text
stringlengths
93
16.4k
id
stringlengths
20
40
metadata
dict
input_ids
listlengths
45
2.05k
attention_mask
listlengths
45
2.05k
complexity
int64
1
9
#[test] fn test_chain() { #[rustfmt::skip] let tests = vec![ ( vec![3,15,3,16,1002,16,10,16,1,16,15,15,4,15,99,0,0], &[4,3,2,1,0], 43210, ), ( vec![3,23,3,24,1002,24,10,24,1002,23,-1,23, 101,5,23,23,1,24,23,23,4,23,99,0,0], &[0,1,2,3,4], 54321, ), ( vec![3,31,3,32,1002,32,10,32,1001,31,-2,31,1007,31,0,33, 1002,33,7,33,1,33,31,31,1,32,31,31,4,31,99,0,0,0], &[1,0,4,3,2], 65210, ), ]; for (prog, settings, output) in tests { let prog = Intcode::new(prog); assert_eq!(output, chain_output(&prog, settings.as_ref())); assert_eq!(output, max_output(&prog, chain_output, 0..=4)); } }
rust_cleaned_test_functions.jsonl/75778
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 555 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 30583, 368, 341, 262, 11506, 35788, 12501, 486, 20599, 921, 262, 1077, 7032, 284, 7486, 90515, 286, 2399, 310, 7486, 20703, 18, 11, 16, 20, 11, 18, 11, 16, 21, 11, 16, 15, 15, 17, 11, 16, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_find_strobogrammatic() { let test_cases = vec![ (2, vec!["11", "69", "88", "96"]), (1, vec!["0", "1", "8"]), ]; for (n, expect) in test_cases { assert_eq!(Solution::find_strobogrammatic(n), expect, "n: {}", n); } }
rust_cleaned_test_functions.jsonl/36757
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 174 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21814, 1261, 22740, 12958, 37244, 368, 341, 286, 1077, 1273, 41427, 284, 7486, 90515, 310, 320, 17, 11, 7486, 0, 1183, 16, 16, 497, 330, 21, 24, 497, 330, 23, 23, 497, 330, 24, 21, 46442, 31...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_ldd_parse_v2_30() { let archlinux_ls_output = "\tlinux-vdso.so.1 (0x00007ffddc1f6000) \tlibcap.so.2 => /usr/lib/libcap.so.2 (0x00007f4980989000) \tlibc.so.6 => /lib/x86_64-linux-gnu/libc.so.6 (0x00007f69ca6a1000) \tlibc.so.6 => /usr/lib/libc.so.6 (0x00007f49807c2000) \t/lib64/ld-linux-x86-64.so.2 => /usr/lib64/ld-linux-x86-64.so.2 (0x00007f49809e9000) "; assert_eq!( parse_ldd_output(archlinux_ls_output) .iter() .map(|p| p.to_str().unwrap()) .collect::<Vec<_>>(), &[ "/usr/lib/libcap.so.2", "/lib/x86_64-linux-gnu/libc.so.6", "/usr/lib/libc.so.6", "/lib64/ld-linux-x86-64.so.2", "/usr/lib64/ld-linux-x86-64.so.2", ] ) }
rust_cleaned_test_functions.jsonl/77642
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 529 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 50573, 67, 21039, 2273, 17, 62, 18, 15, 368, 341, 286, 1077, 5325, 14210, 53174, 7645, 284, 2917, 83, 14210, 8273, 67, 704, 26476, 13, 16, 320, 15, 87, 15, 15, 15, 15, 22, 542, 631, 66, 16...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_parse_body() { let mut buf = BytesMut::from("GET /test HTTP/1.1\r\nContent-Length: 4\r\n\r\nbody"); let mut reader = MessageDecoder::<Request>::default(); let (req, pl) = reader.decode(&mut buf).unwrap().unwrap(); let mut pl = pl.unwrap(); assert_eq!(req.version(), Version::HTTP_11); assert_eq!(*req.method(), Method::GET); assert_eq!(req.path(), "/test"); assert_eq!( pl.decode(&mut buf).unwrap().unwrap().chunk().as_ref(), b"body" ); }
rust_cleaned_test_functions.jsonl/22260
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 284 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21039, 14114, 368, 341, 286, 1077, 5206, 6607, 4035, 310, 30024, 51440, 486, 1499, 445, 3806, 608, 1944, 10130, 14, 16, 13, 16, 12016, 1699, 2762, 52493, 25, 220, 19, 12016, 1699, 12016, 1699, 2...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_consecutive_skips() { let constraint: Box<dyn SinglePartConstraint> = Box::new(NoConsecutiveSkips); run_scale_free_test(&constraint, &[1, 2, 1], 4, true); run_scale_free_test(&constraint, &[1, 4, 3], 4, true); run_scale_free_test(&constraint, &[1, 4, 1], 4, false); run_scale_free_test(&constraint, &[1, 4, 6], 4, false); }
rust_cleaned_test_functions.jsonl/74369
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 188 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 3382, 85780, 33811, 3077, 368, 341, 286, 1077, 21568, 25, 8261, 92846, 11327, 5800, 17890, 29, 284, 8261, 486, 931, 7, 2753, 1109, 85780, 19290, 3077, 317, 286, 1598, 16727, 8905, 4452, 2099, 4805...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_truncate() { let mut v: Vec<Box<_>> = vec![box 6, box 5, box 4]; v.truncate(1); let v = v; assert_eq!(v.len(), 1); assert_eq!(*(v[0]), 6); }
rust_cleaned_test_functions.jsonl/12863
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 105 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 3547, 26900, 368, 341, 262, 1077, 5206, 348, 25, 11312, 79852, 32399, 2452, 284, 7486, 20703, 2011, 220, 21, 11, 3745, 220, 20, 11, 3745, 220, 19, 935, 262, 348, 5427, 26900, 7, 16, 317, 262, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_ignore_union_typedef_from_decl_context_redecl() { let ir = ir_from_cc( r#" namespace test_namespace_bindings { union MyUnion {}; } namespace test_namespace_bindings { typedef MyUnion MyUnion; } "#, ) .unwrap(); assert_ir_matches!(ir, quote! { Record { ... cc_name: "MyUnion" ...}}); assert_ir_not_matches!(ir, quote! { TypeAlias { identifier: "MyUnion" ... } }); }
rust_cleaned_test_functions.jsonl/37194
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 188 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 58493, 51621, 42111, 4219, 5673, 35814, 8467, 1288, 10005, 368, 341, 262, 1077, 6216, 284, 6216, 5673, 28955, 1006, 286, 435, 2, 698, 286, 4473, 1273, 41571, 94516, 314, 11300, 3017, 32658, 52166, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_multipart_no_end_crlf() { run_on(|| { let (sender, payload) = create_stream(); let (bytes, headers) = create_simple_request_with_header(); let bytes_stripped = bytes.slice_to(bytes.len()); // strip crlf sender.unbounded_send(Ok(bytes_stripped)).unwrap(); drop(sender); // eof let mut multipart = Multipart::new(&headers, payload); match multipart.poll().unwrap() { Async::Ready(Some(_)) => (), _ => unreachable!(), } match multipart.poll().unwrap() { Async::Ready(Some(_)) => (), _ => unreachable!(), } match multipart.poll().unwrap() { Async::Ready(None) => (), _ => unreachable!(), } }) }
rust_cleaned_test_functions.jsonl/43762
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 464 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 717, 18204, 6536, 6213, 666, 2381, 69, 368, 341, 286, 1598, 4470, 79453, 341, 310, 1077, 320, 11644, 11, 7729, 8, 284, 1855, 12673, 543, 310, 1077, 320, 9651, 11, 7102, 8, 284, 1855, 30015, 78...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
5
#[test] fn test_unkeyed_empty() { let mut st = Xoodyak::hash(); let mut out = [0u8; 32]; st.squeeze(&mut out); assert_eq!( out, [ 141, 216, 213, 137, 191, 252, 99, 169, 25, 45, 35, 27, 20, 160, 165, 255, 204, 246, 41, 214, 87, 39, 76, 114, 39, 130, 131, 52, 124, 189, 128, 53 ] ); let mut st = Xoodyak::hash(); let mut out = [0u8; 32]; st.absorb(&[]); st.squeeze(&mut out); assert_eq!( out, [ 234, 21, 47, 43, 71, 188, 226, 78, 251, 102, 196, 121, 212, 173, 241, 123, 211, 36, 216, 6, 232, 95, 247, 94, 227, 105, 238, 80, 220, 143, 139, 209 ] ); }
rust_cleaned_test_functions.jsonl/125256
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 465 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 4907, 792, 291, 15124, 368, 341, 286, 1077, 5206, 357, 284, 1599, 78, 1076, 585, 486, 8296, 543, 286, 1077, 5206, 700, 284, 508, 15, 84, 23, 26, 220, 18, 17, 935, 286, 357, 61720, 2099, 6984...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_pipeline_transaction() { let ctx = TestContext::new(); block_on_all(ctx.async_connection().and_then(|con| { let mut pipe = redis::pipe(); pipe.atomic() .cmd("SET") .arg("key_1") .arg(42) .ignore() .cmd("SET") .arg("key_2") .arg(43) .ignore() .cmd("MGET") .arg(&["key_1", "key_2"]); pipe.query_async(con) .and_then(|(_con, ((k1, k2),)): (_, ((i32, i32),))| { assert_eq!(k1, 42); assert_eq!(k2, 43); Ok(()) }) })) .unwrap(); }
rust_cleaned_test_functions.jsonl/10903
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 428 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 45187, 28884, 368, 341, 262, 1077, 5635, 284, 3393, 1972, 486, 931, 543, 262, 2504, 4470, 5705, 7502, 24747, 15866, 1005, 437, 68367, 22428, 443, 91, 341, 286, 1077, 5206, 13647, 284, 20870, 486, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_serialize_id_unset() { let mut builder = new_builder(); builder.id(0x0405); builder.df_flag(true); let mut buf = (&[0, 1, 2, 3, 3, 4, 5, 7, 8, 9]) .into_serializer() .encapsulate(builder) .serialize_vec_outer() .unwrap(); let packet = buf.parse::<Ipv4Packet<_>>().unwrap(); assert_eq!(packet.id(), 0); assert!(packet.df_flag()); assert_eq!(packet.mf_flag(), false); assert_eq!(packet.fragment_offset(), 0); assert_eq!(packet.fragment_type(), Ipv4FragmentType::InitialFragment); }
rust_cleaned_test_functions.jsonl/31693
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 332 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 88686, 842, 98109, 368, 341, 286, 1077, 5206, 7363, 284, 501, 28532, 543, 286, 7363, 1764, 7, 15, 87, 15, 19, 15, 20, 317, 286, 7363, 48378, 10933, 3715, 626, 286, 1077, 5206, 6607, 284, 15899...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_header_typ_override() { let p1 = json!({ "key1" : "val1", "key2" : "val2", "key3" : "val3" }); let h1 = json!({"typ" : "cust", "alg" : Algorithm::ES512.to_string()}); let header = json!({"typ" : "cust"}); let jwt1 = encode(header, &get_ec_private_key_path(), &p1, Algorithm::ES512).unwrap(); let (header, payload) = decode(&jwt1, &get_ec_public_key_path(), Algorithm::ES512).unwrap(); assert_eq!(h1, header); assert_eq!(p1, payload); }
rust_cleaned_test_functions.jsonl/45858
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 295 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 8757, 42111, 48576, 368, 341, 286, 1077, 281, 16, 284, 2951, 0, 2262, 310, 330, 792, 16, 1, 549, 330, 831, 16, 756, 310, 330, 792, 17, 1, 549, 330, 831, 17, 756, 310, 330, 792, 18, 1, 54...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_read_before_init() { let _guard = crate::setup(); // Initialize cluster let mut cluster = new_node_cluster(0, 3); configure_for_lease_read(&mut cluster, Some(50), Some(10_000)); let pd_client = Arc::clone(&cluster.pd_client); pd_client.disable_default_operator(); // Set region and peers let r1 = cluster.run_conf_change(); let p1 = new_peer(1, 1); let p2 = new_peer(2, 2); cluster.pd_client.must_add_peer(r1, p2.clone()); cluster.must_put(b"k0", b"v0"); cluster.pd_client.must_none_pending_peer(p2.clone()); must_get_equal(&cluster.get_engine(2), b"k0", b"v0"); fail::cfg("before_apply_snap_update_region", "return").unwrap(); // Add peer 3 let p3 = new_peer(3, 3); cluster.pd_client.must_add_peer(r1, p3.clone()); thread::sleep(Duration::from_millis(500)); let region = cluster.get_region(b"k0"); assert_eq!(cluster.leader_of_region(r1).unwrap(), p1); let mut request = new_request( region.get_id(), region.get_region_epoch().clone(), vec![new_get_cf_cmd("default", b"k0")], false, ); request.mut_header().set_peer(p3.clone()); request.mut_header().set_replica_read(true); let (cb, rx) = make_cb(&request); cluster .sim .rl() .async_command_on_node(3, request, cb) .unwrap(); let resp = rx.recv_timeout(Duration::from_secs(5)).unwrap(); assert!( resp.get_header() .get_error() .get_message() .contains("not initialized yet"), "{:?}", resp.get_header().get_error() ); }
rust_cleaned_test_functions.jsonl/19972
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 755 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6443, 23708, 6137, 368, 341, 262, 1077, 716, 26098, 284, 17717, 486, 15188, 543, 262, 442, 9008, 10652, 198, 262, 1077, 5206, 10652, 284, 501, 5084, 28441, 7, 15, 11, 220, 18, 317, 262, 14411, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_euc_jp_decode() { // Empty decode_euc_jp(b"", &""); // ASCII decode_euc_jp(b"\x61\x62", "\u{0061}\u{0062}"); // Half-width decode_euc_jp(b"\x8E\xA1", "\u{FF61}"); decode_euc_jp(b"\x8E\xDF", "\u{FF9F}"); decode_euc_jp(b"\x8E\xA0", "\u{FFFD}"); decode_euc_jp(b"\x8E\xE0", "\u{FFFD}"); decode_euc_jp(b"\x8E\xFF", "\u{FFFD}"); decode_euc_jp(b"\x8E", "\u{FFFD}"); // JIS 0212 decode_euc_jp(b"\x8F\xA1\xA1", "\u{FFFD}"); decode_euc_jp(b"\x8F\xA2\xAF", "\u{02D8}"); decode_euc_jp(b"\x8F\xA2\xFF", "\u{FFFD}"); decode_euc_jp(b"\x8F\xA1", "\u{FFFD}"); decode_euc_jp(b"\x8F", "\u{FFFD}"); // JIS 0208 decode_euc_jp(b"\xA1\xA1", "\u{3000}"); decode_euc_jp(b"\xA1\xA0", "\u{FFFD}"); decode_euc_jp(b"\xFC\xFE", "\u{FF02}"); decode_euc_jp(b"\xFE\xFE", "\u{FFFD}"); decode_euc_jp(b"\xA1", "\u{FFFD}"); // Bad leads decode_euc_jp(b"\xFF\xA1\xA1", "\u{FFFD}\u{3000}"); decode_euc_jp(b"\xA0\xA1\xA1", "\u{FFFD}\u{3000}"); decode_euc_jp(b"\x80\xA1\xA1", "\u{FFFD}\u{3000}"); decode_euc_jp(b"\x81\xA1\xA1", "\u{FFFD}\u{3000}"); decode_euc_jp(b"\x82\xA1\xA1", "\u{FFFD}\u{3000}"); decode_euc_jp(b"\x83\xA1\xA1", "\u{FFFD}\u{3000}"); decode_euc_jp(b"\x84\xA1\xA1", "\u{FFFD}\u{3000}"); decode_euc_jp(b"\x85\xA1\xA1", "\u{FFFD}\u{3000}"); decode_euc_jp(b"\x86\xA1\xA1", "\u{FFFD}\u{3000}"); decode_euc_jp(b"\x87\xA1\xA1", "\u{FFFD}\u{3000}"); decode_euc_jp(b"\x88\xA1\xA1", "\u{FFFD}\u{3000}"); decode_euc_jp(b"\x89\xA1\xA1", "\u{FFFD}\u{3000}"); decode_euc_jp(b"\x8A\xA1\xA1", "\u{FFFD}\u{3000}"); decode_euc_jp(b"\x8B\xA1\xA1", "\u{FFFD}\u{3000}"); decode_euc_jp(b"\x8C\xA1\xA1", "\u{FFFD}\u{3000}"); decode_euc_jp(b"\x8D\xA1\xA1", "\u{FFFD}\u{3000}"); // Bad ASCII trail decode_euc_jp(b"\xA1\x40", "\u{FFFD}\u{0040}"); }
rust_cleaned_test_functions.jsonl/15055
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1369 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2204, 1754, 5374, 79, 15227, 368, 341, 286, 442, 22228, 198, 286, 16895, 2204, 1754, 5374, 79, 1883, 56323, 609, 3014, 626, 286, 442, 39316, 198, 286, 16895, 2204, 1754, 5374, 79, 1883, 11934, 8...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_parser() { assert_eq!( ByteRange { length: 99999, start: Some(2), }, "99999@2".parse::<ByteRange>().unwrap() ); assert_eq!( ByteRange { length: 99999, start: Some(2), }, "99999@2".parse::<ByteRange>().unwrap() ); assert_eq!( ByteRange { length: 99999, start: None, }, "99999".parse::<ByteRange>().unwrap() ); assert!("".parse::<ByteRange>().is_err()); }
rust_cleaned_test_functions.jsonl/8004
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 404 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 18517, 368, 341, 286, 2060, 10714, 33673, 310, 10906, 6046, 341, 394, 3084, 25, 220, 24, 24, 24, 24, 24, 345, 394, 1191, 25, 4329, 7, 17, 1326, 310, 1153, 310, 330, 24, 24, 24, 24, 24, 31,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_panic_mark_file_path() { let dir = Builder::new() .prefix("test_panic_mark_file_path") .tempdir() .unwrap(); let panic_mark_file = panic_mark_file_path(dir.path()); assert_eq!(panic_mark_file, dir.path().join(PANIC_MARK_FILE)) }
rust_cleaned_test_functions.jsonl/20424
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 161 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 620, 31270, 18924, 2458, 2638, 368, 341, 286, 1077, 5419, 284, 20626, 486, 931, 741, 310, 659, 11849, 445, 1944, 620, 31270, 18924, 2458, 2638, 1138, 310, 659, 3888, 3741, 741, 310, 659, 15454, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_object_literal_initializer_numeric_literal() { assert_parse_success!( primary_expression(false, false), "{ 0: true }", Expression::ObjectExpression { loc: Some(((1, 0), (1, 11)).into()), properties: vec![ObjectExpressionProperty::Property(Property { kind: PropertyKind::Init, key: Expression::Literal { value: Literal::NumericLiteral(NumericLiteral(0f64)), loc: Some(((1, 2), (1, 3)).into()), }, value: Expression::Literal { value: Literal::BooleanLiteral(BooleanLiteral(true)), loc: Some(((1, 5), (1, 9)).into()), }, method: false, shorthand: false, computed: false, loc: Some(((1, 2), (1, 9)).into()), })], } ); }
rust_cleaned_test_functions.jsonl/66477
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 521 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 5314, 34100, 36462, 29418, 34100, 368, 341, 262, 2060, 21039, 18632, 33673, 286, 6028, 28068, 3576, 11, 895, 1326, 286, 13868, 220, 15, 25, 830, 335, 756, 286, 16378, 486, 1190, 9595, 341, 310, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_rwlock_default() { let lock = RwLock::<usize>::default(); assert_eq!(lock.wlock.load(Ordering::Relaxed), false); for idx in 0..MAX_READER_THREADS { assert_eq!(lock.rlock[idx].load(Ordering::Relaxed), 0); } assert_eq!(unsafe { *lock.data.get() }, usize::default()); }
rust_cleaned_test_functions.jsonl/77521
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 172 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 98850, 9993, 368, 341, 286, 1077, 5296, 284, 55294, 11989, 27638, 51878, 6831, 2258, 1428, 286, 2060, 10714, 10297, 1023, 1418, 1023, 5104, 39692, 287, 486, 6740, 51451, 701, 895, 317, 286, 369, 7...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_split_datum() { let table = vec![ vec![Datum::I64(1)], vec![ Datum::F64(1f64), Datum::F64(3.15), Datum::Bytes(b"123".to_vec()), ], vec![ Datum::U64(1), Datum::F64(3.15), Datum::Bytes(b"123".to_vec()), Datum::I64(-1), ], vec![Datum::I64(1), Datum::I64(0)], vec![Datum::Null], vec![Datum::I64(100), Datum::U64(100)], vec![Datum::U64(1), Datum::U64(1)], vec![Datum::Dec(10.into())], vec![ Datum::F64(1f64), Datum::F64(3.15), Datum::Bytes(b"123456789012345".to_vec()), ], vec![Datum::Json(Json::from_str(r#"{"key":"value"}"#).unwrap())], vec![ Datum::F64(1f64), Datum::Json(Json::from_str(r#"{"key":"value"}"#).unwrap()), Datum::F64(3.15), Datum::Bytes(b"123456789012345".to_vec()), ], ]; for case in table { let key_bs = encode_key(&case).unwrap(); let mut buf = key_bs.as_slice(); for exp in &case { let (act, rem) = split_datum(buf, false).unwrap(); let exp_bs = encode_key(as_slice(exp)).unwrap(); assert_eq!(exp_bs, act); buf = rem; } assert!(buf.is_empty()); let value_bs = encode_value(&case).unwrap(); let mut buf = value_bs.as_slice(); for exp in &case { let (act, rem) = split_datum(buf, false).unwrap(); let exp_bs = encode_value(as_slice(exp)).unwrap(); assert_eq!(exp_bs, act); buf = rem; } assert!(buf.is_empty()); } }
rust_cleaned_test_functions.jsonl/10806
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1232 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 17052, 15353, 372, 368, 341, 286, 1077, 1965, 284, 7486, 90515, 310, 7486, 20703, 68036, 486, 40, 21, 19, 7, 16, 30749, 310, 7486, 90515, 394, 68459, 486, 37, 21, 19, 7, 16, 69, 21, 19, 1326...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
9
#[test] fn test_single_task() { let runner = SingleTaskRunner::default(); let rt = runner.startup().unwrap(); thread::spawn(move || { loop { if let Err(e) = runner.run() { println!("!!!!!!run failed, reason: {:?}", e); break; } thread::sleep(Duration::from_millis(10)); } }); let mut ids = Vec::with_capacity(50); for index in 0..100 { let uid = rt.alloc(); let uid_copy = uid.clone(); let value = SyncUsize(Arc::new(RefCell::new(index))); let future = TestFuture0::new(rt.clone(), value.clone(), uid.clone()); if let Err(e) = rt.spawn(uid.clone(), async move { println!("!!!!!!async task start, uid: {:?}", uid_copy); let r = future.await; println!("!!!!!!async task finish, uid: {:?}, r: {:?}", uid_copy, r); }) { println!("!!!> spawn task failed, uid: {:?}, reason: {:?}", uid, e); } if index % 2 == 0 { ids.push((uid, value)); } } thread::sleep(Duration::from_millis(3000)); for (id, value) in ids { let id_copy = id.clone(); let uid = rt.alloc(); let uid_copy = uid.clone(); let rt_copy = rt.clone(); if let Err(e) = rt.spawn(uid, async move { rrow_mut() += 1; rt_copy.wakeup(&id_copy); }) { println!("!!!> spawn waker failed, id: {:?}, uid: {:?}, reason: {:?}", id, uid_copy, e); } } thread::sleep(Duration::from_millis(100000000)); }
rust_cleaned_test_functions.jsonl/62453
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 864 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 19487, 12184, 368, 972, 262, 1077, 22259, 284, 11327, 6262, 19486, 486, 2258, 1647, 262, 1077, 16677, 284, 22259, 4962, 454, 1005, 15454, 7317, 262, 4516, 486, 46087, 34081, 1369, 972, 286, 6337, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
8
#[test] fn test_rows_properties() { let mut collector = MvccPropertiesCollector::new(); let num_rows = PROP_ROWS_INDEX_DISTANCE * 3 + 2; for i in 0..num_rows { let key = format!("k-{}", i); let k1 = Key::from_raw(key.as_bytes()).append_ts(2); let k1 = keys::data_key(k1.encoded()); let k2 = Key::from_raw(key.as_bytes()).append_ts(1); let k2 = keys::data_key(k2.encoded()); let v = Write::new(WriteType::Put, 0, None).to_bytes(); collector.add(&k1, &v, DBEntryType::Put, 0, 0); collector.add(&k2, &v, DBEntryType::Put, 0, 0); } let result = UserProperties(collector.finish()); let props = RowsProperties::decode(&result).unwrap(); assert_eq!(props.total_rows, num_rows); assert_eq!(props.index_handles.len(), 5); let cases = [ ("k-0", 1, 1), ( "k-10000", PROP_ROWS_INDEX_DISTANCE, PROP_ROWS_INDEX_DISTANCE + 1, ), ( "k-20000", PROP_ROWS_INDEX_DISTANCE, PROP_ROWS_INDEX_DISTANCE * 2 + 1, ), ( "k-30000", PROP_ROWS_INDEX_DISTANCE, PROP_ROWS_INDEX_DISTANCE * 3 + 1, ), ("k-30001", 1, PROP_ROWS_INDEX_DISTANCE * 3 + 2), ]; for &(key, size, offset) in &cases { let k = Key::from_raw(key.as_bytes()); let k = keys::data_key(k.encoded()); let h = &props.index_handles[&k]; assert_eq!(h.size, size); assert_eq!(h.offset, offset); } let h: Vec<_> = props.index_handles.values().collect(); let cases = [ ("a", "z", h[4].offset), ("a", "a", 0), ("z", "z", 0), ("k-1", "k-10000", h[1].offset - h[0].offset), ("k-1", "k-20000", h[2].offset - h[0].offset), ("k-16666", "k-18888", h[2].offset - h[1].offset), ("k-16666", "k-26666", h[3].offset - h[1].offset), ]; for &(start, end, rows) in &cases { let start = keys::data_key(start.as_bytes()); let end = keys::data_key(end.as_bytes()); assert_eq!(props.get_approximate_rows_in_range(&start, &end), rows); } }
rust_cleaned_test_functions.jsonl/22207
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1384 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 10949, 25158, 368, 341, 286, 1077, 5206, 31953, 284, 386, 85, 638, 7903, 53694, 486, 931, 543, 286, 1077, 1629, 10949, 284, 41977, 62725, 14515, 63217, 353, 220, 18, 488, 220, 17, 280, 286, 369,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
4
#[test] fn test_sigpipe_panic() { let mut cmd = new_ucmd!(); let mut child = cmd.args(&["ext_sort.txt"]).run_no_wait(); // Dropping the stdout should not lead to an error. // The "Broken pipe" error should be silently ignored. drop(child.stdout.take()); assert_eq!( String::from_utf8(child.wait_with_output().unwrap().stderr), Ok(String::new()) ); }
rust_cleaned_test_functions.jsonl/20538
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 168 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 29252, 13768, 620, 31270, 368, 341, 262, 1077, 5206, 5439, 284, 501, 68887, 2277, 0, 543, 262, 1077, 5206, 1682, 284, 5439, 16365, 2099, 1183, 427, 18435, 3909, 45014, 6108, 6536, 18760, 543, 262,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_primitive_type() { let x = 0xf312_u16; let mut wtr: Vec<u8> = vec![]; wtr.extend_from_slice(&x.to_le_bytes()); assert_eq!(x.test_only_hash(), HashValue::sha3_256_of(&wtr[..])); let x = 0x_ff001234_u32; let mut wtr: Vec<u8> = vec![]; wtr.extend_from_slice(&x.to_le_bytes()); assert_eq!(x.test_only_hash(), HashValue::sha3_256_of(&wtr[..])); let x = 0x_89abcdef_01234567_u64; let mut wtr: Vec<u8> = vec![]; wtr.extend_from_slice(&x.to_le_bytes()); assert_eq!(x.test_only_hash(), HashValue::sha3_256_of(&wtr[..])); }
rust_cleaned_test_functions.jsonl/118035
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 298 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 84087, 1819, 368, 341, 262, 1077, 856, 284, 220, 15, 5848, 18, 16, 17, 7300, 16, 21, 280, 262, 1077, 5206, 289, 376, 25, 11312, 34837, 23, 29, 284, 7486, 0, 15078, 262, 289, 376, 15831, 5673...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_read_keys() { if get_effective_uid() == 0 { panic!("can't run tests as root"); } let dir = make_ssh_dir().expect("make_ssh_dir() failed"); let formatted_dir = dir.path().join(KEYS_SUBDIR).to_string_lossy().into_owned(); do_read_keys( dir.path(), &format!( "# {dir}/a file-a-no-newline # {dir}/b file-b file-b2 # {dir}/e # {dir}/nl\u{fffd}nl file-nl # {dir}/sf file-a-no-newline ", dir = formatted_dir ), &format!( "Error: {dir}/.h is a dotfile, ignoring Error: opening {dir}/c Caused by: Permission denied (os error 13) Error: {dir}/d is not a file, ignoring Error: {dir}/dnp is not a file, ignoring Error: {dir}/fifo is not a file, ignoring Error: {dir}/sd is not a file, ignoring Error: couldn't stat {dir}/snx Caused by: No such file or directory (os error 2) ", dir = formatted_dir ), ) .expect("read_keys() failed"); }
rust_cleaned_test_functions.jsonl/76309
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 536 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6443, 12631, 368, 341, 286, 421, 633, 27125, 533, 25396, 368, 621, 220, 15, 341, 310, 21975, 17223, 4814, 944, 1598, 7032, 438, 3704, 797, 286, 555, 286, 1077, 5419, 284, 1281, 82805, 4334, 1005...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_resource_block_with_undeclared_nonlocal_shorthand_rule_body() { let p = Polar::new(); p.register_constant(sym!("Repo"), term!("unimportant")) .unwrap(); p.register_constant(sym!("Org"), term!("unimportant")) .unwrap(); expect_error( &p, r#"resource Repo { roles = ["writer"]; relations = { parent: Org }; "writer" if "owner" on "parent"; }"#, r#"Repo: Relation "parent" in rule body `"owner" on "parent"` has type 'Org', but no such resource block exists. Try declaring one: `resource Org {}`"#, ); expect_error( &p, r#"resource Repo { roles = ["writer"]; relations = { parent: Org }; "writer" if "owner" on "parent"; } resource Org {}"#, r#"Repo: Term "owner" not declared in related resource block 'Org'. Did you mean to declare it as a role, permission, or relation in the 'Org' resource block?"#, ); }
rust_cleaned_test_functions.jsonl/31743
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 561 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 17962, 7113, 6615, 62, 28865, 86251, 21637, 2438, 3712, 61679, 21124, 14114, 368, 341, 286, 1077, 281, 284, 55896, 486, 931, 543, 286, 281, 9929, 34967, 62512, 17223, 25243, 3975, 4647, 17223, 359, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_sample() { let min_val = 1; let max_val = 100; let mut r = task_rng(); let vals = range(min_val, max_val).collect::<Vec<int>>(); let small_sample = r.sample(vals.iter(), 5); let large_sample = r.sample(vals.iter(), vals.len() + 5); assert_eq!(small_sample.len(), 5); assert_eq!(large_sample.len(), vals.len()); assert!(small_sample.iter().all(|e| { **e >= min_val && **e <= max_val })); }
rust_cleaned_test_functions.jsonl/46783
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 255 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 17491, 368, 341, 286, 1077, 1308, 6189, 284, 220, 16, 280, 286, 1077, 1932, 6189, 284, 220, 16, 15, 15, 401, 286, 1077, 5206, 435, 284, 3383, 66849, 543, 286, 1077, 28356, 284, 2088, 14146, 61...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_doc_stripping_specs() { Command::cargo_bin("specdown") .unwrap() .arg("--no-colour") .arg("run") .arg("--running-dir") .arg(".specdown") .arg("docs/cli/stripping_specs_windows.md") .assert() .success(); }
rust_cleaned_test_functions.jsonl/104105
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 158 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 18869, 1261, 461, 10732, 71200, 368, 341, 262, 7348, 486, 66715, 21816, 445, 9535, 2923, 1138, 286, 659, 15454, 741, 286, 659, 858, 21549, 2152, 19459, 413, 1138, 286, 659, 858, 445, 6108, 1138, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_t124() { init(); let result = t124(&OS_TYPE, &OS_VERSION, &SIM_INFO, &APN); println!("{}", result.len()); println!("{:?}", result); }
rust_cleaned_test_functions.jsonl/104730
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 101 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 528, 16, 17, 19, 368, 341, 286, 2930, 543, 286, 1077, 1102, 284, 259, 16, 17, 19, 2099, 3126, 4189, 11, 609, 3126, 10678, 11, 609, 46616, 9068, 11, 609, 2537, 45, 317, 286, 13751, 79878, 110...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_atan_2_args() { let test_cases = vec![ ( Some(Real::new(0.0_f64).unwrap()), Some(Real::new(0.0_f64).unwrap()), Some(Real::new(0.0_f64).unwrap()), ), ( Some(Real::new(0.0_f64).unwrap()), Some(Real::new(-1.0_f64).unwrap()), Some(Real::new(std::f64::consts::PI).unwrap()), ), ( Some(Real::new(1.0_f64).unwrap()), Some(Real::new(-1.0_f64).unwrap()), Some(Real::new(3.0_f64 * std::f64::consts::PI / 4.0_f64).unwrap()), ), ( Some(Real::new(-1.0_f64).unwrap()), Some(Real::new(1.0_f64).unwrap()), Some(Real::new(-std::f64::consts::PI / 4.0_f64).unwrap()), ), ( Some(Real::new(1.0_f64).unwrap()), Some(Real::new(0.0_f64).unwrap()), Some(Real::new(std::f64::consts::PI / 2.0_f64).unwrap()), ), ]; for (arg0, arg1, expect) in test_cases { let output: Option<Real> = RpnFnScalarEvaluator::new() .push_param(arg0) .push_param(arg1) .evaluate(ScalarFuncSig::Atan2Args) .unwrap(); assert!((output.unwrap() - expect.unwrap()).abs() < f64::EPSILON); } }
rust_cleaned_test_functions.jsonl/9500
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 920 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 3752, 276, 62, 17, 8384, 368, 341, 286, 1077, 1273, 41427, 284, 7486, 90515, 310, 2399, 394, 4329, 7, 12768, 486, 931, 7, 15, 13, 15, 761, 21, 19, 568, 15454, 14702, 394, 4329, 7, 12768, 486...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_tera_templates() { let rocket = rocket(); let mut map = HashMap::new(); map.insert("title", "_test_"); map.insert("content", "<script />"); let template = Template::show(&rocket, "tera/txt_test", &map); assert_eq!(template, Some(UNESCAPED_EXPECTED.into())); let template = Template::show(&rocket, "tera/html_test", &map); assert_eq!(template, Some(ESCAPED_EXPECTED.into())); }
rust_cleaned_test_functions.jsonl/32041
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 220 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 62, 50037, 49526, 368, 341, 286, 1077, 24306, 284, 24306, 543, 286, 1077, 5206, 2415, 284, 10528, 486, 931, 543, 286, 2415, 7030, 445, 2102, 497, 9000, 1944, 62, 797, 286, 2415, 7030, 445, 1796,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_stack_overflow_fn_calls() -> Result<(), Box<EvalAltResult>> { let engine = Engine::new(); assert_eq!( engine.eval::<INT>( r" fn foo(n) { if n <= 1 { 0 } else { n + foo(n-1) } } foo(6) ", )?, 20 ); let max = engine.max_call_levels(); #[cfg(not(feature = "unchecked"))] assert!(matches!( *engine .eval::<()>(&format!( r" fn foo(n) {{ if n == 0 {{ 0 }} else {{ n + foo(n-1) }} }} foo({}) ", max + 1 )) .expect_err("should error"), EvalAltResult::ErrorStackOverflow(_) )); Ok(()) }
rust_cleaned_test_functions.jsonl/18320
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 446 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 15528, 79073, 15246, 45636, 368, 1464, 5714, 68843, 8261, 23835, 831, 26017, 2077, 2452, 341, 262, 1077, 4712, 284, 8200, 486, 931, 1428, 262, 2060, 10714, 33673, 286, 4712, 31710, 27638, 3221, 1705...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_configure_system() { let mut vmm = create_vmm_object(InstanceState::Uninitialized); assert_eq!( vmm.configure_system().unwrap_err().to_string(), "Cannot start microvm without kernel configuration." ); vmm.default_kernel_config(None); assert_eq!( vmm.configure_system().unwrap_err().to_string(), "Invalid Memory Configuration: MemoryNotInitialized" ); assert!(vmm.init_guest_memory().is_ok()); assert!(vmm.vm.get_memory().is_some()); assert!(vmm.configure_system().is_ok()); }
rust_cleaned_test_functions.jsonl/93124
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 287 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 75887, 17687, 368, 341, 286, 1077, 5206, 348, 3821, 284, 1855, 2273, 3821, 5314, 7, 8846, 486, 1806, 36161, 317, 286, 2060, 10714, 33673, 310, 348, 3821, 21343, 17687, 1005, 15454, 9266, 1005, 983...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_psbt_malformed_tx_input() { let (wallet, _, _) = get_funded_wallet(get_test_wpkh()); let send_to = wallet.get_address(AddressIndex::New).unwrap(); let mut builder = wallet.build_tx(); builder.add_recipient(send_to.script_pubkey(), 10_000); let (mut psbt, _) = builder.finish().unwrap(); psbt.global.unsigned_tx.input.push(TxIn::default()); let options = SignOptions { trust_witness_utxo: true, ..Default::default() }; let _ = wallet.sign(&mut psbt, options).unwrap(); }
rust_cleaned_test_functions.jsonl/94322
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 271 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 26047, 12755, 717, 278, 10155, 17805, 5898, 368, 341, 286, 1077, 320, 35735, 11, 8358, 27439, 284, 633, 761, 36053, 62308, 5433, 4452, 1670, 20819, 71, 1423, 286, 1077, 3624, 2346, 284, 15085, 670...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_sorts_lexically() { let test_cases = [(&b"A$C$G$T$"[..], "simple"), (&b"A$A$T$T$"[..], "duplicates"), (&b"AA$GA$CA$TA$TC$TG$GT$GC$"[..], "two letter"), (&b"AGCCAT$\ CAGCC$"[..], "substring"), (&b"GTAGGCCTAATTATAATCAGCGGACATTTCGTATTGCTCGGGCTGCCAGGATTTTAGCATCAGTAGCCGGGTAATGGAACCTCAAGAGGTCAGCGTCGAA$\ AATCAGCGGACATTTCGTATTGCTCGGGCTGCCAGGATTTTAGCATCAGTAGCCGGGTAATGGAACCTCAAGAGGTCAGCGTCGAATGGCTATTCCAATA$"[..], "complex"), (&b"GTAGGCCTAATTATAATCAGCGGACATTTCGTATTGCTCGGGCTGCCAGGATTTTAGCATCAGTAGCCGGGTAATGGAACCTCAAGAGGTCAGCGTCGAA$\ TTCGACGCTGACCTCTTGAGGTTCCATTACCCGGCTACTGATGCTAAAATCCTGGCAGCCCGAGCAATACGAAATGTCCGCTGATTATAATTAGGCCTAC$\ AATCAGCGGACATTTCGTATTGCTCGGGCTGCCAGGATTTTAGCATCAGTAGCCGGGTAATGGAACCTCAAGAGGTCAGCGTCGAATGGCTATTCCAATA$\ TATTGGAATAGCCATTCGACGCTGACCTCTTGAGGTTCCATTACCCGGCTACTGATGCTAAAATCCTGGCAGCCCGAGCAATACGAAATGTCCGCTGATT$"[..], "complex with revcomps"), ]; for &(text, test_name) in test_cases.iter() { let pos = suffix_array(text); for i in 0..(pos.len() - 2) { // Check that every element in the suffix array is lexically <= the next elem let cur = str_from_pos(&pos, &text, i); let next = str_from_pos(&pos, &text, i + 1); assert!( cur <= next, format!( "Failed:\n{}\n{}\nat positions {} and {} are out of order in \ test: {}", cur, next, pos[i], pos[i + 1], test_name ) ); } } }
rust_cleaned_test_functions.jsonl/71446
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1207 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 18435, 82, 74547, 2673, 368, 341, 286, 1077, 1273, 41427, 284, 1797, 508, 2099, 65, 29133, 3, 34, 3, 38, 3, 51, 3, 36864, 496, 1125, 330, 22944, 4461, 1797, 15899, 65, 29133, 3, 32, 3, 51, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_local_connection() { let mut ctx = MuxerTestContext::new("local_connection"); let peer_port = 1025; let (mut stream, local_port) = ctx.local_connect(peer_port); // Test guest -> host data flow. let data = [1, 2, 3, 4]; ctx.init_data_pkt(local_port, peer_port, &data); ctx.send(); let mut buf = vec![0u8; data.len()]; stream.read_exact(buf.as_mut_slice()).unwrap(); assert_eq!(buf.as_slice(), &data); // Test host -> guest data flow. let data = [5, 6, 7, 8]; stream.write_all(&data).unwrap(); ctx.notify_muxer(); assert!(ctx.muxer.has_pending_rx()); ctx.recv(); assert_eq!(ctx.pkt.op(), uapi::VSOCK_OP_RW); assert_eq!(ctx.pkt.src_port(), local_port); assert_eq!(ctx.pkt.dst_port(), peer_port); assert_eq!(ctx.pkt.buf().unwrap()[..data.len()], data); }
rust_cleaned_test_functions.jsonl/37601
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 471 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 13564, 15866, 368, 341, 286, 1077, 5206, 5635, 284, 386, 2200, 261, 2271, 1972, 486, 931, 445, 2438, 15866, 797, 286, 1077, 14397, 8716, 284, 220, 16, 15, 17, 20, 280, 286, 1077, 320, 6984, 42...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_optflag_missing() { let args = vec!["blah".to_string()]; match Options::new().optflag("t", "test", "testing").parse(&args) { Ok(ref m) => { assert!(!m.opt_present("test")); assert!(!m.opt_present("t")); } _ => panic!(), } }
rust_cleaned_test_functions.jsonl/52363
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 157 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 15032, 9903, 40447, 368, 341, 262, 1077, 2827, 284, 7486, 0, 1183, 70614, 3263, 983, 3904, 33800, 262, 2432, 14566, 486, 931, 1005, 2912, 9903, 445, 83, 497, 330, 1944, 497, 330, 8840, 1827, 640...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_transaction_with_program_ids_passed_to_programs() { let (genesis_config, mint_keypair) = create_genesis_config(500); let mut bank = Bank::new(&genesis_config); #[allow(clippy::unnecessary_wraps)] fn mock_process_instruction( _program_id: &Pubkey, _data: &[u8], _invoke_context: &mut dyn InvokeContext, ) -> result::Result<(), InstructionError> { Ok(()) } let mock_program_id = Pubkey::new(&[2u8; 32]); bank.add_builtin("mock_program", mock_program_id, mock_process_instruction); let from_pubkey = solana_sdk::pubkey::new_rand(); let to_pubkey = solana_sdk::pubkey::new_rand(); let dup_pubkey = from_pubkey; let from_account = AccountSharedData::new(100, 1, &mock_program_id); let to_account = AccountSharedData::new(0, 1, &mock_program_id); bank.store_account(&from_pubkey, &from_account); bank.store_account(&to_pubkey, &to_account); let account_metas = vec![ AccountMeta::new(from_pubkey, false), AccountMeta::new(to_pubkey, false), AccountMeta::new(dup_pubkey, false), AccountMeta::new(mock_program_id, false), ]; let instruction = Instruction::new_with_bincode(mock_program_id, &10, account_metas); let tx = Transaction::new_signed_with_payer( &[instruction], Some(&mint_keypair.pubkey()), &[&mint_keypair], bank.last_blockhash(), ); let result = bank.process_transaction(&tx); assert_eq!(result, Ok(())); }
rust_cleaned_test_functions.jsonl/2629
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 787 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 28884, 6615, 25096, 8077, 87405, 2346, 25096, 82, 368, 341, 286, 1077, 320, 77894, 5332, 11, 28337, 3097, 12670, 8, 284, 1855, 16322, 13774, 5332, 7, 20, 15, 15, 317, 286, 1077, 5206, 6073, 284,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_coersion_of_nulls() { assert_eq!(coerce_data_type(&[DataType::Null]), DataType::Null); assert_eq!( coerce_data_type(&[DataType::Null, DataType::Boolean]), DataType::Utf8 ); let vec: Vec<DataType> = vec![]; assert_eq!(coerce_data_type(vec.as_slice()), DataType::Null); }
rust_cleaned_test_functions.jsonl/45742
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 185 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 11393, 1325, 3575, 15162, 82, 368, 341, 286, 2060, 10714, 10297, 1015, 25641, 1769, 1819, 2099, 58, 22653, 486, 3280, 9719, 33172, 486, 3280, 317, 286, 2060, 10714, 33673, 310, 83025, 1769, 1819, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_last_successful_build_when_all_releases_failed_or_yanked() { wrapper(|env| { let db = env.db(); env.fake_release() .name("foo") .version("0.0.1") .build_result_failed() .create()?; env.fake_release() .name("foo") .version("0.0.2") .build_result_failed() .create()?; env.fake_release() .name("foo") .version("0.0.3") .yanked(true) .create()?; assert_last_successful_build_equals(db, "foo", "0.0.1", None)?; assert_last_successful_build_equals(db, "foo", "0.0.2", None)?; assert_last_successful_build_equals(db, "foo", "0.0.3", None)?; Ok(()) }); }
rust_cleaned_test_functions.jsonl/6494
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 534 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 12195, 92951, 20801, 47636, 5705, 1288, 28299, 35060, 8734, 4178, 40772, 368, 341, 286, 13261, 22428, 3160, 91, 341, 310, 1077, 2927, 284, 6105, 7076, 1428, 310, 6105, 94624, 24577, 741, 394, 659, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
7
#[test] fn test_find_all_refs_nested_module() { check( r#" //- /lib.rs mod foo { mod bar; } fn f$0() {} //- /foo/bar.rs use crate::f; fn g() { f(); } "#, expect![[r#" f Function FileId(0) 22..31 25..26 FileId(1) 11..12 FileId(1) 24..25 "#]], ); }
rust_cleaned_test_functions.jsonl/60659
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 228 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21814, 5705, 60638, 66279, 10750, 368, 341, 286, 1779, 1006, 310, 435, 2, 698, 61463, 608, 2740, 25638, 198, 2593, 15229, 314, 1463, 3619, 26, 555, 8822, 282, 3, 15, 368, 10086, 61463, 608, 7975...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_create() { let xyz = ThinStr::empty(); let abc = ThinStr::new("foo").clone(); assert_eq!(xyz.len(), 0); assert_eq!(xyz, ""); assert!(xyz.is_empty()); assert_eq!(abc.len(), 3); assert_eq!(abc, "foo"); let xyz2 = xyz.clone(); assert_eq!(xyz2.len(), 0); assert_eq!(xyz2, ""); let s = ThinStr::new("abcde"); assert_eq!(s.len(), 5); let t: ThinStr = "foo".into(); assert_ne!(t, s); let q = s.clone(); assert_eq!(s, q); let z3 = ThinStr::new_zeroed(3); assert_eq!(z3, "\0\0\0"); let z3 = ThinStr::new_zeroed(0); assert_eq!(z3, ""); }
rust_cleaned_test_functions.jsonl/59275
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 402 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 8657, 368, 341, 286, 1077, 40511, 284, 69622, 2580, 486, 3194, 543, 286, 1077, 39022, 284, 69622, 2580, 486, 931, 445, 7975, 1827, 19982, 543, 286, 2060, 10714, 10297, 28854, 19406, 1507, 220, 15,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_next() { let storage = create_storage(); // Currently we accept unordered ranges. let ranges: Vec<Range> = vec![ IntervalRange::from(("foo", "foo_2a")).into(), PointRange::from("foo_2b").into(), PointRange::from("foo_3").into(), IntervalRange::from(("a", "c")).into(), ]; let mut scanner = RangesScanner::new(RangesScannerOptions { storage: storage.clone(), ranges, scan_backward_in_range: false, is_key_only: false, is_scanned_range_aware: false, }); assert_eq!( scanner.next().unwrap(), Some((b"foo".to_vec(), b"1".to_vec())) ); assert_eq!( scanner.next().unwrap(), Some((b"foo_2".to_vec(), b"3".to_vec())) ); assert_eq!( scanner.next().unwrap(), Some((b"foo_3".to_vec(), b"5".to_vec())) ); assert_eq!( scanner.next().unwrap(), Some((b"bar".to_vec(), b"2".to_vec())) ); assert_eq!( scanner.next().unwrap(), Some((b"bar_2".to_vec(), b"4".to_vec())) ); assert_eq!(scanner.next().unwrap(), None); // Backward in range let ranges: Vec<Range> = vec![ IntervalRange::from(("foo", "foo_2a")).into(), PointRange::from("foo_2b").into(), PointRange::from("foo_3").into(), IntervalRange::from(("a", "bar_2")).into(), ]; let mut scanner = RangesScanner::new(RangesScannerOptions { storage: storage.clone(), ranges, scan_backward_in_range: true, is_key_only: false, is_scanned_range_aware: false, }); assert_eq!( scanner.next().unwrap(), Some((b"foo_2".to_vec(), b"3".to_vec())) ); assert_eq!( scanner.next().unwrap(), Some((b"foo".to_vec(), b"1".to_vec())) ); assert_eq!( scanner.next().unwrap(), Some((b"foo_3".to_vec(), b"5".to_vec())) ); assert_eq!( scanner.next().unwrap(), Some((b"bar".to_vec(), b"2".to_vec())) ); assert_eq!(scanner.next().unwrap(), None); // Key only let ranges: Vec<Range> = vec![ IntervalRange::from(("bar", "foo_2a")).into(), PointRange::from("foo_3").into(), PointRange::from("bar_3").into(), ]; let mut scanner = RangesScanner::new(RangesScannerOptions { storage, ranges, scan_backward_in_range: false, is_key_only: true, is_scanned_range_aware: false, }); assert_eq!(scanner.next().unwrap(), Some((b"bar".to_vec(), Vec::new()))); assert_eq!( scanner.next().unwrap(), Some((b"bar_2".to_vec(), Vec::new())) ); assert_eq!(scanner.next().unwrap(), Some((b"foo".to_vec(), Vec::new()))); assert_eq!( scanner.next().unwrap(), Some((b"foo_2".to_vec(), Vec::new())) ); assert_eq!( scanner.next().unwrap(), Some((b"foo_3".to_vec(), Vec::new())) ); assert_eq!(scanner.next().unwrap(), None); }
rust_cleaned_test_functions.jsonl/17917
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1850 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 11257, 368, 341, 286, 1077, 5819, 284, 1855, 23310, 1428, 286, 442, 24150, 582, 4193, 55733, 21283, 624, 286, 1077, 21283, 25, 11312, 27, 6046, 29, 284, 7486, 90515, 310, 40584, 6046, 486, 1499, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_old_messages() { setup_for_test(); let mut tt = Network::new(vec![None, None, None]); tt.send(vec![new_message(1, 1, MessageType::MsgHup, 0)]); tt.send(vec![new_message(2, 2, MessageType::MsgHup, 0)]); tt.send(vec![new_message(1, 1, MessageType::MsgHup, 0)]); // pretend we're an old leader trying to make progress; this entry is expected to be ignored. let mut m = new_message(2, 1, MessageType::MsgAppend, 0); m.set_term(2); m.set_entries(RepeatedField::from_vec(vec![empty_entry(2, 3)])); tt.send(vec![m]); // commit a new entry tt.send(vec![new_message(1, 1, MessageType::MsgPropose, 1)]); let ents = vec![ empty_entry(1, 1), empty_entry(2, 2), empty_entry(3, 3), new_entry(3, 4, SOME_DATA), ]; let ilog = new_raft_log(&ents, 5, 4); let base = ltoa(&ilog); for (id, p) in &tt.peers { let l = ltoa(&p.raft_log); if l != base { panic!("#{}: raft_log: {}, want: {}", id, l, base); } } }
rust_cleaned_test_functions.jsonl/107109
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 512 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21108, 23428, 368, 341, 262, 6505, 5478, 4452, 543, 262, 1077, 5206, 17853, 284, 8141, 486, 931, 25592, 20703, 4064, 11, 2240, 11, 2240, 2558, 1066, 262, 17853, 5219, 25592, 20703, 931, 6462, 7, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_unix() { let ready = Arc::new((Mutex::new(false), Condvar::new())); let ready_clone = Arc::clone(&ready); let tmp = tempfile::tempdir().unwrap(); let path = tmp.path().join("soccer"); let send_path = path.to_owned(); let server = thread::Builder::new() .name("server".to_string()) .spawn(move || { server(ready, &send_path); }) .unwrap(); let send_path = path.to_owned(); let client = thread::Builder::new() .name("client".to_string()) .spawn(move || { client( ready_clone, &send_path, &[ (&["1", "2"], 3), (&["4", "77", "103"], 184), (&["5", "78", "104"], 187), (&[], 0), ], ); }) .unwrap(); client.join().unwrap(); server.join().unwrap(); }
rust_cleaned_test_functions.jsonl/15671
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 515 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 80572, 368, 341, 262, 1077, 5527, 284, 19689, 486, 931, 1188, 38099, 486, 931, 3576, 701, 44826, 947, 486, 931, 7392, 262, 1077, 5527, 54742, 284, 19689, 486, 19982, 2099, 2307, 626, 262, 1077, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_store_opcode() { let default_code = vec![0x60, 0x00, 0x60, 0x05, 0x55]; let mut vm = VM::new(default_code).with_simple_memory().with_random_address(); vm.storage = Some(Storage::new(vm.address.unwrap())); assert!(vm.execute_one().is_ok()); assert!(vm.execute_one().is_ok()); }
rust_cleaned_test_functions.jsonl/125712
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 161 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 14809, 71319, 368, 341, 286, 1077, 1638, 4136, 284, 7486, 20703, 15, 87, 21, 15, 11, 220, 15, 87, 15, 15, 11, 220, 15, 87, 21, 15, 11, 220, 15, 87, 15, 20, 11, 220, 15, 87, 20, 20, 935...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_compute_retransmit_peers_with_fanout_five() { const FANOUT: usize = 5; const NUM_NODES: usize = 2048; const SEED: [u8; 32] = [0x55; 32]; let mut rng = ChaChaRng::from_seed(SEED); let mut index: Vec<_> = (0..NUM_NODES).collect(); index.shuffle(&mut rng); let (neighbors, children) = compute_retransmit_peers(FANOUT, 17, &index); assert_eq!(neighbors, vec![1410, 1293, 1810, 552, 512]); assert_eq!(children, vec![511, 1989, 283, 1606, 1154]); }
rust_cleaned_test_functions.jsonl/11680
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 270 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 57028, 1288, 1458, 1763, 36367, 388, 6615, 761, 276, 411, 95258, 368, 341, 286, 733, 434, 1093, 3656, 25, 22301, 284, 220, 20, 280, 286, 733, 15943, 92948, 25, 22301, 284, 220, 17, 15, 19, 23,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_monte_carlo_pi_1() { let pi = monte_carlo_pi(1); assert!(pi == 0_f32 || pi == 4_f32); }
rust_cleaned_test_functions.jsonl/14769
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 76 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 717, 52277, 26616, 385, 47771, 62, 16, 368, 341, 286, 1077, 8938, 284, 20007, 68, 26616, 385, 47771, 7, 16, 317, 286, 2060, 10297, 2493, 621, 220, 15, 761, 18, 17, 1369, 8938, 621, 220, 19, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
2
#[test] fn test_list_dex_ids_should_pass() { let mut ext = ExtBuilder { initial_dex_list: vec![ ( DEX_A_ID, DEXInfo { base_asset_id: XOR, is_public: true, }, ), ( DEX_B_ID, DEXInfo { base_asset_id: XOR, is_public: true, }, ), ], initial_permission_owners: vec![ (MANAGE_DEX, Scope::Limited(hash(&DEX_A_ID)), vec![ALICE]), (MANAGE_DEX, Scope::Limited(hash(&DEX_B_ID)), vec![BOB]), ], initial_permissions: vec![ (ALICE, Scope::Limited(hash(&DEX_A_ID)), vec![MANAGE_DEX]), (ALICE, Scope::Limited(hash(&DEX_B_ID)), vec![MANAGE_DEX]), ], ..Default::default() } .build(); ext.execute_with(|| { assert_eq!(DEXModule::list_dex_ids(), vec![DEX_A_ID, DEX_B_ID]); }) }
rust_cleaned_test_functions.jsonl/110308
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 637 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2019, 814, 327, 8077, 43378, 15464, 368, 341, 262, 1077, 5206, 1303, 284, 9447, 3297, 341, 286, 2856, 814, 327, 2019, 25, 7486, 90515, 310, 2399, 394, 422, 3257, 1566, 3450, 345, 394, 422, 3257,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_adjust_lockouts_after_replay_all_not_found_even_if_rooted() { let mut tower = Tower::new_for_tests(10, 0.9); tower.vote_state.root_slot = Some(4); tower.record_vote(5, Hash::default()); tower.record_vote(6, Hash::default()); let mut slot_history = SlotHistory::default(); slot_history.add(0); slot_history.add(1); slot_history.add(2); slot_history.add(7); let replayed_root_slot = 7; let result = tower.adjust_lockouts_after_replay(replayed_root_slot, &slot_history); assert_eq!( format!("{}", result.unwrap_err()), "The tower is fatally inconsistent with blockstore: no common slot for rooted tower" ); }
rust_cleaned_test_functions.jsonl/61169
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 344 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 44153, 9818, 11672, 19844, 1288, 1363, 5705, 7913, 21480, 68347, 11119, 12993, 291, 368, 341, 286, 1077, 5206, 21271, 284, 21938, 486, 931, 5478, 32509, 7, 16, 15, 11, 220, 15, 13, 24, 317, 286,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_transfer() { let data: Vec<u8> = (0..2 * BUFF_SIZE).map(|_| rand::random::<u8>()).collect(); let _ret = fs::create_dir("tmp"); let mut src = File::create("tmp/src").unwrap(); let mut dst = File::create("tmp/dst").unwrap(); let _ret = src.write_all(&data); let mut src = File::open("tmp/src").unwrap(); while !transfer(&mut src, &mut dst) {} let status = Command::new("cmp") .arg("tmp/src") .arg("tmp/dst") .status() .expect("command"); let _ret = fs::remove_dir_all("tmp"); assert!(status.success()); }
rust_cleaned_test_functions.jsonl/26652
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 322 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 35403, 368, 341, 286, 1077, 821, 25, 11312, 34837, 23, 29, 284, 320, 15, 496, 17, 353, 94924, 4098, 568, 2186, 22428, 35395, 10382, 486, 11463, 27638, 84, 23, 29, 6011, 17384, 1428, 286, 1077, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_shareable_file_close_unblocks_reads_without_error() { // This test exercises a threading condition that cannot be reproduced in a non-racy manner. // correctly fail. Running this same test a few times ensures that we have higher chances // of catching a problem. for _ in 0..10 { try_shareable_file_close_unblocks_reads_without_error() } }
rust_cleaned_test_functions.jsonl/54830
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 167 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 38272, 480, 2458, 12704, 4907, 21928, 66628, 39904, 4096, 368, 341, 286, 442, 1096, 1273, 22932, 264, 30159, 2971, 429, 4157, 387, 54617, 304, 264, 2477, 3795, 2757, 11566, 624, 1789, 286, 442, 12...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_compress_fail() { #[cfg(not(windows))] TestScenario::new(util_name!()) .ucmd_keepenv() .args(&[ "ext_sort.txt", "-n", "--compress-program", "nonexistent-program", "-S", "10", ]) .fails() .stderr_only("sort: couldn't execute compress program: errno 2"); #[cfg(windows)] TestScenario::new(util_name!()) .ucmd_keepenv() .args(&[ "ext_sort.txt", "-n", "--compress-program", "nonexistent-program", "-S", "10", ]) .fails(); }
rust_cleaned_test_functions.jsonl/20535
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 417 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 87845, 22121, 368, 341, 262, 11506, 14072, 24772, 3622, 1491, 22297, 262, 3393, 54031, 486, 931, 67811, 1269, 0, 2398, 286, 659, 1754, 2277, 50293, 3160, 741, 286, 659, 2116, 2099, 9640, 310, 330,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_since_now() { let _executor = fasync::Executor::new().expect("unable to create executor"); let tmp_dir = TempDir::new().expect("should have created tempdir"); let file_path = tmp_dir.path().join("tmp_file"); let tmp_file = File::create(&file_path).expect("should have created file"); let mut expected = "".to_string(); // since_now message filter test let mut filter_options = LocalOptions::default(); // ignored filter_options.since_time = Some(1000000000); let mut l = Listener::new(tmp_file, filter_options, Decorator::new()); let mut msg = LogMessage { pid: 0, tid: 0, severity: 0, time: 0, msg: String::default(), dropped_logs: 0, tags: vec![], }; msg.msg = "foobar".to_string(); l.log(copy_log_message(&msg)); msg.msg = "foobar".to_string(); msg.time = 2000000000; l.log(copy_log_message(&msg)); expected.push_str("[00002.000000][0][0][] INFO: foobar\n"); // Compare the log output with the expectation. let mut tmp_file = File::open(&file_path).expect("should have opened the file"); let mut content = String::new(); tmp_file.read_to_string(&mut content).expect("something went wrong reading the file"); assert_eq!(content, expected); }
rust_cleaned_test_functions.jsonl/113586
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 661 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 56262, 20813, 368, 341, 286, 1077, 716, 80787, 284, 282, 7692, 486, 25255, 486, 931, 1005, 17119, 445, 45928, 311, 1855, 31558, 797, 286, 1077, 4174, 4334, 284, 19944, 6184, 486, 931, 1005, 17119,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_spoofed_stake_accounts() { assert_eq!( process_instruction(&initialize( &spoofed_stake_state_pubkey(), &Authorized::default(), &Lockup::default() )), Err(InstructionError::InvalidAccountOwner), ); assert_eq!( process_instruction(&authorize( &spoofed_stake_state_pubkey(), &Pubkey::default(), &Pubkey::default(), StakeAuthorize::Staker, None, )), Err(InstructionError::InvalidAccountOwner), ); assert_eq!( process_instruction( &split( &spoofed_stake_state_pubkey(), &Pubkey::default(), 100, &Pubkey::default(), )[2] ), Err(InstructionError::InvalidAccountOwner), ); assert_eq!( process_instruction( &split( &Pubkey::default(), &Pubkey::default(), 100, &spoofed_stake_state_pubkey(), )[2] ), Err(InstructionError::IncorrectProgramId), ); assert_eq!( process_instruction( &merge( &spoofed_stake_state_pubkey(), &Pubkey::default(), &Pubkey::default(), )[0] ), Err(InstructionError::InvalidAccountOwner), ); assert_eq!( process_instruction( &merge( &Pubkey::default(), &spoofed_stake_state_pubkey(), &Pubkey::default(), )[0] ), Err(InstructionError::IncorrectProgramId), ); assert_eq!( process_instruction( &split_with_seed( &spoofed_stake_state_pubkey(), &Pubkey::default(), 100, &Pubkey::default(), &Pubkey::default(), "seed" )[1] ), Err(InstructionError::InvalidAccountOwner), ); assert_eq!( process_instruction(&delegate_stake( &spoofed_stake_state_pubkey(), &Pubkey::default(), &Pubkey::default(), )), Err(InstructionError::InvalidAccountOwner), ); assert_eq!( process_instruction(&withdraw( &spoofed_stake_state_pubkey(), &Pubkey::default(), &solana_sdk::pubkey::new_rand(), 100, None, )), Err(InstructionError::InvalidAccountOwner), ); assert_eq!( process_instruction(&deactivate_stake( &spoofed_stake_state_pubkey(), &Pubkey::default() )), Err(InstructionError::InvalidAccountOwner), ); assert_eq!( process_instruction(&set_lockup( &spoofed_stake_state_pubkey(), &LockupArgs::default(), &Pubkey::default() )), Err(InstructionError::InvalidAccountOwner), ); }
rust_cleaned_test_functions.jsonl/40813
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 2122 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 643, 5368, 1055, 291, 1261, 726, 55665, 368, 341, 286, 2060, 10714, 33673, 310, 1882, 54923, 2099, 21641, 1006, 394, 609, 82859, 1055, 291, 1261, 726, 4387, 34014, 792, 3148, 394, 609, 60454, 486,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_values() { let vec = vec![(1i, 'a'), (2i, 'b'), (3i, 'c')]; let map = vec.move_iter().collect::<TreeMap<int, char>>(); let values = map.values().map(|&v| v).collect::<Vec<char>>(); assert_eq!(values.len(), 3); assert!(values.contains(&'a')); assert!(values.contains(&'b')); assert!(values.contains(&'c')); }
rust_cleaned_test_functions.jsonl/66369
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 197 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 9146, 368, 341, 286, 1077, 7486, 284, 7486, 0, 9697, 16, 72, 11, 364, 64, 4567, 320, 17, 72, 11, 364, 65, 4567, 320, 18, 72, 11, 364, 66, 863, 935, 286, 1077, 2415, 284, 7486, 13635, 11723...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_clone_is_clone() { numid!(@CloneIsClone struct Test); let t = Test::new(); assert_eq!(t, t.clone()); let tt = Test::create_lower(0); assert_eq!(tt, tt.clone()); }
rust_cleaned_test_functions.jsonl/10271
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 121 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 54742, 6892, 54742, 368, 341, 286, 1629, 307, 0, 5957, 37677, 3872, 37677, 2036, 3393, 317, 286, 1077, 259, 284, 3393, 486, 931, 543, 286, 2060, 10714, 10297, 83, 11, 259, 15997, 1423, 286, 1077...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_from() { let array = BinaryArray::<i32>::from(&[Some(b"hello".as_ref()), Some(b" ".as_ref()), None]); let a = array.validity().as_ref().unwrap(); assert_eq!(a.len(), 3); assert_eq!(a.as_slice()[0], 0b00000011); }
rust_cleaned_test_functions.jsonl/42985
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 136 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 5673, 368, 341, 286, 1077, 1334, 284, 17718, 1857, 27638, 72, 18, 17, 6831, 1499, 2099, 58, 8373, 1883, 1, 14990, 3263, 300, 7793, 11858, 4329, 1883, 1, 5933, 300, 7793, 11858, 2240, 10149, 286,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_negated_variable() { assert_expression!( "-N", Expression::UnaryExpression(UnaryOperator::Minus, Box::new("N".as_var_expr(1, 8))) ); }
rust_cleaned_test_functions.jsonl/102633
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 105 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 28209, 657, 14635, 368, 341, 286, 2060, 28068, 33673, 310, 6523, 45, 756, 310, 16378, 486, 94545, 9595, 49289, 658, 18461, 486, 74458, 11, 8261, 486, 931, 445, 45, 3263, 300, 4612, 21915, 7, 16,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_four_of_a_kind_ranks() { test( &vec!["2S 2H 2C 8D 2D", "4S 5H 5S 5D 5C"], &vec!["4S 5H 5S 5D 5C"], ) }
rust_cleaned_test_functions.jsonl/121282
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 102 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 56142, 3575, 4306, 33162, 1710, 4039, 368, 341, 1066, 262, 1273, 1006, 286, 609, 4083, 0, 1183, 17, 50, 220, 17, 39, 220, 17, 34, 220, 23, 35, 220, 17, 35, 497, 330, 19, 50, 220, 20, 39, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_ipv4_reassembly_not_needed() { let mut ctx = DummyContext::default(); // Test that we don't attempt reassembly if the packet is not // fragmented. let builder = get_ipv4_builder(); let body = [1, 2, 3, 4, 5]; let mut buffer = Buf::new(body.to_vec(), ..).encapsulate(builder).serialize_vec_outer().unwrap(); let packet = buffer.parse::<Ipv4Packet<_>>().unwrap(); matches::assert_matches!( process_fragment::<Ipv4, _, &[u8]>(&mut ctx, packet), FragmentProcessingState::NotNeeded(unfragmented) if unfragmented.body() == body ); }
rust_cleaned_test_functions.jsonl/22025
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 306 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 49378, 19, 1288, 14993, 7913, 57426, 368, 341, 286, 1077, 5206, 5635, 284, 50567, 1972, 486, 2258, 1428, 286, 442, 3393, 429, 582, 1513, 944, 4774, 312, 14993, 421, 279, 10151, 374, 537, 198, 28...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_stddev() { let data = [0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10]; assert_eq!(mean(&data), 5.0); assert_eq!(variance(&data), 11.0); assert_eq!(stddev(&data), 11.0_f32.sqrt()); }
rust_cleaned_test_functions.jsonl/81027
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 111 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 15656, 3583, 368, 341, 262, 1077, 821, 284, 508, 15, 11, 220, 16, 11, 220, 17, 11, 220, 18, 11, 220, 19, 11, 220, 20, 11, 220, 21, 11, 220, 22, 11, 220, 23, 11, 220, 24, 11, 220, 16, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_symbols_are_separators() { check_word_count( "hey,my_spacebar_is_broken.", vec![("hey", 1), ("my", 1), ("spacebar", 1), ("is", 1), ("broken", 1)]); }
rust_cleaned_test_functions.jsonl/109974
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 146 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 55752, 56855, 3453, 1732, 2973, 368, 341, 262, 1779, 13533, 3180, 1006, 286, 330, 35561, 11, 2408, 14663, 2257, 6892, 880, 81709, 10346, 286, 7486, 20703, 445, 35561, 497, 220, 16, 1326, 1797, 348...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_serialize_transactions() { let entry = Entry::new(&Hash::default(), 1, vec![]); let empty_vec: Vec<Vec<u8>> = vec![]; assert_eq!(serialize_transactions(&entry), empty_vec); let keypair0 = Keypair::new(); let keypair1 = Keypair::new(); let tx0 = system_transaction::transfer(&keypair0, &keypair1.pubkey(), 1, Hash::default(), 0); let tx1 = system_transaction::transfer(&keypair1, &keypair0.pubkey(), 2, Hash::default(), 0); let serialized_tx0 = serialize(&tx0).unwrap(); let serialized_tx1 = serialize(&tx1).unwrap(); let entry = Entry::new(&Hash::default(), 1, vec![tx0, tx1]); assert_eq!( serialize_transactions(&entry), vec![serialized_tx0, serialized_tx1] ); }
rust_cleaned_test_functions.jsonl/100169
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 387 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 88686, 68182, 368, 341, 286, 1077, 4343, 284, 15788, 486, 931, 2099, 6370, 486, 2258, 1507, 220, 16, 11, 7486, 0, 56703, 286, 1077, 4287, 13251, 25, 11312, 50439, 34837, 23, 2452, 284, 7486, 0, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_sphere_len() { let mut sphere = SphereUv::new(5, 5); assert_eq!(25, sphere.len()); sphere.next(); assert_eq!(24, sphere.len()); assert_eq!(24, sphere.count()); }
rust_cleaned_test_functions.jsonl/86772
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 93 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 86973, 6043, 368, 341, 262, 1077, 5206, 25366, 284, 54499, 52, 85, 486, 931, 7, 20, 11, 220, 20, 317, 262, 2060, 10714, 10297, 17, 20, 11, 25366, 19406, 1423, 262, 25366, 4529, 543, 262, 2060,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_query_balance() { let msg = InstantiateMsg { owner: h(OWNER), nebula_token: h(NEB_TOKEN), }; let info = mock_info(OWNER, &[]); let mut deps = mock_dependencies(&[]); let _res = instantiate(deps.as_mut(), mock_env(), info, msg) .expect("contract successfully executes InstantiateMsg"); let amount = Uint128::new(1000u128); deps.querier .with_token_balances(&[(&h(NEB_TOKEN), &[(&MOCK_CONTRACT_ADDR.to_string(), &amount)])]); let msg = QueryMsg::Balance {}; let res = query(deps.as_ref(), mock_env(), msg).unwrap(); let balance: Uint128 = from_binary(&res).unwrap(); assert_eq!(balance, amount); }
rust_cleaned_test_functions.jsonl/76313
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 296 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 5738, 29396, 368, 341, 262, 1077, 3750, 284, 32288, 6611, 341, 286, 6372, 25, 305, 7, 99031, 1326, 286, 80867, 5607, 6458, 25, 305, 7, 3944, 33, 18681, 1326, 262, 3634, 262, 1077, 3546, 284, 7...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_txn_encode_decode() { let tx_bytes = Vec::from_hex("0100000001a15d57094aa7a21a28cb20b59aab8fc7d1149a3bdbcddba9c622e4f5f6a99ece010000006c493046022100f93bb0e7d8db7bd46e40132d1f8242026e045f03a0efe71bbb8e3f475e970d790221009337cd7f1f929f00cc6ff01f03729b069a7c21b59b1736ddfee5db5946c5da8c0121033b9b137ee87d5a812d6f506efdd37f0affa7ffc310711c06c7f3e097c9447c52ffffffff0100e1f505000000001976a9140389035a9225b3839e2bbf32d826a1e222031fd888ac00000000").unwrap(); let tx: Transaction = deserialize(&tx_bytes).unwrap(); serde_round_trip!(tx); }
rust_cleaned_test_functions.jsonl/332
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 319 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 92299, 11224, 15227, 368, 341, 286, 1077, 9854, 12524, 284, 11312, 486, 1499, 32655, 445, 15, 16, 15, 15, 15, 15, 15, 15, 15, 16, 64, 16, 20, 67, 20, 22, 15, 24, 19, 5305, 22, 64, 17, 16...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_try_from_cigar_for_sam_record_cigar() -> io::Result<()> { use sam::record::cigar::{op, Op}; let bytes = [0x40, 0x02, 0x00, 0x00, 0x62, 0x03, 0x00, 0x00]; let cigar = Cigar::new(&bytes); let actual = sam::record::Cigar::try_from(cigar)?; let expected = sam::record::Cigar::from(vec![ Op::new(op::Kind::Match, 36), Op::new(op::Kind::Deletion, 54), ]); assert_eq!(actual, expected); Ok(()) }
rust_cleaned_test_functions.jsonl/29764
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 265 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 53283, 5673, 666, 51284, 5478, 643, 309, 14192, 666, 51284, 368, 1464, 6399, 486, 2077, 71698, 341, 286, 990, 9962, 486, 8548, 486, 66, 51284, 22964, 453, 11, 10672, 2315, 286, 1077, 5820, 284, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_recent_blockhashes_sysvar() { let (genesis_config, _mint_keypair) = create_genesis_config(500); let mut bank = Arc::new(Bank::new(&genesis_config)); for i in 1..5 { let bhq_account = bank.get_account(&sysvar::recent_blockhashes::id()).unwrap(); let recent_blockhashes = sysvar::recent_blockhashes::RecentBlockhashes::from_account(&bhq_account).unwrap(); // Check length assert_eq!(recent_blockhashes.len(), i); let most_recent_hash = recent_blockhashes.iter().nth(0).unwrap(); // Check order assert_eq!(Some(true), bank.check_hash_age(most_recent_hash, 0)); goto_end_of_slot(Arc::get_mut(&mut bank).unwrap()); bank = Arc::new(new_from_parent(&bank)); } }
rust_cleaned_test_functions.jsonl/42429
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 397 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 62361, 7113, 8296, 288, 20344, 947, 368, 341, 286, 1077, 320, 77894, 5332, 11, 716, 67791, 3097, 12670, 8, 284, 1855, 16322, 13774, 5332, 7, 20, 15, 15, 317, 286, 1077, 5206, 6073, 284, 19689, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_fn() { let mut stack = DynStack::<dyn Fn() -> usize>::new(); for i in 0..100 { dyn_push!(stack, move || i); } let mut item2 = 0; for func in stack.iter() { item2 += func(); } assert_eq!(item2, 4950); }
rust_cleaned_test_functions.jsonl/21297
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 133 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 15246, 368, 341, 262, 1077, 5206, 5611, 284, 43938, 4336, 27638, 43085, 50182, 368, 1464, 22301, 6831, 931, 543, 262, 369, 600, 304, 220, 15, 496, 16, 15, 15, 341, 286, 31070, 14218, 10297, 7693...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
4
#[test] fn test_incorrect_transfer_account_from() { const TOKEN_ID: u16 = 0; const INITIAL_BALANCE: u64 = 10; const TOKEN_AMOUNT: u64 = 7; const FEE_AMOUNT: u64 = 3; const ERR_MSG: &str = "op_valid is true/enforce equal to one"; let incorrect_from_account = WitnessTestAccount::new(3, INITIAL_BALANCE); // Input data: transaction is signed by an incorrect account (address of account let accounts = vec![ WitnessTestAccount::new(1, INITIAL_BALANCE), WitnessTestAccount::new_empty(2), ]; let (account_from, account_to) = (&accounts[0], &accounts[1]); let transfer_op = TransferOp { tx: incorrect_from_account .zksync_account .sign_transfer( TOKEN_ID, "", BigUint::from(TOKEN_AMOUNT), BigUint::from(FEE_AMOUNT), &account_to.account.address, None, true, ) .0, from: account_from.id, to: account_to.id, }; let input = SigDataInput::from_transfer_op(&transfer_op).expect("SigDataInput creation failed"); incorrect_op_test_scenario::<TransferWitness<Bn256>, _>( &accounts, transfer_op, input, ERR_MSG, || { vec![CollectedFee { token: TOKEN_ID, amount: FEE_AMOUNT.into(), }] }, ); }
rust_cleaned_test_functions.jsonl/56188
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 750 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 1243, 19928, 35403, 13500, 5673, 368, 341, 262, 733, 43574, 3450, 25, 575, 16, 21, 284, 220, 15, 280, 262, 733, 56854, 79952, 8440, 25, 575, 21, 19, 284, 220, 16, 15, 280, 262, 733, 43574, 5...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_write_and_load() { let mut regfile = Registers::new(); regfile.write(2, 3); let mut r3 = regfile.load(3); assert_eq!(r3, 2); regfile.write(1, 3); r3 = regfile.load(3); assert_ne!(r3, 2); }
rust_cleaned_test_functions.jsonl/112388
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 152 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 9165, 8378, 12411, 368, 341, 286, 1077, 5206, 1217, 1192, 284, 54774, 486, 931, 543, 286, 1217, 1192, 3836, 7, 17, 11, 220, 18, 317, 286, 1077, 5206, 435, 18, 284, 1217, 1192, 5104, 7, 18, 3...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_parse_mask() { assert_eq!( Some("XXXXXXXXXXXXXXXXXXXXXXXXXXXXX1XXXX0X"), parse_mask("mask = XXXXXXXXXXXXXXXXXXXXXXXXXXXXX1XXXX0X") ); assert_eq!(None, parse_mask("mem[8] = 11")); }
rust_cleaned_test_functions.jsonl/90588
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 131 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21039, 9999, 368, 341, 286, 2060, 10714, 33673, 310, 4329, 445, 61516, 61516, 61516, 23830, 55, 16, 23830, 15, 55, 4461, 310, 4715, 9999, 445, 11258, 284, 19975, 61516, 61516, 61516, 6148, 16, 238...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_json() { let val = json!({"arr": [ "one", 2, true, null ]}); let t = JsonTemplate { foo: "a", bar: &val, }; // Note: the json filter lacks a way to specify initial indentation assert_eq!( t.render().unwrap(), r#"{ "foo": "a", "bar": { "arr": [ "one", 2, true, null ] } }"# ); }
rust_cleaned_test_functions.jsonl/8699
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 196 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 9455, 368, 341, 262, 1077, 1044, 284, 2951, 0, 16864, 1118, 788, 508, 330, 603, 497, 220, 17, 11, 830, 11, 845, 2279, 2960, 262, 1077, 259, 284, 8308, 7275, 341, 286, 15229, 25, 330, 64, 756...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_which_absolute_extension() { let f = TestFixture::new(); // Don't append EXE_EXTENSION here. let b = f.bins[3].parent().unwrap().join(&BIN_NAME); assert_eq!(_which(&f, &b).unwrap(), f.bins[3].canonicalize().unwrap()); }
rust_cleaned_test_functions.jsonl/13405
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 112 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 62, 8206, 50874, 31035, 368, 341, 262, 1077, 282, 284, 3393, 18930, 486, 931, 543, 262, 442, 4320, 944, 8737, 4063, 36, 37012, 1588, 624, 262, 1077, 293, 284, 282, 948, 1330, 58, 18, 936, 3765...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_fold_arithmetic3() { fold("x = null * undefined", "x = NaN"); fold("x = null * 1", "x = 0"); fold("x = (null - 1) * 2", "x = -2"); fold("x = (null + 1) * 2", "x = 2"); fold("x = null ** 0", "x = 1"); }
rust_cleaned_test_functions.jsonl/122184
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 118 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 61187, 25842, 25922, 18, 368, 341, 262, 11555, 445, 87, 284, 845, 353, 5614, 497, 330, 87, 284, 32178, 797, 262, 11555, 445, 87, 284, 845, 353, 220, 16, 497, 330, 87, 284, 220, 15, 797, 262,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_to_pretty_oct() { assert_eq!(to_pretty_oct(0o0), "0o0"); assert_eq!(to_pretty_oct(0o12), "0o12"); assert_eq!(to_pretty_oct(0o123), "0o123"); assert_eq!(to_pretty_oct(0o1234), "0o1_234"); assert_eq!(to_pretty_oct(0o12345), "0o12_345"); assert_eq!(to_pretty_oct(0o123456), "0o123_456"); assert_eq!(to_pretty_oct(0o1234567), "0o1_234_567"); assert_eq!(to_pretty_oct(0o12345670), "0o12_345_670"); assert_eq!(to_pretty_oct(0o123456701), "0o123_456_701"); }
rust_cleaned_test_functions.jsonl/17923
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 343 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2346, 620, 21322, 70135, 368, 341, 286, 2060, 10714, 10297, 983, 620, 21322, 70135, 7, 15, 78, 15, 701, 260, 330, 15, 78, 15, 797, 286, 2060, 10714, 10297, 983, 620, 21322, 70135, 7, 15, 78, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_results_page() { /* * It would be a neat paginated fibonacci API if the page selector was * just the last two numbers! Dropshot doesn't support that and it's * not clear that's a practical use case anyway. */ let items = vec![1, 1, 2, 3, 5, 8, 13]; let dummy_scan_params = 21; #[derive(Debug, Deserialize, Serialize)] struct FibPageSelector { prev: usize, } let get_page = |item: &usize, scan_params: &usize| FibPageSelector { prev: *item + *scan_params, }; let results = ResultsPage::new(items.clone(), &dummy_scan_params, get_page) .unwrap(); assert_eq!(results.items, items); assert!(results.next_page.is_some()); let token = results.next_page.unwrap(); let deserialized: FibPageSelector = deserialize_page_token(&token).unwrap(); assert_eq!(deserialized.prev, 34); let results = ResultsPage::new(Vec::new(), &dummy_scan_params, get_page).unwrap(); assert_eq!(results.items.len(), 0); assert!(results.next_page.is_none()); }
rust_cleaned_test_functions.jsonl/16569
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 564 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 13576, 6129, 368, 341, 286, 9049, 260, 353, 1084, 1035, 387, 264, 28485, 14774, 15479, 75698, 5333, 421, 279, 2150, 9367, 572, 198, 260, 353, 1101, 279, 1537, 1378, 5109, 0, 220, 15733, 6340, 31...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_txn_store_lock_primary() { let store = AssertionStorage::default(); // txn1 locks "p" then aborts. store.prewrite_ok( vec![Mutation::Put((Key::from_raw(b"p"), b"p1".to_vec()))], b"p", 1, ); store.prewrite_locked( vec![ Mutation::Put((Key::from_raw(b"p"), b"p2".to_vec())), Mutation::Put((Key::from_raw(b"s"), b"s2".to_vec())), ], b"p", 2, vec![(b"p", b"p", 1.into())], ); // txn2 cleanups txn1's lock. store.rollback_ok(vec![b"p"], 1); store.resolve_lock_ok(1, None::<TimeStamp>); store.prewrite_ok( vec![ Mutation::Put((Key::from_raw(b"p"), b"p3".to_vec())), Mutation::Put((Key::from_raw(b"s"), b"s3".to_vec())), ], b"p", 3, ); }
rust_cleaned_test_functions.jsonl/63411
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 492 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 92299, 14809, 9818, 45314, 368, 341, 262, 1077, 3553, 284, 46730, 5793, 486, 2258, 543, 262, 442, 49721, 16, 31676, 330, 79, 1, 1221, 11326, 82, 624, 262, 3553, 556, 52473, 19817, 1006, 286, 748...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_no_connected_storage() { let mut world = World::default(); world.insert_resource(TestAmount { amount: 2.0 }); let mut stage = SystemStage::parallel(); stage.add_system(distribute_to_storage_test_system.system()); world.spawn().insert(StorageConsolidator::default()); stage.run(&mut world); // should not panic }
rust_cleaned_test_functions.jsonl/112996
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 127 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6536, 43276, 23310, 368, 341, 262, 1077, 5206, 1879, 284, 4337, 486, 2258, 543, 262, 1879, 7030, 17962, 31159, 10093, 314, 3311, 25, 220, 17, 13, 15, 3011, 262, 1077, 5206, 6430, 284, 739, 19398...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_shld() { let mut state = State8080::empty_state(); state.memory = vec![0x22, 0x03, 0x00, 0x00, 0x00]; state.h = 0xae; state.l = 0x29; emulate_8080_op(&mut state); assert_eq!(state.read_memory(0x03), 0x29); assert_eq!(state.read_memory(0x04), 0xae); assert_eq!(state.program_counter(), 3); }
rust_cleaned_test_functions.jsonl/7799
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 203 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 3712, 507, 368, 341, 286, 1077, 5206, 1584, 284, 3234, 23, 15, 23, 15, 486, 3194, 4387, 543, 286, 1584, 36611, 284, 7486, 20703, 15, 87, 17, 17, 11, 220, 15, 87, 15, 18, 11, 220, 15, 87, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_fuzz() { assert_eq!( parse("\x2D\x38\x31\x39\x34\x38\x34"), Err(ParseError::ImpossibleTimestamp("Invalid month")) ); // Garbage in the third delimited field assert_eq!( parse("2..\x00\x000d\x00+\x010d\x01\x00\x00\x00+"), Err(ParseError::UnrecognizedFormat) ); let default = NaiveDate::from_ymd(2016, 6, 29).and_hms(0, 0, 0); let p = Parser::default(); let res = p.parse( "\x0D\x31", None, None, false, false, Some(&default), false, &HashMap::new(), ); assert_eq!(res, Err(ParseError::NoDate)); assert_eq!( parse("\x2D\x2D\x32\x31\x38\x6D"), Err(ParseError::ImpossibleTimestamp("Invalid minute")) ); }
rust_cleaned_test_functions.jsonl/4776
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 417 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 761, 8889, 368, 341, 262, 2060, 10714, 33673, 286, 4715, 4921, 87, 17, 35, 3462, 18, 23, 3462, 18, 16, 3462, 18, 24, 3462, 18, 19, 3462, 18, 23, 3462, 18, 19, 4461, 286, 15495, 71812, 1454, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_truncated_frame() { #[rustfmt::skip] let bad_frame: Vec<u8> = vec![ // WPA version 0x01, 0x00, 0x00, 0x50 ]; let wpa_frame = from_bytes(&bad_frame[..]); assert!(!wpa_frame.is_ok()); }
rust_cleaned_test_functions.jsonl/54819
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 186 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 3547, 38007, 8929, 368, 341, 286, 11506, 35788, 12501, 486, 20599, 921, 286, 1077, 3873, 8929, 25, 11312, 34837, 23, 29, 284, 7486, 90515, 310, 442, 467, 8041, 2319, 198, 310, 220, 15, 87, 15, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_write_pin() { let counter = Counter { total: 20 }; pin_mut!(counter); // works with future that requires unpin counter.as_mut().update_total(30); assert_eq!(counter.get_total(), 30); }
rust_cleaned_test_functions.jsonl/59839
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 105 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 9165, 26296, 368, 341, 286, 1077, 5546, 284, 19735, 314, 2790, 25, 220, 17, 15, 2605, 286, 8983, 29523, 10297, 8292, 1215, 442, 4278, 448, 3853, 429, 7460, 650, 13273, 198, 286, 5546, 5357, 2952...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_count() { for opt in vec!["-q", "--count"] { new_ucmd!() .arg(opt) .succeeds() .stdout_is(expected_result(&[opt])); } }
rust_cleaned_test_functions.jsonl/79388
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 117 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 3180, 368, 341, 262, 369, 3387, 304, 7486, 0, 1183, 12, 80, 497, 14482, 1830, 1341, 341, 286, 501, 68887, 2277, 0, 741, 310, 659, 858, 24539, 340, 310, 659, 82, 29264, 82, 741, 310, 659, 363...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
2
#[test] fn test_transaction_wrong_key() { let program_id = Pubkey::default(); let keypair0 = Keypair::new(); let wrong_id = Pubkey::default(); let ix = Instruction::new_with_bincode(program_id, &0, vec![AccountMeta::new(wrong_id, true)]); let message = Message::new(&[ix], Some(&wrong_id)); Transaction::new_unsigned(message).sign(&[&keypair0], Hash::default()); }
rust_cleaned_test_functions.jsonl/11241
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 189 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 28884, 75198, 3097, 368, 341, 286, 1077, 2025, 842, 284, 22611, 792, 486, 2258, 543, 286, 1077, 1376, 12670, 15, 284, 6569, 1082, 1310, 486, 931, 543, 286, 1077, 4969, 842, 284, 22611, 792, 486,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_kvm_getters() { let kvm = Kvm::new().unwrap(); // vCPU related getters let nr_vcpus = kvm.get_nr_vcpus(); assert!(nr_vcpus >= 4); assert!(kvm.get_max_vcpus() >= nr_vcpus); // Memory related getters assert!(kvm.get_vcpu_mmap_size().unwrap() > 0); assert!(kvm.get_nr_memslots() >= 32); }
rust_cleaned_test_functions.jsonl/127386
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 205 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 4698, 7338, 3062, 5045, 368, 341, 286, 1077, 94748, 284, 730, 7338, 486, 931, 1005, 15454, 1428, 286, 442, 348, 31615, 5435, 52894, 198, 286, 1077, 20262, 2273, 4672, 355, 284, 94748, 670, 36513, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_mvcc_txn_commit_ok() { test_mvcc_txn_commit_ok_imp(b"x", b"v", b"y", b"z"); let long_value = "v".repeat(SHORT_VALUE_MAX_LEN + 1).into_bytes(); test_mvcc_txn_commit_ok_imp(b"x", &long_value, b"y", b"z"); }
rust_cleaned_test_functions.jsonl/61085
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 144 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 73187, 638, 92299, 36346, 19817, 368, 341, 286, 1273, 73187, 638, 92299, 36346, 19817, 36788, 1883, 65438, 497, 293, 1, 85, 497, 293, 1, 88, 497, 293, 1, 89, 3071, 286, 1077, 1293, 3142, 284, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_prev_index() { let sql = "SELECT version"; all_dialects().run_parser_method(sql, |parser| { assert_eq!(parser.peek_token(), Some(Token::make_keyword("SELECT"))); assert_eq!(parser.next_token(), Some(Token::make_keyword("SELECT"))); parser.prev_token(); assert_eq!(parser.next_token(), Some(Token::make_keyword("SELECT"))); assert_eq!(parser.next_token(), Some(Token::make_word("version", None))); parser.prev_token(); assert_eq!(parser.peek_token(), Some(Token::make_word("version", None))); assert_eq!(parser.next_token(), Some(Token::make_word("version", None))); assert_eq!(parser.peek_token(), None); parser.prev_token(); assert_eq!(parser.next_token(), Some(Token::make_word("version", None))); assert_eq!(parser.next_token(), None); assert_eq!(parser.next_token(), None); parser.prev_token(); }); }
rust_cleaned_test_functions.jsonl/92121
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 473 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 25566, 3560, 368, 341, 286, 1077, 5704, 284, 330, 4858, 2319, 876, 286, 678, 814, 55056, 82, 1005, 6108, 18517, 9032, 13148, 11, 760, 9657, 91, 341, 310, 2060, 10714, 10297, 9657, 41249, 6458, 1...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_remove_account_before_initialization() { let location = TempLocation::new(); request_stream_test( location.to_persistent_lifetime(), create_clean_pre_auth_manager(), None, Arc::new(Inspector::new()), |proxy| async move { assert_eq!( proxy.remove_account(FORCE_REMOVE_ON).await?, Err(ApiError::FailedPrecondition) ); Ok(()) }, ); }
rust_cleaned_test_functions.jsonl/105849
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 306 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 18193, 13500, 23708, 15809, 2022, 368, 341, 286, 1077, 3728, 284, 19944, 4707, 486, 931, 543, 286, 1681, 12673, 4452, 1006, 310, 3728, 2389, 620, 13931, 98827, 3148, 310, 1855, 19573, 10442, 14014, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_memcmp_try_decode_first_error() { let cases = vec![ vec![1, 2, 3, 4], vec![0, 0, 0, 0, 0, 0, 0, 247], vec![0, 0, 0, 0, 0, 0, 0, 0, 246], vec![0, 0, 0, 0, 0, 0, 0, 1, 247], vec![1, 2, 3, 4, 5, 6, 7, 8, 0], vec![1, 2, 3, 4, 5, 6, 7, 8, 255, 1], vec![1, 2, 3, 4, 5, 6, 7, 8, 255, 1, 2, 3, 4, 5, 6, 7, 8], vec![1, 2, 3, 4, 5, 6, 7, 8, 255, 1, 2, 3, 4, 5, 6, 7, 8, 255], vec![1, 2, 3, 4, 5, 6, 7, 8, 255, 1, 2, 3, 4, 5, 6, 7, 8, 0], vec![1, 2, 3, 4, 5, 6, 7, 8, 255, 1, 0, 0, 0, 0, 0, 0, 0, 247], ]; for invalid_src in cases { let mut dest = vec![0; invalid_src.len()]; let result = MemComparableByteCodec::try_decode_first( invalid_src.as_slice(), dest.as_mut_slice(), ); assert!(result.is_err()); } }
rust_cleaned_test_functions.jsonl/26698
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 608 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 12976, 7293, 53283, 15227, 12978, 4096, 368, 341, 286, 1077, 5048, 284, 7486, 90515, 310, 7486, 20703, 16, 11, 220, 17, 11, 220, 18, 11, 220, 19, 1259, 310, 7486, 20703, 15, 11, 220, 15, 11, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_builders() { let my_struct = MyTestStruct::new(String::from("Reid"), 25).with_weight(100); assert_eq!(my_struct.weight(), &Some(100)); assert_eq!(my_struct.married(), &None); }
rust_cleaned_test_functions.jsonl/117669
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 87 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 20801, 388, 368, 341, 262, 1077, 847, 15126, 284, 3017, 2271, 9422, 486, 931, 2242, 486, 1499, 445, 693, 307, 3975, 220, 17, 20, 568, 4197, 15876, 7, 16, 15, 15, 317, 262, 2060, 10714, 10297, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_insert_query_with_escaped_single_quote_in_the_begining() { let mut lexer = Lexer::new("insert into tab1 values ('''abs');"); assert_eq!(lexer.next_lexem(), Some(Token::Word("insert".to_string()))); assert_eq!(lexer.next_lexem(), Some(Token::Word("into".to_string()))); assert_eq!(lexer.next_lexem(), Some(Token::Word("tab1".to_string()))); assert_eq!(lexer.next_lexem(), Some(Token::Word("values".to_string()))); assert_eq!(lexer.next_lexem(), Some(Token::LeftParenthesis)); assert_eq!(lexer.next_lexem(), Some(Token::SingleQuote)); assert_eq!(lexer.next_lexem(), Some(Token::Word("'abs".to_string()))); assert_eq!(lexer.next_lexem(), Some(Token::SingleQuote)); assert_eq!(lexer.next_lexem(), Some(Token::RightParenthesis)); assert_eq!(lexer.next_lexem(), Some(Token::SemiColon)); }
rust_cleaned_test_functions.jsonl/98883
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 348 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 17678, 5738, 6615, 62, 65826, 19487, 45236, 1243, 16068, 23338, 287, 368, 341, 262, 1077, 5206, 53259, 284, 85082, 486, 931, 445, 4208, 1119, 5651, 16, 2750, 4319, 4605, 3435, 4667, 3071, 262, 206...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_test_strndup() { assert_emscripten_output!( "../../emtests/test_strndup.wasm", "test_strndup", vec![], "../../emtests/test_strndup.out" ); }
rust_cleaned_test_functions.jsonl/66877
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 113 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 4452, 2895, 303, 454, 368, 341, 262, 2060, 22504, 2282, 268, 7645, 33673, 286, 10208, 336, 23841, 12697, 2895, 303, 454, 1418, 10530, 756, 286, 330, 1944, 2895, 303, 454, 756, 286, 7486, 20703, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_transfer_multisession_signing() { paychains_logger::setup(); let mint_keypair = Keypair::new(); let mint_pubkey = mint_keypair.pubkey(); let faucet_addr = run_local_faucet(mint_keypair, None); let test_validator = TestValidator::with_custom_fees( mint_pubkey, 1, Some(faucet_addr), SocketAddrSpace::Unspecified, ); let to_pubkey = Pubkey::new(&[1u8; 32]); let offline_from_signer = keypair_from_seed(&[2u8; 32]).unwrap(); let offline_fee_payer_signer = keypair_from_seed(&[3u8; 32]).unwrap(); let from_null_signer = NullSigner::new(&offline_from_signer.pubkey()); // Setup accounts let rpc_client = RpcClient::new_with_commitment(test_validator.rpc_url(), CommitmentConfig::processed()); request_and_confirm_airdrop( &rpc_client, &CliConfig::recent_for_tests(), &offline_from_signer.pubkey(), pay_to_lamports(43.0), ) .unwrap(); request_and_confirm_airdrop( &rpc_client, &CliConfig::recent_for_tests(), &offline_fee_payer_signer.pubkey(), pay_to_lamports(1.0) + 3, ) .unwrap(); check_recent_balance( pay_to_lamports(43.0), &rpc_client, &offline_from_signer.pubkey(), ); check_recent_balance( pay_to_lamports(1.0) + 3, &rpc_client, &offline_fee_payer_signer.pubkey(), ); check_recent_balance(0, &rpc_client, &to_pubkey); check_ready(&rpc_client); let blockhash = rpc_client.get_latest_blockhash().unwrap(); // Offline fee-payer signs first let mut fee_payer_config = CliConfig::recent_for_tests(); fee_payer_config.json_rpc_url = String::default(); fee_payer_config.signers = vec![&offline_fee_payer_signer, &from_null_signer]; // Verify we cannot contact the cluster fee_payer_config.command = CliCommand::ClusterVersion; process_command(&fee_payer_config).unwrap_err(); fee_payer_config.command = CliCommand::Transfer { amount: SpendAmount::Some(pay_to_lamports(42.0)), to: to_pubkey, from: 1, sign_only: true, dump_transaction_message: false, allow_unfunded_recipient: true, no_wait: false, blockhash_query: BlockhashQuery::None(blockhash), nonce_account: None, nonce_authority: 0, memo: None, fee_payer: 0, derived_address_seed: None, derived_address_program_id: None, }; fee_payer_config.output_format = OutputFormat::JsonCompact; let sign_only_reply = process_command(&fee_payer_config).unwrap(); let sign_only = parse_sign_only_reply_string(&sign_only_reply); assert!(!sign_only.has_all_signers()); let fee_payer_presigner = sign_only .presigner_of(&offline_fee_payer_signer.pubkey()) .unwrap(); // Now the offline fund source let mut from_config = CliConfig::recent_for_tests(); from_config.json_rpc_url = String::default(); from_config.signers = vec![&fee_payer_presigner, &offline_from_signer]; // Verify we cannot contact the cluster from_config.command = CliCommand::ClusterVersion; process_command(&from_config).unwrap_err(); from_config.command = CliCommand::Transfer { amount: SpendAmount::Some(pay_to_lamports(42.0)), to: to_pubkey, from: 1, sign_only: true, dump_transaction_message: false, allow_unfunded_recipient: true, no_wait: false, blockhash_query: BlockhashQuery::None(blockhash), nonce_account: None, nonce_authority: 0, memo: None, fee_payer: 0, derived_address_seed: None, derived_address_program_id: None, }; from_config.output_format = OutputFormat::JsonCompact; let sign_only_reply = process_command(&from_config).unwrap(); let sign_only = parse_sign_only_reply_string(&sign_only_reply); assert!(sign_only.has_all_signers()); let from_presigner = sign_only .presigner_of(&offline_from_signer.pubkey()) .unwrap(); // Finally submit to the cluster let mut config = CliConfig::recent_for_tests(); config.json_rpc_url = test_validator.rpc_url(); config.signers = vec![&fee_payer_presigner, &from_presigner]; config.command = CliCommand::Transfer { amount: SpendAmount::Some(pay_to_lamports(42.0)), to: to_pubkey, from: 1, sign_only: false, dump_transaction_message: false, allow_unfunded_recipient: true, no_wait: false, blockhash_query: BlockhashQuery::FeeCalculator(blockhash_query::Source::Cluster, blockhash), nonce_account: None, nonce_authority: 0, memo: None, fee_payer: 0, derived_address_seed: None, derived_address_program_id: None, }; process_command(&config).unwrap(); check_recent_balance( pay_to_lamports(1.0), &rpc_client, &offline_from_signer.pubkey(), ); check_recent_balance( pay_to_lamports(1.0) + 1, &rpc_client, &offline_fee_payer_signer.pubkey(), ); check_recent_balance(pay_to_lamports(42.0), &rpc_client, &to_pubkey); }
rust_cleaned_test_functions.jsonl/71164
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 2325 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 35403, 26290, 285, 1338, 11172, 287, 368, 341, 262, 2291, 58358, 27413, 486, 15188, 543, 262, 1077, 28337, 3097, 12670, 284, 6569, 1082, 1310, 486, 931, 543, 262, 1077, 28337, 34014, 792, 284, 283...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_constant_initializer_explicit() { let mut context = Scope::new(); let init = constant_initializer(&mut context, 3_i32, [2, 2, 2].as_ref()).unwrap(); let var = context .get_variable_with_initializer(init, true, "") .unwrap(); let results = test_suite!(run_op: [var]; context, input: {}); test_suite!(results; assert_len: {[0;Int32] == 8}); test_suite!(results; assert: {[0;Int32] == [3_i32, 3, 3, 3, 3, 3, 3, 3]}); }
rust_cleaned_test_functions.jsonl/96395
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 212 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 34967, 36462, 14214, 6026, 368, 341, 262, 1077, 5206, 2266, 284, 34920, 486, 931, 1428, 262, 1077, 2930, 284, 6783, 36462, 2099, 6984, 2266, 11, 220, 18, 5318, 18, 17, 11, 508, 17, 11, 220, 17...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_timestamps_with_different_days_are_not_equal() -> IonResult<()> { let builder = Timestamp::with_year(2021).with_month(2); let timestamp1 = builder.clone().with_day(5).build(); let timestamp2 = builder.clone().with_day(6).build(); assert_ne!(timestamp1, timestamp2); Ok(()) }
rust_cleaned_test_functions.jsonl/13960
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 148 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 23073, 82, 6615, 82741, 28353, 56855, 7913, 11478, 368, 1464, 44805, 2077, 71698, 341, 286, 1077, 7363, 284, 32758, 486, 4197, 14645, 7, 17, 15, 17, 16, 568, 4197, 18933, 7, 17, 317, 286, 1077, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_path_band() { let mut files = FileMap::new(); files.add_file(PathBuf::from("a/b")); files.add_relative(PathBuf::from("d/e/f"), &PathBuf::from("d")); dbg!(&files.tree); assert!(files.tree.contains_key(&String::from("a"))); assert!(files.tree.contains_key(&String::from("e"))); }
rust_cleaned_test_functions.jsonl/81407
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 172 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2638, 45344, 368, 341, 286, 1077, 5206, 3542, 284, 2887, 2227, 486, 931, 543, 286, 3542, 1364, 2458, 33030, 15064, 486, 1499, 445, 64, 3470, 4010, 286, 3542, 1364, 29286, 33030, 15064, 486, 1499, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_checkout_deleted_tree_and_added_blob() -> BitResult<()> { BitRepo::with_sample_repo_no_sym(|repo| { bit_branch!(repo: "checkpoint"); let target = commit! { foo bar dir < "changed to a file" }; rmdir!(repo: "dir"); bit_checkout!(repo: &rev!(target))?; // reset and test force checkout as well bit_reset!(repo: --hard "checkpoint"); assert!(exists!(repo: "dir/bar")); rmdir!(repo: "dir"); bit_checkout!(repo: &rev!(target))?; assert_eq!(cat!(repo: "dir"), "changed to a file"); Ok(()) }) }
rust_cleaned_test_functions.jsonl/62982
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 346 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 68186, 39418, 11663, 8378, 37653, 45908, 368, 1464, 6495, 2077, 71698, 341, 262, 6495, 25243, 486, 4197, 17491, 37784, 6536, 26825, 22428, 23476, 91, 341, 286, 2699, 28031, 10297, 23476, 25, 330, 69...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_a_bench() { if !is_nightly() { return; } let p = project() .file( "Cargo.toml", r#" [project] name = "foo" authors = [] version = "0.1.0" [lib] name = "foo" test = false doctest = false [[bench]] name = "b" test = true "#, ).file("src/lib.rs", "") .file("benches/b.rs", "#[test] fn foo() {}") .build(); p.cargo("test") .with_stderr( "\ [COMPILING] foo v0.1.0 ([..]) [FINISHED] dev [unoptimized + debuginfo] target(s) in [..] [RUNNING] target/debug/deps/b-[..][EXE]", ).with_stdout_contains("test foo ... ok") .run(); }
rust_cleaned_test_functions.jsonl/50459
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 480 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 4306, 880, 19762, 368, 341, 262, 421, 753, 285, 1089, 71948, 368, 341, 286, 470, 280, 262, 555, 262, 1077, 281, 284, 2390, 741, 286, 659, 1192, 1006, 310, 330, 98228, 73494, 75, 756, 310, 435,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_invalid_arms() { fn check(macro_body: &str, err: ParseError) { let m = parse_macro_arm(macro_body); assert_eq!(m, Err(err.into())); } check("invalid", ParseError::Expected("expected subtree".into())); check("$i:ident => ()", ParseError::Expected("expected subtree".into())); check("($i:ident) ()", ParseError::Expected("expected `=`".into())); check("($($i:ident)_) => ()", ParseError::InvalidRepeat); check("($i) => ($i)", ParseError::UnexpectedToken("bad fragment specifier 1".into())); check("($i:) => ($i)", ParseError::UnexpectedToken("bad fragment specifier 1".into())); }
rust_cleaned_test_functions.jsonl/28781
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 300 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 31433, 62, 15914, 368, 341, 286, 5168, 1779, 1255, 49507, 14114, 25, 609, 495, 11, 1848, 25, 14775, 1454, 8, 341, 310, 1077, 296, 284, 4715, 58810, 34680, 1255, 49507, 14114, 317, 310, 2060, 107...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1