text
stringlengths
93
16.4k
id
stringlengths
20
40
metadata
dict
input_ids
listlengths
45
2.05k
attention_mask
listlengths
45
2.05k
complexity
int64
1
9
#[test] fn test_complete_1() { let square = Square::try_new(vec![8, 1, 6, 3, 5, 7]).unwrap(); assert!(square.is_magic()); square.render(); }
rust_cleaned_test_functions.jsonl/13908
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 74 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 27675, 62, 16, 368, 341, 262, 1077, 9334, 284, 15619, 486, 1539, 5921, 25592, 20703, 23, 11, 220, 16, 11, 220, 21, 11, 220, 18, 11, 220, 20, 11, 220, 22, 10697, 15454, 543, 262, 2060, 10297,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_deserialize_utc_date_time_overflows() { let _guard = LOCK.run_concurrently(); let t: i64 = 1_530_492_218 * 1_000 + 999; let mut raw0 = vec![0x09, b'A', 0x00]; raw0.write_all(&t.to_le_bytes()).unwrap(); let mut raw = vec![]; raw.write_all(&((raw0.len() + 4 + 1) as i32).to_le_bytes()) .unwrap(); raw.write_all(&raw0).unwrap(); raw.write_all(&[0]).unwrap(); let deserialized = Document::from_reader(&mut Cursor::new(raw)).unwrap(); let expected = doc! { "A": Utc.timestamp(1_530_492_218, 999 * 1_000_000)}; assert_eq!(deserialized, expected); }
rust_cleaned_test_functions.jsonl/49154
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 282 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 15768, 9050, 84259, 4164, 3009, 15431, 38140, 368, 341, 262, 1077, 716, 26098, 284, 49463, 7634, 3382, 58202, 543, 262, 1077, 259, 25, 600, 21, 19, 284, 220, 16, 62, 20, 18, 15, 62, 19, 24, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_encode_decode() { let txn_info = TransactionInfo::new( HashValue::random(), HashValue::random(), HashValue::random(), 7, StatusCode::EXECUTED, ); assert_encode_decode::<TransactionInfoSchema>(&0u64, &txn_info); }
rust_cleaned_test_functions.jsonl/89280
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 137 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 11224, 15227, 368, 341, 262, 1077, 49721, 3109, 284, 17869, 1731, 486, 931, 1006, 286, 6531, 1130, 486, 11463, 3148, 286, 6531, 1130, 486, 11463, 3148, 286, 6531, 1130, 486, 11463, 3148, 286, 220,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_request() { use helix::*; let req = GetStreamTagsRequest::builder() .broadcaster_id("198704263".to_string()) .build(); // From twitch docs let data = "\ {\n\ \"data\": [\n\ {\n\ \"tag_id\": \"621fb5bf-5498-4d8f-b4ac-db4d40d401bf\",\n\ \"is_auto\": false,\n\ \"localization_names\": {\n\ \"bg-bg\": \"Завършване без продължаване\",\n\ \"cs-cz\": \"Na jeden z&aacute;tah\",\n\ \"da-dk\": \"Continue klaret\"\n\ },\n\ \"localization_descriptions\": {\n\ \"bg-bg\": \"За потоци с акцент върху завършване на аркадна игра с монети, в която не се използва продължаване\",\n\ \"cs-cz\": \"Pro vys&iacute;l&aacute;n&iacute; s důrazem na plněn&iacute; mincov&yacute;ch ark&aacute;dov&yacute;ch her bez použit&iacute; pokračov&aacute;n&iacute;.\",\n\ \"da-dk\": \"Til streams med v&aelig;gt p&aring; at gennemf&oslash;re et arkadespil uden at bruge continues\"\n\ }\n\ },\n\ {\n\ \"tag_id\": \"79977fb9-f106-4a87-a386-f1b0f99783dd\",\n\ \"is_auto\": false,\n\ \"localization_names\": {\n\ \"bg-bg\": \"PvE\",\n\ \"cs-cz\": \"PvE\"\n\ },\n\ \"localization_descriptions\": {\n\ \"bg-bg\": \"За потоци с акцент върху PVE геймплей\",\n\ \"cs-cz\": \"Pro vys&iacute;l&aacute;n&iacute; s důrazem na hratelnost \\\"hr&aacute;č vs. prostřed&iacute;\\\".\",\n\ \"da-dk\": \"Til streams med v&aelig;gt p&aring; spil, hvor det er spilleren mod omgivelserne.\"\n\ }\n\ }\n\ ]\n\ }\n\ " .as_bytes().to_vec(); let http_response = http::Response::builder().body(data).unwrap(); let uri = req.get_uri().unwrap(); assert_eq!( uri.to_string(), "https://api.twitch.tv/helix/streams/tags?broadcaster_id=198704263" ); dbg!(GetStreamTagsRequest::parse_response(Some(req), &uri, http_response).unwrap()); }
rust_cleaned_test_functions.jsonl/96077
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1304 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 7893, 368, 341, 262, 990, 11338, 941, 56162, 262, 1077, 4232, 284, 2126, 3027, 15930, 1900, 486, 17850, 741, 286, 659, 65, 8546, 32020, 842, 445, 16, 24, 23, 22, 15, 19, 17, 21, 18, 3263, 98...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_virtual_alloc_free() { const SIZE: SIZE_T = 0x1000; let addr = unsafe { VirtualAlloc( std::ptr::null_mut(), SIZE, MEM_COMMIT | MEM_RESERVE, PAGE_READWRITE, ) }; assert!(addr != std::ptr::null_mut(), "VirtualAlloc failed"); let result = unsafe { VirtualFree(addr, 0, MEM_RELEASE) }; assert!(result != 0, "VirtualFree failed"); }
rust_cleaned_test_functions.jsonl/46650
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 263 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 58730, 14802, 8905, 368, 341, 286, 733, 25341, 25, 25341, 1139, 284, 220, 15, 87, 16, 15, 15, 15, 280, 286, 1077, 10789, 284, 19860, 341, 310, 20721, 25154, 1006, 394, 1460, 486, 3505, 486, 29...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_cond_deku() { let test_data: Vec<u8> = [0x01, 0x02].to_vec(); let ret_read = samples::CondDeku::try_from(test_data.as_ref()).unwrap(); assert_eq!( samples::CondDeku { field_a: 0x01, field_b: Some(0x02), }, ret_read ); let ret_write: Vec<u8> = ret_read.try_into().unwrap(); assert_eq!(test_data, ret_write); }
rust_cleaned_test_functions.jsonl/123233
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 217 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 24433, 2259, 12133, 368, 341, 262, 1077, 1273, 1769, 25, 11312, 34837, 23, 29, 284, 508, 15, 87, 15, 16, 11, 220, 15, 87, 15, 17, 936, 983, 13251, 1428, 262, 1077, 2112, 6443, 284, 10469, 48...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_statsd_client_gauge_f64() { let client = new_nop_client("client.test"); let expected = Gauge::new_f64("client.test.", "gauge.key", 5.5); assert_eq!(expected, client.gauge("gauge.key", 5.5).unwrap()); }
rust_cleaned_test_functions.jsonl/106613
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 107 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 15381, 67, 8179, 1889, 19392, 761, 21, 19, 368, 341, 262, 1077, 2943, 284, 501, 1089, 453, 8179, 445, 2972, 5958, 797, 262, 1077, 3601, 284, 72060, 486, 931, 761, 21, 19, 445, 2972, 5958, 1046...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_point_addition_bad_length() -> std::result::Result<(), PrecompileFailure> { let input: Vec<u8> = [0u8; 33].to_vec(); let cost: u64 = 1; match Curve25519Add::execute(&input, cost) { Ok((_, _out)) => { panic!("Test not expected to work"); } Err(e) => { assert_eq!( e, PrecompileFailure::Error { exit_status: ExitError::Other( "input must contain multiple of 32 bytes".into() ) } ); Ok(()) } } }
rust_cleaned_test_functions.jsonl/59618
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 237 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6085, 2891, 680, 34199, 5118, 368, 1464, 1460, 486, 1382, 486, 2077, 68843, 4968, 20433, 17507, 29, 341, 197, 10217, 1946, 25, 11312, 34837, 23, 29, 284, 508, 15, 84, 23, 26, 220, 18, 18, 936,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_internally_a_roundtrip() { let v = EnumStructInternally::VariantA { foo: 1, bar: 2, different: 3, }; test_roundtrip(v); }
rust_cleaned_test_functions.jsonl/110485
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 94 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 4042, 932, 745, 4306, 29896, 32981, 368, 341, 262, 1077, 348, 284, 14086, 9422, 67916, 745, 486, 20746, 32, 341, 286, 15229, 25, 220, 16, 345, 286, 3619, 25, 220, 17, 345, 286, 2155, 25, 220, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_ceil() { assert_eq!(ceil(0, 1), 0); assert_eq!(ceil(1, 1), 1); assert_eq!(ceil(1, 2), 1); assert_eq!(ceil(1, 8), 1); assert_eq!(ceil(7, 8), 1); assert_eq!(ceil(8, 8), 1); assert_eq!(ceil(9, 8), 2); assert_eq!(ceil(9, 9), 1); assert_eq!(ceil(10000000000, 10), 1000000000); assert_eq!(ceil(10, 10000000000), 1); assert_eq!(ceil(10000000000, 1000000000), 10); }
rust_cleaned_test_functions.jsonl/6790
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 272 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 62, 22058, 368, 341, 286, 2060, 10714, 10297, 22058, 7, 15, 11, 220, 16, 701, 220, 15, 317, 286, 2060, 10714, 10297, 22058, 7, 16, 11, 220, 16, 701, 220, 16, 317, 286, 2060, 10714, 10297, 22...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_leader_sync_follower_log() { let l = default_logger(); let ents = vec![ empty_entry(1, 2), empty_entry(1, 3), empty_entry(4, 4), empty_entry(4, 5), empty_entry(5, 6), empty_entry(5, 7), empty_entry(6, 8), empty_entry(6, 9), empty_entry(6, 10), ]; let term = 8u64; let mut tests = vec![ vec![ empty_entry(1, 2), empty_entry(1, 3), empty_entry(4, 4), empty_entry(4, 5), empty_entry(5, 6), empty_entry(5, 7), empty_entry(6, 8), empty_entry(6, 9), ], vec![empty_entry(1, 2), empty_entry(1, 3), empty_entry(4, 4)], vec![ empty_entry(1, 2), empty_entry(1, 3), empty_entry(4, 4), empty_entry(4, 5), empty_entry(5, 6), empty_entry(5, 7), empty_entry(6, 8), empty_entry(6, 9), empty_entry(6, 10), empty_entry(6, 11), ], vec![ empty_entry(1, 2), empty_entry(1, 3), empty_entry(4, 4), empty_entry(4, 5), empty_entry(5, 6), empty_entry(5, 7), empty_entry(6, 8), empty_entry(6, 9), empty_entry(6, 10), empty_entry(7, 11), empty_entry(7, 12), ], vec![ empty_entry(1, 2), empty_entry(1, 3), empty_entry(4, 4), empty_entry(4, 5), empty_entry(4, 6), empty_entry(4, 7), ], vec![ empty_entry(1, 2), empty_entry(1, 3), empty_entry(2, 4), empty_entry(2, 5), empty_entry(2, 6), empty_entry(3, 7), empty_entry(3, 8), empty_entry(3, 9), empty_entry(3, 10), empty_entry(3, 11), ], ]; for (i, tt) in tests.drain(..).enumerate() { let mut lead = { let store = MemStorage::new_with_conf_state((vec![1, 2, 3], vec![])); store.wl().append(&ents).unwrap(); let cfg = new_test_config(1, 10, 1); new_test_raft_with_config(&cfg, store, &l) }; let last_index = lead.raft_log.last_index(); lead.load_state(&hard_state(term, last_index, 0)); let mut follower = { let store = MemStorage::new_with_conf_state((vec![1, 2, 3], vec![])); store.wl().append(&tt).unwrap(); let cfg = new_test_config(2, 10, 1); new_test_raft_with_config(&cfg, store, &l) }; follower.load_state(&hard_state(term - 1, 1, 0)); // It is necessary to have a three-node cluster. // first node needs the vote from the third node to become the leader. let mut n = Network::new(vec![Some(lead), Some(follower), NOP_STEPPER], &l); n.send(vec![new_message(1, 1, MessageType::MsgHup, 0)]); // The election occurs in the term after the one we loaded with let mut m = new_message(3, 1, MessageType::MsgRequestVoteResponse, 0); m.term = term + 1; n.send(vec![m]); let mut m = new_message(1, 1, MessageType::MsgPropose, 0); m.entries = vec![Entry::default()].into(); n.send(vec![m]); let lead_str = ltoa(&n.peers[&1].raft_log); let follower_str = ltoa(&n.peers[&2].raft_log); if lead_str != follower_str { panic!( "#{}: lead str: {}, follower_str: {}", i, lead_str, follower_str ); } } }
rust_cleaned_test_functions.jsonl/62309
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 2100 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 79991, 23008, 761, 29034, 5224, 368, 341, 262, 1077, 326, 284, 1638, 27413, 543, 262, 1077, 36852, 284, 7486, 90515, 286, 4287, 9078, 7, 16, 11, 220, 17, 1326, 286, 4287, 9078, 7, 16, 11, 220,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_perceptron_learn() { let mut rng = rand::thread_rng(); let random_weights: Vec<f32> = (0..2).map(|_| rng.gen()).collect(); let mut p_and = perceptron::Node { weights: random_weights, bias: rng.gen(), learning_rate: 0.1, }; let input1 = vec![0.0, 0.0]; let input2 = vec![0.0, 1.0]; let input3 = vec![1.0, 0.0]; let input4 = vec![1.0, 1.0]; let inputs = vec![&input1, &input2, &input3, &input4]; let targets = vec![0., 0., 0., 1.]; for _ in 0..100 { p_and.epoch(&inputs, &targets); } // Test AND Perceptron assert_eq!(p_and.activate(&input1), 0.); assert_eq!(p_and.activate(&input2), 0.); assert_eq!(p_and.activate(&input3), 0.); assert_eq!(p_and.activate(&input4), 1.); assert_eq!(p_and.loss(&inputs, &targets), 0.); }
rust_cleaned_test_functions.jsonl/130159
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 417 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 5678, 346, 94710, 98948, 368, 341, 262, 1077, 5206, 28422, 284, 10382, 486, 4528, 66849, 543, 262, 1077, 4194, 21114, 25, 11312, 63895, 18, 17, 29, 284, 320, 15, 496, 17, 568, 2186, 22428, 35395...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_call_search_with_args() { let output = Command::new("./target/release/tio") .args([ "search", "830e3f2aeb7409b27683480e6edd0fe6c1f3c503486c31b5df5a0472b395433d", ]) .output() .expect("failed to search for message"); assert!(String::from_utf8_lossy(&output.stdout).contains(BASE_SEARCH_OUTPUT)) }
rust_cleaned_test_functions.jsonl/41469
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 235 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 13429, 10716, 6615, 8384, 368, 341, 286, 1077, 2550, 284, 7348, 486, 931, 13988, 5657, 88648, 5523, 815, 1138, 310, 659, 2116, 8956, 394, 330, 1836, 756, 394, 330, 23, 18, 15, 68, 18, 69, 17, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_function_param_anon_lifetime() { check_assist( introduce_named_lifetime, r#"fn my_fun(x: X<'_<|>>)"#, r#"fn my_fun<'a>(x: X<'a>)"#, ); }
rust_cleaned_test_functions.jsonl/109558
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 135 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 9174, 4090, 12008, 263, 98827, 368, 341, 286, 1779, 12083, 380, 1006, 310, 19131, 71834, 98827, 345, 310, 435, 55543, 8822, 847, 28315, 2075, 25, 1599, 18291, 41743, 91, 2452, 9940, 2, 345, 310, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_net_hotplug() { let focal = UbuntuDiskConfig::new(FOCAL_IMAGE_NAME.to_string()); let guest = Guest::new(Box::new(focal)); let kernel_path = direct_kernel_boot_path(); let api_socket = temp_api_path(&guest.tmp_dir); // Boot without network let mut child = GuestCommand::new(&guest) .args(&["--api-socket", &api_socket]) .args(&["--cpus", "boot=1"]) .args(&["--memory", "size=512M"]) .args(&["--kernel", kernel_path.to_str().unwrap()]) .args(&["--cmdline", DIRECT_KERNEL_BOOT_CMDLINE]) .default_disks() .capture_output() .spawn() .unwrap(); thread::sleep(std::time::Duration::new(20, 0)); let r = std::panic::catch_unwind(|| { // Add network let (cmd_success, cmd_output) = remote_command_w_output( &api_socket, "add-net", Some(guest.default_net_string().as_str()), ); assert!(cmd_success); assert!(String::from_utf8_lossy(&cmd_output) .contains("{\"id\":\"_net2\",\"bdf\":\"0000:00:05.0\"}")); thread::sleep(std::time::Duration::new(5, 0)); // 1 network interfaces + default localhost ==> 2 interfaces assert_eq!( guest .ssh_command("ip -o link | wc -l") .unwrap() .trim() .parse::<u32>() .unwrap_or_default(), 2 ); // Remove network assert!(remote_command(&api_socket, "remove-device", Some("_net2"))); thread::sleep(std::time::Duration::new(5, 0)); // Add network again let (cmd_success, cmd_output) = remote_command_w_output( &api_socket, "add-net", Some(guest.default_net_string().as_str()), ); assert!(cmd_success); assert!(String::from_utf8_lossy(&cmd_output) .contains("{\"id\":\"_net3\",\"bdf\":\"0000:00:05.0\"}")); thread::sleep(std::time::Duration::new(5, 0)); // 1 network interfaces + default localhost ==> 2 interfaces assert_eq!( guest .ssh_command("ip -o link | wc -l") .unwrap() .trim() .parse::<u32>() .unwrap_or_default(), 2 ); guest.reboot_linux(0, None); // Check still there after reboot // 1 network interfaces + default localhost ==> 2 interfaces assert_eq!( guest .ssh_command("ip -o link | wc -l") .unwrap() .trim() .parse::<u32>() .unwrap_or_default(), 2 ); }); let _ = child.kill(); let output = child.wait_with_output().unwrap(); handle_child_output(r, &output); }
rust_cleaned_test_functions.jsonl/29414
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 2093 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 19722, 33433, 47474, 368, 341, 310, 1077, 41099, 284, 34960, 47583, 2648, 486, 931, 7, 3788, 49533, 19121, 4708, 2389, 3904, 1423, 310, 1077, 8640, 284, 26215, 486, 931, 67758, 486, 931, 955, 3683...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_generic_i64_get() { let t1 = Generic { data: 2i64 }; assert_eq!( rune_n! { make_native_module().expect("failed making native module"), (t1, ), i64 => pub fn main(v) { v.data } }, 2 ); }
rust_cleaned_test_functions.jsonl/77914
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 170 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 41232, 5318, 21, 19, 3062, 368, 341, 262, 1077, 259, 16, 284, 21281, 314, 821, 25, 220, 17, 72, 21, 19, 2605, 262, 2060, 10714, 33673, 286, 63499, 1089, 0, 341, 310, 1281, 44494, 10750, 1005, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_c_ns_method_calls() { let unique_ptr = ffi2::ns_c_return_unique_ptr_ns(); let old_value = unique_ptr.get(); assert_eq!(1000, old_value); }
rust_cleaned_test_functions.jsonl/50902
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 81 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 666, 34728, 9032, 45636, 368, 341, 262, 1077, 4911, 4348, 284, 76956, 17, 486, 4412, 666, 12511, 21218, 4348, 34728, 1428, 262, 1077, 2310, 3142, 284, 4911, 4348, 670, 543, 262, 2060, 10714, 10297...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_vec_segment() { let dat = vec![1u8, 2, 3, 5, 10]; assert_write_check_read(dat, 8); }
rust_cleaned_test_functions.jsonl/118840
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 60 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 13251, 28061, 368, 341, 262, 1077, 3258, 284, 7486, 20703, 16, 84, 23, 11, 220, 17, 11, 220, 18, 11, 220, 20, 11, 220, 16, 15, 935, 262, 2060, 9165, 7200, 6443, 44841, 11, 220, 23, 317, 92...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_run_program() { init(); let mut prog = [1, 0, 0, 0, 99]; run_program(&mut prog, || 42, |_| {}); assert_eq!(prog, [2, 0, 0, 0, 99]); let mut prog = [2, 3, 0, 3, 99]; run_program(&mut prog, || 42, |_| {}); assert_eq!(prog, [2, 3, 0, 6, 99]); let mut prog = [2, 4, 4, 5, 99, 0]; run_program(&mut prog, || 42, |_| {}); assert_eq!(prog, [2, 4, 4, 5, 99, 9801]); let mut prog = [1, 1, 1, 4, 99, 5, 6, 0, 99]; run_program(&mut prog, || 42, |_| {}); assert_eq!(prog, [30, 1, 1, 4, 2, 5, 6, 0, 99]); }
rust_cleaned_test_functions.jsonl/28216
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 347 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 14007, 25096, 368, 341, 286, 2930, 1428, 286, 1077, 5206, 29271, 284, 508, 16, 11, 220, 15, 11, 220, 15, 11, 220, 15, 11, 220, 24, 24, 935, 286, 1598, 25096, 2099, 6984, 29271, 11, 1369, 220...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
5
#[test] fn test_hash_ops() { let ctx = TestContext::new(); let mut con = ctx.connection(); redis::cmd("HSET") .arg("foo") .arg("key_1") .arg(1) .execute(&mut con); redis::cmd("HSET") .arg("foo") .arg("key_2") .arg(2) .execute(&mut con); let h: HashMap<String, i32> = redis::cmd("HGETALL").arg("foo").query(&mut con).unwrap(); assert_eq!(h.len(), 2); assert_eq!(h.get("key_1"), Some(&1i32)); assert_eq!(h.get("key_2"), Some(&2i32)); let h: BTreeMap<String, i32> = redis::cmd("HGETALL").arg("foo").query(&mut con).unwrap(); assert_eq!(h.len(), 2); assert_eq!(h.get("key_1"), Some(&1i32)); assert_eq!(h.get("key_2"), Some(&2i32)); }
rust_cleaned_test_functions.jsonl/108945
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 378 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 8950, 21959, 368, 341, 262, 1077, 5635, 284, 3393, 1972, 486, 931, 543, 262, 1077, 5206, 390, 284, 5635, 20310, 1428, 262, 20870, 486, 8710, 445, 39, 5884, 1138, 286, 659, 858, 445, 7975, 1138, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_parse_ack() { let s = [0x00, 0x04, 0x00, 0x01]; let ack = ACK::parse(&s).unwrap(); assert_eq!(ack.block(), 1); }
rust_cleaned_test_functions.jsonl/104030
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 93 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21039, 48447, 368, 341, 286, 1077, 274, 284, 508, 15, 87, 15, 15, 11, 220, 15, 87, 15, 19, 11, 220, 15, 87, 15, 15, 11, 220, 15, 87, 15, 16, 935, 286, 1077, 10725, 284, 53763, 486, 6400,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_ilrawtag_with_value_bad_id() { const SAMPLE: [u8; 5] = [0, 1, 2, 3, 4]; ILRawTag::with_value(15, &SAMPLE); }
rust_cleaned_test_functions.jsonl/25713
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 73 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 26743, 1041, 4578, 6615, 3142, 34199, 842, 368, 341, 262, 733, 62420, 25, 508, 84, 23, 26, 220, 20, 60, 284, 508, 15, 11, 220, 16, 11, 220, 17, 11, 220, 18, 11, 220, 19, 935, 262, 11344, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_cookies_on_redirect() -> Result<(), Error> { let testserver = TestServer::new(cookie_and_redirect); let url = format!("http://localhost:{}/first", testserver.port); let agent = Agent::new(); agent.post(&url).call()?; let cookies = agent.state.cookie_tin.get_request_cookies( &format!("https://localhost:{}/", testserver.port) .parse() .unwrap(), ); let mut cookie_names: Vec<String> = cookies.iter().map(|c| c.name().to_string()).collect(); cookie_names.sort(); assert_eq!(cookie_names, vec!["first", "second", "third"]); Ok(()) }
rust_cleaned_test_functions.jsonl/73114
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 258 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 94158, 4470, 30043, 368, 1464, 5714, 68843, 4600, 29, 341, 262, 1077, 1273, 4030, 284, 3393, 5475, 486, 931, 56351, 8378, 30043, 317, 262, 1077, 2515, 284, 3561, 17223, 1254, 1110, 8301, 12547, 44...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_identifier_json_ser_deser() { let hex = "942b6c0bd43bdcb24f3edfe7fadbc77054ecc4f2"; let identifier = Identifier::from_hex(hex).unwrap(); #[derive(Debug, Serialize, Deserialize, PartialEq)] struct HasAnIdentifier { identifier: Identifier, } let has_an_identifier = HasAnIdentifier { identifier }; let json = serde_json::to_string(&has_an_identifier).unwrap(); assert_eq!(json, "{\"identifier\":\"942b6c0bd43bdcb24f3e\"}"); let deserialized: HasAnIdentifier = serde_json::from_str(&json).unwrap(); assert_eq!(deserialized, has_an_identifier); }
rust_cleaned_test_functions.jsonl/60449
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 246 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 33176, 9455, 75861, 15768, 261, 368, 341, 197, 10217, 12371, 284, 330, 24, 19, 17, 65, 21, 66, 15, 8940, 19, 18, 8940, 7221, 17, 19, 69, 18, 291, 1859, 22, 83059, 8904, 22, 22, 15, 20, 19,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_find_program_address() { for _ in 0..1_000 { let program_id = Pubkey::new_unique(); let (address, bump_seed) = try_find_program_address(&[b"Lil'", b"Bits"], &program_id, 100).unwrap(); assert_eq!( address, create_program_address(&[b"Lil'", b"Bits", &[bump_seed]], &program_id, 1).unwrap() ); } let program_id = Pubkey::from_str("BPFLoaderUpgradeab1e11111111111111111111111").unwrap(); let max_tries = 256; // one per seed let seeds: &[&[u8]] = &[b""]; let (_, bump_seed) = try_find_program_address(seeds, &program_id, max_tries).unwrap(); let remaining = 256 - bump_seed as u64; let _ = try_find_program_address(seeds, &program_id, remaining).unwrap(); assert_eq!( try_find_program_address(seeds, &program_id, remaining - 1), Err( SyscallError::InstructionError(InstructionError::ComputationalBudgetExceeded) .into() ) ); let exceeded_seed = &[127; MAX_SEED_LEN + 1]; assert_eq!( try_find_program_address(&[exceeded_seed], &program_id, max_tries - 1), Err(SyscallError::BadSeeds(PubkeyError::MaxSeedLengthExceeded).into()) ); let exceeded_seeds: &[&[u8]] = &[ &[1], &[2], &[3], &[4], &[5], &[6], &[7], &[8], &[9], &[10], &[11], &[12], &[13], &[14], &[15], &[16], &[17], ]; assert_eq!( try_find_program_address(exceeded_seeds, &program_id, max_tries - 1), Err(SyscallError::BadSeeds(PubkeyError::MaxSeedLengthExceeded).into()) ); }
rust_cleaned_test_functions.jsonl/35336
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1086 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21814, 25096, 6744, 368, 341, 286, 369, 716, 304, 220, 15, 496, 16, 62, 15, 15, 15, 341, 310, 1077, 2025, 842, 284, 22611, 792, 486, 931, 21218, 543, 310, 1077, 320, 4995, 11, 27575, 33809, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_install_copy_file() { let (at, mut ucmd) = at_and_ucmd!(); let file1 = "source_file"; let file2 = "target_file"; at.touch(file1); ucmd.arg(file1).arg(file2).succeeds().no_stderr(); assert!(at.file_exists(file1)); assert!(at.file_exists(file2)); }
rust_cleaned_test_functions.jsonl/47030
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 143 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 34245, 16096, 2458, 368, 341, 262, 1077, 320, 266, 11, 5206, 575, 8710, 8, 284, 518, 8378, 68887, 2277, 0, 543, 262, 1077, 1034, 16, 284, 330, 2427, 2458, 876, 262, 1077, 1034, 17, 284, 330, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_parse_router_alert() { let mut buffer: Vec<u8> = vec![148, 4, 0, 0]; let options = Options::<_, Ipv4OptionsImpl>::parse(buffer.as_mut()).unwrap(); let rtralt = options.iter().next().unwrap(); assert!(rtralt.copied); assert_eq!(rtralt.data, Ipv4OptionData::RouterAlert { data: 0 }); }
rust_cleaned_test_functions.jsonl/31699
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 191 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21039, 55587, 35717, 368, 341, 310, 1077, 5206, 4147, 25, 11312, 34837, 23, 29, 284, 7486, 20703, 16, 19, 23, 11, 220, 19, 11, 220, 15, 11, 220, 15, 935, 310, 1077, 2606, 284, 14566, 27638, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_fq_repr_num_bits() { let mut a = BigInteger256::from(0); assert_eq!(0, a.num_bits()); a = BigInteger256::from(1); for i in 1..257 { assert_eq!(i, a.num_bits()); a.mul2(); } assert_eq!(0, a.num_bits()); }
rust_cleaned_test_functions.jsonl/3541
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 142 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 761, 80, 68535, 4273, 20034, 368, 341, 262, 1077, 5206, 264, 284, 34042, 17, 20, 21, 486, 1499, 7, 15, 317, 262, 2060, 10714, 10297, 15, 11, 264, 10522, 20034, 1423, 262, 264, 284, 34042, 17, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_path_element() { use crate::prelude::*; let da = crate::create_mocked_drawing_area(300, 300, |m| { m.check_draw_path(|c, s, path| { assert_eq!(c, BLUE.to_rgba()); assert_eq!(s, 5); assert_eq!(path, vec![(100, 101), (105, 107), (150, 157)]); }); m.drop_check(|b| { assert_eq!(b.num_draw_path_call, 1); assert_eq!(b.draw_count, 1); }); }); da.draw(&Path::new( vec![(100, 101), (105, 107), (150, 157)], Into::<ShapeStyle>::into(&BLUE).stroke_width(5), )) .expect("Drawing Failure"); }
rust_cleaned_test_functions.jsonl/76167
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 348 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2638, 7894, 368, 341, 262, 990, 17717, 486, 1726, 52538, 56162, 262, 1077, 2994, 284, 17717, 486, 3182, 34134, 291, 814, 1696, 15030, 7, 18, 15, 15, 11, 220, 18, 15, 15, 11, 760, 76, 91, 341...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_scans_match_expression() { let mut scanner = Scanner::new("<?php $a = match ($x) { 2, 1 => 1, default => 0 }; ?>"); scanner.scan().unwrap(); assert_eq!( token_list!(scanner.tokens), "<?php $a = match ( $x ) { 2 , 1 => 1 , default => 0 } ; ?>" ); }
rust_cleaned_test_functions.jsonl/52961
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 165 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 13171, 596, 10708, 28068, 368, 341, 286, 1077, 5206, 20775, 284, 17170, 486, 931, 98276, 1208, 400, 64, 284, 2432, 1711, 87, 8, 314, 220, 17, 11, 220, 16, 589, 220, 16, 11, 1638, 589, 220, 1...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_fmindex() { let text = b"GCCTTAACATTATTACGCCTA$"; let alphabet = dna::n_alphabet(); let sa = suffix_array(text); let bwt = bwt(text, &sa); let less = less(&bwt, &alphabet); let occ = Occ::new(&bwt, 3, &alphabet); let fm = FMIndex::new(&bwt, &less, &occ); let pattern = b"TTA"; let sai = fm.backward_search(pattern.iter()); let positions = sai.occ(&sa); assert_eq!(positions, [3, 12, 9]); }
rust_cleaned_test_functions.jsonl/18359
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 256 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 78694, 1252, 368, 341, 286, 1077, 1467, 284, 293, 1, 22863, 1162, 15204, 1706, 21614, 21614, 1706, 22863, 1162, 32, 3, 876, 286, 1077, 27790, 284, 75334, 486, 77, 8418, 18485, 543, 286, 1077, 82...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_day_digit() { init(); for n in 1..=31 { if n < 10 { let s: &str = &n.to_string(); let input = s.chars().collect::<Vec<_>>(); let result: Expr = (day_digit() - end()).parse(&input).to_result().unwrap(); assert_eq!(result, ValueExpr(n)); } let s: &str = &format!("{:<02}", n); let input = s.chars().collect::<Vec<_>>(); let result: Expr = (day_digit() - end()).parse(&input).to_result().unwrap(); assert_eq!(result, ValueExpr(n)); } let input = "32".chars().collect::<Vec<_>>(); let result = (day_digit() - end()).parse(&input).to_result(); assert!(result.is_err()); }
rust_cleaned_test_functions.jsonl/106895
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 321 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 16763, 48403, 368, 341, 262, 2930, 543, 262, 369, 308, 304, 220, 16, 496, 28, 18, 16, 341, 414, 421, 308, 366, 220, 16, 15, 341, 286, 1077, 274, 25, 609, 495, 284, 609, 77, 2389, 3904, 543...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_realtime_period_not_supported() { // arrange let tmp = create_temp_dir("test_realtime_period_not_supported") .expect("create temp directory for test"); let cpu = LinuxCpuBuilder::new().with_realtime_period(5).build(); // act let result = Cpu::apply(&tmp, &cpu); // assert assert!( result.is_err(), "realtime period is not supported and should return an error" ); }
rust_cleaned_test_functions.jsonl/126565
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 222 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 15266, 1678, 20818, 7913, 57885, 368, 341, 286, 442, 30893, 198, 286, 1077, 4174, 284, 1855, 11771, 4334, 445, 1944, 15266, 1678, 20818, 7913, 57885, 1138, 310, 659, 17119, 445, 3182, 2730, 6220, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_doesnt_accept_wrong_port() { let mut s = socket_established(); s.rx_buffer = SocketBuffer::new(vec![0; 6]); s.assembler = Assembler::new(s.rx_buffer.capacity()); let tcp_repr = TcpRepr { seq_number: REMOTE_SEQ + 1, ack_number: Some(LOCAL_SEQ + 1), dst_port: LOCAL_PORT + 1, ..SEND_TEMPL }; assert!(!s.accepts(&SEND_IP_TEMPL, &tcp_repr)); let tcp_repr = TcpRepr { seq_number: REMOTE_SEQ + 1, ack_number: Some(LOCAL_SEQ + 1), src_port: REMOTE_PORT + 1, ..SEND_TEMPL }; assert!(!s.accepts(&SEND_IP_TEMPL, &tcp_repr)); }
rust_cleaned_test_functions.jsonl/1791
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 410 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 96374, 406, 35728, 75198, 8716, 368, 341, 286, 1077, 5206, 274, 284, 7575, 18583, 5102, 291, 543, 286, 274, 45348, 7776, 284, 20954, 4095, 486, 931, 25592, 20703, 15, 26, 220, 21, 2558, 286, 274...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_transpile_jsx_pragma() { let specifier = resolve_url_or_path("https://deno.land/x/mod.ts") .expect("could not resolve specifier"); let source = r#" /** @jsx h */ /** @jsxFrag Fragment */ import { h, Fragment } from "https://deno.land/x/mod.ts"; function App() { return ( <div><></></div> ); }"#; let module = parse_module(ParseParams { specifier: specifier.as_str().to_string(), source: SourceTextInfo::from_string(source.to_string()), media_type: deno_ast::MediaType::Jsx, capture_tokens: false, maybe_syntax: None, scope_analysis: true, }) .unwrap(); let (code, _) = transpile(&module, &EmitOptions::default()).unwrap(); let expected = r#"/** @jsx h */ /** @jsxFrag Fragment */ import { h, Fragment } from "https://deno.land/x/mod.ts"; function App() { return(/*#__PURE__*/ h("div", null, /*#__PURE__*/ h(Fragment, null))); }"#; assert_eq!(&code[..expected.len()], expected); }
rust_cleaned_test_functions.jsonl/65184
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 419 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 7965, 12192, 26250, 87, 620, 4101, 1728, 368, 341, 262, 1077, 97616, 284, 8830, 2903, 8734, 2638, 445, 2428, 1110, 5183, 78, 87627, 10776, 38479, 21288, 1138, 414, 659, 17119, 445, 28077, 537, 883...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_fn_signature_with_docs_simple() { let info = call_info( r#" /// test // non-doc-comment fn foo(j: u32) -> u32 { j } fn bar() { let _ = foo(<|>); } "#, ); assert_eq!(info.parameters(), ["j: u32"]); assert_eq!(info.active_parameter, Some(0)); assert_eq!(info.label(), "fn foo(j: u32) -> u32"); assert_eq!(info.doc().map(|it| it.into()), Some("test".to_string())); }
rust_cleaned_test_functions.jsonl/55354
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 240 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 15246, 39859, 6615, 49692, 30015, 368, 341, 286, 1077, 3546, 284, 1618, 3109, 1006, 310, 435, 2, 698, 2575, 1273, 198, 322, 2477, 11527, 45666, 198, 8822, 15229, 3325, 25, 575, 18, 17, 8, 1464, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_map_array_complex_structure() { // A made up structure for this test struct TestStructure { durp0: u64, durp1: String, durp2: f64, durp3: bool, } // Create the map and initialize a vector of TestStructure let array_size: u64 = 10; let map: ArrayMap = unsafe { ArrayMap::new( "mymap", std::mem::size_of::<u64>() as u32, array_size as u32, ) .expect("Failed to create new map") }; let data: Vec<TestStructure> = (0..array_size) .map(|v| TestStructure { durp0: v, durp1: format!("Durp {}", v), durp2: 0.1234, durp3: v % 2 == 0, }) .collect(); // Write the test structures to the map for (i, tmp) in data.iter().enumerate() { unsafe { map.write(i as u32, tmp).expect("could not write to map") }; } // Read the test structures from the map and compare with originals for (i, item) in data.iter().enumerate() { let val: &TestStructure = unsafe { map.read(i as u32).expect("Failed to read value from array") }; assert_eq!(val.durp0, item.durp0); assert_eq!(val.durp1, item.durp1); assert_eq!(val.durp2, item.durp2); assert_eq!(val.durp3, item.durp3); } }
rust_cleaned_test_functions.jsonl/40487
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 830 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 5376, 3858, 41522, 38283, 368, 341, 286, 442, 362, 1865, 705, 5944, 369, 419, 1273, 198, 286, 2036, 3393, 22952, 341, 310, 10651, 79, 15, 25, 575, 21, 19, 345, 310, 10651, 79, 16, 25, 923, 3...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_tuple_struct() { Python::with_gil(|py| { let tup = PyTuple::new(py, &[1.into_py(py), "test".into_py(py)]); let tup = Tuple::extract(tup.as_ref()); assert!(tup.is_err()); let tup = PyTuple::new(py, &["test".into_py(py), 1.into_py(py)]); let tup = Tuple::extract(tup.as_ref()).expect("Failed to extract Tuple from PyTuple"); assert_eq!(tup.0, "test"); assert_eq!(tup.1, 1); }); }
rust_cleaned_test_functions.jsonl/59470
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 244 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21773, 15126, 368, 341, 262, 13027, 486, 4197, 1889, 321, 22428, 3288, 91, 341, 286, 1077, 57385, 284, 80824, 486, 931, 46827, 11, 44590, 16, 39860, 40291, 46827, 701, 330, 1944, 3263, 18122, 4029...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_same_merkle_root() { let dir1 = TempDir::new(super::gen_tempdir_name().as_str()).unwrap(); let path1 = dir1.path(); let db1 = create_database(path1); let dir2 = TempDir::new(super::gen_tempdir_name().as_str()).unwrap(); let path2 = dir2.path(); let db2 = create_database(path2); super::same_merkle_root(db1, db2); }
rust_cleaned_test_functions.jsonl/115567
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 192 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 33574, 717, 16754, 273, 12993, 368, 341, 286, 1077, 5419, 16, 284, 19944, 6184, 486, 931, 56040, 486, 4370, 11771, 3741, 1269, 1005, 300, 2895, 6011, 15454, 543, 286, 1077, 1815, 16, 284, 5419, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_invalid_email() { let email_service = OhMySmtp::new(format!("API_KEY")); assert_eq!( email_service.send(&Email::new( format!("from@email.address"), format!("test@-iana.org"), format!("Body text"), )), Err(Error::InvalidEmail) ); }
rust_cleaned_test_functions.jsonl/67588
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 164 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 31433, 9172, 368, 341, 262, 1077, 2551, 12267, 284, 8670, 5050, 10673, 790, 486, 931, 20698, 17223, 7082, 6600, 14929, 262, 2060, 10714, 33673, 286, 2551, 12267, 5219, 2099, 4781, 486, 931, 1006, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_edgengram_tokenizer_max_size() { let tokenizer = NGramTokenizer::new("hello", 2, 1000, Edge::Left); let tokens = tokenizer.collect::<Vec<Token>>(); assert_eq!(tokens, vec![ Token { term: Term::from_string("he"), position: 1 }, Token { term: Term::from_string("hel"), position: 1 }, Token { term: Term::from_string("hell"), position: 1 }, Token { term: Term::from_string("hello"), position: 1 }, ]); }
rust_cleaned_test_functions.jsonl/50144
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 226 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 32370, 70, 826, 2396, 6458, 3135, 6345, 2368, 368, 341, 286, 1077, 45958, 284, 20018, 2396, 37434, 486, 931, 445, 14990, 497, 220, 17, 11, 220, 16, 15, 15, 15, 11, 10349, 486, 5415, 317, 286, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_new_unaligned_sized() { // new_unaligned_from_suffix return empty slices. Test that an unaligned // buffer whose length is a multiple of the element size works for // memory. let mut buf = [0u8; 8]; test_new_helper_unaligned( LayoutVerified::<_, [u8; 8]>::new_unaligned(&mut buf[..]).unwrap(), ); buf = [0xFFu8; 8]; test_new_helper_unaligned( LayoutVerified::<_, [u8; 8]>::new_unaligned_zeroed(&mut buf[..]).unwrap(), ); { // in a block so that lv and suffix don't live too long buf = [0u8; 8]; let (lv, suffix) = LayoutVerified::<_, [u8; 8]>::new_unaligned_from_prefix(&mut buf[..]).unwrap(); assert!(suffix.is_empty()); test_new_helper_unaligned(lv); } { buf = [0xFFu8; 8]; let (lv, suffix) = LayoutVerified::<_, [u8; 8]>::new_unaligned_from_prefix_zeroed(&mut buf[..]) .unwrap(); assert!(suffix.is_empty()); test_new_helper_unaligned(lv); } { buf = [0u8; 8]; let (prefix, lv) = LayoutVerified::<_, [u8; 8]>::new_unaligned_from_suffix(&mut buf[..]).unwrap(); assert!(prefix.is_empty()); test_new_helper_unaligned(lv); } { buf = [0xFFu8; 8]; let (prefix, lv) = LayoutVerified::<_, [u8; 8]>::new_unaligned_from_suffix_zeroed(&mut buf[..]) .unwrap(); assert!(prefix.is_empty()); test_new_helper_unaligned(lv); } let mut buf = [0u8; 16]; // buf.buf should be aligned to 8 and have a length which is a multiple test_new_helper_slice_unaligned( LayoutVerified::<_, [u8]>::new_slice(&mut buf[..]).unwrap(), ); buf = [0xFFu8; 16]; test_new_helper_slice_unaligned( LayoutVerified::<_, [u8]>::new_slice_zeroed(&mut buf[..]).unwrap(), ); }
rust_cleaned_test_functions.jsonl/18895
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1193 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 5921, 4907, 47142, 643, 1506, 368, 341, 73363, 286, 442, 501, 4907, 47142, 5673, 37151, 470, 4287, 34254, 13, 3393, 429, 458, 650, 47142, 198, 286, 442, 4147, 6693, 3084, 374, 264, 5248, 315, 27...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_pop_push() { let mut c = ContextImpl(vec![]); c.push(wrap(10i32)); assert_eq!(1, c.len()); assert_eq!(10i32, unwrap::<i32>(c.pop().unwrap()).unwrap()); assert!(c.is_empty()); }
rust_cleaned_test_functions.jsonl/7108
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 132 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 17061, 14218, 368, 341, 286, 1077, 5206, 272, 284, 9608, 9673, 25592, 0, 56703, 286, 272, 2552, 3622, 4611, 7, 16, 15, 72, 18, 17, 1106, 286, 2060, 10714, 10297, 16, 11, 272, 19406, 1423, 286,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_txs() { let mut r = Register::new(); r.set_X(0xFF); txs(&mut r); assert_eq!(r.get_S(),0xFF) }
rust_cleaned_test_functions.jsonl/14192
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 76 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 17805, 82, 368, 341, 262, 1077, 5206, 435, 284, 8451, 486, 931, 543, 262, 435, 980, 6859, 7, 15, 9264, 317, 262, 9854, 82, 2099, 6984, 435, 317, 262, 2060, 10714, 10297, 81, 670, 1098, 1507, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_reach_thirteen_height() { let sandbox = timestamping_sandbox(); let sandbox_state = SandboxState::new(); let target_height = 13; for height in 2..target_height + 1 { add_one_height(&sandbox, &sandbox_state); sandbox.assert_state(Height(height), ROUND_ONE); } }
rust_cleaned_test_functions.jsonl/8873
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 129 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 1288, 610, 5854, 44904, 9561, 368, 341, 262, 1077, 42754, 284, 11441, 287, 643, 31536, 543, 262, 1077, 42754, 4387, 284, 96860, 1397, 486, 931, 1428, 262, 1077, 2169, 9561, 284, 220, 16, 18, 401...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_auth_change() { let mesh = Mesh::new(4, 16); let network = Network::new(mesh.clone(), 0).unwrap(); let mut transport = MockConnectingTransport::expect_connections(vec![ Ok(Box::new(MockConnection::new())), Ok(Box::new(MockConnection::new())), Ok(Box::new(MockConnection::new())), ]); let orchestrator_connection = transport .connect("inproc://admin-service") .expect("failed to create connection"); let orchestrator = ServiceOrchestrator::new(vec![], orchestrator_connection, 1, 1, 1) .expect("failed to create orchestrator"); let peer_connector = PeerConnector::new(network.clone(), Box::new(transport)); let state = setup_splinter_state(); let key_registry = StorageKeyRegistry::new("memory".to_string()).unwrap(); let mut shared = AdminServiceShared::new( "my_peer_id".into(), orchestrator, peer_connector, Box::new(MockAuthInquisitor), state, Box::new(HashVerifier), Box::new(key_registry), Box::new(AllowAllKeyPermissionManager), "memory", ) .unwrap(); let mut circuit = admin::Circuit::new(); circuit.set_circuit_id("test_propose_circuit".into()); circuit.set_authorization_type(admin::Circuit_AuthorizationType::TRUST_AUTHORIZATION); circuit.set_persistence(admin::Circuit_PersistenceType::ANY_PERSISTENCE); circuit.set_routes(admin::Circuit_RouteType::ANY_ROUTE); circuit.set_durability(admin::Circuit_DurabilityType::NO_DURABILITY); circuit.set_circuit_management_type("test app auth handler".into()); circuit.set_members(protobuf::RepeatedField::from_vec(vec![ splinter_node("test-node", "tcp://someplace:8000"), splinter_node("other-node", "tcp://otherplace:8000"), ])); circuit.set_roster(protobuf::RepeatedField::from_vec(vec![ splinter_service("service-a", "sabre"), splinter_service("service-b", "sabre"), ])); let mut request = admin::CircuitCreateRequest::new(); request.set_circuit(circuit); let mut header = admin::CircuitManagementPayload_Header::new(); header.set_action(admin::CircuitManagementPayload_Action::CIRCUIT_CREATE_REQUEST); let mut payload = admin::CircuitManagementPayload::new(); payload.set_signature(Vec::new()); payload.set_header(protobuf::Message::write_to_bytes(&header).unwrap()); payload.set_circuit_create_request(request); shared .propose_circuit(payload) .expect("Proposal not accepted"); // None of the proposed members are peered assert_eq!(0, shared.pending_circuit_payloads.len()); shared.on_authorization_change("test-node", PeerAuthorizationState::Authorized); // One node is still unpeered assert_eq!(0, shared.pending_circuit_payloads.len()); shared.on_authorization_change("other-node", PeerAuthorizationState::Authorized); assert_eq!(1, shared.pending_circuit_payloads.len()); }
rust_cleaned_test_functions.jsonl/124167
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1400 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 14014, 15947, 368, 341, 286, 1077, 11294, 284, 25122, 486, 931, 7, 19, 11, 220, 16, 21, 317, 286, 1077, 3922, 284, 8141, 486, 931, 46341, 15997, 1507, 220, 15, 568, 15454, 543, 286, 1077, 5206...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_tags() { let pos_t = get::<Pos>(); let kind = pos_t.get_kind(); let new_pos_t = TaggedType::new(&pos_t, kind, Box::new(42)); assert!(new_pos_t.get_tagged_data() == Some(&42)); assert!(new_pos_t.get_tagged_type() == &*pos_t); }
rust_cleaned_test_functions.jsonl/101715
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 130 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 16333, 368, 341, 262, 1077, 1133, 528, 284, 633, 27638, 4859, 3913, 262, 1077, 3093, 284, 1133, 528, 670, 33162, 543, 262, 1077, 501, 6479, 528, 284, 12353, 3556, 929, 486, 931, 2099, 966, 528, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_api_server_cert_auth_data_valid() -> Result<()> { match get_api_server_cert_auth_data(&HeaderValue::from_static(VALID_CERT_BASE64)) { Ok(data) => { assert_eq!(data, base64::decode(VALID_CERT_BASE64.as_bytes())?); Ok(()) } Err(e) => anyhow::bail!("got {}, want: valid cert data", e), } }
rust_cleaned_test_functions.jsonl/125246
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 215 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 11697, 12015, 37097, 14014, 1769, 8337, 368, 1464, 5714, 71698, 341, 286, 2432, 633, 11697, 12015, 37097, 14014, 1769, 2099, 97721, 486, 1499, 25360, 7, 10044, 55298, 11762, 21, 19, 593, 341, 310, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_target_family_shortcut() { setup_test!("CARGO_CFG_TARGET_FAMILY": "unix"); assert!(build_cfg!(target_family = "unix")); assert!(!build_cfg!(target_family = "windows")); assert!(!build_cfg!(target_family = "wasm")); assert!(build_cfg!(unix)); assert!(!build_cfg!(windows)); assert!(!build_cfg!(wasm)); setup_test!("CARGO_CFG_TARGET_FAMILY": "windows"); assert!(!build_cfg!(target_family = "unix")); assert!(build_cfg!(target_family = "windows")); assert!(!build_cfg!(target_family = "wasm")); assert!(!build_cfg!(unix)); assert!(build_cfg!(windows)); assert!(!build_cfg!(wasm)); setup_test!("CARGO_CFG_TARGET_FAMILY": "wasm"); assert!(!build_cfg!(target_family = "unix")); assert!(!build_cfg!(target_family = "windows")); assert!(build_cfg!(target_family = "wasm")); assert!(!build_cfg!(unix)); assert!(!build_cfg!(windows)); assert!(build_cfg!(wasm)); }
rust_cleaned_test_functions.jsonl/64893
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 389 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 11123, 26823, 16673, 10242, 368, 341, 84571, 4452, 17223, 34, 7581, 46, 21760, 29299, 80828, 788, 330, 56646, 797, 6948, 10297, 5834, 18343, 10297, 5657, 26823, 284, 330, 56646, 4010, 6948, 0, 3471,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_pipe_lit() { test_walk( "(a=<-)=>a", vec![ "File", "ExprStmt", "FunctionExpr", "Property", "Identifier", "PipeLit", "Identifier", ], ) }
rust_cleaned_test_functions.jsonl/133866
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 185 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 41862, 98399, 368, 341, 262, 1273, 56131, 1006, 286, 11993, 64, 38698, 12, 27166, 64, 756, 286, 7486, 90515, 310, 330, 1703, 756, 310, 330, 16041, 31063, 756, 310, 330, 5152, 16041, 756, 310, 33...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_listen() { let addr = unused_addr(); let (tx, rx) = mpsc::channel(); let h = thread::spawn(move || { let sys = scrappy_rt::System::new("test"); let lst = net::TcpListener::bind(addr).unwrap(); Server::build() .disable_signals() .workers(1) .listen("test", lst, move || fn_service(|_| ok::<_, ()>(()))) .unwrap() .start(); let _ = tx.send(scrappy_rt::System::current()); let _ = sys.run(); }); let sys = rx.recv().unwrap(); thread::sleep(time::Duration::from_millis(500)); assert!(net::TcpStream::connect(addr).is_ok()); let _ = sys.stop(); let _ = h.join(); }
rust_cleaned_test_functions.jsonl/5726
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 349 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 79286, 368, 341, 262, 1077, 10789, 284, 20006, 7387, 543, 262, 1077, 320, 3998, 11, 19111, 8, 284, 296, 81984, 486, 10119, 1428, 262, 1077, 305, 284, 4516, 486, 46087, 34081, 1369, 341, 286, 107...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_majority_disk_full() { let mut cluster = new_node_cluster(0, 3); // To ensure the thread has full store disk usage infomation. cluster.cfg.raft_store.store_batch_system.pool_size = 1; cluster.pd_client.disable_default_operator(); cluster.run(); // To ensure all replicas are not pending. cluster.must_put(b"k1", b"v1"); must_get_equal(&cluster.get_engine(1), b"k1", b"v1"); must_get_equal(&cluster.get_engine(2), b"k1", b"v1"); must_get_equal(&cluster.get_engine(3), b"k1", b"v1"); cluster.must_transfer_leader(1, new_peer(1, 1)); let region = cluster.get_region(b"k1"); let epoch = region.get_region_epoch().clone(); // To ensure followers have reported disk usages to the leader. for i in 1..3 { fail::cfg(get_fp(DiskUsage::AlmostFull, i + 1), "return").unwrap(); ensure_disk_usage_is_reported(&mut cluster, i + 1, i + 1, &region); } // Normal proposals will be rejected because of majority peers' disk full. let ch = cluster.async_put(b"k2", b"v2").unwrap(); let resp = ch.recv_timeout(Duration::from_secs(1)).unwrap(); assert_eq!(disk_full_stores(&resp), vec![2, 3]); // Proposals with special `DiskFullOpt`s can be accepted even if all peers are disk full. fail::cfg(get_fp(DiskUsage::AlmostFull, 1), "return").unwrap(); let reqs = vec![new_put_cmd(b"k3", b"v3")]; let put = new_request(1, epoch.clone(), reqs, false); let mut opts = RaftCmdExtraOpts::default(); opts.disk_full_opt = DiskFullOpt::AllowedOnAlmostFull; let ch = cluster.async_request_with_opts(put, opts).unwrap(); let resp = ch.recv_timeout(Duration::from_secs(1)).unwrap(); assert!(!resp.get_header().has_error()); // Reset disk full status for peer 2 and 3. 2 follower reads must success because the leader // will continue to append entries to followers after the new disk usages are reported. for i in 1..3 { fail::remove(get_fp(DiskUsage::AlmostFull, i + 1)); ensure_disk_usage_is_reported(&mut cluster, i + 1, i + 1, &region); must_get_equal(&cluster.get_engine(i + 1), b"k3", b"v3"); } // To ensure followers have reported disk usages to the leader. for i in 1..3 { fail::cfg(get_fp(DiskUsage::AlreadyFull, i + 1), "return").unwrap(); ensure_disk_usage_is_reported(&mut cluster, i + 1, i + 1, &region); } // Proposals with special `DiskFullOpt`s will still be rejected if majority peers are already // disk full. let reqs = vec![new_put_cmd(b"k3", b"v3")]; let put = new_request(1, epoch.clone(), reqs, false); let mut opts = RaftCmdExtraOpts::default(); opts.disk_full_opt = DiskFullOpt::AllowedOnAlmostFull; let ch = cluster.async_request_with_opts(put, opts).unwrap(); let resp = ch.recv_timeout(Duration::from_secs(10)).unwrap(); assert_eq!(disk_full_stores(&resp), vec![2, 3]); // Peer 2 disk usage changes from already full to almost full. fail::remove(get_fp(DiskUsage::AlreadyFull, 2)); fail::cfg(get_fp(DiskUsage::AlmostFull, 2), "return").unwrap(); ensure_disk_usage_is_reported(&mut cluster, 2, 2, &region); // Configuration change should be alloed. cluster.pd_client.must_remove_peer(1, new_peer(2, 2)); // should be allowed. let reqs = vec![new_put_cmd(b"k4", b"v4")]; let put = new_request(1, epoch, reqs, false); let mut opts = RaftCmdExtraOpts::default(); opts.disk_full_opt = DiskFullOpt::AllowedOnAlmostFull; let ch = cluster.async_request_with_opts(put, opts).unwrap(); let resp = ch.recv_timeout(Duration::from_secs(1)).unwrap(); assert_eq!(disk_full_stores(&resp), vec![3]); for i in 0..3 { fail::remove(get_fp(DiskUsage::AlreadyFull, i + 1)); fail::remove(get_fp(DiskUsage::AlmostFull, i + 1)); } }
rust_cleaned_test_functions.jsonl/64928
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1522 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 47916, 487, 41687, 16372, 368, 341, 262, 1077, 5206, 10652, 284, 501, 5084, 28441, 7, 15, 11, 220, 18, 317, 262, 442, 2014, 5978, 279, 4516, 702, 2480, 3553, 13364, 10431, 4132, 316, 367, 624, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
5
#[test] fn test_star_network_push_ring_200() { let mut network = ring_network_create(200); let thread_pool = build_gossip_thread_pool(); network_simulator(&thread_pool, &mut network, 0.9); }
rust_cleaned_test_functions.jsonl/2399
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 82 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 31681, 20966, 14218, 34683, 62, 17, 15, 15, 368, 341, 262, 1077, 5206, 3922, 284, 10058, 20966, 8657, 7, 17, 15, 15, 317, 262, 1077, 4516, 15709, 284, 1936, 1889, 41473, 10814, 15709, 543, 262, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_lp_vector_bad_int_p() { let v: Vector<f64> = Vector::new(vec![]); VectorNorm::norm(&Lp::Integer(0), &v); }
rust_cleaned_test_functions.jsonl/6909
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 78 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 76529, 12247, 34199, 4042, 620, 368, 341, 286, 1077, 348, 25, 4196, 63895, 21, 19, 29, 284, 4196, 486, 931, 25592, 0, 56703, 286, 4196, 24993, 486, 20011, 2099, 43, 79, 486, 3486, 7, 15, 701, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_ignore() { let flag = NumberFormat::IGNORE; let flag = flag | NumberFormat::from_digit_separator(b'_'); assert_eq!(flag.flags(), NumberFormat::DIGIT_SEPARATOR_FLAG_MASK); assert_eq!(flag.digit_separator(), b'_'); assert_eq!(flag.decimal_point(), b'.'); assert_eq!(flag.exponent_decimal(), b'e'); assert_eq!(flag.required_integer_digits(), false); assert_eq!(flag.required_fraction_digits(), false); assert_eq!(flag.required_exponent_digits(), false); assert_eq!(flag.required_digits(), false); assert_eq!(flag.no_positive_mantissa_sign(), false); assert_eq!(flag.required_mantissa_sign(), false); assert_eq!(flag.no_exponent_notation(), false); assert_eq!(flag.no_positive_exponent_sign(), false); assert_eq!(flag.required_exponent_sign(), false); assert_eq!(flag.no_exponent_without_fraction(), false); assert_eq!(flag.no_special(), false); assert_eq!(flag.case_sensitive_special(), false); assert_eq!(flag.no_integer_leading_zeros(), false); assert_eq!(flag.no_float_leading_zeros(), false); assert_eq!(flag.required_exponent_notation(), false); assert_eq!(flag.integer_internal_digit_separator(), true); assert_eq!(flag.fraction_internal_digit_separator(), true); assert_eq!(flag.exponent_internal_digit_separator(), true); assert_eq!(flag.internal_digit_separator(), true); assert_eq!(flag.integer_leading_digit_separator(), true); assert_eq!(flag.fraction_leading_digit_separator(), true); assert_eq!(flag.exponent_leading_digit_separator(), true); assert_eq!(flag.leading_digit_separator(), true); assert_eq!(flag.integer_trailing_digit_separator(), true); assert_eq!(flag.fraction_trailing_digit_separator(), true); assert_eq!(flag.exponent_trailing_digit_separator(), true); assert_eq!(flag.trailing_digit_separator(), true); assert_eq!(flag.integer_consecutive_digit_separator(), true); assert_eq!(flag.fraction_consecutive_digit_separator(), true); assert_eq!(flag.exponent_consecutive_digit_separator(), true); assert_eq!(flag.consecutive_digit_separator(), true); assert_eq!(flag.special_digit_separator(), true); #[cfg(feature = "power_of_two")] assert_eq!(flag.exponent_backup(), b'^'); }
rust_cleaned_test_functions.jsonl/70027
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1040 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 58493, 368, 341, 286, 1077, 5181, 284, 5624, 4061, 486, 35045, 280, 286, 1077, 5181, 284, 5181, 760, 5624, 4061, 486, 1499, 48403, 58204, 1883, 36777, 1157, 286, 2060, 10714, 10297, 9903, 27203, 1...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_strip_whitespace_block() { let text = "Hello, {{- if name -}} {name} {{- endif -}} , how are you?"; let instructions = compile(text).unwrap(); assert_eq!(6, instructions.len()); assert_eq!(&Literal("Hello,"), &instructions[0]); assert_eq!( &Branch(vec![PathStep::Name("name")], true, 5), &instructions[1] ); assert_eq!(&Literal(""), &instructions[2]); assert_eq!(&Value(vec![PathStep::Name("name")]), &instructions[3]); assert_eq!(&Literal(""), &instructions[4]); assert_eq!(&Literal(", how are you?"), &instructions[5]); }
rust_cleaned_test_functions.jsonl/18180
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 336 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 66130, 86175, 7113, 368, 972, 286, 1077, 1467, 284, 330, 9707, 11, 257, 5867, 12, 421, 829, 481, 3417, 262, 314, 606, 92, 262, 5867, 12, 12330, 481, 3417, 256, 1154, 1246, 525, 498, 30, 3534, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_forced_checkout_of_added_blob_with_content_conflict() -> BitResult<()> { BitRepo::with_minimal_repo(|repo| { rm!(repo: "foo"); bit_commit_all!(repo); touch!(repo: "foo" < "new foo contents"); bit_checkout!(repo: --force "HEAD^")?; assert_eq!(cat!(repo: "foo"), "default foo contents"); Ok(()) }) }
rust_cleaned_test_functions.jsonl/62944
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 189 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 5478, 1998, 68186, 3575, 37653, 45908, 6615, 7495, 16059, 21242, 368, 1464, 6495, 2077, 71698, 341, 262, 6495, 25243, 486, 4197, 7260, 2861, 37784, 22428, 23476, 91, 341, 286, 18998, 10297, 23476, 2...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_check_unique() { // See https://github.com/clap-rs/clap/issues/2624 new_ucmd!() .args(&["-c", "-u"]) .pipe_in("A\nA\n") .fails() .code_is(1) .stderr_only("sort: -:2: disorder: A"); }
rust_cleaned_test_functions.jsonl/20528
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 151 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 7200, 21218, 368, 341, 1066, 262, 442, 3496, 3703, 1110, 5204, 905, 55931, 391, 3795, 82, 55931, 391, 38745, 14, 17, 21, 17, 19, 198, 262, 501, 68887, 2277, 0, 741, 286, 659, 2116, 2099, 1183,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_missing_group() { let regex = r"^(?P<foo>\d*)$"; let input = "1"; let output: Result<Test> = from_str(input, regex); assert!(output.is_err()); }
rust_cleaned_test_functions.jsonl/133417
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 104 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 40447, 6288, 368, 341, 286, 1077, 20180, 284, 435, 1, 13268, 30, 47, 27, 7975, 8449, 67, 3764, 3, 876, 286, 1077, 1946, 284, 330, 16, 876, 286, 1077, 2550, 25, 5714, 71273, 29, 284, 504, 289...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_ip_has_changed_with_two_different_ips() { let mut results = IpResults::new(Some(false)); results.add_result(IpAddr::V4(Ipv4Addr::new(127, 0, 0, 1)), Utc::now()); results.add_result(IpAddr::V4(Ipv4Addr::new(127, 0, 0, 2)), Utc::now()); assert!(results.ip_has_changed() == true); }
rust_cleaned_test_functions.jsonl/86299
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 166 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 10385, 21778, 25213, 6615, 23241, 82741, 71074, 368, 341, 286, 1077, 5206, 3059, 284, 35033, 9801, 486, 931, 65405, 3576, 1106, 286, 3059, 1364, 5287, 8972, 79, 13986, 486, 53, 19, 8972, 30168, 19...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_parse_linear_gradient_7() { assert_eq!( parse_style_background_content( "linear-gradient(to right, rgba(255,0, 0,1) 0%,rgba(0,0,0, 0) 100%)" ), Ok(StyleBackgroundContent::LinearGradient(LinearGradient { direction: Direction::FromTo(DirectionCorner::Left, DirectionCorner::Right), extend_mode: ExtendMode::Clamp, stops: vec![ GradientStopPre { offset: Some(PercentageValue::new(0.0)), color: ColorU { r: 255, g: 0, b: 0, a: 255 }, }, GradientStopPre { offset: Some(PercentageValue::new(100.0)), color: ColorU { r: 0, g: 0, b: 0, a: 0 }, } ], })) ); }
rust_cleaned_test_functions.jsonl/114009
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 806 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21039, 40674, 49482, 62, 22, 368, 341, 286, 2060, 10714, 33673, 310, 4715, 15117, 24103, 7495, 1006, 394, 330, 22763, 42738, 12186, 1290, 11, 23524, 7, 17, 20, 20, 11, 15, 11, 220, 15, 11, 16,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_isaac_clone() { let seed = [1,0,0,0, 23,0,0,0, 200,1,0,0, 210,30,0,0, 57,48,0,0, 0,0,0,0, 0,0,0,0, 0,0,0,0]; let mut rng1 = IsaacRng::from_seed(seed); let mut rng2 = rng1.clone(); for _ in 0..16 { assert_eq!(rng1.next_u32(), rng2.next_u32()); } }
rust_cleaned_test_functions.jsonl/52743
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 225 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6892, 64705, 54742, 368, 341, 286, 1077, 10320, 284, 508, 16, 11, 15, 11, 15, 11, 15, 11, 220, 17, 18, 11, 15, 11, 15, 11, 15, 11, 220, 17, 15, 15, 11, 16, 11, 15, 11, 15, 11, 220, 1...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_parse_ansi_term_style_with_special_omit_attribute() { assert_eq!( parse_ansi_term_style("omit", None, false), (ansi_term::Style::new(), true, false, false) ); assert_eq!( parse_ansi_term_style("omit syntax italic white hidden", None, false), ( ansi_term::Style { background: Some(ansi_term::Color::White), is_italic: true, is_hidden: true, ..ansi_term::Style::new() }, true, false, true ) ); }
rust_cleaned_test_functions.jsonl/129640
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 415 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21039, 62, 52067, 17464, 15117, 6615, 41629, 62, 77968, 16791, 368, 341, 286, 2060, 10714, 33673, 310, 4715, 62, 52067, 17464, 15117, 445, 77968, 497, 2240, 11, 895, 1326, 310, 320, 52067, 17464, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_self_in_path_to_parameter() { test_rename( r#" struct Foo { i: i32, } impl Foo { fn f(&self) -> i32 { let self_var = 1; self<|>.i } } "#, "foo", r#" struct Foo { i: i32, } impl Foo { fn f(foo: &Foo) -> i32 { let self_var = 1; foo.i } } "#, ); }
rust_cleaned_test_functions.jsonl/58103
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 310 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 25637, 1243, 2638, 2346, 24899, 368, 341, 286, 1273, 79399, 1006, 310, 435, 2, 698, 262, 2036, 33428, 341, 286, 600, 25, 600, 18, 17, 345, 262, 555, 262, 11605, 33428, 341, 286, 5168, 282, 209...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_fieldtype_from_sample() { let example_unicode = "abc123!"; let example_int = "123"; let example_float = "1.23"; let example_date = "2019-07-10"; let example_date2 = "7/10/19"; let example_date3 = "7/10/2019"; let example_date4 = "8-Jul-2019"; let example_datetime = "2019-07-10T16:39:57-08:00"; let example_datetime2 = "2019-07-10T16:39:57Z"; let sample_unicode = FieldType::from_sample(example_unicode.as_bytes()); let sample_int = FieldType::from_sample(example_int.as_bytes()); let sample_float = FieldType::from_sample(example_float.as_bytes()); let sample_date = FieldType::from_sample(example_date.as_bytes()); let sample_date2 = FieldType::from_sample(example_date2.as_bytes()); let sample_date3 = FieldType::from_sample(example_date3.as_bytes()); let sample_date4 = FieldType::from_sample(example_date4.as_bytes()); let sample_datetime = FieldType::from_sample(example_datetime.as_bytes()); let sample_datetime2 = FieldType::from_sample(example_datetime2.as_bytes()); assert_eq!(FieldType::TUnicode, sample_unicode); assert_eq!(FieldType::TInteger, sample_int); assert_eq!(FieldType::TFloat, sample_float); assert_eq!(FieldType::TDate, sample_date); assert_eq!(FieldType::TDate, sample_date2); assert_eq!(FieldType::TDate, sample_date3); assert_eq!(FieldType::TDate, sample_date4); assert_eq!(FieldType::TDateTime, sample_datetime); assert_eq!(FieldType::TDateTime, sample_datetime2); }
rust_cleaned_test_functions.jsonl/125469
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 708 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 5013, 1313, 5673, 17491, 368, 341, 286, 1077, 3110, 54662, 284, 330, 13683, 16, 17, 18, 26782, 286, 1077, 3110, 4042, 284, 330, 16, 17, 18, 876, 286, 1077, 3110, 17586, 284, 330, 16, 13, 17, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_draw_resource_tabs_block() { let backend = TestBackend::new(100, 7); let mut terminal = Terminal::new(backend).unwrap(); terminal .draw(|f| { let size = f.size(); let mut app = App::default(); let mut pod = KubePod::default(); pod.name = "pod name test".into(); pod.namespace = "pod namespace test".into(); pod.ready = "0/2".into(); pod.status = "Failed".into(); pod.age = "6h52m".into(); app.data.pods.set_items(vec![pod]); draw_resource_tabs_block(f, &mut app, size); }) .unwrap(); let mut expected = Buffer::with_lines(vec![ "┌Resources─────────────────────────────────────────────────────────────────────────────────────────┐", "│ Pods <1> │ Services <2> │ Nodes <3> │ ConfigMaps <4> │ StatefulSets <5> │ ReplicaSets <6> │ Deplo│", "│ │", "│Pods (ns: all) [1] | Containers <enter> | describe <d> | yaml <y>─────────────────────────────────│", "│ Namespace Name Ready Status Restarts A │", "│=> pod namespace test pod name test 0/2 Failed 0 6 │", "└──────────────────────────────────────────────────────────────────────────────────────────────────┘", ]); // set row styles // First row heading style for col in 0..=99 { match col { 0 | 10..=99 => { expected .get_mut(col, 0) .set_style(Style::default().fg(Color::Yellow)); } _ => { expected.get_mut(col, 0).set_style( Style::default() .fg(Color::Yellow) .add_modifier(Modifier::BOLD), ); } } } // second row tab headings for co ma 25..=27 | 37..=39 | 54..=56 | 73..=75 | 91..=93 | 99 => { expected .get_mut(col, 1) .set_style(Style::default().fg(Color::Yellow)); } _ => { expected .get_mut(col, 1) .set_style(Style::default().fg(Color::White)); } }
rust_cleaned_test_functions.jsonl/66711
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1184 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 23021, 17962, 57953, 7113, 368, 341, 262, 1077, 19163, 284, 3393, 29699, 486, 931, 7, 16, 15, 15, 11, 220, 22, 317, 262, 1077, 5206, 15022, 284, 34090, 486, 931, 7, 20942, 568, 15454, 1428, 26...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
4
#[test] fn test_dec_binary() { let mut d = BinaryDigit(1u8); let underflow = d.dec(); assert!(!underflow); assert_eq!(d, BinaryDigit(0)); let mut d = BinaryDigit(0xffu8); let underflow = d.dec(); assert!(!underflow); assert_eq!(d, BinaryDigit(0xfe)); let mut d = BinaryDigit(0u8); let underflow = d.dec(); assert!(underflow); assert_eq!(d, BinaryDigit(0xff)); let mut d = BinaryDigit(0x100u16); let underflow = d.dec(); assert!(!underflow); assert_eq!(d, BinaryDigit(0xff)); let mut d = BinaryDigit(0u16); let underflow = d.dec(); assert!(underflow); assert_eq!(d, BinaryDigit(0xffff)); let mut d = BinaryDigit(0x100000u32); let underflow = d.dec(); assert!(!underflow); assert_eq!(d, BinaryDigit(0xfffff)); let mut d = BinaryDigit(0u32); let underflow = d.dec(); assert!(underflow); assert_eq!(d, BinaryDigit(0xffffffff)); }
rust_cleaned_test_functions.jsonl/26387
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 547 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 13783, 31761, 741, 262, 341, 286, 1077, 5206, 294, 284, 17718, 36420, 7, 16, 84, 23, 317, 286, 1077, 1212, 4965, 284, 294, 28020, 543, 286, 2060, 0, 3471, 7995, 4965, 317, 286, 2060, 10714, 10...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_iterator_enumerate_fold() { let xs = [0, 1, 2, 3, 4, 5]; let mut it = xs.iter().enumerate(); // steal a couple to get an interesting offset assert_eq!(it.next(), Some((0, &0))); assert_eq!(it.next(), Some((1, &1))); let i = it.fold(2, |i, (j, &x)| { assert_eq!(i, j); assert_eq!(x, xs[j]); i + 1 }); assert_eq!(i, xs.len()); let mut it = xs.iter().enumerate(); assert_eq!(it.next(), Some((0, &0))); let i = it.rfold(xs.len() - 1, |i, (j, &x)| { assert_eq!(i, j); assert_eq!(x, xs[j]); i - 1 }); assert_eq!(i, 0); }
rust_cleaned_test_functions.jsonl/54078
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 343 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 13491, 6205, 3389, 349, 61187, 368, 341, 262, 1077, 11943, 284, 508, 15, 11, 220, 16, 11, 220, 17, 11, 220, 18, 11, 220, 19, 11, 220, 20, 935, 262, 1077, 5206, 432, 284, 11943, 19471, 1005, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_binary_array_iter_round_trip() { let array = BinaryArray::from(vec![ Some(b"a" as &[u8]), None, Some(b"aaa"), None, Some(b"aaaaa"), ]); // to and from iter let result: BinaryArray = array.iter().collect(); assert_eq!(result, array); }
rust_cleaned_test_functions.jsonl/19274
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 198 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 31761, 3858, 11723, 29896, 63883, 368, 341, 286, 1077, 1334, 284, 17718, 1857, 486, 1499, 25592, 90515, 310, 4329, 1883, 56693, 1, 438, 44590, 84, 23, 17036, 310, 2240, 345, 310, 4329, 1883, 1, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_movegen() { //TODO Add more tests let mut game = Game::new(); game.create_piece(0, 0, 8); game.set_moves(); assert_eq!( game.square_moves[8][0..2], [ PieceMove { start: 8, end: 16, special: SpecialMove::None, }, PieceMove { start: 8, end: 24, special: SpecialMove::None, } ][..] ) }
rust_cleaned_test_functions.jsonl/120652
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 386 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 17134, 4370, 368, 341, 286, 442, 14732, 2691, 803, 7032, 198, 286, 1077, 5206, 1809, 284, 4050, 486, 931, 543, 286, 1809, 2520, 48470, 7, 15, 11, 220, 15, 11, 220, 23, 317, 286, 1809, 980, 4...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_get_device_global_uid() { // Input device. if let Some(input) = test_get_default_device(Scope::Input) { let uid = get_device_global_uid(input).unwrap(); let uid = uid.into_string(); assert!(!uid.is_empty()); } // Output device. if let Some(output) = test_get_default_device(Scope::Output) { let uid = get_device_global_uid(output).unwrap(); let uid = uid.into_string(); assert!(!uid.is_empty()); } }
rust_cleaned_test_functions.jsonl/113804
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 223 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 3062, 9204, 19296, 25396, 368, 341, 262, 442, 5571, 3671, 624, 262, 421, 1077, 4329, 5384, 8, 284, 1273, 3062, 9993, 9204, 3759, 2417, 486, 2505, 8, 341, 286, 1077, 14617, 284, 633, 9204, 19296,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_status_service() { let config = TiKvConfig::default(); let mut status_server = StatusServer::new(1, config); let _ = status_server.start("127.0.0.1:0".to_string()); let client = Client::new(); let uri = Uri::builder() .scheme("http") .authority(status_server.listening_addr().to_string().as_str()) .path_and_query("/metrics") .build() .unwrap(); let handle = status_server.thread_pool.spawn_handle(lazy(move || { client .get(uri) .map(|res| { assert_eq!(res.status(), StatusCode::OK); }) .map_err(|err| { panic!("response status is not OK: {:?}", err); }) })); handle.wait().unwrap(); status_server.stop(); }
rust_cleaned_test_functions.jsonl/47230
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 485 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 4773, 12267, 368, 341, 286, 1077, 2193, 284, 22325, 42, 85, 2648, 486, 2258, 543, 286, 1077, 5206, 2639, 12015, 284, 8104, 5475, 486, 931, 7, 16, 11, 2193, 317, 286, 1077, 716, 284, 2639, 1201...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_batch_discard_random() { solana_logger::setup(); let mut batch = PacketBatch::default(); batch.resize(1, Packet::default()); let num_batches = 100; let mut batches = vec![batch; num_batches]; let max = 5; discard_batches_randomly(&mut batches, max, num_batches); assert_eq!(batches.len(), max); }
rust_cleaned_test_functions.jsonl/6923
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 179 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 14534, 37745, 567, 22644, 368, 341, 286, 2048, 3362, 27413, 486, 15188, 543, 286, 1077, 5206, 7162, 284, 28889, 21074, 486, 2258, 543, 286, 7162, 17382, 7, 16, 11, 28889, 486, 2258, 1423, 286, 1...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_is_truthy() { assert_eq!( true, Variable::from_json(&"{\"foo\": \"bar\"}") .unwrap() .is_truthy() ); assert_eq!(false, Variable::from_json(&"{}").unwrap().is_truthy()); assert_eq!(true, Variable::from_json(&"[\"foo\"]").unwrap().is_truthy()); assert_eq!(false, Variable::from_json(&"[]").unwrap().is_truthy()); assert_eq!(false, Variable::Null.is_truthy()); assert_eq!(true, Variable::Bool(true).is_truthy()); assert_eq!(false, Variable::Bool(false).is_truthy()); assert_eq!(true, Variable::String("foo".to_string()).is_truthy()); assert_eq!(false, Variable::String("".to_string()).is_truthy()); assert_eq!( true, Variable::Number(Number::from_f64(10.0).unwrap()).is_truthy() ); assert_eq!( true, Variable::Number(Number::from_f64(0.0).unwrap()).is_truthy() ); }
rust_cleaned_test_functions.jsonl/108380
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 514 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6892, 49186, 88, 368, 341, 286, 2060, 10714, 33673, 310, 830, 345, 310, 12407, 486, 1499, 9455, 2099, 14129, 2105, 7975, 11693, 7245, 2257, 2105, 14451, 394, 659, 15454, 741, 394, 659, 285, 49186,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_txn_store_gc3() { let key = "k"; let store = AssertionStorage::default(); store.test_txn_store_gc3(key.as_bytes()[0]); let (mut cluster, mut raft_store) = AssertionStorage::new_raft_storage_with_store_count(3, key); raft_store.test_txn_store_gc3_for_cluster(&mut cluster, key.as_bytes()[0]); }
rust_cleaned_test_functions.jsonl/63407
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 145 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 92299, 14809, 49423, 18, 368, 341, 262, 1077, 1376, 284, 330, 74, 876, 262, 1077, 3553, 284, 46730, 5793, 486, 2258, 543, 262, 3553, 5958, 92299, 14809, 49423, 18, 4857, 5357, 12524, 10116, 15, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_build_payload_adds_the_build_url_if_provided() { let result = TestResult::Ok; let payload = super::build_payload(result, "1".to_string(), Some("http://build-url".to_string())); expect!(payload).to(be_equal_to(json!({ "providerApplicationVersion": "1", "success": true, "buildUrl": "http://build-url" }))); }
rust_cleaned_test_functions.jsonl/67355
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 155 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 20801, 32813, 2891, 82, 16068, 20801, 2903, 11119, 2540, 42957, 368, 341, 262, 1077, 1102, 284, 3393, 2077, 486, 11578, 280, 262, 1077, 7729, 284, 2256, 486, 5834, 32813, 4456, 11, 330, 16, 3263, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_eq_member() { let member = Member { avatar: None, deaf: false, guild_id: GuildId::new(3).expect("non zero"), joined_at: None, mute: true, nick: Some("member nick".to_owned()), pending: false, premium_since: None, roles: Vec::new(), user: user(), }; assert_eq!(cached_member(), member); }
rust_cleaned_test_functions.jsonl/100073
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 253 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 10714, 19388, 368, 341, 286, 1077, 4462, 284, 12039, 341, 310, 20701, 25, 2240, 345, 310, 46742, 25, 895, 345, 310, 26411, 842, 25, 32492, 764, 486, 931, 7, 18, 568, 17119, 445, 6280, 7168, 44...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_wordinfo_with_longword() { let lexicon = read_lexicon(); let word_info = lexicon.get_word_info(36); assert_eq!(300, word_info.surface.chars().count()); assert_eq!(300, word_info.head_word_length); assert_eq!(300, word_info.normalized_form.chars().count()); assert_eq!(-1, word_info.dictionary_form_word_id); assert_eq!(300, word_info.dictionary_form.chars().count()); assert_eq!(570, word_info.reading_form.chars().count()); }
rust_cleaned_test_functions.jsonl/113036
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 200 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 13533, 2733, 6615, 17799, 1158, 368, 341, 262, 1077, 22429, 1924, 284, 1349, 74547, 1924, 543, 262, 1077, 3409, 3109, 284, 22429, 1924, 670, 13533, 3109, 7, 18, 21, 317, 262, 2060, 10714, 10297, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_create_transactions() { let mut transactions = Mint::new(100).create_transaction().into_iter(); let tx = transactions.next().unwrap(); assert_eq!(tx.instructions.len(), 1); assert!(system_program::check_id(tx.program_id(0))); let instruction: SystemInstruction = deserialize(tx.userdata(0)).unwrap(); if let SystemInstruction::Move { tokens } = instruction { assert_eq!(tokens, 100); } assert_eq!(transactions.next(), None); }
rust_cleaned_test_functions.jsonl/7365
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 223 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 8657, 68182, 368, 341, 286, 1077, 5206, 14131, 284, 41310, 486, 931, 7, 16, 15, 15, 568, 3182, 28884, 1005, 18122, 11723, 543, 286, 1077, 9854, 284, 14131, 4529, 1005, 15454, 543, 286, 2060, 107...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_serialization() { let dt = "2018-02-11T07:09:22.765Z".parse::<DateTime<Utc>>().unwrap(); let proposal = Proposal { msg_type: Type::Proposal, height: Height::from(12345_u32), round: Round::from(23456_u16), pol_round: None, block_id: Some(BlockId { hash: Hash::from_hex_upper( Algorithm::Sha256, "DEADBEEFDEADBEEFBAFBAFBAFBAFBAFADEADBEEFDEADBEEFBAFBAFBAFBAFBAFA", ) .unwrap(), parts: Header { total: 65535, hash: Hash::from_hex_upper( Algorithm::Sha256, "0022446688AACCEE1133557799BBDDFF0022446688AACCEE1133557799BBDDFF", ) .unwrap(), }, }), timestamp: Some(dt.into()), signature: Signature::Ed25519(Ed25519Signature::new([0; ED25519_SIGNATURE_SIZE])), }; let mut got = vec![]; let request = SignProposalRequest { proposal, chain_id: ChainId::from_str("test_chain_id").unwrap(), }; let _have = request.to_signable_bytes(&mut got); // the following vector is generated via: let want = vec![ 136, 1, 8, 32, 17, 57, 48, 0, 0, 0, 0, 0, 0, 25, 160, 91, 0, 0, 0, 0, 0, 0, 32, 255, 255, 255, 255, 255, 255, 255, 255, 255, 1, 42, 74, 10, 32, 222, 173, 190, 239, 222, 173, 190, 239, 186, 251, 175, 186, 251, 175, 186, 250, 222, 173, 190, 239, 222, 173, 190, 239, 186, 251, 175, 186, 251, 175, 186, 250, 18, 38, 8, 255, 255, 3, 18, 32, 0, 34, 68, 102, 136, 170, 204, 238, 17, 51, 85, 119, 153, 187, 221, 255, 0, 34, 68, 102, 136, 170, 204, 238, 17, 51, 85, 119, 153, 187, 221, 255, 50, 12, 8, 162, 216, 255, 211, 5, 16, 192, 242, 227, 236, 2, 58, 13, 116, 101, 115, 116, 95, 99, 104, 97, 105, 110, 95, 105, 100, ]; assert_eq!(got, want) }
rust_cleaned_test_functions.jsonl/90191
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1198 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 25602, 2022, 368, 341, 286, 1077, 7594, 284, 330, 17, 15, 16, 23, 12, 15, 17, 12, 16, 16, 51, 15, 22, 25, 15, 24, 25, 17, 17, 13, 22, 21, 20, 57, 3263, 6400, 27638, 7689, 36397, 10413, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_parse_string() { let data = "\"/home/nikita/pepe.c\""; do_test_result!( data, parse_string(data), ("", String::from("/home/nikita/pepe.c")) ) }
rust_cleaned_test_functions.jsonl/74252
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 134 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21039, 3904, 368, 341, 286, 1077, 821, 284, 15898, 14, 5117, 9612, 1579, 6255, 14, 375, 375, 520, 95349, 286, 653, 4452, 5287, 33673, 310, 821, 345, 310, 4715, 3904, 2592, 1326, 310, 3489, 497, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_vote_unsubscribe() { let GenesisConfigInfo { genesis_config, .. } = create_genesis_config(10_000); let bank = Bank::new(&genesis_config); let bank_forks = Arc::new(RwLock::new(BankForks::new(bank))); let rpc = RpcSolPubSubImpl::default_with_bank_forks(bank_forks); let session = create_session(); let (subscriber, _id_receiver, _) = Subscriber::new_test("voteNotification"); rpc.vote_subscribe(session, subscriber); let session = create_session(); assert!(rpc .vote_unsubscribe(Some(session), SubscriptionId::Number(42)) .is_err()); let session = create_session(); assert!(rpc .vote_unsubscribe(Some(session), SubscriptionId::Number(0)) .is_ok()); }
rust_cleaned_test_functions.jsonl/4708
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 365 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 54360, 4907, 9384, 368, 341, 286, 1077, 40788, 2648, 1731, 314, 59366, 5332, 11, 5241, 335, 284, 1855, 16322, 13774, 5332, 7, 16, 15, 62, 15, 15, 15, 317, 286, 1077, 6073, 284, 8547, 486, 931,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_untagged_newtype_variant_containing_unit_struct_not_map() { #[derive(Debug, PartialEq, Serialize, Deserialize)] struct Unit; #[derive(Debug, PartialEq, Serialize, Deserialize)] #[serde(untagged)] enum Message { Unit(Unit), Map(BTreeMap<String, String>), } assert_tokens( &Message::Map(BTreeMap::new()), &[Token::Map { len: Some(0) }, Token::MapEnd], ); }
rust_cleaned_test_functions.jsonl/56450
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 203 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 62, 3850, 96476, 5921, 1313, 46112, 10260, 2056, 14832, 15126, 7913, 5376, 368, 341, 262, 11506, 27098, 42618, 11, 55039, 11, 39900, 11, 48440, 5563, 262, 2036, 7954, 401, 262, 11506, 27098, 42618, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_get_broker_pod_owner_kind_job() { let owner_references: Vec<OwnerReference> = vec![OwnerReference { kind: "Job".to_string(), controller: Some(true), ..Default::default() }]; assert_eq!( get_broker_pod_owner_kind(&make_pod_with_owner_references(owner_references)), BrokerPodOwnerKind::Job ); }
rust_cleaned_test_functions.jsonl/55236
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 205 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 3062, 880, 45985, 85337, 29027, 33162, 20298, 368, 341, 286, 1077, 6372, 92702, 25, 11312, 27, 13801, 8856, 29, 284, 7486, 20703, 13801, 8856, 341, 310, 3093, 25, 330, 12245, 3263, 983, 3904, 3148...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_lazy_groupby_sort_by() { let df = df! { "a" => ["a", "a", "a", "b", "b", "c"], "b" => [1, 2, 3, 4, 5, 6], "c" => [6, 1, 4, 3, 2, 1] } .unwrap(); let out = df .lazy() .groupby(vec![col("a")]) .agg(vec![col("b").sort_by(col("c"), true).first()]) .collect() .unwrap() .sort("a", false) .unwrap(); assert_eq!( Vec::from(out.column("b_first").unwrap().i32().unwrap()), [Some(1), Some(4), Some(6)] ); }
rust_cleaned_test_functions.jsonl/22388
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 316 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 49646, 6288, 1694, 18435, 3710, 368, 341, 262, 1077, 6764, 284, 6764, 0, 341, 286, 330, 64, 1, 589, 4383, 64, 497, 330, 64, 497, 330, 64, 497, 330, 65, 497, 330, 65, 497, 330, 66, 8097, 28...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_calls() { test_roundtrip("f();"); test_roundtrip("f(1);"); test_roundtrip("f(1, 2);"); test_roundtrip("(f?.(1, 2))(3);"); test_roundtrip("f?.(1, 2)?.(3)(5);"); test_roundtrip("new f();"); test_roundtrip("new f(1);"); test_roundtrip("new(a.b);"); test_roundtrip("new(a.b());"); test_roundtrip("new(a.b())();"); test_roundtrip("new(a.b())(c);"); test_roundtrip("new(a?.b())(c);"); test_roundtrip("new(1 + 2);"); test_roundtrip("new(fn(foo)[bar])()"); test_roundtrip("new(fn(foo)[bar])(c)"); test_roundtrip("new(fn(foo).bar)()"); test_roundtrip("new(fn(foo).bar)(c)"); test_roundtrip("import('foo')"); }
rust_cleaned_test_functions.jsonl/102593
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 331 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 45636, 368, 341, 262, 1273, 29896, 32981, 445, 69, 2129, 797, 262, 1273, 29896, 32981, 445, 69, 7, 16, 1215, 797, 262, 1273, 29896, 32981, 445, 69, 7, 16, 11, 220, 17, 1215, 797, 262, 1273, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_address_book_init() { let config = ConfigBuilder::new().with_network(Network::Signet).build(); let result = AddressBook::new(&config, make_logger()); assert!(result.is_err()); let err = result.unwrap_err(); assert!(matches!(err, AddressBookError::NoAddressesFound)); }
rust_cleaned_test_functions.jsonl/10126
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 137 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6744, 26421, 6137, 368, 341, 286, 1077, 2193, 284, 5532, 3297, 486, 931, 1005, 4197, 20966, 77623, 486, 7264, 295, 568, 5834, 543, 286, 1077, 1102, 284, 9177, 7134, 486, 931, 2099, 1676, 11, 128...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_runtime_config() { println!("{:?}", runtime_config::RUNTIME_CONFIG.api_endpoints); println!("{:?}", runtime_config::RUNTIME_CONFIG.internal_endpoints); println!("{:?}", runtime_config::RUNTIME_CONFIG.audit); println!("{:?}", runtime_config::RUNTIME_CONFIG.env); }
rust_cleaned_test_functions.jsonl/60217
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 147 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 33232, 5332, 368, 341, 286, 13751, 88928, 25, 52652, 15592, 5332, 486, 47390, 18129, 12568, 6183, 6213, 7706, 317, 286, 13751, 88928, 25, 52652, 15592, 5332, 486, 47390, 18129, 12568, 18264, 6213, 7...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_map_changed() { let method = method( ("Windows.Foundation.Collections", "IObservableMap`2"), "map_changed", ); assert!(method.kind == MethodKind::Add); assert!(method.params.len() == 1); let handler = &method.params[0]; assert!(handler.array == false); assert!(handler.input == true); assert!(handler.by_ref == false); let handler = match &handler.kind { TypeKind::Delegate(delegate) => delegate, _ => panic!("Wrong type"), }; assert!( handler.runtime_name() == "Windows.Foundation.Collections.MapChangedEventHandler`2<K, V>" ); let token = method.return_type.as_ref().unwrap(); assert!(token.array == false); assert!(token.input == false); assert!(token.by_ref == true); let token = match &token.kind { TypeKind::Struct(token) => token, _ => panic!("Wrong type"), }; assert!(token.runtime_name() == "Windows.Foundation.EventRegistrationToken"); }
rust_cleaned_test_functions.jsonl/21659
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 524 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 5376, 25213, 368, 341, 286, 1077, 1714, 284, 1714, 1006, 310, 3489, 13164, 75737, 3572, 497, 330, 3810, 8293, 2227, 63, 17, 4461, 310, 330, 2186, 25213, 756, 286, 3475, 286, 2060, 10297, 4393, 3...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_edges_directed() { let g: MatrixGraph<char, bool> = MatrixGraph::from_edges(&[ (0, 5), (0, 2), (0, 3), (0, 1), (1, 3), (2, 3), (2, 4), (4, 0), (6, 6), ]); assert_eq!(g.edges_directed(node_index(0), Outgoing).count(), 4); assert_eq!(g.edges_directed(node_index(1), Outgoing).count(), 1); assert_eq!(g.edges_directed(node_index(2), Outgoing).count(), 2); assert_eq!(g.edges_directed(node_index(3), Outgoing).count(), 0); assert_eq!(g.edges_directed(node_index(4), Outgoing).count(), 1); assert_eq!(g.edges_directed(node_index(5), Outgoing).count(), 0); assert_eq!(g.edges_directed(node_index(6), Outgoing).count(), 1); assert_eq!(g.edges_directed(node_index(0), Incoming).count(), 1); assert_eq!(g.edges_directed(node_index(1), Incoming).count(), 1); assert_eq!(g.edges_directed(node_index(2), Incoming).count(), 1); assert_eq!(g.edges_directed(node_index(3), Incoming).count(), 3); assert_eq!(g.edges_directed(node_index(4), Incoming).count(), 1); assert_eq!(g.edges_directed(node_index(5), Incoming).count(), 1); assert_eq!(g.edges_directed(node_index(6), Incoming).count(), 1); }
rust_cleaned_test_functions.jsonl/81969
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 678 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 28026, 32871, 291, 368, 341, 286, 1077, 342, 25, 11631, 11212, 21919, 11, 1807, 29, 284, 11631, 11212, 486, 1499, 28026, 2099, 9640, 310, 320, 15, 11, 220, 20, 1326, 310, 320, 15, 11, 220, 17,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_map() { let mut m = HashMap::new(); m.insert(4u64, "foo".to_string()); m.insert(0u64, "bar".to_string()); the_same(m); }
rust_cleaned_test_functions.jsonl/6264
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 80 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 5376, 368, 341, 262, 1077, 5206, 296, 284, 10528, 486, 931, 543, 262, 296, 7030, 7, 19, 84, 21, 19, 11, 330, 7975, 3263, 983, 3904, 1423, 262, 296, 7030, 7, 15, 84, 21, 19, 11, 330, 2257, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_min_max() { let min = |x: Weibull| x.min(); let max = |x: Weibull| x.max(); test_case(1.0, 1.0, 0.0, min); test_case(1.0, 1.0, f64::INFINITY, max); }
rust_cleaned_test_functions.jsonl/122501
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 123 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 7260, 6345, 368, 341, 286, 1077, 1308, 284, 760, 87, 25, 1205, 579, 617, 91, 856, 4358, 543, 286, 1077, 1932, 284, 760, 87, 25, 1205, 579, 617, 91, 856, 6678, 543, 286, 1273, 19096, 7, 16, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_bind() { let mut cx = Context::new(); let id = ViewId::default(); cx.init_state(id, &MyState::default); let s = State::new(id); let b = bind(s, MyLens {}); *b.get_mut(&mut cx) = 42; assert_eq!(*b.get(&mut cx), 42); }
rust_cleaned_test_functions.jsonl/100081
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 155 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 27461, 368, 341, 286, 1077, 5206, 20716, 284, 9608, 486, 931, 543, 286, 1077, 877, 284, 2738, 764, 486, 2258, 543, 286, 20716, 8271, 4387, 3724, 11, 609, 5050, 1397, 486, 2258, 317, 286, 1077, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_f32x4_debug() { let a = F32x4::new(48.0, -4.0, 200.0, 7.0); assert_eq!("<48, -4, 200, 7>", format!("{:?}", a)); }
rust_cleaned_test_functions.jsonl/66190
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 85 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 761, 18, 17, 87, 19, 15446, 368, 341, 262, 1077, 264, 284, 434, 18, 17, 87, 19, 486, 931, 7, 19, 23, 13, 15, 11, 481, 19, 13, 15, 11, 220, 17, 15, 15, 13, 15, 11, 220, 22, 13, 15, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_limits_no_panic() { let s = schema(&[ ("a", DataType::Int64), ("b", DataType::Int64), ("c", DataType::Int64), ("d", DataType::Int64), ("e", DataType::Int64), ]); let extract = |sql| PartitionFilter::extract(&s, &[parse(sql, &s)]); let filter = extract( "a IN (1,2,3,4,5,6,7,8,9) \ AND b = 1 \ AND c = 1 \ AND d IN (1,2,3,4,5,6,7) \ AND e IN (1, 2)", ); assert_ne!(filter.min_max.len(), 0); assert!(filter.can_match( Some(&vec![TableValue::Int(1); 5]), Some(&vec![TableValue::Int(1); 5]) )); let max_row = &[9, 1, 1, 7, 2]; assert!(filter.can_match(Some(&vals(max_row)), Some(&vals(max_row)))); // Check we keep information about min and max values for each field. for i in 0..s.fields().len() { let mut row_before = vec![1; 5]; row_before[i] -= 1; assert!( !filter.can_match(Some(&vals(&row_before)), Some(&vals(&row_before))), "must not match {:?}", row_before ); let mut row_after = max_row.to_vec(); row_after[i] += 1; assert!( !filter.can_match(Some(&vals(&row_after)), Some(&vals(&row_after))), "must not match {:?}", row_after ); } fn vals(is: &[i64]) -> Vec<TableValue> { is.iter().map(|i| TableValue::Int(*i)).collect() } }
rust_cleaned_test_functions.jsonl/65541
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 941 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 31820, 6536, 620, 31270, 368, 341, 286, 1077, 274, 284, 10802, 2099, 9640, 310, 3489, 64, 497, 33172, 486, 1072, 21, 19, 1326, 310, 3489, 65, 497, 33172, 486, 1072, 21, 19, 1326, 310, 3489, 66...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_movss_store() { assert_emit!(0xf3, 0x0f, 0x11, 0x40, 1; movss_store(Mem::Base(RAX, 1), XMM0)); assert_emit!(0xf2, 0x44, 0x0f, 0x11, 0x78, 1; movsd_store(Mem::Base(RAX, 1), XMM15)); }
rust_cleaned_test_functions.jsonl/85506
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 132 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 55798, 778, 14809, 368, 341, 286, 2060, 69082, 10297, 15, 5848, 18, 11, 220, 15, 87, 15, 69, 11, 220, 15, 87, 16, 16, 11, 220, 15, 87, 19, 15, 11, 220, 16, 26, 1974, 778, 14809, 3189, 33...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_chrono_utc_value() { let timestamp = DateTime::<Utc>::from_utc(NaiveDate::from_ymd(2022, 1, 2).and_hms(3, 4, 5), Utc); let value: Value = timestamp.into(); let out: DateTime<Utc> = value.unwrap(); assert_eq!(out, timestamp); }
rust_cleaned_test_functions.jsonl/12486
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 151 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 4138, 2248, 78, 84259, 3142, 368, 341, 286, 1077, 11441, 4035, 310, 6520, 27638, 97768, 6831, 1499, 84259, 8204, 64, 533, 1916, 486, 1499, 62, 1600, 67, 7, 17, 15, 17, 17, 11, 220, 16, 11, 2...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_unlink() { const TMPDIR_POSTFIX: &str = "wslcmd-unlink"; // init tmpdir let tmpdir = init_tmpdir(TMPDIR_POSTFIX).expect("Tmp dir initialize"); let (bin1, _) = copy_tmpbin(&tmpdir, None).expect("Bin initialize"); // test linking only let mut wslcmd_list = WslCmdList::new(&bin1).expect("New WslCmdList"); unit_test_mod(&tmpdir, &mut wslcmd_list, "test", false, TestKind::Link) .expect("Unlink test prepare"); unit_test_mod(&tmpdir, &mut wslcmd_list, "test", false, TestKind::Unlink) .expect("Test unlink"); // clean tmpdir clean_tmpdir(TMPDIR_POSTFIX); }
rust_cleaned_test_functions.jsonl/34191
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 318 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 4907, 2080, 368, 341, 286, 733, 66253, 12251, 20506, 39690, 25, 609, 495, 284, 330, 86, 3226, 8710, 19892, 2080, 3302, 286, 442, 2930, 4174, 3741, 198, 286, 1077, 4174, 3741, 284, 2930, 16125, 3...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_prop_success() -> Result<(), Box<dyn std::error::Error>> { let mut cmd = Command::cargo_bin("jj")?; let assert = cmd.arg("_.x.y").write_stdin(r#"{"x":{"y":42}}"#).assert(); assert.success().stdout("42\n").stderr(""); Ok(()) }
rust_cleaned_test_functions.jsonl/43233
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 117 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21663, 18632, 368, 1464, 5714, 68843, 8261, 92846, 1460, 486, 841, 486, 1454, 2452, 341, 262, 1077, 5206, 5439, 284, 7348, 486, 66715, 21816, 445, 38811, 899, 37445, 262, 1077, 2060, 284, 5439, 21...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_ecdsa_adaptor_signature_wrong_proof() { let msg = msg_from_str("8131e6f4b45754f2c90bd06688ceeabc0c45055460729928b4eecf11026a9e2d"); let pubkey = "035be5e9478209674a96e60f1f037f6176540fd001fa1d64694770c56a7709c42c" .parse() .unwrap(); let encryption_key = "0214ccb756249ad6e733c80285ea7ac2ee12ffebbcee4e556e6810793a60c45ad4" .parse() .unwrap(); let adaptor_sig: EcdsaAdaptorSignature = "03f94dca206d7582c015fb9bffe4e43b14591b30ef7d2b464d103ec5e116595dba03127f8ac3533d249280332474339000922eb6a58e3b9bf4fc7e01e4b4df2b7a4100a1e089f16e5d70bb89f961516f1de0684cc79db978495df2f399b0d01ed7240fa6e3252aedb58bdc6b5877b0c602628a235dd1ccaebdddcbe96198c0c21bead7b05f423b673d14d206fa1507b2dbe2722af792b8c266fc25a2d901d7e2c335" .parse() .unwrap(); adaptor_sig .verify(&SECP256K1, &msg, &pubkey, &encryption_key) .expect_err("providing a wrong proof should fail validation"); }
rust_cleaned_test_functions.jsonl/62235
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 582 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 36844, 96780, 10027, 32657, 39859, 75198, 86757, 368, 341, 286, 1077, 3750, 284, 3750, 5673, 2895, 445, 23, 16, 18, 16, 68, 21, 69, 19, 65, 19, 20, 22, 20, 19, 69, 17, 66, 24, 15, 8940, 15...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1