text
stringlengths
93
16.4k
id
stringlengths
20
40
metadata
dict
input_ids
listlengths
45
2.05k
attention_mask
listlengths
45
2.05k
complexity
int64
1
9
#[test] fn test_pathbuf_string_conversion() { let input_path_string = "/home/test/.kube/config"; let legal_path = PathBuf::from(input_path_string); let legal_path_string = CreatingConfig::pathbuf_to_string("testfield", legal_path).unwrap(); assert_eq!(input_path_string, legal_path_string); }
rust_cleaned_test_functions.jsonl/32150
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 138 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2638, 5909, 3904, 64132, 368, 341, 286, 1077, 1946, 2638, 3904, 284, 3521, 5117, 12697, 11930, 97717, 14730, 876, 286, 1077, 5777, 2638, 284, 7933, 15064, 486, 1499, 5384, 2638, 3904, 317, 286, 10...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_solve() { let input = vec![1721, 979, 366, 299, 675, 1456]; assert_eq!(solve(&input), Some(241861950)); }
rust_cleaned_test_functions.jsonl/108750
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 62 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 86246, 368, 341, 10217, 1946, 284, 7486, 20703, 16, 22, 17, 16, 11, 220, 24, 22, 24, 11, 220, 18, 21, 21, 11, 220, 17, 24, 24, 11, 220, 21, 22, 20, 11, 220, 16, 19, 20, 21, 935, 6948, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_parse_fail_thematic_break_into_paragraph() { assert_eq!( parse("# boop\n\n-d--\n\n## boop 2\n\n",).unwrap(), Mdx { ast: vec![ MdxAst::ATXHeading(ast::ATXHeading { level: 1, value: "boop" }), MdxAst::Paragraph(ast::Paragraph { words: "-d--" }), MdxAst::ATXHeading(ast::ATXHeading { level: 2, value: "boop 2" }) ] } ); }
rust_cleaned_test_functions.jsonl/58230
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 367 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21039, 22121, 5854, 12240, 39494, 45514, 96713, 368, 341, 262, 2060, 10714, 33673, 286, 4715, 3584, 708, 453, 1699, 1699, 1737, 313, 59, 77, 1699, 565, 708, 453, 220, 17, 1699, 1699, 497, 568, 1...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_add_iface() { let mut exec = fasync::TestExecutor::new().expect("Failed to create an executor"); // Boilerplate for adding a new interface. let iface_map = Arc::new(IfaceMap::new()); let iface_counter = Arc::new(IfaceCounter::new()); let (inspect_tree, _persistence_stream) = test_helper::fake_inspect_tree(); let (sender, _receiver) = mpsc::channel(1); let cobalt_sender = CobaltSender::new(sender); let (cobalt_1dot1_proxy, _) = create_proxy::<fidl_fuchsia_metrics::MetricEventLoggerMarker>() .expect("failed to create Cobalt 1.1 proxy"); let (dev_monitor_proxy, _) = create_proxy::<fidl_fuchsia_wlan_device_service::DeviceMonitorMarker>() .expect("failed to create DeviceMonitor proxy"); let cfg = ServiceCfg { wep_supported: false, wpa1_supported: false }; // Construct the request. let (mlme_channel, mlme_receiver) = create_endpoints().expect("failed to create fake MLME proxy"); let mut mlme_stream = mlme_receiver.into_stream().expect("failed to create MLME stream"); let req = fidl_svc::AddIfaceRequest { phy_id: 123, assigned_iface_id: 456, iface: mlme_channel }; let fut = add_iface( req, &cfg, &iface_map, &iface_counter, &inspect_tree, &cobalt_sender, cobalt_1dot1_proxy, dev_monitor_proxy, ); pin_mut!(fut); assert_variant!(exec.run_until_stalled(&mut fut), Poll::Pending); // The future should have requested the PHY's information. assert_variant!( exec.run_until_stalled(&mut mlme_stream.next()), Poll::Ready(Some(Ok(fidl_mlme::MlmeRequest::QueryDeviceInfo { responder }))) => { let mut device_info = fake_device_info(); responder.send(&mut device_info).expect("failed to send MLME response"); }); // The future should complete successfully. assert_variant!(exec.run_until_stalled(&mut fut), Poll::Ready(result) => { assert!(result.result.is_ok()); assert_eq!(result.status, zx::sys::ZX_OK); assert_eq!(result.iface_id, Some(fidl_svc::AddIfaceResponse { iface_id: 0 })); }); }
rust_cleaned_test_functions.jsonl/46968
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1112 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2891, 67666, 368, 341, 286, 1077, 5206, 3883, 284, 282, 7692, 486, 2271, 25255, 486, 931, 1005, 17119, 445, 9408, 311, 1855, 458, 31558, 3071, 286, 442, 45665, 1750, 369, 7842, 264, 501, 3749, 6...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_symlink_type_dir() { let tmp_dir = tempdir().expect("failed to create temp dir"); // Create directory let dir_path = tmp_dir.path().join("dir.d"); std::fs::create_dir(&dir_path).expect("failed to create dir"); // Create symlink let symlink_path = tmp_dir.path().join("target.d"); symlink(&dir_path, &symlink_path).expect("failed to create symlink"); let meta = symlink_path .symlink_metadata() .expect("failed to get metas"); let colors = Colors::new(ThemeOption::NoLscolors); let file_type = FileType::new(&meta, Some(&meta), &Permissions::from(&meta)); assert_eq!( "l".to_string().with(Color::AnsiValue(44)), file_type.render(&colors) ); }
rust_cleaned_test_functions.jsonl/60421
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 375 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 58530, 44243, 1819, 4334, 368, 341, 286, 1077, 4174, 4334, 284, 2730, 3741, 1005, 17119, 445, 16091, 311, 1855, 2730, 5419, 3071, 286, 442, 4230, 6220, 198, 286, 1077, 5419, 2638, 284, 4174, 4334,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_op_gte() { let mut c = Compiler::new(); c.add(Instruction::LoadConst(Value::from(1))); c.add(Instruction::LoadConst(Value::from(2))); c.add(Instruction::Gte); c.add(Instruction::Emit); let mut output = String::new(); simple_eval(&c.finish().0, (), &mut output).unwrap(); assert_eq!(output, "false"); let mut c = Compiler::new(); c.add(Instruction::LoadConst(Value::from(1))); c.add(Instruction::LoadConst(Value::from(1))); c.add(Instruction::Gte); c.add(Instruction::Emit); let mut output = String::new(); simple_eval(&c.finish().0, (), &mut output).unwrap(); assert_eq!(output, "true"); }
rust_cleaned_test_functions.jsonl/72131
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 286 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 10287, 1889, 665, 368, 341, 262, 1077, 5206, 272, 284, 45631, 486, 931, 543, 262, 272, 1364, 7, 16664, 486, 5879, 19167, 25346, 486, 1499, 7, 16, 4945, 262, 272, 1364, 7, 16664, 486, 5879, 191...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_parse_en_passant() { let movegen = MoveGenerator::new(); let mut builder = PositionBuilder::new(); builder .place(Square::C4, Piece::BlackPawn, Color::Black) .place(Square::B4, Piece::WhitePawn, Color::White) .place(Square::G5, Piece::WhitePawn, Color::White) .place(Square::H5, Piece::BlackPawn, Color::Black); let pos = builder .clone() .side_to_move(Color::Black) .en_passant_target(Some(Square::B3)) .build(); assert_eq!( Ok(Move { kind: MoveKind::EnPassantCapture, from: Square::C4, to: Square::B3, }), movegen.parse_move(&pos, "c4b3"), ); let pos = builder .clone() .side_to_move(Color::White) .en_passant_target(Some(Square::H6)) .build(); assert_eq!( Ok(Move { kind: MoveKind::EnPassantCapture, from: Square::G5, to: Square::H6, }), movegen.parse_move(&pos, "g5h6"), ); }
rust_cleaned_test_functions.jsonl/134622
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 483 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21039, 6205, 15464, 517, 368, 341, 262, 1077, 3271, 4370, 284, 14561, 12561, 486, 931, 543, 262, 1077, 5206, 7363, 284, 12380, 3297, 486, 931, 543, 262, 7363, 198, 414, 659, 2007, 3759, 5151, 48...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_fn_signature_two_args_empty() { let info = call_info( r#"fn foo(x: u32, y: u32) -> u32 {x + y} fn bar() { foo(<|>); }"#, ); assert_eq!(info.parameters(), ["x: u32", "y: u32"]); assert_eq!(info.active_parameter, Some(0)); }
rust_cleaned_test_functions.jsonl/55348
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 161 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 15246, 39859, 23241, 8384, 15124, 368, 341, 286, 1077, 3546, 284, 1618, 3109, 1006, 310, 435, 55543, 8822, 15229, 2075, 25, 575, 18, 17, 11, 379, 25, 575, 18, 17, 8, 1464, 575, 18, 17, 314, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_try_split() { let mut a: Vec<Element> = [ (0u32, 4u32), (7, 4), (4, 3), (7, 4), (8, 4), (0, 4), (13, 4), (1, 2), (1, 2), ] .iter() .map(|(value, depth)| Element { value: *value, depth: *depth, }) .collect(); let should_split = try_split(&mut a); assert!(should_split); assert_eq!(a, parse_line("[[[[0,7],4],[[7,8],[0,[6,7]]]],[1,1]]")); }
rust_cleaned_test_functions.jsonl/124064
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 373 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 53283, 17052, 368, 341, 286, 1077, 5206, 264, 25, 11312, 72365, 29, 284, 2278, 310, 320, 15, 84, 18, 17, 11, 220, 19, 84, 18, 17, 1326, 310, 320, 22, 11, 220, 19, 1326, 310, 320, 19, 11, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_zip321_parse_empty_message() { let fragment = "message="; let result = zcashparam(&TEST_NETWORK)(fragment).unwrap().1.param; assert_eq!(result, Param::Message("".to_string())); }
rust_cleaned_test_functions.jsonl/81781
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 101 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 42131, 18, 17, 16, 21039, 15124, 6462, 368, 341, 286, 1077, 12289, 284, 330, 1994, 428, 401, 286, 1077, 1102, 284, 1147, 41271, 903, 2099, 10033, 48119, 2376, 42202, 568, 15454, 1005, 16, 6634, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_session_description_json() { let tests = vec![ ( RTCSessionDescription { sdp_type: RTCSdpType::Offer, sdp: "sdp".to_owned(), parsed: None, }, r#"{"type":"offer","sdp":"sdp"}"#, ), ( RTCSessionDescription { sdp_type: RTCSdpType::Pranswer, sdp: "sdp".to_owned(), parsed: None, }, r#"{"type":"pranswer","sdp":"sdp"}"#, ), ( RTCSessionDescription { sdp_type: RTCSdpType::Answer, sdp: "sdp".to_owned(), parsed: None, }, r#"{"type":"answer","sdp":"sdp"}"#, ), ( RTCSessionDescription { sdp_type: RTCSdpType::Rollback, sdp: "sdp".to_owned(), parsed: None, }, r#"{"type":"rollback","sdp":"sdp"}"#, ), ( RTCSessionDescription { sdp_type: RTCSdpType::Unspecified, sdp: "sdp".to_owned(), parsed: None, }, r#"{"type":"Unspecified","sdp":"sdp"}"#, ), ]; for (desc, expected_string) in tests { let result = serde_json::to_string(&desc); assert!(result.is_ok(), "testCase: marshal err: {:?}", result); let desc_data = result.unwrap(); assert_eq!(desc_data, expected_string, "string is not expected"); let result = serde_json::from_str::<RTCSessionDescription>(&desc_data); assert!(result.is_ok(), "testCase: unmarshal err: {:?}", result); if let Ok(sd) = result { assert!(sd.sdp == desc.sdp && sd.sdp_type == desc.sdp_type); } } }
rust_cleaned_test_functions.jsonl/124416
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1271 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 12316, 11448, 9455, 368, 341, 286, 1077, 7032, 284, 7486, 90515, 310, 2399, 394, 35047, 5283, 5009, 341, 503, 274, 9796, 1819, 25, 10635, 6412, 9796, 929, 486, 39462, 345, 503, 274, 9796, 25, 33...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
4
#[test] fn test_move_to_winapi() { let (saved_x, saved_y) = position().unwrap(); move_to(saved_x + 1, saved_y + 1).unwrap(); assert_eq!(position().unwrap(), (saved_x + 1, saved_y + 1)); move_to(saved_x, saved_y).unwrap(); assert_eq!(position().unwrap(), (saved_x, saved_y)); }
rust_cleaned_test_functions.jsonl/15637
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 164 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 17134, 2346, 25672, 2068, 368, 341, 286, 1077, 320, 32702, 3212, 11, 6781, 4178, 8, 284, 2309, 1005, 15454, 1428, 286, 3271, 2346, 14217, 3212, 488, 220, 16, 11, 6781, 4178, 488, 220, 16, 568, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_start_training_selected_participant_training_complete() { let mut protocol = Protocol::new(get_default_fl_settings()); protocol.is_training_complete = true; let resp = protocol.start_training(ClientState::Selected); assert_eq!(StartTrainingResponse::Reject, resp); assert!(protocol.next_event().is_none()); }
rust_cleaned_test_functions.jsonl/97781
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 142 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 4906, 32891, 23755, 10495, 21757, 32891, 27675, 368, 341, 286, 1077, 5206, 11507, 284, 24572, 486, 931, 5433, 9993, 5081, 10853, 1423, 286, 11507, 2079, 32891, 27675, 284, 830, 401, 286, 1077, 9039,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_folder_dup() { let items = string_vec_to_status(&[ "a/file.txt", "a/file2.txt", ]); let res = FileTreeItems::new(&items, &BTreeSet::new()) .unwrap() .items .iter() .map(|i| i.info.full_path.clone()) .collect::<Vec<_>>(); assert_eq!( res, vec![ String::from("a"), items[0].path.clone(), items[1].path.clone() ] ); }
rust_cleaned_test_functions.jsonl/56874
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 352 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 15268, 51932, 368, 341, 286, 1077, 3589, 284, 914, 13251, 2346, 4773, 2099, 9640, 310, 330, 64, 23903, 3909, 497, 2303, 310, 330, 64, 23903, 17, 3909, 497, 715, 286, 22712, 286, 1077, 592, 284, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_binary_representation_rfc_private_key() { let parameters = [ HssParameter::construct_default_parameters(), HssParameter::construct_default_parameters(), ]; let mut seed = Seed::default(); OsRng.fill_bytes(&mut seed); let key = ReferenceImplPrivateKey::generate(&parameters, &seed).unwrap(); let binary_representation = key.to_binary_representation(); let deserialized = ReferenceImplPrivateKey::<Hasher>::from_binary_representation( binary_representation.as_slice(), ) .unwrap(); assert!(key == deserialized); }
rust_cleaned_test_functions.jsonl/29975
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 274 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 31761, 94263, 1710, 8316, 26249, 3097, 368, 341, 286, 1077, 5029, 284, 2278, 310, 472, 778, 4971, 486, 7596, 9993, 18263, 3148, 310, 472, 778, 4971, 486, 7596, 9993, 18263, 3148, 286, 15424, 286, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_ElfMut_from_dynamic_hdr() { let mut buf = ELF32_DYNAMIC_ELF_HDR.clone(); let elf: Result<ElfMut<'_, LittleEndian, Elf32>, ElfError> = ElfMut::try_from(&mut buf[0..]); assert!(elf.is_ok()); }
rust_cleaned_test_functions.jsonl/119500
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 112 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2089, 11008, 51440, 5673, 45992, 28238, 368, 341, 262, 1077, 5206, 6607, 284, 72568, 18, 17, 57356, 2089, 22609, 55765, 15997, 543, 262, 1077, 40745, 25, 5714, 27, 75832, 51440, 18291, 6878, 14671, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_check_resource_blocks_missing_has_permission_warning() { let mut kb = KnowledgeBase::new(); kb.resource_blocks .resources .insert(term!(sym!("Organization"))); assert!(check_resource_blocks_missing_has_permission(&kb).is_some()); }
rust_cleaned_test_functions.jsonl/102136
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 134 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 7200, 17962, 25201, 40447, 21778, 37971, 38395, 368, 341, 286, 1077, 5206, 38653, 284, 31925, 3978, 486, 931, 543, 286, 38653, 24013, 25201, 198, 310, 659, 12745, 198, 310, 659, 4208, 44654, 10297, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_merge_normal_to_sparse() { let mut hll: HyperLogLogPlus<u64, PassThroughHasherBuilder> = HyperLogLogPlus::new(16, PassThroughHasherBuilder {}).unwrap(); let mut other: HyperLogLogPlus<u64, PassThroughHasherBuilder> = HyperLogLogPlus::new(16, PassThroughHasherBuilder {}).unwrap(); other.sparse_to_normal(); other.add(&0x00010fffffffffff); other.add(&0x00020fffffffffff); other.add(&0x00030fffffffffff); other.add(&0x00040fffffffffff); other.add(&0x00050fffffffffff); other.add(&0x00050fffffffffff); assert_eq!(other.count().trunc() as u64, 5); let res = hll.merge(&other); assert_eq!(res, Ok(())); assert_eq!(hll.count().trunc() as u64, 5); assert!(!hll.is_sparse() && !other.is_sparse()); }
rust_cleaned_test_functions.jsonl/8355
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 404 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 20888, 13973, 2346, 71123, 368, 341, 286, 1077, 5206, 305, 654, 25, 32732, 2201, 2201, 21807, 34837, 21, 19, 11, 9970, 23857, 6370, 261, 3297, 29, 4035, 310, 32732, 2201, 2201, 21807, 486, 931, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_parse_colouring() -> Result<(), Error> { let test_input = "f=[1| 0 , 3 | 2] x o\n\n"; let (_, (parsed_colours, max_colour)) = parse_colouring(5, test_input)?; assert_eq!(4, max_colour); assert_eq!(vec![2, 1, 3, 2, DEFAULT_COLOR], parsed_colours); Ok(()) }
rust_cleaned_test_functions.jsonl/46229
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 165 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21039, 56260, 287, 368, 1464, 5714, 68843, 4600, 29, 341, 286, 1077, 1273, 5898, 284, 330, 69, 5818, 16, 91, 220, 220, 15, 220, 1154, 220, 220, 18, 760, 220, 17, 60, 856, 297, 1699, 1699, 87...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_eq_scalar() { test_generic_scalar::<i32, _>( vec!["arrow", "parquet", "datafusion", "flight"], "arrow", eq_scalar, vec![true, false, false, false], ) }
rust_cleaned_test_functions.jsonl/64918
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 142 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 10714, 41652, 368, 341, 286, 1273, 41232, 41652, 27638, 72, 18, 17, 11, 716, 17055, 310, 7486, 0, 1183, 6044, 497, 330, 1732, 23300, 497, 330, 691, 54565, 497, 330, 38390, 8097, 310, 330, 6044, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_local_state_storage() -> Result<()> { init_for_e2e_testing(); let (mock_chain_service, _handle) = MockChainClient::new(); let client = Arc::new(mock_chain_service.clone()); let account_address = AccountAddress::random(); faucet_sync(mock_chain_service, account_address, 1_000_000)?; debug!("faucet finish"); let storage = LocalStateStorage::new(account_address, client)?; let state_view = storage.new_state_view(None)?; let account_resource = state_view.get(&AccessPath::new_for_account(account_address))?; debug_assert!(account_resource.is_some()); debug!("test finish"); Ok(()) }
rust_cleaned_test_functions.jsonl/111154
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 243 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 13564, 4387, 23310, 368, 1464, 5714, 71698, 341, 262, 2930, 5478, 2204, 17, 68, 70962, 543, 262, 1077, 320, 16712, 30583, 12267, 11, 716, 8192, 8, 284, 14563, 18837, 2959, 486, 931, 543, 262, 10...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
5
#[test] fn test_from_vec_int() { let s: Series<i64, usize> = Series::from(vec![1, 2, 3]); let exp: Series<i64, usize> = Series::new(vec![1, 2, 3], vec![0, 1, 2]); assert_eq!(s, exp); }
rust_cleaned_test_functions.jsonl/77388
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 118 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 5673, 13251, 4042, 368, 341, 286, 1077, 274, 25, 11131, 21897, 21, 19, 11, 22301, 29, 284, 11131, 486, 1499, 25592, 20703, 16, 11, 220, 17, 11, 220, 18, 2558, 286, 1077, 1343, 25, 11131, 21897...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_role() { let mut cmd1 = Command::cargo_bin("factomd").unwrap(); let mut cmd2 = Command::cargo_bin("factomd").unwrap(); let mut cmd3 = Command::cargo_bin("factomd").unwrap(); let mut cmd4 = Command::cargo_bin("factomd").unwrap(); cmd1.arg("--role").arg("FULL").assert().success(); cmd2.arg("--role").arg("AUTHORITY").assert().success(); cmd3.arg("--role").arg("LIGHT").assert().success(); cmd4.arg("--role").arg("OTHER").assert().failure(); }
rust_cleaned_test_functions.jsonl/86577
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 197 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 19792, 368, 341, 262, 1077, 5206, 5439, 16, 284, 7348, 486, 66715, 21816, 445, 33110, 316, 67, 1827, 15454, 543, 262, 1077, 5206, 5439, 17, 284, 7348, 486, 66715, 21816, 445, 33110, 316, 67, 182...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_merge_multivalued_int_fields() { let mut schema_builder = schema::SchemaBuilder::default(); let int_options = IntOptions::default() .set_fast(Cardinality::MultiValues) .set_indexed(); let int_field = schema_builder.add_u64_field("intvals", int_options); let index = Index::create_in_ram(schema_builder.build()); { let mut index_writer = index.writer_with_num_threads(1, 40_000_000).unwrap(); let index_doc = |index_writer: &mut IndexWriter, int_vals: &[u64]| { let mut doc = Document::default(); for &val in int_vals { doc.add_u64(int_field, val); } index_writer.add_document(doc); }; index_doc(&mut index_writer, &[1, 2]); index_doc(&mut index_writer, &[1, 2, 3]); index_doc(&mut index_writer, &[4, 5]); index_doc(&mut index_writer, &[1, 2]); index_doc(&mut index_writer, &[1, 5]); index_doc(&mut index_writer, &[3]); index_doc(&mut index_writer, &[17]); index_writer.commit().expect("committed"); index_doc(&mut index_writer, &[20]); index_writer.commit().expect("committed"); index_doc(&mut index_writer, &[28, 27]); index_doc(&mut index_writer, &[1_000]); index_writer.commit().expect("committed"); } index.load_searchers().unwrap(); let searcher = index.searcher(); let mut vals: Vec<u64> = Vec::new(); { let segment = searcher.segment_reader(0u32); let ff_reader = segment.multi_fast_field_reader(int_field).unwrap(); ff_reader.get_vals(0, &mut vals); assert_eq!(&vals, &[1, 2]); ff_reader.get_vals(1, &mut vals); assert_eq!(&vals, &[1, 2, 3]); ff_reader.get_vals(2, &mut vals); assert_eq!(&vals, &[4, 5]); ff_reader.get_vals(3, &mut vals); assert_eq!(&vals, &[1, 2]); ff_reader.get_vals(4, &mut vals); assert_eq!(&vals, &[1, 5]); ff_reader.get_vals(5, &mut vals); assert_eq!(&vals, &[3]); ff_reader.get_vals(6, &mut vals); assert_eq!(&vals, &[17]); } { let segment = searcher.segment_reader(1u32); let ff_reader = segment.multi_fast_field_reader(int_field).unwrap(); ff_reader.get_vals(0, &mut vals); assert_eq!(&vals, &[20]); } { let segment = searcher.segment_reader(2u32); let ff_reader = segment.multi_fast_field_reader(int_field).unwrap(); ff_reader.get_vals(0, &mut vals); assert_eq!(&vals, &[28, 27]); ff_reader.get_vals(1, &mut vals); assert_eq!(&vals, &[1_000]); } // Merging the segments { let segment_ids = index .searchable_segment_ids() .expect("Searchable segments failed."); let mut index_writer = index.writer_with_num_threads(1, 40_000_000).unwrap(); index_writer .merge(&segment_ids) .expect("Failed to initiate merge") .wait() .expect("Merging failed"); index_writer.wait_merging_threads().unwrap(); } index.load_searchers().unwrap(); { let searcher = index.searcher(); let segment = searcher.segment_reader(0u32); let ff_reader = segment.multi_fast_field_reader(int_field).unwrap(); ff_reader.get_vals(0, &mut vals); assert_eq!(&vals, &[1, 2]); ff_reader.get_vals(1, &mut vals); assert_eq!(&vals, &[1, 2, 3]); ff_reader.get_vals(2, &mut vals); assert_eq!(&vals, &[4, 5]); ff_reader.get_vals(3, &mut vals); assert_eq!(&vals, &[1, 2]); ff_reader.get_vals(4, &mut vals); assert_eq!(&vals, &[1, 5]); ff_reader.get_vals(5, &mut vals); assert_eq!(&vals, &[3]); ff_reader.get_vals(6, &mut vals); assert_eq!(&vals, &[17]); ff_reader.get_vals(7, &mut vals); assert_eq!(&vals, &[20]); ff_reader.get_vals(8, &mut vals); assert_eq!(&vals, &[28, 27]); ff_reader.get_vals(9, &mut vals); assert_eq!(&vals, &[1_000]); } }
rust_cleaned_test_functions.jsonl/72014
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 2466 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 20888, 26290, 3936, 3260, 4042, 12132, 368, 341, 286, 1077, 5206, 10802, 28532, 284, 10802, 486, 8632, 3297, 486, 2258, 543, 286, 1077, 526, 8743, 284, 1333, 3798, 486, 2258, 741, 310, 659, 746, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_github_cert() { Context::new( "github", "github.com", &[ include_bytes!("testdata/cert-github.0.der"), include_bytes!("testdata/cert-github.1.der"), ], ) .bench(100) }
rust_cleaned_test_functions.jsonl/801
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 142 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 1889, 3827, 37097, 368, 341, 262, 9608, 486, 931, 1006, 286, 330, 5204, 756, 286, 330, 5204, 905, 756, 286, 609, 9640, 310, 2924, 12524, 17223, 92425, 2899, 529, 2371, 3827, 13, 15, 75819, 4461,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_analyze_function() { let b = ast::BaseNode::default(); let pkg = ast::Package { base: b.clone(), path: "path".to_string(), package: "main".to_string(), files: vec![ast::File { base: b.clone(), name: "foo.flux".to_string(), package: None, imports: Vec::new(), body: vec![ ast::Statement::Variable(ast::VariableAssgn { base: b.clone(), id: ast::Identifier { base: b.clone(), name: "f".to_string(), }, init: ast::Expression::Function(Box::new(ast::FunctionExpr { base: b.clone(), params: vec![ ast::Property { base: b.clone(), key: ast::PropertyKey::Identifier(ast::Identifier { base: b.clone(), name: "a".to_string(), }), value: None, }, ast::Property { base: b.clone(), key: ast::PropertyKey::Identifier(ast::Identifier { base: b.clone(), name: "b".to_string(), }), value: None, }, ], body: ast::FunctionBody::Expr(ast::Expression::Binary(Box::new( ast::BinaryExpr { base: b.clone(), operator: ast::Operator::AdditionOperator, left: ast::Expression::Identifier(ast::Identifier { base: b.clone(), name: "a".to_string(), }), right: ast::Expression::Identifier(ast::Identifier { base: b.clone(), name: "b".to_string(), }), }, ))), })), }), ast::Statement::Expr(ast::ExprStmt { base: b.clone(), expression: ast::Expression::Call(Box::new(ast::CallExpr { base: b.clone(), callee: ast::Expression::Identifier(ast::Identifier { base: b.clone(), name: "f".to_string(), }), arguments: vec![ast::Expression::Object(Box::new(ast::ObjectExpr { base: b.clone(), with: None, properties: vec![ ast::Property { base: b.clone(), key: ast::PropertyKey::Identifier(ast::Identifier { base: b.clone(), name: "a".to_string(), }), value: Some(ast::Expression::Integer(ast::IntegerLit { base: b.clone(), value: 2, })), }, ast::Property { base: b.clone(), key: ast::PropertyKey::Identifier(ast::Identifier { base: b.clone(), name: "b".to_string(), }), value: Some(ast::Expression::Integer(ast::IntegerLit { base: b.clone(), value: 3, })), }, ], }))], })), }), ], }], }; let want = Package { loc: b.location.clone(), package: "main".to_string(), files: vec![File { loc: b.location.clone(), package: None, imports: Vec::new(), body: vec![ Statement::Variable(VariableAssgn { loc: b.location.clone(), id: Identifier { loc: b.location.clone(), name: "f".to_string(), }, init: Expression::Function(Box::new(FunctionExpr { loc: b.location.clone(), typ: type_info(), params: vec![ FunctionParameter { loc: b.location.clone(), is_pipe: false, key: Identifier { loc: b.location.clone(), name: "a".to_string(), }, default: None, }, FunctionParameter { loc: b.location.clone(), is_pipe: false, key: Identifier { loc: b.location.clone(), name: "b".to_string(), }, default: None, }, ], body: Block { loc: b.location.clone(), body: vec![Statement::Return(ReturnStmt { loc: b.location.clone(), argument: Expression::Binary(Box::new(BinaryExpr { loc: b.location.clone(), typ: type_info(), operator: ast::Operator::AdditionOperator, left: Expression::Identifier(IdentifierExpr { loc: b.location.clone(), typ: type_info(), name: "a".to_string(), }), right: Expression::Identifier(IdentifierExpr { loc: b.location.clone(), typ: type_info(), name: "b".to_string(), }), })), })], }, })), }), Statement::Expr(ExprStmt { loc: b.location.clone(), expression: Expression::Call(Box::new(CallExpr { loc: b.location.clone(), typ: type_info(), pipe: None, callee: Expression::Identifier(IdentifierExpr { loc: b.location.clone(), typ: type_info(), name: "f".to_string(), }), arguments: vec![ Property { loc: b.location.clone(), key: Identifier { loc: b.location.clone(), name: "a".to_string(), }, value: Expression::Integer(IntegerLit { loc: b.location.clone(), typ: type_info(), value: 2, }), }, Property { loc: b.location.clone(), key: Identifier { loc: b.location.clone(), name: "b".to_string(), }, value: Expression::Integer(IntegerLit { loc: b.location.clone(), typ: type_info(), value: 3, }), }, ], })), }), ], }], }; let got = test_analyze(pkg).unwrap(); assert_eq!(want, got); }
rust_cleaned_test_functions.jsonl/61562
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 7413 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 12008, 55856, 9174, 368, 341, 286, 1077, 293, 284, 11763, 486, 3978, 1955, 486, 2258, 543, 286, 1077, 24793, 284, 11763, 486, 13100, 341, 310, 2331, 25, 293, 15997, 3148, 310, 1815, 25, 330, 234...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_rect_points() { assert_eq!( Rect::new(10, 20, 100, 200), rect_points(PixelsXY { x: 10, y: 20 }, PixelsXY { x: 110, y: 220 }) ); assert_eq!( Rect::new(10, 20, 100, 200), rect_points(PixelsXY { x: 110, y: 20 }, PixelsXY { x: 10, y: 220 }) ); assert_eq!( Rect::new(10, 20, 100, 200), rect_points(PixelsXY { x: 10, y: 220 }, PixelsXY { x: 110, y: 20 }) ); assert_eq!( Rect::new(10, 20, 100, 200), rect_points(PixelsXY { x: 110, y: 220 }, PixelsXY { x: 10, y: 20 }) ); assert_eq!( Rect::new(-31000, -32000, 31005, 32010), rect_points(PixelsXY { x: 5, y: -32000 }, PixelsXY { x: -31000, y: 10 }) ); assert_eq!( Rect::new(10, 5, 30990, 31995), rect_points(PixelsXY { x: 31000, y: 5 }, PixelsXY { x: 10, y: 32000 }) ); assert_eq!( Rect::new(-31000, -32000, 62000, 64000), rect_points(PixelsXY { x: -31000, y: -32000 }, PixelsXY { x: 31000, y: 32000 }) ); assert_eq!( Rect::new(-31000, -32000, 62000, 64000), rect_points(PixelsXY { x: 31000, y: 32000 }, PixelsXY { x: -31000, y: -32000 }) ); }
rust_cleaned_test_functions.jsonl/15259
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 748 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 16979, 12928, 368, 341, 286, 2060, 10714, 33673, 310, 11920, 486, 931, 7, 16, 15, 11, 220, 17, 15, 11, 220, 16, 15, 15, 11, 220, 17, 15, 15, 1326, 310, 7608, 12928, 5304, 10274, 16356, 314, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_syscall_parameter_on_stack() { test_interpreter_and_jit_asm!( " mov64 r1, r10 add64 r1, -0x100 mov64 r2, 0x1 syscall BpfSyscallString mov64 r0, 0x0 exit", [], ( b"BpfSyscallString" => syscalls::BpfSyscallString::call; syscalls::BpfSyscallString {}, ), { |_vm, res: Result| { res.unwrap() == 0 } }, 6 ); }
rust_cleaned_test_functions.jsonl/59037
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 260 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 20344, 6659, 24899, 4470, 15528, 368, 341, 262, 1273, 15318, 28637, 8378, 5374, 275, 67529, 33673, 286, 6228, 286, 1974, 21, 19, 435, 16, 11, 435, 16, 15, 198, 286, 912, 21, 19, 435, 16, 11, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_check_program_subscribe_for_missing_optimistically_confirmed_slot() { // Testing if we can get the pubsub notification if a slot does not // receive OptimisticallyConfirmed but its descendant slot get the confirmed // notification. let GenesisConfigInfo { genesis_config, mint_keypair, .. } = create_genesis_config(100); let bank = Bank::new_for_tests(&genesis_config); bank.lazy_rent_collection.store(true, Relaxed); let blockhash = bank.last_blockhash(); let bank_forks = Arc::new(RwLock::new(BankForks::new(bank))); let bank0 = bank_forks.read().unwrap().get(0).unwrap().clone(); let bank1 = Bank::new_from_parent(&bank0, &Pubkey::default(), 1); bank_forks.write().unwrap().insert(bank1); let bank1 = bank_forks.read().unwrap().get(1).unwrap().clone(); // add account for alice and process the transaction at bank1 let alice = Keypair::new(); let tx = system_transaction::create_account( &mint_keypair, &alice, blockhash, 1, 16, &stake::program::id(), ); bank1.process_transaction(&tx).unwrap(); let bank2 = Bank::new_from_parent(&bank1, &Pubkey::default(), 2); bank_forks.write().unwrap().insert(bank2); // add account for bob and process the transaction at bank2 let bob = Keypair::new(); let tx = system_transaction::create_account( &mint_keypair, &bob, blockhash, 2, 16, &stake::program::id(), ); let bank2 = bank_forks.read().unwrap().get(2).unwrap().clone(); bank2.process_transaction(&tx).unwrap(); let bank3 = Bank::new_from_parent(&bank2, &Pubkey::default(), 3); bank_forks.write().unwrap().insert(bank3); // add account for joe and process the transaction at bank3 let joe = Keypair::new(); let tx = system_transaction::create_account( &mint_keypair, &joe, blockhash, 3, 16, &stake::program::id(), ); let bank3 = bank_forks.read().unwrap().get(3).unwrap().clone(); bank3.process_transaction(&tx).unwrap(); // now add programSubscribe at the "confirmed" commitment level let exit = Arc::new(AtomicBool::new(false)); let optimistically_confirmed_bank = OptimisticallyConfirmedBank::locked_from_bank_forks_root(&bank_forks); let mut pending_optimistically_confirmed_banks = HashSet::new(); let subscriptions = Arc::new(RpcSubscriptions::new_for_tests( &exit, bank_forks.clone(), Arc::new(RwLock::new(BlockCommitmentCache::new_for_tests_with_slots( 1, 1, ))), optimistically_confirmed_bank.clone(), )); let (rpc, mut receiver) = rpc_pubsub_service::test_connection(&subscriptions); let sub_id = rpc .program_subscribe( stake::program::id().to_string(), Some(RpcProgramAccountsConfig { account_config: RpcAccountInfoConfig { commitment: Some(CommitmentConfig::confirmed()), ..RpcAccountInfoConfig::default() }, ..RpcProgramAccountsConfig::default() }), ) .unwrap(); subscriptions .control .assert_subscribed(&SubscriptionParams::Program(ProgramSubscriptionParams { pubkey: stake::program::id(), filters: Vec::new(), encoding: UiAccountEncoding::Binary, data_slice: None, commitment: CommitmentConfig::confirmed(), with_context: false, })); let mut highest_confirmed_slot: Slot = 0; let mut last_notified_confirmed_slot: Slot = 0; // to see transaction for alice and bob to be notified in order. OptimisticallyConfirmedBankTracker::process_notification( BankNotification::OptimisticallyConfirmed(3), &bank_forks, &optimistically_confirmed_bank, &subscriptions, &mut pending_optimistically_confirmed_banks, &mut last_notified_confirmed_slot, &mut highest_confirmed_slot, &None, ); // a closure to reduce code duplications in building expected responses: let build_expected_resp = |slot: Slot, lamports: u64, pubkey: &str, subscription: i32| { json!({ "jsonrpc": "2.0", "method": "programNotification", "params": { "result": { "context": { "slot": slot }, "value": { "account": { "data": "1111111111111111", "executable": false, "lamports": lamports, "owner": "Stake11111111111111111111111111111111111111", "rentEpoch": 0, }, "pubkey": pubkey, }, }, "subscription": subscription, } }) }; let response = receiver.recv(); let expected = build_expected_resp(1, 1, &alice.pubkey().to_string(), 0); assert_eq!( expected, serde_json::from_str::<serde_json::Value>(&response).unwrap(), ); let response = receiver.recv(); let expected = build_expected_resp(2, 2, &bob.pubkey().to_string(), 0); assert_eq!( expected, serde_json::from_str::<serde_json::Value>(&response).unwrap(), ); bank3.freeze(); OptimisticallyConfirmedBankTracker::process_notification( BankNotification::Frozen(bank3), &bank_forks, &optimistically_confirmed_bank, &subscriptions, &mut pending_optimistically_confirmed_banks, &mut last_notified_confirmed_slot, &mut highest_confirmed_slot, &None, ); let response = receiver.recv(); let expected = build_expected_resp(3, 3, &joe.pubkey().to_string(), 0); assert_eq!( expected, serde_json::from_str::<serde_json::Value>(&response).unwrap(), ); rpc.program_unsubscribe(sub_id).unwrap(); }
rust_cleaned_test_functions.jsonl/14337
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 3388 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 7200, 25096, 88935, 5478, 40447, 15032, 318, 37110, 16059, 8434, 27563, 368, 341, 286, 442, 26768, 421, 582, 646, 633, 279, 6675, 1966, 11540, 421, 264, 9446, 1558, 537, 198, 286, 442, 5258, 30097...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_show_stories() -> Result<(), Box<dyn Error>> { setup(); let client = JsonClient::new(); let ids = client.show_stories()?; log::debug!("ids = {:?}", ids); Ok(()) }
rust_cleaned_test_functions.jsonl/106545
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 114 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 15267, 1261, 2433, 368, 1464, 5714, 68843, 8261, 92846, 4600, 2452, 341, 286, 6505, 1428, 286, 1077, 2943, 284, 8308, 2959, 486, 931, 543, 286, 1077, 14151, 284, 2943, 5460, 1261, 2433, 94136, 286...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
2
#[test] fn test_from_static_custom_long_uppercase() { HeaderName::from_static( "Longer-Than-63--ThisHeaderIsLongerThanSixtyThreeCharactersAndThusHandledDifferent", ); }
rust_cleaned_test_functions.jsonl/3414
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 94 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 5673, 25360, 15875, 17799, 34445, 5638, 368, 341, 286, 12104, 675, 486, 1499, 25360, 1006, 310, 330, 6583, 261, 12, 26067, 12, 21, 18, 313, 1986, 4047, 3872, 6583, 261, 26067, 41460, 1881, 19641, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_row() { assert_eq!(row(""), Row::Blank); assert_eq!(row("# comment"), Row::Comment("comment")); assert_eq!( row("f1,f2,DIRECT"), Row::Record(Record { domain: "f1", account_id: "f2", relation: Relation::Direct, authority_id: None, }) ); assert_eq!( row("name=value"), Row::Variable(Variable { name: "name", value: "value", }) ); assert_eq!(row("unknown"), Row::Unknown("unknown")); }
rust_cleaned_test_functions.jsonl/95250
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 293 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 8530, 368, 341, 262, 2060, 10714, 10297, 651, 86076, 10801, 486, 22770, 317, 262, 2060, 10714, 10297, 651, 3584, 3980, 3975, 10801, 486, 10677, 445, 6182, 4010, 262, 2060, 10714, 33673, 286, 2802, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_parsing_invalid_validator_value_type() { match read_single_check("checks/tests/test11.json") { Some(_) => assert!(false), None => assert!(true), } }
rust_cleaned_test_functions.jsonl/80338
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 108 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 620, 28598, 31433, 64959, 3142, 1819, 368, 341, 286, 2432, 1349, 19487, 7200, 445, 49383, 62468, 12697, 16, 16, 4323, 899, 341, 310, 4329, 48139, 589, 2060, 10297, 3849, 1326, 310, 2240, 589, 2060...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
2
#[test] fn test_myers_long_overflow() { let pattern = b"AAGACGAGAAAAGAAAGTCTAAAGGACTTTTGTGGCAAGACCATCCCTGTTCCCAACCCGACCCCTGGACCTCCCGCCCCGGGCACTCCCGACCCCCCGACCCCCCGACTCCTGGACCAGGAGACTGA"; let text = b"GGCAAGGGGGACTGTAGATGGGTGAAAAGAGCAGTCAGGGACCAGGTCCTCAGCCCCCCAGCCCCCCAGCCCTCCAGGTCCCCAGCCCTCCAGGTCCCCAGCCCAACCCTTGTCCTTACCAGAACGTTGTTTTCAGGAAGTCTGAAAGACAAGAGCAGAAAGTCAGTCCCATGGAATTTTCGCTTCCCACAG".to_vec(); let myers: Myers<u64> = Myers::new(pattern.iter().cloned()); let hits: Vec<_> = myers.find_all_end(text, usize::max_value() - 64).collect(); dbg!(hits); }
rust_cleaned_test_functions.jsonl/21452
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 308 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 35686, 388, 17799, 79073, 368, 341, 286, 1077, 5383, 284, 293, 29133, 1890, 1706, 38, 1890, 50107, 1890, 6029, 1890, 51, 1162, 6029, 1890, 38, 6823, 14903, 51, 25388, 22254, 5049, 1890, 1706, 2819...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_list_attempts_for_endpoint_query_parameters_validation() { let q: ListAttemptsForEndpointQueryParameters = serde_json::from_value(json!({ "channel": INVALID_CHANNEL })).unwrap(); assert!(q.validate().is_err()); let q: ListAttemptsForEndpointQueryParameters = serde_json::from_value(json!({ "channel": VALID_CHANNEL })).unwrap(); q.validate().unwrap(); }
rust_cleaned_test_functions.jsonl/64494
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 190 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2019, 79490, 5478, 36699, 5738, 18263, 19416, 368, 341, 286, 1077, 2804, 25, 1759, 81517, 2461, 27380, 2859, 9706, 4035, 310, 61570, 9455, 486, 1499, 3142, 9304, 0, 2306, 330, 10119, 788, 32269, 2...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_file_reader_iter_projection_err() { let schema = " message spark_schema { REQUIRED INT32 key; REQUIRED BOOLEAN value; } "; let proj = parse_message_type(&schema).ok(); let path = get_test_path("nested_maps.snappy.parquet"); let reader = SerializedFileReader::try_from(path.as_path()).unwrap(); let res = RowIter::from_file_into(Box::new(reader)).project(proj); assert!(res.is_err()); assert_eq!( res.err().unwrap(), general_err!("Root schema does not contain projection") ); }
rust_cleaned_test_functions.jsonl/69597
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 294 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2458, 22306, 11723, 72738, 9266, 368, 341, 286, 1077, 10802, 284, 6228, 414, 1943, 15186, 25371, 341, 286, 66577, 9221, 18, 17, 1376, 280, 286, 66577, 59393, 897, 280, 414, 456, 262, 7620, 286, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_sum_two_singles() { assert_eq!(sum_two_singles(1.111111, 1.111111), 2.222222); }
rust_cleaned_test_functions.jsonl/123618
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 65 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 10160, 23241, 643, 49603, 368, 972, 286, 2060, 10714, 10297, 1242, 23241, 643, 49603, 7, 16, 13, 16, 16, 16, 16, 16, 16, 11, 220, 16, 13, 16, 16, 16, 16, 16, 16, 701, 220, 17, 13, 17, 17...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_reserve() { let mut map = TypedHandleMap::<u32>::with_capacity(10); let cap0 = map.capacity(); map.reserve(cap0 + 10); assert!(map.capacity() >= cap0 + 10); }
rust_cleaned_test_functions.jsonl/15924
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 106 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 89591, 368, 341, 286, 1077, 5206, 2415, 284, 50554, 6999, 2227, 27638, 84, 18, 17, 6831, 4197, 35603, 7, 16, 15, 317, 286, 1077, 2062, 15, 284, 2415, 59168, 543, 286, 2415, 48520, 51386, 15, 4...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_rchunks_next() { let v = [0, 1, 2, 3, 4, 5]; let mut c = v.rchunks(2); assert_eq!(c.next().unwrap(), &[4, 5]); assert_eq!(c.next().unwrap(), &[2, 3]); assert_eq!(c.next().unwrap(), &[0, 1]); assert_eq!(c.next(), None); let v = [0, 1, 2, 3, 4, 5, 6, 7]; let mut c = v.rchunks(3); assert_eq!(c.next().unwrap(), &[5, 6, 7]); assert_eq!(c.next().unwrap(), &[2, 3, 4]); assert_eq!(c.next().unwrap(), &[0, 1]); assert_eq!(c.next(), None); }
rust_cleaned_test_functions.jsonl/9663
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 265 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 1710, 84263, 11257, 368, 341, 262, 1077, 348, 284, 508, 15, 11, 220, 16, 11, 220, 17, 11, 220, 18, 11, 220, 19, 11, 220, 20, 935, 262, 1077, 5206, 272, 284, 348, 1746, 84263, 7, 17, 317, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_sha_file_existing() { let mut wiki = Wiki::new(); let input_dir = "tests/example_md/real_md"; assert!(wiki.read_from_directory(input_dir).is_ok()); assert!(wiki.read_content_from_current_paths(input_dir, "html2").is_ok()); let sha_file = Path::new("html2").join(".files.sha"); assert!(sha_file.exists()); assert!(wiki.read_content_from_current_paths(input_dir, "html2").is_ok()); }
rust_cleaned_test_functions.jsonl/117359
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 180 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 48836, 2458, 62630, 368, 341, 262, 1077, 5206, 28609, 284, 29228, 486, 931, 543, 262, 1077, 1946, 4334, 284, 330, 23841, 65182, 32994, 14, 7951, 32994, 876, 262, 2060, 10297, 29707, 4125, 5673, 14...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_deactivate_device() { let mut d = TestDevices::default(); let core_a = MockDeviceId(1); let a = d.add_active_device(core_a, 10).unwrap(); let b = d.add_device(20); assert_eq!(d.deactivate_device(b).unwrap_err(), ToggleError::NoChange); assert_eq!(d.deactivate_device(1000).unwrap_err(), ToggleError::NotFound); let (core, info) = d.deactivate_device(a).unwrap(); assert_eq!(core, core_a); assert_eq!(info.info, 10); assert!(info.core_id.is_none()); // both a and b should be inactive now: assert!(d.active_devices.is_empty()); assert!(d.id_map.is_empty()); }
rust_cleaned_test_functions.jsonl/19848
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 321 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2259, 16856, 9204, 368, 341, 286, 1077, 5206, 294, 284, 3393, 40835, 486, 2258, 543, 286, 1077, 6200, 4306, 284, 14563, 6985, 764, 7, 16, 317, 286, 1077, 264, 284, 294, 1364, 12930, 9204, 47867,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_decode_enum() { let value: Animal = super::decode("\"Dog\"").unwrap(); assert_eq!(value, Dog); let s = "{\"variant\":\"Frog\",\"fields\":[\"Henry\",349]}"; let value: Animal = super::decode(s).unwrap(); assert_eq!(value, Frog("Henry".into_string(), 349)); }
rust_cleaned_test_functions.jsonl/6556
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 145 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 15227, 31054, 368, 341, 286, 1077, 897, 25, 21292, 284, 2256, 486, 18196, 38915, 48940, 2105, 1827, 15454, 543, 286, 2060, 10714, 10297, 957, 11, 14254, 626, 286, 1077, 274, 284, 54734, 15969, 234...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_doc_to_opstamp_mapping_none() { let doc_to_opstamp_mapping = DocToOpstampMapping::None; assert!(doc_to_opstamp_mapping.is_deleted(1u32, 0u64)); assert!(doc_to_opstamp_mapping.is_deleted(1u32, 2u64)); }
rust_cleaned_test_functions.jsonl/53519
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 133 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 18869, 2346, 10287, 49113, 26930, 31488, 368, 341, 286, 1077, 4629, 2346, 10287, 49113, 26930, 284, 21709, 1249, 7125, 49113, 6807, 486, 4064, 280, 286, 2060, 10297, 5236, 2346, 10287, 49113, 26930, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_boolean_and() { let variants = [ OperandType::True, OperandType::False, OperandType::AllocatedTrue, OperandType::AllocatedFalse, OperandType::NegatedAllocatedTrue, OperandType::NegatedAllocatedFalse ]; for first_operand in variants.iter().cloned() { for second_operand in variants.iter().cloned() { let mut cs = TrivialAssembly::<Bn256, PlonkCsWidth4WithNextStepParams, Width4MainGateWithDNext>::new(); let a; let b; { let mut dyn_construct = |operand, name| { match operand { OperandType::True => Boolean::constant(true), OperandType::False => Boolean::constant(false), OperandType::AllocatedTrue => Boolean::from(AllocatedBit::alloc(&mut cs, Some(true)).unwrap()), OperandType::AllocatedFalse => Boolean::from(AllocatedBit::alloc(&mut cs, Some(false)).unwrap()), OperandType::NegatedAllocatedTrue => Boolean::from(AllocatedBit::alloc(&mut cs, Some(true)).unwrap()).not(), OperandType::NegatedAllocatedFalse => Boolean::from(AllocatedBit::alloc(&mut cs, Some(false)).unwrap()).not(), } }; a = dyn_construct(first_operand, "a"); b = dyn_construct(second_operand, "b"); } let c = Boolean::and(&mut cs, &a, &b).unwrap(); assert!(cs.is_satisfied()); match (first_operand, second_operand, c) { (OperandType::True, OperandType::True, Boolean::Constant(true)) => {}, (OperandType::True, OperandType::False, Boolean::Constant(false)) => {}, (OperandType::True, OperandType::AllocatedTrue, Boolean::Is(_)) => {}, (OperandType::True, OperandType::AllocatedFalse, Boolean::Is(_)) => {}, (OperandType::True, OperandType::NegatedAllocatedTrue, Boolean::Not(_)) => {}, (OperandType::True, OperandType::NegatedAllocatedFalse, Boolean::Not(_)) => {}, (OperandType::False, OperandType::True, Boolean::Constant(false)) => {}, (OperandType::False, OperandType::False, Boolean::Constant(false)) => {}, (OperandType::False, OperandType::AllocatedTrue, Boolean::Constant(false)) => {}, (OperandType::False, OperandType::AllocatedFalse, Boolean::Constant(false)) => {}, (OperandType::False, OperandType::NegatedAllocatedTrue, Boolean::Constant(false)) => {}, (OperandType::False, OperandType::NegatedAllocatedFalse, Boolean::Constant(false)) => {}, (OperandType::AllocatedTrue, OperandType::True, Boolean::Is(_)) => {}, (OperandType::AllocatedTrue, OperandType::False, Boolean::Constant(false)) => {}, (OperandType::AllocatedTrue, OperandType::AllocatedTrue, Boolean::Is(ref v)) => { assert_eq!(v.value, Some(true)); }, (OperandType::AllocatedTrue, OperandType::AllocatedFalse, Boolean::Is(ref v)) => { assert_eq!(v.value, Some(false)); }, (OperandType::AllocatedTrue, OperandType::NegatedAllocatedTrue, Boolean::Is(ref v)) => { assert_eq!(v.value, Some(false)); }, (OperandType::AllocatedTrue, OperandType::NegatedAllocatedFalse, Boolean::Is(ref v)) => { assert_eq!(v.value, Some(true)); }, (OperandType::AllocatedFalse, OperandType::True, Boolean::Is(_)) => {}, (OperandType::AllocatedFalse, OperandType::False, Boolean::Constant(false)) => {}, (OperandType::AllocatedFalse, OperandType::AllocatedTrue, Boolean::Is(ref v)) => { assert_eq!(v.value, Some(false)); }, (OperandType::AllocatedFalse, OperandType::AllocatedFalse, Boolean::Is(ref v)) => { assert_eq!(v.value, Some(false)); }, (OperandType::AllocatedFalse, OperandType::NegatedAllocatedTrue, Boolean::Is(ref v)) => { assert_eq!(v.value, Some(false)); }, (OperandType::AllocatedFalse, OperandType::NegatedAllocatedFalse, Boolean::Is(ref v)) => { assert_eq!(v.value, Some(false)); }, (OperandType::NegatedAllocatedTrue, OperandType::True, Boolean::Not(_)) => {}, (OperandType::NegatedAllocatedTrue, OperandType::False, Boolean::Constant(false)) => {}, (OperandType::NegatedAllocatedTrue, OperandType::AllocatedTrue, Boolean::Is(ref v)) => { assert_eq!(v.value, Some(false)); }, (OperandType::NegatedAllocatedTrue, OperandType::AllocatedFalse, Boolean::Is(ref v)) => { assert_eq!(v.value, Some(false)); }, (OperandType::NegatedAllocatedTrue, OperandType::NegatedAllocatedTrue, Boolean::Is(ref v)) => { assert_eq!(v.value, Some(false)); }, (OperandType::NegatedAllocatedTrue, OperandType::NegatedAllocatedFalse, Boolean::Is(ref v)) => { assert_eq!(v.value, Some(false)); }, (OperandType::NegatedAllocatedFalse, OperandType::True, Boolean::Not(_)) => {}, (OperandType::NegatedAllocatedFalse, OperandType::False, Boolean::Constant(false)) => {}, (OperandType::NegatedAllocatedFalse, OperandType::AllocatedTrue, Boolean::Is(ref v)) => { assert_eq!(v.value, Some(true)); }, (OperandType::NegatedAllocatedFalse, OperandType::AllocatedFalse, Boolean::Is(ref v)) => { assert_eq!(v.value, Some(false)); }, (OperandType::NegatedAllocatedFalse, OperandType::NegatedAllocatedTrue, Boolean::Is(ref v)) => { assert_eq!(v.value, Some(false)); }, (OperandType::NegatedAllocatedFalse, OperandType::NegatedAllocatedFalse, Boolean::Is(ref v)) => { assert_eq!(v.value, Some(true)); }, _ => { panic!("unexpected behavior at {:?} AND {:?}", first_operand, second_operand); } } } } }
rust_cleaned_test_functions.jsonl/10418
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 3644 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 46642, 8378, 368, 341, 286, 1077, 26012, 284, 2278, 310, 61085, 929, 486, 2514, 345, 310, 61085, 929, 486, 4049, 345, 310, 61085, 929, 486, 25154, 657, 2514, 345, 310, 61085, 929, 486, 25154, 65...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
5
#[test] fn test_parse_module_jsx_import_source() { let specifier = ModuleSpecifier::parse("file:///a/test01.tsx").unwrap(); let result = parse_module( &specifier, None, Arc::new( r#" /** @jsxImportSource https://example.com/preact */ export function A() { return <div>Hello Deno</div>; } "# .to_string(), ), None, None, ); assert!(result.is_ok()); let actual = result.unwrap(); assert_eq!(actual.dependencies.len(), 1); let dep = actual .dependencies .get("https://example.com/preact/jsx-runtime") .unwrap(); assert!(dep.maybe_code.is_some()); let code_dep = dep.maybe_code.clone().unwrap(); assert!(code_dep.is_ok()); let (dep_specifier, _) = code_dep.unwrap(); assert_eq!( dep_specifier, ModuleSpecifier::parse("https://example.com/preact/jsx-runtime").unwrap() ); assert!(dep.maybe_type.is_none()); assert_eq!(actual.specifier, specifier); assert_eq!(actual.media_type, MediaType::Tsx); }
rust_cleaned_test_functions.jsonl/94373
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 478 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21039, 10750, 26250, 87, 18434, 10347, 368, 341, 262, 1077, 97616, 284, 13711, 87297, 486, 6400, 445, 1192, 60896, 64, 12697, 15, 16, 21288, 87, 1827, 15454, 543, 262, 1077, 1102, 284, 4715, 10750...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_serialize_deserialize_regexp() { let _guard = LOCK.run_concurrently(); let src = Bson::RegularExpression(Regex { pattern: "1".to_owned(), options: "2".to_owned(), }); let dst = vec![14, 0, 0, 0, 11, 107, 101, 121, 0, 49, 0, 50, 0, 0]; let doc = doc! { "key": src }; let mut buf = Vec::new(); doc.to_writer(&mut buf).unwrap(); assert_eq!(buf, dst); let deserialized = Document::from_reader(&mut Cursor::new(buf)).unwrap(); assert_eq!(deserialized, doc); }
rust_cleaned_test_functions.jsonl/49144
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 235 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 88686, 15768, 9050, 4920, 4580, 368, 341, 262, 1077, 716, 26098, 284, 49463, 7634, 3382, 58202, 543, 262, 1077, 2286, 284, 425, 930, 486, 90402, 7, 32464, 341, 286, 5383, 25, 330, 16, 3263, 983,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_custom_pattern() -> Result<(), Box<dyn std::error::Error>> { let mut cmd = Command::cargo_bin("maxtract")?; cmd.arg(common::get_uri()).arg("--regex").arg("child_\\d+"); let expected = "file:///home/josh/CLionProjects/maxtract/tests/pages/child_00.html ├─ child_00 ├─ child_10 file:///home/josh/CLionProjects/maxtract/tests/pages/child_01.html ├─ child_01 file:///home/josh/CLionProjects/maxtract/tests/pages/child_10.html ├─ child_10 file:///home/josh/CLionProjects/maxtract/tests/pages/index.html ├─ child_00 ├─ child_01\n"; cmd.assert() .success() .stdout(predicate::str::similar(expected)); Ok(()) }
rust_cleaned_test_functions.jsonl/67453
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 290 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 15875, 21260, 368, 1464, 5714, 68843, 8261, 92846, 1460, 486, 841, 486, 1454, 2452, 341, 262, 1077, 5206, 5439, 284, 7348, 486, 66715, 21816, 445, 2810, 2144, 899, 69493, 262, 5439, 21186, 57802, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_build_upload_policy_with_normal_storage() -> Result<(), Box<dyn Error>> { let policy = UploadPolicyBuilder::new_policy_for_bucket("test_bucket", &Config::default()) .normal_storage() .build(); assert_eq!(policy.is_normal_storage_used(), true); assert_eq!(policy.is_infrequent_storage_used(), false); let v: Value = serde_json::from_str(policy.as_json().as_str())?; assert_eq!(v["fileType"], json!(null)); Ok(()) }
rust_cleaned_test_functions.jsonl/2354
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 227 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 20801, 21691, 22773, 6615, 13973, 23310, 368, 1464, 5714, 68843, 8261, 92846, 4600, 2452, 341, 286, 1077, 4842, 284, 24996, 13825, 3297, 486, 931, 22773, 5478, 38749, 445, 1944, 38749, 497, 609, 264...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_get_oldest_ancestor() { // smt0 - smt00 - smt000 - smt0000 - smt00000 // |\ smt001 - smt0010 - smt00100 // | smt0011 - smt00110 // | smt00111 // smt002 let smt0 = SparseMerkleTree::new(LEAF.hash()); let smt00 = update(&smt0); let smt000 = update(&smt00); let smt0000 = update(&smt000); let smt00000 = update(&smt0000); let smt001 = update(&smt00); let smt0010 = update(&smt001); let smt00100 = update(&smt0010); let smt0011 = update(&smt001); let smt00110 = update(&smt0011); let smt00111 = update(&smt0011); let smt002 = update(&smt00); assert_eq_pointee(&smt0.get_oldest_ancestor(), &smt0); assert_eq_pointee(&smt00.get_oldest_ancestor(), &smt0); assert_eq_pointee(&smt000.get_oldest_ancestor(), &smt0); assert_eq_pointee(&smt0000.get_oldest_ancestor(), &smt0); assert_eq_pointee(&smt00000.get_oldest_ancestor(), &smt0); assert_eq_pointee(&smt001.get_oldest_ancestor(), &smt0); assert_eq_pointee(&smt0010.get_oldest_ancestor(), &smt0); assert_eq_pointee(&smt00100.get_oldest_ancestor(), &smt0); assert_eq_pointee(&smt0011.get_oldest_ancestor(), &smt0); assert_eq_pointee(&smt00110.get_oldest_ancestor(), &smt0); assert_eq_pointee(&smt00111.get_oldest_ancestor(), &smt0); assert_eq_pointee(&smt002.get_oldest_ancestor(), &smt0); drop(smt0); assert_eq_pointee(&smt00.get_oldest_ancestor(), &smt00); assert_eq_pointee(&smt000.get_oldest_ancestor(), &smt00); assert_eq_pointee(&smt0000.get_oldest_ancestor(), &smt00); assert_eq_pointee(&smt00000.get_oldest_ancestor(), &smt00); assert_eq_pointee(&smt001.get_oldest_ancestor(), &smt00); assert_eq_pointee(&smt0010.get_oldest_ancestor(), &smt00); assert_eq_pointee(&smt00100.get_oldest_ancestor(), &smt00); assert_eq_pointee(&smt0011.get_oldest_ancestor(), &smt00); assert_eq_pointee(&smt00110.get_oldest_ancestor(), &smt00); assert_eq_pointee(&smt00111.get_oldest_ancestor(), &smt00); assert_eq_pointee(&smt002.get_oldest_ancestor(), &smt00); drop(smt00); assert_eq_pointee(&smt000.get_oldest_ancestor(), &smt000); assert_eq_pointee(&smt0000.get_oldest_ancestor(), &smt000); assert_eq_pointee(&smt00000.get_oldest_ancestor(), &smt000); assert_eq_pointee(&smt001.get_oldest_ancestor(), &smt001); assert_eq_pointee(&smt0010.get_oldest_ancestor(), &smt001); assert_eq_pointee(&smt00100.get_oldest_ancestor(), &smt001); assert_eq_pointee(&smt0011.get_oldest_ancestor(), &smt001); assert_eq_pointee(&smt00110.get_oldest_ancestor(), &smt001); assert_eq_pointee(&smt00111.get_oldest_ancestor(), &smt001); assert_eq_pointee(&smt002.get_oldest_ancestor(), &smt002); drop(smt001); assert_eq_pointee(&smt000.get_oldest_ancestor(), &smt000); assert_eq_pointee(&smt0000.get_oldest_ancestor(), &smt000); assert_eq_pointee(&smt00000.get_oldest_ancestor(), &smt000); assert_eq_pointee(&smt0010.get_oldest_ancestor(), &smt0010); assert_eq_pointee(&smt00100.get_oldest_ancestor(), &smt0010); assert_eq_pointee(&smt0011.get_oldest_ancestor(), &smt0011); assert_eq_pointee(&smt00110.get_oldest_ancestor(), &smt0011); assert_eq_pointee(&smt00111.get_oldest_ancestor(), &smt0011); assert_eq_pointee(&smt002.get_oldest_ancestor(), &smt002); drop(smt000); assert_eq_pointee(&smt0000.get_oldest_ancestor(), &smt0000); assert_eq_pointee(&smt00000.get_oldest_ancestor(), &smt0000); drop(smt0000); assert_eq_pointee(&smt00000.get_oldest_ancestor(), &smt00000); drop(smt0010); assert_eq_pointee(&smt00100.get_oldest_ancestor(), &smt00100); drop(smt0011); assert_eq_pointee(&smt00110.get_oldest_ancestor(), &smt00110); assert_eq_pointee(&smt00111.get_oldest_ancestor(), &smt00111); }
rust_cleaned_test_functions.jsonl/63261
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1886 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 3062, 62, 337, 4979, 62, 66878, 368, 341, 262, 442, 1525, 83, 15, 481, 1525, 83, 15, 15, 481, 1525, 83, 15, 15, 15, 481, 1525, 83, 15, 15, 15, 15, 481, 1525, 83, 15, 15, 15, 15, 15, 72...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_device() { let ua_parser = UserAgentParser::from_path("uap-core/regexes.yaml").unwrap(); let yaml = fs::read_to_string("uap-core/tests/test_device.yaml").unwrap(); let yamls = YamlLoader::load_from_str(&yaml).unwrap(); let yaml = &yamls[0]; let test_cases = yaml .as_hash() .unwrap() .get(&Yaml::String("test_cases".to_string())) .unwrap() .as_vec() .unwrap(); let yaml_user_agent_string = Yaml::String("user_agent_string".to_string()); let yaml_family = Yaml::String("family".to_string()); let yaml_brand = Yaml::String("brand".to_string()); let yaml_model = Yaml::String("model".to_string()); for test_case in test_cases { let test_case = test_case.as_hash().unwrap(); let user_agent = test_case.get(&yaml_user_agent_string).unwrap().as_str().unwrap(); let name = test_case.get(&yaml_family).unwrap().as_str().map(Cow::from); let brand = test_case.get(&yaml_brand).unwrap().as_str().map(Cow::from); let model = test_case.get(&yaml_model).unwrap().as_str().map(Cow::from); let device = ua_parser.parse_device(user_agent); assert_eq!(name, device.name); assert_eq!(brand, device.brand); assert_eq!(model, device.model); } }
rust_cleaned_test_functions.jsonl/111012
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 581 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 9204, 368, 341, 262, 1077, 45559, 18517, 284, 2657, 16810, 6570, 486, 1499, 2638, 445, 84, 391, 23460, 14, 26387, 288, 33406, 1827, 15454, 1428, 262, 1077, 32246, 284, 8619, 486, 878, 2346, 3904, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_encode_decode_tsig() { test_encode_decode(TSIG::new( TsigAlgorithm::HmacSha256, 0, 300, vec![0, 1, 2, 3], 0, 0, vec![4, 5, 6, 7], )); test_encode_decode(TSIG::new( TsigAlgorithm::HmacSha384, 123456789, 60, vec![9, 8, 7, 6, 5, 4], 1, 2, vec![], )); test_encode_decode(TSIG::new( TsigAlgorithm::Unknown(Name::from_ascii("unkown_algorithm").unwrap()), 123456789, 60, vec![], 1, 2, vec![0, 1, 2, 3, 4, 5, 6], )); }
rust_cleaned_test_functions.jsonl/60097
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 510 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 11224, 15227, 528, 21339, 368, 341, 286, 1273, 11224, 15227, 4140, 50631, 486, 931, 1006, 310, 350, 21339, 27847, 486, 39, 11948, 62316, 17, 20, 21, 345, 310, 220, 15, 345, 310, 220, 18, 15, 1...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_parse_constraint_two_ident() { let mut p = Parser::new(r#"A: Addable + Subtractable"#); let parsed = p.parse_constraints(); let loc = Locator::new(&p.source[..]); assert_eq!( parsed, vec![TypeConstraint { base: BaseNode { location: loc.get(1, 1, 1, 26), ..BaseNode::default() }, tvar: Identifier { base: BaseNode { location: loc.get(1, 1, 1, 2), ..BaseNode::default() }, name: "A".to_string(), }, kinds: vec![ Identifier { base: BaseNode { location: loc.get(1, 4, 1, 11), ..BaseNode::default() }, name: "Addable".to_string(), }, Identifier { base: BaseNode { location: loc.get(1, 14, 1, 26), ..BaseNode::default() }, name: "Subtractable".to_string(), } ] }], ) }
rust_cleaned_test_functions.jsonl/67834
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 766 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21039, 46973, 23241, 38399, 368, 341, 262, 1077, 5206, 281, 284, 21102, 486, 931, 2601, 55543, 32, 25, 2691, 480, 488, 93210, 480, 57676, 317, 262, 1077, 15676, 284, 281, 4632, 60267, 543, 262, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_yaw_only() { let (yaw, pitch) = yaw_and_pitch_from_vector(&Vector3::new(1.0, 0.0, 0.0)); assert_relative_eq!(yaw, f32::pi() / 2.0); assert_relative_eq!(pitch, 0.0); let (yaw, pitch) = yaw_and_pitch_from_vector(&Vector3::new(-1.0, 0.0, 0.0)); assert_relative_eq!(yaw, -f32::pi() / 2.0); assert_relative_eq!(pitch, 0.0); }
rust_cleaned_test_functions.jsonl/106182
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 216 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 80183, 18410, 368, 341, 286, 1077, 320, 98586, 11, 9649, 8, 284, 45672, 8378, 51959, 5673, 12247, 2099, 3781, 18, 486, 931, 7, 16, 13, 15, 11, 220, 15, 13, 15, 11, 220, 15, 13, 15, 1106, 2...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_affine_group() { let mut rng = test_rng(); let a: EdwardsAffine = rng.gen(); let b: EdwardsAffine = rng.gen(); for _i in 0..100 { group_test::<EdwardsAffine>(a, b); } }
rust_cleaned_test_functions.jsonl/10054
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 107 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 48914, 482, 6288, 368, 341, 262, 1077, 5206, 28422, 284, 1273, 66849, 543, 262, 1077, 264, 25, 36763, 25841, 482, 284, 28422, 22822, 543, 262, 1077, 293, 25, 36763, 25841, 482, 284, 28422, 22822, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_decode_ok_packet() { const DATA: &[u8] = b"\x00\x00\x00\x02@\x00\x00"; let p = OkPacket::decode(DATA.into()).unwrap(); assert_eq!(p.affected_rows, 0); assert_eq!(p.last_insert_id, 0); assert_eq!(p.warnings, 0); assert!(p.status.contains(Status::SERVER_STATUS_AUTOCOMMIT)); assert!(p.status.contains(Status::SERVER_SESSION_STATE_CHANGED)); }
rust_cleaned_test_functions.jsonl/99058
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 189 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 15227, 19817, 21078, 368, 341, 262, 733, 14112, 25, 44590, 84, 23, 60, 284, 293, 11934, 87, 15, 15, 3462, 15, 15, 3462, 15, 15, 3462, 15, 17, 66339, 87, 15, 15, 3462, 15, 15, 3302, 262, 10...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_pubkey_from_slice_bad_context() { let s = Secp256k1::without_caps(); let sk = SecretKey::new(&mut thread_rng()); assert_eq!(PublicKey::from_secret_key(&s, &sk), Err(IncapableContext)); let s = Secp256k1::with_caps(ContextFlag::VerifyOnly); assert_eq!(PublicKey::from_secret_key(&s, &sk), Err(IncapableContext)); let s = Secp256k1::with_caps(ContextFlag::SignOnly); assert!(PublicKey::from_secret_key(&s, &sk).is_ok()); let s = Secp256k1::with_caps(ContextFlag::Full); assert!(PublicKey::from_secret_key(&s, &sk).is_ok()); }
rust_cleaned_test_functions.jsonl/41394
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 281 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 34014, 792, 5673, 26488, 34199, 8467, 368, 341, 286, 1077, 274, 284, 4520, 79, 17, 20, 21, 74, 16, 486, 28996, 52955, 543, 286, 1077, 1901, 284, 8599, 1592, 486, 931, 2099, 6984, 4516, 66849, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_fold_useless_do_1() { test("do { foo() } while(false);", "foo()"); test("do { foo() } while(void 0);", "foo()"); test("do { foo() } while(undefined);", "foo()"); test("do { foo() } while(true);", "for(;;) foo();"); test("do { var a = 0; } while(false);", "var a=0"); }
rust_cleaned_test_functions.jsonl/378
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 137 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 61187, 15951, 1717, 26309, 62, 16, 368, 341, 262, 1273, 445, 2982, 314, 15229, 368, 335, 1393, 3576, 1215, 497, 330, 7975, 45961, 262, 1273, 445, 2982, 314, 15229, 368, 335, 1393, 4333, 220, 15,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_crc32() { if is_x86_feature_detected!("sse4.2") { unsafe { let result = crc32_hash(b"hello", 123); assert_eq!(result, 2927487359); let result = crc32_hash(b"helloworld", 123); assert_eq!(result, 314229527); let result = crc32_hash(b"helloworldparquet", 123); assert_eq!(result, 667078870); } } }
rust_cleaned_test_functions.jsonl/3347
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 270 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 59084, 18, 17, 368, 341, 286, 421, 374, 3212, 23, 21, 17069, 98876, 17223, 64513, 19, 13, 17, 899, 341, 310, 19860, 341, 394, 1077, 1102, 284, 37180, 18, 17, 8950, 1883, 1, 14990, 497, 220, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_pull_request_opened() { let mut test = new_test(); test.handler.event = "pull_request".into(); test.handler.action = "opened".into(); test.handler.data.pull_request = some_pr(); test.handler.data.sender = User::new("the-pr-owner"); test.github.mock_get_pull_request_commits( "some-user", "some-repo", 32, Ok(some_commits()), ); let attach = vec![ SlackAttachmentBuilder::new("") .title("Pull Request #32: \"The PR\"") .title_link("http://the-pr") .build(), ]; let msg = "Pull Request opened by the.pr.owner"; test.slack.expect(vec![ slack::req( "the-reviews-channel", &format!("{} {}", msg, REPO_MSG), attach.clone() ), ]); let resp = test.handler.handle_event().unwrap(); assert_eq!((StatusCode::OK, "pr".into()), resp); }
rust_cleaned_test_functions.jsonl/89638
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 444 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 65693, 7893, 11311, 291, 368, 341, 262, 1077, 5206, 1273, 284, 501, 4452, 543, 262, 1273, 31171, 5773, 284, 330, 23441, 7893, 3263, 18122, 543, 262, 1273, 31171, 12395, 284, 330, 56128, 3263, 1812...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_skipmap_iterator() { let skm = make_skipmap(); let mut i = 0; for (k, v) in LdbIteratorIter::wrap(&mut skm.iter()) { assert!(!k.is_empty()); assert!(!v.is_empty()); i += 1; } assert_eq!(i, 26); }
rust_cleaned_test_functions.jsonl/89157
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 171 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 44830, 2186, 13491, 368, 341, 286, 1077, 1901, 76, 284, 1281, 44830, 2186, 543, 286, 1077, 5206, 600, 284, 220, 15, 401, 286, 369, 320, 74, 11, 348, 8, 304, 444, 1999, 11951, 8537, 486, 10097,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_calculate_code_for_row_and_column() { assert_eq!(FIRST_CODE, calculate_code_for_row_and_column(1, 1)); assert_eq!(31_916_031, calculate_code_for_row_and_column(2, 1)); assert_eq!(18_749_137, calculate_code_for_row_and_column(1, 2)); assert_eq!(16_080_970, calculate_code_for_row_and_column(3, 1)); assert_eq!(21_629_792, calculate_code_for_row_and_column(2, 2)); assert_eq!(17_289_845, calculate_code_for_row_and_column(1, 3)); }
rust_cleaned_test_functions.jsonl/64658
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 246 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 24005, 11207, 4136, 5478, 8530, 8378, 8744, 368, 341, 286, 2060, 10714, 10297, 67792, 10020, 11, 11047, 4136, 5478, 8530, 8378, 8744, 7, 16, 11, 220, 16, 1106, 286, 2060, 10714, 10297, 18, 16, 6...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_exchange_code_with_400_status_code() { let body = r#"{"error":"invalid_request","error_description":"Expired code."}"#; let client = new_client(); let token = client .exchange_code(AuthorizationCode::new("ccc".to_string())) .request(mock_http_client( vec![ (ACCEPT, "application/json"), (CONTENT_TYPE, "application/x-www-form-urlencoded"), (AUTHORIZATION, "Basic YWFhOmJiYg=="), ], "grant_type=authorization_code&code=ccc", None, HttpResponse { status_code: StatusCode::BAD_REQUEST, headers: vec![( CONTENT_TYPE, HeaderValue::from_str("application/json").unwrap(), )] .into_iter() .collect(), body: body.to_string().into_bytes(), }, )); assert!(token.is_err()); match token.err().unwrap() { RequestTokenError::ServerResponse(error_response) => { assert_eq!( BasicErrorResponseType::InvalidRequest, *error_response.error() ); assert_eq!( Some(&"Expired code.".to_string()), error_response.error_description() ); assert_eq!(None, error_response.error_uri()); } other => panic!("Unexpected error: {:?}", other), } }
rust_cleaned_test_functions.jsonl/18607
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 794 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 59212, 4136, 6615, 62, 19, 15, 15, 4773, 4136, 368, 341, 262, 1077, 2487, 284, 435, 55543, 4913, 841, 3252, 11808, 7893, 2198, 841, 11448, 3252, 54349, 2038, 1189, 9863, 2, 280, 262, 1077, 2943,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_find_succeeding() { let mut output = String::new(); let method = StringMethod { method: "find", variable: "$FOO", pattern: "\"O\"", selection: Select::All, }; method.handle(&mut output, &VariableExpander); assert_eq!(output, "1"); }
rust_cleaned_test_functions.jsonl/85296
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 182 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21814, 643, 29264, 287, 368, 341, 286, 1077, 5206, 2550, 284, 923, 486, 931, 543, 286, 1077, 1714, 284, 923, 3523, 341, 310, 1714, 25, 262, 330, 3903, 756, 310, 3890, 25, 220, 5201, 3788, 46, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_remove_comments_empty_multiline() { let example: Vec<char> = "/**//* */test".to_string().chars().collect(); let result = remove_comments(&example); let without_comments = chars_to_string(&result.without_comments); assert_eq!(" test", without_comments); assert_eq!(1, result.comments.len()); assert_eq!(1, result.comments[0].position); assert_eq!(" ", chars_to_string(&result.comments[0].text)); }
rust_cleaned_test_functions.jsonl/126904
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 196 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 18193, 30359, 15124, 26290, 26560, 368, 341, 286, 1077, 3110, 25, 11312, 21919, 29, 284, 3521, 334, 21417, 639, 1944, 3263, 983, 3904, 1005, 19255, 1005, 17384, 543, 286, 1077, 1102, 284, 4057, 30...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_1() { #[derive(DeepSizeOf)] struct Example<'a>(&'a u32, &'a u32); let number = &42; let example = Example(number, number); let size = example.deep_size_of(); // Data past references is not counted assert_eq!(size, 2 * size_of::<usize>()); }
rust_cleaned_test_functions.jsonl/9196
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 156 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 62, 16, 368, 341, 286, 11506, 27098, 7, 33464, 1695, 2124, 5563, 286, 2036, 13383, 18291, 64, 44784, 6, 64, 575, 18, 17, 11, 30136, 64, 575, 18, 17, 626, 286, 1077, 1372, 284, 609, 19, 17, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_request() { use helix::*; let req = GetEmoteSetsRequest::builder() .emote_set_id(vec!["301590448".into()]) .build(); // From twitch docs let data = br#" { "data": [ { "id": "304456832", "name": "twitchdevPitchfork", "images": { "url_1x": "https://static-cdn.jtvnw.net/emoticons/v2/304456832/static/light/1.0", "url_2x": "https://static-cdn.jtvnw.net/emoticons/v2/304456832/static/light/2.0", "url_4x": "https://static-cdn.jtvnw.net/emoticons/v2/304456832/static/light/3.0" }, "emote_type": "subscriptions", "emote_set_id": "301590448", "owner_id": "141981764", "format": [ "static" ], "scale": [ "1.0", "2.0", "3.0" ], "theme_mode": [ "light", "dark" ] } ], "template": "https://static-cdn.jtvnw.net/emoticons/v2/{{id}}/{{format}}/{{theme_mode}}/{{scale}}" } "# .to_vec(); let http_response = http::Response::builder().body(data).unwrap(); let uri = req.get_uri().unwrap(); assert_eq!( uri.to_string(), "https://api.twitch.tv/helix/chat/emotes/set?emote_set_id=301590448" ); dbg!(GetEmoteSetsRequest::parse_response(Some(req), &uri, http_response).unwrap()); }
rust_cleaned_test_functions.jsonl/55332
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 803 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 7893, 368, 341, 262, 990, 11338, 941, 56162, 262, 1077, 4232, 284, 2126, 2269, 1272, 30175, 1900, 486, 17850, 741, 286, 659, 336, 1272, 2602, 842, 25592, 0, 1183, 18, 15, 16, 20, 24, 15, 19, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_simple_func() { let isa = lookup(triple!("x86_64")) .expect("expect x86 ISA") .as_builder() .finish(Flags::new(builder())); let mut context = Context::for_function(create_function( CallConv::SystemV, Some(StackSlotData::new(StackSlotKind::ExplicitSlot, 64)), )); context.func.collect_frame_layout_info(); context.compile(&*isa).expect("expected compilation"); let mut sink = SimpleUnwindSink(Vec::new(), 0, Vec::new()); emit_fde(&context.func, &*isa, &mut sink); assert_eq!( sink.0, vec![ 20, 0, 0, 0, // CIE len 0, 0, 0, 0, // CIE marker 1, // version 0, // augmentation string 1, // code aligment = 1 120, // data alignment = -8 16, // RA = r16 0x0c, 0x07, 0x08, 0x90, 0x01, 0, 0, 0, 0, 0, 0, // padding 36, 0, 0, 0, // FDE len 28, 0, 0, 0, // CIE offset 0, 0, 0, 0, 0, 0, 0, 0, // addr reloc 16, 0, 0, 0, 0, 0, 0, 0, // function length 0x42, // DW_CFA_advance_loc 2 0x0e, 0x10, // DW_CFA_def_cfa_offset 16 0x86, 0x02, 0x43, // DW_CFA_advance_loc 3 0x0d, 0x06, // DW_CFA_def_cfa_register 0x4a, // DW_CFA_advance_loc 10 0x0c, 0x07, 0x08, 0, 0, 0, 0, // padding 0, 0, 0, 0, // End of FDEs ] ); assert_eq!(sink.1, 24); assert_eq!(sink.2.len(), 1); }
rust_cleaned_test_functions.jsonl/103557
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1068 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 30015, 9596, 368, 341, 286, 1077, 51335, 284, 18615, 7624, 3778, 17223, 87, 23, 21, 62, 21, 19, 5455, 310, 659, 17119, 445, 17119, 856, 23, 21, 84290, 1138, 310, 659, 300, 28532, 741, 310, 659...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_inet_aton() { let cases = vec![ (Datum::Bytes(b"0.0.0.0".to_vec()), Datum::I64(0)), ( Datum::Bytes(b"255.255.255.255".to_vec()), Datum::I64(4294967295), ), (Datum::Bytes(b"127.0.0.1".to_vec()), Datum::I64(2130706433)), ( Datum::Bytes(b"113.14.22.3".to_vec()), Datum::I64(1896748547), ), (Datum::Bytes(b"1".to_vec()), Datum::I64(1)), (Datum::Bytes(b"0.1.2".to_vec()), Datum::I64(65538)), (Datum::Bytes(b"0.1.2.3.4".to_vec()), Datum::Null), (Datum::Bytes(b"0.1.2..3".to_vec()), Datum::Null), (Datum::Bytes(b".0.1.2.3".to_vec()), Datum::Null), (Datum::Bytes(b"0.1.2.3.".to_vec()), Datum::Null), (Datum::Bytes(b"1.-2.3.4".to_vec()), Datum::Null), (Datum::Bytes(b"".to_vec()), Datum::Null), (Datum::Bytes(b"0.0.0.256".to_vec()), Datum::Null), (Datum::Bytes(b"127.0.0,1".to_vec()), Datum::Null), (Datum::Null, Datum::Null), ]; let mut ctx = EvalContext::default(); for (input, exp) in cases { let input = datum_expr(input); let op = scalar_func_expr(ScalarFuncSig::InetAton, &[input]); let op = Expression::build(&mut ctx, op).unwrap(); let got = op.eval(&mut ctx, &[]).unwrap(); assert_eq!(got, exp); } }
rust_cleaned_test_functions.jsonl/75116
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 892 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 1243, 295, 3752, 263, 368, 341, 286, 1077, 5048, 284, 7486, 90515, 310, 320, 68036, 486, 7078, 1883, 1, 15, 13, 15, 13, 15, 13, 15, 3263, 983, 13251, 11858, 68459, 486, 40, 21, 19, 7, 15, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_filter_normal_code() { let s = r#" fn main() { println!("hello, world"); } "#; assert_eq!(s, filter_normal_code(s)); let s_with_line_comment = r#" fn main() { // hello, world println!("hello, world"); } "#; assert_eq!(s, filter_normal_code(s_with_line_comment)); let s_with_block_comment = r#" fn main() { /* hello, world */ println!("hello, world"); } "#; assert_eq!(s, filter_normal_code(s_with_block_comment)); let s_with_multi_line_comment = r#" fn main() { /* hello, * world */ println!("hello, world"); } "#; assert_eq!(s, filter_normal_code(s_with_multi_line_comment)); }
rust_cleaned_test_functions.jsonl/65549
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 339 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 8727, 13973, 4136, 368, 341, 286, 1077, 274, 284, 435, 2, 698, 8822, 1887, 368, 341, 262, 13751, 17223, 14990, 11, 1879, 797, 532, 57676, 280, 286, 2060, 10714, 10297, 82, 11, 4051, 13973, 4136,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_once_reset() { let mut spawner = Spawner::once(5.0.into(), true); spawner.tick(1.0); spawner.reset(); let count = spawner.tick(1.0); assert_eq!(count, 5); }
rust_cleaned_test_functions.jsonl/83393
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 117 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 7630, 18983, 368, 341, 286, 1077, 5206, 978, 67193, 284, 3089, 67193, 486, 13184, 7, 20, 13, 15, 39860, 1507, 830, 317, 286, 978, 67193, 40323, 7, 16, 13, 15, 317, 286, 978, 67193, 13857, 543,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_no_duplicate_thermal_state_update() { // expected thermal state let thermal_load = ThermalLoad(25); let trip_points = vec![ThermalLoad(50)]; let expected_thermal_state = 0; let mut exec = fasync::Executor::new().unwrap(); let node = setup_test_node(); // Setup the actor stream with trip_points: [50] let mut stream = exec .run_singlethreaded(subscribe_actor( node.clone(), fthermal::ActorType::Unspecified, trip_points, )) .unwrap(); // There should already be a "state 0" state change event waiting for us assert_eq!(exec.run_singlethreaded(get_actor_state(&mut stream)), expected_thermal_state); // Tell the ThermalLimiter that thermal load changed to 25 exec.run_singlethreaded(set_thermal_load(&node, thermal_load)); // change events waiting assert!(exec.run_until_stalled(&mut stream.next()).is_pending()); }
rust_cleaned_test_functions.jsonl/76810
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 469 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6536, 70434, 62, 68118, 4387, 8882, 368, 341, 1789, 286, 442, 3601, 28387, 1584, 198, 286, 1077, 28387, 12411, 284, 65626, 5879, 7, 17, 20, 317, 286, 1077, 8411, 12928, 284, 7486, 20703, 1001, 1...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_remove_nested_other() { use crate::protocol::User; let mut event = Annotated::new(Event { user: Annotated::from(User { other: { let mut other = Object::new(); other.insert("foo".to_string(), Value::U64(42).into()); other.insert("bar".to_string(), Value::U64(42).into()); other }, ..Default::default() }), ..Default::default() }); process_value( &mut event, &mut RemoveOtherProcessor, ProcessingState::root(), ) .unwrap(); assert!(get_value!(event.user!).other.is_empty()); }
rust_cleaned_test_functions.jsonl/14152
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 337 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 18193, 66279, 30456, 368, 341, 262, 990, 17717, 486, 17014, 486, 1474, 401, 262, 1077, 5206, 1538, 284, 1527, 87029, 486, 931, 30469, 341, 286, 1196, 25, 1527, 87029, 486, 1499, 13087, 341, 310, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_format_utc_time() { let mut local_options = LocalOptions::default(); let timestamp = 636253000631621; local_options.clock = Clock::UTC; local_options.time_format = "%H:%M:%S %d/%m/%Y".to_string(); let timestamp_utc_formatted = local_options.format_time(timestamp); let timestamp_utc_struct = chrono::NaiveDateTime::parse_from_str( &timestamp_utc_formatted, &local_options.time_format, ) .unwrap(); assert_eq!( timestamp_utc_struct.format(&local_options.time_format).to_string(), timestamp_utc_formatted ); let zero_utc_formatted = local_options.format_time(0); assert_ne!(zero_utc_formatted, timestamp_utc_formatted); }
rust_cleaned_test_functions.jsonl/113589
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 372 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 8955, 84259, 3009, 368, 341, 286, 1077, 5206, 2205, 8743, 284, 8774, 3798, 486, 2258, 543, 286, 1077, 11441, 284, 220, 21, 18, 21, 17, 20, 18, 15, 15, 15, 21, 18, 16, 21, 17, 16, 280, 286,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_origin_point() { assert!((Point::origin().norm() - 1.).abs() <= EPSILON); // The point chosen below is about 66km from the north pole towards the East // origin as far away as possible from the longitudinal edges of large // Cells. (The line of longitude through the chosen point is always 1/3 // or 2/3 of the way across any Cell with longitudinal edges that it let p = Point::from_coords(-0.01, 0.01 * st_to_uv(2. / 3.), 1.); assert!(p.approx_eq(&Point::origin())); // Check that the origin is not too close to either pole. const EARTH_RADIUS_KM: f64 = 6371.01; assert!(Point::origin().0.z.acos() * EARTH_RADIUS_KM > 50.); }
rust_cleaned_test_functions.jsonl/70553
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 322 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 34043, 6085, 368, 341, 286, 2060, 0, 1188, 2609, 486, 8611, 1005, 20011, 368, 481, 220, 16, 35334, 3435, 368, 2651, 40607, 55016, 626, 286, 442, 576, 1459, 11882, 3685, 374, 911, 220, 21, 21, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_type_16() { let ast = check_parse("type rec = {i64 f};"); check_name(ast.get(0),"rec"); assert_eq!(ast.get(1),&Node::IntType(true,64)); check_name(ast.get(2),"f"); assert_eq!(ast.get(3),&Node::RecordType(vec![(Type(1),Name(2))])); }
rust_cleaned_test_functions.jsonl/96546
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 133 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 1819, 62, 16, 21, 368, 341, 262, 1077, 11763, 284, 1779, 21039, 445, 1313, 1395, 284, 314, 72, 21, 19, 282, 11061, 797, 262, 1779, 1269, 52574, 670, 7, 15, 35393, 2758, 797, 262, 2060, 10714, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_domain_parse_empty_message() { const PACKET: [u8; 1] = [0]; let mut bv = BufferViewWrapper(&PACKET[..]); assert_eq!(Domain::parse(&mut bv, None).unwrap_err(), ParseError::UnexpectedZeroCharacter); }
rust_cleaned_test_functions.jsonl/34446
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 111 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 20111, 21039, 15124, 6462, 368, 341, 286, 733, 73205, 25, 508, 84, 23, 26, 220, 16, 60, 284, 508, 15, 935, 286, 1077, 5206, 56937, 284, 10312, 851, 11542, 2099, 17279, 1348, 95874, 2558, 286, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_extension_successful_with_complete_json_response() { use colorful_extension::*; let mock = mock("POST", "/token") .match_header("Accept", "application/json") .match_body("grant_type=authorization_code&code=ccc&client_id=aaa&client_secret=bbb") .with_header("content-type", "application/json") .with_body( "{\"access_token\": \"12/34\", \"token_type\": \"red\", \"scope\": \"read write\", \ \"expires_in\": 3600, \"refresh_token\": \"foobar\", \"shape\": \"round\", \ \"height\": 12}", ) .create(); let client = ColorfulClient::new( ClientId::new("aaa".to_string()), Some(ClientSecret::new("bbb".to_string())), AuthUrl::new(Url::parse("http://example.com/auth").unwrap()), Some(TokenUrl::new( Url::parse(&(SERVER_URL.to_string() + "/token")).unwrap(), )), ).set_auth_type(oauth2::AuthType::RequestBody); let token = client .exchange_code(AuthorizationCode::new("ccc".to_string())) .unwrap(); mock.assert(); assert_eq!("12/34", token.access_token().secret()); assert_eq!(ColorfulTokenType::Red, *token.token_type()); assert_eq!( Some(&vec![ Scope::new("read".to_string()), Scope::new("write".to_string()), ]), token.scopes() ); assert_eq!(3600, token.expires_in().unwrap().as_secs()); assert_eq!("foobar", token.refresh_token().clone().unwrap().secret()); assert_eq!(Some(&"round".to_string()), token.extra_fields().shape()); assert_eq!(12, token.extra_fields().height()); // Ensure that serialization produces an equivalent JSON value. let serialized_json = serde_json::to_string(&token).unwrap(); assert_eq!( "{\"access_token\":\"12/34\",\"token_type\":\"red\",\"expires_in\":3600,\ \"refresh_token\":\"foobar\",\"scope\":\"read write\",\"shape\":\"round\",\"height\":12}" .to_string(), serialized_json ); let deserialized_token = ColorfulTokenResponse::from_json(&serialized_json).unwrap(); assert_eq!(token, deserialized_token); }
rust_cleaned_test_functions.jsonl/12782
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 931 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 31035, 92951, 6615, 27675, 9455, 9655, 368, 341, 262, 990, 33866, 31035, 79304, 262, 1077, 7860, 284, 7860, 445, 2946, 497, 3521, 5839, 1138, 286, 659, 6347, 8757, 445, 16646, 497, 330, 5132, 8931...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_mod_int() { let tests = vec![ (Some(13), Some(11), Some(2)), (Some(-13), Some(11), Some(-2)), (Some(13), Some(-11), Some(2)), (Some(-13), Some(-11), Some(-2)), (Some(33), Some(11), Some(0)), (Some(33), Some(-11), Some(0)), (Some(-33), Some(-11), Some(0)), (Some(-11), None, None), (None, Some(-11), None), (Some(11), Some(0), None), (Some(-11), Some(0), None), (Some(i64::MAX), Some(i64::MIN), Some(i64::MAX)), (Some(i64::MIN), Some(i64::MAX), Some(-1)), ]; for (lhs, rhs, expected) in tests { let output = RpnFnScalarEvaluator::new() .push_param(lhs) .push_param(rhs) .evaluate(ScalarFuncSig::ModInt) .unwrap(); assert_eq!(output, expected, "lhs={:?}, rhs={:?}", lhs, rhs); } }
rust_cleaned_test_functions.jsonl/78966
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 573 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 7480, 4042, 368, 341, 286, 1077, 7032, 284, 7486, 90515, 310, 320, 8373, 7, 16, 18, 701, 4329, 7, 16, 16, 701, 4329, 7, 17, 6965, 310, 320, 8373, 4080, 16, 18, 701, 4329, 7, 16, 16, 701, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_long_format() { let login = "root"; let pw: Passwd = Passwd::locate(login).unwrap(); let user_info = pw.user_info.unwrap_or_default(); let user_dir = pw.user_dir.unwrap_or_default(); let user_shell = pw.user_shell.unwrap_or_default(); let real_name = user_info.replace('&', &pw.name.capitalize()); let ts = TestScenario::new(util_name!()); ts.ucmd().arg("-l").arg(login).succeeds().stdout_is(format!( "Login name: {:<28}In real life: {}\nDirectory: {:<29}Shell: {}\n\n", login, real_name, user_dir, user_shell )); ts.ucmd() .arg("-lb") .arg(login) .succeeds() .stdout_is(format!( "Login name: {:<28}In real life: {1}\n\n", login, real_name )); }
rust_cleaned_test_functions.jsonl/85401
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 387 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 17799, 8955, 368, 341, 262, 1077, 5858, 284, 330, 2888, 876, 262, 1077, 26581, 25, 9970, 6377, 284, 9970, 6377, 486, 22401, 31587, 568, 15454, 543, 262, 1077, 1196, 3109, 284, 26581, 3324, 3109, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_compile_not_d() { let compiled = bitwise::compile_not("D".to_string()); assert_eq!(compiled.len(), 1); assert_eq!(compiled[0], 0b01111011); }
rust_cleaned_test_functions.jsonl/100595
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 82 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 74170, 7913, 814, 368, 341, 262, 1077, 19697, 284, 97970, 486, 20433, 7913, 445, 35, 3263, 983, 3904, 5231, 262, 2060, 10714, 10297, 50845, 19406, 1507, 220, 16, 317, 262, 2060, 10714, 10297, 5084...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_prove_pk_prop() { let secret = DlogProverInput::random(); let pk = secret.public_image(); let tree = ErgoTree::try_from(Expr::Const(pk.into())).unwrap(); let message = vec![0u8; 100]; let prover = TestProver { secrets: vec![PrivateInput::DlogProverInput(secret)], }; let res = prover.prove( &tree, &Env::empty(), Rc::new(force_any_val::<Context>()), message.as_slice(), &HintsBag::empty(), ); assert!(res.is_ok()); assert_ne!(res.unwrap().proof, ProofBytes::Empty); }
rust_cleaned_test_functions.jsonl/3883
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 339 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2540, 586, 33321, 21663, 368, 341, 286, 1077, 6234, 284, 422, 839, 1336, 423, 2505, 486, 11463, 543, 286, 1077, 22458, 284, 6234, 37899, 4954, 543, 286, 1077, 4916, 284, 73202, 78, 6533, 486, 15...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_make_absolute_slash_path() { crate::history::clear(); crate::history::append("gemini://typed-hole.org"); let url = "/foo"; let expected_url = Url::parse("gemini://typed-hole.org/foo").unwrap(); let absolute_url = Gemini { source: String::from(url), } .to_absolute_url() .unwrap(); assert_eq!(expected_url, absolute_url); }
rust_cleaned_test_functions.jsonl/49239
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 163 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 28230, 50874, 11886, 988, 2638, 368, 341, 262, 17717, 486, 18844, 486, 7422, 1428, 262, 17717, 486, 18844, 486, 5090, 445, 34103, 6591, 1110, 44181, 86593, 2659, 797, 262, 1077, 2515, 284, 3521, 7...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_deserialize_signature() { let s = r#""hvA+XXFEkHk80pLMeIYjNkWy5Ds2ZckSrvj00NvbyFJQe3H9LuJNnu8JLZ/ffIzChs3HmhwPldO0MSmyJAYpCA""#; let _: Signature = serde_json::from_str(s).unwrap(); }
rust_cleaned_test_functions.jsonl/31930
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 139 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 15768, 9050, 39859, 368, 341, 286, 1077, 274, 284, 435, 2, 3014, 81979, 32, 10, 6148, 11419, 74, 39, 74, 23, 15, 79, 43, 7823, 40, 56, 73, 45, 74, 66907, 20, 66950, 17, 57, 377, 50, 10553,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_update_gc_purged_fork() { let key = Keypair::new(); let mut index = AccountsIndex::<bool>::default(); let mut gc = Vec::new(); index.insert(0, &key.pubkey(), true, &mut gc); assert!(gc.is_empty()); index.insert(1, &key.pubkey(), false, &mut gc); index.insert(2, &key.pubkey(), true, &mut gc); index.insert(3, &key.pubkey(), true, &mut gc); index.add_root(0); index.add_root(1); index.add_root(3); index.insert(4, &key.pubkey(), true, &mut gc); assert_eq!(gc, vec![(0, true), (1, false), (2, true)]); let ancestors = vec![].into_iter().collect(); assert_eq!(index.get(&key.pubkey(), &ancestors), Some((&true, 3))); }
rust_cleaned_test_functions.jsonl/44249
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 373 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 8882, 49423, 620, 324, 3556, 761, 669, 368, 341, 286, 1077, 1376, 284, 6569, 1082, 1310, 486, 931, 543, 286, 1077, 5206, 1922, 284, 40655, 1552, 27638, 2641, 6831, 2258, 543, 286, 1077, 5206, 22...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_divide() { let x = Complex::new(3.0, 4.0); let y = Complex::new(5.0, 6.0); let z: Complex = x.divide(&y); assert_that(39.0 / 61.0, is(close_to(z.get_real(), 1.0e-5))); assert_that(2.0 / 61.0, is(close_to(z.get_imaginary(), 1.0e-5))); }
rust_cleaned_test_functions.jsonl/43839
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 170 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 16237, 577, 368, 341, 286, 1077, 856, 284, 22096, 486, 931, 7, 18, 13, 15, 11, 220, 19, 13, 15, 317, 286, 1077, 379, 284, 22096, 486, 931, 7, 20, 13, 15, 11, 220, 21, 13, 15, 317, 286, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_from_dna_string() { let dna = "ACGTACGT"; let dna_string = DnaString::from_dna_string(dna); let values: Vec<u8> = dna_string.iter().collect(); assert_eq!(dna_string.len, 8); assert_eq!(values, [0, 1, 2, 3, 0, 1, 2, 3]); let dna_cp = dna_string.to_string(); assert_eq!(dna, dna_cp); }
rust_cleaned_test_functions.jsonl/95212
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 197 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 5673, 814, 3376, 3904, 368, 341, 286, 1077, 75334, 284, 330, 1706, 25388, 1706, 25388, 876, 286, 1077, 75334, 3904, 284, 422, 3376, 703, 486, 1499, 814, 3376, 3904, 1500, 3376, 317, 286, 1077, 2...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_rotation_look_at_rh_x_axis() { let direction: Vector3<f64> = Vector3::unit_x(); let up: Vector3<f64> = Vector3::unit_y(); let angle = Degrees(90_f64); let expected = Rotation3::from_angle_y(angle); let result = Rotation3::look_at_rh(&direction, &up); assert!(relative_eq!(result, expected, epsilon = 1e-8)); }
rust_cleaned_test_functions.jsonl/70529
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 180 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 44813, 24271, 3752, 1710, 71, 3212, 23567, 368, 341, 286, 1077, 5106, 25, 4196, 18, 63895, 21, 19, 29, 284, 4196, 18, 486, 3843, 3212, 543, 286, 1077, 705, 25, 4196, 18, 63895, 21, 19, 29, 2...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_subprotocols() { let sub_proto = test_utils::custom_subprotocol(); let super_proto = test_utils::custom_protocol(); assert!(sub_proto.conforms_to(super_proto)); #[cfg(feature = "malloc")] assert_eq!(sub_proto.adopted_protocols()[0], super_proto); }
rust_cleaned_test_functions.jsonl/7129
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 150 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 5228, 85412, 368, 341, 286, 1077, 1186, 37689, 284, 1273, 17309, 486, 9163, 5228, 17014, 543, 286, 1077, 2256, 37689, 284, 1273, 17309, 486, 9163, 34880, 543, 286, 2060, 10297, 1966, 37689, 2862, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_supplies_buy_misc_insufficient() { let mut supplies = Supplies::new(); let reason = supplies.buy_misc(1000).unwrap_err().reason; assert_eq!(BuyErrorType::InsufficientFunds, reason); assert_eq!(700, supplies.money); assert_eq!(0, supplies.misc); }
rust_cleaned_test_functions.jsonl/28670
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 135 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 23723, 7202, 46348, 69350, 34386, 26683, 368, 341, 286, 1077, 5206, 16720, 284, 50252, 486, 931, 543, 286, 1077, 2874, 284, 16720, 63871, 69350, 7, 16, 15, 15, 15, 568, 15454, 9266, 1005, 19895, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_iterator_reverse() { let data = vec![5, 9, 3]; let iterout = vec![3, 5, 9]; let pq = BinaryHeap::from(data); let v: Vec<_> = pq.iter().rev().cloned().collect(); assert_eq!(v, iterout); }
rust_cleaned_test_functions.jsonl/83199
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 107 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 13491, 43277, 368, 341, 262, 1077, 821, 284, 7486, 20703, 20, 11, 220, 24, 11, 220, 18, 935, 262, 1077, 5367, 411, 284, 7486, 20703, 18, 11, 220, 20, 11, 220, 24, 935, 262, 1077, 39639, 284,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_select_from_values() { use crate::values; let expected_sql = "SELECT `vals`.* FROM (VALUES (?,?),(?,?)) AS `vals`"; let values = Table::from(values!((1, 2), (3, 4))).alias("vals"); let query = Select::from_table(values); let (sql, params) = Sqlite::build(query).unwrap(); assert_eq!(expected_sql, sql); assert_eq!( vec![ Value::integer(1), Value::integer(2), Value::integer(3), Value::integer(4), ], params ); }
rust_cleaned_test_functions.jsonl/52900
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 320 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 13051, 5673, 9146, 368, 341, 286, 990, 17717, 486, 3661, 401, 286, 1077, 3601, 18063, 284, 330, 4858, 1565, 25596, 63, 4908, 4295, 320, 46089, 63985, 30, 23547, 12622, 30, 593, 5752, 1565, 25596, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_part1_example1() { let input = r#" COM)B B)C C)D D)E E)F B)G G)H D)I E)J J)K K)L "#; assert_eq!(part1(&to_lines(input)), 42); }
rust_cleaned_test_functions.jsonl/90091
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 112 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 10495, 16, 39304, 16, 368, 341, 286, 1077, 1946, 284, 435, 2, 698, 8696, 8, 33, 198, 33, 8, 34, 198, 34, 8, 35, 198, 35, 8, 36, 198, 36, 8, 37, 198, 33, 8, 38, 198, 38, 8, 39, 198, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_case2() { assert_eq!( Solution::reorder_log_files(vec_string![ "dig1 8 1 5 1", "let1 art can", "dig2 3 6", "let2 own kit dig", "let3 art zero" ]), vec_string![ "let1 art can", "let3 art zero", "let2 own kit dig", "dig1 8 1 5 1", "dig2 3 6" ] ); }
rust_cleaned_test_functions.jsonl/101191
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 341 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 19096, 17, 368, 341, 286, 2060, 10714, 33673, 310, 12478, 486, 265, 1358, 5224, 10931, 25592, 3904, 90515, 394, 330, 44861, 16, 220, 23, 220, 16, 220, 20, 220, 16, 756, 394, 330, 1149, 16, 194...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_index() { let mut map: TreeMap<int, int> = TreeMap::new(); map.insert(1, 2); map.insert(2, 1); map.insert(3, 4); assert_eq!(map[2], 1); }
rust_cleaned_test_functions.jsonl/88299
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 114 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 3560, 368, 341, 286, 1077, 5206, 2415, 25, 76883, 4159, 11, 526, 29, 284, 76883, 486, 931, 1428, 286, 2415, 7030, 7, 16, 11, 220, 17, 317, 286, 2415, 7030, 7, 17, 11, 220, 16, 317, 286, 24...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_pool_compact1() { let cpus = cpu_descriptor_from_socket_size(4, 6); let mut pool = ResourcePool::new(&ResourceDescriptor::new(cpus, Vec::new()), &[]); let rq1 = CpuRequest::Compact(4).into(); let al1 = pool.try_allocate_resources(&rq1, None).unwrap(); assert_eq!(pool.get_sockets(&al1).len(), 1); let al2 = pool.try_allocate_resources(&rq1, None).unwrap(); assert_eq!(pool.get_sockets(&al2).len(), 1); assert_ne!(pool.get_sockets(&al1), pool.get_sockets(&al2)); let rq2 = CpuRequest::Compact(3).into(); let al3 = pool.try_allocate_resources(&rq2, None).unwrap(); assert_eq!(pool.get_sockets(&al3).len(), 1); let al4 = pool.try_allocate_resources(&rq2, None).unwrap(); assert_eq!(pool.get_sockets(&al4).len(), 1); assert_eq!(pool.get_sockets(&al3), pool.get_sockets(&al4)); let rq3 = CpuRequest::Compact(6).into(); let al = pool.try_allocate_resources(&rq3, None).unwrap(); assert_eq!(pool.get_sockets(&al).len(), 1); pool.release_allocation(al); let rq3 = CpuRequest::Compact(7).into(); let al = pool.try_allocate_resources(&rq3, None).unwrap(); assert_eq!(pool.get_sockets(&al).len(), 2); pool.release_allocation(al); let rq3 = CpuRequest::Compact(8).into(); let al = pool.try_allocate_resources(&rq3, None).unwrap(); assert_eq!(pool.get_sockets(&al).len(), 2); pool.release_allocation(al); let rq3 = CpuRequest::Compact(9).into(); let al = pool.try_allocate_resources(&rq3, None).unwrap(); assert_eq!(pool.get_sockets(&al).len(), 3); pool.release_allocation(al); }
rust_cleaned_test_functions.jsonl/92225
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 815 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 15709, 18177, 531, 16, 368, 341, 286, 1077, 12490, 355, 284, 17319, 33774, 5673, 19555, 2368, 7, 19, 11, 220, 21, 317, 286, 1077, 5206, 7314, 284, 11765, 10551, 486, 931, 2099, 4783, 11709, 486,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_options_builder() { let mut tu_options = TUOptionsBuilder::new(); assert_eq!(tu_options.build(), CXTranslationUnit_None); tu_options.detailed_preprocessor_record(); assert_eq!( tu_options.build(), CXTranslationUnit_DetailedPreprocessingRecord ); tu_options.incomplete(); assert_eq!( tu_options.build(), CXTranslationUnit_DetailedPreprocessingRecord | CXTranslationUnit_Incomplete ); tu_options.precompiled_preamble(); assert_eq!( tu_options.build(), CXTranslationUnit_DetailedPreprocessingRecord | CXTranslationUnit_Incomplete | CXTranslationUnit_PrecompiledPreamble ); tu_options .cache_completion_results() .for_serialization() .chained_phc() .skip_function_bodies() .include_brief_comments_in_code_completion(); assert_eq!( tu_options.build(), CXTranslationUnit_DetailedPreprocessingRecord | CXTranslationUnit_Incomplete | CXTranslationUnit_PrecompiledPreamble | CXTranslationUnit_CacheCompletionResults | CXTranslationUnit_ForSerialization | CXTranslationUnit_CXXChainedPCH | CXTranslationUnit_SkipFunctionBodies | CXTranslationUnit_IncludeBriefCommentsInCodeCompletion ); }
rust_cleaned_test_functions.jsonl/111703
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 733 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 8743, 28532, 368, 341, 286, 1077, 5206, 9765, 8743, 284, 69414, 3798, 3297, 486, 931, 543, 286, 2060, 10714, 10297, 24494, 8743, 13239, 1507, 48483, 24412, 4562, 52523, 317, 286, 9765, 8743, 950, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_boolean_array_builder() { // Test building a boolean array with ArrayData builder and offset let buf = Buffer::from([27_u8]); let buf2 = buf.clone(); let data = ArrayData::builder(DataType::Boolean) .len(5) .offset(2) .add_buffer(buf) .build(); let arr = BooleanArray::from(data); assert_eq!(buf2, arr.values()); assert_eq!(5, arr.len()); assert_eq!(2, arr.offset()); assert_eq!(0, arr.null_count()); for i in 0..3 { assert_eq!(i != 0, arr.value(i), "failed at {}", i); } }
rust_cleaned_test_functions.jsonl/11603
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 337 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 46642, 3858, 28532, 368, 341, 286, 442, 3393, 4752, 264, 2710, 1334, 448, 2910, 1043, 7363, 323, 4347, 8945, 286, 1077, 6607, 284, 10312, 486, 1499, 2561, 17, 22, 7300, 23, 2558, 286, 1077, 6607...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_grapheme_cursor_chunk_start_require_precontext() { let s = "\r\n"; let mut c = GraphemeCursor::new(1, s.len(), true); assert_eq!(c.is_boundary(&s[1..], 1), Err(GraphemeIncomplete::PreContext(1))); c.provide_context(&s[..1], 0); assert_eq!(c.is_boundary(&s[1..], 1), Ok(false)); }
rust_cleaned_test_functions.jsonl/121017
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 155 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 14738, 3894, 28601, 30539, 4906, 13793, 10442, 2147, 368, 341, 262, 1077, 274, 284, 2917, 81, 1699, 876, 262, 1077, 5206, 272, 284, 12165, 3894, 14543, 486, 931, 7, 16, 11, 274, 19406, 1507, 830...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_fp2_basics() { assert_eq!(Fp2::new(Fp::zero(), Fp::zero()), Fp2::zero()); assert_eq!(Fp2::new(Fp::one(), Fp::zero()), Fp2::one()); assert!(Fp2::zero().is_zero()); assert!(!Fp2::one().is_zero()); assert!(!Fp2::new(Fp::zero(), Fp::one(),).is_zero()); }
rust_cleaned_test_functions.jsonl/84756
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 174 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 34160, 17, 880, 67981, 368, 341, 286, 2060, 10714, 10297, 37, 79, 17, 486, 931, 7832, 79, 486, 14154, 1507, 434, 79, 486, 14154, 11858, 434, 79, 17, 486, 14154, 1423, 286, 2060, 10714, 10297, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_to_vec() { let xs: Box<_> = Box::new([1, 2, 3]); let ys = xs.to_vec(); assert_eq!(ys, [1, 2, 3]); }
rust_cleaned_test_functions.jsonl/80830
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 76 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2346, 13251, 368, 341, 262, 1077, 11943, 25, 8261, 32399, 29, 284, 8261, 486, 931, 2561, 16, 11, 220, 17, 11, 220, 18, 2558, 262, 1077, 31810, 284, 11943, 2389, 13251, 543, 262, 2060, 10714, 1...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1