text
stringlengths
93
16.4k
id
stringlengths
20
40
metadata
dict
input_ids
listlengths
45
2.05k
attention_mask
listlengths
45
2.05k
complexity
int64
1
9
#[test] fn test_version_long() { let (r, sioe) = do_execute!(&["--version"]); assert_eq!(buff!(sioe, serr), ""); assert_eq!(buff!(sioe, sout), version_msg!()); assert_eq!(r.is_ok(), true); }
rust_cleaned_test_functions.jsonl/62176
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 125 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 9438, 17799, 368, 341, 286, 1077, 320, 81, 11, 274, 815, 68, 8, 284, 653, 44329, 0, 2099, 1183, 313, 4366, 15049, 286, 2060, 10714, 10297, 25976, 10297, 82, 815, 68, 11, 61934, 701, 14498, 286...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_part1() { assert_eq!(solve_part1(5), 0124515891); assert_eq!(solve_part1(18), 9251071085); assert_eq!(solve_part1(2018), 5941429882); }
rust_cleaned_test_functions.jsonl/24673
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 104 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 10495, 16, 368, 341, 286, 2060, 10714, 10297, 59419, 10495, 16, 7, 20, 701, 220, 15, 16, 17, 19, 20, 16, 20, 23, 24, 16, 317, 286, 2060, 10714, 10297, 59419, 10495, 16, 7, 16, 23, 701, 220...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_is_subsequence() { let candidate = "foobaaar"; assert!(is_subsequence(candidate, "foobar", MatchCase::No).is_some()); assert!(is_subsequence(candidate, "foobaaar", MatchCase::No).is_some()); assert!(is_subsequence(candidate, "foOBAaar", MatchCase::No).is_some()); ...
rust_cleaned_test_functions.jsonl/88765
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 707 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6892, 5228, 15512, 368, 341, 286, 1077, 9144, 284, 330, 824, 674, 5305, 277, 876, 286, 2060, 10297, 285, 5228, 15512, 72021, 11, 330, 50267, 497, 14152, 4207, 486, 2753, 568, 285, 61855, 1423, 2...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_append_by_appending_string() { let initial_str = "Iñtërnâtiônàlizætiøn"; let to_append = "_more_strings"; let expected = concat!("Iñtërnâtiônàlizætiøn", "_more_strings"); unsafe { let built = NSString::alloc(nil).init_str(initial_st...
rust_cleaned_test_functions.jsonl/78766
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 396 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 26041, 3710, 8191, 2459, 3904, 368, 341, 310, 1077, 2856, 2895, 284, 330, 40, 5653, 83, 12179, 35622, 8835, 10251, 61452, 6362, 75, 449, 9191, 10251, 6151, 77, 876, 310, 1077, 311, 26041, 284, 9...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_primitive_array_abs_i32() { let a = Int32Array::from(vec![-5, -6, 7, -8, -0]); let c: &PrimitiveArray<Int32Type> = &ScalarFunctions::abs(vec![&a]).unwrap()[0]; assert_eq!(5, c.value(0)); assert_eq!(6, c.value(1)); assert_eq!(7, c.value(2)); assert_...
rust_cleaned_test_functions.jsonl/96115
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 211 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 84087, 3858, 31170, 5318, 18, 17, 368, 341, 286, 1077, 264, 284, 1333, 18, 17, 1857, 486, 1499, 25592, 0, 7609, 20, 11, 481, 21, 11, 220, 22, 11, 481, 23, 11, 481, 15, 2558, 286, 1077, 272...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_build_all_versions() { use super::*; let paths = ProjectPathsConfig::builder() .root("./test-data/test-contract-versions") .sources("./test-data/test-contract-versions") .build() .unwrap(); let project = Project::builder()....
rust_cleaned_test_functions.jsonl/26853
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 272 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 20801, 5705, 65148, 368, 341, 286, 990, 2256, 79304, 286, 1077, 12716, 284, 5787, 26901, 2648, 486, 17850, 741, 310, 659, 2888, 13988, 1944, 13945, 12697, 14859, 2144, 12, 28290, 1138, 310, 659, 3...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_bfs_with_graph() { let mut graph: Vec<Vec<usize>> = Vec::new(); graph.resize(4, vec![]); add_edge(&mut graph, 0, 1); add_edge(&mut graph, 0, 2); add_edge(&mut graph, 1, 2); add_edge(&mut graph, 2, 0); add_edge(&mut graph, 2, 3); add_edge(&mut graph, 3, 3); p...
rust_cleaned_test_functions.jsonl/4654
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 176 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 880, 3848, 6615, 14738, 368, 341, 262, 1077, 5206, 4771, 25, 11312, 50439, 90244, 2452, 284, 11312, 486, 931, 543, 262, 4771, 17382, 7, 19, 11, 7486, 0, 1294, 626, 262, 912, 17932, 2099, 6984, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_buffer() { static mut DATA: [u8; 64] = [0u8; 64]; let b = unsafe { let b = &mut *(DATA.as_mut_ptr() as *mut Buffer); b.header = BufferHeader { len: (DATA.len() - mem::size_of::<BufferHeader>()) as u32, pos: 0, };...
rust_cleaned_test_functions.jsonl/14940
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 348 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 7776, 368, 341, 286, 1099, 5206, 14112, 25, 508, 84, 23, 26, 220, 21, 19, 60, 284, 508, 15, 84, 23, 26, 220, 21, 19, 935, 286, 1077, 293, 284, 19860, 341, 310, 1077, 293, 284, 609, 6984, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_weightedindex() { let mut r = ::test::rng(700); const N_REPS: u32 = 5000; let weights = [1u32, 2, 3, 0, 5, 6, 7, 1, 2, 3, 4, 5, 6, 7]; let total_weight = weights.iter().sum::<u32>() as f32; let verify = |result: [i32; 14]| { for (i, count) in ...
rust_cleaned_test_functions.jsonl/47382
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1072 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 15876, 291, 1252, 368, 341, 286, 1077, 5206, 435, 284, 3504, 1944, 486, 69890, 7, 22, 15, 15, 317, 286, 733, 451, 2192, 5012, 25, 575, 18, 17, 284, 220, 20, 15, 15, 15, 280, 286, 1077, 143...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
7
#[test] fn test_memoized_factorial_correctness() { let mut memo = HashMap::new(); assert_eq!(memoized_factorial(4, &mut memo), 24); assert_eq!(memo.get(&0), Some(&24)); assert_eq!(memo.get(&1), Some(&24)); assert_eq!(memo.get(&2), Some(&12)); assert_eq!(memo.get(&3), Some(&4)); asse...
rust_cleaned_test_functions.jsonl/57068
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 164 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 717, 6726, 1506, 18588, 530, 31550, 2090, 368, 341, 262, 1077, 5206, 21438, 284, 10528, 486, 931, 1428, 262, 2060, 10714, 10297, 55409, 1506, 18588, 530, 7, 19, 11, 609, 6984, 21438, 701, 220, 1...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_rposition() { let b = [1, 2, 3, 5, 5]; assert!(b.iter().rposition(|&v| v == 9) == None); assert!(b.iter().rposition(|&v| v == 5) == Some(4)); assert!(b.iter().rposition(|&v| v == 3) == Some(2)); assert!(b.iter().rposition(|&v| v == 0) == None); }
rust_cleaned_test_functions.jsonl/8436
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 142 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 1710, 3487, 368, 341, 262, 1077, 293, 284, 508, 16, 11, 220, 17, 11, 220, 18, 11, 220, 20, 11, 220, 20, 935, 262, 2060, 10297, 65, 19471, 1005, 81, 3487, 22428, 5, 85, 91, 348, 621, 220, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_serialize_serde() { let s = Secp256k1::new(); for _ in 0..500 { let (sk, pk) = s.generate_keypair(&mut thread_rng()).unwrap(); round_trip_serde!(sk); round_trip_serde!(pk); } }
rust_cleaned_test_functions.jsonl/41399
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 152 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 88686, 75861, 450, 368, 341, 286, 1077, 274, 284, 4520, 79, 17, 20, 21, 74, 16, 486, 931, 543, 286, 369, 716, 304, 220, 15, 496, 20, 15, 15, 341, 310, 1077, 320, 4886, 11, 22458, 8, 284, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_verifier_new() { let _setup = SetupAriesMocks::init(); let verifier_sm = _verifier_sm(); assert_match!(VerifierState::Initiated(_), verifier_sm.state); assert_eq!(source_id(), verifier_sm.source_id()); }
rust_cleaned_test_functions.jsonl/57243
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 140 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 26042, 3049, 5921, 368, 341, 310, 1077, 716, 15188, 284, 18626, 32, 4019, 72577, 486, 2327, 1428, 310, 1077, 88737, 15874, 284, 716, 423, 3049, 15874, 1428, 310, 2060, 10708, 10297, 82394, 1397, 4...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_no_row() { #[derive(Debug, AggrFunction)] #[aggr_function(state = AggrFnFooState)] struct AggrFnFoo; #[derive(Debug)] struct AggrFnFooState; impl ConcreteAggrFunctionState for AggrFnFooState { type ParameterType = Real; f...
rust_cleaned_test_functions.jsonl/56099
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1510 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6536, 8530, 368, 341, 286, 11506, 27098, 42618, 11, 4598, 901, 5152, 5563, 286, 11506, 351, 901, 9174, 8390, 284, 4598, 901, 24911, 40923, 1397, 5563, 286, 2036, 4598, 901, 24911, 40923, 401, 286,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_destroy_input_stream_after_unplugging_a_default_input_device() { test_unplug_a_device_on_an_active_stream(StreamType::INPUT, Scope::Input, true, 0); }
rust_cleaned_test_functions.jsonl/23853
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 72 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 18066, 5898, 12673, 19844, 4907, 500, 35268, 4306, 9993, 5898, 9204, 368, 341, 262, 1273, 4907, 47474, 4306, 9204, 4470, 12008, 12930, 12673, 52011, 929, 486, 29421, 11, 34920, 486, 2505, 11, 830, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_parse_long_long_int() { assert_eq!( parse_long_long_int(&[0, 0, 0, 0, 0, 0, 0, 0][..]), Ok((EMPTY, 0)) ); assert_eq!( parse_long_long_int(&[255, 255, 255, 255, 255, 255, 255, 255][..]), Ok((EMPTY, -1)) ); }
rust_cleaned_test_functions.jsonl/25455
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 189 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21039, 17799, 17799, 4042, 368, 341, 286, 2060, 10714, 33673, 310, 4715, 17799, 17799, 4042, 2099, 58, 15, 11, 220, 15, 11, 220, 15, 11, 220, 15, 11, 220, 15, 11, 220, 15, 11, 220, 15, 11, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_decode_ping_packets() { assert_decode_packet(b"\xc0\x00", Packet::PingRequest); assert_decode_packet(b"\xd0\x00", Packet::PingResponse); }
rust_cleaned_test_functions.jsonl/19930
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 90 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 15227, 71661, 63569, 368, 341, 286, 2060, 15227, 21078, 1883, 11934, 8148, 15, 3462, 15, 15, 497, 28889, 486, 69883, 1900, 317, 286, 2060, 15227, 21078, 1883, 11934, 9703, 15, 3462, 15, 15, 497, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_update_at() { let e = List::one(3).cons(4).cons(1).cons(2); let e = e.update_at(1, 5); assert_eq!(e.tail().head(), &5); }
rust_cleaned_test_functions.jsonl/40672
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 114 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 8882, 3752, 368, 341, 1789, 286, 1077, 384, 284, 1759, 486, 603, 7, 18, 568, 6254, 7, 19, 568, 6254, 7, 16, 568, 6254, 7, 17, 317, 1789, 286, 1077, 384, 284, 384, 5317, 3752, 7, 16, 11, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_list_array_invalid_buffer_len() { let value_data = ArrayData::builder(DataType::Int32) .len(8) .add_buffer(Buffer::from(&[0, 1, 2, 3, 4, 5, 6, 7].to_byte_slice())) .build(); let list_data_type = DataType::List(Box::new(DataType::Int32)); ...
rust_cleaned_test_functions.jsonl/11613
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 258 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2019, 3858, 31433, 7776, 6043, 368, 341, 286, 1077, 897, 1769, 284, 2910, 1043, 486, 17850, 63941, 486, 1072, 18, 17, 340, 310, 659, 2892, 7, 23, 340, 310, 659, 718, 7776, 55574, 486, 1499, 20...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_unescape_str_good() { fn check(literal_text: &str, expected: &str) { let mut buf = Ok(String::with_capacity(literal_text.len())); unescape_str(literal_text, &mut |range, c| { if let Ok(b) = &mut buf { match c { ...
rust_cleaned_test_functions.jsonl/61421
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 473 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 4907, 12998, 2895, 44781, 368, 341, 286, 5168, 1779, 2333, 9953, 4326, 25, 609, 495, 11, 3601, 25, 609, 495, 8, 341, 310, 1077, 5206, 6607, 284, 7622, 2242, 486, 4197, 35603, 2333, 9953, 4326, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_parse_arguments_explicit_dep_target() { let args = stringvec!["-c", "foo.c", "-MT", "depfile", "-fabc", "-MF", "file", "-o", "foo.o"]; let ParsedArguments { input, language, depfile: _, outputs, preprocessor_args, ...
rust_cleaned_test_functions.jsonl/15018
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 515 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21039, 43433, 14214, 6026, 49258, 11123, 368, 341, 286, 1077, 2827, 284, 914, 4083, 0, 1183, 12, 66, 497, 330, 7975, 520, 497, 6523, 8505, 497, 330, 14891, 1192, 497, 6523, 69, 13683, 497, 6523,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_coinbase_serialize_bytes() { use crypto::random::Random; for _ in 0..10 { let address = Address::random().unwrap(); let distance = Random::u64_range(1, 10).unwrap(); let difficulty = Random::u64_range(1, 10).unwrap(); let coinbase_a = Coinbase::new(&addre...
rust_cleaned_test_functions.jsonl/70436
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 280 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 75718, 3152, 88686, 12524, 368, 341, 262, 990, 19028, 486, 11463, 486, 13999, 401, 262, 369, 716, 304, 220, 15, 496, 16, 15, 341, 286, 1077, 2621, 284, 9177, 486, 11463, 1005, 15454, 543, 286, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_boolean_equal() { let a = BooleanArray::from(vec![false, false, true]); let a = a.data(); let b = BooleanArray::from(vec![false, false, true]); let b = b.data(); test_equal(&a, &b, true); let b = BooleanArray::from(vec![false, false, false]); ...
rust_cleaned_test_functions.jsonl/24204
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 183 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 46642, 11478, 368, 341, 286, 1077, 264, 284, 6992, 1857, 486, 1499, 25592, 20703, 3849, 11, 895, 11, 830, 2558, 286, 1077, 264, 284, 264, 2196, 543, 286, 1077, 293, 284, 6992, 1857, 486, 1499, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_ort_status() { setup_runtime(); let status = create_status(OrtErrorCode_ORT_MODEL_LOADED, "OKOKOKO".to_string()); assert_eq!(9, get_error_code(status)); release_status(status as *mut OrtStatus); }
rust_cleaned_test_functions.jsonl/21166
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 116 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 62, 371, 4773, 368, 341, 286, 6505, 33232, 543, 286, 1077, 2639, 284, 1855, 4773, 7, 2195, 83, 30748, 62, 2868, 27551, 89917, 11, 330, 3925, 3925, 3925, 46, 3263, 983, 3904, 1423, 286, 2060, 1...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_topological_sort() { let edges_list = vec![ vec![(5, 2), (5, 0), (4, 0), (4, 1), (2, 3), (3, 1)], vec![(0, 1), (1, 2), (2, 3), (3, 4)], vec![ (0, 1), (0, 2), (0, 3), (0, 4), ...
rust_cleaned_test_functions.jsonl/64951
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 573 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 10426, 5729, 18435, 368, 341, 286, 1077, 12822, 2019, 284, 7486, 90515, 310, 7486, 0, 9697, 20, 11, 220, 17, 701, 320, 20, 11, 220, 15, 701, 320, 19, 11, 220, 15, 701, 320, 19, 11, 220, 16...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_varcon_same_locale() { let dict = BuiltIn::new(crate::config::Locale::EnUs); let correction = dict.correct_word(typos::tokens::Word::new_unchecked( "finalizes", typos::tokens::Case::Lower, 0, )); assert_eq!(correction, Some(Stat...
rust_cleaned_test_functions.jsonl/62318
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 170 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 4612, 443, 33574, 55518, 368, 341, 286, 1077, 6451, 284, 33054, 641, 486, 931, 54907, 486, 1676, 486, 19231, 486, 1702, 3558, 317, 286, 1077, 26262, 284, 6451, 81497, 13533, 1155, 88, 966, 486, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_set_guild_commands() { let route = Route::SetGuildCommands { application_id: APPLICATION_ID, guild_id: GUILD_ID, }; assert_eq!( route.to_string(), format!( "applications/{application_id}/guilds/{guild_id}/com...
rust_cleaned_test_functions.jsonl/119853
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 256 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2602, 1889, 1498, 44151, 368, 341, 286, 1077, 6021, 284, 9572, 486, 1649, 72574, 30479, 341, 310, 3766, 842, 25, 59237, 3450, 345, 310, 26411, 842, 25, 479, 18023, 3450, 345, 286, 2605, 286, 206...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_cached_path_remote_file() { // For debugging: let server = MockServer::start(); // Setup cache. let cache_dir = tempdir().unwrap(); let cache = Cache::builder() .dir(cache_dir.path().to_owned()) .progress_bar(None) .freshness_lifetime(300) ...
rust_cleaned_test_functions.jsonl/38006
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1098 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 64369, 2638, 36425, 2458, 368, 341, 262, 442, 1752, 27703, 510, 1066, 262, 1077, 3538, 284, 14563, 5475, 486, 2468, 1428, 262, 442, 18626, 6500, 624, 262, 1077, 6500, 4334, 284, 2730, 3741, 1005, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_duplicate_payment_hash_one_failure_one_success() { // Topology : A --> B --> C let chanmon_cfgs = create_chanmon_cfgs(3); let node_cfgs = create_node_cfgs(3, &chanmon_cfgs); let node_chanmgrs = create_node_chanmgrs(3, &node_cfgs, &[None, None, None]); let mut nodes = create_network(3, &no...
rust_cleaned_test_functions.jsonl/28314
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 2523 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 70434, 26696, 8950, 11667, 43618, 11667, 18632, 368, 341, 197, 322, 6909, 2449, 549, 362, 3844, 425, 3844, 356, 17642, 10217, 26023, 1645, 18343, 82, 284, 1855, 45552, 1645, 18343, 82, 7, 18, 317,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
6
#[test] fn test_decrypt_first_segment() { let mut rc4_key = [0u8; 255]; for (i, p) in rc4_key.iter_mut().enumerate() { *p = i as u8 } let crypto = QMCStreamRC4Crypto::new(&rc4_key); let mut data = [0u8; 16]; crypto.decrypt(0, &mut data); assert...
rust_cleaned_test_functions.jsonl/37644
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 219 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 80764, 12978, 28061, 368, 341, 286, 1077, 5206, 10192, 19, 3097, 284, 508, 15, 84, 23, 26, 220, 17, 20, 20, 935, 286, 369, 320, 72, 11, 281, 8, 304, 10192, 19, 3097, 19471, 29523, 1005, 7656...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_parser_headline() { let src = r#" This is the first paragraph. It has multiple sentences. Each on their own line. But it is still a single paragraph. "#; assert_parser(src, vec![Token::Headline(src.trim())]); }
rust_cleaned_test_functions.jsonl/10003
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 103 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 18517, 13138, 1056, 368, 341, 286, 1077, 2286, 284, 435, 2, 1837, 1986, 374, 279, 1156, 14311, 624, 2132, 702, 5248, 22870, 624, 4854, 389, 862, 1828, 1555, 624, 3983, 432, 374, 2058, 264, 3175,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_rng_32_seeded() { let seed: &[_] = &[1, 23, 456, 7890, 12345]; let mut ra: IsaacRng = SeedableRng::from_seed(seed); let mut rb: IsaacRng = SeedableRng::from_seed(seed); assert!(ra.gen_ascii_chars() .take(100) .eq(rb.gen_ascii_ch...
rust_cleaned_test_functions.jsonl/42029
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 195 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 66849, 62, 18, 17, 3453, 29935, 368, 341, 286, 1077, 10320, 25, 609, 13496, 60, 284, 44590, 16, 11, 220, 17, 18, 11, 220, 19, 20, 21, 11, 220, 22, 23, 24, 15, 11, 220, 16, 17, 18, 19, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_create_new_chain() { let tmp_dir = tempfile::tempdir().unwrap(); let chain_dir = tmp_dir.path().join("foo.test"); let block = MetadataFactory::metadata_block() .seed_random() .source(MetadataFactory::dataset_source_root().build()) .build(); let (chain, _...
rust_cleaned_test_functions.jsonl/119227
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 175 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 8657, 5921, 30583, 368, 341, 262, 1077, 4174, 4334, 284, 54819, 486, 3888, 3741, 1005, 15454, 543, 262, 1077, 8781, 4334, 284, 4174, 4334, 3875, 1005, 5987, 445, 7975, 5958, 3071, 262, 1077, 2504,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_sha256() { let input = rand_bytes(100); let mut hasher = sha2::Sha256::default(); hasher.update(&input); let output = hasher.finalize().to_vec(); test_precompile!(Sha256, &input, output, 108); }
rust_cleaned_test_functions.jsonl/51963
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 102 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 48836, 17, 20, 21, 368, 341, 262, 1077, 1946, 284, 10382, 12524, 7, 16, 15, 15, 317, 262, 1077, 5206, 90819, 284, 15870, 17, 486, 62316, 17, 20, 21, 486, 2258, 543, 262, 90819, 5317, 2099, 1...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_raw_node_restart() { setup_for_test(); let entries = vec![empty_entry(1, 1), new_entry(1, 2, Some("foo"))]; let st = hard_state(1, 1, 0); let store = new_storage(); store.wl().set_hardstate(st); store.wl().append(&entries).expect(""); let mut raw_node = new_raw_node(...
rust_cleaned_test_functions.jsonl/2061
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 286 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 16067, 5084, 69392, 368, 341, 262, 6505, 5478, 4452, 543, 262, 1077, 10695, 284, 7486, 20703, 3194, 9078, 7, 16, 11, 220, 16, 701, 501, 9078, 7, 16, 11, 220, 17, 11, 4329, 445, 7975, 2761, 9...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_rle_consume_flush_buffer() { let data = vec![1, 1, 1, 2, 2, 3, 3, 3]; let mut encoder1 = RleEncoder::new(3, 256); let mut encoder2 = RleEncoder::new(3, 256); for value in data { encoder1.put(value as u64).unwrap(); encoder2.put(value as u64...
rust_cleaned_test_functions.jsonl/72787
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 251 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 1710, 273, 3382, 31323, 39213, 7776, 368, 341, 286, 1077, 821, 284, 7486, 20703, 16, 11, 220, 16, 11, 220, 16, 11, 220, 17, 11, 220, 17, 11, 220, 18, 11, 220, 18, 11, 220, 18, 935, 286, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_is_url() { assert!(is_url("http://example.org/")); assert!(is_url("https://example.org/")); assert!(is_url("file:///tmp/filename")); assert!(is_url( "applewebdata://00000000-0000-1000-8080-808080808080" )); assert!(!is_url("app:///index.bundle")); // react native ...
rust_cleaned_test_functions.jsonl/107909
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 211 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6892, 2903, 368, 341, 262, 2060, 10297, 285, 2903, 445, 1254, 1110, 8687, 2659, 14, 4010, 262, 2060, 10297, 285, 2903, 445, 2428, 1110, 8687, 2659, 14, 4010, 262, 2060, 10297, 285, 2903, 445, 11...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_spqlios_poly_mul() { let n = 1024; let mut plan = FFTPlan::new(n); let mut rng = rand::thread_rng(); let mut a: Vec<u32> = vec![0u32; n]; let mut b: Vec<u32> = vec![0u32; n]; a.iter_mut().for_each(|e| *e = rng.gen::<u32>()); b.iter_mut() ...
rust_cleaned_test_functions.jsonl/109565
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 375 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 10123, 6905, 436, 36133, 24944, 368, 341, 286, 1077, 308, 284, 220, 16, 15, 17, 19, 280, 286, 1077, 5206, 3119, 284, 60036, 20485, 486, 931, 1445, 317, 286, 1077, 5206, 28422, 284, 10382, 486, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_register_app() { use crate::config; use config::Config; let _ = env_logger::try_init(); // Init apps from test-fixtures/webapps and verify in test-apps-dir. let current = env::current_dir().unwrap(); let root_path = format!("{}/test-fixtures/webapps", current.display())...
rust_cleaned_test_functions.jsonl/114194
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 2065 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 14000, 8191, 368, 341, 262, 990, 17717, 486, 1676, 280, 262, 990, 2193, 486, 2648, 401, 262, 1077, 716, 284, 6105, 27413, 486, 1539, 6137, 1428, 262, 442, 15690, 10500, 504, 1273, 70913, 18513, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
9
#[test] fn test_crud() { let db_name = format!("{}.sqlite3", random::string(8).as_str()); let temp_dir = tempdir().unwrap(); let db_folder = temp_dir.path().to_str().unwrap().to_string(); let db_path = format!("{}{}", db_folder, db_name); embed_migrations!("./migrations"...
rust_cleaned_test_functions.jsonl/83080
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 2321 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 32331, 661, 368, 341, 286, 1077, 2927, 1269, 284, 3561, 17223, 46391, 37042, 18, 497, 4194, 486, 917, 7, 23, 568, 300, 2895, 1423, 286, 1077, 2730, 4334, 284, 2730, 3741, 1005, 15454, 543, 286, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_template() { let tera = &create_tera(TEMPLATES.to_vec(), None).unwrap(); let package_urn = Urn::from("Package"); let module_a_urn = Urn::from("Package/ModuleA"); let module_b_urn = Urn::from("Package/ModuleB"); let generator = PackageDocumentationTask { ...
rust_cleaned_test_functions.jsonl/40135
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1125 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 8693, 368, 341, 286, 1077, 1982, 64, 284, 609, 3182, 62, 50037, 7, 56408, 30304, 2389, 13251, 1507, 2240, 568, 15454, 543, 286, 1077, 6328, 62, 399, 284, 16809, 77, 486, 1499, 445, 13100, 797, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_tya() { let mut r = Register::new(); r.set_Y(0xFF); tya(&mut r); assert_eq!(r.get_A(),0xFF) }
rust_cleaned_test_functions.jsonl/14193
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 76 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 528, 7755, 368, 341, 262, 1077, 5206, 435, 284, 8451, 486, 931, 543, 262, 435, 980, 10626, 7, 15, 9264, 317, 262, 259, 7755, 2099, 6984, 435, 317, 262, 2060, 10714, 10297, 81, 670, 1566, 1507,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_config_bad_owner() { let from_pubkey = Pubkey::new_unique(); let config_pubkey = Pubkey::new_unique(); let new_config = MyConfig::new(84); let signer0_pubkey = Pubkey::new_unique(); let signer0_account = AccountSharedData::new_ref(0, 0, &Pubkey::new_unique...
rust_cleaned_test_functions.jsonl/36703
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 479 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 5332, 34199, 29027, 368, 341, 286, 1077, 504, 34014, 792, 284, 22611, 792, 486, 931, 21218, 543, 286, 1077, 2193, 34014, 792, 284, 22611, 792, 486, 931, 21218, 543, 286, 1077, 501, 5332, 284, 30...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_alloc_commons() { the_same::<Vec<u32>>(vec![1, 2, 3, 4, 5]); the_same(String::from("Hello world")); the_same(Box::<u32>::new(5)); the_same(Box::<[u32]>::from(vec![1, 2, 3, 4, 5])); the_same(Cow::<u32>::Owned(5)); the_same(Cow::<u32>::Borrowed(&5)); the_same(Rc::<u32>:...
rust_cleaned_test_functions.jsonl/70638
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 624 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 14802, 21107, 82, 368, 341, 262, 279, 33574, 27638, 10050, 34837, 18, 17, 25526, 4083, 20703, 16, 11, 220, 17, 11, 220, 18, 11, 220, 19, 11, 220, 20, 2558, 262, 279, 33574, 2242, 486, 1499, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_add_sub() { let q = Secp256r1Scalar::q(); let start: Secp256r1Scalar = ECScalar::new_random(); let b: Secp256r1Scalar = ECScalar::new_random(); let tmp = BigInt::mod_add(&start.to_big_int(), &b.to_big_int(), &q); let end = BigInt::mod_sub(&tmp, &b.to_big_i...
rust_cleaned_test_functions.jsonl/12361
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 197 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2891, 5228, 368, 341, 286, 1077, 2804, 284, 4520, 79, 17, 20, 21, 81, 16, 20639, 486, 80, 543, 286, 1077, 1191, 25, 4520, 79, 17, 20, 21, 81, 16, 20639, 284, 20633, 20639, 486, 931, 22644, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_server_stop_sending_encoder_stream() { let (mut hconn, mut peer_conn) = connect(); peer_conn .stream_stop_sending(SERVER_SIDE_ENCODER_STREAM_ID, Error::HttpNoError.code()) .unwrap(); let out = peer_conn.process(None, now()); hconn.process(o...
rust_cleaned_test_functions.jsonl/52199
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 190 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 12015, 19039, 643, 2459, 39068, 12673, 368, 341, 286, 1077, 320, 6984, 305, 5148, 11, 5206, 14397, 17241, 8, 284, 4564, 543, 286, 14397, 17241, 198, 310, 659, 4027, 19039, 643, 2459, 3759, 8417, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_write_header() { let header = IppHeader::new(IppVersion::Ipp21, 0x1234, 0xaa55aa55); let mut buf = Vec::new(); assert!(header.write(&mut Cursor::new(&mut buf)).is_ok()); assert_eq!(buf, vec![0x02, 0x01, 0x12, 0x34, 0xaa, 0x55, 0xaa, 0x55]); }
rust_cleaned_test_functions.jsonl/127284
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 155 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 9165, 8757, 368, 341, 286, 1077, 4247, 284, 358, 602, 4047, 486, 931, 8972, 602, 5637, 486, 40, 602, 17, 16, 11, 220, 15, 87, 16, 17, 18, 19, 11, 220, 15, 43300, 20, 20, 5305, 20, 20, 31...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_slice_excess_length() { let v = vec![0, 0, 0, 0]; assert_eq!(Color::try_from(&v[..]), Err(IntoColorError::BadLen)); }
rust_cleaned_test_functions.jsonl/764
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 82 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 26488, 2702, 1120, 5118, 368, 341, 286, 1077, 348, 284, 7486, 20703, 15, 11, 220, 15, 11, 220, 15, 11, 220, 15, 935, 286, 2060, 10714, 10297, 1636, 486, 1539, 5673, 2099, 85, 95874, 9719, 1549...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_add_singular() { let len = SINGULAR_INFLECTIONS.read().unwrap().len(); add_singular("aaaaa", "aaaaa"); assert_eq!(len + 1, SINGULAR_INFLECTIONS.read().unwrap().len()); }
rust_cleaned_test_functions.jsonl/42792
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 105 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2891, 93240, 368, 341, 286, 1077, 2422, 284, 328, 1718, 7081, 65487, 28017, 50, 4125, 1005, 15454, 1005, 2892, 543, 286, 912, 93240, 445, 28458, 64, 497, 330, 28458, 64, 797, 286, 2060, 10714, 1...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_persist_context_remove_poll_interval() { block_on(async { let mut storage = MemStorage::new(); let last_update_time = i64_to_time(123456789); storage.set_int(SERVER_DICTATED_POLL_INTERVAL, 987654).await.unwrap(); let context = Context { ...
rust_cleaned_test_functions.jsonl/69584
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 512 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 620, 4975, 8467, 18193, 40002, 20541, 368, 341, 286, 2504, 4470, 18285, 341, 310, 1077, 5206, 5819, 284, 13550, 5793, 486, 931, 543, 310, 1077, 1537, 8882, 3009, 284, 600, 21, 19, 2346, 3009, 7,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_delete_messages() { let route = Route::DeleteMessages { channel_id: CHANNEL_ID, }; assert_eq!( route.to_string(), format!( "channels/{channel_id}/messages/bulk-delete", channel_id = CHANNEL_ID ...
rust_cleaned_test_functions.jsonl/119906
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 200 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 11353, 23428, 368, 341, 286, 1077, 6021, 284, 9572, 486, 6435, 15820, 341, 310, 5496, 842, 25, 58756, 3450, 345, 286, 2605, 286, 2060, 10714, 33673, 310, 6021, 2389, 3904, 3148, 310, 3561, 33673, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_tif() { let info = Infer::new(); assert_eq!(infer::Type { mime: String::from("image/tiff"), ext: String::from("tif"), }, info.get(&fs::read("testdata/sample.tif").unwrap()).unwrap()); }
rust_cleaned_test_functions.jsonl/110132
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 115 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 528, 333, 368, 341, 262, 1077, 3546, 284, 62658, 486, 931, 1428, 262, 2060, 10714, 10297, 89559, 486, 929, 314, 715, 286, 45270, 25, 923, 486, 1499, 445, 1805, 5523, 3092, 3975, 715, 286, 1303, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_ryu() { check!(0.3); check!(1234000000000.0); check!(1.234e13); check!(2.71828); check!(1.1e32); check!(1.1e-32); check!(2.7182817); check!(1e-45); check!(3.4028235e38); check!(-0.001234); }
rust_cleaned_test_functions.jsonl/58231
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 149 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 62, 884, 84, 368, 341, 262, 1779, 10297, 15, 13, 18, 317, 262, 1779, 10297, 16, 17, 18, 19, 15, 15, 15, 15, 15, 15, 15, 15, 15, 13, 15, 317, 262, 1779, 10297, 16, 13, 17, 18, 19, 68, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_latm_get_value() { let input: BitsCtx<'_> = (&[0x40, 0x40, 0x40], 0usize); assert_matches!(parse_latm_get_value(input), Ok(((&[0x40], 2), 0x101))); let input: BitsCtx<'_> = (&[0x3f, 0xc0], 0usize); assert_matches!(parse_latm_get_value(input), Ok...
rust_cleaned_test_functions.jsonl/34683
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 193 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 26174, 76, 3062, 3142, 368, 341, 1789, 286, 1077, 1946, 25, 49457, 23684, 18291, 98377, 284, 15899, 58, 15, 87, 19, 15, 11, 220, 15, 87, 19, 15, 11, 220, 15, 87, 19, 15, 1125, 220, 15, 518...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_read_hibernated_region() { let mut cluster = new_node_cluster(0, 3); // Initialize the cluster. configure_for_lease_read(&mut cluster, Some(100), Some(8)); cluster.cfg.raft_store.raft_store_max_leader_lease = ReadableDuration(Duration::from_millis(1)); cluster.pd_client.disab...
rust_cleaned_test_functions.jsonl/100487
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1034 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6443, 1523, 17660, 657, 20627, 368, 341, 262, 1077, 5206, 10652, 284, 501, 5084, 28441, 7, 15, 11, 220, 18, 317, 262, 442, 9008, 279, 10652, 624, 262, 14411, 5478, 62, 1623, 6443, 2099, 6984, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_consuming_line() { let empty = Rope::default(); assert_eq!( (empty.slice(..), empty.slice(..)), consuming_line(&empty.slice(..)) ); let newline = Rope::from("\n"); assert_eq!( (empty.slice(..), empty.slice(..)), ...
rust_cleaned_test_functions.jsonl/129955
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 596 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 3382, 61117, 6528, 368, 341, 286, 1077, 4287, 284, 97896, 486, 2258, 543, 286, 2060, 10714, 33673, 310, 320, 3194, 14530, 56422, 701, 4287, 14530, 56422, 6965, 310, 34108, 6528, 2099, 3194, 14530, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_service() { let mut service = SimpleService { a: 0 }; match service.process_request(service::Request::Add(13)) { Some(service::Response::Add(13)) => {}, _ => panic!("invalid response for `Add()`"), }; match service.process_request(service:...
rust_cleaned_test_functions.jsonl/28682
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 209 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 12267, 368, 341, 286, 1077, 5206, 2473, 284, 8993, 1860, 314, 264, 25, 220, 15, 2605, 286, 2432, 2473, 16988, 7893, 21656, 486, 1900, 486, 2212, 7, 16, 18, 593, 341, 310, 4329, 21656, 486, 258...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_write_dictionary() -> Result<()> { // define a schema. let field_type = DataType::Dictionary(Box::new(DataType::Int32), Box::new(DataType::Utf8)); let schema = Arc::new(Schema::new(vec![Field::new("d1", field_type, true)])); let array = DictionaryPrimitive::<i32,...
rust_cleaned_test_functions.jsonl/39713
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 488 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 9165, 42605, 368, 1464, 5714, 71698, 341, 286, 442, 6979, 264, 10802, 624, 286, 1077, 2070, 1819, 284, 33172, 486, 8517, 67758, 486, 931, 63941, 486, 1072, 18, 17, 701, 8261, 486, 931, 63941, 48...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_get_txn_commit_info() { let path = TempDir::new("_test_storage_mvcc_reader_get_txn_commit_info").expect(""); let path = path.path().to_str().unwrap(); let region = make_region(1, vec![], vec![]); let db = open_db(path, true); let mut engine = RegionEngine:...
rust_cleaned_test_functions.jsonl/85951
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1295 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 3062, 92299, 36346, 3109, 368, 341, 286, 1077, 1815, 284, 19944, 6184, 486, 931, 16975, 1944, 23310, 73187, 638, 22306, 3062, 92299, 36346, 3109, 1827, 17119, 13056, 286, 1077, 1815, 284, 1815, 3875...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_fetch() { let tmp_dir = tempfile::tempdir().unwrap(); let path = tmp_dir.path().join("test_fetch"); let name = path.to_str().unwrap(); let index = "index"; let field = "mostSignificantField"; let i = IndexSpec::new(index, vec![field]); let ...
rust_cleaned_test_functions.jsonl/110736
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 429 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 11803, 368, 341, 286, 1077, 4174, 4334, 284, 54819, 486, 3888, 3741, 1005, 15454, 543, 286, 1077, 1815, 284, 4174, 4334, 3875, 1005, 5987, 445, 1944, 11803, 797, 286, 1077, 829, 284, 1815, 2389, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_block_chain_iterator() { ic_test_utilities::artifact_pool_config::with_test_pool_config(|pool_config| { let time_source = FastForwardTimeSource::new(); let subnet_id = subnet_test_id(1); let committee = vec![node_test_id(0)]; let dkg_interv...
rust_cleaned_test_functions.jsonl/118229
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1366 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 7113, 30583, 13491, 368, 341, 286, 17902, 4452, 94044, 486, 63722, 15709, 5332, 486, 4197, 4452, 15709, 5332, 22428, 10285, 5332, 91, 341, 310, 1077, 882, 10347, 284, 17288, 25925, 1462, 3608, 486, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_record_schema_with_cyclic_references() { let schema = Schema::parse_str( r#" { "type": "record", "name": "test", "fields": [{ "name": "recordField", "type": { "...
rust_cleaned_test_functions.jsonl/69043
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1391 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 14192, 25371, 6615, 666, 65304, 92702, 368, 341, 262, 1077, 10802, 284, 12539, 486, 6400, 2895, 1006, 286, 435, 2, 698, 310, 341, 394, 330, 1313, 788, 330, 8548, 756, 394, 330, 606, 788, 330, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
4
#[test] fn test_basic_atoms() { let test_cases = vec![ ("(atom 5)", atom_with_value(Number(5))), ("(atom? (atom 5))", Bool(true)), ("(atom? nil)", Bool(false)), ("(atom? 1)", Bool(false)), ("(def! a (atom 5)) (deref a)", Number(5)), ...
rust_cleaned_test_functions.jsonl/114214
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1336 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 34729, 67755, 368, 341, 286, 1077, 1273, 41427, 284, 7486, 90515, 310, 3489, 7, 21855, 220, 20, 11583, 19124, 6615, 3142, 42999, 7, 20, 41749, 310, 3489, 7, 21855, 30, 320, 21855, 220, 20, 593, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_resolution() { let mut stream = LinearUpSamplingStream::new(15625, 44100, Resolution::RangePerTick); println!("{}", stream.output_sampling_step); // LinearUpSamplingStream lags by one sample. assert!(stream.is_tick() == Tick::One); stream.push(0_f32, 0_f...
rust_cleaned_test_functions.jsonl/121685
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 433 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 39849, 368, 341, 286, 1077, 5206, 4269, 284, 28263, 2324, 98622, 3027, 486, 931, 7, 16, 20, 21, 17, 20, 11, 220, 19, 19, 16, 15, 15, 11, 37116, 486, 6046, 3889, 22213, 317, 286, 13751, 79878...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_data_type() { let input = to_chars("s32"); let ret = data_type().parse(&input).expect("must be parsed"); println!("{:#?}", ret); assert_eq!(ret, DataType::S32); }
rust_cleaned_test_functions.jsonl/57919
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 108 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 1769, 1819, 368, 341, 286, 1077, 1946, 284, 311, 37418, 445, 82, 18, 17, 797, 286, 1077, 2112, 284, 821, 1819, 1005, 6400, 2099, 1355, 568, 17119, 445, 24812, 387, 15676, 797, 286, 13751, 88928,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_request_more_than_allowed_data_length() { let mut transaction_context = TransactionContext::new(Vec::new(), 1); let invoke_context = InvokeContext::new_mock(&mut transaction_context, &[]); let from_account = RefCell::new(AccountSharedData::new(100, 0, &system_program::id(...
rust_cleaned_test_functions.jsonl/106192
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 851 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 7893, 36664, 51613, 42155, 1769, 5118, 368, 341, 286, 1077, 5206, 7745, 8467, 284, 17869, 1972, 486, 931, 49923, 486, 931, 1507, 220, 16, 317, 286, 1077, 19873, 8467, 284, 39667, 1972, 486, 931, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_intraday_dealts_401_failed() { let it = crawler::IntradayBuilder::new().token("").build(); assert_err!(it.dealts("2884").call(), Err(FugleError::Unauthorized)); }
rust_cleaned_test_functions.jsonl/49449
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 81 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 1243, 47026, 352, 2259, 278, 2576, 62, 19, 15, 16, 35060, 368, 341, 262, 1077, 432, 284, 73094, 486, 641, 47026, 352, 3297, 486, 931, 1005, 5839, 80821, 5834, 543, 262, 2060, 9266, 10297, 275, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_transforms_with_kafka_meta() { let mut test_value = json!({ "name": "A", "modified": "2021-03-16T14:38:58Z", }); let test_message = OwnedMessage::new( Some(test_value.to_string().into_bytes()), None, "test".to_s...
rust_cleaned_test_functions.jsonl/124212
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1222 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 18449, 82, 6615, 4698, 21883, 13381, 368, 341, 286, 1077, 5206, 1273, 3142, 284, 2951, 0, 2262, 310, 330, 606, 788, 330, 32, 756, 310, 330, 27162, 788, 330, 17, 15, 17, 16, 12, 15, 18, 12, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_overrides() { let user_config = table_from_toml_str(r#"tab_size = 42"#).unwrap(); let rust_config = table_from_toml_str(r#"tab_size = 31"#).unwrap(); let lang_def = rust_lang_def(None); let rust_id: LanguageId = "Rust".into(); let buf_id_1 = BufferId(1);...
rust_cleaned_test_functions.jsonl/105405
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 780 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 15431, 18245, 368, 341, 286, 1077, 1196, 5332, 284, 1965, 5673, 528, 316, 75, 2895, 2601, 55543, 6192, 2368, 284, 220, 19, 17, 57676, 568, 15454, 543, 286, 1077, 23071, 5332, 284, 1965, 5673, 52...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_out_of_sync() { let client = TestClient::new_with_config(Value::Null); let error = client.request_json("setup", json!({ "baseUrl": TestClient::get_network_address(), "outOfSyncThreshold": -1 })).unwrap_err(); assert_eq!(error.code, 1013); }
rust_cleaned_test_functions.jsonl/69936
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 146 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6068, 3575, 23008, 368, 341, 262, 1077, 2943, 284, 3393, 2959, 486, 931, 6615, 5332, 25346, 486, 3280, 626, 262, 1077, 1465, 284, 2943, 8223, 9455, 445, 15188, 756, 286, 2951, 0, 2262, 310, 330,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_run_string_fsm() { let mut lexer = Lexer::new("'this is a string' or 'this is another string'"); match lexer.next_token() { Ok(tok) => assert_eq!(tok.content, "'this is a string'"), Err(_msg) => assert!(false), } match lexer.next_token() { ...
rust_cleaned_test_functions.jsonl/30854
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 304 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 14007, 3904, 97069, 368, 341, 286, 1077, 5206, 53259, 284, 85082, 486, 931, 45456, 574, 374, 264, 914, 6, 476, 364, 574, 374, 2441, 914, 28116, 286, 2432, 53259, 4529, 6458, 368, 341, 310, 7622,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
4
#[test] fn test_create_agent_fails() { init!("true"); let json_string = r#"{"agency_url":"https://enym-eagency.pdev.evernym.com","agency_did":"Ab8TvZa3Q19VNkQVzAWVL7","agency_verkey":"5LXaR43B1aQyeh94VBP8LG1Sgvjk7aNfqiksBCSjwqbf","wallet_name":"test_provision_agent","agent_seed":null,"enterpris...
rust_cleaned_test_functions.jsonl/19369
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 354 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 8657, 25730, 761, 6209, 368, 341, 286, 2930, 17223, 1866, 3071, 286, 1077, 2951, 3904, 284, 435, 55543, 4913, 55565, 2903, 3252, 2428, 1110, 268, 1600, 5655, 55565, 556, 3583, 1734, 423, 48121, 90...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_raw() { let current_dir = std::env::current_dir().unwrap(); let path = RootLocation::from("path").path().unwrap(); assert_eq!(path, current_dir.join("path")); }
rust_cleaned_test_functions.jsonl/92109
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 109 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 16067, 368, 341, 310, 1077, 1482, 4334, 284, 1460, 486, 3160, 486, 3231, 4334, 1005, 15454, 543, 310, 1077, 1815, 284, 18854, 4707, 486, 1499, 445, 2343, 1827, 2343, 1005, 15454, 543, 310, 2060, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_fn_signature_with_docs_impl() { check( r#" struct addr; impl addr { /// Adds one to the number given. /// /// # Examples /// /// ``` /// let five = 5; /// /// assert_eq!(6, my_crate::add_one(5)); /// ``` pub fn add_one(x: i32) -> i32 { ...
rust_cleaned_test_functions.jsonl/75016
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 400 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 15246, 39859, 6615, 49692, 21007, 368, 341, 262, 1779, 1006, 286, 435, 2, 698, 1235, 10789, 280, 6383, 10789, 341, 262, 1048, 24475, 825, 311, 279, 1372, 2661, 624, 262, 17057, 262, 1048, 671, 2...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_activate_epoch() { let stakes_cache = StakesCache::default(); let ((vote_pubkey, vote_account), (stake_pubkey, stake_account)) = create_staked_node_accounts(10); stakes_cache.check_and_store(&vote_pubkey, &vote_account); stakes_cache.check_and_store(...
rust_cleaned_test_functions.jsonl/22040
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 564 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 67894, 20682, 368, 341, 286, 1077, 44425, 11529, 284, 794, 2050, 8233, 486, 2258, 1428, 286, 1077, 1781, 29358, 34014, 792, 11, 6910, 13500, 701, 320, 267, 726, 34014, 792, 11, 18279, 13500, 593, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_raw_delete_range() { test_raw_delete_range_impl(ApiVersion::V1); test_raw_delete_range_impl(ApiVersion::V1ttl); test_raw_delete_range_impl(ApiVersion::V2); }
rust_cleaned_test_functions.jsonl/133279
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 103 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 16067, 11353, 9698, 368, 341, 286, 1273, 16067, 11353, 9698, 21007, 65830, 5637, 486, 53, 16, 317, 286, 1273, 16067, 11353, 9698, 21007, 65830, 5637, 486, 53, 16, 62858, 317, 286, 1273, 16067, 113...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_grounding_1() -> TestResult { test_grounding( "f(x) if x in y and x > 0 and y = [1, 2, 3] and x = 1;", term!(call!("f", [sym!("x")])), &[|r: Bindings| { assert_eq!(r.get(&sym!("x")).unwrap(), &term!(1)); Ok(()) ...
rust_cleaned_test_functions.jsonl/63049
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 213 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 72492, 287, 62, 16, 368, 1464, 3393, 2077, 341, 286, 1273, 72492, 287, 1006, 310, 330, 69, 2075, 8, 421, 856, 304, 379, 323, 856, 861, 220, 15, 323, 379, 284, 508, 16, 11, 220, 17, 11, 220...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_get_variable_info_with_inherited_fields() { let variable_info = get_variable_info( &build_syntax_grammar( vec![ SyntaxVariable { name: "rule0".to_string(), kind: VariableType::Named, ...
rust_cleaned_test_functions.jsonl/54398
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1256 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 3062, 14635, 3109, 6615, 1243, 48394, 12132, 368, 341, 286, 1077, 3890, 3109, 284, 633, 14635, 3109, 1006, 310, 609, 5834, 78894, 62, 41094, 1006, 394, 7486, 90515, 503, 32117, 7827, 341, 664, 829...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_default_reduce_reduce() { let grm = YaccGrammar::new(YaccKind::Original(YaccOriginalActionKind::GenericParseTree), &" %start A %% A : B 'x' | C 'x' 'x'; B : 'a'; C : 'a'; ").unwrap(); let sg = pager_stategraph(...
rust_cleaned_test_functions.jsonl/38020
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 448 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 9993, 64596, 64596, 368, 341, 286, 1077, 1081, 76, 284, 809, 4475, 97178, 486, 931, 20206, 4475, 10629, 486, 18395, 20206, 4475, 18395, 2512, 10629, 486, 19964, 14463, 6533, 701, 609, 698, 310, 10...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_json_file() { let n = File { base: BaseNode::default(), package: Some(PackageClause { base: BaseNode::default(), name: Identifier { base: Default::default(), name: "foo".to_string(), }, }), im...
rust_cleaned_test_functions.jsonl/40416
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 749 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 9455, 2458, 368, 341, 262, 1077, 308, 284, 2887, 341, 286, 2331, 25, 5351, 1955, 486, 2258, 3148, 286, 6328, 25, 4329, 5304, 1434, 28482, 341, 310, 2331, 25, 5351, 1955, 486, 2258, 3148, 310, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_css_pseudo_selector_parse() { let ok_res = [ ("first", CssPathPseudoSelector::First), ("last", CssPathPseudoSelector::Last), ("nth-child(4)", CssPathPseudoSelector::NthChild(4)), ("hover", CssPathPseudoSelector::Hover), ("active", CssPathPseudoSe...
rust_cleaned_test_functions.jsonl/22820
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 520 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 25924, 620, 21952, 28890, 21039, 368, 972, 262, 1077, 5394, 4918, 284, 23637, 286, 3489, 3896, 497, 79214, 1820, 47, 21952, 5877, 486, 5338, 9912, 286, 3489, 4259, 497, 79214, 1820, 47, 21952, 587...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_mut_splitator() { let mut xs = [0, 1, 0, 2, 3, 0, 0, 4, 5, 0]; assert_eq!(xs.split_mut(|x| *x == 0).count(), 6); for slice in xs.split_mut(|x| *x == 0) { slice.reverse(); } assert!(xs == [0, 1, 0, 3, 2, 0, 0, 5, 4, 0]); let mut xs = [0, 1, 0, 2, 3, 0, 0, 4, 5, 0,...
rust_cleaned_test_functions.jsonl/12919
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 261 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 29523, 17052, 850, 368, 341, 262, 1077, 5206, 11943, 284, 508, 15, 11, 220, 16, 11, 220, 15, 11, 220, 17, 11, 220, 18, 11, 220, 15, 11, 220, 15, 11, 220, 19, 11, 220, 20, 11, 220, 15, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_deserialization() { type ClientMessage = super::ClientMessage<DefaultScalarValue>; assert_eq!( ClientMessage::ConnectionInit { payload: [("foo".to_string(), InputValue::scalar("bar"))] .iter() .cloned() ...
rust_cleaned_test_functions.jsonl/27161
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1451 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 15768, 50563, 368, 341, 286, 943, 8423, 2052, 284, 2256, 486, 2959, 2052, 27, 3675, 20639, 1130, 19421, 286, 2060, 10714, 33673, 310, 8423, 2052, 486, 4526, 3803, 341, 394, 7729, 25, 84019, 7975, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_get_wpa_psk() { let bss = fake_wpa1_bss_description(b"foo_bss".to_vec()); let credential = fidl_sme::Credential::Psk(vec![0xAA; 32]); get_legacy_wpa_association(&fake_device_info(CLIENT_ADDR), &credential, &bss) .expect("expected successful RSNA with valid PSK...
rust_cleaned_test_functions.jsonl/23529
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 160 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 3062, 1670, 6595, 620, 4886, 368, 341, 286, 1077, 293, 778, 284, 12418, 1670, 6595, 16, 880, 778, 11448, 1883, 1, 7975, 880, 778, 3263, 983, 13251, 1423, 286, 1077, 40207, 284, 32104, 75, 643, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_misused_facet_collector() { let mut facet_collector = FacetCollector::for_field(Field::from_field_id(0)); facet_collector.add_facet(Facet::from("/country")); facet_collector.add_facet(Facet::from("/country/europe")); }
rust_cleaned_test_functions.jsonl/10752
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 120 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 717, 285, 2591, 41589, 295, 10211, 27669, 368, 341, 286, 1077, 5206, 44507, 10211, 27669, 284, 16945, 295, 53694, 486, 1958, 5013, 57788, 486, 1499, 5013, 842, 7, 15, 1106, 286, 44507, 10211, 2766...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_emit() { let name = &[ 0x09, 0x72, 0x75, 0x73, 0x74, 0x2d, 0x6c, 0x61, 0x6e, 0x67, 0x03, 0x6f, 0x72, 0x67, 0x00, ]; let repr = Repr { transaction_id: 0x1234, flags: Flags::RECURSION_DESIRED, opcode: Opcode::Quer...
rust_cleaned_test_functions.jsonl/88887
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 557 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 69082, 368, 341, 286, 1077, 829, 284, 609, 9640, 310, 220, 15, 87, 15, 24, 11, 220, 15, 87, 22, 17, 11, 220, 15, 87, 22, 20, 11, 220, 15, 87, 22, 18, 11, 220, 15, 87, 22, 19, 11, 220...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_p2wsh() { // stolen from Bitcoin transaction 5df912fda4becb1c29e928bec8d64d93e9ba8efa9b5b405bd683c86fd2c65667 let script = hex_script!("52210375e00eb72e29da82b89367947f29ef34afb75e8654f6ea368e0acdfd92976b7c2103a1b26313f430c4b15bb1fdce663207659d8cac749a0e53d70eff01874496feff2103c9...
rust_cleaned_test_functions.jsonl/63231
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 379 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 620, 17, 86, 927, 368, 341, 286, 442, 22329, 504, 13127, 7745, 220, 20, 2940, 24, 16, 17, 69, 3235, 19, 16692, 65, 16, 66, 17, 24, 68, 24, 17, 23, 16692, 23, 67, 21, 19, 67, 24, 18, 68...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_hsv_string_parsing() { let red_hsv: HSVColor = "hsv(0, 120%, 50%)".parse().unwrap(); assert!(red_hsv.h.abs() <= 0.0001); assert!((red_hsv.s - 1.0) <= 0.0001); assert!((red_hsv.v - 0.5) <= 0.0001); let lavender_hsv: HSVColor = "hsv(-445, 24%, 1000%)".parse(...
rust_cleaned_test_functions.jsonl/40397
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 279 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 1523, 3492, 3904, 620, 28598, 368, 341, 286, 1077, 2518, 1523, 3492, 25, 80311, 1636, 284, 330, 71, 3492, 7, 15, 11, 220, 16, 17, 15, 13384, 220, 20, 15, 11334, 3263, 6400, 1005, 15454, 543, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_lex_keywords() -> Result<(), LexError> { let mut lexer = Lexer::new("true false let in if then else match with fun rec"); let tokens = lexer.lex()?; assert_eq!( tokens, &vec![ Token::True, Token::False, ...
rust_cleaned_test_functions.jsonl/50972
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 376 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 74547, 51354, 368, 1464, 5714, 68843, 26819, 1454, 29, 341, 286, 1077, 5206, 53259, 284, 85082, 486, 931, 445, 1866, 895, 1077, 304, 421, 1221, 770, 2432, 448, 2464, 1395, 797, 286, 1077, 11211, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_base64() { let content = "halsdjflwefjklasdjflkasdjf"; let e = encrypt_config(content.as_bytes(), CipherType::ChaCha20Ietf, "test").unwrap(); let d = decrypt_config(e.as_bytes(), CipherType::ChaCha20Ietf, "test").unwrap(); assert_eq!(content, String::from_utf8(d)....
rust_cleaned_test_functions.jsonl/56168
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 155 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 7651, 21, 19, 368, 341, 286, 1077, 2213, 284, 330, 71, 1127, 77504, 1489, 86, 823, 73, 10561, 300, 77504, 1489, 62899, 77504, 69, 876, 286, 1077, 384, 284, 29625, 5332, 15063, 5357, 12524, 1507,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_find_chunk2() { let index = vec![0_usize, 0, 5]; assert_eq!(find_chunk(&index, 0), 1); assert_eq!(find_chunk(&index, 1), 1); assert_eq!(find_chunk(&index, 2), 1); assert_eq!(find_chunk(&index, 3), 1); assert_eq!(find_chunk(&index, 4), 1); assert_eq!(find_chunk(&index,...
rust_cleaned_test_functions.jsonl/64637
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 162 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21814, 30539, 17, 368, 341, 262, 1077, 1922, 284, 7486, 20703, 15, 11306, 551, 11, 220, 15, 11, 220, 20, 935, 262, 2060, 10714, 10297, 3903, 30539, 2099, 1252, 11, 220, 15, 701, 220, 16, 317, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_read_channel_config_wrong_data_checksum() { let mut data = vec![ 0xa4, 0x9e, 0x79, 0x5a, // magic 1, 0, // version 55, 0, // data_len 0xcd, 0xa3, 0xdd, 0xeb, // data_checksum 0x2b, 0x94, 0xe6, 0xef, // header_checksum ];...
rust_cleaned_test_functions.jsonl/43609
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 308 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6443, 14571, 5332, 75198, 1769, 64038, 368, 341, 286, 1077, 5206, 821, 284, 7486, 90515, 310, 220, 15, 9591, 19, 11, 220, 15, 87, 24, 68, 11, 220, 15, 87, 22, 24, 11, 220, 15, 87, 20, 64, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_subsequence() { let sequence = "GGGUUUGCGGUGUAAGUGCAGCCCGUCUUACACCGUGCGGCACAGGCACUAGUACUGAUGUCGUAUACAGGGCUUUUGACAU"; let bpw = BasePairWeights { AU: 2.0, GC: 3.0, GU: 1.0, }; let encoded = EncodedSequence::with_basep...
rust_cleaned_test_functions.jsonl/7882
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 515 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 5228, 15512, 368, 341, 286, 1077, 8500, 4035, 310, 330, 22254, 54695, 52, 2941, 8798, 38, 2941, 17782, 1890, 60902, 1890, 3706, 8798, 5459, 86564, 1706, 1706, 8798, 2941, 8798, 22863, 1706, 1890, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_align_to_simple() { let bytes = [1u8, 2, 3, 4, 5, 6, 7]; let (prefix, aligned, suffix) = unsafe { bytes.align_to::<u16>() }; assert_eq!(aligned.len(), 3); assert!(prefix == [1] || suffix == [7]); let expect1 = [1 << 8 | 2, 3 << 8 | 4, 5 << 8 | 6]; let expect2 = [1 | 2 << ...
rust_cleaned_test_functions.jsonl/8468
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 304 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 37015, 2346, 30015, 368, 341, 262, 1077, 5820, 284, 508, 16, 84, 23, 11, 220, 17, 11, 220, 18, 11, 220, 19, 11, 220, 20, 11, 220, 21, 11, 220, 22, 935, 262, 1077, 320, 11849, 11, 26118, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
5
#[test] fn test_rtp_extensions_from_media_description() -> Result<()> { let extensions = rtp_extensions_from_media_description(&MediaDescription { media_name: MediaName { media: "audio".to_owned(), formats: vec!["111".to_owned()], ..Default::default() }, ...
rust_cleaned_test_functions.jsonl/12076
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 441 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 1710, 790, 60498, 5673, 29173, 11448, 368, 1464, 5714, 71698, 341, 262, 1077, 19721, 284, 435, 790, 60498, 5673, 29173, 11448, 2099, 12661, 5009, 341, 286, 3687, 1269, 25, 7816, 675, 341, 310, 368...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_parse_release_date() { assert_eq!(parse_release_date("2018/02/07").unwrap(), "2018-02-07"); assert!(parse_release_date("").is_err()); assert!(parse_release_date("2018").is_err()); }
rust_cleaned_test_functions.jsonl/134382
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 106 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21039, 24577, 4164, 368, 341, 286, 2060, 10714, 10297, 6400, 24577, 4164, 445, 17, 15, 16, 23, 14, 15, 17, 14, 15, 22, 1827, 15454, 1507, 330, 17, 15, 16, 23, 12, 15, 17, 12, 15, 22, 3071,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_triplet_optional_map_column() { let path = vec!["a", "key_value", "value", "key_value", "key"]; let values = vec![ Field::Int(1), Field::Int(2), Field::Int(1), Field::Int(1), Field::Int(3), Field::Int(4), ...
rust_cleaned_test_functions.jsonl/43018
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 390 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 63883, 1149, 74644, 5376, 8744, 368, 341, 286, 1077, 1815, 284, 7486, 0, 1183, 64, 497, 330, 792, 3142, 497, 330, 957, 497, 330, 792, 3142, 497, 330, 792, 6332, 286, 1077, 2750, 284, 7486, 905...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_lex_simple() { let tokens = Lexer::new().lex("1+2").unwrap(); assert_eq!(tokens, vec![Token::Integer(1), Token::Plus, Token::Integer(2)]); }
rust_cleaned_test_functions.jsonl/33555
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 105 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 74547, 30015, 368, 341, 286, 1077, 11211, 284, 85082, 486, 931, 1005, 2571, 445, 16, 10, 17, 1827, 15454, 543, 286, 2060, 10714, 10297, 30566, 345, 4293, 7486, 20703, 3323, 486, 3486, 7, 16, 701...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_mandali() { run_test( &TEST_DATA, "harfbuzz/good-mandali.te", "telugu/Mandali-Regular.ttf", &[JOINER_GLYPH_INDEX], 8, ); }
rust_cleaned_test_functions.jsonl/91176
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 213 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 717, 437, 7956, 368, 341, 394, 1598, 4452, 1006, 503, 609, 10033, 7896, 345, 503, 330, 12982, 10798, 8889, 4846, 1386, 1448, 437, 7956, 31853, 756, 503, 330, 22924, 29785, 10270, 437, 7956, 87591,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_multi_signatures() { let kp = Keypair::new(); let tx = Transaction::new_signed_with_payer(&[], Some(&kp.pubkey()), &[&kp], Hash::default()); let entries = vec![Entry::new(&Hash::default(), 1, vec![tx.clone()])]; let signatures = CompletedDataSetsServic...
rust_cleaned_test_functions.jsonl/29108
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 309 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 25133, 11172, 2789, 368, 341, 286, 1077, 60319, 284, 6569, 1082, 1310, 486, 931, 543, 286, 1077, 9854, 4035, 310, 17869, 486, 931, 55617, 6615, 620, 1135, 2099, 12995, 4329, 2099, 48495, 47773, 79...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1