text
stringlengths
93
16.4k
id
stringlengths
20
40
metadata
dict
input_ids
listlengths
45
2.05k
attention_mask
listlengths
45
2.05k
complexity
int64
1
9
#[test] fn test_from_f64() { let cs = vec![ ( std::f64::INFINITY, Err(Error::InvalidDataType(String::new())), ), ( -std::f64::INFINITY, Err(Error::InvalidDataType(String::new())), ), (10.123, Ok(Decimal::from_str("10.123").unwrap())), (-10.123, Ok(Decimal::from_str("-10.123").unwrap())), (10.111, Ok(Decimal::from_str("10.111").unwrap())), (-10.111, Ok(Decimal::from_str("-10.111").unwrap())), ( 18446744073709552000.0, Ok(Decimal::from_str("18446744073709552000").unwrap()), ), ( -18446744073709552000.0, Ok(Decimal::from_str("-18446744073709552000").unwrap()), ), // so these cases can not pass ( 36893488147419103000.0, Ok(Decimal::from_str("36893488147419103000.0").unwrap()), ), ( -36893488147419103000.0, Ok(Decimal::from_str("-36893488147419103000.0").unwrap()), ), ]; for (input, expect) in cs { let r = Decimal::from_f64(input); let log = format!( "input: {}, expect: {:?}, output: {:?}", input, expect.as_ref().map(|x| x.to_string()), r.as_ref().map(|x| x.to_string()) ); match expect { Err(e) => { assert!(r.is_err(), "{}", log.as_str()); match e { Error::InvalidDataType(_) => (), _ => panic!("{}", log.as_str()), } } Ok(d) => { assert!(r.is_ok(), "{}", log.as_str()); assert_eq!(r.unwrap(), d, "{}", log.as_str()); } } } }
rust_cleaned_test_functions.jsonl/40303
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1359 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 5673, 761, 21, 19, 368, 341, 286, 1077, 10532, 284, 7486, 90515, 310, 2399, 394, 1460, 486, 69, 21, 19, 486, 687, 55990, 345, 394, 15495, 37396, 486, 7928, 22653, 2242, 486, 931, 73727, 310, 2...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
4
#[test] fn test_parse_noise_ik() { let pubkey_str = "080e287879c918794170e258bfaddd75acac5b3e350419044655e4983a487120"; let pubkey = x25519::PublicKey::from_encoded_string(pubkey_str).unwrap(); let addr = NetworkAddress::from_str(&format!("/ln-noise-ik/{}", pubkey_str)).unwrap(); let expected_suffix: &[Protocol] = &[]; assert_eq!( parse_noise_ik(addr.as_slice()).unwrap(), (&pubkey, expected_suffix) ); let addr = NetworkAddress::from_str(&format!("/ln-noise-ik/{}/tcp/999", pubkey_str)).unwrap(); let expected_suffix: &[Protocol] = &[Protocol::Tcp(999)]; assert_eq!( parse_noise_ik(addr.as_slice()).unwrap(), (&pubkey, expected_suffix) ); let addr = NetworkAddress::from_str("/tcp/999/memory/123").unwrap(); assert_eq!(None, parse_noise_ik(addr.as_slice())); }
rust_cleaned_test_functions.jsonl/4283
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 465 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21039, 40313, 62, 1579, 368, 341, 286, 1077, 95116, 2895, 284, 330, 15, 23, 15, 68, 17, 23, 22, 23, 22, 24, 66, 24, 16, 23, 22, 24, 19, 16, 22, 15, 68, 17, 20, 23, 13233, 329, 631, 22,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_addition_minus_infinity() { let summand1 = ExtendedBigInt::BigInt(BigInt::zero()); let summand2 = ExtendedBigInt::MinusInfinity; assert_eq!(summand1 + summand2, ExtendedBigInt::MinusInfinity); }
rust_cleaned_test_functions.jsonl/101399
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 106 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2891, 680, 38457, 1243, 19888, 368, 341, 286, 1077, 2629, 1928, 16, 284, 40565, 87474, 486, 87474, 5349, 343, 1072, 486, 14154, 1423, 286, 1077, 2629, 1928, 17, 284, 40565, 87474, 486, 74458, 4509...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_7xnn_add() { let mut machine = Machine::new(TestContext::new()); // Seed registers machine.register_set(0xB, 3); machine.test_opcode(0x7BCD); // Should add NN to reg_x assert_eq!(machine.register_get(0xB), 3 + 0xCD); // Should increment program counter by two assert_eq!(machine.pc, PC_BEGIN + 2); }
rust_cleaned_test_functions.jsonl/127955
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 149 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 62, 22, 87, 7370, 2891, 368, 341, 262, 1077, 5206, 5662, 284, 12960, 486, 931, 31159, 1972, 486, 931, 1423, 262, 442, 35822, 24740, 198, 262, 5662, 9929, 2602, 7, 15, 14377, 11, 220, 18, 317, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_link_enum() { assert_eq!( GiDocgen::from_str("[enum@Orientation]"), Ok(GiDocgen::Enum { namespace: None, type_: "Orientation".to_string() }) ); }
rust_cleaned_test_functions.jsonl/78469
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 156 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 7233, 31054, 368, 341, 286, 2060, 10714, 33673, 310, 15392, 9550, 4370, 486, 1499, 2895, 10937, 9018, 31, 22332, 60, 4461, 310, 7622, 6699, 72, 9550, 4370, 486, 10766, 341, 394, 4473, 25, 2240, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_auto_import_add_use() { check_assist( add_import, " use stdx; impl std::fmt::Debug<|> for Foo { } ", " use stdx; use std::fmt::Debug; impl Debug<|> for Foo { } ", ); }
rust_cleaned_test_functions.jsonl/39948
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 150 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 27740, 18434, 2891, 15951, 368, 341, 286, 1779, 12083, 380, 1006, 310, 912, 18434, 345, 310, 6228, 810, 1460, 87, 401, 6383, 1460, 486, 12501, 486, 7939, 27, 91, 29, 369, 33428, 341, 532, 262, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_mime_type_guessing() { assert_eq!( from_ext("gif").first_or_octet_stream().to_string(), "image/gif".to_string() ); assert_eq!( from_ext("TXT").first_or_octet_stream().to_string(), "text/plain".to_string() ); assert_eq!( from_ext("blahblah").first_or_octet_stream().to_string(), "application/octet-stream".to_string() ); assert_eq!( from_path(Path::new("/path/to/file.gif")) .first_or_octet_stream() .to_string(), "image/gif".to_string() ); assert_eq!( from_path("/path/to/file.gif").first_or_octet_stream().to_string(), "image/gif".to_string() ); }
rust_cleaned_test_functions.jsonl/61806
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 303 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 83624, 1819, 54737, 287, 368, 341, 197, 6948, 10714, 33673, 298, 42727, 9927, 445, 33186, 1827, 3896, 8734, 70135, 295, 12673, 1005, 983, 3904, 3148, 298, 197, 1, 1805, 90831, 3263, 983, 3904, 741...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_string() { let mut p = Parser::new(); assert_eq!(p.string("\"βáƨïç_ƨƭřïñϱ\"").1, Done("", TOMLValue::String("βáƨïç_ƨƭřïñϱ".into(), StrType::Basic))); p = Parser::new(); assert_eq!(p.string(r#""""₥ℓ_βáƨïç_ƨƭřïñϱ ñú₥βèř_ƭωô NÛMßÉR-THRÉÉ """"#).1, Done("", TOMLValue::String(r#"₥ℓ_βáƨïç_ƨƭřïñϱ ñú₥βèř_ƭωô NÛMßÉR-THRÉÉ "#.into(), StrType::MLBasic))); p = Parser::new(); assert_eq!(p.string("'£ÌTÉR£§TRïNG'").1, Done("", TOMLValue::String("£ÌTÉR£§TRïNG".into(), StrType::Literal))); p = Parser::new(); assert_eq!(p.string(r#"'''§ƥřïƭè Çôƙè Þèƥƨï '''"#).1, Done("", TOMLValue::String(r#"§ƥřïƭè Çôƙè Þèƥƨï "#.into(), StrType::MLLiteral))); }
rust_cleaned_test_functions.jsonl/27411
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 627 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 3904, 368, 341, 262, 1077, 5206, 281, 284, 21102, 486, 931, 543, 262, 2060, 10714, 10297, 79, 4804, 38915, 71807, 29456, 18791, 39832, 144839, 75005, 18791, 33985, 18791, 17851, 62, 144839, 75005, 1...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_sequences() { test_roundtrip("var x = (1, 2, 3);"); test_roundtrip("foo((1, 2, 3), 4);"); }
rust_cleaned_test_functions.jsonl/102596
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 60 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 58732, 368, 341, 262, 1273, 29896, 32981, 445, 947, 856, 284, 320, 16, 11, 220, 17, 11, 220, 18, 1215, 797, 262, 1273, 29896, 32981, 445, 7975, 1188, 16, 11, 220, 17, 11, 220, 18, 701, 220, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_sum_two_dwords() { assert_eq!(sum_two_dwords(2000000000, 1000000000), 3000000000); }
rust_cleaned_test_functions.jsonl/123617
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 59 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 10160, 23241, 814, 5761, 368, 972, 286, 2060, 10714, 10297, 1242, 23241, 814, 5761, 7, 17, 15, 15, 15, 15, 15, 15, 15, 15, 15, 11, 220, 16, 15, 15, 15, 15, 15, 15, 15, 15, 15, 701, 220, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_paginated_records_list() { let mut collection = setup_collection(); collection.create().unwrap(); for _ in 0..10 { collection.new_record().create().unwrap(); } let resource = Record::new(collection.clone()); let response = resource .list_request() .unwrap() .limit(3) .follow_subrequests() .unwrap(); let records: Vec<Record> = unwrap_collection_records(&response, &collection.new_record()); assert_eq!(records.len(), 10); }
rust_cleaned_test_functions.jsonl/63505
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 337 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 51003, 15479, 31279, 2019, 368, 341, 286, 1077, 5206, 4426, 284, 6505, 25019, 543, 286, 4426, 2520, 1005, 15454, 543, 286, 369, 716, 304, 220, 15, 496, 16, 15, 341, 310, 4426, 4618, 14192, 1005,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_unsplit_uri() { assert_eq!(unsplit_uri("", ""), ""); assert_eq!(unsplit_uri("data", ""), "data:"); assert_eq!(unsplit_uri("data", "foo"), "data://foo"); assert_eq!(unsplit_uri("http", ""), "http://"); assert_eq!(unsplit_uri("http", "foo"), "http://foo"); }
rust_cleaned_test_functions.jsonl/4014
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 162 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 4907, 6960, 15572, 368, 341, 286, 2060, 10714, 10297, 359, 6960, 15572, 19814, 77130, 14498, 286, 2060, 10714, 10297, 359, 6960, 15572, 445, 691, 497, 77130, 330, 691, 24305, 286, 2060, 10714, 10297...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_take_sized() { let v = [1, 2, 3]; let mut c = Cursor::new(v); let (v, got) = take_sized(&mut c, 2).unwrap(); assert_eq!(v, vec![1, 2]); assert_eq!(got, 2); let (v, got) = take_sized(&mut c, 2).unwrap(); assert_eq!(v, vec![3]); assert_eq!(got, 1); }
rust_cleaned_test_functions.jsonl/107630
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 191 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 73261, 643, 1506, 368, 341, 286, 1077, 348, 284, 508, 16, 11, 220, 17, 11, 220, 18, 935, 286, 1077, 5206, 272, 284, 28067, 486, 931, 3747, 317, 286, 1077, 320, 85, 11, 2684, 8, 284, 1896, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_simple_path() { equal_tokens! { <nodes> "chrome.exe" -> b::token_list(vec![b::bare("chrome"), b::op(Operator::Dot), b::bare("exe")]) } equal_tokens! { <nodes> ".azure" -> b::token_list(vec![b::op(Operator::Dot), b::bare("azure")]) } equal_tokens! { <nodes> r"C:\windows\system.dll" -> b::token_list(vec![b::bare(r"C:\windows\system"), b::op(Operator::Dot), b::bare("dll")]) } equal_tokens! { <nodes> r"C:\Code\-testing\my_tests.js" -> b::token_list(vec![b::bare(r"C:\Code\-testing\my_tests"), b::op(Operator::Dot), b::bare("js")]) } }
rust_cleaned_test_functions.jsonl/5861
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 408 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 30015, 2638, 368, 341, 286, 6144, 28838, 0, 341, 310, 366, 20008, 397, 310, 330, 31902, 19399, 1, 1464, 293, 486, 5839, 2019, 25592, 20703, 65, 486, 54102, 445, 31902, 3975, 293, 486, 453, 7, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_samples_in_range() { use rand::rngs::StdRng; use rand::SeedableRng; use rand::distributions::Distribution; let seed = [ 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31 ]; let mut r: StdRng = SeedableRng::from_seed(seed); let min = -0.5; let max = 0.5; let num_trials = 10_000; let n = try_create(min, max); assert!((0..num_trials) .map(|_| n.sample::<StdRng>(&mut r)) .all(|v| (min <= v) && (v < max)) ); }
rust_cleaned_test_functions.jsonl/47380
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 374 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 18297, 1243, 9698, 368, 341, 286, 990, 10382, 486, 69890, 82, 486, 22748, 49, 968, 280, 286, 990, 10382, 486, 41471, 480, 49, 968, 280, 286, 990, 10382, 486, 67, 17994, 486, 62377, 401, 286, 1...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_split_off_front() { fn make_block(timestamp: TimeStamp) -> Block { let transaction = Transaction::new( AccountIdentifier::new(CanisterId::from_u64(1).get(), None), AccountIdentifier::new(CanisterId::from_u64(2).get(), None), ICPTs::new(10000, 50).unwrap(), TRANSACTION_FEE, Memo(456), TimeStamp::new(1, 0), ); Block::new_from_transaction(None, transaction, timestamp) } let start_t: std::time::SystemTime = dfn_core::api::now(); let mut blocks: Vec<EncodedBlock> = vec![]; // blocks[0] is the oldest for i in 0..10 { blocks.push( make_block(TimeStamp::from(start_t + std::time::Duration::new(i, 0))) .encode() .unwrap(), ) } let all_blocks = blocks.clone(); println!("[test] blocks: {:?}", blocks); println!("[test] splitting off first 7 blocks"); assert!(blocks.len() == 10); let split = split_off_front(&mut blocks, 7); println!("[test] blocks left after split: {:?}", blocks); assert!(blocks.len() == 3); println!("[test] blocks which have been split off: {:?}", split); assert!(split.len() == 7); assert!(all_blocks[7..=9] == blocks[..]); assert!(all_blocks[0..=6] == split[..]); }
rust_cleaned_test_functions.jsonl/43528
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 773 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 17052, 13651, 22926, 368, 341, 286, 5168, 1281, 7113, 51027, 25, 4120, 20906, 8, 1464, 8362, 341, 310, 1077, 7745, 284, 17869, 486, 931, 1006, 394, 8615, 8714, 486, 931, 3025, 276, 1571, 764, 48...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_normalize_path_trailing_slashes_disabled() { let app = App::new() .resource("/resource1", |r| r.method(Method::GET).f(index)) .resource("/resource2/", |r| r.method(Method::GET).f(index)) .default_resource(|r| { r.h(NormalizePath::new( false, true, StatusCode::MOVED_PERMANENTLY, )) }).finish(); // trailing slashes let params = vec![ ("/resource1", StatusCode::OK), ("/resource1/", StatusCode::MOVED_PERMANENTLY), ("/resource2", StatusCode::NOT_FOUND), ("/resource2/", StatusCode::OK), ("/resource1?p1=1&p2=2", StatusCode::OK), ("/resource1/?p1=1&p2=2", StatusCode::MOVED_PERMANENTLY), ("/resource2?p1=1&p2=2", StatusCode::NOT_FOUND), ("/resource2/?p1=1&p2=2", StatusCode::OK), ]; for (path, code) in params { let req = TestRequest::with_uri(path).request(); let resp = app.run(req); let r = &resp.as_msg(); assert_eq!(r.status(), code); } }
rust_cleaned_test_functions.jsonl/38137
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 665 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 80807, 2638, 3547, 14277, 11886, 14051, 51401, 368, 341, 286, 1077, 906, 284, 1845, 486, 931, 741, 310, 659, 9233, 4283, 9233, 16, 497, 760, 81, 91, 435, 12908, 35419, 486, 3806, 568, 69, 7195, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_match_group_in_group() { parse_macro( r#" macro_rules! foo { { $( ( $($i:ident)* ) )* } => ( $( ( $($i)* ) )* ); }"#, ) .assert_expand_items("foo! ( (a b) );", "(a b)"); }
rust_cleaned_test_functions.jsonl/28719
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 139 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 10708, 6288, 1243, 6288, 368, 341, 262, 4715, 58810, 1006, 286, 435, 2, 698, 286, 18072, 21407, 0, 15229, 341, 310, 314, 4930, 320, 93977, 72, 25, 1713, 4806, 873, 89401, 335, 589, 320, 4930, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_request_extract() { let req = TestRequest::with_uri("/name/user1/?id=test").finish(); let mut router = Router::<()>::default(); router.register_resource(Resource::new(ResourceDef::new("/{key}/{value}/"))); let info = router.recognize(&req, &(), 0); let req = req.with_route_info(info); let s = Path::<MyStruct>::from_request(&req, &PathConfig::default()).unwrap(); assert_eq!(s.key, "name"); assert_eq!(s.value, "user1"); let s = Path::<(String, String)>::from_request(&req, &PathConfig::default()).unwrap(); assert_eq!(s.0, "name"); assert_eq!(s.1, "user1"); let s = Query::<Id>::from_request(&req, &QueryConfig::default()).unwrap(); assert_eq!(s.id, "test"); let mut router = Router::<()>::default(); router.register_resource(Resource::new(ResourceDef::new("/{key}/{value}/"))); let req = TestRequest::with_uri("/name/32/").finish(); let info = router.recognize(&req, &(), 0); let req = req.with_route_info(info); let s = Path::<Test2>::from_request(&req, &PathConfig::default()).unwrap(); assert_eq!(s.as_ref().key, "name"); assert_eq!(s.value, 32); let s = Path::<(String, u8)>::from_request(&req, &PathConfig::default()).unwrap(); assert_eq!(s.0, "name"); assert_eq!(s.1, 32); let res = Path::<Vec<String>>::extract(&req).unwrap(); assert_eq!(res[0], "name".to_owned()); assert_eq!(res[1], "32".to_owned()); }
rust_cleaned_test_functions.jsonl/46187
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 713 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 7893, 39123, 368, 341, 286, 1077, 4232, 284, 3393, 1900, 486, 4197, 15572, 4283, 606, 11739, 16, 17763, 307, 53538, 1827, 30150, 1428, 286, 1077, 5206, 9273, 284, 10554, 27638, 368, 6831, 2258, 54...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_jwt_initialize_claims() { let key = service_account_key_from_file(&TEST_PRIVATE_KEY_PATH.to_string()).unwrap(); let scopes = vec!["scope1", "scope2", "scope3"]; let claims = super::init_claims_from_key(&key, &scopes); assert_eq!(claims.iss, "oauth2-public-test@sanguine-rhythm-105020.iam.gserviceaccount.com".to_string()); assert_eq!(claims.scope, "scope1 scope2 scope3".to_string()); assert_eq!(claims.aud, "https://accounts.google.com/o/oauth2/token".to_string()); assert!(claims.exp > 1000000000); assert!(claims.iat < claims.exp); assert_eq!(claims.exp - claims.iat, 3595); }
rust_cleaned_test_functions.jsonl/25282
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 346 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 95576, 40889, 6794, 25676, 368, 341, 286, 1077, 1376, 284, 2473, 13500, 3097, 5673, 2458, 2099, 10033, 30470, 6600, 7944, 2389, 3904, 6011, 15454, 543, 286, 1077, 50598, 284, 7486, 0, 1183, 4186, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_massive_task_creation() { let test_tasks = 4_200_000; let pool = Pool::<ThunkWorker<()>>::new(TEST_TASKS); let b0 = Arc::new(Barrier::new(TEST_TASKS + 1)); let b1 = Arc::new(Barrier::new(TEST_TASKS + 1)); let (tx, rx) = channel(); for i in 0..test_tasks { let tx = tx.clone(); let (b0, b1) = (b0.clone(), b1.clone()); pool.execute(Thunk::of(move || { // Wait until the pool has been filled once. if i < TEST_TASKS { b0.wait(); // wait so the pool can be measured b1.wait(); } tx.send(1).is_ok(); })); } b0.wait(); assert_eq!(pool.active_count(), TEST_TASKS); b1.wait(); assert_eq!(rx.iter().take(test_tasks).fold(0, |a, b| a + b), test_tasks); pool.join(); let atomic_active_count = pool.active_count(); assert!( atomic_active_count == 0, "atomic_active_count: {}", atomic_active_count ); }
rust_cleaned_test_functions.jsonl/22900
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 647 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 36714, 533, 12184, 46163, 368, 341, 286, 1077, 1273, 32823, 284, 220, 19, 62, 17, 15, 15, 62, 15, 15, 15, 401, 286, 1077, 7314, 284, 22728, 27638, 38223, 21936, 27, 368, 77595, 931, 50320, 263...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
4
#[test] fn test_cli_compatibility() { let input = include_bytes!("../../assets/example.txt.zst"); let output = decode_all(&input[..]).unwrap(); let expected = include_bytes!("../../assets/example.txt"); assert_eq!( &output[..], &expected[..], "error decoding cli-compressed data" ); }
rust_cleaned_test_functions.jsonl/134372
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 141 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 47147, 2965, 53053, 368, 341, 262, 1077, 1946, 284, 2924, 12524, 17223, 2748, 5160, 65182, 3909, 3938, 267, 3071, 262, 1077, 2550, 284, 16895, 5705, 2099, 1355, 95874, 10697, 15454, 1428, 262, 1077,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_scheme() { assert_eq!(scheme("https://yay"), Ok(("yay", Scheme::HTTPS))); assert_eq!(scheme("http://yay"), Ok(("yay", Scheme::HTTP))); assert_eq!( scheme("bla://yay"), Err(NomErr::Error(VerboseError { errors: vec![ ("bla://yay", VerboseErrorKind::Nom(ErrorKind::Tag)), ("bla://yay", VerboseErrorKind::Nom(ErrorKind::Alt)), ("bla://yay", VerboseErrorKind::Context("scheme")), ] })) ); }
rust_cleaned_test_functions.jsonl/118912
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 326 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 53293, 368, 341, 286, 2060, 10714, 10297, 46141, 445, 2428, 1110, 88, 352, 3975, 7622, 30873, 88, 352, 497, 43781, 486, 82354, 4945, 286, 2060, 10714, 10297, 46141, 445, 1254, 1110, 88, 352, 3975,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_create_and_load_snapshot() { // Create diff snapshot. let (snapshot_file, memory_file) = verify_create_snapshot(true); // Create a new microVm from snapshot. This only tests code-level logic; it verifies // that a microVM can be built with no errors from given snapshot. // It does _not_ verify that the guest is actually restored properly. We're using // python integration tests for that. verify_load_snapshot(snapshot_file, memory_file); // Create full snapshot. let (snapshot_file, memory_file) = verify_create_snapshot(false); // Create a new microVm from snapshot. This only tests code-level logic; it verifies // that a microVM can be built with no errors from given snapshot. // It does _not_ verify that the guest is actually restored properly. We're using // python integration tests for that. verify_load_snapshot(snapshot_file, memory_file); }
rust_cleaned_test_functions.jsonl/132812
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 288 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 8657, 8378, 12411, 53265, 368, 341, 262, 442, 4230, 3638, 16295, 624, 262, 1077, 320, 35501, 2458, 11, 4938, 2458, 8, 284, 10146, 8657, 53265, 3715, 317, 262, 442, 4230, 264, 501, 8003, 88124, 5...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_1() { let program = vec![ 3, 26, 1001, 26, -4, 26, 3, 27, 1002, 27, 2, 27, 1, 27, 26, 27, 4, 27, 1001, 28, -1, 28, 1005, 28, 6, 99, 0, 0, 5, ]; let mut amps = Amplifiers::new(&program, &[9, 8, 7, 6, 5]); let actual = amps.run_to_end(0); assert_eq!(actual, 139_629_729); }
rust_cleaned_test_functions.jsonl/69054
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 172 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 62, 16, 368, 341, 262, 1077, 2025, 284, 7486, 90515, 414, 220, 18, 11, 220, 17, 21, 11, 220, 16, 15, 15, 16, 11, 220, 17, 21, 11, 481, 19, 11, 220, 17, 21, 11, 220, 18, 11, 220, 17, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_write_various() { let tmp = tempfile::Builder::new() .prefix("rust-htslib") .tempdir() .expect("Cannot create temp dir"); let out_path = tmp.path().join("test_various.out.vcf"); let vcf = Reader::from_path(&"test/test_various.vcf").expect("Error opening file."); // The writer goes into its own block so we can ensure that the file is closed and // all data is written below. { let mut writer = Writer::from_path( &out_path, &Header::from_template(&vcf.header()), true, Format::VCF, ) .expect("Error opening file."); let header = writer.header().clone(); let mut record = writer.empty_record(); record.set_rid(Some(0)); assert_eq!(record.rid().unwrap(), 0); record.set_pos(12); assert_eq!(record.pos(), 12); assert_eq!(str::from_utf8(record.id().as_ref()).unwrap(), "."); record.set_id(b"to_be_cleared").unwrap(); assert_eq!( str::from_utf8(record.id().as_ref()).unwrap(), "to_be_cleared" ); record.clear_id().unwrap(); assert_eq!(str::from_utf8(record.id().as_ref()).unwrap(), "."); record.set_id(b"first_id").unwrap(); record.push_id(b"second_id").unwrap(); record.push_id(b"first_id").unwrap(); assert!(record.filters().next().is_none()); record.set_filters(&[header.name_to_id(b"q10").unwrap()]); record.push_filter(header.name_to_id(b"s50").unwrap()); record.remove_filter(header.name_to_id(b"q10").unwrap(), true); record.push_filter(header.name_to_id(b"q10").unwrap()); record.set_alleles(&[b"C", b"T", b"G"]).unwrap(); record.set_qual(10.0); record.push_info_integer(b"N1", &[32]).unwrap(); record.push_info_float(b"F1", &[33.0]).unwrap(); record.push_info_string(b"S1", &[b"fourtytwo"]).unwrap(); record.push_info_flag(b"X1").unwrap(); record .push_genotypes(&[ GenotypeAllele::Unphased(0), GenotypeAllele::Unphased(1), GenotypeAllele::Unphased(1), GenotypeAllele::Phased(1), ]) .unwrap(); record .push_format_string(b"FS1", &[&b"yes"[..], &b"no"[..]]) .unwrap(); record.push_format_integer(b"FF1", &[43, 11]).unwrap(); record.push_format_float(b"FN1", &[42.0, 10.0]).unwrap(); record .push_format_char(b"CH1", &[b"A"[0], b"B"[0]]) .unwrap(); writer.write(&record).unwrap(); } let expected = read_all("test/test_various.out.vcf"); let actual = read_all(&out_path); assert_eq!(expected, actual); }
rust_cleaned_test_functions.jsonl/8773
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1715 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 9165, 4612, 1223, 368, 341, 1789, 286, 1077, 4174, 284, 54819, 486, 3297, 486, 931, 741, 310, 659, 11849, 445, 35788, 12, 426, 82, 2740, 1138, 310, 659, 3888, 3741, 741, 310, 659, 17119, 445, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_canonicalize_idents_by_stripping_trailing_url_slash() { let ident1 = ident(&url("https://github.com/PistonDevelopers/piston/")); let ident2 = ident(&url("https://github.com/PistonDevelopers/piston")); assert_eq!(ident1, ident2); }
rust_cleaned_test_functions.jsonl/74051
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 121 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 27421, 22391, 551, 842, 805, 3710, 1261, 461, 10732, 3547, 14277, 2903, 11886, 988, 368, 341, 286, 1077, 3524, 16, 284, 3524, 2099, 1085, 445, 2428, 1110, 5204, 905, 16341, 58819, 20444, 388, 4322...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_default_headers() { let server = server::http(move |req| { async move { assert_eq!(req.headers()["reqwest-test"], "orly"); http::Response::default() } }); let mut headers = http::HeaderMap::with_capacity(1); headers.insert("reqwest-test", "orly".parse().unwrap()); let client = reqwest::blocking::Client::builder() .default_headers(headers) .build() .unwrap(); let url = format!("http://{}/1", server.addr()); let res = client.get(&url).send().unwrap(); assert_eq!(res.url().as_str(), &url); assert_eq!(res.status(), reqwest::StatusCode::OK); }
rust_cleaned_test_functions.jsonl/131409
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 286 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 9993, 26719, 368, 341, 262, 1077, 3538, 284, 3538, 486, 1254, 34081, 760, 2958, 91, 341, 286, 3312, 3271, 341, 310, 2060, 10714, 10297, 2958, 18022, 64322, 2958, 11039, 16839, 7914, 330, 269, 398,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_intraday_volumes_400_failed() { let it = crawler::IntradayBuilder::default().build(); assert_err!(it.volumes("").call(), Err(FugleError::General(_))); }
rust_cleaned_test_functions.jsonl/49451
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 75 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 1243, 47026, 352, 2273, 19705, 62, 19, 15, 15, 35060, 368, 341, 262, 1077, 432, 284, 73094, 486, 641, 47026, 352, 3297, 486, 2258, 1005, 5834, 543, 262, 2060, 9266, 10297, 275, 3133, 19705, 8082...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_parse_article_without_reply() { let documents = load_document("../tests/Soft_Job_M.1181804025.A.7A7.html"); let article_date = Some( FixedOffset::east(8 * 3600) .ymd(2007, 6, 14) .and_hms(14, 53, 44), ); assert_eq!(parse_replies(&documents, article_date).len(), 0) }
rust_cleaned_test_functions.jsonl/87157
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 194 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21039, 37321, 39904, 15323, 368, 341, 286, 1077, 9293, 284, 2795, 26231, 17409, 23841, 14, 30531, 10598, 674, 1245, 13, 16, 16, 23, 16, 23, 15, 19, 15, 17, 20, 875, 13, 22, 32, 22, 2564, 797...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_extensible_extended_1() { // from playground serialize_and_deserialize_uper( 16, &[0x83, 0xD6], &BasicConstrainedExtensible { abc: BitVec::from_bytes(vec![0b1010_1100], 7), }, ); }
rust_cleaned_test_functions.jsonl/50182
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 141 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 9927, 36764, 61678, 62, 16, 368, 341, 262, 442, 504, 41615, 198, 262, 24235, 8378, 15768, 9050, 62, 3466, 1006, 286, 220, 16, 21, 345, 286, 44590, 15, 87, 23, 18, 11, 220, 15, 15764, 21, 125...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_arp_table_static_cancel_waiting_timer() { let mut ctx = DummyContext::default(); // Perform a lookup in order to kick off a request and install a retry // timer. lookup(&mut ctx, (), TEST_LOCAL_MAC, TEST_REMOTE_IPV4); // We should be in the Waiting state. assert!(ctx.get_ref().arp_state.table.get_remaining_tries(TEST_REMOTE_IPV4).is_some()); // We should have an ARP request retry timer set. validate_single_retry_timer(&ctx, DEFAULT_ARP_REQUEST_PERIOD, TEST_REMOTE_IPV4); // Now insert a static entry. insert_static_neighbor(&mut ctx, (), TEST_REMOTE_IPV4, TEST_REMOTE_MAC); // The timer should have been canceled. assert_eq!(ctx.timers().len(), 0); // We should have notified the device layer. assert_eq!(ctx.get_ref().addr_resolved.as_slice(), [(TEST_REMOTE_IPV4, TEST_REMOTE_MAC)]); }
rust_cleaned_test_functions.jsonl/17004
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 414 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 62, 7876, 5237, 25360, 28895, 84683, 16255, 368, 341, 1789, 23459, 286, 1077, 5206, 5635, 284, 50567, 1972, 486, 2258, 1428, 286, 442, 25001, 264, 18615, 304, 1973, 311, 10323, 1007, 264, 1681, 32...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_multi_comparisons_corner_cases() { for (&x, &y, &z) in iproduct!(test_values(), test_values(), test_values()) { println!("Testing combined comparisons with inputs {:?}", (x, y, z)); test_multi_comparisons(x, y, z); } }
rust_cleaned_test_functions.jsonl/122904
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 115 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 25133, 2965, 1732, 19379, 66884, 41427, 368, 341, 262, 369, 15899, 87, 11, 609, 88, 11, 609, 89, 8, 304, 5997, 299, 1058, 10297, 1944, 9146, 1507, 1273, 9146, 1507, 1273, 9146, 2140, 341, 286, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_random_bit_extraction() { // Length of the data vector we'll be extracting from. let len = 20; let rng = &mut XorShiftRng::from_seed(TEST_SEED); let data: Vec<u8> = (0..len).map(|_| rng.gen()).collect(); // TODO: Evaluate designing a scattered pattered of `pos` and `num_bits` // instead of repeating too many iterations with any number. for _ in 0..100 { let pos = rng.gen_range(0..data.len() / 2); let num_bits = rng.gen_range(1..data.len() * 8 - pos); let new_offset = rng.gen_range(0..8); let mut bv = BitVec::<LittleEndian, u8>::new(); bv.extend( BitVec::<LittleEndian, u8>::from(&data[..]) .into_iter() .skip(pos) .take(num_bits), ); let shifted_bv: BitVec<LittleEndian, u8> = bv >> new_offset; assert_eq!( shifted_bv.as_slice(), &extract_bits_and_shift(&data, pos, num_bits, new_offset)[..], ); } }
rust_cleaned_test_functions.jsonl/75455
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 598 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 22644, 13996, 94842, 368, 341, 286, 442, 17287, 315, 279, 821, 4621, 582, 3278, 387, 59408, 504, 624, 286, 1077, 2422, 284, 220, 17, 15, 401, 286, 1077, 28422, 284, 609, 6984, 1599, 269, 24841, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_unaligned_sizes() { macro_rules! test_size { ($size:expr) => { let mut buf = FixedVecDeque::<[u32; $size]>::new(); assert_eq!(buf.back(), None); assert_eq!(buf.front(), None); assert_eq!(buf.get(0), None); assert_eq!(buf.get_mut(0), None); for i in 1..($size + 1) { *buf.push_back() = i; assert_eq!(buf.front(), Some(&1)); assert_eq!(buf.back(), Some(&i)); assert_eq!(buf.get(0), Some(&1)); assert_eq!(buf.get(buf.len() - 1), Some(&i)); assert_eq!(buf[0], 1); assert_eq!(buf[buf.len() - 1], i); } let mut buf = FixedVecDeque::<[u32; $size]>::new(); assert_eq!(buf.back(), None); assert_eq!(buf.front(), None); assert_eq!(buf.get(0), None); assert_eq!(buf.get_mut(0), None); for i in 1..($size + 1) { *buf.push_front() = i; assert_eq!(buf.back(), Some(&1)); assert_eq!(buf.front(), Some(&i)); assert_eq!(buf.get(buf.len() - 1), Some(&1)); assert_eq!(buf.get(0), Some(&i)); assert_eq!(buf[buf.len() - 1], 1); assert_eq!(buf[0], i); } }; } test_size!(0); test_size!(1); test_size!(2); test_size!(3); test_size!(4); test_size!(5); test_size!(6); test_size!(7); test_size!(8); test_size!(9); test_size!(10); test_size!(11); test_size!(12); test_size!(13); test_size!(14); test_size!(15); test_size!(16); test_size!(20); test_size!(24); test_size!(32); test_size!(36); }
rust_cleaned_test_functions.jsonl/3285
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1266 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 4907, 47142, 32159, 368, 341, 286, 18072, 21407, 0, 1273, 2368, 341, 310, 1711, 2141, 96011, 8, 589, 341, 394, 1077, 5206, 6607, 284, 20149, 10050, 73891, 27638, 58, 84, 18, 17, 26, 400, 2141, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_le_advertising_data() { let buf = [7, 2, 240, 255, 229, 255, 224, 255]; assert_eq!(le_advertising_data(&buf), Ok((&[][..], vec![ServiceClassUUID16(65520), ServiceClassUUID16(65509), ServiceClassUUID16(65504)]))); let buf = [18,9,76,69,68,66,108,117,101,45,69,65,57,55,66,55,65,51,32]; assert_eq!(le_advertising_data(&buf), Ok((&[][..], vec![ LocalName(String::from("LEDBlue-EA97B7A3 "))]))); }
rust_cleaned_test_functions.jsonl/125937
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 418 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 11751, 10027, 29924, 1769, 368, 341, 286, 1077, 6607, 284, 508, 22, 11, 220, 17, 11, 220, 17, 19, 15, 11, 220, 17, 20, 20, 11, 220, 17, 17, 24, 11, 220, 17, 20, 20, 11, 220, 17, 17, 19...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_locate_latest_common_block2() { let consensus = Consensus::default(); let (chain_controller1, shared1, _notify1) = start_chain(Some(consensus.clone()), None); let (chain_controller2, shared2, _notify2) = start_chain(Some(consensus.clone()), None); let block_number = 200; let mut blocks: Vec<BlockView> = Vec::new(); let mut parent = consensus.genesis_block().header().to_owned(); for i in 1..block_number { let parent_epoch = shared1.store().get_block_epoch(&parent.hash()).unwrap(); let epoch = shared1 .next_epoch_ext(&parent_epoch, &parent) .unwrap_or(parent_epoch); let new_block = gen_block(&shared1, &parent, &epoch, i); blocks.push(new_block.clone()); chain_controller1 .process_block(Arc::new(new_block.clone()), false) .expect("process block ok"); chain_controller2 .process_block(Arc::new(new_block.clone()), false) .expect("process block ok"); parent = new_block.header().to_owned(); } parent = blocks[150].header().to_owned(); let fork = parent.number(); for i in 1..=block_number { let parent_epoch = shared2.store().get_block_epoch(&parent.hash()).unwrap(); let epoch = shared2 .next_epoch_ext(&parent_epoch, &parent) .unwrap_or(parent_epoch); let new_block = gen_block(&shared2, &parent, &epoch, i + 100); chain_controller2 .process_block(Arc::new(new_block.clone()), false) .expect("process block ok"); parent = new_block.header().to_owned(); } let synchronizer1 = gen_synchronizer(chain_controller1.clone(), shared1.clone()); let synchronizer2 = gen_synchronizer(chain_controller2.clone(), shared2.clone()); let locator1 = synchronizer1 .shared .get_locator(shared1.snapshot().tip_header()); let latest_common = synchronizer2 .shared .locate_latest_common_block(&H256::zero().pack(), &locator1[..]) .unwrap(); assert_eq!( shared1.store().get_block_hash(fork).unwrap(), shared2.store().get_block_hash(fork).unwrap() ); assert!( shared1.store().get_block_hash(fork + 1).unwrap() != shared2.store().get_block_hash(fork + 1).unwrap() ); assert_eq!( shared1.store().get_block_hash(latest_common).unwrap(), shared1.store().get_block_hash(fork).unwrap() ); }
rust_cleaned_test_functions.jsonl/113659
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1305 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 13400, 349, 64880, 21107, 7113, 17, 368, 341, 286, 1077, 23869, 284, 7292, 13626, 486, 2258, 543, 286, 1077, 320, 8819, 21600, 16, 11, 6094, 16, 11, 716, 21948, 16, 8, 284, 1191, 30583, 65405, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_reading_deflate_encoding_large_random_ssl() { use openssl::ssl::{SslConnector, SslMethod, SslVerifyMode}; use rustls::internal::pemfile::{certs, rsa_private_keys}; use rustls::{NoClientAuth, ServerConfig}; use std::fs::File; use std::io::BufReader; let addr = TestServer::unused_addr(); let (tx, rx) = mpsc::channel(); let data = rand::thread_rng() .sample_iter(&Alphanumeric) .take(160_000) .collect::<String>(); thread::spawn(move || { let sys = actix_rt::System::new("test"); // load ssl keys let mut config = ServerConfig::new(NoClientAuth::new()); let cert_file = &mut BufReader::new(File::open("tests/cert.pem").unwrap()); let key_file = &mut BufReader::new(File::open("tests/key.pem").unwrap()); let cert_chain = certs(cert_file).unwrap(); let mut keys = rsa_private_keys(key_file).unwrap(); config.set_single_cert(cert_chain, keys.remove(0)).unwrap(); let srv = HttpServer::new(|| { App::new().service(web::resource("/").route(web::to(|bytes: Bytes| { Ok::<_, Error>( HttpResponse::Ok() .encoding(http::ContentEncoding::Identity) .body(bytes), ) }))) }) .bind_rustls(addr, config) .unwrap() .start(); let _ = tx.send((srv, actix_rt::System::current())); let _ = sys.run(); }); let (srv, _sys) = rx.recv().unwrap(); let client = test::run_on(|| { let mut builder = SslConnector::builder(SslMethod::tls()).unwrap(); builder.set_verify(SslVerifyMode::NONE); let _ = builder.set_alpn_protos(b"\x02h2\x08http/1.1").unwrap(); awc::Client::build() .connector( awc::Connector::new() .timeout(std::time::Duration::from_millis(500)) .ssl(builder.build()) .finish(), ) .finish() }); // encode data let mut e = ZlibEncoder::new(Vec::new(), Compression::default()); e.write_all(data.as_ref()).unwrap(); let enc = e.finish().unwrap(); // client request let _req = client .post(format!("https://{}/", addr)) .header(http::header::CONTENT_ENCODING, "deflate") .send_body(enc); // TODO: fix // read response // stop let _ = srv.stop(false); }
rust_cleaned_test_functions.jsonl/48239
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1243 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 81859, 7844, 5075, 37613, 45228, 22644, 48210, 368, 341, 262, 990, 80733, 486, 24635, 22964, 50, 3226, 35954, 11, 328, 3226, 3523, 11, 328, 3226, 32627, 3636, 2440, 262, 990, 23071, 4730, 486, 104...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
4
#[test] fn test_run() { let elevator = ELEVATOR.lock().unwrap(); println!("The elevator will now do a run from the bottom floor to the top floor. It will stop in the floor below the top floor"); elevator.set_direction(ElevatorDirection::Down); while elevator.read_floor_sensor() != Some(0) { if let Some(floor) = elevator.read_floor_sensor() { elevator.set_floor_indicator(floor); } } elevator.set_floor_indicator(0); elevator.set_direction(ElevatorDirection::Up); while elevator.read_floor_sensor() != Some(ElevatorInterface::N_FLOORS - 1) { if let Some(floor) = elevator.read_floor_sensor() { elevator.set_floor_indicator(floor); } } elevator.set_floor_indicator(ElevatorInterface::N_FLOORS - 1); elevator.set_direction(ElevatorDirection::Down); while elevator.read_floor_sensor() != Some(ElevatorInterface::N_FLOORS - 2) {} elevator.set_floor_indicator(ElevatorInterface::N_FLOORS - 2); elevator.set_direction(ElevatorDirection::Stop); }
rust_cleaned_test_functions.jsonl/42307
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 497 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 14007, 368, 341, 286, 1077, 38636, 284, 468, 85411, 11857, 21003, 1005, 15454, 543, 286, 13751, 17223, 785, 38636, 686, 1431, 653, 264, 1598, 504, 279, 5622, 6422, 311, 279, 1909, 6422, 13, 1084, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
6
#[test] fn test_supplies_buy_misc_success() { let mut supplies = Supplies::new(); supplies.buy_misc(200).unwrap(); assert_eq!(500, supplies.money); assert_eq!(200, supplies.misc); }
rust_cleaned_test_functions.jsonl/28668
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 108 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 23723, 7202, 46348, 69350, 18632, 368, 341, 286, 1077, 5206, 16720, 284, 50252, 486, 931, 543, 286, 16720, 63871, 69350, 7, 17, 15, 15, 568, 15454, 543, 1066, 286, 2060, 10714, 10297, 20, 15, 15...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_global_var_f32() { // create a GlobalType instance let result = GlobalType::create(ValType::F32, Mutability::Var); assert!(result.is_ok()); let mut ty = result.unwrap(); assert!(!ty.ctx.is_null()); // create a Var Global instance let result = Global::create(&mut ty, Value::F32(13.14)); assert!(result.is_ok()); assert!(ty.ctx.is_null()); assert!(ty.registered); let mut global_var = result.unwrap(); // access the value held by global_var assert_eq!(global_var.get_value(), Value::F32(13.14)); let result = global_var.set_value(Value::F32(1.314)); assert!(result.is_ok()); assert_eq!(global_var.get_value(), Value::F32(1.314)); // access the global type let result = global_var.ty(); assert!(result.is_ok()); let ty = result.unwrap(); assert!(!ty.ctx.is_null()); assert!(ty.registered); assert_eq!(ty.value_type(), ValType::F32); assert_eq!(ty.mutability(), Mutability::Var); }
rust_cleaned_test_functions.jsonl/130797
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 501 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 19296, 4612, 761, 18, 17, 368, 341, 286, 442, 1855, 264, 7962, 929, 2867, 198, 286, 1077, 1102, 284, 7962, 929, 486, 3182, 7, 2208, 929, 486, 37, 18, 17, 11, 31228, 2897, 486, 3962, 317, 286...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_pow_function() -> Result<()> { let tests = vec![ ScalarFunctionTest { name: "pow-with-literal", columns: vec![Series::from_data([2]), Series::from_data([2])], expect: Series::from_data(vec![4_f64]), error: "", }, ScalarFunctionTest { name: "pow-with-series", columns: vec![Series::from_data([2, 2]), Series::from_data([2, -2])], expect: Series::from_data([4_f64, 0.25]), error: "", }, ScalarFunctionTest { name: "pow-with-null", columns: vec![ Series::from_data([Some(2), None, None]), Series::from_data([Some(2), Some(-2), None]), ], expect: Series::from_data([Some(4_f64), None, None]), error: "", }, ScalarFunctionTest { name: "pow-x-constant", columns: vec![ ConstColumn::new(Series::from_data(vec![2]), 3).arc(), Series::from_data([Some(2), Some(-2), None]), ], expect: Series::from_data([Some(4_f64), Some(0.25), None]), error: "", }, ScalarFunctionTest { name: "pow-y-constant", columns: vec![ Series::from_data([Some(2), Some(-2), None]), ConstColumn::new(Series::from_data(vec![2]), 3).arc(), ], expect: Series::from_data([Some(4_f64), Some(4.0), None]), error: "", }, ]; test_scalar_functions("pow", &tests) }
rust_cleaned_test_functions.jsonl/66267
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 883 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 56183, 9174, 368, 1464, 5714, 71698, 341, 262, 1077, 7032, 284, 7486, 90515, 286, 35176, 5152, 2271, 341, 310, 829, 25, 330, 21743, 26189, 2852, 9953, 756, 310, 8147, 25, 7486, 20703, 25544, 486, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_default() { let g = MatrixGraph::<i32, i32>::default(); assert_eq!(g.node_count(), 0); assert_eq!(g.edge_count(), 0); }
rust_cleaned_test_functions.jsonl/81954
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 88 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 9993, 368, 341, 286, 1077, 342, 284, 11631, 11212, 27638, 72, 18, 17, 11, 600, 18, 17, 6831, 2258, 543, 286, 2060, 10714, 10297, 70, 12097, 3180, 1507, 220, 15, 317, 286, 2060, 10714, 10297, 7...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_02() { let alloc: bumpalo::Bump = bumpalo::Bump::new(); let mut buf = bumpalo::vec![in &alloc; 1, 2, 3]; let _s = BumpSliceMut::new(&alloc, buf.as_mut_slice()); }
rust_cleaned_test_functions.jsonl/115370
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 105 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 62, 15, 17, 368, 341, 286, 1077, 5574, 25, 27575, 12529, 486, 33, 1510, 284, 27575, 12529, 486, 33, 1510, 486, 931, 543, 286, 1077, 5206, 6607, 284, 27575, 12529, 486, 4083, 20703, 258, 609, 4...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_select() { let sql = "SELECT * FROM label1 Where a = 123 and b != '456'"; let mut tokenizer = Tokenizer::new(&sql); let tokens = tokenizer.tokenize().unwrap_or_default(); assert_eq!( vec![ Token::Keyword(Keyword::SELECT), Token::Whitespace(Whitespace::Space), Token::Star, Token::Whitespace(Whitespace::Space), Token::Keyword(Keyword::FROM), Token::Whitespace(Whitespace::Space), Token::Identifier("label1".to_owned()), Token::Whitespace(Whitespace::Space), Token::Keyword(Keyword::WHERE), Token::Whitespace(Whitespace::Space), Token::Identifier("a".to_owned()), Token::Whitespace(Whitespace::Space), Token::Eq, Token::Whitespace(Whitespace::Space), Token::Number("123".to_owned()), Token::Whitespace(Whitespace::Space), Token::Keyword(Keyword::AND), Token::Whitespace(Whitespace::Space), Token::Identifier("b".to_owned()), Token::Whitespace(Whitespace::Space), Token::Neq, Token::Whitespace(Whitespace::Space), Token::String("456".to_owned()), Token::EOF, ], tokens ); }
rust_cleaned_test_functions.jsonl/83085
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 792 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 13051, 368, 341, 286, 1077, 5704, 284, 330, 4858, 353, 4295, 2383, 16, 10967, 264, 284, 220, 16, 17, 18, 323, 293, 961, 364, 19, 20, 21, 21689, 286, 1077, 5206, 45958, 284, 9660, 3135, 486, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_m_limit() { let s = "copy 1 m\n"; assert_eq!( parse_text(s), Ok(vec![Instruction::Copy( Target::Literal(1), Target::Register("m".into()), )]) ); let s = "copy m m\n"; assert_eq!( parse_text(s), Err("cannot reference M register more than once in one instruction".into()), ); }
rust_cleaned_test_functions.jsonl/72903
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 270 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 717, 14763, 368, 972, 286, 1077, 274, 284, 330, 8560, 220, 16, 296, 1699, 3534, 286, 2060, 10714, 0, 7805, 310, 4715, 4326, 1141, 9912, 310, 7622, 25592, 20703, 16664, 486, 12106, 7805, 394, 134...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_accessible() { let mut p = EdgeProperties::default(); p.normalize(); assert!(!p.accessible()); p.foot = FOOT_ALLOWED; assert!(p.accessible()) }
rust_cleaned_test_functions.jsonl/62183
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 80 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 88724, 368, 341, 262, 1077, 5206, 281, 284, 10349, 7903, 486, 2258, 543, 262, 281, 44657, 543, 262, 2060, 0, 3471, 79, 21986, 1238, 5231, 262, 281, 13, 5334, 284, 80037, 73186, 280, 262, 2060, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_decimal_as_json() { test_none_with_ctx(cast_any_as_any::<Decimal, Json>); let cs = vec![ ( Decimal::from_f64(i64::MIN as f64).unwrap(), Json::Double(i64::MIN as f64), ), ( Decimal::from_f64(i64::MAX as f64).unwrap(), Json::Double(i64::MAX as f64), ), ( Decimal::from_bytes(b"184467440737095516160") .unwrap() .unwrap(), Json::Double(184467440737095516160.0), ), ( Decimal::from_bytes(b"-184467440737095516160") .unwrap() .unwrap(), Json::Double(-184467440737095516160.0), ), ]; for (input, expect) in cs { let mut ctx = EvalContext::default(); let r = cast_any_as_any::<Decimal, Json>(&mut ctx, &Some(input.clone())); let log = make_log(&input, &expect, &r); check_result(Some(&expect), &r, log.as_str()); } }
rust_cleaned_test_functions.jsonl/101817
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 695 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 74429, 11898, 9455, 368, 341, 286, 1273, 31488, 6615, 15147, 1337, 559, 37248, 11898, 37248, 27638, 11269, 11, 8308, 42013, 286, 1077, 10532, 284, 7486, 90515, 310, 2399, 394, 26728, 486, 1499, 761,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_forecast_request_builder_defaults() { let request = ForecastRequestBuilder::new(API_KEY, LAT, LONG).build(); let expected_url = Url::parse(&format!( "{base}/{key}/{lat:.16},{long:.16}?", base = FORECAST_URL, key = API_KEY, lat = LAT, long = LONG )).unwrap(); let expected = ForecastRequest::new( API_KEY, LAT, LONG, expected_url, Vec::new(), None, None, None ); assert_eq!(expected.api_key, request.api_key); assert_eq!(expected.latitude, request.latitude); assert_eq!(expected.longitude, request.longitude); assert_eq!(expected.exclude, request.exclude); assert_eq!(expected.extend, request.extend); assert_eq!(expected.lang, request.lang); assert_eq!(expected.units, request.units); assert_eq!(expected.url, request.url); assert_eq!(expected, request); }
rust_cleaned_test_functions.jsonl/24714
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 534 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 35563, 3829, 7893, 28532, 42290, 368, 341, 286, 1077, 1681, 284, 55675, 1900, 3297, 486, 931, 48953, 6600, 11, 53187, 11, 33942, 568, 5834, 1428, 286, 1077, 3601, 2903, 284, 22840, 486, 6400, 2099...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_without_miter_limit(){ let expected_limit = 4.0; let stroke_options = StrokeOptions::default(); assert_eq!(expected_limit, stroke_options.miter_limit); }
rust_cleaned_test_functions.jsonl/25092
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 73 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 39904, 717, 2015, 14763, 3032, 262, 1077, 3601, 14763, 284, 220, 19, 13, 15, 280, 262, 1077, 12654, 8743, 284, 68934, 3798, 486, 2258, 1428, 262, 2060, 10714, 10297, 7325, 14763, 11, 12654, 8743, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_current_user() { let value = CurrentUser { accent_color: Some(16_711_680), avatar: Some("avatar hash".to_owned()), banner: None, bot: true, discriminator: 9999, email: None, id: UserId::new(1).expect("non zero"), mfa_enabled: true, name: "test name".to_owned(), verified: Some(true), premium_type: Some(PremiumType::NitroClassic), public_flags: Some(UserFlags::DISCORD_EMPLOYEE), flags: None, locale: Some("test locale".to_owned()), }; // Deserializing a current user with a string discriminator (which // Discord provides) serde_test::assert_tokens(&value, &user_tokens(Token::Str("9999"))); // Deserializing a current user with an integer discriminator. Userland // code may have this due to being a more compact memory representation // of a discriminator. serde_test::assert_de_tokens(&value, &user_tokens(Token::U64(9999))); }
rust_cleaned_test_functions.jsonl/21722
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 509 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 11080, 3317, 368, 341, 286, 1077, 897, 284, 9125, 1474, 341, 310, 29100, 6714, 25, 4329, 7, 16, 21, 62, 22, 16, 16, 62, 21, 23, 15, 1326, 310, 20701, 25, 4329, 445, 11962, 5175, 3263, 983, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_target_redirect_not_found() { wrapper(|env| { let web = env.frontend(); assert_eq!( web.get("/crate/fdsafdsafdsafdsa/0.1.0/target-redirect/x86_64-apple-darwin/") .send()? .status(), StatusCode::NOT_FOUND, ); Ok(()) }) }
rust_cleaned_test_functions.jsonl/13867
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 244 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 11123, 30043, 7913, 21480, 368, 341, 286, 13261, 22428, 3160, 91, 341, 310, 1077, 3482, 284, 6105, 23445, 408, 543, 310, 2060, 10714, 33673, 394, 3482, 670, 4283, 61711, 6663, 5356, 2577, 5356, 25...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_peer_selector() { let peers = vec![ PeerInfo::new( PeerId::random(), ChainInfo::new(1.into(), HashValue::zero(), mock_chain_status(100.into())), vec![], vec![], ), PeerInfo::new( PeerId::random(), ChainInfo::new(1.into(), HashValue::zero(), mock_chain_status(99.into())), vec![], vec![], ), PeerInfo::new( PeerId::random(), ChainInfo::new(1.into(), HashValue::zero(), mock_chain_status(100.into())), vec![], vec![], ), PeerInfo::new( PeerId::random(), ChainInfo::new(1.into(), HashValue::zero(), mock_chain_status(1.into())), vec![], vec![], ), ]; let peer_selector = PeerSelector::new(peers, PeerStrategy::default(), None); let best_selector = peer_selector.bests(0.into()).unwrap(); assert_eq!(2, best_selector.len()); let top_selector = peer_selector.top(3); assert_eq!(3, top_selector.len()); }
rust_cleaned_test_functions.jsonl/100338
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 577 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 45159, 28890, 368, 341, 262, 1077, 25029, 284, 7486, 90515, 286, 45147, 1731, 486, 931, 1006, 310, 45147, 764, 486, 11463, 3148, 310, 28525, 1731, 486, 931, 7, 16, 39860, 1507, 6531, 1130, 486, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_snapshot_hash_of() { assert_eq!( snapshot_hash_of(&format!("snapshot-42-{}.tar.bz2", Hash::default())), Some((42, Hash::default())) ); assert!(snapshot_hash_of("invalid").is_none()); }
rust_cleaned_test_functions.jsonl/38788
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 134 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 53265, 8950, 3575, 368, 341, 286, 2060, 10714, 33673, 310, 16295, 8950, 3575, 2099, 2243, 17223, 35501, 12, 19, 17, 12, 46391, 26737, 81374, 17, 497, 6531, 486, 2258, 73727, 310, 4329, 1188, 19, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_parse_wallet_create_tx() { let cli_args = vec!["bdk-cli", "--network", "testnet", "wallet", "--descriptor", "wpkh(tpubDEnoLuPdBep9bzw5LoGYpsxUQYheRQ9gcgrJhJEcdKFB9cWQRyYmkCyRoTqeD4tJYiVVgt6A3rN6rWn9RYhR9sBsGxji29LYWHuKKbdb1ev/0/*)", "--change_descriptor", "wpkh(tpubDEnoLuPdBep9bzw5LoGYpsxUQYheRQ9gcgrJhJEcdKFB9cWQRyYmkCyRoTqeD4tJYiVVgt6A3rN6rWn9RYhR9sBsGxji29LYWHuKKbdb1ev/1/*)", "create_tx", "--to", "n2Z3YNXtceeJhFkTknVaNjT1mnCGWesykJ:123456","mjDZ34icH4V2k9GmC8niCrhzVuR3z8Mgkf:78910", "--utxos","87345e46bfd702d24d54890cc094d08a005f773b27c8f965dfe0eb1e23eef88e:1", "--utxos","87345e46bfd702d24d54890cc094d08a005f773b27c8f965dfe0eb1e23eef88e:2"]; let cli_opts = CliOpts::from_iter(&cli_args); let script1 = Address::from_str("n2Z3YNXtceeJhFkTknVaNjT1mnCGWesykJ") .unwrap() .script_pubkey(); let script2 = Address::from_str("mjDZ34icH4V2k9GmC8niCrhzVuR3z8Mgkf") .unwrap() .script_pubkey(); let outpoint1 = OutPoint::from_str( "87345e46bfd702d24d54890cc094d08a005f773b27c8f965dfe0eb1e23eef88e:1", ) .unwrap(); let outpoint2 = OutPoint::from_str( "87345e46bfd702d24d54890cc094d08a005f773b27c8f965dfe0eb1e23eef88e:2", ) .unwrap(); let expected_cli_opts = CliOpts { network: Network::Testnet, subcommand: CliSubCommand::Wallet { wallet_opts: WalletOpts { wallet: "main".to_string(), descriptor: "wpkh(tpubDEnoLuPdBep9bzw5LoGYpsxUQYheRQ9gcgrJhJEcdKFB9cWQRyYmkCyRoTqeD4tJYiVVgt6A3rN6rWn9RYhR9sBsGxji29LYWHuKKbdb1ev/0/*)".to_string(), change_descriptor: Some("wpkh(tpubDEnoLuPdBep9bzw5LoGYpsxUQYheRQ9gcgrJhJEcdKFB9cWQRyYmkCyRoTqeD4tJYiVVgt6A3rN6rWn9RYhR9sBsGxji29LYWHuKKbdb1ev/1/*)".to_string()), #[cfg(feature = "electrum")] electrum_opts: ElectrumOpts { timeout: None, electrum: "ssl://electrum.blockstream.info:60002".to_string(), }, #[cfg(feature = "esplora")] esplora_opts: EsploraOpts { esplora: None, esplora_concurrency: 4, }, #[cfg(feature = "compact_filters")] compactfilter_opts: CompactFilterOpts{ address: vec!["127.0.0.1:18444".to_string()], conn_count: 4, skip_blocks: 0, }, #[cfg(any(feature="compact_filters", feature="electrum"))] proxy_opts: ProxyOpts{ proxy: None, proxy_auth: None, retries: 5, } }, subcommand: WalletSubCommand::OfflineWalletSubCommand(CreateTx { recipients: vec![(script1, 123456), (script2, 78910)], send_all: false, enable_rbf: false, offline_signer: false, utxos: Some(vec!(outpoint1, outpoint2)), unspendable: None, fee_rate: None, external_policy: None, internal_policy: None, }), }, }; assert_eq!(expected_cli_opts, cli_opts); }
rust_cleaned_test_functions.jsonl/53341
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 2356 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21039, 62308, 8657, 17805, 368, 341, 286, 1077, 21348, 8384, 284, 7486, 0, 1183, 65, 7584, 54797, 497, 14482, 17511, 497, 330, 1944, 4711, 497, 330, 35735, 756, 999, 14482, 53132, 497, 330, 8421, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_valid_suffixes() { let all_suffixes = vec![ (KubeQuantity("500m".into()), Suffix::Millicpu), (KubeQuantity("123456".into()), Suffix::None), (KubeQuantity("1.23456".into()), Suffix::None), (KubeQuantity("500K".into()), Suffix::Kilobyte), (KubeQuantity("500M".into()), Suffix::Megabyte), (KubeQuantity("500G".into()), Suffix::Gigabyte), (KubeQuantity("500T".into()), Suffix::Terabyte), (KubeQuantity("500P".into()), Suffix::Petabyte), (KubeQuantity("500E".into()), Suffix::Exabyte), (KubeQuantity("500Ki".into()), Suffix::Kibibyte), (KubeQuantity("500Mi".into()), Suffix::Mebibyte), (KubeQuantity("500Gi".into()), Suffix::Gibibyte), (KubeQuantity("500Ti".into()), Suffix::Tebibyte), (KubeQuantity("500Pi".into()), Suffix::Pebibyte), (KubeQuantity("500Ei".into()), Suffix::Exbibyte), ]; for (quantity, expected) in all_suffixes { let parsed = get_suffix(&quantity); assert_eq!(parsed, expected, "Expected parsed suffix to equal expected"); } }
rust_cleaned_test_functions.jsonl/51863
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 598 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 8337, 37151, 288, 368, 341, 286, 1077, 678, 37151, 288, 284, 7486, 90515, 310, 320, 42, 3760, 17342, 445, 20, 15, 15, 76, 3263, 18122, 11858, 328, 13554, 486, 59232, 415, 5584, 1326, 310, 320, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_net_unreachable() { // Receive an IP packet for an unreachable destination address. Check to // make sure that we respond with the appropriate ICMP message. test_receive_ip_packet::<Ipv4, _, _, _, _>( |_| {}, &mut [0u8; 128], Ipv4Addr::new([1, 2, 3, 4]), 64, IpProto::Udp, &["send_icmpv4_net_unreachable", "send_icmp_error_message"], Some(( IcmpDestUnreachable::default(), Icmpv4DestUnreachableCode::DestNetworkUnreachable, )), // ensure packet is truncated to the right length |packet| assert_eq!(packet.original_packet().bytes().len(), 84), ); test_receive_ip_packet::<Ipv6, _, _, _, _>( |_| {}, &mut [0u8; 128], Ipv6Addr::new([1, 2, 3, 4, 5, 6, 7, 8, 1, 2, 3, 4, 5, 6, 7, 8]), 64, IpProto::Udp, &["send_icmpv6_net_unreachable", "send_icmp_error_message"], Some((IcmpDestUnreachable::default(), Icmpv6DestUnreachableCode::NoRoute)), // ensure packet is truncated to the right length |packet| assert_eq!(packet.original_packet().bytes().len(), 168), ); }
rust_cleaned_test_functions.jsonl/122961
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 687 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 19722, 4907, 46550, 368, 341, 286, 442, 37422, 458, 6790, 10151, 369, 458, 69322, 9106, 2621, 13, 4248, 311, 198, 286, 442, 1281, 2704, 429, 582, 5889, 448, 279, 8311, 83988, 1943, 624, 286, 127...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_probe() { crate::init().unwrap(); let (major, minor, micro, _) = crate::version(); let pad = crate::Pad::new(Some("src"), crate::PadDirection::Src); let events = Arc::new(Mutex::new(Vec::new())); let buffers = Arc::new(Mutex::new(Vec::new())); let flow_override = if (major, minor, micro) >= (1, 16, 1) { Err(FlowError::Eos) } else { Ok(FlowSuccess::Ok) }; { let events = events.clone(); pad.add_probe(crate::PadProbeType::EVENT_DOWNSTREAM, move |_, info| { if let Some(PadProbeData::Event(event)) = &info.data { let mut events = events.lock().unwrap(); events.push(event.clone()); } else { unreachable!(); } crate::PadProbeReturn::Ok }); } { let events = events.clone(); pad.add_probe(crate::PadProbeType::EVENT_UPSTREAM, move |_, info| { if let Some(PadProbeData::Event(event)) = info.data.take() { let mut events = events.lock().unwrap(); events.push(event); } else { unreachable!(); } crate::PadProbeReturn::Handled }); } { let buffers = buffers.clone(); let flow_override = flow_override; pad.add_probe(crate::PadProbeType::BUFFER, move |_, info| { if let Some(PadProbeData::Buffer(buffer)) = info.data.take() { let mut buffers = buffers.lock().unwrap(); info.flow_res = if buffers.is_empty() { Ok(FlowSuccess::Ok) } else { flow_override }; buffers.push(buffer); } else { unreachable!(); } crate::PadProbeReturn::Handled }); } pad.set_active(true).unwrap(); assert!( pad.send_event(crate::event::Latency::new(crate::ClockTime::from_nseconds( 10 ))) ); assert!(pad.push_event(crate::event::StreamStart::new("test"))); let segment = crate::FormattedSegment::<crate::ClockTime>::new(); assert!(pad.push_event(crate::event::Segment::new(segment.as_ref()))); assert_eq!(pad.push(crate::Buffer::new()), Ok(FlowSuccess::Ok)); assert_eq!(pad.push(crate::Buffer::new()), flow_override); let events = events.lock().unwrap(); let buffers = buffers.lock().unwrap(); assert_eq!(events.len(), 3); assert_eq!(buffers.len(), 2); assert_eq!(events[0].type_(), crate::EventType::Latency); assert_eq!(events[1].type_(), crate::EventType::StreamStart); assert_eq!(events[2].type_(), crate::EventType::Segment); assert!( buffers.iter().all(|b| b.is_writable()), "A buffer ref leaked!" ); drop(pad); // Need to drop the pad first to unref sticky events assert!( events.iter().all(|e| e.is_writable()), "An event ref leaked!" ); }
rust_cleaned_test_functions.jsonl/4738
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1805 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 49108, 368, 341, 286, 17717, 486, 2327, 1005, 15454, 1428, 286, 1077, 320, 36505, 11, 8922, 11, 8003, 11, 27439, 284, 17717, 486, 4366, 543, 286, 1077, 11016, 284, 17717, 486, 13731, 486, 931, 6...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
6
#[test] fn test_vrna_eval() { let sequence = "GGGUUUGCGGUGUAAGUGCAGCCCGUCUUACACCGUGCGGCACAGGCACUAGUACUGAUGUCGUAUACAGGGCUUUUGACAU"; let vc = VCompound::new(sequence); // MFE structure: // minimum free energy = -25.80 kcal/mol let pt = Array1::from_vec(vec![ 82, 24, 23, 22, 21, 20, 0, 19, 18, 17, 0, 0, 0, 0, 0, 0, 0, 9, 8, 7, 5, 4, 3, 2, 1, 80, 79, 78, 0, 0, 0, 0, 0, 71, 70, 66, 65, 64, 63, 62, 61, 60, 59, 57, 56, 55, 0, 0, 0, 0, 0, 0, 0, 0, 0, 45, 44, 43, 0, 42, 41, 40, 39, 38, 37, 36, 35, 0, 0, 0, 34, 33, 0, 0, 0, 0, 0, 0, 27, 26, 25, 0, 0, ]); assert_eq!(-25.8f64, vc.evaluate_structure_f64(pt.view())); }
rust_cleaned_test_functions.jsonl/10738
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 436 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2273, 89231, 21296, 368, 341, 286, 1077, 8500, 4035, 310, 330, 22254, 54695, 52, 2941, 8798, 38, 2941, 17782, 1890, 60902, 1890, 3706, 8798, 5459, 86564, 1706, 1706, 8798, 2941, 8798, 22863, 1706, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_contains() { let mut cache = LruCache::new(2); cache.put("apple", "red"); cache.put("banana", "yellow"); cache.put("pear", "green"); assert!(!cache.contains(&"apple")); assert!(cache.contains(&"banana")); assert!(cache.contains(&"pear")); }
rust_cleaned_test_functions.jsonl/77937
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 159 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 63598, 368, 341, 286, 1077, 5206, 6500, 284, 444, 2672, 8233, 486, 931, 7, 17, 626, 286, 6500, 3597, 445, 22377, 497, 330, 1151, 797, 286, 6500, 3597, 445, 87747, 497, 330, 27869, 797, 286, 65...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_bcrypt_sha256() { let django = Django { version: DjangoVersion::V1_9, }; let encoded = django.make_password_with_settings("lètmein", "", Algorithm::BCryptSHA256); assert!(is_password_usable(&encoded)); assert!(encoded.starts_with("bcrypt_sha256$")); assert!(check_password("lètmein", &encoded).unwrap()); assert!(!check_password("lètmeinz", &encoded).unwrap()); // Verify that password truncation no longer works let password = "VSK0UYV6FFQVZ0KG88DYN9WADAADZO1CTSIVDJUNZSUML6IBX7LN7ZS3R5JGB3RGZ7VI7G7DJQ9NI8\ BQFSRPTG6UWTTVESA5ZPUN"; let trunc_encoded = django.make_password_with_settings(password, "", Algorithm::BCryptSHA256); assert!(check_password(password, &trunc_encoded).unwrap()); assert!(!check_password(&password[0..72], &trunc_encoded).unwrap()); // Blank passwords let blank_encoded = django.make_password_with_settings("", "", Algorithm::BCryptSHA256); assert!(is_password_usable(&blank_encoded)); assert!(blank_encoded.starts_with("bcrypt_sha256$")); assert!(check_password("", &blank_encoded).unwrap()); assert!(!check_password(" ", &blank_encoded).unwrap()); }
rust_cleaned_test_functions.jsonl/104132
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 505 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 880, 48125, 48836, 17, 20, 21, 368, 341, 262, 1077, 8262, 284, 52604, 341, 286, 2319, 25, 52604, 5637, 486, 53, 16, 62, 24, 345, 262, 2605, 262, 1077, 20498, 284, 8262, 10117, 10122, 6615, 108...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_compose() { let scale = scale_transform(2.0, 3.0); let translate = translate_transform(1.0, 10.0); assert_eq!(apply(compose(translate, scale), [5.0, 7.0]), [11.0, 31.0]); assert_eq!(apply(compose(scale, translate), [5.0, 7.0]), [12.0, 51.0]); }
rust_cleaned_test_functions.jsonl/39373
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 188 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2965, 2900, 368, 341, 286, 1077, 5452, 284, 5452, 18449, 7, 17, 13, 15, 11, 220, 18, 13, 15, 317, 286, 1077, 14683, 284, 14683, 18449, 7, 16, 13, 15, 11, 220, 16, 15, 13, 15, 317, 286, 2...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_dad_b_carry() { let mut state = State8080::empty_state(); state.memory = vec![0x09]; state.b = 0xff; state.c = 0xff; state.h = 0x00; state.l = 0x02; emulate_8080_op(&mut state); assert_eq!(state.b, 0xff); assert_eq!(state.c, 0xff); assert_eq!(state.h, 0x00); assert_eq!(state.l, 0x01); assert_eq!(state.cc.cy, 1); }
rust_cleaned_test_functions.jsonl/7760
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 248 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 814, 329, 880, 666, 11433, 368, 341, 286, 1077, 5206, 1584, 284, 3234, 23, 15, 23, 15, 486, 3194, 4387, 543, 286, 1584, 36611, 284, 7486, 20703, 15, 87, 15, 24, 935, 286, 1584, 948, 284, 220...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_deep_nesting_group() { fn build_and_roundtrip(depth: usize) -> Result<(), prost::DecodeError> { use crate::groups::{nested_group2::OptionalGroup, NestedGroup2}; let mut a = NestedGroup2::default(); for _ in 0..depth { a = NestedGroup2 { optionalgroup: Some(Box::new(OptionalGroup { nested_group: Some(a), })), }; } let mut buf = Vec::new(); a.encode(&mut buf).unwrap(); NestedGroup2::decode(&*buf).map(|_| ()) } assert!(build_and_roundtrip(50).is_ok()); assert!(build_and_roundtrip(51).is_err()); }
rust_cleaned_test_functions.jsonl/8854
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 401 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 87044, 1089, 59855, 6288, 368, 341, 286, 5168, 1936, 8378, 29896, 32981, 53675, 25, 22301, 8, 1464, 5714, 68843, 35221, 486, 32564, 1454, 29, 341, 310, 990, 17717, 486, 16753, 22964, 59271, 6288, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_heapsizeof() { use heapsize::HeapSizeOf; let h = H128::zero(); assert_eq!(h.heap_size_of_children(),0); }
rust_cleaned_test_functions.jsonl/123492
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 68 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 33059, 10318, 368, 341, 197, 41819, 17364, 2141, 486, 27909, 1695, 2124, 280, 197, 10217, 305, 284, 472, 16, 17, 23, 486, 14154, 543, 197, 6948, 10714, 10297, 71, 77147, 2368, 3575, 31206, 1507, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_get_network() { let temp_config = Config::new( String::from("goodday"), Option::Some(String::from("127.0.0.1:8081")), ); assert_eq!(temp_config.get_network(), "127.0.0.1:8081"); }
rust_cleaned_test_functions.jsonl/123545
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 134 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 3062, 20966, 368, 341, 286, 1077, 2730, 5332, 284, 5532, 486, 931, 1006, 310, 923, 486, 1499, 445, 18536, 1292, 4461, 310, 6959, 486, 8373, 2242, 486, 1499, 445, 16, 17, 22, 13, 15, 13, 15, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_fetch() { assert_eq!( Opt { force: false, verbose: 3, cmd: Sub::Fetch {} }, Opt::parse_from(&["test", "-vvv", "fetch"]) ); assert_eq!( Opt { force: true, verbose: 0, cmd: Sub::Fetch {} }, Opt::parse_from(&["test", "--force", "fetch"]) ); }
rust_cleaned_test_functions.jsonl/46408
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 242 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 11803, 368, 341, 262, 2060, 10714, 33673, 286, 16554, 341, 310, 5344, 25, 895, 345, 310, 13694, 25, 220, 18, 345, 310, 5439, 25, 3719, 486, 20714, 5613, 286, 1153, 286, 16554, 486, 6400, 5673, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_registration_query() { assert_eq!(registration_query("", ""), format!("{}..", CONFIG_KEY_REGISTRATIONS)); assert_eq!( registration_query("a-b", "c-d"), format!("{}.a-b.c-d", CONFIG_KEY_REGISTRATIONS) ); assert_eq!( registration_query("a.b", "c.d"), format!("{}.a%2Eb.c%2Ed", CONFIG_KEY_REGISTRATIONS) ); assert_eq!( registration_query("a%b", "c%d"), format!("{}.a%25b.c%25d", CONFIG_KEY_REGISTRATIONS) ); }
rust_cleaned_test_functions.jsonl/98260
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 310 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 49101, 5738, 368, 341, 286, 2060, 10714, 10297, 25862, 5738, 19814, 77130, 3561, 17223, 6257, 496, 497, 13202, 6600, 8064, 29503, 21792, 1106, 286, 2060, 10714, 33673, 310, 12227, 5738, 445, 64, 145...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_serde() { let strings = ["3", "4+4", "21^(2*2)--3>5||!true"]; for string in &strings { let manual_tree = build_operator_tree(string).unwrap(); let serde_tree: Node = ron::de::from_str(&format!("\"{}\"", string)).unwrap(); assert_eq!(manual_tree.eval(), serde_tree.eval()); } }
rust_cleaned_test_functions.jsonl/105356
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 155 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 75861, 450, 368, 341, 262, 1077, 9069, 284, 4383, 18, 497, 330, 19, 10, 19, 497, 330, 17, 16, 13268, 17, 9, 17, 29621, 18, 29, 20, 8484, 0, 1866, 31797, 262, 369, 914, 304, 609, 18594, 341...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_binop() { test_roundtrip("null + null"); test_roundtrip("1 + 1"); test_roundtrip("1 * 2 + (3 + 4)"); test_roundtrip("1 ** 2 ** 3 ** 4"); test_roundtrip("1 in 2 + (2 - 4) / 3"); test_roundtrip("1 instanceof 2 + (2 - 4) / 3"); }
rust_cleaned_test_functions.jsonl/102589
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 125 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21816, 453, 368, 341, 262, 1273, 29896, 32981, 445, 2921, 488, 845, 797, 262, 1273, 29896, 32981, 445, 16, 488, 220, 16, 797, 262, 1273, 29896, 32981, 445, 16, 353, 220, 17, 488, 320, 18, 488,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_that_pop_actually_detaches_node() { let mut cache = LruCache::new(5); cache.put("a", 1); cache.put("b", 2); cache.put("c", 3); cache.put("d", 4); cache.put("e", 5); assert!(cache.contains(&"c")); assert_eq!(cache.pop(&"c"), Some(3)); assert!(!cache.contains(&"c")); cache.put("f", 6); let mut iter = cache.iter(); assert_opt_eq_tuple(iter.next(), ("f", 6)); assert_opt_eq_tuple(iter.next(), ("e", 5)); assert_opt_eq_tuple(iter.next(), ("d", 4)); assert_opt_eq_tuple(iter.next(), ("b", 2)); assert_opt_eq_tuple(iter.next(), ("a", 1)); assert!(iter.next().is_none()); }
rust_cleaned_test_functions.jsonl/77942
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 377 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 70197, 17061, 29370, 1832, 24409, 14242, 5084, 368, 341, 286, 1077, 5206, 6500, 284, 444, 2672, 8233, 486, 931, 7, 20, 626, 286, 6500, 3597, 445, 64, 497, 220, 16, 317, 286, 6500, 3597, 445, 6...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_scm_credentials() { use libc; use nix::sys::uio::IoVec; use nix::unistd::{close, getpid, getuid, getgid}; use nix::sys::socket::{socketpair, sendmsg, recvmsg, setsockopt, AddressFamily, SockType, SockFlag, ControlMessage, CmsgSpace, MsgFlags}; use nix::sys::socket::sockopt::PassCred; let (send, recv) = socketpair(AddressFamily::Unix, SockType::Stream, None, SockFlag::empty()) .unwrap(); setsockopt(recv, PassCred, &true).unwrap(); { let iov = [IoVec::from_slice(b"hello")]; let cred = libc::ucred { pid: getpid().as_raw(), uid: getuid().as_raw(), gid: getgid().as_raw(), }; let cmsg = ControlMessage::ScmCredentials(&cred); assert_eq!(sendmsg(send, &iov, &[cmsg], MsgFlags::empty(), None).unwrap(), 5); close(send).unwrap(); } { let mut buf = [0u8; 5]; let iov = [IoVec::from_mut_slice(&mut buf[..])]; let mut cmsgspace: CmsgSpace<libc::ucred> = CmsgSpace::new(); let msg = recvmsg(recv, &iov, Some(&mut cmsgspace), MsgFlags::empty()).unwrap(); let mut received_cred = None; for cmsg in msg.cmsgs() { if let ControlMessage::ScmCredentials(cred) = cmsg { assert!(received_cred.is_none()); assert_eq!(cred.pid, getpid().as_raw()); assert_eq!(cred.uid, getuid().as_raw()); assert_eq!(cred.gid, getgid().as_raw()); received_cred = Some(*cred); } else { panic!("unexpected cmsg"); } } received_cred.expect("no creds received"); assert!(!msg.flags.intersects(MsgFlags::MSG_TRUNC | MsgFlags::MSG_CTRUNC)); close(recv).unwrap(); } }
rust_cleaned_test_functions.jsonl/44198
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 960 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 643, 6226, 47396, 368, 341, 262, 990, 42142, 280, 262, 990, 308, 941, 486, 7791, 486, 84, 815, 486, 42799, 10050, 280, 262, 990, 308, 941, 486, 27483, 22964, 5552, 11, 95378, 11, 633, 2423, 11...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_338() { assert_eq!(Solution::count_bits(2), vec![0, 1, 1]); assert_eq!(Solution::count_bits(5), vec![0, 1, 1, 2, 1, 2]); }
rust_cleaned_test_functions.jsonl/123843
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 88 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 62, 18, 18, 23, 368, 341, 286, 2060, 10714, 10297, 36842, 486, 1830, 20034, 7, 17, 701, 7486, 20703, 15, 11, 220, 16, 11, 220, 16, 2558, 286, 2060, 10714, 10297, 36842, 486, 1830, 20034, 7, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_int_counter() { let counter = IntCounter::new("foo", "bar").unwrap(); counter.inc(); assert_eq!(counter.get(), 1); counter.inc_by(11); assert_eq!(counter.get(), 12); let mut mfs = counter.collect(); assert_eq!(mfs.len(), 1); let mf = mfs.pop().unwrap(); let m = mf.get_metric().get(0).unwrap(); assert_eq!(m.get_label().len(), 0); assert_eq!(m.get_counter().get_value() as u64, 12); counter.reset(); assert_eq!(counter.get() as u64, 0); }
rust_cleaned_test_functions.jsonl/46516
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 284 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 4042, 15730, 368, 341, 286, 1077, 5546, 284, 1333, 14099, 486, 931, 445, 7975, 497, 330, 2257, 1827, 15454, 543, 286, 5546, 26797, 543, 286, 2060, 10714, 10297, 8292, 670, 1507, 220, 16, 317, 28...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_latex() { let gate = Y::new(); let mut state = LatexExportState::new(1, 0); assert_eq!(gate.latex(&[0], &mut state), Ok(())); assert_eq!(state.code(), r#"\Qcircuit @C=1em @R=.7em { \lstick{\ket{0}} & \gate{Y} & \qw \\ } "#); }
rust_cleaned_test_functions.jsonl/21205
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 160 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 26174, 327, 741, 262, 341, 286, 1077, 18126, 284, 809, 486, 931, 543, 286, 1077, 5206, 1584, 284, 9926, 327, 16894, 1397, 486, 931, 7, 16, 11, 220, 15, 317, 286, 2060, 10714, 10297, 24601, 286...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_shred_type_compat() { assert_eq!(std::mem::size_of::<ShredType>(), std::mem::size_of::<u8>()); assert_eq!(ShredType::from_u8(0), None); assert_eq!(ShredType::from_u8(1), None); assert_matches!(bincode::deserialize::<ShredType>(&[0u8]), Err(_)); // data shred assert_eq!(ShredType::Data as u8, 0b1010_0101); assert_eq!(ShredType::from_u8(0b1010_0101), Some(ShredType::Data)); let buf = bincode::serialize(&ShredType::Data).unwrap(); assert_eq!(buf, vec![0b1010_0101]); assert_matches!( bincode::deserialize::<ShredType>(&[0b1010_0101]), Ok(ShredType::Data) ); // coding shred assert_eq!(ShredType::Code as u8, 0b0101_1010); assert_eq!(ShredType::from_u8(0b0101_1010), Some(ShredType::Code)); let buf = bincode::serialize(&ShredType::Code).unwrap(); assert_eq!(buf, vec![0b0101_1010]); assert_matches!( bincode::deserialize::<ShredType>(&[0b0101_1010]), Ok(ShredType::Code) ); }
rust_cleaned_test_functions.jsonl/125660
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 576 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 3712, 1151, 1819, 89602, 368, 341, 286, 2060, 10714, 10297, 1834, 486, 10536, 486, 2141, 3575, 27638, 2016, 1151, 929, 39019, 1460, 486, 10536, 486, 2141, 3575, 27638, 84, 23, 32872, 286, 2060, 10...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_logical() { test_roundtrip("a && b || c"); test_roundtrip("a || b && c"); test_roundtrip("(a || b) && c"); test_roundtrip("(a || b) ?? c"); test_roundtrip("(a ?? b) || c"); }
rust_cleaned_test_functions.jsonl/102595
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 101 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 86484, 368, 341, 262, 1273, 29896, 32981, 445, 64, 1009, 293, 1369, 272, 797, 262, 1273, 29896, 32981, 445, 64, 1369, 293, 1009, 272, 797, 262, 1273, 29896, 32981, 31732, 64, 1369, 293, 8, 1009,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_success() { let output = "{\"success\":true}"; let o: Result<Success, serde_json::error::Error> = serde_json::from_str(output); assert!(o.is_ok()); }
rust_cleaned_test_functions.jsonl/56066
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 93 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 18632, 368, 341, 286, 1077, 2550, 284, 54734, 5630, 11693, 1866, 26259, 286, 1077, 297, 25, 5714, 27, 7188, 11, 61570, 9455, 486, 841, 486, 1454, 29, 284, 61570, 9455, 486, 1499, 2895, 11057, 31...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_mark_read_non_existing_post() { let readlist = readlist_from(vec![ ("feed1", vec!["post1", "post2"]), ("feed2", vec!["post3", "post5"]), ]); let output = _mark_read(readlist.clone(), "post4"); assert_eq!(readlist, output); }
rust_cleaned_test_functions.jsonl/56105
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 157 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 18924, 6443, 21637, 62630, 6333, 368, 341, 286, 1077, 1349, 1607, 284, 1349, 1607, 5673, 25592, 90515, 310, 3489, 11184, 16, 497, 7486, 0, 1183, 2203, 16, 497, 330, 2203, 17, 46442, 310, 3489, 1...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_region_new() { let region = Region::new(RegionType::CacheFast); assert_eq!(region.status, RegionStatus::Init); assert!(!region.has_user_io()); assert!(region.seg.is_empty()); assert_eq!(region.chunks.len(), 0); assert_eq!(region.tags.len(), 0); assert_eq!(region.blob_address, 0); assert_eq!(region.blob_len, 0); }
rust_cleaned_test_functions.jsonl/130989
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 194 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 20627, 5921, 368, 341, 286, 1077, 5537, 284, 17152, 486, 931, 7, 14091, 929, 486, 8233, 32174, 626, 286, 2060, 10714, 10297, 3943, 4299, 11, 17152, 2522, 486, 3803, 317, 286, 2060, 0, 3471, 3943...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_set_c() { let mut cpu: CPU = CPU::new(); let pc = cpu.pc; cpu = cpu.set_c(Register { value: 0 }); cpu.memory.write_64bit(1, 10); cpu = execute_set(cpu, pc, 0b010); assert_eq!(cpu.pc.value, 9); assert_eq!(cpu.f.value, 0); assert_eq!(cpu.c.value, 10); }
rust_cleaned_test_functions.jsonl/123554
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 185 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2602, 666, 368, 341, 286, 1077, 5206, 17319, 25, 13940, 284, 13940, 486, 931, 543, 286, 1077, 13312, 284, 17319, 53335, 401, 286, 17319, 284, 17319, 980, 666, 79203, 314, 897, 25, 220, 15, 1625,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_pull_assignment_up_not_last_not_applicable() { check_assist_not_applicable( pull_assignment_up, r#" fn foo() { let mut a = 1; if true { $0a = 2; b = a; } else { a = 3; } }"#, ) }
rust_cleaned_test_functions.jsonl/117255
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 175 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 65693, 51891, 8237, 7913, 12195, 7913, 8191, 46114, 368, 341, 286, 1779, 12083, 380, 7913, 8191, 46114, 1006, 310, 6815, 51891, 8237, 345, 310, 435, 2, 698, 8822, 15229, 368, 341, 262, 1077, 5206,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_functions_keys() -> anyhow::Result<()> { let func1 = new_null_func(S3X_AMZ_COPY_SOURCE, ValueSet::new(vec![Value::Bool(true)]))?; let func2 = new_ip_address_func( AWS_SOURCE_IP, ValueSet::new(vec![Value::String("192.168.1.0/24".to_string())]), )?; let func3 = new_string_equals_func( S3X_AMZ_COPY_SOURCE, ValueSet::new(vec![Value::String("mybucket/myobject".to_string())]), )?; let func4 = new_string_like_func( S3X_AMZ_COPY_SOURCE, ValueSet::new(vec![Value::String("mybucket/myobject".to_string())]), )?; let cases = [( Functions::new(vec![func1, func2, func3, func4]), KeySet::from([S3X_AMZ_COPY_SOURCE, AWS_SOURCE_IP]), )]; for (key, expected_result) in cases { let result = key.keys(); assert_eq!( result, expected_result, "key: '{}', expected: {:?}, got: {:?}", key, expected_result, result ); } Ok(()) }
rust_cleaned_test_functions.jsonl/29806
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 614 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 31708, 12631, 368, 1464, 88964, 486, 2077, 71698, 341, 286, 1077, 2915, 16, 284, 501, 15162, 9596, 3759, 18, 55, 25022, 57, 35556, 25430, 11, 5162, 1649, 486, 931, 25592, 20703, 1130, 486, 11233, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
6
#[test] fn test_encode() { let input = b"Burning 'em, if you ain't quick and nimble I go crazy when I hear a cymbal"; let output = String::from("0b3637272a2b2e63622c2e69692a23693a2a3c6324202d623d63343c2a26226324272765272a282b2f20430a652e2c652a3124333a653e2b2027630c692b20283165286326302e27282f"); assert_eq!(bytes_to_hex_string(&encode(&input.to_vec(), &b"ICE".to_vec())), output); }
rust_cleaned_test_functions.jsonl/51160
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 204 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 11224, 368, 341, 286, 1077, 1946, 284, 293, 63590, 53344, 364, 336, 11, 421, 498, 36102, 944, 3974, 323, 45692, 891, 198, 40, 728, 14264, 979, 358, 6723, 264, 272, 3356, 278, 876, 286, 1077, 2...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_mat_times_identity_equals_identity_times_mat() { test_cases().iter().for_each(|test| { let a_mat_times_identity = test.a_mat * Matrix2x2::identity(); let identity_times_a_mat = Matrix2x2::identity() * test.a_mat; let b_mat_times_identity = test.b_mat * Matrix2x2::identity(); let identity_times_b_mat = Matrix2x2::identity() * test.b_mat; assert_eq!(a_mat_times_identity, identity_times_a_mat); assert_eq!(b_mat_times_identity, identity_times_b_mat); }) }
rust_cleaned_test_functions.jsonl/128959
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 280 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 16610, 22353, 46244, 61664, 46244, 22353, 16610, 368, 341, 286, 1273, 41427, 1005, 2015, 1005, 1958, 32046, 22428, 1944, 91, 341, 310, 1077, 264, 16610, 22353, 46244, 284, 1273, 5849, 16610, 353, 11...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_data_attributes() { use crate as typed_html; use crate::dom::DOMTree; let frag: DOMTree<String> = html!(<div data-id="1234">"Boo!"</div>); assert_eq!("<div data-id=\"1234\">Boo!</div>", frag.to_string()); }
rust_cleaned_test_functions.jsonl/24614
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 107 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 1769, 18240, 368, 341, 262, 990, 17717, 438, 31969, 9564, 280, 262, 990, 17717, 486, 5600, 486, 15242, 6533, 401, 262, 1077, 8343, 25, 18051, 6533, 3464, 29, 284, 5272, 10297, 27, 611, 821, 1289...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_builder_finish() { let mut b = Int32BufferBuilder::new(5); assert_eq!(16, b.capacity()); for i in 0..10 { b.append(i); } let mut a = b.finish(); assert_eq!(40, a.len()); assert_eq!(0, b.len()); assert_eq!(0, b.capacity()); // Try build another buffer after cleaning up. for i in 0..20 { b.append(i) } assert_eq!(32, b.capacity()); a = b.finish(); assert_eq!(80, a.len()); }
rust_cleaned_test_functions.jsonl/74109
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 293 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 28532, 42980, 368, 341, 286, 1077, 5206, 293, 284, 1333, 18, 17, 4095, 3297, 486, 931, 7, 20, 317, 286, 2060, 10714, 10297, 16, 21, 11, 293, 59168, 1423, 286, 369, 600, 304, 220, 15, 496, 16...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_end_training_selected_participant_no_success() { let mut protocol = Protocol::new(get_default_fl_settings()); let client_id = ClientId::new(); protocol.counters = Counters { waiting: 0, selected: 2, done: 5, done_and_inactive: 3, ignored: 2, }; protocol.end_training(client_id, false, ClientState::Selected); let counters = protocol.counters(); let expected = Counters { waiting: 0, selected: 1, done: 5, done_and_inactive: 3, ignored: 3, }; assert_eq!(counters, expected); assert_eq!( protocol.next_event().unwrap(), Event::SetState(client_id, ClientState::Ignored) ); assert!(protocol.next_event().is_none()); }
rust_cleaned_test_functions.jsonl/97787
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 445 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6213, 32891, 23755, 10495, 21757, 6536, 18632, 368, 341, 286, 1077, 5206, 11507, 284, 24572, 486, 931, 5433, 9993, 5081, 10853, 1423, 286, 1077, 2943, 842, 284, 8423, 764, 486, 931, 543, 286, 1150...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_cast_i32_utf8() -> Result<()> { generic_test_cast!( Int32Array, DataType::Int32, vec![1, 2, 3, 4, 5], StringArray, DataType::Utf8, vec![Some("1"), Some("2"), Some("3"), Some("4"), Some("5")], DEFAULT_DATAFUSION_CAST_OPTIONS ); Ok(()) }
rust_cleaned_test_functions.jsonl/57555
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 223 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 5303, 5318, 18, 17, 39453, 23, 368, 1464, 5714, 71698, 341, 286, 13954, 4452, 5303, 33673, 310, 1333, 18, 17, 1857, 345, 310, 33172, 486, 1072, 18, 17, 345, 310, 7486, 20703, 16, 11, 220, 17, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_none_this_week() { let metric = Metric { id: Some("1".to_string()), habit: "2".to_string(), user: "3".to_string(), time: Some(100) }; let stats = into_weekly_figures(&vec![metric]); assert_eq!(Stats { success: 0 }, stats); }
rust_cleaned_test_functions.jsonl/117602
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 197 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 31488, 24868, 31277, 368, 341, 286, 1077, 18266, 284, 52458, 341, 310, 877, 25, 4329, 445, 16, 3263, 983, 3904, 14702, 310, 14132, 25, 330, 17, 3263, 983, 3904, 3148, 310, 1196, 25, 330, 18, 3...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_parse_headers() { match parse_http_headers("Host: 127.0.0.1\r\nUser-Agent: Mozilla/5.0 (Macintosh; Intel Mac OS X 10.9; rv:50.0) Gecko/20100101 Firefox/50.0\r\n") { Ok((_, hdrs)) => { let mut headers = Headers::new(); headers.push(("Host".to_string(), "127.0.0.1".to_string())); headers.push(("User-Agent".to_string(), "Mozilla/5.0 (Macintosh; Intel Mac OS X 10.9; rv:50.0) Gecko/20100101 Firefox/50.0".to_string())); assert!(compare_vec(&hdrs, &headers)); }, Err(_e) => {}, }; }
rust_cleaned_test_functions.jsonl/50870
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 361 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21039, 26719, 368, 341, 286, 2432, 4715, 25888, 26719, 445, 9296, 25, 220, 16, 17, 22, 13, 15, 13, 15, 13, 16, 12016, 1699, 1474, 45118, 25, 34733, 14, 20, 13, 15, 320, 19552, 61594, 26, 156...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_fs_is_valid() { let mut a = Fs(MODULUS); assert!(!a.is_valid()); a.0.sub_noborrow(&FsRepr::from(1)); assert!(a.is_valid()); assert!(Fs(FsRepr::from(0)).is_valid()); assert!(!Fs(FsRepr([0xffffffffffffffff, 0xffffffffffffffff, 0xffffffffffffffff, 0xffffffffffffffff])).is_valid()); let mut rng = XorShiftRng::from_seed([0x5dbe6259, 0x8d313d76, 0x3237db17, 0xe5bc0654]); for _ in 0..1000 { let a = Fs::rand(&mut rng); assert!(a.is_valid()); } }
rust_cleaned_test_functions.jsonl/95510
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 261 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 34470, 6892, 8337, 368, 341, 262, 1077, 5206, 264, 284, 84619, 3189, 2069, 1094, 2034, 317, 262, 2060, 0, 3471, 64, 2079, 8337, 1423, 262, 264, 13, 15, 4309, 1089, 674, 7768, 2099, 48300, 693, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_fq2_inverse() { use super::fq::FqRepr; use PrimeField; assert!(Fq2::zero().inverse().is_none()); let a = Fq2 { c0: Fq::from_repr(FqRepr([ 0x85c9f989e1461f03, 0xa2e33c333449a1d6, 0x41e461154a7354a3, 0x9ee53e7e84d7532e, 0x1c202d8ed97afb45, 0x51d3f9253e2516f, ])).unwrap(), c1: Fq::from_repr(FqRepr([ 0xa7348a8b511aedcf, 0x143c215d8176b319, 0x4cc48081c09b8903, 0x9533e4a9a5158be, 0x7a5e1ecb676d65f9, 0x180c3ee46656b008, ])).unwrap(), }; let a = a.inverse().unwrap(); assert_eq!( a, Fq2 { c0: Fq::from_repr(FqRepr([ 0x70300f9bcb9e594, 0xe5ecda5fdafddbb2, 0x64bef617d2915a8f, 0xdfba703293941c30, 0xa6c3d8f9586f2636, 0x1351ef01941b70c4 ])).unwrap(), c1: Fq::from_repr(FqRepr([ 0x8c39fd76a8312cb4, 0x15d7b6b95defbff0, 0x947143f89faedee9, 0xcbf651a0f367afb2, 0xdf4e54f0d3ef15a6, 0x103bdf241afb0019 ])).unwrap(), } ); }
rust_cleaned_test_functions.jsonl/130065
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 944 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 761, 80, 17, 63333, 368, 341, 262, 990, 2256, 486, 63919, 486, 37, 80, 693, 649, 280, 262, 990, 12518, 1877, 401, 262, 2060, 10297, 37, 80, 17, 486, 14154, 1005, 61482, 1005, 285, 31488, 5231,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_builder_no_inline() { let expected = EmbedField { inline: false, name: "name".to_owned(), value: "value".to_owned(), }; let actual = EmbedFieldBuilder::new("name", "value").build(); assert_eq!(actual, expected); }
rust_cleaned_test_functions.jsonl/62786
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 150 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 28532, 6536, 41871, 368, 341, 286, 1077, 3601, 284, 37068, 1877, 341, 310, 7381, 25, 895, 345, 310, 829, 25, 330, 606, 3263, 983, 51973, 3148, 310, 897, 25, 330, 957, 3263, 983, 51973, 3148, 2...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_fold_after_tab_as_word_boundary() { new_ucmd!() .args(&["-w10", "-s"]) .pipe_in("a\tbbb\n") .succeeds() .stdout_is("a\t\nbbb\n"); }
rust_cleaned_test_functions.jsonl/23286
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 119 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 61187, 19844, 17344, 11898, 13533, 54004, 368, 341, 262, 501, 68887, 2277, 0, 741, 286, 659, 2116, 2099, 1183, 12, 86, 16, 15, 497, 6523, 82, 14108, 286, 659, 13768, 1243, 445, 64, 4955, 53151, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_cluster_nodes_broadcast() { let mut rng = rand::thread_rng(); let (nodes, stakes, cluster_info) = make_cluster(&mut rng); // ClusterInfo::tvu_peers excludes the node itself. assert_eq!(cluster_info.tvu_peers().len(), nodes.len() - 1); let cluster_nodes = ClusterNodes::<BroadcastStage>::new(&cluster_info, &stakes); // All nodes with contact-info should be in the index. // Excluding this node itself. assert_eq!(cluster_nodes.index.len() + 1, nodes.len()); // Staked nodes with no contact-info should be included. assert!(cluster_nodes.nodes.len() > nodes.len()); // Assert that all nodes keep their contact-info. { let cluster_nodes: HashMap<_, _> = cluster_nodes .nodes .iter() .map(|node| (node.pubkey(), node)) .collect(); for node in &nodes { assert_eq!(cluster_nodes[&node.id].contact_info().unwrap().id, node.id); } for (pubkey, stake) in &stakes { if *stake > 0 { assert_eq!(cluster_nodes[pubkey].stake, *stake); } } } let (peers, peers_and_stakes) = get_broadcast_peers(&cluster_info, Some(&stakes)); assert_eq!(peers_and_stakes.len(), peers.len()); assert_eq!(cluster_nodes.index.len(), peers.len()); for (i, node) in cluster_nodes .index .iter() .map(|(_, i)| &cluster_nodes.nodes[*i]) .enumerate() { let (stake, index) = peers_and_stakes[i]; assert_eq!(node.contact_info().unwrap(), &peers[index]); assert_eq!(node.stake.max(1), stake); } for _ in 0..100 { let mut shred_seed = [0u8; 32]; rng.fill(&mut shred_seed[..]); let index = weighted_best(&peers_and_stakes, shred_seed); let peer = cluster_nodes.get_broadcast_peer(shred_seed).unwrap(); assert_eq!(*peer, peers[index]); } }
rust_cleaned_test_functions.jsonl/18830
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1094 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 28441, 14896, 74923, 368, 341, 286, 1077, 5206, 28422, 284, 10382, 486, 4528, 66849, 543, 286, 1077, 320, 20008, 11, 44425, 11, 10652, 3109, 8, 284, 1281, 28441, 2099, 6984, 28422, 317, 286, 442, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
6
#[test] fn test_max_sum() { assert_eq!(max_sum(0), 0); assert_eq!(max_sum(1), 1); assert_eq!(max_sum(2), 1); assert_eq!(max_sum(3), 2); assert_eq!(max_sum(4), 2); assert_eq!(max_sum(5), 2); assert_eq!(max_sum(6), 3); assert_eq!(max_sum(7), 3); assert_eq!(max_sum(8), 3); assert_eq!(max_sum(9), 3); assert_eq!(max_sum(10), 4); assert_eq!(max_sum(5049), 99); assert_eq!(max_sum(5050), 100); assert_eq!(max_sum(5051), 100); assert_eq!(max_sum(5150), 100); assert_eq!(max_sum(5151), 101); }
rust_cleaned_test_functions.jsonl/2727
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 298 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6345, 10160, 368, 341, 262, 2060, 10714, 10297, 2810, 10160, 7, 15, 701, 220, 15, 317, 262, 2060, 10714, 10297, 2810, 10160, 7, 16, 701, 220, 16, 317, 262, 2060, 10714, 10297, 2810, 10160, 7, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_metrics_report_update_check_failure_reason_omaha() { block_on(async { let mut metrics_reporter = MockMetricsReporter::new(); let mut state_machine = StateMachineBuilder::new_stub() .metrics_reporter(&mut metrics_reporter) .build() .await; state_machine.run_once().await; assert!(metrics_reporter .metrics .contains(&Metrics::UpdateCheckFailureReason(UpdateCheckFailureReason::Omaha))); }); }
rust_cleaned_test_functions.jsonl/59689
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 283 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 37686, 14813, 8882, 7200, 43618, 38229, 62, 316, 13546, 368, 341, 286, 2504, 4470, 18285, 341, 310, 1077, 5206, 16734, 14813, 261, 284, 14563, 27328, 52766, 486, 931, 543, 310, 1077, 5206, 1584, 3...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_init_with_empty_state() { let initial_state_json: serde_json::Value = serde_json::from_str("{}").unwrap(); let value = Value::from_json(&initial_state_json); let (frontend, _) = Frontend::new_with_initial_state(value).unwrap(); let result_state = frontend.state().to_json(); assert_eq!(initial_state_json, result_state); }
rust_cleaned_test_functions.jsonl/75975
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 142 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6137, 6615, 15124, 4387, 368, 341, 262, 1077, 2856, 4387, 9455, 25, 61570, 9455, 486, 1130, 284, 61570, 9455, 486, 1499, 2895, 53430, 1827, 15454, 543, 262, 1077, 897, 284, 5162, 486, 1499, 9455, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_cpuset_systemd_too_old() -> Result<()> { let systemd_version = 235; let cpu = LinuxCpuBuilder::default() .build() .context("build cpu spec")?; let mut properties: HashMap<&str, Box<dyn RefArg>> = HashMap::new(); let result = CpuSet::apply(&cpu, systemd_version, &mut properties); assert!(result.is_err()); Ok(()) }
rust_cleaned_test_functions.jsonl/39170
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 191 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 90673, 295, 17687, 67, 2346, 78, 21108, 368, 1464, 5714, 71698, 341, 286, 1077, 74966, 9438, 284, 220, 17, 18, 20, 280, 286, 1077, 17319, 284, 14340, 34, 5584, 3297, 486, 2258, 741, 310, 659, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2