text
stringlengths
93
16.4k
id
stringlengths
20
40
metadata
dict
input_ids
listlengths
45
2.05k
attention_mask
listlengths
45
2.05k
complexity
int64
1
9
#[test] fn test_default_select_all() { let selector = FindQuery::find_all().as_value().to_string(); assert_eq!(selector, r#"{"selector":{"_id":{"$ne":null}}}"#) }
rust_cleaned_test_functions.jsonl/40406
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 86 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 9993, 13051, 5705, 368, 341, 286, 1077, 9367, 284, 7379, 2859, 486, 3903, 5705, 1005, 300, 3142, 1005, 983, 3904, 543, 286, 2060, 10714, 10297, 8925, 11, 435, 55543, 4913, 8925, 22317, 62, 307, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_equality() { let a1 = Rad(2.0); assert_ulps_eq!(a1, Rad(2.0)); assert_ulps_eq!(Deg(200.0), Deg(200.0)); assert!(!(Deg(200.0) == Deg(100.0))); assert!(Deg(200.0) < Deg(300.0)); assert!(Deg(250.0) > Deg(100.0)); assert_relative_eq!(Deg(359....
rust_cleaned_test_functions.jsonl/58805
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 288 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2204, 10473, 368, 341, 286, 1077, 264, 16, 284, 20605, 7, 17, 13, 15, 317, 286, 2060, 61039, 1690, 10714, 10297, 64, 16, 11, 20605, 7, 17, 13, 15, 1106, 286, 2060, 61039, 1690, 10714, 10297, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_persisted_acount() -> Result<()> { let server = crate::test::with_directory_server(); let url = DirectoryUrl::Other(&server.dir_url); let persist = MemoryPersist::new(); let dir = Directory::from_url(persist, url)?; let acc1 = dir.account("foo@bar.com")?; ...
rust_cleaned_test_functions.jsonl/110114
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 276 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 620, 4975, 291, 14718, 629, 368, 1464, 5714, 71698, 341, 286, 1077, 3538, 284, 17717, 486, 1944, 486, 4197, 14846, 12015, 543, 286, 1077, 2515, 284, 18033, 2864, 486, 11409, 2099, 4030, 14395, 290...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
5
#[test] fn test_no_trailing_target_slash() { wrapper(|env| { env.fake_release().name("dummy").version("0.1.0").create()?; let web = env.frontend(); assert_redirect( "/crate/dummy/0.1.0/target-redirect/x86_64-apple-darwin", "/dummy/0.1.0...
rust_cleaned_test_functions.jsonl/13869
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 622 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6536, 3547, 14277, 11123, 11886, 988, 368, 341, 286, 13261, 22428, 3160, 91, 341, 310, 6105, 94624, 24577, 1005, 606, 445, 31390, 1827, 4366, 445, 15, 13, 16, 13, 15, 1827, 3182, 94136, 310, 107...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
6
#[test] fn test_lda() { let mut r = Register::new(); let mut b = MockBus::new(); b.memory[0xA5] = 0xFF; lda(0xA5, &mut r, &mut b); assert_eq!(r.get_A(),0xFF); }
rust_cleaned_test_functions.jsonl/14180
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 102 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 50573, 64, 368, 341, 262, 1077, 5206, 435, 284, 8451, 486, 931, 543, 262, 1077, 5206, 293, 284, 14563, 15073, 486, 931, 543, 262, 293, 36611, 58, 15, 14673, 20, 60, 284, 220, 15, 9264, 280, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_bundled_config_files() { let resource = Resource::bundled_ckb_config(); CKBAppConfig::load_from_slice(&resource.get().expect("read bundled file")) .expect("deserialize config"); let resource = Resource::bundled_miner_config(); MinerAppConfig::load_from_slice(&resource.ge...
rust_cleaned_test_functions.jsonl/113840
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 146 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 880, 1241, 832, 5332, 10931, 368, 341, 262, 1077, 5101, 284, 11765, 486, 65, 1241, 832, 89236, 65, 5332, 543, 262, 356, 29862, 2164, 2648, 486, 1078, 5673, 26488, 2099, 9233, 670, 1005, 17119, 4...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_reverse() { let mut v = vec![10, 20]; assert_eq!(v[0], 10); assert_eq!(v[1], 20); v.reverse(); assert_eq!(v[0], 20); assert_eq!(v[1], 10); let mut v3 = Vec::<i32>::new(); v3.reverse(); assert!(v3.is_empty()); // check the 1-byte-types path let mut v ...
rust_cleaned_test_functions.jsonl/12867
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 291 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 43277, 368, 341, 262, 1077, 5206, 348, 284, 7486, 20703, 16, 15, 11, 220, 17, 15, 935, 262, 2060, 10714, 10297, 85, 58, 15, 1125, 220, 16, 15, 317, 262, 2060, 10714, 10297, 85, 58, 16, 1125,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_subscribe_to_invalid_topic() { let t1 = Topic::new("t1"); let t2 = Topic::new("t2"); let (mut gs, _, _) = inject_nodes::<IdentityTransform, _>() .subscription_filter(WhitelistSubscriptionFilter( vec![t1.hash()].into_iter().collect(), ...
rust_cleaned_test_functions.jsonl/66950
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 251 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 88935, 2346, 31433, 31414, 368, 341, 286, 1077, 259, 16, 284, 32911, 486, 931, 445, 83, 16, 797, 286, 1077, 259, 17, 284, 32911, 486, 931, 445, 83, 17, 797, 286, 1077, 320, 6984, 28081, 11, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_config_serialization() { let _ = env_logger::builder().is_test(true).try_init(); let json = r#"{"discoveryHandler":{"name":"random", "discoveryDetails":""}, "capacity":4}"#; let deserialized: ConfigurationSpec = serde_json::from_str(json).unwrap(); assert_eq!(4, ...
rust_cleaned_test_functions.jsonl/34769
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 339 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 5332, 25602, 2022, 368, 341, 286, 1077, 716, 284, 6105, 27413, 486, 17850, 1005, 285, 4452, 3715, 568, 1539, 6137, 1428, 286, 1077, 2951, 284, 435, 55543, 4913, 4243, 7449, 3050, 22317, 606, 3252,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_event_display() { use super::SgmlEvent::*; assert_eq!( format!( "{}", MarkupDeclaration { keyword: "DOCTYPE".into(), body: "HTML".into(), }, ), "<!DOCTYPE H...
rust_cleaned_test_functions.jsonl/121443
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1021 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6748, 14825, 368, 341, 286, 990, 2256, 486, 50, 70, 1014, 1556, 56162, 286, 2060, 10714, 33673, 310, 3561, 33673, 394, 35503, 756, 394, 98561, 24489, 341, 503, 16174, 25, 330, 15458, 3263, 18122, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_unregister_errors() { let mut event_manager = EventManager::new().unwrap(); let dummy_subscriber = Arc::new(Mutex::new(DummySubscriber::new())); event_manager .add_subscriber(dummy_subscriber.clone()) .unwrap(); assert!(event_man...
rust_cleaned_test_functions.jsonl/92056
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 366 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 68992, 20196, 368, 341, 286, 1077, 5206, 1538, 12144, 284, 3665, 2043, 486, 931, 1005, 15454, 543, 286, 1077, 17292, 5228, 20351, 284, 19689, 486, 931, 3189, 9371, 486, 931, 5432, 8574, 40236, 486...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_iter_02() { let x = "x".to_string(); // Initiailise heap let t = Term::Fun(x, Expr{index:123}); for i in &t { assert_eq!(i,123); } }
rust_cleaned_test_functions.jsonl/39129
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 104 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 11723, 62, 15, 17, 368, 341, 262, 1077, 856, 284, 330, 87, 3263, 983, 3904, 2129, 1789, 262, 442, 31397, 604, 1064, 17364, 198, 262, 1077, 259, 284, 17519, 486, 30855, 2075, 11, 28819, 90, 125...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_str_with_millisecond_timestamp() { let input = r#"{ "time" : "2021-04-30T17:03:14.123+02:00", "temperature" : 25 }"#; let output = ThinEdgeJson::from_str(input).unwrap(); assert_eq!( output.timestamp, Some( ...
rust_cleaned_test_functions.jsonl/117067
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 297 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2895, 6615, 717, 65358, 23073, 368, 341, 286, 1077, 1946, 284, 435, 55543, 515, 310, 330, 1678, 1, 549, 330, 17, 15, 17, 16, 12, 15, 19, 12, 18, 15, 51, 16, 22, 25, 15, 18, 25, 16, 19, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_cache_user_guild_state() { let user_id = UserId(2); let cache = InMemoryCache::new(); cache.cache_user(Cow::Owned(user(user_id)), Some(GuildId(1))); // Test the guild's ID is the only one in the user's set of guilds. { let user = cache.0.users...
rust_cleaned_test_functions.jsonl/86440
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 709 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 11529, 3317, 1889, 1498, 4387, 368, 341, 286, 1077, 1196, 842, 284, 40883, 7, 17, 317, 286, 1077, 6500, 284, 758, 10642, 8233, 486, 931, 543, 286, 6500, 20087, 3317, 3025, 363, 486, 57641, 4277,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_scroll() { let fj = parse_top_level_json(OBJECT.to_owned()).unwrap(); let mut viewer = JsonViewer::new(fj, Mode::Line); viewer.dimensions.height = 8; viewer.scrolloff_setting = 2; assert_window_tracking( &mut viewer, vec![ ...
rust_cleaned_test_functions.jsonl/41769
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 871 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 41407, 368, 341, 286, 1077, 75371, 284, 4715, 10426, 8274, 9455, 19238, 10467, 2389, 51973, 6011, 15454, 543, 286, 1077, 5206, 25708, 284, 8308, 28271, 486, 931, 955, 73, 11, 14562, 486, 2460, 317...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_collect_expr() -> Result<()> { let mut accum: HashSet<Column> = HashSet::new(); expr_to_columns( &Expr::Cast { expr: Box::new(col("a")), data_type: DataType::Float64, }, &mut accum, )?; expr_to_co...
rust_cleaned_test_functions.jsonl/4244
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 360 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 68140, 21915, 368, 1464, 5714, 71698, 341, 286, 1077, 5206, 15421, 25, 18931, 27, 2933, 29, 284, 18931, 486, 931, 543, 286, 15169, 2346, 22590, 1006, 310, 609, 16041, 486, 18714, 341, 394, 15169, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_param_reccy() { let reccy1 = RecCy { x: 1, y: 2, t: One(1) }; let reccy2 = RecCy { x: 345, y: 2, t: Two(1, 2) }; let reccy3 = RecCy { x: 1, y: 777, t: Three(1, 2, 3) }; let reccy4 = RecCy { x: 19, y: 252, t: Two(17, 42) }; test_parameterized::<RecCy>(reccy...
rust_cleaned_test_functions.jsonl/26214
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 200 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 4090, 1288, 638, 88, 368, 341, 286, 1077, 312, 638, 88, 16, 284, 4067, 56715, 314, 856, 25, 220, 16, 11, 379, 25, 220, 17, 11, 259, 25, 3776, 7, 16, 8, 2605, 286, 1077, 312, 638, 88, 17,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_or_with_one_gte_parse() { let name1 = _random_string(10); let value1 = _random_string(10); let json = format!(r#"{{"$or":[{{"~{}":{{"$gte":"{}"}}}}]}}"#, name1, value1); let query = parse_from_json(&json).unwrap(); let expected = Operator::Or( ...
rust_cleaned_test_functions.jsonl/11848
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 314 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 8734, 6615, 11667, 1889, 665, 21039, 368, 341, 286, 1077, 829, 16, 284, 716, 11463, 3904, 7, 16, 15, 317, 286, 1077, 897, 16, 284, 716, 11463, 3904, 7, 16, 15, 626, 286, 1077, 2951, 284, 356...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_read_pairs() { let input = "() (1 2 3) (1 (2) ((3)))"; let heap = &mut Heap::new(); let results : Vec<Value> = read_from_str(input, heap, "test_read_pairs") .map(|(_, r)| *r.ok().expect("Should not get a read error")) .collect(); assert_eq!...
rust_cleaned_test_functions.jsonl/62117
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1851 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6443, 36430, 368, 341, 286, 1077, 1946, 284, 67411, 320, 16, 220, 17, 220, 18, 8, 320, 16, 320, 17, 8, 1781, 18, 7705, 876, 286, 1077, 17364, 284, 609, 6984, 47307, 486, 931, 543, 286, 1077,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_try_from_patch_vm() { let (mut sender, receiver) = UnixStream::pair().unwrap(); let mut connection = HttpConnection::new(receiver); let body = "{ \ \"state\": \"Paused\" \ }"; sender .write_all(http_request("PATCH", "/vm", Some(&bod...
rust_cleaned_test_functions.jsonl/106588
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 249 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 53283, 5673, 39643, 39008, 368, 341, 286, 1077, 320, 6984, 4646, 11, 13964, 8, 284, 46995, 3027, 486, 12670, 1005, 15454, 543, 286, 1077, 5206, 3633, 284, 4823, 4526, 486, 931, 78126, 317, 286, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_api_anchoring_observer_normal() { let mut testkit = AnchoringTestKit::default(); let anchoring_addr = testkit.current_addr(); anchor_first_block(&mut testkit); anchor_first_block_lect_normal(&mut testkit); // Anchoring transaction for block with height 0. let first_ancho...
rust_cleaned_test_functions.jsonl/80051
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 717 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 11697, 62, 3497, 5503, 81912, 13973, 368, 341, 262, 1077, 5206, 1273, 8226, 284, 71484, 5503, 2271, 7695, 486, 2258, 543, 262, 1077, 33230, 5503, 7387, 284, 1273, 8226, 4952, 7387, 1428, 262, 1710...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_arrays() { let mut rng = crate::new(); let _: [i8; 0] = Standard.sample(&mut rng); let _: [u8; 1] = Standard.sample(&mut rng); let _: [i16; 13] = Standard.sample(&mut rng); let _: [u16; 14] = Standard.sample(&mut rng); let _: [i32; 20] = Standard.sample(&mut rng); let _: [u32; 21] = Stand...
rust_cleaned_test_functions.jsonl/85581
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 231 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 68983, 368, 341, 10217, 5206, 28422, 284, 17717, 486, 931, 543, 10217, 58536, 508, 72, 23, 26, 220, 15, 60, 284, 11766, 23882, 2099, 6984, 28422, 317, 10217, 58536, 508, 84, 23, 26, 220, 16, 6...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_probability_of_heads() { let test_cases = vec![ (vec![0.5,0.5,0.5,0.5,0.5], 0, 0.03125), (vec![0.2,0.8,0f64,0.3,0.5], 3, 0.182), (vec![0.4f64], 1, 0.4f64), (vec![1.0,1.0,1.0,1.0,1.0,1.0], 6, 1f64), (vec![1.0,1.0,1.0...
rust_cleaned_test_functions.jsonl/85614
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 475 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 68589, 3575, 76320, 368, 341, 286, 1077, 1273, 41427, 284, 7486, 90515, 310, 320, 4083, 20703, 15, 13, 20, 11, 15, 13, 20, 11, 15, 13, 20, 11, 15, 13, 20, 11, 15, 13, 20, 1125, 220, 15, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_lazy_logical_plan_schema() { let df = get_df(); let lp = df .clone() .lazy() .select(&[col("variety").alias("foo")]) .logical_plan; println!("{:#?}", lp.schema().fields()); assert!(lp.schema().field_with_name("foo")...
rust_cleaned_test_functions.jsonl/87595
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 343 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 49646, 86484, 26564, 25371, 368, 341, 286, 1077, 6764, 284, 633, 10894, 543, 286, 1077, 18576, 284, 6764, 198, 310, 659, 19982, 741, 310, 659, 49013, 741, 310, 659, 1742, 2099, 58, 2074, 445, 29...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_compile_or_d() { let compiled = bitwise::compile_or("D".to_string()); assert_eq!(compiled.len(), 1); assert_eq!(compiled[0], 0b01111001); }
rust_cleaned_test_functions.jsonl/100588
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 81 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 74170, 8734, 814, 368, 341, 262, 1077, 19697, 284, 97970, 486, 20433, 8734, 445, 35, 3263, 983, 3904, 5231, 262, 2060, 10714, 10297, 50845, 19406, 1507, 220, 16, 317, 262, 2060, 10714, 10297, 5084...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_txin() { let txin: Result<TxIn, _> = deserialize(&Vec::from_hex("a15d57094aa7a21a28cb20b59aab8fc7d1149a3bdbcddba9c622e4f5f6a99ece010000006c493046022100f93bb0e7d8db7bd46e40132d1f8242026e045f03a0efe71bbb8e3f475e970d790221009337cd7f1f929f00cc6ff01f03729b069a7c21b59b1736ddfee5db5946c5da8c012...
rust_cleaned_test_functions.jsonl/324
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 261 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 17805, 258, 368, 341, 286, 1077, 9854, 258, 25, 5714, 3125, 87, 641, 11, 716, 29, 284, 35240, 2099, 10050, 486, 1499, 32655, 445, 64, 16, 20, 67, 20, 22, 15, 24, 19, 5305, 22, 64, 17, 16, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_eval_binary_function_vector_vector() { #[rpn_fn(nullable)] fn foo(v1: Option<&Real>, v2: Option<&i64>) -> Result<Option<i64>> { Ok(Some( (v1.unwrap().into_inner() * 2.5 - (*v2.unwrap() as f64) * 3.5) as i64, )) } le...
rust_cleaned_test_functions.jsonl/92668
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1077 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21296, 31761, 9174, 12247, 12247, 368, 341, 394, 11506, 81, 19958, 15246, 34885, 5563, 286, 5168, 15229, 3747, 16, 25, 6959, 52244, 12768, 8066, 348, 17, 25, 6959, 52244, 72, 21, 19, 9231, 1464, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_select_order_by() { let expected_sql = "SELECT `musti`.* FROM `musti` ORDER BY `foo`, `baz` ASC, `bar` DESC"; let query = Select::from_table("musti") .order_by("foo") .order_by("baz".ascend()) .order_by("bar".descend()); let (sql, param...
rust_cleaned_test_functions.jsonl/52903
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 220 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 13051, 7869, 3710, 368, 341, 286, 1077, 3601, 18063, 284, 330, 4858, 1565, 24812, 72, 63, 4908, 4295, 1565, 24812, 72, 63, 15520, 7710, 1565, 7975, 7808, 1565, 42573, 63, 19796, 11, 1565, 2257, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_fifo() { let mut q = PerValidatorQueue::new(QueueStyle::FIFO, 3); let validator = AccountAddress::new([0u8; ADDRESS_LENGTH]); // Test order q.push( validator, ProposalMsg { msg: "msg1".to_string(), }, ); q.push( validator, ...
rust_cleaned_test_functions.jsonl/62474
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 724 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 56590, 368, 341, 262, 1077, 5206, 2804, 284, 3616, 14256, 7554, 486, 931, 6253, 6318, 2323, 486, 37, 25997, 11, 220, 18, 317, 262, 1077, 22935, 284, 8615, 4286, 486, 931, 2561, 15, 84, 23, 26,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_window_function_from_str() -> Result<()> { assert_eq!( WindowFunction::from_str("max")?, WindowFunction::AggregateFunction(AggregateFunction::Max) ); assert_eq!( WindowFunction::from_str("min")?, WindowFunction::AggregateFun...
rust_cleaned_test_functions.jsonl/119617
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 622 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 12571, 9174, 5673, 2895, 368, 1464, 5714, 71698, 341, 286, 2060, 10714, 33673, 310, 13642, 5152, 486, 1499, 2895, 445, 2810, 899, 36474, 310, 13642, 5152, 486, 64580, 5152, 4346, 70, 14240, 5152, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
9
#[test] fn test_enable_with_handler() { let controllers = context().controllers(); let mut battery_conservation = controllers.battery_conservation(); let mut rapid_charge = controllers.rapid_charge(); // set up our scenario here battery_conservation .enable()...
rust_cleaned_test_functions.jsonl/15395
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1049 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 18988, 6615, 10183, 368, 341, 286, 1077, 26225, 284, 2266, 1005, 21611, 543, 286, 1077, 5206, 11602, 31971, 8768, 284, 26225, 948, 18670, 31971, 8768, 543, 286, 1077, 5206, 11048, 46008, 284, 26225,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_hello() { // perfect byte match with the example document. let mut writer = NbtWriter::new(); let mut root = writer.root("hello world"); root.field("name").string("Bananrama"); root.finish(); let result = writer.finish(); let expected = include_bytes!("../file...
rust_cleaned_test_functions.jsonl/90955
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 138 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 96724, 368, 341, 1066, 262, 442, 4727, 4922, 2432, 448, 279, 3110, 2197, 382, 262, 1077, 5206, 6916, 284, 451, 12755, 6492, 486, 931, 1428, 262, 1077, 5206, 3704, 284, 6916, 12576, 445, 14990, 1...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_illformed_length() { let raw_schema = r#" { "type": "record", "name": "test", "fields": [ {"name": "a", "type": "long", "default": 42}, {"name": "b", "type": "string"} ] ...
rust_cleaned_test_functions.jsonl/77304
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 367 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 62, 483, 10155, 5118, 368, 341, 286, 1077, 7112, 25371, 284, 435, 2, 698, 310, 341, 394, 330, 1313, 788, 330, 8548, 756, 394, 330, 606, 788, 330, 1944, 756, 394, 330, 9007, 788, 2278, 503, 5...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_simplified_fractions() { let test_cases = vec![ (2, vec!["1/2"]), (4, vec!["1/2","1/3","1/4","2/3","3/4"]), ]; for (n, expect) in test_cases { assert_eq!(Solution::simplified_fractions(n), expect); } }
rust_cleaned_test_functions.jsonl/32110
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 185 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 643, 73837, 761, 956, 5136, 368, 341, 286, 1077, 1273, 41427, 284, 7486, 90515, 310, 320, 17, 11, 7486, 0, 1183, 16, 14, 17, 46442, 3374, 310, 320, 19, 11, 7486, 0, 1183, 16, 14, 17, 2198, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_asterisk_per() { init(); for n in 0..59 { let s: &str = &format!("*/{:<02}", n); let input = s.chars().collect::<Vec<_>>(); let result = (asterisk_per(min_digit()) - end()).parse(&input).to_result().unwrap(); assert_eq!( result, PerExpr { ...
rust_cleaned_test_functions.jsonl/106891
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 219 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 62, 2300, 3187, 5678, 368, 341, 262, 2930, 543, 262, 369, 308, 304, 220, 15, 496, 20, 24, 341, 414, 1077, 274, 25, 609, 495, 284, 609, 2243, 17223, 1812, 90, 31252, 15, 17, 9545, 308, 317, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_year() { let cases = vec![ (Some("0000-00-00 00:00:00"), Some(0i64)), (Some("1-01-01 01:01:01"), Some(1i64)), (Some("2018-01-01 01:01:01"), Some(2018i64)), (Some("2019-01-01 01:01:01"), Some(2019i64)), (Some("2020-01-01 01:01:01...
rust_cleaned_test_functions.jsonl/36254
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 737 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 14645, 368, 341, 286, 1077, 5048, 284, 7486, 90515, 310, 320, 8373, 445, 15, 15, 15, 15, 12, 15, 15, 12, 15, 15, 220, 15, 15, 25, 15, 15, 25, 15, 15, 3975, 4329, 7, 15, 72, 21, 19, 696...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_curve25519() { let mut output = [0; 32]; curve25519::scalarmult(&mut output, &SCALAR1, &INPUT1); assert_eq!(output, EXPECTED1); curve25519::scalarmult(&mut output, &SCALAR2, &INPUT2); assert_eq!(output, EXPECTED2); }
rust_cleaned_test_functions.jsonl/512
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 121 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 43407, 17, 20, 20, 16, 24, 368, 341, 262, 1077, 5206, 2550, 284, 508, 15, 26, 220, 18, 17, 4821, 262, 15655, 17, 20, 20, 16, 24, 486, 2388, 56780, 494, 2099, 6984, 2550, 11, 609, 3540, 727...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_is_empty() { let cigar = Cigar::default(); assert!(cigar.is_empty()); let cigar = Cigar::from(vec![Op::new(Kind::Match, 1)]); assert!(!cigar.is_empty()); }
rust_cleaned_test_functions.jsonl/127482
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 107 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6892, 15124, 368, 341, 286, 1077, 53674, 284, 356, 51284, 486, 2258, 543, 286, 2060, 10297, 66, 51284, 2079, 15124, 5231, 286, 1077, 53674, 284, 356, 51284, 486, 1499, 25592, 20703, 7125, 486, 931...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_with_helpers() { macro_rules! t( (s: $path:expr, $op:ident, $arg:expr, $res:expr) => ( { let pstr = $path; let path = Path::new(pstr); let arg = $arg; let res = path.$op(arg); ...
rust_cleaned_test_functions.jsonl/102776
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 2460 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6615, 54473, 368, 341, 286, 18072, 21407, 0, 259, 1006, 310, 320, 82, 25, 400, 2343, 96011, 11, 400, 453, 25, 1713, 11, 400, 858, 96011, 11, 400, 416, 96011, 8, 589, 2399, 394, 341, 503, 107...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_unescape_char_bad() { fn check(literal_text: &str, expected_error: EscapeError) { let actual_result = unescape_char(literal_text).map_err(|(_offset, err)| err); assert_eq!(actual_result, Err(expected_error)); } check("", EscapeError::ZeroChars); ...
rust_cleaned_test_functions.jsonl/61419
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1438 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 4907, 12998, 9232, 34199, 368, 341, 286, 5168, 1779, 2333, 9953, 4326, 25, 609, 495, 11, 3601, 4096, 25, 45643, 1454, 8, 341, 310, 1077, 5042, 5287, 284, 650, 12998, 9232, 2333, 9953, 4326, 568,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_0108_example_2() { let nums = vec![1, 3]; let result = tree![3, 1]; assert_eq!(Solution::sorted_array_to_bst(nums), result); }
rust_cleaned_test_functions.jsonl/5735
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 94 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 62, 15, 16, 15, 23, 39304, 62, 17, 368, 341, 286, 1077, 10307, 284, 7486, 20703, 16, 11, 220, 18, 935, 286, 1077, 1102, 284, 4916, 20703, 18, 11, 220, 16, 4821, 286, 2060, 10714, 10297, 3684...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_basename() { let mut output = String::new(); let method = StringMethod { method: "basename", variable: "\"/home/redox/file.txt\"", pattern: "", selection: Select::All, }; method.handle(&mut output, &VariableExp...
rust_cleaned_test_functions.jsonl/85273
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 187 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 81135, 368, 341, 286, 1077, 5206, 2550, 284, 923, 486, 931, 543, 286, 1077, 1714, 284, 923, 3523, 341, 310, 1714, 25, 262, 330, 42953, 756, 310, 3890, 25, 220, 15898, 14, 5117, 77900, 5131, 23...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_closure_argcount_error() { assert_eq!( eval_ok("{ {|x| x + 1} value } onPanic: { |p| p description }").string_as_str(), "Argument count mismatch, block wanted 1, got 0: []" ); }
rust_cleaned_test_functions.jsonl/15572
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 102 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 72823, 6057, 1830, 4096, 368, 341, 262, 2060, 10714, 33673, 286, 5603, 19817, 13976, 40960, 87, 91, 856, 488, 220, 16, 92, 897, 335, 389, 47, 31270, 25, 314, 760, 79, 91, 281, 4008, 335, 1827,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_validate_ip_v4_cow() { let test: Cow<'static, str> = "1.1.1.1".into(); assert_eq!(validate_ip_v4(test), true); let test: Cow<'static, str> = String::from("1.1.1.1").into(); assert_eq!(validate_ip_v4(test), true); let test: Cow<'static, str> = "٧.2٥.3٣.243"...
rust_cleaned_test_functions.jsonl/46418
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 266 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 42681, 10385, 2273, 19, 666, 363, 368, 341, 286, 1077, 1273, 25, 21851, 18291, 1978, 11, 607, 29, 284, 330, 16, 13, 16, 13, 16, 13, 16, 3263, 18122, 543, 286, 2060, 10714, 10297, 7067, 10385, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_alu() { let input: [u8; 16] = [ 0x61, 0x62, 0x63, 0x64, 0x81, 0x66, 0x67, 0x68, 0x69, 0x70, 0x71, 0x72, 0x73, 0x74, 0x75, 0x76, ]; let mut alu = 0u64; unsafe { ::core::ptr::copy_nonoverlapping(input.as_ptr(), &mut alu as *mut u6...
rust_cleaned_test_functions.jsonl/30501
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 271 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 8418, 84, 368, 341, 286, 1077, 1946, 25, 508, 84, 23, 26, 220, 16, 21, 60, 284, 2278, 310, 220, 15, 87, 21, 16, 11, 220, 15, 87, 21, 17, 11, 220, 15, 87, 21, 18, 11, 220, 15, 87, 21,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_t1f() { init(); let result = t1f(*IS_ROOT, &OS_NAME, &OS_VERSION, "China Mobile GSM", &APN, 2); println!("{}", result.len()); println!("{:?}", result) }
rust_cleaned_test_functions.jsonl/104710
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 112 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 528, 16, 69, 368, 341, 286, 2930, 543, 286, 1077, 1102, 284, 259, 16, 69, 4071, 1637, 16197, 11, 609, 3126, 4708, 11, 609, 3126, 10678, 11, 330, 22282, 13411, 67555, 497, 609, 2537, 45, 11, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_sort_boolean() { // boolean test_sort_to_indices_boolean_arrays( vec![None, Some(false), Some(true), Some(true), Some(false), None], None, vec![0, 5, 1, 4, 2, 3], ); test_sort_to_indices_boolean_arrays( vec...
rust_cleaned_test_functions.jsonl/39269
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 497 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 18435, 46642, 368, 341, 286, 442, 2710, 198, 286, 1273, 18435, 2346, 18333, 46642, 68983, 1006, 310, 7486, 20703, 4064, 11, 4329, 3576, 701, 4329, 3715, 701, 4329, 3715, 701, 4329, 3576, 701, 2240...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_get_set_bit_roundtrip() { const NUM_BYTES: usize = 10; const NUM_SETS: usize = 10; let mut buffer: [u8; NUM_BYTES * 8] = [0; NUM_BYTES * 8]; let mut v = HashSet::new(); let mut rng = thread_rng(); for _ in 0..NUM_SETS { let offset = rn...
rust_cleaned_test_functions.jsonl/6787
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 303 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 3062, 2602, 13996, 29896, 32981, 368, 341, 286, 733, 15943, 40705, 25, 22301, 284, 220, 16, 15, 280, 286, 733, 15943, 8481, 50, 25, 22301, 284, 220, 16, 15, 401, 286, 1077, 5206, 4147, 25, 508...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_tx_log_order() { let GenesisConfigInfo { genesis_config, mint_keypair, .. } = create_genesis_config_with_leader( 1_000_000_000_000_000, &Pubkey::new_unique(), bootstrap_validator_stake_lamports(), ); ...
rust_cleaned_test_functions.jsonl/2678
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1352 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 17805, 5224, 7869, 368, 341, 286, 1077, 40788, 2648, 1731, 341, 310, 59366, 5332, 345, 310, 28337, 3097, 12670, 345, 310, 54538, 286, 335, 284, 1855, 16322, 13774, 5332, 6615, 79991, 1006, 310, 22...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_30() { assert_eq!( Solution::find_substring( "barfoothefoobarman".to_string(), vec!["foo".to_string(), "bar".to_string()] ), vec![0, 9] ); assert_eq!( Solution::find_substring( ...
rust_cleaned_test_functions.jsonl/33891
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 884 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 62, 18, 15, 368, 341, 286, 2060, 10714, 33673, 310, 12478, 486, 3903, 5228, 917, 1006, 394, 330, 2257, 7975, 339, 823, 78, 31393, 1515, 3263, 983, 3904, 3148, 394, 7486, 0, 1183, 7975, 3263, 9...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_depad() { let mut data = depad(&[1, 2, 3, 4, 5, 6, 7, 8]); assert_eq!(data, [1, 2, 3, 4, 5, 6, 7, 8]); data = depad(&[1, 2, 3, 4, 5, 6, 7, 1]); assert_eq!(data, [1, 2, 3, 4, 5, 6, 7]); data = depad(&[1, 2, 3, 4, 5, 6, 2, 2]); assert_eq!(data, [1,...
rust_cleaned_test_functions.jsonl/128378
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 358 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 2259, 13242, 368, 341, 286, 1077, 5206, 821, 284, 2170, 329, 2099, 58, 16, 11, 220, 17, 11, 220, 18, 11, 220, 19, 11, 220, 20, 11, 220, 21, 11, 220, 22, 11, 220, 23, 2558, 286, 2060, 107...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_diagonal_dominant() { let matrix = super::generate_diagonal_dominant(10, 0.005); test_symmetric(matrix); }
rust_cleaned_test_functions.jsonl/132506
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 71 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 29477, 23450, 814, 7970, 517, 368, 341, 286, 1077, 6172, 284, 2256, 486, 19366, 29477, 23450, 814, 7970, 517, 7, 16, 15, 11, 220, 15, 13, 15, 15, 20, 317, 286, 1273, 26825, 15903, 28127, 317, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_test_collector() { let specifier = resolve_url("file:///a/example.ts").unwrap(); let source = Arc::new( r#" Deno.test({ name: "test a", async fn(t) { await t.step("a step", ({ step }) => { await step({ name: "sub step", ...
rust_cleaned_test_functions.jsonl/47478
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1920 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 4452, 10211, 27669, 368, 341, 262, 1077, 97616, 284, 8830, 2903, 445, 1192, 60896, 64, 65182, 21288, 1827, 15454, 543, 262, 1077, 2530, 284, 19689, 486, 931, 1006, 414, 435, 2, 698, 414, 9774, 7...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_cast_utf8_to_date32() { use chrono::NaiveDate; let from_ymd = chrono::NaiveDate::from_ymd; let since = chrono::NaiveDate::signed_duration_since; let a = StringArray::from(vec![ "2000-01-01", // valid date with leading 0s "2000-2-2...
rust_cleaned_test_functions.jsonl/45440
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 701 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 5303, 39453, 23, 2346, 4164, 18, 17, 368, 341, 286, 990, 80372, 486, 16193, 533, 1916, 280, 286, 1077, 504, 62, 1600, 67, 284, 80372, 486, 16193, 533, 1916, 486, 1499, 62, 1600, 67, 280, 286, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_fq_legendre() { assert_eq!(QuadraticResidue, Fq::one().legendre()); assert_eq!(Zero, Fq::zero().legendre()); let e = BigInteger([ 0x0dbc5349cd5664da, 0x8ac5b6296e3ae29d, 0x127cb819feceaa3b, 0x3a6b21fb03867191, ]); assert_eq!(QuadraticResidue, ...
rust_cleaned_test_functions.jsonl/81830
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 321 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 761, 80, 76612, 265, 368, 341, 262, 2060, 10714, 10297, 2183, 88678, 1061, 60607, 11, 434, 80, 486, 603, 1005, 14505, 265, 1423, 262, 2060, 10714, 10297, 17999, 11, 434, 80, 486, 14154, 1005, 14...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_get_valid_block_valid_for_master() { let block = Some(Block::new(hex::decode(BLOCK).unwrap())); let state = Master::for_test().candidate_block(block.clone()).build(); let blockhash = SHA256Hash::from_slice(&hex::decode(HASH).unwrap()[..]).unwrap(); assert_eq!(*get...
rust_cleaned_test_functions.jsonl/75387
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 159 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 3062, 8337, 7113, 8337, 5478, 24582, 368, 341, 286, 1077, 2504, 284, 4329, 55243, 486, 931, 44660, 486, 18196, 5349, 8044, 568, 15454, 7392, 286, 1077, 1584, 284, 10824, 486, 1958, 4452, 1005, 462...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_parse_internal_key() { let s = &[254, 100, 101, 0, 1, 240, 84, 0, 0, 0, 0, 0]; let mut p = ParsedInternalKey::default(); parse_internal_key(s, &mut p); assert_eq!(p.user_key, &[254, 100, 101, 0]); assert_eq!(p.value_type, ValueType::TypeValue); ass...
rust_cleaned_test_functions.jsonl/124313
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 176 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21039, 23472, 3097, 368, 341, 286, 1077, 274, 284, 44590, 17, 20, 19, 11, 220, 16, 15, 15, 11, 220, 16, 15, 16, 11, 220, 15, 11, 220, 16, 11, 220, 17, 19, 15, 11, 220, 23, 19, 11, 220,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_before() { assert_eq!(before("[before 2]"), Ok(("", 2)),); assert_eq!( rule("&[before 2] a"), Ok(( "", Rule::SetContext { before: Some(2), sequence: "a".into(), } ...
rust_cleaned_test_functions.jsonl/21715
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 594 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 23708, 368, 341, 286, 2060, 10714, 10297, 14801, 10937, 14801, 220, 17, 60, 3975, 7622, 7, 19814, 220, 17, 5731, 626, 286, 2060, 10714, 33673, 310, 5912, 34866, 58, 14801, 220, 17, 60, 264, 4461...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_send_coord_sig_msg_not_acked() { let txid = Txid::from_str("fcb6ab963b654c773de786f4ac92c132b3d2e816ccea37af9592aa0b4aaec04b") .unwrap(); let ctx = secp256k1::Secp256k1::new(); let (_, public_key) = create_keys(&ctx, &[1; secp256k1::constants::...
rust_cleaned_test_functions.jsonl/92899
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1153 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 13565, 30096, 29252, 6483, 7913, 62, 11191, 368, 341, 286, 1077, 9854, 307, 4035, 310, 39850, 307, 486, 1499, 2895, 445, 69, 7221, 21, 370, 24, 21, 18, 65, 21, 20, 19, 66, 22, 22, 18, 450, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_from_id() { let vendor = Vendor::from_id(0x14c3).unwrap(); assert_eq!(vendor.name(), "MEDIATEK Corp."); assert_eq!(vendor.id(), 0x14c3); }
rust_cleaned_test_functions.jsonl/27528
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 100 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 5673, 842, 368, 341, 286, 1077, 20728, 284, 45136, 486, 1499, 842, 7, 15, 87, 16, 19, 66, 18, 568, 15454, 1428, 286, 2060, 10714, 10297, 19213, 2644, 1507, 330, 44, 48353, 21863, 7320, 286, 20...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_hget_hset() { if let Ok(mut conn) = connection::get_connection(None) { let key = "redis_hash_test_key"; let field = "field"; let value = 5; self::hset(&mut conn, key, field, value).expect("Error h-setting value"); let result: i3...
rust_cleaned_test_functions.jsonl/111547
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 269 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 1523, 455, 1523, 746, 368, 341, 286, 421, 1077, 7622, 70305, 4534, 8, 284, 3633, 486, 455, 15866, 26717, 8, 341, 310, 1077, 1376, 284, 330, 21748, 8950, 4452, 3097, 876, 310, 1077, 2070, 284, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_basic_erroring_closure() { // > // // B for code in 1..i8::MAX { let result = unsafe { run_in_pty(move || Err(code.into())) }; assert_exit_code(code.into(), result); }
rust_cleaned_test_functions.jsonl/20649
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 148 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 34729, 4096, 287, 72823, 368, 341, 16885, 1797, 442, 861, 257, 6475, 414, 442, 425, 257, 369, 2038, 304, 220, 16, 496, 72, 23, 486, 10586, 341, 310, 1077, 1102, 284, 19860, 314, 1598, 1243, 62...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
2
#[test] fn test_static_str() { assert_eq!(Body::from("").size(), BodySize::Sized(0)); assert_eq!(Body::from("test").size(), BodySize::Sized(4)); assert_eq!(Body::from("test").get_ref(), b"test"); assert_eq!("test".size(), BodySize::Sized(4)); assert_eq!( bloc...
rust_cleaned_test_functions.jsonl/82685
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 215 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 25360, 2895, 368, 341, 286, 2060, 10714, 10297, 5444, 486, 1499, 80821, 2141, 1507, 13958, 1695, 486, 50, 1506, 7, 15, 1106, 286, 2060, 10714, 10297, 5444, 486, 1499, 445, 1944, 1827, 2141, 1507, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_serialize() { let mut buf = (&[]) .into_serializer() .encapsulate(UdpPacketBuilder::new( TEST_SRC_IPV4, TEST_DST_IPV4, NonZeroU16::new(1), NonZeroU16::new(2).unwrap(), )) .seri...
rust_cleaned_test_functions.jsonl/112488
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 442 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 88686, 368, 341, 286, 1077, 5206, 6607, 284, 15899, 24377, 310, 659, 18122, 67441, 741, 310, 659, 954, 2625, 6334, 12317, 9796, 16679, 3297, 486, 931, 1006, 394, 13602, 29409, 58830, 19, 345, 394,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_response_message() { let payload = vec![ 0x00, 0x00, 0x00, 0x02, 0x72, 0xea, 0x1d, 0x6a, 0x11, 0x63, 0x88, 0x88, 0x01, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x14, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x00, 0x24, 0x00, 0x04, 0xd7, 0x1a, 0x06, 0x00, ...
rust_cleaned_test_functions.jsonl/81446
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1355 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 9655, 6462, 741, 515, 10217, 7729, 284, 7486, 90515, 197, 197, 15, 87, 15, 15, 11, 220, 15, 87, 15, 15, 11, 715, 197, 197, 15, 87, 15, 15, 11, 715, 197, 197, 15, 87, 15, 17, 11, 715, 1...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_mutable_write() { let mut buf = MutableBuffer::new(100); buf.write("hello".as_bytes()).expect("Ok"); assert_eq!(5, buf.len()); assert_eq!("hello".as_bytes(), buf.data()); buf.write(" world".as_bytes()).expect("Ok"); assert_eq!(11, buf.len()); ...
rust_cleaned_test_functions.jsonl/20573
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 277 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 717, 5922, 9165, 368, 341, 286, 1077, 5206, 6607, 284, 31143, 4095, 486, 931, 7, 16, 15, 15, 317, 286, 6607, 3836, 445, 14990, 3263, 300, 12524, 6011, 17119, 445, 11578, 797, 286, 2060, 10714, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_negative() { assert_eq!( PositiveNonzeroInteger::from_str("-555"), Err(ParsePosNonzeroError::Creation(CreationError::Negative)) ); }
rust_cleaned_test_functions.jsonl/7748
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 101 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 53865, 368, 341, 286, 2060, 10714, 33673, 310, 43903, 8121, 14154, 3486, 486, 1499, 2895, 13645, 20, 20, 20, 4461, 310, 15495, 71812, 4859, 8121, 14154, 1454, 486, 32701, 3025, 26453, 1454, 486, 3...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_expire_one() { let mut cache = Cache::with_capacity(100); let key1 = Key::Rid(RID(1)); let key2 = Key::Rid(RID(2)); let dbs = Box::new(DivBufShared::from(vec![0u8; 53])); cache.insert(key1, dbs); let dbs = Box::new(DivBufShared::from(vec![0u8; 57])); cache.insert(key2...
rust_cleaned_test_functions.jsonl/90039
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 201 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 83409, 11667, 368, 341, 262, 1077, 5206, 6500, 284, 19479, 486, 4197, 35603, 7, 16, 15, 15, 317, 262, 1077, 1376, 16, 284, 5309, 486, 49, 307, 2785, 915, 7, 16, 1106, 262, 1077, 1376, 17, 28...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_array_scalar_comparison() { use std::sync::Arc; use super::*; #[allow(dead_code)] struct ArrayTest { name: &'static str, array: DataArrayRef, scalar: DataValue, expect: DataArrayRef, error: &'static str, op: DataValueComparisonOpe...
rust_cleaned_test_functions.jsonl/78654
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1458 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 3858, 41652, 90797, 368, 341, 262, 990, 1460, 486, 12996, 486, 36809, 401, 262, 990, 2256, 79304, 262, 11506, 7183, 83207, 4136, 5563, 262, 2036, 2910, 2271, 341, 286, 829, 25, 30136, 1978, 607, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_fn_signature_with_docs_simple() { check( r#" /// test // non-doc-comment fn foo(j: u32) -> u32 { j } fn bar() { let _ = foo($0); } "#, expect![[r#" test ------ fn foo(j: u32) -> u32 (<j: u32>) "#]], ); }
rust_cleaned_test_functions.jsonl/75014
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 195 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 15246, 39859, 6615, 49692, 30015, 368, 341, 262, 1779, 1006, 286, 435, 2, 698, 2575, 1273, 198, 322, 2477, 11527, 45666, 198, 8822, 15229, 3325, 25, 575, 18, 17, 8, 1464, 575, 18, 17, 341, 262...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_reg() { let r = ControlRegister4 { output_data_rate: DataRate::Rate_6_25Hz, z_axis_enabled: true }; let b = r.pack(); assert_eq!([0b00010010], b); }
rust_cleaned_test_functions.jsonl/10794
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 101 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 4920, 368, 341, 262, 1077, 435, 284, 7779, 8690, 19, 341, 286, 2550, 1769, 9246, 25, 2885, 11564, 486, 11564, 62, 21, 62, 17, 20, 11475, 345, 286, 1147, 23567, 18220, 25, 830, 198, 262, 3634, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_miller_loop() { use fields::Fq6; let g1 = G1::one() * Fr::from_str( "18097487326282793650237947474982649264364522469319914492172746413872781676", ) .unwrap(); let g2 = G2::one() * Fr::from_str( "20390255904278144451778773028944...
rust_cleaned_test_functions.jsonl/6620
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1054 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 717, 15252, 17198, 368, 341, 262, 990, 5043, 486, 37, 80, 21, 401, 262, 1077, 342, 16, 284, 479, 16, 486, 603, 741, 286, 353, 2869, 486, 1499, 2895, 1006, 310, 330, 16, 23, 15, 24, 22, 19,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_parse() { let a = WireGuard::try_from(TEXT).unwrap(); println!("{:?}", a); assert!(a.interfaces.len() == 3); assert!(a.interfaces["wg0"].len() == 6); let e1 = match &a.interfaces["wg0"][1] { Endpoint::Local(_) => panic!(), Endpoint...
rust_cleaned_test_functions.jsonl/13451
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 358 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21039, 368, 341, 286, 1077, 264, 284, 19378, 20806, 486, 1539, 5673, 46356, 568, 15454, 543, 286, 13751, 88928, 25, 52652, 264, 317, 286, 2060, 10297, 64, 34459, 19406, 368, 621, 220, 18, 317, 2...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_package() { let output = cargo_hack() .args(&["hack", "check", "--package", "member1"]) .current_dir(test_dir("tests/fixtures/virtual")) .output() .unwrap(); output .assert_success() .assert_stderr_contains("running `cargo check` on member...
rust_cleaned_test_functions.jsonl/25297
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 179 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 26328, 368, 341, 262, 1077, 2550, 284, 25652, 1523, 473, 741, 286, 659, 2116, 2099, 1183, 65972, 497, 330, 2028, 497, 14482, 1722, 497, 330, 9597, 16, 14108, 286, 659, 3231, 4334, 8623, 4334, 44...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_negated_boolean_precedence() { let scenario = TestScenario::new(util_name!()); let tests = [ vec!["!", "(", "foo", ")", "-o", "bar"], vec!["!", "", "-o", "", "-a", ""], vec!["!", "(", "", "-a", "", ")", "-o", ""], ]; for test in &tests { scenario...
rust_cleaned_test_functions.jsonl/11029
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 329 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 28209, 657, 46642, 10442, 1998, 763, 368, 341, 262, 1077, 15048, 284, 3393, 54031, 486, 931, 67811, 1269, 0, 5231, 262, 1077, 7032, 284, 2278, 286, 7486, 0, 1183, 18789, 330, 12918, 330, 7975, 4...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
3
#[test] fn test_get_txn_commit_info_of_pessimistic_txn() { let path = tempfile::Builder::new() .prefix("_test_storage_mvcc_reader_get_txn_commit_info_of_pessimistic_txn") .tempdir() .unwrap(); let path = path.path().to_str().unwrap(); let region = make...
rust_cleaned_test_functions.jsonl/14867
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 688 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 3062, 92299, 36346, 3109, 3575, 620, 66733, 4532, 92299, 368, 341, 286, 1077, 1815, 284, 54819, 486, 3297, 486, 931, 741, 310, 659, 11849, 16975, 1944, 23310, 73187, 638, 22306, 3062, 92299, 36346, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_scan_non_existent_table() -> Result<(), Box<dyn std::error::Error>> { let mut c = setup()?; let cmd = c.args(&[ "--region", "local", "--table", "dummy-table-doent-exist", "scan", ]); cmd.assert().failure().stderr(predicate::str::contains( ...
rust_cleaned_test_functions.jsonl/37972
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 189 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 28857, 21637, 2702, 18128, 5237, 368, 1464, 5714, 68843, 8261, 92846, 1460, 486, 841, 486, 1454, 2452, 341, 262, 1077, 5206, 272, 284, 6505, 94136, 262, 1077, 5439, 284, 272, 16365, 2099, 9640, 28...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_get_proof_after() { let mut rng = CustomRng; let mut tree = MerkleTree::new(create(3), POOL_PARAMS.clone()); let tree_size = 6; let new_hashes_size = 3; for index in 0..tree_size { let leaf = rng.gen(); tree.add_hash(index, leaf, ...
rust_cleaned_test_functions.jsonl/23758
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 306 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 3062, 86757, 19844, 368, 341, 286, 1077, 5206, 28422, 284, 8406, 49, 968, 280, 286, 1077, 5206, 4916, 284, 8755, 23089, 6533, 486, 931, 32602, 7, 18, 701, 12932, 1930, 37488, 15997, 5231, 286, 1...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_match_body_not_matching() { let _m = mock("POST", "/").match_body("hello").create(); let (status, _, _) = request_with_body("POST /", "", "bye"); assert_eq!("HTTP/1.1 501 Mock Not Found\r\n", status); }
rust_cleaned_test_functions.jsonl/82384
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 100 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 10708, 14114, 7913, 70763, 368, 341, 262, 1077, 716, 76, 284, 7860, 445, 2946, 497, 3521, 1827, 6347, 14114, 445, 14990, 1827, 3182, 1428, 262, 1077, 320, 2829, 11, 8358, 27439, 284, 1681, 6615, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_type() { assert_eq!( rsass( "a {b: selector-parse(\"c\")}\ \n" ) .unwrap(), "a {\ \n b: c;\ \n}\ \n" ); }
rust_cleaned_test_functions.jsonl/60096
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 218 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 1819, 368, 341, 310, 2060, 10714, 33673, 394, 10036, 395, 1006, 503, 330, 64, 314, 65, 25, 9367, 85382, 36014, 66, 62705, 92, 5661, 310, 1124, 77, 698, 394, 1727, 394, 659, 15454, 3148, 394, 3...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_loading() { let ipsets = LookupSets::new("blocklist-ipsets/**/*.*set"); let ip: Ipv4Addr = "8.8.8.8".parse().expect("Invalid IP"); let categories: Vec<&NetSetFeed> = ipsets.lookup_by_ip(ip); assert!(!categories.is_empty(), "no results for a lookup"); }
rust_cleaned_test_functions.jsonl/116391
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 131 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 57726, 368, 341, 262, 1077, 5997, 4917, 284, 50311, 30175, 486, 931, 445, 4574, 1607, 74732, 4917, 3663, 1057, 4908, 746, 797, 262, 1077, 5997, 25, 358, 30168, 19, 13986, 284, 330, 23, 13, 23, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_validate_origin() { let cors = Cors::build() .allowed_origin("https://www.example.com") .finish(); let req = TestRequest::with_header("Origin", "https://www.example.com") .method(Method::GET) .finish(); assert!(cors.start(...
rust_cleaned_test_functions.jsonl/90070
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 171 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 42681, 34043, 368, 341, 286, 1077, 43911, 284, 52518, 486, 5834, 741, 310, 659, 20967, 34043, 445, 2428, 1110, 2136, 7724, 905, 1138, 310, 659, 30150, 1428, 286, 1077, 4232, 284, 3393, 1900, 486, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_pop_g1() { for vec in get_dflt_vecs("pop_g1").unwrap() { test_pop::<G1>(vec.unwrap(), 48).unwrap(); } }
rust_cleaned_test_functions.jsonl/48359
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 77 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 17061, 1889, 16, 368, 341, 262, 369, 7486, 304, 633, 814, 79209, 13251, 82, 445, 8374, 1889, 16, 1827, 15454, 368, 341, 286, 1273, 17061, 27638, 38, 16, 2235, 4083, 55395, 1507, 220, 19, 23, 5...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
2
#[test] fn test_supplies_money_left() { let mut supplies = Supplies::new(); supplies.buy_oxen(200).unwrap(); assert_eq!(500, supplies.money_left()); }
rust_cleaned_test_functions.jsonl/28649
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 85 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 23723, 7202, 34065, 9579, 368, 341, 286, 1077, 5206, 16720, 284, 50252, 486, 931, 543, 286, 16720, 63871, 62, 5131, 268, 7, 17, 15, 15, 568, 15454, 543, 286, 2060, 10714, 10297, 20, 15, 15, 11...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_token_bucket_create() { let before = Instant::now(); let tb = TokenBucket::new(1000, 0, 1000).unwrap(); assert_eq!(tb.capacity(), 1000); assert_eq!(tb.budget(), 1000); assert!(*tb.get_last_update() >= before); let after = Instant::now(); as...
rust_cleaned_test_functions.jsonl/15883
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 329 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6458, 38749, 8657, 368, 341, 286, 1077, 1573, 284, 18058, 486, 3328, 543, 286, 1077, 16363, 284, 9660, 36018, 486, 931, 7, 16, 15, 15, 15, 11, 220, 15, 11, 220, 16, 15, 15, 15, 568, 15454, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_eval_context() { // It's nice if an operation and its arguments can fit on a single // line in the test program. use self::AssemblerEntry::*; use crate::constants::*; // Test `frame_base` and `call_frame_cfa` callbacks. #[rustfmt::skip] le...
rust_cleaned_test_functions.jsonl/45771
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 2252 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 21296, 8467, 368, 341, 286, 442, 1084, 594, 6419, 421, 458, 5666, 323, 1181, 5977, 646, 4946, 389, 264, 3175, 198, 286, 442, 1555, 304, 279, 1273, 2025, 624, 286, 990, 656, 486, 77858, 5874, 5...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
6
#[test] fn test_logcosh_alpha_err() { let input = Dataset::from(Array::random((4, 4), Uniform::new(0.0, 1.0))); let ica = FastIca::new().gfunc(GFunc::Logcosh(10.)); let ica = ica.fit(&input); assert!(ica.is_err()); }
rust_cleaned_test_functions.jsonl/84829
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 133 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 5224, 66, 9267, 26633, 9266, 368, 341, 286, 1077, 1946, 284, 39183, 486, 1499, 38192, 486, 11463, 1188, 19, 11, 220, 19, 701, 47889, 486, 931, 7, 15, 13, 15, 11, 220, 16, 13, 15, 4945, 286, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_cost_tracker_try_add_is_atomic() { let (mint_keypair, start_hash) = test_setup(); let (tx, _keys, _cost) = build_simple_transaction(&mint_keypair, &start_hash); let tx = SanitizedTransaction::from_transaction_for_tests(tx); let acct1 = Pubkey::new_unique(); ...
rust_cleaned_test_functions.jsonl/21957
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 1323 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 15890, 50264, 53283, 2891, 6892, 51367, 368, 341, 286, 1077, 320, 67791, 3097, 12670, 11, 1191, 8950, 8, 284, 1273, 21363, 543, 286, 1077, 320, 3998, 11, 716, 10563, 11, 716, 16440, 8, 284, 1936...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_post_response_default() { let response = PostResponse { status: "".into(), translated: "".into(), source_text: "".into(), source_lang: "".into(), target_lang: "".into(), }; assert_eq!( response, ...
rust_cleaned_test_functions.jsonl/133996
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 230 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6333, 9655, 9993, 368, 341, 286, 1077, 2033, 284, 3877, 2582, 341, 310, 2639, 25, 44907, 18122, 3148, 310, 24531, 25, 44907, 18122, 3148, 310, 2530, 4326, 25, 44907, 18122, 3148, 310, 2530, 17876,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_bank_inflation() { let key = Pubkey::default(); let bank = Arc::new(Bank::new(&GenesisConfig { accounts: (0..42) .into_iter() .map(|_| (Pubkey::new_rand(), Account::new(42, 0, &key))) .collect(), ..GenesisCon...
rust_cleaned_test_functions.jsonl/42369
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 546 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 35733, 1243, 64149, 368, 341, 286, 1077, 1376, 284, 22611, 792, 486, 2258, 543, 286, 1077, 6073, 284, 19689, 486, 931, 5349, 1180, 486, 931, 2099, 84652, 2648, 341, 310, 9618, 25, 320, 15, 496, ...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_metadata_from_cargo_toml() { let readme = indoc!( r#" # Some test package This is the readme for a test package "# ); let cargo_toml = indoc!( r#" [package] authors = ["konstin <konstin@mail...
rust_cleaned_test_functions.jsonl/77312
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 982 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 22220, 5673, 666, 12088, 528, 316, 75, 368, 341, 286, 1077, 83684, 284, 1257, 509, 33673, 310, 435, 2, 698, 310, 671, 4329, 1273, 6328, 271, 310, 1096, 374, 279, 83684, 369, 264, 1273, 6328, 1...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2
#[test] fn test_pushenv() { setup(); let e1 = std::env::var_os(VAR); { let _e = pushenv(VAR, "1"); let e2 = std::env::var_os(VAR); assert_eq!(e2, Some("1".into())); { let _e = pushenv(VAR, "2"); let e3 = std::env::var_os(VAR); asse...
rust_cleaned_test_functions.jsonl/52769
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 299 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 14218, 3160, 368, 341, 262, 6505, 1428, 262, 1077, 384, 16, 284, 1460, 486, 3160, 486, 947, 29387, 12410, 934, 317, 262, 341, 286, 1077, 716, 68, 284, 4484, 3160, 12410, 934, 11, 330, 16, 797,...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_optimize_switch_1() { test("switch(a){}", ""); test("switch(foo()){}", "foo()"); test("switch(a){default:}", ""); test("switch(a){default:break;}", ""); test("switch(a){default:var b;break;}", "var b"); test("switch(a){case 1: default:}", ""); test("switch(a){default:...
rust_cleaned_test_functions.jsonl/389
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 850 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 15032, 11853, 27652, 62, 16, 368, 341, 262, 1273, 445, 17338, 2877, 6098, 9545, 14498, 262, 1273, 445, 17338, 71880, 2140, 42351, 330, 7975, 45961, 262, 1273, 445, 17338, 2877, 6098, 2258, 25, 954...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_value_doc_headline_invalid() { let src = " // Package foo does a thing. package foo // A is a constant. a = 1 "; let loc = Locator::new(&src[..]); assert_docs_full( src, PackageDoc { path: "p...
rust_cleaned_test_functions.jsonl/9986
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 784 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 3142, 18869, 13138, 1056, 31433, 368, 341, 286, 1077, 2286, 284, 6228, 286, 442, 16906, 15229, 1558, 264, 3166, 624, 286, 6328, 15229, 271, 286, 442, 362, 374, 264, 6783, 624, 286, 264, 284, 220...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_sighashes_with_annex_and_script() { test_taproot_sighash( "020000000132fb72cb8fba496755f027a9743e2d698c831fdb8304e4d1a346ac92cbf51acba50100000026bdc7df044aad34000000000017a9144fa2554ed6174586854fa3bc01de58dcf33567d0875802000000000000160014950367e1e62cdf240b35b883fc2f5e39f0eb9...
rust_cleaned_test_functions.jsonl/115161
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 930 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 643, 1090, 14051, 6615, 51870, 327, 8378, 14660, 368, 341, 286, 1273, 528, 391, 2888, 643, 1090, 988, 1006, 310, 330, 15, 17, 15, 15, 15, 15, 15, 15, 15, 16, 18, 17, 10798, 22, 17, 7221, 2...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_bwt() { let text = b"gccttaacattattacgccta\0"; let pos = vec![ 21, 20, 5, 6, 14, 11, 8, 7, 17, 1, 15, 18, 2, 16, 0, 19, 4, 13, 10, 3, 12, 9, ]; let bwt_correct = b"attattcaggaccc\0ctttcaa"; assert_eq!(bwt(text, &pos), bwt_correct); }
rust_cleaned_test_functions.jsonl/51324
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 183 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 880, 9306, 368, 341, 286, 1077, 1467, 284, 293, 1, 20669, 302, 2565, 580, 1587, 1587, 580, 20669, 77519, 59, 15, 876, 286, 1077, 1133, 284, 7486, 90515, 310, 220, 17, 16, 11, 220, 17, 15, 11...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_method_lex() { let j_method = "public final static void main(String[] args) {"; let tokens = lex_contents(&j_method.to_string()); assert_eq!(Token::LineNumber(String::from("1")), tokens[0]); assert_eq!(Token::Keyword(String::from("public")), tokens[1]); assert_eq!(Token::Ke...
rust_cleaned_test_functions.jsonl/62779
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 325 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 9032, 74547, 368, 341, 262, 1077, 502, 9032, 284, 330, 888, 1590, 1099, 737, 1887, 2242, 1294, 2827, 8, 314, 3302, 262, 1077, 11211, 284, 22429, 16682, 2099, 73, 9032, 2389, 3904, 5231, 262, 206...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_is_supported() { assert!(!is_supported(Path::new("tests/subdir/redirects"))); assert!(!is_supported(Path::new("README.md"))); assert!(is_supported(Path::new("lib/typescript.d.ts"))); assert!(is_supported(Path::new("cli/tests/001_hello.js"))); assert!(is_supported(Path::new("cli/tests/0...
rust_cleaned_test_functions.jsonl/99222
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 175 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 6892, 57885, 368, 341, 220, 2060, 0, 3471, 285, 57885, 33030, 486, 931, 445, 23841, 37885, 3741, 14, 8117, 82, 17621, 220, 2060, 0, 3471, 285, 57885, 33030, 486, 931, 445, 54675, 21324, 17621, 2...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
1
#[test] fn test_a_dbl_and_add_1() { let p = a_dbl_and_add((a(), b()), ASc::from_literal(1), paxy()); assert_eq!(p,paxy()); }
rust_cleaned_test_functions.jsonl/11560
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 76 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 4306, 814, 2024, 8378, 2891, 62, 16, 368, 341, 262, 1077, 281, 284, 264, 814, 2024, 8378, 2891, 1188, 64, 1507, 293, 11858, 362, 3326, 486, 1499, 34100, 7, 16, 701, 281, 13773, 1423, 262, 2060...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
1
#[test] fn test_nvidia_card_pci_hotplug() { let hirsute = UbuntuDiskConfig::new(HIRSUTE_NVIDIA_IMAGE_NAME.to_string()); let guest = Guest::new(Box::new(hirsute)); let api_socket = temp_api_path(&guest.tmp_dir); let mut child = GuestCommand::new(&guest) .args(&["--cpu...
rust_cleaned_test_functions.jsonl/26194
{ "file_path": "/home/dung/Code/Cross_test_gen (Copy)/clean_data_rust/data/rust_cleaned_test_functions.jsonl", "token_count": 756 }
[ 262, 11506, 1944, 921, 262, 5168, 1273, 1089, 40098, 16888, 76384, 33433, 47474, 368, 341, 286, 1077, 305, 16838, 1070, 284, 34960, 47583, 2648, 486, 931, 10896, 89964, 11447, 1604, 29352, 19121, 4708, 2389, 3904, 1423, 286, 1077, 8640, 2...
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1...
2