text
stringlengths
93
16.4k
id
stringlengths
20
40
metadata
dict
input_ids
listlengths
45
2.05k
attention_mask
listlengths
45
2.05k
complexity
int64
1
9
#[test] fn test_mmap_region_build() { let a = Arc::new(TempFile::new().unwrap().into_file()); let prot = libc::PROT_READ | libc::PROT_WRITE; let flags = libc::MAP_NORESERVE | libc::MAP_PRIVATE; let offset = 4096; let size = 1000; // Offset + size will overflow. let r = MmapRegion::build( Some(FileOffset::from_arc(a.clone(), std::u64::MAX)), size, prot, flags, ); assert_eq!(format!("{:?}", r.unwrap_err()), "InvalidOffsetLength"); let r = MmapRegion::build( Some(FileOffset::from_arc(a.clone(), offset)), size, prot, flags, ); assert_eq!(format!("{:?}", r.unwrap_err()), "MappingPastEof"); // MAP_FIXED was specified among the flags. let r = MmapRegion::build( Some(FileOffset::from_arc(a.clone(), offset)), size, prot, flags | libc::MAP_FIXED, ); assert_eq!(format!("{:?}", r.unwrap_err()), "MapFixed"); // Let's resize the file. assert_eq!(unsafe { libc::ftruncate(a.as_raw_fd(), 1024 * 10) }, 0); // The offset is not properly aligned. let r = MmapRegion::build( Some(FileOffset::from_arc(a.clone(), offset - 1)), size, prot, flags, ); assert_eq!(r.unwrap_err().raw_os_error(), libc::EINVAL); // The build should be successful now. let r = MmapRegion::build( Some(FileOffset::from_arc(a.clone(), offset)), size, prot, flags, ) .unwrap(); assert_eq!(r.size(), size); assert_eq!(r.file_offset().unwrap().start(), offset as u64); assert_eq!(r.prot(), libc::PROT_READ | libc::PROT_WRITE); assert_eq!(r.flags(), libc::MAP_NORESERVE | libc::MAP_PRIVATE); }
rust_cleaned_test_functions.jsonl/39
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1024 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 717, 2186, 20627, 20801, 368, 341, 286, 1077, 264, 284, 19689, 486, 931, 75387, 1703, 486, 931, 1005, 15454, 1005, 18122, 2458, 5231, 286, 1077, 1724, 284, 42142, 486, 9117, 51, 13117, 760, 42142,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_serde_pubkey() { let ElGamalKeypair { public, secret: _ } = ElGamalKeypair::new_rand(); let encoded = bincode::serialize(&public).unwrap(); let decoded: ElGamalPubkey = bincode::deserialize(&encoded).unwrap(); assert_eq!(public, decoded); }
rust_cleaned_test_functions.jsonl/36655
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 131 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 75861, 450, 34014, 792, 368, 341, 286, 1077, 3984, 78884, 278, 6608, 1082, 1310, 314, 584, 11, 6234, 25, 716, 335, 284, 3984, 78884, 278, 6608, 1082, 1310, 486, 931, 33864, 1428, 286, 1077, 2049...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_functions() -> TestResult { let p = polar(); p.load_str( r#"f(1); f(2); g(1); g(2); h(2); k(x) if f(x) and h(x) and g(x);"#, )?; qnull(&p, "k(1)"); qeval(&p, "k(2)"); qnull(&p, "k(3)"); qvar(&p, "k(a)", "a", values![2]); Ok(()) }
rust_cleaned_test_functions.jsonl/68088
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 231 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 31708, 368, 1464, 3393, 2077, 341, 262, 1077, 281, 284, 24660, 543, 262, 281, 5104, 2895, 1006, 286, 435, 55543, 69, 7, 16, 317, 1843, 282, 7, 17, 317, 1843, 342, 7, 16, 317, 1843, 342, 7, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_escaped_backslash_char() { assert_eq!( apply( r#" '\\' + "# .trim() ), Ok(vec![ Token::Char(span(1, 1, "'\\\\'")), Token::Symbol(span(1, 6, "+")) ]) ) }
rust_cleaned_test_functions.jsonl/27570
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 219 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 62, 65826, 3895, 50256, 9232, 368, 341, 286, 2060, 10714, 33673, 310, 3796, 1006, 394, 435, 2, 698, 6, 3422, 6, 3610, 1, 4956, 503, 659, 10666, 741, 310, 2837, 310, 7622, 25592, 90515, 394, 96...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_same() { let x = b"ACGTATCATAGACCCTAGATAGGGTTGTGTAGATGATCCACAGACGTATCATAGATTAGATAGGGTTGTGTAGATGATTCC\ ACAG"; let y = *x; compare_to_full_alignment_local(x, &y); compare_to_full_alignment_global(x, &y); compare_to_full_alignment_semiglobal(x, &y); }
rust_cleaned_test_functions.jsonl/126726
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 188 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 33574, 368, 341, 286, 1077, 856, 4035, 310, 293, 1, 1706, 25388, 828, 28196, 1890, 29442, 1162, 1890, 828, 1890, 22254, 14903, 25388, 25388, 1890, 828, 38, 828, 3706, 1706, 1890, 1706, 25388, 828,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_init_wizard() -> Result<(), Error> { let server = test::Server::new()?; assert!(Path::new(&server.wg_conf_path()).exists()); Ok(()) }
rust_cleaned_test_functions.jsonl/15775
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 98 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6137, 1670, 13722, 368, 1464, 5714, 68843, 4600, 29, 341, 1789, 286, 1077, 3538, 284, 1273, 486, 5475, 486, 931, 368, 69493, 286, 2060, 10297, 1820, 486, 931, 2099, 4030, 1418, 70, 16059, 2638, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
2
#[test] fn test_sg_map_range_mut_panic_1() { let mut map = SgMap::<usize, usize, DEFAULT_CAPACITY>::new(); map.insert(3, 3); map.insert(5, 5); map.insert(8, 8); let _bad_range = map.range_mut((Included(&8), Included(&3))); }
rust_cleaned_test_functions.jsonl/18662
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 120 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 76318, 5376, 9698, 29523, 620, 31270, 62, 16, 368, 341, 262, 1077, 5206, 2415, 284, 328, 70, 2227, 27638, 51878, 11, 22301, 11, 11955, 92153, 6831, 931, 543, 262, 2415, 7030, 7, 18, 11, 220, 1...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_recover_pk() { let message = "test message"; let sig = "d9tibmnic9t5y41hg7hkakdcra94akas9ku3rmmj4ag9mritc8ok4p5qzefs78c9pqfhpuftqqzhydbdwfg7u6w6wdxcqpqn4sj4e73e"; let pk = recover_pk(message.as_bytes(), sig); assert_eq!(pk.unwrap(), PublicKey::from_secret_key(&Secp256k1::signing_only(), &ONE_KEY)) }
rust_cleaned_test_functions.jsonl/74468
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 199 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 1288, 3688, 33321, 368, 341, 286, 1077, 1943, 284, 330, 1944, 1943, 876, 286, 1077, 8366, 284, 330, 67, 24, 83, 579, 76, 11590, 24, 83, 20, 88, 19, 16, 66602, 22, 85511, 585, 7628, 956, 24, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_add_stake_dispatch_info_ok() { new_test_ext().execute_with(|| { let account_id = 0; let stake = 5000; let call = Call::Subtensor(SubtensorCall::add_stake(account_id, stake)); assert_eq!(call.get_dispatch_info(), DispatchInfo { weight: 0, class: DispatchClass::Normal, pays_fee: Pays::Yes }); }); }
rust_cleaned_test_functions.jsonl/17148
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 153 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2891, 1261, 726, 42991, 3109, 19817, 368, 341, 8638, 4452, 9927, 1005, 10257, 6615, 79453, 341, 197, 10217, 2692, 842, 284, 220, 15, 280, 197, 10217, 18279, 284, 220, 20, 15, 15, 15, 280, 286, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_to_packets() { let keypair = Keypair::new(); let hash = Hash::new(&[1; 32]); let tx = Transaction::system_new(&keypair, keypair.pubkey(), 1, hash); let rv = to_packets(&vec![tx.clone(); 1]); assert_eq!(rv.len(), 1); assert_eq!(rv[0].read().unwrap().packets.len(), 1); let rv = to_packets(&vec![tx.clone(); NUM_PACKETS]); assert_eq!(rv.len(), 1); assert_eq!(rv[0].read().unwrap().packets.len(), NUM_PACKETS); let rv = to_packets(&vec![tx.clone(); NUM_PACKETS + 1]); assert_eq!(rv.len(), 2); assert_eq!(rv[0].read().unwrap().packets.len(), NUM_PACKETS); assert_eq!(rv[1].read().unwrap().packets.len(), 1); }
rust_cleaned_test_functions.jsonl/89211
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 368 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2346, 63569, 368, 341, 286, 1077, 1376, 12670, 284, 6569, 1082, 1310, 486, 931, 543, 286, 1077, 5175, 284, 6531, 486, 931, 2099, 58, 16, 26, 220, 18, 17, 2558, 286, 1077, 9854, 284, 17869, 486...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_parse() { let expected = vec![ Direction::Forward(5), Direction::Down(5), Direction::Forward(8), Direction::Up(3), Direction::Down(8), Direction::Forward(2), ]; let dirs = Direction::from_lines(INPUT); assert_eq!(dirs, Ok(expected)); }
rust_cleaned_test_functions.jsonl/53309
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 194 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21039, 368, 341, 286, 1077, 3601, 284, 7486, 90515, 310, 18904, 486, 25925, 7, 20, 1326, 310, 18904, 486, 4454, 7, 20, 1326, 310, 18904, 486, 25925, 7, 23, 1326, 310, 18904, 486, 2324, 7, 18, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_inline_this() { test( concat!( "/** @constructor */", "function C() {}", "", "C.prototype.m = function() {", " var self = this;", " if (true) {", " alert(self);", " }", "};", ), concat!( "(/** @constructor */", "function C() {}).prototype.m = function() {", " if (true) {", " alert(this);", " }", "};", ), ); }
rust_cleaned_test_functions.jsonl/27707
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 357 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 41871, 24868, 368, 341, 262, 1273, 1006, 286, 33720, 33673, 310, 3521, 334, 569, 21846, 639, 756, 310, 330, 1688, 356, 368, 4687, 756, 310, 8324, 310, 330, 34, 6003, 744, 284, 729, 368, 314, 7...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_chain_insert_delete() { let base_rope: Rope = vec![0, 1, 2, 3].into(); let mut delta_builder = DeltaBuilder::new(base_rope.len()); delta_builder.replace(0..0, Into::<Rope>::into(vec![5, 6, 7]).into_node()); let insertion = delta_builder.build(); let mid_rope = base_rope.apply_delta(&insertion); let mut delta_builder2 = DeltaBuilder::new(mid_rope.len()); delta_builder2.delete(0..1); let deletion = delta_builder2.build(); let final_rope = mid_rope.apply_delta(&deletion); assert_eq!(&final_rope.slice_to_cow(..), &vec![6, 7, 0, 1, 2, 3]); let chained_subsets = Action::from_delta(insertion.clone()).subsets_for_chain(deletion.clone()); assert_eq!(&chained_subsets.0.delete_from_string("5670123"), "0123"); assert_eq!(&chained_subsets.1.delete_from_string("5670123"), "670123"); assert_eq!(&chained_subsets.2.delete_from_string("5670123"), "0123"); let chained_delta = Action::from_delta(insertion).chain(&mid_rope, deletion); let chain_final_rope = base_rope.apply_delta(&chained_delta.delta); assert_eq!(&chain_final_rope.slice_to_cow(..), &vec![6, 7, 0, 1, 2, 3]); }
rust_cleaned_test_functions.jsonl/10026
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 573 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 30583, 17678, 11353, 368, 341, 286, 1077, 2331, 26608, 375, 25, 97896, 284, 7486, 20703, 15, 11, 220, 16, 11, 220, 17, 11, 220, 18, 936, 18122, 543, 286, 1077, 5206, 9477, 28532, 284, 24957, 3...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_address_resolution() { // Test a basic ARP resolution scenario with both sides participating. // We expect the following steps: // ARP request and set a request retry timer. // layer is notified of the resolution. let local = DummyContext::default(); let mut remote = DummyContext::default(); remote.get_mut().hw_addr = TEST_REMOTE_MAC; remote.get_mut().proto_addr = Some(TEST_REMOTE_IPV4); let mut network = DummyNetwork::new( vec![("local", local), ("remote", remote)], |ctx, _state: &DummyArpContext, _meta| { if ctx == "local" { ("remote", (), (), None) } else { ("local", (), (), None) } }, ); // The lookup should fail. assert!(lookup(network.context("local"), (), TEST_LOCAL_MAC, TEST_REMOTE_IPV4).is_none()); // We should have sent an ARP request. validate_last_arp_packet( network.context("local"), 1, Mac::BROADCAST, ArpOp::Request, TEST_LOCAL_IPV4, TEST_REMOTE_IPV4, TEST_LOCAL_MAC, Mac::BROADCAST, ); // We should have installed a retry timer. validate_single_retry_timer( network.context("local"), DEFAULT_ARP_REQUEST_PERIOD, TEST_REMOTE_IPV4, ); // Step once to deliver the ARP request to the remote. let res = network.step::<ArpTimerFrameHandler<EthernetLinkDevice, Ipv4Addr>>(); assert_eq!(res.timers_fired(), 0); assert_eq!(res.frames_sent(), 1); // The remote should have populated its ARP cache with the local's // information. assert_eq!( network.context("remote").get_ref().arp_state.table.lookup(TEST_LOCAL_IPV4).unwrap(), &TEST_LOCAL_MAC ); // The remote should have sent an ARP response. validate_last_arp_packet( network.context("remote"), 1, TEST_LOCAL_MAC, ArpOp::Response, TEST_REMOTE_IPV4, TEST_LOCAL_IPV4, TEST_REMOTE_MAC, TEST_LOCAL_MAC, ); // Step once to deliver the ARP response to the local. let res = network.step::<ArpTimerFrameHandler<EthernetLinkDevice, Ipv4Addr>>(); assert_eq!(res.timers_fired(), 0); assert_eq!(res.frames_sent(), 1); // The local should have populated its cache with the remote's // information. assert_eq!( network.context("local").get_ref().arp_state.table.lookup(TEST_REMOTE_IPV4).unwrap(), &TEST_REMOTE_MAC ); // expiration timer. validate_single_entry_timer( network.context("local"), DEFAULT_ARP_ENTRY_EXPIRATION_PERIOD, TEST_REMOTE_IPV4, ); // The device layer should have been notified. assert_eq!( network.context("local").get_ref().addr_resolved.as_slice(), [(TEST_REMOTE_IPV4, TEST_REMOTE_MAC)] ); }
rust_cleaned_test_functions.jsonl/16997
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1643 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6744, 39849, 368, 341, 286, 442, 3393, 264, 6770, 91337, 10935, 15048, 448, 2176, 11067, 23528, 624, 286, 442, 1205, 1720, 279, 2701, 7354, 510, 1789, 286, 442, 262, 91337, 1681, 323, 738, 264, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_lambda() { let ref a = parse_expr("|a: i32| let a = 1; let b = 1; a").unwrap(); let ref b = parse_expr("|a: i32| let a = 1; let c = 1; a").unwrap(); assert_eq!(ExprHash::from(a).unwrap(), ExprHash::from(b).unwrap()); }
rust_cleaned_test_functions.jsonl/103360
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 116 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 51884, 368, 341, 262, 1077, 2053, 264, 284, 4715, 21915, 38547, 64, 25, 600, 18, 17, 91, 1077, 264, 284, 220, 16, 26, 1077, 293, 284, 220, 16, 26, 264, 1827, 15454, 543, 262, 1077, 2053, 293...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_synth() { let mut rng = XorShiftRng::from_seed([0x3dbe6259, 0x8d313d76, 0x3237db17, 0xe5bc0654]); let window_size = 4; let mut assignment = vec![Fr::zero(); 1 << window_size]; let constants: Vec<_> = (0..(1 << window_size)).map(|_| Fr::rand(&mut rng)).collect(); synth::<Bls12, _>(window_size, &constants, &mut assignment); for b in 0..(1 << window_size) { let mut acc = Fr::zero(); for j in 0..(1 << window_size) { if j & b == j { acc.add_assign(&assignment[j]); } } assert_eq!(acc, constants[b]); } }
rust_cleaned_test_functions.jsonl/66528
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 368 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 643, 45809, 368, 341, 286, 1077, 5206, 28422, 284, 1599, 269, 24841, 49, 968, 486, 1499, 33809, 2561, 15, 87, 18, 83406, 21, 17, 20, 24, 11, 220, 15, 87, 23, 67, 18, 16, 18, 67, 22, 21, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
4
#[test] fn test_decode_date_time() { let buf = [11, 218, 7, 10, 17, 19, 27, 30, 1, 0, 0, 0]; let date1 = <NaiveDateTime as Decode<MySql>>::decode(Some(MySqlValue::Binary(&buf))).unwrap(); assert_eq!(date1.to_string(), "2010-10-17 19:27:30.000001"); let buf = [7, 218, 7, 10, 17, 19, 27, 30]; let date2 = <NaiveDateTime as Decode<MySql>>::decode(Some(MySqlValue::Binary(&buf))).unwrap(); assert_eq!(date2.to_string(), "2010-10-17 19:27:30"); let buf = [4, 218, 7, 10, 17]; let date3 = <NaiveDateTime as Decode<MySql>>::decode(Some(MySqlValue::Binary(&buf))).unwrap(); assert_eq!(date3.to_string(), "2010-10-17 00:00:00"); }
rust_cleaned_test_functions.jsonl/18497
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 313 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 15227, 4164, 3009, 368, 341, 1066, 262, 1077, 6607, 284, 508, 16, 16, 11, 220, 17, 16, 23, 11, 220, 22, 11, 220, 16, 15, 11, 220, 16, 22, 11, 220, 16, 24, 11, 220, 17, 22, 11, 220, 18,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_method_not_found() { let io = IoHandler::new(); let request = r#"{"jsonrpc": "2.0", "method": "say_hello", "params": [42, 23], "id": 1}"#; let response = r#"{"jsonrpc":"2.0","error":{"code":-32601,"message":"Method not found"},"id":1}"#; assert_eq!(io.handle_request_sync(request), Some(response.to_string())); }
rust_cleaned_test_functions.jsonl/95532
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 141 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 9032, 7913, 21480, 368, 341, 197, 10217, 6399, 284, 29655, 3050, 486, 931, 1428, 197, 10217, 1681, 284, 435, 55543, 4913, 2236, 29414, 788, 330, 17, 13, 15, 497, 330, 4393, 788, 330, 36790, 9672...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_simple_vertex_traversal_with_label_and_has_v2() { let client = graph_serializer(GraphSON::V2); drop_vertices(&client, "test_simple_vertex_traversal_with_label_and_has").unwrap(); let vertex = create_vertex_with_label( &client, "test_simple_vertex_traversal_with_label_and_has", "Traversal", ); let g = traversal().with_remote(client); let results = g .v(()) .has_label("test_simple_vertex_traversal_with_label_and_has") .has(("name", "Traversal")) .to_list() .unwrap(); assert_eq!(1, results.len()); assert_eq!(vertex.id(), results[0].id()); // with 3 params let results = g .v(()) .has(( "test_simple_vertex_traversal_with_label_and_has", "name", "Traversal", )) .to_list() .unwrap(); assert_eq!(1, results.len()); assert_eq!(vertex.id(), results[0].id()); // with 1 param let results = g .v(()) .has_label("test_simple_vertex_traversal_with_label_and_has") .has("name") .to_list() .unwrap(); assert_eq!(1, results.len()); assert_eq!(vertex.id(), results[0].id()); // hasNot let results = g .v(()) .has_label("test_simple_vertex_traversal_with_label_and_has") .has_not("surname") .to_list() .unwrap(); assert_eq!(1, results.len()); assert_eq!(vertex.id(), results[0].id()); }
rust_cleaned_test_functions.jsonl/26272
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 750 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 30015, 26611, 3547, 45545, 6615, 6106, 8378, 21778, 2273, 17, 368, 341, 262, 1077, 2943, 284, 4771, 67441, 63779, 2703, 486, 53, 17, 626, 262, 5943, 37720, 2099, 2972, 11, 330, 1944, 30015, 26611,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_version_sort_overwrite_by_timesort() { let dir = tempdir(); dir.child("2").touch().unwrap(); dir.child("11").touch().unwrap(); cmd() .arg("-v") .arg("-t") .arg("--ignore-config") .arg(dir.path()) .assert() .stdout(predicate::str::is_match("11\n2\n$").unwrap()); }
rust_cleaned_test_functions.jsonl/639
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 177 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 9438, 18435, 15431, 4934, 3710, 22353, 371, 368, 341, 262, 1077, 5419, 284, 2730, 3741, 543, 262, 5419, 17531, 445, 17, 1827, 22020, 1005, 15454, 543, 262, 5419, 17531, 445, 16, 16, 1827, 22020, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_geq_same_num_digits_gt_true() { // Given: let a = Counter::from(vec![0, 1]); let b = Counter::from(vec![0, 2]); // Then: assert!(b >= a); }
rust_cleaned_test_functions.jsonl/79532
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 139 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 32933, 80, 33574, 4273, 41432, 37479, 16082, 368, 341, 310, 442, 16246, 510, 310, 1077, 264, 284, 19735, 486, 1499, 25592, 20703, 15, 11, 220, 16, 2558, 310, 1077, 293, 284, 19735, 486, 1499, 25...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_to_vec() { let data = Data { base: "https://example.com".into(), client_id: "adbc01234".into(), client_secret: "0987dcba".into(), redirect: "urn:ietf:wg:oauth:2.0:oob".into(), token: "fedc5678".into(), }; let v = to_vec(&data).expect("Couldn't write to vec"); let desered = from_slice(&v).expect("Couldn't deserialize data"); assert_eq!(data, desered); }
rust_cleaned_test_functions.jsonl/39222
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 248 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2346, 13251, 368, 341, 286, 1077, 821, 284, 2885, 341, 310, 2331, 25, 330, 2428, 1110, 8687, 905, 3263, 18122, 3148, 310, 2943, 842, 25, 330, 329, 8904, 15, 16, 17, 18, 19, 3263, 18122, 3148, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_short_ascii() { // always inlined on all archs let strs = vec!["nyc", "statue", "liberty", "img_1234.png"]; for s in strs { let compact = CompactString::new(s); assert_eq!(compact, s); assert_eq!(s, compact); assert_eq!(compact.is_heap_allocated(), false); } }
rust_cleaned_test_functions.jsonl/2780
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 160 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 16673, 50238, 368, 341, 262, 442, 2677, 304, 15121, 389, 678, 5325, 82, 198, 262, 1077, 57584, 284, 7486, 0, 1183, 77, 3337, 497, 330, 9878, 361, 497, 330, 2740, 1344, 497, 330, 1892, 62, 16, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_introspection() { let conn = PgConnection::establish(&TEST_DATABASE_URL) .expect(&format!("Error connecting to {}", TEST_DATABASE_URL)); let seed_user = seed::user_journey(&conn); let seed_token = seed::auth_token(&conn, seed_user); let user = endpoints::introspection(&conn, seed_token.token.to_string().as_str()); assert_eq!(757, user.len()); println!("{}", user); }
rust_cleaned_test_functions.jsonl/123717
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 200 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 4042, 3630, 16076, 368, 341, 286, 1077, 4534, 284, 97265, 4526, 486, 33400, 2099, 10033, 45510, 8000, 340, 310, 659, 17119, 2099, 2243, 17223, 1454, 20913, 311, 24689, 13602, 45510, 8000, 1106, 286,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_publicationproperties_depth() { let mut publication: Publication = Publication { publication_type: PublicationType::Pdf, depth_mm: Some(10.0), ..Default::default() }; assert_eq!( publication.dimension_error(), Err(ThothError::DimensionDigitalError) ); publication.depth_mm = None; assert_eq!(publication.dimension_error(), Ok(())); publication.depth_in = Some(3.94); assert_eq!( publication.dimension_error(), Err(ThothError::DimensionDigitalError) ); publication.publication_type = PublicationType::Paperback; assert_eq!( publication.dimension_error(), Err(ThothError::DepthEmptyError) ); publication.depth_in = None; assert_eq!(publication.dimension_error(), Ok(())); publication.depth_mm = Some(10.0); assert_eq!( publication.dimension_error(), Err(ThothError::DepthEmptyError) ); publication.depth_in = Some(3.94); assert_eq!(publication.dimension_error(), Ok(())); }
rust_cleaned_test_functions.jsonl/46235
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 424 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 27074, 367, 13193, 19061, 368, 341, 262, 1077, 5206, 16599, 25, 56894, 284, 56894, 341, 286, 16599, 1819, 25, 56894, 929, 486, 67596, 345, 286, 7990, 35599, 25, 4329, 7, 16, 15, 13, 15, 1326, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_group_shares() { let share1 = fake_share(1, vec![1]); let share2 = fake_share(1, vec![2]); let share3 = fake_share(2, vec![1]); let grouped_shares = group_shares(Box::new(vec![share1, share2, share3].into_iter())); assert_eq!(grouped_shares.get(&1).unwrap().len(), 2); assert_eq!(grouped_shares.get(&2).unwrap().len(), 1); }
rust_cleaned_test_functions.jsonl/31393
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 194 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6288, 3712, 5403, 368, 341, 286, 1077, 4332, 16, 284, 12418, 38272, 7, 16, 11, 7486, 20703, 16, 2558, 286, 1077, 4332, 17, 284, 12418, 38272, 7, 16, 11, 7486, 20703, 17, 2558, 286, 1077, 4332,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_vector_2() { let address = "DdzFFzCqrht4it4GYgBp4J39FNnKBsPFejSppARXHCf2gGiTJcwXzpRvgDmxPvKQ8aZZmVqcLUz5L66a8Ja46pfKVtFRaKyn9eKdvpaC".parse().unwrap(); let public_key = XPub::from_bytes([ 0xff, 0x7b, 0xf1, 0x29, 0x9d, 0xf3, 0xd7, 0x17, 0x98, 0xae, 0xfd, 0xc4, 0xae, 0xa7, 0xdb, 0x2f, 0x8d, 0xb7, 0x60, 0x46, 0x56, 0x94, 0x41, 0xea, 0xe5, 0x8b, 0x72, 0x23, 0xb6, 0x8b, 0x44, 0x04, 0x82, 0x15, 0xcb, 0xac, 0x94, 0xbc, 0xb7, 0xf2, 0xcf, 0x33, 0x6c, 0x6c, 0x18, 0xbc, 0x3e, 0x71, 0x3f, 0xfd, 0x82, 0x67, 0x59, 0x4f, 0xf6, 0x34, 0x93, 0x32, 0xce, 0x4f, 0x98, 0x04, 0xa7, 0xff, ]); assert_same_address(address, public_key) }
rust_cleaned_test_functions.jsonl/1894
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 500 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 12247, 62, 17, 368, 341, 286, 1077, 2621, 284, 330, 35, 37877, 1748, 89, 34, 23004, 426, 19, 275, 19, 41470, 70, 33, 79, 19, 41, 18, 24, 41604, 77, 29862, 82, 47, 6123, 73, 50, 602, 934, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_connect() { let tmpdir = tempfile::tempdir().unwrap(); let path = format!("{}/socket", tmpdir.as_ref().to_str().unwrap()); let path1 = path.clone(); assert!(RemotePublisher::connect("a".repeat(16384)).is_err()); assert!(RemotePublisher::connect(&path).is_err()); let barrier = Arc::new(Barrier::new(2)); let barrier2 = barrier.clone(); let thread = std::thread::spawn(move || { let listener = UnixListener::bind(&path1).unwrap(); listener.set_nonblocking(true).unwrap(); let t = Arc::new(Box::new(FakeServer {}) as Box<dyn Events + Send + Sync>); let service = client::create_events(t); let mut server = Server::new() .add_listener(listener.as_raw_fd()) .unwrap() .register_service(service); std::mem::forget(listener); server.start().unwrap(); barrier2.wait(); barrier2.wait(); server.shutdown(); }); barrier.wait(); let client = RemotePublisher::new(&path).unwrap(); let mut msg = TaskOOM::new(); msg.set_container_id("test".to_string()); client .publish(Context::default(), "/tasks/oom", "ns1", msg) .unwrap(); barrier.wait(); thread.join().unwrap(); }
rust_cleaned_test_functions.jsonl/14259
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 663 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 15720, 368, 341, 286, 1077, 4174, 3741, 284, 54819, 486, 3888, 3741, 1005, 15454, 543, 286, 1077, 1815, 284, 3561, 88928, 4472, 9556, 497, 4174, 3741, 5357, 7793, 1005, 983, 2895, 1005, 15454, 142...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_get_device_name() { if let Some(device) = test_get_default_device(Scope::Input) { let name = get_device_name(device, DeviceType::INPUT).unwrap(); println!("input device name: {}", name.into_string()); } else { println!("No input device."); } if let Some(device) = test_get_default_device(Scope::Output) { let name = get_device_name(device, DeviceType::OUTPUT).unwrap(); println!("output device name: {}", name.into_string()); } else { println!("No output device."); } }
rust_cleaned_test_functions.jsonl/113812
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 230 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 3062, 9204, 1269, 368, 341, 262, 421, 1077, 4329, 17848, 8, 284, 1273, 3062, 9993, 9204, 3759, 2417, 486, 2505, 8, 341, 286, 1077, 829, 284, 633, 9204, 1269, 17848, 11, 13903, 929, 486, 29421, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_slice_2() { let ss = "中华Việt Nam"; assert_eq!("华", ss.slice(3u, 6u)); assert_eq!("Việt Nam", ss.slice(6u, 16u)); assert_eq!("ab", "abc".slice(0u, 2u)); assert_eq!("bc", "abc".slice(1u, 3u)); assert_eq!("", "abc".slice(1u, 1u)); assert_eq!("中", ss.slice(0u, 3u)); assert_eq!("华V", ss.slice(3u, 7u)); assert_eq!("", ss.slice(3u, 3u)); /*0: 中 3: 华 6: V 7: i 8: ệ 11: t 12: 13: N 14: a 15: m */ }
rust_cleaned_test_functions.jsonl/2437
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 384 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 26488, 62, 17, 368, 341, 286, 1077, 10870, 284, 330, 100849, 35544, 124382, 29974, 3302, 286, 2060, 10714, 17223, 85361, 497, 10870, 14530, 7, 18, 84, 11, 220, 21, 84, 1106, 286, 2060, 10714, 17...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_root_ns_meth_ret_nonpod() { let hdr = indoc! {" #include <cstdint> #include <memory> struct Bob { uint32_t a; }; namespace B { struct C { uint32_t a; Bob daft() const { Bob bob; bob.a = 12; return bob; } }; } "}; let rs = quote! { let b = ffi::B::C { a: 12 }; b.daft().as_ref().unwrap(); }; run_test("", hdr, rs, &["Bob"], &["B::C"]); }
rust_cleaned_test_functions.jsonl/9842
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 300 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 12993, 34728, 717, 769, 21695, 21637, 39073, 368, 341, 262, 1077, 36615, 284, 1257, 509, 0, 314, 698, 286, 671, 997, 366, 96975, 397, 286, 671, 997, 366, 17269, 397, 286, 2036, 14261, 341, 310, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_take_0() { let input = [].as_ref(); let count = 0usize; assert_eq!(count, 0usize); let offset = 0usize; let result: crate::IResult<(&[u8], usize), usize> = take(count)((input, offset)); assert_eq!(result, Ok(((input, offset), 0))); }
rust_cleaned_test_functions.jsonl/41245
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 127 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 73261, 62, 15, 368, 341, 262, 1077, 1946, 284, 72375, 300, 7793, 543, 262, 1077, 1760, 284, 220, 15, 51878, 280, 262, 2060, 10714, 10297, 1830, 11, 220, 15, 51878, 317, 262, 1077, 4347, 284, 2...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_ln_pdf() { let ln_pdf = |arg: DVector<_>| move |x: MultivariateNormal| x.ln_pdf(&arg); test_case(vec![0., 0.], vec![1., 0., 0., 1.], (0.05854983152431917f64).ln(), ln_pdf(dvec![1., 1.])); test_almost(vec![0., 0.], vec![1., 0., 0., 1.], (0.013064233284684921f64).ln(), 1e-15, ln_pdf(dvec![1., 2.])); test_almost(vec![0., 0.], vec![1., 0., 0., 1.], (1.8618676045881531e-23f64).ln(), 1e-15, ln_pdf(dvec![1., 10.])); test_almost(vec![0., 0.], vec![1., 0., 0., 1.], (5.920684802611216e-45f64).ln(), 1e-15, ln_pdf(dvec![10., 10.])); test_almost(vec![0., 0.], vec![1., 0.9, 0.9, 1.], (1.6576716577547003e-05f64).ln(), 1e-14, ln_pdf(dvec![1., -1.])); test_almost(vec![0., 0.], vec![1., 0.99, 0.99, 1.], (4.1970621773477824e-44f64).ln(), 1e-12, ln_pdf(dvec![1., -1.])); test_almost(vec![0.5, -0.2], vec![2.0, 0.3, 0.3, 0.5], (0.0013075203140666656f64).ln(), 1e-15, ln_pdf(dvec![2., 2.])); test_case(vec![0., 0.], vec![f64::INFINITY, 0., 0., f64::INFINITY], f64::NEG_INFINITY, ln_pdf(dvec![10., 10.])); test_case(vec![0., 0.], vec![f64::INFINITY, 0., 0., f64::INFINITY], f64::NEG_INFINITY, ln_pdf(dvec![100., 100.])); }
rust_cleaned_test_functions.jsonl/106558
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 684 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 60401, 39948, 368, 341, 286, 1077, 29390, 39948, 284, 760, 858, 25, 422, 3781, 32399, 69844, 3271, 760, 87, 25, 22162, 55422, 12206, 91, 856, 918, 77, 39948, 2099, 858, 317, 286, 1273, 19096, 25...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_bare_variant() { // "TestUnit" let bser_v2 = b"\x00\x02\x00\x00\x00\x00\x05\x0b\x00\x00\x00\x02\x03\x08TestUnit"; let decoded = from_slice::<BytestringVariant>(bser_v2).unwrap(); assert_eq!(decoded, BytestringVariant::TestUnit); }
rust_cleaned_test_functions.jsonl/34066
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 139 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 880, 546, 46112, 368, 341, 262, 442, 330, 2271, 4562, 698, 262, 1077, 293, 799, 2273, 17, 284, 293, 11934, 87, 15, 15, 3462, 15, 17, 3462, 15, 15, 3462, 15, 15, 3462, 15, 15, 3462, 15, 15,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_remove_node_and_edges_undirected() { let mut g = UnMatrix::new_undirected(); let a = g.add_node('a'); let b = g.add_node('b'); let c = g.add_node('c'); g.add_edge(a, b, ()); g.add_edge(b, c, ()); g.add_edge(c, a, ()); // removing a should break the `a - b` and `a - c` edges g.remove_node(a); assert_eq!(g.node_count(), 2); let b_neighbors = g.neighbors(b).into_sorted_vec(); assert_eq!(b_neighbors, vec![c]); let c_neighbors = g.neighbors(c).into_sorted_vec(); assert_eq!(c_neighbors, vec![b]); }
rust_cleaned_test_functions.jsonl/81967
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 339 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 18193, 5084, 8378, 28026, 62, 1241, 74612, 368, 341, 286, 1077, 5206, 342, 284, 1230, 6689, 486, 931, 62, 1241, 74612, 543, 286, 1077, 264, 284, 342, 1364, 5084, 492, 64, 1157, 286, 1077, 293, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_raw_transaction_with_a_write_set_canonical_serialization_example() { let input = RawTransaction::new_write_set( AccountAddress::new([ 0xc3, 0x39, 0x8a, 0x59, 0x9a, 0x6f, 0x3b, 0x9f, 0x30, 0xb6, 0x35, 0xaf, 0x29, 0xf2, 0xba, 0x04, ]), 32, get_common_write_set(), ); let expected_output = vec![ 195, 57, 138, 89, 154, 111, 59, 159, 48, 182, 53, 175, 41, 242, 186, 4, 32, 0, 0, 0, 0, 0, 0, 0, 1, 2, 167, 29, 118, 250, 162, 210, 213, 195, 34, 78, 195, 212, 29, 235, 41, 57, 33, 1, 33, 125, 166, 198, 179, 225, 159, 24, 37, 207, 178, 103, 109, 174, 204, 227, 191, 61, 224, 60, 242, 102, 71, 199, 141, 240, 11, 55, 27, 37, 204, 151, 0, 196, 198, 63, 128, 199, 75, 17, 38, 62, 66, 30, 191, 132, 134, 164, 227, 9, 1, 33, 125, 166, 198, 179, 225, 159, 24, 1, 4, 202, 254, 208, 13, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 3, 76, 66, 82, 255, 255, 255, 255, 255, 255, 255, 255, ]; let actual_output = to_bytes(&input).unwrap(); assert_eq!(expected_output, actual_output); }
rust_cleaned_test_functions.jsonl/8054
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 585 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 16067, 28884, 6615, 4306, 9165, 2602, 27421, 22391, 25602, 2022, 39304, 368, 341, 262, 1077, 1946, 284, 23022, 8070, 486, 931, 9165, 2602, 1006, 286, 8615, 4286, 486, 931, 8956, 310, 220, 15, 8148...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_range() { let engine = TestEngineBuilder::new().build().unwrap(); for i in 1..7 { // ts = 1: value = [] must_prewrite_put(&engine, &[i], &[], &[i], 1); must_commit(&engine, &[i], 1, 1); // ts = 7: value = [ts] must_prewrite_put(&engine, &[i], &[i], &[i], 7); must_commit(&engine, &[i], 7, 7); // ts = 14: value = [] must_prewrite_put(&engine, &[i], &[], &[i], 14); must_commit(&engine, &[i], 14, 14); } let snapshot = engine.snapshot(&Context::default()).unwrap(); // Test both bound specified. let mut scanner = ScannerBuilder::new(snapshot.clone(), 10, true) .range(Some(Key::from_raw(&[3u8])), Some(Key::from_raw(&[5u8]))) .build() .unwrap(); assert_eq!( scanner.next().unwrap(), Some((Key::from_raw(&[4u8]), vec![4u8])) ); assert_eq!( scanner.next().unwrap(), Some((Key::from_raw(&[3u8]), vec![3u8])) ); assert_eq!(scanner.next().unwrap(), None); // Test left bound not specified. let mut scanner = ScannerBuilder::new(snapshot.clone(), 10, true) .range(None, Some(Key::from_raw(&[3u8]))) .build() .unwrap(); assert_eq!( scanner.next().unwrap(), Some((Key::from_raw(&[2u8]), vec![2u8])) ); assert_eq!( scanner.next().unwrap(), Some((Key::from_raw(&[1u8]), vec![1u8])) ); assert_eq!(scanner.next().unwrap(), None); // Test right bound not specified. let mut scanner = ScannerBuilder::new(snapshot.clone(), 10, true) .range(Some(Key::from_raw(&[5u8])), None) .build() .unwrap(); assert_eq!( scanner.next().unwrap(), Some((Key::from_raw(&[6u8]), vec![6u8])) ); assert_eq!( scanner.next().unwrap(), Some((Key::from_raw(&[5u8]), vec![5u8])) ); assert_eq!(scanner.next().unwrap(), None); // Test both bound not specified. let mut scanner = ScannerBuilder::new(snapshot.clone(), 10, true) .range(None, None) .build() .unwrap(); assert_eq!( scanner.next().unwrap(), Some((Key::from_raw(&[6u8]), vec![6u8])) ); assert_eq!( scanner.next().unwrap(), Some((Key::from_raw(&[5u8]), vec![5u8])) ); assert_eq!( scanner.next().unwrap(), Some((Key::from_raw(&[4u8]), vec![4u8])) ); assert_eq!( scanner.next().unwrap(), Some((Key::from_raw(&[3u8]), vec![3u8])) ); assert_eq!( scanner.next().unwrap(), Some((Key::from_raw(&[2u8]), vec![2u8])) ); assert_eq!( scanner.next().unwrap(), Some((Key::from_raw(&[1u8]), vec![1u8])) ); assert_eq!(scanner.next().unwrap(), None); }
rust_cleaned_test_functions.jsonl/36639
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1742 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 9698, 368, 341, 286, 1077, 4712, 284, 3393, 4571, 3297, 486, 931, 1005, 5834, 1005, 15454, 1428, 1789, 286, 369, 600, 304, 220, 16, 496, 22, 341, 310, 442, 10591, 284, 220, 16, 25, 897, 284, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_pass_doesnt_produce_invalid_code1() { test_same(concat!( "function f(x = void 0) {", " var z;", " {", " const y = {};", " x && (y['x'] = x);", " z = y;", " }", " return z;", "}", )); }
rust_cleaned_test_functions.jsonl/27592
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 188 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 15464, 96374, 406, 2540, 13373, 31433, 4136, 16, 368, 341, 262, 1273, 33574, 96360, 33673, 286, 330, 1688, 282, 2075, 284, 737, 220, 15, 8, 314, 756, 286, 330, 220, 762, 1147, 64497, 286, 330, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_poc050_burn_from() { let mut t = Token::deployed(); let amount = 5_000_000.into(); t.mint(t.bro, amount, Sender(t.futjin)); t.increase_allowance(t.futjin, 1.into(), Sender(t.bro)); t.burn_from(t.bro, 1.into(), Sender(t.futjin)); assert_eq!(t.balance_of(t.bro), 4_999_999.into()); }
rust_cleaned_test_functions.jsonl/39706
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 160 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 620, 509, 15, 20, 15, 880, 399, 5673, 368, 341, 262, 1077, 5206, 259, 284, 9660, 486, 35794, 291, 543, 262, 1077, 3311, 284, 220, 20, 62, 15, 15, 15, 62, 15, 15, 15, 39860, 1428, 262, 259,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_configure_system() { let mut vmm = create_vmm_object(InstanceState::Uninitialized); assert!(vmm.init_guest_memory().is_ok()); // test that we can do this any number of times we want. assert!(vmm.init_guest_memory().is_ok()); assert!(vmm.vm.memory().is_some()); assert_eq!( vmm.configure_system(&Vec::new()).unwrap_err().to_string(), "Cannot start microvm without kernel configuration." ); vmm.default_kernel_config(None); // We need this so that configure_system finds a properly setup GIC device #[cfg(target_arch = "aarch64")] assert!(vmm.vm.setup_irqchip(1).is_ok()); assert!(vmm.configure_system(&Vec::new()).is_ok()); vmm.stdin_handle.lock().set_canon_mode().unwrap(); }
rust_cleaned_test_functions.jsonl/28158
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 373 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 75887, 17687, 368, 341, 286, 1077, 5206, 348, 3821, 284, 1855, 2273, 3821, 5314, 7, 8846, 486, 1806, 36161, 626, 286, 2060, 10297, 85, 3821, 8271, 62739, 19195, 1005, 285, 19817, 5231, 286, 442, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_concat_str() { let a = "Hello"; let b = "World"; let c = format!("{} {}", a, b); assert_eq!(c, "Hello World") }
rust_cleaned_test_functions.jsonl/24893
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 94 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 57478, 2895, 368, 341, 286, 1077, 264, 284, 330, 9707, 876, 286, 1077, 293, 284, 330, 10134, 876, 286, 1077, 272, 284, 3561, 17223, 6257, 24689, 264, 11, 293, 317, 286, 2060, 10714, 10297, 66, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_invert() { assert!(Matrix4::<f64>::identity().invert().unwrap().is_identity()); assert!(C.invert().unwrap().approx_eq(&( Matrix4::new( 5.0f64, -4.0f64, 1.0f64, 0.0f64, -4.0f64, 8.0f64, -4.0f64, 0.0f64, 4.0f64, -8.0f64, 4.0f64, 8.0f64, -3.0f64, 4.0f64, 1.0f64, -8.0f64) * 0.125f64))); let mat_c = Matrix4::new(-0.131917f64, -0.76871f64, 0.625846f64, 0.0f64, -0., 0.631364f64, 0.775487f64, 0.0f64, -0.991261f64, 0.1023f64, -0.083287f64, 0.0f64, 0., -1.262728f64, -1.550973f64, 1.0f64); assert!((mat_c.invert().unwrap() * mat_c).is_identity()); let mat_d = Matrix4::new( 0.065455f64, -0.720002f64, 0.690879f64, 0.0f64, -0., 0.692364f64, 0.721549f64, 0.0f64, -0.997856f64, -0.047229f64, 0.045318f64, 0.0f64, 0., -1.384727f64, -1.443098f64, 1.0f64); assert!((mat_d.invert().unwrap() * mat_d).is_identity()); let mat_e = Matrix4::new( 0.409936f64, 0.683812f64, -0.603617f64, 0.0f64, 0., 0.661778f64, 0.7497f64, 0.0f64, 0.912114f64, -0.307329f64, 0.271286f64, 0.0f64, -0., -1.323555f64, -1.499401f64, 1.0f64); assert!((mat_e.invert().unwrap() * mat_e).is_identity()); let mat_f = Matrix4::new(-0.160691f64, -0.772608f64, 0.614211f64, 0.0f64, -0., 0.622298f64, 0.78278f64, 0.0f64, -0.987005f64, 0.125786f64, -0.099998f64, 0.0f64, 0., -1.244597f64, -1.565561f64, 1.0f64); assert!((mat_f.invert().unwrap() * mat_f).is_identity()); }
rust_cleaned_test_functions.jsonl/30172
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1418 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 1243, 1621, 368, 341, 286, 2060, 10297, 6689, 19, 27638, 69, 21, 19, 6831, 16912, 1005, 83729, 1005, 15454, 1005, 285, 46244, 5231, 286, 2060, 10297, 34, 1858, 1621, 1005, 15454, 1005, 48053, 1071...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_root_grpc_to_oci() { #[derive(Debug)] struct TestData { grpcroot: grpc::Root, result: oci::Root, } let tests = &[ TestData { // Default fields grpcroot: grpc::Root { ..Default::default() }, result: oci::Root { ..Default::default() }, }, TestData { grpcroot: grpc::Root { Path: String::from("path"), Readonly: false, ..Default::default() }, result: oci::Root { path: String::from("path"), readonly: false, ..Default::default() }, }, TestData { grpcroot: grpc::Root { Path: String::from("path"), Readonly: true, ..Default::default() }, result: oci::Root { path: String::from("path"), readonly: true, ..Default::default() }, }, ]; for (i, d) in tests.iter().enumerate() { let msg = format!("test[{}]: {:?}", i, d); let result = root_grpc_to_oci(&d.grpcroot); let msg = format!("{}, result: {:?}", msg, result); assert_eq!(d.result, result, "{}", msg); } }
rust_cleaned_test_functions.jsonl/89912
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1024 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 12993, 15682, 3992, 2346, 62, 2119, 368, 341, 286, 11506, 27098, 42618, 5563, 286, 2036, 93200, 341, 310, 47900, 2888, 25, 47900, 486, 8439, 345, 310, 1102, 25, 93975, 486, 8439, 345, 286, 555, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_put_u8() { let mut buf = Vec::with_capacity(8); buf.put_u8(33); assert_eq!(b"\x21", &buf[..]); }
rust_cleaned_test_functions.jsonl/51219
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 71 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 15557, 7300, 23, 368, 341, 262, 1077, 5206, 6607, 284, 11312, 486, 4197, 35603, 7, 23, 317, 262, 6607, 3597, 7300, 23, 7, 18, 18, 317, 262, 2060, 10714, 10297, 65, 11934, 87, 17, 16, 497, 60...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_failing_loader() { let dir = create_dir_and_file("fake.fail"); let asset_server = setup(dir.path()); asset_server.add_loader(FailingLoader); let path: AssetPath = "fake.fail".into(); let handle = asset_server.get_handle_untyped(path.get_id()); let err = futures_lite::future::block_on(asset_server.load_async(path.clone(), true)) .unwrap_err(); assert!(matches!(err, AssetServerError::AssetLoaderError(_))); assert_eq!(asset_server.get_load_state(handle), LoadState::Failed); }
rust_cleaned_test_functions.jsonl/3153
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 251 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 761, 14277, 22139, 368, 341, 286, 1077, 5419, 284, 1855, 4334, 8378, 2458, 445, 30570, 26738, 797, 286, 1077, 9329, 12015, 284, 6505, 14161, 3875, 1423, 286, 9329, 12015, 1364, 22139, 7832, 14277, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_augmentation_parse_just_signal_trampoline() { let aug_str = &mut EndianSlice::new(b"S", LittleEndian); let bases = Default::default(); let address_size = 8; let section = EhFrame::new(&[], LittleEndian); let input = &mut EndianSlice::new(&[], LittleEndian); let mut augmentation = Augmentation::default(); augmentation.is_signal_trampoline = true; assert_eq!( Augmentation::parse(aug_str, &bases, address_size, &section, input), Ok(augmentation) ); }
rust_cleaned_test_functions.jsonl/9388
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 257 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 60411, 31099, 21039, 62, 4250, 21137, 92942, 368, 341, 286, 1077, 19303, 2895, 284, 609, 6984, 3972, 1103, 33236, 486, 931, 1883, 66310, 497, 14671, 43231, 317, 286, 1077, 23092, 284, 7899, 486, 2...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_virtio_write_config() { let mut block = default_block(); let expected_config_space: [u8; CONFIG_SPACE_SIZE] = [0x00, 0x50, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00]; block.write_config(0, &expected_config_space); let mut actual_config_space = [0u8; CONFIG_SPACE_SIZE]; block.read_config(0, &mut actual_config_space); assert_eq!(actual_config_space, expected_config_space); let expected_config_space = [0x11, 0x22, 0x33, 0x44, 0x55, 0x66, 0x00, 0x11]; for i in 0..expected_config_space.len() { block.write_config(i as u64, &expected_config_space[i..=i]); } block.read_config(0, &mut actual_config_space); assert_eq!(actual_config_space, expected_config_space); // Invalid write. let new_config_space = [0xd, 0xe, 0xa, 0xd, 0xb, 0xe, 0xe, 0xf]; block.write_config(5, &new_config_space); // Make sure nothing got written. block.read_config(0, &mut actual_config_space); assert_eq!(actual_config_space, expected_config_space); }
rust_cleaned_test_functions.jsonl/73916
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 526 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2273, 2106, 815, 9165, 5332, 368, 341, 286, 1077, 5206, 2504, 284, 1638, 7113, 1428, 286, 1077, 3601, 5332, 14663, 25, 508, 84, 23, 26, 13202, 38404, 4098, 60, 4035, 310, 508, 15, 87, 15, 15, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_insert_learner_that_is_voter() -> Result<()> { let mut set = ProgressSet::new(default_logger()); let default_progress = Progress::new(0, 256); let mut canary_progress = Progress::new(0, 256); canary_progress.matched = CANARY; set.insert_voter(1, default_progress.clone())?; assert!( set.insert_learner(1, canary_progress).is_err(), "Should return an error on invalid learner insert." ); assert_eq!( *set.get(1).expect("Should be inserted."), default_progress, "The ProgressSet was mutated in a `insert_learner` that returned error." ); Ok(()) }
rust_cleaned_test_functions.jsonl/48660
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 325 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 17678, 62, 93595, 70197, 6892, 2273, 25392, 368, 1464, 5714, 71698, 341, 286, 1077, 5206, 738, 284, 16033, 1649, 486, 931, 18978, 27413, 1423, 286, 1077, 1638, 27200, 284, 16033, 486, 931, 7, 15, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_get_keyfile_name_succeeded() { let mut path = dirs::home_dir().unwrap(); path.push(BLOCK_KEYPAIR_FILENAME); assert_eq!( path.into_os_string().into_string().unwrap(), get_keyfile_name() ); }
rust_cleaned_test_functions.jsonl/71225
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 145 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 3062, 3097, 1192, 1269, 643, 43805, 368, 341, 286, 1077, 5206, 1815, 284, 42248, 486, 5117, 4334, 1005, 15454, 1428, 286, 1815, 2552, 5349, 8044, 6600, 82966, 45005, 317, 286, 2060, 10714, 33673, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_init_sanity() { let (init_result, deps) = init_helper(vec![InitialBalance { address: HumanAddr("lebron".to_string()), amount: Uint128(5000), }]); assert_eq!(init_result.unwrap(), InitResponse::default()); let config = ReadonlyConfig::from_storage(&deps.storage); let constants = config.constants().unwrap(); assert_eq!(config.total_supply(), 5000); assert_eq!(config.contract_status(), ContractStatusLevel::NormalRun); assert_eq!(constants.name, "sec-sec".to_string()); assert_eq!(constants.admin, HumanAddr("admin".to_string())); assert_eq!(constants.symbol, "SECSEC".to_string()); assert_eq!(constants.decimals, 8); assert_eq!( constants.prng_seed, sha_256("lolz fun yay".to_owned().as_bytes()) ); assert_eq!(constants.total_supply_is_public, false); }
rust_cleaned_test_functions.jsonl/69599
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 431 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6137, 643, 38270, 368, 341, 286, 1077, 320, 2327, 5287, 11, 48178, 8, 284, 2930, 10418, 25592, 20703, 6341, 21190, 341, 310, 2621, 25, 11097, 13986, 445, 273, 67457, 3263, 983, 3904, 14702, 310, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_should_panic_good_message() { fn f() { panic!("an error message"); } let desc = TestDescAndFn { desc: TestDesc { name: StaticTestName("whatever"), ignore: false, should_panic: ShouldPanic::YesWithMessage("error message"), allow_fail: false, }, testfn: DynTestFn(Box::new(f)), }; let (tx, rx) = channel(); run_test(&TestOpts::new(), false, desc, tx); let (_, res, _) = rx.recv().unwrap(); assert!(res == TrOk); }
rust_cleaned_test_functions.jsonl/3485
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 330 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 43378, 620, 31270, 44781, 6462, 368, 341, 286, 5168, 282, 368, 341, 310, 21975, 17223, 276, 1465, 1943, 797, 286, 456, 286, 1077, 6560, 284, 3393, 11065, 3036, 24911, 341, 310, 6560, 25, 3393, 1...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_op_parse_deref_type() { // Doesn't matter for this test. let encoding = encoding4(); check_op_parse( |s| s.D8(constants::DW_OP_deref_type.0).D8(8).uleb(100), &Operation::Deref { base_type: UnitOffset(100), size: 8, space: false, }, encoding, ); check_op_parse( |s| s.D8(constants::DW_OP_GNU_deref_type.0).D8(8).uleb(100), &Operation::Deref { base_type: UnitOffset(100), size: 8, space: false, }, encoding, ); check_op_parse( |s| s.D8(constants::DW_OP_xderef_type.0).D8(8).uleb(100), &Operation::Deref { base_type: UnitOffset(100), size: 8, space: true, }, encoding, ); }
rust_cleaned_test_functions.jsonl/45758
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 600 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 10287, 21039, 814, 43970, 1819, 368, 341, 286, 442, 48832, 944, 4925, 369, 419, 1273, 624, 286, 1077, 11170, 284, 11170, 19, 1428, 286, 1779, 10287, 21039, 1006, 310, 760, 82, 91, 274, 909, 23, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_complex() { let mut list = List::new(FooAdaptor); list.push_back(Rc::new(Foo::new(1))); list.push_back(Rc::new(Foo::new(2))); list.push_back(Rc::new(Foo::new(3))); list.push_back(Rc::new(Foo::new(4))); assert_eq!(list.pop_front().unwrap().value, 1); list.push_back(Rc::new(Foo::new(5))); assert_eq!(list.pop_front().unwrap().value, 2); assert_eq!(list.pop_front().unwrap().value, 3); assert_eq!(list.pop_front().unwrap().value, 4); list.push_back(Rc::new(Foo::new(6))); assert_eq!(list.pop_front().unwrap().value, 5); assert_eq!(list.pop_front().unwrap().value, 6); assert!(list.pop_front().is_none()); }
rust_cleaned_test_functions.jsonl/68046
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 382 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 41522, 368, 341, 286, 1077, 5206, 1140, 284, 1759, 486, 931, 7832, 2624, 2589, 32657, 626, 286, 1140, 2552, 3895, 2785, 66, 486, 931, 7832, 2624, 486, 931, 7, 16, 4945, 286, 1140, 2552, 3895, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_allow_invalid_timestamp() -> Result<()> { let mut ctx = EvalContext::from(TimeEnv { allow_invalid_date: true, ..TimeEnv::default() }); let ok_cases = vec![ "2019-9-31 11:11:11", "2019-0-1 11:11:11", "2013-2-29 11:11:11", ]; for case in ok_cases { assert_eq!( "0000-00-00 00:00:00", Time::parse_timestamp(&mut ctx, case, 0, false)?.to_string() ); } let dsts = vec![ ("2019-03-10 02:00:00", "America/New_York"), ("2022-04-01 02:00:00", "America/Monterrey"), ]; for (timestamp, time_zone) in dsts { let mut ctx = EvalContext::from(TimeEnv { allow_invalid_date: true, time_zone: Tz::from_tz_name(time_zone), ..TimeEnv::default() }); assert_eq!( "0000-00-00 00:00:00", Time::parse_timestamp(&mut ctx, timestamp, 0, false)?.to_string() ) } Ok(()) }
rust_cleaned_test_functions.jsonl/40461
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 665 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 55731, 31433, 23073, 368, 1464, 5714, 71698, 341, 286, 1077, 5206, 5635, 284, 58239, 1972, 486, 1499, 36968, 14359, 341, 310, 2138, 31433, 4164, 25, 830, 345, 310, 5241, 1462, 14359, 486, 2258, 74...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
7
#[test] fn test_set_properties() { let obj = Object::with_type( SimpleObject::static_type(), &[("construct-name", &"meh"), ("name", &"initial")], ) .expect("Object::new failed"); assert_eq!( obj.property::<String>("construct-name"), String::from("meh") ); assert_eq!( obj.try_set_property("construct-name", &"test") .err() .expect("Failed to set 'construct-name' property") .to_string(), "property 'construct-name' of type 'SimpleObject' is not writable", ); assert_eq!( obj.property::<String>("construct-name"), String::from("meh") ); assert_eq!(obj.property::<String>("name"), String::from("initial")); assert!(obj.try_set_property("name", &"test").is_ok()); assert_eq!(obj.property::<String>("name"), String::from("test")); assert_eq!( obj.try_set_property("test", &true) .err() .expect("set_property failed") .to_string(), "property 'test' of type 'SimpleObject' not found", ); assert_eq!( obj.try_set_property("constructed", &false) .err() .expect("Failed to set 'constructed' property") .to_string(), "property 'constructed' of type 'SimpleObject' is not writable", ); assert_eq!( obj.try_set_property("name", &false) .err() .expect("Failed to set 'name' property") .to_string(), "property 'name' of type 'SimpleObject' can't be set from the given type (expected: 'gchararray', got: 'gboolean')", ); let other_obj = Object::with_type(SimpleObject::static_type(), &[]).expect("Object::new failed"); assert_eq!( obj.try_set_property("child", &other_obj) .err() .expect("Failed to set 'child' property") .to_string(), "property 'child' of type 'SimpleObject' can't be set from the given type (expected: 'ChildObject', got: 'SimpleObject')", ); let child = Object::with_type(ChildObject::static_type(), &[]).expect("Object::new failed"); assert!(obj.try_set_property("child", &child).is_ok()); }
rust_cleaned_test_functions.jsonl/9012
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1211 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2602, 25158, 368, 341, 286, 1077, 2839, 284, 3002, 486, 4197, 1819, 1006, 310, 8993, 1190, 486, 1978, 1819, 3148, 310, 44590, 445, 7596, 11494, 497, 609, 1, 76, 2636, 3975, 3489, 606, 497, 609, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_scope_variable_segment() { let app = App::new() .scope("/ab-{project}", |scope| { scope.resource("/path1", |r| { r.f(|r| { HttpResponse::Ok() .body(format!("project: {}", &r.match_info()["project"])) }) }) }) .finish(); let req = TestRequest::with_uri("/ab-project1/path1").request(); let resp = app.run(req); assert_eq!(resp.as_msg().status(), StatusCode::OK); match resp.as_msg().body() { &Body::Binary(ref b) => { let bytes: Bytes = b.clone().into(); assert_eq!(bytes, Bytes::from_static(b"project: project1")); } _ => panic!(), } let req = TestRequest::with_uri("/aa-project1/path1").request(); let resp = app.run(req); assert_eq!(resp.as_msg().status(), StatusCode::NOT_FOUND); }
rust_cleaned_test_functions.jsonl/22444
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 563 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 23199, 14635, 28061, 368, 341, 286, 1077, 906, 284, 1845, 486, 931, 741, 310, 659, 4186, 4283, 370, 63347, 4987, 9545, 760, 4186, 91, 341, 394, 6891, 24013, 4283, 2343, 16, 497, 760, 81, 91, 3...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_parsing_bitmasks_requiring_params_mem_access_no_param() { let mut v = ZERO_BOUND_HEADER.to_vec(); v.append(&mut vec![0x3e, 0x00, 0x04, 0x00]); // OpStore v.append(&mut vec![0x01, 0x00, 0x00, 0x00]); // pointer: 1 v.append(&mut vec![0x02, 0x00, 0x00, 0x00]); // object: 2 v.append(&mut vec![0x01, 0x00, 0x00, 0x00]); // Volatile let mut c = RetainingConsumer::new(); { let p = Parser::new(&v, &mut c); assert_matches!(p.parse(), Ok(())); } assert_eq!(1, c.insts.len()); let inst = &c.insts[0]; assert_eq!("Store", inst.class.opname); assert_eq!(None, inst.result_type); assert_eq!(None, inst.result_id); assert_eq!(vec![dr::Operand::IdRef(1), dr::Operand::IdRef(2), dr::Operand::MemoryAccess(spirv::MemoryAccess::VOLATILE)], inst.operands); }
rust_cleaned_test_functions.jsonl/85755
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 529 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 620, 28598, 13996, 76, 4604, 1288, 70094, 6745, 12976, 12759, 6536, 4090, 368, 341, 286, 1077, 5206, 348, 284, 54593, 73644, 20330, 2389, 13251, 543, 286, 348, 2057, 2099, 6984, 7486, 20703, 15, 8...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_multidim() { let mut mat = ArcArray::zeros(2 * 3 * 4 * 5 * 6).reshape((2, 3, 4, 5, 6)); mat[(0, 0, 0, 0, 0)] = 22u8; { for (i, elt) in mat.iter_mut().enumerate() { *elt = i as u8; } } assert_eq!(mat.shape(), &[2, 3, 4, 5, 6]); }
rust_cleaned_test_functions.jsonl/92612
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 171 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 26290, 307, 318, 368, 341, 262, 1077, 5206, 5517, 284, 19689, 1857, 486, 35716, 7, 17, 353, 220, 18, 353, 220, 19, 353, 220, 20, 353, 220, 21, 568, 16137, 1188, 17, 11, 220, 18, 11, 220, 1...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_payload_too_big() { let p256dh = base64::decode_config( "BLMaF9ffKBiWQLCKvTHb6LO8Nb6dcUh6TItC455vu2kElga6PQvUmaFyCdykxY2nOSSL3yKgfbmFLRTUaGv4yV8", URL_SAFE, ) .unwrap(); let auth = base64::decode_config("xS03Fj5ErfTNH_l9WHE9Ig", URL_SAFE).unwrap(); let http_ece = HttpEce::new(ContentEncoding::Aes128Gcm, &p256dh, &auth, None); //This content is one above limit. let content = [0u8; 3801]; assert_eq!(Err(WebPushError::PayloadTooLarge), http_ece.encrypt(&content)); }
rust_cleaned_test_functions.jsonl/94468
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 322 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 32813, 2346, 78, 36386, 368, 341, 286, 1077, 281, 17, 20, 21, 30621, 284, 2331, 21, 19, 486, 18196, 5332, 1006, 310, 330, 9389, 29535, 37, 24, 542, 29862, 72, 54, 3588, 3021, 85, 3617, 65, 2...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_parse_concat_transform() { let transform = match parse_concat_transform(FileSpan::new(Rc::new(String::from("ConcatTransform 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16")), Rc::new(String::from("input")))).unwrap().1 { Transformation::ConcatTransform(t) => t, _ => panic!() }; assert_eq!(transform.m00.value, 1.0); assert_eq!(transform.m01.value, 2.0); assert_eq!(transform.m02.value, 3.0); assert_eq!(transform.m03.value, 4.0); assert_eq!(transform.m10.value, 5.0); assert_eq!(transform.m11.value, 6.0); assert_eq!(transform.m12.value, 7.0); assert_eq!(transform.m13.value, 8.0); assert_eq!(transform.m20.value, 9.0); assert_eq!(transform.m21.value, 10.0); assert_eq!(transform.m22.value, 11.0); assert_eq!(transform.m23.value, 12.0); assert_eq!(transform.m30.value, 13.0); assert_eq!(transform.m31.value, 14.0); assert_eq!(transform.m32.value, 15.0); assert_eq!(transform.m33.value, 16.0); }
rust_cleaned_test_functions.jsonl/68354
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 450 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21039, 57478, 18449, 368, 341, 262, 1077, 5165, 284, 2432, 4715, 57478, 18449, 19821, 12485, 486, 931, 2785, 66, 486, 931, 2242, 486, 1499, 445, 78440, 8963, 220, 16, 220, 17, 220, 18, 220, 19, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_add_nodes_to_subnet_succeeds() { local_test_on_nns_subnet(|runtime| { async move { let num_nodes_in_subnet = 4 as usize; let num_unassigned_nodes = 4 as usize; let (init_mutate, subnet_id, unassigned_node_ids, _) = common::prepare_registry(num_nodes_in_subnet, num_unassigned_nodes); // registry so it would allow mutation by the subnet handler. let registry = set_up_registry_canister( &runtime, RegistryCanisterInitPayloadBuilder::new() .push_init_mutate_request(init_mutate) .build(), ) .await; // Install the universal canister in place of the proposals canister let fake_proposal_canister = set_up_universal_canister(&runtime).await; // it assert_eq!( fake_proposal_canister.canister_id(), ic_nns_constants::GOVERNANCE_CANISTER_ID ); // Ensure that the subnet record is there let subnet_list_record = get_value::<SubnetListRecord>(&registry, SUBNET_LIST_KEY.as_bytes()).await; // one assert_eq!(subnet_list_record.subnets.len(), 2); assert_eq!(subnet_list_record.subnets[1], subnet_id.get().to_vec()); let subnet_record = get_value::<SubnetRecord>(&registry, &make_subnet_record_key(subnet_id).as_bytes()) .await; assert_eq!(subnet_record.membership.len(), num_nodes_in_subnet as usize); let payload = AddNodesToSubnetPayload { subnet_id: subnet_id.get(), node_ids: unassigned_node_ids.clone(), }; assert!( forward_call_via_universal_canister( &fake_proposal_canister, &registry, "add_nodes_to_subnet", Encode!(&payload).unwrap() ) .await ); let subnet_list_record = get_value::<SubnetListRecord>(&registry, SUBNET_LIST_KEY.as_bytes()).await; // one assert_eq!(subnet_list_record.subnets.len(), 2); assert_eq!(subnet_list_record.subnets[1], subnet_id.get().to_vec()); let subnet_record = get_value::<SubnetRecord>(&registry, &make_subnet_record_key(subnet_id).as_bytes()) .await; // the number of nodes doubled assert_eq!( subnet_record.membership.len(), num_nodes_in_subnet + num_unassigned_nodes ); for node_id in unassigned_node_ids { let node_id = node_id.get().to_vec(); assert!(subnet_record.membership.iter().any(|x| *x == node_id)); } Ok(()) } }); }
rust_cleaned_test_functions.jsonl/128506
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1710 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2891, 14896, 2346, 95681, 643, 29264, 82, 368, 341, 262, 2205, 4452, 4470, 1089, 4412, 95681, 22428, 22255, 91, 341, 286, 3312, 3271, 341, 310, 1077, 1629, 14896, 1243, 95681, 284, 220, 19, 438, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_vcx_credential_update_state() { settings::set_defaults(); settings::set_config_value(settings::CONFIG_ENABLE_TEST_MODE,"true"); let cxn = ::connection::build_connection("test_credential_update_state").unwrap(); let handle = credential::from_string(DEFAULT_SERIALIZED_CREDENTIAL).unwrap(); ::utils::httpclient::set_next_u8_response(::utils::constants::NEW_CREDENTIAL_OFFER_RESPONSE.to_vec()); assert_eq!(vcx_credential_update_state(0, handle, Some(get_state_cb)), error::SUCCESS.code_num); thread::sleep(Duration::from_millis(300)); assert_eq!(vcx_credential_send_request(0, handle, cxn,0, Some(send_offer_cb)), error::SUCCESS.code_num); thread::sleep(Duration::from_millis(200)); }
rust_cleaned_test_functions.jsonl/7551
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 329 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2273, 25844, 666, 30320, 8882, 4387, 368, 341, 286, 5003, 486, 746, 42290, 543, 286, 5003, 486, 746, 5332, 3142, 23369, 486, 24652, 14379, 11641, 8414, 1335, 1866, 797, 286, 1077, 20716, 77, 284, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_rotate_line_around_point() { let line0 = Line::new(Point::new(0., 0.), Point::new(0., 2.)); let line1 = Line::new(Point::new(0., 0.), Point::new(-2., 0.)); assert_relative_eq!(line0.rotate_around_point(90., Point::new(0., 0.)), line1); }
rust_cleaned_test_functions.jsonl/49666
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 134 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 60834, 6528, 62, 19454, 6085, 368, 341, 286, 1077, 1555, 15, 284, 7083, 486, 931, 32737, 486, 931, 7, 15, 2572, 220, 15, 24389, 5126, 486, 931, 7, 15, 2572, 220, 17, 13, 1106, 286, 1077, 155...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_fail_adding_more_cycles_when_not_enough_balance() { let cycles_amount = 1_000_000_000_000; let max_num_instructions = NumInstructions::from(1 << 30); let cycles_account_manager = CyclesAccountManagerBuilder::new() .with_max_num_instructions(max_num_instructions) .build(); let system_state = get_new_running_system_state(Cycles::from(cycles_amount), SubnetType::Application); let mut api = get_system_api(get_update_api_type(), system_state, cycles_account_manager); // Check ic0_canister_cycle_balance after first ic0_call_new. assert_eq!(api.ic0_call_new(0, 0, 0, 0, 0, 0, 0, 0, &[]), Ok(())); // Check cycles balance. assert_eq!( api.ic0_canister_cycle_balance().unwrap() as u128, cycles_amount ); // Add cycles to call. let amount = cycles_amount / 2 + 1; assert_eq!( api.ic0_call_cycles_add128(amount.try_into().unwrap()), Ok(()) ); // Check cycles balance after call_add_cycles. assert_eq!( api.ic0_canister_cycle_balance().unwrap() as u128, cycles_amount - amount ); // Adding more cycles fails because not enough balance left. assert_eq!( api.ic0_call_cycles_add128(amount.try_into().unwrap()) .unwrap_err(), HypervisorError::InsufficientCyclesBalance { available: Cycles::from(cycles_amount - amount), requested: Cycles::from(amount), } ); // Balance unchanged after the second call_add_cycles. assert_eq!( api.ic0_canister_cycle_balance().unwrap() as u128, cycles_amount - amount ); }
rust_cleaned_test_functions.jsonl/109060
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 863 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 22121, 2891, 287, 36664, 68970, 47636, 7913, 6205, 1384, 29396, 368, 341, 286, 1077, 24484, 13471, 284, 220, 16, 62, 15, 15, 15, 62, 15, 15, 15, 62, 15, 15, 15, 62, 15, 15, 15, 280, 286, 1...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_enum_node() { assert_ne!(Node::Num(0).clone(), Node::Var.clone()); assert_eq!(format!("{:?}", Node::Var), String::from("Var")); assert_eq!(format!("{:?}", Node::Num(0)), String::from("Num(0)")); let mut n: Node; n = Node::UnOp { op: UnOp::Not, rhs: Box::new(Node::Var), }; assert_ne!(n.clone(), Node::Var); assert_eq!(format!("{:?}", n), String::from("UnOp { op: Not, rhs: Var }")); n = Node::BinOp { op: BinOp::Add, lhs: Box::new(Node::Var), rhs: Box::new(Node::Var), }; assert_ne!(n.clone(), Node::Var); assert_eq!( format!("{:?}", n), String::from("BinOp { op: Add, lhs: Var, rhs: Var }") ); n = Node::Cond { test: Box::new(Node::Var), if_true: Box::new(Node::Var), if_false: Box::new(Node::Var), }; assert_ne!(n.clone(), Node::Var); assert_eq!( format!("{:?}", n), String::from("Cond { test: Var, if_true: Var, if_false: Var }") ); }
rust_cleaned_test_functions.jsonl/95575
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 645 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 31054, 5084, 368, 341, 286, 2060, 13925, 10297, 1955, 486, 4651, 7, 15, 568, 19982, 1507, 6018, 486, 3962, 15997, 1423, 286, 2060, 10714, 10297, 2243, 88928, 25, 52652, 6018, 486, 3962, 701, 923, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_dns_name_parsing() { // Make sure `dns::Name`'s validation isn't too strict. It is // implemented in terms of `webpki::DNSName` which has many more tests struct Case { input: &'static str, output: &'static str, } static VALID: &[Case] = &[ Case { input: "1.2.3.x", output: "1.2.3.x", }, Case { input: "1.2.3.x", output: "1.2.3.x", }, Case { input: "1.2.3.4A", output: "1.2.3.4a", }, Case { input: "a.b.c.d", output: "a.b.c.d", }, // Uppercase letters in labels Case { input: "A.b.c.d", output: "a.b.c.d", }, Case { input: "a.mIddle.c", output: "a.middle.c", }, Case { input: "a.b.c.D", output: "a.b.c.d", }, // Absolute Case { input: "a.b.c.d.", output: "a.b.c.d.", }, ]; for case in VALID { let name = Name::from_str(&case.input); assert_eq!(name.as_ref().map(|x| x.as_ref()), Ok(case.output)); } static INVALID: &[&str] = &[ // These are not in the "preferred name syntax" as defined by // the last label only has digits. "1.2.3.4", "a.1.2.3", "1.2.x.3", ]; for case in INVALID { assert!(Name::from_str(case).is_err()); } }
rust_cleaned_test_functions.jsonl/106474
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1142 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 71125, 1269, 620, 28598, 368, 341, 286, 442, 7405, 2704, 1565, 45226, 486, 675, 63, 6, 82, 10519, 4436, 944, 2238, 7304, 13, 1084, 374, 198, 286, 442, 11537, 304, 3793, 315, 1565, 2911, 79, 66...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
8
#[test] fn test_layer_env_delta_fs_read_write() { let mut original_delta = LayerEnvDelta::new(); original_delta.insert(ModificationBehavior::Default, "FOO", "BAR"); original_delta.insert(ModificationBehavior::Append, "APPEND_TO_ME", "NEW_VALUE"); let temp_dir = tempdir().unwrap(); original_delta.write_to_env_dir(&temp_dir.path()).unwrap(); let disk_delta = LayerEnvDelta::read_from_env_dir(&temp_dir.path()).unwrap(); assert_eq!(original_delta, disk_delta); }
rust_cleaned_test_functions.jsonl/36432
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 231 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 12680, 15879, 26710, 34470, 6443, 9165, 368, 341, 286, 1077, 5206, 4024, 26710, 284, 22735, 14359, 20277, 486, 931, 543, 286, 4024, 26710, 7030, 71956, 2404, 22753, 486, 3675, 11, 330, 3788, 46, 4...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_add_derive() { check_action( "struct Foo { a: i32, <|>}", "#[derive(<|>)]\nstruct Foo { a: i32, }", |file, off| add_derive(file, off).map(|f| f()), ); check_action( "struct Foo { <|> a: i32, }", "#[derive(<|>)]\nstruct Foo { a: i32, }", |file, off| add_derive(file, off).map(|f| f()), ); check_action( "#[derive(Clone)]\nstruct Foo { a: i32<|>, }", "#[derive(Clone<|>)]\nstruct Foo { a: i32, }", |file, off| add_derive(file, off).map(|f| f()), ); }
rust_cleaned_test_functions.jsonl/100435
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 378 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2891, 35345, 533, 368, 341, 286, 1779, 7931, 1006, 310, 330, 1235, 33428, 314, 264, 25, 600, 18, 17, 11, 82639, 29, 24375, 310, 5869, 58, 27098, 22726, 91, 29, 7252, 59, 77, 1235, 33428, 314, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_invalid_mac_ipv6_undersize() { let event = DhcpEvent::LeaseAdded { event_timestamp: DateTime::<FixedOffset>::from(Local::now()), lease_info: full_lease_info_v6(), }; let mut result_command = Command::new(namib_dnsmasq_hook_exe()); let (args, mut envs) = create_args_and_env_map_from_event(&event); envs.insert("DNSMASQ_MAC".to_string(), "aa".to_string()); assert_eq!( 6, result_command .args(args) .env_clear() .envs(envs) .stdout(Stdio::null()) .stderr(Stdio::null()) .status() .expect("Error while running command.") .code() .expect("Command was terminated by a signal.") ); }
rust_cleaned_test_functions.jsonl/48456
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 470 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 31433, 22802, 49378, 21, 62, 31009, 551, 368, 341, 286, 1077, 1538, 284, 43227, 4672, 1556, 486, 2304, 519, 19337, 341, 310, 1538, 23073, 25, 6520, 27638, 13520, 6446, 6831, 1499, 42718, 486, 3328...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_str_input() { let mut input = "test".as_input(); assert_eq!(input.head(), In('t')); input.step(); assert_eq!(input.head(), In('e')); input.step(); assert_eq!(input.head(), In('s')); input.step(); assert_eq!(input.head(), In('t')); input.step(); assert_eq!(input.head(), Out); }
rust_cleaned_test_functions.jsonl/32347
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 198 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2895, 5898, 368, 341, 286, 1077, 5206, 1946, 284, 330, 1944, 3263, 300, 5898, 543, 286, 2060, 10714, 10297, 1355, 16042, 1507, 758, 492, 83, 6336, 286, 1946, 21465, 543, 286, 2060, 10714, 10297, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_phi_values() { let context = Context::create(); let builder = context.create_builder(); let module = context.create_module("my_mod"); let void_type = context.void_type(); let bool_type = context.bool_type(); let fn_type = void_type.fn_type(&[bool_type.into()], false); let fn_value = module.add_function("my_func", fn_type, None); assert!(fn_value.as_global_value().is_declaration()); let entry_block = fn_value.append_basic_block("entry"); let then_block = fn_value.append_basic_block("then"); let else_block = fn_value.append_basic_block("else"); assert!(!fn_value.as_global_value().is_declaration()); builder.position_at_end(&entry_block); let false_val = bool_type.const_int(0, false); let true_val = bool_type.const_int(1, false); let phi = builder.build_phi(bool_type, "if"); assert!(!phi.is_null()); assert!(!phi.is_undef()); assert!(phi.as_basic_value().is_int_value()); assert_eq!(phi.as_instruction().get_opcode(), Phi); assert_eq!(phi.count_incoming(), 0); assert_eq!(*phi.print_to_string(), *CString::new(" %if = phi i1 ").unwrap()); phi.add_incoming(&[ (&false_val, &then_block), (&true_val, &else_block), ]); assert_eq!(phi.count_incoming(), 2); assert_eq!(*phi.print_to_string(), *CString::new(" %if = phi i1 [ false, %then ], [ true, %else ]").unwrap()); let (then_val, then_bb) = phi.get_incoming(0).unwrap(); let (else_val, else_bb) = phi.get_incoming(1).unwrap(); assert_eq!(then_val.into_int_value(), false_val); assert_eq!(else_val.into_int_value(), true_val); assert_eq!(then_bb, then_block); assert_eq!(else_bb, else_block); assert!(phi.get_incoming(2).is_none()); }
rust_cleaned_test_functions.jsonl/122311
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 734 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 42009, 9146, 368, 341, 262, 1077, 2266, 284, 9608, 486, 3182, 543, 262, 1077, 7363, 284, 2266, 2520, 28532, 543, 262, 1077, 4688, 284, 2266, 2520, 10750, 445, 2408, 7480, 797, 262, 1077, 737, 18...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_normalize_attr() { // See comment on xml_doc::parser::DocumentParser::normalize_attr_value let xml = "<?xml version=\"1.0\"?> <root attr=\" \r\t ab&#xD; c \" />"; let doc = Document::parse_str(xml).unwrap(); let root = doc.root_element().unwrap(); let val = root.attribute(&doc, "attr").unwrap(); assert_eq!(val, "ab\r c"); }
rust_cleaned_test_functions.jsonl/74415
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 158 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 80807, 10422, 368, 341, 262, 442, 3496, 3980, 389, 8396, 18869, 486, 9657, 486, 7524, 6570, 486, 30590, 10422, 3142, 198, 262, 1077, 8396, 284, 40271, 6455, 2319, 4070, 16, 13, 15, 2105, 5993, 2...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_op_parse_regval_type() { // Doesn't matter for this test. let encoding = encoding4(); check_op_parse( |s| s.D8(constants::DW_OP_regval_type.0).uleb(1).uleb(100), &Operation::RegisterOffset { register: Register(1), offset: 0, base_type: UnitOffset(100), }, encoding, ); check_op_parse( |s| s.D8(constants::DW_OP_GNU_regval_type.0).uleb(1).uleb(100), &Operation::RegisterOffset { register: Register(1), offset: 0, base_type: UnitOffset(100), }, encoding, ); }
rust_cleaned_test_functions.jsonl/45757
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 420 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 10287, 21039, 4920, 831, 1819, 368, 341, 286, 442, 48832, 944, 4925, 369, 419, 1273, 624, 286, 1077, 11170, 284, 11170, 19, 1428, 286, 1779, 10287, 21039, 1006, 310, 760, 82, 91, 274, 909, 23, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_cdc_write_rollback_when_no_lock() { let mut suite = TestSuite::new(1); let mut req = suite.new_changedata_request(1); req.set_extra_op(ExtraOp::ReadOldValue); let (mut req_tx, _, receive_event) = new_event_feed(suite.get_region_cdc_client(1)); let _req_tx = block_on(req_tx.send((req, WriteFlags::default()))).unwrap(); // Txn1 commit_ts = 15 let mut m1 = Mutation::default(); let k1 = b"k1".to_vec(); m1.set_op(Op::Put); m1.key = k1.clone(); m1.value = b"v1".to_vec(); suite.must_kv_prewrite(1, vec![m1], k1.clone(), 10.into()); // Wait until resolved_ts advanced to 10 loop { let event = receive_event(true); if let Some(resolved_ts) = event.resolved_ts.as_ref() { if resolved_ts.ts == 10 { break; } } } suite.must_kv_rollback(1, vec![k1.clone()], 5.into()); // resolved_ts shouldn't be advanced beyond 10 for _ in 0..10 { let event = receive_event(true); if let Some(resolved_ts) = event.resolved_ts.as_ref() { if resolved_ts.ts > 10 { panic!("resolved_ts shouldn't be advanced beyond 10"); } } } suite.must_kv_commit(1, vec![k1], 10.into(), 15.into()); let mut advance_cnt = 0; loop { let event = receive_event(true); if let Some(resolved_ts) = event.resolved_ts.as_ref() { advance_cnt += 1; if resolved_ts.ts > 15 { break; } if advance_cnt > 10 { panic!("resolved_ts is not advanced, stuck at {}", resolved_ts.ts); } } } suite.stop(); }
rust_cleaned_test_functions.jsonl/13020
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 853 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 666, 7628, 9165, 62, 33559, 47636, 6536, 9818, 368, 341, 262, 1077, 5206, 16182, 284, 3393, 28000, 486, 931, 7, 16, 317, 262, 1077, 5206, 4232, 284, 16182, 4618, 25213, 459, 7893, 7, 16, 317, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
9
#[test] fn test_mutex_arc_nested() { // Tests nested mutexes and access // to underlying data. let arc = Arc::new(Mutex::new(1)); let arc2 = Arc::new(Mutex::new(arc)); let (tx, rx) = channel(); let _t = thread::spawn(move || { let lock = arc2.lock().unwrap(); let lock2 = lock.lock().unwrap(); assert_eq!(*lock2, 1); tx.send(()).unwrap(); }); rx.recv().unwrap(); }
rust_cleaned_test_functions.jsonl/8920
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 254 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 14204, 62914, 66279, 368, 341, 286, 442, 20150, 24034, 30863, 288, 323, 2615, 198, 286, 442, 311, 16533, 821, 624, 286, 1077, 15580, 284, 19689, 486, 931, 3189, 9371, 486, 931, 7, 16, 1106, 286,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_result_with_list() { assert_eq!(format!("{:?}", result_with_list()), "Ok([1, 11, 1426, 3])"); }
rust_cleaned_test_functions.jsonl/3827
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 67 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 5287, 6615, 2019, 368, 341, 286, 2060, 10714, 10297, 2243, 88928, 25, 52652, 1102, 6615, 2019, 11858, 330, 11578, 2561, 16, 11, 220, 16, 16, 11, 220, 16, 19, 17, 21, 11, 220, 18, 2467, 797, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_is_valid_number() { let list = [35, 20, 15, 25, 47]; assert_eq!(is_valid_number(40, &list), true); assert_eq!(is_valid_number(50, &list), true); assert_eq!(is_valid_number(102, &list), false); assert_eq!(is_valid_number(10, &list), false); }
rust_cleaned_test_functions.jsonl/54490
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 130 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6892, 8337, 5500, 368, 341, 262, 1077, 1140, 284, 508, 18, 20, 11, 220, 17, 15, 11, 220, 16, 20, 11, 220, 17, 20, 11, 220, 19, 22, 935, 262, 2060, 10714, 10297, 285, 8337, 5500, 7, 19, 1...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_bn128_mul_ethereum() { let x = FromHex::from_hex( "2bd3e6d0f3b142924f5ca7b49ce5b9d54c4703d7ae5648e61d02268b1a0a9fb7" ).unwrap(); let y = FromHex::from_hex( "21611ce0a6af85915e2f1d70300909ce2e49dfad4a4619c8390cae66cefdb204" ).unwrap(); let scalar = FromHex::from_hex( "00000000000000000000000000000000000000000000000011138ce750fa15c2" ).unwrap(); let mut output = [0u8; 64]; let expected = FromHex::from_hex( "\ 070a8d6a982153cae4be29d434e8faef8a47b274a053f5a4ee2a6c9c13c31e5c\ 031b8ce914eba3a9ffb989f9cdd5b0f01943074bf4f0f315690ec3cec6981afc", ) .unwrap(); bn128_mul(&x, &y, &scalar, &mut output).expect("Builtin should not fail"); assert_eq!(output.to_vec(), expected); }
rust_cleaned_test_functions.jsonl/103162
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 544 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 58112, 16, 17, 23, 24944, 57757, 23923, 368, 341, 286, 1077, 856, 284, 5542, 20335, 486, 1499, 32655, 1006, 394, 330, 17, 8940, 18, 68, 21, 67, 15, 69, 18, 65, 16, 19, 17, 24, 17, 19, 69, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_get_ntp_time_offset() { let s = r#"synchronised to NTP server (10.73.10.10) at stratum 12 time correct to within 949 ms polling server every 64 s"#; assert_eq!(parse_ntp_time_offset(s), Some("949 ms".to_string().into())); }
rust_cleaned_test_functions.jsonl/14477
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 117 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 3062, 38945, 79, 3009, 6917, 368, 341, 286, 1077, 274, 284, 435, 55543, 82, 14113, 4056, 311, 451, 4239, 3538, 320, 16, 15, 13, 22, 18, 13, 16, 15, 13, 16, 15, 8, 518, 607, 26253, 220, 16,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_and3() { let compiled = compile("SET A 255\nAND A A"); let out_cpu = test_program(compiled); assert_eq!(out_cpu.a.value, 255); assert_eq!(out_cpu.f.value, 0); }
rust_cleaned_test_functions.jsonl/63158
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 92 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 8378, 18, 368, 341, 262, 1077, 19697, 284, 19192, 445, 5884, 362, 220, 17, 20, 20, 1699, 3976, 362, 362, 797, 262, 1077, 700, 21795, 284, 1273, 25096, 30008, 2181, 626, 262, 2060, 10714, 10297, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_match_group_with_multichar_sep() { check( r#" macro_rules! m { (fn $name:ident { $($i:literal)* }) => ( fn $name() -> bool { $($i)&&* } ); } m! (fn baz { true false } ); "#, expect![[r#" macro_rules! m { (fn $name:ident { $($i:literal)* }) => ( fn $name() -> bool { $($i)&&* } ); } fn baz() -> bool { true && false } "#]], ); check( r#" macro_rules! m { (fn $name:ident { $($i:literal)&&* }) => ( fn $name() -> bool { $($i)&&* } ); } m! (fn baz { true && false } ); "#, expect![[r#" macro_rules! m { (fn $name:ident { $($i:literal)&&* }) => ( fn $name() -> bool { $($i)&&* } ); } fn baz() -> bool { true && false } "#]], ); }
rust_cleaned_test_functions.jsonl/85211
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 367 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 10708, 6288, 6615, 26290, 713, 277, 54775, 368, 341, 262, 1779, 1006, 286, 435, 2, 698, 32606, 21407, 0, 296, 341, 262, 320, 8822, 400, 606, 25, 1713, 314, 93977, 72, 25, 35785, 4806, 6413, 58...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_delta_bit_packed_int32_repeat() { let block_data = vec![ 1, 2, 3, 4, 5, 6, 7, 8, 1, 2, 3, 4, 5, 6, 7, 8, 1, 2, 3, 4, 5, 6, 7, 8, 1, 2, 3, 4, 5, 6, 7, 8, ]; test_delta_bit_packed_decode::<Int32Type>(vec![block_data]); }
rust_cleaned_test_functions.jsonl/38519
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 177 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 26710, 13996, 620, 11191, 4042, 18, 17, 41975, 368, 341, 286, 1077, 2504, 1769, 284, 7486, 90515, 310, 220, 16, 11, 220, 17, 11, 220, 18, 11, 220, 19, 11, 220, 20, 11, 220, 21, 11, 220, 22...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_prf_know_plaintext_sound() { let mut rng = rand::thread_rng(); let x = Scalar::random(&mut rng); let pk = PublicKey::new(GENERATOR.scaled(&x)); let m = CurveElem::random(&mut rng); let r = Scalar::random(&mut rng); let enc = pk.encrypt(&m, &r); let mut proof = PrfKnowPlaintext::new(&mut rng, enc, r); proof.r.0 += &rust_elgamal::Scalar::one(); assert!(!proof.verify()); }
rust_cleaned_test_functions.jsonl/84420
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 232 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 5294, 69, 4698, 3328, 6317, 1641, 427, 37676, 368, 341, 286, 1077, 5206, 28422, 284, 10382, 486, 4528, 66849, 1428, 286, 1077, 856, 284, 35176, 486, 11463, 2099, 6984, 28422, 317, 286, 1077, 22458...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_shift() { let ca = Int32Chunked::new_from_slice("", &[1, 2, 3]); let shifted = ca.shift(1, &Some(0)).unwrap(); assert_eq!(shifted.cont_slice().unwrap(), &[0, 1, 2]); let shifted = ca.shift(1, &None).unwrap(); assert_eq!(Vec::from(&shifted), &[None, Some(1), Some(2)]); let shifted = ca.shift(-1, &None).unwrap(); assert_eq!(Vec::from(&shifted), &[Some(2), Some(3), None]); assert!(ca.shift(3, &None).is_err()); let s = Series::new("a", ["a", "b", "c"]); let shifted = s.shift(-1).unwrap(); assert_eq!( Vec::from(shifted.utf8().unwrap()), &[Some("b"), Some("c"), None] ); }
rust_cleaned_test_functions.jsonl/57987
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 366 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 22230, 368, 341, 286, 1077, 2162, 284, 1333, 18, 17, 28304, 291, 486, 931, 5673, 26488, 19814, 44590, 16, 11, 220, 17, 11, 220, 18, 2558, 286, 1077, 28973, 284, 2162, 29154, 7, 16, 11, 609, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_actuals() { let addresses = [ // Elements ("2dxmEBXc2qMYcLSKiDBxdEePY3Ytixmnh4E", false, AddressParams::ELEMENTS), ("CTEo6VKG8xbe7HnfVW9mQoWTgtgeRSPktwTLbELzGw5tV8Ngzu53EBiasFMQKVbWmKWWTAdN5AUf4M6Y", true, AddressParams::ELEMENTS), ("ert1qwhh2n5qypypm0eufahm2pvj8raj9zq5c27cysu", false, AddressParams::ELEMENTS), ("el1qq0umk3pez693jrrlxz9ndlkuwne93gdu9g83mhhzuyf46e3mdzfpva0w48gqgzgrklncnm0k5zeyw8my2ypfsmxh4xcjh2rse", true, AddressParams::ELEMENTS), // Liquid ("GqiQRsPEyJLAsEBFB5R34KHuqxDNkG3zur", false, AddressParams::LIQUID), ("VJLDwMVWXg8RKq4mRe3YFNTAEykVN6V8x5MRUKKoC3nfRnbpnZeiG3jygMC6A4Gw967GY5EotJ4Rau2F", true, AddressParams::LIQUID), ("ex1q7gkeyjut0mrxc3j0kjlt7rmcnvsh0gt45d3fud", false, AddressParams::LIQUID), ("lq1qqf8er278e6nyvuwtgf39e6ewvdcnjupn9a86rzpx655y5lhkt0walu3djf9cklkxd3ryld97hu8h3xepw7sh2rlu7q45dcew5", true, AddressParams::LIQUID), ]; for &(a, blinded, ref params) in &addresses { let result = a.parse(); assert!(result.is_ok(), "vector: {}, err: \"{}\"", a, result.unwrap_err()); let addr: Address = result.unwrap(); assert_eq!(a, &addr.to_string(), "vector: {}", a); assert_eq!(blinded, addr.is_blinded()); assert_eq!(params, addr.params); roundtrips(&addr); } }
rust_cleaned_test_functions.jsonl/64316
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 863 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 40149, 82, 368, 341, 1789, 286, 1077, 14230, 284, 2278, 310, 442, 34157, 198, 310, 3489, 17, 12719, 76, 8264, 55, 66, 17, 80, 19159, 66, 7268, 72572, 3506, 9703, 36, 68, 37881, 18, 56, 83, 9...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_stream_lookup() { let spec = "output a: UInt8 := 3\n output b: UInt8 := a[0]"; assert_eq!(0, num_type_errors(spec)); assert_eq!(get_type(spec), ValueTy::UInt(UIntTy::U8)); }
rust_cleaned_test_functions.jsonl/110671
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 114 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 12673, 27464, 368, 341, 286, 1077, 1398, 284, 330, 3006, 264, 25, 22275, 23, 1669, 220, 18, 1699, 2550, 293, 25, 22275, 23, 1669, 264, 58, 15, 59757, 286, 2060, 10714, 10297, 15, 11, 1629, 181...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_enum() { #[derive(Deserialize, PartialEq, Debug)] enum E { Unit, Newtype(u32), Tuple(u32, u32), Struct { a: u32 }, } let lua = Lua::new(); lua.context(|lua| { let expected = E::Unit; let value = lua.load( r#" return "Unit" "#).eval().unwrap(); let got = from_value(value).unwrap(); assert_eq!(expected, got); let expected = E::Newtype(1); let value = lua.load( r#" a = {} a["Newtype"] = 1 return a "#).eval().unwrap(); let got = from_value(value).unwrap(); assert_eq!(expected, got); let expected = E::Tuple(1, 2); let value = lua.load( r#" a = {} a["Tuple"] = {1, 2} return a "#).eval().unwrap(); let got = from_value(value).unwrap(); assert_eq!(expected, got); let expected = E::Struct { a: 1 }; let value = lua.load( r#" a = {} a["Struct"] = {} a["Struct"]["a"] = 1 return a "#).eval().unwrap(); let got = from_value(value).unwrap(); assert_eq!(expected, got); }); }
rust_cleaned_test_functions.jsonl/15900
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 909 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 31054, 368, 341, 286, 11506, 27098, 7, 64465, 11, 55039, 11, 11091, 5563, 286, 7618, 468, 341, 310, 7954, 345, 310, 1532, 1313, 8154, 18, 17, 1326, 310, 24622, 8154, 18, 17, 11, 575, 18, 17, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_obj_lit_with_trailing_comma() { assert_json_snapshot!(parse_literal(r#"{ abc: "foo", }"#.into()).unwrap().1); assert_json_snapshot!( parse_literal(r#"{ abc: 123, def: { foo: "bar", }, }"#.into()) .unwrap() .1 ); parse_literal(r#"{,}"#.into()).unwrap_err(); parse_literal(r#"{ , }"#.into()).unwrap_err(); }
rust_cleaned_test_functions.jsonl/77773
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 238 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 7328, 98399, 6615, 3547, 14277, 2965, 1728, 368, 341, 286, 2060, 9455, 53265, 10297, 6400, 34100, 2601, 2, 14129, 39022, 25, 330, 7975, 497, 335, 57676, 13, 18122, 6011, 15454, 1005, 16, 317, 286,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_string_array() { let result = linear_search( &vec![ String::from("test"), String::from("this"), String::from("array"), ], String::from("this"), ); assert_eq!(result, Some(1)); }
rust_cleaned_test_functions.jsonl/50283
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 180 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 3904, 3858, 368, 341, 286, 1077, 1102, 284, 13482, 10716, 1006, 310, 609, 4083, 90515, 394, 923, 486, 1499, 445, 1944, 4461, 394, 923, 486, 1499, 445, 574, 4461, 394, 923, 486, 1499, 445, 1653, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_merkle_tree_insert() { let mut tree = TestSMT::new(3); assert_eq!(tree.capacity(), 8); tree.insert(0, TestLeaf(1)); assert_eq!(tree.root_hash(), 697_516_875); tree.insert(0, TestLeaf(2)); assert_eq!(tree.root_hash(), 741_131_083); tree.insert(3, TestLeaf(2)); assert_eq!(tree.root_hash(), 793_215_819); }
rust_cleaned_test_functions.jsonl/35063
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 206 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 717, 16754, 273, 11663, 17678, 368, 341, 286, 1077, 5206, 4916, 284, 3393, 50, 8505, 486, 931, 7, 18, 626, 286, 2060, 10714, 10297, 9344, 59168, 1507, 220, 23, 626, 286, 4916, 7030, 7, 15, 11,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_as_ref_reader() { let buf = [0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10]; let mut rd = ReadRefReader::new(&buf); assert_eq!(rd.read_slice(1).unwrap(), Reference::Borrowed(&[0][..])); assert_eq!(rd.read_slice(6).unwrap(), Reference::Borrowed(&[1, 2, 3, 4, 5, 6][..])); assert!(rd.read_slice(5).is_err()); assert_eq!(rd.read_slice(4).unwrap(), Reference::Borrowed(&[7, 8, 9, 10][..])); }
rust_cleaned_test_functions.jsonl/106803
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 201 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 11898, 7793, 22306, 368, 341, 262, 1077, 6607, 284, 508, 15, 11, 220, 16, 11, 220, 17, 11, 220, 18, 11, 220, 19, 11, 220, 20, 11, 220, 21, 11, 220, 22, 11, 220, 23, 11, 220, 24, 11, 22...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_simple_enc() { let sk_bob: SecretKey = random(); let sk_eve: SecretKey = random(); let pk_bob = sk_bob.public_key(); let msg = b"Muffins in the canteen today! Don't tell Eve!"; let ciphertext = pk_bob.encrypt(&msg[..]); assert!(ciphertext.verify()); // Bob can decrypt the message. let decrypted = sk_bob.decrypt(&ciphertext).expect("invalid ciphertext"); assert_eq!(msg[..], decrypted[..]); // Eve can't. let decrypted_eve = sk_eve.decrypt(&ciphertext).expect("invalid ciphertext"); assert_ne!(msg[..], decrypted_eve[..]); let Ciphertext(u, v, w) = ciphertext; let fake_ciphertext = Ciphertext(u, vec![0; v.len()], w); assert!(!fake_ciphertext.verify()); assert_eq!(None, sk_bob.decrypt(&fake_ciphertext)); }
rust_cleaned_test_functions.jsonl/30566
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 408 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 30015, 13781, 368, 341, 286, 1077, 1901, 880, 674, 25, 8599, 1592, 284, 4194, 543, 286, 1077, 1901, 2204, 586, 25, 8599, 1592, 284, 4194, 543, 286, 1077, 22458, 880, 674, 284, 1901, 880, 674, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_find_start() { let mut u = Ukkonen::with_capacity(10, unit_cost); let pattern = b"ACCGT"; // hit begins at 1st position let text1 = b"ACCGTGGATGAGCGCCATAG"; // hit begins at 2nd position let text2 = b"AACCGTGGATGAGCGCCATAG"; let occ: Vec<(usize, usize)> = u.find_all_end(pattern, text1, 1).collect(); assert_eq!(occ, [(3, 1), (4, 0), (5, 1)]); let occ: Vec<(usize, usize)> = u.find_all_end(pattern, text2, 1).collect(); assert_eq!(occ, [(4, 1), (5, 0), (6, 1)]); }
rust_cleaned_test_functions.jsonl/10298
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 287 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21814, 4906, 368, 341, 286, 1077, 5206, 575, 284, 547, 19196, 41928, 486, 4197, 35603, 7, 16, 15, 11, 4982, 15890, 626, 286, 1077, 5383, 284, 293, 1, 1706, 8798, 51, 876, 286, 442, 4201, 12033...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_iterate_into_string() { let words = vec!["hello", " ", "world"]; let capitalized_words: String = capitalize_words(words).join(""); assert_eq!(capitalized_words, "Hello World"); }
rust_cleaned_test_functions.jsonl/4276
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 96 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 11723, 349, 45514, 3904, 368, 341, 286, 1077, 4244, 284, 7486, 0, 1183, 14990, 497, 330, 3670, 330, 14615, 6332, 286, 1077, 97321, 18981, 25, 923, 284, 52725, 18981, 36289, 568, 5987, 13056, 286, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_merge_types_via_tvar() { let mut t = Inferator::new("burritos"); let intlist = Type::StrictList(Box::new(Type::Int)); let unknownlist = Type::StrictList(Box::new(Type::Unknown)); let tvar = Type::Var(Lstr::Sref("Taco")); let mtype0 = t.merge_types(&unknownlist, &tvar); assert_eq!(Ok(unknownlist), mtype0); let mtype1 = t.merge_types(&intlist, &tvar); assert_eq!(Ok(intlist), mtype1); }
rust_cleaned_test_functions.jsonl/15071
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 232 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 20888, 9763, 80710, 528, 947, 741, 262, 341, 286, 1077, 5206, 259, 284, 62658, 850, 486, 931, 445, 11240, 94012, 797, 286, 1077, 526, 1607, 284, 3990, 486, 41857, 852, 67758, 486, 931, 22498, 48...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_path_ext_html_jinja_and_ext_txt() { let t = PathHtmlJinjaAndExtTxt; assert_eq!(t.render().unwrap(), "foo.html.jinja"); assert_eq!(PathHtmlJinjaAndExtTxt::EXTENSION, Some("txt")); }
rust_cleaned_test_functions.jsonl/133246
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 103 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2638, 9927, 9564, 5374, 41420, 8378, 9927, 22436, 368, 341, 262, 1077, 259, 284, 7933, 13591, 41, 41420, 3036, 6756, 35629, 280, 262, 2060, 10714, 10297, 83, 8740, 1005, 15454, 1507, 330, 7975, 25...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_day2_part1() { let mut cpu = IntcodeEmulator::default(); let program = Program::from_file("../day02/input.txt").expect("Failed to read input"); cpu.load_program(&program); cpu.mem_mut()[1] = 12; cpu.mem_mut()[2] = 2; assert!(cpu.run().is_ok()); assert!(cpu.is_halted()); assert_eq!(cpu.mem()[0], 4714701); }
rust_cleaned_test_functions.jsonl/119108
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 196 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 16763, 17, 10495, 16, 368, 341, 286, 1077, 5206, 17319, 284, 1333, 1851, 2269, 10511, 486, 2258, 543, 286, 1077, 2025, 284, 6687, 486, 1499, 2458, 17409, 1292, 15, 17, 39990, 3909, 1827, 17119, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_bpf_loader_check_load_dw() { let prog = &[ 0x18, 0x00, 0x00, 0x00, 0x88, 0x77, 0x66, 0x55, // first half of lddw ]; verifier::check(prog, &Config::default()).unwrap(); }
rust_cleaned_test_functions.jsonl/3069
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 130 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 880, 15897, 22139, 7200, 12411, 79503, 368, 341, 286, 1077, 29271, 284, 609, 9640, 310, 220, 15, 87, 16, 23, 11, 220, 15, 87, 15, 15, 11, 220, 15, 87, 15, 15, 11, 220, 15, 87, 15, 15, 11...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_primitive_by_itself() { let bvc = ByValueChecker::new(); let t_id = QualifiedName::new_from_cpp_name("u32"); assert!(bvc.is_pod(&t_id)); }
rust_cleaned_test_functions.jsonl/93407
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 97 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 84087, 3710, 14631, 721, 368, 341, 286, 1077, 293, 7362, 284, 3216, 1130, 35188, 486, 931, 543, 286, 1077, 259, 842, 284, 60306, 675, 486, 931, 5673, 59686, 1269, 445, 84, 18, 17, 797, 286, 20...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_query_state_hash() { let sandbox = timestamping_sandbox(); let sandbox_state = SandboxState::new(); // We do not change the state hash in between blocks for TimestampingService for now for _ in 0..2 { let state_hash = sandbox.last_state_hash(); let configs_rh = sandbox.get_configs_merkle_root(); let proof = sandbox.get_proof_to_index("core.consensus_config"); let proof = proof.check_against_hash(state_hash).unwrap(); assert_ne!(configs_rh, Hash::zero()); assert_eq!( proof .entries() .map(|(k, v)| (k.as_str(), v)) .collect::<Vec<_>>(), vec![("core.consensus_config", &configs_rh)] ); let proof = sandbox.get_proof_to_index("timestamping.first"); let proof = proof.check_against_hash(state_hash).unwrap(); assert_eq!( proof .entries() .map(|(k, v)| (k.as_str(), v)) .collect::<Vec<_>>(), vec![("timestamping.first", &Hash::new([127; HASH_SIZE]))] ); let proof = sandbox.get_proof_to_index("timestamping.second"); let proof = proof.check_against_hash(state_hash).unwrap(); assert_eq!( proof .entries() .map(|(k, v)| (k.as_str(), v)) .collect::<Vec<_>>(), vec![("timestamping.second", &Hash::new([128; HASH_SIZE]))] ); add_one_height(&sandbox, &sandbox_state) } }
rust_cleaned_test_functions.jsonl/83612
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 788 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 5738, 4387, 8950, 368, 341, 262, 1077, 42754, 284, 11441, 287, 643, 31536, 543, 262, 1077, 42754, 4387, 284, 96860, 1397, 486, 931, 543, 262, 442, 1205, 653, 537, 2297, 279, 1584, 5175, 304, 194...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2