text
stringlengths
93
16.4k
id
stringlengths
20
40
metadata
dict
input_ids
listlengths
45
2.05k
attention_mask
listlengths
45
2.05k
complexity
int64
1
9
#[test] fn test_from_str_socket_addr() { assert_eq!(Some(SocketAddr { ip: Ipv4Addr(77, 88, 21, 11), port: 80 }), FromStr::from_str("77.88.21.11:80")); assert_eq!(Some(SocketAddr { ip: Ipv6Addr(0x2a02, 0x6b8, 0, 1, 0, 0, 0, 1), port: 53 }), FromStr::from_str("[2a02...
rust_cleaned_test_functions.jsonl/818
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 546 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 5673, 2895, 19555, 7387, 368, 341, 286, 2060, 10714, 10297, 8373, 73066, 13986, 314, 5997, 25, 358, 30168, 19, 13986, 7, 22, 22, 11, 220, 23, 23, 11, 220, 17, 16, 11, 220, 16, 16, 701, 2635,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_example() { //create a new state instance with the name "foo" let mut state = State::load_else_create("foo").unwrap(); //set some variables in foo state.set("var", "some value").unwrap(); state.set("user_wants_pie", true).unwrap(); //destroy the state variable drop(state); //create...
rust_cleaned_test_functions.jsonl/55505
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 198 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 39304, 368, 341, 1572, 197, 322, 3182, 264, 501, 1584, 2867, 448, 279, 829, 330, 7975, 698, 10217, 5206, 1584, 284, 3234, 486, 1078, 62628, 8657, 445, 7975, 1827, 15454, 543, 197, 322, 746, 1045...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_xof_seek() { let mut out = [0; 533]; let mut hasher = crate::Hasher::new(); hasher.update(b"foo"); hasher.finalize_xof().fill(&mut out); assert_eq!(hasher.finalize().as_bytes(), &out[0..32]); let mut reader = hasher.finalize_xof(); reader.set_position(303); let m...
rust_cleaned_test_functions.jsonl/39150
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 727 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 3212, 1055, 74473, 368, 341, 262, 1077, 5206, 700, 284, 508, 15, 26, 220, 20, 18, 18, 935, 262, 1077, 5206, 90819, 284, 17717, 486, 6370, 261, 486, 931, 543, 262, 90819, 5317, 1883, 1, 7975, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_date_from_isoywd() { let isoywd_opt = |y,w,d| NaiveDate::from_isoywd_opt(y, w, d); let ymd = |y,m,d| NaiveDate::from_ymd(y, m, d); assert_eq!(isoywd_opt(2004, 0, Weekday::Sun), None); assert_eq!(isoywd_opt(2004, 1, Weekday::Mon), Some(ymd(2003, 12, 29))); ...
rust_cleaned_test_functions.jsonl/4758
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 862 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 4164, 5673, 6892, 2253, 6377, 368, 341, 286, 1077, 374, 2253, 6377, 15032, 284, 760, 88, 24558, 11991, 91, 12812, 533, 1916, 486, 1499, 6892, 2253, 6377, 15032, 7021, 11, 289, 11, 294, 317, 286,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_pull_request_merged_no_labels() { let mut test = new_test(); test.handler.event = "pull_request".into(); test.handler.action = "closed".into(); test.handler.data.pull_request = some_pr(); if let Some(ref mut pr) = test.handler.data.pull_request { pr.merged = Some(true...
rust_cleaned_test_functions.jsonl/89648
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 585 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 65693, 7893, 90702, 6536, 14547, 368, 341, 262, 1077, 5206, 1273, 284, 501, 4452, 543, 262, 1273, 31171, 5773, 284, 330, 23441, 7893, 3263, 18122, 543, 262, 1273, 31171, 12395, 284, 330, 34087, 32...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_generate_type_check_empty() { let types = &[]; let expected = quote! { let __usdt_private_args_lambda = $args_lambda; let _ = || { let _: () = __usdt_private_args_lambda(); }; }; let block = generate_type_check("...
rust_cleaned_test_functions.jsonl/8786
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 205 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 48851, 1819, 7200, 15124, 368, 341, 286, 1077, 4494, 284, 609, 15078, 286, 1077, 3601, 284, 12641, 0, 341, 310, 1077, 1304, 355, 8047, 26249, 8384, 51884, 284, 400, 2116, 51884, 280, 310, 1077, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_json_as_int() { test_none_with_ctx(cast_json_as_any::<Int>); // no overflow let cs = vec![ ( Json::from_object(BTreeMap::default()).unwrap(), 0, false, true, ), ...
rust_cleaned_test_functions.jsonl/1955
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1900 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 9455, 11898, 4042, 368, 341, 286, 1273, 31488, 6615, 15147, 1337, 559, 9455, 11898, 37248, 27638, 1072, 29, 626, 286, 442, 902, 16484, 198, 286, 1077, 10532, 284, 7486, 90515, 3374, 310, 2399, 394...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_321_variable_expansion() { let mut templates = [ UriTemplate::new("{count}"), UriTemplate::new("{count*}"), UriTemplate::new("{/count}"), UriTemplate::new("{/count*}"), UriTemplate::new("{;count}"), UriTemplate::new("{;count*}"), UriTem...
rust_cleaned_test_functions.jsonl/36931
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 881 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 62, 18, 17, 16, 14635, 14214, 10501, 368, 341, 262, 1077, 5206, 19911, 284, 2278, 286, 17226, 7275, 486, 931, 13976, 1830, 92, 4461, 286, 17226, 7275, 486, 931, 13976, 1830, 9, 92, 4461, 286, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_get_country() { let mut exec = fasync::Executor::new().expect("failed to create an executor"); let (wlansvc_local, wlansvc_remote) = create_proxy::<DeviceServiceMarker>().expect("failed to create DeviceService service"); let mut wlansvc_stream = wlansvc_remote...
rust_cleaned_test_functions.jsonl/37344
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 563 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 3062, 28106, 368, 341, 286, 1077, 5206, 3883, 284, 282, 7692, 486, 25255, 486, 931, 1005, 17119, 445, 16091, 311, 1855, 458, 31558, 797, 286, 1077, 320, 26417, 596, 7362, 13564, 11, 44709, 596, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_is_all() { assert!(Flags::all().is_all()); assert!(!FlagA.is_all()); assert!(FlagABC.is_all()); assert!(AnotherFlag.is_all()); }
rust_cleaned_test_functions.jsonl/13426
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 98 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6892, 5705, 368, 341, 286, 2060, 10297, 9195, 486, 541, 1005, 285, 5705, 1423, 286, 2060, 0, 3471, 12135, 32, 2079, 5705, 1423, 286, 2060, 10297, 12135, 25411, 2079, 5705, 5231, 286, 2060, 10297, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_axfr() { let mut authority = create_example(); authority.set_allow_axfr(true); let query = LowerQuery::from(Query::query( Name::from_str("example.com.").unwrap(), RecordType::AXFR, )); let result = authority .search(&query, false, Supp...
rust_cleaned_test_functions.jsonl/48174
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 205 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 42385, 1626, 368, 341, 262, 1077, 5206, 11198, 284, 1855, 39304, 543, 262, 11198, 980, 55731, 42385, 1626, 3715, 626, 9401, 14808, 262, 1077, 3239, 284, 27536, 2859, 486, 1499, 59036, 486, 1631, 1...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_fac() { let r = parse_and_eval( r#" block 0 { r2 = 1; r1 = 5; goto(1); } block 1 { ifz r1 { exit(r2); } else { ...
rust_cleaned_test_functions.jsonl/55935
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 380 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 41589, 368, 341, 286, 1077, 435, 284, 4715, 8378, 21296, 1006, 310, 435, 2, 698, 310, 2504, 220, 15, 341, 394, 435, 17, 284, 220, 16, 280, 394, 435, 16, 284, 220, 20, 280, 394, 7986, 7, 16...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_slot_subscription() { let pubsub_addr = SocketAddr::new( IpAddr::V4(Ipv4Addr::new(0, 0, 0, 0)), rpc_port::DEFAULT_RPC_PUBSUB_PORT, ); let exit = Arc::new(AtomicBool::new(false)); let GenesisConfigInfo { genesis_config, .. } = create_genesis_config(10_000); let...
rust_cleaned_test_functions.jsonl/10201
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 920 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 27563, 59838, 368, 341, 262, 1077, 6675, 1966, 7387, 284, 20954, 13986, 486, 931, 1006, 286, 35033, 13986, 486, 53, 19, 8972, 30168, 19, 13986, 486, 931, 7, 15, 11, 220, 15, 11, 220, 15, 11, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
4
#[test] fn test_context_function_build_arg_from_ctx() -> Result<()> { use pretty_assertions::assert_eq; let ctx = crate::tests::try_create_context()?; // Ok. { let args = ContextFunction::build_args_from_ctx("database".clone(), ctx.clone())?; assert_eq!("default", format!("{:?}"...
rust_cleaned_test_functions.jsonl/27874
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 219 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 8467, 9174, 20801, 6057, 5673, 15147, 368, 1464, 5714, 71698, 341, 262, 990, 5020, 16553, 908, 486, 2207, 10714, 280, 262, 1077, 5635, 284, 17717, 486, 23841, 486, 1539, 8657, 8467, 368, 69493, 26...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_multiple_constraints() { let constraint = Constraint { a: 1, b: 2, c: 3, qm: Scalar::zero(), ql: Scalar::one(), qr: Scalar::one(), qo: -Scalar::one(), qc: Scalar::zero(), }; le...
rust_cleaned_test_functions.jsonl/28103
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 976 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 45233, 60267, 368, 341, 286, 1077, 21568, 284, 44264, 341, 310, 264, 25, 220, 16, 345, 310, 293, 25, 220, 17, 345, 310, 272, 25, 220, 18, 345, 310, 2804, 76, 25, 35176, 486, 14154, 3148, 310...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_long_to_long() { assert_less(Variant::from(1_i64), Variant::from(2_i64)); assert_equal(Variant::from(3_i64), Variant::from(3_i64)); assert_greater(Variant::from(5_i64), Variant::from(4_i64)); }
rust_cleaned_test_functions.jsonl/84527
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 136 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 17799, 2346, 17799, 368, 341, 310, 2060, 50747, 12410, 15341, 486, 1499, 7, 16, 5318, 21, 19, 701, 39292, 486, 1499, 7, 17, 5318, 21, 19, 1106, 310, 2060, 11478, 12410, 15341, 486, 1499, 7, 18...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_optimize_switch_with_default_case_with_fallthru() { test( concat!( "function f() {", " switch(a) {", " case 'x':", " case foo():", " default: return 3", " }", "}", ), "foo()...
rust_cleaned_test_functions.jsonl/401
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 209 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 15032, 11853, 27652, 6615, 9993, 19096, 6615, 761, 541, 339, 2672, 368, 341, 262, 1273, 1006, 286, 33720, 33673, 310, 330, 1688, 282, 368, 314, 756, 310, 330, 220, 3398, 2877, 8, 314, 756, 310, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_vec_list_insert_after_panic_index_invalidated() { let mut list = VecList::new(); let index = list.push_front(0); list.remove(index); list.insert_after(index, 1); }
rust_cleaned_test_functions.jsonl/11532
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 104 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 13251, 2019, 17678, 19844, 620, 31270, 3560, 31433, 657, 368, 341, 286, 1077, 5206, 1140, 284, 11312, 852, 486, 931, 543, 286, 1077, 1922, 284, 1140, 2552, 22926, 7, 15, 317, 286, 1140, 4850, 71...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_create_revoke_client() { run_e2e_client_test(4, |mut client| { let resp = client .create_symmetric_key(CryptographicAlgorithm::AES, 128) .unwrap(); eprintln!("{:?}", resp); let get = client.get(&resp.unique_identifier)...
rust_cleaned_test_functions.jsonl/56504
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 466 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 8657, 1288, 7621, 8179, 368, 341, 286, 1598, 2204, 17, 68, 8179, 4452, 7, 19, 11, 760, 6984, 2943, 91, 341, 310, 1077, 9039, 284, 2943, 198, 394, 659, 3182, 26825, 15903, 3097, 3025, 3571, 126...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_bounded_queue_inspect() { let inspect = inspect::Inspector::new(); let queue_inspect = inspect.root().create_child("queue"); let mut queue: BoundedQueue<Record> = BoundedQueue::new( 3 * std::mem::size_of::<Record>(), Duration::new(0, 0), ...
rust_cleaned_test_functions.jsonl/120998
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 418 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 880, 13082, 10841, 34386, 987, 368, 341, 286, 1077, 24085, 284, 24085, 486, 46230, 486, 931, 543, 286, 1077, 7177, 34386, 987, 284, 24085, 12576, 1005, 3182, 17268, 445, 4584, 797, 286, 1077, 5206...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_file_offset() { let file = TempFile::new().unwrap().into_file(); let start = 1234; let file_offset = FileOffset::new(file, start); assert_eq!(file_offset.start(), start); assert_eq!( file_offset.file() as *const File, file_offset.ar...
rust_cleaned_test_functions.jsonl/46436
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 175 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2458, 6917, 368, 341, 286, 1077, 1034, 284, 19944, 1703, 486, 931, 1005, 15454, 1005, 18122, 2458, 543, 286, 1077, 1191, 284, 220, 16, 17, 18, 19, 280, 286, 1077, 1034, 6917, 284, 2887, 6446, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_esprima_basic() { let esprima = Esprima::new(); let parsed = esprima.parse_str("function foo() {}") .unwrap(); let expected = json!({ "body": [{ "body": { "body":[], "type":"BlockStatement" }, "expres...
rust_cleaned_test_functions.jsonl/64669
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 363 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 33741, 649, 7523, 34729, 368, 341, 262, 1077, 1531, 649, 7523, 284, 9236, 649, 7523, 486, 931, 543, 262, 1077, 15676, 284, 1531, 649, 7523, 4632, 2895, 445, 1688, 15229, 368, 4687, 1138, 286, 65...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_contains() { let mut buf = Buffer::new(); buf.insert(0, &['a', 'b', 'c', 'd', 'e', 'f', 'g']); let mut buf2 = Buffer::new(); buf2.insert(0, &['a', 'b', 'c']); assert_eq!(buf.contains(&buf2), true); let mut buf2 = Buffer::new(); buf2.insert(...
rust_cleaned_test_functions.jsonl/61898
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 274 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 63598, 368, 341, 286, 1077, 5206, 6607, 284, 10312, 486, 931, 543, 286, 6607, 7030, 7, 15, 11, 609, 677, 64, 516, 364, 65, 516, 364, 66, 516, 364, 67, 516, 364, 68, 516, 364, 69, 516, 364,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_resolve_with_filter() { let mut rt = Runtime::new().unwrap(); // should always resolve to something and keep this test from being flaky. let f = async move { // this should always return something let addrs = resolve_with_filter(IpFilter...
rust_cleaned_test_functions.jsonl/98947
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 604 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 77291, 6615, 8727, 368, 341, 286, 1077, 5206, 16677, 284, 10954, 486, 931, 1005, 15454, 1428, 1789, 286, 442, 1265, 2677, 8830, 311, 2494, 323, 2506, 419, 1273, 504, 1660, 1320, 28100, 382, 286, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_random_extreme_thresholds() { let mut rng = rand::thread_rng(); let sks = SecretKeySet::random(0, &mut rng); assert_eq!(0, sks.threshold()); assert!(SecretKeySet::try_random(usize::max_value(), &mut rng).is_err()); }
rust_cleaned_test_functions.jsonl/30567
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 129 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 22644, 9927, 9634, 21858, 82, 368, 341, 286, 1077, 5206, 28422, 284, 10382, 486, 4528, 66849, 543, 286, 1077, 1901, 82, 284, 8599, 1592, 1649, 486, 11463, 7, 15, 11, 609, 6984, 28422, 317, 286, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_reduce_middleware() { let initial_state = TestState { counter: 0 }; let store = StoreRef::new(TestReducer, initial_state); let callback_test = Rc::new(RefCell::new(0)); let callback_test_copy = callback_test.clone(); let callback: Callback<TestState, Test...
rust_cleaned_test_functions.jsonl/69274
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 375 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 64596, 717, 11603, 368, 341, 286, 1077, 2856, 4387, 284, 3393, 1397, 314, 5546, 25, 220, 15, 2605, 286, 1077, 3553, 284, 9129, 3945, 486, 931, 31159, 20874, 11, 2856, 4387, 626, 286, 1077, 4822,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_generate_post_dynamic_to_fixed_input() { let dynamic_a = GeneratePoStDynamicSectorsCountInput { post_config: TEST_CONFIG, challenge_seed: [0; 32], input_parts: vec![], }; let dynamic_b = GeneratePoStDynamicSectorsCountInput { ...
rust_cleaned_test_functions.jsonl/6741
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1034 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 48851, 6333, 45992, 2346, 37839, 5898, 368, 341, 286, 1077, 8741, 4306, 284, 19813, 32904, 623, 21752, 50, 10605, 2507, 2505, 341, 310, 1736, 5332, 25, 13602, 12568, 345, 310, 8645, 33809, 25, 508...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_vote_process_instruction_decode_bail() { assert_eq!( super::process_instruction(&Pubkey::default(), &[], &[],), Err(InstructionError::NotEnoughAccountKeys), ); }
rust_cleaned_test_functions.jsonl/74409
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 109 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 54360, 11305, 54923, 15227, 880, 604, 368, 341, 286, 2060, 10714, 33673, 310, 2256, 486, 4630, 54923, 2099, 29162, 792, 486, 2258, 1507, 609, 12995, 609, 12995, 1326, 310, 15495, 7, 16664, 1454, 4...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_note_is_tonic_first_note() { let constraint: Box<dyn SinglePartConstraint> = Box::new(NoteIsTonic(0)); assert!(constraint.is_active(&vec![], 10)); assert!(!constraint.is_active(&vec![PitchClassOctave(PC::from_str("E").unwrap(), 1)], 10)); run_scale_free_test(&cons...
rust_cleaned_test_functions.jsonl/74361
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 190 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 27207, 6892, 528, 14011, 12978, 27207, 368, 341, 286, 1077, 21568, 25, 8261, 92846, 11327, 5800, 17890, 29, 284, 8261, 486, 931, 89389, 3872, 51, 14011, 7, 15, 1106, 286, 2060, 10297, 48057, 2079,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_day08() { let test_input = "nop +0 acc +1 jmp +4 acc +3 jmp -3 acc -99 acc +1 jmp -4 acc +6" .to_owned(); assert_eq!(part1(&parse(&test_input)), 5); assert_eq!(part2(&parse(&test_input)), 8); }
rust_cleaned_test_functions.jsonl/28052
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 142 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 16763, 15, 23, 368, 341, 286, 1077, 1273, 5898, 284, 330, 62813, 488, 15, 198, 4475, 488, 16, 198, 61055, 488, 19, 198, 4475, 488, 18, 198, 61055, 481, 18, 198, 4475, 481, 24, 24, 198, 4475,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_multi_time_parse() { assert_eq!( parse_duration::parse("2.5s500ms").unwrap(), Duration::from_secs(3) ) }
rust_cleaned_test_functions.jsonl/7236
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 97 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 25133, 3009, 21039, 368, 341, 286, 2060, 10714, 33673, 310, 4715, 25454, 486, 6400, 445, 17, 13, 20, 82, 20, 15, 15, 1011, 1827, 15454, 3148, 310, 21045, 486, 1499, 68718, 7, 18, 340, 286, 172...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_read_unsigned_limits() { assert_eq!( read_unsigned(&cbor_unsigned!(std::u64::MAX)), Ok(std::u64::MAX) ); assert_eq!( read_unsigned(&cbor_unsigned!((std::i64::MAX as u64) + 1)), Ok((std::i64::MAX as u64) + 1) ); ...
rust_cleaned_test_functions.jsonl/51434
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 580 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6443, 67830, 31820, 368, 341, 286, 2060, 10714, 33673, 310, 1349, 67830, 2099, 7221, 269, 67830, 10297, 1834, 486, 84, 21, 19, 486, 10586, 6965, 310, 7622, 5194, 486, 84, 21, 19, 486, 10586, 340...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_map_str() { let c = make(); let m: Map<String, String> = c.get("place.creator").unwrap(); if cfg!(feature = "preserve_order") { assert_eq!( m.into_iter().collect::<Vec<(String, String)>>(), vec![ ("name".to_string(), "John Smith".to_st...
rust_cleaned_test_functions.jsonl/39927
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 308 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 5376, 2895, 368, 341, 262, 1077, 272, 284, 1281, 543, 262, 1077, 296, 25, 5027, 3464, 11, 923, 29, 284, 272, 670, 445, 2007, 79660, 1827, 15454, 1428, 262, 421, 13286, 10297, 12753, 284, 330, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_ends_with_path() { macro_rules! t( (s: $path:expr, $child:expr, $exp:expr) => ( { let path = Path::new($path); let child = Path::new($child); assert_eq!(path.ends_with_path(&child), $exp); ...
rust_cleaned_test_functions.jsonl/105888
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 906 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 90729, 6615, 2638, 368, 341, 286, 18072, 21407, 0, 259, 1006, 310, 320, 82, 25, 400, 2343, 96011, 11, 400, 3048, 96011, 11, 400, 4580, 96011, 8, 589, 2399, 394, 341, 503, 1077, 1815, 284, 7933...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_ascii_uppercase() { assert_eq!(Atom::from("").to_ascii_uppercase(), Atom::from("")); assert_eq!(Atom::from("aZ9").to_ascii_uppercase(), Atom::from("AZ9")); assert_eq!(Atom::from("The Quick Brown Fox!").to_ascii_uppercase(), Atom::from("THE QUICK BROWN FOX!")); ass...
rust_cleaned_test_functions.jsonl/80901
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 196 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 50238, 34445, 5638, 368, 341, 286, 2060, 10714, 10297, 35836, 486, 1499, 80821, 983, 50238, 34445, 5638, 1507, 39516, 486, 1499, 89744, 286, 2060, 10714, 10297, 35836, 486, 1499, 445, 64, 57, 24, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_lines_in_range_simple() { let ranges_to_test = vec![ (("foo.rs", 1, 10), ("foo.rs", 5, 12)), (("foo.rs", 1, 10), ("foo.rs", 5, 11)), (("foo.rs", 1, 10), ("foo.rs", 10, 19)), (("foo.rs", 1, 10), ("foo.rs", 9, 12)), (("foo.rs", 8,...
rust_cleaned_test_functions.jsonl/28050
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 233 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 18323, 1243, 9698, 30015, 368, 341, 286, 1077, 21283, 2346, 4452, 284, 7486, 90515, 310, 89101, 7975, 25638, 497, 220, 16, 11, 220, 16, 15, 701, 3489, 7975, 25638, 497, 220, 20, 11, 220, 16, 1...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_empty_environment_is_removed() { let mut event = Annotated::new(Event { environment: Annotated::new("".to_string()), ..Event::default() }); let mut processor = NormalizeProcessor::default(); process_value(&mut event, &mut processor, ProcessingState::root()).unwra...
rust_cleaned_test_functions.jsonl/14089
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 155 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 15124, 51774, 6892, 68248, 368, 341, 262, 1077, 5206, 1538, 284, 1527, 87029, 486, 931, 30469, 341, 286, 4573, 25, 1527, 87029, 486, 931, 445, 3263, 983, 3904, 14702, 286, 5241, 1556, 486, 2258, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_process_acceptance_message() { init!("true"); let handle = create_connection("test_process_acceptance_message").unwrap(); let message = serde_json::from_str(INVITE_ACCEPTED_RESPONSE).unwrap(); assert_eq!(error::SUCCESS.code_num, process_acceptance_message(handle, ...
rust_cleaned_test_functions.jsonl/34230
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 140 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 11305, 35728, 681, 6462, 368, 341, 286, 2930, 17223, 1866, 797, 286, 1077, 3705, 284, 1855, 15866, 445, 1944, 11305, 35728, 681, 6462, 1827, 15454, 543, 286, 1077, 1943, 284, 61570, 9455, 486, 149...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_deduct() { let mut deps = mock_dependencies(&[]); let tax_rate = Decimal::percent(2); let tax_cap = Uint128::from(1_000_000u128); deps.querier.with_tax( Decimal::percent(2), &[(&"uusd".to_string(), &Uint128::from(1000000u128))], ); let amount = Uint128::...
rust_cleaned_test_functions.jsonl/8665
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 356 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 814, 80500, 368, 341, 262, 1077, 5206, 48178, 284, 7860, 71841, 2099, 1294, 626, 262, 1077, 3742, 9246, 284, 26728, 486, 24422, 7, 17, 317, 262, 1077, 3742, 16388, 284, 27883, 16, 17, 23, 486, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_deletions_ouside_band() { let x = b"AAAAATTGAGGAGTAATAGTAAA"; let y = b"AAAAAAAAAAAAGGAAGG"; let base_score = Scoring::from_scores(-13, 0, 1, -5); let scoring = Scoring { xclip_prefix: 0, xclip_suffix: -136, yclip_prefix: -112, ...
rust_cleaned_test_functions.jsonl/126767
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 741 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2259, 1149, 908, 62, 782, 577, 45344, 368, 341, 286, 1077, 856, 284, 293, 1, 25699, 21614, 38, 1890, 38, 1890, 15204, 828, 1890, 51, 50107, 876, 286, 1077, 379, 284, 293, 1, 57905, 50107, 1890...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_rchunksator() { let v = &[1, 2, 3, 4, 5]; assert_eq!(v.rchunks(2).len(), 3); let chunks: &[&[_]] = &[&[4, 5], &[2, 3], &[1]]; assert_eq!(v.rchunks(2).collect::<Vec<_>>(), chunks); let chunks: &[&[_]] = &[&[3, 4, 5], &[1, 2]]; assert_eq!(v.rchunks(3).collect::<Vec<_>>(),...
rust_cleaned_test_functions.jsonl/12905
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 298 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 1710, 84263, 850, 368, 341, 262, 1077, 348, 284, 44590, 16, 11, 220, 17, 11, 220, 18, 11, 220, 19, 11, 220, 20, 4821, 262, 2060, 10714, 10297, 85, 1746, 84263, 7, 17, 568, 2892, 1507, 220, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_union() { let ir = ir_from_cc("union SomeUnion { int first_field; int second_field; };").unwrap(); assert_ir_matches!( ir, quote! { Record { rs_name: "SomeUnion" ... cc_name: "SomeUnion" ... fields: [ ...
rust_cleaned_test_functions.jsonl/37206
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 907 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 51621, 368, 341, 262, 1077, 6216, 284, 6216, 5673, 28955, 445, 16192, 4329, 32658, 314, 526, 1156, 5013, 26, 526, 2086, 5013, 26, 20066, 1827, 15454, 543, 262, 2060, 51433, 38344, 33673, 286, 6216...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_level2() { delay(); let found_snapshot = Arc::new(AtomicBool::new(false)); let found_snapshot_2 = found_snapshot.clone(); let found_l2update = Arc::new(AtomicBool::new(false)); let found_l2update_2 = found_l2update.clone(); // hard to check in san...
rust_cleaned_test_functions.jsonl/118782
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 842 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 8274, 17, 368, 341, 286, 7626, 543, 286, 1077, 1730, 53265, 284, 19689, 486, 931, 7, 65857, 11233, 486, 931, 3576, 1106, 286, 1077, 1730, 53265, 62, 17, 284, 1730, 53265, 15997, 543, 286, 1077, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
4
#[test] fn test_reading_single_line() { let mut pointer = "9q5".as_bytes(); let reader = Reader::new(&mut pointer); assert_eq!(1, reader.count()); }
rust_cleaned_test_functions.jsonl/100197
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 84 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 81859, 19487, 6528, 368, 341, 286, 1077, 5206, 7445, 284, 330, 24, 80, 20, 3263, 300, 12524, 543, 286, 1077, 6604, 284, 25166, 486, 931, 2099, 6984, 7445, 317, 286, 2060, 10714, 10297, 16, 11, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_take_random() -> Result<()> { // Test DFUint16Array let df_uint16_array = &DFUInt16Array::new_from_iter(1u16..4u16); // Create TakeRandBranch for the array let taker = df_uint16_array.take_rand(); // Call APIs defined in trait TakeRandom assert_eq!(Some(1u16), taker.get(0...
rust_cleaned_test_functions.jsonl/13062
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 758 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 73261, 22644, 368, 1464, 5714, 71698, 341, 262, 442, 3393, 43376, 21570, 16, 21, 1857, 198, 262, 1077, 6764, 15807, 16, 21, 3858, 284, 609, 5262, 18777, 16, 21, 1857, 486, 931, 5673, 11723, 7, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_config_with_invalid_options() { let query = "query"; let file = File::open("./test-data/test.txt").unwrap(); let config = Config::new(Some("vi"), query, &file); assert_eq!(config.is_err(), true); }
rust_cleaned_test_functions.jsonl/63338
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 116 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 5332, 6615, 31433, 8743, 368, 341, 286, 1077, 3239, 284, 330, 1631, 876, 286, 1077, 1034, 284, 2887, 486, 2508, 13988, 1944, 13945, 12697, 3909, 1827, 15454, 543, 286, 1077, 2193, 284, 5532, 486, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_partition_limits_boundary5() { let mut part = Partition::new(100, 1000, 100, true); part.allocate_causetids(901); // One more than allowed. }
rust_cleaned_test_functions.jsonl/13984
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 80 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 43840, 31820, 54004, 20, 368, 341, 286, 1077, 5206, 949, 284, 54626, 486, 931, 7, 16, 15, 15, 11, 220, 16, 15, 15, 15, 11, 220, 16, 15, 15, 11, 830, 317, 286, 949, 68726, 666, 11855, 295, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_unix_datagram_recv() { let dir = tmpdir(); let path1 = dir.path().join("sock1"); let sock1 = or_panic!(UnixDatagram::bind(&path1)); let sock2 = or_panic!(UnixDatagram::unbound()); or_panic!(sock2.connect(&path1)); let msg = b"hello world"; ...
rust_cleaned_test_functions.jsonl/13728
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 254 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 80572, 15353, 5745, 36118, 368, 341, 286, 1077, 5419, 284, 4174, 3741, 543, 286, 1077, 1815, 16, 284, 5419, 3875, 1005, 5987, 445, 13199, 16, 3071, 286, 1077, 11087, 16, 284, 476, 620, 31270, 10...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_encode_histogram() { let metric = Metric { name: "requests".to_owned(), timestamp: None, tags: None, kind: MetricKind::Absolute, value: MetricValue::AggregatedHistogram { buckets: vec![1.0, 2.1, 3.0], ...
rust_cleaned_test_functions.jsonl/120140
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 477 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 11224, 68564, 368, 341, 286, 1077, 18266, 284, 52458, 341, 310, 829, 25, 330, 36242, 3263, 983, 51973, 3148, 310, 11441, 25, 2240, 345, 310, 9492, 25, 2240, 345, 310, 3093, 25, 52458, 10629, 486...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_struct() -> Result<()> { use hex_literal::hex; #[bitcoin_code(crate = "crate")] #[derive(BitcoinCode, PartialEq, Debug)] struct Test { int: u32, seq: Vec<Vec<u8>>, } let j = hex!("010000000201770199"); let expected ...
rust_cleaned_test_functions.jsonl/77193
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 281 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 15126, 368, 1464, 5714, 71698, 341, 286, 990, 12371, 34100, 486, 17308, 280, 286, 11506, 83910, 4136, 54907, 284, 330, 61711, 5422, 286, 11506, 27098, 68653, 7160, 2078, 11, 55039, 11, 11091, 5563, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_redirect_301_and_302_and_303_changes_post_to_get() { let client = reqwest::Client::new(); let codes = [301, 302, 303]; for code in codes.iter() { let redirect = server! { request: format!("\ POST /{} HTTP/1.1\r\n\ user-agent: $USER...
rust_cleaned_test_functions.jsonl/105509
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1062 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 30043, 62, 18, 15, 16, 8378, 62, 18, 15, 17, 8378, 62, 18, 15, 18, 47526, 6333, 2346, 3062, 368, 341, 262, 1077, 2943, 284, 4232, 11039, 486, 2959, 486, 931, 543, 262, 1077, 13912, 284, 508,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_matrix_components1() { let matrix = Matrix2x2::new(1_i32, 2_i32, 3_i32, 4_i32); assert_eq!(matrix[0][0], 1_i32); assert_eq!(matrix[0][1], 2_i32); assert_eq!(matrix[1][0], 3_i32); assert_eq!(matrix[1][1], 4_i32); }
rust_cleaned_test_functions.jsonl/128952
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 165 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 10193, 23258, 16, 368, 341, 286, 1077, 6172, 284, 11631, 17, 87, 17, 486, 931, 7, 16, 5318, 18, 17, 11, 220, 17, 5318, 18, 17, 11, 220, 18, 5318, 18, 17, 11, 220, 19, 5318, 18, 17, 626, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_single_reference_after_initialzation() { test("var a; a = foo();a;", "foo();"); test_same("var a; if (a = foo()) { alert(3); } a;"); test_same("var a; switch (a = foo()) {} a;"); test_same("var a; function f(){ return a = foo(); } a;"); test_same("function f(){ var a; return ...
rust_cleaned_test_functions.jsonl/27621
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 268 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 19487, 25433, 19844, 15809, 89, 367, 368, 341, 262, 1273, 445, 947, 264, 26, 264, 284, 15229, 2129, 64, 32503, 330, 7975, 2129, 797, 262, 1273, 33574, 445, 947, 264, 26, 421, 320, 64, 284, 152...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_tcp_sack_block() { let sack = TcpSackBlock::new(1, 2); assert_eq!(sack.left_edge.get(), 1); assert_eq!(sack.right_edge.get(), 2); assert_eq!(sack.left_edge(), 1); assert_eq!(sack.right_edge(), 2); }
rust_cleaned_test_functions.jsonl/121768
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 167 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 45562, 643, 473, 7113, 368, 341, 310, 1077, 52333, 284, 64876, 50, 473, 4713, 486, 931, 7, 16, 11, 220, 17, 317, 310, 2060, 10714, 10297, 82, 473, 8272, 17932, 670, 1507, 220, 16, 317, 310, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_get_valid_interface() { let iface_name = "eth0".to_string(); let mut interfaces: Vec<NetworkInterface> = vec![]; let intf_eth0 = NetworkInterface { name: "eth0".to_string(), index: 0, mac: None, ips: vec![], fla...
rust_cleaned_test_functions.jsonl/41629
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 428 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 3062, 8337, 20546, 368, 341, 286, 1077, 49313, 1269, 284, 330, 769, 15, 3263, 983, 3904, 543, 286, 1077, 5206, 24099, 25, 11312, 27, 12320, 5051, 29, 284, 7486, 0, 40901, 286, 1077, 93706, 57757...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_zero_size() { let data = [(), (), ()]; let traversal: Vec<()> = data.as_slice().map(|&x| x).collect(); assert_eq!(&*traversal, data.as_slice()); }
rust_cleaned_test_functions.jsonl/117263
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 97 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 19359, 2368, 368, 341, 286, 1077, 821, 284, 508, 1507, 38104, 1719, 935, 286, 1077, 56302, 25, 11312, 71698, 284, 821, 5357, 26488, 1005, 2186, 22428, 5, 87, 91, 856, 568, 17384, 543, 286, 2060,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_pop_covar_consistent_with_pop_var() { let mut data = testing::load_data("nist/lottery.txt"); assert_almost_eq!((&data).population_variance(), (&data).population_covariance(&data), 1e-10); data = testing::load_data("nist/lew.txt"); assert_almost_eq!((&data).popula...
rust_cleaned_test_functions.jsonl/55247
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 360 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 17061, 50028, 277, 31971, 18128, 6615, 17061, 4612, 368, 341, 286, 1077, 5206, 821, 284, 7497, 486, 1078, 1769, 445, 64759, 14, 9184, 17615, 3909, 797, 286, 2060, 94418, 10714, 0, 42902, 691, 568,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_status_service_fail_endpoints() { let _guard = fail::FailScenario::setup(); let config = TiKvConfig::default(); let mut status_server = StatusServer::new(1, config); let _ = status_server.start("127.0.0.1:0".to_string()); let client = Client::new(); ...
rust_cleaned_test_functions.jsonl/47232
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 2996 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 4773, 12267, 22121, 6213, 7706, 368, 341, 286, 1077, 716, 26098, 284, 3690, 486, 19524, 54031, 486, 15188, 543, 286, 1077, 2193, 284, 22325, 42, 85, 2648, 486, 2258, 543, 286, 1077, 5206, 2639, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_create_triangle() { let mut dcel = DCEL::new(); let v0 = dcel.insert_vertex(()); let v1 = dcel.insert_vertex(()); let v2 = dcel.insert_vertex(()); let e01 = dcel.connect_two_isolated_vertices(v0, v1, 0); let e12 = dcel.connect_edge_to_isolated_vert...
rust_cleaned_test_functions.jsonl/7373
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 929 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 8657, 70575, 368, 341, 286, 1077, 5206, 294, 3672, 284, 422, 41664, 486, 931, 543, 286, 1077, 348, 15, 284, 294, 3672, 7030, 26611, 7, 1423, 286, 1077, 348, 16, 284, 294, 3672, 7030, 26611, 7,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_record_special_member_access_specifiers() { let ir = ir_from_cc( " struct SomeStruct { private: SomeStruct(SomeStruct& s); protected: SomeStruct(SomeStruct&& s); public: ~SomeStruct(); }; ", ) ...
rust_cleaned_test_functions.jsonl/37164
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 376 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 14192, 41629, 19388, 12759, 13594, 11836, 368, 341, 262, 1077, 6216, 284, 6216, 5673, 28955, 1006, 286, 6228, 286, 2036, 4329, 9422, 341, 688, 869, 510, 310, 4329, 9422, 65405, 9422, 5, 274, 317, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_output_read() -> Result<(), Box<dyn Error>> { TestSample { source: StringLiteral(",..+"), expected_result: Some(BinaryLiteral(&[11][..])), expected_output: Some(BinaryLiteral(&[10, 10][..])), input_data: Some(BinaryLiteral(&[10][..])), }.run() }
rust_cleaned_test_functions.jsonl/20222
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 145 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 7645, 6443, 368, 1464, 5714, 68843, 8261, 92846, 4600, 2452, 341, 262, 3393, 17571, 341, 286, 2530, 25, 923, 17350, 12918, 496, 10, 4461, 286, 3601, 5287, 25, 4329, 77833, 17350, 2099, 58, 16, 1...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_get_neighbors_linux() { use crate::KI; use std::os::unix::process::ExitStatusExt; use std::process::ExitStatus; use std::process::Output; KI.set_mock(Box::new(move |program, args| { assert_eq!(program, "ip"); assert_eq!(args, &["neigh"]); Ok(Output ...
rust_cleaned_test_functions.jsonl/33712
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 608 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 3062, 55925, 77463, 368, 341, 262, 990, 17717, 486, 80971, 401, 262, 990, 1460, 486, 436, 486, 56646, 486, 4630, 486, 15339, 2522, 6756, 280, 262, 990, 1460, 486, 4630, 486, 15339, 2522, 280, 26...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_register_virtio_device() { let start_addr1 = GuestAddress(0x0); let start_addr2 = GuestAddress(0x1000); let guest_mem = GuestMemoryMmap::from_ranges(&[(start_addr1, 0x1000), (start_addr2, 0x1000)]).unwrap(); let mut vm = builder::setup_kvm_vm(&guest_me...
rust_cleaned_test_functions.jsonl/34958
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 443 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 14000, 2273, 2106, 815, 9204, 368, 341, 286, 1077, 1191, 7387, 16, 284, 26215, 4286, 7, 15, 87, 15, 317, 286, 1077, 1191, 7387, 17, 284, 26215, 4286, 7, 15, 87, 16, 15, 15, 15, 317, 286, 1...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_generate_getter_from_field_with_visibility_marker() { check_assist( generate_getter, r#" pub(crate) struct Context { dat$0a: Data, } "#, r#" pub(crate) struct Context { data: Data, } impl Context { /// Get a reference to the context's data...
rust_cleaned_test_functions.jsonl/127256
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 214 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 48851, 3062, 465, 5673, 5013, 6615, 71256, 26267, 368, 341, 286, 1779, 12083, 380, 1006, 310, 6923, 3062, 465, 345, 310, 435, 2, 698, 9585, 54907, 8, 2036, 9608, 341, 262, 3258, 3, 15, 64, 25,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_example_toml_startup() { named_test_harness("example.toml", |_, tcp_port, _, _| { let mut io_loop = Runtime::new().unwrap(); let addr: SocketAddr = SocketAddr::new( Ipv4Addr::new(127, 0, 0, 1).into(), tcp_port.expect("no tcp_port"), ); ...
rust_cleaned_test_functions.jsonl/88395
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 566 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 39304, 528, 316, 75, 80858, 368, 341, 262, 6941, 4452, 1523, 23518, 445, 8687, 73494, 75, 497, 760, 6878, 28051, 8716, 11, 8358, 85137, 341, 286, 1077, 5206, 6399, 17198, 284, 10954, 486, 931, 1...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_stream_lookup_dft_fault() { let spec = "output a: UInt8 := 3\n output b: Bool := a[-1].defaults(to: false)"; assert_eq!(1, num_type_errors(spec)); }
rust_cleaned_test_functions.jsonl/110674
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 95 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 12673, 27464, 814, 723, 70097, 368, 341, 286, 1077, 1398, 284, 330, 3006, 264, 25, 22275, 23, 1669, 220, 18, 1699, 2550, 293, 25, 12608, 1669, 264, 7609, 16, 936, 26756, 12186, 25, 895, 24023, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_push_maybe_quoted_string() { assert_eq!(push_maybe_quoted_string(String::from_str("foo,"), &String::from_str("bar")), String::from_str("foo,bar")); assert_eq!(push_maybe_quoted_string(String::from_str("foo,"), &String::from_str("bar/baz")), String::from_str("foo,\"bar/baz\"")); ...
rust_cleaned_test_functions.jsonl/8812
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 141 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 14218, 717, 49791, 11280, 9253, 3904, 368, 341, 286, 2060, 10714, 10297, 9077, 717, 49791, 11280, 9253, 3904, 2242, 486, 1499, 2895, 445, 7975, 1335, 701, 609, 703, 486, 1499, 2895, 445, 2257, 356...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_canonicalize_idents_by_lowercasing_github_urls() { let ident1 = ident(&url("https://github.com/PistonDevelopers/piston")); let ident2 = ident(&url("https://github.com/pistondevelopers/piston")); assert_eq!(ident1, ident2); }
rust_cleaned_test_functions.jsonl/74052
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 119 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 27421, 22391, 551, 842, 805, 3710, 30425, 66, 4422, 1889, 3827, 32822, 368, 341, 286, 1077, 3524, 16, 284, 3524, 2099, 1085, 445, 2428, 1110, 5204, 905, 16341, 58819, 20444, 388, 4322, 58819, 4010...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_date_addassignment() { let ymd = NaiveDate::from_ymd; let mut date = ymd(2016, 10, 1); date += Duration::days(10); assert_eq!(date, ymd(2016, 10, 11)); date += Duration::days(30); assert_eq!(date, ymd(2016, 11, 10)); }
rust_cleaned_test_functions.jsonl/4770
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 149 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 4164, 2891, 29951, 368, 341, 286, 1077, 379, 2277, 284, 12812, 533, 1916, 486, 1499, 62, 1600, 67, 280, 286, 1077, 5206, 2400, 284, 379, 2277, 7, 17, 15, 16, 21, 11, 220, 16, 15, 11, 220, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_parse_put_request() { assert!(parse_put_drive(&Body::new("invalid_payload"), Some(&"id")).is_err()); // PATCH with invalid fields. let body = r#"{ "drive_id": "bar", "is_read_only": false }"#; assert!(parse_put_drive(...
rust_cleaned_test_functions.jsonl/8226
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 728 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21039, 15557, 7893, 368, 341, 286, 2060, 10297, 6400, 15557, 67151, 2099, 5444, 486, 931, 445, 11808, 32813, 3975, 4329, 2099, 1, 307, 15197, 285, 9266, 5231, 286, 442, 59345, 448, 8318, 5043, 624...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_level_case_insensitive() { let cases = [ (Level::Fatal, [level_token("fatal")]), (Level::Error, [level_token("error")]), (Level::Warn, [level_token("warn")]), (Level::Info, [level_token("info")]), (Level::Debug, [level_token("de...
rust_cleaned_test_functions.jsonl/91798
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 255 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 8274, 19096, 34386, 18723, 368, 341, 286, 1077, 5048, 284, 2278, 310, 320, 4449, 486, 62396, 11, 508, 3294, 6458, 445, 74394, 899, 17036, 310, 320, 4449, 486, 1454, 11, 508, 3294, 6458, 445, 841...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_asn1_non_der_signature() { assert!(Signature::from_der(&[ der::Tag::Sequence.into(), 0x06, // length of below der::Tag::Integer.into(), 0x01, // length of value 0x01, // value=1 der::Tag::Integer.into(), ...
rust_cleaned_test_functions.jsonl/113398
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 496 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 11898, 77, 16, 21637, 35345, 39859, 368, 341, 1789, 286, 2060, 10297, 25088, 486, 1499, 35345, 2099, 9640, 310, 2694, 486, 5668, 486, 14076, 39860, 3148, 310, 220, 15, 87, 15, 21, 11, 442, 3084,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_memory_hotplug() { let focal = UbuntuDiskConfig::new(FOCAL_IMAGE_NAME.to_string()); let guest = Guest::new(Box::new(focal)); let api_socket = temp_api_path(&guest.tmp_dir); let kernel_path = direct_kernel_boot_path(); let mut child = ...
rust_cleaned_test_functions.jsonl/29408
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1621 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 19195, 33433, 47474, 368, 341, 310, 1077, 41099, 284, 34960, 47583, 2648, 486, 931, 7, 3788, 49533, 19121, 4708, 2389, 3904, 1423, 310, 1077, 8640, 284, 26215, 486, 931, 67758, 486, 931, 955, 3683...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_has_with_p_steps_v2() { let client = graph_serializer(GraphSON::V2); drop_vertices(&client, "test_has_with_p_steps").unwrap(); let g = traversal().with_remote(client); g.add_v("test_has_with_p_steps") .property("age", 26) .to_list() .unwrap(); let v...
rust_cleaned_test_functions.jsonl/26298
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 616 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21778, 6615, 620, 22731, 2273, 17, 368, 341, 262, 1077, 2943, 284, 4771, 67441, 63779, 2703, 486, 53, 17, 626, 262, 5943, 37720, 2099, 2972, 11, 330, 1944, 21778, 6615, 620, 22731, 1827, 15454, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_zero_on_nonzero_integer_missing_byte() { let bytes = &[0; 7]; assert_eq!( std::num::NonZeroUsize::try_from_slice(bytes) .unwrap_err() .to_string(), ERROR_UNEXPECTED_LENGTH_OF_INPUT ); }
rust_cleaned_test_functions.jsonl/103726
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 139 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 19359, 4470, 21637, 14154, 31725, 40447, 19737, 368, 341, 262, 1077, 5820, 284, 44590, 15, 26, 220, 22, 935, 262, 2060, 10714, 33673, 286, 1460, 486, 2413, 486, 8121, 17999, 52, 2141, 486, 1539, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_lazy_udf() { let df = get_df(); let new = df .lazy() .select([col("sepal.width").map(|s| Ok(s * 200.0), GetOutput::same_type())]) .collect() .unwrap(); assert_eq!( new.column("sepal.width").unwrap().f64().unwrap().get(0), Some(700.0) ...
rust_cleaned_test_functions.jsonl/108
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 174 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 49646, 71939, 69, 368, 341, 262, 1077, 6764, 284, 633, 10894, 543, 262, 1077, 501, 284, 6764, 198, 286, 659, 49013, 741, 286, 659, 1742, 2561, 2074, 445, 325, 19308, 5441, 1827, 2186, 22428, 82,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_equality() { assert_eq!(MetricValue::Int(1), MetricValue::Int(1)); assert_eq!(MetricValue::Float(1.0), MetricValue::Float(1.0)); assert_eq!(MetricValue::String("A".to_string()), MetricValue::String("A".to_string())); assert_eq!(MetricValue::Bool(true), Me...
rust_cleaned_test_functions.jsonl/36072
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1198 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2204, 10473, 368, 341, 1789, 286, 2060, 10714, 10297, 54310, 1130, 486, 1072, 7, 16, 701, 52458, 1130, 486, 1072, 7, 16, 1106, 286, 2060, 10714, 10297, 54310, 1130, 486, 5442, 7, 16, 13, 15, 7...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_multi_threaded_access() { // Use Arc from the Stdlib to keep track of observed values. let observations = ::std::sync::Arc::new( ::std::sync::Mutex::new( Vec::<i32>::new(), ), ); let o1 = observations.clone(); let o2...
rust_cleaned_test_functions.jsonl/1840
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 514 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 25133, 10814, 291, 12759, 368, 341, 286, 442, 5443, 19689, 504, 279, 42517, 2740, 311, 2506, 3754, 315, 13166, 2750, 624, 286, 1077, 23722, 284, 3504, 1834, 486, 12996, 486, 36809, 486, 931, 1006,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_encoding_script() { static OP_RETURN: [u8; 40] = [ 0x26, 0x0, 0x6a, 0x24, 0xaa, 0x21, 0xa9, 0xed, 0x20, 0x28, 0xf, 0x53, 0xf2, 0xd2, 0x16, 0x63, 0xca, 0xc8, 0x9e, 0x6b, 0xd2, 0xad, 0x19, 0xed, 0xba, 0xbb, 0x4, 0x8c, 0xda, 0x8, 0xe7, 0x3e, 0xd1, ...
rust_cleaned_test_functions.jsonl/43977
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1684 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 37613, 14660, 368, 341, 286, 1099, 13134, 21909, 25, 508, 84, 23, 26, 220, 19, 15, 60, 284, 2278, 310, 220, 15, 87, 17, 21, 11, 220, 15, 87, 15, 11, 220, 15, 87, 21, 64, 11, 220, 15, 8...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_tcp_listen_only() { let server = TcpListener::bind("127.0.0.1:0").unwrap(); let server_addr = server.local_addr().unwrap(); let client = TcpStream::connect(server_addr).unwrap(); let client_addr = client.local_addr().unwrap(); let mut session = session::t...
rust_cleaned_test_functions.jsonl/90995
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 334 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 45562, 79286, 18410, 368, 341, 286, 1077, 3538, 284, 64876, 2743, 486, 7666, 445, 16, 17, 22, 13, 15, 13, 15, 13, 16, 25, 15, 1827, 15454, 543, 286, 1077, 3538, 7387, 284, 3538, 11033, 7387, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_serialize_binary_generic() { let _guard = LOCK.run_concurrently(); let src = Binary { subtype: BinarySubtype::Generic, bytes: vec![0, 1, 2, 3, 4], }; let dst = vec![ 20, 0, 0, 0, 5, 107, 101, 121, 0, 5, 0, 0, 0, 0, 0, 1, 2, 3, 4, 0, ]; let doc = d...
rust_cleaned_test_functions.jsonl/49150
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 254 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 88686, 31761, 41232, 368, 341, 262, 1077, 716, 26098, 284, 49463, 7634, 3382, 58202, 543, 262, 1077, 2286, 284, 17718, 341, 286, 52482, 25, 17718, 3136, 1313, 486, 19964, 345, 286, 5820, 25, 7486,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_long() { assert_eq!( Variant::VLong(42).divide(Variant::VInteger(2)).unwrap(), Variant::VInteger(21) ); }
rust_cleaned_test_functions.jsonl/84633
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 136 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 17799, 368, 341, 394, 2060, 10714, 33673, 503, 39292, 486, 53, 6583, 7, 19, 17, 568, 59394, 12410, 15341, 486, 53, 3486, 7, 17, 4579, 15454, 3148, 503, 39292, 486, 53, 3486, 7, 17, 16, 340, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_root_ns_func_ret_nonpod() { let hdr = indoc! {" #include <cstdint> #include <memory> struct Bob { uint32_t a; }; namespace B { inline Bob daft() { Bob bob; bob.a = 12; return bob; } } "}; let rs = quote! { ...
rust_cleaned_test_functions.jsonl/9840
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 228 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 12993, 34728, 9596, 21695, 21637, 39073, 368, 341, 262, 1077, 36615, 284, 1257, 509, 0, 314, 698, 286, 671, 997, 366, 96975, 397, 286, 671, 997, 366, 17269, 397, 286, 2036, 14261, 341, 310, 2622...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_large_rate() -> Result<(), Box<dyn std::error::Error>> { Command::new(get_os_binary_loc()) .arg("-r") .arg("18446744073709551616") .assert() .failure() .stderr(predicate::str::contains( "Please set your update rate to be at most unsigned IN...
rust_cleaned_test_functions.jsonl/65682
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 173 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 45228, 9246, 368, 1464, 5714, 68843, 8261, 92846, 1460, 486, 841, 486, 1454, 2452, 341, 262, 7348, 486, 931, 5433, 29387, 31761, 13400, 2398, 286, 659, 858, 13645, 81, 1138, 286, 659, 858, 445, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_serialize_router_alert() { let mut buffer = [0u8; 4]; let option = Ipv4Option { copied: true, data: Ipv4OptionData::RouterAlert { data: 0 } }; <Ipv4Option<'_> as RecordBuilder>::serialize_into(&option, &mut buffer); assert_eq!(buffer[0], 148); ...
rust_cleaned_test_functions.jsonl/31698
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 227 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 88686, 55587, 35717, 368, 341, 310, 1077, 5206, 4147, 284, 508, 15, 84, 23, 26, 220, 19, 935, 310, 1077, 2999, 284, 358, 30168, 19, 5341, 314, 21774, 25, 830, 11, 821, 25, 358, 30168, 19, 53...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_find_service_uuid() { assert_eq!(find_service_uuid("GAP"), Some(SERVICE_UUIDS[0])); assert_eq!(find_service_uuid("Gap"), Some(SERVICE_UUIDS[0])); assert_eq!(find_service_uuid("gap"), Some(SERVICE_UUIDS[0])); assert_eq!(find_service_uuid("hIdS"), Some(SERVICE_UUIDS...
rust_cleaned_test_functions.jsonl/46715
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 717 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21814, 12267, 25540, 368, 341, 286, 2060, 10714, 10297, 3903, 12267, 25540, 445, 38, 2537, 3975, 4329, 3759, 71598, 57499, 50, 58, 15, 14382, 286, 2060, 10714, 10297, 3903, 12267, 25540, 445, 12868,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_try_from_put_logger() { let (mut sender, receiver) = UnixStream::pair().unwrap(); let mut connection = HttpConnection::new(receiver); let req_as_bytes = b"PUT /logger HTTP/1.1\r\n\ Content-Type: application/json\r\n\ Content-Length: 91\r\n...
rust_cleaned_test_functions.jsonl/43146
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 371 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 53283, 5673, 15557, 27413, 368, 341, 286, 1077, 320, 6984, 4646, 11, 13964, 8, 284, 46995, 3027, 486, 12670, 1005, 15454, 543, 286, 1077, 5206, 3633, 284, 4823, 4526, 486, 931, 78126, 626, 286, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_swma1() { let mut candles = RandomCandles::default(); let mut ma = TestingMethod::new(1, candles.first().close).unwrap(); candles.take(100).for_each(|x| { assert!((x.close - ma.next(x.close)).abs() < SIGMA); }); }
rust_cleaned_test_functions.jsonl/122820
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 105 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 32581, 1728, 16, 368, 341, 197, 10217, 5206, 51205, 284, 10612, 34, 20125, 486, 2258, 1428, 197, 10217, 5206, 7491, 284, 26768, 3523, 486, 931, 7, 16, 11, 51205, 7389, 1005, 5552, 568, 15454, 14...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_blake2f() { let input = &hex_decode("0000000048c9bdf267e6096a3ba7ca8485ae67bb2bf894fe72f36e3cf1361d5f3af54fa5d182e6ad7f520e511f6c3e2b8c68059b6bbd41fbabd9831f79217e1319cde05b61626300000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000...
rust_cleaned_test_functions.jsonl/51970
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 500 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 13141, 726, 17, 69, 368, 341, 262, 1077, 1946, 284, 609, 17308, 15227, 445, 15, 15, 15, 15, 15, 15, 15, 15, 19, 23, 66, 24, 65, 2940, 17, 21, 22, 68, 21, 15, 24, 21, 64, 18, 4645, 22, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_next_multiple_of_eight() { for x in 0usize..=IPV6_HBH_OPTIONS_MAX_LEN { let y = next_multiple_of_eight(x); assert_eq!(y % 8, 0); assert!(y >= x); if x % 8 == 0 { assert_eq!(x, y); } else { assert_...
rust_cleaned_test_functions.jsonl/85899
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 240 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 11257, 45233, 3575, 2204, 491, 368, 341, 286, 369, 856, 304, 220, 15, 51878, 496, 28, 3298, 53, 21, 2039, 97151, 36321, 6806, 15536, 341, 310, 1077, 379, 284, 1790, 45233, 3575, 2204, 491, 2075,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_healthyness() { let mut server = common::setup_server().unwrap(); // Check that the server is healthy let req = http::Request::get("/health").body(Body::empty()).unwrap(); let res = server.simulate(req).unwrap(); assert_eq!(res.status(), 200); // Set the serve Unhealth...
rust_cleaned_test_functions.jsonl/14809
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 509 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 45727, 1872, 433, 368, 341, 262, 1077, 5206, 3538, 284, 4185, 486, 15188, 12015, 1005, 15454, 1428, 262, 442, 4248, 429, 279, 3538, 374, 9314, 271, 262, 1077, 4232, 284, 1758, 486, 1900, 486, 45...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_conversions() { assert_eq!( StickerFormatType::try_from(1).unwrap(), StickerFormatType::Png ); assert_eq!( StickerFormatType::try_from(2).unwrap(), StickerFormatType::Apng ); assert_eq!( StickerFo...
rust_cleaned_test_functions.jsonl/105268
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 225 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 3382, 28290, 368, 341, 286, 2060, 10714, 33673, 310, 794, 5215, 4061, 929, 486, 1539, 5673, 7, 16, 568, 15454, 3148, 310, 794, 5215, 4061, 929, 486, 47, 968, 198, 286, 1439, 286, 2060, 10714, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_sub_2() { let z1 = c(1f64, 2f64); let z2 = c(3f64, 4f64); let z3 = c(0f64, 0f64); assert_eq!(&z1 - &z2 - &z3, c(-2.0, -2.0)); }
rust_cleaned_test_functions.jsonl/80103
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 107 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 5228, 62, 17, 368, 341, 262, 1077, 1147, 16, 284, 272, 7, 16, 69, 21, 19, 11, 220, 17, 69, 21, 19, 317, 262, 1077, 1147, 17, 284, 272, 7, 18, 69, 21, 19, 11, 220, 19, 69, 21, 19, 317...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_aggregation() { // prepare data and store let tid = 1; let cis = vec![ new_col_info(1, types::LONG_LONG), new_col_info(2, types::VARCHAR), new_col_info(3, types::NEW_DECIMAL), ]; let raw_data = vec![ vec![ ...
rust_cleaned_test_functions.jsonl/3102
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 2559 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 20587, 34442, 368, 341, 286, 442, 10549, 821, 323, 3553, 198, 286, 1077, 13112, 284, 220, 16, 280, 286, 1077, 66404, 284, 7486, 90515, 310, 501, 10211, 3109, 7, 16, 11, 4494, 486, 51306, 19903, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_possible_property() { let input = "a.b.c"; let eol_reader = EolReader::from(input); let mut parser = word_p(); let (_, result) = parser.parse(eol_reader).expect("Should parse"); assert_eq!( ...
rust_cleaned_test_functions.jsonl/102674
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 555 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 71244, 16638, 368, 341, 503, 1077, 1946, 284, 330, 64, 948, 520, 876, 503, 1077, 384, 337, 22306, 284, 468, 337, 5062, 486, 1499, 5384, 317, 503, 1077, 5206, 6729, 284, 3409, 620, 543, 503, 10...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_json2json_maintain_fields() -> Result<()> { let mut del_test_output = DeleteTestOutput::new(); let root = find_project_root().unwrap(); let root = root.as_path(); let output_path = root.join("test_data/serial-link.log.json.output"); { let input_path = root.join("te...
rust_cleaned_test_functions.jsonl/58779
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 557 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 9455, 17, 2236, 717, 1641, 466, 12132, 368, 1464, 5714, 71698, 341, 262, 1077, 5206, 1594, 4452, 7645, 284, 10428, 2271, 5097, 486, 931, 1428, 262, 1077, 3704, 284, 1477, 16352, 12993, 1005, 15454...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_broken_database() { let _ = env_logger::try_init(); let r = Reader::open_readfile("test-data/test-data/GeoIP2-City-Test-Broken-Double-Format.mmdb") .ok() .unwrap(); let ip: IpAddr = FromStr::from_str("2001:220::").unwrap(); #[derive(Deserialize, Debug)] stru...
rust_cleaned_test_functions.jsonl/42005
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 262 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 880, 81709, 27341, 368, 341, 262, 1077, 716, 284, 6105, 27413, 486, 1539, 6137, 1428, 262, 1077, 435, 284, 25166, 486, 2508, 6443, 1192, 445, 1944, 13945, 12697, 13945, 14, 37344, 3298, 17, 7658, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_create_negative_lamports() { // Attempt to create account with more lamports than remaining in from_account let new_program_owner = Pubkey::new(&[9; 32]); let from = Pubkey::new_rand(); let mut from_account = Account::new(100, 0, &system_program::id()); l...
rust_cleaned_test_functions.jsonl/24254
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 411 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 8657, 53865, 907, 309, 3394, 368, 341, 286, 442, 43517, 311, 1855, 2692, 448, 803, 31603, 3394, 1091, 9664, 304, 504, 13500, 198, 286, 1077, 501, 25096, 29027, 284, 22611, 792, 486, 931, 2099, 5...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_deserialize_discovery_details_empty() { let yaml = r#" opcuaDiscoveryMethod: standard: {} "#; let dh_config: OpcuaDiscoveryDetails = deserialize_discovery_details(yaml).unwrap(); let serialized = serde_json::to_string(&dh_config...
rust_cleaned_test_functions.jsonl/66110
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 236 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 15768, 9050, 9932, 7449, 13260, 15124, 368, 341, 1789, 286, 1077, 32246, 284, 435, 2, 698, 310, 37027, 4284, 67400, 3523, 25, 715, 1060, 5297, 25, 5613, 286, 5869, 280, 286, 1077, 34096, 5332, 2...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_latex() { let gate = Kron::new(H::new(), X::new()); let mut state = LatexExportState::new(2, 0); assert_eq!(gate.latex(&[0, 1], &mut state), Ok(())); assert_eq!(state.code(), r#"\Qcircuit @C=1em @R=.7em { \lstick{\ket{0}} & \gate{H} & \qw \\ \lstick{\k...
rust_cleaned_test_functions.jsonl/34672
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 561 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 26174, 327, 741, 262, 341, 286, 1077, 18126, 284, 96560, 486, 931, 10896, 486, 931, 1507, 1599, 486, 931, 1423, 286, 1077, 5206, 1584, 284, 9926, 327, 16894, 1397, 486, 931, 7, 17, 11, 220, 15...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1