text
stringlengths
93
16.4k
id
stringlengths
20
40
metadata
dict
input_ids
listlengths
45
2.05k
attention_mask
listlengths
45
2.05k
complexity
int64
1
9
#[test] fn test_same_module_struct_resolution() { let allocator = Arena::new(); let vm_cache = VMModuleCache::new(&allocator); let code = String::from( " modules: module M1 { struct X {} struct T { i: u64, x: V#Self.X } } script: main() { return; } ", ); let module = parse_modules(code); let fetcher = FakeFetcher::new(module); let block_cache = BlockModuleCache::new(&vm_cache, fetcher); { let code_key = CodeKey::new(AccountAddress::default(), "M1".to_string()); let module_ref = block_cache.get_loaded_module(&code_key).unwrap().unwrap(); let gas = GasMeter::new(100_000_000); let struct_x = block_cache .resolve_struct_def(module_ref, StructDefinitionIndex::new(0), &gas) .unwrap() .unwrap() .unwrap(); let struct_t = block_cache .resolve_struct_def(module_ref, StructDefinitionIndex::new(1), &gas) .unwrap() .unwrap() .unwrap(); assert_eq!(struct_x, StructDef::new(vec![])); assert_eq!( struct_t, StructDef::new(vec![Type::U64, Type::Struct(StructDef::new(vec![]))]), ); } }
rust_cleaned_test_functions.jsonl/127132
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 658 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 33574, 10750, 15126, 39849, 368, 341, 262, 1077, 43655, 284, 27047, 486, 931, 543, 262, 1077, 10995, 11529, 284, 17792, 3332, 8233, 486, 931, 2099, 57631, 626, 262, 1077, 2038, 284, 923, 486, 1499...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_display_local_timestamp_without_date() { let c_time = chrono::offset::Utc::now().format("%Y-%m-%d %H:%M:%S").to_string(); assert_eq!( convert_to_local_timestamp(&c_time, false).unwrap(), Local::now().format("%H:%M:%S").to_string(), ); }
rust_cleaned_test_functions.jsonl/10674
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 160 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 14825, 13564, 23073, 39904, 4164, 368, 341, 286, 1077, 272, 3009, 284, 80372, 486, 3176, 486, 97768, 486, 3328, 1005, 2243, 4430, 56, 11069, 76, 11069, 67, 1018, 39, 7533, 44, 7533, 50, 1827, 98...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_step_config() { let l = default_logger(); // a raft that cannot make progress let mut r = new_test_raft(1, vec![1, 2], 10, 1, new_storage(), &l); r.become_candidate(); r.become_leader(); let index = r.raft_log.last_index(); let mut m = new_message(1, 1, MessageType::MsgPropose, 0); let mut e = Entry::default(); e.set_entry_type(EntryType::EntryConfChange); m.mut_entries().push(e); r.step(m).expect(""); assert_eq!(r.raft_log.last_index(), index + 1); }
rust_cleaned_test_functions.jsonl/19145
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 226 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 11946, 5332, 368, 341, 262, 1077, 326, 284, 1638, 27413, 543, 262, 442, 264, 52455, 429, 4157, 1281, 5098, 198, 262, 1077, 5206, 435, 284, 501, 4452, 62, 2944, 7, 16, 11, 7486, 20703, 16, 11, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_slow() { let text = b"gccttaacattattacgccta\0"; let pos_correct = vec![ 21, 20, 5, 6, 14, 11, 8, 7, 17, 1, 15, 18, 2, 16, 0, 19, 4, 13, 10, 3, 12, 9, ]; assert_eq!(slow(text), pos_correct); }
rust_cleaned_test_functions.jsonl/51322
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 150 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 82447, 368, 341, 286, 1077, 1467, 284, 293, 1, 20669, 302, 2565, 580, 1587, 1587, 580, 20669, 77519, 59, 15, 3302, 286, 1077, 1133, 31550, 284, 7486, 90515, 310, 220, 17, 16, 11, 220, 17, 15, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_undo_char() { let mut test = setup_new_test(); // test deletes a single mistake test.on_char(get_wrong_char(test.current_char)); assert_eq!(test.done, 1); assert_eq!(test.mistakes, 1); test.undo_char(); assert_eq!(test.done, 0); assert_eq!(test.mistakes, 0); // test doesn't do anything at the beginning test.undo_char(); assert_eq!(test.done, 0); assert_eq!(test.mistakes, 0); // test deletes extras while test.current_char != ' ' { test.on_char(test.current_char); } let done = test.done; test.on_char(get_wrong_char(test.current_char)); assert!(!test.fetch(done - 1).is_empty()); test.undo_char(); assert!(test.fetch(done - 1).is_empty()); }
rust_cleaned_test_functions.jsonl/27499
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 413 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 98940, 9232, 368, 341, 286, 1077, 5206, 1273, 284, 6505, 5921, 4452, 1428, 286, 442, 1273, 54170, 264, 3175, 16523, 198, 286, 1273, 3488, 9232, 5433, 75198, 9232, 8623, 4952, 9232, 1106, 286, 2060...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_name_auction_length() { assert_eq!( get_name_auction_length(&String::from("1.chain")).unwrap(), 29760 ); assert_eq!( get_name_auction_length(&String::from("12345678.chain")).unwrap(), 14880 ); assert_eq!( get_name_auction_length(&String::from("123456789.chain")).unwrap(), 480 ); assert_eq!( get_name_auction_length(&String::from("1234567890.chain")).unwrap(), 480 ); assert_eq!( get_name_auction_length(&String::from("12345467890123.chain")).unwrap(), 0 ); }
rust_cleaned_test_functions.jsonl/82846
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 299 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 1269, 4306, 2654, 5118, 368, 341, 262, 2060, 10714, 33673, 286, 633, 1269, 4306, 2654, 5118, 2099, 703, 486, 1499, 445, 16, 52041, 15197, 15454, 3148, 286, 220, 17, 24, 22, 21, 15, 198, 262, 1...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_truncating_buffer_serializer() { // Test truncate front. let body = vec![0, 1, 2, 3, 4, 5, 6, 7, 8, 9]; let ser = BufferSerializer::new_vec_truncate( Buf::new(body.clone(), ..), TruncateDirection::DiscardFront, ); let buf = ser.serialize_mtu_outer(4).unwrap(); let buf: &[u8] = buf.as_ref(); assert_eq!(buf, &[6, 7, 8, 9][..]); // Test truncate back. let ser = BufferSerializer::new_vec_truncate( Buf::new(body.clone(), ..), TruncateDirection::DiscardBack, ); let buf = ser.serialize_mtu_outer(7).unwrap(); let buf: &[u8] = buf.as_ref(); assert_eq!(buf, &[0, 1, 2, 3, 4, 5, 6][..]); let ser = BufferSerializer::new_vec_truncate( Buf::new(body.clone(), ..), TruncateDirection::NoTruncating, ); assert!(ser.serialize_mtu_outer(5).is_err()); let ser = BufferSerializer::new_vec(Buf::new(body.clone(), ..)); assert!(ser.serialize_mtu_outer(5).is_err()); }
rust_cleaned_test_functions.jsonl/83356
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 628 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 3547, 1347, 1095, 7776, 67441, 368, 341, 1789, 286, 442, 3393, 56772, 4065, 624, 23459, 286, 1077, 2487, 284, 7486, 20703, 15, 11, 220, 16, 11, 220, 17, 11, 220, 18, 11, 220, 19, 11, 220, 20...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_call_with_kwargs() { let gil = Python::acquire_gil(); let py = gil.python(); let list = vec![3, 6, 5, 4, 7].to_object(py); let dict = vec![("reverse", true)].into_py_dict(py); list.call_method(py, "sort", (), Some(dict)).unwrap(); assert_eq!(list.extract::<Vec<i32>>(py).unwrap(), vec![7, 6, 5, 4, 3]); }
rust_cleaned_test_functions.jsonl/57476
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 190 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 13429, 6615, 36235, 368, 341, 286, 1077, 342, 321, 284, 13027, 486, 580, 984, 1889, 321, 543, 286, 1077, 4510, 284, 342, 321, 43193, 543, 286, 1077, 1140, 284, 7486, 20703, 18, 11, 220, 21, 11...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_385() { assert_eq!( Solution::deserialize("324".to_string()), NestedInteger::Int(324) ); assert_eq!( Solution::deserialize("[123,[456,[789]]]".to_string()), NestedInteger::List(vec![ NestedInteger::Int(123), NestedInteger::List(vec![ NestedInteger::Int(456), NestedInteger::List(vec![NestedInteger::Int(789)]) ]) ]) ); }
rust_cleaned_test_functions.jsonl/95
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 309 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 62, 18, 23, 20, 368, 341, 286, 2060, 10714, 33673, 310, 12478, 486, 66777, 445, 18, 17, 19, 3263, 983, 3904, 14702, 310, 71742, 3486, 486, 1072, 7, 18, 17, 19, 340, 286, 1439, 286, 2060, 107...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_bad_record_type() { let mut log = new_record_test(); let test = "foo"; log.write(test); // the record type is in header[6] log.increment_byte(6, 100); log.fix_checksum(0, test.len()); log.read(); }
rust_cleaned_test_functions.jsonl/46689
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 142 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 34199, 14192, 1819, 368, 341, 286, 1077, 5206, 1487, 284, 501, 14192, 4452, 543, 286, 1077, 1273, 284, 330, 7975, 876, 286, 1487, 3836, 8623, 317, 286, 442, 279, 3255, 943, 374, 304, 4247, 58, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_block_on() { let c = MainContext::new(); let mut v = None; { let v = &mut v; let future = futures_util::future::lazy(|_ctx| { *v = Some(123); Ok::<i32, ()>(123) }); let res = c.block_on(future); assert_eq!(res, Ok(123)); } assert_eq!(v, Some(123)); }
rust_cleaned_test_functions.jsonl/82049
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 247 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 7113, 4470, 368, 341, 286, 1077, 272, 284, 4697, 1972, 486, 931, 1428, 286, 1077, 5206, 348, 284, 2240, 280, 286, 341, 310, 1077, 348, 284, 609, 6984, 348, 401, 310, 1077, 3853, 284, 36823, 18...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_vcx_issuer_credential_release() { init!("true"); let handle = create_default_issuer_credential(); let unknown_handle = handle + 1; assert_eq!(vcx_issuer_credential_release(unknown_handle), error::INVALID_ISSUER_CREDENTIAL_HANDLE.code_num); }
rust_cleaned_test_functions.jsonl/66781
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 136 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2273, 25844, 62, 66817, 666, 30320, 24577, 368, 341, 286, 2930, 17223, 1866, 797, 286, 1077, 3705, 284, 1855, 9993, 62, 66817, 666, 30320, 543, 286, 1077, 9788, 10630, 284, 3705, 488, 220, 16, 2...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_tail() { let (at, mut ucmd) = testing(UTIL_NAME); let result = ucmd.args(&["-d", ":", "--complement", "-f", "1", INPUT]).run(); assert_eq!(result.stdout, at.read("lists_tail.expected")); }
rust_cleaned_test_functions.jsonl/77650
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 99 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 35471, 368, 341, 262, 1077, 320, 266, 11, 5206, 575, 8710, 8, 284, 7497, 7, 36969, 4708, 317, 262, 1077, 1102, 284, 575, 8710, 16365, 2099, 1183, 12, 67, 497, 330, 12147, 14482, 874, 2764, 497...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_emit_simple_binary_op() { let program = Program::Binary { op: OpCode::Add as u8, left: int(73), right: int(68) }; let code = emit(&program); assert_eq!(interpret(&code), Ok(Term::Integer(141))); }
rust_cleaned_test_functions.jsonl/24917
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 122 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 69082, 30015, 31761, 10287, 368, 341, 262, 1077, 2025, 284, 6687, 486, 21338, 341, 286, 1179, 25, 97779, 486, 2212, 438, 575, 23, 345, 286, 2115, 25, 526, 7, 22, 18, 1326, 286, 1290, 25, 526, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_windows_last() { let v: &[i32] = &[0, 1, 2, 3, 4, 5]; let c = v.windows(2); assert_eq!(c.last().unwrap()[1], 5); let v2: &[i32] = &[0, 1, 2, 3, 4]; let c2 = v2.windows(2); assert_eq!(c2.last().unwrap()[0], 3); }
rust_cleaned_test_functions.jsonl/4148
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 145 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 58220, 12195, 368, 341, 262, 1077, 348, 25, 44590, 72, 18, 17, 60, 284, 44590, 15, 11, 220, 16, 11, 220, 17, 11, 220, 18, 11, 220, 19, 11, 220, 20, 935, 262, 1077, 272, 284, 348, 68113, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_merge_unmodified_tree_into_tree_to_blob() -> BitResult<()> { BitRepo::with_minimal_repo_with_dir(|repo| { let ours = commit! { dir < "typechange blob->tree" }; let theirs = commit! { dir { bar < "default bar contents" } }; repo.three_way_merge(ours, theirs)?; assert_eq!(cat!(repo: "dir"), "typechange blob->tree"); Ok(()) }) }
rust_cleaned_test_functions.jsonl/94176
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 249 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 20888, 4907, 27162, 11663, 45514, 11663, 2346, 45908, 368, 1464, 6495, 2077, 71698, 341, 262, 6495, 25243, 486, 4197, 7260, 2861, 37784, 6615, 4334, 22428, 23476, 91, 341, 286, 1077, 11350, 284, 526...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_bad_kernel_magic() { let gm = create_guest_mem(); let mut bad_image = make_test_bin(); #[cfg(any(target_arch = "x86", target_arch = "x86_64"))] let offset = 0x1; #[cfg(target_arch = "aarch64")] let offset = 0x38; bad_image[offset] = 0x33; assert_eq!( Err(Error::InvalidElfMagicNumber), load_kernel(&gm, &mut Cursor::new(&bad_image), 0) ); }
rust_cleaned_test_functions.jsonl/88246
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 243 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 34199, 26876, 54612, 368, 341, 286, 1077, 37879, 284, 1855, 62739, 12976, 543, 286, 1077, 5206, 3873, 4954, 284, 1281, 4452, 21816, 543, 286, 11506, 14072, 40268, 8637, 34330, 284, 330, 87, 23, 21...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_replace_submit_dir() { let mut program = program_def( "%{SUBMIT_DIR}", Some("%{SUBMIT_DIR}/out"), Some("%{SUBMIT_DIR}/err"), "/submit-dir", 5, 1, ); replace_placeholders_worker(&mut program); assert_eq!(program.cwd, Some("/submit-dir".into())); assert_eq!(program.stdout, StdioDef::File("/submit-dir/out".into())); assert_eq!(program.stderr, StdioDef::File("/submit-dir/err".into())); }
rust_cleaned_test_functions.jsonl/107297
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 284 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 10633, 31674, 4334, 368, 341, 286, 1077, 5206, 2025, 284, 2025, 7844, 1006, 310, 5962, 90, 29038, 18330, 8291, 24375, 310, 4329, 4430, 90, 29038, 18330, 8291, 4472, 411, 4461, 310, 4329, 4430, 90,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_read_write_le_mem() { let uints = [0, 1, 2, 42, 10_123, 100_123_456, ::u64::MAX]; let mut writer = MemWriter::new(); for i in uints.iter() { writer.write_le_u64(*i).unwrap(); } let mut reader = MemReader::new(writer.unwrap()); for i in uints.iter() { assert!(reader.read_le_u64().unwrap() == *i); } }
rust_cleaned_test_functions.jsonl/4835
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 213 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6443, 9165, 11751, 12976, 368, 341, 286, 1077, 2622, 82, 284, 508, 15, 11, 220, 16, 11, 220, 17, 11, 220, 19, 17, 11, 220, 16, 15, 62, 16, 17, 18, 11, 220, 16, 15, 15, 62, 16, 17, 18, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_idempotent() { let blockman = BlockManager::new(); let a = create_block("A", NULL_BLOCK_IDENTIFIER, 0); let b = create_block("B", "A", 1); let c = create_block("C", "B", 1); let d = create_block("D", "C", 1); blockman .put(vec![a.clone(), b.clone(), c.clone(), d.clone()]) .unwrap(); { let _d_ref = blockman.ref_block("D").unwrap(); blockman .put(vec![a.clone(), b.clone(), c.clone(), d.clone()]) .unwrap(); } assert!(blockman.unref_block("D").unwrap()); }
rust_cleaned_test_functions.jsonl/10256
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 394 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 842, 3262, 63532, 368, 341, 286, 1077, 2504, 1515, 284, 8362, 2043, 486, 931, 1428, 286, 1077, 264, 284, 1855, 7113, 445, 32, 497, 1770, 18756, 49554, 11, 220, 15, 317, 286, 1077, 293, 284, 18...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_issuer_handle_credential_init_message_from_initial_state() { let _setup = TestModeSetup::init(); let mut issuer_sm = _issuer_sm(); issuer_sm = issuer_sm.handle_message(CredentialIssuanceMessage::CredentialInit(mock_connection())).unwrap(); assert_match!(IssuerState::OfferSent(_), issuer_sm.state); }
rust_cleaned_test_functions.jsonl/20324
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 167 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 62, 66817, 10630, 666, 30320, 6137, 6462, 5673, 15809, 4387, 368, 341, 310, 1077, 716, 15188, 284, 3393, 3636, 21821, 486, 2327, 1428, 310, 1077, 5206, 54835, 15874, 284, 716, 66817, 15874, 543, 3...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_keep_alive_msg() { let msg_str = r#"{"timestamp":1568284616.24,"peer":"192.0.2.0","peer_asn":"64496","id":"21-192-0-2-0-53776312","host":"rrc00","type":"KEEPALIVE"} "#; let _msg: RisMessage = serde_json::from_str(&msg_str).unwrap(); }
rust_cleaned_test_functions.jsonl/94948
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 138 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 50293, 58850, 6483, 368, 341, 286, 1077, 3750, 2895, 284, 435, 55543, 4913, 13035, 788, 16, 20, 21, 23, 17, 23, 19, 21, 16, 21, 13, 17, 19, 1335, 16537, 3252, 16, 24, 17, 13, 15, 13, 17, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_double_ended_flatten() { let u = [0, 1]; let v = [5, 6, 7, 8]; let mut it = u.iter().map(|x| &v[*x..v.len()]).flatten(); assert_eq!(it.next_back().unwrap(), &8); assert_eq!(it.next().unwrap(), &5); assert_eq!(it.next_back().unwrap(), &7); assert_eq!(it.next_back().unwrap(), &6); assert_eq!(it.next_back().unwrap(), &8); assert_eq!(it.next().unwrap(), &6); assert_eq!(it.next_back().unwrap(), &7); assert_eq!(it.next_back(), None); assert_eq!(it.next(), None); assert_eq!(it.next_back(), None); }
rust_cleaned_test_functions.jsonl/70228
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 275 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 24598, 62, 2883, 5081, 14456, 368, 341, 262, 1077, 575, 284, 508, 15, 11, 220, 16, 935, 262, 1077, 348, 284, 508, 20, 11, 220, 21, 11, 220, 22, 11, 220, 23, 935, 262, 1077, 5206, 432, 284,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_header() { fn t(input: &str, expect: &str) { let output = format!("{}", Markdown(input)); assert_eq!(output, expect); reset_ids(true); } t("# Foo bar", "\n<h1 id='foo-bar' class='section-header'>\ <a href='#foo-bar'>Foo bar</a></h1>"); t("## Foo-bar_baz qux", "\n<h2 id='foo-bar_baz-qux' class=\'section-\ header'><a href='#foo-bar_baz-qux'>Foo-bar_baz qux</a></h2>"); t("### **Foo** *bar* baz!?!& -_qux_-%", "\n<h3 id='foo-bar-baz--_qux_-' class='section-header'>\ <a href='#foo-bar-baz--_qux_-'><strong>Foo</strong> \ <em>bar</em> baz!?!&amp; -_qux_-%</a></h3>"); t("####**Foo?** & \\*bar?!* _`baz`_ ❤ #qux", "\n<h4 id='foo--bar--baz--qux' class='section-header'>\ <a href='#foo--bar--baz--qux'><strong>Foo?</strong> &amp; *bar?!* \ <em><code>baz</code></em> ❤ #qux</a></h4>"); }
rust_cleaned_test_functions.jsonl/43372
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 550 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 8757, 368, 341, 286, 5168, 259, 5384, 25, 609, 495, 11, 1720, 25, 609, 495, 8, 341, 310, 1077, 2550, 284, 3561, 79878, 73192, 5384, 1106, 310, 2060, 10714, 10297, 3006, 11, 1720, 317, 310, 758...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_exit_without_value() { test_interpreter_and_jit_asm!( " exit", [], (), { |_vm, res: Result| { res.unwrap() == 0x0 } }, 1 ); }
rust_cleaned_test_functions.jsonl/59004
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 121 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 16880, 39904, 3142, 368, 341, 262, 1273, 15318, 28637, 8378, 5374, 275, 67529, 33673, 286, 6228, 286, 4869, 756, 286, 10239, 286, 84201, 286, 314, 70886, 7338, 11, 592, 25, 5714, 91, 314, 592, 5...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_the_other_thing() { //Define the function "add" //Takes are x and y modfunc!(replace_add,IDC, add(x: u64, y: u64) => u64 { x + y }); //verify add works correctly assert_eq!(add(5,2),7); //define a function that is not add fn totally_not_add(x: u64, y: u64) -> u64 { return x*x+y; } replace_add(totally_not_add); //add no longer works as expected assert_eq!(add(5,2),27); }
rust_cleaned_test_functions.jsonl/121111
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 220 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 16068, 30456, 62, 1596, 368, 1476, 262, 442, 35338, 279, 729, 330, 718, 698, 262, 442, 51, 2050, 525, 856, 323, 379, 198, 262, 1463, 2830, 10297, 8156, 2891, 96758, 34, 11, 912, 2075, 25, 575,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_account_deserialize() { let key = Pubkey::new_unique(); let (account1, _account2) = make_two_accounts(&key); account1.deserialize_data::<String>().unwrap(); }
rust_cleaned_test_functions.jsonl/48199
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 95 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 13500, 15768, 9050, 368, 341, 286, 1077, 1376, 284, 22611, 792, 486, 931, 21218, 543, 286, 1077, 320, 4608, 16, 11, 716, 4608, 17, 8, 284, 1281, 23241, 55665, 2099, 792, 317, 286, 2692, 16, 50...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_compute_vote_index_one() { let keypair = Keypair::new(); let vote = CrdsValue::new_unsigned(CrdsData::Vote( 0, Vote::new(&keypair.pubkey(), test_tx(), 0), )); for i in 0..MAX_VOTES { let votes = vec![&vote]; assert!(CrdsValue::compute_vote_index(i as usize, votes) > 0); let votes = vec![&vote]; assert!(CrdsValue::compute_vote_index(i as usize, votes) < MAX_VOTES); } }
rust_cleaned_test_functions.jsonl/5327
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 271 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 57028, 54360, 3560, 11667, 368, 341, 286, 1077, 1376, 12670, 284, 6569, 1082, 1310, 486, 931, 543, 286, 1077, 6910, 284, 4553, 5356, 1130, 486, 931, 67830, 3025, 81, 5356, 1043, 486, 41412, 1006, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_t09() { // Flatten arrays let (r, sioe) = do_execute!(&["-s", "..\"dna\""], super::IN_DAT_09); assert_eq!(buff!(sioe, serr), ""); assert_eq!( buff!(sioe, sout), "[\"c\",\"a\",\"c\",\"g\",\"t\",\"a\",\"t\"]\n", ); assert_eq!(r.is_ok(), true); }
rust_cleaned_test_functions.jsonl/118364
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 205 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 528, 15, 24, 368, 341, 286, 442, 85638, 18386, 198, 286, 1077, 320, 81, 11, 274, 815, 68, 8, 284, 653, 44329, 0, 2099, 1183, 12, 82, 497, 32213, 2105, 92877, 2105, 7914, 2256, 486, 687, 3634...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_eh_frame_hdr_indirect_length() { let section = Section::with_endian(Endian::Little) .L8(1) .L8(0x0b) .L8(0x83) .L8(0x0b) .L32(0x12345) .L32(2); let section = section.get_contents().unwrap(); let bases = BaseAddresses::default(); let result = EhFrameHdr::new(&section, LittleEndian).parse(&bases, 8); assert!(result.is_err()); assert_eq!(result.unwrap_err(), Error::UnsupportedPointerEncoding); }
rust_cleaned_test_functions.jsonl/9377
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 289 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2204, 71, 8929, 28238, 9122, 1226, 5118, 368, 341, 286, 1077, 3772, 284, 11113, 486, 4197, 87193, 7, 43231, 486, 38103, 340, 310, 659, 43, 23, 7, 16, 340, 310, 659, 43, 23, 7, 15, 87, 15, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_into_alogithm_id() { assert_eq!( Into::<TPM2_ALG_ID>::into(HashingAlgorithm::Sha1), TPM2_ALG_SHA1 ); assert_eq!( Into::<TPM2_ALG_ID>::into(HashingAlgorithm::Sha256), TPM2_ALG_SHA256 ); assert_eq!( Into::<TPM2_ALG_ID>::into(HashingAlgorithm::Sha384), TPM2_ALG_SHA384 ); assert_eq!( Into::<TPM2_ALG_ID>::into(HashingAlgorithm::Sha512), TPM2_ALG_SHA512 ); assert_eq!( Into::<TPM2_ALG_ID>::into(HashingAlgorithm::Sm3_256), TPM2_ALG_SM3_256 ); assert_eq!( Into::<TPM2_ALG_ID>::into(HashingAlgorithm::Sha3_256), TPM2_ALG_SHA3_256 ); assert_eq!( Into::<TPM2_ALG_ID>::into(HashingAlgorithm::Sha3_384), TPM2_ALG_SHA3_384 ); assert_eq!( Into::<TPM2_ALG_ID>::into(HashingAlgorithm::Sha3_512), TPM2_ALG_SHA3_512 ); }
rust_cleaned_test_functions.jsonl/41501
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 675 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 45514, 8418, 538, 410, 76, 842, 368, 341, 286, 2060, 10714, 33673, 310, 31645, 27638, 4239, 44, 17, 8912, 38, 3450, 6831, 18122, 7, 6370, 287, 27847, 486, 62316, 16, 1326, 310, 63644, 17, 8912, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_create_broker_app_name_job() { let _ = env_logger::builder().is_test(true).try_init(); assert_eq!( "node-instance-name-1-job", create_broker_app_name("instance.name", Some("node"), true, "1-job") ); }
rust_cleaned_test_functions.jsonl/1224
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 140 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 8657, 880, 45985, 8191, 1269, 20298, 368, 341, 286, 1077, 716, 284, 6105, 27413, 486, 17850, 1005, 285, 4452, 3715, 568, 1539, 6137, 1428, 286, 2060, 10714, 33673, 310, 330, 3509, 73655, 11494, 12...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_aggregate_signatures_1() { let sign_1 = Bn256.to_compressed_g1(G1::one()).unwrap(); let sign_2 = Bn256.to_compressed_g1(G1::one()).unwrap(); let signatures = [&sign_1[..], &sign_2[..]]; // Aggregation let agg_signature = Bn256 .aggregate_signatures(&signatures) .expect("Signature aggregation should not fail if G1 points are valid."); // Check let expected = hex::decode("02030644e72e131a029b85045b68181585d97816a916871ca8d3c208c16d87cfd3") .unwrap(); assert_eq!(agg_signature, expected); }
rust_cleaned_test_functions.jsonl/65099
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 327 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 20587, 14240, 11172, 2789, 62, 16, 368, 341, 1789, 286, 1077, 1841, 62, 16, 284, 425, 77, 17, 20, 21, 2389, 2965, 14318, 1889, 16, 6699, 16, 486, 603, 6011, 15454, 543, 286, 1077, 1841, 62, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_append_block_at_wrong_location() { let mut rng: StdRng = SeedableRng::from_seed([1u8; 32]); let mut ledger_db = create_db(); let account_key = AccountKey::random(&mut rng); // initialize a ledger with 3 blocks. let n_blocks = 3; let (blocks, _) = populate_db(&mut ledger_db, n_blocks, 2); assert_eq!(ledger_db.num_blocks().unwrap(), n_blocks); let key_images = vec![KeyImage::from(rng.next_u64())]; let tx_out = TxOut::new( 100, &account_key.default_subaddress(), &RistrettoPrivate::from_random(&mut rng), Default::default(), ) .unwrap(); let outputs = vec![tx_out]; let block_contents = BlockContents::new(key_images, outputs); // Appending a block to a previously written location should fail. let mut new_block = Block::new( BLOCK_VERSION, &blocks[0].id, 1, blocks[0].cumulative_txo_count, &Default::default(), &block_contents, ); assert_eq!( ledger_db.append_block(&new_block, &block_contents, None), Err(Error::InvalidBlock) ); // Appending a non-contiguous location should fail. new_block.index = 3 * n_blocks; assert_eq!( ledger_db.append_block(&new_block, &block_contents, None), Err(Error::InvalidBlock) ); }
rust_cleaned_test_functions.jsonl/89699
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 728 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 26041, 7113, 3752, 75198, 13126, 368, 341, 286, 1077, 5206, 28422, 25, 42517, 49, 968, 284, 35822, 480, 49, 968, 486, 1499, 33809, 2561, 16, 84, 23, 26, 220, 18, 17, 2558, 286, 1077, 5206, 469...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_skewness_with_low_d2() { let skewness = |x: FisherSnedecor| x.skewness().unwrap(); get_value(0.1, 0.1, skewness); }
rust_cleaned_test_functions.jsonl/42685
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 88 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 33811, 365, 2090, 6615, 23767, 814, 17, 368, 341, 286, 1077, 40543, 2090, 284, 760, 87, 25, 35504, 50, 18694, 757, 269, 91, 856, 39454, 365, 2090, 1005, 15454, 543, 286, 633, 3142, 7, 15, 13, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_clear_gif_full() { assert_borders_full!("clear.gif", Borders { top: 0, right: 0, bottom: 0, left: 0, }); }
rust_cleaned_test_functions.jsonl/48478
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 224 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21811, 1889, 333, 16372, 368, 341, 262, 2060, 880, 7917, 16372, 17223, 7422, 16008, 756, 5108, 80712, 341, 6526, 1909, 25, 220, 15, 345, 6526, 1290, 25, 220, 15, 345, 6526, 5622, 25, 220, 15, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_parse_time_coverage() { let result = parse_time_coverage("2010", "2020", "P0001-00-00").unwrap(); let expected = ( TimeInstance::from(DateTime::new_utc(2010, 1, 1, 0, 0, 0)), TimeInstance::from(DateTime::new_utc(2021, 1, 1, 0, 0, 0)), TimeStep { granularity: TimeGranularity::Years, step: 1, }, ); assert_eq!(result, expected); }
rust_cleaned_test_functions.jsonl/121837
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 248 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21039, 3009, 73384, 368, 341, 286, 1077, 1102, 284, 4715, 3009, 73384, 445, 17, 15, 16, 15, 497, 330, 17, 15, 17, 15, 497, 330, 47, 15, 15, 15, 16, 12, 15, 15, 12, 15, 15, 1827, 15454, 5...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_csp_real() { let json = r#"{ "csp-report": { "document-uri": "https://sentry.io/sentry/csp/issues/88513416/", "referrer": "https://sentry.io/sentry/sentry/releases/7329107476ff14cfa19cf013acd8ce47781bb93a/", "violated-directive": "script-src", "effective-directive": "script-src", "original-policy": "default-src *; script-src 'make_csp_snapshot' 'unsafe-eval' 'unsafe-inline' e90d271df3e973c7.global.ssl.fastly.net cdn.ravenjs.com assets.zendesk.com ajax.googleapis.com ssl.google-analytics.com www.googleadservices.com analytics.twitter.com platform.twitter.com *.pingdom.net js.stripe.com api.stripe.com statuspage-production.s3.amazonaws.com s3.amazonaws.com *.google.com www.gstatic.com aui-cdn.atlassian.com *.atlassian.net *.jira.com *.zopim.com; font-src * data:; connect-src * wss://*.zopim.com; style-src 'make_csp_snapshot' 'unsafe-inline' e90d271df3e973c7.global.ssl.fastly.net s3.amazonaws.com aui-cdn.atlassian.com fonts.googleapis.com; img-src * data: blob:; report-uri https://sentry.io/api/54785/csp-report/?sentry_key=f724a8a027db45f5b21507e7142ff78e&sentry_release=39662eb9734f68e56b7f202260bb706be2f4cee7", "disposition": "enforce", "blocked-uri": "http://baddomain.com/test.js?_=1515535030116", "line-number": 24, "column-number": 66270, "source-file": "https://e90d271df3e973c7.global.ssl.fastly.net/_static/f0c7c026a4b2a3d2b287ae2d012c9924/sentry/dist/vendor.js", "status-code": 0, "script-sample": "" } }"#; let mut event = Event::default(); Csp::apply_to_event(json.as_bytes(), &mut event).unwrap(); assert_annotated_snapshot!(Annotated::new(event), @r###" { "culprit": "script-src", "logentry": { "formatted": "Blocked 'script' from 'baddomain.com'" }, "request": { "url": "https://sentry.io/sentry/csp/issues/88513416/", "headers": [ [ "Referer", "https://sentry.io/sentry/sentry/releases/7329107476ff14cfa19cf013acd8ce47781bb93a/" ] ] }, "tags": [ [ "effective-directive", "script-src" ], [ "blocked-uri", "http://baddomain.com/test.js?_=1515535030116" ] ], "csp": { "effective_directive": "script-src", "blocked_uri": "http://baddomain.com/test.js?_=1515535030116", "document_uri": "https://sentry.io/sentry/csp/issues/88513416/", "original_policy": "default-src *; script-src 'make_csp_snapshot' 'unsafe-eval' 'unsafe-inline' e90d271df3e973c7.global.ssl.fastly.net cdn.ravenjs.com assets.zendesk.com ajax.googleapis.com ssl.google-analytics.com www.googleadservices.com analytics.twitter.com platform.twitter.com *.pingdom.net js.stripe.com api.stripe.com statuspage-production.s3.amazonaws.com s3.amazonaws.com *.google.com www.gstatic.com aui-cdn.atlassian.com *.atlassian.net *.jira.com *.zopim.com; font-src * data:; connect-src * wss://*.zopim.com; style-src 'make_csp_snapshot' 'unsafe-inline' e90d271df3e973c7.global.ssl.fastly.net s3.amazonaws.com aui-cdn.atlassian.com fonts.googleapis.com; img-src * data: blob:; report-uri https://sentry.io/api/54785/csp-report/?sentry_key=f724a8a027db45f5b21507e7142ff78e&sentry_release=39662eb9734f68e56b7f202260bb706be2f4cee7", "referrer": "https://sentry.io/sentry/sentry/releases/7329107476ff14cfa19cf013acd8ce47781bb93a/", "status_code": 0, "violated_directive": "script-src", "source_file": "https://e90d271df3e973c7.global.ssl.fastly.net/_static/f0c7c026a4b2a3d2b287ae2d012c9924/sentry/dist/vendor.js", "line_number": 24, "column_number": 66270, "script_sample": "", "disposition": "enforce" } } "###); }
rust_cleaned_test_functions.jsonl/4019
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 2135 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 666, 2154, 15266, 368, 341, 286, 1077, 2951, 284, 435, 55543, 515, 310, 330, 66, 2154, 47411, 788, 341, 394, 330, 6062, 87232, 788, 330, 2428, 1110, 82, 4085, 4245, 2687, 4085, 2899, 2154, 38745...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_entry_ref() { let xs = [ ("One".to_owned(), 10), ("Two".to_owned(), 20), ("Three".to_owned(), 30), ("Four".to_owned(), 40), ("Five".to_owned(), 50), ("Six".to_owned(), 60), ]; let mut map: HashMap<_, _> = xs.iter().cloned().collect(); match map.entry_ref("One") { EntryRef::Vacant(_) => unreachable!(), EntryRef::Occupied(mut view) => { assert_eq!(view.get(), &10); assert_eq!(view.insert(100), 10); } } assert_eq!(map.get("One").unwrap(), &100); assert_eq!(map.len(), 6); match map.entry_ref("Two") { EntryRef::Vacant(_) => unreachable!(), EntryRef::Occupied(mut view) => { let v = view.get_mut(); let new_v = (*v) * 10; *v = new_v; } } assert_eq!(map.get("Two").unwrap(), &200); assert_eq!(map.len(), 6); match map.entry_ref("Three") { EntryRef::Vacant(_) => unreachable!(), EntryRef::Occupied(view) => { assert_eq!(view.remove(), 30); } } assert_eq!(map.get("Three"), None); assert_eq!(map.len(), 5); match map.entry_ref("Ten") { EntryRef::Occupied(_) => unreachable!(), EntryRef::Vacant(view) => { assert_eq!(*view.insert(1000), 1000); } } assert_eq!(map.get("Ten").unwrap(), &1000); assert_eq!(map.len(), 6); }
rust_cleaned_test_functions.jsonl/26970
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 948 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 9078, 7793, 368, 341, 286, 1077, 11943, 284, 2278, 310, 3489, 3966, 3263, 983, 51973, 1507, 220, 16, 15, 1326, 310, 3489, 11613, 3263, 983, 51973, 1507, 220, 17, 15, 1326, 310, 3489, 19641, 3263...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
5
#[test] fn test_parse_arguments_pgo() { assert_eq!( CompilerArguments::CannotCache("-fprofile-use", None), parse_arguments_( stringvec!["-c", "foo.c", "-fprofile-use", "-o", "foo.o"], false ) ); assert_eq!( CompilerArguments::CannotCache("-fprofile-use", None), parse_arguments_( stringvec!["-c", "foo.c", "-fprofile-use=file", "-o", "foo.o"], false ) ); }
rust_cleaned_test_functions.jsonl/17758
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 310 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21039, 43433, 620, 3346, 368, 341, 286, 2060, 10714, 33673, 310, 45631, 19139, 486, 17444, 8233, 13645, 69, 5365, 24673, 497, 2240, 1326, 310, 4715, 43433, 62, 1006, 394, 914, 4083, 0, 1183, 12, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_collect_stats() { use engine_test::{kv::KvTestEngine, raft::RaftTestEngine}; use std::sync::Mutex; use std::time::Instant; use tikv_util::worker::LazyWorker; struct RunnerTest { store_stat: Arc<Mutex<StoreStat>>, stats_monitor: StatsMonitor<KvTestEngine, RaftTestEngine>, } impl RunnerTest { fn new( interval: u64, scheduler: Scheduler<Task<KvTestEngine, RaftTestEngine>>, store_stat: Arc<Mutex<StoreStat>>, ) -> RunnerTest { let mut stats_monitor = StatsMonitor::new(Duration::from_secs(interval), scheduler); if let Err(e) = stats_monitor.start(AutoSplitController::default()) { error!("failed to start stats collector, error = {:?}", e); } RunnerTest { store_stat, stats_monitor, } } fn handle_store_infos( &mut self, cpu_usages: RecordPairVec, read_io_rates: RecordPairVec, write_io_rates: RecordPairVec, ) { let mut store_stat = self.store_stat.lock().unwrap(); store_stat.store_cpu_usages = cpu_usages; store_stat.store_read_io_rates = read_io_rates; store_stat.store_write_io_rates = write_io_rates; } } impl Runnable for RunnerTest { type Task = Task<KvTestEngine, RaftTestEngine>; fn run(&mut self, task: Task<KvTestEngine, RaftTestEngine>) { if let Task::StoreInfos { cpu_usages, read_io_rates, write_io_rates, } = task { self.handle_store_infos(cpu_usages, read_io_rates, write_io_rates) }; } fn shutdown(&mut self) { self.stats_monitor.stop(); } } fn sum_record_pairs(pairs: &[pdpb::RecordPair]) -> u64 { let mut sum = 0; for record in pairs.iter() { sum += record.get_value(); } sum } let mut pd_worker = LazyWorker::new("test-pd-worker"); let store_stat = Arc::new(Mutex::new(StoreStat::default())); let runner = RunnerTest::new(1, pd_worker.scheduler(), Arc::clone(&store_stat)); assert!(pd_worker.start(runner)); let start = Instant::now(); loop { if (Instant::now() - start).as_secs() > 2 { break; } } let total_cpu_usages = sum_record_pairs(&store_stat.lock().unwrap().store_cpu_usages); assert!(total_cpu_usages > 90); pd_worker.stop(); }
rust_cleaned_test_functions.jsonl/64558
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1592 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 68140, 15381, 368, 341, 286, 990, 4712, 4452, 22964, 43408, 486, 42, 85, 2271, 4571, 11, 52455, 486, 55535, 723, 2271, 4571, 2440, 286, 990, 1460, 486, 12996, 486, 38099, 280, 286, 990, 1460, 48...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_case_49() { let key = "bfba2449a607f3cca1c911d3b7d9cb972bcd84b0246189c7820032e031949f1e"; let nonce = "97e8ad5eb5a75cc805900850969de48e"; let expected_output = "19faebfbb954552fcfbf9b91f271c9397a15c641733c394a9cb731c286c68645"; hchacha_test_runner(key, nonce, expected_output); }
rust_cleaned_test_functions.jsonl/44711
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 221 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 19096, 62, 19, 24, 368, 341, 310, 1077, 1376, 284, 330, 13233, 4645, 17, 19, 19, 24, 64, 21, 15, 22, 69, 18, 24441, 16, 66, 24, 16, 16, 67, 18, 65, 22, 67, 24, 7221, 24, 22, 17, 91490,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_amounts_to_hr() { let c = Currency::Btc; assert_eq!(&c.amount_to_hr_string(1, false), "0.00000001"); assert_eq!(&c.amount_to_hr_string(100, false), "0.00000100"); assert_eq!(&c.amount_to_hr_string(713, false), "0.00000713"); assert_eq!(&c.amount_to_hr_string(100_000, false), "0.00100000"); assert_eq!(&c.amount_to_hr_string(10_000_000, false), "0.10000000"); assert_eq!(&c.amount_to_hr_string(12_345_678, false), "0.12345678"); assert_eq!(&c.amount_to_hr_string(100_000_000, false), "1.00000000"); assert_eq!(&c.amount_to_hr_string(100_200_300, false), "1.00200300"); assert_eq!(&c.amount_to_hr_string(102_030_405, false), "1.02030405"); assert_eq!(&c.amount_to_hr_string(110_000_000, false), "1.10000000"); assert_eq!(&c.amount_to_hr_string(123_456_789, false), "1.23456789"); assert_eq!(&c.amount_to_hr_string(1_000_000_000, false), "10.00000000"); assert_eq!(&c.amount_to_hr_string(1_020_304_050, false), "10.20304050"); assert_eq!( &c.amount_to_hr_string(10_000_000_000, false), "100.00000000" ); assert_eq!( &c.amount_to_hr_string(10_000_000_001, false), "100.00000001" ); assert_eq!( &c.amount_to_hr_string(10_000_000_010, false), "100.00000010" ); assert_eq!( &c.amount_to_hr_string(10_000_000_100, false), "100.00000100" ); assert_eq!(&c.amount_to_hr_string(1, true), "0.00000001"); assert_eq!(&c.amount_to_hr_string(100, true), "0.000001"); assert_eq!(&c.amount_to_hr_string(713, true), "0.00000713"); assert_eq!(&c.amount_to_hr_string(100_000, true), "0.001"); assert_eq!(&c.amount_to_hr_string(10_000_000, true), "0.1"); assert_eq!(&c.amount_to_hr_string(12_345_678, true), "0.12345678"); assert_eq!(&c.amount_to_hr_string(100_000_000, true), "1.0"); assert_eq!(&c.amount_to_hr_string(100_200_300, true), "1.002003"); assert_eq!(&c.amount_to_hr_string(102_030_405, true), "1.02030405"); assert_eq!(&c.amount_to_hr_string(110_000_000, true), "1.1"); assert_eq!(&c.amount_to_hr_string(123_456_789, true), "1.23456789"); assert_eq!(&c.amount_to_hr_string(1_000_000_000, true), "10.0"); assert_eq!(&c.amount_to_hr_string(1_020_304_050, true), "10.2030405"); assert_eq!(&c.amount_to_hr_string(10_000_000_000, true), "100.0"); assert_eq!(&c.amount_to_hr_string(10_000_000_001, true), "100.00000001"); assert_eq!(&c.amount_to_hr_string(10_000_000_010, true), "100.0000001"); assert_eq!(&c.amount_to_hr_string(10_000_000_100, true), "100.000001"); }
rust_cleaned_test_functions.jsonl/51423
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1176 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 13471, 82, 2346, 70138, 368, 341, 197, 10217, 272, 284, 28453, 486, 33, 10413, 280, 197, 6948, 10714, 0, 2099, 66, 25276, 2346, 70138, 3904, 7, 16, 11, 895, 701, 330, 15, 13, 15, 15, 15, 15,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_unity_mac_os() { let mut os = OsContext { raw_description: "Mac OS X 10.16.0".to_string().into(), ..OsContext::default() }; normalize_os_context(&mut os); assert_eq_dbg!(Some("macOS"), os.name.as_str()); assert_eq_dbg!(Some("10.16.0"), os.version.as_str()); assert_eq_dbg!(None, os.build.value()); }
rust_cleaned_test_functions.jsonl/68965
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 168 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 62, 2439, 22802, 29387, 368, 341, 262, 1077, 5206, 2643, 284, 15433, 1972, 341, 286, 7112, 11448, 25, 330, 19552, 10085, 1599, 220, 16, 15, 13, 16, 21, 13, 15, 3263, 983, 3904, 1005, 18122, 31...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_fmt() { let cigar = Cigar::from(vec![ Op::new(Kind::Match, 1), Op::new(Kind::Skip, 13), Op::new(Kind::SoftClip, 144), ]); assert_eq!(cigar.to_string(), "1M13N144S"); }
rust_cleaned_test_functions.jsonl/127483
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 148 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 38128, 368, 341, 286, 1077, 53674, 284, 356, 51284, 486, 1499, 25592, 90515, 310, 10672, 486, 931, 7, 10629, 486, 8331, 11, 220, 16, 1326, 310, 10672, 486, 931, 7, 10629, 486, 35134, 11, 220, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_simplify_and_false() { let expr_a = lit(false).and(col("c2")); let expr_b = col("c2").and(lit(false)); let expected = lit(false); assert_eq!(simplify(&expr_a), expected); assert_eq!(simplify(&expr_b), expected); }
rust_cleaned_test_functions.jsonl/19676
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 138 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 643, 70206, 8378, 36015, 368, 341, 286, 1077, 15169, 4306, 284, 13020, 3576, 568, 437, 19611, 445, 66, 17, 4010, 286, 1077, 15169, 880, 284, 1375, 445, 66, 17, 1827, 437, 2333, 275, 3576, 1106, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_regex_sources() -> Result<(), Box<dyn Error>> { ore::log::init(); let temp_dir = tempfile::tempdir()?; let config = util::Config::default(); let (_server, mut client) = util::start_server(config)?; let regex_path = Path::join(temp_dir.path(), "request.log"); fs::write( &regex_path, r#"123.17.127.5 - - [22/Jan/2020 18:59:52] "GET / HTTP/1.1" 200 - 8.15.119.56 - - [22/Jan/2020 18:59:52] "GET /detail/nNZpqxzR HTTP/1.1" 200 - 96.12.83.72 - - [22/Jan/2020 18:59:52] "GET /search/?kw=helper+ins+hennaed HTTP/1.1" 200 - "#, )?; let home_page_row = ( Some("123.17.127.5".into()), Some("22/Jan/2020 18:59:52".into()), Some("GET / HTTP/1.1".into()), None, None, Some("200".into()), ); let detail_page_row = ( Some("8.15.119.56".into()), Some("22/Jan/2020 18:59:52".into()), Some("GET /detail/nNZpqxzR HTTP/1.1".into()), None, Some("nNZpqxzR".into()), Some("200".into()), ); let search_page_row = ( Some("96.12.83.72".into()), Some("22/Jan/2020 18:59:52".into()), Some("GET /search/?kw=helper+ins+hennaed HTTP/1.1".into()), Some("helper+ins+hennaed".into()), None, Some("200".into()), ); client.batch_execute(&*format!( "CREATE SOURCE regex_source FROM FILE '{}' FORMAT REGEX '{}'", regex_path.display(), r#"(?P<ip>\d{1,3}\.\d{1,3}\.\d{1,3}\.\d{1,3}) - - \[(?P<ts>[^]]+)\] "(?P<path>(?:GET /search/\?kw=(?P<search_kw>[^ ]*) HTTP/\d\.\d)|(?:GET /detail/(?P<product_detail_id>[a-zA-Z0-9]+) HTTP/\d\.\d)|(?:[^"]+))" (?P<code>\d{3}) -"# ))?; client.batch_execute("CREATE MATERIALIZED VIEW regex AS SELECT * FROM regex_source")?; thread::sleep(Duration::from_secs(1)); let all_results: Vec<_> = client .query("SELECT * FROM regex ORDER BY mz_line_no", &[])? .into_iter() .map(|r| (r.get(0), r.get(1), r.get(2), r.get(3), r.get(4), r.get(5))) .collect::<Vec<( Option<String>, Option<String>, Option<String>, Option<String>, Option<String>, Option<String>, )>>(); assert_eq!( all_results, vec![home_page_row, detail_page_row, search_page_row.clone()] ); let search_only: Vec<_> = client .query( "SELECT search_kw FROM regex WHERE search_kw IS NOT NULL", &[], )? .into_iter() .map(|r| r.get(0)) .collect::<Vec<Option<String>>>(); assert_eq!(search_only, vec![search_page_row.3]); Ok(()) }
rust_cleaned_test_functions.jsonl/123703
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1409 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 41832, 52896, 368, 1464, 5714, 68843, 8261, 92846, 4600, 2452, 341, 262, 16144, 486, 839, 486, 2327, 1428, 262, 1077, 2730, 4334, 284, 54819, 486, 3888, 3741, 94136, 262, 1077, 2193, 284, 4094, 48...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
6
#[test] fn test_unix_stream_timeout_zero_duration() { let dir = tmpdir(); let socket_path = dir.path().join("sock"); let listener = or_panic!(UnixListener::bind(&socket_path)); let stream = or_panic!(UnixStream::connect(&socket_path)); let result = stream.set_write_timeout(Some(Duration::new(0, 0))); let err = result.unwrap_err(); assert_eq!(err.kind(), ErrorKind::InvalidInput); let result = stream.set_read_timeout(Some(Duration::new(0, 0))); let err = result.unwrap_err(); assert_eq!(err.kind(), ErrorKind::InvalidInput); drop(listener); }
rust_cleaned_test_functions.jsonl/98541
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 272 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 80572, 12673, 20537, 19359, 25454, 368, 341, 286, 1077, 5419, 284, 4174, 3741, 543, 286, 1077, 7575, 2638, 284, 5419, 3875, 1005, 5987, 445, 13199, 3071, 286, 1077, 11446, 284, 476, 620, 31270, 10...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_iter_rev_cloned_collect() { let data = vec![5, 9, 3]; let iterout = vec![3, 5, 9]; let pq = BinaryHeap::from(data); let v: Vec<_> = pq.iter().rev().cloned().collect(); assert_eq!(v, iterout); }
rust_cleaned_test_functions.jsonl/62349
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 112 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 11723, 38082, 6794, 19684, 68140, 368, 341, 262, 1077, 821, 284, 7486, 20703, 20, 11, 220, 24, 11, 220, 18, 935, 262, 1077, 5367, 411, 284, 7486, 20703, 18, 11, 220, 20, 11, 220, 24, 935, 26...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_vote_accounts_cow() { let mut rng = rand::thread_rng(); let mut accounts = new_rand_vote_accounts(&mut rng, 64); // Add vote accounts. let mut vote_accounts = VoteAccounts::default(); for (pubkey, (stake, vote_account)) in (&mut accounts).take(1024) { vote_accounts.insert(pubkey, (stake, vote_account)); } let vote_accounts_hashmap = Arc::<VoteAccountsHashMap>::from(&vote_accounts); assert_eq!(vote_accounts_hashmap, vote_accounts.vote_accounts); assert!(Arc::ptr_eq( &vote_accounts_hashmap, &vote_accounts.vote_accounts )); let (pubkey, (more_stake, vote_account)) = accounts.find(|(_, (stake, _))| *stake != 0).unwrap(); vote_accounts.insert(pubkey, (more_stake, vote_account.clone())); assert!(!Arc::ptr_eq( &vote_accounts_hashmap, &vote_accounts.vote_accounts )); assert_ne!(vote_accounts_hashmap, vote_accounts.vote_accounts); let other = (more_stake, vote_account); for (pk, value) in vote_accounts.iter() { if *pk != pubkey { assert_eq!(value, &vote_accounts_hashmap[pk]); } else { assert_eq!(value, &other); } } }
rust_cleaned_test_functions.jsonl/23439
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 666 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 54360, 55665, 666, 363, 368, 341, 286, 1077, 5206, 28422, 284, 10382, 486, 4528, 66849, 543, 286, 1077, 5206, 9618, 284, 501, 33864, 54360, 55665, 2099, 6984, 28422, 11, 220, 21, 19, 317, 286, 4...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
4
#[test] fn test_vec() { let supported = SupportedAlgorithms::all(); let array: Vec<u8> = (&supported).into(); let decoded: SupportedAlgorithms = (&array as &[_]).into(); assert_eq!(supported, decoded); let mut supported = SupportedAlgorithms::new(); supported.set(Algorithm::RSASHA256); supported.set(Algorithm::ECDSAP256SHA256); supported.set(Algorithm::ECDSAP384SHA384); supported.set(Algorithm::ED25519); let array: Vec<u8> = (&supported).into(); let decoded: SupportedAlgorithms = (&array as &[_]).into(); assert_eq!(supported, decoded); assert!(!supported.has(Algorithm::RSASHA1)); assert!(!supported.has(Algorithm::RSASHA1NSEC3SHA1)); assert!(supported.has(Algorithm::RSASHA256)); assert!(supported.has(Algorithm::ECDSAP256SHA256)); assert!(supported.has(Algorithm::ECDSAP384SHA384)); assert!(supported.has(Algorithm::ED25519)); }
rust_cleaned_test_functions.jsonl/47075
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 345 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 13251, 368, 341, 262, 1077, 7248, 284, 48980, 2101, 18980, 486, 541, 543, 262, 1077, 1334, 25, 11312, 34837, 23, 29, 284, 15899, 18216, 568, 18122, 543, 262, 1077, 29213, 25, 48980, 2101, 18980, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_value_ConstrainedEntss() { let mut schemaReplicant = SchemaReplicant::default(); associate_causetId(&mut schemaReplicant, Keyword::namespaced("foo", "bar"), 99); add_attribute(&mut schemaReplicant, 99, Attribute { value_type: MinkowskiValueType::Boolean, ..Default::default() }); let x = ToUpper::from_valid_name("?x"); let y = ToUpper::from_valid_name("?y"); let b: BTreeMap<ToUpper, MinkowskiType> = vec![(y.clone(), MinkowskiType::Boolean(true))].into_iter().collect(); let inputs = CausetQInputs::with_values(b); let variables: BTreeSet<ToUpper> = vec![ToUpper::from_valid_name("?y")].into_iter().collect(); let mut cc = ConjoiningGerunds::with_inputs(variables, inputs); let knownCauset = KnownCauset::for_schemaReplicant(&schemaReplicant); cc.apply_parsed_TuringString(knownCauset, TuringString { source: None, instanton: TuringStringNonValuePlace::ToUpper(x.clone()), attribute: causetid("foo", "bar"), value: TuringStringValuePlace::ToUpper(y.clone()), causetx: TuringStringNonValuePlace::Placeholder, }); let d0_e = QualifiedAlias::new("Causets00".to_string(), CausetsCausetIndex::Instanton); let d0_a = QualifiedAlias::new("Causets00".to_string(), CausetsCausetIndex::Attribute); let d0_v = QualifiedAlias::new("Causets00".to_string(), CausetsCausetIndex::Value); // ?y has been expanded into `true`. assert_eq!(cc.wheres, vec![ CausetIndexConstraint::Equals(d0_a, CausetQValue::SolitonId(99)), CausetIndexConstraint::Equals(d0_v, CausetQValue::MinkowskiType(MinkowskiType::Boolean(true))), ].into()); // There is no Constrained for ?y. assert!(!cc.CausetIndex_ConstrainedEntss.contains_key(&y)); // ?x is bound to the instanton. assert_eq!(cc.CausetIndex_ConstrainedEntss.get(&x).unwrap(), &vec![d0_e.clone()]); }
rust_cleaned_test_functions.jsonl/32593
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 962 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 3142, 15100, 57727, 2250, 778, 368, 341, 286, 1077, 5206, 10802, 18327, 35237, 284, 12539, 18327, 35237, 486, 2258, 1428, 286, 21946, 666, 11855, 295, 764, 2099, 6984, 10802, 18327, 35237, 11, 48970...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_network_home_generate_key_file() { let dir = tempdir().unwrap(); fs::create_dir_all(dir.path().join("localhost/accounts/latest")).unwrap(); let network_home = NetworkHome::new(dir.path().join("localhost").as_path()); network_home.generate_key_file().unwrap(); assert_eq!( dir.path() .join("localhost/accounts/latest/dev.key") .exists(), true ); }
rust_cleaned_test_functions.jsonl/39526
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 234 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 20966, 21653, 48851, 3097, 2458, 368, 341, 286, 1077, 5419, 284, 2730, 3741, 1005, 15454, 543, 286, 8619, 486, 3182, 4334, 5705, 14161, 3875, 1005, 5987, 445, 8301, 83743, 33149, 15197, 15454, 1428,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_recordbatch_iterator() { let df = df!( "foo" => &[1, 2, 3, 4, 5] ) .unwrap(); let mut iter = df.iter_record_batches(); assert_eq!(5, iter.next().unwrap().num_rows()); assert!(iter.next().is_none()); }
rust_cleaned_test_functions.jsonl/18787
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 154 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 14192, 14049, 13491, 368, 341, 286, 1077, 6764, 284, 6764, 33673, 310, 330, 7975, 1, 589, 44590, 16, 11, 220, 17, 11, 220, 18, 11, 220, 19, 11, 220, 20, 921, 286, 1727, 286, 659, 15454, 543,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_verifying_key_path() { for rsp in &REGISTERED_SEAL_PROOFS { rsp.cache_verifying_key_path() .expect("failed to get verifying key path"); } }
rust_cleaned_test_functions.jsonl/88714
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 111 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 26042, 7766, 3097, 2638, 368, 341, 286, 369, 42160, 304, 609, 46302, 1479, 3620, 969, 5756, 46, 8485, 341, 310, 42160, 20087, 26042, 7766, 3097, 2638, 741, 394, 659, 17119, 445, 16091, 311, 633, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
2
#[test] fn test_statsd_client_as_gauged_f64() { let client: Box<dyn Gauged<f64>> = Box::new(StatsdClient::from_sink("prefix", NopMetricSink)); client.gauge("some.gauge", 3.2).unwrap(); }
rust_cleaned_test_functions.jsonl/10618
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 105 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 15381, 67, 8179, 11898, 1889, 19179, 291, 761, 21, 19, 368, 341, 286, 1077, 2943, 25, 8261, 92846, 18373, 768, 291, 63895, 21, 19, 2452, 284, 8261, 486, 931, 7, 16635, 67, 2959, 486, 1499, 515...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_raw_auth() { let mut headers = Headers::new(); headers.set(Authorization("foo bar baz".to_owned())); assert_eq!(headers.to_string(), "Authorization: foo bar baz\r\n".to_owned()); }
rust_cleaned_test_functions.jsonl/31561
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 102 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 16067, 14014, 368, 341, 286, 1077, 5206, 7102, 284, 21426, 486, 931, 543, 286, 7102, 980, 4346, 1553, 2022, 445, 7975, 3619, 50247, 3263, 983, 51973, 7392, 286, 2060, 10714, 10297, 7713, 2389, 390...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_new_record() { let mut collection = setup_collection(); collection.create().unwrap(); let record = collection.new_record(); assert_eq!(record.data, None); assert_eq!(record.get_id(), None); }
rust_cleaned_test_functions.jsonl/63503
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 112 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 5921, 14192, 368, 341, 286, 1077, 5206, 4426, 284, 6505, 25019, 543, 286, 4426, 2520, 1005, 15454, 543, 286, 1077, 3255, 284, 4426, 4618, 14192, 543, 286, 2060, 10714, 10297, 8548, 2196, 11, 2240,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_usage_description_newline_handling() { let mut opts = Options::new(); opts.optflag( "k", "k\u{2013}w\u{2013}", "The word kiwi is normally spelled with two i's", ); opts.optflag( "a", "apple", "This description forces a new line.\n Here is a premature\n\ newline", ); let expected = "Usage: fruits Options: -k, --k–w– The word kiwi is normally spelled with two i's -a, --apple This description forces a new line. Here is a premature newline "; let usage = opts.usage("Usage: fruits"); debug!("expected: <<{}>>", expected); debug!("generated: <<{}>>", usage); assert!(usage == expected) }
rust_cleaned_test_functions.jsonl/52393
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 371 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 31507, 11448, 5921, 1056, 75642, 368, 341, 262, 1077, 5206, 12185, 284, 14566, 486, 931, 543, 262, 12185, 28102, 9903, 1006, 286, 330, 74, 756, 286, 330, 74, 3770, 90, 17, 15, 16, 18, 92, 86, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_prune_out_of_bounds() { let blockstore_path = get_tmp_ledger_path!(); let blockstore = Blockstore::open(&blockstore_path).unwrap(); blockstore.prune(5); drop(blockstore); Blockstore::destroy(&blockstore_path).expect("Expected successful database destruction"); }
rust_cleaned_test_functions.jsonl/94030
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 144 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 5294, 2886, 6068, 3575, 36878, 368, 341, 286, 1077, 2504, 4314, 2638, 284, 633, 16125, 38367, 1389, 2638, 0, 543, 286, 1077, 2504, 4314, 284, 8362, 4314, 486, 2508, 2099, 4574, 4314, 2638, 568, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_cast_range_i8_max() { assert_eq!(i8::max_value.to_int(), Some(i8::max_value as int)); assert_eq!(i8::max_value.to_i8(), Some(i8::max_value as i8)); assert_eq!(i8::max_value.to_i16(), Some(i8::max_value as i16)); assert_eq!(i8::max_value.to_i32(), Some(i8::max_value as i32)); assert_eq!(i8::max_value.to_i64(), Some(i8::max_value as i64)); assert_eq!(i8::max_value.to_uint(), Some(i8::max_value as uint)); assert_eq!(i8::max_value.to_u8(), Some(i8::max_value as u8)); assert_eq!(i8::max_value.to_u16(), Some(i8::max_value as u16)); assert_eq!(i8::max_value.to_u32(), Some(i8::max_value as u32)); assert_eq!(i8::max_value.to_u64(), Some(i8::max_value as u64)); }
rust_cleaned_test_functions.jsonl/12451
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 406 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 5303, 9698, 5318, 23, 6345, 368, 341, 286, 2060, 10714, 10297, 72, 23, 486, 2810, 3142, 2389, 4042, 1507, 220, 4329, 1956, 23, 486, 2810, 3142, 438, 526, 1106, 286, 2060, 10714, 10297, 72, 23, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_value_arc() { assert_ne!(crate::Type::INVALID, MySharedArc::type_()); let b = MySharedArc::from_refcounted(std::sync::Arc::new(MySharedInner { foo: String::from("abc"), })); let v = b.to_value(); let b2 = v.get_some::<MySharedArc>().unwrap(); assert!(std::sync::Arc::ptr_eq(&b.0, &b2.0)); }
rust_cleaned_test_functions.jsonl/49617
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 196 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 3142, 62914, 368, 341, 286, 2060, 13925, 10297, 61711, 486, 929, 486, 46859, 11, 3017, 16997, 36809, 486, 1313, 62, 5231, 286, 1077, 293, 284, 3017, 16997, 36809, 486, 1499, 7793, 1830, 291, 5194,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_trusted_insert_shreds() { let ledger_path = get_tmp_ledger_path_auto_delete!(); let blockstore = Blockstore::open(ledger_path.path()).unwrap(); // Make shred for slot 1 let (shreds1, _) = make_slot_entries(1, 0, 1); let last_root = 100; blockstore.set_roots(std::iter::once(&last_root)).unwrap(); blockstore .insert_shreds(shreds1[..].to_vec(), None, false) .unwrap(); assert!(blockstore.get_data_shred(1, 0).unwrap().is_none()); // Insert through trusted path will succeed blockstore .insert_shreds(shreds1[..].to_vec(), None, true) .unwrap(); assert!(blockstore.get_data_shred(1, 0).unwrap().is_some()); }
rust_cleaned_test_functions.jsonl/9555
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 380 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 3547, 27145, 17678, 3712, 53369, 368, 341, 286, 1077, 46933, 2638, 284, 633, 16125, 38367, 1389, 2638, 27740, 11353, 0, 543, 286, 1077, 2504, 4314, 284, 8362, 4314, 486, 2508, 7, 50704, 2638, 3875...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_generate_btree_ranges_complex() { let index_schema = IndexSchema::new(vec![ FieldSpec::new(vec![String::from("a")], Value::Int32(0)), FieldSpec::new(vec![String::from("b")], Value::Int32(0)), FieldSpec::new(vec![String::from("c")], Value::Int32(0)), ]); let constraint = &HashMap::from([ ( vec![String::from("a")], Constraint::Or( Box::new(Constraint::LessThan(Value::Int32(2))), Box::new(Constraint::GreaterThan(Value::Int32(8))), ), ), ( vec![String::from("b")], Constraint::Or( Box::new(Constraint::Equals(Value::Int32(5))), Box::new(Constraint::LessThan(Value::Int32(3))), ), ), ( vec![String::from("c")], Constraint::And( Box::new(Constraint::GreaterThan(Value::Int32(4))), Box::new(Constraint::LessThan(Value::Int32(9))), ), ), ]); assert!(are_ranges_equal_unordered( &index_schema.generate_btree_ranges(constraint), &vec![ ( Bound::Included(Index::new(vec![ Value::Int32(0).get_min_value(), Value::Int32(5), Value::Int32(4), ])), Bound::Included(Index::new(vec![ Value::Int32(2), Value::Int32(5), Value::Int32(9), ])) ), ( Bound::Included(Index::new(vec![ Value::Int32(0).get_min_value(), Value::Int32(0).get_min_value(), Value::Int32(4), ])), Bound::Included(Index::new(vec![ Value::Int32(2), Value::Int32(3), Value::Int32(9), ])) ), ( Bound::Included(Index::new(vec![ Value::Int32(8), Value::Int32(5), Value::Int32(4), ])), Bound::Included(Index::new(vec![ Value::Int32(0,).get_max_value(), Value::Int32(5,), Value::Int32(9,), ])) ), ( Bound::Included(Index::new(vec![ Value::Int32(8), Value::Int32(0).get_min_value(), Value::Int32(4), ])), Bound::Included(Index::new(vec![ Value::Int32(0).get_max_value(), Value::Int32(3), Value::Int32(9), ])) ) ] )); }
rust_cleaned_test_functions.jsonl/71775
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 2148 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 48851, 880, 9344, 58748, 41522, 368, 341, 286, 1077, 1922, 25371, 284, 8008, 8632, 486, 931, 25592, 90515, 310, 8601, 8327, 486, 931, 25592, 20703, 703, 486, 1499, 445, 64, 899, 1125, 5162, 486, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_load_int_const() { let mut masm = MacroAssembler::new(); masm.load_int_const(Int32, R0, 0); assert_emit!(0x52800000; masm); let mut masm = MacroAssembler::new(); masm.load_int_const(Int32, R0, 0xFFFF); assert_emit!(0x529FFFE0; masm); let mut masm = MacroAssembler::new(); masm.load_int_const(Int32, R0, 1i64 << 16); assert_emit!(0x52a00020; masm); let mut masm = MacroAssembler::new(); masm.load_int_const(Ptr, R0, 0); assert_emit!(0xD2800000; masm); let mut masm = MacroAssembler::new(); masm.load_int_const(Int32, R0, -1); assert_emit!(0x12800000; masm); let mut masm = MacroAssembler::new(); masm.load_int_const(Ptr, R0, -1); assert_emit!(0x92800000; masm); }
rust_cleaned_test_functions.jsonl/20612
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 441 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 12411, 4042, 13610, 368, 341, 286, 1077, 5206, 9243, 76, 284, 53317, 77858, 486, 931, 543, 286, 9243, 76, 5104, 4042, 13610, 24123, 18, 17, 11, 431, 15, 11, 220, 15, 317, 286, 2060, 69082, 102...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_iter_syntax() { let nonempty = NonEmpty::from((0, vec![1, 2, 3])); for n in &nonempty { assert_eq!(*n, *n); // Prove that we're dealing with references. } for _ in nonempty {} }
rust_cleaned_test_functions.jsonl/17875
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 124 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 11723, 78894, 368, 341, 286, 1077, 2477, 3194, 284, 11581, 3522, 486, 1499, 1188, 15, 11, 7486, 20703, 16, 11, 220, 17, 11, 220, 18, 14382, 286, 369, 308, 304, 609, 6280, 3194, 341, 310, 2060,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_get_vertex_bytes() { let vertices = &[ ([0., 0., 0.], [1., 1., 1.], [2., 2.]), ([3., 3., 3.], [4., 4., 4.], [5., 5.]), ([6., 6., 6.], [7., 7., 7.], [8., 8.]), ]; let mut positions = Vec::new(); let mut normals = Vec::new(); let mut uvs = Vec::new(); for (position, normal, uv) in vertices.iter() { positions.push(*position); normals.push(*normal); uvs.push(*uv); } let mesh = Mesh { primitive_topology: PrimitiveTopology::TriangleStrip, attributes: vec![ VertexAttribute::position(positions), VertexAttribute::normal(normals), VertexAttribute::uv(uvs), ], indices: None, }; let expected_vertices = &[ Vertex { position: [0., 0., 0.], normal: [1., 1., 1.], uv: [2., 2.], }, Vertex { position: [3., 3., 3.], normal: [4., 4., 4.], uv: [5., 5.], }, Vertex { position: [6., 6., 6.], normal: [7., 7., 7.], uv: [8., 8.], }, ]; let descriptor = Vertex::as_vertex_buffer_descriptor(); assert_eq!( mesh.get_vertex_buffer_bytes(descriptor, true).unwrap(), expected_vertices.as_bytes(), "buffer bytes are equal" ); }
rust_cleaned_test_functions.jsonl/54644
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 919 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 3062, 26611, 12524, 368, 341, 286, 1077, 17228, 284, 609, 9640, 310, 11743, 15, 2572, 220, 15, 2572, 220, 15, 13, 1125, 508, 16, 2572, 220, 16, 2572, 220, 16, 13, 1125, 508, 17, 2572, 220, 1...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_enum_no_reader_schema() { let writer_raw_schema = r#" { "type": "record", "name": "test", "fields": [ {"name": "a", "type": "long", "default": 42}, {"name": "b", "type": "string"}, { "name": "c", "type": { "type": "enum", "name": "suit", "symbols": ["diamonds", "spades", "clubs", "hearts"] }, "default": "spades" } ] } "#; let writer_schema = Schema::parse_str(writer_raw_schema).unwrap(); let mut writer = Writer::with_codec(&writer_schema, Vec::new(), Codec::Null); let mut record = Record::new(writer.schema()).unwrap(); record.put("a", 27i64); record.put("b", "foo"); record.put("c", "clubs"); writer.append(record).unwrap(); let input = writer.into_inner().unwrap(); let mut reader = Reader::new(&input[..]).unwrap(); assert_eq!( reader.next().unwrap().unwrap(), Value::Record(vec![ ("a".to_string(), Value::Long(27)), ("b".to_string(), Value::String("foo".to_string())), ("c".to_string(), Value::Enum(2, "clubs".to_string())), ]) ); }
rust_cleaned_test_functions.jsonl/77303
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 887 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 31054, 6536, 22306, 25371, 368, 341, 286, 1077, 6916, 16067, 25371, 284, 435, 2, 698, 310, 341, 394, 330, 1313, 788, 330, 8548, 756, 394, 330, 606, 788, 330, 1944, 756, 394, 330, 9007, 788, 22...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_timeout() -> io::Result<()> { let mut events = Events::new(); let mut sources = Sources::new(); sources.register((), &io::stdin(), interest::READ); let err = sources .wait_timeout(&mut events, Duration::from_millis(1)) .unwrap_err(); assert_eq!(sources.len(), 1); assert_eq!(err.kind(), io::ErrorKind::TimedOut); assert!(events.is_empty()); Ok(()) }
rust_cleaned_test_functions.jsonl/1041
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 217 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 20537, 368, 1464, 6399, 486, 2077, 71698, 341, 286, 1077, 5206, 4357, 284, 17627, 486, 931, 543, 286, 1077, 5206, 8173, 284, 47032, 486, 931, 1428, 286, 8173, 9929, 7, 1507, 609, 815, 486, 51602...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_image_buffer_copy_within_oob() { let mut image: GrayImage = ImageBuffer::from_raw(4, 4, vec![0u8; 16]).unwrap(); assert!(!image.copy_within(Rect { x: 0, y: 0, width: 5, height: 4 }, 0, 0)); assert!(!image.copy_within(Rect { x: 0, y: 0, width: 4, height: 5 }, 0, 0)); assert!(!image.copy_within(Rect { x: 1, y: 0, width: 4, height: 4 }, 0, 0)); assert!(!image.copy_within(Rect { x: 0, y: 0, width: 4, height: 4 }, 1, 0)); assert!(!image.copy_within(Rect { x: 0, y: 1, width: 4, height: 4 }, 0, 0)); assert!(!image.copy_within(Rect { x: 0, y: 0, width: 4, height: 4 }, 0, 1)); assert!(!image.copy_within(Rect { x: 1, y: 1, width: 4, height: 4 }, 0, 0)); }
rust_cleaned_test_functions.jsonl/25548
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 349 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 4954, 7776, 16096, 72385, 14179, 674, 368, 341, 286, 1077, 5206, 2168, 25, 23366, 1906, 284, 4654, 4095, 486, 1499, 16067, 7, 19, 11, 220, 19, 11, 7486, 20703, 15, 84, 23, 26, 220, 16, 21, 1...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_pop() { let mut data = String::from("ประเทศไทย中华b¢€𤭢"); assert_eq!(data.pop().unwrap(), '𤭢'); // 4 bytes assert_eq!(data.ap(), '€'); // 3 bytes assert_eq!(data.po(), '¢'); // 2 bytes assert_eq!(data.pop), 'b'); // 1 bytes assert_eq!(data.pop), '华'); assert_eq!(data, "ประเทศไทย中"); }
rust_cleaned_test_functions.jsonl/3167
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 191 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 17061, 368, 341, 262, 1077, 5206, 821, 284, 923, 486, 1499, 445, 130391, 100849, 65, 56394, 15056, 101877, 255, 95, 797, 262, 2060, 10714, 10297, 691, 8288, 1005, 15454, 1507, 364, 101877, 255, 95...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_chromatic_scale_with_sharps() { process_chromatic_case( "C", &[ "C", "C#", "D", "D#", "E", "F", "F#", "G", "G#", "A", "A#", "B", ], ); }
rust_cleaned_test_functions.jsonl/103939
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 127 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 4138, 98766, 16727, 6615, 3712, 277, 1690, 368, 341, 262, 1882, 4138, 98766, 19096, 1006, 286, 330, 34, 756, 286, 609, 9640, 310, 330, 34, 497, 330, 34, 75915, 330, 35, 497, 330, 35, 75915, 33...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_full_jitter_backoff() { let mut backoff = FullJitterBackoff::new(2, 7, 3); assert!(backoff.next_delay_duration().unwrap() <= Duration::from_millis(2)); assert!(backoff.next_delay_duration().unwrap() <= Duration::from_millis(4)); assert!(backoff.next_delay_duration().unwrap() <= Duration::from_millis(7)); assert_eq!(backoff.next_delay_duration(), None); }
rust_cleaned_test_functions.jsonl/16664
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 178 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 16372, 5374, 3248, 3895, 1847, 368, 341, 286, 1077, 5206, 1182, 1847, 284, 8627, 41, 3248, 3707, 1847, 486, 931, 7, 17, 11, 220, 22, 11, 220, 18, 317, 286, 2060, 10297, 1419, 1847, 4529, 22198...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_default_features() { let p = project("foo") .file("Cargo.toml", r#" [project] name = "foo" version = "0.0.1" authors = [] [features] default = ["a"] a = [] [[test]] name = "foo" required-features = ["a"] "#) .file("tests/foo.rs", "#[test]\nfn test() {}"); p.build(); assert_that(p.cargo("test"), execs().with_status(0).with_stderr(format!("\ [COMPILING] foo v0.0.1 ({}) [FINISHED] dev [unoptimized + debuginfo] target(s) in [..] [RUNNING] target[/]debug[/]deps[/]foo-[..][EXE]", p.url())) .with_stdout(" running 1 test test test ... ok test result: ok. 1 passed; 0 failed; 0 ignored; 0 measured ")); assert_that(p.cargo("test").arg("--no-default-features"), execs().with_status(0).with_stderr(format!("\ [FINISHED] dev [unoptimized + debuginfo] target(s) in [..]")) .with_stdout("")); assert_that(p.cargo("test").arg("--test=foo"), execs().with_status(0).with_stderr(format!("\ [FINISHED] dev [unoptimized + debuginfo] target(s) in [..] [RUNNING] target[/]debug[/]deps[/]foo-[..][EXE]")) .with_stdout(" running 1 test test test ... ok test result: ok. 1 passed; 0 failed; 0 ignored; 0 measured ")); assert_that(p.cargo("test").arg("--test=foo").arg("--no-default-features"), execs().with_status(101).with_stderr("\ error: target `foo` requires the features: `a` Consider enabling them by passing e.g. `--features=\"a\"` ")); }
rust_cleaned_test_functions.jsonl/93339
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 796 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 9993, 14965, 368, 341, 262, 1077, 281, 284, 2390, 445, 7975, 1138, 286, 659, 1192, 445, 98228, 73494, 75, 497, 435, 2, 698, 310, 508, 4987, 921, 310, 829, 284, 330, 7975, 698, 310, 2319, 284, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_at_signs_file_not_readable() { let td = tempfile::Builder::new() .prefix("sccache") .tempdir() .unwrap(); let arg = format!("-@{}", td.path().join("foo").display()); // File foo doesn't exist. assert_eq!( parse_arguments_(vec![arg]), CompilerArguments::CannotCache("-@", None) ); }
rust_cleaned_test_functions.jsonl/18539
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 214 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 3752, 11172, 82, 2458, 7913, 91232, 368, 341, 286, 1077, 17941, 284, 54819, 486, 3297, 486, 931, 741, 310, 659, 11849, 445, 82, 638, 1777, 1138, 310, 659, 3888, 3741, 741, 310, 659, 15454, 543, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_rlp_nested_empty_list_encode() { let mut stream = RlpStream::new_list(2); stream.append_list(&(Vec::new() as Vec<u32>)); stream.append(&0x28_u32); assert_eq!(stream.out()[..], hex!("c2c028")[..]); }
rust_cleaned_test_functions.jsonl/74208
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 105 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 1710, 13545, 66279, 15124, 2019, 11224, 368, 341, 10217, 5206, 4269, 284, 431, 13545, 3027, 486, 931, 2019, 7, 17, 317, 44440, 2057, 2019, 29089, 10050, 486, 931, 368, 438, 11312, 34837, 18, 17, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_ancestor_iterator_with_hash() { let ledger_path = get_tmp_ledger_path_auto_delete!(); let blockstore = setup_forks(ledger_path.path()); // Insert frozen hashes let mut slot_to_bank_hash = HashMap::new(); for slot in 0..=4 { let bank_hash = Hash::new_unique(); slot_to_bank_hash.insert(slot, bank_hash); blockstore.insert_bank_hash(slot, bank_hash, false); } // Test correctness assert!( AncestorIteratorWithHash::from(AncestorIterator::new(0, &blockstore)) .next() .is_none() ); assert_eq!( AncestorIteratorWithHash::from(AncestorIterator::new(4, &blockstore)) .collect::<Vec<(Slot, Hash)>>(), vec![(1, slot_to_bank_hash[&1]), (0, slot_to_bank_hash[&0])] ); assert_eq!( AncestorIteratorWithHash::from(AncestorIterator::new(3, &blockstore)) .collect::<Vec<(Slot, Hash)>>(), vec![ (2, slot_to_bank_hash[&2]), (1, slot_to_bank_hash[&1]), (0, slot_to_bank_hash[&0]) ] ); }
rust_cleaned_test_functions.jsonl/122485
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 657 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 62, 66878, 13491, 6615, 8950, 368, 341, 286, 1077, 46933, 2638, 284, 633, 16125, 38367, 1389, 2638, 27740, 11353, 0, 543, 286, 1077, 2504, 4314, 284, 6505, 761, 73302, 7, 50704, 2638, 3875, 5231, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_multiple_packages() { let p = project() .file( "Cargo.toml", r#" [package] name = "foo" version = "0.0.1" authors = [] [dependencies.d1] path = "d1" [dependencies.d2] path = "d2" [lib] name = "foo" doctest = false "#, ) .file("src/lib.rs", "") .file( "d1/Cargo.toml", r#" [package] name = "d1" version = "0.0.1" authors = [] [lib] name = "d1" doctest = false "#, ) .file("d1/src/lib.rs", "") .file( "d2/Cargo.toml", r#" [package] name = "d2" version = "0.0.1" authors = [] [lib] name = "d2" doctest = false "#, ) .file("d2/src/lib.rs", ""); let p = p.build(); p.cargo("test -p d1 -p d2") .with_stderr_contains("[RUNNING] target/debug/deps/d1-[..][EXE]") .with_stderr_contains("[RUNNING] target/debug/deps/d2-[..][EXE]") .with_stdout_contains_n("running 0 tests", 2) .run(); }
rust_cleaned_test_functions.jsonl/95366
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 893 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 45233, 41874, 368, 341, 262, 1077, 281, 284, 2390, 741, 286, 659, 1192, 1006, 310, 330, 98228, 73494, 75, 756, 310, 435, 2, 698, 310, 508, 1722, 921, 310, 829, 284, 330, 7975, 698, 310, 2319, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_real_as_json() { test_none_with_ctx(cast_any_as_json::<Real>); let cs = vec![ ( f64::from(f32::MAX), Json::from_f64(f64::from(f32::MAX)).unwrap(), ), ( f64::from(f32::MIN), Json::from_f64(f64::from(f32::MIN)).unwrap(), ), (f64::MAX, Json::from_f64(f64::MAX).unwrap()), (f64::MIN, Json::from_f64(f64::MIN).unwrap()), ]; for (input, expect) in cs { let mut ctx = EvalContext::default(); let r = cast_any_as_json::<Real>(&mut ctx, Real::new(input).as_ref().ok()); let log = make_log(&input, &expect, &r); check_result(Some(&expect), &r, log.as_str()); } }
rust_cleaned_test_functions.jsonl/2000
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 474 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 15266, 11898, 9455, 368, 341, 286, 1273, 31488, 6615, 15147, 1337, 559, 37248, 11898, 9455, 27638, 12768, 29, 626, 286, 1077, 10532, 284, 7486, 90515, 310, 2399, 394, 282, 21, 19, 486, 1499, 955, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_count() { let rocket = super::rocket(); // Count should start at 0. assert_eq!(get_count(&rocket), 0); for _ in 0..99 { register_hit(&rocket); } assert_eq!(get_count(&rocket), 99); register_hit(&rocket); assert_eq!(get_count(&rocket), 100); }
rust_cleaned_test_functions.jsonl/9217
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 120 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 3180, 368, 341, 262, 1077, 24306, 284, 2256, 486, 46790, 1428, 262, 442, 4504, 1265, 1191, 518, 220, 15, 624, 262, 2060, 10714, 10297, 455, 3180, 2099, 46790, 701, 220, 15, 626, 262, 369, 716, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_9() { assert_eq!( parse_column_type(&mut Parser::new("smallint(8) unsigned zerofill")), ColumnType::SmallInt(NumericAttr { maximum: Some(8), decimal: None, unsigned: Some(true), zero_fill: Some(true), }) ); }
rust_cleaned_test_functions.jsonl/73838
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 204 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 62, 24, 368, 341, 286, 2060, 10714, 33673, 310, 4715, 8744, 1819, 2099, 6984, 21102, 486, 931, 445, 9004, 396, 7, 23, 8, 3774, 76178, 1055, 483, 30154, 310, 9332, 929, 486, 25307, 1072, 8204, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_is_range_covered() { let meta = vec![(b"b", b"d"), (b"d", b"e"), (b"e", b"f"), (b"f", b"h")]; let mut region_ranges = BTreeMap::new(); let mut region_peers = HashMap::new(); { for (i, (start, end)) in meta.into_iter().enumerate() { let mut region = metapb::Region::new(); let peer = metapb::Peer::new(); region.set_peers(RepeatedField::from_vec(vec![peer])); region.set_start_key(start.to_vec()); region.set_end_key(end.to_vec()); region_ranges.insert(enc_end_key(&region), i as u64); region_peers.insert(i as u64, region); } let check_range = |start: &[u8], end: &[u8]| { is_range_covered( &region_ranges, |id: u64| &region_peers[&id], data_key(start), data_end_key(end), ) }; assert!(!check_range(b"a", b"c")); assert!(check_range(b"b", b"d")); assert!(check_range(b"b", b"e")); assert!(check_range(b"e", b"f")); assert!(check_range(b"b", b"g")); assert!(check_range(b"e", b"h")); assert!(!check_range(b"e", b"n")); assert!(!check_range(b"g", b"n")); assert!(!check_range(b"o", b"z")); assert!(!check_range(b"", b"")); } let meta = vec![(b"b", b"d"), (b"e", b"f"), (b"f", b"h")]; region_ranges.clear(); region_peers.clear(); { for (i, (start, end)) in meta.into_iter().enumerate() { let mut region = metapb::Region::new(); let peer = metapb::Peer::new(); region.set_peers(RepeatedField::from_vec(vec![peer])); region.set_start_key(start.to_vec()); region.set_end_key(end.to_vec()); region_ranges.insert(enc_end_key(&region), i as u64); region_peers.insert(i as u64, region); } let check_range = |start: &[u8], end: &[u8]| { is_range_covered( &region_ranges, |id: u64| &region_peers[&id], data_key(start), data_end_key(end), ) }; assert!(!check_range(b"a", b"c")); assert!(check_range(b"b", b"d")); assert!(!check_range(b"b", b"e")); assert!(check_range(b"e", b"f")); assert!(!check_range(b"b", b"g")); assert!(check_range(b"e", b"g")); assert!(check_range(b"e", b"h")); assert!(!check_range(b"e", b"n")); assert!(!check_range(b"g", b"n")); assert!(!check_range(b"o", b"z")); assert!(!check_range(b"", b"")); } }
rust_cleaned_test_functions.jsonl/86484
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1754 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6892, 9698, 38087, 291, 368, 341, 286, 1077, 8823, 284, 7486, 0, 9697, 65, 1, 65, 497, 293, 44917, 3975, 320, 65, 44917, 497, 293, 1, 68, 3975, 320, 65, 1, 68, 497, 293, 96171, 3975, 320, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_long() { match Variant::VInteger(42).plus(Variant::VLong(2)).unwrap() { Variant::VLong(result) => assert_eq!(result, 44), _ => panic!("assertion failed"), } }
rust_cleaned_test_functions.jsonl/84547
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 151 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 17799, 368, 341, 394, 2432, 39292, 486, 53, 3486, 7, 19, 17, 568, 7138, 12410, 15341, 486, 53, 6583, 7, 17, 4579, 15454, 368, 341, 503, 39292, 486, 53, 6583, 4456, 8, 589, 2060, 10714, 10297, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
2
#[test] fn test_ensure_on_channel_followed_by_scheduled_scan() { let exec = fasync::TestExecutor::new().expect("failed to create an executor"); let mut m = MockObjects::new(&exec); let mut me = m.make_mlme(); me.make_client_station(); let mut client = me.get_bound_client().expect("client should be present"); client.send_open_auth_frame().expect("error delivering WLAN frame"); assert_eq!(m.fake_device.wlan_queue.len(), 1); me.on_sme_scan(scan_req()); assert_eq!(me.ctx.device.channel(), MAIN_CHANNEL); // Verify that triggering scheduled timeout by channel scheduler would switch channel let (_, timed_event) = m.time_stream.try_next().unwrap().expect("Should have scheduled a timed event"); me.handle_timed_event(timed_event.id, timed_event.event); assert_eq!(me.ctx.device.channel().primary, SCAN_CHANNEL_PRIMARY); }
rust_cleaned_test_functions.jsonl/32101
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 410 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 62, 27289, 4470, 14571, 43490, 291, 3710, 643, 26644, 28857, 368, 341, 286, 1077, 3883, 284, 282, 7692, 486, 2271, 25255, 486, 931, 1005, 17119, 445, 16091, 311, 1855, 458, 31558, 797, 286, 1077, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_hover_self_has_impl_action() { check_actions( r#"struct foo where Self$0:;"#, expect![[r#" [ Implementation( FilePosition { file_id: FileId( 0, ), offset: 7, }, ), ] "#]], ); }
rust_cleaned_test_functions.jsonl/66667
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 368 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 53445, 25637, 21778, 21007, 7931, 368, 341, 286, 1779, 25368, 1006, 310, 435, 55543, 1235, 15229, 1380, 10115, 3, 15, 62973, 2, 345, 310, 1720, 0, 15505, 81, 2, 698, 394, 2278, 503, 30813, 1006,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_character_renderer() -> SimpleResult<()> { let data = b"\x41\x10\x09".to_vec(); let offset = Offset::Dynamic(Context::new(&data)); let a = H2String::new(3, CharacterReader::ASCII, CharacterFormatter::pretty_str_character())?; assert_eq!("\"A\\x10\\t\"", a.to_display(offset)?); let a = H2String::new(3, CharacterReader::ASCII, CharacterFormatter::new_character( false, // show_single_quotes CharacterReplacementPolicy::ReplaceEverything, CharacterUnprintableOption::URLEncode, ))?; assert_eq!("\"%41%10%09\"", a.to_display(offset)?); Ok(()) }
rust_cleaned_test_functions.jsonl/102197
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 311 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 40988, 52345, 368, 1464, 8993, 2077, 71698, 341, 286, 1077, 821, 284, 293, 11934, 87, 19, 16, 3462, 16, 15, 3462, 15, 24, 3263, 983, 13251, 543, 286, 1077, 4347, 284, 16861, 486, 21752, 14001, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
5
#[test] fn test_server_continues_on_bad_data_udp() { named_test_harness("example.toml", |port, _, _| { let mut io_loop = Runtime::new().unwrap(); let addr: SocketAddr = SocketAddr::new(Ipv4Addr::new(127, 0, 0, 1).into(), port); let stream = UdpClientStream::<TokioUdpSocket>::new(addr); let (bg, mut client) = ClientFuture::connect(stream); io_loop.spawn(bg); query_a(&mut io_loop, &mut client); let raw_socket = UdpSocket::bind(SocketAddr::new(Ipv4Addr::new(0, 0, 0, 0).into(), 0)) .expect("couldn't bind raw"); raw_socket .send_to(b"0xDEADBEEF", addr) .expect("raw send failed"); // just tests that multiple queries work let addr: SocketAddr = SocketAddr::new(Ipv4Addr::new(127, 0, 0, 1).into(), port); let stream = UdpClientStream::<TokioUdpSocket>::new(addr); let (bg, mut client) = ClientFuture::connect(stream); io_loop.spawn(bg); query_a(&mut io_loop, &mut client); }) }
rust_cleaned_test_functions.jsonl/75217
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 493 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 12015, 68948, 1137, 4470, 34199, 1769, 69432, 368, 341, 262, 6941, 4452, 1523, 23518, 445, 8687, 73494, 75, 497, 760, 403, 11, 8358, 85137, 341, 286, 1077, 5206, 6399, 17198, 284, 10954, 486, 931,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_doc_comment() { assert_eq!(lex("/// \n"), (Token::DocComment, 4)); assert_eq!(lex("///hello\n"), (Token::DocComment, 8)); assert_eq!(lex("/// hello\n"), (Token::DocComment, 9)); }
rust_cleaned_test_functions.jsonl/80515
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 107 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 18869, 17638, 368, 341, 286, 2060, 10714, 10297, 2571, 445, 2575, 1124, 77, 3975, 320, 3323, 486, 9550, 10677, 11, 220, 19, 1106, 286, 2060, 10714, 10297, 2571, 445, 2575, 14990, 1699, 3975, 320, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_load_elf() { test_interpreter_and_jit_elf!( "tests/elfs/noop.so", [], ( b"log" => syscalls::BpfSyscallString::call; syscalls::BpfSyscallString {}, b"log_64" => syscalls::BpfSyscallU64::call; syscalls::BpfSyscallU64 {}, ), { |_vm, res: Result| { res.unwrap() == 0 } }, 11 ); }
rust_cleaned_test_functions.jsonl/59053
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 214 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 12411, 62, 490, 368, 341, 262, 1273, 15318, 28637, 8378, 5374, 275, 62, 490, 33673, 286, 330, 23841, 14, 490, 82, 33100, 453, 26476, 756, 286, 10239, 286, 2399, 310, 293, 47012, 1, 589, 5708, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_multidimensional_array() { let datums = vec![ Datum::Int32(1), Datum::Int32(2), Datum::Int32(3), Datum::Int32(4), Datum::Int32(5), Datum::Int32(6), Datum::Int32(7), Datum::Int32(8), ]; let mut row = Row::default(); row.push_array( &[ ArrayDimension { lower_bound: 1, length: 1, }, ArrayDimension { lower_bound: 1, length: 4, }, ArrayDimension { lower_bound: 1, length: 2, }, ], &datums, ) .unwrap(); let array = row.unpack_first().unwrap_array(); assert_eq!(array.elements().into_iter().collect::<Vec<_>>(), datums); }
rust_cleaned_test_functions.jsonl/56496
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 622 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 26290, 307, 28221, 3858, 368, 341, 286, 1077, 3258, 6237, 284, 7486, 90515, 310, 68459, 486, 1072, 18, 17, 7, 16, 1326, 310, 68459, 486, 1072, 18, 17, 7, 17, 1326, 310, 68459, 486, 1072, 18, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_empty_has_no_sigs() { let sig = Signature::default(); let blockhash = hash(Hash::default().as_ref()); let status_cache = BankStatusCache::default(); assert_eq!( status_cache.get_signature_status(&sig, &blockhash, &HashMap::new()), None ); assert_eq!( status_cache.get_signature_status_slow(&sig, &HashMap::new()), None ); }
rust_cleaned_test_functions.jsonl/82705
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 227 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 15124, 21778, 6536, 643, 14462, 368, 341, 286, 1077, 8366, 284, 32232, 486, 2258, 543, 286, 1077, 2504, 8296, 284, 5175, 7, 6370, 486, 2258, 1005, 300, 7793, 1423, 286, 1077, 2639, 11529, 284, 8...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_du_threshold() { let scene = TestScenario::new(util_name!()); let threshold = if cfg!(windows) { "7K" } else { "10K" }; scene .ucmd() .arg(format!("--threshold={}", threshold)) .succeeds() .stdout_contains("links") .stdout_does_not_contain("deeper_dir"); scene .ucmd() .arg(format!("--threshold=-{}", threshold)) .succeeds() .stdout_does_not_contain("links") .stdout_contains("deeper_dir"); }
rust_cleaned_test_functions.jsonl/23741
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 256 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 814, 84, 21858, 368, 341, 262, 1077, 6109, 284, 3393, 54031, 486, 931, 67811, 1269, 0, 5231, 262, 1077, 12171, 284, 421, 13286, 10297, 27077, 8, 314, 330, 22, 42, 1, 335, 770, 314, 330, 16, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_query_matches_with_multiple_on_same_root() { allocations::record(|| { let language = get_language("javascript"); let query = Query::new( language, "(class_declaration name: (identifier) @the-class-name (class_body (method_definition name: (property_identifier) @the-method-name)))", ) .unwrap(); assert_query_matches( language, &query, " class Person { // the constructor constructor(name) { this.name = name; } // the getter getFullName() { return this.name; } } ", &[ ( 0, vec![ ("the-class-name", "Person"), ("the-method-name", "constructor"), ], ), ( 0, vec![ ("the-class-name", "Person"), ("the-method-name", "getFullName"), ], ), ], ); }); }
rust_cleaned_test_functions.jsonl/25147
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 810 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 5738, 38344, 6615, 45233, 4470, 33574, 12993, 368, 341, 262, 69642, 486, 8548, 79453, 341, 286, 1077, 4128, 284, 633, 29021, 445, 14073, 797, 286, 1077, 3239, 284, 11361, 486, 931, 1006, 310, 4128...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_static_provider_custom_time_expiration() { let start_time = Utc::now(); let result = StaticProvider::new( "fake-key".to_owned(), "fake-secret".to_owned(), None, Some(10000), ) .credentials() .wait(); assert!(result.is_ok()); let finalized = result.unwrap(); let expires_at = finalized.expires_at().unwrap().clone(); assert!(start_time + Duration::minutes(100) < expires_at); assert!(expires_at < start_time + Duration::minutes(200)); }
rust_cleaned_test_functions.jsonl/83675
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 292 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 25360, 29518, 15875, 3009, 2702, 28479, 368, 341, 286, 1077, 1191, 3009, 284, 547, 10413, 486, 3328, 543, 286, 1077, 1102, 284, 23105, 5179, 486, 931, 1006, 310, 330, 30570, 16173, 3263, 983, 5197...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_part_b() { let xss = read_input(InputType::Sample); for xs in &xss { println!("{:?}", xs); } assert_eq!(1134, part_b(&xss)); }
rust_cleaned_test_functions.jsonl/13194
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 116 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 10495, 880, 368, 341, 286, 1077, 856, 778, 284, 1349, 5898, 29773, 929, 486, 17571, 317, 286, 369, 11943, 304, 609, 87, 778, 341, 310, 13751, 88928, 25, 52652, 11943, 317, 286, 555, 286, 2060, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
2
#[test] fn test_a_big_bitmap() { let mut bitmap: Bitmap = (1..1_000_000).collect(); let serialized_buffer = bitmap.serialize(); assert_eq!(serialized_buffer.len(), 131_208); assert!(bitmap.run_optimize()); let serialized_buffer = bitmap.serialize(); assert_eq!(serialized_buffer.len(), 230); }
rust_cleaned_test_functions.jsonl/103104
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 126 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 4306, 36386, 41527, 368, 341, 10217, 5206, 19746, 25, 17533, 284, 320, 16, 496, 16, 62, 15, 15, 15, 62, 15, 15, 15, 568, 17384, 543, 10217, 32916, 7776, 284, 19746, 33969, 1428, 11120, 6948, 1...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_next_sequence_send_fail() { let port_channel = (PortId::default(), ChannelId::new(0)); let context: Context<Test> = Context::new(); new_test_ext().execute_with(|| { let result = context.get_next_sequence_send(&port_channel.clone()).unwrap_err().to_string(); assert_eq!(result, ICS04Error::missing_next_send_seq(port_channel).to_string()); }) }
rust_cleaned_test_functions.jsonl/60073
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 139 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 11257, 23735, 13565, 22121, 368, 341, 10217, 2635, 14571, 284, 320, 7084, 764, 486, 2258, 1507, 13434, 764, 486, 931, 7, 15, 1106, 10217, 2266, 25, 9608, 71273, 29, 284, 9608, 486, 931, 1428, 86...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_remove_derive_attrs() { let tt = mbe::parse_to_token_tree( r#" #[allow(unused)] #[derive(Copy)] #[derive(Hello)] struct A { bar: u32 } "#, ) .unwrap() .0; let result = format!("{:#?}", remove_derive_attrs(&tt).unwrap()); assert_eq_text!( &result, r#" SUBTREE $ PUNCH # [alone] 0 SUBTREE [] 1 IDENT allow 2 SUBTREE () 3 IDENT unused 4 IDENT struct 15 IDENT A 16 SUBTREE {} 17 IDENT bar 18 PUNCH : [alone] 19 IDENT u32 20 "# .trim() ); }
rust_cleaned_test_functions.jsonl/90737
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 376 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 18193, 35345, 533, 39578, 368, 341, 286, 1077, 17853, 284, 296, 1371, 486, 6400, 2346, 6458, 11663, 1006, 310, 435, 2, 698, 262, 11506, 7183, 18364, 2591, 5563, 262, 11506, 27098, 3025, 1266, 5563...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_get_hash_chain() { let mut blockchain = Blockchain::new(); blockchain.set_check_trans(false); let genesis_hash = blockchain.tip(); let block1 = generate_random_block(&genesis_hash); let block2 = generate_random_block(&block1.hash); let block3 = generate_random_block(&block2.hash); blockchain.insert(&block1); blockchain.insert(&block2); blockchain.insert(&block3); let hashes = blockchain.hash_chain(); assert_eq!(genesis_hash, hashes[3]); assert_eq!(block1.hash, hashes[2]); assert_eq!(block2.hash, hashes[1]); assert_eq!(block3.hash, hashes[0]); }
rust_cleaned_test_functions.jsonl/61921
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 296 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 3062, 8950, 30583, 368, 341, 286, 1077, 5206, 17944, 284, 42885, 486, 931, 543, 286, 17944, 980, 7200, 7965, 3576, 317, 286, 1077, 59366, 8950, 284, 17944, 78044, 543, 286, 1077, 2504, 16, 284, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_introduce_var_return() { check_assist_range( introduce_variable, " fn foo() -> u32 { <|>return 2 + 2<|>; } ", " fn foo() -> u32 { let <|>var_name = 2 + 2; return var_name; } ", ); }
rust_cleaned_test_functions.jsonl/5718
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 157 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 4042, 47845, 4612, 12511, 368, 341, 286, 1779, 12083, 380, 9698, 1006, 310, 19131, 14635, 345, 310, 6228, 8822, 15229, 368, 1464, 575, 18, 17, 341, 262, 82639, 29, 689, 220, 17, 488, 220, 17, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1