text
stringlengths
93
16.4k
id
stringlengths
20
40
metadata
dict
input_ids
listlengths
45
2.05k
attention_mask
listlengths
45
2.05k
complexity
int64
1
9
#[test] fn test_parse_arguments_pdb() { let args = ovec!["-c", "foo.c", "-Zi", "-Fdfoo.pdb", "-Fofoo.obj"]; let ParsedArguments { input, language, depfile: _, outputs, preprocessor_args, msvc_show_includes, commo...
rust_cleaned_test_functions.jsonl/14160
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 579 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21039, 43433, 620, 1999, 368, 341, 286, 1077, 2827, 284, 297, 4083, 0, 1183, 12, 66, 497, 330, 7975, 520, 497, 6523, 57, 72, 497, 6523, 74476, 7975, 556, 1999, 497, 6523, 91879, 7975, 21232, 6...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_p2p_magic_number_byteorder() { let mainnet_bytes = &[0xF9u8, 0xBEu8, 0xB4u8, 0xD9u8][..]; let testnet_bytes = &[0x0Bu8, 0x11u8, 0x09u8, 0x07u8][..]; let regtest_bytes = &[0xFAu8, 0xBFu8, 0xB5u8, 0xDAu8][..]; let signet_bytes = &[0x0Au8, 0x03u8, 0xCFu8, 0x40u8][..]...
rust_cleaned_test_functions.jsonl/115615
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 838 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 620, 17, 79, 54612, 5500, 19737, 1358, 368, 341, 286, 1077, 1887, 4711, 12524, 284, 44590, 15, 9770, 24, 84, 23, 11, 220, 15, 85449, 84, 23, 11, 220, 15, 14377, 19, 84, 23, 11, 220, 15, 15...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_memcmp_encode_all_panic() { let cases = vec![(0, 0), (0, 7), (0, 8), (7, 8), (8, 9), (8, 17)]; for (src_len, dest_len) in cases { let src = vec![0; src_len]; let mut dest = vec![0; dest_len]; let result = panic_hook::recover_safe(move || { ...
rust_cleaned_test_functions.jsonl/26696
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 458 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 12976, 7293, 11224, 5705, 620, 31270, 368, 341, 286, 1077, 5048, 284, 7486, 0, 9697, 15, 11, 220, 15, 701, 320, 15, 11, 220, 22, 701, 320, 15, 11, 220, 23, 701, 320, 22, 11, 220, 23, 701, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
4
#[test] fn test_close_ww() { test_executor!(async move { let rc = Rc::new(RwLock::new(1)); let rc2 = rc.clone(); Task::local(async move { let _lock = rc2.write().await.unwrap(); rc2.close(); }) .await; ...
rust_cleaned_test_functions.jsonl/134530
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 226 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 12704, 62, 1250, 368, 341, 286, 1273, 81207, 10297, 7692, 3271, 341, 310, 1077, 10192, 284, 81463, 486, 931, 2785, 86, 11989, 486, 931, 7, 16, 1106, 310, 1077, 10192, 17, 284, 10192, 15997, 1428...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_inverse_matrix() { let a: Matrix<isize> = Matrix::identity(2, 2); let b = a.inverse(); assert_eq!(b[0][0], 1); assert_eq!(b[1][1], 1); let a: Matrix<f32> = Matrix::identity(2, 2); let b = (&a * &2f32).inverse(); assert_eq!(b[0][0], 0.5);...
rust_cleaned_test_functions.jsonl/60183
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 204 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 63333, 10193, 368, 341, 286, 1077, 264, 25, 11631, 27, 285, 551, 29, 284, 11631, 486, 16912, 7, 17, 11, 220, 17, 317, 286, 1077, 293, 284, 264, 76563, 1428, 286, 2060, 10714, 10297, 65, 58, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_version_order_both_semantic() { let a = SystemVersion::Semantic(SemanticVersion::from([1, 2, 3, 4])); let b = SystemVersion::Semantic(SemanticVersion::from([1, 2, 3, 5])); assert_eq!(a < b, true); assert_eq!(a <= b, true); assert_eq!(a > b, false); ...
rust_cleaned_test_functions.jsonl/126055
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 245 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 9438, 7869, 88819, 30442, 8159, 368, 341, 286, 1077, 264, 284, 739, 5637, 486, 97931, 3759, 336, 8159, 5637, 486, 1499, 2561, 16, 11, 220, 17, 11, 220, 18, 11, 220, 19, 14382, 286, 1077, 293, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_parse_term() { use std::collections::HashMap; let mut vars_map = HashMap::new(); vars_map.insert("x".to_string(), 10.0); assert_eq!( parse_expr(CompleteStr("(3(3))")) .unwrap() .1 .evaluate(&HashMap::new()) .unwrap(), ...
rust_cleaned_test_functions.jsonl/50209
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 2695 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21039, 17464, 368, 341, 262, 990, 1460, 486, 51137, 486, 18497, 280, 262, 1077, 5206, 19942, 5376, 284, 10528, 486, 931, 543, 262, 19942, 5376, 7030, 445, 87, 3263, 983, 3904, 1507, 220, 16, 15,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_decode_flow_control_on_command() { let buf = [ 0b10100001, 0b00000001, ]; let expected = MuxCommand { params: MuxCommandParams::FlowControlOn(FlowControlParams {}), command_response: CommandResponse::Response, }; ...
rust_cleaned_test_functions.jsonl/107774
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 193 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 15227, 27441, 13436, 4470, 10811, 368, 341, 286, 1077, 6607, 284, 2278, 310, 220, 15, 65, 16, 15, 16, 15, 15, 15, 15, 16, 11, 715, 310, 220, 15, 65, 15, 15, 15, 15, 15, 15, 15, 16, 11, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_key_is_less_than_or_equal() { let skl = new_test_skl(); let key = vec![1u8, 2u8, 3u8]; let tests = vec![ (vec![1u8, 2u8], false), (vec![1u8, 2u8, 4u8], true), (vec![1u8, 2u8, 3u8], true), ]; // nullptr should be conside...
rust_cleaned_test_functions.jsonl/15457
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 344 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 3097, 6892, 50747, 51613, 8734, 11478, 368, 341, 286, 1077, 82542, 284, 501, 4452, 643, 10561, 543, 286, 1077, 1376, 284, 7486, 20703, 16, 84, 23, 11, 220, 17, 84, 23, 11, 220, 18, 84, 23, 4...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_thread_local() { thread_local! { static TMP_THREAD_LOCAL: AtomicUsize = AtomicUsize::new(0); } let join1 = thread::spawn(move || { TMP_THREAD_LOCAL.try_with(move |local| { println!("!!!!!!local: {:?}", local.load(Ordering::Relaxed)); l...
rust_cleaned_test_functions.jsonl/62436
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 711 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 10814, 13564, 368, 972, 262, 4516, 13564, 0, 972, 286, 1099, 66253, 27087, 28399, 25, 30316, 52, 2141, 284, 30316, 52, 2141, 486, 931, 7, 15, 736, 262, 2553, 262, 1077, 5138, 16, 284, 4516, 48...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
6
#[test] fn test_pattern() { let mut res = scan( "hi abcdefghijklmnop 0123456789", "hi {[a-l]}{[^a-l ]} {[01234-8]}{[9]}", ); assert_eq!(res.next().unwrap(), "abcdefghijkl"); assert_eq!(res.next().unwrap(), "mnop"); assert_eq!(res.next().unwrap(), "012345678"); assert_eq!(...
rust_cleaned_test_functions.jsonl/50246
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 263 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21260, 368, 341, 262, 1077, 5206, 592, 284, 8569, 1006, 286, 330, 6023, 39022, 750, 866, 59779, 63500, 220, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 756, 286, 330, 6023, 45591, 64, 2852, 1398...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_secretkey_to_mnemonic_and_from_mnemonic() { // Valid Mnemonic sequence let desired_k = RistrettoSecretKey::random(&mut OsRng); match desired_k.to_mnemonic(&MnemonicLanguage::Japanese) { Ok(mnemonic_seq) => { match RistrettoSecretKey::from_mnemo...
rust_cleaned_test_functions.jsonl/10402
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 825 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21962, 792, 2346, 717, 70775, 8378, 5673, 717, 70775, 368, 341, 286, 442, 7818, 56731, 38801, 8500, 198, 286, 1077, 12685, 4698, 284, 431, 380, 2122, 983, 19773, 1592, 486, 11463, 2099, 6984, 1543...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
6
#[test] fn test_map_transactions_to_statuses() { let ledger_path = get_tmp_ledger_path_auto_delete!(); let blockstore = Blockstore::open(ledger_path.path()).unwrap(); let transaction_status_cf = &blockstore.transaction_status_cf; let slot = 0; let mut transactions: Vec<...
rust_cleaned_test_functions.jsonl/9571
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1199 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 5376, 68182, 2346, 83702, 368, 341, 286, 1077, 46933, 2638, 284, 633, 16125, 38367, 1389, 2638, 27740, 11353, 0, 543, 286, 1077, 2504, 4314, 284, 8362, 4314, 486, 2508, 7, 50704, 2638, 3875, 6011,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_read_bytes() { let input = "abcdefghijklmnopqrstuvwxyz\n12345678"; // spell-checker:disable-line new_ucmd!() .arg("--endian=little") .arg("--read-bytes=27") .run_piped_stdin(input.as_bytes()) .no_stderr() .success() .stdout_is(unindent(ALPH...
rust_cleaned_test_functions.jsonl/48823
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 176 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6443, 12524, 368, 341, 262, 1077, 1946, 284, 330, 67512, 1699, 16, 17, 18, 19, 20, 21, 22, 23, 5123, 442, 12845, 15934, 261, 42066, 8447, 198, 262, 501, 68887, 2277, 0, 741, 286, 659, 858, 2...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_create() { let data = r#" { "title": "Example Document", "contents": [{ "obj_type": "Paragraph", "params": { "text": "Hello World!", "font_size": 18, ...
rust_cleaned_test_functions.jsonl/77584
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 514 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 8657, 368, 341, 286, 1077, 821, 284, 435, 2, 698, 286, 341, 310, 330, 2102, 788, 330, 13314, 11789, 756, 310, 330, 17610, 788, 18396, 503, 330, 2295, 1819, 788, 330, 42165, 756, 503, 330, 3519...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_get_string_fails() { match to_string(0) { Ok(_) => assert_eq!(1, 0), //fail if we get here Err(_) => assert_eq!(0, 0), }; }
rust_cleaned_test_functions.jsonl/34219
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 108 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 3062, 3904, 761, 6209, 368, 341, 286, 2432, 311, 3904, 7, 15, 8, 341, 310, 7622, 48139, 589, 2060, 10714, 10297, 16, 11, 220, 15, 701, 442, 18403, 421, 582, 633, 1588, 198, 310, 15495, 48139, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
2
#[test] fn test_vec4mask_any() { assert_eq!(Vec4Mask::new(false, false, false, false).any(), false); assert_eq!(Vec4Mask::new(true, false, false, false).any(), true); assert_eq!(Vec4Mask::new(false, true, false, false).any(), true); assert_eq!(Vec4Mask::new(false, false, true, false).any(), true...
rust_cleaned_test_functions.jsonl/68874
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 163 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 13251, 19, 11258, 37248, 368, 341, 262, 2060, 10714, 10297, 10050, 19, 12686, 486, 931, 3576, 11, 895, 11, 895, 11, 895, 568, 3767, 1507, 895, 317, 262, 2060, 10714, 10297, 10050, 19, 12686, 486...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_devnet_pass() { let mut cluster_vec = Vec::<String>::new(); cluster_vec.push(SCFS_DEVNET.to_string()); let mut my_matrix = ScfsMatrix::new(Some(ScfsCriteria { clusters: Some(cluster_vec), ..Default::default() })) .unwrap(); ...
rust_cleaned_test_functions.jsonl/38834
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 239 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 10433, 4711, 15464, 368, 341, 286, 1077, 5206, 10652, 13251, 284, 11312, 27638, 703, 6831, 931, 543, 286, 10652, 13251, 2552, 59461, 8485, 26419, 15373, 2389, 3904, 1423, 286, 1077, 5206, 847, 10193...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_concat() { assert_eq!( string_concat(Value::from("foo"), &Value::from(42)), Value::from("foo42") ); assert_eq!( string_concat(Value::from(23), &Value::from(42)), Value::from("2342") ); }
rust_cleaned_test_functions.jsonl/108532
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 130 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 57478, 368, 341, 262, 2060, 10714, 33673, 286, 914, 57478, 25346, 486, 1499, 445, 7975, 3975, 609, 1130, 486, 1499, 7, 19, 17, 6965, 286, 5162, 486, 1499, 445, 7975, 19, 17, 1138, 262, 1439, 2...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_cosh() { assert!(close(_0_0i.cosh(), _1_0i)); assert!(close( _1_0i.cosh(), _1_0i.scale((f64::consts::E + 1.0 / f64::consts::E) / 2.0) )); assert!(close(_0_1i.cosh(), _1_0i.scale(1.0.cos()))); for &c in al...
rust_cleaned_test_functions.jsonl/105698
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 350 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 666, 9267, 368, 341, 310, 2060, 10297, 5552, 2490, 15, 62, 15, 72, 520, 9267, 1507, 716, 16, 62, 15, 72, 1106, 310, 2060, 10297, 5552, 1006, 394, 716, 16, 62, 15, 72, 520, 9267, 3148, 394, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_column_bytes() { let fields: Vec<FieldType> = vec![ FieldTypeTp::VarChar.into(), FieldTypeTp::VarString.into(), FieldTypeTp::String.into(), FieldTypeTp::Blob.into(), FieldTypeTp::TinyBlob.into(), FieldTypeTp::MediumB...
rust_cleaned_test_functions.jsonl/80498
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 263 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 8744, 12524, 368, 341, 286, 1077, 5043, 25, 11312, 27, 63733, 29, 284, 7486, 90515, 310, 84614, 62241, 486, 38266, 39860, 3148, 310, 84614, 62241, 486, 3962, 703, 39860, 3148, 310, 84614, 62241, 4...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_broadcast_last_tick() { logger::setup(); // The number of validators const N: usize = 5; logger::setup(); // Create the bootstrap leader node information let bootstrap_leader_keypair = Keypair::new(); let bootstrap_leader_node = Node::new_localhost_with_pubkey(bootst...
rust_cleaned_test_functions.jsonl/36561
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1776 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 74923, 12195, 43612, 368, 341, 262, 5925, 486, 15188, 543, 262, 442, 576, 1372, 315, 38588, 198, 262, 733, 451, 25, 22301, 284, 220, 20, 280, 262, 5925, 486, 15188, 1428, 262, 442, 4230, 279, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
7
#[test] fn test_conditional_open_qasm() { let bit_names = [String::from("qb0"), String::from("qb1")]; let qasm = Kron::new(H::new(), X::new()) .conditional_open_qasm("b == 1", &bit_names, &[1, 0]); assert_eq!(qasm, Ok(String::from("if (b == 1) h qb1; if (b == 1) x qb0")))...
rust_cleaned_test_functions.jsonl/34669
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 168 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 24433, 3005, 11311, 8976, 10530, 741, 262, 341, 286, 1077, 2699, 9187, 284, 508, 703, 486, 1499, 445, 49698, 15, 3975, 923, 486, 1499, 445, 49698, 16, 899, 935, 286, 1077, 2804, 10530, 284, 9656...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_from_raw_semicolon() { let a = HeaderValue::from_static("form-data; filename=\"A semicolon here;.pdf\""); let a: ContentDisposition = ContentDisposition::from_raw(&a).unwrap(); let b = ContentDisposition { disposition: DispositionType::FormData, ...
rust_cleaned_test_functions.jsonl/129587
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 231 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 5673, 16067, 3453, 21220, 72269, 368, 341, 286, 1077, 264, 4035, 310, 12104, 1130, 486, 1499, 25360, 445, 627, 13945, 26, 3899, 4070, 32, 5234, 38517, 1588, 78698, 11828, 88385, 286, 1077, 264, 25...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_getrange_function() { crate::init().unwrap(); let pad = crate::Pad::builder(Some("src"), crate::PadDirection::Src) .activate_function(|pad, _parent| { pad.activate_mode(crate::PadMode::Pull, true) .map_err(|err| err.into()) ...
rust_cleaned_test_functions.jsonl/4735
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1170 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 3062, 9669, 9174, 368, 341, 286, 17717, 486, 2327, 1005, 15454, 1428, 286, 1077, 11016, 284, 17717, 486, 13731, 486, 17850, 65405, 445, 3548, 3975, 17717, 486, 13731, 9268, 486, 20360, 340, 310, 6...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_writer_parity() { let obj1 = TestSingleObjectWriter { a: 300, b: 34.555, c: vec!["cat".into(), "dog".into()], }; let mut buf1: Vec<u8> = Vec::new(); let mut buf2: Vec<u8> = Vec::new(); let mut buf3: Vec<u8> = Vec::new()...
rust_cleaned_test_functions.jsonl/130967
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 547 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 28908, 620, 10748, 368, 341, 286, 1077, 2839, 16, 284, 3393, 10888, 1190, 6492, 341, 310, 264, 25, 220, 18, 15, 15, 345, 310, 293, 25, 220, 18, 19, 13, 20, 20, 20, 345, 310, 272, 25, 7486,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_decoder_decode_header_name_invalid_character() { let buffer = "RTSP/2.0 200 OK\r\n\ Content Length: 1\r\n\ \r\n"; let mut decoder = Decoder::new(); let (result, bytes_decoded) = decoder.decode(buffer); assert_ne!(bytes_d...
rust_cleaned_test_functions.jsonl/123056
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 251 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 49843, 15227, 8757, 1269, 31433, 40988, 368, 341, 286, 1077, 4147, 284, 330, 5350, 4592, 14, 17, 13, 15, 220, 17, 15, 15, 10402, 12016, 1699, 5661, 2549, 8883, 17287, 25, 220, 16, 12016, 1699, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_punctuation_2() { assert_eq!(lex("!="), (Token::BangEqual, 2)); assert_eq!(lex("%="), (Token::PercentEqual, 2)); assert_eq!(lex("&&"), (Token::And2, 2)); assert_eq!(lex("&="), (Token::AndEqual, 2)); assert_eq!(lex("**"), (Token::Star2, 2)); assert_...
rust_cleaned_test_functions.jsonl/80524
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 670 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 620, 72299, 62, 17, 368, 341, 286, 2060, 10714, 10297, 2571, 445, 32299, 701, 320, 3323, 486, 62819, 2993, 11, 220, 17, 1106, 286, 2060, 10714, 10297, 2571, 4430, 428, 701, 320, 3323, 486, 32010...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_slice_into_dict() { Python::with_gil(|py| { let arr = [("a", 1), ("b", 2), ("c", 3)]; let py_map = arr.into_py_dict(py); assert_eq!(py_map.len(), 3); assert_eq!(py_map.get_item("b").unwrap().extract::<i32>().unwrap(), 2); }); }
rust_cleaned_test_functions.jsonl/7739
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 180 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 26488, 45514, 5243, 368, 341, 286, 13027, 486, 4197, 1889, 321, 22428, 3288, 91, 341, 310, 1077, 2890, 284, 84019, 64, 497, 220, 16, 701, 3489, 65, 497, 220, 17, 701, 3489, 66, 497, 220, 18, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_numeric_floats_with_nan2() { test_helper( "numeric-floats-with-nan2", &["-n", "--numeric-sort", "--sort=numeric"], ); }
rust_cleaned_test_functions.jsonl/20493
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 89 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 29418, 17586, 82, 6615, 73936, 17, 368, 341, 262, 1273, 10418, 1006, 286, 330, 19600, 2220, 1239, 82, 26189, 5279, 276, 17, 756, 286, 609, 1183, 12, 77, 497, 14482, 19600, 46540, 497, 14482, 686...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_read_gamma_encoding() -> io::Result<()> { let data = [ 9, // Elias gamma encoding ID 1, // args.len 1, // offset ]; let mut reader = &data[..]; let encoding = read_encoding(&mut reader)?; assert_eq!(encoding, Encoding::...
rust_cleaned_test_functions.jsonl/5079
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 181 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6443, 61179, 37613, 368, 1464, 6399, 486, 2077, 71698, 341, 286, 1077, 821, 284, 2278, 310, 220, 24, 11, 442, 85656, 21619, 11170, 3034, 198, 310, 220, 16, 11, 442, 2827, 19406, 198, 310, 220, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_query_captures_ordered_by_both_start_and_end_positions() { allocations::record(|| { let language = get_language("javascript"); let query = Query::new( language, r#" (call_expression) @call (member_expression) @member ...
rust_cleaned_test_functions.jsonl/25193
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 634 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 5738, 666, 2689, 1413, 75272, 3710, 88819, 4906, 8378, 6213, 37219, 368, 341, 262, 69642, 486, 8548, 79453, 341, 286, 1077, 4128, 284, 633, 29021, 445, 14073, 797, 286, 1077, 3239, 284, 11361, 486...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_incorrect_transfer_amount() { const TOKEN_ID: u16 = 0; // Balance check should fail. // "balance-fee bits" is message for subtraction check in circuit. const ERR_MSG: &str = "balance-fee bits"; let test_vector = vec![ (10u64, 11u64, 3u64), // Transfer too b...
rust_cleaned_test_functions.jsonl/130994
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 946 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 1243, 19928, 35403, 13471, 368, 341, 262, 733, 43574, 3450, 25, 575, 16, 21, 284, 220, 15, 280, 262, 442, 30846, 1779, 1265, 3690, 624, 262, 442, 330, 21571, 12, 30017, 9472, 1, 374, 1943, 369...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_step_ignore_old_term_msg() { let scenario = fail::FailScenario::setup(); let l = default_logger(); let mut sm = new_test_raft(1, vec![1], 10, 1, new_storage(), &l); fail::cfg("before_step", "panic").unwrap(); sm.term = 2; let mut m = new_message(0, 0, MessageType::MsgAppe...
rust_cleaned_test_functions.jsonl/6150
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 173 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 11946, 58493, 21108, 17464, 6483, 368, 341, 262, 1077, 15048, 284, 3690, 486, 19524, 54031, 486, 15188, 543, 262, 1077, 326, 284, 1638, 27413, 543, 262, 1077, 5206, 1525, 284, 501, 4452, 62, 2944,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_less() { // Text: gccttaacattattacgccta\0 let bwt_vec = b"attattcaggaccc\0ctttcaa"; let mut less_correct = vec![0; 256]; less_correct[1..='a' as usize] .iter_mut() .for_each(|c| *c = 1); less_correct['b' as usize..='c' as usize] ...
rust_cleaned_test_functions.jsonl/51327
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 447 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 50747, 368, 341, 286, 442, 2918, 25, 22122, 302, 2565, 580, 1587, 1587, 580, 20669, 77519, 59, 15, 198, 286, 1077, 293, 9306, 13251, 284, 293, 1, 1587, 1587, 66, 15718, 580, 638, 59, 15, 302, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_title_file_io() { let tempfile = "tmp.csv"; let titles_expected = vec![ Title { id: 0, ns: 0, name: "a".to_string(), }, Title { id: 1, ns: 0, name: ...
rust_cleaned_test_functions.jsonl/43821
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 540 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6112, 2458, 16939, 368, 341, 286, 1077, 54819, 284, 330, 5173, 11219, 876, 286, 1077, 15311, 32190, 284, 7486, 90515, 310, 10869, 341, 394, 877, 25, 220, 15, 345, 394, 12268, 25, 220, 15, 345, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_y_then_z() { let vec = vec3(0.0f32, 0.0f32, 1.0f32); let rot = Quaternion::from(Euler::new(Deg(0.0), Deg(90.0), Deg(90.0))); assert_ulps_eq!(vec3(1.0, 0.0, 0.0), rot * vec); }
rust_cleaned_test_functions.jsonl/38263
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 135 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 4178, 68367, 6415, 368, 341, 286, 1077, 7486, 284, 7486, 18, 7, 15, 13, 15, 69, 18, 17, 11, 220, 15, 13, 15, 69, 18, 17, 11, 220, 16, 13, 15, 69, 18, 17, 626, 286, 1077, 5749, 284, 248...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_parsing_with_quoted_string() { let result = parse_statement("INSERT INTO test set k='test';").unwrap(); let result = parse_statement("INSERT INTO test set k='test my ''friend''';").unwrap(); }
rust_cleaned_test_functions.jsonl/114445
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 91 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 620, 28598, 6615, 11280, 9253, 3904, 368, 341, 286, 1077, 1102, 284, 4715, 37404, 445, 12698, 12496, 1273, 738, 595, 1131, 1944, 6967, 1827, 15454, 543, 286, 1077, 1102, 284, 4715, 37404, 445, 126...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_struct_equal_null() { let strings: ArrayRef = Arc::new(StringArray::from(vec![ Some("joe"), None, None, Some("mark"), Some("doe"), ])); let ints: ArrayRef = Arc::new(Int32Array::from(vec![ Some(1), ...
rust_cleaned_test_functions.jsonl/24229
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1768 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 15126, 11478, 15162, 368, 341, 286, 1077, 9069, 25, 2910, 3945, 284, 19689, 486, 931, 2242, 1857, 486, 1499, 25592, 90515, 310, 4329, 445, 73, 4644, 4461, 310, 2240, 345, 310, 2240, 345, 310, 43...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_find_matching_closing_symbol_multiline() { let doc = Document::new( vec![ Row::from("fn test() {"), Row::from(" return 2;"), Row::from("};"), ], PathBuf::from("test.txt"), ); assert_eq!( Navigator::find_matching_clo...
rust_cleaned_test_functions.jsonl/52827
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 455 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21814, 70763, 666, 17831, 21179, 26290, 26560, 368, 341, 262, 1077, 4629, 284, 11789, 486, 931, 1006, 286, 7486, 90515, 310, 10801, 486, 1499, 445, 8822, 1273, 368, 314, 4461, 310, 10801, 486, 149...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_padding() { let mut buffer = buffer(); assert!(buffer.enqueue(6, ()).is_ok()); assert!(buffer.enqueue(8, ()).is_ok()); assert!(buffer.dequeue().is_ok()); buffer.enqueue(4, ()).unwrap().copy_from_slice(b"abcd"); assert_eq!(buffer.metadata_ring.len()...
rust_cleaned_test_functions.jsonl/101976
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 232 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 40726, 368, 341, 286, 1077, 5206, 4147, 284, 4147, 543, 286, 2060, 10297, 7573, 47468, 7, 21, 11, 1719, 568, 285, 19817, 1423, 286, 2060, 10297, 7573, 47468, 7, 23, 11, 1719, 568, 285, 19817, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_to_bool_str() { let val: ScalarCow<'_> = "foobar".into(); assert_eq!(val.to_bool(), None); let val: ScalarCow<'_> = "true".into(); assert_eq!(val.to_bool(), None); let val: ScalarCow<'_> = "false".into(); assert_eq!(val.to_bool(), None); }
rust_cleaned_test_functions.jsonl/108138
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 159 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2346, 22159, 2895, 368, 341, 286, 1077, 1044, 25, 35176, 89915, 18291, 98377, 284, 330, 50267, 3263, 18122, 543, 286, 2060, 10714, 10297, 831, 2389, 22159, 1507, 2240, 626, 286, 1077, 1044, 25, 35...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_is_not_id_continue() { let chars = [ '\x00', '\x01', ' ', '[', '<', '{', '(', '\u{02c2}', '\u{ffff}', ]; for &ch in &chars { assert!(!super::UnicodeID::is_id_continue(ch), "{}", ch); } }
rust_cleaned_test_functions.jsonl/103069
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 133 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6892, 7913, 842, 75297, 368, 341, 262, 1077, 23000, 284, 2278, 286, 5196, 87, 15, 15, 516, 5196, 87, 15, 16, 516, 364, 6614, 18309, 516, 3857, 516, 11573, 516, 364, 13749, 5196, 84, 90, 15, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_construct_twitter_search_url() { let fake_query = "hello world"; assert_eq!( construct_twitter_search_url(fake_query), "https://twitter.com/search?q=hello%20world" ); }
rust_cleaned_test_functions.jsonl/125791
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 119 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 64803, 83338, 10716, 2903, 368, 341, 286, 1077, 12418, 5738, 284, 330, 14990, 1879, 876, 286, 2060, 10714, 33673, 310, 9245, 83338, 10716, 2903, 74138, 5738, 1326, 310, 330, 2428, 1110, 14679, 905, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_merge_filters() { let mut ctx1 = ScmpFilterContext::new_filter(ScmpAction::Allow).unwrap(); let mut ctx2 = ScmpFilterContext::new_filter(ScmpAction::Allow).unwrap(); let native_arch = get_native_arch().unwrap(); let mut prospective_arch = ScmpArch::Aarch64; ...
rust_cleaned_test_functions.jsonl/66425
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 328 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 20888, 22481, 368, 341, 286, 1077, 5206, 5635, 16, 284, 2463, 1307, 5632, 1972, 486, 931, 8727, 7, 3326, 1307, 2512, 486, 18605, 568, 15454, 543, 286, 1077, 5206, 5635, 17, 284, 2463, 1307, 5632...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_unterminated_varint() { let buf = vec![0xff as u8; 12]; let mut read = buf.as_slice(); assert!(read.read_varint::<u64>().is_err()); }
rust_cleaned_test_functions.jsonl/80010
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 94 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 4907, 68659, 4612, 396, 368, 341, 286, 1077, 6607, 284, 7486, 20703, 15, 9020, 438, 575, 23, 26, 220, 16, 17, 935, 286, 1077, 5206, 1349, 284, 6607, 5357, 26488, 543, 286, 2060, 10297, 878, 41...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_from_bytes() { let bitv = Bitv::from_bytes(&[0b10110110, 0b00000000, 0b11111111]); let str = concat!("10110110", "00000000", "11111111"); assert_eq!(format!("{:?}", bitv), str); }
rust_cleaned_test_functions.jsonl/119286
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 111 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 5673, 12524, 368, 341, 286, 1077, 2699, 85, 284, 6495, 85, 486, 1499, 12524, 2099, 58, 15, 65, 16, 15, 16, 16, 15, 16, 16, 15, 11, 220, 15, 65, 15, 15, 15, 15, 15, 15, 15, 15, 11, 220,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_connect() { let mut data: &[u8] = &[ 0b00010000, 39, 0x00, 0x04, 'M' as u8, 'Q' as u8, 'T' as u8, 'T' as u8, 0x04, 0b11001110, 0x00, 0x0a, // 10 sec 0x00, 0x04, 't' as u8, 'e' as u8, 's' as u8, 't' as u8, // client_id 0x00, 0x02, '/' as u8, 'a' as u8,...
rust_cleaned_test_functions.jsonl/77898
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 671 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 15720, 368, 341, 262, 1077, 5206, 821, 25, 44590, 84, 23, 60, 284, 609, 9640, 286, 220, 15, 65, 15, 15, 15, 16, 15, 15, 15, 15, 11, 220, 18, 24, 11, 220, 15, 87, 15, 15, 11, 220, 15, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_zero_page_wrapping() { let mut memory = MemoryMap::builder().ram(0x0000, 0xFFFF).build(); let mut registers = Registers::new(); registers.x = 0xFF; // Write some test data to key addresses memory.write().byte(0x0000, 101); memory.write().byte(0x01...
rust_cleaned_test_functions.jsonl/51240
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 266 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 19359, 6129, 44074, 3629, 368, 341, 286, 1077, 5206, 4938, 284, 13850, 2227, 486, 17850, 1005, 2396, 7, 15, 87, 15, 15, 15, 15, 11, 220, 15, 14384, 568, 5834, 543, 286, 1077, 5206, 24740, 284,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_function_like() { let function: ItemFn = parse_quote!( fn f(a: u8) -> Result<()> {} ); let method: ImplItemMethod = parse_quote!( fn f(a: u8) -> Result<()> {} ); assert_eq!(quote!(#function).to_string(), quote!(#method).to_string())...
rust_cleaned_test_functions.jsonl/64602
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 167 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 9174, 25535, 368, 341, 286, 1077, 729, 25, 5739, 24911, 284, 4715, 45236, 33673, 310, 5168, 282, 2877, 25, 575, 23, 8, 1464, 5714, 71698, 5613, 286, 1439, 286, 1077, 1714, 25, 88092, 1234, 3523,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_from_auth_db_error() { let err = TokenManagerError::from(AuthDbError::CredentialNotFound); let err_fatal = TokenManagerError::from(AuthDbError::DbInvalid); assert_eq!( (format!("{:?}", err.cause.as_ref().unwrap()), err.fatal, err.status), ("credent...
rust_cleaned_test_functions.jsonl/7175
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 281 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 5673, 14014, 8685, 4096, 368, 341, 286, 1077, 1848, 284, 9660, 2043, 1454, 486, 1499, 37640, 7994, 1454, 486, 48265, 10372, 317, 286, 1077, 1848, 92188, 284, 9660, 2043, 1454, 486, 1499, 37640, 79...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_target() { assert_eq!(parse_target("329 ok"), Ok((" ok", Target::Literal(329)))); assert_eq!(parse_target("-1 ok"), Ok((" ok", Target::Literal(-1)))); assert_eq!(parse_target("+9999 ok"), Ok((" ok", Target::Literal(9999)))); assert_eq!( parse_target("...
rust_cleaned_test_functions.jsonl/987
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 270 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 11123, 368, 341, 286, 2060, 10714, 10297, 6400, 11123, 445, 18, 17, 24, 5394, 3975, 7622, 30873, 5394, 497, 13483, 486, 17350, 7, 18, 17, 24, 38776, 286, 2060, 10714, 10297, 6400, 11123, 13645, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_disjoint() { let mut xs = HashSet::new(); let mut ys = HashSet::new(); assert!(xs.par_is_disjoint(&ys)); assert!(ys.par_is_disjoint(&xs)); assert!(xs.insert(5)); assert!(ys.insert(11)); assert!(xs.par_is_disjoint(&ys)); assert!(ys.p...
rust_cleaned_test_functions.jsonl/28366
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 382 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 9932, 32850, 368, 341, 286, 1077, 5206, 11943, 284, 18931, 486, 931, 543, 286, 1077, 5206, 31810, 284, 18931, 486, 931, 543, 286, 2060, 10297, 18561, 33277, 6892, 9932, 32850, 2099, 1047, 1106, 28...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_ipv4() { assert_eq!( encode( ProxyCommand::Proxy, ProxyTransportProtocol::Stream, ProxyAddresses::Ipv4 { source: SocketAddrV4::new(Ipv4Addr::new(1, 2, 3, 4), 65535), destination: SocketAdd...
rust_cleaned_test_functions.jsonl/124007
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1396 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 49378, 19, 368, 341, 286, 2060, 10714, 33673, 310, 16164, 1006, 394, 32778, 4062, 486, 16219, 345, 394, 32778, 27560, 20689, 486, 3027, 345, 394, 32778, 52290, 486, 80656, 19, 341, 503, 2530, 25, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_chained_write_bit() { let mut val: u32 = 1 << 12; val.write_bit(5, true) .write_bit(10, true) .write_bit(15, true) .write_bit(12, false); assert!(val == 1 << 5 | 1 << 10 | 1 << 15); }
rust_cleaned_test_functions.jsonl/4117
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 152 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 4138, 2627, 9165, 13996, 368, 341, 286, 1077, 5206, 1044, 25, 575, 18, 17, 284, 220, 16, 1115, 220, 16, 17, 401, 286, 1044, 3836, 13996, 7, 20, 11, 830, 340, 310, 659, 4934, 13996, 7, 16, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_seal_open_tamper() { use randombytes::randombytes; for i in 0..32usize { let k = gen_key(); let m = randombytes(i); let n = gen_nonce(); let mut c = seal(&m, &n, &k); for i in 0..c.len() { c[i] ^= 0x20; ...
rust_cleaned_test_functions.jsonl/132936
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 277 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 3453, 278, 11311, 528, 309, 712, 368, 341, 286, 990, 4194, 9651, 486, 11463, 9651, 280, 286, 369, 600, 304, 220, 15, 496, 18, 17, 51878, 341, 310, 1077, 595, 284, 4081, 3097, 543, 310, 1077, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_team_serialization() { let o = Team::Orange; assert_eq!(r#""Orange""#, encode(&o)); let b = Team::Blue; assert_eq!(r#""Blue""#, encode(&b)); }
rust_cleaned_test_functions.jsonl/36141
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 103 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 26532, 25602, 2022, 368, 341, 286, 1077, 297, 284, 7909, 486, 41969, 280, 286, 2060, 10714, 10297, 81, 2, 3014, 41969, 3014, 60778, 16164, 2099, 78, 3237, 286, 1077, 293, 284, 7909, 486, 10331, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_type_at_beginning() { let (mut ime, statechan, _actionchan) = set_up("cde", 0, 0); simulate_keypress(&mut ime, 'a', false, false); let state = statechan.try_recv().unwrap(); assert_eq!(2, state.revision); assert_eq!("acde", state.text); assert_eq!...
rust_cleaned_test_functions.jsonl/54280
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 318 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 1819, 3752, 23338, 1229, 368, 341, 286, 1077, 320, 6984, 74434, 11, 1584, 5658, 11, 716, 1311, 5658, 8, 284, 738, 8237, 445, 66, 450, 497, 220, 15, 11, 220, 15, 626, 286, 37453, 3097, 1873, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_reqopt_multi() { let args = vec!("--test=20".to_string(), "-t".to_string(), "30".to_string()); let opts = vec!(reqopt("t", "test", "testing", "TEST")); let rs = getopts(args.as_slice(), opts.as_slice()); match rs { Err(OptionDuplicated(_)) => {}, ...
rust_cleaned_test_functions.jsonl/11178
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 177 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 17644, 2912, 25133, 368, 341, 286, 1077, 2827, 284, 7486, 17223, 313, 1944, 28, 17, 15, 3263, 983, 3904, 1507, 6523, 83, 3263, 983, 3904, 1507, 330, 18, 15, 3263, 983, 3904, 1423, 286, 1077, 1...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_tuple() { let data = "{type=\"breakpoint\"}"; let result = Value::Tuple(TupleValue::Data(vec![Variable( "type", Value::Const(Cow::from("breakpoint")), )])); do_test_result!(data, tuple_value(data), ("", result)) }
rust_cleaned_test_functions.jsonl/74248
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 146 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21773, 368, 341, 286, 1077, 821, 284, 13868, 1313, 4070, 8960, 2768, 2105, 26259, 286, 1077, 1102, 284, 5162, 486, 28681, 4140, 6061, 1130, 486, 1043, 25592, 20703, 7827, 1006, 310, 330, 1313, 756...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_double_partition() { // Init state let mut vote_simulator = VoteSimulator::new(2); let node_pubkey = vote_simulator.node_pubkeys[0]; let vote_pubkey = vote_simulator.vote_pubkeys[0]; let mut tower = Tower::default(); let num_slots_to_try = 200; ...
rust_cleaned_test_functions.jsonl/61122
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1892 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 24598, 43840, 368, 341, 286, 442, 15690, 1584, 198, 286, 1077, 5206, 6910, 18314, 10511, 284, 34034, 14027, 10511, 486, 931, 7, 17, 317, 286, 1077, 2436, 34014, 792, 284, 6910, 18314, 10511, 12097...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_structured_append() { let data = "I read the news today oh boy".as_bytes(); let data_half = "I read the new".as_bytes(); let parity = data.iter().fold(0u8, |acc, &x| acc ^ x); let mut bits = Bits::new(Version::Normal(1)); bits.push_mode_indicator(ExtendedM...
rust_cleaned_test_functions.jsonl/81035
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 387 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 15126, 3073, 26041, 368, 341, 286, 1077, 821, 284, 330, 40, 1349, 279, 3669, 3351, 14019, 8171, 3263, 300, 12524, 543, 286, 1077, 821, 40626, 284, 330, 40, 1349, 279, 501, 3263, 300, 12524, 543,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_parse_error() { let data = Vec::from("-Error\r\n"); let ParseResult { value, value_src_len } = parse_resp_value(data.as_slice()).unwrap().unwrap(); assert_eq!(RespInternalValue::Error("Error".to_string()), value); assert_eq!(data.len(), value_src_len)...
rust_cleaned_test_functions.jsonl/85366
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 241 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21039, 4096, 368, 341, 286, 1077, 821, 284, 11312, 486, 1499, 13645, 1454, 12016, 1699, 797, 286, 1077, 14775, 2077, 314, 897, 11, 897, 16274, 6043, 456, 310, 284, 4715, 35160, 3142, 2592, 5357, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_to_lines() { let buffer = setup_buffer("Test\nA\nTest"); let mut lines = buffer.lines(); assert_eq!(lines.next().unwrap(), [b'T',b'e',b's',b't',b'\n']); assert_eq!(lines.next().unwrap(), [b'A',b'\n']); assert_eq!(lines.next().unwrap(), [b'T',b'e',b's',b't...
rust_cleaned_test_functions.jsonl/94762
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 171 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2346, 18323, 368, 341, 286, 1077, 4147, 284, 6505, 7776, 445, 2271, 1699, 32, 1699, 2271, 797, 286, 1077, 5206, 5128, 284, 4147, 44061, 1428, 286, 2060, 10714, 10297, 7969, 4529, 1005, 15454, 1507...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_finalize_record_handler_record_already_final() { let mut transaction_context = MockTransactionContext::default(); transaction_context.add_schema(); transaction_context.add_agent(PUBLIC_KEY); transaction_context.add_finalized_record(); let mut state = Trac...
rust_cleaned_test_functions.jsonl/32551
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 385 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 70616, 14192, 10183, 14192, 80772, 20676, 368, 341, 286, 1077, 5206, 7745, 8467, 284, 14563, 8070, 1972, 486, 2258, 543, 286, 7745, 8467, 1364, 25371, 543, 286, 7745, 8467, 1364, 25730, 5304, 17153,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_validate_non_genesis_write_set() { let (config, keypair) = get_test_config(); let vm_validator = TestValidator::new(&config); let address = account_config::association_address(); let signed_txn = transaction_test_helpers::get_write_set_txn( address, 0, ke...
rust_cleaned_test_functions.jsonl/90971
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 287 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 42681, 21637, 16322, 13774, 9165, 2602, 368, 341, 262, 1077, 320, 1676, 11, 1376, 12670, 8, 284, 633, 4452, 5332, 543, 262, 1077, 10995, 64959, 284, 3393, 14256, 486, 931, 2099, 1676, 626, 262, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_anyo_2() { let query = proto_vulcan_query!(|q| { anyo { conde { 1 == q, 2 == q, 3 == q, } } }); let mut iter = query.run(); assert_eq!(iter.next().u...
rust_cleaned_test_functions.jsonl/14019
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 354 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 37248, 78, 62, 17, 368, 341, 286, 1077, 3239, 284, 18433, 2273, 360, 4814, 5738, 10297, 91, 80, 91, 341, 310, 894, 78, 341, 394, 390, 450, 341, 503, 220, 16, 621, 2804, 345, 503, 220, 17, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_security_report_type_deserializer_recognizes_csp_reports() { let csp_report_text = r#"{ "csp-report": { "document-uri": "https://example.com/foo/bar", "referrer": "https://www.google.com/", "violated-directive": "default-src sel...
rust_cleaned_test_functions.jsonl/4041
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 328 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 48726, 14813, 1819, 15768, 41939, 7080, 3934, 4756, 666, 2154, 64423, 368, 341, 286, 1077, 272, 2154, 14813, 4326, 284, 435, 55543, 515, 310, 330, 66, 2154, 47411, 788, 341, 394, 330, 6062, 87232,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_ver_to_max_block_set_count() { { assert_eq!(None, ver_to_max_block_set_count(Version::V1, None)); assert_eq!(None, ver_to_max_block_set_count(Version::V2, None)); assert_eq!(None, ver_to_max_block_set_count(Version::V3, None)); } { assert_eq!( ...
rust_cleaned_test_functions.jsonl/107027
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1069 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 26042, 2346, 6345, 7113, 2602, 3180, 368, 341, 262, 341, 286, 2060, 10714, 10297, 4064, 11, 2739, 2346, 6345, 7113, 2602, 3180, 7, 5637, 486, 53, 16, 11, 2240, 1106, 286, 2060, 10714, 10297, 406...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_brackets_1() { assert_eq!(eval("(5) + (min(3, 4, 5)) + 20"), Ok(to_value(28))); }
rust_cleaned_test_functions.jsonl/28404
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 65 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 17682, 18382, 62, 16, 368, 341, 286, 2060, 10714, 10297, 14170, 31732, 20, 8, 488, 320, 1065, 7, 18, 11, 220, 19, 11, 220, 20, 593, 488, 220, 17, 15, 3975, 7622, 12186, 3142, 7, 17, 23, 49...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_date_format_day() { let scene = TestScenario::new(util_name!()); let mut result = scene.ucmd().arg("+%a").succeeds(); assert!(result.success); let mut re = Regex::new(r"\S+").unwrap(); assert!(re.is_match(&result.stdout.trim())); result = scene.ucmd().arg("+%A").succee...
rust_cleaned_test_functions.jsonl/25495
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 274 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 4164, 8955, 16763, 368, 341, 262, 1077, 6109, 284, 3393, 54031, 486, 931, 67811, 1269, 0, 5231, 262, 1077, 5206, 1102, 284, 6109, 56334, 2277, 1005, 858, 34973, 4, 64, 1827, 82, 29264, 82, 1428,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_components_iter() { macro_rules! t( (s: $path:expr, $exp:expr) => ( { let path = Path::new($path); let comps = path.components().collect::<Vec<&[u8]>>(); let exp: &[&str] = $exp; l...
rust_cleaned_test_functions.jsonl/7698
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1250 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 23258, 11723, 368, 341, 286, 18072, 21407, 0, 259, 1006, 310, 320, 82, 25, 400, 2343, 96011, 11, 400, 4580, 96011, 8, 589, 2399, 394, 341, 503, 1077, 1815, 284, 7933, 486, 931, 699, 2343, 317,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_hour() { assert_eq!(hour("hours"), Ok(("", "hours"))); assert_eq!(hour("hour"), Ok(("", "hour"))); assert_eq!(hour("h"), Ok(("", "h"))); }
rust_cleaned_test_functions.jsonl/71141
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 113 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 32292, 368, 341, 310, 2060, 10714, 10297, 24677, 445, 30382, 3975, 7622, 7, 19814, 330, 30382, 17621, 310, 2060, 10714, 10297, 24677, 445, 24677, 3975, 7622, 7, 19814, 330, 24677, 17621, 310, 2060, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_switch_github_issue1234() { test_same(concat!( "var x;", "switch ('a') {", " case 'a':", " break;", " default:", " x = 1;", " break;", "}", "use(x);", )); }
rust_cleaned_test_functions.jsonl/27733
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 170 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 27652, 1889, 3827, 53340, 16, 17, 18, 19, 368, 341, 262, 1273, 33574, 96360, 33673, 286, 330, 947, 856, 64497, 286, 330, 17338, 4319, 64, 863, 314, 756, 286, 330, 220, 1142, 364, 64, 1210, 756...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_subtract_bad_stack() { let mut vm = ShrekVM::new(Vec::new()); vm.push(3); assert!(subtract(&mut vm).is_err()); }
rust_cleaned_test_functions.jsonl/71697
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 87 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 5228, 2144, 34199, 15528, 368, 341, 286, 1077, 5206, 10995, 284, 1417, 41861, 11187, 486, 931, 49923, 486, 931, 1423, 286, 10995, 2552, 7, 18, 317, 286, 2060, 10297, 59442, 2099, 6984, 10995, 568,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_covariance_consistent_with_variance() { let mut data = testing::load_data("nist/lottery.txt"); assert_almost_eq!((&data).variance(), (&data).covariance(&data), 1e-10); data = testing::load_data("nist/lew.txt"); assert_almost_eq!((&data).variance(), (&data).covari...
rust_cleaned_test_functions.jsonl/55246
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 338 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 50028, 36905, 31971, 18128, 6615, 77450, 368, 341, 286, 1077, 5206, 821, 284, 7497, 486, 1078, 1769, 445, 64759, 14, 9184, 17615, 3909, 797, 286, 2060, 94418, 10714, 0, 42902, 691, 568, 947, 5284,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_activate_for_success() { let a_0 = agent::ZeroAgent::new("tcp://127.0.0.1:1234".to_string()); let ths = a_0.activate(); thread::sleep(time::Duration::from_millis(2 * agent::WAIT)); send_kill("tcp://127.0.0.1:1234"); ths.0.join().unwrap(); ths.1.joi...
rust_cleaned_test_functions.jsonl/104676
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 172 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 67894, 5478, 18632, 368, 341, 286, 1077, 264, 62, 15, 284, 8315, 486, 17999, 16810, 486, 931, 445, 27161, 1110, 16, 17, 22, 13, 15, 13, 15, 13, 16, 25, 16, 17, 18, 19, 3263, 983, 3904, 142...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_document_from_mg_mval_mmol_with_text() { let it = doc! { KEY_MG: ">0.01", KEY_MVAL: ">0.01", KEY_MMOL: "--", KEY_MVAL_PERCENT: "" }; let r = MgMvalMmol::try_from(&it); assert!(r.is_ok()); assert_eq!(r.unwrap(...
rust_cleaned_test_functions.jsonl/16362
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 332 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 26231, 5673, 717, 70, 717, 831, 35599, 337, 6615, 4326, 368, 341, 286, 1077, 432, 284, 4629, 0, 341, 310, 12013, 1245, 38, 25, 28957, 15, 13, 15, 16, 756, 310, 12013, 1245, 5594, 25, 28957, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_load_by_program() { let paths = get_tmp_accounts_path!(); let accounts_db = AccountsDB::new(0, &paths.paths); // Load accounts owned by various programs into AccountsDB let pubkey0 = Pubkey::new_rand(); let account0 = Account::new(1, 0, &Pubkey::new(&[2; ...
rust_cleaned_test_functions.jsonl/77676
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 679 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 12411, 3710, 25096, 368, 341, 286, 1077, 12716, 284, 633, 16125, 55665, 2638, 0, 543, 286, 1077, 9618, 8685, 284, 40655, 3506, 486, 931, 7, 15, 11, 609, 21623, 65345, 626, 286, 442, 8893, 9618, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_load_malformed_file() { let temp_dir = tempfile::tempdir_in("/data").expect("failed to create the temp dir"); let path = temp_dir.path().join("net.config.json"); { let mut file = fs::File::create(&path).expect("failed to open file for writing"); //...
rust_cleaned_test_functions.jsonl/49774
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 350 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 12411, 717, 278, 10155, 2458, 368, 341, 286, 1077, 2730, 4334, 284, 54819, 486, 3888, 3741, 1243, 4283, 691, 1827, 17119, 445, 16091, 311, 1855, 279, 2730, 5419, 797, 286, 1077, 1815, 284, 2730, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_f32x4_except_second_not_all() { let x1 = f32x4::new(1.0, 2.0, 2.0, 2.0); let x2 = f32x4::splat(2.0); assert!(!(x1.eq(x2)).all()); }
rust_cleaned_test_functions.jsonl/43326
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 115 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 761, 18, 17, 87, 19, 54633, 29644, 7913, 5705, 368, 341, 286, 1077, 856, 16, 284, 282, 18, 17, 87, 19, 486, 931, 7, 16, 13, 15, 11, 220, 17, 13, 15, 11, 220, 17, 13, 15, 11, 220, 17, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_method_pass_pod_by_reference() { let cxx = indoc! {" uint32_t Bob::get_bob(const Anna&) const { return a; } "}; let hdr = indoc! {" #include <cstdint> struct Anna { uint32_t a; }; struct Bob { public: ...
rust_cleaned_test_functions.jsonl/9767
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 369 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 9032, 15464, 85337, 3710, 25433, 368, 341, 262, 1077, 272, 4146, 284, 1257, 509, 0, 314, 698, 286, 2622, 18, 17, 528, 14261, 486, 455, 880, 674, 2741, 23223, 33484, 733, 341, 310, 470, 264, 28...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_filtered_query() { let mut schema = Schema::new(); let the_field = schema.add_field("the".to_string(), FieldType::Text, FIELD_INDEXED).unwrap(); let query = parse(&serde_json::from_str(" { \"query\": { \"term\": { \...
rust_cleaned_test_functions.jsonl/121944
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 591 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 51429, 5738, 368, 341, 286, 1077, 5206, 10802, 284, 12539, 486, 931, 543, 286, 1077, 279, 5013, 284, 10802, 1364, 5013, 445, 1782, 3263, 983, 3904, 1507, 84614, 486, 1178, 11, 40278, 14515, 1479, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_encoding_extendedpubkey() { static EXT_PUBKEY1: [u8; 78] = [ 4, 136, 178, 30, 0, 0, 0, 0, 0, 0, 0, 0, 0, 135, 61, 255, 129, 192, 47, 82, 86, 35, 253, 31, 229, 22, 126, 172, 58, 85, 160, 73, 222, 61, 49, 75, 180, 46, 226, 39, 255, 237, 55, 213, 8, 3, 57...
rust_cleaned_test_functions.jsonl/43976
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 923 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 37613, 61678, 9585, 792, 368, 341, 286, 1099, 33757, 1088, 4493, 4784, 16, 25, 508, 84, 23, 26, 220, 22, 23, 60, 284, 2278, 310, 220, 19, 11, 220, 16, 18, 21, 11, 220, 16, 22, 23, 11, 22...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_handle_truncate() { let mut ctx = EvalContext::new(Arc::new(EvalConfig::new(0).unwrap())); assert!(ctx.handle_truncate(false).is_ok()); assert!(ctx.handle_truncate(true).is_err()); assert!(ctx.take_warnings().warnings.is_empty()); // ignore_trunca...
rust_cleaned_test_functions.jsonl/55217
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 418 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 10630, 3547, 26900, 368, 341, 1789, 286, 1077, 5206, 5635, 284, 58239, 1972, 486, 931, 4346, 1287, 486, 931, 10722, 831, 2648, 486, 931, 7, 15, 568, 15454, 7392, 286, 2060, 10297, 3773, 10132, 3...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_serde_to_online_config() { let cases = vec![ ( "raftstore.store_pool_size", "raft_store.store_batch_system.pool_size", ), ( "raftstore.store-pool-size", "raft_store.store_batch_system.pool...
rust_cleaned_test_functions.jsonl/2177
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1210 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 75861, 450, 2346, 51546, 5332, 368, 341, 286, 1077, 5048, 284, 7486, 90515, 310, 2399, 394, 330, 2944, 4314, 16114, 15709, 2368, 756, 394, 330, 2944, 14809, 16114, 14534, 17687, 38963, 2368, 756, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_deinitialize_cancels_timers() { // Test that associated timers are cancelled when the NDP device // is deinitialized. set_logger_for_test(); let mut ctx = DummyEventDispatcherBuilder::default().build::<DummyEventDispatcher>(); let dev_id = ctx ...
rust_cleaned_test_functions.jsonl/82795
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 547 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2259, 21641, 666, 1129, 2010, 29087, 388, 368, 341, 286, 442, 3393, 429, 5815, 44522, 525, 25681, 979, 279, 53650, 3671, 198, 286, 442, 374, 409, 36161, 382, 286, 738, 27413, 5478, 4452, 543, 28...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_channel() { let mut channel = TestChannel::new(); let msg_view = StringView::from(MESSAGE); channel.send_response(999, StringBuffer::create(msg_view)); assert_eq!(CALL_COUNT.swap(0, SeqCst), 1); channel.send_notification(StringBuffer::create(msg_view)); assert_eq!(CALL_CO...
rust_cleaned_test_functions.jsonl/73771
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 188 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 14571, 368, 341, 262, 1077, 5206, 5496, 284, 3393, 9629, 486, 931, 543, 262, 1077, 3750, 7122, 284, 923, 851, 486, 1499, 3189, 11963, 317, 262, 5496, 5219, 9655, 7, 24, 24, 24, 11, 29891, 486,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_prec_limit_exceeded_with_exp() { let res = Decimal::<3>::from_str("17.4e-3"); assert!(res.is_err()); let err = res.unwrap_err(); assert_eq!(err, ParseDecimalError::PrecLimitExceeded); }
rust_cleaned_test_functions.jsonl/12026
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 125 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 59179, 14763, 2702, 94206, 6615, 14214, 368, 341, 286, 1077, 592, 284, 26728, 27638, 18, 6831, 1499, 2895, 445, 16, 22, 13, 19, 68, 12, 18, 797, 286, 2060, 10297, 416, 2079, 9266, 1423, 286, 1...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_online() { let table = EmojiTable::load_online((13, 0)).unwrap(); let kissing_face = vec![0x1f617]; let smiling_face = vec![0x263a, 0xfe0f]; let woman_medium_skin_tone_white_hair = vec![0x1f469, 0x1f3fd, 0x200d, 0x1f9b3]; assert_eq!(table.get_codepoint_by_name("kissing face...
rust_cleaned_test_functions.jsonl/23130
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 457 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 51546, 368, 341, 262, 1077, 1965, 284, 82367, 2556, 486, 1078, 51546, 1188, 16, 18, 11, 220, 15, 4579, 15454, 1428, 262, 1077, 51046, 30985, 284, 7486, 20703, 15, 87, 16, 69, 21, 16, 22, 935, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_query_matches_with_immediate_siblings() { allocations::record(|| { let language = get_language("python"); // The immediate child operator '.' can be used in three similar ways: // named siblings before that child node. // sibling after...
rust_cleaned_test_functions.jsonl/25156
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1411 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 5738, 38344, 6615, 17895, 14636, 643, 24229, 368, 341, 262, 69642, 486, 8548, 79453, 341, 286, 1077, 4128, 284, 633, 29021, 445, 12669, 3071, 286, 442, 576, 13922, 1682, 5675, 24361, 646, 387, 148...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_enrich_url() { let req = test::TestRequest::with_uri("https://example.com/q/?q=5").to_http_request(); let url = Url::from_str("https://result.com/"); let result = enrich_url(url.unwrap(), &req); assert_eq!(result.into_string(), "https://result.com/q/?q=5"); }
rust_cleaned_test_functions.jsonl/68784
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 124 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6205, 13851, 2903, 368, 341, 262, 1077, 4232, 284, 1273, 486, 2271, 1900, 486, 4197, 15572, 445, 2428, 1110, 8687, 905, 33894, 17763, 80, 28, 20, 1827, 983, 25888, 7893, 543, 262, 1077, 2515, 28...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_slices_vec_deque() { for first in 0..10 { let mut v = VecDeque::with_capacity(10); for i in 0..first { v.push_back(i); } for i in first..10 { v.push_back(i - first); } v.drain(..first)...
rust_cleaned_test_functions.jsonl/20429
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 749 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 87288, 13251, 2259, 591, 368, 341, 286, 369, 1156, 304, 220, 15, 496, 16, 15, 341, 310, 1077, 5206, 348, 284, 11312, 73891, 486, 4197, 35603, 7, 16, 15, 317, 310, 369, 600, 304, 220, 15, 496...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
8
#[test] fn test_ease_in_out_cubic() { assert_eq!(ease(ease_in_out_cubic, 1.0, 0.0, 1.0), 0.0); assert_eq!(ease(ease_in_out_cubic, 1.0, 0.0, 0.25), 0.9375); }
rust_cleaned_test_functions.jsonl/40068
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 118 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2204, 519, 1243, 6068, 666, 41181, 368, 341, 286, 2060, 10714, 10297, 46614, 2026, 519, 1243, 6068, 666, 41181, 11, 220, 16, 13, 15, 11, 220, 15, 13, 15, 11, 220, 16, 13, 15, 701, 220, 15, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_set_tracer_provider() { let _ = set_tracer_provider(TestTracerProvider::new("global one")); { let _ = set_tracer_provider(TestTracerProvider::new("inner one")); assert!(format!("{:?}", tracer_provider()).contains("inner one")); } assert!(...
rust_cleaned_test_functions.jsonl/81543
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 180 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2602, 3547, 9584, 29518, 368, 341, 286, 1077, 716, 284, 738, 3547, 9584, 29518, 31159, 1282, 9584, 5179, 486, 931, 445, 9752, 825, 14929, 286, 341, 310, 1077, 716, 284, 738, 3547, 9584, 29518, 3...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_fill_rpool_k1_ok() { let result = fill_rpool( "[\"aa75ca8a2fd3f8af94976bfaa7aa476dc31f5d78d9fef8fb86a97a775f611ae5\"]".to_string(), "[\"031241ac15c9c9c070e1cba1dbdb3992018f9c66f0e50a8d9afbebc510aaf355e7\"]".to_string(), Curve::Secp256k1, "{...
rust_cleaned_test_functions.jsonl/49753
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 577 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 30728, 1710, 10285, 4698, 16, 19817, 368, 341, 286, 1077, 1102, 284, 5155, 1710, 10285, 1006, 310, 10545, 2105, 5305, 22, 20, 924, 23, 64, 17, 6902, 18, 69, 23, 2577, 24, 19, 24, 22, 21, 65,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_get_active_neighbors_count() { let game = Conway3D::from(SAMPLE); assert_eq!(game.get_active_neighbors_count((0, 0, 0).into()), 1); assert_eq!(game.get_active_neighbors_count((1, 1, 0).into()), 5); assert_eq!(game.get_active_neighbors_count((1, 1, 1).into()), 5); ...
rust_cleaned_test_functions.jsonl/90885
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 194 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 3062, 12930, 55925, 3180, 368, 341, 286, 1077, 1809, 284, 59474, 18, 35, 486, 1499, 3759, 18918, 317, 286, 2060, 10714, 10297, 5804, 670, 12930, 55925, 3180, 1188, 15, 11, 220, 15, 11, 220, 15, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_implied_initial_field_value() { new_ucmd!() .args(&["--from=auto", "--field", "-2", "1K 2K 3K"]) .succeeds() .stdout_only("1000 2000 3K\n"); // same as above but with the equal sign new_ucmd!() .args(&["--from=auto", "--field=-2", "1K 2K 3K"]) ...
rust_cleaned_test_functions.jsonl/46021
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 194 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 17895, 3440, 15809, 5013, 3142, 368, 341, 262, 501, 68887, 2277, 0, 741, 286, 659, 2116, 2099, 1183, 313, 1499, 28, 3902, 497, 14482, 2566, 497, 6523, 17, 497, 330, 16, 42, 220, 17, 42, 220, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_introduce_var_return() { check_assist( introduce_variable, " fn foo() -> u32 { <|>return 2 + 2<|>; } ", " fn foo() -> u32 { let <|>var_name = 2 + 2; return var_name; } ", ); }
rust_cleaned_test_functions.jsonl/108762
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 155 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 4042, 47845, 4612, 12511, 368, 341, 286, 1779, 12083, 380, 1006, 310, 19131, 14635, 345, 310, 6228, 8822, 15229, 368, 1464, 575, 18, 17, 341, 262, 82639, 29, 689, 220, 17, 488, 220, 17, 27, 91...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_datetime_lit() { test_walk( "2019-01-01T00:00:00Z", vec!["File", "ExprStmt", "DateTimeLit"], ) }
rust_cleaned_test_functions.jsonl/3334
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 121 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 28943, 98399, 368, 341, 310, 1273, 56131, 1006, 394, 330, 17, 15, 16, 24, 12, 15, 16, 12, 15, 16, 51, 15, 15, 25, 15, 15, 25, 15, 15, 57, 756, 394, 7486, 0, 1183, 1703, 497, 330, 16041, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1