
"focusbordercolor" : [ 0.0, 0.0, 0.0, 1.0 ],
"id" : "obj-6",
"maxclass" : "live.dial",
"needlecolor" : [ 0.32549, 0.345098, 0.372549, 1.0 ],
"numinlets" : 1,
"numoutlets" : 2,
"outlettype" : [ "", "float" ],
"parameter_enable" : 1,
"patching_rect" : [ 306.0, 47.0, 44.0, 47.0 ],
"presentation" : 1,
"presentation_rect" : [ 114.0, 114.0, 44.0, 47.0 ],
"saved_attribute_attributes" : {
"valueof" : {
"parameter_linknames" : 1,
"parameter_longname" : "multi shift shape",
"parameter_shortname" : "s+shape",
"parameter_type" : 0,
"parameter_unitstyle" : 0
}
}
,
"textcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"tribordercolor" : [ 0.32549, 0.345098, 0.372549, 1.0 ],
"tricolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"varname" : "multi shift shape"
}
}
, {
"box" : {
"activedialcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"activeneedlecolor" : [ 0.65098, 0.666667, 0.662745, 1.0 ],
"dialcolor" : [ 0.862745, 0.870588, 0.878431, 1.0 ],
"focusbordercolor" : [ 0.0, 0.0, 0.0, 1.0 ],
"id" : "obj-4",
"maxclass" : "live.dial",
"needlecolor" : [ 0.32549, 0.345098, 0.372549, 1.0 ],
"numinlets" : 1,
"numoutlets" : 2,
"outlettype" : [ "", "float" ],
"panelcolor" : [ 0.65098, 0.666667, 0.662745, 1.0 ],
"parameter_enable" : 1,
"patching_rect" : [ 237.0, 47.0, 44.0, 47.0 ],
"presentation" : 1,
"presentation_rect" : [ 114.0, 52.0, 44.0, 47.0 ],
"saved_attribute_attributes" : {
"valueof" : {
"parameter_longname" : "multi shape",
"parameter_shortname" : "shape",
"parameter_type" : 1,
"parameter_unitstyle" : 0
}
}
,
"textcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"tribordercolor" : [ 0.32549, 0.345098, 0.372549, 1.0 ],
"tricolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"varname" : "multi_shape"
}
}
, {
"box" : {
"activedialcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"activeneedlecolor" : [ 0.65098, 0.666667, 0.662745, 1.0 ],
"dialcolor" : [ 0.862745, 0.870588, 0.878431, 1.0 ],
"focusbordercolor" : [ 0.0, 0.0, 0.0, 1.0 ],
"id" : "obj-3",
"maxclass" : "live.dial",
"needlecolor" : [ 0.32549, 0.345098, 0.372549, 1.0 ],
"numinlets" : 1,
"numoutlets" : 2,
"outlettype" : [ "", "float" ],
"parameter_enable" : 1,
"patching_rect" : [ 165.0, 47.0, 44.0, 47.0 ],
"presentation" : 1,
"presentation_rect" : [ 37.0, 114.0, 44.0, 47.0 ],
"saved_attribute_attributes" : {
"valueof" : {
"parameter_longname" : "multi select",
"parameter_shortname" : "select",
"parameter_type" : 1,
"parameter_mmax" : 15.0,
"parameter_initial" : [ 0.0 ],
"parameter_unitstyle" : 0,
"parameter_steps" : 16
}
}
,
"textcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"tribordercolor" : [ 0.32549, 0.345098, 0.372549, 1.0 ],
"tricolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"varname" : "multi_select"
}
}
, {
"box" : {
"activedialcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"activeneedlecolor" : [ 0.65098, 0.666667, 0.662745, 1.0 ],
"dialcolor" : [ 0.862745, 0.870588, 0.878431, 1.0 ],
"focusbordercolor" : [ 0.0, 0.0, 0.0, 1.0 ],
"id" : "obj-2",
"maxclass" : "live.dial",
"needlecolor" : [ 0.32549, 0.345098, 0.372549, 1.0 ],
"numinlets" : 1,
"numoutlets" : 2,
"outlettype" : [ "", "float" ],
"parameter_enable" : 1,
"patching_rect" : [ 86.0, 47.0, 44.0, 47.0 ],
"presentation" : 1,
"presentation_rect" : [ 37.0, 52.0, 44.0, 47.0 ],
"saved_attribute_attributes" : {
"valueof" : {
"parameter_longname" : "multi type",
"parameter_shortname" : "type",
"parameter_type" : 2,
"parameter_enum" : [ "noise", "vpm", "user" ],
"parameter_initial" : [ 0.0 ],
"parameter_unitstyle" : 0,
"parameter_steps" : 3
}
}
,
"textcolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"tribordercolor" : [ 0.32549, 0.345098, 0.372549, 1.0 ],
"tricolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"varname" : "multi_type"
}
}
, {
"box" : {
"angle" : 270.0,
"bgcolor" : [ 0.0, 0.0, 0.0, 1.0 ],
"border" : 1,
"bordercolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"id" : "obj-9",
"maxclass" : "panel",
"mode" : 0,
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 70.0, 14.0, 521.0, 118.0 ],
"presentation" : 1,
"presentation_rect" : [ 6.0, 4.5, 191.0, 171.5 ],
"proportion" : 0.39,
"rounded" : 16,
"style" : ""
}
}
, {
"box" : {
"angle" : 270.0,
"bgcolor" : [ 0.0, 0.0, 0.0, 1.0 ],
"border" : 1,
"bordercolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"id" : "obj-228",
"maxclass" : "panel",
"mode" : 0,
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 913.625, 3.0, 1050.0, 685.0 ],
"presentation" : 1,
"presentation_rect" : [ 397.0, 181.5, 877.0, 278.5 ],
"proportion" : 0.39,
"rounded" : 16,
"style" : ""
}
}
, {
"box" : {
"angle" : 270.0,
"bgcolor" : [ 0.0, 0.0, 0.0, 1.0 ],
"border" : 1,
"bordercolor" : [ 1.0, 1.0, 1.0, 1.0 ],
"id" : "obj-18",
"maxclass" : "panel",
"mode" : 0,
"numinlets" : 1,
"numoutlets" : 0,
"patching_rect" : [ 603.0, 3.0, 285.0, 840.5 ],
"presentation" : 1,
"presentation_rect" : [ 1008.0, 4.5, 266.0, 171.5 ],
"proportion" : 0.39,
"rounded" : 16,
"style" : ""
}
}
],
"lines" : [ {
"patchline" : {
"destination" : [ "obj-65", 0 ],
"source" : [ "obj-1", 1 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-30", 0 ],
"source" : [ "obj-10", 1 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-167", 0 ],
"midpoints" : [ 377.0, 1605.0, 401.0, 1605.0 ],
"source" : [ "obj-102", 1 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-106", 0 ],
"midpoints" : [ 875.0, 600.0, 818.0, 600.0 ],
"source" : [ "obj-103", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-17", 0 ],
"midpoints" : [ 799.0, 600.0, 742.0, 600.0 ],
"source" : [ "obj-107", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-21", 0 ],
"source" : [ "obj-111", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-17", 0 ],
"midpoints" : [ 120.0, 267.0, 742.0, 267.0 ],
"source" : [ "obj-120", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-120", 0 ],
"source" : [ "obj-121", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-141", 0 ],
"midpoints" : [ 269.0, 486.0, 120.5, 486.0 ],
"source" : [ "obj-129", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-145", 0 ],
"midpoints" : [ 273.0, 1058.0, 262.0, 1058.0 ],
"source" : [ "obj-13", 1 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-129", 0 ],
"source" : [ "obj-132", 1 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-141", 0 ],
"midpoints" : [ 497.0, 486.0, 120.5, 486.0 ],
"source" : [ "obj-133", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-133", 0 ],
"source" : [ "obj-136", 1 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-141", 0 ],
"midpoints" : [ 420.0, 486.0, 120.5, 486.0 ],
"source" : [ "obj-137", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-17", 0 ],
"midpoints" : [ 37.5, 882.0, 702.0, 882.0, 702.0, 771.0, 742.0, 771.0 ],
"source" : [ "obj-138", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-137", 0 ],
"source" : [ "obj-139", 1 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-23", 0 ],
"source" : [ "obj-14", 1 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-17", 0 ],
"midpoints" : [ 120.5, 528.0, 742.0, 528.0 ],
"source" : [ "obj-141", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-10", 0 ],
"source" : [ "obj-142", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-132", 0 ],
"source" : [ "obj-142", 2 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-136", 0 ],
"source" : [ "obj-142", 5 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-139", 0 ],
"source" : [ "obj-142", 4 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-57", 0 ],
"source" : [ "obj-142", 1 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-67", 0 ],
"source" : [ "obj-142", 3 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-180", 0 ],
"midpoints" : [ 346.0, 1150.0, 26.5, 1150.0 ],
"source" : [ "obj-143", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-180", 0 ],
"midpoints" : [ 262.0, 1150.0, 26.5, 1150.0 ],
"source" : [ "obj-145", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-180", 0 ],
"midpoints" : [ 178.0, 1150.0, 26.5, 1150.0 ],
"source" : [ "obj-147", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-180", 0 ],
"midpoints" : [ 97.5, 1151.0, 26.5, 1151.0 ],
"source" : [ "obj-148", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-147", 0 ],
"midpoints" : [ 198.5, 1058.0, 178.0, 1058.0 ],
"source" : [ "obj-15", 1 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-157", 0 ],
"midpoints" : [ 352.0, 1392.0, 104.5, 1392.0 ],
"source" : [ "obj-151", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-157", 0 ],
"midpoints" : [ 268.0, 1392.0, 104.5, 1392.0 ],
"source" : [ "obj-153", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-157", 0 ],
"midpoints" : [ 184.0, 1392.0, 104.5, 1392.0 ],
"source" : [ "obj-155", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-157", 0 ],
"midpoints" : [ 104.5, 1383.0, 104.5, 1383.0 ],
"source" : [ "obj-156", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-17", 0 ],
"midpoints" : [ 104.5, 1431.0, 702.0, 1431.0, 702.0, 771.0, 742.0, 771.0 ],
"source" : [ "obj-157", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-165", 0 ],
"midpoints" : [ 323.0, 1653.0, 75.5, 1653.0 ],
"source" : [ "obj-159", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-179", 0 ],
"source" : [ "obj-16", 1 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-165", 0 ],
"midpoints" : [ 239.0, 1653.0, 75.5, 1653.0 ],
"source" : [ "obj-161", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-165", 0 ],
"source" : [ "obj-163", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-165", 0 ],
"midpoints" : [ 75.5, 1643.0, 75.5, 1643.0 ],
"source" : [ "obj-164", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-17", 0 ],
"midpoints" : [ 75.5, 1692.0, 702.0, 1692.0, 702.0, 771.0, 742.0, 771.0 ],
"source" : [ "obj-165", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-165", 0 ],
"midpoints" : [ 401.0, 1653.0, 75.5, 1653.0 ],
"source" : [ "obj-167", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-207", 0 ],
"order" : 1,
"source" : [ "obj-168", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-232", 0 ],
"order" : 0,
"source" : [ "obj-168", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-168", 1 ],
"source" : [ "obj-173", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-168", 0 ],
"source" : [ "obj-177", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-58", 0 ],
"source" : [ "obj-178", 1 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-84", 0 ],
"source" : [ "obj-178", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-181", 0 ],
"source" : [ "obj-179", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-61", 0 ],
"source" : [ "obj-179", 1 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-17", 0 ],
"midpoints" : [ 26.5, 1176.0, 702.0, 1176.0, 702.0, 771.0, 742.0, 771.0 ],
"source" : [ "obj-180", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-180", 0 ],
"source" : [ "obj-181", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-221", 0 ],
"source" : [ "obj-182", 1 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-14", 0 ],
"order" : 0,
"source" : [ "obj-186", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-182", 0 ],
"order" : 2,
"source" : [ "obj-186", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-216", 0 ],
"order" : 1,
"source" : [ "obj-186", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-120", 0 ],
"midpoints" : [ 199.5, 186.0, 120.0, 186.0 ],
"source" : [ "obj-19", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-121", 0 ],
"source" : [ "obj-2", 1 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-220", 0 ],
"source" : [ "obj-206", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-188", 0 ],
"source" : [ "obj-207", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-189", 0 ],
"source" : [ "obj-207", 1 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-190", 0 ],
"source" : [ "obj-207", 3 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-191", 0 ],
"source" : [ "obj-207", 2 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-192", 0 ],
"source" : [ "obj-207", 7 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-193", 0 ],
"source" : [ "obj-207", 6 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-194", 0 ],
"source" : [ "obj-207", 5 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-195", 0 ],
"source" : [ "obj-207", 4 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-196", 0 ],
"source" : [ "obj-207", 15 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-197", 0 ],
"source" : [ "obj-207", 14 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-198", 0 ],
"source" : [ "obj-207", 13 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-199", 0 ],
"source" : [ "obj-207", 12 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-200", 0 ],
"source" : [ "obj-207", 11 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-201", 0 ],
"source" : [ "obj-207", 10 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-202", 0 ],
"source" : [ "obj-207", 9 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-203", 0 ],
"source" : [ "obj-207", 8 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-124", 0 ],
"order" : 1,
"source" : [ "obj-21", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-128", 0 ],
"order" : 1,
"source" : [ "obj-21", 1 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-140", 1 ],
"order" : 0,
"source" : [ "obj-21", 1 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-140", 0 ],
"order" : 0,
"source" : [ "obj-21", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-206", 0 ],
"source" : [ "obj-216", 1 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-226", 2 ],
"source" : [ "obj-220", 2 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-226", 1 ],
"source" : [ "obj-220", 1 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-226", 0 ],
"source" : [ "obj-220", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-206", 1 ],
"source" : [ "obj-221", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-23", 1 ],
"source" : [ "obj-223", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-239", 0 ],
"source" : [ "obj-227", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-28", 0 ],
"source" : [ "obj-23", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-186", 0 ],
"source" : [ "obj-232", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-235", 1 ],
"order" : 0,
"source" : [ "obj-237", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-238", 1 ],
"order" : 0,
"source" : [ "obj-237", 1 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-254", 1 ],
"order" : 1,
"source" : [ "obj-237", 1 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-254", 0 ],
"order" : 1,
"source" : [ "obj-237", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-168", 0 ],
"order" : 0,
"source" : [ "obj-239", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-249", 0 ],
"order" : 1,
"source" : [ "obj-239", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-242", 0 ],
"order" : 1,
"source" : [ "obj-240", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-248", 0 ],
"order" : 0,
"source" : [ "obj-240", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-168", 0 ],
"source" : [ "obj-242", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-244", 0 ],
"source" : [ "obj-243", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-239", 0 ],
"source" : [ "obj-244", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-246", 0 ],
"source" : [ "obj-245", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-240", 0 ],
"source" : [ "obj-246", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-177", 0 ],
"source" : [ "obj-248", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-177", 0 ],
"source" : [ "obj-249", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-2", 0 ],
"source" : [ "obj-253", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-3", 0 ],
"source" : [ "obj-253", 1 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-4", 0 ],
"source" : [ "obj-253", 2 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-6", 0 ],
"source" : [ "obj-253", 3 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-1", 0 ],
"source" : [ "obj-255", 1 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-27", 0 ],
"source" : [ "obj-255", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-5", 0 ],
"source" : [ "obj-255", 2 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-7", 0 ],
"source" : [ "obj-255", 3 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-13", 0 ],
"source" : [ "obj-256", 2 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-15", 0 ],
"source" : [ "obj-256", 1 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-16", 0 ],
"source" : [ "obj-256", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-8", 0 ],
"source" : [ "obj-256", 3 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-92", 0 ],
"source" : [ "obj-257", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-93", 0 ],
"source" : [ "obj-257", 1 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-94", 0 ],
"source" : [ "obj-257", 2 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-95", 0 ],
"source" : [ "obj-257", 3 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-102", 0 ],
"source" : [ "obj-258", 4 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-96", 0 ],
"source" : [ "obj-258", 3 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-97", 0 ],
"source" : [ "obj-258", 2 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-98", 0 ],
"source" : [ "obj-258", 1 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-99", 0 ],
"source" : [ "obj-258", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-178", 0 ],
"source" : [ "obj-27", 1 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-221", 1 ],
"source" : [ "obj-28", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-19", 0 ],
"source" : [ "obj-3", 1 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-141", 0 ],
"midpoints" : [ 120.5, 471.0, 120.5, 471.0 ],
"source" : [ "obj-30", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-68", 0 ],
"source" : [ "obj-34", 1 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-54", 0 ],
"source" : [ "obj-4", 1 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-14", 0 ],
"order" : 0,
"source" : [ "obj-40", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-182", 0 ],
"order" : 2,
"source" : [ "obj-40", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-216", 0 ],
"order" : 1,
"source" : [ "obj-40", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-63", 0 ],
"source" : [ "obj-5", 1 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-120", 0 ],
"midpoints" : [ 283.5, 186.0, 120.0, 186.0 ],
"source" : [ "obj-54", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-141", 0 ],
"midpoints" : [ 193.5, 486.0, 120.5, 486.0 ],
"source" : [ "obj-55", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-120", 0 ],
"midpoints" : [ 367.5, 186.0, 120.0, 186.0 ],
"source" : [ "obj-56", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-55", 0 ],
"source" : [ "obj-57", 1 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-59", 0 ],
"source" : [ "obj-58", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-66", 0 ],
"source" : [ "obj-59", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-56", 0 ],
"source" : [ "obj-6", 1 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-138", 0 ],
"midpoints" : [ 363.5, 851.0, 37.5, 851.0 ],
"source" : [ "obj-60", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-62", 0 ],
"source" : [ "obj-61", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-148", 0 ],
"source" : [ "obj-62", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-138", 0 ],
"midpoints" : [ 279.5, 850.0, 37.5, 850.0 ],
"source" : [ "obj-63", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-141", 0 ],
"midpoints" : [ 346.0, 486.0, 120.5, 486.0 ],
"source" : [ "obj-64", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-138", 0 ],
"midpoints" : [ 195.5, 850.0, 37.5, 850.0 ],
"source" : [ "obj-65", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-138", 0 ],
"midpoints" : [ 117.5, 852.0, 37.5, 852.0 ],
"source" : [ "obj-66", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-64", 0 ],
"source" : [ "obj-67", 1 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-120", 0 ],
"midpoints" : [ 534.5, 186.0, 120.0, 186.0 ],
"source" : [ "obj-68", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-60", 0 ],
"source" : [ "obj-7", 1 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-143", 0 ],
"midpoints" : [ 347.0, 1013.0, 346.0, 1013.0 ],
"source" : [ "obj-8", 1 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-34", 0 ],
"source" : [ "obj-83", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-138", 0 ],
"source" : [ "obj-84", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-222", 0 ],
"source" : [ "obj-87", 0 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-156", 0 ],
"midpoints" : [ 128.0, 1344.0, 104.5, 1344.0 ],
"source" : [ "obj-92", 1 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-155", 0 ],
"midpoints" : [ 190.0, 1344.0, 184.0, 1344.0 ],
"source" : [ "obj-93", 1 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-153", 0 ],
"midpoints" : [ 255.5, 1344.0, 268.0, 1344.0 ],
"source" : [ "obj-94", 1 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-151", 0 ],
"midpoints" : [ 319.5, 1344.0, 352.0, 1344.0 ],
"source" : [ "obj-95", 1 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-159", 0 ],
"midpoints" : [ 309.5, 1605.0, 323.0, 1605.0 ],
"source" : [ "obj-96", 1 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-161", 0 ],
"midpoints" : [ 245.5, 1605.0, 239.0, 1605.0 ],
"source" : [ "obj-97", 1 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-163", 0 ],
"midpoints" : [ 180.0, 1605.0, 155.0, 1605.0 ],
"source" : [ "obj-98", 1 ]
}
}
, {
"patchline" : {
"destination" : [ "obj-164", 0 ],
"midpoints" : [ 118.0, 1605.0, 75.5, 1605.0 ],
"source" : [ "obj-99", 1 ]
}
}
],
"parameters" : {
"obj-57" : [ "param2", "param2", 0 ],
"obj-5" : [ "modfx speed", "speed", 0 ],
"obj-94" : [ "eg sustain", "sustain", 0 ],
"obj-1" : [ "modfx subtype", "subtype", 0 ],
"obj-4" : [ "multi shape", "shape", 0 ],
"obj-3" : [ "multi select", "select", 0 ],
"obj-34" : [ "portamento", "portamento", 0 ],
"obj-97" : [ "lfo rate", "rate", 0 ],
"obj-27" : [ "modfx type", "type", 0 ],
"obj-136" : [ "param6", "param6", 0 ],
"obj-173" : [ "tempo", "tempo", 0 ],
"obj-99" : [ "lfo wave", "wave", 0 ],
"obj-2" : [ "multi type", "type", 0 ],
"obj-6" : [ "multi shift shape", "s+shape", 0 ],
"obj-132" : [ "param3", "param3", 0 ],
"obj-8" : [ "sendfx depth", "depth", 0 ],
"obj-13" : [ "sendfx time", "time", 0 ],
"obj-93" : [ "eg decay", "decay", 0 ],
"obj-139" : [ "param5", "param5", 0 ],
"obj-95" : [ "eg release", "release", 0 ],
"obj-10" : [ "param1", "param1", 0 ],
"obj-92" : [ "eg attack", "attack", 0 ],
"obj-87" : [ "octave", "octave", 0 ],
"obj-102" : [ "lfo target", "target", 0 ],
"obj-96" : [ "lfo int", "lfo_int", 0 ],
"obj-67" : [ "param4", "param4", 0 ],
"obj-15" : [ "sendfx subtype", "subtype", 0 ],
"obj-98" : [ "lfo mode", "mode", 0 ],
"obj-16" : [ "sendfx type", "type", 0 ],
"obj-7" : [ "modfx depth", "depth", 0 ]
}
,
"dependency_cache" : [ ],
"autosave" : 0,
"textcolor" : [ 0.862745, 0.870588, 0.878431, 1.0 ]
}
}
| Max | 3 | smith-xyz/logue-sdk | devboards/rev_a/devboard.maxpat | [
"BSD-3-Clause"
] |
.\" **************************************************************************
.\" * _ _ ____ _
.\" * Project ___| | | | _ \| |
.\" * / __| | | | |_) | |
.\" * | (__| |_| | _ <| |___
.\" * \___|\___/|_| \_\_____|
.\" *
.\" * Copyright (C) 1998 - 2021, Daniel Stenberg, <daniel@haxx.se>, et al.
.\" *
.\" * This software is licensed as described in the file COPYING, which
.\" * you should have received as part of this distribution. The terms
.\" * are also available at https://curl.se/docs/copyright.html.
.\" *
.\" * You may opt to use, copy, modify, merge, publish, distribute and/or sell
.\" * copies of the Software, and permit persons to whom the Software is
.\" * furnished to do so, under the terms of the COPYING file.
.\" *
.\" * This software is distributed on an "AS IS" basis, WITHOUT WARRANTY OF ANY
.\" * KIND, either express or implied.
.\" *
.\" **************************************************************************
.\"
.TH CURLOPT_CAINFO_BLOB 3 "31 March 2021" "libcurl 7.77.0" "curl_easy_setopt options"
.SH NAME
CURLOPT_CAINFO_BLOB \- Certificate Authority (CA) bundle in PEM format
.SH SYNOPSIS
#include <curl/curl.h>
CURLcode curl_easy_setopt(CURL *handle, CURLOPT_CAINFO_BLOB, struct curl_blob *stblob);
.SH DESCRIPTION
Pass a pointer to a curl_blob structure, which contains information (pointer
and size) about a memory block with binary data of PEM encoded content holding
one or more certificates to verify the HTTPS server with.
If \fICURLOPT_SSL_VERIFYPEER(3)\fP is zero and you avoid verifying the
server's certificate, \fICURLOPT_CAINFO_BLOB(3)\fP is not needed.
This option overrides \fICURLOPT_CAINFO(3)\fP.
.SH DEFAULT
NULL
.SH PROTOCOLS
All TLS based protocols: HTTPS, FTPS, IMAPS, POP3S, SMTPS etc.
.SH EXAMPLE
.nf
char *strpem; /* strpem must point to a PEM string */
CURL *curl = curl_easy_init();
if(curl) {
struct curl_blob blob;
curl_easy_setopt(curl, CURLOPT_URL, "https://example.com/");
blob.data = strpem;
blob.len = strlen(strpem);
blob.flags = CURL_BLOB_COPY;
curl_easy_setopt(curl, CURLOPT_CAINFO_BLOB, &blob);
ret = curl_easy_perform(curl);
curl_easy_cleanup(curl);
}
.fi
.SH AVAILABILITY
Added in 7.77.0.
This option is supported by the BearSSL (since 7.79.0),
OpenSSL, Secure Transport and Schannel backends.
.SH RETURN VALUE
Returns CURLE_OK if the option is supported, CURLE_UNKNOWN_OPTION if not, or
CURLE_OUT_OF_MEMORY if there was insufficient heap space.
.SH "SEE ALSO"
.BR CURLOPT_CAINFO "(3), " CURLOPT_CAPATH "(3), "
.BR CURLOPT_SSL_VERIFYPEER "(3), " CURLOPT_SSL_VERIFYHOST "(3), "
| Groff | 4 | striezel/curl | docs/libcurl/opts/CURLOPT_CAINFO_BLOB.3 | [
"curl"
] |
<?xml version="1.0" encoding="utf-8"?>
<xsl:stylesheet xmlns:xsl="http://www.w3.org/1999/XSL/Transform"
version="1.0"
xmlns:fo="http://www.w3.org/1999/XSL/Format">
<xsl:import href="http://docbook.sourceforge.net/release/xsl/current/fo/docbook.xsl"/>
<xsl:include href="stylesheet-common.xsl" />
<xsl:param name="fop1.extensions" select="1"></xsl:param>
<xsl:param name="tablecolumns.extension" select="0"></xsl:param>
<xsl:param name="toc.max.depth">3</xsl:param>
<xsl:param name="ulink.footnotes" select="1"></xsl:param>
<xsl:param name="use.extensions" select="1"></xsl:param>
<xsl:param name="variablelist.as.blocks" select="1"></xsl:param>
<xsl:param name="orderedlist.label.width">1.5em</xsl:param>
<xsl:attribute-set name="monospace.verbatim.properties"
use-attribute-sets="verbatim.properties monospace.properties">
<xsl:attribute name="wrap-option">wrap</xsl:attribute>
</xsl:attribute-set>
<xsl:attribute-set name="nongraphical.admonition.properties">
<xsl:attribute name="border-style">solid</xsl:attribute>
<xsl:attribute name="border-width">1pt</xsl:attribute>
<xsl:attribute name="border-color">black</xsl:attribute>
<xsl:attribute name="padding-start">12pt</xsl:attribute>
<xsl:attribute name="padding-end">12pt</xsl:attribute>
<xsl:attribute name="padding-top">6pt</xsl:attribute>
<xsl:attribute name="padding-bottom">6pt</xsl:attribute>
</xsl:attribute-set>
<xsl:attribute-set name="admonition.title.properties">
<xsl:attribute name="text-align">center</xsl:attribute>
</xsl:attribute-set>
<!-- Make all tables default to left alignment, for consistency with HTML -->
<xsl:attribute-set name="table.table.properties">
<xsl:attribute name="text-align">left</xsl:attribute>
</xsl:attribute-set>
<!-- fix missing space after vertical simplelist
https://github.com/docbook/xslt10-stylesheets/issues/31 -->
<xsl:attribute-set name="normal.para.spacing">
<xsl:attribute name="space-after.optimum">1em</xsl:attribute>
<xsl:attribute name="space-after.minimum">0.8em</xsl:attribute>
<xsl:attribute name="space-after.maximum">1.2em</xsl:attribute>
</xsl:attribute-set>
<!-- Change display of some elements -->
<xsl:template match="command">
<xsl:call-template name="inline.monoseq"/>
</xsl:template>
<xsl:template match="confgroup" mode="bibliography.mode">
<fo:inline>
<xsl:apply-templates select="conftitle/text()" mode="bibliography.mode"/>
<xsl:text>, </xsl:text>
<xsl:apply-templates select="confdates/text()" mode="bibliography.mode"/>
<xsl:value-of select="$biblioentry.item.separator"/>
</fo:inline>
</xsl:template>
<xsl:template match="isbn" mode="bibliography.mode">
<fo:inline>
<xsl:text>ISBN </xsl:text>
<xsl:apply-templates mode="bibliography.mode"/>
<xsl:value-of select="$biblioentry.item.separator"/>
</fo:inline>
</xsl:template>
<!-- formatting for entries in tables of functions -->
<xsl:template match="entry[@role='func_table_entry']/para">
<fo:block margin-left="4em" text-align="left">
<xsl:if test="self::para[@role='func_signature']">
<xsl:attribute name="text-indent">-3.5em</xsl:attribute>
</xsl:if>
<xsl:apply-templates/>
</fo:block>
</xsl:template>
<!-- formatting for entries in tables of catalog/view columns -->
<xsl:template match="entry[@role='catalog_table_entry']/para">
<fo:block margin-left="4em" text-align="left">
<xsl:if test="self::para[@role='column_definition']">
<xsl:attribute name="text-indent">-3.5em</xsl:attribute>
</xsl:if>
<xsl:apply-templates/>
</fo:block>
</xsl:template>
<!-- overrides stylesheet-common.xsl -->
<!-- FOP needs us to be explicit about the font to use for right arrow -->
<xsl:template match="returnvalue">
<fo:inline font-family="{$symbol.font.family}">→ </fo:inline>
<xsl:call-template name="inline.monoseq"/>
</xsl:template>
<!-- FOP needs us to be explicit about use of symbol font in some cases -->
<xsl:template match="phrase[@role='symbol_font']">
<fo:inline font-family="{$symbol.font.family}"><xsl:value-of select="."/></fo:inline>
</xsl:template>
<!-- bug fix from <https://sourceforge.net/p/docbook/bugs/1360/#831b> -->
<xsl:template match="varlistentry/term" mode="xref-to">
<xsl:param name="verbose" select="1"/>
<xsl:apply-templates mode="no.anchor.mode"/>
</xsl:template>
<!-- include refsects in PDF bookmarks
(https://github.com/docbook/xslt10-stylesheets/issues/46) -->
<xsl:template match="refsect1|refsect2|refsect3"
mode="bookmark">
<xsl:variable name="id">
<xsl:call-template name="object.id"/>
</xsl:variable>
<xsl:variable name="bookmark-label">
<xsl:apply-templates select="." mode="object.title.markup"/>
</xsl:variable>
<fo:bookmark internal-destination="{$id}">
<xsl:attribute name="starting-state">
<xsl:value-of select="$bookmarks.state"/>
</xsl:attribute>
<fo:bookmark-title>
<xsl:value-of select="normalize-space($bookmark-label)"/>
</fo:bookmark-title>
<xsl:apply-templates select="*" mode="bookmark"/>
</fo:bookmark>
</xsl:template>
</xsl:stylesheet>
| XSLT | 4 | lmwnshn/postgres | doc/src/sgml/stylesheet-fo.xsl | [
"PostgreSQL"
] |
type Foo3* = object
a1: int
| Nimrod | 2 | JohnAD/Nim | tests/errmsgs/m8794.nim | [
"MIT"
] |
// @allowJs: true
// @checkJs: true
// @noEmit: true
// @Filename: /a.js
// Bad: missing a type
/** @typedef T */
const t = 0;
// OK: missing a type, but have property tags.
/**
* @typedef Person
* @property {string} name
*/
/** @type Person */
const person = { name: "" };
| TypeScript | 4 | nilamjadhav/TypeScript | tests/cases/compiler/jsdocTypedefMissingType.ts | [
"Apache-2.0"
] |
ng_opts='addon asset-sizes b build completion d destroy doc e2e g generate get github-pages:deploy gh-pages:deploy h help i init install lint make-this-awesome new s serve server set t test update v version -h --help'
_ng_completion () {
local words cword opts
read -Ac words
read -cn cword
let cword-=1
case $words[cword] in
addon )
opts='-b --blueprint -d -dir --directory --dry-run -sb --skip-bower -sg --skip-git -sn --skip-npm -v --verbose'
;;
asset-sizes )
opts='-o --output-path'
;;
b | build )
opts='--environment --output-path --suppress-sizes --target --watch --watcher -dev -e -prod'
;;
d | destroy )
opts='--dry-run --verbose --pod --classic --dummy --in-repo --in-repo-addon -d -v -p -c -dum -id -ir'
;;
g | generate )
opts='class component directive enum module pipe route service --generate -d --dry-run --verbose -v --pod -p --classic -c --dummy -dum -id --in-repo --in-repo-addon -ir'
;;
gh-pages:deploy | github-pages:deploy )
opts='--environment --gh-token --gh-username --skip-build --user-page --message'
;;
h | help | -h | --help)
opts='--json --verbose -v'
;;
init )
opts='--blueprint --dry-run --link-cli --mobile --name --prefix --skip-bower --skip-npm --source-dir --style --verbose -b -d -lc -n -p -sb -sd -sn -v'
;;
new )
opts='--blueprint --directory --dry-run --link-cli --mobile --prefix --skip-bower --skip-git --skip-npm --source-dir --style --verbose -b -d -dir -lc -p -sb -sd -sg -sn -v'
;;
s | serve | server )
opts='--environment --host --insecure-proxy --inspr --live-reload --live-reload-base-url --live-reload-host --live-reload-live-css --live-reload-port --output-path --port --proxy --ssl --ssl-cert --ssl-key --target --watcher -H -dev -e -lr -lrbu -lrh -lrp -op -out -p -pr -prod -pxy -t -w'
;;
set )
opts='--global -g'
;;
t | test )
opts='--browsers --colors --config-file --environment --filter --host --launch --log-level --module --path --port --query --reporter --server --silent --test-page --test-port --watch -H -c -cf -e -f -m -r -s -tp -w'
;;
update )
opts='--all --dryRun --force --from --migrate-only --next --registry --to -d'
;;
v | version )
opts='--verbose'
;;
ng )
opts=$ng_opts
;;
* )
opts=''
;;
esac
reply=(${=opts})
}
compctl -K _ng_completion ng
| Shell | 4 | chensanle/ohmyzsh | plugins/ng/ng.plugin.zsh | [
"MIT"
] |
Prefix(:=<http://example.org/>)
Ontology(:ParentOntology
Import( <http://localhost:10000/circular_child.owl> )
)
| Web Ontology Language | 3 | jmcmurry/SciGraph | SciGraph-core/src/test/resources/ontologies/import/circular_parent.owl | [
"Apache-2.0"
] |
KIDS Distribution saved on Jun 08, 2021@13:24:22
Test Patch SAMI*18.0*12 SEQ #12 T1 (1.18.0.12-t1-i12)
**KIDS**:SAMI*18.0*12^
**INSTALL NAME**
SAMI*18.0*12
"BLD",11510,0)
SAMI*18.0*12^SAMI^0^3210608^n
"BLD",11510,4,0)
^9.64PA^^
"BLD",11510,6)
1^12
"BLD",11510,6.3)
1
"BLD",11510,"KRN",0)
^9.67PA^1.5^25
"BLD",11510,"KRN",.4,0)
.4
"BLD",11510,"KRN",.401,0)
.401
"BLD",11510,"KRN",.402,0)
.402
"BLD",11510,"KRN",.403,0)
.403
"BLD",11510,"KRN",.5,0)
.5
"BLD",11510,"KRN",.84,0)
.84
"BLD",11510,"KRN",1.5,0)
1.5
"BLD",11510,"KRN",1.6,0)
1.6
"BLD",11510,"KRN",1.61,0)
1.61
"BLD",11510,"KRN",1.62,0)
1.62
"BLD",11510,"KRN",3.6,0)
3.6
"BLD",11510,"KRN",3.8,0)
3.8
"BLD",11510,"KRN",9.2,0)
9.2
"BLD",11510,"KRN",9.8,0)
9.8
"BLD",11510,"KRN",9.8,"NM",0)
^9.68A^2^2
"BLD",11510,"KRN",9.8,"NM",1,0)
SAMIORM^^0^B175905048
"BLD",11510,"KRN",9.8,"NM",2,0)
SAMIOUL^^0^B103859
"BLD",11510,"KRN",9.8,"NM","B","SAMIORM",1)
"BLD",11510,"KRN",9.8,"NM","B","SAMIOUL",2)
"BLD",11510,"KRN",19,0)
19
"BLD",11510,"KRN",19.1,0)
19.1
"BLD",11510,"KRN",101,0)
101
"BLD",11510,"KRN",409.61,0)
409.61
"BLD",11510,"KRN",771,0)
771
"BLD",11510,"KRN",779.2,0)
779.2
"BLD",11510,"KRN",870,0)
870
"BLD",11510,"KRN",8989.51,0)
8989.51
"BLD",11510,"KRN",8989.52,0)
8989.52
"BLD",11510,"KRN",8993,0)
8993
"BLD",11510,"KRN",8994,0)
8994
"BLD",11510,"KRN","B",.4,.4)
"BLD",11510,"KRN","B",.401,.401)
"BLD",11510,"KRN","B",.402,.402)
"BLD",11510,"KRN","B",.403,.403)
"BLD",11510,"KRN","B",.5,.5)
"BLD",11510,"KRN","B",.84,.84)
"BLD",11510,"KRN","B",1.5,1.5)
"BLD",11510,"KRN","B",1.6,1.6)
"BLD",11510,"KRN","B",1.61,1.61)
"BLD",11510,"KRN","B",1.62,1.62)
"BLD",11510,"KRN","B",3.6,3.6)
"BLD",11510,"KRN","B",3.8,3.8)
"BLD",11510,"KRN","B",9.2,9.2)
"BLD",11510,"KRN","B",9.8,9.8)
"BLD",11510,"KRN","B",19,19)
"BLD",11510,"KRN","B",19.1,19.1)
"BLD",11510,"KRN","B",101,101)
"BLD",11510,"KRN","B",409.61,409.61)
"BLD",11510,"KRN","B",771,771)
"BLD",11510,"KRN","B",779.2,779.2)
"BLD",11510,"KRN","B",870,870)
"BLD",11510,"KRN","B",8989.51,8989.51)
"BLD",11510,"KRN","B",8989.52,8989.52)
"BLD",11510,"KRN","B",8993,8993)
"BLD",11510,"KRN","B",8994,8994)
"BLD",11510,"QUES",0)
^9.62^^
"BLD",11510,"REQB",0)
^9.611^1^1
"BLD",11510,"REQB",1,0)
SAMI*18.0*11^0
"BLD",11510,"REQB","B","SAMI*18.0*11",1)
"MBREQ")
0
"PKG",230,-1)
1^1
"PKG",230,0)
SAMI^SAMI^SCREENING APPLICATIONS MANAGEMENT - IELCAP
"PKG",230,22,0)
^9.49I^1^1
"PKG",230,22,1,0)
18.0^3191203
"PKG",230,22,1,"PAH",1,0)
12^3210608
"QUES","XPF1",0)
Y
"QUES","XPF1","??")
^D REP^XPDH
"QUES","XPF1","A")
Shall I write over your |FLAG| File
"QUES","XPF1","B")
YES
"QUES","XPF1","M")
D XPF1^XPDIQ
"QUES","XPF2",0)
Y
"QUES","XPF2","??")
^D DTA^XPDH
"QUES","XPF2","A")
Want my data |FLAG| yours
"QUES","XPF2","B")
YES
"QUES","XPF2","M")
D XPF2^XPDIQ
"QUES","XPI1",0)
YO
"QUES","XPI1","??")
^D INHIBIT^XPDH
"QUES","XPI1","A")
Want KIDS to INHIBIT LOGONs during the install
"QUES","XPI1","B")
NO
"QUES","XPI1","M")
D XPI1^XPDIQ
"QUES","XPM1",0)
PO^VA(200,:EM
"QUES","XPM1","??")
^D MG^XPDH
"QUES","XPM1","A")
Enter the Coordinator for Mail Group '|FLAG|'
"QUES","XPM1","B")
"QUES","XPM1","M")
D XPM1^XPDIQ
"QUES","XPO1",0)
Y
"QUES","XPO1","??")
^D MENU^XPDH
"QUES","XPO1","A")
Want KIDS to Rebuild Menu Trees Upon Completion of Install
"QUES","XPO1","B")
NO
"QUES","XPO1","M")
D XPO1^XPDIQ
"QUES","XPZ1",0)
Y
"QUES","XPZ1","??")
^D OPT^XPDH
"QUES","XPZ1","A")
Want to DISABLE Scheduled Options, Menu Options, and Protocols
"QUES","XPZ1","B")
NO
"QUES","XPZ1","M")
D XPZ1^XPDIQ
"QUES","XPZ2",0)
Y
"QUES","XPZ2","??")
^D RTN^XPDH
"QUES","XPZ2","A")
Want to MOVE routines to other CPUs
"QUES","XPZ2","B")
NO
"QUES","XPZ2","M")
D XPZ2^XPDIQ
"RTN")
2
"RTN","SAMIORM")
0^1^B175905048
"RTN","SAMIORM",1,0)
SAMIORM ;ven/lgc&arc - HL7: ORM > patient-lookup ;2021-06-08T20:07Z
"RTN","SAMIORM",2,0)
;;18.0;SAMI;**11,12**;2020-01;Build 1
"RTN","SAMIORM",3,0)
;;1.18.0.12-t1+i12
"RTN","SAMIORM",4,0)
;
"RTN","SAMIORM",5,0)
; SAMIORM parses an incoming Order (ORM) message into the fields
"RTN","SAMIORM",6,0)
; array, then calls SAMIHL7 to use the array to update the patient-
"RTN","SAMIORM",7,0)
; lookup graph.
"RTN","SAMIORM",8,0)
;
"RTN","SAMIORM",9,0)
; SAMIOUL contains the development log for the SAMIHL7 & SAMIOR*
"RTN","SAMIORM",10,0)
; routines.
"RTN","SAMIORM",11,0)
;
"RTN","SAMIORM",12,0)
quit ; no entry from top
"RTN","SAMIORM",13,0)
;
"RTN","SAMIORM",14,0)
;
"RTN","SAMIORM",15,0)
;
"RTN","SAMIORM",16,0)
;@section 0 primary development
"RTN","SAMIORM",17,0)
;
"RTN","SAMIORM",18,0)
;
"RTN","SAMIORM",19,0)
;
"RTN","SAMIORM",20,0)
;@routine-credits
"RTN","SAMIORM",21,0)
;@primary-dev Larry G. Carlson (lgc)
"RTN","SAMIORM",22,0)
; larry@fiscientific.com
"RTN","SAMIORM",23,0)
;@primary-dev-org Vista Expertise Network (ven)
"RTN","SAMIORM",24,0)
; http://vistaexpertise.net
"RTN","SAMIORM",25,0)
;@copyright 2020/2021, lgc, all rights reserved
"RTN","SAMIORM",26,0)
;@license see routine SAMIUL
"RTN","SAMIORM",27,0)
;
"RTN","SAMIORM",28,0)
;@last-updated 2021-06-08T20:07Z
"RTN","SAMIORM",29,0)
;@application Screening Applications Management (SAM)
"RTN","SAMIORM",30,0)
;@module Screening Applications Management - IELCAP (SAMI)
"RTN","SAMIORM",31,0)
;@submodule HL7 interface - SAMIHL* & SAMIOR*
"RTN","SAMIORM",32,0)
;@suite-of-files SAMI Forms (311.101-311.199)
"RTN","SAMIORM",33,0)
;@version 1.18.0.12-t1+i12
"RTN","SAMIORM",34,0)
;@release-date 2020-01
"RTN","SAMIORM",35,0)
;@patch-list **11,12**
"RTN","SAMIORM",36,0)
;
"RTN","SAMIORM",37,0)
;@additional-dev Alexis R. Carlson (arc)
"RTN","SAMIORM",38,0)
; arc@vistaexpertise.net
"RTN","SAMIORM",39,0)
;@additional-dev George P. Lilly (gpl)
"RTN","SAMIORM",40,0)
; gpl@vistaexpertise.net
"RTN","SAMIORM",41,0)
;@additional-dev Frederick D. S. Marshall (toad)
"RTN","SAMIORM",42,0)
; toad@vistaexpertise.net
"RTN","SAMIORM",43,0)
;@additional-dev Kenneth McGlothlen (mcglk)
"RTN","SAMIORM",44,0)
; mcglk@vistaexpertise.net
"RTN","SAMIORM",45,0)
;
"RTN","SAMIORM",46,0)
;@routine-log repo github.com:VA-PALS-ELCAP/SAMI-VAPALS-ELCAP.git
"RTN","SAMIORM",47,0)
; see routine SAMIHL7
"RTN","SAMIORM",48,0)
;@contents
"RTN","SAMIORM",49,0)
; EN-BLDARR-PMSG-UPDTPTL parse ORM msg > patient-lookup graph
"RTN","SAMIORM",50,0)
;
"RTN","SAMIORM",51,0)
; PARSEMSG get patient data f/ORM msg
"RTN","SAMIORM",52,0)
; PID-ORMADDR get patient data from PID segment
"RTN","SAMIORM",53,0)
; PV1 get patient data from PV1 segment
"RTN","SAMIORM",54,0)
; ORC get patient data from ORC segment
"RTN","SAMIORM",55,0)
; OBR get patient data from OBR segment
"RTN","SAMIORM",56,0)
;
"RTN","SAMIORM",57,0)
; TEST test hli EN^SAMIORM
"RTN","SAMIORM",58,0)
;
"RTN","SAMIORM",59,0)
;
"RTN","SAMIORM",60,0)
;
"RTN","SAMIORM",61,0)
;@section 1 hl7 applications & protocols that call hli EN^SAMIORM
"RTN","SAMIORM",62,0)
;
"RTN","SAMIORM",63,0)
;
"RTN","SAMIORM",64,0)
;
"RTN","SAMIORM",65,0)
; SAMI HL logical links
"RTN","SAMIORM",66,0)
;
"RTN","SAMIORM",67,0)
; NODE: LISTENER INSTITUTION: VISTA HEALTH CARE
"RTN","SAMIORM",68,0)
; LLP TYPE: TCP DEVICE TYPE: Multi-threaded Server
"RTN","SAMIORM",69,0)
; STATE: 7757 server AUTOSTART: Enabled
"RTN","SAMIORM",70,0)
; MAILMAN DOMAIN: VAPALS.ELCAP.ORG SHUTDOWN LLP ?: NO
"RTN","SAMIORM",71,0)
; QUEUE SIZE: 10 DO NOT PING: NO
"RTN","SAMIORM",72,0)
; RE-TRANSMISSION ATTEMPTS: 5 READ TIMEOUT: 600
"RTN","SAMIORM",73,0)
; ACK TIMEOUT: 600 EXCEED RE-TRANSMIT ACTION: ignore
"RTN","SAMIORM",74,0)
; TCP/IP PORT: 5000 TCP/IP SERVICE TYPE: MULTI LISTENER
"RTN","SAMIORM",75,0)
; PERSISTENT: YES STARTUP NODE: USER:VAPALS
"RTN","SAMIORM",76,0)
; IN QUEUE BACK POINTER: 117 IN QUEUE FRONT POINTER: 105
"RTN","SAMIORM",77,0)
; OUT QUEUE BACK POINTER: 76 OUT QUEUE FRONT POINTER: 76
"RTN","SAMIORM",78,0)
;
"RTN","SAMIORM",79,0)
;
"RTN","SAMIORM",80,0)
;
"RTN","SAMIORM",81,0)
; SAMI HL7 applications
"RTN","SAMIORM",82,0)
;
"RTN","SAMIORM",83,0)
; NAME: MCAR-INST ACTIVE/INACTIVE: ACTIVE
"RTN","SAMIORM",84,0)
; FACILITY NAME: VISTA COUNTRY CODE: USA
"RTN","SAMIORM",85,0)
; HL7 ENCODING CHARACTERS: ^~\& HL7 FIELD SEPARATOR: |
"RTN","SAMIORM",86,0)
;
"RTN","SAMIORM",87,0)
;
"RTN","SAMIORM",88,0)
; NAME: INST-MCAR ACTIVE/INACTIVE: ACTIVE
"RTN","SAMIORM",89,0)
; FACILITY NAME: VAPALS COUNTRY CODE: USA
"RTN","SAMIORM",90,0)
; HL7 ENCODING CHARACTERS: ^~\& HL7 FIELD SEPARATOR: |
"RTN","SAMIORM",91,0)
;
"RTN","SAMIORM",92,0)
;
"RTN","SAMIORM",93,0)
;
"RTN","SAMIORM",94,0)
; SAMI HL7 ORM protocols
"RTN","SAMIORM",95,0)
;
"RTN","SAMIORM",96,0)
; NAME: MCAR ORM SERVER
"RTN","SAMIORM",97,0)
; ITEM TEXT: Clinical Procedures ORM Protocol Server
"RTN","SAMIORM",98,0)
; TYPE: event driver CREATOR: LABTECH,FORTYEIGHT
"RTN","SAMIORM",99,0)
; TIMESTAMP: 59921,33274 SENDING APPLICATION: MCAR-INST
"RTN","SAMIORM",100,0)
; TRANSACTION MESSAGE TYPE: ORM EVENT TYPE: O01
"RTN","SAMIORM",101,0)
; VERSION ID: 2.3
"RTN","SAMIORM",102,0)
; SUBSCRIBERS: PHX ENROLL ORM
"RTN","SAMIORM",103,0)
;
"RTN","SAMIORM",104,0)
;
"RTN","SAMIORM",105,0)
; NAME: PHX ENROLL ORM EVN TYPE: event driver
"RTN","SAMIORM",106,0)
; CREATOR: CARLSON,LARRY G SENDING APPLICATION: MCAR-INST
"RTN","SAMIORM",107,0)
; TRANSACTION MESSAGE TYPE: ORM EVENT TYPE: O01
"RTN","SAMIORM",108,0)
; ACCEPT ACK CODE: AL APPLICATION ACK TYPE: NE
"RTN","SAMIORM",109,0)
; VERSION ID: 2.3
"RTN","SAMIORM",110,0)
; SUBSCRIBERS: PHX ENROLL ORM
"RTN","SAMIORM",111,0)
;
"RTN","SAMIORM",112,0)
;
"RTN","SAMIORM",113,0)
; NAME: PHX ENROLL ORM TYPE: subscriber
"RTN","SAMIORM",114,0)
; CREATOR: CARLSON,LARRY G RECEIVING APPLICATION: INST-MCAR
"RTN","SAMIORM",115,0)
; EVENT TYPE: O01 RESPONSE MESSAGE TYPE: ACK
"RTN","SAMIORM",116,0)
; PROCESSING ROUTINE: D EN^SAMIORM SENDING FACILITY REQUIRED?: YES
"RTN","SAMIORM",117,0)
;
"RTN","SAMIORM",118,0)
; RECEIVING FACILITY REQUIRED?: YES
"RTN","SAMIORM",119,0)
;
"RTN","SAMIORM",120,0)
;
"RTN","SAMIORM",121,0)
;
"RTN","SAMIORM",122,0)
;@section 2 main hli EN^SAMIORM
"RTN","SAMIORM",123,0)
;
"RTN","SAMIORM",124,0)
;
"RTN","SAMIORM",125,0)
;
"RTN","SAMIORM",126,0)
;@hli EN^SAMIORM
"RTN","SAMIORM",127,0)
EN ; parse ORM message into patient-lookup graph
"RTN","SAMIORM",128,0)
;
"RTN","SAMIORM",129,0)
;@stanza 1 invocation, binding, & branching
"RTN","SAMIORM",130,0)
;
"RTN","SAMIORM",131,0)
;;hli;procedure;clean;silent;sac
"RTN","SAMIORM",132,0)
;@falls-thru-to
"RTN","SAMIORM",133,0)
; BLDARR-PMSG-UPDTPTL
"RTN","SAMIORM",134,0)
;@called-by [see section 1]
"RTN","SAMIORM",135,0)
;@calls
"RTN","SAMIORM",136,0)
; $$HTFM^XLFDT
"RTN","SAMIORM",137,0)
; ACK^SAMIHL7
"RTN","SAMIORM",138,0)
;@input [tbd]
"RTN","SAMIORM",139,0)
; ]HLNEXT = executable code that sets HLNODE to next line of hl7 msg
"RTN","SAMIORM",140,0)
; ]HL("ECH")
"RTN","SAMIORM",141,0)
; ]HL("FS")
"RTN","SAMIORM",142,0)
; ]HLREC("MID")
"RTN","SAMIORM",143,0)
;@output [tbd]
"RTN","SAMIORM",144,0)
; patient-lookup graph updated for patient
"RTN","SAMIORM",145,0)
; ^KBAP = debug array
"RTN","SAMIORM",146,0)
; hl7 ACK msg sent
"RTN","SAMIORM",147,0)
;
"RTN","SAMIORM",148,0)
;
"RTN","SAMIORM",149,0)
;@stanza 2 setup
"RTN","SAMIORM",150,0)
;
"RTN","SAMIORM",151,0)
kill ^KBAP("SAMIORM")
"RTN","SAMIORM",152,0)
set ^KBAP("SAMIORM","EN")=$$HTFM^XLFDT($horolog)_" TEST"
"RTN","SAMIORM",153,0)
;
"RTN","SAMIORM",154,0)
; immediately return COMM ACK ***** TMP TURNED OFF
"RTN","SAMIORM",155,0)
do ACK^SAMIHL7
"RTN","SAMIORM",156,0)
;
"RTN","SAMIORM",157,0)
;
"RTN","SAMIORM",158,0)
BLDARR ;@stanza 3 pull out message into samihl7 array
"RTN","SAMIORM",159,0)
;
"RTN","SAMIORM",160,0)
;@falls-thru-from
"RTN","SAMIORM",161,0)
; EN
"RTN","SAMIORM",162,0)
;@falls-thru-to
"RTN","SAMIORM",163,0)
; PMSG-UPDTPTL
"RTN","SAMIORM",164,0)
;@called-by none
"RTN","SAMIORM",165,0)
;@calls
"RTN","SAMIORM",166,0)
; $$HTFM^XLFDT
"RTN","SAMIORM",167,0)
;
"RTN","SAMIORM",168,0)
new invdt set invdt=9999999.9999-$$HTFM^XLFDT($horolog)
"RTN","SAMIORM",169,0)
;
"RTN","SAMIORM",170,0)
new HLARR ; hl7 msg array fetched by xecuting HLNEXT
"RTN","SAMIORM",171,0)
new samihl7 ; ditto
"RTN","SAMIORM",172,0)
new cnt set cnt=0 ; line count
"RTN","SAMIORM",173,0)
for do quit:$get(HLNODE)=""
"RTN","SAMIORM",174,0)
. xecute HLNEXT ; get next line of hl7 msg
"RTN","SAMIORM",175,0)
. quit:$get(HLNODE)="" ; done when out of lines
"RTN","SAMIORM",176,0)
. set cnt=cnt+1 ; count line
"RTN","SAMIORM",177,0)
. set HLARR(cnt)=HLNODE ; save line
"RTN","SAMIORM",178,0)
. set samihl7(cnt)=HLNODE ; ditto
"RTN","SAMIORM",179,0)
. quit
"RTN","SAMIORM",180,0)
;
"RTN","SAMIORM",181,0)
kill ^KBAP("SAMIORM","BLDARR")
"RTN","SAMIORM",182,0)
merge ^KBAP("SAMIORM","BLDARR","HLARR")=HLARR
"RTN","SAMIORM",183,0)
;
"RTN","SAMIORM",184,0)
new INFS set INFS=$get(HL("FS"))
"RTN","SAMIORM",185,0)
new INCC set INCC=$extract($get(HL("ECH")))
"RTN","SAMIORM",186,0)
;
"RTN","SAMIORM",187,0)
;
"RTN","SAMIORM",188,0)
PMSG ;@stanza 4 pull patient data in ORM message > fields array
"RTN","SAMIORM",189,0)
;
"RTN","SAMIORM",190,0)
;@falls-thru-from
"RTN","SAMIORM",191,0)
; EN-BLDARR
"RTN","SAMIORM",192,0)
;@falls-thru-to
"RTN","SAMIORM",193,0)
; UPDTPTL
"RTN","SAMIORM",194,0)
;@called-by none
"RTN","SAMIORM",195,0)
;@calls
"RTN","SAMIORM",196,0)
; PARSEMSG
"RTN","SAMIORM",197,0)
;
"RTN","SAMIORM",198,0)
new fields set fields("ORM",invdt,"msgid")=$get(HLREC("MID"))
"RTN","SAMIORM",199,0)
do PARSEMSG(.HLARR,.fields) ; get patient data f/ORM msg
"RTN","SAMIORM",200,0)
;
"RTN","SAMIORM",201,0)
merge ^KBAP("SAMIORM","samihl7")=samihl7
"RTN","SAMIORM",202,0)
merge ^KBAP("SAMIORM","fields")=fields
"RTN","SAMIORM",203,0)
;
"RTN","SAMIORM",204,0)
;
"RTN","SAMIORM",205,0)
UPDTPTL ;@stanza 5 update patient-lookup graph using fields array
"RTN","SAMIORM",206,0)
;
"RTN","SAMIORM",207,0)
;@falls-thru-from
"RTN","SAMIORM",208,0)
; EN-BLDARR-PMSG
"RTN","SAMIORM",209,0)
;@called-by none
"RTN","SAMIORM",210,0)
;@calls
"RTN","SAMIORM",211,0)
; UPDTPTL^SAMIHL7
"RTN","SAMIORM",212,0)
; $$setroot^%wd
"RTN","SAMIORM",213,0)
;
"RTN","SAMIORM",214,0)
do UPDTPTL^SAMIHL7(.fields) ; update patient-lookup w/pat-flds array
"RTN","SAMIORM",215,0)
;
"RTN","SAMIORM",216,0)
merge ^KBAP("SAMIORM","fields")=fields
"RTN","SAMIORM",217,0)
;
"RTN","SAMIORM",218,0)
;
"RTN","SAMIORM",219,0)
;@stanza 6 file hl7 msg in patient-lookup graph
"RTN","SAMIORM",220,0)
;
"RTN","SAMIORM",221,0)
; At this point the fields have been filed in the patient with ptien
"RTN","SAMIORM",222,0)
; into the patient lookup graph. I have the ptien in fields("ptien")
"RTN","SAMIORM",223,0)
; and I have the HL7 message segments in samihl7. Time to file the
"RTN","SAMIORM",224,0)
; actual hl7 message into patient lookup.
"RTN","SAMIORM",225,0)
; NOTE: @rootpl@(ptien,"hl7 counter") was updated in UPDTPTL^SAMIHL7.
"RTN","SAMIORM",226,0)
;
"RTN","SAMIORM",227,0)
new ptien set ptien=$get(fields("ptien"))
"RTN","SAMIORM",228,0)
quit:'ptien
"RTN","SAMIORM",229,0)
;
"RTN","SAMIORM",230,0)
new rootpl set rootpl=$$setroot^%wd("patient-lookup")
"RTN","SAMIORM",231,0)
new hl7cnt set hl7cnt=$get(@rootpl@(ptien,"hl7 counter"))
"RTN","SAMIORM",232,0)
set fields("ORM",hl7cnt,"msgid")=$get(HLREC("MID"))
"RTN","SAMIORM",233,0)
;
"RTN","SAMIORM",234,0)
new cnt set cnt=0
"RTN","SAMIORM",235,0)
for set cnt=$order(samihl7(cnt)) quit:'cnt do
"RTN","SAMIORM",236,0)
. new seg set seg=$extract(samihl7(cnt),1,3)
"RTN","SAMIORM",237,0)
. set @rootpl@(ptien,"hl7",hl7cnt,seg)=samihl7(cnt)
"RTN","SAMIORM",238,0)
. quit
"RTN","SAMIORM",239,0)
;
"RTN","SAMIORM",240,0)
;
"RTN","SAMIORM",241,0)
;@stanza 7 termination
"RTN","SAMIORM",242,0)
;
"RTN","SAMIORM",243,0)
quit ; end of hli EN^SAMIORM
"RTN","SAMIORM",244,0)
;
"RTN","SAMIORM",245,0)
;
"RTN","SAMIORM",246,0)
;
"RTN","SAMIORM",247,0)
;@section 3 PARSEMSG subroutines
"RTN","SAMIORM",248,0)
;
"RTN","SAMIORM",249,0)
;
"RTN","SAMIORM",250,0)
;
"RTN","SAMIORM",251,0)
PARSEMSG(HLARR,fields) ; get patient data f/ORM msg
"RTN","SAMIORM",252,0)
;
"RTN","SAMIORM",253,0)
;@stanza 1 invocation, binding, & branching
"RTN","SAMIORM",254,0)
;
"RTN","SAMIORM",255,0)
;;private;procedure;clean;silent;sac
"RTN","SAMIORM",256,0)
;@called-by
"RTN","SAMIORM",257,0)
; hli EN^SAMIORM
"RTN","SAMIORM",258,0)
;@calls
"RTN","SAMIORM",259,0)
; PID
"RTN","SAMIORM",260,0)
; PV1
"RTN","SAMIORM",261,0)
; ORC
"RTN","SAMIORM",262,0)
; OBR
"RTN","SAMIORM",263,0)
;@input [tbd]
"RTN","SAMIORM",264,0)
; .HLARR = hl7 msg array
"RTN","SAMIORM",265,0)
; ]INFS = field separator
"RTN","SAMIORM",266,0)
; ]INCC = subfield separator
"RTN","SAMIORM",267,0)
; ]HL("FS") = field separator
"RTN","SAMIORM",268,0)
;@output [tbd]
"RTN","SAMIORM",269,0)
; .fields = fields array
"RTN","SAMIORM",270,0)
; ^KBAP = debug array
"RTN","SAMIORM",271,0)
;
"RTN","SAMIORM",272,0)
;
"RTN","SAMIORM",273,0)
;@stanza 2 get patient data
"RTN","SAMIORM",274,0)
;
"RTN","SAMIORM",275,0)
set ^KBAP("SAMIORM","PARSEMSG","INFS")=$get(INFS)
"RTN","SAMIORM",276,0)
set ^KBAP("SAMIORM","PARSEMSG","INCC")=$get(INCC)
"RTN","SAMIORM",277,0)
;
"RTN","SAMIORM",278,0)
; get patient data from ORM message
"RTN","SAMIORM",279,0)
new cnt set cnt=0
"RTN","SAMIORM",280,0)
for do quit:'cnt
"RTN","SAMIORM",281,0)
. set cnt=$order(HLARR(cnt))
"RTN","SAMIORM",282,0)
. quit:'cnt
"RTN","SAMIORM",283,0)
. ;
"RTN","SAMIORM",284,0)
. new segment set segment=HLARR(cnt)
"RTN","SAMIORM",285,0)
. new SEG set SEG=$piece(HLARR(cnt),HL("FS"))
"RTN","SAMIORM",286,0)
. if SEG="PID" do PID(segment,.fields)
"RTN","SAMIORM",287,0)
. if SEG="PV1" do PV1(segment,.fields)
"RTN","SAMIORM",288,0)
. if SEG="ORC" do ORC(segment,.fields)
"RTN","SAMIORM",289,0)
. if SEG="OBR" do OBR(segment,.fields)
"RTN","SAMIORM",290,0)
. quit
"RTN","SAMIORM",291,0)
;
"RTN","SAMIORM",292,0)
merge ^KBAP("SAMIORM","fields")=fields
"RTN","SAMIORM",293,0)
;
"RTN","SAMIORM",294,0)
;
"RTN","SAMIORM",295,0)
;@stanza 3 termination
"RTN","SAMIORM",296,0)
;
"RTN","SAMIORM",297,0)
quit ; end of PARSEMSG
"RTN","SAMIORM",298,0)
;
"RTN","SAMIORM",299,0)
;
"RTN","SAMIORM",300,0)
;
"RTN","SAMIORM",301,0)
PID(segment,fields) ; get patient data from PID segment
"RTN","SAMIORM",302,0)
;
"RTN","SAMIORM",303,0)
;@stanza 1 invocation, binding, & branching
"RTN","SAMIORM",304,0)
;
"RTN","SAMIORM",305,0)
;;private;procedure;clean;silent;sac
"RTN","SAMIORM",306,0)
;@falls-thru-to
"RTN","SAMIORM",307,0)
; ORMADDR
"RTN","SAMIORM",308,0)
;@called-by
"RTN","SAMIORM",309,0)
; PARSEMSG
"RTN","SAMIORM",310,0)
;@calls
"RTN","SAMIORM",311,0)
; $$UP^XLFSTR
"RTN","SAMIORM",312,0)
;@input
"RTN","SAMIORM",313,0)
; .segment = PID segment of hl7 message
"RTN","SAMIORM",314,0)
; ]INFS = field separator
"RTN","SAMIORM",315,0)
; ]INCC = subfield separator
"RTN","SAMIORM",316,0)
;@output
"RTN","SAMIORM",317,0)
; .fields = fields array
"RTN","SAMIORM",318,0)
; ^KBAP = debug array
"RTN","SAMIORM",319,0)
;
"RTN","SAMIORM",320,0)
;
"RTN","SAMIORM",321,0)
;@stanza 2 get patient id #s
"RTN","SAMIORM",322,0)
;
"RTN","SAMIORM",323,0)
set ^KBAP("SAMIORM","fields","PID","segment")=segment
"RTN","SAMIORM",324,0)
;
"RTN","SAMIORM",325,0)
set fields("icn")="" ; not currently using integration control #
"RTN","SAMIORM",326,0)
set fields("ssn")=$piece($piece(segment,INFS,4),INCC)
"RTN","SAMIORM",327,0)
;
"RTN","SAMIORM",328,0)
;
"RTN","SAMIORM",329,0)
;@stanza 3 get patient name
"RTN","SAMIORM",330,0)
;
"RTN","SAMIORM",331,0)
new name set name=$$UP^XLFSTR($piece(segment,INFS,6)) ; full upper
"RTN","SAMIORM",332,0)
new lname set lname=$piece(name,INCC) ; last
"RTN","SAMIORM",333,0)
new fname set fname=$piece(name,INCC,2) ; first
"RTN","SAMIORM",334,0)
;
"RTN","SAMIORM",335,0)
new mname set mname="" ; middle
"RTN","SAMIORM",336,0)
if $length(name,INCC)>2 set mname=$piece(name,INCC,3)
"RTN","SAMIORM",337,0)
;
"RTN","SAMIORM",338,0)
new suffix set suffix="" ; suffix, e.g., JR, 3RD, etc.
"RTN","SAMIORM",339,0)
if $length(name,INCC)>3 set suffix=$piece(name,INCC,4)
"RTN","SAMIORM",340,0)
;
"RTN","SAMIORM",341,0)
if $length(mname) set fname=fname_" "_mname
"RTN","SAMIORM",342,0)
if $length(suffix) set lname=lname_" "_suffix
"RTN","SAMIORM",343,0)
set name=lname_","_fname ; replace full
"RTN","SAMIORM",344,0)
;
"RTN","SAMIORM",345,0)
set fields("saminame")=name
"RTN","SAMIORM",346,0)
set fields("sinamef")=fname
"RTN","SAMIORM",347,0)
set fields("sinamel")=lname
"RTN","SAMIORM",348,0)
;
"RTN","SAMIORM",349,0)
;
"RTN","SAMIORM",350,0)
;@stanza 4 get other patient demographics
"RTN","SAMIORM",351,0)
;
"RTN","SAMIORM",352,0)
if $length(fields("ssn")),$length(fields("saminame")) do
"RTN","SAMIORM",353,0)
. set fields("last5")=$extract(fields("saminame"))_$extract(fields("ssn"),6,9)
"RTN","SAMIORM",354,0)
. set ^KBAP("SAMIORM","MadeLast5")=$get(fields("last5"))
"RTN","SAMIORM",355,0)
. quit
"RTN","SAMIORM",356,0)
;
"RTN","SAMIORM",357,0)
set fields("sbdob")=$piece(segment,INFS,8)
"RTN","SAMIORM",358,0)
set fields("sex")=$piece(segment,INFS,9)
"RTN","SAMIORM",359,0)
;
"RTN","SAMIORM",360,0)
;
"RTN","SAMIORM",361,0)
ORMADDR ;@stanza 5 get address
"RTN","SAMIORM",362,0)
;
"RTN","SAMIORM",363,0)
;@falls-thru-from
"RTN","SAMIORM",364,0)
; PID
"RTN","SAMIORM",365,0)
;@called-by none
"RTN","SAMIORM",366,0)
;@calls none
"RTN","SAMIORM",367,0)
;
"RTN","SAMIORM",368,0)
set fields("ORM",invdt,"fulladdress")=$piece(segment,INFS,12)
"RTN","SAMIORM",369,0)
;
"RTN","SAMIORM",370,0)
set fields("address1")=$piece($piece(segment,INFS,12),INCC)
"RTN","SAMIORM",371,0)
set fields("city")=$piece($piece(segment,INFS,12),INCC,3)
"RTN","SAMIORM",372,0)
set fields("state")=$piece($piece(segment,INFS,12),INCC,4)
"RTN","SAMIORM",373,0)
set fields("zip")=$piece($piece(segment,INFS,12),INCC,5)
"RTN","SAMIORM",374,0)
set fields("phone")=$piece(segment,INFS,14)
"RTN","SAMIORM",375,0)
; set fields("ssn")=$piece(segment,INFS,20)
"RTN","SAMIORM",376,0)
;
"RTN","SAMIORM",377,0)
;
"RTN","SAMIORM",378,0)
;@stanza 6 termination
"RTN","SAMIORM",379,0)
;
"RTN","SAMIORM",380,0)
quit ; end of PID-ORMADDR
"RTN","SAMIORM",381,0)
;
"RTN","SAMIORM",382,0)
;
"RTN","SAMIORM",383,0)
;
"RTN","SAMIORM",384,0)
PV1(segment,fields) ; get patient data from PV1 segment
"RTN","SAMIORM",385,0)
;
"RTN","SAMIORM",386,0)
;@stanza 1 invocation, binding, & branching
"RTN","SAMIORM",387,0)
;
"RTN","SAMIORM",388,0)
;;private;procedure;clean;silent;sac
"RTN","SAMIORM",389,0)
;@called-by
"RTN","SAMIORM",390,0)
; PARSEMSG
"RTN","SAMIORM",391,0)
;@calls none
"RTN","SAMIORM",392,0)
;@input [tbd]
"RTN","SAMIORM",393,0)
; .segment = PV1 segment of hl7 message
"RTN","SAMIORM",394,0)
; ]INFS = field separator
"RTN","SAMIORM",395,0)
; ]INCC = subfield separator
"RTN","SAMIORM",396,0)
;@output [tbd]
"RTN","SAMIORM",397,0)
; .fields = fields array
"RTN","SAMIORM",398,0)
; ^KBAP = debug array
"RTN","SAMIORM",399,0)
;
"RTN","SAMIORM",400,0)
;
"RTN","SAMIORM",401,0)
;@stanza 2 get patient data
"RTN","SAMIORM",402,0)
;
"RTN","SAMIORM",403,0)
set ^KBAP("SAMIORM","fields","PIV","segment")=segment
"RTN","SAMIORM",404,0)
;
"RTN","SAMIORM",405,0)
set fields("ORM",invdt,"patientclass")=$piece(segment,INFS,3)
"RTN","SAMIORM",406,0)
set fields("ORM",invdt,"assignedlocation")=$piece(segment,INFS,4)
"RTN","SAMIORM",407,0)
set fields("ORM",invdt,"providerien")=$piece($piece(segment,INFS,9),INCC)
"RTN","SAMIORM",408,0)
set fields("ORM",invdt,"providernm")=$translate($piece($piece(segment,INFS,9),INCC,2,4),"^",",")
"RTN","SAMIORM",409,0)
;
"RTN","SAMIORM",410,0)
;
"RTN","SAMIORM",411,0)
;@stanza 3 termination
"RTN","SAMIORM",412,0)
;
"RTN","SAMIORM",413,0)
quit ; end of PV1
"RTN","SAMIORM",414,0)
;
"RTN","SAMIORM",415,0)
;
"RTN","SAMIORM",416,0)
;
"RTN","SAMIORM",417,0)
ORC(segment,fields) ; get patient data from ORC segment
"RTN","SAMIORM",418,0)
;
"RTN","SAMIORM",419,0)
;@stanza 1 invocation, binding, & branching
"RTN","SAMIORM",420,0)
;
"RTN","SAMIORM",421,0)
;;private;procedure;clean;silent;sac
"RTN","SAMIORM",422,0)
;@called-by
"RTN","SAMIORM",423,0)
; PARSEMSG
"RTN","SAMIORM",424,0)
;@calls none
"RTN","SAMIORM",425,0)
;@input [tbd]
"RTN","SAMIORM",426,0)
; .segment = ORC segment of hl7 message
"RTN","SAMIORM",427,0)
; ]INFS = field separator
"RTN","SAMIORM",428,0)
;@output [tbd]
"RTN","SAMIORM",429,0)
; .fields = fields array
"RTN","SAMIORM",430,0)
; ^KBAP = debug array
"RTN","SAMIORM",431,0)
;
"RTN","SAMIORM",432,0)
;
"RTN","SAMIORM",433,0)
;@stanza 2 get patient data
"RTN","SAMIORM",434,0)
;
"RTN","SAMIORM",435,0)
set ^KBAP("SAMIORM","fields","ORC","segment")=segment
"RTN","SAMIORM",436,0)
;
"RTN","SAMIORM",437,0)
set fields("ORM",invdt,"ordercontrol")=$piece(segment,INFS,2)
"RTN","SAMIORM",438,0)
set fields("ORM",invdt,"ordernumber")=$piece(segment,INFS,3)
"RTN","SAMIORM",439,0)
set fields("ORM",invdt,"orderstatus")=$piece(segment,INFS,6)
"RTN","SAMIORM",440,0)
set fields("ORM",invdt,"transactiondt")=$piece(segment,INFS,10)
"RTN","SAMIORM",441,0)
set fields("ORM",invdt,"ordereffectivedt")=$piece(segment,INFS,16)
"RTN","SAMIORM",442,0)
;
"RTN","SAMIORM",443,0)
;
"RTN","SAMIORM",444,0)
;@stanza 3 termination
"RTN","SAMIORM",445,0)
;
"RTN","SAMIORM",446,0)
quit ; end of ORC
"RTN","SAMIORM",447,0)
;
"RTN","SAMIORM",448,0)
;
"RTN","SAMIORM",449,0)
;
"RTN","SAMIORM",450,0)
OBR(segment,fields) ; get patient data from OBR segment
"RTN","SAMIORM",451,0)
;
"RTN","SAMIORM",452,0)
;@stanza 1 invocation, binding, & branching
"RTN","SAMIORM",453,0)
;
"RTN","SAMIORM",454,0)
;;private;procedure;clean;silent;sac
"RTN","SAMIORM",455,0)
;@called-by
"RTN","SAMIORM",456,0)
; PARSEMSG
"RTN","SAMIORM",457,0)
;@calls none
"RTN","SAMIORM",458,0)
;@input [tbd]
"RTN","SAMIORM",459,0)
; .segment = OBR segment of hl7 message
"RTN","SAMIORM",460,0)
; ]INFS = field separator
"RTN","SAMIORM",461,0)
; ]INCC = subfield separator
"RTN","SAMIORM",462,0)
;@output [tbd]
"RTN","SAMIORM",463,0)
; .fields = fields array
"RTN","SAMIORM",464,0)
; ^KBAP = debug array
"RTN","SAMIORM",465,0)
;
"RTN","SAMIORM",466,0)
;
"RTN","SAMIORM",467,0)
;@stanza 2 get patient data
"RTN","SAMIORM",468,0)
;
"RTN","SAMIORM",469,0)
set ^KBAP("SAMIORM","fields","OBR","segment")=segment
"RTN","SAMIORM",470,0)
;
"RTN","SAMIORM",471,0)
set fields("ORM",invdt,"order")=$piece($piece(segment,INFS,5),INCC)
"RTN","SAMIORM",472,0)
;
"RTN","SAMIORM",473,0)
set fields("ORM",invdt,"siteid")=$piece($piece($piece(segment,INFS,5),INCC),"_")
"RTN","SAMIORM",474,0)
set fields("siteid")=$piece($piece($piece(segment,INFS,5),INCC),"_")
"RTN","SAMIORM",475,0)
;
"RTN","SAMIORM",476,0)
set fields("ORM",invdt,"order2")=$piece($piece(segment,INFS,5),INCC,2)
"RTN","SAMIORM",477,0)
;
"RTN","SAMIORM",478,0)
;
"RTN","SAMIORM",479,0)
;@stanza 3 termination
"RTN","SAMIORM",480,0)
;
"RTN","SAMIORM",481,0)
quit ; end of OBR
"RTN","SAMIORM",482,0)
;
"RTN","SAMIORM",483,0)
;
"RTN","SAMIORM",484,0)
;
"RTN","SAMIORM",485,0)
CAMELCAS(str) ; convert string to camel case
"RTN","SAMIORM",486,0)
;
"RTN","SAMIORM",487,0)
;@stanza 1 invocation, binding, & branching
"RTN","SAMIORM",488,0)
;
"RTN","SAMIORM",489,0)
;;private;function;clean;silent;sac
"RTN","SAMIORM",490,0)
;@called-by
"RTN","SAMIORM",491,0)
; PID
"RTN","SAMIORM",492,0)
;@calls
"RTN","SAMIORM",493,0)
; $$LOW^XLFSTR
"RTN","SAMIORM",494,0)
; $$UP^XLFSTR
"RTN","SAMIORM",495,0)
;@input [tbd]
"RTN","SAMIORM",496,0)
; str = string to convert
"RTN","SAMIORM",497,0)
;@output = string in camel case
"RTN","SAMIORM",498,0)
;
"RTN","SAMIORM",499,0)
;
"RTN","SAMIORM",500,0)
;@stanza 2 convert string
"RTN","SAMIORM",501,0)
;
"RTN","SAMIORM",502,0)
if $get(str)="" quit str
"RTN","SAMIORM",503,0)
set str=$$LOW^XLFSTR(str)
"RTN","SAMIORM",504,0)
set str=$$UP^XLFSTR($extract(str,1))_$extract(str,2,$length(str))
"RTN","SAMIORM",505,0)
;
"RTN","SAMIORM",506,0)
;
"RTN","SAMIORM",507,0)
;@stanza 3 termination
"RTN","SAMIORM",508,0)
;
"RTN","SAMIORM",509,0)
quit str ; end of $$CAMELCAS
"RTN","SAMIORM",510,0)
;
"RTN","SAMIORM",511,0)
;
"RTN","SAMIORM",512,0)
;
"RTN","SAMIORM",513,0)
;@section 4 test subroutine
"RTN","SAMIORM",514,0)
;
"RTN","SAMIORM",515,0)
;
"RTN","SAMIORM",516,0)
;
"RTN","SAMIORM",517,0)
TEST ; test hli EN^SAMIORM
"RTN","SAMIORM",518,0)
;
"RTN","SAMIORM",519,0)
;@stanza 1 invocation, binding, & branching
"RTN","SAMIORM",520,0)
;
"RTN","SAMIORM",521,0)
;;dmi-test;procedure;clean;silent;sac
"RTN","SAMIORM",522,0)
;@called-by
"RTN","SAMIORM",523,0)
; PID
"RTN","SAMIORM",524,0)
;@calls
"RTN","SAMIORM",525,0)
; $$LOW^XLFSTR
"RTN","SAMIORM",526,0)
; $$UP^XLFSTR
"RTN","SAMIORM",527,0)
;@input [tbd]
"RTN","SAMIORM",528,0)
; str = string to convert
"RTN","SAMIORM",529,0)
;@output = string in camel case
"RTN","SAMIORM",530,0)
;
"RTN","SAMIORM",531,0)
;
"RTN","SAMIORM",532,0)
;@stanza 2 convert string
"RTN","SAMIORM",533,0)
;
"RTN","SAMIORM",534,0)
kill HLARR ; hl7 test orm msg
"RTN","SAMIORM",535,0)
set HLARR(1)="MSH|^~\&|MCAR-INST|VISTA|INST-MCAR|VAPALS|20200616135751-0700||ORM^O01|6442288610689|P|2.3|||||USA"
"RTN","SAMIORM",536,0)
set HLARR(2)="PID|1||000002341||ZZTEST^MACHO^^^^^L||19271106000000|M|||7726 W ORCHID ST^^PHOENIX^AZ^85017||||||||000002341|"
"RTN","SAMIORM",537,0)
set HLARR(3)="PV1||O|PHX-PULM RN LSS PHONE|||||244088^GARCIA^DANIEL^P"
"RTN","SAMIORM",538,0)
set HLARR(4)="ORC|NW|3200616135751|||NW||||20200616135751||||||20200616135751"
"RTN","SAMIORM",539,0)
set HLARR(5)="OBR||||PHO_LUNG^LUNG|"
"RTN","SAMIORM",540,0)
;
"RTN","SAMIORM",541,0)
do HLENV^SAMIORU("MCAR ORM SERVER") ; set hl7 variables for testing
"RTN","SAMIORM",542,0)
;
"RTN","SAMIORM",543,0)
set HLNEXT="D HLNEXT^HLCSUTL" ; get-next-line qwik
"RTN","SAMIORM",544,0)
set HLQUIT=0 ; curent ien of "IN" wp field in msg array in file 771
"RTN","SAMIORM",545,0)
;
"RTN","SAMIORM",546,0)
do EN ; parse ORM msg > patient-lookup graph
"RTN","SAMIORM",547,0)
;
"RTN","SAMIORM",548,0)
;
"RTN","SAMIORM",549,0)
;@stanza 3 termination
"RTN","SAMIORM",550,0)
;
"RTN","SAMIORM",551,0)
quit ; end of TEST
"RTN","SAMIORM",552,0)
;
"RTN","SAMIORM",553,0)
;
"RTN","SAMIORM",554,0)
;
"RTN","SAMIORM",555,0)
EOR ; end of routine SAMIORM
"RTN","SAMIOUL")
0^2^B103859
"RTN","SAMIOUL",1,0)
SAMIOUL ;ven/toad - HL7 development log ;2021-06-08T19:27Z
"RTN","SAMIOUL",2,0)
;;18.0;SAMI;**12**;2020-01;Build 1
"RTN","SAMIOUL",3,0)
;;1.18.0.12-t1+i12
"RTN","SAMIOUL",4,0)
;
"RTN","SAMIOUL",5,0)
; SAMIOUL is the development log for the SAMIHL7 & SAMIOR* routines,
"RTN","SAMIOUL",6,0)
; which support VAPALS-ELCAP HL7 processing.
"RTN","SAMIOUL",7,0)
;
"RTN","SAMIOUL",8,0)
quit ; no entry from top
"RTN","SAMIOUL",9,0)
;
"RTN","SAMIOUL",10,0)
;
"RTN","SAMIOUL",11,0)
;
"RTN","SAMIOUL",12,0)
;@section 0 primary development
"RTN","SAMIOUL",13,0)
;
"RTN","SAMIOUL",14,0)
;
"RTN","SAMIOUL",15,0)
;
"RTN","SAMIOUL",16,0)
;@routine-credits
"RTN","SAMIOUL",17,0)
;@primary-dev Larry G. Carlson (lgc)
"RTN","SAMIOUL",18,0)
; lgc@vistaexpertise.net
"RTN","SAMIOUL",19,0)
;@primary-dev-org Vista Expertise Network (ven)
"RTN","SAMIOUL",20,0)
; http://vistaexpertise.net
"RTN","SAMIOUL",21,0)
;@copyright 2017/2021, lgc, all rights reserved
"RTN","SAMIOUL",22,0)
;@license see routine SAMIUL
"RTN","SAMIOUL",23,0)
;
"RTN","SAMIOUL",24,0)
;@last-updated 2021-06-08T19:27Z
"RTN","SAMIOUL",25,0)
;@application Screening Applications Management (SAM)
"RTN","SAMIOUL",26,0)
;@module Screening Applications Management - IELCAP (SAMI)
"RTN","SAMIOUL",27,0)
;@suite-of-files SAMI Forms (311.101-311.199)
"RTN","SAMIOUL",28,0)
;@version 1.18.0.12-t1+i12
"RTN","SAMIOUL",29,0)
;@release-date 2020-01
"RTN","SAMIOUL",30,0)
;@patch-list **12**
"RTN","SAMIOUL",31,0)
;
"RTN","SAMIOUL",32,0)
;@additional-dev Alexis R. Carlson (arc)
"RTN","SAMIOUL",33,0)
; arc@vistaexpertise.net
"RTN","SAMIOUL",34,0)
;@additional-dev George P. Lilly (gpl)
"RTN","SAMIOUL",35,0)
; gpl@vistaexpertise.net
"RTN","SAMIOUL",36,0)
;@additional-dev Frederick D. S. Marshall (toad)
"RTN","SAMIOUL",37,0)
; toad@vistaexpertise.net
"RTN","SAMIOUL",38,0)
;@additional-dev Kenneth McGlothlen (mcglk)
"RTN","SAMIOUL",39,0)
; mcglk@vistaexpertise.net
"RTN","SAMIOUL",40,0)
;
"RTN","SAMIOUL",41,0)
;@module-credits
"RTN","SAMIOUL",42,0)
;@project VA Partnership to Increase Access to Lung Screening
"RTN","SAMIOUL",43,0)
; (VA-PALS)
"RTN","SAMIOUL",44,0)
; http://va-pals.org/
"RTN","SAMIOUL",45,0)
;@funding 2017/2021, Bristol-Myers Squibb Foundation (bmsf)
"RTN","SAMIOUL",46,0)
; https://www.bms.com/about-us/responsibility/bristol-myers-squibb-foundation.html
"RTN","SAMIOUL",47,0)
;@partner-org Veterans Affairs Office of Rural health
"RTN","SAMIOUL",48,0)
; https://www.ruralhealth.va.gov/
"RTN","SAMIOUL",49,0)
;@partner-org International Early Lung Cancer Action Program (I-ELCAP)
"RTN","SAMIOUL",50,0)
; http://ielcap.com/
"RTN","SAMIOUL",51,0)
;@partner-org Paraxial Technologies (par)
"RTN","SAMIOUL",52,0)
; http://paraxialtech.com/
"RTN","SAMIOUL",53,0)
;@partner-org Open Source Electronic Health Record Alliance (OSEHRA)
"RTN","SAMIOUL",54,0)
; https://www.osehra.org/groups/va-pals-open-source-project-group
"RTN","SAMIOUL",55,0)
;
"RTN","SAMIOUL",56,0)
;@module-log repo github.com:VA-PALS-ELCAP/SAMI-VAPALS-ELCAP.git
"RTN","SAMIOUL",57,0)
;
"RTN","SAMIOUL",58,0)
; 2019-10-03/28 ven/lgc 1.18.0 d01fd10,ff6cea0,3670fb3,613e8ff
"RTN","SAMIOUL",59,0)
; ,82979cc
"RTN","SAMIOUL",60,0)
; SAMIHL7: HL7 routines to populate & update patient-lookup graph,
"RTN","SAMIOUL",61,0)
; reorganize HL7 routines & work on unit tests, change how gender is
"RTN","SAMIOUL",62,0)
; handled, update unit test routines for dfn 1, further updates to
"RTN","SAMIOUL",63,0)
; SAMI unit tests.
"RTN","SAMIOUL",64,0)
;
"RTN","SAMIOUL",65,0)
; 2020-01-15 ven/lgc 1.18.0 0a2af96
"RTN","SAMIOUL",66,0)
; SAMIHL7: bulk commit due to switch to cache, major overhaul:
"RTN","SAMIOUL",67,0)
; update capture of array structure; in UPDTPTL add UPDTPTL1,MATCHLOG
"RTN","SAMIOUL",68,0)
; & update indices; r/root w/rootpl; annotate; cut DELPTL & 2 lines,
"RTN","SAMIOUL",69,0)
; leaving rest of subroutine orphaned.
"RTN","SAMIOUL",70,0)
;
"RTN","SAMIOUL",71,0)
; 2020-01-16 ven/lgc 1.18.0 [no repo commit]
"RTN","SAMIOUL",72,0)
; SAMIHL7: in MATCHLOG unbreak line MATCHLOG+13.
"RTN","SAMIOUL",73,0)
;
"RTN","SAMIOUL",74,0)
; 2020-02-04/12 ven/lgc 1.18.0.11+i11 ee53d8a
"RTN","SAMIOUL",75,0)
; SAMIORM,SAMIORR ORM HL7 routines.
"RTN","SAMIOUL",76,0)
;
"RTN","SAMIOUL",77,0)
; 2020-07-24/28 ven/lgc 1.18.0.8/11+i8/i11 c08b051
"RTN","SAMIOUL",78,0)
; SAMIHL7,SAMIORM,SAMIORU: update for ORU messaging.
"RTN","SAMIOUL",79,0)
; SAMIHL7: in top update incoming fields array example; passim
"RTN","SAMIOUL",80,0)
; checkpoint into ^KBAP; in UPDTPTL1 add block to if new patient get
"RTN","SAMIOUL",81,0)
; next ptien to use & set dfn; in MATCHLOG r/MATCHLOG w/HL7MATCHLOG,
"RTN","SAMIOUL",82,0)
; if new patient load ORM msg data later, fix undef error, as didn't
"RTN","SAMIOUL",83,0)
; get dfn from va vista server (only ssn) do not try to set remotedfn
"RTN","SAMIOUL",84,0)
; field, build saminame index, call CAPTORM to save all ORM flds in
"RTN","SAMIOUL",85,0)
; patient-lookup; add CAPTORM; in ACK clear & set HLA("HLA").
"RTN","SAMIOUL",86,0)
; SAMIORM: passim annotate, checkpoint into ^KBAP; in BLDAR get
"RTN","SAMIOUL",87,0)
; inverse date, put HL7 nodes in samihl7; in DEBUG save msg id; add
"RTN","SAMIOUL",88,0)
; PMSG; in PARSEMSG call PV1,ORC; in PID r/dfn w/ssn, get name flds,
"RTN","SAMIOUL",89,0)
; get last5; add tag ORMADDR; add PV1,ORC to handle those segments;
"RTN","SAMIOUL",90,0)
; in OBR reorg fields array; add CAMELCAS; update TEST.
"RTN","SAMIOUL",91,0)
; SAMIORU: new routine?
"RTN","SAMIOUL",92,0)
;
"RTN","SAMIOUL",93,0)
; 2020-08-17/09-04 ven/lgc 1.18.0.11+i11 f3d7b38
"RTN","SAMIOUL",94,0)
; SAMIORU: update to remove gtm mod: extensive chgs passim, incl add
"RTN","SAMIOUL",95,0)
; TESTALL,TESTOBXC; TESTOBX > TESTOBXV; PID2 > PID1; in DFN pull data
"RTN","SAMIOUL",96,0)
; from entry in patient-lookup graph; in HL7VARS if msg id returned,
"RTN","SAMIOUL",97,0)
; preface it with 1^; in ORMVARS don't confuse ORM msg id w/ORU msg
"RTN","SAMIOUL",98,0)
; id; etc.
"RTN","SAMIOUL",99,0)
;
"RTN","SAMIOUL",100,0)
; 2021-02-03 ven/gpl 1.18.0.8+i8 54a0c2e
"RTN","SAMIOUL",101,0)
; SAMIORU: in EN chg line length limit (climit) to 81.
"RTN","SAMIOUL",102,0)
;
"RTN","SAMIOUL",103,0)
; 2021-03-12/13 ven/lgc 1.18.0.8+i8 6093b45
"RTN","SAMIOUL",104,0)
; SAMIORU: larry's latest version of hl7 message building to
"RTN","SAMIOUL",105,0)
; preserve note formatting: in TESTALL cut dead code, chg patient &
"RTN","SAMIOUL",106,0)
; form, call EN&SAMIORU as function; in EN add debug code, cut climit
"RTN","SAMIOUL",107,0)
; lines & cache filter; in DFN add tag FINDORM; in OBX cut climit
"RTN","SAMIOUL",108,0)
; lines & dead code & BLDTXT.
"RTN","SAMIOUL",109,0)
;
"RTN","SAMIOUL",110,0)
; 2021-04-14/20 ven/gpl 1.18.0.11+i11 3a5756a,d7182d7
"RTN","SAMIOUL",111,0)
; SAMIHL7: fix for duplicate patients fr/HL7, fix for updating
"RTN","SAMIOUL",112,0)
; patient-lookup graph on receipt of 2nd order: in UPDTPTL1 uppercase
"RTN","SAMIOUL",113,0)
; names; in MATCHLOG prevent undef error.
"RTN","SAMIOUL",114,0)
;
"RTN","SAMIOUL",115,0)
; 2021-05-11 ven/lgc 1.18.0.11+i11 [no repo commit]
"RTN","SAMIOUL",116,0)
; SAMIORM: in UPDTPTL stop updating hl7 counter node, because it was
"RTN","SAMIOUL",117,0)
; updated earlier, just set hl7cnt; in OBR set fields("siteid").
"RTN","SAMIOUL",118,0)
;
"RTN","SAMIOUL",119,0)
; 2021-05-20/21 ven/mcglk&toad 1.18.0.11+i11 43a4557,70fc6ba,129e96b
"RTN","SAMIOUL",120,0)
; SAMIHL7: passim build hdr comments & dev log, lt refactor, bump
"RTN","SAMIOUL",121,0)
; version.
"RTN","SAMIOUL",122,0)
;
"RTN","SAMIOUL",123,0)
; 2021-05-27 ven/lgc 1.18.0.11+i11 2093bf0,a51e714
"RTN","SAMIOUL",124,0)
; SAMIHL7,SAMIORM: new fixes for saving ORM & HL7 in patient-lookup
"RTN","SAMIOUL",125,0)
; SAMIHL7: in section 1 update sample array; in MATCHLOG
"RTN","SAMIOUL",126,0)
; r/fields(field)'="" w/'(field=""); in CAPTORM annotate, r/invdt
"RTN","SAMIOUL",127,0)
; algo w/hl7cnt algo to align array structures of SAMIHL7 & SAMIORM,
"RTN","SAMIOUL",128,0)
; to use counters for subscripts instead of inverse dates.
"RTN","SAMIOUL",129,0)
; SAMIORM: in BLDARR, new hl7cnt, cut tag DEBUG, move inits of INFS,
"RTN","SAMIOUL",130,0)
; INCC up to where DEBUG tag was; in PMSG fix KBaP typo, annotate,
"RTN","SAMIOUL",131,0)
; refactor block, get msgid; in PID get suffix.
"RTN","SAMIOUL",132,0)
;
"RTN","SAMIOUL",133,0)
; 2021-06-01/04 ven/mcglk&toad 1.18.0.11+i11 7dd9410
"RTN","SAMIOUL",134,0)
; SAMIHL7: update log, add SAMIORM,ORR,ORU to log.
"RTN","SAMIOUL",135,0)
; SAMIORM,ORR,ORU: annotate, document hl7 call structure, refactor,
"RTN","SAMIOUL",136,0)
; bump version & dates.
"RTN","SAMIOUL",137,0)
;
"RTN","SAMIOUL",138,0)
; 2021-06-08 ven/toad 1.18.0.12-t1+i12
"RTN","SAMIOUL",139,0)
; SAMIORM: in BLDARR fix new cnt, bug introduced in 06-04 refactor,
"RTN","SAMIOUL",140,0)
; bump version; in PID uppercase patient name; cut CAMELCAS.
"RTN","SAMIOUL",141,0)
; SAMIOUL < SAMIHL7: create routine from existing dev log.
"RTN","SAMIOUL",142,0)
;
"RTN","SAMIOUL",143,0)
;
"RTN","SAMIOUL",144,0)
;
"RTN","SAMIOUL",145,0)
;@contents
"RTN","SAMIOUL",146,0)
; SAMIHL7 HL7 utilities
"RTN","SAMIOUL",147,0)
; SAMIORM HL7 ORM > patient-lookup
"RTN","SAMIOUL",148,0)
; SAMIORR HL7 ORR enrollment response
"RTN","SAMIOUL",149,0)
; SAMIORU HL7 ORU enrollment response
"RTN","SAMIOUL",150,0)
; SAMIOUL HL7 development log
"RTN","SAMIOUL",151,0)
;
"RTN","SAMIOUL",152,0)
;
"RTN","SAMIOUL",153,0)
;
"RTN","SAMIOUL",154,0)
EOR ; end of routine SAMIOUL
"VER")
8.0^22.2
**END**
**END**
| Genshi | 4 | OSEHRA/SAMI-VAPALS-ELCAP | dist/18-12/t1/sami-1.18.0.12-t1-i12.kid | [
"Apache-2.0"
] |
; inherits: c
[
(field_declaration_list)
(class_specifier)
(condition_clause)
] @indent
| Scheme | 1 | hmac/nvim-treesitter | queries/cpp/indents.scm | [
"Apache-2.0"
] |
/*EXPECTED
hello world!
*/
class Test {
static function run() : void {
// console.log("hello world!");
log "hello world!";
}
} | JSX | 4 | websharks/ace-builds | demo/kitchen-sink/docs/jsx.jsx | [
"BSD-3-Clause"
] |
<h1>P0 Experiment 4: Gossip</h1>
<p>Purpose: Stress P2P layer with and without boundary node rate limiting and having a lot of clients (currently not investigated by the networking team).<br />
See presentation from networking team.</p>
<pre>
Topology: 13 node subnet, 1 machine NNS
Deploy one instance of the counter or nop canister
Start the workload generator to generate some load
Incrementally add nodes up to 50 nodes until performance degrades
Measure and determine:
Requests / second
Error rate
Request latency
P2P metrics
Workload generator metrics
</pre>
<p>Request type: <b>{{type}}</b> on workload <b>{{workload}}</b>.</p>
| Harbour | 3 | 3cL1p5e7/ic | scalability/templates/run_gossip_experiment.html.hb | [
"Apache-2.0"
] |
#include <Wire.h>
#include <Servo.h>
#include <CapSense.h>
String inputString = ""; // a string to hold incoming data
boolean inputComplete = false; // whether the string is complete
boolean sendSensors = false;
long count_timer = 0;
/*
RX commands:
0x1: reset board (turn all off and default servo's position)
0x2: set servos and leds
0x0..0x2: led 1
0x3..0x5: led 2
0x6..0x8: led 3
0x10: servo 1
0x11: servo 2
0x12: servo 3
0x3: set relays
0x0: relay 1
0x1: relay 2
TX commands:
0x1: button statuses
0x0 button 1
0x1 button 2
0x2 button 3
0x3: cap sense
0x4: joy switch
0x4: temp
0x5: light
0x6: joy analogic
*/
#define LED3_RED 2
#define LED3_GREEN 4
#define LED3_BLUE 3
#define LED2_RED 5
#define LED2_GREEN 7
#define LED2_BLUE 6
#define LED1_RED 8
#define LED1_GREEN 10
#define LED1_BLUE 9
#define SERVO1 11
#define SERVO2 12
#define SERVO3 13
#define TOUCH_RECV 14
#define TOUCH_SEND 15
#define RELAY1 A0
#define RELAY2 A1
#define LIGHT_SENSOR A2
#define TEMP_SENSOR A3
#define BUTTON1 A6
#define BUTTON2 A7
#define BUTTON3 A8
#define JOY_SWITCH A9 // pulls line down when pressed
#define JOY_nINT A10 // active low interrupt input
#define JOY_nRESET A11 // active low reset output
Servo servos[3];
// 10M ohm resistor on demo shield
CapSense touch_robot = CapSense(TOUCH_SEND, TOUCH_RECV);
void setup();
void loop();
void init_buttons()
{
pinMode(BUTTON1, INPUT);
pinMode(BUTTON2, INPUT);
pinMode(BUTTON3, INPUT);
pinMode(JOY_SWITCH, INPUT);
// enable the internal pullups
digitalWrite(BUTTON1, HIGH);
digitalWrite(BUTTON2, HIGH);
digitalWrite(BUTTON3, HIGH);
digitalWrite(JOY_SWITCH, HIGH);
}
void init_relays()
{
pinMode(RELAY1, OUTPUT);
pinMode(RELAY2, OUTPUT);
}
void init_leds()
{
digitalWrite(LED1_RED, 1);
digitalWrite(LED1_GREEN, 1);
digitalWrite(LED1_BLUE, 1);
pinMode(LED1_RED, OUTPUT);
pinMode(LED1_GREEN, OUTPUT);
pinMode(LED1_BLUE, OUTPUT);
digitalWrite(LED2_RED, 1);
digitalWrite(LED2_GREEN, 1);
digitalWrite(LED2_BLUE, 1);
pinMode(LED2_RED, OUTPUT);
pinMode(LED2_GREEN, OUTPUT);
pinMode(LED2_BLUE, OUTPUT);
digitalWrite(LED3_RED, 1);
digitalWrite(LED3_GREEN, 1);
digitalWrite(LED3_BLUE, 1);
pinMode(LED3_RED, OUTPUT);
pinMode(LED3_GREEN, OUTPUT);
pinMode(LED3_BLUE, OUTPUT);
}
void init_joystick(int threshold);
byte b1, b2, b3, b4;
boolean c;
void setup()
{
inputString.reserve(200);
Serial.begin(57600);
Serial.println("\r\nStart");
init_leds();
init_relays();
init_buttons();
init_joystick( 5 );
// autocalibrate OFF
touch_robot.set_CS_AutocaL_Millis(0xFFFFFFFF);
servos[0].attach(SERVO1);
servos[0].write(90);
servos[1].attach(SERVO2);
servos[1].write(90);
servos[2].attach(SERVO3);
servos[2].write(90);
b1 = digitalRead(BUTTON1);
b2 = digitalRead(BUTTON2);
b3 = digitalRead(BUTTON3);
b4 = digitalRead(JOY_SWITCH);
c = 0;
count_timer = millis();
}
void serialEvent() {
while (Serial.available()) {
// get the new byte:
char inChar = (char)Serial.read();
// if the incoming character is a newline, set a flag
// so the main loop can do something about it:
if (inChar == '\n' || inChar == '.') {
inputComplete = true;
} else {
// add it to the inputString:
inputString += inChar;
}
}
}
void getData() {
inputComplete = false;
if (inputString=="data") {
sendSensors=true;
} else if (inputString.length() > 0) {
char cmd = inputString[0];
char control = inputString[1];
char v1 = inputString[2];
char v2 = inputString[3];
char value=0;
if (v1>='0' && v1<='9') {
value+=(v1-'0');
} else if (v1>='a' && v1<='f'){
value+=(10+v1-'a');
}
value=value<<4;
if (v2>='0' && v2<='9') {
value+=(v2-'0');
} else if (v2>='a' && v2<='f'){
value+=(10+v2-'a');
}
Serial.print("log:"); Serial.println(inputString);
// assumes only one command per packet
if (cmd == 'r') {
// reset outputs to default values on disconnect
analogWrite(LED1_RED, 255);
analogWrite(LED1_GREEN, 255);
analogWrite(LED1_BLUE, 255);
analogWrite(LED2_RED, 255);
analogWrite(LED2_GREEN, 255);
analogWrite(LED2_BLUE, 255);
analogWrite(LED3_RED, 255);
analogWrite(LED3_GREEN, 255);
analogWrite(LED3_BLUE, 255);
servos[0].write(90);
servos[0].write(90);
servos[0].write(90);
digitalWrite(RELAY1, LOW);
digitalWrite(RELAY2, LOW);
} else if (cmd == 'c') {
if (control == '0')
analogWrite(LED1_RED, 255 - value);
else if (control == '1')
analogWrite(LED1_GREEN, 255 - value);
else if (control == '2')
analogWrite(LED1_BLUE, 255 - value);
else if (control == '3')
analogWrite(LED2_RED, 255 - value);
else if (control == '4')
analogWrite(LED2_GREEN, 255 - value);
else if (control == '5')
analogWrite(LED2_BLUE, 255 - value);
else if (control == '6')
analogWrite(LED3_RED, 255 - value);
else if (control == '7')
analogWrite(LED3_GREEN, 255 - value);
else if (control == '8')
analogWrite(LED3_BLUE, 255 - value);
} else if (cmd == 's') {
if (control == '0')
servos[0].write(map(value, 0, 255, 0, 180));
else if (control == '1')
servos[1].write(map(value, 0, 255, 0, 180));
else if (control == '2')
servos[2].write(map(value, 0, 255, 0, 180));
} else if (cmd == 't') {
if (control == '0')
digitalWrite(RELAY1, value ? HIGH : LOW);
else if (control == '1')
digitalWrite(RELAY2, value ? HIGH : LOW);
}
}
inputString = "";
}
void sendData() {
int i;
byte b;
uint16_t val;
int x, y;
boolean c0;
static byte count = 0;
long touchcount;
char msg[4];
msg[0] = '1';
b = digitalRead(BUTTON1);
if (b != b1) {
Serial.print("b1:"); Serial.println((b ? '0' : '1'));
//acc.write(msg, 3);
b1 = b;
}
b = digitalRead(BUTTON2);
if (b != b2) {
Serial.print("b2:"); Serial.println((b ? '0' : '1'));
//acc.write(msg, 3);
b2 = b;
}
b = digitalRead(BUTTON3);
if (b != b3) {
Serial.print("b3:"); Serial.println((b ? '0' : '1'));
//acc.write(msg, 3);
b3 = b;
}
b = digitalRead(JOY_SWITCH);
if (b != b4) {
Serial.print("js:"); Serial.println((b ? '0' : '1'));
//acc.write(msg, 3);
b4 = b;
}
touchcount = touch_robot.capSense(5);
c0 = touchcount > 300;
if (c0 != c) {
Serial.print("c:"); Serial.print(c0 ? '1' : '0');
c = c0;
}
if (sendSensors) {
sendSensors=false;
val = analogRead(TEMP_SENSOR);
Serial.print("t:"); Serial.println(val);
val = analogRead(LIGHT_SENSOR);
Serial.print("l:"); Serial.println(val);
read_joystick(&x, &y);
Serial.print("jxy:"); Serial.print(constrain(x, -128, 127));
Serial.print(","); Serial.println(constrain(y, -128, 127));
}
}
void loop()
{
if (inputComplete) {
getData();
// clear the string:
inputString = "";
inputComplete = false;
}
if (millis() - count_timer > 10) {
count_timer = millis();
sendData();
}
//delay(10);
}
// ==============================================================================
// Austria Microsystems i2c Joystick
void init_joystick(int threshold)
{
byte status = 0;
pinMode(JOY_SWITCH, INPUT);
digitalWrite(JOY_SWITCH, HIGH);
pinMode(JOY_nINT, INPUT);
digitalWrite(JOY_nINT, HIGH);
pinMode(JOY_nRESET, OUTPUT);
digitalWrite(JOY_nRESET, 1);
delay(1);
digitalWrite(JOY_nRESET, 0);
delay(1);
digitalWrite(JOY_nRESET, 1);
Wire.begin();
do {
status = read_joy_reg(0x0f);
} while ((status & 0xf0) != 0xf0);
// invert magnet polarity setting, per datasheet
write_joy_reg(0x2e, 0x86);
calibrate_joystick(threshold);
}
int offset_X, offset_Y;
void calibrate_joystick(int dz)
{
char iii;
int x_cal = 0;
int y_cal = 0;
// Low Power Mode, 20ms auto wakeup
// INTn output enabled
// INTn active after each measurement
// Normal (non-Reset) mode
write_joy_reg(0x0f, 0x00);
delay(1);
// dummy read of Y_reg to reset interrupt
read_joy_reg(0x11);
for(iii = 0; iii != 16; iii++) {
while(!joystick_interrupt()) {}
x_cal += read_joy_reg(0x10);
y_cal += read_joy_reg(0x11);
}
// divide by 16 to get average
offset_X = -(x_cal>>4);
offset_Y = -(y_cal>>4);
write_joy_reg(0x12, dz - offset_X); // Xp, LEFT threshold for INTn
write_joy_reg(0x13, -dz - offset_X); // Xn, RIGHT threshold for INTn
write_joy_reg(0x14, dz - offset_Y); // Yp, UP threshold for INTn
write_joy_reg(0x15, -dz - offset_Y); // Yn, DOWN threshold for INTn
// dead zone threshold detect requested?
if (dz)
write_joy_reg(0x0f, 0x04);
}
void read_joystick(int *x, int *y)
{
*x = read_joy_reg(0x10) + offset_X;
*y = read_joy_reg(0x11) + offset_Y; // reading Y clears the interrupt
}
char joystick_interrupt()
{
return digitalRead(JOY_nINT) == 0;
}
#define JOY_I2C_ADDR 0x40
char read_joy_reg(char reg_addr)
{
char c;
Wire.beginTransmission(JOY_I2C_ADDR);
Wire.write(reg_addr);
Wire.endTransmission();
Wire.requestFrom(JOY_I2C_ADDR, 1);
while(Wire.available())
c = Wire.read();
return c;
}
void write_joy_reg(char reg_addr, char val)
{
Wire.beginTransmission(JOY_I2C_ADDR);
Wire.write(reg_addr);
Wire.write(val);
Wire.endTransmission();
}
| Arduino | 4 | HannesGitH/chrome-extensions-samples | apps/samples/serial/adkjs/firmware/demokitclient/demokitclient.ino | [
"Apache-2.0"
] |
QT.webchannel_private.VERSION = 5.9.4
QT.webchannel_private.name = QtWebChannel
QT.webchannel_private.module =
QT.webchannel_private.libs = $$QT_MODULE_LIB_BASE
QT.webchannel_private.includes = $$QT_MODULE_INCLUDE_BASE/QtWebChannel/5.9.4 $$QT_MODULE_INCLUDE_BASE/QtWebChannel/5.9.4/QtWebChannel
QT.webchannel_private.frameworks =
QT.webchannel_private.depends = core_private webchannel
QT.webchannel_private.uses =
QT.webchannel_private.module_config = v2 internal_module
QT.webchannel_private.enabled_features =
QT.webchannel_private.disabled_features =
| QMake | 1 | PLohrmannAMD/renderdoc | qrenderdoc/3rdparty/qt/x64/mkspecs/modules/qt_lib_webchannel_private.pri | [
"MIT"
] |
%lex
%%
\s+ /* skip */
^[^\d\W]\w* return 'IDENTIFIER';
[0-9]+("."[0-9]+)?\b return 'NUMBER';
"-" return "-";
"+" return "+";
"/" return "/";
"*" return "*";
"(" return "(";
")" return ")";
"=" return "=";
"TOKEN_INDENT" return "INDENT";
"TOKEN_DEDENT" return "DEDENT";
<<EOF>> return "EOF";
/lex
/* Operator Precedence */
%left '='
%left '+' '-'
%left '/' '*'
%left '^'
%start expressions
%%
expressions
: e EOF { return $1; };
e : e[l] "+" e[r]
{ $$ = { ast: { kind: '+', l: $l, r: $r }, range: { start: {row: @l.first_line, column: @l.first_column}, end: {row: @r.last_line, column: @r.last_column} } } }
| e[l] "-" e[r]
{ $$ = { ast: { kind: '-', l: $l, r: $r }, range: { start: {row: @l.first_line, column: @l.first_column}, end: {row: @r.last_line, column: @r.last_column} } } }
| e[l] "*" e[r]
{ $$ = { ast: { kind: '*', l: $l, r: $r }, range: { start: {row: @l.first_line, column: @l.first_column}, end: {row: @r.last_line, column: @r.last_column} } } }
| e[l] "/" e[r]
{ $$ = { ast: { kind: '/', l: $l, r: $r }, range: { start: {row: @l.first_line, column: @l.first_column}, end: {row: @r.last_line, column: @r.last_column} } } }
| e[l] "=" e[r]
{ $$ = { ast: { kind: '=', l: $l, r: $r }, range: { start: {row: @l.first_line, column: @l.first_column}, end: {row: @r.last_line, column: @r.last_column} } } }
| '(' e[exp] ')'
{ $$ = $exp; }
| IDENTIFIER
{ $$ = {ast: { kind: 'id', value: yytext }, range: { start: {row: @0.first_line, column: @0.first_column}, end: {row: @0.last_line, column: @0.last_column} } } }
| NUMBER
{ $$ = {ast: { kind: 'float', value: Number(yytext) }, range: { start: {row: @0.first_line, column: @0.first_column}, end: {row: @0.last_line, column: @0.last_column} } } }; | Bison | 4 | giuseppemag/ts-bccc-meta-interpreter | python_parser/python.bison | [
"MIT"
] |
a { value: #0h\61sh } | CSS | 0 | mengxy/swc | crates/swc_css_parser/tests/fixture/esbuild/misc/C4I0cdQcSbpaGOS-V8fwew/input.css | [
"Apache-2.0"
] |
-- A test suite for IN JOINS in parent side, subquery, and both predicate subquery
-- It includes correlated cases.
-- There are 2 dimensions we want to test
-- 1. run with broadcast hash join, sort merge join or shuffle hash join.
-- 2. run with whole-stage-codegen, operator codegen or no codegen.
--CONFIG_DIM1 spark.sql.autoBroadcastJoinThreshold=10485760
--CONFIG_DIM1 spark.sql.autoBroadcastJoinThreshold=-1,spark.sql.join.preferSortMergeJoin=true
--CONFIG_DIM1 spark.sql.autoBroadcastJoinThreshold=-1,spark.sql.join.forceApplyShuffledHashJoin=true
--CONFIG_DIM2 spark.sql.codegen.wholeStage=true
--CONFIG_DIM2 spark.sql.codegen.wholeStage=false,spark.sql.codegen.factoryMode=CODEGEN_ONLY
--CONFIG_DIM2 spark.sql.codegen.wholeStage=false,spark.sql.codegen.factoryMode=NO_CODEGEN
--CONFIG_DIM3 spark.sql.optimizeNullAwareAntiJoin=true
--CONFIG_DIM3 spark.sql.optimizeNullAwareAntiJoin=false
create temporary view t1 as select * from values
("val1a", 6S, 8, 10L, float(15.0), 20D, 20E2, timestamp '2014-04-04 01:00:00.000', date '2014-04-04'),
("val1b", 8S, 16, 19L, float(17.0), 25D, 26E2, timestamp '2014-05-04 01:01:00.000', date '2014-05-04'),
("val1a", 16S, 12, 21L, float(15.0), 20D, 20E2, timestamp '2014-06-04 01:02:00.001', date '2014-06-04'),
("val1a", 16S, 12, 10L, float(15.0), 20D, 20E2, timestamp '2014-07-04 01:01:00.000', date '2014-07-04'),
("val1c", 8S, 16, 19L, float(17.0), 25D, 26E2, timestamp '2014-05-04 01:02:00.001', date '2014-05-05'),
("val1d", null, 16, 22L, float(17.0), 25D, 26E2, timestamp '2014-06-04 01:01:00.000', null),
("val1d", null, 16, 19L, float(17.0), 25D, 26E2, timestamp '2014-07-04 01:02:00.001', null),
("val1e", 10S, null, 25L, float(17.0), 25D, 26E2, timestamp '2014-08-04 01:01:00.000', date '2014-08-04'),
("val1e", 10S, null, 19L, float(17.0), 25D, 26E2, timestamp '2014-09-04 01:02:00.001', date '2014-09-04'),
("val1d", 10S, null, 12L, float(17.0), 25D, 26E2, timestamp '2015-05-04 01:01:00.000', date '2015-05-04'),
("val1a", 6S, 8, 10L, float(15.0), 20D, 20E2, timestamp '2014-04-04 01:02:00.001', date '2014-04-04'),
("val1e", 10S, null, 19L, float(17.0), 25D, 26E2, timestamp '2014-05-04 01:01:00.000', date '2014-05-04')
as t1(t1a, t1b, t1c, t1d, t1e, t1f, t1g, t1h, t1i);
create temporary view t2 as select * from values
("val2a", 6S, 12, 14L, float(15), 20D, 20E2, timestamp '2014-04-04 01:01:00.000', date '2014-04-04'),
("val1b", 10S, 12, 19L, float(17), 25D, 26E2, timestamp '2014-05-04 01:01:00.000', date '2014-05-04'),
("val1b", 8S, 16, 119L, float(17), 25D, 26E2, timestamp '2015-05-04 01:01:00.000', date '2015-05-04'),
("val1c", 12S, 16, 219L, float(17), 25D, 26E2, timestamp '2016-05-04 01:01:00.000', date '2016-05-04'),
("val1b", null, 16, 319L, float(17), 25D, 26E2, timestamp '2017-05-04 01:01:00.000', null),
("val2e", 8S, null, 419L, float(17), 25D, 26E2, timestamp '2014-06-04 01:01:00.000', date '2014-06-04'),
("val1f", 19S, null, 519L, float(17), 25D, 26E2, timestamp '2014-05-04 01:01:00.000', date '2014-05-04'),
("val1b", 10S, 12, 19L, float(17), 25D, 26E2, timestamp '2014-06-04 01:01:00.000', date '2014-06-04'),
("val1b", 8S, 16, 19L, float(17), 25D, 26E2, timestamp '2014-07-04 01:01:00.000', date '2014-07-04'),
("val1c", 12S, 16, 19L, float(17), 25D, 26E2, timestamp '2014-08-04 01:01:00.000', date '2014-08-05'),
("val1e", 8S, null, 19L, float(17), 25D, 26E2, timestamp '2014-09-04 01:01:00.000', date '2014-09-04'),
("val1f", 19S, null, 19L, float(17), 25D, 26E2, timestamp '2014-10-04 01:01:00.000', date '2014-10-04'),
("val1b", null, 16, 19L, float(17), 25D, 26E2, timestamp '2014-05-04 01:01:00.000', null)
as t2(t2a, t2b, t2c, t2d, t2e, t2f, t2g, t2h, t2i);
create temporary view t3 as select * from values
("val3a", 6S, 12, 110L, float(15), 20D, 20E2, timestamp '2014-04-04 01:02:00.000', date '2014-04-04'),
("val3a", 6S, 12, 10L, float(15), 20D, 20E2, timestamp '2014-05-04 01:02:00.000', date '2014-05-04'),
("val1b", 10S, 12, 219L, float(17), 25D, 26E2, timestamp '2014-05-04 01:02:00.000', date '2014-05-04'),
("val1b", 10S, 12, 19L, float(17), 25D, 26E2, timestamp '2014-05-04 01:02:00.000', date '2014-05-04'),
("val1b", 8S, 16, 319L, float(17), 25D, 26E2, timestamp '2014-06-04 01:02:00.000', date '2014-06-04'),
("val1b", 8S, 16, 19L, float(17), 25D, 26E2, timestamp '2014-07-04 01:02:00.000', date '2014-07-04'),
("val3c", 17S, 16, 519L, float(17), 25D, 26E2, timestamp '2014-08-04 01:02:00.000', date '2014-08-04'),
("val3c", 17S, 16, 19L, float(17), 25D, 26E2, timestamp '2014-09-04 01:02:00.000', date '2014-09-05'),
("val1b", null, 16, 419L, float(17), 25D, 26E2, timestamp '2014-10-04 01:02:00.000', null),
("val1b", null, 16, 19L, float(17), 25D, 26E2, timestamp '2014-11-04 01:02:00.000', null),
("val3b", 8S, null, 719L, float(17), 25D, 26E2, timestamp '2014-05-04 01:02:00.000', date '2014-05-04'),
("val3b", 8S, null, 19L, float(17), 25D, 26E2, timestamp '2015-05-04 01:02:00.000', date '2015-05-04')
as t3(t3a, t3b, t3c, t3d, t3e, t3f, t3g, t3h, t3i);
create temporary view s1 as select * from values
(1), (3), (5), (7), (9)
as s1(id);
create temporary view s2 as select * from values
(1), (3), (4), (6), (9)
as s2(id);
create temporary view s3 as select * from values
(3), (4), (6), (9)
as s3(id);
-- correlated IN subquery
-- different JOIN in parent side
-- TC 01.01
SELECT t1a, t1b, t1c, t3a, t3b, t3c
FROM t1 natural JOIN t3
WHERE t1a IN (SELECT t2a
FROM t2
WHERE t1a = t2a)
AND t1b = t3b
AND t1a = t3a
ORDER BY t1a,
t1b,
t1c DESC nulls first;
-- TC 01.02
SELECT Count(DISTINCT(t1a)),
t1b,
t3a,
t3b,
t3c
FROM t1 natural left JOIN t3
WHERE t1a IN
(
SELECT t2a
FROM t2
WHERE t1d = t2d)
AND t1b > t3b
GROUP BY t1a,
t1b,
t3a,
t3b,
t3c
ORDER BY t1a DESC, t3b DESC, t3c ASC;
-- TC 01.03
SELECT Count(DISTINCT(t1a))
FROM t1 natural right JOIN t3
WHERE t1a IN
(
SELECT t2a
FROM t2
WHERE t1b = t2b)
AND t1d IN
(
SELECT t2d
FROM t2
WHERE t1c > t2c)
AND t1a = t3a
GROUP BY t1a
ORDER BY t1a;
-- TC 01.04
SELECT t1a,
t1b,
t1c,
t3a,
t3b,
t3c
FROM t1 FULL OUTER JOIN t3
where t1a IN
(
SELECT t2a
FROM t2
WHERE t2c IS NOT NULL)
AND t1b != t3b
AND t1a = 'val1b'
ORDER BY t1a;
-- TC 01.05
SELECT Count(DISTINCT(t1a)),
t1b
FROM t1 RIGHT JOIN t3
where t1a IN
(
SELECT t2a
FROM t2
WHERE t2h > t3h)
AND t3a IN
(
SELECT t2a
FROM t2
WHERE t2c > t3c)
AND t1h >= t3h
GROUP BY t1a,
t1b
HAVING t1b > 8
ORDER BY t1a;
-- TC 01.06
SELECT Count(DISTINCT(t1a))
FROM t1 LEFT OUTER
JOIN t3
ON t1a = t3a
WHERE t1a IN
(
SELECT t2a
FROM t2
WHERE t1h < t2h )
GROUP BY t1a
ORDER BY t1a;
-- TC 01.07
SELECT Count(DISTINCT(t1a)),
t1b
FROM t1 INNER JOIN t2
ON t1a > t2a
WHERE t1b IN
(
SELECT t2b
FROM t2
WHERE t2h > t1h)
OR t1a IN
(
SELECT t2a
FROM t2
WHERE t2h < t1h)
GROUP BY t1b
HAVING t1b > 6;
-- different JOIN in the subquery
-- TC 01.08
SELECT Count(DISTINCT(t1a)),
t1b
FROM t1
WHERE t1a IN
(
SELECT t2a
FROM t2
JOIN t1
WHERE t2b <> t1b)
AND t1h IN
(
SELECT t2h
FROM t2
RIGHT JOIN t3
where t2b = t3b)
GROUP BY t1b
HAVING t1b > 8;
-- TC 01.09
SELECT Count(DISTINCT(t1a)),
t1b
FROM t1
WHERE t1a IN
(
SELECT t2a
FROM t2
JOIN t1
WHERE t2b <> t1b)
AND t1h IN
(
SELECT t2h
FROM t2
RIGHT JOIN t3
where t2b = t3b)
AND t1b IN
(
SELECT t2b
FROM t2
FULL OUTER JOIN t3
where t2b = t3b)
GROUP BY t1b
HAVING t1b > 8;
-- JOIN in the parent and subquery
-- TC 01.10
SELECT Count(DISTINCT(t1a)),
t1b
FROM t1
INNER JOIN t2 on t1b = t2b
RIGHT JOIN t3 ON t1a = t3a
where t1a IN
(
SELECT t2a
FROM t2
FULL OUTER JOIN t3
WHERE t2b > t3b)
AND t1c IN
(
SELECT t3c
FROM t3
LEFT OUTER JOIN t2
ON t3a = t2a )
AND t1b IN
(
SELECT t3b
FROM t3 LEFT OUTER
JOIN t1
WHERE t3c = t1c)
AND t1a = t2a
GROUP BY t1b
ORDER BY t1b DESC;
-- TC 01.11
SELECT t1a,
t1b,
t1c,
count(distinct(t2a)),
t2b,
t2c
FROM t1
FULL JOIN t2 on t1a = t2a
RIGHT JOIN t3 on t1a = t3a
where t1a IN
(
SELECT t2a
FROM t2 INNER
JOIN t3
ON t2b < t3b
WHERE t2c IN
(
SELECT t1c
FROM t1
WHERE t1a = t2a))
and t1a = t2a
Group By t1a, t1b, t1c, t2a, t2b, t2c
HAVING t2c IS NOT NULL
ORDER By t2b DESC nulls last;
SELECT s1.id FROM s1
JOIN s2 ON s1.id = s2.id
AND s1.id IN (SELECT 9);
SELECT s1.id FROM s1
JOIN s2 ON s1.id = s2.id
AND s1.id NOT IN (SELECT 9);
-- IN with Subquery ON INNER JOIN
SELECT s1.id FROM s1
JOIN s2 ON s1.id = s2.id
AND s1.id IN (SELECT id FROM s3);
-- IN with Subquery ON LEFT SEMI JOIN
SELECT s1.id AS id2 FROM s1
LEFT SEMI JOIN s2
ON s1.id = s2.id
AND s1.id IN (SELECT id FROM s3);
-- IN with Subquery ON LEFT ANTI JOIN
SELECT s1.id as id2 FROM s1
LEFT ANTI JOIN s2
ON s1.id = s2.id
AND s1.id IN (SELECT id FROM s3);
-- IN with Subquery ON LEFT OUTER JOIN
SELECT s1.id, s2.id as id2 FROM s1
LEFT OUTER JOIN s2
ON s1.id = s2.id
AND s1.id IN (SELECT id FROM s3);
-- IN with Subquery ON RIGHT OUTER JOIN
SELECT s1.id, s2.id as id2 FROM s1
RIGHT OUTER JOIN s2
ON s1.id = s2.id
AND s1.id IN (SELECT id FROM s3);
-- IN with Subquery ON FULL OUTER JOIN
SELECT s1.id, s2.id AS id2 FROM s1
FULL OUTER JOIN s2
ON s1.id = s2.id
AND s1.id IN (SELECT id FROM s3);
-- NOT IN with Subquery ON INNER JOIN
SELECT s1.id FROM s1
JOIN s2 ON s1.id = s2.id
AND s1.id NOT IN (SELECT id FROM s3);
-- NOT IN with Subquery ON LEFT SEMI JOIN
SELECT s1.id AS id2 FROM s1
LEFT SEMI JOIN s2
ON s1.id = s2.id
AND s1.id NOT IN (SELECT id FROM s3);
-- NOT IN with Subquery ON LEFT ANTI JOIN
SELECT s1.id AS id2 FROM s1
LEFT ANTI JOIN s2
ON s1.id = s2.id
AND s1.id NOT IN (SELECT id FROM s3);
-- NOT IN with Subquery ON LEFT OUTER JOIN
SELECT s1.id, s2.id AS id2 FROM s1
LEFT OUTER JOIN s2
ON s1.id = s2.id
AND s1.id NOT IN (SELECT id FROM s3);
-- NOT IN with Subquery ON RIGHT OUTER JOIN
SELECT s1.id, s2.id AS id2 FROM s1
RIGHT OUTER JOIN s2
ON s1.id = s2.id
AND s1.id NOT IN (SELECT id FROM s3);
-- NOT IN with Subquery ON FULL OUTER JOIN
SELECT s1.id, s2.id AS id2 FROM s1
FULL OUTER JOIN s2
ON s1.id = s2.id
AND s1.id NOT IN (SELECT id FROM s3);
DROP VIEW s1;
DROP VIEW s2;
DROP VIEW s3;
| SQL | 5 | akhalymon-cv/spark | sql/core/src/test/resources/sql-tests/inputs/subquery/in-subquery/in-joins.sql | [
"Apache-2.0"
] |
// GUnit.grace
// GUnit project
//
// Created by Andrew Black on 6/26/12.
import "mirrors" as mirror
type Assertion = {
assert(bb:Boolean)description(str:String) -> Done
deny(bb:Boolean)description (str:String) -> Done
assert(bb:Boolean) -> Done
deny(bb:Boolean)-> Done
assert(s1:Object)shouldBe(s2:Object) -> Done
assert(b:Block)shouldRaise(de:Exception) -> Done
assert(b:Block)shouldntRaise(ue:Exception) -> Done
assert(s:Object) hasType (t:Type) -> Done
}
type TestCase = Assertion & type {
run(_:TestResult) -> Done
debug(_:TestResult) -> Done
size -> Number
name -> String
}
type Set = {
add -> done
...
}
type TestResult = {
testStarted(name:String) -> Done
testFailed(name:String) -> Done
testErrored(name:String) -> Done
summary -> String
detailedSummary -> String
numberOfErrors -> Number
errors -> Set<String>
numberOfFailures -> Number
failures -> Set<String>
numberOfRuns -> Number
}
type TestSuite = TestCase & type {
add(t:TestCase) -> Done
}
class assertion.trait {
def AssertionFailure is readable = Exception.refine "AssertionFailure"
method failBecause(str) {
assert (false) description (str)
}
method assert(bb: Boolean)description(str) {
if (! bb)
then {
AssertionFailure.raise(str)
}
}
method deny(bb: Boolean)description (str) {
assert (! bb) description (str)
}
method assert(bb: Boolean) {
assert (bb) description "Assertion failed!"
}
method deny(bb: Boolean) {
assert (! bb)
}
method assert(s1:Object)shouldBe(s2:Object) {
assert (s1 == s2) description "‹{s1}› should be ‹{s2}›"
}
method assert(block0)shouldRaise(desiredException) {
var completedNormally
try {
block0.apply
completedNormally := true
} catch { raisedException:desiredException ->
completedNormally := false
} catch { raisedException ->
failBecause "code raised exception {raisedException.exception}" +
": \"{raisedException.message}\" instead of {desiredException}"
}
if (completedNormally) then {failBecause "code did not raise an exception"}
}
method assert(block0)shouldntRaise(undesiredException) {
try {
block0.apply
} catch { raisedException:undesiredException ->
failBecause "code raised exception {raisedException.exception}"
} catch { raisedException -> // do nothing: it's ok to raise some other exception
}
}
method assert(value) hasType (DesiredType) {
match (value)
case { _:DesiredType -> assert (true) }
case { _ ->
def m = methodsIn(DesiredType) missingFrom (value)
failBecause "{value} does not have type {DesiredType}; it's missing methods {m}." }
}
method methodsIn(DesiredType) missingFrom (value) -> String is confidential {
def vMethods = mirror.reflect(value).methodNames
def tMethods = DesiredType.methodNames
def missing = tMethods -- vMethods
if (missing.size == 0) then {
ProgrammingError.raise "{value} seems to have all the methods of {DesiredType}"
} else {
var s := ""
missing.do { each -> s := s ++ each }
separatedBy { s := s ++ ", " }
s
}
}
method deny(value) hasType (UndesiredType) {
match (value)
case { _:UndesiredType -> failBecause "{value} has type {UndesiredType}" }
case { _ -> assert (true) }
}
}
method testCaseNamed(name') -> TestCase {
object {
inherits assertion.trait
method setup { }
method teardown { }
method run (result) {
result.testStarted(name)
try {
try {
setup
def methodImage = mirror.reflect(self).getMethod(name)
methodImage.request([[]])
} finally { teardown }
} catch {e: self.AssertionFailure ->
result.testFailed(name)withMessage(e.message)
} catch {e: Exception ->
result.testErrored(name)withMessage "{e.exception}: {e.message}"
}
}
method debug (result) {
result.testStarted(name)
try {
print ""
print "debugging method {name} ..."
try {
setup
def methodImage = mirror.reflect(self).getMethod(name)
methodImage.request([[]])
} finally { teardown }
} catch {e: self.AssertionFailure ->
result.testFailed(name)withMessage(e.message)
printBackTrace(e) limitedTo(8)
} catch {e: Exception ->
result.testErrored(name)withMessage(e.message)
printBackTrace(e) limitedTo(8)
}
}
method printBackTrace(exceptionPacket) limitedTo(callLimit) {
def ex = exceptionPacket.exception
def msg = exceptionPacket.message
def lineNr = exceptionPacket.lineNumber
print "{ex} on line {lineNr}: {msg}"
def bt = exceptionPacket.backtrace
var backTraceLimit := callLimit
while {bt.size > 0} do {
backTraceLimit := backTraceLimit - 1
if (backTraceLimit <= 0) then {
print "..."
return
}
print(" called from " ++ bt.pop)
}
}
method printFullBacktrace(exceptionPacket) {
print "backtrace:"
def bt = exceptionPacket.backtrace
while {bt.size > 0} do {
print(" called from " ++ bt.pop)
}
}
method runAndPrintResults {
def result = testResult
self.run(result)
print(result.detailedSummary)
}
method debugAndPrintResults {
def result = testResult
self.debug(result)
print(result.detailedSummary)
}
def size is public = 1
method name {name'}
}
}
factory method testResult {
var failSet := set.empty
var errorSet := set.empty
var runCount := 0
method testStarted(name) {
runCount := runCount + 1
}
method testFailed(name)withMessage(msg) {
failSet.add(testRecordFor(name)message(msg))
}
method testErrored(name)withMessage(msg) {
errorSet.add(testRecordFor(name)message(msg))
}
method summary {
def s = if (numberOfErrors == 1) then {""} else {"s"}
"{runCount} run, {numberOfFailures} failed, {numberOfErrors} error{s}"
}
method detailedSummary {
var output := summary
if (numberOfFailures > 0) then {
output := output ++ "\nFailures:"
for (failSet) do { each ->
output := output ++ "\n " ++ each
}
}
if (numberOfErrors > 0) then {
output := output ++ "\nErrors:"
for (errorSet) do { each ->
output := output ++ "\n " ++ each
}
}
output
}
method numberOfErrors {
errorSet.size
}
method errors {
set.withAll(errorSet)
}
method erroredTestNames {
errorSet.map{each -> each.name}.onto(set)
}
method numberOfFailures {
failSet.size
}
method failures {
set.withAll(failSet)
}
method failedTestNames {
failSet.map{each -> each.name}.onto(set)
}
method numberOfRuns {
runCount
}
}
factory method testRecordFor(testName)message(testMsg) {
method name {testName}
method message {testMsg}
method asString {"{testName}: {testMsg}"}
method hash {testName.hash}
}
def testSuite is readable = object {
inherits collections.collectionFactory.trait
method withAll(initialContents) -> TestSuite {
object {
inherits collections.enumerable.trait
def tests = list.empty
for (initialContents) do { each -> self.add(each) }
method add(e) { tests.push(e) }
method run(result) {
for (tests) do { each -> each.run(result) }
}
method debug(result) {
for (tests) do { each -> each.debug(result) }
}
method size { tests.size }
method name {
var namelist := ""
for (tests) do { each -> namelist := namelist ++ each.name ++ " " }
namelist
}
method runAndPrintResults {
def result = testResult
self.run(result)
print(result.detailedSummary)
}
method debugAndPrintResults {
def result = testResult
self.debug(result)
print(result.detailedSummary)
}
method iterator { tests.iterator }
method do (aBlock) { tests.do (aBlock) }
method addAll(anotherSuite) {
anotherSuite.do { each -> self.add(each) }
self
}
method ++ (anotherSuite) {
outer.withAll(tests).addAll(anotherSuite)
}
}
}
method fromTestMethodsIn(aTestClass) -> TestCase {
def newSuite = self.empty
def example = aTestClass.forMethod("null")
for (mirror.reflect(example).methods) do { each ->
if (each.name.substringFrom(1)to(4)=="test") then {
newSuite.add(aTestClass.forMethod(each.name))
}
}
newSuite
}
}
| Grace | 5 | smola/language-dataset | data/github.com/rogrush/grace-dictionary/f22c3f8233dc57d2e762c50ed5cdf15d1ec4ab84/gUnit.grace | [
"MIT"
] |
#tag Class
Private Class ProxyEngineCreator
Inherits libcURL.ProxyEngine
#tag Method, Flags = &h0
Sub Constructor(Owner As libcURL.EasyHandle)
' This class exists solely to protect the superclass Constructor from being called
' from outside the libcURL module.
// Calling the overridden superclass constructor.
// Constructor(Owner As libcURL.EasyHandle) -- From ProxyEngine
Super.Constructor(Owner)
End Sub
#tag EndMethod
#tag ViewBehavior
#tag ViewProperty
Name="Address"
Group="Behavior"
Type="String"
EditorType="MultiLineEditor"
InheritedFrom="libcURL.ProxyEngine"
#tag EndViewProperty
#tag ViewProperty
Name="HTTPTunnel"
Group="Behavior"
Type="Boolean"
InheritedFrom="libcURL.ProxyEngine"
#tag EndViewProperty
#tag ViewProperty
Name="Index"
Visible=true
Group="ID"
InitialValue="-2147483648"
InheritedFrom="Object"
#tag EndViewProperty
#tag ViewProperty
Name="Left"
Visible=true
Group="Position"
InitialValue="0"
InheritedFrom="Object"
#tag EndViewProperty
#tag ViewProperty
Name="Name"
Visible=true
Group="ID"
InheritedFrom="Object"
#tag EndViewProperty
#tag ViewProperty
Name="Password"
Group="Behavior"
Type="String"
EditorType="MultiLineEditor"
InheritedFrom="libcURL.ProxyEngine"
#tag EndViewProperty
#tag ViewProperty
Name="Port"
Group="Behavior"
Type="Integer"
InheritedFrom="libcURL.ProxyEngine"
#tag EndViewProperty
#tag ViewProperty
Name="ServiceName"
Group="Behavior"
Type="String"
EditorType="MultiLineEditor"
InheritedFrom="libcURL.ProxyEngine"
#tag EndViewProperty
#tag ViewProperty
Name="Super"
Visible=true
Group="ID"
InheritedFrom="Object"
#tag EndViewProperty
#tag ViewProperty
Name="Top"
Visible=true
Group="Position"
InitialValue="0"
InheritedFrom="Object"
#tag EndViewProperty
#tag ViewProperty
Name="UnifiedHeaders"
Group="Behavior"
Type="Boolean"
InheritedFrom="libcURL.ProxyEngine"
#tag EndViewProperty
#tag ViewProperty
Name="Username"
Group="Behavior"
Type="String"
EditorType="MultiLineEditor"
InheritedFrom="libcURL.ProxyEngine"
#tag EndViewProperty
#tag EndViewBehavior
End Class
#tag EndClass
| REALbasic | 4 | charonn0/RB-libcURL | libcURL/ProxyEngineCreator.rbbas | [
"MIT"
] |
; RUN: llvm-as -disable-output %s -o - 2>&1 | FileCheck %s
source_filename = "t.c"
target datalayout = "e-m:o-i64:64-f80:128-n8:16:32:64-S128"
target triple = "x86_64-apple-macosx10.12.0"
define void @f() !dbg !4 {
entry:
; CHECK: scope points into the type hierarchy
; CHECK: DILocation
ret void, !dbg !7
}
define void @g() !dbg !8 {
entry:
; CHECK: scope points into the type hierarchy
; CHECK: DILexicalBlockFile
ret void, !dbg !9
}
; CHECK: warning: ignoring invalid debug info
!llvm.dbg.cu = !{!0}
!llvm.module.flags = !{!2, !3}
!0 = distinct !DICompileUnit(language: DW_LANG_C99, file: !1, emissionKind: FullDebug)
!1 = !DIFile(filename: "t.c", directory: "/tmp")
!2 = !{i32 2, !"Dwarf Version", i32 4}
!3 = !{i32 2, !"Debug Info Version", i32 3}
!4 = distinct !DISubprogram(name: "f", scope: !1, file: !1, line: 2, type: !5, isDefinition: true, scopeLine: 2, flags: DIFlagPrototyped, unit: !0)
!5 = !DISubroutineType(types: !{})
!6 = distinct !DISubprogram(name: "f", scope: !1, file: !1, line: 2, type: !5, isDefinition: false, scopeLine: 2)
!7 = !DILocation(line: 2, scope: !6)
!8 = distinct !DISubprogram(name: "g", scope: !1, file: !1, line: 2, type: !5, isDefinition: true, scopeLine: 2, flags: DIFlagPrototyped, unit: !0)
!9 = !DILocation(line: 2, scope: !10, inlinedAt: !11)
!10 = !DILexicalBlockFile(scope: !6, file: !2, discriminator: 0)
!11 = !DILocation(line: 2, scope: !8)
| LLVM | 2 | medismailben/llvm-project | llvm/test/Verifier/DILocation-parents.ll | [
"Apache-2.0"
] |
// Licensed to the .NET Foundation under one or more agreements.
// The .NET Foundation licenses this file to you under the MIT license.
// See the LICENSE file in the project root for more information.
#nullable disable
using System;
using System.Collections.Generic;
using System.Collections.Immutable;
using System.Threading;
using System.Threading.Tasks;
using Microsoft.CodeAnalysis.CodeActions;
using Microsoft.CodeAnalysis.CodeFixes;
using Microsoft.CodeAnalysis.Editor.Shared.Extensions;
using Microsoft.CodeAnalysis.Editor.Shared.Utilities;
using Microsoft.CodeAnalysis.ErrorReporting;
using Microsoft.CodeAnalysis.Extensions;
using Microsoft.CodeAnalysis.Internal.Log;
using Microsoft.CodeAnalysis.Shared.TestHooks;
using Microsoft.CodeAnalysis.Shared.Utilities;
using Microsoft.CodeAnalysis.Text;
using Microsoft.VisualStudio.Core.Imaging;
using Microsoft.VisualStudio.Imaging.Interop;
using Microsoft.VisualStudio.Language.Intellisense;
using Microsoft.VisualStudio.Text;
using Microsoft.VisualStudio.Threading;
using Microsoft.VisualStudio.Utilities;
using Roslyn.Utilities;
namespace Microsoft.CodeAnalysis.Editor.Implementation.Suggestions
{
/// <summary>
/// Base class for all Roslyn light bulb menu items.
/// </summary>
internal abstract partial class SuggestedAction : ForegroundThreadAffinitizedObject, ISuggestedAction3, IEquatable<ISuggestedAction>
{
protected readonly SuggestedActionsSourceProvider SourceProvider;
protected readonly Workspace Workspace;
protected readonly ITextBuffer SubjectBuffer;
protected readonly object Provider;
internal readonly CodeAction CodeAction;
private ICodeActionEditHandlerService EditHandler => SourceProvider.EditHandler;
internal SuggestedAction(
IThreadingContext threadingContext,
SuggestedActionsSourceProvider sourceProvider,
Workspace workspace,
ITextBuffer subjectBuffer,
object provider,
CodeAction codeAction)
: base(threadingContext)
{
Contract.ThrowIfNull(provider);
Contract.ThrowIfNull(codeAction);
SourceProvider = sourceProvider;
Workspace = workspace;
SubjectBuffer = subjectBuffer;
Provider = provider;
CodeAction = codeAction;
}
internal virtual CodeActionPriority Priority => CodeAction.Priority;
internal bool IsForCodeQualityImprovement
=> (Provider as SyntaxEditorBasedCodeFixProvider)?.CodeFixCategory == CodeFixCategory.CodeQuality;
public virtual bool TryGetTelemetryId(out Guid telemetryId)
{
telemetryId = CodeAction.GetType().GetTelemetryId();
return true;
}
// NOTE: We want to avoid computing the operations on the UI thread. So we use Task.Run() to do this work on the background thread.
protected Task<ImmutableArray<CodeActionOperation>> GetOperationsAsync(
IProgressTracker progressTracker, CancellationToken cancellationToken)
{
return Task.Run(
() => CodeAction.GetOperationsAsync(progressTracker, cancellationToken), cancellationToken);
}
protected static Task<IEnumerable<CodeActionOperation>> GetOperationsAsync(CodeActionWithOptions actionWithOptions, object options, CancellationToken cancellationToken)
{
return Task.Run(
() => actionWithOptions.GetOperationsAsync(options, cancellationToken), cancellationToken);
}
protected Task<ImmutableArray<CodeActionOperation>> GetPreviewOperationsAsync(CancellationToken cancellationToken)
{
return Task.Run(
() => CodeAction.GetPreviewOperationsAsync(cancellationToken), cancellationToken);
}
public void Invoke(CancellationToken cancellationToken)
{
throw new NotImplementedException("Invoke(CancellationToken) is no longer supported. Use Invoke(IUIThreadOperationContext) instead.");
}
public void Invoke(IUIThreadOperationContext context)
{
// we're going to return immediately from Invoke and kick off our own async work to invoke the
// code action. Once this returns, the editor will close the threaded wait dialog it created.
// So we need to take ownership of it and start our own TWD instead to track this.
context.TakeOwnership();
_ = InvokeAsync();
}
private async Task InvokeAsync()
{
try
{
using var token = SourceProvider.OperationListener.BeginAsyncOperation($"{nameof(SuggestedAction)}.{nameof(Invoke)}");
using var context = SourceProvider.UIThreadOperationExecutor.BeginExecute(
EditorFeaturesResources.Execute_Suggested_Action, CodeAction.Title, allowCancellation: true, showProgress: true);
using var scope = context.AddScope(allowCancellation: true, CodeAction.Message);
await this.InnerInvokeAsync(new UIThreadOperationContextProgressTracker(scope), context.UserCancellationToken).ConfigureAwait(false);
}
catch (OperationCanceledException)
{
}
catch (Exception ex) when (FatalError.ReportAndCatch(ex))
{
}
}
protected virtual async Task InnerInvokeAsync(IProgressTracker progressTracker, CancellationToken cancellationToken)
{
await this.ThreadingContext.JoinableTaskFactory.SwitchToMainThreadAsync(cancellationToken);
using (new CaretPositionRestorer(SubjectBuffer, EditHandler.AssociatedViewService))
{
// ConfigureAwait(true) so that CaretPositionRestorer.Dispose runs on the UI thread.
await Workspace.Services.GetService<IExtensionManager>().PerformActionAsync(
Provider, () => InvokeWorkerAsync(progressTracker, cancellationToken)).ConfigureAwait(true);
}
}
private async Task InvokeWorkerAsync(IProgressTracker progressTracker, CancellationToken cancellationToken)
{
await this.ThreadingContext.JoinableTaskFactory.SwitchToMainThreadAsync(cancellationToken);
IEnumerable<CodeActionOperation> operations = null;
if (CodeAction is CodeActionWithOptions actionWithOptions)
{
var options = actionWithOptions.GetOptions(cancellationToken);
if (options != null)
operations = await GetOperationsAsync(actionWithOptions, options, cancellationToken).ConfigureAwait(true);
}
else
{
operations = await GetOperationsAsync(progressTracker, cancellationToken).ConfigureAwait(true);
}
AssertIsForeground();
if (operations != null)
{
// Clear the progress we showed while computing the action.
// We'll now show progress as we apply the action.
progressTracker.Clear();
using (Logger.LogBlock(
FunctionId.CodeFixes_ApplyChanges, KeyValueLogMessage.Create(LogType.UserAction, m => CreateLogProperties(m)), cancellationToken))
{
var document = this.SubjectBuffer.CurrentSnapshot.GetOpenDocumentInCurrentContextWithChanges();
await EditHandler.ApplyAsync(
Workspace, document,
operations.ToImmutableArray(), CodeAction.Title,
progressTracker, cancellationToken).ConfigureAwait(false);
}
}
}
private void CreateLogProperties(Dictionary<string, object> map)
{
// set various correlation info
if (CodeAction is FixSomeCodeAction fixSome)
{
// fix all correlation info
map[FixAllLogger.CorrelationId] = fixSome.FixAllState.CorrelationId;
map[FixAllLogger.FixAllScope] = fixSome.FixAllState.Scope.ToString();
}
if (TryGetTelemetryId(out var telemetryId))
{
// Lightbulb correlation info
map["TelemetryId"] = telemetryId.ToString();
}
if (this is ITelemetryDiagnosticID<string> diagnosticId)
{
// save what it is actually fixing
map["DiagnosticId"] = diagnosticId.GetDiagnosticID();
}
}
public string DisplayText
{
get
{
// Underscores will become an accelerator in the VS smart tag. So we double all
// underscores so they actually get represented as an underscore in the UI.
var extensionManager = Workspace.Services.GetService<IExtensionManager>();
var text = extensionManager.PerformFunction(Provider, () => CodeAction.Title, defaultValue: string.Empty);
return text.Replace("_", "__");
}
}
public string DisplayTextSuffix => "";
protected async Task<SolutionPreviewResult> GetPreviewResultAsync(CancellationToken cancellationToken)
{
cancellationToken.ThrowIfCancellationRequested();
// We will always invoke this from the UI thread.
AssertIsForeground();
// We use ConfigureAwait(true) to stay on the UI thread.
var operations = await GetPreviewOperationsAsync(cancellationToken).ConfigureAwait(true);
return await EditHandler.GetPreviewsAsync(Workspace, operations, cancellationToken).ConfigureAwait(true);
}
public virtual bool HasPreview => false;
public virtual Task<object> GetPreviewAsync(CancellationToken cancellationToken)
=> SpecializedTasks.Null<object>();
public virtual bool HasActionSets => false;
public virtual Task<IEnumerable<SuggestedActionSet>> GetActionSetsAsync(CancellationToken cancellationToken)
=> SpecializedTasks.EmptyEnumerable<SuggestedActionSet>();
#region not supported
void IDisposable.Dispose()
{
// do nothing
}
// same as display text
string ISuggestedAction.IconAutomationText => DisplayText;
ImageMoniker ISuggestedAction.IconMoniker
{
get
{
var tags = CodeAction.Tags;
if (tags.Length > 0)
{
foreach (var service in SourceProvider.ImageIdServices)
{
if (service.Value.TryGetImageId(tags, out var imageId) && !imageId.Equals(default(ImageId)))
{
// Not using the extension method because it's not available in Cocoa
return new ImageMoniker
{
Guid = imageId.Guid,
Id = imageId.Id
};
}
}
}
return default;
}
}
// no shortcut support
string ISuggestedAction.InputGestureText => null;
#endregion
#region IEquatable<ISuggestedAction>
public bool Equals(ISuggestedAction other)
=> Equals(other as SuggestedAction);
public override bool Equals(object obj)
=> Equals(obj as SuggestedAction);
internal bool Equals(SuggestedAction otherSuggestedAction)
{
if (otherSuggestedAction == null)
{
return false;
}
if (this == otherSuggestedAction)
{
return true;
}
if (Provider != otherSuggestedAction.Provider)
{
return false;
}
var otherCodeAction = otherSuggestedAction.CodeAction;
if (CodeAction.EquivalenceKey == null || otherCodeAction.EquivalenceKey == null)
{
return false;
}
return CodeAction.EquivalenceKey == otherCodeAction.EquivalenceKey;
}
public override int GetHashCode()
{
if (CodeAction.EquivalenceKey == null)
{
return base.GetHashCode();
}
return Hash.Combine(Provider.GetHashCode(), CodeAction.EquivalenceKey.GetHashCode());
}
#endregion
internal TestAccessor GetTestAccessor() => new(this);
internal readonly struct TestAccessor
{
private readonly SuggestedAction _suggestedAction;
public TestAccessor(SuggestedAction suggestedAction)
=> _suggestedAction = suggestedAction;
public Task InvokeAsync()
=> _suggestedAction.InvokeAsync();
}
}
}
| C# | 4 | frandesc/roslyn | src/EditorFeatures/Core.Wpf/Suggestions/SuggestedActions/SuggestedAction.cs | [
"MIT"
] |
@color: green;
.componentClassName {
color: @color;
}
| Less | 3 | waltercruz/gatsby | e2e-tests/production-runtime/src/pages/styling/less.module.less | [
"MIT"
] |
load "common.gnu"
data = "../data/map_construct.csv"
set output dir."map_construct".ext
set title "constructing maps"
plot data using 1:2, for [i=3:21] '' using 1:i
| Gnuplot | 3 | jafingerhut/bifurcan | benchmarks/gnuplot/map_construct.gnu | [
"MIT"
] |
[[build-tool-plugins.other-build-systems]]
== Supporting Other Build Systems
If you want to use a build tool other than Maven, Gradle, or Ant, you likely need to develop your own plugin.
Executable jars need to follow a specific format and certain entries need to be written in an uncompressed form (see the "`<<executable-jar#executable-jar, executable jar format>>`" section in the appendix for details).
The Spring Boot Maven and Gradle plugins both make use of `spring-boot-loader-tools` to actually generate jars.
If you need to, you may use this library directly.
[[build-tool-plugins.other-build-systems.repackaging-archives]]
=== Repackaging Archives
To repackage an existing archive so that it becomes a self-contained executable archive, use `org.springframework.boot.loader.tools.Repackager`.
The `Repackager` class takes a single constructor argument that refers to an existing jar or war archive.
Use one of the two available `repackage()` methods to either replace the original file or write to a new destination.
Various settings can also be configured on the repackager before it is run.
[[build-tool-plugins.other-build-systems.nested-libraries]]
=== Nested Libraries
When repackaging an archive, you can include references to dependency files by using the `org.springframework.boot.loader.tools.Libraries` interface.
We do not provide any concrete implementations of `Libraries` here as they are usually build-system-specific.
If your archive already includes libraries, you can use `Libraries.NONE`.
[[build-tool-plugins.other-build-systems.finding-main-class]]
=== Finding a Main Class
If you do not use `Repackager.setMainClass()` to specify a main class, the repackager uses https://asm.ow2.io/[ASM] to read class files and tries to find a suitable class with a `public static void main(String[] args)` method.
An exception is thrown if more than one candidate is found.
[[build-tool-plugins.other-build-systems.example-repackage-implementation]]
=== Example Repackage Implementation
The following example shows a typical repackage implementation:
[source,java,indent=0,subs="verbatim"]
----
include::{docs-java}/buildtoolplugins/otherbuildsystems/examplerepackageimplementation/MyBuildTool.java[]
----
| AsciiDoc | 3 | techAi007/spring-boot | spring-boot-project/spring-boot-docs/src/docs/asciidoc/build-tool-plugins/other-build-systems.adoc | [
"Apache-2.0"
] |
ITERABLE_SECTION_RAM(test_ram, 4)
| Linker Script | 0 | Trifunik/zephyr | tests/misc/iterable_sections/sections-ram.ld | [
"Apache-2.0"
] |
# Copyright (c) 2018-2021, Carnegie Mellon University
# See LICENSE for details
#Concatenation(Conf("spiral_dir"), Conf("path_sep"), "libgen", Conf("path_sep"),
#F InitLibgen(<opts>)
#F opts must have a .libgen field.
#F Example: opts := InitLibgen(LibgenDefaults);
#F
InitLibgen := function(opts)
local base_opts, bench;
opts := Copy(opts);
base_opts := CopyFields(opts, rec(
globalUnrolling := opts.libgen.basesUnrolling,
breakdownRules := opts.libgen.basesBreakdowns,
hashFile := opts.libgen.basesHashFile,
benchTransforms := opts.libgen.bases));
bench:= CopyFields(DPBench(rec(bases := base_opts), rec(verbosity:=0)),
rec(generateCfiles := false, generateSums := true, matrixVerify := false));
bench.resumeAll();
opts.libgen.baseBench := bench;
opts.baseHashes := Concatenation(opts.baseHashes, [ CreateRecursBaseHash(bench.exp.bases.hashTable) ]);
return opts;
end;
_bases := function(max)
local t, facs, sizesTwoPower, sizesGeneral;
sizesTwoPower := List([1..Log2Int(max)], x->2^x);
facs := [2, 3, 5, 7, 11];
sizesGeneral := Filtered([2 .. max], i -> ForAll(FactorsInt(i), f -> f in (facs)));
t := [];
Append(t, List(sizesTwoPower, PRDFT3));
Append(t, List(sizesTwoPower, n -> PRDFT3(n, -1).transpose()));
Append(t, List(sizesTwoPower, n -> DFT(n, -1 mod n)));
# Append(t, List(sizesTwoPower, URDFT));
Append(t, List(sizesGeneral, PRDFT));
Append(t, List(sizesGeneral, DFT));
return t;
end;
LibgenDefaultsMixin := rec(
codegen := RecCodegen,
verbosity := 1,
hashTable := HashTableDP(),
formulaStrategies := rec(
sigmaSpl := [ StandardSumsRules, HfuncSumsRules ],
preRC := [],
rc := [ StandardSumsRules, HfuncSumsRules ],
postProcess := [
(s, opts) -> BlockSums(opts.globalUnrolling, s),
(s, opts) -> Process_fPrecompute(s, opts),
RecursStepTerm
]
),
libgen := rec(
codeletTab := CreateCodeletHashTable(),
terminateStrategy := [ HfuncSumsRules ], # used in SumsCodelet
bases := _bases(34),
basesUnrolling := 2^16,
basesHashFile := let(p:=Conf("path_sep"),
Concat(Conf("spiral_dir"), p, "spiral", p, "libgen", p, "realbases.hash")),
basesBreakdowns := rec(
DFT := [DFT_Base, DFT_CT, DFT_GoodThomas, DFT_PD, DFT_Rader],
PRDFT := [PRDFT1_Base2, PRDFT1_CT, PRDFT1_PF, PRDFT_Rader, PRDFT_PD],
PRDFT3 := [PRDFT3_Base1, PRDFT3_Base2, PRDFT3_CT, PRDFT3_OddToPRDFT1])
)
);
LibgenDefaults := CopyFields(SpiralDefaults, LibgenDefaultsMixin, rec(
globalUnrolling := 66,
breakdownRules := rec(
DFT := [DFT_Base, DFT_CT],
PRDFT := [PRDFT1_Base2, PRDFT1_CT],
PRDFT3 := [PRDFT3_Base2, PRDFT3_CT],
PDCT4 := [PDCT4_Base2, PDCT4_CT],
PDST4 := [PDST4_Base2, PDST4_CT],
InfoNt := [Info_Base]),
libgen := Copy(LibgenDefaultsMixin.libgen)
));
CplxLibgenDefaults := CopyFields(CplxSpiralDefaults, LibgenDefaultsMixin, rec(
globalUnrolling := 34,
breakdownRules := rec(
DFT := [DFT_Base, DFT_CT],
PRDFT := [PRDFT1_Base2, PRDFT1_CT],
PRDFT3 := [PRDFT3_Base2, PRDFT3_CT],
InfoNt := [Info_Base]),
libgen := CopyFields(Copy(LibgenDefaultsMixin.libgen), rec(
bases := List([1..5], x->DFT(2^x)),
basesHashFile := let(p:=Conf("path_sep"),
Concat(Conf("spiral_dir"), p, "spiral", p, "libgen", p, "cplxbases.hash")),
basesBreakdowns := rec(
DFT := [DFT_Base, DFT_PRDFT],
PRDFT := [PRDFT1_Base1, PRDFT1_Base2, PRDFT1_CT, PRDFT1_PF, PRDFT_PD, PRDFT_Rader],
PRDFT3 := [PRDFT3_Base1, PRDFT3_Base2, PRDFT3_CT, PRDFT3_OddToPRDFT1])
))
));
| GAP | 5 | sr7cb/spiral-software | namespaces/spiral/libgen/defaults.gi | [
"BSD-2-Clause-FreeBSD"
] |
<template>
<div>
<button class="bg-blue-500 hover:bg-blue-600 text-white font-bold py-2 px-4 rounded">
My Component Button
</button>
</div>
</template>
| Vue | 3 | ardyno/nuxt.js | examples/tailwindcss-purgecss/components/MyComponent.vue | [
"MIT"
] |
#include <ATen/NativeFunctions.h>
#include <ATen/Dispatch.h>
#include <ATen/ExpandUtils.h>
#include <ATen/Functions.h>
#include <ATen/native/cuda/Loops.cuh>
#include <ATen/native/TensorIterator.h>
namespace {
inline void lerp_cuda(at::Tensor& ret, const at::Tensor& self, const at::Tensor& end, const at::Tensor& weights) {
TORCH_CHECK(self.dtype() == end.dtype(), "expected dtype ", self.dtype(), " for `end` but got dtype ", end.dtype());
TORCH_CHECK(self.dtype() == weights.dtype(), "expected dtype ", self.dtype(), " for `weights` but got dtype ", weights.dtype());
at::TensorIterator iter = at::TensorIteratorConfig()
.add_output(ret)
.add_input(self)
.add_input(end)
.add_input(weights)
.build();
AT_DISPATCH_FLOATING_AND_COMPLEX_TYPES_AND2(
at::ScalarType::Half, at::ScalarType::BFloat16,
iter.common_dtype(), "lerp_cuda",
[&] {
at::native::gpu_kernel(
iter,
[] GPU_LAMBDA(
scalar_t self_val,
scalar_t end_val,
scalar_t weight_val) -> scalar_t {
return (std::abs(weight_val) < 0.5)
? self_val + weight_val * (end_val - self_val)
: end_val -
(end_val - self_val) *
(static_cast<scalar_t>(1) - weight_val);
});
});
}
inline void lerp_scalar_cuda(at::Tensor& ret, const at::Tensor& self, const at::Tensor& end, const c10::Scalar& weight) {
TORCH_CHECK(self.dtype() == end.dtype(), "expected dtype ", self.dtype(), " for `end` but got dtype ", end.dtype());
at::TensorIterator iter = at::TensorIteratorConfig()
.add_output(ret)
.add_input(self)
.add_input(end)
.build();
AT_DISPATCH_FLOATING_AND_COMPLEX_TYPES_AND2(
at::ScalarType::Half, at::ScalarType::BFloat16,
self.scalar_type(), "lerp_cuda",
[&]{
auto weight_val = weight.to<scalar_t>();
at::native::gpu_kernel(
iter, [=] GPU_LAMBDA(scalar_t self_val, scalar_t end_val) {
return (std::abs(weight_val) < 0.5)
? self_val + weight_val * (end_val - self_val)
: end_val -
(end_val - self_val) * (static_cast<scalar_t>(1) - weight_val);
});
});
}
} // anonymous namespace
namespace at {
namespace native {
Tensor& lerp_cuda_tensor_out(const Tensor& self,
const Tensor& end, const Tensor& weight, Tensor& result) {
c10::MaybeOwned<Tensor> b_self, b_end, b_weight;
std::tie(b_self, b_end, b_weight) = expand_outplace(self, end, weight, "lerp_out_cuda");
lerp_cuda(result, *b_self, *b_end, *b_weight);
return result;
}
Tensor& lerp_cuda_scalar_out(const Tensor& self,
const Tensor& end, const Scalar& weight, Tensor& result) {
c10::MaybeOwned<Tensor> b_self, b_end;
std::tie(b_self, b_end) = expand_outplace(self, end, "lerp_out_cuda");
lerp_scalar_cuda(result, *b_self, *b_end, weight);
return result;
}
Tensor& lerp_cuda_tensor_(Tensor& self, const Tensor& end, const Tensor& weight) {
c10::MaybeOwned<Tensor> b_self, b_end, b_weight;
std::tie(b_self, b_end, b_weight) = expand_outplace(self, end, weight, "lerp__cuda");
TORCH_CHECK(b_self->sizes() == self.sizes(),
"output with shape ", self.sizes(),
" doesn't match the broadcast shape ", b_self->sizes());
lerp_cuda(self, *b_self, *b_end, *b_weight);
return self;
}
Tensor& lerp_cuda_scalar_(Tensor& self, const Tensor& end, const Scalar& weight) {
c10::MaybeOwned<Tensor> b_self, b_end;
std::tie(b_self, b_end) = expand_outplace(self, end, "lerp__cuda");
TORCH_CHECK(b_self->sizes() == self.sizes(),
"output with shape ", self.sizes(),
" doesn't match the broadcast shape ", b_self->sizes());
lerp_scalar_cuda(self, *b_self, *b_end, weight);
return self;
}
Tensor lerp_cuda_tensor(const Tensor& self, const Tensor& end, const Tensor& weight) {
c10::MaybeOwned<Tensor> b_self, b_end, b_weight;
std::tie(b_self, b_end, b_weight) = expand_outplace(self, end, weight, "lerp_cuda");
Tensor result = at::empty_like(*b_self, b_self->suggest_memory_format());
lerp_cuda(result, *b_self, *b_end, *b_weight);
return result;
}
Tensor lerp_cuda_scalar(const Tensor& self, const Tensor& end, const Scalar& weight) {
c10::MaybeOwned<Tensor> b_self, b_end;
std::tie(b_self, b_end) = expand_outplace(self, end, "lerp_cuda");
Tensor result = at::empty_like(*b_self, b_self->suggest_memory_format());
lerp_scalar_cuda(result, *b_self, *b_end, weight);
return result;
}
} // namespace native
} // namespace at
| Cuda | 4 | xiaohanhuang/pytorch | aten/src/ATen/native/cuda/Lerp.cu | [
"Intel"
] |
#! /bin/sh -e
# DP: Fix GNAT on alpha.
dir=
if [ $# -eq 3 -a "$2" = '-d' ]; then
pdir="-d $3"
dir="$3/"
elif [ $# -ne 1 ]; then
echo >&2 "`basename $0`: script expects -patch|-unpatch as argument"
exit 1
fi
case "$1" in
-patch)
patch $pdir -f --no-backup-if-mismatch -p0 < $0
;;
-unpatch)
patch $pdir -f --no-backup-if-mismatch -R -p0 < $0
;;
*)
echo >&2 "`basename $0`: script expects -patch|-unpatch as argument"
exit 1
esac
exit 0
2008-04-01 Aurelien Jarno <aurelien@aurel32.net>
* s-osinte-linux-alpha.ads (SC_NPROCESSORS_ONLN): New constant
for sysconf call.
(bit_field): New packed boolean type used by cpu_set_t.
(cpu_set_t): New type corresponding to the C type with
the same name. Note that on the Ada side we use a bit
field array for the affinity mask. There is not need
for the C macro for setting individual bit.
(pthread_setaffinity_np): New imported routine.
Index: gcc/ada/s-osinte-linux-alpha.ads
===================================================================
--- gcc/ada/s-osinte-linux-alpha.ads (révision 133772)
+++ gcc/ada/s-osinte-linux-alpha.ads (copie de travail)
@@ -237,6 +237,7 @@
pragma Import (C, sysconf);
SC_CLK_TCK : constant := 2;
+ SC_NPROCESSORS_ONLN : constant := 84;
-------------------------
-- Priority Scheduling --
@@ -268,6 +269,7 @@
type Thread_Body is access
function (arg : System.Address) return System.Address;
+ pragma Convention (C, Thread_Body);
function Thread_Body_Access is new
Unchecked_Conversion (System.Address, Thread_Body);
@@ -448,12 +450,31 @@
pragma Import (C, pthread_getspecific, "pthread_getspecific");
type destructor_pointer is access procedure (arg : System.Address);
+ pragma Convention (C, destructor_pointer);
function pthread_key_create
(key : access pthread_key_t;
destructor : destructor_pointer) return int;
pragma Import (C, pthread_key_create, "pthread_key_create");
+ CPU_SETSIZE : constant := 1_024;
+
+ type bit_field is array (1 .. CPU_SETSIZE) of Boolean;
+ for bit_field'Size use CPU_SETSIZE;
+ pragma Pack (bit_field);
+ pragma Convention (C, bit_field);
+
+ type cpu_set_t is record
+ bits : bit_field;
+ end record;
+ pragma Convention (C, cpu_set_t);
+
+ function pthread_setaffinity_np
+ (thread : pthread_t;
+ cpusetsize : size_t;
+ cpuset : access cpu_set_t) return int;
+ pragma Import (C, pthread_setaffinity_np, "__gnat_pthread_setaffinity_np");
+
private
type sigset_t is record
| Darcs Patch | 4 | JrCs/opendreambox | recipes/gcc/gcc-4.3.4/debian/ada-alpha.dpatch | [
"MIT"
] |
- dashboard: traffic_engagement_overview
title: Traffic Engagement Overview
layout: newspaper
elements:
- name: User Engagement metrics by acquisition source, keyword searched, first page
visited, and more
type: text
title_text: User Engagement metrics by acquisition source, keyword searched, first
page visited, and more
row: 0
col: 0
width: 24
height: 2
- name: Total Sessions (Traffic)
title: Total Sessions (Traffic)
model: google_analytics_block
explore: ga_sessions
type: single_value
fields:
- ga_sessions.session_count
limit: 500
column_limit: 50
query_timezone: America/New_York
custom_color_enabled: false
custom_color: forestgreen
show_single_value_title: true
show_comparison: false
comparison_type: value
comparison_reverse_colors: false
show_comparison_label: true
stacking: ''
show_value_labels: false
label_density: 25
legend_position: center
x_axis_gridlines: false
y_axis_gridlines: true
show_view_names: true
limit_displayed_rows: false
y_axis_combined: true
show_y_axis_labels: true
show_y_axis_ticks: true
y_axis_tick_density: default
y_axis_tick_density_custom: 5
show_x_axis_label: true
show_x_axis_ticks: true
x_axis_scale: auto
y_axis_scale_mode: linear
ordering: none
show_null_labels: false
show_totals_labels: false
show_silhouette: false
totals_color: "#808080"
series_types:
__FILE: bq_connectors_ga360/traffic_engagement_overview.dashboard.lookml
__LINE_NUM: 224
listen:
Date: ga_sessions.partition_date
Campaign: trafficSource.campaign
First Time Visitor: ga_sessions.first_time_visitor
row: 2
col: 0
width: 6
height: 2
- name: Unique Visitors (Traffic)
title: Unique Visitors (Traffic)
model: google_analytics_block
explore: ga_sessions
type: single_value
fields:
- ga_sessions.unique_visitors
limit: 500
column_limit: 50
query_timezone: America/New_York
custom_color_enabled: false
custom_color: forestgreen
show_single_value_title: true
show_comparison: false
comparison_type: value
comparison_reverse_colors: false
show_comparison_label: true
stacking: ''
show_value_labels: false
label_density: 25
legend_position: center
x_axis_gridlines: false
y_axis_gridlines: true
show_view_names: true
limit_displayed_rows: false
y_axis_combined: true
show_y_axis_labels: true
show_y_axis_ticks: true
y_axis_tick_density: default
y_axis_tick_density_custom: 5
show_x_axis_label: true
show_x_axis_ticks: true
x_axis_scale: auto
y_axis_scale_mode: linear
ordering: none
show_null_labels: false
show_totals_labels: false
show_silhouette: false
totals_color: "#808080"
series_types:
__FILE: bq_connectors_ga360/traffic_engagement_overview.dashboard.lookml
__LINE_NUM: 98
listen:
Date: ga_sessions.partition_date
Campaign: trafficSource.campaign
First Time Visitor: ga_sessions.first_time_visitor
row: 2
col: 6
width: 6
height: 2
- name: Returning Visitors
title: Returning Visitors
model: google_analytics_block
explore: ga_sessions
type: single_value
fields:
- ga_sessions.returning_visitors
limit: 500
column_limit: 50
query_timezone: America/New_York
custom_color_enabled: false
custom_color: forestgreen
show_single_value_title: true
show_comparison: false
comparison_type: value
comparison_reverse_colors: false
show_comparison_label: true
stacking: ''
show_value_labels: false
label_density: 25
legend_position: center
x_axis_gridlines: false
y_axis_gridlines: true
show_view_names: true
limit_displayed_rows: false
y_axis_combined: true
show_y_axis_labels: true
show_y_axis_ticks: true
y_axis_tick_density: default
y_axis_tick_density_custom: 5
show_x_axis_label: true
show_x_axis_ticks: true
x_axis_scale: auto
y_axis_scale_mode: linear
ordering: none
show_null_labels: false
show_totals_labels: false
show_silhouette: false
totals_color: "#808080"
series_types:
__FILE: bq_connectors_ga360/traffic_engagement_overview.dashboard.lookml
__LINE_NUM: 182
listen:
Date: ga_sessions.partition_date
Campaign: trafficSource.campaign
First Time Visitor: ga_sessions.first_time_visitor
row: 2
col: 18
width: 6
height: 2
- name: First Time Visitors
title: First Time Visitors
model: google_analytics_block
explore: ga_sessions
type: single_value
fields:
- ga_sessions.first_time_visitors
limit: 500
column_limit: 50
query_timezone: America/New_York
custom_color_enabled: false
custom_color: forestgreen
show_single_value_title: true
show_comparison: false
comparison_type: value
comparison_reverse_colors: false
show_comparison_label: true
stacking: ''
show_value_labels: false
label_density: 25
legend_position: center
x_axis_gridlines: false
y_axis_gridlines: true
show_view_names: true
limit_displayed_rows: false
y_axis_combined: true
show_y_axis_labels: true
show_y_axis_ticks: true
y_axis_tick_density: default
y_axis_tick_density_custom: 5
show_x_axis_label: true
show_x_axis_ticks: true
x_axis_scale: auto
y_axis_scale_mode: linear
ordering: none
show_null_labels: false
show_totals_labels: false
show_silhouette: false
totals_color: "#808080"
series_types:
__FILE: bq_connectors_ga360/traffic_engagement_overview.dashboard.lookml
__LINE_NUM: 140
listen:
Date: ga_sessions.partition_date
Campaign: trafficSource.campaign
First Time Visitor: ga_sessions.first_time_visitor
row: 2
col: 12
width: 6
height: 2
- name: Average Sessions per Visitor (Traffic)
title: Average Sessions per Visitor (Traffic)
model: google_analytics_block
explore: ga_sessions
type: single_value
fields:
- ga_sessions.average_sessions_ver_visitor
limit: 500
column_limit: 50
query_timezone: America/New_York
custom_color_enabled: false
custom_color: forestgreen
show_single_value_title: true
show_comparison: false
comparison_type: value
comparison_reverse_colors: false
show_comparison_label: true
stacking: ''
show_value_labels: false
label_density: 25
legend_position: center
x_axis_gridlines: false
y_axis_gridlines: true
show_view_names: true
limit_displayed_rows: false
y_axis_combined: true
show_y_axis_labels: true
show_y_axis_ticks: true
y_axis_tick_density: default
y_axis_tick_density_custom: 5
show_x_axis_label: true
show_x_axis_ticks: true
x_axis_scale: auto
y_axis_scale_mode: linear
ordering: none
show_null_labels: false
show_totals_labels: false
show_silhouette: false
totals_color: "#808080"
series_types:
__FILE: bq_connectors_ga360/traffic_engagement_overview.dashboard.lookml
__LINE_NUM: 266
listen:
Date: ga_sessions.partition_date
Campaign: trafficSource.campaign
First Time Visitor: ga_sessions.first_time_visitor
row: 4
col: 0
width: 9
height: 2
- name: Average Page Views per Session
title: Average Page Views per Session
model: google_analytics_block
explore: ga_sessions
type: single_value
fields:
- totals.page_views_session
limit: 500
column_limit: 50
query_timezone: America/New_York
custom_color_enabled: false
custom_color: forestgreen
show_single_value_title: true
show_comparison: false
comparison_type: value
comparison_reverse_colors: false
show_comparison_label: true
stacking: ''
show_value_labels: false
label_density: 25
legend_position: center
x_axis_gridlines: false
y_axis_gridlines: true
show_view_names: true
limit_displayed_rows: false
y_axis_combined: true
show_y_axis_labels: true
show_y_axis_ticks: true
y_axis_tick_density: default
y_axis_tick_density_custom: 5
show_x_axis_label: true
show_x_axis_ticks: true
x_axis_scale: auto
y_axis_scale_mode: linear
ordering: none
show_null_labels: false
show_totals_labels: false
show_silhouette: false
totals_color: "#808080"
series_types:
__FILE: bq_connectors_ga360/traffic_engagement_overview.dashboard.lookml
__LINE_NUM: 308
listen:
Date: ga_sessions.partition_date
Campaign: trafficSource.campaign
First Time Visitor: ga_sessions.first_time_visitor
row: 4
col: 9
width: 6
height: 2
- name: Average Session Length
title: Average Session Length
model: google_analytics_block
explore: ga_sessions
type: single_value
fields:
- totals.timeonsite_average_per_session
limit: 500
column_limit: 50
query_timezone: America/New_York
custom_color_enabled: false
custom_color: forestgreen
show_single_value_title: true
show_comparison: false
comparison_type: value
comparison_reverse_colors: false
show_comparison_label: true
stacking: ''
show_value_labels: false
label_density: 25
legend_position: center
x_axis_gridlines: false
y_axis_gridlines: true
show_view_names: true
limit_displayed_rows: false
y_axis_combined: true
show_y_axis_labels: true
show_y_axis_ticks: true
y_axis_tick_density: default
y_axis_tick_density_custom: 5
show_x_axis_label: true
show_x_axis_ticks: true
x_axis_scale: auto
y_axis_scale_mode: linear
ordering: none
show_null_labels: false
show_totals_labels: false
show_silhouette: false
totals_color: "#808080"
series_types:
__FILE: bq_connectors_ga360/traffic_engagement_overview.dashboard.lookml
__LINE_NUM: 350
listen:
Date: ga_sessions.partition_date
Campaign: trafficSource.campaign
First Time Visitor: ga_sessions.first_time_visitor
row: 4
col: 15
width: 9
height: 2
- title: User Conversion Funnel by Source
name: User Conversion Funnel by Source
model: google_analytics_block
explore: ga_sessions
type: looker_column
fields:
- trafficSource.source
- ga_sessions.session_count
- ga_sessions.unique_visitors
- totals.transactions_count
sorts:
- ga_sessions.session_count desc
limit: 3
column_limit: 50
query_timezone: America/New_York
stacking: ''
show_value_labels: false
label_density: 25
legend_position: center
x_axis_gridlines: false
y_axis_gridlines: true
show_view_names: true
limit_displayed_rows: false
y_axis_combined: true
show_y_axis_labels: true
show_y_axis_ticks: true
y_axis_tick_density: default
y_axis_tick_density_custom: 5
show_x_axis_label: true
show_x_axis_ticks: true
x_axis_scale: auto
y_axis_scale_mode: linear
ordering: none
show_null_labels: false
show_totals_labels: false
show_silhouette: false
totals_color: "#808080"
show_dropoff: true
series_colors:
totals.hits_total: "#3B4260"
totals.pageviews_total: "#1D98D3"
totals.transactions_count: "#39A736"
__FILE: bq_connectors_ga360/traffic_engagement_overview.dashboard.lookml
__LINE_NUM: 389
ga_sessions.session_count: "#3B4260"
ga_sessions.unique_visitors: "#1D98D3"
listen:
Date: ga_sessions.partition_date
Campaign: trafficSource.campaign
First Time Visitor: ga_sessions.first_time_visitor
row: 6
col: 0
width: 12
height: 8
- title: User Conversion Funnel by Keyword
name: User Conversion Funnel by Keyword
model: google_analytics_block
explore: ga_sessions
type: looker_column
fields:
- trafficSource.keyword
- ga_sessions.session_count
- ga_sessions.unique_visitors
- totals.transactions_count
sorts:
- ga_sessions.session_count desc
limit: 3
column_limit: 50
query_timezone: America/New_York
stacking: ''
show_value_labels: false
label_density: 25
legend_position: center
x_axis_gridlines: false
y_axis_gridlines: true
show_view_names: true
limit_displayed_rows: false
y_axis_combined: true
show_y_axis_labels: true
show_y_axis_ticks: true
y_axis_tick_density: default
y_axis_tick_density_custom: 5
show_x_axis_label: true
show_x_axis_ticks: true
x_axis_scale: auto
y_axis_scale_mode: linear
ordering: none
show_null_labels: false
show_totals_labels: false
show_silhouette: false
totals_color: "#808080"
show_dropoff: true
series_colors:
totals.hits_total: "#3B4260"
totals.pageviews_total: "#1D98D3"
totals.transactions_count: "#39A736"
__FILE: bq_connectors_ga360/traffic_engagement_overview.dashboard.lookml
__LINE_NUM: 389
ga_sessions.session_count: "#3B4260"
ga_sessions.unique_visitors: "#1D98D3"
listen:
Date: ga_sessions.partition_date
Campaign: trafficSource.campaign
First Time Visitor: ga_sessions.first_time_visitor
row: 6
col: 12
width: 12
height: 8
- name: Engagement by Keyword Search
title: Engagement by Keyword Search
model: google_analytics_block
explore: ga_sessions
type: looker_bar
fields:
- trafficSource.keyword
- totals.page_views_session
- totals.timeonsite_average_per_session
- ga_sessions.session_count
filters:
trafficSource.keyword: "-NULL,-(not provided)"
sorts:
- ga_sessions.session_count desc
limit: 10
column_limit: 50
dynamic_fields:
- table_calculation: average_time_spent_per_page
label: Average Time Spent per Page
expression: "${totals.timeonsite_average_per_session}/${totals.page_views_session}"
value_format:
value_format_name: decimal_2
_kind_hint: measure
_type_hint: number
- table_calculation: average_pageviews_per_session
label: Average Pageviews per Session
expression: "${totals.page_views_session}"
value_format:
value_format_name: decimal_2
_kind_hint: measure
_type_hint: number
- table_calculation: average_time_per_session
label: Average Time per Session
expression: "${totals.timeonsite_average_per_session}"
value_format:
value_format_name: decimal_2
_kind_hint: measure
_type_hint: number
- table_calculation: total_sessions
label: Total Sessions
expression: "${ga_sessions.session_count}"
value_format:
value_format_name:
_kind_hint: measure
_type_hint: number
stacking: ''
show_value_labels: true
label_density: 25
legend_position: center
x_axis_gridlines: false
y_axis_gridlines: true
show_view_names: true
limit_displayed_rows: false
y_axis_combined: true
show_y_axis_labels: true
show_y_axis_ticks: true
y_axis_tick_density: default
y_axis_tick_density_custom: 5
show_x_axis_label: true
show_x_axis_ticks: true
x_axis_scale: auto
y_axis_scale_mode: linear
ordering: none
show_null_labels: false
show_totals_labels: false
show_silhouette: false
totals_color: "#808080"
query_timezone: America/New_York
custom_color_enabled: false
custom_color: forestgreen
show_single_value_title: true
show_comparison: false
comparison_type: value
comparison_reverse_colors: false
show_comparison_label: true
series_types:
average_time_spent_per_page: line
average_pageviews_per_session: line
average_time_per_session: line
hidden_series:
- average_time_spent_per_page
- average_pageviews_per_session
y_axes:
- label: ''
maxValue:
minValue:
orientation: left
showLabels: true
showValues: true
tickDensity: default
tickDensityCustom:
type: linear
unpinAxis: false
valueFormat:
series:
- id: total_sessions
name: Total Sessions
__FILE: bq_connectors_ga360/traffic_engagement_overview.dashboard.lookml
__LINE_NUM: 628
__FILE: bq_connectors_ga360/traffic_engagement_overview.dashboard.lookml
__LINE_NUM: 626
- label:
maxValue:
minValue:
orientation: right
showLabels: false
showValues: false
tickDensity: default
tickDensityCustom:
type: linear
unpinAxis: false
valueFormat:
series:
- id: average_time_per_session
name: Average Time per Session
__FILE: bq_connectors_ga360/traffic_engagement_overview.dashboard.lookml
__LINE_NUM: 632
- id: average_time_spent_per_page
name: Average Time Spent per Page
- id: average_pageviews_per_session
name: Average Pageviews per Session
__FILE: bq_connectors_ga360/traffic_engagement_overview.dashboard.lookml
__LINE_NUM: 629
series_colors:
ga_sessions.session_count: "#3B4260"
totals.page_views_session: "#39A736"
totals.timeonsite_average_per_session: "#B1B0B0"
__FILE: bq_connectors_ga360/traffic_engagement_overview.dashboard.lookml
__LINE_NUM: 639
total_sessions: "#3B4260"
average_pageviews_per_session: "#39A736"
average_time_per_session: "#F3BF0E"
hidden_fields:
- totals.page_views_session
- totals.timeonsite_average_per_session
- ga_sessions.session_count
label_color:
- "#1D98D3"
- "#39A736"
- "#F3BF0E"
- "#ffffff"
listen:
Date: ga_sessions.partition_date
Campaign: trafficSource.campaign
First Time Visitor: ga_sessions.first_time_visitor
row: 14
col: 0
width: 12
height: 12
- name: Keyword Full Detail
title: Keyword Full Detail
model: google_analytics_block
explore: ga_sessions
type: table
fields:
- trafficSource.keyword
- ga_sessions.session_count
- totals.visits_total
- ga_sessions.returning_visitors
- ga_sessions.unique_visitors
- totals.page_views_session
- totals.timeonsite_average_per_session
- totals.transactions_count
- totals.transactionRevenue_total
filters:
trafficSource.keyword: "-NULL,-(not provided)"
sorts:
- ga_sessions.session_count desc
limit: 500
column_limit: 50
query_timezone: America/New_York
show_view_names: true
show_row_numbers: true
truncate_column_names: false
hide_totals: false
hide_row_totals: false
table_theme: gray
limit_displayed_rows: false
enable_conditional_formatting: false
conditional_formatting_ignored_fields: []
conditional_formatting_include_totals: false
conditional_formatting_include_nulls: false
stacking: ''
show_value_labels: false
label_density: 25
legend_position: center
x_axis_gridlines: false
y_axis_gridlines: true
y_axis_combined: true
show_y_axis_labels: true
show_y_axis_ticks: true
y_axis_tick_density: default
y_axis_tick_density_custom: 5
show_x_axis_label: true
show_x_axis_ticks: true
x_axis_scale: auto
y_axis_scale_mode: linear
ordering: none
show_null_labels: false
show_totals_labels: false
show_silhouette: false
totals_color: "#808080"
series_types:
__FILE: bq_connectors_ga360/traffic_engagement_overview.dashboard.lookml
__LINE_NUM: 814
listen:
Date: ga_sessions.partition_date
Campaign: trafficSource.campaign
First Time Visitor: ga_sessions.first_time_visitor
row: 14
col: 12
width: 12
height: 12
- name: Traffic Source Full Detail
title: Traffic Source Full Detail
model: google_analytics_block
explore: ga_sessions
type: table
fields:
- trafficSource.source
- ga_sessions.session_count
- totals.visits_total
- ga_sessions.returning_visitors
- ga_sessions.unique_visitors
- totals.page_views_session
- totals.timeonsite_average_per_session
- totals.transactions_count
- totals.transactionRevenue_total
sorts:
- ga_sessions.session_count desc
limit: 500
column_limit: 50
query_timezone: America/New_York
show_view_names: true
show_row_numbers: true
truncate_column_names: false
hide_totals: false
hide_row_totals: false
table_theme: gray
limit_displayed_rows: false
enable_conditional_formatting: false
conditional_formatting_ignored_fields: []
conditional_formatting_include_totals: false
conditional_formatting_include_nulls: false
stacking: ''
show_value_labels: false
label_density: 25
legend_position: center
x_axis_gridlines: false
y_axis_gridlines: true
y_axis_combined: true
show_y_axis_labels: true
show_y_axis_ticks: true
y_axis_tick_density: default
y_axis_tick_density_custom: 5
show_x_axis_label: true
show_x_axis_ticks: true
x_axis_scale: auto
y_axis_scale_mode: linear
ordering: none
show_null_labels: false
show_totals_labels: false
show_silhouette: false
totals_color: "#808080"
series_types:
__FILE: bq_connectors_ga360/traffic_engagement_overview.dashboard.lookml
__LINE_NUM: 762
listen:
Date: ga_sessions.partition_date
Campaign: trafficSource.campaign
First Time Visitor: ga_sessions.first_time_visitor
row: 26
col: 0
width: 12
height: 12
- title: Top Performing First Pages Visited
name: Top Performing First Pages Visited
model: google_analytics_block
explore: ga_sessions
type: looker_line
fields:
- first_page.pageTitle
- totals.pageviews_total
- totals.page_views_session
- ga_sessions.session_count
- totals.timeonsite_average_per_session
sorts:
- ga_sessions.session_count desc
limit: 10
column_limit: 50
dynamic_fields:
- table_calculation: average_time_spent_per_page
label: Average Time Spent per Page
expression: "${totals.timeonsite_average_per_session}/${totals.page_views_session}"
value_format:
value_format_name: decimal_2
_kind_hint: measure
_type_hint: number
- table_calculation: average_pageviews_per_session
label: Average Pageviews per Session
expression: "${totals.page_views_session}"
value_format:
value_format_name: decimal_2
_kind_hint: measure
_type_hint: number
- table_calculation: average_time_per_session
label: Average Time per Session
expression: "${totals.timeonsite_average_per_session}"
value_format:
value_format_name: decimal_2
_kind_hint: measure
_type_hint: number
- table_calculation: total_sessions
label: Total Sessions
expression: "${ga_sessions.session_count}"
value_format:
value_format_name: decimal_0
_kind_hint: measure
_type_hint: number
stacking: ''
show_value_labels: true
label_density: 25
legend_position: center
x_axis_gridlines: false
y_axis_gridlines: true
show_view_names: true
limit_displayed_rows: false
y_axis_combined: true
show_y_axis_labels: true
show_y_axis_ticks: true
y_axis_tick_density: default
y_axis_tick_density_custom: 5
show_x_axis_label: true
show_x_axis_ticks: true
x_axis_scale: auto
y_axis_scale_mode: linear
show_null_points: true
point_style: circle
interpolation: monotone
ordering: none
show_null_labels: false
show_totals_labels: false
show_silhouette: false
totals_color: "#808080"
hidden_fields:
- totals.timeonsite_average_per_session
- ga_sessions.session_count
- totals.page_views_session
- totals.pageviews_total
series_types:
total_sessions: column
series_colors:
total_sessions: "#3B4260"
average_pageviews_per_session: "#39A736"
average_time_per_session: "#F3BF0E"
label_color:
- "#1D98D3"
- "#39A736"
- "#F3BF0E"
- "#fff"
y_axes:
- label: Time in Seconds
maxValue:
minValue:
orientation: left
showLabels: true
showValues: true
tickDensity: default
tickDensityCustom: 5
type: linear
unpinAxis: false
valueFormat:
series:
- id: average_time_spent_per_page
name: Average Time Spent per Page
axisId: average_time_spent_per_page
- id: average_pageviews_per_session
name: Average Pageviews per Session
axisId: average_pageviews_per_session
- id: average_time_per_session
name: Average Time per Session
axisId: average_time_per_session
- label:
maxValue:
minValue:
orientation: right
showLabels: true
showValues: true
tickDensity: default
tickDensityCustom: 5
type: linear
unpinAxis: false
valueFormat:
series:
- id: total_sessions
name: Total Sessions
axisId: total_sessions
hidden_series:
- average_time_spent_per_page
- average_pageviews_per_session
listen:
Date: ga_sessions.partition_date
Campaign: trafficSource.campaign
First Time Visitor: ga_sessions.first_time_visitor
row: 38
col: 0
width: 24
height: 8
- title: Top 15 Pages - First Page Visited
name: Top 15 Pages - First Page Visited
model: google_analytics_block
explore: ga_sessions
type: table
fields:
- totals.pageviews_total
- ga_sessions.session_count
- totals.page_views_session
- totals.timeonsite_average_per_session
- ga_sessions.unique_visitors
- ga_sessions.returning_visitors
- totals.bounces_total
- totals.bounce_rate
- totals.transactions_count
- totals.transactionRevenue_total
- first_page.pageTitle
sorts:
- ga_sessions.session_count desc
limit: 15
column_limit: 50
query_timezone: America/New_York
show_view_names: false
show_row_numbers: true
truncate_column_names: false
hide_totals: false
hide_row_totals: false
table_theme: gray
limit_displayed_rows: false
stacking: ''
show_value_labels: false
label_density: 25
legend_position: center
x_axis_gridlines: false
y_axis_gridlines: true
y_axis_combined: false
show_y_axis_labels: true
show_y_axis_ticks: true
y_axis_tick_density: default
y_axis_tick_density_custom: 5
show_x_axis_label: true
show_x_axis_ticks: true
x_axis_scale: auto
y_axis_scale_mode: linear
ordering: none
show_null_labels: false
show_totals_labels: false
show_silhouette: false
totals_color: "#808080"
font_size: '12'
series_types:
__FILE: bq_connectors_ga360/ga_sessions_and_visitors.dashboard.lookml
__LINE_NUM: 394
enable_conditional_formatting: false
conditional_formatting_ignored_fields: []
conditional_formatting_include_totals: false
conditional_formatting_include_nulls: false
listen:
Date: ga_sessions.partition_date
Campaign: trafficSource.campaign
First Time Visitor: ga_sessions.first_time_visitor
row: 46
col: 0
width: 24
height: 8
- name: Engagement by Traffic Source
title: Engagement by Traffic Source
model: google_analytics_block
explore: ga_sessions
type: looker_bar
fields:
- trafficSource.source
- totals.page_views_session
- totals.timeonsite_average_per_session
- ga_sessions.session_count
sorts:
- ga_sessions.session_count desc
limit: 10
column_limit: 50
dynamic_fields:
- table_calculation: average_time_spent_per_page
label: Average Time Spent per Page
expression: "${totals.timeonsite_average_per_session}/${totals.page_views_session}"
value_format:
value_format_name: decimal_2
_kind_hint: measure
_type_hint: number
- table_calculation: average_pageviews_per_session
label: Average Pageviews per Session
expression: "${totals.page_views_session}"
value_format:
value_format_name: decimal_2
_kind_hint: measure
_type_hint: number
- table_calculation: average_time_per_session
label: Average Time per Session
expression: "${totals.timeonsite_average_per_session}"
value_format:
value_format_name: decimal_2
_kind_hint: measure
_type_hint: number
- table_calculation: total_sessions
label: Total Sessions
expression: "${ga_sessions.session_count}"
value_format:
value_format_name:
_kind_hint: measure
_type_hint: number
stacking: ''
show_value_labels: true
label_density: 25
legend_position: center
x_axis_gridlines: false
y_axis_gridlines: true
show_view_names: true
limit_displayed_rows: false
y_axis_combined: true
show_y_axis_labels: true
show_y_axis_ticks: true
y_axis_tick_density: default
y_axis_tick_density_custom: 5
show_x_axis_label: true
show_x_axis_ticks: true
x_axis_scale: auto
y_axis_scale_mode: linear
ordering: none
show_null_labels: false
show_totals_labels: false
show_silhouette: false
totals_color: "#808080"
query_timezone: America/New_York
custom_color_enabled: false
custom_color: forestgreen
show_single_value_title: true
show_comparison: false
comparison_type: value
comparison_reverse_colors: false
show_comparison_label: true
series_types:
average_time_per_session: line
average_pageviews_per_session: line
average_time_spent_per_page: line
hidden_series:
- average_time_spent_per_page
- average_pageviews_per_session
y_axes:
- label: Time in Seconds
maxValue:
minValue:
orientation: top
showLabels: false
showValues: false
tickDensity: default
tickDensityCustom:
type: linear
unpinAxis: false
valueFormat:
series:
- id: average_pageviews_per_session
name: Average Pageviews per Session
__FILE: bq_connectors_ga360/traffic_engagement_overview.dashboard.lookml
__LINE_NUM: 488
axisId: average_pageviews_per_session
- id: average_time_per_session
name: Average Time per Session
axisId: average_time_per_session
- id: average_time_spent_per_page
name: Average Time Spent per Page
axisId: average_time_spent_per_page
__FILE: bq_connectors_ga360/traffic_engagement_overview.dashboard.lookml
__LINE_NUM: 486
- label:
maxValue:
minValue:
orientation: bottom
showLabels: true
showValues: true
tickDensity: default
tickDensityCustom:
type: linear
unpinAxis: false
valueFormat:
series:
- id: total_sessions
name: Total Sessions
__FILE: bq_connectors_ga360/traffic_engagement_overview.dashboard.lookml
__LINE_NUM: 492
axisId: total_sessions
__FILE: bq_connectors_ga360/traffic_engagement_overview.dashboard.lookml
__LINE_NUM: 489
series_colors:
ga_sessions.session_count: "#3B4260"
totals.page_views_session: "#39A736"
totals.timeonsite_average_per_session: "#B1B0B0"
__FILE: bq_connectors_ga360/traffic_engagement_overview.dashboard.lookml
__LINE_NUM: 499
total_sessions: "#3B4260"
average_time_per_session: "#F3BF0E"
average_pageviews_per_session: "#39A736"
hidden_fields:
- totals.page_views_session
- totals.timeonsite_average_per_session
- ga_sessions.session_count
label_color:
- "#1D98D3"
- "#39A736"
- "#F3BF0E"
- "#ffffff"
listen:
Date: ga_sessions.partition_date
Campaign: trafficSource.campaign
First Time Visitor: ga_sessions.first_time_visitor
row: 26
col: 12
width: 12
height: 12
filters:
- name: Date
title: Date
type: date_filter
default_value: 7 days
allow_multiple_values: true
required: false
- name: Property (Website)
title: Property (Website)
type: string_filter
default_value: ''
allow_multiple_values: true
required: false
- name: Campaign
title: Campaign
type: field_filter
default_value: ''
model: google_analytics_block
explore: ga_sessions
field: trafficSource.campaign
listens_to_filters: []
allow_multiple_values: true
required: false
- name: First Time Visitor
title: First Time Visitor
type: field_filter
default_value: ''
model: google_analytics_block
explore: ga_sessions
field: ga_sessions.first_time_visitor
listens_to_filters: []
allow_multiple_values: true
required: false | LookML | 3 | thomasbanghart/testing-remote-dep | lookml_dashboards/traffic_engagement_overview.dashboard.lookml | [
"MIT"
] |
// May not matter, since people can use them with a nightly feature.
// However this tests to guarantee they don't leak out via portable_simd,
// and thus don't accidentally get stabilized.
use std::simd::intrinsics; //~ERROR E0603
fn main() {
()
}
| Rust | 2 | david-perez/rust | src/test/ui/simd/portable-intrinsics-arent-exposed.rs | [
"ECL-2.0",
"Apache-2.0",
"MIT-0",
"MIT"
] |
// https://dom.spec.whatwg.org/#nondocumenttypechildnode
interface mixin NonDocumentTypeChildNode {
readonly attribute Element? previousElementSibling;
readonly attribute Element? nextElementSibling;
};
Element includes NonDocumentTypeChildNode;
CharacterData includes NonDocumentTypeChildNode;
| WebIDL | 3 | Unique184/jsdom | lib/jsdom/living/nodes/NonDocumentTypeChildNode.webidl | [
"MIT"
] |
--TEST--
filter_var() and FILTER_SANITIZE_EMAIL
--EXTENSIONS--
filter
--FILE--
<?php
var_dump(filter_var("a@b.c", FILTER_SANITIZE_EMAIL));
var_dump(filter_var("a[!@#$%^&*()@a@#$%^&*(.com@#$%^&*(", FILTER_SANITIZE_EMAIL));
var_dump(filter_var("white space here \ \ \" some more", FILTER_SANITIZE_EMAIL));
var_dump(filter_var("", FILTER_SANITIZE_EMAIL));
var_dump(filter_var("123456789000000", FILTER_SANITIZE_EMAIL));
echo "Done\n";
?>
--EXPECT--
string(5) "a@b.c"
string(30) "a[!@#$%^&*@a@#$%^&*.com@#$%^&*"
string(22) "whitespaceheresomemore"
string(0) ""
string(15) "123456789000000"
Done
| PHP | 3 | NathanFreeman/php-src | ext/filter/tests/022.phpt | [
"PHP-3.01"
] |
option now = () => 2020-02-22T18:00:00Z
@tableflux.h2o_temperature{location, state,
bottom_degrees, surface_degrees, time > -3h}
| FLUX | 2 | RohanSreerama5/flux | colm/tableflux/query15.flux | [
"MIT"
] |
#!/bin/sh
GO111MODULE=on
mv go.mod /tmp/
go mod init | Shell | 3 | ikysil/lazygit | scripts/bump_modules.sh | [
"MIT"
] |
validatorRules: {
<#list columns as po>
<#include "core.ftl">
</#list>
},
| FreeMarker | 0 | sammydai/jeecg-boot | jeecg-boot/jeecg-boot-module-system/src/main/resources/jeecg/code-template-online/common/validatorRulesTemplate/main.ftl | [
"Apache-2.0"
] |
#tag Module
Protected Module FormatCodePreferences
#tag Note, Name = About
This module is optional. If present, the FormatCode IDE Script will use the constants found here instead
of the ones in the script.
The module does not need all of these constants, but must have at lease one or the script will fail.
Most of the constants are booleans. The KeywordsTo... provide exceptions to the default CaseConversion.
For example, if you want all of your keywords as title case except for if/then/else, you would
set CaseConversion = "kTitleCase" and KeywordsToLowerCase to "if,then,else". (Spaces around the
keywords will be stripped by the script).
The KeywordsTo... constants are comma-delimited strings.
#tag EndNote
#tag Constant, Name = AlignAs, Type = Boolean, Dynamic = False, Default = \"False", Scope = Protected
#tag EndConstant
#tag Constant, Name = CaseConversion, Type = String, Dynamic = False, Default = \"kLowerCase", Scope = Protected
#tag EndConstant
#tag Constant, Name = DoDebug, Type = Boolean, Dynamic = False, Default = \"False", Scope = Protected
#tag EndConstant
#tag Constant, Name = KeywordsToLowerCase, Type = String, Dynamic = False, Default = \"if\x2C then\x2C end\x2C while\x2C wend\x2C select\x2C case\x2C print\n", Scope = Protected
#tag EndConstant
#tag Constant, Name = KeywordsToTitleCase, Type = String, Dynamic = False, Default = \"Int8\x2C Int16\x2C Int32\x2C Int64\x2C UInt8\x2C UInt16\x2C UInt32\x2C UInt64\n\nDictionary\x2C Date\n\nTrue\x2C False\n\nClose\n\nRaiseEvent\n\nBackgroundTasks\nNilObjectChecking\nStackOverflowChecking\nBoundsChecking\nDebugBuild", Scope = Protected
#tag EndConstant
#tag Constant, Name = KeywordsToUpperCase, Type = String, Dynamic = False, Default = \"", Scope = Protected
#tag EndConstant
#tag Constant, Name = PadComma, Type = Boolean, Dynamic = False, Default = \"True", Scope = Protected
#tag EndConstant
#tag Constant, Name = PadOperators, Type = Boolean, Dynamic = False, Default = \"True", Scope = Protected
#tag EndConstant
#tag Constant, Name = PadParensInner, Type = Boolean, Dynamic = False, Default = \"True", Scope = Protected
#tag EndConstant
#tag Constant, Name = PadParensOuter, Type = Boolean, Dynamic = False, Default = \"False", Scope = Protected
#tag EndConstant
#tag ViewBehavior
#tag ViewProperty
Name="Index"
Visible=true
Group="ID"
InitialValue="-2147483648"
Type="Integer"
#tag EndViewProperty
#tag ViewProperty
Name="Left"
Visible=true
Group="Position"
InitialValue="0"
Type="Integer"
#tag EndViewProperty
#tag ViewProperty
Name="Name"
Visible=true
Group="ID"
Type="String"
#tag EndViewProperty
#tag ViewProperty
Name="Super"
Visible=true
Group="ID"
Type="String"
#tag EndViewProperty
#tag ViewProperty
Name="Top"
Visible=true
Group="Position"
InitialValue="0"
Type="Integer"
#tag EndViewProperty
#tag EndViewBehavior
End Module
#tag EndModule
| Xojo | 4 | joneisen/Kaju | Kaju Admin CLI/FormatCodePreferences.xojo_code | [
"MIT"
] |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.