text
stringlengths
93
16.4k
id
stringlengths
20
40
metadata
dict
input_ids
listlengths
45
2.05k
attention_mask
listlengths
45
2.05k
complexity
int64
1
9
#[test] fn test_return_pod_by_ref_and_ptr() { let hdr = indoc! {" #include <cstdint> struct B { uint32_t a; }; struct A { B b; }; inline const B& return_b_ref(const A& a) { return a.b; } inline const B* return_b_ptr(const A& a) { return &a.b; } "}; let rs = quote! { let a = ffi::A { b: ffi::B { a: 3 } }; assert_eq!(ffi::return_b_ref(&a).a, 3); let b_ptr = ffi::return_b_ptr(&a); assert_eq!(unsafe { b_ptr.as_ref() }.unwrap().a, 3); }; run_test("", hdr, rs, &["return_b_ref", "return_b_ptr"], &["A", "B"]); }
rust_cleaned_test_functions.jsonl/9737
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 401 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 12511, 85337, 3710, 7793, 8378, 4348, 368, 341, 262, 1077, 36615, 284, 1257, 509, 0, 314, 698, 286, 671, 997, 366, 96975, 397, 286, 2036, 425, 341, 310, 2622, 18, 17, 528, 264, 280, 286, 2605,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_set_controller() { local_test_e(|runtime| async move { let universal_canister = set_up_universal_canister(&runtime).await; universal_canister .set_controller(universal_canister.canister_id().get()) .await .unwrap(); // Can't use "query_": we get "IC0301: Could not find subnet for canister // aaaaa-aa" // The anonymous user is not allowed to do a "canister_status" let res: Result<CanisterStatusResult, String> = runtime .get_management_canister() .update_( ic00::Method::CanisterStatus.to_string(), dfn_candid::candid, (CanisterIdRecord::from(universal_canister.canister_id()),), ) .await; assert_matches!(res, Err(msg) if msg.contains(&ErrorCode::CanisterInvalidController.to_string())); // Now call canister_status from the controller let arg = universal_canister_argument_builder() .call_simple( IC_00, ic00::Method::CanisterStatus.to_string(), CallArgs::default().other_side( Encode!(&CanisterIdRecord::from(universal_canister.canister_id())).unwrap(), ), ) .build(); let status_bytes: Vec<u8> = universal_canister .update_("update", bytes, arg) .await .unwrap(); let status = Decode!(&status_bytes, CanisterStatusResult).unwrap(); assert_eq!(status.controller(), universal_canister.canister_id().get()); Ok(()) }) }
rust_cleaned_test_functions.jsonl/39207
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 797 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2602, 21600, 368, 341, 262, 2205, 4452, 2204, 22428, 22255, 91, 3312, 3271, 341, 286, 1077, 20178, 27421, 1571, 284, 738, 8237, 4907, 33952, 27421, 1571, 2099, 22255, 568, 11421, 401, 286, 20178, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_outer_join() { let (temp, rain) = create_frames(); let joined = temp.outer_join(&rain, "days", "days").unwrap(); println!("{:?}", &joined); assert_eq!(joined.height(), 5); assert_eq!(joined.column("days").unwrap().sum::<i32>(), Some(7)); }
rust_cleaned_test_functions.jsonl/4174
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 142 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 67258, 31017, 368, 341, 286, 1077, 320, 3888, 11, 11174, 8, 284, 1855, 29319, 543, 286, 1077, 10859, 284, 2730, 53719, 31017, 2099, 29093, 11, 330, 13778, 497, 330, 13778, 1827, 15454, 543, 286, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_bpf_to_bpf_scratch_registers() { test_interpreter_and_jit_elf!( "tests/elfs/scratch_registers.so", [1], ( b"log_64" => syscalls::BpfSyscallU64::call; syscalls::BpfSyscallU64 {}, ), { |_vm, res: Result| { res.unwrap() == 112 } }, 41 ); }
rust_cleaned_test_functions.jsonl/59035
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 186 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 880, 15897, 2346, 880, 15897, 59728, 754, 78360, 368, 341, 262, 1273, 15318, 28637, 8378, 5374, 275, 62, 490, 33673, 286, 330, 23841, 14, 490, 82, 14, 54055, 78360, 26476, 756, 286, 508, 16, 125...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_100099() { assert_eq!( get_final_state(parse_opcodes(&String::from("1,0,0,0,99"))), vec![2, 0, 0, 0, 99] ); }
rust_cleaned_test_functions.jsonl/105028
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 108 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 62, 16, 15, 15, 15, 24, 24, 368, 341, 286, 2060, 10714, 33673, 310, 633, 20676, 4387, 27762, 10287, 25814, 2099, 703, 486, 1499, 445, 16, 11, 15, 11, 15, 11, 15, 11, 24, 24, 2761, 1326, 31...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_date_set_permissions_error() { if !(get_effective_uid() == 0 || is_wsl()) { let (_, mut ucmd) = at_and_ucmd!(); let result = ucmd.arg("--set").arg("2020-03-11 21:45:00+08:00").fails(); let result = result.no_stdout(); assert!(result.stderr.starts_with("date: cannot set date: ")); } }
rust_cleaned_test_functions.jsonl/77626
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 164 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 4164, 2602, 44767, 4096, 368, 341, 262, 421, 18208, 455, 27125, 533, 25396, 368, 621, 220, 15, 1369, 374, 1670, 3226, 2140, 341, 286, 1077, 39464, 5206, 575, 8710, 8, 284, 518, 8378, 68887, 2277...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_block() { let keys = KeyPair::random(); let ts = Utc::now(); let txs = [2]; let tx_count = txs.len() as u32; let content = Block { height: Height(500), tx_count, prev_hash: crypto::hash(&[1]), tx_hash: crypto::hash(&txs), state_hash: crypto::hash(&[3]), error_hash: crypto::hash(&[4]), additional_headers: AdditionalHeaders::new(), }; let precommits = vec![ Verified::from_value( Precommit::new( ValidatorId(123), Height(15), Round(25), crypto::hash(&[1, 2, 3]), crypto::hash(&[3, 2, 1]), ts, ), keys.public_key(), keys.secret_key(), ), Verified::from_value( Precommit::new( ValidatorId(13), Height(25), Round(35), crypto::hash(&[4, 2, 3]), crypto::hash(&[3, 3, 1]), ts, ), keys.public_key(), keys.secret_key(), ), Verified::from_value( Precommit::new( ValidatorId(323), Height(15), Round(25), crypto::hash(&[1, 1, 3]), crypto::hash(&[5, 2, 1]), ts, ), keys.public_key(), keys.secret_key(), ), ]; let transactions = [ Verified::from_value( Status::new(Height(2), Height(2), crypto::hash(&[]), 0), keys.public_key(), keys.secret_key(), ), Verified::from_value( Status::new(Height(4), Height(4), crypto::hash(&[2]), 0), keys.public_key(), keys.secret_key(), ), Verified::from_value( Status::new(Height(7), Height(7), crypto::hash(&[3]), 0), keys.public_key(), keys.secret_key(), ), ] .iter() .map(ObjectHash::object_hash) .collect::<Vec<_>>(); let precommits_buf: Vec<_> = precommits.iter().map(BinaryValue::to_bytes).collect(); let block = Verified::from_value( BlockResponse::new( keys.public_key(), content.clone(), precommits_buf.clone(), transactions.iter().cloned(), ), keys.public_key(), keys.secret_key(), ); assert_eq!(block.author(), keys.public_key()); assert_eq!(block.payload().to, keys.public_key()); assert_eq!(block.payload().block, content); assert_eq!(block.payload().precommits, precommits_buf); assert_eq!(block.payload().transactions, transactions); let block2: Verified<BlockResponse> = SignedMessage::from_bytes(block.to_bytes().into()) .unwrap() .into_verified() .unwrap(); assert_eq!(block2.author(), keys.public_key()); assert_eq!(block2.payload().to, keys.public_key()); assert_eq!(block2.payload().block, content); assert_eq!(block2.payload().precommits, precommits_buf); assert_eq!(block2.payload().transactions, transactions); let block_proof = BlockProof::new(content, precommits); let json_str = serde_json::to_string(&block_proof).unwrap(); let block_proof_1: BlockProof = serde_json::from_str(&json_str).unwrap(); assert_eq!(block_proof, block_proof_1); }
rust_cleaned_test_functions.jsonl/43027
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 2170 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 7113, 368, 341, 286, 1077, 6894, 284, 5309, 12443, 486, 11463, 543, 286, 1077, 10591, 284, 547, 10413, 486, 3328, 543, 286, 1077, 9854, 82, 284, 508, 17, 935, 286, 1077, 9854, 3180, 284, 9854, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_segments_of_arrays() { let mut buf = vec![255; 64]; let v1 = [1u8, 2, 3]; let v2 = [1u8, 3]; let v3 = [2u8, 5, 2, 3, 56, 3]; let dat = vec![v1.as_ref(), v2.as_ref(), v3.as_ref()]; Field::write(&dat, &mut buf, 48, 56); <Vec<&[u8]> as Field>::check(&buf, 48.into(), 56.into(), 64.into()).unwrap(); let buf2 = buf.clone(); <Vec<&[u8]> as Field>::check(&buf2, 48.into(), 56.into(), 64.into()).unwrap(); let dat2: Vec<&[u8]> = unsafe { Field::read(&buf2, 48, 56) }; assert_eq!(dat2, dat); //48 spaces + 8 segment of vec + 8 spaces = 64 + // + v1_segment + v2_segment + v3_segment + // + v1_body + v2_body + v3_body assert_eq!(buf.len(), 64 + v1.len() + v2.len() + v3.len() + 3 * 8); }
rust_cleaned_test_functions.jsonl/118849
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 378 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 55735, 3575, 68983, 368, 341, 262, 1077, 5206, 6607, 284, 7486, 20703, 17, 20, 20, 26, 220, 21, 19, 935, 262, 1077, 348, 16, 284, 508, 16, 84, 23, 11, 220, 17, 11, 220, 18, 935, 262, 1077,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_invalid_icmpv4_in_ipv6() { let ip_config = Ipv6::DUMMY_CONFIG; let mut ctx = DummyEventDispatcherBuilder::from_config(ip_config.clone()) .build::<DummyEventDispatcher>(); let device = DeviceId::new_ethernet(1); let frame_dst = FrameDestination::Unicast; let ic_config = Ipv4::DUMMY_CONFIG; let icmp_builder = IcmpPacketBuilder::<Ipv4, &[u8], _>::new( ic_config.remote_ip, ic_config.local_ip, IcmpUnusedCode, IcmpEchoRequest::new(0, 0), ); let ip_builder = Ipv6PacketBuilder::new( ip_config.remote_ip, ip_config.local_ip, 64, Ipv6Proto::Other(Ipv4Proto::Icmp.into()), ); let buf = Buf::new(Vec::new(), ..) .encapsulate(icmp_builder) .encapsulate(ip_builder) .serialize_vec_outer() .unwrap(); receive_ipv6_packet(&mut ctx, device, frame_dst, buf); // Should not have dispatched the packet. assert_eq!(get_counter_val(&mut ctx, "dispatch_receive_ipv6_packet"), 0); // but the netstack chooses to just drop the packet since we are not // required to send the ICMP response. assert_empty(ctx.dispatcher.frames_sent().iter()); }
rust_cleaned_test_functions.jsonl/122985
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 699 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 31433, 32747, 1307, 85, 19, 1243, 49378, 21, 368, 341, 286, 1077, 5997, 5332, 284, 358, 30168, 21, 486, 35, 58673, 12568, 280, 286, 1077, 5206, 5635, 284, 50567, 1556, 21839, 3297, 486, 1499, 53...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_match_char_with_surrounding_properties() { let o = CellGrid::o(); let q = CellGrid::q(); let u = CellGrid::u(); let unit4 = Cell::unit(4); // Expecting to match . let fragments = vec![arc(o, q, unit4), line(q, u)]; let top_left = &Property::empty(); let top = &Property::empty(); let top_right = &Property::empty(); let left = &Property::empty(); let right = Property::from_char('-').expect("must have a property"); let bottom_left = Property::from_char('/').unwrap(); let bottom = &Property::empty(); let bottom_right = &Property::empty(); let ch = PropertyBuffer::match_char_with_surrounding_properties( &Settings::default(), &fragments, top_left, top, top_right, left, right, bottom_left, bottom, bottom_right, ); println!("ch: {:?}", ch); assert_eq!(ch, Some(',')); }
rust_cleaned_test_functions.jsonl/33914
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 623 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 10708, 9232, 6615, 49946, 1049, 287, 25158, 368, 341, 286, 1077, 297, 284, 13972, 3543, 486, 78, 543, 286, 1077, 2804, 284, 13972, 3543, 486, 80, 543, 286, 1077, 575, 284, 13972, 3543, 486, 84, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_formats() { let rocket = rocket::ignite() .mount("/", routes![json, xml, json_long, msgpack_long, msgpack, plain, binary, other]); let client = Client::tracked(rocket).unwrap(); let response = client.post("/").header(ContentType::JSON).dispatch(); assert_eq!(response.into_string().unwrap(), "json"); let response = client.post("/").header(ContentType::MsgPack).dispatch(); assert_eq!(response.into_string().unwrap(), "msgpack_long"); let response = client.post("/").header(ContentType::XML).dispatch(); assert_eq!(response.into_string().unwrap(), "xml"); let response = client.get("/").header(Accept::Plain).dispatch(); assert_eq!(response.into_string().unwrap(), "plain"); let response = client.get("/").header(Accept::Binary).dispatch(); assert_eq!(response.into_string().unwrap(), "binary"); let response = client.get("/").header(ContentType::JSON).dispatch(); assert_eq!(response.into_string().unwrap(), "plain"); let response = client.get("/").dispatch(); assert_eq!(response.into_string().unwrap(), "plain"); let response = client.put("/").header(ContentType::HTML).dispatch(); assert_eq!(response.status(), Status::NotFound); }
rust_cleaned_test_functions.jsonl/34696
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 449 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 68351, 368, 341, 262, 1077, 24306, 284, 24306, 486, 95408, 741, 286, 659, 16557, 35460, 11291, 20703, 2236, 11, 8396, 11, 2951, 17799, 11, 3750, 4748, 17799, 11, 3750, 4748, 345, 2290, 14396, 11, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_preserve_root() { for d in [ "/", "/////dev///../../../../", "../../../../../../../../../../../../../../", "./../../../../../../../../../../../../../../", ] { new_ucmd!() .arg("--preserve-root") .arg("-R") .arg("bin").arg(d) .fails() .stderr_is("chgrp: it is dangerous to operate recursively on '/'\nchgrp: use --no-preserve-root to override this failsafe"); } }
rust_cleaned_test_functions.jsonl/49269
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 267 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 32116, 5852, 12993, 368, 341, 1066, 262, 369, 294, 304, 2278, 286, 3521, 756, 286, 330, 97656, 3583, 2575, 84257, 756, 286, 63392, 84257, 84257, 2748, 756, 286, 5924, 84257, 84257, 84257, 2748, 75...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_ascii_boundary_below() -> io::Result<()> { test_truncate_length("1337_hello_world", 15, "1337_hello_worl", "…") }
rust_cleaned_test_functions.jsonl/106751
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 66 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 50238, 54004, 82750, 368, 1464, 6399, 486, 2077, 71698, 341, 262, 1273, 3547, 26900, 5118, 445, 16, 18, 18, 22, 96724, 31792, 497, 220, 16, 20, 11, 330, 16, 18, 18, 22, 96724, 1670, 269, 75, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_iter() { let mut p = make_parser(); assert_eq!(p.next().and_then(|n| Some(n.typ)), Some(ItemType::ItemText)); assert_eq!(p.collect::<Vec<_>>().len(), 12); }
rust_cleaned_test_functions.jsonl/8624
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 104 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 11723, 368, 341, 286, 1077, 5206, 281, 284, 1281, 18517, 543, 286, 2060, 10714, 10297, 79, 4529, 1005, 437, 68367, 22428, 77, 91, 4329, 1445, 49286, 5731, 4329, 29771, 929, 486, 1234, 1178, 1106, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_distinct() { let expected_sql = "SELECT DISTINCT \"bar\" FROM \"test\""; let query = Select::from_table("test").column(Column::new("bar")).distinct(); let (sql, _) = Postgres::build(query).unwrap(); assert_eq!(expected_sql, sql); }
rust_cleaned_test_functions.jsonl/6448
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 125 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 16031, 7800, 368, 341, 286, 1077, 3601, 18063, 284, 330, 4858, 59086, 7245, 2257, 2105, 4295, 7245, 1944, 95349, 286, 1077, 3239, 284, 8427, 486, 1499, 5237, 445, 1944, 1827, 6229, 95105, 486, 931...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_shr_reg_reg() { assert_emit!(0xD3, 0xE8; emit_shr_reg_cl(0, RAX)); assert_emit!(0x41, 0xD3, 0xE9; emit_shr_reg_cl(0, R9)); assert_emit!(0x48, 0xD3, 0xE8; emit_shr_reg_cl(1, RAX)); assert_emit!(0x49, 0xD3, 0xE9; emit_shr_reg_cl(1, R9)); }
rust_cleaned_test_functions.jsonl/85466
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 186 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 3712, 81, 4920, 4920, 368, 341, 286, 2060, 69082, 10297, 15, 15764, 18, 11, 220, 15, 12606, 23, 26, 16691, 3712, 81, 4920, 6794, 7, 15, 11, 431, 2954, 1106, 286, 2060, 69082, 10297, 15, 87, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_storage_stage_process_account_proofs() { solana_logger::setup(); let keypair = Arc::new(Keypair::new()); let storage_keypair = Arc::new(Keypair::new()); let archiver_keypair = Arc::new(Keypair::new()); let exit = Arc::new(AtomicBool::new(false)); let GenesisConfigInfo { mut genesis_config, mint_keypair, .. } = create_genesis_config(1000); genesis_config .native_instruction_processors .push(solana_storage_program::solana_storage_program!()); let (ledger_path, _blockhash) = create_new_tmp_ledger!(&genesis_config); let blocktree = Arc::new(Blocktree::open(&ledger_path).unwrap()); let bank = Bank::new(&genesis_config); let bank = Arc::new(bank); let bank_forks = Arc::new(RwLock::new(BankForks::new_from_banks( &[bank.clone()], vec![0], ))); let cluster_info = test_cluster_info(&keypair.pubkey()); let (bank_sender, bank_receiver) = channel(); let storage_state = StorageState::new( &bank.last_blockhash(), SLOTS_PER_TURN_TEST, bank.slots_per_segment(), ); let storage_stage = StorageStage::new( &storage_state, bank_receiver, Some(blocktree.clone()), &keypair, &storage_keypair, &exit.clone(), &bank_forks, &cluster_info, ); bank_sender.send(vec![bank.clone()]).unwrap(); // create accounts let bank = Arc::new(Bank::new_from_parent(&bank, &keypair.pubkey(), 1)); let account_ix = storage_instruction::create_storage_account( &mint_keypair.pubkey(), &Pubkey::new_rand(), &archiver_keypair.pubkey(), 1, StorageAccountType::Archiver, ); let account_tx = Transaction::new_signed_instructions( &[&mint_keypair, &archiver_keypair], account_ix, bank.last_blockhash(), ); bank.process_transaction(&account_tx).expect("create"); bank_sender.send(vec![bank.clone()]).unwrap(); let mut reference_keys; { let keys = &storage_state.state.read().unwrap().storage_keys; reference_keys = vec![0; keys.len()]; reference_keys.copy_from_slice(keys); } let keypair = Keypair::new(); let mining_proof_ix = storage_instruction::mining_proof( &archiver_keypair.pubkey(), Hash::default(), 0, keypair.sign_message(b"test"), bank.last_blockhash(), ); let next_bank = Arc::new(Bank::new_from_parent(&bank, &keypair.pubkey(), 2)); //register ticks so the program reports a different segment blocktree_processor::process_entries( &next_bank, &entry::create_ticks( DEFAULT_TICKS_PER_SLOT * next_bank.slots_per_segment() + 1, 0, bank.last_blockhash(), ), true, ) .unwrap(); let message = Message::new_with_payer(vec![mining_proof_ix], Some(&mint_keypair.pubkey())); let mining_proof_tx = Transaction::new( &[&mint_keypair, archiver_keypair.as_ref()], message, next_bank.last_blockhash(), ); next_bank .process_transaction(&mining_proof_tx) .expect("process txs"); bank_sender.send(vec![next_bank]).unwrap(); for _ in 0..5 { { let keys = &storage_state.state.read().unwrap().storage_keys; if keys[..] != *reference_keys.as_slice() { break; } } sleep(Duration::new(1, 0)); } debug!("joining..?"); exit.store(true, Ordering::Relaxed); storage_stage.join().unwrap(); { let keys = &storage_state.state.read().unwrap().storage_keys; assert_ne!(keys[..], *reference_keys); } remove_dir_all(ledger_path).unwrap(); }
rust_cleaned_test_functions.jsonl/82499
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 2152 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 23310, 35238, 11305, 13500, 2540, 36081, 368, 341, 286, 2048, 3362, 27413, 486, 15188, 543, 286, 1077, 1376, 12670, 284, 19689, 486, 931, 7, 6608, 1082, 1310, 486, 931, 1423, 286, 1077, 5819, 3097...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_get_colors_error() { let status = Command::new(get_path()) .arg("--base-colors=#FFFFFF,#001488") .arg("--target-colors=000000") .stderr(Stdio::null()) .status() .expect("failed to start color_bruteforcer"); match status.code() { Some(code) => assert_eq!(1, code), None => assert!(false, "Process terminated by signal"), } }
rust_cleaned_test_functions.jsonl/4295
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 237 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 3062, 33670, 4096, 368, 341, 286, 1077, 2639, 284, 7348, 486, 931, 5433, 2638, 2398, 310, 659, 858, 21549, 3152, 7889, 82, 45131, 28321, 38898, 15, 15, 16, 19, 23, 23, 1138, 310, 659, 858, 215...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_pool_ray_srm() { pool_actions::run_test( "RDM.RAY-SRM-V4", vec![ utils::Swap { protocol: "RDM", from_token: "SOL", to_token: "RAY", amount: 0.111, }, utils::Swap { protocol: "RDM", from_token: "SOL", to_token: "SRM", amount: 0.111, }, ], vec![], false, ); }
rust_cleaned_test_functions.jsonl/120672
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 348 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 15709, 72690, 643, 8719, 368, 341, 262, 7314, 25368, 486, 6108, 4452, 1006, 286, 330, 49, 8395, 2013, 3022, 6222, 23652, 19625, 19, 756, 286, 7486, 90515, 310, 12439, 486, 46179, 341, 394, 11507, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_stop_sending_other_error_with_reset() { let (mut client, mut server, request_stream_id) = connect_and_send_request(false); // Stop sending with RequestRejected. assert_eq!( Ok(()), server .conn .stream_stop_sending(request_stream_id, Error::HttpRequestRejected.code()) ); // also reset with RequestRejected. assert_eq!( Ok(()), server .conn .stream_reset_send(request_stream_id, Error::HttpRequestRejected.code()) ); let out = server.conn.process(None, now()); client.process(out.dgram(), now()); let mut reset = false; let mut stop_sending = false; while let Some(e) = client.next_event() { match e { Http3ClientEvent::StopSending { stream_id, error } => { assert_eq!(stream_id, request_stream_id); assert_eq!(error, Error::HttpRequestRejected.code()); stop_sending = true; } Http3ClientEvent::Reset { stream_id, error, local, } => { assert_eq!(stream_id, request_stream_id); assert_eq!(error, Error::HttpRequestRejected.code()); assert!(!local); reset = true; } Http3ClientEvent::HeaderReady { .. } | Http3ClientEvent::DataReadable { .. } => { panic!("We should not get any headers or data"); } _ => {} } } assert!(reset); assert!(stop_sending); // after this stream will be removed from client. We will check this by trying to read // from the stream and that should fail. let mut buf = [0_u8; 100]; let res = client.read_response_data(now(), request_stream_id, &mut buf); assert!(res.is_err()); assert_eq!(res.unwrap_err(), Error::InvalidStreamId); client.close(now(), 0, ""); }
rust_cleaned_test_functions.jsonl/101903
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1145 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 19039, 643, 2459, 30456, 4096, 6615, 18983, 368, 341, 1789, 286, 1077, 320, 6984, 2943, 11, 5206, 3538, 11, 1681, 12673, 842, 8, 284, 4564, 8378, 13565, 7893, 3576, 626, 286, 442, 14215, 11628, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_rm_force() { let (at, mut ucmd) = testing(UTIL_NAME); let file_a = "test_rm_force_a"; let file_b = "test_rm_force_b"; let result = ucmd.arg("-f") .arg(file_a) .arg(file_b) .run(); assert_empty_stderr!(result); assert!(result.success); assert!(!at.file_exists(file_a)); assert!(!at.file_exists(file_b)); }
rust_cleaned_test_functions.jsonl/61414
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 236 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 58537, 40739, 368, 341, 262, 1077, 320, 266, 11, 5206, 575, 8710, 8, 284, 7497, 7, 36969, 4708, 317, 262, 1077, 1034, 4306, 284, 330, 1944, 58537, 40739, 4306, 876, 262, 1077, 1034, 880, 284, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_escaped_char() { assert_eq!( apply( r#" '\'' + "# .trim() ), Ok(vec![ Token::Char(span(1, 1, "'\\''")), Token::Symbol(span(1, 6, "+")) ]) ) }
rust_cleaned_test_functions.jsonl/27569
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 215 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 62, 65826, 9232, 368, 341, 286, 2060, 10714, 33673, 310, 3796, 1006, 394, 435, 2, 698, 15777, 4605, 3610, 1, 4956, 503, 659, 10666, 741, 310, 2837, 310, 7622, 25592, 90515, 394, 9660, 486, 4768,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_std() { ::init().unwrap(); let mut it = Iterator::from_vec(vec![1i32, 2, 3]).into_iter(); assert_eq!(it.next(), Some(Ok(1))); assert_eq!(it.next(), Some(Ok(2))); assert_eq!(it.next(), Some(Ok(3))); assert_eq!(it.next(), None); }
rust_cleaned_test_functions.jsonl/50298
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 161 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 15656, 368, 341, 286, 3504, 2327, 1005, 15454, 1428, 286, 1077, 5206, 432, 284, 23023, 486, 1499, 13251, 25592, 20703, 16, 72, 18, 17, 11, 220, 17, 11, 220, 18, 10697, 18122, 11723, 543, 286, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_index_debug() { let mut list = VecList::new(); let index = list.push_back(5); assert_eq!( format!("{:?}", index), format!("Index(0, {})", index.generation) ); }
rust_cleaned_test_functions.jsonl/11490
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 129 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 3560, 15446, 368, 341, 286, 1077, 5206, 1140, 284, 11312, 852, 486, 931, 543, 286, 1077, 1922, 284, 1140, 2552, 3895, 7, 20, 626, 286, 2060, 10714, 33673, 310, 3561, 88928, 25, 52652, 1922, 1326...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_is_current() { let now = Instant::now(); let not_the_future = now + Duration::from_secs(4); let future = now + Duration::from_secs(5); let past_the_future = now + Duration::from_secs(6); let value = LruValue { lookup: Err(ResolveErrorKind::Message("test error").into()), valid_until: future, }; assert!(value.is_current(now)); assert!(value.is_current(not_the_future)); assert!(value.is_current(future)); assert!(!value.is_current(past_the_future)); }
rust_cleaned_test_functions.jsonl/2126
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 269 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6892, 11080, 368, 341, 286, 1077, 1431, 284, 18058, 486, 3328, 543, 286, 1077, 537, 16068, 59740, 284, 1431, 488, 21045, 486, 1499, 68718, 7, 19, 317, 286, 1077, 3853, 284, 1431, 488, 21045, 486...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_yield_rate_period() { let expected = 0.005_f32; let invest = Investment::new(10000, 12, 0.06, 0); assert!( &expected.approx_eq(&invest.yield_rate_period(), 2.0 * ::std::f32::EPSILON, 2), "expected: {}, actual: {}", expected, invest.yield_rate_period() ); }
rust_cleaned_test_functions.jsonl/126190
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 192 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 83709, 9246, 20818, 368, 341, 286, 1077, 3601, 284, 220, 15, 13, 15, 15, 20, 761, 18, 17, 280, 286, 1077, 2725, 284, 32250, 486, 931, 7, 16, 15, 15, 15, 15, 11, 220, 16, 17, 11, 220, 15,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_new_run_classical_register() { pyo3::prepare_freethreaded_python(); Python::with_gil(|py| -> () { let mut circs: Vec<CircuitWrapper> = Vec::new(); circs.push(CircuitWrapper::new()); let mut circ1 = CircuitWrapper::new(); circ1.internal += RotateX::new(0, 0.0.into()); circs.push(circ1.clone()); let br_type = py.get_type::<ClassicalRegisterWrapper>(); let input = br_type .call1((Some(CircuitWrapper::new()), circs.clone())) .unwrap() .cast_as::<PyCell<ClassicalRegisterWrapper>>() .unwrap(); let program_type = py.get_type::<QuantumProgramWrapper>(); let program = program_type .call1((input, vec!["test".to_string()])) .unwrap() .cast_as::<PyCell<QuantumProgramWrapper>>() .unwrap(); let program_wrapper = program.extract::<QuantumProgramWrapper>().unwrap(); let cr = ClassicalRegister { constant_circuit: Some(Circuit::new()), circuits: vec![Circuit::new(), circ1.internal], }; assert_eq!( program_wrapper, QuantumProgramWrapper { internal: QuantumProgram::ClassicalRegister { measurement: cr.clone(), input_parameter_names: vec!["test".to_string()] } } ); let measurement = ClassicalRegisterWrapper::extract( program .call_method1("run_registers", (TestBackend, Some(vec![0.0]))) .unwrap(), ) .unwrap(); assert_eq!(measurement.internal, cr); let error = program.call_method1("run", (TestBackend, Some(vec![0.0]))); assert!(error.is_err()); }) }
rust_cleaned_test_functions.jsonl/8604
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 903 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 5921, 14007, 4790, 938, 14000, 368, 341, 262, 4510, 78, 18, 486, 13609, 74179, 769, 878, 291, 55869, 543, 262, 13027, 486, 4197, 1889, 321, 22428, 3288, 91, 1464, 1719, 341, 286, 1077, 5206, 422...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_extend() { let cmd = RelayCmd::EXTEND; assert_eq!(Into::<u8>::into(cmd), 6_u8); let body = "7F000001 138C 71510FC729E1DBE35586F0031D69A38FC684B26D657821EE640C299BA9F8FD38D3A3376F2DD3A79A0B73836AB4B42E5FB3BEE1383F3184A852B292626DCC64AF672A8FAEFC263C38370768EF9EA6C244BA079142D3E23835F6914DE0C7F468316C4265E109F5312987275D61E1DC831A3323195DDE70841CEE2DC30F6DCDBDABA40A75FDFB714431FC5EB8F84D4150EE2C2478A79018F18D7F30F6BB677516CF03390F5180B371DEAEBB89175798864D2130B13ED1D20B254F07 CF555174CBE8AD62A7E764A8F3D85D40C5145ABB"; let addr = "127.0.0.1".parse::<Ipv4Addr>().unwrap(); let handshake = hex::decode("71510FC729E1DBE35586F0031D69A38FC684B26D657821EE640C299BA9F8FD38D3A3376F2DD3A79A0B73836AB4B42E5FB3BEE1383F3184A852B292626DCC64AF672A8FAEFC263C38370768EF9EA6C244BA079142D3E23835F6914DE0C7F468316C4265E109F5312987275D61E1DC831A3323195DDE70841CEE2DC30F6DCDBDABA40A75FDFB714431FC5EB8F84D4150EE2C2478A79018F18D7F30F6BB677516CF03390F5180B371DEAEBB89175798864D2130B13ED1D20B254F07").unwrap(); let rsa = RsaIdentity::from_bytes(&hex::decode("CF555174CBE8AD62A7E764A8F3D85D40C5145ABB").unwrap()) .unwrap(); msg( cmd, body, &msg::Extend::new(addr, 5004, handshake, rsa).into(), ); }
rust_cleaned_test_functions.jsonl/66344
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 752 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 70265, 368, 341, 262, 1077, 5439, 284, 46172, 15613, 486, 5722, 4689, 280, 262, 2060, 10714, 10297, 26591, 27638, 84, 23, 6831, 18122, 14160, 701, 220, 21, 7300, 23, 626, 262, 1077, 2487, 284, 3...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_star_network_pull_50() { let mut network = star_network_create(50); let thread_pool = build_gossip_thread_pool(); network_simulator_pull_only(&thread_pool, &mut network); }
rust_cleaned_test_functions.jsonl/2395
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 80 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 31681, 20966, 65693, 62, 20, 15, 368, 341, 262, 1077, 5206, 3922, 284, 6774, 20966, 8657, 7, 20, 15, 317, 262, 1077, 4516, 15709, 284, 1936, 1889, 41473, 10814, 15709, 543, 262, 3922, 18314, 105...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_aes_siv_cmac256_enc() { let key = hex::decode("fffefdfcfbfaf9f8f7f6f5f4f3f2f1f0\ f0f1f2f3f4f5f6f7f8f9fafbfcfdfeff").unwrap(); let aad = hex::decode("101112131415161718191a1b1c1d1e1f\ 2021222324252627").unwrap(); let plaintext = hex::decode("112233445566778899aabbccddee").unwrap(); // NOTE: Layout = IV || C let mut ciphertext_and_tag = plaintext.clone(); for _ in 0..AesSivCmac256::TAG_LEN { ciphertext_and_tag.insert(0, 0); } let cipher = AesSivCmac256::new(&key); cipher.encrypt_slice(&[&aad], &mut ciphertext_and_tag); assert_eq!(&ciphertext_and_tag[..], &hex::decode("85632d07c6e8f37f950acd320a2ecc93\ 40c02b9690c4dc04daef7f6afe5c").unwrap()[..]); let key = hex::decode("7f7e7d7c7b7a79787776757473727170\ 404142434445464748494a4b4c4d4e4f").unwrap(); let ad1 = hex::decode("\ 00112233445566778899aabbccddeeff\ deaddadadeaddadaffeeddccbbaa9988\ 7766554433221100").unwrap(); let ad2 = hex::decode("102030405060708090a0").unwrap(); let nonce = hex::decode("09f911029d74e35bd84156c5635688c0").unwrap(); let plaintext = hex::decode("7468697320697320736f6d6520706c61\ 696e7465787420746f20656e63727970\ 74207573696e67205349562d414553").unwrap(); // NOTE: Layout = IV || C let mut ciphertext_and_tag = plaintext.clone(); for _ in 0..AesSivCmac256::TAG_LEN { ciphertext_and_tag.insert(0, 0); } let cipher = AesSivCmac256::new(&key); cipher.encrypt_slice(&[&ad1, &ad2, &nonce], &mut ciphertext_and_tag); assert_eq!(&ciphertext_and_tag[..], &hex::decode("7bdb6e3b432667eb06f4d14bff2fbd0f\ cb900f2fddbe404326601965c889bf17\ dba77ceb094fa663b7a3f748ba8af829\ ea64ad544a272e9c485b62a3fd5c0d").unwrap()[..]); }
rust_cleaned_test_functions.jsonl/78463
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 931 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 90958, 643, 344, 666, 11948, 17, 20, 21, 13781, 368, 341, 9401, 262, 1077, 1376, 981, 284, 12371, 486, 18196, 445, 14092, 823, 2940, 9792, 13233, 2577, 24, 69, 23, 69, 22, 69, 21, 69, 20, 69...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_is_votable() { let (genesis_block, mint_keypair) = GenesisBlock::new(500); let bank = Arc::new(Bank::new(&genesis_block)); let key1 = Keypair::new(); assert_eq!(bank.is_votable(), false); // Set is_delta to true let tx_transfer_mint_to_1 = system_transaction::transfer(&mint_keypair, &key1.pubkey(), 1, genesis_block.hash(), 0); assert_eq!(bank.process_transaction(&tx_transfer_mint_to_1), Ok(())); assert_eq!(bank.is_votable(), false); // Register enough ticks to hit max tick height for i in 0..genesis_block.ticks_per_slot - 1 { bank.register_tick(&hash::hash(format!("hello world {}", i).as_bytes())); } assert_eq!(bank.is_votable(), true); }
rust_cleaned_test_functions.jsonl/41910
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 363 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6892, 2273, 354, 480, 368, 341, 286, 1077, 320, 77894, 7113, 11, 28337, 3097, 12670, 8, 284, 40788, 4713, 486, 931, 7, 20, 15, 15, 317, 286, 1077, 6073, 284, 19689, 486, 931, 5349, 1180, 486, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_set_time_warp() { let mut environment = CanisterEnv::new(); let start = environment.now(); environment.set_time_warp(TimeWarp { delta_s: 1_000 }); let delta_s = environment.now() - start; assert!(delta_s >= 1000, "delta_s = {}", delta_s); assert!(delta_s < 1005, "delta_s = {}", delta_s); }
rust_cleaned_test_functions.jsonl/57026
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 144 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2602, 3009, 1670, 7876, 368, 341, 262, 1077, 5206, 4573, 284, 2980, 1571, 14359, 486, 931, 1428, 262, 1077, 1191, 284, 4573, 10700, 543, 262, 4573, 980, 3009, 1670, 7876, 36968, 54, 7876, 314, 9...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_decode_and() { match decode_16(0x401a) { Instruction::AND_reg { params, thumb32 } => { assert_eq!(params.rd, Reg::R2); assert_eq!(params.rn, Reg::R2); assert_eq!(params.rm, Reg::R3); assert_eq!(thumb32, false); assert_eq!(params.shift_t, SRType::LSL); assert_eq!(params.shift_n, 0); assert!(params.setflags == SetFlags::NotInITBlock); } _ => { assert!(false); } } }
rust_cleaned_test_functions.jsonl/64776
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 297 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 15227, 8378, 368, 341, 1066, 262, 2432, 16895, 62, 16, 21, 7, 15, 87, 19, 15, 16, 64, 8, 341, 286, 29051, 486, 3976, 4920, 314, 3628, 11, 24050, 18, 17, 335, 589, 341, 310, 2060, 10714, 10...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_should_panic_non_string_message_type() { use crate::tests::TrFailedMsg; use std::any::TypeId; fn f() { std::panic::panic_any(1i32); } let expected = "foobar"; let failed_msg = format!( r#"expected panic with string value, found non-string value: `{:?}` expected substring: `"foobar"`"#, TypeId::of::<i32>() ); let desc = TestDescAndFn { desc: TestDesc { name: StaticTestName("whatever"), ignore: false, should_panic: ShouldPanic::YesWithMessage(expected), allow_fail: false, compile_fail: false, no_run: false, test_type: TestType::Unknown, }, testfn: DynTestFn(Box::new(f)), }; let (tx, rx) = channel(); run_test(&TestOpts::new(), false, TestId(0), desc, RunStrategy::InProcess, tx, Concurrent::No); let result = rx.recv().unwrap().result; assert_eq!(result, TrFailedMsg(failed_msg)); }
rust_cleaned_test_functions.jsonl/7705
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 470 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 43378, 620, 31270, 21637, 3904, 6462, 1819, 368, 341, 262, 990, 17717, 486, 23841, 486, 1282, 9408, 6611, 280, 262, 990, 1460, 486, 3767, 486, 31934, 280, 262, 5168, 282, 368, 341, 286, 1460, 48...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_can_validate_option_fields_without_lifetime() { let instance = ParentWithOptionalChild { child: Some(Child { value: String::new() }) }; let res = instance.validate(); assert!(res.is_err()); let err = res.unwrap_err(); let errs = err.errors(); assert_eq!(errs.len(), 1); assert!(errs.contains_key("child")); if let ValidationErrorsKind::Struct(ref errs) = errs["child"] { unwrap_map(errs, |errs| { assert_eq!(errs.len(), 1); assert!(errs.contains_key("value")); if let ValidationErrorsKind::Field(ref errs) = errs["value"] { assert_eq!(errs.len(), 1); assert_eq!(errs[0].code, "length"); } else { panic!("Expected field validation errors"); } }); } else { panic!("Expected struct validation errors"); } }
rust_cleaned_test_functions.jsonl/779
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 421 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 27421, 42681, 9672, 12132, 39904, 98827, 368, 341, 262, 1077, 2867, 284, 17022, 2354, 15309, 3652, 314, 1682, 25, 4329, 7, 3652, 314, 897, 25, 923, 486, 931, 368, 6413, 3634, 262, 1077, 592, 284...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_read_holding_registers() { let (_s, cfg) = start_dummy_server_with_cfg(); let mut trans = Transport::new_with_cfg("127.0.0.1", cfg).unwrap(); assert_eq!(trans.read_holding_registers(0, 5).unwrap().len(), 5); assert!(trans.read_holding_registers(0, 5).unwrap().iter().all(|c| *c == 0)); }
rust_cleaned_test_functions.jsonl/46834
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 160 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6443, 1523, 14995, 78360, 368, 341, 286, 1077, 5453, 82, 11, 13286, 8, 284, 1191, 60321, 12015, 6615, 18343, 543, 286, 1077, 5206, 1356, 284, 16742, 486, 931, 6615, 18343, 445, 16, 17, 22, 13, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_empty_statement() { let src = r#" ;;;let a = 10;; if(a) ; a "#; assert_eq!(&exec(src), "10"); }
rust_cleaned_test_functions.jsonl/39568
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 90 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 15124, 37404, 368, 341, 262, 1077, 2286, 284, 435, 2, 698, 286, 2587, 6768, 1149, 264, 284, 220, 16, 15, 28207, 286, 421, 2877, 8, 4386, 286, 264, 198, 262, 5869, 280, 262, 2060, 10714, 0, 2...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_state_info_update() { fn update_delta(port: Delta<StateEvent>, system: Delta<SystemState>) -> StateDelta { StateDelta { port: IpVersions { ipv4: port.clone(), ipv6: port }, system: IpVersions { ipv4: system.clone(), ipv6: system }, } } let if1_local_event = StateEvent::construct(State::Local); let if1_local = IpVersions::<StateEvent>::construct(if1_local_event); // Post-update the system state should be Local due to interface 1. let mut state = StateInfo::default(); let want = update_delta( Delta { previous: None, current: if1_local_event }, Delta { previous: None, current: SystemState { id: ID1, state: if1_local_event } }, ); assert_eq!(state.update(ID1, if1_local.clone()), want); let want_state = StateInfo { per_interface: std::iter::once((ID1, if1_local.clone())).collect::<HashMap<_, _>>(), system: IpVersions { ipv4: Some(ID1), ipv6: Some(ID1) }, }; assert_eq!(state, want_state); let if2_gateway_event = StateEvent::construct(State::Gateway); let if2_gateway = IpVersions::<StateEvent>::construct(if2_gateway_event); // will be Gateway due to interface 2. let want = update_delta( Delta { previous: None, current: if2_gateway_event }, Delta { previous: Some(SystemState { id: ID1, state: if1_local_event }), current: SystemState { id: ID2, state: if2_gateway_event }, }, ); assert_eq!(state.update(ID2, if2_gateway.clone()), want); let want_state = StateInfo { per_interface: [(ID1, if1_local.clone()), (ID2, if2_gateway.clone())] .iter() .cloned() .collect::<HashMap<_, _>>(), system: IpVersions { ipv4: Some(ID2), ipv6: Some(ID2) }, }; assert_eq!(state, want_state); let if2_removed_event = StateEvent::construct(State::Removed); let if2_removed = IpVersions::<StateEvent>::construct(if2_removed_event); // will be Local due to interface 1. let want = update_delta( Delta { previous: Some(if2_gateway_event), current: if2_removed_event }, Delta { previous: Some(SystemState { id: ID2, state: if2_gateway_event }), current: SystemState { id: ID1, state: if1_local_event }, }, ); assert_eq!(state.update(ID2, if2_removed.clone()), want); let want_state = StateInfo { per_interface: [(ID1, if1_local.clone()), (ID2, if2_removed.clone())] .iter() .cloned() .collect::<HashMap<_, _>>(), system: IpVersions { ipv4: Some(ID1), ipv6: Some(ID1) }, }; assert_eq!(state, want_state); }
rust_cleaned_test_functions.jsonl/64394
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1438 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 4387, 3109, 8882, 368, 341, 286, 5168, 2647, 26710, 21230, 25, 24957, 62201, 1556, 8066, 1849, 25, 24957, 30721, 1397, 9231, 1464, 3234, 20277, 341, 310, 3234, 20277, 341, 394, 2635, 25, 35033, 69...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_mm_anon() { let siz = 1024 * 1024; let addr = mm_anon(siz).unwrap(); unsafe { assert_eq!(*(addr.offset((siz - 1) as isize) as *const u8), 0u8); } }
rust_cleaned_test_functions.jsonl/91343
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 121 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 35599, 12008, 263, 368, 341, 286, 1077, 64896, 284, 220, 16, 15, 17, 19, 353, 220, 16, 15, 17, 19, 280, 286, 1077, 10789, 284, 9465, 12008, 263, 1141, 449, 568, 15454, 543, 286, 19860, 341, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_lif_manager_add_same_name() { let mut lm = LIFManager::new(); let l = LIF::new(3, LIFType::LAN, "lan1", PortId::from(0), vec![PortId::from(1)], 0, None) .unwrap(); lm.add_lif(&l).unwrap(); let l = LIF::new(4, LIFType::LAN, "lan1", PortId::from(0), vec![PortId::from(2)], 0, None) .unwrap(); assert!(lm.add_lif(&l).is_err()); assert_eq!(lm.lifs.len(), 1); }
rust_cleaned_test_functions.jsonl/81914
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 248 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 907, 333, 12144, 2891, 33574, 1269, 368, 341, 286, 1077, 5206, 40238, 284, 444, 2773, 2043, 486, 931, 543, 286, 1077, 326, 284, 444, 2773, 486, 931, 7, 18, 11, 444, 2773, 929, 486, 23408, 11, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_rfc6979_sample() { let msg = "sample"; let k = "A6E3C57DD01ABE90086538398355DD4C3B17AA873382B0F24D6129493D8AAD60"; let r = "EFD48B2AACB6A8FD1140DD9CD45E81D69D2C877B56AAF991C34D0EA84EAF3716"; let s = "F7CB1C942D657C41D436C7A1B6E29F65F3E900DBB9AFF4064DC4AB2F843ACDA8"; test_rfc6979(msg, k, r, s); }
rust_cleaned_test_functions.jsonl/81724
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 227 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 1710, 8316, 21, 24, 22, 24, 17491, 368, 341, 286, 1077, 3750, 284, 330, 13611, 876, 286, 1077, 595, 284, 330, 32, 21, 36, 18, 34, 20, 22, 4103, 15, 16, 1867, 36, 24, 15, 15, 23, 21, 20, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_find_saves_node() { let node_table = DummyNodeTable { node: None }; let mut svc: Service<TestsIdType, net::SocketAddr, DummyNodeTable, String> = Service::new(node_table); let node = test::new_node(test::make_id(43)); assert!(svc.handler.on_find_node(&node, &node.id).is_empty()); let result = svc.handler.on_find_node(&node, &node.id); assert_eq!(1, result.len()); assert_eq!(test::make_id(43), result.get(0).unwrap().id) }
rust_cleaned_test_functions.jsonl/110956
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 241 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21814, 643, 4693, 5084, 368, 341, 286, 1077, 2436, 5237, 284, 50567, 1955, 2556, 314, 2436, 25, 2240, 2605, 286, 1077, 5206, 46154, 25, 5362, 27, 18200, 764, 929, 11, 4179, 486, 10286, 13986, 11...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_insert_all() { let mut map = MultiMap::new(); map.insert("a", "b"); map.insert_all("a", vec!["c"], false); map.insert_all("a", vec!["d"], false); assert_eq!(*map.get("a").unwrap(), vec!["b", "c", "d"]); let replace = map.insert_all("a", vec!["e"], true); assert_eq!(replace, Some(vec!["b", "c", "d"])); let vec = &map["a"]; assert_eq!(vec, &vec!["e"]); }
rust_cleaned_test_functions.jsonl/134333
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 193 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 17678, 5705, 368, 341, 262, 1077, 5206, 2415, 284, 17439, 2227, 486, 931, 1428, 262, 2415, 7030, 445, 64, 497, 330, 65, 3071, 262, 2415, 7030, 5705, 445, 64, 497, 7486, 0, 1183, 66, 7914, 895,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_count() { use rand::thread_rng; use rand::Rng; use rand::seq::SliceRandom; use std::collections::HashMap; TIMER.run(); let mut rng = thread_rng(); let count = Arc::new(AtomicUsize::new(0)); let mut timer_refs = vec![]; let mut timer_map = HashMap::new(); let total = 100000; for _i in 1..total + 1 { let count = count.clone(); let t = rng.gen_range(10, 5000); let timer_ref =TIMER.set_timeout(FuncRuner::new(Box::new(move || { count.fetch_add(1, Ordering::SeqCst); })), t); timer_refs.push(timer_ref); timer_map.insert(timer_ref, true); } let cancel: Vec<usize> = timer_refs.choose_multiple(&mut rng, 50).cloned().collect(); println!("shuffled timer_refs = {:?}", cancel); let mut cancel_success = Vec::new(); let mut cancel_fail = Vec::new(); for c in cancel { if let Some(_) = TIMER.cancel(c) { cancel_success.push(c); } else { cancel_fail.push(c); } thread::sleep(Duration::from_millis(rng.gen_range(10, 100))); } thread::sleep(Duration::from_millis(5100)); println!("run: {:?}, total: {:?}, cancel_success: {}, cancel_fail:{}", count, total, cancel_success.len(), cancel_fail.len()); }
rust_cleaned_test_functions.jsonl/507
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 604 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 3180, 368, 972, 262, 990, 10382, 486, 4528, 66849, 463, 262, 990, 10382, 486, 49, 968, 463, 41819, 10382, 486, 13262, 486, 33236, 13999, 463, 41819, 1460, 486, 51137, 486, 18497, 1926, 262, 49931,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
5
#[test] fn test_benchmarks() { ExtBuilder::build_with(|storage| { pallet_balances::GenesisConfig::<Test, pallet_balances::Instance1> { balances: vec![ (account("Origin", 0, 0), 1 << 32), (account("Vault", 0, 0), 1 << 32), ], } .assimilate_storage(storage) .unwrap(); sla::GenesisConfig::<Test> { vault_target_sla: FixedI128::from(100), vault_redeem_failure_sla_change: FixedI128::from(0), vault_executed_issue_max_sla_change: FixedI128::from(0), vault_submitted_issue_proof: FixedI128::from(0), vault_refunded: FixedI128::from(1), relayer_target_sla: FixedI128::from(100), relayer_block_submission: FixedI128::from(1), relayer_correct_no_data_vote_or_report: FixedI128::from(1), relayer_correct_invalid_vote_or_report: FixedI128::from(10), relayer_correct_liquidation_report: FixedI128::from(1), relayer_correct_theft_report: FixedI128::from(1), relayer_correct_oracle_offline_report: FixedI128::from(1), relayer_false_no_data_vote_or_report: FixedI128::from(-10), relayer_false_invalid_vote_or_report: FixedI128::from(-100), relayer_ignored_vote: FixedI128::from(-10), } .assimilate_storage(storage) .unwrap(); GenesisConfig::<Test> { gov_id: account("Origin", 0, 0), maturity_period: 10, } .assimilate_storage(storage) .unwrap(); }) .execute_with(|| { assert_ok!(test_benchmark_register_staked_relayer::<Test>()); assert_ok!(test_benchmark_deregister_staked_relayer::<Test>()); assert_ok!(test_benchmark_suggest_status_update::<Test>()); assert_ok!(test_benchmark_vote_on_status_update::<Test>()); assert_ok!(test_benchmark_force_status_update::<Test>()); assert_ok!(test_benchmark_slash_staked_relayer::<Test>()); assert_ok!(test_benchmark_report_vault_theft::<Test>()); assert_ok!(test_benchmark_report_vault_under_liquidation_threshold::< Test, >()); assert_ok!(test_benchmark_remove_active_status_update::<Test>()); assert_ok!(test_benchmark_remove_inactive_status_update::<Test>()); }); }
rust_cleaned_test_functions.jsonl/43779
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1370 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 880, 19762, 15544, 368, 341, 286, 9447, 3297, 486, 5834, 6615, 22428, 16172, 91, 341, 310, 58803, 56441, 3020, 486, 84652, 2648, 27638, 2271, 11, 58803, 56441, 3020, 486, 2523, 16, 29, 341, 394, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_neuron_spawn() { let from = *TEST_NEURON_1_OWNER_PRINCIPAL; // Compute the subaccount to which the transfer would have been made let nonce = 1234u64; let block_height = 543212234; let dissolve_delay_seconds = MIN_DISSOLVE_DELAY_FOR_VOTE_ELIGIBILITY_SECONDS; let neuron_stake_e8s = 1_000_000_000; let (mut driver, mut gov, id, _) = governance_with_staked_neuron( dissolve_delay_seconds, neuron_stake_e8s, block_height, from, nonce, ); let neuron = gov.get_neuron_mut(&id).expect("Neuron did not exist"); assert_eq!( neuron.get_neuron_info(driver.now()).state(), NeuronState::NotDissolving ); // Starts with too little maturity neuron.maturity_e8s_equivalent = 187; assert!( neuron.maturity_e8s_equivalent < NetworkEconomics::with_default_values().neuron_minimum_stake_e8s ); let child_controller = *TEST_NEURON_2_OWNER_PRINCIPAL; // An attempt to spawn a neuron should simply return an error and // change nothing. let neuron_before = neuron.clone(); let spawn_res = gov .spawn_neuron( &id, &from, &Spawn { new_controller: Some(child_controller), }, ) .now_or_never() .unwrap(); assert_matches!( spawn_res, Err(GovernanceError{error_type: code, error_message: msg}) if code == InsufficientFunds as i32 && msg.to_lowercase().contains("maturity")); assert_eq!(*gov.get_neuron(&id).unwrap(), neuron_before); // Artificially set the neuron's maturity to sufficient value let neuron = gov.get_neuron_mut(&id).expect("Neuron did not exist"); let parent_maturity_e8s_equivalent: u64 = 123_456_789; assert!( parent_maturity_e8s_equivalent > NetworkEconomics::with_default_values().neuron_minimum_stake_e8s ); neuron.maturity_e8s_equivalent = parent_maturity_e8s_equivalent; // Advance the time so that we can check that the spawned neuron has the age // and the right creation timestamp driver.advance_time_by(1); let child_nid = gov .spawn_neuron( &id, &from, &Spawn { new_controller: Some(child_controller), }, ) .now_or_never() .unwrap() .unwrap(); // We should now have 2 neurons. assert_eq!(gov.proto.neurons.len(), 2); // And we should have two ledger accounts. driver.assert_num_neuron_accounts_exist(2); let child_neuron = gov .get_neuron(&child_nid) .expect("The child neuron is missing"); let parent_neuron = gov.get_neuron(&id).expect("The parent neuron is missing"); let child_subaccount = child_neuron.account.clone(); // Maturity on the parent neuron should be reset. assert_eq!(parent_neuron.maturity_e8s_equivalent, 0); assert_eq!( child_neuron, &Neuron { id: Some(child_nid.clone()), account: child_subaccount, controller: Some(child_controller), cached_neuron_stake_e8s: parent_maturity_e8s_equivalent, created_timestamp_seconds: driver.now(), aging_since_timestamp_seconds: driver.now(), dissolve_state: Some(DissolveState::DissolveDelaySeconds( gov.proto .economics .as_ref() .unwrap() .neuron_spawn_dissolve_delay_seconds )), kyc_verified: true, ..Default::default() } ); }
rust_cleaned_test_functions.jsonl/1161
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1716 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 13925, 36090, 76026, 368, 341, 262, 1077, 504, 284, 353, 10033, 14039, 1511, 711, 62, 16, 74323, 10571, 38439, 3298, 969, 280, 262, 442, 22603, 279, 1186, 4608, 311, 892, 279, 8317, 1035, 614, 1...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_start_training_selected_participant() { let mut protocol = Protocol::new(get_default_fl_settings()); let resp = protocol.start_training(ClientState::Selected); assert_eq!(StartTrainingResponse::Accept, resp); assert!(protocol.next_event().is_none()); }
rust_cleaned_test_functions.jsonl/97780
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 119 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 4906, 32891, 23755, 10495, 21757, 368, 341, 286, 1077, 5206, 11507, 284, 24572, 486, 931, 5433, 9993, 5081, 10853, 5231, 286, 1077, 9039, 284, 11507, 4962, 32891, 46851, 1397, 486, 6316, 626, 286, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_issue_203() { struct Bar(RwLock<()>); impl Drop for Bar { fn drop(&mut self) { let _n = self.0.write(); } } thread_local! { static B: Bar = Bar(RwLock::new(())); } thread::spawn(|| { B.with(|_| ()); let a = RwLock::new(()); let _a = a.read(); }) .join() .unwrap(); }
rust_cleaned_test_functions.jsonl/15765
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 278 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 53340, 62, 17, 15, 18, 368, 341, 286, 2036, 4716, 2785, 86, 11989, 71698, 626, 286, 11605, 15733, 369, 4716, 341, 310, 5168, 5943, 2099, 6984, 656, 8, 341, 394, 1077, 716, 77, 284, 656, 13, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_cipher_filter() { let ecdhe_ciphers: Vec<&TlsCipherSuite> = CIPHERS .values() .filter(|c| c.kx == TlsCipherKx::Ecdhe) .collect(); assert!(ecdhe_ciphers.len() > 20); }
rust_cleaned_test_functions.jsonl/37915
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 144 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 76692, 8727, 368, 341, 286, 1077, 384, 4385, 383, 666, 82077, 25, 11312, 52244, 51, 4730, 79460, 28000, 29, 284, 356, 58088, 50, 198, 310, 659, 3661, 741, 310, 659, 5315, 22428, 66, 91, 272, 5...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_url_1() { test_url("/npoplayer.html?tx_eonpo_npoplayer%5Bmid%5D=WO_EO_16582885&tx_eonpo_npoplayer%5Bhash%5D=45a69ca57ac8eee5025d45f06f9910f85fd9a0db814c590fg560293d<549880f&tx_eonpo_npoplayer%5Boverlay%5D=https%3A%2F%2Fblauwbloed.eo.nl%2Ffileadmin%2Fbestanden-2016%2Fuser_upload%2F2021-07%2FKoninklijk_gezin_fotosessie_zomer_2021.jpg&tx_eonpo_npoplayer%5Bhasadconsent%5D=0&tx_eonpo_npoplayer%5Breferralurl%5D=https%3A%2F%2Fblauwbloed.eo.nl%2Fartikel%2F2021%2F07%2Fkijk-de-eerste-foto-van-de-fotosessie-van-de-oranjes&tx_eonpo_npoplayer%5BsterSiteId%5D=blauwbloed&tx_eonpo_npoplayer%5BsterIdentifier%5D=blauwbloed-ios-smartphone&tx_eonpo_npoplayer%5BatinternetSiteId%5D=25&tx_eonpo_npoplayer%5BatinternetUserId%5D=287dbe14-d677-4b9b-8eeb-ecb389349db1&tx_eonpo_npoplayer%5BatinternetUserIdCookieDuration%5D=394"); }
rust_cleaned_test_functions.jsonl/23709
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 464 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2903, 62, 16, 368, 341, 286, 1273, 2903, 4283, 6199, 93108, 2564, 30, 3998, 2204, 263, 5368, 1089, 8374, 10333, 4, 20, 33, 16106, 4, 20, 35, 28, 22681, 2089, 46, 62, 16, 21, 20, 23, 17, 23...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_hover_return_impl_traits_has_goto_type_action() { check_actions( r#" trait Foo {} trait Bar {} fn foo() -> impl Foo + Bar {} fn main() { let s$0t = foo(); } "#, expect![[r#" [ GoToType( [ HoverGotoTypeData { mod_path: "test::Foo", nav: NavigationTarget { file_id: FileId( 0, ), full_range: 0..12, focus_range: 6..9, name: "Foo", kind: Trait, description: "trait Foo", }, }, HoverGotoTypeData { mod_path: "test::Bar", nav: NavigationTarget { file_id: FileId( 0, ), full_range: 13..25, focus_range: 19..22, name: "Bar", kind: Trait, description: "trait Bar", }, }, ], ), ] "#]], ); }
rust_cleaned_test_functions.jsonl/66676
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1295 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 53445, 12511, 21007, 39693, 21778, 97732, 1819, 7931, 368, 341, 286, 1779, 25368, 1006, 310, 435, 2, 698, 29432, 33428, 5613, 29432, 4716, 5613, 8822, 15229, 368, 1464, 11605, 33428, 488, 4716, 1008...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_open_subkey_with_flags_query_info() { let hklm = RegKey::predef(HKEY_LOCAL_MACHINE); let win = hklm .open_subkey_with_flags("Software\\Microsoft\\Windows", KEY_READ) .unwrap(); let info = win.query_info().unwrap(); info.get_last_write_time_system(); #[cfg(feature = "chrono")] info.get_last_write_time_chrono(); assert!(win .open_subkey_with_flags("CurrentVersion\\", KEY_READ) .is_ok()); assert!(hklm .open_subkey_with_flags("i\\just\\hope\\nobody\\created\\that\\key", KEY_READ) .is_err()); }
rust_cleaned_test_functions.jsonl/128082
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 277 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 11311, 5228, 792, 6615, 14130, 5738, 3109, 368, 341, 262, 1077, 305, 10561, 76, 284, 3184, 1592, 486, 1726, 750, 10896, 4784, 28399, 66702, 317, 262, 1077, 3164, 284, 305, 10561, 76, 198, 286, 6...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_utf_16le_decode_near_end() { let mut output = [0u8; 4]; let mut decoder = UTF_16LE.new_decoder(); { let (result, read, written, had_errors) = decoder.decode_to_utf8(&[0x03], &mut output[..], false); assert_eq!(result, CoderResult::InputEmpty); assert_eq!(read, 1); assert_eq!(written, 0); assert!(!had_errors); assert_eq!(output[0], 0x0); } { let (result, read, written, had_errors) = decoder.decode_to_utf8(&[0x26, 0x03, 0x26], &mut output[..], false); assert_eq!(result, CoderResult::OutputFull); assert_eq!(read, 1); assert_eq!(written, 3); assert!(!had_errors); assert_eq!(output[0], 0xE2); assert_eq!(output[1], 0x98); assert_eq!(output[2], 0x83); assert_eq!(output[3], 0x00); } }
rust_cleaned_test_functions.jsonl/86902
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 550 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 39453, 62, 16, 21, 273, 15227, 76340, 6213, 368, 341, 286, 1077, 5206, 2550, 284, 508, 15, 84, 23, 26, 220, 19, 935, 286, 1077, 5206, 24551, 284, 20076, 62, 16, 21, 867, 4618, 49843, 543, 28...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_serialize_combo_option() { let m = UciMessage::Option(UciOptionConfig::Combo { name: "Style".to_string(), default: Some(String::from("Normal")), var: vec![String::from("Solid"), String::from("Normal"), String::from("Risky")], }); assert_eq!(m.serialize(), "option name Style type combo default Normal var Solid var Normal var Risky"); }
rust_cleaned_test_functions.jsonl/19052
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 177 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 88686, 54781, 9672, 368, 341, 286, 1077, 296, 284, 547, 5855, 2052, 486, 5341, 12317, 5855, 5341, 2648, 486, 56893, 341, 310, 829, 25, 330, 2323, 3263, 983, 3904, 3148, 310, 1638, 25, 4329, 2242...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_specfile() { let specfile = super::test_utils::file("logspec.toml"); std::fs::remove_file(&specfile).ok(); assert!(!specfile.exists()); let logger = Logger::try_with_str("info") .unwrap() .log_to_file( FileSpec::default() .directory(super::test_utils::dir()) .suppress_timestamp(), ) .format(detailed_format) .start_with_specfile(&specfile) .unwrap_or_else(|e| panic!("Logger initialization failed because: {}", e)); error!("This is an error-0"); warn!("This is a warning-0"); info!("This is an info-0"); debug!("This is a debug-0"); trace!("This is a trace-0"); eprintln!( "[{}] ===== behave like many editors: rename and recreate, as warn", chrono::Local::now() ); { let mut old_name = specfile.clone(); old_name.set_file_name("old_logspec.toml"); std::fs::rename(&specfile, old_name).unwrap(); let mut file = std::fs::OpenOptions::new() .create(true) .write(true) .open(&specfile) .unwrap(); file.write_all( b" global_level = 'warn' [modules] ", ) .unwrap(); } std::thread::sleep(std::time::Duration::from_millis(WAIT_MILLIS)); error!("This is an error-1"); warn!("This is a warning-1"); info!("This is an info-1"); debug!("This is a debug-1"); trace!("This is a trace-1"); eprintln!( "[{}] ===== truncate and rewrite, update to error", chrono::Local::now() ); { let mut file = std::fs::OpenOptions::new() .truncate(true) .write(true) .open(&specfile) .unwrap(); file.write_all( b" global_level = 'error' [modules] ", ) .unwrap(); } std::thread::sleep(std::time::Duration::from_millis(WAIT_MILLIS)); error!("This is an error-2"); warn!("This is a warning-2"); info!("This is an info-2"); debug!("This is a debug-2"); trace!("This is a trace-2"); if cfg!(feature = "specfile") { eprintln!("feature is: specfile!"); logger.validate_logs(&[ ("ERROR", "test_specfile::a", "error-0"), ("WARN", "test_specfile::a", "warning-0"), ("INFO", "test_specfile::a", "info-0"), ("ERROR", "test_specfile::a", "error-1"), ("WARN", "test_specfile::a", "warning-1"), ("ERROR", "test_specfile::a", "error-2"), ]); } else { eprintln!("feature is: specfile_without_notification!"); logger.validate_logs(&[ ("ERROR", "test_specfile::a", "error-0"), ("WARN", "test_specfile::a", "warning-0"), ("INFO", "test_specfile::a", "info-0"), ("ERROR", "test_specfile::a", "error-1"), ("WARN", "test_specfile::a", "warning-1"), ("INFO", "test_specfile::a", "info-1"), ("ERROR", "test_specfile::a", "error-2"), ("WARN", "test_specfile::a", "warning-2"), ("INFO", "test_specfile::a", "info-2"), ]); } }
rust_cleaned_test_functions.jsonl/125196
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 2012 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 13594, 1192, 368, 341, 286, 1077, 1398, 1192, 284, 2256, 486, 1944, 17309, 486, 1192, 445, 839, 9535, 73494, 75, 3071, 286, 1460, 486, 3848, 486, 5399, 2458, 2099, 9535, 1192, 568, 562, 543, 286...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_guide_library_positive() { let g1 = Guide::new(0, "foo-1", "ACGTCAGCATGCATGACGTT", "FOO", GuideType::Other); let g2 = Guide::new(1, "foo-2", "GCTAGACTGGACTCTAATGC", "FOO", GuideType::Other); let l1 = GuideLibrary::new(vec![]).unwrap(); assert_eq!(l1.len(), 0); assert!(l1.is_empty()); let l2 = GuideLibrary::new(vec![g1.clone(), g2.clone()]).unwrap(); assert_eq!(l2.len(), 2); assert_eq!(l2.guides, vec![g1, g2]); assert_eq!(l2.guide_length, 20); }
rust_cleaned_test_functions.jsonl/48767
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 282 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 80407, 39461, 54160, 368, 341, 286, 1077, 342, 16, 284, 12712, 486, 931, 7, 15, 11, 330, 7975, 12, 16, 497, 330, 1706, 38, 7749, 1890, 28196, 22863, 828, 38, 1706, 38, 14903, 497, 330, 3788, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_many_categorys() { let enc = build_fake_str_enc(); let cat_it = ["dog", "cat", "fish", "background"].iter().cloned(); let res: Vec<Option<Vec<f64>>> = cat_it.map(|v| enc.get_one_hot(&v)).collect(); let v = vec![ Some(vec![0.0, 1.0, 0.0]), Some(vec![0.0, 0.0, 1.0]), None, Some(vec![1.0, 0.0, 0.0]), ]; assert_eq!(res, v) }
rust_cleaned_test_functions.jsonl/109963
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 259 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 22101, 11847, 82, 368, 341, 286, 1077, 3209, 284, 1936, 56881, 2895, 13781, 543, 286, 1077, 8251, 14631, 284, 4383, 18457, 497, 330, 4616, 497, 330, 18170, 497, 330, 6742, 5521, 2015, 1005, 564, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_catchable() { #[derive(Debug, Display, Clone)] enum MainErrorKind { A1, #[allow(dead_code)] A2, } impl Error for MainErrorKind {}; impl From<MainErrorKind> for CommonError { fn from(error: MainErrorKind) -> Self { CommonError::new(CommonErrorKind::Main, Box::new(error)) } } #[derive(Debug, Display, Clone)] enum ServiceErrorKind { B1, B2, } impl Error for ServiceErrorKind {}; impl From<ServiceErrorKind> for CommonError { fn from(error: ServiceErrorKind) -> Self { CommonError::new(CommonErrorKind::Service, Box::new(error)) } } fn call_service_b1() -> CommonResult<()> { Err(ServiceErrorKind::B1.into()) } fn call_service_b2() -> CommonResult<()> { Err(ServiceErrorKind::B2.into()) } // will catch b1 fn call_main_a1() -> CommonResult<()> { let _result = call_service_b1().or_else_catch::<ServiceErrorKind, _>(|e| match e { ServiceErrorKind::B1 => Some(Err(MainErrorKind::A1.into())), _ => None, })?; Ok(()) } // will catch b1 and ignore the error fn call_main_a1_2() -> CommonResult<()> { let _result = call_service_b1().or_else_catch::<ServiceErrorKind, _>(|e| match e { ServiceErrorKind::B1 => Some(Ok(())), _ => None, })?; Ok(()) } // will not catch b2 fn call_main_a2() -> CommonResult<()> { let _result = call_service_b2()?; Ok(()) } assert_eq!(format!("{}", call_main_a1().unwrap_err()), "Main Error: A1"); assert!(call_main_a1_2().is_ok()); assert_eq!( format!("{}", call_main_a2().unwrap_err()), "Service Error: B2" ); }
rust_cleaned_test_functions.jsonl/103847
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 712 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 666, 754, 480, 368, 341, 197, 197, 13353, 27098, 42618, 11, 10623, 11, 27913, 5563, 197, 37777, 4697, 1454, 10629, 341, 298, 22985, 16, 345, 298, 197, 13353, 7183, 83207, 4136, 5563, 298, 22985, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_code_with_spaces() { let mut reader = Lexer::from_str("1 2 3"); assert_tok( &mut reader, TokenKind::LitInt("1".into(), IntBase::Dec, IntSuffix::Int), 1, 1, ); assert_tok( &mut reader, TokenKind::LitInt("2".into(), IntBase::Dec, IntSuffix::Int), 1, 3, ); assert_tok( &mut reader, TokenKind::LitInt("3".into(), IntBase::Dec, IntSuffix::Int), 1, 5, ); assert_end(&mut reader, 1, 6); }
rust_cleaned_test_functions.jsonl/101124
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 372 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 4136, 6615, 67883, 368, 341, 286, 1077, 5206, 6604, 284, 85082, 486, 1499, 2895, 445, 16, 220, 17, 220, 18, 797, 286, 2060, 76162, 1006, 310, 609, 6984, 6604, 345, 310, 9660, 10629, 486, 68954, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_passfile() -> Result<()> { let user = "user"; let pass = "pass"; let path = create_passfile(&UserConfig::new(user.into(), pass.into()))?; let buf = read(&path)?; let s = String::from_utf8(buf)?; assert_eq!(s, format!("{}+plc\n{}\n", user, pass)); let output = Command::new("/usr/bin/cat").arg(&path).output()?; assert!(output.status.success()); Ok(()) }
rust_cleaned_test_functions.jsonl/102213
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 169 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 15464, 1192, 368, 1464, 5714, 71698, 341, 197, 10217, 1196, 284, 330, 872, 876, 197, 10217, 1494, 284, 330, 6385, 876, 197, 10217, 1815, 284, 1855, 15464, 1192, 2099, 1474, 2648, 486, 931, 4277, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
5
#[test] fn test_optopt() { let long_args = vec!("--test=20".to_string()); let opts = vec!(optopt("t", "test", "testing", "TEST")); let rs = getopts(long_args.as_slice(), opts.as_slice()); match rs { Ok(ref m) => { assert!(m.opt_present("test")); assert_eq!(m.opt_str("test").unwrap(), "20"); assert!((m.opt_present("t"))); assert_eq!(m.opt_str("t").unwrap(), "20"); } _ => panic!() } let short_args = vec!("-t".to_string(), "20".to_string()); match getopts(short_args.as_slice(), opts.as_slice()) { Ok(ref m) => { assert!((m.opt_present("test"))); assert_eq!(m.opt_str("test").unwrap(), "20"); assert!((m.opt_present("t"))); assert_eq!(m.opt_str("t").unwrap(), "20"); } _ => panic!() } }
rust_cleaned_test_functions.jsonl/11179
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 505 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 15032, 2912, 368, 341, 286, 1077, 1293, 8384, 284, 7486, 17223, 313, 1944, 28, 17, 15, 3263, 983, 3904, 1423, 286, 1077, 12185, 284, 7486, 10297, 2912, 2912, 445, 83, 497, 330, 1944, 497, 330, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_parsing_after_editing_end_of_code() { let mut parser = Parser::new(); parser.set_language(get_language("javascript")).unwrap(); let mut code = b"x * (100 + abc);".to_vec(); let mut tree = parser.parse(&code, None).unwrap(); assert_eq!( tree.root_node().to_sexp(), concat!( "(program (expression_statement (binary_expression ", "left: (identifier) ", "right: (parenthesized_expression (binary_expression left: (number) right: (identifier))))))", ) ); let position = code.len() - 2; perform_edit( &mut tree, &mut code, &Edit { position, deleted_length: 0, inserted_text: b".d".to_vec(), }, ); let mut recorder = ReadRecorder::new(&code); let tree = parser .parse_with(&mut |i, _| recorder.read(i), Some(&tree)) .unwrap(); assert_eq!( tree.root_node().to_sexp(), concat!( "(program (expression_statement (binary_expression ", "left: (identifier) ", "right: (parenthesized_expression (binary_expression ", "left: (number) ", "right: (member_expression ", "object: (identifier) ", "property: (property_identifier)))))))" ) ); assert_eq!(recorder.strings_read(), vec![" * ", "abc.d)",]); }
rust_cleaned_test_functions.jsonl/15867
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 666 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 620, 28598, 19844, 13156, 287, 6213, 3575, 4136, 368, 341, 262, 1077, 5206, 6729, 284, 21102, 486, 931, 543, 262, 6729, 980, 29021, 5433, 29021, 445, 14073, 15197, 15454, 1428, 262, 1077, 5206, 20...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_grounding_not_3() -> TestResult { test_grounding( r#" f(x) if x > 0 and not (x >= 1 and x = 1); "#, term!(call!("f", [sym!("x")])), &[|r: Bindings| { assert_partial_expression!(r, "x", "_this > 0 and _this != 1"); Ok(()) }], ) }
rust_cleaned_test_functions.jsonl/63052
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 262 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 72492, 287, 7913, 62, 18, 368, 1464, 3393, 2077, 341, 286, 1273, 72492, 287, 1006, 310, 435, 2, 698, 310, 282, 2075, 8, 421, 856, 861, 220, 15, 323, 537, 320, 87, 2604, 220, 16, 323, 856, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_args_lr_update_rate() { let mut args = Args::new(); assert_eq!(100, args.lr_update_rate()); args.set_lr_update_rate(50); assert_eq!(50, args.lr_update_rate()); }
rust_cleaned_test_functions.jsonl/118612
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 111 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 8384, 46086, 8882, 9246, 368, 341, 286, 1077, 5206, 2827, 284, 17693, 486, 931, 543, 286, 2060, 10714, 10297, 16, 15, 15, 11, 2827, 63349, 8882, 9246, 5231, 286, 2827, 980, 46086, 8882, 9246, 7,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_memory_transport_server_only_auth() { test_transport_success( memory::MemoryTransport, Auth::ServerOnly, "/memory/0", expect_memory_noise_addr, ); }
rust_cleaned_test_functions.jsonl/14345
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 128 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 19195, 46398, 12015, 18410, 14014, 368, 341, 286, 1273, 46398, 18632, 1006, 310, 4938, 486, 10642, 27560, 345, 310, 7366, 486, 5475, 7308, 345, 310, 3521, 17269, 14, 15, 756, 310, 1720, 19195, 403...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_range_of_line_at_position_b() { let code: Vec<char> = "text\ntext".to_string().chars().collect(); assert_eq!(range_of_line_at_position(&code, 5), 5..9); let code: Vec<char> = "text\ntext".to_string().chars().collect(); assert_eq!(range_of_line_at_position(&code, 7), 5..9); let code: Vec<char> = "text\ntext".to_string().chars().collect(); assert_eq!(range_of_line_at_position(&code, 8), 5..9); }
rust_cleaned_test_functions.jsonl/126884
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 218 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 9698, 3575, 6528, 3752, 9661, 880, 368, 341, 286, 1077, 2038, 25, 11312, 21919, 29, 284, 330, 1318, 59, 406, 427, 3263, 983, 3904, 1005, 19255, 1005, 17384, 543, 286, 2060, 10714, 10297, 9669, 3...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_integration() { let expr = ExprDefBuilder::aggr_func(ExprType::Sum, FieldTypeTp::Double) .push_child(ExprDefBuilder::column_ref(0, FieldTypeTp::VarString)) .build(); AggrFnDefinitionParserSum.check_supported(&expr).unwrap(); let src_schema = [FieldTypeTp::VarString.into()]; let mut columns = LazyBatchColumnVec::from(vec![{ let mut col = LazyBatchColumn::decoded_with_capacity_and_tp(0, EvalType::Bytes); col.mut_decoded().push_bytes(Some(b"12.5".to_vec())); col.mut_decoded().push_bytes(None); col.mut_decoded().push_bytes(Some(b"10000.0".to_vec())); col.mut_decoded().push_bytes(Some(b"42.0".to_vec())); col.mut_decoded().push_bytes(None); col }]); let logical_rows = vec![0, 1, 3, 4]; let mut schema = vec![]; let mut exp = vec![]; let aggr_fn = AggrFnDefinitionParserSum .parse(expr, &Tz::utc(), &src_schema, &mut schema, &mut exp) .unwrap(); assert_eq!(schema.len(), 1); assert_eq!(schema[0].tp(), FieldTypeTp::Double); assert_eq!(exp.len(), 1); let mut state = aggr_fn.create_state(); let mut ctx = EvalContext::default(); let exp_result = exp[0] .eval(&mut ctx, &src_schema, &mut columns, &logical_rows, 4) .unwrap(); let exp_result = exp_result.vector_value().unwrap(); let slice: &[Option<Real>] = exp_result.as_ref().as_ref(); state .update_vector(&mut ctx, slice, exp_result.logical_rows()) .unwrap(); let mut aggr_result = [VectorValue::with_capacity(0, EvalType::Real)]; state.push_result(&mut ctx, &mut aggr_result).unwrap(); assert_eq!(aggr_result[0].as_real_slice(), &[Real::new(54.5).ok()]); }
rust_cleaned_test_functions.jsonl/110901
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 921 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 90250, 368, 341, 286, 1077, 15169, 284, 28819, 2620, 3297, 486, 351, 901, 9596, 7, 16041, 929, 486, 9190, 11, 84614, 62241, 486, 7378, 340, 310, 659, 9077, 17268, 7, 16041, 2620, 3297, 486, 6229...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_struct() { ok("struct Foo {}"); err( "struct Foo {} struct Foo {}", pos(1, 15), Msg::ShadowStruct("Foo".into()), ); err( "struct Foo {} class Foo {}", pos(1, 15), Msg::ShadowStruct("Foo".into()), ); err( "struct Foo {} fun Foo() {}", pos(1, 15), Msg::ShadowStruct("Foo".into()), ); }
rust_cleaned_test_functions.jsonl/45236
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 280 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 15126, 368, 341, 286, 5394, 445, 1235, 33428, 4687, 797, 286, 1848, 1006, 310, 330, 1235, 33428, 4687, 2036, 33428, 4687, 756, 310, 1133, 7, 16, 11, 220, 16, 20, 1326, 310, 24205, 486, 23667, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_hand_evaluation() { let g = test_helpers::create_test_bid_phase(); // User: ♣2 ♣6 ♣9 ♣10 ♣A ♥6 ♥9 ♥10 ♥A ♠2 ♠7 ♠8 ♠K assert_eq!( hand_evaluation(hand_score(g.hand(Position::User)), Some(Suit::Clubs)), BidResponse::HandEvaluation(HandRating::Excellent, Some(Suit::Clubs)) ); assert_eq!( hand_evaluation(hand_score(g.hand(Position::User)), Some(Suit::Diamonds)), BidResponse::HandEvaluation(HandRating::Fair, Some(Suit::Diamonds)) ); // Dummy: ♦6 ♦7 ♦8 ♦K ♣5 ♣K ♥4 ♥7 ♥J ♥Q ♠4 ♠5 ♠10 assert_eq!( hand_evaluation(hand_score(g.hand(Position::Dummy)), Some(Suit::Clubs)), BidResponse::HandEvaluation(HandRating::Poor, Some(Suit::Clubs)) ); assert_eq!( hand_evaluation(hand_score(g.hand(Position::Dummy)), Some(Suit::Diamonds)), BidResponse::HandEvaluation(HandRating::Fair, Some(Suit::Diamonds)) ); }
rust_cleaned_test_functions.jsonl/83222
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 521 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 23194, 86505, 368, 341, 286, 1077, 342, 284, 1273, 54473, 486, 3182, 4452, 62509, 37593, 543, 286, 442, 2657, 25, 220, 35358, 96, 17, 35358, 96, 21, 35358, 96, 24, 35358, 96, 16, 15, 35358, 96...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_from() { let a = Bump::new(); assert_eq!(Map::<i64, i64>::from(&a, Vec::new()), map![]); assert_eq!( Map::<i64, i64>::from(&a, vec![(6, 7), (8, 9)]), map![&a; 8 => 9, 6 => 7] ); }
rust_cleaned_test_functions.jsonl/118072
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 162 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 5673, 368, 341, 286, 1077, 264, 284, 425, 1510, 486, 931, 543, 286, 2060, 10714, 10297, 2227, 27638, 72, 21, 19, 11, 600, 21, 19, 6831, 1499, 2099, 64, 11, 11312, 486, 931, 11858, 2415, 0, 5...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_query_directed_bounds() { // if shift and expand operation have reached the end of the vecs an error should be returned let mut lsh = hi8::LshMem::new(2, 1, 1).multi_probe(1000).l2(4.).unwrap(); lsh.store_vec(&[1.]).unwrap(); assert!(lsh.query_bucket_ids(&[1.]).is_err()) }
rust_cleaned_test_functions.jsonl/107651
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 148 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 5738, 32871, 291, 36878, 368, 341, 286, 442, 421, 6407, 323, 9225, 5666, 614, 8643, 279, 835, 315, 279, 7486, 82, 458, 1465, 1265, 387, 5927, 198, 286, 1077, 5206, 326, 927, 284, 15588, 23, 48...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_generated() { let mut rng = StdRng::seed_from_u64(0); let mut n_pixels = 0; while n_pixels < 20_000_000 { let min_len = rng.gen_range(1..=5000); let channels = rng.gen_range(3..=4); let gen = ImageGen::new_random(&mut rng); let img = gen.generate(&mut rng, channels, min_len); let encode = |data: &[u8], size| encode_to_vec(data, size, 1); let decode = |data: &[u8]| decode_to_vec(data).map(|r| r.1); let encode_c = |data: &[u8], size| qoi_encode(data, size, 1, channels as _); let decode_c = |data: &[u8]| qoi_decode(data, channels as _).map(|r| r.1); check_roundtrip("qoi-rust -> qoi-rust", &img, channels as _, encode, decode); check_roundtrip("qoi-rust -> qoi.h", &img, channels as _, encode, decode_c); check_roundtrip("qoi.h -> qoi-rust", &img, channels as _, encode_c, decode); let size = (img.len() / channels) as u32; let encoded = encode(&img, size).unwrap(); let encoded_c = encode_c(&img, size).unwrap(); cfg_if! { if #[cfg(feature = "reference")] { let eq = encoded.as_slice() == encoded_c.as_ref(); assert!(eq, "qoi-rust [reference mode] doesn't match qoi.h"); } else { let eq = encoded.len() == encoded_c.len(); assert!(eq, "qoi-rust [non-reference mode] length doesn't match qoi.h"); } } n_pixels += size; } }
rust_cleaned_test_functions.jsonl/27216
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 730 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 67313, 368, 341, 262, 1077, 5206, 28422, 284, 42517, 49, 968, 486, 22602, 5673, 7300, 21, 19, 7, 15, 626, 262, 1077, 5206, 308, 49745, 284, 220, 15, 280, 262, 1393, 308, 49745, 366, 220, 17, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_to_vec() { Python::with_gil(|py| { let src = b"Hello Python"; let bytearray = PyByteArray::new(py, src); let vec = bytearray.to_vec(); assert_eq!(src, vec.as_slice()); }); }
rust_cleaned_test_functions.jsonl/47842
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 148 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2346, 13251, 368, 341, 286, 13027, 486, 4197, 1889, 321, 22428, 3288, 91, 341, 310, 1077, 2286, 284, 293, 1, 9707, 13027, 876, 310, 1077, 95603, 284, 5355, 18394, 486, 931, 46827, 11, 2286, 626,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_doesnt_accept_wrong_proto() { #[cfg(feature = "proto-ipv4")] { let socket = RawSocket::new( IpVersion::Ipv4, IpProtocol::Unknown(ipv4_locals::IP_PROTO + 1), buffer(1), buffer(1), ); assert!(!socket.accepts(&ipv4_locals::HEADER_REPR)); #[cfg(feature = "proto-ipv6")] assert!(!socket.accepts(&ipv6_locals::HEADER_REPR)); } #[cfg(feature = "proto-ipv6")] { let socket = RawSocket::new( IpVersion::Ipv6, IpProtocol::Unknown(ipv6_locals::IP_PROTO + 1), buffer(1), buffer(1), ); assert!(!socket.accepts(&ipv6_locals::HEADER_REPR)); #[cfg(feature = "proto-ipv4")] assert!(!socket.accepts(&ipv4_locals::HEADER_REPR)); } }
rust_cleaned_test_functions.jsonl/7287
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 572 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 96374, 406, 35728, 75198, 37689, 368, 341, 286, 11506, 14072, 27062, 284, 330, 15110, 12, 42676, 19, 5422, 286, 341, 310, 1077, 7575, 284, 23022, 10286, 486, 931, 1006, 394, 35033, 5637, 486, 8065...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_get_slice_range() { let data = &[0, 1, 2, 3, 4, 5, 6, 7, 8, 9]; assert_eq!(get_slice_range(data, 0..6).unwrap(), &[0, 1, 2, 3, 4, 5]); assert_eq!(get_slice_range(data, 7..10).unwrap(), &[7, 8, 9]); get_slice_range(data, 5..15).unwrap_err(); get_slice_range(data, 20..25).unwrap_err(); }
rust_cleaned_test_functions.jsonl/100520
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 187 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 3062, 26488, 9698, 368, 341, 286, 1077, 821, 284, 44590, 15, 11, 220, 16, 11, 220, 17, 11, 220, 18, 11, 220, 19, 11, 220, 20, 11, 220, 21, 11, 220, 22, 11, 220, 23, 11, 220, 24, 935, 2...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_straight_flush_ranks() { test(&["4H 6H 7H 8H 5H", "5S 7S 8S 9S 6S"], &["5S 7S 8S 9S 6S"]) }
rust_cleaned_test_functions.jsonl/49921
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 73 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2895, 7386, 39213, 1710, 4039, 368, 341, 1066, 262, 1273, 2099, 1183, 19, 39, 220, 21, 39, 220, 22, 39, 220, 23, 39, 220, 20, 39, 497, 330, 20, 50, 220, 22, 50, 220, 23, 50, 220, 24, 50,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_read_client_state_failed_by_supply_error_client_id() { let gp_client_id = ClientId::new(ClientType::Grandpa, 0).unwrap(); let gp_client_id_failed = ClientId::new(ClientType::Grandpa, 1).unwrap(); let gp_client_state = GPClientState::new( ChainId::new("ibc".to_string(), 0), Height::default(), Height::default(), ) .unwrap(); let gp_client_state = AnyClientState::Grandpa(gp_client_state); let mut context: Context<Test> = Context::new(); new_test_ext().execute_with(|| { assert_eq!( context .store_client_state(gp_client_id.clone(), gp_client_state.clone()) .is_ok(), true ); let ret = ClientReader::client_state(&context, &gp_client_id_failed) .unwrap_err() .to_string(); assert_eq!(ret, ICS02Error::client_not_found(gp_client_id_failed).to_string()); }) }
rust_cleaned_test_functions.jsonl/60059
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 333 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6443, 8179, 4387, 35060, 3710, 65630, 4096, 8179, 842, 368, 341, 10217, 28705, 8179, 842, 284, 8423, 764, 486, 931, 46851, 929, 486, 40151, 6595, 11, 220, 15, 568, 15454, 543, 10217, 28705, 8179, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_try_map() { // One - OK let one: OneOrSet<MockKeyU8> = OneOrSet::new_one(MockKeyU8(1)); let one_add: OneOrSet<MockKeyU8> = one .try_map(|item| { if item.key() == &1 { Ok(MockKeyU8(item.0 + 1)) } else { Err(Error::OneOrSetEmpty) } }) .unwrap(); assert_eq!(one_add, OneOrSet::new_one(MockKeyU8(2))); // One - ERROR let one_err: OneOrSet<MockKeyU8> = OneOrSet::new_one(MockKeyU8(1)); let result_one: Result<OneOrSet<MockKeyBool>> = one_err.try_map(|item| { if item.key() == &1 { Err(Error::OneOrSetEmpty) } else { Ok(MockKeyBool(false)) } }); assert!(matches!(result_one, Err(Error::OneOrSetEmpty))); // Set - OK let set: OneOrSet<MockKeyU8> = OneOrSet::new_set((1..=3).map(MockKeyU8).collect()).unwrap(); let set_add: OneOrSet<MockKeyU8> = set .try_map(|item| { if item.key() < &4 { Ok(MockKeyU8(item.0 + 10)) } else { Err(Error::OneOrSetEmpty) } }) .unwrap(); assert_eq!(set_add, OneOrSet::new_set((11..=13).map(MockKeyU8).collect()).unwrap()); // Set - ERROR let set_err: OneOrSet<MockKeyU8> = OneOrSet::new_set((1..=3).map(MockKeyU8).collect()).unwrap(); let result_set: Result<OneOrSet<MockKeyU8>> = set_err.try_map(|item| { if item.key() < &4 { Err(Error::OneOrSetEmpty) } else { Ok(MockKeyU8(item.0)) } }); assert!(matches!(result_set, Err(Error::OneOrSetEmpty))); // Set reduced to one - OK let set_many: OneOrSet<MockKeyU8> = OneOrSet::new_set([2, 4, 6, 8].into_iter().map(MockKeyU8).collect()).unwrap(); assert_eq!(set_many.len(), 4); let set_bool: OneOrSet<MockKeyBool> = set_many .try_map(|item| { if item.key() % 2 == 0 { Ok(MockKeyBool(item.0 % 2 == 0)) } else { Err(Error::OneOrSetEmpty) } }) .unwrap(); assert_eq!(set_bool, OneOrSet::new_one(MockKeyBool(true))); assert_eq!(set_bool.0, OneOrSetInner::One(MockKeyBool(true))); assert_eq!(set_bool.len(), 1); }
rust_cleaned_test_functions.jsonl/5924
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1113 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 53283, 5376, 368, 341, 262, 442, 3776, 481, 10402, 198, 262, 1077, 825, 25, 3776, 2195, 1649, 27, 11571, 1592, 52, 23, 29, 284, 3776, 2195, 1649, 486, 931, 11667, 66436, 1592, 52, 23, 7, 16, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
6
#[test] fn test_position() { let b = [1, 2, 3, 5, 5]; assert_eq!(b.iter().position(|&v| v == 9), None); assert_eq!(b.iter().position(|&v| v == 5), Some(3)); assert_eq!(b.iter().position(|&v| v == 3), Some(2)); assert_eq!(b.iter().position(|&v| v == 0), None); }
rust_cleaned_test_functions.jsonl/9607
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 141 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 9661, 368, 341, 262, 1077, 293, 284, 508, 16, 11, 220, 17, 11, 220, 18, 11, 220, 20, 11, 220, 20, 935, 262, 2060, 10714, 10297, 65, 19471, 1005, 3487, 22428, 5, 85, 91, 348, 621, 220, 24, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_security_feature_from_str() { assert_eq!(SecurityFeature::from_str("nat").unwrap(), SecurityFeature::NAT); assert_eq!(SecurityFeature::from_str("NAT").unwrap(), SecurityFeature::NAT); assert_eq!(SecurityFeature::from_str("NaT").unwrap(), SecurityFeature::NAT); assert_eq!( SecurityFeature::from_str("nnat").unwrap_err().to_string(), format!("Invalid security feature: 'nnat'") ); }
rust_cleaned_test_functions.jsonl/112937
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 196 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 48726, 17069, 5673, 2895, 368, 341, 286, 2060, 10714, 10297, 15352, 13859, 486, 1499, 2895, 445, 33297, 1827, 15454, 1507, 8234, 13859, 486, 45, 828, 317, 286, 2060, 10714, 10297, 15352, 13859, 486,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_g1_generator() { let generator = G1Affine::prime_subgroup_generator(); assert!(generator.is_on_curve()); assert!(generator.is_in_correct_subgroup_assuming_on_curve()); }
rust_cleaned_test_functions.jsonl/15276
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 86 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 1889, 16, 25813, 368, 341, 262, 1077, 13823, 284, 479, 16, 25841, 482, 486, 32338, 5228, 4074, 25813, 543, 262, 2060, 10297, 35851, 2079, 4470, 43407, 1423, 262, 2060, 10297, 35851, 2079, 1243, 31...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_if_not_endif() { let text = "{{ if not foo }}Hello!{{ endif }}"; let instructions = compile(text).unwrap(); assert_eq!(2, instructions.len()); assert_eq!(&Branch(vec!["foo"], false, 2), &instructions[0]); assert_eq!(&Literal("Hello!"), &instructions[1]); }
rust_cleaned_test_functions.jsonl/131990
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 151 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 11119, 7913, 62, 2330, 368, 972, 286, 1077, 1467, 284, 47219, 421, 537, 15229, 3869, 9707, 0, 2979, 12330, 3869, 3534, 286, 1077, 11221, 284, 19192, 7235, 568, 15454, 1647, 286, 2060, 10714, 10297...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_mut_chunks_exact_0() { let mut v = [1, 2, 3, 4]; let _it = v.chunks_exact_mut(0); }
rust_cleaned_test_functions.jsonl/12927
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 64 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 29523, 65470, 71084, 62, 15, 368, 341, 262, 1077, 5206, 348, 284, 508, 16, 11, 220, 17, 11, 220, 18, 11, 220, 19, 935, 262, 1077, 716, 275, 284, 348, 5329, 15296, 71084, 29523, 7, 15, 317, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_truncate() { let mut v: Vec<Box<_>> = vec![Box::new(6), Box::new(5), Box::new(4)]; v.truncate(1); let v = v; assert_eq!(v.len(), 1); assert_eq!(*(v[0]), 6); }
rust_cleaned_test_functions.jsonl/80755
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 115 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 3547, 26900, 368, 341, 262, 1077, 5206, 348, 25, 11312, 79852, 32399, 2452, 284, 7486, 20703, 1611, 486, 931, 7, 21, 701, 8261, 486, 931, 7, 20, 701, 8261, 486, 931, 7, 19, 12587, 262, 348, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_serde_deserialize() { use self::serde_json::from_str; use Month::*; let cases: Vec<(&str, Month)> = vec![ ("\"january\"", January), ("\"jan\"", January), ("\"FeB\"", February), ("\"MAR\"", March), ("\"mar\"", March), ("\"april\"", April), ("\"may\"", May), ("\"june\"", June), ("\"JULY\"", July), ("\"august\"", August), ("\"september\"", September), ("\"October\"", October), ("\"November\"", November), ("\"DECEmbEr\"", December), ]; for (string, expected_month) in cases { let month = from_str::<Month>(string).unwrap(); assert_eq!(month, expected_month); } let errors: Vec<&str> = vec!["\"not a month\"", "\"ja\"", "\"Dece\"", "Dec", "\"Augustin\""]; for string in errors { from_str::<Month>(string).unwrap_err(); } }
rust_cleaned_test_functions.jsonl/92414
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 554 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 75861, 450, 15768, 9050, 368, 341, 286, 990, 656, 486, 47024, 9455, 486, 1499, 2895, 280, 286, 990, 19397, 79304, 286, 1077, 5048, 25, 11312, 27, 2099, 495, 11, 19397, 16018, 284, 7486, 90515, 3...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_hash_sha2_256() { let mut output = [0x00_u8; 32]; sha2_256(TEST_INPUT, &mut output); assert_eq!( output, [ 136, 15, 25, 218, 88, 54, 49, 152, 115, 168, 147, 189, 207, 171, 243, 129, 161, 76, 15, 141, 197, 106, 111, 213, 19, 197, 133, 219, 181, 233, 195, 120 ] ); }
rust_cleaned_test_functions.jsonl/37532
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 246 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 8950, 48836, 17, 62, 17, 20, 21, 368, 341, 286, 1077, 5206, 2550, 284, 508, 15, 87, 15, 15, 7300, 23, 26, 220, 18, 17, 935, 286, 15870, 17, 62, 17, 20, 21, 50320, 21022, 11, 609, 6984, 2...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_get_coefficients() { let x = DMatrix::from_vec(5, 1, vec![2_f64, 1., 3., 4., 5.]); let y = DMatrix::from_vec(5, 1, vec![1_f64, 2., 3., 4., 5.]); let result = get_coefficients(&x, &y); assert_approx_eq!(result[(0)], 0.9818181818181818); let x = DMatrix::from_vec(3, 2, vec![1_f64, 2., 1., 1., 1., 2.]); let y = DMatrix::from_vec(3, 1, vec![3_f64, 4., 5.]); let result = get_coefficients(&x, &y); assert_approx_eq!(result[(0)], 1.); assert_approx_eq!(result[(1)], 2.); }
rust_cleaned_test_functions.jsonl/6779
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 308 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 3062, 31990, 28142, 368, 341, 286, 1077, 856, 284, 422, 6689, 486, 1499, 13251, 7, 20, 11, 220, 16, 11, 7486, 20703, 17, 761, 21, 19, 11, 220, 16, 2572, 220, 18, 2572, 220, 19, 2572, 220, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_sum_two_longs() { assert_eq!(sum_two_longs(-600000, 700000), 100000); }
rust_cleaned_test_functions.jsonl/123613
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 58 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 10160, 23241, 907, 13181, 368, 972, 286, 2060, 10714, 10297, 1242, 23241, 907, 13181, 4080, 21, 15, 15, 15, 15, 15, 11, 220, 22, 15, 15, 15, 15, 15, 701, 220, 16, 15, 15, 15, 15, 15, 736, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_buffer_wraparound_tx() { let mut s = socket_established(); s.tx_buffer = SocketBuffer::new(vec![b'.'; 9]); assert_eq!(s.send_slice(b"xxxyyy"), Ok(6)); assert_eq!(s.tx_buffer.dequeue_many(3), &b"xxx"[..]); assert_eq!(s.tx_buffer.len(), 3); // "abcdef" not contiguous in tx buffer assert_eq!(s.send_slice(b"abcdef"), Ok(6)); recv!(s, Ok(TcpRepr { seq_number: LOCAL_SEQ + 1, ack_number: Some(REMOTE_SEQ + 1), payload: &b"yyyabc"[..], ..RECV_TEMPL })); recv!(s, Ok(TcpRepr { seq_number: LOCAL_SEQ + 1 + 6, ack_number: Some(REMOTE_SEQ + 1), payload: &b"def"[..], ..RECV_TEMPL })); }
rust_cleaned_test_functions.jsonl/91918
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 457 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 7776, 38550, 19454, 17805, 368, 341, 286, 1077, 5206, 274, 284, 7575, 18583, 5102, 291, 543, 286, 274, 33807, 7776, 284, 20954, 4095, 486, 931, 25592, 20703, 65, 6, 3159, 26, 220, 24, 2558, 286,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_buffered_reader_seek_relative() { let inner: &[u8] = &[5, 6, 7, 0, 1, 2, 3, 4]; let mut reader = BufReader::with_capacity(2, io::Cursor::new(inner)); assert!(reader.seek_relative(3).is_ok()); assert_eq!(reader.fill_buf().ok(), Some(&[0, 1][..])); assert!(reader.seek_relative(0).is_ok()); assert_eq!(reader.fill_buf().ok(), Some(&[0, 1][..])); assert!(reader.seek_relative(1).is_ok()); assert_eq!(reader.fill_buf().ok(), Some(&[1][..])); assert!(reader.seek_relative(-1).is_ok()); assert_eq!(reader.fill_buf().ok(), Some(&[0, 1][..])); assert!(reader.seek_relative(2).is_ok()); assert_eq!(reader.fill_buf().ok(), Some(&[2, 3][..])); }
rust_cleaned_test_functions.jsonl/17434
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 363 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 7776, 291, 22306, 74473, 29286, 368, 341, 286, 1077, 9179, 25, 44590, 84, 23, 60, 284, 44590, 20, 11, 220, 21, 11, 220, 22, 11, 220, 15, 11, 220, 16, 11, 220, 17, 11, 220, 18, 11, 220, 1...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_prewrite_committed_encounter_newer_lock() { let engine = TestEngineBuilder::new().build().unwrap(); let mut statistics = Statistics::default(); let k1 = b"k1"; let v1 = b"v1"; let v2 = b"v2"; must_prewrite_put_async_commit(&engine, k1, v1, k1, &Some(vec![]), 5, 10); // This commit may actually come from a ResolveLock command must_commit(&engine, k1, 5, 15); // Another transaction prewrites must_prewrite_put(&engine, k1, v2, k1, 20); // A retried prewrite of the first transaction should be idempotent. let prewrite_cmd = Prewrite::new( vec![Mutation::make_put(Key::from_raw(k1), v1.to_vec())], k1.to_vec(), 5.into(), 2000, false, 1, 5.into(), 1000.into(), Some(vec![]), false, AssertionLevel::Off, Context::default(), ); let context = WriteContext { lock_mgr: &DummyLockManager {}, concurrency_manager: ConcurrencyManager::new(20.into()), extra_op: ExtraOp::Noop, statistics: &mut statistics, async_apply_prewrite: false, }; let snap = engine.snapshot(Default::default()).unwrap(); let res = prewrite_cmd.cmd.process_write(snap, context).unwrap(); match res.pr { ProcessResult::PrewriteResult { result } => { assert!(result.locks.is_empty(), "{:?}", result); assert_eq!(result.min_commit_ts, 15.into(), "{:?}", result); } _ => panic!("unexpected result {:?}", res.pr), } }
rust_cleaned_test_functions.jsonl/31436
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 871 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 620, 52473, 2965, 5483, 13781, 39914, 5921, 261, 9818, 368, 341, 286, 1077, 4712, 284, 3393, 4571, 3297, 486, 931, 1005, 5834, 1005, 15454, 543, 286, 1077, 5206, 13142, 284, 24624, 486, 2258, 1428...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_overlap() { let cube_a = Cuboid { lower: [1, 1, 1], upper: [4, 4, 4], }; let cube_b = Cuboid { lower: [2, 2, 2], upper: [3, 3, 3], }; let mut new_cubes = Vec::new(); // B is fully inside A so it should overlap and the result should be empty assert!(!cube_b.retain_nonoverlapping(&cube_a, &mut new_cubes)); assert_eq!(new_cubes, Vec::new()); assert!(!cube_a.retain_nonoverlapping(&cube_b, &mut new_cubes)); assert_eq!(new_cubes.len(), 6); }
rust_cleaned_test_functions.jsonl/93684
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 323 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 65794, 368, 341, 286, 1077, 23739, 4306, 284, 18030, 588, 341, 310, 4722, 25, 508, 16, 11, 220, 16, 11, 220, 16, 1259, 310, 8416, 25, 508, 19, 11, 220, 19, 11, 220, 19, 1259, 286, 3634, 28...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_into() { let v = QUATERNION; { let v: [f32; 4] = v.into(); assert_eq!(v, [1.0, 2.0, 3.0, 4.0]); } { let v: (f32, f32, f32, f32) = v.into(); assert_eq!(v, (1.0, 2.0, 3.0, 4.0)); } }
rust_cleaned_test_functions.jsonl/15342
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 205 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 45514, 368, 341, 286, 1077, 348, 284, 25999, 828, 13660, 1271, 280, 286, 341, 310, 1077, 348, 25, 508, 69, 18, 17, 26, 220, 19, 60, 284, 348, 39860, 543, 310, 2060, 10714, 10297, 85, 11, 508...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_qmp_event_msg() { let event_json = r#"{"event":"STOP","data":{},"timestamp":{"seconds":1575531524,"microseconds":91519}}"#; let qmp_event: schema::QmpEvent = serde_json::from_str(&event_json).unwrap(); match qmp_event { schema::QmpEvent::STOP { data: _, timestamp: _, } => { assert!(true); } _ => assert!(false), } }
rust_cleaned_test_functions.jsonl/66356
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 273 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 8976, 1307, 6748, 6483, 368, 341, 286, 1077, 1538, 9455, 4035, 310, 435, 55543, 4913, 3087, 3252, 50669, 2198, 691, 788, 6257, 1335, 13035, 22317, 17403, 788, 16, 20, 22, 20, 20, 18, 16, 20, 1...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_pop_sequence_recurrence() { assert!(!cdll::LinkedList::is_valid_pop_sequence_recurrence( 0, &[2, 0, 1] )); assert!(cdll::LinkedList::is_valid_pop_sequence_recurrence( 0, &[0, 1, 2] )); assert!(cdll::LinkedList::is_valid_pop_sequence_recurrence( 0, &[0, 2, 1] )); assert!(cdll::LinkedList::is_valid_pop_sequence_recurrence( 0, &[1, 0, 2] )); assert!(cdll::LinkedList::is_valid_pop_sequence_recurrence( 0, &[1, 2, 0] )); assert!(cdll::LinkedList::is_valid_pop_sequence_recurrence( 0, &[2, 1, 0] )); }
rust_cleaned_test_functions.jsonl/23387
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 460 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 17061, 23735, 7080, 20559, 368, 341, 286, 2060, 0, 3471, 4385, 654, 486, 33915, 486, 285, 8337, 17061, 23735, 7080, 20559, 1006, 310, 220, 15, 345, 310, 44590, 17, 11, 220, 15, 11, 220, 16, 92...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_init_all_passes_for_module() { let context = Context::create(); let module = context.create_module("my_module"); let pass_manager = PassManager::create(()); pass_manager.add_argument_promotion_pass(); pass_manager.add_constant_merge_pass(); pass_manager.add_dead_arg_elimination_pass(); pass_manager.add_function_attrs_pass(); pass_manager.add_function_inlining_pass(); pass_manager.add_always_inliner_pass(); pass_manager.add_global_dce_pass(); pass_manager.add_global_optimizer_pass(); pass_manager.add_ip_constant_propagation_pass(); pass_manager.add_prune_eh_pass(); pass_manager.add_ipsccp_pass(); pass_manager.add_internalize_pass(true); pass_manager.add_strip_dead_prototypes_pass(); pass_manager.add_strip_symbol_pass(); #[cfg(any(feature = "llvm3-6", feature = "llvm3-7", feature = "llvm3-8", feature = "llvm3-9", feature = "llvm4-0"))] pass_manager.add_bb_vectorize_pass(); pass_manager.add_loop_vectorize_pass(); pass_manager.add_slp_vectorize_pass(); pass_manager.add_aggressive_dce_pass(); #[cfg(not(feature = "llvm3-6"))] pass_manager.add_bit_tracking_dce_pass(); pass_manager.add_alignment_from_assumptions_pass(); pass_manager.add_cfg_simplification_pass(); pass_manager.add_dead_store_elimination_pass(); pass_manager.add_scalarizer_pass(); pass_manager.add_merged_load_store_motion_pass(); pass_manager.add_gvn_pass(); pass_manager.add_ind_var_simplify_pass(); pass_manager.add_instruction_combining_pass(); pass_manager.add_jump_threading_pass(); pass_manager.add_licm_pass(); pass_manager.add_loop_deletion_pass(); pass_manager.add_loop_idiom_pass(); pass_manager.add_loop_rotate_pass(); pass_manager.add_loop_reroll_pass(); pass_manager.add_loop_unroll_pass(); pass_manager.add_loop_unswitch_pass(); pass_manager.add_memcpy_optimize_pass(); pass_manager.add_partially_inline_lib_calls_pass(); pass_manager.add_lower_switch_pass(); pass_manager.add_promote_memory_to_register_pass(); pass_manager.add_reassociate_pass(); pass_manager.add_sccp_pass(); pass_manager.add_scalar_repl_aggregates_pass(); pass_manager.add_scalar_repl_aggregates_pass_ssa(); pass_manager.add_scalar_repl_aggregates_pass_with_threshold(1); pass_manager.add_simplify_lib_calls_pass(); pass_manager.add_tail_call_elimination_pass(); pass_manager.add_constant_propagation_pass(); pass_manager.add_demote_memory_to_register_pass(); pass_manager.add_verifier_pass(); pass_manager.add_correlated_value_propagation_pass(); pass_manager.add_early_cse_pass(); pass_manager.add_lower_expect_intrinsic_pass(); pass_manager.add_type_based_alias_analysis_pass(); pass_manager.add_scoped_no_alias_aa_pass(); pass_manager.add_basic_alias_analysis_pass(); #[cfg(not(any(feature = "llvm3-6", feature = "llvm3-7", feature = "llvm3-8", feature = "llvm3-9")))] { pass_manager.add_early_cse_mem_ssa_pass(); pass_manager.add_new_gvn_pass(); } #[cfg(not(any(feature = "llvm3-6", feature = "llvm3-7", feature = "llvm3-8", feature = "llvm3-9", feature = "llvm4-0", feature = "llvm5-0", feature = "llvm6-0")))] { pass_manager.add_aggressive_inst_combiner_pass(); pass_manager.add_loop_unroll_and_jam_pass(); } #[cfg(not(any(feature = "llvm3-6", feature = "llvm3-7", feature = "llvm3-8", feature = "llvm3-9", feature = "llvm4-0", feature = "llvm5-0", feature = "llvm6-0", feature = "llvm7-0")))] { pass_manager.add_coroutine_early_pass(); pass_manager.add_coroutine_split_pass(); pass_manager.add_coroutine_elide_pass(); pass_manager.add_coroutine_cleanup_pass(); } pass_manager.run_on(&module); }
rust_cleaned_test_functions.jsonl/42667
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1641 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6137, 5705, 15464, 288, 5478, 10750, 368, 341, 262, 1077, 2266, 284, 9608, 486, 3182, 543, 262, 1077, 4688, 284, 2266, 2520, 10750, 445, 2408, 10750, 797, 262, 1077, 1494, 12144, 284, 9970, 2043, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_established_retransmit_reset_after_ack() { let mut s = socket_established(); s.remote_win_len = 6; s.send_slice(b"abcdef").unwrap(); s.send_slice(b"123456").unwrap(); s.send_slice(b"ABCDEF").unwrap(); recv!(s, time 1000, Ok(TcpRepr { seq_number: LOCAL_SEQ + 1, ack_number: Some(REMOTE_SEQ + 1), payload: &b"abcdef"[..], ..RECV_TEMPL })); send!(s, time 1005, TcpRepr { seq_number: REMOTE_SEQ + 1, ack_number: Some(LOCAL_SEQ + 1 + 6), window_len: 6, ..SEND_TEMPL }); recv!(s, time 1010, Ok(TcpRepr { seq_number: LOCAL_SEQ + 1 + 6, ack_number: Some(REMOTE_SEQ + 1), payload: &b"123456"[..], ..RECV_TEMPL })); send!(s, time 1015, TcpRepr { seq_number: REMOTE_SEQ + 1, ack_number: Some(LOCAL_SEQ + 1 + 6 + 6), window_len: 6, ..SEND_TEMPL }); recv!(s, time 1020, Ok(TcpRepr { seq_number: LOCAL_SEQ + 1 + 6 + 6, ack_number: Some(REMOTE_SEQ + 1), payload: &b"ABCDEF"[..], ..RECV_TEMPL })); }
rust_cleaned_test_functions.jsonl/1766
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 771 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 18583, 5102, 291, 1288, 1458, 1763, 18983, 19844, 48447, 368, 341, 286, 1077, 5206, 274, 284, 7575, 18583, 5102, 291, 543, 286, 274, 34093, 25672, 6043, 284, 220, 21, 280, 286, 274, 5219, 26488, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_encrypt_decrypt() { let _ = simple_logger::SimpleLogger::new() .with_level(log::Level::Info.to_level_filter()) .init(); let plaintext = b"Hello world!Hello world!"; let current_plaintext = *plaintext; let oracle = PaddingOracle::new(16, 1, oracle_fn); let iv: Vec<u8> = [].to_vec(); let ciphertext = oracle.encrypt(&plaintext.to_vec(), &iv).unwrap(); let plaintext = oracle.decrypt(&ciphertext, &iv).unwrap(); assert_eq!( current_plaintext.to_vec(), unpad(plaintext[32..].to_vec(), 16).unwrap() ); }
rust_cleaned_test_functions.jsonl/78891
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 313 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 66593, 80764, 368, 341, 286, 1077, 716, 284, 4285, 27413, 486, 16374, 7395, 486, 931, 741, 310, 659, 4197, 8274, 12531, 486, 4449, 486, 1731, 2389, 8274, 8727, 2398, 310, 659, 2327, 1428, 286, 1...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_true() { assert_eq!( crate::rsass( "a {b: join(c, d, $bracketed: true)}\ \n" ) .unwrap(), "a {\ \n b: [c d];\ \n}\ \n" ); }
rust_cleaned_test_functions.jsonl/71426
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 195 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 16082, 368, 341, 286, 2060, 10714, 33673, 310, 17717, 486, 5428, 395, 1006, 394, 330, 64, 314, 65, 25, 5138, 1337, 11, 294, 11, 400, 1323, 5709, 291, 25, 830, 9139, 5661, 310, 1124, 77, 698, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_normalize() { fn t(wp: &PosixPath, s: &str) { let ss = wp.to_str(); let sss = s.to_owned(); if (ss != sss) { debug!("got %s", ss); debug!("expected %s", sss); assert_eq!(ss, sss); } } t(&(PosixPath("hi/there.txt") .with_dirname(".").normalize()), "there.txt"); t(&(PosixPath("a/b/../c/././/../foo.txt/").normalize()), "a/foo.txt"); t(&(PosixPath("a/b/c") .push("..").normalize()), "a/b"); }
rust_cleaned_test_functions.jsonl/45744
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 358 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 80807, 368, 341, 286, 5168, 259, 88117, 25, 609, 4859, 941, 1820, 11, 274, 25, 609, 495, 8, 341, 310, 1077, 10870, 284, 12609, 2389, 2895, 543, 310, 1077, 274, 778, 284, 274, 2389, 51973, 543,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2