text stringlengths 0 7.84M | meta dict |
|---|---|
The capsule was hoisted out of the water and placed on the deck of a recovery boat shortly before 10 a.m.
The mission comes at a precarious time for brash billionaire Elon Musk, SpaceX’s founder and CEO, who has come under fire for his sometimes erratic behavior.
AD
AD
The reentry is one of the biggest tests of the Dragon and of SpaceX, the company founded by Musk in 2002 with the ultimate goal of flying humans to Earth’s orbit and beyond. If deemed a complete success, the mission would give NASA increased confidence in one of its prime contractors and propel the space agency a step closer to restoring human spaceflight from U.S. soil.
Since the space shuttle was retired in 2011, NASA has been unable to fly its astronauts. Instead, it has paid Russia for rides to the space station at an increasing price tag that now tops $80 million.
In 2014, NASA awarded contracts worth a combined $6.8 billion to SpaceX and Boeing to build spacecrafts capable of carrying NASA’s astronauts to the orbiting laboratory 250 miles above Earth. Since then, both companies have faced delays and setbacks. But now, SpaceX has taken a major leap forward and is poised to fly its first test mission with two NASA astronauts on board later this year.
Boeing is scheduled to fly its first uncrewed mission to the station by next month at the earliest, though that date is likely to slip, officials have said.
AD
AD
SpaceX’s uncrewed mission began early Saturday, when its Falcon 9 rocket blasted off in the predawn darkness from a historic launchpad at the Kennedy Space Center in Florida, where the crew of Apollo 11 began their journey to the lunar surface.
Once aloft, the SpaceX craft traveled to the space station, whizzing around Earth at 17,500 mph, catching up early the next morning. Before the mission, NASA officials had said the spacecraft’s ability to dock autonomously to the station would be one of the biggest tests of the vehicle.
Russia, one of NASA’s key partners on the space station, initially objected, citing concerns with SpaceX’s computer systems that would fly the vehicle toward the station.
AD
But like the launch, the docking was a success, and soon the three astronauts on board the station — NASA’s Anne McClain, Oleg Kononenko of Russia, and Canada’s David Saint-Jacques — were able to check out the first commercial space vehicle designed for human space flight ever to dock with the station.
AD
In a call with the astronauts on board the station Wednesday, Vice President Pence said, “It was inspiring to see the launch, and it was actually more inspiring to see the docking, and to see you all open that door and float into that spacecraft knowing that we’ll very soon have American astronauts arriving at the International Space Station in the same vehicle.”
The successful landing is a coup for SpaceX and a relief for Musk, who said he wouldn’t be able to relax until the spacecraft had landed safely.
Musk and his companies have been under scrutiny lately. The Securities and Exchange Commission fined him $20 million last year after it said he misled investors of his electric car company, Tesla, when he tweeted that he would take the company private. More recently, the SEC claimed he violated the terms of the settlement, which require an attorney to review tweets that could affect Tesla’s stock price.
AD
AD
A judge in that case gave Musk until Monday to say why he should not be held in contempt for violating the terms of the settlement.
Musk has also faced trouble at SpaceX. The Air Force recently announced it was reviewing the certifications it had granted SpaceX that allow to launch national security payloads. After Musk smoked marijuana during a podcast appearance, NASA announced it was conducting a safety review of SpaceX and Boeing. And Bloomberg News reported Thursday that Musk’s marijuana use also prompted the Pentagon to review his security clearance.
Despite the distractions, Friday’s landing appeared to be another triumph for SpaceX, and validation of years of work.
AD
Leading up to the reentry, Musk had said he was worried about whether the spacecraft would end up in an uncontrollable spin.
AD
The Dragon is outfitted with abort thrusters that make the spacecraft asymmetrical, which he said “could potentially cause a roll.” But he said he thought it was “unlikely” since the company had run “simulations a thousand times.”
Still, he added “hypersonic reentry is probably my biggest concern." | {
"pile_set_name": "OpenWebText2"
} |
G20: SPD-Innensenator droht Demonstrant*innen mit Schusswaffengebrauch Im Vorfeld der Anti-G20-Proteste werden die Einschüchterungen gegen Demonstrant*innen immer stärker. Innensenator Andy Grote (SPD) drohte nun, dass Blockierer*innen damit zu rechnen hätten, vom Secret Service des US-Präsidenten erschossen zu werden.
Der SPD-geführte Hamburger Senat bereitet sich auf harte Repression gegen die Gipfelgegner*innen vor, die zum Protest gegen den G20-Gipfel in der Hafenstadt Anfang Juli anreisen werden. Nachdem in den vergangenen Monaten zwischenzeitlich von Demonstrationsverboten die Rede war, hat SPD-Innensenator Andy Grote am Dienstag noch schwerere Geschütze aufgefahren.
„Sollte es zu einer erfolgreichen Blockade kommen, würden sich die Teilnehmer beim Aufeinandertreffen mit der Kolonne in Gefahr bringen“, so Grote. Damit kündigt er zwei Dinge an: Zum einen würde der Personenschutz des US-Präsidenten Donald Trump, der Secret Service, den Stillstand von Trumps Fahrzeugkolonne als Ernstfall auffassen. Laut Informationen der Hamburger Morgenpost erteilt das BKA den Sicherheitskräften eine Waffentrageerlaubnis, sodass im “worst case” mit Schusswaffengebrauch zu rechnen ist.
Grote meint zum anderen aber auch, dass deshalb der Einsatz von Polizeikräften gegen Blockierer*innen geradezu ein Glücksfall für letztere sei: „Mit der Freihaltung der Protokollstrecken schützt die Polizei auch die Teilnehmer möglicher Blockade-Aktionen.“ Demonstrant*innen dürfen sich also freuen, wenn sie „nur“ von Polizeiknüppeln und Pfefferspray bearbeitet werden, anstelle davon, für die Teilnahme an Protesten gleich erschossen zu werden.
Emily Laquer, Sprecherin der Anti-G20-Großdemonstration am 8. Juli, reagierte entsprechend entrüstet: „Wir fordern Grote auf, Trump auszuladen, wenn er sein Personal als Gefahr für die Bevölkerung einstuft, anstatt unsere Sicherheit zu riskieren oder das Grundrecht auf Versammlungsfreiheit anzugreifen.“
Zwei Monate vor den Gipfelprotesten schiebt die SPD schon jetzt jegliche Schuld an staatlicher Gewalt gegen Demonstrant*innen auf die Blockierer*innen selbst. Laut dieser skandalösen Demagogie hat man jegliche Rechte verwirkt und darf nur noch zwischen Knüppel und Kugel wählen, wenn man sich zum Protest gegen Trump und Co. entschließt.
Damit offenbart die Sozialdemokratie nur noch einmal mehr ihre völlige Verfaultheit. Sie schürt mit diesem Diskurs Angst und Schrecken und wäscht gleichzeitig ihre Hände rein. | {
"pile_set_name": "OpenWebText2"
} |
f - 1. Let b(s) = -2*j(s) + 7*z(s). What is the second derivative of b(w) wrt w?
200
What is the second derivative of -3 - 1 + 7*a**3 + 4*a**3 + 59*a + 4 - 3*a**2 wrt a?
66*a - 6
Let t(g) = -2912*g**3 + 6*g**2 - 20*g - 9. Let d(n) = 728*n**3 - 2*n**2 + 5*n + 2. Let f(i) = -9*d(i) - 2*t(i). What is the third derivative of f(r) wrt r?
-4368
Let u(c) be the third derivative of c**7/210 + 41*c**5/30 + 13*c**4/6 + c**3/6 - 173*c**2. Find the second derivative of u(w) wrt w.
12*w**2 + 164
Let g(k) be the second derivative of 5*k**8/56 - 11*k**6/15 - k**4/12 - 9*k**2/2 - k. Find the third derivative of g(l) wrt l.
600*l**3 - 528*l
Let h be (18/(-10))/(27/(-180)). Differentiate -3 - h*c**3 + 2 + 0*c + 0*c with respect to c.
-36*c**2
Find the second derivative of -2 + 2 + 2*o**3 - 28*o**4 + 30*o**4 + 20*o + 4*o wrt o.
24*o**2 + 12*o
Let w be 20*3/(4 - 1). Suppose -p + 6*p - 5*o + w = 0, 8 = -5*p + 2*o. What is the third derivative of -4*x**2 + 2*x**5 + 3*x**3 + p*x**3 - 3*x**3 wrt x?
120*x**2
Let g(p) be the second derivative of 109*p**8/8 - 167*p**4/12 - p**3/2 - 2*p + 22. Find the third derivative of g(c) wrt c.
91560*c**3
Let p(r) be the second derivative of 47*r**4/12 + 29*r**3 - 14*r. What is the second derivative of p(c) wrt c?
94
Let h(i) be the second derivative of 17*i**5/4 + 183*i**2 + 6*i + 25. Find the first derivative of h(t) wrt t.
255*t**2
What is the derivative of -64*q**2 - 44*q**2 - 1497 + 1567 wrt q?
-216*q
Let c(z) = z**3 + z**2 + 2*z. Let i(v) = 2*v**4 + 5*v**3 + 5*v**2 + 172*v - 262. Let f(l) = -5*c(l) + i(l). Differentiate f(y) with respect to y.
8*y**3 + 162
Let r(x) = 5*x + 2*x**2 - 12 - 13*x + 6*x + 6*x. Let j(t) = 9*t**2 + 15*t - 48. Let c(l) = 4*j(l) - 15*r(l). What is the derivative of c(z) wrt z?
12*z
Let y = -1003 + 1005. Let u(c) be the second derivative of 8*c + 2/3*c**4 + 0 + 0*c**y - 3/2*c**3. What is the second derivative of u(j) wrt j?
16
Let u = 327 + -321. Let l(h) be the first derivative of u*h + 1/2*h**2 + 1. What is the derivative of l(n) wrt n?
1
Let d(h) = -46*h - 205. Let o(m) = 46*m + 204. Let z(u) = -2*d(u) - 3*o(u). Differentiate z(x) wrt x.
-46
Suppose 2*k = k + 4*q + 39, -2*q = -2*k + 66. What is the second derivative of 16*y + 10*y**3 + 7*y**3 - k*y**3 wrt y?
-84*y
What is the derivative of -44*u - u**3 - 31*u + 132 - 25*u wrt u?
-3*u**2 - 100
Let w(l) = -6*l + 51. Let z be w(8). What is the third derivative of -73*m**3 - 2*m**4 + 73*m**z - 26*m**2 wrt m?
-48*m
Suppose -21*b + 10*b + 44 = 0. Find the third derivative of -4*l**4 - 6*l**4 + b*l**4 + 19*l**2 wrt l.
-144*l
Let c(n) = 23 + 2*n - 48 + 26. Let f be c(3). Find the first derivative of 12 + 2*k - f - 2*k + 7*k**2 wrt k.
14*k
Let w(h) be the first derivative of -179*h**3/3 + 205*h + 187. Differentiate w(v) with respect to v.
-358*v
Let v be (-4)/12*-6*1. Differentiate 17 + 6*w**2 - 18 + w**v - w**2 with respect to w.
12*w
Let g(d) be the first derivative of 2*d**6/5 - 4*d**2 - 7*d + 1. Let k(b) be the first derivative of g(b). Differentiate k(m) wrt m.
48*m**3
Let k(c) be the first derivative of -995*c**3/3 - 3*c**2/2 + 2. What is the second derivative of k(a) wrt a?
-1990
Let j(y) be the second derivative of 64*y**7/21 - 53*y**3/6 - 2*y**2 - 2*y + 23. Find the second derivative of j(r) wrt r.
2560*r**3
Let o(q) be the second derivative of 61*q**7/42 + 25*q**4/4 - q + 45. Find the third derivative of o(y) wrt y.
3660*y**2
Let f(d) be the first derivative of -47*d**2/2 + 85*d + 50. Differentiate f(b) wrt b.
-47
Let s(l) = 97*l**3 + 10*l**2 - 452*l. Let j(c) = 2*c**2 - 2*c. Let u(v) = 5*j(v) - s(v). What is the second derivative of u(a) wrt a?
-582*a
Let y be 5/(30/(-4)) - 28/(-6). What is the second derivative of 123*d - 5*d**3 + 4 - y - 146*d wrt d?
-30*d
Suppose 0 = 4*p + z + 2*z - 11, 0 = -3*p - z + 7. Suppose 3*u - 2 = -n, p*u - 4*u = 2*n - 12. Find the second derivative of n*v - 2*v**4 - 5*v**4 + 3*v wrt v.
-84*v**2
Let k(c) be the third derivative of -c**7/35 - c**6/120 - 23*c**5/30 + 8*c**2 - 3*c. Find the third derivative of k(o) wrt o.
-144*o - 6
Let q = -30 + -2. Let n = q - -34. Find the third derivative of -r**n + 8*r**2 - 11*r**4 + 4*r**2 wrt r.
-264*r
Differentiate -3*n + 70 - 35*n - 45*n wrt n.
-83
Let j(u) be the second derivative of u**6/30 - 11*u**4/3 - u**3/6 + 155*u**2/2 + 270*u - 2. What is the second derivative of j(n) wrt n?
12*n**2 - 88
Let j(w) be the third derivative of -83*w**5/20 + 56*w**3 + 162*w**2. Differentiate j(m) with respect to m.
-498*m
Let z(q) be the second derivative of 49*q**6/5 - 205*q**2/2 - 357*q. What is the derivative of z(a) wrt a?
1176*a**3
Let p(a) be the third derivative of -a**7/30 - a**6/20 - 25*a**3/6 + 3*a**2. Let i(t) be the first derivative of p(t). Find the third derivative of i(s) wrt s.
-168
Let b(y) be the third derivative of -13*y**5/30 + y**4/24 - 61*y**3/6 + 253*y**2 + 2*y. Find the second derivative of b(j) wrt j.
-52
Let h(m) = -3*m**3 - 122*m**2 - 123*m + 5. Let d(q) = q**3 + 2*q**2 + q - 1. Let i(u) = 5*d(u) + h(u). What is the second derivative of i(w) wrt w?
12*w - 224
What is the third derivative of -19 + 3*c**3 + 8*c**4 + 289*c**2 - 146*c**2 - 148*c**2 wrt c?
192*c + 18
Let v(c) = c**2 - 9*c - 2. Let t be v(10). Find the third derivative of -d**3 + 7*d**3 - 51*d**2 + t*d**3 + 43*d**2 wrt d.
84
Differentiate -54*b**4 - 5*b**3 - 3*b**3 + 8*b**3 + 336 - b**3 wrt b.
-216*b**3 - 3*b**2
Suppose -8 = -3*t - 2*m, t - 2*m - 6 = -m. Let a be ((-18)/(-2))/((26 + 7)/11). What is the derivative of -17 + 7 + a*f**t + 7*f**4 wrt f?
40*f**3
Let x(s) be the first derivative of 7*s**6/10 - 4*s**4/3 - 2*s - 13. Let f(k) be the first derivative of x(k). What is the third derivative of f(c) wrt c?
504*c
Let l(p) be the third derivative of 4*p**7/15 - p**6/40 - 71*p**5/15 + 727*p**2. Find the third derivative of l(t) wrt t.
1344*t - 18
What is the second derivative of w - 99 + 146*w**4 + 13*w**2 - 70*w**4 - 67*w**4 wrt w?
108*w**2 + 26
Let w(p) be the first derivative of 31*p**3/3 - 60*p - 65. Differentiate w(s) with respect to s.
62*s
Let u(z) = z**3 + 5*z**2 + 6*z - 3. Let y(s) = -s**2 - s + 1. Let b(w) = u(w) + 6*y(w). Let c be b(0). Find the first derivative of 0 - 5 + o**3 + 2*o**c wrt o.
9*o**2
Suppose 28 = -0*o + o - x, 0 = 4*x - 12. Differentiate 25 + 805*n + o*n**2 - 805*n wrt n.
62*n
Let a(u) be the third derivative of -u**8/840 - u**5/20 + u**4/8 + 9*u**2. Let t(y) be the second derivative of a(y). What is the derivative of t(w) wrt w?
-24*w**2
Let r(x) be the second derivative of -x**4 + 35*x**2/2 + 43*x + 1. What is the derivative of r(i) wrt i?
-24*i
Let n(u) = -119*u**2 - 42*u - 7. Let z(k) = -60*k**2 - 21*k - 4. Let d(h) = 4*n(h) - 7*z(h). Find the second derivative of d(i) wrt i.
-112
Find the second derivative of 5*l + 14*l + 5*l + 482*l**2 - 3 + 48*l + 13*l wrt l.
964
Let q(k) = 526*k**2 + 12*k - 337. Let l(z) = -2629*z**2 - 66*z + 1686. Let j(c) = -2*l(c) - 11*q(c). Differentiate j(h) wrt h.
-1056*h
Suppose 3*h - 2 = -r + 3*r, -12 = -4*r - 2*h. Differentiate -n**4 + 4 + r*n**4 - 2*n**4 with respect to n.
-4*n**3
Let j(g) be the third derivative of 13*g**5/20 - g**4/24 - 11*g**3/2 - g**2 + 31*g. What is the second derivative of j(h) wrt h?
78
Let h be (-40)/(-2) - (7 - 9). Let t = h - 19. Differentiate -8*v**t - 42*v - 11 + 42*v wrt v.
-24*v**2
What is the second derivative of -11*z**5 + 199*z + 106*z**5 - 350*z wrt z?
1900*z**3
Let v(j) be the first derivative of 25/2*j**2 + 8/3*j**3 + 15 + 0*j. Find the second derivative of v(h) wrt h.
16
Let b(a) be the third derivative of -6*a**2 - 1/24*a**4 + 0*a**3 + 0 + 0*a - 1/5*a**5. What is the second derivative of b(t) wrt t?
-24
What is the second derivative of 55*y + 3*y - 40*y**2 + 201 - y**3 - 201 wrt y?
-6*y - 80
Let r be -3*130/36 + 11. Let m(x) be the second derivative of 0 + 2/3*x**3 - r*x**4 + 0*x**2 + x. Find the second derivative of m(p) wrt p.
-4
Let m be 9/((0 + 4)/4). Let w(o) = 6*o**2 - 8. Let q(x) = -23*x**2 + 31. Let f(h) = m*w(h) + 2*q(h). What is the first derivative of f(s) wrt s?
16*s
What is the second derivative of -o**5 + 10*o**2 + 14*o**5 - 6*o**5 - 5*o**5 - 3 + 3*o**2 + 9*o wrt o?
40*o**3 + 26
Let f(o) = -2*o**3 - 44*o**2 - 6*o. Let b(m) = -3*m**3 - 44*m**2 - 5*m. Let y(h) = 6*b(h) - 5*f(h). Find the third | {
"pile_set_name": "DM Mathematics"
} |
The clinical and economic impact of deep chest surgical site infections following coronary artery bypass graft surgery.
To examine how deep chest surgical site infections following coronary artery bypass graft (CABG) surgery impact hospital inpatient length of stay (LOS), costs, and mortality. A large, Midwestern community medical center. All CABG patients who developed deep chest infection (n = 41) were compared to a set of control subjects (n = 160) systematically selected as every tenth uninfected CABG patient. Clinical data were abstracted from patient records, and cost information was obtained from the cost accounting database of the hospital. Variables that significantly increased the risk of deep chest surgical site infection included obesity (odds ratio [OR], 11; p = 0. 0001), renal insufficiency (OR, 8.9; p = 0.0001), connective tissue disease (OR, 25.4; p = 0.0003), reexploration for bleeding (OR, 8.2; p = 0.0015), and the timing of antibiotic prophylaxis (> 60 min before incision; OR, 5.3; p = 0.0128). Within 1 year postoperatively, patients with deep chest surgical site infection had a mortality rate of 22%, vs 0.6% for uninfected patients (p = 0.0001). Infected patients also incurred an average of 20 additional hospital days (p = 0.0001). Univariate analysis indicated that patients who developed deep chest surgical site infection incurred $20,012 in additional costs in the first year (p = 0.0001). Infected patients who died incurred on average $60,547 more than infected patients who survived (p = 0.034). Multivariate analysis confirmed the magnitude of the estimate of the cost for deep chest surgical site infection ($18, 938; p = 0.0001). Deep chest surgical site infections following CABG surgery are associated with significant increases in LOS, hospitalization costs, and mortality. These results suggest the need for improved infection control measures to reduce deep chest surgical site infection rates. | {
"pile_set_name": "PubMed Abstracts"
} |
Q:
Varistor S10K30 for 24-40VDC input?
I was put in charge of redesigning a motor control circuit which accepts 24-40V DC on its input.
As a side note: As far as i know, the existing circuit has been working fine for several years. The redesign aims to make the production cheaper and replace all obsolete THT parts with SMD and optimizing some other stuff.
The current circuit is protected by a 3A fuse and a varistor of type S10K30. Looking at the datasheet (see below), the "30" obviously refers to the \$ V_{RMS} \$ rating.
What bothers me is, that \$ V_{dc} \$ is 38V. I would've chosen the next lager type with a continuous DC voltage rating of at least >40V (more like 44V for +/-10% supply tolerance).
I am trying to understand if this varistor type was a poor choice by the engineer, or if I am missing something (I never had to choose a varistor before).
The data-sheet further specifies \$ V_v=47V \$, but I am not sure how to interpret this parameter.
What does the (1 mA) exactly mean? Does the varistor sink about 1 mA @ 47V? Is this the reason why the original developer was fine with this particular type, because he did not care if the varistor permanently consumes
$$ P = 47V * 1mA = 0,047W $$
Is this bad practice or somehow justified?
How to properly choose the correct varistor for this application?
A:
The data sheets are telling you this: -
The device will conduct 1mA somewhere between 47-10% and 47+10% at 25ºC
At 5A the voltage across the device will be no more than 93V (this is a pulse test)
The max impulse current (based on 8/20us pulse) is 500A at 85ºC
At 85ºC ambient watch out because the operating voltage level drops to 38Vdc
You also need to look at the VI curve for this device: -
The above will tell you what to expect for two conditions. The left hand area marked A is for quiescent conditions (leakage current) and at 40Vdc there may be a current of about 500uA flowing. This is OK for the design unless you are operating super low power. The right hand area is the protection side of the graph - note how the device has a staggered curve where left and right cross-over. This is giving you the 93V max at 5A figure and you can use the curve to predict what the worst case terminal voltage will be clamped at (say) for 1A. To me this looks like 82V.
My conclusion is that it is OK for a 40V supply unless you are operating at a high ambient temperature - this could give a clue about where/how you should mount the device on the PCB - If the PCB is vertical, maybe it's at a low part of the board where temperatures are bound to be lower. Maybe it's near to a fan. You need to make these decisions.
| {
"pile_set_name": "StackExchange"
} |
Power plants, such as automotive or marine engines, and engines driving stationary electrical generators or pumps, for example, are often required to operate over a wide range of output torque. An automobile engine, for example, must provide a significant amount of torque for accelerating the automobile from rest to a cruising speed. Once the automobile has reached the cruising speed, substantially less torque is generally required for maintaining the cruising speed. An engine that produces sufficient power for rapidly accelerating an automobile will generally be larger than would be required for maintaining cruising speed, and will operate inefficiently when throttled back to produce only the power required for maintaining the desired cruising speed. A stationary power plant driving a generator presents a similar challenge when electrical loads are imposed on, and removed from the generator.
One approach to improving the efficiency of power plants used in such applications is to utilize multi-engine power plants, having two or more engines, or two or more engine modules, with output shafts that are selectively coupled together when the demand for output torque is high, such as during acceleration of an automobile. Once a steady state condition is reached, and the torque requirement is reduced, such as during steady speed cruising of an automobile, the second engine is decoupled, and may actually be shut down to improve efficiency of the power plant. Commonly assigned U.S. Pat. No. 6,306,056 B1, to Moore, and U.S. Pat. No. 6,474,068 B1, to Abdel Jalil, et al, describe methods and apparatus for operating multi-engine power plants in this manner.
Both Moore, and Abdel Jalil, disclose individually controlling airflow to separate internal combustion engines of a multi-engine power plant. This approach works well, and is consistent with state of the art beliefs, as held by those having skill in the art, that airflow to each engine must be controlled with a separate throttle body, in order to achieve proper operation and torque sharing of the engines. It has been commonly accepted by those having skill in the art that a separate throttle body was required for each engine in a multi-engine power plant, to control the speed of an engine during the period of time when that engine was being started, so that the engine speed would not run away while the engine was being started and brought up to an operating speed that matched the speed of other engines in the power plant that were already running.
The inventor of the present invention has discovered, however, that in a multi-engine power plant, including a first internal combustion engine module having an air intake and an output shaft for delivering power, and a second internal combustion engine module having an air intake and an output shaft for delivering power, air flow can be controlled to the intakes of the engine modules at a common manifold absolute pressure (MAP) of both engine modules, during operation of one or both of the engine modules, with a single throttle body operatively connected to the air intakes of both the first and second engine modules.
By using only a single throttle body for controlling airflow to two or more engine modules of a multi-engine power plant, a number of duplicate components, that were required in prior multi-engine power plants, can be eliminated. The complexity, cost, weight and size of a power plant according to the invention are all reduced, and reliability is improved, in comparison to prior multi-engine power plants.
In one form of the invention, an apparatus for controlling a multi-engine power plant includes a single throttle body, and a controller operatively connected to the throttle body for controlling a flow of air through the throttle body. The throttle body includes an inlet for receiving a flow of air, and an outlet operatively connected to the air intakes of both a first and a second engine module for delivering the flow of air to the intakes of the engine modules at a common manifold absolute pressure (MAP) of both engine modules during operation of one or both of the engine modules. The apparatus may further include an inlet manifold defining a common internal plenum, having an inlet for receiving the flow of air from the throttle body, a first outlet for delivering a portion of the flow of air from the common internal plenum to the intake of the first engine module, and a second outlet for delivering a remainder of the flow of air from the common internal plenum to the intake of the second engine module.
A multi-engine power plant, according to the invention may include a first internal combustion engine module having an air intake and an output shaft for delivering power, a second internal combustion engine module having an air intake and an output shaft for delivering power, and a single throttle body operatively connected to the air intakes of both the first and second engine modules, for controlling a flow of air to the intakes of the engine modules at a common manifold absolute pressure (MAP) of both engine modules during operation of one or both of the engine modules. The power plant may also include a selectively engagable clutch for operatively coupling the output shaft of the second engine module to output shaft of the first engine module, to thereby produce a common output torque from the first and second engine modules.
In an apparatus or method, according to the invention, a flow of fuel to the first engine module may be controlled independently from a flow of fuel to the second engine module, and a flow of fuel to the second engine module may be controlled independently from a flow of fuel to the first engine module. Ignition in the first engine module may also be controlled independently from ignition in the second engine module, and ignition in the second engine module may be controlled independently from ignition in the first engine module. The flow of air through the throttle body may be controlled as a function of a desired torque output of the power plant.
The output shaft of the second engine module may be selectively operatively connected to the output shaft of the first engine module. The flow of air through the throttle body may be controlled as a function of whether the output shaft of the second engine module is operatively coupled to the output shaft of the first engine module. The output shaft of the second engine module may be selectively operatively connected to the output shaft of the first engine module, as a function of the desired torque output of the power plant.
The flow of air through the throttle body may be controlled according to a first function of desired torque output from the power plant when only the first engine module is operating, and controlled according to a second function of desired torque output when both the first and second engine modules are operating. When the speed of the output shaft of the second engine module does not substantially match the speed of the output shaft of the first engine module, as would be the case when the first engine module was operating but the second engine module was only idling or being started, for example, the throttle body may be controlled according to a third function of desired torque output from the power plant. The second engine module may also be started, by coupling its output shaft to the output shaft of the first engine module, while the first engine module is operating, and controlling the throttle body according to the third function of desired torque while the second engine module is being started.
The foregoing and other features and advantages of the invention will become further apparent from the following detailed description of exemplary embodiments, read in conjunction with the accompanying drawings. The detailed description and drawings are merely illustrative of our invention rather than limiting, the scope of the invention being defined by the appended claims and equivalents thereof.
Throughout the following description of exemplary embodiments of the invention, components and features that are substantially equivalent or similar will be identified in the drawings by the same reference numerals. For the sake of brevity, once a particular element or function of the invention has been described in relation to one exemplary embodiment, the description and function will not be repeated for elements that are substantially equivalent or similar in form and/or function to the components previously described, in those instances where the alternate exemplary embodiments will be readily understood by those skilled in the art from a comparison of the drawings showing the various exemplary embodiments in light of the description of a previously presented embodiment. | {
"pile_set_name": "USPTO Backgrounds"
} |
Jacob Matthew
#Hellomynameis Jake! I’m a final year pharmacy student from Preston! I’ve worked part time in the NHS for 4 years now and represent young people at my local Trust’s Patient Experience Improvement Group! I’ve also been a member of the NHS Youth Forum for 2 years now! I’m looking forward to tweeting today and introducing you to some of the NHS Youth Forum’s amazing work and members! | {
"pile_set_name": "Pile-CC"
} |
Related literature {#sec1}
====================
For general background to the title compound, see: Rivera *et al.* (2010[@bb6]). For related structures, see: Rivera *et al.* (2010[@bb6], 2011[@bb5]); Silversides *et al.* (2006[@bb7]).
Experimental {#sec2}
==============
{#sec2.1}
### Crystal data {#sec2.1.1}
C~10~H~10~N~4~*M* *~r~* = 186.2Orthorhombic,*a* = 7.6404 (3) Å*b* = 15.1703 (7) Å*c* = 15.9168 (7) Å*V* = 1844.87 (14) Å^3^*Z* = 8Cu *K*α radiationμ = 0.69 mm^−1^*T* = 120 K0.17 × 0.15 × 0.10 mm
### Data collection {#sec2.1.2}
Agilent Xcalibur (Atlas, Gemini ultra) diffractometerAbsorption correction: multi-scan (*CrysAlis PRO*; Agilent, 2012[@bb1]) *T* ~min~ = 0.68, *T* ~max~ = 19893 measured reflections1641 independent reflections1359 reflections with *I* \> 3σ(*I*)*R* ~int~ = 0.061
### Refinement {#sec2.1.3}
*R*\[*F* ^2^ \> 2σ(*F* ^2^)\] = 0.039*wR*(*F* ^2^) = 0.104*S* = 1.551641 reflections133 parametersH atoms treated by a mixture of independent and constrained refinementΔρ~max~ = 0.16 e Å^−3^Δρ~min~ = −0.20 e Å^−3^
{#d5e449}
Data collection: *CrysAlis PRO* (Agilent, 2012[@bb1]); cell refinement: *CrysAlis PRO*; data reduction: *CrysAlis PRO*; program(s) used to solve structure: *SUPERFLIP* (Palatinus & Chapuis, 2007[@bb3]); program(s) used to refine structure: *JANA2006* (Petříček *et al.*, 2006[@bb4]); molecular graphics: *DIAMOND* (Brandenburg & Putz, 2005[@bb2]); software used to prepare material for publication: *JANA2006*.
Supplementary Material
======================
######
Click here for additional data file.
Crystal structure: contains datablock(s) global, I. DOI: [10.1107/S1600536812047538/bt6866sup1.cif](http://dx.doi.org/10.1107/S1600536812047538/bt6866sup1.cif)
######
Click here for additional data file.
Structure factors: contains datablock(s) I. DOI: [10.1107/S1600536812047538/bt6866Isup2.hkl](http://dx.doi.org/10.1107/S1600536812047538/bt6866Isup2.hkl)
######
Click here for additional data file.
Supplementary material file. DOI: [10.1107/S1600536812047538/bt6866Isup3.cml](http://dx.doi.org/10.1107/S1600536812047538/bt6866Isup3.cml)
Additional supplementary materials: [crystallographic information](http://scripts.iucr.org/cgi-bin/sendsupfiles?bt6866&file=bt6866sup0.html&mime=text/html); [3D view](http://scripts.iucr.org/cgi-bin/sendcif?bt6866sup1&Qmime=cif); [checkCIF report](http://scripts.iucr.org/cgi-bin/paper?bt6866&checkcif=yes)
Supplementary data and figures for this paper are available from the IUCr electronic archives (Reference: [BT6866](http://scripts.iucr.org/cgi-bin/sendsup?bt6866)).
We acknowledge the Dirección de Investigaciones, Sede Bogotá (DIB) de la Universidad Nacional de Colombia, for financial support of this work, as well the Praemium Academiae project of the Academy of Sciences of the Czech Republic. LJ---C acknowledges the Vicerrectoría Académica de la Universidad Nacional de Colombia for a fellowship.
Comment
=======
The reaction of *N*^1^,*N*^2^-bis((1*H*-benzotriazol-1-yl)methyl)benzene-1,2-diamine with potassium cyanide in DMSO at room temperature gives the title compound in high yield. The two cyanomethyl groups are both *anti* with respect to the planar aromatic ring, no doubt in order to favour intermolecular N---H···N interactions. Intermolecular amine-to-amine and amine-to-cyano hydrogen bonding interactions established \"ladder-like\" parallel tapes in the crystalline solid (Fig. 2).
The molecular structure and atom numbering scheme for the title compound are shown in Fig. 1. Its X-ray structure confirms the presence of intramolecular hydrogen bond between the amino groups \[N--H, 2.426 (18) Å\]. Furthermore the observed C3---N1 bond length \[1.4357 (17) Å\] is considerably elongated in relation to related structures \[1.404 (3) Å\] (Rivera *et al.*, 2010), \[1.3961 (18) Å\] (Silversides *et al.*, 2006) and is longer than the C4---N2 bond \[1.4016 (16) Å\]. Thus, these results indicate that the intramolecular interaction is responsible for the C3---N1 bond elongation. This is confirmed by the N1---C7 bond length \[1.4648 (18) Å\] that is longer than N2---C5 bond \[1.4457 (19) Å\]. Besides, the hybridization of both N1 and N2 atoms are slightly different. In fact, N1 has more *sp^2^* character \[Sα = 347.25°\] than N2 \[Sα = 330.39°\] if compared to *sp^3^*-hybridization \[Sα = 328.50°\] angle value. Other bond distances and bond angles are in good agreement with the standard values.
Experimental {#experimental}
============
A mixture of potassium cyanide (0.260 g, 4.00 mmol) and *N*^1^,*N*^2^-bis((1*H*-benzotriazol-1-yl)methyl)benzene-1,2-diamine (0.370 g, 1.00 mmol) was stirred at room temperature in DMSO (5 ml) for 6 h. After quenching by addition of aqueous ammonium chloride a solid formed which was separated and extracted with ethyl acetate.The organic extract was sequentially washed with saturated Na~2~CO~3~ solution and water, then dried (Na~2~SO~4~), filtered, and concentrated to give a solid homogeneous by TLC (80% EtOAc/benzene) in 82% yield. Single crystals were obtained by recrystallization from chloroform/methanol by slow evaporation of the solvent at room temperaature, m.p. 399--400 K.
Refinement {#refinement}
==========
All hydrogen atoms were discernible in difference Fourier maps and could be refined to reasonable geometry, but according to common practice H atoms bonded to C were kept in ideal positions with C--H = 0.96 Å. The coordinates of the amino H atoms were refined. *U*~iso~(H) was set to 1.2*U*~eq~(C,N). All non-hydrogen atoms were refined using harmonic refinement.
Figures
=======
{#Fap1}
{#Fap2}
Crystal data {#tablewrapcrystaldatalong}
============
------------------------- ---------------------------------------
C~10~H~10~N~4~ *D*~x~ = 1.341 Mg m^−3^
*M~r~* = 186.2 Melting point: 399 K
Orthorhombic, *Pbca* Cu *K*α radiation, λ = 1.5418 Å
Hall symbol: -P 2ac 2ab Cell parameters from 4237 reflections
*a* = 7.6404 (3) Å θ = 4.0--67.0°
*b* = 15.1703 (7) Å µ = 0.69 mm^−1^
*c* = 15.9168 (7) Å *T* = 120 K
*V* = 1844.87 (14) Å^3^ Polygon shape, white
*Z* = 8 0.17 × 0.15 × 0.10 mm
*F*(000) = 784
------------------------- ---------------------------------------
Data collection {#tablewrapdatacollectionlong}
===============
------------------------------------------------------------------- --------------------------------------
Agilent Xcalibur (Atlas, Gemini ultra) diffractometer 1641 independent reflections
Radiation source: Enhance Ultra (Cu) X-ray Source 1359 reflections with *I* \> 3σ(*I*)
Mirror monochromator *R*~int~ = 0.061
Detector resolution: 10.3784 pixels mm^-1^ θ~max~ = 67.2°, θ~min~ = 5.6°
ω scans *h* = −7→9
Absorption correction: multi-scan (*CrysAlis PRO*; Agilent, 2012) *k* = −18→18
*T*~min~ = 0.68, *T*~max~ = 1 *l* = −18→16
9893 measured reflections
------------------------------------------------------------------- --------------------------------------
Refinement {#tablewraprefinementdatalong}
==========
------------------------------------- -------------------------------------------------------------------------------
Refinement on *F*^2^ 34 constraints
*R*\[*F*^2^ \> 2σ(*F*^2^)\] = 0.039 H atoms treated by a mixture of independent and constrained refinement
*wR*(*F*^2^) = 0.104 Weighting scheme based on measured s.u.\'s *w* = 1/(σ^2^(*I*) + 0.0016*I*^2^)
*S* = 1.55 (Δ/σ)~max~ = 0.005
1641 reflections Δρ~max~ = 0.16 e Å^−3^
133 parameters Δρ~min~ = −0.20 e Å^−3^
0 restraints
------------------------------------- -------------------------------------------------------------------------------
Special details {#specialdetails}
===============
----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
Refinement. The refinement was carried out against all reflections. The conventional *R*-factor is always based on *F*. The goodness of fit as well as the weighted *R*-factor are based on *F* and *F*^2^ for refinement carried out on *F* and *F*^2^, respectively. The threshold expression is used only for calculating *R*-factors *etc*. and it is not relevant to the choice of reflections for refinement.The program used for refinement, Jana2006, uses the weighting scheme based on the experimental expectations, see \_refine_ls_weighting_details, that does not force *S* to be one. Therefore the values of *S* are usually larger than the ones from the *SHELX* program.
----------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------
Fractional atomic coordinates and isotropic or equivalent isotropic displacement parameters (Å^2^) {#tablewrapcoords}
==================================================================================================
------- -------------- -------------- --------------- -------------------- --
*x* *y* *z* *U*~iso~\*/*U*~eq~
N1 0.67776 (14) 0.46314 (7) 0.09105 (8) 0.0197 (3)
N2 0.59009 (13) 0.37473 (8) −0.05397 (8) 0.0182 (3)
N3 0.75959 (16) 0.31452 (9) 0.25065 (9) 0.0316 (4)
N4 0.68740 (17) 0.42625 (9) −0.25896 (9) 0.0314 (4)
C1 0.67383 (17) 0.35295 (9) 0.20428 (10) 0.0228 (4)
C2 0.62292 (17) 0.38628 (9) −0.20642 (10) 0.0227 (4)
C3 0.81190 (16) 0.41747 (8) 0.04529 (9) 0.0179 (4)
C4 0.76583 (16) 0.37282 (8) −0.02878 (9) 0.0176 (4)
C5 0.54231 (16) 0.33892 (9) −0.13496 (9) 0.0200 (4)
C6 0.89448 (16) 0.32671 (9) −0.07229 (10) 0.0203 (4)
C7 0.57084 (17) 0.40361 (9) 0.14220 (10) 0.0215 (4)
C8 1.11225 (17) 0.37219 (9) 0.02841 (11) 0.0248 (4)
C9 0.98466 (17) 0.41713 (9) 0.07282 (10) 0.0224 (4)
C10 1.06689 (17) 0.32645 (10) −0.04320 (10) 0.0238 (4)
H1c5 0.417265 0.339719 −0.140823 0.024\*
H2c5 0.57431 0.277778 −0.137292 0.024\*
H1c6 0.864639 0.294979 −0.122465 0.0244\*
H1c7 0.508788 0.363609 0.106188 0.0258\*
H2c7 0.481985 0.436862 0.17073 0.0258\*
H1c8 1.23154 0.372856 0.047341 0.0298\*
H1c9 1.015681 0.44837 0.123117 0.0268\*
H1c10 1.154716 0.294105 −0.073369 0.0286\*
H1 0.732 (2) 0.5050 (12) 0.1255 (12) 0.0237\*
H2 0.536 (2) 0.4245 (12) −0.0403 (12) 0.0219\*
------- -------------- -------------- --------------- -------------------- --
Atomic displacement parameters (Å^2^) {#tablewrapadps}
=====================================
----- ------------ ------------ ------------ ------------- ------------- -------------
*U*^11^ *U*^22^ *U*^33^ *U*^12^ *U*^13^ *U*^23^
N1 0.0140 (5) 0.0231 (6) 0.0221 (7) 0.0001 (4) −0.0013 (5) −0.0013 (5)
N2 0.0087 (5) 0.0257 (6) 0.0202 (7) 0.0023 (4) 0.0000 (5) −0.0013 (5)
N3 0.0229 (6) 0.0399 (7) 0.0319 (8) −0.0047 (6) −0.0020 (6) 0.0091 (6)
N4 0.0267 (6) 0.0389 (7) 0.0287 (8) 0.0053 (6) 0.0054 (6) 0.0065 (6)
C1 0.0167 (7) 0.0287 (7) 0.0231 (8) −0.0035 (6) 0.0041 (6) −0.0004 (6)
C2 0.0154 (6) 0.0286 (7) 0.0241 (9) 0.0052 (6) −0.0007 (6) −0.0013 (6)
C3 0.0117 (6) 0.0210 (6) 0.0210 (8) −0.0002 (5) 0.0014 (5) 0.0041 (5)
C4 0.0101 (6) 0.0217 (6) 0.0211 (8) −0.0006 (5) 0.0001 (5) 0.0045 (5)
C5 0.0124 (6) 0.0268 (7) 0.0208 (8) −0.0011 (5) −0.0006 (6) 0.0008 (5)
C6 0.0131 (6) 0.0249 (7) 0.0229 (8) 0.0011 (5) 0.0019 (6) 0.0012 (6)
C7 0.0137 (6) 0.0285 (7) 0.0223 (8) 0.0013 (5) 0.0007 (6) −0.0007 (6)
C8 0.0094 (6) 0.0300 (7) 0.0350 (9) −0.0019 (5) −0.0030 (6) 0.0081 (6)
C9 0.0153 (6) 0.0262 (7) 0.0256 (9) −0.0038 (5) −0.0042 (6) 0.0051 (6)
C10 0.0107 (6) 0.0284 (7) 0.0324 (9) 0.0028 (5) 0.0043 (6) 0.0064 (6)
----- ------------ ------------ ------------ ------------- ------------- -------------
Geometric parameters (Å, º) {#tablewrapgeomlong}
===========================
---------------- ------------- ------------------ -------------
N1---C3 1.4357 (17) C4---C6 1.3911 (19)
N1---C7 1.4648 (18) C5---H1c5 0.96
N1---H1 0.935 (18) C5---H2c5 0.96
N2---C4 1.4016 (16) C6---C10 1.3963 (18)
N2---C5 1.4457 (19) C6---H1c6 0.96
N2---H2 0.889 (18) C7---H1c7 0.96
N3---C1 1.146 (2) C7---H2c7 0.96
N4---C2 1.144 (2) C8---C9 1.384 (2)
C1---C7 1.479 (2) C8---C10 1.379 (2)
C2---C5 1.480 (2) C8---H1c8 0.96
C3---C4 1.404 (2) C9---H1c9 0.96
C3---C9 1.3908 (18) C10---H1c10 0.96
C3---N1---C7 112.49 (10) H1c5---C5---H2c5 105.18
C3---N1---H1 108.1 (10) C4---C6---C10 120.20 (14)
C7---N1---H1 109.8 (11) C4---C6---H1c6 119.9
C4---N2---C5 119.29 (11) C10---C6---H1c6 119.9
C4---N2---H2 113.2 (11) N1---C7---C1 113.27 (11)
C5---N2---H2 114.8 (12) N1---C7---H1c7 109.47
N3---C1---C7 177.27 (15) N1---C7---H2c7 109.47
N4---C2---C5 176.55 (16) C1---C7---H1c7 109.47
N1---C3---C4 118.67 (11) C1---C7---H2c7 109.47
N1---C3---C9 121.29 (13) H1c7---C7---H2c7 105.38
C4---C3---C9 120.04 (12) C9---C8---C10 119.55 (13)
N2---C4---C3 118.05 (12) C9---C8---H1c8 120.22
N2---C4---C6 123.02 (13) C10---C8---H1c8 120.22
C3---C4---C6 118.90 (12) C3---C9---C8 120.63 (14)
N2---C5---C2 113.45 (11) C3---C9---H1c9 119.69
N2---C5---H1c5 109.47 C8---C9---H1c9 119.69
N2---C5---H2c5 109.47 C6---C10---C8 120.65 (13)
C2---C5---H1c5 109.47 C6---C10---H1c10 119.67
C2---C5---H2c5 109.47 C8---C10---H1c10 119.67
---------------- ------------- ------------------ -------------
Hydrogen-bond geometry (Å, º) {#tablewraphbondslong}
=============================
------------------ ------------ ------------ ------------- ---------------
*D*---H···*A* *D*---H H···*A* *D*···*A* *D*---H···*A*
N1---H1···N4^i^ 0.935 (18) 2.202 (19) 3.0946 (19) 159.2 (16)
N2---H2···N1 0.889 (18) 2.427 (18) 2.7524 (18) 102.0 (13)
N2---H2···N1^ii^ 0.889 (18) 2.494 (17) 3.2536 (16) 143.8 (15)
------------------ ------------ ------------ ------------- ---------------
Symmetry codes: (i) −*x*+3/2, −*y*+1, *z*+1/2; (ii) −*x*+1, −*y*+1, −*z*.
###### Hydrogen-bond geometry (Å, °)
*D*---H⋯*A* *D*---H H⋯*A* *D*⋯*A* *D*---H⋯*A*
---------------- ------------ ------------ ------------- -------------
N1---H1⋯N4^i^ 0.935 (18) 2.202 (19) 3.0946 (19) 159.2 (16)
N2---H2⋯N1 0.889 (18) 2.427 (18) 2.7524 (18) 102.0 (13)
N2---H2⋯N1^ii^ 0.889 (18) 2.494 (17) 3.2536 (16) 143.8 (15)
Symmetry codes: (i) ; (ii) .
| {
"pile_set_name": "PubMed Central"
} |
Colombia deports Calabrian mafia boss Pannunzi to Italy Published duration 6 July 2013
image caption Pannunzi is expected to serve out more than 16 years of his sentence in Italy
Italian police have arrested mafia boss Roberto Pannunzi after he was deported back to Italy from Colombia.
He was detained in a shopping centre in Bogota on Friday in an joint operation carried out by the Colombian authorities and US anti-drug officials.
Pannunzi is alleged to be responsible for importing up to two tonnes of cocaine into Europe every month.
He is the alleged leader of the 'Ndrangheta crime network based in the southern Italian region of Calabria.
The Italian was detained on Friday with the help of the US Drug Enforcement Administration, the Colombian defence ministry said in a statement.
"When he was captured, Pannunzi identified himself with a fake Venezuelan identification card bearing the name Silvano Martino," Colombia's defence ministry said in a Twitter post
Less than 24 hours later, he was put on a plane from Bogota.
Pannunzi was arrested by Italian police upon his arrival at Rome's Fiumicino airport on Saturday evening.
'Not a mafioso'
Roberto Pannunzi, 65, is said to have organised huge shipments of cocaine from South America to Europe.
He collected the money from different criminal organisations and smuggled large scale, profitable drug smuggling operations.
"He is not a mafioso, not a killer, he is a broker," Roberto Saviano, an Italian investigative journalist told the AFP news agency.
Roberto Pannunzi, 65, was first detained in Colombia in 1994 and extradited to Italy but was released when his detention order expired.
He was re-arrested in 2004 and later convicted. But he staged an dramatic escape from a private hospital in Rome in 2010, where he was being treated for heart disease.
Italian authorities have described the 'Ndrangheta as the country's most dangerous and wealthiest crime syndicate, overtaking the Sicilian Mafia. | {
"pile_set_name": "OpenWebText2"
} |
Eumitra
Eumitra is a genus of sea snails, marine gastropod mollusks, in the family Mitridae, the miters or miter snails.
Species
Species within the genus Eumitra include:
† Eumitra alokiza (Tenison Woods, 1879)
Eumitra apheles Lozouet, 1991
Eumitra caledonica Lozouet, 1991
Eumitra imbricata Lozouet, 1991
† Eumitra nitens (P. Marshall, 1918)
Eumitra richeri Lozouet, 1991
Eumitra suduirauti Bozzetti, 1997
† Eumitra waitemataensis (Powell & Bartrum, 1929)
References
*
Category:Gastropods described in 1889 | {
"pile_set_name": "Wikipedia (en)"
} |
Chris Poole. Kevin Abosch Before he was old enough to drink, Chris Poole controlled one of the most influential internet communities in history.
At 15, he founded the freewheeling online image board 4chan, which achieved notoriety early on for hatching memes among a stew of not-safe-for-work content, ranging from inventive pornography to stomach-turning gore.
Poole’s control of the site caused him to field phone calls from the FBI and appear in court, left him nearly bankrupt, and turned him into a human "punching bag."
For the young New York-born techie, it was a formative experience, one that forced Poole to reconcile his love for community and the benefits of anonymity with his contempt for some of the objectionable content on the site. And when he stepped down in 2015 and later sold the site, most assumed it was to escape into his own anonymity after the stress and the challenges that came with running the controversial forum.
As it turns out, Poole was just preparing for his next act. And in one of the most surprising moves in tech this year, Poole has resurfaced at Google, working on the internet company's fledgling entrepreneurship program. The one-time keeper of the memes is now punching the clock at one of the most respected companies in the world.
To succeed at his new role, Poole will need to shed the reputation that's stubbornly clung to him and his site for years. But if he pulls it off, he’ll have accomplished a feat as impressive as any Silicon Valley turnaround story: the chance to reclaim his own identity.
An unusual relationship
Poole agreed to answer questions from Business Insider by email and wrote that joining Google is a continuation of an important journey — "a chance to have entirely new and formative experiences, and grow in ways one simply cannot on their own."
After all, he'd been at it alone for a long time. Poole created 4chan in 2003, modeling it after his favorite Japanese anime site and going by the moniker "moot." Poole's parents had no idea it even existed for the first several years. His identity wasn’t public until his first press profiles in 2009. At that point, 4chan already had 5 million monthly users, with Poole as the sole admin.
Browsers of the site's more controversial boards or anyone aware only of 4chan's headline-grabbing hijinks (like attacking Scientology through Anonymous, the hacktivist group it spawned, or rigging a Time magazine poll), would picture Poole as this maniacal caricature of a human being.
"Once you meet him, Chris is the last guy you’d expect to have been the dude that founded 4chan,” says Drew Curtis, the founder of another early message board, Fark. Curtis considers himself a friend and adviser to Poole — the two met at a TED conference where Poole spoke in 2010.
Those who know him, including Curtis, describe Poole as kind, funny, incredibly bright, intensely private, and as someone who asks thoughtful questions.
Many 4chan users, on the other hand, would describe Poole a bit more … colorfully. Over the years, the shifting community’s relationship to Poole has bucked and dipped. They’ve sent him artwork, obsessed over his love life (he’s even dated a few 4channers), and playfully meme-fied any photo they can get their digital hands on.
But any change to the site would spur insults and death threats, lewd comments on everything from his sexuality to his physical appearance, with a fair number of complex theories on how he was in cahoots with the FBI or, after he banned GamerGate discussions, was in bed with "social justice warriors." Poole has said that their constant assault didn't make him angry (he makes it a point not to get angry at strangers on the internet), but could be draining.
"Sometimes he’d get really frustrated with us. It was a love-hate relationship with users,” Brett, an early 4channer, says. In the spirit of the site, he asked for his full name to remain anonymous. He’s the same age as Poole and joined the site back in 2004. He still visits it nearly every single day.
The face of 4chan
Chris Poole speaking about 4chan at the SHARE Conference. SHARE Conference
Whether 4chan's users appreciated it or not, Poole was a fierce defender of the community he created. And ironically, his protection of the anonymity of his users tied his own identity more closely to their exploits.
Even though he couldn’t really control the site beyond banning certain topics and reporting illegal content to authorities, he was the only one with any modicum of authority.
Poole himself describes 4Chan with pride, and a hint of ambivalence.
He can calmly describe some of the site’s more NSFW images and antics, adding that he’s not easily offended, and can clinically discuss how he fielded countless legal threats from actresses during the massive celebrity leak dubbed on 4chan as “The Fappening.”
“As much as we’ve had our detractors over the years as a community and as a site, I think 4chan has done far, far, far, far more good than bad,” he said during a final, eight-hour Q&A session with his community. “Hundreds of millions of people have used 4chan in some capacity, in some fashion, whether it’s minutes, hours, days, or whatever. There have at least been 100 million dedicated users over the past ten years. For a lot of people it kind of functions as their ‘Place.’”
Keeping that ‘Place’ open never made him money — in fact it almost bankrupted him. Its racy content made mainstream advertisers shrink away while servers and the occasional legal fee drained his bank account to the point where he was once $20,000 in debt.
Ultimately, he said in his final Q&A, he sees 4chan's upkeep over the years as a hobby and a labor of love, and that he did “truly feel very warmly about the community and everything that’s happened” despite “being a punching bag for millions and millions of people."
Although most associate Poole with 4chan, he's actually taken a stab at another projects.
He founded Canvas in 2011 as a network for remixing images, ultimately raising about $3 million from investors like USV and Andreessen Horowitz. In some ways, Canvas felt like a nicer version of 4chan: It enabled a similar kind of creative piggy-backing, without veering into the obscene.
In search of a business model, the app pivoted and its second iteration, DrawQuest, gave users daily illustration prompts. But Poole still couldn’t figure out how to make money. In 2014, Poole wrote a frank blog post declaring that it had to shut down. He describes the next few months as an “emotional roller coaster” and a “burden that took a few months to decompress from.”
Going Google
Google's Bradley Horowitz. Michael Seto
After selling the site last year, Poole fell off the map. No blog posts, few tweets.
“I spent just over two years away from the tech world. I used the time and distance to catch my bearings and recharge after four years of building Canvas and DrawQuest—but more importantly—to seek out new experiences and learn more about myself and the world,” he tells Business Insider.
He traveled, read, wrote. Ultimately, he reconnected with Google’s VP of Photos and Streams, Bradley Horowitz, whom he had met several years before.
4chan’s reputation didn’t faze Horowitz — the longtime Google executive, who once headed up Google's Apps business, had never been a frequent 4chan visitor. Impressions of Chris were based on their relationship, not 4chan's history.
“I've had the good fortune to work with some of the most creative and talented people in the industry. Yet even against that backdrop Chris stands out as a particularly gifted and astute thinker,” he says. “He has an uncanny ability to see through apparent complexities and simplify. It's a rare and valuable gift.”
When Horowitz started working on a new in-house startup incubator, dubbed Area 120, Poole was top of mind.
“I’d always hoped to work with Chris, but was waiting for the right circumstances to arise (both for us and for him), took a bit of patience,” he says. “We stayed in touch, and when Area 120 began to take shape, he was practically the first call I made. And fortunately, I caught him at the perfect moment.”
For Poole, joining Google, helping other people form their own businesses inside a huge company instead of launching out again on his own, feels like the right fit.
It’s been almost exactly one year since he set his churlish, beloved child free, and the 4chan site seems to be whirling along just fine without him. While he’s still best known for 4chan and as “moot,” the identity he picked at 15, those days are falling farther and farther behind him.
“I think 4chan will be a footnote in his biography,” Curtis says. “One day we’ll say, ‘Oh, of course he did this next thing. Look at what he was doing when he was 15.’ I think that’s what 4chan will be for him: just the beginning.” | {
"pile_set_name": "OpenWebText2"
} |
Some problems in the area of conveyance of particulate materials were identified in International Application No. PCT/US2009/006733, published on Jul. 8, 2010 as International Publication No. WO/2010/077348. That publication is herein incorporated by reference, and the disclosure of that publication is deemed to be combined with the disclosure of the present specification.
Particulate materials such as coal are often transported in open top conveyances, usually railway gondola cars. The material is dumped somewhat indiscriminately into these cars to fill them by hoppers or other large-volume low-accuracy supply mechanisms, with the result that the material is piled somewhat loosely in the gondola car in a humped pile, high in some places, and not present in other void areas in the car.
The humped pile has a number of drawbacks. For one, it positions the particulate material such that air passing over the pile more readily carries away lighter particles and dust, resulting in waste and local deposition of large amounts of undesirable dust etc. Also, some space in the car is wasted by the lack of complete distribution of the material in the interior of the car.
Another problem relates to methods adopted to prevent dust from blowing away from the material in the gondola car. WO/2010/077348 shows a system and a method for compacting materials in an open top conveyance. This compaction is beneficial to prevent fly away of dust or small particulate material. Where the material is loaded in a high humped pile in the railway car, though, it may produce a problem, in that humped pile of material in the gondola car may be so disproportionately located in the car that compaction is difficult, and the amount of material that has to be moved to be compacted may strain the apparatus. | {
"pile_set_name": "USPTO Backgrounds"
} |
Q:
2018 Federal Income Tax Deduction for Owner Occupied Rental Property
I live in a 3 bedroom condo in California and decided to rent out 2 of the bedrooms and live in one.
The mortgage is $1M and interest is $4000 per month
HOA is $600 per month
Property tax is $1000 per month
Rental income is $3000 per month
I know HOA, mortgage interest and property tax can all be used to deduct rental income. But in my case, the rental income is less than all those combined. Also, there is a $750,000 limit for mortgage interest deduction for owner occupied house according to the new tax law.
My question is, when I file tax for 2018, how much can I write off my income?
A:
Assuming you were under contract on the house prior to December 16, 2017 and closed prior to April 1, 2018, you are grandfathered in to the $1M limit, so no impact to you unless you're married filing separately.
Since you live there, you cannot claim rental losses (even if you didn't live there, likely no benefit due to AGI, unless you're a real estate professional). You will offset rental income by a percentage of the expenses you listed in addition to depreciation of the rented portion and other expenses like maintenance/repairs. The percentage used is based on how much of the unit is rented. Count 2/3 of any common rooms as rented, and all of any rooms exclusive to tenants as rented. It's acceptable to use room count or square footage in this calculation, likely you'll want to use square footage unless you have a lot of rooms that are exclusive to you (because your rent income is well below rental expenses, you want to minimize rented portion).
If we assume 2/3 is rented, you can use 1/3 of property tax and mortgage interest as itemized deductions.
Using your example numbers you'd have $20,000 in itemized deductions.
On the rental side 2/3 of each expense, so:
Mortgage interest = $2,666
HOA = $400
Property tax = $666
Depreciation = $2020
That's $5,752 in monthly rental expenses (plus maintenance/repairs, insurance, etc.), which fully offsets $3,000/month in rental income leaving you with no tax obligation on the rental side. However, when you sell you will face unrecaptured section 1250 gain even though you're getting no benefit from depreciating the rental portion of your property.
Using whichever method of calculating rented portion that results in a lower percentage would be beneficial to you.
| {
"pile_set_name": "StackExchange"
} |
Q:
What lens should I buy to get better pictures of a one-year old running around a dimly-lit house?
I'm an amateur photographer with a Canon Rebel XS, and I'm trying to figure out what type of lens I should buy to take better photos of my one year old when she is running around in our dimly lit house. I seem to find myself in a lot of situations where there are kids on the move in low light, and my 50mm f/1.8 II just isn't able to do it. Suggestions?
A:
I don't think another lens is necessarily what you need, although since 50mm is a bit narrow indoors on a Rebel XS, you may want to consider something a bit wider. (The question Will a 35mm lens work for great indoor pictures of my kids? asks about Nikon but the answers will apply in general.) A Rebel-series camera has a sensor which is about 22mm wide, which means that the 50mm lens you have acts as a short telephoto. This is great for portraits of stationary subjects, but not so good for fast-moving small children indoors.
Something in the 28mm to 35mm range will be more "normal", a length which gives a convenient, natural perspective in many different circumstances. If you're feeling like it's often difficult to get everything you want in the frame with your current lens, this is something to explore.
For the low-light issue, though, the f/1.8 maximum aperture of your current lens is quite good. You can't go much faster without spending a ton of money. Image stabilization might help if your problem is that you can't stay still enough for longer shutter speeds, but I'm guessing the main problem with movement is in your subject, and nothing in the lens can help that. In fact, a fast lens (one with a wide aperture, like yours) is actually harder to use in this case, since your little one is apt to zoom right out of the narrow area of focus.
So, I think the main thing you need is more light. Since you probably don't want to add stadium floodlights to your house, take a look at Prime lens or flash: which upgrade will most improve baby photos? — with a focus on the "flash" aspect. A better flash provide a lot more illumination than the pop-up flash does, and more importantly, will allow you to bounce light off the ceiling, not just flash it forward, avoiding the harsh light and shadows often associated with amateur flash photography.
Canon's lower-mid-range flash, the Speedlite 430EX II, is a little pricey at $300 — but that's less than a nice lens might cost. It's also very well featured and able to grow with you as you upgrade the rest of your photography. You could also choose a compatible third-party option like the Metz 50 AF-1 ($200) or the more basic (all-automatic only) but very powerful Sigma EF610 DG ST ($150). Or, you can get a much-cheaper all-manual Yongnuo YN-560 ($70!), but that may not be what you want for in-the-moment kid photos.
A:
Creating Memories
I think that what you're trying to do is capture memorable images of your daughter. (Correct me if I'm wrong!). I don't think you're aiming for photographic perfection.
As a result, many compromises - which may sound technically iffy - are fine for this kind of photography.
Bearing that in mind here are a few suggestions...
Don't be afraid to bump up the ISO
Even if the result is very noisy, if you get "the" shot, then nobody will notice the noise.
Slow down the subject
This works differently with different children, but giving them a toy (especially a cute, cuddly, photogenic toy) might make her stop moving for several seconds (!) - enough time for you to snap off a shot. The trick is not to let her see it until you give it to her. You could have a helper do this.
You could place a big cushion in her path and lie in wait. Negotiating the obstacle will present some interesting shots.
When you have no light, any light is good light!
Get a work lamp and put it in the room. I would point it at the ceiling to get good diffused / spread out light.
Set an appropriate white-balance (or shoot in raw).
Also, consider using the pop-up flash on your camera - perhaps dialled down (set the flash exposure compensation to -1 or even -1.5 stops).
| {
"pile_set_name": "StackExchange"
} |
<!DOCTYPE html>
<html lang="en">
<head>
<title>Suave Test Page</title>
<script type="text/javascript">
//<![CDATA[
window.addEventListener("load", function () {
var sendFiles = function(event) {
var fd = new FormData(event.target);
fd.append('custom', 1337);
var request = new XMLHttpRequest();
request.addEventListener("load", function(event) {
if (console && console.log) {
console.info('success', event.target.responseText);
}
});
request.addEventListener("error", function(event) {
if (console && console.log) {
console.error('error', event);
}
});
request.open("PUT", event.target.action);
request.send(fd);
};
document.getElementById("up3").addEventListener("submit", function (event) {
event.preventDefault();
sendFiles(event);
});
});
//]]>
</script>
</head>
<body>
<h1>POST testing</h1>
<h2>Simple data POST</h2>
<form method="post" action="test.html">
<p>
<input type="text" name="edit1" /><br />
<input type="submit" />
</p>
</form>
<h2>1. File Upload test</h2>
<form method="post" action="upload" enctype="multipart/form-data">
<p>
<input type="file" name="myfile" /><br />
<input type="submit" />
</p>
</form>
<h2>2. Multiple File Upload test – <pre>multipart/form-data</pre></h2>
<form method="PUT" action="upload2" enctype="multipart/form-data">
<p>
<input type="file" name="myfile1" /><br />
<input type="file" name="myfile2" /><br />
<input type="text" name="edit1" /><br />
<input type="submit" />
</p>
</form>
<h2>3. Multiple File JavaScript/FormData Upload test</h2>
<form id="up3" name="up3" method="PUT" action="upload2">
<p>Will post with <pre>Content-Type: multipart/form-data; boundary=---------------------------15407761691467256857631277098</pre></p>
<p>
<input type="file" name="myfile1" accept="image/*;capture=camera" required="required" /> *<br />
<input type="file" name="myfile2" accept="image/*;capture=camera" /><br />
<input type="text" name="edit1" /><br />
<input type="submit" />
</p>
</form>
<h2>Image</h2>
<img src="examples.png" />
<h2>4. International Form Fields</h2>
<form id="put1" name="put1" method="POST" action="i18nforms" enctype="multipart/form-data">
<p>Will now post a form with a number of funky names</p>
<p>
<input type="text" name="ödlan" /><br />
<input type="text" name="小" value="small" /><br />
<input type="submit" />
</p>
</form>
</body>
</html> | {
"pile_set_name": "Github"
} |
Cell cycle-dependent securin proteins regulate sister chromatid separation by inhibiting separin function. We isolated and have characterized pituitary tumor transforming gene (PTTG) from rat pituitary tumor cells, and PTTG is functionally homologous to yeast securin. PTTG is overexpressed in several tumor types, and also in some normal replicating tissues (including testis, lympocytes). When the PTTG gene was deleted, resultant knockout mice were viable, fertile and exhibited splenic and testicular hypoplasia and thrombocytopenia. Surprisingly, after 6 months, male PTTG -/- mice do not gain weight, develop profound hyperglycemia, hypo-insulinemia, and hypo-leptinemia with intact insulin sensitivity. In preliminary experiments, pancreatic beta cells appear hypoplastic with diminished islet insulin immunoreactivity, and no evidence for autoimmune islet involvement. This proposal aims to study the role of mammalian securin in pancreatic beta cell function by assessing insulin transcription, secretion and action, regulation of adipocyte hormones and assessment of pancreatic beta cell development and replication, and pancreatic regeneration. As securin-deficient diabetes is restricted to male mice, intact or gonadectomized PTTG -/- animals will be treated with sex steroids, and their impact on glycemia and pancreatic function assessed. These studies highlight the role of a cell cycle-regulating protein in pancreatic beta cell development and function. In the context of this unique genetic background, these experiments identify securin as a critical factor for pancreatic cell function and provide insights into a novel monogenic cause of diabetes. [unreadable] [unreadable] | {
"pile_set_name": "NIH ExPorter"
} |
Eraniel railway station
Eraniel Railway station (Station code: ERL) in Eraniel is the most important railway station of Kallkkulam taluk of Kanyakumari district in the Tamil Nadu state of India. The station has two platforms and falls on the Kanyakumari—Thiruvananthapuram line in the Thiruvananthapuram division of the Southern Railway zone. All daily trains passing through the station halts in Eraniel station.
The famous Mandaikadu Bagavathi Amman Temple, Colachel Port, I.R.E Industries in Manavalakurichi and Padmanabhapuram Palace are situated nearby the Station. The station also is the nearest railhead for two municipalities - Padmanabapuram, Colachel and for 25 villages.
Revenue
Places of interest
Mandaikadu Bagavathi Amman Temple
Padmanabhapuram Palace
Thiruvithamcode
Kumaracoil Murugan Temple
Sivalayams
Muttom
Thiruparrapu Falls
Udayagirib Fort
Colachel
Services
Extension of Trains
Extension of Tiruchi-Tirunelveli Intercity Express 22627/22628 up to Thiruvananthapuram
Extension of Thiruvananthapuram central - Mangaluru 16603/16604 Mavali Express up to Kanniyakumari
New Train Services
A new overnight express from Velankanni to Kochuveli Via. Thanjavur Jn, Trichy Jn, Pudukkottai, Nagercoil Jn, Eraniel and Thiruvananthapuram central
Kaniyakumari to Vasco-Da-Gama (Goa) daily train via. Thiruvananthapuram central and Ernakulam
Technical Details
Total Thiruvananthapuram -Nagercoil Section km = 71.05
Line capacity of Thiruvananthapuram -Nagercoil Section : 114.1%
Maximum Permissible speed of Thiruvananthapuram -Nagercoil Section : 80 km/h
Total Stations =13
Block Station =6
CNC Station = 1
Halt Station =6
Critical Block Section = Eraniel - Nagercoil
Station km = 272.62
Transfer Division
The Thiruvananthapuram-Nagercoil-Kanyakumari railway line was opened on Sixteenth April 1979, and was then under Madurai Division. Thiruvananthapuram division was formed on second October 1979 carving out certain sections from Madurai division. The Meter Gauge sections of Madurai division were retained, while all the newly laid Broad Gauge Sections of Madurai Division were transferred to Thiruvananthapuram Division. Thus, the Thiruvananthapuram-Nagercoil-Kanyakumari BG line, and the under-construction Tirunelveli-Nagercoil BG line were transferred to Thiruvananthapuram Division. It was then mentioned that when the Tirunelveli-Madurai line is converted into BG line the sections falling under Kanyakumari district and Tirunelveli District would be transferred back to Madurai Division. The Thrunelveli-Madurai line was converted into BG line on 8-4-1981 and ever since people from South Tamil Nadu have been demanding the merger of Kanyakumari BG line with Madurai Division.
Ever since its inception, Kanyakumari district has been willfully neglected by Thiruvananthapuram division(like what Thiruvananthapuram and Palakkad Divisions are neglected by Southern Railway), be it in providing Railway infrastructure, providing the required train services, passenger amenities etc. Kanyakumari terminal station lacks the required Railway infrastructures and therefore request for more train services were always turned down by them citing the same handicap as the reason. Kanyakumari District people are demanding transfer Kanyakumari - Nagercoil - Kuzhithurai - Thiruvananthapuram (except Thiruvananthapuram Station) and Nagercoil - Tirunelveli (up to Melappalayam) section to Madurai Division, at the earliest. It is also stressed that under any circumstances, the above places should be under the administration of southern railway zone that is with Chennai only. Even in future also this area should not be attached with any other Zone including Trivandrum, Kerala.
Suburban stations
Gallery
References
External links
Satellite Map of Eraniel Railway Station
Eraniel Railway Station details
Category:Railway stations in Kanyakumari district
Category:Thiruvananthapuram railway division
Category:Railway stations opened in 1979 | {
"pile_set_name": "Wikipedia (en)"
} |
73 N.W.2d 50 (1955)
Clarence ELSE, Guardian of Sim Cundiff, an Aged Person, and
Clarence Else, Guardian of Grace Cundiff, an Aged Person, Appellees,
v.
FREMONT METHODIST CHURCH of Fremont, Iowa, Appellant.
No. 48782.
Supreme Court of Iowa.
November 15, 1955.
*51 Ned P. Gilbert and Charles H. Scholz, Oskaloosa, for appellant.
Tunis H. Klein, Pella, and Bray, Carson & McCoy, Oskaloosa, for appellees.
LARSON, Justice.
This appeal involves an action in equity, brought by Clarence Else, guardian of Sim Cundiff and Grace Cundiff, against the defendant Fremont Methodist Church, wherein the guardian sought to have his wards' deed conveying a remainder interest in the wards' 134 acre farm to the defendant church, subject to a retained life estate in said wards, cancelled and set aside, and title to the property quieted in the wards as against the defendant, upon the grounds that (1) said wards were without sufficient mental capacity to execute said deed and (2) said deed was obtained from said wards by the exercise of undue influence by the pastor and the chairman of the board of trustees of said defendant church. The trial court found that the grantors lacked the requisite mental capacity and that their deed was obtained by the exercise of undue influence, and entered a decree for the plaintiffs. The defendant appealed.
The questions involved on this appeal are (1) whether the appellees satisfied the burden of establishing the claimed lack of mental capacity, (2) whether a confidential relationship existed of such nature as to cast upon the appellant any burden of proof with regard to the claim of undue influence, and if such burden was thereby cast upon the appellant, whether the appellant has met and satisfied that burden, and (3) whether any error was committed in excluding testimony of the grantors' attorney on the grounds of privilege.
Sim Cundiff and his wife Grace, the grantors of the deed in controversy, were 73 and 76 years of age, respectively, at the time of the execution of the deed. They had been married for 40 years, and no children were born as the issue of their marriage. Their only close relatives were Sim's one brother, and Grace's one sister. Sim had been a farmer all his life and he and Grace lived on and farmed a 120 acre farm located approximately two miles northwest of Fremont, Iowa. They also owned the real estate in controversy, said farm being triangular in shape with public highways constituting the north and east boundaries of the farm and a railroad right of way the southwest boundary thereof. In addition, they owned some livestock, farm machinery, bank accounts and government *52 bonds, having a total value of approximately $30,000.
Grace had been a member of defendant church many years, beginning with the time she was in high school and continuing until March 31, 1953, approximately six months after the deed in controversy was executed. She punctually attended church and was by her own statement a devout member. Sim Cundiff also attended this church, but did not become affiliated with it as a member until January 6, 1952.
Dr. Ernest A. Mathews, age 70, a Methodist Church minister since 1907, at the invitation of defendant church, came out of retirement and accepted a call as its supply pastor. He arrived in Fremont in June, 1951, and continued as such pastor until the summer of 1953. Upon arrival in Fremont, Dr. Mathews, seeking to become acquainted with his congregation, called at the Cundiff home in July, 1951, and became acquainted with Sim and Grace Cundiff. Thereafter until Sim sustained a cerebral hemorrhage on July 12, 1952, Dr. Mathews made further visits at the Cundiff home about once a month. A friendly relationship developed between them. On his second or third visit to the Cundiff home, in August or September, 1951, he had a conversation with Sim in the farmyard during which Sim said, without solicitation from Dr. Mathews: "I want to give $20,000 to the building of a new church and it must be on the highway." Dr. Mathews commented that the offer was a very wonderful thought for him to keep in mind, and thanked him.
In December, 1951, between Christmas and New Year's Day, Sim went to the bank with which he did business in Fremont and there delivered to his banker a check for $800 with the statement it was intended as a gift to the Fremont Methodist Church building fund, which check was subsequently turned over to the church treasurer. On Sunday, January 6, 1952, a ceremony for the reception of new members was conducted as part of the regular church service, at which time Sim received holy baptism and was received into the membership of the church. On this occasion Dr. Mathews made a public statement from the pulpit disclosing that a gift had been made to the building fund of the church by Mr. and Mrs. Cundiff. Without disclosing the exact amount, he stated that the gift was substantial. Soon after this Dr. Mathews and the church treasurer called at the Cundiff home to express the church's appreciation of the gift. On this occasion Sim stated the gift was "just a nest egg and he had another quarter." Dr. Mathews' public announcement was contrary to the Cundiff's desire to avoid publicity, and later on when the Cundiffs made a further gift of $400 to their church, they arranged that their tenant, Louis Meyers, mail his check for that amount to the church without any explanation that the Cundiffs were the actual donors, and for a time the church believed it was a gift from the tenant.
In the spring of 1952, following these gifts to the building fund, the church's trustees determined to canvass the church membership to ascertain whether there was any sentiment for the building of a new church building. In connection with this canvass, Dr. Mathews and W. O. McCurdy, chairman of the board of trustees of the church, stopped at the Cundiff home to interview Sim. Concerning this visit Grace testified: "S. E. was so concerned, he told them on this committee, `Let's build a church,'" but they informed him that the money wasn't available and the general congregation thought it wasn't feasible. Mrs. Cundiff also testified on one occasion during this period Sim said to her: "Grace, whenever we sell anything, if we have a little more than we need, we will put it on the building fund," and that there was similar talk for some months prior to the execution of the deed in controversy.
Later, on July 12, 1952, Sim suffered a cerebral hemorrhage which caused a partial paralysis of portions of his body and caused him to be confined to his bed for a period not definitely fixed by the Record. Sim's physical condition improved as time went on and he was able to sit in a wheel chair, and later on was able to get on his hands and knees and crawl, and still later on was able to walk about by leaning and *53 hanging on wires and other objects and without personal assistance from anyone. On September 28, 1952, four days after the deed was executed, Sim did walk from the barnyard to the house. Just before the deed was executed, he was able to be alone in the back yard of his home, exercising under the clothes line. Although his cerebral hemorrhage had affected his ability to talk plainly, he recognized his many visitors, was able to and did raise his hand in greeting, could answer questions by yes and no answers, and by signs and gestures was able to carry on conversations with his visitors and generally could make himself understood to them. His visitors included his neighbors, his farm tenants and their wives, several old family friends, his guardian, Clarence Else, and Mrs. Else, and Dr. Mathews, Mrs. Mathews, W. O. McCurdy, and W. O. McCurdy's daughter-in-law, Mildred McCurdy, most all of whom testified in this trial.
Mildred McCurdy, who moved to the Fremont community in 1949 upon her marriage to Leroy McCurdy, had never seen or heard of the Cundiffs until Sim's baptism on January 6, 1952, on which occasion Sim and Grace were identified as Mr. and Mrs. Cundiff. In March, 1952, she became personally acquainted with them. At Dr. Mathews' invitation she accompanied him and Mrs. Mathews to the Cundiff home for the purpose of playing her harp and singing religious hymns to Sim, she being an accomplished musician. Following this visit, Mildred's calls at the Cundiff home became more frequent and a closer friendship between Grace and Mildred developed after Sim's stroke, during the period from July 12 to September 24, 1952. Grace often called Mildred on the telephone urging her to come to their home, and she came to rely on Mildred to run errands for her, to bring her groceries from Fremont, and to do other similar favors for her.
During this same period Grace began to have difficulties with Sim's brother, Sam Cundiff. Sam's frequent visits to the Cundiff home disturbed and upset Sim, and Grace began to develop a feeling that Sam's motives were improper and he was endeavoring to become Sim's guardian. Sam's actions so dissatisfied her that on the evening of September 21, 1952, she sent her handyman, Archie Fuller, to Fremont to seek out Mildred McCurdy for the purpose of soliciting her aid. Mildred informed Fuller that she was a short-time resident of Iowa, she was not familiar with the Iowa laws, and she therefore did not feel competent to advise or assist Grace. Later on that same evening she received a telephone call from Fuller from his home in Ottumwa. In this call he informed Mildred that he had stopped at the sheriff's office in Ottumwa to discuss the situation and had been advised by the sheriff it was a matter for the Mahaska County authorities, and Grace should seek the aid and assistance of the Mahaska County Attorney, Garold Heslinga. He also stated that the sheriff had suggested it would be well to check into Grace's mental condition. On the following morning, Monday, September 22nd, Mildred drove to the Cundiff home and informed Grace of Mr. Fuller's message and the procedure suggested by him. Grace then decided she would go to Oskaloosa where she would see and consult Dr. Voigt, who was the family physician and who then had Sim under his care, relative to her own mental condition and would seek the aid and assistance of Heslinga. She requested that Mildred take her there for those purposes. They departed for Oskaloosa about 10 o'clock and arrived at Oskaloosa around 11 o'clock that same morning, with W. O. McCurdy, Mildred's father-in-law, furnishing the transportation in his car. On the way to Oskaloosa Grace expressed a desire to avoid climbing any steps to the second story office of the county attorney and suggested she would like to have W. O. McCurdy contact the county attorney and make an appointment to meet her at Dr. Voigt's office. Upon arrival at Dr. Voigt's office Mildred, Grace, and W. O. McCurdy, ascertained that Dr. Voigt would be unable to see them until 12:30 P.M. Thereupon Mildred and Grace left the office and went to a restaurant and ate lunch. Mr. McCurdy proceeded to Heslinga's office where he made arrangements to have Heslinga meet *54 Mrs. Cundiff at Dr. Voigt's office at the appointed hour of 12:30 P.M. At that time Heslinga came to the doctor's office and found Mildred, W. O., and Grace in the waiting room. He visited with them briefly, at which time Grace informed him of her difficulties with Sam and her desire for Heslinga's assistance. In their discussion Heslinga alluded to the fact that Sam Cundiff was Sim's sole heir-at-law and inquired whether any arrangements had been made concerning the devolution of their property in the event of their deaths. Grace informed Heslinga that she and Sim owned all of their property in joint tenancy and that provisions had been made whereby the survivor of Grace and Sim would acquire all of the property. Heslinga then inquired as to whether provisions had been made as to who should succeed to the property upon the death of both of them. Upon being informed by Grace that no such provision had been made, Heslinga suggested that immediate arrangements should be made by Grace and Sim to plan their estates and in connection therewith to execute suitable wills. Grace agreed to this procedure and thereupon she, Heslinga, W. O., and Mildred proceeded into the doctor's conference room, where Grace's difficulties with Sam Cundiff were again explained and the doctor was requested to express an opinion as to Grace's mental condition, and also as to her and Sim's testamentary capacity. Dr. Voigt interrogated Grace at length concerning the members of her family, her relatives and the extent of her property, and in the presence of all four then stated he was of the opinion Grace was of sound mind, she had testamentary capacity, and knew what she was doing and the consequences of her acts. Later he signed and delivered to Heslinga a similar statement of his opinion concerning Grace's testamentary capacity. He also expressed an opinion that Sim Cundiff was then of sound mind and had testamentary capacity.
The four then retired from Dr. Voigt's office and proceeded to the parked McCurdy automobile. Mildred McCurdy departed on a shopping errand, leaving Heslinga, Grace Cundiff and W. O. McCurdy seated in the car. Heslinga and Grace conversed at length concerning the provisions of Grace and Sim's proposed wills, and Heslinga made notes. It appears that he then informed Grace he would prepare the requested wills, and made an appointment to meet Grace and Sim at the Cundiff home at 10 o'clock the following morning, September 23, 1952, to execute their wills. On the way home Grace told Mildred they were going to will 50% of their property to the Fremont Methodist Church.
Heslinga prepared wills for Sim and Grace, and on the following morning, September 23, 1952, he drove to Fremont in his car, where he contacted W. O. McCurdy and W. O.'s son, James McCurdy, and made arrangements for them to accompany him to the Cundiff home for the purpose of witnessing the execution of Grace and Sim Cundiff's wills. This same morning Grace Cundiff told Mrs. Clarence Else, wife of the plaintiff guardian, she was making plans to execute her will and she desired to appoint Mrs. Else's husband Clarence as administrator of her estate. By the time Heslinga and W. O. and James McCurdy reached the Cundiff home that morning Clarence Else had responded to Mrs. Cundiff's message by coming to the house. Else and Louis Meyers, the farm tenant, were at the Cundiff home when Heslinga and the two McCurdys arrived. Heslinga went into the house and there had a conversation with Meyers and Else in which he informed them he had business to transact with the Cundiffs concerning their estate and requested them to leave. Else and Meyers then went outdoors and visited with the two McCurdy men while Heslinga conversed with the Cundiffs in the house. Upon retiring from the house Heslinga informed Else that Sim and Grace had not executed the wills he had brought with him, and there were certain changes to be made. Heslinga and the two McCurdy men then left in Heslinga's car, and he returned to his law office in Oskaloosa where he prepared new wills *55 incorporating the additional provisions and names of beneficiaries the Cundiffs desired named in their wills.
On the following morning, September 24, 1952, Heslinga again drove to Fremont in his car, picked up W. O. and James McCurdy as witnesses, and went to the Cundiff home for the purpose of having the Cundiff wills executed. Grace's will was read aloud and she then executed it and it was witnessed by the two McCurdy men. The prepared draft of Sim's will, Exhibit D-4, the provisions of which were similar to the will signed by Grace, was then read to Sim down to and including paragraph 3 thereof. At that point Sim indicated his dissatisfaction with its terms and pushed the will aside. He then indicated by sound and motion his desire to obtain some object lying upon the kitchen table, which was a piece of paper then on the table. This piece of paper was cut in a triangular shape. Those present endeavored to ascertain Sim's desires and the meaning of the paper. After extended questioning in which Sim could not make himself understood, Sim got out of his wheel chair, down onto the floor and grabbing the leg of Heslinga's trousers and crawling on his hands and knees led Heslinga, Grace and the others, outdoors to Heslinga's car, and by motions indicated his desire to take a ride. They got into the car and Heslinga drove the car in the direction indicated by Sim. He directed them south along the highway, past the crossroads to the railroad crossing at the southeast corner of the tenant farm, then back to the crossroads and west to the tenant house. They then proceeded west in the car to the railroad crossing at the northwest corner of the farm, then turned around and returned to the crossroads and then north to the Cundiff home. Upon their return Mrs. Cundiff suggested to all of them that the paper was in the shape of the tenant farm and perhaps it was intended to represent the farm. Heslinga then inquired of Sim whether he was trying to tell him something about the farm, and Sim, by word and by motion of his head, indicated he was. Then, through questions propounded by Heslinga and answers made by Sim, Sim indicated he wished to make a gift of the farm to the church, not by a will, but by a deed in which a life estate was to be retained by Sim and Grace. Heslinga explained the tax problems involved in such a transaction and the legal implications of a will as distinguished from a deed to be presently delivered. Heslinga told Mrs. Cundiff and Sim that a will could always be torn up and revoked but that a deed was final and could never be changed or revoked.
Informing the Cundiffs that he would prepare such a deed and return to their home later on that day for its execution, Heslinga, W. O. and James McCurdy returned to Fremont. Heslinga obtained a blank deed form and a plat book from the Fremont Bank and after determining the correct legal description of the real estate involved, he prepared the deed on a borrowed typewriter. He ate his lunch alone at a cafe in Fremont and then returned to the Cundiff home. W. O. McCurdy again went with him.
It appears during Heslinga's absence Grace Cundiff telephoned Mrs. Mathews and said to her: "I've a very happy surprise for you and Dr. Mathews. I want you to come right on out to our place." Dr. and Mrs. Mathews responded to this request by immediately driving out to the Cundiff home in their automobile. Upon their arrival at the Cundiff home Grace did not immediately reveal to them the plan to make a gift of the farm to the church. When Heslinga arrived, he informed Dr. Mathews he had some business to transact with the Cundiffs which concerned the church and he did not wish them to be present. Grace then joined Heslinga and Sim in the back yard while Dr. and Mrs. Mathews remained in the front yard and W. O. McCurdy went to the porch of the house. Heslinga then read the deed in full, including the acknowledgment certificate, to Grace and Sim. The deed was then executed by Grace and Sim, and Heslinga completed the acknowledgment form in his capacity as a notary public. Heslinga then called Dr. and Mrs. Mathews and W. O. McCurdy into the back yard and there, in *56 the presence of Sim and Grace, informed all those present that Sim and Grace had just made a gift of their tenant farm to the church, by deeding it to the church. The deed was then handed by Heslinga to W. O. McCurdy. W. O. McCurdy and Dr. Mathews, on behalf of the church, expressed their very great appreciation for the gift and Dr. Mathews offered prayer in thanks. McCurdy then handed the deed to Heslinga and instructed him to take it to Oskaloosa to be recorded. There is a dispute as to whether Sim or Grace voiced or indicated any objection to the recording or publishing of the deed. However, the following day Mr. Heslinga did send the deed to the Mahaska County Recorder for recording.
Upon being informed that his bill was $13.00, Grace prepared a check in that amount and handed it to Heslinga before he left for Oskaloosa. No one else paid Heslinga for these services. It further appears that Heslinga at no time ever represented or acted as attorney for the Fremont Methodist Church, Dr. Mathews, any of the McCurdys or the partnership which is known as the McCurdy Seed Company.
On the day after the execution of the deed, September 25th, Mildred McCurdy was at the Cundiff home and Mrs. Cundiff told her: "We deeded this other farm to the Church. It was all Sim's idea." At that time she showed Mildred the triangular piece of paper, and told her Sim had cut it out.
A birthday-wedding anniversary party was held at the Cundiff home on September 28th. Subsequent to that date, and on September 30th, the Oskaloosa Herald published a list of all deeds which had been recorded recently in the County Recorder's office, including the Cundiff deed to defendant church. Prior thereto Grace told Louis Meyers, their tenant, about the execution of the deed, but at the party there was no reference to the execution of the deed and no complaint was made concerning its execution.
It was following the recording of the deed and talks with various persons that Grace made complaint concerning its execution and delivery. The minister first heard of this change of heart when she called him on the telephone and threatened to "close the doors of the Church" unless they returned the conveyance. Thereafter Louis Meyers took Grace to Heslinga's office to solicit his aid in helping her obtain the return of the deed, and when he declined to help her, Meyers took her to the office of another lawyer, John Sproatt, to consult with him concerning the deed.
There is little controversy in the case as to the applicable law, and the correct result rests largely upon an accurate determination and application of the facts involved.
I. One of appellant's contentions is that the trial court erred in finding from the disclosed facts that a confidential relationship existed between Dr. Mathews and W. O. McCurdy, chairman of the church board of trustees, on one hand, and Sim and Grace Cundiff on the other hand, thereby putting the burden upon appellant to justify the deed. As usual in cases of this nature this question lies at the threshold of a proper determination of the lawsuit. The record, as voluminous as it is, contains little direct evidence bearing on the subject. True, there was the relationship of clergyman and parishioner, but it is well settled that such relationship alone is not conclusive of a confidential relationship. Coughlin v. St. Patrick's Church, 201 Iowa 1268, 203 N.W. 812; Humphrey v. Norwood, 213 Iowa 912, 918, 240 N.W. 232; Roller v. Roller, 201 Iowa 1077, 1082, 203 N.W. 41; Stonewall v. Danielson, 204 Iowa 1367, 1370, 217 N.W. 456; O'Neil v. Morrison, 211 Iowa 416, 233 N.W. 708. Indeed few relationships in name only do carry such import, but the true test has been set forth in several of our cases and reaffirmed as late as our past session. See Dibel v. Meredith, 233 Iowa 545, 549, 10 N.W.2d 28; Merritt v. Easterly, 226 Iowa 514, 284 N.W. 397; Knigge v. Dencker, Iowa, 72 N.W.2d 494. The object back of the rule is to prevent one standing *57 in a confidential relationship with another from gaining an advantage in a transaction with the cestui que trust, which may reasonably be the result of the confidence reposed. Thus before one is allowed to retain the advantages of the transaction, he must show that the cestui acted with freedom, intelligence, and full knowledge of all the facts. Utterback v. Hollingsworth, 208 Iowa 300, 225 N.W. 419, and cases cited therein.
Usually the burden is on one seeking to set aside a deed upon the grounds of mental incapacity and undue influence such as we have here, and he is required to prove the allegations, not by a mere preponderance of the evidence, but by clear, satisfactory and convincing evidence. Merritt v. Easterly, supra, 226 Iowa 514, 516, 284 N.W. 397; Crawford v. Raible, 206 Iowa 732, 745, 221 N.W. 474; Foster v. Foster, 223 Iowa 455, 457, 273 N.W. 165. It should therefore be necessary for one alleging a confidential relationship so as to raise a presumption that transactions between the parties are improper or fraudulent, and shift the burden of proving that the cestui acted freely and with full knowledge of all the facts, to prove that relationship in a clear and convincing manner. Popejoy v. Eastburn, 241 Iowa 747, 757, 41 N.W.2d 764. Some little confusion has resulted in the consideration of most any friendly relationship as a showing of confidential relationship, but far more is necessary. Evidence must be produced to show how and in what manner the alleged trust was reposed, and how the dominance was exercised. The facts giving rise to the relationship, the showing that the one party was actually in a position of dominance or superiority, and the cestui in a corresponding position of inferiority or subservience, the strength of will of one and weakness of the other, the intimate character of their relation, and the facts showing the manner in which trusts and confidences had been reposed in the dominant party, must appear. In other words, this relationship should be clearly shown and not left to conjecture.
We think here the trial court fell into error by assuming, because of the religious nature of the relationship, it was a confidential relationship. This may be a considered factor but is far from conclusive and the ultimate confidential relationship presumed. The trusts, confidences, reliance, dominance, and subversion must be shown. Judge Mantz, speaking for our court in Dibel v. Meredith, supra, 233 Iowa at page 551, 10 N.W.2d at page 31, clarified the meaning of confidential relationship as follows:
"It was the holding in the cited case [Merritt v. Easterly] based upon authority that a confidential relationship arises where one person gains the confidence of another and purports to act and advise with the other's interest in mind."
He also had this to say in the same case, 233 Iowa at page 549, 10 N.W.2d at page 30:
"A confidential relationship arises whenever a continuous trust is reposed by one person in the skill and integrity of another, and so it has been said that all the variety of relations in which dominion may be exercised by one person fall within the general term `confidential relation'." Citing 15 C.J.S., Confidential, p. 822; Pomeroy's Equity Jurisprudence, 3d Ed., section 956.
Judge Bliss further pointed out in the case of Merritt v. Easterly, supra, 226 Iowa 514, 284 N.W. 397, some of the acts and circumstances under which a presumption of confidential relationship properly exists. From a careful reading of that case it is quite evident the defendant here was not shown exercising such a dominance or relationship toward the grantors. In that case the grantee took a deed from the grantor on March 3, 1937, which was alleged to be a gift. In November, 1935, grantee had moved in grantor's home and thereafter took complete charge of her affairs and attended to every detail. He took charge of her bank account and check book, made all deposits and withdrawals. The evidence disclosed he did many other things purportedly with her "interest in mind." It *58 was pointed out therein this court had no intention of fettering the operation of the principles which have been consistently followed by this and other courts in cases involving the correct and just presumption arising from confidential relationships by undertaking to define the term or give the precise limits thereof. Nevertheless we find therein an excellent discussion of the subject and a rather clear explanation of the elements required to be proven to establish this relationship. It is just and proper to so protect weak, incompetent and trusting persons from the fraudulent efforts of unscrupulous persons, but it is also necessary, we think, to show first how and in what manner that trust was reposed and how the dominance was exercised. In that respect the plaintiffs here have utterly failed.
Except for the opportunity to exercise these influences, the evidence discloses no such relationship. We cannot say the usual pastoral visits at the Cundiff home by the minister and his wife, or an occasional call by the chairman of the church board of trustees, who was also the lay leader of this little 100-member church, especially after Sim's illness, can give rise to such an inference. There was no showing these men ever told the Cundiffs what to do, nor were they consulted about any business matters. It is true Mrs. Cundiff said, in answer to a leading question, they consulted about religious and business matters. Her testimony was as follows:
"Q. Did you place trust and confidence in Mr. Mathews? A. Yes, sir. We sure did.
"Q. Also Mr. McCurdy? A. We sure did. I thought he was a Christian man.
* * * "Q. Did they discuss religious matters with you? A. Oh, yes.
"Q. And some business matters? A. Yes. But I didn't always know about that, that would be in the back yard."
But no further details were related. These were important, if true, to establish the alleged relationship, and without evidence thereof, it is of little value to the court.
It is most difficult to find any evidence of the demands or dominance of this minister or Mr. McCurdy, or the subservience of the Cundiffs. They handled no business matters for the Cundiffs and, except for pleasant social relations, we find no evidence of dependence upon them. As a matter of fact, the Cundiffs seemed to be the ones who did the demanding, and these church people, including the daughter-in-law of Mr. McCurdy, a talented musician, and other neighbors and friends, went out of their way to be kind to them and do acts of servitude, especially after Sim's illness. See O'Neil v. Morrison, supra, 211 Iowa 416, 233 N.W. 708.
The fact that McCurdy and his daughter-in-law provided transportation to Oskaloosa on September 22nd at the request of Mrs. Cundiff, does not infer a relationship of dominance over her or her husband. There is nothing at all in this record to show the grantors reposed any special faith and confidence in any suggestions of McCurdy or the minister, certainly not to the extent that they sacrificed their own ideas to those of the church officers. Indeed the evidence disclosed complete independent thinking for themselves, for Mrs. Cundiff wanted a will drawn to her liking, and Mr. Cundiff did not want a will but a deed to his liking. Not once does it appear that the minister or McCurdy offered even a suggestion, to say nothing of a demand for a deed or specific provision or a bequest in the wills for the benefit of the church. We cannot infer from their opportunity or even their disposition to do so that they did so, and thus relieve the parties who would set aside the deed from proving by clear, satisfactory and convincing evidence that its execution and delivery was obtained by undue influence, fraud, or due to the mental incompetency of the grantors. Their relationship was not shown to be any more pronounced than that of many other friends and neighbors who frequently came in to assist at the time of Mr. Cundiff's illness and convalescence. We conclude therefore plaintiffs have failed to prove the alleged trust, confidence, *59 reliance or dominance required to establish the confidential relationship alleged.
II. The trial court found the defendant did not sustain the burden of proof imposed by law on it to show no unfair advantage was taken of the Cundiffs in the transaction. This conclusion, due to our difference with the trial court in Division I hereof, is therefore also in error. It was not defendant's burden, for we determined the alleged confidential relationship had not been established. Therefore, the burden remained the plaintiffs' to prove undue influence by clear, satisfactory and convincing evidence. Merritt v. Easterly, supra, 226 Iowa 514, 516, 284 N.W. 397; Mastain v. Butschy, 224 Iowa 68, 84, 276 N.W. 79. The expression of this court found in In re Estate of Mott, 200 Iowa 948, 205 N. W. 770, approved in Worth v. Pierson, 208 Iowa 353, 223 N.W. 752, and Arndt v. Lapel, 214 Iowa 594, 603, 243 N.W. 605, 609, is as follows:
"`"Influence, to be undue, within the meaning of the law, must be such as to substitute the will of the person exercising the influence for that of the testator, thereby making the writing express, not the purpose and intent of the testator, but that of the person exercising the undue influence. It must be equivalent to moral coercion, must operate at the very time the will is made, and must dominate and control the making of it. [Citing many cases.] * * * Undue influence is not established by proof of opportunity to exercise it. Importunity, request, and persuasion that do not go to the point of controlling the will of the testator are not enough, nor is it established by proof of opportunity and disposition so to do. [Citing cases.] * * * Contestants must go further than this, and show not only the existence of the facts, but that said undue influence existed, and controlled the maker of the instrument in the disposition he made of his property, substituting the will of the person exercising the influence for the will of the person making the writing."'"
Also see Knigge v. Dencker, recently handed down by this court and written by Justice Thompson, Iowa, 72 N.W.2d 494, and cases cited therein.
As to the law of undue influence, little further need be said. Relationship of the parties, improvidence of the gift, activities of beneficiaries, and weakened mental condition might under some circumstances become important. It is manifest to us that under the record these elements did not control, and what we said as to the failure to prove facts that would give rise to a confidential relationship also applies here. See Osborn v. Fry, 202 Iowa 129, 209 N.W. 303; Humphrey v. Norwood, supra, 213 Iowa 912, 918, 240 N.W. 232. Although the burden of proof was not upon it, we think defendant has shown good faith in its relationship with the Cundiffs. There is no showing it interfered or tried to interfere with the wishes or decisions of either Grace or Sim Cundiff.
It will be recalled Grace gave detailed instructions as to how she wished her will drawn and the attorney took notes on two occasions in order to incorporate therein the specific bequests desired by her. There is no contention McCurdy, who was present the first time, made even a suggestion. It was her desire that both prepared wills, hers and Sim's, provide that 50% of the balance left after both were deceased should go to the church building fund. There is no contention that after her will was so prepared she did not sign it in the presence of witnesses, or that Sim did not refuse to sign his will, and in doing so indicated he had other ideas about the tenant farm. When questioned by their attorney at that time, it developed Sim wished to deed that farm to the church rather than will 50% of all their remainder. When the legal implications of such a transfer were explained to him by the attorney, in her presence and in the presence of others, Sim signified that was his desire, and the deed was prepared. Rather than a straight deed, it provided for a life estate in Sim and Grace Cundiff and was executed and delivered in the afternoon of September 24, 1952.
We have carefully reviewed the record and find nowhere even the slightest indication *60 that the will of either the minister or the board chairman was substituted for that of Sim or Grace Cundiff. As heretofore pointed out, if kindness or willingness to help these good people could supply that fact, then all the neighbors thereabout, including their tenants and their present guardian, must be viewed with suspicion, for they also called on the Cundiffs frequently after Sim's stroke and offered help and assistance. No doubt there was a feeling of gratitude toward all these people by the Cundiffs, but clearly we cannot infer thereby a dominance over Sim and Grace. They too, or most of them, were listed as beneficiaries under the prepared wills. But as previously pointed out, even if all these parties had tried to persuade the action of the Cundiffs, that would not have been sufficient, for the law requires a clear and convincing showing that the grantor's will was not his own but that of the party benefited by the instrument, to constitute the exercise of undue influence. Clearly then, the fact that several months before the illness of Sim, the minister and the board chairman had stopped to solicit church funds and report on a canvass to determine the feasibility of a church building program, did not furnish the basis of a superimposed will causing the execution of the deed.
True, there was no consideration for the deed, but clearly none was intended, for it was a gift in contemplation of death. It can scarcely be called an improvident gift, for besides having the life use of the property, the Cundiffs still had a farm of about the same size and about $30,000 in cash and bonds. They had no children, and there were only a brother of Sim's, whom Grace did not like but feared, and a sister of Grace's, who seemed to be of no interest to Grace.
As a matter of fact, it rather clearly appears the Cundiffs wished to do for the church. They had, before Sim's illness, given $800 at one time and $400 at another through a tenant. They wanted a new church built. Defendant contends, with some merit, it was the publicity they received due to the recording of the deed that caused the trouble. Whether it was that or the comments of their neighbors, it is evident they did change their minds. Even though they were warned by their lawyer at the time of the execution as to the import of a deed, they nevertheless now apparently wish to otherwise dispose of that property. Mrs. Cundiff testified that when she signed the deed, she knew it was a deed, and that before she signed it Heslinga said: "Mrs. Cundiff, if you sign a will, you can just tear it up, but you couldn't do a deed that way," and "Mrs. Cundiff, after you sign a will, you can have it changed, but you can't do a deed that way." She also testified that the deed "was Sim's idea" and that she signed it to please Sim. It is now too late to change their minds, for deeds may not be so easily upset. It was grantors' desire then, and if either of them thereafter became unsound of mind, who can say their desire thereafter is the right one? Sim suffered with arteriosclerosis, and how far that malady had developed does not appear. It is well known that it is a progressive disease and it is quite possible that he soon thereafter reached the stage where his mind was unsound. Clearly after that his will could not be determined.
We find support for this conclusion in Leonard v. Leonard, 234 Iowa 421, 428, 12 N.W.2d 899, 902, where we said:
"In order to set aside a deed such as the one in the present case the burden is upon the plaintiff to establish by clear, satisfactory and convincing testimony that the grantor at the time he signed it did not understand in any reasonable manner the nature of the particular transaction in which he was engaged and the consequences and effects upon his rights and interests. Foster v. Foster, 223 Iowa 455, 273 N.W. 165, and cases cited; * * *. The courts have uniformly upheld the right of every person to dispose of his property freely and in accordance with his wishes and have refused to permit such right to be disturbed without strong proof. * * * Our decisions uniformly hold that to set aside an instrument on the *61 ground of undue influence there must be such persuasion as results in overpowering the will of a person or prevents him from acting intelligently, understandingly and voluntarilysuch influence as destroys the free agency of the grantor and substitutes the will of another person for his own." Citing Osborn v. Fry, 202 Iowa 129, 209 N.W. 303, and Gates v. Cole, 137 Iowa 613, 115 N.W. 236.
Only by sheer conjecture could it be found here there existed any basis for a finding that the will of the grantor had been superimposed for nowhere do we find any testimony that anyone suggested that the Cundiffs deed the triangular or tenant farm to the church. Mrs. Cundiff herself said it was all Sim's idea.
Then too, undue influence must operate at the very time the instrument is executed. In re Estate of Brooks, 229 Iowa 485, 493, 294 N.W. 735; In re Estate of Eiker, 233 Iowa 315, 317, 6 N.W.2d 318. The rule was well announced in In re Estate of Hollis, 324 Iowa 761, 769, 12 N.W. 2d 576, 581, where we said:
"Undue influence, although of course it may be proven by circumstantial evidence, must be such as to substitute the will of the person exercising it for that of the testator, thereby making the writing express the purpose and intent of such person, not of the testator. It must be equivalent to moral coercion. It must operate at the very time the will is made and dominate and control its making. It is not established by proof of opportunity and disposition to exercise it. Importunity, request and persuasion that do not control the will are not enough." (Citing cases.)
Also see Campbell v. Hale, 233 Iowa 264, 6 N.W.2d 128, for effect of available opportunity for independent advice.
It is interesting to note, in regard to Grace Cundiff's declarations as to her intent on the execution of the deed, this pronouncement in In re Estate of Eiker, supra, at page 317 of 233 Iowa, at page 320 of 6 N.W.2d:
"We have uniformly held that the fact of the exercise of undue influence cannot be established by proof of declarations of the testator made before or after the execution of the will, such declarations not being substantive evidence of undue influence. There must be some substantive evidence of the exercise of undue influence before declarations may be considered."
Reasonable limits of an opinion do not permit a discussion of all the contentions relating to undue influence. However, we conclude there was insufficient clear, satisfactory, and convincing proof of undue influence exercised by defendant in procuring the deed.
III. Perhaps plaintiffs' principal contention is that both Sim Cundiff and his wife Grace did not have mental capacity to execute the deed, and did not know or realize the import of their act. Such contention likewise demands of plaintiffs clear, satisfactory, and convincing evidence. We find no merit in the contention as to Grace Cundiff. The most persuasive evidence produced as to her mental capacity was from her own doctor, Dr. Voigt, who said, after an examination of her two days before the deed was signed, that she was mentally competent to execute such instruments. Grace said she was nervous, distracted and mentally disturbed due to Sim's illness, and though she knew she was signing a deed, and its import, she was doing it to humor Sim and did not think it would amount to any actual transfer. Several friends and neighbors testified she appeared distraught and mentally disturbed after Sim's illness, but none said she was of unsound mind. Mere mental weakness in a grantor is not grounds to invalidate a deed. In Nowlen v. Nowlen, 122 Iowa 541, 546, 98 N.W. 383, 384, we said:
"Mere mental weakness in a grantor will not invalidate a deed. To have that effect, the mental powers must be so far deteriorated or destroyed that the grantor is incapable of understanding in a reasonable *62 degree the nature and consequences of the instrument he executes."
Also see Paulus v. Reed, 121 Iowa 224, 96 N.W. 757; Gernhart v. Gernhart, 194 Iowa 487, 185 N.W. 483.
Plaintiffs' witnesses said Grace was "worked up like anyone would be," and "Grace appeared to be very distraught and worked up" due to Sim's stroke and physical disability. Dr. McNichols, called by plaintiffs, did not express an opinion as to her mental soundness. We think there is no question that she had the mental capacity to execute the deed on September 24, 1952, knew exactly what she was doing, and knew the consequences of the act. She said she knew it was a deed, but thought it was all being done to please Sim and therefore meant nothing; in other words, was all a hoax upon her unfortunate spouse. We doubt that story.
As to Sim the evidence, though somewhat stronger, is still insufficient to satisfy us he was of unsound mind or did not know what he was doing on the date the deed was executed, or that he did not have the ability to comprehend and understand the nature of his act and its consequences. See 26 C.J.S., Deeds, § 54, page 264, note 95. Mere weakness of mind, or periods of unsoundness of mind in or about that time, are not sufficient proof of mental incapacity to execute a deed if at the time of its execution it clearly appears one has the capacity to comprehend and understand the nature of his act and its consequences. Nowlen v. Nowlen, supra; Altig v. Altig, 137 Iowa 420, 423, 114 N.W. 1056; Cavanagh v. O'Connor, 186 Iowa 257, 264, 169 N.W. 747; Coughlin v. St. Patrick's Church, supra; Leonard v. Leonard, supra; Keune v. McCauley, 228 Iowa 607, 609, 293 N. W. 25.
Here too plaintiffs offered no testimony as to Sim's actual mental condition on the day the deed was executed. An expert witness, Dr. McNichols, produced by plaintiffs, freely admitted that one suffering from the ailment such as Sim had, might possibly have subsequent sane or lucid intervals, though a permanent recovery was not possible. It is true Dr. Campbell, a physician who examined him some months later, found him to be of unsound mind, and said in his opinion that condition existed at the time of the conveyance. But on the other hand, Dr. McNichols, who attended Sim at the time of the stroke in July, 1952, said it was not too severe and he would improve both physically and mentally sixty or ninety days thereafter. On the day of the stroke Dr. McNichols considered him of unsound mind, but did not examine him thereafter and did not know whether he was of sound or unsound mind on September 24, 1952. However, from his experience with like cases, the greater percentage of cases did not result in the patient's loss of a sound mind. "They are of sound mind following a stroke such as Sim Cundiff sustained," he said.
There was the usual testimony of nonexperts as to Sim's mind, and the tenor of those opinions was that, although he knew and recognized them, because he had a blank expression on his face, could only talk or make himself understood with difficulty, mostly answering questions with yes or no, could walk very little and did not show too much interest in things about him, he was of unsound mind, at least at times; also that he was forgetful. They are not very helpful, nor are the facts upon which these witnesses based their opinions as to Sim's mental soundness. See Olson v. Olson, 242 Iowa 192, 204, 46 N.W.2d 1, 40 A.L.R.2d 1. None testified as to the state of his mind on September 24, 1952, the day the instrument was signed. On the other hand, Dr. Voigt, Sim's physician of several years past, expressed the opinion to the Cundiffs' attorney, Mr. Heslinga, two days before the deed was signed that he thought Sim of sound mind and able to execute a legal document.
The undisputed testimony that Sim rejected the will Grace had drawn for him and in a rather ingenious manner indicated the land he wished to deed to the church instead, and the answers given to Attorney Heslinga when he inquired as to Sim's desire, seems to lead to the conclusion he did at that time have the capacity to comprehend *63 and to understand the nature of his act and its consequences. Even Grace said "It was all Sim's idea." As a matter of fact it was a gift which probably would be less than 50% of the remainder after Grace and Sim died, and reasonably could be expected to result in lower court costs in realization. It disclosed a rational decision, if they desired to give a substantial gift to the church.
We fail to find in these undenied transactions any clear or convincing evidence of undue influence or mental incapacity of either party, and therefore plaintiffs' contentions that such existed at or near the time of the deed's execution must fail.
It may be conceded that weakened mental condition such as Sim Cundiff suffered is a factor to be considered, but here he was attended by his wife Grace and his attorney Heslinga, and only by them at the time of the execution of the deed. It must be concluded they would not have permitted him to sign the deed if they had not been convinced he knew what he wanted, what he was doing. They were his helpers and were in a position to give him independent advice or the guidance he might desire. Merritt v. Easterly, supra, at page 528 of 226 Iowa, at page 404 of 284 N.W. Even from plaintiffs evidence it satisfactorily appears that on September 24, 1952, the grantors intended the deed to the land in controversy should be delivered to defendant herein. It would unduly extend this opinion, already too long, to comment at length upon all the testimony and conflicting evidence on Sim's mental soundness, so we say upon the whole record plaintiffs have failed to show by clear, satisfactory, and convincing evidence that Sim or Grace were so mentally incompetent at the time the deed was made that they did not know what they were doing or understand the consequences of their act.
We are supported by a host of cases, among which are: Merritt v. Easterly, supra, 226 Iowa 514, 516, 284 N.W. 397; Crawford v. Raible, supra, 206 Iowa 732, 745, 221 N.W. 474; Keating v. Augustine, 213 Iowa 1336, 1347, 241 N.W. 429; Foster v. Foster, supra, 223 Iowa 455, 457, 273 N.W. 165. Furthermore there is a strong presumption in favor of the grantors' mental competency. Evers v. Webb, 186 Iowa 1172, 1178, 173 N.W. 264; Wilson v. Wilson, 240 Iowa 26, 34 N.W. 2d 911.
In Coughlin v. St. Patrick's Church, supra, 201 Iowa 1268, 1280, 203 N.W. 812, we said:
"While the case is close on the fact question of mental competency,more so than on the question of undue influence, we are of the opinion that, at the time of the execution of the conveyances, the grantor was possessed of such mental capacity as enabled him, in law, to execute the deeds in question."
Perhaps the most significant fact on the issue of mental capacity is the apparent willingness of Grace to permit Sim to sign the deed and to join him in doing so, and the fact that Sim's own attorney, Garold Heslinga, permitted him to execute the deed after consulting with Sim's own physician, Dr. Voigt, relative to Grace and Sim's mental condition. These facts are quite persuasive of the regularity of this transaction.
IV. In arriving at a conclusion different from that of the trial court, we are aware that we have said many times we give serious consideration to the findings of that court because it saw and heard the witnesses. However, we are not bound by its finding, especially in matters like the one at hand where the law is not in dispute and the witnesses who testified to various facts were apparently attempting to tell the truth. There appears to be no serious question of credibility or veracity which should be left to the trial court's better determination. We must, we think, determine for ourselves whether the case has been established by clear, satisfactory, and convincing evidence. Of course this matter is reviewable de novo. Peddicord v. Peddicord, 242 Iowa 555, 47 N.W.2d 264.
It is here not a question whether these witnesses have an honest and abiding convictim *64 as to their expressed opinions on the mental capacity of the parties, but whether the facts they relate are sufficient to support such opinions and convince the court of their correctness. Those opinions are not controlling. They did not refer to the time the deed was made, and some of them did not express the belief Sim was at all times unable to know what he was doing or what was going on. Quite the contrary, he knew most of them at all times and conversed with them the best he could with his speech defect. We attach little significance to the fact he sometimes tried to put a lighted end of a cigar in his mouth, and on one occasion started to wash his feet with his socks on. Many sane old men are just that forgetful. At the most these incidents could disclose only a weakness of mind and body or a forgetfulness common to people of his age, and not a condition which disclosed an inability to know or understand the nature of his acts and their consequences.
We must therefore differ with the conclusions of the able trial court in this matter.
V. We should not conclude this opinion without some comment upon the unfortunate reflection cast upon Mr. Heslinga, the attorney who was drawn into this controversy by being employed by Mrs. Cundiff. We are convinced he served only the Cundiffs. They alone paid him for his services. As the attorney for the Cundiffs we are convinced he furnished them independent, good, and correct legal advice, and nothing is shown to substantiate a charge that he conspired to aid the church obtain the deed in controversy. He received only $13 for his services, which consisted of a conference in Oskaloosa and two trips to the Cundiff home near Fremont, plus the preparation of four wills and a deed. The only possible mistake he made was to assume the Cundiffs wanted their friend Mr. McCurdy as a witness to the wills and took him and his son along for that purpose. However, there is not the slightest indication he was acting for the minister, Mr. McCurdy, or anyone but the Cundiffs. It is suggested the neighbors could have been used as witnesses, but it does not appear the attorney personally knew them or that they may have been desired by the Cundiffs.
VI. Defendant's counterclaim, which prayed that its title to the real estate be quieted subject only to the life estate of Sim and Grace Cundiff, should be upheld. The trial court's dismissal of the counterclaim, as well as its cancellation of the deed, must therefore be reversed.
Reversed and remanded for decree in accordance with this opinion. Reversed and remanded.
All Justices concur except OLIVER, C. J., and PETERSON, J., who take no part.
| {
"pile_set_name": "FreeLaw"
} |
Identification of N-homocysteinylated apolipoprotein AI in normal human serum.
In human serum, a portion of homocysteine (Hcy) exists as an N-linked form to the epsilon-amino group of protein lysine residues. N-homocysteinylated proteins differ structurally and functionally from native proteins. The present study strives to develop detection and potential semi-quantification methods for N-homocysteinylated apolipoprotein AI (N-Hcy-apoAI) in human serum. Serum treated with or without cysteamine was supplied to isoelectric focusing (IEF) followed by an immunoblot using an anti-apoAI antibody. Cysteamine treatment increased the isoelectric point for N-Hcy-apoAI, but not for unmodified apoAI, due to the presence of -SH group(s) derived from Hcy and the absence of a cysteine residue in the apoAI molecule. N-Hcy-apoAI was semi-quantified from the scanned immunoblot pattern via a computer. After cysteamine treatment, N-Hcy-apoAI in the serum was identified by IEF at the position with a higher pI value compared with intact apoAI. The reproducibility (between assays) of the semi-quantification method was 19.1% CV (coefficient of variation) for an average ratio 5.9% of N-Hcy-apoAI to the whole apoAI in the serum. Approximately 1.0-7.4% of apoAI was N-homocysteinylated in the serum obtained from 27 healthy subjects. Neither the ratio of N-Hcy-apoAI nor its concentration, calculated by total apoAI concentration, indicated correlation with the so-called total (free and S-linked) Hcy concentration. We directly found that a portion of apoAI in the serum undergoes homocysteinylation in an N-linkage manner, and used this to develop a potential semi-quantification method for N-Hcy-apoAI. | {
"pile_set_name": "PubMed Abstracts"
} |
News
UCP LEADER TAKES A SHOT AT THE PM—NO BACKSIES
The UCP leader isnt taking back anything he said this week about Prime Minister Justin Trudeau.
During an interview with the Calgary Sun—Jason Kenney was asked what he thought about the Prime Minister’s handling of the TransMountain matter..
Kenney said Trudeau doesnt have a clue what he’s doing—he’s an empty, trust-fund millionaire who’s got the political depth of a finger bowl–and cant read a briefing note longer than a cocktail napkin.
And when he was talking about it with reporters yesterday—he said he stands by his statement:
“I worked with dozens of MP’s in Ottawa, including critics who were thoughtful, intelligent, engaged people with whom I had a constructive relationship. Um–he wasnt one of them.”
For her part, Premier Rachel Notley thinks its more personal:
“I would suggest anyone who is presenting themselves as being equipped to lead the province—needs to learn very quickly—to rise above personal hostilities—and that is not what we see demonstrated in this.” | {
"pile_set_name": "Pile-CC"
} |
Lotus programs (the client Notes and server) use a special port for
communication: according to some docs it is 1352. According to my experience,
running Notes under Wine requires a corresponding service known by the system.
Adding these line to /etc/services helps:
lotusnote 1352/tcp lotusnotes # Lotus
lotusnote 1352/udp lotusnotes # Lotus
---
Run Lotus Notes under Wine, try to connect to an example server already present
in the adress book.
--- | {
"pile_set_name": "Pile-CC"
} |
Introduction {#Sec1}
============
Many fundamental questions concerning the mechanisms of self-renewal and differentiation of stem cells are addressed using *Drosophila* oogenesis as a model^[@CR1]^. *Drosophila* ovaries consist of ovarioles, chains of egg chambers connected to the germarium, which houses germline stem cells (GSCs). A microenvironment of somatic cells known as a niche regulates GSC state via different cell signaling pathways^[@CR1]--[@CR3]^. The ovarian niche includes terminal filament (TF) cells, cap cells (CCs), and escort cells (ECs). GSCs directly contact CCs and the most anterior ECs, which prevent GSC differentiation by secreting decapentaplegic (Dpp) and glass bottom boat (Gbb) protein ligands^[@CR4]--[@CR7]^. These ligands interact with GSC surface receptors and activate BMP signaling, which represses transcription of the *bam* gene required for GSC differentiation. After GSC division, one of the daughter cells retains its stem state, whereas the other one leaves the self-renewal niche and begins to differentiate into a cystoblast, which then divides and differentiates to form a cyst of germ cells surrounded by somatic follicle cells. A special marker of GSCs and cystoblasts is the spectrosome, a cytoplasmic body, which transforms into a branching structure called the fusome connecting the dividing germ cells. To initiate the differentiation of the cystoblast, BMP signaling must be decreased by different intrinsic and extrinsic mechanisms^[@CR8]^. The majority of ECs limit the spreading of BMP ligands and therefore promote differentiation of the cystoblasts and dividing cysts^[@CR9],[@CR10]^. Thus, the renewal somatic niche provides maintenance signals for GSCs, while a more posteriorly located differentiation niche, represented by ECs, is required for proper differentiation of GSC progeny.
The piRNA (Piwi-interacting RNA) pathway controls expression of transposable elements (TEs) in both somatic and germ cells of *Drosophila* ovaries. Piwi proteins guided by small piRNAs (24--30 nt) recognize complementary RNA molecules leading to their degradation or the repression of transcription with the help of other proteins (for review see^[@CR11]^). The known molecular function of the piRNA pathway in the ovarian soma is the repression of a specific group of somatically active LTR retrotransposons^[@CR12]--[@CR16]^. The piRNA machinery in *Drosophila* ovarian somatic cells seems to be simpler than its counterpart in the germline. It operates via a single Piwi protein unlike the three proteins in germ cells and a substantial part of somatic piRNAs originates from a single source, the piRNA cluster *flamenco* (*flam*)^[@CR14],[@CR15],[@CR17]^ that is an extended 180 kb region of X-chromosome heterochromatin, filled by TE copies and their fragments^[@CR18]--[@CR20]^. The *flam* locus is responsible for the repression of at least three somatically expressed retrotransposons: *gypsy*, *ZAM* and *Idefix*^[@CR21]--[@CR24]^. Cleavage of *flam* transcripts into small RNA molecules occurs in cytoplasmic Yb bodies. The cytoplasmic piRNA biogenesis machinery in somatic cells includes the nuclease Zucchini (Zuc), the RNA helicase Armitage (Armi), the TUDOR domain-containing proteins fs(1)Yb (Yb) and Vreteno (Vret), and other components^[@CR16],[@CR25]--[@CR27]^. In the course of *flam* transcript cleavage, piRNAs are loaded into Piwi and then move into the nucleus, where mature piRNA-Piwi complexes recognize complementary TE transcripts and repress their transcription with the help of adaptors, which recruit histone modification proteins, such as H3K9 methyltransferase Eggless (Egg) and H3K4 demethylase dLSD1^[@CR28]--[@CR32]^.
piRNA pathway mutations cause upregulation of TEs and lead to different oogenesis defects and sterility. Initially, two key components of the piRNA system, Piwi and Yb, have been shown to be required in somatic cells to prevent GSC loss^[@CR33],[@CR34]^. Later it was found that the lack of several components of the somatic piRNA pathway, including Piwi^[@CR35]--[@CR37]^, Vret^[@CR27]^, *flam*^[@CR23],[@CR38]^ and Egg^[@CR38],[@CR39]^ lead to the accumulation of undifferentiated germ cells in germaria, known as a germline tumor phenotype. The germ cell differentiation defects observed in piRNA pathway mutants are thought to be related to the dysfunction of ECs^[@CR36],[@CR37],[@CR39]^. Knockdowns of Piwi and Yb specifically in ECs induced large numbers of ectopic GSC-like cells^[@CR36],[@CR37]^. However, the underlying mechanisms are contradictory. Several papers noted an increased rate of somatic cell death in ovaries due to TE activation^[@CR27],[@CR38]^. Others have found that Piwi downregulates expression of the *dpp* gene in ECs^[@CR36],[@CR37]^ and that TE activation decreases the expression of Wnt4 ligand, which ensures EC function in germ cell differentiation^[@CR39]^. It has been shown also that *piwi* mutations disrupt the spatial position of gonadal intermingled cells (the EC progenitors) and germ cells in early development^[@CR36]^.
Here we provide results indicating that the germ cell differentiation defects caused by somatic TE activation in *flam* mutants are due to a decrease of EC precursor population at the larval stage, whereas no EC death or additional decline of their production rate was observed in *flam* adult ovaries. We also found drastic oogenesis defects in *flam* mutants combined with mutations of genes encoding Chk2 (Checkpoint kinase 2) or ATM (ataxia telangiectasia-mutated) checkpoint kinases, contrary to known suppressor effect of *chk2* mutation on ovarian development caused by TE derepression in the germline^[@CR38],[@CR40]--[@CR43]^. These results indicate that the somatic cells of ovaries are especially sensitive to TE upregulation upon loss of the Chk2 DNA damage response pathway.
Results {#Sec2}
=======
The occurrence of germ cell differentiation defects caused by somatic TE activation correlates with a reduced number of ECs {#Sec3}
---------------------------------------------------------------------------------------------------------------------------
To extend previous observations^[@CR27],[@CR37]--[@CR39]^ that activation of TEs in ovarian somatic cells leads to germ cell differentiation defects, we estimated the spectrosome-containing cell number in ovaries lacking various components of the somatic piRNA pathway, some of which have not been tested in this regard before. For this and most subsequent experiments, we analyzed ovaries of 7-day-old females to allow tumor phenotype to develop to a pronounced degree. α-spectrin immunostaining revealed a drastic increase in the number of spectrosome-containing cells upon somatic depletion of Asterix (Arx) (also known as GTSF1) (Fig. [1a,b](#Fig1){ref-type="fig"}), a nuclear Piwi cofactor^[@CR29],[@CR30]^. Depleting Armi, a cytoplasmic component of piRNA biogenesis machinery^[@CR16],[@CR25]^, in all somatic cells of ovaries (Fig. [1a,b](#Fig1){ref-type="fig"}) or only in ECs (Fig. [S1a](#MOESM1){ref-type="media"}) also caused germline tumors. Moreover, this phenotype was observed in ovaries lacking Zuc and Yb proteins (Fig. [S1b](#MOESM1){ref-type="media"}). *piwi*^*Nt*^ mutation causing TE derepression due to cytoplasmic Piwi localization^[@CR44]^ also led to the excess of spectrosome-containing germ cells (Fig. [S1c](#MOESM1){ref-type="media"}), whereas in agreement with our previous report^[@CR44]^ a GSC loss phenotype was rare in *piwi*^*Nt*^ ovaries in contrast to *piwi* null mutants (Fig. [S1d](#MOESM1){ref-type="media"}). Thus, our results together with previous findings^[@CR27],[@CR38],[@CR39]^, show that defects in germ cell differentiation are associated with the disruption of any component of the TE silencing pathway in somatic cells of ovaries.Figure 1The occurrence of germ cell differentiation defects caused by somatic TE activation correlates with a reduced number of ECs. (**a**) Examples of wild-type and tumorous germaria stained for α-spectrin (red) to detect spectrosomes and fusomes and for lamin (blue) to visualize cell nuclei. A wild-type germarium (upper panel) usually contains 2--3 GSCs and a few cystoblasts marked by round spectrosomes (s). GSC are located at the anterior end of the germarium in close proximity to somatic cap cells (cc). Dividing cysts carry branched fusome structures (f). Germaria of Arx (middle panel) and Armi (lower panel) knockdowns (KDs) driven by *traffic jam Gal4* (*tj-Gal4*) in ovarian somatic cells carry an excess of spectrosome-containing cells and lack fusomes. (**b**) Quantification of spectrosome-containing cells in 7-day-old females with KDs of piRNA pathway components in ovarian somatic cells. Each dot corresponds to a single germarium. The central mark indicates the median, and the bottom and top lines indicate the 25th and 75th percentiles, respectively. All tested KD germaria contain significantly more spectrosomes than control (Mann--Whitney U-test; \*p \< 0.00001). Effects of Piwi and Vret KDs corroborate previously reported result^[@CR27],[@CR35]--[@CR39]^ (**c**). Quantifi**c**ation of spectrosome-containing cells in 7-day-old *flam* mutants (Mann--Whitney U-test; \*p \< 0.00001). (**d**) Quantification of ECs in *flam* germaria using *PZ1444-lacZ* line. EC number per germarium is indicated (Mann--Whitney U-test; \*p \< 0.00001). (**e**) Immunostaining of *flam*^*KG*^/*Df* and control germaria for α-spectrin (red), *PZ1444-lacZ* (green) and lamin (blue). (**f**) Increase of spectrosome-containing cell number in mutant germaria containing a reduced number of ECs. Percentage of *flam*^*KG*^/*Df* germaria with more than 10 spectrosome-containing cells in groups of germaria with different number of ECs is shown, based on three replicates (n = 181). Mean +/− s.d. are indicated. (Student's t-test; \*\*p \< 0.05). Scale bars, 10 µm.
Mutations affecting protein-coding genes could exert pleiotropic effects, if corresponding proteins have additional specific functions in oogenesis, unrelated to TE repression, as has been reported for Piwi^[@CR45],[@CR46]^. Therefore, to directly examine the influence of activated somatic TEs on germline differentiation, we focused on the studies of *flam* piRNA cluster mutants. In most experiments, we analyzed *flam*^*BG*^*/Df* and *flam*^*KG*^*/Df* mutants carrying P-element-induced mutations^[@CR17],[@CR23]^ and an X chromosome deletion (*Df*) covering the whole *flam* locus. Both mutants exhibit the derepression of *flam*-regulated somatic TEs (Fig. [S2b](#MOESM1){ref-type="media"}) and about one-half of mutant germaria show a prominent germline tumor phenotype (Figs. [1c](#Fig1){ref-type="fig"} and [S3a](#MOESM1){ref-type="media"}) and some other defects (Fig. [S3b](#MOESM1){ref-type="media"}). We found no or faint *bam-GFP* reporter^[@CR4]^ expression in germ cells constituting tumors in *flam*^*KG*^*/Df* germaria (Fig. [S3c](#MOESM1){ref-type="media"}), indicating an abnormally enhanced BMP-signaling, which may be caused by the failure of ECs to restrict Dpp spreading^[@CR9],[@CR10]^. The number of ECs visualized by immunostaining for *PZ1444 lacZ* reporter expression^[@CR47],[@CR48]^ was reduced about two-fold from an average of 29 ECs per germarium in the *flam*/+ control to 16 and 18 ECs in *flam*^*KG*^*/Df* and *flam*^*BG*^*/Df* mutants, respectively (Figs. [1d](#Fig1){ref-type="fig"} and [S3d](#MOESM1){ref-type="media"}). ECs of *flam* mutants lacked cellular processes that wrap up differentiating germ cells in wild-type ovaries (Fig. [S3e](#MOESM1){ref-type="media"}). The latter effect may be a consequence of defective germline differentiation according to literature. For example, it has been shown that *bam* mutation impedes the formation of EC processes^[@CR9]^.
Although the decrease in the EC number was previously reported for *piwi* somatic knockdown^[@CR37]^, it was not clear whether EC reduction directly affects the germ cell differentiation. Since both the spectrosome and EC numbers substantially varied among individuals carrying *flam* mutations, we wondered how these parameters would be related within a single genotype. Simultaneous immunostaining of mutant ovaries with antibodies against α-spectrin and β-galactosidase (*PZ1444* reporter) (Fig. [1e](#Fig1){ref-type="fig"}) revealed that germline tumors were rarely detected in *flam* germaria containing more than 20 ECs, whereas germaria with a small number of ECs more often accumulated large numbers of spectrosome-containing cells (Fig. [1f](#Fig1){ref-type="fig"}). This result clearly shows a correlation between EC number reduction and germline tumor formation. Alternatively, the disruption of the differentiation niche may be caused by the loss of EC functional status, such as an abnormal or reduced production of signaling molecules. Impairment of different signaling pathways, including Wnt^[@CR35],[@CR49]--[@CR51]^, Rho^[@CR9],[@CR52]^, EGFR^[@CR53],[@CR54]^, Hh and Hpo/Yki^[@CR52]^, as well as the enhancement of BMP signaling in ECs may lead to the germline tumor phenotype. Specifically, loss of piRNA pathway in ECs has been shown to be associated with enhancement of Dpp expression^[@CR36],[@CR37]^ and a decrease in Wnt signaling^[@CR39]^. However, we observed no significant changes in the Wnt2 ligand mRNA expression, a two-fold decrease of the Wnt4 ligand and Frizzled3 (Fz3, target of Wnt pathway) mRNAs and a slight upregulation of Dpp in both *flam*^*KG*^*/Df* and *flam*^*BG*^*/Df* germaria compared to control siblings (Fig. [S4a](#MOESM1){ref-type="media"}). The two-fold decrease of *wnt4* expression is likely explained by the observed two-fold reduction of EC number in *flam* mutants (Fig. [1d](#Fig1){ref-type="fig"}), given that Wnt4 (but not Wnt2) is expressed only in ECs and is not detected in other cell types in the germarium^[@CR49]^. The observed Dpp upregulation in *flam* germaria (Fig. [S4a](#MOESM1){ref-type="media"}) can also be interpreted as a consequence of EC number reduction, because the antagonism between Wnt and BMP pathways in the ovarian somatic cells has been established^[@CR50],[@CR51]^. The Wnt4 target *tkv-lacZ* expression^[@CR49]^ was similar in ECs of *flam* and control ovaries indicating active Wnt signaling (Fig. [S4b](#MOESM1){ref-type="media"}). Secreted Wnt ligands are known to act in ECs in an autocrine manner^[@CR49],[@CR51]^ resulting in stabilization of a downstream effector protein β-catenin/Armadillo (Arm)^[@CR55]^. We failed to find any alteration of Arm protein level in *flam* germaria by Western blot (Fig. [S4c](#MOESM1){ref-type="media"}). Overexpression of Arm in *flam* mutants did not cause a decrease in spectrosome-containing germ cell number (Fig. [S4d](#MOESM1){ref-type="media"}). Similarly, expression of the constitutive Arm form (*UAS-Arm-S10*) driven by *c587-Gal4* in ECs did not rescue the germline tumor phenotype of *piwi* mutants (Fig. [S4e](#MOESM1){ref-type="media"}). As a whole, these results suggest that the germ cell differentiation defect in *flam* mutants is mediated rather by a decrease in the number of ECs, than by dysfunction of remaining ECs.
EC number and the formation of germline tumor phenotype in flam mutants are determined at the larval stage {#Sec4}
----------------------------------------------------------------------------------------------------------
ECs are initially produced from the intermingled cells during larval and pupal development^[@CR56]--[@CR58]^. Then, in adult ovaries ECs exhibit slow turnover rates, though a fraction of ECs is renewed. Escort stem cells^[@CR59]^ or self-duplications of ECs^[@CR9],[@CR10]^ were previously suggested as a source of new ECs in the adult gonads. A recent study revealed that new ECs in the imago are produced by divisions of follicle stem cells^[@CR60]^. The reduction of EC number in *flam* germaria could be attributed to an increased rate of EC death, to defects of their renewal in adult ovaries or to a decline of EC production during earlier development. The TUNEL assay revealed less than 10% of *flam*/+ germaria containing at least one apoptotic EC. Unexpectedly, in *flam*^*KG*^*/Df* germaria the apoptotic ECs were even less frequently detected (Fig. [S5a--c](#MOESM1){ref-type="media"}). To examine the formation of new ECs in *flam* ovaries, we carried out immunostaining for phosphohistone H3 Ser10 (PH3) mitotic marker and EdU incorporation assay. Both methods failed to detect a significant number of newly formed ECs in the *flam*^*KG*^*/Df* and control flies (Fig. [S5d,e](#MOESM1){ref-type="media"}). Furthermore, most ovaries of females fed on EdU-containing food for three days did not contain EdU-positive ECs (Fig. [2a](#Fig2){ref-type="fig"}), suggesting that ECs in tested lines are mainly produced at earlier developmental stages. Importantly, we found about the same number of ECs in germaria of one-, four- or seven-day-old *flam* adults (Fig. [2b](#Fig2){ref-type="fig"}). Thus, the decrease of EC number is observed already in one-day-old *flam* mutants (Fig. [2b](#Fig2){ref-type="fig"}) and, therefore, is determined prior to the imago stage.Figure 2*flam* mutation leads to a reduction in EC number in larval development but not in adults. (**a**) *flam*^*KG*^/+ germarium of an adult female after feeding EdU for three days, stained for EdU (purple) and lamin (red). (**a'**) The same germarium with *PZ1444* immunostaining (green). ECs (indicated by green arrows) and CCs are EdU-negative. (**b**) Quantification of ECs in *flam*^*KG*^/+ (red dots) and *flam*^*KG*^/*Df* (green dots) flies at the age of 1, 4 and 7 days. The differences between samples of different ages of the same genotypes are not significant (n.s.) (Mann--Whitney U-test; p \> 0.1). (**c,d**) Germaria of females, obtained from larvae reared on EdU-containing food. White and green arrows indicate EdU-positive and EdU-negative ECs, respectively. (**e**,**e'**) An example of *flam*^*KG*^/*Df* germarium with large number of ECs, most of which are EdU-negative after larval EdU incorporation. Full Z-series projections are shown. (**f**,**f'**) *flam*^*KG*^/+ germarium. EdU-positive ECs are located at the more anterior region of the germarium compared to EdU-negative ECs. (**g**) Quantification of EdU-positive and EdU-negative ECs in *flam*^*KG*^/+ and *flam*^*KG*^/*Df* germaria after larval EdU feeding. Mean +/− s.d. are indicated, based on three replicates (Student's t test; \*p = 0.01; n.s. = not significant). Scale bars, 10 µm.
To find out the developmental stage when ECs are lost, we reared larvae on EdU-containing food, then placed eclosed flies on standard food and analyzed 3-day-old fly ovaries. In this case, all dividing larval cells will contain EdU signals, which then will be diluted with each round of replication in pupae and adults. Expectedly, the follicle cells and most of the germ cells were EdU-negative. Conversely, strong EdU immunostaining was observed in CCs and TF cells (Fig. [2c--f](#Fig2){ref-type="fig"}), which are known to be formed in larvae and then do not divide or renew^[@CR56]--[@CR58],[@CR61]^. About 70% of ECs were also labeled by EdU in *flam*^*KG*^/+ germaria. Apparently, the EdU-positive ECs were formed as a result of a few divisions of parental cells marked by EdU incorporation at the larval stage, while the EdU-negative ECs were likely produced later in development or originated from more actively proliferating cells. Interestingly, EdU-positive ECs were usually located more anteriorly than EdU-negative ECs (Fig. [2c,f](#Fig2){ref-type="fig"}), which is consistent with the possible origin of the latter from follicle stem cells^[@CR60]^. In *flam*^*KG*^*/Df* germaria we observed a significant decrease of EdU-positive EC number compared to *flam*^*KG*^/+ sisters (Fig. [2d,e,g](#Fig2){ref-type="fig"}), which demonstrates decreased EC precursors formation in *flam* larvae. However, the number of EdU-negative ECs in *flam* mutant showed a large scatter of values (Fig. [2g](#Fig2){ref-type="fig"}). In some *flam* germaria the number of the EdU-negative ECs was even increased compared to control (as exemplified in Fig. [2e](#Fig2){ref-type="fig"}), suggesting that new ECs can be actively produced after the larval stage to compensate for the lack of EC precursors in earlier development.
Primordial germ cells (PGCs) starting from mid-larval third instar stage are associated with intermingled cells that are EC progenitors. At this stage, all germ cells of the developing ovary are grouped together. Germaria formation occurs later in pupae, when TFs, CCs and their attached PGCs are separated into individual germaria units^[@CR56],[@CR62],[@CR63]^. If EC number and germline differentiation defects are determined during larval development of *flam* gonads, a correlation can be expected between phenotypes of germaria within the same ovary. Indeed, we found that the numbers of both ECs and spectrosomes were quite similar in *flam* germaria belonging to the same ovary but varied substantially between individual ovaries (Fig. [3](#Fig3){ref-type="fig"}). Thus, developmental events prior to the pupal stage predetermine the germ cell differentiation defects in *flam* mutants.Figure 3*flam* germaria belonging to the same ovary exhibit similar phenotypes. Quantification of spectrosome-containing cells (**a**) and ECs (**b**) per germarium in the same ovaries of *flam*^*KG*^/*Df* mutants. Germaria in one оvary are shown by grouped dots of the same color. Spectrosome numbers in germaria from tumorous ovaries (A and B) are significantly higher than their numbers in the non-tumorous ovaries (C-G) (Mann--Whitney U-test; \*p \< 0.05 for A and B vs C-G).
*flam* mutation induces DNA breaks in somatic cells of larval ovaries {#Sec5}
---------------------------------------------------------------------
The observed decline of EC precursor production in larval ovaries may be caused by the appearance of TE-induced DNA lesions in their genomes. To check this, we examined the presence of phosphorylated H2Av (γ-H2Av) histone, a commonly used DNA break marker^[@CR64]^, in larval somatic intermingled cells marked by Traffic jam (Tj) immunostaining^[@CR56],[@CR58]^. γ-H2Av dots were observed in 10--20% of Tj-positive cells in wild-type (*Batumi*) and *flam*^*KG*^/+ (Fig. [4a](#Fig4){ref-type="fig"}) third instar larval (L3) ovaries. In *flam*^*KG*^*/Df* L3 ovaries about 80% of Tj-positive cells contained γ-H2Av signals (Fig. [4b,c](#Fig4){ref-type="fig"}). γ-H2Av foci were also detected in Tj-negative somatic cells, including TF cells, as well as somatic apical (AP) and basal (BS) cells (Fig. [4b](#Fig4){ref-type="fig"}), which are known to be not incorporated into germaria^[@CR57]^. However, most PGCs surrounded by intermingled cells did not contain γ-H2Av foci in mutant ovaries (Fig. [4b](#Fig4){ref-type="fig"}). Thus, the *flam* mutation leads to DNA breaks in somatic, but not germline cells of the larval ovaries. Immunostaining with activated Caspase3 antibodies, as well as TUNEL assay detected an increase of somatic cell death in *flam*^*KG*^*/Df* larval ovaries (Fig. [S6](#MOESM1){ref-type="media"}). However, we cannot exclude that a reduction of EC number is partially caused by a decrease of division rate of EC precursors.Figure 4Intermingled cells in *flam* larval ovaries more often contain DNA breaks than ECs in adult ovaries. (**a**,**a'**) The *flam*^*KG*^/+ ovary of third instar larval stage stained for lamin (green), γ-H2Av DNA break marker (red) and Traffic jam (Tj, blue) showing intermingled cells (IC). Tj-negative cells include somatic apical (AP) and basal (BC) cells, TF, and Primordial germ cells (PGC). (**b**,**b**') *flam*^*KG*^*/Df* L3 ovaries accumulate γ-H2Av in most ICs and other somatic cells, including TF and AP, but not in PGCs. (**c**) Quantification of γ-H2Av-positive among Tj-positive cells in *flam*^*KG*^/+ and *flam*^*KG*^/*Df* larval ovaries. Mean + /− s.d. are indicated (Student's t test; \*p \< 1e-26). (**d**) *flam*^*KG*^/+ germarium of adult ovary stained for lamin (blue), γ-H2Av (red) and *PZ1444* EC marker (green). γ-H2Av signals are observed mainly in germ cells (GC, indicated by yellow arrows). (**e**,**e'**) In *flam*^*KG*^**/***Df* germaria γ-H2Av foci appear in most follicle cells (FC, white arrows) and only in some *PZ1444*-marked ECs (green arrows). (**f**) Quantification of γ-H2Av signals in FCs and ECs in ovaries of adults. Mean + /− s.d. are indicated (Student's t test; \*p \< 1e-9). Scale bars, 10 µm.
Then we monitored γ-H2Av presence in the somatic cells of adult *flam* ovaries. In *flam*/+ germaria, as in wild-type, γ-H2Av signals were absent in ECs and CCs, but were detected in the meiotic germ cells and endocycling nurse cells (Fig. [4d](#Fig4){ref-type="fig"}) where DNA breaks are generated during normal development^[@CR65]--[@CR69]^. In the *flam*^*KG*^*/Df* germaria only about 20% of ECs contained γ-H2Av foci, whereas follicle cells were mostly γ-H2Av-positive (Fig. [4e,f](#Fig4){ref-type="fig"}). These observations indicate that DNA damage events occur in mature *flam* ECs less often than in their precursors, intermingled cells, at the larval stage and/or mature ECs have an enhanced capacity to repair DNA lesions.
The absence of Chk2 or ATM checkpoint kinases enhanced oogenesis defects of *flam* mutants {#Sec6}
------------------------------------------------------------------------------------------
DNA damage is known to block cell proliferation through the activation of checkpoint kinases, which induce cell cycle arrest followed by apoptosis or DNA repair (for review see^[@CR70]^). *Drosophila* Chk2 encoded by the *Mnk/Loki* gene together with other checkpoint kinases is required for cell cycle arrest in response to DNA breaks in both somatic and germ cells^[@CR71]--[@CR74]^. Another function of Chk2 is p53 phosphorylation that activates transcription of genes involved in DNA repair and/or apoptosis pathways^[@CR75],[@CR76]^. To examine whether the *flam* mutant phenotype is mediated by the checkpoint response to TE-induced DNA breaks, we crossed the *mnk*^*p6*^ mutation (the well-characterized loss of function allele^[@CR42],[@CR43],[@CR71],[@CR77]^) into a *flam* mutant background. Although the *chk2* mutation was shown to partially rescue the germline differentiation defects induced by TE activation in germ cells^[@CR38],[@CR42],[@CR43]^, we unexpectedly observed its opposite effect in *flam* mutants. The *flam*^*KG*^*/Df*; *mnk*^*p6*^/*mnk*^*p6*^ double mutants had drastically more defective ovaries than *flam*^*KG*^*/Df*; *mnk*^*p6*^/+ individuals, whereas *flam*^*KG*^/+; *mnk*^*p6*^/*mnk*^*p6*^ ovaries displayed no visible morphological defects (Fig. [5a--d](#Fig5){ref-type="fig"}). The formation of germaria was abolished in most *flam*^*KG*^*/Df*; *mnk*^*p6*^/*mnk*^*p6*^ ovaries (Fig. [5c,d](#Fig5){ref-type="fig"}) and in some of them the number of Tj-positive ovarian somatic cells was highly reduced (Fig. [5d](#Fig5){ref-type="fig"}). Severe oogenesis defects were also observed when we combined *flam* with two different mutations in the *tefu* gene (Fig. [S7](#MOESM1){ref-type="media"}), encoding a *Drosophila* homolog of ATM kinase that is directly recruited and activated by DNA double-strand breaks, acting upstream of Chk2^[@CR70],[@CR78]^. We suggested that the observed catastrophic ovarian phenotypes can be induced by the death or dysfunction of ovarian somatic cells, including ECs due to their inability to repair TE-induced DNA lesions. Then, we checked whether DNA breaks are accumulated in ECs of *flam* mutants lacking checkpoint response. We found that somatic cell nuclei in rarely observed germaria-like structures of *flam*^*KG*^*/Df*; *mnk*^*p6*^/*mnk*^*p6*^ ovaries were dramatically enriched in γ-H2Av signals compared to both *flam*^*KG*^*/Df*; *mnk*^*p6*^/+ and *flam*^*KG*^/+; *mnk*^*p6*^/*mnk*^*p6*^ germaria (Fig. [5e--g](#Fig5){ref-type="fig"}). Somatic depletion of Mnk in the *flam*^*KG*^*/Df*, but not *flam*^*KG*^/+ background also caused accumulation of γ-H2Av in nearly all ECs (Fig. [5h,i](#Fig5){ref-type="fig"}) in contrast to about 20% of γ-H2Av-positive ECs observed in *flam*^*KG*^*/Df* ovaries (Fig. [4f](#Fig4){ref-type="fig"}). In addition, γ-H2Av foci were accumulated in ECs upon depletion of another checkpoint kinase, mei-41 (*Drosophila* homolog of ATR) (Fig. [5h,j](#Fig5){ref-type="fig"}), which, however, did not enhance oogenesis defects. Thus, Chk2, ATM and ATR kinases are involved in cellular response upon TE activation in ECs or their progenitors, but their specific molecular functions in this process warrant further examination.Figure 5c*hk2* mutation enhances ovarian defects in *flam* mutants. (**a**) *flam*^*KG*^/*Df*; *mnk*^*p6*^/+ germarium stained for lamin (blue), α-spectrin (red) and Tj (green) showing nuclei of CCs, ECs and FCs. (**b**) *flam*^*KG*^/+*; mnk*^*p6*^*/mnk*^*p6*^ germarium with no morphological defects. (**c,d**) Fragments of *flam*^*KG*^/*Df*; *mnk*^*p6*^/*mnk*^*p6*^ ovaries showing an impaired formation of germaria and ovarioles. Abnormal germaria-like structures (G) are filled with spectrosome-containing cells and lack Tj-positive somatic cells or lack both germ cells and ECs. Separate accumulations of Tj-positive somatic cells (S) are indicated. (**e**) Immunostaining of *flam*^*KG*^/+; *mnk*^*p6*^/*mnk*^*p6*^ germarium with Tj (green), γ-H2Av (red) and lamin (blue). γ-H2Av signals are observed in meiotic germ cells and in a few somatic cells. (**f**) *flam*^*KG*^*/Df*; *mnk*^*p6*^/+ germarium containing γ-H2Av dots in follicle cells and in some ECs. (**g**) *flam*^*KG*^*/Df*; *mnk*^*p6*^/*mnk*^*p6*^ germarium showing increased intensity of γ-H2Av signals in Tj-positive somatic cells. (**h**) Quantification of γ-H2Av-positive ECs in *flam*^*KG*^*/Df*; *tj-Gal4/Cy* (no KD, control), *flam*^*KG*^*/Df*; *tj-Gal4* \> *mnk KD* and *flam*^*KG*^*/Df*; *tj-Gal4* \> *mei-41 KD* ovaries. Mean +/− s.d. are indicated (Student's t test; \*p \< 0.001). **(i)** Immunostaining of *flam*^*KG*^*/Df*; *tj-Gal4* \>*mnk KD* germarium with γ-H2Av (red) and lamin (blue) and Tj-marked somatic cells (green) (**i')**. **(j,j')** Immunostaining of *flam*^*KG*^*/Df*; *tj-Gal4* \>*mei-41 KD* germarium with the same antibodies. (**k**) A working model of the occurrence of germ cell differentiation defects due to TE activation in ovarian somatic cells. Scale bars, 10 µm.
Discussion {#Sec7}
==========
Activation of TEs in ovarian somatic cells is known to compromise differentiation of germ cells^[@CR27],[@CR38],[@CR39]^. Here, we found that the accumulation of GSC-like cells caused by mutations in the somatic piRNA cluster, *flam*, is determined by an insufficient number of somatic ECs. We demonstrated that the decrease of EC production in *flam* mutants, as well as the formation of germline tumor phenotype, depend on the events which occur in larvae and possibly at earlier stages of development, but not in the adult ovaries (Fig. [5k](#Fig5){ref-type="fig"}). These observations are consistent with previous report showing that Piwi expression in intermingled cells during the larval L3 stage is required to restrict GSC number in adults^[@CR36]^. Of note, somatic piRNAs against TEs were found to be produced de novo in large amounts between embryogenesis and the L3 stage^[@CR79]^ that shows the piRNA pathway activity in somatic cells of larval ovaries. Our finding of abundant DNA breaks in intermingled cells of *flam* mutant (Fig. [4b,c](#Fig4){ref-type="fig"}) indicates that activated TEs affect the genome of EC precursors at the larval stage. Interestingly, the intermingled cells accumulated more DNA breaks than mature ECs (Fig. [4](#Fig4){ref-type="fig"}). The reason for this vulnerability of somatic niche to TE activation during larval development remains unclear.
Mobilization of TEs in the germ cells was shown to initiate the checkpoint response. In developing oocytes, TE-induced DNA breaks trigger Chk2-dependent oocyte polarization abnormalities^[@CR40],[@CR41]^. Consistent with this, *chk2* mutation suppresses polarization defects in the oocytes of piRNA pathway mutants^[@CR40],[@CR41]^. Derepression of TEs in GSCs leads to Chk2-mediated arrest of cell cycle^[@CR42],[@CR43],[@CR80]^ and induction of p53 activity^[@CR81]^, which launches DNA repair or apoptosis. In particular, mutation of *aub* gene encoding a germline-specific piRNA-binding protein is phenotypically manifested as a decrease of GSC number and a delayed differentiation of cystoblasts^[@CR42],[@CR43]^. The *chk2* mutation partially rescues these defects^[@CR42],[@CR43]^. Transpositions of *P* element during hybrid dysgenesis also induce Chk2-dependent arrest of germ cell differentiation and selective apoptosis of some GSCs, whereas mutating Chk2 restores GSC self-renewal and normal looking germaria^[@CR38],[@CR80]^. However, in this case *chk2* mutants show strong γ-H2Av signals and death of some cells at all oogenesis stages and never restore fertility^[@CR80]^. Interestingly, GSCs in dysgenic females are able, over time, to acquire resistance to *P* element due to the piRNA amplification by ping-pong mechanism, whereas this adaptation does not occur in *chk2* mutants^[@CR80]^. As a result, the ovarian defects in older dysgenic females are enhanced by *chk2* mutation^[@CR80]^. Here, we for the first time examined the role of checkpoint response upon genomic stress caused by TE activation in somatic cells of ovaries, which lack ping-pong piRNA amplification^[@CR11],[@CR14],[@CR15]^. We found that the absence of Chk2 or ATM kinases in the *flam* mutant background leads to dramatically more severe oogenesis defects compared to those induced by the *flam* mutation alone (Figs. [5](#Fig5){ref-type="fig"} and [S7](#MOESM1){ref-type="media"}). Thus, in contrast to germ cells, the Chk2-dependent response to TE activation in somatic ovarian cells is critical for the preservation of normal ovarian structure. The observed phenotypes of *flam mnk* double mutants indicate the loss of somatic cells due to the accumulation of unrepaired DNA lesions (Fig. [5](#Fig5){ref-type="fig"}). Our results suggest that the primary function of the Chk2-mediated response in ovarian somatic cells is the induction of DNA repair (Fig. [5k](#Fig5){ref-type="fig"}). The canonical activation of DNA repair/apoptosis pathways following DNA damage requires Chk2-mediated phosphorylation of p53^[@CR75],[@CR76]^. However, p53 activity in *Drosophila* ovaries was shown to be restricted to GSCs and cystoblasts^[@CR81]^, suggesting that in ovarian somatic cells Chk2 induces DNA repair by an unknown mechanism, which is of interest for further research.
Methods {#Sec8}
=======
Drosophila stocks {#Sec9}
-----------------
*Drosophila melanogaster* stocks were maintained under standard conditions at 25 °C. For analysis of *flam* mutations the following stocks were obtained from the Bloomington Drosophila Stock Center: *w*^1118^ *P{GT*1*}*^1^*, flam*^*BG02658*^ (\#13912, *flam*^*BG*^), *y*^*1*^ *P{SUPor-P}flam*^*KG00476*^ (BDSC \#16453, *flam*^*KG*^) and *Df(1)Exel6255*, *w*^1118^ *P{XP-U}Exel6255*/*FM7c* (BDSC \#7723, *flamDf*). To distinguish between *flam*^*KG*^*/Df* and *flam*^*KG*^/+ larvae we used the *y*^1^ *w*^*67c23*^ *Alr*^1^/*FM7i, P{w\[ + mC\] = ActGFP}JMR3* (BDSC \#25048) balancer and manually selected GFP-positive and GFP-negative larvae. To visualize ECs *flam* mutations were combined with the *PZ1444 lacZ* enhancer trap line^[@CR47],[@CR48]^. For *piwi*, we used *piwi*^2^ and *piwi*^3^ null mutations^[@CR34]^ and *piwi*^*Nt*^ mutation with disrupted Piwi nuclear localization^[@CR44]^. To analyze *piwi*^*Nt*^*/piwi*^*Nt*^ females we used a strain with a higher survival rate of homozygous flies due to a change of genetic background. The following UAS-RNAi stocks were obtained from Vienna Drosophila Resource Center (VDRC): piwi-RNAi (\#101658), vret-RNAi (\#34897, \#101134), armi-RNAi (\#103589), arx-RNAi (\#40480, \#40479), mei-41-RNAi (\#11251), Chk2-RNAi (\#110342). RNAi depletion or expression of proteins was induced by *UAS-Dicer tj-Gal4* driver active in most somatic ovarian cells^[@CR16],[@CR82]^ or *c587-Gal4* driver active in ECs and early follicle progenitors^[@CR9],[@CR37]^. Other fly stocks were the following: *Df(2 L)Prl* and *zuc*^*HM27*^ (from T. Schüpbach lab), *mnk*^*p6*^ (*lok*^*p6*^)^[@CR71]^ (from M. Simonelig lab), *tefu*^1^, *tefu*^*red3*1^ ^[@CR83]^, *fs(*1*)Yb*^*1*^ (*Yb*^*1*^), *fs(1)Yb*^[@CR72]^ (*Yb*^[@CR72]^)^[@CR33]^, *bamGFP*^[@CR4]^, *Batumi*, *P{w(+mC) = UAS-arm.S10}C, y(1) w(1118)* (BDSC \#4782, *UAS-arm.S10*), *y(1) w(1118); P{w(+mC) = UAS-arm.Exel}2* (BDSC \#8369, *UAS-arm*), *y(1) w(67c23)*; *P{w(+mC) = lacW}tkv(k16713)*/*CyO* (BDSC \#11191, *tkv-lacZ*), *y(1) w(\*); P{w(+mC) = UAS-mCD8::GFP.L}LL5* (BDSC \#5137, *UAS-mCD8::GFP*).
Immunostaining {#Sec10}
--------------
For spectrosome analysis ovaries from 7-day-old females were used, and for other purposes - as indicated in the text. We revealed that germline differentiation defects in *flam* and *piwi* mutants are more pronounced in the progeny of older parents and to standardize further analysis we used offspring from the parents less than three weeks old. Immunostaining was basically performed as described previously^[@CR84]^ with some modifications. Ovaries were manually isolated in PBT (PBS containing 0.01% Tween-20) at 4 °C, rinsed in PBS and fixed in 4% formaldehyde (in PBT) for 25 min at room temperature. Fixation was stopped by incubation with 0.25 M glycine (Sigma-Aldrich) for 5 min. Then ovaries were washed in PBS three times for 10 min at room temperature, permeabilized with PBTX (PBS with 0.1% Tween-20, 0.3% Triton X-100) for 10 min, blocked with PBTX containing 3% normal goat serum (NGS, Invitrogen) for 3 h, incubated with primary antibody in PBTX containing 3% NGS for 7 h at room temperature, or overnight at 4 °C, washed in PBTX three times for 10 min, incubated with secondary antibodies (1:1000) in PBTX containing 3% NGS for 7 h or overnight in a dark chamber, and then washed in PBTX three times for 10 min. Coverslips were mounted with a drop of SlowFade Gold Antifade reagent (Invitrogen) containing DAPI. The following primary antibodies were used: rabbit anti-lamin Dm0 (1:500, provided by P. Fisher^[@CR85]^), chicken anti-β-galactosidase (1:500, Abcam, ab9361), mouse anti-β-galactosidase (1:200, DSHB \#40-1а), rabbit anti-pS10H3 (1:200, Millipore \#MC463), rabbit anti-GFP (1:500, Abcam, ab290), mouse anti-α-spectrin (1:200, DSHB, 3А9), rabbit anti-γ-H2av (1:100, Rockland, anti-H2AvD pS137), rat anti-Vasa (1:100; DSHB), guinea pig anti-Tj (1:5000, a gift from Dorothea Godt), rabbit anti-Caspase-3 antibody (1:200; Abcam, ab13847). The following secondary antibodies (Invitrogen, Thermo Fisher Scientific) were used: anti-rat IgG Alexa Fluor 546; anti-rabbit IgG Alexa Fluor 488; anti-rabbit IgG Alexa Fluor 546; anti-rabbit IgG Alexa Fluor 633; anti-mouse IgG Alexa Fluor 488; anti-mouse IgG Alexa Fluor 633; anti-chicken IgG Alexa Fluor 633; anti-guinea pig IgG Alexa Fluor 488; anti-guinea pig IgG Alexa Fluor 633. Confocal microscopy was done using LSM 510 META system (Zeiss).
TUNEL assay {#Sec11}
-----------
TUNEL staining was performed using Click-iT™ Plus TUNEL Assay for *In Situ* Apoptosis Detection, Alexa Fluor™ 647 dye kit (\#C10619, Invitrigen, Thermo Fisher Scientific) according to the manufacturer's instructions.
EdU incorporation assays {#Sec12}
------------------------
For the two-hour EdU labeling, the ovaries were incubated in Grace's medium containing 10 µM EdU for 2 hours at 25 °C. For the EdU *in vivo* incorporation assay, females were fed on food with yeast paste containing EdU (0.5 mM) for three days. For larval EdU assay, parental flies were placed on EdU-containing food (0.5 mM), where larvae developed. Then newly eclosed flies were placed on food without EdU and after 3 days the ovaries were dissected and analyzed.
The ovaries from all these types of assays were fixed, permeabilized as described above, and processed for EdU label detection using the Click-iT™ reaction according to the manufacturer's instructions. Click-iT reaction was carried out in a cocktail containing Alexa Fluor 647 azide, triethylammonium salt (\#A10277, Invitrogen) and Reaction Buffer Kit (\#C10269, Invitrogen) 30 min in the dark at room temperature. Then ovaries were washed in PBTX and processed for immunostaining.
Western blot {#Sec13}
------------
Ovarian lysates were fractionated by SDS-PAGE (10% acrylamide gel) and transferred to a PVDF membrane (Immobilon-P, Millipore). Blots were developed using alkaline phosphatase-conjugated secondary antibody (Sigma) and the Immun-Star AP detection system (Bio-Rad). The following primary antibodies were used: mouse anti-Arm (1:500, DSHB), and mouse anti-β-Actin (1:3000; Abcam, ab8224).
RT-qPCR analysis {#Sec14}
----------------
Total RNA was isolated from manually dissected ovaries using Trizol reagent (Invitrogen, Thermo Fisher Scientific) and cleared of genomic DNA by DNA-free kit (Ambion).
For analysis of signaling pathway genes in germaria, RNA was isolated from 0-1-day ovaries containing no late stage egg chambers. 1 μg of total RNA was used for the reverse transcription reaction with oligo(dT) primer and Superscript II reverse transcriptase (Invitrogen). The resulting cDNAs in at least three biological replicates were analyzed by RT-qPCR performed in MJ Mini thermal cycler (Bio-Rad) using SYBR Green chemistry (Applied Biosystems). The following primers were used for PCR:
Gypsy for CTTCACGTTCTGCGAGCGGTCT,
Gypsy rev CGCTCGAAGGTTACCAGGTAGGTTC,
Zam for3 TCACATCCTTCCAGCAATCTTCAA,
Zam rev3 TATTACAGTTTCTGACATTATTTCTTCGTG,
MDG1 dir AACAGAAACGCCAGCAACAGC,
MDG1 rev CGTTCCCATGTCCGTTGTGAT,
Idefix for AACAAAATCGTGGCAGGAAG,
Idefix rev TCCATTTTTCGCGTTTACTG,
dpp for2 GGCTTCTACTCCTCGCAGTG,
dpp rev2 TGCTTTTGCTAATGCTGTGC,
wnt4 for5 ATGATCCTCACCCACCTGAG,
wnt4 rev5 ACCTGACCAGCATTGTTTCC,
wnt2 for CAATAACCGAGCAGGGAGAAC,
wnt2 rev CATGAGTCTATCGCCAACCAG,
fz3 for TCTGCTTCGTCCTGACACTG,
fz3 rev CCTTGCTTGATTGTGGAACAC,
Rp49_up ATGACCATCCGCCCAGCATAC,
Rp49_rev2 GCTTAGCATATCGATCCGACTGG.
Supplementary information
=========================
{#Sec15}
Supplementary information.
**Publisher's note** Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Supplementary information
=========================
is available for this paper at 10.1038/s41598-020-57901-2.
We thank T. Schüpbach, M. Simonelig and the Bloomington Drosophila Stock Center for the fly stocks, M. Siomi and P. Fisher for antibodies and Y. Shevelyov for helpful discussion on the manuscript. The work was carried out with the use of the equipment of the common use center «Center of Cell and Gene Technology», Institute of Molecular Genetics, RAS. The work was supported by the grant from Russian Foundation for Basic Research \[16-04-01524 for M.K.\] and by the Presidium of the Russian Academy of Sciences program Molecular and Cell Biology (for V. G.).
M.K., O.S., V.G. and E.M. designed experiments; O.S., E.M., S.K., Y.A. and M.K. performed experiments; M.K. wrote the manuscript with support from V.G.; M.K. coordinated the project.
All data generated or analyzed during this study are included in this published article (and its Supplementary Information Files).
The authors declare no competing interests.
| {
"pile_set_name": "PubMed Central"
} |
Q:
Encryption / Decryption PHP classes
What is the best encryption / decryption class / functions that can encrypt an array of data or objects and return it as a hash serialized string?
Then, on decryption, the serialized strings can be decrypted back to its original form of values containing objects or array values.
Thanks
A:
Preface: You seem to have a notion that hashing some data would be the same thing as encrypting it. Hashing is NOT encryption and cannot be reversed with a password or keyfile, like encryption can.
PHP comes with several hashing protocols like md5 (md5_file), SHA1 (SHA1_file). It all really depends on what you're doing with this hash and what you're hashing in the first place.
A:
The mcrypt library has a lot of functions to do encryption in as many ways as you can dream. Here's an example using AES:
$secretKey = 'the longer, the better';
$originalString = 'some text here';
$iv_size = mcrypt_get_iv_size(MCRYPT_RIJNDAEL_256, MCRYPT_MODE_CBC);
$iv = mcrypt_create_iv($iv_size, MCRYPT_RAND);
$crypttext = mcrypt_encrypt(MCRYPT_RIJNDAEL_256, $secretKey, $originalString,
MCRYPT_MODE_CBC, $iv);
printf( "Original string: %s\n", $originalString );
// Returns "Original string: some text here"
printf( "Encrypted string: %s\n", $crypttext );
// Returns "Encrypted string: <gibberish>"
$decrypttext = mcrypt_decrypt(MCRYPT_RIJNDAEL_256, $secretKey, $crypttext,
MCRYPT_MODE_CBC, $iv);
// Drop nulls from end of string
$decrypttext = rtrim($decrypttext, "\0");
printf( "Decrypted string: %s\n", $decrypttext );
// Returns "Decrypted string: some text here"
| {
"pile_set_name": "StackExchange"
} |
Q:
Distinct() on Class, anonymus type and SelectListItem
I want to select all categories from a webservice. The webservice does not have a method for that, so I have to get all products, then select all categories that these products are in. When I recieve the data from the webservice, I make WebServiceProduct (ID, Name, etc) and WebServiceCategory (ID, Name, etc) objects of it.
This does not work:
IQueryable<SelectListItem> categories = (from p in webserviceProductRepository.GetProducts()
from c in p.Categories
select new SelectListItem
{
Value = c.ID.ToString(),
Text = c.Name
}).Distinct().OrderBy(c => c.Text);
But it works when I first select it as a anonymus type:
var foo = (from p in webserviceProductRepository.GetProducts()
from c in p.Categories
select new
{
ID = c.ID.ToString(),
Name = c.Name
}).Distinct().OrderBy(c => c.Name);
IQueryable<SelectListItem> categories = from c in foo
select new SelectListItem
{
Value = c.ID.ToString(),
Text = c.Name
};
I have also tried with a IEqualityComparer and overrided Equals and GetHashCode to check on WebServiceCategory.ID, but it does not work either.
So my question are, why is Distinct() working better on a anonymus type than on my WebServiceCategory object and SelectListItem?
A:
Anonymous types have value equality. Reference types have reference equality. LINQ to Entities is following the default semantics for the types. But overriding Equals or implementing IEquatable won't work, because LINQ to Entities queries are translated to SQL, and LINQ to Entities cannot translate arbitrary C# code to SQL. Note that the overloads of, e.g., Distinct which take a comparer aren't supported in L2E.
You have one workaround already, in your second code example. Another would be to group by an anonymous type:
var categories = from p in webserviceProductRepository.GetProducts()
from c in p.Categories
group c by new { Id = c.ID, Name = c.Name } into g
order by g.Key.Name
select new SelectListItem
{
Value = g.Key.Id.ToString(),
Text = g.Key.Name
};
| {
"pile_set_name": "StackExchange"
} |
Hotel intern stole from guests
A student of the School of Hospitality program at the University College of the Cayman Islands received a suspended sentence on Thursday after pleading guilty to stealing from four guests at the hotel where he was gaining experience as an intern.
Joseph Maitland, 19, entered his guilty plea in July. Sentencing was postponed until this week for a social inquiry report.
Senior Crown counsel Tanya Lobban said the offense occurred at the Caribbean Club on May 29, about a week before Maitland would have graduated from the hospitality program.
Guests at the Caribbean Club returned to their rooms, which could only be accessed with a digital key, to find money missing. One man found that between US$700 and US$800 was missing from a closet. Another man found that US$180 was missing from his wallet, which he had left in a backpack. Two women reported US$300 missing from each of their handbags, which had been on the floor of their bedrooms. The total missing cash was US$1,580.
The matter was reported to management and an investigation showed there was no forced entry. Inquiries were made among staff who had been issued digital keys.
Maitland’s supervisor found out that he had left work early. It was also learned that Maitland was not scheduled to be in that apartment that day for any work-related reason.
The intern had a digital key because his duties included taking luggage to guests’ rooms.
When police searched Maitland’s room at his home, they found US$250. In an interview with police, Maitland initially denied taking the money, saying he was holding it for a friend. The friend was contacted and told officers she had not given him any money to hold.
Meanwhile, police took fingerprints and shoe prints from the apartment.
In a second interview a week later, Maitland admitted going through the rooms and stealing the cash. He said he wrapped most of the money in tissue and hid it in the bush near Abacus Restaurant; when he went back for it, it was gone.
On Monday this week, Ms. Lobban set out details of the charge, defense attorney Laurence Aiolfi spoke in mitigation and Magistrate Valdis Foldats adjourned the matter to decide whether the offense should be punished by immediate imprisonment.
Program’s reputation said to be tarnished
Ms. Lobban said the theft had tarnished the hospitality program. Companies would be reluctant to take on young people from the program, which was designed to introduce them to work in the hospitality industry.
In his remarks on Thursday, the judge cited a recent employee theft case that had been appealed to the Grand Court. In that case, Justice Malcolm Swift allowed the appeal against an immediate jail sentence for theft of CI$946, saying the amount was small. “I am bound by Justice Swift’s ruling,” the magistrate said.
But, he noted, the Crown had said there were other factors to consider, including harm to the reputation of the hotel and Cayman’s tourism industry. The court heard that the Caribbean Club had severed its relationship with the intern program, thereby affecting placement for future students.
As a result of this offending, Maitland has been suspended from UCCI for one year. He will not be allowed to return to the program. He was emotionally distressed by his action and the impact it had on his family, to the point that he was admitted to hospital at one stage, Mr. Aiolfi said.
The magistrate noted that the court had to send a message that theft in the tourism industry will likely result in imprisonment.
The magistrate imposed a four month sentence, reduced from six months for the guilty plea discount, and suspended it for two years.
He gave Maitland a year to pay back the stolen money to the Caribbean Club, which had already reimbursed the guests.
1 COMMENT
I watch this on the news and all i could do was hold my head down in shame. What a dumb move. All this person did was hurt the real young people who want a job of service. But by watching that news report you would think that they had won a million dollars or something like that. I am sorry if this upsets anyone but because he has messed up the opportunity for other young people to get the chance to work at that Hotel he should go to jail to know that he messed up big time for others.
I don’t know the specifics of the case against this young man nor his criminal background if any so I cannot really speak to why he wasn’t sentenced to jail time. So all I can offer is my opinion which is the punishment doesn’t equal the damage that was done not just to the to the guests that will spread this news, the Hotel Reputation as well as Caymans reputation but to all the young people that will now lose the opportunities that this program would have created. | {
"pile_set_name": "Pile-CC"
} |
The effect of rest interval length on bench press performance with heavy vs. light loads.
The purpose of the current study was to compare the effect of 3 different rest intervals on multiple sets of the bench press exercise performed with heavy vs. light loads. Sixteen resistance-trained men performed 2 testing sessions each week for 3 weeks. During the first testing session each week, 5 consecutive sets of the bench press were performed with 80% of 1 repetition maximum (1RM) and with a 1-, 2-, or 3-minute rest interval between sets. During the second testing session each week the same procedures were repeated with 50% of 1RM. The total repetitions completed and the sustainability of repetitions were compared between rest conditions and between loads. For each load, resting 3 minutes between sets resulted in significantly greater total repetitions vs. resting 2 minutes (p = 0.000) or 1 minute (p = 0.000) between sets. However, the sustainability of repetitions was not significantly different between loads (p = 0.849). These results can be applied to weekly bench press workouts that undulate between heavy (i.e., 80% 1RM) and light (i.e., 50% 1RM) intensities. When the training goal is maximal strength development, 3 minutes of rest should be taken between sets to avoid significant declines in repetitions. The ability to sustain repetitions while keeping the intensity constant may result in a higher training volume and consequently greater gains in muscular strength. | {
"pile_set_name": "PubMed Abstracts"
} |
Most Bluetooth Smart Locks can be Hacker, says Researcher
A researcher, at Defcon in Las Vegas, said that most of the Bluetooth Smart Locks currently in use could be hacked into easily by unauthorized users. He also expressed his concern with vendors’ lack of intent to overcome this.
Anthony Rose, an electrical engineer, and Ben Ramsey, a security researcher, tested 16 Bluetooth smart locks and said that 12 of those were unlocked when attacked wirelessly. The difficulty in carrying out the feat ranged from shockingly minimal to a little moderate, according to the researchers. They tested locks from companies like iBlulock, Ceomate, Vians, Elecycle, Okidokey, and Mesh Motion.
Anthony Rose said that his partner and he had aimed at finding vulnerabilities in the Bluetooth smart locks and then contacting the vendors to let them know about it. After doing so, though, they said that only one of the twelve vendors got back to them, and the one that did get back responded that they knew about the issue but would not solve it.
According to Rose, the problem does not necessarily lie with the Bluetooth Low Energy protocol, but it is the way Bluetooth communications are implemented by the locks that are dangerous to the users. For example, he said that four of the locks that Ramsey and he tested sent the passwords as plaintext to the user’s smartphone. Anyone with a Bluetooth sniffer can intercept this message and use the password.
There are vendors, though, that encrypt the password to protect the user. However, not all of them make it as secure as it should be. One vendor did not decrypt the password when being entered. This means that intercepting the encrypted password and then sending it in that same format could easily let any unauthorized user gain access to the lock.
Okidokey smart lock said that they use proprietary software for their job. Since the researchers knew that his approach had flaws, they tried sending random bits to the lock to see what would happen. By simply changing one bit in the encrypted message they were able to send the lock in an error state which led to it being unlocked.
Mesh Motion’s Bitlock bicycle lock proved to be the toughest opponent for Rose and Ramsey, but they succeeded eventually. They replicated the lock’s wireless profile on an Android phone using free software and then mounted a man-in-the-middle attack on the communication between the traffic through the lock, the app, and Mesh Motion’s cloud.
The encryption depended on a nonce, which is a randomly generated number that aids in encrypting the text randomly. However, on studying the pattern, the researchers found that two encrypted messages only differed by one digit, which enabled them to gain access to the lock.
More than the ease of breaking into these Bluetooth Smart Locks, the researchers were surprised at the vendors’ unwillingness to act upon it. They said that these vendors should use good encryption and multi-factor authentication techniques like those used by the four locks they could not hack into. | {
"pile_set_name": "Pile-CC"
} |
IN THE SUPREME COURT OF PENNSYLVANIA
WESTERN DISTRICT
COMMONWEALTH OF PENNSYLVANIA, : No. 65 WAL 2019
:
Respondent :
: Petition for Allowance of Appeal from
: the Order of the Superior Court
v. :
:
:
JOSEPH MARION, :
:
Petitioner :
ORDER
PER CURIAM
AND NOW, this 6th day of August, 2019, the Petition for Allowance of Appeal is
DENIED.
| {
"pile_set_name": "FreeLaw"
} |
Insecticide interaction with carrier and neuroproteins.
Binding of alpha-, beta-, gamma-hexachlorocyclohexane, p,p'-DDT and p,p'-DDE with bovine serum albumin (BSA) and locust brain homogenate was studied. Binding affinities of pesticides were higher for the locust brain homogenates than for BSA. Results of uptake by isolated locust brain revealed higher uptake of gamma-HCH than alpha-HCH. gamma-HCH uptake was also higher from locust haemolymph than either from BSA or from buffer. | {
"pile_set_name": "PubMed Abstracts"
} |
“Not Safe for Brand” (NSFB) or How Reddit Will Censor Controversial Content - neverminder
https://penetrate.blogspot.com/2018/01/not-safe-for-brand-nsfb-or-how-reddit.html
======
krapp
I don't understand the conspiratorial language here. The premise that
businesses "love leftist dogma" because it's "non-controversial" is farcical,
and an API flag marking something as unsafe for advertisement isn't
"censorship."
The slippery slope arguments being employed by certain people in defense of
"free speech" are starting to devolve into a swamp. I put free speech in
quotes there because I have little doubt, judging from the site's content and
my impression of the author's views, they would have no issue at all with
censorship of "leftists" and their speech.
~~~
CommieBobDole
One the one hand, as someone more or less on the left, I am a little concerned
with the political orthodoxy I see on the left, where there's a package of
"correct" ideas of varying quality, and disagreeing with or having varying
levels of enthusiasm about any of them is seen as almost worse than rejecting
them all entirely.
On the other hand, nearly everyone I see these days who talks about being
really passionate about free speech and preventing groupthink seems to be an
actual goddamned neo-Nazi whose idea of free speech is the right to scream
racial slurs at top volume into the faces of "libtard cucks" until they're
driven out of public spaces and they can resurrect the Third Reich without
interference.
~~~
existencebox
I realize your statement may be slightly hyperbolic, but I want to reassure
you there are many moderate/centrally leaning individuals passionate about
free speech and the power of questioning any status quo as a tool to seek
truth. (obviously not as many as I might desire, but...) This _cannot_ be an
issue that only becomes provenance of the worst kinds, because then it becomes
easy to dismiss. One need only be a student of history to see the importance
of the above for _breaking_ oppression and tyranny.
(Sorry, not to distract from the OP and the primary discussion, I just felt
strongly enough about the above statement to wave a "I promise we're out here"
flag.)
------
CommieBobDole
This is literally a flag for "this thing is uncontroversial enough that we can
display ads on it without the advertiser complaining". I don't see how this is
a problem for a commercial enterprise that makes its money from advertising.
I encourage anyone reading this to browse around the rest of the linked site
and decide for yourself whether the authors are driven by a sincere desire to
protect free speech for everyone on Reddit, or if maybe they have another
agenda in mind.
------
freeone3000
So the insidious actions here are that certain subreddits are going to be
manually reviewed, and marked as safe for large advertisers based on the
absence of objectionable content. And reddit has yet to make a public
announcement on this.
Cool? Seems like a sensical approach to monetization for me.
~~~
paulddraper
Choosing where to have your brand is really basic advertising stuff.
\---
That said, it's a little weird to have a global NSFB tag.
Safe for what brand? NRA? Ben & Jerry's? NFL? Chick-fil-a? Planned Parenthood?
Hooters? Disney? Communist Party USA?
It further coalesces a division between universally "acceptable, popular" and
universally "unacceptable, unpopular" thoughts.
~~~
freeone3000
There is already a global "nsfw" tag (applied per-post) for users to flag
content as potentially objectionable. I don't see this as a huge step beyond
that conceptually, it's the same thing with a different purpose.
~~~
paulddraper
But NSFW has a very well-understood definition: obscenity/gore. Obscenity is
even a matter of legal interest and gets tried in court.
NSFB is really, really mushy. It's a matter of marketing interest.
------
nazihunter1234
Umm ... if it wasn't already obvious, this guy is a nazi. See:
"But if I tell that obvious truth about the ongoing program of genocide
against my race, the white race, Liberals and respectable conservatives agree
that I am a naziwhowantstokillsixmillionjews. They say they are anti-racist.
What they are is anti-white."
[https://penetrate.blogspot.com/2016/02/americas-race-
problem...](https://penetrate.blogspot.com/2016/02/americas-race-problem.html)
See also: [https://penetrate.blogspot.com/2016/02/why-europe-is-
committ...](https://penetrate.blogspot.com/2016/02/why-europe-is-committing-
suicide.html) [https://penetrate.blogspot.com/2010/01/racist-word-
invented-...](https://penetrate.blogspot.com/2010/01/racist-word-invented-by-
ussrs-leon.html) [https://penetrate.blogspot.com/2016/11/an-alt-right-
search-e...](https://penetrate.blogspot.com/2016/11/an-alt-right-search-
engine.html) [https://penetrate.blogspot.com/2016/10/anonymous-email-is-
an...](https://penetrate.blogspot.com/2016/10/anonymous-email-is-anti-
semitism-new.html)
~~~
paulddraper
Where in those blog posts do you see that he is a member, ally, or ideological
proponent of the National Socialist German Workers' Party?
He's a nationalist, but explicitly rejects Nazism/neo-Nazism.
> Why the Future of Nationalism is Far from the Mess that is "White
> Nationalism"
> To my mind, it's a mistake to identify as pro-white or neo-Nazi when what we
> want is much simpler...That means that each nation rules itself, makes its
> own rules, and does so through culture instead of the bureaucratic
> governments that absorb infinite money, make crazy rules, become corrupt,
> and kick down your door in the night because you said something socially
> unpopular on Farcebook or Twitless.
> In my view, those who want to be "pro-white" should shift to this
> generalized nationalist program
[https://penetrate.blogspot.com/2013/11/why-future-of-
nationa...](https://penetrate.blogspot.com/2013/11/why-future-of-nationalism-
is-far-from.html)
EDIT: I definitely don't agree with his views; I'm just don't want HN to
devolve into factless name-calling/labeling. I wouldn't call indiscriminately
call anyone with far-left views "commies". We already have Reddit.
~~~
CommieBobDole
Thank you for your pedantry - You are indeed correct that the author of the
linked site does not appear to be a current member of a political party that
ceased to exist some 70+ years ago.
He or she does, however, appear to be a neo-Nazi, a white nationalist and a
white supremacist.
~~~
paulddraper
CommieBobDole, it's not pedantics; I simply saw his public denouncement of
white nationalism/white supremacy/neo-Nazism (while still supporting general
nationalism/cultural unity) and took it at face value.
If you disagree, you might explain why.
~~~
CommieBobDole
Here's an article from the site calling for less race-baiting because it's
harmful to the public perception of white nationalism, thereby hindering white
nationalists from reaching their goals:
[https://penetrate.blogspot.com/2015/05/you-can-fight-for-
rac...](https://penetrate.blogspot.com/2015/05/you-can-fight-for-racial-
nationalism.html)
Here's an article that suggests it's counterproductive to beat up gay people
because again, it's unpopular, and instead advocates that they be segregated
and their behavior outlawed as an unpleasant nuisance:
[https://penetrate.blogspot.com/2016/03/a-word-on-
homosexuals...](https://penetrate.blogspot.com/2016/03/a-word-on-
homosexuals.html)
Here's a link to a donation campaign being run by the organization "White
Revolution" with the context that if white nationalist groups were more
practical like this, the author would like them more.
[https://penetrate.blogspot.com/2011/04/unbelievable-white-
na...](https://penetrate.blogspot.com/2011/04/unbelievable-white-nationalists-
do.html)
Here is a link to a lighthearted funny meme about Anders Breivik, a neo-nazi
who murdered 77 people.
[https://penetrate.blogspot.com/2014/01/anders-breivik-
king-o...](https://penetrate.blogspot.com/2014/01/anders-breivik-king-of-all-
media.html)
The general tone of the site seems to be that of a white supremacist and neo-
nazi who believes that others who share his or her goals are not effective and
should adopt other tactics in order to achieve their aims.
If you're not able to see this, I have to question whether you've reviewed the
material your commenting on, or if you're incredibly politically naive, or if
perhaps your questioning is not entirely in good faith.
~~~
true_religion
So the author is calling for less violence against minorities, wants to remove
racist language from public discourse, but he must still be racist because he
does not totally condemn racists who happen to want the same goals as he does?
Not criticizing, I just want to know if this is a fair assessment. I do not
know how I feel about this in general, but in specific, his short term goal of
reducing violence makes him a more tollerable enemy.
~~~
krapp
> but he must still be racist because he does not totally condemn racists who
> happen to want the same goals as he does?
Yes, because those goals are racist.
He's racist because of his belief in and support for white nationalism and
racial segregation, and the genetic and cultural superiority of the white
race, and his definition of "western civilization" in purely (pun intended)
racial terms. He's racist because he views the presence of non-white people as
a form of pollution and believes in racist conspiracy theories like white
genocide.
Being racist and civil is still being racist.
~~~
paulddraper
I'm not sure "genetic superiority" is in his list of claims. But in any case,
going back to the original point, there's some real muddling of terminology
here.
Racist != Nazi
My great grandmother was racist. Woodrow Wilson was racist. Neither one was a
Nazi.
~~~
krapp
>My great grandmother was racist. Woodrow Wilson was racist. Neither one was a
Nazi.
Fair enough. Racist but not full Nazi.
------
notatoad
The mix of conspiracy theory and condescension in this article is really
obnoxious.
------
John_KZ
Reddit has already devolved into a forum for 15 year olds to post nonsense
jokes. Those of us who knew how reddit used to be and still occasionally visit
tend to stay away from the main subs and visit for very specific reasons.
We should make another forum-aggregator to replace reddit and it's terrible
moderation system, but it probably just won't get big enough.
~~~
Finch2193
I have been patiently waiting for an alternative to Reddit. In this time, I
have been reading books, and hacker news. Going back to Reddit feels like an
extreme regression.
Should I give up on the hope that one day we'll see another, better Reddit?
Digg died when they redesigned their site, I was hoping we'd see the same
thing with reddit, rinse and repeat...
~~~
elektor
There is an offshoot of Reddit that I frequent and enjoy, it was made by a
former Reddit dev: [https://blog.tildes.net/announcing-
tildes](https://blog.tildes.net/announcing-tildes)
I've got 2 more invites for those are that interested.
| {
"pile_set_name": "HackerNews"
} |
#include <stdio.h>
#include <string.h>
int romanToInt(char *s) {
int len = strlen(s);
int ans = 0;
int i = 0;
while (i < len) {
switch (s[i]) {
case 'M':
ans += 1000;
break;
case 'D':
ans += 500;
break;
case 'C':
if (s[i + 1] == 'D' || s[i + 1] == 'M'){
ans -= 100;
}
else {
ans += 100;
}
break;
case 'L':
ans += 50;
break;
case 'X':
if (s[i + 1] == 'L' || s[i + 1] == 'C'){
ans -= 10;
}
else {
ans += 10;
}
break;
case 'V':
ans += 5;
break;
case 'I':
if (s[i + 1] == 'V' || s[i + 1] == 'X'){
ans -= 1;
}
else {
ans += 1;
}
break;
default:
break;
}
i++;
}
return ans;
}
int main() {
char s1[] = "MMXIV";
char s2[] = "MMXV";
/* should be 2014 */
printf("%d\n", romanToInt(s1));
/* should be 2015 */
printf("%d\n", romanToInt(s2));
return 0;
}
| {
"pile_set_name": "Github"
} |
Cyclic stretch upregulates SDF-1alpha/CXCR4 axis in human saphenous vein smooth muscle cells.
Cyclic stretch (CS) mediates different cellular functions in vascular smooth muscle cells and involves in neointimal hyperplasia and subsequent atherosclerosis of vein grafts. Here, we investigated whether CS can modulate stromal cell-derived factor-1alpha (SDF-1alpha)/CXCR4 axis in human saphenous vein smooth muscle cells. We found CS induced the upregulation of SDF-1alpha and CXCR4 in human saphenous vein smooth muscle cells in vitro, which was dependent on PI3K/Akt/mTOR pathway. Furthermore, CS augmented human saphenous vein smooth muscle migration and focal adhesion kinase (FAK) activation by PI3K/Akt/mTOR pathway. Interestingly, the upregulation of SDF-1alpha/CXCR4 axis was instrumental in CS-induced saphenous vein smooth muscle cell migration and FAK activation, as showed by AMD3100, an inhibitor of SDF-1alpha/CXCR4 axis, partially but significantly blocked the CS-induced cellular effects. Thus, those data suggested SDF-1alpha/CXCR4 axis involves in CS-mediated cellular functions in human saphenous vein smooth muscle cells. | {
"pile_set_name": "PubMed Abstracts"
} |
Ferrofluidic screens and magnets for forming images on the screens are known. In such apparatus, magnetically active particles are disposed in a dispersion medium which substantially precludes travel of the particles throughout the medium yet permits the particles to orient themselves under the influence of a magnetic field. The dispersion medium and particles are typically disposed within an enclosure with at least one side of the enclosure forming a transparent or translucent screen. When a magnetic field is imposed on the magnetically active particles, the particles will orient or align themselves in the dispersion medium along the flux lines of the magnetic field. This alters the light transmission characteristics through the screen. The ferrofluidic screens were primarily developed for industrial application to display the magnetic field of magnetized materials (such as multi-pole magnets) as an aid for quality control during the production of magnets. A typical use of a ferrofluidic screen is to imploy a magnet in the form of a pen such that the pen, when moved along the screen surface, aligns the magnetically active particles to form an image, i.e., the magnetic pen writes on the ferrofluidic screen. The present invention adapts the ferrofluidic screen and magnet phenomena to a scanning apparatus for viewing from one side of an opaque surface element otherwise not visible on the opposite side of the surface. | {
"pile_set_name": "USPTO Backgrounds"
} |
Pupsmo Mall
*Suvi runs in again* Oh my Reesee, I am so sorry, but now I need a filing cabinet! You don't want to know what is in the one they have over there! Could you please have one delivered to the PD and I will explain it to Baron. Oh, and please make it the biggest one you have that locks. Thanks ever so much, Reesee.
PawSpot Law Enforcement is looking for a few brave doggies to become part of our special team. Height and weight are not a requirement. Experience is a plus, but we will train the right candidates. Our motto is: No Dog too Big or Small - There is a Job for All! PawSpot Law Enforcement is an EOE. | {
"pile_set_name": "Pile-CC"
} |
News coverage of the climate crisis can no longer rely on the false pretense of objectivity, writer and activist Naomi Klein said Tuesday.
"There is a confirmation bias among the largest chunk of journalists out there who really pride themselves on being centrists," Klein said Tuesday during a town hall at the Columbia Journalism School in New York. "There's an absolute fetish for centrism, for seriousness defined by splitting the difference—and not getting too excited about anything"
The mainstream media is "profoundly distrustful of people who are saying 'actually, the house is on fire,'" Klein said, citing the impulse among many journalists to remain objective and hear both sides.
"But guess what," said Klein. "The house is on fire."
The journalism school's publication, The Columbia Journalism Review (CJR), is joining with The Nation to launch an initiative, #CoveringClimateNow, to change coverage of the climate crisis.
In an essay describing the initiative from April 22, Mark Hertsgaard, environmental correspondent for The Nation, and Kyle Pope, the publisher of CJR, described how they see the journalist's job in the climate crisis as one of sounding the alarm.
SCROLL TO CONTINUE WITH CONTENT Never Miss a Beat. Get our best delivered to your inbox.
"Instead of sleepwalking us toward disaster, the U.S. news media need to remember their Paul Revere responsibilities," wrote Hertsgaard and Pope, "to awaken, inform, and rouse the people to action."
Part of that mission, Klein said, is pushing back on conventional wisdom about the role of extractive technologies in furthering neoliberal economic development.
"You can't leave it all to the markets," Klein said, laying out a vision of the future that leaves neoliberalism behind.
"You have to plan," Klein added. "You have to regulate."
Further, said Klein, the entire project of neoliberalism "falls apart" if the climate crisis is reality.
Watch Klein's comments: | {
"pile_set_name": "OpenWebText2"
} |
Pasi Rilindja dështoi që të sillte ashtu sikurse pati premtuar një analizë nga një laborator ndërkombëtar, për të thënë se përgjimi i Babales qe një manipulim, ajo përdori skenarin “B”. Krijimin e një dëshmitari fals. E gjithë trimëria e Ramës nëpër studio dhe akuza e prokurorisë u vërvitën tek një personazh, të cilin e kishin paralajmëruar muaj më parë mediat pranë qeverisë, dhe që do pohonte se kishte marrë para, për të luajtur zërin e Agron Xhafës.
Fredi Alizoti u konsiderua nga mbështetësit e qeverisë në panelin e “Opinion” si njeriu që po nxirrte të vërtetën.
Lexo me tej:
Andi Bushati:“Hidhu nga ne”, rrëzimi i turpshëm i alibive të Ramës
Por, papritmas në emision ndodhi një kthesë e beftë: Salianji nxori videon ku Fredi Alizoti ishte takuar më shefin e policisë Ardi Veliu, dhe ai me dorën e tij e kishte çuar në prokurorinë e Arta Markut, ku do luante rolin e dëshmitarit të rremë. Alizoti i pranonte të gjitha këto me gojën e tij, me zë dhe figurë.
Pra tani nuk ka më asnjë dyshim se ka rënë edhe alibia e alibisë së alibisë, që mbështeste tezën e Ramës se videopërgjimi qe i manipuluar. Sepse pas kësaj videoje rezulton, në rastin më të keq, që i gjithë hetimi është fals, ndërsa në rastin më të mirë, se dëshmitari kryesor dhe i vetëm i akuzës është një njeri krejtësisht i pabesueshëm. Përpos Alizotit prokuroria nuk kishte asnjë fakt tjetër për të shpallur se audio-përgjimi i Agron Xhafajt është i manipuluar.
Dhe kjo ngjarje, nuk është thjeshtë nxjerrja e një gënjeshtre më shumë si ato për avionët e drogës, Dritan Zaganit, Xhisielës e me radhë.
Ajo është prova flagrante që tregon për një mafie që ka kapur shtetit, ku drejtori i policisë Ardi Veliu shtrembëron provat, ku prokuroria i bën fresk qeverisë dhe zbaton direktivat e saj, ku ai prokurori Gent Osmani, që i mbajnë si kosë në qafë vettingun, është i gatshëm të “besojë” çdo fabul.
Nëse deri tani ka pasur dyshime që në përgjim ishte kapur vëllai i ministrit të Brendshëm, tani kjo as që diskutohet më. Madje, po ta kthesh filmin nga pas, më mirë ta kishin pranuar në fillim që ishte zëri i Agron Xhafës, sesa të telendiseshin kështu duke i rënë alibitë njëra pas tjetrës.
©Lapsi.al | {
"pile_set_name": "OpenWebText2"
} |
Omaha police are investigating a shooting that left three people injured early Sunday morning. The victims told police they had been shot while at a house party.Police originally responded to the area of 55th and Sprague just before 2 a.m., after several callers reported hearing shots fired. Officers found a residence in the area that had been struck several times by gunfire, but they didn't find any victims there. Around 2:00 a.m. two people arrived at Creighton University Medical Center. Officers say they had been shot in the knees.Around the same time, a third shooting victim walked into CHI Health Immanuel.Officials report all three victims have non life-threatening injuries.The incident is still under investigation. The victims were not able to provide any description of a suspect. Three other homes in the area were also hit by gunfire. Anyone with information about what happened should call Crime Stoppers, 402-444-STOP.
Omaha police are investigating a shooting that left three people injured early Sunday morning. The victims told police they had been shot while at a house party.
Police originally responded to the area of 55th and Sprague just before 2 a.m., after several callers reported hearing shots fired. Officers found a residence in the area that had been struck several times by gunfire, but they didn't find any victims there.
Around 2:00 a.m. two people arrived at Creighton University Medical Center. Officers say they had been shot in the knees.
Around the same time, a third shooting victim walked into CHI Health Immanuel.
Officials report all three victims have non life-threatening injuries.
The incident is still under investigation. The victims were not able to provide any description of a suspect. Three other homes in the area were also hit by gunfire.
Anyone with information about what happened should call Crime Stoppers, 402-444-STOP. | {
"pile_set_name": "OpenWebText2"
} |
A phase II trial of induction epirubicin, oxaliplatin, and fluorouracil, followed by surgery and postoperative concurrent cisplatin and fluorouracil chemoradiotherapy in patients with locoregionally advanced adenocarcinoma of the esophagus and gastroesophageal junction.
Preoperative chemoradiotherapy improves local control in patients with locoregionally advanced adenocarcinoma of the esophagus and gastroesophageal junction (GEJ). Distant failure remains common, however, suggesting potential benefit from additional chemotherapy. This phase II study investigated the addition of induction chemotherapy to surgery and adjuvant chemoradiotherapy. Patients with cT3-4 or N1 or M1a (American Joint Committee on Cancer 6th edition) adenocarcinoma of the esophagus and GEJ were eligible. Induction chemotherapy, with epirubicin 50 mg/m/d, oxaliplatin 130 mg/m/d, and fluorouracil 200 mg/m/d continuous infusion for 3 weeks, was given every 21 days for three courses, followed by surgery. Adjuvant chemoradiotherapy consisted of 50 to 55 Gy at 1.8 to 2.0 Gy/d and two courses of cisplatin (20 mg/m/d) and fluorouracil (1000 mg/m/d) during weeks 1 and 4 of radiotherapy. Between February 2008 and January 2012, 60 evaluable patients enrolled. Resection was accomplished in 54 patients (90%) and adjuvant chemoradiotherapy in 48 (80%) patients. Toxicity included unplanned hospitalization in 18% of patients during induction chemotherapy and 19% of patients during adjuvant chemoradiotherapy. There was one chemotherapy-related and two postoperative deaths. With a median follow-up of 43 months, the projected 3-year locoregional control is 88%, distant metastatic control 46%, relapse-free survival 41%, and overall survival 47%. Symptomatic response to chemotherapy and the percentage of remaining viable tumor at surgery proved the strongest predictors of survival and distant control. Chemotherapy, surgery, and adjuvant chemoradiotherapy are feasible and produce outcomes similar to other multimodality treatment schedules in locoregionally advanced adenocarcinoma of the esophagus and GEJ. Symptomatic response and less residual tumor at surgery were associated with improved outcomes. | {
"pile_set_name": "PubMed Abstracts"
} |
Background {#Sec1}
==========
According with the definition of Abrams et al. \[[@CR1]\], which is accepted and adopted also by recent clinical and epidemiological studies \[[@CR2], [@CR3]\], urinary incontinence (UI) is the condition in which an involuntary loss of urine occurs, which is well identifiable and can create problems of a hygienic and social nature. Although the International Continence Society (ICS) withdrew the hygienic and social aspects of UI from the latest definition reported by the ICS Glossary, this study adopted the statement of meaning of Abrams et al. \[[@CR1]\], because it is broader and multidisciplinary and so compliant with the purpose of this research, i.e. to look at the UI and at its repercussions on family caregivers of older people with incontinence from a sociological perspective. UI is often a chronic, age-related disorder, frequently occurring in association with disability \[[@CR4], [@CR5]\]. The unprecedented and worldwide population ageing implies, therefore, that the prevalence of this phenomenon is likely to increase in the future. In Italy, for example, where 22.3% of the whole population is over 65 years old \[[@CR6]\], there are about 4,5 million people suffering from UI (i.e. 7.8% of the population) \[[@CR7]\]. This condition concerns between 15 and 35% of older people living in the community, and 30% of those in nursing homes and facilities \[[@CR7]\].
In Italy, as well as in Europe, older people with incontinence (OPI) are assisted mainly by family caregivers, often daughters, daughters-in-law and wives who deal with their older relatives' personal hygiene, change of absorbent devices and frequent washing of linen. This is not surprising, as family caregivers are often the main source of assistance in the informal care sector, representing the backbone of long-term care provision across Europe \[[@CR8]--[@CR11]\].
Several studies highlight that the physical and psychological burden of family caregivers of OPI is higher than that experienced by family caregivers of older people without incontinence \[[@CR12]--[@CR15]\], and that such a burden can be mitigated by social and healthcare services meeting family caregivers' needs \[[@CR13]\]. Literature shows also that when caregivers of OPI feel that they are supported in providing assistance, their perception of the burden of care may be alleviated \[[@CR16]\].
In Italy, services that explicitly target family caregivers are extremely limited, while those targeting OPI are more frequent. Among the latter, the main -- and often only -- service delivered by the Regional Health Systems (RHS) across the country is the free supply of absorbent products \[[@CR17]\] through provincial administrative structures called *Aree Vaste* (literally "Large Areas", occupying a position midway between the provincial and regional scale). The latter are responsible for the recognition of the disorder and of the granting of the free supply of absorbent products. In some regions, including the Marche region, each Large Area (LA) can decide for itself whether to distribute the products via pharmacies or deliver them to homes. As a result, methods of distribution of these products may differ within the same region. The number of absorbent products to be delivered each month and their type (model), in contrast, are decided by a regional law, which transposes and applies national legislation locally. For example, the Marche Region (Central Italy), where this study was carried out, at the time of this study data collection, allocated 60 pieces per month to individuals with incontinence, regardless of the severity of their disorder (Regional Law n. 1696/2012, which incorporated the law n. 135/2012, widely referred to as the "Spending Review"). Recently the Marche Region, in accordance with Law n. 716/2017, has doubled this amount, thus granting now 120 absorbent products per month (up to 150 for cases of serious incontinence), and delegating the LAs to decide the number of products to be granted. Other Italian Regional Health Systems (for example the Lombardy Region) have adopted the use of vouchers (i.e. a pre-paid receipt), but only as an experiment.
International literature has taken into consideration the impact of the quantity and quality of absorbent products on the well-being of people with incontinence and their caregivers \[[@CR18]--[@CR20]\], and has examined the cost of incontinence management in terms of public expenditure \[[@CR21], [@CR22]\]. In Italy, two studies \[[@CR23], [@CR24]\] highlighted the negative impact of complex procedures and lengthy waiting times to receive absorbent products in an informal care setting. To date, however, there are no studies at national as well as international level that have examined the impact of the method of distribution of these products on family caregivers' perception of the support received.
This study, conducted in the Marche Region between January and July 2016, seeks to identify the method of distribution of absorbent products that provides Italian family caregivers of OPI with the greatest support, and whether this can mitigate their burden. The research question which the study tried to answer was: do caregivers who receive the products at home feel more supported than those who collect them at the pharmacy?
Methods {#Sec2}
=======
Study design and participants {#Sec3}
-----------------------------
To answer this research question, two groups of family caregivers, living in two LAs of the Marche region with two different systems for the supply of absorbent products were compared. The first group lived in Ancona (the region's capital city) and collected the products via pharmacies. The second group lived in Fermo (a small town in the south of the region's inland area), and received the products at home.
The sample size was estimated in order to obtain the representativeness of the family caregivers of OPI residing in Ancona and in Fermo. In 2015, the older population of Ancona had 25,659 subjects \[[@CR25]\]. In the health district of Ancona in the same year, according to the data supplied by the Marche Region Health System, 1700 older people were entitled to receive absorbent aids, i.e. 7% of the total older population. Fermo counted 9251 older people \[[@CR25]\]. However, for Fermo the number of residents who had applied to receive absorbent aids was not available. The estimation of the sample, therefore, was based on available data for the regional capital. Consequently, assuming a prevalence of urinary incontinence in the older male population of between 11 and 34%, and that of between 5 and 69% in the older female population \[[@CR5]\], a sample of at least 100 subjects was estimated to be sufficiently representative of the OPI living in the Marche region. In order to ensure that the study complied with national ethical standards, the research protocol was submitted for approval to the Ethical Committee of the Marche Region, which deemed that ethical approval was not required as it was not a clinical trial.
An ad hoc questionnaire was administered to 101 family caregivers of OPI, who were included in the study on the basis of the following criteria: they had to be caregivers of older people with a medium-to-severe incontinence level (without a catheter), who used at least 2 pads daily, and who were residents in the municipalities of Ancona and Fermo.
Family caregivers were recruited from among all patients with UI admitted to the geriatric and neurology departments (which according to internal statistics had the highest annual OPI admissions) of two geriatric hospitals in Ancona and Fermo, between January and July 2016. Participants were recruited simultaneously in the two different geographical areas of the Marche region.
Family caregivers were informed by the head nurse about the aims of the study and that they might be interviewed. They were then contacted in the ward by interviewers and informed about the aims and methods of the study, in compliance with national personal data protection legislation (Law no. 196 of 2003, recently coordinated with the 2018 General Data Protection Regulation). Only family caregivers who signed the informed consent form and agreed to take part in the study were interviewed, i.e. 89.4% of the caregivers contacted.
Measurements {#Sec4}
------------
The questionnaire consisted of questions relating to socio-demographic (age, gender, living and working conditions, etc.) and health-related factors concerning both family caregivers (self-assessment) and OPI, who were assessed according to the Instrumental Activities of Daily Living (IADL) scale \[[@CR26]--[@CR28]\]. The variables generated by the self-assessment questionnaire for family caregivers and the IADL scale for OPI were used to analyse the main characteristics of both counterparts and the management of household assistance overall. A variable, "IADL lost", was built, indicating the sum of instrumental activities that the OPI in question can no longer perform. This variable was assigned a value of "\<= 9", if the older person was no longer able to perform 9 out of 10 activities, while it was assigned a value of "= 0" if he/she had lost the ability to perform all instrumental activities. The "chronic disease" variable is a binary (yes/no) variable. The variable "Number of absorbent products used in 24 hours" was broken down into three values: "\<= 2" if the older person changed 1 or 2 pads a day, "3--5" for 3 to 5 changes, and "\> 5" if the older person required more than 5 pads a day.
The outcome variable of the study is the "Quality of perceived support", which was generated by the COPE Index "Quality of support" subscale, which has a reliability of α = 0.77--0.78 \[[@CR29], [@CR30]\].
Regarding the validity of this measurement, it is most highly correlated with the well-being and quality of life measures and with the Social Restriction Scale \[[@CR30], [@CR31]\]. The "Quality of support" subscale raw score ranged from 4 to 16. The score was dichotomised at a cut-off corresponding to the 50th percentile and was divided into two classes: a value between 4 and 10 indicated a low level of perceived support, while 11 and higher indicated a high level of perceived support.
The 5-Well-Being Index \[[@CR32]\] is a short questionnaire used to assess the family caregivers' subjective psychological well-being. The raw score ranges from 0 to 25, where 0 represents the worst possible and 25 the best possible quality of life. A score below 13 indicates poor wellbeing, which is an indicator for testing for depression and an appropriate tool for screening this disorder \[[@CR33]\]. In light of this, the variable "poor wellbeing", identifying family caregivers at risk of depression, was assigned the value "1″ if the index was \< 13 or if at least one of the 5 items of the index had a score of 0 or 1. The variable was assigned the value "0″ if the index was \> 13.
The variable indicating the opinion of caregivers on means of the pads distribution type they utilised, was followed by an open question to specify the reasons for the answer provided. Caregivers' preferences on how they would like to receive absorbent aids were also taken into consideration through a multiple-choice question.
Finally, family caregivers were asked to give their opinion on the adoption of a voucher, i.e. a pre-paid receipt, which LAs would provide for people with incontinence for the free supply of absorbent products. The voucher-based system would allow users to choose their preferred type of absorbent products as long as the total cost of the products is below the expenditure threshold covered by the voucher. Respondents were asked to complete the following sentence: "The adoption of a voucher system for receiving absorbent products would be ..." with one of the following options: "positive", "indifferent", "negative", and were also asked to provide the reason for their choice through an open answer.
Data analysis {#Sec5}
-------------
Data are reported as mean (± SD) for continuous variables, and as absolute frequencies for categorical variables. Patients' characteristics, divided by geographical area of residence, were compared using the chi-square test for categorical variables, and the t-Student test for continuous variables. A probability value of \< 0.05 was considered statistically significant. Statistical analysis was performed using SPSS for Win V21.0 (SPSS Inc., Chicago, IL, USA). The association between "Quality of perceived support" and two geographical areas/methods of absorbent products delivery (i.e. Ancona and Fermo, respectively pharmacy distribution and home distribution) was analysed by means of a generalized linear model (GLM) by adjusting for the following confounding factors: family support (i.e. having a co-carer), income (i.e. being in employment and having any source of income) and living arrangements (i.e. cohabiting with the older person) \[[@CR34], [@CR35]\].
Results {#Sec6}
=======
The 101 family caregivers of OPI enrolled in the study were asked to answer a questionnaire that included questions addressing both respondents and older people. The demographic characteristics of the sample of family caregivers and of the older relatives for whom they care are shown in Table [1](#Tab1){ref-type="table"}. The mean age of the family caregivers is 60.5 years; 83 respondents are females and 82 people are married. Almost two thirds of respondents (65 people) perceive their health as "bad" or "very bad". 51 respondents live with the assisted older person, in the same apartment, while 15 people live in the same building, but in different apartments. Only 8 family caregivers live 30 min away by car. 72 have secondary and higher education, while 12 have a bachelor's degree. 39 family caregivers are in paid work (26 full-time and 13 part-time job), 50 do not work (retired and unemployed) and 11 women are housewives. 89 caregivers provide their loved ones with emotional and psychological support, 79 provide physical and practical support, and 76 help the older relative with personal hygiene (multiple answers). 80 respondents of the 101 carry out activities directly connected to incontinence (i.e. cleaning, changing of absorbent aids and washing of linen) on a daily basis or at least twice a week. Table 1Characteristics of family caregivers to care recipientsFamily caregivers' characteristicsAll (*n* = 101) *Age (years)*60.5 (10.34) *Gender* Male19 Female82 *Marital status* Unmarried11 Married82 Widower4 Divorced/Separate4 *Health condition self-evaluation* Very good/Good10 Nor good neither bad25 Bad/Very bad65 *Living condition* With the cared for51 With spouse, cared for and children14 With cared for and migrant care worker4 With spouse, cared for and migrant care worker2 *Household proximity from the older person* Same apartment51 In the same building but in different apartments15 At walking distance10 At 10 min by car bus or train16 At 30 min by car bus or train8 *Educational level* None3 Primary School13 Secondary School36 High School36 Bachelor degree12 *Employment* Full-time employed26 Part-time employed13 Retired43 Unemployed7 Housewife11 *Caregiving activities (from 3 times a week to every day)* Emotional, psychological and social support89 Physical help79 Medicine administration78 Housework77 Personal hygiene76 *Frequency of caregiving activities related to the continence management* Rarely/never20 Once/twice a week at least80Care recipients' characteristics *Age (years)*83.6 (9.35) *Gender* Male42 Female59 *Number of pads per day* \< 210 3--560 \> 531 *IADL lost* \< =945 1056 *Chronic diseases* No6 Yes95Data are mean (SD) or number of cases
The mean age of OPI is 83.6 years. 43 are men and 59 are women. 10 respondents use up to two diapers a day, 60 use between 2 and 5, and 31 use more than 5 per day. 45 OPI have lost up to 9 out of 10 of the activities in the IADL and 56 have lost 10 IADL. 95 out of 101 older people suffer from a chronic illness.
The sample was divided into two groups, according to the method of distribution of the absorbent products. The first group consisted of 47 caregivers (46.6% of the sample) who collected the continence products in pharmacies. We called "PHAD" (standing for "Pharmacy Distribution"). The second group consisted of 54 caregivers (53.4% of the sample) who received continence products at home, which we called "HOD" (for "Home Distribution"). Table [2](#Tab2){ref-type="table"} compares the main results for the two groups of caregivers. Table 2Family caregivers' level of support perceived, wellbeing and opinion on the pads delivery per method of distributionType of pads delivery systemPPHADs (*n* = 47)HODs (*n* = 54)Family caregivers' level of support perceived Low26 (65.0)15 (31.9)0.002 High14 (35.0)32 (68.1)Poor well-being No14 (29.8)25 (46.3)0.089 Yes33 (70.2)29 (53.7)Family caregivers' opinion about the modality of distribution of pads \"not suitable at all"5 (11.3)0 (0.0)\< 0.001 \"acceptable"25 (56.8)5 (9.6) \"completely suitable"14 (31.8)47 (90.4)Family caregivers' preferencesconcerning the method f distribution of continence products At home21 (47.7)0 (0.0)\< 0.001 Pharmacy17 (38.6)0 (0.0) "It's ok"6 (13.6)54 (100.0)Family caregivers' opinion on voucher \"It is positive"35 (76.1)23 (43.4)\< 0.001 \"It does not make any difference"11 (23.9)20 (37.7) \"It is negative"0 (0)10 (18.9)Data are number of cases (percentage)
Concerning the perceived support, 65% of caregivers in the PHAD group perceived a lower level of support (\<= 10) and 35% perceived a higher level of support (\> = 11). The results are virtually reversed among caregivers in the HOD group, 31.9% of whom perceived a lower level of support and 68.1% a higher level of support. The difference is statistically significant (*p* = 0.002).
The association between perceived support level and distribution method remained significant even after correction for family support, income and living solution, according to the GLM. In addition, 70.2% of caregivers in the PHAD group reported "Poor well-being", as against only 53.7% in the HOD group.
Moreover, concerning the respondents' opinions on the pads delivery method, 56.8% of caregivers in the PHAD group considered defined the distribution via pharmacies as "totally adequate", 31.8% considered it "adequate", and 11.3% "not at all adequate". The main reason for the latter response was difficulty for caregivers in leaving the workplace or the older people to go to the pharmacy. The responses changed significantly among caregivers in the HOD group, 90.4% of whom found home delivery as "totally adequate", 9.6% "adequate", and none found it "not at all adequate". Almost one half of caregivers in the PHAD group (47.7%) would prefer to receive products at home, while all caregivers in the HOD group were satisfied with home delivery and did not want to change.
76.1% of caregivers in the PHAD group were positive with regard to the introduction of a voucher system for the supply of absorbent products, as against only 43.4% of caregivers in the HOD group. 23.9% of caregivers in the PHAD group and 37.7% in the HOD group were indifferent. None in the PHAD group viewed the voucher system negatively, while 18.9% of those in the HOD group did. The difference is statistically significant (*p* \< 0.001).
Discussion {#Sec7}
==========
The aim of this study was to determine to what extent the method of distribution of absorbent products might affect the perception among OPI family caregivers of the support received and whether this, as a consequence, might influence the caregiving burden.
In light of our descriptive data analysis, the characteristics of family caregivers and OPI are consistent with what is reported in the literature. Concerning family caregivers, our data confirms the prevalence of women, the poor health conditions experienced, and the heavy care burden imposed by managing incontinence \[[@CR8]--[@CR15]\]. As far as OPI are concerned, our results underline the very advanced age, the reduced autonomy, and high incidence of chronic diseases.
In order to assess the impact of the method of distribution of absorbent products on the perception of support received among family caregivers of OPI, the study compared two groups of caregivers: the first collected the products from pharmacies (PHADs) and the second received them at home (HODs).
The results show that there is a significant association between the specific absorbent products distribution system and family caregivers' perception of support received. Indeed, although PHADs and HODs received the same number of pads per month and of very similar quality, HODs perceived a greater level of support and reported higher levels of satisfaction with the service, which they did not wish to change.
Moreover, the difference in the percentages of respondents reporting "Poor well-being" in the two groups (70.2% of PHADs vs 53.7% of HODs), albeit not statistically significant, should lead to additional research on the possible association between these two items (i.e. pads distribution system and caregivers' well-being). Indeed, people reporting "Poor well-being" rate might be at severe risk of depression \[[@CR32]\].
The results, therefore, show that the distribution of absorbent products to the recipients' homes better meets the needs of family caregivers involved in this study, making them feel better supported, with possible positive repercussions on their well-being.
This study sheds light on the effects of the method of distribution of absorbent products on the caregiving burden. In doing so, it fills a gap in the existing literature, which is focused mainly on the impact of the quantity and quality of the continence devices on the management of the continence care \[[@CR18]--[@CR20]\] and on the public expenditure \[[@CR21], [@CR22]\].
Although a number of confounding factors were taken into account in the analysis (i.e. family support, living arrangements and income) \[[@CR34], [@CR35]\], social and cultural patterns, e.g. representations of elderly care, traditions and values system \[[@CR36]\], might have influenced the perception of the support received by family caregivers, which may be different in urban (i.e. Ancona) and rural (i.e. Fermo) areas. This study, due to its overall design, was not able to distinguish to what extent social and cultural factors might have influenced respondents' opinions. It is therefore recommended that future research addresses this issue, by including qualitative questions to identify the cultural drivers of individuals' preferences.
In this respect, a mixed-method approach \[[@CR37], [@CR38]\] seems to be the most appropriate means of data collection for appropriately dealing with this issue. Such an approach might help take into account the multifactorial nature of caring for an older person with incontinence (such as multimorbidity, the need for constant watchfulness, the physical effort and psychological stress of family caregivers and so on), as well as the sensitivity of this kind of care, as it is closely associated with the patient's dignity and the risk of stigma and social exclusion. This study has only partially adopted this approach by adding some open questions. Nevertheless, in view of the above, it would be more appropriate for future studies to combine semi-structured interviews with the questionnaire.
Despite these limitations, this is the first study in Italy to examine the effects of the distribution of absorbent products on family caregivers' perception of the support received, and its results could help to design more effective services for supporting them. The method of distribution of absorbent products is the meeting point between the citizen with a healthcare and the health service from which the response to such a need is expected. It should therefore be adapted to the needs of users, in order to ensure a more efficient match between health demand and supply, thus also improving family caregivers' well-being.
Conclusions {#Sec8}
===========
This study has analysed the level of support perceived by family caregivers of OPI in relation to the method of distribution of absorbent products, thus filling a gap in the literature available today. The results seem to suggest that the home distribution of absorbent products is of greater help for family caregivers of OPI living in the Marche region in Italy, regardless of working, housing and economic conditions. In light of these outcomes, any reform of the services supporting dependent OPI should therefore also take into account the preferences of their family caregivers concerning the method used to supply absorbent products, in order to provide a truly useful service. Such a reform should start from a systematic assessment of families' health and social needs. The health conditions of care recipients and family caregivers change over time, as do the formal support networks (e.g. public and private long-term care services) and the informal support networks (e.g. family members and close friends) on which they can count. Therefore, Italy's Large Areas and the Regional Health Systems should periodically distribute questionnaires to and conduct interviews with older people with incontinence and their family caregivers, in order to identify and monitor their needs and preferences not only regarding the quality and quantity of absorbent products (i.e. the "what" of the service), but also the method of distribution (i.e. the "how" of the service). Once the demand for health services has been assessed, the second step should be to trial new solutions for products distribution designed on the basis of the insights gathered, for example by doing a voucher-based system (where it is not yet in place) or a "personal budget", i.e. an amount of money granted by the RHS which people can use to buy absorbent products wherever they want (for example from supermarkets) with the option of home delivery.
Indeed, given the enormous commitment required to family caregivers, any choice that saves them time and effort, including the method of distribution of absorbent products, can potentially mitigate the negative effects of care on their health and well-being. Allowing family caregivers to choose their preferred method of pad distribution would appear to be the best option in terms of the utility of the service. Just as the "one size does not fit all" principle was applied to the quality of absorbent products, it can similarly be said that "one pad distribution system does not fit all".
GLM
: General Linear Model
HOD
: Home Distribution
IADL
: Instrumental Activities of Daily Living
LA
: Large Area
OPI
: Older People with Incontinence
PHAD
: Pharmacy Distribution
RHS
: Regional Health System
**Publisher's Note**
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Special thanks to the head physicians and the nurses of geriatrics and neurology departments of INRCA geriatric hospitals in Ancona and Fermo for their cooperation during the recruitment phase.
SS led the project and was responsible for conception, design, drafting and completion of the manuscript. PF made substantial contributions to the acquisition of data and analysis and contributed to drafting of the manuscript. GL made substantial contribution to the conception and design, was involved in drafting the manuscript and contributed critically for important intellectual content. SS, PF and GL gave final approval for the final version and took full responsibility for the content and agreed to be accountable for all aspects of the work, associated with accuracy and integrity. All authors have read and approved the final manuscript.
This study was supported by Italian Ministry of Health Grant to Sara Santini and partially funded by Essity Italy. The latter did not play any role in designing the study nor in data collection, analysis and interpretation, nor in writing this paper.
Data and material are available on request from the corresponding author.
Marche Region Ethics Committee determined that ethics approval was not required for the study. Nevertheless, the procedures performed by the study and involving human participants were in accordance with the ethical standards of this Ethic Committee, the 1964 Helsinki Declaration and its amendments or comparable ethical standards, and with the national personal data protection legislation (Law no. 196 of 2003) recently coordinated with the 2018 General Data Protection Regulation. Written informed consent was obtained from all individual participants included in the study.
Not applicable.
The authors declare that they have no conflict of interest nor Essity Italy, which partially funded the study, as the company did not influence the study design nor the report of the results in any way.
| {
"pile_set_name": "PubMed Central"
} |
About Us
Reality Entertainment is a world renowned producer of cutting edge films by world class authors, researchers and experts from across the globe. From Ancient Mysteries, UFO’s and Aliens, Secret Societies and Conspiracies, The Paranormal and Occult, Quantum Theory, Prophecy, Spirituality, Religion, Esoteric Teachings, History and much more, Reality Films ventures into mysterious and unknown realms with its unique brand of life altering documentaries and feature films. Visit exotic places, mysterious realms and discover the secrets of all ages by entering a domain where Strange Is Normal | {
"pile_set_name": "Pile-CC"
} |
Q:
external hard drive can not copy the data capacity of more than 6GB
I recently bought an external hard drive with 500GB capacity. hard drive is still in new condition and vacant. but when I would copy a file larger than 6GB hard drive can not copy the file. if I copy the file size of less than 6BG, the file can be copied.
what causes it?
A:
Some filesystems (such as FAT32) have a 4GB limit on file sizes
Some cheap hard drives are fake
| {
"pile_set_name": "StackExchange"
} |
Q:
How would I be able to assign a random integer to a variable?
I have been trying to assign a random number to a variable, such as health or luck but it never seems to work as when I print the variable it just says it's not defined. I would greatly appreciate any help with this. Thank you very much.
from random import randint
def ageroll():
age= int(input("How old will you be?"))
if age <= 0:
print("Input a valid number from 1 to 120")
ageroll()
elif age <= 18:
health = randint(1,4)
agility = randint(4,8)
strength = randint(1,2)
luck = randint(1,10)
endurance = randint(2,4)
intelligence = randint(1,5)
charm = randint(1,7)
return(health,agility,strength,luck,endurance,intelligence,charm)
elif age <= 35:
health = randint(4,10)
agility = randint(5,9)
strength = randint(5,10)
luck = randint(1,10)
endurance = randint(4,8)
intelligence = randint(3,10)
charm = randint(4,7)
elif age <= 56:
health = randint(4,8)
agility = randint(3,6)
strength = randint(3,10)
luck = randint(1,10)
endurance = randint(5,8)
intelligence = randint(5,10)
charm = randint(6,10)
elif age <= 78:
health = randint(2,5)
agility = randint(2,5)
strength = randint(2,6)
luck = randint(1,10)
endurance = randint(1,4)
intelligence = randint(6,10)
charm = randint(5,6)
elif age <= 101:
health = randint(1,5)
agility = randint(1,4)
strength = randint(1,4)
luck = randint(4,10)
endurance = randint(3,9)
intelligence = randint(3,10)
charm = randint(4,7)
elif age <= 120:
health = randint(1,2)
agility = randint(1,3)
strength = randint(1,4)
luck = 10
endurance = randint(6,8)
intelligence = randint(10,10)
charm = randint(6,10)
else:
print("Input a valid number from 1 to 120")
ageroll()
A:
You have to return your variables, and assign this return-value to a variable again, to use it:
from random import randint
PROPERTY_RANGES = [
(18, dict(health=(1,4), agility=(4,8), strength=(1,2), luck=(1,10), endurance=(2,4), intelligence=(1,5), charm=(1,7))),
(35, dict(health=(4,10), agility=(5,9), strength=(5,10), luck=(1,10), endurance=(4,8), intelligence=(3,10), charm=(4,7))),
(56, dict(health=(4,8), agility=(3,6), strength=(3,10), luck=(1,10), endurance=(5,8), intelligence=(5,10), charm=(6,10))),
(78, dict(health=(2,5), agility=(2,5), strength=(2,6), luck=(1,10), endurance=(1,4), intelligence=(6,10), charm=(5,6))),
(101, dict(health=(1,5), agility=(1,4), strength=(1,4), luck=(4,10), endurance=(3,9), intelligence=(3,10), charm=(4,7))),
(120, dict(health=(1,2), agility=(1,3), strength=(1,4), luck=(10,10), endurance=(6,8), intelligence=(10,10), charm=(6,10))),
]
def ageroll():
while True:
age = int(input("How old will you be?"))
if 0 < age <= 120:
break
print("Input a valid number from 1 to 120")
for max_age, values in PROPERTY_RANGES:
if age <= max_age:
break
return {k: randint(*r) for k, r in values.items()}
properties = ageroll()
print(properties['health'])
| {
"pile_set_name": "StackExchange"
} |
PRM Channel Best-Practices Blog
The overarching best practice in deal registration is to design your process with partners’ interests in mind, and they’ll register deals without too much prompting from you. If a partner’s relationship with your company and product is serving them, they’ll register deals.
What is Deal Registration?
First, what is deal registration and why should you make it part of your channel management process? It is most often used to manage possible channel conflict by having partners or VARs (value added resellers) tells you about a lead and they get ‘first dibs’ on it versus another channel partner. Usually the partner has a set amount of time to close the deal before it opened to other partners again.
Reward Partners for Doing the Things That Positively Affect Your Business
Partners are most interested in closing business and so preferred pricing is great. But don’t stop there. You can look at it as the layers in Maslow’s Hierarchy of Needs. The base is, “Protect the partner’s deal and give them preferred pricing.” For that they’ll register.
Then add value, another layer, by encouraging collaboration between vendor and partner. If partners have to wait a day to get the pricing, or they’re not getting the information they need quickly, that puts a deal at risk; We all know time kills all deals.
You can make deal registration an engagement tool by providing what they need in real-time. Also help your partners keep more deals alive by implementing reminders and alerts in your PRM – available in Channeltivity — to keep them on top of their pending deals. Start thinking about the process from the partner’s point of view: What you can do and what systems you can implement to make it easier for them to close.
Information has value: The better you can see what’s in your pipeline, the better you can forecast, the more productive your channel will be.
Remove Friction from the Process
If it’s hard for partners to register deals, you’ve created a big deterrent to people bothering with deal registration. If you’re not getting the throughput you want, the first questions to consider are, “Have we given them good reason to register our deals?” and “How can we make this task of registering deals go more easily for partners?”
Determine the Value of Visibility
Incentives are critical. You need the visibility into the sales pipeline that deal registration delivers. So think about what value you place on that visibility. Without it, you don’t know what your revenues are, and you have no warning on whether you’re going to make or break your quarter.
The information has value: The better you can see what’s in your pipeline, the better you can forecast, the more productive your channel will be. Incentives enable you to buy this valuable visibility from partners. The question is: how will you compensate them?
Create the Right Incentives and Disincentives as Appropriate
In other words, provide the right carrots and minimize the sticks. The faster partners can satisfy your requirements, get in and get out, the more likely they are to bother with it – and to feed you good data. Streamline the process by requiring only the essential info and ensuring your deal registration form is glitch-free.
And don’t forget about the carrots. Create the right incentives and disincentives as appropriate, for example:
• “Your deal is not protected if it’s not registered”
• “Get extra points for registering”
• “Approved deal registration = better discounts”
You won’t find any VARs who like registering deals, but they do recognize the value. You can further reinforce that value for them by making sure the system feeds back their information clearly and accurately. | {
"pile_set_name": "Pile-CC"
} |
Q:
Vector SAT MATH 2
If the magnitudes of vectors a and b are 5 and 12, respectively, then the magnitude of vector (b-a) could NOT be:
a) 5
b) 7
c) 10
d) 12
e) 17
The answer is 5. But I am not sure which theorem I should use to go about this problem. Triangle inequality theorem? Help is appreciated!
A:
By triangle inequality:
$$|b|-|a|\le |a-b| \le |a|+|b|\to 7\le |a-b| \le 17$$
| {
"pile_set_name": "StackExchange"
} |
A popular American burger company surprised Kiwi fans with a brief pop-up store today.
In-N-Out burger fans were treated to limited classic California-style burgers, chips and drinks in Ponsonby, Auckland this afternoon.
Diners had to be in quick - the food ran out within 90 minutes and doors closed at 1.30pm.
Three In-N-Out staff were flown into Auckland to sell the burgers using New Zealand beef, but there are no further plans to open a permanent store here.
The pop-up was the 28th 'testing kitchen' done around the world in the last three years, event co-ordinator at Soiree Events, Holly Bidwell said.
The company is still focused on spreading its reach in the United States.
The Ponsonby pop-up attracted a flurry of interest after just one advertisement ran in the Auckland City Harbour News, Bidwell said.
Fast food fans took to Twitter to air their delight that an outlet was in town, and disappointment that it didn't last long.
"I am so upset. I had NO idea In-n-Out Burger was in Ponsonby today. #PleaseComeBack," Vanessa @nessleberry tweeted.
"This is a little crazy with the weather today I kind of feel like Im in LA 'In-N-Out Burger pop up store in Auckland", tweeted Abby Rose @byarose.
In-N-Out burger is known for its neopolitan shakes and home-style Secret Menu that includes three-pattie burgers and grilled cheese sandwiches. It also allegedly has a swathe of celebrity fans including the likes of Beyonce and Kim Kardashian.
Earlier this year Bloomberg reported the chain's 30-year-old owner and president is one of the worlds' youngest female billionaires, and refused to franchise to outside operators so as to retain control over the brand. | {
"pile_set_name": "OpenWebText2"
} |
A 36p Lighting brochure for BHS Homeware. I have led this project from initial creative pitch to editorial design and content audit, alongside a senior art director who managed the photographic art direction. | {
"pile_set_name": "Pile-CC"
} |
Insidious 3
According to Deadline, Dermot Mulroney (the guy who is not Dylan McDermott) has been cast as the lead in Bunker Hill, CBS’ medical drama pilot about doctors who use computers. Mulroney’s character is Walter Wallace, a “veteran surgeon with a controversial past” who “might care a little too much about his patients,” and he’s been hired by a “young Silicon Valley tech titan” to help start a high-tech hospital that uses fancy gadgets to help people. Being an old person, Mulroney will probably try to resist this “new school” way of treating patients by grunting and frowning a lot, but people will still like him for some reason and then by the end of each episode he’ll come around and admit that technology is pretty cool. Presumably, this change will be inspired by him seeing a robot manage to surgically replace someone’s brain or a 3D printer that creates a perfect replica of a patient’s butt.
Bunker Hill comes from Parenthood’s Jason Katims, and it will also star Augustus Prew and Brenda Song. | {
"pile_set_name": "OpenWebText2"
} |
Q:
What sort of datatype is PRIntn for the file strcase.c
Background
I am reworking a plugin for ettercap and hope to find useful information about handling HTTP-RESPONSE´s in the firefox source code.
Question
So I have found this file named
strcase.c
in the directory
nsprpub/lib/libc/src
from mozilla-beta.
So there is a method called PL_strncasecmp(...) which is interesting for me.
Code:
PR_IMPLEMENT(PRIntn)
PL_strncasecmp(const char *a, const char *b, PRUint32 max)
{
const unsigned char *ua = (const unsigned char *)a;
const unsigned char *ub = (const unsigned char *)b;
if( ((const char *)0 == a) || (const char *)0 == b )
return (PRIntn)(a-b);
while( max && (uc[*ua] == uc[*ub]) && ('\0' != *a) )
{
a++;
ua++;
ub++;
max--;
}
if( 0 == max ) return (PRIntn)0;
return (PRIntn)(uc[*ua] - uc[*ub]);
}
And there is this one line which says: return (PRIntn)(a-b);
And I´m curious what sort of datatype PRIntn is.
Output of grep -rnw "typedef PRIntn" :
root@kali:~/Desktop/mozilla-beta# grep -rnw "typedef PRIntn"
security/nss/lib/base/baset.h:72:typedef PRIntn (* nssListSortFunc)(void *a, void *b);
services/crypto/modules/WeaveCrypto.js:152: // typedef PRIntn PRBool; --> int
nsprpub/lib/ds/plhash.h:21:typedef PRIntn (PR_CALLBACK *PLHashComparator)(const void *v1, const void *v2);
nsprpub/lib/ds/plhash.h:23:typedef PRIntn (PR_CALLBACK *PLHashEnumerator)(PLHashEntry *he, PRIntn i, void *arg);
nsprpub/pr/tests/dlltest.c:36:typedef PRIntn (PR_CALLBACK *GetFcnType)(void);
nsprpub/pr/src/pthreads/ptio.c:283:typedef PRIntn pt_SockLen;
nsprpub/pr/include/prinit.h:105:typedef PRIntn (PR_CALLBACK *PRPrimordialFn)(PRIntn argc, char **argv);
nsprpub/pr/include/prprf.h:67:typedef PRIntn (*PRStuffFunc)(void *arg, const char *s, PRUint32 slen);
nsprpub/pr/include/obsolete/protypes.h:18:typedef PRIntn intn;
nsprpub/pr/include/prtypes.h:467:typedef PRIntn PRBool;
nsprpub/pr/include/prio.h:50:typedef PRIntn PRDescIdentity; /* see: Layering file descriptors */
nsprpub/pr/include/prio.h:357:typedef PRIntn (PR_CALLBACK *PRReservedFN)(PRFileDesc *fd);
nsprpub/pr/include/md/_unixos.h:607:typedef PRIntn (*_MD_Fstat64)(PRIntn osfd, _MDStat64 *buf);
nsprpub/pr/include/md/_unixos.h:608:typedef PRIntn (*_MD_Open64)(const char *path, int oflag, ...);
nsprpub/pr/include/md/_unixos.h:609:typedef PRIntn (*_MD_Stat64)(const char *path, _MDStat64 *buf);
From my understanding of the code I would say it is a kind of Integer or Boolean value. But I can´t argue with just my beliefs.
Thanks in advance
Found Answer
PRIntn is really an integer-type
proof:
prtypes.h:400
400 /************************************************************************
401 ** TYPES: PRUintn
402 ** PRIntn
403 ** DESCRIPTION:
404 ** The PRIntn types are most appropriate for automatic variables. They are
405 ** guaranteed to be at least 16 bits, though various architectures may
406 ** define them to be wider (e.g., 32 or even 64 bits). These types are
407 ** never valid for fields of a structure.
408 ************************************************************************/
409 #if PR_BYTES_PER_INT >= 2
410 typedef int PRIntn;
411 typedef unsigned int PRUintn;
412 #else
413 #error 'sizeof(int)' not sufficient for platform use
414 #endif
A:
Found Answer
PRIntn is really an integer-type.
The statement PR_IMPLEMENT(PRIntn) is linking to the file
prtypes.h
so with looking at this file I found the answer.
proof:
prtypes.h:400
400 /************************************************************************
401 ** TYPES: PRUintn
402 ** PRIntn
403 ** DESCRIPTION:
404 ** The PRIntn types are most appropriate for automatic variables. They are
405 ** guaranteed to be at least 16 bits, though various architectures may
406 ** define them to be wider (e.g., 32 or even 64 bits). These types are
407 ** never valid for fields of a structure.
408 ************************************************************************/
409 #if PR_BYTES_PER_INT >= 2
410 typedef int PRIntn;
411 typedef unsigned int PRUintn;
412 #else
413 #error 'sizeof(int)' not sufficient for platform use
414 #endif
| {
"pile_set_name": "StackExchange"
} |
Tag Archives: Salad
When one mentions the name of the pickled side dish, acar, one usually thinks of the yellowish pickled vegetables dish with pineapples, carrots, cucumbers and the hot and spicy sambal belacan. In Singapore and many parts of Southeast Asia, we … Read more
I had couscous salad for the first time at a recent lunch appointment. It was at the Privé café. I ordered a grilled salmon served with couscous. I remember the taste very vividly – fresh, crunchy, citrus, light and a … Read more
The vibrant mix of colours in the salad, the lightness of the vermicelli soaking in the fragrance of herbs and the citrus juices of tomatoes and limes. These qualities are what makes Yum Woon Sen so appealing and refreshing – … Read more | {
"pile_set_name": "Pile-CC"
} |
Chris Fleming (comedian)
Chris Fleming (born January 29, 1987) is an American comedian best known for his YouTube series Gayle, in which he stars as the titular character of Gayle Waters-Waters. In June 2019, Fleming was named one of Variety's 10 Comics to Watch for 2019.
Early life and education
Fleming grew up in Stow, Massachusetts, attended Nashoba Regional High School, when he first began to do stand-up comedy. He received a degree in theater from Skidmore College in 2009, and one credit short of receiving a minor in dance.
Gayle
GAYLE is a 40-episode, absurdist comedy series on YouTube that was launched in 2012. The series follows high-strung, eccentric suburban mother Gayle Waters-Waters and her ruthless journey to uphold social status in her small suburban community of Northbread, Massachusetts. Fleming developed the idea for Gayle through stand-up. GAYLE is written by Fleming and directed by Melissa Strype, who also plays Gayle's daughter, Terry Gross Waters-Waters. Fleming's mother co-stars as Bonnie, Gayle's best friend and biggest rival, and his father's legs play the role of Dave (with Fleming's voice), Gayle's very submissive husband. The music is by Brian Heveron-Smith, Tom Lowery, and Chris Hartford. Comedian Margaret Cho grew an interest in the show and guest starred in an episode. The series is filmed in Chris Fleming's hometown in Massachusetts. In 2014 the Gayle team went on a US tour with the show titled Gayle Live.
YouTube channel
Fleming runs a YouTube channel under his own name; the channel has gained over 373,000 subscribers as of November 2019. In addition to Gayle, Fleming has a variety of other content that ranges from music videos to car rants. His 2015 video "COMPANY IS COMING", starring his Gayle character, went viral, accruing over 10 million views as of April 2019.
Stand-up comedy
Chris Fleming began doing stand-up comedy in 2005, and in 2016 and 2017 he toured the United States with his stand-up comedy show titled Showpig.
References
External links
Rising comic Chris Fleming chases stand-up dream in LA – The Boston Globe
Local Comedian Chris Fleming Brings Fictional Local Web Character ‘Gayle’ to Boston Stage – BDCwire
Meet Chris Fleming, a Man Who's Man Enough to Admit He's Afraid to Talk to Men - LA Weekly
Category:1987 births
Category:Living people
Category:People from Stow, Massachusetts
Category:Comedians from Massachusetts
Category:American YouTubers
Category:21st-century American comedians
Category:Skidmore College alumni | {
"pile_set_name": "Wikipedia (en)"
} |
Q:
Cassandra or Hadoop Hive or MYSQL?
I am Developing a Web Crawler,Which is Good for storing data? Cassandra or Hadoop Hive or MySQL?and why?i am having 1TB of Data from past 6 Months in my MySQL DB,i need to index them and i need to get the out put in my search ASAP,and as i think,it will store more amount of DATA,like 10 Peta Byes as my crawler are working fast,i need to get the read/write operation fast,i need to integrate it in my PHP app
A:
That depends on details of your requirements, but I think that in your case HBase would be the best option.
Using HBase as a web-crawler database is well documented and it's HBase's use that is described in BigTable whitepaper.
| {
"pile_set_name": "StackExchange"
} |
Chevrolet P30 Series Heater Hose
You enjoy taking care of your P30 Series.
The vehicle in your driveway is head and shoulders above the rest when it comes to all the cars, trucks, and SUVs these days. When your Chevrolet P30 Series left the factory, it was destined for a person with discerning taste who wants value in their automobile. You bought your P30 Series because its reliability and value struck a chord inside you; so why would you be okay with anything but the best when it comes to the highest quality auto parts? While it's not hard to find replacement parts for Chevrolet vehicles, these days the necessity for nothing but the highest quality are required to fix your automobile.
Why Heater Hose replacement is so important.
Believe it or not, your car or truck's heating system is closely tied to its engine cooling system. The engine of your Chevrolet P30 Series constantly pumps and turns a mixture of water and ethylene glycol through the engine block in order to absorb the heat it generates, and transfers it through heater hoses to the heater core so you can warm up the passenger compartment. Chevrolet P30 Series heater hoses assist the vehicle's primary cooling system by providing another route for the cooling liquid to follow so that it could dissipate heat. The return heater hose re-introduces the coolant to the engine after it has heated the heater core so the radiator can return it to optimum temperature.
You've tried the rest, now try the best.
Get your P30 Series back on the road with the highest quality replacement parts from the experts at Car Parts Discount. When your Chevrolet requires the best replacement Heater Hose, there's no need to go somewhere besides the authority, Car Parts Discount. Given all the trouble that can be involved with installing a part to fix your car or truck, let www.carpartsdiscount.com be the most authoritative website you go to make purchasing it easy. If your car or truck was built in 1967, 1966, 1965, 1964, 1963, 1962, 1961, 1960, then you will find the correct Chevrolet P30 Series Heater Hose parts right here. | {
"pile_set_name": "Pile-CC"
} |
City Council Members in New York City and Los Angeles are calling for businesses to cut ties with companies responsible for the Amazon rainforest fires.
Fires burning in the Amazon have been linked to the beef industry; cattle ranchers often set fire to areas of the forest in order to clear land for their herds. There have been 41,000 recorded fire locations so far, according to the Brazilian National Institute for Space Research.
The fires are devastating for indigenous people and wild animals, but they also have a wider impact; Amazonian trees absorb carbon dioxide and are an extremely helpful resource in the fight against the climate crisis.
NYC City Council Members Costa Constantinides and Justin Brannan are co-sponsors of the new resolution, in partnership with Brooklyn Borough President Eric Adams. On the west coast, LA City Council Members Paul Koretz and David Ryu have put forward a similar resolution.
‘What We Eat Matters’
“We are facing a climate emergency,” said Adams in a statement. “We can’t continue business as usual while the planet burns.”
He continued, “today we urge both city agencies and local businesses to cut ties with any company linked to the multinational corporations responsible for the fires still raging throughout the Amazon rainforest.”
“Each individual consumer choice, each corporate decision, and each specific legislative policy must be geared toward making our planet more sustainable and habitable for generations to come,” he added.
NYC and LA are the two largest cities in the United States. City Council Members from both hope that they can lead by example. They want to inspire the other 35,000 cities in the country to join them and introduce similar resolutions.
Leaders also want city residents to consider reducing the number of animal products they consume. According to the United Nations Environment Programme, tackling meat consumption is the world’s most urgent environmental problem.
“What we eat matters,” said Adams, who follows a vegan diet. “Who we do business with matters. This resolution is a first step in opening a broader conversation about how we overcome one of the most significant challenges humanity has ever faced.” | {
"pile_set_name": "OpenWebText2"
} |
Category Archive
There are two main types of latex mattresses on the market: Talalay and Dunlop. In order to understand them, let’s talk go back and briefly discuss the history of latex. When it comes to mattresses, latex is one of the most interesting, sought after, studied and tested materials out there. And it’s got a rich (and sometimes dark) history that … Read More
At M&N Mattress, we are passionate about sleep. We understand the importance of a good night’s rest, and we want other people to feel the physical and mental benefits gained from proper sleep health. There are many factors that determine whether or not a person will rest well overnight. Things like how dark or quiet a room is, whether or … Read More
It’s difficult to keep up with all the technological advancements of the day. Whether that’s drones that make deliveries or a phone that can turn into a life raft (just kidding, but that would be cool), it sometimes feels like we are living in that future we dreamt of as kids. Some technological advancements have the ability to improve our … Read More
Reviews
I initially looked at M& N to support the local economy. When I decided to buy I found the service to be excellent, the mattress good quality and at a good price. I had requested a full sized box spring however I found it made the whole bed too high with the wider mattress, I phoned the store and they came back the "same day" and replaced the box spring with a thinner one and there were no additional charges. Great shop, nice people, good quality products I would highly recommend.
Thank you.
Terence McFall
20:17 23 Sep 16
We purchased two twin Natural XL Ironman beds in March with the help and guidance of the great staff at M and N Beds in Parksville. We noticed very soon after that our sleep patterns improved as did freedom from morning back aches. Yes, these beds cost somewhat more than many regular beds and that is because they are unlike many regular beds.
Very importantly is the after sales contact made by this Company to ensure your satisfaction with the beds. I have no hesitation in recommending M and N Beds
Terry M. Qualicum Beach
Melanie Trudeau
21:52 15 Oct 16
Great customer service! They were able to answer all my questions! We were there for an hour and the representative was very patient to help us decide which bed to purchase! Very happy with our nee bed! Thank you Sukh!
Jim Horncastle
02:07 12 Oct 16
Sukh was very knowledgeable and helpful when were shopping for a mattress for our travel trailer (a challenge with my back issues). The follow up service was superb when we needed to exchange the mattress under the comfort exchange guarantee. In summary - friendly knowledgeable staff; excellent service; excellent after sales support.
Sunita Dhak
17:28 01 Oct 16
Excellent service
Jessie Kalsi
01:52 28 Sep 16
Best customer service I have ever received!!
Charlene King
02:54 20 Nov 16
Customer service was excellent and they went above and beyond our expectations!!!
Pauline Brown
16:12 14 Sep 16
I initially looked at M& N to support the local economy. When I decided to buy I found the service to be excellent, the mattress good quality and at a good price. I had requested a full sized box spring however I found it made the whole bed too high with the wider mattress, I phoned the store and they came back the "same day" and replaced the box spring with a thinner one and there were no additional charges. Great shop, nice people, good quality products I would highly recommend.
Thank you.
Jim Horncastle
02:07 12 Oct 16
Sukh was very knowledgeable and helpful when were shopping for a mattress for our travel trailer (a challenge with my back issues). The follow up service was superb when we needed to exchange the mattress under the comfort exchange guarantee. In summary - friendly knowledgeable staff; excellent service; excellent after sales support.
Melanie Trudeau
21:52 15 Oct 16
Great customer service! They were able to answer all my questions! We were there for an hour and the representative was very patient to help us decide which bed to purchase! Very happy with our nee bed! Thank you Sukh!
Terence McFall
20:17 23 Sep 16
We purchased two twin Natural XL Ironman beds in March with the help and guidance of the great staff at M and N Beds in Parksville. We noticed very soon after that our sleep patterns improved as did freedom from morning back aches. Yes, these beds cost somewhat more than many regular beds and that is because they are unlike many regular beds.
Very importantly is the after sales contact made by this Company to ensure your satisfaction with the beds. I have no hesitation in recommending M and N Beds
Terry M. Qualicum Beach
Charlene King
02:54 20 Nov 16
Customer service was excellent and they went above and beyond our expectations!!!
Steve Weldon
16:46 10 Dec 16
The Folks at M&N Mattress are extremely knowledgable in their area of expertise: Sleep & Mattresses.
Although I have known them quite some time through business, it wasn't until I went to select my Ironman mattress in the store that I found out how truly deep their product and technical knowledge was. Also, the after purchase service was fantastic as well. The delivery was prompt and any questions I may have had were answered concisely.
Thanks M&N, now I can rest easy!
Jessie Kalsi
01:52 28 Sep 16
Best customer service I have ever received!!
Jane Campbell
23:50 06 Jan 17
Our third purchase at M & N says it all. Friendly and professional, staff finds the right fit for your needs. Customer service is exceptional and to top it off, mattresses are made in Canada. Doesn't get much better than that!
Cory Chapman
18:29 07 Jan 17
Have had our Ironman mattress for almost 5 years now and still love it. Staff, management and owners here were excellent to deal with and would highly recommend them. Thank you for the great service and comfy mattress.
John World
17:32 24 Nov 16
Great comfort and healthy choice!!
Avery Chris
17:25 10 Jan 17
Elaine Conway
23:31 17 Dec 16
great people so helpful to every income levels.
Jay Deleskie
20:54 13 Jan 17
My wife and I both have chronic pain from arthritis to lower back injuries which make mobility difficult. Before we met the staff at M & N mattress we were unsure as to what was the best option to aid in our chronic pain injuries. They suggested an Ironman bed with adjustable positioning. These beds saved our lives as since we have gotten our new bed we have been more mobile and wake up not in pain because this is the most comfortable bed we have ever slept in. I am buying one for my parents because they also have similar injuries. This bed will heal you and is the best investment I have ever made hands down!!
Could not be happier with the service and the product! A must see if you want a better healthy life.
Sunita Dhak
17:28 01 Oct 16
Excellent service
D M
03:40 22 Jan 17
Above and beyond Service. I can definitely recommend them.
korinna leach
02:13 20 Mar 17
I have just moved to Vancouver Island sight unseen from Australia. With chronic back injuries that leave me often incapacitated with migraines and sciatica, I decided to invest in a good bed as well as a new life. I researched mattresses for months and phoned around to find the best deal from a local shop and finally found M&N Mattress Shop. I was impressed with the knowledge not only of the products but also the in depth understanding of my physical issues.This family run business gave me a great bed as well as sincere personal rapport. It is one of the most pleasant customer care experiences I have ever has and served as a nice welcome to me on this new adventure and new chapter in my life. And a great sleep is the bonus!
John Lee
23:54 22 Mar 17
Great store, great service, great products at great prices! I am a light sleeper who has had trouble getting a full nights sleep for years. Thanks to Sukh for finding my wife and I a solution that works for both of us and thanks to owners, Mark and Neelam for finding a way to accommodate our budget. We will be back!
Ricia Adair
22:16 15 Apr 17
I'm totally in love with my Ironman King Bed that I got from M & N Mattress in Parksville. First was going to get a Queen, but am so glad I upgraded to a King. I wake up back pain free feeling and feel so well rested. Thank you Mark and Neelam for the awesome customer service.
Rick Primus
16:25 23 Apr 17
Very friendly and knowledgable.
Mattress is great. Haven't slept so well in years.
Jeanette Ferguson
20:10 30 May 17
We have dealt with M & N Mattress for 15 years, buying beds and furniture. We have found their prices to be good and they supply good quality. I had to deal with M & N very recently regarding a mattress that didn't stand up well and they stood right behind me and worked towards me getting a new mattress. Their customer service and after sales service are the best in my experience. I would highly recommend them for their service, pricing and knowledge of product.
victoria gillott
16:23 01 Jun 17
I bought an iron man bed and have never slept better in my life! Would highly recommend to everyone from just wanting a new bed to having any pain this bed will fix everything!
Wendy Mortensen
21:27 03 Jun 17
This will be the 3rd mattress set we have purchased. The quality and service are 2nd to none. We would highly recommend M&N Mattress
Joanne Thomson
00:43 04 Jun 17
Excellent customer service. Sukh ensures you get what "you " want and need at the right price and ensures you're happy with the product afterward.
Erin van Steen
19:12 04 Jun 17
service was great, but the Ironman bed was even better, product was better then we anticipated. we are having great sleeps and it has helped with our back pain. Even bought a second one as my husband works out of town and couldnt get the same sleep without it.thanks M &N for helping us out. the vansteens
steve k
20:46 05 Jun 17
The staff at M&N Mattress Shop are amazing. Very Knowledgeable about there product and the most amazing customer service i have ever seen and experienced. Sukh and Neelam make an amazing team at the store making sure everything is smooth sailing. I was very surprised how well they cater to your needs. As far as a great sleep i would highly recommend the ironman mattress it is a must for a great recovery and sleep.
Yvonne White
15:30 07 Jun 17
I would like to thank everyone at M&N Mattress for making my experience of finding the perfect bed so easy! I love my Ironman bed! I have never slept better. I truly believe it has helped my shoulder injury as I can now sleep on my side again. I have to also mention the ironman pillow. After buying so many different pillows I found this one. It is amazing! After a year it has never changed! I don't think I'll ever need to buy another! I know longer wake up with a headache feeling the need to fix my neck lol.
It was really a great experience as delivery was the same day and they went above and beyond setting up my bed and taking away my old bed without any extra charges. Great customer service is sometimes hard to come by these days. Thank you everyone at M&N Mattress!
Yvonne White
Mike Bourcier
17:56 13 Jul 17
The fact that their "IronMan" bed has literally changed my sleeping life is enough to recommend them BUT, the attentive customer service you get at M&N Mattress goes well beyond the norm. Neelam and Mark are owners who are involved 100% and their staff reflects the professionalism they project. I name numerous friends in this community who are as impressed as I am.
Michelle Pelletier
18:16 13 Jul 17
Sleeping on my Ironman mattress has really improved my quality of life. I wake up refreshed and the arthritis and fibromyalgia pain I used to feel is mostly gone. I just wish I could take it with me when I travel. It is so great to come home to it. I recommend it to everyone, just think of how many hours you spend on your bed. Totally worth the money. I found the owners and staff to be friendly and they obviously know their product very well. Just go try it!!!
Ageliki L.
20:48 26 Jul 17
The M & N Mattress Shop consistently has given us the best customer service! With moving to a new city and having to purchase bedroom sets and mattresses for the whole family, they made things super easy with no stress. We received information on all their products by experienced and friendly staff and they assisted us in picking the best mattress for us. Both of us have spinal issues and along with their assistance we chose the right mattress. It has made a huge difference in the amount of pain we experience throughout the day. If we have any questions, we simply call them and they are always happy to help us. M & N Mattress Shop is DEFINITELY the BEST place on the island to get an expert opinion and the best mattress for a good nights rest!!!
Joe Goode
18:33 14 Aug 17
We were new to the Parksville area and in dire need of a new mattress, M & N Mattresses was an amazing pick. After reading a few reviews on Google I thought I would go see what they were about. I was fully educated on the mattress industry within 20 mins of being there and felt much more comfortable about my purchase (normally I shop around, to make sure I get the best bang for my buck). I was extremely impressed with the knowledge that was bestowed upon me and can't wait for my free delivery! I saved a lot of money and am very excited to try our new bed. Thanks a ton guys!
Vicki Elsdon
23:39 19 Sep 17
We were in need of a new bed. Suk asked us all the things we like in a mattress. Then he asked us if we had a medical issue that he needed to address. Once we informed him that I suffer from Fibromyalgia he let us try certain mattress' then let us try the one he would pick for me. He was so right!!!! He explained exactly what the mattress was manufactured of and why I was feeling the differences. After 4 nights sleeping on the new mattress I felt SO GOOD. My body is really happy we made this purchase :)
We were NEVER pressured or rushed at all. It was an absolute delight and fun dealing with Suk.
The pillows that we chose turned out to be too soft, true to their word when I returned 3 days later they exchanged them for the next firmer ones. Not hassles at all.
The delivery was right on date. We have NEVER had such efficient, polite and knowledgeable young men deliver to us.
All in all, we would recommend M&N Mattress Shop to our family and friends.
Vicki
Valerie Hudson
20:30 20 Sep 17
Without a doubt the best customer service I have ever experienced.
The sales staff are knowledgeable professional and personable. I had just arrived in B.C and required a bed asap. My purchase was delivered by their delivery team who were on time and professional.
A week later I had to purchase a metal frame which was delivered and installed for me by one of the sales staff which was so appreciated as my mobility is currently compromised.
Then I needed a smaller box spring as the bed was too high. I called the owner and they made the delivery and exchanged my box spring on the same day as I had called. Amazing service !! I couldn't be more satisfied and I highly recommend M & N Mattress Shop
Lynn Chwartacki
00:20 24 Oct 17
Personalized service, every customer counts.
Interested in your sleep habits and physical health in order to properly assess your mattress requirements.
Finding the mattress which meets your needs is extremely important. I commend the staff on their knowledge and client driven approach.
Thank you...
Gloved Up Promotions
14:55 02 Nov 17
I have dealt with M&N furniture for close to fifteen years now and I struggle to find the right words in describing such a helpful and community driven store. Mark and Neelam - and Sukh- have gone above and beyond their roles at the store to assist me and my family in much more than choosing the right mattress. When I was younger Mark offered me a job at a time in need, when I bought my first home Mark was quick to borrow me his truck, and now as I type, I am in possession of the M&N delivery truck as they helped, yet again, in a move to a new home. If you are anywhere from Campbell River to Duncan, and everywhere in between, you owe it to yourself to check out M&N mattress.
Aren Foster
22:58 07 Nov 17
We recently purchased a cabinet bed at M & N Mattress. Sukh came to our house to take measurements and help select the finish colour. The delivery was prompt and efficient and we were shown how to set up and store the mattress in the cabinet by the helpful staff. As newcomers to the area we were pleased by the personal service and warm welcome we received.
Donna Andres
22:41 09 Nov 17
We purchased an Ironman Bed from Mark and no bed has compared to to. When I travel and sleep on other beds my back usually hurts. When I’m back in my own Ironman I feel refreshed and always have a good sleep. Mark has been wonderful. Thank you M & N Mattress. Definitely 5 star.
julie towers
15:39 15 Nov 17
Just bought my 2nd mattress in a year from this amazing company. Plus a beautiful new bed frame. We absolutely love our new mattresses both in our RV and in our home. Great products, the service is over and above anything I have experienced, it puts the big box stores to shame. Delivery fast and efficient and everyone so friendly and accommodating. Thank you for such a positive shopping experience.
Donna Jansonius
21:04 16 Nov 17
Great service! After not picking up my paid for mattress for many months, I was worried they would not honour my purchase. That wasn't the case at all! They quickly found my paperwork for my purchase and promptly ordered the mattress for me. Very impressed. M&N I'll be a customer for life. ??
Kari-Lee Burnham
20:43 04 Jan 18
Mark was very helpful. He found a good match in our budget and the mattress was delivered the next day. Its been just over a week and hubby and i are sleeping great. We will be back for our future mattress purchases.
GWT SLT
22:35 05 Jan 18
Highly recommend the M&M Mattress Shop - the staff is welcoming, very knowledgeable and the prices are extremely reasonable. We have recently purchase three beds for our new home and are very happy to have shopped locally . Delivery personnel are also very efficient and respectful in every way.
Amanda Hatcher
00:45 10 Jan 18
From the moment I walked in the store to saying our goodbyes, I found the staff very friendly. I enjoyed my shopping experience and appreciated all that was offered. They went above and beyond my expectations. Thank you!
Elisabeth Smith
15:48 03 Feb 18
Excellent product and service. We purchased the Cabinet Bed, and it is comfortable and very easy to set up and take down. Thank you M & N Mattress Shop!
Katie Classen
21:46 19 Mar 18
We purchased a dresser from M&N Mattress recently and are extremely happy with it. The quality is great but it is the customer service that really stood out. The purchase was easy and the men that delivered it were exceptional. They made sure we were happy with the product before they left and made it very clear that they were only a phone call away if we noticed any problems. That was such a refreshing change from most that run as soon as they have your money. We will definitely be doing more business with this store.
Lynda de Fouw
18:17 27 Mar 18
We recently bought a NEWGEN mattress from M&N Mattress in Parksville BC. The staff were fantastic, very friendly and extremely knowledgeable, even the delivery men were super great. The mattress is the best sleep we have ever had. I recently had shoulder surgery and found that I am not tossing and turning, but actually sleeping through the night. My partner as well has had no back, hip, or shoulder pain. Excellent all the way around. We highly recommend this establishment and the bed... Great job M&N Mattress
Laura Healey
03:15 04 Apr 18
Wow, this purchase was one of the final items to arrive in my new home. The service from the sales, to delivery to management was awesome. I work in the service sector and they impressed me. The delivery guys took the time to explain set up and how to use it. It was refreshing to purchase from a company that truly cares! Follow up call was a nice touch. Impressed
Albert Delos-Angeles
00:31 05 Apr 18
The staff were amazing and knowledgeable about the products they sell. I’m very happy with the customer service they have provided me. I purchased a Ironman 3.0 and the mattress was a little to firm for my liking. I’m so glad about their 366 night comfort exchange guarantee. I came in and informed them about my mattress and they exchange my mattress for another one with no hassle. They delivered and picked up my other mattress free of charge. Absolutely blown away with the service they provide. Thank you so so much! I will highly recommend you to everyone who needs a mattress.
louise brandt
20:51 12 Apr 18
These people at M&N are very professional to do business with, I had very good information about purchasing a mattress to suit me. The warranty is excellent, and they make ever effort to please . My mattress I purchase was to firm for me, so after trying it for a few night they replaced it with a softer mattress, no problems to do that, , the young fellows that delivered my mattress were very good, pleasant,and polite, I recommend anyone wanting a new mattress to go see these people, I am a very happy customer. Thanks M&N mattress-Parksville, Vancouver Island.
Derek Simnett
20:43 26 Apr 18
This is the place to get your new mattress! We received our IronMan Mattress two weeks ago and my partner and I have never slept better. Mark is knowledgable, professional and knew exactly what kind of mattress would work for our needs. The delivery team was great,and we even received a call a few days later asking how we were sleeping. We can't recommend M&N Mattress shop enough. They truly go above and beyond and really care for their customers.
Natalie Zavaglia
20:12 14 May 18
Best mattress ever. We have two. Service is really good. I just acquired a king size pillow from them and so far so good. I'll be back for a couple more pillows. Lol. We have a queen size and a king size mattress. Both are different in their firmness and both are great. Definitely the only mattress we will ever have.
John Anderson
05:35 22 Jun 18
We were originally looking for a “Murphy bed” and discovered M & N Mattress by chance. The bed we purchased folds into a cabinet which looks like a large dresser. It unfolds into a double bed with a high quality foam mattress which competes with our deluxe king size bed for comfort. We were most impressed by the build quality and that these beds are made in Canada. When the bed was delivered, the two gentlemen who set it up went over the procedure for unfolding and returning the mattress to the cabinet. Very professional and courteous. I’d recommend this local business and their products to anyone looking for a space-saving bed.
Cindy Shantz
15:28 01 Jul 18
We recently bought a NewGen mattress and a cabinet bed because we were so impressed with the knowledge of the staff. Our mattress is very comfortable and the cabinet bed looks great in the guest room. (No one has slept on it yet, but I assume it will also be comfortable.) The two men who delivered the mattress and the cabinet bed were polite, informative and efficient. M & N Mattress has outstanding service and that is one of the reasons we decided to deal with them. We have no doubt that if we encounter any problems in the future that they will be dealt with, although we certainly don't anticipate any problems!
Kathy Karlsen
23:13 14 Jul 18
I have purchased a few mattresses over the years and M & N is without a doubt, the best place to get assistance and guidance on making that purchase. I would be hard pressed to go anywhere else, as the customer service and product quality is by far the best. They have always exceeded my expectations.
Jim Steeves
21:51 20 Jul 18
In store service was excellent, the delivery team was on time and courteous. The bed and the pillows have provided the best sleep in years.
You guys provided all of the information required for us to buy the best bed we could. Thank you
Ramy Gerber
05:29 31 Jul 18
Wonderful experiences both at the shop buying the cabinet bed and when it was delivery. The cabinet bed allows us to have another guest room with usable space when we need it. The staff was helpful and attentive to answering our questions. The delivery people were polite, hardworking, and helpful as well. Highly recommend this Mattress Shop.
Jordan Woods
01:19 10 Aug 18
I would highly recommend the wonderful, helpful, friendly service at the M&M furniture store in Parksville. From the owners to the employees, all the staff are so kind. it does not matter what age you are younger or older, they are so willing and helpful.
Karen Taylor
20:37 24 Aug 18
M & N were very welcoming! They took their time listening to my specific needs and offered me their professional opinions and solutions.
I would definitely go back! Thank you.
AJ Ewart
05:43 01 Sep 18
The original telephone contact gave me confidence as Sukh explained various concerns a first-time cabinet bed buyer may have. He suggested I visit the local outlet to better prepare before my decision!
The help locally was invaluable...such a team they are despite the miles between their stores. Within 7 hours I had seen the ideal unit for my new home and it is on order to be delivered the day of my move-in.
Seldom in my life have I been given such caring, no-pressure information to assist me with a big purchase. Thank you, M&N Mattress, Parksville, BC.
Diane Long
15:03 03 Sep 18
I purchased a Nex Gen mattress a few weeks ago and couldn’t be more impressed. The staff were so helpful and so informative, taking the time to let me try the range of mattresses. Within nights of sleeping on my new mattress I was able to cut my pain meds in half and now most nights are pain free. I also bought the adjustable base which allows me to get in just the right position to alleviate the pressure on my lower back. Works great for decreasing snoring and reflux too which have been issues, not to mention I’ve never been more comfortable reading in bed. Well worth the money. Only wish I’d purchased it a few years ago.
premi sandhu
18:29 12 Sep 18
What an amazing experience! I had no idea so much went into mattresses. The staff are very knowledgeable and know exactly what goes into a good night sleep, and they defiantly know there product. I would highly recommend anyone in the market looking for a new mattress to visit M & N! these guys are awesome!
Lorie Heshka
20:01 13 Sep 18
Sukh was so welcoming and gave us such great information that I am extremely happy with my new mattress and pillow. He treated my grandchildren so nicely also!! I will definitely go back to M&N when I need more for sleep comfort!
Patricia Allaby
01:12 02 Oct 18
We just moved to the Island. We met Suhke at the homeshow and bought a mattress. We are very happy with the bed and the service. We received it the day after we went to the store. It’s super comfortable. The delivery was prompt and they took away our old mattress. I would recommend M & N Mattress Shop.
Craig Gooding
03:32 02 Oct 18
We Have done business together for over 10 years, and it has always been a great experience. I am a builder of quality homes, and I always recommend them to my clients for bedding and furniture. Good people, good business.
Eowyn Christensen
20:52 02 Oct 18
I came across M&N Mattress Shop by chance and I happened to be in the market for a new bed. The staff are knowledgeable and very friendly. The whole experience was positive from the showroom to my room.
Thanks M&N!
Justin Johal
06:38 11 Oct 18
I have enjoyed my new mattresses for several days now and I am satisfied with my purchase. I chose M & N Mattress Shop because they have some of the best mattress material for comfort, durability and overall value. I am pleased with not just the mattress but the personal service they provided especially with the care they took with the delivery process. I would recommend M & N Mattress Shop products and services to anyone. Thanks.
rcf
18:36 21 Oct 18
What great service. I had already mentioned this shop to a friend looking for a new bed. They had what she needed and delivered the next day. She's very happy with the bed and the whole experience. Then I found myself with a broken wheel on my bed frame. The shop went through their parts and found a suitable replacement. No charge. You can't get much better than that. The new wheel fit perfectly. I'll definitely be back when a new bed is needed and will continue to recommend this shop.
Kane S
19:45 17 Nov 18
Wonderful service from all staff at this local BC business. Delivered and setup right on time. Very courteous and helpful and removed our old mattress. We've had the mattress Ironman "Radiance Series" King-size for a week now, so comfortable one wishes to not get out of bed! Our only regret is that we put up for so long with sleeping on our old mattress and didn't do this sooner! Thanks again.
Des Moran
00:55 19 Nov 18
We are very pleased and impressed with the service we receive. We have dealt with this business before and certainly will do so in the future. We recommend them highly!
CA Aube
21:03 20 Nov 18
I purchased a cabinet bed. The quality of the piece is very good. Solid wood and the colour of the stain was what I expected. The mattress that came with it is a bit firm but it's higher quality mattress. Unit is well made, safety features like the latches on the inside add to the quality. It does need to "off gas". Delivered before promised - Excellent delivery service - on time, efficient.
Steve Taylor
18:04 01 Dec 18
Stellar products and even better service. A wonderful experience all round. This is the kind of place where they "go the extra mile" to make sure you are happy.
Rick Branger
14:43 05 Dec 18
We bought a NewGen split king from M&N. This bed is great! Everyone in the store was friendly and helpful. We received an incredible amount of information on the structure and manufacturing of the mattress. You sure can't beat their warranty AND they're local!
The delivery guys were very efficient and helpful, They made sure we understood the controls before they left, and took the old mattress and frame away. One less thing for me to do!
Keep up the good work!!!
.
Tammy Exner
18:38 11 Dec 18
Love to shop local! Great experience at M&N Mattress - easy, fast, good service and low price. Had just what I was looking for and could deliver it in a few days. My first time shopping here. I'll be back.
Kimberly Anne Thompson
19:55 13 Dec 18
Excellent customer service and excellent mattresses! I have been an M & N customer for just about 2 years now and I have had only positive experiences shopping with them! If you're lucky, you sleep a third of your life... so it might as well be on an amazing mattress that makes for a great sleep! I am a Massage Practitioner and truly believe that getting a good sleep on a good mattress is very important and makes for good days and a happy, healthy life :)
Bj Porter
16:30 25 Dec 16
We purchased an IronBed 3 years ago from M&N Mattress Shop ,received great service from knowledgeable staff that helped us understand why their mattress was the right choice for us. After just one night of perfect uninterrupted sleep I was hooked , no morning back stiffness , refreshed and ready for each day . 3 years later my mattress is still in perfect shape , no lumps , no indentations and each night I look forward to another amazing sleep and expect to for another 20 years. If you are considering one of these beds you will not be disappointed.
elaine strome
19:23 10 Mar 18
Just purchased a cabinet bed. My space is limited and its always nice to have room for guests. The cabinet makes a nice piece of furniture as well. The delivery guys showed me how it works and were courteous and clean.
Patty Matranga
20:58 13 Apr 18
I recently had the pleasure of visiting M&N Mattress Shop and trying out an ironman mattress. The owner, Mark was very helpful. I left the store with a latex pillow. The pillow provides firm support and is the most comfortable pillow i have ever used. The next time I need a new mattress, I know who i will be contacting. Thanks again Mark. | {
"pile_set_name": "Pile-CC"
} |
Perhaps like many of you, I’ve had to embrace the world of Bluetooth headphones and earbuds much sooner than I would’ve liked. Mobvoi makes some superb Wear OS smartwatches, but the IndieGoGo-backed TicPods Free finally give Android users a solid alternative to Apple AirPods.
While often as a reviewer you might take a jab at Apple or make a bold claim about a product being ‘X’s answer to Y’, the TicPods Free actually do genuinely offer up an exceptional alternative to the AirPods. Clearly, the design will be justified as ‘close-enough’ to the official Apple wireless earbuds to make them more appealing to those that don’t know any better.
Of course, the influence of the big fruit is all over these headphones. From the case to the shape, to the base color option, these reek of ‘Apple-ification’, but that doesn’t mean they are a by-the-numbers replica. In fact, they’re far from it. Mobvoi have created a pair of Bluetooth earbuds that not only stand up to the market leaders, they also beat them in a number of core ways.
Design
Copying a style icon
As I’ve said (and as you can see), the TicPods Free look like a cast off or prototype from the Apple design labs in Cupertino. The elongated antenna-like ear-prongs are almost indistinguishable from a distance, however, up close they do have a few unique design choices.
Let’s start with the headphone case. It’s a small, sarcophagus-style carry box that acts as both a home and charging dock for these earbuds. The lid does feel light and is my only concern with the entire package, as the mechanism lacks the rigidity I’d expect. That said, the lid is secure, locks into position and stays closed comfortably thanks to a magnetic clasp.
That worry is probably unfounded though, as even after dropping the case once or twice, my TicPods didn’t budge and neither did the lid. You can shake away vigorously and the lid won’t flop open — but in white you can see the LED lighting that blips to confirm your headphones are charging or disconnected from your device.
I like the ridged lid of the case as it gives a nice grippy surface but it also serves the dual purpose of me being able to tell which is the right way up when the TicPods are in my pocket or bag. It’s a little touch that might go unnoticed by many but I appreciate those neat extra thoughts during the design process.
On the side panel of the carry case you’ll see the only branding found on the packaging, the TicPods embossed logo is framed by two LEDs. These change color to indicate the battery level of the buds when opening the lid.
Like most wireless earbuds, the case needs a charge to keep the TicPods Free topped up when safely enclosed inside. There is one solitary micro USB port — which should be a USB Type-C at this point — found on the right side of the case which allows for charging.
The earbuds themselves feel like a slight upgrade over the AirPods thanks to the inclusion of the traditional rubber tip that sits better in your ear canal. The fit is snug but there are only one additional set of silicone tips in the box. That could be a problem if these buds don’t fit quite right with the included options — Mobvoi should definitely have included some more in the box.
I’ve yet to mention the color options, of which there are three: Navy, Lava and Ice. That will be blue, a sort of orange-red and white to everyone else. I tested the white version and I did receive plenty of comments asking if I had an iPhone now, prepare some witty replies and retorts for that exact situation.
Each pronged headphone has that same ridged design on each stem, this gives extra grip but also help with audio controls and general control — more on this later though.
Sound Quality
Almost exceptional
I’m in no way an audio snob or what some might call an audiophile. My listening preferences veer towards Podcasts more so than playlists nowadays. That said, I am impressed with the overall balance and despite the bass feeling a little weak at times, it’s more than acceptable for my eclectic musical tastes.
I found vocals to be clear even in muddy tracks, that said in bassy dance tracks the overall experience felt a little duller than I would normally wish for without that extra bassy oomph. It’s pretty much par for the course given the form factor, as the smaller size means drivers tend to have much less power. Of course, there are very few in-ear earbuds that will match the sound quality offered by over-ear headphones.
Almost all genres hold up well, and they are comparable to many other headphones priced in and around the same entry point. For avid podcast listeners, you will have no qualms with the sound quality.
I’ve used these buds for quite a few phone calls and video calls too and yes, people still do that. Call quality and microphone pickup were excellent, the active noise cancellation packed in is clearly helping when picking up speech.
Noise cancellation can be a misnomer though, as it doesn’t block ambient noise when wearing the earbuds. It simply blocks the microphones when making calls.
Controls
The TicPods respond to tap and swiping gestures, with the stem design actually working well for these kinds of swipe and tapping gestures. To increase volume you swipe up from the base of the prong while, naturally, swiping down decreases the volume.
Double tapping skips the track or skips forward in your podcast app of choice, while a single tap pauses the playing audio. This can be achieved by taking out the right earbud too as the TicPods Free automatically re-pair and resume playing when you place them back in your ears.
Holding your finger on the side of the stem activates Google Assistant, which I found useful for checking the time when out and about. Overall I found the controls really intuitive in theory but less so in practice. The volume controls worked without fail for me at least, but skipping and pausing tracks probably worked around 85% of the time.
Battery Life
Mobvoi claims that the battery on the TicPods Free can last up to 18 hours, however, that includes a couple of charges in the case. Initially, I thought that was a bold claim, but in practice I was getting at least 15 hours and by that point, I was automatically plugging in to charge the earbuds anyway.
The battery life is just that good. It doesn’t quite match the Apple AirPods but it gets damn close. What I will say is that these buds are way more comfortable than any Apple headphones when worn for a significant amount of time. .
Final thoughts
I cannot recommend the TicPods Free highly enough if you were looking for Apple AirPods alternatives that actually work well with an Android phone. The sound is great, not quite exceptional but there are quite a few more expensive wireless earbuds with comparably poorer sound quality than the TicPods.
When bought at RRP, the TicPods Free are still up to $30 cheaper than the Apple counterpart. They play nicely with Android and the controls — when they work — are arguably better than those on the AirPods on an Android smartphone.
Where to buy TicPods Free
Mobvoi
Amazon
US
UK
FTC: We use income earning auto affiliate links. More.
Check out 9to5Google on YouTube for more news: | {
"pile_set_name": "OpenWebText2"
} |
Q:
Can't access particular website on Windows Server, but ping works
In my Windows Server hosted in AWS, I tried to access a particular site from Chrome/IE and both browsers returned - the site can't be reached/the server refused to connect. However, when I try to ping the same website from cmd it seems to work just fine. I don't use any proxy in the network setting and Chrome is set to detect network settings automatically.
So this is definitely not an IP based block from the website. My local PC and my server PC are in the same region, but different city. It works great in my local PC but in the server, it simply works via ping.
What are some possible reasons that might have caused this?
Updates
Telnet Connection Failed
A:
Is not an IP based block, but what about procotol type or port block?
ping sends ICMP packages to a host but when you try to open the website via Chrome you need to establish a TCP connection to a host:port. So you should check the firewall in your server, if is hosted in AWS check also the Security Group rules.
Then you can test if you are able to connect to HTTP (80) or HTTPS ports (443), for example using:
telnet myserver 80
telnet myserver 443
instead of
ping myserver
| {
"pile_set_name": "StackExchange"
} |
By
I make no secret about the fact that I’m a gamer geek who loves to play World of Warcraft. It’s an outlet for many things, including a place to go when coping with my depression, anxiety, or the mental and physical symptoms of a CFS flareup. But it’s also great for my creativity as a writer; my favorite fiction genre is fantasy, and that’s what World of Warcraft is. There’s an aspect of gameplay in World of Warcraft that has very little to do with the game’s mechanics and everything to do with the world-building the creators have done. Roleplaying is completely optional, but there are entire servers (called “realms”) that specialize in roleplay, and players on these servers can really get into their characters.
I’d like you to meet my main character, Carisse Dawnfire.
Carisse (kuh-REESE) is a Blood Elf mage. Back before the Catacylsm, and back before the Third War, she was Magistrix Carisse Dawnstar of Silvermoon City. But after the attack on the Sunwell that robbed her of her father and her sister, Carisse didn’t have the heart for politics anymore, and she took to traveling for a few years. Though she had a knack for it, the mercenary life was not for her. But that was how she met Elynxdria k’Shinar, known to friends as “Lynx,” and the two had remained friends even after leaving the merc company.
The decision to wander the newly discovered continent of Pandaria was an easy one for Carisse. Garrosh Hellscream was spilling the blood of his people like water, as if dead fighters were of no more consequence than insects squashed under foot. Maybe that was the military way of thinking, but he had burned through enlisted soldiers long ago and was now forcibly conscripting any member of the Horde he could get his hands on. Lor’themar Theron saw Garrosh for what he was, and setting up his own campaign in Pandaria while under the guise of working with the bloodthristy Warchief was a brilliant stroke. Carisse had been able to help Lor’themar’s cause while exploring on her own and learning all she could about this “new world.” These Pandaren were fascinating, with such a rich history. She was learning all she could, now, and thought she might be able to make her new home here.
Maybe. Mage gifted as she was, she could easily keep apartments in many cities in different parts of the world, choosing where to spend her time differently on a daily basis. But had she been moving around too much? Silvermoon had been her home for over a century. Could she really stay away? Her estranged mother was still there, true, but so were the graves of her father and her sister.
This was not the time to decide. This was the time for discovery.
World of Warcraft and its universe belong to Blizzard Entertainment. They are very supportive of fan-created works, and as a fan, I am grateful for the opportunity to immerse myself in their world. Carisse (me) and Lynx (Tom) play on the US-Emerald Dream server. Our guild is called Sapere Aude. If you are interested in starting a new World of Warcraft account, please leave a comment on this post, and I will send you a Recruit-a-Friend code for the free starter version of WoW.
Christina Gleason ( 974 Posts That’s me: Christina Gleason. I’m a professional copywriter, editor, and blogger. My company is called Phenomenal Content. (Hire me!) I'm a multiply disabled autistic woman doing my best in this world built for abled people. I’m a geek for grammar, fantasy, and select types of gaming, including Twitch Sings and Plants vs Zombies 2. I hate vegetables. I have an intense phone phobia, so I’ll happily conduct business over email or IM instead. | {
"pile_set_name": "OpenWebText2"
} |
Pseudohypoparathyroidism type 1A and morbid obesity in infancy.
To describe an infant with early excessive weight gain as the principle manifestation of pseudohypoparathyroidism (PHP) type 1a and Albright hereditary osteodystrophy (AHO). We describe the clinical and laboratory findings in an infant with early excessive weight gain without evidence of hyperphagia and review relevant literature. The proband's birth weight was 4047 g (1.4 SD). She was breastfed from birth. Excessive weight gain was noted by 1 month of age. At 3 months of age, hard subcutaneous nodules were observed, and histologic analysis of a biopsied lesion suggested a possible diagnosis of ossified pilomatricoma. At 6 months of age, she was documented to have mild hypothyroidism. Abnormal weight gain continued despite a caloric intake of about 65 kcal/kg per day. At 11 months of age, 2 new subcutaneous hard nodules were identified, which in the context of excessive weight gain and evolving mild primary hypothyroidism, suggested a unifying diagnosis of PHP type 1a and AHO. GNAS sequence analysis was performed, which revealed a 4-base deletion (Nt565delGACT) in exon 8. As more monogenic causes of severe early obesity are described, it is important to consider PHP type 1a in the differential diagnosis. Lack of short stature, skeletal abnormalities, or absence of PTH resistance should not exclude this diagnosis in a young child. | {
"pile_set_name": "PubMed Abstracts"
} |
Henry Schein Named A 2018 World's Most Ethical Company By The Ethisphere Institute For Seventh Consecutive Year
Henry Schein has been recognized as a 2018 World's Most Ethical Company® by the Ethisphere Institute, a global leader in defining and advancing the standards of ethical business practices. This is the seventh consecutive year that Henry Schein has been honored with this award, which recognizes organizations that operate with purpose and incorporate integrity into their ecosystems.
The Company is one of only 135 companies honored this year and is the only honoree in the health care products category. The World's Most Ethical Companies designation recognizes those organizations that have had a material impact on the way business is conducted by fostering a culture of ethics and transparency at every level. This is the 12th year that Ethisphere Institute has published the World's Most Ethical Companies list. For more information on Ethisphere’s World’s Most Ethical Companies rankings, please visit
https://www.worldsmostethicalcompanies.com/honorees/. | {
"pile_set_name": "Pile-CC"
} |
"Lock her up for what? Because you disagree with her?"
A chorus of Albertans at a political rally chanting "Lock her up" about Premier Rachel Notley initially left communications professor Brian Gorman speechless.
"We have a long and ignoble history in Canada of aping the Americans — unfortunately not always in positive ways," Gorman said Sunday, referring to similar refrains from American voters keen to see Hillary Clinton behind bars.
More than 1,000 people crowded in front of Alberta's legislature building on Saturday for a rally hosted by the right-wing Rebel Media group.
The chant erupted in response to a speech from politician Chris Alexander, a federal Conservative leadership hopeful.
"There's an ugly tendency among the extreme right, and I suppose the extreme left as well ... to confuse any disagreement with something that must be eliminated," Gorman said.
He pointed to groups such as Breitbart News Network in the U.S. and Rebel Media in Canada. Neither strive for coverage that reflects both sides of a debate, said Gorman, a former journalist who now teaches at MacEwan University.
Brian Gorman, a communications professor at MacEwan University, said chants at a rally against Alberta's carbon tax left him speechless. (Zoe Todd/CBC)
"They see journalism as a struggle between opposing ideologies — and their aim is to win that struggle."
At Saturday's rally, Rebel Media leader Ezra Levant urged protesters not to engage with CBC employees covering the event. He decried them as extremists and activists, prone to causing scuffles.
Levant passed his microphone to speakers such as Wildrose leader Brian Jean, who vowed to tear up the carbon tax legislation if his party is elected.
Gorman described the speeches at Saturday's rally as a political power play, tapping into the anger and resentment of Albertans who feel ignored by their government.
"I think they're ripe for manipulation," he said.
"Politicians pay lip service to them and then get elected and then forget about them."
Alberta's current government, he added, shouldn't underestimate the vote of those left struggling and frustrated in the province.
"There are people with legitimate grievances and if we treat them as if they're an afterthought or irrelevant, the only weapon they have to employ is their sullenness and their anger." | {
"pile_set_name": "OpenWebText2"
} |
Tuesday, March 30, 2010
Building Memcached on Windows
I like to be able to compile my software on multiple platforms with
different compilers, because it force me to write that complies to
standards (if not you'll most likely have a spaghetti of #ifdefs all
over your code). One of the bonuses you get from using multiple
compilers is that you'll get "more eyes" looking at your code, and
they may warn you on different things. Supporting multiple platforms
will also make it easier to ensure that you don't have 'hidden bombs'
in your code (byte order, alignment, assumptions that you can
dereference a NIL pointer etc)...
Building software that runs on different flavors of Unix/Linux isn't
that hard, but adding support for Microsoft Windows offers some
challenges. Among the challenges are:
Microsoft Windows doesn't provide the headerfiles found on most Unix-like systems (unistd.h etc).
Sockets is implemented in a separate "subsystem" on windows.
Win32 provides another threads/mutex implementation than what most software written for Unix-like systems use (pthreads).
Microsoft doesn't supply a C99 compiler. One would think that it would be safe to assume that one could use a C standard that is more than 10 years old....
I am really glad to announce that we just pushed a number of
changesets to memcached to allow you to build memcached on windows
"just as easy" as you would on your favorite Unix/Linux system. This
means that as of today users using Microsoft Windows is no longer
stuck with an ancient version!
`The first thing you need to do in order to build memcached on Windows
is to install the "fullversion"
of msysgit. In
addition to installing git, it also installs a compiler capable of
building a 32 bit version of memcached.
So let's go ahead and build the dependencies we need to get our 32bit
memcached version up and running!
The first thing up
is libevent. You
should download the latest 2.x release available (there is a bug in
all versions up to (and including) 2.0.4, so unless there is a new one
out there you can grab a development version I pushed
to libevent-2.0.4-alpha-dev.tar.gz),
and install it with the following commands (from within your
msysgit-shell). Please note that I'm using /tmp because I've had
problems using my "home directory" because of spaces in the directory
name (or at least I guess that's the reason ;-) ):
$ cd /tmp
$ tar xfz libevent-2.0.4-alpha-dev.tar.gz
$ cd libevent-2.0.4-alpha-dev
$ ./configure --prefix=/usr/local
$ make all (this will fail with an error, but don't care about that.. it's is in the example code)
$ make install (this will fail with an error, but don't care about that.. it's just an example)
It's time to start build memcached!!! Let's check out the source
code and build it!
Go ahead and telnet to port 11211 and issue the "stats" command to
verify that it works!
You don't need to install msysgit on the systems where you want to
run memcached, but you do need to include pthreadGC2.dll from the
msysgit distribution. That means that if you want to run memcached
on another machine you need to copy the following files:
memcached.exe .libs/default_engine.so and /mingw/bin/pthreadGC2.dll
(Just place them in the same directory on the machine you want to
run memcached on :-)
But wait, the world is 64 bit by now. Lets build a 64 bit binary instead
So how does it perform?
I'm pretty sure a lot of the "Linux fanboys" are ready to jump in and
tell how much faster the Linux version is. I have to admit that I was
a bit skeptical in the beginning if the layers we added to get "Unix
compatibility" had any performance impact. The only way to know for
sure is to run a benchmark to measure the performance.
I ran a small benchmark where I had my client create 512 connections
to the server, and then randomly choosing a connection and perform a
get or a set operation on one of the 100 000 items I had stored in
the server. I ran 500 000 operation (33% of the operations are set
operations), and calculated the average time. I can dual-boot one of
my machines into Windows 7 and Red Hat Enterprise Linux, so my
results shows the "out of the box"-numbers between Windows 7 and Red
Hat Enterprise Linux running on the same hardware. I used my
OpenSolaris box to drive the test (connected to the same
switch). Posting numbers is always "dangerous", because people put
too much into the absolute numbers. The intention with my graphs is
to show that the version running on Microsoft Windows is pretty much
"on par" with the Linux version.
Buuuuut..... the version from trondn/memcached.git is 1.3.3 and the last official version is 1.4.5 (http://www.memcached.org)....Using totalcommander I notice several differences between versions.And if I try to use the official repository instead of trondn's repository, the code wont compile.Also, the result exe wont work as a windows service or as a deamon either. This port does the trick but uses version 1.2.1 (Dec 23, 2006)...
Never the less, the version 1.3.3 seems to work ok. Here is the compiled result from my Intel x86:http://fox.originsoftware.com.ar/memcached-1.3.3.zip
IANAL, but AFAIK the BSD license allows you to mix in other licenses, and the LGPL library allows you to link with other licenses.. You do however need to comply to the terms of both the licenses, so if you make modifications to the lgpl bits you need to make the source available to the people you give the binary... People should just stay away from *GPL and the world would be a better place...
when I use this command: make -f win32/Makefile.mingw ,something wrong. make win32/Makefile.mingw: No such file or directory make *** No rules to make target win32/Makefile.mingw . stop.I install msysgit in C:\msysgit\msysgit. The Tmp path is F:\tmp.
please help to deal with it, tks.by the way , I am a chinese ,so my English is not well.
Hello.Sorry my bad English.Trond Norbye, I try to build memcached from MB-6508 branch on msysgit 1.7.11 and I got errorhttp://pastebin.com/fCuzE80vWhat is the dependency tcmalloc_minimal.dll and where I can get this dll?
I am trying to build memcached now and get some problems linking to libevent.
I get your git version of Memcached and use the win32/Makefile.mingw replacing some of the -lxxx with -Lpathtolibrary as teh whole path on my env is quite a mess.
I downloaded the latest libevent code too and build it using nmake, which produced a bunch of .lib files. I copied the libevent.lib file and use it for the linking with -L on the memcached.exe recipe and copied the header files to the mingw include folder so they are found.
Sadly when I try to build I get a lot of "undefined reference to event_*".
I think the problem is that I am linking wrongly but I am not sure as I am not familiar with gcc and c any more, Im a .Net guy this days.
If you can bring some light you will be more than appreciated. I found the following thread (https://groups.google.com/forum/#!topic/memcached/P4qMK4upyMk) where you answer some questions but the original problem wasn't hte same as mine.
Sure, when I'm done.. I'm currently working on making the compilation process of Couchbase better on windows. (please note that you may run Couchbase on Windows, and it does support memcached buckets...) | {
"pile_set_name": "Pile-CC"
} |
import { IScheduler } from '../Scheduler';
import { Observable } from '../Observable';
import { Subscriber } from '../Subscriber';
import { TeardownLogic } from '../Subscription';
/**
* We need this JSDoc comment for affecting ESDoc.
* @extends {Ignored}
* @hide true
*/
export declare class ScalarObservable<T> extends Observable<T> {
value: T;
private scheduler;
static create<T>(value: T, scheduler?: IScheduler): ScalarObservable<T>;
static dispatch(state: any): void;
_isScalar: boolean;
constructor(value: T, scheduler?: IScheduler);
protected _subscribe(subscriber: Subscriber<T>): TeardownLogic;
}
| {
"pile_set_name": "Github"
} |
package ezy.sdk3rd.social.sdk;
/**
* Created by ezy on 17/3/18.
*/
public interface OnSucceed<T> {
void onSucceed(T result);
}
| {
"pile_set_name": "Github"
} |
by Robert Herron
Sprint 4G Rollout Updates
Thursday, July 10, 2014 - 1:30 PM MDT
A few months back, Sprint announced new group partnerships with members of the CCA (Competitive Carriers Association) to expand the availability of Sprint LTE availability in many places across the country outside Sprint service areas. Additionally, Sprint has recently formed a subgroup of current/future LTE providers of the CCA that is referred to as the Rural Roaming Preferred Program (RRPP). Announcing such a deal with nTelos in May, and nearly another dozen in June.
Sprint is part of the over-arching CCA, and working with its large membership group to establish a national LTE roaming group. However, where the action is happening now is with the Rural Roaming Preferred Program. RRPP members are joining a specific Sprint alliance which gives them more direct access to Sprint, their vendors, technology, devices and most importantly…Sprint’s vast spectrum holdings.
As it has been explained to us, CCA members who are not a part of Sprint’s RRRP program are using their own spectrum and resources. Current disclosed members of the RRRP are regional and rural providers nTelos, C-Spire Wireless, SouthernLINC Wireless, Nex-Tech Wireless, Carolina West Wireless, VTel Wireless, Flat Wireless, MobileNation/SI Wireless, Inland Cellular, Illinois Valley Cellular, James Valley Telecommunications and Phoenix Wireless. There are more currently in discussion. Some speculate US Cellular will be announced soon, but we have not been able to confirm that.
The news of the CCA and RRPP partnerships was well received by Sprint customers and members of the S4GRU community. Our members have been stoked at this announcement for months. Craving more details. When is this going to happen? Where, exactly? And the most important question to our readers has been, ‘how will the service be treated…native or roaming?’
In press conferences, news releases and media coverage, it is often being referred to as “LTE roaming” deals. When people see the term roaming, they immediately conjure up ideas of monthly limits or added expenses. For instance, most Sprint postpaid plans currently limit their 1xRTT and 3G EVDO data roaming to only 100MB or 300MB per month. That’s not very much. So many of our members at S4GRU have wondered whether these “LTE roaming” deals would count against current very limited roaming allotments, or if something more generous would be provided on partner LTE networks. This has been the source of some anxiety to our members who want to be excited about this, but want to understand the full impact to their usage behaviors.
Drum roll, please…
We recently have received verification from a Sprint executive, who will remain anonymous, that the coverage with the RRPP providers will be treated as native. Fully native. When you are on these rural partner networks, it will be like you are on your Sprint LTE coverage and all your normal account usages will be allowed.
If you have a 1GB data plan with Sprint. Your usage on these other networks counts against your 1GB monthly allotment. And if you have an unlimited plan on Sprint, you can use unlimited smartphone data on these rural partner networks.
The executive said the point of these new coverages is to provide a seamless customer experience travelling from Sprint LTE coverage into these new rural partner coverage areas. To feel like they are on the Sprint network. And maybe even better in many instances given the lightly used rural nature of this additional coverage. They want Sprint customers, and in turn rural partner customers on the Sprint network, to enjoy a cohesive and expanded national LTE footprint. Something that makes them more competitive with the duopoly.
Some of these rural partners already have their own operating LTE networks on varied spectrum holdings. And others are counting on Sprint spectrum to host their LTE networks or supplement them. We are told that existing LTE networks from these RRPP members on frequencies that current Sprint LTE devices support should be open as soon as logistically possible. Maybe even this summer. They continue to work out some network bugs and billing/authentication issues. Additional LTE frequencies in Band 4 and Band 12 are anticipated to be added to new upcoming devices at the end of this year or early next year and will add even more mileage.
This is great news for Sprint customers. This will open up a lot more LTE coverage. Upon full implementation, the coverage will be quite expansive in square miles. When other CCA partner providers coverage comes online, Sprint should be able to handily eclipse AT&T’s LTE network coverage. Which has recently been purported to be mothballed by AT&T, with no timelines in place to restart. We currently do not know the details of VoLTE (Voice over LTE) on these partner networks. But a VTel Wireless executive did mention recently in a Fierce Wireless article that they were deploying VoLTE themselves. Sprint has been very mum on their VoLTE plans internally or through partners.
We currently do not know if the LTE coverage that is provided by CCA members outside the RRPP will be counted as native the same way. Though T-Mobile is a member of the CCA, they are not a member of Sprint’s RRPP. So Sprint and its customers may see some unique advantages in both off network usage being counted as native and the availability of many more spectrum bands and more coverage than other standard CCA members experience.
We excitedly watch and discuss the progress in S4GRU forums. Stay tuned. | {
"pile_set_name": "OpenWebText2"
} |
A power supply to control the flow of energy between a first alternating current (AC) system and a second AC system is required in a variety of commercial and industrial applications, such as the control of AC motor operation. Some such power supplies convert the energy from a first frequency and voltage to a second frequency and voltage. One way to implement such a system is with a drive containing one or more power cells that include two solid state converters with an intermediate direct current (DC) link. A power cell is an electrical device that has a three-phase alternating current input and a single-phase alternating current output. One such system is described in U.S. Pat. No. 5,625,545 to Hammond, the disclosure of which is incorporated herein by reference in its entirety.
Power cells may be either non-regenerative or regenerative. Non-regenerative power cells can drive a motor but cannot control the flow of current to brake a motor by absorbing regenerative power. Regenerative power cells have the capability of absorbing regenerative power and optionally returning it to the source, thus, allowing the cell to participating in braking the motor. Recently, power cells have been developed that use switching devices, such as insulated gate bipolar transistors (IGBTs) to allow the cell to assist in both driving and braking a motor. For example, referring to FIG. 1 herein, a power cell 160 includes an active front end 162 that serves as a three-phase bridge as it receives power from dedicated three-phase secondary windings of the transformer via an input 142. The cell 160 also includes a plurality of input switches 170-175, which may be bidirectional current-controlling devices such as IGBTs or other transistors, thyristors, or other switching devices. Although six transistors in a bridge format—in this example, three pairs of two transistors each connected in parallel across the DC terminals—are illustrated in FIG. 1, other numbers and types of input switches may be used. The input switches control the DC bus voltage in the cell. A DC filter section 166 includes one or more capacitors 168. The remainder of the cell may include an output stage 164 such as an H-bridge inverter made up of four output switches 131-134, each connected across the output or DC terminals of the active front end 162 and the DC filter 166, to deliver AC power to the output 144.
A circuit including power cells such as 160 in FIG. 1, when connected to a load such as a motor, can provide power from an input source to the motor when operating in the motoring mode. When input converter sections 162 such as those shown in FIG. 1 are used, drive switching events can product harmonic currents. Harmonic currents may also be produced when a single-phase inverter section is connected to a motor. The harmonics can be compounded when multiple cells have switches that operate at the same time.
U.S. Pat. No. 5,625,545 discloses that a multi-winding transformer may be used to reduce harmonic currents created by a unidirectional, or non-regenerative, power cell. However, this method may not always reduce harmonics in regenerative power cells to a desired level. Other methods, such as using a master clock to generate synchronized carriers and applying the carriers to multiple converters connected to a transformer having non-phase shifted secondary windings, have not been entirely effective, and many increase drive complexity and cost.
The disclosure contained herein describes attempts to reduce harmonics created by operating a power cell having bidirectional switching devices. | {
"pile_set_name": "USPTO Backgrounds"
} |
Q:
Mixing audio with HDMI video to replace the sound from the camera
I would like to live-stream from a camera, but replace the audio from the camera with a higher-quality mixed soundtrack, ready for sending over HDMI to a transmission device.
How can I do this?
I know that the Tascam DR-701D has two HDMI ports (in and out). Could I use this as the mixer to replace the soundtrack on the HDMI video feed, ready for transmission, or is there a better way?
Details
The video will come from the micro-HDMI port on the camera.
The audio will come from one of three sources:
XLR stream from the event
Directional XLR mic
MP3 player
The audio will be mixed together by a mixer during the event as appropriate.
I now need to mix the audio from the sound mixer with the video from the camera’s HMDI port (which will have an unusable poor-quality audio track from the camera). How can I do this?
A:
It seems that what you are looking for is an HDMI audio embedder.
It seems that the Tascam DR-701D offers this functionality as described in Outputting this unit's audio as the HDMI output audio
Examples of external alternative such products can be found here (I am not affiliated with these manufacturers, other products might exist):
Kramer FC-69
Extron HAI 100 4K
| {
"pile_set_name": "StackExchange"
} |
Sensory organs of gastropods
The sensory organs of gastropods (snails and slugs) include olfactory organs, eyes, statocysts and mechanoreceptors. Gastropods have no sense of hearing.
Olfactory organs
In terrestrial gastropods the most important sensory organs are the olfactory organs which are located on the tips of the 4 tentacles. Some terrestrial gastropods can track the odor of food using their tentacles (tropotaxis) and the wind (anemotaxis).
In opisthobranch marine gastropods, the chemosensory organs are two protruding structures on top of the head. These are known as rhinophores. An opisthobranch sea slug Navanax inermis has chemoreceptors on the sides of its mouth to track mucopolysaccharides in the slime trails of prey, and of potential mates.
The freshwater snail Bithynia tentaculata is capable of detecting the presence of molluscivorous (mollusk-eating) leeches through chemoreception, and of closing its operculum to avoid predation.
The deepwater snail Bathynerita naticoidea can detect mussel beds containing the mussel Bathymodiolus childressi, because it is attracted to water that has cues in it from this species of mussel.
Eyes
In terrestrial pulmonate gastropods, eye spots are present at the tips of the tentacles in the Stylommatophora or at the base of the tentacles in the Basommatophora. These eye spots range from simple ocelli that cannot project an image (simply distinguishing light and dark), to more complex pit and even lens eyes. Vision is not the most important requirement in terrestrial gastropods, because they are mainly nocturnal animals.
Some gastropods, for example the freshwater Apple snails (family Ampullariidae) and marine species of genus Strombus can completely regenerate their eyes. The gastropods in both of these families have lens eyes.
Morphological sequence of different types of multicellular eyes exemplified by gastropod eyes:
Lens eyes
{|
||[[File:Bolinus brandaris eye.png|left|thumb|Lens eye of Bolinus brandaris.]]
||
||
|}
another drawing of eye of Helix pomatia
Statocysts
In the statocysts of Haliotis asinina'' was found the expression of a conserved gene (Pax-258 gene), which is also important for forming structures for balance in eumetazoans.
Mechanoreceptors
The mechanoreceptors are very crucial to the snail's sensory.
See also
Hancock's organ
Sensory ecology
Sensory systems in fish
References
This article incorporates CC-BY-2.0 text from the reference
Further reading
Sergei Tschachotin. 1908. Die Statocyste der Heteropoden. Heidelberg, Univ., Diss., (Zeitschrift f. wissenschaftl. Zoologie; Bd. 90; S. 343-422).
External links
Category:Gastropod anatomy
Category:Sensory organs in animals | {
"pile_set_name": "Wikipedia (en)"
} |
Predictors of lower extremity arterial injury after total knee or total hip arthroplasty.
Lower extremity arterial injury is a rare complication following total knee (TKA) or total hip arthroplasty (THA). To date, no multi-institutional study has identified preoperative factors that may portend increased risk for these injuries. We queried a large clinical database for the incidence and predictors of arterial injury and/or compromise following lower extremity arthroplasty. Prospectively collected preoperative and postoperative data by the National Surgical Quality Improvement Program (NSQIP) of the Veterans Affairs Medical Centers were analyzed. All patients from 1996 to 2003 in the NSQIP database who underwent TKA or THA were identified via CPT codes. NSQIP defined, 30-day, postoperative outcomes were analyzed. Data were compared using bivariable analysis, as well as limited multivariable logistic regression. A total of 41,633 arthroplasties (24,029 TKA, 2077 redo-TKA, 13,494 THA, 2033 redo-THA) were identified in the NSQIP database. A total of 34 (0.08%) lower extremity arterial injuries were recognized (0.08% TKA, 0.19% redo-TKA, 0.04% THA, 0.20% redo-THA). Eighteen injuries were repaired on the same day of surgery (seven intraop, 11 postop), eight between postoperative days 1 and 5, and 8 between days 6 and 30. Only two patients underwent lower extremity amputation (overall limb loss rate of 5.9% of patients who had arterial injury). Statistically significant predictors of lower extremity arterial injury identified on logistic regression analysis included redo procedure (odds ratio [OR] 2.7, 95% confidence interval [CI] 1.2-6.0, P = .013) and African American race (OR 2.5, 95% CI 1.2-5.3, P = .02). Lower extremity arterial injury was exceedingly rare after total knee or total hip arthroplasty. There is an increased incidence in African American patients and those undergoing redo arthroplasty. Among patients who sustain vascular injury, excellent limb salvage rates can be achieved with close postoperative surveillance to achieve early detection and repair of injuries. | {
"pile_set_name": "PubMed Abstracts"
} |
498 So.2d 854 (1986)
David COPELAND
v.
PERSONNEL BOARD OF JEFFERSON COUNTY, Oscar Stillwagon, and Belinda Rushon.
Civ. 5429.
Court of Civil Appeals of Alabama.
November 5, 1986.
*855 David Copeland, pro se.
Charles H. Wyatt, Jr., Birmingham, for appellees Stillwagon and Rushon.
Judson Eugene Tomlin, Jr., and Charles A. McCallum III of Haskell, Slaughter & Young, Birmingham, for appellee Personnel Bd. of Jefferson County.
BRADLEY, Judge.
This is an appeal of a Jefferson County Personnel Board decision.
The plaintiff in the present case was prosecuted in the Birmingham Municipal Court on criminal charges involving assault, battery, and harassment. The plaintiff subpoenaed over seventy witnesses to testify in his defense to the criminal charges brought against him in the municipal court. One of the persons subpoenaed was Mr. Oscar Stillwagon, the chief clerk for the Birmingham Municipal Court.
After the criminal proceeding, at which the plaintiff was convicted of the charges against him and ordered to pay a fine, the plaintiff filed a complaint with the Jefferson County Personnel Board wherein he sought the dismissal of Mr. Stillwagon and another municipal court employee, Ms. Belinda Rushon, who was the subpoena clerk.
A hearing was held by the Jefferson County Personnel Board wherein the Board examined the conduct of both employees. At the hearing the plaintiff alleged that Mr. Stillwagon was guilty of misconduct for failing to appear at the previous criminal proceeding after being subpoenaed. The plaintiff alleged that Ms. Rushon was guilty of misconduct for failing to properly issue all of the subpoenas he requested be issued.
During the Personnel Board hearing the plaintiff voluntarily dropped the complaint he previously lodged against Ms. Rushon. The remainder of the proceeding, therefore, was devoted to the allegations surrounding Mr. Stillwagon's conduct. After the hearing the Personnel Board concluded that Mr. Stillwagon was not guilty of misconduct, and, therefore, dismissed the charges against him.
The plaintiff subsequently sought review of the Personnel Board decision by the Circuit Court of Jefferson County, and a three-judge panel was appointed to review the Personnel Board decision. The three-judge panel affirmed the decision of the Jefferson County Personnel Board. The plaintiff seeks review in this court.
The method of review of a three-judge circuit court panel decision upholding a Jefferson County Personnel Board order is by common-law writ of certiorari. See Ex parte Smith, 394 So.2d 45 (Ala.Civ.App. 1981). Review of the writ of certiorari in this court is limited to a consideration of the proper application of the law by the circuit court and whether that court's decision is supported by the legal evidence. Ex parte Smith, supra.
The record in the present case indicates that the plaintiff filed a complaint with the Personnel Board, alleging that Mr. Stillwagon failed to answer a subpoena. The record also indicates the plaintiff filed a complaint against Ms. Rushon, alleging she was guilty of misconduct for failing to issue several subpoenas. The plaintiff voluntarily *856 dismissed his complaint against Ms. Rushon at trial.
The testimony before the Personnel Board indicates that Mr. Stillwagon was served with a subpoena to appear at the plaintiff's trial in municipal court; however, because of job-related obligations, Mr. Stillwagon had to be in Ensley, Alabama on the day of the plaintiff's criminal trial. In an effort to comply with the subpoena, Mr. Stillwagon informed Municipal Court Judge Emory Anthony of the circumstances necessitating his absence from court. Judge Anthony nonetheless placed Mr. Stillwagon on call in the event that his testimony was necessary for the disposition of the criminal case.
The plaintiff attempted to call Mr. Stillwagon as a witness in the marathon municipal case which lasted almost a day and in which the plaintiff subpoenaed over seventy witnesses. The plaintiff purportedly wanted to use Mr. Stillwagon's testimony to impeach the testimony of one of his own prior witnesses. The record indicates, however, that Judge Anthony denied the plaintiff's request that Stillwagon be allowed to testify because Stillwagon lacked personal knowledge about the matter at hand. As the evidence shows, Mr. Stillwagon was on call but did not testify because the trial judge ruled that his testimony would be irrelevant.
After a careful review of the record, we are satisfied there is an absence of evidence that would support a finding that either Ms. Rushon or Mr. Stillwagon was guilty of misconduct during plaintiff's criminal trial. Mr. Stillwagon did answer the subpoena, and the complaint against Ms. Rushon was dropped at the Personnel Board hearing. For these reasons, we hold that the circuit court's decision is supported by the evidence. See, City of Mobile v. Seals, 471 So.2d 431 (Ala.Civ.App. 1985). Therefore, its judgment is affirmed.
AFFIRMED.
WRIGHT, P.J., and HOLMES, J., concur.
| {
"pile_set_name": "FreeLaw"
} |
There is little room for perspective in the immediate aftermath of a 9-3 victory over the Dodgers in the home opener at Petco Park.
The Padres on Tuesday were patient, they were aggressive. They were resilient. They were clutch.
“Everything we didn’t do on the road trip, we did today” Venable said. “… Not having a game like that and then to have one just gives you confidence that everything you believed is true.”
Hmmmmm. Don’t know about that quite yet.
We’ll keep the champagne on ice for when a Padres starting pitcher gets out of the sixth inning.
But now we know it’s possible.
Maybe, just maybe, Yonder Alonso’s admonishment before the game was spot on.
“Just 1-5, man,” a super chill Alonso said as he lounged in the chair in front of his locker. “You guys are definitely going crazy on it. It’s 162 games. It’s a long season. We can get on a roll. Then the wins can come in bunches.”
Related
Every one of the 30 teams in Major League Baseball had at least one stretch in 2012 in which they lost five of six games.
"Half of us are hitting .150,” Venable, sounding a bit irritated, said before going out and tying a career high with four RBI. “If someone thinks that is an example of how the season is going to go, they probably haven’t watched a whole lot of baseball.”
Yes, we can be absolutely certain that even Everth Cabrera is going to top .200 by September.
It’s just when a team loses five of its first six, the stretch is magnified.
Especially when it’s the Padres, who make a habit of being the turtle that falls too far behind.
It’s going to take quite the next 19 games to avoid their third straight losing April and seventh April in the past eight years without a winning record. They haven’t been to the postseason in the past six years.
Even Alonso, the cool cucumber, acknowledged that might not be a coincidence in a roundabout way.
“You can’t win a division in the first month,” Alonso said. “But you can definitely stay afloat.”
Or you can be sunk.
The Padres talked extensively in March about making sure they started quickly. Their desire was to be playing meaningful games in August but also, certainly, to not be irrelevant by the end of May as they were with a 17-35 record to that point in 2012.
A team that had one home run in six road games to start the season -- none in three games in Colorado -- took a 1-0 lead in the first inning on Venable’s liner and a 3-2 lead on Hundley’s high fly in the third.
Their other five runs were the result of actual hits with runners in scoring position.
A team that was 9-for-54 (.167) with runners in scoring position the first six games was five-for-11 on Tuesday against their loaded rivals.
“It’s great to be home,” Hundley said after the Padres raised their team batting average to .224 from the .204 it was after their 1-5 trek to New York and back via Colorado. “To break through is great.”
Now, being no hypocrite, Hundley did offer some perspective to ruin the Opening Day high.
“You take it that it’s April 9,” he said. “You don’t put too much stock in it.” | {
"pile_set_name": "Pile-CC"
} |
Analysis: China toughens trade stance with tariffs
By IBT Staff Reporter12/15/11 AT 8:40 AM
China has fired a warning shot with its decision to impose tariffs on imports of sport-utility vehicles (SUV) and other large cars from the United States as both countries gear up for increased trade friction next year.
The tariffs, announced on Wednesday and ranging from 2 percent to 22 percent, are unlikely to inflict much pain on American carmakers, who generally only import a small fraction of what they sell in China.
But by hitting a powerful industry that has benefited from a U.S. government bailout, China can signal a tough stance in the face of rising pressure over its trade practices while at the same time pressuring American companies into lobbying on its behalf.
It's a threat to companies, to say that you'd better lobby your government not to impose more tariffs because that could lead to a trade war and that's going to hurt you here, said Usha Haley, professor of international business at Massey University in New Zealand, who studies the Chinese auto sector.
It's an extremely effective way of working.
China's move comes as the United States -- increasingly frustrated with a mammoth trade deficit and what it calls unfair treatment of U.S. companies in China -- changes its own tactics.
Instead of focusing on dumping of cheap Chinese-made goods, it is building a case that China's support for state-owned firms -- from discounted land and electricity prices to loans that can be perpetually rolled -- violates World Trade Organization (WTO) rules.
Arguing that China isn't playing fair will appeal to U.S. politicians in an election year when jobs are a sore point.
A WTO appeals panel overturned the first American attempt to apply anti-subsidy measures against Chinese steel, sacks and tires, but left the door open for a more nuanced case that China subsidizes its state-owned sector.
The U.S. is getting ready to be a lot tougher on China on trade. They are doing a top-to-bottom review in Washington, said James McGregor, senior consultant for APCO Worldwide in Beijing.
It's going to get at the whole state-owned sector and at subsidies that are hard to quantify.
At a news conference on Thursday, a Ministry of Commerce spokesman declined to explain why China had chosen to target car imports.
HIGHER GEAR
China's complaints about American car imports aren't new.
It launched its investigation shortly before U.S. President Barack Obama visited in November 2009, in apparent retaliation for U.S. duties on Chinese-made steel pipes used in the oil and gas industry.
At the time, the Ministry of Commerce said it was investigating incentives and tax breaks granted by the U.S. federal government and the state of Michigan, home to the U.S. auto industry.
Wednesday's announcement came amid Chinese anger over a U.S. investigation into whether China unfairly subsidizes its solar panel makers. But China's previous experience with trade disputes have taught its officials the lesson that American firms can be allies in opening American markets.
In recent years, the U.S. poultry industry lobbied actively against a Congressional ban on negotiating with China to import Chinese cooked chicken -- imposed after Chinese food safety scandals -- because they feared losing the lucrative Chinese market for chicken feet.
China's choice of targets is limited by its reluctance to alienate Chinese consumers with higher prices for imported foodstuffs or raw materials.
The value of soy and oilseeds imports from America so far this year is triple that of cars, at about $12 billion. Making imported cotton, chemicals or grains more expensive would also only contribute to inflation in China.
Liu Hongyan, shopping at a Beijing Cadillac dealership on a clear and windy Thursday, shrugged off the possibility that customers like him might have to pay more for cars.
I think it doesn't really affect people of our class and status who buy these types of cars, because the tariff rate only takes up a small percentage of the cost, he told Reuters.
If you like the car it doesn't matter.
The automakers themselves are more vulnerable, although their problem isn't the direct impact on imports, which only make up 9 percent of auto sales in China.
Chrysler is a bit vulnerable as it's been counting mostly on imported models to drive its China sales, but the impact on GM and others is very limited as imports accounts a small portion of the tally, said Sheng Ye, associate research director for the Greater China region at industry consultancy Ipsos.
Instead, their Achilles heel is their business in China -- the world's biggest market for cars, and one of the only growth areas of scale.
With regulators already delaying permission to expand production unless automakers agree to transfer branding rights and technology, none of the big automakers will relish being left out in the cold.
(Additional reporting by Fang Yan and Steve Wang; Editing by Don Durfee and Robert Birsel) | {
"pile_set_name": "Pile-CC"
} |
1996 TCU Horned Frogs football team
The 1996 TCU Horned Frogs football team represented Texas Christian University (TCU) in the 1996 NCAA Division I-A football season. The Horned Frogs finished the season 4–7 overall and 3–5 in the Western Athletic Conference. The team was coached by Pat Sullivan, in his fifth year as head coach. The Frogs played their home games in Amon G. Carter Stadium, which is located on campus in Fort Worth, Texas.
Schedule
References
TCU
Category:TCU Horned Frogs football seasons
TCU Horned Frogs football | {
"pile_set_name": "Wikipedia (en)"
} |
Pool League Management
Everything you need to run your billiard league easily and affordably. With more than 15 years experience with online pool league management, we know what it takes - and provide essential tools for smooth league operation: | {
"pile_set_name": "Pile-CC"
} |
SLC22A12
Solute carrier family 22 (organic anion/cation transporter), member 12, also known as SLC22A12 and URAT1, is a protein which in humans is encoded by the SLC22A12 gene.
Function
The protein encoded by this gene is a urate transporter and urate-anion exchanger which regulates the level of urate in the blood. This protein is an integral membrane protein primarily found in kidney. Two transcript variants encoding different isoforms have been found for this gene.
Clinical significance
Numerous single nucleotide polymorphisms of this gene are significantly associated with altered (increased or decreased) reabsorption of uric acid by the kidneys. Respectively, these altered rates of reabsorption contribute to hyperuricemia and hypouricemia.
Interactions
SLC22A12 has been shown to interact with PDZK1.
Inhibition
Lesinurad is a urate transporter inhibitor that has been approved to treat gout. Lesinurad enhances urate excretion by inhibition the tubular re-absorption. Probenecid also facilitates uric acid secretion.
See also
Solute carrier family
References
Further reading
Category:Solute carrier family
Category:Uric acid | {
"pile_set_name": "Wikipedia (en)"
} |
Q:
Confluence wiki format put new paragraph
I'd like to put empty linespace (<p></p> in HTML) in Confluence wiki result, but failed whatever I tried.
Based on the the document, it said two carriage-return will put <p></p> but \r\r, \n\n, \n\n\n\n, etc.trials are not working at all.
POST http://wiki.mysite.com/rest/api/content
{"type":"page","title":"new page1","ancestors":[{"id":390668024}], "space":{"key":"EXAMPLE"},"body":{"storage":{"value":"[Some link|http://example.com/url] - Show page.\n\nbq. Query by [Some link info|http://example.com/reference?id=214]","representation":"wiki"}}}
With above REST request, I'd like to show as below format;
Some link - Show page.
<blank line>
Query by Some link info
Some trials (between words Show page. and bq. Query by)
\n\n => Show page.</p>\n\n<blockquote><p>Query by
\\\\ => Show page. <br class=\"atl-forced-newline\" /> bq. Query by
A:
Below trial gives expected result
Show page.\n\n \\\\ \nbq. Query by
=> Show page.</p>\n\n<p> <br class=\"atl-forced-newline\" /> </p>\n<blockquote><p>Query by
| {
"pile_set_name": "StackExchange"
} |
package jsoniter
import (
"encoding/json"
"io"
"reflect"
"sync"
"unsafe"
"github.com/modern-go/concurrent"
"github.com/modern-go/reflect2"
)
// Config customize how the API should behave.
// The API is created from Config by Froze.
type Config struct {
IndentionStep int
MarshalFloatWith6Digits bool
EscapeHTML bool
SortMapKeys bool
UseNumber bool
DisallowUnknownFields bool
TagKey string
OnlyTaggedField bool
ValidateJsonRawMessage bool
ObjectFieldMustBeSimpleString bool
CaseSensitive bool
}
// API the public interface of this package.
// Primary Marshal and Unmarshal.
type API interface {
IteratorPool
StreamPool
MarshalToString(v interface{}) (string, error)
Marshal(v interface{}) ([]byte, error)
MarshalIndent(v interface{}, prefix, indent string) ([]byte, error)
UnmarshalFromString(str string, v interface{}) error
Unmarshal(data []byte, v interface{}) error
Get(data []byte, path ...interface{}) Any
NewEncoder(writer io.Writer) *Encoder
NewDecoder(reader io.Reader) *Decoder
Valid(data []byte) bool
RegisterExtension(extension Extension)
DecoderOf(typ reflect2.Type) ValDecoder
EncoderOf(typ reflect2.Type) ValEncoder
}
// ConfigDefault the default API
var ConfigDefault = Config{
EscapeHTML: true,
}.Froze()
// ConfigCompatibleWithStandardLibrary tries to be 100% compatible with standard library behavior
var ConfigCompatibleWithStandardLibrary = Config{
EscapeHTML: true,
SortMapKeys: true,
ValidateJsonRawMessage: true,
}.Froze()
// ConfigFastest marshals float with only 6 digits precision
var ConfigFastest = Config{
EscapeHTML: false,
MarshalFloatWith6Digits: true, // will lose precession
ObjectFieldMustBeSimpleString: true, // do not unescape object field
}.Froze()
type frozenConfig struct {
configBeforeFrozen Config
sortMapKeys bool
indentionStep int
objectFieldMustBeSimpleString bool
onlyTaggedField bool
disallowUnknownFields bool
decoderCache *concurrent.Map
encoderCache *concurrent.Map
encoderExtension Extension
decoderExtension Extension
extraExtensions []Extension
streamPool *sync.Pool
iteratorPool *sync.Pool
caseSensitive bool
}
func (cfg *frozenConfig) initCache() {
cfg.decoderCache = concurrent.NewMap()
cfg.encoderCache = concurrent.NewMap()
}
func (cfg *frozenConfig) addDecoderToCache(cacheKey uintptr, decoder ValDecoder) {
cfg.decoderCache.Store(cacheKey, decoder)
}
func (cfg *frozenConfig) addEncoderToCache(cacheKey uintptr, encoder ValEncoder) {
cfg.encoderCache.Store(cacheKey, encoder)
}
func (cfg *frozenConfig) getDecoderFromCache(cacheKey uintptr) ValDecoder {
decoder, found := cfg.decoderCache.Load(cacheKey)
if found {
return decoder.(ValDecoder)
}
return nil
}
func (cfg *frozenConfig) getEncoderFromCache(cacheKey uintptr) ValEncoder {
encoder, found := cfg.encoderCache.Load(cacheKey)
if found {
return encoder.(ValEncoder)
}
return nil
}
var cfgCache = concurrent.NewMap()
func getFrozenConfigFromCache(cfg Config) *frozenConfig {
obj, found := cfgCache.Load(cfg)
if found {
return obj.(*frozenConfig)
}
return nil
}
func addFrozenConfigToCache(cfg Config, frozenConfig *frozenConfig) {
cfgCache.Store(cfg, frozenConfig)
}
// Froze forge API from config
func (cfg Config) Froze() API {
api := &frozenConfig{
sortMapKeys: cfg.SortMapKeys,
indentionStep: cfg.IndentionStep,
objectFieldMustBeSimpleString: cfg.ObjectFieldMustBeSimpleString,
onlyTaggedField: cfg.OnlyTaggedField,
disallowUnknownFields: cfg.DisallowUnknownFields,
caseSensitive: cfg.CaseSensitive,
}
api.streamPool = &sync.Pool{
New: func() interface{} {
return NewStream(api, nil, 512)
},
}
api.iteratorPool = &sync.Pool{
New: func() interface{} {
return NewIterator(api)
},
}
api.initCache()
encoderExtension := EncoderExtension{}
decoderExtension := DecoderExtension{}
if cfg.MarshalFloatWith6Digits {
api.marshalFloatWith6Digits(encoderExtension)
}
if cfg.EscapeHTML {
api.escapeHTML(encoderExtension)
}
if cfg.UseNumber {
api.useNumber(decoderExtension)
}
if cfg.ValidateJsonRawMessage {
api.validateJsonRawMessage(encoderExtension)
}
api.encoderExtension = encoderExtension
api.decoderExtension = decoderExtension
api.configBeforeFrozen = cfg
return api
}
func (cfg Config) frozeWithCacheReuse(extraExtensions []Extension) *frozenConfig {
api := getFrozenConfigFromCache(cfg)
if api != nil {
return api
}
api = cfg.Froze().(*frozenConfig)
for _, extension := range extraExtensions {
api.RegisterExtension(extension)
}
addFrozenConfigToCache(cfg, api)
return api
}
func (cfg *frozenConfig) validateJsonRawMessage(extension EncoderExtension) {
encoder := &funcEncoder{func(ptr unsafe.Pointer, stream *Stream) {
rawMessage := *(*json.RawMessage)(ptr)
iter := cfg.BorrowIterator([]byte(rawMessage))
defer cfg.ReturnIterator(iter)
iter.Read()
if iter.Error != nil && iter.Error != io.EOF {
stream.WriteRaw("null")
} else {
stream.WriteRaw(string(rawMessage))
}
}, func(ptr unsafe.Pointer) bool {
return len(*((*json.RawMessage)(ptr))) == 0
}}
extension[reflect2.TypeOfPtr((*json.RawMessage)(nil)).Elem()] = encoder
extension[reflect2.TypeOfPtr((*RawMessage)(nil)).Elem()] = encoder
}
func (cfg *frozenConfig) useNumber(extension DecoderExtension) {
extension[reflect2.TypeOfPtr((*interface{})(nil)).Elem()] = &funcDecoder{func(ptr unsafe.Pointer, iter *Iterator) {
exitingValue := *((*interface{})(ptr))
if exitingValue != nil && reflect.TypeOf(exitingValue).Kind() == reflect.Ptr {
iter.ReadVal(exitingValue)
return
}
if iter.WhatIsNext() == NumberValue {
*((*interface{})(ptr)) = json.Number(iter.readNumberAsString())
} else {
*((*interface{})(ptr)) = iter.Read()
}
}}
}
func (cfg *frozenConfig) getTagKey() string {
tagKey := cfg.configBeforeFrozen.TagKey
if tagKey == "" {
return "json"
}
return tagKey
}
func (cfg *frozenConfig) RegisterExtension(extension Extension) {
cfg.extraExtensions = append(cfg.extraExtensions, extension)
copied := cfg.configBeforeFrozen
cfg.configBeforeFrozen = copied
}
type lossyFloat32Encoder struct {
}
func (encoder *lossyFloat32Encoder) Encode(ptr unsafe.Pointer, stream *Stream) {
stream.WriteFloat32Lossy(*((*float32)(ptr)))
}
func (encoder *lossyFloat32Encoder) IsEmpty(ptr unsafe.Pointer) bool {
return *((*float32)(ptr)) == 0
}
type lossyFloat64Encoder struct {
}
func (encoder *lossyFloat64Encoder) Encode(ptr unsafe.Pointer, stream *Stream) {
stream.WriteFloat64Lossy(*((*float64)(ptr)))
}
func (encoder *lossyFloat64Encoder) IsEmpty(ptr unsafe.Pointer) bool {
return *((*float64)(ptr)) == 0
}
// EnableLossyFloatMarshalling keeps 10**(-6) precision
// for float variables for better performance.
func (cfg *frozenConfig) marshalFloatWith6Digits(extension EncoderExtension) {
// for better performance
extension[reflect2.TypeOfPtr((*float32)(nil)).Elem()] = &lossyFloat32Encoder{}
extension[reflect2.TypeOfPtr((*float64)(nil)).Elem()] = &lossyFloat64Encoder{}
}
type htmlEscapedStringEncoder struct {
}
func (encoder *htmlEscapedStringEncoder) Encode(ptr unsafe.Pointer, stream *Stream) {
str := *((*string)(ptr))
stream.WriteStringWithHTMLEscaped(str)
}
func (encoder *htmlEscapedStringEncoder) IsEmpty(ptr unsafe.Pointer) bool {
return *((*string)(ptr)) == ""
}
func (cfg *frozenConfig) escapeHTML(encoderExtension EncoderExtension) {
encoderExtension[reflect2.TypeOfPtr((*string)(nil)).Elem()] = &htmlEscapedStringEncoder{}
}
func (cfg *frozenConfig) cleanDecoders() {
typeDecoders = map[string]ValDecoder{}
fieldDecoders = map[string]ValDecoder{}
*cfg = *(cfg.configBeforeFrozen.Froze().(*frozenConfig))
}
func (cfg *frozenConfig) cleanEncoders() {
typeEncoders = map[string]ValEncoder{}
fieldEncoders = map[string]ValEncoder{}
*cfg = *(cfg.configBeforeFrozen.Froze().(*frozenConfig))
}
func (cfg *frozenConfig) MarshalToString(v interface{}) (string, error) {
stream := cfg.BorrowStream(nil)
defer cfg.ReturnStream(stream)
stream.WriteVal(v)
if stream.Error != nil {
return "", stream.Error
}
return string(stream.Buffer()), nil
}
func (cfg *frozenConfig) Marshal(v interface{}) ([]byte, error) {
stream := cfg.BorrowStream(nil)
defer cfg.ReturnStream(stream)
stream.WriteVal(v)
if stream.Error != nil {
return nil, stream.Error
}
result := stream.Buffer()
copied := make([]byte, len(result))
copy(copied, result)
return copied, nil
}
func (cfg *frozenConfig) MarshalIndent(v interface{}, prefix, indent string) ([]byte, error) {
if prefix != "" {
panic("prefix is not supported")
}
for _, r := range indent {
if r != ' ' {
panic("indent can only be space")
}
}
newCfg := cfg.configBeforeFrozen
newCfg.IndentionStep = len(indent)
return newCfg.frozeWithCacheReuse(cfg.extraExtensions).Marshal(v)
}
func (cfg *frozenConfig) UnmarshalFromString(str string, v interface{}) error {
data := []byte(str)
iter := cfg.BorrowIterator(data)
defer cfg.ReturnIterator(iter)
iter.ReadVal(v)
c := iter.nextToken()
if c == 0 {
if iter.Error == io.EOF {
return nil
}
return iter.Error
}
iter.ReportError("Unmarshal", "there are bytes left after unmarshal")
return iter.Error
}
func (cfg *frozenConfig) Get(data []byte, path ...interface{}) Any {
iter := cfg.BorrowIterator(data)
defer cfg.ReturnIterator(iter)
return locatePath(iter, path)
}
func (cfg *frozenConfig) Unmarshal(data []byte, v interface{}) error {
iter := cfg.BorrowIterator(data)
defer cfg.ReturnIterator(iter)
iter.ReadVal(v)
c := iter.nextToken()
if c == 0 {
if iter.Error == io.EOF {
return nil
}
return iter.Error
}
iter.ReportError("Unmarshal", "there are bytes left after unmarshal")
return iter.Error
}
func (cfg *frozenConfig) NewEncoder(writer io.Writer) *Encoder {
stream := NewStream(cfg, writer, 512)
return &Encoder{stream}
}
func (cfg *frozenConfig) NewDecoder(reader io.Reader) *Decoder {
iter := Parse(cfg, reader, 512)
return &Decoder{iter}
}
func (cfg *frozenConfig) Valid(data []byte) bool {
iter := cfg.BorrowIterator(data)
defer cfg.ReturnIterator(iter)
iter.Skip()
return iter.Error == nil
}
| {
"pile_set_name": "Github"
} |
The heroes are journeying through some dangerous area—nearly always a dark and mysterious forest. A wizard or other such guide has sent them on their way with one piece of advice: Stay on the Path. Straying from the path will lead to "something" bad.
If the heroes leave the path because they were told not to leave it, it's also a case of Forbidden Fruit.
Examples
open/close all folders
Comic Books
One JMS' Spider-Man story involves Doctor Strange sending Peter to the Astral Plane to fight a villain, with a warning not to leave the designated path. He strays off after seeing some random giant spider-shaped thingie, and accidentally unleashes a spider-eating Wasp spirit named Shathra who makes his life miserable for a while afterward.
Cluracan comes to visit his sister Nuala in Dream's castle, and out of curiosity, disregards the doorkeeper's warning to stay on the path. As a result, he ends up creating his own nemesis.
On another occasion:
"I have spoken to the lord of this realm. He has given you permission to enter the castle, and will grant you audience. I am honour-bound to warn you to stay on the path through the castle. Straying from the path could mean your destruction. You killed my friend, woman. Stray from your path."
In the original The Books of Magic, Tim Hunter and Doctor Occult take a trip into Fairyland. Occult gives the warning; Tim actually stays on the path fairly well, until Baba Yaga uses an illusion of the Doctor to convince him to step off it...and then tries to eat him.
The hero of An American Werewolf in London and his wing-man are given the warning "Stay on the road, and beware of the moon!" They ignore the first, and don't understand the second. As a result, one of them dies, and the other becomes a werewolf.
The Golden Child: Before undergoing a test, Eddie Murphy's character is warned to (among other things) "Stay on the path". During the test, the path he's on suddenly explodes, and he angrily demands to know what's going on. A voice tells him that he has to know when to break the rules (an important clue for completing the Secret Test of Character).
Psycho: Marion discovers that she has missed her exit while driving in the dark and the rain, and gotten off the main road onto the old road. This was in 1960, when the highway system was new, and she made a very common mistake people made then, which would have made the audience nod in recognition. She stops at the Bates Motel to ask directions, and decides to stay the night before trying to find her way back in the dark. After being spooked by an essentially harmless, but seemingly menacing, policeman when she tried sleeping in her car the night before. She feels sorry for Norman, who is lonely, hasn't rented a room in a long time, and seems so harmless.
Rowan of Rin: they were in a swamp that through some means conjured up images of loved ones drowning just off the path. If you rush off to save them....
The Hobbit has Gandalf give this advice. Inverted in The Lord of the Rings when Gandalf tells Frodo and Sam to stay off the roads and meet up with the Nazgūl as a result of Merry and Pippin not following the rule.
Stardust: Neil Gaiman is a fan of this trope, as seen in the Comic Books folder. Anyone who strays from the path through the Serewood will fall victim to murderous plants.
David from The Book of Lost Things is warned to stay off the road; when he strays to pick an apple, he is captured by a hunter.
In Dream Park, visitors at the Chamber of Horrors attraction are warned to stay on the green glowing path, as they pass through a holographic diorama of underwater terrors. One woman steps off the path anyway, and is instantly snatched away and torn to pieces by a shark and an aquatic zombie! Lucky for Dream Park's liability insurance, she turns out to be a hologram too.
One of the main themes in the first book of the The Edge Chronicles, mainly because it's set in the Deepwoods, where Everything Is Trying to Kill You. This mentality even extends to children's sports in the woodtroll villages - when protagonist Twig "strays from the path" during a game, he's beaten up by the other kids even though there's technically no rule against it. No-one strays from the path.
In the Dragaera universe, if you're in the world of the dead and you leave the path, you'll never be able to find it again, wandering for all eternity even if you're very much alive.
Xanth features "magic paths" which are designated safe travelling points. Said paths are sometimes one-way such that if you step off of it it disappears. The trope is played with half the time where the protagonists lose the path, find the path is no longer safe, or leave the path. The other half of the time, it's used as a convenient shorthand for "nothing exciting happened between here and there because they were walking on the enchanted path".
In one of Jack Vance's Dying Earth novellas, a traveler's father gives him a charm, which will protect him so long as he remains on the road.
When traveling the Nevernever in The Dresden Files, wizards usually stick to the safer Ways, lest they wander off into an area that is horrifyingly dangerous. In the Nevernever, quite literally anything can happen.
When Ivanova is hooked into the Great Machine ("Voices of Authority"), she is advised by Draal to "stay on the path" when the Eye of Z'ha'dum somehow detects her probing and almost succeeds in mentally compelling her to go towards it. The "path" was a mental visualization given by the machine as a guide away from this Eye.
When traveling in hyperspace, it is important to follow the hyperspace beacons, and stay in range of their signals, so as not to become permanently lost in hyperspace—something that almost happens to an explorer ship in the episode "A Distant Star".
The Invaders: The old TV series began like this, as the protagonist took a wrong turn somewhere and accidentally discovered the alien invasion going on...
Tabletop Games
Changeling: The Lost makes it very clear that wandering off the path in The Hedge can be a very, very bad thing. Not only do the Thorns that make up most of the Hedge drink a Changeling's power (or a human's soul), but hobgoblins lurk in some of the deeper parts. The Gentry occasionally take their strolls through it as well.
Changeling The Dreaming, has elements of this, despite being Lighter and Softer. Wandering off the Silver Path while wandering the Dreaming is a very good way to get lost in some of the deeper delusions of the collective unconsciousness.
Module I5 Lost Tomb of Martek. Before entering the Crystal Prism the PCs read runes that say "Walk that path straight and narrow". If they don't do so, the Iron Phoenix's powerful attacks will probably destroy them.
Module I12 Egg of the Phoenix. In one section of the adventure the PCs are told "If a path is given, do not stray from it". They really need to follow this advice. If they don't, not only will they not be able to complete the mission and possibly get lost 200 million years in the past, but if they stray off the Platinum Path in the Black Forest they'll end up getting massively energy drained and almost certainly die.
A meta-example. Video games are built on budgets, no matter what, so a smart dev team will cheat where they can. One cheat is to highlight a path that they intend for the player to follow. The highlights don't have to be obvious - just lights, warm colors, convenient approaches to an objective, the infamous chest-high walls, and so on. It allows the player the illusion of freedom when they really can't get too far from the game's set pieces. The devs can then devote less time to things "off the path." The cost of leaving the path? Wasting time, ruining your immersion by taking nonsensical actions just to "see if the world is real," being exposed to the second-rate textures, sky boxes, and objects which are pure filler, losing your immersion and time by blundering into the Insurmountable Waist High Fence, expending more resources fighting pointless enemies, and worst of all - finding nothing of interest and growing bored.
Valve's Developer Commentary in Left 4 Dead pointed out a few ways they used this trope, for those who are interested. Everything from car headlights to color schemes are chosen so players can intuit their way through the level. This is important because a little exploration can be very helpful, but a lot of it guarantees more enemies will spawn and possibly overwhelm the players.
No shortage of games invert this trope, rewarding the player for when they do NOT Stay on the Path, or zig-zag it, cluing the player in subtly when it might be a good idea to stray from the path.
Justified in Alan Wake. The enemies are immune to attacks if not exposed to brilliant light first, and they are powerless in bright light. Gameplay consists of a run and gun from light to light. When things go south, following the path from light to light is the best way to progress.
As alluded to in the trope description, you have to stay on the path in order to progress through The Lost Woods in many games.
Racing games with open areas will often respawn you should you leave the area, for obvious reasons.
This is the idea of the game The Path: The player must stray the girl from the path and meet their wolf in order to succeed in the girl's route in the story, rather than following the game's instructions to stay on the path. Following the path gets you a failure screen.
The Haunted Wasteland forces you to follow the flags; going off-route will cause you to be swallowed by the desert winds (and teleported back to a checkpoint). A similar puzzle occurs near Pinnacle Rock in the western ocean of Majora's Mask.
Zelda II The Adventure Of Link: Staying on roads neutralizes enemy encounters. While you're on it, no encounters pop up, and if you spawn some then move back onto the path, the "battle" is a barren plain devoid of enemies you can just walk out of. Naturally, there are many places you can't get to by staying on the path. Early in the game, you'll want these encounters (free Experience Points) but as the game begins to go from Nintendo Hard to "Miyamoto, you sadist!" they become great ways to die horribly (and naturally, at this point, much harder to avoid.)
World of Warcraft: One of the loading screen tips is that players are much less likely to encounter monsters when following a path. Generally true, but there are also some regions where particularly deadly enemies follow the roads, and some roads lead directly to dungeons or the cities of the opposite faction. Pre-expanion Rexxar followed a very long path through Durotar and Feralas, and was death to any Alliance character who didn't see him coming in time.
In Neverwinter Nights, a village has been suspended out of time by Lathander. When you get to the castle you have 3 paths to choose from. If you stay on the correct path, then you get a note from Lathander complementing you on your choice of the middle balanced way. In the others you get attacked by deamon or devils and appropriately chastied by Lathander.
In Black Sigil, you must cross a desert. You are told to follow the path (marked by specific plants), else you will encounter Sand Worms, which are rather tough for you at that point. Straying from the path also means interesting items.
In Fallout: New Vegas, low-level characters can do quite a bit of exploring in relative safety if they stick to the crumbling roads (as long as they heed any "KEEP OUT" signs they come across). Wander just a little way off the path and the restored-to-their-former-magnificence Deathclaws and their adorable new sidekicks, the Cazadores, await you.
In Final Fantasy V, a moogle shows you the way to the moogle village. He walks into a patch of desert, shakes his head "no", and avoids the desert all the rest of the way. When you take control, walking on the path will result in no Random Encounters, while the encounters in the desert are, at least for your likely current level, likely to spawn a Boss In Mooks Clothing.
After entering a dark cellar in Amnesia: The Dark Descent Daniel has a flashback to the first time he went through the area. He questions why it's kept so dark, but Alexander insists that he not stray from the lighted path. Since the only monsters in the castle at the time were the ones under Alexander's control, it's not clear what he thought would happen if Daniel didn't follow him.
At the beginning of Afraid Of Monsters, David is told to "follow the red." What follows is a trip through a surreal nightmare realm, which changes from pitch black walls and floors to insane, tilted rooms. Colored dots lead your way, and if you don't follow the red, you'll end up at the bottom of the pit.
In Finding Nemo the School of fish that gives Dory and Marlin directions to Sydney warns the pair to go THROUGH a particular undersea Canyon, rather than over it. Dory characteristically forgets this warning, leading to a near fatal incident with the jellyfish school.
Zig-zagged in a Monkey Dust skit where Geoff goes to a public Cottager outing somewhere in the murky, dark English countryside. In a nearby pub, a grizzled, toothless old man warns him not to stray too far off the path. Geoff asks him why.
TV Tropes is licensed under a Creative Commons Attribution-NonCommercial-ShareAlike 3.0 Unported License. Permissions beyond the scope of this license may be available from thestaff@tvtropes.org. Privacy Policy | {
"pile_set_name": "Pile-CC"
} |
Nothing earth shattering, but to keep my Mt McKinley company. Got this last Saturday at a yard sale... $5.00
I added the Rock Shox fork & 26" front wheel to create a early Beast of the East look. Haven't ridden yet to see how it preforms. I'm planning that tomorrow. I've kept the original fork & wheel just in case it doesn't work out.
Well, I've been waiting patiently over a year for a nice lugged steel MTB frame in my size to appear for $20 at a yard sale, or on craigslist...but no such luck!
So, when this '91 Trek 800 - the bottom of the barrel - popped up on CL for $10, I figured it would make a great winter beater. I'm also very uptight about riding anything of value on the local trails (Allamuchy, NJ...nothing but rocks, roots and mud pits). But now I can finally ride them with abandon!
I spent a total of $80 on the build, including a new seatpost, crankset, tires, brake pads and used Deore DX thumb shifters. I traded a frame for the wheelset: Araya RM-20 rims laced to Deore DX hubs (they ride very nicely indeed!) The rest was cobbled together from parts I had in the bin: Deore XT FD, Alivio cantis, stem, bars and levers from another 90s Trek, Exage 300 LX RD. The only original parts are the headset and seatpost binder.
Despite the high tensile fork and stays, and the plain gauge CrMo tubes, I don't think the ride is heavy, sluggish or sloppy. But then, I've mountain biked so little, what the hell would I know?
Saved this one from a guy who was using it as his beater bike to get back and forth to work....
Was my dream bike BITD. I remember asking the guy at the LBS if I could touch it and when I picked it up I fell in love.
Fast forward 18 years or so, I finally own one, granted this one's got a lot of dings, cut bars, wrong rear wheel, cracked seat post and a tiny crack at the hole in the seat post tube, but I couldn't be happier....putting it back in shape will be a pleasure.
Saved this one from a guy who was using it as his beater bike to get back and forth to work....
Was my dream bike BITD. I remember asking the guy at the LBS if I could touch it and when I picked it up I fell in love.
Fast forward 18 years or so, I finally own one, granted this one's got a lot of dings, cut bars, wrong rear wheel, cracked seat post and a tiny crack at the hole in the seat post tube, but I couldn't be happier....putting it back in shape will be a pleasure.
Can't wait to hit the single track with it.
One of my dream bikes as well. A friend tried to sell his in the middle '90's and I didn't buy it. Dang. I'm still waiting for another to fall out of the sky.
These pictures make me sad. I had a 1992 Schwinn Sidewinder, dark blue. I loved it, it was my first "nice" bike. For some reason it did not make it to my parents' new house during a move. My girlfriend's got a Nishiki Bravo from about the same time period.
This is my '89 3.0 that rides beautifully, but I'm trying to find a replacement fork for it (I'm wondering if I could clamp it in a vice and bend the shaft about 1-1.5" ??)....I still have the original bars which put one in a fairly aggressive position, so I replaced them with the one's pictured for my city commute
NO! I wouldn't even ride it as is. Replace it, 1" forks are cheap and abundant.
Pinguwin
I disagree. The fork doesn't look catastrophically bent, and any LBS should have a fork bender that'll have it looking and riding like new in no time. It shouldn't affect the integrity of the fork, either.
I disagree. The fork doesn't look catastrophically bent, and any LBS should have a fork bender that'll have it looking and riding like new in no time. It shouldn't affect the integrity of the fork, either.
That's what I was thinking. The steel forks Cannondale used were pretty high quality and I dont think it would be a biggie... But then, I've never had a bent fork before either
no cracks, though! geez...no cracks...cracks in your fork are, unh, bad...really, really, bad. If you do get it bent back, check it really well, and check it after the first time you pound it...stress may make 'em show up later.
no cracks, though! geez...no cracks...cracks in your fork are, unh, bad...really, really, bad. If you do get it bent back, check it really well, and check it after the first time you pound it...stress may make 'em show up later.
there's a red die that you can use to check for cracks isn't there? i recall seeing a machinist use it the last place i worked.
I guess there are differences in opinion but for myself, I'm very cautious about something on the front end like that. I know that you probably could ride it but for something that can be replaced quite cheaply, why bother? My long time mechanic always replaced such forks and like I said, I'm very cautious like that. I fly hang gliders and there is a saying, "If there is any doubt, there is no doubt." YMMV.
here's my mb-2. i got it for 50 bucks and put 125 in it, including the brooks which i'm going to swap out for a black one. it's a great ride and a little different for me as i'm usually on road bikes or vintage three-speeds. it's a bit small as you can tell from the saddle height, but hey, fifty bucks for a mb-2. | {
"pile_set_name": "Pile-CC"
} |
Camera
Panavision Millennium DXL2, Panavision C-, D- and E-Series Lenses
Red Monstro, Panavision C-, D- and E-Series Lenses | {
"pile_set_name": "OpenWebText2"
} |
Q:
Skip "$RECYCLE.BIN" when copying all directories
I am trying to copy all folders to c: the issue is it keeps trying to access the recycle bin folder. I tried many thing to avoid it but it did't work. I had same issue with system volume information but i simply skipped over it. I don't know why this approach is not working with the $recycle.bin
public void Copy(string sourceDirectory, string targetDirectory)
{
DirectoryInfo diSource = new DirectoryInfo(sourceDirectory);
DirectoryInfo diTarget = new DirectoryInfo(targetDirectory);
string[] entries;
try
{
//Gets list of all files and directories (we need it for progress bar)
entries = Directory.GetFileSystemEntries(sourceDirectory, "*", SearchOption.AllDirectories);
//entries = Directory.GetFiles(sourceDirectory, "*.*", SearchOption.AllDirectories)
// .Where(d => !d.StartsWith("$RECYCLE.BIN"))
// .Where(d => !d.StartsWith("System Volume Information")).ToArray();
}
catch (Exception ex)
{
MessageBox.Show(ex.Message);
return;
}
Invoke(new Action(() => progressBar1.Maximum = entries.Count()));
Invoke(new Action(() => progressBar1.Step = 1));
Invoke(new Action(() => progressBar1.Value = 0)); //Using Invoke to prevent Cross thread exception
CopyAll(diSource, diTarget, entries);
}
public void CopyAll(DirectoryInfo source, DirectoryInfo target, string[] entries)
{
// lblInfo.Text = "Copying " + source;
Directory.CreateDirectory(target.FullName);
// Copy each file into the new directory.
foreach (FileInfo fi in source.GetFiles())
{
try
{
if (source.ToString() != "D:\\$RECYCLE.BIN" && source.ToString() != "System Volume Information")
{
if (!IsWorking)
{
Invoke(new Action(() => lblInfo.Text = "Stopped"));
return;
}
//Using Invoke to prevent Cross thread exception
Invoke(new Action(() => this.lblInfo.Text = string.Format("Copied {0}\\{1}", source.FullName, fi.Name)));
if (File.Exists(Path.Combine(target.FullName, fi.Name)))
{
File.Delete(Path.Combine(target.FullName, fi.Name));
}
fi.CopyTo(Path.Combine(target.FullName, fi.Name), true);
Application.DoEvents();
Invoke(new Action(() => progressBar1.Value++));
}
}
catch (UnauthorizedAccessException ex)
{
// ok, so we are not allowed to dig into that directory. Move on.
}
}
// Copy each subdirectory using recursion.
foreach (DirectoryInfo diSourceSubDir in source.GetDirectories())
{
try
{
if (diSourceSubDir.ToString() != "System Volume Information" && diSourceSubDir.ToString() != "$RECYCLE.BIN")
{
DirectoryInfo nextTargetSubDir =
target.CreateSubdirectory(diSourceSubDir.Name);
CopyAll(diSourceSubDir, nextTargetSubDir, entries);
Invoke(new Action(() => progressBar1.Value++));
}
else
{
Invoke(new Action(() => progressBar1.Value = progressBar1.Value + 2));
}
}
catch (UnauthorizedAccessException ex)
{
// ok, so we are not allowed to dig into that directory. Move on.
}
}
I tried the commented out LINQ and if statements and most online answers. I don't want to run it as admin and I deleted the app.manifest file I appreciate the help.
A:
Here is what I did: I added the conditions and removed the return; and show box so when it catch something it just moves on to the next directory.
try
{
if (!diSource.ToString().Contains("System Volume Information") &&
!diSource.ToString().ToUpper().Contains("$RECYCLE.BIN"))
{
entries = Directory.GetFileSystemEntries(sourceDirectory, "*",
SearchOption.AllDirectories);
}
}
catch (UnauthorizedAccessException ex)
{
//ok, so we are not allowed to dig into that directory. Move on.
}
| {
"pile_set_name": "StackExchange"
} |
Most Peruvian mummies come bundled in cloth, with their legs folded up to their chests and their arms around their knees. But the young boy we now know only as the Nasca Boy was buried in a position he probably occupied in life: on a contoured, cushioned adobe stool, with his lower legs tucked beneath his seat. It’s the only burial of its kind that archaeologists have ever seen, and it immediately suggests two very important things about this child: he lived with a disability that would have required additional care and resources, and he was well cared for and valued by the people around him, even during a period of their history when food was scarce and life was uncertain.
That’s the conclusion of a new study, which revisits the original 1973 research on the mummified remains of the young boy, who died around 700 CE. The original archaeologists, led by the late Marvin Allison, focused on identifying evidence of tuberculosis in the boy’s remains; they provided the first evidence that the disease had stalked South American populations long before Europeans arrived.
Archaeologist Lorna Tilley and her colleagues have taken a second look at that study in an effort to reconstruct details of the child’s experience with his illness and disability, the kind of care he probably received, and what that reveals about the culture in which he lived. “I rely on taking the information available from the work of other archaeologists and synthesizing it, hoping that I've understood their research results and providing copious references so that readers can go to the sources themselves,” Tilley told Ars Technica.
A short, difficult childhood
An autopsy in the early 1970s found evidence of tuberculosis infection in the Nasca Boy’s spine, a condition called Pott’s Disease. Allison and his colleagues suggested that the child's ordeal began as a mild respiratory infection when the boy was a year or two old. Tuberculosis bacteria in his bloodstream must have spread to his spine, where it eventually left a 5cm-wide abscess in his lower spine, having eaten away at several vertebrae and the discs between them.
Allison and his colleagues also found lesions (called tubercles) and Mycobacterium tuberculosis bacteria in the boy’s lungs, heart, liver, and right kidney. This widespread infection, called miliary tuberculosis, may have spread through his bloodstream from the abscess in his spine, and it probably killed him within weeks.
Tilley and her colleagues didn't do any new analysis of the boy’s remains. Their focus is on re-examining the work of earlier archaeologists, whose research often is directed at identifying signs of disease in ancient populations; Tilley and her colleagues comb that earlier research for overlooked clues about health care in past societies.
Caring for the Nasca Boy
The Nasca Boy probably lived with Pott’s disease for a few years before losing mobility in his legs, and it would have taken a heavy toll on his early childhood, forcing him to live with back and chest pain, fevers, weight loss, and fatigue. It’s likely that he would never have been able to keep up with his peers, either at play or in the work often expected of children in agricultural communities. Tilley and her colleagues compared the Nasca Boy’s case to studies of modern children facing chronic disease, and they speculate that he may also have dealt with depression, anxiety, and grief.
A child with such an illness would have needed additional care and support from his family members—sick children need to be comforted when they’re in pain, cooled when they’re feverish, and probably coaxed to eat.
When Pott’s disease left him immobilized, the Nasca Boy would have required an even higher level of care: help with bathing and personal hygiene, frequent massages and repositioning to help with circulation, and much closer supervision to make sure he was safe, hydrated, and getting enough nutrition. “Without massaging, repositioning, constant hygiene monitoring and maintenance, pressure sores are inevitable when a subject is immobilized, and if left untreated rapidly become infected,” Tilley told Ars Technica. “Similarly, when someone is effectively immobilized, their circulatory and respiratory (as well as other!) systems are very rapidly compromised.”
The fact that the Nasca Boy survived eight to ten years with such a serious illness is proof that he received the care he needed, and it seems he was cared for well; his skin, preserved by natural mummification for nearly 1,300 years, shows no sign of bedsores, which means he likely benefited from good hygiene and frequent position changes. And the stool itself tells a story.
“The stool speaks of an understanding and acceptance of the Nasca Boy’s needs and of the readiness to work around them,” wrote Tilley and her colleagues.
Medicine in the pre-Columbian Andes?
There’s no evidence of what sorts of medicines he might have taken for pain, fever, or digestive problems, because the 1973 study focused on looking for evidence of disease, not treatment.
“Allison et al. approached their subject’s remains with one objective in mind and perceived information extraneous to that as irrelevant,” wrote Tilley and her colleagues. But Tilley says the Nasca almost certainly had access to medicines, either locally or through trade, and biochemical analysis of his hair could yield some clues about whether his body metabolized certain chemical compounds, including alcohol, in his final months. Hair also contains cortisol, which can offer insights into a person’s stress levels, and stable isotopes of strontium and oxygen which could suggest what he ate. Those answers may not be forthcoming any time soon, though.
“While this would satisfy curiosity, I don't think it would be seen as a priority,” Tilley told Ars Technica.
Analysis of his gut contents also could produce evidence of medicinal plants or his last meals, but that opportunity may have been lost; it's not clear whether Allison and his colleagues removed and discarded the mummy's entire stomach and intestines in the 1970s.
It took a village
There’s no evidence of who would have cared for the Nasca Boy during his short, challenging life, but Tilley and her colleagues suggest it was probably a joint effort by his mother and some mixture of older siblings, elderly relatives, and possibly others. In a society where survival depended on crops and livestock, any time away from the work of growing food would have been a costly prospect for a family. That would have been especially true for the Late Nasca, living under the strain of drought and a fickle climate, which had troubled the region since around 640 CE.
The fact that the care happened despite these hardships may suggest something important about the Nasca. “The Nasca Boy’s survival suggests this particular child was sufficiently loved and prized for those responsible for looking after him to make this commitment,” wrote Tilley and her colleagues. “There is no reason to suppose that all children were not equally valued.
That is informed speculation at best, but it’s potentially the clearest insight we have into the family life of a culture that left behind almost no record of such things. All of the art the Nasca have left us has to do with religious or ritual matters—women show up only rarely, and children and daily life are completely absent.
“At this distance in time—over 1,200 years ago, and with no written evidence to fall back on—we can never be sure we're right in the fine detail of analysis,” Tilley told Ars Technica. “But at the broad-brush level, and focusing on the practical and emotional aspects of looking after a very sick child over an extended period in which their decline is obvious, we can surmise a society in which children were valued in their own right; recognized as individuals with individual needs; and supported by the use of possibly scarce resources in their maintenance.”
International Journal of Paleopathology, 2018. DOI: 10.1016/j.ijpp.2018.08.001 (About DOIs). | {
"pile_set_name": "OpenWebText2"
} |
Lucies Farm Photo Gallery
Home of Scottish | Kobe Beef, Kurobuta Pork, and Pampered Dogs
Marjorie (Holding My Stick) on the Nevsky Prospect160 viewsOne of the main streets in St. Petersburg.
Lobby Bar - Radisson SAS Royal Hotel, St. Petersburg100 viewsOur base-of-operations in St. Petersburg. You can watch the folks on the main Nevsky Prospect from this bar/lounge. And Marjorie loved the falafel.
Nevsky Prospect - St. Petersburg4090 viewsTo cross the street in either direction on Nevsky Prospect -- one of the main streets in St. Petersburg -- you need to go into this pedestrian underpass. When we did so, on a bright spring afternoon (our wedding anniversary), my camera was stolen. I'd just entered the underpass, and as my eyes adjusted to the gloom someone bumped into me quite hard, and I knew my camera was gone when my left shoulder suddenly didn't feel the weight. But there was a crowd, and no obvious villan.
Nevsky Prospect - St. Petersburg296 viewsThis is where my wallet was stolen. This is one of the main streets in St. Petersburg, Russia. Marjorie and I were walking up the street (same direction as the girl with the yellow shoulder bag) on a sunny spring afternoon. A large man on a cell phone came out from behind the bus shelter (on the left in this photo) and blocked my path. Others crowded me from behind when I stopped suddenly, and my wallet was gone. The police didn't really care -- this is apparently typical in St. Petersburg. | {
"pile_set_name": "Pile-CC"
} |
This year, there has been a significant increase in regulation and compliance initiatives as the cryptocurrency market saw the fallout from initial coin offerings (ICOs), of which many were poorly disguised securities offerings and many more were outright scams. Earlier this year, Satis Group reported that 92 percent of ICOs were scams or have otherwise failed to list on exchanges, resulting in billions of dollars in losses for investors. Still, there are further billions wrapped up in non-compliant tokens and projects, all at risk of becoming the Securities and Exchange Commission’s next target. Airfox and Paragon will not be the only companies that face legal action, they are merely a signal fire to let everyone else know — the SEC is coming.
Now more than ever, it’s important to track the industry as it shifts its focus from ICOs to security token offerings (STOs). However, navigating these changes can be difficult as new companies, offerings, and compliance solutions appear by the month. Pink Sky has been working to prepare for these changes and would like to share our thoughts with you.
We want to initiate dialogue regarding various issuance platforms and financial instruments that are ripe for tokenization. To do this, we are releasing our Security Token Series—a collection of articles on new protocols, offerings, and assets as they pertain to current news events. In this article we will discuss Harbor’s asset tokenization, the platform’s usage in the real estate market, and their Regulated Token standard. | {
"pile_set_name": "OpenWebText2"
} |
Q:
How to search all levels nested Javascript object
I have a Javascript Object that represents a nested JSON string like this:
http://pastebin.com/vwZb1XrA
There are many levels that contain a "name" element. For example "SVI" or "Population" or "Human Development Index".
I am trying to find a way to iterate over every level of the object to find the name "SVI" or "Population" or "Human Development Index". When a match is made I want to then replace the weight value with something like this:
if (data[key].name == name) {
data[key].weight = 55;
}
A:
You can recursively check each and every object, like this
function rec(currentObject, values, replacement) {
if (values.some(function(currentValue) {
return currentObject.name === currentValue;
})) {
currentObject.weight = replacement;
}
(currentObject.children || []).forEach(function(currentItem) {
rec(currentItem, values, replacement);
});
}
rec(data, ["SVI", "Population", "Human Development Index"], 55);
console.log(data);
Working demo
| {
"pile_set_name": "StackExchange"
} |
[Flavonols and flavones of vegetables. VIII. Flavones of carrot leaves (author's transl)].
The flavonoid constituents of carrot leaves (Daucus carota L. ssp. sativa) were separated by means of cellulose column chromatography, and the following compounds were obtained crystalline and identified by usual procedures: luteolin 7-beta-D-glucoside as the main flavon, luteolin 4'-beta-D-glucoside, luteolin 7-beta-D-glucuronide, apigenin 7-beta-D-glucoside, apigenin 7-rutinoside, chrysoeriol 7-beta-D-glucoside. Luteolin 7-rutinoside also was identified, but could not be obtained crystalline. | {
"pile_set_name": "PubMed Abstracts"
} |
According to a WakeMed spokeswoman, a Raleigh fire commander who suffered critical personal injuries in a December 4 crash involving a Wake County school bus died of those injuries on December 11.
Veteran firefighter Harry P. Kissinger at WakeMed after suffering head trauma in an accident on Ligon Mill Road in North Raleigh.
According to Sgt. J.E. Brewer, a spokesman for the North Carolina Highway Patrol, charges that were expected to be filed against the driver of the school bus, Garner resident Sheila Hall, will now be reviewed by the Wake County District Attorney’s Office.
City authorities say Kissinger, a married father of two young daughters, joined the fire department on October 27, 1997 and was assigned to Fire Station Six on Fairview Road.
The Highway Patrol said that the fatal wreck occurred shortly before 6:30 a.m.
According to an accident reconstruction team, the bus, driven by Hall, crossed the center line and clipped a Ford Taurus before colliding head-on with the Dodge pickup truck Kissinger was driving.
City officials say Kissinger was returning home from work at the time of the crash.
Kissinger was pinned inside his truck for nearly 45 minutes as his fellow firefighters cut the top off the vehicle off in order to extract him. | {
"pile_set_name": "Pile-CC"
} |
Noun: Bold or insolent heedlessness of restraints, as of those imposed by prudence, propriety, or convention.
As I explain below, the Administration's principal justification for its stark violation of FISA is the claim that Congress authorized the surveillance in question -- the circumvention of FISA's finely wrought scheme -- when, on September 18, 2004, it enacted the AUMF authorizing the President to take "necessary and appropriate force" against those reponsible for the 9/11 attacks. I suggested that this didn't pass the laugh test -- that it is simply inconceviable that any member of Congress, let alone a majority, intended by voting for the AUMF to allow circumvention of the FISA-court approval mechanism as to the wiretapping of communications involving U.S. persons. (If the AUMF had authorized such interceptions, why did the Administration seek and receive amendments to FISA in the PATRIOT Act? Why, in 2003, did the Justice Department draft further amendments to FISA -- including to section 1802 in particular -- without mentioned the surgery that had been performed by the AUMF, and why in that draft is the "U.S. person" limitation accurately described as if it had not been amended?)
But the Attorney General's press conference today makes it clear that that's their story, and they're sticking to it. The odd thing, of course, is that the Administration specifically went to Congress with a package of statutory authorities -- many related to wiretaps and surveillance -- that it thought were necessary to fight the battle against Al Qaeda. It was called the PATRIOT Act. Therefore, it's understandable that two reporters at today's conference asked the AG why they didn't simply ask Congress for a simple amendment to FISA, if this eavesdropping authority was as critical as the Administration now claims.
First, Gonzales is asked why, if this authority is so important, they didn't just "address that issue and fix it," i.e., through statutory amendment, rather than taking the "backdoor approach" [of pretending that it had already been authorized]. Here's his response:
"This is not a backdoor approach. We believe Congress has authorized this kind of surveillance. We have had discussions with Congress in the past -- certain members of Congress -- as to whether or not FISA could be amended to allow us to adequately deal with this kind of threat, and we were advised that that would be difficult, if not impossible."
Did you catch that? It's a two-part answer: (1) Congress has authorized the circumvention of FISA (in the AUMF); and (ii) We didn't ask Congress for an amendment to FISA because we were informed they would have denied it.
And then there's this exchange, in which the answers are inverted (1. We couldn't have gotten congressional authorization; 2. In any event, we got congressional authorization):
Q If FISA didn't work, why didn't you seek a new statute that allowed something like this legally?
ATTORNEY GENERAL GONZALES: That question was asked earlier. We've had discussions with members of Congress, certain members of Congress, about whether or not we could get an amendment to FISA, and we were advised that that was not likely to be -- that was not something we could likely get, certainly not without jeopardizing the existence of the program, and therefore, killing the program. And that -- and so a decision was made that because we felt that the authorities were there, that we should continue moving forward with this program.
The interesting question now, of course, is whether Congress will permit itself to be treated with such contempt.
I agree that the Administration's arguments here are pretty weak, though not novel (the inherent powers argument has found support, bafflingly to my mind, for quite some time).
But I find it funny that people who don't mind finding all kinds of liberal goodies in the Constitution, which never did and never would get there by any Democratic process, think those are worth fighting tooth and nail for. On the other hand, when John Yoo finds what Lincoln found there, he's "lawless."
Actually, he is, as was Lincoln's suspension of the writ, as was Roe, as was Roper. I'm against ALL the lawlessness. Who knows, maybe Bush's playfulness with written laws will make textualists of all the purposivists out there...there is, after all, a reason to write things down and to insist that words have meanings that can be understood: the rule of law.
The AUMF argument only makes sense in relation to the (far stronger) Article II claim. We need to take a step back and think here: does the administration have the right to intercept messages from an organization we have declared war on to residents of the US without judicial oversite? If we were talking about Goebbels sending letters to German immigrants i imagine it would pass the laugh test. Its the wiretapping that is freaking us out. If it was a letter or morse code or smoke signals no-one would think twice about the governments ability to intercept it when its transmitted from an overseas combatant.
Actually, Mark, your points are fair as to the substance of things. But law is not just about results. I'm not so bothered by wiretaps--I think the internet and Visa have pretty much eliminated privacy, a right we tend to fetishize in modernity anyway. So I might be perfectly comfortable with giving this power to the executive.
What I am not comfortable with is the prospect of a lawless executive claiming to be the sole interpreter of its own unwritten inherent powers. This surveillance program, if it is necessary for our security, could be accomplished legislatively, and I would not be bothered.
The best discussion of Lincoln's constitutional thought I've seen is "Lincoln's Constitution," by Daniel Farber. My impression from that book is that Lincoln was a good deal more respectful of constitutional and Congressional authority than Bush/Gonzales are. Far from overriding settled law when it was inconvenient, Lincoln acknowledged that ultimately Congressional authority was required for constitutionally controversial emergency actions.
My other impression is that the Civil War was a far more existential threat to the United States than the current perma-yellow-alert emergency is.
As to Goebbels and German immigrants: if there had been settled law against wiretaps of this sort, that should have been serious back then too. I seem to recall other actions against Americans of foreign extraction back then that most Americans are ashamed of today.
"What I am not comfortable with is the prospect of a lawless executive claiming to be the sole interpreter of its own unwritten inherent powers."
If that were truly the case he would hardly be briefing Congressional leaders. Assumedly there was aquessance in their silence.
This is where the AUMF has an impact. We arent talking simply about a president eavesdropping on offshore groups he personally deems dangerous to the US (although he certainly has that discretion if they arent communicating with anyone on US soil). Gonzalez rightly (if ineptly) points out that this organization is a specific enemy, specifically declared an enemy by Congress. I pointed to this example on VC: if during a 'conventional' war, an enemy submarine was comminicating with a commando team already on US soil, would the administration require a warrant intercept? Or would that not clearly fall under his Article II purview? So obviously there is a line here, the question becomes where is it drawn? In in that context the AUMF is certainly germaine.
Briefings aren't acquiescence. Say I bind and gag you and then 'brief' you that I'm about to rob your house. Later I tell the court "he didn't object." I guess you'd be pulling your chin saying "hmm, guy's got a point."
I think opposition party congressmen and women can't just run around blabbing about whatever they hear at an intelligence briefing. All they can do -- the few who even hear about the program, that is -- is object directly to the administration. Jay Rockefeller wrote a letter to Cheney doing just that, expressing strong reservations that were anything but acquiescence.
I pointed to this example on VC: if during a 'conventional' war, an enemy submarine was comminicating with a commando team already on US soil, would the administration require a warrant intercept? Or would that not clearly fall under his Article II purview? So obviously there is a line here, the question becomes where is it drawn? In in that context the AUMF is certainly germaine.
But of course, the FISA already provides for this exigency. There is no need to make an end-run around the statute. The administration can wiretap such communications immediately, subject to obtaining a warrant from the FISC within 72 hours.
Briefings aren't acquiescence. Say I bind and gag you and then 'brief' you that I'm about to rob your house. Later I tell the court "he didn't object." I guess you'd be pulling your chin saying "hmm, guy's got a point."
The representatives were far from bound and gagged. They definitely had other means of investigation and oversite by means of the Intelligence committees. Those venues are already within a classified realm and can discuss such issues. If they then deemed the presidents activities as illegal, they then could tell him so and take further action as neccessary. Which include court actions if deemed appropriate.
Rockefeller's single letter is far from performing his due diligence in this. He most certainly could have brought this up in committee and forced the issue if he chose to.
And note, other Senators, of both parties, made similar statements and still did nothing. They all should be given a portion of the blame for failure to do anything beyond the most meager of protests.
They definitely had other means of investigation and oversite by means of the Intelligence committees.
Yeah, right. Bush has said it was "shameful" to reveal the existence of this unapproved, illegal program. The Senate and the House are both run by party-line partisans who have to shamed (and what an iffy proposition that was) into keeping their own promise to follow up on the pre-war politicization of intelligence. Oops, make that 'promising to keep their own promise.'
You know that you'd be supporting Bush and the Republicans to the hilt if Rockefeller had come out saying anything he was sworn not to.
There wasn't oversight, there was the arm-twisted appearance of oversight. And you know it.
Secondly, there are such things as roving wiretaps. Now, by the way, any time you hear the United States government talking about wiretap, it requires -- a wiretap requires a court order. Nothing has changed, by the way. When we're talking about chasing down terrorists, we're talking about getting a court order before we do so. It's important for our fellow citizens to understand, when you think Patriot Act, constitutional guarantees are in place when it comes to doing what is necessary to protect our homeland, because we value the Constitution.
Good point, whig. Pres. Bush also made the same claim last fall during one of the presidential debates. He claimed, in response to a question during the "undecided voters" debate, that all wiretaps required a warrant, knowing as he said so that he had repeatedly authorized warrantless wiretaps. That's called lying.
I certainly have a problem with the president having carte blanche authority to surveil American's in search of foreign intelligence, but it seems that there is in fact some legal basis this view.
It seems that there are actually quite a few federal cases that say that the President has the "inherent authority" to wiretap without a warrant in order to gain foreign intelligence. In particular, there seems to be a 2002 case, In Re Sealed Case 310 F.3d 717, which explicitly states this. I this case, the Foreign Intelligence Surveillance Court of Review determined that the President had “inherent authority to conduct warrantless searches to obtain foreign intelligence information,” and that so long as the only real use of a FISA warrant is to be later able to use that information in a criminal prosecution. This authority apparently comes from the President’s role as Commander-in-Chief. and therefore Congress had no power to restrict this authority through FISA or any other means short of proposing a Constitutional Amendment.
I am more than willing to have someone tell me that I am wrong here, in fact, I wish someone would, but it seems to me that this was within the law.
One additional place to Acquire Buy Aion Kina is a Grim Maul Testimonial even though it will demand a bunch of you in case you are wanting to to Get RS2 Gold in this way. You can do this pretty very well Tera Gold on the other hand may find the idea onerous to acquire alone! | {
"pile_set_name": "Pile-CC"
} |
Theresa May is to travel to Brussels on Wednesday evening to finalise the Brexit deal in a meeting with the European commission president, Jean-Claude Juncker.
With talk of a backbench coup against the prime minister fizzling out, No 10 said the prime minister would head for discussions with Juncker “as part of the ongoing negotiations over the future framework”.
Downing Street and the commission have a deal in principle on the withdrawal agreement concerning citizens’ rights, the £39bn divorce bill and the Irish border problem. Negotiations continue over a separate document about the future relationship.
May’s trip comes as the recent pressure on her position slightly eases, with speculation about an imminent leadership challenge fading as Brexiter rebels failed to amass the 48 letters of no confidence from Conservative MPs needed to trigger a challenge.
She does, however, face a parallel problem after the Democratic Unionist party, which keeps her in office, breached its confidence and supply deal with the Tories by failing to back the government on a series of budget votes on Monday night.
The full text of a political declaration on future EU-UK relations was meant to be published on Tuesday, but the timing is now up in the air. The commission’s chief spokesman declined to say whether the document would appear before or after May’s meeting with Juncker.
“The aim of the meeting is to prepare Sunday’s European council article 50 format [EU 27 leaders] and to ensure that we are in a position again, I repeat, to endorse the draft withdrawal agreement and approve the political declaration of the framework of the future relationship,” he said. “This is not a dinner, it is afternoon tea.”
The EU’s chief Brexit negotiator, Michel Barnier, told MEPs in private that the political declaration would be circulated shortly to a restricted group and offered some hope to May that some of the demands from member states for the political declaration had been resisted.
Asked about the call for the UK to “dynamically align” on environmental, social and labour regulations, Barnier said the EU had to be realistic and could not seek from the UK the same standards outside the bloc as inside it, sources said.
He said he was also mindful to ensure any ambitious language in the document did not allow the Chequers proposals to come back in through the back window, with them having been widely rejected as an attempt at “a la carte membership of the single market”.
Earlier, the Spanish foreign minister, Josep Borrell, and the Spanish prime minister, Pedro Sánchez, warned their country could withhold its support for the entire package unless there was an explicit statement that a future trade deal with the UK would only cover Gibraltar if it received Madrid’s consent.
“In the past 72 hours none of the documents have clarified something which is fundamental for us,” Sánchez said on Tuesday morning. “Gibraltar is not part of the UK … As it stands, the [Spanish] government will vote against the Brexit agreement.”
Borrell echoed his prime minister, saying: “Mrs May said that she will not agree with the withdrawal treaty ... without knowing the content of the political declaration about the future relationship.
“She has said she will not agree with one thing unless I know and agree with the other. Me too. I want to see both things.”
Borrell said Barnier was “trying to write a paper that fits everything together and makes [everybody] happy”.
He added: “We have always been working with one idea, an idea approved several times by the European council. On the future relations, it will not include Gibraltar. Gibraltar is something apart ... Spain has to agree … we want it to be clear one way or another.
“I don’t mind about the instrument but I want it to be clear the future will be negotiated about Gibraltar with the agreement of Spain.”
Borrell said the withdrawal agreement would still go through without Spain’s support, as it did not require unanimity.
He added, however, that the Brexit process had laid bare the fragility of the UK, and warned he could foresee Scotland becoming independent and joining the EU.
“Why not?”, Borrell told Politico in an interview on Tuesday morning. “If they leave Britain within the accordance of the internal regulations. If Westminster agrees, we are not going to be more Papist than the pope. If Westminster agrees, why would we be against it?”
The commission’s spokesman declined to comment on how it would handle Spain’s objections to the withdrawal agreement.
Despite the recent crisis in Catalonia prompted by the independence movement, Borrell said: “I am very much [more] worried about the unity of the United Kingdom than the unity of Spain. I think the United Kingdom will split apart before Spain.”
He warned against a second Brexit referendum, however, as proposed by his prime minister last week.
“I don’t like second referendums. In Europe, we have a record of people voting, voting something that was not what the authorities liked and then being convinced to vote again,” Borrell said.
“It was the case with the Irish at least twice and the Danish also. It is also something that doesn’t look very democratic.” | {
"pile_set_name": "OpenWebText2"
} |
#region Copyright notice and license
// Copyright 2019 The gRPC Authors
//
// Licensed under the Apache License, Version 2.0 (the "License");
// you may not use this file except in compliance with the License.
// You may obtain a copy of the License at
//
// http://www.apache.org/licenses/LICENSE-2.0
//
// Unless required by applicable law or agreed to in writing, software
// distributed under the License is distributed on an "AS IS" BASIS,
// WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
// See the License for the specific language governing permissions and
// limitations under the License.
#endregion
using Microsoft.Extensions.DependencyInjection;
namespace Grpc.AspNetCore.Server.Internal
{
/// <summary>
/// A marker class used to determine if all the required gRPC services were added
/// to the <see cref="IServiceCollection"/>.
/// </summary>
internal class GrpcMarkerService
{
}
}
| {
"pile_set_name": "Github"
} |
IN 1962 Jacob Cohen, a psychologist at New York University, reported an alarming finding. He had analysed 70 articles published in the Journal of Abnormal and Social Psychology and calculated their statistical “power” (a mathematical estimate of the probability that an experiment would detect a real effect). He reckoned most of the studies he looked at would actually have detected the effects their authors were looking for only about 20% of the time—yet, in fact, nearly all reported significant results. Scientists, Cohen surmised, were not reporting their unsuccessful research. No surprise there, perhaps. But his finding also suggested some of the papers were actually reporting false positives, in other words noise that looked like data. He urged researchers to boost the power of their studies by increasing the number of subjects in their experiments.
Wind the clock forward half a century and little has changed. In a new paper, this time published in Royal Society Open Science, two researchers, Paul Smaldino of the University of California, Merced, and Richard McElreath at the Max Planck Institute for Evolutionary Anthropology, in Leipzig, show that published studies in psychology, neuroscience and medicine are little more powerful than in Cohen’s day.
They also offer an explanation of why scientists continue to publish such poor studies. Not only are dodgy methods that seem to produce results perpetuated because those who publish prodigiously prosper—something that might easily have been predicted. But worryingly, the process of replication, by which published results are tested anew, is incapable of correcting the situation no matter how rigorously it is pursued.
The preservation of favoured places
First, Dr Smaldino and Dr McElreath calculated that the average power of papers culled from 44 reviews published between 1960 and 2011 was about 24%. This is barely higher than Cohen reported, despite repeated calls in the scientific literature for researchers to do better. The pair then decided to apply the methods of science to the question of why this was the case, by modelling the way scientific institutions and practices reproduce and spread, to see if they could nail down what is going on.
They focused in particular on incentives within science that might lead even honest researchers to produce poor work unintentionally. To this end, they built an evolutionary computer model in which 100 laboratories competed for “pay-offs” representing prestige or funding that result from publications. They used the volume of publications to calculate these pay-offs because the length of a researcher’s CV is a known proxy of professional success. Labs that garnered more pay-offs were more likely to pass on their methods to other, newer labs (their “progeny”).
Some labs were better able to spot new results (and thus garner pay-offs) than others. Yet these labs also tended to produce more false positives—their methods were good at detecting signals in noisy data but also, as Cohen suggested, often mistook noise for a signal. More thorough labs took time to rule these false positives out, but that slowed down the rate at which they could test new hypotheses. This, in turn, meant they published fewer papers.
In each cycle of “reproduction”, all the laboratories in the model performed and published their experiments. Then one—the oldest of a randomly selected subset—“died” and was removed from the model. Next, the lab with the highest pay-off score from another randomly selected group was allowed to reproduce, creating a new lab with a similar aptitude for creating real or bogus science.
Sharp-eyed readers will notice that this process is similar to that of natural selection, as described by Charles Darwin, in “The Origin of Species”. And lo! (and unsurprisingly), when Dr Smaldino and Dr McElreath ran their simulation, they found that labs which expended the least effort to eliminate junk science prospered and spread their methods throughout the virtual scientific community.
Their next result, however, was surprising. Though more often honoured in the breach than in the execution, the process of replicating the work of people in other labs is supposed to be one of the things that keeps science on the straight and narrow. But the two researchers’ model suggests it may not do so, even in principle.
Replication has recently become all the rage in psychology. In 2015, for example, over 200 researchers in the field repeated 100 published studies to see if the results of these could be reproduced (only 36% could). Dr Smaldino and Dr McElreath therefore modified their model to simulate the effects of replication, by randomly selecting experiments from the “published” literature to be repeated.
A successful replication would boost the reputation of the lab that published the original result. Failure to replicate would result in a penalty. Worryingly, poor methods still won—albeit more slowly. This was true in even the most punitive version of the model, in which labs received a penalty 100 times the value of the original “pay-off” for a result that failed to replicate, and replication rates were high (half of all results were subject to replication efforts).
The researchers’ conclusion is therefore that when the ability to publish copiously in journals determines a lab’s success, then “top-performing laboratories will always be those who are able to cut corners”—and that is regardless of the supposedly corrective process of replication.
Ultimately, therefore, the way to end the proliferation of bad science is not to nag people to behave better, or even to encourage replication, but for universities and funding agencies to stop rewarding researchers who publish copiously over those who publish fewer, but perhaps higher-quality papers. This, Dr Smaldino concedes, is easier said than done. Yet his model amply demonstrates the consequences for science of not doing so. | {
"pile_set_name": "OpenWebText2"
} |
Comments
Comment by autopsied
drop rate for this and the legs in baradin hold is pretty low. personally i saved vp for the chest first, and have been waiting for these or the legs to drop. the low drop rate means you might be better off farming vp weekly to get them rather than relying on rng to acquire these.
Comment by fm0use
Actualy, the worst piece of warlock t11 set
Comment by nachocheese17
These aren't the best gloves (which is sad as it is T11) These or These are better.(Haste and crit are a Destro warlocks dream)Just remember to reforge the mastery! ;) | {
"pile_set_name": "Pile-CC"
} |
Aechmea leucolepis
Aechmea leucolepis is a species in the genus Aechmea. This species is endemic to eastern Brazil from Bahia to Espírito Santo.
References
leucolepis
Category:Flora of Brazil
Category:Plants described in 1955 | {
"pile_set_name": "Wikipedia (en)"
} |
It astounds me, without exception to see how goats can climb. They are fearless climbers. They love steep and dangerous slopes. They lurch way out on a high flimsy tree limb or a narrow mountain ledge. I know that a fear of heights is a goat’s best defense against predators since a predator wouldn’t dare venture out onto that ledge to catch one measly little goat. At our farm, we don’t have any bold ramps, cliffs or toys for the goats to scale, although we do have a low stand outside in the sun and a steep staircase just inside the barn door where they like to slumber.
I am not brave but I am working on it. My brother, Mike, the pilot, would often take me flying with him. While we wait for take off, we have a custom we would observe. I would look out of the side window at the ground and utter, “Look at those people down there, they look just like ants!” Mike would smile generously and respond, “They are ants - we haven’t left the ground yet.” He would be notably disappointed if I didn’t say that. The last thing I wanted to do was disappoint Mike just before our flight.
Mike knew that I was weak-kneed; I don’t consider myself brave, but because I flew regularly with Mike, I have never deemed myself afraid of heights. At the age of three, I enjoyed being up in the balcony in church. I would gaze down on the congregation and the people would appear so tiny. I also had a spectacular view of all the tops of their heads. I would count all the hats.When Mike and I went flying as teenagers, he sometimes took me for a ‘spin’ especially if I had flustrated him earlier that day. A spin is an aerial maneuver. I guess you could call it an ‘aggravated stall’. Once he decides to spin, he takes us over crown forestland. He simultaneously yaws and stalls the airplane. The aircraft begins to fall out of the sky. It then rotates following a corkscrew path. Looking through the cockpit windshield, I see one tree rotating in the centre like a hub and all the other trees revolving around it. As our plane spins and plummets, I scream like banshee. Mike would then recover the plane and we would be on our way - otherwise I wouldn’t be writing this today.
My one-month-old bottle-baby, Wisdom, has no fear of heights what so ever. Like his goat ancestors, he loves to climb and spends his days at the very top of the steep staircase. The final additions weren’t finished on our barn so there was a small opening in the underside of the eaves where the soffit goes. One afternoon I was on my way out to the barn with Wisdom’s bottle. I heard him call to me. I couldn’t see where he was calling from at first, then I noticed him watching me from under the eaves. He had spied me coming with his bottle. I heard him struggling and all of a sudden, his head and front legs appeared over the top of the wall. I screamed and ran as fast as I could but before I could get there, down he came with his limbs spread wide. He looked like a white fluffy aircraft falling through the air. He landed on his side and bounced right to his feet. Then the delinquent kid-goat came bounding towards me and hopped into my lap for his milk.
Don't worry he wasn't hurt at all; he was just fine. He did scare me half to death. There’s no way of knowing what a kidgoat will do next. We finished installing the soffit as soon as Wisdom was finished drinking his bottle so that this wouldn't happen again. That evening a small group of children, who wanted to see the kid-goats, came to visit. Wisdom was looking down upon our group from the top step with a smile on his face. It looked as if he were saying, “Look at those people down there, they look just like ants.” I wondered if he was counting hats. | {
"pile_set_name": "Pile-CC"
} |
204 B.R. 18 (1997)
In re KELLY FOOD PRODUCTS, INC., Debtor.
G & G SALES CORPORATION, Plaintiff,
v.
KELLY FOOD PRODUCTS, INC., Defendant.
RED RIVER VALLEY POTATO MARKETING ASSOCIATION, Plaintiff,
v.
KELLY FOOD PRODUCTS, INC., Defendant.
Bankruptcy Case No. 96-72781, Adversary Nos. 96-7198, 96-7199.
United States Bankruptcy Court, C.D. Illinois.
January 10, 1997.
*19 Richard P. Klaus, Champaign, IL, for G & G Sales.
Stephen P. McCarron, Louis W. Diess, III, Washington, DC, for Red River Valley.
Barry M. Barash, Galesburg, IL, for Debtor.
Timothy J. Howard, Peoria, IL, for First of America Bank.
OPINION
LARRY L. LESSEN, Bankruptcy Judge.
The two issues before the Court are (i) the scope of protection provided by preserving the benefits of a PACA trust through the newly-authorized method of placing a statutorily-prescribed statement on a bill or invoice statement as opposed to preserving one's rights through the traditional written *20 notice, and (ii) whether a PACA statutory trust is a "true trust" or merely a disguised security agreement.
Kelly Food Products, Inc. ("Kelly") is a Chapter 11 Debtor-in-possession. First of America Bank-Illinois, N.A. ("FOA") is Kelly's largest secured creditor with a first priority security interest in virtually all of Kelly's assets, including inventory and accounts receivable. FOA currently holds approximately $330,000 of Kelly's cash assets, to which Plaintiffs claim they are entitled under the provisions of the Perishable Agricultural Commodities Act ("PACA"), 7 U.S.C. § 499e. FOA concedes that its first priority security interest in the subject $330,000 would be inferior to a valid PACA trust claim.
This matter is before the Court on Plaintiffs' Motion for Turnover wherein Plaintiffs assert that, as the only protected PACA claimants, they are entitled to have the $330,000 being held by FOA turned over to them. Kelly objects to the turnover, claiming that the funds are not PACA trust assets because the new method of preserving trust claims, through placing the prescribed language on the invoice or bill, limits the assets subject to the trust claims to the particular inventory and proceeds from their inventory which, Kelly further asserts (and is essentially conceded), are long gone. Kelly cites In re Zois, 201 B.R. 501 (Bankr.N.D.Ill.1996) for the proposition that the res of a PACA trust on perishable goods disappears as the perishable goods perish. Plaintiffs counter that the sole purpose and effect of the new subsection was to create another way for suppliers to preserve their rights in the trust and that the new subsection has no bearing on the nature or extent of the PACA trust.
PACA creates a non-segregated floating trust on perishable commodities that permits the commingling of trust assets without defeating the trust. In re Zois, supra at 509; Endico Potatoes, Inc. v. CIT Group/Factoring, Inc., 67 F.3d 1063, 1067 (2d Cir.1995); JSG Trading Corp. v. Tray-Wrap, Inc., 917 F.2d 75, 78 (2d Cir.1990). In order to preserve the trust, 7 U.S.C. § 499e(c)(3) requires that the seller give the purchaser written notice of intent to preserve the PACA trust benefits and file that notice with the Secretary of Agriculture within a prescribed period of time. The PACA notice must be in writing, state that it is a notice of intent to preserve PACA trust benefits and include certain prescribed information.
In November 15, 1995, 7 U.S.C. § 499e was amended to add subsection (c)(4), which provided an alternative method of preserving the benefits of the PACA trust. Under this amendment, a beneficiary may use ordinary and usual billing or invoice statements to provide notice of the supplier's intent to preserve the trust. To accomplish preservation of the trust benefits under this subsection, the bill or invoice must contain on its face the following language:
The perishable agricultural commodities listed on this invoice are sold subject to the statutory trust authorized by section 5(c) of the Perishable Agricultural Commodities Act, 1930 (7 U.S.C. 499e(c)). The seller of these commodities retains a trust claim over these commodities, all inventories of food or other products derived from these commodities, and any receivables or proceeds from the sale of these commodities until full payment is received.
7 U.S.C. § 499e(c)(4).
In this case, it is conceded that the Plaintiffs preserved their rights under the trust provisions of 7 U.S.C. § 499e(c) through the method set forth in subsection (c)(4) with the required language. Plaintiff G & G Sales Corporation ("G & G") asserts a PACA trust claim in the amount of $259,860.06 and Plaintiff Red River Valley Potato Marketing Association ("Red River") asserts a PACA trust claim is the amount of $181,455.03.
On the issue of the scope of the new method of trust preservation under PACA, this appears to be a question of first impression in the federal courts. While there is no judicial precedent interpreting this new subsection, the legislative history provides solid evidence of Congress' intent. H.R.Rep. No. 207, 104th Cong., 1st Sess., at 9 (1995) states in part as follows:
The amendments to the PACA trust provisions contained in this legislation are intended to strengthen and improve the operation of the trust and eliminate the *21 expense to USDA in administering these provisions. . . .
To enhance the operation of the trust, an alternate method of preserving trust benefits has been included in the bill. The current requirement to file a trust notice with the USDA is eliminated. Instead, the legislation makes clear that a licensee may use standard invoices or other billing statements to provide notice to the buyer of intent to preserve trust benefits . . .
Under current law, the trust is in effect at the time of shipment of the perishable commodity. The unpaid supplier, seller or agent must provide notice of trust coverage to the buyer in order to preserve these trust benefits. Consistent with this principle, this legislation, under paragraph 4 of section 5(c) of PACA, provides that the suppliers, seller, or agent may perfect its trust claim by giving notice to the buyer on the invoice or billing statement. This change to the Act provides both a convenience and cost savings to the unpaid supplier, seller or agent. The Committee intends the effect of notice provided through the use of usual billing or invoice statements to be the legal equivalent to the current practice of providing notice subsequent to the payment date by means independent of the billing statement or invoice. (Emphasis added).
It is quite clear that Congress' intent in adding § 499e(c)(4) was to provide a simpler and, for the government, a less expensive way for suppliers to preserve their trust rights. It is equally clear that Congress had no intent to redefine what constitutes the trust res under PACA. If Congress had intended to redefine or limit the trust res, it could have and should have amended § 499e(c)(2), which defines trust res, rather than dealing with the issue in a subsection relating only to preservation. In addition, the last sentence of the legislative history set forth above is very clear about the effect of the amendment it says that the new method of trust preservation is the legal equivalent of the then current practice of filing notice set forth in subsection (c)(3). It says nothing about providing lesser or different protection through the new alternative manner of preservation. Clearly, if it had been Congress' intent to do what Kelly has asserted, the legislative history would not say that the new method of trust preservation is the legal equivalent of filing notice; moreover, the statute, or at least the legislative history, would have explicitly stated that the alternative method of preservation, though available, provides much more limited protection to suppliers. In fact, in the context of perishable agricultural commodities, the protection provided by § 499e(c)(4) under Kelly's interpretation would be so fleeting as to be virtually meaningless in many contexts where the useful life of the products is only a matter of days. Virtually no informed perishable commodity supplier would use § 499e(c)(4) because of the greatly reduced benefit as compared to the traditional manner of preservation and corresponding trust. Finally, if Kelly's position were correct, Congress would have set a dangerous (and well-camouflaged) trap for unwary sellers with its 1995 amendment, completely undercutting the purpose of PACA, which was enacted to protect such sellers.
Kelly's reliance on In re Zois, supra, in support of its position is misplaced. Kelly accurately cites Zois for the holding that a PACA trust res consisting of perishable goods disappears as the perishable goods perish. However, this holding does not purport to define or limit the scope of a PACA trust res or alter how a supplier avails itself of PACA protection; in fact, Judge Schmetterer's opinion in Zois is in accord with other published precedent on the issues of what constitutes the res of a PACA trust and how a supplier protects its interest in the trust. Zois acknowledges that "(t)here is no necessity to specifically identify all of the trust assets through each step of the asset accrual and disposal process. Since commingling is contemplated, all trust assets would be subject to the claims of unpaid seller-suppliers and agents to the extent of the amount owed them." Zois, supra at 509, citing H.R.Rep. No. 98-543 (1983), reprinted in 1984 U.S.C.C.A.N. 405. In addition, Zois acknowledges that a "PACA (t)rust consists of perishable goods, products derived from those goods, and all receivables or proceeds from the sale of those goods." Zois, supra *22 at 508, citing 7 U.S.C.A. § 499e(c)(2). Accordingly, the fact that Zois recognizes that a PACA trust res may diminish through both liquidation and rotting does little to advance Kelly's position.
The second question raised is Kelly's interest in the subject $330,000. Kelly asserts that it has an interest in the funds superior to that of FOA by virtue of the trustee's strong-arm powers under 11 U.S.C. § 551, which Kelly may exercise as a debtor-in-possession pursuant to 11 U.S.C. § 1107(a). However, Kelly concedes that it has no strong-arm powers if the $330,000 is subject to a "true trust"; Kelly argues that the PACA trust is not a "true trust", but is more like a "floating lien" or a "disguised security agreement" under the Uniform Commercial Code. Defendant's Points & Authorities, pp. 5-6. Plaintiffs counter that the PACA trust is a "true trust" and, such being the case, Kelly has no interest in the funds and, consequently, no standing to object to the Motion for Turnover.
On the question of whether the PACA trust is a "true trust", the federal courts have unanimously answered the question in the affirmative. See Matter of Snyder, 184 B.R. 473, 475 (D.Md.1995) (the PACA trust satisfies all of the requirements of an express trust); In re Harper, 150 B.R. 416, 418-19 (Bankr.E.D.Tenn.1993) (PACA trust satisfies express trust requirements); In re Nix, 1992 WL 119143, p. 9. (M.D.Ga.) (PACA creates a true trust). Kelly failed to provide, and this Court was unable to find, any case which held that the PACA trust was anything other than a "true trust". Accordingly, Kelly's theory, though innovative, is without any precedential support and hence must be rejected.
To summarize, the subject $330,000 is not subject to Kelly's strong-arm powers pursuant to 11 U.S.C. § 551 because it has been properly preserved in a PACA trust, which the Court finds to be a true trust and not a disguised security agreement. Hence, Kelly, by its own admission, has no interest in the $330,000 in the hands of FOA. Even if it had been determined that Kelly had an interest in the funds, the Court finds that, by properly preserving their trust claims pursuant to 7 U.S.C. § 499e(c)(4), Plaintiffs' trust claims are not limited only to receivables attributable to the specific goods described in their invoices, but rather extend to the subject $330,000 as well.
As stated above, G & G asserts a PACA trust claim in the amount of $259,860.06 and Red River's PACA trust claim is for $181,455.03. Hence, the aggregate amount of valid PACA trust claims is $441,315.09. Plaintiffs and FOA have previously agreed that $20,000 of the available funds should be held back for future administrative costs in collecting accounts receivable, leaving approximately $310,000 available for distribution to valid PACA trust claimants. As G & G's trust claim constitutes 58.88311% of the total valid trust claims, G & G is entitled to 58.88311% of the funds collected by FOA (less $20,000 holdback), or approximately $182,537.64 ($310,000 × .5888311). Red River's claim is 41.11689% of the total valid trust claims; hence Red River is entitled to 41.11689% of the funds collected by FOA (less $20,000 holdback), or approximately $127,462.36 ($310,000 × .4111689).
For the reasons set forth above, Plaintiffs' Motion for Emergency Relief and Immediate Turnover of Trust Funds is granted.
This Opinion is to serve as Findings of Fact and Conclusions of Law pursuant to Rule 7052 of the Rules of Bankruptcy Procedure.
| {
"pile_set_name": "FreeLaw"
} |
Check out our new site Makeup Addiction
add your own caption
add your own caption
add your own caption
add your own caption
add your own caption
add your own caption
add your own caption
add your own caption
add your own caption
add your own caption
add your own caption
Asks girlfriend to have sex "yeah, after this game of halo." | {
"pile_set_name": "OpenWebText2"
} |
Post navigation
We have our new work for October’s workshop! David Gaukroger is busy producing the music for his new children’s opera which we expect to become as popular as Romany Wood.
We are privileged to to have the first performance and are proud to know that the last Festival’s Romany Wood workshop – notably the children’s orchestra (a first in itself) – was the inspiration for this new work.
We will have lots of fun (and hard work) with Rebecca’s World which the three primary school orchestras will start work on immediately. The choir contingent will begin towards the end of term.
The Irfon Valley School Orchestra is under way and, unusually, rehearses in school time so it is not competing with lunchtime play. It is already booked for the Festival Holy Saturday concert.
David Gaukroger (composer of Romany Wood) is working on a new composition for children’s orchestra and choir after being inspired by the children’s orchestra brought together for 2014’s Romany Wood at Garth Village Hall.
Holy Saturday (4 April) will be inspired by the Chaos and Creation elements of Haydn’s Creation Oratorio and we will be joined by Irfon Valley School Orchestra.
The Festival is scheduled for 2-4 October (a week earlier than usual) and we will move the children’s workshop (with the new work by David Gaukroger) to Sunday and have the Mervyn Bourdillon Memorial Concert on Saturday Evening.
Gareth Cornelius (head teacher of Irfon Valley Primary School) has given the go ahead for a lunchtime school orchestra, starting after Christmas. Irfon Valley will join Llanelwedd and Builth Primaries in providing an ensemble for all the children learning orchestral instruments. See the projects page for more details.
The festival plans to bring these groups together in future events.
We thank South Powys Youth Music (SPYM) who, in recognition of our work in encouraging primary ensembles and similar projects, is providing financial support.
The performance of Haydn’s Seven Last Words Quartets at Beulah Chapel on Holy Saturday was accompanied by readings, poetry and songs on the theme of Remembering 1914. There was a small exhibition of memorabilia and a thematic image was projected for each word.
All the proceeds, amounting to £105.20 were donated to Help for Heroes.
We are pleased to announce that this celebrated men’s choir will join us in the Mervyn Bourdillon Memorial Concert on 12 October at Eglwys Oen Duw. The programme will include orchestral pieces from the Festival Ensemble and will be finalised as soon as possible. | {
"pile_set_name": "Pile-CC"
} |
Q:
How do I remove all headers from a CURL Post
I am trying to post xml to a server using cURL without any headers but I can't seem to get rid of the following headers:
Content-Disposition: form-data; name="data"; filename="tempData.xml".
Does anyone know how to remove these headers and just send the file?
Code is below:
$URL = www.myurl.com/process/php;
//get post data
$post = array("data"=>"@tempData.xml");
//add headers
/*$Headers = array
( "POST HTTP/1.0"
, "Accept: text/xml"
, "Content-type: text/xml"
);*/
//$Headers = array("");
//create curl instance and set options
$CH = curl_init($URL);
curl_setopt( $CH, CURLOPT_TIMEOUT, 60 ); //timeout after 60 seconds
curl_setopt( $CH, CURLOPT_SSL_VERIFYPEER, false);
curl_setopt( $CH, CURLOPT_SSL_VERIFYHOST, false);
curl_setopt( $CH, CURLOPT_HTTPHEADER, 0);
curl_setopt( $CH, CURLOPT_HEADER, 0);
curl_setopt( $CH, CURLOPT_POST, true );
curl_setopt( $CH, CURLOPT_POSTFIELDS, $post ); // add post fields
//echo curl_error($CH);
$output = curl_exec( $CH );
$info = curl_getinfo( $CH );
//print_r($info);
if($info['http_code'] != 200){
//header('HTTP/1.0 500 Could Not Send XML');
echo 'error ' . $info["http_code"];
curl_close($CH);
exit(1);
}
curl_close($CH)
;
A:
It isn't really possible if done like this.
When you select to do a multipart formpost with libcurl, it will actually do a formpost according to the spec. It was originally specified in RFC1867, and it did already then specify that the Content-Disposition: should be there for each form part.
If you want to do your own non-compliant post, then craft your own buffer completely instead of relying on libcurl's multipart formpost support.
Let me end up with saying that your commented out code that specifies custom headers is wrong since it includes a request line among the headers.
| {
"pile_set_name": "StackExchange"
} |
Q:
load an object twice and change one of them, the other one doesnt changed
Father father = BL.GetFatherById(1);
Product product = BL.GetByID(123);
(father.Products[553] == product)
product.delete = true;
father.Products[553].delete == false !!??
why is that ?
aren't they connected ?? its the same object.
A:
As you can read in section 10.3 of the NHibernate reference manual database identity and CLR object identity are equivalent per session.
Therefore Object.ReferenceEquals(foo, bar) will yield true if and only if foo and bar are attached to the same session and map to the same database row. Be careful when using == for comparing object identity - the operator may have been overloaded (but you should usually know that).
In consequence you should always get the same object no matter what query you use for the object as long as you stay within the same session. Are you using multiple sessions? Maybe a Unit of Work pattern and you are comparing objects returned from to different units of work?
| {
"pile_set_name": "StackExchange"
} |
In the course of daily life, one typically regards objects located at different distances from the eye. To selectively focus on such objects, the focal length of the eye's lens must change. In a healthy eye, this is achieved through the contraction of a ciliary muscle that is mechanically coupled to the lens. To the extent that the ciliary muscle contracts, it deforms the lens. This deformation changes the focal length of the lens. By selectively deforming the lens in this manner, it becomes possible to focus on objects that are at different distances from the eye. This process of selectively focusing on objects at different distances is referred to as “accommodation”.
As a person ages, the lens loses plasticity. As a result, it becomes increasingly difficult to deform the lens sufficiently to focus on objects at different distances. To compensate for this loss of function, it is necessary to provide different optical corrections for focusing on objects at different distances.
One approach to applying different optical corrections is to carry different pairs of glasses and to swap glasses as the need arises. For example, one might carry reading glasses for reading and a separate pair of distance glasses for driving. This is inconvenient both because of the need to carry more than one pair of glasses and because of the need to swap glasses frequently.
Bifocal lenses assist accommodation by integrating two different optical corrections onto the same lens. The lower part of the lens is ground to provide a correction suitable for reading or other close-up work while the remainder of the lens is ground to provide a correction for distance vision. To regard an object, a wearer of a bifocal lens need only maneuver the head so that rays extending between the object-of-regard and the pupil pass through that portion of the bifocal lens having an optical correction appropriate for the range to that object.
The concept of a bifocal lens, in which different optical corrections are integrated into the same lens, has been generalized to include trifocal lenses, in which three different optical corrections are integrated into the same lens, and continuous gradient lenses in which a continuum of optical corrections are integrated into the same lens. However, just as in the case of bifocal lenses, optical correction for different ranges of distance using these multifocal lenses relies extensively on relative motion between the pupil and the lens.
Once a lens is implanted in the eye, the lens and the pupil move together as a unit. Thus, no matter how the patient's head is tilted, rays extending between the object-of-regard and the pupil cannot be made to pass through a selected portion of the implanted lens. As a result, multifocal lenses are generally unsuitable for intraocular implantation because once the lens is implanted into the eye, there can be no longer be relative motion between the lens and the pupil.
A lens suitable for intraocular implantation is therefore generally restricted to being a single focus lens. Such a lens can provide optical correction for only a single range of distances. A patient who has had such a lens implanted into the eye must therefore continue to wear glasses to provide optical corrections for those distances that are not accommodated by the intraocular lens. | {
"pile_set_name": "USPTO Backgrounds"
} |
Elenski but
Elenski but ( or (more precisely but less commonly) , sometimes translated as Elena round or Elena leg) is a dry-cured ham from the town of Elena in northern Bulgaria and a popular delicacy throughout the country. The meat has a specific taste and can be preserved in the course of several years, owing much to the special process of making and the climatic conditions of the part of Stara Planina where Elena is located.
Preparation
The legs and quarters of the pig, traditionally singed and scraped, are taken from the body. Later the redundant parts are removed, so that the remaining meat is protected by hide or the skin that surrounds the muscle tissue. After the legs are shaped, they are well salted and put at the bottom of a postav, a special type of barrel designed for the occasion. The delicacy traditionally remains in salt for 40 days, then is taken out and left to dry.
Preservation technologies
There are various preservation technologies used to prepare elenski but these typically vary considerably from family to family, as opposed to regionally. In the past, the rounds were put in well trampled upon maize meal or processed with lime milk. The meat could also be stored in specially sewn bags of cheesecloth or wooden containers with thick nets instead of walls (muharnik), but as a rule were placed somewhere airy, where the clear mountain air could aid the drying and conservation, and also in order to prevent houseflies laying eggs on the rounds.
In many of the small towns around Elena, the rounds were in the past left in conservation in the rooms where the daily house fire was lit, so that a certain amount of smoking could be achieved in order to add smoked flavour.
See also
Prosciutto and Jamón serrano, similar delicacies
Bulgarian cuisine
List of hams
List of dried foods
List of smoked foods
Notes
External links
Short Journey.bg article on elenski but, featuring a couple of pictures
Category:Bulgarian cuisine
Category:Balkan mountains
Category:Ham
Category:Dried meat
Category:Smoked meat | {
"pile_set_name": "Wikipedia (en)"
} |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.