text
stringlengths
93
16.4k
id
stringlengths
20
40
metadata
dict
input_ids
listlengths
45
2.05k
attention_mask
listlengths
45
2.05k
complexity
int64
1
9
#[test] fn test_ignoring_multiple_keys_on_get() { let statement = get_statement!("GET KEY1 KEY2 KEY3"); assert_eq!( statement, Statement { stype: StatementType::Get, key: Some("KEY1".to_owned()), ...
rust_cleaned_test_functions.jsonl/104583
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 229 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 62, 622, 5503, 45233, 12631, 4470, 3062, 368, 341, 310, 1077, 5114, 284, 633, 37404, 17223, 3806, 12013, 16, 12013, 17, 12013, 18, 797, 310, 2060, 10714, 33673, 394, 5114, 345, 394, 21756, 341, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_reqopt_missing() { let args = vec!("blah".to_string()); let opts = vec!(reqopt("t", "test", "testing", "TEST")); let rs = getopts(args.as_slice(), opts.as_slice()); match rs { Err(f) => check_fail_type(f, OptionMissing_), _ => fail!() }...
rust_cleaned_test_functions.jsonl/13309
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 167 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 17644, 2912, 40447, 368, 341, 286, 1077, 2827, 284, 7486, 17223, 70614, 3263, 983, 3904, 1423, 286, 1077, 12185, 284, 7486, 10297, 2958, 2912, 445, 83, 497, 330, 1944, 497, 330, 8840, 497, 330, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_parse() { let image = vec![1, 2, 3, 4, 5, 6, 7, 8]; let layers = parse_space_image_format(&image, 2, 1); assert_eq!(layers.len(), 4); let expectation = vec![vec![1, 2], vec![3, 4], vec![5, 6], vec![7, 8]]; assert_eq!(layers.cmp(&expectation), std::cmp::Or...
rust_cleaned_test_functions.jsonl/10791
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 394 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21039, 368, 341, 286, 1077, 2168, 284, 7486, 20703, 16, 11, 220, 17, 11, 220, 18, 11, 220, 19, 11, 220, 20, 11, 220, 21, 11, 220, 22, 11, 220, 23, 4821, 286, 1077, 13617, 284, 4715, 14663,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_zero_commit_fails() { let keychain = Keychain::from_random_seed().unwrap(); let key_id1 = keychain.derive_key_id(1).unwrap(); // blinding should fail as signing with a zero r*G shouldn't work build::transaction( vec![ input(10, key_id1.clone()), output(9, key_id1.clone()), ...
rust_cleaned_test_functions.jsonl/9522
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 166 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 19359, 36346, 761, 6209, 368, 341, 197, 10217, 1376, 8819, 284, 5309, 8819, 486, 1499, 22644, 33809, 1005, 15454, 543, 197, 10217, 1376, 842, 16, 284, 1376, 8819, 75819, 533, 3097, 842, 7, 16, 5...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_sub_call_system_no_args_allowed() { assert_parser_err!( "SYSTEM 42", QError::syntax_error("Expected: end-of-statement"), 1, 7 ); }
rust_cleaned_test_functions.jsonl/27896
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 157 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 5228, 13429, 17687, 6536, 8384, 42155, 368, 341, 310, 2060, 18517, 9266, 33673, 394, 330, 46487, 220, 19, 17, 756, 394, 1207, 1454, 486, 56193, 4096, 445, 18896, 25, 835, 8668, 5477, 5605, 4461, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_list_attempts_by_msg_query_parameters_validation() { let q: ListAttemptsByMsgQueryParameters = serde_json::from_value(json!({ "event_types": INVALID_EVENT_TYPES })).unwrap(); assert!(q.validate().is_err()); let q: ListAttemptsByMsgQueryParameters = ...
rust_cleaned_test_functions.jsonl/64493
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 461 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2019, 79490, 3710, 6483, 5738, 18263, 19416, 368, 341, 286, 1077, 2804, 25, 1759, 81517, 1359, 6611, 2859, 9706, 4035, 310, 61570, 9455, 486, 1499, 3142, 9304, 0, 2306, 330, 3087, 9763, 788, 32269...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_variance_with_low_d2() { let variance = |x: FisherSnedecor| x.variance().unwrap(); get_value(0.1, 0.1, variance); }
rust_cleaned_test_functions.jsonl/42683
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 80 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 77450, 6615, 23767, 814, 17, 368, 341, 286, 1077, 32273, 284, 760, 87, 25, 35504, 50, 18694, 757, 269, 91, 856, 19526, 5284, 1005, 15454, 543, 286, 633, 3142, 7, 15, 13, 16, 11, 220, 15, 13,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_sub() { let mut a : felem_as_words = [11671922859260663127, 11050707557586042878, 284884720401305268, 17749945728364010941, 8613774818643959860, 145621051382923523]; let mut b : felem_as_words = [9794203289623549276, 7309342082925068282, 1139538881605221074, 15659550692327388916, 1600835...
rust_cleaned_test_functions.jsonl/91329
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 280 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 5228, 368, 341, 262, 1077, 5206, 264, 549, 1152, 3433, 11898, 18981, 284, 508, 16, 16, 21, 22, 16, 24, 17, 17, 23, 20, 24, 17, 21, 15, 21, 21, 18, 16, 17, 22, 11, 220, 16, 16, 15, 20, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_convert_from_biguint() { assert_eq!(BigInt::from(BigUint::zero()), BigInt::zero()); assert_eq!(BigInt::from(BigUint::one()), BigInt::one()); assert_eq!( BigInt::from(BigUint::from_slice(&[1, 2, 3])), BigInt::from_slice(Plus, &[1, 2, 3]) ); }
rust_cleaned_test_functions.jsonl/56627
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 145 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 34910, 5673, 36386, 2496, 368, 341, 262, 2060, 10714, 10297, 87474, 486, 1499, 5349, 343, 21570, 486, 14154, 11858, 62608, 486, 14154, 1423, 262, 2060, 10714, 10297, 87474, 486, 1499, 5349, 343, 215...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_range_inclusive() { assert!(super::range_inclusive(0, 5).eq([0, 1, 2, 3, 4, 5].iter().cloned())); assert!(super::range_inclusive(0, 5) .rev() .eq([5, 4, 3, 2, 1, 0].iter().cloned())); assert_eq!(super::range_inclusive(200, -5).count(), 0); ...
rust_cleaned_test_functions.jsonl/37394
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 420 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 9698, 1243, 8336, 368, 341, 286, 2060, 10297, 9522, 486, 9669, 1243, 8336, 7, 15, 11, 220, 20, 568, 11006, 2561, 15, 11, 220, 16, 11, 220, 17, 11, 220, 18, 11, 220, 19, 11, 220, 20, 936, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_len_with_right_trim() { assert_eq!(len_with_right_trim(b"ATGC\n"), 4); assert_eq!(len_with_right_trim(b"ATGC\r\n"), 4); }
rust_cleaned_test_functions.jsonl/27395
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 93 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6043, 6615, 10539, 70025, 368, 341, 286, 2060, 10714, 10297, 2892, 6615, 10539, 70025, 1883, 1, 828, 22863, 1699, 3975, 220, 19, 317, 286, 2060, 10714, 10297, 2892, 6615, 10539, 70025, 1883, 1, 82...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_digraph_visit() { let mut g = Digraph::new(13); g.add_edge(0, 1); g.add_edge(2, 0); g.add_edge(6, 0); g.add_edge(0, 5); g.add_edge(3, 5); g.add_edge(5, 4); g.add_edge(2, 3); g.add_edge(3, 2); g.add_edge(4, 3); g.add_edge(4, 2); g.add_edge(6, 4);...
rust_cleaned_test_functions.jsonl/66716
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 585 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 814, 53867, 56484, 368, 341, 262, 1077, 5206, 342, 284, 37969, 1935, 486, 931, 7, 16, 18, 317, 262, 342, 1364, 17932, 7, 15, 11, 220, 16, 317, 262, 342, 1364, 17932, 7, 17, 11, 220, 15, 31...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_circuit_error_handler_no_service() { // Set up disptacher and mock sender let sender = Box::new(MockSender::default()); let mut dispatcher = Dispatcher::new(sender.box_clone()); // create empty state let circuit_directory = CircuitDirectory::new(); ...
rust_cleaned_test_functions.jsonl/93795
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 659 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 666, 37268, 4096, 10183, 6536, 12267, 368, 341, 286, 442, 2573, 705, 827, 417, 11007, 323, 7860, 4646, 198, 286, 1077, 4646, 284, 8261, 486, 931, 66436, 20381, 486, 2258, 1423, 286, 1077, 5206, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_c_return() { let shared = ffi::Shared { z: 2020 }; let ns_shared = ffi::AShared { z: 2020 }; let nested_ns_shared = ffi::ABShared { z: 2020 }; assert_eq!(2020, ffi::c_return_primitive()); assert_eq!(2020, ffi::c_return_shared().z); assert_eq!(2020, ffi::c_return_box().0)...
rust_cleaned_test_functions.jsonl/50895
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1082 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 666, 12511, 368, 341, 262, 1077, 6094, 284, 76956, 486, 16997, 314, 1147, 25, 220, 17, 15, 17, 15, 2605, 262, 1077, 12268, 20405, 284, 76956, 486, 1911, 71, 1605, 314, 1147, 25, 220, 17, 15, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
6
#[test] fn test_panic_file() { let mut scan = scanner_from_file("input_file.txt"); let mut out = writer_to_file("output_file.txt"); solve(&mut scan, &mut out); }
rust_cleaned_test_functions.jsonl/129560
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 89 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 620, 31270, 2458, 368, 341, 286, 1077, 5206, 8569, 284, 20775, 5673, 2458, 445, 1355, 2458, 3909, 797, 286, 1077, 5206, 700, 284, 6916, 2346, 2458, 445, 3006, 2458, 3909, 3071, 286, 11625, 2099, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_fill_pdt_interval_sql_errors() { use DateTimeField::*; let test_cases = [ // Invalid syntax ( "1.2", Year, "Invalid syntax at offset 1: provided Dot but expected Dash", ), ( ...
rust_cleaned_test_functions.jsonl/100330
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 579 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 30728, 620, 8047, 20541, 18063, 20196, 368, 341, 286, 990, 6520, 1877, 56162, 286, 1077, 1273, 41427, 284, 2278, 310, 442, 13882, 19482, 198, 310, 2399, 394, 330, 16, 13, 17, 756, 394, 9742, 345...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_multiple_outs_signal_flow() { let mut graph: RouteGraph<S, R> = RouteGraphBuilder::new().with_buffer_size(32).build(); let output = graph.add_node_with_idx(|id| { Node::with_id( id, 1, Box::new(OutputRoute { ...
rust_cleaned_test_functions.jsonl/72322
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1014 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 45233, 6068, 82, 21137, 27441, 368, 341, 286, 1077, 5206, 4771, 25, 9572, 11212, 18858, 11, 431, 29, 284, 9572, 11212, 3297, 486, 931, 1005, 4197, 7776, 2368, 7, 18, 17, 568, 5834, 1428, 286, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_highlighting_multiline_nodes_to_html() { let source = vec![ "const SOMETHING = `", " one ${", " two()", " } three", "`", "", ] .join("\n"); assert_eq!( &to_html(&source, get_language("javascript"), &JS_SHEET,).unwrap()...
rust_cleaned_test_functions.jsonl/12257
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 466 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 74546, 287, 26290, 26560, 14896, 2346, 9564, 368, 341, 262, 1077, 2530, 284, 7486, 90515, 286, 330, 1024, 73290, 7625, 1718, 284, 1565, 756, 286, 330, 220, 825, 3570, 756, 286, 330, 262, 1378, 3...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_with_key_usages() { let mut params: CertificateParams = Default::default(); // Set key_usages params.key_usages = vec![ KeyUsagePurpose::DigitalSignature, KeyUsagePurpose::KeyEncipherment, KeyUsagePurpose::ContentCommitment, ]; // This can sign things! params.is_ca = IsCa:...
rust_cleaned_test_functions.jsonl/3855
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 411 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6615, 3097, 11306, 1134, 368, 341, 197, 10217, 5206, 3628, 25, 31402, 4870, 284, 7899, 486, 2258, 1428, 197, 197, 322, 2573, 1376, 11306, 1134, 198, 197, 25856, 4735, 11306, 1134, 284, 7486, 90515...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
4
#[test] fn test_invalid_private_key_1() { let compressed = hex::decode("aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa").unwrap(); let private_key = PrivateKey::new(&compressed.as_slice()); assert_eq!(private_key.is_err(), true); ...
rust_cleaned_test_functions.jsonl/65086
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 122 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 31433, 26249, 3097, 62, 16, 368, 341, 286, 1077, 30649, 284, 12371, 486, 18196, 445, 69440, 69440, 69440, 69440, 69440, 69440, 69440, 69440, 69440, 69440, 69440, 69440, 28458, 1827, 15454, 543, 286, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_uuid_value() { let uuid = uuid::Uuid::parse_str("936DA01F9ABD4d9d80C702AF85C822A8").unwrap(); let value: Value = uuid.into(); let out: uuid::Uuid = value.unwrap(); assert_eq!(out, uuid); }
rust_cleaned_test_functions.jsonl/12495
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 131 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 25540, 3142, 368, 341, 286, 1077, 16040, 284, 16040, 486, 38431, 486, 6400, 2895, 445, 24, 18, 21, 6352, 15, 16, 37, 24, 1867, 35, 19, 67, 24, 67, 23, 15, 34, 22, 15, 17, 8276, 23, 20, 3...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_word_movement() { let f = |s: &str| mv_magnitude(Word, s.chars()); assert_eq!(f("Hello, world!"), 5); assert_eq!(f(", world! Another word"), 7); }
rust_cleaned_test_functions.jsonl/78498
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 101 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 13533, 70325, 368, 341, 286, 1077, 282, 284, 760, 82, 25, 609, 495, 91, 23164, 717, 34715, 7, 10879, 11, 274, 85062, 1423, 286, 2060, 10714, 10297, 69, 445, 9707, 11, 1879, 0, 3975, 220, 20, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_ecdsa_object_pool_panic_on_wrong_type() { let metrics_registry = MetricsRegistry::new(); let metrics = EcdsaPoolMetrics::new(metrics_registry, POOL_ECDSA, POOL_TYPE_VALIDATED); let mut object_pool = EcdsaObjectPool::new(EcdsaMessageType::DealingSupport, metrics); ...
rust_cleaned_test_functions.jsonl/26783
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 230 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 36844, 96780, 5314, 15709, 620, 31270, 4470, 75198, 1819, 368, 341, 286, 1077, 16734, 50650, 284, 54190, 15603, 486, 931, 543, 286, 1077, 16734, 284, 468, 4385, 9081, 10551, 27328, 486, 931, 89788, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_umount() { let vfs = Vfs::new(VfsOptions::default()); let fs1 = FakeFileSystemOne {}; let fs2 = FakeFileSystemOne {}; assert!(vfs.mount(Box::new(fs1), "/foo").is_ok()); assert!(vfs.umount("/foo").is_ok()); assert!(vfs.mount(Box::new(fs2), "/x/y")....
rust_cleaned_test_functions.jsonl/33258
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 243 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 72063, 629, 368, 341, 286, 1077, 92941, 284, 647, 3848, 486, 931, 12410, 3848, 3798, 486, 2258, 1423, 286, 1077, 8619, 16, 284, 36965, 50720, 3966, 9321, 286, 1077, 8619, 17, 284, 36965, 50720, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_lms_pos() { let orig_text = b"GCCTTAACATTATTACGCCTA$"; let alphabet = Alphabet::new(orig_text); let text: Vec<u8> = transform_text(orig_text, &alphabet, 1); let n = text.len(); let mut sais = SAIS::new(n); let pos_types = PosTypes::new(&text); ...
rust_cleaned_test_functions.jsonl/71442
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 184 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 907, 1011, 6479, 368, 341, 286, 1077, 2713, 4326, 284, 293, 1, 22863, 1162, 15204, 1706, 21614, 21614, 1706, 22863, 1162, 32, 3, 876, 286, 1077, 27790, 284, 62797, 486, 931, 54837, 4326, 317, 28...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_nullif_int_array_offset() { let a = Int32Array::from(vec![None, Some(15), Some(8), Some(1), Some(9)]); let a = a.slice(1, 3); let a = a.as_any().downcast_ref::<Int32Array>().unwrap(); let comp = BooleanArray::from(vec![ Some(false), Some(f...
rust_cleaned_test_functions.jsonl/45031
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 442 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 15162, 333, 4042, 3858, 6917, 368, 341, 286, 1077, 264, 284, 1333, 18, 17, 1857, 486, 1499, 25592, 20703, 4064, 11, 4329, 7, 16, 20, 701, 4329, 7, 23, 701, 4329, 7, 16, 701, 4329, 7, 24, 4...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_switch_threshold_across_tower_reload() { solana_logger::setup(); // Init state let mut vote_simulator = VoteSimulator::new(2); let my_pubkey = vote_simulator.node_pubkeys[0]; let other_vote_account = vote_simulator.vote_pubkeys[1]; let bank0 = vote...
rust_cleaned_test_functions.jsonl/77050
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 3625 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 27652, 21858, 14718, 2128, 528, 1202, 79405, 368, 341, 286, 2048, 3362, 27413, 486, 15188, 543, 286, 442, 15690, 1584, 198, 286, 1077, 5206, 6910, 18314, 10511, 284, 34034, 14027, 10511, 486, 931, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
4
#[test] fn test_overload_constructors() { let cxx = indoc! {" Bob::Bob() {} Bob::Bob(uint32_t _a) :a(_a) {} "}; let hdr = indoc! {" #include <cstdint> #include <memory> struct Bob { Bob(); Bob(uint32_t a); uint32_t a; ...
rust_cleaned_test_functions.jsonl/9787
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 290 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 15431, 1078, 64803, 1087, 368, 341, 262, 1077, 272, 4146, 284, 1257, 509, 0, 314, 698, 286, 14261, 486, 32388, 368, 5613, 286, 14261, 486, 32388, 8488, 18, 17, 528, 716, 64, 8, 549, 64, 2490, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_merge_our_head_only() -> BitResult<()> { BitRepo::with_minimal_repo(|repo| { let base = commit! {}; let ours = commit! { foo < "hello" }; let theirs = commit! {}; repo.three_way_merge_with_base(base, ours, theirs)?; assert_eq!(cat!(...
rust_cleaned_test_functions.jsonl/94152
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 192 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 20888, 62, 413, 13138, 18410, 368, 1464, 6495, 2077, 71698, 341, 262, 6495, 25243, 486, 4197, 7260, 2861, 37784, 22428, 23476, 91, 341, 286, 1077, 2331, 284, 5266, 0, 9321, 286, 1077, 11350, 284, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_leader_to_validator_transition() { logger::setup(); let leader_rotation_interval = 20; // Make a dummy validator id to be the next leader let validator_keypair = Keypair::new(); // Create the leader node information let leader_keypair = Arc::new(Keypair::new()); let...
rust_cleaned_test_functions.jsonl/36558
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1625 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 79991, 2346, 64959, 53593, 368, 341, 262, 5925, 486, 15188, 543, 262, 1077, 7653, 44813, 20541, 284, 220, 17, 15, 401, 262, 442, 7405, 264, 17292, 22935, 877, 311, 387, 279, 1790, 7653, 198, 262...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
7
#[test] fn test_find_best_labeling() { let left_image = [[1, 1, 0].to_vec()].to_vec(); let right_image = [[1, 0, 0].to_vec()].to_vec(); let max_disparity: usize = 3; let mut diffusion_graph = DiffusionGraph::initialize(left_image, right_image, max_disparity, 1.); dif...
rust_cleaned_test_functions.jsonl/133564
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 593 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21814, 33101, 6106, 287, 368, 341, 260, 1077, 2115, 4954, 284, 4318, 16, 11, 220, 16, 11, 220, 15, 936, 983, 13251, 57590, 983, 13251, 543, 260, 1077, 1290, 4954, 284, 4318, 16, 11, 220, 15, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_parse_hexa_byte_invalid_format() { let invalid = "0xG42"; let parsed = parse_hexa_byte(invalid); assert!(parsed.is_err()); }
rust_cleaned_test_functions.jsonl/116174
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 89 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21039, 32655, 64, 19737, 31433, 8955, 368, 341, 286, 1077, 8318, 284, 330, 15, 87, 38, 19, 17, 876, 286, 1077, 15676, 284, 4715, 32655, 64, 19737, 5900, 1891, 317, 286, 2060, 10297, 41030, 2079,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_authorize_with_seed() { let authority_base_address = solana_sdk::pubkey::new_rand(); let authority_address = solana_sdk::pubkey::new_rand(); let seed = "42"; let stake_address = Pubkey::create_with_seed(&authority_base_address, seed, &id()).unwrap(); let s...
rust_cleaned_test_functions.jsonl/31637
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1981 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 22938, 551, 6615, 33809, 368, 341, 286, 1077, 11198, 7651, 6744, 284, 2048, 3362, 61783, 486, 9585, 792, 486, 931, 33864, 543, 286, 1077, 11198, 6744, 284, 2048, 3362, 61783, 486, 9585, 792, 486, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_program_id_as_payer() { solana_logger::setup(); let (genesis_config, mint_keypair) = create_genesis_config(500); let mut bank = Bank::new(&genesis_config); let from_pubkey = solana_sdk::pubkey::new_rand(); let to_pubkey = solana_sdk::pubkey::new_rand(); ...
rust_cleaned_test_functions.jsonl/2633
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 834 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 25096, 842, 11898, 620, 1135, 368, 341, 286, 2048, 3362, 27413, 486, 15188, 543, 286, 1077, 320, 77894, 5332, 11, 28337, 3097, 12670, 8, 284, 1855, 16322, 13774, 5332, 7, 20, 15, 15, 317, 286, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_circular_load() { let loader = MockLoader::new(); let loads = loader.loads.clone(); let mut runtime = JsRuntime::new(RuntimeOptions { module_loader: Some(loader), ..Default::default() }); let fut = async move { let spec = crate::resolve_url("file:///circula...
rust_cleaned_test_functions.jsonl/126049
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 819 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 666, 21472, 12411, 368, 341, 262, 1077, 16047, 284, 14563, 9181, 486, 931, 543, 262, 1077, 20907, 284, 16047, 22961, 15997, 543, 262, 1077, 5206, 15592, 284, 39122, 15123, 486, 931, 52610, 3798, 3...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_good() { let input = "Allegoric Alaskians;Blithering Badgers;win\n".to_string() + "Devastating Donkeys;Courageous Californians;draw\n" + "Devastating Donkeys;Allegoric Alaskians;win\n" + "Courageous Californians;Blithering Badgers;loss\n" + ...
rust_cleaned_test_functions.jsonl/21168
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 505 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 44781, 368, 341, 262, 1077, 1946, 284, 330, 2101, 1937, 26359, 1674, 1073, 5380, 26, 4923, 2485, 287, 11461, 10637, 26, 7526, 1699, 3263, 983, 3904, 368, 3610, 394, 330, 14592, 559, 1095, 4320, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_cpi_equal() { let mut state = State8080::empty_state(); state.memory = vec![0xfe, 0x4a]; state.a = 0x4a; emulate_8080_op(&mut state); assert_eq!(state.cc.cy, 0); assert_eq!(state.cc.z, 1); assert_eq!(state.program_counter(), 2); }
rust_cleaned_test_functions.jsonl/7783
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 167 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 666, 2493, 11478, 368, 341, 286, 1077, 5206, 1584, 284, 3234, 23, 15, 23, 15, 486, 3194, 4387, 543, 286, 1584, 36611, 284, 7486, 20703, 15, 31469, 11, 220, 15, 87, 19, 64, 935, 286, 1584, 58...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_read_bits() { let val: u32 = 0b1000_0000_0000_0000_0011_0101_0001_0000; // Test a couple of successive ranges assert!( val.read_bits_in_range(&BitRange { msb_index: 3, lsb_index: 2 }) == 0b00 ); asse...
rust_cleaned_test_functions.jsonl/4120
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1641 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6443, 20034, 368, 341, 286, 1077, 1044, 25, 575, 18, 17, 284, 220, 15, 65, 16, 15, 15, 15, 62, 15, 15, 15, 15, 62, 15, 15, 15, 15, 62, 15, 15, 15, 15, 62, 15, 15, 16, 16, 62, 15, 1...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_votes_land_in_fork_during_long_partition() { let total_stake = 100; // Make `lighter_stake` insufficient for switching threshold let lighter_stake = (SWITCH_FORK_THRESHOLD as f64 * total_stake as f64) as u64; let heavier_stake = lighter_stake + 1; let failures_stake = total_s...
rust_cleaned_test_functions.jsonl/31919
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1996 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 65116, 60506, 1243, 761, 669, 814, 1677, 17799, 43840, 368, 341, 262, 1077, 2790, 1261, 726, 284, 220, 16, 15, 15, 280, 262, 442, 7405, 1565, 4145, 261, 1261, 726, 63, 38313, 369, 27765, 12171, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_bank_record_transactions() { solana_logger::setup(); let GenesisConfigInfo { genesis_config, mint_keypair, .. } = create_genesis_config(10_000); let bank = Arc::new(Bank::new_no_wallclock_throttle_for_tests(&genesis_config)); ...
rust_cleaned_test_functions.jsonl/15482
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1378 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 35733, 14192, 68182, 368, 341, 286, 2048, 3362, 27413, 486, 15188, 1428, 286, 1077, 40788, 2648, 1731, 341, 310, 59366, 5332, 345, 310, 28337, 3097, 12670, 345, 310, 54538, 286, 335, 284, 1855, 16...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_vcx_credential_release() { let _setup = SetupMocks::init(); let handle = _vcx_credential_create_with_offer_c_closure(ARIES_CREDENTIAL_OFFER).unwrap(); assert_eq!(vcx_credential_release(handle + 1), error::INVALID_CREDENTIAL_HANDLE.code_num); assert_eq!(vcx_cred...
rust_cleaned_test_functions.jsonl/115039
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 212 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2273, 25844, 666, 30320, 24577, 368, 341, 286, 1077, 716, 15188, 284, 18626, 72577, 486, 2327, 1428, 286, 1077, 3705, 284, 716, 7362, 87, 666, 30320, 8657, 6615, 67814, 666, 72823, 7, 934, 5369, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_old_overridden() { let toml = r#" unstable_features = true imports_granularity = "Module" "#; let mut config = Config::from_toml(toml, Path::new("")).unwrap(); config.override_value("merge_imports", "true"); ...
rust_cleaned_test_functions.jsonl/130644
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 224 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21108, 15431, 42185, 368, 341, 310, 1077, 311, 1014, 284, 435, 2, 698, 394, 44211, 14965, 284, 830, 198, 394, 15202, 15682, 276, 28979, 284, 330, 3332, 698, 310, 5869, 280, 310, 1077, 5206, 2193...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_setb_reg() { assert_emit!(0x0f, 0x94, 0xc0; emit_setb_reg(CondCode::Equal, RAX)); assert_emit!(0x41, 0x0f, 0x95, 0xc7; emit_setb_reg(CondCode::NotEqual, R15)); assert_emit!(0x0f, 0x9d, 0xc1; emit_setb_reg(CondCode::GreaterEq, RCX)); assert_emit!(0x0f, 0x9f, 0xc2; ...
rust_cleaned_test_functions.jsonl/85456
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 302 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2602, 65, 4920, 368, 341, 286, 2060, 69082, 10297, 15, 87, 15, 69, 11, 220, 15, 87, 24, 19, 11, 220, 15, 8148, 15, 26, 16691, 2602, 65, 4920, 7, 49696, 2078, 486, 2993, 11, 431, 2954, 1106...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_get() { let file_name: String = String::from("/tmp/apache_license.txt"); let uri: String = String::from("https://raw.githubusercontent.com/pyrsia/.github/main/LICENSE"); let result = get(File::create(file_name.clone()).unwrap(), uri); match futures::executor::block_on(result) { ...
rust_cleaned_test_functions.jsonl/74935
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 339 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 3062, 368, 341, 262, 1077, 1034, 1269, 25, 923, 284, 923, 486, 1499, 4283, 5173, 38737, 63839, 3909, 797, 262, 1077, 13071, 25, 923, 284, 923, 486, 1499, 445, 2428, 1110, 1041, 50927, 905, 90834...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_protoentry_all_supported_unsupported_high_version() { let protocols: UnvalidatedProtoEntry = "HSDir=12-100".parse().unwrap(); let unsupported: Option<UnvalidatedProtoEntry> = protocols.all_supported(); assert_eq!(true, unsupported.is_some()); assert_eq!("HSDir=12-...
rust_cleaned_test_functions.jsonl/5155
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 145 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 37689, 4085, 5705, 57885, 4907, 18216, 22680, 9438, 368, 341, 286, 1077, 31785, 25, 1230, 59590, 31549, 5874, 284, 330, 39, 5491, 404, 28, 16, 17, 12, 16, 15, 15, 3263, 6400, 1005, 15454, 543, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_ecdsa_p256_jwk_thumbprint() { let k = KeyPair::from_pem(KEY_ECDSA_P256_PEM.as_bytes()).unwrap(); let jwk = k.jwk_public_key_thumbprint().unwrap(); assert!(jwk.is_object()); let jwk = jwk.as_object().unwrap(); assert_eq!(jwk.len(), 4); assert!(jwk.contains_key("kty")); ...
rust_cleaned_test_functions.jsonl/72349
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 446 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 36844, 96780, 620, 17, 20, 21, 5374, 50522, 46352, 1350, 368, 341, 262, 1077, 595, 284, 5309, 12443, 486, 1499, 620, 336, 37076, 69510, 72638, 1088, 17, 20, 21, 1088, 2716, 5357, 12524, 6011, 15...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_expansions() { let mut test = ExpansionTester::new("tests/no_features", "testing"); test.add_source_dir("from", vec![ExpansionTester::duplicate_for_inline()]); test.add_source_dir( "expected", vec![ ExpansionTester::copy(), ExpansionTester::copy_with_prefix("inline_"), ], ); tes...
rust_cleaned_test_functions.jsonl/116796
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 247 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 14214, 596, 908, 741, 515, 10217, 5206, 1273, 284, 54554, 58699, 486, 931, 445, 23841, 33100, 14965, 497, 330, 8840, 797, 18185, 1364, 10347, 4334, 445, 1499, 497, 7486, 20703, 71642, 58699, 486, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_delete_all_documents_and_rollback() { let mut schema_builder = schema::Schema::builder(); let text_field = schema_builder.add_text_field("text", schema::TEXT); let index = Index::create_in_ram(schema_builder.build()); let mut index_writer = index.writer_with_num_t...
rust_cleaned_test_functions.jsonl/21508
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 588 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 11353, 5705, 75927, 8378, 62, 33559, 368, 341, 286, 1077, 5206, 10802, 28532, 284, 10802, 486, 8632, 486, 17850, 543, 286, 1077, 1467, 5013, 284, 10802, 28532, 1364, 4326, 5013, 445, 1318, 497, 10...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_parse_lang_val_min() { let source = format!("Add RX1 {}", LangValue::min_value()); assert_eq!( parse(&source).unwrap().body, vec![Node( Statement::Operator(Node( Operator::Add( Node(RegisterRef::U...
rust_cleaned_test_functions.jsonl/118218
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 547 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21039, 17876, 6189, 7260, 368, 341, 286, 1077, 2530, 284, 3561, 17223, 2212, 28170, 16, 24689, 22463, 1130, 486, 1065, 3142, 1423, 286, 2060, 10714, 33673, 310, 4715, 2099, 2427, 568, 15454, 1005, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_sufficient_stake() { let driver = fake::FakeDriver::default(); let mut gov = Governance::new( fixture_for_following(), driver.get_fake_env(), driver.get_fake_ledger(), ); gov.proto .neurons .get_mut(&1) .unwrap() .cache...
rust_cleaned_test_functions.jsonl/1120
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 804 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 643, 26683, 1261, 726, 368, 341, 262, 1077, 5579, 284, 12418, 486, 52317, 11349, 486, 2258, 543, 262, 1077, 5206, 47625, 284, 80589, 486, 931, 1006, 286, 12507, 5478, 43490, 287, 3148, 286, 5579, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_arc_cyclic_with_zero_refs() { struct ZeroRefs { inner: Weak<ZeroRefs>, } let zero_refs = Arc::new_cyclic(|inner| { assert_eq!(inner.strong_count(), 0); assert!(inner.upgrade().is_none()); ZeroRefs { inner: Weak::new() } }); assert_eq!(Arc::str...
rust_cleaned_test_functions.jsonl/42735
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 233 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 62914, 666, 65304, 6615, 19359, 60638, 368, 341, 262, 2036, 18306, 82807, 341, 286, 9179, 25, 41164, 27, 17999, 82807, 12520, 262, 456, 262, 1077, 7168, 60638, 284, 19689, 486, 931, 666, 65304, 22...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_decode_loca() { let buffer = read_fixture("tests/fonts/opentype/test-font.ttf"); let file = ReadScope::new(&buffer).read::<OpenTypeFile>().unwrap(); match file.font { OpenTypeFont::Single(ttf) => { let head = ttf .read_table(&file.scope, tag::HEAD...
rust_cleaned_test_functions.jsonl/6592
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 658 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 15227, 5560, 924, 368, 341, 262, 1077, 4147, 284, 1349, 74409, 445, 23841, 60667, 52000, 306, 499, 12697, 30671, 45192, 797, 262, 1077, 1034, 284, 4457, 10803, 486, 931, 2099, 7573, 568, 878, 2763...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_join_err() -> Result<()> { let df1 = df![ "a" => [1, 2], "b" => ["foo", "bar"] ]?; let df2 = df![ "a" => [1, 2, 3, 4], "b" => [true, true, true, false] ]?; assert!(df1 .join(&df2, vec![...
rust_cleaned_test_functions.jsonl/10283
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 350 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 31017, 9266, 368, 1464, 5714, 71698, 341, 286, 1077, 6764, 16, 284, 6764, 90515, 310, 330, 64, 1, 589, 508, 16, 11, 220, 17, 1259, 310, 330, 65, 1, 589, 4383, 7975, 497, 330, 2257, 7026, 286...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_debug_format() { // Check zero padding let hash = Hash::new([1; 32]); assert_eq!(format!("{:?}", &hash), "Hash(01010101)"); let pk = PublicKey::new([15; 32]); assert_eq!(format!("{:?}", &pk), "PublicKey(0F0F0F0F)"); let sk = SecretKey::new([8; 64]...
rust_cleaned_test_functions.jsonl/5653
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 427 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 15446, 8955, 368, 341, 286, 442, 4248, 7168, 5300, 198, 286, 1077, 5175, 284, 6531, 486, 931, 2561, 16, 26, 220, 18, 17, 2558, 286, 2060, 10714, 10297, 2243, 88928, 25, 52652, 609, 8296, 701, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_parse_token_mint_with_extensions() { let owner_pubkey = SplTokenPubkey::new(&[3; 32]); let mint_size = ExtensionType::get_account_len::<Mint>(&[ExtensionType::MintCloseAuthority]); let mint_base = Mint { mint_authority: COption::Some(owner_pubkey),...
rust_cleaned_test_functions.jsonl/103632
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1139 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21039, 6458, 717, 396, 6615, 60498, 368, 341, 286, 1077, 6372, 34014, 792, 284, 51198, 3323, 29162, 792, 486, 931, 2099, 58, 18, 26, 220, 18, 17, 2558, 286, 1077, 28337, 2368, 4035, 310, 26473, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_from_xml() { let xml = r#"<Types xmlns="http://schemas.openxmlformats.org/package/2006/content-types"> <Override ContentType="application/vnd.openxmlformats-officedocument.wordprocessingml.document.main+xml" PartName="/word/document.xml"></Override></Types>"#; let c = Con...
rust_cleaned_test_functions.jsonl/59504
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 284 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 5673, 23855, 368, 341, 286, 1077, 8396, 284, 435, 2, 22476, 4173, 24967, 428, 1254, 1110, 56543, 5826, 6455, 63482, 2659, 64000, 14, 17, 15, 15, 21, 27917, 20817, 881, 286, 366, 2177, 70431, 428...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_join_nulls() -> Result<()> { let a = df![ "a" => [Some(1), None, None] ]?; let b = df![ "a" => [Some(1), None, None, None, None] ]?; let out = a.inner_join(&b, ["a"], ["a"])?; assert_eq!(out.shape(), (9, 1)); Ok(()...
rust_cleaned_test_functions.jsonl/69997
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 194 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 31017, 15162, 82, 368, 1464, 5714, 71698, 341, 286, 1077, 264, 284, 6764, 90515, 310, 330, 64, 1, 589, 508, 8373, 7, 16, 701, 2240, 11, 2240, 921, 286, 2279, 37445, 286, 1077, 293, 284, 6764, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
4
#[test] fn test_entry_ref_and_replace_entry_with() { let mut a = HashMap::new(); let key = "a key"; let value = "an initial value"; let new_value = "a new value"; let entry = a.entry_ref(key).and_replace_entry_with(|_, _| panic!()); match entry { En...
rust_cleaned_test_functions.jsonl/26982
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 722 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 9078, 7793, 8378, 10633, 9078, 6615, 368, 341, 286, 1077, 5206, 264, 284, 10528, 486, 931, 1428, 286, 1077, 1376, 284, 330, 64, 1376, 876, 286, 1077, 897, 284, 330, 276, 2856, 897, 876, 286, 1...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
4
#[test] fn test_string_diff() { let sa = String::from("test"); let sb = String::from("another_string"); let diff = sa.diff(&sb).unwrap(); assert_eq!(diff, DiffString(Some("another_string".into()))); let sc = sa.merge(diff).unwrap(); assert_eq!(sb, sc); }
rust_cleaned_test_functions.jsonl/95414
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 121 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 3904, 15850, 368, 341, 262, 1077, 822, 284, 923, 486, 1499, 445, 1944, 797, 262, 1077, 7898, 284, 923, 486, 1499, 445, 41963, 3904, 3071, 262, 1077, 3638, 284, 822, 40679, 2099, 16892, 568, 1545...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_unordered_list() { assert_markdown_eq( common::parts::unordered_list, r###" * one * two * three "###, ); }
rust_cleaned_test_functions.jsonl/133515
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 80 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 4907, 10544, 2019, 368, 341, 262, 2060, 18924, 2923, 10714, 1006, 286, 4185, 486, 18252, 486, 30419, 2019, 345, 286, 435, 14374, 698, 9, 825, 198, 9, 1378, 198, 9, 2326, 271, 1, 14374, 345, 26...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_lazy_is_null() { let df = get_df(); let new = df .clone() .lazy() .filter(col("sepal.width").is_null()) .collect() .unwrap(); assert_eq!(new.height(), 0); let new = df .clone() .lazy() .filter(col("sepal.width").is...
rust_cleaned_test_functions.jsonl/109
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 335 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 49646, 6892, 15162, 368, 341, 262, 1077, 6764, 284, 633, 10894, 543, 262, 1077, 501, 284, 6764, 198, 286, 659, 19982, 741, 286, 659, 49013, 741, 286, 659, 5315, 19611, 445, 325, 19308, 5441, 182...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_parse_thread_id_element() { assert_eq!(parse_thread_id_element(&b"0"[..]), Done(&b""[..], Id::Any)); assert_eq!(parse_thread_id_element(&b"-1"[..]), Done(&b""[..], Id::All)); assert_eq!( parse_thread_id_element(&b"23"[..]), Done(&b""[..], Id::Id(0x23)) ); }
rust_cleaned_test_functions.jsonl/40109
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 152 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21039, 10814, 842, 7894, 368, 341, 262, 2060, 10714, 10297, 6400, 10814, 842, 7894, 2099, 65, 1, 15, 36864, 496, 9719, 27357, 2099, 65, 3014, 95874, 1125, 5223, 486, 8610, 1106, 262, 2060, 10714, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_transcribes_guanine_cytosine() { assert_eq!(Ok(dna::RNA::new("C")), dna::DNA::new("G").to_rna()); }
rust_cleaned_test_functions.jsonl/107197
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 65 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 7965, 55136, 1889, 10386, 482, 666, 16415, 436, 482, 368, 341, 262, 2060, 10714, 10297, 11578, 1500, 3376, 486, 30720, 486, 931, 445, 34, 35674, 75334, 486, 55320, 486, 931, 445, 38, 1827, 983, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_events_no_data() { let event_fd = EventFd::new(0).unwrap(); let event_set = EventSet::IN; let events_raw = Events::new_raw(event_fd.as_raw_fd(), event_set); let events = Events::new(&event_fd, event_set); assert_eq!(events_raw, events); assert_e...
rust_cleaned_test_functions.jsonl/78841
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 212 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 19691, 6536, 1769, 368, 341, 286, 1077, 1538, 17676, 284, 3665, 74476, 486, 931, 7, 15, 568, 15454, 543, 286, 1077, 1538, 2602, 284, 3665, 1649, 486, 687, 401, 286, 1077, 4357, 16067, 284, 17627...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_gjk_exact() { let shape = Rectangle::new(1., 1.); let t = transform(0., 0., 0.); let gjk = GJK2::new(); let p = gjk.intersection(&CollisionStrategy::FullResolution, &shape, &t, &shape, &t); assert!(p.is_some()); let d = gjk.distance(&shape, &t, &sh...
rust_cleaned_test_functions.jsonl/90900
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 189 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 1889, 41808, 71084, 368, 341, 286, 1077, 6083, 284, 19280, 486, 931, 7, 16, 2572, 220, 16, 58957, 286, 1077, 259, 284, 5165, 7, 15, 2572, 220, 15, 2572, 220, 15, 58957, 286, 1077, 35001, 74, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_check_secondary_locks() { let storage = TestStorageBuilder::new(DummyLockManager {}, false) .build() .unwrap(); let cm = storage.concurrency_manager.clone(); let (tx, rx) = channel(); let k1 = Key::from_raw(b"k1"); let k2 = Key::fr...
rust_cleaned_test_functions.jsonl/2101
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 2143 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 7200, 77759, 9818, 82, 368, 341, 286, 1077, 5819, 284, 3393, 5793, 3297, 486, 931, 5432, 8574, 11989, 2043, 16452, 895, 340, 310, 659, 5834, 741, 310, 659, 15454, 543, 286, 1077, 9961, 284, 5819...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_needs_kick() { let m = &GuestMemoryMmap::from_ranges(&[(GuestAddress(0), 0x10000)]).unwrap(); let vq = VirtQueue::new(GuestAddress(0), m, 16); let mut q = vq.create_queue(); { q.uses_notif_suppression = false; for...
rust_cleaned_test_functions.jsonl/134255
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 880 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 13925, 6767, 4698, 865, 368, 341, 286, 1077, 296, 284, 609, 37804, 10642, 44, 2186, 486, 1499, 58748, 2099, 9697, 37804, 4286, 7, 15, 701, 220, 15, 87, 16, 15, 15, 15, 15, 7252, 568, 15454, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
4
#[test] fn test_dynamic_vec_count() { let test_data: Vec<u8> = [0x02, 0xAA, 0xBB].to_vec(); // Read let mut ret_read = samples::VecCountDeku::try_from(test_data.as_ref()).unwrap(); assert_eq!( samples::VecCountDeku { count: 0x02, vec_data: vec![0xAA, 0xBB] ...
rust_cleaned_test_functions.jsonl/123225
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 300 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 45992, 13251, 3180, 368, 341, 262, 1077, 1273, 1769, 25, 11312, 34837, 23, 29, 284, 508, 15, 87, 15, 17, 11, 220, 15, 60051, 11, 220, 15, 80197, 936, 983, 13251, 1428, 262, 442, 4457, 198, 2...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_loopback_alpn() { let cert = match localhost_cert() { Some(cert) => cert, None => return, }; let listener = TcpListener::bind("127.0.0.1:0").unwrap(); let addr = listener.local_addr().unwrap(); let t = thread::spawn(move || { let stream = TcpStream::conn...
rust_cleaned_test_functions.jsonl/93520
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 625 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 17198, 1419, 8418, 19958, 368, 341, 10217, 2777, 284, 2432, 47422, 37097, 368, 341, 286, 4329, 87793, 8, 589, 2777, 345, 286, 2240, 589, 470, 345, 262, 3634, 262, 1077, 11446, 284, 64876, 2743, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_init() { let pd = PocketDimension::new3(&Pos3(0,0,0), test_grid()); assert_eq!(pd.at(&Pos3(0,0,0)), &Cube::Inactive); assert_eq!(pd.at(&Pos3(1,0,0)), &Cube::Active); assert_eq!(pd.at(&Pos3(3,6,9)), &Cube::Inactive); assert_eq!(pd.at(&Pos3(2,1,0)), &Cube::A...
rust_cleaned_test_functions.jsonl/76745
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 180 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6137, 368, 341, 286, 1077, 7744, 284, 45724, 26121, 486, 931, 18, 2099, 4859, 18, 7, 15, 11, 15, 11, 15, 701, 1273, 15604, 1423, 286, 2060, 10714, 10297, 15360, 6847, 2099, 4859, 18, 7, 15, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_sentinel() { use rocket::{local::blocking::Client, error::ErrorKind::SentinelAborts}; let err = Client::debug_with(routes![is_reloading]).unwrap_err(); assert!(matches!(err.kind(), SentinelAborts(vec) if vec.len() == 1)); let err = Client::debug_with(routes![is_reloading, templ...
rust_cleaned_test_functions.jsonl/84749
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 694 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 24115, 29708, 368, 341, 262, 990, 24306, 22964, 2438, 486, 70356, 486, 2959, 11, 1465, 486, 1454, 10629, 486, 31358, 29708, 5830, 18955, 2315, 262, 1077, 1848, 284, 8423, 486, 8349, 6615, 44888, 2...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_mq_setattr() { use nix::mqueue::{mq_getattr, mq_setattr}; const MSG_SIZE: mq_attr_member_t = 32; let initial_attr = MqAttr::new(0, 10, MSG_SIZE, 0); let mq_name = &CString::new(b"/attr_test_get_attr".as_ref()).unwrap(); let oflag = MQ_OFlag::O_CREAT | MQ_OFlag::O_WRONLY; ...
rust_cleaned_test_functions.jsonl/28038
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 705 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 717, 80, 2602, 2991, 368, 341, 262, 990, 308, 941, 486, 76, 4584, 22964, 27674, 3062, 2991, 11, 72298, 2602, 2991, 2440, 262, 733, 23317, 4098, 25, 72298, 10422, 19388, 528, 284, 220, 18, 17, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_boolean_builder_increases_buffer_len() { let buf = Buffer::from([72_u8, 2_u8]); let mut builder = BufferBuilder::<bool>::new(8); for i in 0..10 { if i == 3 || i == 6 || i == 9 { builder.push(true).unwrap(); } else { ...
rust_cleaned_test_functions.jsonl/127623
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 277 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 46642, 28532, 1243, 837, 2264, 7776, 6043, 368, 341, 1789, 286, 1077, 6607, 284, 10312, 486, 1499, 2561, 22, 17, 7300, 23, 11, 220, 17, 7300, 23, 2558, 286, 1077, 5206, 7363, 284, 10312, 3297, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
5
#[test] fn test_foreign_ns_func_arg_nonpod() { let hdr = indoc! {" #include <cstdint> #include <memory> namespace A { struct Bob { uint32_t a; Bob(uint32_t _a) :a(_a) {} }; } namespace B { inline uint...
rust_cleaned_test_functions.jsonl/9824
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 320 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 78983, 34728, 9596, 6057, 21637, 39073, 368, 341, 262, 1077, 36615, 284, 1257, 509, 0, 314, 698, 286, 671, 997, 366, 96975, 397, 286, 671, 997, 366, 17269, 397, 286, 4473, 362, 341, 310, 2036, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_add() { let mut a = Num::from_input("[[[[4,3],4],4],[7,[[8,4],9]]]"); let b = Num::from_input("[1,1]"); a.add(b); assert_eq!(a._format(), "[[[[0,7],4],[[7,8],[6,0]]],[8,1]]"); }
rust_cleaned_test_functions.jsonl/122923
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 139 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2891, 368, 341, 286, 1077, 5206, 264, 284, 16212, 486, 1499, 5898, 10937, 15505, 58, 19, 11, 18, 1125, 19, 1125, 19, 14955, 22, 11, 15505, 23, 11, 19, 1125, 24, 5053, 37389, 286, 1077, 293, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_nums() { // Complete number assert_eq!(number(&b"0x12344+"[..]), Done(&b"+"[..], 0x12344)); assert_eq!(number(&b"012344+"[..]), Done(&b"+"[..], 0o12344)); assert_eq!(number(&b"-012344+"[..]), Done(&b"+"[..], -0o12344)); assert_eq!(number(&b"12344+"[..]), Done(&b"+"[..], 12344...
rust_cleaned_test_functions.jsonl/11380
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 666 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 51875, 368, 341, 262, 442, 18608, 1372, 198, 262, 2060, 10714, 10297, 4082, 2099, 65, 1, 15, 87, 16, 17, 18, 19, 19, 5172, 95874, 9719, 27357, 2099, 65, 77728, 95874, 1125, 220, 15, 87, 16, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_inherit_env() { use os; if running_on_valgrind() { return; } let mut result = env_cmd().output().unwrap(); let output = String::from_utf8(result.stdout).unwrap(); let r = os::env(); for &(ref k, ref v) in &r { // don't check android R...
rust_cleaned_test_functions.jsonl/5989
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 495 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 1243, 9263, 15879, 368, 341, 286, 990, 2643, 280, 286, 421, 4303, 4470, 6189, 901, 484, 368, 314, 470, 26, 555, 286, 1077, 5206, 1102, 284, 6105, 11684, 1005, 3006, 1005, 15454, 543, 286, 1077, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
5
#[test] fn test_static_spendable_outputs_justice_tx_revoked_htlc_success_tx() { let chanmon_cfgs = create_chanmon_cfgs(2); let node_cfgs = create_node_cfgs(2, &chanmon_cfgs); let node_chanmgrs = create_node_chanmgrs(2, &node_cfgs, &[None, None]); let nodes = create_network(2, &node_cfgs, &node_chanmgrs); ...
rust_cleaned_test_functions.jsonl/28312
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1069 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 25360, 643, 3740, 480, 35189, 62, 38768, 17805, 38082, 10823, 49086, 17257, 18632, 17805, 368, 341, 10217, 26023, 1645, 18343, 82, 284, 1855, 45552, 1645, 18343, 82, 7, 17, 317, 10217, 2436, 18343, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_validate_signature_invalid() { let channel_secret: &str = "hogehoge"; let signature: &str = "+uCVw4g3BuIOKnlseFJAYyFoVBFaMjxP8KXBbnIRRI0="; let request_body: &str = r#" { "destination": "xxxxxxxxxx", "events": [ { ...
rust_cleaned_test_functions.jsonl/78227
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1059 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 42681, 39859, 31433, 368, 341, 286, 1077, 5496, 21962, 25, 609, 495, 284, 330, 60622, 2636, 40532, 876, 286, 1077, 11957, 25, 609, 495, 284, 6630, 84, 19589, 86, 19, 70, 18, 59808, 3810, 42, 1...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_txs_wal() { let wal = SignedTxsWAL::new(FULL_TXS_PATH.to_string()); let txs_01 = mock_wal_txs(); let hash_01 = Hash::digest(Bytes::from(rlp::encode_list(&txs_01))); wal.save(1u64, hash_01.clone(), txs_01.clone()).unwrap(); let txs_02 = mock_wal_txs(); ...
rust_cleaned_test_functions.jsonl/122488
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 381 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 17805, 82, 1670, 278, 368, 341, 286, 1077, 40826, 284, 52453, 51, 18561, 54, 969, 486, 931, 7832, 1426, 18819, 50, 7944, 2389, 3904, 1423, 286, 1077, 9854, 82, 62, 15, 16, 284, 7860, 1670, 278...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_fastq_seek() { for cap in 3..31 { let mut reader = Reader::with_capacity(io::Cursor::new(b"@s1\nA\n+\n~\n@s2\nA\n+\n~\n@s3\nA\n+\n~\n"), cap); let pos0 = reader.position().clone(); let rec1 = reader.next().unwrap().unwrap().to_owned_record(); let pos1 = reader...
rust_cleaned_test_functions.jsonl/40341
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 708 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 35743, 80, 74473, 368, 341, 262, 369, 2062, 304, 220, 18, 496, 18, 16, 341, 286, 1077, 5206, 6604, 284, 25166, 486, 4197, 35603, 37258, 486, 14543, 486, 931, 1883, 96270, 82, 16, 1699, 32, 169...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_transcribes_cytosine_guanine() { assert_eq!(dna::RibonucleicAcid::new("G"), dna::DeoxyribonucleicAcid::new("C").to_rna()); }
rust_cleaned_test_functions.jsonl/36946
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 75 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 7965, 55136, 666, 16415, 436, 482, 1889, 10386, 482, 368, 341, 262, 2060, 10714, 10297, 92877, 486, 98884, 263, 22147, 292, 11654, 307, 486, 931, 445, 38, 3975, 75334, 486, 1912, 60163, 1897, 263,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_vector_1() { let x = [0x74, 0x65, 0x73, 0x74, 0x69, 0x6e, 0x67, 0xa]; let h_expected = [0x24, 0xf9, 0x50, 0xaa, 0xc7, 0xb9, 0xea, 0x9b ,0x3c, 0xb7, 0x28, 0x22, 0x8a, 0x0c, 0x82, 0xb6 ,0x7c, 0x39, 0xe9, 0x6b, 0x4b...
rust_cleaned_test_functions.jsonl/10634
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 590 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 12247, 62, 16, 368, 341, 16885, 286, 1077, 856, 284, 508, 15, 87, 22, 19, 11, 220, 15, 87, 21, 20, 11, 220, 15, 87, 22, 18, 11, 220, 15, 87, 22, 19, 11, 220, 15, 87, 21, 24, 11, 220,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_collections_in_mapping() { let s = " ? a sequence : - item 1 - item 2 ? a mapping : key 1: value 1 key 2: value 2 "; let mut p = Scanner::new(s.chars()); next!(p, StreamStart(..)); next!(p, BlockMappingStart); next!(p, Key); next_scalar!(p, TSc...
rust_cleaned_test_functions.jsonl/91011
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 637 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 89742, 1243, 26930, 368, 341, 286, 1077, 274, 284, 6228, 30, 264, 8500, 198, 25, 481, 1509, 220, 16, 198, 220, 481, 1509, 220, 17, 198, 30, 264, 12731, 198, 25, 1376, 220, 16, 25, 897, 220, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_unbond() { let mut deps = mock_dependencies(&[]); let msg = InstantiateMsg { anchor_token: "reward0000".to_string(), staking_token: "staking0000".to_string(), distribution_schedule: vec![ (12345, 12345 + 100, Uint128::from(1000000u128)), (...
rust_cleaned_test_functions.jsonl/2049
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 876 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 4907, 64239, 368, 341, 262, 1077, 5206, 48178, 284, 7860, 71841, 2099, 1294, 626, 262, 1077, 3750, 284, 32288, 6611, 341, 286, 17105, 6458, 25, 330, 49007, 15, 15, 15, 15, 3263, 983, 3904, 3148,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_create_cred_def() { init!("true"); let (id, _) = generate_cred_def("did", SCHEMAS_JSON, "tag_1", None, Some(false)).unwrap(); assert_eq!(id, CRED_DEF_ID); }
rust_cleaned_test_functions.jsonl/76652
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 106 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 8657, 73475, 7844, 368, 341, 286, 2930, 17223, 1866, 797, 286, 1077, 320, 307, 11, 27439, 284, 6923, 73475, 7844, 445, 22920, 497, 7531, 1799, 40092, 25356, 11, 330, 4578, 62, 16, 497, 2240, 11,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_time_machine_request_builder_complex() { let mut builder = TimeMachineRequestBuilder::new(API_KEY, LAT, LONG, TIME); let mut blocks = vec![ExcludeBlock::Daily, ExcludeBlock::Alerts]; builder = builder.exclude_block(ExcludeBlock::Hourly); builder = builder.exclude...
rust_cleaned_test_functions.jsonl/24719
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 757 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 3009, 38695, 7893, 28532, 41522, 368, 341, 286, 1077, 5206, 7363, 284, 4120, 21605, 1900, 3297, 486, 931, 48953, 6600, 11, 53187, 11, 33942, 11, 22236, 317, 286, 1077, 5206, 10010, 284, 7486, 2070...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_fr_sub_assign() { { // Test arbitrary subtraction that tests reduction. let mut tmp = Fr(FrRepr([0x6a68c64b6f735a2b, 0xd5f4d143fe0a1972, 0x37c17f3829267c62, 0xa2f37391f30915c])); tmp.sub_assign(&Fr(FrRepr([0xade5adacdccb6190, 0xaa21ee0f27db3ccd, 0x2550f4704ae39086, 0x...
rust_cleaned_test_functions.jsonl/66325
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 962 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 41537, 5228, 20688, 368, 341, 262, 341, 286, 442, 3393, 24168, 75240, 429, 7032, 13951, 624, 286, 1077, 5206, 4174, 284, 2869, 7832, 81, 693, 649, 2561, 15, 87, 21, 64, 21, 23, 66, 21, 19, 6...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_parse_frame_mask() { let mut buf = BytesMut::from(&[0b0000_0001u8, 0b1000_0001u8][..]); buf.extend(b"0001"); buf.extend(b"1"); assert!(Parser::parse(&mut buf, false, 1024).is_err()); let frame = extract(Parser::parse(&mut buf, true, 1024)); asser...
rust_cleaned_test_functions.jsonl/86807
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 217 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21039, 8929, 9999, 368, 341, 286, 1077, 5206, 6607, 284, 30024, 51440, 486, 1499, 2099, 58, 15, 65, 15, 15, 15, 15, 62, 15, 15, 15, 16, 84, 23, 11, 220, 15, 65, 16, 15, 15, 15, 62, 15, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_box_slice_clone() { let data = vec![vec![0, 1], vec![0], vec![1]]; let data2 = data.clone().into_boxed_slice().clone().to_vec(); assert_eq!(data, data2); }
rust_cleaned_test_functions.jsonl/12935
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 90 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 10194, 26488, 54742, 368, 341, 262, 1077, 821, 284, 7486, 20703, 4083, 20703, 15, 11, 220, 16, 1125, 7486, 20703, 15, 1125, 7486, 20703, 16, 13204, 262, 1077, 821, 17, 284, 821, 15997, 1005, 181...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_sanitize_unsanitary() { let unsanitary_tx58 = "ju9xZWuDBX4pRxX2oZkTjxU5jB4SSTgEGhX8bQ8PURNzyzqKMPPpNvWihx8zUe\ FfrbVNoAaEsNKZvGzAnTDy5bhNT9kt6KFCTBixpvrLCzg4M5UdFUQYrn1gdgjX\ pLHxcaShD81xBNaFDgnA2nkkdHnKtZt4hVSfKAmw3VRZbjrZ7L2fKZBx21CwsG\ hD6onjM2M3...
rust_cleaned_test_functions.jsonl/6342
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 566 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 643, 58652, 4907, 33082, 44806, 368, 341, 286, 1077, 6975, 276, 44806, 17805, 20, 23, 284, 330, 8613, 24, 87, 81756, 84, 3506, 55, 19, 79, 50639, 55, 17, 78, 57, 74, 51, 73, 87, 52, 20, 73...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_read_linux() { // only run this test if linux_checkout present let linux_dir = PathBuf::from(env!("CARGO_MANIFEST_DIR")).join("benches/assets/linux_checkout"); if linux_dir.exists() { for each in WalkDir::new(linux_dir) { let path = each.unwrap().path(); ...
rust_cleaned_test_functions.jsonl/126464
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 168 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6443, 77463, 368, 341, 262, 442, 1172, 1598, 419, 1273, 421, 36245, 68186, 3042, 198, 262, 1077, 36245, 4334, 284, 7933, 15064, 486, 1499, 16978, 17223, 34, 7581, 46, 25143, 91120, 8291, 15197, 59...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_workon_from_tags_prioritized() { let config = a_config(); let logger = a_logger(); let resolved = config.resolve_after_workon(&logger, config.projects.get("test5").unwrap()); assert_that(&resolved).is_equal_to(vec!["workon4".to_string(), "workon3".to_string()]); }
rust_cleaned_test_functions.jsonl/52622
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 122 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 11498, 263, 5673, 16333, 58782, 83443, 368, 341, 262, 1077, 2193, 284, 264, 5332, 543, 262, 1077, 5925, 284, 264, 27413, 543, 262, 1077, 19673, 284, 2193, 14691, 19844, 11498, 263, 2099, 9786, 11,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_resource_block_resource_must_be_registered() { let p = Polar::new(); let valid_policy = "resource Org{}"; expect_error( &p, valid_policy, "Invalid resource block 'Org' -- 'Org' must be a registered class.", ); p.register...
rust_cleaned_test_functions.jsonl/31739
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 215 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 17962, 7113, 17962, 717, 590, 21263, 72683, 368, 341, 286, 1077, 281, 284, 55896, 486, 931, 543, 286, 1077, 2697, 22773, 284, 330, 9233, 33706, 6257, 876, 286, 1720, 4096, 1006, 310, 609, 79, 34...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_chunks_mut_zip() { let v1: &mut [i32] = &mut [0, 1, 2, 3, 4]; let v2: &[i32] = &[6, 7, 8, 9, 10]; for (a, b) in v1.chunks_mut(2).zip(v2.chunks(2)) { let sum = b.iter().sum::<i32>(); for v in a { *v += sum; } } assert_eq!(v1, [13, 14, 19, 2...
rust_cleaned_test_functions.jsonl/4137
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 199 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 65470, 29523, 42131, 368, 341, 262, 1077, 348, 16, 25, 609, 6984, 508, 72, 18, 17, 60, 284, 609, 6984, 508, 15, 11, 220, 16, 11, 220, 17, 11, 220, 18, 11, 220, 19, 935, 262, 1077, 348, 1...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_setup_regs() { let hv = hypervisor::new().unwrap(); let vm = hv.create_vm().expect("new VM fd creation failed"); let vcpu = vm.create_vcpu(0).unwrap(); let expected_regs: StandardRegisters = StandardRegisters { rflags: 0x0000000000000002u64, ...
rust_cleaned_test_functions.jsonl/21462
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 415 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21363, 36910, 368, 341, 286, 1077, 22747, 284, 9751, 31396, 486, 931, 1005, 15454, 543, 286, 1077, 10995, 284, 22747, 2520, 39008, 1005, 17119, 445, 931, 17792, 12414, 9688, 4641, 797, 286, 1077, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_new_releases() { let mut oauth = SpotifyOAuth::default().scope("user-follow-read").build(); match get_token(&mut oauth) { Some(token_info) => { let client_credential = SpotifyClientCredentials::default() .token_info(token_info) .build()...
rust_cleaned_test_functions.jsonl/79269
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 303 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 5921, 1288, 28299, 368, 341, 262, 1077, 5206, 46415, 284, 40537, 57850, 486, 2258, 1005, 4186, 445, 872, 92585, 28806, 1827, 5834, 543, 262, 2432, 633, 6458, 2099, 6984, 46415, 8, 341, 286, 4329, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_simple() { let mut m = MemoryBoundedBuffer::new(12); m.push(1, 4); m.push(2, 4); m.push(3, 4); assert_eq!( &m.iter_mut().collect::<Vec<(&mut i32, usize)>>()[..], &[(&mut 1, 4), (&mut 2, 4), (&mut 3, 4)] ...
rust_cleaned_test_functions.jsonl/76999
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 219 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 30015, 368, 341, 310, 1077, 5206, 296, 284, 13850, 33, 13082, 4095, 486, 931, 7, 16, 17, 317, 310, 296, 2552, 7, 16, 11, 220, 19, 317, 310, 296, 2552, 7, 17, 11, 220, 19, 317, 310, 296, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_push_and_into() { let batch_msg = BatchMessage::Track(Track { ..Default::default() }); let context = json!({ "foo": "bar", }); let mut batcher = Batcher::new(Some(context.clone())); batcher.without_auto_timestamp(); ...
rust_cleaned_test_functions.jsonl/35279
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 361 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 14218, 8378, 45514, 368, 341, 286, 1077, 7162, 6483, 284, 33904, 2052, 486, 15667, 7, 15667, 341, 310, 5241, 3675, 486, 2258, 741, 286, 3011, 286, 1077, 2266, 284, 2951, 0, 2262, 310, 330, 7975,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_read_timestamp() -> IonResult<()> { let mut cursor = ion_cursor_for(&[0x68, 0x80, 0x0F, 0xD0, 0x81, 0x81, 0x80, 0x80, 0x80]); assert_eq!(cursor.next()?, Some(Value(IonType::Timestamp, false))); let naive_datetime = NaiveDate::from_ymd(2000 as i32, 1 as u32, 1 as u32) ...
rust_cleaned_test_functions.jsonl/82740
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 277 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6443, 23073, 368, 1464, 44805, 2077, 71698, 341, 286, 1077, 5206, 8128, 284, 27672, 28601, 5478, 2099, 58, 15, 87, 21, 23, 11, 220, 15, 87, 23, 15, 11, 220, 15, 87, 15, 37, 11, 220, 15, 15...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3