text
stringlengths
93
16.4k
id
stringlengths
20
40
metadata
dict
input_ids
listlengths
45
2.05k
attention_mask
listlengths
45
2.05k
complexity
int64
1
9
#[test] fn test_seq_concat_string() { Python::with_gil(|py| { let v = "string"; let ob = v.to_object(py); let seq = ob.cast_as::<PySequence>(py).unwrap(); let concat_seq = seq.concat(seq).unwrap(); assert_eq!(12, concat_seq.len().unwrap()); let concat_v = "stringstring".to_owned(); for (el, cc) in seq.iter().unwrap().zip(concat_v.chars()) { assert_eq!(cc, el.unwrap().extract::<char>().unwrap()); } }); }
rust_cleaned_test_functions.jsonl/70325
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 297 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 14486, 57478, 3904, 368, 341, 286, 13027, 486, 4197, 1889, 321, 22428, 3288, 91, 341, 310, 1077, 348, 284, 330, 917, 876, 310, 1077, 1508, 284, 348, 2389, 5314, 46827, 317, 310, 1077, 12981, 284...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_write_json() { let data: &str = r#" { "error": null, "id": 0, "result": [ { "askEp": 426800, "bidEp": 426300, "fundingRateEr": 10000, "highEp": 429200, "indexEp": 426585, "lastEp": 426300, "lowEp": 417200, "markEp": 426605, "openEp": 420500, "openInterest": 10973, "predFundingRateEr": 10000, "symbol": "LTCUSD", "timestamp": 1595103169787216117, "turnoverEv": 13159209790, "volume": 1555142 }, { "askEp": 18121000, "bidEp": 18065000, "fundingRateEr": 10000, "highEp": 18121000, "indexEp": 18101870, "lastEp": 18121000, "lowEp": 18065000, "markEp": 18102726, "openEp": 18099000, "openInterest": 182039, "predFundingRateEr": 10000, "symbol": "GOLDUSD", "timestamp": 1595103169787268293, "turnoverEv": 152464051, "volume": 8426 } ] }"#; assert_eq!(write_json(data), true); }
rust_cleaned_test_functions.jsonl/84061
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 787 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 9165, 9455, 368, 341, 286, 1077, 821, 25, 609, 495, 284, 435, 2, 698, 310, 314, 330, 841, 788, 845, 345, 1060, 330, 307, 788, 220, 15, 345, 1060, 330, 1382, 788, 2278, 286, 341, 310, 330, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_is_banned_and_ban_for() { let mut rng = rand::rngs::OsRng; let (_sk, pk) = RistrettoPublicKey::random_keypair(&mut rng); let node_id = NodeId::from_key(&pk).unwrap(); let addresses = MultiaddressesWithStats::from("/ip4/123.0.0.123/tcp/8000".parse::<Multiaddr>().unwrap()); let mut peer: Peer = Peer::new(pk, node_id, addresses, PeerFlags::default(), PeerFeatures::empty(), &[]); assert_eq!(peer.is_banned(), false); peer.ban_for(Duration::from_millis(std::u64::MAX)); assert_eq!(peer.is_banned(), true); peer.ban_for(Duration::from_millis(0)); assert_eq!(peer.is_banned(), false); }
rust_cleaned_test_functions.jsonl/104017
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 315 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6892, 880, 7295, 8378, 880, 276, 5478, 368, 341, 286, 1077, 5206, 28422, 284, 10382, 486, 69890, 82, 486, 28867, 49, 968, 280, 286, 1077, 5453, 4886, 11, 22458, 8, 284, 431, 380, 2122, 983, 61...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_probe() { struct TestReaper; impl Actor for TestReaper { type Msg = (); fn receive(&mut self, _: (), _: &mut ActorContext<()>) {} fn receive_signal(&mut self, signal: Signal, ctx: &mut ActorContext<()>) { if let Signal::Started = signal { let mut probe = ctx.spawn_probe::<usize>(); let doubler = ctx.spawn(Doubler); doubler.tell(DoublerMsg::Double(4, probe.actor_ref.clone())); assert_eq!(probe.receive(time::Duration::from_secs(10)), 8); // the probe stops the actor? ctx.actor_ref().stop(); } } } assert!(ActorSystem::new().spawn(TestReaper).is_ok()); }
rust_cleaned_test_functions.jsonl/49289
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 459 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 49108, 368, 341, 286, 2036, 3393, 693, 3191, 401, 286, 11605, 24718, 369, 3393, 693, 3191, 341, 310, 943, 24205, 284, 25162, 310, 5168, 5258, 2099, 6984, 656, 11, 58536, 38104, 58536, 609, 6984, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_find_all_refs_enum_var_privacy() { check( r#" mod m { pub enum En { Variant { field<|>: u8, } } } fn f() -> m::En { m::En::Variant { field: 0 } } "#, expect![[r#" field Field FileId(0) 56..65 56..61 Other FileId(0) 125..130 RecordFieldExprOrPat Read "#]], ); }
rust_cleaned_test_functions.jsonl/47788
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 250 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21814, 5705, 60638, 31054, 4612, 24726, 2757, 368, 341, 286, 1779, 1006, 310, 435, 2, 698, 2593, 296, 341, 262, 6675, 7618, 2925, 341, 286, 39292, 341, 310, 2070, 27, 91, 26818, 575, 23, 345, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_pow() { assert_eq!(_1_2.pow(2), Ratio::new(1, 4)); assert_eq!(_1_2.pow(-2), Ratio::new(4, 1)); assert_eq!(_1.pow(1), _1); assert_eq!(_NEG1_2.pow(2), _1_2.pow(2)); assert_eq!(_NEG1_2.pow(3), -_1_2.pow(3)); assert_eq!(_3_2.pow(0), _1); assert_eq!(_3_2.pow(-1), _3_2.recip()); assert_eq!(_3_2.pow(3), Ratio::new(27, 8)); }
rust_cleaned_test_functions.jsonl/124703
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 260 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 56183, 368, 341, 286, 2060, 10714, 0, 2490, 16, 62, 17, 25290, 7, 17, 701, 50748, 486, 931, 7, 16, 11, 220, 19, 1106, 286, 2060, 10714, 0, 2490, 16, 62, 17, 25290, 4080, 17, 701, 50748, 48...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_execute_invalid_public_key() { let matches = CreateNodeVssCommand::args().get_matches_from(vec![ "createnodevss", "--threshold", "2", "--public-key", "x", "--private-key", "cQYYBMFS9dRR3Mt16gW4jixCqSiMhCwuDMHUBs6WeHMTxMnsq8Gh", ]); let response = CreateNodeVssCommand::execute(&matches); assert_eq!(format!("{}", response.err().unwrap()), "InvalidKey"); }
rust_cleaned_test_functions.jsonl/111721
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 275 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 44329, 31433, 27074, 3097, 368, 341, 286, 1077, 9071, 284, 4230, 1955, 53, 778, 4062, 486, 2116, 1005, 455, 38344, 5673, 25592, 90515, 310, 330, 837, 13518, 534, 85, 778, 756, 310, 14482, 28902, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_dispatching_with_struct() { init_test_log(); let tracker = AssertCollect::new(); let system = ActorSystem::create(ActorSystemConfig::default().thread_pool_size(2)); // We create a basic struct with a handler and use that handler to dispatch to other // inherent methods in the struct. Note that we don't have to implement any traits here // and there is nothing forcing the handler to be an inherent method. struct Data { value: i32, tracker: AssertCollect, } impl Data { fn handle_bool(mut self, message: bool) -> ActorResult<Self> { if message { self.value += 1; } else { self.value -= 1; } Ok(Status::done(self)) // This assertion will fail but we still have to return. } fn handle_i32(mut self, message: i32) -> ActorResult<Self> { self.value += message; Ok(Status::done(self)) // This assertion will fail but we still have to return. } async fn handle(self, _context: Context, message: Message) -> ActorResult<Self> { if let Some(msg) = message.content_as::<bool>() { self.handle_bool(*msg) } else if let Some(msg) = message.content_as::<i32>() { self.handle_i32(*msg) } else if let Some(_msg) = message.content_as::<SystemMsg>() { // want the most frequently received messages first. Ok(Status::done(self)) } else { self.tracker.panic("Failed to dispatch properly") } } } let data = Data { value: 0, tracker: tracker.clone(), }; let aid = system.spawn().with(data, Data::handle).unwrap(); // Send some messages to the actor. aid.send_new(11).unwrap(); aid.send_new(true).unwrap(); aid.send_new(true).unwrap(); aid.send_new(false).unwrap(); await_received(&aid, 4, 1000).unwrap(); system.trigger_and_await_shutdown(None); tracker.collect(); }
rust_cleaned_test_functions.jsonl/1275
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1116 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 42991, 287, 6615, 15126, 368, 341, 286, 2930, 4452, 5224, 1428, 286, 1077, 28331, 284, 5319, 47504, 486, 931, 543, 286, 1077, 1849, 284, 24718, 2320, 486, 3182, 7, 18870, 2320, 2648, 486, 2258, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_zero_add() { type LengthCm = Length<f32, Cm>; let length: LengthCm = Length::new(5.0); let result = length - LengthCm::zero(); assert_eq!(result, length); }
rust_cleaned_test_functions.jsonl/50594
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 105 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 19359, 2891, 368, 341, 286, 943, 17287, 34, 76, 284, 17287, 63895, 18, 17, 11, 356, 76, 10133, 286, 1077, 3084, 25, 17287, 34, 76, 284, 17287, 486, 931, 7, 20, 13, 15, 626, 286, 1077, 1102, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_json() { assert_eq!(json(true).unwrap(), "true"); assert_eq!(json("foo").unwrap(), r#""foo""#); assert_eq!(json(&true).unwrap(), "true"); assert_eq!(json(&"foo").unwrap(), r#""foo""#); assert_eq!( json(&vec!["foo", "bar"]).unwrap(), r#"[ "foo", "bar" ]"# ); }
rust_cleaned_test_functions.jsonl/120647
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 199 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 9455, 368, 341, 286, 2060, 10714, 10297, 2236, 3715, 568, 15454, 1507, 330, 1866, 797, 286, 2060, 10714, 10297, 2236, 445, 7975, 1827, 15454, 1507, 435, 2, 3014, 7975, 3014, 2, 317, 286, 2060, 1...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_process_missed_votes() { let account_a = solana_sdk::pubkey::new_rand(); let mut vote_state_a = VoteState::new_for_test(&account_a); let account_b = solana_sdk::pubkey::new_rand(); let mut vote_state_b = VoteState::new_for_test(&account_b); // process some votes on account a (0..5).for_each(|i| vote_state_a.process_slot_vote_unchecked(i as u64)); assert_ne!(recent_votes(&vote_state_a), recent_votes(&vote_state_b)); // as long as b has missed less than "NUM_RECENT" votes both accounts should be in sync let slots = (0u64..MAX_RECENT_VOTES as u64).collect(); let vote = Vote::new(slots, Hash::default()); let slot_hashes: Vec<_> = vote.slots.iter().rev().map(|x| (*x, vote.hash)).collect(); assert_eq!( vote_state_a.process_vote(&vote, &slot_hashes, 0, Some(&FeatureSet::default())), Ok(()) ); assert_eq!( vote_state_b.process_vote(&vote, &slot_hashes, 0, Some(&FeatureSet::default())), Ok(()) ); assert_eq!(recent_votes(&vote_state_a), recent_votes(&vote_state_b)); }
rust_cleaned_test_functions.jsonl/6092
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 535 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 11305, 67722, 291, 65116, 368, 341, 286, 1077, 2692, 4306, 284, 2048, 3362, 61783, 486, 9585, 792, 486, 931, 33864, 543, 286, 1077, 5206, 6910, 4387, 4306, 284, 34034, 1397, 486, 931, 5478, 4452, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_nested_class_methods() { let hdr = indoc! {" #include <cstdint> class A { public: virtual ~A() {} struct B { virtual void b() const {} }; virtual void a() const {} struct C { virtual void b() const {} }; virtual void c() const {} struct D { virtual void b() const {} }; }; "}; let rs = quote! { let a = ffi::A::make_unique(); a.a(); a.c(); }; run_test("", hdr, rs, &["A"], &[]); }
rust_cleaned_test_functions.jsonl/9974
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 307 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 66279, 4790, 36084, 368, 341, 262, 1077, 36615, 284, 1257, 509, 0, 314, 698, 262, 671, 997, 366, 96975, 397, 262, 536, 362, 341, 262, 584, 510, 286, 4108, 3968, 32, 368, 5613, 286, 2036, 425, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_global_const_i32() { // create a GlobalType instance let result = GlobalType::create(ValType::I32, Mutability::Const); assert!(result.is_ok()); let mut ty = result.unwrap(); assert!(!ty.ctx.is_null()); // create a const Global instance let result = Global::create(&mut ty, Value::I32(99)); assert!(result.is_ok()); assert!(ty.ctx.is_null()); assert!(ty.registered); let mut global_const = result.unwrap(); // access the value held by global_const assert_eq!(global_const.get_value(), Value::I32(99)); let result = global_const.set_value(Value::I32(0)); assert!(result.is_err()); // access the global type let result = global_const.ty(); assert!(result.is_ok()); let ty = result.unwrap(); assert!(!ty.ctx.is_null()); assert!(ty.registered); assert_eq!(ty.value_type(), ValType::I32); assert_eq!(ty.mutability(), Mutability::Const); }
rust_cleaned_test_functions.jsonl/130796
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 465 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 19296, 13610, 5318, 18, 17, 368, 341, 286, 442, 1855, 264, 7962, 929, 2867, 198, 286, 1077, 1102, 284, 7962, 929, 486, 3182, 7, 2208, 929, 486, 40, 18, 17, 11, 31228, 2897, 486, 19167, 317, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_mmds_detour_and_injection() { let mut net = Net::default_net(TestMutators::default()); let sha = MacAddr::parse_str("11:11:11:11:11:11").unwrap(); let spa = Ipv4Addr::new(10, 1, 2, 3); let tha = MacAddr::parse_str("22:22:22:22:22:22").unwrap(); let tpa = Ipv4Addr::new(169, 254, 169, 254); let packet_len; { // Create an ethernet frame. let eth_frame_i = EthernetFrame::write_incomplete( frame_bytes_from_buf_mut(&mut net.tx_frame_buf), tha, sha, ETHERTYPE_ARP, ) .ok() .unwrap(); // Set its length to hold an ARP request. let mut eth_frame_complete = eth_frame_i.with_payload_len_unchecked(ETH_IPV4_FRAME_LEN); // Save the total frame length. packet_len = vnet_hdr_len() + eth_frame_complete.payload_offset() + ETH_IPV4_FRAME_LEN; // Create the ARP request. let arp_req = EthIPv4ArpFrame::write_request( eth_frame_complete.payload_mut(), sha, spa, tha, tpa, ); // Validate success. assert!(arp_req.is_ok()); } // Call the code which sends the packet to the host or MMDS. // Validate the frame was consumed by MMDS and that the metrics reflect that. check_metric_after_block!( &METRICS.mmds.rx_accepted, 1, assert!(Net::write_to_mmds_or_tap( net.mmds_ns.as_mut(), &mut net.tx_rate_limiter, &net.tx_frame_buf[..packet_len], &mut net.tap, Some(sha), )) ); // Validate that MMDS has a response and we can retrieve it. check_metric_after_block!( &METRICS.mmds.tx_frames, 1, net.read_from_mmds_or_tap().unwrap() ); }
rust_cleaned_test_functions.jsonl/63424
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1136 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 717, 2277, 82, 24409, 413, 8378, 1243, 7606, 368, 341, 286, 1077, 5206, 4179, 284, 9374, 486, 2258, 19722, 31159, 51440, 2973, 486, 2258, 5231, 286, 1077, 15870, 284, 7401, 13986, 486, 6400, 2895,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_generate_mul_table() { let m = G2Poly(0b111); assert_eq!(include_str!("../tests/mul_table.txt").trim(), generate_mul_table_string(m)); }
rust_cleaned_test_functions.jsonl/728
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 89 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 48851, 24944, 5237, 368, 341, 286, 1077, 296, 284, 479, 17, 38164, 7, 15, 65, 16, 16, 16, 626, 286, 2060, 10714, 10297, 997, 2895, 17223, 1244, 23841, 3183, 360, 5237, 3909, 1827, 10666, 1507, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_uncle_proposals_hash() { let (shared, chain1, chain2) = prepare(); let dummy_context = dummy_context(&shared); let block_number = 17; let uncle = chain1[16] .to_owned() .as_advanced_builder() .parent_hash(chain2[15].hash()) .proposal([1; 10].pack()) .build_unchecked() .as_uncle(); let block = chain2[18] .to_owned() .as_advanced_builder() .uncle(uncle) .build(); let epoch = epoch(&shared, &chain2, block_number); let uncle_verifier_context = UncleVerifierContext::new(&dummy_context, &epoch); let verifier = UnclesVerifier::new(uncle_verifier_context, &block); assert_eq!( verifier.verify(), Err(Error::Uncles(UnclesError::ProposalsHash)) ); }
rust_cleaned_test_functions.jsonl/118904
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 363 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 76576, 273, 21663, 85975, 8950, 368, 341, 262, 1077, 320, 6100, 11, 8781, 16, 11, 8781, 17, 8, 284, 10549, 543, 262, 1077, 17292, 8467, 284, 17292, 8467, 2099, 6100, 317, 262, 1077, 2504, 5500, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_late_binding() { check_output_default( "fun a() { b(); }\n\ fun b() { print \"hello world\"; }\n\ \n\ a();\n", "'hello world'", ) }
rust_cleaned_test_functions.jsonl/111862
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 148 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 907, 349, 60815, 368, 341, 286, 1779, 7645, 9993, 1006, 310, 330, 11894, 264, 368, 314, 293, 2129, 51300, 77, 5661, 1797, 2464, 293, 368, 314, 1173, 7245, 14990, 1879, 2105, 26, 51300, 77, 5661,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_du_hard_link() { let scene = TestScenario::new(util_name!()); let at = &scene.fixtures; at.hard_link(SUB_FILE, SUB_LINK); let result = scene.ucmd().arg(SUB_DIR_LINKS).succeeds(); #[cfg(target_os = "linux")] { let result_reference = scene.cmd("du").arg(SUB_DIR_LINKS).run(); if result_reference.succeeded() { assert_eq!(result.stdout_str(), result_reference.stdout_str()); return; } } // We do not double count hard links as the inodes are identical _du_hard_link(result.stdout_str()); }
rust_cleaned_test_functions.jsonl/23734
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 271 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 814, 84, 77712, 7233, 368, 341, 262, 1077, 6109, 284, 3393, 54031, 486, 931, 67811, 1269, 0, 1423, 262, 1077, 518, 284, 609, 22483, 67785, 18513, 401, 262, 518, 860, 567, 7233, 3759, 4493, 8087,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_timestamp() { use std::collections::HashSet; let timestamp = ::prost_types::Timestamp { seconds: 100, nanos: 42, }; let mut non_normalized_timestamp = ::prost_types::Timestamp { seconds: 99, nanos: 1_000_000_042, }; let mut hashset = HashSet::new(); assert!(hashset.insert(timestamp.clone())); assert!( hashset.insert(non_normalized_timestamp.clone()), "hash for non-normalized different and should be inserted" ); assert_ne!( timestamp, non_normalized_timestamp, "non-nomarlized timestamp considered different" ); non_normalized_timestamp.normalize(); assert_eq!( timestamp, non_normalized_timestamp, "normalized timestamp matches" ); let mut hashset = HashSet::new(); assert!(hashset.insert(timestamp.clone())); assert!( !hashset.insert(non_normalized_timestamp), "hash for normalized should match and not inserted" ); }
rust_cleaned_test_functions.jsonl/28035
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 423 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 23073, 368, 341, 262, 990, 1460, 486, 51137, 486, 44601, 401, 262, 1077, 11441, 284, 3504, 776, 267, 9763, 486, 20812, 341, 286, 6486, 25, 220, 16, 15, 15, 345, 286, 20021, 436, 25, 220, 19, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_redeem_tokens() { let (bank, alice_keypair) = create_bank(38); let bank = Arc::new(bank); let bank_client = BankClient::new_shared(&bank); let alice_pubkey = alice_keypair.pubkey(); let date_keypair = Keypair::new(); let date_pubkey = date_keypair.pubkey(); let current_date = Utc.ymd(2019, 1, 1); create_date_account(&bank_client, &date_keypair, &alice_keypair, current_date).unwrap(); let contract_keypair = Keypair::new(); let contract_pubkey = contract_keypair.pubkey(); let bob_pubkey = Pubkey::new_rand(); let start_date = Utc.ymd(2018, 1, 1); create_vest_account( &bank_client, &contract_keypair, &alice_keypair, &alice_pubkey, &bob_pubkey, start_date, &date_pubkey, 36, ) .unwrap(); assert_eq!(bank_client.get_balance(&alice_pubkey).unwrap(), 1); assert_eq!(bank_client.get_balance(&contract_pubkey).unwrap(), 36); send_redeem_tokens( &bank_client, &contract_pubkey, &alice_keypair, &bob_pubkey, &date_pubkey, ) .unwrap(); assert_eq!(bank_client.get_balance(&alice_pubkey).unwrap(), 1); assert_eq!(bank_client.get_balance(&contract_pubkey).unwrap(), 24); assert_eq!(bank_client.get_balance(&bob_pubkey).unwrap(), 12); // Update the date oracle and redeem more tokens store_date( &bank_client, &date_keypair, &alice_keypair, Utc.ymd(2019, 2, 1), ) .unwrap(); // Force a new blockhash so that there's not a duplicate signature. for _ in 0..bank.ticks_per_slot() { bank.register_tick(&hash(&[1])); } send_redeem_tokens( &bank_client, &contract_pubkey, &alice_keypair, &bob_pubkey, &date_pubkey, ) .unwrap(); assert_eq!(bank_client.get_balance(&alice_pubkey).unwrap(), 1); assert_eq!(bank_client.get_balance(&contract_pubkey).unwrap(), 23); assert_eq!(bank_client.get_balance(&bob_pubkey).unwrap(), 13); }
rust_cleaned_test_functions.jsonl/88804
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1200 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 1288, 450, 336, 28838, 368, 341, 286, 1077, 320, 17033, 11, 70433, 3097, 12670, 8, 284, 1855, 35733, 7, 18, 23, 317, 286, 1077, 6073, 284, 19689, 486, 931, 1883, 1180, 317, 286, 1077, 6073, 81...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_repr_parse_valid() { let packet = Packet::new_unchecked(&REPR_PACKET_BYTES[..]); let repr = Repr::parse(&packet).unwrap(); assert_eq!(repr, packet_repr()); }
rust_cleaned_test_functions.jsonl/126219
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 102 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 68535, 21039, 8337, 368, 341, 286, 1077, 10151, 284, 28889, 486, 931, 4907, 7549, 2099, 787, 6480, 40328, 40705, 95874, 2558, 286, 1077, 30636, 284, 1032, 649, 486, 6400, 2099, 24829, 568, 15454, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_string_debug_malformed() { let string = NbtString::new(b"foo bar\" \0 \xC0"); let formatted = format!("{:?}", string); assert_eq!(formatted, r#""foo bar\" \0 \xC0""#); }
rust_cleaned_test_functions.jsonl/67163
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 93 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 3904, 15446, 717, 278, 10155, 368, 341, 262, 1077, 914, 284, 451, 12755, 703, 486, 931, 1883, 1, 7975, 3619, 2105, 1124, 15, 1124, 12125, 15, 3071, 262, 1077, 23126, 284, 3561, 88928, 25, 52652,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_rev_iterator() { let mut m = VecMap::new(); assert!(m.insert(0, 1).is_none()); assert!(m.insert(1, 2).is_none()); assert!(m.insert(3, 5).is_none()); assert!(m.insert(6, 10).is_none()); assert!(m.insert(10, 11).is_none()); let mut it = m.iter().rev(); assert_eq!(it.next().unwrap(), (10, &11)); assert_eq!(it.next().unwrap(), (6, &10)); assert_eq!(it.next().unwrap(), (3, &5)); assert_eq!(it.next().unwrap(), (1, &2)); assert_eq!(it.next().unwrap(), (0, &1)); assert!(it.next().is_none()); }
rust_cleaned_test_functions.jsonl/53273
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 323 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 38082, 13491, 368, 341, 286, 1077, 5206, 296, 284, 11312, 2227, 486, 931, 1428, 286, 2060, 10297, 76, 7030, 7, 15, 11, 220, 16, 568, 285, 31488, 1423, 286, 2060, 10297, 76, 7030, 7, 16, 11, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_single_neuron_proposal() { check_proposal_status_after_voting_and_after_expiration( vec![Neuron { dissolve_state: NOTDISSOLVING_MIN_DISSOLVE_DELAY_TO_VOTE, cached_neuron_stake_e8s: 1, ..Neuron::default() }], "P", ProposalStatus::Executed, ProposalStatus::Executed, ); }
rust_cleaned_test_functions.jsonl/1109
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 201 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 19487, 13925, 36090, 21663, 32556, 368, 341, 262, 1779, 21663, 32556, 4773, 19844, 2273, 11519, 8378, 19844, 2702, 28479, 1006, 286, 7486, 20703, 8813, 36090, 341, 310, 72639, 4387, 25, 4183, 17625, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_from_assignment_node() { let node = AssignmentNode { lhs: Box::new(VarNode::new("adsf").into()), rhs: Box::new(IntNode::new(324).into()), span: None, }; let clone = node.clone(); assert_eq!( ExpressionNode::from(node), ExpressionNode::Assignment(clone) ); }
rust_cleaned_test_functions.jsonl/89513
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 201 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 5673, 51891, 5084, 368, 341, 286, 1077, 2436, 284, 34427, 1955, 341, 310, 22505, 25, 8261, 486, 931, 7, 3962, 1955, 486, 931, 445, 7664, 69, 1827, 18122, 14702, 310, 12916, 25, 8261, 486, 931, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_basic() { use std::thread; let x = 5; let y = Blocker::new(&x); let z = y.get(); thread::spawn(move || { thread::sleep_ms(1000); println!("{}", *z); }); }
rust_cleaned_test_functions.jsonl/94621
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 111 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 34729, 368, 341, 262, 990, 1460, 486, 4528, 280, 262, 1077, 856, 284, 220, 20, 280, 262, 1077, 379, 284, 8362, 261, 486, 931, 2099, 87, 317, 262, 1077, 1147, 284, 379, 670, 543, 262, 4516, 4...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_l_to_r_password() { let test_door: Door = Door("abc".to_string()); assert_eq!(test_door.l_to_r_password(), "18f47a30"); }
rust_cleaned_test_functions.jsonl/125869
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 83 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 907, 2346, 1710, 10122, 368, 341, 286, 1077, 1273, 78962, 25, 24191, 284, 24191, 445, 13683, 3263, 983, 3904, 5231, 286, 2060, 10714, 10297, 1944, 78962, 918, 2346, 1710, 10122, 1507, 330, 16, 23,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_to_json() { let config = Config { width: 100, height: 100, samples_per_pixel: 1, max_depth: 1, sky: Some(Sky::new_default_sky()), camera: Camera::new( Point3D::new(0.0, 0.0, 0.0), Point3D::new(0.0, 0.0, -1.0), Point3D::new(0.0, 1.0, 0.0), 90.0, 1.0, ), objects: vec![Sphere::new( Point3D::new(0.0, 0.0, -1.0), 0.5, Material::Lambertian(Lambertian::new(Srgb::new( 0.8 as f32, 0.3 as f32, 0.3 as f32, ))), )], }; let serialized = serde_json::to_string(&config).unwrap(); assert_eq!("{\"width\":100,\"height\":100,\"samples_per_pixel\":1,\"max_depth\":1,\"sky\":{\"texture\":\"\"},\"camera\":{\"look_from\":{\"x\":0.0,\"y\":0.0,\"z\":0.0},\"look_at\":{\"x\":0.0,\"y\":0.0,\"z\":-1.0},\"vup\":{\"x\":0.0,\"y\":1.0,\"z\":0.0},\"vfov\":90.0,\"aspect\":1.0},\"objects\":[{\"center\":{\"x\":0.0,\"y\":0.0,\"z\":-1.0},\"radius\":0.5,\"material\":{\"Lambertian\":{\"albedo\":[0.8,0.3,0.3]}}}]}", serialized); }
rust_cleaned_test_functions.jsonl/118684
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 657 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2346, 9455, 368, 341, 262, 1077, 2193, 284, 5532, 341, 286, 2374, 25, 220, 16, 15, 15, 345, 286, 2608, 25, 220, 16, 15, 15, 345, 286, 10469, 5678, 29760, 25, 220, 16, 345, 286, 1932, 19061, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_norwegian_lang_serde() { #[derive(Serialize, Deserialize, PartialEq, Debug)] struct TestStruct { no: Lang, nb: Lang, en: Lang } let test_json = "{\"nb\":\"nb\",\"no\":\"no\",\"en\":\"en\"}"; let test_struct: TestStruct = serde_json::from_str(test_json).unwrap(); assert_eq!(test_struct.nb, Lang::NorwegianBokmal); assert_eq!(test_struct.no, Lang::NorwegianBokmal); assert_eq!(test_struct.en, Lang::English); let test_struct_serialized = serde_json::to_string(&test_struct).unwrap(); let test_struct_deserialized: TestStruct = serde_json::from_str( test_struct_serialized.as_str() ).unwrap(); assert_eq!(test_struct_deserialized.nb, Lang::NorwegianBokmal); assert_eq!(test_struct_deserialized.no, Lang::NorwegianBokmal); assert_eq!(test_struct_deserialized.en, Lang::English); }
rust_cleaned_test_functions.jsonl/24720
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 451 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 1089, 269, 36565, 17876, 75861, 450, 368, 1476, 286, 11506, 27098, 3759, 9050, 11, 48440, 11, 55039, 11, 11091, 5563, 286, 2036, 3393, 9422, 341, 310, 902, 25, 22463, 345, 310, 16649, 25, 22463, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_verify_message_valid_signature() { let message = "test message".to_owned(); let signature = "304402204146402099809E1F021421569F72BA34DCAFCC832741AB6310F887F60734D9F002203E813AD6A59D67D8EE06C8EA05BCC1BA8F690B631E6F243E8BE60633D27BE05D".to_owned(); let out_dir = std::env::var("OUT_DIR").unwrap(); let mut jscontext = JavaScript::new(format!("{}/xpring.js", out_dir))?; let verified_message = verify( &mut jscontext, message, signature, "038BF420B5271ADA2D7479358FF98A29954CF18DC25155184AEAD05796DA737E89".to_owned(), )?; assert!(verified_message); }
rust_cleaned_test_functions.jsonl/118748
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 345 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 35638, 6462, 8337, 39859, 368, 341, 286, 1077, 1943, 284, 330, 1944, 1943, 3263, 983, 51973, 543, 286, 1077, 11957, 284, 330, 18, 15, 19, 19, 15, 17, 17, 15, 19, 16, 19, 21, 19, 15, 17, 15...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_decode_unsigned_byte() { let byte: u8 = 255; let decoded: u8 = decode_unsigned_byte(byte); assert_eq!(byte, decoded) }
rust_cleaned_test_functions.jsonl/16121
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 69 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 15227, 67830, 19737, 368, 341, 262, 1077, 4922, 25, 575, 23, 284, 220, 17, 20, 20, 280, 262, 1077, 29213, 25, 575, 23, 284, 16895, 67830, 19737, 19738, 317, 262, 2060, 10714, 10297, 3782, 11, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_de() { let b= to_bson(&1u64).unwrap(); let c:Bson = from_bson(b).unwrap(); println!("{}",c); }
rust_cleaned_test_functions.jsonl/12640
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 85 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2259, 368, 341, 286, 1077, 293, 28, 311, 880, 930, 2099, 16, 84, 21, 19, 568, 15454, 543, 286, 1077, 272, 81268, 930, 284, 504, 880, 930, 1883, 568, 15454, 543, 286, 13751, 79878, 66, 317, 2...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_as_dangerous_str() { // Valid assert_eq!(input!(b"").to_dangerous_str::<Expected>().unwrap(), ""); assert_eq!( input!(b"hello").to_dangerous_str::<Expected>().unwrap(), "hello" ); // Invalid let _ = input!(b"\xff").to_dangerous_str::<Expected>().unwrap_err(); }
rust_cleaned_test_functions.jsonl/15432
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 155 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 11898, 814, 4003, 782, 2895, 368, 341, 262, 442, 7818, 198, 262, 2060, 10714, 10297, 1355, 10297, 65, 1, 1827, 983, 814, 4003, 782, 2895, 27638, 18896, 10483, 15454, 1507, 14498, 262, 2060, 10714,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_benchmarks() { new_test_ext().execute_with(|| { assert_ok!(test_benchmark_report_offence_im_online::<Test>()); assert_ok!(test_benchmark_report_offence_grandpa::<Test>()); assert_ok!(test_benchmark_report_offence_babe::<Test>()); assert_ok!(test_benchmark_on_initialize::<Test>()); }); }
rust_cleaned_test_functions.jsonl/81689
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 142 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 880, 19762, 15544, 368, 341, 197, 8638, 4452, 9927, 1005, 10257, 6615, 79453, 341, 298, 6948, 19817, 10297, 1944, 880, 39381, 14813, 13651, 763, 17895, 51546, 27638, 2271, 32872, 298, 6948, 19817, 1...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_multiplication() { let a = Fp([ 0x0397_a383_2017_0cd4, 0x734c_1b2c_9e76_1d30, 0x5ed2_55ad_9a48_beb5, 0x095a_3c6b_22a7_fcfc, 0x2294_ce75_d4e2_6a27, 0x1333_8bd8_7001_1ebb, ]); let b = Fp([ 0xb9c3_c7c5_b119_6af7, 0x2580_e208_6ce3_35c1, 0xf49a_ed3d_8a57_ef42, 0x41f2_81e4_9846_e878, 0xe076_2346_c384_52ce, 0x0652_e893_26e5_7dc0, ]); let c = Fp([ 0xf96e_f3d7_11ab_5355, 0xe8d4_59ea_00f1_48dd, 0x53f7_354a_5f00_fa78, 0x9e34_a4f3_125c_5f83, 0x3fbe_0c47_ca74_c19e, 0x01b0_6a8b_bd4a_dfe4, ]); assert_eq!(a * b, c); }
rust_cleaned_test_functions.jsonl/23229
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 528 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 91802, 1693, 368, 341, 262, 1077, 264, 284, 434, 79, 8956, 286, 220, 15, 87, 15, 18, 24, 22, 4306, 18, 23, 18, 62, 17, 15, 16, 22, 62, 15, 4385, 19, 345, 286, 220, 15, 87, 22, 18, 19, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_unconf_chan_via_listen() { do_test_unconf_chan(true, true, false, ConnectStyle::FullBlockViaListen); do_test_unconf_chan(false, true, false, ConnectStyle::FullBlockViaListen); do_test_unconf_chan(true, false, false, ConnectStyle::FullBlockViaListen); do_test_unconf_chan(false, false, false, ConnectStyle::FullBlockViaListen); }
rust_cleaned_test_functions.jsonl/97703
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 127 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 4907, 6135, 45552, 80710, 79286, 368, 341, 19935, 4452, 4907, 6135, 45552, 3715, 11, 830, 11, 895, 11, 13015, 2323, 486, 9432, 4713, 54428, 38714, 317, 19935, 4452, 4907, 6135, 45552, 3576, 11, 83...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_mul() { let a = Jacobian::from(Affine::new( field_element!("01ef15c18599971b7beced415a40f0c7deacfd9b0d1819e03d723d8bc943cfca"), field_element!("005668060aa49730b7be4801df46ec62de53ecd11abe43a32873000c36e8dc1f"), )); let b = ScalarFieldElement::from(u256h!( "07374b7d69dc9825fc758b28913c8d2a27be5e7c32412f612b20c9c97afbe4dd" )); let c = Jacobian::from(Affine::new( field_element!("00f24921907180cd42c9d2d4f9490a7bc19ac987242e80ac09a8ac2bcf0445de"), field_element!("018a7a2ab4e795405f924de277b0e723d90eac55f2a470d8532113d735bdedd4"), )); assert_eq!(a * b, c); }
rust_cleaned_test_functions.jsonl/38966
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 408 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 24944, 368, 341, 286, 1077, 264, 284, 24521, 1103, 486, 1499, 4346, 542, 482, 486, 931, 1006, 310, 2070, 7894, 17223, 15, 16, 823, 16, 20, 66, 16, 23, 20, 24, 24, 24, 22, 16, 65, 22, 16692...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_type_required_double() { let schemaReplicant = SchemaReplicant::default(); let causetq = r#"[:find ?x :where [?x _ ?e] [(type ?e :edb.type/double)]]"#; let SQLCausetQ { allegrosql, args } = translate(&schemaReplicant, causetq); assert_eq!(allegrosql, "SELECT DISTINCT `Causets00`.e AS `?x` \ FROM `causets` AS `Causets00` \ WHERE ((`Causets00`.value_type_tag = 5 AND \ (typeof(`Causets00`.v) = 'real')))"); assert_eq!(args, vec![]); }
rust_cleaned_test_functions.jsonl/90702
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 280 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 1819, 18743, 24598, 368, 341, 262, 1077, 10802, 18327, 35237, 284, 12539, 18327, 35237, 486, 2258, 1428, 262, 1077, 2162, 18187, 80, 284, 435, 55543, 3447, 3903, 937, 87, 549, 2870, 508, 30, 87, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_file_dict_file_record_corrupted() { let tempdir = tempfile::tempdir().unwrap(); let mut file_dict_file = FileDictionaryFile::new( tempdir.path(), "test_file_dict_file_record_corrupted_1", true, 10, /*file_rewrite_threshold*/ ) .unwrap(); let info1 = create_file_info(1, EncryptionMethod::Aes256Ctr); let info2 = create_file_info(2, EncryptionMethod::Unknown); // 9 represents that the first 9 bytes will be discarded. fail::cfg("file_dict_log_append_incomplete", "return(9)").unwrap(); file_dict_file.insert("info1", &info1).unwrap(); fail::remove("file_dict_log_append_incomplete"); file_dict_file.insert("info2", &info2).unwrap(); // Intermediate record damage is not allowed. assert!(file_dict_file.recovery().is_err()); let mut file_dict_file = FileDictionaryFile::new( tempdir.path(), "test_file_dict_file_record_corrupted_2", true, 10, /*file_rewrite_threshold*/ ) .unwrap(); let info1 = create_file_info(1, EncryptionMethod::Aes256Ctr); let info2 = create_file_info(2, EncryptionMethod::Unknown); file_dict_file.insert("info1", &info1).unwrap(); fail::cfg("file_dict_log_append_incomplete", "return(9)").unwrap(); file_dict_file.insert("info2", &info2).unwrap(); fail::remove("file_dict_log_append_incomplete"); // The ending record can be discarded. let file_dict = file_dict_file.recovery().unwrap(); assert_eq!(*file_dict.files.get("info1").unwrap(), info1); assert_eq!(file_dict.files.len(), 1); }
rust_cleaned_test_functions.jsonl/132890
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 652 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2458, 5243, 2458, 14192, 14734, 85954, 368, 341, 262, 1077, 2730, 3741, 284, 54819, 486, 3888, 3741, 1005, 15454, 543, 262, 1077, 5206, 1034, 5243, 2458, 284, 2887, 8517, 1703, 486, 931, 1006, 286...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_persistent_prefixes() { // to ensure all the variants are tested by this test. let mut remaining: HashSet<_> = SecureTokenKind::VARIANTS.iter().copied().collect(); let mut ensure = |kind: SecureTokenKind, prefix| { assert_eq!(kind.prefix(), prefix); remaining.remove(&kind); }; ensure(SecureTokenKind::Api, "cio"); assert!( remaining.is_empty(), "not all variants have a test to check the prefix" ); }
rust_cleaned_test_functions.jsonl/90684
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 252 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 620, 13931, 13974, 288, 368, 341, 16885, 286, 442, 311, 5978, 678, 279, 26012, 525, 12510, 553, 419, 1273, 624, 286, 1077, 5206, 9664, 25, 18931, 32399, 29, 284, 34502, 3323, 10629, 486, 53, 160...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_day16() { let part1 = day16_part1(); assert_eq!(part1, "12541048"); let part2 = day16_part2(); assert_eq!(part2, "62858988"); }
rust_cleaned_test_functions.jsonl/95569
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 102 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 16763, 16, 21, 368, 341, 286, 1077, 949, 16, 284, 1899, 16, 21, 10495, 16, 543, 286, 2060, 10714, 10297, 4480, 16, 11, 330, 16, 17, 20, 19, 16, 15, 19, 23, 3071, 286, 1077, 949, 17, 284, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_ip_addrs_split_by_preference() { let ip_v4 = Ipv4Addr::new(127, 0, 0, 1); let ip_v6 = Ipv6Addr::new(0, 0, 0, 0, 0, 0, 0, 1); let v4_addr = (ip_v4, 80).into(); let v6_addr = (ip_v6, 80).into(); let (mut preferred, mut fallback) = SocketAddrs { iter: vec![v4_addr, v6_addr].into_iter(), } .split_by_preference(None, None); assert!(preferred.next().unwrap().is_ipv4()); assert!(fallback.next().unwrap().is_ipv6()); let (mut preferred, mut fallback) = SocketAddrs { iter: vec![v6_addr, v4_addr].into_iter(), } .split_by_preference(None, None); assert!(preferred.next().unwrap().is_ipv6()); assert!(fallback.next().unwrap().is_ipv4()); let (mut preferred, mut fallback) = SocketAddrs { iter: vec![v4_addr, v6_addr].into_iter(), } .split_by_preference(Some(ip_v4), Some(ip_v6)); assert!(preferred.next().unwrap().is_ipv4()); assert!(fallback.next().unwrap().is_ipv6()); let (mut preferred, mut fallback) = SocketAddrs { iter: vec![v6_addr, v4_addr].into_iter(), } .split_by_preference(Some(ip_v4), Some(ip_v6)); assert!(preferred.next().unwrap().is_ipv6()); assert!(fallback.next().unwrap().is_ipv4()); let (mut preferred, fallback) = SocketAddrs { iter: vec![v4_addr, v6_addr].into_iter(), } .split_by_preference(Some(ip_v4), None); assert!(preferred.next().unwrap().is_ipv4()); assert!(fallback.is_empty()); let (mut preferred, fallback) = SocketAddrs { iter: vec![v4_addr, v6_addr].into_iter(), } .split_by_preference(None, Some(ip_v6)); assert!(preferred.next().unwrap().is_ipv6()); assert!(fallback.is_empty()); }
rust_cleaned_test_functions.jsonl/29699
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 956 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 10385, 2891, 5428, 17052, 3710, 92718, 368, 341, 286, 1077, 5997, 2273, 19, 284, 358, 30168, 19, 13986, 486, 931, 7, 16, 17, 22, 11, 220, 15, 11, 220, 15, 11, 220, 16, 317, 286, 1077, 5997, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_parse_test_query_plus_a_b_plus_d() { test_parse_query_to_ast_helper("+(a b) +d", "(+(*\"a\" *\"b\") +\"d\")"); }
rust_cleaned_test_functions.jsonl/64421
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 81 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21039, 4452, 5738, 28043, 4306, 880, 28043, 814, 368, 341, 286, 1273, 21039, 5738, 2346, 48019, 10418, 445, 13362, 64, 293, 8, 488, 67, 497, 11993, 10, 4071, 2105, 64, 2105, 353, 2105, 65, 62705...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_model_no_mapping_1() { let device = device(None); let uplink = default_uplink(5); let model_id = eval_data_schema(None, &device, &None, &uplink.port.to_string()); assert_eq!(model_id, None); }
rust_cleaned_test_functions.jsonl/29637
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 122 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 5047, 6536, 26930, 62, 16, 368, 341, 286, 1077, 3671, 284, 3671, 26717, 317, 286, 1077, 705, 2080, 284, 1638, 8237, 2080, 7, 20, 626, 286, 1077, 1614, 842, 284, 5603, 1769, 25371, 26717, 11, 6...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_max() { assert_eq!(1f32.max(&2f32), 2f32); assert_eq!(2f32.max(&1f32), 2f32); }
rust_cleaned_test_functions.jsonl/33101
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 76 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6345, 368, 341, 286, 2060, 10714, 10297, 16, 69, 18, 17, 6678, 2099, 17, 69, 18, 17, 701, 220, 17, 69, 18, 17, 317, 286, 2060, 10714, 10297, 17, 69, 18, 17, 6678, 2099, 16, 69, 18, 17, 7...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_with_labels_gather() { let mut labels = HashMap::new(); labels.insert("tkey".to_string(), "tvalue".to_string()); let r = Registry::new_custom(None, Some(labels)).unwrap(); let counter_a = Counter::new("test_a_counter", "test help").unwrap(); r.register(Box::new(counter_a.clone())).unwrap(); let counter_vec = CounterVec::new(Opts::new("test_vec", "test vec help"), &["a", "b"]).unwrap(); r.register(Box::new(counter_vec.clone())).unwrap(); counter_vec.with_label_values(&["one", "two"]).inc(); counter_vec.with_label_values(&["three", "four"]).inc(); let mfs = r.gather(); assert_eq!(mfs.len(), 2); assert_eq!(mfs[0].get_name(), "test_a_counter"); assert_eq!(mfs[1].get_name(), "test_vec"); let mut needle = proto::LabelPair::default(); needle.set_name("tkey".to_string()); needle.set_value("tvalue".to_string()); let metrics = mfs[0].get_metric(); for m in metrics { assert!(m.get_label().contains(&needle)); } let metrics = mfs[1].get_metric(); for m in metrics { assert!(m.get_label().contains(&needle)); } }
rust_cleaned_test_functions.jsonl/132419
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 586 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6615, 14547, 1889, 1856, 368, 341, 286, 1077, 5206, 9201, 284, 10528, 486, 931, 543, 286, 9201, 7030, 445, 83, 792, 3263, 983, 3904, 1507, 330, 83, 957, 3263, 983, 3904, 5231, 286, 1077, 435, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_meta_doc_comments() { let rules = create_rules( r#" macro_rules! foo { ($(#[$ i:meta])+) => ( $(#[$ i])+ fn bar() {} ) } "#, ); assert_expansion( MacroKind::Items, &rules, r#"foo! { /// Single Line Doc 1 /** MultiLines Doc */ }"#, "# [doc = \" Single Line Doc 1\"] # [doc = \"\\\\n MultiLines Doc\\\\n \"] fn bar () {}", ); }
rust_cleaned_test_functions.jsonl/14722
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 349 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 13381, 18869, 30359, 368, 341, 262, 1077, 5601, 284, 1855, 21407, 1006, 286, 435, 2, 698, 286, 18072, 21407, 0, 15229, 341, 310, 1711, 32735, 3442, 600, 25, 5490, 2467, 36197, 589, 2399, 394, 49...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_cast_routing_id_slice() { assert_eq!(mem::size_of::<u32>(), mem::size_of::<RoutingId>()); let routing_stack: &[u32] = &[1, 2, 3, 4]; let cast_stack = unsafe { slice::from_raw_parts( routing_stack.as_ptr() as *const RoutingId, routing_stack.len(), ) }; for (&i, &j) in routing_stack.iter().zip(cast_stack.iter()) { assert_eq!(i, j.0); } }
rust_cleaned_test_functions.jsonl/125622
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 276 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 5303, 97710, 842, 26488, 368, 341, 286, 2060, 10714, 10297, 10536, 486, 2141, 3575, 27638, 84, 18, 17, 39019, 1833, 486, 2141, 3575, 27638, 24701, 764, 32872, 286, 1077, 29058, 15528, 25, 44590, 8...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_ceil() { let cases = vec![ ("12345", "12345"), ("0.99999", "1"), ("-0.99999", "0"), ("18446744073709551615", "18446744073709551615"), ("18446744073709551616", "18446744073709551616"), ("-18446744073709551615", "-18446744073709551615"), ("-18446744073709551616", "-18446744073709551616"), ("-1", "-1"), ("1.23", "2"), ("-1.23", "-1"), ("1.00000", "1"), ("-1.00000", "-1"), ( "9999999999999999999999999.001", "10000000000000000000000000", ), ]; for (input, exp) in cases { let dec: Decimal = input.parse().unwrap(); let exp: Decimal = exp.parse().unwrap(); let got = dec.ceil().unwrap(); assert_eq!(got, exp); } }
rust_cleaned_test_functions.jsonl/13671
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 543 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 62, 22058, 368, 341, 286, 1077, 5048, 284, 7486, 90515, 310, 3489, 16, 17, 18, 19, 20, 497, 330, 16, 17, 18, 19, 20, 4461, 310, 3489, 15, 13, 24, 24, 24, 24, 24, 497, 330, 16, 4461, 310,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_global() -> Result<(), Box<dyn Error>> { let map = { let mut map = HeaderMap::new(); map.insert( HeaderName::from_static("x-ratelimit-global"), HeaderValue::from_static("true"), ); map.insert( HeaderName::from_static("retry-after"), HeaderValue::from_static("65"), ); map }; let headers = RatelimitHeaders::try_from(&map)?; assert!( matches!(headers, RatelimitHeaders::GlobalLimited { reset_after } if reset_after == 65) ); Ok(()) }
rust_cleaned_test_functions.jsonl/13093
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 343 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 19296, 368, 1464, 5714, 68843, 8261, 92846, 4600, 2452, 341, 286, 1077, 2415, 284, 341, 310, 1077, 5206, 2415, 284, 12104, 2227, 486, 931, 543, 310, 2415, 7030, 1006, 394, 12104, 675, 486, 1499, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_multiple_headers_merge_into_one_from_hyp() { assert_headers!("friend" => ["alice"], "friend" => ["bob"]); assert_headers!("friend" => ["alice"], "friend" => ["bob"], "friend" => ["carol"]); assert_headers!("friend" => ["alice"], "friend" => ["bob"], "enemy" => ["carol"]); }
rust_cleaned_test_functions.jsonl/94551
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 123 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 45233, 26719, 20888, 45514, 11667, 5673, 1523, 1082, 368, 341, 262, 2060, 26719, 17223, 10701, 1, 589, 4383, 63195, 7914, 330, 10701, 1, 589, 4383, 47086, 15049, 262, 2060, 26719, 17223, 10701, 1, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_incomplete_length() { let bytes = hex!("30"); let res = parse_ber(&bytes).err().expect("expected error"); assert_eq!(res, Err::Incomplete(Needed::new(1))); let res = parse_der(&bytes).err().expect("expected error"); assert_eq!(res, Err::Incomplete(Needed::new(1))); let bytes = hex!("02"); let res = parse_ber(&bytes).err().expect("expected error"); assert_eq!(res, Err::Incomplete(Needed::new(1))); let bytes = hex!("02 05"); let _ = parse_ber(&bytes).err().expect("expected error"); let bytes = hex!("02 85"); let res = parse_ber(&bytes).err().expect("expected error"); assert_eq!(res, Err::Incomplete(Needed::new(5))); let bytes = hex!("02 85 ff"); let res = parse_ber(&bytes).err().expect("expected error"); assert_eq!(res, Err::Incomplete(Needed::new(4))); }
rust_cleaned_test_functions.jsonl/67470
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 332 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 1243, 14737, 5118, 368, 341, 262, 1077, 5820, 284, 12371, 17223, 18, 15, 797, 262, 1077, 592, 284, 4715, 88165, 2099, 9651, 568, 615, 1005, 17119, 445, 7325, 1465, 797, 262, 2060, 10714, 10297, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_extreme_indices_bad_polygon() { let poly1 = polygon![ (x: 1.0, y: 0.0), (x: 1.3, y: 1.), (x: 2.0, y: 1.0), (x: 1.75, y: 1.75), (x: 1.0, y: 2.0), (x: 0.0, y: 1.0), (x: 1.0, y: 0.0) ]; let extremes = find_extreme_indices(polymax_naive_indices, &poly1).unwrap(); let correct = Extremes { ymin: 0, xmax: 1, ymax: 3, xmin: 4, }; assert_eq!(extremes, correct); }
rust_cleaned_test_functions.jsonl/100477
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 381 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 9927, 9634, 18333, 34199, 73542, 368, 341, 1789, 286, 1077, 9861, 16, 284, 29372, 90515, 310, 320, 87, 25, 220, 16, 13, 15, 11, 379, 25, 220, 15, 13, 15, 1326, 310, 320, 87, 25, 220, 16, 1...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_markbase_de() { let binary_gpos = vec![ 0x00, 0x01, 0x00, 0x00, 0x00, 0x0a, 0x00, 0x1e, 0x00, 0x2c, 0x00, 0x01, 0x44, 0x46, 0x4c, 0x54, 0x00, 0x08, 0x00, 0x04, 0x00, 0x00, 0x00, 0x00, 0xff, 0xff, 0x00, 0x01, 0x00, 0x00, 0x00, 0x01, 0x74, 0x65, 0x73, 0x74, 0x00, 0x08, 0x00, 0x00, 0x00, 0x01, 0x00, 0x00, 0x00, 0x01, 0x00, 0x04, 0x00, 0x05, 0x00, 0x00, 0x00, 0x01, 0x00, 0x08, // MarkLigPosFormat1 // MarkLigAttachSubTable MarkLigPos subtable definition 0x00, 0x01, // 1 posFormat 0x00, 0x0C, // MarkGlyphsCoverage offset to markCoverage table 0x00, 0x14, // LigGlyphsCoverage offset to ligatureCoverage table 0x00, 0x02, // 2 markClassCount 0x00, 0x1A, // MarkGlyphsArray offset to MarkArray table 0x00, 0x30, // LigGlyphsArray offset to LigatureArray table // CoverageFormat1 // MarkGlyphsCoverage Coverage table definition 0x00, 0x01, // 1 coverageFormat: lists 0x00, 0x02, // 2 glyphCount 0x03, 0x3C, // sukunMarkGlyphID glyphArray[0] 0x03, 0x3F, // kasratanMarkGlyphID glyphArray[1] // CoverageFormat1 // LigGlyphsCoverage Coverage table definition 0x00, 0x01, // 1 coverageFormat: lists 0x00, 0x01, // 1 glyphCount 0x02, 0x34, // LamWithMeemWithJeem // LigatureGlyphID glyphArray[0] // MarkArray // MarkGlyphsArray MarkArray table definition 0x00, 0x02, // 2 markCount // markRecords[0] MarkRecords in Coverage index order 0x00, 0x00, 0x00, 0x0A, // sukunMarkAnchor markAnchorOffset // markRecords[1] 0x00, 0x01, 0x00, 0x10, // kasratanMarkAnchor markAnchorOffset // AnchorFormat1 // sukunMarkAnchor Anchor table definition 0x00, 0x01, // 1 anchorFormat: design units only 0x01, 0x5A, // 346 xCoordinate 0xFF, 0x9E, // -98 yCoordinate // AnchorFormat1 // kasratanMarkAnchor Anchor table definition 0x00, 0x01, // 1 anchorFormat: design units only 0x01, 0x05, // 261 xCoordinate 0x01, 0xE8, // 488 yCoordinate // LigatureArray // LigGlyphsArray LigatureArray table definition 0x00, 0x01, // 1 ligatureCount 0x00, 0x04, // LamWithMeemWithJeemLigAttach ligatureAttachOffsets[0] // LigatureAttach // LamWithMeemWithJeemLigAttach LigatureAttach table definition 0x00, 0x03, // 3 componentCount 0x00, 0x0E, // AboveLamAnchor ligatureAnchorOffsets[0] — offsets ordered by mark class 0x00, 0x00, // NULL ligatureAnchorOffsets[1] — no attachment points for Class1 marks // componentRecords[1] 0x00, 0x00, // NULL ligatureAnchorOffsets[0] — no attachment points for Class 0 marks 0x00, 0x14, // B // componentRecords[2] 0x00, 0x00, // NULL ligatureAnchorOffsets — no attachment points for Class 0 marks 0x00, 0x00, // NULL ligatureAnchorOffsets[1] — no attachment points for Class 1 marks // AnchorFormat1 // AboveLamAnchor Anchor table definition 0x00, 0x01, // 1 anchorFormat: design units only 0x02, 0x71, // 625 xCoordinate 0x07, 0x08, // 1800 yCoordinate // AnchorFormat1 // BelowMeemAnchor Anchor table definition 0x00, 0x01, // 1 anchorFormat: design units only 0x01, 0x78, // 376 xCoordinate 0xFE, 0x90, // -368 yCoordinate ]; let expected = expected_gpos(vec![Lookup { flags: LookupFlags::empty(), mark_filtering_set: None, rule: Positioning::MarkToLig(vec![MarkLigPos { ligatures: btreemap!(564 => vec![ btreemap!(0 => Anchor { xCoordinate: 625, yCoordinate: 1800, anchorPoint: None }, ), btreemap!( 1 => Anchor { xCoordinate: 376, yCoordinate: -368, anchorPoint: None }, ), btreemap!(), ]), marks: btreemap!( 828 => (0, Anchor { xCoordinate: 346, yCoordinate: -98, anchorPoint: None }), 831 => (1, Anchor { xCoordinate: 261, yCoordinate: 488, anchorPoint: None }) ), }]), }]); assert_can_roundtrip(binary_gpos, &expected); }
rust_cleaned_test_functions.jsonl/13673
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 2680 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 18924, 3152, 2259, 368, 341, 286, 1077, 7868, 1889, 966, 284, 7486, 90515, 310, 220, 15, 87, 15, 15, 11, 220, 15, 87, 15, 16, 11, 220, 15, 87, 15, 15, 11, 220, 15, 87, 15, 15, 11, 220, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_two_sum() { assert_eq!(two_sum(&[2, 7, 11, 15], 9), vec![(0usize, 1usize)]); assert_eq!(two_sum(&[2, 7, 11, 15], 13), vec![(0usize, 2usize)]); assert_eq!(two_sum(&[2, 7, 11, 15], 18), vec![(1usize, 2usize)]); assert_eq!( two_sum(&[2, 7, 4, 5], 9), vec![(0usize, 1usize), (2usize, 3usize)] ); }
rust_cleaned_test_functions.jsonl/133926
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 229 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 23241, 10160, 368, 341, 286, 2060, 10714, 10297, 19789, 10160, 2099, 58, 17, 11, 220, 22, 11, 220, 16, 16, 11, 220, 16, 20, 1125, 220, 24, 701, 7486, 0, 9697, 15, 51878, 11, 220, 16, 51878, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_init_request() { let init = Package::create_init_request(TEST_ROOMID, "key".to_owned()); match &init { Package::InitRequest(payload) => assert!(payload.starts_with(PACKAGE_INIT_BEGINNING)), _ => unreachable!(), } let init = init.encode().unwrap(); assert_eq!(init.len(), 94); }
rust_cleaned_test_functions.jsonl/125888
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 177 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6137, 7893, 368, 341, 286, 1077, 2930, 284, 16906, 486, 3182, 6137, 7893, 50320, 59966, 915, 11, 330, 792, 3263, 983, 51973, 1423, 286, 2432, 609, 2327, 341, 310, 16906, 486, 3803, 1900, 26772, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_from_into_authenticator_transport() { let cbor_authenticator_transport: cbor::Value = cbor_text!("usb"); let authenticator_transport = AuthenticatorTransport::try_from(cbor_authenticator_transport.clone()); let expected_authenticator_transport = AuthenticatorTransport::Usb; assert_eq!( authenticator_transport, Ok(expected_authenticator_transport) ); let created_cbor: cbor::Value = authenticator_transport.unwrap().into(); assert_eq!(created_cbor, cbor_authenticator_transport); }
rust_cleaned_test_functions.jsonl/49005
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 252 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 5673, 45514, 14014, 61393, 46398, 368, 341, 286, 1077, 272, 9368, 14014, 61393, 46398, 25, 272, 9368, 486, 1130, 284, 272, 9368, 4326, 17223, 24343, 797, 286, 1077, 13210, 850, 46398, 4035, 310, 4...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_time() { let mut p = Parser::new(); assert_eq!(p.time("T11:22:33.456").1, Done("", Time::new_str("11", "22", "33", Some("456"), None))); p = Parser::new(); assert_eq!(p.time("T04:05:06").1, Done("", Time::new_str("04", "05", "06", None, None))); }
rust_cleaned_test_functions.jsonl/27414
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 148 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 3009, 368, 341, 262, 1077, 5206, 281, 284, 21102, 486, 931, 543, 262, 2060, 10714, 10297, 79, 6378, 445, 51, 16, 16, 25, 17, 17, 25, 18, 18, 13, 19, 20, 21, 1827, 16, 345, 414, 27357, 1981...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_update_slot_propagated_threshold_from_votes() { let keypairs: HashMap<_, _> = iter::repeat_with(|| { let node_keypair = Keypair::new(); let vote_keypair = Keypair::new(); let stake_keypair = Keypair::new(); let node_pubkey = node_keypair.pubkey(); ( node_pubkey, ValidatorVoteKeypairs::new(node_keypair, vote_keypair, stake_keypair), ) }) .take(10) .collect(); let new_vote_pubkeys: Vec<_> = keypairs .values() .map(|keys| keys.vote_keypair.pubkey()) .collect(); let new_node_pubkeys: Vec<_> = keypairs .values() .map(|keys| keys.node_keypair.pubkey()) .collect(); run_test_update_slot_propagated_threshold_from_votes(&keypairs, &new_vote_pubkeys, &[], 4); // Adding the same node pubkey's instead of the corresponding // vote pubkeys should be equivalent run_test_update_slot_propagated_threshold_from_votes(&keypairs, &[], &new_node_pubkeys, 4); // Adding the same node pubkey's in the same order as their // reach the threshold any sooner. run_test_update_slot_propagated_threshold_from_votes( &keypairs, &new_vote_pubkeys, &new_node_pubkeys, 4, ); // because now we are getting 2 new pubkeys on each // we should have 4/10 validators voting run_test_update_slot_propagated_threshold_from_votes( &keypairs, &new_vote_pubkeys[0..5], &new_node_pubkeys[5..], 2, ); }
rust_cleaned_test_functions.jsonl/91767
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 905 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 8882, 27563, 21663, 351, 657, 21858, 5673, 65116, 368, 341, 286, 1077, 1376, 77256, 25, 10528, 27, 6878, 716, 29, 284, 5367, 486, 30624, 6615, 79453, 341, 310, 1077, 2436, 3097, 12670, 284, 6569, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_match_section_byte() { assert!(match_section_byte::QueryParser::new() .parse("SELECT foo") .is_ok()); assert!(match_section_byte::QueryParser::new() .parse("select foo") .is_ok()); assert!(match_section_byte::QueryParser::new() .parse("INSERT foo") .is_ok()); assert!(match_section_byte::QueryParser::new() .parse("UPDATE foo") .is_ok()); assert!(match_section_byte::QueryParser::new() .parse("UPDATE update") .is_err()); }
rust_cleaned_test_functions.jsonl/27434
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 249 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 10708, 16221, 19737, 368, 341, 262, 2060, 10297, 6347, 16221, 19737, 486, 2859, 6570, 486, 931, 741, 286, 659, 6400, 445, 4858, 15229, 1138, 286, 659, 285, 19817, 1423, 262, 2060, 10297, 6347, 162...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_monitor_update_fail_claim() { // Basic test for monitor update failures when processing claim_funds calls. // the payments from C onwards to A. let chanmon_cfgs = create_chanmon_cfgs(3); let node_cfgs = create_node_cfgs(3, &chanmon_cfgs); let node_chanmgrs = create_node_chanmgrs(3, &node_cfgs, &[None, None, None]); let mut nodes = create_network(3, &node_cfgs, &node_chanmgrs); let chan_1 = create_announced_chan_between_nodes(&nodes, 0, 1, InitFeatures::known(), InitFeatures::known()); create_announced_chan_between_nodes(&nodes, 1, 2, InitFeatures::known(), InitFeatures::known()); // Rebalance a bit so that we can send backwards from 3 to 2. send_payment(&nodes[0], &[&nodes[1], &nodes[2]], 5000000); let (payment_preimage_1, _, _) = route_payment(&nodes[0], &[&nodes[1]], 1000000); chanmon_cfgs[1].persister.set_update_ret(Err(ChannelMonitorUpdateErr::TemporaryFailure)); assert!(nodes[1].node.claim_funds(payment_preimage_1)); nodes[1].logger.assert_log("lightning::ln::channelmanager".to_string(), "Temporary failure claiming HTLC, treating as success: Failed to update ChannelMonitor".to_string(), 1); check_added_monitors!(nodes[1], 1); // Note that at this point there is a pending commitment transaction update for A being held by // already-signed commitment transaction and will instead wait for it to resolve before // forwarding the payment onwards. let (route, payment_hash_2, _, payment_secret_2) = get_route_and_payment_hash!(nodes[2], nodes[0], 1_000_000); { nodes[2].node.send_payment(&route, payment_hash_2, &Some(payment_secret_2)).unwrap(); check_added_monitors!(nodes[2], 1); } chanmon_cfgs[1].persister.set_update_ret(Ok(())); let mut events = nodes[2].node.get_and_clear_pending_msg_events(); assert_eq!(events.len(), 1); let payment_event = SendEvent::from_event(events.pop().unwrap()); nodes[1].node.handle_update_add_htlc(&nodes[2].node.get_our_node_id(), &payment_event.msgs[0]); let events = nodes[1].node.get_and_clear_pending_msg_events(); assert_eq!(events.len(), 0); commitment_signed_dance!(nodes[1], nodes[2], payment_event.commitment_msg, false, true); let (_, payment_hash_3, payment_secret_3) = get_payment_preimage_hash!(nodes[0]); nodes[2].node.send_payment(&route, payment_hash_3, &Some(payment_secret_3)).unwrap(); check_added_monitors!(nodes[2], 1); let mut events = nodes[2].node.get_and_clear_pending_msg_events(); assert_eq!(events.len(), 1); let payment_event = SendEvent::from_event(events.pop().unwrap()); nodes[1].node.handle_update_add_htlc(&nodes[2].node.get_our_node_id(), &payment_event.msgs[0]); let events = nodes[1].node.get_and_clear_pending_msg_events(); assert_eq!(events.len(), 0); commitment_signed_dance!(nodes[1], nodes[2], payment_event.commitment_msg, false, true); // Now restore monitor updating on the 0<->1 channel and claim the funds on B. let (outpoint, latest_update, _) = nodes[1].chain_monitor.latest_monitor_update_id.lock().unwrap().get(&chan_1.2).unwrap().clone(); nodes[1].chain_monitor.chain_monitor.force_channel_monitor_updated(outpoint, latest_update); check_added_monitors!(nodes[1], 0); let bs_fulfill_update = get_htlc_update_msgs!(nodes[1], nodes[0].node.get_our_node_id()); nodes[0].node.handle_update_fulfill_htlc(&nodes[1].node.get_our_node_id(), &bs_fulfill_update.update_fulfill_htlcs[0]); commitment_signed_dance!(nodes[0], nodes[1], bs_fulfill_update.commitment_signed, false); expect_payment_sent!(nodes[0], payment_preimage_1); expect_pending_htlcs_forwardable!(nodes[1]); check_added_monitors!(nodes[1], 1); let bs_forward_update = get_htlc_update_msgs!(nodes[1], nodes[0].node.get_our_node_id()); nodes[0].node.handle_update_add_htlc(&nodes[1].node.get_our_node_id(), &bs_forward_update.update_add_htlcs[0]); nodes[0].node.handle_update_add_htlc(&nodes[1].node.get_our_node_id(), &bs_forward_update.update_add_htlcs[1]); commitment_signed_dance!(nodes[0], nodes[1], bs_forward_update.commitment_signed, false); expect_pending_htlcs_forwardable!(nodes[0]); let events = nodes[0].node.get_and_clear_pending_events(); assert_eq!(events.len(), 2); match events[0] { Event::PaymentReceived { ref payment_hash, ref purpose, amt } => { assert_eq!(payment_hash_2, *payment_hash); assert_eq!(1_000_000, amt); match &purpose { PaymentPurpose::InvoicePayment { payment_preimage, payment_secret, .. } => { assert!(payment_preimage.is_none()); assert_eq!(payment_secret_2, *payment_secret); }, _ => panic!("expected PaymentPurpose::InvoicePayment") } }, _ => panic!("Unexpected event"), } match events[1] { Event::PaymentReceived { ref payment_hash, ref purpose, amt } => { assert_eq!(payment_hash_3, *payment_hash); assert_eq!(1_000_000, amt); match &purpose { PaymentPurpose::InvoicePayment { payment_preimage, payment_secret, .. } => { assert!(payment_preimage.is_none()); assert_eq!(payment_secret_3, *payment_secret); }, _ => panic!("expected PaymentPurpose::InvoicePayment") } }, _ => panic!("Unexpected event"), } }
rust_cleaned_test_functions.jsonl/58344
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1970 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 40112, 8882, 22121, 84969, 368, 341, 197, 322, 14625, 1273, 369, 8718, 2647, 27850, 979, 8692, 3717, 761, 42950, 6738, 624, 49106, 197, 322, 279, 14173, 504, 356, 59425, 311, 362, 624, 10217, 2602...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
5
#[test] fn test_top_modules() { let inv = Invoice { bindle_version: "v1".to_owned(), yanked: None, signature: None, annotations: None, bindle: BindleSpec { id: "drink/1.2.3" .to_owned() .try_into() .expect("This should parse"), description: None, authors: None, }, group: Some(vec![Group { name: "coffee".to_owned(), required: None, satisfied_by: None, }]), parcel: Some(vec![ Parcel { label: Label { sha256: "yubbadubbadoo".to_owned(), name: "mocha-java".to_owned(), media_type: WASM_MEDIA_TYPE.to_owned(), size: 1234, annotations: None, feature: None, }, conditions: Some(Condition { member_of: Some(vec!["coffee".to_owned()]), requires: None, }), }, Parcel { label: Label { sha256: "abc123".to_owned(), name: "yirgacheffe".to_owned(), media_type: WASM_MEDIA_TYPE.to_owned(), size: 1234, annotations: None, feature: None, }, conditions: Some(Condition { member_of: Some(vec!["coffee".to_owned()]), requires: None, }), }, Parcel { label: Label { sha256: "yubbadubbadoonow".to_owned(), name: "water".to_owned(), media_type: WASM_MEDIA_TYPE.to_owned(), size: 1234, annotations: None, feature: None, }, conditions: Some(Condition { member_of: None, requires: None, }), }, ]), }; let res = top_modules(&inv); assert_eq!(res.len(), 1); assert_eq!( res.get(0).expect("first item").label.name, "water".to_owned() ); }
rust_cleaned_test_functions.jsonl/82234
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1722 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 10426, 15848, 368, 341, 286, 1077, 1529, 284, 40190, 341, 310, 10719, 273, 9438, 25, 330, 85, 16, 3263, 983, 51973, 3148, 310, 379, 40772, 25, 2240, 345, 310, 11957, 25, 2240, 345, 310, 32207, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_binary_encoders() -> Result<(), ConnectionError> { assert_bind_encode(true, &[0, 0, 0, 1, 1]); assert_bind_encode(false, &[0, 0, 0, 1, 0]); assert_bind_encode( TimestampValue::new(1650890322, None), &[0, 0, 0, 8, 255, 252, 162, 254, 196, 225, 80, 202], ); assert_bind_encode( TimestampValue::new(1650890322, Some("UTC".to_string())), &[0, 0, 0, 8, 255, 252, 162, 254, 196, 225, 80, 202], ); Ok(()) }
rust_cleaned_test_functions.jsonl/14351
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 285 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 31761, 13781, 52498, 368, 1464, 5714, 68843, 11032, 1454, 29, 341, 286, 2060, 27461, 11224, 3715, 11, 44590, 15, 11, 220, 15, 11, 220, 15, 11, 220, 16, 11, 220, 16, 2558, 286, 2060, 27461, 112...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_search_remote_apps() { let remote_url = "https://api.github.com/repos/ScoopInstaller/Main/git/trees/HEAD?recursive=1"; let query = "7zip"; let actual = App::search_remote_apps(remote_url, query).unwrap(); let expect = vec![App { name: String::from("bucket/7zip"), version: String::new(), bin: Vec::new(), }]; assert_eq!(expect, actual); }
rust_cleaned_test_functions.jsonl/9979
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 230 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 10716, 36425, 69899, 368, 341, 286, 1077, 8699, 2903, 4035, 310, 330, 2428, 1110, 2068, 11021, 905, 49505, 11374, 86857, 88096, 65241, 60590, 5523, 7858, 14, 35433, 30, 49512, 28, 16, 876, 286, 10...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_malformed_module() { // Compile module M. let code = r#" module {{ADDR}}::M { public fun foo() {} } "#; let code = code.replace("{{ADDR}}", &format!("0x{}", TEST_ADDR.to_string())); let mut units = compile_units(&code).unwrap(); let m = as_module(units.pop().unwrap()); let mut blob = vec![]; m.serialize(&mut blob).unwrap(); let module_id = ModuleId::new(TEST_ADDR, Identifier::new("M").unwrap()); let fun_name = Identifier::new("foo").unwrap(); let mut gas_status = GasStatus::new_unmetered(); { let mut storage = InMemoryStorage::new(); storage.publish_or_overwrite_module(m.self_id(), blob.clone()); let vm = MoveVM::new(vec![]).unwrap(); let mut sess = vm.new_session(&storage); sess.execute_function(&module_id, &fun_name, vec![], vec![], &mut gas_status) .unwrap(); } // Start over with a fresh storage and publish a corrupted version of M. // A fresh VM needs to be used whenever the storage has been modified or otherwise the // loader cache gets out of sync. // invariant violation error. { blob[0] = 0xde; blob[1] = 0xad; blob[2] = 0xbe; blob[3] = 0xef; let mut storage = InMemoryStorage::new(); storage.publish_or_overwrite_module(m.self_id(), blob); let vm = MoveVM::new(vec![]).unwrap(); let mut sess = vm.new_session(&storage); let err = sess .execute_function(&module_id, &fun_name, vec![], vec![], &mut gas_status) .unwrap_err(); assert_eq!(err.status_type(), StatusType::InvariantViolation); } }
rust_cleaned_test_functions.jsonl/48432
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 755 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 717, 278, 10155, 10750, 368, 341, 262, 442, 54467, 4688, 386, 624, 262, 1077, 2038, 284, 435, 2, 698, 286, 4688, 5867, 29210, 3417, 486, 44, 341, 310, 584, 2464, 15229, 368, 5613, 286, 456, 26...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_mut() { let span = span::mock().named("err_mut"); let (collector, handle) = collector::mock() .new_span(span.clone()) .enter(span.clone()) .event(event::mock().at_level(Level::ERROR)) .exit(span.clone()) .drop_span(span) .done() .run_with_handle(); with_default(collector, || err_mut(&mut 0).ok()); handle.assert_finished(); }
rust_cleaned_test_functions.jsonl/3566
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 197 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 29523, 368, 341, 262, 1077, 9390, 284, 9390, 486, 16712, 1005, 30245, 445, 615, 29523, 797, 262, 1077, 320, 91469, 11, 3705, 8, 284, 31953, 486, 16712, 741, 286, 659, 931, 37382, 66092, 15997, 2...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_schema_from_thrift_with_num_children_set() { let message_type = " message schema { OPTIONAL BYTE_ARRAY id (UTF8); OPTIONAL BYTE_ARRAY name (UTF8); OPTIONAL BYTE_ARRAY message (UTF8); OPTIONAL INT32 type (UINT_8); OPTIONAL INT64 author_time (TIMESTAMP_MILLIS); OPTIONAL INT64 __index_level_0__; } "; let expected_schema = parse_message_type(message_type).unwrap(); let mut thrift_schema = to_thrift(&expected_schema).unwrap(); for mut elem in &mut thrift_schema[..] { if elem.num_children == None { elem.num_children = Some(0); } } let result_schema = from_thrift(&thrift_schema).unwrap(); assert_eq!(result_schema, Arc::new(expected_schema)); }
rust_cleaned_test_functions.jsonl/16694
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 410 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 25371, 5673, 5854, 41380, 6615, 4273, 31206, 2602, 368, 341, 1789, 286, 1077, 1943, 1819, 284, 6228, 262, 1943, 10802, 341, 414, 76232, 35377, 17724, 877, 320, 8561, 23, 317, 414, 76232, 35377, 17...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_parse_decimal() { let tests = [ ("123.00", 12300i128), ("123.123", 123123i128), ("0.0123", 123i128), ("0.12300", 12300i128), ("-5.123", -5123i128), ("-45.432432", -45432432i128), ]; for (s, i) in tests { let result = parse_decimal(s); assert_eq!(i, result.unwrap()); } }
rust_cleaned_test_functions.jsonl/16419
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 259 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21039, 74429, 368, 341, 286, 1077, 7032, 284, 2278, 310, 3489, 16, 17, 18, 13, 15, 15, 497, 220, 16, 17, 18, 15, 15, 72, 16, 17, 23, 1326, 310, 3489, 16, 17, 18, 13, 16, 17, 18, 497, 2...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_generic_opaque_type_in_fn_ptr() { // Test printing a generic opaque type as an fn ptr's parameter reparse_test!( program { struct Foo {} trait Bar<T> {} trait Faz { type Assoc; } impl Faz for Foo { type Assoc = fn(Baz<Foo>); } impl<T> Bar<T> for Foo { } opaque type Baz<T>: Bar<T> = Foo; } ); }
rust_cleaned_test_functions.jsonl/34210
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 272 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 41232, 10287, 19659, 1819, 1243, 15246, 4348, 368, 341, 262, 442, 3393, 18484, 264, 13954, 46484, 943, 438, 458, 5168, 10087, 594, 5733, 198, 262, 312, 6400, 4452, 33673, 286, 2025, 341, 310, 2036...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_bank_forks_different_set_root() { solana_logger::setup(); let leader_keypair = Keypair::new(); let GenesisConfigInfo { mut genesis_config, mint_keypair: _, voting_keypair, } = create_genesis_config_with_leader(10_000, &leader_keypair.pubkey(), 1_000); let slots_in_epoch = 32; genesis_config.epoch_schedule = EpochSchedule::new(slots_in_epoch); let bank0 = Bank::new(&genesis_config); let mut bank_forks0 = BankForks::new(bank0); bank_forks0.set_root(0, &AbsRequestSender::default(), None); let bank1 = Bank::new(&genesis_config); let mut bank_forks1 = BankForks::new(bank1); let additional_timestamp_secs = 2; let num_slots = slots_in_epoch + 1; // Advance past first epoch boundary for slot in 1..num_slots { let update_timestamp_case = slot == slots_in_epoch; let child1 = Bank::new_from_parent(&bank_forks0[slot - 1], &Pubkey::default(), slot); let child2 = Bank::new_from_parent(&bank_forks1[slot - 1], &Pubkey::default(), slot); if update_timestamp_case { for child in &[&child1, &child2] { let recent_timestamp: UnixTimestamp = child.unix_timestamp_from_genesis(); update_vote_account_timestamp( BlockTimestamp { slot: child.slot(), timestamp: recent_timestamp + additional_timestamp_secs, }, &child, &voting_keypair.pubkey(), ); } } // Set root in bank_forks0 to truncate the ancestor history bank_forks0.insert(child1); bank_forks0.set_root(slot, &AbsRequestSender::default(), None); // Don't set root in bank_forks1 to keep the ancestor history bank_forks1.insert(child2); } let child1 = &bank_forks0.working_bank(); let child2 = &bank_forks1.working_bank(); child1.freeze(); child2.freeze(); info!("child0.ancestors: {:?}", child1.ancestors); info!("child1.ancestors: {:?}", child2.ancestors); assert_eq!(child1.hash(), child2.hash()); }
rust_cleaned_test_functions.jsonl/30581
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1211 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 35733, 761, 73302, 82741, 2602, 12993, 368, 341, 286, 2048, 3362, 27413, 486, 15188, 543, 286, 1077, 7653, 3097, 12670, 284, 6569, 1082, 1310, 486, 931, 543, 286, 1077, 40788, 2648, 1731, 341, 310...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
4
#[test] fn test_from_str_vec() { let vec = vec!["foo", "asdfas", "asdkj", "as"]; let value = vec .iter() .map(|i| ExpressionNode::from(*i)) .collect::<Vec<_>>(); assert_eq!( ExpressionNode::from(vec.to_vec()), ExpressionNode::Array(ArrayNode { value, span: None }) ); }
rust_cleaned_test_functions.jsonl/89520
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 202 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 5673, 2895, 13251, 368, 341, 286, 1077, 7486, 284, 7486, 0, 1183, 7975, 497, 330, 76615, 300, 497, 330, 300, 7584, 73, 497, 330, 300, 31797, 286, 1077, 897, 284, 7486, 198, 310, 659, 2015, 741...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_extract_struct_keep_comments_and_attrs_several_fields_tuple() { check_assist( extract_struct_from_enum_variant, "enum A { $0One(/* comment */ #[attr] u32, /* another */ u32 /* tail */) }", r#" struct One(/* comment */ #[attr] u32, /* another */ u32 /* tail */); enum A { One(One) }"#, ); }
rust_cleaned_test_functions.jsonl/36299
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 179 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 39123, 15126, 50293, 30359, 8378, 39578, 3453, 17539, 12132, 21773, 368, 341, 286, 1779, 12083, 380, 1006, 310, 8649, 15126, 5673, 31054, 46112, 345, 310, 330, 9018, 362, 314, 400, 15, 3966, 49589, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_addition() { assert_eq!(Boolean(false) + Boolean(false), Boolean(false)); assert_eq!(Boolean(false) + Boolean(true), Boolean(true)); assert_eq!(Boolean(true) + Boolean(false), Boolean(true)); assert_eq!(Boolean(true) + Boolean(true), Boolean(true)); assert_eq!(Float(1.1) + Float(2.2), Float(3.3)); assert_eq!(Float(1.1) + Float(-2.2), Float(-1.1)); assert_eq!(Float(1.1) + Integer(2), Float(3.1)); assert_eq!(Float(1.1) + Integer(-2), Float(-0.9)); assert_eq!(Integer(1) + Integer(2), Integer(3)); assert_eq!(Integer(1) + Integer(-2), Integer(-1)); assert_eq!(Integer(1) + Float(2.2), Float(3.2)); assert_eq!(Integer(1) + Float(-2.1), Float(-1.1)); }
rust_cleaned_test_functions.jsonl/101193
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 367 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2891, 680, 368, 341, 286, 2060, 10714, 10297, 6890, 3576, 8, 488, 6992, 3576, 701, 6992, 3576, 1106, 286, 2060, 10714, 10297, 6890, 3576, 8, 488, 6992, 3715, 701, 6992, 3715, 1106, 286, 2060, 10...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_strings_in_vec_should_be_concatenated_and_escaped_correctly() { let params = StreamsParams::new() .with_channel("StarCraft I") .with_channel("StarCraft II"); assert_eq!(params.into_query_string(), "?channel=StarCraft%20I,StarCraft%20II"); }
rust_cleaned_test_functions.jsonl/53706
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 148 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 33500, 1243, 13251, 43378, 21263, 57478, 268, 657, 8378, 62, 65826, 31550, 398, 368, 341, 286, 1077, 3628, 284, 94522, 4870, 486, 931, 741, 394, 659, 4197, 14571, 445, 12699, 38849, 358, 1138, 394...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_rust_logo_scale_down() { // The goal of this test is to check that the tessellator can handle very small geometry. let mut builder = Path::builder().flattened(0.011).with_svg(); build_logo_path(&mut builder); let mut path = builder.build(); scale_path(&mut path, 0.005); test_path(path.as_slice()); }
rust_cleaned_test_functions.jsonl/102407
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 131 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 1710, 590, 29962, 16727, 13998, 368, 341, 262, 442, 576, 5795, 315, 419, 1273, 374, 311, 1779, 429, 279, 79830, 613, 850, 646, 3705, 1602, 2613, 17047, 382, 262, 1077, 5206, 7363, 284, 7933, 486...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_rpc_verify_pubkey() { let pubkey = solana_sdk::pubkey::new_rand(); assert_eq!(verify_pubkey(&pubkey.to_string()).unwrap(), pubkey); let bad_pubkey = "a1b2c3d4"; assert_eq!( verify_pubkey(&bad_pubkey.to_string()), Err(Error::invalid_params("Invalid param: WrongSize")) ); }
rust_cleaned_test_functions.jsonl/3045
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 187 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 60799, 35638, 34014, 792, 368, 341, 286, 1077, 95116, 284, 2048, 3362, 61783, 486, 9585, 792, 486, 931, 33864, 543, 286, 2060, 10714, 10297, 12446, 34014, 792, 2099, 9585, 792, 2389, 3904, 6011, 1...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_flags_from_vec_2() { let (flags, subcommand, argv) = flags_from_vec(svec!["deno", "-r", "run", "script.ts"]); assert_eq!( flags, DenoFlags { reload: true, ..DenoFlags::default() } ); assert_eq!(subcommand, DenoSubcommand::Run); assert_eq!(argv, svec!["deno", "script.ts"]); }
rust_cleaned_test_functions.jsonl/112831
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 182 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 14130, 5673, 13251, 62, 17, 368, 341, 262, 1077, 320, 11161, 11, 1186, 5631, 11, 10213, 8, 4035, 414, 8042, 5673, 13251, 1141, 4083, 0, 1183, 5183, 78, 497, 6523, 81, 497, 330, 6108, 497, 330,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_tokenomic() { new_test_ext().execute_with(|| { let params = TokenomicParameters::<Test>::get().unwrap(); let tokenomic = Tokenomic::<Test>::new(params); fn pow(x: FixedPoint, n: u32) -> FixedPoint { let mut i = n; let mut x_pow2 = x; let mut z = FixedPoint::from_num(1); while i > 0 { if i & 1 == 1 { z *= x_pow2; } x_pow2 *= x_pow2; i >>= 1; } z } // Vmax assert_eq!(tokenomic.v_max(), fp!(30000)); // Minimal stake assert_eq!(tokenomic.minimal_stake(1000), 3162_277660146355); // Ve for different confidence level assert_eq!( tokenomic.ve(1000 * DOLLARS, 1000, 1), fp!(1690.0000000000000000282) ); assert_eq!( tokenomic.ve(1000 * DOLLARS, 1000, 2), fp!(1690.0000000000000000282) ); assert_eq!( tokenomic.ve(1000 * DOLLARS, 1000, 3), fp!(1690.0000000000000000282) ); assert_eq!( tokenomic.ve(1000 * DOLLARS, 1000, 4), fp!(1612.0000000000000000247) ); assert_eq!( tokenomic.ve(1000 * DOLLARS, 1000, 5), fp!(1572.9999999999999999877) ); // Rig cost estimation assert_eq!(tokenomic.rig_cost(500), fp!(150.0000000000000000054)); assert_eq!(tokenomic.rig_cost(2000), fp!(600.0000000000000000217)); assert_eq!(tokenomic.rig_cost(2800), fp!(840.00000000000000003036)); const BLOCK_SEC: u32 = 12; const HOUR_BLOCKS: u32 = 3600 / BLOCK_SEC; let slash_rate = FixedPoint::from_bits(tokenomic.params.slash_rate); let slash_decay = FixedPoint::from_num(1) - slash_rate; assert_eq!(pow(slash_decay, HOUR_BLOCKS), fp!(0.9990004981683704595)); // rho per hour let rho = FixedPoint::from_bits(tokenomic.params.rho); assert_eq!(pow(rho, HOUR_BLOCKS), fp!(1.00019999999998037056)); // Budget per day let budger_per_block = FixedPoint::from_bits(tokenomic.params.budget_per_block); assert_eq!(budger_per_block * 3600 * 24 / 12, fp!(720000)); // Cost estimation per year assert_eq!( tokenomic.op_cost(2000) / 12 * 3600 * 24 * 365, fp!(171.71874999975847951583) ); }); }
rust_cleaned_test_functions.jsonl/86889
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1050 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6458, 3075, 368, 341, 298, 8638, 4452, 9927, 1005, 10257, 6615, 79453, 341, 571, 10217, 3628, 284, 9660, 3075, 9706, 27638, 2271, 6831, 455, 1005, 15454, 543, 571, 10217, 3950, 3075, 284, 9660, 30...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_parse_unfinished() { test_parse_err::<Simple>(&["<Simple> <c>abc</c> <a/> <b>2</b> <d/>"]); }
rust_cleaned_test_functions.jsonl/54633
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 110 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21039, 4907, 12129, 368, 341, 262, 1273, 21039, 9266, 27638, 16374, 44784, 1183, 27, 16374, 397, 310, 366, 66, 29, 13683, 522, 66, 397, 310, 366, 64, 10171, 310, 366, 65, 29, 17, 522, 65, 397,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_init_empty_context_for_sandbox_with_patch_json() -> Result<(), anyhow::Error> { // init runtime and turn on/off ocaml logging client::change_runtime_configuration(TezosRuntimeConfiguration { debug_mode: false, compute_context_action_tree_hashes: false, log_enabled: common::is_ocaml_log_enabled(), }) .unwrap(); // prepare data let storage_data_dir = "init_storage_tests_02"; // run init storage for all nets let net = TezosEnvironment::Sandbox; let default_networks = default_networks(); let tezos_env: &TezosEnvironmentConfiguration = default_networks .get(&net) .unwrap_or_else(|| panic!("no tezos environment configured for: {:?}", &net)); let patch_context = PatchContext { key: String::from("sandbox_parameter"), json: String::from( r#" { "genesis_pubkey": "edpkuSLWfVU1Vq7Jg9FucPyKmma6otcMHac9zG4oU1KMHSTBpJuGQ2"} "#, ), }; let storage = TezosContextStorageConfiguration::Both( TezosContextIrminStorageConfiguration { data_dir: common::prepare_empty_dir(storage_data_dir), }, TezosContextTezEdgeStorageConfiguration { backend: tezos_api::ffi::ContextKvStoreConfiguration::InMem, ipc_socket_path: None, }, ); let context_config = TezosContextConfiguration { storage, genesis: tezos_env.genesis.clone(), protocol_overrides: tezos_env.protocol_overrides.clone(), commit_genesis: true, enable_testchain: false, readonly: false, sandbox_json_patch_context: Some(patch_context), context_stats_db_path: None, }; match client::init_protocol_context(context_config) { Err(e) => panic!( "Failed to initialize storage for: {:?}, Reason: {:?}", net, e ), Ok(init_info) => { if let Some(commit_hash) = &init_info.genesis_commit_hash { assert_eq!( *commit_hash, ContextHash::try_from("CoVBYdAGWBoDTkiVXJEGX6FQvDN1oGCPJu8STMvaTYdeh7N3KGTz")? ) } else { panic!("Expected some context hash") } } } Ok(()) }
rust_cleaned_test_functions.jsonl/54418
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1064 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6137, 15124, 8467, 5478, 643, 31536, 6615, 39643, 9455, 368, 1464, 5714, 68843, 88964, 486, 1454, 29, 341, 262, 442, 2930, 15592, 323, 2484, 389, 50806, 17796, 9467, 8392, 198, 262, 2943, 486, 337...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
5
#[test] fn test_create_session_config_cacert_not_found() { let cfg = CloudConfig { auth_type: Some("password".into()), auth: Some(Auth { auth_url: Some("http://127.0.0.1".into()), username: Some("vasya".into()), password: Some("hacker".into()), project_name: Some("admin".into()), ..Auth::default() }), cacert: Some("/I/do/not/exist".into()), region_name: Some("Lapland".into()), ..CloudConfig::default() }; assert!(cfg.create_session_config().is_err()); }
rust_cleaned_test_functions.jsonl/99078
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 343 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 8657, 12316, 5332, 666, 580, 529, 7913, 21480, 368, 341, 286, 1077, 13286, 284, 14817, 2648, 341, 310, 4166, 1819, 25, 4329, 445, 3833, 3263, 18122, 14702, 310, 4166, 25, 4329, 37640, 341, 394, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_is_valid_half() { assert_eq!( FinancialPeriod::Half { half: 1, year: 1972 } .is_valid(), true ); assert_eq!( FinancialPeriod::Half { half: 5, year: 1972 } .is_valid(), false ); }
rust_cleaned_test_functions.jsonl/21179
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 270 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6892, 8337, 40626, 368, 341, 286, 2060, 10714, 33673, 310, 17503, 23750, 486, 42627, 341, 394, 4279, 25, 220, 16, 345, 394, 1042, 25, 220, 16, 24, 22, 17, 198, 310, 456, 310, 659, 285, 8337, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_json_as_duration() { test_none_with_ctx_and_extra(cast_json_as_duration); // the case that Json::unquote failed had be tested by test_json_unquote let cs = vec![ Json::from_object(BTreeMap::default()).unwrap(), Json::from_array(vec![]).unwrap(), Json::from_i64(10).unwrap(), Json::from_i64(i64::MAX).unwrap(), Json::from_i64(i64::MIN).unwrap(), Json::from_u64(0).unwrap(), Json::from_u64(u64::MAX).unwrap(), Json::from_f64(10.5).unwrap(), Json::from_f64(10.4).unwrap(), Json::from_f64(-10.4).unwrap(), Json::from_f64(-10.5).unwrap(), Json::from_f64(i64::MIN as u64 as f64).unwrap(), Json::from_f64(i64::MAX as u64 as f64).unwrap(), Json::from_f64(i64::MIN as u64 as f64).unwrap(), Json::from_f64(i64::MIN as f64).unwrap(), Json::from_f64(((1u64 << 63) + (1u64 << 62)) as u64 as f64).unwrap(), Json::from_f64(-((1u64 << 63) as f64 + (1u64 << 62) as f64)).unwrap(), Json::from_f64(f64::from(f32::MIN)).unwrap(), Json::from_f64(f64::from(f32::MAX)).unwrap(), Json::from_f64(f64::MAX).unwrap(), Json::from_f64(f64::MAX).unwrap(), Json::from_string(String::from("10.0")).unwrap(), Json::from_string(String::from( "999999999999999999999999999999999999999999999999", )) .unwrap(), Json::from_string(String::from( "-999999999999999999999999999999999999999999999999", )) .unwrap(), Json::from_string(String::from( "99999999999999999999999999999999999999999999999aabcde9", )) .unwrap(), Json::from_string(String::from( "-99999999999999999999999999999999999999999999999aabcde9", )) .unwrap(), Json::from_bool(true).unwrap(), Json::from_bool(false).unwrap(), Json::none().unwrap(), ]; let cs_ref: Vec<JsonRef> = cs.iter().map(|x| x.as_ref()).collect(); test_as_duration_helper( cs_ref, |x| x.unquote().unwrap(), |x| format!("{:?}", x), cast_json_as_duration, "cast_json_as_duration", ); }
rust_cleaned_test_functions.jsonl/1996
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1351 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 9455, 11898, 25454, 368, 341, 286, 1273, 31488, 6615, 15147, 8378, 31858, 1337, 559, 9455, 11898, 25454, 626, 286, 442, 279, 1142, 429, 8308, 486, 359, 2949, 4641, 1030, 387, 12510, 553, 1273, 945...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_mul() { let t1 = Decomposed { scale: 2.0f64, rot: Quaternion::new(0.5f64.sqrt(), 0.5f64.sqrt(), 0.0, 0.0), disp: Vector3::new(1.0f64, 2.0, 3.0), }; let t2 = Decomposed { scale: 3.0f64, rot: Quaternion::new(0.5f64.sqrt(), 0.0, 0.5f64.sqrt(), 0.0), disp: Vector3::new(-2.0, 1.0, 0.0), }; let actual = t1 * t2; let expected = Decomposed { scale: 6.0f64, rot: Quaternion::new(0.5, 0.5, 0.5, 0.5), disp: Vector3::new(-3.0, 2.0, 5.0), }; assert_ulps_eq!(actual, expected); }
rust_cleaned_test_functions.jsonl/86457
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 346 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 24944, 368, 341, 262, 1077, 259, 16, 284, 96378, 3865, 341, 286, 5452, 25, 220, 17, 13, 15, 69, 21, 19, 345, 286, 5749, 25, 24801, 486, 931, 7, 15, 13, 20, 69, 21, 19, 18049, 1507, 220, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_serde_ser_internally_tagged_enum() -> Result<(), Box<EvalAltResult>> { #[derive(Serialize)] #[serde(tag = "tag")] enum MyEnum { VariantEmptyStruct {}, VariantStruct { a: i32 }, } let mut map = to_dynamic(MyEnum::VariantEmptyStruct {})?.cast::<Map>(); assert_eq!( "VariantEmptyStruct", map.remove("tag") .unwrap() .into_immutable_string() .unwrap() .as_str() ); assert!(map.is_empty()); let mut map = to_dynamic(MyEnum::VariantStruct { a: 123 })?.cast::<Map>(); assert_eq!( "VariantStruct", map.remove("tag") .unwrap() .into_immutable_string() .unwrap() .as_str() ); assert_eq!(Ok(123), map.remove("a").unwrap().as_int()); assert!(map.is_empty()); Ok(()) }
rust_cleaned_test_functions.jsonl/97329
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 454 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 75861, 450, 75861, 4042, 932, 745, 9372, 3556, 31054, 368, 1464, 5714, 68843, 8261, 23835, 831, 26017, 2077, 2452, 341, 262, 11506, 27098, 3759, 9050, 5563, 262, 11506, 47024, 19343, 284, 330, 4578,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_arr() { let code = vec![0x6B, 0xD1]; let mut nes = Cpu::new(); let mut memory = new_memory(code); nes.A = 0xFF; nes.next(&mut memory).unwrap(); assert_eq!(1, nes.C); assert_eq!(0, nes.V); assert_eq!(0, nes.N); assert_eq!(0, nes.Z); assert_eq!(0x68, nes.A); }
rust_cleaned_test_functions.jsonl/38742
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 220 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 11210, 368, 341, 286, 1077, 2038, 284, 7486, 20703, 15, 87, 21, 33, 11, 220, 15, 15764, 16, 935, 286, 1077, 5206, 308, 288, 284, 356, 5584, 486, 931, 543, 286, 1077, 5206, 4938, 284, 501, 19...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_assert_range_fail() { assert_range!((0..10), 11); assert_range!((1.0..=2.0), 2.1); }
rust_cleaned_test_functions.jsonl/83469
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 60 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 16553, 9698, 22121, 368, 341, 262, 2060, 9698, 0, 1188, 15, 496, 16, 15, 701, 220, 16, 16, 317, 262, 2060, 9698, 0, 1188, 16, 13, 15, 496, 28, 17, 13, 15, 701, 220, 17, 13, 16, 317, 92 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_extract_session_metrics_ok() { let mut metrics = vec![]; let session = SessionUpdate::parse( r#"{ "init": false, "started": "2021-04-26T08:00:00+0100", "attrs": { "release": "1.0.0" }, "did": "user123" }"# .as_bytes(), ) .unwrap(); extract_session_metrics(&session.attributes, &session, &mut metrics); // A none-initial update will not trigger any metric if it's not errored/crashed assert_eq!(metrics.len(), 0); }
rust_cleaned_test_functions.jsonl/63638
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 353 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 39123, 12316, 37686, 19817, 368, 341, 286, 1077, 5206, 16734, 284, 7486, 0, 40901, 286, 1077, 3797, 284, 9164, 4289, 486, 6400, 1006, 310, 435, 55543, 515, 394, 330, 2327, 788, 895, 345, 394, 33...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_dcx_h() { let mut state = State8080::empty_state(); state.memory = vec![0x2b]; state.h = 0x98; state.l = 0x00; emulate_8080_op(&mut state); assert_eq!(state.h, 0x97); assert_eq!(state.l, 0xff); }
rust_cleaned_test_functions.jsonl/7758
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 156 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 814, 25844, 1523, 368, 341, 286, 1077, 5206, 1584, 284, 3234, 23, 15, 23, 15, 486, 3194, 4387, 543, 286, 1584, 36611, 284, 7486, 20703, 15, 87, 17, 65, 935, 286, 1584, 860, 284, 220, 15, 87,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_cast_noop() { // check if we can cast categorical twice without panic let ca = Utf8Chunked::new_from_slice("foo", &["bar", "ham"]); let out = ca.cast(&DataType::Categorical).unwrap(); let out = out.cast(&DataType::Categorical).unwrap(); assert_eq!(out.dtype(), &DataType::Categorical) }
rust_cleaned_test_functions.jsonl/5660
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 154 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 5303, 6536, 453, 368, 341, 286, 442, 1779, 421, 582, 646, 6311, 69536, 10917, 2041, 21975, 198, 286, 1077, 2162, 284, 43432, 23, 28304, 291, 486, 931, 5673, 26488, 445, 7975, 497, 609, 1183, 225...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_none() { let code = "123qwe"; let span = code.span(); let x = substr("asd"); let t = x.or_else(|| substr("qwe")); let r = t.parse(span.ref_clone()); println!("{:?}", r); assert_eq!(r, None); }
rust_cleaned_test_functions.jsonl/94326
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 149 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 31488, 368, 341, 286, 1077, 2038, 284, 330, 16, 17, 18, 80, 896, 876, 286, 1077, 9390, 284, 2038, 52869, 543, 286, 1077, 856, 284, 15769, 445, 79102, 797, 286, 1077, 259, 284, 856, 24282, 6262...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_get() { assert_eq!(2u32.bit(0), false); assert_eq!(2u32.bit(1), true); assert_eq!(2u32.bit(2), false); assert_eq!(123u32.bits(0..0), 0); assert_eq!(255u32.bits(0..8), 255); assert_eq!(255u32.bits(0..9), 255); assert_eq!(255u32.bits(0..7), 127); assert_eq!(1234u32.bits(32..), 0); assert_eq!(1234u32.bits(..32), 1234); assert_eq!(1234u32.bits(0..32), 1234); assert_eq!(123u32.bits(0..=0), 1); assert_eq!(123u32.bits(0..=-1), 0); assert_eq!(1234u32.bits(0..=31), 1234); assert_eq!((-1i32).bits(0..), !0); assert_eq!((-1i32).bits(1..), !0 >> 1); assert_eq!(0xFFu32.bits((Bound::Excluded(1), Bound::Included(1))), 0); assert_eq!((!0u32).bits((Bound::Excluded(31), Bound::Included(31))), 0); assert_eq!((!0u32).bits((Bound::Excluded(-1), Bound::Included(31))), !0); assert_eq!( 0x555u32.bits((Bound::Excluded(1), Bound::Included(7))), 0x15 ); assert_eq!( 0xAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAu128.bits(0..128), 0xAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA ); assert_eq!( 0xAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAu128.bits(0i8..=127i8), 0xAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA ); assert_eq!( 0xAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAu128.bits(64..), 0xAAAAAAAAAAAAAAAA ); assert_eq!(0xAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAu128.bits(127..), 1); }
rust_cleaned_test_functions.jsonl/52222
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 583 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 3062, 368, 341, 6948, 10714, 10297, 17, 84, 18, 17, 30099, 7, 15, 701, 895, 317, 6948, 10714, 10297, 17, 84, 18, 17, 30099, 7, 16, 701, 830, 317, 6948, 10714, 10297, 17, 84, 18, 17, 30099, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_numeric_valid_nested() { let mut test = Map::new(); test.assign("numeric", Value::String("3".to_owned())).ok(); let mut params = Map::new(); params.assign("test", Value::Map(test)).ok(); let mut rules = BTreeMap::new(); rules.insert("test.numeric", vec![Rule::Numeric]); let result = validate(&rules, params); assert!(result.is_ok()); assert_eq!(result.unwrap().find(&["test", "numeric"]).unwrap(), &Value::U64(3)); }
rust_cleaned_test_functions.jsonl/74448
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 204 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 29418, 8337, 66279, 368, 341, 262, 1077, 5206, 1273, 284, 5027, 486, 931, 543, 262, 1273, 17870, 445, 19600, 497, 5162, 486, 703, 445, 18, 3263, 983, 51973, 34670, 562, 543, 262, 1077, 5206, 362...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_matches_starts_and_ends_with_correctly() { check( &WildcardPattern::StartsAndEndsWith { pattern: "alf*cats".into(), starts_with: "alf".into(), ends_with: "cats".into() }, vec!["alf-loves-cats", "alfcats", "alf+cats"], vec!["alf_loves_ats", "", "cats", "not-only-alf-loves-cats"]); }
rust_cleaned_test_functions.jsonl/80619
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 228 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 38344, 86552, 8378, 90729, 6615, 31550, 398, 368, 341, 286, 1779, 1006, 310, 609, 92988, 15760, 486, 3479, 82, 3036, 3727, 16056, 341, 394, 5383, 25, 330, 3104, 9, 37452, 3263, 18122, 3148, 394, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_vertica_epoch_days() { assert_eq!( -358, NaiveDate::from_ymd(1999, 1, 8) .to_y2k_epoch_duration() .num_days() ); assert_eq!( 0, NaiveDate::from_ymd(2000, 1, 1) .to_y2k_epoch_duration() .num_days() ); assert_eq!( 366, NaiveDate::from_ymd(2001, 1, 1) .to_y2k_epoch_duration() .num_days() ); }
rust_cleaned_test_functions.jsonl/13418
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 365 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 54000, 3001, 20682, 28353, 368, 341, 286, 2060, 10714, 33673, 310, 481, 18, 20, 23, 345, 310, 12812, 533, 1916, 486, 1499, 62, 1600, 67, 7, 16, 24, 24, 24, 11, 220, 16, 11, 220, 23, 340, 3...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_kms_envelope_roundtrip() { tink_aead::init(); let a = create_kms_envelope_aead(); let original_plaintext = b"hello world"; let ciphertext = a .encrypt(original_plaintext, &[]) .expect("failed to encrypt"); let plaintext = a.decrypt(&ciphertext, &[]).expect("failed to decrypt"); assert_eq!( plaintext, original_plaintext, "Decrypt(Encrypt({})) = {}; want {}", hex::encode(&original_plaintext), hex::encode(&plaintext), hex::encode(&original_plaintext) ); // Can clone the boxed AEAD. let a2 = a.box_clone(); let plaintext = a2.decrypt(&ciphertext, &[]).expect("failed to decrypt"); assert_eq!(plaintext, original_plaintext,); }
rust_cleaned_test_functions.jsonl/13384
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 329 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 4698, 1011, 6205, 18853, 29896, 32981, 368, 341, 262, 90584, 4306, 3149, 486, 2327, 543, 262, 1077, 264, 284, 1855, 4698, 1011, 6205, 18853, 4306, 3149, 1428, 262, 1077, 4024, 6317, 1641, 427, 284...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_peerset_reject_incoming_in_reserved_only() { let incoming = PeerId::random(); let ii = IncomingIndex(1); let config = PeersetConfig { sets: vec![SetConfig { in_peers: 50, out_peers: 50, bootnodes: vec![], reserved_nodes: Default::default(), reserved_only: true, }], }; let (mut peerset, _) = Peerset::from_config(config); peerset.incoming(SetId::from(0), incoming, ii); assert_messages(peerset, vec![Message::Reject(ii)]); }
rust_cleaned_test_functions.jsonl/50344
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 326 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 36367, 44146, 1288, 583, 1243, 4959, 1243, 74913, 18410, 368, 341, 286, 1077, 19393, 284, 45147, 764, 486, 11463, 543, 286, 1077, 14460, 284, 96143, 1552, 7, 16, 317, 286, 1077, 2193, 284, 5139, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_5() { assert_eq!( parse_column_type(&mut Parser::new("decimal(4,2)")), ColumnType::Decimal(NumericAttr { maximum: Some(4), decimal: Some(2), unsigned: None, zero_fill: None, }) ); }
rust_cleaned_test_functions.jsonl/73834
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 199 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 62, 20, 368, 341, 286, 2060, 10714, 33673, 310, 4715, 8744, 1819, 2099, 6984, 21102, 486, 931, 445, 23289, 7, 19, 11, 17, 8, 30154, 310, 9332, 929, 486, 11269, 8204, 12572, 13371, 341, 394, 71...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_zero_size_dom() { struct TestLayout { } impl Layout for TestLayout { fn layout(&self) -> Dom<Self> { Dom::new(NodeType::Div) } } let mut null_dom = (0..0) .map(|_| NodeData { node_type: NodeType::Div, .. Default::default() }) .collect::<Dom<TestLayout>>(); assert!(null_dom.arena.borrow().nodes_len() == 1); null_dom.push_class("hello"); // should not panic null_dom.set_id("id-hello"); // should not panic }
rust_cleaned_test_functions.jsonl/2902
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 256 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 19359, 2368, 35749, 368, 8022, 262, 2036, 3393, 2175, 314, 2553, 262, 11605, 13821, 369, 3393, 2175, 972, 286, 5168, 6789, 2099, 721, 8, 1464, 20751, 61748, 29, 972, 310, 20751, 486, 931, 22078, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_issue39() { let reads = b"GGCGTGGTGGCTTATGCCTGTAATCCCAGCACTTTGGGAGGTCGAAGTGGGCGG$CCGC\ CCACTTCGACCTCCCAAAGTGCTGGGATTACAGGCATAAGCCACCACGCC$CGAAGTGG\ GCGGATCACTTGAGGTCAGGAGTTGGAGACTAGCCTGGCCAACACGATGAAACCCCGTC\ TCTAATA$TATTAGAGACGGGGTTTCATCGTGTTGGCCAGGCTAGTCTCCAACTCCTGA\ CCTCAAGTGATCCGCCCACTTCG$AGCTCGAAAAATGTTTGCTTATTTTGGTAAAATTA\ TTCATTGACTATGCTCAGAAATCAAGCAAACTGTCCATATTTCATTTTTTG$CAAAAAA\ TGAAATATGGACAGTTTGCTTGATTTCTGAGCATAGTCAATGAATAATTTTACCAAAAT\ AAGCAAACATTTTTCGAGCT$AGCTCGAAAAATGTTTGCTTATTTTGGTAAAATTATTC\ ATTGACTATGCTCAGAAATCAAGCAAACTGTCCATATTTCATTTTTTGAAATTACATAT\ $ATATGTAATTTCAAAAAATGAAATATGGACAGTTTGCTTGATTTCTGAGCATAGTCAA\ TGAATAATTTTACCAAAATAAGCAAACATTTTTCGAGCT$TAAAATTTCCTCTGACAGT\ GTAAAAGAGATCTTCATACAAAAATCAGAATTTATATAGTCTCTTTCCAAAAGACCATA\ AAACCAATCAGTTAATAGTTGAT$ATCAACTATTAACTGATTGGTTTTATGGTCTTTTG\ GAAAGAGACTATATAAATTCTGATTTTTGTATGAAGATCTCTTTTACACTGTCAGAGGA\ AATTTTA$CACCTATCTACCCTGAATCTAAGTGCTAACAGGAAAGGATGCCAGATTGCA\ TGCCTGCTGATAAAGCCACAGTTTGGACTGTCACTCAATCACCATCGTTC$GAACGATG\ GTGATTGAGTGACAGTCCAAACTGTGGCTTTATCAGCAGGCATGCAATCTGGCATCCTT\ TCCTGTTAGCACTTAGATTCAGGGTAGATAGGTG$CATCGTTCCTCCTGTGACTCAGTA\ TAACAAGATTGGGAGAATACTCTACAGTTCCTGATTCCCCCACAG$CTGTGGGGGAATC\ AGGAACTGTAGAGTATTCTCCCAATCTTGTTATACTGAGTCACAGGAGGAACGATG$TG\ TAAATTCTGAGAAAAATTTGCAGGTCTTTCTTCAGGAGCATGTAATCTCTTGCTCTCTT\ TGTTATCTATCTATAGTACTGTAGGTTATCTGGAGTTGCT$AGCAACTCCAGATAACCT\ ACAGTACTATAGATAGATAACAAAGAGAGCAAGAGATTACATGCTCCTGAAGAAAGACC\ TGCAAATTTTTCTCAGAATTTACA$CACTTCTCCTTGTCTTTACAGACTGGTTTTGCAC\ TGGGAAATCCTTTCACCAGTCAGCCCAGTTAGAGATTCTG$CAGAATCTCTAACTGGGC\ TGACTGGTGAAAGGATTTCCCAGTGCAAAACCAGTCTGTAAAGACAAGGAGAAGTG$AA\ TGGAGGTATATAAATTATCTGGCAAAGTGACATATCCTGACACATTCTCCAGGATAGAT\ CAAATGTTAGGTCACAAAGAGAGTCTTAACAAAATT$AATTTTGTTAAGACTCTCTTTG\ TGACCTAACATTTGATCTATCCTGGAGAATGTGTCAGGATATGTCACTTTGCCAGATAA\ TTTATATACCTCCATT$TTAATTTTGTTAAGACTCTCTTTGTGACCTAACATTTGATCT\ ATCCTGGAGAATGTGTCAGGATATGTCACTTTGCCAGATAATTTATATACCTCCATTTT\ $AAAATGGAGGTATATAAATTATCTGGCAAAGTGACATATCCTGACACATTCTCCAGGA\ TAGATCAAATGTTAGGTCACAAAGAGAGTCTTAACAAAATTAA$TTCTTCTTTGACTCA\ TTGGTTGTTCAATAGTATGTTGTTTAATTTCCATATATTTGTAAATGTTTCCGTTTTCC\ TTCTACTATTGAATTTTTGCTTCATC$GATGAAGCAAAAATTCAATAGTAGAAGGAAAA\ CGGAAACATTTACAAATATATGGAAATTAAACAACATACTATTGAACAACCAATGAGTC\ AAAGAAGAA$AGGAAAACGGAAACATTTACAAATATATGGAAATTAAACAACATACTAT\ TGAACAACCAATGAGTCAAAGAAGAAATCAAAAAGAATATTAGAAAAC$GTTTTCTAAT\ ATTCTTTTTGATTTCTTCTTTGACTCATTGGTTGTTCAATAGTATGTTGTTTAATTTCC\ ATATATTTGTAAATGTTTCCGTTTTCCT$TTAGAAAACAAGCTGACAAAAAAATAAAAA\ AACACAACATAGCAAAACTTAGAAATGCAGCAAAGGCAGTACTAAAGAGGGAAATTTAT\ AGCAATAAATGC$GCATTTATTGCTATAAATTTCCCTCTTTAGTACTGCCTTTGCTGCA\ TTTCTAAGTTTTGCTATGTTGTGTTTTTTTATTTTTTTGTCAGCTTGTTTTCTAA$TTT\ ATTGCTATAAATTTCCCTCTTTAGTACTGCCTTTGCTGCATTTCTAAGTTTTGCTATGT\ TGTGTTTTTTTATTTTTTTGTCAGCTTGTTTTCTA$TAGAAAACAAGCTGACAAAAAAA\ TAAAAAAACACAACATAGCAAAACTTAGAAATGCAGCAAAGGCAGTACTAAAGAGGGAA\ ATTTATAGCAATAAA$TCTTTCTTCTTTTTTAAGGTAGGCATTTATTGCTATAAATTTC\ CCTCTTTAGTACTGCCTTTG$CAAAGGCAGTACTAAAGAGGGAAATTTATAGCAATAAA\ TGCCTACCTTAAAAAAGAAGAAAGA$"; let alphabet = dna::n_alphabet(); let sa = suffix_array(reads); let bwt = bwt(reads, &sa); let less = less(&bwt, &alphabet); let occ = Occ::new(&bwt, 3, &alphabet); let fmindex = FMIndex::new(&bwt, &less, &occ); let fmdindex = FMDIndex::from(fmindex); let read = b"GGCGTGGTGGCTTATGCCTGTAATCCCAGCACTTTGGGAGGTCGAAGTGGGCGG"; let read_pos = 0; for i in 0..read.len() { println!("i {}", i); let intervals = fmdindex.smems(read, i); println!("{:?}", intervals); let matches = intervals .iter() .flat_map(|interval| interval.forward().occ(&sa)) .collect::<Vec<usize>>(); assert_eq!(matches, vec![read_pos]); } }
rust_cleaned_test_functions.jsonl/18362
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 3112 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 53340, 18, 24, 368, 341, 286, 1077, 15804, 284, 293, 1, 22254, 8798, 51, 22254, 51, 22254, 1162, 51, 828, 22863, 1162, 38, 15204, 828, 53873, 1890, 5049, 1162, 14903, 22254, 38, 1890, 38, 7749, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2