text
stringlengths
93
16.4k
id
stringlengths
20
40
metadata
dict
input_ids
listlengths
45
2.05k
attention_mask
listlengths
45
2.05k
complexity
int64
1
9
#[test] fn test_interval_negate() { assert_eq!( -IntervalDT::try_from_dhms(1, 2, 3, 4, 5).unwrap(), IntervalDT::try_from_usecs(-93784000005).unwrap() ); assert_eq!( IntervalDT::try_from_dhms(1, 2, 3, 4, 5).unwrap().negate(), IntervalDT::try...
rust_cleaned_test_functions.jsonl/51036
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 2026 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 20541, 28209, 349, 368, 341, 286, 2060, 10714, 33673, 310, 481, 10256, 10599, 486, 1539, 5673, 814, 71, 1011, 7, 16, 11, 220, 17, 11, 220, 18, 11, 220, 19, 11, 220, 20, 568, 15454, 3148, 310...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_string_ops() { // === Matching against ascii === assert!("{}".is_enclosed('{', '}')); assert!("{ }".is_enclosed('{', '}')); assert!(!"{".is_enclosed('{', '}')); assert!(!"{a".is_enclosed('{', '}')); assert!(!"a}".is_enclosed('{', '}')); ass...
rust_cleaned_test_functions.jsonl/26541
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 660 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 3904, 21959, 368, 341, 286, 442, 2049, 70691, 2348, 47120, 2049, 198, 286, 2060, 17223, 42025, 285, 13781, 9259, 33440, 516, 40074, 6336, 286, 2060, 88928, 335, 3263, 285, 13781, 9259, 33440, 516, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_parse_num() { let test_cases = vec![ ("0", Ok(0)), ("1000", Ok(1000)), ("\t\t\t1000 ", Ok(1000)), ("123456789", Ok(123456789)), ("18446744073709551615", Ok(18446744073709551615)), ("18446744073709551616", Err("64-bi...
rust_cleaned_test_functions.jsonl/88824
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 426 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21039, 4273, 368, 341, 286, 1077, 1273, 41427, 284, 7486, 90515, 310, 3489, 15, 497, 7622, 7, 15, 6965, 310, 3489, 16, 15, 15, 15, 497, 7622, 7, 16, 15, 15, 15, 6965, 310, 51658, 83, 4955, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_find_roots_quad() { let quad = BoundedQuadratic::new(-1., 5., 1., -5., 6.); let (x1, x2) = quad.find_roots(); assert_eq!(x1, 2.); assert_eq!(x2, 3.); }
rust_cleaned_test_functions.jsonl/19868
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 118 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21814, 26608, 2412, 68631, 368, 341, 286, 1077, 27082, 284, 425, 13082, 2183, 88678, 486, 931, 4080, 16, 2572, 220, 20, 2572, 220, 16, 2572, 481, 20, 2572, 220, 21, 58957, 286, 1077, 320, 87, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_dealloc_native() { let capacity = 5; let a = memory::allocate_aligned(capacity); unsafe { Bytes::new(a, 3, Deallocation::Native(capacity)) }; }
rust_cleaned_test_functions.jsonl/15141
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 95 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2259, 4742, 44494, 368, 341, 286, 1077, 8654, 284, 220, 20, 280, 286, 1077, 264, 284, 4938, 486, 31191, 66385, 51386, 4018, 317, 1789, 286, 19860, 314, 30024, 486, 931, 2877, 11, 220, 18, 11, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_server_http_codec() { let request = "\ GET / HTTP/1.0\r\n\ Host: www.rust-lang.org\r\n\ \r\n\ " .as_bytes(); let input = Cursor::new(request); let output = Cursor::new(Vec::new()); let f = ReadWritePair(input, output) .framed(HttpServerCodec) .into_futu...
rust_cleaned_test_functions.jsonl/78713
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 384 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 12015, 25888, 51084, 368, 341, 197, 10217, 1681, 284, 93317, 298, 197, 3806, 608, 10130, 14, 16, 13, 15, 12016, 1699, 5661, 298, 197, 9296, 25, 8438, 1746, 590, 75460, 2659, 12016, 1699, 5661, 2...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_real_as_uint() { test_none_with_ctx_and_metadata(cast_real_as_uint); // in_union let cs = vec![ (-10.0, 0u64), (i64::MIN as f64, 0), (10.0, 10u64), (i64::MAX as f64, (1u64 << 63)), ]; for (inpu...
rust_cleaned_test_functions.jsonl/1942
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1572 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 15266, 11898, 15807, 368, 341, 286, 1273, 31488, 6615, 15147, 8378, 22220, 1337, 559, 15266, 11898, 15807, 626, 286, 442, 304, 51621, 198, 286, 1077, 10532, 284, 7486, 90515, 3374, 310, 10293, 16, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
4
#[test] fn test_load_locale() { let map = load_locale("examples/i18n-example/locale"); map.get("zh-cn") .map(|lsm| { assert_eq!(lsm.get("name"), Some(&"δΈ­ζ–‡".to_owned())); assert_eq!(lsm.get("log.level"), Some(&"ζ—₯εΏ—η­‰ηΊ§".to_owned())); assert...
rust_cleaned_test_functions.jsonl/30232
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 481 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 12411, 55518, 368, 341, 286, 1077, 2415, 284, 2795, 55518, 445, 51668, 16438, 16, 23, 77, 43430, 84039, 797, 286, 2415, 670, 445, 23815, 63264, 1138, 310, 659, 2186, 22428, 75, 3563, 91, 341, 39...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_primitive_array_lt_eq_scalar() { cmp_i64_scalar!( lt_eq_scalar, vec![6, 7, 8, 9, 10, 6, 7, 8, 9, 10], 8, vec![true, true, true, false, false, true, true, true, false, false] ); }
rust_cleaned_test_functions.jsonl/36023
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 166 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 84087, 3858, 39164, 10714, 41652, 368, 341, 286, 26089, 5318, 21, 19, 41652, 33673, 310, 25175, 10714, 41652, 345, 310, 7486, 20703, 21, 11, 220, 22, 11, 220, 23, 11, 220, 24, 11, 220, 16, 15,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_no_params() { let ethabi_constructor = ethabi::Constructor { inputs: vec![] }; let c = Constructor::from(&ethabi_constructor); let expected = quote! { /// Encodes a call to contract's constructor. pub fn constructor<>(code: ethabi::Bytes) -> ethabi::Bytes { let c = ethabi::Cons...
rust_cleaned_test_functions.jsonl/11217
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 212 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6536, 6745, 368, 341, 197, 10217, 8372, 25084, 66210, 284, 8372, 25084, 486, 13288, 314, 11127, 25, 7486, 0, 1294, 3634, 197, 10217, 272, 284, 16786, 486, 1499, 2099, 769, 25084, 66210, 626, 197, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_find_all() { let text = b"dhjalkjwqnnnannanaflkjdklfj"; let pattern = b"qnnnannan"; let bom = BOM::new(pattern); assert_eq!(bom.find_all(text).collect_vec(), [8]); }
rust_cleaned_test_functions.jsonl/121175
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 120 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21814, 5705, 368, 341, 286, 1077, 1467, 284, 293, 1, 30621, 73, 1692, 73, 86, 80, 7370, 77, 1020, 3362, 1489, 74, 88851, 11008, 73, 876, 286, 1077, 5383, 284, 293, 1, 80, 7370, 77, 1020, 276...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_overhangs2() { let x = b"GCACACGAGCACACGTAGCACACGTGTGCGCTATACAGTAAGTAGTAGTACACGTGTCACAGTTGTACTAGCATGAC"; let y = b"TATACAGGAAGTAGGAGTACACGTGTCACATTTGTACTAGCATGAC"; compare_to_full_alignment_local(x, y); compare_to_full_alignment_global(x, y); compare_to_fu...
rust_cleaned_test_functions.jsonl/126732
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 192 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 15431, 20658, 82, 17, 368, 341, 286, 1077, 856, 284, 293, 1, 22863, 1706, 1706, 38, 1890, 92832, 1706, 25388, 1890, 92832, 1706, 25388, 25388, 38, 8798, 1162, 828, 1706, 1890, 15204, 1890, 32144, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_stxdw() { test_interpreter_and_jit_asm!( " mov r2, -2005440939 lsh r2, 32 or r2, 0x44332211 stxdw [r1+2], r2 ldxdw r0, [r1+2] exit", [ 0xaa, 0xbb, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xff, 0xcc, 0x...
rust_cleaned_test_functions.jsonl/59000
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 289 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 1261, 9703, 86, 368, 341, 262, 1273, 15318, 28637, 8378, 5374, 275, 67529, 33673, 286, 6228, 286, 1974, 435, 17, 11, 481, 17, 15, 15, 20, 19, 19, 15, 24, 18, 24, 198, 286, 326, 927, 435, 1...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_dispatch() { let mut isolate = TestBehavior::setup(TestBehaviorMode::AsyncImmediate); js_check(isolate.execute( "filename.js", r#" let control = new Uint8Array([42]); libdeno.send(control); async function main() { libdeno.send(control); ...
rust_cleaned_test_functions.jsonl/113674
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 198 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 42991, 368, 341, 262, 1077, 5206, 42123, 284, 3393, 22753, 486, 15188, 31159, 22753, 3636, 486, 6525, 52734, 317, 262, 6994, 7200, 82669, 7769, 1006, 414, 330, 8404, 2857, 756, 414, 435, 2, 698, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_plain_scalar_containing_indicators_in_block() { let s = "a:,b"; let mut p = Scanner::new(s.chars()); next!(p, StreamStart(..)); next_scalar!(p, TScalarStyle::Plain, "a:,b"); next!(p, StreamEnd); end!(p); let s = ":,b"; let mut p = ...
rust_cleaned_test_functions.jsonl/91015
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 265 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 41015, 41652, 10260, 2056, 9122, 42052, 1243, 7113, 368, 341, 286, 1077, 274, 284, 330, 64, 41239, 65, 876, 286, 1077, 5206, 281, 284, 17170, 486, 931, 1141, 85062, 1423, 286, 1790, 10297, 79, 1...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_url_to_unix_connection_info() { let cases = vec![ ( url::Url::parse("unix:///var/run/redis.sock").unwrap(), ConnectionInfo { addr: Box::new(ConnectionAddr::Unix("/var/run/redis.sock".into())), db: 0, ...
rust_cleaned_test_functions.jsonl/19227
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1597 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2903, 2346, 80572, 15866, 3109, 368, 341, 286, 1077, 5048, 284, 7486, 90515, 310, 2399, 394, 2515, 486, 2864, 486, 6400, 445, 56646, 60896, 947, 48385, 14, 21748, 68171, 1827, 15454, 3148, 394, 11...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_raw_node_start() { let l = default_logger(); let store = new_storage(); let mut raw_node = new_raw_node(1, vec![1], 10, 1, store.clone(), &l); let rd = raw_node.ready(); must_cmp_ready(&rd, &None, &None, &[], &[], &None, true, false); let _ = raw_node.advance(rd); r...
rust_cleaned_test_functions.jsonl/53366
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 697 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 16067, 5084, 4906, 368, 341, 262, 1077, 326, 284, 1638, 27413, 543, 262, 1077, 3553, 284, 501, 23310, 543, 262, 1077, 5206, 7112, 5084, 284, 501, 16067, 5084, 7, 16, 11, 7486, 20703, 16, 1125, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_all_query_with_boost() { let index = create_test_index(); let searcher = index.searcher().unwrap(); let weight = AllQuery.weight(&searcher, false).unwrap(); let reader = searcher.segment_reader(0); { let mut scorer = weight.scorer(reader, 2.0)....
rust_cleaned_test_functions.jsonl/121589
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 312 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 5705, 5738, 6615, 84913, 368, 341, 286, 1077, 1922, 284, 1855, 4452, 3560, 543, 286, 1077, 94674, 284, 1922, 9288, 261, 1005, 15454, 543, 286, 1077, 4680, 284, 2009, 2859, 25152, 2099, 1836, 261, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_i32_i32() -> Result<()> { let array1 = Int32Array::from(vec![1]); let array2 = Int32Array::from(vec![2]); let cmp = build_compare(&array1, &array2)?; assert_eq!(Ordering::Less, (cmp)(0, 0)); Ok(()) }
rust_cleaned_test_functions.jsonl/7135
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 138 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 5318, 18, 17, 5318, 18, 17, 368, 1464, 5714, 71698, 341, 286, 1077, 1334, 16, 284, 1333, 18, 17, 1857, 486, 1499, 25592, 20703, 16, 2558, 286, 1077, 1334, 17, 284, 1333, 18, 17, 1857, 486, 1...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_pause_resume_microvm() { // Tests that pausing and resuming a microVM work as expected. let pid = unsafe { libc::fork() }; match pid { 0 => { set_panic_hook(); let (vmm, mut event_manager) = default_vmm(None); //...
rust_cleaned_test_functions.jsonl/132809
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 541 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 59989, 58132, 73003, 7338, 368, 341, 262, 442, 20150, 429, 7106, 970, 323, 592, 29489, 264, 8003, 11187, 975, 438, 3601, 624, 262, 1077, 14814, 284, 19860, 314, 42142, 486, 44738, 368, 2605, 262, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_ops() { assert_eq!(Address::from(10) + 5usize, Address::from(15)); assert_eq!(Address::from(10) - Address::from(5), 5usize); assert_eq!(Address::from(100) - 5usize, Address::from(95)); }
rust_cleaned_test_functions.jsonl/126122
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 112 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21959, 368, 341, 286, 2060, 10714, 10297, 4286, 486, 1499, 7, 16, 15, 8, 488, 220, 20, 51878, 11, 9177, 486, 1499, 7, 16, 20, 3237, 286, 2060, 10714, 10297, 4286, 486, 1499, 7, 16, 15, 8, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_lazy_transform() { let lazy_value: LazyTransform<u8, u8> = LazyTransform::new(21); assert_eq!(lazy_value.get(), None); let n = AtomicUsize::new(0); let pool = Pool::new(100); pool.scoped(|scope| { for _ in 0..100 { let lazy_r...
rust_cleaned_test_functions.jsonl/114936
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 699 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 49646, 18449, 368, 341, 286, 1077, 15678, 3142, 25, 44263, 8963, 34837, 23, 11, 575, 23, 29, 284, 44263, 8963, 486, 931, 7, 17, 16, 626, 286, 2060, 10714, 10297, 49013, 3142, 670, 1507, 2240, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_a_canister_other_than_the_governance_canister_cannot_add_a_node_operator() { local_test_on_nns_subnet(|runtime| async move { // An attacker got a canister that is trying to pass for the proposals let attacker_canister = set_up_universal_canister(&runtime).await; ...
rust_cleaned_test_functions.jsonl/76281
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 695 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 4306, 27421, 1571, 30456, 51613, 16068, 1889, 6706, 681, 27421, 1571, 666, 3401, 2891, 4306, 5084, 40594, 368, 341, 262, 2205, 4452, 4470, 1089, 4412, 95681, 22428, 22255, 91, 3312, 3271, 341, 286, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_buffered_writer() { let inner = MemWriter::new(); let mut writer = BufferedWriter::with_capacity(2, inner); writer.write([0, 1]).unwrap(); assert_eq!(writer.get_ref().get_ref(), &[]); writer.write([2]).unwrap(); assert_eq!(writer.get_ref().get_re...
rust_cleaned_test_functions.jsonl/115532
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 633 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 7776, 291, 28908, 368, 341, 286, 1077, 9179, 284, 13550, 6492, 486, 931, 543, 286, 1077, 5206, 6916, 284, 63129, 486, 4197, 35603, 7, 17, 11, 9179, 626, 286, 6916, 3836, 2561, 15, 11, 220, 16,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_fq_mul_assign() { let mut rng = ark_std::test_rng(); for _ in 0..1000000 { let a = Fq::rand(&mut rng); let b = Fq::rand(&mut rng); let c = Fq::rand(&mut rng); let mut tmp1 = a; tmp1.mul_assign(&b); tmp1.mul_assign(&c); l...
rust_cleaned_test_functions.jsonl/3544
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 541 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 761, 80, 24944, 20688, 368, 341, 262, 1077, 5206, 28422, 284, 55217, 15656, 486, 1944, 66849, 1428, 262, 369, 716, 304, 220, 15, 496, 16, 15, 15, 15, 15, 15, 15, 341, 1789, 286, 1077, 264, 2...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_process_reset_cancelled() { let mut rng = ThreadRng256 {}; let user_presence_always_cancel = |_| Err(Ctap2StatusCode::CTAP2_ERR_KEEPALIVE_CANCEL); let mut ctap_state = CtapState::new(&mut rng, user_presence_always_cancel); let reset_reponse = ctap_state.process_r...
rust_cleaned_test_functions.jsonl/35318
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 236 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 11305, 18983, 28895, 832, 368, 341, 286, 1077, 5206, 28422, 284, 8752, 49, 968, 17, 20, 21, 9321, 286, 1077, 1196, 56403, 8418, 2284, 28895, 284, 66091, 15495, 3025, 30047, 17, 15872, 486, 1162, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_private_inner_class() { let hdr = indoc! {" #include <cstdint> inline uint32_t DoMath(uint32_t a) { return a * 3; } class A { protected: inline uint32_t protected_method() { return 0; } private: struct B { int x; }; ...
rust_cleaned_test_functions.jsonl/9970
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 248 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 26249, 34345, 4790, 368, 341, 262, 1077, 36615, 284, 1257, 509, 0, 314, 698, 262, 671, 997, 366, 96975, 397, 262, 7381, 2622, 18, 17, 528, 3155, 8815, 8488, 18, 17, 528, 264, 8, 220, 341, 28...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_empty() { test_helpers::maybe_start_logging(); let observer = TestObserver::new(); let c1 = Arc::new(TestChunk::new("chunk1")); let predicate = PredicateBuilder::new().build(); let pruned = prune_chunks(&observer, vec![c1], &predicate); assert_eq...
rust_cleaned_test_functions.jsonl/47386
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 225 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 15124, 368, 341, 286, 1273, 54473, 486, 36760, 4906, 59982, 543, 286, 1077, 22067, 284, 3393, 17151, 486, 931, 543, 286, 1077, 272, 16, 284, 19689, 486, 931, 31159, 28304, 486, 931, 445, 25979, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_unit_from_empty_seq_without_len() { assert_de_tokens_error::<()>( &[Token::Seq { len: None }, Token::SeqEnd], "invalid type: sequence, expected unit", ); }
rust_cleaned_test_functions.jsonl/129529
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 94 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 14832, 5673, 15124, 14486, 39904, 6043, 368, 341, 262, 2060, 2259, 28838, 4096, 27638, 368, 17055, 286, 44590, 3323, 486, 20183, 314, 2422, 25, 2240, 2470, 9660, 486, 20183, 3727, 1259, 286, 330, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_anonymous_vars() { let p = polar(); qeval(&p, "[1,2,3] = [_,_,_]"); qnull(&p, "[1,2,3] = [__,__,__]"); }
rust_cleaned_test_functions.jsonl/68128
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 82 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 12008, 9757, 11168, 368, 341, 262, 1077, 281, 284, 24660, 543, 262, 2804, 14170, 2099, 79, 11, 10545, 16, 11, 17, 11, 18, 60, 284, 508, 6878, 6878, 62, 37389, 262, 2804, 2921, 2099, 79, 11, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_inconsist_err() { assert_eq!( DNAMotif::from_seqs( vec![b"AAAA".to_vec(), b"TTTT".to_vec(), b"C".to_vec()].as_ref(), Some(&[0.0; 4]) ), Err(Error::InconsistentLen) ); }
rust_cleaned_test_functions.jsonl/17028
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 178 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 1243, 6254, 380, 9266, 368, 341, 286, 2060, 10714, 33673, 310, 60656, 1402, 354, 333, 486, 1499, 93261, 1006, 394, 7486, 20703, 65, 1, 25699, 3263, 983, 13251, 1507, 293, 1, 14903, 14903, 3263, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_local_cluster_start_and_exit_with_config() { morgan_logger::setup(); let mut validator_config = ValidatorConfig::default(); validator_config.rpc_config.enable_fullnode_exit = true; validator_config.storage_rotate_count = STORAGE_ROTATE_TEST_COUNT; const NU...
rust_cleaned_test_functions.jsonl/106470
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 416 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 13564, 28441, 4906, 8378, 16880, 6615, 5332, 368, 341, 286, 296, 8462, 27413, 486, 15188, 543, 286, 1077, 5206, 22935, 5332, 284, 32566, 2648, 486, 2258, 543, 286, 22935, 5332, 55177, 5332, 28697, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_primitives() { setup(); let mut params = v8::Isolate::create_params(); params.set_array_buffer_allocator( v8::array_buffer::Allocator::new_default_allocator(), ); let isolate = v8::Isolate::new(params); let locker = v8::Locker::new(&isolate); v8::HandleScope::enter(&isolate, |s...
rust_cleaned_test_functions.jsonl/83400
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 394 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 5294, 35209, 368, 341, 220, 6505, 543, 220, 1077, 5206, 3628, 284, 348, 23, 486, 3872, 33066, 486, 3182, 6745, 543, 220, 3628, 980, 3858, 7776, 56910, 1006, 262, 348, 23, 486, 1653, 7776, 486, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_submit_txn_inner_vm() { let ac_service = create_ac_service_for_ut(); // create request let mut req: SubmitTransactionRequest = SubmitTransactionRequest::new(); let sender = AccountAddress::new([0; ADDRESS_LENGTH]); let keypair = generate_keypair(); req.set_signed_txn(get_...
rust_cleaned_test_functions.jsonl/15609
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1749 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 31674, 92299, 34345, 39008, 368, 341, 262, 1077, 1613, 12267, 284, 1855, 14718, 12267, 5478, 60363, 543, 262, 442, 1855, 1681, 198, 262, 1077, 5206, 4232, 25, 29170, 8070, 1900, 284, 29170, 8070, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_real_as_bool() { let tests: Vec<(f64, Option<bool>)> = vec![ (0.0, Some(false)), (1.3, Some(true)), (-1.234, Some(true)), (0.000000000000000000000000000000001, Some(true)), (-0.00000000000000000000000000000001, Some(true)), ...
rust_cleaned_test_functions.jsonl/293
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 539 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 15266, 11898, 22159, 368, 341, 286, 1077, 7032, 25, 11312, 28706, 69, 21, 19, 11, 6959, 17028, 9231, 29, 284, 7486, 90515, 310, 320, 15, 13, 15, 11, 4329, 3576, 6965, 310, 320, 16, 13, 18, 1...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_fr_inverse() { assert!(Fr::zero().inverse().is_none()); let mut rng = XorShiftRng::from_seed([0x5dbe6259, 0x8d313d76, 0x3237db17, 0xe5bc0654]); let one = Fr::one(); for _ in 0..1000 { // Ensure that a * a^-1 = 1 let mut a = Fr::rand(&mut rng); let ainv ...
rust_cleaned_test_functions.jsonl/66328
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 211 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 41537, 63333, 368, 341, 262, 2060, 10297, 22560, 486, 14154, 1005, 61482, 1005, 285, 31488, 5231, 262, 1077, 5206, 28422, 284, 1599, 269, 24841, 49, 968, 486, 1499, 33809, 2561, 15, 87, 20, 83406,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_du_soft_link() { let scene = TestScenario::new(util_name!()); let at = &scene.fixtures; at.symlink_file(SUB_FILE, SUB_LINK); let result = scene.ucmd().arg(SUB_DIR_LINKS).succeeds(); #[cfg(target_os = "linux")] { let result_reference = scene.cmd("du").arg(SUB_DI...
rust_cleaned_test_functions.jsonl/23733
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 255 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 814, 84, 38326, 7233, 368, 341, 262, 1077, 6109, 284, 3393, 54031, 486, 931, 67811, 1269, 0, 1423, 262, 1077, 518, 284, 609, 22483, 67785, 18513, 401, 262, 518, 77577, 44243, 2458, 3759, 4493, 8...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_conversion_consistency() { // test if we can serialize and deserialize whilst retaining the same type information/ precision let schema = Schema::new(vec![ Field::new("c1", DataType::Date32, false), Field::new("c2", DataType::Date64, false), ]); ...
rust_cleaned_test_functions.jsonl/124162
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 816 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 64132, 31971, 47094, 368, 341, 286, 442, 1273, 421, 582, 646, 24235, 323, 35240, 23856, 50010, 279, 1852, 943, 1995, 14, 16052, 271, 286, 1077, 10802, 284, 12539, 486, 931, 25592, 90515, 310, 8601...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_zero_point_zero_magnitude() { let zero: Point1<f32> = Point1::new(0_f32); assert_eq!(zero.magnitude(), 0_f32); }
rust_cleaned_test_functions.jsonl/4531
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 82 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 19359, 6085, 19359, 717, 34715, 368, 341, 286, 1077, 7168, 25, 5126, 16, 63895, 18, 17, 29, 284, 5126, 16, 486, 931, 7, 15, 761, 18, 17, 626, 286, 2060, 10714, 10297, 14154, 82791, 1507, 220, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_transitions_visual() { let mut vm: VimMachine<KeyEvent> = VimMachine::default(); let mut ctx = VimContext::default(); ctx.persist.shape = Some(TargetShape::CharWise); vm.input_key(key!('v')); assert_pop2!(vm, CURRENT_POS, ctx); assert_eq!...
rust_cleaned_test_functions.jsonl/74566
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1278 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 7965, 5930, 64630, 368, 341, 286, 1077, 5206, 10995, 25, 94484, 21605, 42003, 1556, 29, 284, 94484, 21605, 486, 2258, 543, 286, 1077, 5206, 5635, 284, 94484, 1972, 486, 2258, 1428, 1789, 286, 5635...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_hc128_ecrypt_set_6_vector_2() { let key = hex::decode("0A5DB00356A9FC4FA2F5489BEE4194E7").unwrap(); let nonce = hex::decode("1F86ED54BB2289F057BE258CF35AC128").unwrap(); let input = [0u8; 64]; let expected_output_hex = "82168AB0023B79AAF1E6B4D823855E14A7084378036...
rust_cleaned_test_functions.jsonl/2191
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 382 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 1523, 66, 16, 17, 23, 36844, 3571, 2602, 62, 21, 12247, 62, 17, 368, 341, 286, 1077, 1376, 284, 12371, 486, 18196, 445, 15, 32, 20, 3506, 15, 15, 18, 20, 21, 32, 24, 6754, 19, 3627, 17, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_rational() { let r = Rational::new(0, 0); assert!(f64::from(r).is_nan()); let r = Rational::new(1, 0); assert!(f64::from(r).is_infinite() && f64::from(r).is_sign_positive()); let r = Rational::new(-1, 0); assert!(f64::from(r).is_infinite() && f64::from(r).is_sign_negati...
rust_cleaned_test_functions.jsonl/122992
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 183 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 1710, 1663, 368, 341, 262, 1077, 435, 284, 54525, 486, 931, 7, 15, 11, 220, 15, 317, 262, 2060, 10297, 69, 21, 19, 486, 1499, 2601, 568, 285, 73936, 5231, 262, 1077, 435, 284, 54525, 486, 93...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_create_and_release() { let subsystem = CString::new("com.example.test").unwrap(); let category = CString::new("category").unwrap(); let log = unsafe { os_log_create(subsystem.as_ptr(), category.as_ptr()) }; assert!(!log.is_null()); unsafe { os...
rust_cleaned_test_functions.jsonl/125805
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 164 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 8657, 8378, 24577, 368, 341, 286, 1077, 52785, 284, 56956, 486, 931, 445, 874, 7724, 5958, 1827, 15454, 543, 286, 1077, 5582, 284, 56956, 486, 931, 445, 5471, 1827, 15454, 543, 286, 1077, 1487, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_deserialize_dict_1() -> Result<()> { let input = "d3:cow3:moo4:spam4:eggse"; let m: BTreeMap<String, String> = from_slice(input.as_bytes())?; let mut expected = BTreeMap::new(); expected.insert(String::from("cow"), String::from("moo")); expected.insert(Str...
rust_cleaned_test_functions.jsonl/120777
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 193 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 15768, 9050, 5243, 62, 16, 368, 1464, 5714, 71698, 341, 286, 1077, 1946, 284, 330, 67, 18, 25, 18921, 18, 30286, 2624, 19, 25, 75545, 19, 25, 28368, 325, 876, 286, 1077, 296, 25, 425, 6533, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_request_with_variables() { let request: Request = serde_json::from_value(json! ({ "query": "{ a b c }", "variables": { "v1": 100, "v2": [1, 2, 3], "v3": "str", } })) .unwrap(); ass...
rust_cleaned_test_functions.jsonl/102695
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 391 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 7893, 6615, 28182, 368, 341, 286, 1077, 1681, 25, 6145, 284, 61570, 9455, 486, 1499, 3142, 9304, 0, 13861, 310, 330, 1631, 788, 13868, 264, 293, 272, 335, 756, 310, 330, 18616, 788, 341, 394, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_glyph_names() { let font_buffer = read_fixture("tests/fonts/opentype/TwitterColorEmoji-SVGinOT.ttf"); let opentype_file = ReadScope::new(&font_buffer) .read::<OpenTypeFont<'_>>() .unwrap(); let font_table_provider = opentype_file .table...
rust_cleaned_test_functions.jsonl/62853
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 509 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 88703, 9187, 368, 341, 286, 1077, 3301, 7776, 284, 1349, 74409, 445, 23841, 60667, 52000, 306, 499, 16731, 3801, 1636, 92731, 6222, 46641, 258, 1793, 45192, 797, 286, 1077, 1179, 306, 499, 2458, 2...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_ofd_write_lock() { use nix::sys::stat::fstat; use std::mem; let tmp = NamedTempFile::new().unwrap(); let fd = tmp.as_raw_fd(); let statfs = nix::sys::statfs::fstatfs(&tmp).unwrap(); if statfs.filesystem_type() == nix::sys::statfs::OVERLAYFS_SUPER...
rust_cleaned_test_functions.jsonl/129576
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 661 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 3575, 67, 9165, 9818, 368, 341, 286, 990, 308, 941, 486, 7791, 486, 9878, 486, 69, 9878, 280, 286, 990, 1460, 486, 10536, 401, 286, 1077, 4174, 284, 40459, 12151, 1703, 486, 931, 1005, 15454, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_country() { assert_eq!(Country::US.to_string(), "US"); assert_eq!(Country::ES.to_string(), "ES"); assert_eq!(Country::ES, Country::from_str("ES").unwrap()); }
rust_cleaned_test_functions.jsonl/14967
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 98 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 28106, 368, 341, 286, 2060, 10714, 10297, 16408, 486, 2034, 2389, 3904, 1507, 330, 2034, 797, 286, 2060, 10714, 10297, 16408, 486, 1570, 2389, 3904, 1507, 330, 1570, 797, 286, 2060, 10714, 10297, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_prf_test_case_65_2() { let key = "Jefe".as_bytes(); let actual = prf(&key[..], "prefix-2", "what do ya want for nothing?".as_bytes(), 256); assert_eq!(actual.is_ok(), true); let expected = Vec::from_hex("47c4908e30c947521ad20be9053450ecbea23d3aa604b77...
rust_cleaned_test_functions.jsonl/132284
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 214 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 5294, 69, 4452, 19096, 62, 21, 20, 62, 17, 368, 341, 286, 1077, 1376, 284, 330, 41, 44953, 3263, 300, 12524, 543, 286, 1077, 5042, 284, 548, 69, 2099, 792, 95874, 1125, 330, 11849, 12, 17, 4...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_cmac_type_url() { tink_mac::init(); let km = tink::registry::get_key_manager(tink_testutil::AES_CMAC_TYPE_URL) .expect("AES CMAC key manager not found"); assert_eq!( km.type_url(), tink_testutil::AES_CMAC_TYPE_URL, "incorrect key_type()" ); ass...
rust_cleaned_test_functions.jsonl/126167
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 227 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 666, 11948, 1819, 2903, 368, 341, 262, 90584, 22802, 486, 2327, 543, 262, 1077, 13136, 284, 90584, 486, 29172, 486, 455, 3097, 12144, 1155, 766, 4452, 1314, 486, 69168, 920, 25788, 4189, 8000, 340...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_finalize(){ let shared = vec![Card::new("Ta"), Card::new("5a"), Card::new("8a"), Card::new("3b"), Card::new("Kb")]; let c1 = [Card::new("Tb"), Card::new("5d")]; let c2 = [Card::new("Tc"), Card::new("4c")]; let mut p1 = Box::new(Human::test_new(Arc::new(Mutex::new(Vec::new()))));...
rust_cleaned_test_functions.jsonl/89686
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 469 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 70616, 3032, 262, 1077, 6094, 284, 7486, 20703, 5770, 486, 931, 445, 55999, 3975, 6795, 486, 931, 445, 20, 64, 3975, 6795, 486, 931, 445, 23, 64, 3975, 6795, 486, 931, 445, 18, 65, 3975, 6795,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_replay_commitment_cache() { fn leader_vote(bank: &Arc<Bank>, pubkey: &Pubkey) { let mut leader_vote_account = bank.get_account(&pubkey).unwrap(); let mut vote_state = VoteState::from(&leader_vote_account).unwrap(); vote_state.process_slot_vote_unchecke...
rust_cleaned_test_functions.jsonl/91761
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 2248 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 1288, 1363, 36346, 478, 11529, 368, 341, 286, 5168, 7653, 54360, 1883, 1180, 25, 609, 36809, 27, 25828, 8066, 95116, 25, 609, 29162, 792, 8, 341, 310, 1077, 5206, 7653, 54360, 13500, 284, 6073, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_flush_filter() { // cf with filter let name = CString::new("test_flush_filter_factory").unwrap(); let factory = Box::new(FlushFactory {}) as Box<dyn CompactionFilterFactory>; let mut cf_opts_wf = ColumnFamilyOptions::default(); cf_opts_wf .set_...
rust_cleaned_test_functions.jsonl/55279
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 727 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 39213, 8727, 368, 341, 286, 442, 24111, 448, 4051, 198, 286, 1077, 829, 284, 56956, 486, 931, 445, 1944, 39213, 8727, 24269, 1827, 15454, 543, 286, 1077, 8633, 284, 8261, 486, 931, 7, 46874, 415...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_tx_queue_interrupt() { let mut event_manager = EventManager::new().unwrap(); let mut net = Net::default_net(TestMutators::default()); let mem_clone = net.mem.clone(); let (rxq, txq) = Net::virtqueues(&mem_clone); net.assign_queues(rxq.create_queue...
rust_cleaned_test_functions.jsonl/63434
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 472 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 17805, 10841, 42606, 368, 341, 1789, 286, 1077, 5206, 1538, 12144, 284, 3665, 2043, 486, 931, 1005, 15454, 543, 286, 1077, 5206, 4179, 284, 9374, 486, 2258, 19722, 31159, 51440, 2973, 486, 2258, 1...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_deserialize() { ::init().unwrap(); let buffer_ron = r#" ( pts: Some(1), dts: None, duration: Some(5), offset: 3, offset_end: 4, flags: ( bits: 80, ...
rust_cleaned_test_functions.jsonl/69950
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1003 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 15768, 9050, 368, 341, 286, 3504, 2327, 1005, 15454, 1428, 286, 1077, 4147, 1710, 263, 284, 435, 2, 698, 310, 2399, 394, 29993, 25, 4329, 7, 16, 1326, 394, 294, 2576, 25, 2240, 345, 394, 8090,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_default_round_trip() { figment::Jail::expect_with(|_| { let original = Config::figment(); let roundtrip = Figment::from(Config::from_provider(&original)); for figment in &[original, roundtrip] { let config = Config::from_provider(figmen...
rust_cleaned_test_functions.jsonl/42695
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 216 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 9993, 29896, 63883, 368, 341, 286, 4144, 478, 486, 41, 604, 486, 17119, 6615, 22428, 35395, 341, 310, 1077, 4024, 284, 5532, 486, 904, 478, 543, 310, 1077, 4778, 32981, 284, 23095, 478, 486, 149...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_assembler_whitespace() { test_case(&[" SET A , [ B ] "], &[0x2401]); test_case(&["SET A,[B]"], &[0x2401]); }
rust_cleaned_test_functions.jsonl/44772
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 84 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 11898, 35401, 86175, 368, 341, 262, 1273, 19096, 2099, 1183, 414, 9019, 256, 362, 256, 1154, 220, 508, 220, 425, 220, 2279, 256, 330, 1125, 44590, 15, 87, 17, 19, 15, 16, 2558, 262, 1273, 1909...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_run_identifier_fsm() { let mut lexer = Lexer::new("thisidmyid or n 12.00033e-08"); let tres0 = lexer.next_token(); match tres0 { Ok(tok) => { assert_eq!(tok.content, "thisidmyid"); assert_eq!(tok.token_type, TokenType...
rust_cleaned_test_functions.jsonl/30853
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 588 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 14007, 33176, 97069, 368, 341, 286, 1077, 5206, 53259, 284, 85082, 486, 931, 445, 574, 307, 2408, 307, 476, 414, 308, 981, 220, 16, 17, 13, 15, 15, 15, 18, 18, 68, 12, 15, 23, 797, 286, 10...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
6
#[test] fn test_virtual_dtor() { unsafe { { let b = bindings::InheritsFromVirtualDestructor::new(); // Let it go out of scope. } assert_eq!(bindings::InheritsFromVirtualDestructor_sDestructorCount, 1); assert_eq!(bindings::VirtualDestructor_sDestructo...
rust_cleaned_test_functions.jsonl/28007
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 161 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 58730, 814, 10980, 368, 341, 262, 19860, 341, 286, 341, 310, 1077, 293, 284, 35700, 486, 641, 38693, 3830, 33026, 84961, 486, 931, 543, 310, 442, 6771, 432, 728, 700, 315, 6891, 624, 286, 555, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_add_get_circuit_and_nodes() { let pool = create_connection_pool_and_migrate(); let store = DieselAdminServiceStore::new(pool); let circuit = create_circuit(); let nodes = create_nodes(); store .add_circuit(circuit.clone(), nodes) ...
rust_cleaned_test_functions.jsonl/569
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 531 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2891, 3062, 666, 37268, 8378, 14896, 368, 341, 286, 1077, 7314, 284, 1855, 15866, 15709, 8378, 717, 34479, 1428, 286, 1077, 3553, 284, 53794, 7210, 1860, 6093, 486, 931, 41838, 626, 286, 1077, 162...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_prepend_path() { let mut manager = ConfigManager::default(); manager.set_config_dir("BASE_PATH"); let config = manager.default_buffer_config(); assert_eq!(config.items.tab_size, 4); assert_eq!(manager.plugin_search_path(), vec![PathBuf::from("BASE_PATH/plu...
rust_cleaned_test_functions.jsonl/40013
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 143 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 10442, 3740, 2638, 368, 341, 286, 1077, 5206, 6645, 284, 5532, 2043, 486, 2258, 543, 286, 6645, 980, 5332, 4334, 445, 18450, 7944, 797, 286, 1077, 2193, 284, 6645, 8764, 7776, 5332, 543, 286, 20...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_empty() { let config = TokenizerConfig { mode: Mode::Decompose(Penalty::default()), ..TokenizerConfig::default() }; let mut tokenizer = Tokenizer::with_config(config).unwrap(); let tokens = tokenizer.tokenize_offsets(""); assert_eq!...
rust_cleaned_test_functions.jsonl/61432
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 157 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 15124, 368, 341, 286, 1077, 2193, 284, 9660, 3135, 2648, 341, 310, 3856, 25, 14562, 486, 4900, 316, 2900, 5304, 268, 10026, 486, 2258, 14702, 310, 5241, 37434, 2648, 486, 2258, 741, 286, 2605, 2...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_set_hl() { let mut cpu: CPU = CPU::new(); let pc = cpu.pc; cpu = cpu.set_hl(Register { value: 0 }); cpu.memory.write_64bit(1, 10); cpu = execute_set(cpu, pc, 0b110); assert_eq!(cpu.pc.value, 9); assert_eq!(cpu.f.value, 0); assert...
rust_cleaned_test_functions.jsonl/123557
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 185 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2602, 1523, 75, 368, 341, 286, 1077, 5206, 17319, 25, 13940, 284, 13940, 486, 931, 543, 286, 1077, 13312, 284, 17319, 53335, 401, 286, 17319, 284, 17319, 980, 1523, 75, 79203, 314, 897, 25, 220,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_int8() { let s = to_chars("int8"); let cur = &mut 0; expect_next_token(&s, cur, Token::Int8); }
rust_cleaned_test_functions.jsonl/21066
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 80 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 4042, 23, 368, 341, 286, 1077, 274, 284, 311, 37418, 445, 396, 23, 797, 286, 1077, 2847, 284, 609, 6984, 220, 15, 280, 286, 1720, 11257, 6458, 2099, 82, 11, 2847, 11, 9660, 486, 1072, 23, 31...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_reconfigure_runner_fails() { let mut exec = fasync::TestExecutor::new().expect("failed to create an executor"); let mut builder = TestMediaTaskBuilder::new(); let mut stream = Stream::build(make_sbc_endpoint(1, avdtp::EndpointType::Source), builder.builder())...
rust_cleaned_test_functions.jsonl/125332
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1401 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 1288, 21002, 54828, 761, 6209, 368, 341, 286, 1077, 5206, 3883, 284, 282, 7692, 486, 2271, 25255, 486, 931, 1005, 17119, 445, 16091, 311, 1855, 458, 31558, 3071, 286, 1077, 5206, 7363, 284, 3393, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_complicated() { let lines = &[ "+------+----+", "| | |", "+---+--+ |", "| | |", "+---+-------+", ]; assert_eq!(3, count(lines)) }
rust_cleaned_test_functions.jsonl/40145
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 136 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 18177, 13724, 368, 341, 262, 1077, 5128, 284, 609, 9640, 286, 6630, 61247, 381, 10, 756, 286, 25203, 414, 760, 262, 760, 756, 286, 6630, 4421, 10, 85894, 262, 760, 756, 286, 25203, 256, 760, 9...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_fq_repr_from() { assert_eq!( BigInteger384::from(100), BigInteger384([100, 0, 0, 0, 0, 0]) ); }
rust_cleaned_test_functions.jsonl/27343
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 79 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 761, 80, 68535, 5673, 368, 341, 262, 2060, 10714, 33673, 286, 34042, 18, 23, 19, 486, 1499, 7, 16, 15, 15, 1326, 286, 34042, 18, 23, 19, 2561, 16, 15, 15, 11, 220, 15, 11, 220, 15, 11, 2...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_from_arg_matches_first() { let argv = vec!["lsd", "--group-dirs", "first"]; let matches = app::build().get_matches_from_safe(argv).unwrap(); assert_eq!( Some(DirGrouping::First), DirGrouping::from_arg_matches(&matches) ); }
rust_cleaned_test_functions.jsonl/54311
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 156 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 5673, 6057, 38344, 12978, 368, 341, 286, 1077, 10213, 284, 7486, 0, 1183, 4730, 67, 497, 14482, 4074, 1737, 16838, 497, 330, 3896, 6332, 286, 1077, 9071, 284, 906, 486, 5834, 1005, 455, 38344, 5...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_orphaned_mempool_transactions() { let network = Network::LocalNet; let (store, mut blocks, mut outputs, consensus_manager) = create_new_blockchain(network); // A parallel store that will "mine" the orphan chain let mut miner = create_mem_db(&consensus_manager); let schemas = ...
rust_cleaned_test_functions.jsonl/61212
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1228 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 8734, 9943, 291, 717, 3262, 1749, 68182, 368, 341, 262, 1077, 3922, 284, 8141, 486, 7319, 6954, 280, 262, 1077, 320, 4314, 11, 5206, 10010, 11, 5206, 16275, 11, 23869, 12144, 8, 284, 1855, 5921,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_trasform() { let tr = Transform::identity() .pre_translate(1.0, 2.0) .pre_rotate(PI / 3.0) .pre_skew(2.0, 3.0) .pre_scale(3.0, 2.0); let inv = tr.invert().unwrap(); let p0 = Point::new(1.0, 1.0); let p1 = tr.apply(p...
rust_cleaned_test_functions.jsonl/20226
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 876 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 3547, 300, 627, 368, 341, 286, 1077, 489, 284, 15226, 486, 16912, 741, 310, 659, 1726, 66381, 7, 16, 13, 15, 11, 220, 17, 13, 15, 340, 310, 659, 1726, 60834, 7, 1893, 608, 220, 18, 13, 15,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_terminate_type_faulty_ac() { // stream type is not compatible let spec = "input in: Int8 input in2: Bool output a(b: Bool): Int8 @in close in2 := 3"; assert_eq!(1, num_type_errors(spec)); }
rust_cleaned_test_functions.jsonl/110677
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 109 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 62, 48061, 1819, 70097, 88, 14718, 368, 341, 286, 442, 4269, 943, 374, 537, 18146, 198, 286, 1077, 1398, 284, 330, 1355, 304, 25, 1333, 23, 1946, 304, 17, 25, 12608, 2550, 264, 1883, 25, 12608...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_fq_double() { let mut rng = XorShiftRng::from_seed([ 0x59, 0x62, 0xbe, 0x5d, 0x76, 0x3d, 0x31, 0x8d, 0x17, 0xdb, 0x37, 0x32, 0x54, 0x06, 0xbc, 0xe5, ]); for _ in 0..1000 { // Ensure doubling a is equivalent to adding a to itself. ...
rust_cleaned_test_functions.jsonl/2329
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 298 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 761, 80, 24598, 368, 341, 286, 1077, 5206, 28422, 284, 1599, 269, 24841, 49, 968, 486, 1499, 33809, 8956, 310, 220, 15, 87, 20, 24, 11, 220, 15, 87, 21, 17, 11, 220, 15, 42459, 11, 220, 15...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_payload_recover_serizalize() { let block_hash = hash(&[]); let prev_txid = Hash::from_slice(block_hash.as_ref()).unwrap(); let payload_script = PayloadBuilder::new() .block_hash(block_hash) .block_height(Height(1234)) .prev_tx_chain(Som...
rust_cleaned_test_functions.jsonl/119537
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 364 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 32813, 1288, 3688, 75861, 449, 278, 551, 368, 341, 286, 1077, 2504, 8950, 284, 5175, 2099, 56703, 286, 1077, 7872, 17805, 307, 284, 6531, 486, 1499, 26488, 18682, 8950, 5357, 7793, 6011, 15454, 54...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_from_iter() { let xs = [(California, "San Diego"), (NewYork, "New York"), (Arizona, "Phoenix")]; let map: DirectIdMap<_, _> = xs.iter().cloned().collect(); for &(k, v) in &xs { assert_eq!(map.get(k), Some(&v)); } check_missing(TINY_STATES, &map); }
rust_cleaned_test_functions.jsonl/38659
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 138 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 5673, 11723, 368, 341, 262, 1077, 11943, 284, 17826, 45410, 11, 330, 23729, 18336, 3975, 320, 3564, 98977, 11, 330, 3564, 4261, 3975, 320, 81491, 11, 330, 78825, 899, 4821, 262, 1077, 2415, 25, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_listen() { // Test value to ensure let test_val = "FooBar".to_string(); // Create handler and register test adapter let handler = SetUIHandler::new(); handler.register_adapter(Box::new(SettingAdapter::new( SettingType::Unknown, Box:...
rust_cleaned_test_functions.jsonl/21401
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1100 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 79286, 368, 341, 286, 442, 3393, 897, 311, 5978, 198, 286, 1077, 1273, 6189, 284, 330, 40923, 3428, 3263, 983, 3904, 543, 286, 442, 4230, 7013, 323, 4161, 1273, 12956, 198, 286, 1077, 7013, 284,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_log_updates() { let result = API_INSTANCE .lock() .unwrap() .log_updates(LogUpdatesArg::Start); assert!(!result.unwrap().is_empty()); }
rust_cleaned_test_functions.jsonl/105535
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 94 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 5224, 57829, 368, 341, 262, 1077, 1102, 284, 5333, 42587, 198, 286, 659, 1023, 741, 286, 659, 15454, 741, 286, 659, 839, 57829, 33028, 37091, 2735, 486, 3479, 317, 262, 2060, 0, 3471, 1382, 5539...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_valid_bytecode() { let mut bytecode: Vec<u8> = BIND_HEADER.to_vec(); append_section_header(&mut bytecode, SYMB_MAGIC_NUM, 18); let str_1: [u8; 5] = [0x57, 0x52, 0x45, 0x4E, 0]; // "WREN" bytecode.extend_from_slice(&[1, 0, 0, 0]); bytecode.extend_from_slic...
rust_cleaned_test_functions.jsonl/67996
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 584 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 8337, 19737, 1851, 368, 341, 286, 1077, 5206, 75129, 25, 11312, 34837, 23, 29, 284, 91370, 20330, 2389, 13251, 543, 286, 8737, 16221, 8757, 2099, 6984, 75129, 11, 16079, 8412, 49194, 9631, 11, 220...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_convert_polytype() { let b = ast::BaseNode::default(); let type_exp = ast::TypeExpression { base: b.clone(), monotype: ast::MonoType::Function(Box::new(ast::FunctionType { base: b.clone(), parameters: vec![ ...
rust_cleaned_test_functions.jsonl/30463
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 2445 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 34910, 36133, 1313, 368, 341, 1789, 286, 1077, 293, 284, 11763, 486, 3978, 1955, 486, 2258, 543, 286, 1077, 943, 14214, 284, 11763, 486, 929, 9595, 341, 310, 2331, 25, 293, 15997, 3148, 310, 161...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_parse_debug_abbrev_offset_32() { let section = Section::with_endian(Endian::Little).L32(0x0403_0201); let buf = section.get_contents().unwrap(); let buf = &mut EndianSlice::new(&buf, LittleEndian); match parse_debug_abbrev_offset(buf, Format::Dwarf32) { ...
rust_cleaned_test_functions.jsonl/101988
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 216 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21039, 15446, 62, 44272, 6917, 62, 18, 17, 368, 341, 286, 1077, 3772, 284, 11113, 486, 4197, 87193, 7, 43231, 486, 38103, 568, 43, 18, 17, 7, 15, 87, 15, 19, 15, 18, 62, 15, 17, 15, 16, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_naive_tf_empty_bag(){ let bag = init_empty_bag(2, 1); assert_eq!(2, bag.len()); assert_eq!(1, bag[0].len()); }
rust_cleaned_test_functions.jsonl/64507
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 74 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 58631, 533, 47719, 15124, 74368, 3032, 262, 1077, 8968, 284, 2930, 15124, 74368, 7, 17, 11, 220, 16, 626, 262, 2060, 10714, 10297, 17, 11, 8968, 19406, 1423, 262, 2060, 10714, 10297, 16, 11, 896...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_alu32_logic() { test_interpreter_and_jit_asm!( " mov32 r0, 0 mov32 r1, 1 mov32 r2, 2 mov32 r3, 3 mov32 r4, 4 mov32 r5, 5 mov32 r6, 6 mov32 r7, 7 mov32 r8, 8 or32 r0, r5 or32 r0, 0xa0 and32...
rust_cleaned_test_functions.jsonl/58933
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 421 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 8418, 84, 18, 17, 54335, 368, 341, 262, 1273, 15318, 28637, 8378, 5374, 275, 67529, 33673, 286, 6228, 286, 1974, 18, 17, 435, 15, 11, 220, 15, 198, 286, 1974, 18, 17, 435, 16, 11, 220, 16, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_split_off_tiny_left_height_2() { let pairs = (0..MIN_INSERTS_HEIGHT_2).map(|i| (i, i)); let mut left: BTreeMap<_, _> = pairs.clone().collect(); let right = left.split_off(&1); left.check(); right.check(); assert_eq!(left.len(), 1); assert_eq!(right.len(), MIN_INSERTS_...
rust_cleaned_test_functions.jsonl/53964
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 203 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 17052, 13651, 528, 6441, 9579, 9561, 62, 17, 368, 341, 262, 1077, 13530, 284, 320, 15, 496, 16413, 47924, 50, 17355, 62, 17, 568, 2186, 22428, 72, 91, 320, 72, 11, 600, 1106, 262, 1077, 5206, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_clip_line3() { let c = CellGrid::c(); let m = CellGrid::m(); let w = CellGrid::w(); let bounds = AABB::new(*m, *w); let clip = clip_line(&bounds, c, w); println!("clip: {:#?}", clip); assert_eq!(clip, Some((m, w))); }
rust_cleaned_test_functions.jsonl/36467
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 159 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 44728, 6528, 18, 368, 341, 286, 1077, 272, 284, 13972, 3543, 486, 66, 543, 286, 1077, 296, 284, 13972, 3543, 486, 76, 543, 286, 1077, 289, 284, 13972, 3543, 486, 86, 543, 286, 1077, 14262, 284...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_send() -> Result<(), Box<dyn Error>> { let dir = temp_dir(); let cf = dir.join("config.toml"); let mut config = File::create(cf)?; config.write_all( toml::to_string(&Root { config: Config { name: "test".to_string(), ...
rust_cleaned_test_functions.jsonl/52895
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 428 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 13565, 368, 1464, 5714, 68843, 8261, 92846, 4600, 2452, 341, 286, 1077, 5419, 284, 2730, 4334, 543, 286, 1077, 24111, 284, 5419, 5446, 445, 1676, 73494, 75, 797, 286, 1077, 5206, 2193, 284, 2887, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
6
#[test] fn test_arg_creation() { let a = Argument::new("<test-app>", Some("Dummy help str".into())); assert!(a.required); assert!(!a.variadic); assert_eq!(a.name, "test_app"); assert_eq!(a.description, Some("Dummy help str".into())); }
rust_cleaned_test_functions.jsonl/61001
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 136 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6057, 46163, 368, 341, 286, 1077, 264, 284, 13818, 486, 931, 9639, 1944, 20023, 21156, 4329, 445, 43344, 1492, 607, 3263, 18122, 25138, 286, 2060, 10297, 64, 20063, 317, 286, 2060, 0, 3471, 64, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_expansion_failures() -> Result<()> { let mode = Mode::NoRenaming; let errs = expand_imports(parse_quote! { "some_project:utils"; }, &mode).unwrap_err(); assert_eq!( errs.into_iter() .map(|e| e.to_string()) .collect::<V...
rust_cleaned_test_functions.jsonl/83018
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 764 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 14214, 10501, 22121, 1413, 368, 1464, 5714, 71698, 341, 286, 1077, 3856, 284, 14562, 486, 2753, 34625, 6469, 401, 1789, 286, 1077, 70817, 284, 9225, 18434, 82, 27762, 45236, 0, 314, 330, 14689, 16...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_float() { let mut args = HashMap::new(); let tests: Vec<(&str, f64)> = vec![("0", 0.0), ("-5.3", -5.3)]; for (input, expected) in tests { let result = float(&to_value(input).unwrap(), &args); assert!(result.is_ok()); assert_eq!(result...
rust_cleaned_test_functions.jsonl/119662
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 364 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 17586, 368, 341, 286, 1077, 5206, 2827, 284, 10528, 486, 931, 1428, 286, 1077, 7032, 25, 11312, 27, 2099, 495, 11, 282, 21, 19, 16018, 284, 7486, 20703, 445, 15, 497, 220, 15, 13, 15, 701, 9...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_render_subexpression_issue_115() { use crate::support::str::StringWriter; let mut r = Registry::new(); r.register_helper( "format", Box::new( |h: &Helper<'_, '_>, _: &Registry<'_>, _: &Context, _: &mut RenderContext<...
rust_cleaned_test_functions.jsonl/15110
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 504 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 22781, 5228, 28099, 53340, 62, 16, 16, 20, 368, 341, 262, 990, 17717, 486, 23362, 486, 495, 486, 703, 6492, 401, 262, 1077, 5206, 435, 284, 32112, 486, 931, 543, 262, 435, 9929, 10418, 1006, 2...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_drop_panic_into_iter() { struct DropPanic; impl Drop for DropPanic { fn drop(&mut self) { panic!("drop"); } } let mut array = ArrayVec::<[DropPanic; 1]>::new(); array.push(DropPanic); array.into_iter(); }
rust_cleaned_test_functions.jsonl/36776
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 137 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 29584, 620, 31270, 45514, 11723, 368, 341, 262, 2036, 15733, 47, 31270, 401, 262, 11605, 15733, 369, 15733, 47, 31270, 341, 286, 5168, 5943, 2099, 6984, 656, 8, 341, 310, 21975, 17223, 6719, 797, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_refcount() { let items = [ Rc::new(Foo::new(1)), Rc::new(Foo::new(2)), Rc::new(Foo::new(3)), ]; let check = |expected: [usize; 3]| { let gotten: Vec<_> = items.iter().map(|r| Rc::strong_count(r)).collect(); asse...
rust_cleaned_test_functions.jsonl/68048
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 556 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 7793, 1830, 368, 341, 286, 1077, 3589, 284, 2278, 310, 81463, 486, 931, 7832, 2624, 486, 931, 7, 16, 6965, 310, 81463, 486, 931, 7832, 2624, 486, 931, 7, 17, 6965, 310, 81463, 486, 931, 7832, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_field_auth_status_user_not_created() { let mut context_builder = ContextBuilder::new(); let conn = context_builder.db_conn(); let user_provider = UserProviderFactory::default().insert(conn); context_builder.set_user_provider(user_provider); let runner = QueryRunner::ne...
rust_cleaned_test_functions.jsonl/129723
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 338 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 5013, 14014, 4773, 3317, 7913, 27288, 368, 341, 262, 1077, 5206, 2266, 28532, 284, 9608, 3297, 486, 931, 543, 262, 1077, 4534, 284, 2266, 28532, 7076, 17241, 1428, 262, 1077, 1196, 29518, 284, 265...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_single_to_single() { assert_less(Variant::from(1.0_f32), Variant::from(2.0_f32)); assert_equal(Variant::from(3.0_f32), Variant::from(3.0_f32)); assert_greater(Variant::from(5.0_f32), Variant::from(4.0_f32)); }
rust_cleaned_test_functions.jsonl/84511
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 148 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 19487, 2346, 19487, 368, 341, 310, 2060, 50747, 12410, 15341, 486, 1499, 7, 16, 13, 15, 761, 18, 17, 701, 39292, 486, 1499, 7, 17, 13, 15, 761, 18, 17, 1106, 310, 2060, 11478, 12410, 15341, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_2_by_2_matrix_complex_eigenvalues() { // This test currently fails - complex eigenvalues would be nice though! let a = matrix![1., -3.; 1., 1.]; // characteristic polynomial is λ² βˆ’ Ξ» + 4 = 0 // Decomposition will fail assert!(a.eigenvalues().is_err()); ...
rust_cleaned_test_functions.jsonl/96792
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 141 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 62, 17, 3710, 62, 17, 10193, 41522, 2204, 6433, 3661, 368, 341, 286, 442, 1096, 1273, 5023, 14525, 481, 6351, 28724, 3661, 1035, 387, 6419, 3498, 4894, 286, 1077, 264, 284, 6172, 20703, 16, 2572...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_power_t_half_two_features() { let mut mi = model_instance::ModelInstance::new_empty().unwrap(); mi.learning_rate = 0.1; mi.power_t = 0.5; mi.bit_precision = 18; mi.init_acc_gradient = 0.0; let mut re = Regressor::<optimizer::Optimi...
rust_cleaned_test_functions.jsonl/124047
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 372 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 20421, 528, 40626, 23241, 14965, 368, 341, 286, 1077, 5206, 9497, 284, 1614, 11904, 486, 1712, 2523, 486, 931, 15124, 1005, 15454, 2129, 1789, 286, 9497, 65602, 9246, 284, 220, 15, 13, 16, 280, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_to_affine_matrix() { let angle = Degrees(60_f64); let cos_angle = angle.cos(); let sin_angle = angle.sin(); let distance = Vector2::new(5_f64, 18_f64); let isometry = Isometry2::from_angle_translation(angle, &distance); let expected = Matrix3x3::ne...
rust_cleaned_test_functions.jsonl/77216
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 281 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2346, 48914, 482, 10193, 368, 341, 286, 1077, 9210, 284, 92901, 7, 21, 15, 761, 21, 19, 317, 286, 1077, 7960, 21727, 284, 9210, 21147, 543, 286, 1077, 7437, 21727, 284, 9210, 16318, 543, 286, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_smoke() { let path = Builder::new().tempdir().unwrap(); let engine = new_default_engine(path.path().to_str().unwrap()).unwrap(); let (k, v) = (b"foo", b"bar"); let p = path.path().join("sst"); let mut writer = RocksSstWriterBuilder::new() .set...
rust_cleaned_test_functions.jsonl/34924
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 723 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 15874, 4740, 368, 341, 286, 1077, 1815, 284, 20626, 486, 931, 1005, 3888, 3741, 1005, 15454, 543, 286, 1077, 4712, 284, 501, 9993, 24823, 5581, 3875, 1005, 983, 2895, 1005, 15454, 6011, 15454, 543...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_valid_url_success() -> Result<()> { let valid_url = "https://example.com:8443".to_string(); match validate_url(valid_url.clone()) { Ok(u) => { assert_eq!(valid_url, u); Ok(()) } Err(e) => anyhow::bail!("got: {:#?...
rust_cleaned_test_functions.jsonl/125243
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 204 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 8337, 2903, 18632, 368, 1464, 5714, 71698, 341, 286, 1077, 2697, 2903, 284, 330, 2428, 1110, 8687, 905, 25, 23, 19, 19, 18, 3263, 983, 3904, 543, 286, 2432, 9593, 2903, 41529, 2903, 15997, 2140,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_ownable_incorrect_owner() { let mut account_owner_pubkey = solana_sdk::pubkey::new_rand(); let new_owner_pubkey = solana_sdk::pubkey::new_rand(); let account = AccountSharedData::new_ref(1, 0, &system_program::id()); let mallory_pubkey = solana_sdk::pubkey::new_ra...
rust_cleaned_test_functions.jsonl/95028
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 314 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 82100, 480, 1243, 19928, 29027, 368, 341, 286, 1077, 5206, 2692, 29027, 34014, 792, 284, 2048, 3362, 61783, 486, 9585, 792, 486, 931, 33864, 543, 286, 1077, 501, 29027, 34014, 792, 284, 2048, 3362...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_get_apps_robot_config() { let path = get_apps_robot_config(Some(PathBuf::from("a.toml"))); assert!(path.is_some()); assert_eq!(path.unwrap(), PathBuf::from("a.toml")); std::env::set_var(OPENRR_APPS_CONFIG_ENV_NAME, "b.yaml"); let path = get_apps_r...
rust_cleaned_test_functions.jsonl/65304
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 444 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 3062, 69899, 59116, 5332, 368, 341, 286, 1077, 1815, 284, 633, 69899, 59116, 5332, 65405, 33030, 15064, 486, 1499, 445, 64, 73494, 75, 17621, 286, 2060, 10297, 2343, 2079, 61855, 1423, 286, 2060, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_path_error_message() { let input = r#" "foo"; "#; let err = serde_json::from_str::<Path>(input).expect_err("must fail"); assert_eq!( err.to_string(), "invalid value: string \"foo\", expected a path with leading `/` \ ...
rust_cleaned_test_functions.jsonl/98674
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 230 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2638, 4096, 6462, 368, 341, 286, 1077, 1946, 284, 435, 2, 698, 310, 330, 7975, 876, 286, 5869, 280, 286, 1077, 1848, 284, 61570, 9455, 486, 1499, 2895, 27638, 1820, 2235, 1355, 568, 17119, 9266,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1