text
stringlengths
93
16.4k
id
stringlengths
20
40
metadata
dict
input_ids
listlengths
45
2.05k
attention_mask
listlengths
45
2.05k
complexity
int64
1
9
#[test] fn test_g1_compression_decompression() { let even = G1Affine::new( Fq::from_repr(BigInteger768([ 0xf99bff3c256c04f0, 0x3d6b06f9ad2e719d, 0x23caf1a099fbff57, 0x59b1d95d29ee4cab, 0x5c68c6de94f80482, 0x2f12567b30d1126b, ...
rust_cleaned_test_functions.jsonl/52493
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1502 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 1889, 16, 2965, 4011, 2259, 83192, 368, 1476, 262, 1077, 1496, 284, 479, 16, 25841, 482, 486, 931, 1006, 286, 434, 80, 486, 1499, 68535, 91756, 22, 21, 23, 8956, 310, 220, 15, 5848, 24, 24, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_read() { let fields: Vec<Field> = json5::from_str(r#" [ {"field": "AC", "alias": "gnomad_AC"}, { field: "AN", alias: "gnomad_AN", missing_value: -2147483648, multiplier: 1, // this is useful for float fields as...
rust_cleaned_test_functions.jsonl/103891
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 465 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6443, 368, 341, 286, 1077, 5043, 25, 11312, 82473, 29, 284, 2951, 20, 486, 1499, 2895, 2601, 2, 698, 286, 2278, 260, 5212, 2566, 788, 330, 1706, 497, 330, 14956, 788, 330, 4905, 316, 329, 1550...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_build_jfif_header() { let mut buf = vec![]; let density = PixelDensity::dpi(100); build_jfif_header(&mut buf, density); assert_eq!(buf, [0x4A, 0x46, 0x49, 0x46, 0x00, 0x01, 0x02, 0x01, 0, 100, 0, 100, 0, 0]); }
rust_cleaned_test_functions.jsonl/41973
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 144 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 20801, 5374, 69, 333, 8757, 368, 341, 286, 1077, 5206, 6607, 284, 7486, 0, 15078, 286, 1077, 17457, 284, 27469, 66719, 486, 78029, 7, 16, 15, 15, 317, 286, 1936, 5374, 69, 333, 8757, 2099, 698...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_watermark_event_orderings() { let watermark_event_a: OperatorEvent = OperatorEvent::new(Timestamp::new(vec![1]), true, || ()); let watermark_event_b: OperatorEvent = OperatorEvent::new(Timestamp::new(vec![2]), true, || ()); assert_eq!( ...
rust_cleaned_test_functions.jsonl/57892
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 385 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 54550, 3987, 6748, 7869, 819, 368, 341, 286, 1077, 88006, 6748, 4306, 25, 28498, 1556, 4035, 310, 28498, 1556, 486, 931, 4140, 4702, 486, 931, 25592, 20703, 16, 9719, 830, 11, 1369, 49323, 286, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_keys() { check_unwrap(super::gc_delay()); check_unwrap(super::persistent_keyring_expiry()); check_unwrap(super::maxbytes()); check_unwrap(super::maxkeys()); check_unwrap(super::root_maxbytes()); check_unwrap(super::root_maxkeys()); }
rust_cleaned_test_functions.jsonl/93780
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 142 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 12631, 368, 341, 286, 1779, 4907, 10097, 56040, 486, 20669, 22198, 1423, 286, 1779, 4907, 10097, 56040, 486, 69389, 3097, 12640, 96509, 1423, 286, 1779, 4907, 10097, 56040, 486, 2810, 9651, 1423, 28...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_old_value_1pc() { let mut suite = TestSuite::new(1); let mut req = suite.new_changedata_request(1); req.set_extra_op(ExtraOp::ReadOldValue); let (mut req_tx, _, receive_event) = new_event_feed(suite.get_region_cdc_client(1)); let _req_tx = block_on(req_tx.send((req, WriteFlag...
rust_cleaned_test_functions.jsonl/13012
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1058 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21108, 3142, 62, 16, 3992, 368, 341, 262, 1077, 5206, 16182, 284, 3393, 28000, 486, 931, 7, 16, 317, 262, 1077, 5206, 4232, 284, 16182, 4618, 25213, 459, 7893, 7, 16, 317, 262, 4232, 980, 3185...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_box_deref() { let s: Box<str> = "Hello world!".into(); let _s: &[&dyn ToSql] = crate::params![s]; let r = s.to_sql(); assert!(r.is_ok()); }
rust_cleaned_test_functions.jsonl/124016
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 111 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 10194, 814, 43970, 368, 341, 286, 1077, 274, 25, 8261, 27, 495, 29, 284, 330, 9707, 1879, 92993, 18122, 543, 286, 1077, 716, 82, 25, 44590, 5, 43085, 2014, 8269, 60, 284, 17717, 486, 3519, 207...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_touch_default() { let (at, mut ucmd) = at_and_ucmd!(); let file = "test_touch_default_file"; ucmd.arg(file).succeeds().no_stderr(); assert!(at.file_exists(file)); }
rust_cleaned_test_functions.jsonl/41015
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 96 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 60840, 9993, 368, 341, 262, 1077, 320, 266, 11, 5206, 575, 8710, 8, 284, 518, 8378, 68887, 2277, 0, 543, 262, 1077, 1034, 284, 330, 1944, 60840, 9993, 2458, 3302, 262, 575, 8710, 21186, 4866, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_token_filter() { let table_create = TableCreateCommand::new("Test".to_string()) .token_filter(TokenFiltersType::StopWord); let mut arg: HashMap<String, String> = HashMap::new(); arg.insert("token_filter".to_string(), "TokenFilterStopWord".to...
rust_cleaned_test_functions.jsonl/74224
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 245 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6458, 8727, 368, 341, 286, 1077, 1965, 8657, 284, 6633, 4021, 4062, 486, 931, 445, 2271, 3263, 983, 3904, 2398, 310, 659, 5839, 8727, 38584, 28351, 929, 486, 10674, 10879, 317, 286, 1077, 5206, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_leaf_not_in_tree() { let tests = [(2u32, 2u32), (7, 7)]; for test in tests.iter() { assert_eq!( leaf_in_tree(test.0.into(), test.1.into()), Err(TreeMathError::LeafNotInTree) ); } }
rust_cleaned_test_functions.jsonl/98699
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 141 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 38909, 7913, 1243, 11663, 368, 341, 262, 1077, 7032, 284, 17826, 17, 84, 18, 17, 11, 220, 17, 84, 18, 17, 701, 320, 22, 11, 220, 22, 12587, 262, 369, 1273, 304, 7032, 19471, 368, 341, 286, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_record_private_member_functions_not_present() { let ir = ir_from_cc( " struct SomeStruct { public: int public_method(); protected: int protected_method(); private: int private_method(); }; ", ) ...
rust_cleaned_test_functions.jsonl/37162
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 272 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 14192, 26249, 19388, 31708, 7913, 36976, 368, 341, 262, 1077, 6216, 284, 6216, 5673, 28955, 1006, 286, 6228, 286, 2036, 4329, 9422, 341, 688, 584, 510, 310, 526, 584, 9032, 543, 688, 2617, 510, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_deserialize_enums() { match deserialize_update( "updateAuthorizationState", serde_json::from_str::<serde_json::Value>(r#"{"@type":"updateAuthorizationState","authorization_state":{"@type":"authorizationStateWaitTdlibParameters"}}"#).unwrap(), ) { Ok(v) => ...
rust_cleaned_test_functions.jsonl/17872
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 824 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 15768, 9050, 6205, 6237, 368, 341, 286, 2432, 35240, 8882, 1006, 310, 330, 2386, 18124, 1397, 497, 61570, 9455, 486, 1499, 2895, 27638, 47024, 9455, 486, 1130, 2235, 81, 55543, 4913, 31, 1313, 325...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
7
#[test] fn test_variance() { use std::collections::btree_set::{IntoIter, Iter, Range}; fn set<'new>(v: BTreeSet<&'static str>) -> BTreeSet<&'new str> { v } fn iter<'a, 'new>(v: Iter<'a, &'static str>) -> Iter<'a, &'new str> { v } fn into_iter<'new>(v: IntoIter<&'static str>) -> IntoIter<&'new s...
rust_cleaned_test_functions.jsonl/4419
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 190 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 77450, 368, 341, 262, 990, 1460, 486, 51137, 486, 65, 9344, 2602, 22964, 26591, 8537, 11, 13704, 11, 16437, 2315, 262, 5168, 738, 18291, 931, 2235, 85, 25, 425, 6533, 1649, 52244, 6, 1978, 607, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_mode_test() -> Result<()> { let rt = TestRuntime::new()?; let output = rt.run(&["--test", "fixtures/tests.rs"])?; println!("{}", output.stderr); assert_eq!(output.status.code().unwrap(), 0); Ok(()) }
rust_cleaned_test_functions.jsonl/44416
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 110 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 7302, 4452, 368, 1464, 5714, 71698, 341, 262, 1077, 16677, 284, 3393, 15123, 486, 931, 94136, 262, 1077, 2550, 284, 16677, 7634, 2099, 1183, 313, 1944, 497, 330, 45247, 62468, 25638, 1341, 40007, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
3
#[test] fn test_check_account_for_fees() { let account_balance = 1; let account_balance_response = json!(Response { context: RpcResponseContext { slot: 1 }, value: json!(account_balance), }); let pubkey = Pubkey::new_rand(); let fee_calculator = Fe...
rust_cleaned_test_functions.jsonl/38825
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1104 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 7200, 13500, 5478, 761, 5516, 368, 341, 286, 1077, 2692, 29396, 284, 220, 16, 280, 286, 1077, 2692, 29396, 9655, 284, 2951, 10297, 2582, 341, 310, 2266, 25, 79961, 2582, 1972, 314, 9446, 25, 220...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_deep_lift_node() { let deepex = from_str("(({x}^2.0)*(({x}^1.0)*2.0))+((({x}^1.0)*2.0)*({x}^2.0))").unwrap(); println!("{}", deepex); assert_eq!( format!("{}", deepex), "(({x}^2.0)*(({x}^1.0)*2.0))+((({x}^1.0)*2.0)*({x}^2.0))" ); let deepex = from_str("(((a+x...
rust_cleaned_test_functions.jsonl/68850
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 488 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 87044, 87004, 5084, 368, 341, 262, 1077, 5538, 327, 284, 504, 2895, 445, 35582, 87, 92, 61, 17, 13, 15, 4806, 35582, 87, 92, 61, 16, 13, 15, 4806, 17, 13, 15, 38592, 1188, 2306, 87, 92, 61...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_errors_app() { use actix_web::{ error::{ErrorBadRequest, ResponseError}, HttpResponse, }; use std::fmt; #[api_v2_errors( 400, description = "Sorry, bad request", code = 401, code = 403, description = "Forbidden, go away", ...
rust_cleaned_test_functions.jsonl/18942
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 2625 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 20196, 8191, 368, 341, 262, 990, 1160, 941, 25960, 74843, 286, 1465, 22964, 1454, 46015, 11, 5949, 1454, 1583, 286, 17580, 345, 262, 2605, 262, 990, 1460, 486, 12501, 401, 262, 11506, 2068, 2273, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_user_delete() { let pool = BDPool::new().unwrap(); let con = pool.get().unwrap(); let new_user = NewUser::new( "user_test_user_delete@email.com", "user_test_user_delete", "some_password", ); let user = new_user.create(&con).unwrap(); let result ...
rust_cleaned_test_functions.jsonl/32736
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 213 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 3317, 11353, 368, 341, 262, 1077, 7314, 284, 425, 10298, 1749, 486, 931, 1005, 15454, 543, 262, 1077, 390, 284, 7314, 670, 1005, 15454, 1428, 262, 1077, 501, 3317, 284, 1532, 1474, 486, 931, 100...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_poa_setup_update() { // deploy contract let mut context = Context::default(); let poa_bin: Bytes = Loader::default().load_binary("poa.strip"); let poa_out_point = context.deploy_cell(poa_bin); let always_success_out_point = context.deploy_cell(ALWAYS_SUCCESS.clone()); //...
rust_cleaned_test_functions.jsonl/22883
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 2700 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 620, 19533, 21363, 8882, 368, 341, 262, 442, 10517, 5116, 198, 262, 1077, 5206, 2266, 284, 9608, 486, 2258, 543, 262, 1077, 3193, 64, 21816, 25, 30024, 284, 27811, 486, 2258, 1005, 1078, 31761, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_keyword_function() { let hdr = indoc! {" inline void move(int a) {}; "}; let rs = quote! {}; run_test("", hdr, rs, &["move_"], &[]); }
rust_cleaned_test_functions.jsonl/9905
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 90 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 45824, 9174, 368, 341, 262, 1077, 36615, 284, 1257, 509, 0, 314, 698, 286, 7381, 737, 3271, 1548, 264, 8, 9321, 262, 330, 2440, 262, 1077, 10036, 284, 12641, 0, 9321, 262, 1598, 4452, 19814, 3...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_rangeproof() { let proof = Confidential::strict_decode(&CONFIDENTIAL_AMOUNT[..]) .unwrap() .bulletproof; let mut buff = vec![]; proof.strict_encode(&mut buff).unwrap(); let mut pad = vec![0u8; 4465]; buff.append(&mut pad); ...
rust_cleaned_test_functions.jsonl/25388
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 235 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 1710, 55851, 75636, 368, 341, 286, 1077, 11064, 284, 73365, 486, 6627, 15227, 2099, 38634, 19811, 6208, 59993, 95874, 2546, 310, 659, 15454, 741, 310, 659, 39460, 15780, 401, 286, 1077, 5206, 11522,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_should_retransmit_and_persist() { let me_id = solana_sdk::pubkey::new_rand(); let leader_keypair = Arc::new(Keypair::new()); let leader_pubkey = leader_keypair.pubkey(); let bank = Arc::new(Bank::new_for_tests( &create_genesis_config_with_leader(100, &...
rust_cleaned_test_functions.jsonl/92157
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1934 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 43378, 1288, 1458, 1763, 8378, 620, 4975, 368, 341, 286, 1077, 752, 842, 284, 2048, 3362, 61783, 486, 9585, 792, 486, 931, 33864, 543, 286, 1077, 7653, 3097, 12670, 284, 19689, 486, 931, 7, 6608...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_buffered_reader_seek_underflow() { // gimmick reader that yields its position modulo 256 for each byte struct PositionReader { pos: u64 } impl Read for PositionReader { fn read(&mut self, buf: &mut [u8]) -> io::Result<usize> { ...
rust_cleaned_test_functions.jsonl/12405
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1019 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 7776, 291, 22306, 74473, 58228, 4965, 368, 341, 286, 442, 74773, 865, 6604, 429, 35408, 1181, 2309, 59864, 220, 17, 20, 21, 369, 1817, 4922, 198, 286, 2036, 12380, 5062, 341, 310, 1133, 25, 575,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_decode_dmb() { // f3bf 8f5f dmb sy assert_eq!(decode_32(0xf3bf8f5f), Instruction::DMB); }
rust_cleaned_test_functions.jsonl/64881
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 73 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 15227, 814, 3096, 368, 341, 262, 442, 220, 282, 18, 13233, 220, 23, 69, 20, 69, 981, 294, 3096, 6568, 198, 262, 2060, 10714, 10297, 18196, 62, 18, 17, 7, 15, 5848, 18, 13233, 23, 69, 20, 6...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_choose_private_exponent() { let c = 70429; let mut rng = rand::thread_rng(); for _ in 0..10 { let p = choose_private_exponent(c, &mut rng); assert!(is_coprime(p, c)); assert!(p > 1); assert!(p < c); } }
rust_cleaned_test_functions.jsonl/16185
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 179 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 77433, 26249, 2702, 1146, 368, 341, 286, 1077, 272, 284, 220, 22, 15, 19, 17, 24, 280, 286, 1077, 5206, 28422, 284, 10382, 486, 4528, 66849, 543, 286, 369, 716, 304, 220, 15, 496, 16, 15, 34...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_get_package_tracking_details() { dotenv().ok(); let c = get_test_client(); let res = GetPackageTrackingDetails(&c, "187748827").expect("GetPackageTrackingDetails"); println!("res = {:#?}", res); }
rust_cleaned_test_functions.jsonl/81401
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 94 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 3062, 26328, 66105, 13260, 368, 341, 262, 91286, 1005, 562, 543, 262, 1077, 272, 284, 633, 4452, 8179, 543, 262, 1077, 592, 284, 2126, 13100, 37119, 7799, 2099, 66, 11, 330, 16, 23, 22, 22, 19...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_print_bn256_poseidon_params_for_quartic_tree() { let params = Bn256PoseidonParams::new_for_quartic_tree::<BlakeHasher>(); println!("MSD"); for el in params.mds_matrix.iter() { println!("{}", el); } println!("Partial rounds constants"); ...
rust_cleaned_test_functions.jsonl/52982
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 270 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 10064, 58112, 17, 20, 21, 33201, 90456, 6745, 5478, 11280, 80887, 11663, 368, 341, 286, 1077, 3628, 284, 425, 77, 17, 20, 21, 46315, 90456, 4870, 486, 931, 5478, 11280, 80887, 11663, 27638, 91038,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
4
#[test] fn test_size_properties() { let cases = [ ("a", 0), ("b", PROP_SIZE_INDEX_DISTANCE / 8), ("c", PROP_SIZE_INDEX_DISTANCE / 4), ("d", PROP_SIZE_INDEX_DISTANCE / 2), ("e", PROP_SIZE_INDEX_DISTANCE / 8), ...
rust_cleaned_test_functions.jsonl/22208
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1488 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2368, 25158, 368, 341, 286, 1077, 5048, 284, 2278, 310, 3489, 64, 497, 220, 15, 1326, 3374, 310, 3489, 65, 497, 41977, 4098, 14515, 63217, 608, 220, 23, 1326, 310, 3489, 66, 497, 41977, 4098, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
4
#[test] fn test_parse_params() { assert_eq!(parse_params("p1 p2 p3"), vec!["p1", "p2", "p3"]); let empty: Vec<&str> = vec![]; assert_eq!(parse_params(""), empty); assert_eq!(parse_params(":foo bar baz "), vec!["foo bar baz "]); assert_eq!( parse_params(":foo :...
rust_cleaned_test_functions.jsonl/24482
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 572 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21039, 6745, 368, 341, 286, 2060, 10714, 10297, 6400, 6745, 445, 79, 16, 281, 17, 281, 18, 3975, 7486, 0, 1183, 79, 16, 497, 330, 79, 17, 497, 330, 79, 18, 15049, 286, 1077, 4287, 25, 11312,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_range_backwards_3() { let map: BTreeMap<_, _> = (0..5).map(|i| (i, i)).collect(); map.range((Excluded(3), Included(2))); }
rust_cleaned_test_functions.jsonl/49388
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 75 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 9698, 3895, 4014, 62, 18, 368, 341, 262, 1077, 2415, 25, 425, 6533, 2227, 27, 6878, 716, 29, 284, 320, 15, 496, 20, 568, 2186, 22428, 72, 91, 320, 72, 11, 600, 4579, 17384, 543, 262, 2415, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_minimize2() { let res = minimize_rpaths(&[ "1a".to_string(), "2".to_string(), "2".to_string(), "1a".to_string(), "4a".to_string(), "1a".to_string(), "2".to_string(), "3".to_string(), ...
rust_cleaned_test_functions.jsonl/20103
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 333 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 7260, 11853, 17, 368, 341, 286, 1077, 592, 284, 29337, 1710, 21623, 2099, 9640, 310, 330, 16, 64, 3263, 983, 3904, 3148, 310, 330, 17, 3263, 983, 3904, 3148, 310, 330, 17, 3263, 983, 3904, 314...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_is_a_parent_of_root() { assert!(is_a_parent_of("/", "/usr/andy")); assert!(is_a_parent_of("/", "/usr")); assert!(!is_a_parent_of("/", "/")); }
rust_cleaned_test_functions.jsonl/32369
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 107 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6892, 4306, 15960, 3575, 12993, 368, 341, 286, 2060, 10297, 285, 4306, 15960, 3575, 35460, 3521, 7063, 14, 13331, 4010, 286, 2060, 10297, 285, 4306, 15960, 3575, 35460, 3521, 7063, 4010, 286, 2060, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_chains() { let random_hash = BlockHash::hash(b"rascafvsdg"); assert_eq!(Chain::Mainnet, Chain::from(CHAIN_PARAMS_MAINNET.clone())); assert_eq!(Chain::Testnet3, Chain::from(CHAIN_PARAMS_TESTNET.clone())); assert_eq!( Chain::Regtest(CHAIN_PARAMS_REGTEST...
rust_cleaned_test_functions.jsonl/115623
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1324 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 4138, 1735, 368, 341, 286, 1077, 4194, 8950, 284, 8362, 6370, 486, 8296, 1883, 1, 12784, 68796, 11562, 35138, 3071, 286, 2060, 10714, 10297, 18837, 486, 6202, 4711, 11, 28525, 486, 1499, 82934, 68...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_cmac_type_url() { tink_mac::init(); let km = tink_core::registry::get_key_manager(tink_tests::AES_CMAC_TYPE_URL) .expect("AES CMAC key manager not found"); assert_eq!( km.type_url(), tink_tests::AES_CMAC_TYPE_URL, "incorrect key_type()" ); asse...
rust_cleaned_test_functions.jsonl/37678
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 227 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 666, 11948, 1819, 2903, 368, 341, 262, 90584, 22802, 486, 2327, 543, 262, 1077, 13136, 284, 90584, 15467, 486, 29172, 486, 455, 3097, 12144, 1155, 766, 32509, 486, 69168, 920, 25788, 4189, 8000, 3...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_add() { let exporter = opentelemetry_prometheus::exporter() .with_default_histogram_boundaries(vec![-0.5, 1.0]) .with_resource(Resource::new(vec![KeyValue::new("R", "V")])) .init(); let meter = exporter.provider().unwrap().meter("test", None); let up_down_co...
rust_cleaned_test_functions.jsonl/36940
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 793 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2891, 368, 341, 262, 1077, 57378, 284, 1179, 6817, 35958, 47877, 39705, 486, 1533, 261, 741, 286, 659, 4197, 9993, 68564, 19447, 5431, 25592, 0, 7609, 15, 13, 20, 11, 220, 16, 13, 15, 2546, 28...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_overall() { const TMPDIR_POSTFIX: &str = "wslcmd-overall"; // init tmpdir let tmpdir = init_tmpdir(TMPDIR_POSTFIX).expect("Tmp dir initialize"); let (bin1, cmd1) = copy_tmpbin(&tmpdir, None).expect("Bin initialize"); let (bin2, cmd2) = copy_tm...
rust_cleaned_test_functions.jsonl/34193
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1038 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 15431, 541, 368, 341, 286, 733, 66253, 12251, 20506, 39690, 25, 609, 495, 284, 330, 86, 3226, 8710, 28252, 541, 3302, 286, 442, 2930, 4174, 3741, 198, 286, 1077, 4174, 3741, 284, 2930, 16125, 37...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_optional_type() { let spec = "input in: Int8\noutput out: Int8? := in.offset(by: -1)"; assert_eq!(0, num_type_errors(spec)); }
rust_cleaned_test_functions.jsonl/110688
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 83 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 74644, 1819, 368, 341, 286, 1077, 1398, 284, 330, 1355, 304, 25, 1333, 23, 1699, 3006, 700, 25, 1333, 23, 30, 1669, 304, 14760, 32028, 25, 481, 16, 24023, 286, 2060, 10714, 10297, 15, 11, 1629...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_init_logger_from_api() { // Error case: update after instance is running let log_file = NamedTempFile::new().unwrap(); let metrics_file = NamedTempFile::new().unwrap(); let desc = LoggerConfig { log_fifo: log_file.path().to_str().unwrap().to_string(), ...
rust_cleaned_test_functions.jsonl/93120
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 2016 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6137, 27413, 5673, 11697, 368, 341, 286, 442, 4600, 1142, 25, 2647, 1283, 2867, 374, 4303, 198, 286, 1077, 1487, 2458, 284, 40459, 12151, 1703, 486, 931, 1005, 15454, 543, 286, 1077, 16734, 2458, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
5
#[test] fn test_tuple_correct() { let c: Result<Color, String> = (183, 65, 14).try_into(); assert_eq!( c, Ok(Color { red: 183, green: 65, blue: 14 }) ); }
rust_cleaned_test_functions.jsonl/11973
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 178 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21773, 31550, 368, 341, 286, 1077, 272, 25, 5714, 88827, 11, 923, 29, 284, 320, 16, 23, 18, 11, 220, 21, 20, 11, 220, 16, 19, 568, 1539, 45514, 543, 286, 2060, 10714, 33673, 310, 272, 345, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_stdrng_construction() { let seed = [1,0,0,0, 23,0,0,0, 200,1,0,0, 210,30,0,0, 0,0,0,0, 0,0,0,0, 0,0,0,0, 0,0,0,0]; let mut rng1 = StdRng::from_seed(seed); assert_eq!(rng1.next_u64(), 15759097995037006553); let mut rng2 = StdRng::from_rng(rng1)...
rust_cleaned_test_functions.jsonl/95429
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 240 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 1261, 3612, 968, 3382, 3024, 368, 341, 286, 1077, 10320, 284, 508, 16, 11, 15, 11, 15, 11, 15, 11, 220, 17, 18, 11, 15, 11, 15, 11, 15, 11, 220, 17, 15, 15, 11, 16, 11, 15, 11, 15, 1...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_operators() { assert_eq!( format!("{:?}", lit(1u32) + lit(2u32)), "UInt32(1) Plus UInt32(2)" ); assert_eq!( format!("{:?}", lit(1u32) - lit(2u32)), "UInt32(1) Minus UInt32(2)" ); assert_eq!( forma...
rust_cleaned_test_functions.jsonl/64118
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 350 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 25634, 2973, 368, 341, 286, 2060, 10714, 33673, 310, 3561, 88928, 25, 52652, 13020, 7, 16, 84, 18, 17, 8, 488, 13020, 7, 17, 84, 18, 17, 6965, 310, 330, 18777, 18, 17, 7, 16, 8, 12343, 222...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_selector_pseudo_only_child() -> Result { let html = r#" <!doctype html> <html lang="en"> <head> <meta charset="utf-8"> <title>:only-child</title> </head> <body> <ul class="list1"> <li>list1-item1</li> </ul> <ul class="list2"> ...
rust_cleaned_test_functions.jsonl/58021
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 391 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 28890, 620, 21952, 18410, 17268, 368, 1464, 5714, 341, 10217, 5272, 284, 435, 2, 698, 262, 71341, 50139, 5272, 397, 262, 366, 1551, 8688, 428, 268, 881, 414, 366, 1983, 397, 286, 366, 5490, 1161...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_derive_sha256() { let tests = tests_sha256(); for t in tests.iter() { let ikm = hex::decode(&t.ikm).unwrap(); let salt = hex::decode(&t.salt).unwrap(); let info = hex::decode(&t.info).unwrap(); let hkdf = Hkdf::<Sha256>::extract(Option::from(&salt[..]), &i...
rust_cleaned_test_functions.jsonl/127012
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 277 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 35345, 533, 48836, 17, 20, 21, 368, 341, 262, 1077, 7032, 284, 7032, 48836, 17, 20, 21, 543, 262, 369, 259, 304, 7032, 19471, 368, 341, 286, 1077, 13361, 76, 284, 12371, 486, 18196, 2099, 83, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_invite_max_uses() { assert!(invite_max_uses(0)); assert!(invite_max_uses(100)); assert!(!invite_max_uses(101)); }
rust_cleaned_test_functions.jsonl/29958
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 88 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 94910, 6345, 62, 4776, 368, 341, 286, 2060, 10297, 56279, 6345, 62, 4776, 7, 15, 1106, 286, 2060, 10297, 56279, 6345, 62, 4776, 7, 16, 15, 15, 1106, 286, 2060, 0, 3471, 56279, 6345, 62, 4776, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_igmp_integration_igmpv1_router_present() { let mut ctx = setup_simple_test_environment(); ctx.igmp_join_group(DummyLinkDeviceId, GROUP_ADDR); assert_eq!(ctx.timers().len(), 1); let instant1 = ctx.timers()[0].0.clone(); receive_igmp_query(&mut ctx, Durati...
rust_cleaned_test_functions.jsonl/128910
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 918 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 62, 343, 1307, 90250, 62, 343, 1307, 85, 16, 55587, 36976, 368, 341, 286, 1077, 5206, 5635, 284, 6505, 30015, 4452, 51774, 1428, 286, 5635, 13, 343, 1307, 31017, 6288, 5432, 8574, 3939, 6985, 76...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_delete_with_sort_by_field_last_opstamp_is_not_max() -> crate::Result<()> { let mut schema_builder = schema::Schema::builder(); let sort_by_field = schema_builder.add_u64_field("sort_by", FAST); let id_field = schema_builder.add_u64_field("id", INDEXED); let schema...
rust_cleaned_test_functions.jsonl/21512
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 712 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 11353, 6615, 18435, 3710, 5013, 12195, 10287, 49113, 6892, 7913, 6345, 368, 1464, 17717, 486, 2077, 71698, 341, 286, 1077, 5206, 10802, 28532, 284, 10802, 486, 8632, 486, 17850, 543, 286, 1077, 3378...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
7
#[test] fn test_update_mcast_port() -> Result<(), Box<dyn std::error::Error>> { let conf = corosync_conf_fixture(); let conf = std::str::from_utf8(&conf)? .trim() .lines() .map(|x| x.to_string()); let conf = Vec::from_iter(update_mcast_port(conf, 400...
rust_cleaned_test_functions.jsonl/23874
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 204 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 8882, 717, 3829, 8716, 368, 1464, 5714, 68843, 8261, 92846, 1460, 486, 841, 486, 1454, 2452, 341, 286, 1077, 2335, 284, 1829, 436, 1721, 16059, 74409, 1428, 286, 1077, 2335, 284, 1460, 486, 495, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_empty_password() { let value = HeaderValue::from_static("Basic QWxhZGRpbjo="); let scheme = Basic::parse(&value); assert!(scheme.is_ok()); let scheme = scheme.unwrap(); assert_eq!(scheme.user_id, "Aladdin"); assert_eq!(scheme.password, None); ...
rust_cleaned_test_functions.jsonl/27909
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 148 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 15124, 10122, 368, 341, 286, 1077, 897, 284, 12104, 1130, 486, 1499, 25360, 445, 15944, 1207, 54, 87, 71, 57, 8626, 16650, 7305, 45219, 286, 1077, 12859, 284, 14625, 486, 6400, 2099, 957, 626, 2...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_write_bool() { assert_eq!(Boolean(true).to_str(), "true".to_owned()); assert_eq!(Boolean(true).to_pretty_str(), "true".to_owned()); assert_eq!(Boolean(false).to_str(), "false".to_owned()); assert_eq!(Boolean(false).to_pretty_str(), "false".to_owned()); }
rust_cleaned_test_functions.jsonl/111063
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 144 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 9165, 22159, 368, 341, 286, 2060, 10714, 10297, 6890, 3715, 568, 983, 2895, 1507, 330, 1866, 3263, 983, 51973, 1423, 286, 2060, 10714, 10297, 6890, 3715, 568, 983, 620, 21322, 2895, 1507, 330, 186...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_self_output_code() -> Result<(), Box<dyn Error>> { TestSample { source: StringTestValue::FromFile("samples/quine.bf"), expected_result: None, expected_output: Some(BinaryTestValue::FromFile("samples/quine.bf")), input_data: None, }.run() }
rust_cleaned_test_functions.jsonl/20217
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 132 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 25637, 7645, 4136, 368, 1464, 5714, 68843, 8261, 92846, 4600, 2452, 341, 262, 3393, 17571, 341, 286, 2530, 25, 923, 2271, 1130, 486, 43633, 445, 41118, 14, 47258, 948, 69, 4461, 286, 3601, 5287, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_indexing() { let mut seg = Seg::new(10, || 0); seg.set(5, 10); assert_eq!(seg[5], 10); }
rust_cleaned_test_functions.jsonl/38812
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 102 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 3560, 287, 368, 972, 310, 1077, 5206, 4810, 284, 17209, 486, 931, 7, 16, 15, 11, 1369, 220, 15, 736, 310, 4810, 980, 7, 20, 11, 220, 16, 15, 736, 310, 2060, 10714, 10297, 14607, 58, 20, 11...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
2
#[test] fn test_skip_with_freq() { let buf = { let mut skip_serializer = SkipSerializer::new(); skip_serializer.write_doc(1u32, 2u8); skip_serializer.write_term_freq(3u8); skip_serializer.write_doc(5u32, 5u8); skip_serializer.write_term_freq(2u...
rust_cleaned_test_functions.jsonl/107044
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 454 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 44830, 6615, 21790, 368, 341, 286, 1077, 6607, 284, 341, 310, 1077, 5206, 10706, 67441, 284, 25784, 13909, 486, 931, 543, 310, 10706, 67441, 3836, 18869, 7, 16, 84, 18, 17, 11, 220, 17, 84, 23...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_log() { let c = Complex::new(2.0, -1.0); let r = c.log(10.0); assert!(close_to_tol(r, Complex::new(0.349485, -0.20135958), 1e-5)); }
rust_cleaned_test_functions.jsonl/105683
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 122 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 5224, 368, 341, 310, 1077, 272, 284, 22096, 486, 931, 7, 17, 13, 15, 11, 481, 16, 13, 15, 317, 310, 1077, 435, 284, 272, 1665, 7, 16, 15, 13, 15, 317, 310, 2060, 10297, 5552, 2346, 70121, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_proxied_request_from_stream() { let test_data = b"GET /testpath HTTP/1.1\r\nHost: localhost\r\nX-Forwarded-For: 9.10.11.12,13.14.15.16\r\n\r\n"; let mut stream = MockStream::with_data(VecDeque::from_iter(test_data.iter().cloned())); let request = Request::from_stream(&mut str...
rust_cleaned_test_functions.jsonl/77696
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 486 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2540, 87, 1122, 7893, 5673, 12673, 368, 341, 262, 1077, 1273, 1769, 4035, 286, 293, 1, 3806, 608, 1944, 2343, 10130, 14, 16, 13, 16, 12016, 1699, 9296, 25, 47422, 12016, 1699, 55, 12, 25925, 2...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_proxy_auth_response() { // Ready let auth: ProxyAuthResponse = serde_json::from_value(json!({ "ready": true, "conn_info": DatabaseInfo::default(), })) .unwrap(); assert!(matches!( auth, ProxyAuthResponse::Rea...
rust_cleaned_test_functions.jsonl/80995
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 446 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 29712, 14014, 9655, 368, 341, 286, 442, 30982, 198, 286, 1077, 4166, 25, 32778, 5087, 2582, 284, 61570, 9455, 486, 1499, 3142, 9304, 0, 2262, 310, 330, 2307, 788, 830, 345, 310, 330, 5148, 3109,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_merge_measurement_names() { let schema1 = SchemaBuilder::new().tag("the_tag").build().unwrap(); // has some of the same and some different fields let schema2 = SchemaBuilder::new() .measurement("my_measurement") .build() .unwrap(); ...
rust_cleaned_test_functions.jsonl/44077
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 367 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 20888, 87342, 9187, 368, 341, 286, 1077, 10802, 16, 284, 12539, 3297, 486, 931, 1005, 4578, 445, 1782, 9372, 1827, 5834, 1005, 15454, 1428, 286, 442, 702, 1045, 315, 279, 1852, 323, 1045, 2155, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_startup_sync_state() { let (mut env, mut client_proxy) = setup_swarm_and_client_proxy(4, 0); client_proxy.create_next_account(false).unwrap(); client_proxy.create_next_account(false).unwrap(); client_proxy.mint_coins(&["mb", "0", "100"], true).unwrap(); client_proxy ....
rust_cleaned_test_functions.jsonl/125050
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1225 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 80858, 23008, 4387, 368, 341, 262, 1077, 320, 6984, 6105, 11, 5206, 2943, 29712, 8, 284, 6505, 32581, 2178, 8378, 8179, 29712, 7, 19, 11, 220, 15, 317, 262, 2943, 29712, 2520, 11257, 13500, 3576...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
4
#[test] fn test_try_from_record_for_program_with_no_id( ) -> Result<(), record::value::TryFromIteratorError> { let record = Record::new( record::Kind::Program, record::Value::try_from_iter(vec![("PN", "noodles")])?, ); assert_eq!( Program::try_fro...
rust_cleaned_test_functions.jsonl/16113
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 211 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 53283, 5673, 14192, 5478, 25096, 6615, 6536, 842, 1006, 262, 873, 1464, 5714, 68843, 3255, 486, 957, 486, 21453, 3830, 11951, 1454, 29, 341, 286, 1077, 3255, 284, 13583, 486, 931, 1006, 310, 3255,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_parse_bg_color() { let colored = Colored::BackgroundColor(Color::Red); assert_eq!(Into::<u16>::into(colored), BG_INTENSITY | BG_RED); }
rust_cleaned_test_functions.jsonl/61031
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 82 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21039, 23122, 6714, 368, 341, 286, 1077, 27197, 284, 4254, 3018, 486, 29546, 15028, 486, 6033, 317, 286, 2060, 10714, 10297, 26591, 27638, 84, 16, 21, 6831, 18122, 19611, 3018, 701, 43011, 9161, 8...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_extract_config_data_ignores_services_defined_on_non_config_data_package() { // Create a single package that is NOT the config data package let mock_reader: Box<dyn PackageReader> = Box::new(MockPackageReader::new()); let mut contents = HashMap::new(); contents.in...
rust_cleaned_test_functions.jsonl/19454
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 337 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 39123, 5332, 1769, 62, 622, 4589, 39846, 52870, 4470, 21637, 5332, 1769, 26328, 368, 341, 286, 442, 4230, 264, 3175, 6328, 429, 374, 4183, 279, 2193, 821, 6328, 198, 286, 1077, 7860, 22306, 25, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_fs_inverse() { assert!(Fs::zero().inverse().is_none()); let mut rng = XorShiftRng::from_seed([0x5dbe6259, 0x8d313d76, 0x3237db17, 0xe5bc0654]); let one = Fs::one(); for _ in 0..1000 { // Ensure that a * a^-1 = 1 let mut a = Fs::rand(&mut rng); let ainv ...
rust_cleaned_test_functions.jsonl/95515
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 213 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 34470, 63333, 368, 341, 262, 2060, 10297, 48300, 486, 14154, 1005, 61482, 1005, 285, 31488, 5231, 262, 1077, 5206, 28422, 284, 1599, 269, 24841, 49, 968, 486, 1499, 33809, 2561, 15, 87, 20, 83406,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_mul() { // For the condition to hold both scales must be uniform let mut first = Transform::default(); first.set_translation_xyz(20., 10., -3.); first.set_scale(Vector3::new(2.0, 2.0, 2.0)); first.set_rotation( UnitQuaternion::rotation_between(...
rust_cleaned_test_functions.jsonl/41637
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 664 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 24944, 368, 341, 286, 442, 1752, 279, 2971, 311, 3331, 2176, 28405, 1969, 387, 13794, 198, 286, 1077, 5206, 1156, 284, 15226, 486, 2258, 543, 286, 1156, 980, 49273, 64974, 7, 17, 15, 2572, 220, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_is_time_yesterday() { assert_eq!(is_time_yesterday("08:08:08", "09:09:09"), true); assert_eq!(is_time_yesterday("08:08:08", "07:59:59"), false); assert_eq!(is_time_yesterday("00:01:08", "23:09:09"), true); assert_eq!(is_time_yesterday("01:01:08", "01:01:00"), fals...
rust_cleaned_test_functions.jsonl/10678
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 167 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6892, 3009, 4178, 11282, 368, 341, 286, 2060, 10714, 10297, 285, 3009, 4178, 11282, 445, 15, 23, 25, 15, 23, 25, 15, 23, 497, 330, 15, 24, 25, 15, 24, 25, 15, 24, 3975, 830, 317, 286, 2060...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_off() { let f = || { fail_point!("off", |_| 2); 0 }; assert_eq!(f(), 0); fail::cfg("off", "off").unwrap(); assert_eq!(f(), 0); }
rust_cleaned_test_functions.jsonl/102078
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 104 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 13651, 368, 341, 262, 1077, 282, 284, 1369, 341, 286, 3690, 6085, 17223, 1847, 497, 66091, 220, 17, 317, 286, 220, 15, 198, 262, 2605, 262, 2060, 10714, 10297, 69, 1507, 220, 15, 626, 262, 369...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
2
#[test] fn test_op_addsub() { let lexer = Lexer::new("3 + 4 - 5"); let actual: Vec<TokType> = lexer.map(|t| t.0).collect(); let expected = vec![ TokType::IntConst(3), TokType::Add, TokType::IntConst(4), TokType::Sub, TokType::In...
rust_cleaned_test_functions.jsonl/24696
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 213 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 10287, 2891, 1966, 368, 341, 286, 1077, 53259, 284, 85082, 486, 931, 445, 18, 488, 220, 19, 481, 220, 20, 797, 286, 1077, 5042, 25, 11312, 3125, 562, 929, 29, 284, 53259, 4770, 22428, 83, 91, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_ignore_unknown() { assert_de_tokens( &DefaultStruct { a1: 1, a2: 2, a3: 3, a4: 0, a5: 123, }, &[ Token::Struct { name: "DefaultStruct", len: 5 }, Token::Str("whoops1"), ...
rust_cleaned_test_functions.jsonl/58609
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 638 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 58493, 57507, 368, 341, 1066, 262, 2060, 2259, 28838, 1006, 286, 609, 3675, 9422, 341, 1797, 264, 16, 25, 220, 16, 345, 1797, 264, 17, 25, 220, 17, 345, 1797, 264, 18, 25, 220, 18, 345, 1797...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_create_document_no_element() { let implementation = get_implementation(); let document_node = implementation.create_document(None, None, None).unwrap(); let document = as_document(&document_node).unwrap(); assert!(document.document_element().is_none()); }
rust_cleaned_test_functions.jsonl/101355
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 96 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 8657, 26231, 6536, 7894, 368, 341, 262, 1077, 8129, 284, 633, 62, 14369, 543, 262, 1077, 2197, 5084, 284, 8129, 2520, 26231, 26717, 11, 2240, 11, 2240, 568, 15454, 543, 262, 1077, 2197, 284, 438...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_simple_url_get_clone_url_https() { let url = "user/repo"; let mut this_repo = Repo::parse(url); match this_repo.url { RepoUrl::Short(ref mut short) => { short.is_https = true; } _ => { panic!("URL should ...
rust_cleaned_test_functions.jsonl/31161
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 248 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 30015, 2903, 3062, 54742, 2903, 26817, 368, 341, 286, 1077, 2515, 284, 330, 872, 10758, 5368, 876, 286, 1077, 5206, 419, 37784, 284, 71509, 486, 6400, 6522, 317, 286, 2432, 419, 37784, 7315, 341, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_example_packet_crc() { let mut data = [0u8; 128]; data[0] = 1; data[1] = 1; data[2] = 0xFF; data[3] = 0xFF; data[126] = 0xA5; data[127] = 0x88; let p = bluetherm::Packet { data: data }; assert!(p.is_checksum_valid()); }
rust_cleaned_test_functions.jsonl/124763
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 149 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 39304, 21078, 59084, 368, 341, 262, 1077, 5206, 821, 284, 508, 15, 84, 23, 26, 220, 16, 17, 23, 935, 262, 821, 58, 15, 60, 284, 220, 16, 280, 262, 821, 58, 16, 60, 284, 220, 16, 280, 262...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_skiplist_delete() { let mut list = SkipList::new(); list.insert(7, 7); list.insert(4, 4); list.insert(1, 1); list.insert(2, 2); list.insert(3, 3); list.insert(5, 5); list.insert(8, 8); list.insert(6, 6); assert_eq!(l...
rust_cleaned_test_functions.jsonl/65970
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 303 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 643, 6642, 39934, 11353, 368, 341, 286, 1077, 5206, 1140, 284, 25784, 852, 486, 931, 543, 286, 1140, 7030, 7, 22, 11, 220, 22, 317, 286, 1140, 7030, 7, 19, 11, 220, 19, 317, 286, 1140, 7030,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_normal_transform() { let t = Transform::rotate(36.0, Vector3f::new(4.0, 5.0, 6.0)); let v = Vector3f::x(); let n = Vector3f::y(); println!("v = {}, n = {}", v, n); assert_eq!(v.dot(&n), 0.0); let v2 = &t * &v; let n2 = t.transform_normal(...
rust_cleaned_test_functions.jsonl/78168
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 239 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 13973, 18449, 368, 341, 286, 1077, 259, 284, 15226, 486, 16213, 7, 18, 21, 13, 15, 11, 4196, 18, 69, 486, 931, 7, 19, 13, 15, 11, 220, 20, 13, 15, 11, 220, 21, 13, 15, 3237, 286, 1077, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_neg_literal() { assert_eq!( parse("Add RX1 -10").unwrap().body, vec![Node( Statement::Operator(Node( Operator::Add( Node(RegisterRef::User(1), span(1, 5, 1, 8)), Node( ...
rust_cleaned_test_functions.jsonl/118216
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 424 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 28209, 34100, 368, 341, 286, 2060, 10714, 33673, 310, 4715, 445, 2212, 28170, 16, 481, 16, 15, 1827, 15454, 1005, 2599, 345, 310, 7486, 20703, 1955, 1006, 394, 21756, 486, 18461, 22078, 1006, 503,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_move_forward() { let mut ship = Ship::new(); ship.move_forward(5); assert_eq!(ship.latitude, 0); assert_eq!(ship.longitude, 5); ship.turn_right(90); assert_eq!(ship.facing, 180); ship.move_forward(8); assert_eq!(ship.latitude, -8...
rust_cleaned_test_functions.jsonl/120429
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 188 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 17134, 32121, 368, 341, 286, 1077, 5206, 8284, 284, 26803, 486, 931, 1428, 286, 8284, 13635, 32121, 7, 20, 317, 286, 2060, 10714, 10297, 5270, 33632, 11, 220, 15, 317, 286, 2060, 10714, 10297, 5...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_encode_buffer_too_small() { let mut buf = []; let response = NonSupportedCommandParams { cr_bit: false, non_supported_command: 8 }; assert_matches!(response.encode(&mut buf[..]), Err(FrameParseError::BufferTooSmall)); }
rust_cleaned_test_functions.jsonl/67133
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 108 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 11224, 7776, 2346, 78, 31966, 368, 341, 286, 1077, 5206, 6607, 284, 5907, 286, 1077, 2033, 284, 11581, 34636, 4062, 4870, 314, 1560, 13996, 25, 895, 11, 2477, 57885, 10811, 25, 220, 23, 2605, 28...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_discover_limit_urls_per_allowed() { let allowed_domains = crate::config::allowed_domains_from_config( Some(vec!["*.example.com".to_string()]), crate::config::Mode::Discover, &Some(url::Url::parse("https://example.com").unwrap()), &None, ...
rust_cleaned_test_functions.jsonl/81999
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 738 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 9932, 3688, 14763, 32822, 5678, 42155, 368, 341, 286, 1077, 5420, 70199, 284, 17717, 486, 1676, 486, 20967, 70199, 5673, 5332, 1006, 310, 4329, 25592, 0, 1183, 19922, 8687, 905, 3263, 983, 3904, 3...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_remove_predecessor() { let mut root = tree!('B' => [2, 'A', 'C']); println!("Input: `{:?}`", root); let removed = root.remove(&'B'); let expected = tree!('A' => [1, Nil, 'C']); assert_eq!(removed, Some('B')); assert_eq!(root, expected); }
rust_cleaned_test_functions.jsonl/9215
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 127 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 18193, 10442, 26911, 269, 368, 341, 197, 10217, 5206, 3704, 284, 4916, 0, 492, 33, 6, 589, 508, 17, 11, 364, 32, 516, 364, 34, 5860, 197, 81168, 17223, 2505, 25, 220, 1565, 44986, 30, 5541, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_allow_threads_pass_stuff_in() { let list: Py<PyList> = Python::with_gil(|py| { let list = PyList::new(py, vec!["foo", "bar"]); list.into() }); let mut v = vec![1, 2, 3]; let a = Arc::new(String::from("foo")); Python::with_gil(|py| ...
rust_cleaned_test_functions.jsonl/10706
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 244 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 55731, 29725, 15464, 95396, 1243, 368, 341, 286, 1077, 1140, 25, 5355, 27, 13828, 852, 29, 284, 13027, 486, 4197, 1889, 321, 22428, 3288, 91, 341, 310, 1077, 1140, 284, 5355, 852, 486, 931, 4682...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_fmindex_not_found() { let text = b"GCCTTAACATTATTACGCCTA$"; let alphabet = dna::n_alphabet(); let sa = suffix_array(text); let bwt = bwt(text, &sa); let less = less(&bwt, &alphabet); let occ = Occ::new(&bwt, 3, &alphabet); let fm = FMIndex:...
rust_cleaned_test_functions.jsonl/50355
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 255 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 78694, 1252, 7913, 21480, 368, 341, 286, 1077, 1467, 284, 293, 1, 22863, 1162, 15204, 1706, 21614, 21614, 1706, 22863, 1162, 32, 3, 876, 286, 1077, 27790, 284, 75334, 486, 77, 8418, 18485, 543, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_g1_affine_projective_conversion() { let a = G1Projective::new( Fq::from_repr(BigInteger768([ 0xb0ed63c4d24e8a1c, 0x50bb6ed9a0862dcb, 0x8c6c55ec0725bb6f, 0x7a6117f051cd5547, 0x64d4b0df25a12962, 0x91ab55890e2526e7...
rust_cleaned_test_functions.jsonl/52503
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1746 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 1889, 16, 48914, 482, 16352, 533, 64132, 368, 1476, 262, 1077, 264, 284, 479, 16, 7849, 533, 486, 931, 1006, 286, 434, 80, 486, 1499, 68535, 91756, 22, 21, 23, 8956, 310, 220, 15, 7929, 15, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_poh_recorder_record_bad_slot() { let ledger_path = get_tmp_ledger_path!(); { let blocktree = Blocktree::open(&ledger_path).expect("Expected to be able to open database ledger"); let GenesisBlockInfo { genesis_block, .. } = create_genesis_bl...
rust_cleaned_test_functions.jsonl/31722
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 857 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 620, 2267, 7080, 1358, 14192, 34199, 27563, 368, 341, 286, 1077, 46933, 2638, 284, 633, 16125, 38367, 1389, 2638, 0, 543, 286, 341, 310, 1077, 2504, 9344, 4035, 394, 8362, 9344, 486, 2508, 2099, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_compression_without_prefix() { let size = 65536; let mut to_compress = Vec::with_capacity(size); for i in 0..size { to_compress.push(i as u8); } let mut v: Vec<Vec<u8>> = vec![]; for i in 1..100 { v.push(compress(&to_compres...
rust_cleaned_test_functions.jsonl/62387
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 542 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2965, 4011, 39904, 13974, 368, 341, 286, 1077, 1379, 284, 220, 21, 20, 20, 18, 21, 280, 286, 1077, 5206, 311, 87845, 284, 11312, 486, 4197, 35603, 6856, 317, 286, 369, 600, 304, 220, 15, 496, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
5
#[test] fn test_convert_monotype_function() { let b = ast::BaseNode::default(); let monotype_ex = ast::MonoType::Function(Box::new(ast::FunctionType { base: b.clone(), parameters: vec![ast::ParameterType::Optional { base: b.clone(), name: a...
rust_cleaned_test_functions.jsonl/30462
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 836 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 34910, 20737, 4156, 9174, 368, 341, 286, 1077, 293, 284, 11763, 486, 3978, 1955, 486, 2258, 543, 286, 1077, 1615, 4156, 2702, 284, 11763, 486, 58946, 929, 486, 5152, 67758, 486, 931, 52574, 486, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_get_record_value_success() { init!("false"); let xtype = CStringUtils::string_to_cstring("record_type".to_string()); let id = CStringUtils::string_to_cstring("123".to_string()); let value = CStringUtils::string_to_cstring("Record Value".to_string()); let t...
rust_cleaned_test_functions.jsonl/37983
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 948 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 3062, 14192, 3142, 18632, 368, 341, 286, 2930, 17223, 3849, 797, 286, 1077, 60614, 284, 356, 34780, 486, 917, 2346, 666, 917, 445, 8548, 1819, 3263, 983, 3904, 1423, 286, 1077, 877, 284, 356, 34...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_bytes_handled() { let test = Testu8 { a: vec![1, 2], b: [3, 4], }; serde_assert(test) // don't check for schema equality to allow for transitioning to bytes or fixed types in the future }
rust_cleaned_test_functions.jsonl/114082
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 130 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 12524, 23194, 832, 368, 341, 286, 1077, 1273, 284, 3393, 84, 23, 341, 310, 264, 25, 7486, 20703, 16, 11, 220, 17, 1259, 310, 293, 25, 508, 18, 11, 220, 19, 1259, 286, 2605, 286, 61570, 16553...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_good_log_levels() { // Take the lock so changing the environment doesn't cause races. let _env_lock = ENV_LOCK.lock().unwrap(); env::set_var(CONFIG_ENV, "stage"); check_config!(RocketConfig::parse(r#" [stage] lo...
rust_cleaned_test_functions.jsonl/35248
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 835 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 44781, 5224, 37819, 368, 341, 286, 442, 11778, 279, 5296, 773, 10018, 279, 4573, 3171, 944, 5240, 20588, 624, 286, 1077, 716, 3160, 9818, 284, 32791, 27661, 21003, 1005, 15454, 543, 286, 6105, 486...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_regexp_match_all_literals() -> Result<()> { use arrow::array::ListArray; let schema = Schema::new(vec![Field::new("a", DataType::Int32, false)]); let ctx_state = ExecutionContextState::new(); let col_value = lit(ScalarValue::Utf8(Some("aaa-555".to_string()))); ...
rust_cleaned_test_functions.jsonl/77886
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 645 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 4920, 4580, 10708, 5705, 49643, 368, 1464, 5714, 71698, 341, 286, 990, 17921, 486, 1653, 486, 852, 1857, 280, 286, 1077, 10802, 284, 12539, 486, 931, 25592, 20703, 1877, 486, 931, 445, 64, 497, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
5
#[test] fn test_txn_store_get_with_type_lock() { let store = AssertionStorage::default(); store.put_ok(b"k1", b"v1", 1, 2); store.prewrite_ok(vec![Mutation::Lock(Key::from_raw(b"k1"))], b"k1", 5); store.get_ok(b"k1", 20, b"v1"); }
rust_cleaned_test_functions.jsonl/63386
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 129 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 92299, 14809, 3062, 6615, 1819, 9818, 368, 341, 262, 1077, 3553, 284, 46730, 5793, 486, 2258, 543, 262, 3553, 3597, 19817, 1883, 62911, 16, 497, 293, 1, 85, 16, 497, 220, 16, 11, 220, 17, 317,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_translation_t5() -> anyhow::Result<()> { let model_resource = RemoteResource::from_pretrained(T5ModelResources::T5_SMALL); let config_resource = RemoteResource::from_pretrained(T5ConfigResources::T5_SMALL); let vocab_resource = RemoteResource::from_pretrained(T5VocabResources::T5_SMA...
rust_cleaned_test_functions.jsonl/48974
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 731 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 49273, 528, 20, 368, 1464, 88964, 486, 2077, 71698, 341, 262, 1077, 1614, 17962, 284, 20738, 4783, 486, 1499, 10442, 35722, 4140, 20, 1712, 11277, 486, 51, 20, 56207, 317, 262, 1077, 2193, 17962, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
5
#[test] fn test_expectct_invalid() { let json = r#"{ "hostname": "www.example.com", "date_time": "Not an RFC3339 datetime" }"#; let mut event = Event::default(); ExpectCt::apply_to_event(json.as_bytes(), &mut event) .expect_err("date_time shou...
rust_cleaned_test_functions.jsonl/4038
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 172 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 68918, 302, 31433, 368, 341, 286, 1077, 2951, 284, 435, 55543, 515, 310, 330, 27806, 788, 330, 2136, 7724, 905, 756, 310, 330, 1028, 3009, 788, 330, 2623, 458, 39233, 18, 18, 18, 24, 8874, 698...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_and_reg_addr2() { let compiled = compile("SET HL 100\nSET B 255\nWRITE64 B\nSET C 345\nAND C (100)"); let out_cpu = test_program(compiled); assert_eq!(out_cpu.hl.value, 100); assert_eq!(out_cpu.a.value, 0); assert_eq!(out_cpu.b.value, 255); assert_eq!(out_cpu.c.value, 89...
rust_cleaned_test_functions.jsonl/63165
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 171 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 8378, 4920, 7387, 17, 368, 341, 262, 1077, 19697, 284, 19192, 445, 5884, 52487, 220, 16, 15, 15, 1699, 5884, 425, 220, 17, 20, 20, 1699, 32781, 21, 19, 425, 1699, 5884, 356, 220, 18, 19, 20,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_custom_hash_skip() { fn custom_hash<XCHA, XCHS, S, F>(_: &mut XCHA, _: &S, field: F, _: usize) where XCHA: ::c2rust_xcheck_runtime::hash::CrossCheckHasher, F: ::std::borrow::Borrow<u64>, { assert_eq!(*field.borrow(), 0x12345678); } test_struct!([] ...
rust_cleaned_test_functions.jsonl/43901
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 237 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 15875, 8950, 44830, 368, 341, 262, 5168, 2526, 8950, 66758, 36787, 11, 1599, 2149, 50, 11, 328, 11, 434, 2235, 23211, 609, 6984, 1599, 36787, 11, 58536, 609, 50, 11, 2070, 25, 434, 11, 58536, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_7() { assert_eq!(Solution::reverse(123), 321); assert_eq!(Solution::reverse(-123), -321); assert_eq!(Solution::reverse(120), 21); assert_eq!(Solution::reverse(0), 0); }
rust_cleaned_test_functions.jsonl/28681
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 107 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 62, 22, 368, 341, 286, 2060, 10714, 10297, 36842, 486, 25903, 7, 16, 17, 18, 701, 220, 18, 17, 16, 317, 286, 2060, 10714, 10297, 36842, 486, 25903, 4080, 16, 17, 18, 701, 481, 18, 17, 16, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_reverse() { let mut ys = [1, 2, 3, 4, 5]; ys.iter_mut().reverse_in_place(); assert!(ys == [5, 4, 3, 2, 1]); }
rust_cleaned_test_functions.jsonl/37051
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 76 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 43277, 368, 341, 262, 1077, 5206, 31810, 284, 508, 16, 11, 220, 17, 11, 220, 18, 11, 220, 19, 11, 220, 20, 935, 262, 31810, 19471, 29523, 1005, 25903, 1243, 34548, 543, 262, 2060, 10297, 1047,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_extracting_extra_symbols() { let mut grammar = build_grammar(vec![ Variable::named("rule_0", Rule::string("x")), Variable::named("comment", Rule::pattern("//.*")), ]); grammar.extra_symbols = vec![Rule::string(" "), Rule::non_terminal(1)]; ...
rust_cleaned_test_functions.jsonl/99762
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 252 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 39123, 287, 31858, 55752, 368, 341, 286, 1077, 5206, 31428, 284, 1936, 62, 41094, 25592, 90515, 310, 12407, 486, 30245, 445, 12937, 62, 15, 497, 18100, 486, 917, 445, 87, 30154, 310, 12407, 486, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_part1() { let input = r#"Butterscotch: capacity -1, durability -2, flavor 6, texture 3, calories 8 Cinnamon: capacity 2, durability 3, flavor -2, texture -1, calories 3"#; let ingredients = get_ingredients(&input); dbg!(ingredients); }
rust_cleaned_test_functions.jsonl/22056
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 114 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 10495, 16, 368, 341, 286, 1077, 1946, 284, 435, 55543, 3983, 5045, 64498, 331, 25, 8654, 481, 16, 11, 38565, 481, 17, 11, 17172, 220, 21, 11, 10434, 220, 18, 11, 24262, 220, 23, 198, 34, 393...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_all() { assert_eq!( parse_java_args(&[ "-Dkey1=value1", "-Dkey2=value2", "-d32", "-d64", "-server", "-wait", "-wait-time", "30000", "-ready", "landlordd", ...
rust_cleaned_test_functions.jsonl/107287
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 825 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 5705, 368, 341, 262, 2060, 10714, 33673, 286, 4715, 77323, 8384, 2099, 9640, 310, 6523, 35, 792, 16, 46538, 16, 756, 310, 6523, 35, 792, 17, 46538, 17, 756, 310, 6523, 67, 18, 17, 756, 310, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_messages_download() { init!("true"); let cb = return_types_u32::Return_U32_STR::new().unwrap(); assert_eq!(vcx_messages_download(cb.command_handle, ptr::null_mut(), ptr::null_mut(), ptr::null_mut(), Some(cb.get_callback())), error::SUCCESS.code_num); cb.receive(S...
rust_cleaned_test_functions.jsonl/19373
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 162 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 23428, 35939, 368, 341, 286, 2930, 17223, 1866, 3071, 286, 1077, 9858, 284, 470, 9763, 7300, 18, 17, 486, 5598, 6665, 18, 17, 7159, 486, 931, 1005, 15454, 543, 286, 2060, 10714, 10297, 7362, 87,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_node_types_with_multiple_valued_fields() { let node_types = get_node_types(InputGrammar { name: String::new(), extra_symbols: Vec::new(), external_tokens: Vec::new(), expected_conflicts: Vec::new(), variables_to_inline: Vec::new...
rust_cleaned_test_functions.jsonl/8322
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1559 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 5084, 9763, 6615, 45233, 6189, 3260, 12132, 368, 341, 286, 1077, 2436, 9763, 284, 633, 5084, 9763, 29773, 97178, 341, 310, 829, 25, 923, 486, 931, 3148, 310, 4960, 55752, 25, 11312, 486, 931, 31...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_poll_ready() { let cnt = Rc::new(Cell::new(0)); let mut srv = Srv1(cnt.clone()).and_then(Srv2(cnt.clone())); let res = srv.poll_ready(); assert!(res.is_ok()); assert_eq!(res.unwrap(), Async::Ready(())); assert_eq!(cnt.get(), 2); }
rust_cleaned_test_functions.jsonl/91386
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 165 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 40002, 35456, 368, 341, 286, 1077, 13195, 284, 81463, 486, 931, 82530, 486, 931, 7, 15, 1106, 286, 1077, 5206, 43578, 284, 328, 10553, 16, 46373, 15997, 6011, 437, 68367, 3759, 10553, 17, 46373, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_log_input() { let config: ConfigBuilder = toml::from_str( r#" [transforms.foo] inputs = ["ignored"] type = "add_fields" [transforms.foo.fields] new_field = "string value" [[tests]] name = "successful test with log event" [tests.input] insert_at = "foo" ...
rust_cleaned_test_functions.jsonl/75165
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 392 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 5224, 5898, 368, 341, 286, 1077, 2193, 25, 5532, 3297, 284, 311, 1014, 486, 1499, 2895, 1006, 310, 435, 2, 698, 58, 94833, 58432, 921, 220, 11127, 284, 4383, 58471, 7026, 220, 943, 284, 330, 7...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1