content
stringlengths
4
1.04M
lang
stringclasses
358 values
score
int64
0
5
repo_name
stringlengths
5
114
repo_path
stringlengths
4
229
repo_licenses
listlengths
1
8
(kicad_pcb (version 20171130) (host pcbnew 5.1.6) (general (thickness 1.6) (drawings 39) (tracks 833) (zones 0) (modules 98) (nets 74) ) (page A4) (layers (0 F.Cu signal) (31 B.Cu signal) (32 B.Adhes user) (33 F.Adhes user) (34 B.Paste user) (35 F.Paste user) (36 B.SilkS user) (37 F.SilkS user) (38 B.Mask user) (39 F.Mask user) (40 Dwgs.User user) (41 Cmts.User user) (42 Eco1.User user) (43 Eco2.User user) (44 Edge.Cuts user) (45 Margin user hide) (46 B.CrtYd user hide) (47 F.CrtYd user) (48 B.Fab user hide) (49 F.Fab user) ) (setup (last_trace_width 0.254) (trace_clearance 0.2) (zone_clearance 0.508) (zone_45_only no) (trace_min 0.2) (via_size 0.8) (via_drill 0.4) (via_min_size 0.4) (via_min_drill 0.3) (uvia_size 0.3) (uvia_drill 0.1) (uvias_allowed no) (uvia_min_size 0.2) (uvia_min_drill 0.1) (edge_width 0.05) (segment_width 0.2) (pcb_text_width 0.3) (pcb_text_size 1.5 1.5) (mod_edge_width 0.12) (mod_text_size 1 1) (mod_text_width 0.15) (pad_size 1.524 1.524) (pad_drill 0.762) (pad_to_mask_clearance 0.05) (aux_axis_origin 0 0) (visible_elements FFFFFF7F) (pcbplotparams (layerselection 0x010fc_ffffffff) (usegerberextensions false) (usegerberattributes true) (usegerberadvancedattributes true) (creategerberjobfile true) (excludeedgelayer true) (linewidth 0.100000) (plotframeref false) (viasonmask false) (mode 1) (useauxorigin false) (hpglpennumber 1) (hpglpenspeed 20) (hpglpendiameter 15.000000) (psnegative false) (psa4output false) (plotreference false) (plotvalue false) (plotinvisibletext false) (padsonsilk false) (subtractmaskfromsilk false) (outputformat 1) (mirror false) (drillshape 0) (scaleselection 1) (outputdirectory "")) ) (net 0 "") (net 1 +5V) (net 2 "Net-(C1-Pad1)") (net 3 VCC) (net 4 "Net-(C8-Pad1)") (net 5 /col4) (net 6 "Net-(J1-PadA5)") (net 7 "Net-(J1-PadA7)") (net 8 "Net-(J1-PadA6)") (net 9 "Net-(J1-PadB5)") (net 10 "Net-(Jack0-PadR1)") (net 11 "Net-(Jack0-PadT)") (net 12 "Net-(Jack1-PadR1)") (net 13 "Net-(Jack1-PadT)") (net 14 /col0) (net 15 /col8) (net 16 /col5) (net 17 /col2) (net 18 /col1) (net 19 /col3) (net 20 /col6) (net 21 /col7) (net 22 "Net-(R1-Pad1)") (net 23 "Net-(R2-Pad2)") (net 24 /col9) (net 25 /row0,0) (net 26 /row1,0) (net 27 /row1,1) (net 28 /row0,1) (net 29 /row0,2) (net 30 /row0,3) (net 31 /row1,3) (net 32 /row1,2) (net 33 VDD) (net 34 VSS) (net 35 "Net-(D0_0-Pad2)") (net 36 "Net-(D0_1-Pad2)") (net 37 "Net-(D0_2-Pad2)") (net 38 "Net-(D0_3-Pad2)") (net 39 "Net-(D0_5-Pad2)") (net 40 "Net-(D0_6-Pad2)") (net 41 "Net-(D0_7-Pad2)") (net 42 "Net-(D0_8-Pad2)") (net 43 "Net-(D0_9-Pad2)") (net 44 "Net-(D1_0-Pad2)") (net 45 "Net-(D1_1-Pad2)") (net 46 "Net-(D1_2-Pad2)") (net 47 "Net-(D1_3-Pad2)") (net 48 "Net-(D1_4-Pad2)") (net 49 "Net-(D1_5-Pad2)") (net 50 "Net-(D1_6-Pad2)") (net 51 "Net-(D1_7-Pad2)") (net 52 "Net-(D1_8-Pad2)") (net 53 "Net-(D1_9-Pad2)") (net 54 "Net-(D2_0-Pad2)") (net 55 "Net-(D2_1-Pad2)") (net 56 "Net-(D2_2-Pad2)") (net 57 "Net-(D2_3-Pad2)") (net 58 "Net-(D2_4-Pad2)") (net 59 "Net-(D2_5-Pad2)") (net 60 "Net-(D2_6-Pad2)") (net 61 "Net-(D2_7-Pad2)") (net 62 "Net-(D2_8-Pad2)") (net 63 "Net-(D2_9-Pad2)") (net 64 "Net-(D3_3-Pad2)") (net 65 "Net-(D3_4-Pad2)") (net 66 "Net-(D3_5-Pad2)") (net 67 "Net-(D3_6-Pad2)") (net 68 "Net-(D0_4-Pad2)") (net 69 "Net-(C2-Pad2)") (net 70 /D-) (net 71 /D+) (net 72 "Net-(R9-Pad1)") (net 73 GND) (net_class Default "This is the default net class." (clearance 0.2) (trace_width 0.254) (via_dia 0.8) (via_drill 0.4) (uvia_dia 0.3) (uvia_drill 0.1) (add_net /D+) (add_net /D-) (add_net /col0) (add_net /col1) (add_net /col2) (add_net /col3) (add_net /col4) (add_net /col5) (add_net /col6) (add_net /col7) (add_net /col8) (add_net /col9) (add_net /row0,0) (add_net /row0,1) (add_net /row0,2) (add_net /row0,3) (add_net /row1,0) (add_net /row1,1) (add_net /row1,2) (add_net /row1,3) (add_net "Net-(C1-Pad1)") (add_net "Net-(C2-Pad2)") (add_net "Net-(C8-Pad1)") (add_net "Net-(D0_0-Pad2)") (add_net "Net-(D0_1-Pad2)") (add_net "Net-(D0_2-Pad2)") (add_net "Net-(D0_3-Pad2)") (add_net "Net-(D0_4-Pad2)") (add_net "Net-(D0_5-Pad2)") (add_net "Net-(D0_6-Pad2)") (add_net "Net-(D0_7-Pad2)") (add_net "Net-(D0_8-Pad2)") (add_net "Net-(D0_9-Pad2)") (add_net "Net-(D1_0-Pad2)") (add_net "Net-(D1_1-Pad2)") (add_net "Net-(D1_2-Pad2)") (add_net "Net-(D1_3-Pad2)") (add_net "Net-(D1_4-Pad2)") (add_net "Net-(D1_5-Pad2)") (add_net "Net-(D1_6-Pad2)") (add_net "Net-(D1_7-Pad2)") (add_net "Net-(D1_8-Pad2)") (add_net "Net-(D1_9-Pad2)") (add_net "Net-(D2_0-Pad2)") (add_net "Net-(D2_1-Pad2)") (add_net "Net-(D2_2-Pad2)") (add_net "Net-(D2_3-Pad2)") (add_net "Net-(D2_4-Pad2)") (add_net "Net-(D2_5-Pad2)") (add_net "Net-(D2_6-Pad2)") (add_net "Net-(D2_7-Pad2)") (add_net "Net-(D2_8-Pad2)") (add_net "Net-(D2_9-Pad2)") (add_net "Net-(D3_3-Pad2)") (add_net "Net-(D3_4-Pad2)") (add_net "Net-(D3_5-Pad2)") (add_net "Net-(D3_6-Pad2)") (add_net "Net-(J1-PadA5)") (add_net "Net-(J1-PadA6)") (add_net "Net-(J1-PadA7)") (add_net "Net-(J1-PadB5)") (add_net "Net-(Jack0-PadR1)") (add_net "Net-(Jack0-PadT)") (add_net "Net-(Jack1-PadR1)") (add_net "Net-(Jack1-PadT)") (add_net "Net-(R1-Pad1)") (add_net "Net-(R2-Pad2)") (add_net "Net-(R9-Pad1)") ) (net_class Power "" (clearance 0.2) (trace_width 0.381) (via_dia 0.8) (via_drill 0.4) (uvia_dia 0.3) (uvia_drill 0.1) (add_net +5V) (add_net GND) (add_net VCC) (add_net VDD) (add_net VSS) ) (module switches:Choc_PG1350_MX_Spacing (layer F.Cu) (tedit 5F834A4E) (tstamp 5ECCC290) (at 163 88 15) (descr "Kailh \"Choc\" PG1350 keyswitch") (tags kailh,choc) (path /5FD3AF3A) (fp_text reference K3_6 (at 0 0 15) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value KEYSW (at 0 10.5 15) (layer Cmts.User) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -9.5 9.5) (end -9.5 -9.5) (layer Eco1.User) (width 0.12)) (fp_line (start 9.5 9.5) (end -9.5 9.5) (layer Eco1.User) (width 0.12)) (fp_line (start 9.5 -9.5) (end 9.5 9.5) (layer Eco1.User) (width 0.12)) (fp_line (start -9.5 -9.5) (end 9.5 -9.5) (layer Eco1.User) (width 0.12)) (fp_line (start -2.6 -3.1) (end 2.6 -3.1) (layer Eco2.User) (width 0.15)) (fp_line (start 2.6 -3.1) (end 2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start 2.6 -6.3) (end -2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start -2.6 -3.1) (end -2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start -6.9 6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15)) (fp_line (start 6.9 -6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15)) (fp_line (start 6.9 -6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15)) (fp_line (start -6.9 6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15)) (pad "" np_thru_hole circle (at -5.5 0 15) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask)) (pad "" np_thru_hole circle (at 5.5 0 15) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask)) (pad "" np_thru_hole circle (at 5.22 -4.2 15) (size 0.9906 0.9906) (drill 0.9906) (layers *.Cu *.Mask)) (pad 1 thru_hole circle (at 0 5.9 15) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask) (net 20 /col6)) (pad 2 thru_hole circle (at -5 3.8 15) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask) (net 67 "Net-(D3_6-Pad2)")) (pad "" np_thru_hole circle (at 0 0 15) (size 3.429 3.429) (drill 3.429) (layers *.Cu *.Mask)) ) (module switches:Choc_PG1350_MX_Spacing (layer F.Cu) (tedit 5F834A4E) (tstamp 5ECCC2AF) (at 142 95 30) (descr "Kailh \"Choc\" PG1350 keyswitch") (tags kailh,choc) (path /5FD3AF30) (fp_text reference K3_5 (at 0 0 30) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value KEYSW (at 0 10.5 30) (layer Cmts.User) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -9.5 9.5) (end -9.5 -9.5) (layer Eco1.User) (width 0.12)) (fp_line (start 9.5 9.5) (end -9.5 9.5) (layer Eco1.User) (width 0.12)) (fp_line (start 9.5 -9.5) (end 9.5 9.5) (layer Eco1.User) (width 0.12)) (fp_line (start -9.5 -9.5) (end 9.5 -9.5) (layer Eco1.User) (width 0.12)) (fp_line (start -2.6 -3.1) (end 2.6 -3.1) (layer Eco2.User) (width 0.15)) (fp_line (start 2.6 -3.1) (end 2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start 2.6 -6.3) (end -2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start -2.6 -3.1) (end -2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start -6.9 6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15)) (fp_line (start 6.9 -6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15)) (fp_line (start 6.9 -6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15)) (fp_line (start -6.9 6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15)) (pad "" np_thru_hole circle (at -5.5 0 30) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask)) (pad "" np_thru_hole circle (at 5.5 0 30) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask)) (pad "" np_thru_hole circle (at 5.22 -4.2 30) (size 0.9906 0.9906) (drill 0.9906) (layers *.Cu *.Mask)) (pad 1 thru_hole circle (at 0 5.9 30) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask) (net 16 /col5)) (pad 2 thru_hole circle (at -5 3.8 30) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask) (net 66 "Net-(D3_5-Pad2)")) (pad "" np_thru_hole circle (at 0 0 30) (size 3.429 3.429) (drill 3.429) (layers *.Cu *.Mask)) ) (module switches:Choc_PG1350_MX_Spacing (layer F.Cu) (tedit 5F834A4E) (tstamp 5EDAB782) (at 110 95 330) (descr "Kailh \"Choc\" PG1350 keyswitch") (tags kailh,choc) (path /5EF1CAA2) (fp_text reference K3_4 (at 0 0 150) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value KEYSW (at 0 10.5 150) (layer Cmts.User) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -9.5 9.5) (end -9.5 -9.5) (layer Eco1.User) (width 0.12)) (fp_line (start 9.5 9.5) (end -9.5 9.5) (layer Eco1.User) (width 0.12)) (fp_line (start 9.5 -9.5) (end 9.5 9.5) (layer Eco1.User) (width 0.12)) (fp_line (start -9.5 -9.5) (end 9.5 -9.5) (layer Eco1.User) (width 0.12)) (fp_line (start -2.6 -3.1) (end 2.6 -3.1) (layer Eco2.User) (width 0.15)) (fp_line (start 2.6 -3.1) (end 2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start 2.6 -6.3) (end -2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start -2.6 -3.1) (end -2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start -6.9 6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15)) (fp_line (start 6.9 -6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15)) (fp_line (start 6.9 -6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15)) (fp_line (start -6.9 6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15)) (pad "" np_thru_hole circle (at -5.5 0 330) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask)) (pad "" np_thru_hole circle (at 5.5 0 330) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask)) (pad "" np_thru_hole circle (at 5.22 -4.2 330) (size 0.9906 0.9906) (drill 0.9906) (layers *.Cu *.Mask)) (pad 1 thru_hole circle (at 0 5.9 330) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask) (net 5 /col4)) (pad 2 thru_hole circle (at -5 3.8 330) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask) (net 65 "Net-(D3_4-Pad2)")) (pad "" np_thru_hole circle (at 0 0 330) (size 3.429 3.429) (drill 3.429) (layers *.Cu *.Mask)) ) (module switches:Choc_PG1350_MX_Spacing (layer F.Cu) (tedit 5F834A4E) (tstamp 5EDCBE57) (at 89 88 345) (descr "Kailh \"Choc\" PG1350 keyswitch") (tags kailh,choc) (path /5EF1C6CA) (fp_text reference K3_3 (at 0 0 165) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value KEYSW (at 0 10.5 165) (layer Cmts.User) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -9.5 9.5) (end -9.5 -9.5) (layer Eco1.User) (width 0.12)) (fp_line (start 9.5 9.5) (end -9.5 9.5) (layer Eco1.User) (width 0.12)) (fp_line (start 9.5 -9.5) (end 9.5 9.5) (layer Eco1.User) (width 0.12)) (fp_line (start -9.5 -9.5) (end 9.5 -9.5) (layer Eco1.User) (width 0.12)) (fp_line (start -2.6 -3.1) (end 2.6 -3.1) (layer Eco2.User) (width 0.15)) (fp_line (start 2.6 -3.1) (end 2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start 2.6 -6.3) (end -2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start -2.6 -3.1) (end -2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start -6.9 6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15)) (fp_line (start 6.9 -6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15)) (fp_line (start 6.9 -6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15)) (fp_line (start -6.9 6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15)) (pad "" np_thru_hole circle (at -5.5 0 345) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask)) (pad "" np_thru_hole circle (at 5.5 0 345) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask)) (pad "" np_thru_hole circle (at 5.22 -4.2 345) (size 0.9906 0.9906) (drill 0.9906) (layers *.Cu *.Mask)) (pad 1 thru_hole circle (at 0 5.9 345) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask) (net 19 /col3)) (pad 2 thru_hole circle (at -5 3.8 345) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask) (net 64 "Net-(D3_3-Pad2)")) (pad "" np_thru_hole circle (at 0 0 345) (size 3.429 3.429) (drill 3.429) (layers *.Cu *.Mask)) ) (module switches:Choc_PG1350_MX_Spacing (layer F.Cu) (tedit 5F834A4E) (tstamp 5ECCC252) (at 229 79) (descr "Kailh \"Choc\" PG1350 keyswitch") (tags kailh,choc) (path /5FD3AEF6) (fp_text reference K2_9 (at 0 0) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value KEYSW (at 0 10.5) (layer Cmts.User) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -9.5 9.5) (end -9.5 -9.5) (layer Eco1.User) (width 0.12)) (fp_line (start 9.5 9.5) (end -9.5 9.5) (layer Eco1.User) (width 0.12)) (fp_line (start 9.5 -9.5) (end 9.5 9.5) (layer Eco1.User) (width 0.12)) (fp_line (start -9.5 -9.5) (end 9.5 -9.5) (layer Eco1.User) (width 0.12)) (fp_line (start -2.6 -3.1) (end 2.6 -3.1) (layer Eco2.User) (width 0.15)) (fp_line (start 2.6 -3.1) (end 2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start 2.6 -6.3) (end -2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start -2.6 -3.1) (end -2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start -6.9 6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15)) (fp_line (start 6.9 -6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15)) (fp_line (start 6.9 -6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15)) (fp_line (start -6.9 6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15)) (pad "" np_thru_hole circle (at -5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask)) (pad "" np_thru_hole circle (at 5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask)) (pad "" np_thru_hole circle (at 5.22 -4.2) (size 0.9906 0.9906) (drill 0.9906) (layers *.Cu *.Mask)) (pad 1 thru_hole circle (at 0 5.9) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask) (net 24 /col9)) (pad 2 thru_hole circle (at -5 3.8) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask) (net 63 "Net-(D2_9-Pad2)")) (pad "" np_thru_hole circle (at 0 0) (size 3.429 3.429) (drill 3.429) (layers *.Cu *.Mask)) ) (module switches:Choc_PG1350_MX_Spacing (layer F.Cu) (tedit 5F834A4E) (tstamp 5ECCC214) (at 210 67) (descr "Kailh \"Choc\" PG1350 keyswitch") (tags kailh,choc) (path /5FD3AEA6) (fp_text reference K2_8 (at 0 0) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value KEYSW (at 0 10.5) (layer Cmts.User) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -9.5 9.5) (end -9.5 -9.5) (layer Eco1.User) (width 0.12)) (fp_line (start 9.5 9.5) (end -9.5 9.5) (layer Eco1.User) (width 0.12)) (fp_line (start 9.5 -9.5) (end 9.5 9.5) (layer Eco1.User) (width 0.12)) (fp_line (start -9.5 -9.5) (end 9.5 -9.5) (layer Eco1.User) (width 0.12)) (fp_line (start -2.6 -3.1) (end 2.6 -3.1) (layer Eco2.User) (width 0.15)) (fp_line (start 2.6 -3.1) (end 2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start 2.6 -6.3) (end -2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start -2.6 -3.1) (end -2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start -6.9 6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15)) (fp_line (start 6.9 -6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15)) (fp_line (start 6.9 -6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15)) (fp_line (start -6.9 6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15)) (pad "" np_thru_hole circle (at -5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask)) (pad "" np_thru_hole circle (at 5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask)) (pad "" np_thru_hole circle (at 5.22 -4.2) (size 0.9906 0.9906) (drill 0.9906) (layers *.Cu *.Mask)) (pad 1 thru_hole circle (at 0 5.9) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask) (net 15 /col8)) (pad 2 thru_hole circle (at -5 3.8) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask) (net 62 "Net-(D2_8-Pad2)")) (pad "" np_thru_hole circle (at 0 0) (size 3.429 3.429) (drill 3.429) (layers *.Cu *.Mask)) ) (module switches:Choc_PG1350_MX_Spacing (layer F.Cu) (tedit 5F834A4E) (tstamp 5ECCC1B7) (at 191 61) (descr "Kailh \"Choc\" PG1350 keyswitch") (tags kailh,choc) (path /5FD3AE69) (fp_text reference K2_7 (at 0 0) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value KEYSW (at 0 10.5) (layer Cmts.User) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -9.5 9.5) (end -9.5 -9.5) (layer Eco1.User) (width 0.12)) (fp_line (start 9.5 9.5) (end -9.5 9.5) (layer Eco1.User) (width 0.12)) (fp_line (start 9.5 -9.5) (end 9.5 9.5) (layer Eco1.User) (width 0.12)) (fp_line (start -9.5 -9.5) (end 9.5 -9.5) (layer Eco1.User) (width 0.12)) (fp_line (start -2.6 -3.1) (end 2.6 -3.1) (layer Eco2.User) (width 0.15)) (fp_line (start 2.6 -3.1) (end 2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start 2.6 -6.3) (end -2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start -2.6 -3.1) (end -2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start -6.9 6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15)) (fp_line (start 6.9 -6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15)) (fp_line (start 6.9 -6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15)) (fp_line (start -6.9 6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15)) (pad "" np_thru_hole circle (at -5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask)) (pad "" np_thru_hole circle (at 5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask)) (pad "" np_thru_hole circle (at 5.22 -4.2) (size 0.9906 0.9906) (drill 0.9906) (layers *.Cu *.Mask)) (pad 1 thru_hole circle (at 0 5.9) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask) (net 21 /col7)) (pad 2 thru_hole circle (at -5 3.8) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask) (net 61 "Net-(D2_7-Pad2)")) (pad "" np_thru_hole circle (at 0 0) (size 3.429 3.429) (drill 3.429) (layers *.Cu *.Mask)) ) (module switches:Choc_PG1350_MX_Spacing (layer F.Cu) (tedit 5F834A4E) (tstamp 5ECCC198) (at 172 66.5) (descr "Kailh \"Choc\" PG1350 keyswitch") (tags kailh,choc) (path /5FD3AE5F) (fp_text reference K2_6 (at 0 0) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value KEYSW (at 0 10.5) (layer Cmts.User) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -9.5 9.5) (end -9.5 -9.5) (layer Eco1.User) (width 0.12)) (fp_line (start 9.5 9.5) (end -9.5 9.5) (layer Eco1.User) (width 0.12)) (fp_line (start 9.5 -9.5) (end 9.5 9.5) (layer Eco1.User) (width 0.12)) (fp_line (start -9.5 -9.5) (end 9.5 -9.5) (layer Eco1.User) (width 0.12)) (fp_line (start -2.6 -3.1) (end 2.6 -3.1) (layer Eco2.User) (width 0.15)) (fp_line (start 2.6 -3.1) (end 2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start 2.6 -6.3) (end -2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start -2.6 -3.1) (end -2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start -6.9 6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15)) (fp_line (start 6.9 -6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15)) (fp_line (start 6.9 -6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15)) (fp_line (start -6.9 6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15)) (pad "" np_thru_hole circle (at -5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask)) (pad "" np_thru_hole circle (at 5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask)) (pad "" np_thru_hole circle (at 5.22 -4.2) (size 0.9906 0.9906) (drill 0.9906) (layers *.Cu *.Mask)) (pad 1 thru_hole circle (at 0 5.9) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask) (net 20 /col6)) (pad 2 thru_hole circle (at -5 3.8) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask) (net 60 "Net-(D2_6-Pad2)")) (pad "" np_thru_hole circle (at 0 0) (size 3.429 3.429) (drill 3.429) (layers *.Cu *.Mask)) ) (module switches:Choc_PG1350_MX_Spacing (layer F.Cu) (tedit 5F834A4E) (tstamp 5ECCC179) (at 153 69) (descr "Kailh \"Choc\" PG1350 keyswitch") (tags kailh,choc) (path /5FD3AE48) (fp_text reference K2_5 (at 0 0) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value KEYSW (at 0 10.5) (layer Cmts.User) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -9.5 9.5) (end -9.5 -9.5) (layer Eco1.User) (width 0.12)) (fp_line (start 9.5 9.5) (end -9.5 9.5) (layer Eco1.User) (width 0.12)) (fp_line (start 9.5 -9.5) (end 9.5 9.5) (layer Eco1.User) (width 0.12)) (fp_line (start -9.5 -9.5) (end 9.5 -9.5) (layer Eco1.User) (width 0.12)) (fp_line (start -2.6 -3.1) (end 2.6 -3.1) (layer Eco2.User) (width 0.15)) (fp_line (start 2.6 -3.1) (end 2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start 2.6 -6.3) (end -2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start -2.6 -3.1) (end -2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start -6.9 6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15)) (fp_line (start 6.9 -6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15)) (fp_line (start 6.9 -6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15)) (fp_line (start -6.9 6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15)) (pad "" np_thru_hole circle (at -5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask)) (pad "" np_thru_hole circle (at 5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask)) (pad "" np_thru_hole circle (at 5.22 -4.2) (size 0.9906 0.9906) (drill 0.9906) (layers *.Cu *.Mask)) (pad 1 thru_hole circle (at 0 5.9) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask) (net 16 /col5)) (pad 2 thru_hole circle (at -5 3.8) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask) (net 59 "Net-(D2_5-Pad2)")) (pad "" np_thru_hole circle (at 0 0) (size 3.429 3.429) (drill 3.429) (layers *.Cu *.Mask)) ) (module switches:Choc_PG1350_MX_Spacing (layer F.Cu) (tedit 5F834A4E) (tstamp 5EDAABD6) (at 99 69) (descr "Kailh \"Choc\" PG1350 keyswitch") (tags kailh,choc) (path /5EEFBA25) (fp_text reference K2_4 (at 0 0) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value KEYSW (at 0 10.5) (layer Cmts.User) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -9.5 9.5) (end -9.5 -9.5) (layer Eco1.User) (width 0.12)) (fp_line (start 9.5 9.5) (end -9.5 9.5) (layer Eco1.User) (width 0.12)) (fp_line (start 9.5 -9.5) (end 9.5 9.5) (layer Eco1.User) (width 0.12)) (fp_line (start -9.5 -9.5) (end 9.5 -9.5) (layer Eco1.User) (width 0.12)) (fp_line (start -2.6 -3.1) (end 2.6 -3.1) (layer Eco2.User) (width 0.15)) (fp_line (start 2.6 -3.1) (end 2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start 2.6 -6.3) (end -2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start -2.6 -3.1) (end -2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start -6.9 6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15)) (fp_line (start 6.9 -6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15)) (fp_line (start 6.9 -6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15)) (fp_line (start -6.9 6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15)) (pad "" np_thru_hole circle (at -5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask)) (pad "" np_thru_hole circle (at 5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask)) (pad "" np_thru_hole circle (at 5.22 -4.2) (size 0.9906 0.9906) (drill 0.9906) (layers *.Cu *.Mask)) (pad 1 thru_hole circle (at 0 5.9) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask) (net 5 /col4)) (pad 2 thru_hole circle (at -5 3.8) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask) (net 58 "Net-(D2_4-Pad2)")) (pad "" np_thru_hole circle (at 0 0) (size 3.429 3.429) (drill 3.429) (layers *.Cu *.Mask)) ) (module switches:Choc_PG1350_MX_Spacing (layer F.Cu) (tedit 5F834A4E) (tstamp 5EDAB11F) (at 80 66.5) (descr "Kailh \"Choc\" PG1350 keyswitch") (tags kailh,choc) (path /5EEF764A) (fp_text reference K2_3 (at 0 0) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value KEYSW (at 0 10.5) (layer Cmts.User) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -9.5 9.5) (end -9.5 -9.5) (layer Eco1.User) (width 0.12)) (fp_line (start 9.5 9.5) (end -9.5 9.5) (layer Eco1.User) (width 0.12)) (fp_line (start 9.5 -9.5) (end 9.5 9.5) (layer Eco1.User) (width 0.12)) (fp_line (start -9.5 -9.5) (end 9.5 -9.5) (layer Eco1.User) (width 0.12)) (fp_line (start -2.6 -3.1) (end 2.6 -3.1) (layer Eco2.User) (width 0.15)) (fp_line (start 2.6 -3.1) (end 2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start 2.6 -6.3) (end -2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start -2.6 -3.1) (end -2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start -6.9 6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15)) (fp_line (start 6.9 -6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15)) (fp_line (start 6.9 -6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15)) (fp_line (start -6.9 6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15)) (pad "" np_thru_hole circle (at -5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask)) (pad "" np_thru_hole circle (at 5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask)) (pad "" np_thru_hole circle (at 5.22 -4.2) (size 0.9906 0.9906) (drill 0.9906) (layers *.Cu *.Mask)) (pad 1 thru_hole circle (at 0 5.9) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask) (net 19 /col3)) (pad 2 thru_hole circle (at -5 3.8) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask) (net 57 "Net-(D2_3-Pad2)")) (pad "" np_thru_hole circle (at 0 0) (size 3.429 3.429) (drill 3.429) (layers *.Cu *.Mask)) ) (module switches:Choc_PG1350_MX_Spacing (layer F.Cu) (tedit 5F834A4E) (tstamp 5EDCC5CD) (at 61 61) (descr "Kailh \"Choc\" PG1350 keyswitch") (tags kailh,choc) (path /5EED6065) (fp_text reference K2_2 (at 0 0) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value KEYSW (at 0 10.5) (layer Cmts.User) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -9.5 9.5) (end -9.5 -9.5) (layer Eco1.User) (width 0.12)) (fp_line (start 9.5 9.5) (end -9.5 9.5) (layer Eco1.User) (width 0.12)) (fp_line (start 9.5 -9.5) (end 9.5 9.5) (layer Eco1.User) (width 0.12)) (fp_line (start -9.5 -9.5) (end 9.5 -9.5) (layer Eco1.User) (width 0.12)) (fp_line (start -2.6 -3.1) (end 2.6 -3.1) (layer Eco2.User) (width 0.15)) (fp_line (start 2.6 -3.1) (end 2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start 2.6 -6.3) (end -2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start -2.6 -3.1) (end -2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start -6.9 6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15)) (fp_line (start 6.9 -6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15)) (fp_line (start 6.9 -6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15)) (fp_line (start -6.9 6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15)) (pad "" np_thru_hole circle (at -5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask)) (pad "" np_thru_hole circle (at 5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask)) (pad "" np_thru_hole circle (at 5.22 -4.2) (size 0.9906 0.9906) (drill 0.9906) (layers *.Cu *.Mask)) (pad 1 thru_hole circle (at 0 5.9) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask) (net 17 /col2)) (pad 2 thru_hole circle (at -5 3.8) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask) (net 56 "Net-(D2_2-Pad2)")) (pad "" np_thru_hole circle (at 0 0) (size 3.429 3.429) (drill 3.429) (layers *.Cu *.Mask)) ) (module switches:Choc_PG1350_MX_Spacing (layer F.Cu) (tedit 5F834A4E) (tstamp 5EDABA4C) (at 42 67) (descr "Kailh \"Choc\" PG1350 keyswitch") (tags kailh,choc) (path /5EED5B60) (fp_text reference K2_1 (at 0 0) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value KEYSW (at 0 10.5) (layer Cmts.User) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -9.5 9.5) (end -9.5 -9.5) (layer Eco1.User) (width 0.12)) (fp_line (start 9.5 9.5) (end -9.5 9.5) (layer Eco1.User) (width 0.12)) (fp_line (start 9.5 -9.5) (end 9.5 9.5) (layer Eco1.User) (width 0.12)) (fp_line (start -9.5 -9.5) (end 9.5 -9.5) (layer Eco1.User) (width 0.12)) (fp_line (start -2.6 -3.1) (end 2.6 -3.1) (layer Eco2.User) (width 0.15)) (fp_line (start 2.6 -3.1) (end 2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start 2.6 -6.3) (end -2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start -2.6 -3.1) (end -2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start -6.9 6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15)) (fp_line (start 6.9 -6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15)) (fp_line (start 6.9 -6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15)) (fp_line (start -6.9 6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15)) (pad "" np_thru_hole circle (at -5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask)) (pad "" np_thru_hole circle (at 5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask)) (pad "" np_thru_hole circle (at 5.22 -4.2) (size 0.9906 0.9906) (drill 0.9906) (layers *.Cu *.Mask)) (pad 1 thru_hole circle (at 0 5.9) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask) (net 18 /col1)) (pad 2 thru_hole circle (at -5 3.8) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask) (net 55 "Net-(D2_1-Pad2)")) (pad "" np_thru_hole circle (at 0 0) (size 3.429 3.429) (drill 3.429) (layers *.Cu *.Mask)) ) (module switches:Choc_PG1350_MX_Spacing (layer F.Cu) (tedit 5F834A4E) (tstamp 5EDAAED6) (at 23 79) (descr "Kailh \"Choc\" PG1350 keyswitch") (tags kailh,choc) (path /5EED2FA2) (fp_text reference K2_0 (at 0 0) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value KEYSW (at 0 10.5) (layer Cmts.User) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -9.5 9.5) (end -9.5 -9.5) (layer Eco1.User) (width 0.12)) (fp_line (start 9.5 9.5) (end -9.5 9.5) (layer Eco1.User) (width 0.12)) (fp_line (start 9.5 -9.5) (end 9.5 9.5) (layer Eco1.User) (width 0.12)) (fp_line (start -9.5 -9.5) (end 9.5 -9.5) (layer Eco1.User) (width 0.12)) (fp_line (start -2.6 -3.1) (end 2.6 -3.1) (layer Eco2.User) (width 0.15)) (fp_line (start 2.6 -3.1) (end 2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start 2.6 -6.3) (end -2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start -2.6 -3.1) (end -2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start -6.9 6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15)) (fp_line (start 6.9 -6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15)) (fp_line (start 6.9 -6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15)) (fp_line (start -6.9 6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15)) (pad "" np_thru_hole circle (at -5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask)) (pad "" np_thru_hole circle (at 5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask)) (pad "" np_thru_hole circle (at 5.22 -4.2) (size 0.9906 0.9906) (drill 0.9906) (layers *.Cu *.Mask)) (pad 1 thru_hole circle (at 0 5.9) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask) (net 14 /col0)) (pad 2 thru_hole circle (at -5 3.8) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask) (net 54 "Net-(D2_0-Pad2)")) (pad "" np_thru_hole circle (at 0 0) (size 3.429 3.429) (drill 3.429) (layers *.Cu *.Mask)) ) (module switches:Choc_PG1350_MX_Spacing (layer F.Cu) (tedit 5F834A4E) (tstamp 5ECCC005) (at 229 60) (descr "Kailh \"Choc\" PG1350 keyswitch") (tags kailh,choc) (path /5FD3AEE2) (fp_text reference K1_9 (at 0 0) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value KEYSW (at 0 10.5) (layer Cmts.User) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -9.5 9.5) (end -9.5 -9.5) (layer Eco1.User) (width 0.12)) (fp_line (start 9.5 9.5) (end -9.5 9.5) (layer Eco1.User) (width 0.12)) (fp_line (start 9.5 -9.5) (end 9.5 9.5) (layer Eco1.User) (width 0.12)) (fp_line (start -9.5 -9.5) (end 9.5 -9.5) (layer Eco1.User) (width 0.12)) (fp_line (start -2.6 -3.1) (end 2.6 -3.1) (layer Eco2.User) (width 0.15)) (fp_line (start 2.6 -3.1) (end 2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start 2.6 -6.3) (end -2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start -2.6 -3.1) (end -2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start -6.9 6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15)) (fp_line (start 6.9 -6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15)) (fp_line (start 6.9 -6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15)) (fp_line (start -6.9 6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15)) (pad "" np_thru_hole circle (at -5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask)) (pad "" np_thru_hole circle (at 5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask)) (pad "" np_thru_hole circle (at 5.22 -4.2) (size 0.9906 0.9906) (drill 0.9906) (layers *.Cu *.Mask)) (pad 1 thru_hole circle (at 0 5.9) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask) (net 24 /col9)) (pad 2 thru_hole circle (at -5 3.8) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask) (net 53 "Net-(D1_9-Pad2)")) (pad "" np_thru_hole circle (at 0 0) (size 3.429 3.429) (drill 3.429) (layers *.Cu *.Mask)) ) (module switches:Choc_PG1350_MX_Spacing (layer F.Cu) (tedit 5F834A4E) (tstamp 5ECCC043) (at 210 48) (descr "Kailh \"Choc\" PG1350 keyswitch") (tags kailh,choc) (path /5FD3AE9C) (fp_text reference K1_8 (at 0 0) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value KEYSW (at 0 10.5) (layer Cmts.User) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -9.5 9.5) (end -9.5 -9.5) (layer Eco1.User) (width 0.12)) (fp_line (start 9.5 9.5) (end -9.5 9.5) (layer Eco1.User) (width 0.12)) (fp_line (start 9.5 -9.5) (end 9.5 9.5) (layer Eco1.User) (width 0.12)) (fp_line (start -9.5 -9.5) (end 9.5 -9.5) (layer Eco1.User) (width 0.12)) (fp_line (start -2.6 -3.1) (end 2.6 -3.1) (layer Eco2.User) (width 0.15)) (fp_line (start 2.6 -3.1) (end 2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start 2.6 -6.3) (end -2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start -2.6 -3.1) (end -2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start -6.9 6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15)) (fp_line (start 6.9 -6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15)) (fp_line (start 6.9 -6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15)) (fp_line (start -6.9 6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15)) (pad "" np_thru_hole circle (at -5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask)) (pad "" np_thru_hole circle (at 5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask)) (pad "" np_thru_hole circle (at 5.22 -4.2) (size 0.9906 0.9906) (drill 0.9906) (layers *.Cu *.Mask)) (pad 1 thru_hole circle (at 0 5.9) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask) (net 15 /col8)) (pad 2 thru_hole circle (at -5 3.8) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask) (net 52 "Net-(D1_8-Pad2)")) (pad "" np_thru_hole circle (at 0 0) (size 3.429 3.429) (drill 3.429) (layers *.Cu *.Mask)) ) (module switches:Choc_PG1350_MX_Spacing (layer F.Cu) (tedit 5F834A4E) (tstamp 5ECCC0A0) (at 191 42) (descr "Kailh \"Choc\" PG1350 keyswitch") (tags kailh,choc) (path /5FD3AE31) (fp_text reference K1_7 (at 0 0) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value KEYSW (at 0 10.5) (layer Cmts.User) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -9.5 9.5) (end -9.5 -9.5) (layer Eco1.User) (width 0.12)) (fp_line (start 9.5 9.5) (end -9.5 9.5) (layer Eco1.User) (width 0.12)) (fp_line (start 9.5 -9.5) (end 9.5 9.5) (layer Eco1.User) (width 0.12)) (fp_line (start -9.5 -9.5) (end 9.5 -9.5) (layer Eco1.User) (width 0.12)) (fp_line (start -2.6 -3.1) (end 2.6 -3.1) (layer Eco2.User) (width 0.15)) (fp_line (start 2.6 -3.1) (end 2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start 2.6 -6.3) (end -2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start -2.6 -3.1) (end -2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start -6.9 6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15)) (fp_line (start 6.9 -6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15)) (fp_line (start 6.9 -6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15)) (fp_line (start -6.9 6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15)) (pad "" np_thru_hole circle (at -5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask)) (pad "" np_thru_hole circle (at 5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask)) (pad "" np_thru_hole circle (at 5.22 -4.2) (size 0.9906 0.9906) (drill 0.9906) (layers *.Cu *.Mask)) (pad 1 thru_hole circle (at 0 5.9) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask) (net 21 /col7)) (pad 2 thru_hole circle (at -5 3.8) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask) (net 51 "Net-(D1_7-Pad2)")) (pad "" np_thru_hole circle (at 0 0) (size 3.429 3.429) (drill 3.429) (layers *.Cu *.Mask)) ) (module switches:Choc_PG1350_MX_Spacing (layer F.Cu) (tedit 5F834A4E) (tstamp 5ECCC0BF) (at 172 47.5) (descr "Kailh \"Choc\" PG1350 keyswitch") (tags kailh,choc) (path /5FD3AE02) (fp_text reference K1_6 (at 0 0) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value KEYSW (at 0 10.5) (layer Cmts.User) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -9.5 9.5) (end -9.5 -9.5) (layer Eco1.User) (width 0.12)) (fp_line (start 9.5 9.5) (end -9.5 9.5) (layer Eco1.User) (width 0.12)) (fp_line (start 9.5 -9.5) (end 9.5 9.5) (layer Eco1.User) (width 0.12)) (fp_line (start -9.5 -9.5) (end 9.5 -9.5) (layer Eco1.User) (width 0.12)) (fp_line (start -2.6 -3.1) (end 2.6 -3.1) (layer Eco2.User) (width 0.15)) (fp_line (start 2.6 -3.1) (end 2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start 2.6 -6.3) (end -2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start -2.6 -3.1) (end -2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start -6.9 6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15)) (fp_line (start 6.9 -6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15)) (fp_line (start 6.9 -6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15)) (fp_line (start -6.9 6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15)) (pad "" np_thru_hole circle (at -5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask)) (pad "" np_thru_hole circle (at 5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask)) (pad "" np_thru_hole circle (at 5.22 -4.2) (size 0.9906 0.9906) (drill 0.9906) (layers *.Cu *.Mask)) (pad 1 thru_hole circle (at 0 5.9) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask) (net 20 /col6)) (pad 2 thru_hole circle (at -5 3.8) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask) (net 50 "Net-(D1_6-Pad2)")) (pad "" np_thru_hole circle (at 0 0) (size 3.429 3.429) (drill 3.429) (layers *.Cu *.Mask)) ) (module switches:Choc_PG1350_MX_Spacing (layer F.Cu) (tedit 5F834A4E) (tstamp 5ECCC0DE) (at 153 50) (descr "Kailh \"Choc\" PG1350 keyswitch") (tags kailh,choc) (path /5FD3ADD3) (fp_text reference K1_5 (at 0 0) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value KEYSW (at 0 10.5) (layer Cmts.User) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -9.5 9.5) (end -9.5 -9.5) (layer Eco1.User) (width 0.12)) (fp_line (start 9.5 9.5) (end -9.5 9.5) (layer Eco1.User) (width 0.12)) (fp_line (start 9.5 -9.5) (end 9.5 9.5) (layer Eco1.User) (width 0.12)) (fp_line (start -9.5 -9.5) (end 9.5 -9.5) (layer Eco1.User) (width 0.12)) (fp_line (start -2.6 -3.1) (end 2.6 -3.1) (layer Eco2.User) (width 0.15)) (fp_line (start 2.6 -3.1) (end 2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start 2.6 -6.3) (end -2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start -2.6 -3.1) (end -2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start -6.9 6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15)) (fp_line (start 6.9 -6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15)) (fp_line (start 6.9 -6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15)) (fp_line (start -6.9 6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15)) (pad "" np_thru_hole circle (at -5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask)) (pad "" np_thru_hole circle (at 5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask)) (pad "" np_thru_hole circle (at 5.22 -4.2) (size 0.9906 0.9906) (drill 0.9906) (layers *.Cu *.Mask)) (pad 1 thru_hole circle (at 0 5.9) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask) (net 16 /col5)) (pad 2 thru_hole circle (at -5 3.8) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask) (net 49 "Net-(D1_5-Pad2)")) (pad "" np_thru_hole circle (at 0 0) (size 3.429 3.429) (drill 3.429) (layers *.Cu *.Mask)) ) (module switches:Choc_PG1350_MX_Spacing (layer F.Cu) (tedit 5F834A4E) (tstamp 5EDABBD5) (at 99 50) (descr "Kailh \"Choc\" PG1350 keyswitch") (tags kailh,choc) (path /5EEFA968) (fp_text reference K1_4 (at 0 0) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value KEYSW (at 0 10.5) (layer Cmts.User) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -9.5 9.5) (end -9.5 -9.5) (layer Eco1.User) (width 0.12)) (fp_line (start 9.5 9.5) (end -9.5 9.5) (layer Eco1.User) (width 0.12)) (fp_line (start 9.5 -9.5) (end 9.5 9.5) (layer Eco1.User) (width 0.12)) (fp_line (start -9.5 -9.5) (end 9.5 -9.5) (layer Eco1.User) (width 0.12)) (fp_line (start -2.6 -3.1) (end 2.6 -3.1) (layer Eco2.User) (width 0.15)) (fp_line (start 2.6 -3.1) (end 2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start 2.6 -6.3) (end -2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start -2.6 -3.1) (end -2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start -6.9 6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15)) (fp_line (start 6.9 -6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15)) (fp_line (start 6.9 -6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15)) (fp_line (start -6.9 6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15)) (pad "" np_thru_hole circle (at -5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask)) (pad "" np_thru_hole circle (at 5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask)) (pad "" np_thru_hole circle (at 5.22 -4.2) (size 0.9906 0.9906) (drill 0.9906) (layers *.Cu *.Mask)) (pad 1 thru_hole circle (at 0 5.9) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask) (net 5 /col4)) (pad 2 thru_hole circle (at -5 3.8) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask) (net 48 "Net-(D1_4-Pad2)")) (pad "" np_thru_hole circle (at 0 0) (size 3.429 3.429) (drill 3.429) (layers *.Cu *.Mask)) ) (module switches:Choc_PG1350_MX_Spacing (layer F.Cu) (tedit 5F834A4E) (tstamp 5EDAA810) (at 80 47.5) (descr "Kailh \"Choc\" PG1350 keyswitch") (tags kailh,choc) (path /5EEF70F9) (fp_text reference K1_3 (at 0 0) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value KEYSW (at 0 10.5) (layer Cmts.User) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -9.5 9.5) (end -9.5 -9.5) (layer Eco1.User) (width 0.12)) (fp_line (start 9.5 9.5) (end -9.5 9.5) (layer Eco1.User) (width 0.12)) (fp_line (start 9.5 -9.5) (end 9.5 9.5) (layer Eco1.User) (width 0.12)) (fp_line (start -9.5 -9.5) (end 9.5 -9.5) (layer Eco1.User) (width 0.12)) (fp_line (start -2.6 -3.1) (end 2.6 -3.1) (layer Eco2.User) (width 0.15)) (fp_line (start 2.6 -3.1) (end 2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start 2.6 -6.3) (end -2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start -2.6 -3.1) (end -2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start -6.9 6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15)) (fp_line (start 6.9 -6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15)) (fp_line (start 6.9 -6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15)) (fp_line (start -6.9 6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15)) (pad "" np_thru_hole circle (at -5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask)) (pad "" np_thru_hole circle (at 5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask)) (pad "" np_thru_hole circle (at 5.22 -4.2) (size 0.9906 0.9906) (drill 0.9906) (layers *.Cu *.Mask)) (pad 1 thru_hole circle (at 0 5.9) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask) (net 19 /col3)) (pad 2 thru_hole circle (at -5 3.8) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask) (net 47 "Net-(D1_3-Pad2)")) (pad "" np_thru_hole circle (at 0 0) (size 3.429 3.429) (drill 3.429) (layers *.Cu *.Mask)) ) (module switches:Choc_PG1350_MX_Spacing (layer F.Cu) (tedit 5F834A4E) (tstamp 5EDAB8F9) (at 61 42) (descr "Kailh \"Choc\" PG1350 keyswitch") (tags kailh,choc) (path /5EECD1C4) (fp_text reference K1_2 (at 0 0) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value KEYSW (at 0 10.5) (layer Cmts.User) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -9.5 9.5) (end -9.5 -9.5) (layer Eco1.User) (width 0.12)) (fp_line (start 9.5 9.5) (end -9.5 9.5) (layer Eco1.User) (width 0.12)) (fp_line (start 9.5 -9.5) (end 9.5 9.5) (layer Eco1.User) (width 0.12)) (fp_line (start -9.5 -9.5) (end 9.5 -9.5) (layer Eco1.User) (width 0.12)) (fp_line (start -2.6 -3.1) (end 2.6 -3.1) (layer Eco2.User) (width 0.15)) (fp_line (start 2.6 -3.1) (end 2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start 2.6 -6.3) (end -2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start -2.6 -3.1) (end -2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start -6.9 6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15)) (fp_line (start 6.9 -6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15)) (fp_line (start 6.9 -6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15)) (fp_line (start -6.9 6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15)) (pad "" np_thru_hole circle (at -5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask)) (pad "" np_thru_hole circle (at 5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask)) (pad "" np_thru_hole circle (at 5.22 -4.2) (size 0.9906 0.9906) (drill 0.9906) (layers *.Cu *.Mask)) (pad 1 thru_hole circle (at 0 5.9) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask) (net 17 /col2)) (pad 2 thru_hole circle (at -5 3.8) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask) (net 46 "Net-(D1_2-Pad2)")) (pad "" np_thru_hole circle (at 0 0) (size 3.429 3.429) (drill 3.429) (layers *.Cu *.Mask)) ) (module switches:Choc_PG1350_MX_Spacing (layer F.Cu) (tedit 5F834A4E) (tstamp 5EDAB836) (at 42 48) (descr "Kailh \"Choc\" PG1350 keyswitch") (tags kailh,choc) (path /5EE47E8A) (fp_text reference K1_1 (at 0 0) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value KEYSW (at 0 10.5) (layer Cmts.User) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -9.5 9.5) (end -9.5 -9.5) (layer Eco1.User) (width 0.12)) (fp_line (start 9.5 9.5) (end -9.5 9.5) (layer Eco1.User) (width 0.12)) (fp_line (start 9.5 -9.5) (end 9.5 9.5) (layer Eco1.User) (width 0.12)) (fp_line (start -9.5 -9.5) (end 9.5 -9.5) (layer Eco1.User) (width 0.12)) (fp_line (start -2.6 -3.1) (end 2.6 -3.1) (layer Eco2.User) (width 0.15)) (fp_line (start 2.6 -3.1) (end 2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start 2.6 -6.3) (end -2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start -2.6 -3.1) (end -2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start -6.9 6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15)) (fp_line (start 6.9 -6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15)) (fp_line (start 6.9 -6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15)) (fp_line (start -6.9 6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15)) (pad "" np_thru_hole circle (at -5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask)) (pad "" np_thru_hole circle (at 5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask)) (pad "" np_thru_hole circle (at 5.22 -4.2) (size 0.9906 0.9906) (drill 0.9906) (layers *.Cu *.Mask)) (pad 1 thru_hole circle (at 0 5.9) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask) (net 18 /col1)) (pad 2 thru_hole circle (at -5 3.8) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask) (net 45 "Net-(D1_1-Pad2)")) (pad "" np_thru_hole circle (at 0 0) (size 3.429 3.429) (drill 3.429) (layers *.Cu *.Mask)) ) (module switches:Choc_PG1350_MX_Spacing (layer F.Cu) (tedit 5F834A4E) (tstamp 5EDAB548) (at 23 60) (descr "Kailh \"Choc\" PG1350 keyswitch") (tags kailh,choc) (path /5EE22042) (fp_text reference K1_0 (at 0 0) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value KEYSW (at 0 10.5) (layer Cmts.User) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -9.5 9.5) (end -9.5 -9.5) (layer Eco1.User) (width 0.12)) (fp_line (start 9.5 9.5) (end -9.5 9.5) (layer Eco1.User) (width 0.12)) (fp_line (start 9.5 -9.5) (end 9.5 9.5) (layer Eco1.User) (width 0.12)) (fp_line (start -9.5 -9.5) (end 9.5 -9.5) (layer Eco1.User) (width 0.12)) (fp_line (start -2.6 -3.1) (end 2.6 -3.1) (layer Eco2.User) (width 0.15)) (fp_line (start 2.6 -3.1) (end 2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start 2.6 -6.3) (end -2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start -2.6 -3.1) (end -2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start -6.9 6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15)) (fp_line (start 6.9 -6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15)) (fp_line (start 6.9 -6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15)) (fp_line (start -6.9 6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15)) (pad "" np_thru_hole circle (at -5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask)) (pad "" np_thru_hole circle (at 5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask)) (pad "" np_thru_hole circle (at 5.22 -4.2) (size 0.9906 0.9906) (drill 0.9906) (layers *.Cu *.Mask)) (pad 1 thru_hole circle (at 0 5.9) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask) (net 14 /col0)) (pad 2 thru_hole circle (at -5 3.8) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask) (net 44 "Net-(D1_0-Pad2)")) (pad "" np_thru_hole circle (at 0 0) (size 3.429 3.429) (drill 3.429) (layers *.Cu *.Mask)) ) (module switches:Choc_PG1350_MX_Spacing (layer F.Cu) (tedit 5F834A4E) (tstamp 5ECCBECF) (at 229 41) (descr "Kailh \"Choc\" PG1350 keyswitch") (tags kailh,choc) (path /5FD3AECE) (fp_text reference K0_9 (at 0 0) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value KEYSW (at 0 10.5) (layer Cmts.User) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -9.5 9.5) (end -9.5 -9.5) (layer Eco1.User) (width 0.12)) (fp_line (start 9.5 9.5) (end -9.5 9.5) (layer Eco1.User) (width 0.12)) (fp_line (start 9.5 -9.5) (end 9.5 9.5) (layer Eco1.User) (width 0.12)) (fp_line (start -9.5 -9.5) (end 9.5 -9.5) (layer Eco1.User) (width 0.12)) (fp_line (start -2.6 -3.1) (end 2.6 -3.1) (layer Eco2.User) (width 0.15)) (fp_line (start 2.6 -3.1) (end 2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start 2.6 -6.3) (end -2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start -2.6 -3.1) (end -2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start -6.9 6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15)) (fp_line (start 6.9 -6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15)) (fp_line (start 6.9 -6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15)) (fp_line (start -6.9 6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15)) (pad "" np_thru_hole circle (at -5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask)) (pad "" np_thru_hole circle (at 5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask)) (pad "" np_thru_hole circle (at 5.22 -4.2) (size 0.9906 0.9906) (drill 0.9906) (layers *.Cu *.Mask)) (pad 1 thru_hole circle (at 0 5.9) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask) (net 24 /col9)) (pad 2 thru_hole circle (at -5 3.8) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask) (net 43 "Net-(D0_9-Pad2)")) (pad "" np_thru_hole circle (at 0 0) (size 3.429 3.429) (drill 3.429) (layers *.Cu *.Mask)) ) (module switches:Choc_PG1350_MX_Spacing (layer F.Cu) (tedit 5F834A4E) (tstamp 5ECCBF2C) (at 210 29) (descr "Kailh \"Choc\" PG1350 keyswitch") (tags kailh,choc) (path /5FD3AE92) (fp_text reference K0_8 (at 0 0) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value KEYSW (at 0 10.5) (layer Cmts.User) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -9.5 9.5) (end -9.5 -9.5) (layer Eco1.User) (width 0.12)) (fp_line (start 9.5 9.5) (end -9.5 9.5) (layer Eco1.User) (width 0.12)) (fp_line (start 9.5 -9.5) (end 9.5 9.5) (layer Eco1.User) (width 0.12)) (fp_line (start -9.5 -9.5) (end 9.5 -9.5) (layer Eco1.User) (width 0.12)) (fp_line (start -2.6 -3.1) (end 2.6 -3.1) (layer Eco2.User) (width 0.15)) (fp_line (start 2.6 -3.1) (end 2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start 2.6 -6.3) (end -2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start -2.6 -3.1) (end -2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start -6.9 6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15)) (fp_line (start 6.9 -6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15)) (fp_line (start 6.9 -6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15)) (fp_line (start -6.9 6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15)) (pad "" np_thru_hole circle (at -5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask)) (pad "" np_thru_hole circle (at 5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask)) (pad "" np_thru_hole circle (at 5.22 -4.2) (size 0.9906 0.9906) (drill 0.9906) (layers *.Cu *.Mask)) (pad 1 thru_hole circle (at 0 5.9) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask) (net 15 /col8)) (pad 2 thru_hole circle (at -5 3.8) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask) (net 42 "Net-(D0_8-Pad2)")) (pad "" np_thru_hole circle (at 0 0) (size 3.429 3.429) (drill 3.429) (layers *.Cu *.Mask)) ) (module switches:Choc_PG1350_MX_Spacing (layer F.Cu) (tedit 5F834A4E) (tstamp 5ECCBFE6) (at 191 23) (descr "Kailh \"Choc\" PG1350 keyswitch") (tags kailh,choc) (path /5FD3AE0F) (fp_text reference K0_7 (at 0 0) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value KEYSW (at 0 10.5) (layer Cmts.User) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -9.5 9.5) (end -9.5 -9.5) (layer Eco1.User) (width 0.12)) (fp_line (start 9.5 9.5) (end -9.5 9.5) (layer Eco1.User) (width 0.12)) (fp_line (start 9.5 -9.5) (end 9.5 9.5) (layer Eco1.User) (width 0.12)) (fp_line (start -9.5 -9.5) (end 9.5 -9.5) (layer Eco1.User) (width 0.12)) (fp_line (start -2.6 -3.1) (end 2.6 -3.1) (layer Eco2.User) (width 0.15)) (fp_line (start 2.6 -3.1) (end 2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start 2.6 -6.3) (end -2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start -2.6 -3.1) (end -2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start -6.9 6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15)) (fp_line (start 6.9 -6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15)) (fp_line (start 6.9 -6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15)) (fp_line (start -6.9 6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15)) (pad "" np_thru_hole circle (at -5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask)) (pad "" np_thru_hole circle (at 5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask)) (pad "" np_thru_hole circle (at 5.22 -4.2) (size 0.9906 0.9906) (drill 0.9906) (layers *.Cu *.Mask)) (pad 1 thru_hole circle (at 0 5.9) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask) (net 21 /col7)) (pad 2 thru_hole circle (at -5 3.8) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask) (net 41 "Net-(D0_7-Pad2)")) (pad "" np_thru_hole circle (at 0 0) (size 3.429 3.429) (drill 3.429) (layers *.Cu *.Mask)) ) (module switches:Choc_PG1350_MX_Spacing (layer F.Cu) (tedit 5F834A4E) (tstamp 5ECCBFC7) (at 172 28.5) (descr "Kailh \"Choc\" PG1350 keyswitch") (tags kailh,choc) (path /5FD3AE23) (fp_text reference K0_6 (at 0 0) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value KEYSW (at 0 10.5) (layer Cmts.User) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -9.5 9.5) (end -9.5 -9.5) (layer Eco1.User) (width 0.12)) (fp_line (start 9.5 9.5) (end -9.5 9.5) (layer Eco1.User) (width 0.12)) (fp_line (start 9.5 -9.5) (end 9.5 9.5) (layer Eco1.User) (width 0.12)) (fp_line (start -9.5 -9.5) (end 9.5 -9.5) (layer Eco1.User) (width 0.12)) (fp_line (start -2.6 -3.1) (end 2.6 -3.1) (layer Eco2.User) (width 0.15)) (fp_line (start 2.6 -3.1) (end 2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start 2.6 -6.3) (end -2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start -2.6 -3.1) (end -2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start -6.9 6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15)) (fp_line (start 6.9 -6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15)) (fp_line (start 6.9 -6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15)) (fp_line (start -6.9 6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15)) (pad "" np_thru_hole circle (at -5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask)) (pad "" np_thru_hole circle (at 5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask)) (pad "" np_thru_hole circle (at 5.22 -4.2) (size 0.9906 0.9906) (drill 0.9906) (layers *.Cu *.Mask)) (pad 1 thru_hole circle (at 0 5.9) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask) (net 20 /col6)) (pad 2 thru_hole circle (at -5 3.8) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask) (net 40 "Net-(D0_6-Pad2)")) (pad "" np_thru_hole circle (at 0 0) (size 3.429 3.429) (drill 3.429) (layers *.Cu *.Mask)) ) (module switches:Choc_PG1350_MX_Spacing (layer F.Cu) (tedit 5F834A4E) (tstamp 5ECCBF4B) (at 153 31) (descr "Kailh \"Choc\" PG1350 keyswitch") (tags kailh,choc) (path /5FD3ADBA) (fp_text reference K0_5 (at 0 0) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value KEYSW (at 0 10.5) (layer Cmts.User) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -9.5 9.5) (end -9.5 -9.5) (layer Eco1.User) (width 0.12)) (fp_line (start 9.5 9.5) (end -9.5 9.5) (layer Eco1.User) (width 0.12)) (fp_line (start 9.5 -9.5) (end 9.5 9.5) (layer Eco1.User) (width 0.12)) (fp_line (start -9.5 -9.5) (end 9.5 -9.5) (layer Eco1.User) (width 0.12)) (fp_line (start -2.6 -3.1) (end 2.6 -3.1) (layer Eco2.User) (width 0.15)) (fp_line (start 2.6 -3.1) (end 2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start 2.6 -6.3) (end -2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start -2.6 -3.1) (end -2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start -6.9 6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15)) (fp_line (start 6.9 -6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15)) (fp_line (start 6.9 -6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15)) (fp_line (start -6.9 6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15)) (pad "" np_thru_hole circle (at -5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask)) (pad "" np_thru_hole circle (at 5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask)) (pad "" np_thru_hole circle (at 5.22 -4.2) (size 0.9906 0.9906) (drill 0.9906) (layers *.Cu *.Mask)) (pad 1 thru_hole circle (at 0 5.9) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask) (net 16 /col5)) (pad 2 thru_hole circle (at -5 3.8) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask) (net 39 "Net-(D0_5-Pad2)")) (pad "" np_thru_hole circle (at 0 0) (size 3.429 3.429) (drill 3.429) (layers *.Cu *.Mask)) ) (module switches:Choc_PG1350_MX_Spacing (layer F.Cu) (tedit 5F834A4E) (tstamp 5EDAB4F7) (at 99 31) (descr "Kailh \"Choc\" PG1350 keyswitch") (tags kailh,choc) (path /5EEF9889) (fp_text reference K0_4 (at 0 0) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value KEYSW (at 0 10.5) (layer Cmts.User) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -9.5 9.5) (end -9.5 -9.5) (layer Eco1.User) (width 0.12)) (fp_line (start 9.5 9.5) (end -9.5 9.5) (layer Eco1.User) (width 0.12)) (fp_line (start 9.5 -9.5) (end 9.5 9.5) (layer Eco1.User) (width 0.12)) (fp_line (start -9.5 -9.5) (end 9.5 -9.5) (layer Eco1.User) (width 0.12)) (fp_line (start -2.6 -3.1) (end 2.6 -3.1) (layer Eco2.User) (width 0.15)) (fp_line (start 2.6 -3.1) (end 2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start 2.6 -6.3) (end -2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start -2.6 -3.1) (end -2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start -6.9 6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15)) (fp_line (start 6.9 -6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15)) (fp_line (start 6.9 -6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15)) (fp_line (start -6.9 6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15)) (pad "" np_thru_hole circle (at -5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask)) (pad "" np_thru_hole circle (at 5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask)) (pad "" np_thru_hole circle (at 5.22 -4.2) (size 0.9906 0.9906) (drill 0.9906) (layers *.Cu *.Mask)) (pad 1 thru_hole circle (at 0 5.9) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask) (net 5 /col4)) (pad 2 thru_hole circle (at -5 3.8) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask) (net 68 "Net-(D0_4-Pad2)")) (pad "" np_thru_hole circle (at 0 0) (size 3.429 3.429) (drill 3.429) (layers *.Cu *.Mask)) ) (module switches:Choc_PG1350_MX_Spacing (layer F.Cu) (tedit 5F834A4E) (tstamp 5EDAAC45) (at 80 28.5) (descr "Kailh \"Choc\" PG1350 keyswitch") (tags kailh,choc) (path /5EEF6C30) (fp_text reference K0_3 (at 0 0) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value KEYSW (at 0 10.5) (layer Cmts.User) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -9.5 9.5) (end -9.5 -9.5) (layer Eco1.User) (width 0.12)) (fp_line (start 9.5 9.5) (end -9.5 9.5) (layer Eco1.User) (width 0.12)) (fp_line (start 9.5 -9.5) (end 9.5 9.5) (layer Eco1.User) (width 0.12)) (fp_line (start -9.5 -9.5) (end 9.5 -9.5) (layer Eco1.User) (width 0.12)) (fp_line (start -2.6 -3.1) (end 2.6 -3.1) (layer Eco2.User) (width 0.15)) (fp_line (start 2.6 -3.1) (end 2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start 2.6 -6.3) (end -2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start -2.6 -3.1) (end -2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start -6.9 6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15)) (fp_line (start 6.9 -6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15)) (fp_line (start 6.9 -6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15)) (fp_line (start -6.9 6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15)) (pad "" np_thru_hole circle (at -5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask)) (pad "" np_thru_hole circle (at 5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask)) (pad "" np_thru_hole circle (at 5.22 -4.2) (size 0.9906 0.9906) (drill 0.9906) (layers *.Cu *.Mask)) (pad 1 thru_hole circle (at 0 5.9) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask) (net 19 /col3)) (pad 2 thru_hole circle (at -5 3.8) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask) (net 38 "Net-(D0_3-Pad2)")) (pad "" np_thru_hole circle (at 0 0) (size 3.429 3.429) (drill 3.429) (layers *.Cu *.Mask)) ) (module switches:Choc_PG1350_MX_Spacing (layer F.Cu) (tedit 5F834A4E) (tstamp 5EDAB5B7) (at 61 23) (descr "Kailh \"Choc\" PG1350 keyswitch") (tags kailh,choc) (path /5EE8C569) (fp_text reference K0_2 (at 0 0) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value KEYSW (at 0 10.5) (layer Cmts.User) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -9.5 9.5) (end -9.5 -9.5) (layer Eco1.User) (width 0.12)) (fp_line (start 9.5 9.5) (end -9.5 9.5) (layer Eco1.User) (width 0.12)) (fp_line (start 9.5 -9.5) (end 9.5 9.5) (layer Eco1.User) (width 0.12)) (fp_line (start -9.5 -9.5) (end 9.5 -9.5) (layer Eco1.User) (width 0.12)) (fp_line (start -2.6 -3.1) (end 2.6 -3.1) (layer Eco2.User) (width 0.15)) (fp_line (start 2.6 -3.1) (end 2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start 2.6 -6.3) (end -2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start -2.6 -3.1) (end -2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start -6.9 6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15)) (fp_line (start 6.9 -6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15)) (fp_line (start 6.9 -6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15)) (fp_line (start -6.9 6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15)) (pad "" np_thru_hole circle (at -5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask)) (pad "" np_thru_hole circle (at 5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask)) (pad "" np_thru_hole circle (at 5.22 -4.2) (size 0.9906 0.9906) (drill 0.9906) (layers *.Cu *.Mask)) (pad 1 thru_hole circle (at 0 5.9) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask) (net 17 /col2)) (pad 2 thru_hole circle (at -5 3.8) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask) (net 37 "Net-(D0_2-Pad2)")) (pad "" np_thru_hole circle (at 0 0) (size 3.429 3.429) (drill 3.429) (layers *.Cu *.Mask)) ) (module switches:Choc_PG1350_MX_Spacing (layer F.Cu) (tedit 5F834A4E) (tstamp 5EDAAB67) (at 42 29) (descr "Kailh \"Choc\" PG1350 keyswitch") (tags kailh,choc) (path /5EEBC822) (fp_text reference K0_1 (at 0 0) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value KEYSW (at 0 10.5) (layer Cmts.User) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -9.5 9.5) (end -9.5 -9.5) (layer Eco1.User) (width 0.12)) (fp_line (start 9.5 9.5) (end -9.5 9.5) (layer Eco1.User) (width 0.12)) (fp_line (start 9.5 -9.5) (end 9.5 9.5) (layer Eco1.User) (width 0.12)) (fp_line (start -9.5 -9.5) (end 9.5 -9.5) (layer Eco1.User) (width 0.12)) (fp_line (start -2.6 -3.1) (end 2.6 -3.1) (layer Eco2.User) (width 0.15)) (fp_line (start 2.6 -3.1) (end 2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start 2.6 -6.3) (end -2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start -2.6 -3.1) (end -2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start -6.9 6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15)) (fp_line (start 6.9 -6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15)) (fp_line (start 6.9 -6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15)) (fp_line (start -6.9 6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15)) (pad "" np_thru_hole circle (at -5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask)) (pad "" np_thru_hole circle (at 5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask)) (pad "" np_thru_hole circle (at 5.22 -4.2) (size 0.9906 0.9906) (drill 0.9906) (layers *.Cu *.Mask)) (pad 1 thru_hole circle (at 0 5.9) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask) (net 18 /col1)) (pad 2 thru_hole circle (at -5 3.8) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask) (net 36 "Net-(D0_1-Pad2)")) (pad "" np_thru_hole circle (at 0 0) (size 3.429 3.429) (drill 3.429) (layers *.Cu *.Mask)) ) (module switches:Choc_PG1350_MX_Spacing (layer F.Cu) (tedit 5F834A4E) (tstamp 5EDAA6FC) (at 23 41) (descr "Kailh \"Choc\" PG1350 keyswitch") (tags kailh,choc) (path /5EE18079) (fp_text reference K0_0 (at 0 0) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value KEYSW (at 0 10.5) (layer Cmts.User) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -9.5 9.5) (end -9.5 -9.5) (layer Eco1.User) (width 0.12)) (fp_line (start 9.5 9.5) (end -9.5 9.5) (layer Eco1.User) (width 0.12)) (fp_line (start 9.5 -9.5) (end 9.5 9.5) (layer Eco1.User) (width 0.12)) (fp_line (start -9.5 -9.5) (end 9.5 -9.5) (layer Eco1.User) (width 0.12)) (fp_line (start -2.6 -3.1) (end 2.6 -3.1) (layer Eco2.User) (width 0.15)) (fp_line (start 2.6 -3.1) (end 2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start 2.6 -6.3) (end -2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start -2.6 -3.1) (end -2.6 -6.3) (layer Eco2.User) (width 0.15)) (fp_line (start -6.9 6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15)) (fp_line (start 6.9 -6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15)) (fp_line (start 6.9 -6.9) (end 6.9 6.9) (layer Eco2.User) (width 0.15)) (fp_line (start -6.9 6.9) (end -6.9 -6.9) (layer Eco2.User) (width 0.15)) (pad "" np_thru_hole circle (at -5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask)) (pad "" np_thru_hole circle (at 5.5 0) (size 1.7018 1.7018) (drill 1.7018) (layers *.Cu *.Mask)) (pad "" np_thru_hole circle (at 5.22 -4.2) (size 0.9906 0.9906) (drill 0.9906) (layers *.Cu *.Mask)) (pad 1 thru_hole circle (at 0 5.9) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask) (net 14 /col0)) (pad 2 thru_hole circle (at -5 3.8) (size 2.032 2.032) (drill 1.27) (layers *.Cu *.Mask) (net 35 "Net-(D0_0-Pad2)")) (pad "" np_thru_hole circle (at 0 0) (size 3.429 3.429) (drill 3.429) (layers *.Cu *.Mask)) ) (module silkscreens:safe_rust locked (layer B.Cu) (tedit 0) (tstamp 5EE0C344) (at 186.43 52.99 190) (attr virtual) (fp_text reference G*** (at 0 0 190) (layer B.SilkS) hide (effects (font (size 1.524 1.524) (thickness 0.3)) (justify mirror)) ) (fp_text value LOGO (at 0.75 0 190) (layer B.SilkS) hide (effects (font (size 1.524 1.524) (thickness 0.3)) (justify mirror)) ) (fp_poly (pts (xy 3.410133 27.16612) (xy 3.917737 27.024859) (xy 4.372532 26.819581) (xy 4.750326 26.556438) (xy 4.952383 26.345711) (xy 5.193906 26.004911) (xy 5.465817 25.558276) (xy 5.759835 25.020942) (xy 6.067678 24.408042) (xy 6.381066 23.734712) (xy 6.381729 23.733235) (xy 6.681212 23.067199) (xy 6.934015 22.508747) (xy 7.144355 22.049108) (xy 7.316455 21.679513) (xy 7.454533 21.391192) (xy 7.56281 21.175375) (xy 7.645506 21.023293) (xy 7.706841 20.926176) (xy 7.751035 20.875254) (xy 7.76028 20.868472) (xy 7.877291 20.840241) (xy 8.04065 20.878023) (xy 8.255 20.985457) (xy 8.342963 21.044339) (xy 11.820461 21.044339) (xy 12.249866 20.409807) (xy 12.476177 20.062873) (xy 12.642853 19.771163) (xy 12.770916 19.491802) (xy 12.88139 19.181916) (xy 12.931225 19.020215) (xy 13.044404 18.83354) (xy 13.25956 18.705572) (xy 13.531076 18.638713) (xy 13.695938 18.588578) (xy 13.921721 18.48847) (xy 14.163524 18.358628) (xy 14.197826 18.338186) (xy 14.438645 18.199411) (xy 14.66861 18.078432) (xy 14.842554 17.998852) (xy 14.859 17.992669) (xy 15.085107 17.935909) (xy 15.328582 17.912487) (xy 15.548584 17.922345) (xy 15.704272 17.965424) (xy 15.7411 17.993937) (xy 15.770617 18.117624) (xy 15.749999 18.354478) (xy 15.679867 18.701248) (xy 15.560845 19.154686) (xy 15.44135 19.558) (xy 15.139432 20.477546) (xy 14.838513 21.270101) (xy 14.538588 21.935671) (xy 14.239656 22.474259) (xy 14.098468 22.68497) (xy 13.896795 22.931374) (xy 13.719926 23.064596) (xy 13.552233 23.091845) (xy 13.378087 23.020332) (xy 13.375381 23.018567) (xy 13.234765 22.896743) (xy 13.039099 22.684574) (xy 12.801932 22.398589) (xy 12.536816 22.05532) (xy 12.257302 21.671299) (xy 12.175919 21.555295) (xy 11.820461 21.044339) (xy 8.342963 21.044339) (xy 8.524983 21.166182) (xy 8.855243 21.423833) (xy 9.250423 21.76205) (xy 9.715164 22.18447) (xy 10.25411 22.694731) (xy 10.871903 23.296471) (xy 10.922 23.345839) (xy 11.361561 23.778931) (xy 11.722127 24.13274) (xy 12.014884 24.417404) (xy 12.251018 24.643063) (xy 12.441716 24.819855) (xy 12.598165 24.957918) (xy 12.73155 25.067391) (xy 12.853058 25.158412) (xy 12.973876 25.241121) (xy 13.105189 25.325656) (xy 13.109307 25.328262) (xy 13.417463 25.479674) (xy 13.709616 25.520015) (xy 14.022101 25.451643) (xy 14.156851 25.396237) (xy 14.59911 25.129969) (xy 15.025042 24.742039) (xy 15.431752 24.237073) (xy 15.816344 23.619699) (xy 16.175924 22.89454) (xy 16.507596 22.066225) (xy 16.797363 21.17725) (xy 17.034957 20.372914) (xy 17.241009 19.682305) (xy 17.418469 19.096927) (xy 17.57029 18.608284) (xy 17.699424 18.207877) (xy 17.808822 17.887209) (xy 17.901436 17.637783) (xy 17.980219 17.451102) (xy 18.048121 17.318668) (xy 18.108096 17.231985) (xy 18.163094 17.182554) (xy 18.189737 17.16912) (xy 18.344385 17.154344) (xy 18.527799 17.222763) (xy 18.745964 17.379721) (xy 19.004867 17.630565) (xy 19.310493 17.98064) (xy 19.668829 18.435291) (xy 19.794211 18.601868) (xy 20.058222 18.944718) (xy 20.280829 19.195066) (xy 20.489221 19.367294) (xy 20.710587 19.475782) (xy 20.972115 19.534914) (xy 21.300993 19.559069) (xy 21.611023 19.562885) (xy 22.037036 19.552565) (xy 22.365891 19.514983) (xy 22.626245 19.440204) (xy 22.846752 19.318292) (xy 23.056069 19.139314) (xy 23.167314 19.02333) (xy 23.494339 18.573706) (xy 23.717918 18.050722) (xy 23.810754 17.653) (xy 23.83256 17.472696) (xy 23.856922 17.188864) (xy 23.882296 16.82491) (xy 23.907137 16.404239) (xy 23.929903 15.950258) (xy 23.942682 15.65275) (xy 23.976443 14.883386) (xy 24.011272 14.238494) (xy 24.047391 13.715553) (xy 24.085021 13.312038) (xy 24.124385 13.025426) (xy 24.165705 12.853194) (xy 24.193669 12.801431) (xy 24.270437 12.784359) (xy 24.417211 12.83019) (xy 24.649157 12.94404) (xy 24.702867 12.973104) (xy 25.192025 13.215016) (xy 25.624255 13.370248) (xy 26.026835 13.447191) (xy 26.283065 13.459213) (xy 26.791483 13.399985) (xy 27.237862 13.230352) (xy 27.620557 12.951632) (xy 27.937922 12.565143) (xy 28.188311 12.072201) (xy 28.25885 11.877701) (xy 28.341277 11.582221) (xy 28.397189 11.262888) (xy 28.426948 10.901911) (xy 28.430913 10.481499) (xy 28.409444 9.983858) (xy 28.362901 9.391198) (xy 28.318342 8.936657) (xy 28.170508 7.513207) (xy 28.296869 7.296846) (xy 28.40431 7.155915) (xy 28.579604 6.970298) (xy 28.790469 6.77342) (xy 28.860737 6.713037) (xy 29.135012 6.495039) (xy 29.476419 6.242486) (xy 29.85949 5.972439) (xy 30.258755 5.701959) (xy 30.648745 5.448109) (xy 31.003991 5.227949) (xy 31.299023 5.05854) (xy 31.4325 4.990268) (xy 31.604972 4.911138) (xy 31.750585 4.856783) (xy 31.899527 4.82256) (xy 32.081988 4.803826) (xy 32.328156 4.79594) (xy 32.668221 4.794256) (xy 32.70707 4.79425) (xy 32.986684 4.794955) (xy 33.211983 4.790926) (xy 33.399333 4.772945) (xy 33.565101 4.731798) (xy 33.725653 4.658266) (xy 33.897357 4.543134) (xy 34.096578 4.377184) (xy 34.339683 4.151202) (xy 34.643039 3.85597) (xy 35.004375 3.500572) (xy 35.941 2.580701) (xy 35.941 0.6973) (xy 35.967677 -0.814319) (xy 36.050581 -2.243295) (xy 36.194018 -3.622886) (xy 36.402293 -4.986351) (xy 36.679715 -6.366948) (xy 37.030588 -7.797938) (xy 37.050829 -7.874) (xy 37.181306 -8.364543) (xy 37.278406 -8.750217) (xy 37.340544 -9.04911) (xy 37.366134 -9.27931) (xy 37.353589 -9.458904) (xy 37.301324 -9.605981) (xy 37.207752 -9.738628) (xy 37.071287 -9.874933) (xy 36.890342 -10.032984) (xy 36.859153 -10.059782) (xy 36.706441 -10.192934) (xy 36.581024 -10.313794) (xy 36.479921 -10.436201) (xy 36.400151 -10.573991) (xy 36.338732 -10.741002) (xy 36.292682 -10.951073) (xy 36.25902 -11.218042) (xy 36.234764 -11.555745) (xy 36.216933 -11.978022) (xy 36.202546 -12.498709) (xy 36.188621 -13.131645) (xy 36.187676 -13.17625) (xy 36.174415 -13.713773) (xy 36.158209 -14.226688) (xy 36.13989 -14.697166) (xy 36.120284 -15.107378) (xy 36.100223 -15.439496) (xy 36.080534 -15.675692) (xy 36.066648 -15.778468) (xy 35.958712 -16.185561) (xy 35.810893 -16.481162) (xy 35.614382 -16.676917) (xy 35.360367 -16.784474) (xy 35.29585 -16.797464) (xy 35.157706 -16.810728) (xy 35.017204 -16.79812) (xy 34.862493 -16.752465) (xy 34.681723 -16.666588) (xy 34.463043 -16.533313) (xy 34.194603 -16.345465) (xy 33.864553 -16.095868) (xy 33.461042 -15.777346) (xy 33.009815 -15.413263) (xy 32.5568 -15.082154) (xy 32.15283 -14.86556) (xy 31.794301 -14.762423) (xy 31.477604 -14.771687) (xy 31.209353 -14.885498) (xy 31.103159 -14.993391) (xy 30.978645 -15.174182) (xy 30.888381 -15.338494) (xy 30.792825 -15.562238) (xy 30.733565 -15.782958) (xy 30.713575 -16.016007) (xy 30.735828 -16.276738) (xy 30.8033 -16.580507) (xy 30.918964 -16.942666) (xy 31.085794 -17.378571) (xy 31.306764 -17.903574) (xy 31.447422 -18.2245) (xy 31.720342 -18.864468) (xy 31.933351 -19.426618) (xy 32.092587 -19.941606) (xy 32.204188 -20.440088) (xy 32.27429 -20.952722) (xy 32.309032 -21.510161) (xy 32.31455 -22.143064) (xy 32.307678 -22.521444) (xy 32.292475 -22.996347) (xy 32.26781 -23.372858) (xy 32.225227 -23.679579) (xy 32.156272 -23.945115) (xy 32.052492 -24.198069) (xy 31.905431 -24.467044) (xy 31.706636 -24.780643) (xy 31.58661 -24.961006) (xy 31.016179 -25.749446) (xy 30.410733 -26.470116) (xy 29.78426 -27.108799) (xy 29.150746 -27.651277) (xy 28.52418 -28.083336) (xy 28.500838 -28.097301) (xy 28.089787 -28.32531) (xy 27.635853 -28.548783) (xy 27.157269 -28.761309) (xy 26.672267 -28.956481) (xy 26.19908 -29.127887) (xy 25.755939 -29.26912) (xy 25.361078 -29.37377) (xy 25.032729 -29.435428) (xy 24.789124 -29.447684) (xy 24.702445 -29.43255) (xy 24.61253 -29.368864) (xy 24.537591 -29.230593) (xy 24.472582 -29.002567) (xy 24.412456 -28.669619) (xy 24.385409 -28.47975) (xy 24.365878 -28.309725) (xy 24.339607 -28.046323) (xy 24.308625 -27.713589) (xy 24.274959 -27.335574) (xy 24.240639 -26.936325) (xy 24.207691 -26.539892) (xy 24.178145 -26.170321) (xy 24.154029 -25.851663) (xy 24.13737 -25.607965) (xy 24.130198 -25.463276) (xy 24.130066 -25.452213) (xy 24.068569 -25.433052) (xy 23.888285 -25.435915) (xy 23.595389 -25.460148) (xy 23.196052 -25.505093) (xy 22.696448 -25.570095) (xy 22.102748 -25.654498) (xy 21.795542 -25.700293) (xy 21.551825 -25.681305) (xy 21.258436 -25.567769) (xy 20.936041 -25.370882) (xy 20.605305 -25.101838) (xy 20.493662 -24.994954) (xy 20.094085 -24.540999) (xy 19.809861 -24.083284) (xy 19.63774 -23.607025) (xy 19.574472 -23.097437) (xy 19.616809 -22.539734) (xy 19.761501 -21.919133) (xy 19.794172 -21.81225) (xy 20.101549 -21.027878) (xy 20.527338 -20.243806) (xy 21.063562 -19.472754) (xy 21.702243 -18.727443) (xy 21.779963 -18.645966) (xy 22.44277 -18.012366) (xy 23.119951 -17.477892) (xy 23.845863 -17.016255) (xy 24.074627 -16.889986) (xy 24.57658 -16.596962) (xy 24.968386 -16.310048) (xy 25.265326 -16.015445) (xy 25.482683 -15.69935) (xy 25.556094 -15.552027) (xy 25.609523 -15.404997) (xy 25.678475 -15.174684) (xy 25.757506 -14.884113) (xy 25.84117 -14.556311) (xy 25.924021 -14.214303) (xy 26.000612 -13.881116) (xy 26.065499 -13.579774) (xy 26.113236 -13.333303) (xy 26.138377 -13.16473) (xy 26.136522 -13.097855) (xy 26.086479 -13.132635) (xy 25.958455 -13.239516) (xy 25.768175 -13.40488) (xy 25.531364 -13.615106) (xy 25.331128 -13.795428) (xy 24.718638 -14.343062) (xy 24.172065 -14.81571) (xy 23.67035 -15.230927) (xy 23.192432 -15.606266) (xy 22.86 -15.855244) (xy 21.587753 -16.743249) (xy 20.266723 -17.57183) (xy 18.884336 -18.347251) (xy 17.428017 -19.075772) (xy 15.885192 -19.763658) (xy 14.243287 -20.41717) (xy 12.489729 -21.042571) (xy 12.35075 -21.089394) (xy 11.845142 -21.25766) (xy 11.452422 -21.388838) (xy 11.166529 -21.490351) (xy 10.981406 -21.569621) (xy 10.890995 -21.634073) (xy 10.889238 -21.691128) (xy 10.970077 -21.748211) (xy 11.127454 -21.812743) (xy 11.355311 -21.89215) (xy 11.6205 -21.984195) (xy 12.49253 -22.352136) (xy 13.348455 -22.83205) (xy 14.198673 -23.430063) (xy 14.5415 -23.705378) (xy 14.734092 -23.872143) (xy 14.979503 -24.094814) (xy 15.264654 -24.360549) (xy 15.57647 -24.656505) (xy 15.901876 -24.969836) (xy 16.227794 -25.287702) (xy 16.54115 -25.597257) (xy 16.828868 -25.885658) (xy 17.07787 -26.140062) (xy 17.275082 -26.347626) (xy 17.407427 -26.495506) (xy 17.46183 -26.570859) (xy 17.4625 -26.574433) (xy 17.420375 -26.644937) (xy 17.305717 -26.784639) (xy 17.136095 -26.973237) (xy 16.931595 -27.187858) (xy 16.284986 -27.767809) (xy 15.520799 -28.306154) (xy 14.642034 -28.801156) (xy 13.651693 -29.251081) (xy 12.827 -29.561551) (xy 12.364843 -29.725831) (xy 12.011046 -29.861439) (xy 11.751833 -29.974526) (xy 11.573431 -30.071245) (xy 11.462067 -30.157745) (xy 11.441655 -30.180205) (xy 11.420041 -30.29324) (xy 11.482249 -30.482792) (xy 11.630016 -30.752073) (xy 11.865076 -31.104296) (xy 12.149921 -31.49121) (xy 12.55013 -32.01882) (xy 12.881045 -32.45784) (xy 13.151062 -32.820145) (xy 13.368579 -33.117609) (xy 13.54199 -33.362106) (xy 13.679694 -33.565512) (xy 13.790086 -33.739702) (xy 13.881564 -33.896549) (xy 13.962523 -34.047928) (xy 13.974963 -34.072242) (xy 14.10116 -34.342688) (xy 14.184722 -34.568614) (xy 14.215144 -34.720727) (xy 14.214033 -34.738992) (xy 14.132717 -34.884987) (xy 13.939847 -35.031728) (xy 13.650804 -35.175961) (xy 13.280969 -35.314432) (xy 12.845726 -35.443887) (xy 12.360455 -35.56107) (xy 11.840539 -35.662728) (xy 11.301359 -35.745606) (xy 10.758298 -35.80645) (xy 10.226738 -35.842006) (xy 9.72206 -35.849019) (xy 9.259646 -35.824234) (xy 9.144 -35.811664) (xy 8.240715 -35.654437) (xy 7.356117 -35.410159) (xy 6.5111 -35.087746) (xy 5.726562 -34.696114) (xy 5.023396 -34.24418) (xy 4.531706 -33.843575) (xy 4.267241 -33.58873) (xy 4.018431 -33.317889) (xy 3.775267 -33.016398) (xy 3.527743 -32.669605) (xy 3.265852 -32.262859) (xy 2.979586 -31.781506) (xy 2.658938 -31.210896) (xy 2.369822 -30.678212) (xy 1.967224 -29.944904) (xy 1.601255 -29.317431) (xy 1.262374 -28.783317) (xy 0.941035 -28.330088) (xy 0.627695 -27.945269) (xy 0.31281 -27.616386) (xy -0.013164 -27.330965) (xy -0.35977 -27.07653) (xy -0.41275 -27.041177) (xy -0.610381 -26.918574) (xy -0.894585 -26.752711) (xy -1.239013 -26.558443) (xy -1.617315 -26.350622) (xy -2.00314 -26.144104) (xy -2.017836 -26.136355) (xy -2.426003 -25.917962) (xy -2.848875 -25.685955) (xy -3.253805 -25.458644) (xy -3.608141 -25.254337) (xy -3.859336 -25.103697) (xy -4.164653 -24.915058) (xy -4.472828 -24.724929) (xy -4.745122 -24.557194) (xy -4.92125 -24.448948) (xy -5.185861 -24.296106) (xy -5.465085 -24.155889) (xy -5.771567 -24.024543) (xy -6.117957 -23.898313) (xy -6.516901 -23.773443) (xy -6.981046 -23.646179) (xy -7.52304 -23.512766) (xy -8.15553 -23.36945) (xy -8.891163 -23.212475) (xy -9.525 -23.082136) (xy -10.573159 -22.863744) (xy -11.503947 -22.658304) (xy -12.315569 -22.466256) (xy -13.006225 -22.288041) (xy -13.57412 -22.124098) (xy -13.9617 -21.995311) (xy -14.235753 -21.902528) (xy -14.482787 -21.829897) (xy -14.66709 -21.787406) (xy -14.729683 -21.7805) (xy -14.774709 -21.778887) (xy -14.81244 -21.781291) (xy -14.845002 -21.798575) (xy -14.87452 -21.8416) (xy -14.903121 -21.921229) (xy -14.932929 -22.048325) (xy -14.96607 -22.23375) (xy -15.004671 -22.488366) (xy -15.050856 -22.823036) (xy -15.106751 -23.248622) (xy -15.174481 -23.775987) (xy -15.256173 -24.415993) (xy -15.276423 -24.5745) (xy -15.405759 -25.520139) (xy -15.537925 -26.347981) (xy -15.675528 -27.067226) (xy -15.821176 -27.687078) (xy -15.977478 -28.216738) (xy -16.147042 -28.665407) (xy -16.332476 -29.042288) (xy -16.536388 -29.356582) (xy -16.682078 -29.53389) (xy -16.959676 -29.786824) (xy -17.247902 -29.934336) (xy -17.557836 -29.975911) (xy -17.900557 -29.911034) (xy -18.287144 -29.73919) (xy -18.728676 -29.459864) (xy -18.760564 -29.437246) (xy -19.072936 -29.197021) (xy -19.382438 -28.921825) (xy -19.693338 -28.605046) (xy -20.0099 -28.240073) (xy -20.336392 -27.820294) (xy -20.677078 -27.339099) (xy -21.036224 -26.789876) (xy -21.418097 -26.166015) (xy -21.826962 -25.460904) (xy -22.267085 -24.667932) (xy -22.742732 -23.780488) (xy -23.258169 -22.79196) (xy -23.817662 -21.695739) (xy -24.039156 -21.256625) (xy -24.319258 -20.700655) (xy -24.582121 -20.180659) (xy -24.822253 -19.707381) (xy -25.03416 -19.291561) (xy -25.212349 -18.943945) (xy -25.351328 -18.675273) (xy -25.445603 -18.496289) (xy -25.489682 -18.417736) (xy -25.4921 -18.415) (xy -25.573011 -18.440633) (xy -25.742657 -18.509807) (xy -25.975364 -18.610934) (xy -26.245455 -18.732423) (xy -26.527257 -18.862688) (xy -26.795094 -18.990138) (xy -27.02329 -19.103184) (xy -27.069444 -19.126956) (xy -27.464391 -19.347686) (xy -27.944331 -19.641852) (xy -28.497049 -20.001163) (xy -29.11033 -20.417325) (xy -29.77196 -20.882045) (xy -30.469723 -21.387032) (xy -31.191406 -21.923992) (xy -31.21025 -21.938207) (xy -31.844431 -22.413576) (xy -32.394472 -22.818337) (xy -32.874612 -23.162199) (xy -33.299087 -23.454872) (xy -33.682135 -23.706067) (xy -34.037993 -23.925492) (xy -34.380901 -24.122858) (xy -34.545773 -24.212985) (xy -35.264867 -24.563407) (xy -35.949136 -24.824371) (xy -36.589728 -24.994204) (xy -37.177791 -25.07123) (xy -37.704473 -25.053776) (xy -38.160921 -24.940166) (xy -38.232677 -24.910381) (xy -38.571243 -24.707228) (xy -38.870768 -24.412356) (xy -39.133906 -24.020145) (xy -39.363312 -23.524974) (xy -39.561641 -22.921225) (xy -39.731547 -22.203277) (xy -39.861117 -21.463) (xy -39.901131 -21.111879) (xy -39.932569 -20.656144) (xy -39.946731 -20.322962) (xy -38.092646 -20.322962) (xy -38.087148 -20.84685) (xy -38.071958 -21.279984) (xy -38.045658 -21.634407) (xy -38.006828 -21.922161) (xy -37.954049 -22.15529) (xy -37.885904 -22.345837) (xy -37.800972 -22.505845) (xy -37.697836 -22.647357) (xy -37.637004 -22.717125) (xy -37.515706 -22.822407) (xy -37.39945 -22.84551) (xy -37.263937 -22.780132) (xy -37.084865 -22.619974) (xy -37.024656 -22.558375) (xy -36.899017 -22.421462) (xy -36.708292 -22.205627) (xy -36.468648 -21.929552) (xy -36.196254 -21.611919) (xy -35.907276 -21.271412) (xy -35.774497 -21.11375) (xy -35.395374 -20.666547) (xy -34.94445 -20.141635) (xy -34.435706 -19.554959) (xy -33.88312 -18.922462) (xy -33.300673 -18.260087) (xy -32.702345 -17.583777) (xy -32.102115 -16.909478) (xy -31.513964 -16.253131) (xy -31.459413 -16.1925) (xy -31.004863 -15.681984) (xy -30.632687 -15.25128) (xy -30.335161 -14.890692) (xy -30.104564 -14.590523) (xy -29.933172 -14.341077) (xy -29.813265 -14.132657) (xy -29.803813 -14.113707) (xy -29.719185 -13.934155) (xy -29.677943 -13.801544) (xy -29.675944 -13.667395) (xy -29.709051 -13.483229) (xy -29.738741 -13.351707) (xy -29.784856 -13.14366) (xy -29.822561 -12.951543) (xy -29.853216 -12.758144) (xy -29.87818 -12.546251) (xy -29.898812 -12.29865) (xy -29.916471 -11.998127) (xy -29.932518 -11.627471) (xy -29.94831 -11.169468) (xy -29.965209 -10.606905) (xy -29.97073 -10.414) (xy -29.987192 -9.911849) (xy -30.006939 -9.43465) (xy -30.02886 -9.001695) (xy -30.051841 -8.632277) (xy -30.074751 -8.345949) (xy -26.214811 -8.345949) (xy -26.209484 -8.747894) (xy -26.183917 -9.151948) (xy -26.135466 -9.566723) (xy -26.061485 -10.000834) (xy -25.959329 -10.462893) (xy -25.826353 -10.961513) (xy -25.659912 -11.505308) (xy -25.45736 -12.102891) (xy -25.216052 -12.762876) (xy -24.933343 -13.493875) (xy -24.606587 -14.304502) (xy -24.23314 -15.20337) (xy -23.810356 -16.199092) (xy -23.33559 -17.300282) (xy -23.306542 -17.36725) (xy -22.929004 -18.239391) (xy -22.595968 -19.013557) (xy -22.299989 -19.707661) (xy -22.033624 -20.33962) (xy -21.789429 -20.927348) (xy -21.559961 -21.48876) (xy -21.337776 -22.041771) (xy -21.115431 -22.604298) (xy -20.885643 -23.193835) (xy -20.713703 -23.632843) (xy -20.540966 -24.065417) (xy -20.377651 -24.46658) (xy -20.23398 -24.811359) (xy -20.120173 -25.074777) (xy -20.078015 -25.16742) (xy -19.863626 -25.593017) (xy -19.633094 -25.995206) (xy -19.397828 -26.358544) (xy -19.169238 -26.667586) (xy -18.958734 -26.906886) (xy -18.777726 -27.061) (xy -18.63961 -27.1145) (xy -18.571831 -27.052314) (xy -18.521617 -26.865266) (xy -18.509447 -26.780807) (xy -18.495882 -26.543474) (xy -18.498627 -26.192218) (xy -18.516719 -25.738937) (xy -18.549196 -25.195529) (xy -18.595096 -24.57389) (xy -18.653456 -23.885918) (xy -18.723314 -23.14351) (xy -18.803707 -22.358564) (xy -18.893673 -21.542977) (xy -18.992251 -20.708647) (xy -19.016642 -20.5105) (xy -19.105453 -19.775807) (xy -19.176415 -19.13871) (xy -19.231378 -18.571339) (xy -19.272196 -18.045826) (xy -19.300721 -17.534305) (xy -19.318804 -17.008907) (xy -19.328298 -16.441763) (xy -19.331055 -15.805007) (xy -19.331052 -15.77975) (xy -19.328916 -15.180652) (xy -19.322191 -14.687206) (xy -19.309902 -14.278116) (xy -19.291072 -13.932085) (xy -19.264724 -13.627817) (xy -19.229883 -13.344015) (xy -19.214616 -13.23975) (xy -19.074555 -12.470974) (xy -18.905829 -11.822592) (xy -18.70652 -11.290845) (xy -18.474712 -10.871975) (xy -18.208486 -10.562225) (xy -17.905926 -10.357836) (xy -17.706567 -10.284325) (xy -17.531602 -10.244682) (xy -17.428718 -10.253347) (xy -17.349587 -10.318242) (xy -17.325765 -10.346753) (xy -17.246604 -10.481717) (xy -17.137847 -10.720869) (xy -17.005599 -11.046518) (xy -16.855963 -11.440973) (xy -16.695043 -11.886541) (xy -16.528943 -12.365532) (xy -16.363766 -12.860255) (xy -16.205616 -13.353018) (xy -16.060597 -13.82613) (xy -15.934814 -14.2619) (xy -15.834369 -14.642636) (xy -15.812786 -14.732) (xy -15.743648 -15.023919) (xy -15.678434 -15.296975) (xy -15.627314 -15.508675) (xy -15.611165 -15.574427) (xy -15.537788 -15.769559) (xy -15.408048 -15.963897) (xy -15.208555 -16.170772) (xy -14.92592 -16.403517) (xy -14.546756 -16.675461) (xy -14.417074 -16.763397) (xy -14.061758 -17.00407) (xy -13.661422 -17.278534) (xy -13.26925 -17.550172) (xy -12.98575 -17.748876) (xy -12.478808 -18.085828) (xy -11.988589 -18.371333) (xy -11.533576 -18.596287) (xy -11.132249 -18.751588) (xy -10.803089 -18.828133) (xy -10.792025 -18.829392) (xy -10.562571 -18.837782) (xy -10.369739 -18.798088) (xy -10.191975 -18.695913) (xy -10.007729 -18.516862) (xy -9.795449 -18.246541) (xy -9.683338 -18.088853) (xy -9.374034 -17.655775) (xy -9.123029 -17.327865) (xy -8.925964 -17.099825) (xy -8.778477 -16.966355) (xy -8.73961 -16.941981) (xy -8.648571 -16.91318) (xy -8.560542 -16.949697) (xy -8.440771 -17.06873) (xy -8.408198 -17.105977) (xy -8.304846 -17.248663) (xy -8.162456 -17.47676) (xy -7.997963 -17.761682) (xy -7.828303 -18.074839) (xy -7.78584 -18.15657) (xy -7.446815 -18.786729) (xy -7.102479 -19.36346) (xy -6.736903 -19.907685) (xy -6.334161 -20.440327) (xy -5.878323 -20.982308) (xy -5.353462 -21.554551) (xy -4.74365 -22.177979) (xy -4.664485 -22.25675) (xy -4.122067 -22.784086) (xy -3.617544 -23.248037) (xy -3.130203 -23.663601) (xy -2.63933 -24.045775) (xy -2.124213 -24.409558) (xy -1.564139 -24.769948) (xy -0.938395 -25.141942) (xy -0.226268 -25.540538) (xy 0.15875 -25.749173) (xy 0.647063 -26.01181) (xy 1.040107 -26.224187) (xy 1.354592 -26.395951) (xy 1.607232 -26.536748) (xy 1.814739 -26.656226) (xy 1.993825 -26.764031) (xy 2.161204 -26.86981) (xy 2.333586 -26.983211) (xy 2.527685 -27.113879) (xy 2.55474 -27.132201) (xy 3.042846 -27.498838) (xy 3.442639 -27.874536) (xy 3.742295 -28.246666) (xy 3.929087 -28.600179) (xy 4.023492 -28.925025) (xy 4.10204 -29.33583) (xy 4.158905 -29.791947) (xy 4.188263 -30.25273) (xy 4.191 -30.427583) (xy 4.232476 -31.031144) (xy 4.361465 -31.551349) (xy 4.584807 -32.002931) (xy 4.909341 -32.40062) (xy 5.23875 -32.684104) (xy 5.76158 -33.026732) (xy 6.368784 -33.339793) (xy 7.018242 -33.605069) (xy 7.667836 -33.80434) (xy 7.9952 -33.876482) (xy 8.246345 -33.910075) (xy 8.576896 -33.93494) (xy 8.96397 -33.951291) (xy 9.384681 -33.959344) (xy 9.816146 -33.959316) (xy 10.235479 -33.951421) (xy 10.619796 -33.935875) (xy 10.946212 -33.912895) (xy 11.191843 -33.882694) (xy 11.333805 -33.84549) (xy 11.33475 -33.84502) (xy 11.486179 -33.736682) (xy 11.544974 -33.600306) (xy 11.509546 -33.421595) (xy 11.378307 -33.186251) (xy 11.240408 -32.995532) (xy 10.972158 -32.629337) (xy 10.685738 -32.209639) (xy 10.389161 -31.750826) (xy 10.090439 -31.267286) (xy 9.797585 -30.773405) (xy 9.518612 -30.283572) (xy 9.261531 -29.812173) (xy 9.034356 -29.373596) (xy 8.8451 -28.982228) (xy 8.701774 -28.652456) (xy 8.612392 -28.398668) (xy 8.584966 -28.235252) (xy 8.58549 -28.228379) (xy 8.667712 -28.035411) (xy 8.871291 -27.862725) (xy 9.191726 -27.713605) (xy 9.369717 -27.655973) (xy 9.584284 -27.596805) (xy 9.80258 -27.544624) (xy 10.045204 -27.495925) (xy 10.332755 -27.447206) (xy 10.685833 -27.39496) (xy 11.125035 -27.335684) (xy 11.639326 -27.269855) (xy 12.322691 -27.179456) (xy 12.895876 -27.093234) (xy 13.375458 -27.007509) (xy 13.778013 -26.918604) (xy 14.120119 -26.82284) (xy 14.418352 -26.716539) (xy 14.689289 -26.596022) (xy 14.70025 -26.590628) (xy 14.996482 -26.418429) (xy 15.170979 -26.246386) (xy 15.228154 -26.059993) (xy 15.172423 -25.844745) (xy 15.008201 -25.586134) (xy 15.00659 -25.584019) (xy 14.743494 -25.285855) (xy 14.396129 -24.959674) (xy 13.995897 -24.629887) (xy 13.574203 -24.320907) (xy 13.162449 -24.057148) (xy 12.793829 -23.863821) (xy 12.293418 -23.688291) (xy 11.705907 -23.561069) (xy 11.061348 -23.482617) (xy 10.38979 -23.453395) (xy 9.721287 -23.473864) (xy 9.085887 -23.544484) (xy 8.513643 -23.665716) (xy 8.138289 -23.79247) (xy 7.702795 -24.036701) (xy 7.278403 -24.404676) (xy 6.867846 -24.893417) (xy 6.473854 -25.499943) (xy 6.322692 -25.772635) (xy 6.169151 -26.047175) (xy 6.011114 -26.305637) (xy 5.872684 -26.509554) (xy 5.814855 -26.583118) (xy 5.614108 -26.815347) (xy 5.387261 -26.707702) (xy 5.162913 -26.576434) (xy 4.862377 -26.362333) (xy 4.496575 -26.074985) (xy 4.076426 -25.723974) (xy 3.612852 -25.318887) (xy 3.116773 -24.869308) (xy 2.694329 -24.473939) (xy 4.953 -24.473939) (xy 5.007521 -24.603465) (xy 5.151658 -24.680603) (xy 5.356273 -24.697976) (xy 5.592224 -24.648208) (xy 5.612295 -24.640834) (xy 5.807751 -24.500611) (xy 5.944268 -24.258994) (xy 5.991908 -24.079958) (xy 5.993085 -23.90681) (xy 5.913054 -23.828235) (xy 5.74839 -23.842341) (xy 5.63495 -23.882855) (xy 5.470398 -23.973034) (xy 5.288229 -24.104983) (xy 5.120151 -24.251221) (xy 4.997871 -24.384264) (xy 4.953 -24.473939) (xy 2.694329 -24.473939) (xy 2.59911 -24.384823) (xy 2.070785 -23.875017) (xy 1.542717 -23.349475) (xy 1.424659 -23.229638) (xy 0.65369 -22.4216) (xy -0.040613 -21.647661) (xy -0.654935 -20.912656) (xy -1.185961 -20.221419) (xy -1.630375 -19.578781) (xy -1.984859 -18.989577) (xy -2.2461 -18.458641) (xy -2.41078 -17.990805) (xy -2.475584 -17.590904) (xy -2.4765 -17.543071) (xy -2.449531 -17.342512) (xy -2.381059 -17.151473) (xy -2.289744 -17.009095) (xy -2.19596 -16.9545) (xy -2.102814 -17.002404) (xy -1.955811 -17.131208) (xy -1.775028 -17.31855) (xy -1.580538 -17.542067) (xy -1.392417 -17.779395) (xy -1.230739 -18.008173) (xy -1.184908 -18.080778) (xy -1.051595 -18.326385) (xy -0.937181 -18.582524) (xy -0.878695 -18.752628) (xy -0.819332 -18.938116) (xy -0.744993 -19.04018) (xy -0.617893 -19.100333) (xy -0.542139 -19.122417) (xy -0.360861 -19.148363) (xy -0.067574 -19.160586) (xy 0.32352 -19.159457) (xy 0.798214 -19.14535) (xy 1.342305 -19.118636) (xy 1.941588 -19.079688) (xy 2.38125 -19.04576) (xy 4.336997 -18.826811) (xy 6.321587 -18.490033) (xy 8.325726 -18.038737) (xy 10.340123 -17.476234) (xy 12.355487 -16.805834) (xy 14.362525 -16.030848) (xy 16.351947 -15.154588) (xy 18.314459 -14.180364) (xy 20.240772 -13.111487) (xy 21.912285 -12.086427) (xy 22.639664 -11.612455) (xy 23.261307 -11.191722) (xy 23.784108 -10.818786) (xy 24.214959 -10.488203) (xy 24.560755 -10.19453) (xy 24.828389 -9.932322) (xy 25.024754 -9.696138) (xy 25.115846 -9.55675) (xy 25.192252 -9.395137) (xy 25.289801 -9.145894) (xy 25.395643 -8.843753) (xy 25.491751 -8.54075) (xy 25.754206 -7.767238) (xy 26.04595 -7.10548) (xy 26.374401 -6.542128) (xy 26.746976 -6.063833) (xy 27.021757 -5.787256) (xy 27.281645 -5.56132) (xy 27.497463 -5.407228) (xy 27.708866 -5.301331) (xy 27.955507 -5.219979) (xy 27.987625 -5.211208) (xy 28.259965 -5.17917) (xy 28.533288 -5.215792) (xy 28.778851 -5.308507) (xy 28.967911 -5.444748) (xy 29.071726 -5.611948) (xy 29.083 -5.690143) (xy 29.066638 -5.774726) (xy 29.003169 -5.852563) (xy 28.871016 -5.940747) (xy 28.648604 -6.056372) (xy 28.57618 -6.091661) (xy 28.321228 -6.212029) (xy 28.087017 -6.317512) (xy 27.913664 -6.390196) (xy 27.87768 -6.403573) (xy 27.818427 -6.421836) (xy 27.771376 -6.439764) (xy 27.736356 -6.47047) (xy 27.713197 -6.527065) (xy 27.701731 -6.622664) (xy 27.701786 -6.770377) (xy 27.713194 -6.983319) (xy 27.735784 -7.274601) (xy 27.769388 -7.657337) (xy 27.813834 -8.144639) (xy 27.850012 -8.54075) (xy 27.910699 -9.274978) (xy 27.961767 -10.029043) (xy 28.002724 -10.784747) (xy 28.033075 -11.523897) (xy 28.052328 -12.228297) (xy 28.059989 -12.879752) (xy 28.055565 -13.460066) (xy 28.038562 -13.951046) (xy 28.008487 -14.334495) (xy 28.007377 -14.344155) (xy 27.883155 -15.091213) (xy 27.693176 -15.792726) (xy 27.446914 -16.414796) (xy 27.403945 -16.502662) (xy 27.23885 -16.812541) (xy 27.080215 -17.055684) (xy 26.907148 -17.246583) (xy 26.698753 -17.399733) (xy 26.434135 -17.529629) (xy 26.092401 -17.650765) (xy 25.652657 -17.777637) (xy 25.511345 -17.815571) (xy 24.894499 -17.996016) (xy 24.380895 -18.18584) (xy 23.946809 -18.397164) (xy 23.568513 -18.642112) (xy 23.22228 -18.932805) (xy 23.108742 -19.043119) (xy 22.868084 -19.30393) (xy 22.628418 -19.596194) (xy 22.427387 -19.872785) (xy 22.356264 -19.985137) (xy 22.146087 -20.377148) (xy 21.948814 -20.812123) (xy 21.771971 -21.266309) (xy 21.623087 -21.715956) (xy 21.509686 -22.13731) (xy 21.439295 -22.506621) (xy 21.419442 -22.800138) (xy 21.430166 -22.907625) (xy 21.477261 -23.054284) (xy 21.564427 -23.109529) (xy 21.62454 -23.114) (xy 21.779386 -23.081906) (xy 22.041691 -22.986204) (xy 22.409499 -22.827764) (xy 22.880854 -22.607458) (xy 23.453799 -22.326154) (xy 23.886134 -22.107763) (xy 24.483412 -21.814) (xy 24.986066 -21.591541) (xy 25.403004 -21.438138) (xy 25.743133 -21.351541) (xy 26.015363 -21.329501) (xy 26.228601 -21.369769) (xy 26.391756 -21.470096) (xy 26.396032 -21.474068) (xy 26.478231 -21.570908) (xy 26.522885 -21.691625) (xy 26.540443 -21.875909) (xy 26.542327 -22.029693) (xy 26.530539 -22.309754) (xy 26.495105 -22.666108) (xy 26.434741 -23.106738) (xy 26.348161 -23.639625) (xy 26.234079 -24.272752) (xy 26.09121 -25.0141) (xy 25.943328 -25.74925) (xy 25.83288 -26.286732) (xy 25.747677 -26.711999) (xy 25.690537 -27.037842) (xy 25.664275 -27.277049) (xy 25.671708 -27.44241) (xy 25.715653 -27.546715) (xy 25.798927 -27.602752) (xy 25.924346 -27.623312) (xy 26.094727 -27.621183) (xy 26.312886 -27.609155) (xy 26.3525 -27.607162) (xy 26.790097 -27.562487) (xy 27.157707 -27.468866) (xy 27.273781 -27.424922) (xy 27.868734 -27.120229) (xy 28.454936 -26.702742) (xy 29.018654 -26.18657) (xy 29.546154 -25.585821) (xy 30.023703 -24.914603) (xy 30.437567 -24.187025) (xy 30.450213 -24.16175) (xy 30.797258 -23.350457) (xy 31.019129 -22.559786) (xy 31.115657 -21.78792) (xy 31.08667 -21.033043) (xy 30.931998 -20.293338) (xy 30.651469 -19.566991) (xy 30.244914 -18.852183) (xy 29.907062 -18.385333) (xy 29.723254 -18.142653) (xy 29.568746 -17.92215) (xy 29.461587 -17.750624) (xy 29.421409 -17.664166) (xy 29.41081 -17.530081) (xy 29.430389 -17.322895) (xy 29.481886 -17.035085) (xy 29.567037 -16.659125) (xy 29.687582 -16.187491) (xy 29.84526 -15.61266) (xy 30.041807 -14.927108) (xy 30.098846 -14.732) (xy 30.329 -13.941572) (xy 30.523869 -13.256894) (xy 30.686648 -12.662687) (xy 30.82053 -12.143671) (xy 30.928711 -11.684567) (xy 31.014386 -11.270094) (xy 31.080749 -10.884973) (xy 31.130995 -10.513924) (xy 31.16832 -10.141668) (xy 31.195917 -9.752925) (xy 31.214117 -9.398) (xy 31.225736 -8.855995) (xy 31.218024 -8.239448) (xy 31.193017 -7.586532) (xy 31.152746 -6.935416) (xy 31.099246 -6.324273) (xy 31.034549 -5.791274) (xy 31.015262 -5.664699) (xy 30.93235 -5.190184) (xy 30.824375 -4.635896) (xy 30.695987 -4.021174) (xy 30.551832 -3.365356) (xy 30.396559 -2.687783) (xy 30.234816 -2.007794) (xy 30.071251 -1.344728) (xy 29.910512 -0.717925) (xy 29.757246 -0.146723) (xy 29.616103 0.349538) (xy 29.491731 0.751518) (xy 29.429845 0.931817) (xy 29.2486 1.394981) (xy 29.041282 1.847819) (xy 28.798719 2.304759) (xy 28.697242 2.472884) (xy 30.4165 2.472884) (xy 30.451709 2.409402) (xy 30.551384 2.255409) (xy 30.706597 2.024042) (xy 30.90842 1.728435) (xy 31.147925 1.381723) (xy 31.416184 0.997041) (xy 31.52775 0.838024) (xy 32.639 -0.743172) (xy 32.640503 -4.292711) (xy 32.641927 -5.226238) (xy 32.645623 -6.041617) (xy 32.651996 -6.747685) (xy 32.661448 -7.353279) (xy 32.674384 -7.867238) (xy 32.691208 -8.298399) (xy 32.712322 -8.655599) (xy 32.738131 -8.947677) (xy 32.769039 -9.183469) (xy 32.805448 -9.371814) (xy 32.847763 -9.52155) (xy 32.883537 -9.613648) (xy 32.95717 -9.746365) (xy 33.077583 -9.9289) (xy 33.226668 -10.137629) (xy 33.386314 -10.348931) (xy 33.538413 -10.539182) (xy 33.664855 -10.684761) (xy 33.74753 -10.762043) (xy 33.767694 -10.766972) (xy 33.769004 -10.701834) (xy 33.765275 -10.523558) (xy 33.75698 -10.245886) (xy 33.744594 -9.882558) (xy 33.728589 -9.447318) (xy 33.70944 -8.953907) (xy 33.68762 -8.416067) (xy 33.681953 -8.279857) (xy 33.630979 -6.797632) (xy 33.60696 -5.430453) (xy 33.609756 -4.169292) (xy 33.613954 -3.90525) (xy 33.625538 -3.325976) (xy 33.638422 -2.847522) (xy 33.655239 -2.443715) (xy 33.678621 -2.088382) (xy 33.711202 -1.755349) (xy 33.755616 -1.418444) (xy 33.814494 -1.051493) (xy 33.89047 -0.628322) (xy 33.986177 -0.12276) (xy 34.003636 -0.03175) (xy 34.072699 0.369228) (xy 34.134409 0.803072) (xy 34.182015 1.217431) (xy 34.20871 1.55875) (xy 34.220638 1.925071) (xy 34.207771 2.196631) (xy 34.159474 2.404881) (xy 34.065111 2.581266) (xy 33.914048 2.757237) (xy 33.750372 2.914108) (xy 33.335188 3.226877) (xy 32.895805 3.428926) (xy 32.446849 3.517035) (xy 32.002948 3.487986) (xy 31.65475 3.375286) (xy 31.484105 3.284367) (xy 31.270212 3.150971) (xy 31.037785 2.99311) (xy 30.811542 2.828797) (xy 30.616198 2.676044) (xy 30.476469 2.552863) (xy 30.41707 2.477266) (xy 30.4165 2.472884) (xy 28.697242 2.472884) (xy 28.511734 2.780228) (xy 28.171153 3.288654) (xy 27.767801 3.844463) (xy 27.292504 4.462084) (xy 26.770424 5.113746) (xy 26.24173 5.754176) (xy 25.678019 6.41916) (xy 25.089505 7.09774) (xy 24.486401 7.778955) (xy 23.878923 8.451849) (xy 23.277284 9.105461) (xy 22.691699 9.728834) (xy 22.293751 10.143046) (xy 26.040574 10.143046) (xy 26.121906 9.886365) (xy 26.166608 9.819314) (xy 26.283749 9.690007) (xy 26.372515 9.663693) (xy 26.470118 9.734611) (xy 26.500889 9.767553) (xy 26.617082 9.946489) (xy 26.717575 10.1933) (xy 26.797467 10.478763) (xy 26.851852 10.773656) (xy 26.875826 11.048758) (xy 26.864487 11.274847) (xy 26.81293 11.422699) (xy 26.783434 11.451241) (xy 26.691926 11.480493) (xy 26.588591 11.431588) (xy 26.492015 11.346741) (xy 26.275384 11.079094) (xy 26.123686 10.769321) (xy 26.043292 10.447335) (xy 26.040574 10.143046) (xy 22.293751 10.143046) (xy 22.132382 10.311009) (xy 21.609547 10.841027) (xy 21.133409 11.30793) (xy 20.714182 11.700759) (xy 20.362081 12.008555) (xy 20.285875 12.070825) (xy 20.032891 12.262145) (xy 19.68495 12.507521) (xy 19.256937 12.797255) (xy 18.763733 13.121651) (xy 18.220221 13.471011) (xy 17.641284 13.835638) (xy 17.041805 14.205836) (xy 16.570904 14.491389) (xy 15.944615 14.864273) (xy 15.326944 15.223928) (xy 14.978936 15.421607) (xy 20.142519 15.421607) (xy 20.164638 15.187753) (xy 20.244219 15.021001) (xy 20.386271 14.903818) (xy 20.595801 14.818672) (xy 20.6375 14.806403) (xy 20.92882 14.743368) (xy 21.125567 14.74944) (xy 21.240618 14.82602) (xy 21.265965 14.874875) (xy 21.303574 15.018506) (xy 21.349614 15.260438) (xy 21.400095 15.57258) (xy 21.451027 15.926844) (xy 21.498419 16.295137) (xy 21.538282 16.64937) (xy 21.566626 16.961454) (xy 21.570937 17.021933) (xy 21.583014 17.368613) (xy 21.561082 17.607718) (xy 21.499228 17.755529) (xy 21.391536 17.828324) (xy 21.272475 17.8435) (xy 21.027516 17.782651) (xy 20.806542 17.599649) (xy 20.60914 17.293812) (xy 20.434896 16.864461) (xy 20.283396 16.310914) (xy 20.250634 16.16075) (xy 20.172854 15.740095) (xy 20.142519 15.421607) (xy 14.978936 15.421607) (xy 14.703667 15.577968) (xy 14.06056 15.93401) (xy 13.383399 16.299672) (xy 12.65796 16.682568) (xy 11.870018 17.090315) (xy 11.00535 17.530528) (xy 10.049732 18.010826) (xy 9.30275 18.38307) (xy 8.515764 18.774833) (xy 7.835443 19.115336) (xy 7.254184 19.408739) (xy 6.764382 19.659204) (xy 6.358433 19.87089) (xy 6.028732 20.047958) (xy 5.767677 20.194569) (xy 5.567662 20.314884) (xy 5.421083 20.413062) (xy 5.320336 20.493266) (xy 5.257818 20.559654) (xy 5.227177 20.61301) (xy 5.249666 20.7205) (xy 5.367886 20.885881) (xy 5.461715 20.98748) (xy 5.611675 21.147057) (xy 5.688833 21.263993) (xy 5.7116 21.384021) (xy 5.698386 21.55287) (xy 5.696291 21.570147) (xy 5.64359 21.852523) (xy 5.548534 22.214166) (xy 5.419312 22.633808) (xy 5.264112 23.090179) (xy 5.091123 23.56201) (xy 4.908534 24.028031) (xy 4.724534 24.466974) (xy 4.547312 24.857569) (xy 4.385055 25.178547) (xy 4.245954 25.408639) (xy 4.191482 25.478686) (xy 3.951236 25.74925) (xy 3.388493 25.74925) (xy 3.101926 25.744805) (xy 2.898502 25.72535) (xy 2.734495 25.681705) (xy 2.56618 25.60469) (xy 2.481088 25.55875) (xy 2.21851 25.381703) (xy 1.968172 25.142915) (xy 1.723061 24.831498) (xy 1.476162 24.436565) (xy 1.220462 23.947228) (xy 0.948947 23.3526) (xy 0.742509 22.86) (xy 0.507621 22.263811) (xy 0.327737 21.764712) (xy 0.204188 21.366836) (xy 0.138305 21.074314) (xy 0.127 20.948312) (xy 0.183373 20.733519) (xy 0.335525 20.580189) (xy 0.558 20.511945) (xy 0.598714 20.510501) (xy 0.798211 20.473014) (xy 0.949694 20.377141) (xy 1.015351 20.247762) (xy 1.015762 20.23609) (xy 0.965458 20.077448) (xy 0.834999 19.890587) (xy 0.653801 19.711498) (xy 0.496104 19.60032) (xy 0.258286 19.489844) (xy -0.078681 19.369814) (xy -0.487949 19.246603) (xy -0.942669 19.126588) (xy -1.415994 19.016142) (xy -1.881075 18.92164) (xy -2.311065 18.849457) (xy -2.679115 18.805967) (xy -2.891441 18.796) (xy -3.110177 18.803875) (xy -3.302099 18.834806) (xy -3.489775 18.899759) (xy -3.695769 19.009695) (xy -3.942645 19.175579) (xy -4.252971 19.408373) (xy -4.420829 19.539057) (xy -5.002483 19.973904) (xy -5.619204 20.397042) (xy -6.251586 20.797475) (xy -6.880225 21.164211) (xy -7.485719 21.486255) (xy -8.048661 21.752613) (xy -8.549649 21.952291) (xy -8.840515 22.043171) (xy -9.171337 22.074712) (xy -9.46909 21.984035) (xy -9.733097 21.771722) (xy -9.962681 21.438354) (xy -10.157167 20.984515) (xy -10.190954 20.881998) (xy -10.298824 20.488688) (xy -10.398426 20.026903) (xy -10.488113 19.515428) (xy -10.566234 18.973048) (xy -10.63114 18.418551) (xy -10.681181 17.87072) (xy -10.714707 17.348342) (xy -10.730069 16.870203) (xy -10.725618 16.455087) (xy -10.699704 16.121781) (xy -10.650676 15.88907) (xy -10.63319 15.845771) (xy -10.466297 15.631578) (xy -10.224745 15.513347) (xy -10.058609 15.494) (xy -9.794849 15.433552) (xy -9.522871 15.259034) (xy -9.343927 15.082285) (xy -9.200571 14.890733) (xy -9.155693 14.7289) (xy -9.208282 14.556815) (xy -9.326077 14.376403) (xy -9.449935 14.226752) (xy -9.642126 14.018153) (xy -9.889597 13.762906) (xy -10.179292 13.473312) (xy -10.498161 13.161671) (xy -10.833147 12.840284) (xy -11.1712 12.521451) (xy -11.499264 12.217472) (xy -11.804286 11.940648) (xy -12.073213 11.70328) (xy -12.292991 11.517667) (xy -12.450568 11.39611) (xy -12.532889 11.35091) (xy -12.536607 11.351089) (xy -12.617776 11.377702) (xy -12.798632 11.442627) (xy -13.060218 11.538875) (xy -13.383574 11.659455) (xy -13.749744 11.797377) (xy -13.84877 11.834892) (xy -14.651496 12.135249) (xy -15.354345 12.388139) (xy -15.97351 12.597643) (xy -16.525181 12.767845) (xy -17.02555 12.902826) (xy -17.490808 13.006669) (xy -17.937146 13.083456) (xy -18.380755 13.137271) (xy -18.837826 13.172195) (xy -19.219727 13.189134) (xy -20.310204 13.225065) (xy -20.285567 12.978408) (xy -20.270077 12.796638) (xy -20.25129 12.537832) (xy -20.232774 12.25177) (xy -20.229201 12.192) (xy -20.192159 11.804297) (xy -20.123111 11.414374) (xy -20.015822 11.0021) (xy -19.864051 10.547345) (xy -19.661564 10.02998) (xy -19.40212 9.429873) (xy -19.310212 9.226221) (xy -19.160608 8.876365) (xy -19.013044 8.495281) (xy -18.887556 8.136482) (xy -18.822811 7.924471) (xy -18.719037 7.554535) (xy -18.627969 7.276193) (xy -18.530103 7.0751) (xy -18.405937 6.936911) (xy -18.235967 6.847281) (xy -18.00069 6.791863) (xy -17.680601 6.756314) (xy -17.256199 6.726288) (xy -17.187601 6.721725) (xy -16.832555 6.696935) (xy -16.506262 6.672164) (xy -16.237403 6.649733) (xy -16.054656 6.631964) (xy -16.010716 6.626483) (xy -15.797182 6.59556) (xy -15.840288 6.044155) (xy -15.913642 5.333091) (xy -16.01325 4.744543) (xy -16.139704 4.276644) (xy -16.293592 3.927531) (xy -16.475506 3.695338) (xy -16.612564 3.604614) (xy -16.742779 3.56347) (xy -16.835603 3.606031) (xy -16.89846 3.676444) (xy -16.987863 3.845961) (xy -17.018 3.998972) (xy -17.066244 4.216368) (xy -17.215342 4.399244) (xy -17.471842 4.551772) (xy -17.842296 4.678125) (xy -18.214356 4.761155) (xy -18.385576 4.787249) (xy -18.665084 4.822589) (xy -19.034652 4.86534) (xy -19.476051 4.91367) (xy -19.971055 4.965744) (xy -20.501434 5.019731) (xy -21.04896 5.073796) (xy -21.595406 5.126107) (xy -22.122543 5.174831) (xy -22.612144 5.218134) (xy -23.04598 5.254183) (xy -23.33625 5.276253) (xy -23.895666 5.307527) (xy -24.391962 5.31762) (xy -24.810656 5.307022) (xy -25.137261 5.276227) (xy -25.357292 5.225725) (xy -25.401706 5.206088) (xy -25.555255 5.086983) (xy -25.612359 4.932527) (xy -25.57642 4.72123) (xy -25.50618 4.546281) (xy -25.250476 4.07991) (xy -24.896941 3.571598) (xy -24.46116 3.036546) (xy -23.958721 2.489955) (xy -23.405209 1.947024) (xy -22.816212 1.422956) (xy -22.207316 0.93295) (xy -21.594108 0.492208) (xy -20.992175 0.11593) (xy -20.92325 0.076844) (xy -20.630493 -0.087479) (xy -20.330611 -0.256127) (xy -20.071705 -0.402038) (xy -19.981015 -0.453277) (xy -19.729204 -0.610303) (xy -19.568144 -0.760469) (xy -19.485826 -0.933559) (xy -19.470242 -1.159359) (xy -19.509383 -1.467654) (xy -19.528881 -1.574756) (xy -19.599501 -1.919813) (xy -19.66804 -2.164454) (xy -19.748377 -2.334259) (xy -19.854388 -2.454805) (xy -19.999952 -2.551672) (xy -20.082078 -2.594361) (xy -20.251554 -2.692876) (xy -20.360897 -2.784073) (xy -20.3835 -2.826602) (xy -20.3292 -2.93118) (xy -20.168016 -3.098019) (xy -19.902522 -3.324976) (xy -19.535296 -3.609908) (xy -19.068912 -3.950674) (xy -18.822229 -4.125275) (xy -17.911978 -4.772333) (xy -17.100297 -5.367642) (xy -16.374745 -5.921144) (xy -15.722881 -6.442783) (xy -15.132266 -6.942501) (xy -14.59046 -7.430241) (xy -14.108491 -7.892673) (xy -13.665125 -8.347144) (xy -13.28785 -8.765774) (xy -12.982232 -9.140826) (xy -12.75384 -9.464564) (xy -12.608238 -9.729254) (xy -12.550995 -9.927159) (xy -12.570818 -10.029468) (xy -12.679821 -10.089797) (xy -12.880379 -10.085094) (xy -13.157105 -10.018824) (xy -13.494607 -9.89445) (xy -13.806191 -9.751399) (xy -14.231196 -9.523208) (xy -14.737614 -9.221593) (xy -15.310729 -8.856129) (xy -15.935828 -8.436388) (xy -16.598194 -7.971946) (xy -17.09289 -7.613052) (xy -17.936091 -7.0076) (xy -18.704882 -6.489177) (xy -19.411944 -6.052381) (xy -20.069961 -5.691808) (xy -20.691615 -5.402057) (xy -21.289591 -5.177724) (xy -21.876571 -5.013407) (xy -22.465237 -4.903703) (xy -23.068274 -4.843209) (xy -23.63475 -4.826374) (xy -24.199353 -4.848125) (xy -24.676686 -4.919941) (xy -25.073956 -5.050557) (xy -25.398371 -5.248703) (xy -25.657139 -5.523114) (xy -25.857468 -5.882521) (xy -26.006564 -6.335658) (xy -26.111637 -6.891258) (xy -26.179892 -7.558052) (xy -26.202545 -7.9375) (xy -26.214811 -8.345949) (xy -30.074751 -8.345949) (xy -30.074772 -8.345687) (xy -30.096539 -8.161218) (xy -30.102438 -8.129742) (xy -30.16079 -7.925728) (xy -30.249989 -7.750052) (xy -30.394577 -7.562108) (xy -30.543805 -7.399492) (xy -30.806052 -7.102381) (xy -30.994202 -6.827136) (xy -31.109304 -6.554536) (xy -31.152405 -6.265358) (xy -31.124555 -5.940381) (xy -31.026803 -5.560382) (xy -30.886215 -5.177078) (xy -28.482728 -5.177078) (xy -28.423037 -5.262893) (xy -28.411025 -5.276273) (xy -28.287835 -5.372113) (xy -28.149383 -5.382887) (xy -27.969745 -5.305198) (xy -27.806653 -5.197111) (xy -27.621909 -5.056399) (xy -27.388623 -4.86737) (xy -27.152302 -4.667047) (xy -27.1145 -4.634006) (xy -26.655433 -4.265443) (xy -26.139867 -3.910464) (xy -25.601702 -3.589142) (xy -25.07484 -3.32155) (xy -24.593181 -3.127759) (xy -24.54275 -3.11128) (xy -24.32756 -3.031674) (xy -24.086598 -2.925604) (xy -23.852942 -2.8098) (xy -23.659667 -2.70099) (xy -23.539851 -2.615905) (xy -23.521273 -2.594637) (xy -23.514599 -2.489928) (xy -23.614714 -2.39817) (xy -23.801455 -2.328719) (xy -24.054662 -2.290934) (xy -24.18466 -2.286753) (xy -24.719894 -2.335421) (xy -25.261547 -2.482864) (xy -25.821886 -2.734121) (xy -26.413176 -3.094227) (xy -26.762414 -3.345328) (xy -27.093033 -3.607542) (xy -27.425804 -3.893911) (xy -27.741148 -4.18545) (xy -28.019488 -4.463171) (xy -28.241245 -4.708088) (xy -28.386841 -4.901215) (xy -28.412282 -4.945325) (xy -28.479075 -5.089276) (xy -28.482728 -5.177078) (xy -30.886215 -5.177078) (xy -30.860196 -5.106139) (xy -30.690762 -4.705347) (xy -30.494584 -4.203756) (xy -30.384178 -3.787027) (xy -30.358186 -3.447626) (xy -30.415251 -3.178017) (xy -30.415362 -3.177748) (xy -30.565662 -2.959283) (xy -30.82198 -2.745593) (xy -31.163388 -2.54512) (xy -31.568959 -2.366305) (xy -32.017764 -2.217591) (xy -32.488874 -2.10742) (xy -32.961361 -2.044235) (xy -33.254786 -2.032354) (xy -33.674026 -2.04812) (xy -33.996651 -2.105505) (xy -34.250464 -2.220657) (xy -34.463269 -2.409728) (xy -34.66287 -2.688867) (xy -34.800974 -2.930458) (xy -35.150238 -3.635541) (xy -35.500879 -4.461477) (xy -35.853592 -5.410068) (xy -36.209077 -6.483117) (xy -36.34511 -6.924141) (xy -36.719264 -8.225115) (xy -37.041418 -9.491594) (xy -37.314444 -10.743509) (xy -37.541218 -12.000789) (xy -37.724613 -13.283363) (xy -37.867505 -14.611161) (xy -37.972767 -16.004111) (xy -38.043274 -17.482144) (xy -38.08024 -18.95475) (xy -38.08987 -19.696276) (xy -38.092646 -20.322962) (xy -39.946731 -20.322962) (xy -39.955448 -20.117888) (xy -39.969786 -19.519205) (xy -39.975602 -18.88219) (xy -39.972913 -18.228936) (xy -39.961736 -17.581538) (xy -39.94209 -16.962089) (xy -39.913993 -16.392685) (xy -39.877461 -15.895418) (xy -39.856456 -15.6845) (xy -39.655934 -14.111053) (xy -39.40315 -12.522999) (xy -39.10311 -10.94254) (xy -38.760821 -9.39188) (xy -38.381289 -7.893224) (xy -37.969522 -6.468774) (xy -37.530525 -5.140734) (xy -37.393766 -4.763093) (xy -37.189508 -4.243372) (xy -36.952764 -3.694446) (xy -36.695717 -3.140764) (xy -36.430547 -2.606773) (xy -36.169438 -2.116924) (xy -35.92457 -1.695665) (xy -35.708125 -1.367446) (xy -35.688627 -1.340836) (xy -35.289569 -0.872513) (xy -34.869553 -0.519779) (xy -34.423828 -0.282352) (xy -33.947643 -0.159949) (xy -33.436247 -0.152286) (xy -32.88489 -0.25908) (xy -32.288821 -0.480049) (xy -31.643288 -0.814908) (xy -31.22364 -1.074686) (xy -30.860264 -1.301185) (xy -30.497037 -1.508387) (xy -30.162726 -1.681087) (xy -29.886101 -1.804083) (xy -29.762181 -1.847014) (xy -29.636572 -1.862177) (xy -29.520693 -1.824065) (xy -29.407552 -1.721596) (xy -29.356021 -1.643501) (xy -27.213849 -1.643501) (xy -27.21221 -1.822523) (xy -27.211727 -1.82448) (xy -27.141483 -1.944296) (xy -27.020052 -1.947901) (xy -26.847422 -1.835295) (xy -26.7589 -1.7526) (xy -26.61194 -1.593423) (xy -26.556426 -1.478091) (xy -26.587805 -1.367302) (xy -26.697903 -1.225915) (xy -26.814626 -1.111979) (xy -26.904261 -1.089789) (xy -26.967778 -1.117445) (xy -27.073126 -1.237323) (xy -27.161319 -1.430555) (xy -27.213849 -1.643501) (xy -29.356021 -1.643501) (xy -29.290157 -1.543687) (xy -29.161517 -1.279259) (xy -29.014639 -0.917229) (xy -28.842534 -0.446516) (xy -28.797172 -0.3175) (xy -28.627277 0.155467) (xy -28.481001 0.527673) (xy -28.347116 0.820484) (xy -28.214394 1.055265) (xy -28.071607 1.253382) (xy -27.907528 1.4362) (xy -27.840461 1.502991) (xy -27.628068 1.731915) (xy -27.505028 1.92513) (xy -27.457707 2.073633) (xy -27.447417 2.215169) (xy -27.44707 2.457471) (xy -27.455988 2.774751) (xy -27.47349 3.14122) (xy -27.494464 3.470065) (xy -27.531396 4.140827) (xy -27.536756 4.701913) (xy -27.50848 5.167168) (xy -27.444508 5.550439) (xy -27.342777 5.865572) (xy -27.201228 6.126415) (xy -27.07513 6.286574) (xy -26.843777 6.488939) (xy -26.558558 6.631466) (xy -26.193964 6.724344) (xy -25.87625 6.765424) (xy -25.532898 6.811353) (xy -25.256884 6.888411) (xy -25.00012 7.016089) (xy -24.985206 7.026418) (xy -22.513998 7.026418) (xy -22.513183 6.817209) (xy -22.417263 6.6484) (xy -22.255305 6.533747) (xy -22.056378 6.487005) (xy -21.849551 6.521931) (xy -21.682364 6.632864) (xy -21.57917 6.79552) (xy -21.52502 7.006053) (xy -21.515843 7.235536) (xy -21.547566 7.455042) (xy -21.616118 7.635642) (xy -21.717427 7.748409) (xy -21.841863 7.765958) (xy -21.970666 7.691801) (xy -22.134523 7.545628) (xy -22.301067 7.363048) (xy -22.437933 7.179674) (xy -22.512758 7.031116) (xy -22.513998 7.026418) (xy -24.985206 7.026418) (xy -24.714519 7.213876) (xy -24.652536 7.261369) (xy -24.459199 7.4237) (xy -24.210484 7.651313) (xy -23.922886 7.927211) (xy -23.612903 8.234396) (xy -23.297033 8.555873) (xy -22.991774 8.874643) (xy -22.713622 9.173711) (xy -22.479075 9.436078) (xy -22.304631 9.644749) (xy -22.208895 9.779) (xy -22.119883 9.945717) (xy -22.048892 10.113256) (xy -21.991794 10.302213) (xy -21.944462 10.533188) (xy -21.90277 10.826777) (xy -21.86259 11.203581) (xy -21.819795 11.684195) (xy -21.814482 11.7475) (xy -21.767911 12.273632) (xy -21.724046 12.690358) (xy -21.679595 13.01513) (xy -21.631267 13.265402) (xy -21.57577 13.458626) (xy -21.509814 13.612254) (xy -21.441021 13.72779) (xy -21.316758 13.889676) (xy -21.174588 14.021597) (xy -21.000903 14.126469) (xy -20.782091 14.20721) (xy -20.504543 14.266735) (xy -20.15465 14.30796) (xy -19.718801 14.333802) (xy -19.183388 14.347176) (xy -18.534799 14.351) (xy -18.532586 14.351) (xy -18.076384 14.353842) (xy -17.640672 14.361813) (xy -17.24864 14.374085) (xy -16.923481 14.38983) (xy -16.688384 14.408218) (xy -16.601038 14.420022) (xy -16.082525 14.577436) (xy -15.579083 14.857757) (xy -15.087632 15.26276) (xy -15.016403 15.332723) (xy -14.68262 15.716113) (xy -14.378644 16.170932) (xy -14.099811 16.707655) (xy -13.841458 17.336756) (xy -13.598922 18.068711) (xy -13.367541 18.913993) (xy -13.300621 19.186994) (xy -13.110065 19.959454) (xy -12.933072 20.623931) (xy -12.763866 21.197965) (xy -12.596668 21.699091) (xy -12.425701 22.144847) (xy -12.245187 22.55277) (xy -12.088157 22.867207) (xy -11.871916 23.237605) (xy -11.656194 23.500458) (xy -11.414366 23.672285) (xy -11.119807 23.769607) (xy -10.745891 23.808944) (xy -10.565193 23.812146) (xy -9.807907 23.761958) (xy -9.038748 23.608448) (xy -8.251588 23.348972) (xy -7.440296 22.980886) (xy -6.598743 22.501543) (xy -5.720799 21.9083) (xy -5.1435 21.472731) (xy -4.762102 21.186965) (xy -4.413406 20.950608) (xy -4.111041 20.77135) (xy -3.868634 20.656879) (xy -3.699814 20.614885) (xy -3.642549 20.625864) (xy -3.544521 20.717713) (xy -3.388237 20.91352) (xy -3.178193 21.206835) (xy -2.91889 21.591203) (xy -2.614824 22.060173) (xy -2.3495 22.480506) (xy -1.834603 23.297465) (xy -1.374238 24.010819) (xy -0.961614 24.628178) (xy -0.589942 25.157153) (xy -0.252429 25.605352) (xy 0.057714 25.980385) (xy 0.347279 26.289861) (xy 0.623055 26.541392) (xy 0.891834 26.742584) (xy 1.160406 26.90105) (xy 1.435563 27.024397) (xy 1.724094 27.120236) (xy 1.812388 27.14427) (xy 2.333266 27.231978) (xy 2.873912 27.23721) (xy 3.410133 27.16612)) (layer B.SilkS) (width 0.01)) (fp_poly (pts (xy 6.456307 -4.66739) (xy 6.876448 -4.720313) (xy 7.302739 -4.809144) (xy 7.699177 -4.927306) (xy 8.029755 -5.068225) (xy 8.127831 -5.124602) (xy 8.223095 -5.198005) (xy 8.37637 -5.329858) (xy 8.565445 -5.49948) (xy 8.768111 -5.686192) (xy 8.962157 -5.869315) (xy 9.125373 -6.028168) (xy 9.235548 -6.142073) (xy 9.271 -6.188979) (xy 9.216021 -6.17479) (xy 9.067848 -6.123437) (xy 8.851622 -6.04386) (xy 8.683625 -5.980135) (xy 8.373013 -5.867756) (xy 8.125586 -5.79922) (xy 7.889736 -5.764043) (xy 7.613856 -5.751741) (xy 7.5565 -5.75115) (xy 7.25667 -5.756119) (xy 7.042367 -5.780585) (xy 6.872748 -5.831389) (xy 6.76275 -5.884116) (xy 6.400814 -6.140877) (xy 6.147945 -6.46237) (xy 6.004299 -6.847997) (xy 5.970032 -7.297163) (xy 6.045303 -7.809269) (xy 6.157069 -8.187229) (xy 6.404096 -8.763394) (xy 6.71414 -9.268077) (xy 7.076021 -9.69112) (xy 7.47856 -10.022362) (xy 7.910574 -10.251643) (xy 8.360886 -10.368803) (xy 8.5725 -10.38225) (xy 8.953065 -10.342642) (xy 9.279588 -10.217601) (xy 9.562677 -9.997802) (xy 9.812942 -9.67392) (xy 10.040991 -9.236629) (xy 10.136357 -9.007602) (xy 10.225099 -8.797076) (xy 10.301938 -8.642577) (xy 10.351966 -8.573641) (xy 10.355961 -8.5725) (xy 10.390018 -8.630174) (xy 10.442276 -8.78548) (xy 10.504458 -9.01184) (xy 10.545315 -9.180328) (xy 10.653231 -9.902259) (xy 10.6435 -10.633176) (xy 10.515034 -11.380787) (xy 10.266746 -12.152798) (xy 10.058463 -12.633767) (xy 9.740474 -13.229938) (xy 9.396826 -13.732366) (xy 9.034953 -14.132922) (xy 8.66229 -14.423478) (xy 8.286272 -14.595906) (xy 8.255976 -14.604432) (xy 7.862962 -14.675815) (xy 7.434244 -14.699366) (xy 7.041181 -14.671591) (xy 7.005468 -14.665658) (xy 6.346533 -14.486958) (xy 5.719503 -14.197214) (xy 5.142901 -13.810282) (xy 4.635249 -13.340016) (xy 4.215071 -12.800271) (xy 3.995426 -12.41425) (xy 3.768923 -11.888954) (xy 3.608182 -11.355752) (xy 3.54482 -11.00216) (xy 5.790772 -11.00216) (xy 5.792797 -11.194015) (xy 5.870784 -11.395287) (xy 5.91427 -11.458477) (xy 6.126118 -11.646347) (xy 6.372258 -11.737258) (xy 6.62082 -11.724211) (xy 6.78037 -11.648649) (xy 6.889798 -11.501603) (xy 6.922438 -11.296002) (xy 6.872413 -11.078648) (xy 6.856117 -11.045482) (xy 6.705594 -10.886003) (xy 6.482491 -10.7851) (xy 6.230768 -10.750883) (xy 5.994388 -10.791463) (xy 5.868083 -10.863202) (xy 5.790772 -11.00216) (xy 3.54482 -11.00216) (xy 3.504645 -10.777964) (xy 3.449756 -10.11891) (xy 3.447344 -10.06475) (xy 3.453719 -9.126797) (xy 3.558014 -8.25386) (xy 3.764307 -7.425379) (xy 4.076679 -6.620795) (xy 4.169288 -6.426119) (xy 4.384517 -6.045669) (xy 4.644485 -5.675204) (xy 4.930096 -5.335262) (xy 5.222252 -5.04638) (xy 5.501857 -4.829093) (xy 5.749814 -4.703939) (xy 5.7785 -4.695567) (xy 6.078323 -4.65695) (xy 6.456307 -4.66739)) (layer B.SilkS) (width 0.01)) (fp_poly (pts (xy 18.186538 -0.460222) (xy 18.413224 -0.514507) (xy 18.669556 -0.596442) (xy 18.92717 -0.694147) (xy 19.157706 -0.795738) (xy 19.3328 -0.889336) (xy 19.424091 -0.963058) (xy 19.431 -0.981548) (xy 19.37669 -1.04922) (xy 19.238445 -1.131118) (xy 19.141755 -1.172709) (xy 18.875624 -1.316124) (xy 18.583983 -1.540459) (xy 18.300525 -1.81428) (xy 18.058943 -2.106149) (xy 17.936912 -2.296828) (xy 17.791596 -2.677134) (xy 17.756077 -3.097034) (xy 17.830129 -3.566704) (xy 17.903565 -3.81) (xy 18.0813 -4.219852) (xy 18.332469 -4.649616) (xy 18.635758 -5.07283) (xy 18.96985 -5.46303) (xy 19.313429 -5.793753) (xy 19.64518 -6.038536) (xy 19.742394 -6.092885) (xy 19.908575 -6.163769) (xy 20.057703 -6.185089) (xy 20.211297 -6.148212) (xy 20.390876 -6.044507) (xy 20.617959 -5.86534) (xy 20.873265 -5.639223) (xy 21.138488 -5.40169) (xy 21.32871 -5.242521) (xy 21.460413 -5.151992) (xy 21.550081 -5.12038) (xy 21.614198 -5.13796) (xy 21.65557 -5.177745) (xy 21.767781 -5.404731) (xy 21.813026 -5.717491) (xy 21.797807 -6.098201) (xy 21.728621 -6.529038) (xy 21.611968 -6.99218) (xy 21.454346 -7.469804) (xy 21.262256 -7.944088) (xy 21.042195 -8.397207) (xy 20.800663 -8.81134) (xy 20.544159 -9.168664) (xy 20.279182 -9.451356) (xy 20.03162 -9.631234) (xy 19.720145 -9.753512) (xy 19.317331 -9.837837) (xy 18.853904 -9.881293) (xy 18.360597 -9.880968) (xy 17.878249 -9.835431) (xy 17.318477 -9.712295) (xy 16.845274 -9.511666) (xy 16.438191 -9.220108) (xy 16.076779 -8.824184) (xy 15.859485 -8.509) (xy 15.53403 -7.882496) (xy 15.28614 -7.176992) (xy 15.218685 -6.873875) (xy 17.200976 -6.873875) (xy 17.226266 -7.11496) (xy 17.345364 -7.279344) (xy 17.544996 -7.35285) (xy 17.649754 -7.353205) (xy 17.801084 -7.328723) (xy 17.863536 -7.266943) (xy 17.87525 -7.145625) (xy 17.835767 -6.975859) (xy 17.7165 -6.876686) (xy 17.543155 -6.816443) (xy 17.371769 -6.7982) (xy 17.244005 -6.822186) (xy 17.200976 -6.873875) (xy 15.218685 -6.873875) (xy 15.116466 -6.414545) (xy 15.025654 -5.617211) (xy 15.014354 -4.807049) (xy 15.083214 -4.006115) (xy 15.232883 -3.236466) (xy 15.464009 -2.520161) (xy 15.670189 -2.070691) (xy 15.956047 -1.621261) (xy 16.304046 -1.227367) (xy 16.695989 -0.900656) (xy 17.11368 -0.652775) (xy 17.538921 -0.495369) (xy 17.953515 -0.440084) (xy 18.186538 -0.460222)) (layer B.SilkS) (width 0.01)) ) (module silkscreens:unsafe_rust locked (layer B.Cu) (tedit 0) (tstamp 5EE0C401) (at 67.89 61.31 170) (attr virtual) (fp_text reference G*** (at 0 0 350) (layer B.SilkS) hide (effects (font (size 1.524 1.524) (thickness 0.3)) (justify mirror)) ) (fp_text value LOGO (at 0.75 0 350) (layer B.SilkS) hide (effects (font (size 1.524 1.524) (thickness 0.3)) (justify mirror)) ) (fp_poly (pts (xy 11.049867 30.490883) (xy 11.170577 30.343542) (xy 11.250573 30.184006) (xy 11.312187 30.025933) (xy 11.347973 29.870078) (xy 11.361813 29.67977) (xy 11.357588 29.418341) (xy 11.349768 29.246631) (xy 11.331222 28.990829) (xy 11.299258 28.727321) (xy 11.250465 28.443286) (xy 11.181429 28.125904) (xy 11.088739 27.762352) (xy 10.968983 27.33981) (xy 10.818748 26.845457) (xy 10.634622 26.266471) (xy 10.413193 25.59003) (xy 10.230099 25.039487) (xy 9.98532 24.300246) (xy 9.780906 23.665372) (xy 9.613375 23.120045) (xy 9.479243 22.649442) (xy 9.375028 22.238741) (xy 9.297247 21.873119) (xy 9.242418 21.537755) (xy 9.207057 21.217827) (xy 9.187683 20.898511) (xy 9.180862 20.574) (xy 9.182249 20.192219) (xy 9.193137 19.912193) (xy 9.215876 19.70888) (xy 9.252818 19.557236) (xy 9.283684 19.478625) (xy 9.406833 19.293071) (xy 9.551309 19.232347) (xy 9.716668 19.296163) (xy 9.902465 19.484229) (xy 10.108255 19.796257) (xy 10.285071 20.131028) (xy 10.46111 20.461457) (xy 10.686212 20.830829) (xy 10.967858 21.249845) (xy 11.313527 21.729205) (xy 11.730702 22.27961) (xy 12.226861 22.911762) (xy 12.24435 22.93374) (xy 12.763869 23.594888) (xy 13.204855 24.175952) (xy 13.575493 24.689636) (xy 13.883965 25.148645) (xy 14.138455 25.565683) (xy 14.347145 25.953452) (xy 14.51822 26.324657) (xy 14.65332 26.673434) (xy 14.794569 27.03683) (xy 14.945093 27.333698) (xy 15.137073 27.622431) (xy 15.277384 27.805746) (xy 15.510009 28.079014) (xy 15.761011 28.339023) (xy 16.009987 28.567984) (xy 16.236533 28.748104) (xy 16.420248 28.861594) (xy 16.52364 28.892461) (xy 16.65411 28.835904) (xy 16.729472 28.670462) (xy 16.747643 28.402651) (xy 16.734634 28.23242) (xy 16.632466 27.605669) (xy 16.460045 26.930157) (xy 16.213572 26.194531) (xy 15.889251 25.387438) (xy 15.489736 24.511) (xy 15.312467 24.132177) (xy 15.150274 23.769893) (xy 15.013193 23.447807) (xy 14.911261 23.189581) (xy 14.854515 23.018873) (xy 14.851424 23.006288) (xy 14.813135 22.805315) (xy 14.813287 22.646115) (xy 14.857322 22.470367) (xy 14.916585 22.307788) (xy 15.010745 21.971939) (xy 15.071407 21.539669) (xy 15.098604 21.006123) (xy 15.092367 20.366446) (xy 15.05273 19.615784) (xy 14.979726 18.749283) (xy 14.942997 18.386306) (xy 14.903195 18.008361) (xy 15.333756 18.481556) (xy 15.658644 18.859675) (xy 16.018222 19.315214) (xy 16.404155 19.834769) (xy 16.808107 20.404936) (xy 17.221743 21.012311) (xy 17.636726 21.64349) (xy 18.044721 22.285069) (xy 18.437392 22.923644) (xy 18.806403 23.545811) (xy 19.143419 24.138165) (xy 19.440104 24.687304) (xy 19.688123 25.179823) (xy 19.879139 25.602317) (xy 20.004817 25.941383) (xy 20.031112 26.035) (xy 20.182957 26.475339) (xy 20.401238 26.878351) (xy 20.668387 27.221165) (xy 20.966836 27.480913) (xy 21.25397 27.626864) (xy 21.415728 27.665743) (xy 21.525692 27.639524) (xy 21.601539 27.581114) (xy 21.666637 27.508879) (xy 21.702349 27.417118) (xy 21.713798 27.273483) (xy 21.706111 27.045629) (xy 21.700769 26.954854) (xy 21.649548 26.558937) (xy 21.538978 26.0941) (xy 21.366428 25.552615) (xy 21.129267 24.926751) (xy 20.824864 24.208777) (xy 20.588062 23.6855) (xy 20.348586 23.163652) (xy 20.158797 22.736555) (xy 20.01345 22.384454) (xy 19.9073 22.087595) (xy 19.835101 21.826225) (xy 19.791609 21.580589) (xy 19.771579 21.330933) (xy 19.769764 21.057502) (xy 19.780921 20.740542) (xy 19.784739 20.660043) (xy 19.800747 20.290792) (xy 19.80571 20.016561) (xy 19.797383 19.805675) (xy 19.77352 19.626459) (xy 19.731874 19.447239) (xy 19.687927 19.294793) (xy 19.549093 18.906295) (xy 19.347949 18.461404) (xy 19.079712 17.951256) (xy 18.739603 17.366986) (xy 18.32284 16.699729) (xy 18.11751 16.383) (xy 17.781651 15.864839) (xy 17.516481 15.443308) (xy 17.318912 15.111663) (xy 17.185855 14.86316) (xy 17.114224 14.691057) (xy 17.10093 14.588608) (xy 17.142886 14.54907) (xy 17.237004 14.565701) (xy 17.296656 14.590214) (xy 17.527151 14.730856) (xy 17.82379 14.970724) (xy 18.181162 15.304121) (xy 18.593855 15.725349) (xy 19.056457 16.228712) (xy 19.563558 16.808513) (xy 20.109745 17.459054) (xy 20.627173 18.096457) (xy 21.268862 18.888685) (xy 21.850738 19.585202) (xy 22.382492 20.196588) (xy 22.873819 20.733425) (xy 23.334411 21.206291) (xy 23.773961 21.625769) (xy 24.202162 22.002437) (xy 24.216837 22.014786) (xy 24.61316 22.332072) (xy 24.933975 22.552591) (xy 25.184351 22.677746) (xy 25.369352 22.708938) (xy 25.494045 22.647569) (xy 25.563497 22.49504) (xy 25.578552 22.391606) (xy 25.546359 22.073661) (xy 25.40479 21.717535) (xy 25.161528 21.334305) (xy 24.824254 20.935048) (xy 24.400652 20.530841) (xy 24.136919 20.312996) (xy 23.975737 20.185611) (xy 23.83577 20.071833) (xy 23.706674 19.960551) (xy 23.578105 19.840658) (xy 23.43972 19.701043) (xy 23.281174 19.530596) (xy 23.092125 19.318208) (xy 22.862228 19.05277) (xy 22.581141 18.723171) (xy 22.238519 18.318303) (xy 21.839904 17.84589) (xy 21.350402 17.261717) (xy 20.941945 16.765444) (xy 20.610145 16.351004) (xy 20.35061 16.012329) (xy 20.158951 15.743351) (xy 20.030779 15.538004) (xy 19.961703 15.390221) (xy 19.947334 15.293934) (xy 19.965749 15.255584) (xy 20.057909 15.246353) (xy 20.209549 15.316953) (xy 20.3971 15.451131) (xy 20.596994 15.632635) (xy 20.740896 15.790115) (xy 21.011829 16.104418) (xy 21.251092 16.36466) (xy 21.446389 16.558461) (xy 21.585421 16.67344) (xy 21.645144 16.700501) (xy 21.7128 16.670197) (xy 21.705911 16.576528) (xy 21.621575 16.415355) (xy 21.456887 16.182542) (xy 21.208942 15.87395) (xy 20.874837 15.485442) (xy 20.491091 15.05633) (xy 20.102773 14.621993) (xy 19.715912 14.17836) (xy 19.339728 13.736938) (xy 18.983444 13.309232) (xy 18.65628 12.906749) (xy 18.367459 12.540994) (xy 18.126203 12.223474) (xy 17.941733 11.965695) (xy 17.823271 11.779162) (xy 17.780038 11.675382) (xy 17.78 11.673663) (xy 17.82608 11.621447) (xy 17.951931 11.644104) (xy 18.138968 11.736164) (xy 18.263494 11.815985) (xy 18.531661 12.023473) (xy 18.863147 12.317564) (xy 19.243869 12.684172) (xy 19.659748 13.10921) (xy 20.096699 13.578593) (xy 20.540642 14.078235) (xy 20.639079 14.19225) (xy 20.916511 14.512742) (xy 21.182294 14.815051) (xy 21.419582 15.08038) (xy 21.611533 15.289927) (xy 21.741303 15.424892) (xy 21.757153 15.440188) (xy 21.992775 15.645198) (xy 22.227226 15.819243) (xy 22.432731 15.943827) (xy 22.581512 16.000451) (xy 22.600777 16.002001) (xy 22.744459 16.03609) (xy 22.965061 16.128731) (xy 23.235572 16.265485) (xy 23.528983 16.431911) (xy 23.818285 16.61357) (xy 24.053444 16.77862) (xy 24.755378 17.335518) (xy 25.401256 17.908846) (xy 25.963243 18.473463) (xy 26.111196 18.63725) (xy 26.499962 19.122055) (xy 26.799536 19.602384) (xy 27.021117 20.106286) (xy 27.175905 20.66181) (xy 27.275099 21.297006) (xy 27.305511 21.628529) (xy 27.340348 22.006779) (xy 27.383861 22.2755) (xy 27.443838 22.452158) (xy 27.528069 22.55422) (xy 27.644342 22.599154) (xy 27.741379 22.606) (xy 27.964604 22.547297) (xy 28.188129 22.38655) (xy 28.390305 22.146803) (xy 28.549483 21.851103) (xy 28.607854 21.683656) (xy 28.672909 21.474711) (xy 28.732597 21.315209) (xy 28.767881 21.248575) (xy 28.846102 21.215247) (xy 28.976407 21.239417) (xy 29.17064 21.326398) (xy 29.440648 21.481507) (xy 29.798275 21.710058) (xy 29.802457 21.712814) (xy 30.079011 21.892774) (xy 30.336372 22.056106) (xy 30.545712 22.184772) (xy 30.6778 22.260526) (xy 30.817909 22.325941) (xy 30.895583 22.327464) (xy 30.958951 22.263691) (xy 30.967522 22.252074) (xy 31.03467 22.141293) (xy 31.0515 22.089998) (xy 30.999017 21.908126) (xy 30.84705 21.668263) (xy 30.603817 21.379709) (xy 30.277539 21.05177) (xy 29.876437 20.693746) (xy 29.65683 20.511578) (xy 29.187762 20.11988) (xy 28.821179 19.787746) (xy 28.551138 19.508615) (xy 28.371694 19.275927) (xy 28.276906 19.083123) (xy 28.257737 18.967385) (xy 28.3163 18.858821) (xy 28.473785 18.76561) (xy 28.702189 18.698812) (xy 28.973508 18.669486) (xy 29.013326 18.669001) (xy 29.340059 18.645067) (xy 29.550718 18.573813) (xy 29.644512 18.45606) (xy 29.620648 18.29263) (xy 29.523897 18.139093) (xy 29.428738 18.049428) (xy 29.247615 17.905873) (xy 29.001074 17.723712) (xy 28.70966 17.518228) (xy 28.472731 17.357147) (xy 28.007938 17.036918) (xy 27.651294 16.769835) (xy 27.397752 16.551466) (xy 27.242264 16.377379) (xy 27.17978 16.243142) (xy 27.178 16.220469) (xy 27.234411 16.126475) (xy 27.375678 16.054605) (xy 27.559854 16.019945) (xy 27.709948 16.029157) (xy 27.92509 16.098771) (xy 28.210457 16.22916) (xy 28.535267 16.404111) (xy 28.868739 16.607413) (xy 29.083 16.752345) (xy 29.625359 17.131596) (xy 30.080617 17.437398) (xy 30.460699 17.675817) (xy 30.777529 17.852922) (xy 31.043034 17.974778) (xy 31.269137 18.047452) (xy 31.467764 18.077011) (xy 31.65084 18.069522) (xy 31.66747 18.067162) (xy 31.872915 18.014578) (xy 32.045627 17.934722) (xy 32.074336 17.914234) (xy 32.171407 17.781127) (xy 32.161855 17.622273) (xy 32.043173 17.435089) (xy 31.812852 17.216989) (xy 31.468387 16.965387) (xy 31.007269 16.677699) (xy 30.708878 16.506433) (xy 29.857227 16.02046) (xy 29.108435 15.573469) (xy 28.448189 15.155459) (xy 27.862173 14.756433) (xy 27.336073 14.366391) (xy 26.855573 13.975333) (xy 26.40636 13.573261) (xy 26.133971 13.310785) (xy 25.603351 12.747759) (xy 25.19003 12.224594) (xy 24.891744 11.738332) (xy 24.82536 11.601433) (xy 24.753943 11.390589) (xy 24.713051 11.161791) (xy 24.705377 10.953779) (xy 24.73361 10.805292) (xy 24.76706 10.761977) (xy 24.870221 10.764966) (xy 25.0668 10.835956) (xy 25.346467 10.969704) (xy 25.698891 11.160964) (xy 26.113743 11.404489) (xy 26.484897 11.634218) (xy 26.974031 11.939397) (xy 27.367509 12.175497) (xy 27.673652 12.346367) (xy 27.900777 12.455856) (xy 28.057203 12.507811) (xy 28.15125 12.506083) (xy 28.191236 12.454519) (xy 28.194 12.424924) (xy 28.169536 12.338485) (xy 28.102428 12.159908) (xy 28.002097 11.912889) (xy 27.877966 11.621126) (xy 27.83779 11.529088) (xy 27.667563 11.121728) (xy 27.540523 10.776238) (xy 27.460003 10.504481) (xy 27.429332 10.318316) (xy 27.451841 10.229606) (xy 27.471264 10.223738) (xy 27.576308 10.259277) (xy 27.748044 10.368292) (xy 27.992498 10.555317) (xy 28.315694 10.824886) (xy 28.60675 11.078106) (xy 29.031731 11.438476) (xy 29.449427 11.766388) (xy 29.844221 12.051303) (xy 30.200495 12.282686) (xy 30.502632 12.450001) (xy 30.735017 12.542711) (xy 30.796547 12.555526) (xy 30.973913 12.563326) (xy 31.045289 12.523533) (xy 31.009175 12.433852) (xy 30.864067 12.291987) (xy 30.608465 12.095641) (xy 30.400625 11.950169) (xy 29.778844 11.501452) (xy 29.249692 11.064644) (xy 28.784267 10.614783) (xy 28.526489 10.331566) (xy 28.297106 10.049913) (xy 28.108733 9.783742) (xy 27.973028 9.552728) (xy 27.901648 9.376546) (xy 27.903055 9.279406) (xy 27.976295 9.254939) (xy 28.141579 9.274331) (xy 28.402556 9.338747) (xy 28.762872 9.449348) (xy 29.226179 9.607297) (xy 29.796123 9.813759) (xy 30.476353 10.069897) (xy 30.929085 10.244087) (xy 31.544847 10.480794) (xy 32.054328 10.671769) (xy 32.468632 10.819753) (xy 32.798865 10.927485) (xy 33.056131 10.997705) (xy 33.251535 11.033152) (xy 33.396183 11.036567) (xy 33.501179 11.010688) (xy 33.577628 10.958256) (xy 33.619649 10.907871) (xy 33.705838 10.692733) (xy 33.692917 10.426526) (xy 33.579808 10.098204) (xy 33.530293 9.99415) (xy 33.28892 9.58622) (xy 32.966157 9.171311) (xy 32.553354 8.740655) (xy 32.041858 8.28548) (xy 31.423017 7.797019) (xy 31.1981 7.630196) (xy 30.897384 7.395643) (xy 30.647936 7.172672) (xy 30.465663 6.977449) (xy 30.366472 6.826143) (xy 30.353 6.771271) (xy 30.412362 6.664279) (xy 30.576097 6.581244) (xy 30.822681 6.529439) (xy 31.109459 6.515693) (xy 31.646469 6.585475) (xy 32.185081 6.778173) (xy 32.706519 7.079186) (xy 32.998974 7.269563) (xy 33.28663 7.43485) (xy 33.588048 7.581964) (xy 33.921788 7.717821) (xy 34.306411 7.849338) (xy 34.760477 7.983432) (xy 35.302547 8.12702) (xy 35.941 8.284567) (xy 36.349283 8.38775) (xy 36.825687 8.515723) (xy 37.31758 8.653933) (xy 37.77233 8.787829) (xy 37.87775 8.820067) (xy 38.326123 8.956656) (xy 38.668428 9.055498) (xy 38.919067 9.119032) (xy 39.092445 9.149697) (xy 39.202967 9.149933) (xy 39.265038 9.122179) (xy 39.293062 9.068873) (xy 39.294982 9.060059) (xy 39.259607 8.913068) (xy 39.104084 8.734679) (xy 38.830921 8.526426) (xy 38.442627 8.28984) (xy 37.94171 8.026456) (xy 37.330679 7.737806) (xy 36.6395 7.436959) (xy 35.961199 7.130484) (xy 35.341337 6.808262) (xy 34.789873 6.477576) (xy 34.316765 6.145712) (xy 33.931973 5.819955) (xy 33.645457 5.50759) (xy 33.467175 5.215901) (xy 33.422608 5.083852) (xy 33.359224 4.923214) (xy 33.237966 4.772494) (xy 33.041855 4.617355) (xy 32.753913 4.44346) (xy 32.512 4.314881) (xy 32.233781 4.164609) (xy 31.974005 4.011528) (xy 31.769318 3.877843) (xy 31.6865 3.814734) (xy 31.46425 3.624662) (xy 31.685634 3.622081) (xy 31.806205 3.641376) (xy 32.027307 3.696968) (xy 32.329603 3.783186) (xy 32.69376 3.894359) (xy 33.100442 4.024816) (xy 33.408729 4.1275) (xy 33.948116 4.307579) (xy 34.378516 4.445405) (xy 34.70982 4.543407) (xy 34.951922 4.604015) (xy 35.114715 4.629656) (xy 35.208091 4.622759) (xy 35.241944 4.585754) (xy 35.2425 4.577693) (xy 35.185181 4.504317) (xy 35.015185 4.380109) (xy 34.735449 4.206792) (xy 34.348913 3.986087) (xy 33.858515 3.719716) (xy 33.267193 3.409401) (xy 33.108991 3.327757) (xy 32.464597 2.991705) (xy 31.931564 2.70357) (xy 31.504974 2.460191) (xy 31.179911 2.258411) (xy 30.951457 2.095071) (xy 30.814697 1.967012) (xy 30.764713 1.871076) (xy 30.774176 1.827867) (xy 30.83468 1.761844) (xy 30.930001 1.720068) (xy 31.075465 1.702976) (xy 31.286401 1.711005) (xy 31.578138 1.744593) (xy 31.966002 1.804179) (xy 32.370574 1.873455) (xy 32.975018 1.981799) (xy 33.468199 2.075083) (xy 33.864512 2.156654) (xy 34.178356 2.229857) (xy 34.424125 2.298037) (xy 34.616216 2.364539) (xy 34.761867 2.429092) (xy 34.96538 2.511667) (xy 35.22987 2.582818) (xy 35.567859 2.644348) (xy 35.991871 2.698062) (xy 36.514431 2.745763) (xy 37.148061 2.789257) (xy 37.340374 2.800545) (xy 37.754075 2.82099) (xy 38.22041 2.838738) (xy 38.723634 2.853676) (xy 39.248006 2.865693) (xy 39.777781 2.874678) (xy 40.297217 2.880519) (xy 40.79057 2.883104) (xy 41.242097 2.882322) (xy 41.636056 2.878062) (xy 41.956701 2.870211) (xy 42.188292 2.858658) (xy 42.315084 2.843292) (xy 42.333051 2.835934) (xy 42.329796 2.761201) (xy 42.218128 2.651757) (xy 42.00939 2.515168) (xy 41.714925 2.359001) (xy 41.402 2.214905) (xy 40.828205 1.957589) (xy 40.361141 1.728604) (xy 39.986375 1.518219) (xy 39.689475 1.316704) (xy 39.456009 1.114327) (xy 39.271545 0.901358) (xy 39.130088 0.683091) (xy 39.007289 0.483906) (xy 38.888394 0.319517) (xy 38.822139 0.247153) (xy 38.698913 0.17877) (xy 38.478357 0.09156) (xy 38.187306 -0.006612) (xy 37.852593 -0.107882) (xy 37.501053 -0.204383) (xy 37.159519 -0.288252) (xy 36.854825 -0.351623) (xy 36.68851 -0.378194) (xy 36.474322 -0.402347) (xy 36.161235 -0.432256) (xy 35.777087 -0.46553) (xy 35.349719 -0.49978) (xy 34.906968 -0.532614) (xy 34.81526 -0.539062) (xy 34.031014 -0.602132) (xy 33.363623 -0.674908) (xy 32.80318 -0.759387) (xy 32.339774 -0.857564) (xy 31.963497 -0.971437) (xy 31.664438 -1.103001) (xy 31.493544 -1.208248) (xy 31.35502 -1.350062) (xy 31.304502 -1.496519) (xy 31.345378 -1.616637) (xy 31.44281 -1.672095) (xy 31.5926 -1.678794) (xy 31.851497 -1.652824) (xy 32.206493 -1.5964) (xy 32.644581 -1.511732) (xy 33.152752 -1.401036) (xy 33.4645 -1.328164) (xy 34.144215 -1.172765) (xy 34.716773 -1.059485) (xy 35.194956 -0.988683) (xy 35.591546 -0.960722) (xy 35.919325 -0.975961) (xy 36.191073 -1.034763) (xy 36.419575 -1.137487) (xy 36.61761 -1.284496) (xy 36.751169 -1.420991) (xy 36.90775 -1.648059) (xy 36.947446 -1.851679) (xy 36.87242 -2.052634) (xy 36.823997 -2.120458) (xy 36.671419 -2.270847) (xy 36.457176 -2.402198) (xy 36.162403 -2.52309) (xy 35.768236 -2.642104) (xy 35.558269 -2.696131) (xy 35.279555 -2.769645) (xy 35.042581 -2.840571) (xy 34.877556 -2.899385) (xy 34.82042 -2.928743) (xy 34.740396 -3.041729) (xy 34.784479 -3.14744) (xy 34.954024 -3.248618) (xy 34.98485 -3.26138) (xy 35.190138 -3.331103) (xy 35.435642 -3.389073) (xy 35.737624 -3.437288) (xy 36.112351 -3.477744) (xy 36.576087 -3.512437) (xy 37.145096 -3.543365) (xy 37.362429 -3.553246) (xy 37.76628 -3.573757) (xy 38.125789 -3.597472) (xy 38.421544 -3.622677) (xy 38.634136 -3.647658) (xy 38.744156 -3.670703) (xy 38.753464 -3.676064) (xy 38.758262 -3.760359) (xy 38.662641 -3.90879) (xy 38.586159 -3.997892) (xy 38.457171 -4.149302) (xy 38.372877 -4.264812) (xy 38.354 -4.30575) (xy 38.388522 -4.395219) (xy 38.474896 -4.546048) (xy 38.587334 -4.719092) (xy 38.700048 -4.87521) (xy 38.787249 -4.975255) (xy 38.803272 -4.987699) (xy 38.968307 -5.051788) (xy 39.215736 -5.086601) (xy 39.556758 -5.092485) (xy 40.002573 -5.069789) (xy 40.385366 -5.036853) (xy 41.050626 -4.983852) (xy 41.601098 -4.965672) (xy 42.044411 -4.983321) (xy 42.388193 -5.037809) (xy 42.640072 -5.130146) (xy 42.807678 -5.26134) (xy 42.87426 -5.366203) (xy 42.898788 -5.552117) (xy 42.799565 -5.724161) (xy 42.579412 -5.878885) (xy 42.385888 -5.963681) (xy 42.175911 -6.035662) (xy 42.001969 -6.08374) (xy 41.923492 -6.09605) (xy 41.758728 -6.133287) (xy 41.526937 -6.233244) (xy 41.259578 -6.378457) (xy 40.988111 -6.551464) (xy 40.743996 -6.734798) (xy 40.690695 -6.780404) (xy 40.443434 -6.978708) (xy 40.225707 -7.100904) (xy 39.992195 -7.172722) (xy 39.842958 -7.193158) (xy 39.58614 -7.215333) (xy 39.241125 -7.238124) (xy 38.8273 -7.260405) (xy 38.364049 -7.281054) (xy 37.87076 -7.298946) (xy 37.75075 -7.302685) (xy 36.982766 -7.330144) (xy 36.327618 -7.363508) (xy 35.771219 -7.404193) (xy 35.299484 -7.453622) (xy 34.898327 -7.513212) (xy 34.553663 -7.584383) (xy 34.314608 -7.648961) (xy 34.046225 -7.752046) (xy 33.830154 -7.877295) (xy 33.692067 -8.007081) (xy 33.655 -8.101792) (xy 33.714564 -8.211109) (xy 33.878989 -8.323163) (xy 34.126875 -8.427022) (xy 34.436821 -8.511755) (xy 34.47184 -8.519046) (xy 34.736791 -8.555256) (xy 35.102439 -8.580639) (xy 35.542953 -8.595271) (xy 36.032498 -8.599226) (xy 36.545243 -8.592581) (xy 37.055352 -8.57541) (xy 37.536995 -8.547789) (xy 37.964336 -8.509793) (xy 37.973 -8.508833) (xy 38.406006 -8.46914) (xy 38.869665 -8.441308) (xy 39.340921 -8.425308) (xy 39.796718 -8.421107) (xy 40.213998 -8.428675) (xy 40.569705 -8.447981) (xy 40.840784 -8.478994) (xy 40.983054 -8.512882) (xy 41.209976 -8.626544) (xy 41.319102 -8.751815) (xy 41.318623 -8.884294) (xy 41.21673 -9.019583) (xy 41.021612 -9.153281) (xy 40.741463 -9.280988) (xy 40.384471 -9.398305) (xy 39.958828 -9.500832) (xy 39.472725 -9.584169) (xy 38.934353 -9.643916) (xy 38.867603 -9.649217) (xy 38.266397 -9.71616) (xy 37.752279 -9.817398) (xy 37.338 -9.949774) (xy 37.05225 -10.098915) (xy 36.596989 -10.368808) (xy 36.088018 -10.58354) (xy 35.505952 -10.749171) (xy 34.831404 -10.87176) (xy 34.417 -10.922712) (xy 33.960564 -10.978565) (xy 33.567344 -11.041591) (xy 33.251477 -11.108553) (xy 33.027099 -11.176213) (xy 32.908348 -11.241333) (xy 32.893 -11.27173) (xy 32.955365 -11.403908) (xy 33.138111 -11.539249) (xy 33.434717 -11.675993) (xy 33.838658 -11.812377) (xy 34.343412 -11.946638) (xy 34.942456 -12.077015) (xy 35.629268 -12.201746) (xy 36.397324 -12.319069) (xy 37.11575 -12.412444) (xy 37.754738 -12.492829) (xy 38.277627 -12.566703) (xy 38.695024 -12.636165) (xy 39.017539 -12.703312) (xy 39.255778 -12.770246) (xy 39.420351 -12.839065) (xy 39.487706 -12.881795) (xy 39.603283 -13.034046) (xy 39.683071 -13.25698) (xy 39.713823 -13.496295) (xy 39.68504 -13.690719) (xy 39.658678 -13.747492) (xy 39.617683 -13.792952) (xy 39.54692 -13.8299) (xy 39.431253 -13.86114) (xy 39.255547 -13.889475) (xy 39.004667 -13.917707) (xy 38.663476 -13.948638) (xy 38.21684 -13.985071) (xy 38.00475 -14.001854) (xy 37.354131 -14.053456) (xy 36.819002 -14.096702) (xy 36.388203 -14.132667) (xy 36.050573 -14.162428) (xy 35.794954 -14.18706) (xy 35.610185 -14.20764) (xy 35.485107 -14.225243) (xy 35.408559 -14.240945) (xy 35.369383 -14.255822) (xy 35.369178 -14.255948) (xy 35.326086 -14.328707) (xy 35.406431 -14.415896) (xy 35.607549 -14.516863) (xy 35.926777 -14.630954) (xy 36.361449 -14.757517) (xy 36.908902 -14.895898) (xy 37.566472 -15.045444) (xy 38.331496 -15.205503) (xy 39.201308 -15.37542) (xy 40.173245 -15.554542) (xy 41.244644 -15.742218) (xy 41.8465 -15.844026) (xy 42.59972 -15.979812) (xy 43.229451 -16.11531) (xy 43.739189 -16.252204) (xy 44.132429 -16.392178) (xy 44.412668 -16.536916) (xy 44.5834 -16.688101) (xy 44.648122 -16.847417) (xy 44.610328 -17.016547) (xy 44.529375 -17.136218) (xy 44.439864 -17.203815) (xy 44.286567 -17.264558) (xy 44.062855 -17.319034) (xy 43.762102 -17.36783) (xy 43.377679 -17.411536) (xy 42.90296 -17.450737) (xy 42.331316 -17.486023) (xy 41.65612 -17.517981) (xy 40.870745 -17.547198) (xy 39.968563 -17.574262) (xy 39.4335 -17.588115) (xy 38.473989 -17.613551) (xy 37.633908 -17.639903) (xy 36.905683 -17.66791) (xy 36.281744 -17.698309) (xy 35.754519 -17.731838) (xy 35.316438 -17.769235) (xy 34.959927 -17.811236) (xy 34.677417 -17.858581) (xy 34.461336 -17.912006) (xy 34.304112 -17.972248) (xy 34.198174 -18.040047) (xy 34.143176 -18.103546) (xy 34.097266 -18.282341) (xy 34.175885 -18.464035) (xy 34.376623 -18.647496) (xy 34.697075 -18.831596) (xy 35.134832 -19.015204) (xy 35.687485 -19.197189) (xy 36.352628 -19.376421) (xy 37.127853 -19.55177) (xy 37.30625 -19.588366) (xy 37.990717 -19.728751) (xy 38.559492 -19.850723) (xy 39.022158 -19.956724) (xy 39.388299 -20.049197) (xy 39.667499 -20.130585) (xy 39.869341 -20.20333) (xy 40.003408 -20.269876) (xy 40.01862 -20.279713) (xy 40.188136 -20.423104) (xy 40.239161 -20.555925) (xy 40.176543 -20.697896) (xy 40.133689 -20.748057) (xy 40.045826 -20.828501) (xy 39.938783 -20.892892) (xy 39.798649 -20.942797) (xy 39.611514 -20.979784) (xy 39.363467 -21.005418) (xy 39.040598 -21.021267) (xy 38.628998 -21.028898) (xy 38.114756 -21.029878) (xy 37.6555 -21.027207) (xy 37.005177 -21.024771) (xy 36.463374 -21.029011) (xy 36.011754 -21.040527) (xy 35.631983 -21.05992) (xy 35.305725 -21.087792) (xy 35.1155 -21.110496) (xy 34.711742 -21.159119) (xy 34.327161 -21.192512) (xy 33.947379 -21.209409) (xy 33.558018 -21.208543) (xy 33.144701 -21.188647) (xy 32.693048 -21.148454) (xy 32.188683 -21.086699) (xy 31.617227 -21.002115) (xy 30.964303 -20.893434) (xy 30.215532 -20.759392) (xy 29.4005 -20.607059) (xy 28.314319 -20.404245) (xy 27.350129 -20.230806) (xy 26.506418 -20.086525) (xy 25.781673 -19.971186) (xy 25.174379 -19.884572) (xy 24.683025 -19.826465) (xy 24.306097 -19.796651) (xy 24.042082 -19.794911) (xy 23.894975 -19.818879) (xy 23.850293 -19.854222) (xy 23.898633 -19.903916) (xy 24.053022 -19.980325) (xy 24.075484 -19.990212) (xy 24.410907 -20.119829) (xy 24.844475 -20.257708) (xy 25.380489 -20.404877) (xy 26.023251 -20.562367) (xy 26.777062 -20.731204) (xy 27.646222 -20.912417) (xy 28.635034 -21.107034) (xy 29.179276 -21.210371) (xy 29.955226 -21.361778) (xy 30.686492 -21.515528) (xy 31.365378 -21.6693) (xy 31.984189 -21.820771) (xy 32.535229 -21.96762) (xy 33.010805 -22.107527) (xy 33.403219 -22.23817) (xy 33.704777 -22.357227) (xy 33.907784 -22.462377) (xy 34.004544 -22.551298) (xy 33.987363 -22.62167) (xy 33.940495 -22.646634) (xy 33.820177 -22.663539) (xy 33.592758 -22.66862) (xy 33.277486 -22.662908) (xy 32.893607 -22.64743) (xy 32.46037 -22.623216) (xy 31.99702 -22.591295) (xy 31.522805 -22.552696) (xy 31.056973 -22.508448) (xy 30.76575 -22.47691) (xy 29.611947 -22.332681) (xy 28.526351 -22.170306) (xy 27.450506 -21.980897) (xy 27.2415 -21.94095) (xy 26.927096 -21.881183) (xy 26.639548 -21.82981) (xy 26.365907 -21.786002) (xy 26.093222 -21.748932) (xy 25.808543 -21.717771) (xy 25.498919 -21.691691) (xy 25.1514 -21.669863) (xy 24.753037 -21.651459) (xy 24.290877 -21.635651) (xy 23.751973 -21.62161) (xy 23.123372 -21.608508) (xy 22.392125 -21.595517) (xy 21.6535 -21.583519) (xy 20.83094 -21.570413) (xy 20.126174 -21.559153) (xy 19.530005 -21.549759) (xy 19.033238 -21.542254) (xy 18.62668 -21.536661) (xy 18.301136 -21.533003) (xy 18.04741 -21.531301) (xy 17.856309 -21.531577) (xy 17.718637 -21.533855) (xy 17.6252 -21.538156) (xy 17.566804 -21.544504) (xy 17.534253 -21.552919) (xy 17.518352 -21.563425) (xy 17.509908 -21.576044) (xy 17.499726 -21.590799) (xy 17.497054 -21.593628) (xy 17.468141 -21.683502) (xy 17.445808 -21.870889) (xy 17.432858 -22.12636) (xy 17.43075 -22.289458) (xy 17.427722 -22.613562) (xy 17.406227 -22.843423) (xy 17.347644 -22.995233) (xy 17.233355 -23.085182) (xy 17.04474 -23.12946) (xy 16.763179 -23.144257) (xy 16.445996 -23.14575) (xy 16.071134 -23.142815) (xy 15.803475 -23.122181) (xy 15.623225 -23.066098) (xy 15.510586 -22.95682) (xy 15.445762 -22.776598) (xy 15.408957 -22.507684) (xy 15.384791 -22.19435) (xy 15.33525 -21.496951) (xy 14.946212 -21.9721) (xy 14.743573 -22.209339) (xy 14.519154 -22.455501) (xy 14.291615 -22.692045) (xy 14.079614 -22.900432) (xy 13.901809 -23.062121) (xy 13.776859 -23.158571) (xy 13.733141 -23.1775) (xy 13.655326 -23.14593) (xy 13.485282 -23.057402) (xy 13.239145 -22.921181) (xy 12.933051 -22.746536) (xy 12.583136 -22.542733) (xy 12.205535 -22.319041) (xy 11.816385 -22.084728) (xy 11.59158 -21.94751) (xy 11.250223 -21.741931) (xy 10.996712 -21.607618) (xy 10.812038 -21.547203) (xy 10.67719 -21.563319) (xy 10.573158 -21.658597) (xy 10.48093 -21.835671) (xy 10.381496 -22.097173) (xy 10.374739 -22.116015) (xy 10.193905 -22.588619) (xy 10.030714 -22.944632) (xy 9.880614 -23.192509) (xy 9.73905 -23.340707) (xy 9.702568 -23.364242) (xy 9.587323 -23.415544) (xy 9.477897 -23.415016) (xy 9.322478 -23.359042) (xy 9.265424 -23.333735) (xy 8.895993 -23.105828) (xy 8.581407 -22.792654) (xy 8.346876 -22.424531) (xy 8.228263 -22.086357) (xy 8.144977 -21.925261) (xy 8.002885 -21.866264) (xy 7.826595 -21.915698) (xy 7.755244 -21.964641) (xy 7.529424 -22.136625) (xy 7.345989 -22.243648) (xy 7.154608 -22.307539) (xy 6.90495 -22.350128) (xy 6.85017 -22.357187) (xy 6.517058 -22.419724) (xy 6.298291 -22.512513) (xy 6.183535 -22.641633) (xy 6.1595 -22.763522) (xy 6.115036 -22.901175) (xy 6.007543 -23.044047) (xy 6.002527 -23.048829) (xy 5.803284 -23.155497) (xy 5.522574 -23.195377) (xy 5.184325 -23.172543) (xy 4.812462 -23.091072) (xy 4.430909 -22.955039) (xy 4.063594 -22.768519) (xy 3.954713 -22.699995) (xy 3.710043 -22.518483) (xy 3.534635 -22.33087) (xy 3.400106 -22.098075) (xy 3.278071 -21.781022) (xy 3.27025 -21.757634) (xy 3.1723 -21.505887) (xy 3.086755 -21.374668) (xy 3.015523 -21.365719) (xy 2.961702 -21.476278) (xy 2.93868 -21.639681) (xy 2.926107 -21.89454) (xy 2.923545 -22.205779) (xy 2.930561 -22.538322) (xy 2.946719 -22.857092) (xy 2.971585 -23.127012) (xy 2.98319 -23.20925) (xy 3.009268 -23.353552) (xy 3.043123 -23.482268) (xy 3.091994 -23.59669) (xy 3.163121 -23.698114) (xy 3.263744 -23.787832) (xy 3.401103 -23.867139) (xy 3.582437 -23.937329) (xy 3.814986 -23.999697) (xy 4.10599 -24.055536) (xy 4.462688 -24.10614) (xy 4.892321 -24.152804) (xy 5.402128 -24.196822) (xy 5.999348 -24.239487) (xy 6.691222 -24.282094) (xy 7.484989 -24.325937) (xy 8.387889 -24.372311) (xy 9.407162 -24.422508) (xy 9.906 -24.446702) (xy 11.41578 -24.521342) (xy 12.803163 -24.593325) (xy 14.072712 -24.662995) (xy 15.228993 -24.730696) (xy 16.276573 -24.796774) (xy 17.220017 -24.861571) (xy 18.063891 -24.925434) (xy 18.81276 -24.988705) (xy 19.471191 -25.051729) (xy 20.043748 -25.114852) (xy 20.534998 -25.178417) (xy 20.949506 -25.242768) (xy 21.271907 -25.303998) (xy 21.581946 -25.381823) (xy 21.872245 -25.476422) (xy 22.119789 -25.577762) (xy 22.301565 -25.675808) (xy 22.394558 -25.760526) (xy 22.400206 -25.795928) (xy 22.327414 -25.849022) (xy 22.168293 -25.900257) (xy 22.029474 -25.927062) (xy 21.908147 -25.935619) (xy 21.668841 -25.943758) (xy 21.320575 -25.951457) (xy 20.872369 -25.958696) (xy 20.333243 -25.96545) (xy 19.712216 -25.971699) (xy 19.018308 -25.977421) (xy 18.260538 -25.982593) (xy 17.447927 -25.987194) (xy 16.589495 -25.991201) (xy 15.69426 -25.994592) (xy 14.771243 -25.997346) (xy 13.829463 -25.999441) (xy 12.877941 -26.000853) (xy 11.925695 -26.001563) (xy 10.981746 -26.001546) (xy 10.055114 -26.000783) (xy 9.154818 -25.999249) (xy 8.289877 -25.996924) (xy 7.469312 -25.993785) (xy 6.702143 -25.989811) (xy 5.997388 -25.984979) (xy 5.364068 -25.979267) (xy 4.811203 -25.972654) (xy 4.60375 -25.96958) (xy 2.807062 -25.940068) (xy 1.0495 -25.909143) (xy -0.664706 -25.876941) (xy -2.331328 -25.843595) (xy -3.946136 -25.80924) (xy -5.5049 -25.774011) (xy -7.003392 -25.738042) (xy -8.437381 -25.701467) (xy -9.802639 -25.66442) (xy -11.094937 -25.627037) (xy -12.310044 -25.589451) (xy -13.443731 -25.551797) (xy -14.49177 -25.51421) (xy -15.44993 -25.476823) (xy -16.313982 -25.439771) (xy -17.079698 -25.403189) (xy -17.742847 -25.367211) (xy -18.2992 -25.331971) (xy -18.744528 -25.297604) (xy -19.074602 -25.264244) (xy -19.285192 -25.232025) (xy -19.363544 -25.207916) (xy -19.431705 -25.157487) (xy -19.431 -25.144564) (xy -19.298407 -25.128238) (xy -19.099001 -25.112766) (xy -18.828679 -25.098083) (xy -18.48334 -25.084121) (xy -18.058879 -25.070815) (xy -17.551196 -25.058099) (xy -16.956186 -25.045906) (xy -16.269747 -25.034171) (xy -15.487777 -25.022825) (xy -14.606173 -25.011805) (xy -13.620832 -25.001042) (xy -12.527652 -24.990471) (xy -11.322529 -24.980026) (xy -10.001362 -24.969641) (xy -8.560047 -24.959248) (xy -7.52475 -24.952246) (xy -6.392336 -24.944496) (xy -5.29064 -24.936429) (xy -4.226721 -24.928119) (xy -3.207642 -24.919644) (xy -2.240463 -24.911078) (xy -1.332245 -24.902498) (xy -0.490049 -24.893979) (xy 0.279063 -24.885598) (xy 0.968032 -24.87743) (xy 1.569797 -24.869551) (xy 2.077295 -24.862037) (xy 2.483467 -24.854964) (xy 2.781251 -24.848408) (xy 2.963587 -24.842444) (xy 3.01625 -24.838996) (xy 3.39725 -24.792854) (xy 2.9845 -24.746276) (xy 2.579791 -24.707897) (xy 2.055097 -24.670191) (xy 1.417436 -24.633399) (xy 0.67382 -24.59776) (xy -0.168734 -24.563514) (xy -1.103212 -24.530902) (xy -2.122598 -24.500163) (xy -3.219876 -24.471538) (xy -4.388033 -24.445265) (xy -5.620052 -24.421586) (xy -6.908919 -24.400739) (xy -7.269517 -24.395575) (xy -10.379783 -24.35225) (xy -10.459441 -23.794226) (xy -10.466899 -23.748648) (xy -7.747 -23.748648) (xy -7.688224 -23.81172) (xy -7.530192 -23.863997) (xy -7.300354 -23.903355) (xy -7.026159 -23.927672) (xy -6.735056 -23.934823) (xy -6.454493 -23.922687) (xy -6.211919 -23.88914) (xy -6.143625 -23.872661) (xy -5.964379 -23.800502) (xy -5.899984 -23.721978) (xy -5.938952 -23.643648) (xy -6.069792 -23.57207) (xy -6.281016 -23.513802) (xy -6.561134 -23.475402) (xy -6.860878 -23.46325) (xy -7.168344 -23.47112) (xy -7.380584 -23.497987) (xy -7.528583 -23.548735) (xy -7.575253 -23.575838) (xy -7.694095 -23.670591) (xy -7.746844 -23.745971) (xy -7.747 -23.748648) (xy -10.466899 -23.748648) (xy -10.516319 -23.446629) (xy -10.535656 -23.368313) (xy -4.888645 -23.368313) (xy -4.887443 -23.506196) (xy -4.868595 -23.537071) (xy -4.759409 -23.582341) (xy -4.548813 -23.617863) (xy -4.26204 -23.643423) (xy -3.924322 -23.658804) (xy -3.560892 -23.663789) (xy -3.196981 -23.658163) (xy -2.857822 -23.64171) (xy -2.841805 -23.640187) (xy 0.144725 -23.640187) (xy 0.144858 -23.769935) (xy 0.218658 -23.858696) (xy 0.238125 -23.870913) (xy 0.358034 -23.902091) (xy 0.570955 -23.923108) (xy 0.843298 -23.933893) (xy 1.141476 -23.934372) (xy 1.431901 -23.924473) (xy 1.680985 -23.904123) (xy 1.851057 -23.874405) (xy 2.010606 -23.811351) (xy 2.108094 -23.738037) (xy 2.115757 -23.7243) (xy 2.104356 -23.590352) (xy 2.000942 -23.40876) (xy 1.820525 -23.200258) (xy 1.584914 -22.990939) (xy 1.293849 -22.786859) (xy 1.055869 -22.689674) (xy 0.850588 -22.702692) (xy 0.657618 -22.829218) (xy 0.456571 -23.07256) (xy 0.380284 -23.186309) (xy 0.221964 -23.451596) (xy 0.144725 -23.640187) (xy -2.841805 -23.640187) (xy -2.568648 -23.614214) (xy -2.35469 -23.575457) (xy -2.301875 -23.559056) (xy -2.153482 -23.463831) (xy -2.095629 -23.31397) (xy -2.1277 -23.097655) (xy -2.249081 -22.803068) (xy -2.261255 -22.778514) (xy -2.436004 -22.466575) (xy -2.585852 -22.27889) (xy -2.710696 -22.215505) (xy -2.810428 -22.276467) (xy -2.884944 -22.461822) (xy -2.893496 -22.498331) (xy -2.995779 -22.764497) (xy -3.160647 -22.978585) (xy -3.362851 -23.118683) (xy -3.577145 -23.162881) (xy -3.647203 -23.152439) (xy -3.788149 -23.058123) (xy -3.89238 -22.87873) (xy -3.936733 -22.655455) (xy -3.937 -22.636996) (xy -3.985736 -22.478926) (xy -4.110964 -22.404117) (xy -4.281219 -22.428943) (xy -4.309933 -22.442932) (xy -4.451974 -22.558283) (xy -4.596365 -22.738853) (xy -4.727607 -22.954285) (xy -4.8302 -23.174224) (xy -4.888645 -23.368313) (xy -10.535656 -23.368313) (xy -10.57495 -23.209176) (xy -10.642165 -23.06511) (xy -10.724792 -22.997678) (xy -10.788501 -22.987) (xy -10.900256 -23.010342) (xy -11.091077 -23.072147) (xy -11.323632 -23.160076) (xy -11.372522 -23.179982) (xy -11.610638 -23.269549) (xy -11.816914 -23.331777) (xy -11.953147 -23.355476) (xy -11.96863 -23.354607) (xy -12.079858 -23.282128) (xy -12.20829 -23.091425) (xy -12.28078 -22.948776) (xy -12.393136 -22.738225) (xy -12.505433 -22.569702) (xy -12.586936 -22.485034) (xy -12.704975 -22.442683) (xy -12.910853 -22.397483) (xy -13.165877 -22.357503) (xy -13.243864 -22.347996) (xy -13.579538 -22.296054) (xy -13.947466 -22.21805) (xy -14.26853 -22.130778) (xy -14.271209 -22.129924) (xy -14.61399 -22.030721) (xy -14.878638 -21.984415) (xy -15.10215 -21.99029) (xy -15.321524 -22.047632) (xy -15.467391 -22.106816) (xy -15.619391 -22.167513) (xy -15.764416 -22.204259) (xy -15.936482 -22.220421) (xy -16.169604 -22.219365) (xy -16.469216 -22.205978) (xy -16.904511 -22.192644) (xy -17.269725 -22.208885) (xy -17.601855 -22.262673) (xy -17.937899 -22.361982) (xy -18.314856 -22.514786) (xy -18.669 -22.680062) (xy -19.191515 -22.925326) (xy -19.608026 -23.104668) (xy -19.920605 -23.218863) (xy -20.131326 -23.268687) (xy -20.226712 -23.26321) (xy -20.298246 -23.221238) (xy -20.307219 -23.155293) (xy -20.247489 -23.039325) (xy -20.136193 -22.879316) (xy -19.93825 -22.582845) (xy -19.817836 -22.335665) (xy -19.759936 -22.100094) (xy -19.7485 -21.906478) (xy -19.758466 -21.666302) (xy -19.797566 -21.495277) (xy -19.879608 -21.390486) (xy -20.018401 -21.349012) (xy -20.227752 -21.367938) (xy -20.521468 -21.444348) (xy -20.913357 -21.575324) (xy -21.063098 -21.628769) (xy -21.660132 -21.837282) (xy -22.152365 -21.993695) (xy -22.549955 -22.099883) (xy -22.86306 -22.15772) (xy -23.101839 -22.169082) (xy -23.27645 -22.135843) (xy -23.397051 -22.059877) (xy -23.39737 -22.059558) (xy -23.462206 -21.943862) (xy -23.444384 -21.793254) (xy -23.338953 -21.588911) (xy -23.23299 -21.434615) (xy -23.096756 -21.210291) (xy -23.05803 -21.05396) (xy -23.107273 -20.965281) (xy -23.234945 -20.943911) (xy -23.431507 -20.989509) (xy -23.687419 -21.101733) (xy -23.993142 -21.28024) (xy -24.268784 -21.471735) (xy -24.689934 -21.749367) (xy -25.097059 -21.952049) (xy -25.467429 -22.069839) (xy -25.69709 -22.096492) (xy -25.90823 -22.067949) (xy -26.067846 -21.991846) (xy -26.146499 -21.886343) (xy -26.144065 -21.820754) (xy -26.058154 -21.714498) (xy -25.882544 -21.592652) (xy -25.649769 -21.474087) (xy -25.392365 -21.377675) (xy -25.367388 -21.370231) (xy -25.103639 -21.27268) (xy -24.918055 -21.161099) (xy -24.831981 -21.049196) (xy -24.828501 -21.024156) (xy -24.88843 -20.949736) (xy -25.053939 -20.881744) (xy -25.303606 -20.826173) (xy -25.616013 -20.789021) (xy -25.68575 -20.78423) (xy -26.091654 -20.746353) (xy -26.382106 -20.686119) (xy -26.556944 -20.599595) (xy -26.616008 -20.48285) (xy -26.559135 -20.331953) (xy -26.386165 -20.142972) (xy -26.096935 -19.911975) (xy -25.691284 -19.635031) (xy -25.637112 -19.600026) (xy -25.298802 -19.364149) (xy -25.078534 -19.166798) (xy -24.974185 -19.005397) (xy -24.98363 -18.877374) (xy -25.011468 -18.841902) (xy -25.122997 -18.799251) (xy -25.341884 -18.773971) (xy -25.649771 -18.765415) (xy -26.0283 -18.772938) (xy -26.459114 -18.795893) (xy -26.923854 -18.833633) (xy -27.404162 -18.885511) (xy -27.813 -18.940545) (xy -28.490432 -19.036579) (xy -29.055601 -19.106296) (xy -29.520477 -19.14976) (xy -29.897026 -19.167035) (xy -30.197217 -19.158187) (xy -30.433017 -19.123279) (xy -30.616395 -19.062375) (xy -30.759317 -18.975541) (xy -30.782404 -18.956532) (xy -30.888378 -18.840369) (xy -30.949599 -18.692745) (xy -30.983897 -18.468407) (xy -30.986707 -18.438053) (xy -30.99685 -18.314124) (xy -31.01021 -18.209947) (xy -31.037077 -18.123726) (xy -31.087739 -18.053666) (xy -31.172488 -17.997973) (xy -31.301614 -17.954852) (xy -31.485406 -17.922507) (xy -31.734155 -17.899145) (xy -32.05815 -17.882969) (xy -32.467681 -17.872185) (xy -32.97304 -17.864999) (xy -33.584514 -17.859616) (xy -34.312395 -17.85424) (xy -34.334707 -17.854071) (xy -35.048352 -17.847992) (xy -35.644597 -17.841305) (xy -36.133041 -17.833668) (xy -36.523284 -17.824739) (xy -36.824925 -17.814178) (xy -37.047564 -17.801642) (xy -37.2008 -17.786791) (xy -37.294232 -17.769284) (xy -37.33746 -17.748778) (xy -37.338835 -17.747244) (xy -37.372573 -17.621295) (xy -37.34814 -17.435154) (xy -37.278176 -17.234053) (xy -37.175322 -17.063228) (xy -37.135829 -17.020755) (xy -37.070752 -16.968851) (xy -36.988785 -16.926952) (xy -36.874368 -16.892995) (xy -36.711944 -16.86492) (xy -36.485952 -16.840665) (xy -36.180836 -16.818171) (xy -35.781034 -16.795375) (xy -35.27099 -16.770217) (xy -35.229765 -16.768267) (xy -34.769645 -16.74446) (xy -34.416681 -16.720574) (xy -34.15105 -16.694239) (xy -33.95293 -16.663083) (xy -33.802497 -16.624736) (xy -33.698085 -16.585055) (xy -33.489727 -16.479401) (xy -33.369809 -16.368367) (xy -33.304894 -16.210874) (xy -33.27692 -16.067656) (xy -33.237384 -15.914132) (xy -33.15847 -15.845602) (xy -33.032926 -15.823186) (xy -32.873349 -15.828817) (xy -32.636481 -15.861736) (xy -32.367418 -15.915312) (xy -32.303406 -15.930424) (xy -31.967177 -16.004699) (xy -31.580235 -16.077854) (xy -31.17646 -16.144708) (xy -30.789735 -16.200083) (xy -30.45394 -16.238798) (xy -30.202957 -16.255672) (xy -30.173974 -16.256) (xy -30.000772 -16.239633) (xy -29.886366 -16.198855) (xy -29.871365 -16.183786) (xy -29.867193 -16.116187) (xy -29.933467 -16.033408) (xy -30.075672 -15.933107) (xy -30.299287 -15.812945) (xy -30.609795 -15.670581) (xy -31.012678 -15.503673) (xy -31.513416 -15.309883) (xy -32.117491 -15.086868) (xy -32.830386 -14.832289) (xy -33.657581 -14.543805) (xy -33.94075 -14.446205) (xy -34.890166 -14.117723) (xy -35.723141 -13.82502) (xy -36.444513 -13.566175) (xy -37.059119 -13.339272) (xy -37.571793 -13.142391) (xy -37.987374 -12.973614) (xy -38.310698 -12.831022) (xy -38.5466 -12.712696) (xy -38.699919 -12.616718) (xy -38.775489 -12.541169) (xy -38.782759 -12.525375) (xy -38.764784 -12.50582) (xy -38.690729 -12.489513) (xy -38.551555 -12.476193) (xy -38.338223 -12.465602) (xy -38.041694 -12.45748) (xy -37.652931 -12.45157) (xy -37.162893 -12.447611) (xy -36.562542 -12.445345) (xy -35.962167 -12.444559) (xy -35.338015 -12.44284) (xy -34.724171 -12.43852) (xy -34.138489 -12.431909) (xy -33.598823 -12.423314) (xy -33.123029 -12.413046) (xy -32.728959 -12.401413) (xy -32.434469 -12.388723) (xy -32.323878 -12.381599) (xy -31.867414 -12.340145) (xy -31.45429 -12.291168) (xy -31.105299 -12.23785) (xy -30.841233 -12.183378) (xy -30.682886 -12.130934) (xy -30.681112 -12.130018) (xy -30.695899 -12.089135) (xy -30.819262 -12.016533) (xy -31.038713 -11.918864) (xy -31.189112 -11.859439) (xy -31.309748 -11.814265) (xy -18.656115 -11.814265) (xy -18.652722 -11.828085) (xy -18.570039 -11.91485) (xy -18.386773 -12.020099) (xy -18.126026 -12.133481) (xy -17.810897 -12.244646) (xy -17.555841 -12.319513) (xy -17.198604 -12.431422) (xy -16.872375 -12.563005) (xy -16.603393 -12.701502) (xy -16.417895 -12.834151) (xy -16.360391 -12.900915) (xy -16.343937 -13.04) (xy -16.410865 -13.237066) (xy -16.544879 -13.471397) (xy -16.729683 -13.722278) (xy -16.948979 -13.968994) (xy -17.186471 -14.19083) (xy -17.425861 -14.367072) (xy -17.578205 -14.448892) (xy -17.761958 -14.5551) (xy -17.841622 -14.660529) (xy -17.8435 -14.677602) (xy -17.804194 -14.77529) (xy -17.699984 -14.92896) (xy -17.551434 -15.115897) (xy -17.379107 -15.313384) (xy -17.203569 -15.498704) (xy -17.045382 -15.649142) (xy -16.92511 -15.74198) (xy -16.866067 -15.757351) (xy -16.525706 -15.496202) (xy -16.200873 -15.253306) (xy -15.911198 -15.042857) (xy -15.676307 -14.87905) (xy -15.515829 -14.776077) (xy -15.487192 -14.760229) (xy -15.345368 -14.696862) (xy -15.25961 -14.699456) (xy -15.191491 -14.753295) (xy -15.108865 -14.914459) (xy -15.069441 -15.179253) (xy -15.073883 -15.53164) (xy -15.122854 -15.955587) (xy -15.137916 -16.046782) (xy -15.259746 -16.633694) (xy -15.410638 -17.128099) (xy -15.602987 -17.56339) (xy -15.849186 -17.972962) (xy -15.857099 -17.984566) (xy -16.003494 -18.204736) (xy -16.117505 -18.387924) (xy -16.182988 -18.50759) (xy -16.1925 -18.535912) (xy -16.136634 -18.607931) (xy -15.994995 -18.647668) (xy -15.80652 -18.646837) (xy -15.730699 -18.634158) (xy -15.380471 -18.511717) (xy -14.97235 -18.285111) (xy -14.514292 -17.958764) (xy -14.50842 -17.954178) (xy -14.162081 -17.700015) (xy -13.853041 -17.505622) (xy -13.598732 -17.380845) (xy -13.416587 -17.335529) (xy -13.413004 -17.3355) (xy -13.260676 -17.388786) (xy -13.101331 -17.524725) (xy -12.973554 -17.707439) (xy -12.94552 -17.770222) (xy -12.904032 -17.907434) (xy -12.848019 -18.130078) (xy -12.787118 -18.398909) (xy -12.762654 -18.51492) (xy -12.676127 -18.894358) (xy -12.593002 -19.180704) (xy -12.516988 -19.363133) (xy -12.451795 -19.430821) (xy -12.448695 -19.431) (xy -12.372359 -19.382543) (xy -12.236008 -19.248409) (xy -12.054572 -19.045449) (xy -11.842982 -18.790514) (xy -11.616167 -18.500455) (xy -11.569472 -18.43862) (xy -11.206601 -17.997874) (xy -10.864698 -17.674236) (xy -10.534818 -17.461388) (xy -10.208017 -17.35301) (xy -10.007945 -17.3355) (xy -9.717528 -17.380079) (xy -9.508112 -17.515752) (xy -9.378097 -17.745418) (xy -9.325883 -18.071977) (xy -9.34987 -18.498329) (xy -9.353053 -18.522409) (xy -9.378583 -18.76141) (xy -9.387393 -18.959019) (xy -9.37775 -19.074399) (xy -9.376622 -19.077621) (xy -9.296146 -19.165569) (xy -9.182617 -19.162605) (xy -9.067128 -19.087424) (xy -8.980774 -18.958724) (xy -8.9535 -18.823214) (xy -8.898656 -18.633804) (xy -8.746498 -18.499512) (xy -8.515593 -18.423484) (xy -8.224505 -18.408863) (xy -7.891799 -18.458794) (xy -7.53604 -18.576421) (xy -7.52475 -18.581223) (xy -7.207547 -18.709727) (xy -6.968813 -18.777568) (xy -6.77362 -18.78127) (xy -6.587038 -18.717355) (xy -6.374139 -18.582343) (xy -6.197708 -18.449078) (xy -5.899035 -18.248776) (xy -5.653835 -18.159973) (xy -5.451496 -18.184525) (xy -5.281406 -18.324286) (xy -5.13295 -18.581112) (xy -5.107849 -18.639573) (xy -4.974184 -18.902777) (xy -4.836071 -19.064894) (xy -4.717877 -19.1135) (xy -4.581271 -19.053296) (xy -4.434945 -18.882755) (xy -4.289018 -18.616978) (xy -4.153891 -18.271906) (xy -4.008482 -17.905344) (xy -3.848092 -17.6235) (xy -3.775768 -17.532909) (xy -3.641129 -17.39774) (xy -3.542062 -17.34411) (xy -3.435485 -17.353844) (xy -3.387572 -17.369155) (xy -3.280301 -17.42517) (xy -3.19838 -17.52622) (xy -3.121264 -17.703359) (xy -3.073802 -17.843393) (xy -2.914279 -18.217538) (xy -2.714813 -18.472958) (xy -2.473273 -18.612166) (xy -2.408953 -18.628534) (xy -2.228141 -18.686149) (xy -1.978144 -18.792927) (xy -1.696951 -18.929901) (xy -1.422556 -19.078101) (xy -1.19295 -19.21856) (xy -1.111701 -19.276211) (xy -0.940343 -19.38957) (xy -0.73837 -19.499577) (xy -0.551141 -19.583607) (xy -0.424451 -19.619014) (xy -0.332874 -19.594469) (xy -0.233951 -19.550064) (xy -0.020369 -19.40787) (xy 0.130404 -19.244492) (xy 0.190384 -19.090622) (xy 0.1905 -19.084549) (xy 0.159105 -18.972075) (xy 0.075174 -18.785061) (xy -0.045915 -18.556279) (xy -0.106278 -18.452048) (xy -0.272552 -18.151298) (xy -0.314168 -18.050899) (xy 29.602822 -18.050899) (xy 29.638267 -18.158513) (xy 29.792521 -18.255567) (xy 29.996188 -18.310655) (xy 30.245853 -18.310272) (xy 30.561124 -18.251931) (xy 30.961607 -18.133143) (xy 31.082643 -18.091864) (xy 31.59125 -17.914728) (xy 30.6078 -17.926739) (xy 30.231981 -17.932593) (xy 29.964469 -17.941042) (xy 29.786571 -17.954393) (xy 29.679594 -17.974958) (xy 29.624845 -18.005045) (xy 29.603631 -18.046963) (xy 29.602822 -18.050899) (xy -0.314168 -18.050899) (xy -0.368788 -17.919131) (xy -0.406427 -17.726714) (xy -0.407903 -17.692054) (xy -0.41275 -17.43075) (xy 0.1905 -17.43075) (xy 0.475686 -17.428417) (xy 0.678116 -17.413995) (xy 0.842029 -17.376348) (xy 1.011665 -17.304341) (xy 1.231265 -17.186838) (xy 1.290515 -17.153865) (xy 1.591085 -17.000113) (xy 1.822618 -16.922609) (xy 2.016135 -16.919386) (xy 2.202654 -16.988475) (xy 2.356181 -17.086257) (xy 2.649041 -17.24568) (xy 3.055511 -17.391718) (xy 3.562597 -17.521033) (xy 4.157307 -17.630286) (xy 4.79425 -17.712734) (xy 5.147783 -17.745246) (xy 5.516192 -17.77052) (xy 5.87614 -17.787936) (xy 6.20429 -17.796876) (xy 6.477307 -17.796719) (xy 6.671853 -17.786846) (xy 6.764593 -17.766636) (xy 6.766389 -17.765103) (xy 6.750656 -17.699178) (xy 6.66382 -17.571388) (xy 6.526138 -17.41102) (xy 6.354804 -17.21888) (xy 6.249814 -17.064006) (xy 6.185856 -16.895755) (xy 6.137616 -16.663484) (xy 6.129869 -16.618202) (xy 6.104064 -16.497256) (xy 6.059704 -16.410164) (xy 5.974074 -16.342588) (xy 5.82446 -16.280193) (xy 5.588147 -16.208642) (xy 5.3975 -16.155954) (xy 5.008127 -16.032651) (xy 4.698064 -15.900087) (xy 4.477653 -15.765227) (xy 4.357233 -15.635033) (xy 4.347145 -15.516469) (xy 4.379595 -15.470504) (xy 4.518585 -15.406829) (xy 4.761445 -15.37734) (xy 5.089895 -15.38145) (xy 5.485658 -15.418573) (xy 5.930455 -15.488121) (xy 6.126164 -15.526582) (xy 6.586538 -15.61392) (xy 6.92964 -15.659639) (xy 7.158076 -15.664061) (xy 7.199118 -15.658465) (xy 7.403837 -15.5803) (xy 7.611994 -15.438119) (xy 7.791167 -15.262224) (xy 7.908933 -15.082919) (xy 7.9375 -14.968361) (xy 7.929742 -14.880141) (xy 7.892868 -14.816979) (xy 7.806469 -14.771376) (xy 7.65014 -14.735832) (xy 7.403475 -14.702845) (xy 7.137426 -14.674292) (xy 6.686452 -14.610328) (xy 6.351863 -14.52224) (xy 6.1885 -14.439495) (xy 32.079366 -14.439495) (xy 32.163207 -14.537664) (xy 32.210375 -14.573316) (xy 32.397358 -14.637048) (xy 32.684664 -14.636624) (xy 33.06346 -14.572804) (xy 33.462235 -14.46579) (xy 33.680952 -14.393596) (xy 33.852209 -14.327088) (xy 33.937575 -14.281559) (xy 33.920133 -14.24689) (xy 33.801119 -14.222288) (xy 33.605544 -14.207548) (xy 33.358421 -14.202465) (xy 33.084759 -14.206834) (xy 32.809572 -14.220448) (xy 32.55787 -14.243104) (xy 32.354666 -14.274595) (xy 32.273875 -14.295212) (xy 32.115062 -14.363904) (xy 32.079366 -14.439495) (xy 6.1885 -14.439495) (xy 6.12485 -14.407256) (xy 6.040599 -14.329086) (xy 5.991025 -14.205171) (xy 6.054245 -14.10737) (xy 6.216903 -14.047152) (xy 6.384916 -14.0335) (xy 6.586017 -14.014869) (xy 6.719111 -13.943905) (xy 6.785317 -13.871643) (xy 8.266854 -13.871643) (xy 8.28943 -13.970068) (xy 8.396129 -14.061649) (xy 8.544617 -14.143105) (xy 8.687007 -14.149824) (xy 8.854116 -14.098571) (xy 8.985314 -13.996826) (xy 9.011812 -13.85521) (xy 8.9408 -13.7287) (xy 8.804328 -13.666533) (xy 8.615466 -13.65786) (xy 8.435826 -13.7002) (xy 8.354785 -13.752285) (xy 8.266854 -13.871643) (xy 6.785317 -13.871643) (xy 6.7873 -13.869479) (xy 6.927075 -13.636773) (xy 7.056711 -13.324399) (xy 7.15971 -12.979532) (xy 7.219576 -12.649345) (xy 7.221821 -12.62698) (xy 7.255486 -12.268211) (xy 7.009118 -12.10619) (xy 6.608377 -11.916312) (xy 6.173776 -11.843483) (xy 5.801358 -11.876345) (xy 5.544609 -11.914719) (xy 5.392777 -11.898969) (xy 5.335186 -11.827573) (xy 5.334 -11.809822) (xy 5.393775 -11.698337) (xy 5.573196 -11.546067) (xy 5.872408 -11.352916) (xy 6.291553 -11.118786) (xy 6.57225 -10.973024) (xy 6.98492 -10.7605) (xy 7.298538 -10.591449) (xy 7.529003 -10.455358) (xy 7.692216 -10.341712) (xy 7.804079 -10.239999) (xy 7.880493 -10.139705) (xy 7.909218 -10.08904) (xy 7.962338 -9.951984) (xy 7.938275 -9.848727) (xy 7.908054 -9.80329) (xy 7.857953 -9.752661) (xy 7.780041 -9.718576) (xy 7.651241 -9.697866) (xy 7.448476 -9.687361) (xy 7.148669 -9.683892) (xy 7.03765 -9.68375) (xy 6.668698 -9.687697) (xy 6.392577 -9.706414) (xy 6.175199 -9.750215) (xy 5.982474 -9.829411) (xy 5.780311 -9.954316) (xy 5.534621 -10.135242) (xy 5.527644 -10.140559) (xy 5.296059 -10.2919) (xy 5.130662 -10.338237) (xy 5.024679 -10.278517) (xy 4.971336 -10.111685) (xy 4.96543 -10.053097) (xy 5.001549 -9.738735) (xy 5.149284 -9.382805) (xy 5.375927 -9.033277) (xy 5.385861 -9.018114) (xy 9.173241 -9.018114) (xy 9.187645 -9.059349) (xy 9.280812 -9.089498) (xy 9.419235 -9.122212) (xy 9.549765 -9.131747) (xy 9.711201 -9.116087) (xy 9.942343 -9.073213) (xy 10.057813 -9.049093) (xy 10.374973 -8.965963) (xy 10.614833 -8.870475) (xy 10.759574 -8.771113) (xy 10.795 -8.698036) (xy 10.73757 -8.660568) (xy 10.586794 -8.640974) (xy 10.374936 -8.638416) (xy 10.134263 -8.652054) (xy 9.897041 -8.681049) (xy 9.695536 -8.72456) (xy 9.687837 -8.726842) (xy 9.480899 -8.80461) (xy 9.308469 -8.895621) (xy 9.258932 -8.932671) (xy 9.173241 -9.018114) (xy 5.385861 -9.018114) (xy 5.496707 -8.848925) (xy 5.616045 -8.629695) (xy 5.713967 -8.416784) (xy 5.770503 -8.251387) (xy 5.777105 -8.205803) (xy 5.74777 -8.140949) (xy 5.648826 -8.081675) (xy 5.467418 -8.024304) (xy 5.190697 -7.965161) (xy 4.805808 -7.900568) (xy 4.60375 -7.870188) (xy 4.19437 -7.809487) (xy 3.888105 -7.761175) (xy 3.662323 -7.719851) (xy 3.494389 -7.680109) (xy 3.361672 -7.636547) (xy 3.241539 -7.583762) (xy 3.111358 -7.516348) (xy 3.103064 -7.511898) (xy 2.84563 -7.326389) (xy 2.698892 -7.110543) (xy 2.667 -6.944087) (xy 2.708941 -6.857538) (xy 2.821375 -6.707561) (xy 2.984217 -6.51975) (xy 3.07975 -6.418116) (xy 3.259814 -6.224798) (xy 3.400082 -6.061256) (xy 3.480719 -5.951279) (xy 3.4925 -5.923084) (xy 3.433028 -5.836203) (xy 3.258011 -5.788866) (xy 2.972544 -5.780931) (xy 2.581721 -5.81226) (xy 2.090638 -5.882713) (xy 1.5875 -5.975385) (xy 1.052061 -6.071697) (xy 0.562071 -6.139368) (xy 0.132384 -6.177621) (xy -0.22214 -6.185679) (xy -0.486647 -6.162765) (xy -0.646278 -6.108101) (xy -0.66441 -6.093192) (xy -0.720255 -6.018588) (xy -0.709505 -5.937993) (xy -0.624806 -5.807772) (xy -0.613782 -5.792774) (xy -0.522275 -5.681186) (xy -0.500532 -5.656361) (xy 31.3055 -5.656361) (xy 31.364603 -5.765224) (xy 31.52678 -5.879835) (xy 31.76933 -5.98833) (xy 32.069555 -6.07885) (xy 32.148125 -6.096679) (xy 32.396315 -6.127819) (xy 32.737623 -6.141076) (xy 33.139661 -6.137957) (xy 33.570036 -6.119972) (xy 33.996358 -6.08863) (xy 34.386237 -6.04544) (xy 34.70728 -5.991909) (xy 34.786435 -5.973783) (xy 35.219264 -5.846575) (xy 35.62568 -5.691592) (xy 35.979633 -5.521099) (xy 36.255073 -5.347357) (xy 36.402326 -5.213154) (xy 36.527014 -5.039606) (xy 36.56798 -4.906684) (xy 36.517965 -4.810814) (xy 36.369706 -4.748418) (xy 36.115944 -4.715919) (xy 35.749416 -4.70974) (xy 35.40125 -4.720012) (xy 34.783462 -4.757355) (xy 34.177313 -4.815469) (xy 33.595799 -4.891385) (xy 33.051915 -4.98213) (xy 32.558657 -5.084734) (xy 32.129022 -5.196226) (xy 31.776005 -5.313634) (xy 31.512602 -5.433988) (xy 31.351808 -5.554317) (xy 31.3055 -5.656361) (xy -0.500532 -5.656361) (xy -0.360711 -5.496725) (xy -0.146423 -5.258671) (xy 0.10326 -4.986307) (xy 0.332675 -4.739768) (xy 0.547246 -4.508682) (xy 2.8575 -4.508682) (xy 2.906731 -4.5661) (xy 3.045818 -4.550838) (xy 3.261847 -4.46483) (xy 3.296687 -4.447527) (xy 27.8765 -4.447527) (xy 27.929856 -4.514093) (xy 28.051139 -4.562064) (xy 28.083066 -4.566986) (xy 28.158764 -4.561732) (xy 28.339491 -4.544062) (xy 28.604122 -4.516195) (xy 28.931532 -4.480349) (xy 29.257816 -4.443624) (xy 30.323385 -4.320119) (xy 31.265844 -4.20629) (xy 32.088671 -4.10158) (xy 32.795341 -4.005432) (xy 33.389332 -3.917289) (xy 33.874121 -3.836593) (xy 34.253186 -3.762788) (xy 34.530003 -3.695317) (xy 34.708049 -3.633622) (xy 34.790802 -3.577147) (xy 34.798 -3.556) (xy 34.737532 -3.490976) (xy 34.56665 -3.440241) (xy 34.301133 -3.403807) (xy 33.956762 -3.381687) (xy 33.549317 -3.373891) (xy 33.094577 -3.380432) (xy 32.608324 -3.401322) (xy 32.106337 -3.436573) (xy 31.604397 -3.486196) (xy 31.118284 -3.550204) (xy 31.098449 -3.553207) (xy 30.631096 -3.63186) (xy 30.153167 -3.725743) (xy 29.680981 -3.830326) (xy 29.230858 -3.941079) (xy 28.819116 -4.053472) (xy 28.462076 -4.162976) (xy 28.176056 -4.26506) (xy 27.977377 -4.355196) (xy 27.882356 -4.428852) (xy 27.8765 -4.447527) (xy 3.296687 -4.447527) (xy 3.310194 -4.440819) (xy 3.521961 -4.311816) (xy 3.730773 -4.148998) (xy 3.921859 -3.969818) (xy 4.08045 -3.79173) (xy 4.191774 -3.632187) (xy 4.24106 -3.508641) (xy 4.213539 -3.438548) (xy 4.166486 -3.429) (xy 4.037259 -3.4697) (xy 3.849319 -3.578328) (xy 3.627165 -3.734677) (xy 3.395297 -3.918538) (xy 3.178215 -4.109702) (xy 3.00042 -4.287962) (xy 2.886411 -4.433109) (xy 2.8575 -4.508682) (xy 0.547246 -4.508682) (xy 0.680308 -4.365379) (xy 0.945112 -4.071631) (xy 1.134253 -3.849555) (xy 1.2549 -3.690182) (xy 1.314217 -3.584541) (xy 1.319371 -3.523665) (xy 1.312333 -3.513666) (xy 1.272022 -3.503341) (xy 1.19771 -3.533039) (xy 1.07711 -3.611553) (xy 0.897937 -3.747673) (xy 0.647902 -3.950192) (xy 0.317865 -4.225261) (xy -0.098616 -4.566866) (xy -0.434852 -4.823655) (xy -0.699567 -5.001442) (xy -0.901484 -5.106037) (xy -1.049328 -5.143256) (xy -1.060183 -5.1435) (xy -1.152249 -5.123335) (xy -1.196752 -5.052338) (xy -1.192848 -4.914755) (xy -1.139693 -4.69483) (xy -1.036446 -4.37681) (xy -1.016 -4.318) (xy -0.914263 -3.993986) (xy -0.850042 -3.718454) (xy -0.826038 -3.510446) (xy -0.844949 -3.389002) (xy -0.881017 -3.3655) (xy -0.970021 -3.385175) (xy -1.130734 -3.4349) (xy -1.214392 -3.463566) (xy -1.542174 -3.561009) (xy -1.953359 -3.656379) (xy -2.406433 -3.742491) (xy -2.859878 -3.812157) (xy -3.272179 -3.858192) (xy -3.58274 -3.8735) (xy -3.854847 -3.870323) (xy -4.033145 -3.855805) (xy -4.150768 -3.822468) (xy -4.240847 -3.762831) (xy -4.293793 -3.712979) (xy -4.381174 -3.60237) (xy -4.418288 -3.478348) (xy -4.401948 -3.318273) (xy -4.328963 -3.099502) (xy -4.196146 -2.799393) (xy -4.152034 -2.706533) (xy -4.080629 -2.550169) (xy -2.720681 -2.550169) (xy -2.715253 -2.595213) (xy -2.678428 -2.603872) (xy -2.645834 -2.6035) (xy -2.555359 -2.561423) (xy -2.417183 -2.453893) (xy -2.328334 -2.370666) (xy -2.171371 -2.185334) (xy -2.103249 -2.018532) (xy -2.0955 -1.926166) (xy -2.125837 -1.772172) (xy -2.204641 -1.715646) (xy -2.313601 -1.74603) (xy -2.434408 -1.852765) (xy -2.548751 -2.025294) (xy -2.633495 -2.236396) (xy -2.693749 -2.440108) (xy -2.720681 -2.550169) (xy -4.080629 -2.550169) (xy -4.023275 -2.424578) (xy -3.955169 -2.238199) (xy -3.944184 -2.133386) (xy -3.986788 -2.096128) (xy -3.99799 -2.0955) (xy -4.075284 -2.123413) (xy -4.240224 -2.199361) (xy -4.468377 -2.311652) (xy -4.727945 -2.44475) (xy -5.005234 -2.582807) (xy -5.255235 -2.695102) (xy -5.449227 -2.769488) (xy -5.553746 -2.794) (xy -5.739419 -2.851718) (xy -5.963281 -3.025663) (xy -6.226555 -3.31702) (xy -6.530469 -3.726974) (xy -6.554616 -3.76207) (xy -6.847842 -4.152561) (xy -7.112241 -4.426574) (xy -7.345731 -4.582376) (xy -7.546231 -4.618231) (xy -7.575661 -4.612583) (xy -7.728424 -4.512806) (xy -7.832614 -4.318388) (xy -7.873843 -4.057002) (xy -7.874 -4.038737) (xy -7.903027 -3.779753) (xy -7.979723 -3.551264) (xy -8.088512 -3.394238) (xy -8.130505 -3.364159) (xy -8.278856 -3.318478) (xy -8.441326 -3.302) (xy -8.585071 -3.285467) (xy -8.623137 -3.230417) (xy -8.553971 -3.128675) (xy -8.37924 -2.974646) (xy -8.191173 -2.799426) (xy -8.027384 -2.604587) (xy -7.913274 -2.424102) (xy -7.874 -2.298915) (xy -7.930919 -2.174617) (xy -8.08362 -2.086913) (xy -8.305022 -2.040247) (xy -8.568043 -2.039065) (xy -8.845604 -2.087813) (xy -8.953189 -2.121766) (xy -9.132709 -2.217686) (xy -9.265151 -2.369504) (xy -9.359581 -2.596451) (xy -9.425067 -2.917758) (xy -9.456729 -3.189716) (xy -9.538305 -3.701758) (xy -9.675723 -4.100391) (xy -9.869531 -4.38654) (xy -10.120278 -4.561127) (xy -10.303401 -4.613559) (xy -10.457338 -4.618446) (xy -10.57325 -4.566263) (xy -10.658552 -4.442146) (xy -10.720665 -4.231234) (xy -10.767006 -3.918664) (xy -10.794119 -3.63034) (xy -10.847109 -3.172269) (xy -10.922928 -2.835615) (xy -11.023659 -2.6165) (xy -11.151387 -2.511047) (xy -11.308196 -2.515377) (xy -11.377109 -2.545677) (xy -11.473913 -2.644094) (xy -11.591877 -2.832246) (xy -11.713896 -3.078772) (xy -11.822865 -3.352306) (xy -11.832872 -3.381375) (xy -11.896289 -3.479497) (xy -11.983349 -3.458719) (xy -12.09885 -3.31743) (xy -12.119359 -3.285041) (xy -12.28661 -3.054091) (xy -12.452094 -2.894942) (xy -12.595513 -2.824844) (xy -12.655308 -2.82957) (xy -12.755618 -2.929898) (xy -12.827787 -3.121781) (xy -12.869918 -3.372517) (xy -12.880114 -3.649403) (xy -12.85648 -3.919734) (xy -12.797117 -4.150808) (xy -12.738525 -4.26439) (xy -12.631844 -4.367007) (xy -12.448634 -4.497492) (xy -12.226953 -4.62896) (xy -12.208468 -4.638836) (xy -11.887376 -4.843111) (xy -11.674275 -5.05553) (xy -11.575849 -5.267826) (xy -11.579847 -5.416381) (xy -11.607427 -5.488615) (xy -11.664024 -5.531389) (xy -11.777803 -5.552287) (xy -11.976933 -5.558894) (xy -12.110293 -5.559217) (xy -12.397284 -5.567109) (xy -12.60916 -5.598536) (xy -12.797133 -5.663967) (xy -12.92225 -5.725216) (xy -13.190052 -5.883704) (xy -13.357148 -6.034272) (xy -13.445524 -6.201806) (xy -13.472911 -6.348551) (xy -13.5028 -6.490609) (xy -13.57321 -6.593169) (xy -13.70164 -6.662296) (xy -13.905591 -6.70405) (xy -14.202564 -6.724492) (xy -14.57325 -6.729689) (xy -15.35102 -6.698371) (xy -16.113815 -6.607239) (xy -16.815957 -6.462233) (xy -16.983155 -6.416378) (xy -17.143667 -6.36956) (xy -17.257351 -6.340052) (xy -17.317196 -6.336019) (xy -17.31619 -6.36563) (xy -17.247323 -6.437051) (xy -17.103582 -6.558452) (xy -16.877955 -6.737998) (xy -16.563433 -6.983857) (xy -16.359357 -7.143013) (xy -15.935683 -7.476324) (xy -15.605121 -7.743495) (xy -15.358321 -7.953426) (xy -15.185935 -8.115015) (xy -15.078612 -8.237162) (xy -15.027004 -8.328766) (xy -15.021762 -8.398726) (xy -15.025959 -8.412243) (xy -15.114198 -8.48847) (xy -15.29442 -8.49137) (xy -15.569619 -8.420343) (xy -15.942788 -8.274791) (xy -16.128749 -8.191616) (xy -16.374383 -8.08187) (xy -16.573724 -7.999224) (xy -16.701204 -7.953906) (xy -16.733759 -7.949591) (xy -16.727474 -8.017327) (xy -16.688746 -8.175576) (xy -16.625202 -8.394336) (xy -16.600926 -8.472047) (xy -16.509248 -8.805834) (xy -16.485932 -9.044998) (xy -16.539903 -9.207147) (xy -16.680087 -9.309891) (xy -16.915407 -9.370839) (xy -17.06647 -9.390601) (xy -17.300482 -9.433281) (xy -17.427523 -9.51154) (xy -17.456382 -9.644344) (xy -17.395847 -9.850656) (xy -17.338938 -9.978568) (xy -17.150188 -10.314305) (xy -16.945849 -10.542302) (xy -16.707953 -10.681798) (xy -16.66875 -10.696112) (xy -16.505677 -10.77344) (xy -16.405161 -10.861985) (xy -16.39331 -10.888861) (xy -16.418127 -11.042783) (xy -16.560135 -11.177952) (xy -16.821472 -11.295279) (xy -17.204277 -11.395675) (xy -17.710687 -11.480052) (xy -17.81175 -11.493185) (xy -18.179007 -11.553925) (xy -18.448308 -11.630136) (xy -18.610422 -11.718142) (xy -18.656115 -11.814265) (xy -31.309748 -11.814265) (xy -31.501106 -11.742609) (xy -31.767114 -11.650329) (xy -32.021049 -11.573089) (xy -32.296825 -11.501381) (xy -32.628353 -11.425698) (xy -33.049548 -11.33653) (xy -33.067316 -11.332844) (xy -33.487806 -11.236213) (xy -33.791088 -11.143627) (xy -33.986696 -11.051016) (xy -34.084163 -10.954315) (xy -34.099501 -10.892481) (xy -34.139103 -10.80388) (xy -34.243747 -10.652368) (xy -34.39219 -10.468221) (xy -34.418448 -10.437911) (xy -34.56814 -10.255402) (xy -34.67364 -10.104559) (xy -34.715636 -10.013542) (xy -34.714929 -10.005591) (xy -34.645003 -9.965368) (xy -34.483587 -9.925616) (xy -34.270365 -9.895505) (xy -33.89286 -9.842574) (xy -33.562107 -9.7563) (xy -33.219653 -9.619249) (xy -33.016201 -9.521455) (xy -32.730039 -9.360406) (xy -32.568017 -9.225635) (xy -32.530173 -9.11718) (xy -32.555434 -9.075166) (xy -32.661701 -9.020807) (xy -32.882207 -8.949994) (xy -33.205586 -8.865044) (xy -33.620471 -8.768276) (xy -34.115498 -8.662008) (xy -34.679298 -8.548558) (xy -35.300508 -8.430244) (xy -35.967759 -8.309385) (xy -36.669687 -8.188298) (xy -37.394926 -8.069302) (xy -37.799978 -8.00553) (xy -38.336955 -7.918524) (xy -38.758804 -7.841105) (xy -39.07679 -7.770425) (xy -39.302176 -7.703636) (xy -39.446224 -7.637889) (xy -39.520057 -7.570566) (xy -39.523966 -7.482642) (xy -39.498848 -7.307749) (xy -39.450017 -7.081187) (xy -39.440919 -7.044705) (xy -39.369713 -6.792833) (xy -39.30397 -6.638692) (xy -39.229346 -6.554568) (xy -39.172086 -6.525329) (xy -39.082509 -6.50254) (xy -38.963001 -6.49322) (xy -38.802708 -6.499124) (xy -38.590777 -6.522009) (xy -38.316355 -6.563629) (xy -37.968588 -6.62574) (xy -37.536624 -6.710099) (xy -37.009609 -6.81846) (xy -36.37669 -6.95258) (xy -35.90925 -7.05313) (xy -34.819374 -7.283698) (xy -33.843876 -7.479541) (xy -32.975308 -7.641806) (xy -32.206218 -7.77164) (xy -31.529158 -7.870189) (xy -30.936677 -7.9386) (xy -30.421325 -7.978019) (xy -29.975653 -7.989593) (xy -29.839002 -7.987398) (xy -29.492255 -7.968807) (xy -29.266953 -7.937015) (xy -29.158424 -7.893752) (xy -29.161994 -7.840752) (xy -29.27299 -7.779746) (xy -29.48674 -7.712465) (xy -29.798569 -7.640643) (xy -30.203806 -7.566011) (xy -30.697776 -7.4903) (xy -31.275806 -7.415243) (xy -31.4325 -7.39683) (xy -31.965129 -7.328973) (xy -32.448076 -7.254749) (xy -32.866213 -7.177287) (xy -33.204414 -7.099717) (xy -33.447549 -7.025169) (xy -33.58049 -6.956773) (xy -33.586356 -6.951208) (xy -33.61101 -6.917556) (xy -33.600441 -6.893122) (xy -33.540337 -6.877237) (xy -33.416388 -6.869231) (xy -33.214282 -6.868436) (xy -32.919709 -6.874181) (xy -32.518358 -6.885798) (xy -32.3215 -6.892042) (xy -31.814047 -6.905728) (xy -31.432017 -6.910095) (xy -31.174172 -6.905126) (xy -31.039276 -6.8908) (xy -31.01975 -6.871841) (xy -31.119377 -6.813438) (xy -31.3293 -6.723056) (xy -31.638058 -6.604835) (xy -32.034192 -6.46292) (xy -32.506245 -6.301454) (xy -33.042755 -6.124578) (xy -33.43275 -5.999457) (xy -34.047277 -5.800005) (xy -34.548636 -5.625093) (xy -34.946638 -5.467552) (xy -35.251094 -5.320214) (xy -35.471816 -5.175912) (xy -35.618613 -5.027476) (xy -35.701297 -4.867739) (xy -35.729679 -4.689533) (xy -35.713568 -4.48569) (xy -35.687513 -4.352035) (xy -35.661901 -4.205018) (xy -35.664434 -4.080475) (xy -35.706366 -3.972136) (xy -35.79895 -3.87373) (xy -35.953439 -3.778987) (xy -36.181085 -3.681635) (xy -36.493141 -3.575404) (xy -36.900861 -3.454023) (xy -37.415498 -3.311222) (xy -37.68725 -3.237686) (xy -38.529711 -3.000727) (xy -39.257682 -2.774068) (xy -39.882871 -2.553744) (xy -40.416984 -2.335788) (xy -40.608756 -2.247903) (xy -40.928718 -2.082644) (xy -41.189184 -1.921688) (xy -41.372328 -1.777742) (xy -41.460321 -1.663517) (xy -41.465501 -1.637096) (xy -41.462945 -1.61588) (xy -41.446416 -1.601226) (xy -41.402622 -1.594514) (xy -41.318271 -1.597124) (xy -41.180073 -1.610437) (xy -40.974734 -1.635833) (xy -40.688963 -1.67469) (xy -40.309469 -1.728391) (xy -39.822959 -1.798313) (xy -39.59225 -1.83159) (xy -39.231852 -1.881662) (xy -38.767442 -1.943174) (xy -38.22121 -2.013349) (xy -37.615347 -2.089412) (xy -36.972041 -2.168583) (xy -36.313484 -2.248088) (xy -35.661865 -2.325149) (xy -35.46475 -2.348107) (xy -34.410513 -2.471079) (xy -33.418683 -2.588115) (xy -32.496416 -2.698325) (xy -31.650867 -2.800819) (xy -30.889192 -2.894707) (xy -30.218547 -2.9791) (xy -29.646087 -3.053106) (xy -29.178969 -3.115837) (xy -28.824349 -3.166401) (xy -28.603514 -3.201427) (xy -28.309702 -3.240336) (xy -28.12999 -3.235518) (xy -28.066241 -3.18737) (xy -28.118567 -3.098033) (xy -28.229674 -3.036273) (xy -28.457734 -2.952489) (xy -28.795009 -2.848766) (xy -29.233762 -2.727191) (xy -29.766254 -2.589851) (xy -30.384748 -2.438833) (xy -31.081507 -2.276222) (xy -31.600404 -2.159122) (xy -32.361676 -1.988133) (xy -33.011718 -1.838564) (xy -33.530431 -1.714564) (xy 19.132848 -1.714564) (xy 19.185837 -1.806678) (xy 19.239081 -1.85312) (xy 19.416237 -1.93466) (xy 19.648324 -1.966893) (xy 19.876733 -1.947407) (xy 20.028143 -1.885567) (xy 20.114322 -1.756693) (xy 20.102503 -1.598868) (xy 20.000924 -1.452731) (xy 19.930272 -1.402804) (xy 19.794582 -1.347222) (xy 19.651086 -1.349346) (xy 19.502683 -1.387045) (xy 19.319371 -1.468279) (xy 19.188645 -1.573354) (xy 19.169582 -1.601358) (xy 19.132848 -1.714564) (xy -33.530431 -1.714564) (xy -33.563771 -1.706594) (xy -34.031071 -1.588403) (xy -34.426856 -1.48017) (xy -34.764365 -1.378074) (xy -35.056835 -1.278294) (xy -35.317505 -1.17701) (xy -35.559612 -1.0704) (xy -35.796395 -0.954645) (xy -35.825842 -0.939566) (xy -36.083235 -0.789417) (xy -36.33099 -0.613914) (xy -36.550537 -0.430458) (xy -36.723308 -0.256453) (xy -36.830734 -0.109299) (xy -36.854247 -0.0064) (xy -36.842329 0.013072) (xy -36.744431 0.035306) (xy -36.536518 0.025825) (xy -36.23103 -0.013417) (xy -35.840408 -0.080465) (xy -35.377092 -0.173364) (xy -34.853523 -0.290159) (xy -34.7345 -0.318152) (xy -34.290026 -0.41753) (xy -33.947301 -0.47809) (xy -33.687385 -0.500554) (xy -33.491341 -0.485643) (xy -33.340227 -0.434079) (xy -33.248709 -0.374735) (xy -33.116315 -0.232391) (xy -32.977972 -0.025655) (xy -32.858149 0.201185) (xy -32.781317 0.403844) (xy -32.766001 0.498904) (xy -32.812834 0.651474) (xy -32.942836 0.867655) (xy -33.14026 1.131402) (xy -33.38936 1.426671) (xy -33.4254 1.465963) (xy 36.08853 1.465963) (xy 36.125248 1.381854) (xy 36.268659 1.308444) (xy 36.429896 1.267832) (xy 36.705917 1.233867) (xy 37.060136 1.217442) (xy 37.444995 1.218359) (xy 37.812936 1.236422) (xy 38.116401 1.271436) (xy 38.135962 1.274871) (xy 38.476461 1.359687) (xy 38.694425 1.468939) (xy 38.792206 1.603973) (xy 38.7985 1.654036) (xy 38.751932 1.770305) (xy 38.606978 1.852294) (xy 38.355764 1.90229) (xy 37.990414 1.922578) (xy 37.871051 1.923259) (xy 37.476868 1.90794) (xy 37.110391 1.867398) (xy 36.782904 1.806765) (xy 36.505691 1.731173) (xy 36.290035 1.645755) (xy 36.14722 1.555641) (xy 36.08853 1.465963) (xy -33.4254 1.465963) (xy -33.674389 1.737419) (xy -33.979601 2.047602) (xy -34.28925 2.341176) (xy -34.587588 2.602096) (xy -34.85887 2.81432) (xy -35.087349 2.961803) (xy -35.246895 3.026654) (xy -35.474627 3.131674) (xy -35.627744 3.336388) (xy -35.68113 3.50535) (xy -35.720918 3.637385) (xy -35.796158 3.707574) (xy -35.946969 3.746809) (xy -36.007017 3.756277) (xy -36.262123 3.818411) (xy -36.617123 3.943744) (xy -37.073738 4.13302) (xy -37.63369 4.386981) (xy -38.298703 4.706368) (xy -38.862 4.98655) (xy -39.45722 5.290256) (xy -39.942354 5.547367) (xy -40.323686 5.762158) (xy -40.607498 5.938904) (xy -40.800073 6.081878) (xy -40.907692 6.195357) (xy -40.936639 6.283614) (xy -40.893195 6.350924) (xy -40.880276 6.359826) (xy -40.740255 6.399215) (xy -40.509865 6.412426) (xy -40.222611 6.401295) (xy -39.911996 6.367657) (xy -39.611524 6.313349) (xy -39.492706 6.283803) (xy -38.873504 6.127574) (xy -38.358591 6.029314) (xy -37.93936 5.988817) (xy -37.607207 6.005882) (xy -37.353527 6.080304) (xy -37.169713 6.211879) (xy -37.154581 6.22847) (xy -37.012804 6.349931) (xy -36.871978 6.411581) (xy -36.849829 6.4135) (xy -36.720749 6.400249) (xy -36.54689 6.358394) (xy -36.321012 6.284789) (xy -36.035878 6.176283) (xy -35.684252 6.029729) (xy -35.258894 5.841977) (xy -34.752567 5.609879) (xy -34.158034 5.330285) (xy -33.468056 5.000049) (xy -32.675396 4.61602) (xy -32.3215 4.443487) (xy -31.57776 4.081572) (xy -30.938275 3.773269) (xy -30.39411 3.514597) (xy -29.936333 3.301572) (xy -29.556009 3.130212) (xy -29.244204 2.996534) (xy -28.991985 2.896555) (xy -28.790418 2.826291) (xy -28.630568 2.781761) (xy -28.562615 2.767745) (xy -28.389669 2.754375) (xy -28.255984 2.804152) (xy -28.133832 2.902903) (xy -27.997006 3.06889) (xy -27.908558 3.251407) (xy -27.900752 3.283143) (xy -27.910668 3.435976) (xy -27.964314 3.546175) (xy -25.3365 3.546175) (xy -25.284253 3.445544) (xy -25.146469 3.311826) (xy -24.951583 3.167965) (xy -24.728032 3.036903) (xy -24.66975 3.008237) (xy -24.40467 2.898651) (xy -24.226519 2.864159) (xy -24.120759 2.903476) (xy -24.08791 2.9568) (xy -24.086796 3.123286) (xy -24.187943 3.297509) (xy -24.372181 3.450001) (xy -24.429086 3.481329) (xy -24.590402 3.547487) (xy -14.207578 3.547487) (xy -14.202862 3.374954) (xy -14.144363 3.191446) (xy -14.047415 3.034982) (xy -13.927354 2.94358) (xy -13.846906 2.936485) (xy -13.780868 2.990046) (xy -13.754705 3.131095) (xy -13.754021 3.235274) (xy -13.781566 3.451849) (xy -13.863963 3.593681) (xy -13.905112 3.631145) (xy -14.026121 3.706494) (xy -14.116433 3.690866) (xy -14.143177 3.671028) (xy -14.207578 3.547487) (xy -24.590402 3.547487) (xy -24.6796 3.584068) (xy -24.922543 3.644326) (xy -25.130958 3.660175) (xy -25.277889 3.629689) (xy -25.33638 3.550943) (xy -25.3365 3.546175) (xy -27.964314 3.546175) (xy -27.99748 3.614304) (xy -28.16567 3.821624) (xy -28.419719 4.061438) (xy -28.764108 4.337244) (xy -29.20332 4.652542) (xy -29.741834 5.010831) (xy -30.384134 5.415612) (xy -31.134699 5.870383) (xy -31.46425 6.065896) (xy -31.748777 6.235437) (xy -6.530893 6.235437) (xy -6.465992 5.978632) (xy -6.34439 5.719516) (xy -6.176812 5.487557) (xy -5.973985 5.312225) (xy -5.969 5.309098) (xy -5.794335 5.22276) (xy -5.673624 5.227355) (xy -5.631395 5.262946) (xy 20.968946 5.262946) (xy 20.998343 5.205864) (xy 21.131952 5.219683) (xy 21.369249 5.304609) (xy 21.638284 5.426228) (xy 21.858931 5.538737) (xy 22.154809 5.699133) (xy 22.492825 5.889007) (xy 22.839885 6.08995) (xy 22.969993 6.167015) (xy 23.311019 6.366508) (xy 23.655394 6.561084) (xy 23.970229 6.732611) (xy 24.222635 6.862953) (xy 24.297516 6.898925) (xy 24.769034 7.186479) (xy 25.164891 7.573258) (xy 25.203749 7.632829) (xy 25.81694 7.632829) (xy 25.893746 7.648738) (xy 26.067389 7.729518) (xy 26.116904 7.754254) (xy 26.386083 7.903314) (xy 26.592845 8.04529) (xy 26.720798 8.166679) (xy 26.753548 8.253979) (xy 26.74352 8.27038) (xy 26.619591 8.311987) (xy 26.444428 8.266909) (xy 26.243857 8.149412) (xy 26.043704 7.973762) (xy 25.906045 7.807755) (xy 25.825023 7.684825) (xy 25.81694 7.632829) (xy 25.203749 7.632829) (xy 25.476156 8.050432) (xy 25.490185 8.078203) (xy 25.598569 8.341412) (xy 25.649204 8.567735) (xy 25.638334 8.730997) (xy 25.592816 8.793319) (xy 25.518135 8.773142) (xy 25.39028 8.681244) (xy 25.285153 8.584654) (xy 25.078209 8.400905) (xy 24.761563 8.153796) (xy 24.335476 7.843517) (xy 23.800205 7.470253) (xy 23.156009 7.034192) (xy 22.987 6.921397) (xy 22.497388 6.59094) (xy 22.100169 6.311981) (xy 21.778274 6.071616) (xy 21.514637 5.85694) (xy 21.292191 5.655048) (xy 21.224875 5.58899) (xy 21.044282 5.390723) (xy 20.968946 5.262946) (xy -5.631395 5.262946) (xy -5.595545 5.29316) (xy -5.553105 5.434299) (xy -5.577432 5.644304) (xy -5.654462 5.894083) (xy -5.710193 6.019574) (xy 17.0815 6.019574) (xy 17.127874 5.970079) (xy 17.266876 6.00721) (xy 17.498323 6.130902) (xy 17.637126 6.217719) (xy 18.044742 6.50601) (xy 18.366195 6.785645) (xy 18.592246 7.0467) (xy 18.713657 7.279248) (xy 18.7325 7.394597) (xy 18.692079 7.481357) (xy 18.574965 7.474068) (xy 18.387379 7.374883) (xy 18.140369 7.189934) (xy 17.962465 7.031343) (xy 17.760045 6.832475) (xy 17.553215 6.615552) (xy 17.362079 6.402796) (xy 17.206744 6.21643) (xy 17.107314 6.078676) (xy 17.0815 6.019574) (xy -5.710193 6.019574) (xy -5.770135 6.154544) (xy -5.910389 6.396593) (xy -6.061161 6.59114) (xy -6.20839 6.709091) (xy -6.290528 6.731) (xy -6.370181 6.690714) (xy -6.447688 6.624242) (xy -6.528367 6.460463) (xy -6.530893 6.235437) (xy -31.748777 6.235437) (xy -32.133437 6.464643) (xy -32.711256 6.818294) (xy -33.218641 7.14106) (xy -33.676527 7.44715) (xy -34.105848 7.750774) (xy -34.52754 8.066143) (xy -34.962535 8.407465) (xy -35.21848 8.614208) (xy -35.572404 8.913227) (xy -35.877486 9.192137) (xy -36.121551 9.438361) (xy -36.292422 9.63932) (xy -36.377924 9.782438) (xy -36.385501 9.819691) (xy -36.32816 9.880893) (xy -36.159099 9.892173) (xy -35.882762 9.854941) (xy -35.503592 9.770611) (xy -35.026031 9.640592) (xy -34.454522 9.466298) (xy -33.79351 9.249139) (xy -33.047436 8.990527) (xy -32.220744 8.691875) (xy -31.317877 8.354593) (xy -30.343278 7.980094) (xy -29.30139 7.569789) (xy -29.289894 7.56521) (xy -28.706674 7.334061) (xy -28.230235 7.148232) (xy -27.850116 7.004228) (xy -27.555856 6.89855) (xy -27.336992 6.8277) (xy -27.183065 6.788181) (xy -27.083613 6.776496) (xy -27.028174 6.789147) (xy -27.01334 6.804065) (xy -27.027538 6.898448) (xy -27.142853 7.050389) (xy -27.350677 7.253496) (xy -27.371745 7.271398) (xy 12.7635 7.271398) (xy 12.802238 7.267127) (xy 12.90726 7.342212) (xy 13.061777 7.479945) (xy 13.249002 7.663618) (xy 13.452145 7.876525) (xy 13.654418 8.101959) (xy 13.839032 8.323212) (xy 13.903365 8.405739) (xy 14.152778 8.750974) (xy 14.242404 8.88824) (xy 18.099492 8.88824) (xy 18.113826 8.831343) (xy 18.220894 8.859361) (xy 18.422882 8.970521) (xy 18.57978 9.069403) (xy 18.768839 9.20099) (xy 19.024443 9.391547) (xy 19.316291 9.617887) (xy 19.614079 9.856824) (xy 19.685 9.915065) (xy 19.949309 10.130376) (xy 20.289123 10.402867) (xy 20.679129 10.712486) (xy 21.094013 11.039181) (xy 21.508462 11.362902) (xy 21.717 11.524642) (xy 22.443008 12.105695) (xy 23.123054 12.688656) (xy 23.745054 13.261759) (xy 24.296922 13.813239) (xy 24.766575 14.331331) (xy 25.141928 14.804272) (xy 25.260377 14.974287) (xy 25.4615 15.286527) (xy 25.588196 15.509537) (xy 25.644768 15.653736) (xy 25.635519 15.729547) (xy 25.579898 15.748) (xy 25.444026 15.709108) (xy 25.226235 15.599626) (xy 24.942105 15.430348) (xy 24.607215 15.212066) (xy 24.237145 14.955574) (xy 23.847475 14.671665) (xy 23.453784 14.371131) (xy 23.07165 14.064765) (xy 22.722448 13.768446) (xy 22.321184 13.407089) (xy 21.876136 12.990049) (xy 21.401663 12.532087) (xy 20.912128 12.047966) (xy 20.42189 11.552448) (xy 19.945312 11.060295) (xy 19.496753 10.586269) (xy 19.090576 10.145132) (xy 18.74114 9.751647) (xy 18.462807 9.420576) (xy 18.340293 9.263876) (xy 18.17571 9.031826) (xy 18.099492 8.88824) (xy 14.242404 8.88824) (xy 14.37712 9.094562) (xy 14.5645 9.415337) (xy 14.703027 9.692133) (xy 14.780809 9.903785) (xy 14.793388 9.98999) (xy 14.758984 10.036513) (xy 14.665571 9.989394) (xy 14.523377 9.86146) (xy 14.342629 9.665537) (xy 14.133552 9.414453) (xy 13.906375 9.121033) (xy 13.671322 8.798105) (xy 13.438623 8.458495) (xy 13.218502 8.115029) (xy 13.021187 7.780535) (xy 12.996809 7.736683) (xy 12.885138 7.529002) (xy 12.802601 7.365626) (xy 12.764469 7.277007) (xy 12.7635 7.271398) (xy -27.371745 7.271398) (xy -27.642403 7.501374) (xy -28.009424 7.787628) (xy -28.443135 8.105865) (xy -28.934927 8.449691) (xy -29.285348 8.684714) (xy -27.419923 8.684714) (xy -27.386531 8.561419) (xy -27.26835 8.419224) (xy -27.097703 8.288366) (xy -26.90691 8.199083) (xy -26.897974 8.196412) (xy -26.706306 8.159299) (xy -26.47429 8.137963) (xy -26.416 8.136308) (xy -26.13025 8.133162) (xy -26.3525 8.325665) (xy -26.640654 8.549766) (xy -26.905132 8.707817) (xy -27.130577 8.794651) (xy -27.301633 8.805104) (xy -27.402942 8.734009) (xy -27.419923 8.684714) (xy -29.285348 8.684714) (xy -29.476195 8.812712) (xy -30.058332 9.188533) (xy -30.672731 9.570761) (xy -31.01975 9.780483) (xy -31.639088 10.15546) (xy -32.174316 10.489034) (xy -32.620952 10.778127) (xy -32.974515 11.019659) (xy -33.230523 11.210553) (xy -33.384494 11.34773) (xy -33.431946 11.42811) (xy -33.429282 11.435613) (xy -33.336565 11.47867) (xy -33.149685 11.492679) (xy -32.897678 11.479434) (xy -32.609577 11.440731) (xy -32.314418 11.378365) (xy -32.256724 11.363109) (xy -31.939793 11.257221) (xy -31.533078 11.090994) (xy -31.053919 10.872298) (xy -30.51966 10.609004) (xy -30.020236 10.348022) (xy -29.625495 10.162958) (xy -29.175895 9.99631) (xy -28.69328 9.852116) (xy -28.199494 9.734412) (xy -27.71638 9.647233) (xy -27.265784 9.594616) (xy -26.869547 9.580598) (xy -26.549515 9.609215) (xy -26.353063 9.670407) (xy -26.221036 9.756578) (xy -26.164037 9.85346) (xy -26.188104 9.972883) (xy -26.299276 10.126677) (xy -26.50359 10.326672) (xy -26.807084 10.584698) (xy -26.82875 10.602423) (xy -27.260618 10.942789) (xy -27.689546 11.257996) (xy -28.101349 11.539398) (xy -28.481837 11.778352) (xy -28.816822 11.966212) (xy -29.092117 12.094334) (xy -29.293534 12.154074) (xy -29.374081 12.153238) (xy -29.515142 12.156698) (xy -29.578195 12.23427) (xy -29.554207 12.353427) (xy -29.459864 12.462118) (xy -29.330156 12.53944) (xy -29.173634 12.560484) (xy -29.010608 12.546065) (xy -28.606111 12.456167) (xy -28.127544 12.288173) (xy -27.593481 12.05086) (xy -27.022491 11.753004) (xy -26.433146 11.403381) (xy -26.019815 11.132671) (xy -25.716687 10.92614) (xy -25.414174 10.720151) (xy -25.146583 10.538056) (xy -24.94822 10.403208) (xy -24.942122 10.399067) (xy -24.720697 10.265649) (xy -24.50413 10.162736) (xy -24.356432 10.116628) (xy -24.206594 10.106879) (xy -24.086516 10.150241) (xy -23.946868 10.267433) (xy -23.909436 10.304365) (xy -23.767088 10.468865) (xy -23.700573 10.620018) (xy -23.713459 10.78153) (xy -23.809313 10.977105) (xy -23.991704 11.230446) (xy -24.062214 11.319248) (xy -24.518305 11.838485) (xy -25.064973 12.373122) (xy -25.708673 12.928538) (xy -26.455861 13.510116) (xy -27.312992 14.123236) (xy -27.90825 14.525411) (xy -28.476876 14.904673) (xy -28.943692 15.221837) (xy -29.314949 15.48153) (xy -29.596895 15.688381) (xy -29.795781 15.847016) (xy -29.917855 15.962062) (xy -29.969368 16.038148) (xy -29.972 16.05353) (xy -29.92214 16.120664) (xy -29.780644 16.120004) (xy -29.55964 16.056983) (xy -29.271257 15.937033) (xy -28.927623 15.765587) (xy -28.540866 15.548078) (xy -28.123113 15.289938) (xy -27.823198 15.091016) (xy -27.485928 14.866244) (xy -27.238268 14.714669) (xy -27.069634 14.631445) (xy -26.969445 14.611726) (xy -26.927116 14.650666) (xy -26.924 14.679284) (xy -26.969874 14.758306) (xy -27.100378 14.910986) (xy -27.304831 15.127043) (xy -27.572558 15.396199) (xy -27.892879 15.708171) (xy -28.255115 16.052682) (xy -28.648589 16.41945) (xy -29.062623 16.798195) (xy -29.486537 17.178639) (xy -29.87675 17.521887) (xy -30.526045 18.091436) (xy -31.079305 18.586581) (xy -31.540434 19.011285) (xy -31.913334 19.369513) (xy -32.201908 19.665229) (xy -32.410059 19.902397) (xy -32.54169 20.08498) (xy -32.600703 20.216944) (xy -32.598995 20.286866) (xy -32.496637 20.394213) (xy -32.307224 20.468241) (xy -32.068738 20.497894) (xy -31.906865 20.488338) (xy -31.62042 20.419642) (xy -31.302345 20.282876) (xy -30.930687 20.067733) (xy -30.730444 19.936062) (xy -30.384053 19.720819) (xy -30.071597 19.578234) (xy -29.740021 19.488437) (xy -29.402384 19.438643) (xy -29.123271 19.399986) (xy -28.882865 19.344228) (xy -28.66688 19.259919) (xy -28.461031 19.135606) (xy -28.251034 18.959836) (xy -28.022601 18.721159) (xy -27.761448 18.408121) (xy -27.453289 18.009271) (xy -27.20519 17.677243) (xy -26.716912 17.044022) (xy -26.27412 16.524227) (xy -25.872799 16.114328) (xy -25.50893 15.810796) (xy -25.178499 15.610102) (xy -24.877489 15.508715) (xy -24.720783 15.494001) (xy -24.600502 15.507748) (xy -24.534492 15.556737) (xy -24.526403 15.652588) (xy -24.579881 15.806922) (xy -24.698576 16.031359) (xy -24.886135 16.337519) (xy -25.079025 16.63512) (xy -25.37163 17.091257) (xy -25.585815 17.452579) (xy -25.722011 17.723824) (xy -25.780653 17.909731) (xy -25.762173 18.01504) (xy -25.667005 18.044489) (xy -25.49558 18.002817) (xy -25.248332 17.894763) (xy -25.191515 17.86646) (xy -24.874025 17.696976) (xy -24.563255 17.510796) (xy -24.250736 17.300217) (xy -23.927995 17.057539) (xy -23.586563 16.775062) (xy -23.217967 16.445083) (xy -22.813736 16.059901) (xy -22.365401 15.611817) (xy -21.864489 15.093129) (xy -21.302531 14.496135) (xy -20.671053 13.813136) (xy -20.36316 13.476997) (xy -19.761224 12.821823) (xy -19.24045 12.262578) (xy -18.799891 11.798302) (xy -18.438602 11.428037) (xy -18.155637 11.150821) (xy -17.95005 10.965697) (xy -17.820895 10.871703) (xy -17.782489 10.8585) (xy -17.731422 10.904552) (xy -17.755179 11.034522) (xy -17.845661 11.236138) (xy -17.974561 11.46175) (xy -16.514405 11.46175) (xy -16.218918 10.860642) (xy -16.04593 10.514133) (xy -15.915286 10.26777) (xy -15.816973 10.105994) (xy -15.740977 10.013244) (xy -15.677286 9.973962) (xy -15.645447 9.9695) (xy -15.576607 10.023721) (xy -15.5575 10.117364) (xy -15.601208 10.279972) (xy -15.722063 10.505763) (xy -15.904669 10.770948) (xy -16.133628 11.051737) (xy -16.233587 11.161862) (xy -16.458798 11.402367) (xy -5.712316 11.402367) (xy -5.688884 11.102657) (xy -5.647081 10.942126) (xy -5.531441 10.726845) (xy -5.390032 10.58779) (xy -5.245235 10.533225) (xy -5.119436 10.571414) (xy -5.035016 10.710622) (xy -5.033585 10.715625) (xy -4.994455 10.962505) (xy -4.98976 11.260372) (xy -5.016045 11.561882) (xy -5.069859 11.819692) (xy -5.123746 11.951735) (xy -5.265223 12.12809) (xy -5.406209 12.183928) (xy -5.534581 12.118647) (xy -5.621073 11.97638) (xy -5.689184 11.714595) (xy -5.712316 11.402367) (xy -16.458798 11.402367) (xy -16.514405 11.46175) (xy -17.974561 11.46175) (xy -17.994773 11.497126) (xy -18.194416 11.805212) (xy -18.436494 12.148122) (xy -18.712909 12.513582) (xy -19.015564 12.889317) (xy -19.336362 13.263055) (xy -19.458149 13.3985) (xy -19.675268 13.645393) (xy -19.87639 13.889409) (xy -20.035484 14.098138) (xy -20.11152 14.211958) (xy -20.190803 14.359404) (xy -20.236773 14.495578) (xy -20.256104 14.660205) (xy -20.255466 14.89301) (xy -20.250157 15.037458) (xy -20.231294 15.615754) (xy -20.230526 15.743649) (xy -18.282434 15.743649) (xy -18.254526 15.514066) (xy -18.190036 15.271737) (xy -18.098935 15.067155) (xy -18.096613 15.063307) (xy -17.979349 14.901305) (xy -17.899618 14.860015) (xy -17.859151 14.938299) (xy -17.859678 15.135022) (xy -17.867705 15.21372) (xy -17.914461 15.471746) (xy -17.984299 15.695429) (xy -18.066365 15.865688) (xy -18.149805 15.963444) (xy -18.223766 15.969616) (xy -18.263792 15.909995) (xy -18.282434 15.743649) (xy -20.230526 15.743649) (xy -20.228452 16.088656) (xy -20.24282 16.476903) (xy -20.275586 16.801231) (xy -20.327938 17.082377) (xy -20.377991 17.268275) (xy -20.588632 17.835877) (xy -20.613735 17.888022) (xy -19.4945 17.888022) (xy -19.435165 17.594977) (xy -19.266024 17.295259) (xy -19.039074 17.047434) (xy -18.83671 16.891072) (xy -18.692832 16.844817) (xy -18.601171 16.909525) (xy -18.555461 17.086051) (xy -18.552849 17.113779) (xy -18.576715 17.49145) (xy -18.711286 17.816028) (xy -18.894245 18.028111) (xy -19.111396 18.176311) (xy -19.29126 18.216293) (xy -19.421085 18.151033) (xy -19.488122 17.983507) (xy -19.4945 17.888022) (xy -20.613735 17.888022) (xy -20.897175 18.476792) (xy -21.301087 19.18661) (xy -21.797834 19.960915) (xy -22.384881 20.795295) (xy -22.466461 20.906271) (xy -22.896184 21.500003) (xy -23.321129 22.109511) (xy -23.730545 22.717948) (xy -24.113685 23.308468) (xy -24.4598 23.864224) (xy -24.758141 24.368368) (xy -24.997961 24.804052) (xy -25.149363 25.111489) (xy -25.267796 25.390544) (xy -25.32404 25.574683) (xy -25.32026 25.67848) (xy -25.258622 25.716506) (xy -25.23944 25.7175) (xy -25.091495 25.680907) (xy -24.862501 25.579043) (xy -24.572293 25.423784) (xy -24.240704 25.227002) (xy -23.887569 25.000574) (xy -23.532724 24.756373) (xy -23.196003 24.506275) (xy -23.130472 24.454925) (xy -22.884529 24.23544) (xy -22.582437 23.921281) (xy -22.221468 23.509316) (xy -21.798892 22.996414) (xy -21.311978 22.379444) (xy -21.241546 22.2885) (xy -20.711309 21.606689) (xy -20.244913 21.017251) (xy -19.832367 20.50923) (xy -19.46368 20.071665) (xy -19.128859 19.693598) (xy -18.817913 19.364072) (xy -18.520849 19.072127) (xy -18.227676 18.806805) (xy -17.928403 18.557148) (xy -17.622549 18.319372) (xy -17.195513 17.986144) (xy -16.856867 17.694423) (xy -16.584819 17.422562) (xy -16.357576 17.148914) (xy -16.167582 16.874213) (xy -15.9826 16.607819) (xy -15.836589 16.442362) (xy -15.735609 16.379002) (xy -15.685723 16.418899) (xy -15.69299 16.563213) (xy -15.757565 16.79575) (xy -15.82065 16.958306) (xy -15.930294 17.214489) (xy -16.077262 17.543839) (xy -16.252322 17.925896) (xy -16.44624 18.340198) (xy -16.602929 18.669) (xy -16.857233 19.200942) (xy -17.059155 19.629924) (xy -17.213152 19.966561) (xy -17.323679 20.221465) (xy -17.395192 20.40525) (xy -17.432148 20.528528) (xy -17.439002 20.601913) (xy -17.426694 20.630974) (xy -17.398031 20.63789) (xy -17.353377 20.607876) (xy -17.287191 20.532325) (xy -17.193935 20.402632) (xy -17.068069 20.210191) (xy -16.904053 19.946397) (xy -16.696349 19.602644) (xy -16.439417 19.170327) (xy -16.127718 18.640839) (xy -15.94486 18.328873) (xy -15.782177 18.072983) (xy -15.607511 17.833021) (xy -15.452018 17.650948) (xy -15.414443 17.614498) (xy -15.294492 17.511172) (xy -15.190438 17.447613) (xy -15.066545 17.414169) (xy -14.887076 17.401183) (xy -14.616791 17.399001) (xy -14.336824 17.39505) (xy -14.151636 17.379034) (xy -14.029139 17.344704) (xy -13.937244 17.28581) (xy -13.909637 17.261294) (xy -13.817025 17.151835) (xy -13.71482 16.983519) (xy -13.599775 16.747973) (xy -13.468641 16.436825) (xy -13.318172 16.041702) (xy -13.14512 15.554232) (xy -12.946237 14.966042) (xy -12.718276 14.268759) (xy -12.571876 13.812369) (xy -12.415128 13.361885) (xy -12.251284 12.964322) (xy -12.088175 12.634192) (xy -11.933631 12.386009) (xy -11.795485 12.234286) (xy -11.697574 12.192) (xy -11.650154 12.252025) (xy -11.639041 12.428998) (xy -11.663899 12.718269) (xy -11.724392 13.115188) (xy -11.789227 13.462) (xy -11.978097 14.208314) (xy -12.253294 15.00375) (xy -12.600929 15.819427) (xy -13.007109 16.626462) (xy -13.457943 17.395973) (xy -13.939539 18.099075) (xy -14.15012 18.370699) (xy -14.458156 18.771279) (xy -14.669879 19.090875) (xy -14.785885 19.330584) (xy -14.806769 19.491507) (xy -14.78384 19.540301) (xy -14.644703 19.613757) (xy -14.438402 19.597601) (xy -14.184634 19.494872) (xy -14.075477 19.431001) (xy -13.849472 19.297748) (xy -13.705651 19.24705) (xy -13.626275 19.283082) (xy -13.5936 19.410017) (xy -13.589 19.545451) (xy -13.606852 19.712346) (xy -13.662209 19.959029) (xy -13.757777 20.295044) (xy -13.89626 20.729937) (xy -14.070277 21.244076) (xy -14.360521 22.086508) (xy -14.611262 22.820479) (xy -14.825341 23.45726) (xy -15.005598 24.008121) (xy -15.154872 24.484336) (xy -15.276003 24.897176) (xy -15.371831 25.257912) (xy -15.445196 25.577816) (xy -15.498938 25.86816) (xy -15.535897 26.140216) (xy -15.558912 26.405254) (xy -15.570824 26.674548) (xy -15.574472 26.959368) (xy -15.573314 27.20975) (xy -15.566744 27.57467) (xy -15.554881 27.911213) (xy -15.539137 28.191467) (xy -15.520923 28.387517) (xy -15.510688 28.448) (xy -15.433326 28.626529) (xy -15.315676 28.685173) (xy -15.158249 28.624316) (xy -14.961553 28.444343) (xy -14.726099 28.145638) (xy -14.452396 27.728584) (xy -14.364715 27.583498) (xy -14.221802 27.331001) (xy -14.031524 26.97588) (xy -13.800106 26.530649) (xy -13.533771 26.007825) (xy -13.238744 25.419922) (xy -12.921248 24.779457) (xy -12.587508 24.098944) (xy -12.243748 23.390898) (xy -11.896192 22.667837) (xy -11.551065 21.942274) (xy -11.399837 21.62175) (xy -11.111683 21.015028) (xy -10.828115 20.428597) (xy -10.555706 19.875343) (xy -10.301028 19.368155) (xy -10.070654 18.919921) (xy -9.871154 18.543528) (xy -9.709103 18.251864) (xy -9.591071 18.057817) (xy -9.559273 18.012546) (xy -9.435384 17.921501) (xy -9.307644 17.946772) (xy -9.197592 18.08024) (xy -9.16346 18.161774) (xy -9.097346 18.481524) (xy -9.078195 18.901099) (xy -9.103665 19.403286) (xy -9.171411 19.970873) (xy -9.27909 20.586648) (xy -9.424359 21.233397) (xy -9.604873 21.893909) (xy -9.722934 22.270859) (xy -9.828497 22.612947) (xy -9.883141 22.855344) (xy -9.885665 23.015224) (xy -9.834867 23.10976) (xy -9.729548 23.156125) (xy -9.660346 23.16621) (xy -9.34836 23.135487) (xy -9.056478 22.981252) (xy -8.78402 22.702879) (xy -8.530305 22.299745) (xy -8.384883 21.9933) (xy -8.086787 21.206562) (xy -7.883114 20.45298) (xy -7.775462 19.743375) (xy -7.765433 19.088568) (xy -7.854626 18.499381) (xy -7.863268 18.465975) (xy -8.026926 17.64654) (xy -8.108664 16.73051) (xy -8.108439 15.718373) (xy -8.108356 15.71625) (xy -8.072853 15.121155) (xy -8.017302 14.648637) (xy -7.941154 14.29578) (xy -7.843864 14.059668) (xy -7.782728 13.980062) (xy -7.707911 13.92151) (xy -7.639597 13.932867) (xy -7.539765 14.026371) (xy -7.498668 14.071514) (xy -7.340636 14.306221) (xy -7.184237 14.646624) (xy -7.033841 15.071446) (xy -6.893813 15.559411) (xy -6.768523 16.089243) (xy -6.662339 16.639667) (xy -6.579628 17.189408) (xy -6.524759 17.717188) (xy -6.502099 18.201734) (xy -6.516017 18.621767) (xy -6.533584 18.77224) (xy -6.581048 19.031976) (xy -6.638922 19.264994) (xy -6.675396 19.3675) (xy -3.77314 19.3675) (xy -3.766097 18.923163) (xy -3.739235 18.581576) (xy -3.687402 18.319337) (xy -3.605442 18.113046) (xy -3.488202 17.939301) (xy -3.448487 17.893449) (xy -3.331582 17.794445) (xy -3.252406 17.813754) (xy -3.193099 17.954625) (xy -3.176285 18.079175) (xy -3.162884 18.305035) (xy -3.15279 18.613799) (xy -3.145897 18.987062) (xy -3.142097 19.406418) (xy -3.141285 19.853461) (xy -3.143354 20.309785) (xy -3.148197 20.756983) (xy -3.155709 21.17665) (xy -3.165782 21.550381) (xy -3.178311 21.859768) (xy -3.193188 22.086406) (xy -3.210307 22.21189) (xy -3.217821 22.229699) (xy -3.279443 22.226055) (xy -3.348604 22.113064) (xy -3.421968 21.907912) (xy -3.496201 21.627787) (xy -3.567969 21.289874) (xy -3.633937 20.91136) (xy -3.690771 20.509432) (xy -3.735135 20.101276) (xy -3.763696 19.704079) (xy -3.77314 19.3675) (xy -6.675396 19.3675) (xy -6.695071 19.422794) (xy -6.697645 19.427897) (xy -6.765678 19.583637) (xy -6.82386 19.776818) (xy -6.87564 20.026301) (xy -6.924464 20.350946) (xy -6.973782 20.769615) (xy -7.0126 21.150825) (xy -7.067056 21.771202) (xy -7.113971 22.427743) (xy -7.153105 23.105559) (xy -7.184216 23.789761) (xy -7.207064 24.46546) (xy -7.221408 25.117766) (xy -7.227006 25.731792) (xy -7.223618 26.292647) (xy -7.211002 26.785443) (xy -7.188917 27.19529) (xy -7.157122 27.5073) (xy -7.118572 27.696794) (xy -6.997529 27.983343) (xy -6.856072 28.145061) (xy -6.697754 28.181836) (xy -6.526127 28.093555) (xy -6.344744 27.880105) (xy -6.250346 27.724315) (xy -6.149537 27.531222) (xy -6.064445 27.338122) (xy -5.992205 27.129645) (xy -5.929952 26.890422) (xy -5.874819 26.605085) (xy -5.823943 26.258264) (xy -5.774458 25.83459) (xy -5.723499 25.318694) (xy -5.6682 24.695207) (xy -5.653555 24.523003) (xy -5.614705 24.145152) (xy -5.565064 23.783893) (xy -5.50885 23.460306) (xy -5.450284 23.19547) (xy -5.393587 23.010465) (xy -5.342978 22.926368) (xy -5.333334 22.9235) (xy -5.289803 22.981374) (xy -5.215682 23.143453) (xy -5.117287 23.392425) (xy -5.000937 23.710975) (xy -4.872949 24.081792) (xy -4.739641 24.48756) (xy -4.607329 24.910969) (xy -4.603445 24.92375) (xy -4.441324 25.454502) (xy -4.308581 25.880523) (xy -4.199253 26.219065) (xy -4.107379 26.487383) (xy -4.026997 26.702728) (xy -3.952144 26.882353) (xy -3.876858 27.043512) (xy -3.857365 27.08275) (xy -3.592099 27.561103) (xy -3.314255 27.97071) (xy -3.034316 28.30028) (xy -2.762771 28.538524) (xy -2.510103 28.67415) (xy -2.353555 28.702001) (xy -2.212604 28.640004) (xy -2.059777 28.458283) (xy -1.898045 28.163245) (xy -1.730381 27.761295) (xy -1.559754 27.258839) (xy -1.389138 26.662281) (xy -1.365646 26.572487) (xy -1.266461 26.181021) (xy -1.183748 25.829047) (xy -1.116241 25.500328) (xy -1.06267 25.178625) (xy -1.02177 24.847702) (xy -0.992272 24.491322) (xy -0.97291 24.093247) (xy -0.962415 23.637241) (xy -0.959521 23.107066) (xy -0.962959 22.486485) (xy -0.971463 21.759261) (xy -0.97424 21.55825) (xy -0.984489 20.922039) (xy -0.997249 20.275263) (xy -1.011924 19.640022) (xy -1.027917 19.038411) (xy -1.044631 18.492528) (xy -1.06147 18.02447) (xy -1.077837 17.656335) (xy -1.081396 17.5895) (xy -1.107892 17.049142) (xy -1.129352 16.484543) (xy -1.145738 15.911009) (xy -1.157011 15.343845) (xy -1.163135 14.798358) (xy -1.164072 14.289855) (xy -1.159782 13.83364) (xy -1.15023 13.44502) (xy -1.135375 13.139301) (xy -1.115182 12.931789) (xy -1.093141 12.842875) (xy -0.997027 12.722866) (xy -0.909162 12.725008) (xy -0.821052 12.851208) (xy -0.794815 12.909909) (xy -0.747103 13.043428) (xy -0.705724 13.206445) (xy -0.701025 13.233115) (xy 5.216693 13.233115) (xy 5.252896 13.153674) (xy 5.341085 13.188881) (xy 5.485077 13.337473) (xy 5.489022 13.342151) (xy 5.616514 13.525469) (xy 5.770637 13.794272) (xy 5.935084 14.114525) (xy 6.044017 14.346649) (xy 14.097 14.346649) (xy 14.131434 14.19844) (xy 14.234249 14.156539) (xy 14.404712 14.220707) (xy 14.642091 14.390705) (xy 14.87876 14.601867) (xy 15.199233 14.933399) (xy 15.439322 15.239462) (xy 15.591976 15.508338) (xy 15.650142 15.72831) (xy 15.629715 15.849481) (xy 15.556261 15.964006) (xy 15.460456 15.992338) (xy 15.312994 15.935984) (xy 15.202519 15.871459) (xy 15.028303 15.73215) (xy 14.827576 15.522909) (xy 14.619503 15.270171) (xy 14.423255 15.000376) (xy 14.257997 14.73996) (xy 14.142898 14.515361) (xy 14.097125 14.353016) (xy 14.097 14.346649) (xy 6.044017 14.346649) (xy 6.093548 14.452192) (xy 6.229722 14.773238) (xy 6.327298 15.043626) (xy 6.358057 15.15595) (xy 6.387735 15.385799) (xy 6.382105 15.614806) (xy 6.346886 15.812224) (xy 6.287798 15.947306) (xy 6.21056 15.989304) (xy 6.203365 15.987603) (xy 6.128163 15.912688) (xy 6.025878 15.737352) (xy 5.904729 15.483172) (xy 5.772933 15.171721) (xy 5.638706 14.824577) (xy 5.510268 14.463313) (xy 5.395835 14.109505) (xy 5.303624 13.78473) (xy 5.241853 13.51056) (xy 5.22866 13.428471) (xy 5.216693 13.233115) (xy -0.701025 13.233115) (xy -0.669881 13.409871) (xy -0.638774 13.664617) (xy -0.611605 13.981594) (xy -0.587577 14.371712) (xy -0.56589 14.845882) (xy -0.545746 15.415014) (xy -0.526347 16.09002) (xy -0.508155 16.8275) (xy -0.486575 17.690304) (xy -0.464633 18.432933) (xy -0.441897 19.062214) (xy -0.417935 19.584972) (xy -0.392315 20.008035) (xy -0.364604 20.338226) (xy -0.334369 20.582373) (xy -0.301178 20.7473) (xy -0.2646 20.839835) (xy -0.253096 20.854305) (xy -0.174548 20.873415) (xy -0.103339 20.76861) (xy -0.040017 20.542794) (xy 0.014869 20.198872) (xy 0.060772 19.739748) (xy 0.097143 19.168325) (xy 0.107418 18.944747) (xy 0.149665 17.93875) (xy 0.357148 18.89125) (xy 0.500632 19.591099) (xy 0.610335 20.230742) (xy 0.69037 20.847939) (xy 0.744853 21.480449) (xy 0.777897 22.166031) (xy 0.793079 22.89175) (xy 0.801355 23.361558) (xy 0.814621 23.780619) (xy 0.831937 24.130831) (xy 0.852369 24.394089) (xy 0.874978 24.552291) (xy 0.879961 24.570612) (xy 0.965088 24.756891) (xy 1.094643 24.964108) (xy 1.146207 25.032493) (xy 1.310088 25.263741) (xy 1.450854 25.528378) (xy 1.57599 25.846988) (xy 1.692984 26.240155) (xy 1.80932 26.728464) (xy 1.872713 27.030128) (xy 2.005531 27.658994) (xy 2.127407 28.176002) (xy 2.243475 28.595271) (xy 2.358872 28.930923) (xy 2.47873 29.197075) (xy 2.608187 29.40785) (xy 2.752375 29.577366) (xy 2.823173 29.64372) (xy 3.062957 29.816141) (xy 3.271993 29.891329) (xy 3.434189 29.864132) (xy 3.458326 29.847012) (xy 3.537918 29.76087) (xy 3.599687 29.640393) (xy 3.645576 29.470538) (xy 3.677532 29.236258) (xy 3.697497 28.922508) (xy 3.707418 28.514244) (xy 3.709239 27.99642) (xy 3.708933 27.90825) (xy 3.700811 27.307338) (xy 3.680442 26.709783) (xy 3.646216 26.095235) (xy 3.596521 25.443342) (xy 3.529746 24.733753) (xy 3.444279 23.946116) (xy 3.338509 23.060081) (xy 3.301661 22.76475) (xy 3.22372 22.136074) (xy 3.162633 21.617694) (xy 3.117376 21.194175) (xy 3.086924 20.850077) (xy 3.070254 20.569963) (xy 3.066342 20.338396) (xy 3.074162 20.139937) (xy 3.09269 19.959149) (xy 3.108473 19.853031) (xy 3.175923 19.549218) (xy 3.270446 19.266147) (xy 3.380051 19.029356) (xy 3.492747 18.86438) (xy 3.596542 18.796756) (xy 3.604694 18.796316) (xy 3.728846 18.82493) (xy 3.864754 18.915253) (xy 4.017576 19.075033) (xy 4.192473 19.31202) (xy 4.394601 19.633965) (xy 4.62912 20.048618) (xy 4.901188 20.563727) (xy 5.215964 21.187044) (xy 5.274057 21.30425) (xy 5.479814 21.713248) (xy 5.682033 22.102277) (xy 5.869516 22.450759) (xy 6.031062 22.738118) (xy 6.155474 22.943775) (xy 6.207147 23.01875) (xy 6.540295 23.352383) (xy 6.95825 23.598028) (xy 7.429442 23.743923) (xy 7.605565 23.786389) (xy 7.758046 23.84678) (xy 7.894084 23.936927) (xy 8.020878 24.068663) (xy 8.145627 24.253819) (xy 8.275529 24.504229) (xy 8.417784 24.831724) (xy 8.579591 25.248136) (xy 8.768148 25.765297) (xy 8.919966 26.19375) (xy 9.223419 27.046433) (xy 9.493974 27.785095) (xy 9.735005 28.417427) (xy 9.949888 28.95112) (xy 10.141996 29.393863) (xy 10.314704 29.753346) (xy 10.471387 30.03726) (xy 10.615419 30.253294) (xy 10.750175 30.409139) (xy 10.783351 30.440077) (xy 10.924253 30.521165) (xy 11.049867 30.490883)) (layer B.SilkS) (width 0.01)) (fp_poly (pts (xy 33.167845 14.027427) (xy 33.24412 13.900608) (xy 33.228276 13.749518) (xy 33.10245 13.577745) (xy 32.879256 13.397756) (xy 32.571307 13.222019) (xy 32.544354 13.208979) (xy 32.250613 13.07457) (xy 32.049444 12.998823) (xy 31.923419 12.976923) (xy 31.855112 13.004054) (xy 31.84613 13.016076) (xy 31.85185 13.116998) (xy 31.934765 13.275645) (xy 32.074376 13.468591) (xy 32.250187 13.672412) (xy 32.441698 13.863683) (xy 32.628411 14.01898) (xy 32.78983 14.114877) (xy 32.816059 14.124485) (xy 33.005073 14.125317) (xy 33.167845 14.027427)) (layer B.SilkS) (width 0.01)) (fp_poly (pts (xy 0.650556 -8.670962) (xy 0.916733 -8.678634) (xy 1.112619 -8.696221) (xy 1.266549 -8.727184) (xy 1.406859 -8.774988) (xy 1.509993 -8.819351) (xy 1.912898 -9.069485) (xy 2.244815 -9.420761) (xy 2.502881 -9.867141) (xy 2.684231 -10.402584) (xy 2.786001 -11.021049) (xy 2.808294 -11.557) (xy 2.762036 -12.218698) (xy 2.636583 -12.84588) (xy 2.440221 -13.42894) (xy 2.181236 -13.95827) (xy 1.867916 -14.424266) (xy 1.508547 -14.817322) (xy 1.111417 -15.12783) (xy 0.684811 -15.346185) (xy 0.237016 -15.462781) (xy -0.223681 -15.468013) (xy -0.515632 -15.410138) (xy -0.987394 -15.212841) (xy -1.425273 -14.902242) (xy -1.814378 -14.49061) (xy -2.052978 -14.143561) (xy -2.300091 -13.62066) (xy -2.468275 -13.025478) (xy -2.557508 -12.385245) (xy -2.56777 -11.727188) (xy -2.499039 -11.078538) (xy -2.410888 -10.71338) (xy 0.08769 -10.71338) (xy 0.108518 -11.045064) (xy 0.228327 -11.375567) (xy 0.426569 -11.664163) (xy 0.66675 -11.861227) (xy 0.926237 -11.961133) (xy 1.194245 -11.984446) (xy 1.432285 -11.933051) (xy 1.596505 -11.815647) (xy 1.681792 -11.636947) (xy 1.73886 -11.369145) (xy 1.767184 -11.04708) (xy 1.766239 -10.705592) (xy 1.735501 -10.379523) (xy 1.674445 -10.103712) (xy 1.624154 -9.978985) (xy 1.489943 -9.80191) (xy 1.311958 -9.722086) (xy 1.076128 -9.737773) (xy 0.768384 -9.847227) (xy 0.723932 -9.867521) (xy 0.408253 -10.066114) (xy 0.202156 -10.322094) (xy 0.096602 -10.647476) (xy 0.08769 -10.71338) (xy -2.410888 -10.71338) (xy -2.351295 -10.466525) (xy -2.124517 -9.918377) (xy -2.056316 -9.795938) (xy -1.728106 -9.348551) (xy -1.337437 -9.01174) (xy -0.963145 -8.815118) (xy -0.798806 -8.755776) (xy -0.636011 -8.715055) (xy -0.445297 -8.689525) (xy -0.197201 -8.675757) (xy 0.137739 -8.67032) (xy 0.28575 -8.669741) (xy 0.650556 -8.670962)) (layer B.SilkS) (width 0.01)) (fp_poly (pts (xy -10.015769 -8.101232) (xy -9.79982 -8.114631) (xy -9.628334 -8.148034) (xy -9.460075 -8.209376) (xy -9.260386 -8.303356) (xy -8.79599 -8.599765) (xy -8.380484 -9.000088) (xy -8.027479 -9.48624) (xy -7.750588 -10.040134) (xy -7.593396 -10.518415) (xy -7.531979 -10.869932) (xy -7.500959 -11.297691) (xy -7.50037 -11.75462) (xy -7.530248 -12.193643) (xy -7.590627 -12.567687) (xy -7.591868 -12.573) (xy -7.739406 -13.044242) (xy -7.952704 -13.512538) (xy -8.215343 -13.953645) (xy -8.5109 -14.343322) (xy -8.822953 -14.657325) (xy -9.135081 -14.871414) (xy -9.155758 -14.88167) (xy -9.486298 -14.996412) (xy -9.885397 -15.067603) (xy -10.300415 -15.089623) (xy -10.678707 -15.056851) (xy -10.720306 -15.048723) (xy -11.240834 -14.876876) (xy -11.726225 -14.59593) (xy -12.154943 -14.223059) (xy -12.505452 -13.775433) (xy -12.656416 -13.504992) (xy -12.832824 -13.101273) (xy -12.949948 -12.72343) (xy -13.016968 -12.32759) (xy -13.043062 -11.869877) (xy -13.044051 -11.65225) (xy -13.001362 -10.991701) (xy -12.947215 -10.69424) (xy -11.149436 -10.69424) (xy -11.148014 -10.702019) (xy -11.034665 -10.98357) (xy -10.82139 -11.237152) (xy -10.534225 -11.451001) (xy -10.199205 -11.61335) (xy -9.842365 -11.712436) (xy -9.489743 -11.736493) (xy -9.167373 -11.673757) (xy -9.0805 -11.636276) (xy -8.891465 -11.488885) (xy -8.770791 -11.263033) (xy -8.714362 -10.946621) (xy -8.715719 -10.563976) (xy -8.765436 -10.183729) (xy -8.870477 -9.899777) (xy -9.043474 -9.688803) (xy -9.270033 -9.540875) (xy -9.642731 -9.418085) (xy -10.021997 -9.41916) (xy -10.396617 -9.542215) (xy -10.755376 -9.785365) (xy -10.762578 -9.791673) (xy -11.013036 -10.076175) (xy -11.143062 -10.379566) (xy -11.149436 -10.69424) (xy -12.947215 -10.69424) (xy -12.886738 -10.362013) (xy -12.707047 -9.783277) (xy -12.469154 -9.275581) (xy -12.179927 -8.859015) (xy -12.038383 -8.70997) (xy -11.707749 -8.442692) (xy -11.357599 -8.25944) (xy -10.958406 -8.149746) (xy -10.480642 -8.103143) (xy -10.317415 -8.099899) (xy -10.015769 -8.101232)) (layer B.SilkS) (width 0.01)) ) (module copper_pads:ferris locked (layer F.Cu) (tedit 5F81BAD1) (tstamp 5EDC1554) (at 188 83 10) (attr virtual) (fp_text reference G*** (at 0 0 10) (layer F.SilkS) hide (effects (font (size 1.524 1.524) (thickness 0.3))) ) (fp_text value LOGO (at 0.75 0 10) (layer F.SilkS) hide (effects (font (size 1.524 1.524) (thickness 0.3))) ) (fp_poly (pts (xy 0.204806 -6.667386) (xy 0.251355 -6.666904) (xy 0.286186 -6.66584) (xy 0.311907 -6.66398) (xy 0.331126 -6.661112) (xy 0.346451 -6.657021) (xy 0.360488 -6.651495) (xy 0.365103 -6.649403) (xy 0.380736 -6.642173) (xy 0.394728 -6.635246) (xy 0.407772 -6.627619) (xy 0.420563 -6.618292) (xy 0.433795 -6.606263) (xy 0.448162 -6.590531) (xy 0.46436 -6.570093) (xy 0.483081 -6.543948) (xy 0.505021 -6.511095) (xy 0.530874 -6.470532) (xy 0.561335 -6.421257) (xy 0.597097 -6.362268) (xy 0.638856 -6.292565) (xy 0.687305 -6.211146) (xy 0.743139 -6.117008) (xy 0.795725 -6.028266) (xy 0.841799 -5.950535) (xy 0.880048 -5.886112) (xy 0.91127 -5.833733) (xy 0.936266 -5.792136) (xy 0.955837 -5.760058) (xy 0.970783 -5.736234) (xy 0.981904 -5.719404) (xy 0.99 -5.708302) (xy 0.995873 -5.701666) (xy 1.000322 -5.698234) (xy 1.004147 -5.696741) (xy 1.006054 -5.696332) (xy 1.010852 -5.696228) (xy 1.016812 -5.698554) (xy 1.025185 -5.704586) (xy 1.037223 -5.715601) (xy 1.054178 -5.732876) (xy 1.077301 -5.757686) (xy 1.107843 -5.79131) (xy 1.147056 -5.835023) (xy 1.196191 -5.890102) (xy 1.198033 -5.892169) (xy 1.283248 -5.987764) (xy 1.358037 -6.071503) (xy 1.423184 -6.144217) (xy 1.479477 -6.20674) (xy 1.527703 -6.259902) (xy 1.568648 -6.304536) (xy 1.603099 -6.341474) (xy 1.631841 -6.371547) (xy 1.655663 -6.395588) (xy 1.67535 -6.414428) (xy 1.69169 -6.4289) (xy 1.705468 -6.439835) (xy 1.717472 -6.448065) (xy 1.728488 -6.454423) (xy 1.730786 -6.455616) (xy 1.748421 -6.46443) (xy 1.763829 -6.470987) (xy 1.779909 -6.475668) (xy 1.799557 -6.478856) (xy 1.82567 -6.48093) (xy 1.861144 -6.482272) (xy 1.908876 -6.483263) (xy 1.945448 -6.483861) (xy 2.014182 -6.484446) (xy 2.068816 -6.483413) (xy 2.112148 -6.480254) (xy 2.146974 -6.474463) (xy 2.176093 -6.465532) (xy 2.202301 -6.452956) (xy 2.228396 -6.436226) (xy 2.235199 -6.431358) (xy 2.24853 -6.42177) (xy 2.260247 -6.413038) (xy 2.270849 -6.404024) (xy 2.280834 -6.39359) (xy 2.2907 -6.380596) (xy 2.300947 -6.363905) (xy 2.312073 -6.342377) (xy 2.324576 -6.314874) (xy 2.338955 -6.280257) (xy 2.355709 -6.237389) (xy 2.375335 -6.18513) (xy 2.398332 -6.122341) (xy 2.4252 -6.047884) (xy 2.456436 -5.960621) (xy 2.492538 -5.859413) (xy 2.522897 -5.774266) (xy 2.550552 -5.697086) (xy 2.576768 -5.62462) (xy 2.600948 -5.558467) (xy 2.622498 -5.500223) (xy 2.640821 -5.451485) (xy 2.655323 -5.413851) (xy 2.665407 -5.388918) (xy 2.670478 -5.378283) (xy 2.67058 -5.378166) (xy 2.68554 -5.369523) (xy 2.708381 -5.362871) (xy 2.711138 -5.362387) (xy 2.718249 -5.361652) (xy 2.725938 -5.362318) (xy 2.735368 -5.365177) (xy 2.7477 -5.371025) (xy 2.764099 -5.380654) (xy 2.785726 -5.394858) (xy 2.813745 -5.414431) (xy 2.849317 -5.440167) (xy 2.893607 -5.47286) (xy 2.947777 -5.513303) (xy 3.012989 -5.56229) (xy 3.090406 -5.620615) (xy 3.100019 -5.627862) (xy 3.189504 -5.695018) (xy 3.268927 -5.753971) (xy 3.337777 -5.804356) (xy 3.395541 -5.845808) (xy 3.441706 -5.877959) (xy 3.475763 -5.900444) (xy 3.497197 -5.912897) (xy 3.500967 -5.914575) (xy 3.517784 -5.920301) (xy 3.536154 -5.924535) (xy 3.558876 -5.927492) (xy 3.588751 -5.929387) (xy 3.628577 -5.930437) (xy 3.681154 -5.930858) (xy 3.712633 -5.9309) (xy 3.77051 -5.930819) (xy 3.814276 -5.930388) (xy 3.846755 -5.929317) (xy 3.870769 -5.92732) (xy 3.88914 -5.924108) (xy 3.904691 -5.919396) (xy 3.920246 -5.912894) (xy 3.928919 -5.908877) (xy 3.983792 -5.877242) (xy 4.026187 -5.838388) (xy 4.06022 -5.788468) (xy 4.062743 -5.783808) (xy 4.068513 -5.772454) (xy 4.073792 -5.760365) (xy 4.078846 -5.746141) (xy 4.083941 -5.728383) (xy 4.089345 -5.705692) (xy 4.095322 -5.67667) (xy 4.10214 -5.639919) (xy 4.110063 -5.594038) (xy 4.11936 -5.537629) (xy 4.130295 -5.469293) (xy 4.143135 -5.387631) (xy 4.158146 -5.291246) (xy 4.165515 -5.24376) (xy 4.179457 -5.15424) (xy 4.192792 -5.069343) (xy 4.205269 -4.990613) (xy 4.21664 -4.919593) (xy 4.226653 -4.857827) (xy 4.235059 -4.806858) (xy 4.241609 -4.768229) (xy 4.246051 -4.743484) (xy 4.247983 -4.734524) (xy 4.259706 -4.71885) (xy 4.283759 -4.700056) (xy 4.3053 -4.687014) (xy 4.3561 -4.659014) (xy 4.736079 -4.840077) (xy 4.812039 -4.876102) (xy 4.884338 -4.910066) (xy 4.951347 -4.941225) (xy 5.011438 -4.968837) (xy 5.062979 -4.992159) (xy 5.104343 -5.010448) (xy 5.133898 -5.022961) (xy 5.150017 -5.028956) (xy 5.150946 -5.029196) (xy 5.180633 -5.033496) (xy 5.222868 -5.036275) (xy 5.273384 -5.037589) (xy 5.327916 -5.037494) (xy 5.382197 -5.036044) (xy 5.43196 -5.033295) (xy 5.47294 -5.029303) (xy 5.498817 -5.024684) (xy 5.561443 -4.99995) (xy 5.615367 -4.961549) (xy 5.65852 -4.911386) (xy 5.688829 -4.851365) (xy 5.689596 -4.849212) (xy 5.694604 -4.833738) (xy 5.69851 -4.817692) (xy 5.701442 -4.798829) (xy 5.703528 -4.774904) (xy 5.704894 -4.743671) (xy 5.705667 -4.702886) (xy 5.705975 -4.650303) (xy 5.705944 -4.583678) (xy 5.705891 -4.561628) (xy 5.705349 -4.489434) (xy 5.704139 -4.405155) (xy 5.702367 -4.31362) (xy 5.700138 -4.21966) (xy 5.697557 -4.128104) (xy 5.69473 -4.043783) (xy 5.694379 -4.034366) (xy 5.683509 -3.7465) (xy 5.709837 -3.722495) (xy 5.732271 -3.702604) (xy 5.759533 -3.679173) (xy 5.772809 -3.668019) (xy 5.809451 -3.637546) (xy 6.587977 -3.828216) (xy 6.750505 -3.825458) (xy 6.807091 -3.824409) (xy 6.849669 -3.823209) (xy 6.881164 -3.821495) (xy 6.904499 -3.818899) (xy 6.922599 -3.815057) (xy 6.938388 -3.809603) (xy 6.95479 -3.802173) (xy 6.960959 -3.799164) (xy 7.016623 -3.762511) (xy 7.062612 -3.712244) (xy 7.093922 -3.658616) (xy 7.101551 -3.64164) (xy 7.107255 -3.625922) (xy 7.111357 -3.608618) (xy 7.114181 -3.586887) (xy 7.116049 -3.557884) (xy 7.117283 -3.518767) (xy 7.118208 -3.466693) (xy 7.118562 -3.4417) (xy 7.120891 -3.272366) (xy 7.028676 -2.866215) (xy 6.93646 -2.460063) (xy 6.983214 -2.400548) (xy 7.004633 -2.373337) (xy 7.022155 -2.351175) (xy 7.033089 -2.337465) (xy 7.035102 -2.335005) (xy 7.044444 -2.333956) (xy 7.068801 -2.333604) (xy 7.106272 -2.333912) (xy 7.154954 -2.334843) (xy 7.212945 -2.33636) (xy 7.278343 -2.338427) (xy 7.349246 -2.341006) (xy 7.353401 -2.341167) (xy 7.435265 -2.344135) (xy 7.521061 -2.346853) (xy 7.607047 -2.34923) (xy 7.68948 -2.351174) (xy 7.764615 -2.352594) (xy 7.82871 -2.353398) (xy 7.858865 -2.353545) (xy 7.922251 -2.353477) (xy 7.971308 -2.353008) (xy 8.008638 -2.351952) (xy 8.036844 -2.350124) (xy 8.058529 -2.347337) (xy 8.076295 -2.343406) (xy 8.092746 -2.338144) (xy 8.097177 -2.336517) (xy 8.154973 -2.306019) (xy 8.20419 -2.261549) (xy 8.243318 -2.204524) (xy 8.248338 -2.194742) (xy 8.276166 -2.138242) (xy 8.279083 -1.983979) (xy 8.279622 -1.921755) (xy 8.27884 -1.867113) (xy 8.276831 -1.822881) (xy 8.273688 -1.79189) (xy 8.272558 -1.785693) (xy 8.267361 -1.769388) (xy 8.25602 -1.73926) (xy 8.239226 -1.696977) (xy 8.217669 -1.644209) (xy 8.192039 -1.582627) (xy 8.163027 -1.513898) (xy 8.131322 -1.439693) (xy 8.097616 -1.361681) (xy 8.090009 -1.344194) (xy 7.916901 -0.946716) (xy 7.946357 -0.888224) (xy 7.9609 -0.860551) (xy 7.972885 -0.839946) (xy 7.980139 -0.830092) (xy 7.980881 -0.829733) (xy 7.989932 -0.828354) (xy 8.014175 -0.824385) (xy 8.052107 -0.818079) (xy 8.102226 -0.809687) (xy 8.16303 -0.799463) (xy 8.233018 -0.787659) (xy 8.310688 -0.774528) (xy 8.394537 -0.760321) (xy 8.461258 -0.748996) (xy 8.568881 -0.73068) (xy 8.661165 -0.714806) (xy 8.739472 -0.700997) (xy 8.80516 -0.68888) (xy 8.85959 -0.678081) (xy 8.904121 -0.668224) (xy 8.940113 -0.658936) (xy 8.968926 -0.649842) (xy 8.991919 -0.640567) (xy 9.010453 -0.630737) (xy 9.025888 -0.619978) (xy 9.039582 -0.607915) (xy 9.052896 -0.594173) (xy 9.06271 -0.583364) (xy 9.08955 -0.549961) (xy 9.109594 -0.515531) (xy 9.123881 -0.476689) (xy 9.13345 -0.430048) (xy 9.139341 -0.372221) (xy 9.141732 -0.325966) (xy 9.142762 -0.238851) (xy 9.138891 -0.162847) (xy 9.130287 -0.099471) (xy 9.117117 -0.050243) (xy 9.109453 -0.032533) (xy 9.098274 -0.013144) (xy 9.079542 0.016632) (xy 9.055484 0.05336) (xy 9.028329 0.093606) (xy 9.015511 0.112213) (xy 8.989891 0.149744) (xy 8.968485 0.182257) (xy 8.952837 0.207312) (xy 8.944492 0.222465) (xy 8.943641 0.225798) (xy 8.950535 0.221273) (xy 8.967658 0.206358) (xy 8.993289 0.182661) (xy 9.025707 0.15179) (xy 9.063192 0.115352) (xy 9.087223 0.09166) (xy 9.226716 -0.046566) (xy 9.292122 -0.194387) (xy 9.315654 -0.248284) (xy 9.33255 -0.288894) (xy 9.343494 -0.318197) (xy 9.349174 -0.338173) (xy 9.350276 -0.350802) (xy 9.34841 -0.356807) (xy 9.339344 -0.369451) (xy 9.322383 -0.391572) (xy 9.300342 -0.419534) (xy 9.285854 -0.437598) (xy 9.162113 -0.602315) (xy 9.051345 -0.773467) (xy 8.954226 -0.949623) (xy 8.871432 -1.129355) (xy 8.803639 -1.311232) (xy 8.751524 -1.493825) (xy 8.72397 -1.625599) (xy 8.718539 -1.66664) (xy 8.713945 -1.721585) (xy 8.710223 -1.787424) (xy 8.707409 -1.861147) (xy 8.705536 -1.939745) (xy 8.704641 -2.020207) (xy 8.704758 -2.099523) (xy 8.705922 -2.174684) (xy 8.708168 -2.242679) (xy 8.711532 -2.300498) (xy 8.71563 -2.342006) (xy 8.745931 -2.509132) (xy 8.792721 -2.672486) (xy 8.85597 -2.832027) (xy 8.935649 -2.987715) (xy 9.03173 -3.139509) (xy 9.144183 -3.287368) (xy 9.27298 -3.431251) (xy 9.418092 -3.571118) (xy 9.57949 -3.706929) (xy 9.757145 -3.838641) (xy 9.800166 -3.868259) (xy 9.925374 -3.949835) (xy 10.062688 -4.033047) (xy 10.207777 -4.115468) (xy 10.356309 -4.19467) (xy 10.503953 -4.268222) (xy 10.564199 -4.296634) (xy 10.701698 -4.360333) (xy 10.930466 -4.360333) (xy 10.930466 -4.247617) (xy 10.930201 -4.20052) (xy 10.929056 -4.166455) (xy 10.926505 -4.141527) (xy 10.922026 -4.12184) (xy 10.915092 -4.103496) (xy 10.909411 -4.091257) (xy 10.892359 -4.050587) (xy 10.873607 -3.996671) (xy 10.854163 -3.932978) (xy 10.835034 -3.862977) (xy 10.817226 -3.790138) (xy 10.803302 -3.725719) (xy 10.783162 -3.618877) (xy 10.765283 -3.508801) (xy 10.749328 -3.392804) (xy 10.734962 -3.268198) (xy 10.721849 -3.132295) (xy 10.709653 -2.982407) (xy 10.708546 -2.967566) (xy 10.706609 -2.933716) (xy 10.704831 -2.8878) (xy 10.703222 -2.831658) (xy 10.701792 -2.767129) (xy 10.700551 -2.696054) (xy 10.699508 -2.620272) (xy 10.698673 -2.541623) (xy 10.698056 -2.461947) (xy 10.697666 -2.383084) (xy 10.697513 -2.306874) (xy 10.697608 -2.235157) (xy 10.697959 -2.169773) (xy 10.698576 -2.112562) (xy 10.69947 -2.065363) (xy 10.700649 -2.030016) (xy 10.702124 -2.008362) (xy 10.703448 -2.002194) (xy 10.713978 -2.00309) (xy 10.735051 -2.01412) (xy 10.764869 -2.033824) (xy 10.801632 -2.060745) (xy 10.843541 -2.093422) (xy 10.888797 -2.130398) (xy 10.935601 -2.170212) (xy 10.982153 -2.211407) (xy 11.026654 -2.252523) (xy 11.067306 -2.292101) (xy 11.090768 -2.316265) (xy 11.224437 -2.469856) (xy 11.347126 -2.636093) (xy 11.458862 -2.815031) (xy 11.559672 -3.006729) (xy 11.649583 -3.211244) (xy 11.728623 -3.428633) (xy 11.796819 -3.658952) (xy 11.854198 -3.90226) (xy 11.861721 -3.939116) (xy 11.871467 -3.9878) (xy 12.103371 -3.9878) (xy 12.129583 -3.947583) (xy 12.206152 -3.818081) (xy 12.275609 -3.676318) (xy 12.336364 -3.526042) (xy 12.38683 -3.370996) (xy 12.408358 -3.290221) (xy 12.422175 -3.23309) (xy 12.433652 -3.182513) (xy 12.443002 -3.136117) (xy 12.45044 -3.091529) (xy 12.456181 -3.046376) (xy 12.46044 -2.998285) (xy 12.46343 -2.944883) (xy 12.465367 -2.883797) (xy 12.466466 -2.812653) (xy 12.46694 -2.729079) (xy 12.46701 -2.641599) (xy 12.466914 -2.554821) (xy 12.466655 -2.482913) (xy 12.466144 -2.423812) (xy 12.465294 -2.375457) (xy 12.464018 -2.335784) (xy 12.462227 -2.30273) (xy 12.459833 -2.274233) (xy 12.45675 -2.24823) (xy 12.452889 -2.222659) (xy 12.448162 -2.195456) (xy 12.448 -2.194556) (xy 12.407566 -2.007735) (xy 12.35504 -1.829187) (xy 12.289423 -1.656456) (xy 12.20972 -1.487086) (xy 12.114933 -1.318623) (xy 12.051885 -1.219199) (xy 11.932347 -1.05094) (xy 11.796563 -0.883605) (xy 11.645216 -0.717813) (xy 11.478989 -0.554182) (xy 11.298567 -0.393331) (xy 11.104632 -0.235876) (xy 10.89787 -0.082437) (xy 10.678962 0.066369) (xy 10.5156 0.169446) (xy 10.457932 0.205877) (xy 10.415527 0.235296) (xy 10.388274 0.257783) (xy 10.377531 0.270447) (xy 10.362535 0.293901) (xy 10.33909 0.328188) (xy 10.309081 0.370725) (xy 10.274393 0.418928) (xy 10.236908 0.470213) (xy 10.19851 0.521998) (xy 10.161084 0.571699) (xy 10.126513 0.616732) (xy 10.105517 0.643471) (xy 9.986027 0.790227) (xy 9.868821 0.926521) (xy 9.749376 1.057393) (xy 9.623172 1.187886) (xy 9.568236 1.242636) (xy 9.526845 1.284148) (xy 9.492561 1.319872) (xy 9.466634 1.348423) (xy 9.450315 1.368413) (xy 9.444854 1.378457) (xy 9.445141 1.379122) (xy 9.453222 1.38531) (xy 9.473743 1.400615) (xy 9.505488 1.424141) (xy 9.547241 1.454989) (xy 9.597787 1.492265) (xy 9.65591 1.535071) (xy 9.720394 1.582511) (xy 9.790024 1.633688) (xy 9.859433 1.684659) (xy 9.933866 1.739461) (xy 10.005062 1.792197) (xy 10.071692 1.84186) (xy 10.132428 1.887448) (xy 10.185943 1.927954) (xy 10.230909 1.962376) (xy 10.265998 1.989707) (xy 10.289881 2.008945) (xy 10.300504 2.018307) (xy 10.321757 2.041771) (xy 10.338384 2.065389) (xy 10.350931 2.091605) (xy 10.359947 2.12286) (xy 10.36598 2.161597) (xy 10.369577 2.21026) (xy 10.371287 2.27129) (xy 10.371666 2.335524) (xy 10.371459 2.399689) (xy 10.370697 2.449955) (xy 10.369175 2.489354) (xy 10.366683 2.520917) (xy 10.363014 2.547674) (xy 10.357961 2.572657) (xy 10.354427 2.587089) (xy 10.339772 2.632883) (xy 10.317041 2.689378) (xy 10.287798 2.753354) (xy 10.253602 2.821587) (xy 10.216015 2.890855) (xy 10.176598 2.957937) (xy 10.168012 2.971801) (xy 10.107747 3.06674) (xy 10.037313 3.175146) (xy 9.956744 3.296969) (xy 9.866072 3.432161) (xy 9.765333 3.580673) (xy 9.654559 3.742456) (xy 9.533784 3.917463) (xy 9.403042 4.105643) (xy 9.262366 4.30695) (xy 9.11179 4.521334) (xy 8.951347 4.748746) (xy 8.781072 4.989139) (xy 8.600997 5.242462) (xy 8.475404 5.418667) (xy 8.419332 5.497647) (xy 8.363813 5.576588) (xy 8.310073 5.6537) (xy 8.259337 5.72719) (xy 8.212831 5.79527) (xy 8.171782 5.856147) (xy 8.137414 5.908032) (xy 8.110953 5.949133) (xy 8.098705 5.969) (xy 8.042496 6.061946) (xy 7.988316 6.149884) (xy 7.937033 6.231486) (xy 7.889515 6.305425) (xy 7.846629 6.370373) (xy 7.809243 6.425002) (xy 7.778225 6.467986) (xy 7.754443 6.497996) (xy 7.74862 6.504517) (xy 7.726898 6.5278) (xy 7.4853 6.5278) (xy 7.479548 6.497141) (xy 7.476716 6.469537) (xy 7.475522 6.428377) (xy 7.475812 6.376946) (xy 7.477433 6.318525) (xy 7.480233 6.256399) (xy 7.484059 6.193849) (xy 7.488756 6.134161) (xy 7.494173 6.080615) (xy 7.500157 6.036497) (xy 7.501349 6.029428) (xy 7.520767 5.931301) (xy 7.546117 5.82277) (xy 7.576136 5.708757) (xy 7.609559 5.594185) (xy 7.628853 5.532967) (xy 7.668004 5.415563) (xy 7.706967 5.306155) (xy 7.747297 5.200965) (xy 7.790548 5.096216) (xy 7.838274 4.988132) (xy 7.892031 4.872936) (xy 7.947736 4.758267) (xy 8.04181 4.560548) (xy 8.136178 4.348632) (xy 8.229758 4.125199) (xy 8.321471 3.892928) (xy 8.410237 3.654501) (xy 8.494974 3.412596) (xy 8.518693 3.342018) (xy 8.539734 3.277358) (xy 8.561137 3.208968) (xy 8.58233 3.138924) (xy 8.602738 3.069303) (xy 8.621788 3.002184) (xy 8.638906 2.939643) (xy 8.65352 2.883757) (xy 8.665056 2.836604) (xy 8.672941 2.80026) (xy 8.6766 2.776804) (xy 8.676582 2.770026) (xy 8.671477 2.770312) (xy 8.660131 2.782925) (xy 8.644627 2.805444) (xy 8.640817 2.811567) (xy 8.594892 2.885308) (xy 8.539203 2.972387) (xy 8.473974 3.072472) (xy 8.399433 3.185228) (xy 8.315806 3.310323) (xy 8.223316 3.447423) (xy 8.122192 3.596194) (xy 8.012658 3.756304) (xy 7.894941 3.927418) (xy 7.769266 4.109203) (xy 7.635859 4.301326) (xy 7.494947 4.503453) (xy 7.488464 4.512734) (xy 7.438825 4.584247) (xy 7.388918 4.656985) (xy 7.340298 4.728625) (xy 7.294519 4.796843) (xy 7.253139 4.859314) (xy 7.217711 4.913714) (xy 7.189791 4.957719) (xy 7.179693 4.974167) (xy 7.138164 5.042201) (xy 7.097766 5.107081) (xy 7.059695 5.166979) (xy 7.025146 5.220064) (xy 6.995313 5.264507) (xy 6.971391 5.298477) (xy 6.954575 5.320146) (xy 6.95163 5.323417) (xy 6.943319 5.331098) (xy 6.933461 5.336383) (xy 6.918952 5.339718) (xy 6.896692 5.341547) (xy 6.863575 5.342315) (xy 6.818777 5.342467) (xy 6.704013 5.342467) (xy 6.707574 5.183717) (xy 6.709092 5.125473) (xy 6.710992 5.080179) (xy 6.713739 5.04385) (xy 6.717795 5.012504) (xy 6.723626 4.982155) (xy 6.731695 4.948821) (xy 6.737471 4.926965) (xy 6.781683 4.774004) (xy 6.832395 4.620727) (xy 6.890557 4.464733) (xy 6.957117 4.303623) (xy 7.033025 4.134997) (xy 7.119229 3.956453) (xy 7.128952 3.936962) (xy 7.197567 3.798014) (xy 7.261842 3.663899) (xy 7.323443 3.530913) (xy 7.384037 3.39535) (xy 7.445288 3.253504) (xy 7.508864 3.101672) (xy 7.5531 2.993714) (xy 7.5742 2.941537) (xy 7.592843 2.894865) (xy 7.608175 2.855884) (xy 7.619342 2.82678) (xy 7.62549 2.80974) (xy 7.626391 2.80617) (xy 7.618695 2.809353) (xy 7.599481 2.819535) (xy 7.571785 2.835057) (xy 7.5438 2.851237) (xy 7.514147 2.867976) (xy 7.472369 2.890685) (xy 7.421485 2.917767) (xy 7.364517 2.947627) (xy 7.304488 2.978665) (xy 7.2517 3.005602) (xy 6.96083 3.145561) (xy 6.655264 3.278176) (xy 6.335637 3.40329) (xy 6.002583 3.52075) (xy 5.656738 3.630399) (xy 5.298736 3.732084) (xy 4.929211 3.825649) (xy 4.5488 3.910938) (xy 4.158136 3.987798) (xy 3.757855 4.056072) (xy 3.348591 4.115606) (xy 2.93098 4.166244) (xy 2.505656 4.207833) (xy 2.243666 4.228621) (xy 2.117599 4.237515) (xy 1.999019 4.245329) (xy 1.885672 4.252143) (xy 1.775305 4.258037) (xy 1.665665 4.263092) (xy 1.554498 4.267387) (xy 1.439551 4.271002) (xy 1.318571 4.274018) (xy 1.189304 4.276516) (xy 1.049498 4.278574) (xy 0.896897 4.280273) (xy 0.757766 4.281478) (xy 0.404027 4.282662) (xy 0.064641 4.280536) (xy -0.262666 4.274992) (xy -0.58017 4.265922) (xy -0.890144 4.253218) (xy -1.194863 4.236771) (xy -1.496602 4.216475) (xy -1.797636 4.192221) (xy -2.100239 4.163901) (xy -2.406686 4.131408) (xy -2.408767 4.131175) (xy -2.794274 4.084137) (xy -3.17472 4.030081) (xy -3.549081 3.96925) (xy -3.91633 3.901892) (xy -4.275444 3.828252) (xy -4.625397 3.748576) (xy -4.965165 3.66311) (xy -5.293723 3.5721) (xy -5.610046 3.475792) (xy -5.913109 3.374431) (xy -6.201888 3.268263) (xy -6.475357 3.157535) (xy -6.486445 3.152809) (xy -6.535801 3.131833) (xy -6.579843 3.113317) (xy -6.616217 3.098236) (xy -6.64257 3.087562) (xy -6.656545 3.082269) (xy -6.658075 3.081867) (xy -6.656009 3.089065) (xy -6.647048 3.10942) (xy -6.632123 3.141075) (xy -6.61217 3.182175) (xy -6.588122 3.230862) (xy -6.560914 3.28528) (xy -6.531478 3.343572) (xy -6.50075 3.403882) (xy -6.469662 3.464352) (xy -6.43915 3.523126) (xy -6.410146 3.578348) (xy -6.383585 3.62816) (xy -6.379122 3.636434) (xy -6.348612 3.691787) (xy -6.312648 3.755316) (xy -6.274775 3.820855) (xy -6.238542 3.882239) (xy -6.220836 3.911601) (xy -6.133694 4.060848) (xy -6.050312 4.215672) (xy -5.972179 4.372888) (xy -5.900779 4.529309) (xy -5.837597 4.68175) (xy -5.78412 4.827024) (xy -5.760863 4.897967) (xy -5.749526 4.934835) (xy -5.74119 4.964779) (xy -5.735315 4.991702) (xy -5.731361 5.019511) (xy -5.728789 5.052111) (xy -5.72706 5.093408) (xy -5.725633 5.147305) (xy -5.725474 5.154084) (xy -5.721852 5.308601) (xy -5.841597 5.308601) (xy -5.888795 5.308515) (xy -5.922135 5.307923) (xy -5.944689 5.306319) (xy -5.959533 5.303196) (xy -5.969742 5.298049) (xy -5.978389 5.290374) (xy -5.983193 5.285317) (xy -6.01058 5.254314) (xy -6.044403 5.212706) (xy -6.085295 5.159668) (xy -6.133888 5.094374) (xy -6.190814 5.015998) (xy -6.214221 4.983369) (xy -6.246179 4.939803) (xy -6.287091 4.885777) (xy -6.334999 4.823778) (xy -6.387948 4.756296) (xy -6.443982 4.685821) (xy -6.501142 4.61484) (xy -6.557473 4.545843) (xy -6.572321 4.527835) (xy -6.730279 4.336326) (xy -6.88017 4.153842) (xy -7.021772 3.980665) (xy -7.154859 3.817078) (xy -7.279209 3.663363) (xy -7.394597 3.519802) (xy -7.500799 3.386677) (xy -7.597591 3.264272) (xy -7.68475 3.152869) (xy -7.762051 3.05275) (xy -7.803511 2.998131) (xy 0.086758 2.998131) (xy 0.0955 3.012284) (xy 0.114267 3.034887) (xy 0.144086 3.067577) (xy 0.146042 3.069672) (xy 0.242493 3.162098) (xy 0.34518 3.239747) (xy 0.453248 3.302079) (xy 0.565841 3.348556) (xy 0.609599 3.361937) (xy 0.643853 3.370944) (xy 0.670097 3.375649) (xy 0.693804 3.375889) (xy 0.720445 3.371499) (xy 0.755493 3.362315) (xy 0.773978 3.357006) (xy 0.88447 3.316295) (xy 0.991499 3.259399) (xy 1.09416 3.186874) (xy 1.185925 3.104885) (xy 1.210537 3.079002) (xy 1.238025 3.047742) (xy 1.266407 3.013663) (xy 1.2937 2.979326) (xy 1.317924 2.947287) (xy 1.337097 2.920106) (xy 1.349237 2.900341) (xy 1.352361 2.89055) (xy 1.352161 2.890273) (xy 1.343561 2.890564) (xy 1.319407 2.892132) (xy 1.28102 2.894877) (xy 1.229723 2.898695) (xy 1.166839 2.903487) (xy 1.09369 2.909149) (xy 1.011598 2.915582) (xy 0.921886 2.922682) (xy 0.825876 2.930348) (xy 0.727843 2.93824) (xy 0.626724 2.946403) (xy 0.530427 2.954158) (xy 0.440299 2.961397) (xy 0.357686 2.968013) (xy 0.283933 2.973899) (xy 0.220387 2.978947) (xy 0.168393 2.983051) (xy 0.129298 2.986103) (xy 0.104448 2.987997) (xy 0.09525 2.988624) (xy 0.087017 2.990789) (xy 0.086758 2.998131) (xy -7.803511 2.998131) (xy -7.829271 2.964197) (xy -7.886185 2.887493) (xy -7.93257 2.82292) (xy -7.968201 2.770761) (xy -7.979787 2.752813) (xy -8.029832 2.673525) (xy -8.049474 2.697779) (xy -8.057981 2.709055) (xy -8.063078 2.719853) (xy -8.064291 2.73287) (xy -8.061143 2.750806) (xy -8.053158 2.776357) (xy -8.039862 2.812223) (xy -8.020778 2.861101) (xy -8.020609 2.861531) (xy -7.982885 2.951665) (xy -7.936125 3.05376) (xy -7.881313 3.166127) (xy -7.819435 3.287078) (xy -7.751476 3.414923) (xy -7.678422 3.547975) (xy -7.601258 3.684545) (xy -7.52097 3.822944) (xy -7.438542 3.961484) (xy -7.35496 4.098476) (xy -7.27121 4.232232) (xy -7.188277 4.361064) (xy -7.107146 4.483282) (xy -7.028802 4.597198) (xy -6.954231 4.701125) (xy -6.92125 4.745398) (xy -6.813296 4.893603) (xy -6.709295 5.046643) (xy -6.610319 5.202556) (xy -6.517442 5.359379) (xy -6.431738 5.515149) (xy -6.354281 5.667901) (xy -6.286143 5.815674) (xy -6.228398 5.956503) (xy -6.182119 6.088426) (xy -6.175813 6.1087) (xy -6.16751 6.137244) (xy -6.161322 6.16299) (xy -6.156858 6.189428) (xy -6.153724 6.220046) (xy -6.151527 6.258335) (xy -6.149876 6.307782) (xy -6.148902 6.347884) (xy -6.145242 6.510867) (xy -6.390813 6.510867) (xy -6.43179 6.477906) (xy -6.463384 6.450222) (xy -6.505014 6.410031) (xy -6.556064 6.357989) (xy -6.615919 6.294751) (xy -6.683963 6.220974) (xy -6.759581 6.137314) (xy -6.842155 6.044427) (xy -6.893561 5.985934) (xy -6.936483 5.937829) (xy -6.983677 5.886487) (xy -7.031146 5.836156) (xy -7.074892 5.791086) (xy -7.104671 5.761529) (xy -7.2744 5.59686) (xy -7.442508 5.433075) (xy -7.61079 5.268402) (xy -7.781041 5.101073) (xy -7.955058 4.929316) (xy -8.134635 4.751363) (xy -8.321568 4.565442) (xy -8.517652 4.369785) (xy -8.602578 4.284871) (xy -8.741764 4.145514) (xy -8.869435 4.017423) (xy -8.986143 3.899987) (xy -9.092445 3.792597) (xy -9.188895 3.694644) (xy -9.276049 3.605517) (xy -9.35446 3.524606) (xy -9.424685 3.451302) (xy -9.487277 3.384996) (xy -9.542793 3.325077) (xy -9.591787 3.270936) (xy -9.634813 3.221964) (xy -9.672428 3.177549) (xy -9.705185 3.137083) (xy -9.73364 3.099956) (xy -9.758347 3.065559) (xy -9.779862 3.033281) (xy -9.79874 3.002512) (xy -9.815535 2.972644) (xy -9.830803 2.943066) (xy -9.838764 2.926673) (xy -9.858377 2.883532) (xy -9.873148 2.845164) (xy -9.883738 2.807915) (xy -9.89081 2.76813) (xy -9.895025 2.722155) (xy -9.897045 2.666336) (xy -9.897534 2.602138) (xy -9.896931 2.531229) (xy -9.894872 2.474699) (xy -9.890978 2.43003) (xy -9.884872 2.394704) (xy -9.876177 2.366201) (xy -9.864516 2.342003) (xy -9.856688 2.329598) (xy -9.850912 2.321846) (xy -9.841592 2.310524) (xy -9.828084 2.294936) (xy -9.809739 2.274386) (xy -9.785913 2.248178) (xy -9.755958 2.215618) (xy -9.719229 2.176007) (xy -9.675079 2.128652) (xy -9.622862 2.072855) (xy -9.561931 2.007922) (xy -9.491641 1.933156) (xy -9.411344 1.847861) (xy -9.320395 1.751342) (xy -9.267024 1.694732) (xy -9.246281 1.671793) (xy -9.231125 1.653239) (xy -9.224513 1.642719) (xy -9.224434 1.642185) (xy -9.231324 1.635419) (xy -9.25023 1.621945) (xy -9.278509 1.603529) (xy -9.313514 1.581934) (xy -9.325379 1.574835) (xy -9.496219 1.468865) (xy -9.658777 1.359068) (xy -9.812182 1.246263) (xy -9.834332 1.228498) (xy -2.183907 1.228498) (xy -2.175949 1.302296) (xy -2.15815 1.381469) (xy -2.140696 1.439334) (xy -2.095151 1.552002) (xy -2.034104 1.659523) (xy -1.95841 1.761132) (xy -1.868922 1.856065) (xy -1.766496 1.943558) (xy -1.651984 2.022846) (xy -1.526242 2.093166) (xy -1.390124 2.153753) (xy -1.309041 2.183362) (xy -1.271441 2.196041) (xy -1.242284 2.204987) (xy -1.217896 2.2102) (xy -1.194606 2.211677) (xy -1.16874 2.209418) (xy -1.136626 2.203422) (xy -1.094591 2.193687) (xy -1.051625 2.183271) (xy -0.916442 2.143319) (xy -0.793578 2.091858) (xy -0.682766 2.02871) (xy -0.583737 1.953696) (xy -0.496226 1.866636) (xy -0.419964 1.76735) (xy -0.410258 1.752601) (xy -0.378563 1.70108) (xy -0.352732 1.652721) (xy -0.329848 1.601432) (xy -0.306995 1.541118) (xy -0.301303 1.524943) (xy -0.271697 1.431203) (xy -0.251312 1.344374) (xy -0.239042 1.257946) (xy -0.233776 1.165414) (xy -0.233679 1.155617) (xy 1.45403 1.155617) (xy 1.462288 1.234054) (xy 1.480512 1.32003) (xy 1.508073 1.410976) (xy 1.54434 1.504323) (xy 1.574988 1.570567) (xy 1.591807 1.603926) (xy 1.607515 1.633121) (xy 1.62378 1.660543) (xy 1.642266 1.688582) (xy 1.66464 1.719628) (xy 1.692568 1.756072) (xy 1.727716 1.800304) (xy 1.771751 1.854715) (xy 1.78075 1.865775) (xy 1.858865 1.950648) (xy 1.944114 2.022739) (xy 2.034817 2.080901) (xy 2.129289 2.12399) (xy 2.186424 2.14196) (xy 2.237093 2.153199) (xy 2.281747 2.157646) (xy 2.327441 2.155434) (xy 2.381231 2.146699) (xy 2.38584 2.145775) (xy 2.46893 2.124712) (xy 2.56096 2.093987) (xy 2.658257 2.055236) (xy 2.757149 2.010095) (xy 2.853962 1.960199) (xy 2.945024 1.907186) (xy 2.996873 1.873545) (xy 3.074955 1.81483) (xy 3.139353 1.753276) (xy 3.193308 1.685527) (xy 3.222319 1.639991) (xy 3.272253 1.541) (xy 3.30939 1.437053) (xy 3.333089 1.331082) (xy 3.342711 1.226023) (xy 3.337614 1.124808) (xy 3.336529 1.116807) (xy 3.317333 1.008432) (xy 3.289842 0.890841) (xy 3.255514 0.768657) (xy 3.215809 0.646505) (xy 3.172185 0.529011) (xy 3.126101 0.420799) (xy 3.099494 0.365443) (xy 3.074672 0.326946) (xy 3.037262 0.283022) (xy 2.989782 0.235898) (xy 2.93475 0.187799) (xy 2.874683 0.140952) (xy 2.812099 0.097581) (xy 2.76163 0.066723) (xy 2.720713 0.045327) (xy 2.672323 0.02311) (xy 2.621665 0.002192) (xy 2.573946 -0.015311) (xy 2.534371 -0.027279) (xy 2.525535 -0.029334) (xy 2.498371 -0.035057) (xy 2.534987 0.019546) (xy 2.57656 0.093943) (xy 2.611293 0.182546) (xy 2.630588 0.249767) (xy 2.636457 0.283672) (xy 2.641042 0.331191) (xy 2.644346 0.389055) (xy 2.646369 0.453993) (xy 2.647113 0.522735) (xy 2.646579 0.592012) (xy 2.64477 0.658552) (xy 2.641686 0.719087) (xy 2.637329 0.770346) (xy 2.631701 0.809058) (xy 2.630325 0.81543) (xy 2.601065 0.913043) (xy 2.561917 1.000342) (xy 2.513756 1.076317) (xy 2.45746 1.139961) (xy 2.393905 1.190265) (xy 2.323969 1.226221) (xy 2.256366 1.245467) (xy 2.226637 1.248896) (xy 2.183502 1.25108) (xy 2.130447 1.251918) (xy 2.070961 1.25131) (xy 2.061633 1.251086) (xy 2.005961 1.24937) (xy 1.963889 1.247245) (xy 1.932081 1.244318) (xy 1.907203 1.240199) (xy 1.885921 1.234496) (xy 1.869097 1.228473) (xy 1.801442 1.193363) (xy 1.739061 1.143489) (xy 1.683196 1.080532) (xy 1.635088 1.006173) (xy 1.595978 0.922096) (xy 1.567107 0.829981) (xy 1.563478 0.814417) (xy 1.544083 0.727133) (xy 1.516926 0.814417) (xy 1.484423 0.932334) (xy 1.462276 1.0452) (xy 1.45637 1.087288) (xy 1.45403 1.155617) (xy -0.233679 1.155617) (xy -0.233383 1.126067) (xy -0.238484 1.002109) (xy -0.254206 0.885619) (xy -0.28153 0.772489) (xy -0.321435 0.65861) (xy -0.37184 0.5461) (xy -0.439488 0.42467) (xy -0.51647 0.317366) (xy -0.602779 0.224194) (xy -0.698409 0.145157) (xy -0.803355 0.080258) (xy -0.917611 0.029503) (xy -1.041171 -0.007104) (xy -1.17403 -0.029561) (xy -1.17475 -0.029641) (xy -1.202075 -0.032111) (xy -1.221187 -0.032749) (xy -1.227667 -0.031585) (xy -1.22328 -0.023193) (xy -1.211643 -0.004453) (xy -1.195036 0.020989) (xy -1.190414 0.027912) (xy -1.168176 0.064924) (xy -1.145642 0.108622) (xy -1.127679 0.149566) (xy -1.127634 0.149683) (xy -1.111694 0.194137) (xy -1.09921 0.237145) (xy -1.0898 0.281647) (xy -1.083084 0.330587) (xy -1.078682 0.386905) (xy -1.076214 0.453544) (xy -1.075298 0.533446) (xy -1.075267 0.554567) (xy -1.075703 0.63171) (xy -1.07709 0.694369) (xy -1.079552 0.744976) (xy -1.08321 0.785959) (xy -1.088184 0.81975) (xy -1.088687 0.822449) (xy -1.114034 0.920952) (xy -1.150678 1.011301) (xy -1.197567 1.091936) (xy -1.253652 1.161295) (xy -1.317882 1.217816) (xy -1.380067 1.255577) (xy -1.4351 1.282701) (xy -1.6383 1.282701) (xy -1.702172 1.282655) (xy -1.751571 1.282375) (xy -1.788958 1.281642) (xy -1.816796 1.280241) (xy -1.837544 1.277955) (xy -1.853664 1.274566) (xy -1.867616 1.269858) (xy -1.881863 1.263615) (xy -1.888067 1.260699) (xy -1.960946 1.217055) (xy -2.026246 1.158512) (xy -2.084133 1.084899) (xy -2.120645 1.02373) (xy -2.13312 1.000626) (xy -2.142083 0.986984) (xy -2.14876 0.984102) (xy -2.154379 0.99328) (xy -2.160166 1.015815) (xy -2.167347 1.053008) (xy -2.171944 1.078051) (xy -2.182435 1.15533) (xy -2.183907 1.228498) (xy -9.834332 1.228498) (xy -9.955566 1.131268) (xy -10.088058 1.014901) (xy -10.208788 0.89798) (xy -10.316888 0.781324) (xy -10.411488 0.66575) (xy -10.491717 0.552078) (xy -10.556707 0.441124) (xy -10.57962 0.394735) (xy -10.619741 0.308486) (xy -10.775458 0.229143) (xy -11.006694 0.106076) (xy -11.222289 -0.019477) (xy -11.422106 -0.147403) (xy -11.606007 -0.277587) (xy -11.773852 -0.409915) (xy -11.925505 -0.544271) (xy -12.060826 -0.680542) (xy -12.179678 -0.818611) (xy -12.281923 -0.958366) (xy -12.359401 -1.08508) (xy -12.404665 -1.176011) (xy -12.446029 -1.277247) (xy -12.481437 -1.382803) (xy -12.508834 -1.486693) (xy -12.523224 -1.562099) (xy -12.527988 -1.604816) (xy -12.531548 -1.660638) (xy -12.533927 -1.726277) (xy -12.535149 -1.798445) (xy -12.535238 -1.873852) (xy -12.534216 -1.949212) (xy -12.532107 -2.021235) (xy -12.528935 -2.086633) (xy -12.524723 -2.142119) (xy -12.519494 -2.184403) (xy -12.518763 -2.188633) (xy -12.485137 -2.334902) (xy -12.437275 -2.478343) (xy -12.374641 -2.620067) (xy -12.296701 -2.761184) (xy -12.20292 -2.902804) (xy -12.125321 -3.005666) (xy -12.091897 -3.045626) (xy -12.049117 -3.093395) (xy -11.999933 -3.145968) (xy -11.947296 -3.200337) (xy -11.894158 -3.253497) (xy -11.843472 -3.302442) (xy -11.798189 -3.344166) (xy -11.764903 -3.372724) (xy -11.706106 -3.420533) (xy -11.475264 -3.420533) (xy -11.464632 -3.350683) (xy -11.439686 -3.214506) (xy -11.405347 -3.069317) (xy -11.362877 -2.919267) (xy -11.313535 -2.768505) (xy -11.258582 -2.621183) (xy -11.203642 -2.491117) (xy -11.152187 -2.38399) (xy -11.091643 -2.270393) (xy -11.024621 -2.154623) (xy -10.953732 -2.040977) (xy -10.881587 -1.933751) (xy -10.810798 -1.837243) (xy -10.79089 -1.811866) (xy -10.75085 -1.762569) (xy -10.710825 -1.714873) (xy -10.672263 -1.670351) (xy -10.636612 -1.630576) (xy -10.605321 -1.59712) (xy -10.579837 -1.571555) (xy -10.56161 -1.555454) (xy -10.552088 -1.550389) (xy -10.55108 -1.55151) (xy -10.551609 -1.563013) (xy -10.554357 -1.589151) (xy -10.559051 -1.627808) (xy -10.565422 -1.676871) (xy -10.573196 -1.734225) (xy -10.582104 -1.797754) (xy -10.587401 -1.834648) (xy -10.59522 -1.88867) (xy -10.605156 -1.957334) (xy -10.616904 -2.038527) (xy -10.630158 -2.130131) (xy -10.644612 -2.230032) (xy -10.65996 -2.336114) (xy -10.675895 -2.44626) (xy -10.692111 -2.558356) (xy -10.708303 -2.670286) (xy -10.71885 -2.743199) (xy -10.734255 -2.849674) (xy -10.749438 -2.954571) (xy -10.764151 -3.056183) (xy -10.778147 -3.152802) (xy -10.791177 -3.242718) (xy -10.802995 -3.324223) (xy -10.813353 -3.395609) (xy -10.822002 -3.455166) (xy -10.828696 -3.501186) (xy -10.832792 -3.529269) (xy -10.844841 -3.623372) (xy -10.851814 -3.708262) (xy -10.854252 -3.7907) (xy -10.854267 -3.798086) (xy -10.854267 -3.920066) (xy -10.626479 -3.920066) (xy -10.47579 -3.844472) (xy -10.249531 -3.724603) (xy -10.039564 -3.600166) (xy -9.845871 -3.471142) (xy -9.668432 -3.337509) (xy -9.507227 -3.199245) (xy -9.362238 -3.05633) (xy -9.233445 -2.908741) (xy -9.120829 -2.756459) (xy -9.024371 -2.599461) (xy -8.94405 -2.437726) (xy -8.879849 -2.271232) (xy -8.831747 -2.09996) (xy -8.813421 -2.010833) (xy -8.799749 -1.916444) (xy -8.790109 -1.809363) (xy -8.784449 -1.693334) (xy -8.782718 -1.572099) (xy -8.784865 -1.449401) (xy -8.790839 -1.328982) (xy -8.800589 -1.214586) (xy -8.814063 -1.109953) (xy -8.826697 -1.039579) (xy -8.872812 -0.854781) (xy -8.934675 -0.667969) (xy -9.011523 -0.480893) (xy -9.102596 -0.295301) (xy -9.207132 -0.112942) (xy -9.278711 -0.001764) (xy -9.303049 0.034474) (xy -9.324476 0.066429) (xy -9.340962 0.091068) (xy -9.350475 0.105359) (xy -9.351434 0.106819) (xy -9.349994 0.119495) (xy -9.336028 0.140275) (xy -9.311085 0.16785) (xy -9.276714 0.200908) (xy -9.234463 0.23814) (xy -9.185881 0.278236) (xy -9.132518 0.319886) (xy -9.075921 0.361779) (xy -9.017641 0.402605) (xy -8.959226 0.441054) (xy -8.947694 0.448324) (xy -8.90824 0.472017) (xy -8.860332 0.499203) (xy -8.806045 0.528849) (xy -8.747449 0.559922) (xy -8.686619 0.591391) (xy -8.625627 0.622221) (xy -8.566546 0.651382) (xy -8.511449 0.677839) (xy -8.462408 0.700561) (xy -8.421497 0.718515) (xy -8.390788 0.730669) (xy -8.372354 0.735989) (xy -8.369933 0.736132) (xy -8.359004 0.729658) (xy -8.344618 0.714525) (xy -8.343306 0.712849) (xy -8.325779 0.690034) (xy -8.572698 0.332845) (xy -8.634266 0.243463) (xy -8.686466 0.166963) (xy -8.729844 0.1025) (xy -8.764949 0.04923) (xy -8.792327 0.006307) (xy -8.812526 -0.027112) (xy -8.826094 -0.051873) (xy -8.833578 -0.068819) (xy -8.834135 -0.070499) (xy -8.839233 -0.089374) (xy -8.842897 -0.110564) (xy -8.845279 -0.136867) (xy -8.846532 -0.171084) (xy -8.846807 -0.216013) (xy -8.846257 -0.274453) (xy -8.846043 -0.28927) (xy -8.843434 -0.461887) (xy -8.815562 -0.518455) (xy -8.793021 -0.557194) (xy -8.76727 -0.590629) (xy -8.753214 -0.604532) (xy -8.743335 -0.613198) (xy -8.734567 -0.620923) (xy -8.725957 -0.627913) (xy -8.71655 -0.634372) (xy -8.705393 -0.640503) (xy -8.69153 -0.646512) (xy -8.674009 -0.652603) (xy -8.651876 -0.65898) (xy -8.624175 -0.665849) (xy -8.589953 -0.673412) (xy -8.548256 -0.681875) (xy -8.49813 -0.691442) (xy -8.43862 -0.702318) (xy -8.368773 -0.714707) (xy -8.287635 -0.728813) (xy -8.194252 -0.744842) (xy -8.087668 -0.762996) (xy -7.966931 -0.783482) (xy -7.831087 -0.806502) (xy -7.733304 -0.82308) (xy -7.681507 -0.831865) (xy -7.653817 -0.889102) (xy -7.626128 -0.94634) (xy -7.792381 -1.327192) (xy -7.825859 -1.403957) (xy -7.857679 -1.477062) (xy -7.887113 -1.544827) (xy -7.913434 -1.60557) (xy -7.935916 -1.657611) (xy -7.953831 -1.699269) (xy -7.966451 -1.728864) (xy -7.97305 -1.744715) (xy -7.973218 -1.745139) (xy -7.978359 -1.760892) (xy -7.982187 -1.780084) (xy -7.984885 -1.805314) (xy -7.986636 -1.83918) (xy -7.987621 -1.884281) (xy -7.988025 -1.943217) (xy -7.988051 -1.956246) (xy -7.9883 -2.13026) (xy -7.956029 -2.195549) (xy -7.918688 -2.254987) (xy -7.872041 -2.300483) (xy -7.815351 -2.332701) (xy -7.795388 -2.340175) (xy -7.767852 -2.345809) (xy -7.72346 -2.349924) (xy -7.662224 -2.35252) (xy -7.584152 -2.353596) (xy -7.489254 -2.353154) (xy -7.377541 -2.351192) (xy -7.249022 -2.34771) (xy -7.103707 -2.34271) (xy -7.066094 -2.341274) (xy -6.994979 -2.338607) (xy -6.929246 -2.336324) (xy -6.870802 -2.334477) (xy -6.821555 -2.333119) (xy -6.783411 -2.332301) (xy -6.758278 -2.332078) (xy -6.748063 -2.3325) (xy -6.747979 -2.332538) (xy -6.740722 -2.340359) (xy -6.725839 -2.358502) (xy -6.705912 -2.38378) (xy -6.694474 -2.398607) (xy -6.646477 -2.461271) (xy -6.737062 -2.854119) (xy -6.827648 -3.246966) (xy -6.827819 -3.424766) (xy -6.827603 -3.491643) (xy -6.826418 -3.544383) (xy -6.823679 -3.585778) (xy -6.818801 -3.618623) (xy -6.811198 -3.645709) (xy -6.800285 -3.669828) (xy -6.785476 -3.693773) (xy -6.766185 -3.720337) (xy -6.765711 -3.720966) (xy -6.72453 -3.763526) (xy -6.679115 -3.793453) (xy -6.625167 -3.8227) (xy -6.294967 -3.828132) (xy -5.913967 -3.7341) (xy -5.835907 -3.715019) (xy -5.762506 -3.697432) (xy -5.695474 -3.681724) (xy -5.636521 -3.668278) (xy -5.587359 -3.65748) (xy -5.549698 -3.649713) (xy -5.525249 -3.645362) (xy -5.516034 -3.644661) (xy -5.502169 -3.652316) (xy -5.480187 -3.668638) (xy -5.454159 -3.690534) (xy -5.446007 -3.697876) (xy -5.392913 -3.7465) (xy -5.406396 -4.119033) (xy -5.409281 -4.204588) (xy -5.41182 -4.291412) (xy -5.413956 -4.376628) (xy -5.415632 -4.457359) (xy -5.416789 -4.530727) (xy -5.417369 -4.593855) (xy -5.417317 -4.643866) (xy -5.417156 -4.656666) (xy -5.41611 -4.713951) (xy -5.414894 -4.757207) (xy -5.413165 -4.789341) (xy -5.410581 -4.813257) (xy -5.406799 -4.83186) (xy -5.401475 -4.848055) (xy -5.394267 -4.864747) (xy -5.392014 -4.869586) (xy -5.355985 -4.927235) (xy -5.307492 -4.975554) (xy -5.250587 -5.010902) (xy -5.231974 -5.019116) (xy -5.214546 -5.025118) (xy -5.195076 -5.029333) (xy -5.170337 -5.032183) (xy -5.137102 -5.034092) (xy -5.092144 -5.035483) (xy -5.057301 -5.036265) (xy -4.994929 -5.036855) (xy -4.940756 -5.035939) (xy -4.897614 -5.033614) (xy -4.868334 -5.029979) (xy -4.866895 -5.029682) (xy -4.851566 -5.025008) (xy -4.826576 -5.015395) (xy -4.791346 -5.000577) (xy -4.745295 -4.980286) (xy -4.687843 -4.954255) (xy -4.618411 -4.92222) (xy -4.536418 -4.883911) (xy -4.441284 -4.839064) (xy -4.33243 -4.787411) (xy -4.209275 -4.728685) (xy -4.137372 -4.694299) (xy -4.062576 -4.658497) (xy -4.009916 -4.688609) (xy -3.957256 -4.71872) (xy -3.878693 -5.223101) (xy -3.861471 -5.33348) (xy -3.846507 -5.428456) (xy -3.833472 -5.509359) (xy -3.822036 -5.577519) (xy -3.811868 -5.634267) (xy -3.802639 -5.680934) (xy -3.794018 -5.718851) (xy -3.785676 -5.749347) (xy -3.777282 -5.773753) (xy -3.768507 -5.793401) (xy -3.75902 -5.809621) (xy -3.748492 -5.823742) (xy -3.736592 -5.837097) (xy -3.72299 -5.851015) (xy -3.722945 -5.851061) (xy -3.69367 -5.875878) (xy -3.658779 -5.899189) (xy -3.640667 -5.908867) (xy -3.62302 -5.916721) (xy -3.606359 -5.922517) (xy -3.58762 -5.926635) (xy -3.563741 -5.929455) (xy -3.531661 -5.931358) (xy -3.488317 -5.932722) (xy -3.440256 -5.933745) (xy -3.371022 -5.934405) (xy -3.31562 -5.933002) (xy -3.271012 -5.928947) (xy -3.23416 -5.921651) (xy -3.202027 -5.910525) (xy -3.171576 -5.894979) (xy -3.141829 -5.875849) (xy -3.125505 -5.86416) (xy -3.09724 -5.843428) (xy -3.058604 -5.814822) (xy -3.011162 -5.779511) (xy -2.956483 -5.738665) (xy -2.896135 -5.693451) (xy -2.831686 -5.64504) (xy -2.769328 -5.598087) (xy -2.444088 -5.352908) (xy -2.409423 -5.364719) (xy -2.374758 -5.376531) (xy -2.210404 -5.835748) (xy -2.179761 -5.92112) (xy -2.150319 -6.002666) (xy -2.122658 -6.078816) (xy -2.097354 -6.148003) (xy -2.074986 -6.208659) (xy -2.056131 -6.259213) (xy -2.041367 -6.298099) (xy -2.031272 -6.323748) (xy -2.02717 -6.333234) (xy -1.997666 -6.377595) (xy -1.956469 -6.418722) (xy -1.908765 -6.45202) (xy -1.875129 -6.467895) (xy -1.856831 -6.474331) (xy -1.839403 -6.479039) (xy -1.819938 -6.48223) (xy -1.795531 -6.484118) (xy -1.763277 -6.484914) (xy -1.720269 -6.484831) (xy -1.663601 -6.484081) (xy -1.655424 -6.483951) (xy -1.4859 -6.481233) (xy -1.434236 -6.453204) (xy -1.422137 -6.446066) (xy -1.409169 -6.436981) (xy -1.394341 -6.424918) (xy -1.376665 -6.408848) (xy -1.355149 -6.387743) (xy -1.328806 -6.360572) (xy -1.296645 -6.326306) (xy -1.257677 -6.283916) (xy -1.210911 -6.232372) (xy -1.155358 -6.170644) (xy -1.090029 -6.097704) (xy -1.057778 -6.061621) (xy -0.981335 -5.976299) (xy -0.915492 -5.903348) (xy -0.85981 -5.842301) (xy -0.813849 -5.792691) (xy -0.777168 -5.75405) (xy -0.749327 -5.72591) (xy -0.729887 -5.707805) (xy -0.718406 -5.699266) (xy -0.715742 -5.69842) (xy -0.710386 -5.701251) (xy -0.701947 -5.710198) (xy -0.689842 -5.726188) (xy -0.673487 -5.750147) (xy -0.652297 -5.783002) (xy -0.625687 -5.82568) (xy -0.593073 -5.879108) (xy -0.553871 -5.944212) (xy -0.507497 -6.02192) (xy -0.453365 -6.113158) (xy -0.440267 -6.13529) (xy -0.383771 -6.230681) (xy -0.335034 -6.31259) (xy -0.29326 -6.382145) (xy -0.257651 -6.440476) (xy -0.227411 -6.488712) (xy -0.20174 -6.527982) (xy -0.179843 -6.559416) (xy -0.160921 -6.584142) (xy -0.144178 -6.60329) (xy -0.128816 -6.617989) (xy -0.114037 -6.629369) (xy -0.099045 -6.638558) (xy -0.083041 -6.646685) (xy -0.077237 -6.649403) (xy -0.063063 -6.655431) (xy -0.04843 -6.659954) (xy -0.030732 -6.663188) (xy -0.00736 -6.665345) (xy 0.024292 -6.666639) (xy 0.066833 -6.667283) (xy 0.122871 -6.667491) (xy 0.143933 -6.6675) (xy 0.204806 -6.667386)) (layer F.Mask) (width 0.01)) (fp_poly (pts (xy 2.375655 1.004383) (xy 2.364773 1.017455) (xy 2.362199 1.020234) (xy 2.347714 1.034474) (xy 2.338593 1.041298) (xy 2.338081 1.041401) (xy 2.340277 1.036084) (xy 2.351159 1.023012) (xy 2.353733 1.020234) (xy 2.368219 1.005994) (xy 2.377339 0.999169) (xy 2.377851 0.999067) (xy 2.375655 1.004383)) (layer Eco2.User) (width 0.01)) (fp_poly (pts (xy 0.20217 -6.55362) (xy 0.250122 -6.541287) (xy 0.29307 -6.518417) (xy 0.329501 -6.489324) (xy 0.337191 -6.482017) (xy 0.345211 -6.473391) (xy 0.354212 -6.462404) (xy 0.364843 -6.448013) (xy 0.377754 -6.429174) (xy 0.393596 -6.404845) (xy 0.413019 -6.373984) (xy 0.436674 -6.335548) (xy 0.46521 -6.288494) (xy 0.499278 -6.23178) (xy 0.539527 -6.164362) (xy 0.586609 -6.085199) (xy 0.641173 -5.993247) (xy 0.685658 -5.9182) (xy 0.739084 -5.828124) (xy 0.784022 -5.75254) (xy 0.820542 -5.691327) (xy 0.848718 -5.644365) (xy 0.868619 -5.611537) (xy 0.880318 -5.592721) (xy 0.883853 -5.58766) (xy 0.89667 -5.58522) (xy 0.921604 -5.582189) (xy 0.954875 -5.578869) (xy 0.992705 -5.575558) (xy 1.031313 -5.572557) (xy 1.066921 -5.570165) (xy 1.09575 -5.568683) (xy 1.114019 -5.56841) (xy 1.118463 -5.569044) (xy 1.125907 -5.577351) (xy 1.142384 -5.595855) (xy 1.165693 -5.62208) (xy 1.193634 -5.653552) (xy 1.203459 -5.664625) (xy 1.29769 -5.770794) (xy 1.381433 -5.865001) (xy 1.455389 -5.947998) (xy 1.52026 -6.020532) (xy 1.576746 -6.083353) (xy 1.625549 -6.137211) (xy 1.667371 -6.182854) (xy 1.702911 -6.221032) (xy 1.732872 -6.252495) (xy 1.757954 -6.277991) (xy 1.778859 -6.298269) (xy 1.796288 -6.31408) (xy 1.810942 -6.326172) (xy 1.823522 -6.335295) (xy 1.83473 -6.342198) (xy 1.840346 -6.345209) (xy 1.90113 -6.367302) (xy 1.964391 -6.37416) (xy 2.02721 -6.366508) (xy 2.086663 -6.345074) (xy 2.139831 -6.310587) (xy 2.183792 -6.263771) (xy 2.187301 -6.258829) (xy 2.192839 -6.250621) (xy 2.198201 -6.241893) (xy 2.203837 -6.231459) (xy 2.210197 -6.218132) (xy 2.217732 -6.200726) (xy 2.226892 -6.178053) (xy 2.238126 -6.148926) (xy 2.251885 -6.112159) (xy 2.268619 -6.066565) (xy 2.288779 -6.010956) (xy 2.312813 -5.944147) (xy 2.341174 -5.864949) (xy 2.37431 -5.772177) (xy 2.412672 -5.664643) (xy 2.41283 -5.6642) (xy 2.440461 -5.587088) (xy 2.466631 -5.514747) (xy 2.49075 -5.448765) (xy 2.512223 -5.390731) (xy 2.530459 -5.342233) (xy 2.544866 -5.304859) (xy 2.554851 -5.280199) (xy 2.559822 -5.26984) (xy 2.559927 -5.269727) (xy 2.571008 -5.26411) (xy 2.594429 -5.25499) (xy 2.626286 -5.24365) (xy 2.662676 -5.231373) (xy 2.699696 -5.219444) (xy 2.733442 -5.209144) (xy 2.760012 -5.20176) (xy 2.775503 -5.198572) (xy 2.776424 -5.198533) (xy 2.784825 -5.203496) (xy 2.805495 -5.217786) (xy 2.837208 -5.2405) (xy 2.878735 -5.270737) (xy 2.92885 -5.307596) (xy 2.986327 -5.350174) (xy 3.049939 -5.397569) (xy 3.118458 -5.448882) (xy 3.177655 -5.493405) (xy 3.271641 -5.563946) (xy 3.355257 -5.62611) (xy 3.428058 -5.679579) (xy 3.489602 -5.724035) (xy 3.539444 -5.75916) (xy 3.577141 -5.784635) (xy 3.60225 -5.800142) (xy 3.611158 -5.804555) (xy 3.668208 -5.818572) (xy 3.729736 -5.820134) (xy 3.789288 -5.809433) (xy 3.818853 -5.798394) (xy 3.87385 -5.767021) (xy 3.916447 -5.727946) (xy 3.950717 -5.677374) (xy 3.952677 -5.673741) (xy 3.958448 -5.662381) (xy 3.963732 -5.650271) (xy 3.968794 -5.636013) (xy 3.973902 -5.61821) (xy 3.979323 -5.595461) (xy 3.985323 -5.566368) (xy 3.992169 -5.529533) (xy 4.000128 -5.483557) (xy 4.009467 -5.427041) (xy 4.020451 -5.358586) (xy 4.033349 -5.276794) (xy 4.048427 -5.180266) (xy 4.055676 -5.133693) (xy 4.069615 -5.044224) (xy 4.082872 -4.959408) (xy 4.095202 -4.880786) (xy 4.106363 -4.809894) (xy 4.116111 -4.748272) (xy 4.124203 -4.697457) (xy 4.130396 -4.658989) (xy 4.134447 -4.634405) (xy 4.136025 -4.625568) (xy 4.143693 -4.613949) (xy 4.16308 -4.598193) (xy 4.195459 -4.577399) (xy 4.240624 -4.551485) (xy 4.277812 -4.531083) (xy 4.30963 -4.514038) (xy 4.333197 -4.501863) (xy 4.345627 -4.496072) (xy 4.346676 -4.4958) (xy 4.355146 -4.499336) (xy 4.377525 -4.509515) (xy 4.412439 -4.525692) (xy 4.458513 -4.547221) (xy 4.514373 -4.573457) (xy 4.578643 -4.603753) (xy 4.649948 -4.637466) (xy 4.726914 -4.673948) (xy 4.790233 -4.704027) (xy 4.902335 -4.757085) (xy 4.999543 -4.80257) (xy 5.082062 -4.840573) (xy 5.150097 -4.871187) (xy 5.203853 -4.894502) (xy 5.243536 -4.910611) (xy 5.26935 -4.919605) (xy 5.276208 -4.921302) (xy 5.337977 -4.924706) (xy 5.398677 -4.912856) (xy 5.455639 -4.887354) (xy 5.506194 -4.849804) (xy 5.547672 -4.801807) (xy 5.577405 -4.744968) (xy 5.579529 -4.739145) (xy 5.584419 -4.72337) (xy 5.588441 -4.705444) (xy 5.591606 -4.684005) (xy 5.593922 -4.657693) (xy 5.595399 -4.625144) (xy 5.596046 -4.584996) (xy 5.595874 -4.535889) (xy 5.59489 -4.47646) (xy 5.593105 -4.405346) (xy 5.590528 -4.321187) (xy 5.587167 -4.222619) (xy 5.58374 -4.1275) (xy 5.580963 -4.049845) (xy 5.578395 -3.974479) (xy 5.576109 -3.903777) (xy 5.574176 -3.840111) (xy 5.572668 -3.785856) (xy 5.571656 -3.743387) (xy 5.571212 -3.715076) (xy 5.571199 -3.711959) (xy 5.571066 -3.635085) (xy 5.65743 -3.561675) (xy 5.690039 -3.534552) (xy 5.718541 -3.511953) (xy 5.740247 -3.495929) (xy 5.75247 -3.488532) (xy 5.75362 -3.488266) (xy 5.763472 -3.490261) (xy 5.788217 -3.495996) (xy 5.826321 -3.505097) (xy 5.876253 -3.51719) (xy 5.936479 -3.531902) (xy 6.005466 -3.548859) (xy 6.08168 -3.567686) (xy 6.16359 -3.58801) (xy 6.211239 -3.599872) (xy 6.310813 -3.624626) (xy 6.395474 -3.645504) (xy 6.466711 -3.662827) (xy 6.526017 -3.676918) (xy 6.574881 -3.688097) (xy 6.614796 -3.696688) (xy 6.647251 -3.703011) (xy 6.673738 -3.707388) (xy 6.695747 -3.710141) (xy 6.71477 -3.711593) (xy 6.731 -3.712055) (xy 6.769792 -3.71156) (xy 6.798165 -3.708507) (xy 6.822579 -3.70166) (xy 6.849494 -3.689782) (xy 6.850892 -3.689097) (xy 6.905609 -3.653097) (xy 6.950495 -3.60484) (xy 6.983844 -3.546925) (xy 7.003948 -3.481953) (xy 7.008379 -3.449184) (xy 7.008954 -3.436287) (xy 7.008532 -3.421263) (xy 7.006847 -3.402765) (xy 7.003637 -3.379443) (xy 6.998636 -3.349949) (xy 6.991582 -3.312935) (xy 6.98221 -3.267051) (xy 6.970256 -3.210948) (xy 6.955456 -3.143278) (xy 6.937547 -3.062693) (xy 6.916263 -2.967843) (xy 6.900327 -2.897161) (xy 6.78793 -2.399276) (xy 6.862614 -2.304371) (xy 6.937298 -2.209465) (xy 7.022532 -2.214179) (xy 7.058939 -2.216003) (xy 7.108239 -2.21819) (xy 7.168136 -2.220661) (xy 7.236329 -2.223336) (xy 7.310522 -2.226135) (xy 7.388414 -2.228977) (xy 7.467709 -2.231782) (xy 7.546107 -2.234471) (xy 7.621309 -2.236963) (xy 7.691019 -2.239178) (xy 7.752936 -2.241036) (xy 7.804763 -2.242456) (xy 7.844201 -2.24336) (xy 7.868467 -2.243666) (xy 7.920701 -2.241443) (xy 7.962707 -2.234175) (xy 7.987111 -2.22645) (xy 8.043507 -2.196708) (xy 8.091195 -2.154398) (xy 8.128722 -2.102257) (xy 8.154636 -2.043017) (xy 8.167483 -1.979413) (xy 8.16581 -1.914179) (xy 8.162597 -1.896252) (xy 8.15611 -1.874099) (xy 8.143935 -1.839851) (xy 8.127359 -1.796842) (xy 8.107667 -1.748408) (xy 8.086196 -1.698004) (xy 8.066989 -1.653971) (xy 8.042307 -1.597395) (xy 8.01345 -1.53125) (xy 7.981714 -1.458513) (xy 7.948399 -1.38216) (xy 7.914803 -1.305165) (xy 7.886719 -1.240804) (xy 7.753903 -0.936443) (xy 7.8067 -0.834404) (xy 7.826446 -0.796527) (xy 7.843619 -0.764118) (xy 7.856633 -0.740134) (xy 7.863901 -0.727528) (xy 7.864631 -0.726504) (xy 7.873696 -0.724049) (xy 7.897964 -0.719068) (xy 7.935936 -0.711829) (xy 7.986114 -0.702602) (xy 8.047 -0.691659) (xy 8.117095 -0.679267) (xy 8.194901 -0.665698) (xy 8.27892 -0.651221) (xy 8.348133 -0.639417) (xy 8.456079 -0.621055) (xy 8.548682 -0.605135) (xy 8.627298 -0.591287) (xy 8.69328 -0.579137) (xy 8.747985 -0.568313) (xy 8.792766 -0.558444) (xy 8.82898 -0.549155) (xy 8.85798 -0.540076) (xy 8.881121 -0.530834) (xy 8.899759 -0.521057) (xy 8.915249 -0.510371) (xy 8.928944 -0.498406) (xy 8.942201 -0.484788) (xy 8.952643 -0.473297) (xy 8.992768 -0.416536) (xy 9.017455 -0.352958) (xy 9.026429 -0.283288) (xy 9.02646 -0.279682) (xy 9.026242 -0.250966) (xy 9.024758 -0.225962) (xy 9.021061 -0.202693) (xy 9.014203 -0.179185) (xy 9.003236 -0.153461) (xy 8.987212 -0.123546) (xy 8.965183 -0.087465) (xy 8.936201 -0.043241) (xy 8.899319 0.011101) (xy 8.858453 0.070485) (xy 8.816431 0.131399) (xy 8.768197 0.201327) (xy 8.717148 0.275343) (xy 8.666683 0.348519) (xy 8.6202 0.415928) (xy 8.603418 0.440267) (xy 8.567519 0.492277) (xy 8.533606 0.541304) (xy 8.503215 0.585135) (xy 8.477881 0.621558) (xy 8.459141 0.648362) (xy 8.448799 0.662964) (xy 8.43434 0.686023) (xy 8.430087 0.703626) (xy 8.432746 0.717998) (xy 8.439499 0.73937) (xy 8.448703 0.768517) (xy 8.45398 0.785236) (xy 8.467995 0.829638) (xy 8.570046 0.751476) (xy 8.655419 0.684306) (xy 8.747955 0.608333) (xy 8.844523 0.526327) (xy 8.94199 0.441053) (xy 9.037225 0.355282) (xy 9.127096 0.27178) (xy 9.208471 0.193316) (xy 9.259089 0.142473) (xy 9.336079 0.0635) (xy 9.434773 -0.157781) (xy 9.460141 -0.214921) (xy 9.483095 -0.267127) (xy 9.502763 -0.312374) (xy 9.518273 -0.348641) (xy 9.528755 -0.373904) (xy 9.533335 -0.38614) (xy 9.533466 -0.386836) (xy 9.527815 -0.396748) (xy 9.513411 -0.413354) (xy 9.50301 -0.423789) (xy 9.485415 -0.44217) (xy 9.460773 -0.469919) (xy 9.432509 -0.503098) (xy 9.407168 -0.533903) (xy 9.280184 -0.702149) (xy 9.167156 -0.874945) (xy 9.068585 -1.051241) (xy 8.984971 -1.229988) (xy 8.916816 -1.410134) (xy 8.864619 -1.590629) (xy 8.834501 -1.735666) (xy 8.826277 -1.797896) (xy 8.820321 -1.871967) (xy 8.816723 -1.95293) (xy 8.815572 -2.035835) (xy 8.816957 -2.11573) (xy 8.820967 -2.187665) (xy 8.825555 -2.231939) (xy 8.855178 -2.396375) (xy 8.900188 -2.556523) (xy 8.960697 -2.712514) (xy 9.036816 -2.864476) (xy 9.128659 -3.012541) (xy 9.236338 -3.156839) (xy 9.359965 -3.2975) (xy 9.499652 -3.434653) (xy 9.655512 -3.568429) (xy 9.827657 -3.698959) (xy 10.016199 -3.826372) (xy 10.221251 -3.950799) (xy 10.3886 -4.04366) (xy 10.435645 -4.068385) (xy 10.487426 -4.094876) (xy 10.541808 -4.122113) (xy 10.596657 -4.149079) (xy 10.649836 -4.174756) (xy 10.69921 -4.198124) (xy 10.742645 -4.218167) (xy 10.778004 -4.233865) (xy 10.803154 -4.244201) (xy 10.815958 -4.248156) (xy 10.817047 -4.247974) (xy 10.815442 -4.239265) (xy 10.807937 -4.220092) (xy 10.799288 -4.201207) (xy 10.782275 -4.160626) (xy 10.763557 -4.106799) (xy 10.74414 -4.043197) (xy 10.725032 -3.973289) (xy 10.707238 -3.900544) (xy 10.693235 -3.835785) (xy 10.673645 -3.732102) (xy 10.656211 -3.625531) (xy 10.640599 -3.513399) (xy 10.626475 -3.393035) (xy 10.613502 -3.261766) (xy 10.601348 -3.116919) (xy 10.598351 -3.077633) (xy 10.596461 -3.043838) (xy 10.594767 -2.996652) (xy 10.593272 -2.937787) (xy 10.591976 -2.868953) (xy 10.590883 -2.791863) (xy 10.589992 -2.708227) (xy 10.589306 -2.619757) (xy 10.588827 -2.528164) (xy 10.588556 -2.435159) (xy 10.588495 -2.342453) (xy 10.588646 -2.251758) (xy 10.589009 -2.164786) (xy 10.589588 -2.083247) (xy 10.590383 -2.008852) (xy 10.591397 -1.943314) (xy 10.59263 -1.888343) (xy 10.594085 -1.84565) (xy 10.595764 -1.816947) (xy 10.59711 -1.805913) (xy 10.6045 -1.770326) (xy 10.688155 -1.812589) (xy 10.804907 -1.878908) (xy 10.922778 -1.959954) (xy 11.039559 -2.053852) (xy 11.153039 -2.158726) (xy 11.261009 -2.272701) (xy 11.338026 -2.364259) (xy 11.460051 -2.530313) (xy 11.571122 -2.708765) (xy 11.671295 -2.899745) (xy 11.760626 -3.103383) (xy 11.839171 -3.31981) (xy 11.906988 -3.549156) (xy 11.964132 -3.791551) (xy 11.971788 -3.82905) (xy 11.977907 -3.855044) (xy 11.983816 -3.872707) (xy 11.987419 -3.877733) (xy 11.995864 -3.870469) (xy 12.011174 -3.849665) (xy 12.032394 -3.816799) (xy 12.05857 -3.77335) (xy 12.088748 -3.720799) (xy 12.089418 -3.719607) (xy 12.154215 -3.592085) (xy 12.212708 -3.452211) (xy 12.263611 -3.303802) (xy 12.305638 -3.150679) (xy 12.337505 -2.99666) (xy 12.342166 -2.968487) (xy 12.348917 -2.912527) (xy 12.353832 -2.843792) (xy 12.356933 -2.765924) (xy 12.358246 -2.682566) (xy 12.357795 -2.597363) (xy 12.355604 -2.513955) (xy 12.351697 -2.435988) (xy 12.346098 -2.367103) (xy 12.338833 -2.310944) (xy 12.337741 -2.304623) (xy 12.297496 -2.117732) (xy 12.244788 -1.938613) (xy 12.178684 -1.764969) (xy 12.098252 -1.594503) (xy 12.00256 -1.424919) (xy 11.941818 -1.329266) (xy 11.822281 -1.161006) (xy 11.686497 -0.993671) (xy 11.535149 -0.82788) (xy 11.368923 -0.664249) (xy 11.1885 -0.503397) (xy 10.994566 -0.345943) (xy 10.787803 -0.192504) (xy 10.568896 -0.043698) (xy 10.405533 0.059379) (xy 10.347865 0.095811) (xy 10.30546 0.125229) (xy 10.278208 0.147716) (xy 10.267465 0.160381) (xy 10.244979 0.195825) (xy 10.213242 0.242089) (xy 10.173887 0.297022) (xy 10.12855 0.358474) (xy 10.078864 0.424293) (xy 10.026463 0.49233) (xy 9.972982 0.560432) (xy 9.920055 0.626449) (xy 9.869315 0.688231) (xy 9.839302 0.7239) (xy 9.777436 0.795034) (xy 9.708921 0.871036) (xy 9.636053 0.949547) (xy 9.561124 1.028208) (xy 9.486428 1.10466) (xy 9.414259 1.176541) (xy 9.34691 1.241494) (xy 9.286675 1.297158) (xy 9.254998 1.325034) (xy 9.229039 1.347821) (xy 9.208756 1.366553) (xy 9.197055 1.378501) (xy 9.195329 1.381093) (xy 9.201884 1.386852) (xy 9.221012 1.401831) (xy 9.251635 1.425226) (xy 9.29268 1.456232) (xy 9.343072 1.494043) (xy 9.401735 1.537856) (xy 9.467595 1.586864) (xy 9.539576 1.640264) (xy 9.616604 1.69725) (xy 9.686094 1.748535) (xy 9.767424 1.808625) (xy 9.845218 1.866361) (xy 9.918326 1.920873) (xy 9.985597 1.971292) (xy 10.045881 2.016747) (xy 10.098027 2.056369) (xy 10.140886 2.089287) (xy 10.173308 2.114633) (xy 10.194141 2.131537) (xy 10.201693 2.138398) (xy 10.231121 2.183887) (xy 10.250979 2.240886) (xy 10.260929 2.30671) (xy 10.260632 2.378674) (xy 10.249749 2.454091) (xy 10.244361 2.477023) (xy 10.229705 2.522816) (xy 10.206975 2.579312) (xy 10.177731 2.643287) (xy 10.143535 2.71152) (xy 10.105948 2.780789) (xy 10.066532 2.847871) (xy 10.057946 2.861734) (xy 9.997681 2.956673) (xy 9.927246 3.065079) (xy 9.846677 3.186902) (xy 9.756006 3.322094) (xy 9.655266 3.470606) (xy 9.544492 3.632389) (xy 9.423717 3.807396) (xy 9.292975 3.995577) (xy 9.152299 4.196883) (xy 9.001723 4.411267) (xy 8.84128 4.63868) (xy 8.671005 4.879072) (xy 8.49093 5.132396) (xy 8.365337 5.308601) (xy 8.309265 5.387581) (xy 8.253746 5.466522) (xy 8.200006 5.543633) (xy 8.14927 5.617124) (xy 8.102765 5.685203) (xy 8.061715 5.74608) (xy 8.027347 5.797965) (xy 8.000886 5.839066) (xy 7.988638 5.858934) (xy 7.932429 5.95188) (xy 7.87825 6.039817) (xy 7.826967 6.121419) (xy 7.779448 6.195358) (xy 7.736562 6.260306) (xy 7.699176 6.314936) (xy 7.668158 6.357919) (xy 7.644377 6.387929) (xy 7.638554 6.39445) (xy 7.617815 6.412753) (xy 7.603238 6.41566) (xy 7.59364 6.403032) (xy 7.589931 6.388759) (xy 7.58778 6.357964) (xy 7.589713 6.313321) (xy 7.595338 6.257316) (xy 7.604265 6.192432) (xy 7.616101 6.121154) (xy 7.630456 6.045966) (xy 7.646938 5.969352) (xy 7.665156 5.893796) (xy 7.672046 5.8674) (xy 7.72325 5.689454) (xy 7.781815 5.512727) (xy 7.848849 5.334348) (xy 7.925463 5.151444) (xy 8.012765 4.961144) (xy 8.057803 4.868334) (xy 8.120497 4.737887) (xy 8.183686 4.600069) (xy 8.246809 4.456439) (xy 8.309303 4.308552) (xy 8.370608 4.157966) (xy 8.430161 4.006238) (xy 8.4874 3.854926) (xy 8.541764 3.705586) (xy 8.592691 3.559774) (xy 8.639619 3.41905) (xy 8.681986 3.284969) (xy 8.71923 3.159088) (xy 8.75079 3.042965) (xy 8.776104 2.938157) (xy 8.79461 2.846221) (xy 8.800511 2.809847) (xy 8.808466 2.749781) (xy 8.81234 2.702881) (xy 8.812152 2.665884) (xy 8.80792 2.635528) (xy 8.801672 2.613928) (xy 8.794988 2.598055) (xy 8.785784 2.583735) (xy 8.771772 2.56891) (xy 8.750667 2.551521) (xy 8.72018 2.529506) (xy 8.678024 2.500805) (xy 8.670396 2.495691) (xy 8.638894 2.474425) (xy 8.612052 2.455985) (xy 8.593416 2.442824) (xy 8.587316 2.438208) (xy 8.578256 2.432631) (xy 8.576733 2.433552) (xy 8.569684 2.431897) (xy 8.550644 2.424047) (xy 8.522777 2.411367) (xy 8.498774 2.399894) (xy 8.431181 2.370132) (xy 8.352758 2.340745) (xy 8.26953 2.31373) (xy 8.187522 2.29108) (xy 8.132233 2.278519) (xy 8.06019 2.265717) (xy 7.986044 2.255712) (xy 7.912679 2.248642) (xy 7.842977 2.244643) (xy 7.779823 2.243855) (xy 7.726099 2.246414) (xy 7.68469 2.252459) (xy 7.670543 2.256458) (xy 7.648011 2.263258) (xy 7.632909 2.26568) (xy 7.630041 2.264998) (xy 7.620771 2.265432) (xy 7.616545 2.268098) (xy 7.604653 2.272955) (xy 7.579453 2.280404) (xy 7.544227 2.289647) (xy 7.502256 2.299885) (xy 7.456823 2.310318) (xy 7.411209 2.320149) (xy 7.368697 2.328578) (xy 7.366 2.329081) (xy 7.331584 2.336982) (xy 7.299068 2.346946) (xy 7.280265 2.354613) (xy 7.259843 2.363048) (xy 7.246226 2.36545) (xy 7.244281 2.36466) (xy 7.239306 2.365598) (xy 7.239 2.368269) (xy 7.232049 2.37789) (xy 7.224183 2.381629) (xy 7.211837 2.386552) (xy 7.18702 2.397356) (xy 7.152601 2.412762) (xy 7.111452 2.431486) (xy 7.078133 2.446829) (xy 7.019005 2.473733) (xy 6.951237 2.503779) (xy 6.87646 2.536304) (xy 6.796308 2.570641) (xy 6.712412 2.606124) (xy 6.626405 2.642089) (xy 6.539921 2.67787) (xy 6.454591 2.712801) (xy 6.372048 2.746218) (xy 6.293926 2.777454) (xy 6.221855 2.805845) (xy 6.15747 2.830725) (xy 6.102402 2.851429) (xy 6.058284 2.867291) (xy 6.02675 2.877646) (xy 6.011494 2.881549) (xy 5.993784 2.887314) (xy 5.981404 2.893221) (xy 5.967203 2.899232) (xy 5.938749 2.909746) (xy 5.897929 2.924143) (xy 5.846629 2.9418) (xy 5.786735 2.962096) (xy 5.720135 2.984409) (xy 5.648713 3.008118) (xy 5.574357 3.0326) (xy 5.498953 3.057234) (xy 5.424387 3.081398) (xy 5.352546 3.104471) (xy 5.285316 3.125831) (xy 5.224584 3.144856) (xy 5.172235 3.160925) (xy 5.139266 3.170764) (xy 5.08223 3.187311) (xy 5.019296 3.20527) (xy 4.95267 3.22404) (xy 4.884557 3.24302) (xy 4.817162 3.261606) (xy 4.752689 3.2792) (xy 4.693345 3.295197) (xy 4.641334 3.308998) (xy 4.598861 3.320001) (xy 4.56813 3.327604) (xy 4.551348 3.331205) (xy 4.550833 3.331281) (xy 4.529952 3.335896) (xy 4.5212 3.338867) (xy 4.50374 3.344415) (xy 4.471582 3.352957) (xy 4.426612 3.364075) (xy 4.370718 3.37735) (xy 4.305787 3.392365) (xy 4.233707 3.408701) (xy 4.156364 3.425939) (xy 4.075646 3.443663) (xy 3.99344 3.461453) (xy 3.911633 3.478891) (xy 3.832113 3.495559) (xy 3.756767 3.511039) (xy 3.687482 3.524912) (xy 3.640666 3.534005) (xy 3.5407 3.552752) (xy 3.43777 3.571417) (xy 3.334727 3.589521) (xy 3.234423 3.606586) (xy 3.139709 3.622134) (xy 3.053438 3.635687) (xy 2.978462 3.646767) (xy 2.925233 3.653947) (xy 2.894457 3.657926) (xy 2.866294 3.661711) (xy 2.857499 3.662944) (xy 2.770022 3.675099) (xy 2.673477 3.687799) (xy 2.57066 3.700725) (xy 2.46437 3.713561) (xy 2.357404 3.72599) (xy 2.252559 3.737694) (xy 2.152633 3.748357) (xy 2.060423 3.75766) (xy 1.978727 3.765287) (xy 1.910341 3.77092) (xy 1.896533 3.771919) (xy 1.860552 3.774562) (xy 1.814646 3.778117) (xy 1.76576 3.78204) (xy 1.735666 3.784529) (xy 1.563861 3.797338) (xy 1.378088 3.808236) (xy 1.18121 3.817192) (xy 0.976086 3.824177) (xy 0.765578 3.829159) (xy 0.552547 3.832107) (xy 0.339855 3.832993) (xy 0.130363 3.831784) (xy -0.073069 3.828452) (xy -0.267579 3.822964) (xy -0.450305 3.815291) (xy -0.563034 3.809016) (xy -0.612177 3.806097) (xy -0.656702 3.803675) (xy -0.693305 3.801915) (xy -0.718682 3.800977) (xy -0.728124 3.800902) (xy -0.743207 3.800516) (xy -0.772651 3.798951) (xy -0.81394 3.796392) (xy -0.864557 3.793023) (xy -0.921986 3.789028) (xy -0.983709 3.784591) (xy -1.047209 3.779896) (xy -1.109971 3.775126) (xy -1.169476 3.770467) (xy -1.223208 3.766101) (xy -1.268651 3.762213) (xy -1.303288 3.758987) (xy -1.3081 3.758499) (xy -1.345319 3.754739) (xy -1.376979 3.751685) (xy -1.398777 3.749744) (xy -1.405467 3.749278) (xy -1.421097 3.748141) (xy -1.450725 3.745512) (xy -1.491509 3.741675) (xy -1.540609 3.736914) (xy -1.595183 3.731513) (xy -1.652388 3.725756) (xy -1.709383 3.719927) (xy -1.763327 3.71431) (xy -1.811379 3.709188) (xy -1.850695 3.704847) (xy -1.854744 3.704385) (xy -2.443003 3.628791) (xy -3.031229 3.536569) (xy -3.619672 3.427669) (xy -4.208584 3.302041) (xy -4.798214 3.159635) (xy -5.388813 3.000399) (xy -5.473701 2.976153) (xy -5.534361 2.958507) (xy -5.602174 2.938437) (xy -5.675084 2.916582) (xy -5.751039 2.893577) (xy -5.756981 2.891761) (xy -0.13445 2.891761) (xy -0.132749 2.900736) (xy -0.124513 2.921223) (xy -0.11139 2.949907) (xy -0.095026 2.983475) (xy -0.07707 3.018611) (xy -0.059168 3.052002) (xy -0.042967 3.080334) (xy -0.032502 3.096889) (xy 0.018014 3.161037) (xy 0.081471 3.225969) (xy 0.154271 3.288829) (xy 0.232819 3.346761) (xy 0.313518 3.39691) (xy 0.39277 3.436419) (xy 0.397815 3.438563) (xy 0.496563 3.471468) (xy 0.600521 3.490244) (xy 0.706154 3.494678) (xy 0.809929 3.484561) (xy 0.883523 3.467559) (xy 0.989603 3.429122) (xy 1.089121 3.377743) (xy 1.184032 3.3122) (xy 1.276292 3.231272) (xy 1.300713 3.206919) (xy 1.355806 3.148117) (xy 1.40028 3.094365) (xy 1.437422 3.041055) (xy 1.470519 2.983574) (xy 1.494766 2.934739) (xy 1.511006 2.898796) (xy 1.527019 2.860805) (xy 1.541539 2.824107) (xy 1.553302 2.79204) (xy 1.561044 2.767944) (xy 1.563501 2.755158) (xy 1.563145 2.754124) (xy 1.554544 2.754414) (xy 1.530446 2.755995) (xy 1.492229 2.758756) (xy 1.441269 2.762585) (xy 1.378945 2.76737) (xy 1.306633 2.772999) (xy 1.225713 2.779361) (xy 1.137561 2.786343) (xy 1.043555 2.793835) (xy 0.945073 2.801725) (xy 0.843493 2.8099) (xy 0.740191 2.81825) (xy 0.636547 2.826662) (xy 0.533936 2.835025) (xy 0.433738 2.843227) (xy 0.33733 2.851156) (xy 0.246088 2.858701) (xy 0.161392 2.86575) (xy 0.084619 2.872191) (xy 0.017146 2.877913) (xy -0.039649 2.882804) (xy -0.084388 2.886752) (xy -0.115694 2.889645) (xy -0.132189 2.891372) (xy -0.13445 2.891761) (xy -5.756981 2.891761) (xy -5.827984 2.870061) (xy -5.903864 2.84667) (xy -5.976625 2.824041) (xy -6.044214 2.802811) (xy -6.104577 2.783617) (xy -6.155658 2.767097) (xy -6.195405 2.753887) (xy -6.221762 2.744624) (xy -6.227881 2.742255) (xy -6.249974 2.734121) (xy -6.266296 2.729436) (xy -6.284001 2.724515) (xy -6.304396 2.717435) (xy -6.322039 2.710956) (xy -6.330725 2.708208) (xy -6.330772 2.708207) (xy -6.33977 2.705639) (xy -6.361306 2.698619) (xy -6.391951 2.688328) (xy -6.428273 2.675948) (xy -6.466843 2.662659) (xy -6.50423 2.649644) (xy -6.537005 2.638083) (xy -6.561736 2.629158) (xy -6.574367 2.62432) (xy -6.595212 2.616154) (xy -6.609872 2.61149) (xy -6.609946 2.611475) (xy -6.623656 2.607348) (xy -6.650367 2.598251) (xy -6.687529 2.585125) (xy -6.732591 2.568914) (xy -6.783001 2.55056) (xy -6.83621 2.531007) (xy -6.889666 2.511196) (xy -6.940817 2.492071) (xy -6.987114 2.474574) (xy -7.026006 2.459649) (xy -7.05494 2.448238) (xy -7.071368 2.441283) (xy -7.073668 2.440091) (xy -7.089613 2.433636) (xy -7.091843 2.4332) (xy -7.104896 2.429287) (xy -7.129898 2.420201) (xy -7.163936 2.407131) (xy -7.204095 2.391267) (xy -7.24746 2.373796) (xy -7.291118 2.35591) (xy -7.332153 2.338797) (xy -7.367651 2.323646) (xy -7.394697 2.311646) (xy -7.410379 2.303987) (xy -7.413067 2.302125) (xy -7.421843 2.29696) (xy -7.423736 2.29761) (xy -7.433213 2.295671) (xy -7.455058 2.287941) (xy -7.486204 2.275594) (xy -7.523584 2.259804) (xy -7.5311 2.256528) (xy -7.6327 2.212027) (xy -7.698347 2.24489) (xy -7.737979 2.265536) (xy -7.780464 2.288926) (xy -7.817035 2.310223) (xy -7.819146 2.31151) (xy -7.846498 2.327679) (xy -7.86849 2.339624) (xy -7.881002 2.34513) (xy -7.881911 2.345267) (xy -7.892016 2.351281) (xy -7.892345 2.351968) (xy -7.900324 2.360509) (xy -7.917485 2.374767) (xy -7.929034 2.383508) (xy -7.959824 2.407428) (xy -7.996809 2.438214) (xy -8.036951 2.473114) (xy -8.077215 2.509376) (xy -8.114565 2.544248) (xy -8.145963 2.574978) (xy -8.168375 2.598814) (xy -8.173798 2.605356) (xy -8.191802 2.630718) (xy -8.200904 2.652195) (xy -8.203997 2.678048) (xy -8.204201 2.692195) (xy -8.19982 2.743713) (xy -8.186555 2.806066) (xy -8.164217 2.879786) (xy -8.13262 2.965403) (xy -8.091576 3.063448) (xy -8.040897 3.17445) (xy -8.014286 3.230034) (xy -7.952392 3.353926) (xy -7.882564 3.487073) (xy -7.806142 3.627263) (xy -7.724461 3.772283) (xy -7.638862 3.91992) (xy -7.550682 4.067962) (xy -7.461258 4.214197) (xy -7.37193 4.35641) (xy -7.284035 4.492391) (xy -7.198911 4.619925) (xy -7.117897 4.736801) (xy -7.04233 4.840806) (xy -7.031317 4.855465) (xy -6.912548 5.019001) (xy -6.798669 5.188101) (xy -6.691168 5.360193) (xy -6.591533 5.532702) (xy -6.501252 5.703053) (xy -6.421812 5.868674) (xy -6.355865 6.024034) (xy -6.327981 6.097813) (xy -6.304129 6.167061) (xy -6.284671 6.230229) (xy -6.269971 6.285769) (xy -6.260391 6.332131) (xy -6.256294 6.367765) (xy -6.258043 6.391124) (xy -6.266001 6.400657) (xy -6.267583 6.4008) (xy -6.285356 6.394199) (xy -6.313264 6.374377) (xy -6.35133 6.34131) (xy -6.399579 6.294973) (xy -6.458037 6.235341) (xy -6.526727 6.162388) (xy -6.605675 6.076089) (xy -6.694904 5.97642) (xy -6.783495 5.875867) (xy -6.826416 5.827763) (xy -6.87361 5.77642) (xy -6.921079 5.72609) (xy -6.964825 5.68102) (xy -6.994604 5.651462) (xy -7.164334 5.486794) (xy -7.332441 5.323008) (xy -7.500723 5.158335) (xy -7.670975 4.991006) (xy -7.844991 4.819249) (xy -8.024568 4.641296) (xy -8.211501 4.455376) (xy -8.407585 4.259718) (xy -8.492511 4.174804) (xy -8.631698 4.035447) (xy -8.759368 3.907356) (xy -8.876077 3.789921) (xy -8.982378 3.682531) (xy -9.078829 3.584577) (xy -9.165982 3.49545) (xy -9.244394 3.414539) (xy -9.314618 3.341236) (xy -9.377211 3.274929) (xy -9.432727 3.215011) (xy -9.48172 3.16087) (xy -9.524747 3.111897) (xy -9.562361 3.067482) (xy -9.595118 3.027017) (xy -9.623573 2.98989) (xy -9.64828 2.955492) (xy -9.669796 2.923214) (xy -9.688673 2.892446) (xy -9.705469 2.862577) (xy -9.720736 2.832999) (xy -9.728697 2.816606) (xy -9.745786 2.777929) (xy -9.761462 2.73763) (xy -9.772857 2.703189) (xy -9.774548 2.696972) (xy -9.785571 2.631314) (xy -9.785814 2.566364) (xy -9.775715 2.506139) (xy -9.755709 2.454654) (xy -9.746621 2.439698) (xy -9.735915 2.426404) (xy -9.714313 2.40174) (xy -9.682622 2.366575) (xy -9.64165 2.321778) (xy -9.592204 2.268217) (xy -9.535092 2.20676) (xy -9.471121 2.138276) (xy -9.401099 2.063633) (xy -9.325834 1.9837) (xy -9.246133 1.899344) (xy -9.162803 1.811435) (xy -9.143128 1.790719) (xy -9.091749 1.736423) (xy -9.048903 1.690686) (xy -9.015318 1.654299) (xy -8.991721 1.628054) (xy -8.978838 1.612744) (xy -8.976627 1.609398) (xy -8.981992 1.602273) (xy -8.998198 1.590665) (xy -9.010494 1.583383) (xy -9.205521 1.470487) (xy -9.389892 1.354933) (xy -9.563001 1.237259) (xy -9.616035 1.198034) (xy -2.298248 1.198034) (xy -2.297557 1.27466) (xy -2.294711 1.338606) (xy -2.289127 1.39405) (xy -2.280226 1.44517) (xy -2.267426 1.496147) (xy -2.250146 1.551159) (xy -2.248457 1.556141) (xy -2.200959 1.669651) (xy -2.137991 1.777883) (xy -2.060427 1.880002) (xy -1.969135 1.975173) (xy -1.864987 2.06256) (xy -1.748856 2.141329) (xy -1.62161 2.210644) (xy -1.517843 2.256553) (xy -1.441971 2.285931) (xy -1.377609 2.30795) (xy -1.321292 2.323155) (xy -1.269554 2.332091) (xy -1.21893 2.335302) (xy -1.165955 2.333333) (xy -1.107164 2.326729) (xy -1.088589 2.324033) (xy -0.940493 2.294862) (xy -0.804477 2.253826) (xy -0.68056 2.20095) (xy -0.568763 2.136256) (xy -0.469108 2.059769) (xy -0.381614 1.971513) (xy -0.306303 1.871511) (xy -0.243195 1.759788) (xy -0.192311 1.636367) (xy -0.153673 1.501273) (xy -0.1273 1.354528) (xy -0.113517 1.202267) (xy -0.11322 1.138767) (xy 1.342152 1.138767) (xy 1.344457 1.240173) (xy 1.351721 1.329395) (xy 1.364843 1.410686) (xy 1.384723 1.488302) (xy 1.412258 1.566497) (xy 1.44835 1.649527) (xy 1.451523 1.656272) (xy 1.469968 1.694119) (xy 1.488251 1.728572) (xy 1.507919 1.761832) (xy 1.530514 1.796094) (xy 1.557584 1.83356) (xy 1.590672 1.876426) (xy 1.631324 1.926892) (xy 1.681085 1.987156) (xy 1.699937 2.009771) (xy 1.777398 2.089509) (xy 1.865548 2.156607) (xy 1.962832 2.210128) (xy 2.067701 2.249133) (xy 2.116666 2.261637) (xy 2.171968 2.270066) (xy 2.238556 2.27426) (xy 2.311353 2.274333) (xy 2.38528 2.270399) (xy 2.455258 2.262571) (xy 2.508353 2.252827) (xy 2.589034 2.231991) (xy 2.668153 2.206247) (xy 2.750138 2.173944) (xy 2.839413 2.133435) (xy 2.874433 2.116404) (xy 2.979843 2.061499) (xy 3.070132 2.008006) (xy 3.146896 1.954648) (xy 3.211732 1.900148) (xy 3.266237 1.843229) (xy 3.312007 1.782612) (xy 3.332386 1.750058) (xy 3.384929 1.644059) (xy 3.42376 1.528669) (xy 3.448901 1.404401) (xy 3.460373 1.271769) (xy 3.458198 1.131289) (xy 3.442397 0.983473) (xy 3.412991 0.828838) (xy 3.370003 0.667896) (xy 3.313453 0.501163) (xy 3.276264 0.406416) (xy 3.25051 0.344768) (xy 3.228944 0.296169) (xy 3.209883 0.257788) (xy 3.191639 0.226791) (xy 3.172527 0.200347) (xy 3.150863 0.175623) (xy 3.124959 0.149788) (xy 3.121674 0.146657) (xy 3.013766 0.05334) (xy 2.90423 -0.02313) (xy 2.79302 -0.082765) (xy 2.680088 -0.125577) (xy 2.565387 -0.15158) (xy 2.448869 -0.160785) (xy 2.330488 -0.153204) (xy 2.210195 -0.128851) (xy 2.14423 -0.108663) (xy 2.107796 -0.096057) (xy 2.08578 -0.087751) (xy 2.076534 -0.082699) (xy 2.078409 -0.079854) (xy 2.089755 -0.078172) (xy 2.095392 -0.077685) (xy 2.119726 -0.073817) (xy 2.137415 -0.067704) (xy 2.139734 -0.066155) (xy 2.156081 -0.060963) (xy 2.162854 -0.062183) (xy 2.176403 -0.062347) (xy 2.180166 -0.059266) (xy 2.190977 -0.05498) (xy 2.197371 -0.056308) (xy 2.208065 -0.055555) (xy 2.209799 -0.051206) (xy 2.214933 -0.045308) (xy 2.218266 -0.046566) (xy 2.226056 -0.045614) (xy 2.226733 -0.042333) (xy 2.23189 -0.036812) (xy 2.235199 -0.0381) (xy 2.242989 -0.037147) (xy 2.243666 -0.033866) (xy 2.248824 -0.028345) (xy 2.252133 -0.029633) (xy 2.259838 -0.028307) (xy 2.260599 -0.024488) (xy 2.26384 -0.018279) (xy 2.266112 -0.019623) (xy 2.274924 -0.018413) (xy 2.283674 -0.010451) (xy 2.291221 -0.002773) (xy 2.289932 -0.008466) (xy 2.291072 -0.010948) (xy 2.300706 -0.002386) (xy 2.306849 0.004234) (xy 2.319522 0.017458) (xy 2.324805 0.020974) (xy 2.324212 0.01905) (xy 2.320832 0.009864) (xy 2.325941 0.011751) (xy 2.34044 0.02537) (xy 2.358365 0.044049) (xy 2.373207 0.060809) (xy 2.378897 0.069415) (xy 2.374899 0.068393) (xy 2.369833 0.066362) (xy 2.376217 0.073978) (xy 2.383366 0.080896) (xy 2.398758 0.097323) (xy 2.406405 0.109569) (xy 2.406571 0.111821) (xy 2.411177 0.120589) (xy 2.417106 0.12389) (xy 2.425745 0.131886) (xy 2.425114 0.136414) (xy 2.427422 0.145366) (xy 2.433581 0.149114) (xy 2.442586 0.157077) (xy 2.442085 0.161754) (xy 2.443753 0.168815) (xy 2.446866 0.169334) (xy 2.452387 0.174491) (xy 2.451099 0.1778) (xy 2.452052 0.18559) (xy 2.455333 0.186267) (xy 2.460854 0.191425) (xy 2.459566 0.194734) (xy 2.460518 0.202523) (xy 2.463799 0.2032) (xy 2.469321 0.208358) (xy 2.468033 0.211667) (xy 2.468553 0.219476) (xy 2.471501 0.220134) (xy 2.476588 0.22632) (xy 2.475328 0.232834) (xy 2.475932 0.243695) (xy 2.480327 0.245534) (xy 2.486224 0.250667) (xy 2.484966 0.254) (xy 2.486144 0.26178) (xy 2.489606 0.262467) (xy 2.495693 0.268605) (xy 2.494604 0.275167) (xy 2.494697 0.286056) (xy 2.498502 0.287867) (xy 2.503404 0.294469) (xy 2.501899 0.3048) (xy 2.501276 0.318751) (xy 2.506468 0.321734) (xy 2.512677 0.327847) (xy 2.511642 0.334163) (xy 2.511915 0.3479) (xy 2.515314 0.351809) (xy 2.520137 0.363069) (xy 2.518833 0.372534) (xy 2.518791 0.38794) (xy 2.522982 0.393648) (xy 2.528057 0.405586) (xy 2.526799 0.427258) (xy 2.525584 0.44937) (xy 2.530772 0.460964) (xy 2.535454 0.472054) (xy 2.538682 0.496397) (xy 2.539992 0.530341) (xy 2.539999 0.5334) (xy 2.538866 0.567962) (xy 2.535776 0.593219) (xy 2.531195 0.605519) (xy 2.530772 0.605837) (xy 2.525521 0.618076) (xy 2.526923 0.640203) (xy 2.528467 0.662007) (xy 2.522532 0.668867) (xy 2.516479 0.675772) (xy 2.517946 0.689515) (xy 2.519032 0.706932) (xy 2.515 0.715186) (xy 2.51036 0.726217) (xy 2.511642 0.732638) (xy 2.510698 0.743323) (xy 2.506133 0.745067) (xy 2.499637 0.751166) (xy 2.500624 0.757496) (xy 2.50046 0.771166) (xy 2.497158 0.775014) (xy 2.492426 0.784803) (xy 2.493433 0.787401) (xy 2.491992 0.797723) (xy 2.489199 0.800101) (xy 2.484172 0.810241) (xy 2.485328 0.813386) (xy 2.483853 0.820719) (xy 2.480733 0.821267) (xy 2.475016 0.826269) (xy 2.476138 0.829149) (xy 2.475046 0.840006) (xy 2.472266 0.842434) (xy 2.467239 0.852575) (xy 2.468394 0.855719) (xy 2.46692 0.863053) (xy 2.463799 0.863601) (xy 2.458278 0.868758) (xy 2.459566 0.872067) (xy 2.458614 0.879857) (xy 2.455333 0.880534) (xy 2.4495 0.885364) (xy 2.450551 0.888113) (xy 2.448211 0.897016) (xy 2.442048 0.900754) (xy 2.43333 0.909144) (xy 2.434129 0.914341) (xy 2.433235 0.922173) (xy 2.429933 0.922867) (xy 2.424241 0.927905) (xy 2.425378 0.930813) (xy 2.42321 0.940771) (xy 2.415294 0.947489) (xy 2.406103 0.954466) (xy 2.407093 0.956476) (xy 2.40445 0.962014) (xy 2.391821 0.976703) (xy 2.371476 0.99801) (xy 2.356293 1.013131) (xy 2.330806 1.037312) (xy 2.309607 1.055985) (xy 2.295666 1.066607) (xy 2.292114 1.068086) (xy 2.283831 1.073401) (xy 2.280643 1.079373) (xy 2.272675 1.088032) (xy 2.268179 1.087419) (xy 2.261118 1.089088) (xy 2.260599 1.092201) (xy 2.255442 1.097722) (xy 2.252133 1.096434) (xy 2.244343 1.097386) (xy 2.243666 1.100667) (xy 2.238509 1.106188) (xy 2.235199 1.104901) (xy 2.22741 1.105853) (xy 2.226733 1.109134) (xy 2.221731 1.114851) (xy 2.218851 1.113729) (xy 2.207934 1.114707) (xy 2.20588 1.117093) (xy 2.19479 1.121827) (xy 2.188362 1.120558) (xy 2.177659 1.121153) (xy 2.175933 1.125323) (xy 2.169027 1.13114) (xy 2.15569 1.129776) (xy 2.138189 1.129162) (xy 2.12979 1.133848) (xy 2.118196 1.140089) (xy 2.097578 1.142977) (xy 2.095499 1.143001) (xy 2.074446 1.140527) (xy 2.061691 1.134508) (xy 2.061209 1.133848) (xy 2.049649 1.128665) (xy 2.035309 1.129776) (xy 2.019278 1.130547) (xy 2.015066 1.125323) (xy 2.008914 1.119524) (xy 2.002366 1.120662) (xy 1.991486 1.120413) (xy 1.989666 1.116429) (xy 1.983497 1.110995) (xy 1.976966 1.112196) (xy 1.966076 1.112137) (xy 1.964266 1.108368) (xy 1.959063 1.10356) (xy 1.955799 1.104901) (xy 1.94801 1.103948) (xy 1.947333 1.100667) (xy 1.942175 1.095146) (xy 1.938866 1.096434) (xy 1.931064 1.095763) (xy 1.930399 1.0927) (xy 1.924912 1.085632) (xy 1.92253 1.085851) (xy 1.911845 1.081643) (xy 1.900736 1.071034) (xy 1.892563 1.062798) (xy 1.892518 1.066801) (xy 1.890656 1.068304) (xy 1.879987 1.059196) (xy 1.86677 1.045634) (xy 1.85192 1.030326) (xy 1.845078 1.024728) (xy 1.846874 1.028701) (xy 1.854174 1.04022) (xy 1.850732 1.039438) (xy 1.843709 1.034091) (xy 1.833792 1.022251) (xy 1.833361 1.015469) (xy 1.830152 1.006428) (xy 1.816688 0.992978) (xy 1.812434 0.989682) (xy 1.797134 0.975874) (xy 1.791183 0.965294) (xy 1.791569 0.963794) (xy 1.789007 0.955224) (xy 1.782818 0.951554) (xy 1.773831 0.943563) (xy 1.774351 0.938854) (xy 1.772044 0.929902) (xy 1.765885 0.926154) (xy 1.756879 0.918191) (xy 1.757381 0.913513) (xy 1.755712 0.906453) (xy 1.752599 0.905934) (xy 1.747078 0.900776) (xy 1.748366 0.897467) (xy 1.747414 0.889678) (xy 1.744133 0.889001) (xy 1.738379 0.884054) (xy 1.739478 0.881216) (xy 1.738226 0.869754) (xy 1.731914 0.861058) (xy 1.724099 0.848975) (xy 1.72478 0.843442) (xy 1.72343 0.838662) (xy 1.719644 0.838201) (xy 1.71327 0.833234) (xy 1.714499 0.829734) (xy 1.713979 0.821925) (xy 1.711032 0.821267) (xy 1.705945 0.815081) (xy 1.707204 0.808567) (xy 1.706956 0.797687) (xy 1.702971 0.795867) (xy 1.697537 0.789698) (xy 1.698738 0.783167) (xy 1.698489 0.772287) (xy 1.694504 0.770467) (xy 1.688889 0.764369) (xy 1.689942 0.758624) (xy 1.688918 0.744883) (xy 1.685305 0.741105) (xy 1.679976 0.730756) (xy 1.681224 0.727178) (xy 1.680879 0.714567) (xy 1.676399 0.706967) (xy 1.67056 0.692672) (xy 1.671937 0.686171) (xy 1.672941 0.671962) (xy 1.670617 0.66675) (xy 1.66562 0.650538) (xy 1.661894 0.62203) (xy 1.659448 0.585067) (xy 1.658294 0.543488) (xy 1.658441 0.501134) (xy 1.6599 0.461846) (xy 1.662682 0.429463) (xy 1.666798 0.407826) (xy 1.669895 0.401615) (xy 1.672849 0.38948) (xy 1.671094 0.37551) (xy 1.670504 0.359519) (xy 1.676052 0.3556) (xy 1.6822 0.349124) (xy 1.680633 0.338667) (xy 1.68001 0.324716) (xy 1.685201 0.321734) (xy 1.691349 0.315598) (xy 1.690271 0.309034) (xy 1.69052 0.298154) (xy 1.694504 0.296334) (xy 1.699939 0.290164) (xy 1.698738 0.283634) (xy 1.698987 0.272754) (xy 1.702971 0.270934) (xy 1.708405 0.264764) (xy 1.707204 0.258234) (xy 1.707263 0.247344) (xy 1.711032 0.245534) (xy 1.71584 0.240331) (xy 1.714499 0.237067) (xy 1.71502 0.229259) (xy 1.717967 0.2286) (xy 1.723054 0.222415) (xy 1.721795 0.2159) (xy 1.722398 0.205039) (xy 1.726793 0.2032) (xy 1.733018 0.198524) (xy 1.731981 0.195621) (xy 1.734322 0.186719) (xy 1.740485 0.182981) (xy 1.749202 0.17459) (xy 1.748403 0.169394) (xy 1.749692 0.161636) (xy 1.753511 0.160867) (xy 1.75972 0.157627) (xy 1.758376 0.155354) (xy 1.759586 0.146543) (xy 1.767548 0.137793) (xy 1.77541 0.130062) (xy 1.769533 0.131234) (xy 1.765553 0.131058) (xy 1.773766 0.123031) (xy 1.786565 0.110612) (xy 1.790717 0.103353) (xy 1.797191 0.092225) (xy 1.814488 0.074067) (xy 1.839484 0.05145) (xy 1.869052 0.026943) (xy 1.900067 0.003115) (xy 1.929403 -0.017465) (xy 1.953934 -0.032225) (xy 1.958268 -0.034385) (xy 1.982472 -0.046536) (xy 1.997301 -0.055396) (xy 1.999877 -0.059221) (xy 1.999318 -0.059259) (xy 1.98008 -0.054169) (xy 1.952226 -0.040625) (xy 1.919953 -0.021245) (xy 1.88746 0.001353) (xy 1.858944 0.024554) (xy 1.847904 0.035133) (xy 1.826503 0.055916) (xy 1.808926 0.070686) (xy 1.799106 0.0762) (xy 1.786974 0.081908) (xy 1.766065 0.097276) (xy 1.739249 0.11967) (xy 1.709394 0.146455) (xy 1.679369 0.174998) (xy 1.652042 0.202665) (xy 1.630281 0.226821) (xy 1.618961 0.241616) (xy 1.597506 0.276861) (xy 1.571605 0.323797) (xy 1.543226 0.378445) (xy 1.514335 0.436824) (xy 1.4869 0.494954) (xy 1.462887 0.548856) (xy 1.444264 0.594548) (xy 1.443376 0.5969) (xy 1.408515 0.695475) (xy 1.382038 0.784649) (xy 1.363054 0.86919) (xy 1.350674 0.953864) (xy 1.344005 1.043438) (xy 1.342152 1.138767) (xy -0.11322 1.138767) (xy -0.112779 1.044772) (xy -0.126479 0.889483) (xy -0.154208 0.73859) (xy -0.195554 0.594284) (xy -0.250108 0.458754) (xy -0.254447 0.449577) (xy -0.320977 0.327045) (xy -0.396776 0.218673) (xy -0.481937 0.124389) (xy -0.57655 0.044124) (xy -0.680708 -0.022194) (xy -0.765543 -0.06129) (xy 2.027205 -0.06129) (xy 2.035527 -0.059935) (xy 2.046509 -0.061491) (xy 2.04664 -0.064381) (xy 2.035308 -0.066403) (xy 2.030412 -0.06505) (xy 2.027205 -0.06129) (xy -0.765543 -0.06129) (xy -0.794501 -0.074635) (xy -0.918021 -0.11327) (xy -1.006658 -0.131532) (xy -1.063343 -0.138221) (xy -1.132066 -0.141972) (xy -1.208208 -0.142895) (xy -1.287153 -0.141101) (xy -1.36428 -0.136702) (xy -1.434973 -0.129807) (xy -1.494612 -0.120528) (xy -1.4986 -0.11972) (xy -1.565082 -0.105463) (xy -1.618748 -0.092843) (xy -1.658641 -0.082119) (xy -1.683804 -0.073551) (xy -1.693282 -0.067396) (xy -1.693334 -0.067021) (xy -1.685569 -0.063927) (xy -1.665019 -0.062197) (xy -1.635795 -0.062134) (xy -1.629422 -0.062342) (xy -1.598283 -0.062696) (xy -1.574329 -0.061403) (xy -1.562032 -0.058739) (xy -1.561417 -0.05816) (xy -1.551216 -0.054849) (xy -1.544896 -0.056308) (xy -1.534183 -0.055915) (xy -1.532467 -0.051971) (xy -1.526298 -0.046537) (xy -1.519767 -0.047738) (xy -1.508906 -0.047134) (xy -1.507067 -0.042739) (xy -1.501934 -0.036841) (xy -1.4986 -0.0381) (xy -1.490811 -0.037147) (xy -1.490134 -0.033866) (xy -1.484976 -0.028345) (xy -1.481667 -0.029633) (xy -1.473878 -0.028681) (xy -1.4732 -0.0254) (xy -1.46837 -0.019567) (xy -1.465621 -0.020618) (xy -1.456664 -0.018351) (xy -1.453157 -0.012572) (xy -1.445005 -0.002591) (xy -1.440689 -0.002038) (xy -1.430487 0.00217) (xy -1.415822 0.015363) (xy -1.414408 0.016934) (xy -1.403536 0.028151) (xy -1.400474 0.028922) (xy -1.401088 0.027517) (xy -1.404486 0.018365) (xy -1.39942 0.020152) (xy -1.384946 0.033558) (xy -1.366969 0.052044) (xy -1.351312 0.069548) (xy -1.344138 0.079877) (xy -1.3462 0.081033) (xy -1.349356 0.081544) (xy -1.341118 0.090546) (xy -1.337734 0.093608) (xy -1.32391 0.108386) (xy -1.318657 0.119272) (xy -1.318762 0.119889) (xy -1.314148 0.129011) (xy -1.308228 0.132357) (xy -1.299588 0.140353) (xy -1.300219 0.144881) (xy -1.297912 0.153833) (xy -1.291752 0.157581) (xy -1.282747 0.165544) (xy -1.283249 0.170221) (xy -1.28158 0.177282) (xy -1.278467 0.1778) (xy -1.272946 0.182958) (xy -1.274234 0.186267) (xy -1.273282 0.194057) (xy -1.27 0.194734) (xy -1.264479 0.199891) (xy -1.265767 0.2032) (xy -1.264815 0.21099) (xy -1.261534 0.211667) (xy -1.256013 0.216825) (xy -1.2573 0.220134) (xy -1.256348 0.227923) (xy -1.253067 0.2286) (xy -1.247546 0.233758) (xy -1.248834 0.237067) (xy -1.247656 0.244846) (xy -1.244194 0.245534) (xy -1.238107 0.251672) (xy -1.239196 0.258234) (xy -1.239497 0.269142) (xy -1.236134 0.270934) (xy -1.231704 0.277151) (xy -1.233072 0.283634) (xy -1.232823 0.294514) (xy -1.228839 0.296334) (xy -1.223404 0.302503) (xy -1.224605 0.309034) (xy -1.223969 0.319893) (xy -1.219536 0.321734) (xy -1.213401 0.328213) (xy -1.214967 0.338667) (xy -1.215656 0.352521) (xy -1.210734 0.3556) (xy -1.204918 0.362109) (xy -1.206274 0.371821) (xy -1.206568 0.387542) (xy -1.202267 0.3937) (xy -1.196958 0.405298) (xy -1.198236 0.415504) (xy -1.199696 0.43368) (xy -1.197169 0.441666) (xy -1.194769 0.453643) (xy -1.192802 0.478865) (xy -1.191471 0.513645) (xy -1.190978 0.554296) (xy -1.190978 0.554567) (xy -1.191465 0.595244) (xy -1.192791 0.630073) (xy -1.194755 0.655368) (xy -1.197153 0.667441) (xy -1.197169 0.667468) (xy -1.200016 0.683312) (xy -1.198236 0.69363) (xy -1.197972 0.709321) (xy -1.202267 0.715434) (xy -1.207563 0.727027) (xy -1.206274 0.737313) (xy -1.205906 0.750619) (xy -1.210734 0.753534) (xy -1.21652 0.760069) (xy -1.214967 0.770467) (xy -1.214344 0.784418) (xy -1.219536 0.787401) (xy -1.225683 0.793536) (xy -1.224605 0.800101) (xy -1.224854 0.810981) (xy -1.228839 0.812801) (xy -1.234273 0.81897) (xy -1.233072 0.825501) (xy -1.23277 0.836409) (xy -1.236134 0.838201) (xy -1.240564 0.844417) (xy -1.239196 0.850901) (xy -1.239799 0.861762) (xy -1.244194 0.863601) (xy -1.250092 0.868734) (xy -1.248834 0.872067) (xy -1.249786 0.879857) (xy -1.253067 0.880534) (xy -1.258588 0.885691) (xy -1.2573 0.889001) (xy -1.258253 0.89679) (xy -1.261534 0.897467) (xy -1.267055 0.902625) (xy -1.265767 0.905934) (xy -1.266719 0.913723) (xy -1.27 0.914401) (xy -1.275522 0.919558) (xy -1.274234 0.922867) (xy -1.275186 0.930657) (xy -1.278467 0.931334) (xy -1.2843 0.936164) (xy -1.283249 0.938913) (xy -1.285589 0.947816) (xy -1.291752 0.951554) (xy -1.30074 0.959544) (xy -1.300219 0.964254) (xy -1.302453 0.973261) (xy -1.308228 0.976778) (xy -1.318209 0.98493) (xy -1.318762 0.989245) (xy -1.32297 0.999447) (xy -1.336163 1.014112) (xy -1.337734 1.015526) (xy -1.348951 1.026398) (xy -1.349722 1.02946) (xy -1.348317 1.028846) (xy -1.339165 1.025448) (xy -1.340952 1.030514) (xy -1.354358 1.044988) (xy -1.372844 1.062966) (xy -1.390348 1.078623) (xy -1.400677 1.085796) (xy -1.401833 1.083734) (xy -1.402344 1.080578) (xy -1.411346 1.088816) (xy -1.414408 1.092201) (xy -1.429186 1.106025) (xy -1.440072 1.111277) (xy -1.440689 1.111172) (xy -1.449811 1.115787) (xy -1.453157 1.121707) (xy -1.461125 1.130365) (xy -1.465621 1.129752) (xy -1.472682 1.131421) (xy -1.4732 1.134534) (xy -1.478358 1.140055) (xy -1.481667 1.138767) (xy -1.489457 1.139719) (xy -1.490134 1.143001) (xy -1.495291 1.148522) (xy -1.4986 1.147234) (xy -1.50638 1.148412) (xy -1.507067 1.151873) (xy -1.513205 1.157961) (xy -1.519767 1.156872) (xy -1.530647 1.157121) (xy -1.532467 1.161105) (xy -1.538568 1.166715) (xy -1.544339 1.165656) (xy -1.558245 1.164749) (xy -1.561838 1.166726) (xy -1.572675 1.169629) (xy -1.595232 1.171584) (xy -1.624699 1.172583) (xy -1.656265 1.172616) (xy -1.685118 1.171676) (xy -1.706448 1.169753) (xy -1.715361 1.167008) (xy -1.725403 1.163949) (xy -1.731705 1.165443) (xy -1.742418 1.165049) (xy -1.744134 1.161105) (xy -1.750303 1.155671) (xy -1.756834 1.156872) (xy -1.767695 1.156268) (xy -1.769534 1.151873) (xy -1.774667 1.145976) (xy -1.778 1.147234) (xy -1.78579 1.146282) (xy -1.786467 1.143001) (xy -1.791625 1.137479) (xy -1.794934 1.138767) (xy -1.802723 1.137815) (xy -1.8034 1.134534) (xy -1.808231 1.128701) (xy -1.81098 1.129752) (xy -1.819803 1.127308) (xy -1.823879 1.120573) (xy -1.830642 1.111281) (xy -1.834284 1.111795) (xy -1.842728 1.109898) (xy -1.85589 1.098198) (xy -1.855897 1.09819) (xy -1.865463 1.088912) (xy -1.866789 1.091171) (xy -1.866323 1.092201) (xy -1.868555 1.093492) (xy -1.880255 1.08472) (xy -1.898899 1.067781) (xy -1.899177 1.067515) (xy -1.918677 1.047352) (xy -1.931272 1.031481) (xy -1.934223 1.023803) (xy -1.937525 1.014988) (xy -1.950716 1.001546) (xy -1.95364 0.999177) (xy -1.965561 0.988797) (xy -1.96632 0.985643) (xy -1.964267 0.986367) (xy -1.95843 0.987409) (xy -1.966252 0.979808) (xy -1.975702 0.968426) (xy -1.975624 0.962446) (xy -1.977466 0.95559) (xy -1.984173 0.951813) (xy -1.993674 0.94385) (xy -1.993352 0.938913) (xy -1.995021 0.931853) (xy -1.998134 0.931334) (xy -2.003655 0.926176) (xy -2.002367 0.922867) (xy -2.003319 0.915078) (xy -2.0066 0.914401) (xy -2.012122 0.909243) (xy -2.010834 0.905934) (xy -2.011786 0.898144) (xy -2.015067 0.897467) (xy -2.020588 0.89231) (xy -2.0193 0.889001) (xy -2.020253 0.881211) (xy -2.023534 0.880534) (xy -2.029055 0.875376) (xy -2.027767 0.872067) (xy -2.028288 0.864259) (xy -2.031235 0.863601) (xy -2.036322 0.857415) (xy -2.035062 0.850901) (xy -2.035311 0.84002) (xy -2.039296 0.838201) (xy -2.04473 0.832031) (xy -2.043529 0.825501) (xy -2.043778 0.81462) (xy -2.047762 0.812801) (xy -2.053197 0.806631) (xy -2.051996 0.800101) (xy -2.052784 0.789247) (xy -2.0574 0.787401) (xy -2.063896 0.781302) (xy -2.062909 0.774972) (xy -2.062576 0.761612) (xy -2.065442 0.75803) (xy -2.069521 0.747273) (xy -2.068318 0.736592) (xy -2.068744 0.722688) (xy -2.074264 0.719667) (xy -2.080953 0.712866) (xy -2.079454 0.699019) (xy -2.077754 0.682014) (xy -2.080653 0.674428) (xy -2.083062 0.664909) (xy -2.084822 0.642254) (xy -2.08594 0.610249) (xy -2.086424 0.572681) (xy -2.08628 0.533334) (xy -2.085516 0.495994) (xy -2.084138 0.464446) (xy -2.082153 0.442477) (xy -2.080206 0.434452) (xy -2.078199 0.419598) (xy -2.081103 0.40651) (xy -2.087224 0.403928) (xy -2.097433 0.415719) (xy -2.111037 0.440015) (xy -2.127339 0.474945) (xy -2.145646 0.51864) (xy -2.165261 0.56923) (xy -2.185491 0.624845) (xy -2.205639 0.683616) (xy -2.225011 0.743674) (xy -2.242912 0.803147) (xy -2.258647 0.860168) (xy -2.27152 0.912865) (xy -2.274625 0.927101) (xy -2.283168 0.96937) (xy -2.289365 1.005881) (xy -2.29359 1.040943) (xy -2.296219 1.078862) (xy -2.297628 1.123949) (xy -2.298192 1.18051) (xy -2.298248 1.198034) (xy -9.616035 1.198034) (xy -9.724242 1.118004) (xy -9.873009 0.997708) (xy -10.008697 0.87691) (xy -10.1307 0.756149) (xy -10.238411 0.635964) (xy -10.331226 0.516895) (xy -10.408539 0.39948) (xy -10.469553 0.284668) (xy -10.509674 0.198419) (xy -10.665391 0.119076) (xy -10.896627 -0.00399) (xy -11.112222 -0.129544) (xy -11.31204 -0.25747) (xy -11.49594 -0.387654) (xy -11.663786 -0.519981) (xy -11.815438 -0.654338) (xy -11.95076 -0.790608) (xy -12.069612 -0.928678) (xy -12.171856 -1.068433) (xy -12.249334 -1.195147) (xy -12.294124 -1.285014) (xy -12.335087 -1.384934) (xy -12.370217 -1.489059) (xy -12.397511 -1.591543) (xy -12.412927 -1.672166) (xy -12.419508 -1.734115) (xy -12.422892 -1.806909) (xy -12.423147 -1.884774) (xy -12.420341 -1.96194) (xy -12.414541 -2.032634) (xy -12.408158 -2.078566) (xy -12.372617 -2.233608) (xy -12.320266 -2.386635) (xy -12.251107 -2.537642) (xy -12.165142 -2.686625) (xy -12.062374 -2.833578) (xy -11.942806 -2.978497) (xy -11.832593 -3.095441) (xy -11.788142 -3.139319) (xy -11.744049 -3.181498) (xy -11.702146 -3.220347) (xy -11.664269 -3.254237) (xy -11.632249 -3.281539) (xy -11.60792 -3.300622) (xy -11.593116 -3.309857) (xy -11.590685 -3.310466) (xy -11.587064 -3.302725) (xy -11.582066 -3.282096) (xy -11.576581 -3.252472) (xy -11.574699 -3.240616) (xy -11.556892 -3.140854) (xy -11.532625 -3.030733) (xy -11.503159 -2.914964) (xy -11.469754 -2.798259) (xy -11.43367 -2.685329) (xy -11.403123 -2.599266) (xy -11.322492 -2.40342) (xy -11.228851 -2.211546) (xy -11.123485 -2.025575) (xy -11.007676 -1.847437) (xy -10.882709 -1.679059) (xy -10.749867 -1.522373) (xy -10.610434 -1.379306) (xy -10.560634 -1.333097) (xy -10.520153 -1.297144) (xy -10.480606 -1.263104) (xy -10.44404 -1.232627) (xy -10.412499 -1.207361) (xy -10.388028 -1.188957) (xy -10.372672 -1.179064) (xy -10.36844 -1.17809) (xy -10.369222 -1.186782) (xy -10.372252 -1.210739) (xy -10.37732 -1.24847) (xy -10.384217 -1.298486) (xy -10.392737 -1.359296) (xy -10.402669 -1.429411) (xy -10.413805 -1.50734) (xy -10.425938 -1.591594) (xy -10.436388 -1.663699) (xy -10.451402 -1.767043) (xy -10.467415 -1.877341) (xy -10.483941 -1.991238) (xy -10.500494 -2.105376) (xy -10.516586 -2.216399) (xy -10.53173 -2.320951) (xy -10.545441 -2.415673) (xy -10.557232 -2.497211) (xy -10.557909 -2.501899) (xy -10.569744 -2.583772) (xy -10.583508 -2.678921) (xy -10.598696 -2.783863) (xy -10.614803 -2.895117) (xy -10.631327 -3.009201) (xy -10.647761 -3.122632) (xy -10.663604 -3.231929) (xy -10.677235 -3.325929) (xy -10.689807 -3.413095) (xy -10.701525 -3.495293) (xy -10.712178 -3.570987) (xy -10.721559 -3.638641) (xy -10.729456 -3.696718) (xy -10.735659 -3.743682) (xy -10.739961 -3.777997) (xy -10.74215 -3.798126) (xy -10.742329 -3.802913) (xy -10.734185 -3.802165) (xy -10.713184 -3.794268) (xy -10.681315 -3.780215) (xy -10.640567 -3.761001) (xy -10.592929 -3.737621) (xy -10.54039 -3.711071) (xy -10.484939 -3.682344) (xy -10.428566 -3.652436) (xy -10.373258 -3.622341) (xy -10.321005 -3.593054) (xy -10.309047 -3.586203) (xy -10.10327 -3.460851) (xy -9.913812 -3.331105) (xy -9.74062 -3.196897) (xy -9.583642 -3.058161) (xy -9.442827 -2.91483) (xy -9.318122 -2.766837) (xy -9.209476 -2.614115) (xy -9.116835 -2.456597) (xy -9.040149 -2.294217) (xy -8.979364 -2.126909) (xy -8.934428 -1.954604) (xy -8.906779 -1.789511) (xy -8.899916 -1.709632) (xy -8.897209 -1.617937) (xy -8.898443 -1.51897) (xy -8.903405 -1.417276) (xy -8.911884 -1.317399) (xy -8.923665 -1.223883) (xy -8.936764 -1.149646) (xy -8.979989 -0.9758) (xy -9.037841 -0.798498) (xy -9.109117 -0.620294) (xy -9.192616 -0.443744) (xy -9.287134 -0.271405) (xy -9.391469 -0.105832) (xy -9.496783 0.040525) (xy -9.520069 0.070856) (xy -9.535184 0.093302) (xy -9.541786 0.111517) (xy -9.539534 0.129154) (xy -9.528089 0.149868) (xy -9.507109 0.177312) (xy -9.481056 0.209237) (xy -9.403793 0.293856) (xy -9.310046 0.378488) (xy -9.200261 0.462854) (xy -9.074884 0.546674) (xy -8.934362 0.629669) (xy -8.779141 0.71156) (xy -8.609668 0.792066) (xy -8.426389 0.870909) (xy -8.4201 0.873483) (xy -8.3185 0.91501) (xy -8.232368 0.823689) (xy -8.201488 0.790086) (xy -8.174823 0.759442) (xy -8.154605 0.734448) (xy -8.143065 0.717793) (xy -8.141365 0.714016) (xy -8.142322 0.707058) (xy -8.147881 0.694251) (xy -8.158624 0.674699) (xy -8.175132 0.647506) (xy -8.197988 0.611776) (xy -8.227775 0.566612) (xy -8.265074 0.511119) (xy -8.310468 0.444401) (xy -8.357336 0.376062) (xy -2.073665 0.376062) (xy -2.072109 0.387043) (xy -2.069219 0.387174) (xy -2.067197 0.375842) (xy -2.06855 0.370946) (xy -2.07231 0.367739) (xy -2.073665 0.376062) (xy -8.357336 0.376062) (xy -8.364538 0.365562) (xy -8.39183 0.325967) (xy -2.061115 0.325967) (xy -2.061038 0.331381) (xy -2.056362 0.322701) (xy -2.048054 0.301823) (xy -2.046036 0.296334) (xy -2.031635 0.259506) (xy -2.015171 0.221395) (xy -2.003868 0.197637) (xy -1.987692 0.169099) (xy -1.965522 0.134221) (xy -1.941819 0.09998) (xy -1.938929 0.096037) (xy -1.920464 0.070724) (xy -1.912036 0.058253) (xy -1.913367 0.058037) (xy -1.924178 0.069489) (xy -1.928648 0.074464) (xy -1.964279 0.120111) (xy -1.998205 0.173995) (xy -2.027687 0.230911) (xy -2.049982 0.285655) (xy -2.061115 0.325967) (xy -8.39183 0.325967) (xy -8.42099 0.283664) (xy -8.490597 0.18251) (xy -8.550538 0.094641) (xy -8.601013 0.019745) (xy -1.86948 0.019745) (xy -1.869423 0.025261) (xy -1.867937 0.0254) (xy -1.86087 0.019615) (xy -1.853121 0.010584) (xy -1.845798 0.000555) (xy -1.850183 0.002658) (xy -1.856317 0.007387) (xy -1.86948 0.019745) (xy -8.601013 0.019745) (xy -8.601088 0.019634) (xy -8.614456 -0.000551) (xy -1.835191 -0.000551) (xy -1.834033 0) (xy -1.826307 -0.00596) (xy -1.824567 -0.008466) (xy -1.82241 -0.016382) (xy -1.823568 -0.016933) (xy -1.831294 -0.010972) (xy -1.833034 -0.008466) (xy -1.835191 -0.000551) (xy -8.614456 -0.000551) (xy -8.628109 -0.021166) (xy -1.811867 -0.021166) (xy -1.807634 -0.016933) (xy -1.8034 -0.021166) (xy -1.807634 -0.0254) (xy -1.811867 -0.021166) (xy -8.628109 -0.021166) (xy -8.633716 -0.029633) (xy -1.794934 -0.029633) (xy -1.7907 -0.0254) (xy -1.786467 -0.029633) (xy -1.7907 -0.033866) (xy -1.794934 -0.029633) (xy -8.633716 -0.029633) (xy -8.639324 -0.0381) (xy -1.778 -0.0381) (xy -1.773767 -0.033866) (xy -1.769534 -0.0381) (xy -1.773767 -0.042333) (xy -1.778 -0.0381) (xy -8.639324 -0.0381) (xy -8.642524 -0.042931) (xy -8.644868 -0.046566) (xy -1.7526 -0.046566) (xy -1.748367 -0.042333) (xy -1.744134 -0.046566) (xy -1.748367 -0.0508) (xy -1.7526 -0.046566) (xy -8.644868 -0.046566) (xy -8.650328 -0.055033) (xy -1.7272 -0.055033) (xy -1.722967 -0.0508) (xy -1.718734 -0.055033) (xy -1.722967 -0.059266) (xy -1.7272 -0.055033) (xy -8.650328 -0.055033) (xy -8.675122 -0.093478) (xy -8.699159 -0.132428) (xy -8.714912 -0.160203) (xy -8.722345 -0.176306) (xy -8.735555 -0.236668) (xy -8.735494 -0.300361) (xy -8.723135 -0.363473) (xy -8.699453 -0.422086) (xy -8.665423 -0.472285) (xy -8.643147 -0.494465) (xy -8.633274 -0.503128) (xy -8.624518 -0.51085) (xy -8.615927 -0.517836) (xy -8.606546 -0.524289) (xy -8.59542 -0.530414) (xy -8.581597 -0.536415) (xy -8.564121 -0.542498) (xy -8.542039 -0.548866) (xy -8.514397 -0.555724) (xy -8.480241 -0.563276) (xy -8.438616 -0.571727) (xy -8.388569 -0.581281) (xy -8.329146 -0.592142) (xy -8.259392 -0.604516) (xy -8.178353 -0.618607) (xy -8.085076 -0.634618) (xy -7.978606 -0.652755) (xy -7.857989 -0.673222) (xy -7.722272 -0.696223) (xy -7.623464 -0.712975) (xy -7.571895 -0.721723) (xy -7.464605 -0.938351) (xy -7.656656 -1.378428) (xy -7.692573 -1.460829) (xy -7.726785 -1.539507) (xy -7.758627 -1.612923) (xy -7.787439 -1.679541) (xy -7.812556 -1.737824) (xy -7.833316 -1.786235) (xy -7.849056 -1.823237) (xy -7.859114 -1.847292) (xy -7.862343 -1.855402) (xy -7.870355 -1.887796) (xy -7.875154 -1.929944) (xy -7.876105 -1.958265) (xy -7.875329 -1.993892) (xy -7.871684 -2.021192) (xy -7.86344 -2.047348) (xy -7.848865 -2.079548) (xy -7.844961 -2.087501) (xy -7.808068 -2.14586) (xy -7.761344 -2.190675) (xy -7.703667 -2.222924) (xy -7.679427 -2.231834) (xy -7.668443 -2.235173) (xy -7.65695 -2.237901) (xy -7.643437 -2.240017) (xy -7.626392 -2.241526) (xy -7.604302 -2.242427) (xy -7.575656 -2.242724) (xy -7.538942 -2.242417) (xy -7.492647 -2.241509) (xy -7.435259 -2.240001) (xy -7.365267 -2.237896) (xy -7.281157 -2.235194) (xy -7.196827 -2.232411) (xy -7.110408 -2.229484) (xy -7.027475 -2.226565) (xy -6.949889 -2.223729) (xy -6.879511 -2.221046) (xy -6.818203 -2.218591) (xy -6.767824 -2.216437) (xy -6.730236 -2.214657) (xy -6.707301 -2.213322) (xy -6.70439 -2.213095) (xy -6.648146 -2.208263) (xy -6.572806 -2.303299) (xy -6.497465 -2.398334) (xy -6.606891 -2.877684) (xy -6.632229 -2.989088) (xy -6.653854 -3.085358) (xy -6.671962 -3.167835) (xy -6.686749 -3.237861) (xy -6.698412 -3.296777) (xy -6.707147 -3.345924) (xy -6.713152 -3.386644) (xy -6.716622 -3.420279) (xy -6.717755 -3.448169) (xy -6.716746 -3.471657) (xy -6.713792 -3.492083) (xy -6.70909 -3.510789) (xy -6.702836 -3.529117) (xy -6.702475 -3.530078) (xy -6.671521 -3.58996) (xy -6.628628 -3.640235) (xy -6.576206 -3.679065) (xy -6.516665 -3.704608) (xy -6.46081 -3.7146) (xy -6.44746 -3.715083) (xy -6.432477 -3.714585) (xy -6.414456 -3.712809) (xy -6.39199 -3.709454) (xy -6.363672 -3.704221) (xy -6.328097 -3.696812) (xy -6.283857 -3.686925) (xy -6.229548 -3.674262) (xy -6.163762 -3.658525) (xy -6.085094 -3.639412) (xy -5.992136 -3.616625) (xy -5.938008 -3.603305) (xy -5.851729 -3.582094) (xy -5.770271 -3.56215) (xy -5.695134 -3.543833) (xy -5.627822 -3.527508) (xy -5.569834 -3.513534) (xy -5.522671 -3.502275) (xy -5.487836 -3.494093) (xy -5.466829 -3.48935) (xy -5.461074 -3.488266) (xy -5.451389 -3.493565) (xy -5.431677 -3.508099) (xy -5.404545 -3.529831) (xy -5.372598 -3.556717) (xy -5.36251 -3.565444) (xy -5.273856 -3.642622) (xy -5.278605 -3.719961) (xy -5.280689 -3.75851) (xy -5.282983 -3.808984) (xy -5.28543 -3.869428) (xy -5.287975 -3.937888) (xy -5.290561 -4.012407) (xy -5.293132 -4.091032) (xy -5.295632 -4.171806) (xy -5.298005 -4.252776) (xy -5.300195 -4.331985) (xy -5.302146 -4.407479) (xy -5.303801 -4.477303) (xy -5.305106 -4.539503) (xy -5.306002 -4.592121) (xy -5.306435 -4.633205) (xy -5.306349 -4.660799) (xy -5.305905 -4.671508) (xy -5.291668 -4.73468) (xy -5.263901 -4.791566) (xy -5.224826 -4.840508) (xy -5.176662 -4.879847) (xy -5.12163 -4.907925) (xy -5.061951 -4.923082) (xy -4.999845 -4.92366) (xy -4.974167 -4.919291) (xy -4.961703 -4.915521) (xy -4.94214 -4.908109) (xy -4.914741 -4.896716) (xy -4.878767 -4.880998) (xy -4.833479 -4.860615) (xy -4.778138 -4.835225) (xy -4.712006 -4.804487) (xy -4.634344 -4.768061) (xy -4.544413 -4.725603) (xy -4.441475 -4.676774) (xy -4.324791 -4.621231) (xy -4.193623 -4.558634) (xy -4.192163 -4.557937) (xy -4.148862 -4.537457) (xy -4.110749 -4.51982) (xy -4.080493 -4.506229) (xy -4.06076 -4.497888) (xy -4.054419 -4.495799) (xy -4.044584 -4.499756) (xy -4.023011 -4.510597) (xy -3.992647 -4.526778) (xy -3.956439 -4.546754) (xy -3.946993 -4.552063) (xy -3.84724 -4.608327) (xy -3.768652 -5.112871) (xy -3.751427 -5.223267) (xy -3.736461 -5.31826) (xy -3.723424 -5.399179) (xy -3.711986 -5.467355) (xy -3.701816 -5.524117) (xy -3.692586 -5.570798) (xy -3.683965 -5.608726) (xy -3.675623 -5.639232) (xy -3.667231 -5.663647) (xy -3.658457 -5.683301) (xy -3.648974 -5.699524) (xy -3.638449 -5.713646) (xy -3.626555 -5.726999) (xy -3.61296 -5.740912) (xy -3.612878 -5.740994) (xy -3.560632 -5.782189) (xy -3.501765 -5.80902) (xy -3.439001 -5.821234) (xy -3.375067 -5.818577) (xy -3.312688 -5.800793) (xy -3.26298 -5.773633) (xy -3.249422 -5.763881) (xy -3.223743 -5.744995) (xy -3.187349 -5.718025) (xy -3.141648 -5.684019) (xy -3.088046 -5.644027) (xy -3.027952 -5.599098) (xy -2.962772 -5.550281) (xy -2.893914 -5.498625) (xy -2.865522 -5.477302) (xy -2.796588 -5.425587) (xy -2.73156 -5.376942) (xy -2.671726 -5.332321) (xy -2.618374 -5.292677) (xy -2.57279 -5.258963) (xy -2.536262 -5.232134) (xy -2.510077 -5.213141) (xy -2.495523 -5.20294) (xy -2.493067 -5.201454) (xy -2.481372 -5.202354) (xy -2.456924 -5.207728) (xy -2.42305 -5.216738) (xy -2.383076 -5.228548) (xy -2.37356 -5.231513) (xy -2.264834 -5.265709) (xy -2.100409 -5.725304) (xy -2.069764 -5.810712) (xy -2.040321 -5.892294) (xy -2.012657 -5.96848) (xy -1.98735 -6.037705) (xy -1.964976 -6.098398) (xy -1.946114 -6.148994) (xy -1.931339 -6.187923) (xy -1.92123 -6.213619) (xy -1.917104 -6.223167) (xy -1.900275 -6.250045) (xy -1.876282 -6.279971) (xy -1.856734 -6.300244) (xy -1.802235 -6.340393) (xy -1.742117 -6.365387) (xy -1.678716 -6.374911) (xy -1.614364 -6.368649) (xy -1.551397 -6.346288) (xy -1.543905 -6.342433) (xy -1.5321 -6.335584) (xy -1.519462 -6.326847) (xy -1.505017 -6.315208) (xy -1.487791 -6.299653) (xy -1.46681 -6.279168) (xy -1.4411 -6.252739) (xy -1.409686 -6.219352) (xy -1.371594 -6.177993) (xy -1.32585 -6.127648) (xy -1.271481 -6.067303) (xy -1.207511 -5.995943) (xy -1.160068 -5.942891) (xy -1.099759 -5.875458) (xy -1.042752 -5.811823) (xy -0.990055 -5.753102) (xy -0.942676 -5.700413) (xy -0.901624 -5.654875) (xy -0.867904 -5.617605) (xy -0.842526 -5.589721) (xy -0.826497 -5.572341) (xy -0.820886 -5.566598) (xy -0.811063 -5.566226) (xy -0.788382 -5.567487) (xy -0.756644 -5.570002) (xy -0.719649 -5.573391) (xy -0.681195 -5.577271) (xy -0.645082 -5.581263) (xy -0.615111 -5.584987) (xy -0.59508 -5.588063) (xy -0.588729 -5.589844) (xy -0.584234 -5.597358) (xy -0.57187 -5.61816) (xy -0.552398 -5.650966) (xy -0.526579 -5.694494) (xy -0.495172 -5.747462) (xy -0.45894 -5.808587) (xy -0.418642 -5.876587) (xy -0.375038 -5.950178) (xy -0.333793 -6.019799) (xy -0.287033 -6.098462) (xy -0.242106 -6.173514) (xy -0.199875 -6.24355) (xy -0.161202 -6.307162) (xy -0.126949 -6.362947) (xy -0.097978 -6.409498) (xy -0.075152 -6.44541) (xy -0.059332 -6.469276) (xy -0.052201 -6.478864) (xy -0.028249 -6.500426) (xy 0.003054 -6.522185) (xy 0.02404 -6.533897) (xy 0.051576 -6.546135) (xy 0.076573 -6.553272) (xy 0.105557 -6.556584) (xy 0.143933 -6.55735) (xy 0.20217 -6.55362)) (layer F.Cu) (width 0.01)) (fp_poly (pts (xy 1.786466 0.105834) (xy 1.782233 0.110067) (xy 1.777999 0.105834) (xy 1.782233 0.1016) (xy 1.786466 0.105834)) (layer Eco2.User) (width 0.01)) (fp_text user LOGO (at 0.75 0 10) (layer F.SilkS) hide (effects (font (size 1.524 1.524) (thickness 0.3))) ) (fp_text user G*** (at 0 0 10) (layer F.SilkS) hide (effects (font (size 1.524 1.524) (thickness 0.3))) ) ) (module Connector_USB:USB_C_Receptacle_HRO_TYPE-C-31-M-12 (layer F.Cu) (tedit 5D3C0721) (tstamp 5EDAAA52) (at 116.695 61.015 180) (descr "USB Type-C receptacle for USB 2.0 and PD, http://www.krhro.com/uploads/soft/180320/1-1P320120243.pdf") (tags "usb usb-c 2.0 pd") (path /5EF5D00C) (attr smd) (fp_text reference J1 (at 0 -5.645) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value "USB C" (at 0 5.1) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -4.7 3.9) (end 4.7 3.9) (layer F.SilkS) (width 0.12)) (fp_line (start -4.47 -3.65) (end 4.47 -3.65) (layer F.Fab) (width 0.1)) (fp_line (start -4.47 -3.65) (end -4.47 3.65) (layer F.Fab) (width 0.1)) (fp_line (start -4.47 3.65) (end 4.47 3.65) (layer F.Fab) (width 0.1)) (fp_line (start 4.47 -3.65) (end 4.47 3.65) (layer F.Fab) (width 0.1)) (fp_line (start -5.32 -5.27) (end 5.32 -5.27) (layer F.CrtYd) (width 0.05)) (fp_line (start -5.32 4.15) (end 5.32 4.15) (layer F.CrtYd) (width 0.05)) (fp_line (start -5.32 -5.27) (end -5.32 4.15) (layer F.CrtYd) (width 0.05)) (fp_line (start 5.32 -5.27) (end 5.32 4.15) (layer F.CrtYd) (width 0.05)) (fp_line (start 4.7 -1.9) (end 4.7 0.1) (layer F.SilkS) (width 0.12)) (fp_line (start 4.7 2) (end 4.7 3.9) (layer F.SilkS) (width 0.12)) (fp_line (start -4.7 -1.9) (end -4.7 0.1) (layer F.SilkS) (width 0.12)) (fp_line (start -4.7 2) (end -4.7 3.9) (layer F.SilkS) (width 0.12)) (fp_text user %V (at 0 0) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text user %V (at 0 0) (layer F.Fab) (effects (font (size 0.4 0.4) (thickness 0.08))) ) (pad B1 smd rect (at 3.25 -4.045 180) (size 0.6 1.45) (layers F.Cu F.Paste F.Mask) (net 73 GND)) (pad A9 smd rect (at 2.45 -4.045 180) (size 0.6 1.45) (layers F.Cu F.Paste F.Mask) (net 3 VCC)) (pad B9 smd rect (at -2.45 -4.045 180) (size 0.6 1.45) (layers F.Cu F.Paste F.Mask) (net 3 VCC)) (pad B12 smd rect (at -3.25 -4.045 180) (size 0.6 1.45) (layers F.Cu F.Paste F.Mask) (net 73 GND)) (pad A1 smd rect (at -3.25 -4.045 180) (size 0.6 1.45) (layers F.Cu F.Paste F.Mask) (net 73 GND)) (pad A4 smd rect (at -2.45 -4.045 180) (size 0.6 1.45) (layers F.Cu F.Paste F.Mask) (net 3 VCC)) (pad B4 smd rect (at 2.45 -4.045 180) (size 0.6 1.45) (layers F.Cu F.Paste F.Mask) (net 3 VCC)) (pad A12 smd rect (at 3.25 -4.045 180) (size 0.6 1.45) (layers F.Cu F.Paste F.Mask) (net 73 GND)) (pad B8 smd rect (at -1.75 -4.045 180) (size 0.3 1.45) (layers F.Cu F.Paste F.Mask)) (pad A5 smd rect (at -1.25 -4.045 180) (size 0.3 1.45) (layers F.Cu F.Paste F.Mask) (net 6 "Net-(J1-PadA5)")) (pad B7 smd rect (at -0.75 -4.045 180) (size 0.3 1.45) (layers F.Cu F.Paste F.Mask) (net 7 "Net-(J1-PadA7)")) (pad A7 smd rect (at 0.25 -4.045 180) (size 0.3 1.45) (layers F.Cu F.Paste F.Mask) (net 7 "Net-(J1-PadA7)")) (pad B6 smd rect (at 0.75 -4.045 180) (size 0.3 1.45) (layers F.Cu F.Paste F.Mask) (net 8 "Net-(J1-PadA6)")) (pad A8 smd rect (at 1.25 -4.045 180) (size 0.3 1.45) (layers F.Cu F.Paste F.Mask)) (pad B5 smd rect (at 1.75 -4.045 180) (size 0.3 1.45) (layers F.Cu F.Paste F.Mask) (net 9 "Net-(J1-PadB5)")) (pad A6 smd rect (at -0.25 -4.045 180) (size 0.3 1.45) (layers F.Cu F.Paste F.Mask) (net 8 "Net-(J1-PadA6)")) (pad S1 thru_hole oval (at 4.32 -3.13 180) (size 1 2.1) (drill oval 0.6 1.7) (layers *.Cu *.Mask) (net 73 GND)) (pad S1 thru_hole oval (at -4.32 -3.13 180) (size 1 2.1) (drill oval 0.6 1.7) (layers *.Cu *.Mask) (net 73 GND)) (pad "" np_thru_hole circle (at -2.89 -2.6 180) (size 0.65 0.65) (drill 0.65) (layers *.Cu *.Mask)) (pad S1 thru_hole oval (at -4.32 1.05 180) (size 1 1.6) (drill oval 0.6 1.2) (layers *.Cu *.Mask) (net 73 GND)) (pad "" np_thru_hole circle (at 2.89 -2.6 180) (size 0.65 0.65) (drill 0.65) (layers *.Cu *.Mask)) (pad S1 thru_hole oval (at 4.32 1.05 180) (size 1 1.6) (drill oval 0.6 1.2) (layers *.Cu *.Mask) (net 73 GND)) (model ${KISYS3DMOD}/Connector_USB.3dshapes/USB_C_Receptacle_HRO_TYPE-C-31-M-12.wrl (at (xyz 0 0 0)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 0)) ) ) (module Fuse:Fuse_1206_3216Metric (layer F.Cu) (tedit 5B301BBE) (tstamp 5EDEAD34) (at 119.08 71) (descr "Fuse SMD 1206 (3216 Metric), square (rectangular) end terminal, IPC_7351 nominal, (Body size source: http://www.tortai-tech.com/upload/download/2011102023233369053.pdf), generated with kicad-footprint-generator") (tags resistor) (path /5EF6C20F) (attr smd) (fp_text reference F1 (at 0 -1.82) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value 500mA (at 0 1.82) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -1.6 0.8) (end -1.6 -0.8) (layer F.Fab) (width 0.1)) (fp_line (start -1.6 -0.8) (end 1.6 -0.8) (layer F.Fab) (width 0.1)) (fp_line (start 1.6 -0.8) (end 1.6 0.8) (layer F.Fab) (width 0.1)) (fp_line (start 1.6 0.8) (end -1.6 0.8) (layer F.Fab) (width 0.1)) (fp_line (start -0.602064 -0.91) (end 0.602064 -0.91) (layer F.SilkS) (width 0.12)) (fp_line (start -0.602064 0.91) (end 0.602064 0.91) (layer F.SilkS) (width 0.12)) (fp_line (start -2.28 1.12) (end -2.28 -1.12) (layer F.CrtYd) (width 0.05)) (fp_line (start -2.28 -1.12) (end 2.28 -1.12) (layer F.CrtYd) (width 0.05)) (fp_line (start 2.28 -1.12) (end 2.28 1.12) (layer F.CrtYd) (width 0.05)) (fp_line (start 2.28 1.12) (end -2.28 1.12) (layer F.CrtYd) (width 0.05)) (fp_text user %V (at 0 0) (layer F.Fab) (effects (font (size 0.4 0.4) (thickness 0.08))) ) (pad 2 smd roundrect (at 1.4 0) (size 1.25 1.75) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.2) (net 3 VCC)) (pad 1 smd roundrect (at -1.4 0) (size 1.25 1.75) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.2) (net 1 +5V)) (model ${KISYS3DMOD}/Fuse.3dshapes/Fuse_1206_3216Metric.wrl (at (xyz 0 0 0)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 0)) ) ) (module Resistor_SMD:R_0805_2012Metric_Pad1.15x1.40mm_HandSolder (layer F.Cu) (tedit 5B36C52B) (tstamp 5EDC85D3) (at 136.3 76.45) (descr "Resistor SMD 0805 (2012 Metric), square (rectangular) end terminal, IPC_7351 nominal with elongated pad for handsoldering. (Body size source: https://docs.google.com/spreadsheets/d/1BsfQQcO9C6DZCsRaXUlFlo91Tg2WpOkGARC1WS5S8t0/edit?usp=sharing), generated with kicad-footprint-generator") (tags "resistor handsolder") (path /5FA6C6B0) (attr smd) (fp_text reference R9 (at 0 -1.65) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value 10k (at 0 1.65) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start 1.85 0.95) (end -1.85 0.95) (layer F.CrtYd) (width 0.05)) (fp_line (start 1.85 -0.95) (end 1.85 0.95) (layer F.CrtYd) (width 0.05)) (fp_line (start -1.85 -0.95) (end 1.85 -0.95) (layer F.CrtYd) (width 0.05)) (fp_line (start -1.85 0.95) (end -1.85 -0.95) (layer F.CrtYd) (width 0.05)) (fp_line (start -0.261252 0.71) (end 0.261252 0.71) (layer F.SilkS) (width 0.12)) (fp_line (start -0.261252 -0.71) (end 0.261252 -0.71) (layer F.SilkS) (width 0.12)) (fp_line (start 1 0.6) (end -1 0.6) (layer F.Fab) (width 0.1)) (fp_line (start 1 -0.6) (end 1 0.6) (layer F.Fab) (width 0.1)) (fp_line (start -1 -0.6) (end 1 -0.6) (layer F.Fab) (width 0.1)) (fp_line (start -1 0.6) (end -1 -0.6) (layer F.Fab) (width 0.1)) (fp_text user %V (at 0 0) (layer F.Fab) (effects (font (size 0.4 0.4) (thickness 0.08))) ) (pad 2 smd roundrect (at 1.025 0) (size 1.15 1.4) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.217391) (net 33 VDD)) (pad 1 smd roundrect (at -1.025 0) (size 1.15 1.4) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.217391) (net 72 "Net-(R9-Pad1)")) (model ${KISYS3DMOD}/Resistor_SMD.3dshapes/R_0805_2012Metric.wrl (at (xyz 0 0 0)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 0)) ) ) (module Capacitor_SMD:C_0805_2012Metric_Pad1.15x1.40mm_HandSolder (layer F.Cu) (tedit 5B36C52B) (tstamp 5EDC2D05) (at 132.2 76.45) (descr "Capacitor SMD 0805 (2012 Metric), square (rectangular) end terminal, IPC_7351 nominal with elongated pad for handsoldering. (Body size source: https://docs.google.com/spreadsheets/d/1BsfQQcO9C6DZCsRaXUlFlo91Tg2WpOkGARC1WS5S8t0/edit?usp=sharing), generated with kicad-footprint-generator") (tags "capacitor handsolder") (path /5F9F59AE) (attr smd) (fp_text reference C10 (at 0 -1.65) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value 0.1u (at 0 1.65) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start 1.85 0.95) (end -1.85 0.95) (layer F.CrtYd) (width 0.05)) (fp_line (start 1.85 -0.95) (end 1.85 0.95) (layer F.CrtYd) (width 0.05)) (fp_line (start -1.85 -0.95) (end 1.85 -0.95) (layer F.CrtYd) (width 0.05)) (fp_line (start -1.85 0.95) (end -1.85 -0.95) (layer F.CrtYd) (width 0.05)) (fp_line (start -0.261252 0.71) (end 0.261252 0.71) (layer F.SilkS) (width 0.12)) (fp_line (start -0.261252 -0.71) (end 0.261252 -0.71) (layer F.SilkS) (width 0.12)) (fp_line (start 1 0.6) (end -1 0.6) (layer F.Fab) (width 0.1)) (fp_line (start 1 -0.6) (end 1 0.6) (layer F.Fab) (width 0.1)) (fp_line (start -1 -0.6) (end 1 -0.6) (layer F.Fab) (width 0.1)) (fp_line (start -1 0.6) (end -1 -0.6) (layer F.Fab) (width 0.1)) (fp_text user %V (at 0 0 180) (layer F.Fab) (effects (font (size 0.4 0.4) (thickness 0.08))) ) (pad 2 smd roundrect (at 1.025 0) (size 1.15 1.4) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.217391) (net 33 VDD)) (pad 1 smd roundrect (at -1.025 0) (size 1.15 1.4) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.217391) (net 34 VSS)) (model ${KISYS3DMOD}/Capacitor_SMD.3dshapes/C_0805_2012Metric.wrl (at (xyz 0 0 0)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 0)) ) ) (module Crystal:Crystal_SMD_3225-4Pin_3.2x2.5mm (layer F.Cu) (tedit 5A0FD1B2) (tstamp 5EDCC63B) (at 54.5 82.95 90) (descr "SMD Crystal SERIES SMD3225/4 http://www.txccrystal.com/images/pdf/7m-accuracy.pdf, 3.2x2.5mm^2 package") (tags "SMD SMT crystal") (path /5F03D985) (attr smd) (fp_text reference Y1 (at 0 -2.45 90) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value Crystal (at 0 2.45 90) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -1.6 -1.25) (end -1.6 1.25) (layer F.Fab) (width 0.1)) (fp_line (start -1.6 1.25) (end 1.6 1.25) (layer F.Fab) (width 0.1)) (fp_line (start 1.6 1.25) (end 1.6 -1.25) (layer F.Fab) (width 0.1)) (fp_line (start 1.6 -1.25) (end -1.6 -1.25) (layer F.Fab) (width 0.1)) (fp_line (start -1.6 0.25) (end -0.6 1.25) (layer F.Fab) (width 0.1)) (fp_line (start -2 -1.65) (end -2 1.65) (layer F.SilkS) (width 0.12)) (fp_line (start -2 1.65) (end 2 1.65) (layer F.SilkS) (width 0.12)) (fp_line (start -2.1 -1.7) (end -2.1 1.7) (layer F.CrtYd) (width 0.05)) (fp_line (start -2.1 1.7) (end 2.1 1.7) (layer F.CrtYd) (width 0.05)) (fp_line (start 2.1 1.7) (end 2.1 -1.7) (layer F.CrtYd) (width 0.05)) (fp_line (start 2.1 -1.7) (end -2.1 -1.7) (layer F.CrtYd) (width 0.05)) (fp_text user %V (at 0 0 180) (layer F.Fab) (effects (font (size 0.4 0.4) (thickness 0.07))) ) (pad 1 smd rect (at -1.1 0.85 90) (size 1.4 1.2) (layers F.Cu F.Paste F.Mask) (net 2 "Net-(C1-Pad1)")) (pad 2 smd rect (at 1.1 0.85 90) (size 1.4 1.2) (layers F.Cu F.Paste F.Mask) (net 73 GND)) (pad 3 smd rect (at 1.1 -0.85 90) (size 1.4 1.2) (layers F.Cu F.Paste F.Mask) (net 69 "Net-(C2-Pad2)")) (pad 4 smd rect (at -1.1 -0.85 90) (size 1.4 1.2) (layers F.Cu F.Paste F.Mask) (net 73 GND)) (model ${KISYS3DMOD}/Crystal.3dshapes/Crystal_SMD_3225-4Pin_3.2x2.5mm.wrl (at (xyz 0 0 0)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 0)) ) ) (module Package_QFP:TQFP-44_10x10mm_P0.8mm (layer F.Cu) (tedit 5A02F146) (tstamp 5EDCC6F7) (at 64.5 84 270) (descr "44-Lead Plastic Thin Quad Flatpack (PT) - 10x10x1.0 mm Body [TQFP] (see Microchip Packaging Specification 00000049BS.pdf)") (tags "QFP 0.8") (path /5F0A0905) (attr smd) (fp_text reference U1 (at 0 -7.45 90) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value ATmega32U4-AU (at 0 7.45 90) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -5.175 -4.6) (end -6.45 -4.6) (layer F.SilkS) (width 0.15)) (fp_line (start 5.175 -5.175) (end 4.5 -5.175) (layer F.SilkS) (width 0.15)) (fp_line (start 5.175 5.175) (end 4.5 5.175) (layer F.SilkS) (width 0.15)) (fp_line (start -5.175 5.175) (end -4.5 5.175) (layer F.SilkS) (width 0.15)) (fp_line (start -5.175 -5.175) (end -4.5 -5.175) (layer F.SilkS) (width 0.15)) (fp_line (start -5.175 5.175) (end -5.175 4.5) (layer F.SilkS) (width 0.15)) (fp_line (start 5.175 5.175) (end 5.175 4.5) (layer F.SilkS) (width 0.15)) (fp_line (start 5.175 -5.175) (end 5.175 -4.5) (layer F.SilkS) (width 0.15)) (fp_line (start -5.175 -5.175) (end -5.175 -4.6) (layer F.SilkS) (width 0.15)) (fp_line (start -6.7 6.7) (end 6.7 6.7) (layer F.CrtYd) (width 0.05)) (fp_line (start -6.7 -6.7) (end 6.7 -6.7) (layer F.CrtYd) (width 0.05)) (fp_line (start 6.7 -6.7) (end 6.7 6.7) (layer F.CrtYd) (width 0.05)) (fp_line (start -6.7 -6.7) (end -6.7 6.7) (layer F.CrtYd) (width 0.05)) (fp_line (start -5 -4) (end -4 -5) (layer F.Fab) (width 0.15)) (fp_line (start -5 5) (end -5 -4) (layer F.Fab) (width 0.15)) (fp_line (start 5 5) (end -5 5) (layer F.Fab) (width 0.15)) (fp_line (start 5 -5) (end 5 5) (layer F.Fab) (width 0.15)) (fp_line (start -4 -5) (end 5 -5) (layer F.Fab) (width 0.15)) (fp_text user %V (at 0 0 180) (layer F.Fab) (effects (font (size 0.4 0.4) (thickness 0.08))) ) (pad 44 smd rect (at -4 -5.7) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask) (net 1 +5V)) (pad 43 smd rect (at -3.2 -5.7) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask) (net 73 GND)) (pad 42 smd rect (at -2.4 -5.7) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask)) (pad 41 smd rect (at -1.6 -5.7) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask) (net 30 /row0,3)) (pad 40 smd rect (at -0.8 -5.7) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask)) (pad 39 smd rect (at 0 -5.7) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask)) (pad 38 smd rect (at 0.8 -5.7) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask)) (pad 37 smd rect (at 1.6 -5.7) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask)) (pad 36 smd rect (at 2.4 -5.7) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask)) (pad 35 smd rect (at 3.2 -5.7) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask) (net 73 GND)) (pad 34 smd rect (at 4 -5.7) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask) (net 1 +5V)) (pad 33 smd rect (at 5.7 -4 270) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask) (net 23 "Net-(R2-Pad2)")) (pad 32 smd rect (at 5.7 -3.2 270) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask)) (pad 31 smd rect (at 5.7 -2.4 270) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask)) (pad 30 smd rect (at 5.7 -1.6 270) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask) (net 5 /col4)) (pad 29 smd rect (at 5.7 -0.8 270) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask) (net 19 /col3)) (pad 28 smd rect (at 5.7 0 270) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask) (net 17 /col2)) (pad 27 smd rect (at 5.7 0.8 270) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask) (net 18 /col1)) (pad 26 smd rect (at 5.7 1.6 270) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask) (net 14 /col0)) (pad 25 smd rect (at 5.7 2.4 270) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask)) (pad 24 smd rect (at 5.7 3.2 270) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask) (net 1 +5V)) (pad 23 smd rect (at 5.7 4 270) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask) (net 73 GND)) (pad 22 smd rect (at 4 5.7) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask)) (pad 21 smd rect (at 3.2 5.7) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask)) (pad 20 smd rect (at 2.4 5.7) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask)) (pad 19 smd rect (at 1.6 5.7) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask) (net 10 "Net-(Jack0-PadR1)")) (pad 18 smd rect (at 0.8 5.7) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask) (net 11 "Net-(Jack0-PadT)")) (pad 17 smd rect (at 0 5.7) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask) (net 2 "Net-(C1-Pad1)")) (pad 16 smd rect (at -0.8 5.7) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask) (net 69 "Net-(C2-Pad2)")) (pad 15 smd rect (at -1.6 5.7) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask) (net 73 GND)) (pad 14 smd rect (at -2.4 5.7) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask) (net 1 +5V)) (pad 13 smd rect (at -3.2 5.7) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask) (net 22 "Net-(R1-Pad1)")) (pad 12 smd rect (at -4 5.7) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask)) (pad 11 smd rect (at -5.7 4 270) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask) (net 25 /row0,0)) (pad 10 smd rect (at -5.7 3.2 270) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask) (net 28 /row0,1)) (pad 9 smd rect (at -5.7 2.4 270) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask) (net 29 /row0,2)) (pad 8 smd rect (at -5.7 1.6 270) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask)) (pad 7 smd rect (at -5.7 0.8 270) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask) (net 1 +5V)) (pad 6 smd rect (at -5.7 0 270) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask) (net 4 "Net-(C8-Pad1)")) (pad 5 smd rect (at -5.7 -0.8 270) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask) (net 73 GND)) (pad 4 smd rect (at -5.7 -1.6 270) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask) (net 71 /D+)) (pad 3 smd rect (at -5.7 -2.4 270) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask) (net 70 /D-)) (pad 2 smd rect (at -5.7 -3.2 270) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask) (net 1 +5V)) (pad 1 smd rect (at -5.7 -4 270) (size 1.5 0.55) (layers F.Cu F.Paste F.Mask)) (model ${KISYS3DMOD}/Package_QFP.3dshapes/TQFP-44_10x10mm_P0.8mm.wrl (at (xyz 0 0 0)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 0)) ) ) (module kbd:TRRS-PJ-320A (layer F.Cu) (tedit 5ECEB228) (tstamp 5ECCBEB0) (at 130 80.7 90) (path /5EFEDC58) (fp_text reference Jack1 (at 0 14.2 90) (layer Dwgs.User) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value TRRS (at 0 -5.6 90) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start 3.05 0) (end -3.05 0) (layer F.SilkS) (width 0.15)) (fp_line (start 3.05 12.1) (end -3.05 12.1) (layer F.SilkS) (width 0.15)) (fp_line (start 3.05 0) (end 3.05 12.1) (layer F.SilkS) (width 0.15)) (fp_line (start -3.05 0) (end -3.05 12.1) (layer F.SilkS) (width 0.15)) (fp_line (start 2.8 0) (end 2.8 -2) (layer F.SilkS) (width 0.15)) (fp_line (start -2.8 0) (end -2.8 -2) (layer F.SilkS) (width 0.15)) (fp_line (start 2.8 -2) (end -2.8 -2) (layer F.SilkS) (width 0.15)) (fp_text user Sleeve (at 0.25 11.4 90) (layer F.Fab) hide (effects (font (size 0.7 0.7) (thickness 0.1))) ) (fp_text user Tip (at 0 10 90) (layer F.Fab) hide (effects (font (size 0.7 0.7) (thickness 0.1))) ) (fp_text user Ring1 (at 0 6.25 90) (layer F.Fab) hide (effects (font (size 0.7 0.7) (thickness 0.1))) ) (fp_text user Ring2 (at 0 3.25 90) (layer F.Fab) hide (effects (font (size 0.7 0.7) (thickness 0.1))) ) (pad R1 thru_hole oval (at 2.3 6.2 90) (size 1.6 2) (drill oval 0.9 1.3) (layers *.Cu *.Mask) (net 12 "Net-(Jack1-PadR1)")) (pad "" np_thru_hole circle (at 0 1.6 90) (size 0.8 0.8) (drill 0.8) (layers *.Cu *.Mask)) (pad "" np_thru_hole circle (at 0 8.6 90) (size 0.8 0.8) (drill 0.8) (layers *.Cu *.Mask)) (pad R2 thru_hole oval (at 2.3 3.2 90) (size 1.6 2) (drill oval 0.9 1.3) (layers *.Cu *.Mask) (net 33 VDD)) (pad T thru_hole oval (at 2.3 10.2 90) (size 1.6 2) (drill oval 0.9 1.3) (layers *.Cu *.Mask) (net 13 "Net-(Jack1-PadT)")) (pad S thru_hole oval (at -2.3 11.3 90) (size 1.6 2) (drill oval 0.9 1.3) (layers *.Cu *.Mask) (net 34 VSS)) (model /Users/danny/syncproj/kicad-libs/footprints/Keebio-Parts.pretty/3dmodels/PJ-320A.step (at (xyz 0 0 0)) (scale (xyz 1 1 1)) (rotate (xyz -90 0 180)) ) ) (module Diode_SMD:D_SOD-123 (layer F.Cu) (tedit 58645DC7) (tstamp 5ECCBCEC) (at 172 42.75 180) (descr SOD-123) (tags SOD-123) (path /5FD3ADF8) (attr smd) (fp_text reference D1_6 (at 0 -2) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value D (at 0 2.1) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -2.25 -1) (end -2.25 1) (layer F.SilkS) (width 0.12)) (fp_line (start 0.25 0) (end 0.75 0) (layer F.Fab) (width 0.1)) (fp_line (start 0.25 0.4) (end -0.35 0) (layer F.Fab) (width 0.1)) (fp_line (start 0.25 -0.4) (end 0.25 0.4) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end 0.25 -0.4) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end -0.35 0.55) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end -0.35 -0.55) (layer F.Fab) (width 0.1)) (fp_line (start -0.75 0) (end -0.35 0) (layer F.Fab) (width 0.1)) (fp_line (start -1.4 0.9) (end -1.4 -0.9) (layer F.Fab) (width 0.1)) (fp_line (start 1.4 0.9) (end -1.4 0.9) (layer F.Fab) (width 0.1)) (fp_line (start 1.4 -0.9) (end 1.4 0.9) (layer F.Fab) (width 0.1)) (fp_line (start -1.4 -0.9) (end 1.4 -0.9) (layer F.Fab) (width 0.1)) (fp_line (start -2.35 -1.15) (end 2.35 -1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start 2.35 -1.15) (end 2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start 2.35 1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start -2.35 -1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start -2.25 1) (end 1.65 1) (layer F.SilkS) (width 0.12)) (fp_line (start -2.25 -1) (end 1.65 -1) (layer F.SilkS) (width 0.12)) (fp_text user %R (at 0 -2) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (pad 2 smd rect (at 1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask) (net 50 "Net-(D1_6-Pad2)")) (pad 1 smd rect (at -1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask) (net 27 /row1,1)) (model ${KISYS3DMOD}/Diode_SMD.3dshapes/D_SOD-123.wrl (at (xyz 0 0 0)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 0)) ) ) (module Diode_SMD:D_SOD-123 (layer F.Cu) (tedit 58645DC7) (tstamp 5ECCBC8A) (at 191 18.25 180) (descr SOD-123) (tags SOD-123) (path /5FD3AE19) (attr smd) (fp_text reference D0_7 (at 0 -2) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value D (at 0 2.1) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -2.25 -1) (end -2.25 1) (layer F.SilkS) (width 0.12)) (fp_line (start 0.25 0) (end 0.75 0) (layer F.Fab) (width 0.1)) (fp_line (start 0.25 0.4) (end -0.35 0) (layer F.Fab) (width 0.1)) (fp_line (start 0.25 -0.4) (end 0.25 0.4) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end 0.25 -0.4) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end -0.35 0.55) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end -0.35 -0.55) (layer F.Fab) (width 0.1)) (fp_line (start -0.75 0) (end -0.35 0) (layer F.Fab) (width 0.1)) (fp_line (start -1.4 0.9) (end -1.4 -0.9) (layer F.Fab) (width 0.1)) (fp_line (start 1.4 0.9) (end -1.4 0.9) (layer F.Fab) (width 0.1)) (fp_line (start 1.4 -0.9) (end 1.4 0.9) (layer F.Fab) (width 0.1)) (fp_line (start -1.4 -0.9) (end 1.4 -0.9) (layer F.Fab) (width 0.1)) (fp_line (start -2.35 -1.15) (end 2.35 -1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start 2.35 -1.15) (end 2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start 2.35 1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start -2.35 -1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start -2.25 1) (end 1.65 1) (layer F.SilkS) (width 0.12)) (fp_line (start -2.25 -1) (end 1.65 -1) (layer F.SilkS) (width 0.12)) (fp_text user %R (at 0 -2) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (pad 2 smd rect (at 1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask) (net 41 "Net-(D0_7-Pad2)")) (pad 1 smd rect (at -1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask) (net 26 /row1,0)) (model ${KISYS3DMOD}/Diode_SMD.3dshapes/D_SOD-123.wrl (at (xyz 0 0 0)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 0)) ) ) (module Diode_SMD:D_SOD-123 (layer F.Cu) (tedit 58645DC7) (tstamp 5ECCBDDA) (at 153 64.25 180) (descr SOD-123) (tags SOD-123) (path /5FD3AE53) (attr smd) (fp_text reference D2_5 (at 0 -2) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value D (at 0 2.1) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -2.25 -1) (end -2.25 1) (layer F.SilkS) (width 0.12)) (fp_line (start 0.25 0) (end 0.75 0) (layer F.Fab) (width 0.1)) (fp_line (start 0.25 0.4) (end -0.35 0) (layer F.Fab) (width 0.1)) (fp_line (start 0.25 -0.4) (end 0.25 0.4) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end 0.25 -0.4) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end -0.35 0.55) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end -0.35 -0.55) (layer F.Fab) (width 0.1)) (fp_line (start -0.75 0) (end -0.35 0) (layer F.Fab) (width 0.1)) (fp_line (start -1.4 0.9) (end -1.4 -0.9) (layer F.Fab) (width 0.1)) (fp_line (start 1.4 0.9) (end -1.4 0.9) (layer F.Fab) (width 0.1)) (fp_line (start 1.4 -0.9) (end 1.4 0.9) (layer F.Fab) (width 0.1)) (fp_line (start -1.4 -0.9) (end 1.4 -0.9) (layer F.Fab) (width 0.1)) (fp_line (start -2.35 -1.15) (end 2.35 -1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start 2.35 -1.15) (end 2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start 2.35 1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start -2.35 -1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start -2.25 1) (end 1.65 1) (layer F.SilkS) (width 0.12)) (fp_line (start -2.25 -1) (end 1.65 -1) (layer F.SilkS) (width 0.12)) (fp_text user %R (at 0 -2) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (pad 2 smd rect (at 1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask) (net 59 "Net-(D2_5-Pad2)")) (pad 1 smd rect (at -1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask) (net 32 /row1,2)) (model ${KISYS3DMOD}/Diode_SMD.3dshapes/D_SOD-123.wrl (at (xyz 0 0 0)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 0)) ) ) (module Diode_SMD:D_SOD-123 (layer F.Cu) (tedit 58645DC7) (tstamp 5ECCBCB4) (at 153 26.25 180) (descr SOD-123) (tags SOD-123) (path /5FD3ADC4) (attr smd) (fp_text reference D0_5 (at 0 -2) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value D (at 0 2.1) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -2.25 -1) (end -2.25 1) (layer F.SilkS) (width 0.12)) (fp_line (start 0.25 0) (end 0.75 0) (layer F.Fab) (width 0.1)) (fp_line (start 0.25 0.4) (end -0.35 0) (layer F.Fab) (width 0.1)) (fp_line (start 0.25 -0.4) (end 0.25 0.4) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end 0.25 -0.4) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end -0.35 0.55) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end -0.35 -0.55) (layer F.Fab) (width 0.1)) (fp_line (start -0.75 0) (end -0.35 0) (layer F.Fab) (width 0.1)) (fp_line (start -1.4 0.9) (end -1.4 -0.9) (layer F.Fab) (width 0.1)) (fp_line (start 1.4 0.9) (end -1.4 0.9) (layer F.Fab) (width 0.1)) (fp_line (start 1.4 -0.9) (end 1.4 0.9) (layer F.Fab) (width 0.1)) (fp_line (start -1.4 -0.9) (end 1.4 -0.9) (layer F.Fab) (width 0.1)) (fp_line (start -2.35 -1.15) (end 2.35 -1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start 2.35 -1.15) (end 2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start 2.35 1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start -2.35 -1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start -2.25 1) (end 1.65 1) (layer F.SilkS) (width 0.12)) (fp_line (start -2.25 -1) (end 1.65 -1) (layer F.SilkS) (width 0.12)) (fp_text user %R (at 0 -2) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (pad 2 smd rect (at 1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask) (net 39 "Net-(D0_5-Pad2)")) (pad 1 smd rect (at -1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask) (net 26 /row1,0)) (model ${KISYS3DMOD}/Diode_SMD.3dshapes/D_SOD-123.wrl (at (xyz 0 0 0)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 0)) ) ) (module Diode_SMD:D_SOD-123 (layer F.Cu) (tedit 58645DC7) (tstamp 5ECCBE12) (at 139.6 90.9 210) (descr SOD-123) (tags SOD-123) (path /5FD3AF4E) (attr smd) (fp_text reference D3_5 (at 0 -2 30) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value D (at 0 2.1 30) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -2.25 -1) (end -2.25 1) (layer F.SilkS) (width 0.12)) (fp_line (start 0.25 0) (end 0.75 0) (layer F.Fab) (width 0.1)) (fp_line (start 0.25 0.4) (end -0.35 0) (layer F.Fab) (width 0.1)) (fp_line (start 0.25 -0.4) (end 0.25 0.4) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end 0.25 -0.4) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end -0.35 0.55) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end -0.35 -0.55) (layer F.Fab) (width 0.1)) (fp_line (start -0.75 0) (end -0.35 0) (layer F.Fab) (width 0.1)) (fp_line (start -1.4 0.9) (end -1.4 -0.9) (layer F.Fab) (width 0.1)) (fp_line (start 1.4 0.9) (end -1.4 0.9) (layer F.Fab) (width 0.1)) (fp_line (start 1.4 -0.9) (end 1.4 0.9) (layer F.Fab) (width 0.1)) (fp_line (start -1.4 -0.9) (end 1.4 -0.9) (layer F.Fab) (width 0.1)) (fp_line (start -2.35 -1.15) (end 2.35 -1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start 2.35 -1.15) (end 2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start 2.35 1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start -2.35 -1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start -2.25 1) (end 1.65 1) (layer F.SilkS) (width 0.12)) (fp_line (start -2.25 -1) (end 1.65 -1) (layer F.SilkS) (width 0.12)) (fp_text user %R (at 0 -2 30) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (pad 2 smd rect (at 1.65 0 210) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask) (net 66 "Net-(D3_5-Pad2)")) (pad 1 smd rect (at -1.65 0 210) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask) (net 31 /row1,3)) (model ${KISYS3DMOD}/Diode_SMD.3dshapes/D_SOD-123.wrl (at (xyz 0 0 0)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 0)) ) ) (module Diode_SMD:D_SOD-123 (layer F.Cu) (tedit 58645DC7) (tstamp 5ECCBD5C) (at 229 55.25 180) (descr SOD-123) (tags SOD-123) (path /5FD3AEEC) (attr smd) (fp_text reference D1_9 (at 0 -2) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value D (at 0 2.1) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -2.25 -1) (end -2.25 1) (layer F.SilkS) (width 0.12)) (fp_line (start 0.25 0) (end 0.75 0) (layer F.Fab) (width 0.1)) (fp_line (start 0.25 0.4) (end -0.35 0) (layer F.Fab) (width 0.1)) (fp_line (start 0.25 -0.4) (end 0.25 0.4) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end 0.25 -0.4) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end -0.35 0.55) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end -0.35 -0.55) (layer F.Fab) (width 0.1)) (fp_line (start -0.75 0) (end -0.35 0) (layer F.Fab) (width 0.1)) (fp_line (start -1.4 0.9) (end -1.4 -0.9) (layer F.Fab) (width 0.1)) (fp_line (start 1.4 0.9) (end -1.4 0.9) (layer F.Fab) (width 0.1)) (fp_line (start 1.4 -0.9) (end 1.4 0.9) (layer F.Fab) (width 0.1)) (fp_line (start -1.4 -0.9) (end 1.4 -0.9) (layer F.Fab) (width 0.1)) (fp_line (start -2.35 -1.15) (end 2.35 -1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start 2.35 -1.15) (end 2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start 2.35 1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start -2.35 -1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start -2.25 1) (end 1.65 1) (layer F.SilkS) (width 0.12)) (fp_line (start -2.25 -1) (end 1.65 -1) (layer F.SilkS) (width 0.12)) (fp_text user %R (at 0 -2) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (pad 2 smd rect (at 1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask) (net 53 "Net-(D1_9-Pad2)")) (pad 1 smd rect (at -1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask) (net 27 /row1,1)) (model ${KISYS3DMOD}/Diode_SMD.3dshapes/D_SOD-123.wrl (at (xyz 0 0 0)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 0)) ) ) (module Capacitor_SMD:C_0805_2012Metric_Pad1.15x1.40mm_HandSolder (layer F.Cu) (tedit 5B36C52B) (tstamp 5EDC4151) (at 140.4 76.45 180) (descr "Capacitor SMD 0805 (2012 Metric), square (rectangular) end terminal, IPC_7351 nominal with elongated pad for handsoldering. (Body size source: https://docs.google.com/spreadsheets/d/1BsfQQcO9C6DZCsRaXUlFlo91Tg2WpOkGARC1WS5S8t0/edit?usp=sharing), generated with kicad-footprint-generator") (tags "capacitor handsolder") (path /5ED8F3F5) (attr smd) (fp_text reference C9 (at 0 -1.65) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value 0.1u (at 0 1.65) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -1 0.6) (end -1 -0.6) (layer F.Fab) (width 0.1)) (fp_line (start -1 -0.6) (end 1 -0.6) (layer F.Fab) (width 0.1)) (fp_line (start 1 -0.6) (end 1 0.6) (layer F.Fab) (width 0.1)) (fp_line (start 1 0.6) (end -1 0.6) (layer F.Fab) (width 0.1)) (fp_line (start -0.261252 -0.71) (end 0.261252 -0.71) (layer F.SilkS) (width 0.12)) (fp_line (start -0.261252 0.71) (end 0.261252 0.71) (layer F.SilkS) (width 0.12)) (fp_line (start -1.85 0.95) (end -1.85 -0.95) (layer F.CrtYd) (width 0.05)) (fp_line (start -1.85 -0.95) (end 1.85 -0.95) (layer F.CrtYd) (width 0.05)) (fp_line (start 1.85 -0.95) (end 1.85 0.95) (layer F.CrtYd) (width 0.05)) (fp_line (start 1.85 0.95) (end -1.85 0.95) (layer F.CrtYd) (width 0.05)) (fp_text user %V (at 0 0 180) (layer F.Fab) (effects (font (size 0.4 0.4) (thickness 0.08))) ) (pad 2 smd roundrect (at 1.025 0 180) (size 1.15 1.4) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.217391) (net 33 VDD)) (pad 1 smd roundrect (at -1.025 0 180) (size 1.15 1.4) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.217391) (net 34 VSS)) (model ${KISYS3DMOD}/Capacitor_SMD.3dshapes/C_0805_2012Metric.wrl (at (xyz 0 0 0)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 0)) ) ) (module Diode_SMD:D_SOD-123 (layer F.Cu) (tedit 58645DC7) (tstamp 5ECCBC98) (at 172 23.75 180) (descr SOD-123) (tags SOD-123) (path /5FD3ADEC) (attr smd) (fp_text reference D0_6 (at 0 -2) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value D (at 0 2.1) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -2.25 -1) (end -2.25 1) (layer F.SilkS) (width 0.12)) (fp_line (start 0.25 0) (end 0.75 0) (layer F.Fab) (width 0.1)) (fp_line (start 0.25 0.4) (end -0.35 0) (layer F.Fab) (width 0.1)) (fp_line (start 0.25 -0.4) (end 0.25 0.4) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end 0.25 -0.4) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end -0.35 0.55) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end -0.35 -0.55) (layer F.Fab) (width 0.1)) (fp_line (start -0.75 0) (end -0.35 0) (layer F.Fab) (width 0.1)) (fp_line (start -1.4 0.9) (end -1.4 -0.9) (layer F.Fab) (width 0.1)) (fp_line (start 1.4 0.9) (end -1.4 0.9) (layer F.Fab) (width 0.1)) (fp_line (start 1.4 -0.9) (end 1.4 0.9) (layer F.Fab) (width 0.1)) (fp_line (start -1.4 -0.9) (end 1.4 -0.9) (layer F.Fab) (width 0.1)) (fp_line (start -2.35 -1.15) (end 2.35 -1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start 2.35 -1.15) (end 2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start 2.35 1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start -2.35 -1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start -2.25 1) (end 1.65 1) (layer F.SilkS) (width 0.12)) (fp_line (start -2.25 -1) (end 1.65 -1) (layer F.SilkS) (width 0.12)) (fp_text user %R (at 0 -2) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (pad 2 smd rect (at 1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask) (net 40 "Net-(D0_6-Pad2)")) (pad 1 smd rect (at -1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask) (net 26 /row1,0)) (model ${KISYS3DMOD}/Diode_SMD.3dshapes/D_SOD-123.wrl (at (xyz 0 0 0)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 0)) ) ) (module Diode_SMD:D_SOD-123 (layer F.Cu) (tedit 58645DC7) (tstamp 5ECCBE2E) (at 161.75 83.45 195) (descr SOD-123) (tags SOD-123) (path /5FD3AF58) (attr smd) (fp_text reference D3_6 (at 0 -2 15) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value D (at 0 2.1 15) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -2.25 -1) (end -2.25 1) (layer F.SilkS) (width 0.12)) (fp_line (start 0.25 0) (end 0.75 0) (layer F.Fab) (width 0.1)) (fp_line (start 0.25 0.4) (end -0.35 0) (layer F.Fab) (width 0.1)) (fp_line (start 0.25 -0.4) (end 0.25 0.4) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end 0.25 -0.4) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end -0.35 0.55) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end -0.35 -0.55) (layer F.Fab) (width 0.1)) (fp_line (start -0.75 0) (end -0.35 0) (layer F.Fab) (width 0.1)) (fp_line (start -1.4 0.9) (end -1.4 -0.9) (layer F.Fab) (width 0.1)) (fp_line (start 1.4 0.9) (end -1.4 0.9) (layer F.Fab) (width 0.1)) (fp_line (start 1.4 -0.9) (end 1.4 0.9) (layer F.Fab) (width 0.1)) (fp_line (start -1.4 -0.9) (end 1.4 -0.9) (layer F.Fab) (width 0.1)) (fp_line (start -2.35 -1.15) (end 2.35 -1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start 2.35 -1.15) (end 2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start 2.35 1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start -2.35 -1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start -2.25 1) (end 1.65 1) (layer F.SilkS) (width 0.12)) (fp_line (start -2.25 -1) (end 1.65 -1) (layer F.SilkS) (width 0.12)) (fp_text user %R (at 0 -2 15) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (pad 2 smd rect (at 1.65 0 195) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask) (net 67 "Net-(D3_6-Pad2)")) (pad 1 smd rect (at -1.65 0 195) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask) (net 31 /row1,3)) (model ${KISYS3DMOD}/Diode_SMD.3dshapes/D_SOD-123.wrl (at (xyz 0 0 0)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 0)) ) ) (module Diode_SMD:D_SOD-123 (layer F.Cu) (tedit 58645DC7) (tstamp 5ECCBDBE) (at 210 62.25 180) (descr SOD-123) (tags SOD-123) (path /5FD3AEC4) (attr smd) (fp_text reference D2_8 (at 0 -2) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value D (at 0 2.1) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -2.25 -1) (end -2.25 1) (layer F.SilkS) (width 0.12)) (fp_line (start 0.25 0) (end 0.75 0) (layer F.Fab) (width 0.1)) (fp_line (start 0.25 0.4) (end -0.35 0) (layer F.Fab) (width 0.1)) (fp_line (start 0.25 -0.4) (end 0.25 0.4) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end 0.25 -0.4) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end -0.35 0.55) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end -0.35 -0.55) (layer F.Fab) (width 0.1)) (fp_line (start -0.75 0) (end -0.35 0) (layer F.Fab) (width 0.1)) (fp_line (start -1.4 0.9) (end -1.4 -0.9) (layer F.Fab) (width 0.1)) (fp_line (start 1.4 0.9) (end -1.4 0.9) (layer F.Fab) (width 0.1)) (fp_line (start 1.4 -0.9) (end 1.4 0.9) (layer F.Fab) (width 0.1)) (fp_line (start -1.4 -0.9) (end 1.4 -0.9) (layer F.Fab) (width 0.1)) (fp_line (start -2.35 -1.15) (end 2.35 -1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start 2.35 -1.15) (end 2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start 2.35 1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start -2.35 -1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start -2.25 1) (end 1.65 1) (layer F.SilkS) (width 0.12)) (fp_line (start -2.25 -1) (end 1.65 -1) (layer F.SilkS) (width 0.12)) (fp_text user %R (at 0 -2) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (pad 2 smd rect (at 1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask) (net 62 "Net-(D2_8-Pad2)")) (pad 1 smd rect (at -1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask) (net 32 /row1,2)) (model ${KISYS3DMOD}/Diode_SMD.3dshapes/D_SOD-123.wrl (at (xyz 0 0 0)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 0)) ) ) (module Diode_SMD:D_SOD-123 (layer F.Cu) (tedit 58645DC7) (tstamp 5ECCBC6E) (at 210 24.25 180) (descr SOD-123) (tags SOD-123) (path /5FD3AEB0) (attr smd) (fp_text reference D0_8 (at 0 -2) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value D (at 0 2.1) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -2.25 -1) (end -2.25 1) (layer F.SilkS) (width 0.12)) (fp_line (start 0.25 0) (end 0.75 0) (layer F.Fab) (width 0.1)) (fp_line (start 0.25 0.4) (end -0.35 0) (layer F.Fab) (width 0.1)) (fp_line (start 0.25 -0.4) (end 0.25 0.4) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end 0.25 -0.4) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end -0.35 0.55) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end -0.35 -0.55) (layer F.Fab) (width 0.1)) (fp_line (start -0.75 0) (end -0.35 0) (layer F.Fab) (width 0.1)) (fp_line (start -1.4 0.9) (end -1.4 -0.9) (layer F.Fab) (width 0.1)) (fp_line (start 1.4 0.9) (end -1.4 0.9) (layer F.Fab) (width 0.1)) (fp_line (start 1.4 -0.9) (end 1.4 0.9) (layer F.Fab) (width 0.1)) (fp_line (start -1.4 -0.9) (end 1.4 -0.9) (layer F.Fab) (width 0.1)) (fp_line (start -2.35 -1.15) (end 2.35 -1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start 2.35 -1.15) (end 2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start 2.35 1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start -2.35 -1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start -2.25 1) (end 1.65 1) (layer F.SilkS) (width 0.12)) (fp_line (start -2.25 -1) (end 1.65 -1) (layer F.SilkS) (width 0.12)) (fp_text user %R (at 0 -2) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (pad 2 smd rect (at 1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask) (net 42 "Net-(D0_8-Pad2)")) (pad 1 smd rect (at -1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask) (net 26 /row1,0)) (model ${KISYS3DMOD}/Diode_SMD.3dshapes/D_SOD-123.wrl (at (xyz 0 0 0)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 0)) ) ) (module Diode_SMD:D_SOD-123 (layer F.Cu) (tedit 58645DC7) (tstamp 5ECCBCA6) (at 229 36.25 180) (descr SOD-123) (tags SOD-123) (path /5FD3AED8) (attr smd) (fp_text reference D0_9 (at 0 -2) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value D (at 0 2.1) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -2.25 -1) (end -2.25 1) (layer F.SilkS) (width 0.12)) (fp_line (start 0.25 0) (end 0.75 0) (layer F.Fab) (width 0.1)) (fp_line (start 0.25 0.4) (end -0.35 0) (layer F.Fab) (width 0.1)) (fp_line (start 0.25 -0.4) (end 0.25 0.4) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end 0.25 -0.4) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end -0.35 0.55) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end -0.35 -0.55) (layer F.Fab) (width 0.1)) (fp_line (start -0.75 0) (end -0.35 0) (layer F.Fab) (width 0.1)) (fp_line (start -1.4 0.9) (end -1.4 -0.9) (layer F.Fab) (width 0.1)) (fp_line (start 1.4 0.9) (end -1.4 0.9) (layer F.Fab) (width 0.1)) (fp_line (start 1.4 -0.9) (end 1.4 0.9) (layer F.Fab) (width 0.1)) (fp_line (start -1.4 -0.9) (end 1.4 -0.9) (layer F.Fab) (width 0.1)) (fp_line (start -2.35 -1.15) (end 2.35 -1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start 2.35 -1.15) (end 2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start 2.35 1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start -2.35 -1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start -2.25 1) (end 1.65 1) (layer F.SilkS) (width 0.12)) (fp_line (start -2.25 -1) (end 1.65 -1) (layer F.SilkS) (width 0.12)) (fp_text user %R (at 0 -2) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (pad 2 smd rect (at 1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask) (net 43 "Net-(D0_9-Pad2)")) (pad 1 smd rect (at -1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask) (net 26 /row1,0)) (model ${KISYS3DMOD}/Diode_SMD.3dshapes/D_SOD-123.wrl (at (xyz 0 0 0)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 0)) ) ) (module Diode_SMD:D_SOD-123 (layer F.Cu) (tedit 58645DC7) (tstamp 5ECCBD78) (at 172 61.75 180) (descr SOD-123) (tags SOD-123) (path /5FD3AE79) (attr smd) (fp_text reference D2_6 (at 0 -2) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value D (at 0 2.1) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -2.25 -1) (end -2.25 1) (layer F.SilkS) (width 0.12)) (fp_line (start 0.25 0) (end 0.75 0) (layer F.Fab) (width 0.1)) (fp_line (start 0.25 0.4) (end -0.35 0) (layer F.Fab) (width 0.1)) (fp_line (start 0.25 -0.4) (end 0.25 0.4) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end 0.25 -0.4) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end -0.35 0.55) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end -0.35 -0.55) (layer F.Fab) (width 0.1)) (fp_line (start -0.75 0) (end -0.35 0) (layer F.Fab) (width 0.1)) (fp_line (start -1.4 0.9) (end -1.4 -0.9) (layer F.Fab) (width 0.1)) (fp_line (start 1.4 0.9) (end -1.4 0.9) (layer F.Fab) (width 0.1)) (fp_line (start 1.4 -0.9) (end 1.4 0.9) (layer F.Fab) (width 0.1)) (fp_line (start -1.4 -0.9) (end 1.4 -0.9) (layer F.Fab) (width 0.1)) (fp_line (start -2.35 -1.15) (end 2.35 -1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start 2.35 -1.15) (end 2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start 2.35 1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start -2.35 -1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start -2.25 1) (end 1.65 1) (layer F.SilkS) (width 0.12)) (fp_line (start -2.25 -1) (end 1.65 -1) (layer F.SilkS) (width 0.12)) (fp_text user %R (at 0 -2) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (pad 2 smd rect (at 1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask) (net 60 "Net-(D2_6-Pad2)")) (pad 1 smd rect (at -1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask) (net 32 /row1,2)) (model ${KISYS3DMOD}/Diode_SMD.3dshapes/D_SOD-123.wrl (at (xyz 0 0 0)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 0)) ) ) (module Diode_SMD:D_SOD-123 (layer F.Cu) (tedit 58645DC7) (tstamp 5ECCBD24) (at 191 37.25 180) (descr SOD-123) (tags SOD-123) (path /5FD3AE3E) (attr smd) (fp_text reference D1_7 (at 0 -2) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value D (at 0 2.1) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -2.25 -1) (end -2.25 1) (layer F.SilkS) (width 0.12)) (fp_line (start 0.25 0) (end 0.75 0) (layer F.Fab) (width 0.1)) (fp_line (start 0.25 0.4) (end -0.35 0) (layer F.Fab) (width 0.1)) (fp_line (start 0.25 -0.4) (end 0.25 0.4) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end 0.25 -0.4) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end -0.35 0.55) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end -0.35 -0.55) (layer F.Fab) (width 0.1)) (fp_line (start -0.75 0) (end -0.35 0) (layer F.Fab) (width 0.1)) (fp_line (start -1.4 0.9) (end -1.4 -0.9) (layer F.Fab) (width 0.1)) (fp_line (start 1.4 0.9) (end -1.4 0.9) (layer F.Fab) (width 0.1)) (fp_line (start 1.4 -0.9) (end 1.4 0.9) (layer F.Fab) (width 0.1)) (fp_line (start -1.4 -0.9) (end 1.4 -0.9) (layer F.Fab) (width 0.1)) (fp_line (start -2.35 -1.15) (end 2.35 -1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start 2.35 -1.15) (end 2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start 2.35 1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start -2.35 -1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start -2.25 1) (end 1.65 1) (layer F.SilkS) (width 0.12)) (fp_line (start -2.25 -1) (end 1.65 -1) (layer F.SilkS) (width 0.12)) (fp_text user %R (at 0 -2) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (pad 2 smd rect (at 1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask) (net 51 "Net-(D1_7-Pad2)")) (pad 1 smd rect (at -1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask) (net 27 /row1,1)) (model ${KISYS3DMOD}/Diode_SMD.3dshapes/D_SOD-123.wrl (at (xyz 0 0 0)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 0)) ) ) (module Package_SO:SOIC-28W_7.5x17.9mm_P1.27mm (layer F.Cu) (tedit 5D9F72B1) (tstamp 5EDC4344) (at 136.67 66.14) (descr "SOIC, 28 Pin (JEDEC MS-013AE, https://www.analog.com/media/en/package-pcb-resources/package/35833120341221rw_28.pdf), generated with kicad-footprint-generator ipc_gullwing_generator.py") (tags "SOIC SO") (path /5ED65123) (attr smd) (fp_text reference U2 (at 0 -9.9) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value MCP23017_SO (at 0 9.9) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start 0 9.06) (end 3.86 9.06) (layer F.SilkS) (width 0.12)) (fp_line (start 3.86 9.06) (end 3.86 8.815) (layer F.SilkS) (width 0.12)) (fp_line (start 0 9.06) (end -3.86 9.06) (layer F.SilkS) (width 0.12)) (fp_line (start -3.86 9.06) (end -3.86 8.815) (layer F.SilkS) (width 0.12)) (fp_line (start 0 -9.06) (end 3.86 -9.06) (layer F.SilkS) (width 0.12)) (fp_line (start 3.86 -9.06) (end 3.86 -8.815) (layer F.SilkS) (width 0.12)) (fp_line (start 0 -9.06) (end -3.86 -9.06) (layer F.SilkS) (width 0.12)) (fp_line (start -3.86 -9.06) (end -3.86 -8.815) (layer F.SilkS) (width 0.12)) (fp_line (start -3.86 -8.815) (end -5.675 -8.815) (layer F.SilkS) (width 0.12)) (fp_line (start -2.75 -8.95) (end 3.75 -8.95) (layer F.Fab) (width 0.1)) (fp_line (start 3.75 -8.95) (end 3.75 8.95) (layer F.Fab) (width 0.1)) (fp_line (start 3.75 8.95) (end -3.75 8.95) (layer F.Fab) (width 0.1)) (fp_line (start -3.75 8.95) (end -3.75 -7.95) (layer F.Fab) (width 0.1)) (fp_line (start -3.75 -7.95) (end -2.75 -8.95) (layer F.Fab) (width 0.1)) (fp_line (start -5.93 -9.2) (end -5.93 9.2) (layer F.CrtYd) (width 0.05)) (fp_line (start -5.93 9.2) (end 5.93 9.2) (layer F.CrtYd) (width 0.05)) (fp_line (start 5.93 9.2) (end 5.93 -9.2) (layer F.CrtYd) (width 0.05)) (fp_line (start 5.93 -9.2) (end -5.93 -9.2) (layer F.CrtYd) (width 0.05)) (fp_text user %V (at 0 0) (layer F.Fab) (effects (font (size 0.4 0.4) (thickness 0.08))) ) (pad 28 smd roundrect (at 4.65 -8.255) (size 2.05 0.6) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.25)) (pad 27 smd roundrect (at 4.65 -6.985) (size 2.05 0.6) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.25)) (pad 26 smd roundrect (at 4.65 -5.715) (size 2.05 0.6) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.25)) (pad 25 smd roundrect (at 4.65 -4.445) (size 2.05 0.6) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.25) (net 24 /col9)) (pad 24 smd roundrect (at 4.65 -3.175) (size 2.05 0.6) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.25) (net 15 /col8)) (pad 23 smd roundrect (at 4.65 -1.905) (size 2.05 0.6) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.25) (net 21 /col7)) (pad 22 smd roundrect (at 4.65 -0.635) (size 2.05 0.6) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.25) (net 20 /col6)) (pad 21 smd roundrect (at 4.65 0.635) (size 2.05 0.6) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.25) (net 16 /col5)) (pad 20 smd roundrect (at 4.65 1.905) (size 2.05 0.6) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.25)) (pad 19 smd roundrect (at 4.65 3.175) (size 2.05 0.6) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.25)) (pad 18 smd roundrect (at 4.65 4.445) (size 2.05 0.6) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.25) (net 72 "Net-(R9-Pad1)")) (pad 17 smd roundrect (at 4.65 5.715) (size 2.05 0.6) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.25) (net 34 VSS)) (pad 16 smd roundrect (at 4.65 6.985) (size 2.05 0.6) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.25) (net 34 VSS)) (pad 15 smd roundrect (at 4.65 8.255) (size 2.05 0.6) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.25) (net 34 VSS)) (pad 14 smd roundrect (at -4.65 8.255) (size 2.05 0.6) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.25)) (pad 13 smd roundrect (at -4.65 6.985) (size 2.05 0.6) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.25) (net 12 "Net-(Jack1-PadR1)")) (pad 12 smd roundrect (at -4.65 5.715) (size 2.05 0.6) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.25) (net 13 "Net-(Jack1-PadT)")) (pad 11 smd roundrect (at -4.65 4.445) (size 2.05 0.6) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.25)) (pad 10 smd roundrect (at -4.65 3.175) (size 2.05 0.6) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.25) (net 34 VSS)) (pad 9 smd roundrect (at -4.65 1.905) (size 2.05 0.6) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.25) (net 33 VDD)) (pad 8 smd roundrect (at -4.65 0.635) (size 2.05 0.6) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.25)) (pad 7 smd roundrect (at -4.65 -0.635) (size 2.05 0.6) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.25)) (pad 6 smd roundrect (at -4.65 -1.905) (size 2.05 0.6) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.25)) (pad 5 smd roundrect (at -4.65 -3.175) (size 2.05 0.6) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.25)) (pad 4 smd roundrect (at -4.65 -4.445) (size 2.05 0.6) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.25) (net 31 /row1,3)) (pad 3 smd roundrect (at -4.65 -5.715) (size 2.05 0.6) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.25) (net 32 /row1,2)) (pad 2 smd roundrect (at -4.65 -6.985) (size 2.05 0.6) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.25) (net 27 /row1,1)) (pad 1 smd roundrect (at -4.65 -8.255) (size 2.05 0.6) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.25) (net 26 /row1,0)) (model ${KISYS3DMOD}/Package_SO.3dshapes/SOIC-28W_7.5x17.9mm_P1.27mm.wrl (at (xyz 0 0 0)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 0)) ) ) (module Diode_SMD:D_SOD-123 (layer F.Cu) (tedit 58645DC7) (tstamp 5ECCBD4E) (at 210 43.25 180) (descr SOD-123) (tags SOD-123) (path /5FD3AEBA) (attr smd) (fp_text reference D1_8 (at 0 -2) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value D (at 0 2.1) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -2.25 -1) (end -2.25 1) (layer F.SilkS) (width 0.12)) (fp_line (start 0.25 0) (end 0.75 0) (layer F.Fab) (width 0.1)) (fp_line (start 0.25 0.4) (end -0.35 0) (layer F.Fab) (width 0.1)) (fp_line (start 0.25 -0.4) (end 0.25 0.4) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end 0.25 -0.4) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end -0.35 0.55) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end -0.35 -0.55) (layer F.Fab) (width 0.1)) (fp_line (start -0.75 0) (end -0.35 0) (layer F.Fab) (width 0.1)) (fp_line (start -1.4 0.9) (end -1.4 -0.9) (layer F.Fab) (width 0.1)) (fp_line (start 1.4 0.9) (end -1.4 0.9) (layer F.Fab) (width 0.1)) (fp_line (start 1.4 -0.9) (end 1.4 0.9) (layer F.Fab) (width 0.1)) (fp_line (start -1.4 -0.9) (end 1.4 -0.9) (layer F.Fab) (width 0.1)) (fp_line (start -2.35 -1.15) (end 2.35 -1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start 2.35 -1.15) (end 2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start 2.35 1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start -2.35 -1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start -2.25 1) (end 1.65 1) (layer F.SilkS) (width 0.12)) (fp_line (start -2.25 -1) (end 1.65 -1) (layer F.SilkS) (width 0.12)) (fp_text user %R (at 0 -2) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (pad 2 smd rect (at 1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask) (net 52 "Net-(D1_8-Pad2)")) (pad 1 smd rect (at -1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask) (net 27 /row1,1)) (model ${KISYS3DMOD}/Diode_SMD.3dshapes/D_SOD-123.wrl (at (xyz 0 0 0)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 0)) ) ) (module Diode_SMD:D_SOD-123 (layer F.Cu) (tedit 58645DC7) (tstamp 5ECCBDE8) (at 191 56.25 180) (descr SOD-123) (tags SOD-123) (path /5FD3AE83) (attr smd) (fp_text reference D2_7 (at 0 -2) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value D (at 0 2.1) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -2.25 -1) (end -2.25 1) (layer F.SilkS) (width 0.12)) (fp_line (start 0.25 0) (end 0.75 0) (layer F.Fab) (width 0.1)) (fp_line (start 0.25 0.4) (end -0.35 0) (layer F.Fab) (width 0.1)) (fp_line (start 0.25 -0.4) (end 0.25 0.4) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end 0.25 -0.4) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end -0.35 0.55) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end -0.35 -0.55) (layer F.Fab) (width 0.1)) (fp_line (start -0.75 0) (end -0.35 0) (layer F.Fab) (width 0.1)) (fp_line (start -1.4 0.9) (end -1.4 -0.9) (layer F.Fab) (width 0.1)) (fp_line (start 1.4 0.9) (end -1.4 0.9) (layer F.Fab) (width 0.1)) (fp_line (start 1.4 -0.9) (end 1.4 0.9) (layer F.Fab) (width 0.1)) (fp_line (start -1.4 -0.9) (end 1.4 -0.9) (layer F.Fab) (width 0.1)) (fp_line (start -2.35 -1.15) (end 2.35 -1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start 2.35 -1.15) (end 2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start 2.35 1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start -2.35 -1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start -2.25 1) (end 1.65 1) (layer F.SilkS) (width 0.12)) (fp_line (start -2.25 -1) (end 1.65 -1) (layer F.SilkS) (width 0.12)) (fp_text user %R (at 0 -2) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (pad 2 smd rect (at 1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask) (net 61 "Net-(D2_7-Pad2)")) (pad 1 smd rect (at -1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask) (net 32 /row1,2)) (model ${KISYS3DMOD}/Diode_SMD.3dshapes/D_SOD-123.wrl (at (xyz 0 0 0)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 0)) ) ) (module Diode_SMD:D_SOD-123 (layer F.Cu) (tedit 58645DC7) (tstamp 5ECCBD94) (at 229 74.25 180) (descr SOD-123) (tags SOD-123) (path /5FD3AF00) (attr smd) (fp_text reference D2_9 (at 0 -2) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value D (at 0 2.1) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -2.25 -1) (end -2.25 1) (layer F.SilkS) (width 0.12)) (fp_line (start 0.25 0) (end 0.75 0) (layer F.Fab) (width 0.1)) (fp_line (start 0.25 0.4) (end -0.35 0) (layer F.Fab) (width 0.1)) (fp_line (start 0.25 -0.4) (end 0.25 0.4) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end 0.25 -0.4) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end -0.35 0.55) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end -0.35 -0.55) (layer F.Fab) (width 0.1)) (fp_line (start -0.75 0) (end -0.35 0) (layer F.Fab) (width 0.1)) (fp_line (start -1.4 0.9) (end -1.4 -0.9) (layer F.Fab) (width 0.1)) (fp_line (start 1.4 0.9) (end -1.4 0.9) (layer F.Fab) (width 0.1)) (fp_line (start 1.4 -0.9) (end 1.4 0.9) (layer F.Fab) (width 0.1)) (fp_line (start -1.4 -0.9) (end 1.4 -0.9) (layer F.Fab) (width 0.1)) (fp_line (start -2.35 -1.15) (end 2.35 -1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start 2.35 -1.15) (end 2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start 2.35 1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start -2.35 -1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start -2.25 1) (end 1.65 1) (layer F.SilkS) (width 0.12)) (fp_line (start -2.25 -1) (end 1.65 -1) (layer F.SilkS) (width 0.12)) (fp_text user %R (at 0 -2) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (pad 2 smd rect (at 1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask) (net 63 "Net-(D2_9-Pad2)")) (pad 1 smd rect (at -1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask) (net 32 /row1,2)) (model ${KISYS3DMOD}/Diode_SMD.3dshapes/D_SOD-123.wrl (at (xyz 0 0 0)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 0)) ) ) (module Diode_SMD:D_SOD-123 (layer F.Cu) (tedit 58645DC7) (tstamp 5ECCBCDE) (at 153 45.25 180) (descr SOD-123) (tags SOD-123) (path /5FD3ADDD) (attr smd) (fp_text reference D1_5 (at 0 -2) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value D (at 0 2.1) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -2.25 -1) (end -2.25 1) (layer F.SilkS) (width 0.12)) (fp_line (start 0.25 0) (end 0.75 0) (layer F.Fab) (width 0.1)) (fp_line (start 0.25 0.4) (end -0.35 0) (layer F.Fab) (width 0.1)) (fp_line (start 0.25 -0.4) (end 0.25 0.4) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end 0.25 -0.4) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end -0.35 0.55) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end -0.35 -0.55) (layer F.Fab) (width 0.1)) (fp_line (start -0.75 0) (end -0.35 0) (layer F.Fab) (width 0.1)) (fp_line (start -1.4 0.9) (end -1.4 -0.9) (layer F.Fab) (width 0.1)) (fp_line (start 1.4 0.9) (end -1.4 0.9) (layer F.Fab) (width 0.1)) (fp_line (start 1.4 -0.9) (end 1.4 0.9) (layer F.Fab) (width 0.1)) (fp_line (start -1.4 -0.9) (end 1.4 -0.9) (layer F.Fab) (width 0.1)) (fp_line (start -2.35 -1.15) (end 2.35 -1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start 2.35 -1.15) (end 2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start 2.35 1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start -2.35 -1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start -2.25 1) (end 1.65 1) (layer F.SilkS) (width 0.12)) (fp_line (start -2.25 -1) (end 1.65 -1) (layer F.SilkS) (width 0.12)) (fp_text user %R (at 0 -2) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (pad 2 smd rect (at 1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask) (net 49 "Net-(D1_5-Pad2)")) (pad 1 smd rect (at -1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask) (net 27 /row1,1)) (model ${KISYS3DMOD}/Diode_SMD.3dshapes/D_SOD-123.wrl (at (xyz 0 0 0)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 0)) ) ) (module Button_Switch_SMD:SW_SPST_B3U-1000P (layer F.Cu) (tedit 5A02FC95) (tstamp 5F0032F9) (at 42 83.5 90) (descr "Ultra-small-sized Tactile Switch with High Contact Reliability, Top-actuated Model, without Ground Terminal, without Boss") (tags "Tactile Switch") (path /5ECF50EB) (attr smd) (fp_text reference SW1 (at 0 -2.5 90) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value SW_PUSH (at 0 2.5 90) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -2.4 1.65) (end 2.4 1.65) (layer F.CrtYd) (width 0.05)) (fp_line (start 2.4 1.65) (end 2.4 -1.65) (layer F.CrtYd) (width 0.05)) (fp_line (start 2.4 -1.65) (end -2.4 -1.65) (layer F.CrtYd) (width 0.05)) (fp_line (start -2.4 -1.65) (end -2.4 1.65) (layer F.CrtYd) (width 0.05)) (fp_line (start -1.65 1.1) (end -1.65 1.4) (layer F.SilkS) (width 0.12)) (fp_line (start -1.65 1.4) (end 1.65 1.4) (layer F.SilkS) (width 0.12)) (fp_line (start 1.65 1.4) (end 1.65 1.1) (layer F.SilkS) (width 0.12)) (fp_line (start -1.65 -1.1) (end -1.65 -1.4) (layer F.SilkS) (width 0.12)) (fp_line (start -1.65 -1.4) (end 1.65 -1.4) (layer F.SilkS) (width 0.12)) (fp_line (start 1.65 -1.4) (end 1.65 -1.1) (layer F.SilkS) (width 0.12)) (fp_line (start -1.5 -1.25) (end 1.5 -1.25) (layer F.Fab) (width 0.1)) (fp_line (start 1.5 -1.25) (end 1.5 1.25) (layer F.Fab) (width 0.1)) (fp_line (start 1.5 1.25) (end -1.5 1.25) (layer F.Fab) (width 0.1)) (fp_line (start -1.5 1.25) (end -1.5 -1.25) (layer F.Fab) (width 0.1)) (fp_circle (center 0 0) (end 0.75 0) (layer F.Fab) (width 0.1)) (fp_text user %V (at 1.18 0.01 180) (layer F.Fab) (effects (font (size 0.4 0.4) (thickness 0.08))) ) (pad 1 smd rect (at -1.7 0 90) (size 0.9 1.7) (layers F.Cu F.Paste F.Mask) (net 73 GND)) (pad 2 smd rect (at 1.7 0 90) (size 0.9 1.7) (layers F.Cu F.Paste F.Mask) (net 22 "Net-(R1-Pad1)")) (model ${KISYS3DMOD}/Button_Switch_SMD.3dshapes/SW_SPST_B3U-1000P.wrl (at (xyz 0 0 0)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 0)) ) ) (module Diode_SMD:D_SOD-123 (layer F.Cu) (tedit 58645DC7) (tstamp 5EDAAE47) (at 112.3 90.9 150) (descr SOD-123) (tags SOD-123) (path /5EF1DFD1) (attr smd) (fp_text reference D3_4 (at 0 -2 150) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value D (at 0 2.1 150) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -2.25 -1) (end -2.25 1) (layer F.SilkS) (width 0.12)) (fp_line (start 0.25 0) (end 0.75 0) (layer F.Fab) (width 0.1)) (fp_line (start 0.25 0.4) (end -0.35 0) (layer F.Fab) (width 0.1)) (fp_line (start 0.25 -0.4) (end 0.25 0.4) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end 0.25 -0.4) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end -0.35 0.55) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end -0.35 -0.55) (layer F.Fab) (width 0.1)) (fp_line (start -0.75 0) (end -0.35 0) (layer F.Fab) (width 0.1)) (fp_line (start -1.4 0.9) (end -1.4 -0.9) (layer F.Fab) (width 0.1)) (fp_line (start 1.4 0.9) (end -1.4 0.9) (layer F.Fab) (width 0.1)) (fp_line (start 1.4 -0.9) (end 1.4 0.9) (layer F.Fab) (width 0.1)) (fp_line (start -1.4 -0.9) (end 1.4 -0.9) (layer F.Fab) (width 0.1)) (fp_line (start -2.35 -1.15) (end 2.35 -1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start 2.35 -1.15) (end 2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start 2.35 1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start -2.35 -1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start -2.25 1) (end 1.65 1) (layer F.SilkS) (width 0.12)) (fp_line (start -2.25 -1) (end 1.65 -1) (layer F.SilkS) (width 0.12)) (fp_text user %R (at 0 -2 150) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (pad 2 smd rect (at 1.65 0 150) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask) (net 65 "Net-(D3_4-Pad2)")) (pad 1 smd rect (at -1.65 0 150) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask) (net 30 /row0,3)) (model ${KISYS3DMOD}/Diode_SMD.3dshapes/D_SOD-123.wrl (at (xyz 0 0 0)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 0)) ) ) (module Diode_SMD:D_SOD-123 (layer F.Cu) (tedit 58645DC7) (tstamp 5EDAB240) (at 90.2 83.4 165) (descr SOD-123) (tags SOD-123) (path /5EF1DB01) (attr smd) (fp_text reference D3_3 (at 0 -2 165) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value D (at 0 2.1 165) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -2.25 -1) (end -2.25 1) (layer F.SilkS) (width 0.12)) (fp_line (start 0.25 0) (end 0.75 0) (layer F.Fab) (width 0.1)) (fp_line (start 0.25 0.4) (end -0.35 0) (layer F.Fab) (width 0.1)) (fp_line (start 0.25 -0.4) (end 0.25 0.4) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end 0.25 -0.4) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end -0.35 0.55) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end -0.35 -0.55) (layer F.Fab) (width 0.1)) (fp_line (start -0.75 0) (end -0.35 0) (layer F.Fab) (width 0.1)) (fp_line (start -1.4 0.9) (end -1.4 -0.9) (layer F.Fab) (width 0.1)) (fp_line (start 1.4 0.9) (end -1.4 0.9) (layer F.Fab) (width 0.1)) (fp_line (start 1.4 -0.9) (end 1.4 0.9) (layer F.Fab) (width 0.1)) (fp_line (start -1.4 -0.9) (end 1.4 -0.9) (layer F.Fab) (width 0.1)) (fp_line (start -2.35 -1.15) (end 2.35 -1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start 2.35 -1.15) (end 2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start 2.35 1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start -2.35 -1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start -2.25 1) (end 1.65 1) (layer F.SilkS) (width 0.12)) (fp_line (start -2.25 -1) (end 1.65 -1) (layer F.SilkS) (width 0.12)) (fp_text user %R (at 0 -2 165) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (pad 2 smd rect (at 1.65 0 165) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask) (net 64 "Net-(D3_3-Pad2)")) (pad 1 smd rect (at -1.65 0 165) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask) (net 30 /row0,3)) (model ${KISYS3DMOD}/Diode_SMD.3dshapes/D_SOD-123.wrl (at (xyz 0 0 0)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 0)) ) ) (module Diode_SMD:D_SOD-123 (layer F.Cu) (tedit 58645DC7) (tstamp 5EDAA8AA) (at 99 64.25 180) (descr SOD-123) (tags SOD-123) (path /5EEFC892) (attr smd) (fp_text reference D2_4 (at 0 -2) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value D (at 0 2.1) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -2.25 -1) (end -2.25 1) (layer F.SilkS) (width 0.12)) (fp_line (start 0.25 0) (end 0.75 0) (layer F.Fab) (width 0.1)) (fp_line (start 0.25 0.4) (end -0.35 0) (layer F.Fab) (width 0.1)) (fp_line (start 0.25 -0.4) (end 0.25 0.4) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end 0.25 -0.4) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end -0.35 0.55) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end -0.35 -0.55) (layer F.Fab) (width 0.1)) (fp_line (start -0.75 0) (end -0.35 0) (layer F.Fab) (width 0.1)) (fp_line (start -1.4 0.9) (end -1.4 -0.9) (layer F.Fab) (width 0.1)) (fp_line (start 1.4 0.9) (end -1.4 0.9) (layer F.Fab) (width 0.1)) (fp_line (start 1.4 -0.9) (end 1.4 0.9) (layer F.Fab) (width 0.1)) (fp_line (start -1.4 -0.9) (end 1.4 -0.9) (layer F.Fab) (width 0.1)) (fp_line (start -2.35 -1.15) (end 2.35 -1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start 2.35 -1.15) (end 2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start 2.35 1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start -2.35 -1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start -2.25 1) (end 1.65 1) (layer F.SilkS) (width 0.12)) (fp_line (start -2.25 -1) (end 1.65 -1) (layer F.SilkS) (width 0.12)) (fp_text user %R (at 0 -2) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (pad 2 smd rect (at 1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask) (net 58 "Net-(D2_4-Pad2)")) (pad 1 smd rect (at -1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask) (net 29 /row0,2)) (model ${KISYS3DMOD}/Diode_SMD.3dshapes/D_SOD-123.wrl (at (xyz 0 0 0)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 0)) ) ) (module Diode_SMD:D_SOD-123 (layer F.Cu) (tedit 58645DC7) (tstamp 5EDAB9F0) (at 80 61.75 180) (descr SOD-123) (tags SOD-123) (path /5EEF838C) (attr smd) (fp_text reference D2_3 (at 0 -2) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value D (at 0 2.1) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -2.25 -1) (end -2.25 1) (layer F.SilkS) (width 0.12)) (fp_line (start 0.25 0) (end 0.75 0) (layer F.Fab) (width 0.1)) (fp_line (start 0.25 0.4) (end -0.35 0) (layer F.Fab) (width 0.1)) (fp_line (start 0.25 -0.4) (end 0.25 0.4) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end 0.25 -0.4) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end -0.35 0.55) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end -0.35 -0.55) (layer F.Fab) (width 0.1)) (fp_line (start -0.75 0) (end -0.35 0) (layer F.Fab) (width 0.1)) (fp_line (start -1.4 0.9) (end -1.4 -0.9) (layer F.Fab) (width 0.1)) (fp_line (start 1.4 0.9) (end -1.4 0.9) (layer F.Fab) (width 0.1)) (fp_line (start 1.4 -0.9) (end 1.4 0.9) (layer F.Fab) (width 0.1)) (fp_line (start -1.4 -0.9) (end 1.4 -0.9) (layer F.Fab) (width 0.1)) (fp_line (start -2.35 -1.15) (end 2.35 -1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start 2.35 -1.15) (end 2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start 2.35 1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start -2.35 -1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start -2.25 1) (end 1.65 1) (layer F.SilkS) (width 0.12)) (fp_line (start -2.25 -1) (end 1.65 -1) (layer F.SilkS) (width 0.12)) (fp_text user %R (at 0 -2) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (pad 2 smd rect (at 1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask) (net 57 "Net-(D2_3-Pad2)")) (pad 1 smd rect (at -1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask) (net 29 /row0,2)) (model ${KISYS3DMOD}/Diode_SMD.3dshapes/D_SOD-123.wrl (at (xyz 0 0 0)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 0)) ) ) (module Diode_SMD:D_SOD-123 (layer F.Cu) (tedit 58645DC7) (tstamp 5EDAAF37) (at 61 56.25 180) (descr SOD-123) (tags SOD-123) (path /5EEECA76) (attr smd) (fp_text reference D2_2 (at 0 -2) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value D (at 0 2.1) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -2.25 -1) (end -2.25 1) (layer F.SilkS) (width 0.12)) (fp_line (start 0.25 0) (end 0.75 0) (layer F.Fab) (width 0.1)) (fp_line (start 0.25 0.4) (end -0.35 0) (layer F.Fab) (width 0.1)) (fp_line (start 0.25 -0.4) (end 0.25 0.4) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end 0.25 -0.4) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end -0.35 0.55) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end -0.35 -0.55) (layer F.Fab) (width 0.1)) (fp_line (start -0.75 0) (end -0.35 0) (layer F.Fab) (width 0.1)) (fp_line (start -1.4 0.9) (end -1.4 -0.9) (layer F.Fab) (width 0.1)) (fp_line (start 1.4 0.9) (end -1.4 0.9) (layer F.Fab) (width 0.1)) (fp_line (start 1.4 -0.9) (end 1.4 0.9) (layer F.Fab) (width 0.1)) (fp_line (start -1.4 -0.9) (end 1.4 -0.9) (layer F.Fab) (width 0.1)) (fp_line (start -2.35 -1.15) (end 2.35 -1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start 2.35 -1.15) (end 2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start 2.35 1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start -2.35 -1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start -2.25 1) (end 1.65 1) (layer F.SilkS) (width 0.12)) (fp_line (start -2.25 -1) (end 1.65 -1) (layer F.SilkS) (width 0.12)) (fp_text user %R (at 0 -2) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (pad 2 smd rect (at 1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask) (net 56 "Net-(D2_2-Pad2)")) (pad 1 smd rect (at -1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask) (net 29 /row0,2)) (model ${KISYS3DMOD}/Diode_SMD.3dshapes/D_SOD-123.wrl (at (xyz 0 0 0)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 0)) ) ) (module Diode_SMD:D_SOD-123 (layer F.Cu) (tedit 58645DC7) (tstamp 5EDAA78A) (at 42 62.25 180) (descr SOD-123) (tags SOD-123) (path /5EEEC45B) (attr smd) (fp_text reference D2_1 (at 0 -2) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value D (at 0 2.1) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -2.25 -1) (end -2.25 1) (layer F.SilkS) (width 0.12)) (fp_line (start 0.25 0) (end 0.75 0) (layer F.Fab) (width 0.1)) (fp_line (start 0.25 0.4) (end -0.35 0) (layer F.Fab) (width 0.1)) (fp_line (start 0.25 -0.4) (end 0.25 0.4) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end 0.25 -0.4) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end -0.35 0.55) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end -0.35 -0.55) (layer F.Fab) (width 0.1)) (fp_line (start -0.75 0) (end -0.35 0) (layer F.Fab) (width 0.1)) (fp_line (start -1.4 0.9) (end -1.4 -0.9) (layer F.Fab) (width 0.1)) (fp_line (start 1.4 0.9) (end -1.4 0.9) (layer F.Fab) (width 0.1)) (fp_line (start 1.4 -0.9) (end 1.4 0.9) (layer F.Fab) (width 0.1)) (fp_line (start -1.4 -0.9) (end 1.4 -0.9) (layer F.Fab) (width 0.1)) (fp_line (start -2.35 -1.15) (end 2.35 -1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start 2.35 -1.15) (end 2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start 2.35 1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start -2.35 -1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start -2.25 1) (end 1.65 1) (layer F.SilkS) (width 0.12)) (fp_line (start -2.25 -1) (end 1.65 -1) (layer F.SilkS) (width 0.12)) (fp_text user %R (at 0 -2) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (pad 2 smd rect (at 1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask) (net 55 "Net-(D2_1-Pad2)")) (pad 1 smd rect (at -1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask) (net 29 /row0,2)) (model ${KISYS3DMOD}/Diode_SMD.3dshapes/D_SOD-123.wrl (at (xyz 0 0 0)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 0)) ) ) (module Diode_SMD:D_SOD-123 (layer F.Cu) (tedit 58645DC7) (tstamp 5EDAA904) (at 23 74.25 180) (descr SOD-123) (tags SOD-123) (path /5EED3821) (attr smd) (fp_text reference D2_0 (at 0 -2) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value D (at 0 2.1) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -2.25 -1) (end -2.25 1) (layer F.SilkS) (width 0.12)) (fp_line (start 0.25 0) (end 0.75 0) (layer F.Fab) (width 0.1)) (fp_line (start 0.25 0.4) (end -0.35 0) (layer F.Fab) (width 0.1)) (fp_line (start 0.25 -0.4) (end 0.25 0.4) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end 0.25 -0.4) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end -0.35 0.55) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end -0.35 -0.55) (layer F.Fab) (width 0.1)) (fp_line (start -0.75 0) (end -0.35 0) (layer F.Fab) (width 0.1)) (fp_line (start -1.4 0.9) (end -1.4 -0.9) (layer F.Fab) (width 0.1)) (fp_line (start 1.4 0.9) (end -1.4 0.9) (layer F.Fab) (width 0.1)) (fp_line (start 1.4 -0.9) (end 1.4 0.9) (layer F.Fab) (width 0.1)) (fp_line (start -1.4 -0.9) (end 1.4 -0.9) (layer F.Fab) (width 0.1)) (fp_line (start -2.35 -1.15) (end 2.35 -1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start 2.35 -1.15) (end 2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start 2.35 1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start -2.35 -1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start -2.25 1) (end 1.65 1) (layer F.SilkS) (width 0.12)) (fp_line (start -2.25 -1) (end 1.65 -1) (layer F.SilkS) (width 0.12)) (fp_text user %R (at 0 -2) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (pad 2 smd rect (at 1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask) (net 54 "Net-(D2_0-Pad2)")) (pad 1 smd rect (at -1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask) (net 29 /row0,2)) (model ${KISYS3DMOD}/Diode_SMD.3dshapes/D_SOD-123.wrl (at (xyz 0 0 0)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 0)) ) ) (module Diode_SMD:D_SOD-123 (layer F.Cu) (tedit 58645DC7) (tstamp 5EDAB609) (at 99 45.25 180) (descr SOD-123) (tags SOD-123) (path /5EEFB5C1) (attr smd) (fp_text reference D1_4 (at 0 -2) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value D (at 0 2.1) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -2.25 -1) (end -2.25 1) (layer F.SilkS) (width 0.12)) (fp_line (start 0.25 0) (end 0.75 0) (layer F.Fab) (width 0.1)) (fp_line (start 0.25 0.4) (end -0.35 0) (layer F.Fab) (width 0.1)) (fp_line (start 0.25 -0.4) (end 0.25 0.4) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end 0.25 -0.4) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end -0.35 0.55) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end -0.35 -0.55) (layer F.Fab) (width 0.1)) (fp_line (start -0.75 0) (end -0.35 0) (layer F.Fab) (width 0.1)) (fp_line (start -1.4 0.9) (end -1.4 -0.9) (layer F.Fab) (width 0.1)) (fp_line (start 1.4 0.9) (end -1.4 0.9) (layer F.Fab) (width 0.1)) (fp_line (start 1.4 -0.9) (end 1.4 0.9) (layer F.Fab) (width 0.1)) (fp_line (start -1.4 -0.9) (end 1.4 -0.9) (layer F.Fab) (width 0.1)) (fp_line (start -2.35 -1.15) (end 2.35 -1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start 2.35 -1.15) (end 2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start 2.35 1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start -2.35 -1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start -2.25 1) (end 1.65 1) (layer F.SilkS) (width 0.12)) (fp_line (start -2.25 -1) (end 1.65 -1) (layer F.SilkS) (width 0.12)) (fp_text user %R (at 0 -2) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (pad 2 smd rect (at 1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask) (net 48 "Net-(D1_4-Pad2)")) (pad 1 smd rect (at -1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask) (net 28 /row0,1)) (model ${KISYS3DMOD}/Diode_SMD.3dshapes/D_SOD-123.wrl (at (xyz 0 0 0)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 0)) ) ) (module Diode_SMD:D_SOD-123 (layer F.Cu) (tedit 58645DC7) (tstamp 5EDAB288) (at 80 42.75 180) (descr SOD-123) (tags SOD-123) (path /5EEF7F2D) (attr smd) (fp_text reference D1_3 (at 0 -2) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value D (at 0 2.1) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -2.25 -1) (end -2.25 1) (layer F.SilkS) (width 0.12)) (fp_line (start 0.25 0) (end 0.75 0) (layer F.Fab) (width 0.1)) (fp_line (start 0.25 0.4) (end -0.35 0) (layer F.Fab) (width 0.1)) (fp_line (start 0.25 -0.4) (end 0.25 0.4) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end 0.25 -0.4) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end -0.35 0.55) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end -0.35 -0.55) (layer F.Fab) (width 0.1)) (fp_line (start -0.75 0) (end -0.35 0) (layer F.Fab) (width 0.1)) (fp_line (start -1.4 0.9) (end -1.4 -0.9) (layer F.Fab) (width 0.1)) (fp_line (start 1.4 0.9) (end -1.4 0.9) (layer F.Fab) (width 0.1)) (fp_line (start 1.4 -0.9) (end 1.4 0.9) (layer F.Fab) (width 0.1)) (fp_line (start -1.4 -0.9) (end 1.4 -0.9) (layer F.Fab) (width 0.1)) (fp_line (start -2.35 -1.15) (end 2.35 -1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start 2.35 -1.15) (end 2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start 2.35 1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start -2.35 -1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start -2.25 1) (end 1.65 1) (layer F.SilkS) (width 0.12)) (fp_line (start -2.25 -1) (end 1.65 -1) (layer F.SilkS) (width 0.12)) (fp_text user %R (at 0 -2) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (pad 2 smd rect (at 1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask) (net 47 "Net-(D1_3-Pad2)")) (pad 1 smd rect (at -1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask) (net 28 /row0,1)) (model ${KISYS3DMOD}/Diode_SMD.3dshapes/D_SOD-123.wrl (at (xyz 0 0 0)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 0)) ) ) (module Diode_SMD:D_SOD-123 (layer F.Cu) (tedit 58645DC7) (tstamp 5EDAB2D0) (at 61 37.25 180) (descr SOD-123) (tags SOD-123) (path /5EED29B3) (attr smd) (fp_text reference D1_2 (at 0 -2) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value D (at 0 2.1) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -2.25 -1) (end -2.25 1) (layer F.SilkS) (width 0.12)) (fp_line (start 0.25 0) (end 0.75 0) (layer F.Fab) (width 0.1)) (fp_line (start 0.25 0.4) (end -0.35 0) (layer F.Fab) (width 0.1)) (fp_line (start 0.25 -0.4) (end 0.25 0.4) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end 0.25 -0.4) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end -0.35 0.55) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end -0.35 -0.55) (layer F.Fab) (width 0.1)) (fp_line (start -0.75 0) (end -0.35 0) (layer F.Fab) (width 0.1)) (fp_line (start -1.4 0.9) (end -1.4 -0.9) (layer F.Fab) (width 0.1)) (fp_line (start 1.4 0.9) (end -1.4 0.9) (layer F.Fab) (width 0.1)) (fp_line (start 1.4 -0.9) (end 1.4 0.9) (layer F.Fab) (width 0.1)) (fp_line (start -1.4 -0.9) (end 1.4 -0.9) (layer F.Fab) (width 0.1)) (fp_line (start -2.35 -1.15) (end 2.35 -1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start 2.35 -1.15) (end 2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start 2.35 1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start -2.35 -1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start -2.25 1) (end 1.65 1) (layer F.SilkS) (width 0.12)) (fp_line (start -2.25 -1) (end 1.65 -1) (layer F.SilkS) (width 0.12)) (fp_text user %R (at 0 -2) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (pad 2 smd rect (at 1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask) (net 46 "Net-(D1_2-Pad2)")) (pad 1 smd rect (at -1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask) (net 28 /row0,1)) (model ${KISYS3DMOD}/Diode_SMD.3dshapes/D_SOD-123.wrl (at (xyz 0 0 0)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 0)) ) ) (module Diode_SMD:D_SOD-123 (layer F.Cu) (tedit 58645DC7) (tstamp 5EDAACB5) (at 42 43.25 180) (descr SOD-123) (tags SOD-123) (path /5EE478DC) (attr smd) (fp_text reference D1_1 (at 0 -2) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value D (at 0 2.1) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -2.25 -1) (end -2.25 1) (layer F.SilkS) (width 0.12)) (fp_line (start 0.25 0) (end 0.75 0) (layer F.Fab) (width 0.1)) (fp_line (start 0.25 0.4) (end -0.35 0) (layer F.Fab) (width 0.1)) (fp_line (start 0.25 -0.4) (end 0.25 0.4) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end 0.25 -0.4) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end -0.35 0.55) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end -0.35 -0.55) (layer F.Fab) (width 0.1)) (fp_line (start -0.75 0) (end -0.35 0) (layer F.Fab) (width 0.1)) (fp_line (start -1.4 0.9) (end -1.4 -0.9) (layer F.Fab) (width 0.1)) (fp_line (start 1.4 0.9) (end -1.4 0.9) (layer F.Fab) (width 0.1)) (fp_line (start 1.4 -0.9) (end 1.4 0.9) (layer F.Fab) (width 0.1)) (fp_line (start -1.4 -0.9) (end 1.4 -0.9) (layer F.Fab) (width 0.1)) (fp_line (start -2.35 -1.15) (end 2.35 -1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start 2.35 -1.15) (end 2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start 2.35 1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start -2.35 -1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start -2.25 1) (end 1.65 1) (layer F.SilkS) (width 0.12)) (fp_line (start -2.25 -1) (end 1.65 -1) (layer F.SilkS) (width 0.12)) (fp_text user %R (at 0 -2) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (pad 2 smd rect (at 1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask) (net 45 "Net-(D1_1-Pad2)")) (pad 1 smd rect (at -1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask) (net 28 /row0,1)) (model ${KISYS3DMOD}/Diode_SMD.3dshapes/D_SOD-123.wrl (at (xyz 0 0 0)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 0)) ) ) (module Diode_SMD:D_SOD-123 (layer F.Cu) (tedit 58645DC7) (tstamp 5EDAA85C) (at 23 55.25 180) (descr SOD-123) (tags SOD-123) (path /5EE22835) (attr smd) (fp_text reference D1_0 (at 0 -2) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value D (at 0 2.1) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -2.25 -1) (end -2.25 1) (layer F.SilkS) (width 0.12)) (fp_line (start 0.25 0) (end 0.75 0) (layer F.Fab) (width 0.1)) (fp_line (start 0.25 0.4) (end -0.35 0) (layer F.Fab) (width 0.1)) (fp_line (start 0.25 -0.4) (end 0.25 0.4) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end 0.25 -0.4) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end -0.35 0.55) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end -0.35 -0.55) (layer F.Fab) (width 0.1)) (fp_line (start -0.75 0) (end -0.35 0) (layer F.Fab) (width 0.1)) (fp_line (start -1.4 0.9) (end -1.4 -0.9) (layer F.Fab) (width 0.1)) (fp_line (start 1.4 0.9) (end -1.4 0.9) (layer F.Fab) (width 0.1)) (fp_line (start 1.4 -0.9) (end 1.4 0.9) (layer F.Fab) (width 0.1)) (fp_line (start -1.4 -0.9) (end 1.4 -0.9) (layer F.Fab) (width 0.1)) (fp_line (start -2.35 -1.15) (end 2.35 -1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start 2.35 -1.15) (end 2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start 2.35 1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start -2.35 -1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start -2.25 1) (end 1.65 1) (layer F.SilkS) (width 0.12)) (fp_line (start -2.25 -1) (end 1.65 -1) (layer F.SilkS) (width 0.12)) (fp_text user %R (at 0 -2) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (pad 2 smd rect (at 1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask) (net 44 "Net-(D1_0-Pad2)")) (pad 1 smd rect (at -1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask) (net 28 /row0,1)) (model ${KISYS3DMOD}/Diode_SMD.3dshapes/D_SOD-123.wrl (at (xyz 0 0 0)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 0)) ) ) (module Diode_SMD:D_SOD-123 (layer F.Cu) (tedit 58645DC7) (tstamp 5EDAB657) (at 99 26.25 180) (descr SOD-123) (tags SOD-123) (path /5EEFA013) (attr smd) (fp_text reference D0_4 (at 0 -2) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value D (at 0 2.1) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -2.25 -1) (end -2.25 1) (layer F.SilkS) (width 0.12)) (fp_line (start 0.25 0) (end 0.75 0) (layer F.Fab) (width 0.1)) (fp_line (start 0.25 0.4) (end -0.35 0) (layer F.Fab) (width 0.1)) (fp_line (start 0.25 -0.4) (end 0.25 0.4) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end 0.25 -0.4) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end -0.35 0.55) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end -0.35 -0.55) (layer F.Fab) (width 0.1)) (fp_line (start -0.75 0) (end -0.35 0) (layer F.Fab) (width 0.1)) (fp_line (start -1.4 0.9) (end -1.4 -0.9) (layer F.Fab) (width 0.1)) (fp_line (start 1.4 0.9) (end -1.4 0.9) (layer F.Fab) (width 0.1)) (fp_line (start 1.4 -0.9) (end 1.4 0.9) (layer F.Fab) (width 0.1)) (fp_line (start -1.4 -0.9) (end 1.4 -0.9) (layer F.Fab) (width 0.1)) (fp_line (start -2.35 -1.15) (end 2.35 -1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start 2.35 -1.15) (end 2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start 2.35 1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start -2.35 -1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start -2.25 1) (end 1.65 1) (layer F.SilkS) (width 0.12)) (fp_line (start -2.25 -1) (end 1.65 -1) (layer F.SilkS) (width 0.12)) (fp_text user %R (at 0 -2) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (pad 2 smd rect (at 1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask) (net 68 "Net-(D0_4-Pad2)")) (pad 1 smd rect (at -1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask) (net 25 /row0,0)) (model ${KISYS3DMOD}/Diode_SMD.3dshapes/D_SOD-123.wrl (at (xyz 0 0 0)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 0)) ) ) (module Diode_SMD:D_SOD-123 (layer F.Cu) (tedit 58645DC7) (tstamp 5EDAADF6) (at 80 23.75 180) (descr SOD-123) (tags SOD-123) (path /5EEF7A7A) (attr smd) (fp_text reference D0_3 (at 0 -2) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value D (at 0 2.1) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -2.25 -1) (end -2.25 1) (layer F.SilkS) (width 0.12)) (fp_line (start 0.25 0) (end 0.75 0) (layer F.Fab) (width 0.1)) (fp_line (start 0.25 0.4) (end -0.35 0) (layer F.Fab) (width 0.1)) (fp_line (start 0.25 -0.4) (end 0.25 0.4) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end 0.25 -0.4) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end -0.35 0.55) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end -0.35 -0.55) (layer F.Fab) (width 0.1)) (fp_line (start -0.75 0) (end -0.35 0) (layer F.Fab) (width 0.1)) (fp_line (start -1.4 0.9) (end -1.4 -0.9) (layer F.Fab) (width 0.1)) (fp_line (start 1.4 0.9) (end -1.4 0.9) (layer F.Fab) (width 0.1)) (fp_line (start 1.4 -0.9) (end 1.4 0.9) (layer F.Fab) (width 0.1)) (fp_line (start -1.4 -0.9) (end 1.4 -0.9) (layer F.Fab) (width 0.1)) (fp_line (start -2.35 -1.15) (end 2.35 -1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start 2.35 -1.15) (end 2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start 2.35 1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start -2.35 -1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start -2.25 1) (end 1.65 1) (layer F.SilkS) (width 0.12)) (fp_line (start -2.25 -1) (end 1.65 -1) (layer F.SilkS) (width 0.12)) (fp_text user %R (at 0 -2) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (pad 2 smd rect (at 1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask) (net 38 "Net-(D0_3-Pad2)")) (pad 1 smd rect (at -1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask) (net 25 /row0,0)) (model ${KISYS3DMOD}/Diode_SMD.3dshapes/D_SOD-123.wrl (at (xyz 0 0 0)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 0)) ) ) (module Diode_SMD:D_SOD-123 (layer F.Cu) (tedit 58645DC7) (tstamp 5EDAA9F7) (at 61 18.25 180) (descr SOD-123) (tags SOD-123) (path /5EE8DCFE) (attr smd) (fp_text reference D0_2 (at 0 -2) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value D (at 0 2.1) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -2.25 -1) (end -2.25 1) (layer F.SilkS) (width 0.12)) (fp_line (start 0.25 0) (end 0.75 0) (layer F.Fab) (width 0.1)) (fp_line (start 0.25 0.4) (end -0.35 0) (layer F.Fab) (width 0.1)) (fp_line (start 0.25 -0.4) (end 0.25 0.4) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end 0.25 -0.4) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end -0.35 0.55) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end -0.35 -0.55) (layer F.Fab) (width 0.1)) (fp_line (start -0.75 0) (end -0.35 0) (layer F.Fab) (width 0.1)) (fp_line (start -1.4 0.9) (end -1.4 -0.9) (layer F.Fab) (width 0.1)) (fp_line (start 1.4 0.9) (end -1.4 0.9) (layer F.Fab) (width 0.1)) (fp_line (start 1.4 -0.9) (end 1.4 0.9) (layer F.Fab) (width 0.1)) (fp_line (start -1.4 -0.9) (end 1.4 -0.9) (layer F.Fab) (width 0.1)) (fp_line (start -2.35 -1.15) (end 2.35 -1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start 2.35 -1.15) (end 2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start 2.35 1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start -2.35 -1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start -2.25 1) (end 1.65 1) (layer F.SilkS) (width 0.12)) (fp_line (start -2.25 -1) (end 1.65 -1) (layer F.SilkS) (width 0.12)) (fp_text user %R (at 0 -2) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (pad 2 smd rect (at 1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask) (net 37 "Net-(D0_2-Pad2)")) (pad 1 smd rect (at -1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask) (net 25 /row0,0)) (model ${KISYS3DMOD}/Diode_SMD.3dshapes/D_SOD-123.wrl (at (xyz 0 0 0)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 0)) ) ) (module Diode_SMD:D_SOD-123 (layer F.Cu) (tedit 58645DC7) (tstamp 5EDAB6AE) (at 42 24.25 180) (descr SOD-123) (tags SOD-123) (path /5EE44032) (attr smd) (fp_text reference D0_1 (at 0 -2) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value D (at 0 2.1) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -2.25 -1) (end -2.25 1) (layer F.SilkS) (width 0.12)) (fp_line (start 0.25 0) (end 0.75 0) (layer F.Fab) (width 0.1)) (fp_line (start 0.25 0.4) (end -0.35 0) (layer F.Fab) (width 0.1)) (fp_line (start 0.25 -0.4) (end 0.25 0.4) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end 0.25 -0.4) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end -0.35 0.55) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end -0.35 -0.55) (layer F.Fab) (width 0.1)) (fp_line (start -0.75 0) (end -0.35 0) (layer F.Fab) (width 0.1)) (fp_line (start -1.4 0.9) (end -1.4 -0.9) (layer F.Fab) (width 0.1)) (fp_line (start 1.4 0.9) (end -1.4 0.9) (layer F.Fab) (width 0.1)) (fp_line (start 1.4 -0.9) (end 1.4 0.9) (layer F.Fab) (width 0.1)) (fp_line (start -1.4 -0.9) (end 1.4 -0.9) (layer F.Fab) (width 0.1)) (fp_line (start -2.35 -1.15) (end 2.35 -1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start 2.35 -1.15) (end 2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start 2.35 1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start -2.35 -1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start -2.25 1) (end 1.65 1) (layer F.SilkS) (width 0.12)) (fp_line (start -2.25 -1) (end 1.65 -1) (layer F.SilkS) (width 0.12)) (fp_text user %R (at 0 -2) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (pad 2 smd rect (at 1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask) (net 36 "Net-(D0_1-Pad2)")) (pad 1 smd rect (at -1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask) (net 25 /row0,0)) (model ${KISYS3DMOD}/Diode_SMD.3dshapes/D_SOD-123.wrl (at (xyz 0 0 0)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 0)) ) ) (module Diode_SMD:D_SOD-123 (layer F.Cu) (tedit 58645DC7) (tstamp 5EDAB426) (at 23 36.25 180) (descr SOD-123) (tags SOD-123) (path /5EE1B34F) (attr smd) (fp_text reference D0_0 (at 0 -2) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value D (at 0 2.1) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start -2.25 -1) (end -2.25 1) (layer F.SilkS) (width 0.12)) (fp_line (start 0.25 0) (end 0.75 0) (layer F.Fab) (width 0.1)) (fp_line (start 0.25 0.4) (end -0.35 0) (layer F.Fab) (width 0.1)) (fp_line (start 0.25 -0.4) (end 0.25 0.4) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end 0.25 -0.4) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end -0.35 0.55) (layer F.Fab) (width 0.1)) (fp_line (start -0.35 0) (end -0.35 -0.55) (layer F.Fab) (width 0.1)) (fp_line (start -0.75 0) (end -0.35 0) (layer F.Fab) (width 0.1)) (fp_line (start -1.4 0.9) (end -1.4 -0.9) (layer F.Fab) (width 0.1)) (fp_line (start 1.4 0.9) (end -1.4 0.9) (layer F.Fab) (width 0.1)) (fp_line (start 1.4 -0.9) (end 1.4 0.9) (layer F.Fab) (width 0.1)) (fp_line (start -1.4 -0.9) (end 1.4 -0.9) (layer F.Fab) (width 0.1)) (fp_line (start -2.35 -1.15) (end 2.35 -1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start 2.35 -1.15) (end 2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start 2.35 1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start -2.35 -1.15) (end -2.35 1.15) (layer F.CrtYd) (width 0.05)) (fp_line (start -2.25 1) (end 1.65 1) (layer F.SilkS) (width 0.12)) (fp_line (start -2.25 -1) (end 1.65 -1) (layer F.SilkS) (width 0.12)) (fp_text user %R (at 0 -2) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (pad 2 smd rect (at 1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask) (net 35 "Net-(D0_0-Pad2)")) (pad 1 smd rect (at -1.65 0 180) (size 0.9 1.2) (layers F.Cu F.Paste F.Mask) (net 25 /row0,0)) (model ${KISYS3DMOD}/Diode_SMD.3dshapes/D_SOD-123.wrl (at (xyz 0 0 0)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 0)) ) ) (module Capacitor_SMD:C_0805_2012Metric_Pad1.15x1.40mm_HandSolder (layer F.Cu) (tedit 5B36C52B) (tstamp 5EE00D05) (at 54.5 89.39 180) (descr "Capacitor SMD 0805 (2012 Metric), square (rectangular) end terminal, IPC_7351 nominal with elongated pad for handsoldering. (Body size source: https://docs.google.com/spreadsheets/d/1BsfQQcO9C6DZCsRaXUlFlo91Tg2WpOkGARC1WS5S8t0/edit?usp=sharing), generated with kicad-footprint-generator") (tags "capacitor handsolder") (path /5ECE0CD2) (attr smd) (fp_text reference C3 (at 0 -1.65) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value 0.1u (at 0 1.65) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start 1.85 0.95) (end -1.85 0.95) (layer F.CrtYd) (width 0.05)) (fp_line (start 1.85 -0.95) (end 1.85 0.95) (layer F.CrtYd) (width 0.05)) (fp_line (start -1.85 -0.95) (end 1.85 -0.95) (layer F.CrtYd) (width 0.05)) (fp_line (start -1.85 0.95) (end -1.85 -0.95) (layer F.CrtYd) (width 0.05)) (fp_line (start -0.261252 0.71) (end 0.261252 0.71) (layer F.SilkS) (width 0.12)) (fp_line (start -0.261252 -0.71) (end 0.261252 -0.71) (layer F.SilkS) (width 0.12)) (fp_line (start 1 0.6) (end -1 0.6) (layer F.Fab) (width 0.1)) (fp_line (start 1 -0.6) (end 1 0.6) (layer F.Fab) (width 0.1)) (fp_line (start -1 -0.6) (end 1 -0.6) (layer F.Fab) (width 0.1)) (fp_line (start -1 0.6) (end -1 -0.6) (layer F.Fab) (width 0.1)) (fp_text user %V (at 0 0) (layer F.Fab) (effects (font (size 0.4 0.4) (thickness 0.08))) ) (pad 2 smd roundrect (at 1.025 0 180) (size 1.15 1.4) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.217391) (net 73 GND)) (pad 1 smd roundrect (at -1.025 0 180) (size 1.15 1.4) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.217391) (net 1 +5V)) (model ${KISYS3DMOD}/Capacitor_SMD.3dshapes/C_0805_2012Metric.wrl (at (xyz 0 0 0)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 0)) ) ) (module Resistor_SMD:R_0805_2012Metric_Pad1.15x1.40mm_HandSolder (layer F.Cu) (tedit 5B36C52B) (tstamp 5EE08281) (at 120.4 75 270) (descr "Resistor SMD 0805 (2012 Metric), square (rectangular) end terminal, IPC_7351 nominal with elongated pad for handsoldering. (Body size source: https://docs.google.com/spreadsheets/d/1BsfQQcO9C6DZCsRaXUlFlo91Tg2WpOkGARC1WS5S8t0/edit?usp=sharing), generated with kicad-footprint-generator") (tags "resistor handsolder") (path /602A653D) (attr smd) (fp_text reference R8 (at 0 -1.65 90) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value 4.7k (at 0 1.65 90) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start 1.85 0.95) (end -1.85 0.95) (layer F.CrtYd) (width 0.05)) (fp_line (start 1.85 -0.95) (end 1.85 0.95) (layer F.CrtYd) (width 0.05)) (fp_line (start -1.85 -0.95) (end 1.85 -0.95) (layer F.CrtYd) (width 0.05)) (fp_line (start -1.85 0.95) (end -1.85 -0.95) (layer F.CrtYd) (width 0.05)) (fp_line (start -0.261252 0.71) (end 0.261252 0.71) (layer F.SilkS) (width 0.12)) (fp_line (start -0.261252 -0.71) (end 0.261252 -0.71) (layer F.SilkS) (width 0.12)) (fp_line (start 1 0.6) (end -1 0.6) (layer F.Fab) (width 0.1)) (fp_line (start 1 -0.6) (end 1 0.6) (layer F.Fab) (width 0.1)) (fp_line (start -1 -0.6) (end 1 -0.6) (layer F.Fab) (width 0.1)) (fp_line (start -1 0.6) (end -1 -0.6) (layer F.Fab) (width 0.1)) (fp_text user %V (at 0 0 90) (layer F.Fab) (effects (font (size 0.4 0.4) (thickness 0.08))) ) (pad 2 smd roundrect (at 1.025 0 270) (size 1.15 1.4) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.217391) (net 10 "Net-(Jack0-PadR1)")) (pad 1 smd roundrect (at -1.025 0 270) (size 1.15 1.4) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.217391) (net 1 +5V)) (model ${KISYS3DMOD}/Resistor_SMD.3dshapes/R_0805_2012Metric.wrl (at (xyz 0 0 0)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 0)) ) ) (module Resistor_SMD:R_0805_2012Metric_Pad1.15x1.40mm_HandSolder (layer F.Cu) (tedit 5B36C52B) (tstamp 5EDAB89F) (at 117.97 75 90) (descr "Resistor SMD 0805 (2012 Metric), square (rectangular) end terminal, IPC_7351 nominal with elongated pad for handsoldering. (Body size source: https://docs.google.com/spreadsheets/d/1BsfQQcO9C6DZCsRaXUlFlo91Tg2WpOkGARC1WS5S8t0/edit?usp=sharing), generated with kicad-footprint-generator") (tags "resistor handsolder") (path /60281202) (attr smd) (fp_text reference R7 (at 0 -1.65 90) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value 4.7k (at 0 1.65 90) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start 1.85 0.95) (end -1.85 0.95) (layer F.CrtYd) (width 0.05)) (fp_line (start 1.85 -0.95) (end 1.85 0.95) (layer F.CrtYd) (width 0.05)) (fp_line (start -1.85 -0.95) (end 1.85 -0.95) (layer F.CrtYd) (width 0.05)) (fp_line (start -1.85 0.95) (end -1.85 -0.95) (layer F.CrtYd) (width 0.05)) (fp_line (start -0.261252 0.71) (end 0.261252 0.71) (layer F.SilkS) (width 0.12)) (fp_line (start -0.261252 -0.71) (end 0.261252 -0.71) (layer F.SilkS) (width 0.12)) (fp_line (start 1 0.6) (end -1 0.6) (layer F.Fab) (width 0.1)) (fp_line (start 1 -0.6) (end 1 0.6) (layer F.Fab) (width 0.1)) (fp_line (start -1 -0.6) (end 1 -0.6) (layer F.Fab) (width 0.1)) (fp_line (start -1 0.6) (end -1 -0.6) (layer F.Fab) (width 0.1)) (fp_text user %V (at 0 0 90) (layer F.Fab) (effects (font (size 0.4 0.4) (thickness 0.08))) ) (pad 2 smd roundrect (at 1.025 0 90) (size 1.15 1.4) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.217391) (net 1 +5V)) (pad 1 smd roundrect (at -1.025 0 90) (size 1.15 1.4) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.217391) (net 11 "Net-(Jack0-PadT)")) (model ${KISYS3DMOD}/Resistor_SMD.3dshapes/R_0805_2012Metric.wrl (at (xyz 0 0 0)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 0)) ) ) (module Resistor_SMD:R_0805_2012Metric_Pad1.15x1.40mm_HandSolder (layer F.Cu) (tedit 5B36C52B) (tstamp 5EDAB3E3) (at 114 68) (descr "Resistor SMD 0805 (2012 Metric), square (rectangular) end terminal, IPC_7351 nominal with elongated pad for handsoldering. (Body size source: https://docs.google.com/spreadsheets/d/1BsfQQcO9C6DZCsRaXUlFlo91Tg2WpOkGARC1WS5S8t0/edit?usp=sharing), generated with kicad-footprint-generator") (tags "resistor handsolder") (path /5ED69FD6) (attr smd) (fp_text reference R6 (at 0 -1.65) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value 5.1K (at 0 1.65) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start 1.85 0.95) (end -1.85 0.95) (layer F.CrtYd) (width 0.05)) (fp_line (start 1.85 -0.95) (end 1.85 0.95) (layer F.CrtYd) (width 0.05)) (fp_line (start -1.85 -0.95) (end 1.85 -0.95) (layer F.CrtYd) (width 0.05)) (fp_line (start -1.85 0.95) (end -1.85 -0.95) (layer F.CrtYd) (width 0.05)) (fp_line (start -0.261252 0.71) (end 0.261252 0.71) (layer F.SilkS) (width 0.12)) (fp_line (start -0.261252 -0.71) (end 0.261252 -0.71) (layer F.SilkS) (width 0.12)) (fp_line (start 1 0.6) (end -1 0.6) (layer F.Fab) (width 0.1)) (fp_line (start 1 -0.6) (end 1 0.6) (layer F.Fab) (width 0.1)) (fp_line (start -1 -0.6) (end 1 -0.6) (layer F.Fab) (width 0.1)) (fp_line (start -1 0.6) (end -1 -0.6) (layer F.Fab) (width 0.1)) (fp_text user %V (at 0 0) (layer F.Fab) (effects (font (size 0.4 0.4) (thickness 0.08))) ) (pad 2 smd roundrect (at 1.025 0) (size 1.15 1.4) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.217391) (net 9 "Net-(J1-PadB5)")) (pad 1 smd roundrect (at -1.025 0) (size 1.15 1.4) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.217391) (net 73 GND)) (model ${KISYS3DMOD}/Resistor_SMD.3dshapes/R_0805_2012Metric.wrl (at (xyz 0 0 0)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 0)) ) ) (module Resistor_SMD:R_0805_2012Metric_Pad1.15x1.40mm_HandSolder (layer F.Cu) (tedit 5B36C52B) (tstamp 5EDAA741) (at 119.5 68 180) (descr "Resistor SMD 0805 (2012 Metric), square (rectangular) end terminal, IPC_7351 nominal with elongated pad for handsoldering. (Body size source: https://docs.google.com/spreadsheets/d/1BsfQQcO9C6DZCsRaXUlFlo91Tg2WpOkGARC1WS5S8t0/edit?usp=sharing), generated with kicad-footprint-generator") (tags "resistor handsolder") (path /5ED68FE1) (attr smd) (fp_text reference R5 (at 0 -1.65) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value 5.1K (at 0 1.65) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start 1.85 0.95) (end -1.85 0.95) (layer F.CrtYd) (width 0.05)) (fp_line (start 1.85 -0.95) (end 1.85 0.95) (layer F.CrtYd) (width 0.05)) (fp_line (start -1.85 -0.95) (end 1.85 -0.95) (layer F.CrtYd) (width 0.05)) (fp_line (start -1.85 0.95) (end -1.85 -0.95) (layer F.CrtYd) (width 0.05)) (fp_line (start -0.261252 0.71) (end 0.261252 0.71) (layer F.SilkS) (width 0.12)) (fp_line (start -0.261252 -0.71) (end 0.261252 -0.71) (layer F.SilkS) (width 0.12)) (fp_line (start 1 0.6) (end -1 0.6) (layer F.Fab) (width 0.1)) (fp_line (start 1 -0.6) (end 1 0.6) (layer F.Fab) (width 0.1)) (fp_line (start -1 -0.6) (end 1 -0.6) (layer F.Fab) (width 0.1)) (fp_line (start -1 0.6) (end -1 -0.6) (layer F.Fab) (width 0.1)) (fp_text user %V (at 0 0) (layer F.Fab) (effects (font (size 0.4 0.4) (thickness 0.08))) ) (pad 2 smd roundrect (at 1.025 0 180) (size 1.15 1.4) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.217391) (net 6 "Net-(J1-PadA5)")) (pad 1 smd roundrect (at -1.025 0 180) (size 1.15 1.4) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.217391) (net 73 GND)) (model ${KISYS3DMOD}/Resistor_SMD.3dshapes/R_0805_2012Metric.wrl (at (xyz 0 0 0)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 0)) ) ) (module Resistor_SMD:R_0805_2012Metric_Pad1.15x1.40mm_HandSolder (layer F.Cu) (tedit 5B36C52B) (tstamp 5EE0469C) (at 113.1 75 90) (descr "Resistor SMD 0805 (2012 Metric), square (rectangular) end terminal, IPC_7351 nominal with elongated pad for handsoldering. (Body size source: https://docs.google.com/spreadsheets/d/1BsfQQcO9C6DZCsRaXUlFlo91Tg2WpOkGARC1WS5S8t0/edit?usp=sharing), generated with kicad-footprint-generator") (tags "resistor handsolder") (path /5ED4D4BF) (attr smd) (fp_text reference R4 (at 0 -1.65 90) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value 22 (at 0 1.65 90) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start 1.85 0.95) (end -1.85 0.95) (layer F.CrtYd) (width 0.05)) (fp_line (start 1.85 -0.95) (end 1.85 0.95) (layer F.CrtYd) (width 0.05)) (fp_line (start -1.85 -0.95) (end 1.85 -0.95) (layer F.CrtYd) (width 0.05)) (fp_line (start -1.85 0.95) (end -1.85 -0.95) (layer F.CrtYd) (width 0.05)) (fp_line (start -0.261252 0.71) (end 0.261252 0.71) (layer F.SilkS) (width 0.12)) (fp_line (start -0.261252 -0.71) (end 0.261252 -0.71) (layer F.SilkS) (width 0.12)) (fp_line (start 1 0.6) (end -1 0.6) (layer F.Fab) (width 0.1)) (fp_line (start 1 -0.6) (end 1 0.6) (layer F.Fab) (width 0.1)) (fp_line (start -1 -0.6) (end 1 -0.6) (layer F.Fab) (width 0.1)) (fp_line (start -1 0.6) (end -1 -0.6) (layer F.Fab) (width 0.1)) (fp_text user %V (at 0 0 270) (layer F.Fab) (effects (font (size 0.4 0.4) (thickness 0.08))) ) (pad 2 smd roundrect (at 1.025 0 90) (size 1.15 1.4) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.217391) (net 8 "Net-(J1-PadA6)")) (pad 1 smd roundrect (at -1.025 0 90) (size 1.15 1.4) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.217391) (net 71 /D+)) (model ${KISYS3DMOD}/Resistor_SMD.3dshapes/R_0805_2012Metric.wrl (at (xyz 0 0 0)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 0)) ) ) (module Resistor_SMD:R_0805_2012Metric_Pad1.15x1.40mm_HandSolder (layer F.Cu) (tedit 5B36C52B) (tstamp 5EE04545) (at 115.53 75 90) (descr "Resistor SMD 0805 (2012 Metric), square (rectangular) end terminal, IPC_7351 nominal with elongated pad for handsoldering. (Body size source: https://docs.google.com/spreadsheets/d/1BsfQQcO9C6DZCsRaXUlFlo91Tg2WpOkGARC1WS5S8t0/edit?usp=sharing), generated with kicad-footprint-generator") (tags "resistor handsolder") (path /5ED46B5F) (attr smd) (fp_text reference R3 (at 0 -1.65 90) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value 22 (at 0 1.65 90) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start 1.85 0.95) (end -1.85 0.95) (layer F.CrtYd) (width 0.05)) (fp_line (start 1.85 -0.95) (end 1.85 0.95) (layer F.CrtYd) (width 0.05)) (fp_line (start -1.85 -0.95) (end 1.85 -0.95) (layer F.CrtYd) (width 0.05)) (fp_line (start -1.85 0.95) (end -1.85 -0.95) (layer F.CrtYd) (width 0.05)) (fp_line (start -0.261252 0.71) (end 0.261252 0.71) (layer F.SilkS) (width 0.12)) (fp_line (start -0.261252 -0.71) (end 0.261252 -0.71) (layer F.SilkS) (width 0.12)) (fp_line (start 1 0.6) (end -1 0.6) (layer F.Fab) (width 0.1)) (fp_line (start 1 -0.6) (end 1 0.6) (layer F.Fab) (width 0.1)) (fp_line (start -1 -0.6) (end 1 -0.6) (layer F.Fab) (width 0.1)) (fp_line (start -1 0.6) (end -1 -0.6) (layer F.Fab) (width 0.1)) (fp_text user %V (at 0 0 90) (layer F.Fab) (effects (font (size 0.4 0.4) (thickness 0.08))) ) (pad 2 smd roundrect (at 1.025 0 90) (size 1.15 1.4) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.217391) (net 7 "Net-(J1-PadA7)")) (pad 1 smd roundrect (at -1.025 0 90) (size 1.15 1.4) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.217391) (net 70 /D-)) (model ${KISYS3DMOD}/Resistor_SMD.3dshapes/R_0805_2012Metric.wrl (at (xyz 0 0 0)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 0)) ) ) (module Resistor_SMD:R_0805_2012Metric_Pad1.15x1.40mm_HandSolder (layer F.Cu) (tedit 5B36C52B) (tstamp 5EDD3D39) (at 74 89.8 180) (descr "Resistor SMD 0805 (2012 Metric), square (rectangular) end terminal, IPC_7351 nominal with elongated pad for handsoldering. (Body size source: https://docs.google.com/spreadsheets/d/1BsfQQcO9C6DZCsRaXUlFlo91Tg2WpOkGARC1WS5S8t0/edit?usp=sharing), generated with kicad-footprint-generator") (tags "resistor handsolder") (path /5ED02278) (attr smd) (fp_text reference R2 (at 0 -1.65) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value 10k (at 0 1.65) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start 1.85 0.95) (end -1.85 0.95) (layer F.CrtYd) (width 0.05)) (fp_line (start 1.85 -0.95) (end 1.85 0.95) (layer F.CrtYd) (width 0.05)) (fp_line (start -1.85 -0.95) (end 1.85 -0.95) (layer F.CrtYd) (width 0.05)) (fp_line (start -1.85 0.95) (end -1.85 -0.95) (layer F.CrtYd) (width 0.05)) (fp_line (start -0.261252 0.71) (end 0.261252 0.71) (layer F.SilkS) (width 0.12)) (fp_line (start -0.261252 -0.71) (end 0.261252 -0.71) (layer F.SilkS) (width 0.12)) (fp_line (start 1 0.6) (end -1 0.6) (layer F.Fab) (width 0.1)) (fp_line (start 1 -0.6) (end 1 0.6) (layer F.Fab) (width 0.1)) (fp_line (start -1 -0.6) (end 1 -0.6) (layer F.Fab) (width 0.1)) (fp_line (start -1 0.6) (end -1 -0.6) (layer F.Fab) (width 0.1)) (fp_text user %V (at 0 0) (layer F.Fab) (effects (font (size 0.4 0.4) (thickness 0.08))) ) (pad 2 smd roundrect (at 1.025 0 180) (size 1.15 1.4) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.217391) (net 23 "Net-(R2-Pad2)")) (pad 1 smd roundrect (at -1.025 0 180) (size 1.15 1.4) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.217391) (net 73 GND)) (model ${KISYS3DMOD}/Resistor_SMD.3dshapes/R_0805_2012Metric.wrl (at (xyz 0 0 0)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 0)) ) ) (module Resistor_SMD:R_0805_2012Metric_Pad1.15x1.40mm_HandSolder (layer F.Cu) (tedit 5B36C52B) (tstamp 5EDCC525) (at 43.035 78.86) (descr "Resistor SMD 0805 (2012 Metric), square (rectangular) end terminal, IPC_7351 nominal with elongated pad for handsoldering. (Body size source: https://docs.google.com/spreadsheets/d/1BsfQQcO9C6DZCsRaXUlFlo91Tg2WpOkGARC1WS5S8t0/edit?usp=sharing), generated with kicad-footprint-generator") (tags "resistor handsolder") (path /5ECF5B89) (attr smd) (fp_text reference R1 (at 0 -1.65) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value 10k (at 0 1.65) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start 1.85 0.95) (end -1.85 0.95) (layer F.CrtYd) (width 0.05)) (fp_line (start 1.85 -0.95) (end 1.85 0.95) (layer F.CrtYd) (width 0.05)) (fp_line (start -1.85 -0.95) (end 1.85 -0.95) (layer F.CrtYd) (width 0.05)) (fp_line (start -1.85 0.95) (end -1.85 -0.95) (layer F.CrtYd) (width 0.05)) (fp_line (start -0.261252 0.71) (end 0.261252 0.71) (layer F.SilkS) (width 0.12)) (fp_line (start -0.261252 -0.71) (end 0.261252 -0.71) (layer F.SilkS) (width 0.12)) (fp_line (start 1 0.6) (end -1 0.6) (layer F.Fab) (width 0.1)) (fp_line (start 1 -0.6) (end 1 0.6) (layer F.Fab) (width 0.1)) (fp_line (start -1 -0.6) (end 1 -0.6) (layer F.Fab) (width 0.1)) (fp_line (start -1 0.6) (end -1 -0.6) (layer F.Fab) (width 0.1)) (fp_text user %V (at 0 0) (layer F.Fab) (effects (font (size 0.4 0.4) (thickness 0.08))) ) (pad 2 smd roundrect (at 1.025 0) (size 1.15 1.4) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.217391) (net 1 +5V)) (pad 1 smd roundrect (at -1.025 0) (size 1.15 1.4) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.217391) (net 22 "Net-(R1-Pad1)")) (model ${KISYS3DMOD}/Resistor_SMD.3dshapes/R_0805_2012Metric.wrl (at (xyz 0 0 0)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 0)) ) ) (module Capacitor_SMD:C_0805_2012Metric_Pad1.15x1.40mm_HandSolder (layer F.Cu) (tedit 5B36C52B) (tstamp 5EDCC4F2) (at 64.5 74.07 90) (descr "Capacitor SMD 0805 (2012 Metric), square (rectangular) end terminal, IPC_7351 nominal with elongated pad for handsoldering. (Body size source: https://docs.google.com/spreadsheets/d/1BsfQQcO9C6DZCsRaXUlFlo91Tg2WpOkGARC1WS5S8t0/edit?usp=sharing), generated with kicad-footprint-generator") (tags "capacitor handsolder") (path /5ED59971) (attr smd) (fp_text reference C8 (at 0 -1.65 90) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value 1u (at 0 1.65 90) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start 1.85 0.95) (end -1.85 0.95) (layer F.CrtYd) (width 0.05)) (fp_line (start 1.85 -0.95) (end 1.85 0.95) (layer F.CrtYd) (width 0.05)) (fp_line (start -1.85 -0.95) (end 1.85 -0.95) (layer F.CrtYd) (width 0.05)) (fp_line (start -1.85 0.95) (end -1.85 -0.95) (layer F.CrtYd) (width 0.05)) (fp_line (start -0.261252 0.71) (end 0.261252 0.71) (layer F.SilkS) (width 0.12)) (fp_line (start -0.261252 -0.71) (end 0.261252 -0.71) (layer F.SilkS) (width 0.12)) (fp_line (start 1 0.6) (end -1 0.6) (layer F.Fab) (width 0.1)) (fp_line (start 1 -0.6) (end 1 0.6) (layer F.Fab) (width 0.1)) (fp_line (start -1 -0.6) (end 1 -0.6) (layer F.Fab) (width 0.1)) (fp_line (start -1 0.6) (end -1 -0.6) (layer F.Fab) (width 0.1)) (fp_text user %V (at 0 0 270) (layer F.Fab) (effects (font (size 0.4 0.4) (thickness 0.08))) ) (pad 2 smd roundrect (at 1.025 0 90) (size 1.15 1.4) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.217391) (net 73 GND)) (pad 1 smd roundrect (at -1.025 0 90) (size 1.15 1.4) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.217391) (net 4 "Net-(C8-Pad1)")) (model ${KISYS3DMOD}/Capacitor_SMD.3dshapes/C_0805_2012Metric.wrl (at (xyz 0 0 0)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 0)) ) ) (module Capacitor_SMD:C_0805_2012Metric_Pad1.15x1.40mm_HandSolder (layer F.Cu) (tedit 5B36C52B) (tstamp 5EDCC4BF) (at 74.21 80.78 180) (descr "Capacitor SMD 0805 (2012 Metric), square (rectangular) end terminal, IPC_7351 nominal with elongated pad for handsoldering. (Body size source: https://docs.google.com/spreadsheets/d/1BsfQQcO9C6DZCsRaXUlFlo91Tg2WpOkGARC1WS5S8t0/edit?usp=sharing), generated with kicad-footprint-generator") (tags "capacitor handsolder") (path /5ECE163A) (attr smd) (fp_text reference C7 (at 0 -1.65) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value 4.7u (at 0 1.65) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start 1.85 0.95) (end -1.85 0.95) (layer F.CrtYd) (width 0.05)) (fp_line (start 1.85 -0.95) (end 1.85 0.95) (layer F.CrtYd) (width 0.05)) (fp_line (start -1.85 -0.95) (end 1.85 -0.95) (layer F.CrtYd) (width 0.05)) (fp_line (start -1.85 0.95) (end -1.85 -0.95) (layer F.CrtYd) (width 0.05)) (fp_line (start -0.261252 0.71) (end 0.261252 0.71) (layer F.SilkS) (width 0.12)) (fp_line (start -0.261252 -0.71) (end 0.261252 -0.71) (layer F.SilkS) (width 0.12)) (fp_line (start 1 0.6) (end -1 0.6) (layer F.Fab) (width 0.1)) (fp_line (start 1 -0.6) (end 1 0.6) (layer F.Fab) (width 0.1)) (fp_line (start -1 -0.6) (end 1 -0.6) (layer F.Fab) (width 0.1)) (fp_line (start -1 0.6) (end -1 -0.6) (layer F.Fab) (width 0.1)) (fp_text user %V (at 0 0) (layer F.Fab) (effects (font (size 0.4 0.4) (thickness 0.08))) ) (pad 2 smd roundrect (at 1.025 0 180) (size 1.15 1.4) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.217391) (net 73 GND)) (pad 1 smd roundrect (at -1.025 0 180) (size 1.15 1.4) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.217391) (net 1 +5V)) (model ${KISYS3DMOD}/Capacitor_SMD.3dshapes/C_0805_2012Metric.wrl (at (xyz 0 0 0)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 0)) ) ) (module Capacitor_SMD:C_0805_2012Metric_Pad1.15x1.40mm_HandSolder (layer F.Cu) (tedit 5B36C52B) (tstamp 5EDCC48C) (at 74 86.8 180) (descr "Capacitor SMD 0805 (2012 Metric), square (rectangular) end terminal, IPC_7351 nominal with elongated pad for handsoldering. (Body size source: https://docs.google.com/spreadsheets/d/1BsfQQcO9C6DZCsRaXUlFlo91Tg2WpOkGARC1WS5S8t0/edit?usp=sharing), generated with kicad-footprint-generator") (tags "capacitor handsolder") (path /5ECE13D7) (attr smd) (fp_text reference C6 (at 0 -1.65) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value 0.1u (at 0 1.65) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start 1.85 0.95) (end -1.85 0.95) (layer F.CrtYd) (width 0.05)) (fp_line (start 1.85 -0.95) (end 1.85 0.95) (layer F.CrtYd) (width 0.05)) (fp_line (start -1.85 -0.95) (end 1.85 -0.95) (layer F.CrtYd) (width 0.05)) (fp_line (start -1.85 0.95) (end -1.85 -0.95) (layer F.CrtYd) (width 0.05)) (fp_line (start -0.261252 0.71) (end 0.261252 0.71) (layer F.SilkS) (width 0.12)) (fp_line (start -0.261252 -0.71) (end 0.261252 -0.71) (layer F.SilkS) (width 0.12)) (fp_line (start 1 0.6) (end -1 0.6) (layer F.Fab) (width 0.1)) (fp_line (start 1 -0.6) (end 1 0.6) (layer F.Fab) (width 0.1)) (fp_line (start -1 -0.6) (end 1 -0.6) (layer F.Fab) (width 0.1)) (fp_line (start -1 0.6) (end -1 -0.6) (layer F.Fab) (width 0.1)) (fp_text user %V (at 0 0) (layer F.Fab) (effects (font (size 0.4 0.4) (thickness 0.06))) ) (pad 2 smd roundrect (at 1.025 0 180) (size 1.15 1.4) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.217391) (net 73 GND)) (pad 1 smd roundrect (at -1.025 0 180) (size 1.15 1.4) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.217391) (net 1 +5V)) (model ${KISYS3DMOD}/Capacitor_SMD.3dshapes/C_0805_2012Metric.wrl (at (xyz 0 0 0)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 0)) ) ) (module Capacitor_SMD:C_0805_2012Metric_Pad1.15x1.40mm_HandSolder (layer F.Cu) (tedit 5B36C52B) (tstamp 5EDCC459) (at 54.57 76 180) (descr "Capacitor SMD 0805 (2012 Metric), square (rectangular) end terminal, IPC_7351 nominal with elongated pad for handsoldering. (Body size source: https://docs.google.com/spreadsheets/d/1BsfQQcO9C6DZCsRaXUlFlo91Tg2WpOkGARC1WS5S8t0/edit?usp=sharing), generated with kicad-footprint-generator") (tags "capacitor handsolder") (path /5ECE11C2) (attr smd) (fp_text reference C5 (at 0 -1.65) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value 0.1u (at 0 1.65) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start 1.85 0.95) (end -1.85 0.95) (layer F.CrtYd) (width 0.05)) (fp_line (start 1.85 -0.95) (end 1.85 0.95) (layer F.CrtYd) (width 0.05)) (fp_line (start -1.85 -0.95) (end 1.85 -0.95) (layer F.CrtYd) (width 0.05)) (fp_line (start -1.85 0.95) (end -1.85 -0.95) (layer F.CrtYd) (width 0.05)) (fp_line (start -0.261252 0.71) (end 0.261252 0.71) (layer F.SilkS) (width 0.12)) (fp_line (start -0.261252 -0.71) (end 0.261252 -0.71) (layer F.SilkS) (width 0.12)) (fp_line (start 1 0.6) (end -1 0.6) (layer F.Fab) (width 0.1)) (fp_line (start 1 -0.6) (end 1 0.6) (layer F.Fab) (width 0.1)) (fp_line (start -1 -0.6) (end 1 -0.6) (layer F.Fab) (width 0.1)) (fp_line (start -1 0.6) (end -1 -0.6) (layer F.Fab) (width 0.1)) (fp_text user %V (at 0 0) (layer F.Fab) (effects (font (size 0.4 0.4) (thickness 0.08))) ) (pad 2 smd roundrect (at 1.025 0 180) (size 1.15 1.4) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.217391) (net 73 GND)) (pad 1 smd roundrect (at -1.025 0 180) (size 1.15 1.4) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.217391) (net 1 +5V)) (model ${KISYS3DMOD}/Capacitor_SMD.3dshapes/C_0805_2012Metric.wrl (at (xyz 0 0 0)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 0)) ) ) (module Capacitor_SMD:C_0805_2012Metric_Pad1.15x1.40mm_HandSolder (layer F.Cu) (tedit 5B36C52B) (tstamp 5EDCC426) (at 62.05 74.07 90) (descr "Capacitor SMD 0805 (2012 Metric), square (rectangular) end terminal, IPC_7351 nominal with elongated pad for handsoldering. (Body size source: https://docs.google.com/spreadsheets/d/1BsfQQcO9C6DZCsRaXUlFlo91Tg2WpOkGARC1WS5S8t0/edit?usp=sharing), generated with kicad-footprint-generator") (tags "capacitor handsolder") (path /5ECE0FCF) (attr smd) (fp_text reference C4 (at 0 -1.65 90) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value 0.1u (at 0 1.65 90) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start 1.85 0.95) (end -1.85 0.95) (layer F.CrtYd) (width 0.05)) (fp_line (start 1.85 -0.95) (end 1.85 0.95) (layer F.CrtYd) (width 0.05)) (fp_line (start -1.85 -0.95) (end 1.85 -0.95) (layer F.CrtYd) (width 0.05)) (fp_line (start -1.85 0.95) (end -1.85 -0.95) (layer F.CrtYd) (width 0.05)) (fp_line (start -0.261252 0.71) (end 0.261252 0.71) (layer F.SilkS) (width 0.12)) (fp_line (start -0.261252 -0.71) (end 0.261252 -0.71) (layer F.SilkS) (width 0.12)) (fp_line (start 1 0.6) (end -1 0.6) (layer F.Fab) (width 0.1)) (fp_line (start 1 -0.6) (end 1 0.6) (layer F.Fab) (width 0.1)) (fp_line (start -1 -0.6) (end 1 -0.6) (layer F.Fab) (width 0.1)) (fp_line (start -1 0.6) (end -1 -0.6) (layer F.Fab) (width 0.1)) (fp_text user %V (at 0 0 90) (layer F.Fab) (effects (font (size 0.4 0.4) (thickness 0.08))) ) (pad 2 smd roundrect (at 1.025 0 90) (size 1.15 1.4) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.217391) (net 73 GND)) (pad 1 smd roundrect (at -1.025 0 90) (size 1.15 1.4) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.217391) (net 1 +5V)) (model ${KISYS3DMOD}/Capacitor_SMD.3dshapes/C_0805_2012Metric.wrl (at (xyz 0 0 0)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 0)) ) ) (module Capacitor_SMD:C_0805_2012Metric_Pad1.15x1.40mm_HandSolder (layer F.Cu) (tedit 5B36C52B) (tstamp 5EDD4B8D) (at 54.5 79.12 180) (descr "Capacitor SMD 0805 (2012 Metric), square (rectangular) end terminal, IPC_7351 nominal with elongated pad for handsoldering. (Body size source: https://docs.google.com/spreadsheets/d/1BsfQQcO9C6DZCsRaXUlFlo91Tg2WpOkGARC1WS5S8t0/edit?usp=sharing), generated with kicad-footprint-generator") (tags "capacitor handsolder") (path /5ECC5F06) (attr smd) (fp_text reference C2 (at 0 -1.65) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value 22p (at 0 1.65) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start 1.85 0.95) (end -1.85 0.95) (layer F.CrtYd) (width 0.05)) (fp_line (start 1.85 -0.95) (end 1.85 0.95) (layer F.CrtYd) (width 0.05)) (fp_line (start -1.85 -0.95) (end 1.85 -0.95) (layer F.CrtYd) (width 0.05)) (fp_line (start -1.85 0.95) (end -1.85 -0.95) (layer F.CrtYd) (width 0.05)) (fp_line (start -0.261252 0.71) (end 0.261252 0.71) (layer F.SilkS) (width 0.12)) (fp_line (start -0.261252 -0.71) (end 0.261252 -0.71) (layer F.SilkS) (width 0.12)) (fp_line (start 1 0.6) (end -1 0.6) (layer F.Fab) (width 0.1)) (fp_line (start 1 -0.6) (end 1 0.6) (layer F.Fab) (width 0.1)) (fp_line (start -1 -0.6) (end 1 -0.6) (layer F.Fab) (width 0.1)) (fp_line (start -1 0.6) (end -1 -0.6) (layer F.Fab) (width 0.1)) (fp_text user %V (at 0 0) (layer F.Fab) (effects (font (size 0.4 0.4) (thickness 0.08))) ) (pad 2 smd roundrect (at 1.025 0 180) (size 1.15 1.4) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.217391) (net 69 "Net-(C2-Pad2)")) (pad 1 smd roundrect (at -1.025 0 180) (size 1.15 1.4) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.217391) (net 73 GND)) (model ${KISYS3DMOD}/Capacitor_SMD.3dshapes/C_0805_2012Metric.wrl (at (xyz 0 0 0)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 0)) ) ) (module Capacitor_SMD:C_0805_2012Metric_Pad1.15x1.40mm_HandSolder (layer F.Cu) (tedit 5B36C52B) (tstamp 5EDCC3C0) (at 54.5 86.84 180) (descr "Capacitor SMD 0805 (2012 Metric), square (rectangular) end terminal, IPC_7351 nominal with elongated pad for handsoldering. (Body size source: https://docs.google.com/spreadsheets/d/1BsfQQcO9C6DZCsRaXUlFlo91Tg2WpOkGARC1WS5S8t0/edit?usp=sharing), generated with kicad-footprint-generator") (tags "capacitor handsolder") (path /5ECC190F) (attr smd) (fp_text reference C1 (at 0 -1.65) (layer F.SilkS) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value 22p (at 0 1.65) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start 1.85 0.95) (end -1.85 0.95) (layer F.CrtYd) (width 0.05)) (fp_line (start 1.85 -0.95) (end 1.85 0.95) (layer F.CrtYd) (width 0.05)) (fp_line (start -1.85 -0.95) (end 1.85 -0.95) (layer F.CrtYd) (width 0.05)) (fp_line (start -1.85 0.95) (end -1.85 -0.95) (layer F.CrtYd) (width 0.05)) (fp_line (start -0.261252 0.71) (end 0.261252 0.71) (layer F.SilkS) (width 0.12)) (fp_line (start -0.261252 -0.71) (end 0.261252 -0.71) (layer F.SilkS) (width 0.12)) (fp_line (start 1 0.6) (end -1 0.6) (layer F.Fab) (width 0.1)) (fp_line (start 1 -0.6) (end 1 0.6) (layer F.Fab) (width 0.1)) (fp_line (start -1 -0.6) (end 1 -0.6) (layer F.Fab) (width 0.1)) (fp_line (start -1 0.6) (end -1 -0.6) (layer F.Fab) (width 0.1)) (fp_text user %V (at 0 0) (layer F.Fab) (effects (font (size 0.4 0.4) (thickness 0.08))) ) (pad 2 smd roundrect (at 1.025 0 180) (size 1.15 1.4) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.217391) (net 73 GND)) (pad 1 smd roundrect (at -1.025 0 180) (size 1.15 1.4) (layers F.Cu F.Paste F.Mask) (roundrect_rratio 0.217391) (net 2 "Net-(C1-Pad1)")) (model ${KISYS3DMOD}/Capacitor_SMD.3dshapes/C_0805_2012Metric.wrl (at (xyz 0 0 0)) (scale (xyz 1 1 1)) (rotate (xyz 0 0 0)) ) ) (module kbd:TRRS-PJ-320A (layer F.Cu) (tedit 5ECEB228) (tstamp 5EDBA328) (at 122 80.7 270) (path /5FF96E70) (fp_text reference Jack0 (at 0 14.2 90) (layer Dwgs.User) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_text value TRRS (at 0 -5.6 90) (layer F.Fab) hide (effects (font (size 1 1) (thickness 0.15))) ) (fp_line (start 3.05 0) (end -3.05 0) (layer F.SilkS) (width 0.15)) (fp_line (start 3.05 12.1) (end -3.05 12.1) (layer F.SilkS) (width 0.15)) (fp_line (start 3.05 0) (end 3.05 12.1) (layer F.SilkS) (width 0.15)) (fp_line (start -3.05 0) (end -3.05 12.1) (layer F.SilkS) (width 0.15)) (fp_line (start 2.8 0) (end 2.8 -2) (layer F.SilkS) (width 0.15)) (fp_line (start -2.8 0) (end -2.8 -2) (layer F.SilkS) (width 0.15)) (fp_line (start 2.8 -2) (end -2.8 -2) (layer F.SilkS) (width 0.15)) (fp_text user Sleeve (at 0.25 11.4 90) (layer F.Fab) hide (effects (font (size 0.7 0.7) (thickness 0.1))) ) (fp_text user Tip (at 0 10 90) (layer F.Fab) hide (effects (font (size 0.7 0.7) (thickness 0.1))) ) (fp_text user Ring1 (at 0 6.25 90) (layer F.Fab) hide (effects (font (size 0.7 0.7) (thickness 0.1))) ) (fp_text user Ring2 (at 0 3.25 90) (layer F.Fab) hide (effects (font (size 0.7 0.7) (thickness 0.1))) ) (pad R1 thru_hole oval (at 2.3 6.2 270) (size 1.6 2) (drill oval 0.9 1.3) (layers *.Cu *.Mask) (net 10 "Net-(Jack0-PadR1)")) (pad "" np_thru_hole circle (at 0 1.6 270) (size 0.8 0.8) (drill 0.8) (layers *.Cu *.Mask)) (pad "" np_thru_hole circle (at 0 8.6 270) (size 0.8 0.8) (drill 0.8) (layers *.Cu *.Mask)) (pad R2 thru_hole oval (at 2.3 3.2 270) (size 1.6 2) (drill oval 0.9 1.3) (layers *.Cu *.Mask) (net 1 +5V)) (pad T thru_hole oval (at 2.3 10.2 270) (size 1.6 2) (drill oval 0.9 1.3) (layers *.Cu *.Mask) (net 11 "Net-(Jack0-PadT)")) (pad S thru_hole oval (at -2.3 11.3 270) (size 1.6 2) (drill oval 0.9 1.3) (layers *.Cu *.Mask) (net 73 GND)) (model /Users/danny/syncproj/kicad-libs/footprints/Keebio-Parts.pretty/3dmodels/PJ-320A.step (at (xyz 0 0 0)) (scale (xyz 1 1 1)) (rotate (xyz -90 0 180)) ) ) (gr_text "by @pierrec83" (at 115.91 58) (layer B.SilkS) (tstamp 5EE10A87) (effects (font (size 1 1) (thickness 0.15)) (justify mirror)) ) (gr_text "Illustration adapted from \"Safe and unsafe rust\" by @whoisaldeka" (at 61.14 89.3 350) (layer B.SilkS) (effects (font (size 1 1) (thickness 0.15)) (justify mirror)) ) (gr_text "Ferris v0.1" (at 136.61 58) (layer B.SilkS) (effects (font (size 1 1) (thickness 0.15)) (justify mirror)) ) (gr_line (start 122.02 57.615) (end 122.02 84.59) (layer Edge.Cuts) (width 0.05) (tstamp 5EDAAAB2)) (gr_line (start 129.94 57.615) (end 129.95 83.26) (layer Edge.Cuts) (width 0.05) (tstamp 5ED9CE20)) (gr_arc (start 130.69 57.615) (end 129.94 57.615) (angle 90) (layer Edge.Cuts) (width 0.05) (tstamp 5ED9CE18)) (gr_line (start 141.45 56.86) (end 130.69 56.865) (layer Edge.Cuts) (width 0.05) (tstamp 5ED9CE19)) (gr_line (start 236.16 88.506571) (end 236.434998 88.505917) (layer Edge.Cuts) (width 0.05) (tstamp 5ED9CE12)) (gr_arc (start 195.377358 157.337354) (end 143.899755 22.82447) (angle 18.03933832) (layer Edge.Cuts) (width 0.05) (tstamp 5ED9CE11)) (gr_arc (start 139.88 106.68) (end 140.95 108.33) (angle 90.64821197) (layer Edge.Cuts) (width 0.05) (tstamp 5ED9CE16)) (gr_arc (start 236.47 86.505) (end 238.469999 86.574999) (angle 88.99765458) (layer Edge.Cuts) (width 0.05) (tstamp 5ED9CE15)) (gr_line (start 135.725228 103.529919) (end 138.218 107.731265) (layer Edge.Cuts) (width 0.05) (tstamp 5ED9CE1D)) (gr_arc (start 141.485002 54.859083) (end 143.485001 54.929082) (angle 88.99765458) (layer Edge.Cuts) (width 0.05) (tstamp 5ED9CE1E)) (gr_line (start 188.084876 13.497561) (end 192.06 13.5) (layer Edge.Cuts) (width 0.05) (tstamp 5ED9CE1B)) (gr_arc (start 144.215 23.505) (end 143.465 23.505) (angle 65.14479855) (layer Edge.Cuts) (width 0.05) (tstamp 5ED9CE17)) (gr_arc (start 234.59 33.5) (end 237.035 30.255) (angle 35.37139642) (layer Edge.Cuts) (width 0.05) (tstamp 5ED9CE10)) (gr_arc (start 236.44 370.44) (end 166.129829 97.41433) (angle 14.38425514) (layer Edge.Cuts) (width 0.05) (tstamp 5ED9CE14)) (gr_arc (start 187.68 181.64) (end 140.95 108.33) (angle 18.16273367) (layer Edge.Cuts) (width 0.05) (tstamp 5ED9CE13)) (gr_line (start 238.462141 32.26932) (end 238.469999 86.574999) (layer Edge.Cuts) (width 0.05) (tstamp 5ED9CE1A)) (gr_arc (start 192.06 82.23) (end 192.06 13.5) (angle 40.87028694) (layer Edge.Cuts) (width 0.05) (tstamp 5ED9CE1C)) (gr_arc (start 168.846341 83.135491) (end 135.725228 103.529919) (angle 31.43940695) (layer Edge.Cuts) (width 0.05) (tstamp 5ED9CE1F)) (gr_line (start 143.485001 54.929082) (end 143.465 23.505) (layer Edge.Cuts) (width 0.05) (tstamp 5ED9CE21)) (gr_arc (start 83.153348 83.065479) (end 116.274461 103.459907) (angle -29.37657196) (layer Edge.Cuts) (width 0.05) (tstamp 5EDAA9C2)) (gr_line (start 116.274461 103.459907) (end 113.742 107.731265) (layer Edge.Cuts) (width 0.05) (tstamp 5EDAAAB5)) (gr_line (start 108.474999 54.929082) (end 108.495 23.505) (layer Edge.Cuts) (width 0.05) (tstamp 5EDAB87D)) (gr_arc (start 110.474998 54.859083) (end 108.474999 54.929082) (angle -88.99765458) (layer Edge.Cuts) (width 0.05) (tstamp 5EDAB87A)) (gr_arc (start 17.37 33.5) (end 14.925 30.255) (angle -35.37139642) (layer Edge.Cuts) (width 0.05) (tstamp 5EDAB37F)) (gr_arc (start 56.582642 157.337354) (end 108.060245 22.82447) (angle -18.03933832) (layer Edge.Cuts) (width 0.05) (tstamp 5EDAB37C)) (gr_line (start 15.8 88.506571) (end 15.525002 88.505917) (layer Edge.Cuts) (width 0.05) (tstamp 5EDABA87)) (gr_arc (start 64.28 181.64) (end 111.01 108.33) (angle -18.16273367) (layer Edge.Cuts) (width 0.05) (tstamp 5EDABA84)) (gr_arc (start 15.52 370.44) (end 85.830171 97.41433) (angle -14.38425514) (layer Edge.Cuts) (width 0.05) (tstamp 5EDCBAB7)) (gr_arc (start 15.49 86.505) (end 13.490001 86.574999) (angle -88.99765458) (layer Edge.Cuts) (width 0.05) (tstamp 5EDAA8DE)) (gr_arc (start 112.08 106.68) (end 111.01 108.33) (angle -90.64821197) (layer Edge.Cuts) (width 0.05) (tstamp 5EDAABA5)) (gr_arc (start 107.745 23.505) (end 108.495 23.505) (angle -65.14479855) (layer Edge.Cuts) (width 0.05) (tstamp 5EDAABA2)) (gr_arc (start 121.27 57.615) (end 122.02 57.615) (angle -90) (layer Edge.Cuts) (width 0.05) (tstamp 5EDAB58F)) (gr_line (start 110.51 56.86) (end 121.27 56.865) (layer Edge.Cuts) (width 0.05) (tstamp 5EDAB58C)) (gr_line (start 13.497859 32.26932) (end 13.490001 86.574999) (layer Edge.Cuts) (width 0.05) (tstamp 5EDAB9D6)) (gr_line (start 63.875124 13.497561) (end 59.9 13.5) (layer Edge.Cuts) (width 0.05) (tstamp 5EDAB9D3)) (gr_arc (start 59.9 82.23) (end 59.9 13.5) (angle -40.87028694) (layer Edge.Cuts) (width 0.05) (tstamp 5EDABC0A)) (segment (start 63.71 78.29) (end 63.7 78.3) (width 0.381) (layer F.Cu) (net 1) (tstamp 5EDCC782) (status 30)) (segment (start 67.72 78.32) (end 67.7 78.3) (width 0.381) (layer F.Cu) (net 1) (tstamp 5EDCC359) (status 30)) (segment (start 48.01051 74.90949) (end 44.06 78.86) (width 0.381) (layer F.Cu) (net 1) (tstamp 5EDCC21B) (status 20)) (segment (start 54.50449 74.90949) (end 48.01051 74.90949) (width 0.381) (layer F.Cu) (net 1) (tstamp 5EDCC1AF)) (segment (start 55.595 76) (end 54.50449 74.90949) (width 0.381) (layer F.Cu) (net 1) (tstamp 5EDCC1EB) (status 10)) (via (at 76.46 80.79) (size 0.8) (drill 0.4) (layers F.Cu B.Cu) (net 1) (tstamp 5EDCC242)) (segment (start 76.45 80.78) (end 76.46 80.79) (width 0.381) (layer F.Cu) (net 1) (tstamp 5EDCC2D8)) (segment (start 75.235 80.78) (end 76.45 80.78) (width 0.381) (layer F.Cu) (net 1) (tstamp 5EDCC317) (status 10)) (segment (start 61.945 75.2) (end 62.05 75.095) (width 0.381) (layer F.Cu) (net 1) (tstamp 5EDCC620) (status 30)) (segment (start 55.56 76.035) (end 55.595 76) (width 0.381) (layer F.Cu) (net 1) (tstamp 5EDCC200) (status 30)) (segment (start 55.56 77.52) (end 55.56 76.035) (width 0.381) (layer F.Cu) (net 1) (tstamp 5EDCC77F) (status 20)) (segment (start 67.7 79.227902) (end 67.7 78.3) (width 0.381) (layer F.Cu) (net 1) (tstamp 5EDCC35C) (status 20)) (segment (start 67.912599 79.440501) (end 67.7 79.227902) (width 0.381) (layer F.Cu) (net 1) (tstamp 5EDCC1D9)) (segment (start 69.087401 79.440501) (end 67.912599 79.440501) (width 0.381) (layer F.Cu) (net 1) (tstamp 5EDCC275)) (segment (start 69.333392 79.19451) (end 69.087401 79.440501) (width 0.381) (layer F.Cu) (net 1) (tstamp 5EDCC272)) (segment (start 74.14449 79.68949) (end 75.235 80.78) (width 0.381) (layer F.Cu) (net 1) (tstamp 5EDCC1D6) (status 20)) (segment (start 72.59469 79.68949) (end 74.14449 79.68949) (width 0.381) (layer F.Cu) (net 1) (tstamp 5EDCC1DF)) (segment (start 72.28418 80) (end 72.59469 79.68949) (width 0.381) (layer F.Cu) (net 1) (tstamp 5EDCC25A)) (segment (start 70.2 80) (end 72.28418 80) (width 0.381) (layer F.Cu) (net 1) (tstamp 5EDCC218) (status 10)) (segment (start 73.825 88) (end 75.025 86.8) (width 0.381) (layer F.Cu) (net 1) (status 20)) (segment (start 70.2 88) (end 73.825 88) (width 0.381) (layer F.Cu) (net 1) (status 10)) (via (at 76.46 86.82) (size 0.8) (drill 0.4) (layers F.Cu B.Cu) (net 1)) (segment (start 76.44 86.8) (end 76.46 86.82) (width 0.381) (layer F.Cu) (net 1)) (segment (start 75.025 86.8) (end 76.44 86.8) (width 0.381) (layer F.Cu) (net 1) (status 10)) (segment (start 76.46 86.82) (end 76.46 90.01582) (width 0.381) (layer F.Cu) (net 1)) (segment (start 76.46 80.79) (end 76.46 86.82) (width 0.381) (layer B.Cu) (net 1)) (segment (start 75.61531 90.89051) (end 76.46 90.04582) (width 0.381) (layer F.Cu) (net 1)) (segment (start 76.46 90.04582) (end 76.46 86.82) (width 0.381) (layer F.Cu) (net 1)) (segment (start 61.86949 90.89051) (end 75.61531 90.89051) (width 0.381) (layer F.Cu) (net 1)) (segment (start 61.330164 91.429836) (end 61.86949 90.89051) (width 0.381) (layer F.Cu) (net 1)) (segment (start 56.185 89.39) (end 56.61 89.39) (width 0.381) (layer F.Cu) (net 1)) (segment (start 57.669 81.6) (end 57.659499 81.590499) (width 0.381) (layer F.Cu) (net 1)) (segment (start 58.8 81.6) (end 57.669 81.6) (width 0.381) (layer F.Cu) (net 1) (status 10)) (segment (start 57.659499 78.064499) (end 55.595 76) (width 0.381) (layer F.Cu) (net 1) (status 20)) (segment (start 57.659499 81.590499) (end 57.659499 78.064499) (width 0.381) (layer F.Cu) (net 1)) (via (at 55.56 77.52) (size 0.8) (drill 0.4) (layers F.Cu B.Cu) (net 1)) (segment (start 55.49 77.59) (end 55.56 77.52) (width 0.381) (layer B.Cu) (net 1)) (segment (start 59.920164 91.429836) (end 58.811599 91.429836) (width 0.381) (layer F.Cu) (net 1)) (segment (start 59.689836 91.429836) (end 59.920164 91.429836) (width 0.381) (layer F.Cu) (net 1)) (segment (start 59.920164 91.429836) (end 61.330164 91.429836) (width 0.381) (layer F.Cu) (net 1)) (segment (start 58.80261 91.428452) (end 58.212079 90.837921) (width 0.381) (layer F.Cu) (net 1)) (segment (start 58.811599 91.429836) (end 58.80261 91.428452) (width 0.381) (layer F.Cu) (net 1)) (segment (start 59.050501 90.840501) (end 57.6 89.39) (width 0.381) (layer F.Cu) (net 1)) (segment (start 61.087401 90.840501) (end 59.050501 90.840501) (width 0.381) (layer F.Cu) (net 1)) (segment (start 61.3 89.7) (end 61.3 90.627902) (width 0.381) (layer F.Cu) (net 1) (status 10)) (segment (start 57.6 89.39) (end 56.61 89.39) (width 0.381) (layer F.Cu) (net 1)) (segment (start 61.3 90.627902) (end 61.087401 90.840501) (width 0.381) (layer F.Cu) (net 1)) (segment (start 55.525 89.39) (end 56.61 89.39) (width 0.381) (layer F.Cu) (net 1) (status 10)) (segment (start 55.525 89.885) (end 56.477921 90.837921) (width 0.381) (layer F.Cu) (net 1) (status 10)) (segment (start 55.525 89.39) (end 55.525 89.885) (width 0.381) (layer F.Cu) (net 1) (status 30)) (segment (start 58.212079 90.837921) (end 56.477921 90.837921) (width 0.381) (layer F.Cu) (net 1)) (segment (start 62.05 75.095) (end 62.115 75.095) (width 0.381) (layer F.Cu) (net 1) (status 30)) (segment (start 117.97 73.975) (end 120.4 73.975) (width 0.381) (layer F.Cu) (net 1) (status 30)) (segment (start 117.68 73.685) (end 117.97 73.975) (width 0.381) (layer F.Cu) (net 1) (status 30)) (segment (start 117.68 71) (end 117.68 73.685) (width 0.381) (layer F.Cu) (net 1) (status 30)) (via (at 60.51 76.032957) (size 0.8) (drill 0.4) (layers F.Cu B.Cu) (net 1)) (segment (start 61.447957 75.095) (end 60.51 76.032957) (width 0.381) (layer F.Cu) (net 1) (status 10)) (segment (start 62.05 75.095) (end 61.447957 75.095) (width 0.381) (layer F.Cu) (net 1) (status 30)) (via (at 63.18 76.03) (size 0.8) (drill 0.4) (layers F.Cu B.Cu) (net 1)) (segment (start 62.05 75.095) (end 62.539203 75.095) (width 0.381) (layer F.Cu) (net 1) (status 30)) (segment (start 57.047043 76.032957) (end 55.56 77.52) (width 0.381) (layer B.Cu) (net 1)) (segment (start 60.51 76.032957) (end 57.047043 76.032957) (width 0.381) (layer B.Cu) (net 1)) (segment (start 63.260674 76.110674) (end 63.18 76.03) (width 0.381) (layer B.Cu) (net 1)) (segment (start 62.245 75.095) (end 63.18 76.03) (width 0.381) (layer F.Cu) (net 1) (status 10)) (segment (start 62.05 75.095) (end 62.245 75.095) (width 0.381) (layer F.Cu) (net 1) (status 30)) (segment (start 63.7 76.55) (end 63.7 78.3) (width 0.381) (layer F.Cu) (net 1) (status 20)) (segment (start 63.18 76.03) (end 63.7 76.55) (width 0.381) (layer F.Cu) (net 1)) (segment (start 71.163673 79.19451) (end 71.709655 78.648528) (width 0.381) (layer F.Cu) (net 1)) (segment (start 69.333392 79.19451) (end 71.163673 79.19451) (width 0.381) (layer F.Cu) (net 1)) (segment (start 121.49051 78.206875) (end 121.49051 75.43469) (width 0.381) (layer F.Cu) (net 1)) (segment (start 75.828528 78.648528) (end 71.709655 78.648528) (width 0.381) (layer F.Cu) (net 1)) (segment (start 76.46 79.28) (end 75.828528 78.648528) (width 0.381) (layer F.Cu) (net 1)) (segment (start 76.46 80.79) (end 76.46 79.28) (width 0.381) (layer F.Cu) (net 1)) (segment (start 71.7 76.03) (end 76.46 80.79) (width 0.381) (layer B.Cu) (net 1)) (segment (start 63.18 76.03) (end 71.7 76.03) (width 0.381) (layer B.Cu) (net 1)) (segment (start 121.49051 75.06551) (end 120.4 73.975) (width 0.381) (layer F.Cu) (net 1)) (segment (start 121.49051 81.69049) (end 121.49051 75.06551) (width 0.381) (layer F.Cu) (net 1)) (segment (start 120.181 83) (end 121.49051 81.69049) (width 0.381) (layer F.Cu) (net 1)) (segment (start 118.8 83) (end 120.181 83) (width 0.381) (layer F.Cu) (net 1)) (segment (start 117.41 81.61) (end 118.8 83) (width 0.381) (layer F.Cu) (net 1)) (segment (start 117.290501 81.490501) (end 117.41 81.61) (width 0.381) (layer F.Cu) (net 1)) (segment (start 100.118939 81.490501) (end 117.290501 81.490501) (width 0.381) (layer F.Cu) (net 1)) (segment (start 97.276968 78.648528) (end 100.118939 81.490501) (width 0.381) (layer F.Cu) (net 1)) (segment (start 75.828528 78.648528) (end 97.276968 78.648528) (width 0.381) (layer F.Cu) (net 1)) (segment (start 55.34 86.525) (end 55.655 86.84) (width 0.254) (layer F.Cu) (net 2) (tstamp 5EDCC1BB) (status 30)) (segment (start 55.4 84) (end 55.35 84.05) (width 0.254) (layer F.Cu) (net 2) (status 30)) (segment (start 58.8 84) (end 55.9 84) (width 0.254) (layer F.Cu) (net 2) (status 30)) (segment (start 55.525 84.225) (end 55.35 84.05) (width 0.254) (layer F.Cu) (net 2) (status 30)) (segment (start 55.525 86.84) (end 55.525 84.225) (width 0.254) (layer F.Cu) (net 2) (status 30)) (segment (start 114.404499 64.022599) (end 114.482599 63.944499) (width 0.381) (layer F.Cu) (net 3)) (segment (start 114.404499 64.900501) (end 114.404499 64.022599) (width 0.381) (layer F.Cu) (net 3) (status 10)) (segment (start 114.245 65.06) (end 114.404499 64.900501) (width 0.381) (layer F.Cu) (net 3) (status 30)) (segment (start 118.985501 64.900501) (end 119.145 65.06) (width 0.381) (layer F.Cu) (net 3) (status 30)) (segment (start 118.453391 63.490489) (end 118.985501 64.022599) (width 0.381) (layer F.Cu) (net 3)) (segment (start 114.936609 63.490489) (end 118.453391 63.490489) (width 0.381) (layer F.Cu) (net 3)) (segment (start 118.985501 64.022599) (end 118.985501 64.900501) (width 0.381) (layer F.Cu) (net 3) (status 20)) (segment (start 114.404499 64.022599) (end 114.936609 63.490489) (width 0.381) (layer F.Cu) (net 3)) (segment (start 119.145 65.515) (end 119.19051 65.56051) (width 0.381) (layer F.Cu) (net 3) (status 30)) (segment (start 119.145 65.06) (end 119.145 65.515) (width 0.381) (layer F.Cu) (net 3) (status 30)) (segment (start 119.19051 65.10551) (end 119.145 65.06) (width 0.381) (layer F.Cu) (net 3) (status 30)) (segment (start 119.44051 69.96051) (end 120.48 71) (width 0.381) (layer F.Cu) (net 3) (status 20)) (segment (start 119.44051 67.28469) (end 119.44051 69.96051) (width 0.381) (layer F.Cu) (net 3)) (segment (start 119.145 66.98918) (end 119.44051 67.28469) (width 0.381) (layer F.Cu) (net 3)) (segment (start 119.145 65.06) (end 119.145 66.98918) (width 0.381) (layer F.Cu) (net 3) (status 10)) (segment (start 64.5 75.095) (end 64.5 78.3) (width 0.254) (layer F.Cu) (net 4) (tstamp 5EDCC353) (status 30)) (segment (start 96.958499 53.858499) (end 99 55.9) (width 0.254) (layer B.Cu) (net 5) (status 20)) (segment (start 96.958499 38.941501) (end 96.958499 53.858499) (width 0.254) (layer B.Cu) (net 5)) (segment (start 99 36.9) (end 96.958499 38.941501) (width 0.254) (layer B.Cu) (net 5) (status 10)) (segment (start 96.958499 72.858499) (end 99 74.9) (width 0.254) (layer B.Cu) (net 5) (status 20)) (segment (start 96.958499 57.941501) (end 96.958499 72.858499) (width 0.254) (layer B.Cu) (net 5)) (segment (start 99 55.9) (end 96.958499 57.941501) (width 0.254) (layer B.Cu) (net 5) (status 10)) (segment (start 107.05 82.95) (end 107.05 100.10955) (width 0.254) (layer B.Cu) (net 5) (status 20)) (segment (start 99 74.9) (end 107.05 82.95) (width 0.254) (layer B.Cu) (net 5) (status 10)) (via (at 66.416908 88.346122) (size 0.8) (drill 0.4) (layers F.Cu B.Cu) (net 5)) (segment (start 105.172817 98.232367) (end 107.05 100.10955) (width 0.254) (layer B.Cu) (net 5) (status 20)) (segment (start 90.018731 98.232367) (end 105.172817 98.232367) (width 0.254) (layer B.Cu) (net 5)) (segment (start 84.840685 93.054321) (end 90.018731 98.232367) (width 0.254) (layer B.Cu) (net 5)) (segment (start 71.125107 93.054321) (end 84.840685 93.054321) (width 0.254) (layer B.Cu) (net 5)) (segment (start 66.416908 88.346122) (end 71.125107 93.054321) (width 0.254) (layer B.Cu) (net 5)) (segment (start 66.1 88.66303) (end 66.416908 88.346122) (width 0.254) (layer F.Cu) (net 5)) (segment (start 66.1 89.7) (end 66.1 88.66303) (width 0.254) (layer F.Cu) (net 5)) (segment (start 117.945 65.225) (end 117.967999 65.247999) (width 0.254) (layer F.Cu) (net 6) (status 30)) (segment (start 117.945 65.06) (end 117.945 65.225) (width 0.254) (layer F.Cu) (net 6) (status 30)) (segment (start 117.945 67.47) (end 118.475 68) (width 0.254) (layer F.Cu) (net 6) (status 30)) (segment (start 117.945 65.06) (end 117.945 67.47) (width 0.254) (layer F.Cu) (net 6) (status 30)) (segment (start 117.445 64.0504) (end 117.445 65.06) (width 0.254) (layer F.Cu) (net 7) (status 20)) (segment (start 116.518001 64.007999) (end 117.402599 64.007999) (width 0.254) (layer F.Cu) (net 7)) (segment (start 116.445 64.081) (end 116.518001 64.007999) (width 0.254) (layer F.Cu) (net 7)) (segment (start 117.402599 64.007999) (end 117.445 64.0504) (width 0.254) (layer F.Cu) (net 7)) (segment (start 116.445 65.06) (end 116.445 64.081) (width 0.254) (layer F.Cu) (net 7) (status 10)) (segment (start 115.53 69.728085) (end 115.53 73.975) (width 0.254) (layer F.Cu) (net 7) (status 20)) (segment (start 117.445 67.813085) (end 115.53 69.728085) (width 0.254) (layer F.Cu) (net 7)) (segment (start 117.445 65.06) (end 117.445 67.813085) (width 0.254) (layer F.Cu) (net 7) (status 10)) (segment (start 115.945 66.023602) (end 115.945 65.06) (width 0.254) (layer F.Cu) (net 8) (status 20)) (segment (start 116.945 65.06) (end 116.945 66.023602) (width 0.254) (layer F.Cu) (net 8) (status 10)) (segment (start 116.856601 66.112001) (end 116.945 66.023602) (width 0.254) (layer F.Cu) (net 8)) (segment (start 115.945 66.023602) (end 116.033399 66.112001) (width 0.254) (layer F.Cu) (net 8)) (segment (start 116.172001 66.112001) (end 116.17701 66.11701) (width 0.254) (layer F.Cu) (net 8)) (segment (start 116.033399 66.112001) (end 116.172001 66.112001) (width 0.254) (layer F.Cu) (net 8)) (segment (start 116.172001 66.112001) (end 116.856601 66.112001) (width 0.254) (layer F.Cu) (net 8)) (segment (start 115.945 65.06) (end 115.945 68.671018) (width 0.254) (layer F.Cu) (net 8) (status 10)) (segment (start 113.1 71.516019) (end 113.1 73.975) (width 0.254) (layer F.Cu) (net 8) (status 20)) (segment (start 115.945 68.671019) (end 113.1 71.516019) (width 0.254) (layer F.Cu) (net 8)) (segment (start 115.945 65.06) (end 115.945 68.671019) (width 0.254) (layer F.Cu) (net 8) (status 10)) (segment (start 114.945 65.915) (end 114.945 65.06) (width 0.254) (layer F.Cu) (net 9) (status 20)) (segment (start 115.275 68) (end 114.945 67.67) (width 0.254) (layer F.Cu) (net 9) (status 30)) (segment (start 114.945 67.92) (end 115.025 68) (width 0.254) (layer F.Cu) (net 9) (status 30)) (segment (start 114.945 65.06) (end 114.945 67.92) (width 0.254) (layer F.Cu) (net 9) (status 30)) (via (at 70.784232 78.404009) (size 0.8) (drill 0.4) (layers F.Cu B.Cu) (net 10) (tstamp 5EDCC1A9)) (via (at 63.6 85.59) (size 0.8) (drill 0.4) (layers F.Cu B.Cu) (net 10)) (segment (start 120.250962 76.025) (end 120.4 76.025) (width 0.254) (layer F.Cu) (net 10)) (via (at 120.38 77.23) (size 0.8) (drill 0.4) (layers F.Cu B.Cu) (net 10)) (segment (start 120.4 77.21) (end 120.38 77.23) (width 0.254) (layer F.Cu) (net 10)) (segment (start 120.4 76.025) (end 120.4 77.21) (width 0.254) (layer F.Cu) (net 10)) (segment (start 115.8 81.81) (end 115.8 83) (width 0.254) (layer B.Cu) (net 10)) (segment (start 120.38 77.23) (end 115.8 81.81) (width 0.254) (layer B.Cu) (net 10)) (segment (start 116.505 79.92) (end 117.6925 78.7325) (width 0.254) (layer F.Cu) (net 10)) (segment (start 113.15 79.92) (end 116.505 79.92) (width 0.254) (layer F.Cu) (net 10)) (segment (start 112.985967 80.084033) (end 113.15 79.92) (width 0.254) (layer F.Cu) (net 10)) (segment (start 98.44 79.079688) (end 98.44 79.079692) (width 0.254) (layer F.Cu) (net 10)) (segment (start 112.118067 80.94) (end 112.974033 80.084033) (width 0.254) (layer F.Cu) (net 10)) (segment (start 70.918982 78.131018) (end 97.49133 78.131018) (width 0.254) (layer F.Cu) (net 10)) (segment (start 117.6925 78.7325) (end 120.4 76.025) (width 0.254) (layer F.Cu) (net 10)) (segment (start 100.300308 80.94) (end 112.118067 80.94) (width 0.254) (layer F.Cu) (net 10)) (segment (start 98.44 79.079692) (end 100.300308 80.94) (width 0.254) (layer F.Cu) (net 10)) (segment (start 97.49133 78.131018) (end 98.44 79.079688) (width 0.254) (layer F.Cu) (net 10)) (segment (start 70.784232 78.265768) (end 70.918982 78.131018) (width 0.254) (layer F.Cu) (net 10)) (segment (start 112.974033 80.084033) (end 112.985967 80.084033) (width 0.254) (layer F.Cu) (net 10)) (segment (start 70.784232 78.404009) (end 70.784232 78.265768) (width 0.254) (layer F.Cu) (net 10)) (segment (start 63.59 85.6) (end 63.6 85.59) (width 0.254) (layer F.Cu) (net 10)) (segment (start 58.8 85.6) (end 63.59 85.6) (width 0.254) (layer F.Cu) (net 10)) (segment (start 70.784232 78.405768) (end 70.784232 78.404009) (width 0.254) (layer B.Cu) (net 10)) (segment (start 63.6 85.59) (end 70.784232 78.405768) (width 0.254) (layer B.Cu) (net 10)) (segment (start 111.8 83) (end 111.37 83) (width 0.254) (layer F.Cu) (net 11) (status 30)) (via (at 69.375002 78.05) (size 0.8) (drill 0.4) (layers F.Cu B.Cu) (net 11) (tstamp 5EDCC293)) (segment (start 69.375002 78.05) (end 69.375002 78.024998) (width 0.254) (layer F.Cu) (net 11) (tstamp 5EDCC335)) (via (at 62.784833 84.814833) (size 0.8) (drill 0.4) (layers F.Cu B.Cu) (net 11)) (segment (start 112.175962 83) (end 111.8 83) (width 0.254) (layer F.Cu) (net 11) (status 30)) (via (at 117.97 77.23) (size 0.8) (drill 0.4) (layers F.Cu B.Cu) (net 11)) (segment (start 117.97 76.025) (end 117.97 77.23) (width 0.254) (layer F.Cu) (net 11)) (segment (start 112.2 83) (end 111.8 83) (width 0.254) (layer B.Cu) (net 11)) (segment (start 117.97 77.23) (end 112.2 83) (width 0.254) (layer B.Cu) (net 11)) (segment (start 100.437406 80.43503) (end 111.980972 80.435029) (width 0.254) (layer F.Cu) (net 11)) (segment (start 97.679386 77.677008) (end 100.437406 80.43503) (width 0.254) (layer F.Cu) (net 11)) (segment (start 69.747994 77.677008) (end 97.679386 77.677008) (width 0.254) (layer F.Cu) (net 11)) (segment (start 69.375002 78.05) (end 69.747994 77.677008) (width 0.254) (layer F.Cu) (net 11)) (segment (start 112.583 79.833) (end 112.95001 79.46599) (width 0.254) (layer F.Cu) (net 11)) (segment (start 111.980972 80.435029) (end 112.583 79.833) (width 0.254) (layer F.Cu) (net 11)) (segment (start 114.52901 79.46599) (end 115.3025 78.6925) (width 0.254) (layer F.Cu) (net 11)) (segment (start 115.3025 78.6925) (end 117.97 76.025) (width 0.254) (layer F.Cu) (net 11)) (segment (start 112.95001 79.46599) (end 114.52901 79.46599) (width 0.254) (layer F.Cu) (net 11)) (segment (start 114.87599 79.11901) (end 115.3025 78.6925) (width 0.254) (layer F.Cu) (net 11)) (segment (start 62.77 84.8) (end 62.784833 84.814833) (width 0.254) (layer F.Cu) (net 11)) (segment (start 58.8 84.8) (end 62.77 84.8) (width 0.254) (layer F.Cu) (net 11)) (segment (start 62.784833 84.640169) (end 62.784833 84.814833) (width 0.254) (layer B.Cu) (net 11)) (segment (start 69.375002 78.05) (end 62.784833 84.640169) (width 0.254) (layer B.Cu) (net 11)) (segment (start 133.015 73.125) (end 133.69 73.8) (width 0.254) (layer F.Cu) (net 12) (status 10)) (via (at 133.69 73.8) (size 0.8) (drill 0.4) (layers F.Cu B.Cu) (net 12)) (segment (start 132.02 73.125) (end 133.015 73.125) (width 0.254) (layer F.Cu) (net 12) (status 30)) (segment (start 136.2 76.31) (end 136.2 78.4) (width 0.254) (layer B.Cu) (net 12) (status 20)) (segment (start 133.69 73.8) (end 136.2 76.31) (width 0.254) (layer B.Cu) (net 12)) (via (at 133.72 72.8) (size 0.8) (drill 0.4) (layers F.Cu B.Cu) (net 13)) (segment (start 132.775 71.855) (end 133.72 72.8) (width 0.254) (layer F.Cu) (net 13) (status 10)) (segment (start 132.02 71.855) (end 132.775 71.855) (width 0.254) (layer F.Cu) (net 13) (status 30)) (segment (start 139.32 78.4) (end 140.2 78.4) (width 0.254) (layer B.Cu) (net 13) (status 30)) (segment (start 133.72 72.8) (end 139.32 78.4) (width 0.254) (layer B.Cu) (net 13) (status 20)) (segment (start 20.958499 63.858499) (end 23 65.9) (width 0.254) (layer B.Cu) (net 14) (status 20)) (segment (start 20.958499 48.941501) (end 20.958499 63.858499) (width 0.254) (layer B.Cu) (net 14)) (segment (start 23 46.9) (end 20.958499 48.941501) (width 0.254) (layer B.Cu) (net 14) (status 10)) (segment (start 20.958499 82.858499) (end 23 84.9) (width 0.254) (layer B.Cu) (net 14) (status 20)) (segment (start 20.958499 67.941501) (end 20.958499 82.858499) (width 0.254) (layer B.Cu) (net 14)) (segment (start 23 65.9) (end 20.958499 67.941501) (width 0.254) (layer B.Cu) (net 14) (status 10)) (via (at 62.42 88.3) (size 0.8) (drill 0.4) (layers F.Cu B.Cu) (net 14)) (segment (start 32.13 84.9) (end 23 84.9) (width 0.254) (layer B.Cu) (net 14)) (segment (start 35.53 88.3) (end 32.13 84.9) (width 0.254) (layer B.Cu) (net 14)) (segment (start 62.42 88.3) (end 35.53 88.3) (width 0.254) (layer B.Cu) (net 14)) (segment (start 62.9 88.78) (end 62.42 88.3) (width 0.254) (layer F.Cu) (net 14)) (segment (start 62.9 89.7) (end 62.9 88.78) (width 0.254) (layer F.Cu) (net 14)) (segment (start 207.958499 51.858499) (end 210 53.9) (width 0.254) (layer B.Cu) (net 15) (status 20)) (segment (start 207.958499 36.941501) (end 207.958499 51.858499) (width 0.254) (layer B.Cu) (net 15)) (segment (start 210 34.9) (end 207.958499 36.941501) (width 0.254) (layer B.Cu) (net 15) (status 10)) (segment (start 207.958499 70.858499) (end 210 72.9) (width 0.254) (layer B.Cu) (net 15) (status 20)) (segment (start 207.958499 55.941501) (end 207.958499 70.858499) (width 0.254) (layer B.Cu) (net 15)) (segment (start 210 53.9) (end 207.958499 55.941501) (width 0.254) (layer B.Cu) (net 15) (status 10)) (segment (start 183.447011 70.602989) (end 171.167302 70.602989) (width 0.254) (layer F.Cu) (net 15)) (segment (start 151.918954 72.648979) (end 151.653001 72.914933) (width 0.254) (layer F.Cu) (net 15)) (segment (start 151.653001 72.914933) (end 151.203967 73.363967) (width 0.254) (layer F.Cu) (net 15)) (segment (start 151.203967 73.363967) (end 151.013967 73.553967) (width 0.254) (layer F.Cu) (net 15)) (segment (start 170.202989 71.567302) (end 171.167302 70.602989) (width 0.254) (layer F.Cu) (net 15)) (segment (start 169.121313 72.648979) (end 171.167303 70.602989) (width 0.254) (layer F.Cu) (net 15)) (segment (start 151.918954 72.648979) (end 169.121313 72.648979) (width 0.254) (layer F.Cu) (net 15)) (segment (start 171.167302 70.602989) (end 171.542989 70.602989) (width 0.254) (layer F.Cu) (net 15)) (segment (start 171.167303 70.602989) (end 171.542989 70.602989) (width 0.254) (layer F.Cu) (net 15)) (segment (start 203.867933 72.9) (end 210 72.9) (width 0.254) (layer F.Cu) (net 15) (status 20)) (segment (start 196.524932 65.556999) (end 203.867933 72.9) (width 0.254) (layer F.Cu) (net 15)) (segment (start 185.309368 70.602989) (end 190.355358 65.556999) (width 0.254) (layer F.Cu) (net 15)) (segment (start 190.355358 65.556999) (end 196.524932 65.556999) (width 0.254) (layer F.Cu) (net 15)) (segment (start 171.542989 70.602989) (end 185.309368 70.602989) (width 0.254) (layer F.Cu) (net 15)) (segment (start 149.970924 74.597011) (end 151.203967 73.363967) (width 0.254) (layer F.Cu) (net 15)) (segment (start 147.167302 74.597011) (end 149.970924 74.597011) (width 0.254) (layer F.Cu) (net 15)) (segment (start 144.48805 71.917761) (end 147.167302 74.597011) (width 0.254) (layer F.Cu) (net 15)) (segment (start 144.48805 63.08805) (end 144.48805 71.917761) (width 0.254) (layer F.Cu) (net 15)) (segment (start 144.365 62.965) (end 144.48805 63.08805) (width 0.254) (layer F.Cu) (net 15)) (segment (start 141.32 62.965) (end 144.365 62.965) (width 0.254) (layer F.Cu) (net 15) (status 10)) (segment (start 150.958499 53.858499) (end 153 55.9) (width 0.254) (layer B.Cu) (net 16) (status 20)) (segment (start 150.958499 38.941501) (end 150.958499 53.858499) (width 0.254) (layer B.Cu) (net 16)) (segment (start 153 36.9) (end 150.958499 38.941501) (width 0.254) (layer B.Cu) (net 16) (status 10)) (segment (start 150.958499 72.858499) (end 153 74.9) (width 0.254) (layer B.Cu) (net 16) (status 20)) (segment (start 150.958499 57.941501) (end 150.958499 72.858499) (width 0.254) (layer B.Cu) (net 16)) (segment (start 153 55.9) (end 150.958499 57.941501) (width 0.254) (layer B.Cu) (net 16) (status 10)) (segment (start 145.585239 99.474311) (end 144.95 100.10955) (width 0.254) (layer B.Cu) (net 16) (status 30)) (segment (start 145.585239 82.314761) (end 145.585239 99.474311) (width 0.254) (layer B.Cu) (net 16) (status 20)) (segment (start 153 74.9) (end 145.585239 82.314761) (width 0.254) (layer B.Cu) (net 16) (status 10)) (segment (start 151.654424 74.9) (end 153 74.9) (width 0.254) (layer F.Cu) (net 16) (status 20)) (segment (start 150.595384 75.959041) (end 151.654424 74.9) (width 0.254) (layer F.Cu) (net 16)) (segment (start 146.603131 75.959041) (end 150.595384 75.959041) (width 0.254) (layer F.Cu) (net 16)) (segment (start 143.12602 72.48193) (end 146.603131 75.959041) (width 0.254) (layer F.Cu) (net 16)) (segment (start 143.12602 66.94602) (end 143.12602 72.48193) (width 0.254) (layer F.Cu) (net 16)) (segment (start 142.955 66.775) (end 143.12602 66.94602) (width 0.254) (layer F.Cu) (net 16)) (segment (start 141.32 66.775) (end 142.955 66.775) (width 0.254) (layer F.Cu) (net 16) (status 10)) (segment (start 58.958499 45.858499) (end 61 47.9) (width 0.254) (layer B.Cu) (net 17) (status 20)) (segment (start 58.958499 30.941501) (end 58.958499 45.858499) (width 0.254) (layer B.Cu) (net 17)) (segment (start 61 28.9) (end 58.958499 30.941501) (width 0.254) (layer B.Cu) (net 17) (status 10)) (segment (start 58.958499 49.941501) (end 61 47.9) (width 0.254) (layer B.Cu) (net 17) (status 20)) (segment (start 58.958499 64.858499) (end 58.958499 49.941501) (width 0.254) (layer B.Cu) (net 17)) (segment (start 61 66.9) (end 58.958499 64.858499) (width 0.254) (layer B.Cu) (net 17) (status 10)) (via (at 64.418658 88.304301) (size 0.8) (drill 0.4) (layers F.Cu B.Cu) (net 17)) (segment (start 62.015999 67.915999) (end 61 66.9) (width 0.254) (layer B.Cu) (net 17)) (segment (start 62.015999 85.121961) (end 62.015999 67.915999) (width 0.254) (layer B.Cu) (net 17)) (segment (start 64.418658 87.52462) (end 62.015999 85.121961) (width 0.254) (layer B.Cu) (net 17)) (segment (start 64.418658 88.304301) (end 64.418658 87.52462) (width 0.254) (layer B.Cu) (net 17)) (segment (start 64.5 88.385643) (end 64.418658 88.304301) (width 0.254) (layer F.Cu) (net 17)) (segment (start 64.5 89.7) (end 64.5 88.385643) (width 0.254) (layer F.Cu) (net 17)) (segment (start 39.958499 55.941501) (end 42 53.9) (width 0.254) (layer B.Cu) (net 18) (status 20)) (segment (start 39.958499 70.858499) (end 39.958499 55.941501) (width 0.254) (layer B.Cu) (net 18)) (segment (start 39.958499 36.941501) (end 42 34.9) (width 0.254) (layer B.Cu) (net 18) (status 20)) (segment (start 39.958499 51.858499) (end 39.958499 36.941501) (width 0.254) (layer B.Cu) (net 18)) (segment (start 42 53.9) (end 39.958499 51.858499) (width 0.254) (layer B.Cu) (net 18) (status 10)) (segment (start 42 72.9) (end 39.958499 70.858499) (width 0.254) (layer B.Cu) (net 18) (status 10)) (segment (start 42 79.59) (end 42 72.9) (width 0.254) (layer B.Cu) (net 18)) (segment (start 50.25599 87.84599) (end 42 79.59) (width 0.254) (layer B.Cu) (net 18)) (segment (start 61.858981 87.572999) (end 61.58599 87.84599) (width 0.254) (layer B.Cu) (net 18)) (segment (start 61.58599 87.84599) (end 50.25599 87.84599) (width 0.254) (layer B.Cu) (net 18)) (via (at 63.182952 87.317048) (size 0.8) (drill 0.4) (layers F.Cu B.Cu) (net 18)) (segment (start 63.182952 87.98699) (end 63.182952 87.317048) (width 0.254) (layer F.Cu) (net 18)) (segment (start 63.7 88.504038) (end 63.182952 87.98699) (width 0.254) (layer F.Cu) (net 18)) (segment (start 63.7 89.7) (end 63.7 88.504038) (width 0.254) (layer F.Cu) (net 18)) (segment (start 62.114932 87.317048) (end 61.58599 87.84599) (width 0.254) (layer B.Cu) (net 18)) (segment (start 63.182952 87.317048) (end 62.114932 87.317048) (width 0.254) (layer B.Cu) (net 18)) (segment (start 77.958499 51.358499) (end 80 53.4) (width 0.254) (layer B.Cu) (net 19) (status 20)) (segment (start 77.958499 36.441501) (end 77.958499 51.358499) (width 0.254) (layer B.Cu) (net 19)) (segment (start 80 34.4) (end 77.958499 36.441501) (width 0.254) (layer B.Cu) (net 19) (status 10)) (segment (start 77.958499 70.358499) (end 80 72.4) (width 0.254) (layer B.Cu) (net 19) (status 20)) (segment (start 77.958499 55.441501) (end 77.958499 70.358499) (width 0.254) (layer B.Cu) (net 19)) (segment (start 80 53.4) (end 77.958499 55.441501) (width 0.254) (layer B.Cu) (net 19) (status 10)) (segment (start 86.958499 93.184493) (end 87.472968 93.698962) (width 0.254) (layer B.Cu) (net 19) (status 30)) (segment (start 86.958499 79.358499) (end 86.958499 93.184493) (width 0.254) (layer B.Cu) (net 19) (status 20)) (segment (start 80 72.4) (end 86.958499 79.358499) (width 0.254) (layer B.Cu) (net 19) (status 10)) (segment (start 66.765869 87.619121) (end 67.143909 87.997161) (width 0.254) (layer B.Cu) (net 19)) (segment (start 85.028742 92.600311) (end 85.294695 92.866265) (width 0.254) (layer B.Cu) (net 19)) (segment (start 71.313163 92.600311) (end 85.028742 92.600311) (width 0.254) (layer B.Cu) (net 19)) (segment (start 67.143909 88.431057) (end 71.313163 92.600311) (width 0.254) (layer B.Cu) (net 19)) (segment (start 86.127392 93.698962) (end 87.472968 93.698962) (width 0.254) (layer B.Cu) (net 19) (status 20)) (segment (start 85.294695 92.866265) (end 86.127392 93.698962) (width 0.254) (layer B.Cu) (net 19)) (via (at 65.39 87.23) (size 0.8) (drill 0.4) (layers F.Cu B.Cu) (net 19)) (segment (start 66.376748 87.23) (end 65.39 87.23) (width 0.254) (layer B.Cu) (net 19)) (segment (start 67.143909 87.997161) (end 66.376748 87.23) (width 0.254) (layer B.Cu) (net 19)) (segment (start 67.143909 87.997161) (end 67.143909 88.236091) (width 0.254) (layer B.Cu) (net 19)) (segment (start 67.143909 88.236091) (end 67.143909 88.431057) (width 0.254) (layer B.Cu) (net 19)) (segment (start 65.39 89.61) (end 65.3 89.7) (width 0.254) (layer F.Cu) (net 19)) (segment (start 65.39 87.23) (end 65.39 89.61) (width 0.254) (layer F.Cu) (net 19)) (segment (start 169.958499 51.358499) (end 172 53.4) (width 0.254) (layer B.Cu) (net 20) (status 20)) (segment (start 169.958499 36.441501) (end 169.958499 51.358499) (width 0.254) (layer B.Cu) (net 20)) (segment (start 172 34.4) (end 169.958499 36.441501) (width 0.254) (layer B.Cu) (net 20) (status 10)) (segment (start 169.958499 70.358499) (end 172 72.4) (width 0.254) (layer B.Cu) (net 20) (status 20)) (segment (start 169.958499 55.441501) (end 169.958499 70.358499) (width 0.254) (layer B.Cu) (net 20)) (segment (start 172 53.4) (end 169.958499 55.441501) (width 0.254) (layer B.Cu) (net 20) (status 10)) (segment (start 165.041501 93.184493) (end 164.527032 93.698962) (width 0.254) (layer B.Cu) (net 20) (status 30)) (segment (start 165.041501 79.358499) (end 165.041501 93.184493) (width 0.254) (layer B.Cu) (net 20) (status 20)) (segment (start 172 72.4) (end 165.041501 79.358499) (width 0.254) (layer B.Cu) (net 20) (status 10)) (segment (start 152.355359 73.556999) (end 151.656999 74.255359) (width 0.254) (layer F.Cu) (net 20)) (segment (start 170.654425 72.4) (end 172 72.4) (width 0.254) (layer F.Cu) (net 20) (status 20)) (segment (start 169.497426 73.556999) (end 170.654425 72.4) (width 0.254) (layer F.Cu) (net 20)) (segment (start 152.355359 73.556999) (end 169.497426 73.556999) (width 0.254) (layer F.Cu) (net 20)) (segment (start 150.407327 75.505031) (end 152.355359 73.556999) (width 0.254) (layer F.Cu) (net 20)) (segment (start 146.791187 75.505031) (end 150.407327 75.505031) (width 0.254) (layer F.Cu) (net 20)) (segment (start 143.58003 72.293874) (end 146.791187 75.505031) (width 0.254) (layer F.Cu) (net 20)) (segment (start 143.425 65.505) (end 143.58003 65.66003) (width 0.254) (layer F.Cu) (net 20)) (segment (start 143.58003 65.66003) (end 143.58003 72.293874) (width 0.254) (layer F.Cu) (net 20)) (segment (start 141.32 65.505) (end 143.425 65.505) (width 0.254) (layer F.Cu) (net 20) (status 10)) (segment (start 188.958499 45.858499) (end 191 47.9) (width 0.254) (layer B.Cu) (net 21) (status 20)) (segment (start 188.958499 30.941501) (end 188.958499 45.858499) (width 0.254) (layer B.Cu) (net 21)) (segment (start 191 28.9) (end 188.958499 30.941501) (width 0.254) (layer B.Cu) (net 21) (status 10)) (segment (start 188.958499 64.858499) (end 191 66.9) (width 0.254) (layer B.Cu) (net 21) (status 20)) (segment (start 188.958499 49.941501) (end 188.958499 64.858499) (width 0.254) (layer B.Cu) (net 21)) (segment (start 191 47.9) (end 188.958499 49.941501) (width 0.254) (layer B.Cu) (net 21) (status 10)) (segment (start 152.107011 73.102989) (end 151.065 74.145) (width 0.254) (layer F.Cu) (net 21)) (segment (start 151.065 74.145) (end 150.88 74.33) (width 0.254) (layer F.Cu) (net 21)) (segment (start 170.656999 71.755359) (end 171.355359 71.056999) (width 0.254) (layer F.Cu) (net 21)) (segment (start 169.309369 73.102989) (end 171.355359 71.056999) (width 0.254) (layer F.Cu) (net 21)) (segment (start 152.107011 73.102989) (end 169.309369 73.102989) (width 0.254) (layer F.Cu) (net 21)) (segment (start 189.654424 66.9) (end 191 66.9) (width 0.254) (layer F.Cu) (net 21) (status 20)) (segment (start 185.497425 71.056999) (end 189.654424 66.9) (width 0.254) (layer F.Cu) (net 21)) (segment (start 171.355359 71.056999) (end 185.497425 71.056999) (width 0.254) (layer F.Cu) (net 21)) (segment (start 150.158981 75.051021) (end 151.065 74.145) (width 0.254) (layer F.Cu) (net 21)) (segment (start 146.979245 75.051021) (end 150.158981 75.051021) (width 0.254) (layer F.Cu) (net 21)) (segment (start 144.03404 72.105817) (end 146.979245 75.051021) (width 0.254) (layer F.Cu) (net 21)) (segment (start 144.03404 64.39404) (end 144.03404 72.105817) (width 0.254) (layer F.Cu) (net 21)) (segment (start 143.875 64.235) (end 144.03404 64.39404) (width 0.254) (layer F.Cu) (net 21)) (segment (start 141.32 64.235) (end 143.875 64.235) (width 0.254) (layer F.Cu) (net 21) (status 10)) (segment (start 42.01 81.79) (end 42 81.8) (width 0.254) (layer F.Cu) (net 22) (tstamp 5EDCC251) (status 30)) (segment (start 42.01 78.86) (end 42.01 81.79) (width 0.254) (layer F.Cu) (net 22) (tstamp 5EDCC61A) (status 30)) (segment (start 42 81.8) (end 42 81.11) (width 0.254) (layer F.Cu) (net 22) (tstamp 5EDCC320) (status 10)) (segment (start 58.91 80.69) (end 58.8 80.8) (width 0.254) (layer F.Cu) (net 22) (tstamp 5EDCC60E) (status 30)) (segment (start 59.897999 80.515603) (end 59.613602 80.8) (width 0.254) (layer F.Cu) (net 22)) (segment (start 59.897999 78.647999) (end 59.897999 80.515603) (width 0.254) (layer F.Cu) (net 22)) (segment (start 55.64198 74.39198) (end 59.897999 78.647999) (width 0.254) (layer F.Cu) (net 22)) (segment (start 59.613602 80.8) (end 58.8 80.8) (width 0.254) (layer F.Cu) (net 22) (status 20)) (segment (start 47.796151 74.39198) (end 55.64198 74.39198) (width 0.254) (layer F.Cu) (net 22)) (segment (start 44.355142 77.83299) (end 47.796151 74.39198) (width 0.254) (layer F.Cu) (net 22)) (segment (start 43.03701 77.83299) (end 44.355142 77.83299) (width 0.254) (layer F.Cu) (net 22)) (segment (start 42.01 78.86) (end 43.03701 77.83299) (width 0.254) (layer F.Cu) (net 22) (status 10)) (segment (start 68.69 89.89) (end 68.5 89.7) (width 0.254) (layer F.Cu) (net 23) (tstamp 5EDCC36E) (status 30)) (segment (start 72.705 89.7) (end 72.875 89.87) (width 0.254) (layer F.Cu) (net 23) (status 30)) (segment (start 68.5 89.7) (end 72.705 89.7) (width 0.254) (layer F.Cu) (net 23) (status 30)) (segment (start 226.958499 63.858499) (end 229 65.9) (width 0.254) (layer B.Cu) (net 24) (status 20)) (segment (start 226.958499 48.941501) (end 226.958499 63.858499) (width 0.254) (layer B.Cu) (net 24)) (segment (start 229 46.9) (end 226.958499 48.941501) (width 0.254) (layer B.Cu) (net 24) (status 10)) (segment (start 226.958499 82.858499) (end 229 84.9) (width 0.254) (layer B.Cu) (net 24) (status 20)) (segment (start 226.958499 67.941501) (end 226.958499 82.858499) (width 0.254) (layer B.Cu) (net 24)) (segment (start 229 65.9) (end 226.958499 67.941501) (width 0.254) (layer B.Cu) (net 24) (status 10)) (segment (start 229 84.9) (end 224.112358 84.9) (width 0.254) (layer F.Cu) (net 24) (status 10)) (segment (start 224.112358 84.9) (end 210.769357 71.556999) (width 0.254) (layer F.Cu) (net 24)) (segment (start 170.979245 70.14898) (end 168.933256 72.194969) (width 0.254) (layer F.Cu) (net 24)) (segment (start 190.167302 65.102989) (end 185.121312 70.14898) (width 0.254) (layer F.Cu) (net 24)) (segment (start 210.769357 71.556999) (end 209.355359 71.556999) (width 0.254) (layer F.Cu) (net 24)) (segment (start 204.055989 72.44599) (end 196.712989 65.10299) (width 0.254) (layer F.Cu) (net 24)) (segment (start 209.355359 71.556999) (end 208.466368 72.44599) (width 0.254) (layer F.Cu) (net 24)) (segment (start 196.712989 65.10299) (end 190.167302 65.102989) (width 0.254) (layer F.Cu) (net 24)) (segment (start 208.466368 72.44599) (end 204.055989 72.44599) (width 0.254) (layer F.Cu) (net 24)) (segment (start 185.121312 70.14898) (end 170.979245 70.14898) (width 0.254) (layer F.Cu) (net 24)) (segment (start 168.933256 72.194969) (end 151.730899 72.194969) (width 0.254) (layer F.Cu) (net 24)) (segment (start 151.730899 72.194969) (end 149.782867 74.143001) (width 0.254) (layer F.Cu) (net 24)) (segment (start 147.373001 74.143001) (end 144.94206 71.71206) (width 0.254) (layer F.Cu) (net 24)) (segment (start 147.993001 74.143001) (end 147.373001 74.143001) (width 0.254) (layer F.Cu) (net 24)) (segment (start 149.782867 74.143001) (end 147.993001 74.143001) (width 0.254) (layer F.Cu) (net 24)) (segment (start 147.355359 74.143001) (end 147.993001 74.143001) (width 0.254) (layer F.Cu) (net 24)) (segment (start 144.94206 61.79206) (end 144.845 61.695) (width 0.254) (layer F.Cu) (net 24)) (segment (start 144.845 61.695) (end 141.32 61.695) (width 0.254) (layer F.Cu) (net 24) (status 20)) (segment (start 144.94206 71.68206) (end 144.94206 61.79206) (width 0.254) (layer F.Cu) (net 24)) (segment (start 42.722999 23.322999) (end 43.65 24.25) (width 0.254) (layer F.Cu) (net 25) (status 20)) (segment (start 37.577001 23.322999) (end 42.722999 23.322999) (width 0.254) (layer F.Cu) (net 25)) (segment (start 24.65 36.25) (end 37.577001 23.322999) (width 0.254) (layer F.Cu) (net 25) (status 10)) (segment (start 61.722999 17.322999) (end 62.65 18.25) (width 0.254) (layer F.Cu) (net 25) (status 20)) (segment (start 50.577001 17.322999) (end 61.722999 17.322999) (width 0.254) (layer F.Cu) (net 25)) (segment (start 43.65 24.25) (end 50.577001 17.322999) (width 0.254) (layer F.Cu) (net 25) (status 10)) (segment (start 75.877699 17.977699) (end 81.65 23.75) (width 0.254) (layer F.Cu) (net 25) (status 20)) (segment (start 62.922301 17.977699) (end 75.877699 17.977699) (width 0.254) (layer F.Cu) (net 25) (status 10)) (segment (start 62.65 18.25) (end 62.922301 17.977699) (width 0.254) (layer F.Cu) (net 25) (status 30)) (segment (start 97.877699 23.477699) (end 100.65 26.25) (width 0.254) (layer F.Cu) (net 25) (status 20)) (segment (start 81.922301 23.477699) (end 97.877699 23.477699) (width 0.254) (layer F.Cu) (net 25) (status 10)) (segment (start 81.65 23.75) (end 81.922301 23.477699) (width 0.254) (layer F.Cu) (net 25) (status 30)) (segment (start 23.418989 73.511011) (end 23.418989 73.151011) (width 0.254) (layer F.Cu) (net 25)) (segment (start 23.418989 75.118989) (end 23.41899 75.299658) (width 0.254) (layer F.Cu) (net 25)) (segment (start 23.418989 75.299658) (end 23.418989 75.118989) (width 0.254) (layer F.Cu) (net 25)) (segment (start 23.418989 75.118989) (end 23.418989 73.511011) (width 0.254) (layer F.Cu) (net 25)) (segment (start 23.41899 73.200342) (end 23.418989 73.511011) (width 0.254) (layer F.Cu) (net 25)) (segment (start 25.041501 71.577831) (end 23.41899 73.200342) (width 0.254) (layer F.Cu) (net 25)) (segment (start 25.041501 59.020079) (end 25.041501 71.577831) (width 0.254) (layer F.Cu) (net 25)) (segment (start 24.19599 58.174568) (end 25.041501 59.020079) (width 0.254) (layer F.Cu) (net 25)) (segment (start 24.19599 56.38599) (end 24.19599 58.174568) (width 0.254) (layer F.Cu) (net 25)) (segment (start 24.08 56.27) (end 24.19599 56.38599) (width 0.254) (layer F.Cu) (net 25)) (segment (start 23.872999 48.014643) (end 23.872999 56.111601) (width 0.254) (layer F.Cu) (net 25)) (segment (start 25.041501 46.846141) (end 23.872999 48.014643) (width 0.254) (layer F.Cu) (net 25)) (segment (start 25.041501 36.641501) (end 25.041501 46.846141) (width 0.254) (layer F.Cu) (net 25) (status 10)) (segment (start 24.031398 56.27) (end 24.08 56.27) (width 0.254) (layer F.Cu) (net 25)) (segment (start 23.872999 56.111601) (end 24.031398 56.27) (width 0.254) (layer F.Cu) (net 25)) (segment (start 24.65 36.25) (end 25.041501 36.641501) (width 0.254) (layer F.Cu) (net 25) (status 30)) (segment (start 60.5 78.3) (end 60.192067 78.3) (width 0.254) (layer F.Cu) (net 25) (status 10)) (segment (start 60.192067 78.3) (end 56.376033 74.483967) (width 0.254) (layer F.Cu) (net 25)) (segment (start 56.376033 74.483967) (end 55.830037 73.93797) (width 0.254) (layer F.Cu) (net 25)) (segment (start 55.830037 73.93797) (end 48.25203 73.93797) (width 0.254) (layer F.Cu) (net 25)) (segment (start 48.25203 73.93797) (end 47.608094 73.93797) (width 0.254) (layer F.Cu) (net 25)) (segment (start 48.25203 73.93797) (end 47.96 73.93797) (width 0.254) (layer F.Cu) (net 25)) (segment (start 24.64965 76.53032) (end 23.924665 75.805335) (width 0.254) (layer F.Cu) (net 25)) (segment (start 45.015744 76.53032) (end 24.64965 76.53032) (width 0.254) (layer F.Cu) (net 25)) (segment (start 47.608094 73.93797) (end 45.015744 76.53032) (width 0.254) (layer F.Cu) (net 25)) (segment (start 23.924665 75.805335) (end 24.649652 76.530321) (width 0.254) (layer F.Cu) (net 25)) (segment (start 23.41899 75.299658) (end 23.924665 75.805335) (width 0.254) (layer F.Cu) (net 25)) (segment (start 172.722999 22.822999) (end 173.65 23.75) (width 0.254) (layer F.Cu) (net 26) (status 20)) (segment (start 158.077001 22.822999) (end 172.722999 22.822999) (width 0.254) (layer F.Cu) (net 26)) (segment (start 154.65 26.25) (end 158.077001 22.822999) (width 0.254) (layer F.Cu) (net 26) (status 10)) (segment (start 205.377699 17.977699) (end 211.65 24.25) (width 0.254) (layer F.Cu) (net 26) (status 20)) (segment (start 192.922301 17.977699) (end 205.377699 17.977699) (width 0.254) (layer F.Cu) (net 26) (status 10)) (segment (start 192.65 18.25) (end 192.922301 17.977699) (width 0.254) (layer F.Cu) (net 26) (status 30)) (segment (start 218.377699 23.977699) (end 230.65 36.25) (width 0.254) (layer F.Cu) (net 26) (status 20)) (segment (start 211.922301 23.977699) (end 218.377699 23.977699) (width 0.254) (layer F.Cu) (net 26) (status 10)) (segment (start 211.65 24.25) (end 211.922301 23.977699) (width 0.254) (layer F.Cu) (net 26) (status 30)) (segment (start 191.722999 17.322999) (end 192.65 18.25) (width 0.254) (layer F.Cu) (net 26) (status 20)) (segment (start 180.077001 17.322999) (end 191.722999 17.322999) (width 0.254) (layer F.Cu) (net 26)) (segment (start 173.65 23.75) (end 180.077001 17.322999) (width 0.254) (layer F.Cu) (net 26) (status 10)) (segment (start 155.041501 43.219897) (end 155.041501 26.641501) (width 0.254) (layer F.Cu) (net 26) (status 20)) (segment (start 155.041501 26.641501) (end 154.65 26.25) (width 0.254) (layer F.Cu) (net 26) (status 30)) (segment (start 152.061601 46.177001) (end 152.14 46.098602) (width 0.254) (layer F.Cu) (net 26)) (segment (start 153.465407 44.795991) (end 154.205699 44.055699) (width 0.254) (layer F.Cu) (net 26)) (segment (start 153.442612 44.795991) (end 153.465407 44.795991) (width 0.254) (layer F.Cu) (net 26)) (segment (start 152.061601 46.177001) (end 153.442612 44.795991) (width 0.254) (layer F.Cu) (net 26)) (segment (start 154.205699 44.055699) (end 155.041501 43.219897) (width 0.254) (layer F.Cu) (net 26)) (segment (start 153.872999 44.388399) (end 154.205699 44.055699) (width 0.254) (layer F.Cu) (net 26)) (segment (start 132.64701 58.51201) (end 132.02 57.885) (width 0.254) (layer F.Cu) (net 26) (status 20)) (segment (start 145.215924 58.51201) (end 132.64701 58.51201) (width 0.254) (layer F.Cu) (net 26)) (segment (start 149.470009 54.257925) (end 145.215924 58.51201) (width 0.254) (layer F.Cu) (net 26)) (segment (start 149.470009 47.772057) (end 149.470009 54.257925) (width 0.254) (layer F.Cu) (net 26)) (segment (start 149.487943 47.772057) (end 149.470009 47.772057) (width 0.254) (layer F.Cu) (net 26)) (segment (start 151.082999 46.177001) (end 149.487943 47.772057) (width 0.254) (layer F.Cu) (net 26)) (segment (start 152.061601 46.177001) (end 151.082999 46.177001) (width 0.254) (layer F.Cu) (net 26)) (segment (start 172.722999 41.822999) (end 173.65 42.75) (width 0.254) (layer F.Cu) (net 27) (status 20)) (segment (start 158.077001 41.822999) (end 172.722999 41.822999) (width 0.254) (layer F.Cu) (net 27)) (segment (start 154.65 45.25) (end 158.077001 41.822999) (width 0.254) (layer F.Cu) (net 27) (status 10)) (segment (start 191.722999 36.322999) (end 192.65 37.25) (width 0.254) (layer F.Cu) (net 27) (status 20)) (segment (start 180.077001 36.322999) (end 191.722999 36.322999) (width 0.254) (layer F.Cu) (net 27)) (segment (start 173.65 42.75) (end 180.077001 36.322999) (width 0.254) (layer F.Cu) (net 27) (status 10)) (segment (start 205.377699 36.977699) (end 211.65 43.25) (width 0.254) (layer F.Cu) (net 27) (status 20)) (segment (start 192.922301 36.977699) (end 205.377699 36.977699) (width 0.254) (layer F.Cu) (net 27) (status 10)) (segment (start 192.65 37.25) (end 192.922301 36.977699) (width 0.254) (layer F.Cu) (net 27) (status 30)) (segment (start 218.377699 42.977699) (end 230.65 55.25) (width 0.254) (layer F.Cu) (net 27) (status 20)) (segment (start 211.922301 42.977699) (end 218.377699 42.977699) (width 0.254) (layer F.Cu) (net 27) (status 10)) (segment (start 211.65 43.25) (end 211.922301 42.977699) (width 0.254) (layer F.Cu) (net 27) (status 30)) (segment (start 153.630669 45.25) (end 154.65 45.25) (width 0.254) (layer F.Cu) (net 27) (status 20)) (segment (start 152.249658 46.631011) (end 153.630669 45.25) (width 0.254) (layer F.Cu) (net 27)) (segment (start 151.271055 46.631011) (end 152.249658 46.631011) (width 0.254) (layer F.Cu) (net 27)) (segment (start 149.924019 47.978047) (end 151.271055 46.631011) (width 0.254) (layer F.Cu) (net 27)) (segment (start 144.58799 59.78201) (end 149.924019 54.445981) (width 0.254) (layer F.Cu) (net 27)) (segment (start 132.64701 59.78201) (end 144.58799 59.78201) (width 0.254) (layer F.Cu) (net 27)) (segment (start 149.924019 54.445981) (end 149.924019 47.978047) (width 0.254) (layer F.Cu) (net 27)) (segment (start 132.02 59.155) (end 132.64701 59.78201) (width 0.254) (layer F.Cu) (net 27) (status 10)) (segment (start 37.577001 42.322999) (end 24.65 55.25) (width 0.254) (layer F.Cu) (net 28) (status 20)) (segment (start 42.722999 42.322999) (end 37.577001 42.322999) (width 0.254) (layer F.Cu) (net 28)) (segment (start 43.65 43.25) (end 42.722999 42.322999) (width 0.254) (layer F.Cu) (net 28) (status 10)) (segment (start 61.722999 36.322999) (end 62.65 37.25) (width 0.254) (layer F.Cu) (net 28) (status 20)) (segment (start 50.577001 36.322999) (end 61.722999 36.322999) (width 0.254) (layer F.Cu) (net 28)) (segment (start 43.65 43.25) (end 50.577001 36.322999) (width 0.254) (layer F.Cu) (net 28) (status 10)) (segment (start 75.877699 36.977699) (end 81.65 42.75) (width 0.254) (layer F.Cu) (net 28) (status 20)) (segment (start 62.922301 36.977699) (end 75.877699 36.977699) (width 0.254) (layer F.Cu) (net 28) (status 10)) (segment (start 62.65 37.25) (end 62.922301 36.977699) (width 0.254) (layer F.Cu) (net 28) (status 30)) (segment (start 97.877699 42.477699) (end 100.65 45.25) (width 0.254) (layer F.Cu) (net 28) (status 20)) (segment (start 81.922301 42.477699) (end 97.877699 42.477699) (width 0.254) (layer F.Cu) (net 28) (status 10)) (segment (start 81.65 42.75) (end 81.922301 42.477699) (width 0.254) (layer F.Cu) (net 28) (status 30)) (segment (start 25.041501 72.219897) (end 23.872999 73.388399) (width 0.254) (layer F.Cu) (net 28)) (segment (start 24.260699 75.499301) (end 24.837709 76.076311) (width 0.254) (layer F.Cu) (net 28)) (segment (start 23.872999 75.111601) (end 24.260699 75.499301) (width 0.254) (layer F.Cu) (net 28)) (segment (start 24.260699 75.499301) (end 24.383699 75.622301) (width 0.254) (layer F.Cu) (net 28)) (segment (start 61.226999 77.222999) (end 61.3 77.296) (width 0.254) (layer F.Cu) (net 28) (tstamp 5EDCC37A)) (segment (start 60.065066 77.222999) (end 61.226999 77.222999) (width 0.254) (layer F.Cu) (net 28) (tstamp 5EDCC269)) (segment (start 61.3 77.296) (end 61.3 78.3) (width 0.254) (layer F.Cu) (net 28) (tstamp 5EDCC323) (status 20)) (segment (start 24.65 57.986511) (end 24.65 55.25) (width 0.254) (layer F.Cu) (net 28) (status 20)) (segment (start 61.217967 77.213967) (end 59.748099 77.213967) (width 0.254) (layer F.Cu) (net 28)) (segment (start 61.3 77.296) (end 61.217967 77.213967) (width 0.254) (layer F.Cu) (net 28)) (segment (start 47.420037 73.48396) (end 47.154084 73.749914) (width 0.254) (layer F.Cu) (net 28)) (segment (start 59.748099 77.213967) (end 56.402066 73.867934) (width 0.254) (layer F.Cu) (net 28)) (segment (start 56.018094 73.48396) (end 47.420037 73.48396) (width 0.254) (layer F.Cu) (net 28)) (segment (start 56.402066 73.867934) (end 56.018094 73.48396) (width 0.254) (layer F.Cu) (net 28)) (segment (start 25.495511 58.832022) (end 24.65 57.986511) (width 0.254) (layer F.Cu) (net 28)) (segment (start 23.872999 73.388399) (end 25.495511 71.765888) (width 0.254) (layer F.Cu) (net 28)) (segment (start 23.872999 75.111601) (end 23.872999 73.388399) (width 0.254) (layer F.Cu) (net 28)) (segment (start 25.495511 71.765888) (end 25.495511 58.832022) (width 0.254) (layer F.Cu) (net 28)) (segment (start 24.837708 76.07631) (end 23.872999 75.111601) (width 0.254) (layer F.Cu) (net 28)) (segment (start 44.827688 76.07631) (end 24.837708 76.07631) (width 0.254) (layer F.Cu) (net 28)) (segment (start 47.154084 73.749914) (end 44.827688 76.07631) (width 0.254) (layer F.Cu) (net 28)) (segment (start 42.722999 61.322999) (end 43.65 62.25) (width 0.254) (layer F.Cu) (net 29) (status 20)) (segment (start 36.723001 61.322999) (end 42.722999 61.322999) (width 0.254) (layer F.Cu) (net 29)) (segment (start 24.65 73.396) (end 36.723001 61.322999) (width 0.254) (layer F.Cu) (net 29)) (segment (start 24.65 74.25) (end 24.65 73.396) (width 0.254) (layer F.Cu) (net 29) (status 10)) (segment (start 61.722999 55.322999) (end 62.65 56.25) (width 0.254) (layer F.Cu) (net 29) (status 20)) (segment (start 50.577001 55.322999) (end 61.722999 55.322999) (width 0.254) (layer F.Cu) (net 29)) (segment (start 43.65 62.25) (end 50.577001 55.322999) (width 0.254) (layer F.Cu) (net 29) (status 10)) (segment (start 75.877699 55.977699) (end 81.65 61.75) (width 0.254) (layer F.Cu) (net 29) (status 20)) (segment (start 62.922301 55.977699) (end 75.877699 55.977699) (width 0.254) (layer F.Cu) (net 29) (status 10)) (segment (start 62.65 56.25) (end 62.922301 55.977699) (width 0.254) (layer F.Cu) (net 29) (status 30)) (segment (start 97.877699 61.477699) (end 100.65 64.25) (width 0.254) (layer F.Cu) (net 29) (status 20)) (segment (start 81.922301 61.477699) (end 97.877699 61.477699) (width 0.254) (layer F.Cu) (net 29) (status 10)) (segment (start 81.65 61.75) (end 81.922301 61.477699) (width 0.254) (layer F.Cu) (net 29) (status 30)) (segment (start 24.65 74.25) (end 24.65 75.104) (width 0.254) (layer F.Cu) (net 29) (status 10)) (segment (start 24.65 75.246536) (end 24.65 74.25) (width 0.254) (layer F.Cu) (net 29) (status 20)) (segment (start 44.63963 75.6223) (end 25.025764 75.6223) (width 0.254) (layer F.Cu) (net 29)) (segment (start 47.23198 73.02995) (end 44.63963 75.6223) (width 0.254) (layer F.Cu) (net 29)) (segment (start 56.206151 73.02995) (end 47.23198 73.02995) (width 0.254) (layer F.Cu) (net 29)) (segment (start 59.712999 76.536801) (end 56.206151 73.02995) (width 0.254) (layer F.Cu) (net 29)) (segment (start 59.936155 76.759957) (end 59.712999 76.536801) (width 0.254) (layer F.Cu) (net 29)) (segment (start 61.406024 76.759957) (end 59.936155 76.759957) (width 0.254) (layer F.Cu) (net 29)) (segment (start 25.025764 75.6223) (end 24.65 75.246536) (width 0.254) (layer F.Cu) (net 29)) (segment (start 62.1 77.453933) (end 61.406024 76.759957) (width 0.254) (layer F.Cu) (net 29)) (segment (start 62.1 78.3) (end 62.1 77.453933) (width 0.254) (layer F.Cu) (net 29) (status 10)) (segment (start 113.728942 91.03218) (end 113.728942 91.725) (width 0.254) (layer F.Cu) (net 30) (status 30)) (segment (start 106.523813 83.827051) (end 113.728942 91.03218) (width 0.254) (layer F.Cu) (net 30) (status 20)) (segment (start 91.793778 83.827051) (end 106.523813 83.827051) (width 0.254) (layer F.Cu) (net 30) (status 10)) (segment (start 71.4 82.4) (end 70.2 82.4) (width 0.254) (layer F.Cu) (net 30) (tstamp 5EDCC1FD) (status 20)) (segment (start 71.99299 81.80701) (end 71.4 82.4) (width 0.254) (layer F.Cu) (net 30) (tstamp 5EDCC19D)) (segment (start 89.773737 81.80701) (end 71.99299 81.80701) (width 0.254) (layer F.Cu) (net 30) (tstamp 5EDCC24B)) (segment (start 91.793778 83.827051) (end 89.773737 81.80701) (width 0.254) (layer F.Cu) (net 30) (status 10)) (segment (start 163.174846 82.854017) (end 163.343778 83.022949) (width 0.254) (layer F.Cu) (net 31) (status 30)) (segment (start 148.57089 82.533052) (end 141.028942 90.075) (width 0.254) (layer F.Cu) (net 31) (status 20)) (segment (start 162.853881 82.533052) (end 148.57089 82.533052) (width 0.254) (layer F.Cu) (net 31) (status 10)) (segment (start 163.343778 83.022949) (end 162.853881 82.533052) (width 0.254) (layer F.Cu) (net 31) (status 30)) (segment (start 142.67201 88.431932) (end 141.028942 90.075) (width 0.254) (layer F.Cu) (net 31) (status 20)) (segment (start 142.67201 67.55603) (end 142.67201 88.431932) (width 0.254) (layer F.Cu) (net 31)) (segment (start 142.51799 67.40201) (end 142.67201 67.55603) (width 0.254) (layer F.Cu) (net 31)) (segment (start 139.95299 67.33299) (end 140.02201 67.40201) (width 0.254) (layer F.Cu) (net 31)) (segment (start 140.02201 67.40201) (end 142.51799 67.40201) (width 0.254) (layer F.Cu) (net 31)) (segment (start 139.95299 62.44299) (end 139.95299 67.33299) (width 0.254) (layer F.Cu) (net 31)) (segment (start 139.83201 62.32201) (end 139.95299 62.44299) (width 0.254) (layer F.Cu) (net 31)) (segment (start 132.64701 62.32201) (end 139.83201 62.32201) (width 0.254) (layer F.Cu) (net 31)) (segment (start 132.02 61.695) (end 132.64701 62.32201) (width 0.254) (layer F.Cu) (net 31) (status 10)) (segment (start 172.722999 60.822999) (end 173.65 61.75) (width 0.254) (layer F.Cu) (net 32) (status 20)) (segment (start 158.077001 60.822999) (end 172.722999 60.822999) (width 0.254) (layer F.Cu) (net 32)) (segment (start 154.65 64.25) (end 158.077001 60.822999) (width 0.254) (layer F.Cu) (net 32) (status 10)) (segment (start 191.722999 55.322999) (end 192.65 56.25) (width 0.254) (layer F.Cu) (net 32) (status 20)) (segment (start 180.077001 55.322999) (end 191.722999 55.322999) (width 0.254) (layer F.Cu) (net 32)) (segment (start 173.65 61.75) (end 180.077001 55.322999) (width 0.254) (layer F.Cu) (net 32) (status 10)) (segment (start 205.377699 55.977699) (end 211.65 62.25) (width 0.254) (layer F.Cu) (net 32) (status 20)) (segment (start 192.922301 55.977699) (end 205.377699 55.977699) (width 0.254) (layer F.Cu) (net 32) (status 10)) (segment (start 192.65 56.25) (end 192.922301 55.977699) (width 0.254) (layer F.Cu) (net 32) (status 30)) (segment (start 218.377699 61.977699) (end 230.65 74.25) (width 0.254) (layer F.Cu) (net 32) (status 20)) (segment (start 211.922301 61.977699) (end 218.377699 61.977699) (width 0.254) (layer F.Cu) (net 32) (status 10)) (segment (start 211.65 62.25) (end 211.922301 61.977699) (width 0.254) (layer F.Cu) (net 32) (status 30)) (segment (start 151.45201 61.05201) (end 154.65 64.25) (width 0.254) (layer F.Cu) (net 32) (status 20)) (segment (start 132.64701 61.05201) (end 151.45201 61.05201) (width 0.254) (layer F.Cu) (net 32)) (segment (start 132.02 60.425) (end 132.64701 61.05201) (width 0.254) (layer F.Cu) (net 32) (status 10)) (segment (start 133.2 76.475) (end 133.225 76.45) (width 0.381) (layer F.Cu) (net 33) (status 30)) (segment (start 133.2 78.4) (end 133.2 76.475) (width 0.381) (layer F.Cu) (net 33) (status 30)) (segment (start 133.045 68.045) (end 132.02 68.045) (width 0.381) (layer F.Cu) (net 33) (status 20)) (segment (start 134.510501 69.510501) (end 133.045 68.045) (width 0.381) (layer F.Cu) (net 33)) (segment (start 134.510501 75.164499) (end 134.510501 69.510501) (width 0.381) (layer F.Cu) (net 33)) (segment (start 133.225 76.45) (end 134.510501 75.164499) (width 0.381) (layer F.Cu) (net 33) (status 10)) (segment (start 139.375 76.45) (end 137.325 76.45) (width 0.381) (layer F.Cu) (net 33) (status 30)) (segment (start 134.30949 75.73469) (end 134.30949 77.32949) (width 0.381) (layer F.Cu) (net 33)) (segment (start 134.510501 75.533679) (end 134.30949 75.73469) (width 0.381) (layer F.Cu) (net 33)) (segment (start 134.510501 75.164499) (end 134.510501 75.533679) (width 0.381) (layer F.Cu) (net 33)) (segment (start 134.848182 77.868183) (end 134.80949 77.906875) (width 0.381) (layer F.Cu) (net 33)) (segment (start 134.30949 77.32949) (end 134.848182 77.868183) (width 0.381) (layer F.Cu) (net 33)) (segment (start 139.375 77.108635) (end 139.375 76.45) (width 0.381) (layer F.Cu) (net 33) (status 30)) (segment (start 136.893125 79.59051) (end 139.375 77.108635) (width 0.381) (layer F.Cu) (net 33) (status 20)) (segment (start 135.506875 79.59051) (end 136.893125 79.59051) (width 0.381) (layer F.Cu) (net 33)) (segment (start 134.80949 78.893125) (end 135.506875 79.59051) (width 0.381) (layer F.Cu) (net 33)) (segment (start 134.80949 77.906875) (end 134.80949 78.893125) (width 0.381) (layer F.Cu) (net 33)) (segment (start 141.59051 76.61551) (end 141.425 76.45) (width 0.381) (layer F.Cu) (net 34) (status 30)) (segment (start 141.59051 82.70949) (end 141.59051 76.61551) (width 0.381) (layer F.Cu) (net 34) (status 30)) (segment (start 141.3 83) (end 141.59051 82.70949) (width 0.381) (layer F.Cu) (net 34) (status 30)) (segment (start 141.425 74.5) (end 141.32 74.395) (width 0.381) (layer F.Cu) (net 34) (status 30)) (segment (start 141.32 74.395) (end 141.32 73.125) (width 0.381) (layer F.Cu) (net 34) (status 30)) (segment (start 141.32 73.125) (end 141.32 71.855) (width 0.381) (layer F.Cu) (net 34) (status 30)) (segment (start 131.175 78.258635) (end 131.175 76.45) (width 0.381) (layer F.Cu) (net 34) (status 20)) (segment (start 135.916365 83) (end 131.175 78.258635) (width 0.381) (layer F.Cu) (net 34)) (segment (start 141.3 83) (end 135.916365 83) (width 0.381) (layer F.Cu) (net 34) (status 10)) (segment (start 131.500602 69.315) (end 132.02 69.315) (width 0.381) (layer F.Cu) (net 34) (status 30)) (segment (start 130.60449 70.211112) (end 131.500602 69.315) (width 0.381) (layer F.Cu) (net 34) (status 20)) (segment (start 130.60449 75.87949) (end 130.60449 70.211112) (width 0.381) (layer F.Cu) (net 34)) (segment (start 131.175 76.45) (end 130.60449 75.87949) (width 0.381) (layer F.Cu) (net 34) (status 10)) (segment (start 141.425 76.45) (end 141.425 74.5) (width 0.381) (layer F.Cu) (net 34) (status 30)) (segment (start 19.015999 43.784001) (end 19.015999 38.584001) (width 0.254) (layer F.Cu) (net 35)) (segment (start 19.015999 38.584001) (end 21.35 36.25) (width 0.254) (layer F.Cu) (net 35) (status 20)) (segment (start 18 44.8) (end 19.015999 43.784001) (width 0.254) (layer F.Cu) (net 35) (status 10)) (segment (start 38.015999 26.584001) (end 40.35 24.25) (width 0.254) (layer F.Cu) (net 36) (status 20)) (segment (start 38.015999 31.784001) (end 38.015999 26.584001) (width 0.254) (layer F.Cu) (net 36)) (segment (start 37 32.8) (end 38.015999 31.784001) (width 0.254) (layer F.Cu) (net 36) (status 10)) (segment (start 57.015999 20.584001) (end 59.35 18.25) (width 0.254) (layer F.Cu) (net 37) (status 20)) (segment (start 57.015999 25.784001) (end 57.015999 20.584001) (width 0.254) (layer F.Cu) (net 37)) (segment (start 56 26.8) (end 57.015999 25.784001) (width 0.254) (layer F.Cu) (net 37) (status 10)) (segment (start 76.015999 26.084001) (end 78.35 23.75) (width 0.254) (layer F.Cu) (net 38) (status 20)) (segment (start 76.015999 31.284001) (end 76.015999 26.084001) (width 0.254) (layer F.Cu) (net 38)) (segment (start 75 32.3) (end 76.015999 31.284001) (width 0.254) (layer F.Cu) (net 38) (status 10)) (segment (start 149.015999 28.584001) (end 151.35 26.25) (width 0.254) (layer F.Cu) (net 39) (status 20)) (segment (start 149.015999 33.784001) (end 149.015999 28.584001) (width 0.254) (layer F.Cu) (net 39)) (segment (start 148 34.8) (end 149.015999 33.784001) (width 0.254) (layer F.Cu) (net 39) (status 10)) (segment (start 168.015999 26.084001) (end 170.35 23.75) (width 0.254) (layer F.Cu) (net 40) (status 20)) (segment (start 168.015999 31.284001) (end 168.015999 26.084001) (width 0.254) (layer F.Cu) (net 40)) (segment (start 167 32.3) (end 168.015999 31.284001) (width 0.254) (layer F.Cu) (net 40) (status 10)) (segment (start 187.015999 20.584001) (end 189.35 18.25) (width 0.254) (layer F.Cu) (net 41) (status 20)) (segment (start 187.015999 25.784001) (end 187.015999 20.584001) (width 0.254) (layer F.Cu) (net 41)) (segment (start 186 26.8) (end 187.015999 25.784001) (width 0.254) (layer F.Cu) (net 41) (status 10)) (segment (start 206.015999 26.584001) (end 208.35 24.25) (width 0.254) (layer F.Cu) (net 42) (status 20)) (segment (start 206.015999 31.784001) (end 206.015999 26.584001) (width 0.254) (layer F.Cu) (net 42)) (segment (start 205 32.8) (end 206.015999 31.784001) (width 0.254) (layer F.Cu) (net 42) (status 10)) (segment (start 225.015999 38.584001) (end 227.35 36.25) (width 0.254) (layer F.Cu) (net 43) (status 20)) (segment (start 225.015999 43.784001) (end 225.015999 38.584001) (width 0.254) (layer F.Cu) (net 43)) (segment (start 224 44.8) (end 225.015999 43.784001) (width 0.254) (layer F.Cu) (net 43) (status 10)) (segment (start 19.015999 57.584001) (end 21.35 55.25) (width 0.254) (layer F.Cu) (net 44) (status 20)) (segment (start 19.015999 62.784001) (end 19.015999 57.584001) (width 0.254) (layer F.Cu) (net 44)) (segment (start 18 63.8) (end 19.015999 62.784001) (width 0.254) (layer F.Cu) (net 44) (status 10)) (segment (start 38.015999 45.584001) (end 40.35 43.25) (width 0.254) (layer F.Cu) (net 45) (status 20)) (segment (start 38.015999 50.784001) (end 38.015999 45.584001) (width 0.254) (layer F.Cu) (net 45)) (segment (start 37 51.8) (end 38.015999 50.784001) (width 0.254) (layer F.Cu) (net 45) (status 10)) (segment (start 57.015999 39.584001) (end 59.35 37.25) (width 0.254) (layer F.Cu) (net 46) (status 20)) (segment (start 57.015999 44.784001) (end 57.015999 39.584001) (width 0.254) (layer F.Cu) (net 46)) (segment (start 56 45.8) (end 57.015999 44.784001) (width 0.254) (layer F.Cu) (net 46) (status 10)) (segment (start 76.015999 45.084001) (end 78.35 42.75) (width 0.254) (layer F.Cu) (net 47) (status 20)) (segment (start 76.015999 50.284001) (end 76.015999 45.084001) (width 0.254) (layer F.Cu) (net 47)) (segment (start 75 51.3) (end 76.015999 50.284001) (width 0.254) (layer F.Cu) (net 47) (status 10)) (segment (start 95.015999 47.584001) (end 97.35 45.25) (width 0.254) (layer F.Cu) (net 48) (status 20)) (segment (start 95.015999 52.784001) (end 95.015999 47.584001) (width 0.254) (layer F.Cu) (net 48)) (segment (start 94 53.8) (end 95.015999 52.784001) (width 0.254) (layer F.Cu) (net 48) (status 10)) (segment (start 149.015999 47.584001) (end 151.35 45.25) (width 0.254) (layer F.Cu) (net 49) (status 20)) (segment (start 149.015999 52.784001) (end 149.015999 47.584001) (width 0.254) (layer F.Cu) (net 49)) (segment (start 148 53.8) (end 149.015999 52.784001) (width 0.254) (layer F.Cu) (net 49) (status 10)) (segment (start 168.015999 45.084001) (end 170.35 42.75) (width 0.254) (layer F.Cu) (net 50) (status 20)) (segment (start 168.015999 50.284001) (end 168.015999 45.084001) (width 0.254) (layer F.Cu) (net 50)) (segment (start 167 51.3) (end 168.015999 50.284001) (width 0.254) (layer F.Cu) (net 50) (status 10)) (segment (start 187.015999 39.584001) (end 189.35 37.25) (width 0.254) (layer F.Cu) (net 51) (status 20)) (segment (start 187.015999 44.784001) (end 187.015999 39.584001) (width 0.254) (layer F.Cu) (net 51)) (segment (start 186 45.8) (end 187.015999 44.784001) (width 0.254) (layer F.Cu) (net 51) (status 10)) (segment (start 206.015999 45.584001) (end 208.35 43.25) (width 0.254) (layer F.Cu) (net 52) (status 20)) (segment (start 206.015999 50.784001) (end 206.015999 45.584001) (width 0.254) (layer F.Cu) (net 52)) (segment (start 205 51.8) (end 206.015999 50.784001) (width 0.254) (layer F.Cu) (net 52) (status 10)) (segment (start 225.015999 57.584001) (end 227.35 55.25) (width 0.254) (layer F.Cu) (net 53) (status 20)) (segment (start 225.015999 62.784001) (end 225.015999 57.584001) (width 0.254) (layer F.Cu) (net 53)) (segment (start 224 63.8) (end 225.015999 62.784001) (width 0.254) (layer F.Cu) (net 53) (status 10)) (segment (start 19.015999 76.584001) (end 21.35 74.25) (width 0.254) (layer F.Cu) (net 54) (status 20)) (segment (start 19.015999 81.784001) (end 19.015999 76.584001) (width 0.254) (layer F.Cu) (net 54)) (segment (start 18 82.8) (end 19.015999 81.784001) (width 0.254) (layer F.Cu) (net 54) (status 10)) (segment (start 38.015999 64.584001) (end 40.35 62.25) (width 0.254) (layer F.Cu) (net 55) (status 20)) (segment (start 38.015999 69.784001) (end 38.015999 64.584001) (width 0.254) (layer F.Cu) (net 55)) (segment (start 37 70.8) (end 38.015999 69.784001) (width 0.254) (layer F.Cu) (net 55) (status 10)) (segment (start 57.015999 58.584001) (end 59.35 56.25) (width 0.254) (layer F.Cu) (net 56) (status 20)) (segment (start 57.015999 63.784001) (end 57.015999 58.584001) (width 0.254) (layer F.Cu) (net 56)) (segment (start 56 64.8) (end 57.015999 63.784001) (width 0.254) (layer F.Cu) (net 56) (status 10)) (segment (start 76.015999 64.084001) (end 78.35 61.75) (width 0.254) (layer F.Cu) (net 57) (status 20)) (segment (start 76.015999 69.284001) (end 76.015999 64.084001) (width 0.254) (layer F.Cu) (net 57)) (segment (start 75 70.3) (end 76.015999 69.284001) (width 0.254) (layer F.Cu) (net 57) (status 10)) (segment (start 95.015999 66.584001) (end 97.35 64.25) (width 0.254) (layer F.Cu) (net 58) (status 20)) (segment (start 95.015999 71.784001) (end 95.015999 66.584001) (width 0.254) (layer F.Cu) (net 58)) (segment (start 94 72.8) (end 95.015999 71.784001) (width 0.254) (layer F.Cu) (net 58) (status 10)) (segment (start 149.015999 66.584001) (end 151.35 64.25) (width 0.254) (layer F.Cu) (net 59) (status 20)) (segment (start 149.015999 71.784001) (end 149.015999 66.584001) (width 0.254) (layer F.Cu) (net 59)) (segment (start 148 72.8) (end 149.015999 71.784001) (width 0.254) (layer F.Cu) (net 59) (status 10)) (segment (start 168.015999 64.084001) (end 170.35 61.75) (width 0.254) (layer F.Cu) (net 60) (status 20)) (segment (start 168.015999 69.284001) (end 168.015999 64.084001) (width 0.254) (layer F.Cu) (net 60)) (segment (start 167 70.3) (end 168.015999 69.284001) (width 0.254) (layer F.Cu) (net 60) (status 10)) (segment (start 187.015999 58.584001) (end 189.35 56.25) (width 0.254) (layer F.Cu) (net 61) (status 20)) (segment (start 187.015999 63.784001) (end 187.015999 58.584001) (width 0.254) (layer F.Cu) (net 61)) (segment (start 186 64.8) (end 187.015999 63.784001) (width 0.254) (layer F.Cu) (net 61) (status 10)) (segment (start 206.015999 64.584001) (end 208.35 62.25) (width 0.254) (layer F.Cu) (net 62) (status 20)) (segment (start 206.015999 69.784001) (end 206.015999 64.584001) (width 0.254) (layer F.Cu) (net 62)) (segment (start 205 70.8) (end 206.015999 69.784001) (width 0.254) (layer F.Cu) (net 62) (status 10)) (segment (start 225.015999 81.784001) (end 225.015999 76.584001) (width 0.254) (layer F.Cu) (net 63)) (segment (start 225.015999 76.584001) (end 227.35 74.25) (width 0.254) (layer F.Cu) (net 63) (status 20)) (segment (start 224 82.8) (end 225.015999 81.784001) (width 0.254) (layer F.Cu) (net 63) (status 10)) (segment (start 88.606222 84.957059) (end 88.606222 82.972949) (width 0.254) (layer F.Cu) (net 64) (status 20)) (segment (start 83.186858 90.376423) (end 88.606222 84.957059) (width 0.254) (layer F.Cu) (net 64) (status 10)) (segment (start 109.48577 90.075) (end 110.871058 90.075) (width 0.254) (layer F.Cu) (net 65) (status 20)) (segment (start 103.769873 95.790897) (end 109.48577 90.075) (width 0.254) (layer F.Cu) (net 65) (status 10)) (segment (start 138.610288 99.831312) (end 139.569873 100.790897) (width 0.254) (layer F.Cu) (net 66) (status 20)) (segment (start 138.610288 92.16423) (end 138.610288 99.831312) (width 0.254) (layer F.Cu) (net 66) (status 10)) (segment (start 138.171058 91.725) (end 138.610288 92.16423) (width 0.254) (layer F.Cu) (net 66) (status 30)) (segment (start 159.153883 84.87939) (end 160.156222 83.877051) (width 0.254) (layer F.Cu) (net 67) (status 20)) (segment (start 159.153883 92.964613) (end 159.153883 84.87939) (width 0.254) (layer F.Cu) (net 67) (status 10)) (segment (start 95.015999 33.784001) (end 95.015999 28.584001) (width 0.254) (layer F.Cu) (net 68)) (segment (start 95.015999 28.584001) (end 97.35 26.25) (width 0.254) (layer F.Cu) (net 68) (status 20)) (segment (start 94 34.8) (end 95.015999 33.784001) (width 0.254) (layer F.Cu) (net 68) (status 10)) (segment (start 53.65 79.295) (end 53.475 79.12) (width 0.254) (layer F.Cu) (net 69) (status 30)) (segment (start 53.65 81.85) (end 53.65 79.295) (width 0.254) (layer F.Cu) (net 69) (status 30)) (segment (start 58.8 83.2) (end 57.796 83.2) (width 0.254) (layer F.Cu) (net 69) (status 10)) (segment (start 56.560979 82.089748) (end 57.671231 83.2) (width 0.254) (layer F.Cu) (net 69)) (segment (start 57.671231 83.2) (end 58.8 83.2) (width 0.254) (layer F.Cu) (net 69) (status 20)) (segment (start 56.560979 81.172377) (end 56.560979 82.089748) (width 0.254) (layer F.Cu) (net 69)) (segment (start 54.488399 80.822999) (end 56.211601 80.822999) (width 0.254) (layer F.Cu) (net 69)) (segment (start 56.211601 80.822999) (end 56.560979 81.172377) (width 0.254) (layer F.Cu) (net 69)) (segment (start 53.65 81.661398) (end 54.488399 80.822999) (width 0.254) (layer F.Cu) (net 69) (status 10)) (segment (start 53.65 81.85) (end 53.65 81.661398) (width 0.254) (layer F.Cu) (net 69) (status 30)) (segment (start 97.86744 77.222998) (end 100.625463 79.98102) (width 0.254) (layer F.Cu) (net 70)) (segment (start 66.973001 77.222999) (end 97.86744 77.222998) (width 0.254) (layer F.Cu) (net 70)) (segment (start 66.9 77.296) (end 66.973001 77.222999) (width 0.254) (layer F.Cu) (net 70)) (segment (start 66.9 78.3) (end 66.9 77.296) (width 0.254) (layer F.Cu) (net 70)) (segment (start 111.792916 79.98102) (end 112.376968 79.396968) (width 0.254) (layer F.Cu) (net 70)) (segment (start 112.376968 79.396968) (end 111.792915 79.98102) (width 0.254) (layer F.Cu) (net 70)) (segment (start 113.55401 78.219925) (end 113.560075 78.219925) (width 0.254) (layer F.Cu) (net 70)) (segment (start 112.831967 78.941967) (end 113.55401 78.219925) (width 0.254) (layer F.Cu) (net 70)) (segment (start 112.831967 78.941967) (end 112.376968 79.396968) (width 0.254) (layer F.Cu) (net 70)) (segment (start 115.53 76.25) (end 115.53 76.025) (width 0.254) (layer F.Cu) (net 70)) (segment (start 111.792915 79.981019) (end 114.993934 76.78) (width 0.254) (layer F.Cu) (net 70)) (segment (start 114.993934 76.78) (end 115 76.78) (width 0.254) (layer F.Cu) (net 70)) (segment (start 111.61898 79.98102) (end 111.792915 79.981019) (width 0.254) (layer F.Cu) (net 70)) (segment (start 115 76.78) (end 115.53 76.25) (width 0.254) (layer F.Cu) (net 70)) (segment (start 113.560075 78.219925) (end 115 76.78) (width 0.254) (layer F.Cu) (net 70)) (segment (start 100.625463 79.98102) (end 111.61898 79.98102) (width 0.254) (layer F.Cu) (net 70)) (segment (start 111.61898 79.98102) (end 111.792916 79.98102) (width 0.254) (layer F.Cu) (net 70)) (segment (start 113.1 78.031868) (end 113.1 76.025) (width 0.254) (layer F.Cu) (net 71) (status 20)) (segment (start 66.627011 76.768989) (end 98.055499 76.768989) (width 0.254) (layer F.Cu) (net 71)) (segment (start 66.1 77.296) (end 66.627011 76.768989) (width 0.254) (layer F.Cu) (net 71)) (segment (start 66.1 78.3) (end 66.1 77.296) (width 0.254) (layer F.Cu) (net 71) (status 10)) (segment (start 100.81352 79.52701) (end 99.893255 78.606745) (width 0.254) (layer F.Cu) (net 71)) (segment (start 111.604858 79.52701) (end 100.81352 79.52701) (width 0.254) (layer F.Cu) (net 71)) (segment (start 112.350934 78.780934) (end 111.604858 79.52701) (width 0.254) (layer F.Cu) (net 71)) (segment (start 98.055499 76.768989) (end 99.893255 78.606745) (width 0.254) (layer F.Cu) (net 71)) (segment (start 111.830934 79.300934) (end 112.350934 78.780934) (width 0.254) (layer F.Cu) (net 71)) (segment (start 112.350934 78.780934) (end 113.1 78.031868) (width 0.254) (layer F.Cu) (net 71)) (segment (start 140.44 70.585) (end 141.32 70.585) (width 0.254) (layer F.Cu) (net 72) (status 30)) (segment (start 135.275 75.75) (end 140.44 70.585) (width 0.254) (layer F.Cu) (net 72) (status 30)) (segment (start 135.275 76.45) (end 135.275 75.75) (width 0.254) (layer F.Cu) (net 72) (status 30)) (segment (start 73.165 80.8) (end 73.185 80.78) (width 0.381) (layer F.Cu) (net 73) (tstamp 5EDCC3AA) (status 30)) (segment (start 64.5 73.045) (end 64.5 73.371938) (width 0.381) (layer F.Cu) (net 73) (tstamp 5EDCC31D) (status 30)) (segment (start 53.64 86.805) (end 53.605 86.84) (width 0.381) (layer F.Cu) (net 73) (tstamp 5EDCC230) (status 30)) (segment (start 53.605 89.36) (end 53.635 89.39) (width 0.381) (layer F.Cu) (net 73) (tstamp 5EDCC1A3) (status 30)) (segment (start 64.5 73.045) (end 62.05 73.045) (width 0.381) (layer F.Cu) (net 73) (tstamp 5EDCC356) (status 30)) (segment (start 64.505 73.04) (end 64.5 73.045) (width 0.381) (layer F.Cu) (net 73) (tstamp 5EDCC1D0) (status 30)) (segment (start 70.25 87.25) (end 70.2 87.2) (width 0.381) (layer F.Cu) (net 73) (tstamp 5EDCC2B7) (status 30)) (segment (start 53.465 75.92) (end 53.545 76) (width 0.381) (layer F.Cu) (net 73) (tstamp 5EDCC2C3) (status 30)) (segment (start 70.22 80.78) (end 70.2 80.8) (width 0.381) (layer F.Cu) (net 73) (tstamp 5EDCC28D) (status 30)) (segment (start 73.185 80.78) (end 70.22 80.78) (width 0.381) (layer F.Cu) (net 73) (tstamp 5EDCC2BD) (status 30)) (segment (start 53.545 75.755) (end 53.2805 75.4905) (width 0.381) (layer F.Cu) (net 73) (status 30)) (segment (start 53.545 76) (end 53.545 75.755) (width 0.381) (layer F.Cu) (net 73) (status 30)) (segment (start 70.2 87.2) (end 71.425 87.2) (width 0.381) (layer F.Cu) (net 73) (status 10)) (segment (start 72.575 87.2) (end 72.975 86.8) (width 0.381) (layer F.Cu) (net 73) (status 30)) (segment (start 70.2 87.2) (end 72.575 87.2) (width 0.381) (layer F.Cu) (net 73) (status 30)) (segment (start 55.35 82.152902) (end 55.35 81.85) (width 0.381) (layer F.Cu) (net 73) (status 30)) (segment (start 53.65 83.852902) (end 55.35 82.152902) (width 0.254) (layer F.Cu) (net 73) (status 30)) (segment (start 53.65 84.05) (end 53.65 83.852902) (width 0.381) (layer F.Cu) (net 73) (status 30)) (segment (start 55.465 79.12) (end 55.525 79.12) (width 0.381) (layer F.Cu) (net 73) (status 30)) (segment (start 53.65 86.665) (end 53.475 86.84) (width 0.381) (layer F.Cu) (net 73) (status 30)) (segment (start 73.720501 88.665501) (end 74.925 89.87) (width 0.381) (layer F.Cu) (net 73) (status 20)) (segment (start 69.137599 88.665501) (end 73.720501 88.665501) (width 0.381) (layer F.Cu) (net 73)) (segment (start 112.29 60.05) (end 112.375 59.965) (width 0.381) (layer F.Cu) (net 73) (status 30)) (segment (start 65.3 79.41) (end 65.3 78.3) (width 0.254) (layer F.Cu) (net 73) (status 20)) (segment (start 62.31 82.4) (end 65.3 79.41) (width 0.254) (layer F.Cu) (net 73)) (segment (start 58.8 82.4) (end 62.31 82.4) (width 0.254) (layer F.Cu) (net 73) (status 10)) (segment (start 69.059499 88.587401) (end 69.059499 87.526899) (width 0.254) (layer F.Cu) (net 73)) (segment (start 69.386398 87.2) (end 70.2 87.2) (width 0.254) (layer F.Cu) (net 73) (status 20)) (segment (start 69.059499 87.526899) (end 69.386398 87.2) (width 0.254) (layer F.Cu) (net 73)) (segment (start 66.796 80.8) (end 65.3 79.304) (width 0.254) (layer F.Cu) (net 73)) (segment (start 70.2 80.8) (end 66.796 80.8) (width 0.254) (layer F.Cu) (net 73) (status 10)) (segment (start 62.204 82.4) (end 58.8 82.4) (width 0.254) (layer F.Cu) (net 73) (status 20)) (segment (start 65.3 79.304) (end 62.204 82.4) (width 0.254) (layer F.Cu) (net 73)) (segment (start 65.3 78.3) (end 65.3 79.304) (width 0.254) (layer F.Cu) (net 73) (status 10)) (segment (start 113.445 67.78) (end 113.225 68) (width 0.254) (layer F.Cu) (net 73) (status 30)) (segment (start 113.225 65.28) (end 113.445 65.06) (width 0.381) (layer F.Cu) (net 73) (status 30)) (segment (start 113.29 65.06) (end 112.375 64.145) (width 0.381) (layer F.Cu) (net 73) (status 30)) (segment (start 113.445 65.06) (end 113.29 65.06) (width 0.381) (layer F.Cu) (net 73) (status 30)) (segment (start 112.375 64.145) (end 112.375 59.965) (width 0.381) (layer F.Cu) (net 73) (status 30)) (segment (start 112.375 59.965) (end 121.015 59.965) (width 0.381) (layer F.Cu) (net 73) (status 30)) (segment (start 121.015 59.965) (end 121.015 64.145) (width 0.381) (layer F.Cu) (net 73) (status 30)) (segment (start 120.86 64.145) (end 119.945 65.06) (width 0.381) (layer F.Cu) (net 73) (status 30)) (segment (start 121.015 64.145) (end 120.86 64.145) (width 0.381) (layer F.Cu) (net 73) (status 30)) (segment (start 113.445 67.53) (end 112.975 68) (width 0.381) (layer F.Cu) (net 73) (status 30)) (segment (start 113.445 65.06) (end 113.445 67.53) (width 0.381) (layer F.Cu) (net 73) (status 30)) (segment (start 120.525 65.64) (end 120.525 68) (width 0.381) (layer F.Cu) (net 73) (status 20)) (segment (start 119.945 65.06) (end 120.525 65.64) (width 0.381) (layer F.Cu) (net 73) (status 10)) (segment (start 110.7 65.82) (end 112.375 64.145) (width 0.381) (layer F.Cu) (net 73) (status 20)) (segment (start 110.7 78.4) (end 110.7 65.82) (width 0.381) (layer F.Cu) (net 73) (status 10)) (segment (start 58.772098 89.7) (end 60.5 89.7) (width 0.381) (layer F.Cu) (net 73) (status 20)) (segment (start 57.371588 88.29949) (end 58.772098 89.7) (width 0.381) (layer F.Cu) (net 73)) (segment (start 54.56551 88.29949) (end 57.371588 88.29949) (width 0.381) (layer F.Cu) (net 73)) (segment (start 53.475 89.39) (end 54.56551 88.29949) (width 0.381) (layer F.Cu) (net 73) (status 10)) (segment (start 69.069 87.2) (end 70.2 87.2) (width 0.381) (layer F.Cu) (net 73) (status 20)) (segment (start 69.059499 87.190499) (end 69.069 87.2) (width 0.381) (layer F.Cu) (net 73)) (segment (start 69.059499 80.809501) (end 69.059499 87.190499) (width 0.381) (layer F.Cu) (net 73)) (segment (start 69.069 80.8) (end 69.059499 80.809501) (width 0.381) (layer F.Cu) (net 73)) (segment (start 70.2 80.8) (end 69.069 80.8) (width 0.381) (layer F.Cu) (net 73) (status 10)) (segment (start 65.3 77.169) (end 66.217521 76.251479) (width 0.381) (layer F.Cu) (net 73)) (segment (start 65.3 78.3) (end 65.3 77.169) (width 0.381) (layer F.Cu) (net 73) (status 10)) (segment (start 66.217521 74.762521) (end 66.217521 76.251479) (width 0.381) (layer F.Cu) (net 73)) (segment (start 64.5 73.045) (end 66.217521 74.762521) (width 0.381) (layer F.Cu) (net 73) (status 10)) (segment (start 110.6 79.0095) (end 110.6 78.5) (width 0.381) (layer F.Cu) (net 73)) (segment (start 110.6 78.5) (end 110.7 78.4) (width 0.381) (layer F.Cu) (net 73)) (segment (start 101.027878 79.0095) (end 110.6 79.0095) (width 0.381) (layer F.Cu) (net 73)) (segment (start 98.269857 76.251479) (end 101.027878 79.0095) (width 0.381) (layer F.Cu) (net 73)) (segment (start 66.217521 76.251479) (end 98.269857 76.251479) (width 0.381) (layer F.Cu) (net 73)) (segment (start 46.19 89.39) (end 42 85.2) (width 0.381) (layer F.Cu) (net 73)) (segment (start 53.475 89.39) (end 46.19 89.39) (width 0.381) (layer F.Cu) (net 73)) (segment (start 51.2 76) (end 42 85.2) (width 0.381) (layer F.Cu) (net 73)) (segment (start 53.545 76) (end 51.2 76) (width 0.381) (layer F.Cu) (net 73)) (segment (start 57.078489 80.673489) (end 55.525 79.12) (width 0.381) (layer F.Cu) (net 73)) (segment (start 57.078489 81.831161) (end 57.078489 80.673489) (width 0.381) (layer F.Cu) (net 73)) (segment (start 57.647328 82.4) (end 57.078489 81.831161) (width 0.381) (layer F.Cu) (net 73)) (segment (start 58.8 82.4) (end 57.647328 82.4) (width 0.381) (layer F.Cu) (net 73)) (via (at 56.868999 79.12) (size 0.8) (drill 0.4) (layers F.Cu B.Cu) (net 73)) (segment (start 55.525 79.12) (end 56.868999 79.12) (width 0.381) (layer F.Cu) (net 73)) (segment (start 56.868999 79.12) (end 54.57 79.12) (width 0.381) (layer B.Cu) (net 73)) (via (at 56.84 86.76) (size 0.8) (drill 0.4) (layers F.Cu B.Cu) (net 73)) (segment (start 56.868999 86.731001) (end 56.84 86.76) (width 0.381) (layer B.Cu) (net 73)) (segment (start 56.868999 79.12) (end 56.868999 86.731001) (width 0.381) (layer B.Cu) (net 73)) (segment (start 53.475 86.84) (end 53.475 85.345) (width 0.381) (layer F.Cu) (net 73)) (via (at 56.655548 83.212451) (size 0.8) (drill 0.4) (layers F.Cu B.Cu) (net 73)) (segment (start 55.35 81.906903) (end 56.655548 83.212451) (width 0.381) (layer F.Cu) (net 73)) (segment (start 55.35 81.85) (end 55.35 81.906903) (width 0.381) (layer F.Cu) (net 73)) (via (at 52.19 84.03) (size 0.8) (drill 0.4) (layers F.Cu B.Cu) (net 73)) (segment (start 52.21 84.05) (end 52.19 84.03) (width 0.381) (layer F.Cu) (net 73)) (segment (start 53.65 84.05) (end 52.21 84.05) (width 0.381) (layer F.Cu) (net 73)) (segment (start 53.007549 83.212451) (end 56.655548 83.212451) (width 0.381) (layer B.Cu) (net 73)) (segment (start 52.19 84.03) (end 53.007549 83.212451) (width 0.381) (layer B.Cu) (net 73)) (segment (start 68.511597 86.439499) (end 69.272098 87.2) (width 0.381) (layer F.Cu) (net 73)) (segment (start 62.629501 86.439499) (end 68.511597 86.439499) (width 0.381) (layer F.Cu) (net 73)) (segment (start 69.272098 87.2) (end 70.2 87.2) (width 0.381) (layer F.Cu) (net 73)) (segment (start 60.5 88.569) (end 62.629501 86.439499) (width 0.381) (layer F.Cu) (net 73)) (segment (start 60.5 89.7) (end 60.5 88.569) (width 0.381) (layer F.Cu) (net 73)) (zone (net 73) (net_name GND) (layer F.Cu) (tstamp 5EE14219) (hatch edge 0.508) (connect_pads (clearance 0.508)) (min_thickness 0.254) (fill yes (arc_segments 32) (thermal_gap 0.508) (thermal_bridge_width 0.508)) (polygon (pts (xy 69.61 89.09) (xy 59.39 89.1) (xy 59.4 78.9) (xy 69.6 78.9) ) ) (filled_polygon (pts (xy 62.692696 86.399843) (xy 62.523178 86.513111) (xy 62.379015 86.657274) (xy 62.265747 86.826792) (xy 62.187726 87.01515) (xy 62.147952 87.215109) (xy 62.147952 87.298837) (xy 62.118102 87.304774) (xy 61.929744 87.382795) (xy 61.760226 87.496063) (xy 61.616063 87.640226) (xy 61.502795 87.809744) (xy 61.424774 87.998102) (xy 61.385 88.198061) (xy 61.385 88.311928) (xy 61.025 88.311928) (xy 60.900518 88.324188) (xy 60.899337 88.324546) (xy 60.78575 88.315) (xy 60.693667 88.407083) (xy 60.670506 88.419463) (xy 60.573815 88.498815) (xy 60.494463 88.595506) (xy 60.435498 88.70582) (xy 60.399188 88.825518) (xy 60.386928 88.95) (xy 60.386928 88.972024) (xy 60.373 88.972038) (xy 60.373 88.47375) (xy 60.21425 88.315) (xy 60.183881 88.317552) (xy 60.188072 88.275) (xy 60.188072 87.725) (xy 60.175812 87.600518) (xy 60.175655 87.6) (xy 60.175812 87.599482) (xy 60.188072 87.475) (xy 60.188072 86.925) (xy 60.175812 86.800518) (xy 60.175655 86.8) (xy 60.175812 86.799482) (xy 60.188072 86.675) (xy 60.188072 86.362) (xy 62.784056 86.362) ) ) (filled_polygon (pts (xy 65.373815 79.501185) (xy 65.470506 79.580537) (xy 65.493667 79.592917) (xy 65.58575 79.685) (xy 65.699337 79.675454) (xy 65.700518 79.675812) (xy 65.825 79.688072) (xy 66.375 79.688072) (xy 66.499482 79.675812) (xy 66.5 79.675655) (xy 66.500518 79.675812) (xy 66.625 79.688072) (xy 67.009942 79.688072) (xy 67.010301 79.688744) (xy 67.040056 79.725) (xy 67.113459 79.814443) (xy 67.144966 79.8403) (xy 67.300201 79.995535) (xy 67.326058 80.027042) (xy 67.451757 80.1302) (xy 67.595165 80.206854) (xy 67.750773 80.254057) (xy 67.872046 80.266001) (xy 67.872055 80.266001) (xy 67.912598 80.269994) (xy 67.953141 80.266001) (xy 68.811928 80.266001) (xy 68.811928 80.275) (xy 68.824188 80.399482) (xy 68.824546 80.400663) (xy 68.815 80.51425) (xy 68.907083 80.606333) (xy 68.919463 80.629494) (xy 68.998815 80.726185) (xy 69.088759 80.8) (xy 68.998815 80.873815) (xy 68.919463 80.970506) (xy 68.907083 80.993667) (xy 68.815 81.08575) (xy 68.824546 81.199337) (xy 68.824188 81.200518) (xy 68.811928 81.325) (xy 68.811928 81.875) (xy 68.824188 81.999482) (xy 68.824345 82) (xy 68.824188 82.000518) (xy 68.811928 82.125) (xy 68.811928 82.675) (xy 68.824188 82.799482) (xy 68.824345 82.8) (xy 68.824188 82.800518) (xy 68.811928 82.925) (xy 68.811928 83.475) (xy 68.824188 83.599482) (xy 68.824345 83.6) (xy 68.824188 83.600518) (xy 68.811928 83.725) (xy 68.811928 84.275) (xy 68.824188 84.399482) (xy 68.824345 84.4) (xy 68.824188 84.400518) (xy 68.811928 84.525) (xy 68.811928 85.075) (xy 68.824188 85.199482) (xy 68.824345 85.2) (xy 68.824188 85.200518) (xy 68.811928 85.325) (xy 68.811928 85.875) (xy 68.824188 85.999482) (xy 68.824345 86) (xy 68.824188 86.000518) (xy 68.811928 86.125) (xy 68.811928 86.675) (xy 68.824188 86.799482) (xy 68.824546 86.800663) (xy 68.815 86.91425) (xy 68.907083 87.006333) (xy 68.919463 87.029494) (xy 68.998815 87.126185) (xy 69.088759 87.2) (xy 68.998815 87.273815) (xy 68.919463 87.370506) (xy 68.907083 87.393667) (xy 68.815 87.48575) (xy 68.824546 87.599337) (xy 68.824188 87.600518) (xy 68.811928 87.725) (xy 68.811928 88.275) (xy 68.815962 88.315962) (xy 68.775 88.311928) (xy 68.225 88.311928) (xy 68.100518 88.324188) (xy 68.1 88.324345) (xy 68.099482 88.324188) (xy 67.975 88.311928) (xy 67.451908 88.311928) (xy 67.451908 88.244183) (xy 67.412134 88.044224) (xy 67.334113 87.855866) (xy 67.220845 87.686348) (xy 67.076682 87.542185) (xy 66.907164 87.428917) (xy 66.718806 87.350896) (xy 66.518847 87.311122) (xy 66.425 87.311122) (xy 66.425 87.128061) (xy 66.385226 86.928102) (xy 66.307205 86.739744) (xy 66.193937 86.570226) (xy 66.049774 86.426063) (xy 65.880256 86.312795) (xy 65.691898 86.234774) (xy 65.491939 86.195) (xy 65.288061 86.195) (xy 65.088102 86.234774) (xy 64.899744 86.312795) (xy 64.730226 86.426063) (xy 64.586063 86.570226) (xy 64.472795 86.739744) (xy 64.394774 86.928102) (xy 64.355 87.128061) (xy 64.355 87.269301) (xy 64.316719 87.269301) (xy 64.217952 87.288947) (xy 64.217952 87.215109) (xy 64.178178 87.01515) (xy 64.100157 86.826792) (xy 63.986889 86.657274) (xy 63.91105 86.581435) (xy 64.090256 86.507205) (xy 64.259774 86.393937) (xy 64.403937 86.249774) (xy 64.517205 86.080256) (xy 64.595226 85.891898) (xy 64.635 85.691939) (xy 64.635 85.488061) (xy 64.595226 85.288102) (xy 64.517205 85.099744) (xy 64.403937 84.930226) (xy 64.259774 84.786063) (xy 64.090256 84.672795) (xy 63.901898 84.594774) (xy 63.791989 84.572912) (xy 63.780059 84.512935) (xy 63.702038 84.324577) (xy 63.58877 84.155059) (xy 63.444607 84.010896) (xy 63.275089 83.897628) (xy 63.086731 83.819607) (xy 62.886772 83.779833) (xy 62.682894 83.779833) (xy 62.482935 83.819607) (xy 62.294577 83.897628) (xy 62.125059 84.010896) (xy 62.097955 84.038) (xy 60.188072 84.038) (xy 60.188072 83.725) (xy 60.175812 83.600518) (xy 60.175655 83.6) (xy 60.175812 83.599482) (xy 60.188072 83.475) (xy 60.188072 82.925) (xy 60.175812 82.800518) (xy 60.175454 82.799337) (xy 60.185 82.68575) (xy 60.092917 82.593667) (xy 60.080537 82.570506) (xy 60.001185 82.473815) (xy 59.911241 82.4) (xy 60.001185 82.326185) (xy 60.080537 82.229494) (xy 60.092917 82.206333) (xy 60.185 82.11425) (xy 60.175454 82.000663) (xy 60.175812 81.999482) (xy 60.188072 81.875) (xy 60.188072 81.325) (xy 60.186114 81.305118) (xy 60.410345 81.080887) (xy 60.439421 81.057025) (xy 60.534644 80.940995) (xy 60.605401 80.808618) (xy 60.648973 80.664981) (xy 60.659999 80.553029) (xy 60.659999 80.553027) (xy 60.663685 80.515604) (xy 60.659999 80.478181) (xy 60.659999 79.688072) (xy 60.775 79.688072) (xy 60.899482 79.675812) (xy 60.9 79.675655) (xy 60.900518 79.675812) (xy 61.025 79.688072) (xy 61.575 79.688072) (xy 61.699482 79.675812) (xy 61.7 79.675655) (xy 61.700518 79.675812) (xy 61.825 79.688072) (xy 62.375 79.688072) (xy 62.499482 79.675812) (xy 62.5 79.675655) (xy 62.500518 79.675812) (xy 62.625 79.688072) (xy 63.175 79.688072) (xy 63.299482 79.675812) (xy 63.3 79.675655) (xy 63.300518 79.675812) (xy 63.425 79.688072) (xy 63.975 79.688072) (xy 64.099482 79.675812) (xy 64.1 79.675655) (xy 64.100518 79.675812) (xy 64.225 79.688072) (xy 64.775 79.688072) (xy 64.899482 79.675812) (xy 64.900663 79.675454) (xy 65.01425 79.685) (xy 65.106333 79.592917) (xy 65.129494 79.580537) (xy 65.226185 79.501185) (xy 65.3 79.411241) ) ) ) (zone (net 73) (net_name GND) (layer F.Cu) (tstamp 5EE14213) (hatch edge 0.508) (connect_pads (clearance 0.508)) (min_thickness 0.254) (fill yes (arc_segments 32) (thermal_gap 0.508) (thermal_bridge_width 0.508)) (polygon (pts (xy 122.09 66.27) (xy 111.38 66.28) (xy 111.37 56.86) (xy 122.09 56.84) ) ) (filled_polygon (pts (xy 121.237556 57.524984) (xy 121.286867 57.529819) (xy 121.303092 57.534718) (xy 121.318053 57.542672) (xy 121.331189 57.553386) (xy 121.341988 57.566441) (xy 121.350049 57.581349) (xy 121.355062 57.597541) (xy 121.36 57.644525) (xy 121.36 58.586315) (xy 121.316874 58.570881) (xy 121.142 58.697046) (xy 121.142 59.838) (xy 121.162 59.838) (xy 121.162 60.092) (xy 121.142 60.092) (xy 121.142 61.232954) (xy 121.316874 61.359119) (xy 121.36 61.343685) (xy 121.36 62.516315) (xy 121.316874 62.500881) (xy 121.142 62.627046) (xy 121.142 64.018) (xy 121.162 64.018) (xy 121.162 64.272) (xy 121.142 64.272) (xy 121.142 65.662954) (xy 121.316874 65.789119) (xy 121.36 65.773685) (xy 121.36 66.143681) (xy 120.77165 66.14423) (xy 120.775537 66.139494) (xy 120.834502 66.02918) (xy 120.870812 65.909482) (xy 120.883072 65.785) (xy 120.882247 65.667104) (xy 120.888 65.662954) (xy 120.888 64.272) (xy 120.876867 64.272) (xy 120.870812 64.210518) (xy 120.868 64.201248) (xy 120.868 64.018) (xy 120.888 64.018) (xy 120.888 62.627046) (xy 120.713126 62.500881) (xy 120.490024 62.580724) (xy 120.302236 62.702631) (xy 120.157884 62.843206) (xy 120.039731 62.764259) (xy 119.865022 62.691892) (xy 119.679552 62.655) (xy 119.490448 62.655) (xy 119.304978 62.691892) (xy 119.130269 62.764259) (xy 118.986651 62.860222) (xy 118.914233 62.80079) (xy 118.770825 62.724136) (xy 118.615217 62.676933) (xy 118.493944 62.664989) (xy 118.493941 62.664989) (xy 118.453391 62.660995) (xy 118.412841 62.664989) (xy 114.977159 62.664989) (xy 114.936608 62.660995) (xy 114.896058 62.664989) (xy 114.896056 62.664989) (xy 114.774783 62.676933) (xy 114.619175 62.724136) (xy 114.475766 62.80079) (xy 114.438536 62.831344) (xy 114.403349 62.860222) (xy 114.259731 62.764259) (xy 114.085022 62.691892) (xy 113.899552 62.655) (xy 113.710448 62.655) (xy 113.524978 62.691892) (xy 113.350269 62.764259) (xy 113.232116 62.843206) (xy 113.087764 62.702631) (xy 112.899976 62.580724) (xy 112.676874 62.500881) (xy 112.502 62.627046) (xy 112.502 64.018) (xy 112.522 64.018) (xy 112.522 64.201248) (xy 112.519188 64.210518) (xy 112.513133 64.272) (xy 112.502 64.272) (xy 112.502 65.662954) (xy 112.507753 65.667104) (xy 112.506928 65.785) (xy 112.519188 65.909482) (xy 112.555498 66.02918) (xy 112.614463 66.139494) (xy 112.624593 66.151837) (xy 111.506865 66.152881) (xy 111.506103 65.435322) (xy 111.662236 65.587369) (xy 111.850024 65.709276) (xy 112.073126 65.789119) (xy 112.248 65.662954) (xy 112.248 64.272) (xy 112.228 64.272) (xy 112.228 64.018) (xy 112.248 64.018) (xy 112.248 62.627046) (xy 112.073126 62.500881) (xy 111.850024 62.580724) (xy 111.662236 62.702631) (xy 111.503367 62.857343) (xy 111.501396 61.000524) (xy 111.501839 61.001169) (xy 111.662236 61.157369) (xy 111.850024 61.279276) (xy 112.073126 61.359119) (xy 112.248 61.232954) (xy 112.248 60.092) (xy 112.502 60.092) (xy 112.502 61.232954) (xy 112.676874 61.359119) (xy 112.899976 61.279276) (xy 113.087764 61.157369) (xy 113.248161 61.001169) (xy 113.375003 60.816678) (xy 113.463415 60.610987) (xy 113.51 60.392) (xy 113.51 60.092) (xy 119.88 60.092) (xy 119.88 60.392) (xy 119.926585 60.610987) (xy 120.014997 60.816678) (xy 120.141839 61.001169) (xy 120.302236 61.157369) (xy 120.490024 61.279276) (xy 120.713126 61.359119) (xy 120.888 61.232954) (xy 120.888 60.092) (xy 119.88 60.092) (xy 113.51 60.092) (xy 112.502 60.092) (xy 112.248 60.092) (xy 112.228 60.092) (xy 112.228 59.838) (xy 112.248 59.838) (xy 112.248 58.697046) (xy 112.502 58.697046) (xy 112.502 59.838) (xy 113.51 59.838) (xy 113.51 59.538) (xy 119.88 59.538) (xy 119.88 59.838) (xy 120.888 59.838) (xy 120.888 58.697046) (xy 120.713126 58.570881) (xy 120.490024 58.650724) (xy 120.302236 58.772631) (xy 120.141839 58.928831) (xy 120.014997 59.113322) (xy 119.926585 59.319013) (xy 119.88 59.538) (xy 113.51 59.538) (xy 113.463415 59.319013) (xy 113.375003 59.113322) (xy 113.248161 58.928831) (xy 113.087764 58.772631) (xy 112.899976 58.650724) (xy 112.676874 58.570881) (xy 112.502 58.697046) (xy 112.248 58.697046) (xy 112.073126 58.570881) (xy 111.850024 58.650724) (xy 111.662236 58.772631) (xy 111.501839 58.928831) (xy 111.499201 58.932669) (xy 111.497702 57.520458) ) ) ) (zone (net 34) (net_name VSS) (layer F.Cu) (tstamp 5EE14210) (hatch edge 0.508) (connect_pads (clearance 0.508)) (min_thickness 0.254) (fill yes (arc_segments 32) (thermal_gap 0.508) (thermal_bridge_width 0.508)) (polygon (pts (xy 141.52 56.88) (xy 142.59 56.88) (xy 142.59 83.9) (xy 129.97 83.83) (xy 129.86 56.87) ) ) (filled_polygon (pts (xy 131.302 76.323) (xy 131.322 76.323) (xy 131.322 76.577) (xy 131.302 76.577) (xy 131.302 77.62625) (xy 131.46075 77.785) (xy 131.700235 77.787543) (xy 131.667818 77.848192) (xy 131.585764 78.118691) (xy 131.558057 78.4) (xy 131.585764 78.681309) (xy 131.667818 78.951808) (xy 131.801068 79.201101) (xy 131.980392 79.419608) (xy 132.198899 79.598932) (xy 132.448192 79.732182) (xy 132.718691 79.814236) (xy 132.929508 79.835) (xy 133.470492 79.835) (xy 133.681309 79.814236) (xy 133.951808 79.732182) (xy 134.201101 79.598932) (xy 134.28171 79.532778) (xy 134.894481 80.145549) (xy 134.920334 80.177051) (xy 135.046033 80.280209) (xy 135.189441 80.356863) (xy 135.345049 80.404066) (xy 135.466322 80.41601) (xy 135.466324 80.41601) (xy 135.506874 80.420004) (xy 135.547425 80.41601) (xy 136.852575 80.41601) (xy 136.893125 80.420004) (xy 136.933675 80.41601) (xy 136.933678 80.41601) (xy 137.054951 80.404066) (xy 137.210559 80.356863) (xy 137.353967 80.280209) (xy 137.479666 80.177051) (xy 137.505523 80.145544) (xy 138.67877 78.972298) (xy 138.801068 79.201101) (xy 138.980392 79.419608) (xy 139.198899 79.598932) (xy 139.448192 79.732182) (xy 139.718691 79.814236) (xy 139.929508 79.835) (xy 140.470492 79.835) (xy 140.681309 79.814236) (xy 140.951808 79.732182) (xy 141.201101 79.598932) (xy 141.419608 79.419608) (xy 141.598932 79.201101) (xy 141.732182 78.951808) (xy 141.814236 78.681309) (xy 141.841943 78.4) (xy 141.814236 78.118691) (xy 141.732182 77.848192) (xy 141.68423 77.75848) (xy 141.71075 77.785) (xy 141.91001 77.787116) (xy 141.910011 81.621401) (xy 141.652887 81.568063) (xy 141.427 81.720526) (xy 141.427 82.873) (xy 141.447 82.873) (xy 141.447 83.127) (xy 141.427 83.127) (xy 141.427 83.147) (xy 141.173 83.147) (xy 141.173 83.127) (xy 139.830085 83.127) (xy 139.708096 83.349039) (xy 139.718556 83.40673) (xy 139.824449 83.668421) (xy 139.883238 83.757985) (xy 130.621947 83.706615) (xy 130.609996 83.251186) (xy 130.609762 82.650961) (xy 139.708096 82.650961) (xy 139.830085 82.873) (xy 141.173 82.873) (xy 141.173 81.720526) (xy 140.947113 81.568063) (xy 140.670694 81.625404) (xy 140.410773 81.73557) (xy 140.177338 81.894327) (xy 139.979361 82.095575) (xy 139.824449 82.331579) (xy 139.718556 82.59327) (xy 139.708096 82.650961) (xy 130.609762 82.650961) (xy 130.609123 81.012397) (xy 130.682795 81.190256) (xy 130.796063 81.359774) (xy 130.940226 81.503937) (xy 131.109744 81.617205) (xy 131.298102 81.695226) (xy 131.498061 81.735) (xy 131.701939 81.735) (xy 131.901898 81.695226) (xy 132.090256 81.617205) (xy 132.259774 81.503937) (xy 132.403937 81.359774) (xy 132.517205 81.190256) (xy 132.595226 81.001898) (xy 132.635 80.801939) (xy 132.635 80.598061) (xy 137.565 80.598061) (xy 137.565 80.801939) (xy 137.604774 81.001898) (xy 137.682795 81.190256) (xy 137.796063 81.359774) (xy 137.940226 81.503937) (xy 138.109744 81.617205) (xy 138.298102 81.695226) (xy 138.498061 81.735) (xy 138.701939 81.735) (xy 138.901898 81.695226) (xy 139.090256 81.617205) (xy 139.259774 81.503937) (xy 139.403937 81.359774) (xy 139.517205 81.190256) (xy 139.595226 81.001898) (xy 139.635 80.801939) (xy 139.635 80.598061) (xy 139.595226 80.398102) (xy 139.517205 80.209744) (xy 139.403937 80.040226) (xy 139.259774 79.896063) (xy 139.090256 79.782795) (xy 138.901898 79.704774) (xy 138.701939 79.665) (xy 138.498061 79.665) (xy 138.298102 79.704774) (xy 138.109744 79.782795) (xy 137.940226 79.896063) (xy 137.796063 80.040226) (xy 137.682795 80.209744) (xy 137.604774 80.398102) (xy 137.565 80.598061) (xy 132.635 80.598061) (xy 132.595226 80.398102) (xy 132.517205 80.209744) (xy 132.403937 80.040226) (xy 132.259774 79.896063) (xy 132.090256 79.782795) (xy 131.901898 79.704774) (xy 131.701939 79.665) (xy 131.498061 79.665) (xy 131.298102 79.704774) (xy 131.109744 79.782795) (xy 130.940226 79.896063) (xy 130.796063 80.040226) (xy 130.682795 80.209744) (xy 130.60888 80.38819) (xy 130.607866 77.787988) (xy 130.88925 77.785) (xy 131.048 77.62625) (xy 131.048 76.577) (xy 131.028 76.577) (xy 131.028 76.323) (xy 131.048 76.323) (xy 131.048 76.303) (xy 131.302 76.303) ) ) (filled_polygon (pts (xy 141.447 71.728) (xy 141.467 71.728) (xy 141.467 71.982) (xy 141.447 71.982) (xy 141.447 72.998) (xy 141.467 72.998) (xy 141.467 73.252) (xy 141.447 73.252) (xy 141.447 74.268) (xy 141.467 74.268) (xy 141.467 74.522) (xy 141.447 74.522) (xy 141.447 75.17125) (xy 141.552 75.27625) (xy 141.552 76.323) (xy 141.572 76.323) (xy 141.572 76.577) (xy 141.552 76.577) (xy 141.552 76.597) (xy 141.298 76.597) (xy 141.298 76.577) (xy 141.278 76.577) (xy 141.278 76.323) (xy 141.298 76.323) (xy 141.298 75.27375) (xy 141.193 75.16875) (xy 141.193 74.522) (xy 139.81875 74.522) (xy 139.66 74.68075) (xy 139.656928 74.695) (xy 139.669188 74.819482) (xy 139.705498 74.93918) (xy 139.764463 75.049494) (xy 139.825875 75.124326) (xy 139.700001 75.111928) (xy 139.049999 75.111928) (xy 138.876745 75.128992) (xy 138.710149 75.179528) (xy 138.556613 75.261595) (xy 138.422038 75.372038) (xy 138.35 75.459816) (xy 138.277962 75.372038) (xy 138.143387 75.261595) (xy 137.989851 75.179528) (xy 137.823255 75.128992) (xy 137.650001 75.111928) (xy 136.999999 75.111928) (xy 136.989687 75.112944) (xy 138.677631 73.425) (xy 139.656928 73.425) (xy 139.669188 73.549482) (xy 139.705498 73.66918) (xy 139.754043 73.76) (xy 139.705498 73.85082) (xy 139.669188 73.970518) (xy 139.656928 74.095) (xy 139.66 74.10925) (xy 139.81875 74.268) (xy 141.193 74.268) (xy 141.193 73.252) (xy 139.81875 73.252) (xy 139.66 73.41075) (xy 139.656928 73.425) (xy 138.677631 73.425) (xy 139.705022 72.397609) (xy 139.705498 72.39918) (xy 139.754043 72.49) (xy 139.705498 72.58082) (xy 139.669188 72.700518) (xy 139.656928 72.825) (xy 139.66 72.83925) (xy 139.81875 72.998) (xy 141.193 72.998) (xy 141.193 71.982) (xy 141.173 71.982) (xy 141.173 71.728) (xy 141.193 71.728) (xy 141.193 71.708) (xy 141.447 71.708) ) ) (filled_polygon (pts (xy 132.147 69.188) (xy 132.167 69.188) (xy 132.167 69.442) (xy 132.147 69.442) (xy 132.147 69.462) (xy 131.893 69.462) (xy 131.893 69.442) (xy 131.873 69.442) (xy 131.873 69.188) (xy 131.893 69.188) (xy 131.893 69.168) (xy 132.147 69.168) ) ) ) (zone (net 73) (net_name GND) (layer F.Cu) (tstamp 0) (hatch edge 0.508) (connect_pads (clearance 0.508)) (min_thickness 0.254) (fill yes (arc_segments 32) (thermal_gap 0.508) (thermal_bridge_width 0.508)) (polygon (pts (xy 58.21 87.91) (xy 49.92 87.91) (xy 49.92 78.04) (xy 58.21 78.04) ) ) (filled_polygon (pts (xy 52.411595 78.176613) (xy 52.329528 78.330149) (xy 52.278992 78.496745) (xy 52.261928 78.669999) (xy 52.261928 79.570001) (xy 52.278992 79.743255) (xy 52.329528 79.909851) (xy 52.411595 80.063387) (xy 52.522038 80.197962) (xy 52.656613 80.308405) (xy 52.810149 80.390472) (xy 52.888001 80.414088) (xy 52.888001 80.535569) (xy 52.80582 80.560498) (xy 52.695506 80.619463) (xy 52.598815 80.698815) (xy 52.519463 80.795506) (xy 52.460498 80.90582) (xy 52.424188 81.025518) (xy 52.411928 81.15) (xy 52.411928 82.55) (xy 52.424188 82.674482) (xy 52.460498 82.79418) (xy 52.519463 82.904494) (xy 52.556809 82.95) (xy 52.519463 82.995506) (xy 52.460498 83.10582) (xy 52.424188 83.225518) (xy 52.411928 83.35) (xy 52.415 83.76425) (xy 52.57375 83.923) (xy 53.523 83.923) (xy 53.523 83.903) (xy 53.777 83.903) (xy 53.777 83.923) (xy 53.797 83.923) (xy 53.797 84.177) (xy 53.777 84.177) (xy 53.777 85.22625) (xy 53.93575 85.385) (xy 54.25 85.388072) (xy 54.374482 85.375812) (xy 54.49418 85.339502) (xy 54.5 85.336391) (xy 54.50582 85.339502) (xy 54.625518 85.375812) (xy 54.75 85.388072) (xy 54.763001 85.388072) (xy 54.763 85.621455) (xy 54.706613 85.651595) (xy 54.572038 85.762038) (xy 54.566658 85.768594) (xy 54.501185 85.688815) (xy 54.404494 85.609463) (xy 54.29418 85.550498) (xy 54.174482 85.514188) (xy 54.05 85.501928) (xy 53.76075 85.505) (xy 53.602 85.66375) (xy 53.602 86.713) (xy 53.622 86.713) (xy 53.622 86.967) (xy 53.602 86.967) (xy 53.602 86.987) (xy 53.348 86.987) (xy 53.348 86.967) (xy 52.42375 86.967) (xy 52.265 87.12575) (xy 52.261928 87.54) (xy 52.274188 87.664482) (xy 52.31014 87.783) (xy 50.047 87.783) (xy 50.047 86.14) (xy 52.261928 86.14) (xy 52.265 86.55425) (xy 52.42375 86.713) (xy 53.348 86.713) (xy 53.348 85.66375) (xy 53.18925 85.505) (xy 52.9 85.501928) (xy 52.775518 85.514188) (xy 52.65582 85.550498) (xy 52.545506 85.609463) (xy 52.448815 85.688815) (xy 52.369463 85.785506) (xy 52.310498 85.89582) (xy 52.274188 86.015518) (xy 52.261928 86.14) (xy 50.047 86.14) (xy 50.047 84.75) (xy 52.411928 84.75) (xy 52.424188 84.874482) (xy 52.460498 84.99418) (xy 52.519463 85.104494) (xy 52.598815 85.201185) (xy 52.695506 85.280537) (xy 52.80582 85.339502) (xy 52.925518 85.375812) (xy 53.05 85.388072) (xy 53.36425 85.385) (xy 53.523 85.22625) (xy 53.523 84.177) (xy 52.57375 84.177) (xy 52.415 84.33575) (xy 52.411928 84.75) (xy 50.047 84.75) (xy 50.047 78.167) (xy 52.419484 78.167) ) ) (filled_polygon (pts (xy 57.411928 85.075) (xy 57.424188 85.199482) (xy 57.424345 85.2) (xy 57.424188 85.200518) (xy 57.411928 85.325) (xy 57.411928 85.875) (xy 57.424188 85.999482) (xy 57.424345 86) (xy 57.424188 86.000518) (xy 57.411928 86.125) (xy 57.411928 86.675) (xy 57.424188 86.799482) (xy 57.424345 86.8) (xy 57.424188 86.800518) (xy 57.411928 86.925) (xy 57.411928 87.475) (xy 57.424188 87.599482) (xy 57.424345 87.6) (xy 57.424188 87.600518) (xy 57.411928 87.725) (xy 57.411928 87.783) (xy 56.588612 87.783) (xy 56.670472 87.629851) (xy 56.721008 87.463255) (xy 56.738072 87.290001) (xy 56.738072 86.389999) (xy 56.721008 86.216745) (xy 56.670472 86.050149) (xy 56.588405 85.896613) (xy 56.477962 85.762038) (xy 56.343387 85.651595) (xy 56.287 85.621455) (xy 56.287 85.289888) (xy 56.304494 85.280537) (xy 56.401185 85.201185) (xy 56.480537 85.104494) (xy 56.539502 84.99418) (xy 56.575812 84.874482) (xy 56.58689 84.762) (xy 57.411928 84.762) ) ) (filled_polygon (pts (xy 56.6316 83.238) (xy 56.577041 83.238) (xy 56.575812 83.225518) (xy 56.556955 83.163354) ) ) (filled_polygon (pts (xy 55.477 81.723) (xy 55.497 81.723) (xy 55.497 81.977) (xy 55.477 81.977) (xy 55.477 81.997) (xy 55.223 81.997) (xy 55.223 81.977) (xy 55.203 81.977) (xy 55.203 81.723) (xy 55.223 81.723) (xy 55.223 81.703) (xy 55.477 81.703) ) ) (filled_polygon (pts (xy 56.834 78.406433) (xy 56.833999 80.367767) (xy 56.776885 80.310653) (xy 56.753023 80.281577) (xy 56.636993 80.186354) (xy 56.62574 80.180339) (xy 56.630537 80.174494) (xy 56.689502 80.06418) (xy 56.725812 79.944482) (xy 56.738072 79.82) (xy 56.735 79.40575) (xy 56.57625 79.247) (xy 55.652 79.247) (xy 55.652 79.267) (xy 55.398 79.267) (xy 55.398 79.247) (xy 55.378 79.247) (xy 55.378 78.993) (xy 55.398 78.993) (xy 55.398 78.973) (xy 55.652 78.973) (xy 55.652 78.993) (xy 56.57625 78.993) (xy 56.735 78.83425) (xy 56.738072 78.42) (xy 56.72611 78.298543) ) ) ) (zone (net 73) (net_name GND) (layer B.Cu) (tstamp 5EE149CF) (hatch edge 0.508) (connect_pads (clearance 0.508)) (min_thickness 0.254) (fill yes (arc_segments 32) (thermal_gap 0.508) (thermal_bridge_width 0.508)) (polygon (pts (xy 58.21 87.91) (xy 49.92 87.91) (xy 49.92 78.04) (xy 58.21 78.04) ) ) (filled_polygon (pts (xy 54.756063 78.179774) (xy 54.900226 78.323937) (xy 55.069744 78.437205) (xy 55.258102 78.515226) (xy 55.458061 78.555) (xy 55.661939 78.555) (xy 55.861898 78.515226) (xy 56.050256 78.437205) (xy 56.219774 78.323937) (xy 56.363937 78.179774) (xy 56.372472 78.167) (xy 58.083 78.167) (xy 58.083 87.08399) (xy 50.571621 87.08399) (xy 50.047 86.559369) (xy 50.047 78.167) (xy 54.747528 78.167) ) ) ) )
KiCad
4
ankitp4t3l/ferris
0.1/base/ferris.kicad_pcb
[ "CC0-1.0" ]
<%namespace name="ie" file="ie.mako" /> <% import random import string # Sets ID and sets up a lot of other variables ie_request.load_deploy_config() # get an API key for AskOmics askomics_api_key = ie_request.notebook_pw # Get ids of selected datasets additional_ids = trans.request.params.get('additional_dataset_ids', None) if not additional_ids: additional_ids = str(trans.security.encode_id( hda.id ) ) else: additional_ids += "," + trans.security.encode_id( hda.id ) # Launch the IE. This builds and runs the docker command in the background. ie_request.launch( additional_ids=additional_ids if ie_request.use_volumes else None, env_override={ 'ASKO_load_url': 'http://localhost:6543', 'ASKOMICS_API_KEY': askomics_api_key, 'ASKO_files_dir': '/tmp/askomics-ie', 'VIRT_Parameters_NumberOfBuffers': 10000, # see https://github.com/xgaia/askomics-docker-compose/tree/master/virtuoso#virtuoso for this values 'VIRT_Parameters_MaxDirtyBuffers': 6000 } ) # Only once the container is launched can we template our URLs. The ie_request # doesn't have all of the information needed until the container is running. url = ie_request.url_template('${PROXY_URL}/login_api_gie?key=' + askomics_api_key) %> <html> <head> ${ ie.load_default_js() } ${ ie.load_default_app() } </head> <body> <script type="text/javascript"> ${ ie.default_javascript_variables() } var url = '${ url }'; load_askomics(url); </script> <div id="main" width="100%" height="100%"> </div> </body> </html>
Mako
4
rikeshi/galaxy
config/plugins/interactive_environments/askomics/templates/askomics.mako
[ "CC-BY-3.0" ]
extends Node var _tests = [ { "id": "Functional Tests/Shapes", "path": "res://tests/functional/test_shapes.tscn", }, { "id": "Functional Tests/Box Stack", "path": "res://tests/functional/test_stack.tscn", }, { "id": "Functional Tests/Box Pyramid", "path": "res://tests/functional/test_pyramid.tscn", }, { "id": "Functional Tests/Collision Pairs", "path": "res://tests/functional/test_collision_pairs.tscn", }, { "id": "Functional Tests/Character - Slopes", "path": "res://tests/functional/test_character_slopes.tscn", }, { "id": "Functional Tests/Character - Tilemap", "path": "res://tests/functional/test_character_tilemap.tscn", }, { "id": "Functional Tests/Character - Pixels", "path": "res://tests/functional/test_character_pixels.tscn", }, { "id": "Functional Tests/One Way Collision", "path": "res://tests/functional/test_one_way_collision.tscn", }, { "id": "Functional Tests/Joints", "path": "res://tests/functional/test_joints.tscn", }, { "id": "Functional Tests/Raycasting", "path": "res://tests/functional/test_raycasting.tscn", }, { "id": "Performance Tests/Broadphase", "path": "res://tests/performance/test_perf_broadphase.tscn", }, { "id": "Performance Tests/Contacts", "path": "res://tests/performance/test_perf_contacts.tscn", }, { "id" : "Performance Tests/Contact Islands", "path" : "res://tests/performance/test_perf_contact_islands.tscn", }, ] func _ready(): var test_menu = $TestsMenu for test in _tests: test_menu.add_test(test.id, test.path)
GDScript
4
jonbonazza/godot-demo-projects
2d/physics_tests/tests.gd
[ "MIT" ]
# © Microsoft. All rights reserved. #' Add together two numbers. #' #' @param x A number. #' @param y A number. #' @return The sum of \code{x} and \code{y}. #' @examples #' add(1, 1) #' add(10, 1) add <- function(x, y) { x + y } add(1, -2, 2.0) add(1.0e10, 2.0e10) paste("one", NULL) paste(NA, 'two') paste("multi- line", 'multi- line')
R
4
sbj42/vscode
extensions/vscode-colorize-tests/test/colorize-fixtures/test.r
[ "MIT" ]
"""Constants for the Co2signal integration.""" DOMAIN = "co2signal" CONF_COUNTRY_CODE = "country_code" ATTRIBUTION = "Data provided by CO2signal"
Python
2
MrDelik/core
homeassistant/components/co2signal/const.py
[ "Apache-2.0" ]
(set-info :smt-lib-version 2.6) (set-logic QF_UFLRA) (set-info :source |CPAchecker with k-induction on SV-COMP14 program using MathSAT5, submitted by Philipp Wendler, http://cpachecker.sosy-lab.org|) (set-info :category "industrial") (set-info :status sat) (define-fun _1 () Bool true) (declare-fun ___pc@1 () Real) (define-fun _7 () Real 0) (define-fun _14 () Real 17) (define-fun _237 () Real ___pc@1) (define-fun _238 () Bool (= _237 _14)) (define-fun _240 () Bool (not _238)) (define-fun _241 () Bool (= _237 _7)) (define-fun _244 () Bool (not _241)) (define-fun _245 () Bool (and _240 _244)) (define-fun _246 () Real 23) (define-fun _247 () Bool (= _237 _246)) (define-fun _250 () Bool (not _247)) (define-fun _251 () Bool (and _245 _250)) (define-fun _252 () Real 10) (define-fun _253 () Bool (= _237 _252)) (define-fun _256 () Bool (not _253)) (define-fun _257 () Bool (and _251 _256)) (define-fun _258 () Real 16) (define-fun _259 () Bool (= _237 _258)) (define-fun _262 () Bool (not _259)) (define-fun _263 () Bool (and _257 _262)) (define-fun _264 () Real 9) (define-fun _265 () Bool (= _237 _264)) (define-fun _268 () Bool (not _265)) (define-fun _269 () Bool (and _263 _268)) (define-fun _270 () Real 15) (define-fun _271 () Bool (= _237 _270)) (define-fun _274 () Bool (not _271)) (define-fun _275 () Bool (and _269 _274)) (define-fun _276 () Real 8) (define-fun _277 () Bool (= _237 _276)) (define-fun _280 () Bool (not _277)) (define-fun _281 () Bool (and _275 _280)) (define-fun _282 () Real 14) (define-fun _283 () Bool (= _237 _282)) (define-fun _286 () Bool (not _283)) (define-fun _287 () Bool (and _281 _286)) (define-fun _288 () Real 7) (define-fun _289 () Bool (= _237 _288)) (define-fun _292 () Bool (not _289)) (define-fun _293 () Bool (and _287 _292)) (define-fun _294 () Real 13) (define-fun _295 () Bool (= _237 _294)) (define-fun _298 () Bool (not _295)) (define-fun _299 () Bool (and _293 _298)) (define-fun _300 () Real 6) (define-fun _301 () Bool (= _237 _300)) (define-fun _304 () Bool (not _301)) (define-fun _305 () Bool (and _299 _304)) (define-fun _306 () Real 12) (define-fun _307 () Bool (= _237 _306)) (define-fun _310 () Bool (not _307)) (define-fun _311 () Bool (and _305 _310)) (define-fun _312 () Real 22) (define-fun _313 () Bool (= _237 _312)) (define-fun _316 () Bool (not _313)) (define-fun _317 () Bool (and _311 _316)) (define-fun _318 () Real 5) (define-fun _319 () Bool (= _237 _318)) (define-fun _322 () Bool (not _319)) (define-fun _323 () Bool (and _317 _322)) (define-fun _324 () Real 28) (define-fun _325 () Bool (= _237 _324)) (define-fun _328 () Bool (not _325)) (define-fun _329 () Bool (and _323 _328)) (define-fun _330 () Real 21) (define-fun _331 () Bool (= _237 _330)) (define-fun _334 () Bool (not _331)) (define-fun _335 () Bool (and _329 _334)) (define-fun _336 () Real 4) (define-fun _337 () Bool (= _237 _336)) (define-fun _340 () Bool (not _337)) (define-fun _341 () Bool (and _335 _340)) (define-fun _342 () Real 27) (define-fun _343 () Bool (= _237 _342)) (define-fun _346 () Bool (not _343)) (define-fun _347 () Bool (and _341 _346)) (define-fun _348 () Real 20) (define-fun _349 () Bool (= _237 _348)) (define-fun _352 () Bool (not _349)) (define-fun _353 () Bool (and _347 _352)) (define-fun _354 () Real 3) (define-fun _355 () Bool (= _237 _354)) (define-fun _358 () Bool (not _355)) (define-fun _359 () Bool (and _353 _358)) (define-fun _360 () Real 26) (define-fun _361 () Bool (= _237 _360)) (define-fun _364 () Bool (not _361)) (define-fun _365 () Bool (and _359 _364)) (define-fun _366 () Real 19) (define-fun _367 () Bool (= _237 _366)) (define-fun _370 () Bool (not _367)) (define-fun _371 () Bool (and _365 _370)) (define-fun _372 () Real 2) (define-fun _373 () Bool (= _237 _372)) (define-fun _375 () Bool (and _371 _373)) (assert _1) (assert _375) (check-sat) (exit)
SMT
2
livinlife6751/infer
sledge/test/smt/QF_UFLRA/cpachecker-induction-svcomp14/cpachecker-induction.m0_true-unreach-call_drivers-staging-comedi-drivers-ni_pcidio-ko--107_1a--adbbc36.c.smt2
[ "MIT" ]
#include "EXTERN.h" #include "perl.h" #include "XSUB.h" #ifdef I_LANGINFO # define __USE_GNU 1 /* Enables YESSTR, otherwise only __YESSTR. */ # include <langinfo.h> #endif #include "const-c.inc" MODULE = I18N::Langinfo PACKAGE = I18N::Langinfo PROTOTYPES: ENABLE INCLUDE: const-xs.inc SV* langinfo(code) int code CODE: #ifdef HAS_NL_LANGINFO { char *s; if ((s = nl_langinfo(code))) RETVAL = newSVpvn(s, strlen(s)); else RETVAL = &PL_sv_undef; } #else croak("nl_langinfo() not implemented on this architecture"); #endif OUTPUT: RETVAL
XS
3
vlinhd11/vlinhd11-android-scripting
perl/src/ext/I18N-Langinfo/Langinfo.xs
[ "Apache-2.0" ]
<td class="{{#classNames}}{{.}} {{/classNames}}"> {{#checkbox}} <input type="checkbox" name="{{value}}"/> {{/checkbox}} {{^checkbox}} {{#url}}<a href="{{.}}"></span>{{/url}}{{#hint}}<abbr title="{{.}}">{{/hint}}{{value}}</a>{{#hint}}</abbr>{{/hint}} {{/checkbox}} </td>
HTML+Django
3
easyteacher/joplin
packages/server/src/views/partials/tableRowItem.mustache
[ "MIT" ]
.bytecode 50.0 .class A .super java/lang/Object .method m()V invokestatic A/a_A001()V invokestatic A/b_A003()V invokestatic A/c_A005()I pop invokestatic T/d()I pop return .limit locals 1 .limit stack 1 .end method .method private static synthetic a_A001()V new d2j/gen/MI__000 dup aconst_null aconst_null iconst_0 invokespecial d2j/gen/MI__000/<init>(Ljava/lang/Object;[Ljava/lang/Object;I)V invokestatic B/a(Lp;)Ljava/lang/Object; pop return .limit locals 0 .limit stack 5 .end method .method public static a_CB002([Ljava/lang/Object;)Ljava/lang/Object; invokestatic T/a()V aconst_null areturn .limit locals 1 .limit stack 1 .end method .method private static synthetic b_A003()V new d2j/gen/MI__000 dup aconst_null aconst_null iconst_1 invokespecial d2j/gen/MI__000/<init>(Ljava/lang/Object;[Ljava/lang/Object;I)V invokestatic B/b(Lp;)V return .limit locals 0 .limit stack 5 .end method .method public static b_CB004([Ljava/lang/Object;)Ljava/lang/Object; invokestatic T/b()V aconst_null areturn .limit locals 1 .limit stack 1 .end method .method private static synthetic c_A005()I new d2j/gen/MI__000 dup aconst_null aconst_null iconst_2 invokespecial d2j/gen/MI__000/<init>(Ljava/lang/Object;[Ljava/lang/Object;I)V invokestatic B/c(Lp;)Ljava/lang/Object; checkcast java/lang/Number invokevirtual java/lang/Number/intValue()I ireturn .limit locals 0 .limit stack 5 .end method .method public static c_CB006([Ljava/lang/Object;)Ljava/lang/Object; invokestatic T/c()I invokestatic java/lang/Integer/valueOf(I)Ljava/lang/Integer; areturn .limit locals 1 .limit stack 1 .end method
Jasmin
1
Mrack/dex2jar
dex-tools/src/test/resources/weave/c-after.j
[ "Apache-2.0" ]
method ack (m : Number, n : Number) -> Number { print "ack {m} {n}" if (m < = 0) then {n + 1} elseif {n <= 0} then {ack((m -1), 1)} else {ack(m -1, ack(m, n-1))} }
Grace
4
JavascriptID/sourcerer-app
src/test/resources/samples/langs/Grace/ackerman_function.grace
[ "MIT" ]
new arr1[]; new arr2[5][]; new arr3[5][][5]; new arr4[5][5]; new arr5[][]; f1(arr[]) { #pragma unused arr } f2(arr[5][]) { #pragma unused arr } f3(arr[5][][5]) { #pragma unused arr } f4(arr[5][5]) { #pragma unused arr } f5(arr[][]) { #pragma unused arr } main () { arr1[0] = 0; arr2[0][0] = 0; arr3[0][0][0] = 0; arr4[0][0] = 0; arr5[0][0] = 0; new a = sizeof(arr1); a = sizeof(arr1[]); a = sizeof(arr5[][]); #pragma unused a f1(arr1); f2(arr2); f3(arr3); f4(arr4); f5(arr5); }
PAWN
2
pawn-lang/pawn
source/compiler/tests/md_array_size_chk_gh_314.pwn
[ "Zlib" ]
<?xml version="1.0" encoding="utf-8" standalone="yes"?> <Project DefaultTargets="Build" xmlns="http://schemas.microsoft.com/developer/msbuild/2003" ToolsVersion="4.0"> <PropertyGroup> <RootNamespace>SampleServer</RootNamespace> <OutputType>WinExe</OutputType> <AssemblyName>SampleServer</AssemblyName> <AllowGlobals>False</AllowGlobals> <AllowLegacyCreate>False</AllowLegacyCreate> <ApplicationIcon>Properties\App.ico</ApplicationIcon> <Configuration Condition="'$(Configuration)' == ''">Release</Configuration> <ProjectGuid>{90E5FBCE-0445-40DB-BEC8-933B393487FE}</ProjectGuid> <TargetFramework>.NETFramework4.0</TargetFramework> </PropertyGroup> <PropertyGroup Condition=" '$(Configuration)' == 'Debug' "> <DefineConstants>DEBUG;TRACE;</DefineConstants> <OutputPath>.\bin\Debug</OutputPath> <GeneratePDB>True</GeneratePDB> </PropertyGroup> <PropertyGroup Condition=" '$(Configuration)' == 'Release' "> <OutputPath>.\bin\Release</OutputPath> <EnableAsserts>False</EnableAsserts> </PropertyGroup> <ItemGroup> <Reference Include="mscorlib" /> <Reference Include="System" /> <Reference Include="System.Data" /> <Reference Include="System.Drawing" /> <Reference Include="System.Windows.Forms" /> <Reference Include="System.Xml" /> <ProjectReference Include="RemObjects.InternetPack.Echoes"> <Project>{774B9AE9-B695-4908-B24F-5482556D6175}</Project> <ProjectFile>..\..\..\Source\RemObjects.InternetPack.Echoes.elements</ProjectFile> <Private>True</Private> </ProjectReference> </ItemGroup> <ItemGroup> <Compile Include="Properties\AssemblyInfo.pas" /> <Compile Include="MainForm.pas"> <SubType>Form</SubType> <DesignableClassName>SampleServer.MainForm</DesignableClassName> </Compile> <Content Include="Properties\App.ico"> <SubType>Content</SubType> </Content> <EmbeddedResource Include="MainForm.resx" /> <Content Include="HttpRoot\index.html"> <CopyToOutputDirectory>PreserveNewest</CopyToOutputDirectory> </Content> <Content Include="HttpRoot\ip.png"> <CopyToOutputDirectory>PreserveNewest</CopyToOutputDirectory> </Content> <Content Include="HttpRoot\Styles.css"> <CopyToOutputDirectory>PreserveNewest</CopyToOutputDirectory> </Content> </ItemGroup> <ItemGroup> <Folder Include="HttpRoot\" /> <Folder Include="Properties\" /> </ItemGroup> <Import Project="$(MSBuildExtensionsPath)\RemObjects Software\Elements\RemObjects.Elements.Echoes.targets" /> <PropertyGroup> <PreBuildEvent /> </PropertyGroup> </Project>
Oxygene
3
remobjects/internetpack
Samples/Oxygene/Sample Server/SampleServer.oxygene
[ "BSD-2-Clause" ]
size: 200mm 300mm; dpi: 240;
CLIPS
0
asmuth-archive/travistest
test/layer/resize_mm_dpi.clp
[ "Apache-2.0" ]
/** * This file is part of the Phalcon Framework. * * (c) Phalcon Team <team@phalcon.io> * * For the full copyright and license information, please view the LICENSE.txt * file that was distributed with this source code. */ namespace Phalcon\Mvc\Model; use Phalcon\Mvc\ModelInterface; /** * Phalcon\Mvc\Model\BehaviorInterface * * Interface for Phalcon\Mvc\Model\Behavior */ interface BehaviorInterface { /** * Calls a method when it's missing in the model */ public function missingMethod(<ModelInterface> model, string! method, array arguments = []); /** * This method receives the notifications from the EventsManager */ public function notify(string! type, <ModelInterface> model); }
Zephir
4
tidytrax/cphalcon
phalcon/Mvc/Model/BehaviorInterface.zep
[ "BSD-3-Clause" ]
.example-stretched-tabs { max-width: 800px; }
CSS
1
MarkArranz/material2
src/material-examples/tab-group-stretched/tab-group-stretched-example.css
[ "MIT" ]
load 'tables/csv' pop_table =: readcsv 'world-population.csv' get_country =: 4 : '(0 { x = (< y))' country_table =: monad : ', (#~ ((get_country & y) " 1)) pop_table' country_total =: monad : 'makenum 1 { country_table y' NB. two-letter abbreviations based on domain codes us_pop =: country_total 'United States of America' it_pop =: country_total 'Italy' fr_pop =: country_total 'France' vn_pop =: country_total 'Viet Nam' sk_pop =: country_total 'Republic of Korea' nz_pop =: country_total 'New Zealand' de_pop =: country_total 'Germany' se_pop =: country_total 'Sweden' dk_pop =: country_total 'Denmark' no_pop =: country_total 'Norway' fi_pop =: country_total 'Finland' es_pop =: country_total 'Spain' macau_pop =: country_total 'China, Macao SAR' taiwan_pop =: country_total 'China, Taiwan Province of China' br_pop =: country_total 'Brazil' thailand_pop =: country_total 'Thailand' malaysia_pop =: country_total 'Malaysia' in_pop =: country_total 'India' uk_pop =: country_total 'United Kingdom' nl_pop =: country_total 'Netherlands' sg_pop =: country_total 'Singapore' be_pop =: country_total 'Belgium' au_pop =: country_total 'Australia' cn_pop =: country_total 'China' ca_pop =: country_total 'Canada' jp_pop =: country_total 'Japan' kenya_pop =: country_total 'Kenya' is_pop =: country_total 'Iceland' sn_pop =: country_total 'Senegal' rw_pop =: country_total 'Rwanda' pe_pop =: country_total 'Peru' za_pop =: country_total 'South Africa' ie_pop =: country_total 'Ireland' pt_pop =: country_total 'Portugal' at_pop =: country_total 'Austria' ch_pop =: country_total 'Switzerland'
J
3
vmchale/coronavirus
world-population.ijs
[ "BSD-3-Clause" ]
public IViewDemo: IView { name = '' css_class = '' set_css_class(names String) { this.css_class = names return this } }
Tea
2
jackwiy/tea
tests/xview/IViewDemo.tea
[ "Apache-2.0" ]
(set-info :smt-lib-version 2.6) (set-logic QF_UFLRA) (set-info :source |CPAchecker with k-induction on SV-COMP14 program using MathSAT5, submitted by Philipp Wendler, http://cpachecker.sosy-lab.org|) (set-info :category "industrial") (set-info :status unsat) (define-fun _1 () Bool true) (declare-fun |main::lk4@6| () Real) (declare-fun |main::lk2@3| () Real) (declare-fun |main::lk4@2| () Real) (declare-fun |main::lk3@2| () Real) (declare-fun |main::lk1@6| () Real) (declare-fun |main::lk5@2| () Real) (declare-fun |main::lk3@5| () Real) (declare-fun |main::cond@3| () Real) (declare-fun |main::lk6@2| () Real) (declare-fun |main::p7@1| () Real) (declare-fun |main::p5@1| () Real) (declare-fun |main::lk3@4| () Real) (declare-fun |main::lk1@2| () Real) (declare-fun |main::lk5@7| () Real) (declare-fun |main::lk4@3| () Real) (declare-fun |main::lk2@7| () Real) (declare-fun |main::lk6@3| () Real) (declare-fun |main::lk1@7| () Real) (declare-fun |main::lk6@4| () Real) (declare-fun |main::lk8@2| () Real) (declare-fun |main::lk8@3| () Real) (declare-fun |main::lk1@3| () Real) (declare-fun |main::lk2@6| () Real) (declare-fun |main::lk4@4| () Real) (declare-fun |main::lk6@5| () Real) (declare-fun |main::lk7@4| () Real) (declare-fun |main::p3@1| () Real) (declare-fun |main::lk1@4| () Real) (declare-fun |main::lk8@5| () Real) (declare-fun |main::lk4@5| () Real) (declare-fun |main::p8@1| () Real) (declare-fun |main::lk8@4| () Real) (declare-fun |main::lk2@4| () Real) (declare-fun |main::lk5@4| () Real) (declare-fun |main::lk2@5| () Real) (declare-fun |main::lk4@7| () Real) (declare-fun |main::p4@1| () Real) (declare-fun |main::p2@1| () Real) (declare-fun |main::p6@1| () Real) (declare-fun |main::cond@2| () Real) (declare-fun |main::lk3@6| () Real) (declare-fun |main::p1@1| () Real) (declare-fun |main::lk7@2| () Real) (declare-fun |main::lk2@2| () Real) (declare-fun |main::lk7@3| () Real) (declare-fun |main::lk7@6| () Real) (declare-fun |main::lk3@7| () Real) (declare-fun |main::lk5@5| () Real) (declare-fun |main::lk8@6| () Real) (declare-fun |main::lk7@7| () Real) (declare-fun |main::lk6@7| () Real) (declare-fun |main::lk5@6| () Real) (declare-fun |main::lk7@5| () Real) (declare-fun |main::lk6@6| () Real) (declare-fun |main::lk3@3| () Real) (declare-fun |main::lk5@3| () Real) (declare-fun |main::lk1@5| () Real) (define-fun _7 () Real 0) (define-fun _75 () Real |main::cond@3|) (define-fun _76 () Bool (= _75 _7)) (define-fun _77 () Real 1) (define-fun _80 () Bool (not _76)) (define-fun _82 () Real |main::lk1@3|) (define-fun _85 () Real |main::lk2@3|) (define-fun _88 () Real |main::lk3@3|) (define-fun _91 () Real |main::lk4@3|) (define-fun _94 () Real |main::lk5@3|) (define-fun _97 () Real |main::lk6@3|) (define-fun _100 () Real |main::lk7@3|) (define-fun _103 () Real |main::lk8@3|) (define-fun _112 () Real |main::lk1@4|) (define-fun _115 () Bool (= _82 _112)) (define-fun _124 () Real |main::lk2@4|) (define-fun _127 () Bool (= _85 _124)) (define-fun _136 () Real |main::lk3@4|) (define-fun _139 () Bool (= _88 _136)) (define-fun _148 () Real |main::lk4@4|) (define-fun _151 () Bool (= _91 _148)) (define-fun _160 () Real |main::lk5@4|) (define-fun _163 () Bool (= _94 _160)) (define-fun _172 () Real |main::lk6@4|) (define-fun _175 () Bool (= _97 _172)) (define-fun _184 () Real |main::lk7@4|) (define-fun _187 () Bool (= _100 _184)) (define-fun _196 () Real |main::lk8@4|) (define-fun _199 () Bool (= _103 _196)) (define-fun _208 () Real |main::lk1@5|) (define-fun _209 () Bool (= _208 _7)) (define-fun _220 () Real |main::lk2@5|) (define-fun _221 () Bool (= _220 _7)) (define-fun _232 () Real |main::lk3@5|) (define-fun _233 () Bool (= _232 _7)) (define-fun _244 () Real |main::lk4@5|) (define-fun _245 () Bool (= _244 _7)) (define-fun _256 () Real |main::lk5@5|) (define-fun _257 () Bool (= _256 _7)) (define-fun _268 () Real |main::lk6@5|) (define-fun _269 () Bool (= _268 _7)) (define-fun _280 () Real |main::lk7@5|) (define-fun _281 () Bool (= _280 _7)) (define-fun _292 () Real |main::lk8@5|) (define-fun _293 () Bool (= _292 _7)) (define-fun _338 () Real |main::cond@2|) (define-fun _339 () Bool (= _338 _7)) (define-fun _341 () Bool (not _339)) (define-fun _342 () Real |main::lk1@2|) (define-fun _343 () Bool (= _342 _7)) (define-fun _344 () Bool (and _341 _343)) (define-fun _345 () Real |main::lk2@2|) (define-fun _346 () Bool (= _345 _7)) (define-fun _347 () Bool (and _344 _346)) (define-fun _348 () Real |main::lk3@2|) (define-fun _349 () Bool (= _348 _7)) (define-fun _350 () Bool (and _347 _349)) (define-fun _351 () Real |main::lk4@2|) (define-fun _352 () Bool (= _351 _7)) (define-fun _353 () Bool (and _350 _352)) (define-fun _354 () Real |main::lk5@2|) (define-fun _355 () Bool (= _354 _7)) (define-fun _356 () Bool (and _353 _355)) (define-fun _357 () Real |main::lk6@2|) (define-fun _358 () Bool (= _357 _7)) (define-fun _359 () Bool (and _356 _358)) (define-fun _360 () Real |main::lk7@2|) (define-fun _361 () Bool (= _360 _7)) (define-fun _362 () Bool (and _359 _361)) (define-fun _363 () Real |main::lk8@2|) (define-fun _364 () Bool (= _363 _7)) (define-fun _365 () Bool (and _362 _364)) (define-fun _366 () Real |main::p1@1|) (define-fun _367 () Bool (= _366 _7)) (define-fun _368 () Bool (not _367)) (define-fun _370 () Bool (and _365 _368)) (define-fun _371 () Bool (and _365 _367)) (define-fun _372 () Bool (= _82 _77)) (define-fun _373 () Bool (and _370 _372)) (define-fun _374 () Bool (= _82 _342)) (define-fun _375 () Bool (and _371 _374)) (define-fun _376 () Bool (or _373 _375)) (define-fun _377 () Real |main::p2@1|) (define-fun _378 () Bool (= _377 _7)) (define-fun _379 () Bool (not _378)) (define-fun _381 () Bool (and _376 _379)) (define-fun _382 () Bool (and _376 _378)) (define-fun _383 () Bool (= _85 _77)) (define-fun _384 () Bool (and _381 _383)) (define-fun _385 () Bool (= _85 _345)) (define-fun _386 () Bool (and _382 _385)) (define-fun _387 () Bool (or _384 _386)) (define-fun _388 () Real |main::p3@1|) (define-fun _389 () Bool (= _388 _7)) (define-fun _390 () Bool (not _389)) (define-fun _392 () Bool (and _387 _390)) (define-fun _393 () Bool (and _387 _389)) (define-fun _394 () Bool (= _88 _77)) (define-fun _395 () Bool (and _392 _394)) (define-fun _396 () Bool (= _88 _348)) (define-fun _397 () Bool (and _393 _396)) (define-fun _398 () Bool (or _395 _397)) (define-fun _399 () Real |main::p4@1|) (define-fun _400 () Bool (= _399 _7)) (define-fun _401 () Bool (not _400)) (define-fun _403 () Bool (and _398 _401)) (define-fun _404 () Bool (and _398 _400)) (define-fun _405 () Bool (= _91 _77)) (define-fun _406 () Bool (and _403 _405)) (define-fun _407 () Bool (= _91 _351)) (define-fun _408 () Bool (and _404 _407)) (define-fun _409 () Bool (or _406 _408)) (define-fun _410 () Real |main::p5@1|) (define-fun _411 () Bool (= _410 _7)) (define-fun _412 () Bool (not _411)) (define-fun _414 () Bool (and _409 _412)) (define-fun _415 () Bool (and _409 _411)) (define-fun _416 () Bool (= _94 _77)) (define-fun _417 () Bool (and _414 _416)) (define-fun _418 () Bool (= _94 _354)) (define-fun _419 () Bool (and _415 _418)) (define-fun _420 () Bool (or _417 _419)) (define-fun _421 () Real |main::p6@1|) (define-fun _422 () Bool (= _421 _7)) (define-fun _423 () Bool (not _422)) (define-fun _425 () Bool (and _420 _423)) (define-fun _426 () Bool (and _420 _422)) (define-fun _427 () Bool (= _97 _77)) (define-fun _428 () Bool (and _425 _427)) (define-fun _429 () Bool (= _97 _357)) (define-fun _430 () Bool (and _426 _429)) (define-fun _431 () Bool (or _428 _430)) (define-fun _432 () Real |main::p7@1|) (define-fun _433 () Bool (= _432 _7)) (define-fun _434 () Bool (not _433)) (define-fun _436 () Bool (and _431 _434)) (define-fun _437 () Bool (and _431 _433)) (define-fun _438 () Bool (= _100 _77)) (define-fun _439 () Bool (and _436 _438)) (define-fun _440 () Bool (= _100 _360)) (define-fun _441 () Bool (and _437 _440)) (define-fun _442 () Bool (or _439 _441)) (define-fun _443 () Real |main::p8@1|) (define-fun _444 () Bool (= _443 _7)) (define-fun _445 () Bool (not _444)) (define-fun _447 () Bool (and _442 _445)) (define-fun _448 () Bool (and _442 _444)) (define-fun _449 () Bool (= _103 _77)) (define-fun _450 () Bool (and _447 _449)) (define-fun _451 () Bool (= _103 _363)) (define-fun _452 () Bool (and _448 _451)) (define-fun _453 () Bool (or _450 _452)) (define-fun _454 () Bool (and _368 _453)) (define-fun _455 () Bool (and _367 _453)) (define-fun _459 () Bool (and _372 _454)) (define-fun _460 () Bool (= _112 _7)) (define-fun _461 () Bool (and _459 _460)) (define-fun _462 () Bool (and _115 _455)) (define-fun _463 () Bool (or _461 _462)) (define-fun _464 () Bool (and _379 _463)) (define-fun _465 () Bool (and _378 _463)) (define-fun _469 () Bool (and _383 _464)) (define-fun _470 () Bool (= _124 _7)) (define-fun _471 () Bool (and _469 _470)) (define-fun _472 () Bool (and _127 _465)) (define-fun _473 () Bool (or _471 _472)) (define-fun _474 () Bool (and _390 _473)) (define-fun _475 () Bool (and _389 _473)) (define-fun _479 () Bool (and _394 _474)) (define-fun _480 () Bool (= _136 _7)) (define-fun _481 () Bool (and _479 _480)) (define-fun _482 () Bool (and _139 _475)) (define-fun _483 () Bool (or _481 _482)) (define-fun _484 () Bool (and _401 _483)) (define-fun _485 () Bool (and _400 _483)) (define-fun _489 () Bool (and _405 _484)) (define-fun _490 () Bool (= _148 _7)) (define-fun _491 () Bool (and _489 _490)) (define-fun _492 () Bool (and _151 _485)) (define-fun _493 () Bool (or _491 _492)) (define-fun _494 () Bool (and _412 _493)) (define-fun _495 () Bool (and _411 _493)) (define-fun _499 () Bool (and _416 _494)) (define-fun _500 () Bool (= _160 _7)) (define-fun _501 () Bool (and _499 _500)) (define-fun _502 () Bool (and _163 _495)) (define-fun _503 () Bool (or _501 _502)) (define-fun _504 () Bool (and _423 _503)) (define-fun _505 () Bool (and _422 _503)) (define-fun _509 () Bool (and _427 _504)) (define-fun _510 () Bool (= _172 _7)) (define-fun _511 () Bool (and _509 _510)) (define-fun _512 () Bool (and _175 _505)) (define-fun _513 () Bool (or _511 _512)) (define-fun _514 () Bool (and _434 _513)) (define-fun _515 () Bool (and _433 _513)) (define-fun _519 () Bool (and _438 _514)) (define-fun _520 () Bool (= _184 _7)) (define-fun _521 () Bool (and _519 _520)) (define-fun _522 () Bool (and _187 _515)) (define-fun _523 () Bool (or _521 _522)) (define-fun _524 () Bool (and _445 _523)) (define-fun _525 () Bool (and _444 _523)) (define-fun _529 () Bool (and _449 _524)) (define-fun _530 () Bool (= _196 _7)) (define-fun _531 () Bool (and _529 _530)) (define-fun _532 () Bool (and _199 _525)) (define-fun _533 () Bool (or _531 _532)) (define-fun _535 () Bool (and _80 _533)) (define-fun _563 () Bool (and _209 _535)) (define-fun _564 () Bool (and _221 _563)) (define-fun _565 () Bool (and _233 _564)) (define-fun _566 () Bool (and _245 _565)) (define-fun _567 () Bool (and _257 _566)) (define-fun _568 () Bool (and _269 _567)) (define-fun _569 () Bool (and _281 _568)) (define-fun _570 () Bool (and _293 _569)) (define-fun _571 () Bool (and _368 _570)) (define-fun _572 () Bool (and _367 _570)) (define-fun _573 () Real |main::lk1@6|) (define-fun _574 () Bool (= _573 _77)) (define-fun _575 () Bool (and _571 _574)) (define-fun _576 () Bool (= _208 _573)) (define-fun _577 () Bool (and _572 _576)) (define-fun _578 () Bool (or _575 _577)) (define-fun _579 () Bool (and _379 _578)) (define-fun _580 () Bool (and _378 _578)) (define-fun _581 () Real |main::lk2@6|) (define-fun _582 () Bool (= _581 _77)) (define-fun _583 () Bool (and _579 _582)) (define-fun _584 () Bool (= _220 _581)) (define-fun _585 () Bool (and _580 _584)) (define-fun _586 () Bool (or _583 _585)) (define-fun _587 () Bool (and _390 _586)) (define-fun _588 () Bool (and _389 _586)) (define-fun _589 () Real |main::lk3@6|) (define-fun _590 () Bool (= _589 _77)) (define-fun _591 () Bool (and _587 _590)) (define-fun _592 () Bool (= _232 _589)) (define-fun _593 () Bool (and _588 _592)) (define-fun _594 () Bool (or _591 _593)) (define-fun _595 () Bool (and _401 _594)) (define-fun _596 () Bool (and _400 _594)) (define-fun _597 () Real |main::lk4@6|) (define-fun _598 () Bool (= _597 _77)) (define-fun _599 () Bool (and _595 _598)) (define-fun _600 () Bool (= _244 _597)) (define-fun _601 () Bool (and _596 _600)) (define-fun _602 () Bool (or _599 _601)) (define-fun _603 () Bool (and _412 _602)) (define-fun _604 () Bool (and _411 _602)) (define-fun _605 () Real |main::lk5@6|) (define-fun _606 () Bool (= _605 _77)) (define-fun _607 () Bool (and _603 _606)) (define-fun _608 () Bool (= _256 _605)) (define-fun _609 () Bool (and _604 _608)) (define-fun _610 () Bool (or _607 _609)) (define-fun _611 () Bool (and _423 _610)) (define-fun _612 () Bool (and _422 _610)) (define-fun _613 () Real |main::lk6@6|) (define-fun _614 () Bool (= _613 _77)) (define-fun _615 () Bool (and _611 _614)) (define-fun _616 () Bool (= _268 _613)) (define-fun _617 () Bool (and _612 _616)) (define-fun _618 () Bool (or _615 _617)) (define-fun _619 () Bool (and _434 _618)) (define-fun _620 () Bool (and _433 _618)) (define-fun _621 () Real |main::lk7@6|) (define-fun _622 () Bool (= _621 _77)) (define-fun _623 () Bool (and _619 _622)) (define-fun _624 () Bool (= _280 _621)) (define-fun _625 () Bool (and _620 _624)) (define-fun _626 () Bool (or _623 _625)) (define-fun _627 () Bool (and _445 _626)) (define-fun _628 () Bool (and _444 _626)) (define-fun _629 () Real |main::lk8@6|) (define-fun _630 () Bool (= _629 _77)) (define-fun _631 () Bool (and _627 _630)) (define-fun _632 () Bool (= _292 _629)) (define-fun _633 () Bool (and _628 _632)) (define-fun _634 () Bool (or _631 _633)) (define-fun _635 () Bool (and _368 _634)) (define-fun _636 () Bool (and _367 _634)) (define-fun _640 () Bool (and _574 _635)) (define-fun _659 () Real |main::lk1@7|) (define-fun _660 () Bool (= _659 _7)) (define-fun _661 () Bool (and _640 _660)) (define-fun _662 () Bool (= _573 _659)) (define-fun _663 () Bool (and _636 _662)) (define-fun _664 () Bool (or _661 _663)) (define-fun _665 () Bool (and _379 _664)) (define-fun _666 () Bool (and _378 _664)) (define-fun _670 () Bool (and _582 _665)) (define-fun _682 () Real |main::lk2@7|) (define-fun _683 () Bool (= _682 _7)) (define-fun _684 () Bool (and _670 _683)) (define-fun _685 () Bool (= _581 _682)) (define-fun _686 () Bool (and _666 _685)) (define-fun _687 () Bool (or _684 _686)) (define-fun _688 () Bool (and _390 _687)) (define-fun _689 () Bool (and _389 _687)) (define-fun _693 () Bool (and _590 _688)) (define-fun _704 () Real |main::lk3@7|) (define-fun _705 () Bool (= _704 _7)) (define-fun _706 () Bool (and _693 _705)) (define-fun _707 () Bool (= _589 _704)) (define-fun _708 () Bool (and _689 _707)) (define-fun _709 () Bool (or _706 _708)) (define-fun _710 () Bool (and _401 _709)) (define-fun _711 () Bool (and _400 _709)) (define-fun _715 () Bool (and _598 _710)) (define-fun _725 () Real |main::lk4@7|) (define-fun _726 () Bool (= _725 _7)) (define-fun _727 () Bool (and _715 _726)) (define-fun _728 () Bool (= _597 _725)) (define-fun _729 () Bool (and _711 _728)) (define-fun _730 () Bool (or _727 _729)) (define-fun _731 () Bool (and _412 _730)) (define-fun _732 () Bool (and _411 _730)) (define-fun _736 () Bool (and _606 _731)) (define-fun _745 () Real |main::lk5@7|) (define-fun _746 () Bool (= _745 _7)) (define-fun _747 () Bool (and _736 _746)) (define-fun _748 () Bool (= _605 _745)) (define-fun _749 () Bool (and _732 _748)) (define-fun _750 () Bool (or _747 _749)) (define-fun _751 () Bool (and _423 _750)) (define-fun _752 () Bool (and _422 _750)) (define-fun _756 () Bool (and _614 _751)) (define-fun _764 () Real |main::lk6@7|) (define-fun _765 () Bool (= _764 _7)) (define-fun _766 () Bool (and _756 _765)) (define-fun _767 () Bool (= _613 _764)) (define-fun _768 () Bool (and _752 _767)) (define-fun _769 () Bool (or _766 _768)) (define-fun _770 () Bool (and _434 _769)) (define-fun _771 () Bool (and _433 _769)) (define-fun _775 () Bool (and _622 _770)) (define-fun _782 () Real |main::lk7@7|) (define-fun _783 () Bool (= _782 _7)) (define-fun _784 () Bool (and _775 _783)) (define-fun _785 () Bool (= _621 _782)) (define-fun _786 () Bool (and _771 _785)) (define-fun _787 () Bool (or _784 _786)) (define-fun _788 () Bool (and _445 _787)) (define-fun _843 () Bool (not _710)) (define-fun _844 () Bool (or _598 _843)) (define-fun _846 () Bool (not _770)) (define-fun _847 () Bool (or _622 _846)) (define-fun _848 () Bool (and _844 _847)) (define-fun _850 () Bool (not _665)) (define-fun _851 () Bool (or _582 _850)) (define-fun _852 () Bool (and _848 _851)) (define-fun _854 () Bool (not _751)) (define-fun _855 () Bool (or _614 _854)) (define-fun _856 () Bool (and _852 _855)) (define-fun _858 () Bool (not _688)) (define-fun _859 () Bool (or _590 _858)) (define-fun _860 () Bool (and _856 _859)) (define-fun _862 () Bool (not _731)) (define-fun _863 () Bool (or _606 _862)) (define-fun _864 () Bool (and _860 _863)) (define-fun _866 () Bool (not _788)) (define-fun _867 () Bool (or _630 _866)) (define-fun _868 () Bool (and _864 _867)) (define-fun _870 () Bool (not _635)) (define-fun _871 () Bool (or _574 _870)) (define-fun _872 () Bool (and _868 _871)) (define-fun _873 () Bool (not _872)) (assert _1) (assert _873) (check-sat) (exit)
SMT
2
livinlife6751/infer
sledge/test/smt/QF_UFLRA/cpachecker-induction-svcomp14/cpachecker-induction.test_locks_8_true-unreach-call_false-termination.c.smt2
[ "MIT" ]
package com.baeldung.time; import static org.junit.Assert.assertEquals; import java.time.Duration; import java.time.Instant; import java.util.concurrent.TimeUnit; import org.apache.commons.lang3.time.StopWatch; import org.junit.Test; public class ElapsedTimeManualTest { @Test public void givenRunningTask_whenMeasuringTimeWithCurrentTimeMillis_thenGetElapsedTime() throws InterruptedException { long start = System.currentTimeMillis(); simulateRunningTask(); long finish = System.currentTimeMillis(); long timeElapsed = finish - start; assertEquals(true, (2000L <= timeElapsed) && (timeElapsed <= 3000L)); } @Test public void giveRunningTask_whenMeasuringTimeWithNanoTime_thenGetElapsedTime() throws InterruptedException { long start = System.nanoTime(); simulateRunningTask(); long finish = System.nanoTime(); long timeElapsed = finish - start; assertEquals(true, (2000000000L <= timeElapsed) && (timeElapsed <= 3000000000L)); } @Test public void givenRunningTask_whenMeasuringTimeWithStopWatch_thenGetElapsedTime() throws InterruptedException { StopWatch watch = new StopWatch(); watch.start(); simulateRunningTask(); watch.stop(); long timeElapsed = watch.getTime(); assertEquals(true, (2000L <= timeElapsed) && (timeElapsed <= 3000L)); } /* The below test depends on the elapsed time, which isn't ideal in a test. Also, it slows down test execution artificially. */ @Test public void givenRunningTask_whenMeasuringTimeWithInstantClass_thenGetElapsedTime() throws InterruptedException { Instant start = Instant.now(); System.out.println("start: " + start); simulateRunningTask(); Instant finish = Instant.now(); System.out.println("start: " + start); System.out.println("finish: " + finish); long timeElapsed = Duration.between(start, finish).toMillis(); System.out.println("elapsed: " + timeElapsed); assertEquals(true, (2000L <= timeElapsed) && (timeElapsed <= 3000L)); } /** * Simulate task running for 2.5 seconds. * * @throws InterruptedException */ private static void simulateRunningTask() throws InterruptedException { TimeUnit.MILLISECONDS.sleep(2500); // 2.5 seconds } }
Java
5
DBatOWL/tutorials
core-java-modules/core-java-time-measurements/src/test/java/com/baeldung/time/ElapsedTimeManualTest.java
[ "MIT" ]
CJK_WORD 上海合作组织/nt/shang hai he zuo zu zhi/null 世卫/nt/shi wei/null 世界卫生组织/nt/shi jie wei sheng zu zhi/null 世界银行/nt/shi jie yin hang/null 东盟/nt/dong meng/null 亚太经合组织/nt/ya tai jing he zu zhi/null 人权理事会/nt/ren quan li shi hui/null 六方会谈/nt/liu fang hui tan/null 北约/nt/bei yue/null 哈马斯/nt/ha ma si/null 安全理事会/nt/an quan li shi hui/null 安理会/nt/an li hui/null 欧佩克/nt/ou pei ke/null 红十字会/nt/hong shi zi hui/null 联合国/nt/lian he guo/null
Lex
1
Wing-Luo/jcseg
vendors/lexicon/lex-org.lex
[ "Apache-2.0" ]
INTERFACE zif_abapgit_ecatt_upload PUBLIC . METHODS: set_stream_for_upload IMPORTING iv_xml TYPE xstring. ENDINTERFACE.
ABAP
3
jeevanrajv1901/ABAPGIT
src/objects/ecatt/zif_abapgit_ecatt_upload.intf.abap
[ "MIT" ]
#![warn(clippy::zero_sized_map_values)] use std::collections::HashMap; const CONST_OK: Option<HashMap<String, usize>> = None; const CONST_NOT_OK: Option<HashMap<String, ()>> = None; static STATIC_OK: Option<HashMap<String, usize>> = None; static STATIC_NOT_OK: Option<HashMap<String, ()>> = None; type OkMap = HashMap<String, usize>; type NotOkMap = HashMap<String, ()>; enum TestEnum { Ok(HashMap<String, usize>), NotOk(HashMap<String, ()>), } struct Test { ok: HashMap<String, usize>, not_ok: HashMap<String, ()>, also_not_ok: Vec<HashMap<usize, ()>>, } trait TestTrait { type Output; fn produce_output() -> Self::Output; fn weird_map(&self, map: HashMap<usize, ()>); } impl Test { fn ok(&self) -> HashMap<String, usize> { todo!() } fn not_ok(&self) -> HashMap<String, ()> { todo!() } } impl TestTrait for Test { type Output = HashMap<String, ()>; fn produce_output() -> Self::Output { todo!(); } fn weird_map(&self, map: HashMap<usize, ()>) { todo!(); } } fn test(map: HashMap<String, ()>, key: &str) -> HashMap<String, ()> { todo!(); } fn test2(map: HashMap<String, usize>, key: &str) -> HashMap<String, usize> { todo!(); } fn main() { let _: HashMap<String, ()> = HashMap::new(); let _: HashMap<String, usize> = HashMap::new(); let _: HashMap<_, _> = std::iter::empty::<(String, ())>().collect(); }
Rust
4
narpfel/rust-clippy
tests/ui/zero_sized_hashmap_values.rs
[ "ECL-2.0", "Apache-2.0", "MIT-0", "MIT" ]
CJK_WORD :entity tv_station ###### 直播电视台名称词条语料 ###### 湖南卫视/ntv/hu nan wei shi/null 湖南金鹰卡通卫视/ntv/hu nan jin ying ka tong wei shi/null 北京卫视/ntv/bei jing wei shi/null 北京卡酷动画卫视/ntv/bei jing ka ku wei shi/null 天津卫视/ntv/tian jing wei shi/null 河北卫视/ntv/he bei wei shi/null 河南卫视/ntv/he nan wei shi/null 湖北卫视/ntv/hu bei wei shi/null 江西卫视/ntv/jiang xi wei shi/null 福建东南卫视/ntv/fu jian dong nan wei shi/null 福建海峡卫视/ntv/fu jiang hai xia wei shi/null 厦门卫视/ntv/xia men wei shi/null 广东卫视/ntv/guang dong wei shi/null 广东南方卫视/ntv/guang dong nan fang wei shi/null 广东嘉佳卡通卫视/ntv/guang dong jia jia wei shi/null 深圳卫视/ntv/shen zhen wei shi/null 海南旅游卫视/ntv/hai nan lv you wei shi/null 旅游卫视/ntv/lv you wei shi/null 广西卫视/ntv/guang xi wei shi/null 云南卫视/ntv/yun nan wei shi/null 四川卫视/ntv/si chuan wei shi/null 重庆卫视/ntv/chong qing wei shi/null 贵州卫视/ntv/gui zhou wei shi/null 新疆汉语卫视/ntv/xin jiang han yu wei shi/null 新疆维语卫视/ntv/xin jiang wei yu wei shi/null 新疆兵团卫视/ntv/xin jiang bing tuan wei shi/null 新疆综艺/ntv/xin jiang zong yi/null 新疆维语综艺/ntv/xin jiang wei yu zong yi/null 西藏汉语卫视/ntv/xi zang han yu wei shi/null 西藏藏语卫视/ntv/xi zang zang yu wei shi/null 青海汉语卫视/ntv/qing hai han yu wei shi/null 青海藏语卫视/ntv/qing hai zang yu wei shi/null 甘肃卫视/ntv/gan su wei shi/null 宁夏卫视/ntv/ning xia wei shi/null 内蒙古汉语卫视/ntv/nei meng gu han yu wei shi/null 内蒙古蒙语卫视/ntv/nei meng gu meng yu wei shi/null 陕西卫视/ntv/shan xi wei shi/null 山西卫视/ntv/shan xi wei shi/null 辽宁卫视/ntv/liao ning wei shi/null 吉林卫视/ntv/ji lin wei shi/null 吉林延边卫视/ntv/ji lin yan bian wei shi/null 黑龙江卫视/ntv/hei long jiang wei shi/null 山东卫视/ntv/shang dong wei shi/null 山东教育卫视/ntv/shang dong jiao yu wei shi/null 江苏卫视/ntv/jiang su wei shi/null 江苏优漫卡通卫视/ntv/jiang su you man ka tong wei shi/null 安徽卫视/ntv/an hui wei shi/null 浙江卫视/ntv/zhe jiang wei shi/null 东方卫视/ntv/dong fang wei shi/null 炫动卡通卫视/ntv/xuan dong ka tong wei shi/null 翡翠台/ntv/fei cui tai/null 澳亚卫视/ntv/ao ya wei shi/null 华娱卫视/ntv/hua yu wei shi/null 明珠台/ntv/ming zhu tai/null 国际台/ntv/guo ji tai/null 星空卫视/ntv/xing kong wei shi/null 中国电影频道/ntv/zhong guo dian ying pin dao/null 电影频道/ntv/dian ying pin dao/null 北京电视台国际频道/ntv/bei jing dian shi tai guo ji pin dao/null 江苏电视台国际频道/ntv/jiang su dian shi tai guo ji pin dao/null 重庆电视台国际频道/ntv/chong qing dian shi tai guo ji pin dao/null 福建电视台国际频道/ntv/fu jian dian shi tai guo ji pin dao/null 黄河电视台/ntv/huang he dian shi tai/null 华夏电视台/ntv/hua xia dian shi tai/null 湖南卫视国际频道/ntv/hu nan wei shi guo ji pin dao/null 浙江电视台国际频道/ntv/zhe jiang dian shi tai guo ji pin dao/null 安徽电视台国际频道/ntv/an hui dian shi tai guo ji pin dao/null 山东广播电视总台海外频道/ntv/shan dong dian shi tai hai wai pin dao/null 广东电视台珠江海外频道/ntv/guang dong dian shi tai zhu jiang hai wai pin dao/null 天津电视台国际频道/ntv/tian jin dian shi tai guo ji pin dao/null 广州电视台英文频道/ntv/guang zhou dian shi tai ying wen pin dao/null 四川电视台国际频道/ntv/si chuan dian shi tai guo ji pin dao/null 中央电视台/ntv/zhong yang dian shi tai/null 延边卫视/ntv/yan bian wei shi/null 福建卫视/ntv/fu jian wei shi/null 亚洲卫视/ntv/ya zhou wei shi/null 上海炫动卡通卫视/ntv/shang hai xuan dong qia tong wei shi/null 上海东方电视台/ntv/shang hai dong fang dian shi tai/null cctv一/ntv/c c t v yi/null cctv综合/ntv/c c t v zong he/null 中央一台/ntv/zhong yang yi tai/null 中央电视台综合频道/ntv/zhong yang dian shi tai zong he pin dao/null cctv二/ntv/c c t v er/null cctv财经/ntv/c c t v cai jing/null 中央二台/ntv/zhong yang er tai/null 中央电视台财经频道/ntv/zhong yang dian shi tai cai jing pin dao/null cctv三/ntv/c c t v san/null cctv综艺/ntv/c c t v zong yi/null 中央三台/ntv/zhong yang san tai/null 中央电视台综艺频道/ntv/zhong yang dian shi tai zong yi pin dao/null cctv五/ntv/c c t v wu/null cctv体育/ntv/c c t v ti yu/null cctv体育频道/ntv/c c t v ti yu pin dao/null 中央五台/ntv/zhong yang wu tai/null 中央电视台体育频道/ntv/zhong yang dian shi tai ti yu pin dao/null cctv六/ntv/c c t v liu/null cctv电影/ntv/c c t v dian ying/null cctv电影频道/ntv/c c t v dian ying pin dao/null 中央六台/ntv/zhong yang liu tai/null 中央电视台电影频道/ntv/zhong yang dian shi tai dian ying pin dao/null cctv七/ntv/c c t v qi/null cctv军事农业/ntv/c c t v jun shi nong ye/null cctv军事农业频道/ntv/c c t v jun shi nong ye pin dao/null cctv军事/ntv/c c t v jun shi/null cctv军事频道/ntv/c c t v jun shi pin dao/null cctv农业/ntv/c c t v nong ye/null cctv农业频道/ntv/c c t v nong ye pin dao/null 中央七台/ntv/zhong yang qi tai/null 中央电视台军事农业频道/ntv/zhong yang dian shi tai jun shi nong ye pin dao/null cctv八/ntv/c c t v ba/null cctv电视剧/ntv/c c t v dian shi ju/null cctv电视剧频道/ntv/c c t v dian shi ju pin dao/null 中央八台/ntv/zhong yang ba tai/null 中央电视台电视剧频道/ntv/zhong yang dian shi tai dian shi ju pin dao/null cctv九/ntv/c c t v jiu/null cctv纪录/ntv/c c t v ji lu/null cctv纪录频道/ntv/c c t v ji lu pin dao/null 中央九台/ntv/zhong yang jiu tai/null 中央电视台记录频道/ntv/zhong yang dian shi tai ji lu pin dao/null cctv十/ntv/c c t v shi/null cctv科教/ntv/c c t v ke jiao/null cctv科教频道/ntv/c c t v ke jiao pin dao/null 中央十台/ntv/zhong yang shi tai/null 中央电视台科教频道/ntv/zhong yang dian shi tai ke jiao pin dao/null cctv十一/ntv/c c t v shi yi/null cctv戏曲/ntv/c c t v xi qu/null cctv戏曲频道/ntv/c c t v xi qu pin dao/null 中央十一台/ntv/zhong yang shi yi tai/null 中央电视台戏曲频道/ntv/zhong yang dian shi tai xi qu pin dao/null cctv十二/ntv/c c t v shi er/null cctv社会与法/ntv/c c t v she kuai yu fa/null cctv社会/ntv/c c t v she kuai/null cctv社会频道/ntv/c c t v she kuai pin dao/null cctv法律/ntv/c c t v fa lu:/null cctv法律频道/ntv/c c t v fa lu: pin dao/null 中央十二台/ntv/zhong yang shi er tai/null 中央电视台法律频道/ntv/zhong yang dian shi tai fa lu: pin dao/null 中央电视台社会频道/ntv/zhong yang dian shi tai she kuai pin dao/null 中央电视台社会与法频道/ntv/zhong yang dian shi tai she kuai yu fa pin dao/null cctv十三/ntv/c c t v shi san/null cctv新闻/ntv/c c t v xin wen/null cctv新闻频道/ntv/c c t v xin wen pin dao/null 中央十三台/ntv/zhong yang shi san tai/null 中央电视台新闻频道/ntv/zhong yang dian shi tai xin wen pin dao/null cctv十四/ntv/c c t v shi si/null cctv少儿/ntv/c c t v shao r/null cctv少儿频道/ntv/c c t v shao r pin dao/null 中央十四台/ntv/zhong yang shi si tai/null 中央电视台少儿频道/ntv/zhong yang dian shi tai shao r pin dao/null cctv十五/ntv/c c t v shi wu/null cctv音乐频道/ntv/c c t v yin yue pin dao/null 中央十五台/ntv/zhong yang shi wu tai/null 中央电视台音乐频道/ntv/zhong yang dian shi tai yin yue pin dao/null cctv四/ntv/c c t v si/null cctv中文国际/ntv/c c t v zhong wen guo ji/null 中央四台/ntv/zhong yang si tai/null 中央电视台中文国际频道/ntv/zhong yang dian shi tai zhong wen guo ji pin dao/null cctv四美洲台/ntv/c c t v si mei zhou tai/null cctv美洲台/ntv/c c t v mei zhou tai/null cctv欧洲台/ntv/c c t v ou zhou tai/null 中央电视台美洲台/ntv/zhong yang dian shi tai mei zhou tai/null 中央电视台欧洲台/ntv/zhong yang dian shi tai ou zhou tai/null cctv英语/ntv/c c t v ying yu/null cctv英语国际频道/ntv/c c t v ying yu guo ji pin dao/null 中央电视台英文国际频道/ntv/zhong yang dian shi tai ying wen guo ji pin dao/null cctve/ntv/c c t v e/null cctv西班牙语/ntv/c c t v xi ban ya yu/null cctv西班牙语频道/ntv/c c t v xi ban ya yu pin dao/null cctv西班牙语国际频道/ntv/c c t v xi ban ya yu guo ji pin dao/null 中央电视台西班牙语国际频道/ntv/zhong yang dian shi tai xi ban ya yu guo ji pin dao/null cctvf/ntv/c c t v f/null cctv法语/ntv/c c t v fa yu/null cctv法语频道/ntv/c c t v fa yu pin dao/null cctv法语国际频道/ntv/c c t v fa yu guo ji pin dao/null 中央电视台法语国际频道/ntv/zhong yang dian shi tai fa yu guo ji pin dao/null cctvp/ntv/c c t v p/null cctv俄语/ntv/c c t v e yu/null cctv俄语频道/ntv/c c t v e yu pin dao/null cctv俄语国际频道/ntv/c c t v e yu guo ji pin dao/null 中央电视台俄语国际频道/ntv/zhong yang dian shi tai e yu guo ji pin dao/null cctv阿拉伯语/ntv/c c t v e la bo yu/null cctv阿拉伯语频道/ntv/c c t v e la bo yu pin dao/null 中央电视台阿拉伯语频道/ntv/zhong yang dian shi tai e la bo yu pin dao/null 中央电视台阿拉伯语国际频道/ntv/zhong yang dian shi tai e la bo yu guo ji pin dao/null cctv证券资讯/ntv/c c t v zheng quan zi xun/null 中央电视台证券资讯/ntv/zhong yang dian shi tai zheng quan zi xun/null cctv发现之旅/ntv/c c t v fa xian zhi lu:/null 中央电视台发现之旅/ntv/zhong yang dian shi tai fa xian zhi lu:/null cctv中学生/ntv/c c t v zhong xue sheng/null 中央电视台中学生/ntv/zhong yang dian shi tai zhong xue sheng/null cctv老故事/ntv/c c t v lao gu shi/null 中央电视台老故事/ntv/zhong yang dian shi tai lao gu shi/null cctv风云剧场/ntv/c c t v feng yun ju chang/null 中央电视台风云剧场/ntv/zhong yang dian shi tai feng yun ju chang/null cctv第一剧场/ntv/c c t v di yi ju chang/null 中央电视台第一剧场/ntv/zhong yang dian shi tai di yi ju chang/null cctv世界地理/ntv/c c t v shi jie di li/null 中央电视台世界地理/ntv/zhong yang dian shi tai shi jie di li/null cctv国防军事/ntv/c c t v guo fang jun shi/null 中央电视台国防军事/ntv/zhong yang dian shi tai guo fang jun shi/null cctv女性时尚/ntv/c c t v ru xing shi shang/null 中央电视台女性时尚/ntv/zhong yang dian shi tai ru xing shi shang/null cctv央视精品/ntv/c c t v yang shi jing pin/null 中央电视台央视精品/ntv/zhong yang dian shi tai yang shi jing pin/null cctv风云足球/ntv/c c t v feng yun zu qiu/null 中央电视台风云足球/ntv/zhong yang dian shi tai feng yun zu qiu/null cctv风云音乐/ntv/c c t v feng yun yin yue/null 中央电视台风云音乐/ntv/zhong yang dian shi tai feng yun yin yue/null cctv怀旧剧场/ntv/c c t v huai jiu ju chang/null 中央电视台怀旧剧场/ntv/zhong yang dian shi tai huai jiu ju chang/null cctv高尔夫/ntv/c c t v gao er fu/null 中央电视台高尔夫/ntv/zhong yang dian shi tai gao er fu/null cctv网球/ntv/c c t v wang qiu/null 中央电视台网球/ntv/zhong yang dian shi tai wang qiu/null 北京电视台财经频道/ntv/bei jing dian shi tai cai jing pin dao/null 北京电视台体育频道/ntv/bei jing dian shi tai ti yu pin dao/null 长沙电视台/ntv/chang sha dian shi tai/null 长沙公共频道/ntv/chang sha gong gong pin dao/null 长沙女性频道/ntv/chang sha nv xing pin dao/null 长沙新闻频道/ntv/chang sha xin wen pin dao/null 长沙政法频道/ntv/chang sha zheng fa pin dao/null 第一财经频道/ntv/di yi cai jing pin dao/null 东风卫视/ntv/dong feng wei shi/null 东南卫视/ntv/dong nan wei shi/null 东森电视台/ntv/dong sen dian shi tai/null 翡翠卫视/ntv/fei cui wei shi/null 凤凰卫视/ntv/feng huang wei shi/null 凤凰卫视电影台/ntv/feng huang wei shi dian ying tai/null 凤凰卫视美洲台/ntv/feng huang wei shi mei zhou tai/null 凤凰卫视欧洲台/ntv/feng huang wei shi ou zhou tai/null 凤凰卫视中文台/ntv/feng huang wei shi zhong wen tai/null 凤凰卫视资讯台/ntv/feng huang wei shi zi xun tai/null 福建新闻频道/ntv/fu jian xin wen pin dao/null 广州卫视/ntv/guang zhou wei shi/null 海南卫视/ntv/hai nan wei shi/null 湖南公共频道/ntv/hu nan gong gong pin dao/null 湖南经济电视台/ntv/hu nan jing ji dian shi tai/null 湖南时尚频道/ntv/hu nan shi shang pin dao/null 湖南影视频道/ntv/hu nan ying shi pin dao/null 湖南娱乐频道/ntv/hu nan yu le pin dao/null 江苏城市频道/ntv/jiang su cheng shi pin dao/null 江苏教育频道/ntv/jiang su jiao yu pin dao/null 江苏少儿频道/ntv/jiang su shao er pin dao/null 江苏体育频道/ntv/jiang su ti yu pin dao/null 江苏影视频道/ntv/jiang su ying shi pin dao/null 昆明电视台/ntv/kun ming dian shi tai/null 南京电视台/ntv/nan jing dian shi tai/null 南京影视频道/ntv/nan jing ying shi pin dao/null 内蒙古卫视/ntv/nei meng gu wei shi/null 青海卫视/ntv/qing hai wei shi/null 上海电视台电视剧频道/ntv/shang hai dian shi tai dian shi ju pin dao/null 上海电视台纪实频道/ntv/shang hai dian shi tai ji shi pin dao/null 上海电视台生活时尚频道/ntv/shang hai dian shi tai sheng huo shi shang pin dao/null 上海电视台体育频道/ntv/shang hai dian shi tai ti yu pin dao/null 上海电视台新闻综合频道/ntv/shang hai dian shi tai xin wen zong he pin dao/null 上海东方电视台文艺频道/ntv/shang hai dong fang dian shi tai wen yi pin dao/null 上海东方电视台戏剧频道/ntv/shang hai dong fang dian shi tai xi ju pin dao/null 上海东方电视台新闻娱乐频道/ntv/shang hai dong fang dian shi tai xin wen yu le pin dao/null 上海东方电视台音乐频道/ntv/shang hai dong fang dian shi tai yin yue pin dao/null 上海卫视/ntv/shang hai wei shi/null 上海文广集团/ntv/shang hai wen guang ji tuan/null 十八频道/ntv/shi ba pin dao/null 台北国际卫星电视网/ntv/tai bei guo ji wei xing dian shi wang/null 台湾电视台/ntv/tai wan dian shi tai/null 台湾宏观卫视/ntv/tai wan hong guan wei shi/null 台湾民视/ntv/tai wan min shi/null 卫视电影台/ntv/wei shi dian ying tai/null 卫视中文台/ntv/wei shi zhong wen tai/null 武汉卫视/ntv/wu han wei shi/null 无锡城市资讯/ntv/wu xi cheng shi zi xun/null 无锡影视/ntv/wu xi ying shi/null 西藏卫视/ntv/xi zang wei shi/null 香港新知台/ntv/xiang gang xin zhi tai/null 潇湘电影频道/ntv/xiao xiang dian ying pin dao/null 新疆卫视/ntv/xin jiang wei shi/null 亚洲电视台/ntv/ya zhou dian shi tai/null 阳光卫视/ntv/yang guang wei shi/null 直播都市频道/ntv/zhi bo du shi pin dao/null 中华电视公司/ntv/zhong hua dian shi gong si/null 中天新闻台/ntv/zhong tian xin wen tai/null 中天娱乐台/ntv/zhong tian yu le tai/null 中天综合台/ntv/zhong tian zong he tai/null 中央电视台第一剧场频道/ntv/zhong yang dian shi tai di yi ju chang pin dao/null 中央电视台风云足球频道/ntv/zhong yang dian shi tai feng yun zu qiu pin dao/null 中央电视台高尔夫网球频道/ntv/zhong yang dian shi tai gao er fu wang qiu pin dao/null 中央电视台高清电视频道/ntv/zhong yang dian shi tai gao qing dian shi pin dao/null 中央电视台国际频道/ntv/zhong yang dian shi tai guo ji pin dao/null 中央电视台国家地理频道/ntv/zhong yang dian shi tai guo jia di li pin dao/null 中央电视台经济频道/ntv/zhong yang dian shi tai jing ji pin dao/null 中央电视台文艺频道/ntv/zhong yang dian shi tai wen yi pin dao/null 中央电视台西法频道/ntv/zhong yang dian shi tai xi fa pin dao/null 中央电视台英语频道/ntv/zhong yang dian shi tai ying yu pin dao/null 中央电视台中视购物/ntv/zhong yang dian shi tai zhong shi gou wu/null ######################## ###### 电视台别称 ###### 湖南电视台/ntv/hu nan dian shi tai/null 芒果电视台/ntv/hu nan dian shi tai/null 湖南金鹰卡通电视台/ntv/hu nan jin ying ka tong dian shi tai/null 北京卡酷动画电视台/ntv/bei jing ka ku dian shi tai/null 福建东南电视台/ntv/fu jian dong nan dian shi tai/null 福建海峡电视台/ntv/fu jian hai xia dian shi tai/null 厦门电视台/ntv/xia men dian shi tai/null 广东南方电视台/ntv/guang dong nan fang dian shi tai/null 广东嘉佳卡通电视台/ntv/guang dong jia jia qia tong dian shi tai/null 深圳电视台/ntv/shen zhen dian shi tai/null 海南旅游电视台/hai nan lv you dian shi tai/hai nan lu: you dian shi tai/null 旅游电视台/ntv/lv you dian shi tai/null 新疆汉语电视台/ntv/xin jiang hai zhu dian shi tai/null 新疆维语电视台/ntv/xin jiang wei yu dian shi tai/null 西藏汉语电视台/ntv/xi zang han yu dian shi tai/null 西藏藏语电视台/ntv/xi zang zang yu dian shi tai/null 青海汉语电视台/ntv/qing hai han yu dian shi tai/null 青海藏语电视台/ntv/qing hai zang yu dian shi tai/null 内蒙古汉语电视台/ntv/nei meng gu han yu dian shi tai/null 内蒙古蒙语电视台/ntv/nei meng gu nei meng gu yu dian shi tai/null 吉林延边电视台/ntv/ji lin yan bian dian shi tai/null 山东教育电视台/shan dong jiao yu dian shi tai/shan dong jiao yu dian shi tai/null 江苏电视台/ntv/jiang su dian shi tai/null 江苏优漫卡通电视台/ntv/jiang su you man ka tong dian shi tai/null 炫动卡通电视台/ntv/xuan dong ka tong dian shi tai/null 翡翠电视台/ntv/fei cui tai/null 澳亚电视台/ntv/ao ya dian shi tai/null 华娱电视台/ntv/hua yu dian shi tai/null 明珠电视台/ntv/ming zhu dian shi tai/null 国际电视台/ntv/gui ji dian shi tai/null 星空电视台/ntv/xing kong dian shi tai/null 中国电影电视台/ntv/zhong guo dian ying dian shi tai/null 电影电视台/ntv/dian ying dian shi tai/null 延边电视台/ntv/yan bian dian shi tai/null 上海炫动卡通电视台/shang hai xuan dong ka tong dian shi tai/shang hai xuan dong qia tong dian shi tai/null 东南电视台/ntv/dong nan dian shi tai/null 凤凰电视台/ntv/feng huang dian shi tai/null 福建新闻电视台/ntv/fu jian xin wen dian shi tai/null 广州电视台/ntv/guang zhou dian shi tai/null 湖南公共电视台/ntv/hu nan gong gong dian shi tai/null 湖南时尚电视台/ntv/hu nan shi shang dian shi tai/null 湖南影视电视台/ntv/hu nan ying shi dian shi tai/null 湖南娱乐电视台/ntv/hu nan yu le dian shi tai/null 江苏城市电视台/ntv/jiang su cheng shi dian shi tai/null 江苏教育电视台/ntv/jiang su jiao yu dian shi tai/null 江苏少儿电视台/ntv/jiang su shao er dian shi tai/null 江苏体育电视台/ntv/jiang su ti yu dian shi tai/null 江苏影视电视台/ntv/jiang su ying shi dian shi tai/null 南京影视电视台/ntv/nan jing ying shi dian shi tai/null 青海电视台/ntv/qing hai dian shi tai/null 上海电视台/ntv/shang hai dian shi tai/null 十八电视台/ntv/shi ba dian shi tai/null 台北国际卫星电视台/ntv/tai bei guo ji wei xing dian shi wang/null 台湾宏观电视台/ntv/tai wan hong guan dian shi tai/null 台湾民视电视台/ntv/tai wan min shi/null 武汉电视台/ntv/wu han dian shi tai/null 无锡城市资讯电视台/ntv/wu xi cheng shi zi xun/null 无锡影视电视台/ntv/wu xi ying shi/null 香港新知电视台/ntv/xiang gang xin zhi tai/null 潇湘电影电视台/ntv/xiao xiang dian ying dian shi tai/null 阳光电视台/ntv/yang guang dian shi tai/null 直播都市电视台/ntv/zhi bo du shi dian shi tai/null 中天新闻电视台/ntv/zhong tian xin wen dian shi tai/null 中天娱乐电视台/ntv/zhong tian yu le dian shi tai/null 中天综合电视台/ntv/zhong tian zong he dian shi tai/null ######################## ###### 频道别称 ###### 湖南频道/ntv/hu nan pin dao/null 湖南金鹰卡通频道/ntv/hu nan jin ying ka tong pin dao/null 北京频道/ntv/bei jing pin dao/null 北京卡酷动画频道/ntv/bei jing ka ku pin dao/null 天津频道/ntv/tian jing pin dao/null 河北频道/ntv/he bei pin dao/null 河南频道/ntv/he nan pin dao/null 湖北频道/ntv/hu bei pin dao/null 江西频道/ntv/jiang xi pin dao/null 福建东南频道/ntv/fu jian dong nan pin dao/null 福建海峡频道/ntv/fu jiang hai xia pin dao/null 厦门频道/ntv/xia men pin dao/null 广东频道/ntv/guang dong pin dao/null 广东南方频道/ntv/guang dong nan fang pin dao/null 广东嘉佳卡通频道/ntv/guang dong jia jia pin dao/null 深圳频道/ntv/shen zhen pin dao/null 海南旅游频道/ntv/hai nan lv you pin dao/null 旅游频道/ntv/lv you pin dao/null 广西频道/ntv/guang xi pin dao/null 云南频道/ntv/yun nan pin dao/null 四川频道/ntv/si chuan pin dao/null 重庆频道/ntv/chong qing pin dao/null 贵州频道/ntv/gui zhou pin dao/null 新疆汉语频道/ntv/xin jiang han yu pin dao/null 新疆维语频道/ntv/xin jiang wei yu pin dao/null 新疆兵团频道/ntv/xin jiang bing tuan pin dao/null 新疆综艺频道/ntv/xin jiang zong yi/null 西藏汉语频道/ntv/xi zang han yu pin dao/null 西藏藏语频道/ntv/xi zang zang yu pin dao/null 青海汉语频道/ntv/qing hai han yu pin dao/null 青海藏语频道/ntv/qing hai zang yu pin dao/null 甘肃频道/ntv/gan su pin dao/null 宁夏频道/ntv/ning xia pin dao/null 内蒙古汉语频道/ntv/nei meng gu han yu pin dao/null 内蒙古蒙语频道/ntv/nei meng gu meng yu pin dao/null 陕西频道/ntv/shan xi pin dao/null 山西频道/ntv/shan xi pin dao/null 辽宁频道/ntv/liao ning pin dao/null 吉林频道/ntv/ji lin pin dao/null 吉林延边频道/ntv/ji lin yan bian pin dao/null 黑龙江频道/ntv/hei long jiang pin dao/null 山东频道/ntv/shang dong pin dao/null 山东教育频道/ntv/shang dong jiao yu pin dao/null 江苏频道/ntv/jiang su pin dao/null 江苏优漫卡通频道/ntv/jiang su you man ka tong pin dao/null 安徽频道/ntv/an hui pin dao/null 浙江频道/ntv/zhe jiang pin dao/null 东方频道/ntv/dong fang pin dao/null 炫动卡通频道/ntv/xuan dong ka tong pin dao/null 澳亚频道/ntv/ao ya pin dao/null 华娱频道/ntv/hua yu pin dao/null 星空频道/ntv/xing kong pin dao/null 黄河频道/ntv/huang he pin dao/null 华夏频道/ntv/hua xia pin dao/null 中央频道/ntv/zhong yang pin dao/null 内蒙古频道/ntv/nei meng gu pin dao/null 福建频道/ntv/fu jian pin dao/null 海南频道/ntv/hai nan pin dao/null 新疆频道/ntv/xin jiang pin dao/null 西藏频道/ntv/xi zang pin dao/null 延边频道/ntv/yan bian pin dao/null 上海炫动卡通频道/ntv/shang hai xuan dong qia tong pin dao/null 上海东方频道/ntv/shang hai dong fang pin dao/null 长沙频道/ntv/chang sha pin dao/null 东风频道/ntv/dong feng pin dao/null 东南频道/ntv/dong nan pin dao/null 东森频道/ntv/dong sen pin dao/null 翡翠频道/ntv/fei cui pin dao/null 凤凰频道/ntv/feng huang pin dao/null 广州频道/ntv/guang zhou pin dao/null 昆明频道/ntv/kun ming pin dao/null 南京频道/ntv/nan jing pin dao/null 青海频道/ntv/qing hai pin dao/null 上海频道/ntv/shang hai pin dao/null 台湾频道/ntv/tai wan pin dao/null 台湾宏观频道/ntv/tai wan hong guan pin dao/null 武汉频道/ntv/wu han pin dao/null 亚洲频道/ntv/ya zhou pin dao/null 阳光频道/ntv/yang guang pin dao/null 中天新闻频道/ntv/zhong tian xin wen tai/null 中天娱乐频道/ntv/zhong tian yu le tai/null 中天综合频道/ntv/zhong tian zong he tai/null ######################## ###### 台别称 ###### 湖南台/ntv/hu nan tai/null 湖南金鹰卡通台/ntv/hu nan jin ying ka tong tai/null 北京台/ntv/bei jing tai/null 北京卡酷动画台/ntv/bei jing ka ku tai/null 天津台/ntv/tian jing tai/null 河北台/ntv/he bei tai/null 河南台/ntv/he nan tai/null 湖北台/ntv/hu bei tai/null 江西台/ntv/jiang xi tai/null 福建东南台/ntv/fu jian dong nan tai/null 福建海峡台/ntv/fu jiang hai xia tai/null 厦门台/ntv/xia men tai/null 广东台/ntv/guang dong tai/null 广东南方台/ntv/guang dong nan fang tai/null 广东嘉佳卡通台/ntv/guang dong jia jia tai/null 深圳台/ntv/shen zhen tai/null 海南旅游台/ntv/hai nan lv you tai/null 旅游台/ntv/lv you tai/null 广西台/ntv/guang xi tai/null 云南台/ntv/yun nan tai/null 四川台/ntv/si chuan tai/null 重庆台/ntv/chong qing tai/null 贵州台/ntv/gui zhou tai/null 新疆汉语台/ntv/xin jiang han yu tai/null 新疆维语台/ntv/xin jiang wei yu tai/null 新疆兵团台/ntv/xin jiang bing tuan tai/null 西藏汉语台/ntv/xi zang han yu tai/null 西藏藏语台/ntv/xi zang zang yu tai/null 青海汉语台/ntv/qing hai han yu tai/null 青海藏语台/ntv/qing hai zang yu tai/null 甘肃台/ntv/gan su tai/null 宁夏台/ntv/ning xia tai/null 内蒙古汉语台/ntv/nei meng gu han yu tai/null 内蒙古蒙语台/ntv/nei meng gu meng yu tai/null 陕西台/ntv/shan xi tai/null 山西台/ntv/shan xi tai/null 辽宁台/ntv/liao ning tai/null 吉林台/ntv/ji lin tai/null 吉林延边台/ntv/ji lin yan bian tai/null 黑龙江台/ntv/hei long jiang tai/null 山东台/ntv/shang dong tai/null 山东教育台/ntv/shang dong jiao yu tai/null 江苏台/ntv/jiang su tai/null 江苏优漫卡通台/ntv/jiang su you man ka tong tai/null 安徽台/ntv/an hui tai/null 浙江台/ntv/zhe jiang tai/null 东方台/ntv/dong fang tai/null 炫动卡通台/ntv/xuan dong ka tong tai/null 澳亚台/ntv/ao ya tai/null 华娱台/ntv/hua yu tai/null 星空台/ntv/xing kong tai/null 中国电影台/ntv/zhong guo dian ying tai/null 电影台/ntv/dian ying tai/null 北京国际台/ntv/bei jing guo ji tai/null 江苏国际台/ntv/jiang su guo ji tai/null 重庆国际台/ntv/chong qing guo ji tai/null 福建国际台/ntv/fu jian guo ji tai/null 黄河台/ntv/huang he tai/null 华夏台/ntv/hua xia tai/null 湖南卫视国际台/ntv/hu nan wei shi guo ji tai/null 浙江国际台/ntv/zhe jiang dian shi tai guo ji tai/null 安徽国际台/ntv/an hui dian shi tai guo ji tai/null 山东广播海外台/ntv/shan dong dian shi tai hai wai tai/null 广东珠江海外台/ntv/guang dong zhu jiang hai wai tai/null 天津国际台/ntv/tian jin guo ji tai/null 广州英文台/ntv/guang zhou ying wen tai/null 四川国际台/ntv/si chuan guo ji tai/null 中央台/ntv/zhong yang tai/null 山东电视台综艺台/ntv/shan dong dian shi tai zong yi tai/null 山东电视综艺台/ntv/shan dong dian shi zong yi tai/null 内蒙古台/ntv/nei meng gu tai/null 福建台/ntv/fu jian tai/null 海南台/ntv/hai nan tai/null 新疆台/ntv/xin jiang tai/null 西藏台/ntv/xi zang tai/null 延边台/ntv/yan bian tai/null 上海炫动卡通台/ntv/shang hai xuan dong qia tong tai/null 上海东方台/ntv/shang hai dong fang tai/null 北京电视台财经台/ntv/bei jing dian shi tai cai jing tai/null 北京电视台体育台/ntv/bei jing dian shi tai ti yu tai/null 长沙台/ntv/chang sha tai/null 长沙公共台/ntv/chang sha gong gong tai/null 长沙女性台/ntv/chang sha nv xing tai/null 长沙新闻台/ntv/chang sha xin wen tai/null 长沙政法台/ntv/chang sha zheng fa tai/null 第一财经台/ntv/di yi cai jing tai/null 东风台/ntv/dong feng tai/null 东南台/ntv/dong nan tai/null 东森台/ntv/dong sen tai/null 凤凰台/ntv/feng huang tai/null 福建新闻台/ntv/fu jian xin wen tai/null 广州台/ntv/guang zhou tai/null 湖南公共台/ntv/hu nan gong gong tai/null 湖南经济台/ntv/hu nan jing ji tai/null 湖南时尚台/ntv/hu nan shi shang tai/null 湖南影视台/ntv/hu nan ying shi tai/null 湖南娱乐台/ntv/hu nan yu le tai/null 江苏城市台/ntv/jiang su cheng shi tai/null 江苏教育台/ntv/jiang su jiao yu tai/null 江苏少儿台/ntv/jiang su shao er tai/null 江苏体育台/ntv/jiang su ti yu tai/null 江苏影视台/ntv/jiang su ying shi tai/null 昆明台/ntv/kun ming tai/null 南京台/ntv/nan jing tai/null 南京影视台/ntv/nan jing ying shi tai/null 青海台/ntv/qing hai tai/null 上海台/ntv/shang hai tai/null 台湾台/ntv/tai wan tai/null 台湾宏观台/ntv/tai wan hong guan tai/null 武汉台/ntv/wu han tai/null 潇湘电影台/ntv/xiao xiang dian ying tai/null 亚洲台/ntv/ya zhou tai/null 阳光台/ntv/yang guang tai/null 直播都市台/ntv/zhi bo du shi tai/null
Lex
1
Wing-Luo/jcseg
vendors/lexicon/lex-live.lex
[ "Apache-2.0" ]
>DL;804Angiostrongylus_cantonensis -------------------------------------------------- ----------------------------------ATT-AAGCCATG-CA- T-GAG-GA--GTTC-A--GC------TT--TA-A----G-T-GA--AA-C -TGCGAACGGCTCATTAG-AGCAGATG-T-GATT---TATT-CG--G--A A-A--A-T--CC-T----ATT-GGA--TAACTGCG--GTAAT-TCTGGAG CTAATACATGCGTAT-A-A-AC-CCTG-AC---T--T-T--C---GAAA- -GGGTGCAAT-TA-TTAGAG---C---AA-A-TCAAT-CAT--------- ----T-T---TC----------G-GA------TG----TAGTT------- ---T---GCT---G-A-C-TC-TGAATA-A---CG--CAG--CATA-TCG G-CGGC-T-T-GT---TCGCCGATAAT-CCGAAAA----AG---TGT-C- TGCCC-TATCA--AC---CT---GA-TGGTAGTCTATTAGTCTA-CCATG GTTATTACGGGTAACGGAGAATAAGGGTT-CGACTCCGGAGAGGGAGCCT TAGAAACGGCTACCACATCCAAGGAAGGCAGCAG-GCGCGAAACTTATCC AA-T-CTTG-----A-ATAGATGA-GATAGTGACT--------------- --------AAAAATAAAAA--GACCA---TTCC-T-AT-G--GAACG-GT TATTTCAATGAGT--TGATCATAAACCTTTTTT--C-G-AGTA--TCCAG TGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTC--CACTA GTGTA-AATCGTCATTGCTGCGGTTAAAAAGC-TCGTAGTTGGAT-C-TG AGTTGC---AT--GCA-AT-G-ATTCG--C-CT----T--TG--G--CGT ----TAAT------C---AT-TG-TTGTG---ACTA---T------T-T- --G--CTG--G-T-T--TTCT-AT--TG-A--AA-----TTTC-----G- A-TT-----TCTTTA-GTG-GC-TA--GCGA-GTT-TA-CTTTGA-AT-A AATTAAAGTGCT-CAGAACAAG---CGTT-----T--GC-TT-G--AAT- G-GTCGAT-CATGGAATAA-----TAAAAGAGGAC--TTCG---GT-T-- ----CTATT-T----ATTGGTTC-AG---G-AA------CTG------AA GT-AATGATTAAGAGGGACA--ATTC-GGGGGCATTCGTATCCCTGCGCG AGAGGTGAAATTCGTG-GACCG-CAGGGGGACGCCCTAAAGCGAAAG-CA TTTGCC-AAGAAT--GTCTTCATTAATCA-AGAACGAAAGTCAGAGGTTC GAAGGCGATTAGATA--CCGCCC-TAGTTCTGACCGTAAACTATGCCATC TAGC-GA--TCC-GAT--GG-GG--TA--T--TG--T-T----GCCTT-- GTCGAGG-AGCTT-CCCGGAAACGA--AA-GTCTTTCGGT-TCCTGGGGT AGTATGGTTGC-AAAGCT-G-AAACTTAAAGA-AATTGACGGAATGGCAC CACCAGGAGTGGAGCCTGCGGCTTAATTTGACTCAACACGGGA--AAACT -CACCC-GGCCCGGACACCGTAA-GGATTGAC-----AGATTGA--A--- AGCTCTTTCTC-GATTTGGTGGTTGGTGGTGCATGGCCGTTCTTAGTTG- GTGGAG-CGATTTGTCTGGTTTATTCC-GAT-AACGAGCGAGACTCT-AG -C-C--TG-CTAAA-TA-G--TGA--CTA---------------GA---- TT-----------AT------T----GAGTC-------TA-G----T--C -------TA-------------C-TT-----CTT-AG---AGGGATAAG- CGG---TGTT-T-----A-G-C--CGCA--CG-AGATTGAGCGATAACAG GTCTGTGATGCCCTTAGATGTCCGGGG-CTG-CACGCGCGCTACAATGGA AG-AAT-CAGC--TGGC---CTA--T----CCAT-TGC-CG-A-AAGGT- AT----T----GGTAAACCG-TTGAAACT--CTTCC-GTG-ACCGGGATA GGGAATTGT--A-ATT---------ATT---TCCC-TTGAACG-AGGAAT TCCTAGTAAGTGTG-AGTCATCAGCTCACGCTGATTACGTCCC-TGCCAT TTGTACACACCGCCCGTCGCTGTC-CGGG-ACTG--AGC-TGTC--TCGA GAGGACT-GCGG-A-CTA----CT--GTA----TTGA-GG---CCT---- ---T---CGGG------TCG-----CGATA----TGGCG---GG-AAA-C AG-TTC-AATC-G-CAATG-G--CTTGAACCGGGTAAAAGTCGT-AACAA GGTATCTG------------------------------------------ --------------------------- * >DL;815Parelaphostrongylus_odocoil -------------------------------------------------- ----------------------------------ATT-AAGCCATG-CA- T-GTG-GA--GTTC-A--AC------TT--CA-A---AG-T-GA--AA-C -TGCGAACGGCTCATTAG-AGCAGATG-T-CATT---TATT-CG--G--A A-A--A-T--CC-T--T-AAT-GGA--TAACTGCG--GTAAT-TCTGGAG CTAATACATATGCAT-A-A-AC-CCTG-AC---T--C-TG-T---GAAA- -GGGTGCAAT-TA-TTAGAG---C---AA-A-TCAAT-CAT--------- ----T-T---TC----------G-GA------TG----TAGTT------- ---T---GCT---G-A-C-TC-TGAATA-A---CG--CAG--CATA-TCG G-CGGC-T-T-GT---TCGCCGATATT-CCGAAAA----AG---TGT-C- TGCCC-TATCA--AC---CT---GA-TGGTAGTCTATTAGTCTA-CCATG GTTATTACGGGTAACGGAGAATAAGGGTT-CGACTCCGGAGAGGGAGCCT TAGAAACGGCTACCACATCCAAGGAAGGCAGCAG-GCGCGAAACTTATCC AA-T-CTTG-----A-ATAGATGA-GATAGTGACT--------------- --------AAAAATAAAAA--GACCA---TTCC-T-AT-G--GAACG-GT CATTTCAATGAGT--TGATCATAAACCTTTTTT--C-G-AGTA--TCAAG TGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTC--CACTA GTGTA-AATCGTCATTGCTGCGGTTAAAAAGC-TCGTAGTTGGAT-C-TG AGTCGC---AT--GCA-AT-G-ATTCG--C-CT----T--TG--G--CGT ----TAAT------C---AT-TG-TTGTG---ACTA---T------T-T- --G--CTG--G-T-T--TTCT-AT--TG-A--AA-----TTTC-----G- A-TT-----TCTATA-GTG-GC-TA--GCGA-GTT-TA-CTTTGA-AT-A AATTAAAGTGCT-CAGAACAAG---CGTT-----T--GC-TT-G--AAT- G-GTCGAT-CATGGAATAA-----TAAAAGAGGAC--TTCG---GT-T-- ----CTATT-T----ATTGGTTC-AG---G-AA------CTG------AA AT-AATGGTTAAGAGGGACA--ATTC-GGGGGCATTCGTATCCCTGCGCG AGAGGTGAAATTCGTG-GACCG-CAGGGGGACGCCCTAAAGCGAAAG-CA TTTGCC-AAGAAT--GTCTTCATTAATCA-AGAACGAAAGTCAGAGGTTC GAAGGCGATTAGATA--CCGCCC-TAGTTCTGACCGTAAACTATGCCATC TAGC-GA--TCC-GAT--GG-GG--TA--T--TG--T-T----GCCTT-- GTCGAGG-AGCTT-CCCGGAAACGA--AA-GTCTTTCGGT-TCCTGGGGT AGTATGGTTGC-AAAGCT-G-AAACTTAAAGA-AATTGACGGAATGGCAC CACCAGGAGTGGAGCCTGCGGCTTAATTTGACTCAACACGGGA--AAACT -CACCC-GGCCCGGACACCGTAA-GGATTGAC-----AGATTGA--A--- AGCTCTTTCTC-GATTTGGTGGTTGGTGGTGCATGGCCGTTCTTAGTTG- GTGGAG-CGATTTGTCTGGTTTATTCC-GAT-AACGAGCGAGACTCT-AG -C-C--TG-CTAAA-TA-G--TGA--CTA---------------GA---- T------------ACG-----T----ATGTC-------TA-G----T--C -------TA-------------C-TT-----CTT-AG---AGGGATAAG- CGG---TGTT-T-----A-G-C--CGCA--CG-AGATTGAGCGATAACAG GTCTGTGATGCCCTTAGATGTTCGGGG-CTG-CACGCGCGCTACAATGGA AG-AAT-CAGC--TGGC---CTA--T----CCAT-TAC-CG-A-AAGGT- AT----T----GGTAAACCG-TTGAAACT--CTTCC-GTG-ACCGGGATA GGGAATTGT--A-ATT---------ATT---TCCC-TTGAACG-AGGAAT TCCTAGTAAGTGTG-AGTCATCAGCTCACGCTGATTACGTCCC-TGCCAT TTGTACACACCGCCCGTCGCTGTC-CGGG-ACTG--AGC-TGTC--TCGA GAGGACT-GCGG-A-CTA----CT--GTA----TTGA-GG---CCT---- ---T---CGGG------TCG-----CGATA----TGGCG---GG-AAA-C AG-TTC-AATC-G-CAATG-G--CTTGAACCGGGTAAAAGTCGT-A---- -------------------------------------------------- --------------------------- *
Parrot Internal Representation
1
lukasz-kozlowski/biopython
Tests/NBRF/clustalw.pir
[ "BSD-3-Clause" ]
[ data-sizes~="m:0" ] { color:pink; } [ class*="test" ]{ color: silver}
CSS
3
fuelingtheweb/prettier
tests/stylefmt/attr-selector/attr-selector.css
[ "MIT" ]
;============================================================================== ; Autopsy Forensic Browser ; ; Copyright 2019 Basis Technology Corp. ; Contact: carrier <at> sleuthkit <dot> org ; ; Licensed under the Apache License, Version 2.0 (the "License"); ; you may not use this file except in compliance with the License. ; You may obtain a copy of the License at ; ; http://www.apache.org/licenses/LICENSE-2.0 ; ; Unless required by applicable law or agreed to in writing, software ; distributed under the License is distributed on an "AS IS" BASIS, ; WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. ; See the License for the specific language governing permissions and ; limitations under the License. ;============================================================================== #include <GUIConstantsEx.au3> #include <MsgBoxConstants.au3> #include <ProgressConstants.au3> #include <File.au3> #include <WinAPIFiles.au3> #include <ScrollBarConstants.au3> #include <GuiEdit.au3> #include <Date.au3> ;Get the list of names of algorithms Global $algorithms[3] ;increase size of array when adding new algorithms $algorithms[0] = "Single data source" $algorithms[1] = "Folder of logical files" $algorithms[2] = "One data source per folder" Global $algorithmDescriptions[3] ;increase size of array when adding new algorithms $algorithmDescriptions[0] = "Create a single auto ingest manifest file for a single disk image or VM file." $algorithmDescriptions[1] = "Create a single auto ingest manifest file for a single folder of logical files." $algorithmDescriptions[2] = "Create a manifest file for the first supported image of each subfolder of a case folder. If no supported images exist in the folder a manifest will be generated for the folders contents as a logical file set. Supported disk image or VM files: .e01, .l01, .001, .ad1" ; $algorithms[2] = "All Files In One Folder" Global $progressArea = Null Global $manifestFileNameEnd = "Manifest" Global $manifestExtension = ".xml" ;Return an array containing the names of all algorithms Func GetAlgorithmNames() Return $algorithms EndFunc ;Return the description for the specified algorithm index Func GetAlgorithmDescription($index) Return $algorithmDescriptions[$index] EndFunc ;Return the name of the first algorithm as a default algorithm Func GetDefaultAlgorithmName() Return $algorithms[0] EndFunc ;Run the function that corresponds to the specified Algorithm name ;Use Null for $progressArea if not called from a GUI with a $progressArea Func RunAlgorithm($selectedAlgorithm, $settings, ByRef $progressAreaRef) $progressArea = $progressAreaRef UpdateProgressArea("Analyzing: " & $settings[0]) if ($selectedAlgorithm == $algorithms[2]) Then OneDataSourcePerFolder($settings) ElseIf ($selectedAlgorithm == $algorithms[0]) Then SingleDataSource($settings) ElseIf ($selectedAlgorithm == $algorithms[1]) Then SingleDataSource($settings) ; ElseIf ($selectedAlgorithm == $algorithms[2]) Then ; AllFilesInOneFolder($settings) EndIf UpdateProgressArea("-------------------------------------------------------------------------------------------") ;blank line for some EndFunc ;Create a manifest file in the specified $caseDir named $manifestDir _Manifest.xml ;if the $manifestFile is specified the datasource included will be the file instead of the entire folder Func GenerateCaseNameAndWriteManifestFile($caseDir, $subDirName, $manifestFile) Local $manifestName = "" Local $caseName = "" Local $dataSourcePath = "" ;If the manifestDirectory is not Null use it for the file name if ($subDirName <> Null) Then $manifestName = $subDirName $dataSourcePath = $manifestName if ($manifestFile <> Null) Then $dataSourcePath = $dataSourcePath & "\" & $manifestFile EndIf ;If the manifestDirectory was Null then use the file name ElseIf ($manifestFile <> Null) Then $manifestName = $manifestFile $dataSourcePath = $manifestName Else UpdateProgressArea("ERROR: Invalid arguements provided, unable to create manifest file") Return EndIf Local $splitCaseDir = StringSplit($caseDir, "\", $STR_ENTIRESPLIT) $caseName = $splitCaseDir[$splitCaseDir[0]] Local $manfiestFilePath = $caseDir & "\" & $manifestName & "_" & $manifestFileNameEnd & $manifestExtension WriteManifestFile($manfiestFilePath, $manifestName, $caseName, $dataSourcePath) EndFunc ;Write the specified manifest file. Func WriteManifestFile($manifestFilePath, $manifestName, $caseName, $dataSourcePath) _FileCreate($manifestFilePath) Local $fileHandle = FileOpen($manifestFilePath, $FO_APPEND) If $fileHandle == -1 Then UpdateProgressArea("ERROR: " & $manifestName & " Unable to create manifest file") Return EndIf FileWrite($fileHandle,'<?xml version="1.0" encoding="UTF-8" standalone="no"?>' & @CRLF) FileWrite($fileHandle,'<AutopsyManifest>' & @CRLF) FileWrite($fileHandle,'<CaseName>' & $caseName &'</CaseName>' & @CRLF) ;Device ID is not a required field FileWrite($fileHandle,'<DataSource>' & $dataSourcePath & '</DataSource>' & @CRLF) FileWrite($fileHandle,'</AutopsyManifest>' & @CRLF) FileClose($fileHandle) UpdateProgressArea($manifestName & " manifest created") EndFunc ;get the extension of a file Func GetFileExtension($fileName) Local $fileExtension _PathSplit ($fileName, "", "", "", $fileExtension) Return $fileExtension EndFunc ;Return 0 for false if no manifest files exist in the caseDir, or 1 for true if manifest files do exist Func ManifestFilesAlreadyExist($fileList) Local $fileName Local $fileExtension For $i = 1 To $fileList[0] Step 1 _PathSplit ($fileList[$i], "", "", $fileName, $fileExtension) If StringCompare($fileExtension, $manifestExtension, $STR_NOCASESENSE) == 0 Then Local $splitFileName = StringSplit($fileName, "_", $STR_ENTIRESPLIT) if $splitFileName[0] > 1 Then ;It split into more than one chunk so the last chunk should match our _Manifest If StringCompare($splitFileName[$splitFileName[0]], $manifestFileNameEnd, $STR_NOCASESENSE) == 0 Then UpdateProgressArea("Folder already contains manifest file: " & $fileList[$i]) Return 1 EndIf EndIf EndIf Next Return 0 EndFunc ;Check if a manifest file already exists for a specific datasource in the case Dir ;Return 1 if a manifest exists ;Return 0 if no manifest exists Func ManifestAlreadyExists($manifestFilePath) If FileExists($manifestFilePath) == 1 Then Return 1 Else Return 0 EndIf EndFunc ;Algorithm for the "One Data Source Per Folder" ;Creates manifest files Func OneDataSourcePerFolder($settings) Local $validDirectory = 1 Local $caseDir = $settings[0] ;_FileListToArray returns the count of files/folders as the first value then the contents Local $fileList = _FileListToArray($caseDir, Default, $FLTA_FILES, False) Local $caseDirSplit = StringSplit($caseDir, "\", $STR_ENTIRESPLIT) Local $caseDirName if ($caseDirSplit[0] > 1) Then ;if case folder is longer than one directory display just the directory name in progress messages $caseDirName = $caseDirSplit[$caseDirSplit[0]] Else ;if there is only one directory use the entire case dir path EndIf If (@error == 1) Then $validDirectory = 0 UpdateProgressArea("ERROR: " & $caseDirName & " not found") MsgBox($MB_OK, "Directory Not Found", "Selected directory " & $caseDirName & " was not found.") ElseIf (@error > 0) Then ;An acceptable condition as no files means no manifest files EndIf Local $dirList = _FileListToArray($caseDir, Default, $FLTA_FOLDERS, True) If (@error ==4) Then UpdateProgressArea($caseDirName & " no folders found") MsgBox($MB_OK, "Selected Directory Empty", "Selected directory " & $caseDirName & " did not contain any subfolders to use as data sources for manifest files.") $validDirectory = 0 EndIf If $validDirectory = 1 Then Local $validExtensions[4] = [".e01", ".l01", ".001", ".ad1"] ;valid extensions for the One Data Source Per Folder algorithm Local $subDirectoryFileList Local $validSubDirectory For $fileNumber = 1 TO $dirList[0] Step 1 Local $manifestFile = Null Local $manifestDir = $dirList[$fileNumber] Local $splitManifestDir = StringSplit($manifestDir, "\", $STR_ENTIRESPLIT) Local $manifestDirName = $splitManifestDir[$splitManifestDir[0]] $subDirectoryFileList = _FileListToArray($dirList[$fileNumber], Default, Default, False) $validSubDirectory = 1 If (@error == 1) Then $validSubDirectory = 0 UpdateProgressArea("ERROR: " & $dirList[$fileNumber] & " not found") ElseIf (@error ==4) Then UpdateProgressArea($manifestDirName & " empty, no manifest created") $validSubDirectory = 0 EndIf If $validSubDirectory == 1 Then For $i = 1 TO $subDirectoryFileList[0] Step 1 Local $currentFilesExtension = GetFileExtension($subDirectoryFileList[$i]) For $extension IN $validExtensions ;should only be one file or directory in this folder since we checked the number of contents previously If StringCompare($extension, $currentFilesExtension, $STR_NOCASESENSE) == 0 Then $manifestFile = $subDirectoryFileList[$i] ExitLoop 2 ;match was found no reason to check remaining extensions or files in a One Data Source Per Folder algorithm EndIf Next Next Local $manifestFilePath = $caseDir & "\" & $manifestDirName & "_" & $manifestFileNameEnd & $manifestExtension If (ManifestAlreadyExists($manifestFilePath) <> 1) Then ;should only be one file and it should end with a valid extension add as image file, or the whole directory is added as a logical file set GenerateCaseNameAndWriteManifestFile($caseDir, $manifestDirName, $manifestFile) Else UpdateProgressArea($manifestDirName & " manifest exists, skipping") EndIf EndIf Next UpdateProgressArea($caseDirName & " manifest generation complete") EndIf EndFunc ;Create a manifest file for a single data source in the same directory that contains the data source (also used for Folder of Logical Files) Func SingleDataSource($settings) Local $dataSourcePath = $settings[0] Local $caseDir = "" Local $caseDrive = "" Local $dsName = "" Local $dsExtension = "" _PathSplit ($dataSourcePath, $caseDrive, $caseDir, $dsName, $dsExtension) $caseDir = $caseDrive & $caseDir Local $caseName = $settings[1] Local $manfiestFilePath = $caseDir & "\" & $dsName & "_" & $manifestFileNameEnd & $manifestExtension If (ManifestAlreadyExists($manfiestFilePath) <> 1) Then ;should only be one file and it should end with a valid extension add as image file, or the whole directory is added as a logical file set WriteManifestFile($manfiestFilePath, $dsName, $caseName, $dsName & $dsExtension) Else UpdateProgressArea($dsName & " manifest exists, skipping") EndIf EndFunc ;Algorithm for the All Files in One Folder ;Creates manifest files for all files and directories in a single directory Func AllFilesInOneFolder($settings) Local $validDirectory = 1 Local $caseDir = $settings[0] ;_FileListToArray returns the count of files/folders as the first value then the contents Local $fileList = _FileListToArray($caseDir, Default, $FLTA_FILES, False) If (@error == 1) Then $validDirectory = 0 UpdateProgressArea("Selected directory " & $caseDir & " was not found") MsgBox($MB_OK, "Directory Not Found", "Selected directory " & $caseDir & " was not found") ElseIf (@error > 0) Then Local $dirList = _FileListToArray($caseDir, Default, $FLTA_FOLDERS, True) If (@error ==4) Then UpdateProgressArea("Selected directory " & $caseDir & " was empty and contained nothing to generate manifest files for") MsgBox($MB_OK, "Selected Directory Empty", "Selected directory " & $caseDir & " was empty and contained nothing to generate manifest files for") $validDirectory = 0 EndIf ;An acceptable condition as no files means no manifest files ElseIf ManifestFilesAlreadyExist($fileList) == 1 Then UpdateProgressArea("Selected directory " & $caseDir & " already contains manifest files, they must be deleted before generating new ones") MsgBox($MB_OK, "Manifest Files Exist", "Selected directory " & $caseDir & " already contains manifest files, they must be deleted before generating new ones") $validDirectory = 0 EndIf Local $contentsList = _FileListToArray ($caseDir, Default, Default, False) If $validDirectory = 1 Then For $fileNumber = 1 TO $contentsList[0] Step 1 Local $manifestDir = Null Local $manifestFile = $contentsList[$fileNumber] GenerateCaseNameAndWriteManifestFile($caseDir, $manifestDir, $manifestFile) Next UpdateProgressArea($caseDir & " manifest generation complete") EndIf EndFunc ;If the progress area is Null it will not be updated Func UpdateProgressArea($textToAdd) if ($progressArea <> Null) Then Local $currentProgressAreaText = GUICtrlRead($progressArea) $currentProgressAreaText = $currentProgressAreaText & @CRLF & "--" & $textToAdd GUICtrlSetData($progressArea, $currentProgressAreaText) _GUICtrlEdit_Scroll($progressArea, $SB_SCROLLCARET) EndIf EndFunc
AutoIt
4
ljmf00/autopsy
Tools/ManifestTool/ManifestGenerationAlgorithms.au3
[ "Apache-2.0" ]
<xsl:stylesheet version="1.0" xmlns:xsl="http://www.w3.org/1999/XSL/Transform" xmlns:myObj="urn:my-object"> <xsl:template match="/"> <result> <func1>1.<xsl:value-of select="myObj:Fn1()"/></func1> <func2>2.<xsl:value-of select="myObj:Fn2()"/></func2> <func3>3.<xsl:value-of select="myObj:Fn3()"/></func3> </result> </xsl:template> </xsl:stylesheet>
XSLT
3
pyracanda/runtime
src/libraries/System.Private.Xml/tests/Xslt/TestFiles/TestData/XsltApiV2/myObjectDef.xsl
[ "MIT" ]
--- id: 561add10cb82ac39a17513bc title: Certificação de visualização de dados legado certification: legacy-data-visualization challengeType: 7 isPrivate: true tests: - id: bd7157d8c242eddfaeb5bd13 title: Criar um pré-visualizador de markdown - id: bd7156d8c242eddfaeb5bd13 title: Criar um painel de estatísticas dos campers - id: bd7155d8c242eddfaeb5bd13 title: Criar uma caixa de receitas - id: bd7154d8c242eddfaeb5bd13 title: Criar o Jogo da Vida - id: bd7153d8c242eddfaeb5bd13 title: Criar um jogo de RPG do tipo Dungeon Crawler - id: bd7168d8c242eddfaeb5bd13 title: Visualizar dados com um gráfico de barras - id: bd7178d8c242eddfaeb5bd13 title: Visualizar dados com um gráfico de dispersão - id: bd7188d8c242eddfaeb5bd13 title: Visualizar dados com um mapa de calor - id: bd7198d8c242eddfaeb5bd13 title: Mostrar contiguidade nacional com um gráfico direcionado de força - id: bd7108d8c242eddfaeb5bd13 title: Mapear dados através do mundo
YAML
3
fcastillo-serempre/freeCodeCamp
curriculum/challenges/portuguese/00-certifications/legacy-data-visualization-certification/legacy-data-visualization-certification.yml
[ "BSD-3-Clause" ]
-- -- Simple program using multiple integer channels -- %handles: IntTerm = Get Put Close %cohandles: Console = Get Put Close %run ( | console => intTerm1,intTerm2) : hput intTerm1 IntTerm.Get get intTerm1 store x load x hput intTerm2 IntTerm.Put put intTerm2 hput intTerm2 IntTerm.Get get intTerm2 store y load y hput intTerm1 IntTerm.Put put intTerm1 hput intTerm2 IntTerm.Close close intTerm2 hput intTerm1 IntTerm.Close close intTerm1 hput console Console.Close halt console
AMPL
2
prashant007/AMPL
myAMPL/src/test5.ampl
[ "MIT" ]
#!/bin/bash set -e BASE_DIR=`dirname $0` yarn run test-i18n node $BASE_DIR/src/closureSlurper.js yarn run test-i18n-ucd echo "Generating ngParseExt" node $BASE_DIR/ucd/src/extract.js
Shell
3
skylarkfw/skylark-angular2
original/angular.js-1.7.5/i18n/generate.sh
[ "MIT" ]
SELECT * FROM VALUES('x UInt8, y UInt16', 1 + 2, 'Hello'); -- { serverError 36 }
SQL
2
pdv-ru/ClickHouse
tests/queries/0_stateless/01658_values_ubsan.sql
[ "Apache-2.0" ]
<?xml version="1.0" encoding="utf-8"?> <Project DefaultTargets="Build" xmlns="http://schemas.microsoft.com/developer/msbuild/2003" ToolsVersion="4.0"> <PropertyGroup> <RootNamespace>SimpleDatePicker</RootNamespace> <ProjectGuid>{de17260f-4e0e-4e44-9b89-4d63a39f5637}</ProjectGuid> <OutputType>executable</OutputType> <AssemblyName>SimpleDatePicker</AssemblyName> <AllowGlobals>False</AllowGlobals> <AllowLegacyWith>False</AllowLegacyWith> <AllowLegacyOutParams>False</AllowLegacyOutParams> <AllowLegacyCreate>False</AllowLegacyCreate> <AllowUnsafeCode>False</AllowUnsafeCode> <Configuration Condition="'$(Configuration)' == ''">Release</Configuration> <SDK>iOS</SDK> <CreateAppBundle>True</CreateAppBundle> <InfoPListFile>.\Resources\Info.plist</InfoPListFile> <Name>SimpleDatePicker</Name> </PropertyGroup> <PropertyGroup Condition=" '$(Configuration)' == 'Debug' "> <Optimize>false</Optimize> <OutputPath>.\bin\Debug</OutputPath> <DefineConstants>DEBUG;TRACE;</DefineConstants> <GenerateDebugInfo>True</GenerateDebugInfo> <EnableAsserts>True</EnableAsserts> <TreatWarningsAsErrors>False</TreatWarningsAsErrors> <CaptureConsoleOutput>False</CaptureConsoleOutput> <WarnOnCaseMismatch>True</WarnOnCaseMismatch> </PropertyGroup> <PropertyGroup Condition=" '$(Configuration)' == 'Release' "> <Optimize>true</Optimize> <OutputPath>.\bin\Release</OutputPath> <GenerateDebugInfo>False</GenerateDebugInfo> <EnableAsserts>False</EnableAsserts> <TreatWarningsAsErrors>False</TreatWarningsAsErrors> <CaptureConsoleOutput>False</CaptureConsoleOutput> <WarnOnCaseMismatch>True</WarnOnCaseMismatch> <CreateIPA>True</CreateIPA> </PropertyGroup> <ItemGroup> <Reference Include="CoreGraphics.fx" /> <Reference Include="Foundation.fx" /> <Reference Include="UIKit.fx" /> <Reference Include="rtl.fx" /> <Reference Include="libNougat.fx" /> </ItemGroup> <ItemGroup> <Compile Include="AppDelegate.pas" /> <Compile Include="JWADatePicker Helper\JWADatePicker.pas" /> <Compile Include="Program.pas" /> <Compile Include="StaticTableViewController.pas" /> </ItemGroup> <ItemGroup> <Content Include="Resources\Info.plist" /> <AppResource Include="Resources\App Icons\App-29.png" /> <AppResource Include="Resources\App Icons\App-48.png" /> <AppResource Include="Resources\App Icons\App-57.png" /> <AppResource Include="Resources\App Icons\App-58.png" /> <AppResource Include="Resources\App Icons\App-80.png" /> <AppResource Include="Resources\App Icons\App-96.png" /> <AppResource Include="Resources\App Icons\App-114.png" /> <AppResource Include="Resources\App Icons\App-120.png" /> <None Include="Resources\App Icons\App-512.png" /> <None Include="Resources\App Icons\App-1024.png" /> <AppResource Include="Resources\Launch Images\Default.png" /> <AppResource Include="Resources\Launch Images\Default@2x.png" /> <AppResource Include="Resources\Launch Images\Default-568h@2x.png" /> </ItemGroup> <ItemGroup> <Folder Include="JWADatePicker Helper" /> <Folder Include="Properties\" /> <Folder Include="Resources\" /> <Folder Include="Resources\App Icons\" /> <Folder Include="Resources\Launch Images\" /> </ItemGroup> <ItemGroup> <Storyboard Include="Resources\Storyboard.storyboard" /> </ItemGroup> <Import Project="$(MSBuildExtensionsPath)\RemObjects Software\Oxygene\RemObjects.Oxygene.Nougat.targets" /> <PropertyGroup> <PreBuildEvent /> </PropertyGroup> </Project>
Oxygene
2
teamro/elements-samples
Oxygene/Cocoa/iOS/SimpleDatePicker/SimpleDatePicker/SimpleDatePicker.oxygene
[ "MIT" ]
package inline inline fun g(body: () -> Unit) { body() println("i'm inline function") }
Groff
4
qussarah/declare
jps-plugin/testData/incremental/multiModule/inlineFunctionTwoPackageParts/module1_inlineG.kt.new.2
[ "Apache-2.0" ]
package test class A class Some<T> where T: <caret>A
Kotlin
3
Mu-L/kotlin
analysis/analysis-api/testData/referenceResolve/ReferenceInClassWhereConstraint.kt
[ "ECL-2.0", "Apache-2.0" ]
/* Copyright 2018 The Kubernetes Authors. Licensed under the Apache License, Version 2.0 (the "License"); you may not use this file except in compliance with the License. You may obtain a copy of the License at http://www.apache.org/licenses/LICENSE-2.0 Unless required by applicable law or agreed to in writing, software distributed under the License is distributed on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the License for the specific language governing permissions and limitations under the License. */ // To regenerate service.pb.go run hack/update-generated-kms.sh syntax = "proto3"; package v1beta1; // This service defines the public APIs for remote KMS provider. service KeyManagementService { // Version returns the runtime name and runtime version of the KMS provider. rpc Version(VersionRequest) returns (VersionResponse) {} // Execute decryption operation in KMS provider. rpc Decrypt(DecryptRequest) returns (DecryptResponse) {} // Execute encryption operation in KMS provider. rpc Encrypt(EncryptRequest) returns (EncryptResponse) {} } message VersionRequest { // Version of the KMS plugin API. string version = 1; } message VersionResponse { // Version of the KMS plugin API. string version = 1; // Name of the KMS provider. string runtime_name = 2; // Version of the KMS provider. The string must be semver-compatible. string runtime_version = 3; } message DecryptRequest { // Version of the KMS plugin API. string version = 1; // The data to be decrypted. bytes cipher = 2; } message DecryptResponse { // The decrypted data. bytes plain = 1; } message EncryptRequest { // Version of the KMS plugin API. string version = 1; // The data to be encrypted. bytes plain = 2; } message EncryptResponse { // The encrypted data. bytes cipher = 1; }
Protocol Buffer
5
yankay/autoscaler
vertical-pod-autoscaler/e2e/vendor/k8s.io/apiserver/pkg/storage/value/encrypt/envelope/v1beta1/service.proto
[ "Apache-2.0" ]
'' VGA_1024.spin '' '' MODIFIED BY VINCE BRIEL FOR POCKETERM FEATURES '' MODIIFED BY JEFF LEDGER / AKA OLDBITCOLLECTOR '' CON cols = 80 '128 ' number of screen columns lcols = cols / 4 ' number of long in columns rows = 40 '64 ' number of screen rows chars = rows*cols ' number of screen characters esc = $CB ' keyboard esc char rowsnow = 36 ' adjusted for split screen effect maxChars = rowsnow*cols ' adjusted value for split screen effect lastChar = maxChars / 4 ' last screen position in longs adjusted for split lastLine = (rowsnow - 1) * cols ' character position of last row cols1 = 81 ' adjusted value for 80th character TURQUOISE = $29 OBJ vga : "vga_Hires_Text" VAR byte screen[chars] ' screen character buffer byte tmpl[cols] ' temporary line buffer word colors[rows] ' color specs for each screen row (see ColorPtr description above) byte cursor[6] ' cursor info array (see CursorPtr description above) long sync, loc, xloc, yloc ' sync used by VGA routine, others are local screen pointers long kbdreq ' global val of kbdflag long BR[8] long Brate byte inverse byte invs byte state ' Current state of state machine word pos ' Current Position on the screen word oldpos ' Previous location of cursor before update word regionTop, regionBot ' Scroll region top/bottom long arg0 ' First argument of escape sequence long arg1 ' Second argument of escape sequence byte lastc ' Last displayed char word statpos long vgabasepin PUB start(BasePin) | i, char vgabasepin := BasePin ''init screen colors to gold on blue repeat i from 0 to rows - 1 colors[i] := $08F0 '$2804 (if you want cyan on blue) ''init cursor attributes cursor[2] := %110 ' init cursor to underscore with slow blink BR[0]:=300 BR[1]:=1200 BR[2]:=2400 BR[3]:=4800 BR[4]:=9600 BR[5]:=19200 BR[6]:=38400 BR[7]:=57600 BR[8]:=115200 xloc := cursor[0] := 0 yloc := cursor[1] := 0 loc := xloc + yloc*cols pos := 0 regionTop := 0 regionBot := 35 * cols state := 0 statpos := 37 * cols PUB vidon if (!vga.start(vgabasepin, @screen, @colors, @cursor, @sync)) return false 'waitcnt(clkfreq * 1 + cnt) 'wait 1 second for cogs to start PUB vidoff vga.stop PUB inv(c) inverse:=c PUB color(colorVal) | i repeat i from 0 to rows - 1 colors[i] := $0000 | colorVal PUB cursorset(c) | i i:=%000 if c == 1 i:= %001 if c == 2 i:= %010 if c == 3 i:= %011 if c == 4 i:= %101 if c == 5 i:= %110 if c == 6 i:= %111 if c == 7 i:= %000 cursor[2] := i PUB bin(value, digits) '' Print a binary number, specify number of digits repeat while digits > 32 outc("0") digits-- value <<= 32 - digits repeat digits outc((value <-= 1) & 1 + "0") PUB clrbtm(ColorVal) | i repeat i from 36 to rows - 1 'was 35 colors[i] := $0000 + ColorVal PUB cls1(VerStr) | i longfill(@screen[0], $20202020, chars / 4) clrbtm(TURQUOISE) inverse := 1 statprint(36, 0, VerStr) inverse := 0 repeat i from 37 to (rows - 1) statprint(i,0, string(" ")) {{ x :=xloc y := yloc invs := inverse ''clrbtm(TURQUOISE) longfill(@screen, $20202020, chars/4) xloc := 0 yloc :=0 loc := xloc + yloc*cols repeat 80 outc(32) xloc := 0 yloc :=36 loc := xloc + yloc*cols inverse := 1 str(string(" ")) inverse := 0 str(string("Baud Rate: ")) i:= BR[6] dec(i) str(string(" ")) xloc := 18 loc := xloc + yloc*cols str(string("Color ")) str(string("PC Port: ")) if pcport == 1 str(string("OFF ")) if pcport == 0 str(string("ON ")) str(string(" Force 7 bit: ")) if ascii == 0 str(string("NO ")) if ascii == 1 str(string("YES ")) str(string(" Cursor CR W/LF: ")) if CR == 1 str(string("YES")) if CR == 0 str(string("NO ")) outc(13) outc(10) inverse:=1 xloc := 6 loc := xloc + yloc*cols str(string("F1")) xloc := 19 loc := xloc + yloc*cols str(string("F2")) xloc := 30 loc := xloc + yloc*cols str(string("F3")) xloc := 46 loc := xloc + yloc*cols str(string("F4")) xloc := 58 loc := xloc + yloc*cols str(string("F5")) xloc := 70 loc := xloc + yloc*cols str(string("F6")) inverse := invs xloc := cursor[0] := x 'right & left was 0 yloc := cursor[1] := y 'from top was 1 loc := xloc + yloc*cols }} PUB clsupdate(c,screencolor,PCPORT,ascii,CR) | i,x,y,locold invs := inverse locold := loc x := xloc y := yloc ''(TURQUOISE) xloc := 0 yloc :=36 loc := xloc + yloc*cols inverse := 1 str(string(" ")) inverse := 0 xloc := 0 yloc :=37 loc := xloc + yloc*cols str(string("Baud Rate: ")) i:= BR[6] dec(i) str(string(" ")) xloc := 18 loc := xloc + yloc*cols str(string("Color ")) str(string("PC Port: ")) if pcport == 1 str(string("OFF ")) if pcport == 0 str(string("ON ")) str(string(" Force 7 bit: ")) if ascii == 0 str(string("NO ")) if ascii == 1 str(string("YES ")) str(string(" Cursor CR W/LF: ")) if CR == 1 str(string("YES")) if CR == 0 str(string("NO ")) xloc := 0 yloc :=38 loc := xloc + yloc*cols inverse:=1 xloc := 6 loc := xloc + yloc*cols str(string("F1")) xloc := 19 loc := xloc + yloc*cols str(string("F2")) xloc := 30 loc := xloc + yloc*cols str(string("F3")) xloc := 46 loc := xloc + yloc*cols str(string("F4")) xloc := 58 loc := xloc + yloc*cols str(string("F5")) xloc := 70 loc := xloc + yloc*cols str(string("F6")) inverse := invs xloc := cursor[0] := x yloc := cursor[1] := y ' loc := xloc + yloc*cols loc := locold PUB dec(value) | i '' Print a decimal number if value < 0 -value outc("-") i := 1_000_000_000 repeat 10 if value => i outc(value/i + "0") value //= i result~~ elseif result or i == 1 outc("0") i /= 10 PUB hex(value, digits) '' Print a hexadecimal number, specify number of digits repeat while digits > 8 outc("0") digits-- value <<= (8 - digits) << 2 repeat digits outc(lookupz((value <-= 4) & $f : "0".."9", "A".."F")) PUB str(string_ptr) '' Print a zero terminated string repeat strsize(string_ptr) process_char(byte[string_ptr++]) PUB statprint(r, c, str1) | x, ptr ptr := r * cols + c repeat x from 0 to STRSIZE(str1) - 1 putc(ptr++, BYTE[str1 + x]) PUB statnum(r, c, num1) | i, ptr ptr := r * cols + c if num1 < 0 -num1 putc(ptr++,"-") i := 1_000_000_000 repeat 10 if num1 => i putc(ptr++, (num1/i +"0")) num1 //= i result~~ elseif result or i == 1 putc(ptr++, "0") i /= 10 PUB putc(position, c) if inverse c |= $80 screen[position] := c PUB cls longfill (@screen, $20202020, lastChar) PUB fullcls longfill(@screen, $20202020, 800) PUB setInverse(val) inverse := val PUB setInv(c) if c == 7 setInverse(1) else setInverse(0) PUB clEOL(position) | count count := cols - (position // cols) bytefill(@screen + position, $20, count) PUB clBOL(position) | count count := position // cols bytefill(@screen + position - count, $20, count) PUB delLine(position) | src, count position -= position // cols src := position + cols count := (maxChars - src) / 4 if count > 0 longmove(@screen + position, @screen + src, count) longfill(@screen + lastLine, $20202020, lcols) PUB clEOS(position) cleol(position) position += cols - (position // cols) repeat while position < maxChars longfill(@screen + position, $20202020, lcols) pos += cols PUB setCursorPos(position) cursor[0] := position // cols cursor[1] := position / cols PUB insLine(position) | base, nxt base := position - (position // cols) position := lastLine repeat while position > base nxt := position - cols longmove(@screen + position, @screen + nxt, lcols) position := nxt clEOL(base) PUB insChar(position) | count count := (cols - (position // cols)) - 1 bytemove(@tmpl, @screen + position, count) screen[position] := " " bytemove(@screen + position + 1, @tmpl, count) PUB delChar(position) | count count := (cols - (position // cols)) - 1 bytemove(@screen + position, @screen + position + 1, count) screen[position + count] := " " PRI inRegion : answer answer := (pos => regionTop) AND (pos < regionBot) PRI scrollUp delLine(regionTop) if regionBot < maxChars insLine(regionBot) PRI scrollDown if regionBot < maxChars delLine(regionBot) insLine(regionTop) PRI ansi(c) | x, defVal state := 0 if (c <> "r") AND (c <> "J") AND (c <> "m") AND (c <> "K") if arg0 == -1 arg0 := 1 if arg1 == -1 arg1 := 1 case c "@": repeat while arg0-- > 0 insChar(pos) "b": repeat while arg0-- > 0 outc(lastc) "d": if (arg0 < 1) OR (arg0 > rows) arg0 := rows pos := ((arg0 - 1) * cols) + (pos // cols) "m": setInv(arg0) if arg1 <> -1 setInv(arg1) "r": if arg0 < 1 arg0 := 1 elseif arg0 > cols arg0 := cols if arg1 < 1 arg1 := 1 elseif arg1 > cols arg1 := cols if arg1 < arg0 arg1 := arg0 regionTop := (arg0 - 1) * cols regionBot := arg1 * cols pos := 0 "A": repeat while arg0-- > 0 pos -= cols if pos < 0 pos += cols return "B": repeat while arg0-- > 0 pos += cols if pos => maxChars pos -= cols return "C": repeat while arg0-- > 0 pos += 1 if pos => maxChars pos -= 1 return "D": repeat while arg0-- > 0 pos -= 1 if pos < 0 pos := 0 return "G": if (arg0 < 1) OR (arg0 > cols) arg0 := cols pos := (pos - (pos // cols)) + (arg0 - 1) "H", "f": if arg0 =< 0 arg0 := 1 if arg1 =< 0 arg1 := 1 pos := (cols * (arg0 - 1)) + (arg1 - 1) if pos < 0 pos := 0 if pos => maxChars pos := maxChars - 1 "J": if arg0 == 1 clBOL(pos) x := pos - cols x -= x // cols repeat while x => 0 clEOL(x) x -= cols return if arg0 == 2 pos := 0 clEOL(pos) x := pos + cols x -= (x // cols) repeat while x < maxChars clEOL(x) x += cols "K": if arg0 == -1 clEOL(pos) elseif arg0 == 1 clBOL(pos) else clEOL(pos - (pos // cols)) "L": if inRegion repeat while arg0-- > 0 if regionBot < maxChars delLine(regionBot) insLine(pos) "M": if inRegion repeat while arg0-- > 0 delLine(pos) if regionBot < maxChars insLine(regionBot) "P": repeat while arg0-- delChar(pos) PRI outc(c) putc(pos++, lastc := c) if pos == regionBot scrollUp pos -= cols elseif pos == maxChars pos := lastLine PUB process_char(c) case state 0: if c > 127 c := $20 if c => $20 outc(c) setCursorPos(pos) return if c == $1B state := 1 return if c == $0D pos := pos - (pos // cols) setCursorPos(pos) return if c == $0A if inRegion pos += cols if pos => regionBot scrollUp pos -= cols else pos += cols if pos => maxChars pos -= cols setCursorPos(pos) return if c == 9 pos += (8 - (pos // 8)) if pos => maxChars pos := lastLine delLine(0) setCursorPos(pos) return if c == 8 if pos > 0 pos -= 1 setCursorPos(pos) return 1: case c "[": arg0 := arg1 := -1 state := 2 return "P": pos += cols if pos => maxChars pos -= cols "K": if pos > 0 pos -= 1 "H": pos -= cols if pos < 0 pos += cols "D": if inRegion scrollUp "M": if inRegion scrollDown "G": pos := 0 "(": state := 5 return state := 0 return 2: if (c => "0") AND (c =< "9") if arg0 == -1 arg0 := c - "0" else arg0 := (arg0 * 10) + (c - "0") return if c == ";" state := 3 return ansi(c) setCursorPos(pos) return 3: if (c => "0") AND (c =< "9") if arg1 == -1 arg1 := c - "0" else arg1 := (arg1 * 10) + (c - "0") return if c == ";" state := 4 return ansi(c) setCursorPos(pos) return 4: if (c => "0") AND (c =< "9") return if c == ";" return ansi(c) setCursorPos(pos) return 5: state := 0 return return
Propeller Spin
4
davidknoll/RomWBW
Source/Prop/Spin/VGA_1024.spin
[ "DOC", "MIT" ]
extends Node2D func _draw() -> void: var current_cels : Array = Global.current_project.frames[Global.current_project.current_frame].cels for i in range(Global.current_project.layers.size()): if Global.current_project.layers[i].visible and current_cels[i].opacity > 0: var modulate_color := Color(1, 1, 1, current_cels[i].opacity) draw_texture(current_cels[i].image_texture, Vector2.ZERO, modulate_color)
GDScript
4
triptych/Pixelorama
src/UI/Canvas/CurrentFrameDrawer.gd
[ "MIT" ]
/* Copyright 2015 The TensorFlow Authors. All Rights Reserved. Licensed under the Apache License, Version 2.0 (the "License"); you may not use this file except in compliance with the License. You may obtain a copy of the License at http://www.apache.org/licenses/LICENSE-2.0 Unless required by applicable law or agreed to in writing, software distributed under the License is distributed on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the License for the specific language governing permissions and limitations under the License. ==============================================================================*/ #include "tensorflow/core/framework/op.h" #include "tensorflow/core/framework/op_kernel.h" #include "tensorflow/core/platform/macros.h" #include "tensorflow/core/platform/types.h" #include "tensorflow/core/util/bcast.h" namespace tensorflow { // Given shapes of two tensors, computes the broadcast shape. template <typename T> class BCastArgsOp : public OpKernel { public: explicit BCastArgsOp(OpKernelConstruction* ctx) : OpKernel(ctx) {} void Compute(OpKernelContext* ctx) override { OP_REQUIRES( ctx, ctx->num_inputs() == 2, errors::Unimplemented("Broadcast for n-ary operations (n > 2)")); gtl::InlinedVector<BCast::Vec, 4> shapes; for (int i = 0; i < ctx->num_inputs(); ++i) { const Tensor& in = ctx->input(i); OP_REQUIRES(ctx, TensorShapeUtils::IsVector(in.shape()), errors::InvalidArgument("In[", i, "] must be a vector.", in.shape().DebugString())); BCast::Vec vec; for (int64_t i = 0; i < in.NumElements(); ++i) { vec.push_back(in.vec<T>()(i)); } shapes.push_back(vec); } BCast bcast(shapes[0], shapes[1]); OP_REQUIRES(ctx, bcast.IsValid(), errors::InvalidArgument( "Incompatible shapes: [", absl::StrJoin(shapes[0], ","), "] vs. [", absl::StrJoin(shapes[1], ","), "]")); Output(ctx, 0, bcast.output_shape()); } bool IsExpensive() override { return false; } private: void Output(OpKernelContext* ctx, int idx, const BCast::Vec& v) { const int64_t len = v.size(); Tensor* o = nullptr; OP_REQUIRES_OK(ctx, ctx->allocate_output(idx, TensorShape({len}), &o)); for (int64_t i = 0; i < len; ++i) { o->flat<T>()(i) = static_cast<T>(v[i]); } } TF_DISALLOW_COPY_AND_ASSIGN(BCastArgsOp); }; // Given shapes of two tensors, computes the reduction indices for the // gradient computation. // // TODO(zhifengc): // 1. Adds support for n-ary (n >= 2). template <typename T> class BCastGradArgsOp : public OpKernel { public: explicit BCastGradArgsOp(OpKernelConstruction* ctx) : OpKernel(ctx) {} void Compute(OpKernelContext* ctx) override { OP_REQUIRES( ctx, ctx->num_inputs() == 2, errors::Unimplemented("Broadcast for n-ary operations (n > 2)")); gtl::InlinedVector<BCast::Vec, 4> shapes; for (int i = 0; i < ctx->num_inputs(); ++i) { const Tensor& in = ctx->input(i); OP_REQUIRES(ctx, TensorShapeUtils::IsVector(in.shape()), errors::InvalidArgument("In[", i, "] must be a vector.", in.shape().DebugString())); BCast::Vec vec; for (int64_t i = 0; i < in.NumElements(); ++i) { vec.push_back(in.vec<T>()(i)); } shapes.push_back(vec); } BCast bcast(shapes[0], shapes[1]); OP_REQUIRES(ctx, bcast.IsValid(), errors::InvalidArgument( "Incompatible shapes: [", absl::StrJoin(shapes[0], ","), "] vs. [", absl::StrJoin(shapes[1], ","), "]")); Output(ctx, 0, bcast.grad_x_reduce_idx()); Output(ctx, 1, bcast.grad_y_reduce_idx()); } bool IsExpensive() override { return false; } private: void Output(OpKernelContext* ctx, int idx, const BCast::Vec& v) { const int64_t len = v.size(); Tensor* o = nullptr; OP_REQUIRES_OK(ctx, ctx->allocate_output(idx, TensorShape({len}), &o)); for (int64_t i = 0; i < len; ++i) { o->flat<T>()(i) = static_cast<T>(v[i]); } } TF_DISALLOW_COPY_AND_ASSIGN(BCastGradArgsOp); }; REGISTER_KERNEL_BUILDER(Name("BroadcastArgs") .Device(DEVICE_CPU) .TypeConstraint<int32>("T") .HostMemory("s0") .HostMemory("s1") .HostMemory("r0"), BCastArgsOp<int32>); REGISTER_KERNEL_BUILDER(Name("BroadcastArgs") .Device(DEVICE_CPU) .TypeConstraint<int64_t>("T") .HostMemory("s0") .HostMemory("s1") .HostMemory("r0"), BCastArgsOp<int64_t>); REGISTER_KERNEL_BUILDER(Name("BroadcastArgs") .Device(DEVICE_DEFAULT) .TypeConstraint<int32>("T") .HostMemory("s0") .HostMemory("s1") .HostMemory("r0"), BCastArgsOp<int32>); REGISTER_KERNEL_BUILDER(Name("BroadcastArgs") .Device(DEVICE_DEFAULT) .TypeConstraint<int64_t>("T") .HostMemory("s0") .HostMemory("s1") .HostMemory("r0"), BCastArgsOp<int64_t>); REGISTER_KERNEL_BUILDER(Name("BroadcastGradientArgs") .Device(DEVICE_CPU) .TypeConstraint<int32>("T") .HostMemory("s0") .HostMemory("s1") .HostMemory("r0") .HostMemory("r1"), BCastGradArgsOp<int32>); REGISTER_KERNEL_BUILDER(Name("BroadcastGradientArgs") .Device(DEVICE_CPU) .TypeConstraint<int64_t>("T") .HostMemory("s0") .HostMemory("s1") .HostMemory("r0") .HostMemory("r1"), BCastGradArgsOp<int64_t>); REGISTER_KERNEL_BUILDER(Name("BroadcastGradientArgs") .Device(DEVICE_DEFAULT) .TypeConstraint<int32>("T") .HostMemory("s0") .HostMemory("s1") .HostMemory("r0") .HostMemory("r1"), BCastGradArgsOp<int32>); REGISTER_KERNEL_BUILDER(Name("BroadcastGradientArgs") .Device(DEVICE_DEFAULT) .TypeConstraint<int64_t>("T") .HostMemory("s0") .HostMemory("s1") .HostMemory("r0") .HostMemory("r1"), BCastGradArgsOp<int64_t>); } // end namespace tensorflow
C++
5
EricRemmerswaal/tensorflow
tensorflow/core/kernels/bcast_ops.cc
[ "Apache-2.0" ]
from django.forms import ChoiceField, Field, Form, Select from django.test import SimpleTestCase class BasicFieldsTests(SimpleTestCase): def test_field_sets_widget_is_required(self): self.assertTrue(Field(required=True).widget.is_required) self.assertFalse(Field(required=False).widget.is_required) def test_cooperative_multiple_inheritance(self): class A: def __init__(self): self.class_a_var = True super().__init__() class ComplexField(Field, A): def __init__(self): super().__init__() f = ComplexField() self.assertTrue(f.class_a_var) def test_field_deepcopies_widget_instance(self): class CustomChoiceField(ChoiceField): widget = Select(attrs={'class': 'my-custom-class'}) class TestForm(Form): field1 = CustomChoiceField(choices=[]) field2 = CustomChoiceField(choices=[]) f = TestForm() f.fields['field1'].choices = [('1', '1')] f.fields['field2'].choices = [('2', '2')] self.assertEqual(f.fields['field1'].widget.choices, [('1', '1')]) self.assertEqual(f.fields['field2'].widget.choices, [('2', '2')]) class DisabledFieldTests(SimpleTestCase): def test_disabled_field_has_changed_always_false(self): disabled_field = Field(disabled=True) self.assertFalse(disabled_field.has_changed('x', 'y'))
Python
3
ni-ning/django
tests/forms_tests/field_tests/test_base.py
[ "CNRI-Python-GPL-Compatible", "BSD-3-Clause" ]
### Demo Script Example ### # This script, but not the artwork associated with it, is in the # public domain. Feel free to use it as the basis for your own # game. # If you're trying to understand this script, I recommend skipping # down to the line beginning with 'label start:', at least on your # first read-through. # This init block runs first, and sets up all sorts of things that # are used by the rest of the game. Variables that are set in init # blocks are _not_ saved, unless they are changed later on in the # program. init: # Set up the size of the screen, and the window title. $ config.screen_width = 800 $ config.screen_height = 600 $ config.window_title = "The Ren'Py Demo Game" # Declare the images that are used in the program. # Backgrounds. image bg carillon = "carillon.jpg" image bg whitehouse = "whitehouse.jpg" image bg washington = "washington.jpg" image bg onememorial = "1memorial.jpg" image black = Solid((0, 0, 0, 255)) # Character pictures. image eileen happy = "9a_happy.png" image eileen vhappy = "9a_vhappy.png" image eileen concerned = "9a_concerned.png" # A character object. This object lets us have the character say # dialogue without us having to repeatedly type her name. It also # lets us change the color of her name. $ e = Character('Eileen', color=(200, 255, 200, 255)) # The start label marks the place where the main menu jumps to to # begin the actual game. label start: # The save_name variable sets the name of the save game. Like all # variables declared outside of init blocks, this variable is # saved and restored with a save file. $ save_name = "Introduction" # This variable is only used by our game. If it's true, it means # that we won the date. $ date = False # Clear the game runtime timer, so it doesn't reflect time spent # sitting at the main menu. $ renpy.clear_game_runtime() # Start some music playing in the background. $ renpy.music_start('sun-flower-slow-drag.mid') # Now, set up the first scene. We first fade in our washington # background, and then we dissolve in the image of Eileen on top # of it. scene bg washington with fade show eileen vhappy with dissolve # Store the current version of Ren'Py into a variable, so we can # interpolate it into the next line. $ version = renpy.version() # Display a line of dialogue. In this case, we manually specify # who's saying the line of dialogue. We also interpolate in the # version of Ren'Py we're using. "Girl" "Hi, and welcome to the %(version)s demo program." # This instantly replaces the very happy picture of Eileen with # one showing her merely happy. It demonstrates how the show # statement lets characters change emotions. show eileen happy # Another line of dialogue. "Girl" "My name is Eileen, and while I plan to one day star in a real game, for now I'm here to tell you about Ren'Py." # This line used the e character object, which displays Eileen's # name in green. The use of a short name for a character object # lets us save typing when writing the bulk of the dialogue. e "Ren'Py is a language and engine for writing and playing visual novel games." e "Our goal is to allow people to be able to write the script for a game, and with very little effort, turn that script into a working game." e "I can tell you about the features of Ren'Py games, or how to write your own game. What do you want to know about?" # This variable is used to save the choices that have been made in # the main menu. $ seen_set = [ ] label choices: # We change the save name here. $ save_name = "Question Menu" # This is the main menu, that lets the user decide what he wants # to hear about. menu: # The set menu clause ensures that each menu choice can only # be chosen once. set seen_set # This is a menu choice. When chosen, the statements in its # block are executed. "What are some user-visible features of Ren'Py games?": # We call the features label. The from clause needs to be # here to ensure that save games work, even after we # change the script. It was added automatically. call features from _call_features_1 # When we're done talking about features, jump back up # to choices. jump choices # Another choice. "How do I write my own games with it?": call writing from _call_writing_1 jump choices "Can you demonstrate more features to me?": call demonstrate from _call_demonstrate_1 jump choices # This choice has a condition associated with it. It is only # displayed if the condition is true (in this case, if we have # selected at least one other choice has been chosen.) "Where can I find out more?" if seen_set: call find_out_more from _call_find_out_more_1 jump choices "Why are we in Washington, DC?": call washington from _call_washington_1 jump choices "I think I've heard enough." if seen_set: jump ending # This is the section on writing games. label writing: # Change the title of the save games. $ save_name = "Writing Games" # We start off with a bunch of dialogue. e "If you want to write a game, we recommend that you read the Ren'Py reference, which you can get from our web page, http://www.bishoujo.us/renpy/." e "But here, we'll go over some of the basics of writing Ren'Py scripts. It might make sense if you open the source for this game." e "The source for this game can be found in the file game/script.rpy." e "The goal of Ren'Py is to make writing the game similar to typing up the script on the computer." e "For example, a line of dialogue is expressed by putting the character's name next to the dialogue string." # A string by itself like this displays without a name associated # with it. So it's useful for dialogue and narration. "I somehow remember that strings by themselves are displayed as thoughts or narration." e "The menu statement makes it easy to create menus." e "A number of statements let you control what is shown on the screen." # This scene statement has a with clause associated with it. In # this case (based on what is defined in the init clause at the # top of this script), it causes a fade to black, and then back # to the new scene. scene bg whitehouse with fade e "The scene statement clears the scene list, which is the list of things that are shown on the screen." # This shows an image, and dissolves it in. show eileen happy with dissolve e "The show statement shows another image on the screen." # The at clause here, displays the character on the left side of # the screen. The with clause causes us to slide from the old # position to the new position. show eileen happy at left with move e "Images can take at clauses that specify where on the screen they are shown." show eileen vhappy at left e "Showing a new image with the same first part of the name replaces the image in the scene list." hide eileen with dissolve e "Finally, the hide statement hides an image, which is useful when a character leaves the scene." show eileen happy with dissolve e "Don't worry, I'm not going anywhere." e "The with statement is used to cause transitions to happen. Transitions like fade..." # This statement hides the transient stuff from being included # in the next fade. with None # This with statement causes things to fade without changing the # scene. with fade e "... or dissolve ..." # In this block, the scene statement clears the scene list. So we # have to reshow the eileen happy image, so that it appears that # just the background is dissolving. Sneaky. with None scene bg washington show eileen happy with dissolve e "... are easily invoked." e "We now provide a series of user-interface functions, that allow the programmer to create fairly complex interfaces." e "Ren'Py also includes a number of control statements, and even lets you include python code." e "Rather than go into this here, you can read all about it in the reference." e "You can see a number of features in action by asking me to demonstrate them at the next menu." e "If you want to make changes, you can edit the script for this game by editing game/script.rpy" e "When you've made a change, just re-run the game to see your change in action." e "Would you like to know about something else?" # We return back up to the menu that lets the user pick a topic. return # This ends the well-commented portion of this script. label features: $ save_name = "Features" e "Ren'Py provides a number of gameplay features, giving the user a good experience while freeing up the game author to write his game." e "What are some of these features? Well, first of all, we take care of displaying the screen, as well as dialogue and menus." e "You can navigate through the game using the keyboard or the mouse. If you've gotten this far, you've probably figured that out already." e "Right-clicking or pressing escape will bring you to the game menu." e "The game menu lets you save or load the game. Ren'Py doesn't limit the number of save slots available. You can create as many slots as you can stand." e "A preferences screen on the game menu lets you change the fullscreen mode, control skipping, text speed, and transitions, and turn sound and music on and off." e "The game menu also lets you restart or quit the game. But you wouldn't want to do that, would you?" e "Finally, the game menu lets you set up the game preferences. These preferences are saved between games." show eileen vhappy e "The next feature is really neat." show eileen happy menu rollback_menu: "Would you like to hear about rollback?" "Yes.": pass "No.": jump after_rollback e "Rollback is a feature that only Ren'Py has. It lets you go back in time in a game." e "For example, you can go back to a menu and save or make a different choice." e "You can access it by pressing page up or scrolling up on your mouse wheel." e "Why don't you try it by going back to the last menu and choosing 'No.' instead of 'Yes.'" e "Press page up or scroll up the mouse wheel." show eileen concerned e "Well, are you going to try it?" e "Your loss." e "Moving on." label after_rollback: show eileen happy e "Ren'Py gives you a few ways of skipping dialogue. Pressing control quickly skips dialogue you've seen at least once." e "Pressing Tab toggles the skipping of dialogue you've seen at least once." e "Pressing page down or scrolling the mouse wheel down will let you skip dialogue you've seen this session. This is useful after a rollback." e "If you want to try these, you might want to rollback a bit first, so you can skip over something you've seen already." e "Finally, Ren'Py has predictive image loading, so you rarely have to wait for a new image to load." e "Remember, all these features are built into the engine or standard library. So every game written with Ren'Py has them." e "Is there anything else you'd like to know about?" return label find_out_more: $ save_name = "Find Out More" e "There are a few places you can go to find out more about Ren'Py." e "The Ren'Py homepage, http://www.bishoujo.us/renpy/, is probably the best place to start." e "There, you can download new versions of Ren'Py, and read the tutorial online." e "If you have questions, the best place to ask them is the Ren'Py forum of the Lemmasoft forums." e "Just go to http://lemmasoft.renai.us/forums/, and click on Ren'Py." e "We thank Blue Lemma for hosting our forum." e "Finally, feel free to email or IM us if you need help. You can get the addresses to use from http://www.bishoujo.us/renpy/." e "We really want people to make their own games with Ren'Py, and if there's anything we can do to help, just tell us." e "Is there anything I can help you with now?" return label washington: $ save_name = "Washington, DC" e "We're in Washington, DC because over Summer 2004 American Bishoujo's home base was just outside of DC." scene bg whitehouse show eileen happy at left with fade e "Even though we've moved back to New York, we took a bunch of pictures, and decided to use them." show eileen concerned at left e "It was easier than drawing new pictures for this demo." show eileen happy at left e "Do you have a favorite landmark in or around DC?" menu: "The White House.": e "I was supposed to go on a tour of the West Wing, once." show eileen concerned e "They wouldn't let us in." e "The secret service guy who was supposed to show us around was out of town that day." e "Too bad." "The National Mall.": e "It's always fun to go down to the national mall." e "You can visit the monuments, or see one of the museums." e "I guess you could run out of things to do after a while but I didn't over the course of a summer." "The Netherlands Carillon.": jump netherlands jump post_netherlands label netherlands: show eileen vhappy at left e "You've been to the Netherlands Carillon?" scene bg carillon show eileen vhappy at left with dissolve e "It may not be much to look at but the sound of the bells is really neat." e "I love going there. Saturdays during the summer, they have these recitals in the park where a guy comes and plays the bells live." e "You can climb to the top and talk to him, if you're not afraid of heights." e "Once, I saw a little girl there, maybe three or four years old. The guy played the bumblebee song for here, and he even let her play the last note. It was so cute!" e "I haven't been there for so long." menu: "Would you like to go there sometime?": e "You mean, together?" e "Sure, why not. How does next Saturday sound?" e "It's a date." $ date = True "That sounds nice.": show eileen happy at left e "Well, it is." label post_netherlands: scene bg washington show eileen happy with fade e "Anyway, is there anything else you want to know about Ren'Py?" return label ending: $ save_name = "Ending" e "Well, that's okay." e "I hope you'll consider using Ren'Py for your next game project." show eileen vhappy e "Thanks for viewing this demo!" if date: e "And I'll see you on Saturday." scene black with dissolve "Ren'Py and the Ren'Py demo were written by PyTom." 'The background music is "Sun Flower Slow Drag" by S. Joplin (1868-1917). Thanks to the Mutopia project for making it available.' 'The author would like to thank everyone who makes original English-language bishoujo games, and the people on the Lemmasoft forums who encouraged him.' "We can't wait to see what you do with this. Good luck!" $ minutes, seconds = divmod(int(renpy.get_game_runtime()), 60) "It took you %(minutes)d minutes and %(seconds)d seconds to finish this demo." $ renpy.full_restart() label speedtest: with None scene bg whitehouse show eileen happy with dissolve e "Okay, I'm going to run the speedtest on your system." e "I'll only be testing the performance of the dissolve transition. It taxes your system the most, as it needs to redraw the entire screen each frame." $ frames = config.frames with None scene bg washington show eileen happy with Dissolve(5.0) $ frames = config.frames - frames $ fps = frames / 5.0 e "Well, your system displayed %(frames)d frames in five seconds. That's %(fps).1f fps." e "Remember, this is the worst-case speed, as usually we can just draw the parts of the screen that have changed." e "Thanks for viewing the secret speed test." return # Setup the secret key for the speedtest. init: python: config.keymap['speedtest'] = [ 'S' ] config.underlay.append(renpy.Keymap(speedtest=renpy.curried_call_in_new_context('speedtest'))) init: # This is just some example code to show the ui functions in # action. You probably want to delete this (and the call to # day_planner above) from your game. This code isn't really all # that useful except as an example. python: def day_planner(): periods = [ 'Morning', 'Afternoon', 'Evening' ] choices = [ 'Study', 'Exercise', 'Eat', 'Drink', 'Be Merry' ] plan = { 'Morning' : 'Eat', 'Afternoon' : 'Drink', 'Evening' : 'Be Merry' } day = 'March 25th' stats = [ ('Strength', 100, 10), ('Intelligence', 100, 25), ('Moxie', 100, 100), ('Chutzpah', 100, 75), ] editing = None def button(text, selected, returns, **properties): style = 'button' style_text = 'button_text' if selected: style='selected_button' style_text='selected_button_text' ui.button(clicked=ui.returns(returns), style=style, **properties) ui.text(text, style=style_text) while True: # Stats Window ui.window(xpos=0, ypos=0, xanchor='left', yanchor='top', xfill=True, yminimum=200, ) ui.vbox() ui.text('Statistics') ui.null(height=20) for name, range, value in stats: ui.hbox() ui.text(name, minwidth=150) ui.bar(600, 22, range, value, ypos=0.5, yanchor='center') ui.close() ui.close() # Period Selection Window. ui.window(xpos=0, ypos=200, xanchor='left', yanchor='top', xfill=False, xminimum=300 ) ui.vbox(xpos=0.5, xanchor='center') ui.text(day, xpos=0.5, xanchor='center', textalign=0.5) ui.null(height=20) for i in periods: face = i + ": " + plan[i] button(face, editing == i, ("edit", i)) ui.null(height=20) ui.textbutton("Continue", clicked=ui.returns(("done", True))) ui.null(height=20) ui.close() # Choice window. if editing: ui.window(xpos=300, ypos=200, xanchor='left', yanchor='top', xfill=False, xminimum=500 ) ui.vbox() ui.text("What will you do in the %s?" % editing.lower()) ui.null(height=20) for i in choices: button(i, plan[editing] == i, ("set", i), xpos=0, xanchor='left') ui.close() # Window at the bottom. ui.window() ui.vbox() ui.text("To get to the next screen, click the 'Continue' button.") ui.close() type, value = ui.interact() if type == "done": break if type == "edit": editing = value if type == "set": plan[editing] = value editing = None return plan init: image movie = Movie() python: povname = "" pov = DynamicCharacter("povname", color=(255, 0, 0, 255)) $ ectc = Character('Eileen', color=(200, 255, 200, 255), ctc = anim.Blink("arrow.png")) $ ectcf = Character('Eileen', color=(200, 255, 200, 255), ctc = anim.Blink("arrow.png", xpos=760, ypos=560), ctc_position="fixed") image eileen animated = Animation( "9a_vhappy.png", 1.0, "9a_happy.png", 1.0) image smanim = anim.SMAnimation( "r", anim.State("r", Solid((255, 0, 0, 255))), anim.State("g", Solid((0, 255, 0, 255))), anim.State("b", Solid((0, 0, 255, 255))), anim.Edge("r", .5, "g", dissolve), anim.Edge("r", .5, "b", dissolve), anim.Edge("g", .5, "r", dissolve), anim.Edge("g", .5, "b", dissolve), anim.Edge("b", .5, "r", dissolve), anim.Edge("b", .5, "g", dissolve), ) image cyan base = Image("cyan.png") image cyan crop = im.Crop("cyan.png", 100, 0, 100, 200) image cyan composite = im.Composite((200, 300), (0, 0), "cyan.png", (0, 50), "cyan.png", (0, 100), "cyan.png") image cyan green = im.Map("cyan.png", bmap=im.ramp(0, 0)) image cyan alpha = im.Alpha("cyan.png", 0.5) image eileen alpha = im.Alpha("9a_happy.png", 0.5) $ cyanpos = Position(xpos=700, xanchor='right', ypos=100, yanchor='top') init: $ slowcirciris = ImageDissolve("circiris.png", 5.0, 8) $ circirisout = ImageDissolve("circiris.png", 1.0, 8) $ circirisin = ImageDissolve("circiris.png", 1.0, 8, reverse=True) $ demotrans = ImageDissolve("demotrans.png", 3.0, 128) image circiris = "circiris.png" label demonstrate: scene bg washington show eileen happy e "I can give you a demonstration of some of the features in Ren'Py, but you'll have to tell me what it is you'd like to have demonstrated." menu demo_menu: "Simple transitions, updated in 4.8.5": e "Okay, I can tell you about simple transitions. We call them simple because they aren't that flexible." e "But don't let that get you down, since they're the transitions you'll probably use the most." with None scene bg whitehouse show eileen happy with dissolve e "The dissolve transition is probably the most useful, blending one scene into another." with None with fade e "The fade transition fades to black, and then fades back in to the new scene." e "If you're going to stay at a black screen, you'll probably want to use dissolve rather than fade." with None scene bg washington show eileen happy with pixellate e "The pixellate transition pixellates out the old scene, switches to the new scene, and then unpixellates that." e "It's probably not appropriate for most games, but we think it's kind of neat." e "Finally, we can point out that motions can be used as transitions." "..." "......" $ renpy.play('punch.wav') with vpunch e "Hey! Pay attention." e "I was about to demonstrate vpunch... well, I guess I just did." $ renpy.play('punch.wav') with hpunch e "We can also shake the screen horizontally, with hpunch." "ImageDissolve transitions, added in 4.8.7.": e "ImageDissolve allows us to have dissolve transitions that are controlled by images." e "This lets us specify very complex transitions, fairly simply." e "Let's try some, and then I'll show how they work." e "There are two ImageDissolve transitions present by default in the standard library." scene black with blinds scene bg washington show eileen happy with blinds e "The blinds transition opens and closes what looks like vertical blinds." scene black with squares scene bg washington show eileen happy with squares e "The squares transition uses these squares to show things." e "I'm not sure why anyone would want to use it, but it was used in some translated games, so we added it." e "There are also a few transitions that aren't in the standard library." e "These ones require images the size of the screen, and so we couldn't include them as the size of the screen can change from game to game." e "You can find them defined in the source of the demo script." scene black with circirisin e "We can hide things with a circirisin..." with None scene bg washington show eileen happy with circirisout e "... and show them again with a circirisout." e "It's even possible to have weird custom transitions." scene circiris with demotrans e "What we're showing here is the picture that's used in the circiris transitions." e "If you take a look, the center of it is white, while the edges are darker." e "When we use an ImageDissolve, the white will dissolve in first, followed by progressively darker colors." e "Let's try it." with None scene bg washington show eileen happy with slowcirciris e "It's also possible to reverse the transition, so that the black pixels are dissolved in first." "CropMove transitions, added in 4.5.": e "The CropMove transition class lets us provide a wide range of transition effects." hide eileen with dissolve e "I'll stand offscreen, so you can see some of its modes. I'll read out the mode name after each transition." scene bg whitehouse with wiperight e "We first have wiperight..." scene bg washington with wipeleft e "...followed by wipeleft... " scene bg whitehouse with wipeup e "...wipeup..." scene bg washington with wipedown e "...and wipedown." e "Next, the slides." scene bg whitehouse with slideright e "Slideright..." scene bg washington with slideleft e "...slideleft..." scene bg whitehouse with slideup e "...slideup..." scene bg washington with slidedown e "and slidedown." e "While the slide transitions slide in the new scene, the slideaways slide out the old scene." scene bg whitehouse with slideawayright e "Slideawayright..." scene bg washington with slideawayleft e "...slideawayleft..." scene bg whitehouse with slideawayup e "...slideawayup..." scene bg washington with slideawaydown e "and slideawaydown." e "We also have a couple of transitions that use a rectangular iris." scene bg whitehouse with irisout e "There's irisout..." with None scene bg washington show eileen happy with irisin e "... and irisin." e "It's enough to make you feel a bit dizzy." "Positions and movement, updated in 4.8.": e "I'm not stuck standing in the middle of the screen, even though I like being the center of attention." e "Positions, given with an at clause, specify where I'm standing." e "The move transition moves around images that have changed position." e "For example..." show eileen happy at offscreenleft with move e "I can move over to the offscreenleft position, just off the left side of the screen." show eileen happy at left with move e "The left position has my left side border the left margin of the screen." show eileen happy at center with move e "I can also move to the center..." show eileen happy at right with move e "... the right ..." show eileen happy at offscreenright with move e "... or even to offscreenright, off the right-hand side of the screen." show eileen happy at right with move e "We don't limit you to these five positions either. You can always create your own Position objects." # This is necessary to restart the time at which we are # shown. hide eileen happy show eileen happy at Move((1.0, 1.0, 'right', 'bottom'), (0.0, 1.0, 'left', 'bottom'), 4.0, repeat=True, bounce=True) e "It's also possible to have a movement happen while showing dialogue on the screen, using the Move function." e "Move can repeat a movement, and even have it bounce back and forth, like I'm doing now." scene bg onememorial at Pan((0, 800), (0, 0), 10.0) with dissolve e "Finally, we can pan around an image larger than the screen, using the Pan function in an at clause." e "That's what we're doing now, panning up a picture of the memorial to the Big Red One." with None scene bg washington show eileen happy with dissolve "Animation, updated in 4.8.5": e "Ren'Py supports a number of ways of creating animations." e "These animations let you vary images, independent of the user's clicks." show eileen animated e "For example, I'm switching my expression back and forth, once a second." e "Even though you clicked, I'm still doing it." e "This is an example of the Animation function at work." show eileen happy e "The Animation function is limited to simple lists of images, with fixed delays between them." e "The sequence can repeat, or can stop after one go-through." e "If you want more control, you can use the anim.SMAnimation function." e "It can randomly change images, and even apply transitions to changes." with None scene smanim show eileen happy with dissolve e "Here, we randomly dissolve the background between red, green, and blue images." e "Psychadelic." with None scene bg washington show eileen happy with dissolve e "It's probably best if we stop here, before somebody's brain explodes." "Text tags, updated in 5.1.4.": e "Text tags let us control the appearance of text that is shown to the user." e "Text tags can make text {b}bold{/b}, {i}italic{/i}, or {u}underlined{/u}." e "They can make the font size {size=+12}bigger{/size} or {size=-8}smaller{/size}." e "They let you pause{w} the display of the text, optionally with{p}line breaks." e "They let you include {image=slider_idle.png} images inside text." e "They can even change the {color=#f00}color{/color} {color=#ff0}of{/color} {color=#0f0}the{/color} {color=#0ff}text{/color}." e "There are also bold, italic, and underline style properties, which can be styled onto any text." e "If you find yourself using text tags on every line, you should probably look at style properties instead." e "Used with care, text tags can enhance {b}your{/b} game." e "{u}Used{/u} with {i}abandon,{/i} they {b}can{/b} make {b}your{/b} game {color=#333}hard{/color} {color=#888}to{/color} {color=#ccc}read{/color}." e "With great power comes great responsibility, after all." e "And we want to give you all the power you need." "Music, sound and movies, updated in 4.5.": e "Ren'Py supports a number of multimedia functions." e "You're probably hearing music playing in the background." $ renpy.music_stop(fadeout=0.5) e "We can stop it..." $ renpy.music_start('sun-flower-slow-drag.mid') e "... and start it playing again." # This plays a sound effect. $ renpy.play("18005551212.wav") e "We can also play up to eight channels of sound effects on top of the music." e "We ship, in the extras/ directory, code to support characters having voice." e "Finally, we support playing mpeg movies." if renpy.exists('Eisenhow1952.mpg'): e "Since you downloaded the Eisenhower commercial, I can show it to you as a cutscene." e "You can click to continue if it gets on your nerves too much." $ renpy.movie_cutscene('Eisenhow1952.mpg', 63.0) hide eileen show movie at Position(xpos=420, ypos=25, xanchor='left', yanchor='top') show eileen happy $ renpy.movie_start_displayable('Eisenhow1952.mpg', (352, 240)) e "Ren'Py can even overlay rendered images on top of a movie, although that's more taxing for your CPU." e "It's like I'm some sort of newscaster or something." $ renpy.movie_stop() hide movie else: e "You haven't downloaded the Eisenhower commercial, so we can't demonstrate it." e "That's it for multimedia." "Image Operations, added in 4.8.5": e "Image operations allow one to manipulate images as they are loaded in." e "These are efficent, as they are only evaluated when an image is first loaded." e "This way, there's no extra work that needs to be done when each frame is drawn to the screen." show eileen happy at left with move show cyan base at cyanpos with dissolve e "Let me show you a test image, a simple cyan circle." e "We'll be applying some image operations to it, to see how they can be used." show cyan crop at cyanpos with dissolve e "The im.Crop operation can take the image, and chop it up into a smaller image." show cyan composite at cyanpos with dissolve e "The im.Composite operation lets us take multiple images, and draw them into a single image." e "While you can do this by showing multiple images, this is more efficent, if more complex." show cyan green at cyanpos with dissolve e "The im.Map operation lets us mess with the red, green, blue, and alpha channels of an image." e "In this case, we removed all the blue from the image, leaving only the green component of cyan." show cyan alpha at cyanpos with dissolve e "The im.Alpha operation can adjust the alpha channel on an image, making things partially transparent." show eileen alpha at left with dissolve e "It's useful if a character just happens to be ghost." with None hide cyan show eileen happy at left with dissolve e "But that's not the case with me." show eileen happy with move "User interaction.": e "Ren'Py gives a number of ways of interacting with the user." e "You've already seen say statements and menus." e "We can also prompt the user to enter some text." $ povname = renpy.input("What is your name?") pov "My name is %(povname)s." e "Imagemaps let the user click on an image to make a choice." # This is an imagemap. It consists of two images, and a list of # hotspots. For each hotspot we give the coordinates of the left, # top, right, and bottom sides, and the value to return if it is # picked. $ result = renpy.imagemap("ground.png", "selected.png", [ (100, 100, 300, 400, "eileen"), (500, 100, 700, 400, "lucy") ]) # We've assigned the chosen result from the imagemap to the # result variable. We can use an if statement to vary what # happens based on the user's choice. if result == "eileen": show eileen vhappy e "You picked me!" elif result == "lucy": show eileen concerned e "It looks like you picked Lucy." # Eileen is being a bit possesive here. :-P if date: e "You can forget about Saturday." $ date = False show eileen happy e "While these constructs are probably enough for most visual novels, dating simulations may be more complicated." e "The ui functions allow you to create quite complicated interfaces." e "For example, try the following scheduling and stats screen, which could be used by a stat-based dating simulation." $ day_planner() e "The ui functions can be used to rewrite many parts of the interface." e "Hopefully, this gives you enough power to write any visual novel you want." "Potpourri, added in 5.1.2.": e "Welcome to the potpourri section of the demo." e "Here, we demonstrate features that don't fit in any of the other sections, but don't warrant their own section." ectc "Here, we demonstrate a click to continue indicator. In this example, it's nestled in with the text." ectc "This also demonstrates the use of the anim.Blink function." ectcf "A click to continue image can also be placed at a fixed location on the screen." e "That's it for now." " " # Empty, so we have a blank line. "That's enough for me.": return e "Is there anything else you want demonstrated?" jump demo_menu # Here, are a number of customizations that make the game look # better. We place them down here at the bottom, to make the first few # lines of the script look better. # # These can be deleted without issue, if you do not want them. init: # Change some styles, to add images in the background of # the menus and windows. $ style.mm_root_window.background = Image("mainmenu.jpg") $ style.gm_root_window.background = Image("gamemenu.jpg") $ style.window.background = Frame("frame.png", 25, 25) # Change the look of the slider. $ style.bar.left_gutter = 10 $ style.bar.right_gutter = 12 $ style.bar.left_bar = Frame("slider_full.png", 10, 0) $ style.bar.right_bar = Frame("slider_empty.png", 12, 0) $ style.bar.thumb = Image("slider_idle.png") $ style.bar.hover_thumb = Image("slider_hover.png") $ style.bar.thumb_shadow = Image("slider_shadow.png") $ style.bar.thumb_offset = -10 # Change some styles involving the margins and padding of the # default window. (We need this, as we use a frame image that # includes a drop-shadow.) $ style.window.xmargin = 0 $ style.window.ymargin = 0 $ style.window.xpadding = 20 $ style.window.top_padding = 5 $ style.window.bottom_padding = 15 # Interface sounds, just for the heck of it. $ style.button.activate_sound = 'click.wav' $ style.imagemap.activate_sound = 'click.wav' $ library.enter_sound = 'click.wav' $ library.exit_sound = 'click.wav' $ library.sample_sound = "18005551212.wav" # Select the transitions that are used when entering and exiting # the game menu. $ library.enter_transition = pixellate $ library.exit_transition = pixellate # The splashscreen is called, if it exists, before the main menu is # shown the first time. It is not called if the game has restarted. # We'll comment it out for now. # # label splashscreen: # scene black # show text "American Bishoujo Presents..." with dissolve # $ renpy.pause(1.0) # hide text with dissolve # # return
Ren'Py
5
JavascriptID/sourcerer-app
src/test/resources/samples/langs/Ren'Py/example.rpy
[ "MIT" ]
DROP TABLE "public"."t5";
SQL
0
gh-oss-contributor/graphql-engine-1
cli/commands/testdata/config-v2-test-project/migrations/1620138179776_create_table_public_t5/down.sql
[ "Apache-2.0", "MIT" ]
module appendixA/tube abstract sig Station { jubilee, central, circle: set Station } sig Jubilee, Central, Circle in Station {} one sig Stanmore, BakerStreet, BondStreet, Westminster, Waterloo, WestRuislip, EalingBroadway, NorthActon, NottingHillGate, LiverpoolStreet, Epping extends Station {} fact { // the constraints should go here } pred show {} run show
Alloy
3
Kaixi26/org.alloytools.alloy
org.alloytools.alloy.extra/extra/models/book/appendixA/tube.als
[ "Apache-2.0" ]
/* Giovanni Blu Mitolo 2017 - gioscarab@gmail.com With this example it is possible to test HC-12 433MHz wireless serial module (HCMODU0054) along with PJON and ThroughSerial strategy. A software emulated Serial port is used on pin 2 and 3 to communicate with HC12. The receiver device should blink every second.*/ #include <PJONThroughSerial.h> #include <SoftwareSerial.h> SoftwareSerial HC12(2, 3); PJONThroughSerial bus(44); void setup() { // Initialize LED 13 to be off pinMode(LED_BUILTIN, OUTPUT); digitalWrite(LED_BUILTIN, LOW); // Set HC12 baudrate (you must use the one configured in HC12, default 9600) HC12.begin(9600); // Pass the HC12 Serial instance you want to use for PJON communication bus.strategy.set_serial(&HC12); bus.begin(); bus.set_receiver(receiver_function); }; void receiver_function(uint8_t *payload, uint16_t length, const PJON_Packet_Info &packet_info) { /* Make use of the payload before sending something, the buffer where payload points to is overwritten when a new message is dispatched */ if(payload[0] == 'B') { digitalWrite(LED_BUILTIN, HIGH); delay(30); digitalWrite(LED_BUILTIN, LOW); } }; void loop() { bus.receive(1000); };
Arduino
4
jcallano/PJON
examples/ARDUINO/Local/ThroughSerial/HC-12-Blink/Receiver/Receiver.ino
[ "Apache-2.0" ]
#include "EXTERN.h" #include "perl.h" #include "XSUB.h" #include <process.h> #define INCL_DOS #define INCL_DOSERRORS #include <os2.h> static unsigned long constant(char *name, int arg) { errno = 0; if (name[0] == 'P' && name[1] == '_') { if (strEQ(name, "P_BACKGROUND")) #ifdef P_BACKGROUND return P_BACKGROUND; #else goto not_there; #endif if (strEQ(name, "P_DEBUG")) #ifdef P_DEBUG return P_DEBUG; #else goto not_there; #endif if (strEQ(name, "P_DEFAULT")) #ifdef P_DEFAULT return P_DEFAULT; #else goto not_there; #endif if (strEQ(name, "P_DETACH")) #ifdef P_DETACH return P_DETACH; #else goto not_there; #endif if (strEQ(name, "P_FOREGROUND")) #ifdef P_FOREGROUND return P_FOREGROUND; #else goto not_there; #endif if (strEQ(name, "P_FULLSCREEN")) #ifdef P_FULLSCREEN return P_FULLSCREEN; #else goto not_there; #endif if (strEQ(name, "P_MAXIMIZE")) #ifdef P_MAXIMIZE return P_MAXIMIZE; #else goto not_there; #endif if (strEQ(name, "P_MINIMIZE")) #ifdef P_MINIMIZE return P_MINIMIZE; #else goto not_there; #endif if (strEQ(name, "P_NOCLOSE")) #ifdef P_NOCLOSE return P_NOCLOSE; #else goto not_there; #endif if (strEQ(name, "P_NOSESSION")) #ifdef P_NOSESSION return P_NOSESSION; #else goto not_there; #endif if (strEQ(name, "P_NOWAIT")) #ifdef P_NOWAIT return P_NOWAIT; #else goto not_there; #endif if (strEQ(name, "P_OVERLAY")) #ifdef P_OVERLAY return P_OVERLAY; #else goto not_there; #endif if (strEQ(name, "P_PM")) #ifdef P_PM return P_PM; #else goto not_there; #endif if (strEQ(name, "P_QUOTE")) #ifdef P_QUOTE return P_QUOTE; #else goto not_there; #endif if (strEQ(name, "P_SESSION")) #ifdef P_SESSION return P_SESSION; #else goto not_there; #endif if (strEQ(name, "P_TILDE")) #ifdef P_TILDE return P_TILDE; #else goto not_there; #endif if (strEQ(name, "P_UNRELATED")) #ifdef P_UNRELATED return P_UNRELATED; #else goto not_there; #endif if (strEQ(name, "P_WAIT")) #ifdef P_WAIT return P_WAIT; #else goto not_there; #endif if (strEQ(name, "P_WINDOWED")) #ifdef P_WINDOWED return P_WINDOWED; #else goto not_there; #endif } else if (name[0] == 'T' && name[1] == '_') { if (strEQ(name, "FAPPTYP_NOTSPEC")) #ifdef FAPPTYP_NOTSPEC return FAPPTYP_NOTSPEC; #else goto not_there; #endif if (strEQ(name, "T_NOTWINDOWCOMPAT")) #ifdef FAPPTYP_NOTWINDOWCOMPAT return FAPPTYP_NOTWINDOWCOMPAT; #else goto not_there; #endif if (strEQ(name, "T_WINDOWCOMPAT")) #ifdef FAPPTYP_WINDOWCOMPAT return FAPPTYP_WINDOWCOMPAT; #else goto not_there; #endif if (strEQ(name, "T_WINDOWAPI")) #ifdef FAPPTYP_WINDOWAPI return FAPPTYP_WINDOWAPI; #else goto not_there; #endif if (strEQ(name, "T_BOUND")) #ifdef FAPPTYP_BOUND return FAPPTYP_BOUND; #else goto not_there; #endif if (strEQ(name, "T_DLL")) #ifdef FAPPTYP_DLL return FAPPTYP_DLL; #else goto not_there; #endif if (strEQ(name, "T_DOS")) #ifdef FAPPTYP_DOS return FAPPTYP_DOS; #else goto not_there; #endif if (strEQ(name, "T_PHYSDRV")) #ifdef FAPPTYP_PHYSDRV return FAPPTYP_PHYSDRV; #else goto not_there; #endif if (strEQ(name, "T_VIRTDRV")) #ifdef FAPPTYP_VIRTDRV return FAPPTYP_VIRTDRV; #else goto not_there; #endif if (strEQ(name, "T_PROTDLL")) #ifdef FAPPTYP_PROTDLL return FAPPTYP_PROTDLL; #else goto not_there; #endif if (strEQ(name, "T_32BIT")) #ifdef FAPPTYP_32BIT return FAPPTYP_32BIT; #else goto not_there; #endif } errno = EINVAL; return 0; not_there: errno = ENOENT; return 0; } const char* const ptypes[] = { "FS", "DOS", "VIO", "PM", "DETACH" }; static char * my_type() { int rc; TIB *tib; PIB *pib; if (!(_emx_env & 0x200)) return (char*)ptypes[1]; /* not OS/2. */ if (CheckOSError(DosGetInfoBlocks(&tib, &pib))) return NULL; return (pib->pib_ultype <= 4 ? (char*)ptypes[pib->pib_ultype] : "UNKNOWN"); } static ULONG file_type(char *path) { int rc; ULONG apptype; if (!(_emx_env & 0x200)) croak("file_type not implemented on DOS"); /* not OS/2. */ if (CheckOSError(DosQueryAppType(path, &apptype))) { if (rc == ERROR_INVALID_EXE_SIGNATURE) croak("Invalid EXE signature"); else if (rc == ERROR_EXE_MARKED_INVALID) { croak("EXE marked invalid"); } croak("DosQueryAppType err %ld", rc); } return apptype; } static void fill_swcntrl(SWCNTRL *swcntrlp) { int rc; PTIB ptib; PPIB ppib; HSWITCH hSwitch; HWND hwndMe; if (!(_emx_env & 0x200)) croak("switch_entry not implemented on DOS"); /* not OS/2. */ if (CheckOSError(DosGetInfoBlocks(&ptib, &ppib))) croak("DosGetInfoBlocks err %ld", rc); if (CheckWinError(hSwitch = WinQuerySwitchHandle(NULLHANDLE, (PID)ppib->pib_ulpid))) croak("WinQuerySwitchHandle err %ld", Perl_rc); if (CheckOSError(WinQuerySwitchEntry(hSwitch, swcntrlp))) croak("WinQuerySwitchEntry err %ld", rc); } /* static ULONG (* APIENTRY16 pDosSmSetTitle)(ULONG, PSZ); */ ULONG _THUNK_FUNCTION(DosSmSetTitle)(ULONG, PSZ); #if 0 /* Does not work. */ static ULONG (*pDosSmSetTitle)(ULONG, PSZ); static void set_title(char *s) { SWCNTRL swcntrl; static HMODULE hdosc = 0; BYTE buf[20]; long rc; fill_swcntrl(&swcntrl); if (!pDosSmSetTitle || !hdosc) { if (CheckOSError(DosLoadModule(buf, sizeof buf, "sesmgr", &hdosc))) croak("Cannot load SESMGR: no `%s'", buf); if (CheckOSError(DosQueryProcAddr(hdosc, 0, "DOSSMSETTITLE", (PFN*)&pDosSmSetTitle))) croak("Cannot load SESMGR.DOSSMSETTITLE, err=%ld", rc); } /* (pDosSmSetTitle)(swcntrl.idSession,s); */ rc = ((USHORT) (_THUNK_PROLOG (2+4); _THUNK_SHORT (swcntrl.idSession); _THUNK_FLAT (s); _THUNK_CALLI (*pDosSmSetTitle))); if (CheckOSError(rc)) warn("*DOSSMSETTITLE: err=%ld, ses=%ld, addr=%x, *paddr=%x", rc, swcntrl.idSession, &_THUNK_FUNCTION(DosSmSetTitle), pDosSmSetTitle); } #else /* !0 */ static bool set_title(char *s) { SWCNTRL swcntrl; static HMODULE hdosc = 0; BYTE buf[20]; long rc; fill_swcntrl(&swcntrl); rc = ((USHORT) (_THUNK_PROLOG (2+4); _THUNK_SHORT (swcntrl.idSession); _THUNK_FLAT (s); _THUNK_CALL (DosSmSetTitle))); #if 0 if (CheckOSError(rc)) warn("DOSSMSETTITLE: err=%ld, ses=%ld, addr=%x", rc, swcntrl.idSession, _THUNK_FUNCTION(DosSmSetTitle)); #endif return !CheckOSError(rc); } #endif /* !0 */ #if 0 /* Does not work. */ USHORT _THUNK_FUNCTION(Win16SetTitle) (); static void set_title2(char *s) { long rc; rc = ((USHORT) (_THUNK_PROLOG (4); _THUNK_FLAT (s); _THUNK_CALL (Win16SetTitle))); if (CheckWinError(rc)) warn("Win16SetTitle: err=%ld", rc); } #endif MODULE = OS2::Process PACKAGE = OS2::Process unsigned long constant(name,arg) char * name int arg char * my_type() U32 file_type(path) char *path U32 process_entry() PPCODE: { SWCNTRL swcntrl; fill_swcntrl(&swcntrl); EXTEND(sp,9); PUSHs(sv_2mortal(newSVpv(swcntrl.szSwtitle, 0))); PUSHs(sv_2mortal(newSVnv(swcntrl.hwnd))); PUSHs(sv_2mortal(newSVnv(swcntrl.hwndIcon))); PUSHs(sv_2mortal(newSViv(swcntrl.hprog))); PUSHs(sv_2mortal(newSViv(swcntrl.idProcess))); PUSHs(sv_2mortal(newSViv(swcntrl.idSession))); PUSHs(sv_2mortal(newSViv(swcntrl.uchVisibility != SWL_INVISIBLE))); PUSHs(sv_2mortal(newSViv(swcntrl.uchVisibility == SWL_GRAYED))); PUSHs(sv_2mortal(newSViv(swcntrl.fbJump == SWL_JUMPABLE))); PUSHs(sv_2mortal(newSViv(swcntrl.bProgType))); } bool set_title(s) char *s
XS
3
tharindusathis/sourcecodes-of-CodeReadingTheOpenSourcePerspective
perl/os2/os2/Process/Process.xs
[ "Apache-1.1" ]
// Copyright 2014 the V8 project authors. All rights reserved. // Use of this source code is governed by a BSD-style license that can be // found in the LICENSE file. #include "src/heap/gc-idle-time-handler.h" #include "src/flags/flags.h" #include "src/heap/gc-tracer.h" #include "src/utils/utils.h" namespace v8 { namespace internal { const double GCIdleTimeHandler::kConservativeTimeRatio = 0.9; void GCIdleTimeHeapState::Print() { PrintF("size_of_objects=%zu ", size_of_objects); PrintF("incremental_marking_stopped=%d ", incremental_marking_stopped); } size_t GCIdleTimeHandler::EstimateMarkingStepSize( double idle_time_in_ms, double marking_speed_in_bytes_per_ms) { DCHECK_LT(0, idle_time_in_ms); if (marking_speed_in_bytes_per_ms == 0) { marking_speed_in_bytes_per_ms = kInitialConservativeMarkingSpeed; } double marking_step_size = marking_speed_in_bytes_per_ms * idle_time_in_ms; if (marking_step_size >= kMaximumMarkingStepSize) { return kMaximumMarkingStepSize; } return static_cast<size_t>(marking_step_size * kConservativeTimeRatio); } // The following logic is implemented by the controller: // (1) If we don't have any idle time, do nothing, unless a context was // disposed, incremental marking is stopped, and the heap is small. Then do // a full GC. // (2) If the context disposal rate is high and we cannot perform a full GC, // we do nothing until the context disposal rate becomes lower. // (3) If incremental marking is in progress, we perform a marking step. GCIdleTimeAction GCIdleTimeHandler::Compute(double idle_time_in_ms, GCIdleTimeHeapState heap_state) { if (static_cast<int>(idle_time_in_ms) <= 0) { return GCIdleTimeAction::kDone; } if (FLAG_incremental_marking && !heap_state.incremental_marking_stopped) { return GCIdleTimeAction::kIncrementalStep; } return GCIdleTimeAction::kDone; } bool GCIdleTimeHandler::Enabled() { return FLAG_incremental_marking; } } // namespace internal } // namespace v8
C++
4
LancerWang001/v8
src/heap/gc-idle-time-handler.cc
[ "BSD-3-Clause" ]
/obj/structure/tree name = "tree" icon = 'icons/objects/structures/tree.dmi' icon_state = "stump" density = FALSE opacity = TRUE flags = FLAG_SIMULATED | FLAG_ANCHORED layer = TURF_LAYER var/image/canopy_hider var/obj/structure/canopy/canopy /obj/structure/tree/New(var/newloc) . = ..(newloc) canopy = new(newloc, src) /obj/structure/tree/Destroy() QDel(canopy, "tree destroyed") . = ..() /obj/structure/tree/Move() . = ..() if(.) loc = canopy.loc /obj/structure/canopy density = TRUE opacity = FALSE name = "tree canopy" layer = EFFECTS_LAYER icon = 'icons/objects/structures/tree.dmi' icon_state = "canopy" pixel_x = -32 pixel_y = -32 flags = FLAG_SIMULATED | FLAG_ANCHORED var/obj/stump /obj/structure/canopy/Move() . = ..() if(.) loc = stump.loc /obj/structure/canopy/Destroy() QDel(stump, "tree destroyed") . = ..() /obj/structure/tree/Initialize() canopy = image(icon = icon, icon_state = "canopy") canopy.layer = EFFECTS_LAYER overlays += canopy canopy_hider = image(loc = src, icon = icon, icon_state = "stump") canopy_hider.override = TRUE canopy_hider.layer = layer icon_state = "stump" if(prob(75)) var/matrix/M = matrix() M.Turn(pick(90, 180, 270)) transform = M . = ..() /obj/structure/tree/ManipulatedBy(var/mob/user, var/obj/item/prop, var/slot) . = ..() if(!. && !user.OnActionCooldown()) overlays.Cut() /obj/structure/tree/Crossed(atom/movable/O) . = ..() var/mob/M = O if(istype(M) && M.client) M.client.images |= canopy_hider /obj/structure/tree/Uncrossed(atom/movable/O) . = ..() var/mob/M = O if(istype(M) && M.client) M.client.images -= canopy_hider
DM
4
AntimoniumGame/Antimonium
code/objects/structures/flora/tree.dm
[ "CC-BY-4.0" ]
_:b1 a _:b2 . _:b2 a _:B1 .
Turtle
0
joshrose/audacity
lib-src/lv2/serd/tests/bad/bad-id-clash.ttl
[ "CC-BY-3.0" ]
(*********************************************************** AMX VOLUME CONTROL LIBRARY v1.0.0 Website: https://github.com/amclain/amx-lib-volume This is a snake case wrapper for the volume control library functions. To use this file, make sure to include amx-lib-volume.axi in the workspace. For more information, see: amx-lib-volume.axi ************************************************************* Copyright 2011, 2012, 2014 Alex McLain Licensed under the Apache License, Version 2.0 (the "License"); you may not use this file except in compliance with the License. You may obtain a copy of the License at http://www.apache.org/licenses/LICENSE-2.0 Unless required by applicable law or agreed to in writing, software distributed under the License is distributed on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the License for the specific language governing permissions and limitations under the License. ************************************************************) #include 'amx-lib-volume' #if_not_defined AMX_LIB_VOLUME_SC #define AMX_LIB_VOLUME_SC 1 (***********************************************************) /* * Initialize volume control. * * Parameters min, max, and numSteps can be set to 0 if not needed. */ define_function vol_init(volume v, integer lvl, char muteState, integer min, integer max, integer numSteps) { volInit(v, lvl, muteState, min, max, numSteps); } /* * Get pre-mute volume level. * Returns current volume level. * * This function ignores mute status but respects min/max limits * and dim state. */ define_function integer vol_get_level(volume v) { return volGetLevel(v); } /* * Get post-mute volume level. * Returns current volume level. * * This function takes into account mute status, min/max limits, * and dim state. */ define_function integer vol_get_level_post_mute(volume v) { return volGetLevelPostMute(v); } /* * Get pre-mute volume level. * Returns current volume level. * * This function ignores mute status but respects min/max limits. * Return value is scaled from an integer to a byte. */ define_function char vol_get_level_as_byte(volume v) { return volGetLevelAsByte(v); } /* * Get post-mute volume level. * Returns current volume level. * * This function takes into account mute status and min/max limits. * Return value is scaled from an integer to a byte. */ define_function sinteger vol_get_level_post_mute_as_byte(volume v) { return volGetLevelPostMuteAsByte(v); } /* * Get a volume level that fits on a touch panel's bargraph. * Returns current volume level scaled to a range of 0-255 * taking into account min/max. */ define_function char vol_get_touch_panel_level(volume v) { return volGetTouchPanelLevel(v); } /* * Set volume level. * Returns status: * (VOL_SUCCESS | VOL_LIMITED) * * This function takes into account min/max limits. * This function does not affect mute status. */ define_function sinteger vol_set_level(volume v, integer value) { return volSetLevel(v, value); } /* * Set volume level. * Returns status: * (VOL_SUCCESS | VOL_LIMITED) * * This function takes into account min/max limits. * This function does not affect mute status. * Input value is scaled from a byte to an integer. */ define_function sinteger vol_set_level_as_byte(volume v, char value) { return volSetLevelAsByte(v, value); } /* * Set max limit. * Input: value > 0 to enable, value = 0 to disable. * Returns VOL_SUCCESS | VOL_LIMITED. */ define_function sinteger vol_set_max(volume v, integer value) { return volSetMax(v, value); } /* * Set max limit. * Input: value > 0 to enable, value = 0 to disable. * Returns VOL_SUCCESS | VOL_LIMITED. * * Input value is scaled from a byte to an integer. */ define_function sinteger vol_set_max_as_byte(volume v, char value) { return volSetMaxAsByte(v, value); } /* * Set minimum limit. * Input: value > 0 to enable, value = 0 to disable. * Returns VOL_SUCCESS | VOL_LIMITED. */ define_function sinteger vol_set_min(volume v, integer value) { return volSetMin(v, value); } /* * Set minimum limit. * Input: value > 0 to enable, value = 0 to disable. * Returns VOL_SUCCESS | VOL_LIMITED. * * Input value is scaled from a byte to an integer. */ define_function sinteger vol_set_min_as_byte(volume v, char value) { return volSetMinAsByte(v, value); } /* * Mute the channel. */ define_function vol_mute(volume v) { volMute(v); } /* * Unmute the channel. */ define_function vol_unmute(volume v) { volUnmute(v); } /* * Toggle the channel's mute state. * * Returns the resulting mute state after toggle: * (VOL_MUTED | VOL_UNMUTED) */ define_function integer vol_toggle_mute(volume v) { return volToggleMute(v); } /* * Get the control's mute state. * Returns sinteger: * (VOL_MUTED | VOL_UNMUTED) */ define_function integer vol_get_mute_state(volume v) { return volGetMuteState(v); } /* * Set the amount that the level increases/decreases when incremented. */ define_function vol_set_step(volume v, integer value) { volSetStep(v, value); } /* * Set the amount that the level increases/decreases when incremented. * * Input value is scaled from a byte to an integer. */ define_function vol_set_step_as_byte(volume v, char value) { volSetStepAsByte(v, value); } /* * Set the number of steps the control can be incremented/decremented. * * This is an alternative to defining the value of the step. */ define_function sinteger vol_set_number_of_steps(volume v, integer steps) { return volSetNumberOfSteps(v, steps); } /* * Increase the volume by incrementing the level by one step. * Is not affected by mute state. * Returns status: * (VOL_SUCCESS | VOL_LIMITED | VOL_PARAM_NOT_SET) */ define_function sinteger vol_increment(volume v) { return volIncrement(v); } /* * Decrease the volume by decrementing the level by one step. * Is not affected by mute state. * Returns status: * (VOL_SUCCESS | VOL_LIMITED | VOL_PARAM_NOT_SET) */ define_function sinteger vol_decrement(volume v) { return volDecrement(v); } /* * Dim the volume level. */ define_function vol_dim(volume v) { volDim(v); } /* * Undim the volume level, returning it to its "normal" level. */ define_function vol_undim(volume v) { volUndim(v); } /* * Get volume dim state. * Returns status: * (VOL_DIM_ON | VOL_DIM_OFF) */ define_function sinteger vol_get_dim_state(volume v) { return volGetDimState(v); } /* * Get the amount that the level is dimmed when dim is on. */ define_function integer vol_get_dim_amount(volume v) { return volGetDimAmount(v); } /* * Get the amount that the level is dimmed when dim is on. * * Returns a byte scaled from an integer. */ define_function char vol_get_dim_amount_as_byte(volume v) { return volGetDimAmountAsByte(v); } /* * Set the amount that the level dims. */ define_function sinteger vol_set_dim_amount(volume v, integer amount) { return volSetDimAmount(v, amount); } /* * Set the amount that the level dims. * * Input is scaled from a byte to an integer. */ define_function sinteger vol_set_dim_amount_as_byte(volume v, char amount) { return volSetDimAmountAsByte(v, amount); } /* * Initialize an array of volume controls. * * Parameters min, max, and numSteps can be set to 0 if not needed. */ define_function vol_array_init(volume v[], integer lvl, char muteState, integer min, integer max, integer numSteps) { volArrayInit(v, lvl, muteState, min, max, numSteps); } /* * Get the volume level for a control in an array at the given index. * Returns current volume level. * * This function takes into account mute status and min/max limits. */ define_function integer vol_array_get_level(volume v[], integer index) { return volArrayGetLevel(v, index); } /* * Get the volume level for a control in an array at the given index. * Returns current volume level. * * This function takes into account mute status and min/max limits. * Return value is scaled from an integer to a byte. */ define_function char vol_array_get_level_as_byte(volume v[], integer index) { return volArrayGetLevelAsByte(v, index); } /* * Set the volume level for all controls in an array. */ define_function sinteger vol_array_set_level(volume v[], integer value) { return volArraySetLevel(v, value); } /* * Set the volume level for all controls in an array. */ define_function sinteger vol_array_set_level_as_byte(volume v[], char value) { return volArraySetLevelAsByte(v, value); } /* * Set the max volume limit for all controls in an array. * * Returns VOL_LIMITED if any instance in the array is limited. * Otherwise returns VOL_SUCCESS. */ define_function sinteger vol_array_set_max(volume v[], integer value) { return volArraySetMax(v, value); } /* * Set the max volume limit for all controls in an array. * * Returns VOL_LIMITED if any instance in the array is limited. * Otherwise returns VOL_SUCCESS. */ define_function sinteger vol_array_set_max_as_byte(volume v[], char value) { return volArraySetMaxAsByte(v, value); } /* * Set the min volume limit for all controls in an array. * * Returns VOL_LIMITED if any instance in the array is limited. * Otherwise returns VOL_SUCCESS. */ define_function sinteger vol_array_set_min(volume v[], integer value) { return volArraySetMin(v, value); } /* * Set the min volume limit for all controls in an array. * * Returns VOL_LIMITED if any instance in the array is limited. * Otherwise returns VOL_SUCCESS. */ define_function sinteger vol_array_set_min_as_byte(volume v[], char value) { return volArraySetMinAsByte(v, value); } /* * Set the volume step amount for all controls in an array. */ define_function vol_array_set_step(volume v[], integer value) { volArraySetStep(v, value); } /* * Set the volume step amount for all controls in an array. */ define_function vol_array_set_step_as_byte(volume v[], char value) { volArraySetStepAsByte(v, value); } /* * Set the number of steps all controls in the array can be * incremented or decremented. */ define_function sinteger vol_array_set_number_of_steps(volume v[], integer steps) { return volArraySetNumberOfSteps(v, steps); } /* * Mute all of the controls in the array. */ define_function vol_array_mute(volume v[]) { volArrayMute(v); } /* * Unmute all of the controls in the array. */ define_function vol_array_unmute(volume v[]) { volArrayUnmute(v); } /* * Increase the volume of all controls in the array * by one step. */ define_function sinteger vol_array_increment(volume v[]) { return volArrayIncrement(v); } /* * Decrease the volume of all controls in the array * by one step. */ define_function sinteger vol_array_decrement(volume v[]) { return volArrayDecrement(v); } /* * Dim the volume level of all controls in the array. */ define_function vol_array_dim(volume v[]) { volArrayDim(v); } /* * Undim the volume level of all controls in the array, * returning them to their "normal" level. */ define_function vol_array_undim(volume v[]) { volArrayUndim(v); } /* * Set the amount that the level dims for an array. */ define_function vol_array_set_dim_amount(volume v[], integer amount) { volArraySetDimAmount(v, amount); } /* * Set the amount that the level dims for an array. * * Input is scaled from a byte to an integer. */ define_function vol_array_set_dim_amount_as_byte(volume v[], char amount) { volArraySetDimAmountAsByte(v, amount); } (***********************************************************) #end_if
NetLinx
5
ajnavarro/language-dataset
data/github.com/amclain/amx-lib-redis/ad2dd82b8e9f42b02faa62b3a69df633e915f4d8/integration/include/amx-lib-volume/amx-lib-volume-sc.axi
[ "MIT" ]
Note 0 Copyright (C) 2017 Jonathan Hough. All rights reserved. ) NB. Kernel PCA algorithm NB. Applies some kernel to datapoint pairs. Note 'References' [1] Pattern Recognition and Machine Learning, Cristopher M. Bishop page 586-590 ) load 'math/lapack' load 'math/lapack/geev' load 'math/lapack/gesvd' coclass 'KPCASolver' kernelExpSquared=: 3 : 0 'd1 d2 c1 c2'=. y s=. -:- c1 * (+/"1) (*: d1 -"1 1"1 _ d2) c2 * ^ s ) NB. Creates a KPCASolver instance. NB. Arguments: NB. 0: data points NB. 1: kernel type. Can be: NB. 'gaussian' NB. '' NB. 2: restriction, either 0 or 1. 0 implies NB. restricting to eigenvectors whose corresponding NB. eigenvalues are greater than the given limit. NB. 1 implies rectricting to a given number of NB. eigenvectors. NB. 3: limit value. Depends on argument 1. If restriction NB. value is 0, then limit should be a numeric value NB. representing the minimum eigenvalue. NB. If restriction value is 1, then limit should be an NB. integer in the range (1,N), where N is the NB. total number of dimensions (features) of the dataset. NB. 4: kernel parameter 1. NB. 5: kernel parameter 2. create=: 3 : 0 'X kernel restriction limit c1 c2'=. y assert. 2=#$X assert. restriction e. 0 1 assert. (limit < >:1{$X) *. limit>0 K=: kernelExpSquared X;X;c1;c2 N=. #X NB. TODO don't use huge square matrix, inefficient. I=. 1 $~ ,/~ N K3=: (*:N)%~ I (+/ .*) K (+/ .*) I Kr=: (K+K3) Kn=: Kr - N%~ I (+/ .*) K Kd=: Kn - N%~ K (+/ .*) I K=: Kd e=. gesvd_jlapack_ K evals=. >1{e evecs=. >0{e if. restriction = 0 do. reduced=: evecs {"_ 1~ I. evals > limit else. reduced=: limit{."1 evecs end. smoutput limit eigenVecs=: evecs eigenVals=: evals ) destroy=:codestroy
J
5
jonghough/jlearn
dr/kpca.ijs
[ "MIT" ]
; This file is generated from a similarly-named Perl script in the BoringSSL ; source tree. Do not edit by hand. default rel %define XMMWORD %define YMMWORD %define ZMMWORD %ifdef BORINGSSL_PREFIX %include "boringssl_prefix_symbols_nasm.inc" %endif section .text code align=64 global rsaz_1024_sqr_avx2 ALIGN 64 rsaz_1024_sqr_avx2: mov QWORD[8+rsp],rdi ;WIN64 prologue mov QWORD[16+rsp],rsi mov rax,rsp $L$SEH_begin_rsaz_1024_sqr_avx2: mov rdi,rcx mov rsi,rdx mov rdx,r8 mov rcx,r9 mov r8,QWORD[40+rsp] lea rax,[rsp] push rbx push rbp push r12 push r13 push r14 push r15 vzeroupper lea rsp,[((-168))+rsp] vmovaps XMMWORD[(-216)+rax],xmm6 vmovaps XMMWORD[(-200)+rax],xmm7 vmovaps XMMWORD[(-184)+rax],xmm8 vmovaps XMMWORD[(-168)+rax],xmm9 vmovaps XMMWORD[(-152)+rax],xmm10 vmovaps XMMWORD[(-136)+rax],xmm11 vmovaps XMMWORD[(-120)+rax],xmm12 vmovaps XMMWORD[(-104)+rax],xmm13 vmovaps XMMWORD[(-88)+rax],xmm14 vmovaps XMMWORD[(-72)+rax],xmm15 $L$sqr_1024_body: mov rbp,rax mov r13,rdx sub rsp,832 mov r15,r13 sub rdi,-128 sub rsi,-128 sub r13,-128 and r15,4095 add r15,32*10 shr r15,12 vpxor ymm9,ymm9,ymm9 jz NEAR $L$sqr_1024_no_n_copy sub rsp,32*10 vmovdqu ymm0,YMMWORD[((0-128))+r13] and rsp,-2048 vmovdqu ymm1,YMMWORD[((32-128))+r13] vmovdqu ymm2,YMMWORD[((64-128))+r13] vmovdqu ymm3,YMMWORD[((96-128))+r13] vmovdqu ymm4,YMMWORD[((128-128))+r13] vmovdqu ymm5,YMMWORD[((160-128))+r13] vmovdqu ymm6,YMMWORD[((192-128))+r13] vmovdqu ymm7,YMMWORD[((224-128))+r13] vmovdqu ymm8,YMMWORD[((256-128))+r13] lea r13,[((832+128))+rsp] vmovdqu YMMWORD[(0-128)+r13],ymm0 vmovdqu YMMWORD[(32-128)+r13],ymm1 vmovdqu YMMWORD[(64-128)+r13],ymm2 vmovdqu YMMWORD[(96-128)+r13],ymm3 vmovdqu YMMWORD[(128-128)+r13],ymm4 vmovdqu YMMWORD[(160-128)+r13],ymm5 vmovdqu YMMWORD[(192-128)+r13],ymm6 vmovdqu YMMWORD[(224-128)+r13],ymm7 vmovdqu YMMWORD[(256-128)+r13],ymm8 vmovdqu YMMWORD[(288-128)+r13],ymm9 $L$sqr_1024_no_n_copy: and rsp,-1024 vmovdqu ymm1,YMMWORD[((32-128))+rsi] vmovdqu ymm2,YMMWORD[((64-128))+rsi] vmovdqu ymm3,YMMWORD[((96-128))+rsi] vmovdqu ymm4,YMMWORD[((128-128))+rsi] vmovdqu ymm5,YMMWORD[((160-128))+rsi] vmovdqu ymm6,YMMWORD[((192-128))+rsi] vmovdqu ymm7,YMMWORD[((224-128))+rsi] vmovdqu ymm8,YMMWORD[((256-128))+rsi] lea rbx,[192+rsp] vmovdqu ymm15,YMMWORD[$L$and_mask] jmp NEAR $L$OOP_GRANDE_SQR_1024 ALIGN 32 $L$OOP_GRANDE_SQR_1024: lea r9,[((576+128))+rsp] lea r12,[448+rsp] vpaddq ymm1,ymm1,ymm1 vpbroadcastq ymm10,QWORD[((0-128))+rsi] vpaddq ymm2,ymm2,ymm2 vmovdqa YMMWORD[(0-128)+r9],ymm1 vpaddq ymm3,ymm3,ymm3 vmovdqa YMMWORD[(32-128)+r9],ymm2 vpaddq ymm4,ymm4,ymm4 vmovdqa YMMWORD[(64-128)+r9],ymm3 vpaddq ymm5,ymm5,ymm5 vmovdqa YMMWORD[(96-128)+r9],ymm4 vpaddq ymm6,ymm6,ymm6 vmovdqa YMMWORD[(128-128)+r9],ymm5 vpaddq ymm7,ymm7,ymm7 vmovdqa YMMWORD[(160-128)+r9],ymm6 vpaddq ymm8,ymm8,ymm8 vmovdqa YMMWORD[(192-128)+r9],ymm7 vpxor ymm9,ymm9,ymm9 vmovdqa YMMWORD[(224-128)+r9],ymm8 vpmuludq ymm0,ymm10,YMMWORD[((0-128))+rsi] vpbroadcastq ymm11,QWORD[((32-128))+rsi] vmovdqu YMMWORD[(288-192)+rbx],ymm9 vpmuludq ymm1,ymm1,ymm10 vmovdqu YMMWORD[(320-448)+r12],ymm9 vpmuludq ymm2,ymm2,ymm10 vmovdqu YMMWORD[(352-448)+r12],ymm9 vpmuludq ymm3,ymm3,ymm10 vmovdqu YMMWORD[(384-448)+r12],ymm9 vpmuludq ymm4,ymm4,ymm10 vmovdqu YMMWORD[(416-448)+r12],ymm9 vpmuludq ymm5,ymm5,ymm10 vmovdqu YMMWORD[(448-448)+r12],ymm9 vpmuludq ymm6,ymm6,ymm10 vmovdqu YMMWORD[(480-448)+r12],ymm9 vpmuludq ymm7,ymm7,ymm10 vmovdqu YMMWORD[(512-448)+r12],ymm9 vpmuludq ymm8,ymm8,ymm10 vpbroadcastq ymm10,QWORD[((64-128))+rsi] vmovdqu YMMWORD[(544-448)+r12],ymm9 mov r15,rsi mov r14d,4 jmp NEAR $L$sqr_entry_1024 ALIGN 32 $L$OOP_SQR_1024: vpbroadcastq ymm11,QWORD[((32-128))+r15] vpmuludq ymm0,ymm10,YMMWORD[((0-128))+rsi] vpaddq ymm0,ymm0,YMMWORD[((0-192))+rbx] vpmuludq ymm1,ymm10,YMMWORD[((0-128))+r9] vpaddq ymm1,ymm1,YMMWORD[((32-192))+rbx] vpmuludq ymm2,ymm10,YMMWORD[((32-128))+r9] vpaddq ymm2,ymm2,YMMWORD[((64-192))+rbx] vpmuludq ymm3,ymm10,YMMWORD[((64-128))+r9] vpaddq ymm3,ymm3,YMMWORD[((96-192))+rbx] vpmuludq ymm4,ymm10,YMMWORD[((96-128))+r9] vpaddq ymm4,ymm4,YMMWORD[((128-192))+rbx] vpmuludq ymm5,ymm10,YMMWORD[((128-128))+r9] vpaddq ymm5,ymm5,YMMWORD[((160-192))+rbx] vpmuludq ymm6,ymm10,YMMWORD[((160-128))+r9] vpaddq ymm6,ymm6,YMMWORD[((192-192))+rbx] vpmuludq ymm7,ymm10,YMMWORD[((192-128))+r9] vpaddq ymm7,ymm7,YMMWORD[((224-192))+rbx] vpmuludq ymm8,ymm10,YMMWORD[((224-128))+r9] vpbroadcastq ymm10,QWORD[((64-128))+r15] vpaddq ymm8,ymm8,YMMWORD[((256-192))+rbx] $L$sqr_entry_1024: vmovdqu YMMWORD[(0-192)+rbx],ymm0 vmovdqu YMMWORD[(32-192)+rbx],ymm1 vpmuludq ymm12,ymm11,YMMWORD[((32-128))+rsi] vpaddq ymm2,ymm2,ymm12 vpmuludq ymm14,ymm11,YMMWORD[((32-128))+r9] vpaddq ymm3,ymm3,ymm14 vpmuludq ymm13,ymm11,YMMWORD[((64-128))+r9] vpaddq ymm4,ymm4,ymm13 vpmuludq ymm12,ymm11,YMMWORD[((96-128))+r9] vpaddq ymm5,ymm5,ymm12 vpmuludq ymm14,ymm11,YMMWORD[((128-128))+r9] vpaddq ymm6,ymm6,ymm14 vpmuludq ymm13,ymm11,YMMWORD[((160-128))+r9] vpaddq ymm7,ymm7,ymm13 vpmuludq ymm12,ymm11,YMMWORD[((192-128))+r9] vpaddq ymm8,ymm8,ymm12 vpmuludq ymm0,ymm11,YMMWORD[((224-128))+r9] vpbroadcastq ymm11,QWORD[((96-128))+r15] vpaddq ymm0,ymm0,YMMWORD[((288-192))+rbx] vmovdqu YMMWORD[(64-192)+rbx],ymm2 vmovdqu YMMWORD[(96-192)+rbx],ymm3 vpmuludq ymm13,ymm10,YMMWORD[((64-128))+rsi] vpaddq ymm4,ymm4,ymm13 vpmuludq ymm12,ymm10,YMMWORD[((64-128))+r9] vpaddq ymm5,ymm5,ymm12 vpmuludq ymm14,ymm10,YMMWORD[((96-128))+r9] vpaddq ymm6,ymm6,ymm14 vpmuludq ymm13,ymm10,YMMWORD[((128-128))+r9] vpaddq ymm7,ymm7,ymm13 vpmuludq ymm12,ymm10,YMMWORD[((160-128))+r9] vpaddq ymm8,ymm8,ymm12 vpmuludq ymm14,ymm10,YMMWORD[((192-128))+r9] vpaddq ymm0,ymm0,ymm14 vpmuludq ymm1,ymm10,YMMWORD[((224-128))+r9] vpbroadcastq ymm10,QWORD[((128-128))+r15] vpaddq ymm1,ymm1,YMMWORD[((320-448))+r12] vmovdqu YMMWORD[(128-192)+rbx],ymm4 vmovdqu YMMWORD[(160-192)+rbx],ymm5 vpmuludq ymm12,ymm11,YMMWORD[((96-128))+rsi] vpaddq ymm6,ymm6,ymm12 vpmuludq ymm14,ymm11,YMMWORD[((96-128))+r9] vpaddq ymm7,ymm7,ymm14 vpmuludq ymm13,ymm11,YMMWORD[((128-128))+r9] vpaddq ymm8,ymm8,ymm13 vpmuludq ymm12,ymm11,YMMWORD[((160-128))+r9] vpaddq ymm0,ymm0,ymm12 vpmuludq ymm14,ymm11,YMMWORD[((192-128))+r9] vpaddq ymm1,ymm1,ymm14 vpmuludq ymm2,ymm11,YMMWORD[((224-128))+r9] vpbroadcastq ymm11,QWORD[((160-128))+r15] vpaddq ymm2,ymm2,YMMWORD[((352-448))+r12] vmovdqu YMMWORD[(192-192)+rbx],ymm6 vmovdqu YMMWORD[(224-192)+rbx],ymm7 vpmuludq ymm12,ymm10,YMMWORD[((128-128))+rsi] vpaddq ymm8,ymm8,ymm12 vpmuludq ymm14,ymm10,YMMWORD[((128-128))+r9] vpaddq ymm0,ymm0,ymm14 vpmuludq ymm13,ymm10,YMMWORD[((160-128))+r9] vpaddq ymm1,ymm1,ymm13 vpmuludq ymm12,ymm10,YMMWORD[((192-128))+r9] vpaddq ymm2,ymm2,ymm12 vpmuludq ymm3,ymm10,YMMWORD[((224-128))+r9] vpbroadcastq ymm10,QWORD[((192-128))+r15] vpaddq ymm3,ymm3,YMMWORD[((384-448))+r12] vmovdqu YMMWORD[(256-192)+rbx],ymm8 vmovdqu YMMWORD[(288-192)+rbx],ymm0 lea rbx,[8+rbx] vpmuludq ymm13,ymm11,YMMWORD[((160-128))+rsi] vpaddq ymm1,ymm1,ymm13 vpmuludq ymm12,ymm11,YMMWORD[((160-128))+r9] vpaddq ymm2,ymm2,ymm12 vpmuludq ymm14,ymm11,YMMWORD[((192-128))+r9] vpaddq ymm3,ymm3,ymm14 vpmuludq ymm4,ymm11,YMMWORD[((224-128))+r9] vpbroadcastq ymm11,QWORD[((224-128))+r15] vpaddq ymm4,ymm4,YMMWORD[((416-448))+r12] vmovdqu YMMWORD[(320-448)+r12],ymm1 vmovdqu YMMWORD[(352-448)+r12],ymm2 vpmuludq ymm12,ymm10,YMMWORD[((192-128))+rsi] vpaddq ymm3,ymm3,ymm12 vpmuludq ymm14,ymm10,YMMWORD[((192-128))+r9] vpbroadcastq ymm0,QWORD[((256-128))+r15] vpaddq ymm4,ymm4,ymm14 vpmuludq ymm5,ymm10,YMMWORD[((224-128))+r9] vpbroadcastq ymm10,QWORD[((0+8-128))+r15] vpaddq ymm5,ymm5,YMMWORD[((448-448))+r12] vmovdqu YMMWORD[(384-448)+r12],ymm3 vmovdqu YMMWORD[(416-448)+r12],ymm4 lea r15,[8+r15] vpmuludq ymm12,ymm11,YMMWORD[((224-128))+rsi] vpaddq ymm5,ymm5,ymm12 vpmuludq ymm6,ymm11,YMMWORD[((224-128))+r9] vpaddq ymm6,ymm6,YMMWORD[((480-448))+r12] vpmuludq ymm7,ymm0,YMMWORD[((256-128))+rsi] vmovdqu YMMWORD[(448-448)+r12],ymm5 vpaddq ymm7,ymm7,YMMWORD[((512-448))+r12] vmovdqu YMMWORD[(480-448)+r12],ymm6 vmovdqu YMMWORD[(512-448)+r12],ymm7 lea r12,[8+r12] dec r14d jnz NEAR $L$OOP_SQR_1024 vmovdqu ymm8,YMMWORD[256+rsp] vmovdqu ymm1,YMMWORD[288+rsp] vmovdqu ymm2,YMMWORD[320+rsp] lea rbx,[192+rsp] vpsrlq ymm14,ymm8,29 vpand ymm8,ymm8,ymm15 vpsrlq ymm11,ymm1,29 vpand ymm1,ymm1,ymm15 vpermq ymm14,ymm14,0x93 vpxor ymm9,ymm9,ymm9 vpermq ymm11,ymm11,0x93 vpblendd ymm10,ymm14,ymm9,3 vpblendd ymm14,ymm11,ymm14,3 vpaddq ymm8,ymm8,ymm10 vpblendd ymm11,ymm9,ymm11,3 vpaddq ymm1,ymm1,ymm14 vpaddq ymm2,ymm2,ymm11 vmovdqu YMMWORD[(288-192)+rbx],ymm1 vmovdqu YMMWORD[(320-192)+rbx],ymm2 mov rax,QWORD[rsp] mov r10,QWORD[8+rsp] mov r11,QWORD[16+rsp] mov r12,QWORD[24+rsp] vmovdqu ymm1,YMMWORD[32+rsp] vmovdqu ymm2,YMMWORD[((64-192))+rbx] vmovdqu ymm3,YMMWORD[((96-192))+rbx] vmovdqu ymm4,YMMWORD[((128-192))+rbx] vmovdqu ymm5,YMMWORD[((160-192))+rbx] vmovdqu ymm6,YMMWORD[((192-192))+rbx] vmovdqu ymm7,YMMWORD[((224-192))+rbx] mov r9,rax imul eax,ecx and eax,0x1fffffff vmovd xmm12,eax mov rdx,rax imul rax,QWORD[((-128))+r13] vpbroadcastq ymm12,xmm12 add r9,rax mov rax,rdx imul rax,QWORD[((8-128))+r13] shr r9,29 add r10,rax mov rax,rdx imul rax,QWORD[((16-128))+r13] add r10,r9 add r11,rax imul rdx,QWORD[((24-128))+r13] add r12,rdx mov rax,r10 imul eax,ecx and eax,0x1fffffff mov r14d,9 jmp NEAR $L$OOP_REDUCE_1024 ALIGN 32 $L$OOP_REDUCE_1024: vmovd xmm13,eax vpbroadcastq ymm13,xmm13 vpmuludq ymm10,ymm12,YMMWORD[((32-128))+r13] mov rdx,rax imul rax,QWORD[((-128))+r13] vpaddq ymm1,ymm1,ymm10 add r10,rax vpmuludq ymm14,ymm12,YMMWORD[((64-128))+r13] mov rax,rdx imul rax,QWORD[((8-128))+r13] vpaddq ymm2,ymm2,ymm14 vpmuludq ymm11,ymm12,YMMWORD[((96-128))+r13] DB 0x67 add r11,rax DB 0x67 mov rax,rdx imul rax,QWORD[((16-128))+r13] shr r10,29 vpaddq ymm3,ymm3,ymm11 vpmuludq ymm10,ymm12,YMMWORD[((128-128))+r13] add r12,rax add r11,r10 vpaddq ymm4,ymm4,ymm10 vpmuludq ymm14,ymm12,YMMWORD[((160-128))+r13] mov rax,r11 imul eax,ecx vpaddq ymm5,ymm5,ymm14 vpmuludq ymm11,ymm12,YMMWORD[((192-128))+r13] and eax,0x1fffffff vpaddq ymm6,ymm6,ymm11 vpmuludq ymm10,ymm12,YMMWORD[((224-128))+r13] vpaddq ymm7,ymm7,ymm10 vpmuludq ymm14,ymm12,YMMWORD[((256-128))+r13] vmovd xmm12,eax vpaddq ymm8,ymm8,ymm14 vpbroadcastq ymm12,xmm12 vpmuludq ymm11,ymm13,YMMWORD[((32-8-128))+r13] vmovdqu ymm14,YMMWORD[((96-8-128))+r13] mov rdx,rax imul rax,QWORD[((-128))+r13] vpaddq ymm1,ymm1,ymm11 vpmuludq ymm10,ymm13,YMMWORD[((64-8-128))+r13] vmovdqu ymm11,YMMWORD[((128-8-128))+r13] add r11,rax mov rax,rdx imul rax,QWORD[((8-128))+r13] vpaddq ymm2,ymm2,ymm10 add rax,r12 shr r11,29 vpmuludq ymm14,ymm14,ymm13 vmovdqu ymm10,YMMWORD[((160-8-128))+r13] add rax,r11 vpaddq ymm3,ymm3,ymm14 vpmuludq ymm11,ymm11,ymm13 vmovdqu ymm14,YMMWORD[((192-8-128))+r13] DB 0x67 mov r12,rax imul eax,ecx vpaddq ymm4,ymm4,ymm11 vpmuludq ymm10,ymm10,ymm13 DB 0xc4,0x41,0x7e,0x6f,0x9d,0x58,0x00,0x00,0x00 and eax,0x1fffffff vpaddq ymm5,ymm5,ymm10 vpmuludq ymm14,ymm14,ymm13 vmovdqu ymm10,YMMWORD[((256-8-128))+r13] vpaddq ymm6,ymm6,ymm14 vpmuludq ymm11,ymm11,ymm13 vmovdqu ymm9,YMMWORD[((288-8-128))+r13] vmovd xmm0,eax imul rax,QWORD[((-128))+r13] vpaddq ymm7,ymm7,ymm11 vpmuludq ymm10,ymm10,ymm13 vmovdqu ymm14,YMMWORD[((32-16-128))+r13] vpbroadcastq ymm0,xmm0 vpaddq ymm8,ymm8,ymm10 vpmuludq ymm9,ymm9,ymm13 vmovdqu ymm11,YMMWORD[((64-16-128))+r13] add r12,rax vmovdqu ymm13,YMMWORD[((32-24-128))+r13] vpmuludq ymm14,ymm14,ymm12 vmovdqu ymm10,YMMWORD[((96-16-128))+r13] vpaddq ymm1,ymm1,ymm14 vpmuludq ymm13,ymm13,ymm0 vpmuludq ymm11,ymm11,ymm12 DB 0xc4,0x41,0x7e,0x6f,0xb5,0xf0,0xff,0xff,0xff vpaddq ymm13,ymm13,ymm1 vpaddq ymm2,ymm2,ymm11 vpmuludq ymm10,ymm10,ymm12 vmovdqu ymm11,YMMWORD[((160-16-128))+r13] DB 0x67 vmovq rax,xmm13 vmovdqu YMMWORD[rsp],ymm13 vpaddq ymm3,ymm3,ymm10 vpmuludq ymm14,ymm14,ymm12 vmovdqu ymm10,YMMWORD[((192-16-128))+r13] vpaddq ymm4,ymm4,ymm14 vpmuludq ymm11,ymm11,ymm12 vmovdqu ymm14,YMMWORD[((224-16-128))+r13] vpaddq ymm5,ymm5,ymm11 vpmuludq ymm10,ymm10,ymm12 vmovdqu ymm11,YMMWORD[((256-16-128))+r13] vpaddq ymm6,ymm6,ymm10 vpmuludq ymm14,ymm14,ymm12 shr r12,29 vmovdqu ymm10,YMMWORD[((288-16-128))+r13] add rax,r12 vpaddq ymm7,ymm7,ymm14 vpmuludq ymm11,ymm11,ymm12 mov r9,rax imul eax,ecx vpaddq ymm8,ymm8,ymm11 vpmuludq ymm10,ymm10,ymm12 and eax,0x1fffffff vmovd xmm12,eax vmovdqu ymm11,YMMWORD[((96-24-128))+r13] DB 0x67 vpaddq ymm9,ymm9,ymm10 vpbroadcastq ymm12,xmm12 vpmuludq ymm14,ymm0,YMMWORD[((64-24-128))+r13] vmovdqu ymm10,YMMWORD[((128-24-128))+r13] mov rdx,rax imul rax,QWORD[((-128))+r13] mov r10,QWORD[8+rsp] vpaddq ymm1,ymm2,ymm14 vpmuludq ymm11,ymm11,ymm0 vmovdqu ymm14,YMMWORD[((160-24-128))+r13] add r9,rax mov rax,rdx imul rax,QWORD[((8-128))+r13] DB 0x67 shr r9,29 mov r11,QWORD[16+rsp] vpaddq ymm2,ymm3,ymm11 vpmuludq ymm10,ymm10,ymm0 vmovdqu ymm11,YMMWORD[((192-24-128))+r13] add r10,rax mov rax,rdx imul rax,QWORD[((16-128))+r13] vpaddq ymm3,ymm4,ymm10 vpmuludq ymm14,ymm14,ymm0 vmovdqu ymm10,YMMWORD[((224-24-128))+r13] imul rdx,QWORD[((24-128))+r13] add r11,rax lea rax,[r10*1+r9] vpaddq ymm4,ymm5,ymm14 vpmuludq ymm11,ymm11,ymm0 vmovdqu ymm14,YMMWORD[((256-24-128))+r13] mov r10,rax imul eax,ecx vpmuludq ymm10,ymm10,ymm0 vpaddq ymm5,ymm6,ymm11 vmovdqu ymm11,YMMWORD[((288-24-128))+r13] and eax,0x1fffffff vpaddq ymm6,ymm7,ymm10 vpmuludq ymm14,ymm14,ymm0 add rdx,QWORD[24+rsp] vpaddq ymm7,ymm8,ymm14 vpmuludq ymm11,ymm11,ymm0 vpaddq ymm8,ymm9,ymm11 vmovq xmm9,r12 mov r12,rdx dec r14d jnz NEAR $L$OOP_REDUCE_1024 lea r12,[448+rsp] vpaddq ymm0,ymm13,ymm9 vpxor ymm9,ymm9,ymm9 vpaddq ymm0,ymm0,YMMWORD[((288-192))+rbx] vpaddq ymm1,ymm1,YMMWORD[((320-448))+r12] vpaddq ymm2,ymm2,YMMWORD[((352-448))+r12] vpaddq ymm3,ymm3,YMMWORD[((384-448))+r12] vpaddq ymm4,ymm4,YMMWORD[((416-448))+r12] vpaddq ymm5,ymm5,YMMWORD[((448-448))+r12] vpaddq ymm6,ymm6,YMMWORD[((480-448))+r12] vpaddq ymm7,ymm7,YMMWORD[((512-448))+r12] vpaddq ymm8,ymm8,YMMWORD[((544-448))+r12] vpsrlq ymm14,ymm0,29 vpand ymm0,ymm0,ymm15 vpsrlq ymm11,ymm1,29 vpand ymm1,ymm1,ymm15 vpsrlq ymm12,ymm2,29 vpermq ymm14,ymm14,0x93 vpand ymm2,ymm2,ymm15 vpsrlq ymm13,ymm3,29 vpermq ymm11,ymm11,0x93 vpand ymm3,ymm3,ymm15 vpermq ymm12,ymm12,0x93 vpblendd ymm10,ymm14,ymm9,3 vpermq ymm13,ymm13,0x93 vpblendd ymm14,ymm11,ymm14,3 vpaddq ymm0,ymm0,ymm10 vpblendd ymm11,ymm12,ymm11,3 vpaddq ymm1,ymm1,ymm14 vpblendd ymm12,ymm13,ymm12,3 vpaddq ymm2,ymm2,ymm11 vpblendd ymm13,ymm9,ymm13,3 vpaddq ymm3,ymm3,ymm12 vpaddq ymm4,ymm4,ymm13 vpsrlq ymm14,ymm0,29 vpand ymm0,ymm0,ymm15 vpsrlq ymm11,ymm1,29 vpand ymm1,ymm1,ymm15 vpsrlq ymm12,ymm2,29 vpermq ymm14,ymm14,0x93 vpand ymm2,ymm2,ymm15 vpsrlq ymm13,ymm3,29 vpermq ymm11,ymm11,0x93 vpand ymm3,ymm3,ymm15 vpermq ymm12,ymm12,0x93 vpblendd ymm10,ymm14,ymm9,3 vpermq ymm13,ymm13,0x93 vpblendd ymm14,ymm11,ymm14,3 vpaddq ymm0,ymm0,ymm10 vpblendd ymm11,ymm12,ymm11,3 vpaddq ymm1,ymm1,ymm14 vmovdqu YMMWORD[(0-128)+rdi],ymm0 vpblendd ymm12,ymm13,ymm12,3 vpaddq ymm2,ymm2,ymm11 vmovdqu YMMWORD[(32-128)+rdi],ymm1 vpblendd ymm13,ymm9,ymm13,3 vpaddq ymm3,ymm3,ymm12 vmovdqu YMMWORD[(64-128)+rdi],ymm2 vpaddq ymm4,ymm4,ymm13 vmovdqu YMMWORD[(96-128)+rdi],ymm3 vpsrlq ymm14,ymm4,29 vpand ymm4,ymm4,ymm15 vpsrlq ymm11,ymm5,29 vpand ymm5,ymm5,ymm15 vpsrlq ymm12,ymm6,29 vpermq ymm14,ymm14,0x93 vpand ymm6,ymm6,ymm15 vpsrlq ymm13,ymm7,29 vpermq ymm11,ymm11,0x93 vpand ymm7,ymm7,ymm15 vpsrlq ymm0,ymm8,29 vpermq ymm12,ymm12,0x93 vpand ymm8,ymm8,ymm15 vpermq ymm13,ymm13,0x93 vpblendd ymm10,ymm14,ymm9,3 vpermq ymm0,ymm0,0x93 vpblendd ymm14,ymm11,ymm14,3 vpaddq ymm4,ymm4,ymm10 vpblendd ymm11,ymm12,ymm11,3 vpaddq ymm5,ymm5,ymm14 vpblendd ymm12,ymm13,ymm12,3 vpaddq ymm6,ymm6,ymm11 vpblendd ymm13,ymm0,ymm13,3 vpaddq ymm7,ymm7,ymm12 vpaddq ymm8,ymm8,ymm13 vpsrlq ymm14,ymm4,29 vpand ymm4,ymm4,ymm15 vpsrlq ymm11,ymm5,29 vpand ymm5,ymm5,ymm15 vpsrlq ymm12,ymm6,29 vpermq ymm14,ymm14,0x93 vpand ymm6,ymm6,ymm15 vpsrlq ymm13,ymm7,29 vpermq ymm11,ymm11,0x93 vpand ymm7,ymm7,ymm15 vpsrlq ymm0,ymm8,29 vpermq ymm12,ymm12,0x93 vpand ymm8,ymm8,ymm15 vpermq ymm13,ymm13,0x93 vpblendd ymm10,ymm14,ymm9,3 vpermq ymm0,ymm0,0x93 vpblendd ymm14,ymm11,ymm14,3 vpaddq ymm4,ymm4,ymm10 vpblendd ymm11,ymm12,ymm11,3 vpaddq ymm5,ymm5,ymm14 vmovdqu YMMWORD[(128-128)+rdi],ymm4 vpblendd ymm12,ymm13,ymm12,3 vpaddq ymm6,ymm6,ymm11 vmovdqu YMMWORD[(160-128)+rdi],ymm5 vpblendd ymm13,ymm0,ymm13,3 vpaddq ymm7,ymm7,ymm12 vmovdqu YMMWORD[(192-128)+rdi],ymm6 vpaddq ymm8,ymm8,ymm13 vmovdqu YMMWORD[(224-128)+rdi],ymm7 vmovdqu YMMWORD[(256-128)+rdi],ymm8 mov rsi,rdi dec r8d jne NEAR $L$OOP_GRANDE_SQR_1024 vzeroall mov rax,rbp $L$sqr_1024_in_tail: movaps xmm6,XMMWORD[((-216))+rax] movaps xmm7,XMMWORD[((-200))+rax] movaps xmm8,XMMWORD[((-184))+rax] movaps xmm9,XMMWORD[((-168))+rax] movaps xmm10,XMMWORD[((-152))+rax] movaps xmm11,XMMWORD[((-136))+rax] movaps xmm12,XMMWORD[((-120))+rax] movaps xmm13,XMMWORD[((-104))+rax] movaps xmm14,XMMWORD[((-88))+rax] movaps xmm15,XMMWORD[((-72))+rax] mov r15,QWORD[((-48))+rax] mov r14,QWORD[((-40))+rax] mov r13,QWORD[((-32))+rax] mov r12,QWORD[((-24))+rax] mov rbp,QWORD[((-16))+rax] mov rbx,QWORD[((-8))+rax] lea rsp,[rax] $L$sqr_1024_epilogue: mov rdi,QWORD[8+rsp] ;WIN64 epilogue mov rsi,QWORD[16+rsp] DB 0F3h,0C3h ;repret $L$SEH_end_rsaz_1024_sqr_avx2: global rsaz_1024_mul_avx2 ALIGN 64 rsaz_1024_mul_avx2: mov QWORD[8+rsp],rdi ;WIN64 prologue mov QWORD[16+rsp],rsi mov rax,rsp $L$SEH_begin_rsaz_1024_mul_avx2: mov rdi,rcx mov rsi,rdx mov rdx,r8 mov rcx,r9 mov r8,QWORD[40+rsp] lea rax,[rsp] push rbx push rbp push r12 push r13 push r14 push r15 vzeroupper lea rsp,[((-168))+rsp] vmovaps XMMWORD[(-216)+rax],xmm6 vmovaps XMMWORD[(-200)+rax],xmm7 vmovaps XMMWORD[(-184)+rax],xmm8 vmovaps XMMWORD[(-168)+rax],xmm9 vmovaps XMMWORD[(-152)+rax],xmm10 vmovaps XMMWORD[(-136)+rax],xmm11 vmovaps XMMWORD[(-120)+rax],xmm12 vmovaps XMMWORD[(-104)+rax],xmm13 vmovaps XMMWORD[(-88)+rax],xmm14 vmovaps XMMWORD[(-72)+rax],xmm15 $L$mul_1024_body: mov rbp,rax vzeroall mov r13,rdx sub rsp,64 DB 0x67,0x67 mov r15,rsi and r15,4095 add r15,32*10 shr r15,12 mov r15,rsi cmovnz rsi,r13 cmovnz r13,r15 mov r15,rcx sub rsi,-128 sub rcx,-128 sub rdi,-128 and r15,4095 add r15,32*10 DB 0x67,0x67 shr r15,12 jz NEAR $L$mul_1024_no_n_copy sub rsp,32*10 vmovdqu ymm0,YMMWORD[((0-128))+rcx] and rsp,-512 vmovdqu ymm1,YMMWORD[((32-128))+rcx] vmovdqu ymm2,YMMWORD[((64-128))+rcx] vmovdqu ymm3,YMMWORD[((96-128))+rcx] vmovdqu ymm4,YMMWORD[((128-128))+rcx] vmovdqu ymm5,YMMWORD[((160-128))+rcx] vmovdqu ymm6,YMMWORD[((192-128))+rcx] vmovdqu ymm7,YMMWORD[((224-128))+rcx] vmovdqu ymm8,YMMWORD[((256-128))+rcx] lea rcx,[((64+128))+rsp] vmovdqu YMMWORD[(0-128)+rcx],ymm0 vpxor ymm0,ymm0,ymm0 vmovdqu YMMWORD[(32-128)+rcx],ymm1 vpxor ymm1,ymm1,ymm1 vmovdqu YMMWORD[(64-128)+rcx],ymm2 vpxor ymm2,ymm2,ymm2 vmovdqu YMMWORD[(96-128)+rcx],ymm3 vpxor ymm3,ymm3,ymm3 vmovdqu YMMWORD[(128-128)+rcx],ymm4 vpxor ymm4,ymm4,ymm4 vmovdqu YMMWORD[(160-128)+rcx],ymm5 vpxor ymm5,ymm5,ymm5 vmovdqu YMMWORD[(192-128)+rcx],ymm6 vpxor ymm6,ymm6,ymm6 vmovdqu YMMWORD[(224-128)+rcx],ymm7 vpxor ymm7,ymm7,ymm7 vmovdqu YMMWORD[(256-128)+rcx],ymm8 vmovdqa ymm8,ymm0 vmovdqu YMMWORD[(288-128)+rcx],ymm9 $L$mul_1024_no_n_copy: and rsp,-64 mov rbx,QWORD[r13] vpbroadcastq ymm10,QWORD[r13] vmovdqu YMMWORD[rsp],ymm0 xor r9,r9 DB 0x67 xor r10,r10 xor r11,r11 xor r12,r12 vmovdqu ymm15,YMMWORD[$L$and_mask] mov r14d,9 vmovdqu YMMWORD[(288-128)+rdi],ymm9 jmp NEAR $L$oop_mul_1024 ALIGN 32 $L$oop_mul_1024: vpsrlq ymm9,ymm3,29 mov rax,rbx imul rax,QWORD[((-128))+rsi] add rax,r9 mov r10,rbx imul r10,QWORD[((8-128))+rsi] add r10,QWORD[8+rsp] mov r9,rax imul eax,r8d and eax,0x1fffffff mov r11,rbx imul r11,QWORD[((16-128))+rsi] add r11,QWORD[16+rsp] mov r12,rbx imul r12,QWORD[((24-128))+rsi] add r12,QWORD[24+rsp] vpmuludq ymm0,ymm10,YMMWORD[((32-128))+rsi] vmovd xmm11,eax vpaddq ymm1,ymm1,ymm0 vpmuludq ymm12,ymm10,YMMWORD[((64-128))+rsi] vpbroadcastq ymm11,xmm11 vpaddq ymm2,ymm2,ymm12 vpmuludq ymm13,ymm10,YMMWORD[((96-128))+rsi] vpand ymm3,ymm3,ymm15 vpaddq ymm3,ymm3,ymm13 vpmuludq ymm0,ymm10,YMMWORD[((128-128))+rsi] vpaddq ymm4,ymm4,ymm0 vpmuludq ymm12,ymm10,YMMWORD[((160-128))+rsi] vpaddq ymm5,ymm5,ymm12 vpmuludq ymm13,ymm10,YMMWORD[((192-128))+rsi] vpaddq ymm6,ymm6,ymm13 vpmuludq ymm0,ymm10,YMMWORD[((224-128))+rsi] vpermq ymm9,ymm9,0x93 vpaddq ymm7,ymm7,ymm0 vpmuludq ymm12,ymm10,YMMWORD[((256-128))+rsi] vpbroadcastq ymm10,QWORD[8+r13] vpaddq ymm8,ymm8,ymm12 mov rdx,rax imul rax,QWORD[((-128))+rcx] add r9,rax mov rax,rdx imul rax,QWORD[((8-128))+rcx] add r10,rax mov rax,rdx imul rax,QWORD[((16-128))+rcx] add r11,rax shr r9,29 imul rdx,QWORD[((24-128))+rcx] add r12,rdx add r10,r9 vpmuludq ymm13,ymm11,YMMWORD[((32-128))+rcx] vmovq rbx,xmm10 vpaddq ymm1,ymm1,ymm13 vpmuludq ymm0,ymm11,YMMWORD[((64-128))+rcx] vpaddq ymm2,ymm2,ymm0 vpmuludq ymm12,ymm11,YMMWORD[((96-128))+rcx] vpaddq ymm3,ymm3,ymm12 vpmuludq ymm13,ymm11,YMMWORD[((128-128))+rcx] vpaddq ymm4,ymm4,ymm13 vpmuludq ymm0,ymm11,YMMWORD[((160-128))+rcx] vpaddq ymm5,ymm5,ymm0 vpmuludq ymm12,ymm11,YMMWORD[((192-128))+rcx] vpaddq ymm6,ymm6,ymm12 vpmuludq ymm13,ymm11,YMMWORD[((224-128))+rcx] vpblendd ymm12,ymm9,ymm14,3 vpaddq ymm7,ymm7,ymm13 vpmuludq ymm0,ymm11,YMMWORD[((256-128))+rcx] vpaddq ymm3,ymm3,ymm12 vpaddq ymm8,ymm8,ymm0 mov rax,rbx imul rax,QWORD[((-128))+rsi] add r10,rax vmovdqu ymm12,YMMWORD[((-8+32-128))+rsi] mov rax,rbx imul rax,QWORD[((8-128))+rsi] add r11,rax vmovdqu ymm13,YMMWORD[((-8+64-128))+rsi] mov rax,r10 vpblendd ymm9,ymm9,ymm14,0xfc imul eax,r8d vpaddq ymm4,ymm4,ymm9 and eax,0x1fffffff imul rbx,QWORD[((16-128))+rsi] add r12,rbx vpmuludq ymm12,ymm12,ymm10 vmovd xmm11,eax vmovdqu ymm0,YMMWORD[((-8+96-128))+rsi] vpaddq ymm1,ymm1,ymm12 vpmuludq ymm13,ymm13,ymm10 vpbroadcastq ymm11,xmm11 vmovdqu ymm12,YMMWORD[((-8+128-128))+rsi] vpaddq ymm2,ymm2,ymm13 vpmuludq ymm0,ymm0,ymm10 vmovdqu ymm13,YMMWORD[((-8+160-128))+rsi] vpaddq ymm3,ymm3,ymm0 vpmuludq ymm12,ymm12,ymm10 vmovdqu ymm0,YMMWORD[((-8+192-128))+rsi] vpaddq ymm4,ymm4,ymm12 vpmuludq ymm13,ymm13,ymm10 vmovdqu ymm12,YMMWORD[((-8+224-128))+rsi] vpaddq ymm5,ymm5,ymm13 vpmuludq ymm0,ymm0,ymm10 vmovdqu ymm13,YMMWORD[((-8+256-128))+rsi] vpaddq ymm6,ymm6,ymm0 vpmuludq ymm12,ymm12,ymm10 vmovdqu ymm9,YMMWORD[((-8+288-128))+rsi] vpaddq ymm7,ymm7,ymm12 vpmuludq ymm13,ymm13,ymm10 vpaddq ymm8,ymm8,ymm13 vpmuludq ymm9,ymm9,ymm10 vpbroadcastq ymm10,QWORD[16+r13] mov rdx,rax imul rax,QWORD[((-128))+rcx] add r10,rax vmovdqu ymm0,YMMWORD[((-8+32-128))+rcx] mov rax,rdx imul rax,QWORD[((8-128))+rcx] add r11,rax vmovdqu ymm12,YMMWORD[((-8+64-128))+rcx] shr r10,29 imul rdx,QWORD[((16-128))+rcx] add r12,rdx add r11,r10 vpmuludq ymm0,ymm0,ymm11 vmovq rbx,xmm10 vmovdqu ymm13,YMMWORD[((-8+96-128))+rcx] vpaddq ymm1,ymm1,ymm0 vpmuludq ymm12,ymm12,ymm11 vmovdqu ymm0,YMMWORD[((-8+128-128))+rcx] vpaddq ymm2,ymm2,ymm12 vpmuludq ymm13,ymm13,ymm11 vmovdqu ymm12,YMMWORD[((-8+160-128))+rcx] vpaddq ymm3,ymm3,ymm13 vpmuludq ymm0,ymm0,ymm11 vmovdqu ymm13,YMMWORD[((-8+192-128))+rcx] vpaddq ymm4,ymm4,ymm0 vpmuludq ymm12,ymm12,ymm11 vmovdqu ymm0,YMMWORD[((-8+224-128))+rcx] vpaddq ymm5,ymm5,ymm12 vpmuludq ymm13,ymm13,ymm11 vmovdqu ymm12,YMMWORD[((-8+256-128))+rcx] vpaddq ymm6,ymm6,ymm13 vpmuludq ymm0,ymm0,ymm11 vmovdqu ymm13,YMMWORD[((-8+288-128))+rcx] vpaddq ymm7,ymm7,ymm0 vpmuludq ymm12,ymm12,ymm11 vpaddq ymm8,ymm8,ymm12 vpmuludq ymm13,ymm13,ymm11 vpaddq ymm9,ymm9,ymm13 vmovdqu ymm0,YMMWORD[((-16+32-128))+rsi] mov rax,rbx imul rax,QWORD[((-128))+rsi] add rax,r11 vmovdqu ymm12,YMMWORD[((-16+64-128))+rsi] mov r11,rax imul eax,r8d and eax,0x1fffffff imul rbx,QWORD[((8-128))+rsi] add r12,rbx vpmuludq ymm0,ymm0,ymm10 vmovd xmm11,eax vmovdqu ymm13,YMMWORD[((-16+96-128))+rsi] vpaddq ymm1,ymm1,ymm0 vpmuludq ymm12,ymm12,ymm10 vpbroadcastq ymm11,xmm11 vmovdqu ymm0,YMMWORD[((-16+128-128))+rsi] vpaddq ymm2,ymm2,ymm12 vpmuludq ymm13,ymm13,ymm10 vmovdqu ymm12,YMMWORD[((-16+160-128))+rsi] vpaddq ymm3,ymm3,ymm13 vpmuludq ymm0,ymm0,ymm10 vmovdqu ymm13,YMMWORD[((-16+192-128))+rsi] vpaddq ymm4,ymm4,ymm0 vpmuludq ymm12,ymm12,ymm10 vmovdqu ymm0,YMMWORD[((-16+224-128))+rsi] vpaddq ymm5,ymm5,ymm12 vpmuludq ymm13,ymm13,ymm10 vmovdqu ymm12,YMMWORD[((-16+256-128))+rsi] vpaddq ymm6,ymm6,ymm13 vpmuludq ymm0,ymm0,ymm10 vmovdqu ymm13,YMMWORD[((-16+288-128))+rsi] vpaddq ymm7,ymm7,ymm0 vpmuludq ymm12,ymm12,ymm10 vpaddq ymm8,ymm8,ymm12 vpmuludq ymm13,ymm13,ymm10 vpbroadcastq ymm10,QWORD[24+r13] vpaddq ymm9,ymm9,ymm13 vmovdqu ymm0,YMMWORD[((-16+32-128))+rcx] mov rdx,rax imul rax,QWORD[((-128))+rcx] add r11,rax vmovdqu ymm12,YMMWORD[((-16+64-128))+rcx] imul rdx,QWORD[((8-128))+rcx] add r12,rdx shr r11,29 vpmuludq ymm0,ymm0,ymm11 vmovq rbx,xmm10 vmovdqu ymm13,YMMWORD[((-16+96-128))+rcx] vpaddq ymm1,ymm1,ymm0 vpmuludq ymm12,ymm12,ymm11 vmovdqu ymm0,YMMWORD[((-16+128-128))+rcx] vpaddq ymm2,ymm2,ymm12 vpmuludq ymm13,ymm13,ymm11 vmovdqu ymm12,YMMWORD[((-16+160-128))+rcx] vpaddq ymm3,ymm3,ymm13 vpmuludq ymm0,ymm0,ymm11 vmovdqu ymm13,YMMWORD[((-16+192-128))+rcx] vpaddq ymm4,ymm4,ymm0 vpmuludq ymm12,ymm12,ymm11 vmovdqu ymm0,YMMWORD[((-16+224-128))+rcx] vpaddq ymm5,ymm5,ymm12 vpmuludq ymm13,ymm13,ymm11 vmovdqu ymm12,YMMWORD[((-16+256-128))+rcx] vpaddq ymm6,ymm6,ymm13 vpmuludq ymm0,ymm0,ymm11 vmovdqu ymm13,YMMWORD[((-16+288-128))+rcx] vpaddq ymm7,ymm7,ymm0 vpmuludq ymm12,ymm12,ymm11 vmovdqu ymm0,YMMWORD[((-24+32-128))+rsi] vpaddq ymm8,ymm8,ymm12 vpmuludq ymm13,ymm13,ymm11 vmovdqu ymm12,YMMWORD[((-24+64-128))+rsi] vpaddq ymm9,ymm9,ymm13 add r12,r11 imul rbx,QWORD[((-128))+rsi] add r12,rbx mov rax,r12 imul eax,r8d and eax,0x1fffffff vpmuludq ymm0,ymm0,ymm10 vmovd xmm11,eax vmovdqu ymm13,YMMWORD[((-24+96-128))+rsi] vpaddq ymm1,ymm1,ymm0 vpmuludq ymm12,ymm12,ymm10 vpbroadcastq ymm11,xmm11 vmovdqu ymm0,YMMWORD[((-24+128-128))+rsi] vpaddq ymm2,ymm2,ymm12 vpmuludq ymm13,ymm13,ymm10 vmovdqu ymm12,YMMWORD[((-24+160-128))+rsi] vpaddq ymm3,ymm3,ymm13 vpmuludq ymm0,ymm0,ymm10 vmovdqu ymm13,YMMWORD[((-24+192-128))+rsi] vpaddq ymm4,ymm4,ymm0 vpmuludq ymm12,ymm12,ymm10 vmovdqu ymm0,YMMWORD[((-24+224-128))+rsi] vpaddq ymm5,ymm5,ymm12 vpmuludq ymm13,ymm13,ymm10 vmovdqu ymm12,YMMWORD[((-24+256-128))+rsi] vpaddq ymm6,ymm6,ymm13 vpmuludq ymm0,ymm0,ymm10 vmovdqu ymm13,YMMWORD[((-24+288-128))+rsi] vpaddq ymm7,ymm7,ymm0 vpmuludq ymm12,ymm12,ymm10 vpaddq ymm8,ymm8,ymm12 vpmuludq ymm13,ymm13,ymm10 vpbroadcastq ymm10,QWORD[32+r13] vpaddq ymm9,ymm9,ymm13 add r13,32 vmovdqu ymm0,YMMWORD[((-24+32-128))+rcx] imul rax,QWORD[((-128))+rcx] add r12,rax shr r12,29 vmovdqu ymm12,YMMWORD[((-24+64-128))+rcx] vpmuludq ymm0,ymm0,ymm11 vmovq rbx,xmm10 vmovdqu ymm13,YMMWORD[((-24+96-128))+rcx] vpaddq ymm0,ymm1,ymm0 vpmuludq ymm12,ymm12,ymm11 vmovdqu YMMWORD[rsp],ymm0 vpaddq ymm1,ymm2,ymm12 vmovdqu ymm0,YMMWORD[((-24+128-128))+rcx] vpmuludq ymm13,ymm13,ymm11 vmovdqu ymm12,YMMWORD[((-24+160-128))+rcx] vpaddq ymm2,ymm3,ymm13 vpmuludq ymm0,ymm0,ymm11 vmovdqu ymm13,YMMWORD[((-24+192-128))+rcx] vpaddq ymm3,ymm4,ymm0 vpmuludq ymm12,ymm12,ymm11 vmovdqu ymm0,YMMWORD[((-24+224-128))+rcx] vpaddq ymm4,ymm5,ymm12 vpmuludq ymm13,ymm13,ymm11 vmovdqu ymm12,YMMWORD[((-24+256-128))+rcx] vpaddq ymm5,ymm6,ymm13 vpmuludq ymm0,ymm0,ymm11 vmovdqu ymm13,YMMWORD[((-24+288-128))+rcx] mov r9,r12 vpaddq ymm6,ymm7,ymm0 vpmuludq ymm12,ymm12,ymm11 add r9,QWORD[rsp] vpaddq ymm7,ymm8,ymm12 vpmuludq ymm13,ymm13,ymm11 vmovq xmm12,r12 vpaddq ymm8,ymm9,ymm13 dec r14d jnz NEAR $L$oop_mul_1024 vpaddq ymm0,ymm12,YMMWORD[rsp] vpsrlq ymm12,ymm0,29 vpand ymm0,ymm0,ymm15 vpsrlq ymm13,ymm1,29 vpand ymm1,ymm1,ymm15 vpsrlq ymm10,ymm2,29 vpermq ymm12,ymm12,0x93 vpand ymm2,ymm2,ymm15 vpsrlq ymm11,ymm3,29 vpermq ymm13,ymm13,0x93 vpand ymm3,ymm3,ymm15 vpblendd ymm9,ymm12,ymm14,3 vpermq ymm10,ymm10,0x93 vpblendd ymm12,ymm13,ymm12,3 vpermq ymm11,ymm11,0x93 vpaddq ymm0,ymm0,ymm9 vpblendd ymm13,ymm10,ymm13,3 vpaddq ymm1,ymm1,ymm12 vpblendd ymm10,ymm11,ymm10,3 vpaddq ymm2,ymm2,ymm13 vpblendd ymm11,ymm14,ymm11,3 vpaddq ymm3,ymm3,ymm10 vpaddq ymm4,ymm4,ymm11 vpsrlq ymm12,ymm0,29 vpand ymm0,ymm0,ymm15 vpsrlq ymm13,ymm1,29 vpand ymm1,ymm1,ymm15 vpsrlq ymm10,ymm2,29 vpermq ymm12,ymm12,0x93 vpand ymm2,ymm2,ymm15 vpsrlq ymm11,ymm3,29 vpermq ymm13,ymm13,0x93 vpand ymm3,ymm3,ymm15 vpermq ymm10,ymm10,0x93 vpblendd ymm9,ymm12,ymm14,3 vpermq ymm11,ymm11,0x93 vpblendd ymm12,ymm13,ymm12,3 vpaddq ymm0,ymm0,ymm9 vpblendd ymm13,ymm10,ymm13,3 vpaddq ymm1,ymm1,ymm12 vpblendd ymm10,ymm11,ymm10,3 vpaddq ymm2,ymm2,ymm13 vpblendd ymm11,ymm14,ymm11,3 vpaddq ymm3,ymm3,ymm10 vpaddq ymm4,ymm4,ymm11 vmovdqu YMMWORD[(0-128)+rdi],ymm0 vmovdqu YMMWORD[(32-128)+rdi],ymm1 vmovdqu YMMWORD[(64-128)+rdi],ymm2 vmovdqu YMMWORD[(96-128)+rdi],ymm3 vpsrlq ymm12,ymm4,29 vpand ymm4,ymm4,ymm15 vpsrlq ymm13,ymm5,29 vpand ymm5,ymm5,ymm15 vpsrlq ymm10,ymm6,29 vpermq ymm12,ymm12,0x93 vpand ymm6,ymm6,ymm15 vpsrlq ymm11,ymm7,29 vpermq ymm13,ymm13,0x93 vpand ymm7,ymm7,ymm15 vpsrlq ymm0,ymm8,29 vpermq ymm10,ymm10,0x93 vpand ymm8,ymm8,ymm15 vpermq ymm11,ymm11,0x93 vpblendd ymm9,ymm12,ymm14,3 vpermq ymm0,ymm0,0x93 vpblendd ymm12,ymm13,ymm12,3 vpaddq ymm4,ymm4,ymm9 vpblendd ymm13,ymm10,ymm13,3 vpaddq ymm5,ymm5,ymm12 vpblendd ymm10,ymm11,ymm10,3 vpaddq ymm6,ymm6,ymm13 vpblendd ymm11,ymm0,ymm11,3 vpaddq ymm7,ymm7,ymm10 vpaddq ymm8,ymm8,ymm11 vpsrlq ymm12,ymm4,29 vpand ymm4,ymm4,ymm15 vpsrlq ymm13,ymm5,29 vpand ymm5,ymm5,ymm15 vpsrlq ymm10,ymm6,29 vpermq ymm12,ymm12,0x93 vpand ymm6,ymm6,ymm15 vpsrlq ymm11,ymm7,29 vpermq ymm13,ymm13,0x93 vpand ymm7,ymm7,ymm15 vpsrlq ymm0,ymm8,29 vpermq ymm10,ymm10,0x93 vpand ymm8,ymm8,ymm15 vpermq ymm11,ymm11,0x93 vpblendd ymm9,ymm12,ymm14,3 vpermq ymm0,ymm0,0x93 vpblendd ymm12,ymm13,ymm12,3 vpaddq ymm4,ymm4,ymm9 vpblendd ymm13,ymm10,ymm13,3 vpaddq ymm5,ymm5,ymm12 vpblendd ymm10,ymm11,ymm10,3 vpaddq ymm6,ymm6,ymm13 vpblendd ymm11,ymm0,ymm11,3 vpaddq ymm7,ymm7,ymm10 vpaddq ymm8,ymm8,ymm11 vmovdqu YMMWORD[(128-128)+rdi],ymm4 vmovdqu YMMWORD[(160-128)+rdi],ymm5 vmovdqu YMMWORD[(192-128)+rdi],ymm6 vmovdqu YMMWORD[(224-128)+rdi],ymm7 vmovdqu YMMWORD[(256-128)+rdi],ymm8 vzeroupper mov rax,rbp $L$mul_1024_in_tail: movaps xmm6,XMMWORD[((-216))+rax] movaps xmm7,XMMWORD[((-200))+rax] movaps xmm8,XMMWORD[((-184))+rax] movaps xmm9,XMMWORD[((-168))+rax] movaps xmm10,XMMWORD[((-152))+rax] movaps xmm11,XMMWORD[((-136))+rax] movaps xmm12,XMMWORD[((-120))+rax] movaps xmm13,XMMWORD[((-104))+rax] movaps xmm14,XMMWORD[((-88))+rax] movaps xmm15,XMMWORD[((-72))+rax] mov r15,QWORD[((-48))+rax] mov r14,QWORD[((-40))+rax] mov r13,QWORD[((-32))+rax] mov r12,QWORD[((-24))+rax] mov rbp,QWORD[((-16))+rax] mov rbx,QWORD[((-8))+rax] lea rsp,[rax] $L$mul_1024_epilogue: mov rdi,QWORD[8+rsp] ;WIN64 epilogue mov rsi,QWORD[16+rsp] DB 0F3h,0C3h ;repret $L$SEH_end_rsaz_1024_mul_avx2: global rsaz_1024_red2norm_avx2 ALIGN 32 rsaz_1024_red2norm_avx2: sub rdx,-128 xor rax,rax mov r8,QWORD[((-128))+rdx] mov r9,QWORD[((-120))+rdx] mov r10,QWORD[((-112))+rdx] shl r8,0 shl r9,29 mov r11,r10 shl r10,58 shr r11,6 add rax,r8 add rax,r9 add rax,r10 adc r11,0 mov QWORD[rcx],rax mov rax,r11 mov r8,QWORD[((-104))+rdx] mov r9,QWORD[((-96))+rdx] shl r8,23 mov r10,r9 shl r9,52 shr r10,12 add rax,r8 add rax,r9 adc r10,0 mov QWORD[8+rcx],rax mov rax,r10 mov r11,QWORD[((-88))+rdx] mov r8,QWORD[((-80))+rdx] shl r11,17 mov r9,r8 shl r8,46 shr r9,18 add rax,r11 add rax,r8 adc r9,0 mov QWORD[16+rcx],rax mov rax,r9 mov r10,QWORD[((-72))+rdx] mov r11,QWORD[((-64))+rdx] shl r10,11 mov r8,r11 shl r11,40 shr r8,24 add rax,r10 add rax,r11 adc r8,0 mov QWORD[24+rcx],rax mov rax,r8 mov r9,QWORD[((-56))+rdx] mov r10,QWORD[((-48))+rdx] mov r11,QWORD[((-40))+rdx] shl r9,5 shl r10,34 mov r8,r11 shl r11,63 shr r8,1 add rax,r9 add rax,r10 add rax,r11 adc r8,0 mov QWORD[32+rcx],rax mov rax,r8 mov r9,QWORD[((-32))+rdx] mov r10,QWORD[((-24))+rdx] shl r9,28 mov r11,r10 shl r10,57 shr r11,7 add rax,r9 add rax,r10 adc r11,0 mov QWORD[40+rcx],rax mov rax,r11 mov r8,QWORD[((-16))+rdx] mov r9,QWORD[((-8))+rdx] shl r8,22 mov r10,r9 shl r9,51 shr r10,13 add rax,r8 add rax,r9 adc r10,0 mov QWORD[48+rcx],rax mov rax,r10 mov r11,QWORD[rdx] mov r8,QWORD[8+rdx] shl r11,16 mov r9,r8 shl r8,45 shr r9,19 add rax,r11 add rax,r8 adc r9,0 mov QWORD[56+rcx],rax mov rax,r9 mov r10,QWORD[16+rdx] mov r11,QWORD[24+rdx] shl r10,10 mov r8,r11 shl r11,39 shr r8,25 add rax,r10 add rax,r11 adc r8,0 mov QWORD[64+rcx],rax mov rax,r8 mov r9,QWORD[32+rdx] mov r10,QWORD[40+rdx] mov r11,QWORD[48+rdx] shl r9,4 shl r10,33 mov r8,r11 shl r11,62 shr r8,2 add rax,r9 add rax,r10 add rax,r11 adc r8,0 mov QWORD[72+rcx],rax mov rax,r8 mov r9,QWORD[56+rdx] mov r10,QWORD[64+rdx] shl r9,27 mov r11,r10 shl r10,56 shr r11,8 add rax,r9 add rax,r10 adc r11,0 mov QWORD[80+rcx],rax mov rax,r11 mov r8,QWORD[72+rdx] mov r9,QWORD[80+rdx] shl r8,21 mov r10,r9 shl r9,50 shr r10,14 add rax,r8 add rax,r9 adc r10,0 mov QWORD[88+rcx],rax mov rax,r10 mov r11,QWORD[88+rdx] mov r8,QWORD[96+rdx] shl r11,15 mov r9,r8 shl r8,44 shr r9,20 add rax,r11 add rax,r8 adc r9,0 mov QWORD[96+rcx],rax mov rax,r9 mov r10,QWORD[104+rdx] mov r11,QWORD[112+rdx] shl r10,9 mov r8,r11 shl r11,38 shr r8,26 add rax,r10 add rax,r11 adc r8,0 mov QWORD[104+rcx],rax mov rax,r8 mov r9,QWORD[120+rdx] mov r10,QWORD[128+rdx] mov r11,QWORD[136+rdx] shl r9,3 shl r10,32 mov r8,r11 shl r11,61 shr r8,3 add rax,r9 add rax,r10 add rax,r11 adc r8,0 mov QWORD[112+rcx],rax mov rax,r8 mov r9,QWORD[144+rdx] mov r10,QWORD[152+rdx] shl r9,26 mov r11,r10 shl r10,55 shr r11,9 add rax,r9 add rax,r10 adc r11,0 mov QWORD[120+rcx],rax mov rax,r11 DB 0F3h,0C3h ;repret global rsaz_1024_norm2red_avx2 ALIGN 32 rsaz_1024_norm2red_avx2: sub rcx,-128 mov r8,QWORD[rdx] mov eax,0x1fffffff mov r9,QWORD[8+rdx] mov r11,r8 shr r11,0 and r11,rax mov QWORD[((-128))+rcx],r11 mov r10,r8 shr r10,29 and r10,rax mov QWORD[((-120))+rcx],r10 shrd r8,r9,58 and r8,rax mov QWORD[((-112))+rcx],r8 mov r10,QWORD[16+rdx] mov r8,r9 shr r8,23 and r8,rax mov QWORD[((-104))+rcx],r8 shrd r9,r10,52 and r9,rax mov QWORD[((-96))+rcx],r9 mov r11,QWORD[24+rdx] mov r9,r10 shr r9,17 and r9,rax mov QWORD[((-88))+rcx],r9 shrd r10,r11,46 and r10,rax mov QWORD[((-80))+rcx],r10 mov r8,QWORD[32+rdx] mov r10,r11 shr r10,11 and r10,rax mov QWORD[((-72))+rcx],r10 shrd r11,r8,40 and r11,rax mov QWORD[((-64))+rcx],r11 mov r9,QWORD[40+rdx] mov r11,r8 shr r11,5 and r11,rax mov QWORD[((-56))+rcx],r11 mov r10,r8 shr r10,34 and r10,rax mov QWORD[((-48))+rcx],r10 shrd r8,r9,63 and r8,rax mov QWORD[((-40))+rcx],r8 mov r10,QWORD[48+rdx] mov r8,r9 shr r8,28 and r8,rax mov QWORD[((-32))+rcx],r8 shrd r9,r10,57 and r9,rax mov QWORD[((-24))+rcx],r9 mov r11,QWORD[56+rdx] mov r9,r10 shr r9,22 and r9,rax mov QWORD[((-16))+rcx],r9 shrd r10,r11,51 and r10,rax mov QWORD[((-8))+rcx],r10 mov r8,QWORD[64+rdx] mov r10,r11 shr r10,16 and r10,rax mov QWORD[rcx],r10 shrd r11,r8,45 and r11,rax mov QWORD[8+rcx],r11 mov r9,QWORD[72+rdx] mov r11,r8 shr r11,10 and r11,rax mov QWORD[16+rcx],r11 shrd r8,r9,39 and r8,rax mov QWORD[24+rcx],r8 mov r10,QWORD[80+rdx] mov r8,r9 shr r8,4 and r8,rax mov QWORD[32+rcx],r8 mov r11,r9 shr r11,33 and r11,rax mov QWORD[40+rcx],r11 shrd r9,r10,62 and r9,rax mov QWORD[48+rcx],r9 mov r11,QWORD[88+rdx] mov r9,r10 shr r9,27 and r9,rax mov QWORD[56+rcx],r9 shrd r10,r11,56 and r10,rax mov QWORD[64+rcx],r10 mov r8,QWORD[96+rdx] mov r10,r11 shr r10,21 and r10,rax mov QWORD[72+rcx],r10 shrd r11,r8,50 and r11,rax mov QWORD[80+rcx],r11 mov r9,QWORD[104+rdx] mov r11,r8 shr r11,15 and r11,rax mov QWORD[88+rcx],r11 shrd r8,r9,44 and r8,rax mov QWORD[96+rcx],r8 mov r10,QWORD[112+rdx] mov r8,r9 shr r8,9 and r8,rax mov QWORD[104+rcx],r8 shrd r9,r10,38 and r9,rax mov QWORD[112+rcx],r9 mov r11,QWORD[120+rdx] mov r9,r10 shr r9,3 and r9,rax mov QWORD[120+rcx],r9 mov r8,r10 shr r8,32 and r8,rax mov QWORD[128+rcx],r8 shrd r10,r11,61 and r10,rax mov QWORD[136+rcx],r10 xor r8,r8 mov r10,r11 shr r10,26 and r10,rax mov QWORD[144+rcx],r10 shrd r11,r8,55 and r11,rax mov QWORD[152+rcx],r11 mov QWORD[160+rcx],r8 mov QWORD[168+rcx],r8 mov QWORD[176+rcx],r8 mov QWORD[184+rcx],r8 DB 0F3h,0C3h ;repret global rsaz_1024_scatter5_avx2 ALIGN 32 rsaz_1024_scatter5_avx2: vzeroupper vmovdqu ymm5,YMMWORD[$L$scatter_permd] shl r8d,4 lea rcx,[r8*1+rcx] mov eax,9 jmp NEAR $L$oop_scatter_1024 ALIGN 32 $L$oop_scatter_1024: vmovdqu ymm0,YMMWORD[rdx] lea rdx,[32+rdx] vpermd ymm0,ymm5,ymm0 vmovdqu XMMWORD[rcx],xmm0 lea rcx,[512+rcx] dec eax jnz NEAR $L$oop_scatter_1024 vzeroupper DB 0F3h,0C3h ;repret global rsaz_1024_gather5_avx2 ALIGN 32 rsaz_1024_gather5_avx2: vzeroupper mov r11,rsp lea rax,[((-136))+rsp] $L$SEH_begin_rsaz_1024_gather5: DB 0x48,0x8d,0x60,0xe0 DB 0xc5,0xf8,0x29,0x70,0xe0 DB 0xc5,0xf8,0x29,0x78,0xf0 DB 0xc5,0x78,0x29,0x40,0x00 DB 0xc5,0x78,0x29,0x48,0x10 DB 0xc5,0x78,0x29,0x50,0x20 DB 0xc5,0x78,0x29,0x58,0x30 DB 0xc5,0x78,0x29,0x60,0x40 DB 0xc5,0x78,0x29,0x68,0x50 DB 0xc5,0x78,0x29,0x70,0x60 DB 0xc5,0x78,0x29,0x78,0x70 lea rsp,[((-256))+rsp] and rsp,-32 lea r10,[$L$inc] lea rax,[((-128))+rsp] vmovd xmm4,r8d vmovdqa ymm0,YMMWORD[r10] vmovdqa ymm1,YMMWORD[32+r10] vmovdqa ymm5,YMMWORD[64+r10] vpbroadcastd ymm4,xmm4 vpaddd ymm2,ymm0,ymm5 vpcmpeqd ymm0,ymm0,ymm4 vpaddd ymm3,ymm1,ymm5 vpcmpeqd ymm1,ymm1,ymm4 vmovdqa YMMWORD[(0+128)+rax],ymm0 vpaddd ymm0,ymm2,ymm5 vpcmpeqd ymm2,ymm2,ymm4 vmovdqa YMMWORD[(32+128)+rax],ymm1 vpaddd ymm1,ymm3,ymm5 vpcmpeqd ymm3,ymm3,ymm4 vmovdqa YMMWORD[(64+128)+rax],ymm2 vpaddd ymm2,ymm0,ymm5 vpcmpeqd ymm0,ymm0,ymm4 vmovdqa YMMWORD[(96+128)+rax],ymm3 vpaddd ymm3,ymm1,ymm5 vpcmpeqd ymm1,ymm1,ymm4 vmovdqa YMMWORD[(128+128)+rax],ymm0 vpaddd ymm8,ymm2,ymm5 vpcmpeqd ymm2,ymm2,ymm4 vmovdqa YMMWORD[(160+128)+rax],ymm1 vpaddd ymm9,ymm3,ymm5 vpcmpeqd ymm3,ymm3,ymm4 vmovdqa YMMWORD[(192+128)+rax],ymm2 vpaddd ymm10,ymm8,ymm5 vpcmpeqd ymm8,ymm8,ymm4 vmovdqa YMMWORD[(224+128)+rax],ymm3 vpaddd ymm11,ymm9,ymm5 vpcmpeqd ymm9,ymm9,ymm4 vpaddd ymm12,ymm10,ymm5 vpcmpeqd ymm10,ymm10,ymm4 vpaddd ymm13,ymm11,ymm5 vpcmpeqd ymm11,ymm11,ymm4 vpaddd ymm14,ymm12,ymm5 vpcmpeqd ymm12,ymm12,ymm4 vpaddd ymm15,ymm13,ymm5 vpcmpeqd ymm13,ymm13,ymm4 vpcmpeqd ymm14,ymm14,ymm4 vpcmpeqd ymm15,ymm15,ymm4 vmovdqa ymm7,YMMWORD[((-32))+r10] lea rdx,[128+rdx] mov r8d,9 $L$oop_gather_1024: vmovdqa ymm0,YMMWORD[((0-128))+rdx] vmovdqa ymm1,YMMWORD[((32-128))+rdx] vmovdqa ymm2,YMMWORD[((64-128))+rdx] vmovdqa ymm3,YMMWORD[((96-128))+rdx] vpand ymm0,ymm0,YMMWORD[((0+128))+rax] vpand ymm1,ymm1,YMMWORD[((32+128))+rax] vpand ymm2,ymm2,YMMWORD[((64+128))+rax] vpor ymm4,ymm1,ymm0 vpand ymm3,ymm3,YMMWORD[((96+128))+rax] vmovdqa ymm0,YMMWORD[((128-128))+rdx] vmovdqa ymm1,YMMWORD[((160-128))+rdx] vpor ymm5,ymm3,ymm2 vmovdqa ymm2,YMMWORD[((192-128))+rdx] vmovdqa ymm3,YMMWORD[((224-128))+rdx] vpand ymm0,ymm0,YMMWORD[((128+128))+rax] vpand ymm1,ymm1,YMMWORD[((160+128))+rax] vpand ymm2,ymm2,YMMWORD[((192+128))+rax] vpor ymm4,ymm4,ymm0 vpand ymm3,ymm3,YMMWORD[((224+128))+rax] vpand ymm0,ymm8,YMMWORD[((256-128))+rdx] vpor ymm5,ymm5,ymm1 vpand ymm1,ymm9,YMMWORD[((288-128))+rdx] vpor ymm4,ymm4,ymm2 vpand ymm2,ymm10,YMMWORD[((320-128))+rdx] vpor ymm5,ymm5,ymm3 vpand ymm3,ymm11,YMMWORD[((352-128))+rdx] vpor ymm4,ymm4,ymm0 vpand ymm0,ymm12,YMMWORD[((384-128))+rdx] vpor ymm5,ymm5,ymm1 vpand ymm1,ymm13,YMMWORD[((416-128))+rdx] vpor ymm4,ymm4,ymm2 vpand ymm2,ymm14,YMMWORD[((448-128))+rdx] vpor ymm5,ymm5,ymm3 vpand ymm3,ymm15,YMMWORD[((480-128))+rdx] lea rdx,[512+rdx] vpor ymm4,ymm4,ymm0 vpor ymm5,ymm5,ymm1 vpor ymm4,ymm4,ymm2 vpor ymm5,ymm5,ymm3 vpor ymm4,ymm4,ymm5 vextracti128 xmm5,ymm4,1 vpor xmm5,xmm5,xmm4 vpermd ymm5,ymm7,ymm5 vmovdqu YMMWORD[rcx],ymm5 lea rcx,[32+rcx] dec r8d jnz NEAR $L$oop_gather_1024 vpxor ymm0,ymm0,ymm0 vmovdqu YMMWORD[rcx],ymm0 vzeroupper movaps xmm6,XMMWORD[((-168))+r11] movaps xmm7,XMMWORD[((-152))+r11] movaps xmm8,XMMWORD[((-136))+r11] movaps xmm9,XMMWORD[((-120))+r11] movaps xmm10,XMMWORD[((-104))+r11] movaps xmm11,XMMWORD[((-88))+r11] movaps xmm12,XMMWORD[((-72))+r11] movaps xmm13,XMMWORD[((-56))+r11] movaps xmm14,XMMWORD[((-40))+r11] movaps xmm15,XMMWORD[((-24))+r11] lea rsp,[r11] DB 0F3h,0C3h ;repret $L$SEH_end_rsaz_1024_gather5: ALIGN 64 $L$and_mask: DQ 0x1fffffff,0x1fffffff,0x1fffffff,0x1fffffff $L$scatter_permd: DD 0,2,4,6,7,7,7,7 $L$gather_permd: DD 0,7,1,7,2,7,3,7 $L$inc: DD 0,0,0,0,1,1,1,1 DD 2,2,2,2,3,3,3,3 DD 4,4,4,4,4,4,4,4 ALIGN 64 EXTERN __imp_RtlVirtualUnwind ALIGN 16 rsaz_se_handler: push rsi push rdi push rbx push rbp push r12 push r13 push r14 push r15 pushfq sub rsp,64 mov rax,QWORD[120+r8] mov rbx,QWORD[248+r8] mov rsi,QWORD[8+r9] mov r11,QWORD[56+r9] mov r10d,DWORD[r11] lea r10,[r10*1+rsi] cmp rbx,r10 jb NEAR $L$common_seh_tail mov r10d,DWORD[4+r11] lea r10,[r10*1+rsi] cmp rbx,r10 jae NEAR $L$common_seh_tail mov rbp,QWORD[160+r8] mov r10d,DWORD[8+r11] lea r10,[r10*1+rsi] cmp rbx,r10 cmovc rax,rbp mov r15,QWORD[((-48))+rax] mov r14,QWORD[((-40))+rax] mov r13,QWORD[((-32))+rax] mov r12,QWORD[((-24))+rax] mov rbp,QWORD[((-16))+rax] mov rbx,QWORD[((-8))+rax] mov QWORD[240+r8],r15 mov QWORD[232+r8],r14 mov QWORD[224+r8],r13 mov QWORD[216+r8],r12 mov QWORD[160+r8],rbp mov QWORD[144+r8],rbx lea rsi,[((-216))+rax] lea rdi,[512+r8] mov ecx,20 DD 0xa548f3fc $L$common_seh_tail: mov rdi,QWORD[8+rax] mov rsi,QWORD[16+rax] mov QWORD[152+r8],rax mov QWORD[168+r8],rsi mov QWORD[176+r8],rdi mov rdi,QWORD[40+r9] mov rsi,r8 mov ecx,154 DD 0xa548f3fc mov rsi,r9 xor rcx,rcx mov rdx,QWORD[8+rsi] mov r8,QWORD[rsi] mov r9,QWORD[16+rsi] mov r10,QWORD[40+rsi] lea r11,[56+rsi] lea r12,[24+rsi] mov QWORD[32+rsp],r10 mov QWORD[40+rsp],r11 mov QWORD[48+rsp],r12 mov QWORD[56+rsp],rcx call QWORD[__imp_RtlVirtualUnwind] mov eax,1 add rsp,64 popfq pop r15 pop r14 pop r13 pop r12 pop rbp pop rbx pop rdi pop rsi DB 0F3h,0C3h ;repret section .pdata rdata align=4 ALIGN 4 DD $L$SEH_begin_rsaz_1024_sqr_avx2 wrt ..imagebase DD $L$SEH_end_rsaz_1024_sqr_avx2 wrt ..imagebase DD $L$SEH_info_rsaz_1024_sqr_avx2 wrt ..imagebase DD $L$SEH_begin_rsaz_1024_mul_avx2 wrt ..imagebase DD $L$SEH_end_rsaz_1024_mul_avx2 wrt ..imagebase DD $L$SEH_info_rsaz_1024_mul_avx2 wrt ..imagebase DD $L$SEH_begin_rsaz_1024_gather5 wrt ..imagebase DD $L$SEH_end_rsaz_1024_gather5 wrt ..imagebase DD $L$SEH_info_rsaz_1024_gather5 wrt ..imagebase section .xdata rdata align=8 ALIGN 8 $L$SEH_info_rsaz_1024_sqr_avx2: DB 9,0,0,0 DD rsaz_se_handler wrt ..imagebase DD $L$sqr_1024_body wrt ..imagebase,$L$sqr_1024_epilogue wrt ..imagebase,$L$sqr_1024_in_tail wrt ..imagebase DD 0 $L$SEH_info_rsaz_1024_mul_avx2: DB 9,0,0,0 DD rsaz_se_handler wrt ..imagebase DD $L$mul_1024_body wrt ..imagebase,$L$mul_1024_epilogue wrt ..imagebase,$L$mul_1024_in_tail wrt ..imagebase DD 0 $L$SEH_info_rsaz_1024_gather5: DB 0x01,0x36,0x17,0x0b DB 0x36,0xf8,0x09,0x00 DB 0x31,0xe8,0x08,0x00 DB 0x2c,0xd8,0x07,0x00 DB 0x27,0xc8,0x06,0x00 DB 0x22,0xb8,0x05,0x00 DB 0x1d,0xa8,0x04,0x00 DB 0x18,0x98,0x03,0x00 DB 0x13,0x88,0x02,0x00 DB 0x0e,0x78,0x01,0x00 DB 0x09,0x68,0x00,0x00 DB 0x04,0x01,0x15,0x00 DB 0x00,0xb3,0x00,0x00
Assembly
4
pdv-ru/ClickHouse
contrib/boringssl-cmake/win-x86_64/crypto/fipsmodule/rsaz-avx2.asm
[ "Apache-2.0" ]
package cases.display.issues; class Issue9470 extends DisplayTestCase { /** interface I { function method():Void; } class C implements I { public function new() {} public function met{-1-}hod() {} } class Main { static public function main() { (new C() : I).{-2-}method{-3-}(); } } **/ function test(_) { runHaxeJson([], DisplayMethods.FindReferences, {file: file, kind: WithBaseAndDescendants, offset: offset(1)}); var result = parseGotoDefinitionLocations(); Assert.same([range(2, 3)], result.map(l -> l.range)); Assert.pass(); } }
Haxe
3
wiltonlazary/haxe
tests/server/src/cases/display/issues/Issue9470.hx
[ "MIT" ]
test: VIMRUNNER_REUSE_SERVER=1 xvfb-run bundle exec rspec # Run tests in dockerized Vims. DOCKER_REPO:=blueyed/vim-python-pep8-indent-vims-for-test DOCKER_TAG:=3 DOCKER_IMAGE:=$(DOCKER_REPO):$(DOCKER_TAG) docker_image: docker build -t $(DOCKER_REPO):$(DOCKER_TAG) . docker_push: docker push $(DOCKER_REPO):$(DOCKER_TAG) docker_update_latest: docker tag $(DOCKER_REPO):$(DOCKER_TAG) $(DOCKER_REPO):latest docker push $(DOCKER_REPO):latest test_docker: XVFB_ERRORFILE:=/dev/null test_docker: @set -x; export DISPLAY=$(if $(VIMRUNNER_TEST_DISPLAY),$(VIMRUNNER_TEST_DISPLAY),172.17.0.1:99; Xvfb -ac -listen tcp :99 >$(XVFB_ERRORFILE) 2>&1 & XVFB_PID=$$!); \ docker run --rm -ti -e DISPLAY -e VIMRUNNER_REUSE_SERVER=1 \ -v $(CURDIR):/vim-python-pep8-indent $(DOCKER_IMAGE) $(RSPEC_ARGS) \ $(if $(VIMRUNNER_TEST_DISPLAY),,; ret=$$?; kill $$XVFB_PID; exit $$ret) test_coverage: spec/make-coverage
Makefile
3
JiHuDad/vimrc
sources_non_forked/vim-python-pep8-indent/Makefile
[ "MIT" ]
:- load_foreign_files(['libudi_rtree'],[],udi_rtree_init). :- op(700,xfx,'&&'). A '&&' B :- attributes:get_all_atts(A,C), attributes:put_att_term(A,overlap(C,B)).
Prolog
3
ryandesign/yap
packages/udi/rtree/rtree.yap
[ "Artistic-1.0-Perl", "ClArtistic" ]
import Page from '../components/page' import { initializeStore } from '../lib/store' export default function SSG() { return <Page /> } // If you build and start the app, the date returned here will have the same // value for all requests, as this method gets executed at build time. // You will not see this while in development mode though. export function getStaticProps() { const zustandStore = initializeStore() return { props: { // the "stringify and then parse again" piece is required as next.js // isn't able to serialize it to JSON properly initialZustandState: JSON.parse(JSON.stringify(zustandStore.getState())), }, } }
JavaScript
4
nazarepiedady/next.js
examples/with-zustand/pages/ssg.js
[ "MIT" ]
import React from "react" import PropTypes from "prop-types" import ImPropTypes from "react-immutable-proptypes" export default class OperationServers extends React.Component { static propTypes = { // for self path: PropTypes.string.isRequired, method: PropTypes.string.isRequired, operationServers: ImPropTypes.list, pathServers: ImPropTypes.list, setSelectedServer: PropTypes.func.isRequired, setServerVariableValue: PropTypes.func.isRequired, getSelectedServer: PropTypes.func.isRequired, getServerVariable: PropTypes.func.isRequired, getEffectiveServerValue: PropTypes.func.isRequired, // utils getComponent: PropTypes.func.isRequired } setSelectedServer = (server) => { const { path, method } = this.props // FIXME: we should be keeping up with this in props/state upstream of us // instead of cheating™ with `forceUpdate` this.forceUpdate() return this.props.setSelectedServer(server, `${path}:${method}`) } setServerVariableValue = (obj) => { const { path, method } = this.props // FIXME: we should be keeping up with this in props/state upstream of us // instead of cheating™ with `forceUpdate` this.forceUpdate() return this.props.setServerVariableValue({ ...obj, namespace: `${path}:${method}` }) } getSelectedServer = () => { const { path, method } = this.props return this.props.getSelectedServer(`${path}:${method}`) } getServerVariable = (server, key) => { const { path, method } = this.props return this.props.getServerVariable({ namespace: `${path}:${method}`, server }, key) } getEffectiveServerValue = (server) => { const { path, method } = this.props return this.props.getEffectiveServerValue({ server, namespace: `${path}:${method}` }) } render() { const { // for self operationServers, pathServers, // util getComponent } = this.props if(!operationServers && !pathServers) { return null } const Servers = getComponent("Servers") const serversToDisplay = operationServers || pathServers const displaying = operationServers ? "operation" : "path" return <div className="opblock-section operation-servers"> <div className="opblock-section-header"> <div className="tab-header"> <h4 className="opblock-title">Servers</h4> </div> </div> <div className="opblock-description-wrapper"> <h4 className="message"> These {displaying}-level options override the global server options. </h4> <Servers servers={serversToDisplay} currentServer={this.getSelectedServer()} setSelectedServer={this.setSelectedServer} setServerVariableValue={this.setServerVariableValue} getServerVariable={this.getServerVariable} getEffectiveServerValue={this.getEffectiveServerValue} /> </div> </div> } }
JSX
5
ilozano2/swagger-ui
src/core/plugins/oas3/components/operation-servers.jsx
[ "Apache-2.0" ]
#include "script_component.hpp" /* Name: TFAR_fnc_revealInArea Author: Dimitri Yuri, 2600K, Dedmen, Dorbedo Event called upon receving a radio call Arguments: 0: unit to be revealed <OBJECT> 1: distance <OBJECT|ARRAY> Return Value: None Example: [_unit, 50] call TFAR_ai_hearing_fnc_revealInArea; Public: Yes */ params [["_unit", objNull, [objNull, []]], ["_distance", 5, [0]]]; TRACE_2(_unit,_distance); { if (!(isPlayer _x) && {!((vehicle _x) call TFAR_fnc_isVehicleIsolated)} && {_x knowsAbout _unit <= 1.5} && {((_x getVariable [QGVAR(lastReveal), 0]) - CBA_missiontime) < -20}) then { _x setVariable [QGVAR(lastReveal), CBA_missiontime]; private _value = linearConversion [0, _distance, _unit distance _x, 3.5, 1.5, true]; TRACE_3("Revealing Unit",_unit,_x,_value); [QGVAR(reveal), [_x, _unit, _value], _x] call CBA_fnc_targetEvent; }; nil } count (_unit nearEntities ["CAManBase", _distance * 0.95]);
SQF
4
MrDj200/task-force-arma-3-radio
addons/ai_hearing/functions/fnc_revealInArea.sqf
[ "RSA-MD" ]
contract_no,fund_seq_no,term_no,contract_type,internal_transfer_tag,prin_amt,start_date,end_date,region_code,credit_code 2020061000019011020164030595,202006100001901102016403059520200629,1,01,N,356,20200210,20200720,000000, 2020061000019011020164030596,202006100001901102016403059520200628,1,01,N,3561,20200310,20200720,000001, 2020061000019011020164030597,202006100001901102016403059520200627,1,01,N,3562,20200410,20200720,000002,33 2020061000019011020164030598,108319xx0185-202006100001901102016403059520200626,12,02,Y,26368,20200510,20200620,000003, 2020061000019011020164030599,202006100001901102016403059520200625,1,01,N,3960,20200610,20200720,000005,999
CSV
2
WizardXiao/tidb
br/tests/lightning_column_permutation/data/perm.test_perm.0.csv
[ "Apache-2.0" ]
#!/bin/bash set -e trap "echo Exit; exit;" SIGINT SIGTERM CORE_URL="https://src.chromium.org/blink/trunk/Source/core/" MODULE_URL="https://src.chromium.org/blink/trunk/Source/modules/" mkdir -p blink-idl/core mkdir -p blink-idl/modules echo "Fetching core idl files..." rm tmp/ -rf svn co $CORE_URL tmp -q for IDL in $(find tmp/ -iname '*.idl' -type f -printf '%P\n') do echo "- $IDL" mv "tmp/$IDL" blink-idl/core done echo "Fetching modules idl files..." rm tmp/ -rf svn co $MODULE_URL tmp -q for IDL in $(find tmp/ -iname '*.idl' -type f -printf '%P\n') do echo "- $IDL" mv "tmp/$IDL" blink-idl/modules done rm tmp/ -rf
Shell
3
coreyscherbing/angular
packages/zone.js/scripts/grab-blink-idl.sh
[ "MIT" ]
#version 3.6; // Right-handed coordinate system in which the z-axis points upwards camera { location <30,-50,25> sky z right -0.05*x*image_width/image_height up 0.05*z look_at <0,0,0> } // White background background{rgb 1} // Two lights with slightly different colors light_source{<-8,-20,30> color rgb <0.77,0.75,0.75>} light_source{<25,-12,12> color rgb <0.38,0.40,0.40>} // Radius of the Voronoi cell network #declare r=0.008; // Voronoi cells union{ #include "FRAME" pigment{rgb <1,0.4,0.45>} finish{specular 0.5 ambient 0.42} }
POV-Ray SDL
3
softwarecapital/chr1shr.voro
examples/no_release/rad_test.pov
[ "BSD-3-Clause-LBNL" ]
# This script implements a toolkit for counting active S-boxes using Mixed-Integer # Linear Programming for Klein from the paper by N. Mouha, Q. Wang, D. Gu, and B. Preneel, # "Differential and Linear Cryptanalysis using Mixed-Integer Linear Programming," # in Information Security and Cryptology - Inscrypt 2011, # Lecture Notes in Computer Science, Springer-Verlag, 20 pages, 2011."(available at # http://www.cosic.esat.kuleuven.be/publications/article-2080.pdf) # and was downloaded from (http://www.ecrypt.eu.org/tools/) # # This work was done in the context of an internship done at NXP # under supervision of Ventzislav Nikov <vetnzislav.nikov@nxp.com> # and is published under MIT license: # ============================================================================= # Copyright (C) 2012 Laura Winnen <laura.winnen@gmail.com> # # Permission is hereby granted, free of charge, to any person obtaining a copy # of this software and associated documentation files (the "Software"), to deal # in the Software without restriction, including without limitation the rights # to use, copy, modify, merge, publish, distribute, sublicense, and/or sell # copies of the Software, and to permit persons to whom the Software is # furnished to do so, subject to the following conditions: # # The above copyright notice and this permission notice shall be included in # all copies or substantial portions of the Software. # # THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR # IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, # FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE # AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER # LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, # OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN # THE SOFTWARE. #============================================================================= #-- Klein -- # Counting the minimal number of active S-boxes for Klein using "Coin" solver in Sage. # (at least version 5.0 is required, other solvers are possible) # - Differential cryptanalysis non-related key setting # - Any number of rounds (default 5) #Writes the constraints implied by the mixNibbles operation to the file f #in: i1,i2,i3,i4,i5,i6,i7,i8 (nibble inputs to MN), o1,o2,o3,o4,o5,o6,o7,o8 (nibble outputs from MN), m1,m2,m3,m4 (byte inputs to MN), #mo1,mo2,mo3,mo4 (byte inputs to MN), d (dummy variable), f (file to write to) #out: \ def EqMC(i1,i2,i3,i4,i5,i6,i7,i8,o1,o2,o3,o4,o5,o6,o7,o8,m1,m2,m3,m4,mo1,mo2,mo3,mo4,d,f): f.write("p.add_constraint(x["+str(i1)+"] + x["+str(i2)+"] - m["+str(m1)+"] >= 0)"+'\n') f.write("p.add_constraint(x["+str(i3)+"] + x["+str(i4)+"] - m["+str(m2)+"] >= 0)"+'\n') f.write("p.add_constraint(x["+str(i5)+"] + x["+str(i6)+"] - m["+str(m3)+"] >= 0)"+'\n') f.write("p.add_constraint(x["+str(i7)+"] + x["+str(i8)+"] - m["+str(m4)+"] >= 0)"+'\n') f.write("p.add_constraint(m["+str(m1)+"] - x["+str(i1)+"] >= 0)"+'\n') f.write("p.add_constraint(m["+str(m1)+"] - x["+str(i2)+"] >= 0)"+'\n') f.write("p.add_constraint(m["+str(m2)+"] - x["+str(i3)+"] >= 0)"+'\n') f.write("p.add_constraint(m["+str(m2)+"] - x["+str(i4)+"] >= 0)"+'\n') f.write("p.add_constraint(m["+str(m3)+"] - x["+str(i5)+"] >= 0)"+'\n') f.write("p.add_constraint(m["+str(m3)+"] - x["+str(i6)+"] >= 0)"+'\n') f.write("p.add_constraint(m["+str(m4)+"] - x["+str(i7)+"] >= 0)"+'\n') f.write("p.add_constraint(m["+str(m4)+"] - x["+str(i8)+"] >= 0)"+'\n') #MC operation has differential/linear branch number equal to 5 f.write("p.add_constraint(m["+str(m1)+"] + m["+str(m2)+"] + m["+str(m3)+"] + m["+str(m4)+"] + m["+str(mo1)+"] + m["+str(mo2)+"] + m["+str(mo3)+"] + m["+str(mo4)+"] - 5*d["+str(d)+"] >= 0)"+'\n') f.write("p.add_constraint(d["+str(d)+"] - m["+str(m1)+"] >= 0)"+'\n') f.write("p.add_constraint(d["+str(d)+"] - m["+str(m2)+"] >= 0)"+'\n') f.write("p.add_constraint(d["+str(d)+"] - m["+str(m3)+"] >= 0)"+'\n') f.write("p.add_constraint(d["+str(d)+"] - m["+str(m4)+"] >= 0)"+'\n') f.write("p.add_constraint(d["+str(d)+"] - m["+str(mo1)+"] >= 0)"+'\n') f.write("p.add_constraint(d["+str(d)+"] - m["+str(mo2)+"] >= 0)"+'\n') f.write("p.add_constraint(d["+str(d)+"] - m["+str(mo3)+"] >= 0)"+'\n') f.write("p.add_constraint(d["+str(d)+"] - m["+str(mo4)+"] >= 0)"+'\n') f.write("p.add_constraint(x["+str(o1)+"] + x["+str(o2)+"] - m["+str(mo1)+"] >= 0)"+'\n') f.write("p.add_constraint(x["+str(o3)+"] + x["+str(o4)+"] - m["+str(mo2)+"] >= 0)"+'\n') f.write("p.add_constraint(x["+str(o5)+"] + x["+str(o6)+"] - m["+str(mo3)+"] >= 0)"+'\n') f.write("p.add_constraint(x["+str(o7)+"] + x["+str(o8)+"] - m["+str(mo4)+"] >= 0)"+'\n') f.write("p.add_constraint(m["+str(mo1)+"] - x["+str(o1)+"] >= 0)"+'\n') f.write("p.add_constraint(m["+str(mo1)+"] - x["+str(o2)+"] >= 0)"+'\n') f.write("p.add_constraint(m["+str(mo2)+"] - x["+str(o3)+"] >= 0)"+'\n') f.write("p.add_constraint(m["+str(mo2)+"] - x["+str(o4)+"] >= 0)"+'\n') f.write("p.add_constraint(m["+str(mo3)+"] - x["+str(o5)+"] >= 0)"+'\n') f.write("p.add_constraint(m["+str(mo3)+"] - x["+str(o6)+"] >= 0)"+'\n') f.write("p.add_constraint(m["+str(mo4)+"] - x["+str(o7)+"] >= 0)"+'\n') f.write("p.add_constraint(m["+str(mo4)+"] - x["+str(o8)+"] >= 0)"+'\n') #Updates a and O for the S-box transformation #in: a (difference vector), O (list of indices for objective function) #out: a (difference vector), O (list of indices for objective function) def subNibbles(a,O): for i in range(0,16): O.append(a[i]) return [a,O] #Updates a for the Rotate Nibbles transformation #in: a (difference vector) #out: a (difference vector) def rotateNibbles(a): new_a=[] for i in range(0,16): new_a.append(a[(i+4)%16]) a=new_a return a #Updates a,next,dummy,CMC for the mixNibbles operation #in: a (difference vector), m (byte difference vector for mixNibbles), next (the next unused index for a), dummy (the next unused #index for d), next_m (the next unused index for m), CMC (list of constraints implied by the mixNibbles operation) #out: a (difference vector), m (byte difference vector for mixNibbles), next (the next unused index for a), dummy (the next unused #index for d), next_m (the next unused index for m), CMC (list of constraints implied by the mixNibbles operation) def mixNibbles(a,m,next,dummy,next_m,CMC): CMC.append([a[0],a[1],a[2],a[3],a[4],a[5],a[6],a[7],next,next+1,next+2,next+3,next+4,next+5,next+6,next+7,m[0],m[1],m[2],m[3],next_m,next_m+1,next_m+2,next_m+3,dummy]) dummy=dummy+1 next_m=next_m+4 for i in range(0,8): a[i]=next next=next+1 for i in range(0,4): m[i]=next_m next_m=next_m+1 CMC.append([a[8],a[9],a[10],a[11],a[12],a[13],a[14],a[15],next,next+1,next+2,next+3,next+4,next+5,next+6,next+7,m[0],m[1],m[2],m[3],next_m,next_m+1,next_m+2,next_m+3,dummy]) dummy=dummy+1 next_m=next_m+4 for i in range(8,16): a[i]=next next=next+1 for i in range(0,4): m[i]=next_m next_m=next_m+1 return [a,m,next,dummy,next_m,CMC] #Updates a,m,next,dummy,next_m,O and CMC after one round #in: a (difference vector), m (byte difference vector for mixNibbles), next (the next unused index for a), dummy (the next unused #index for d), next_m (the next unused index for m), O (list of indices for objective function), CMC (list of constraints implied by #the mixNibbles operation) #out: a (difference vector), m (byte difference vector for mixNibbles), next (the next unused index for a), dummy (the next unused #index for d), next_m (the next unused index for m), O (list of indices for objective function), CMC (list of constraints implied by #the mixNibbles operation) def round(a,m,next,dummy,next_m,O,CMC): S=subNibbles(a,O) a=S[0] O=S[1] a=rotateNibbles(a) M=mixNibbles(a,m,next,dummy,next_m,CMC) a=M[0] m=M[1] next=M[2] dummy=M[3] next_m=M[4] CMC=M[5] return [a,m,next,dummy,next_m,O,CMC] #Generates a MILP (Sage) for calculating the minimum number of active S-boxes for 'rounds' rounds of Klein with in the non-related key #setting and solves this program using the "Coin" solver #in: rounds (the number of rounds) #out: the MILP (for calculating the minimum number of active S-boxes for 'rounds' rounds of Klein in the non-related key setting and #prints the solution of this program def giveEquationsKleinandSolve(rounds): next=0 #next unused state/key variable index dummy=0 #next unused dummy variable index next_m=4 #next unused state byte variable index a=[] #state variable k=[] #key variable m=[0,1,2,3] #state byte variable O=[] #list of indices for objective function CMC=[] #list of constraints implied by the MixColumn operation CA=[] #list of indices for constraint to ensure not all inputs are zero for i in range(0,16): a.append(next) CA.append(next) next=next+1 for i in range(0,rounds): NR=round(a,m,next,dummy,next_m,O,CMC) a=NR[0] m=NR[1] next=NR[2] dummy=NR[3] next_m=NR[4] O=NR[5] CMC=NR[6] f = open('Eq-Klein-With-'+str(rounds)+'-Rounds-Differential.sage','w') f.write("p = MixedIntegerLinearProgram(maximization=False, solver=\"Coin\")"+'\n') f.write("x = p.new_variable(binary=True)"+'\n') f.write("d = p.new_variable(binary=True)"+'\n') f.write("m = p.new_variable(binary=True)"+'\n') f.write('\n') f.write("p.set_objective(" ) for i in range (0, len(O)-1): f.write("x["+str(O[i])+"] + ") f.write("x["+str(O[len(O)-1])+"])"+'\n') f.write('\n') f.write("p.add_constraint(") for i in range (0, len(CA)-1): f.write("x["+str(CA[i])+"] + ") f.write("x["+str(CA[len(CA)-1])+"] >= 1)"+'\n') for i in range (0, len(CMC)): EqMC(CMC[i][0],CMC[i][1],CMC[i][2],CMC[i][3],CMC[i][4],CMC[i][5],CMC[i][6],CMC[i][7],CMC[i][8],CMC[i][9],CMC[i][10],CMC[i][11],CMC[i][12],CMC[i][13],CMC[i][14],CMC[i][15],CMC[i][16],CMC[i][17],CMC[i][18],CMC[i][19],CMC[i][20],CMC[i][21],CMC[i][22],CMC[i][23],CMC[i][24],f) f.write('\n') f.write("solution=p.solve()"+'\n') f.write("print \"Minimal number of S-boxes:\", solution"+'\n') f.close() execfile('Eq-Klein-With-'+str(rounds)+'-Rounds-Differential.sage') giveEquationsKleinandSolve(4)
Sage
4
Deadlyelder/Crypto-Tools
S-Box MILP tool/Klein.sage
[ "Unlicense" ]
: consume key? if key drop tail then ; here ,file bins\mem.shellcode 16 + value mem-code variable shmem shmem off loadlib api-ms-win-core-synch-l1-2-0.dll value synch.dll synch.dll 1 dllfun WakeByAddressAll WakeByAddressAll synch.dll 4 dllfun WaitOnAddress WaitOnAddress : test mem-code shmem clone ; : >child? shmem 2 + c@ 0= ; : <child? shmem c@ ; : >child shmem 3 + c! 255 shmem 2 + c! shmem 2 + WakeByAddressAll drop ; : <child shmem 1+ c@ 0 shmem c! shmem WakeByAddressAll drop ; : read-child consume begin key? 0= while <child? if <child emit else 1 ms then repeat consume ; variable going : wait begin >child? 0= key? 0= and while 1 ms repeat ; : stream bounds do going on begin going @ while >child? if i c@ >child going off then <child? if <child emit going off then key? if consume unloop return then repeat loop ; : interact ( -- ) readline loadfile if consume .pre .s bounds do going on begin going @ while >child? if i c@ >child going off then <child? if <child emit going off then key? if consume unloop return then repeat loop ." Done loading file\n" .post then ; : wait begin >child? 0= key? 0= and while 1 ms repeat ; : xmit bounds do wait i c@ >child loop ; : send .pre readline stream read-child .post ; : test test .pre read-child .post ;
Forth
4
jephthai/EvilVM
samples/child.fth
[ "MIT" ]
;; Hello, world in Jess! (printout t "Hello from Jess!" crlf)
CLIPS
2
DBatOWL/tutorials
rule-engines/jess/src/main/resources/helloJess.clp
[ "MIT" ]
// WARNING: DO NOT EDIT THIS FILE. THIS FILE IS MANAGED BY SPRING ROO. // You may push code into the target .java compilation unit if you wish to edit any member(s). package com.journaldev.web; import com.journaldev.jpa.data.Employee; import com.journaldev.jpa.data.Phone; import com.journaldev.web.PhoneBean; import com.journaldev.web.converter.EmployeeConverter; import com.journaldev.web.util.MessageFactory; import java.util.ArrayList; import java.util.List; import javax.annotation.PostConstruct; import javax.el.ELContext; import javax.el.ExpressionFactory; import javax.faces.application.FacesMessage; import javax.faces.bean.ManagedBean; import javax.faces.bean.SessionScoped; import javax.faces.component.html.HtmlOutputText; import javax.faces.component.html.HtmlPanelGrid; import javax.faces.context.FacesContext; import javax.faces.validator.LengthValidator; import org.primefaces.component.autocomplete.AutoComplete; import org.primefaces.component.inputtext.InputText; import org.primefaces.component.message.Message; import org.primefaces.component.outputlabel.OutputLabel; import org.primefaces.context.RequestContext; import org.primefaces.event.CloseEvent; privileged aspect PhoneBean_Roo_ManagedBean { declare @type: PhoneBean: @ManagedBean(name = "phoneBean"); declare @type: PhoneBean: @SessionScoped; private String PhoneBean.name = "Phones"; private Phone PhoneBean.phone; private List<Phone> PhoneBean.allPhones; private boolean PhoneBean.dataVisible = false; private List<String> PhoneBean.columns; private HtmlPanelGrid PhoneBean.createPanelGrid; private HtmlPanelGrid PhoneBean.editPanelGrid; private HtmlPanelGrid PhoneBean.viewPanelGrid; private boolean PhoneBean.createDialogVisible = false; @PostConstruct public void PhoneBean.init() { columns = new ArrayList<String>(); columns.add("phNo"); } public String PhoneBean.getName() { return name; } public List<String> PhoneBean.getColumns() { return columns; } public List<Phone> PhoneBean.getAllPhones() { return allPhones; } public void PhoneBean.setAllPhones(List<Phone> allPhones) { this.allPhones = allPhones; } public String PhoneBean.findAllPhones() { allPhones = Phone.findAllPhones(); dataVisible = !allPhones.isEmpty(); return null; } public boolean PhoneBean.isDataVisible() { return dataVisible; } public void PhoneBean.setDataVisible(boolean dataVisible) { this.dataVisible = dataVisible; } public HtmlPanelGrid PhoneBean.getCreatePanelGrid() { if (createPanelGrid == null) { createPanelGrid = populateCreatePanel(); } return createPanelGrid; } public void PhoneBean.setCreatePanelGrid(HtmlPanelGrid createPanelGrid) { this.createPanelGrid = createPanelGrid; } public HtmlPanelGrid PhoneBean.getEditPanelGrid() { if (editPanelGrid == null) { editPanelGrid = populateEditPanel(); } return editPanelGrid; } public void PhoneBean.setEditPanelGrid(HtmlPanelGrid editPanelGrid) { this.editPanelGrid = editPanelGrid; } public HtmlPanelGrid PhoneBean.getViewPanelGrid() { return populateViewPanel(); } public void PhoneBean.setViewPanelGrid(HtmlPanelGrid viewPanelGrid) { this.viewPanelGrid = viewPanelGrid; } public HtmlPanelGrid PhoneBean.populateCreatePanel() { FacesContext facesContext = FacesContext.getCurrentInstance(); javax.faces.application.Application application = facesContext.getApplication(); ExpressionFactory expressionFactory = application.getExpressionFactory(); ELContext elContext = facesContext.getELContext(); HtmlPanelGrid htmlPanelGrid = (HtmlPanelGrid) application.createComponent(HtmlPanelGrid.COMPONENT_TYPE); OutputLabel empIdCreateOutput = (OutputLabel) application.createComponent(OutputLabel.COMPONENT_TYPE); empIdCreateOutput.setFor("empIdCreateInput"); empIdCreateOutput.setId("empIdCreateOutput"); empIdCreateOutput.setValue("Emp Id:"); htmlPanelGrid.getChildren().add(empIdCreateOutput); AutoComplete empIdCreateInput = (AutoComplete) application.createComponent(AutoComplete.COMPONENT_TYPE); empIdCreateInput.setId("empIdCreateInput"); empIdCreateInput.setValueExpression("value", expressionFactory.createValueExpression(elContext, "#{phoneBean.phone.empId}", Employee.class)); empIdCreateInput.setCompleteMethod(expressionFactory.createMethodExpression(elContext, "#{phoneBean.completeEmpId}", List.class, new Class[] { String.class })); empIdCreateInput.setDropdown(true); empIdCreateInput.setValueExpression("var", expressionFactory.createValueExpression(elContext, "empId", String.class)); empIdCreateInput.setValueExpression("itemLabel", expressionFactory.createValueExpression(elContext, "#{empId.empName} #{empId.empHireDate} #{empId.empSalary} #{empId.empId}", String.class)); empIdCreateInput.setValueExpression("itemValue", expressionFactory.createValueExpression(elContext, "#{empId}", Employee.class)); empIdCreateInput.setConverter(new EmployeeConverter()); empIdCreateInput.setRequired(false); htmlPanelGrid.getChildren().add(empIdCreateInput); Message empIdCreateInputMessage = (Message) application.createComponent(Message.COMPONENT_TYPE); empIdCreateInputMessage.setId("empIdCreateInputMessage"); empIdCreateInputMessage.setFor("empIdCreateInput"); empIdCreateInputMessage.setDisplay("icon"); htmlPanelGrid.getChildren().add(empIdCreateInputMessage); OutputLabel phNoCreateOutput = (OutputLabel) application.createComponent(OutputLabel.COMPONENT_TYPE); phNoCreateOutput.setFor("phNoCreateInput"); phNoCreateOutput.setId("phNoCreateOutput"); phNoCreateOutput.setValue("Ph No:"); htmlPanelGrid.getChildren().add(phNoCreateOutput); InputText phNoCreateInput = (InputText) application.createComponent(InputText.COMPONENT_TYPE); phNoCreateInput.setId("phNoCreateInput"); phNoCreateInput.setValueExpression("value", expressionFactory.createValueExpression(elContext, "#{phoneBean.phone.phNo}", String.class)); LengthValidator phNoCreateInputValidator = new LengthValidator(); phNoCreateInputValidator.setMaximum(30); phNoCreateInput.addValidator(phNoCreateInputValidator); phNoCreateInput.setRequired(true); htmlPanelGrid.getChildren().add(phNoCreateInput); Message phNoCreateInputMessage = (Message) application.createComponent(Message.COMPONENT_TYPE); phNoCreateInputMessage.setId("phNoCreateInputMessage"); phNoCreateInputMessage.setFor("phNoCreateInput"); phNoCreateInputMessage.setDisplay("icon"); htmlPanelGrid.getChildren().add(phNoCreateInputMessage); return htmlPanelGrid; } public HtmlPanelGrid PhoneBean.populateEditPanel() { FacesContext facesContext = FacesContext.getCurrentInstance(); javax.faces.application.Application application = facesContext.getApplication(); ExpressionFactory expressionFactory = application.getExpressionFactory(); ELContext elContext = facesContext.getELContext(); HtmlPanelGrid htmlPanelGrid = (HtmlPanelGrid) application.createComponent(HtmlPanelGrid.COMPONENT_TYPE); OutputLabel empIdEditOutput = (OutputLabel) application.createComponent(OutputLabel.COMPONENT_TYPE); empIdEditOutput.setFor("empIdEditInput"); empIdEditOutput.setId("empIdEditOutput"); empIdEditOutput.setValue("Emp Id:"); htmlPanelGrid.getChildren().add(empIdEditOutput); AutoComplete empIdEditInput = (AutoComplete) application.createComponent(AutoComplete.COMPONENT_TYPE); empIdEditInput.setId("empIdEditInput"); empIdEditInput.setValueExpression("value", expressionFactory.createValueExpression(elContext, "#{phoneBean.phone.empId}", Employee.class)); empIdEditInput.setCompleteMethod(expressionFactory.createMethodExpression(elContext, "#{phoneBean.completeEmpId}", List.class, new Class[] { String.class })); empIdEditInput.setDropdown(true); empIdEditInput.setValueExpression("var", expressionFactory.createValueExpression(elContext, "empId", String.class)); empIdEditInput.setValueExpression("itemLabel", expressionFactory.createValueExpression(elContext, "#{empId.empName} #{empId.empHireDate} #{empId.empSalary} #{empId.empId}", String.class)); empIdEditInput.setValueExpression("itemValue", expressionFactory.createValueExpression(elContext, "#{empId}", Employee.class)); empIdEditInput.setConverter(new EmployeeConverter()); empIdEditInput.setRequired(false); htmlPanelGrid.getChildren().add(empIdEditInput); Message empIdEditInputMessage = (Message) application.createComponent(Message.COMPONENT_TYPE); empIdEditInputMessage.setId("empIdEditInputMessage"); empIdEditInputMessage.setFor("empIdEditInput"); empIdEditInputMessage.setDisplay("icon"); htmlPanelGrid.getChildren().add(empIdEditInputMessage); OutputLabel phNoEditOutput = (OutputLabel) application.createComponent(OutputLabel.COMPONENT_TYPE); phNoEditOutput.setFor("phNoEditInput"); phNoEditOutput.setId("phNoEditOutput"); phNoEditOutput.setValue("Ph No:"); htmlPanelGrid.getChildren().add(phNoEditOutput); InputText phNoEditInput = (InputText) application.createComponent(InputText.COMPONENT_TYPE); phNoEditInput.setId("phNoEditInput"); phNoEditInput.setValueExpression("value", expressionFactory.createValueExpression(elContext, "#{phoneBean.phone.phNo}", String.class)); LengthValidator phNoEditInputValidator = new LengthValidator(); phNoEditInputValidator.setMaximum(30); phNoEditInput.addValidator(phNoEditInputValidator); phNoEditInput.setRequired(true); htmlPanelGrid.getChildren().add(phNoEditInput); Message phNoEditInputMessage = (Message) application.createComponent(Message.COMPONENT_TYPE); phNoEditInputMessage.setId("phNoEditInputMessage"); phNoEditInputMessage.setFor("phNoEditInput"); phNoEditInputMessage.setDisplay("icon"); htmlPanelGrid.getChildren().add(phNoEditInputMessage); return htmlPanelGrid; } public HtmlPanelGrid PhoneBean.populateViewPanel() { FacesContext facesContext = FacesContext.getCurrentInstance(); javax.faces.application.Application application = facesContext.getApplication(); ExpressionFactory expressionFactory = application.getExpressionFactory(); ELContext elContext = facesContext.getELContext(); HtmlPanelGrid htmlPanelGrid = (HtmlPanelGrid) application.createComponent(HtmlPanelGrid.COMPONENT_TYPE); HtmlOutputText empIdLabel = (HtmlOutputText) application.createComponent(HtmlOutputText.COMPONENT_TYPE); empIdLabel.setId("empIdLabel"); empIdLabel.setValue("Emp Id:"); htmlPanelGrid.getChildren().add(empIdLabel); HtmlOutputText empIdValue = (HtmlOutputText) application.createComponent(HtmlOutputText.COMPONENT_TYPE); empIdValue.setValueExpression("value", expressionFactory.createValueExpression(elContext, "#{phoneBean.phone.empId}", Employee.class)); empIdValue.setConverter(new EmployeeConverter()); htmlPanelGrid.getChildren().add(empIdValue); HtmlOutputText phNoLabel = (HtmlOutputText) application.createComponent(HtmlOutputText.COMPONENT_TYPE); phNoLabel.setId("phNoLabel"); phNoLabel.setValue("Ph No:"); htmlPanelGrid.getChildren().add(phNoLabel); HtmlOutputText phNoValue = (HtmlOutputText) application.createComponent(HtmlOutputText.COMPONENT_TYPE); phNoValue.setId("phNoValue"); phNoValue.setValueExpression("value", expressionFactory.createValueExpression(elContext, "#{phoneBean.phone.phNo}", String.class)); htmlPanelGrid.getChildren().add(phNoValue); return htmlPanelGrid; } public Phone PhoneBean.getPhone() { if (phone == null) { phone = new Phone(); } return phone; } public void PhoneBean.setPhone(Phone phone) { this.phone = phone; } public List<Employee> PhoneBean.completeEmpId(String query) { List<Employee> suggestions = new ArrayList<Employee>(); for (Employee employee : Employee.findAllEmployees()) { String employeeStr = String.valueOf(employee.getEmpName() + " " + employee.getEmpHireDate() + " " + employee.getEmpSalary() + " " + employee.getEmpId()); if (employeeStr.toLowerCase().startsWith(query.toLowerCase())) { suggestions.add(employee); } } return suggestions; } public String PhoneBean.onEdit() { return null; } public boolean PhoneBean.isCreateDialogVisible() { return createDialogVisible; } public void PhoneBean.setCreateDialogVisible(boolean createDialogVisible) { this.createDialogVisible = createDialogVisible; } public String PhoneBean.displayList() { createDialogVisible = false; findAllPhones(); return "phone"; } public String PhoneBean.displayCreateDialog() { phone = new Phone(); createDialogVisible = true; return "phone"; } public String PhoneBean.persist() { String message = ""; if (phone.getPhId() != null) { phone.merge(); message = "message_successfully_updated"; } else { phone.persist(); message = "message_successfully_created"; } RequestContext context = RequestContext.getCurrentInstance(); context.execute("createDialogWidget.hide()"); context.execute("editDialogWidget.hide()"); FacesMessage facesMessage = MessageFactory.getMessage(message, "Phone"); FacesContext.getCurrentInstance().addMessage(null, facesMessage); reset(); return findAllPhones(); } public String PhoneBean.delete() { phone.remove(); FacesMessage facesMessage = MessageFactory.getMessage("message_successfully_deleted", "Phone"); FacesContext.getCurrentInstance().addMessage(null, facesMessage); reset(); return findAllPhones(); } public void PhoneBean.reset() { phone = null; createDialogVisible = false; } public void PhoneBean.handleDialogClose(CloseEvent event) { reset(); } }
AspectJ
3
ghiloufibelgacem/jornaldev
PrimeFaces/Primefaces-SpringRoo-Hibernate-Sample/src/main/java/com/journaldev/web/PhoneBean_Roo_ManagedBean.aj
[ "MIT" ]
/* * Copyright 2012-2020 the original author or authors. * * Licensed under the Apache License, Version 2.0 (the "License"); * you may not use this file except in compliance with the License. * You may obtain a copy of the License at * * https://www.apache.org/licenses/LICENSE-2.0 * * Unless required by applicable law or agreed to in writing, software * distributed under the License is distributed on an "AS IS" BASIS, * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. * See the License for the specific language governing permissions and * limitations under the License. */ package org.springframework.boot.actuate.health; import java.util.Collections; import java.util.Iterator; import org.junit.jupiter.api.BeforeEach; import org.junit.jupiter.api.Test; import static org.assertj.core.api.Assertions.assertThat; import static org.assertj.core.api.Assertions.assertThatIllegalArgumentException; import static org.assertj.core.api.Assertions.assertThatIllegalStateException; import static org.mockito.BDDMockito.given; import static org.mockito.Mockito.mock; /** * Tests for {@link DefaultContributorRegistry}. * * @author Phillip Webb * @author Vedran Pavic * @author Stephane Nicoll */ abstract class DefaultContributorRegistryTests { private final HealthIndicator one = mock(HealthIndicator.class); private final HealthIndicator two = mock(HealthIndicator.class); private ContributorRegistry<HealthIndicator> registry; @BeforeEach void setUp() { given(this.one.health()).willReturn(new Health.Builder().unknown().withDetail("1", "1").build()); given(this.two.health()).willReturn(new Health.Builder().unknown().withDetail("2", "2").build()); this.registry = new DefaultContributorRegistry<>(); } @Test void createWhenContributorsIsNullThrowsException() { assertThatIllegalArgumentException().isThrownBy(() -> new DefaultContributorRegistry<>(null)) .withMessage("Contributors must not be null"); } @Test void createWhenNameFactoryIsNullThrowsException() { assertThatIllegalArgumentException() .isThrownBy(() -> new DefaultContributorRegistry<>(Collections.emptyMap(), null)) .withMessage("NameFactory must not be null"); } @Test void createUsesHealthIndicatorNameFactoryByDefault() { this.registry = new DefaultContributorRegistry<>(Collections.singletonMap("oneHealthIndicator", this.one)); assertThat(this.registry.getContributor("oneHealthIndicator")).isNull(); assertThat(this.registry.getContributor("one")).isNotNull(); } @Test void createWithCustomNameFactoryAppliesFunctionToName() { this.registry = new DefaultContributorRegistry<>(Collections.singletonMap("one", this.one), this::reverse); assertThat(this.registry.getContributor("one")).isNull(); assertThat(this.registry.getContributor("eno")).isNotNull(); } @Test void registerContributorWhenNameIsNullThrowsException() { assertThatIllegalArgumentException().isThrownBy(() -> this.registry.registerContributor(null, this.one)) .withMessage("Name must not be null"); } @Test void registerContributorWhenContributorIsNullThrowsException() { assertThatIllegalArgumentException().isThrownBy(() -> this.registry.registerContributor("one", null)) .withMessage("Contributor must not be null"); } @Test void registerContributorRegistersContributors() { this.registry.registerContributor("one", this.one); this.registry.registerContributor("two", this.two); assertThat(this.registry).hasSize(2); assertThat(this.registry.getContributor("one")).isSameAs(this.one); assertThat(this.registry.getContributor("two")).isSameAs(this.two); } @Test void registerContributorWhenNameAlreadyUsedThrowsException() { this.registry.registerContributor("one", this.one); assertThatIllegalStateException().isThrownBy(() -> this.registry.registerContributor("one", this.two)) .withMessageContaining("A contributor named \"one\" has already been registered"); } @Test void registerContributorUsesNameFactory() { this.registry.registerContributor("oneHealthIndicator", this.one); assertThat(this.registry.getContributor("oneHealthIndicator")).isNull(); assertThat(this.registry.getContributor("one")).isNotNull(); } @Test void unregisterContributorUnregistersContributor() { this.registry.registerContributor("one", this.one); this.registry.registerContributor("two", this.two); assertThat(this.registry).hasSize(2); HealthIndicator two = this.registry.unregisterContributor("two"); assertThat(two).isSameAs(this.two); assertThat(this.registry).hasSize(1); } @Test void unregisterContributorWhenUnknownReturnsNull() { this.registry.registerContributor("one", this.one); assertThat(this.registry).hasSize(1); HealthIndicator two = this.registry.unregisterContributor("two"); assertThat(two).isNull(); assertThat(this.registry).hasSize(1); } @Test void unregisterContributorUsesNameFactory() { this.registry.registerContributor("oneHealthIndicator", this.one); assertThat(this.registry.getContributor("oneHealthIndicator")).isNull(); assertThat(this.registry.getContributor("one")).isNotNull(); } @Test void getContributorReturnsContributor() { this.registry.registerContributor("one", this.one); assertThat(this.registry.getContributor("one")).isEqualTo(this.one); } @Test void iteratorIteratesContributors() { this.registry.registerContributor("one", this.one); this.registry.registerContributor("two", this.two); Iterator<NamedContributor<HealthIndicator>> iterator = this.registry.iterator(); NamedContributor<HealthIndicator> first = iterator.next(); NamedContributor<HealthIndicator> second = iterator.next(); assertThat(iterator.hasNext()).isFalse(); assertThat(first.getName()).isEqualTo("one"); assertThat(first.getContributor()).isEqualTo(this.one); assertThat(second.getName()).isEqualTo("two"); assertThat(second.getContributor()).isEqualTo(this.two); } private String reverse(String name) { return new StringBuilder(name).reverse().toString(); } }
Java
5
techAi007/spring-boot
spring-boot-project/spring-boot-actuator/src/test/java/org/springframework/boot/actuate/health/DefaultContributorRegistryTests.java
[ "Apache-2.0" ]
// Copyright (c) 2016-2021 Bluespec, Inc. All Rights Reserved. // This module transforms an L1's L2-facing interface // (i.e., l1_to_l2_client and l2_to_l1_server) // to the ChildCacheToParent interface required by the L2. package L1_IFC_Adapter; // ================================================================ export mkL1_IFC_Adapter; // ================================================================ // BSV lib imports import ConfigReg :: *; import Vector :: *; import FIFOF :: *; import GetPut :: *; import ClientServer :: *; import Connectable :: *; // ---------------- // BSV additional libs import Cur_Cycle :: *; import GetPut_Aux :: *; import Semi_FIFOF :: *; // ---------------- // Project imports import MMU_Cache_Common :: *; import Cache_Decls :: *; import LLCache_Aux :: *; import CacheUtils :: *; import CCTypes :: *; // ================================================================ // Interface type-conversion: // from L1 Cache's L2_to_L2_Client and L2_to_L1_Server interfaces // to L1LLConnect's ChildCacheToParent interface function CCTypes::Msi fv_Meta_State_to_Msi (Meta_State s); return (case (s) META_INVALID: I; META_SHARED: S; META_EXCLUSIVE: E; META_MODIFIED: M; endcase); endfunction function Meta_State fv_Msi_to_Meta_State (CCTypes::Msi s); return (case (s) I: META_INVALID; S: META_SHARED; E: META_EXCLUSIVE; M: META_MODIFIED; endcase); endfunction function Maybe #(CCTypes::Line) fv_M_CLine_to_M_Line (Maybe #(CLine) m_cline); return (case (m_cline) matches tagged Invalid: tagged Invalid; tagged Valid .x: tagged Valid (unpack (x)); endcase); endfunction function Maybe #(CLine) fv_M_Line_to_M_CLine (Maybe #(CCTypes::Line) m_line); return (case (m_line) matches tagged Invalid: tagged Invalid; tagged Valid .x: tagged Valid (pack (x)); endcase); endfunction // ---------------- module mkL1_IFC_Adapter #(Integer verbosity_L1_L2, Integer id, Client_Semi_FIFOF #(L1_to_L2_Req, L2_to_L1_Rsp) l1_to_l2_client, Server_Semi_FIFOF #(L2_to_L1_Req, L1_to_L2_Rsp) l2_to_l1_server) (ChildCacheToParent #(L1Way, void)); interface FifoDeq rsToP; // #(CRsMsg #(void)) method Bool notEmpty; return l2_to_l1_server.response.notEmpty; endmethod method Action deq; l2_to_l1_server.response.deq; if (verbosity_L1_L2 >= 2) begin L1_to_L2_Rsp rsp = l2_to_l1_server.response.first; $display ("%0d: L1_IFC_Adapter [%0d]: ", cur_cycle, id, fshow_L1_to_L2_Rsp (rsp)); end endmethod method CRsMsg #(void) first; L1_to_L2_Rsp rsp = l2_to_l1_server.response.first; let cRsMsg = CRsMsg {addr: rsp.addr, toState: fv_Meta_State_to_Msi (rsp.to_state), data: fv_M_CLine_to_M_Line (rsp.m_cline), child: ? }; return cRsMsg; endmethod endinterface interface FifoDeq rqToP; // #(CRqMsg #(L1Way, void)) method Bool notEmpty; return l1_to_l2_client.request.notEmpty; endmethod method Action deq; l1_to_l2_client.request.deq; if (verbosity_L1_L2 >= 2) begin L1_to_L2_Req req = l1_to_l2_client.request.first; $display ("%0d: L1_IFC_Adapter [%0d]: ", cur_cycle, id, fshow_L1_to_L2_Req (req)); end endmethod method CRqMsg #(L1Way, void) first; L1_to_L2_Req req = l1_to_l2_client.request.first; let cRqMsg = CRqMsg {addr: req.addr, fromState: fv_Meta_State_to_Msi (req.from_state), toState: fv_Meta_State_to_Msi (req.to_state), canUpToE: req.can_up_to_E, id: ?, child: ? }; return cRqMsg; endmethod endinterface interface FifoEnq fromP; // #(PRqRsMsg #(L1Way, void) method Bool notFull; return (l1_to_l2_client.response.notFull && l2_to_l1_server.request.notFull); endmethod method Action enq (PRqRsMsg #(L1Way, void) x); case (x) matches tagged PRq .prq: begin let req = L2_to_L1_Req {addr: prq.addr, to_state: fv_Msi_to_Meta_State (prq.toState) }; // Note: prq.child is discarded l2_to_l1_server.request.enq (req); if (verbosity_L1_L2 >= 2) $display ("%0d: L1_IFC_Adapter [%0d]: ", cur_cycle, id, fshow_L2_to_L1_Req (req)); end tagged PRs .prs: begin let rsp = L2_to_L1_Rsp {addr: prs.addr, to_state: fv_Msi_to_Meta_State (prs.toState), m_cline: fv_M_Line_to_M_CLine (prs.data) }; l1_to_l2_client.response.enq (rsp); if (verbosity_L1_L2 >= 2) $display ("%0d: L1_IFC_Adapter [%0d]: ", cur_cycle, id, fshow_L2_to_L1_Rsp (rsp)); end endcase endmethod endinterface endmodule // ================================================================ endpackage
Bluespec
5
darius-bluespec/Flute
src_Core/Near_Mem_VM_WB_L1_L2/L1_IFC_Adapter.bsv
[ "Apache-2.0" ]
fn this_is_obviously(not: a, toml: file) { }
TOML
0
Eric-Arellano/rust
src/tools/clippy/tests/ui-toml/bad_toml/clippy.toml
[ "ECL-2.0", "Apache-2.0", "MIT-0", "MIT" ]
economy fred add dgs5,dgs10 pred rmv dgs10 reset add dgs2 pred mc regression lstm --epochs 2 knn exit
Gosu
0
minhhoang1023/GamestonkTerminal
scripts/test_economy_fred_pred.gst
[ "MIT" ]
--TEST-- JIT ASSIGN: Assign to typed reference should return modified value --INI-- opcache.enable=1 opcache.enable_cli=1 opcache.file_update_protection=0 opcache.jit_buffer_size=1M opcache.protect_memory=1 --FILE-- <?php class Test { public ?string $prop; } function test($val) { $obj = new Test; $ref =& $obj->prop; var_dump($ref = $val); } test(0); ?> --EXPECT-- string(1) "0"
PHP
4
NathanFreeman/php-src
ext/opcache/tests/jit/assign_041.phpt
[ "PHP-3.01" ]
/* Copyright © 2011, 2012 MLstate This file is part of Opa. Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. */ import stdlib.core.queue /** * Authentication information. * We should really parametrise the socket pool with this * type but that would propagate for miles and miles. * For now we just provide two general-purpose ints and a bool * (see Postgres for the use of the ints). */ type SocketPool.auth = { authenticated:bool; i1:int; i2:int } /** * A SocketPool.result is either a socket or a string which describes the socket error. */ type SocketPool.result = outcome(Socket.t, string) /** * A SocketPool result with an authorisation flag. */ type SocketPool.auth_result = outcome((Socket.t,SocketPool.auth), string) /** * Some protocols have a preamble to trigger SSL authentication (see Postgres). */ type SocketPool.preamble = Socket.t -> SocketPool.result /** * Configuration of socket pool. */ type SocketPool.conf = { /** Indicates if the pool should output a trace of its action */ verbose : bool; /** The default hint of the allocated mailboxes */ hint : int; /** The maximum number of allocated socket */ max : int; } @private type SocketPool.waiter = {waiter:continuation(SocketPool.result)} / {auth_waiter:continuation(SocketPool.auth_result)} @private type SocketPool.state = { host : Socket.host; secure_type : option(SSL.secure_type); preamble : option(SocketPool.preamble); conf : SocketPool.conf; sockets: list(Socket.t); auths: list(SocketPool.auth); allocated: list(Socket.t); cnt: int; queue: Queue.t(SocketPool.waiter); open_connections: intset; } @private type SocketPool.msg = {get : continuation(SocketPool.result)} / {get_auth : continuation(SocketPool.auth_result)} / {release : Socket.t} / {release_auth : (Socket.t,SocketPool.auth)} / {reconnect : Socket.host} / {getconf : continuation(SocketPool.conf)} / {updconf : SocketPool.conf -> SocketPool.conf} / {gethost : continuation(Socket.host)} / {close} / {stop} @abstract type SocketPool.t = channel(SocketPool.msg) @server_private SocketPool = {{ @private Log = {{ @private @expand gen(f, m, fn:string, msg) = if m.conf.verbose then f("SocketPool({m.host}).{fn}", msg) else void @expand info(m, fn, msg) = gen(@toplevel.Log.info, m, fn, msg) @expand debug(m, fn, msg) = gen(@toplevel.Log.debug, m, fn, msg) @expand error(m, fn, msg) = gen(@toplevel.Log.error, m, fn, msg) }} @private socket_close(conn, state) = conn_id = Socket.conn_id(conn.conn) do Log.debug(state, "SocketPool.handler", "close {conn_id}") do Socket.close(conn.conn) _ = Mailbox.reset(conn.mbox) {state with open_connections=IntSet.remove(conn_id,state.open_connections)} @private @expand monitor(__from, __state) = #<Ifstatic:SOCKET_POOL_DEBUG> do Log.debug(__state, "handler({__from})", "open={List.list_to_string(Int.to_string,IntSet.To.list(__state.open_connections))}") do Log.debug(__state, "handler({__from})", "sockets={List.list_to_string(Int.to_string,List.map((id -> Socket.conn_id(id.conn)),__state.sockets))}") do Log.debug(__state, "handler({__from})", "allocated={List.list_to_string(Int.to_string,List.map((id -> Socket.conn_id(id.conn)),__state.allocated))}") void #<Else> void #<End> @private release_socket(state:SocketPool.state, connection:Socket.t, authenticated:SocketPool.auth): Session.instruction(SocketPool.state) = do monitor("release", state) conn_id = Socket.conn_id(connection.conn) if List.exists((c -> Socket.conn_id(c.conn) == conn_id),state.allocated) then match Queue.rem(state.queue) with | ({none}, _) -> do Log.debug(state, "handler","socket back in pool {Socket.conn_id(connection.conn)}") sockets = connection +> state.sockets auths = authenticated +> state.auths conn_id = Socket.conn_id(connection.conn) allocated = List.filter((s -> Socket.conn_id(s.conn) != conn_id),state.allocated) {set={state with ~sockets; ~auths; ~allocated}} | ({some={~waiter}}, queue) -> do Log.debug(state, "handler","reallocate socket {Socket.conn_id(connection.conn)}") do Continuation.return(waiter, {success=connection}) {set={state with ~queue}} | ({some={~auth_waiter}}, queue) -> do Log.debug(state, "handler","reallocate socket {Socket.conn_id(connection.conn)}") do Continuation.return(auth_waiter, {success=(connection,authenticated)}) {set={state with ~queue}} end else do Log.debug(state, "handler","drop socket {Socket.conn_id(connection.conn)}") state = socket_close(connection, state) {set=state} @private socket_return(k:SocketPool.waiter, connection, authenticated:SocketPool.auth) : void = match k with | {waiter=k} -> Continuation.return(k, {success=connection}) | {auth_waiter=k} -> Continuation.return(k, {success=(connection,authenticated)}) end @private socket_error(k:SocketPool.waiter, failure:{failure:string}) : void = match (k,failure) with | ({waiter=k},{~failure}) -> Continuation.return(k, ~{failure}) | ({auth_waiter=k},{~failure}) -> Continuation.return(k, ~{failure}) end @private get_socket(state:SocketPool.state, k:SocketPool.waiter): Session.instruction(SocketPool.state) = do monitor("get", state) match (state.sockets,state.auths) with | ([connection|sockets],[authenticated|auths]) -> do Log.debug(state, "handler","reuse open socket {Socket.conn_id(connection.conn)}") do socket_return(k, connection, authenticated) allocated = connection +> state.allocated {set={state with ~sockets; ~auths; ~allocated}} | (_,_) -> if state.cnt >= state.conf.max then do Log.debug(state, "handler", "queue caller") {set={state with queue=Queue.add(k, state.queue)}} else match match state.secure_type with | {some=secure_type} -> match state.preamble with | {some=preamble} -> //match Socket.binary_secure_connect_with_err_cont(state.host.f1,state.host.f2,false,secure_type) with match Socket.binary_connect_with_err_cont(state.host.f1,state.host.f2) with | {success=conn} -> match preamble({~conn; mbox=Mailbox.create(state.conf.hint)}) with | {success=conn} -> Socket.binary_secure_reconnect_with_err_cont(conn.conn,state.host.f1,state.host.f2,secure_type) | ~{failure} -> ~{failure} end | ~{failure} -> ~{failure} end | {none} -> Socket.binary_secure_connect_with_err_cont(state.host.f1,state.host.f2,true,secure_type) end | {none} -> Socket.binary_connect_with_err_cont(state.host.f1,state.host.f2) end with | {success=conn} -> connection = {~conn; mbox=Mailbox.create(state.conf.hint)} state = {state with open_connections=IntSet.add(Socket.conn_id(connection.conn),state.open_connections)} do Log.debug(state, "handler", "successfully opened socket {Socket.conn_id(connection.conn)}") do socket_return(k, connection, {authenticated=false; i1=-1; i2=-1}) allocated = connection +> state.allocated {set={state with cnt=state.cnt+1; ~allocated}} | {failure=str} -> do Log.debug(state, "handler", "open socket failure: {str}") do socket_error(k, {failure=str}) {unchanged} end @private pool_handler(state:SocketPool.state, msg:SocketPool.msg): Session.instruction(SocketPool.state) = match msg with | {release=connection} -> release_socket(state, connection, {authenticated=false; i1=-1; i2=-1}) | {release_auth=(connection,authenticated)} -> release_socket(state, connection, authenticated) | {get=k} -> get_socket(state, {waiter=k}) | {get_auth=k} -> get_socket(state, {auth_waiter=k}) | {reconnect=host} -> do monitor("reconnect", state) do Log.debug(state, "handler", "reconnect({host.f1}.{host.f2})") state = List.fold(socket_close,state.sockets,state) state = List.fold(socket_close,state.allocated,state) {set={state with ~host; cnt=0; sockets=[]; auths=[]; allocated=[]}} | {getconf=k} -> do Continuation.return(k, state.conf) {unchanged} | {updconf=f} -> {set = {state with conf = f(state.conf)}} | {gethost=k} -> do Continuation.return(k, state.host) {unchanged} | {close} -> do Log.debug(state, "handler","close socket pool") state = List.fold(socket_close,state.sockets,state) state = List.fold(socket_close,state.allocated,state) {set={state with auths=[]}} | {stop} -> do monitor("stop", state) do Log.debug(state, "handler","stop socket pool") state = List.fold(socket_close,state.sockets,state) _state = List.fold(socket_close,state.allocated,state) {stop} @private initial_state(host, conf, secure_type, preamble) = { ~host; ~conf; ~secure_type; ~preamble; cnt=0; sockets=[]; auths=[]; allocated=[]; queue=Queue.empty; open_connections=IntSet.empty; } /** * Create a pool of sockets which will return sockets connected to the [host]. * @param host The host to connect * @param conf The initial configuration of the socket pool * @return A pool of sockets */ make(host:Socket.host, conf:SocketPool.conf): SocketPool.t = state = initial_state(host, conf, none, none) do Log.debug(state, "make","{host}") Session.make(state, pool_handler) /** * Create a pool of sockets which will return sockets securely connected to the [host]. * @param host The host to connect * @param conf The initial configuration of the socket pool * @param secure_type The optional SSL security information, none is the same as an insecure connection * @param preamble An optional function to call upon an insecure socket before SSL handshake * @return A pool of sockets */ make_secure(host:Socket.host, conf:SocketPool.conf, secure_type:option(SSL.secure_type), preamble:option(SocketPool.preamble)): SocketPool.t = state = initial_state(host, conf, secure_type, preamble) do Log.debug(state, "make","{host}") Session.make(state, pool_handler) /** * Get a socket from the [pool]. If the maximum of allocated sockets are * reached wait until a socket is released (see [SocketPool.conf]). * @param pool The pool of socket * @return A socket connected to the current [host] of the pool */ get(pool:SocketPool.t) : SocketPool.result = @callcc(k -> Session.send(pool, {get=k})) /** * Same as get but also returns an authentication value associated with the socket. * This is intended, for example, to attach an "authenticated" status to the socket * for connections requiring external authentication. */ get_auth(pool:SocketPool.t) : SocketPool.auth_result = @callcc(k -> Session.send(pool, {get_auth=k})) /** * Same as get but the result is returned to the [callback] * @param pool The pool of socket * @param callback The callback which receives the result */ get_async(pool:SocketPool.t, callback) = @callcc(k -> do Continuation.return(k, void) callback(get(pool)) ) /** * Same as get_async but with the authentication flag. */ get_auth_async(pool:SocketPool.t, callback) = @callcc(k -> do Continuation.return(k, void) callback(get_auth(pool)) ) /** * Release [socket] into the pool. If the socket not coming from the [pool] * then the socket is just close and the pool stay unchanged. * @param socket The socket to release * @param pool The pool of socket */ release(pool:SocketPool.t, socket:Socket.t) : void = Session.send(pool, {release=socket}) /** * Same as release but returns the authentication flag along with the socket. */ release_auth(pool:SocketPool.t, socket:Socket.t, authenticated:SocketPool.auth) : void = Session.send(pool, {release_auth=(socket,authenticated)}) /** * Change the [host] where sockets of the pool are connected. * @param pool The pool of socket * @param host The new host to set */ reconnect(pool:SocketPool.t, host:Socket.host) : void = Session.send(pool, {reconnect=host}) /** * Close all allocated socket into the socket [pool] * @param pool The pool of socket */ close(pool:SocketPool.t) : void = Session.send(pool, {close}) /** * Stop the pool of socket, no more socket will be allocated. * @param pool The pool of socket */ stop(pool:SocketPool.t) : void = Session.send(pool, {stop}) @private getconf_map(pool, f) = f(getconf(pool)) /** * Returns the configuration of the [pool] of socket * @param pool The pool of socket * @return The configuration of the [pool] */ getconf(pool:SocketPool.t) : SocketPool.conf = @callcc(k -> Session.send(pool, {getconf=k})) /** * Returns the host of the [pool] of socket * @param pool The pool of socket * @return The host of the [pool] */ gethost(pool:SocketPool.t) : Socket.host = @callcc(k -> Session.send(pool, {gethost=k})) /** * Returns the maximum number of allocated socket of the [pool] of socket * @param pool The pool of socket * @return The maximum number of allocated socket of the [pool] */ getmax(pool:SocketPool.t) : int = getconf_map(pool, _.max) /** * Returns the default hint of allocated mailboxes of the [pool] of socket * @param pool The pool of socket * @return The default hint of allocated mailboxes of the [pool] */ gethint(pool:SocketPool.t) : int = getconf_map(pool, _.hint) /** * Returns the verbosity of the [pool] of socket * @param pool The pool of socket * @return The verbosity of the [pool] */ getverbose(pool:SocketPool.t) : bool = getconf_map(pool, _.verbose) @private setconf_map(pool, f) = Session.send(pool, {updconf=f}) /** * Set the configuration of the [pool] of socket * @param pool The pool of socket * @param The new configuration of the [pool] */ setconf(pool:SocketPool.t, conf:SocketPool.conf) = setconf_map(pool, (_ -> conf)) /** * Set the maximum number of allocated socket of the [pool] of socket * @param pool The pool of socket * @param max The new maximum number of allocated socket of the [pool] */ setmax(pool:SocketPool.t, max) = setconf_map(pool, (conf -> {conf with ~max})) /** * Set the default hint of allocated mailboxes of the [pool] of socket * @param pool The pool of socket * @param hint The new default hint of allocated mailboxes of the [pool] */ sethint(pool:SocketPool.t, hint:int) = setconf_map(pool, (conf -> {conf with ~hint})) /** * Set the verbosity of the [pool] of socket * @param pool The pool of socket * @param verbose */ setverbose(pool:SocketPool.t, verbose) = setconf_map(pool, (conf -> {conf with ~verbose})) }} // End of file socketpool.opa
Opa
5
Machiaweliczny/oppailang
lib/stdlib/io/socket/socket_pool.opa
[ "MIT" ]
#!/bin/bash set -e CWD="$( cd "$( dirname "${BASH_SOURCE[0]}" )" && pwd )" NYLAS_DIR="$HOME/.nylas-bench" TRUNCATE_TABLES=" Account AccountPluginMetadata Calendar Category Contact ContactSearch Event EventSearch File Message MessageBody MessagePluginMetadata ProviderSyncbackRequest Thread ThreadCategory ThreadContact ThreadCounts ThreadPluginMetadata ThreadSearch" SQLITE_DIR=$CWD/sqlite SQLITE_BIN=$SQLITE_DIR/sqlite3 SQLITE_SRC_DIR="$SQLITE_DIR/sqlite-amalgamation-3170000" # Build the sqlite3 amalgamation if necessary because we need FTS5 support. if [[ ! -e "$SQLITE_BIN" ]] then mkdir -p $SQLITE_DIR curl -s "https://www.sqlite.org/2017/sqlite-amalgamation-3170000.zip" > "$SQLITE_DIR/sqlite-amalgamation.zip" unzip -o -d $SQLITE_DIR "$SQLITE_DIR/sqlite-amalgamation.zip" clang -DSQLITE_DISABLE_INTRINSIC -DSQLITE_ENABLE_FTS5 "$SQLITE_SRC_DIR/sqlite3.c" "$SQLITE_SRC_DIR/shell.c" -o $SQLITE_BIN fi rm -f $NYLAS_DIR/a-*.sqlite EDGEHILL_DB=$NYLAS_DIR/edgehill.db for TABLE in $TRUNCATE_TABLES do COMMAND="DELETE FROM $TABLE" $SQLITE_BIN $EDGEHILL_DB "DELETE FROM $TABLE" done $SQLITE_BIN $EDGEHILL_DB 'DELETE FROM JSONBlob WHERE client_id != "NylasID"'
Shell
3
cnheider/nylas-mail
scripts/drop-data-except-accounts.sh
[ "MIT" ]
#include "Python.h" #ifdef HAVE_GCC_ASM_FOR_X87 // Inline assembly for getting and setting the 387 FPU control word on // GCC/x86. #ifdef _Py_MEMORY_SANITIZER __attribute__((no_sanitize_memory)) #endif unsigned short _Py_get_387controlword(void) { unsigned short cw; __asm__ __volatile__ ("fnstcw %0" : "=m" (cw)); return cw; } void _Py_set_387controlword(unsigned short cw) { __asm__ __volatile__ ("fldcw %0" : : "m" (cw)); } #endif // HAVE_GCC_ASM_FOR_X87
C
4
oleksandr-pavlyk/cpython
Python/pymath.c
[ "0BSD" ]
// This file is part of OpenCV project. // It is subject to the license terms in the LICENSE file found in the top-level directory // of this distribution and at http://opencv.org/license.html. // Copyright (C) 2014, Advanced Micro Devices, Inc., all rights reserved. // Third party copyrights are property of their respective owners. __kernel void NCC(__global const uchar *patch, __global const uchar *positiveSamples, __global const uchar *negativeSamples, __global float *ncc, int posNum, int negNum) { int id = get_global_id(0); if (id >= 1000) return; bool posFlg; if (id < 500) posFlg = true; if (id >= 500) { //Negative index id = id - 500; posFlg = false; } //Variables int s1 = 0, s2 = 0, n1 = 0, n2 = 0, prod = 0; float sq1 = 0, sq2 = 0, ares = 0; int N = 225; //NCC with positive sample if (posFlg && id < posNum) { for (int i = 0; i < N; i++) { s1 += positiveSamples[id * N + i]; s2 += patch[i]; n1 += positiveSamples[id * N + i] * positiveSamples[id * N + i]; n2 += patch[i] * patch[i]; prod += positiveSamples[id * N + i] * patch[i]; } sq1 = sqrt(max(0.0, n1 - 1.0 * s1 * s1 / N)); sq2 = sqrt(max(0.0, n2 - 1.0 * s2 * s2 / N)); ares = (sq2 == 0) ? sq1 / fabs(sq1) : (prod - s1 * s2 / N) / sq1 / sq2; ncc[id] = ares; } //NCC with negative sample if (!posFlg && id < negNum) { for (int i = 0; i < N; i++) { s1 += negativeSamples[id * N + i]; s2 += patch[i]; n1 += negativeSamples[id * N + i] * negativeSamples[id * N + i]; n2 += patch[i] * patch[i]; prod += negativeSamples[id * N + i] * patch[i]; } sq1 = sqrt(max(0.0, n1 - 1.0 * s1 * s1 / N)); sq2 = sqrt(max(0.0, n2 - 1.0 * s2 * s2 / N)); ares = (sq2 == 0) ? sq1 / fabs(sq1) : (prod - s1 * s2 / N) / sq1 / sq2; ncc[id+500] = ares; } } __kernel void batchNCC(__global const uchar *patches, __global const uchar *positiveSamples, __global const uchar *negativeSamples, __global float *posNcc, __global float *negNcc, int posNum, int negNum, int patchNum) { int id = get_global_id(0); bool posFlg; if (id < 500*patchNum) posFlg = true; if (id >= 500*patchNum) { //Negative index id = id - 500*patchNum; posFlg = false; } int modelSampleID = id % 500; int patchID = id / 500; //Variables int s1 = 0, s2 = 0, n1 = 0, n2 = 0, prod = 0; float sq1 = 0, sq2 = 0, ares = 0; int N = 225; //NCC with positive sample if (posFlg && modelSampleID < posNum) { for (int i = 0; i < N; i++) { s1 += positiveSamples[modelSampleID * N + i]; s2 += patches[patchID*N + i]; n1 += positiveSamples[modelSampleID * N + i] * positiveSamples[modelSampleID * N + i]; n2 += patches[patchID*N + i] * patches[patchID*N + i]; prod += positiveSamples[modelSampleID * N + i] * patches[patchID*N + i]; } sq1 = sqrt(max(0.0, n1 - 1.0 * s1 * s1 / N)); sq2 = sqrt(max(0.0, n2 - 1.0 * s2 * s2 / N)); ares = (sq2 == 0) ? sq1 / fabs(sq1) : (prod - s1 * s2 / N) / sq1 / sq2; posNcc[id] = ares; } //NCC with negative sample if (!posFlg && modelSampleID < negNum) { for (int i = 0; i < N; i++) { s1 += negativeSamples[modelSampleID * N + i]; s2 += patches[patchID*N + i]; n1 += negativeSamples[modelSampleID * N + i] * negativeSamples[modelSampleID * N + i]; n2 += patches[patchID*N + i] * patches[patchID*N + i]; prod += negativeSamples[modelSampleID * N + i] * patches[patchID*N + i]; } sq1 = sqrt(max(0.0, n1 - 1.0 * s1 * s1 / N)); sq2 = sqrt(max(0.0, n2 - 1.0 * s2 * s2 / N)); ares = (sq2 == 0) ? sq1 / fabs(sq1) : (prod - s1 * s2 / N) / sq1 / sq2; negNcc[id] = ares; } }
OpenCL
4
Nondzu/opencv_contrib
modules/tracking/src/opencl/tldDetector.cl
[ "BSD-3-Clause" ]
def f(a&: int) -> void begin a = 1 end def main() -> void begin a: int = 0 f(a) # test print(a) # should print '1' end
Cycript
2
matheuspb/cython
examples/reference.cy
[ "MIT" ]
#! /bin/sh -e # multiarch-lib.dpatch by Stephen Frost <sfrost@debian.org> dir= if [ $# -eq 3 -a "$2" = '-d' ]; then pdir="-d $3" dir="$3/" elif [ $# -ne 1 ]; then echo >&2 "`basename $0`: script expects -patch|-unpatch as argument" exit 1 fi case "$1" in -patch) patch $pdir -f --no-backup-if-mismatch -p0 < $0 ;; -unpatch) patch $pdir -f --no-backup-if-mismatch -R -p0 < $0 ;; *) echo >&2 "`basename $0`: script expects -patch|-unpatch as argument" exit 1 esac exit 0 diff -urN gcc.old/config/i386/t-linux64 gcc/config/i386/t-linux64 --- gcc.old/config/i386/t-linux64 2002-11-28 15:47:02.000000000 +0100 +++ gcc/config/i386/t-linux64 2004-07-10 07:28:01.000000000 +0200 @@ -6,7 +6,7 @@ MULTILIB_OPTIONS = m64/m32 MULTILIB_DIRNAMES = 64 32 -MULTILIB_OSDIRNAMES = ../lib64 ../lib +MULTILIB_OSDIRNAMES = x86_64-linux i486-linux LIBGCC = stmp-multilib INSTALL_LIBGCC = install-multilib diff -urN gcc.old/config/t-linux gcc/config/t-linux --- gcc.old/config/t-linux 2004-05-04 18:09:38.000000000 +0200 +++ gcc/config/t-linux 2004-07-10 07:28:01.000000000 +0200 @@ -11,3 +11,11 @@ LIB2ADDEH = $(srcdir)/unwind-dw2.c $(srcdir)/unwind-dw2-fde-glibc.c \ $(srcdir)/unwind-sjlj.c $(srcdir)/gthr-gnat.c $(srcdir)/unwind-c.c LIB2ADDEHDEP = unwind.inc unwind-dw2-fde.h unwind-dw2-fde.c + +MULTILIB_OPTIONS = m32 +MULTILIB_DIRNAMES = 32 +MULTILIB_OSDIRNAMES = $TARGET_ARCH + +LIBGCC = stmp-multilib +INSTALL_LIBGCC = install-multilib +
Darcs Patch
3
JrCs/opendreambox
recipes/gcc/gcc-4.3.4/debian/multiarch-lib.dpatch
[ "MIT" ]
// Copyright 2017 The Go Authors. All rights reserved. // Use of this source code is governed by a BSD-style // license that can be found in the LICENSE file. // Issue 18452: show pos info in undefined name errors package p import ( "C" "fmt" ) func a() { fmt.Println("Hello, world!") C.function_that_does_not_exist() // ERROR HERE C.pi // ERROR HERE }
Go
3
Havoc-OS/androidprebuilts_go_linux-x86
misc/cgo/errors/src/issue18452.go
[ "BSD-3-Clause" ]
(* * Copyright (c) Facebook, Inc. and its affiliates. * * This source code is licensed under the MIT license found in the * LICENSE file in the root directory of this source tree. *) type flow_mode = | OptIn | OptInStrict | OptInStrictLocal | OptOut (* * Specifies a function that should be invoked instead of React.createElement * when interpreting JSX syntax. Otherwise, the usual rules of JSX are * followed: children are varargs after a props argument. *) type jsx_pragma = string * (Loc.t, Loc.t) Flow_ast.Expression.t type t = { flow: flow_mode option; typeAssert: bool; preventMunge: bool; providesModule: string option; jsx: jsx_pragma option; } let default_info = { flow = None; typeAssert = false; preventMunge = false; providesModule = None; jsx = None } (* accessors *) let flow info = info.flow let typeAssert info = info.typeAssert let preventMunge info = info.preventMunge let providesModule info = info.providesModule let jsx info = info.jsx let is_strict info = match info.flow with | Some OptInStrict -> true | Some OptIn | Some OptInStrictLocal | Some OptOut | None -> false let is_flow info = match info.flow with | Some OptIn | Some OptInStrict | Some OptInStrictLocal -> true | Some OptOut | None -> false (* debugging *) let json_of_docblock info = Hh_json.( let flow = match flow info with | Some OptIn -> JSON_String "OptIn" | Some OptInStrict -> JSON_String "OptInStrict" | Some OptInStrictLocal -> JSON_String "OptInStrictLocal" | Some OptOut -> JSON_String "OptOut" | None -> JSON_Null in let preventsMunge = if preventMunge info then JSON_Bool true else JSON_Null in let providesModule = match providesModule info with | Some str -> JSON_String str | None -> JSON_Null in let typeAssert = JSON_Bool (typeAssert info) in JSON_Object [ ("flow", flow); ("typeAssert", typeAssert); ("preventMunge", preventsMunge); ("providesModule", providesModule); ] )
OCaml
5
zhangmaijun/flow
src/common/docblock.ml
[ "MIT" ]
:- initialization(( logtalk_load(a(loader)), logtalk_load(b) )).
Logtalk
2
PaulBrownMagic/logtalk3
examples/looping/b/loader.lgt
[ "Apache-2.0" ]
2016-03-02 09:18:39 fsociety now you are in a special window just for you 2016-03-02 09:18:55 fsociety still getting used to this telegram function in irc.. it works a little differently as you can imagine 2016-03-02 09:19:12 Michael interesting 2016-03-02 09:19:19 fsociety plans for the day? 2016-03-02 09:19:23 Michael ahh many years spent on mIRC 2016-03-02 09:19:52 fsociety its IRC, you are talking about the client itself :) 2016-03-02 09:20:07 Michael umm not sure exactly. I was thinking the car needs a wash because its dirty really abdly and I can't remember the last time i washed it :/ 2016-03-02 09:20:43 fsociety sometimes i wish i could have a day like that 2016-03-02 09:20:44 Michael our car spot out the front is in between two trees and a roof gutter with a power line coming out from the roof to the street power line 2016-03-02 09:20:48 Michael so bird shit galore 2016-03-02 09:20:51 Michael :S 2016-03-02 09:21:09 fsociety maybe not have a day like that though.. haha 2016-03-02 09:21:22 Michael oh mang 2015 was like that for me... I really don't have any plans to make this permanent 2016-03-02 09:21:28 Michael I need to work asap 2016-03-02 09:21:44 Michael so i'm looking for anything... heck even couriering :)  2016-03-02 09:21:57 fsociety yeah dude it industry is fucked 2016-03-02 09:22:11 Michael you know 2016-03-02 09:22:37 Michael I have been giving completing a traineeship for Telecommunications serious thought 2016-03-02 09:22:49 Michael I actually did prior to starting at this TSA company till I got the job 2016-03-02 09:22:50 fsociety that's crap 2016-03-02 09:23:30 Michael as Telstra had many Traineeships beginning 2016... but unfortunately as it's early March they've already begun and I would need to start mid year  2016-03-02 09:23:58 Michael It's completing a Trainesship in Cert III Telecomunications or Cert IV Telecomunication (Network Design) 2016-03-02 09:24:07 Michael and going back asa mature age trainee 2016-03-02 09:24:13 Michael you get about $700 a week 2016-03-02 09:24:52 Michael and complete it in 24 months... upon which the company you completed the traineeship usually have limited positions available 2016-03-02 09:25:13 Michael I thought work while I learn sure why not... and then get into the industry and bobs your uncle 2016-03-02 09:25:30 Michael and I know what your thinking... Cert III or Cert IV wtf? 2016-03-02 09:25:41 Michael it seems a little... underwhemling you could say heh 2016-03-02 09:26:00 Michael But I guess it's because it's more hands on kinda like a trade - being out in the field 2016-03-02 09:26:29 Michael so advanced theory / classrom excercises isn't really required as more on the job experience 2016-03-02 09:26:35 fsociety start your own windows development for small businesses :) 2016-03-02 09:27:15 Michael I'm not that advanced in the windows environment heh 2016-03-02 09:27:34 Michael I had my first tastes of Server 2012 and Exchange 2012 etc at this new company 2016-03-02 09:27:52 Michael even Windows 8 Enterprise actually hehe 2016-03-02 09:28:01 Michael I'm lagging so far behind in knowledge 2016-03-02 09:28:21 Michael (i'm quite capable of learning fast)  2016-03-02 09:29:22 Michael but i'm just sayin'... this new gen of folks graduating frmo using t he latest and best in &quot;Microsoft&quot; orientated products... I would be trailing behind a little perhaps... :S... maybe  2016-03-02 09:31:54 fsociety pfft.. ppl "graduating".. anybody that studies a microsoft certificate or even a linux course will never have a long standing job 2016-03-02 09:31:54 - [Michael] is away: Mobile 2016-03-02 09:32:04 fsociety they don't know how to problem solve, need to be spoon fed 2016-03-02 09:32:29 fsociety amusing how a lot of high profile companies look for what essentially are "whitehat hackers".. people who learnt through trial and error 2016-03-02 09:35:49 Michael lol 2016-03-02 09:35:51 Michael true 2016-03-02 09:36:46 fsociety so im grabbing my spare black drive off my friend tonight and then putting the rma for that black drive in tomorrow 2016-03-02 09:36:50 fsociety it has a 5-yr warranty :) 2016-03-02 09:37:41 Michael but you know the manager's from the last couple companies I worked at (and yes the dush companies - i.e. Toll TCS and TSA) lol I know when they were searching for new candidates the thing that 'mesmerized' management was certifications. Especially if you had this and that and this and that.... lol basically every letter of the alphabet type list of certfications...  2016-03-02 09:37:50 Michael it'd be the main thing that would of wowed them 2016-03-02 09:38:10 Michael Experience came second I guess lol 2016-03-02 09:38:37 Michael ...and I guess it just shows the company's quality :P 2016-03-02 09:38:46 Michael i.e. shit! 2016-03-02 09:39:39 fsociety haha yeah... so many it specialists i have met that are damn hopeless 2016-03-02 09:44:41 Michael 👍  2016-03-02 09:46:13 fsociety which reminds me i'll msg my friend today about the ps4 if you like 2016-03-02 09:47:22 Michael sweeeet 2016-03-02 09:47:29 Michael that would gewwwwd 2016-03-02 09:47:32 fsociety is this your 3rd ps4 2016-03-02 09:47:34 Michael 👍 2016-03-02 09:47:57 Michael yes I believe it would be lol 2016-03-02 09:48:08 Michael third? wow? really? 2016-03-02 09:48:45 fsociety hahahaha... 2016-03-02 09:48:47 Michael jeez im churning through them faster then slimeline PS3s 2016-03-02 09:48:48 fsociety *face palm* 2016-03-02 09:49:04 Michael I think I had 4 of them hehe 2016-03-02 09:49:21 Michael the blu ray died twice on 2 separate ones 2016-03-02 09:49:38 Michael well once it died 2016-03-02 09:50:17 fsociety really - wow 2016-03-02 09:50:20 Michael another one it wasn't reading it right like the disk would be hitting a side when it spun around so it's like the chasis was wrong 2016-03-02 09:50:54 Michael and when it was loading it would do large clinks every now and then and would lock the game up constantly 2016-03-02 09:50:56 Michael lol 2016-03-02 09:51:06 Michael yeah I had many troubles with the PS3 2016-03-02 09:51:57 Michael one of them my housemate at the time was playing one of the CoD games all day long every day whilst I was at work 2016-03-02 09:52:05 Michael and I would come home and play it also 2016-03-02 09:52:58 Michael apparently I heard that with the slim line PS3s or something they don't have sufficient fans or something like that and so evry like hour or two of gaming you need to stop and let it cool for 15 minutes else it would burn out 2016-03-02 09:53:08 fsociety i've never had an issue with my slim line 2016-03-02 09:53:10 fsociety its 6 years old 2016-03-02 09:53:39 fsociety sounds like you are talking about the old xbox 360s haha 2016-03-02 09:53:42 Michael hmmm potato potAhtoe 2016-03-02 09:53:46 Michael :P 2016-03-02 09:54:05 Michael hehe just like the poor sods buying an xbox and getting the ring of death 2016-03-02 09:54:25 Michael hmmm not red ring of death 2016-03-02 09:54:30 Michael there was a name for it though 2016-03-02 09:54:47 Michael affected alot of Xboxs but not all 2016-03-02 09:56:30 fsociety hahaha.. consoles are meh these days.. every aspect i liked about a console has been thrown out the window 2016-03-02 09:56:43 fsociety consoles now require patches, firmware updates, os upgrades, hard drive installations 2016-03-02 09:56:53 fsociety removes every aspect on what made a console appealing 2016-03-02 10:59:11 Michael lol wellz... as they say Its no longer a 'game console' instead now they're 'home entertainment systems'  2016-03-02 10:59:13 Michael hehe :P 2016-03-02 10:59:29 fsociety oh your back :) 2016-03-02 10:59:36 Michael :P 2016-03-02 10:59:44 Michael I'm never too far away 2016-03-02 11:01:20 Michael I'm going to call Legal Aid - specifically Vic Uni Legal (guessing law students) hehe - but yeah before writing back to the HR representative from TSA I want to make sure that what I'll reply with is plausible and if i should bother pursuing the case 2016-03-02 11:01:28 Michael You know 2016-03-02 11:02:56 Michael I still have no documentation relating to the termination... Something even as basic as The Employment separation certficate I don't have... I still don't have any formal letter advising of my termination... and finally... and i mean finally I got paid out my entitlements for which I assume is for my termination 2016-03-02 11:03:50 Michael but hey... because I don't have any documents I don't even know what the payment is for exactly... You know as per my calculations they actually stuffed up by about 1 or 2 days pay 2016-03-02 11:04:29 Michael I got less then what I calculated by exactly a day to which I assume they probably didn't calculate the last day I attended for half the day which was the 16th of Feb...  2016-03-02 11:05:07 Michael but hey if this was all proper and legitmate to begin with I'd already have a document stating this information :/ 2016-03-02 11:05:24 Michael So my dilemma is: 2016-03-02 11:06:41 fsociety yuuusss 2016-03-02 11:09:18 Michael Thursday the HR rep sent me an email saying that she's attempted to contact me regarding my email and that should I wish to discuss the matter further to call her on the work phone / office line. 2016-03-02 11:09:41 Michael so basically I can state what I mentioned to you but on a much mroe professional level 2016-03-02 11:09:44 Michael ALTHOUGH 2016-03-02 11:10:00 Michael what troubles me is the fact she's wanting me to cal her :S 2016-03-02 11:10:33 Michael I don't understand why she wants me to call her... I really think for serious matters like this there should be some formal documentation especially now 2016-03-02 11:10:56 Michael heck I didn't have any to begin with and now there trying to keep anything from being on record?? 2016-03-02 11:11:34 Michael So yeah IF i call legal service to obtain some info... I'll see if i should reply via email stating what I want to state again or if infact I should call her back 2016-03-02 11:11:47 Michael and as she said... to 'discuss' the matter further 2016-03-02 11:12:13 Michael whats there to discuss... is one of the first things that's running through my mind 2016-03-02 11:12:41 Michael secondly why hasn't she followed anything up that I requested such as my separation certificate, termination letter? entitlement letter? 2016-03-02 11:13:10 Michael surely she could have replied in a an email and then concluded by saying if I wish to discuss the matter further to call her... 2016-03-02 11:13:44 Michael not to say nothing, reply with nothing, and to call her to discuss my issues further?? like wtf 2016-03-02 11:15:44 fsociety just threaten legal action in your emails.. that will usually push them along quickly 2016-03-02 11:15:47 fsociety thats what i usually do :) 2016-03-02 11:16:29 Michael well the main thing I'm quite certain I got the last payment which had my annual leave and one week's payment in lieu 2016-03-02 11:17:09 Michael so threatening them I would actually have to threaten them with going to the fair work comission  2016-03-02 11:18:50 Michael I guess looking at it deeper now... There's really two sides to this story.... two sides from my point of view I mean :P hehe 2016-03-02 11:18:53 Michael basically... 2016-03-02 11:20:52 Michael I need to engage with this HR rep to obtain official documents for my termination. This way I can then apply for centrelink as I have the required forms to do so etc  2016-03-02 11:21:25 fsociety just have to be forceful at this point otherwise those corps will just put you on the backburner 2016-03-02 11:22:11 Michael But while I'm obtaining the documents I need to also somehow make mention that this whole termination has been unlawful as it was enacted under an unjust reason 2016-03-02 11:22:33 Michael argh I need to call legal service 2016-03-02 11:22:35 Michael I'll do that 2016-03-02 11:22:37 Michael bbs 2016-03-02 13:55:22 - irc: disconnected from server 2016-03-02 17:56:52 - irc: disconnected from server 2016-03-04 23:15:51 fsociety you online sir 2016-03-04 23:15:51 - [Michael] is away: Mobile 2016-03-06 12:25:19 - irc: disconnected from server
IRC log
0
0x4b1dN/2016-dots
misc/weechat/logs/irc.bitlbee.michael.weechatlog
[ "MIT" ]
#! parrot-nqp # Copyright (C) 2011, Parrot Foundation. # This is the start to rewrite JSON. It starts with rewriting data_json only. # data_json depends on the PGE. The rewrite use NQP. =begin Pod =for NAME JSON, a lightweight data-interchange format. =head1 SYNOPSIS The C<from_json> method return a PMC that containing the data structure for a given valid JSON (JavaScript Object Notation) string. For example: =begin code .sub 'main' :main .local pmc result load_language 'JSON' result = from_json( '[1,2,3]' ) load_bytecode 'dumper.pbc' _dumper( result, 'JSON' ) .end =end code For more information about the structure of the JSON representation, see the documentation at L<http://www.json.org/>. =end Pod INIT { pir::load_bytecode('P6Regex.pbc'); } grammar JSON::Grammar is HLL::Grammar { rule TOP { <value> } proto token value { <...> } token value:sym<string> { <string> } token value:sym<number> { '-'? [ <[1..9]> <[0..9]>+ | <[0..9]> ] [ '.' <[0..9]>+ ]? [ <[Ee]> <[+\-]>? <[0..9]>+ ]? # <.worry('oh, a number!')> } rule value:sym<array> { '[' [ <value> ** ',' ]? ']' } rule value:sym<object> { '{' [ [ <string> ':' <value> ] ** ',' ]? '}' } rule value:sym<true> { 'true' } rule value:sym<false> { 'false' } rule value:sym<null> { 'null' } token string { <?["]> <quote_EXPR: ':qq'> } } class JSON::Actions is HLL::Actions { method TOP($/) { make PAST::Block.new($<value>.ast, :node($/)); }; method value:sym<string>($/) { make $<string>.ast; } method value:sym<number>($/) { make +$/; } method value:sym<array>($/) { my $past := PAST::Op.new(:pasttype<list>, :node($/)); if $<value> { for $<value> { $past.push($_.ast); } } make $past; } method value:sym<object>($/) { my $past := PAST::Stmts.new( :node($/) ); my $hashname := PAST::Compiler.unique('hash'); my $hash := PAST::Var.new( :scope<register>, :name($hashname), :viviself('Hash'), :isdecl ); my $hashreg := PAST::Var.new( :scope<register>, :name($hashname) ); $past.'push'($hash); # loop through all string/value pairs, add set opcodes for each pair. my $n := 0; while $n < +$<string> { $past.'push'(PAST::Op.new( :pirop<set__vQ~*>, $hashreg, $<string>[$n].ast, $<value>[$n].ast ) ); $n++; } # return the Hash as the result of this node $past.'push'($hashreg); make $past; } method value:sym<true>($/) { make 1; } method value:sym<false>($/) { make 0; } method string($/) { make $<quote_EXPR>.ast; } } class JSON::Compiler is HLL::Compiler { INIT { JSON::Compiler.language('JSON'); JSON::Compiler.parsegrammar(JSON::Grammar); JSON::Compiler.parseactions(JSON::Actions); } } sub from_json($value) { my $result := JSON::Compiler.eval($value, :actions(JSON::Actions.new)); return $result; } # vim: expandtab shiftwidth=4 ft=perl6:
Perl6
5
winnit-myself/Wifie
compilers/data_json/JSON.nqp
[ "Artistic-2.0" ]
#NoTrayIcon ProcessSetPriority(@AutoItPID, 0) Global $gVarCmdline_1, $gVarRetLoadSkinCrafter If $cmdline[0] Then If $cmdline[0] <= 1 Then $gVarCmdline_1 = $cmdline[1] EndIf Global Const $gVar0167 = 7 Global Const $gVarRndFlag = 1 Global Const $gVarRndMaxA = 9 Global Const $gVar016A = 2 Global $gUseOfEnCodeItNotPermitted = Fn0081("You are not permitted to use EnCodeIt") Global $gDataUserInfo = Fn0081("You have been verified and authorized to use EnCodeIt") Global Const $gVarRndMinB = 8 Global Const $gVarRndD1 = 5 Global Const $gVarRndMinA = 3 Global Const $gVar0170 = 6 Global Const $gVarRndC = 4 Global Const $gVarRndC2 = 0 Global Const $AutoItPID = @AutoItPID Global Const $ScriptDir = @ScriptDir Global Const $AppDataDir = @AppDataDir Global Const $DocumentsCommonDir = @DocumentsCommonDir Global Const $ScriptFullPath = @ScriptFullPath Global Const $UserName = @UserName Global Const $HomeDrive = @HomeDrive Global Const $UserProfileDir = @UserProfileDir Global Const $CRLF = @CRLF Global Const $CR = @CR Global Const $lf = @LF Global Const $gVarRetDummy1 = InitFiles() Global Const $gVarRetDummy2 = FnFilesCleanUp() ;Global Const $gVarRetDummy3 = FnInetCheckBlackList1() Global $EnCodeItInfo_Dat HotKeySet('{ESC}', 'Unload_EnCodeIt') Opt("GUIOnEventMode", 1) Opt("GUIResizeMode", 802) Opt("WinTitleMatchMode", 4) Func LoadSkinCrafter($SkinEngineDll, $SkinDll) Local $hDll = DllOpen($SkinEngineDll) DllCall($hDll, "none","AboutSkinCrafter") CloseWnd() DllCall($hDll, "int", "InitLicenKeys", "int", MakeUniCodeStr("0"), "int", MakeUniCodeStr("SKINCRAFTER"), "int", MakeUniCodeStr("SKINCRAFTER.COM"), "int", MakeUniCodeStr("support@skincrafter.com"), "int", MakeUniCodeStr("DEMOSKINCRAFTERLICENCE")) CloseWnd() DllCall($hDll, "int", "DefineLanguage", "int", 0) CloseWnd() DllCall($hDll, "int", "InitDecoration", "int", 1) CloseWnd() DllCall($hDll, "int", "LoadSkinFromFile", "int", MakeUniCodeStr($SkinDll)) CloseWnd() DllCall($hDll, "int", "ApplySkin") CloseWnd() Return $hDll EndFunc Func MakeUniCodeStr($Arg00) Local $StrLen = StringLen($Arg00) Local $Var0002 = DllCall("oleaut32.dll", "int", "SysAllocStringLen", "int", 0, "int", $StrLen) DllCall("kernel32.dll", "int", "MultiByteToWideChar", "int", 0, "int", 0, "str", $Arg00, "int", $StrLen, "ptr", $Var0002[0], "int", $StrLen) Return $Var0002[0] EndFunc Func CloseWnd($WndClassName = 'classname=#32770') $MatchMode = Opt("WinTitleMatchMode", 4) Local $hWnd = WinGetHandle($WndClassName) ControlHide($hWnd, '', '') WinKill($hWnd) Opt("WinTitleMatchMode", $MatchMode) EndFunc Func UnLoadSkinCrafter() DllCall($gVarRetLoadSkinCrafter, "int", "DeInitDecoration") DllCall($gVarRetLoadSkinCrafter, "int", "RemoveSkin") DllClose($gVarRetLoadSkinCrafter) EndFunc Global $gDivKey2 = Random($gVarRndMinA & $gVarRndMinB, $gVarRndMinB & $gVarRndMaxA, $gVarRndFlag), $gObfuFileData Global $gVar0184 = Random($gVarRndC & $gVarRndC2, $gVarRndD1 & $gVarRndC2, 1), $gSleepTimeMs, $gOutPFileName, $gVar0187 Global $gEncodeStartStop, $gOutpFileNDrive, $gOutpFileNPath, $gOutpFileNName, $gOutpFileNExt, $gSleepTime = IniRead($ScriptDir & "\EnCodeIt.ini", "SleepTime", "Sleep", 10) Global $gRndCharPrefix = Chr(Random(65, 90, 1)), $g4ByteRandHex = Fn4ByteRandHex() Global $gLogFile_EnCodeIt = ";~===========================================================================================" & $CRLF & ";~ EnCodeIt" & $CRLF & ";~ By" & $CRLF & ";~ SmOke_N" & $CRLF & ";~===========================================================================================" & $CRLF Global $gLogFile_Functions = $CRLF & ";~===========================================================================================" & $CRLF & ";~ Functions" & $CRLF & ";~ " & FnGetMonthName(@MON) & " " & @MDAY & ", " & @YEAR & $CRLF & ";~ " & FnGetTime() & $CRLF & ";~===========================================================================================" & $CRLF & "; No. | Function | EnCoded Function" & $CRLF & ";~===========================================================================================" & $CRLF & $CRLF Global $gLogFile_Vars = $CRLF & ";~===========================================================================================" & $CRLF & ";~ Variables" & $CRLF & ";~ " & FnGetMonthName(@MON) & " " & @MDAY & ", " & @YEAR & $CRLF & ";~ " & FnGetTime() & $CRLF & ";~===========================================================================================" & $CRLF & "; No. | Variables | EnCoded Variables" & $CRLF & ";~===========================================================================================" & $CRLF & $CRLF $GUIhWnd = GUICreate("EnCodeIt v2.0 By SmOke_N", 355, 150) $gVar0187 = $GUIhWnd $GUIhMenu = GUICtrlCreateMenu("&File") $MenuItem_Open = GUICtrlCreateMenuitem("O&pen", $GUIhMenu, 1) GUICtrlCreateMenuitem('', $GUIhMenu, 2) $MenuItem_Exit = GUICtrlCreateMenuitem("&Exit", $GUIhMenu, 3) $MenuItem_Options = GUICtrlCreateMenu("&Options") $MenuItem_Compiler_Location = GUICtrlCreateMenu("Compiler Location", $MenuItem_Options, 1) GUICtrlCreateMenuitem('', $MenuItem_Options, 2) $M8D5A722A6C5B4FC9 = GUICtrlCreateMenuitem(IniRead($ScriptDir & "\EnCodeIt.ini", "Compiler", "Aut2Exe", ''), $MenuItem_Compiler_Location) GUICtrlCreateMenuitem('', $MenuItem_Compiler_Location, 2) $MenuItem_Change = GUICtrlCreateMenuitem("Change", $MenuItem_Compiler_Location, 3) $MenuItem_DecompilerLocation = GUICtrlCreateMenu("Decompiler Location", $MenuItem_Options, 3) $M8D5A722F6C5A4F79 = GUICtrlCreateMenuitem(IniRead($ScriptDir & "\EnCodeIt.ini", "Decompiler", "Exe2Aut", ''), $MenuItem_DecompilerLocation) GUICtrlCreateMenuitem('', $MenuItem_DecompilerLocation, 2) $M8D5A7223685B4F29 = GUICtrlCreateMenuitem("Change", $MenuItem_DecompilerLocation, 3) GUICtrlCreateMenuitem('', $MenuItem_Options, 4) $M8D5A72296C504F29 = GUICtrlCreateMenu("PC Relief", $MenuItem_Options, 5) $M8D5A728F4C5B4F29 = GUICtrlCreateMenuitem("Current Sleep Average Is: " & $gSleepTime & " Milliseconds", $M8D5A72296C504F29, 1) GUICtrlCreateMenuitem('', $M8D5A72296C504F29, 2) $M8D5A722F6C5B5F29 = GUICtrlCreateMenuitem("Change", $M8D5A72296C504F29, 3) $M8D5A72266C5B4A29 = GUICtrlCreateLabel("Input the complete path for the file to Encode...", 10, 15, 300, 20, 0x0001) $GUI_Txt_Input = GUICtrlCreateInput('', 10, 35, 300, 20) If $cmdline[0] Then GUICtrlSetData($GUI_Txt_Input, $gVarCmdline_1) $GUILabelStatus = GUICtrlCreateLabel('', 20, 90, 150, 20) $lblEncoding = GUICtrlCreateLabel('', 160, 90, 80, 20) $GUILabelProcentComplett = GUICtrlCreateLabel('', 290, 90, 50, 20, 0x0001) $M8D5A792FFC5B4F29 = GUICtrlCreateButton("www", 310, 35, 30, 20) GUICtrlSetFont($M8D5A792FFC5B4F29, 10, 400, -1, "Wingdings") $GUIButton_StartEncoding = GUICtrlCreateButton("Start Encoding", 130, 60, 80, 30) $GUIProgressBar = GUICtrlCreateProgress(20, 110, 310, 15) ControlHide($GUIhWnd, '', $GUIProgressBar) GUISetOnEvent(-3, 'FnQuit_EnCodeIt', $GUIhWnd) GUICtrlSetOnEvent($MenuItem_Open, 'FnWndHandler') GUICtrlSetOnEvent($MenuItem_Exit, 'FnWndHandler') GUICtrlSetOnEvent($MenuItem_Change, 'FnWndHandler') GUICtrlSetOnEvent($M8D5A7223685B4F29, 'FnWndHandler') GUICtrlSetOnEvent($M8D5A792FFC5B4F29, 'FnWndHandler') GUICtrlSetOnEvent($GUIButton_StartEncoding, 'FnWndHandler') GUICtrlSetOnEvent($M8D5A722F6C5B5F29, 'FnWndHandler') FnWndShowHide($GUIhWnd) GUISetState() CloseWnd() Fn0078() If UBound($cmdline) - 1 > 1 Then FileInstall('C:\Documents and Settings\EnCodeItInfo\Restart_EnCoded1.au3', $ScriptDir & "\EnCodeItInfo\Backup.bak", 1) If $gSleepTime > 0 And $gSleepTime < 11 Then $gSleepTimeMs = $gSleepTime * 100 ElseIf $gSleepTime = 0 Or $gSleepTime = '' Then $gSleepTimeMs = 10000 Else $gSleepTimeMs = 1000 EndIf Local $Var0004, $Var0005 = TimerInit(), $Var0006, $Var0007, $Var0008 Local $Var0009 = UBound($cmdline) - 1, $Var000A FnWndShowHide($GUIhWnd, 1) ControlShow($GUIhWnd, '', $GUIProgressBar) AdlibEnable('FnShowEncodingLabel', $gSleepTimeMs) For $Var00B1 = 1 To $Var0009 Local $Var000B, $Var000C, $Var000D, $Var000E Local $Var000F = SplitFileName($cmdline[$Var00B1], $Var000B, $Var000C, $Var000D, $Var000E) GUICtrlSetData($GUILabelStatus, $Var000D & $Var000E) GUICtrlSetData($GUI_Txt_Input, '') GUICtrlSetData($GUI_Txt_Input, $cmdline[$Var00B1]) FnCompileDecompile($cmdline[$Var00B1]) Sleep($gSleepTime) $gObfuFileData = FnRemoveComments($ScriptDir & "\EnCodeItInfo\Compiled.au3") Sleep($gSleepTime) $gObfuFileData = FnRemoveLineBreaks($gObfuFileData) Sleep($gSleepTime) FnScanFuncNames($gObfuFileData) Sleep($gSleepTime) $gObfuFileData = FnAddEnCodeItFuncs($gObfuFileData, $gVar0184) Sleep($gSleepTime) FnGetVarName($gObfuFileData) Sleep($gSleepTime) $gObfuFileData = FnReplaceVarStrFuncName($gObfuFileData) $gObfuFileData = FnJoin($gObfuFileData) Sleep($gSleepTime) $Var000A += UBound(StringSplit(StringStripCR($gObfuFileData), $lf)) - 1 $gOutPFileName &= FnOutpAndCleanup($cmdline[$Var00B1], $gObfuFileData) & @CR FnSetStatus($GUIProgressBar, $GUILabelStatus, $GUILabelProcentComplett, "File " & $Var00B1 & " of " & $Var0009 & " Done", (($Var00B1 / $Var0009) * 100)) Sleep(1000) Next AdlibDisable() $Var0006 = TimerDiff($Var0005) / 1000 MsgBox(64, "Info:", "You're Encoded files are here:" & $CR & $gOutPFileName & $CR & "It took EnCodeIt " & StringFormat("%i minute(s) and %i second(s)", $Var0006 / 60, Mod($Var0006, 60)) & " to obfuscate " & $Var0009 & " Files and " & $Var000A & " lines.") Local $Var0010 = Run(FileGetShortName($ScriptFullPath) & " /AutoIt3ExecuteScript " & FileGetShortName($ScriptDir & "\EnCodeItInfo\Backup.bak") & " " & $AutoItPID & " " & FileGetShortName($DocumentsCommonDir), '', @SW_HIDE) ProcessWait($Var0010) FileDelete($ScriptDir & "\EnCodeItInfo\Backup.bak") Exit EndIf While 1 Sleep(100000) WEnd Func FnWndHandler() Switch @GUI_CtrlId Case $MenuItem_Open, $M8D5A792FFC5B4F29 Local $Var0011 = FileOpenDialog("Choose a file to encode", @WorkingDir, "All Files (*.*)") If Not @error Then GUICtrlSetData($GUI_Txt_Input, $Var0011) Case $MenuItem_Exit FnQuit_EnCodeIt() Case $MenuItem_Change Local $Var0012 = FileOpenDialog("Change Compiler Aut2Exe", @WorkingDir, "Exe Files (*.exe)", "Aut2Exe.exe") If Not @error Then IniWrite($ScriptDir & "\EnCodeIt.ini", "Compiler", "Aut2Exe", $Var0012) GUICtrlSetData($M8D5A722A6C5B4FC9, $Var0012) EndIf Case $M8D5A7223685B4F29 Local $Var0013 = FileOpenDialog("Change Decompiler Aut2Exe", @WorkingDir, "Exe Files (*.exe)", "Exe2Aut.exe") If Not @error Then IniWrite($ScriptDir & "\EnCodeIt.ini", "Decompiler", "Exe2Aut", $Var0013) GUICtrlSetData($M8D5A722F6C5A4F79, $Var0012) EndIf Case $M8D5A722F6C5B5F29 Local $Var0014 = InputBox("Change Sleep Time", " ", "<Change Sleep Here>", '', 210, 120) If StringIsInt($Var0014) Then IniWrite($ScriptDir & "\EnCodeIt.ini", "SleepTime", "Sleep", Int($Var0014)) $gSleepTime = Int($Var0014) GUICtrlSetData($M8D5A728F4C5B4F29, "Current Sleep Average Is: " & Int($Var0014) & " Milliseconds") EndIf Case $GUIButton_StartEncoding If UBound($cmdline) - 1 <= 1 Then ;Set SleepTime If $gSleepTime > 0 And $gSleepTime < 11 Then $gSleepTimeMs = $gSleepTime * 100 ElseIf $gSleepTime = 0 Or $gSleepTime = '' Then $gSleepTimeMs = 10000 Else $gSleepTimeMs = 1000 EndIf ;Check $gVarCmdline_1 = GUICtrlRead($GUI_Txt_Input) If Not FileExists($gVarCmdline_1) Then MsgBox(16, "Error", "Please check to ensure that the file path is correct to the file you wish to encode.") Return '' EndIf Local $Var0004, $TimeStamp = TimerInit(), $VarTimerDiff, $VarMsgBoxRet, $Var0008 FnWndShowHide($GUIhWnd, 1) ControlShow($GUIhWnd, '', $GUIProgressBar) AdlibEnable('FnShowEncodingLabel', $gSleepTimeMs) ;Comment out because ExeToAut Decompiler don't support CommandlineArguments ;~ FnCompileDecompile($gVarCmdline_1) ;~ Sleep($gSleepTime) ;~ FnSetStatus($GUIProgressBar, $GUILabelStatus, $GUILabelProcentComplett, "Step 1 of 9 Done", 5) ; $gObfuFileData = FnRemoveComments($ScriptDir & "\EnCodeItInfo\Compiled.au3") $gObfuFileData = FnRemoveComments($gVarCmdline_1) Sleep($gSleepTime) FnSetStatus($GUIProgressBar, $GUILabelStatus, $GUILabelProcentComplett, "Step 2 of 9 Done", 10) MsgBox(0,"FilteredFileData",$gObfuFileData) $gObfuFileData = FnRemoveLineBreaks($gObfuFileData) Sleep($gSleepTime) FnSetStatus($GUIProgressBar, $GUILabelStatus, $GUILabelProcentComplett, "Step 3 of 9 Done", 20) MsgBox(0,"FnRemoveLineBreaks",$gObfuFileData) FnScanFuncNames($gObfuFileData) Sleep($gSleepTime) FnSetStatus($GUIProgressBar, $GUILabelStatus, $GUILabelProcentComplett, "Step 4 of 9 Done", 30) MsgBox(0,"FnScanFuncNames",$gObfuFileData) $gObfuFileData = FnAddEnCodeItFuncs($gObfuFileData, $gVar0184) Sleep($gSleepTime) FnSetStatus($GUIProgressBar, $GUILabelStatus, $GUILabelProcentComplett, "Step 5 of 9 Done", 40) MsgBox(0,"FnAddEnCodeItFuncs " & $gVar0184,$gObfuFileData) FnGetVarName($gObfuFileData) Sleep($gSleepTime) FnSetStatus($GUIProgressBar, $GUILabelStatus, $GUILabelProcentComplett, "Step 6 of 9 Done", 60) MsgBox(0,"FnGetVarName " ,$gObfuFileData) $gObfuFileData = FnReplaceVarStrFuncName($gObfuFileData) FnSetStatus($GUIProgressBar, $GUILabelStatus, $GUILabelProcentComplett, "Step 7 of 9 Done", 85) MsgBox(0,"FnReplaceVarStrFuncName " ,$gObfuFileData) $gObfuFileData = FnJoin($gObfuFileData) Sleep($gSleepTime) FnSetStatus($GUIProgressBar, $GUILabelStatus, $GUILabelProcentComplett, "Step 8 of 9 Done", 90) MsgBox(0,"FnJoin " ,$gObfuFileData) $VarOutPLines = StringSplit(StringStripCR($gObfuFileData), $lf) $gOutPFileName = FnOutpAndCleanup($gVarCmdline_1, $gObfuFileData) FnSetStatus($GUIProgressBar, $GUILabelStatus, $GUILabelProcentComplett, "Finished Encoding", 100) AdlibDisable() $VarTimerDiff = TimerDiff($TimeStamp) / 1000 $VarMsgBoxRet = MsgBox(68, "Info:", "You're Encoded file is here:" & $CR & $gOutPFileName & $CR & $CR & "It took EnCodeIt " & StringFormat("%i minute(s) and %i second(s)", $VarTimerDiff / 60, Mod($VarTimerDiff, 60)) & " to obfuscate " & $VarOutPLines[0] & " lines." & $CR & $CR & "Would you like to open the file now?") If $VarMsgBoxRet = 6 Then Run(@ComSpec & " /c """ & $gOutPFileName & """", '', @SW_HIDE) EndIf FnWndShowHide($GUIhWnd) ControlHide($GUIhWnd, '', $GUIProgressBar) GUICtrlSetData($lblEncoding, '') $gEncodeStartStop = False FnSetStatus($GUIProgressBar, $GUILabelStatus, $GUILabelProcentComplett, '', '') $gRndCharPrefix = Chr(Random(65, 90, 1)) EndIf EndSwitch EndFunc Func FnWndShowHide($Wnd, $ArgOpt01 = 0) Local $VarOldPos = WinGetPos($Wnd) If Not $ArgOpt01 And IsArray($VarOldPos) Then ; X position , Y position , Width , Height WinMove($Wnd, '', $VarOldPos[0], $VarOldPos[1], $VarOldPos[2], $VarOldPos[3] - 35) ElseIf IsArray($VarOldPos) Then WinMove($Wnd, '', $VarOldPos[0], $VarOldPos[1], $VarOldPos[2], $VarOldPos[3] + 35) EndIf EndFunc Func FnShowEncodingLabel() $gEncodeStartStop = Not $gEncodeStartStop If $gEncodeStartStop Then GUICtrlSetData($lblEncoding, "...Encoding...") Else GUICtrlSetData($lblEncoding, '') EndIf If IsArray($EnCodeItInfo_Dat) Then For $Var00B1 = 1 To UBound($EnCodeItInfo_Dat) - 1 If $EnCodeItInfo_Dat[$Var00B1] = "PausingEnCodeItUsage" Then MsgBox(16, "Warning!", "All usage has been temporarily suspened, this could be due to an update.", 5) Exit EndIf Next EndIf EndFunc Func FnSetStatus($Arg00, $Arg01, $Arg02, $Arg03, $Arg04) GUICtrlSetData($Arg00, $Arg04 + 10) GUICtrlSetData($Arg01, $Arg03) If $Arg04 <> '' Then GUICtrlSetData($Arg02, Round($Arg04, 2) & "%") Else GUICtrlSetData($Arg02, '') EndIf Return 1 EndFunc Func FnOutpAndCleanup($Arg00, $Arg01) Local $Var001B, $Var001C, $Var001D, $SeqNum = 1 $Var001B = SplitFileName($Arg00, $gOutpFileNDrive, $gOutpFileNPath, $gOutpFileNName, $gOutpFileNExt) ;Scan for exisiting File While FileExists($gOutpFileNDrive & $gOutpFileNPath & $gOutpFileNName & "_EnCoded" & $SeqNum & ".au3") $SeqNum += 1 WEnd Local $VarNewFileName = $gOutpFileNDrive & $gOutpFileNPath & $gOutpFileNName & "_EnCoded" & $SeqNum & ".au3" Local $VarhFile = FileOpen($VarNewFileName, 2) Local $VarhFileLog = FileOpen($gOutpFileNDrive & $gOutpFileNPath & $gOutpFileNName & "_EnCoded" & $SeqNum & ".log", 2) FileWrite($VarNewFileName, $Arg01) FileWrite($VarhFileLog, $gLogFile_EnCodeIt) FileWrite($VarhFileLog, $gLogFile_Functions) FileWrite($VarhFileLog, $gLogFile_Vars) FileClose($VarhFile) FileClose($VarhFileLog) FileDelete($ScriptDir & "\EnCodeItInfo\Compiled.au3") FileDelete($ScriptDir & "\EnCodeItInfo\Text.ini") FileDelete($ScriptDir & "\EnCodeItInfo\Var.ini") FileDelete($ScriptDir & "\EnCodeItInfo\Func.ini") FileDelete($ScriptDir & "\EnCodeItInfo\FuncReplace.ini") Return $VarNewFileName EndFunc Func FnJoin($Arg00) Local $Lines = StringSplit(StringStripCR($Arg00), $lf), $Var001D For $i = 1 To UBound($Lines) - 1 $Var001D &= StringStripWS($Lines[$i ], 7) & $CRLF Next Return StringTrimRight($Var001D, StringLen($CRLF)) EndFunc Func FnGetVarName($Arg00) Local $VarFuncNames, $Lines, $Var0026 = $gRndCharPrefix Local $Var0027 = StringRegExp ($Arg00, "(?i:\$)([a-zA-Z0-9/_]+)", 3) If Not IsArray($Var0027) Then Return SetError(1, 0, 0) For $Var00B1 = 0 To UBound($Var0027) - 1 $VarFuncNames &= $Var0027[$Var00B1] & Chr(01) Next $VarFuncNames = StringSplit(StringTrimRight($VarFuncNames, 1), Chr(01)) $VarFuncNames = Fn007C($VarFuncNames) Sleep($gSleepTime) $Lines = Fn0069($VarFuncNames) Sleep($gSleepTime) For $i = 1 To UBound($Lines) - 1 If $Lines[$i] = "cmdline" Or $Lines[$i] = "cmdlineraw" Then ContinueLoop $Lines[$i] = $gRndCharPrefix & $Lines[$i] Next Sleep($gSleepTime) FnVarNamesToVar_ini($VarFuncNames, $Lines) Sleep($gSleepTime) Return 1 EndFunc Func Fn0069(ByRef $ArgRef00) Local $Var0028, $Var0029, $Var002A = $g4ByteRandHex Local $Arr002B[UBound($ArgRef00) ] $Arr002B[0] = UBound($ArgRef00) - 1 For $Var004C = 1 To $Arr002B[0] If $ArgRef00[$Var004C] = "cmdline" Then $Arr002B[$Var004C] = "cmdline" ContinueLoop EndIf If $ArgRef00[$Var004C] = "cmdlineraw" Then $Arr002B[$Var004C] = "cmdlineraw" ContinueLoop EndIf $Arr002B[$Var004C] = $Var002A Do Local $Var002C = 0 Local $Var002D = Random(2, StringLen($Var002A) - 1, 1) $Arr002B[$Var004C] = StringLeft($Arr002B[$Var004C], $Var002D - 1) & Hex(Random(0, 15, 1), 1) & StringTrimLeft($Arr002B[$Var004C], $Var002D) For $Var0075 = 1 To $Var004C - 1 If $Arr002B[$Var0075] = $Arr002B[$Var004C] Then $Arr002B[$Var0075] = $Arr002B[$Var004C] $Var002C = 1 ExitLoop EndIf Next Until Not $Var002C Sleep($gSleepTime) Next Return $Arr002B EndFunc Func FnScanFuncNames($Arg00) Local $VarFuncNames, $Lines Local $VarFuncNames = GetFuncNames($Arg00) If Not IsArray($VarFuncNames) Then Return 1 ;Doesn't contain Functions ; Add internal EnCodeIt FunctionNames to $intEnCodeIt_FuncNames Local $intEnCodeIt_FuncNames = StringSplit("_EnCodeIt_UStr,_EnCodeIt_UStr2,_EnCodeIt_OStr", ",") For $i = 1 To UBound($intEnCodeIt_FuncNames) - 1 FnAddElementToArray($VarFuncNames, $intEnCodeIt_FuncNames[$i]) Next $VarFuncNames = Fn007C($VarFuncNames) Sleep($gSleepTime) $Lines = Fn006B($VarFuncNames) Sleep($gSleepTime) For $i = 1 To UBound($Lines) - 1 If $Lines[$i] = 'Fn009F' Or $Lines[$i] = "OnAutoItStart" Then ContinueLoop $Lines[$i] = "_" & $gRndCharPrefix & $Lines[$i] Next FnWriteFunc_ini($VarFuncNames, $Lines) Sleep($gSleepTime) Return 1 EndFunc Func Fn006B(ByRef $ArgRef00) Local $Var0028, $Var0029, $Var002A = $g4ByteRandHex Local $Arr002B[UBound($ArgRef00) ] $Arr002B[0] = UBound($ArgRef00) - 1 For $Var004C = 1 To $Arr002B[0] If $ArgRef00[$Var004C] = 'Fn009F' Then $Arr002B[$Var004C] = 'Fn009F' ContinueLoop EndIf If $ArgRef00[$Var004C] = "OnAutoItStart" Then $Arr002B[$Var004C] = "OnAutoItStart" ContinueLoop EndIf $Arr002B[$Var004C] = $Var002A Do Local $Var002C = 0 Local $Var002D = Random(2, StringLen($Var002A) - 1, 1) $Arr002B[$Var004C] = StringLeft($Arr002B[$Var004C], $Var002D - 1) & Hex(Random(0, 15, 1), 1) & StringTrimLeft($Arr002B[$Var004C], $Var002D) For $Var0075 = 1 To $Var004C - 1 If $Arr002B[$Var0075] = $Arr002B[$Var004C] Then $Var002C = 1 ExitLoop EndIf Next Until Not $Var002C Sleep($gSleepTime) Next Return $Arr002B EndFunc Func GetFuncNames($Arg00) Local $Lines = StringSplit(StringStripCR($Arg00), @LF) Local $ArrFuncNames[$Lines[0] + 1], $VarFuncCount, $Var003B For $i = 1 To $Lines[0] ;Is Line a Function? If StringLeft(StringStripWS($Lines[$i], 8), 4) = "func" Then ;Does it have '(' ? If Not StringInStr($Lines[$i], "(") Then ContinueLoop $VarFuncCount += 1 $VarFuncSplit = StringSplit($Lines[$i], "(") $ArrFuncNames[$VarFuncCount] = StringTrimLeft(StringStripWS($VarFuncSplit[1], 8), 4) EndIf Next ReDim $ArrFuncNames[$VarFuncCount + 1] Return $ArrFuncNames EndFunc Func FnAddEnCodeItFuncs($ScriptData, $DivKey) Local $Var003C = Random(30, 190, 1), $Var003D Local $VariEnCodeItLevel5Call = FnMake_EnCodeIt_UStr2_Call($DivKey) Local $Var001D = Fn006E($ScriptData), $Var0040 Fn007F($Var001D) Sleep($gSleepTime) Local $Arr0041[UBound($Var001D) ], $Var0040[UBound($Var001D) ] For $Var004C = 1 To UBound($Var001D) - 1 If StringLen($Var001D[$Var004C]) > 2 And StringLeft($Var001D[$Var004C], 1) = """" And StringRight($Var001D[$Var004C], 1) = """" Then If StringInStr($Var001D[$Var004C], """""") Then $Var0040[$Var004C] = StringReplace($Var001D[$Var004C], """""", """") Else $Var0040[$Var004C] = $Var001D[$Var004C] EndIf ElseIf StringLen($Var001D[$Var004C]) > 2 And StringLeft($Var001D[$Var004C], 1) = "'" And StringRight($Var001D[$Var004C], 1) = "'" Then If StringInStr($Var001D[$Var004C], "''") Then $Var0040[$Var004C] = StringReplace($Var001D[$Var004C], "''", "'") Else $Var0040[$Var004C] = $Var001D[$Var004C] EndIf Else $Var0040[$Var004C] = $Var001D[$Var004C] EndIf $Arr0041[$Var004C] = "iEnCodeItEnS" & $Var004C $Var003D &= "Global Const $iEnCodeItEnS" & $Var004C & " = " & "_EnCodeIt_UStr(" & "'" & Fn007D($Var0040[$Var004C], $DivKey) & "'" & ", $iEnCodeItLevel5)" & $CRLF Next $ScriptData = StringTrimRight($Var003D, StringLen($CRLF)) & $CRLF & $ScriptData Sleep($gSleepTime) Fn008B($Var001D, $Arr0041) Sleep($gSleepTime) $ScriptData = "Global Const $iEnCodeItLevel5 = " & $VariEnCodeItLevel5Call & $CRLF & $ScriptData $ScriptData = "Global Const $EnCodeItConstVar = Int(99/3+15*100/4-13^2+81/3-17-245+99/3+15*100/4-13^2+81/3-17)" & $CRLF & $ScriptData Sleep($gSleepTime) $ScriptData &= $CRLF & Fn_EnCodeIt_Funcs_Body() Return $ScriptData EndFunc Func Fn006E($Arg00) Local $Var0043, $Arr0044[2] = ['', False], $Var0045 = False, $Var0046, $Var0047 Local $Var0048 = Fn00AE($ScriptDir & "\EnCodeItInfo\Func.ini", "Funcs") $Var0043 = Fn00A1($Arg00) If Not @error Then $Arg00 = Fn0071($Var0043, $Arg00) $Arr0044[1] = True EndIf For $M845A72266C5B4F29 = 1 To UBound($Var0043, 1) - 1 IniWrite($ScriptDir & "\EnCodeItInfo\FuncReplace.ini", "FunctionReplace", $Var0043[$M845A72266C5B4F29][1], $Var0043[$M845A72266C5B4F29][0]) Next Local $Var0049, $Var004A Local $Var004B = StringReplace($Arg00, "''", "ss") $Var004B = StringReplace($Var004B, """""", "dd") Local $Var004C = 0, $Var003A = 0, $Var004E, $Var0045 While StringLen($Arg00) > 0 $Var004A = StringInStr($Var004B, "'") $Var0049 = StringInStr($Var004B, """") If Not $Var004A And Not $Var0049 Then ExitLoop If $Var0049 > 0 And ($Var004A > $Var0049 Or $Var004A = 0) Then $M8DAA72276C5B4F29 = """" $Arg00 = StringTrimLeft($Arg00, $Var0049 - 1) $Var004B = StringTrimLeft($Var004B, $Var0049 - 1) Else $M8DAA72276C5B4F29 = "'" $Arg00 = StringTrimLeft($Arg00, $Var004A - 1) $Var004B = StringTrimLeft($Var004B, $Var004A - 1) EndIf $M8D8A722F6C5B5F29 = StringInStr($Var004B, $M8DAA72276C5B4F29, 0, 2) If $M8D8A722F6C5B5F29 > 0 Then $Var0046 = StringLeft($Arg00, $M8D8A722F6C5B5F29) If Not StringInStr(Chr(01) & $Var0047, Chr(01) & $Var0046 & Chr(01), 1) Then $Var0047 &= $Var0046 & Chr(01) For $M8D5A722F0CDB4F29 = 1 To $Var0048[0][0] If $Var0048[$M8D5A722F0CDB4F29][0] = StringTrimRight(StringTrimLeft($Var0046, 1), 1) Then $Var0045 = True $Arg00 = StringTrimLeft($Arg00, $M8D8A722F6C5B5F29) $Var004B = StringTrimLeft($Var004B, $M8D8A722F6C5B5F29) ExitLoop EndIf Next If Not $Var0045 Then $Var004E &= $Var0046 & $lf $Arg00 = StringTrimLeft($Arg00, $M8D8A722F6C5B5F29) $Var004B = StringTrimLeft($Var004B, $M8D8A722F6C5B5F29) EndIf $Var0045 = False Else $Arg00 = StringTrimLeft($Arg00, $M8D8A722F6C5B5F29) $Var004B = StringTrimLeft($Var004B, $M8D8A722F6C5B5F29) EndIf Else ExitLoop EndIf WEnd If $Arr0044[1] Then $Var004E = Fn006F($Var0043, $Var004E) Return StringSplit(StringTrimRight($Var004E, 1), $lf) EndFunc Func Fn006F(ByRef $ArgRef00, $Arg01) For $Var004C = UBound($ArgRef00) - 1 To 1 Step - 1 $Arg01 = StringReplace($Arg01, $ArgRef00[$Var004C][1], $ArgRef00[$Var004C][0], 0, 1) Next Return $Arg01 EndFunc Func Fn0070($Arg00, $Arg01, $Arg02) Local $Var0050 = Fn0088($Arg00, "\s" & $Arg01, $Arg02) If Not @extended And Not IsArray($Var0050) Then Return SetError(1, 0, 0) Local $Var0051 = "Somethingreallylongandobnoxiousforreplacementof" & StringStripWS($Arg01, 8) $Var0050 = Fn007C($Var0050, 0) Local $Arr0052[$Var0050[0] + 1][2] For $Var004C = 1 To $Var0050[0] $Arr0052[$Var004C][0] = $Var0050[$Var004C] $Arr0052[$Var004C][1] = $Var0051 & $Var004C Next Return $Arr0052 EndFunc Func Fn0071(ByRef $ArgRef00, $Arg01) For $Var004C = 1 To UBound($ArgRef00) - 1 $Arg01 = StringReplace($Arg01, $ArgRef00[$Var004C][0], $ArgRef00[$Var004C][1], 0, 1) Next Return $Arg01 EndFunc Func FnRemoveComments($FileName) Local $VarLinesFromFile = StringSplit(StringStripCR(FileRead($FileName)), @LF) Local $I, $Var001D, $VarAposPos, $VarStrPos, $VarCommentPos, $LineFiltered, $VarChar ;Go through all lines in the File For $I = 1 To UBound($VarLinesFromFile) - 1 If StringLeft(StringStripWS($VarLinesFromFile[$I], 7), 3) = "#cs" Then Do $I += 1 Until StringLeft(StringStripWS($VarLinesFromFile[$I], 7), 3) = "#ce" Or $I = $VarLinesFromFile[0] ContinueLoop EndIf If StringLeft(StringStripWS($VarLinesFromFile[$I], 7), 7) = "#region" Or StringLeft(StringStripWS($VarLinesFromFile[$I], 7), 10) = "#endregion" Then ContinueLoop ;Replace "" => dd and '' =>ss $LineFiltered = StringReplace($VarLinesFromFile[$I], "''", "ss") ;Bug? $LineFiltered = StringReplace($VarLinesFromFile[$I], """""", "dd") $LineFiltered = StringReplace($LineFiltered, """""", "dd") $Var0080 = 0 $VarSomePos = 0 While 1 $VarAposPos = StringInStr($LineFiltered, "'") $VarStrPos = StringInStr($LineFiltered, """") $VarCommentPos = StringInStr($LineFiltered, ";") If Not $VarCommentPos Then $Var0080 = StringLen($VarLinesFromFile[$I]) + 1 ExitLoop EndIf $VarSomePos = $VarCommentPos If $VarAposPos <> 0 And $VarAposPos < $VarSomePos Then $VarSomePos = $VarAposPos If $VarStrPos <> 0 And $VarStrPos < $VarSomePos Then $VarSomePos = $VarStrPos $VarChar = StringMid($LineFiltered, $VarSomePos, 1) $Var0080 += $VarSomePos If $VarChar = ";" Then ExitLoop $LineFiltered = StringTrimLeft($LineFiltered, $VarSomePos) $VarSomePos = StringInStr($LineFiltered, $VarChar) $LineFiltered = StringTrimLeft($LineFiltered, $VarSomePos) $Var0080 += $VarSomePos WEnd If StringStripWS(StringLeft($VarLinesFromFile[$I], $Var0080 - 1), 7) <> '' Then $Var001D &= StringLeft($VarLinesFromFile[$I], $Var0080 - 1) & $CRLF EndIf Next Return StringTrimRight($Var001D, StringLen($CRLF)) EndFunc Func FnRemoveLineBreaks($Arg00) Local $Lines = StringSplit(StringStripCR($Arg00), $lf) Local $RetStr, $i, $Var005E, $Var005F, $Var0045, $Var0059 For $i = 1 To UBound($Lines) - 1 If StringMid(StringStripWS($Lines[$i], 8), StringLen(StringStripWS($Lines[$i], 8)), 1) = "_" Then $Var005F = StringLen($Lines[$i]) While $Var005F > 1 If StringMid($Lines[$i], $Var005F, 1) = "_" And StringMid($Lines[$i], $Var005F - 1, 1) = " " Then $Var0059 = StringLeft($Lines[$i], $Var005F - 1) If StringLeft($Var0059, 1) = Chr(32) Or StringLeft($Var0059, 1) = Chr(09) Then While StringLeft($Var0059, 1) = Chr(32) Or StringLeft($Var0059, 1) = Chr(09) If StringLeft($Var0059, 1) = Chr(32) Then $Var0059 = StringTrimLeft($Var0059, 1) ElseIf StringLeft($Var0059, 1) = Chr(09) Then $Var0059 = StringTrimLeft($Var0059, StringLen(Chr(09))) EndIf WEnd EndIf $RetStr &= $Var0059 $Var0045 = True ExitLoop EndIf $Var005F -= 1 WEnd EndIf If $Var0045 Then If StringMid(StringStripWS($Lines[$i + 1], 8), StringLen(StringStripWS($Lines[$i + 1], 8)), 1) = "_" Then ContinueLoop $i += 1 If StringLeft($Lines[$i], 1) = Chr(32) Or StringLeft($Lines[$i], 1) = Chr(09) Then While StringLeft($Lines[$i], 1) = Chr(32) Or StringLeft($Lines[$i], 1) = Chr(09) If StringLeft($Lines[$i], 1) = Chr(32) Then $Lines[$i] = StringTrimLeft($Lines[$i], 1) ElseIf StringLeft($Lines[$i], 1) = Chr(09) Then $Lines[$i] = StringTrimLeft($Lines[$i], StringLen(Chr(09))) EndIf WEnd EndIf $RetStr &= $Lines[$i] & $CRLF Else $RetStr &= $Lines[$i] & $CRLF EndIf $Var0045 = False Next Return StringTrimRight($RetStr, StringLen($CRLF)) EndFunc Func Fn0074($Arg00, ByRef $ArgRef01) $ArgRef01 = StringSplit(StringStripCR(FileRead($Arg00)), $lf) Return 1 EndFunc Func FnCompileDecompile($Arg00) $Arg00 = $Arg00 Local $VarDecompiler = IniRead($ScriptDir & "\EnCodeIt.ini", "Decompiler", "Exe2Aut", '') Local $VarCompiler = IniRead($ScriptDir & "\EnCodeIt.ini", "Compiler", "Aut2Exe", '') Local $VarCompiled = $ScriptDir & "\EnCodeItInfo\Compiled." MsgBox(0,"Executing Compiler with",$VarCompiler & " /in """ & $Arg00 & """ /out """ & $VarCompiled & "exe" & """ /pass ""A""") RunWait($VarCompiler & " /in """ & $Arg00 & """ /out """ & $VarCompiled & "exe" & """ /pass ""A""") MsgBox(0,"Executing DeCompiler with",$VarDecompiler & " /in """ & $VarCompiled & "exe" & """ /out """ & $VarCompiled & "au3" & """ /pass ""A""") RunWait($VarDecompiler & " /in """ & $VarCompiled & "exe" & """ /out """ & $VarCompiled & "au3" & """ /pass ""A""") FileDelete($VarCompiled & "exe") EndFunc Func InitFiles() ; Delete Note: ScriptDir: Directory containing the running script. If FileExists($ScriptDir & "\EnCodeItInfo\_Revamp191.dll") Then FileDelete($ScriptDir & "\EnCodeItInfo\_Revamp191.dll") If FileExists($ScriptDir & "\EnCodeItInfo\Tranquill.skf") Then FileDelete($ScriptDir & "\EnCodeItInfo\Tranquill.skf") ; Make 'EnCodeItInfo\' Dir If Not FileExists($ScriptDir & "\EnCodeItInfo") Then ; mkdir & Move "c:\EnCodeItInfo" -> "E:\test\EnCodeItInfo" DirCreate($HomeDrive & "\EnCodeItInfo") FileSetAttrib($HomeDrive & "\EnCodeItInfo", "+H", 1) DirMove($HomeDrive & "\EnCodeItInfo", $ScriptDir & "\EnCodeItInfo", 1) EndIf If Not FileExists($ScriptDir & "\EnCodeItInfo\SkinCrafter.dll") Then FileInstall('C:\Documents and Settings\EnCodeItInfo\SkinCrafter.dll', $ScriptDir & "\EnCodeItInfo\SkinCrafter.dll", 1) If Not FileExists($ScriptDir & "\EnCodeItInfo\200699.dll") Then FileInstall('C:\Documents and Settings\EnCodeItInfo\200699.dll', $ScriptDir & "\EnCodeItInfo\200699.dll", 1) ; Start Skincrafter $gVarRetLoadSkinCrafter = LoadSkinCrafter ($ScriptDir & "\EnCodeItInfo\SkinCrafter.dll", $ScriptDir & "\EnCodeItInfo\200699.dll") ; Run Config ; If Not FileExists($ScriptDir & "\EnCodeIt.ini") Then FirstTimeConfig() ;Stupid path name check ; If Not StringInStr($ScriptFullPath, "EnCodeIt 2.0") Then ; MsgBox(16, "Error", "EnCodeIt.exe must be ran from within the EnCodeIt 2.0 folder.") ; Exit ; EndIf EndFunc Func FirstTimeConfig() Local $Var0065, $Var0063, $Var0062, $Okay $Var0065 = MsgBox(64, "Info:", "Welcome to EnCodeIt for AutoIt.au3 Scripts." & $CR & "Let's just take a few seconds to setup file locations.") If $Var0065 = 7 Then MsgBox(16, "Error", "GoodBye") While 1 $Var0063 = FileOpenDialog("Find Aut2Exe", $HomeDrive, "Exe Files (*.*)", 3, "Aut2Exe.exe") If Not @error Then MsgBox(64, "Exe2Aut", "Now find the decompiler.") While 1 $Var0062 = FileOpenDialog("Find Exe2Au3", $HomeDrive, "Exe Files (*.*)", 3, "Exe2Aut.exe") If @error Then $Var0065 = MsgBox(20, "Error", "There was an error retrieving the file, Would you like to quit?") If $Var0065 = 6 Then MsgBox(64, "Quitting", "GoodBye") Exit EndIf Else $Okay = 1 ExitLoop EndIf WEnd Else $Var0065 = MsgBox(20, "Error", "There was an error retrieving the file, Would you like to quit?") If $Var0065 = 6 Then MsgBox(64, "Quitting", "GoodBye") Exit EndIf EndIf If $Okay Then ExitLoop WEnd IniWrite($ScriptDir & "\EnCodeIt.ini", "Compiler", "Aut2Exe", FileGetShortName($Var0063)) IniWrite($ScriptDir & "\EnCodeIt.ini", "Decompiler", "Exe2Aut", FileGetShortName($Var0062)) IniWrite($ScriptDir & "\EnCodeIt.ini", "SleepTime", "Sleep", 10) EndFunc Func Fn0078($ArgOpt00 = -1) If $ArgOpt00 <> -1 Then Local $Var0069 = DllCall("kernel32.dll", "int", "OpenProcess", "int", 0x1F0FFF, "int", False, "int", $ArgOpt00) Local $Var006A = DllCall($ScriptDir & "\psapi.dll", "int", "EmptyWorkingSet", "long", $Var0069[0]) DllCall("kernel32.dll", "int", "CloseHandle", "int", $Var0069[0]) Else Local $Var006A = DllCall("psapi.dll", "int", "EmptyWorkingSet", "long", -1) EndIf Return $Var006A[0] EndFunc Func FnMake_EnCodeIt_UStr2_Call($DivKey) Local $VarChar For $i = 1 To StringLen($DivKey) $VarChar = $VarChar & Chr(Asc(StringMid($DivKey, $i, 1)) + ($gDivKey2 - 11)) Next Return "_EnCodeIt_UStr2(" & "'" & Fn0081($VarChar) & "'" & ", $EnCodeItConstVar)" EndFunc Func FnAddElementToArray(ByRef $ArgRef00, $Arg01) If Not IsArray($ArgRef00) Then Return SetError(1, 0, 0) ReDim $ArgRef00[UBound($ArgRef00) + 1] $ArgRef00[UBound($ArgRef00) - 1] = $Arg01 Return 1 EndFunc Func Fn007B($Arg00, $Arg01) If IsArray($Arg00) Then Return Fn007C($Arg00) If StringRight($Arg00, StringLen($Arg01)) = $Arg01 Then $Arg00 = StringTrimRight($Arg00, StringLen($Arg01)) Local $Var005E = StringSplit(StringStripCR($Arg00), $Arg01), $Var001D, $Lines For $Var004C = 1 To $Var005E[0] If StringInStr($Arg01 & $Var001D, $Arg01 & $Var005E[$Var004C] & $Arg01, 1) Or $Var005E[$Var004C] = '' Then ContinueLoop $Var001D &= $Var005E[$Var004C] & $Arg01 Next $Lines = StringSplit(StringTrimRight($Var001D, StringLen($Arg01)), $Arg01) Fn007F($Lines) Return $Lines EndFunc Func Fn007C($Arg00, $ArgOpt01 = 1, $ArgOpt02 = '') If IsString($Arg00) Then Return Fn007B($Arg00, $ArgOpt02) If $ArgOpt02 = '' Then $ArgOpt02 = Chr(01) Local $Var001D, $Lines For $i = $ArgOpt01 To UBound($Arg00) - 1 If StringInStr($ArgOpt02 & $Var001D, $ArgOpt02 & $Arg00[$i] & $ArgOpt02, 1) Then ContinueLoop If $Arg00[$i] <> '' Then $Var001D &= $Arg00[$i] & $ArgOpt02 Next $Lines = StringSplit(StringTrimRight($Var001D, StringLen($ArgOpt02)), $ArgOpt02) Fn007F($Lines, $ArgOpt01) Return $Lines EndFunc Func Fn007D($Arg00, $Arg01) Local $Var006C $Arg00 = StringTrimLeft(StringTrimRight($Arg00, 1), 1) For $M8D5A722F635B4FB9 = 1 To StringLen($Arg00) $Var006C = $Var006C & Chr(Asc(StringMid($Arg00, $M8D5A722F635B4FB9, 1)) + $Arg01) Next Return Fn0081($Var006C) EndFunc Func Fn007E(ByRef $ArgRef00, $Arg01, $ArgOpt02 = 1) If Not IsArray($ArgRef00) Then Return SetError(1, 0, 0) Local $Var0073 = UBound($ArgRef00), $Var004C, $Var0075 Local $VarFuncNames[$Var0073], $Var0077 = ($Var0073 - $Arg01) For $Var004C = $Var0073 - 1 To ($Var0077 + $ArgOpt02) Step - 1 $VarFuncNames[$Var004C] = $ArgRef00[$Var004C - $Var0077] Next For $Var0075 = $ArgOpt02 To $Var0077 $VarFuncNames[$Var0075] = $ArgRef00[ ($Var0073 - 1) - ($Var0077 - $Var0075) ] Next $ArgRef00 = $VarFuncNames Return True EndFunc Func Fn007F(ByRef $ArgRef00, $ArgOpt01 = 1) For $Var004C = $ArgOpt01 To UBound($ArgRef00) - 2 Local $Var0078 = $Var004C, $Var0079 For $Var0075 = $Var004C + 1 To UBound($ArgRef00) - 1 If StringLen($ArgRef00[$Var0075]) > StringLen($ArgRef00[$Var0078]) Then $Var0078 = $Var0075 If @error Then SetError(1, 0, False) Next If $Var0078 <> $Var004C Then Local $Var0079 = $ArgRef00[$Var004C] $ArgRef00[$Var004C] = $ArgRef00[$Var0078] $ArgRef00[$Var0078] = $Var0079 EndIf Next Return True EndFunc Func Fn0080($Arg00) ; Return BinaryString("0x" & $Arg00) Return Binary("0x" & $Arg00) EndFunc Func Fn0081($Arg00) ; Return Hex(BinaryString($Arg00)) Return Hex(Binary($Arg00)) EndFunc Func FnQuit_EnCodeIt() GUIDelete(HWnd($gVar0187)) DllCall($gVarRetLoadSkinCrafter, "int", "DeInitDecoration") DllCall($gVarRetLoadSkinCrafter, "int", "RemoveSkin") DllClose($gVarRetLoadSkinCrafter) Exit 0 EndFunc Func Unload_EnCodeIt() If MsgBox(36, "Exit", "Are you sure you would like to exit EnCodeIt?") = 6 Then GUIDelete(HWnd($gVar0187)) DllCall($gVarRetLoadSkinCrafter, "int", "DeInitDecoration") DllCall($gVarRetLoadSkinCrafter, "int", "RemoveSkin") DllClose($gVarRetLoadSkinCrafter) FileDelete($ScriptDir & "\EnCodeItInfo\Compiled.au3") FileDelete($ScriptDir & "\EnCodeItInfo\Text.ini") FileDelete($ScriptDir & "\EnCodeItInfo\Var.ini") FileDelete($ScriptDir & "\EnCodeItInfo\Func.ini") FileDelete($ScriptDir & "\EnCodeItInfo\FuncReplace.ini") FileDelete($ScriptDir & "\EnCodeItInfo\Backup.bak") Exit EndIf EndFunc Func Fn0084($Arg00, $ArgOpt01 = 0, $ArgOpt02 = 0) $ArgOpt01 = StringInStr($Arg00, $ArgOpt01) + StringLen($ArgOpt01) Return StringMid($Arg00, $ArgOpt01, StringInStr($Arg00, $ArgOpt02) - $ArgOpt01) EndFunc Func SplitFileName($FinishedPath, ByRef $ArgRef01, ByRef $ArgRef02, ByRef $ArgRef03, ByRef $ArgRef04) Local $VarDrive, $Path, $Filename, $Ext, $i, $Var0080, $ArrFileName[5] ;AbsolutePath? If StringMid($FinishedPath, 2, 1) = ":" Then $VarDrive = StringLeft($FinishedPath, 2) $FinishedPath = StringTrimLeft($FinishedPath, 2) ;NetworkPath? ElseIf StringLeft($FinishedPath, 2) = "\\" Then $FinishedPath = StringTrimLeft($FinishedPath, 2) $Var0080 = StringInStr($FinishedPath, "\") If $Var0080 = 0 Then $Var0080 = StringInStr($FinishedPath, "/") If $Var0080 = 0 Then $VarDrive = "\\" & $FinishedPath $FinishedPath = "" Else $VarDrive = "\\" & StringLeft($FinishedPath, $Var0080 - 1) $FinishedPath = StringTrimLeft($FinishedPath, $Var0080 - 1) EndIf EndIf ;split Path & Name.ext For $i = StringLen($FinishedPath) To 0 Step - 1 If StringMid($FinishedPath, $i, 1) = "\" Or StringMid($FinishedPath, $i, 1) = "/" Then $Path = StringLeft($FinishedPath, $i) $Filename = StringRight($FinishedPath, StringLen($FinishedPath) - $i) ExitLoop EndIf Next If StringLen($Path) = 0 Then $Filename = $FinishedPath For $i = StringLen($Filename) To 0 Step - 1 If StringMid($Filename, $i, 1) = "." Then $Ext = StringRight($Filename, StringLen($Filename) - ($i - 1)) $Filename = StringLeft($Filename, $i - 1) ExitLoop EndIf Next $ArgRef01 = $VarDrive $ArgRef02 = $Path $ArgRef03 = $Filename $ArgRef04 = $Ext $ArrFileName[1] = $VarDrive $ArrFileName[2] = $Path $ArrFileName[3] = $Filename $ArrFileName[4] = $Ext Return $ArrFileName EndFunc Func FnReplaceVarStrFuncName($Arg00, $ArgOpt01 = 1) Local $Var0082 = $ScriptDir & "\EnCodeItInfo\", $Var0083 $Arg00 = Fn00AC(Fn00AB(Fn00A5($Arg00))) Sleep($gSleepTime) Return $Arg00 EndFunc Func Fn0087($Arg00, $ArgOpt01 = 1) Local $Var0082 = $ScriptDir & "\EnCodeItInfo\", $Var0083 FileClose(FileOpen($Var0082 & "1.properties", 2)) $Arg00 = Fn00A5($Arg00) FileWrite($Var0082 & "1.properties", $Arg00) Sleep(100) $Arg00 = Fn00AB(FileRead($Var0082 & "1.properties")) FileClose(FileOpen($Var0082 & "1.properties", 2)) FileWrite($Var0082 & "1.properties", $Arg00) Sleep(100) $Arg00 = Fn00AC(FileRead($Var0082 & "1.properties")) FileClose(FileOpen($Var0082 & "1.properties", 2)) FileWrite($Var0082 & "1.properties", $Arg00) $Var0083 &= FileRead($Var0082 & "1.properties") FileDelete($Var0082 & "1.properties") Sleep($gSleepTime) FileClose(FileOpen($Var0082 & "Compiled.au3", 2)) FileWrite($Var0082 & "Compiled.au3", $Var0083) Return 1 EndFunc Func Fn0088($Arg00, $Arg01, $Arg02, $ArgOpt03 = 'i') If $ArgOpt03 <> "i" Then $ArgOpt03 = '' $Var0027 = StringRegExp ($Arg00, "(?" & $ArgOpt03 & ":" & $Arg01 & ")(.*?)(?" & $ArgOpt03 & ":" & $Arg02 & ")", 3) If @extended & IsArray($Var0027) Then Return $Var0027 Return SetError(1, 0, 0) EndFunc Func FnVarNamesToVar_ini(ByRef $ArgRef00, ByRef $ArgRef01) Local $Var0086 = Fn00AE($ScriptDir & "\EnCodeItInfo\Var.ini", "Vars") Local $Var003A, $Var0088 = Fn008C($ArgRef00) If IsArray($Var0086) And $Var0086[0][0] > 0 Then For $Var004C = 1 To UBound($ArgRef00) - 1 If Not StringInStr($ArgRef00[$Var004C], "EnCodeIt") Then $Var003A += 1 $gLogFile_Vars &= " " & StringFormat("% 6d", $Var003A) & ". " & "$" & $ArgRef00[$Var004C] & $Var0088[$Var004C] & StringFormat("% 6d", $Var003A) & ". " & "$" & $ArgRef01[$Var004C] & $CRLF EndIf IniWrite($ScriptDir & "\EnCodeItInfo\Var.ini", "Vars", $ArgRef00[$Var004C], $ArgRef01[$Var004C]) For $Var0075 = 1 To $Var0086[0][0] If $ArgRef00[$Var004C] = $Var0086[$Var0075][1] Then IniWrite($ScriptDir & "\EnCodeItInfo\Var.ini", "Vars", $Var0086[$Var0075][0], "$" & $ArgRef01[$Var004C]) ExitLoop EndIf Next Next Else For $Var004C = 1 To UBound($ArgRef00) - 1 IniWrite($ScriptDir & "\EnCodeItInfo\Var.ini", "Vars", $ArgRef00[$Var004C], $ArgRef01[$Var004C]) If Not StringInStr($ArgRef00[$Var004C], "EnCodeIt") Then $Var003A += 1 $gLogFile_Vars &= " " & StringFormat("% 6d", $Var003A) & ". " & "$" & $ArgRef00[$Var004C] & $Var0088[$Var004C] & StringFormat("% 6d", $Var003A) & ". " & "$" & $ArgRef01[$Var004C] & $CRLF EndIf Next EndIf Return 1 EndFunc Func FnWriteFunc_ini(ByRef $ArgRef00, ByRef $ArgRef01) Local $Var003A, $Var0088 = Fn008C($ArgRef00) For $Var004C = 1 To UBound($ArgRef00) - 1 IniWrite($ScriptDir & "\EnCodeItInfo\Func.ini", "Funcs", $ArgRef00[$Var004C], $ArgRef01[$Var004C]) If Not StringInStr($ArgRef00[$Var004C], "_EnCodeIt_") Then $Var003A += 1 $gLogFile_Functions &= " " & StringFormat("% 6d", $Var003A) & ". " & $ArgRef00[$Var004C] & $Var0088[$Var004C] & StringFormat("% 6d", $Var003A) & ". " & $ArgRef01[$Var004C] & $CRLF EndIf Next Return 1 EndFunc Func Fn008B(ByRef $ArgRef00, ByRef $ArgRef01) For $Var004C = 1 To UBound($ArgRef00) - 1 IniWrite($ScriptDir & "\EnCodeItInfo\Text.ini", "Text", $ArgRef01[$Var004C], $ArgRef00[$Var004C]) Next Return 1 EndFunc Func Fn008C(ByRef $ArgRef00) Local $Arr008B[UBound($ArgRef00) ], $Var003A For $Var004C = 1 To UBound($ArgRef00) - 1 For $Var0075 = 1 To ((12 + StringLen($ArgRef00[1])) - StringLen($ArgRef00[$Var004C])) $Arr008B[$Var004C] &= Chr(32) Next Next Return $Arr008B EndFunc Func FnGetMonthName($Arg00) Local $ArrMonthNames[13] = ['', "January", "February", "March", "April", "May", "June", "July", "August", "September", "October", "November", "December"] Return $ArrMonthNames[$Arg00] EndFunc Func FnGetTime() Local $VarHOUR = @HOUR, $VarMIN = @MIN, $VarAM_PM If $VarHOUR < 12 Then If $VarHOUR = 00 Then $VarHOUR = 12 $VarAM_PM = " AM" Else If $VarHOUR > 12 Then $VarHOUR -= 12 $VarAM_PM = " PM" EndIf Return $VarHOUR & ":" & $VarMIN & $VarAM_PM EndFunc Func Fn4ByteRandHex() Local $Var002A For $Var004C = 1 To 4 $Var002A &= Hex(Random(0, 2 ^ 16 - 1, 1), 4) Next Return $Var002A EndFunc Func Fn_EnCodeIt_Funcs_Body() Return "Func _EnCodeIt_UStr($sEnCodeItFunction, $iEnCodeItLevel3)" & $CRLF & "Local $iEncodeItOutKey" & $CRLF & "$sEnCodeItFunction = _EnCodeIt_OStr($sEnCodeItFunction)" & $CRLF & "For $xEnCodeItCount = 1 to StringLen($sEnCodeItFunction)" & $CRLF & "$iEncodeItOutKey = $iEncodeItOutKey & Chr(Asc(StringMid($sEnCodeItFunction,$xEnCodeItCount,1))-" & "$iEnCodeItLevel3" & ")" & $CRLF & "Next" & $CRLF & "Return $iEncodeItOutKey" & $CRLF & "EndFunc" & $CRLF & "Func _EnCodeIt_OStr($sEnCodeItStrHex)" & $CRLF & "Local $sEnCodeItChar" & $CRLF & "$aEnCodeIt = StringSplit($sEnCodeItStrHex, """")" & $CRLF & "If Mod($aEnCodeIt[0], 2) <> 0 Then Return SetError(1, 0, -1)" & $CRLF & "For $iXEnCodeItCount = 1 To $aEnCodeIt[0]" & $CRLF & "$iEnCodeItOne = $aEnCodeIt[$iXEnCodeItCount]" & $CRLF & "$iXEnCodeItCount += 1" & $CRLF & "$iEnCodeItTwo = $aEnCodeIt[$iXEnCodeItCount]" & $CRLF & "$iEnCodeItDec = Dec($iEnCodeItOne & $iEnCodeItTwo)" & $CRLF & "If @error <> 0 Then Return SetError(1, 0, -1)" & $CRLF & "$iEnCodeItChar = Chr($iEnCodeItDec)" & $CRLF & "$sEnCodeItChar &= $iEnCodeItChar" & $CRLF & "Next" & $CRLF & "Return $sEnCodeItChar" & $CRLF & "EndFunc" & $CRLF & "Func _EnCodeIt_UStr2($sEnCodeItFunction, $EnCodeItConstVar)" & $CRLF & "Local $iEncodeItOutKey" & $CRLF & "$iEnCodeItDiv = " & ($gDivKey2 - 11) & $CRLF & "$sEnCodeItFunction = _EnCodeIt_OStr($sEnCodeItFunction)" & $CRLF & "For $xEnCodeItCount = 1 to StringLen($sEnCodeItFunction)" & $CRLF & "$iEncodeItOutKey &= Chr(Asc(StringMid($sEnCodeItFunction,$xEnCodeItCount,1))-" & "Int($iEnCodeItDiv)" & ")" & $CRLF & "Next" & $CRLF & "Return $iEncodeItOutKey" & $CRLF & "EndFunc" EndFunc Func Fn0091($Arg00, $Arg01, $Arg02, $ArgOpt03 = 0) If $Arg01 <= 0 Then Return SetError(4, 0, 0) If Not IsString($Arg02) Then Return SetError(6, 0, 0) If $ArgOpt03 <> 0 And $ArgOpt03 <> 1 Then Return SetError(5, 0, 0) If Not FileExists($Arg00) Then Return SetError(2, 0, 0) Local $Var0092 = FileRead($Arg00) $Var0092 = StringSplit($Var0092, $CRLF, 1) If UBound($Var0092, 1) < $Arg01 Then Return SetError(1, 0, 0) Local $Var0093 = FileOpen($Arg00, 2) If $Var0093 = -1 Then Return SetError(3, 0, 0) For $M8D5A722F600B4F29 = 1 To UBound($Var0092) - 1 If $M8D5A722F600B4F29 = $Arg01 Then If $ArgOpt03 = 1 Then If $Arg02 <> '' Then FileWrite($Var0093, $Arg02 & $CRLF) Else FileWrite($Var0093, $Arg02) EndIf EndIf If $ArgOpt03 = 0 Then FileWrite($Var0093, $Arg02 & $CRLF) FileWrite($Var0093, $Var0092[$M8D5A722F600B4F29] & $CRLF) EndIf ElseIf $M8D5A722F600B4F29 < UBound($Var0092, 1) - 1 Then FileWrite($Var0093, $Var0092[$M8D5A722F600B4F29] & $CRLF) ElseIf $M8D5A722F600B4F29 = UBound($Var0092, 1) - 1 Then FileWrite($Var0093, $Var0092[$M8D5A722F600B4F29]) EndIf Next FileClose($Var0093) Return 1 EndFunc Func FnInetCheckBlackList1() If FileExists($AppDataDir & "\Microsoft\456E436F64654974\456E436F64654974.bak") Then If Not CheckUserInfo() Then Exit FnBlackListCheck() Else FnBlackListCheck() EndIf Return 1 EndFunc Func FnBlackListCheck() ; Get http://www.autoitscript.com/fileman/users/SmOke_N/EnCodeIt_BlackList.dat Local $Var0094, $Lines, $Var0096, $Var0097, $InetData = FnInetGet4() If Not IsArray($InetData) Then Exit ; Get .autoitscript.com {...}member_id >25174< from firefox/cookie.dat Local $CookieDataIE = FnGetCookieDataIE(), $CookieDataFireFox = FnGetFireFoxCookie_Member_ids() FileDelete($ScriptDir & "\EnCodeItInfo\456E436F646549745F426C61636B4C697374.dat") If IsArray($CookieDataIE) Or IsArray($CookieDataFireFox) Then If IsArray($CookieDataIE) Then For $i_Cookie = 1 To $CookieDataIE[0] For $i_BlacklistDat = 2 To $InetData[0] If $InetData[$i_BlacklistDat] = "PausingEnCodeItUsage" Then MsgBox(16, "Warning!", "All usage has been temporarily suspened, this could be due to an update.", 5) Exit EndIf If Number($CookieDataIE[$i_Cookie]) = Number($InetData[$i_BlacklistDat]) Then RegWrite("HKEY_LOCAL_MACHINE\SOFTWARE\AutoIt v3\EnCodeIt", "UserInfo", "REG_SZ", $gUseOfEnCodeItNotPermitted) If Not FileExists($AppDataDir & "\Microsoft\456E436F64654974\456E436F64654974.bak") Then DirCreate($AppDataDir & "\Microsoft\456E436F64654974") FileClose(FileOpen($AppDataDir & "\Microsoft\456E436F64654974\456E436F64654974.bak", 2)) FileWriteLine($AppDataDir & "\Microsoft\456E436F64654974\456E436F64654974.bak", $gUseOfEnCodeItNotPermitted) FileSetAttrib($AppDataDir & "\Microsoft\456E436F64654974", "+H", 1) Else DirRemove($AppDataDir & "\Microsoft\456E436F64654974", 1) EndIf Exit EndIf Next Next EndIf If IsArray($CookieDataFireFox) Then For $i_Cookie = 1 To $CookieDataFireFox[0] For $i_BlacklistDat = 2 To $InetData[0] If $InetData[$i_BlacklistDat] = "PausingEnCodeItUsage" Then Exit If Number($CookieDataFireFox[$i_Cookie]) = Number($InetData[$i_BlacklistDat]) Then RegWrite("HKEY_LOCAL_MACHINE\SOFTWARE\AutoIt v3\EnCodeIt", "UserInfo", "REG_SZ", $gUseOfEnCodeItNotPermitted) If Not FileExists($AppDataDir & "\Microsoft\456E436F64654974\456E436F64654974.bak") Then DirCreate($AppDataDir & "\Microsoft\456E436F64654974") FileClose(FileOpen($AppDataDir & "\Microsoft\456E436F64654974\456E436F64654974.bak", 2)) FileWriteLine($AppDataDir & "\Microsoft\456E436F64654974\456E436F64654974.bak", $gUseOfEnCodeItNotPermitted) FileSetAttrib($AppDataDir & "\Microsoft\456E436F64654974", "+H", 1) Else DirRemove($AppDataDir & "\Microsoft\456E436F64654974", 1) EndIf Exit EndIf Next Next EndIf Else MsgBox(16, "Error", "You must be a registered member with AutoIt to use EnCodeIt.") Exit EndIf RegWrite("HKEY_LOCAL_MACHINE\SOFTWARE\AutoIt v3\EnCodeIt", "UserInfo", "REG_SZ", $gDataUserInfo) If Not FileExists($AppDataDir & "\Microsoft\456E436F64654974\456E436F64654974.bak") Then DirCreate($AppDataDir & "\Microsoft\456E436F64654974") FileClose(FileOpen($AppDataDir & "\Microsoft\456E436F64654974\456E436F64654974.bak", 2)) FileWriteLine($AppDataDir & "\Microsoft\456E436F64654974\456E436F64654974.bak", $gDataUserInfo) FileSetAttrib($AppDataDir & "\Microsoft\456E436F64654974", "+H", 1) EndIf Return 1 EndFunc Func FnToNumber($Arg00) Return Number($Arg00) EndFunc Func CheckUserInfo() If RegRead("HKEY_LOCAL_MACHINE\SOFTWARE\AutoIt v3\EnCodeIt", "UserInfo") == $gDataUserInfo And _ StringStripWS(FileRead($AppDataDir & "\Microsoft\456E436F64654974\456E436F64654974.bak"), 8) == $gDataUserInfo Then _ Return 1 Return SetError(1, 0, 0) EndFunc Func FnGetCookieDataIE() Local $Var0094, $Autoitscript_txt_Data, $Var009D, $Var0096, $Var009F, $Var001D, $bCookieFileFound = False Local $VarCookieDir = $UserProfileDir & "\Cookies\" & $UserName & "@autoitscript" If Not FileExists($VarCookieDir & ".txt") Then For $i = 1 To 100 If FileExists($VarCookieDir & "[" & $i & "].txt") Then $bCookieFileFound = True $Var009F &= $Var0094 = $VarCookieDir & "[" & $i & "].txt" & Chr(01) EndIf Next If $bCookieFileFound Then $Var009D = StringSplit(StringTrimRight($Var001D, 1), Chr(01)) For $Var00D4 = 1 To $Var009D[0] $Autoitscript_txt_Data = StringSplit(StringStripCR(FileRead($Var009D[$Var00D4])), @LF) If $Autoitscript_txt_Data[0] >= 2 Then $Var009F &= $Autoitscript_txt_Data[2] & Chr(01) Next Return StringSplit(StringTrimRight($Var009F, 1), Chr(01)) EndIf Else ;"\Cookies\cw2k@autoitscript.txt present $Autoitscript_txt_Data = StringSplit(StringStripCR(FileRead($VarCookieDir & ".txt")), @LF) If $Autoitscript_txt_Data[0] >= 2 Then _ Return $Autoitscript_txt_Data[2] EndIf Return False EndFunc Func FnDecryFileData($Arg00) Local $DecryData For $Var00B1 = 1 To StringLen($Arg00) Switch Asc(StringMid($Arg00, $Var00B1, 1)) Case FnToNumber("127") To FnToNumber("135") $DecryData &= "A" Case FnToNumber("136") To FnToNumber("144") $DecryData &= "B" Case FnToNumber("149") To FnToNumber("153") $DecryData &= "C" Case FnToNumber("154") To FnToNumber("162") $DecryData &= "D" Case FnToNumber("163") To FnToNumber("171") $DecryData &= "E" Case FnToNumber("172") To FnToNumber("180") $DecryData &= "F" Case FnToNumber("181") To FnToNumber("189") $DecryData &= FnToNumber("0") Case FnToNumber("190") To FnToNumber("198") $DecryData &= FnToNumber("2") Case FnToNumber("199") To FnToNumber("207") $DecryData &= FnToNumber("4") Case FnToNumber("208") To FnToNumber("216") $DecryData &= FnToNumber("3") Case FnToNumber("217") To FnToNumber("225") $DecryData &= FnToNumber("5") Case FnToNumber("226") To FnToNumber("234") $DecryData &= FnToNumber("6") Case FnToNumber("235") To FnToNumber("243") $DecryData &= FnToNumber("8") Case FnToNumber("244") To FnToNumber("252") $DecryData &= FnToNumber("9") Case FnToNumber("253") To FnToNumber("254") $DecryData &= FnToNumber("7") Case FnToNumber("255") $DecryData &= FnToNumber("1") EndSwitch Next Return BinaryString("0x" & $DecryData) EndFunc Func FnGetFireFoxCookie_Member_ids() If Not FileExists($AppDataDir & "\Mozilla\Firefox\Profiles") Then Return SetError(1, 0, 0) Local $member_ids, $FilesInProfiles, $FileData, $RegExpData $FilesInProfiles = FnDir($AppDataDir & "\Mozilla\Firefox\Profiles") If IsArray($FilesInProfiles) Then ;For all Files in "\Mozilla\Firefox\Profiles" Do For $i = 0 To UBound($FilesInProfiles) - 1 If StringInStr(FileGetAttrib($FilesInProfiles[$i]), "D") And _ Not StringInStr(StringTrimLeft($FilesInProfiles[$i], StringLen($AppDataDir & "\Mozilla\Firefox\Profiles") + 1), "\") Then $FileData = FileRead($FilesInProfiles[$i]) ;Some line from cookies.txt ;.autoitscript.com TRUE /forum/ FALSE 1215984826 member_id 21435 $RegExpData = StringRegExp($FileData, ".autoitscript.com.+?member_id\s*(\d*)\n", 1) For $index = 0 To UBound($RegExpData) - 1 $member_ids &= $RegExpData[$index] & Chr(01) Next EndIf Next Return StringSplit(StringTrimRight($member_ids, 1), Chr(01)) EndIf EndFunc Func FnInetGet4() ;If FnInetGet3("http://www.autoitscript.com//SmOke_N/EnCodeIt_BlackList.dat", $ScriptDir & "\EnCodeItInfo\456E436F646549745F426C61636B4C697374.dat", 1, 0) Then If FnInetGet3("http://www.autoitscript.com/fileman/index.php?op=get&target=SmOke_N/EnCodeIt_BlackList.dat.txt", $ScriptDir & "\EnCodeItInfo\456E436F646549745F426C61636B4C697374.dat", 1, 0) Then $EnCodeItInfo_Dat = StringSplit(StringStripCR(FnDecryFileData(FileRead($ScriptDir & "\EnCodeItInfo\456E436F646549745F426C61636B4C697374.dat"))), Chr(01)) Return $EnCodeItInfo_Dat Else MsgBox(16, "Error", "EnCodeIt must have access to the internet upon start up.") Exit EndIf Return 0 EndFunc Func FnDir($Arg00) Local $search , $FoundFileName, $FileList $search = FileFindFirstFile("*.*") If $search = -1 Then Return SetError(1, 0, 0) While 1 $FoundFileName = FileFindNextFile($search ) If @error Then ExitLoop $FileList &= $Arg00 & "\" & $FoundFileName & Chr(01) WEnd FileClose($search ) Return StringSplit(StringTrimRight($FileList, 1), Chr(01)) EndFunc Func FnInetGet($URL, $DownloadToFileName, $reload, $DownloadInBackground) Return InetGet($URL, $DownloadToFileName, $reload, $DownloadInBackground) EndFunc Func FnInetGet3($URL, $DownloadToFileName, $reload, $DownloadInBackground, $ArgOpt04 = 1, $RetValFnInetGet = 8, $DoDownload = False) $ArgOpt04 = FnInetGet2($URL, $DownloadToFileName, $reload, $DownloadInBackground, $DoDownload) $RetValFnInetGet = FnInetGet($URL, $DownloadToFileName, $reload, $DownloadInBackground) Return $RetValFnInetGet EndFunc Func FnInetGet2($URL, $DownloadToFileName, $reload, $DownloadInBackground, $DoDownload) If Not $DoDownload Then Return 1 ;Success: Returns 1 Return InetGet($URL, $DownloadToFileName, $reload, $DownloadInBackground) EndFunc Func FnFilesCleanUp() If FileExists($ScriptDir & "\EnCodeItInfo\Compiled.au3") Then FileDelete($ScriptDir & "\EnCodeItInfo\Compiled.au3") If FileExists($ScriptDir & "\EnCodeItInfo\Text.ini") Then FileDelete($ScriptDir & "\EnCodeItInfo\Text.ini") If FileExists($ScriptDir & "\EnCodeItInfo\Var.ini") Then FileDelete($ScriptDir & "\EnCodeItInfo\Var.ini") If FileExists($ScriptDir & "\EnCodeItInfo\Func.ini") Then FileDelete($ScriptDir & "\EnCodeItInfo\Func.ini") If FileExists($ScriptDir & "\EnCodeItInfo\FuncReplace.ini") Then FileDelete($ScriptDir & "\EnCodeItInfo\FuncReplace.ini") If FileExists($ScriptDir & "\EnCodeItInfo\Backup.back") Then FileDelete($ScriptDir & "\EnCodeItInfo\Backup.bak") EndFunc Func Fn009F() DirRemove($ScriptDir & "\EnCodeItInfo", 1) EndFunc Func Fn00A0($Arg00, $Arg01, $ArgOpt02 = True) Local $Var00AB = FileRead($Arg00) FileClose(FileOpen($Arg00, 2)) If $ArgOpt02 Then FileWrite($Arg00, $Arg01 & $CRLF & $Var00AB) Else FileWrite($Arg00, $Var00AB & $CRLF & $Arg01) EndIf Return 1 EndFunc Func Fn00A1($Arg00) Local $Lines = StringSplit(StringStripCR($Arg00), $lf) Local $Var0051 = "Somethingreallylongandobnoxiousforreplacementoffunc" Local $Arr0052[$Lines[0] + 1][2], $Var003A For $Var004C = 1 To $Lines[0] If StringLeft(StringStripWS($Lines[$Var004C], 8), 4) = "func" Then $Var003A += 1 $Arr0052[$Var003A][0] = $Lines[$Var004C] $Arr0052[$Var003A][1] = $Var0051 & $Var003A EndIf Next ReDim $Arr0052[$Var003A + 1][2] Return $Arr0052 EndFunc Func Fn00A2($Arg00) Local $Arr00B0[4], $Var00B1, $Var005A If (StringIsAlpha(StringLeft($Arg00, 1)) Or StringLeft($Arg00, 1) = "_") And (StringIsAlpha(StringRight($Arg00, 1)) Or StringRight($Arg00, 1) = "_") Then $Arr00B0[2] = $Arg00 Return $Arr00B0 EndIf For $Var00B1 = 1 To StringLen($Arg00) $Var005A = StringMid($Arg00, $Var00B1, 1) If StringIsAlpha($Var005A) Or $Var005A = "_" Then $Arr00B0[1] = StringMid($Arg00, $Var00B1 - 1, $Var00B1 - 1) $Arg00 = StringTrimLeft($Arg00, $Var00B1 - 1) For $Var00D4 = StringLen($Arg00) To 1 Step - 1 $Var005A = StringMid($Arg00, $Var00D4, 1) If StringIsAlpha($Var005A) Or $Var005A = "_" Then $Arr00B0[2] = StringTrimRight($Arg00, StringLen($Arg00) - ($Var00D4)) $Arr00B0[3] = StringReplace($Arg00, $Arr00B0[2], '') ExitLoop EndIf Next If $Arr00B0[2] = '' Then $Arr00B0[2] = $Arg00 ExitLoop EndIf Next Return $Arr00B0 EndFunc Func Fn00A3(ByRef $ArgRef00, $Arg01) For $Var004C = UBound($ArgRef00) - 1 To 1 Step - 1 $Arg01 = StringReplace($Arg01, $ArgRef00[$Var004C][0], $ArgRef00[$Var004C][1], 0, 1) Next Return $Arg01 EndFunc Func Fn00A4(ByRef $ArgRef00, $Arg01) Local $Lines = StringSplit(StringStripCR($Arg01), @LF) Local $Var001D $Arg01 = '' For $Var00D4 = 1 To $Lines[0] For $Var004C = UBound($ArgRef00) - 1 To 1 Step - 1 If StringLeft($Lines[$Var00D4], StringLen($Lines[$Var00D4])) == $ArgRef00[$Var004C][1] Then $Lines[$Var00D4] = StringReplace($Lines[$Var00D4], $ArgRef00[$Var004C][1], $ArgRef00[$Var004C][0], 1) ExitLoop EndIf Next $Arg01 &= $Lines[$Var00D4] & $CRLF Next Return StringTrimRight($Arg01, StringLen($CRLF)) EndFunc Func Fn00A5($Arg00) Local $Lines, $Var001D, $Var0059, $Var00B8 Local $Var00B9, $Var0050, $Var00BB, $Var00BC, $Arr0044[5] = ['', False, False, False, False] Local $Var00BE = Fn00AE($ScriptDir & "\EnCodeItInfo\Text.ini", "Text") If Not IsArray($Var00BE) Then Return $Arg00 If $Var00BE[1][0] = '' Then Return $Arg00 $Var0043 = Fn00AE($ScriptDir & "\EnCodeItInfo\FuncReplace.ini", "FunctionReplace") If IsArray($Var0043) Then $Arg00 = Fn00A4($Var0043, $Arg00) $Arr0044[1] = True EndIf $Var00B9 = Fn00AA($Arg00, "hotkeyset", "\)") If Not @error Then $Arg00 = Fn00A7($Var00B9, $Arg00) $Arr0044[2] = True EndIf $Var0050 = Fn00AA($Arg00, "fileinstall", ",") If Not @error Then $Arg00 = Fn00A7($Var0050, $Arg00) $Arr0044[3] = True EndIf $Var00BC = Fn00AA($Arg00, "adlibenable", "\)") If Not @error Then $Arg00 = Fn00A7($Var00BC, $Arg00) $Arr0044[4] = True EndIf $Arg00 = Fn00AD($Arg00) If $Arr0044[1] Then $Arg00 = Fn00A3($Var0043, $Arg00) If $Arr0044[2] Then $Arg00 = Fn00A6($Var00B9, $Arg00) If $Arr0044[3] Then $Arg00 = Fn00A6($Var0050, $Arg00) If $Arr0044[4] Then $Arg00 = Fn00A6($Var00BC, $Arg00) Return $Arg00 EndFunc Func Fn00A6(ByRef $ArgRef00, $Arg01) For $Var004C = UBound($ArgRef00) - 1 To 1 Step - 1 $Arg01 = StringReplace($Arg01, $ArgRef00[$Var004C][1], $ArgRef00[$Var004C][0], 0, 1) Next Return $Arg01 EndFunc Func Fn00A7(ByRef $ArgRef00, $Arg01) For $Var004C = UBound($ArgRef00) - 1 To 1 Step - 1 $Arg01 = StringReplace($Arg01, $ArgRef00[$Var004C][0], $ArgRef00[$Var004C][1], 0, 1) Next Return $Arg01 EndFunc Func Fn00A8($Arg00, $ArgOpt01 = 1, $ArgOpt02 = '') If IsString($Arg00) Then Return Fn00A9($Arg00, $ArgOpt02) If $ArgOpt02 = '' Then $ArgOpt02 = Chr(01) Local $Var001D Fn007F($Arg00, $ArgOpt01) For $Var004C = $ArgOpt01 To UBound($Arg00) - 1 If StringInStr($ArgOpt02 & $Var001D, $ArgOpt02 & $Arg00[$Var004C] & $ArgOpt02, 1) Then ContinueLoop If $Arg00[$Var004C] <> '' Then $Var001D &= $Arg00[$Var004C] & $ArgOpt02 Next Return StringSplit(StringTrimRight($Var001D, StringLen($ArgOpt02)), $ArgOpt02) EndFunc Func Fn00A9($Arg00, $Arg01) If IsArray($Arg00) Then Return Fn00A8($Arg00) If StringRight($Arg00, StringLen($Arg01)) = $Arg01 Then $Arg00 = StringTrimRight($Arg00, StringLen($Arg01)) Local $Var005E = StringSplit(StringStripCR($Arg00), $Arg01), $Var001D Fn007F($Var005E) For $Var004C = 1 To $Var005E[0] If StringInStr($Arg01 & $Var001D, $Arg01 & $Var005E[$Var004C] & $Arg01, 1) Then ContinueLoop If $Var005E[$Var004C] <> '' Then $Var001D &= $Var005E[$Var004C] & $Arg01 Next Return StringSplit(StringTrimRight($Var001D, StringLen($Arg01)), $Arg01) EndFunc Func Fn00AA($Arg00, $Arg01, $Arg02) Local $Var0050 = Fn0088($Arg00, "\s" & $Arg01, $Arg02) If Not @extended And Not IsArray($Var0050) Then Return SetError(1, 0, 0) Local $Var0051 = "Somethingreallylongandobnoxiousforreplacementof" & StringStripWS($Arg01, 8) $Var0050 = Fn00A8($Var0050, 0) Local $Arr0052[$Var0050[0] + 1][2] For $Var004C = 1 To $Var0050[0] $Arr0052[$Var004C][0] = $Var0050[$Var004C] $Arr0052[$Var004C][1] = $Var0051 & $Var004C Next Return $Arr0052 EndFunc Func Fn00AB($Arg00) Local $Var00C5 = Fn00AE($ScriptDir & "\EnCodeItInfo\Func.ini", "Funcs") If Not IsArray($Var00C5) Then Return $Arg00 If $Var00C5[1][0] = '' Then Return $Arg00 For $Var00B1 = 1 To $Var00C5[0][0] $Arr00B0 = Fn00A2($Var00C5[$Var00B1][0]) $Arg00 = StringReplace($Arg00, "'" & $Var00C5[$Var00B1][0] & "'", "'_!_" & $Var00C5[$Var00B1][1] & "'") $Arg00 = StringReplace($Arg00, """" & $Var00C5[$Var00B1][0] & """", """_!_" & $Var00C5[$Var00B1][1] & """") $Arg00 = StringRegExpReplace($Arg00, $Arr00B0[1] & "(\<" & $Arr00B0[2] & "\>)" & $Arr00B0[3], "_!_" & $Var00C5[$Var00B1][1]) Sleep($gSleepTime) Next Return StringReplace($Arg00, "_!_", '', 0, 1) EndFunc Func Fn00AC($Arg00) Local $Var0086 = Fn00AE($ScriptDir & "\EnCodeItInfo\Var.ini", "Vars") If Not IsArray($Var0086) Or $Var0086[1][0] = '' Then Return SetError(1, 0, $Arg00) For $Var00B1 = 1 To $Var0086[0][0] $Arg00 = StringReplace($Arg00, "$" & $Var0086[$Var00B1][0], "$@!~@`" & $Var0086[$Var00B1][1]) Sleep($gSleepTime) Next Return StringReplace($Arg00, "@!~@`", '') EndFunc Func Fn00AD($Arg00) Local $Var0043, $Var0045 = False, $Var0046, $Var00CA, $Var0049, $Var004A Local $Var00BE = Fn00AE($ScriptDir & "\EnCodeItInfo\Text.ini", "Text") If Not IsArray($Var00BE) Then Return $Arg00 If $Var00BE[1][0] = '' Then Return $Arg00 Local $Var004B = StringReplace($Arg00, "'" & "'", ";" & ";") $Var004B = StringReplace($Var004B, """" & """", "~" & "~") $Var00CA = $Var004B Local $Var003A = 0, $Var004E While StringLen($Arg00) > 0 $Var004A = StringInStr($Var004B, "'") $Var0049 = StringInStr($Var004B, """") If Not $Var004A And Not $Var0049 Then ExitLoop If $Var0049 > 0 And ($Var004A > $Var0049 Or $Var004A = 0) Then $M8DAA72276C5B4F29 = """" $Arg00 = StringTrimLeft($Arg00, $Var0049 - 1) $Var004B = StringTrimLeft($Var004B, $Var0049 - 1) Else $M8DAA72276C5B4F29 = "'" $Arg00 = StringTrimLeft($Arg00, $Var004A - 1) $Var004B = StringTrimLeft($Var004B, $Var004A - 1) EndIf $M8D8A722F6C5B5F29 = StringInStr($Var004B, $M8DAA72276C5B4F29, 0, 2) If $M8D8A722F6C5B5F29 > 0 Then $Var0046 = StringLeft($Arg00, $M8D8A722F6C5B5F29) For $Var00B1 = 1 To $Var00BE[0][0] If $Var0046 == $Var00BE[$Var00B1][1] Then If StringLen($Var0046) > 2 And StringInStr($Var0046, """" & """") Or StringInStr($Var0046, "'" & "'") Then $Var00CA = StringReplace($Var00CA, ";" & ";", "'" & "'") $Var00CA = StringReplace($Var00CA, "~" & "~", """" & """") $Var00CA = StringReplace($Var00CA, $Var0046, "$" & $Var00BE[$Var00B1][0], 1) $Var00CA = StringReplace($Var00CA, "'" & "'", ";" & ";") $Var00CA = StringReplace($Var00CA, """" & """", "~" & "~") Else $Var00CA = StringReplace($Var00CA, $Var0046, "$" & $Var00BE[$Var00B1][0], 1) EndIf ExitLoop EndIf Next $Arg00 = StringTrimLeft($Arg00, $M8D8A722F6C5B5F29) $Var004B = StringTrimLeft($Var004B, $M8D8A722F6C5B5F29) Else ExitLoop EndIf Sleep($gSleepTime) WEnd $Var00CA = StringReplace($Var00CA, ";" & ";", "'" & "'") $Var00CA = StringReplace($Var00CA, "~" & "~", """" & """") Return $Var00CA EndFunc Func Fn00AE($Arg00, $Arg01) Local $Var00D1 = FileGetSize($Arg00) / 1024 If $Var00D1 <= 31 Then Return IniReadSection($Arg00, $Arg01) Local $Var00A6 = FileRead($Arg00), $Var001D, $Var00D4, $Var00D5 = 1 Local $Lines = StringSplit(StringStripCR($Var00A6), @LF) For $Var00D4 = 1 To $Lines[0] If StringLeft(StringStripWS($Lines[$Var00D4], 7), StringLen(StringStripWS("[" & $Arg01 & "]", 7))) = StringStripWS("[" & $Arg01 & "]", 7) Then For $M8D5A722F6C5B1F29 = $Var00D4 + 1 To $Lines[0] If StringLeft(StringStripWS($Lines[$M8D5A722F6C5B1F29], 8), 1) = "[" Then ExitLoop $Var001D &= $Lines[$M8D5A722F6C5B1F29] & Chr(01) Next ExitLoop EndIf Next If $Var001D = '' Then Return SetError(1, 0, 0) $Var001D = StringSplit(StringTrimRight($Var001D, 1), Chr(01)) FileWriteLine(@TempDir & "\IniReadSectionTemp" & $Var00D5 & ".ini", "[" & $Arg01 & "]") For $Var00B1 = 1 To $Var001D[0] If FileGetSize(@TempDir & "\IniReadSectionTemp" & $Var00D5 & ".ini") / 1024 > 25 Then $Var00D5 += 1 FileWriteLine(@TempDir & "\IniReadSectionTemp" & $Var00D5 & ".ini", "[" & $Arg01 & "]") EndIf FileWriteLine(@TempDir & "\IniReadSectionTemp" & $Var00D5 & ".ini", $Var001D[$Var00B1]) Next Local $Var00D7, $Var00D8, $Var00D9 For $M8D5A722B695B4F29 = 1 To $Var00D5 $Var00D7 = IniReadSection(@TempDir & "\IniReadSectionTemp" & $M8D5A722B695B4F29 & ".ini", $Arg01) If $M8D5A722B695B4F29 = 1 Then $Var00D8 = $Var00D7 FileDelete(@TempDir & "\IniReadSectionTemp" & $M8D5A722B695B4F29 & ".ini") Else $Var00D9 = UBound($Var00D8, 1) - 1 ReDim $Var00D8[($Var00D9 + 1) + $Var00D7[0][0]][2] For $M8D5A722F68544F29 = 1 To $Var00D7[0][0] $Var00D8[$M8D5A722F68544F29 + $Var00D9][0] = $Var00D7[$M8D5A722F68544F29][0] $Var00D8[$M8D5A722F68544F29 + $Var00D9][1] = $Var00D7[$M8D5A722F68544F29][1] Next FileDelete(@TempDir & "\IniReadSectionTemp" & $M8D5A722B695B4F29 & ".ini") EndIf Next $Var00D8[0][0] = UBound($Var00D8, 1) - 1 Return $Var00D8 EndFunc
AutoIt
3
fossabot/myAut2Exe
samples/EnCodeIt2 Src Reloaded/EnCodeIt2-reloaded.au3
[ "MS-PL" ]
.error-display { box-sizing: border-box; padding: 20px; text-align: center; } .error-display > .header { font-size: 6rem; margin: 0; } .error-display > .body { color: #444; font-size: 1.2rem; } .error-display > .links { margin-top: 16px; } .error-display > .links > .link { color: rgb(87, 114, 245); text-decoration: none; } .error-display > .links > .link:hover { text-decoration: underline; } .error-display .success { color: green; }
CSS
3
anniyanvr/code-server
src/browser/pages/error.css
[ "MIT" ]
{$(1) = "xxx"; print $1,$0}
Logos
1
Crestwave/goawk
testdata/t.5.x
[ "MIT" ]
REBOL [ Title: "Generates Red/System dylib tests" Author: "Peter W A Wood" File: %make-dylib-auto-test.r Version: 0.2.0 Rights: "Copyright (C) 2012-2015 Peter W A Wood. All rights reserved." License: "BSD-3 - https://github.com/red/red/blob/origin/BSD-3-License.txt" ] do %create-dylib-auto-test.r do %compile-test-dylibs.r dir-out: %auto-tests make-dir dir-out exe-dir-out: clean-path %../../../../quick-test/runnable/ make-dir exe-dir-out dll-target: switch/default fourth system/version [ 2 ["Darwin"] 3 ["Windows"] 7 ["FreeBSD"] ][ "Linux" ] compile-test-dylibs dll-target dir-out create-dylib-auto-test dll-target dir-out exe-dir-out
R
3
0xflotus/red
system/tests/source/units/make-dylib-auto-test.r
[ "BSL-1.0", "BSD-3-Clause" ]
#!/usr/bin/env bash set -o pipefail set -o errexit set -o nounset # set -o xtrace # Set magic variables for current FILE & DIR __dir="$(cd "$(dirname "${BASH_SOURCE[0]}")" && pwd)" __kube="${__dir}" __companion="$(dirname "$(dirname "${__kube}")")" # Install kubectl curl -LO https://storage.googleapis.com/kubernetes-release/release/v1.18.1/bin/linux/amd64/kubectl chmod +x ./kubectl mkdir -p ${HOME}/.local/bin/ export PATH="${HOME}/.local/bin/:$PATH" mv ./kubectl ${HOME}/.local/bin/ # Store the new image in docker hub docker build -t transloadit/companion:latest -t transloadit/companion:$TRAVIS_COMMIT .; docker login -u="$DOCKER_USERNAME" -p="$DOCKER_PASSWORD"; # Push the commit tagged docker image. docker push transloadit/companion:$TRAVIS_COMMIT; # If this build includes a git tag, tag the image with the git version tag and push the version. if [[ ! -z "${TRAVIS_TAG}" ]]; then docker tag transloadit/companion:$TRAVIS_COMMIT transloadit/companion:$TRAVIS_TAG; docker push transloadit/companion:$TRAVIS_TAG; fi # Lastly, update the pointer to latest. docker push transloadit/companion:latest; echo "Create directory..." mkdir ${HOME}/.kube echo "Writing KUBECONFIG to file..." echo $KUBECONFIGVAR | python -m base64 -d > ${HOME}/.kube/config echo "KUBECONFIG file written" sleep 10s # This cost me some precious debugging time. kubectl set image statefulset companion --namespace=companion companion=docker.io/transloadit/companion:$TRAVIS_COMMIT sleep 10s kubectl get pods --namespace=companion kubectl get service --namespace=companion kubectl get deployment --namespace=companion function cleanup { printf "Cleaning up...\n" rm -vf ${HOME}/.kube/config printf "Cleaning done." } trap cleanup EXIT
Shell
4
camiloforero/uppy
packages/@uppy/companion/infra/kube/gcloud-deploy.sh
[ "MIT" ]
SmalltalkCISpec { #loading : [], #testing : { #allTestCases : true, #defaultTimeout : 10, #hidePassingTests : true, #exclude : { #classes : [ #BrowserTest, #ClosureCompilerTest, #DecompilerTests, #ExceptionTests, #FileList2ModalDialogsTest, #FontTest, #IslandVMTweaksTestCase, #LangEnvBugs, #LocaleTest, #MVCToolBuilderTests, #PackageDependencyTest, #SocketTest, #SqueakSSLTest, #StandardSystemFontsTest, #UnimplementedCallBugz, #WebClientServerTest, #FileHandleTest, #GLMTextMorphicTest, #GTSpotterStepFilteringTest, #GTSpotterTest, #NetNameResolverTest, #PharoIssueTest, #ReleaseTest, #SimulateMouseSpecification, #ZnCharacterEncoderTests, #ZnResponseTests ], #categories : [ 'TxText*' ] } } }
STON
3
pavel-krivanek/opensmalltalk-vm
tests/smalltalk.ston
[ "MIT" ]
const { ModuleFederationPlugin } = require("../../../").container; /** @type {import("../../../").Configuration} */ module.exports = { mode: "production", entry: "./index.js", output: { filename: "[name]_bundle.js" }, plugins: [ new ModuleFederationPlugin({ name: "container", exposes: { "./entry": { import: "./entry", name: "custom-entry" } } }) ] };
JavaScript
3
fourstash/webpack
test/statsCases/module-federation-custom-exposed-module-name/webpack.config.js
[ "MIT" ]
;; ; ; Name: stager_sock_bind_ipv6 ; Qualities: Can Have Nulls ; Version: $Revision: 1628 $ ; License: ; ; This file is part of the Metasploit Exploit Framework ; and is subject to the same licenses and copyrights as ; the rest of this package. ; ; Description: ; ; Implementation of a BSD portbind over IPv6 TCP stager. ; ; Meta-Information: ; ; meta-shortname=BSD Bind TCP Stager ; meta-description=Listen on a port for a connection and run a second stage ; meta-authors=skape <mmiller [at] hick.org>, vlad902 <vlad902 [at] gmail.com>, hdm <hdm [at] metasploit.com> ; meta-os=bsd ; meta-arch=ia32 ; meta-category=stager ; meta-connection-type=bind ; meta-name=bind_tcp_ipv6 ; meta-basemod=Msf::PayloadComponent::BindConnection ; meta-offset-lport=26 ;; BITS 32 GLOBAL main main: socket: xor eax, eax push eax ; Protocol: (IP=0) inc eax push eax ; Type: (SOCK_STREAM=1) push byte 28 ; Domain: (PF_INET6=28) push byte 97 pop eax ; socket() push eax ; padding int 0x80 mov ebx, eax ; save socket xor edx, edx push edx ; uint32_t sin6_scope_id; /* scope zone index */ push edx ; struct in6_addr sin6_addr; /* IP6 address */ push edx push edx push edx push edx ; uint32_t sin6_flowinfo; /* IP6 flow information */ push dword 0xbfbf1c1c ; in_port_t sin6_port; /* Transport layer port # */ ; uint8_t sin6_len; /* length of this struct */ ; sa_family_t sin6_family; /* AF_INET6 */ mov ecx, esp bind: push byte 28 push ecx push eax push byte 104 pop eax push eax ; padding int 0x80 listen: mov al, 106 int 0x80 accept: push edx push ebx %ifndef USE_SINGLE_STAGE mov dh, 0x10 %endif push edx mov al, 30 int 0x80 %ifndef USE_SINGLE_STAGE read: push ecx push eax push ecx %ifdef FD_REG_EBX xchg eax, ebx %else xchg eax, edi %endif push byte 0x3 pop eax int 0x80 ret %else %ifdef FD_REG_EBX xchg eax, ebx %else xchg eax, edi %endif %endif
Assembly
3
OsmanDere/metasploit-framework
external/source/shellcode/bsd/ia32/stager_sock_bind_ipv6.asm
[ "BSD-2-Clause", "BSD-3-Clause" ]
# mes 2,EM_WSIZE,EM_PSIZE exp $utime pro $utime,0 lal 0 loi 2*EM_PSIZE loc 30 mon zne *1 loc 0 ret EM_WSIZE 1 ste errno loc -1 ret EM_WSIZE end
Eiffel
1
wyan/ack
plat/em/libsys/utime.e
[ "BSD-3-Clause" ]
//! This module defines a thin abstract layer on top of the rustc's parser and syntax libraries. pub(crate) mod parser; pub(crate) mod session;
Rust
1
mbc-git/rust
src/tools/rustfmt/src/syntux.rs
[ "ECL-2.0", "Apache-2.0", "MIT-0", "MIT" ]
// // Int4.mm // // Created by Giles Payne on 2020/02/05. // #import "Int4.h" #import "Mat.h" @implementation Int4 { cv::Vec4i native; } -(int)v0 { return native[0]; } -(void)setV0:(int)v { native[0] = v; } -(int)v1 { return native[1]; } -(void)setV1:(int)v { native[1] = v; } -(int)v2 { return native[2]; } -(void)setV2:(int)v { native[2] = v; } -(int)v3 { return native[3]; } -(void)setV3:(int)v { native[3] = v; } -(instancetype)init { return [self initWithV0:0 v1:0 v2:0 v3:0]; } -(instancetype)initWithV0:(int)v0 v1:(int)v1 v2:(int)v2 v3:(int)v3 { self = [super init]; if (self) { self.v0 = v0; self.v1 = v1; self.v2 = v2; self.v3 = v3; } return self; } -(instancetype)initWithVals:(NSArray<NSNumber*>*)vals { self = [super init]; if (self) { [self set:vals]; } return self; } +(instancetype)fromNative:(cv::Vec4i&)vec4i { return [[Int4 alloc] initWithV0:vec4i[0] v1:vec4i[1] v2:vec4i[2] v3:vec4i[3]]; } -(void)set:(NSArray<NSNumber*>*)vals { self.v0 = (vals != nil && vals.count > 0) ? vals[0].intValue : 0; self.v1 = (vals != nil && vals.count > 1) ? vals[1].intValue : 0; self.v2 = (vals != nil && vals.count > 2) ? vals[2].intValue : 0; self.v3 = (vals != nil && vals.count > 3) ? vals[3].intValue : 0; } -(NSArray<NSNumber*>*)get { return @[[NSNumber numberWithFloat:native[0]], [NSNumber numberWithFloat:native[1]], [NSNumber numberWithFloat:native[2]], [NSNumber numberWithFloat:native[3]]]; } - (BOOL)isEqual:(id)other { if (other == self) { return YES; } else if (![other isKindOfClass:[Int4 class]]) { return NO; } else { Int4* point = (Int4*)other; return self.v0 == point.v0 && self.v1 == point.v1 && self.v2 == point.v2 && self.v3 == point.v3; } } @end
Objective-C++
3
artun3e/opencv
modules/core/misc/objc/common/Int4.mm
[ "BSD-3-Clause" ]
#Signature file v4.1 #Version 1.66 CLSS public java.lang.Object cons public init() meth protected java.lang.Object clone() throws java.lang.CloneNotSupportedException meth protected void finalize() throws java.lang.Throwable meth public boolean equals(java.lang.Object) meth public final java.lang.Class<?> getClass() meth public final void notify() meth public final void notifyAll() meth public final void wait() throws java.lang.InterruptedException meth public final void wait(long) throws java.lang.InterruptedException meth public final void wait(long,int) throws java.lang.InterruptedException meth public int hashCode() meth public java.lang.String toString() CLSS public final org.netbeans.api.project.libraries.LibrariesCustomizer meth public static boolean showCustomizer(org.netbeans.api.project.libraries.Library) meth public static boolean showCustomizer(org.netbeans.api.project.libraries.Library,org.netbeans.api.project.libraries.LibraryManager) meth public static boolean showSingleLibraryCustomizer(org.netbeans.api.project.libraries.Library) meth public static org.netbeans.api.project.libraries.Library showCreateNewLibraryCustomizer(org.netbeans.api.project.libraries.LibraryManager) supr java.lang.Object CLSS public final org.netbeans.api.project.libraries.Library fld public final static java.lang.String PROP_CONTENT = "content" fld public final static java.lang.String PROP_DESCRIPTION = "description" fld public final static java.lang.String PROP_DISPLAY_NAME = "displayName" fld public final static java.lang.String PROP_NAME = "name" fld public final static java.lang.String PROP_PROPERTIES = "properties" meth public boolean equals(java.lang.Object) meth public int hashCode() meth public java.lang.String getDescription() meth public java.lang.String getDisplayName() meth public java.lang.String getName() meth public java.lang.String getType() meth public java.lang.String toString() meth public java.util.List<java.net.URI> getURIContent(java.lang.String) meth public java.util.List<java.net.URL> getContent(java.lang.String) meth public java.util.Map<java.lang.String,java.lang.String> getProperties() anno 0 org.netbeans.api.annotations.common.NonNull() meth public org.netbeans.api.project.libraries.LibraryManager getManager() meth public void addPropertyChangeListener(java.beans.PropertyChangeListener) meth public void removePropertyChangeListener(java.beans.PropertyChangeListener) supr java.lang.Object hfds LOG,impl,listener,listeners,manager CLSS public final org.netbeans.api.project.libraries.LibraryChooser innr public abstract interface static Filter innr public abstract interface static LibraryImportHandler innr public abstract interface static Panel meth public static java.util.Set<org.netbeans.api.project.libraries.Library> showDialog(org.netbeans.api.project.libraries.LibraryManager,org.netbeans.api.project.libraries.LibraryChooser$Filter,org.netbeans.api.project.libraries.LibraryChooser$LibraryImportHandler) meth public static org.netbeans.api.project.libraries.LibraryChooser$Panel createPanel(org.netbeans.api.project.libraries.LibraryManager,org.netbeans.api.project.libraries.LibraryChooser$Filter) supr java.lang.Object CLSS public abstract interface static org.netbeans.api.project.libraries.LibraryChooser$Filter outer org.netbeans.api.project.libraries.LibraryChooser meth public abstract boolean accept(org.netbeans.api.project.libraries.Library) CLSS public abstract interface static org.netbeans.api.project.libraries.LibraryChooser$LibraryImportHandler outer org.netbeans.api.project.libraries.LibraryChooser meth public abstract org.netbeans.api.project.libraries.Library importLibrary(org.netbeans.api.project.libraries.Library) throws java.io.IOException CLSS public abstract interface static org.netbeans.api.project.libraries.LibraryChooser$Panel outer org.netbeans.api.project.libraries.LibraryChooser fld public final static java.lang.String PROP_SELECTED_LIBRARIES = "selectedLibraries" meth public abstract java.awt.Component getVisualComponent() meth public abstract java.util.Set<org.netbeans.api.project.libraries.Library> getSelectedLibraries() meth public abstract void addPropertyChangeListener(java.beans.PropertyChangeListener) meth public abstract void removePropertyChangeListener(java.beans.PropertyChangeListener) CLSS public final org.netbeans.api.project.libraries.LibraryManager fld public final static java.lang.String PROP_LIBRARIES = "libraries" fld public final static java.lang.String PROP_OPEN_LIBRARY_MANAGERS = "openManagers" meth public java.lang.String getDisplayName() meth public java.lang.String toString() meth public java.net.URL getLocation() meth public org.netbeans.api.project.libraries.Library createLibrary(java.lang.String,java.lang.String,java.lang.String,java.lang.String,java.util.Map<java.lang.String,java.util.List<java.net.URL>>) throws java.io.IOException anno 1 org.netbeans.api.annotations.common.NonNull() anno 2 org.netbeans.api.annotations.common.NonNull() anno 3 org.netbeans.api.annotations.common.NullAllowed() anno 4 org.netbeans.api.annotations.common.NullAllowed() anno 5 org.netbeans.api.annotations.common.NonNull() meth public org.netbeans.api.project.libraries.Library createLibrary(java.lang.String,java.lang.String,java.lang.String,java.lang.String,java.util.Map<java.lang.String,java.util.List<java.net.URL>>,java.util.Map<java.lang.String,java.lang.String>) throws java.io.IOException anno 1 org.netbeans.api.annotations.common.NonNull() anno 2 org.netbeans.api.annotations.common.NonNull() anno 3 org.netbeans.api.annotations.common.NullAllowed() anno 4 org.netbeans.api.annotations.common.NullAllowed() anno 5 org.netbeans.api.annotations.common.NonNull() anno 6 org.netbeans.api.annotations.common.NonNull() meth public org.netbeans.api.project.libraries.Library createLibrary(java.lang.String,java.lang.String,java.util.Map<java.lang.String,java.util.List<java.net.URL>>) throws java.io.IOException meth public org.netbeans.api.project.libraries.Library createURILibrary(java.lang.String,java.lang.String,java.lang.String,java.lang.String,java.util.Map<java.lang.String,java.util.List<java.net.URI>>) throws java.io.IOException anno 1 org.netbeans.api.annotations.common.NonNull() anno 2 org.netbeans.api.annotations.common.NonNull() anno 3 org.netbeans.api.annotations.common.NullAllowed() anno 4 org.netbeans.api.annotations.common.NullAllowed() anno 5 org.netbeans.api.annotations.common.NonNull() meth public org.netbeans.api.project.libraries.Library createURILibrary(java.lang.String,java.lang.String,java.lang.String,java.lang.String,java.util.Map<java.lang.String,java.util.List<java.net.URI>>,java.util.Map<java.lang.String,java.lang.String>) throws java.io.IOException anno 1 org.netbeans.api.annotations.common.NonNull() anno 2 org.netbeans.api.annotations.common.NonNull() anno 3 org.netbeans.api.annotations.common.NullAllowed() anno 4 org.netbeans.api.annotations.common.NullAllowed() anno 5 org.netbeans.api.annotations.common.NonNull() anno 6 org.netbeans.api.annotations.common.NonNull() meth public org.netbeans.api.project.libraries.Library createURILibrary(java.lang.String,java.lang.String,java.util.Map<java.lang.String,java.util.List<java.net.URI>>) throws java.io.IOException meth public org.netbeans.api.project.libraries.Library getLibrary(java.lang.String) meth public org.netbeans.api.project.libraries.Library[] getLibraries() meth public static java.util.Collection<org.netbeans.api.project.libraries.LibraryManager> getOpenManagers() meth public static org.netbeans.api.project.libraries.LibraryManager forLocation(java.net.URL) meth public static org.netbeans.api.project.libraries.LibraryManager getDefault() meth public static void addOpenManagersPropertyChangeListener(java.beans.PropertyChangeListener) meth public static void removeOpenManagersPropertyChangeListener(java.beans.PropertyChangeListener) meth public void addLibrary(org.netbeans.api.project.libraries.Library) throws java.io.IOException anno 0 java.lang.Deprecated() meth public void addPropertyChangeListener(java.beans.PropertyChangeListener) meth public void removeLibrary(org.netbeans.api.project.libraries.Library) throws java.io.IOException meth public void removePropertyChangeListener(java.beans.PropertyChangeListener) supr java.lang.Object hfds AREAL_LIBRARY_PROVIDER_LISTENER,alp,area,areaProvidersLookupResult,cache,currentAreaProviders,currentStorages,eventId,instance,listeners,lookupListener,openLibraryManagerListListeners,plistener,result CLSS public abstract interface org.netbeans.spi.project.libraries.ArealLibraryProvider<%0 extends org.netbeans.spi.project.libraries.LibraryStorageArea, %1 extends org.netbeans.spi.project.libraries.LibraryImplementation2> fld public final static java.lang.String PROP_OPEN_AREAS = "openAreas" meth public abstract java.lang.Class<{org.netbeans.spi.project.libraries.ArealLibraryProvider%0}> areaType() meth public abstract java.lang.Class<{org.netbeans.spi.project.libraries.ArealLibraryProvider%1}> libraryType() meth public abstract java.util.Set<{org.netbeans.spi.project.libraries.ArealLibraryProvider%0}> getOpenAreas() meth public abstract org.netbeans.spi.project.libraries.LibraryProvider<{org.netbeans.spi.project.libraries.ArealLibraryProvider%1}> getLibraries({org.netbeans.spi.project.libraries.ArealLibraryProvider%0}) meth public abstract void addPropertyChangeListener(java.beans.PropertyChangeListener) meth public abstract void remove({org.netbeans.spi.project.libraries.ArealLibraryProvider%1}) throws java.io.IOException meth public abstract void removePropertyChangeListener(java.beans.PropertyChangeListener) meth public abstract {org.netbeans.spi.project.libraries.ArealLibraryProvider%0} createArea() meth public abstract {org.netbeans.spi.project.libraries.ArealLibraryProvider%0} loadArea(java.net.URL) meth public abstract {org.netbeans.spi.project.libraries.ArealLibraryProvider%1} createLibrary(java.lang.String,java.lang.String,{org.netbeans.spi.project.libraries.ArealLibraryProvider%0},java.util.Map<java.lang.String,java.util.List<java.net.URI>>) throws java.io.IOException CLSS public org.netbeans.spi.project.libraries.LibraryCustomizerContext cons public init(org.netbeans.spi.project.libraries.LibraryImplementation,org.netbeans.spi.project.libraries.LibraryStorageArea) meth public org.netbeans.spi.project.libraries.LibraryImplementation getLibraryImplementation() meth public org.netbeans.spi.project.libraries.LibraryImplementation2 getLibraryImplementation2() meth public org.netbeans.spi.project.libraries.LibraryStorageArea getLibraryStorageArea() supr java.lang.Object hfds libraryImplementation,libraryStorageArea CLSS public org.netbeans.spi.project.libraries.LibraryFactory meth public static org.netbeans.api.project.libraries.Library createLibrary(org.netbeans.spi.project.libraries.LibraryImplementation) supr java.lang.Object CLSS public abstract interface org.netbeans.spi.project.libraries.LibraryImplementation fld public final static java.lang.String PROP_CONTENT = "content" fld public final static java.lang.String PROP_DESCRIPTION = "description" fld public final static java.lang.String PROP_NAME = "name" meth public abstract java.lang.String getDescription() meth public abstract java.lang.String getLocalizingBundle() meth public abstract java.lang.String getName() meth public abstract java.lang.String getType() meth public abstract java.util.List<java.net.URL> getContent(java.lang.String) meth public abstract void addPropertyChangeListener(java.beans.PropertyChangeListener) meth public abstract void removePropertyChangeListener(java.beans.PropertyChangeListener) meth public abstract void setContent(java.lang.String,java.util.List<java.net.URL>) meth public abstract void setDescription(java.lang.String) meth public abstract void setLocalizingBundle(java.lang.String) meth public abstract void setName(java.lang.String) CLSS public abstract interface org.netbeans.spi.project.libraries.LibraryImplementation2 intf org.netbeans.spi.project.libraries.LibraryImplementation meth public abstract java.util.List<java.net.URI> getURIContent(java.lang.String) meth public abstract void setURIContent(java.lang.String,java.util.List<java.net.URI>) CLSS public abstract interface org.netbeans.spi.project.libraries.LibraryImplementation3 fld public final static java.lang.String PROP_PROPERTIES = "properties" intf org.netbeans.spi.project.libraries.NamedLibraryImplementation meth public abstract java.util.Map<java.lang.String,java.lang.String> getProperties() anno 0 org.netbeans.api.annotations.common.NonNull() meth public abstract void setProperties(java.util.Map<java.lang.String,java.lang.String>) anno 1 org.netbeans.api.annotations.common.NonNull() CLSS public abstract interface org.netbeans.spi.project.libraries.LibraryProvider<%0 extends org.netbeans.spi.project.libraries.LibraryImplementation> fld public final static java.lang.String PROP_LIBRARIES = "libraries" meth public abstract void addPropertyChangeListener(java.beans.PropertyChangeListener) meth public abstract void removePropertyChangeListener(java.beans.PropertyChangeListener) meth public abstract {org.netbeans.spi.project.libraries.LibraryProvider%0}[] getLibraries() CLSS public abstract interface org.netbeans.spi.project.libraries.LibraryStorageArea fld public final static org.netbeans.spi.project.libraries.LibraryStorageArea GLOBAL meth public abstract java.lang.String getDisplayName() meth public abstract java.net.URL getLocation() CLSS public abstract interface org.netbeans.spi.project.libraries.LibraryStorageAreaCache meth public abstract java.util.Collection<? extends java.net.URL> getCachedAreas() anno 0 org.netbeans.api.annotations.common.NonNull() CLSS public abstract interface org.netbeans.spi.project.libraries.LibraryTypeProvider intf org.openide.util.Lookup$Provider meth public abstract java.beans.Customizer getCustomizer(java.lang.String) meth public abstract java.lang.String getDisplayName() meth public abstract java.lang.String getLibraryType() meth public abstract java.lang.String[] getSupportedVolumeTypes() meth public abstract org.netbeans.spi.project.libraries.LibraryImplementation createLibrary() meth public abstract void libraryCreated(org.netbeans.spi.project.libraries.LibraryImplementation) meth public abstract void libraryDeleted(org.netbeans.spi.project.libraries.LibraryImplementation) CLSS public abstract interface org.netbeans.spi.project.libraries.NamedLibraryImplementation fld public final static java.lang.String PROP_DISPLAY_NAME = "displayName" intf org.netbeans.spi.project.libraries.LibraryImplementation meth public abstract java.lang.String getDisplayName() anno 0 org.netbeans.api.annotations.common.CheckForNull() meth public abstract void setDisplayName(java.lang.String) anno 1 org.netbeans.api.annotations.common.NullAllowed() CLSS public abstract interface org.netbeans.spi.project.libraries.WritableLibraryProvider<%0 extends org.netbeans.spi.project.libraries.LibraryImplementation> intf org.netbeans.spi.project.libraries.LibraryProvider<{org.netbeans.spi.project.libraries.WritableLibraryProvider%0}> meth public abstract boolean addLibrary({org.netbeans.spi.project.libraries.WritableLibraryProvider%0}) throws java.io.IOException meth public abstract boolean removeLibrary({org.netbeans.spi.project.libraries.WritableLibraryProvider%0}) throws java.io.IOException meth public abstract boolean updateLibrary({org.netbeans.spi.project.libraries.WritableLibraryProvider%0},{org.netbeans.spi.project.libraries.WritableLibraryProvider%0}) throws java.io.IOException CLSS public abstract org.openide.util.Lookup cons public init() fld public final static org.openide.util.Lookup EMPTY innr public abstract interface static Provider innr public abstract static Item innr public abstract static Result innr public final static Template meth public <%0 extends java.lang.Object> java.util.Collection<? extends {%%0}> lookupAll(java.lang.Class<{%%0}>) meth public <%0 extends java.lang.Object> org.openide.util.Lookup$Item<{%%0}> lookupItem(org.openide.util.Lookup$Template<{%%0}>) meth public <%0 extends java.lang.Object> org.openide.util.Lookup$Result<{%%0}> lookupResult(java.lang.Class<{%%0}>) meth public abstract <%0 extends java.lang.Object> org.openide.util.Lookup$Result<{%%0}> lookup(org.openide.util.Lookup$Template<{%%0}>) meth public abstract <%0 extends java.lang.Object> {%%0} lookup(java.lang.Class<{%%0}>) meth public static org.openide.util.Lookup getDefault() supr java.lang.Object hfds LOG,defaultLookup,defaultLookupProvider hcls DefLookup,Empty CLSS public abstract interface static org.openide.util.Lookup$Provider outer org.openide.util.Lookup meth public abstract org.openide.util.Lookup getLookup()
Standard ML
3
timfel/netbeans
ide/project.libraries.ui/nbproject/org-netbeans-modules-project-libraries-ui.sig
[ "Apache-2.0" ]
alias gawkpath_default 'unsetenv AWKPATH; setenv AWKPATH `gawk -v x=AWKPATH "BEGIN {print ENVIRON[x]}"`' alias gawkpath_prepend 'if (! $?AWKPATH) setenv AWKPATH ""; if ($AWKPATH == "") then; unsetenv AWKPATH; setenv AWKPATH `gawk -v x=AWKPATH "BEGIN {print ENVIRON[x]}"`; endif; setenv AWKPATH "\!*"":$AWKPATH"' alias gawkpath_append 'if (! $?AWKPATH) setenv AWKPATH ""; if ($AWKPATH == "") then; unsetenv AWKPATH; setenv AWKPATH `gawk -v x=AWKPATH "BEGIN {print ENVIRON[x]}"`; endif; setenv AWKPATH "$AWKPATH"":\!*"' alias gawklibpath_default 'unsetenv AWKLIBPATH; setenv AWKLIBPATH `gawk -v x=AWKLIBPATH "BEGIN {print ENVIRON[x]}"`' alias gawklibpath_prepend 'if (! $?AWKLIBPATH) setenv AWKLIBPATH ""; if ($AWKLIBPATH == "") then; unsetenv AWKLIBPATH; setenv AWKLIBPATH `gawk -v x=AWKLIBPATH "BEGIN {print ENVIRON[x]}"`; endif; setenv AWKLIBPATH "\!*"":$AWKLIBPATH"' alias gawklibpath_append 'if (! $?AWKLIBPATH) setenv AWKLIBPATH ""; if ($AWKLIBPATH == "") then; unsetenv AWKLIBPATH; setenv AWKLIBPATH `gawk -v x=AWKLIBPATH "BEGIN {print ENVIRON[x]}"`; endif; setenv AWKLIBPATH "$AWKLIBPATH"":\!*"'
Tcsh
3
Bhuvanesh1208/ruby2.6.1
msys64/usr/etc/profile.d/gawk.csh
[ "Ruby" ]
/** * fannkuch.pike by Robert Brandner * heavily based on the Java JDK-client version by Paul Lofte */ int main(int argc, array(string) argv) { int n = (int)argv[1]; write("Pfannkuchen(" + n + ") = " + fannkuch(n)+"\n"); } int fannkuch(int n) { int check = 0; array(int) perm = allocate(n); array(int) perm1 = allocate(n); array(int) count = allocate(n); array(int) maxPerm = allocate(n); int maxFlipsCount = 0; int m = n - 1; for (int i = 0; i < n; i++) perm1[i] = i; int r = n; while (1) { // write-out the first 30 permutations if (check < 30){ for(int i=0; i<n; i++) write((string)(perm1[i]+1)); write("\n"); check++; } while (r != 1) { count[r - 1] = r; r--; } if (!(perm1[0] == 0 || perm1[m] == m)) { for (int i = 0; i < n; i++) perm[i] = perm1[i]; int flipsCount = 0; int k; while (!((k = perm[0]) == 0)) { int k2 = (k + 1) >> 1; for (int i = 0; i < k2; i++) { int temp = perm[i]; perm[i] = perm[k - i]; perm[k - i] = temp; } flipsCount++; } if (flipsCount > maxFlipsCount) { maxFlipsCount = flipsCount; for (int i = 0; i < n; i++) maxPerm[i] = perm1[i]; } } while (1) { if (r == n) return maxFlipsCount; int perm0 = perm1[0]; int i = 0; while (i < r) { int j = i + 1; perm1[i] = perm1[j]; i = j; } perm1[r] = perm0; count[r] = count[r] - 1; if (count[r] > 0) break; r++; } } }
Pike
4
kragen/shootout
bench/fannkuch/fannkuch.pike
[ "BSD-3-Clause" ]
<?xml version='1.0' encoding='UTF-8'?> <Project Type="Project" LVVersion="12008004"> <Property Name="NI.LV.All.SourceOnly" Type="Bool">true</Property> <Property Name="NI.Project.Description" Type="Str"></Property> <Item Name="My Computer" Type="My Computer"> <Property Name="server.app.propertiesEnabled" Type="Bool">true</Property> <Property Name="server.control.propertiesEnabled" Type="Bool">true</Property> <Property Name="server.tcp.enabled" Type="Bool">false</Property> <Property Name="server.tcp.port" Type="Int">0</Property> <Property Name="server.tcp.serviceName" Type="Str">My Computer/VI Server</Property> <Property Name="server.tcp.serviceName.default" Type="Str">My Computer/VI Server</Property> <Property Name="server.vi.callsEnabled" Type="Bool">true</Property> <Property Name="server.vi.propertiesEnabled" Type="Bool">true</Property> <Property Name="specify.custom.address" Type="Bool">false</Property> <Item Name="Get Project LV Version.vi" Type="VI" URL="../Get Project LV Version.vi"/> <Item Name="Dependencies" Type="Dependencies"> <Item Name="vi.lib" Type="Folder"> <Item Name="Recursive File List.vi" Type="VI" URL="/&lt;vilib&gt;/Utility/libraryn.llb/Recursive File List.vi"/> </Item> <Item Name="msvcrt.dll" Type="Document" URL="msvcrt.dll"> <Property Name="NI.PreserveRelativePath" Type="Bool">true</Property> </Item> </Item> <Item Name="Build Specifications" Type="Build"> <Item Name="My Application" Type="EXE"> <Property Name="App_INI_aliasGUID" Type="Str">{5928282F-930E-40D3-BCD0-5D4DAE7D6098}</Property> <Property Name="App_INI_GUID" Type="Str">{81E49E9C-6526-4233-B540-1D0516915E5A}</Property> <Property Name="Bld_buildCacheID" Type="Str">{91283138-01D6-4E80-88C2-2847C15365C6}</Property> <Property Name="Bld_buildSpecName" Type="Str">My Application</Property> <Property Name="Bld_excludeInlineSubVIs" Type="Bool">true</Property> <Property Name="Bld_excludeLibraryItems" Type="Bool">true</Property> <Property Name="Bld_excludePolymorphicVIs" Type="Bool">true</Property> <Property Name="Bld_localDestDir" Type="Path">..</Property> <Property Name="Bld_localDestDirType" Type="Str">relativeToProject</Property> <Property Name="Bld_modifyLibraryFile" Type="Bool">true</Property> <Property Name="Bld_previewCacheID" Type="Str">{397D4143-EA6F-497F-8C83-E2A0CBDE7FED}</Property> <Property Name="Destination[0].destName" Type="Str">GetProjVersion.exe</Property> <Property Name="Destination[0].path" Type="Path">../GetProjVersion.exe</Property> <Property Name="Destination[0].path.type" Type="Str">relativeToProject</Property> <Property Name="Destination[0].preserveHierarchy" Type="Bool">true</Property> <Property Name="Destination[0].type" Type="Str">App</Property> <Property Name="Destination[1].destName" Type="Str">Support Directory</Property> <Property Name="Destination[1].path" Type="Path">../data</Property> <Property Name="Destination[1].path.type" Type="Str">relativeToProject</Property> <Property Name="DestinationCount" Type="Int">2</Property> <Property Name="Source[0].itemID" Type="Str">{19C241C8-BF26-4A92-97DA-330467AEE0BE}</Property> <Property Name="Source[0].type" Type="Str">Container</Property> <Property Name="Source[1].destinationIndex" Type="Int">0</Property> <Property Name="Source[1].itemID" Type="Ref">/My Computer/Get Project LV Version.vi</Property> <Property Name="Source[1].sourceInclusion" Type="Str">TopLevel</Property> <Property Name="Source[1].type" Type="Str">VI</Property> <Property Name="SourceCount" Type="Int">2</Property> <Property Name="TgtF_companyName" Type="Str">NI</Property> <Property Name="TgtF_fileDescription" Type="Str">My Application</Property> <Property Name="TgtF_fileVersion.major" Type="Int">1</Property> <Property Name="TgtF_internalName" Type="Str">My Application</Property> <Property Name="TgtF_legalCopyright" Type="Str">Copyright © 2013 NI</Property> <Property Name="TgtF_productName" Type="Str">My Application</Property> <Property Name="TgtF_targetfileGUID" Type="Str">{B635F5E8-3BC2-4F81-9778-0E2D9F5315B0}</Property> <Property Name="TgtF_targetfileName" Type="Str">GetProjVersion.exe</Property> </Item> </Item> </Item> </Project>
LabVIEW
1
TBDFramework/Jenkins-Autobuild
Get Project LV Version/Get Project LV Version.lvproj
[ "BSD-2-Clause" ]
sleep 1 t app appmode photo sleep 600 t app button shutter PR d:\autoexec.ash REBOOT yes
AGS Script
0
waltersgrey/autoexechack
MegaLapse/10MinInterval/Hero3PlusBlack/autoexec.ash
[ "MIT" ]
package com.baeldung.openid.oidc.login; import org.junit.jupiter.api.Test; import org.springframework.boot.test.context.SpringBootTest; import org.springframework.test.context.ContextConfiguration; import com.baeldung.openid.oidc.utils.YamlLoaderInitializer; @SpringBootTest(classes = SpringOidcLoginApplication.class, properties = "custom.configyaml.file=login-application.yml") @ContextConfiguration(initializers = YamlLoaderInitializer.class) public class SpringContextTest { @Test public void whenSpringContextIsBootstrapped_thenNoExceptions() { } }
Java
3
DBatOWL/tutorials
spring-security-modules/spring-security-oidc/src/test/java/com/baeldung/openid/oidc/login/SpringContextTest.java
[ "MIT" ]
/* * Program type: Embedded Dynamic SQL * * Description: * This program creates a new database, using a static SQL string. * The newly created database is accessed after its creation, * and a sample table is added. * The contents of this file are subject to the Interbase Public * License Version 1.0 (the "License"); you may not use this file * except in compliance with the License. You may obtain a copy * of the License at http://www.Inprise.com/IPL.html * * Software distributed under the License is distributed on an * "AS IS" basis, WITHOUT WARRANTY OF ANY KIND, either express * or implied. See the License for the specific language governing * rights and limitations under the License. * * The Original Code was created by Inprise Corporation * and its predecessors. Portions created by Inprise Corporation are * Copyright (C) Inprise Corporation. * * All Rights Reserved. * Contributor(s): ______________________________________. */ #include "example.h" #include <stdlib.h> #include <string.h> void pr_error (char *operation); char *new_dbname = "new.fdb"; char *create_tbl = "CREATE TABLE dbinfo (when_created DATE)"; char *insert_date = "INSERT INTO dbinfo VALUES ('NOW')"; /* * Declare a database handle, which will be used by the new database. */ EXEC SQL SET DATABASE db = COMPILETIME "employee.fdb"; int main(int argc, char** argv) { db = NULL; /* * Create a new database, establishing a connection * as well. */ EXEC SQL EXECUTE IMMEDIATE "CREATE DATABASE 'new.fdb'"; if (SQLCODE) { /* Print a descriptive message, if the database exists. */ if (SQLCODE == -902) { printf("\nDatabase already exists.\n"); printf("Remove %s before running this program.\n\n", new_dbname); } pr_error("create database"); return 1; } EXEC SQL COMMIT RELEASE; if (SQLCODE) { pr_error("commit & release"); return 1; } printf("Created database '%s'.\n\n", new_dbname); /* * Connect to the new database and create a sample table. */ /* Use the database handle declared above. */ EXEC SQL CONNECT :new_dbname AS db; if (SQLCODE) { pr_error("connect database"); return 1; } /* Create a sample table. */ EXEC SQL SET TRANSACTION; EXEC SQL EXECUTE IMMEDIATE :create_tbl; if (SQLCODE) { pr_error("create table"); return 1; } EXEC SQL COMMIT RETAIN; /* Insert 1 row into the new table. */ EXEC SQL SET TRANSACTION; EXEC SQL EXECUTE IMMEDIATE :insert_date; if (SQLCODE) { pr_error("insert into"); return 1; } EXEC SQL COMMIT RELEASE; printf("Successfully accessed the newly created database.\n\n"); EXEC SQL DISCONNECT db; return 0; } /* * Print the status, the SQLCODE, and exit. * Also, indicate which operation the error occured on. */ void pr_error(char* operation) { printf("[\n"); printf("PROBLEM ON \"%s\".\n", operation); isc_print_status(gds__status); printf("SQLCODE = %d\n", SQLCODE); printf("]\n"); }
Eiffel
5
AlexeyMochalov/firebird
examples/dyn/dyn1.e
[ "Condor-1.1" ]
# Copyright 1999-2017 Gentoo Foundation # Distributed under the terms of the GNU General Public License v2 # @ECLASS: estack.eclass # @MAINTAINER: # base-system@gentoo.org # @BLURB: stack-like value storage support # @DESCRIPTION: # Support for storing values on stack-like variables. if [[ -z ${_ESTACK_ECLASS} ]]; then # @FUNCTION: estack_push # @USAGE: <stack> [items to push] # @DESCRIPTION: # Push any number of items onto the specified stack. Pick a name that # is a valid variable (i.e. stick to alphanumerics), and push as many # items as you like onto the stack at once. # # The following code snippet will echo 5, then 4, then 3, then ... # @CODE # estack_push mystack 1 2 3 4 5 # while estack_pop mystack i ; do # echo "${i}" # done # @CODE estack_push() { [[ $# -eq 0 ]] && die "estack_push: incorrect # of arguments" local stack_name="_ESTACK_$1_" ; shift eval ${stack_name}+=\( \"\$@\" \) } # @FUNCTION: estack_pop # @USAGE: <stack> [variable] # @DESCRIPTION: # Pop a single item off the specified stack. If a variable is specified, # the popped item is stored there. If no more items are available, return # 1, else return 0. See estack_push for more info. estack_pop() { [[ $# -eq 0 || $# -gt 2 ]] && die "estack_pop: incorrect # of arguments" # We use the fugly _estack_xxx var names to avoid collision with # passing back the return value. If we used "local i" and the # caller ran `estack_pop ... i`, we'd end up setting the local # copy of "i" rather than the caller's copy. The _estack_xxx # garbage is preferable to using $1/$2 everywhere as that is a # bit harder to read. local _estack_name="_ESTACK_$1_" ; shift local _estack_retvar=$1 ; shift eval local _estack_i=\${#${_estack_name}\[@\]} # Don't warn -- let the caller interpret this as a failure # or as normal behavior (akin to `shift`) [[ $(( --_estack_i )) -eq -1 ]] && return 1 if [[ -n ${_estack_retvar} ]] ; then eval ${_estack_retvar}=\"\${${_estack_name}\[${_estack_i}\]}\" fi eval unset \"${_estack_name}\[${_estack_i}\]\" } # @FUNCTION: evar_push # @USAGE: <variable to save> [more vars to save] # @DESCRIPTION: # This let's you temporarily modify a variable and then restore it (including # set vs unset semantics). Arrays are not supported at this time. # # This is meant for variables where using `local` does not work (such as # exported variables, or only temporarily changing things in a func). # # For example: # @CODE # evar_push LC_ALL # export LC_ALL=C # ... do some stuff that needs LC_ALL=C set ... # evar_pop # # # You can also save/restore more than one var at a time # evar_push BUTTERFLY IN THE SKY # ... do stuff with the vars ... # evar_pop # This restores just one var, SKY # ... do more stuff ... # evar_pop 3 # This pops the remaining 3 vars # @CODE evar_push() { local var val for var ; do [[ ${!var+set} == "set" ]] \ && val=${!var} \ || val="unset_76fc3c462065bb4ca959f939e6793f94" estack_push evar "${var}" "${val}" done } # @FUNCTION: evar_push_set # @USAGE: <variable to save> [new value to store] # @DESCRIPTION: # This is a handy shortcut to save and temporarily set a variable. If a value # is not specified, the var will be unset. evar_push_set() { local var=$1 evar_push ${var} case $# in 1) unset ${var} ;; 2) printf -v "${var}" '%s' "$2" ;; *) die "${FUNCNAME}: incorrect # of args: $*" ;; esac } # @FUNCTION: evar_pop # @USAGE: [number of vars to restore] # @DESCRIPTION: # Restore the variables to the state saved with the corresponding # evar_push call. See that function for more details. evar_pop() { local cnt=${1:-bad} case $# in 0) cnt=1 ;; 1) isdigit "${cnt}" || die "${FUNCNAME}: first arg must be a number: $*" ;; *) die "${FUNCNAME}: only accepts one arg: $*" ;; esac local var val while (( cnt-- )) ; do estack_pop evar val || die "${FUNCNAME}: unbalanced push" estack_pop evar var || die "${FUNCNAME}: unbalanced push" [[ ${val} == "unset_76fc3c462065bb4ca959f939e6793f94" ]] \ && unset ${var} \ || printf -v "${var}" '%s' "${val}" done } # @FUNCTION: eshopts_push # @USAGE: [options to `set` or `shopt`] # @DESCRIPTION: # Often times code will want to enable a shell option to change code behavior. # Since changing shell options can easily break other pieces of code (which # assume the default state), eshopts_push is used to (1) push the current shell # options onto a stack and (2) pass the specified arguments to set. # # If the first argument is '-s' or '-u', we assume you want to call `shopt` # rather than `set` as there are some options only available via that. # # A common example is to disable shell globbing so that special meaning/care # may be used with variables/arguments to custom functions. That would be: # @CODE # eshopts_push -o noglob # for x in ${foo} ; do # if ...some check... ; then # eshopts_pop # return 0 # fi # done # eshopts_pop # @CODE eshopts_push() { if [[ $1 == -[su] ]] ; then estack_push eshopts "$(shopt -p)" [[ $# -eq 0 ]] && return 0 shopt "$@" || die "${FUNCNAME}: bad options to shopt: $*" else estack_push eshopts "$(shopt -p -o)" [[ $# -eq 0 ]] && return 0 set "$@" || die "${FUNCNAME}: bad options to set: $*" fi } # @FUNCTION: eshopts_pop # @USAGE: # @DESCRIPTION: # Restore the shell options to the state saved with the corresponding # eshopts_push call. See that function for more details. eshopts_pop() { local s estack_pop eshopts s || die "${FUNCNAME}: unbalanced push" eval "${s}" || die "${FUNCNAME}: sanity: invalid shopt options: ${s}" } # @FUNCTION: eumask_push # @USAGE: <new umask> # @DESCRIPTION: # Set the umask to the new value specified while saving the previous # value onto a stack. Useful for temporarily changing the umask. eumask_push() { estack_push eumask "$(umask)" umask "$@" || die "${FUNCNAME}: bad options to umask: $*" } # @FUNCTION: eumask_pop # @USAGE: # @DESCRIPTION: # Restore the previous umask state. eumask_pop() { [[ $# -eq 0 ]] || die "${FUNCNAME}: we take no options" local s estack_pop eumask s || die "${FUNCNAME}: unbalanced push" umask ${s} || die "${FUNCNAME}: sanity: could not restore umask: ${s}" } # @FUNCTION: isdigit # @USAGE: <number> [more numbers] # @DESCRIPTION: # Return true if all arguments are numbers. isdigit() { local d for d ; do [[ ${d:-bad} == *[!0-9]* ]] && return 1 done return 0 } _ESTACK_ECLASS=1 fi #_ESTACK_ECLASS
Gentoo Eclass
5
NighttimeDriver50000/Sabayon-Packages
local_overlay/eclass/estack.eclass
[ "MIT" ]
<body> <div class="app-lazy-css"></div> <div class="app-eager-css"></div> <div class="pkg-lazy-css imported"></div> <div class="pkg-lazy-css not-imported"></div> </body>
HTML
0
joseconstela/meteor
tools/tests/apps/modules/lazy-css.html
[ "Apache-2.0", "BSD-2-Clause", "MIT" ]
''' Texture ======= .. versionchanged:: 1.6.0 Added support for paletted texture on OES: 'palette4_rgb8', 'palette4_rgba8', 'palette4_r5_g6_b5', 'palette4_rgba4', 'palette4_rgb5_a1', 'palette8_rgb8', 'palette8_rgba8', 'palette8_r5_g6_b5', 'palette8_rgba4' and 'palette8_rgb5_a1'. :class:`Texture` is a class that handles OpenGL textures. Depending on the hardware, some OpenGL capabilities might not be available (BGRA support, NPOT support, etc.) You cannot instantiate this class yourself. You must use the function :meth:`Texture.create` to create a new texture:: texture = Texture.create(size=(640, 480)) When you create a texture, you should be aware of the default color and buffer format: - the color/pixel format (:attr:`Texture.colorfmt`) that can be one of 'rgb', 'rgba', 'luminance', 'luminance_alpha', 'bgr' or 'bgra'. The default value is 'rgb' - the buffer format determines how a color component is stored into memory. This can be one of 'ubyte', 'ushort', 'uint', 'byte', 'short', 'int' or 'float'. The default value and the most commonly used is 'ubyte'. So, if you want to create an RGBA texture:: texture = Texture.create(size=(640, 480), colorfmt='rgba') You can use your texture in almost all vertex instructions with the :attr:`kivy.graphics.VertexIntruction.texture` parameter. If you want to use your texture in kv lang, you can save it in an :class:`~kivy.properties.ObjectProperty` inside your widget. .. warning:: Using Texture before OpenGL has been initialized will lead to a crash. If you need to create textures before the application has started, import Window first: `from kivy.core.window import Window` Blitting custom data -------------------- You can create your own data and blit it to the texture using :meth:`Texture.blit_buffer`. For example, to blit immutable bytes data:: # create a 64x64 texture, defaults to rgba / ubyte texture = Texture.create(size=(64, 64)) # create 64x64 rgb tab, and fill with values from 0 to 255 # we'll have a gradient from black to white size = 64 * 64 * 3 buf = [int(x * 255 / size) for x in range(size)] # then, convert the array to a ubyte string buf = bytes(buf) # then blit the buffer texture.blit_buffer(buf, colorfmt='rgb', bufferfmt='ubyte') # that's all ! you can use it in your graphics now :) # if self is a widget, you can do this with self.canvas: Rectangle(texture=texture, pos=self.pos, size=(64, 64)) Since 1.9.0, you can blit data stored in a instance that implements the python buffer interface, or a memoryview thereof, such as numpy arrays, python `array.array`, a `bytearray`, or a cython array. This is beneficial if you expect to blit similar data, with perhaps a few changes in the data. When using a bytes representation of the data, for every change you have to regenerate the bytes instance, from perhaps a list, which is very inefficient. When using a buffer object, you can simply edit parts of the original data. Similarly, unless starting with a bytes object, converting to bytes requires a full copy, however, when using a buffer instance, no memory is copied, except to upload it to the GPU. Continuing with the example above:: from array import array size = 64 * 64 * 3 buf = [int(x * 255 / size) for x in range(size)] # initialize the array with the buffer values arr = array('B', buf) # now blit the array texture.blit_buffer(arr, colorfmt='rgb', bufferfmt='ubyte') # now change some elements in the original array arr[24] = arr[50] = 99 # blit again the buffer texture.blit_buffer(arr, colorfmt='rgb', bufferfmt='ubyte') BGR/BGRA support ---------------- The first time you try to create a BGR or BGRA texture, we check whether your hardware supports BGR / BGRA textures by checking the extension 'GL_EXT_bgra'. If the extension is not found, the conversion to RGB / RGBA will be done in software. NPOT texture ------------ .. versionchanged:: 1.0.7 If your hardware supports NPOT, no POT is created. As the OpenGL documentation says, a texture must be power-of-two sized. That means your width and height can be one of 64, 32, 256... but not 3, 68, 42. NPOT means non-power-of-two. OpenGL ES 2 supports NPOT textures natively but with some drawbacks. Another type of NPOT texture is called a rectangle texture. POT, NPOT and textures all have their own pro/cons. ================= ============= ============= ================================= Features POT NPOT Rectangle ----------------- ------------- ------------- --------------------------------- OpenGL Target GL_TEXTURE_2D GL_TEXTURE_2D GL_TEXTURE_RECTANGLE_(NV|ARB|EXT) Texture coords 0-1 range 0-1 range width-height range Mipmapping Supported Partially No Wrap mode Supported Supported No ================= ============= ============= ================================= If you create a NPOT texture, we first check whether your hardware supports it by checking the extensions GL_ARB_texture_non_power_of_two or OES_texture_npot. If none of these are available, we create the nearest POT texture that can contain your NPOT texture. The :meth:`Texture.create` will return a :class:`TextureRegion` instead. Texture atlas ------------- A texture atlas is a single texture that contains many images. If you want to separate the original texture into many single ones, you don't need to. You can get a region of the original texture. That will return the original texture with custom texture coordinates:: # for example, load a 128x128 image that contain 4 64x64 images from kivy.core.image import Image texture = Image('mycombinedimage.png').texture bottomleft = texture.get_region(0, 0, 64, 64) bottomright = texture.get_region(0, 64, 64, 64) topleft = texture.get_region(0, 64, 64, 64) topright = texture.get_region(64, 64, 64, 64) .. _mipmap: Mipmapping ---------- .. versionadded:: 1.0.7 Mipmapping is an OpenGL technique for enhancing the rendering of large textures to small surfaces. Without mipmapping, you might see pixelation when you render to small surfaces. The idea is to precalculate the subtexture and apply some image filter as a linear filter. Then, when you render a small surface, instead of using the biggest texture, it will use a lower filtered texture. The result can look better this way. To make that happen, you need to specify mipmap=True when you create a texture. Some widgets already give you the ability to create mipmapped textures, such as the :class:`~kivy.uix.label.Label` and :class:`~kivy.uix.image.Image`. From the OpenGL Wiki : "So a 64x16 2D texture can have 5 mip-maps: 32x8, 16x4, 8x2, 4x1, 2x1, and 1x1". Check http://www.opengl.org/wiki/Texture for more information. .. note:: As the table in previous section said, if your texture is NPOT, we create the nearest POT texture and generate a mipmap from it. This might change in the future. Reloading the Texture --------------------- .. versionadded:: 1.2.0 If the OpenGL context is lost, the Texture must be reloaded. Textures that have a source are automatically reloaded but generated textures must be reloaded by the user. Use the :meth:`Texture.add_reload_observer` to add a reloading function that will be automatically called when needed:: def __init__(self, **kwargs): super(...).__init__(**kwargs) self.texture = Texture.create(size=(512, 512), colorfmt='RGB', bufferfmt='ubyte') self.texture.add_reload_observer(self.populate_texture) # and load the data now. self.cbuffer = '\\x00\\xf0\\xff' * 512 * 512 self.populate_texture(self.texture) def populate_texture(self, texture): texture.blit_buffer(self.cbuffer) This way, you can use the same method for initialization and reloading. .. note:: For all text rendering with our core text renderer, the texture is generated but we already bind a method to redo the text rendering and reupload the text to the texture. You don't have to do anything. ''' __all__ = ('Texture', 'TextureRegion') include "../include/config.pxi" include "common.pxi" include "opengl_utils_def.pxi" include "img_tools.pxi" include "gl_debug_logger.pxi" cimport cython from os import environ from kivy.utils import platform from kivy.weakmethod import WeakMethod from kivy.graphics.context cimport get_context cimport kivy.graphics.cgl as cgldef from kivy.graphics.cgl cimport * from kivy.graphics.opengl_utils cimport gl_has_capability, gl_get_version_major cdef int gles_limts = int(environ.get( 'KIVY_GLES_LIMITS', int(platform not in ('win', 'macosx', 'linux')))) # update flags cdef int TI_MIN_FILTER = 1 << 0 cdef int TI_MAG_FILTER = 1 << 1 cdef int TI_WRAP = 1 << 2 cdef int TI_NEED_GEN = 1 << 3 cdef int TI_NEED_ALLOCATE = 1 << 4 cdef int TI_NEED_PIXELS = 1 << 5 # compatibility layer DEF GL_BGR = 0x80E0 DEF GL_BGRA = 0x80E1 DEF GL_COMPRESSED_RGBA_S3TC_DXT1_EXT = 0x83F1 DEF GL_COMPRESSED_RGBA_S3TC_DXT3_EXT = 0x83F2 DEF GL_COMPRESSED_RGBA_S3TC_DXT5_EXT = 0x83F3 DEF GL_ETC1_RGB8_OES = 0x8D64 DEF GL_PALETTE4_RGB8_OES = 0x8B90 DEF GL_PALETTE4_RGBA8_OES = 0x8B91 DEF GL_PALETTE4_R5_G6_B5_OES = 0x8B92 DEF GL_PALETTE4_RGBA4_OES = 0x8B93 DEF GL_PALETTE4_RGB5_A1_OES = 0x8B94 DEF GL_PALETTE8_RGB8_OES = 0x8B95 DEF GL_PALETTE8_RGBA8_OES = 0x8B96 DEF GL_PALETTE8_R5_G6_B5_OES = 0x8B97 DEF GL_PALETTE8_RGBA4_OES = 0x8B98 DEF GL_PALETTE8_RGB5_A1_OES = 0x8B99 DEF GL_COMPRESSED_RGB_PVRTC_4BPPV1_IMG = 0x8C00 DEF GL_COMPRESSED_RGB_PVRTC_2BPPV1_IMG = 0x8C01 DEF GL_COMPRESSED_RGBA_PVRTC_4BPPV1_IMG = 0x8C02 DEF GL_COMPRESSED_RGBA_PVRTC_2BPPV1_IMG = 0x8C03 DEF GL_RED = 0x1903 DEF GL_RG = 0x8227 DEF GL_R8 = 0x8229 DEF GL_RG8 = 0x822B DEF GL_RGBA8 = 0x8058 DEF GL_UNPACK_ROW_LENGTH = 0x0CF2 DEF GL_UNPACK_SKIP_ROWS = 0x0CF3 DEF GL_UNPACK_SKIP_PIXELS = 0x0CF4 cdef dict _gl_color_fmt = { 'rgba': GL_RGBA, 'bgra': GL_BGRA, 'rgb': GL_RGB, 'bgr': GL_BGR, 'luminance': GL_LUMINANCE, 'luminance_alpha': GL_LUMINANCE_ALPHA, 's3tc_dxt1': GL_COMPRESSED_RGBA_S3TC_DXT1_EXT, 's3tc_dxt3': GL_COMPRESSED_RGBA_S3TC_DXT3_EXT, 's3tc_dxt5': GL_COMPRESSED_RGBA_S3TC_DXT5_EXT, 'etc1_rgb8': GL_ETC1_RGB8_OES, 'palette4_rgb8': GL_PALETTE4_RGB8_OES, 'palette4_rgba8': GL_PALETTE4_RGBA8_OES, 'palette4_r5_g6_b5': GL_PALETTE4_R5_G6_B5_OES, 'palette4_rgba4': GL_PALETTE4_RGBA4_OES, 'palette4_rgb5_a1': GL_PALETTE4_RGB5_A1_OES, 'palette8_rgb8': GL_PALETTE8_RGB8_OES, 'palette8_rgba8': GL_PALETTE8_RGBA8_OES, 'palette8_r5_g6_b5': GL_PALETTE8_R5_G6_B5_OES, 'palette8_rgba4': GL_PALETTE8_RGBA4_OES, 'palette8_rgb5_a1': GL_PALETTE8_RGB5_A1_OES, 'pvrtc_rgba2': GL_COMPRESSED_RGBA_PVRTC_2BPPV1_IMG, 'pvrtc_rgba4': GL_COMPRESSED_RGBA_PVRTC_4BPPV1_IMG, 'pvrtc_rgb2': GL_COMPRESSED_RGB_PVRTC_2BPPV1_IMG, 'pvrtc_rgb4': GL_COMPRESSED_RGB_PVRTC_4BPPV1_IMG, 'red': GL_RED, 'rg': GL_RG, 'r8': GL_R8, 'rg8': GL_RG8, 'rgba8': GL_RGBA8} cdef dict _gl_buffer_fmt = { 'ubyte': GL_UNSIGNED_BYTE, 'ushort': GL_UNSIGNED_SHORT, 'uint': GL_UNSIGNED_INT, 'byte': GL_BYTE, 'short': GL_SHORT, 'int': GL_INT, 'float': GL_FLOAT} cdef dict _gl_buffer_size = { 'ubyte': sizeof(GLubyte), 'ushort': sizeof(GLushort), 'uint': sizeof(GLuint), 'byte': sizeof(GLbyte), 'short': sizeof(GLshort), 'int': sizeof(GLint), 'float': sizeof(GLfloat) } cdef dict _gl_texture_min_filter = { 'nearest': GL_NEAREST, 'linear': GL_LINEAR, 'nearest_mipmap_nearest': GL_NEAREST_MIPMAP_NEAREST, 'nearest_mipmap_linear': GL_NEAREST_MIPMAP_LINEAR, 'linear_mipmap_nearest': GL_LINEAR_MIPMAP_NEAREST, 'linear_mipmap_linear': GL_LINEAR_MIPMAP_LINEAR } cdef inline int _nearest_pow2(int v): # From http://graphics.stanford.edu/~seander/bithacks.html#RoundUpPowerOf2 # Credit: Sean Anderson v -= 1 v |= v >> 1 v |= v >> 2 v |= v >> 4 v |= v >> 8 v |= v >> 16 return v + 1 cdef inline int _is_pow2(int v): # http://graphics.stanford.edu/~seander/bithacks.html#DetermineIfPowerOf2 return (v & (v - 1)) == 0 cdef inline int _color_fmt_to_gl(x): '''Return the GL numeric value from a color string format. ''' x = x.lower() try: return _gl_color_fmt[x] except KeyError: raise Exception('Unknown <%s> color format' % x) cdef inline int _is_compressed_fmt(x): '''Return 1 if the color string format is a compressed one. ''' if x.startswith('palette'): return 1 if x.startswith('pvrtc_'): return 1 if x.startswith('etc1_'): return 1 return x.startswith('s3tc_dxt') cdef inline int _buffer_fmt_to_gl(x): '''Return the GL numeric value from a buffer string format. ''' x = x.lower() try: return _gl_buffer_fmt[x] except KeyError: raise Exception('Unknown <%s> buffer format' % x) cdef inline int _buffer_type_to_gl_size(x): '''Return the size of a buffer string format in str. ''' x = x.lower() try: return _gl_buffer_size[x] except KeyError: raise Exception('Unknown <%s> format' % x) cdef inline GLuint _str_to_gl_texture_min_filter(x): '''Return the GL numeric value from a texture min filter string. ''' x = x.lower() try: return _gl_texture_min_filter[x] except KeyError: raise Exception('Unknown <%s> texture min filter' % x) cdef inline GLuint _str_to_gl_texture_mag_filter(x): '''Return the GL numeric value from a texture mag filter string. ''' x = x.lower() if x == 'nearest': return GL_NEAREST elif x == 'linear': return GL_LINEAR raise Exception('Unknown <%s> texture mag filter' % x) cdef inline GLuint _str_to_gl_texture_wrap(x): '''Return the GL numeric value from a texture wrap string. ''' if x == 'clamp_to_edge': return GL_CLAMP_TO_EDGE elif x == 'repeat': return GL_REPEAT elif x == 'mirrored_repeat': return GL_MIRRORED_REPEAT cdef inline int _gl_format_size(GLuint x): '''Return the GL numeric value from a texture wrap string. ''' if x in (GL_RGB, GL_BGR): return 3 elif x in (GL_RGBA, GL_BGRA): return 4 elif x in (GL_LUMINANCE_ALPHA, GL_RG): return 2 elif x in (GL_LUMINANCE, GL_RED): return 1 elif x in (GL_COMPRESSED_RGBA_S3TC_DXT1_EXT, GL_COMPRESSED_RGBA_S3TC_DXT3_EXT, GL_COMPRESSED_RGBA_S3TC_DXT5_EXT): return 4 raise Exception('Unsupported format size <%s>' % str(format)) cdef inline int _is_gl_format_supported(x): if x in ('bgr', 'bgra'): return gl_has_capability(GLCAP_BGRA) elif x == 's3tc_dxt1': return gl_has_capability(GLCAP_DXT1) elif x.startswith('s3tc_dxt'): return gl_has_capability(GLCAP_S3TC) elif x.startswith('etc1_'): return gl_has_capability(GLCAP_ETC1) return 1 cdef inline str _convert_gl_format(x): if x == 'bgr': return 'rgb' elif x == 'bgra': return 'rgba' return x cdef inline void _gl_prepare_pixels_upload(int width) nogil: '''Set the best pixel alignment for the current width. ''' if not (width & 0x7): cgl.glPixelStorei(GL_UNPACK_ALIGNMENT, 8) elif not (width & 0x3): cgl.glPixelStorei(GL_UNPACK_ALIGNMENT, 4) elif not (width & 0x1): cgl.glPixelStorei(GL_UNPACK_ALIGNMENT, 2) else: cgl.glPixelStorei(GL_UNPACK_ALIGNMENT, 1) cdef Texture _texture_create(int width, int height, colorfmt, bufferfmt, int mipmap, int allocate, object callback, object icolorfmt): '''Create the OpenGL texture. ''' cdef GLuint target = GL_TEXTURE_2D cdef GLuint texid = 0 cdef Texture texture cdef int texture_width, texture_height cdef int glbufferfmt = _buffer_fmt_to_gl(bufferfmt) cdef int make_npot = 0 # check if it's a pot or not if not _is_pow2(width) or not _is_pow2(height): make_npot = 1 if not cgldef.kivy_opengl_es2: if gl_get_version_major() < 3: mipmap = 0 # in case of mipmap is asked for npot texture, make it pot compatible if mipmap: make_npot = 0 allocate = 1 # depending if npot is available, use the real size or pot size if make_npot and gl_has_capability(c_GLCAP_NPOT): texture_width = width texture_height = height else: texture_width = _nearest_pow2(width) texture_height = _nearest_pow2(height) # create the texture with the future color format. icolorfmt = _convert_gl_format(icolorfmt) texture = Texture(texture_width, texture_height, target, colorfmt=colorfmt, bufferfmt=bufferfmt, mipmap=mipmap, callback=callback, icolorfmt=icolorfmt) if allocate or make_npot: texture.flags |= TI_NEED_ALLOCATE # set default parameter for this texture texture.set_wrap('clamp_to_edge') if mipmap: texture.set_min_filter('linear_mipmap_nearest') texture.set_mag_filter('linear') else: texture.set_min_filter('linear') texture.set_mag_filter('linear') # if the texture size is the same as initial size, return the texture # unmodified if texture_width == width and texture_height == height: return texture # otherwise, return a region of that texture return texture.get_region(0, 0, width, height) def texture_create(size=None, colorfmt=None, bufferfmt=None, mipmap=False, callback=None, icolorfmt=None): '''Create a texture based on size. :Parameters: `size`: tuple, defaults to (128, 128) Size of the texture. `colorfmt`: str, defaults to 'rgba' Color format of the texture. Can be 'rgba' or 'rgb', 'luminance' or 'luminance_alpha'. On desktop, additional values are available: 'red', 'rg'. `icolorfmt`: str, defaults to the value of `colorfmt` Internal format storage of the texture. Can be 'rgba' or 'rgb', 'luminance' or 'luminance_alpha'. On desktop, additional values are available: 'r8', 'rg8', 'rgba8'. `bufferfmt`: str, defaults to 'ubyte' Internal buffer format of the texture. Can be 'ubyte', 'ushort', 'uint', 'bute', 'short', 'int' or 'float'. `mipmap`: bool, defaults to False If True, it will automatically generate the mipmap texture. `callback`: callable(), defaults to False If a function is provided, it will be called when data is needed in the texture. .. versionchanged:: 1.7.0 :attr:`callback` has been added ''' cdef int width = 128, height = 128, allocate = 1 if size is not None: width, height = size if colorfmt is None: colorfmt = 'rgba' if bufferfmt is None: bufferfmt = 'ubyte' if callback is not None: allocate = 0 if icolorfmt is None: icolorfmt = colorfmt return _texture_create(width, height, colorfmt, bufferfmt, mipmap, allocate, callback, icolorfmt) def texture_create_from_data(im, mipmap=False): '''Create a texture from an ImageData class. ''' cdef int width = im.width cdef int height = im.height cdef int allocate = 1 cdef int no_blit = 0 cdef Texture texture # optimization, if the texture is power of 2, don't allocate in # _texture_create, but allocate in blit_data => only 1 upload if _is_pow2(width) and _is_pow2(height): allocate = 0 elif gl_has_capability(c_GLCAP_NPOT): allocate = 0 # if imagedata have more than one image, activate mipmap if im.have_mipmap: mipmap = True if not cgldef.kivy_opengl_es2: if gl_get_version_major() < 3: mipmap = False if width == 0 or height == 0: height = width = 1 allocate = 1 no_blit = 1 texture = _texture_create(width, height, im.fmt, 'ubyte', mipmap, allocate, None, im.fmt) if texture is None: return None texture._source = im.source if no_blit == 0: texture.blit_data(im) return texture cdef class Texture: '''Handle an OpenGL texture. This class can be used to create simple textures or complex textures based on ImageData.''' _sequenced_textures = {} '''Internal use only for textures of sequenced images ''' create = staticmethod(texture_create) create_from_data = staticmethod(texture_create_from_data) def __init__(self, width, height, target, texid=0, colorfmt='rgb', bufferfmt='ubyte', mipmap=False, source=None, callback=None, icolorfmt='rgb'): self.observers = [] self._width = width self._height = height self._target = target self._id = texid self._mipmap = mipmap self._wrap = None self._min_filter = None self._mag_filter = None self._is_allocated = 0 self._uvx = 0. self._uvy = 0. self._uvw = 1. self._uvh = 1. self._colorfmt = colorfmt self._bufferfmt = bufferfmt self._icolorfmt = icolorfmt self._source = source self._nofree = 0 self._callback = callback if texid == 0: self.flags |= TI_NEED_GEN if callback is not None: self.flags |= TI_NEED_PIXELS self.update_tex_coords() get_context().register_texture(self) def __dealloc__(self): get_context().dealloc_texture(self) cdef void update_tex_coords(self): self._tex_coords[0] = self._uvx self._tex_coords[1] = self._uvy self._tex_coords[2] = self._uvx + self._uvw self._tex_coords[3] = self._uvy self._tex_coords[4] = self._uvx + self._uvw self._tex_coords[5] = self._uvy + self._uvh self._tex_coords[6] = self._uvx self._tex_coords[7] = self._uvy + self._uvh def add_reload_observer(self, callback): '''Add a callback to be called after the whole graphics context has been reloaded. This is where you can reupload your custom data into the GPU. .. versionadded:: 1.2.0 :Parameters: `callback`: func(context) -> return None The first parameter will be the context itself. ''' self.observers.append(WeakMethod(callback)) def remove_reload_observer(self, callback): '''Remove a callback from the observer list, previously added by :meth:`add_reload_observer`. .. versionadded:: 1.2.0 ''' for cb in self.observers[:]: method = cb() if method is None or method is callback: self.observers.remove(cb) continue cdef void allocate(self): cdef int iglfmt, glfmt, iglbufferfmt, datasize, dataerr = 0 cdef void *data = NULL cdef int is_npot = 0 # check if it's a pot or not if not _is_pow2(self._width) or not _is_pow2(self._height): make_npot = is_npot = 1 # prepare information needed for nogil glfmt = _color_fmt_to_gl(self._colorfmt) iglfmt = _color_fmt_to_gl(self._icolorfmt) iglbufferfmt = _buffer_fmt_to_gl(self._bufferfmt) datasize = self._width * self._height * \ _gl_format_size(glfmt) * _buffer_type_to_gl_size(self._bufferfmt) # act as we have been able to allocate the texture self._is_allocated = 1 # do the rest outside the Python GIL with nogil: data = calloc(1, datasize) if data != NULL: # ensure pixel upload is correct _gl_prepare_pixels_upload(self._width) # do the initial upload with fake data cgl.glTexImage2D(self._target, 0, iglfmt, self._width, self._height, 0, glfmt, iglbufferfmt, data) # free the data ! free(data) # create mipmap if needed if self._mipmap and is_npot == 0: cgl.glGenerateMipmap(self._target) else: dataerr = 1 if dataerr: self._is_allocated = 0 raise Exception('Unable to allocate memory for texture (size is %s)' % datasize) cpdef flip_vertical(self): '''Flip tex_coords for vertical display.''' self._uvy += self._uvh self._uvh = -self._uvh self.update_tex_coords() cpdef flip_horizontal(self): '''Flip tex_coords for horizontal display. .. versionadded:: 1.9.0 ''' self._uvx += self._uvw self._uvw = -self._uvw self.update_tex_coords() cpdef get_region(self, x, y, width, height): '''Return a part of the texture defined by the rectangular arguments (x, y, width, height). Returns a :class:`TextureRegion` instance.''' return TextureRegion(x, y, width, height, self) def ask_update(self, callback): '''Indicate that the content of the texture should be updated and the callback function needs to be called when the texture will be used. ''' self.flags |= TI_NEED_PIXELS self._callback = callback cpdef bind(self): '''Bind the texture to the current opengl state.''' cdef GLuint value # if we have no change to apply, just bind and exit if not self.flags: cgl.glBindTexture(self._target, self._id) log_gl_error('Texture.bind-glBindTexture') return if self.flags & TI_NEED_GEN: self.flags &= ~TI_NEED_GEN cgl.glGenTextures(1, &self._id) log_gl_error('Texture.bind-glGenTextures') cgl.glBindTexture(self._target, self._id) log_gl_error('Texture.bind-glBindTexture') if self.flags & TI_NEED_ALLOCATE: self.flags &= ~TI_NEED_ALLOCATE self.allocate() if self.flags & TI_NEED_PIXELS: self.flags &= ~TI_NEED_PIXELS if self._callback: self._callback(self) self._callback = None if self.flags & TI_MIN_FILTER: self.flags &= ~TI_MIN_FILTER value = _str_to_gl_texture_min_filter(self._min_filter) cgl.glTexParameteri(self._target, GL_TEXTURE_MIN_FILTER, value) log_gl_error('Texture.bind-glTexParameteri (GL_TEXTURE_MIN_FILTER)') if self.flags & TI_MAG_FILTER: self.flags &= ~TI_MAG_FILTER value = _str_to_gl_texture_mag_filter(self._mag_filter) cgl.glTexParameteri(self._target, GL_TEXTURE_MAG_FILTER, value) log_gl_error('Texture.bind-glTexParameteri (GL_TEXTURE_MAG_FILTER') if self.flags & TI_WRAP: self.flags &= ~TI_WRAP value = _str_to_gl_texture_wrap(self._wrap) cgl.glTexParameteri(self._target, GL_TEXTURE_WRAP_S, value) log_gl_error('Texture.bind-glTexParameteri (GL_TEXTURE_WRAP_S)') cgl.glTexParameteri(self._target, GL_TEXTURE_WRAP_T, value) log_gl_error('Texture.bind-glTexParameteri (GL_TEXTURE_WRAP_T') cdef void set_min_filter(self, x): if self._min_filter != x: self._min_filter = x self.flags |= TI_MIN_FILTER cdef void set_mag_filter(self, x): if self._mag_filter != x: self._mag_filter = x self.flags |= TI_MAG_FILTER cdef void set_wrap(self, x): if self._wrap != x: self._wrap = x self.flags |= TI_WRAP def blit_data(self, im, pos=None): '''Replace a whole texture with image data. ''' blit = self.blit_buffer # depending if imagedata have mipmap, think different. if not im.have_mipmap: blit(im.data, size=im.size, colorfmt=im.fmt, pos=pos, rowlength=im.rowlength) else: # upload each level for level, width, height, data, rowlength in im.iterate_mipmaps(): blit(data, size=(width, height), colorfmt=im.fmt, pos=pos, mipmap_level=level, mipmap_generation=False, rowlength=rowlength) @cython.cdivision(True) def blit_buffer(self, pbuffer, size=None, colorfmt=None, pos=None, bufferfmt=None, mipmap_level=0, mipmap_generation=True, int rowlength=0): '''Blit a buffer into the texture. .. note:: Unless the canvas will be updated due to other changes, :meth:`~kivy.graphics.instructions.Canvas.ask_update` should be called in order to update the texture. :Parameters: `pbuffer`: bytes, or a class that implements the buffer interface\ (including memoryview). A buffer containing the image data. It can be either a bytes object or a instance of a class that implements the python buffer interface, e.g. `array.array`, `bytearray`, numpy arrays etc. If it's not a bytes object, the underlying buffer must be contiguous, have only one dimension and must not be readonly, even though the data is not modified, due to a cython limitation. See module description for usage details. `size`: tuple, defaults to texture size Size of the image (width, height) `colorfmt`: str, defaults to 'rgb' Image format, can be one of 'rgb', 'rgba', 'bgr', 'bgra', 'luminance' or 'luminance_alpha'. `pos`: tuple, defaults to (0, 0) Position to blit in the texture. `bufferfmt`: str, defaults to 'ubyte' Type of the data buffer, can be one of 'ubyte', 'ushort', 'uint', 'byte', 'short', 'int' or 'float'. `mipmap_level`: int, defaults to 0 Indicate which mipmap level we are going to update. `mipmap_generation`: bool, defaults to True Indicate if we need to regenerate the mipmap from level 0. .. versionchanged:: 1.0.7 added `mipmap_level` and `mipmap_generation` .. versionchanged:: 1.9.0 `pbuffer` can now be any class instance that implements the python buffer interface and / or memoryviews thereof. ''' cdef GLuint target = self._target cdef int glbufferfmt if colorfmt is None: colorfmt = 'rgb' if bufferfmt is None: bufferfmt = 'ubyte' if pos is None: pos = (0, 0) if size is None: size = self.size glbufferfmt = _buffer_fmt_to_gl(bufferfmt) # gles limitation/issue: cannot blit buffer on a different # buffer/colorfmt # Reference: https://github.com/kivy/kivy/issues/1600 if gles_limts: if colorfmt.lower() != self.colorfmt.lower(): raise Exception(( "GLES LIMIT: Cannot blit with a different colorfmt than " "the created texture. (texture has {}, you passed {}). " "Consider setting KIVY_GLES_LIMITS" ).format(self.colorfmt, colorfmt)) if bufferfmt.lower() != self.bufferfmt.lower(): raise Exception(( "GLES LIMIT: Cannot blit with a different bufferfmt than " "the created texture. (texture has {}, you passed {}). " "Consider setting KIVY_GLES_LIMITS" ).format(self.bufferfmt, bufferfmt)) # bind the texture, and create anything that should be created at this # time. self.bind() # need conversion, do check here because it seems to be faster ? if not gl_has_texture_native_format(colorfmt): pbuffer, colorfmt = convert_to_gl_format(pbuffer, colorfmt, size[0], size[1]) cdef char [:] char_view cdef short [:] short_view cdef unsigned short [:] ushort_view cdef int [:] int_view cdef unsigned int [:] uint_view cdef float [:] float_view cdef char *cdata = NULL cdef long datasize = 0 if isinstance(pbuffer, bytes): # if it's bytes, just use memory cdata = <bytes>pbuffer # explicit bytes datasize = <long>len(pbuffer) else: # if it's a memoryview or buffer type, use start of memory if glbufferfmt == GL_UNSIGNED_BYTE or glbufferfmt == GL_BYTE: char_view = pbuffer cdata = &char_view[0] datasize = char_view.nbytes elif glbufferfmt == GL_SHORT: short_view = pbuffer cdata = <char *>&short_view[0] datasize = short_view.nbytes elif glbufferfmt == GL_UNSIGNED_SHORT: ushort_view = pbuffer cdata = <char *>&ushort_view[0] datasize = ushort_view.nbytes elif glbufferfmt == GL_INT: int_view = pbuffer cdata = <char *>&int_view[0] datasize = int_view.nbytes elif glbufferfmt == GL_UNSIGNED_INT: uint_view = pbuffer cdata = <char *>&uint_view[0] datasize = uint_view.nbytes elif glbufferfmt == GL_FLOAT: float_view = pbuffer cdata = <char *>&float_view[0] datasize = float_view.nbytes # prepare nogil cdef int iglfmt = _color_fmt_to_gl(self._icolorfmt) cdef int glfmt = _color_fmt_to_gl(colorfmt) cdef int x = pos[0] cdef int y = pos[1] cdef int w = size[0] cdef int h = size[1] cdef int is_allocated = self._is_allocated cdef int is_compressed = _is_compressed_fmt(colorfmt) cdef int _mipmap_generation = mipmap_generation and self._mipmap cdef int _mipmap_level = mipmap_level # if there is a pitch/rowlength passed for the texture, # determine the alignment needed, and see if GL can handle it on the # current platform. cdef int bytes_per_pixels = _gl_format_size(glfmt) cdef int target_rowlength = w * bytes_per_pixels * _buffer_type_to_gl_size(bufferfmt) cdef int need_unpack = rowlength > 0 and rowlength != target_rowlength cdef char *cpdata = NULL cdef char *cpsrc cdef char *cpdst cdef int i cdef int require_subimage = 0 # if the hardware doesn't support native unpack, use alternative method. if need_unpack and not gl_has_capability(GLCAP_UNPACK_SUBIMAGE): require_subimage = 1 need_unpack = 0 with nogil: if need_unpack: # native unpack supported, use it. cgl.glPixelStorei(GL_UNPACK_ROW_LENGTH, rowlength / bytes_per_pixels) if y != 0: cgl.glPixelStorei(GL_UNPACK_SKIP_ROWS, y) if x != 0: cgl.glPixelStorei(GL_UNPACK_SKIP_PIXELS, x) _gl_prepare_pixels_upload(rowlength) elif require_subimage: # make a temporary copy to a format without alignment for upload cpsrc = cdata cpdst = cpdata = <char *>malloc(target_rowlength * h) for i in range(h): memcpy(cpdst, cpsrc, target_rowlength) cpsrc += rowlength cpdst += target_rowlength cdata = cpdata datasize = target_rowlength * h else: _gl_prepare_pixels_upload(w) if is_compressed: cgl.glPixelStorei(GL_UNPACK_ALIGNMENT, 1) cgl.glCompressedTexImage2D(target, _mipmap_level, glfmt, w, h, 0, <GLsizei>datasize, cdata) elif is_allocated: cgl.glTexSubImage2D(target, _mipmap_level, x, y, w, h, glfmt, glbufferfmt, cdata) else: cgl.glTexImage2D(target, _mipmap_level, iglfmt, w, h, 0, glfmt, glbufferfmt, cdata) if _mipmap_generation: cgl.glGenerateMipmap(target) if need_unpack: cgl.glPixelStorei(GL_UNPACK_ROW_LENGTH, 0) if y != 0: cgl.glPixelStorei(GL_UNPACK_SKIP_ROWS, 0) if x != 0: cgl.glPixelStorei(GL_UNPACK_SKIP_PIXELS, 0) elif require_subimage: if cpdata != NULL: free(cpdata) def _on_proxyimage_loaded(self, image): if image is not self._proxyimage: return self._reload_propagate(image.image.texture) self._proxyimage = None # the texture might impact something on the drawing, so ask to refresh # the window. # FIXME: the texture used in BindTexture should ask for a retrigger get_context().flag_update_canvas() cdef void reload(self): cdef Texture texture if self._id != <GLuint>-1: return if self._source is None: # manual texture recreation texture = texture_create(self.size, self.colorfmt, self.bufferfmt, self.mipmap) else: source = osource = self._source proto = None if source.startswith('zip|'): proto = 'zip' source = source[4:] chr = type(source) no_cache, filename, mipmap, count = source.split(chr('|')) source = chr(u'{}|{}|{}').format(filename, mipmap, count) if not proto: proto = filename.split(chr(':'), 1)[0] if proto in ('http', 'https', 'ftp', 'smb'): from kivy.loader import Loader self._proxyimage = Loader.image(filename) self._id = 0 # FIXME this will point to an invalid texture ... self._proxyimage.bind(on_load=self._on_proxyimage_loaded) if self._proxyimage.loaded: self._on_proxyimage_loaded(self._proxyimage) return mipmap = 0 if mipmap == '0' else 1 if count == '0': if proto =='zip' or filename.endswith('.gif'): from kivy.core.image import ImageLoader image = ImageLoader.load(filename, nocache=True, mipmap=mipmap) texture_list = [] create_tex = self.create_from_data for data in image._data[1:]: tex = create_tex(data, mipmap=mipmap) texture_list.append(tex) self._sequenced_textures[filename] = texture_list else: from kivy.core.image import Image image = Image(filename, nocache=True, mipmap=mipmap) texture = image.texture else: item_no = int(count) - 1 texture = self._sequenced_textures[filename][item_no] self._reload_propagate(texture) cdef void _reload_propagate(self, Texture texture): # set the same parameters as our current texture texture.set_wrap(self.wrap) texture.set_min_filter(self.min_filter) texture.set_mag_filter(self.mag_filter) texture.flags |= TI_MIN_FILTER | TI_MAG_FILTER | TI_WRAP texture.uvpos = self.uvpos texture.uvsize = self.uvsize # ensure the new opengl ID will not get through GC texture.bind() self._id = texture.id texture._nofree = 1 # then update content again for callback in self.observers[:]: method = callback() if method is None: self.observers.remove(callback) continue method(self) def save(self, filename, flipped=True, fmt=None): '''Save the texture content to a file. Check :meth:`kivy.core.image.Image.save` for more information. The flipped parameter flips the saved image vertically, and defaults to True. .. versionadded:: 1.7.0 .. versionchanged:: 1.8.0 Parameter `flipped` added, defaults to True. All the OpenGL Texture are read from bottom / left, it need to be flipped before saving. If you don't want to flip the image, set flipped to False. .. versionchanged:: 1.11.0 Parameter `fmt` added, to pass the final format to the image provider. Used if filename is a BytesIO ''' from kivy.core.image import Image return Image(self).save(filename, flipped=flipped, fmt=fmt) def __repr__(self): return '<Texture hash=%r id=%d size=%r colorfmt=%r bufferfmt=%r source=%r observers=%d>' % ( id(self), self._id, self.size, self.colorfmt, self.bufferfmt, self._source, len(self.observers)) @property def size(self): '''Return the (width, height) of the texture (readonly). ''' return (self.width, self.height) @property def mipmap(self): '''Return True if the texture has mipmap enabled (readonly). ''' return self._mipmap @property def id(self): '''Return the OpenGL ID of the texture (readonly). ''' return self._id @property def target(self): '''Return the OpenGL target of the texture (readonly). ''' return self._target @property def width(self): '''Return the width of the texture (readonly). ''' return self._width @property def height(self): '''Return the height of the texture (readonly). ''' return self._height @property def tex_coords(self): '''Return the list of tex_coords (opengl). ''' return ( self._tex_coords[0], self._tex_coords[1], self._tex_coords[2], self._tex_coords[3], self._tex_coords[4], self._tex_coords[5], self._tex_coords[6], self._tex_coords[7]) @property def uvpos(self): '''Get/set the UV position inside the texture. ''' return (self._uvx, self._uvy) @uvpos.setter def uvpos(self, x): self._uvx, self._uvy = x self.update_tex_coords() @property def uvsize(self): '''Get/set the UV size inside the texture. .. warning:: The size can be negative if the texture is flipped. ''' return (self._uvw, self._uvh) @uvsize.setter def uvsize(self, x): self._uvw, self._uvh = x self.update_tex_coords() @property def colorfmt(self): '''Return the color format used in this texture (readonly). .. versionadded:: 1.0.7 ''' return self._colorfmt @property def bufferfmt(self): '''Return the buffer format used in this texture (readonly). .. versionadded:: 1.2.0 ''' return self._bufferfmt @property def min_filter(self): '''Get/set the min filter texture. Available values: - linear - nearest - linear_mipmap_linear - linear_mipmap_nearest - nearest_mipmap_nearest - nearest_mipmap_linear Check the opengl documentation for more information about the behavior of these values : http://www.khronos.org/opengles/sdk/docs/man/xhtml/glTexParameter.xml. ''' return self._min_filter @min_filter.setter def min_filter(self, x): self.set_min_filter(x) @property def mag_filter(self): '''Get/set the mag filter texture. Available values: - linear - nearest Check the opengl documentation for more information about the behavior of these values : http://www.khronos.org/opengles/sdk/docs/man/xhtml/glTexParameter.xml. ''' return self._mag_filter @mag_filter.setter def mag_filter(self, x): self.set_mag_filter(x) @property def wrap(self): '''Get/set the wrap texture. Available values: - repeat - mirrored_repeat - clamp_to_edge Check the opengl documentation for more information about the behavior of these values : http://www.khronos.org/opengles/sdk/docs/man/xhtml/glTexParameter.xml. ''' return self._wrap @wrap.setter def wrap(self, wrap): self.set_wrap(wrap) @property def pixels(self): '''Get the pixels texture, in RGBA format only, unsigned byte. The origin of the image is at bottom left. .. versionadded:: 1.7.0 ''' from kivy.graphics.fbo import Fbo return Fbo(size=self.size, texture=self).pixels cdef class TextureRegion(Texture): '''Handle a region of a Texture class. Useful for non power-of-2 texture handling.''' def __init__(self, int x, int y, int width, int height, Texture origin): Texture.__init__(self, width, height, origin.target, origin.id) self._is_allocated = 1 self._mipmap = origin._mipmap self._colorfmt = origin._colorfmt self._bufferfmt = origin._bufferfmt self._icolorfmt = origin._icolorfmt self.x = x self.y = y self.owner = origin # recalculate texture coordinate cdef float origin_u1, origin_v1 origin_u1 = origin._uvx origin_v1 = origin._uvy self._uvx = (x / <float>origin._width) * origin._uvw + origin_u1 self._uvy = (y / <float>origin._height) * origin._uvh + origin_v1 self._uvw = (width / <float>origin._width) * origin._uvw self._uvh = (height / <float>origin._height) * origin._uvh self.update_tex_coords() def __repr__(self): return '<TextureRegion of %r hash=%r id=%d size=%r colorfmt=%r bufferfmt=%r source=%r observers=%d>' % ( self.owner, id(self), self._id, self.size, self.colorfmt, self.bufferfmt, self._source, len(self.observers)) cdef void reload(self): # texture region are reloaded _after_ normal texture # so that could work, except if it's a region of region # it's safe to retrigger a reload, since the owner texture will be not # really reloaded if its id is not -1. self.owner.reload() self._id = self.owner.id # then update content again self.bind() for callback in self.observers[:]: method = callback() if method is None: self.observers.remove(callback) continue method(self) def ask_update(self, callback): # redirect to owner self.owner.ask_update(callback) cpdef bind(self): self.owner.bind() @property def pixels(self): from kivy.graphics.fbo import Fbo from kivy.graphics import Color, Rectangle fbo = Fbo(size=self.size) fbo.clear() self.flip_vertical() with fbo: Color(1, 1, 1) Rectangle(size=self.size, texture=self, tex_coords=self.tex_coords) fbo.draw() self.flip_vertical() return fbo.pixels
Cython
5
yunus-ceyhan/kivy
kivy/graphics/texture.pyx
[ "MIT" ]