code
stringlengths
22
1.05M
apis
listlengths
1
3.31k
extract_api
stringlengths
75
3.25M
#!/usr/bin/python #https://github.com/mitsuhiko/flask/tree/master/examples/flaskr from flask import Flask, render_template, session, redirect, url_for, \ request, flash from utils.logger import Logger from query.query_parser import QueryParser from db.mongodb import MongoDB from pager import Pager import pymongo, ConfigParser from datetime import datetime #from werkzeug.security import check_password_hash, generate_password_hash app = Flask(__name__) logger = Logger().getLogger("web.events") config = ConfigParser.ConfigParser() parser = QueryParser() db = MongoDB('esm') page_size = 25 quest_dict = {} app.secret_key = '^\<KEY>' def get_users(user_name): cursor = db.get_user(user_name) users = {} for u in cursor: users[u['username']] = u['password'] return users @app.route('/') def index(): if not 'user_id' in session: return redirect('/login') else: return redirect('/event') @app.route('/login', methods=['POST', 'GET']) def login(): error = None if request.method == 'POST': username = request.form['username'] password = request.form['password'] users = get_users(username) if not users.has_key(username) : error = 'Invalid username' elif password != users[username]: logger.debug('pwd is ' + password) error = 'Invalid password' else: session['user_id'] = username flash('You were logged in') # return redirect(url_for('event')) return redirect('/event') # the code below this is executed if the request method # was GET or the credentials were invalid return render_template('login.tpl', error=error) @app.route('/logout') def logout(): """Logs the user out.""" flash('You were logged out') session.pop('user_id', None) return redirect(url_for('login')) @app.route('/help') def help_controller(): return render_template('help.tpl') @app.route('/event', methods=['GET']) def events_default_controller(page_num=1): if not 'user_id' in session: return redirect('/login') else: if 'event_query' in session: session['event_query'] = None events = get_events(page_size, 1, {}) pager = Pager(page_size, count_events({}), 1) return render_template('events.tpl', events = events, pager = pager) def count_events(query): return db.count("events", query) def get_events(size, page, query): event_cursor = db.find('events',size, page, 'create_time',pymongo.DESCENDING, query) events = [] i = size * (page - 1) + 1 for e in event_cursor: event = {} event['index'] = i event['time'] = e.get('create_time').strftime("%Y-%m-%dT%H:%M:%SZ") event['domain'] = e.get('domain') event['ip'] = e.get('ip') event['size'] = e.get('size') events.append(event) i += 1 return events @app.route('/event/<int:page>', methods=['GET']) def events_page_controller(page=1): '''Controller to initialize the quest Form''' if not 'user_id' in session: return redirect('/login') else: if 'event_query' in session: query_string = session['event_query'] if query_string is not None and len(query_string) > 0: query = parser.parse(query_string) logger.debug('query_string=' + query_string) else: session['event_query'] = None query = {} else: query = {} events = get_events(page_size, page, query) pager = Pager(page_size, count_events(query), page) return render_template('events.tpl', events = events, pager = pager) @app.route('/event', methods=['POST']) def events_form_controller(): if not 'user_id' in session: return redirect('/login') else: query_string = request.form['event_query'].strip() if query_string is not None and len(query_string) > 0: session['event_query'] = query_string query = parser.parse(query_string) logger.debug('query_string=' + query_string) else: query = {} events = get_events(page_size, 1, query) pager = Pager(page_size, count_events(query), 1) return render_template('events.tpl', events = events, pager = pager) @app.route('/stat', methods=['GET']) def stat_form_controller(): '''Controller to initialize the statistics Form''' if not 'user_id' in session: return redirect('/login') else: #default statics is current day's statistics current_date = datetime.now().strftime("%Y-%m-%d") stat_quest = 'time in ' + current_date db_query = parser.parse(stat_quest) logger.debug(db_query) stats = get_stats(db_query) logger.debug(stats) return render_template('stat.tpl', stats = stats, time = current_date) @app.route('/monthly', methods=['GET']) def stat_monthly_controller(): '''Controller to initialize the statistics Form''' if not 'user_id' in session: return redirect('/login') else: #default statics is current day's statistics current_month = datetime.now().strftime("%Y-%m") stat_quest = 'time in ' + current_month db_query = parser.parse(stat_quest) logger.debug(db_query) stats = get_stats(db_query) # logger.debug(stats) # stats = [] return render_template('stat.tpl', stats = stats, time = current_month) def get_stats(query): stats_cursor = db.countSize('events',query) stats = [] for s in stats_cursor: stat = {} stat['ip'] = s.get('ip') stat['size'] = s.get('size') stats.append(stat) return stats @app.route('/stat', methods=['POST']) def stat_controller(): '''Controller to initialize the statistics Form''' if not 'user_id' in session: return redirect('/login') else: stat_quest = request.form['stat_query'].strip() #default statics is current day's statistics db_query = parser.parse(stat_quest) logger.debug(db_query) stats = get_stats(db_query) return render_template('stat.tpl', stats = stats) if __name__ == '__main__': app.run(host='0.0.0.0', port=8080, debug=True)
[ "db.mongodb.MongoDB", "flask.flash", "flask.session.pop", "flask.redirect", "flask.Flask", "query.query_parser.QueryParser", "flask.url_for", "utils.logger.Logger", "flask.render_template", "ConfigParser.ConfigParser", "datetime.datetime.now" ]
[((445, 460), 'flask.Flask', 'Flask', (['__name__'], {}), '(__name__)\n', (450, 460), False, 'from flask import Flask, render_template, session, redirect, url_for, request, flash\n'), ((512, 539), 'ConfigParser.ConfigParser', 'ConfigParser.ConfigParser', ([], {}), '()\n', (537, 539), False, 'import pymongo, ConfigParser\n'), ((550, 563), 'query.query_parser.QueryParser', 'QueryParser', ([], {}), '()\n', (561, 563), False, 'from query.query_parser import QueryParser\n'), ((569, 583), 'db.mongodb.MongoDB', 'MongoDB', (['"""esm"""'], {}), "('esm')\n", (576, 583), False, 'from db.mongodb import MongoDB\n'), ((1691, 1732), 'flask.render_template', 'render_template', (['"""login.tpl"""'], {'error': 'error'}), "('login.tpl', error=error)\n", (1706, 1732), False, 'from flask import Flask, render_template, session, redirect, url_for, request, flash\n'), ((1803, 1831), 'flask.flash', 'flash', (['"""You were logged out"""'], {}), "('You were logged out')\n", (1808, 1831), False, 'from flask import Flask, render_template, session, redirect, url_for, request, flash\n'), ((1836, 1864), 'flask.session.pop', 'session.pop', (['"""user_id"""', 'None'], {}), "('user_id', None)\n", (1847, 1864), False, 'from flask import Flask, render_template, session, redirect, url_for, request, flash\n'), ((1958, 1985), 'flask.render_template', 'render_template', (['"""help.tpl"""'], {}), "('help.tpl')\n", (1973, 1985), False, 'from flask import Flask, render_template, session, redirect, url_for, request, flash\n'), ((470, 478), 'utils.logger.Logger', 'Logger', ([], {}), '()\n', (476, 478), False, 'from utils.logger import Logger\n'), ((887, 905), 'flask.redirect', 'redirect', (['"""/login"""'], {}), "('/login')\n", (895, 905), False, 'from flask import Flask, render_template, session, redirect, url_for, request, flash\n'), ((931, 949), 'flask.redirect', 'redirect', (['"""/event"""'], {}), "('/event')\n", (939, 949), False, 'from flask import Flask, render_template, session, redirect, url_for, request, flash\n'), ((1885, 1901), 'flask.url_for', 'url_for', (['"""login"""'], {}), "('login')\n", (1892, 1901), False, 'from flask import Flask, render_template, session, redirect, url_for, request, flash\n'), ((2116, 2134), 'flask.redirect', 'redirect', (['"""/login"""'], {}), "('/login')\n", (2124, 2134), False, 'from flask import Flask, render_template, session, redirect, url_for, request, flash\n'), ((2344, 2401), 'flask.render_template', 'render_template', (['"""events.tpl"""'], {'events': 'events', 'pager': 'pager'}), "('events.tpl', events=events, pager=pager)\n", (2359, 2401), False, 'from flask import Flask, render_template, session, redirect, url_for, request, flash\n'), ((3163, 3181), 'flask.redirect', 'redirect', (['"""/login"""'], {}), "('/login')\n", (3171, 3181), False, 'from flask import Flask, render_template, session, redirect, url_for, request, flash\n'), ((3722, 3779), 'flask.render_template', 'render_template', (['"""events.tpl"""'], {'events': 'events', 'pager': 'pager'}), "('events.tpl', events=events, pager=pager)\n", (3737, 3779), False, 'from flask import Flask, render_template, session, redirect, url_for, request, flash\n'), ((3906, 3924), 'flask.redirect', 'redirect', (['"""/login"""'], {}), "('/login')\n", (3914, 3924), False, 'from flask import Flask, render_template, session, redirect, url_for, request, flash\n'), ((4378, 4435), 'flask.render_template', 'render_template', (['"""events.tpl"""'], {'events': 'events', 'pager': 'pager'}), "('events.tpl', events=events, pager=pager)\n", (4393, 4435), False, 'from flask import Flask, render_template, session, redirect, url_for, request, flash\n'), ((4614, 4632), 'flask.redirect', 'redirect', (['"""/login"""'], {}), "('/login')\n", (4622, 4632), False, 'from flask import Flask, render_template, session, redirect, url_for, request, flash\n'), ((4956, 5015), 'flask.render_template', 'render_template', (['"""stat.tpl"""'], {'stats': 'stats', 'time': 'current_date'}), "('stat.tpl', stats=stats, time=current_date)\n", (4971, 5015), False, 'from flask import Flask, render_template, session, redirect, url_for, request, flash\n'), ((5195, 5213), 'flask.redirect', 'redirect', (['"""/login"""'], {}), "('/login')\n", (5203, 5213), False, 'from flask import Flask, render_template, session, redirect, url_for, request, flash\n'), ((5557, 5617), 'flask.render_template', 'render_template', (['"""stat.tpl"""'], {'stats': 'stats', 'time': 'current_month'}), "('stat.tpl', stats=stats, time=current_month)\n", (5572, 5617), False, 'from flask import Flask, render_template, session, redirect, url_for, request, flash\n'), ((6037, 6055), 'flask.redirect', 'redirect', (['"""/login"""'], {}), "('/login')\n", (6045, 6055), False, 'from flask import Flask, render_template, session, redirect, url_for, request, flash\n'), ((6301, 6341), 'flask.render_template', 'render_template', (['"""stat.tpl"""'], {'stats': 'stats'}), "('stat.tpl', stats=stats)\n", (6316, 6341), False, 'from flask import Flask, render_template, session, redirect, url_for, request, flash\n'), ((1461, 1488), 'flask.flash', 'flash', (['"""You were logged in"""'], {}), "('You were logged in')\n", (1466, 1488), False, 'from flask import Flask, render_template, session, redirect, url_for, request, flash\n'), ((1555, 1573), 'flask.redirect', 'redirect', (['"""/event"""'], {}), "('/event')\n", (1563, 1573), False, 'from flask import Flask, render_template, session, redirect, url_for, request, flash\n'), ((4719, 4733), 'datetime.datetime.now', 'datetime.now', ([], {}), '()\n', (4731, 4733), False, 'from datetime import datetime\n'), ((5301, 5315), 'datetime.datetime.now', 'datetime.now', ([], {}), '()\n', (5313, 5315), False, 'from datetime import datetime\n')]
from rasa.nlu.convert import convert_training_data convert_training_data(data_file="./input.json", out_file="./nlu.md", output_format="md", language="")
[ "rasa.nlu.convert.convert_training_data" ]
[((51, 156), 'rasa.nlu.convert.convert_training_data', 'convert_training_data', ([], {'data_file': '"""./input.json"""', 'out_file': '"""./nlu.md"""', 'output_format': '"""md"""', 'language': '""""""'}), "(data_file='./input.json', out_file='./nlu.md',\n output_format='md', language='')\n", (72, 156), False, 'from rasa.nlu.convert import convert_training_data\n')]
import re import string years = [str(x) for x in range(1990, 2200)] number_re = re.compile(r'^\-?[0-9]*\.?[0-9]*$') regex_trailing_As = re.compile(r'(?:\s*A\s*)*$') regex_punctuation = '' for c in string.punctuation: regex_punctuation += f'\\{c}' split_using_punctuation_re = re.compile(r'\w+|' + f'{regex_punctuation}') def split_using_punctuation(s): return list(map(str.strip, split_using_punctuation_re.findall(s))) def number(text): if len(text) == 1 and text[0] == '-': return False return number_re.search(text) is not None def remove_bad_endings(text): s = text bad_endings = ['\n', '%'] while len(s) > 0 and s[-1] in bad_endings: s = s[:-1] # if len(s) < len(text): # print(f' {text} => {s}') return s def filter_bad_tokens(text): if text is None or len(text) == 0 or len(text.strip()) == 0: return False return True def remove_single_nonletters(text): text = text.strip() if (len(text) == 1) and \ (text[0] == '$'): return None else: return text def amount(text): negative = False # If a column heading contains a comma, # ex. "Dec 31,", then this is a problem # since each word is considered separately. # Remove commas only when they appear # within the word and not after it. # This way ex. 33,256,192 is valid. if text[-1:] == ',': return None if len(text) == 1 and text[0] == '.': return None if '(' in text: negative = True text = text.strip() \ .replace('(', '') \ .replace(',', '') \ .replace(')', '') \ .replace('%', '') if len(text) == 0: return None if not number(text): return None # Check if text is single . after the strip # has changed it's length if len(text) == 1 and text[0] == '.': return None value = float(text) if negative: return -value else: return value def row_headings(text): if len(text) == 1 and text[0] in '$%)()—': return None num_digits_in_text = len(list(filter(str.isdigit, text))) num_chars_in_text = len(text) if num_chars_in_text > 0 and \ (num_chars_in_text - num_digits_in_text)/num_chars_in_text > 0.5: return text else: return None def year(text): if text in years: return int(text) else: return None def remove_all_trailing_As(row_headings): return row_headings.transform(lambda x: regex_trailing_As.sub('', x)) def remove_nonascii_chars(str): MAX_ASCII_VALUE = 127 def replace_nonascii(c): if ord(c) > MAX_ASCII_VALUE: return ' ' else: return c result = ''.join(map(replace_nonascii, list(str))) return result
[ "re.compile" ]
[((82, 118), 're.compile', 're.compile', (['"""^\\\\-?[0-9]*\\\\.?[0-9]*$"""'], {}), "('^\\\\-?[0-9]*\\\\.?[0-9]*$')\n", (92, 118), False, 'import re\n'), ((138, 167), 're.compile', 're.compile', (['"""(?:\\\\s*A\\\\s*)*$"""'], {}), "('(?:\\\\s*A\\\\s*)*$')\n", (148, 167), False, 'import re\n'), ((283, 327), 're.compile', 're.compile', (["('\\\\w+|' + f'{regex_punctuation}')"], {}), "('\\\\w+|' + f'{regex_punctuation}')\n", (293, 327), False, 'import re\n')]
import numpy as np import matplotlib.pyplot as plt import cv2 import sys # read the image image = cv2.imread(sys.argv[1]) # convert to grayscale grayscale = cv2.cvtColor(image, cv2.COLOR_BGR2GRAY) # perform edge detection edges = cv2.Canny(grayscale, 30, 100) # detect lines in the image using hough lines technique lines = cv2.HoughLinesP(edges, 1, np.pi/180, 60, np.array([]), 50, 5) # iterate over the output lines and draw them for line in lines: for x1, y1, x2, y2 in line: cv2.line(image, (x1, y1), (x2, y2), color=(20, 220, 20), thickness=3) # show the image plt.imshow(image) plt.show()
[ "cv2.line", "cv2.Canny", "matplotlib.pyplot.show", "cv2.cvtColor", "matplotlib.pyplot.imshow", "cv2.imread", "numpy.array" ]
[((105, 128), 'cv2.imread', 'cv2.imread', (['sys.argv[1]'], {}), '(sys.argv[1])\n', (115, 128), False, 'import cv2\n'), ((168, 207), 'cv2.cvtColor', 'cv2.cvtColor', (['image', 'cv2.COLOR_BGR2GRAY'], {}), '(image, cv2.COLOR_BGR2GRAY)\n', (180, 207), False, 'import cv2\n'), ((245, 274), 'cv2.Canny', 'cv2.Canny', (['grayscale', '(30)', '(100)'], {}), '(grayscale, 30, 100)\n', (254, 274), False, 'import cv2\n'), ((605, 622), 'matplotlib.pyplot.imshow', 'plt.imshow', (['image'], {}), '(image)\n', (615, 622), True, 'import matplotlib.pyplot as plt\n'), ((624, 634), 'matplotlib.pyplot.show', 'plt.show', ([], {}), '()\n', (632, 634), True, 'import matplotlib.pyplot as plt\n'), ((384, 396), 'numpy.array', 'np.array', (['[]'], {}), '([])\n', (392, 396), True, 'import numpy as np\n'), ((514, 583), 'cv2.line', 'cv2.line', (['image', '(x1, y1)', '(x2, y2)'], {'color': '(20, 220, 20)', 'thickness': '(3)'}), '(image, (x1, y1), (x2, y2), color=(20, 220, 20), thickness=3)\n', (522, 583), False, 'import cv2\n')]
import torch a = torch.cuda.is_available() print (a)
[ "torch.cuda.is_available" ]
[((17, 42), 'torch.cuda.is_available', 'torch.cuda.is_available', ([], {}), '()\n', (40, 42), False, 'import torch\n')]
import tensorflow from tensorflow.keras.datasets import cifar10 from tensorflow import keras import numpy as np num_classes = 10 class EvalDataset(object): def __init__(self, batch_size=100): (x_train, y_train), (x_test, y_test) = cifar10.load_data() x_train = x_train.astype('float32') / 255 x_test = x_test.astype('float32') / 255 # If subtract pixel mean is enabled x_train_mean = np.mean(x_train, axis=0) x_train -= x_train_mean x_test -= x_train_mean # Convert class vectors to binary class matrices. y_train = tensorflow.keras.utils.to_categorical(y_train, num_classes) y_test = tensorflow.keras.utils.to_categorical(y_test, num_classes) self.test_images = x_test self.test_labels = y_test def __len__(self): return len(self.test_images) def __getitem__(self, idx): return self.test_images[idx], self.test_labels[idx] from neural_compressor.experimental import Benchmark, common evaluator = Benchmark('benchmark.yaml') evaluator.model = common.Model('./baseline_model') evaluator.b_dataloader = common.DataLoader(EvalDataset()) evaluator('performance')
[ "tensorflow.keras.utils.to_categorical", "neural_compressor.experimental.Benchmark", "tensorflow.keras.datasets.cifar10.load_data", "neural_compressor.experimental.common.Model", "numpy.mean" ]
[((1031, 1058), 'neural_compressor.experimental.Benchmark', 'Benchmark', (['"""benchmark.yaml"""'], {}), "('benchmark.yaml')\n", (1040, 1058), False, 'from neural_compressor.experimental import Benchmark, common\n'), ((1077, 1109), 'neural_compressor.experimental.common.Model', 'common.Model', (['"""./baseline_model"""'], {}), "('./baseline_model')\n", (1089, 1109), False, 'from neural_compressor.experimental import Benchmark, common\n'), ((246, 265), 'tensorflow.keras.datasets.cifar10.load_data', 'cifar10.load_data', ([], {}), '()\n', (263, 265), False, 'from tensorflow.keras.datasets import cifar10\n'), ((433, 457), 'numpy.mean', 'np.mean', (['x_train'], {'axis': '(0)'}), '(x_train, axis=0)\n', (440, 457), True, 'import numpy as np\n'), ((598, 657), 'tensorflow.keras.utils.to_categorical', 'tensorflow.keras.utils.to_categorical', (['y_train', 'num_classes'], {}), '(y_train, num_classes)\n', (635, 657), False, 'import tensorflow\n'), ((675, 733), 'tensorflow.keras.utils.to_categorical', 'tensorflow.keras.utils.to_categorical', (['y_test', 'num_classes'], {}), '(y_test, num_classes)\n', (712, 733), False, 'import tensorflow\n')]
# Copyright 2019-2020 Lawrence Livermore National Security, LLC and other # Archspec Project Developers. See the top-level COPYRIGHT file for details. # # SPDX-License-Identifier: (Apache-2.0 OR MIT) """Global objects with the content of the microarchitecture JSON file and its schema """ import json import os.path try: from collections.abc import MutableMapping # novm except ImportError: from collections import MutableMapping class LazyDictionary(MutableMapping): """Lazy dictionary that gets constructed on first access to any object key Args: factory (callable): factory function to construct the dictionary """ def __init__(self, factory, *args, **kwargs): self.factory = factory self.args = args self.kwargs = kwargs self._data = None @property def data(self): """Returns the lazily constructed dictionary""" if self._data is None: self._data = self.factory(*self.args, **self.kwargs) return self._data def __getitem__(self, key): return self.data[key] def __setitem__(self, key, value): self.data[key] = value def __delitem__(self, key): del self.data[key] def __iter__(self): return iter(self.data) def __len__(self): return len(self.data) def _load_json_file(json_file): json_dir = os.path.join(os.path.dirname(__file__), "..", "json", "cpu") json_dir = os.path.abspath(json_dir) def _factory(): filename = os.path.join(json_dir, json_file) with open(filename, "r") as file: return json.load(file) return _factory #: In memory representation of the data in microarchitectures.json, #: loaded on first access TARGETS_JSON = LazyDictionary(_load_json_file("microarchitectures.json")) #: JSON schema for microarchitectures.json, loaded on first access SCHEMA = LazyDictionary(_load_json_file("microarchitectures_schema.json"))
[ "json.load" ]
[((1616, 1631), 'json.load', 'json.load', (['file'], {}), '(file)\n', (1625, 1631), False, 'import json\n')]
#OUTDATED #The current version of this file uses full genes and not constructed genes #Finds nearest gene in domains that DHS intergenic site has membership in #domains_with_full_genes_#.csv generated from gene_analsysis.py #DHS_with_domains.csv generated in domain_analsysis.py #Exports DHS_#_nearest_full_gene_distance.csv import pandas as pd import math import time printed = False files = ['1', '2', '4', '8'] last_time = 0 for file in files: domains_with_genes = {} DHSs_with_domains = {} DHS_and_distance = [] DHSs = [] #path = "data/DHS_" + file + "_cell_with_domain.csv" #domain data doesn't have uniform columns printed = False path = "data/mm10_data/domains/domains_with_genes_" + file + ".csv" with open(path) as domain_genes: #split file into lines genes = [] lis = [line.split() for line in domain_genes] for bulk in lis: domain = None #Scope of the genes from the domain data #domain data and gene data is formatted: chr#:start-end #These features are being loaded from that format for domain_data in bulk: gene_list = [] domain_data = domain_data.split(',') #First element is domain id domain = domain_data[0] #All remaining elements are genes or empty space domain_removed = domain_data[4:] for element in domain_removed: #filter out empty space if len(element) > 0: genes.append(element) #Extract gene features and add to gene list for gene in genes: pre_chr = gene.split(':') chr = pre_chr[0] pre_loc = pre_chr[1] pre_start = pre_loc.split('-') start = pre_start[0] end = pre_start[1] #Append gene data to list of genes gene_list.append([chr, start, end, gene]) #Create domain dictionary entry with genes in its scope domains_with_genes[domain] = gene_list printed = False path = "data/mm10_data/domains/domains_with_DHSs_" + file + ".csv" with open(path) as DHS_domains: #split file into lines lis = [line.split() for line in DHS_domains] for bulk in lis: dhs_list = [] DHS_id = None #Scope of the domain data from the dhs data for DHS_data in bulk: DHS = [] data = DHS_data.split(',') domain_id = data[0] DHS_data = data[1:] for element in DHS_data: if len(element) > 0: DHSs.append(element) for dhs in DHSs: pre_chr = domain.split(':') chr = pre_chr[0] pre_loc = pre_chr[1] pre_start = pre_loc.split('-') start = pre_start[0] end = pre_start[1] dhs_list.append([chr, start, end, dhs]) DHSs_with_domains[domain_id] = dhs_list printed = False #Find the genes that the DHS site may interact with in the domain for domain in DHSs_with_domains.keys(): genes_in_domain = [] distances = [] on_left = [] on_right = [] DHS_matrix = [] gene_matrix = domains_with_genes[domain] for gene in gene_matrix: genes_in_domain.append(gene) for dhs in DHSs_with_domains.values(): DHS_matrix.append(dhs) for dhs_row in DHS_matrix: for dhs in dhs_row: start = int(dhs[1]) end = int(dhs[2]) id = dhs[3] #Find the center of the DHS site dhs_center = math.floor(( int(start) + int(end) ) / 2) for gene in genes_in_domain: if int(gene[2]) < dhs_center: on_left.append(gene) elif dhs_center < int(gene[1]): on_right.append(gene) for gene in on_left: dis = abs(start - int(gene[2])) distances.append(dis) for gene in on_right: dis = abs(int(gene[1]) - end) distances.append(dis) shortest_distance = min(distances) DHS_and_distance.append([id, shortest_distance]) #Export data Distance_df = pd.DataFrame(DHS_and_distance) path = "data/mm10_data/nearest_gene_in_domain/DHS_" + file + "_nearest_gene_in_domain_distance.csv" Distance_df.to_csv(path, index=False, header=False) time_to_complete = time.process_time() - last_time print("Time taken to process nearest genes for " + file + " cell: " + str(time_to_complete)) last_time = time_to_complete
[ "pandas.DataFrame", "time.process_time" ]
[((4567, 4597), 'pandas.DataFrame', 'pd.DataFrame', (['DHS_and_distance'], {}), '(DHS_and_distance)\n', (4579, 4597), True, 'import pandas as pd\n'), ((4781, 4800), 'time.process_time', 'time.process_time', ([], {}), '()\n', (4798, 4800), False, 'import time\n')]
## Read subset data .csv labels ## and get united filename-tokens format separated by comma for Word2Vec. import os import re import sys import warnings import numpy as np from PIL import Image from config import Config if __name__ == '__main__': SUBSET_LIST = ['deviantart_verified', 'wikiart_verified'] FRACTION = 1.0 ## To prepare smaller dataset, make 1.0 to take all if len(sys.argv) != 2: print("Usage: python {} <output_dir>".format(sys.argv[0])) exit() OUTPUT_DIR = sys.argv[1] os.makedirs(OUTPUT_DIR, exist_ok=True) OUTPUT_FILE = os.path.join(OUTPUT_DIR, 'all_labels.csv') if os.path.isfile(OUTPUT_FILE): print(OUTPUT_FILE, 'exists. Exiting.') exit() warnings.filterwarnings('error') config = Config() image_file_counter = 0 all_lines = [] for subset in SUBSET_LIST: labels_file = os.path.join(subset, 'labels.csv') if not os.path.isfile(labels_file): print(labels_file, 'not found. Passing') continue with open(labels_file, 'r') as f: lines = f.readlines() ## Fraction the lines lines = sorted(np.random.choice(lines, int(len(lines) * FRACTION), replace=False)) for line in lines: row = line.strip().split(',') image_filename = row[0] labels = row[1:] image_relative_file = os.path.join('data', subset, 'images', image_filename) ## Relative to project base image_file = os.path.abspath(os.path.join(__file__, os.path.pardir, os.path.pardir, image_relative_file)) ## Check image file existence if not os.path.isfile(image_file): continue ## Apply label conditions if len(labels) < config.MIN_SENTENCE_LENGTH or len(labels) > config.MAX_SENTENCE_LENGTH: continue ## Check image integrity try: img = Image.open(image_file) if img.mode != 'RGB': continue except (Exception, Warning) as e: print("Bad image", image_file, e) continue ## Apply image shape conditions w, h = img.size if w < config.MIN_IMAGE_WIDTH or w > config.MAX_IMAGE_WIDTH: continue if h < config.MIN_IMAGE_HEIGHT or w > config.MAX_IMAGE_HEIGHT: continue if max(w, h) / (min(w, h) + 1e-7) > config.MAX_ASPECT_RATIO: continue ## Normalize tokens label_sentence = str(' '.join(labels)) ## First column is image filename label_sentence = re.sub(r"[^A-Za-z0-9']+", " ", label_sentence).lower() ## Only alphanumeric characters label_sentence = re.sub(r"\b[a-zA-Z]\b", " ", label_sentence) ## Replace single letters label_sentence = re.sub(" ", " ", label_sentence) ## Go one space label_sentence = re.sub(" ", " ", label_sentence) ## Go one space label_sentence = label_sentence.replace(' ', ',') all_lines.append(image_relative_file + ',' + label_sentence + '\n') image_file_counter += 1 with open(OUTPUT_FILE, 'w') as f: f.writelines(all_lines) print(OUTPUT_FILE, 'was written with {} file'.format(image_file_counter))
[ "os.makedirs", "config.Config", "warnings.filterwarnings", "PIL.Image.open", "os.path.isfile", "os.path.join", "re.sub" ]
[((529, 567), 'os.makedirs', 'os.makedirs', (['OUTPUT_DIR'], {'exist_ok': '(True)'}), '(OUTPUT_DIR, exist_ok=True)\n', (540, 567), False, 'import os\n'), ((586, 628), 'os.path.join', 'os.path.join', (['OUTPUT_DIR', '"""all_labels.csv"""'], {}), "(OUTPUT_DIR, 'all_labels.csv')\n", (598, 628), False, 'import os\n'), ((636, 663), 'os.path.isfile', 'os.path.isfile', (['OUTPUT_FILE'], {}), '(OUTPUT_FILE)\n', (650, 663), False, 'import os\n'), ((732, 764), 'warnings.filterwarnings', 'warnings.filterwarnings', (['"""error"""'], {}), "('error')\n", (755, 764), False, 'import warnings\n'), ((779, 787), 'config.Config', 'Config', ([], {}), '()\n', (785, 787), False, 'from config import Config\n'), ((888, 922), 'os.path.join', 'os.path.join', (['subset', '"""labels.csv"""'], {}), "(subset, 'labels.csv')\n", (900, 922), False, 'import os\n'), ((939, 966), 'os.path.isfile', 'os.path.isfile', (['labels_file'], {}), '(labels_file)\n', (953, 966), False, 'import os\n'), ((1410, 1464), 'os.path.join', 'os.path.join', (['"""data"""', 'subset', '"""images"""', 'image_filename'], {}), "('data', subset, 'images', image_filename)\n", (1422, 1464), False, 'import os\n'), ((2856, 2901), 're.sub', 're.sub', (['"""\\\\b[a-zA-Z]\\\\b"""', '""" """', 'label_sentence'], {}), "('\\\\b[a-zA-Z]\\\\b', ' ', label_sentence)\n", (2862, 2901), False, 'import re\n'), ((2971, 3005), 're.sub', 're.sub', (['""" """', '""" """', 'label_sentence'], {}), "(' ', ' ', label_sentence)\n", (2977, 3005), False, 'import re\n'), ((3076, 3109), 're.sub', 're.sub', (['""" """', '""" """', 'label_sentence'], {}), "(' ', ' ', label_sentence)\n", (3082, 3109), False, 'import re\n'), ((1535, 1610), 'os.path.join', 'os.path.join', (['__file__', 'os.path.pardir', 'os.path.pardir', 'image_relative_file'], {}), '(__file__, os.path.pardir, os.path.pardir, image_relative_file)\n', (1547, 1610), False, 'import os\n'), ((1674, 1700), 'os.path.isfile', 'os.path.isfile', (['image_file'], {}), '(image_file)\n', (1688, 1700), False, 'import os\n'), ((1969, 1991), 'PIL.Image.open', 'Image.open', (['image_file'], {}), '(image_file)\n', (1979, 1991), False, 'from PIL import Image\n'), ((2735, 2780), 're.sub', 're.sub', (['"""[^A-Za-z0-9\']+"""', '""" """', 'label_sentence'], {}), '("[^A-Za-z0-9\']+", \' \', label_sentence)\n', (2741, 2780), False, 'import re\n')]
""" Miscellaneous utility functions and common data. Attributes: common_formulas: A set of common formulas. The keys to the data are strings from :obj:`pymatgen.core.composition.Composition.reduced_formula`. connected_geometries: A list of geometries that are considered "connectable" polyhedra. E.g. Their face-sharing, edge-sharing, etc properties are of interest. geometry_to_polyhedra: A mapping from geometry type (e.g. octahedral) to the plural polyhedra name (e.g. octahedra). dimensionality_to_shape: A mapping from dimensionality to the component shape. """ import re from collections import defaultdict from typing import Any, Dict, List, Union from monty.json import MontyDecoder from monty.serialization import loadfn from pkg_resources import resource_filename from pymatgen.core.periodic_table import Element, Species, get_el_sp from pymatgen.util.string import latexify_spacegroup common_formulas: Dict[str, str] = loadfn( resource_filename("robocrys.condense", "formula_db.json.gz") ) connected_geometries: List[str] = [ "tetrahedral", "octahedral", "trigonal pyramidal", "square pyramidal", "trigonal bipyramidal", "pentagonal pyramidal", "hexagonal pyramidal", "pentagonal bipyramidal", "hexagonal bipyramidal", "cuboctahedral", ] geometry_to_polyhedra: Dict[str, str] = { "octahedral": "octahedra", "tetrahedral": "tetrahedra", "trigonal pyramidal": "trigonal pyramid", "square pyramidal": "square pyramid", "trigonal bipyramidal": "trigonal bipyramid", "pentagonal pyramidal": "pentagonal pyramid", "hexagonal pyramidal": "hexagonal pyramid", "pentagonal bipyramidal": "pentagonal bipyramid", "hexagonal bipyramidal": "hexagonal bipyramid", "cuboctahedral": "cuboctahedra", } polyhedra_plurals: Dict[str, str] = { "octahedra": "octahedra", "tetrahedra": "tetrahedra", "trigonal pyramid": "trigonal pyramids", "square pyramid": "square pyramids", "trigonal bipyramid": "trigonal bipyramids", "pentagonal pyramid": "pentagonal pyramids", "hexagonal pyramid": "hexagonal pyramids", "pentagonal bipyramid": "pentagonal bipyramids", "hexagonal bipyramid": "hexagonal bipyramids", "cuboctahedra": "cuboctahedra", } dimensionality_to_shape: Dict[int, str] = { 3: "framework", 2: "sheet", 1: "ribbon", 0: "cluster", } def get_el(obj: Union[Element, Species, str, int]) -> str: """Utility method to get an element str from a symbol, Element, or Specie. Args: obj: An arbitrary object. Supported objects are Element/Species objects, integers (representing atomic numbers), or strings (element symbols or species strings). Returns: The element as a string. """ if isinstance(obj, str): obj = get_el_sp(obj) if isinstance(obj, Element): return obj.name elif isinstance(obj, Species): return obj.element.name elif isinstance(obj, int): return Element.from_Z(obj).name else: raise ValueError(f"Unsupported element type: {type(obj)}.") def get_formatted_el( element: str, sym_label: str, use_oxi_state: bool = True, use_sym_label: bool = True, fmt: str = "raw", ): """Formats an element string. Performs a variety of functions, including: - Changing "Sn+0" to "Sn". - Inserting the symmetry label between the element and oxidation state, if required. - Removing the oxidation state if required. - Latexifying the element and oxidation state. - Unicodeifying the element and oxidation state. - Converting the element and oxidation state to html. Args: element: The element string (possibly including the oxidation state. E.g. "Sn" or "Sn2+". sym_label: The symmetry label. E.g. "(1)" use_oxi_state: Whether to include the oxidation state, if present. use_sym_label: Whether to use the symmetry label. fmt: How to format the element strings. Options are: - "raw" (default): Don't apply special formatting (e.g. "SnO2"). - "unicode": Format super/subscripts using unicode characters (e.g. SnO₂). - "latex": Use LaTeX markup for formatting (e.g. "SnO$_2$"). - "html": Use html markup for formatting (e.g. "SnO<sub>2</sub>"). Returns: The formatted element string. """ specie = get_el_sp(element) if isinstance(specie, Species): oxi_state = specie.oxi_state sign = "+" if oxi_state > 0 else "-" if oxi_state == 0: oxi_state = None elif oxi_state % 1 == 0: oxi_state = f"{int(abs(oxi_state)):d}{sign}" else: oxi_state = f"{abs(oxi_state):+.2f}{sign}" else: oxi_state = None formatted_element = specie.name if use_sym_label: formatted_element += sym_label if use_oxi_state and oxi_state: if fmt == "latex": oxi_state = f"^{{{oxi_state}}}" elif fmt == "unicode": oxi_state = superscript_number(oxi_state) elif fmt == "html": oxi_state = f"<sup>{oxi_state}</sup>" formatted_element += oxi_state return formatted_element def superscript_number(string): """Converts a string containing numbers to superscript. Will only convert the numbers 0-9, and the + and - characters. Args: string: A string containing the numbers 0-9 or +/- characters. Returns: The superscript string. """ if "." in string: # no unicode period exists return string subscript_unicode_map = { 0: "⁰", 1: "¹", 2: "²", 3: "³", 4: "⁴", 5: "⁵", 6: "⁶", 7: "⁷", 8: "⁸", 9: "⁹", "-": "⁻", "+": "⁺", } for original_subscript, subscript_unicode in subscript_unicode_map.items(): string = string.replace(str(original_subscript), subscript_unicode) return string def unicodeify_spacegroup(spacegroup_symbol: str) -> str: """Formats a spacegroup using unicode symbols. E.g. Fd-3m -> Fd̅3m Args: spacegroup_symbol: A spacegroup symbol. Returns: The unicode formatted spacegroup symbol. """ subscript_unicode_map = { 0: "₀", 1: "₁", 2: "₂", 3: "₃", 4: "₄", 5: "₅", 6: "₆", 7: "₇", 8: "₈", 9: "₉", } symbol = latexify_spacegroup(spacegroup_symbol) for number, unicode_number in subscript_unicode_map.items(): symbol = symbol.replace("$_{" + str(number) + "}$", unicode_number) overline = "\u0305" # u"\u0304" (macron) is also an option symbol = symbol.replace("$\\overline{", overline) symbol = symbol.replace("$", "") symbol = symbol.replace("{", "") symbol = symbol.replace("}", "") return symbol def htmlify_spacegroup(spacegroup_symbol: str) -> str: """Formats a spacegroup using unicode symbols. E.g. P-42_1m -> P̅42<sub>1</sub>m Args: spacegroup_symbol: A spacegroup symbol. Returns: The html formatted spacegroup symbol. """ overline = "\u0305" # u"\u0304" (macron) is also an option symbol = re.sub(r"_(\d+)", r"<sub>\1</sub>", spacegroup_symbol) symbol = re.sub(r"-(\d)", fr"{overline}\1", symbol) return symbol def defaultdict_to_dict(dictionary: defaultdict) -> Dict: """Recursively convert nested :obj:`defaultdict` to :obj:`dict`. Args: dictionary: A defaultdict. Returns: The defaultdict as a :obj:`dict`. """ if isinstance(dictionary, defaultdict): dictionary = {k: defaultdict_to_dict(v) for k, v in dictionary.items()} return dictionary def load_condensed_structure_json(filename: str) -> Dict[str, Any]: """Load condensed structure data from a file. Args: filename: The filename. Returns: The condensed structure data. """ # Json does not support using integeras a dictionary keys, therefore # manually convert dictionary keys from str to int if possible. def json_keys_to_int(x): if isinstance(x, dict): return {int(k) if k.isdigit() else k: v for k, v in x.items()} return loadfn(filename, cls=MontyDecoder, object_hook=json_keys_to_int)
[ "pymatgen.util.string.latexify_spacegroup", "pymatgen.core.periodic_table.get_el_sp", "monty.serialization.loadfn", "pkg_resources.resource_filename", "pymatgen.core.periodic_table.Element.from_Z", "re.sub" ]
[((1001, 1061), 'pkg_resources.resource_filename', 'resource_filename', (['"""robocrys.condense"""', '"""formula_db.json.gz"""'], {}), "('robocrys.condense', 'formula_db.json.gz')\n", (1018, 1061), False, 'from pkg_resources import resource_filename\n'), ((4507, 4525), 'pymatgen.core.periodic_table.get_el_sp', 'get_el_sp', (['element'], {}), '(element)\n', (4516, 4525), False, 'from pymatgen.core.periodic_table import Element, Species, get_el_sp\n'), ((6600, 6638), 'pymatgen.util.string.latexify_spacegroup', 'latexify_spacegroup', (['spacegroup_symbol'], {}), '(spacegroup_symbol)\n', (6619, 6638), False, 'from pymatgen.util.string import latexify_spacegroup\n'), ((7382, 7436), 're.sub', 're.sub', (['"""_(\\\\d+)"""', '"""<sub>\\\\1</sub>"""', 'spacegroup_symbol'], {}), "('_(\\\\d+)', '<sub>\\\\1</sub>', spacegroup_symbol)\n", (7388, 7436), False, 'import re\n'), ((7450, 7492), 're.sub', 're.sub', (['"""-(\\\\d)"""', 'f"""{overline}\\\\1"""', 'symbol'], {}), "('-(\\\\d)', f'{overline}\\\\1', symbol)\n", (7456, 7492), False, 'import re\n'), ((8409, 8473), 'monty.serialization.loadfn', 'loadfn', (['filename'], {'cls': 'MontyDecoder', 'object_hook': 'json_keys_to_int'}), '(filename, cls=MontyDecoder, object_hook=json_keys_to_int)\n', (8415, 8473), False, 'from monty.serialization import loadfn\n'), ((2876, 2890), 'pymatgen.core.periodic_table.get_el_sp', 'get_el_sp', (['obj'], {}), '(obj)\n', (2885, 2890), False, 'from pymatgen.core.periodic_table import Element, Species, get_el_sp\n'), ((3062, 3081), 'pymatgen.core.periodic_table.Element.from_Z', 'Element.from_Z', (['obj'], {}), '(obj)\n', (3076, 3081), False, 'from pymatgen.core.periodic_table import Element, Species, get_el_sp\n')]
# -*- coding: utf-8 -*- """ Tencent is pleased to support the open source community by making BK-BASE 蓝鲸基础平台 available. Copyright (C) 2021 THL A29 Limited, a Tencent company. All rights reserved. BK-BASE 蓝鲸基础平台 is licensed under the MIT License. License for BK-BASE 蓝鲸基础平台: -------------------------------------------------------------------- Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions: The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. """ import importlib import json from bkbase.dataflow.core.exec.pipeline import Pipeline from bkbase.dataflow.metrics.util.exceptions import MetricsVerifyException from bkbase.dataflow.one_model.conf import deeplearning_conf from bkbase.dataflow.one_model.exception.tensorflow_exception import ( TensorFlowReportException, ) from bkbase.dataflow.one_model.metric.monitor_handler import MonitorHandler from bkbase.dataflow.one_model.topo.deeplearning_source_node import ( ModelIcebergResultSetSourceNode, ) from bkbase.dataflow.one_model.utils.deeplearning_constant import NodeType, ProcessType from bkbase.dataflow.one_model.utils.deeplearning_logger import ( logger as deeplearning_logger, ) class DeepLearningPipeline(Pipeline): def __init__(self, topology): super().__init__(topology) self.monitors = {} if deeplearning_conf.ENABLE_MONITOR: self.enable_monitor() self.dataframe_dict = {} self.model_dict = {} def source(self): deeplearning_logger.info("Pipeline source start") self.__create_source(self.topology.source_nodes) def sink(self): deeplearning_logger.info("Pipeline sink start") self.__create_sink(self.topology.sink_nodes, self.topology.source_nodes) def transform(self): deeplearning_logger.info("Pipeline transform start") return self.__create_transform(self.topology.transform_nodes) def submit(self): try: self.source() deeplearning_logger.info("source_data_dict: {}".format(self.dataframe_dict)) deeplearning_logger.info("model_dict:{}".format(self.model_dict)) transform_result = self.transform() deeplearning_logger.info("transform_dict: {}".format(transform_result)) self.sink() self.send_monitor() deeplearning_logger.info("pipeline submit finished") except Exception as e: self.send_monitor() raise e def __create_source(self, source_nodes): for node in source_nodes: source = source_nodes[node].create_source() node_type = source_nodes[node].type if node_type == NodeType.MODEL.value: self.model_dict[node] = source else: self.dataframe_dict[node] = source def __create_sink(self, sink_nodes, source_nodes): deeplearning_logger.info(sink_nodes) for node in sink_nodes: node_type = sink_nodes[node].type if node_type == NodeType.MODEL.value: if node in self.model_dict: sink_nodes[node].create_sink(self.model_dict[node]) else: # 将源dataset与目标dataset结合起来作为输出 target_dataset = self.dataframe_dict[node] sink_nodes[node].create_sink(target_dataset) def __create_transform(self, transform_nodes): for node_id in transform_nodes: process_type = transform_nodes[node_id].process_type transform_module = importlib.import_module(transform_nodes[node_id].user_main_module) if process_type == ProcessType.UNTRAINED_RUN.value: result_dict = transform_module.transform( self.dataframe_dict, self.model_dict, transform_nodes[node_id].user_args ) elif process_type == ProcessType.TRAINED_RUN.value: result_dict = transform_module.predict(self.dataframe_dict, self.model_dict) elif process_type == ProcessType.TRAIN.value: result_dict = transform_module.train(self.dataframe_dict, self.model_dict) else: raise Exception("unsuppoted operation:{}".format(process_type)) return result_dict def send_monitor(self): try: if deeplearning_conf.ENABLE_MONITOR: deeplearning_logger.info("Pipeline send monitor") input_count_info = self.get_input_count_info() for monitor in self.monitors: self.monitors[monitor].report(input_count_info) else: deeplearning_logger.info("Monitor disabled, won't send report data") except (ValueError, TypeError, AssertionError, MetricsVerifyException, TensorFlowReportException) as e: deeplearning_logger.exception(e) deeplearning_logger.error(e) def get_input_count_info(self): input_info = {} source_nodes = self.topology.source_nodes try: for source_id in source_nodes: source_obj = source_nodes[source_id] if isinstance(source_obj, ModelIcebergResultSetSourceNode): # rt表的时候才需要上报 start = source_obj.input["time_range_list"][0]["start_time"] end = source_obj.input["time_range_list"][0]["end_time"] count = MonitorHandler.get_rt_count( start, end, source_obj.input["storage_conf"]["storekit_hdfs_conf"] ) input_info[source_id] = {"count": count, "start": start, "end": end} deeplearning_logger.info("input info:" + json.dumps(input_info)) return input_info except Exception as e: deeplearning_logger.error(e) raise TensorFlowReportException("Get input information error:%s" % e) def enable_monitor(self): for sink_node in self.topology.sink_nodes: sink_obj = self.topology.sink_nodes[sink_node] # if isinstance(sink_obj, ModelIcebergResultSetSinkNode): if sink_obj.fields: # fields不为空,说明为表 self.monitors[sink_node] = MonitorHandler(self.topology, sink_node)
[ "bkbase.dataflow.one_model.metric.monitor_handler.MonitorHandler.get_rt_count", "bkbase.dataflow.one_model.utils.deeplearning_logger.logger.info", "importlib.import_module", "bkbase.dataflow.one_model.exception.tensorflow_exception.TensorFlowReportException", "bkbase.dataflow.one_model.utils.deeplearning_logger.logger.error", "bkbase.dataflow.one_model.utils.deeplearning_logger.logger.exception", "json.dumps", "bkbase.dataflow.one_model.metric.monitor_handler.MonitorHandler" ]
[((2385, 2434), 'bkbase.dataflow.one_model.utils.deeplearning_logger.logger.info', 'deeplearning_logger.info', (['"""Pipeline source start"""'], {}), "('Pipeline source start')\n", (2409, 2434), True, 'from bkbase.dataflow.one_model.utils.deeplearning_logger import logger as deeplearning_logger\n'), ((2521, 2568), 'bkbase.dataflow.one_model.utils.deeplearning_logger.logger.info', 'deeplearning_logger.info', (['"""Pipeline sink start"""'], {}), "('Pipeline sink start')\n", (2545, 2568), True, 'from bkbase.dataflow.one_model.utils.deeplearning_logger import logger as deeplearning_logger\n'), ((2684, 2736), 'bkbase.dataflow.one_model.utils.deeplearning_logger.logger.info', 'deeplearning_logger.info', (['"""Pipeline transform start"""'], {}), "('Pipeline transform start')\n", (2708, 2736), True, 'from bkbase.dataflow.one_model.utils.deeplearning_logger import logger as deeplearning_logger\n'), ((3786, 3822), 'bkbase.dataflow.one_model.utils.deeplearning_logger.logger.info', 'deeplearning_logger.info', (['sink_nodes'], {}), '(sink_nodes)\n', (3810, 3822), True, 'from bkbase.dataflow.one_model.utils.deeplearning_logger import logger as deeplearning_logger\n'), ((3236, 3288), 'bkbase.dataflow.one_model.utils.deeplearning_logger.logger.info', 'deeplearning_logger.info', (['"""pipeline submit finished"""'], {}), "('pipeline submit finished')\n", (3260, 3288), True, 'from bkbase.dataflow.one_model.utils.deeplearning_logger import logger as deeplearning_logger\n'), ((4439, 4505), 'importlib.import_module', 'importlib.import_module', (['transform_nodes[node_id].user_main_module'], {}), '(transform_nodes[node_id].user_main_module)\n', (4462, 4505), False, 'import importlib\n'), ((5281, 5330), 'bkbase.dataflow.one_model.utils.deeplearning_logger.logger.info', 'deeplearning_logger.info', (['"""Pipeline send monitor"""'], {}), "('Pipeline send monitor')\n", (5305, 5330), True, 'from bkbase.dataflow.one_model.utils.deeplearning_logger import logger as deeplearning_logger\n'), ((5542, 5610), 'bkbase.dataflow.one_model.utils.deeplearning_logger.logger.info', 'deeplearning_logger.info', (['"""Monitor disabled, won\'t send report data"""'], {}), '("Monitor disabled, won\'t send report data")\n', (5566, 5610), True, 'from bkbase.dataflow.one_model.utils.deeplearning_logger import logger as deeplearning_logger\n'), ((5735, 5767), 'bkbase.dataflow.one_model.utils.deeplearning_logger.logger.exception', 'deeplearning_logger.exception', (['e'], {}), '(e)\n', (5764, 5767), True, 'from bkbase.dataflow.one_model.utils.deeplearning_logger import logger as deeplearning_logger\n'), ((5780, 5808), 'bkbase.dataflow.one_model.utils.deeplearning_logger.logger.error', 'deeplearning_logger.error', (['e'], {}), '(e)\n', (5805, 5808), True, 'from bkbase.dataflow.one_model.utils.deeplearning_logger import logger as deeplearning_logger\n'), ((6706, 6734), 'bkbase.dataflow.one_model.utils.deeplearning_logger.logger.error', 'deeplearning_logger.error', (['e'], {}), '(e)\n', (6731, 6734), True, 'from bkbase.dataflow.one_model.utils.deeplearning_logger import logger as deeplearning_logger\n'), ((6753, 6816), 'bkbase.dataflow.one_model.exception.tensorflow_exception.TensorFlowReportException', 'TensorFlowReportException', (["('Get input information error:%s' % e)"], {}), "('Get input information error:%s' % e)\n", (6778, 6816), False, 'from bkbase.dataflow.one_model.exception.tensorflow_exception import TensorFlowReportException\n'), ((7136, 7176), 'bkbase.dataflow.one_model.metric.monitor_handler.MonitorHandler', 'MonitorHandler', (['self.topology', 'sink_node'], {}), '(self.topology, sink_node)\n', (7150, 7176), False, 'from bkbase.dataflow.one_model.metric.monitor_handler import MonitorHandler\n'), ((6325, 6425), 'bkbase.dataflow.one_model.metric.monitor_handler.MonitorHandler.get_rt_count', 'MonitorHandler.get_rt_count', (['start', 'end', "source_obj.input['storage_conf']['storekit_hdfs_conf']"], {}), "(start, end, source_obj.input['storage_conf'][\n 'storekit_hdfs_conf'])\n", (6352, 6425), False, 'from bkbase.dataflow.one_model.metric.monitor_handler import MonitorHandler\n'), ((6609, 6631), 'json.dumps', 'json.dumps', (['input_info'], {}), '(input_info)\n', (6619, 6631), False, 'import json\n')]
from django.http import HttpResponsePermanentRedirect, HttpResponseNotFound, HttpResponseBadRequest from django.core.files.storage import default_storage from easy_thumbnails.files import get_thumbnailer from easy_thumbnails.exceptions import InvalidImageFormatError import re SIZE_RE = re.compile(r'^(\d+),(\d+)$') def resize(request, path): thumbnail_opts = {} if 'size' in request.GET: if SIZE_RE.match(request.GET['size']): thumbnail_opts['size'] = map(int, request.GET['size'].split(',')) if 'crop' in request.GET: thumbnail_opts['crop'] = request.GET['crop'] else: return HttpResponseBadRequest(u'Size must be expressed in the format "size=[integer],[integer]"') else: return HttpResponsePermanentRedirect(default_storage.url(path)) try: thumbnailer = get_thumbnailer(default_storage, path) thumbnail = thumbnailer.get_thumbnail(thumbnail_opts) return HttpResponsePermanentRedirect(thumbnail.url) except IOError: return HttpResponseNotFound(u'File not found.') except InvalidImageFormatError: return HttpResponseBadRequest(u'File is not an image.')
[ "django.core.files.storage.default_storage.url", "django.http.HttpResponseBadRequest", "easy_thumbnails.files.get_thumbnailer", "django.http.HttpResponseNotFound", "django.http.HttpResponsePermanentRedirect", "re.compile" ]
[((289, 318), 're.compile', 're.compile', (['"""^(\\\\d+),(\\\\d+)$"""'], {}), "('^(\\\\d+),(\\\\d+)$')\n", (299, 318), False, 'import re\n'), ((862, 900), 'easy_thumbnails.files.get_thumbnailer', 'get_thumbnailer', (['default_storage', 'path'], {}), '(default_storage, path)\n', (877, 900), False, 'from easy_thumbnails.files import get_thumbnailer\n'), ((978, 1022), 'django.http.HttpResponsePermanentRedirect', 'HttpResponsePermanentRedirect', (['thumbnail.url'], {}), '(thumbnail.url)\n', (1007, 1022), False, 'from django.http import HttpResponsePermanentRedirect, HttpResponseNotFound, HttpResponseBadRequest\n'), ((658, 753), 'django.http.HttpResponseBadRequest', 'HttpResponseBadRequest', (['u"""Size must be expressed in the format "size=[integer],[integer]\\""""'], {}), '(\n u\'Size must be expressed in the format "size=[integer],[integer]"\')\n', (680, 753), False, 'from django.http import HttpResponsePermanentRedirect, HttpResponseNotFound, HttpResponseBadRequest\n'), ((804, 829), 'django.core.files.storage.default_storage.url', 'default_storage.url', (['path'], {}), '(path)\n', (823, 829), False, 'from django.core.files.storage import default_storage\n'), ((1058, 1098), 'django.http.HttpResponseNotFound', 'HttpResponseNotFound', (['u"""File not found."""'], {}), "(u'File not found.')\n", (1078, 1098), False, 'from django.http import HttpResponsePermanentRedirect, HttpResponseNotFound, HttpResponseBadRequest\n'), ((1150, 1198), 'django.http.HttpResponseBadRequest', 'HttpResponseBadRequest', (['u"""File is not an image."""'], {}), "(u'File is not an image.')\n", (1172, 1198), False, 'from django.http import HttpResponsePermanentRedirect, HttpResponseNotFound, HttpResponseBadRequest\n')]
import ast, gast import inspect import numpy as np import sys import typing from chainer_compiler.elichika.typing import types from chainer_compiler.elichika.typing.type_inference import InferenceEngine from chainer_compiler.elichika.typing.utils import node_description, is_expr from chainer_compiler.elichika.parser import utils class IDAssignor(gast.NodeVisitor): def __init__(self): self.counter = 0 self.node2id = {} def visit(self, node): self.node2id[node] = self.counter self.counter += 1 return super().visit(node) def run(self, node, subroutine_node): self.visit(node) for ns in subroutine_node.values(): for n in ns: self.visit(n) return self.node2id def generate_node2id(tree, subroutine_node): a = IDAssignor() node2id = a.run(tree, subroutine_node) return node2id def generate_id2node(node2id): id2node = {} for n, i in node2id.items(): id2node[i] = n return id2node def generate_node2type(tree, args, is_debug=False, module=None, type_hints={}): reset_state() tc = InferenceEngine(is_debug=is_debug, module=module) func_body = tree.body[0] # XXX: only checks first function try: node2type = tc.infer_function_value_args(func_body, args, type_hints=type_hints) return node2type, tc.subroutine_node except Exception as e: tc.dump_tyenv() raise e def generate_id2type(node2type, node2id): id2type = {} for n, t in node2type.items(): if n not in node2id.keys(): continue # user-defined modules in nn.Sequential id2type[node2id[n]] = t return id2type def generate_assertion(type_table_name, id2type, id2node, ofile=None): for i, t in sorted(id2type.items()): node = id2node[i] if not is_expr(node): if not isinstance(node, gast.FunctionDef): continue output = " # === function {} ===".format(node.name) else: comment = "\t# " + node_description(node) output = " self.assertEqual(str({}[{}]), \"{}\"){}".format( \ type_table_name, i, t, comment) if ofile is None: print(output) else: ofile.write(output + '\n') # For testing def generate_id2type_from_forward(model, args, is_debug=False): code = utils.clip_head(inspect.getsource(model.forward)) tree = gast.ast_to_gast(ast.parse(code)) module = sys.modules[model.forward.__module__] node2type, subroutine_node = generate_node2type( tree, (model,) + args, is_debug=is_debug, module=module, type_hints=typing.get_type_hints(model.forward)) node2id = generate_node2id(tree, subroutine_node) id2type = generate_id2type(node2type, node2id) return id2type # For debug def generate_type_inference_results(model, forward_args, is_debug=True): code = utils.clip_head(inspect.getsource(model.forward)) node = gast.ast_to_gast(ast.parse(code)) # node = Canonicalizer().visit(node) module = sys.modules[model.forward.__module__] node2type, subroutine_node = generate_node2type( node, (model,) + forward_args, is_debug=is_debug, module=module, type_hints=typing.get_type_hints(model.forward)) node2id = generate_node2id(node, subroutine_node) id2type = generate_id2type(node2type, node2id) id2node = generate_id2node(node2id) return id2type, id2node def reset_state(): np.random.seed(42) types.var_counter = 0 if __name__ == '__main__': import argparse import numpy as np import chainer import chainer.functions as F import chainer.links as L from tests.elichika_typing.EspNet_test import * from tests.elichika_typing.Models_test import * parser = argparse.ArgumentParser() parser.add_argument("-e", help="Execute the script", action="store_true") parser.add_argument("-o", help="Specify file name to output the assertions", type=str) args = parser.parse_args() class Test(): def forward(self): x = np.zeros((1, 1)).astype('float32') y = F.pad_sequence([x], length=5) return y # model, forward_args = gen_MLP_model() model, forward_args = gen_GoogLeNet_model() # model, forward_args = gen_AttDot_model() # model, forward_args = gen_AttLoc_model() # model, forward_args = gen_BLSTM_model() # model, forward_args = gen_VGG2L_model() # model, forward_args = gen_StatelessLSTM_model() # model, forward_args = gen_Decoder_model() # model, forward_args = gen_E2E_model() # model, forward_args = Test(), () if args.e: model.forward(*forward_args) else: id2type, id2node = generate_type_inference_results(model, forward_args) if args.o: ofile = open(args.o, 'w') generate_assertion("id2type", id2type, id2node, ofile)
[ "chainer_compiler.elichika.typing.type_inference.InferenceEngine", "numpy.random.seed", "argparse.ArgumentParser", "chainer_compiler.elichika.typing.utils.is_expr", "typing.get_type_hints", "numpy.zeros", "inspect.getsource", "chainer.functions.pad_sequence", "ast.parse", "chainer_compiler.elichika.typing.utils.node_description" ]
[((1137, 1186), 'chainer_compiler.elichika.typing.type_inference.InferenceEngine', 'InferenceEngine', ([], {'is_debug': 'is_debug', 'module': 'module'}), '(is_debug=is_debug, module=module)\n', (1152, 1186), False, 'from chainer_compiler.elichika.typing.type_inference import InferenceEngine\n'), ((3532, 3550), 'numpy.random.seed', 'np.random.seed', (['(42)'], {}), '(42)\n', (3546, 3550), True, 'import numpy as np\n'), ((3852, 3877), 'argparse.ArgumentParser', 'argparse.ArgumentParser', ([], {}), '()\n', (3875, 3877), False, 'import argparse\n'), ((2429, 2461), 'inspect.getsource', 'inspect.getsource', (['model.forward'], {}), '(model.forward)\n', (2446, 2461), False, 'import inspect\n'), ((2491, 2506), 'ast.parse', 'ast.parse', (['code'], {}), '(code)\n', (2500, 2506), False, 'import ast, gast\n'), ((2980, 3012), 'inspect.getsource', 'inspect.getsource', (['model.forward'], {}), '(model.forward)\n', (2997, 3012), False, 'import inspect\n'), ((3042, 3057), 'ast.parse', 'ast.parse', (['code'], {}), '(code)\n', (3051, 3057), False, 'import ast, gast\n'), ((1850, 1863), 'chainer_compiler.elichika.typing.utils.is_expr', 'is_expr', (['node'], {}), '(node)\n', (1857, 1863), False, 'from chainer_compiler.elichika.typing.utils import node_description, is_expr\n'), ((2704, 2740), 'typing.get_type_hints', 'typing.get_type_hints', (['model.forward'], {}), '(model.forward)\n', (2725, 2740), False, 'import typing\n'), ((3296, 3332), 'typing.get_type_hints', 'typing.get_type_hints', (['model.forward'], {}), '(model.forward)\n', (3317, 3332), False, 'import typing\n'), ((4204, 4233), 'chainer.functions.pad_sequence', 'F.pad_sequence', (['[x]'], {'length': '(5)'}), '([x], length=5)\n', (4218, 4233), True, 'import chainer.functions as F\n'), ((2061, 2083), 'chainer_compiler.elichika.typing.utils.node_description', 'node_description', (['node'], {}), '(node)\n', (2077, 2083), False, 'from chainer_compiler.elichika.typing.utils import node_description, is_expr\n'), ((4153, 4169), 'numpy.zeros', 'np.zeros', (['(1, 1)'], {}), '((1, 1))\n', (4161, 4169), True, 'import numpy as np\n')]
#!/bin/python3 #https://docs.python.org/3/howto/sockets.html import sys import socket from datetime import datetime if len(sys.argv) == 2: target = socket.gethostbyname(sys.argv[1]) # traslate to ipv4 else: print("invalid amoount of args") print("syntax: pyhon3 scanner.py <ip>") exit() print("banner") print(target) print("time:"+str(datetime.now())) exit() HOST = target PORT = "7777" try: for port in range(50,85): # create an INET, STREAMing socket s = socket.socket(socket.AF_INET, socket.SOCK_STREAM) # now connect to the web server on port 80 - the normal http port socket.setdefaulttimeout(1) result = s.connect_ex((HOST, PORT)) if result == 0: print("port {} is open".format(port)) s.close() except KeyboardInterrupt: print("exiting") sys.exit() except socket.gairror: print("exiting") sys.exit() except socket.errort: print("exiting") sys.exit()
[ "socket.socket", "socket.gethostbyname", "socket.setdefaulttimeout", "datetime.datetime.now", "sys.exit" ]
[((154, 187), 'socket.gethostbyname', 'socket.gethostbyname', (['sys.argv[1]'], {}), '(sys.argv[1])\n', (174, 187), False, 'import socket\n'), ((498, 547), 'socket.socket', 'socket.socket', (['socket.AF_INET', 'socket.SOCK_STREAM'], {}), '(socket.AF_INET, socket.SOCK_STREAM)\n', (511, 547), False, 'import socket\n'), ((630, 657), 'socket.setdefaulttimeout', 'socket.setdefaulttimeout', (['(1)'], {}), '(1)\n', (654, 657), False, 'import socket\n'), ((845, 855), 'sys.exit', 'sys.exit', ([], {}), '()\n', (853, 855), False, 'import sys\n'), ((904, 914), 'sys.exit', 'sys.exit', ([], {}), '()\n', (912, 914), False, 'import sys\n'), ((962, 972), 'sys.exit', 'sys.exit', ([], {}), '()\n', (970, 972), False, 'import sys\n'), ((354, 368), 'datetime.datetime.now', 'datetime.now', ([], {}), '()\n', (366, 368), False, 'from datetime import datetime\n')]
import dash_core_components as dcc import dash_html_components as html import dash_bootstrap_components as dbc ##================================== ## Selectors ##================================== out = dbc.Col([ dbc.Row([ # Class selector (what differentiates the data) dbc.Col([ html.Div([ html.P('Classes: ') ], className = 'dropdown-label', style = dict(marginRight = 30) ), html.Div([ dcc.Dropdown( id='pca-class-select', options = [], placeholder = 'Select...', clearable = True, ) ], className = 'dropdown-axis' ), ], className = 'dropdown-group' ), ], justify = 'center'), ], id = 'pca-axis-dropdowns', width = dict(size = 12, offset = 0), style = dict( marginTop = 30, marginLeft = 0, marginRight = 0, ), align = 'center', ) def get(): return out
[ "dash_html_components.P", "dash_core_components.Dropdown" ]
[((362, 384), 'dash_html_components.P', 'html.P', (['"""Classes: """'], {}), "('Classes: ')\n", (368, 384), True, 'import dash_html_components as html\n'), ((532, 624), 'dash_core_components.Dropdown', 'dcc.Dropdown', ([], {'id': '"""pca-class-select"""', 'options': '[]', 'placeholder': '"""Select..."""', 'clearable': '(True)'}), "(id='pca-class-select', options=[], placeholder='Select...',\n clearable=True)\n", (544, 624), True, 'import dash_core_components as dcc\n')]
#!/usr/bin/env python3 # MIT License # # Copyright (c) 2020 FABRIC Testbed # # Permission is hereby granted, free of charge, to any person obtaining a copy # of this software and associated documentation files (the "Software"), to deal # in the Software without restriction, including without limitation the rights # to use, copy, modify, merge, publish, distribute, sublicense, and/or sell # copies of the Software, and to permit persons to whom the Software is # furnished to do so, subject to the following conditions: # # The above copyright notice and this permission notice shall be included in all # copies or substantial portions of the Software. # # THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR # IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, # FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE # AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER # LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, # OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE # SOFTWARE. # # # Author: <NAME> (<EMAIL>) from typing import Tuple, List, Dict from collections import defaultdict import uuid from fim.graph.abc_property_graph import ABCPropertyGraph, PropertyGraphQueryException from fim.graph.resources.abc_cbm import ABCCBMPropertyGraph from fim.graph.resources.abc_bqm import ABCBQMPropertyGraph from fim.graph.networkx_property_graph import NetworkXGraphImporter from fim.graph.resources.networkx_abqm import NetworkXAggregateBQM from fim.slivers.capacities_labels import Capacities from fim.slivers.delegations import DelegationFormat from fim.slivers.network_node import CompositeNodeSliver, NodeType from fim.slivers.attached_components import ComponentSliver, ComponentType from fim.slivers.interface_info import InterfaceType from fim.slivers.network_service import ServiceType class AggregatedBQMPlugin: """ Implement a plugin for simple aggregation of CBM into BQM, transforming site topologies into CompositeNodes and linking them with (Composite)Links This is based on fim.pluggable BrokerPluggable """ # set to true to test creating ABQM without talking to database or requiring # an actor reference DEBUG_FLAG = False def __init__(self, actor, logger=None): if not self.DEBUG_FLAG: assert actor is not None self.actor = actor self.logger = logger @staticmethod def _remove_none_entries(d): return {k: v for (k, v) in d.items() if v} def __occupied_node_capacity(self, *, node_id: str) -> Tuple[Capacities, Dict[ComponentType, Dict[str, Capacities]]]: """ Figure out the total capacity occupied in the network node and return a tuple of capacities occupied in this node and a dict of component capacities that are occupied organized by component type and model. """ assert node_id is not None # get existing reservations for this node existing_reservations = self.actor.get_plugin().get_database().get_reservations(graph_node_id=node_id) # node capacities occupied_capacities = Capacities() occupied_component_capacities = defaultdict(dict) # Remove allocated capacities to the reservations if existing_reservations is not None: for reservation in existing_reservations: # For Active or Ticketed or Ticketing reservations; compute the counts from available allocated_sliver = None if reservation.is_ticketing() and reservation.get_approved_resources() is not None: allocated_sliver = reservation.get_approved_resources().get_sliver() if (reservation.is_active() or reservation.is_ticketed()) and \ reservation.get_resources() is not None: allocated_sliver = reservation.get_resources().get_sliver() if allocated_sliver is not None: occupied_capacities = occupied_capacities + allocated_sliver.get_capacities() if allocated_sliver.attached_components_info is not None: for allocated_component in allocated_sliver.attached_components_info.devices.values(): rt = allocated_component.resource_type rm = allocated_component.resource_model if occupied_component_capacities[rt].get(rm) is None: occupied_component_capacities[rt][rm] = Capacities() occupied_component_capacities[rt][rm] = occupied_component_capacities[rt][rm] + \ allocated_component.capacity_allocations return occupied_capacities, occupied_component_capacities def plug_produce_bqm(self, *, cbm: ABCCBMPropertyGraph, **kwargs) -> ABCBQMPropertyGraph: """ Take a CBM, sort nodes by site, aggregate servers, components and interfaces to create a site-based advertisement. Use a NetworkX-based implementation. :param cbm: :param kwargs: :return: """ if kwargs.get('query_level', None) is None or kwargs['query_level'] != 1: return cbm.clone_graph(new_graph_id=str(uuid.uuid4())) # do a one-pass aggregation of servers, their components and interfaces # this includes facilities nnodes = cbm.get_all_nodes_by_class(label=ABCPropertyGraph.CLASS_NetworkNode) slivers_by_site = defaultdict(list) for n in nnodes: # build deep slivers for each advertised server, aggregate by site node_sliver = cbm.build_deep_node_sliver(node_id=n) slivers_by_site[node_sliver.site].append(node_sliver) # create a new blank Aggregated BQM NetworkX graph abqm = NetworkXAggregateBQM(graph_id=str(uuid.uuid4()), importer=NetworkXGraphImporter(logger=self.logger), logger=self.logger) site_to_composite_node_id = dict() site_to_ns_node_id = dict() facilities_by_site = defaultdict(list) for s, ls in slivers_by_site.items(): # add up capacities and delegated capacities, skip labels for now # count up components and figure out links between site site_sliver = CompositeNodeSliver() # count what is taken site_sliver.capacity_allocations = Capacities() # count what is available site_sliver.capacities = Capacities() site_sliver.resource_name = s site_sliver.resource_type = NodeType.Server site_sliver.node_id = str(uuid.uuid4()) # available components organized by [type][model] site_comps_by_type = defaultdict(dict) # occupied component capacities organized by [type][model] into lists (by server) site_allocated_comps_caps_by_type = defaultdict(dict) loc = None for sliver in ls: if sliver.get_type() != NodeType.Server: # skipping NAS, Facility and dataplane switches if sliver.get_type() == NodeType.Facility: # keep track of facilities for each site facilities_by_site[s].append(sliver) continue if self.DEBUG_FLAG: # for debugging and running in a test environment allocated_comp_caps = dict() else: # query database for everything taken on this node allocated_caps, allocated_comp_caps = self.__occupied_node_capacity(node_id=sliver.node_id) site_sliver.capacity_allocations = site_sliver.capacity_allocations + allocated_caps # get the location if available if loc is None: loc = sliver.get_location() # calculate available node capacities based on delegations if sliver.get_capacity_delegations() is not None: # CBM only has one delegation if it has one _, delegation = sliver.get_capacity_delegations().get_sole_delegation() # FIXME: skip pool definitions and references for now if delegation.get_format() == DelegationFormat.SinglePool: site_sliver.capacities = site_sliver.capacities + \ delegation.get_details() # merge allocated component capacities for kt, v in allocated_comp_caps.items(): for km, vcap in v.items(): if site_allocated_comps_caps_by_type[kt].get(km) is None: site_allocated_comps_caps_by_type[kt][km] = Capacities() site_allocated_comps_caps_by_type[kt][km] = site_allocated_comps_caps_by_type[kt][km] + \ vcap # collect available components in lists by type and model for the site (for later aggregation) if sliver.attached_components_info is None: continue for comp in sliver.attached_components_info.list_devices(): rt = comp.resource_type rm = comp.resource_model if site_comps_by_type[rt].get(rm) is None: site_comps_by_type[rt][rm] = list() site_comps_by_type[rt][rm].append(comp) # set location to whatever is available site_sliver.set_location(loc) site_sliver.set_site(s) # create a Composite node for every site site_to_composite_node_id[s] = site_sliver.node_id site_props = abqm.node_sliver_to_graph_properties_dict(site_sliver) abqm.add_node(node_id=site_sliver.node_id, label=ABCPropertyGraph.CLASS_CompositeNode, props=site_props) # add a network service ns_id = str(uuid.uuid4()) site_to_ns_node_id[s] = ns_id ns_props = {ABCPropertyGraph.PROP_NAME: s + '_ns', ABCPropertyGraph.PROP_TYPE: str(ServiceType.MPLS)} abqm.add_node(node_id=ns_id, label=ABCPropertyGraph.CLASS_NetworkService, props=ns_props) abqm.add_link(node_a=site_sliver.node_id, rel=ABCPropertyGraph.REL_HAS, node_b=ns_id) # create a component sliver for every component type/model pairing # and add a node for it linking back to site node for ctype, cdict in site_comps_by_type.items(): for cmodel, comp_list in cdict.items(): comp_sliver = ComponentSliver() # count what is available comp_sliver.capacities = Capacities() # count what is taken (ignore those type/model pairings that were unused) comp_sliver.capacity_allocations = site_allocated_comps_caps_by_type[ctype].get(cmodel) or \ Capacities() comp_sliver.set_type(ctype) comp_sliver.set_model(cmodel) comp_sliver.set_name(str(ctype) + '-' + cmodel) for comp in comp_list: comp_sliver.capacities = comp_sliver.capacities + comp.capacities comp_node_id = str(uuid.uuid4()) comp_props = abqm.component_sliver_to_graph_properties_dict(comp_sliver) abqm.add_node(node_id=comp_node_id, label=ABCPropertyGraph.CLASS_Component, props=comp_props) abqm.add_link(node_a=site_sliver.node_id, rel=ABCPropertyGraph.REL_HAS, node_b=comp_node_id) # get all intersite links - add them to the aggregated BQM graph intersite_links = cbm.get_intersite_links() for l in intersite_links: source_switch = l[0] sink_switch = l[2] link = l[1] source_site = l[3] sink_site = l[4] source_cp = l[5] sink_cp = l[6] _, cbm_source_cp_props = cbm.get_node_properties(node_id=source_cp) _, cbm_sink_cp_props = cbm.get_node_properties(node_id=sink_cp) _, cbm_link_props = cbm.get_node_properties(node_id=link) # add connection point, link, connection point between two NetworkServices assert(site_to_ns_node_id.get(source_site) is not None and site_to_ns_node_id.get(sink_site) is not None) source_cp_id = str(uuid.uuid4()) sink_cp_id = str(uuid.uuid4()) source_cp_props = {ABCPropertyGraph.PROP_NAME: "_".join([source_site, sink_site]), ABCPropertyGraph.PROP_TYPE: str(InterfaceType.TrunkPort), ABCPropertyGraph.PROP_CLASS: ABCPropertyGraph.CLASS_ConnectionPoint, ABCPropertyGraph.PROP_LABELS: cbm_source_cp_props.get(ABCPropertyGraph.PROP_LABELS), ABCPropertyGraph.PROP_CAPACITIES: cbm_source_cp_props.get(ABCPropertyGraph.PROP_CAPACITIES) } source_cp_props = {k: v for (k, v) in source_cp_props.items() if v} abqm.add_node(node_id=source_cp_id, label=ABCPropertyGraph.CLASS_ConnectionPoint, props=source_cp_props) # FIXME: CP names may not be unique if we are dealing with a multigraph sink_cp_props = {ABCPropertyGraph.PROP_NAME: "_".join([sink_site, source_site]), ABCPropertyGraph.PROP_TYPE: str(InterfaceType.TrunkPort), ABCPropertyGraph.PROP_CLASS: ABCPropertyGraph.CLASS_ConnectionPoint, ABCPropertyGraph.PROP_LABELS: cbm_sink_cp_props.get(ABCPropertyGraph.PROP_LABELS), ABCPropertyGraph.PROP_CAPACITIES: cbm_sink_cp_props.get(ABCPropertyGraph.PROP_CAPACITIES) } sink_cp_props = {k: v for (k, v) in sink_cp_props.items() if v} abqm.add_node(node_id=sink_cp_id, label=ABCPropertyGraph.CLASS_ConnectionPoint, props=sink_cp_props) # selectively replicate link node and its properties from CBM new_link_props = {ABCPropertyGraph.PROP_NAME: cbm_link_props[ABCPropertyGraph.PROP_NAME], ABCPropertyGraph.PROP_TYPE: cbm_link_props[ABCPropertyGraph.PROP_TYPE], ABCPropertyGraph.PROP_CLASS: cbm_link_props[ABCPropertyGraph.PROP_CLASS], ABCPropertyGraph.PROP_LAYER: cbm_link_props[ABCPropertyGraph.PROP_LAYER] } abqm.add_node(node_id=link, label=ABCPropertyGraph.CLASS_Link, props=new_link_props) # connect them together abqm.add_link(node_a=site_to_ns_node_id[source_site], rel=ABCPropertyGraph.REL_CONNECTS, node_b=source_cp_id) abqm.add_link(node_a=source_cp_id, rel=ABCPropertyGraph.REL_CONNECTS, node_b=link) abqm.add_link(node_a=link, rel=ABCPropertyGraph.REL_CONNECTS, node_b=sink_cp_id) abqm.add_link(node_a=sink_cp_id, rel=ABCPropertyGraph.REL_CONNECTS, node_b=site_to_ns_node_id[sink_site]) # link facilities to their sites for s, lf in facilities_by_site.items(): # multiple facilities per site possible for fac_sliver in lf: fac_nbs = cbm.get_first_and_second_neighbor(node_id=fac_sliver.node_id, rel1=ABCPropertyGraph.REL_HAS, node1_label=ABCPropertyGraph.CLASS_NetworkService, rel2=ABCPropertyGraph.REL_CONNECTS, node2_label=ABCPropertyGraph.CLASS_ConnectionPoint) try: fac_ns_node_id = fac_nbs[0][0] fac_cp_node_id = fac_nbs[0][1] except KeyError: if self.logger: self.logger.warning(f'Unable to trace facility ConnectionPoint for ' f'facility {fac_sliver.resource_name}, continuing') else: print(f'Unable to trace facility ConnectionPoint for ' f'facility {fac_sliver.resource_name}, continuing') continue _, fac_props = cbm.get_node_properties(node_id=fac_sliver.node_id) _, fac_ns_props = cbm.get_node_properties(node_id=fac_ns_node_id) _, fac_cp_props = cbm.get_node_properties(node_id=fac_cp_node_id) # filter down only the needed properties then recreate the structure of facility in ABQM new_fac_props = {ABCPropertyGraph.PROP_NAME: fac_props[ABCPropertyGraph.PROP_NAME], ABCPropertyGraph.PROP_TYPE: fac_props[ABCPropertyGraph.PROP_TYPE] } abqm.add_node(node_id=fac_sliver.node_id, label=ABCPropertyGraph.CLASS_NetworkNode, props=new_fac_props) new_ns_props = {ABCPropertyGraph.PROP_NAME: fac_ns_props[ABCPropertyGraph.PROP_NAME], ABCPropertyGraph.PROP_TYPE: fac_ns_props[ABCPropertyGraph.PROP_TYPE] } abqm.add_node(node_id=fac_ns_node_id, label=ABCPropertyGraph.CLASS_NetworkService, props=new_ns_props) new_cp_props = {ABCPropertyGraph.PROP_NAME: fac_cp_props[ABCPropertyGraph.PROP_NAME], ABCPropertyGraph.PROP_TYPE: fac_cp_props[ABCPropertyGraph.PROP_TYPE], ABCPropertyGraph.PROP_LABELS: fac_cp_props.get(ABCPropertyGraph.PROP_LABELS), ABCPropertyGraph.PROP_CAPACITIES: fac_cp_props.get(ABCPropertyGraph.PROP_CAPACITIES) } new_cp_props = {k: v for (k, v) in new_cp_props.items() if v} abqm.add_node(node_id=fac_cp_node_id, label=ABCPropertyGraph.CLASS_ConnectionPoint, props=new_cp_props) abqm.add_link(node_a=fac_sliver.node_id, rel=ABCPropertyGraph.REL_HAS, node_b=fac_ns_node_id) abqm.add_link(node_a=fac_ns_node_id, rel=ABCPropertyGraph.REL_CONNECTS, node_b=fac_cp_node_id) # trace the link to a switch port/ConnectionPoint and replicate them for simplicity fac_cp_nbs = cbm.get_first_and_second_neighbor(node_id=fac_cp_node_id, rel1=ABCPropertyGraph.REL_CONNECTS, node1_label=ABCPropertyGraph.CLASS_Link, rel2=ABCPropertyGraph.REL_CONNECTS, node2_label=ABCPropertyGraph.CLASS_ConnectionPoint) if len(fac_cp_nbs) == 0 or len(fac_cp_nbs) > 1: if self.logger: self.logger.warning(f'Unable to trace switch port from Facility port ' f'for facility {fac_sliver.resource_name} {fac_cp_nbs}') else: print(f'Unable to trace switch port from Facility port ' f'for facility {fac_sliver.resource_name} {fac_cp_nbs}') continue fac_link_id = fac_cp_nbs[0][0] fac_sp_id = fac_cp_nbs[0][1] _, fac_link_props = cbm.get_node_properties(node_id=fac_link_id) # selectively replicate link properties new_link_props = {ABCPropertyGraph.PROP_NAME: fac_link_props[ABCPropertyGraph.PROP_NAME], ABCPropertyGraph.PROP_TYPE: fac_link_props[ABCPropertyGraph.PROP_TYPE], ABCPropertyGraph.PROP_LAYER: fac_link_props[ABCPropertyGraph.PROP_LAYER] } abqm.add_node(node_id=fac_link_id, label=ABCPropertyGraph.CLASS_Link, props=new_link_props) try: abqm.get_node_properties(node_id=fac_sp_id) except PropertyGraphQueryException: # if the node doesn't exist we need to create it (it could have been created in the first pass) _, fac_sp_props = cbm.get_node_properties(node_id=fac_sp_id) new_sp_props = {ABCPropertyGraph.PROP_NAME: fac_sp_props[ABCPropertyGraph.PROP_NAME], ABCPropertyGraph.PROP_TYPE: fac_sp_props[ABCPropertyGraph.PROP_TYPE], ABCPropertyGraph.PROP_CAPACITIES: fac_sp_props.get( ABCPropertyGraph.PROP_CAPACITIES), ABCPropertyGraph.PROP_LABELS: fac_sp_props.get(ABCPropertyGraph.PROP_LABELS) } new_sp_props = {k: v for (k, v) in new_sp_props.items() if v} abqm.add_node(node_id=fac_sp_id, label=ABCPropertyGraph.CLASS_ConnectionPoint, props=new_sp_props) # link these together abqm.add_link(node_a=fac_cp_node_id, rel=ABCPropertyGraph.REL_CONNECTS, node_b=fac_link_id) abqm.add_link(node_a=fac_link_id, rel=ABCPropertyGraph.REL_CONNECTS, node_b=fac_sp_id) abqm.add_link(node_a=fac_sp_id, rel=ABCPropertyGraph.REL_CONNECTS, node_b=site_to_ns_node_id[s]) return abqm
[ "fim.slivers.attached_components.ComponentSliver", "uuid.uuid4", "fim.slivers.network_node.CompositeNodeSliver", "collections.defaultdict", "fim.graph.networkx_property_graph.NetworkXGraphImporter", "fim.slivers.capacities_labels.Capacities" ]
[((3293, 3305), 'fim.slivers.capacities_labels.Capacities', 'Capacities', ([], {}), '()\n', (3303, 3305), False, 'from fim.slivers.capacities_labels import Capacities\n'), ((3346, 3363), 'collections.defaultdict', 'defaultdict', (['dict'], {}), '(dict)\n', (3357, 3363), False, 'from collections import defaultdict\n'), ((5720, 5737), 'collections.defaultdict', 'defaultdict', (['list'], {}), '(list)\n', (5731, 5737), False, 'from collections import defaultdict\n'), ((6349, 6366), 'collections.defaultdict', 'defaultdict', (['list'], {}), '(list)\n', (6360, 6366), False, 'from collections import defaultdict\n'), ((6586, 6607), 'fim.slivers.network_node.CompositeNodeSliver', 'CompositeNodeSliver', ([], {}), '()\n', (6605, 6607), False, 'from fim.slivers.network_node import CompositeNodeSliver, NodeType\n'), ((6689, 6701), 'fim.slivers.capacities_labels.Capacities', 'Capacities', ([], {}), '()\n', (6699, 6701), False, 'from fim.slivers.capacities_labels import Capacities\n'), ((6777, 6789), 'fim.slivers.capacities_labels.Capacities', 'Capacities', ([], {}), '()\n', (6787, 6789), False, 'from fim.slivers.capacities_labels import Capacities\n'), ((7035, 7052), 'collections.defaultdict', 'defaultdict', (['dict'], {}), '(dict)\n', (7046, 7052), False, 'from collections import defaultdict\n'), ((7195, 7212), 'collections.defaultdict', 'defaultdict', (['dict'], {}), '(dict)\n', (7206, 7212), False, 'from collections import defaultdict\n'), ((6141, 6182), 'fim.graph.networkx_property_graph.NetworkXGraphImporter', 'NetworkXGraphImporter', ([], {'logger': 'self.logger'}), '(logger=self.logger)\n', (6162, 6182), False, 'from fim.graph.networkx_property_graph import NetworkXGraphImporter\n'), ((6926, 6938), 'uuid.uuid4', 'uuid.uuid4', ([], {}), '()\n', (6936, 6938), False, 'import uuid\n'), ((10379, 10391), 'uuid.uuid4', 'uuid.uuid4', ([], {}), '()\n', (10389, 10391), False, 'import uuid\n'), ((13047, 13059), 'uuid.uuid4', 'uuid.uuid4', ([], {}), '()\n', (13057, 13059), False, 'import uuid\n'), ((13090, 13102), 'uuid.uuid4', 'uuid.uuid4', ([], {}), '()\n', (13100, 13102), False, 'import uuid\n'), ((6081, 6093), 'uuid.uuid4', 'uuid.uuid4', ([], {}), '()\n', (6091, 6093), False, 'import uuid\n'), ((11065, 11082), 'fim.slivers.attached_components.ComponentSliver', 'ComponentSliver', ([], {}), '()\n', (11080, 11082), False, 'from fim.slivers.attached_components import ComponentSliver, ComponentType\n'), ((11174, 11186), 'fim.slivers.capacities_labels.Capacities', 'Capacities', ([], {}), '()\n', (11184, 11186), False, 'from fim.slivers.capacities_labels import Capacities\n'), ((5477, 5489), 'uuid.uuid4', 'uuid.uuid4', ([], {}), '()\n', (5487, 5489), False, 'import uuid\n'), ((11449, 11461), 'fim.slivers.capacities_labels.Capacities', 'Capacities', ([], {}), '()\n', (11459, 11461), False, 'from fim.slivers.capacities_labels import Capacities\n'), ((11800, 11812), 'uuid.uuid4', 'uuid.uuid4', ([], {}), '()\n', (11810, 11812), False, 'import uuid\n'), ((9099, 9111), 'fim.slivers.capacities_labels.Capacities', 'Capacities', ([], {}), '()\n', (9109, 9111), False, 'from fim.slivers.capacities_labels import Capacities\n'), ((4706, 4718), 'fim.slivers.capacities_labels.Capacities', 'Capacities', ([], {}), '()\n', (4716, 4718), False, 'from fim.slivers.capacities_labels import Capacities\n')]
#!/usr/bin/env python # # Copyright (c) 2015 10X Genomics, Inc. All rights reserved. # import cPickle from collections import defaultdict from itertools import izip import json import numpy as np import cellranger.constants as cr_constants import cellranger.library_constants as lib_constants from cellranger.molecule_counter import MoleculeCounter import cellranger.rna.library as rna_library import cellranger.utils as cr_utils import tenkit.safe_json as tk_safe_json import tenkit.stats as tk_stats __MRO__ = """ stage SUBSAMPLE_READS( in h5 molecule_info, in csv filtered_barcodes, out json summary, src py "stages/counter/subsample_reads", ) split using ( in int chunk_start, in int chunk_len, in map[] subsample_info, out pickle metrics, ) """ def get_cell_associated_barcodes(genomes, filtered_barcodes_csv): """ Get cell-associated barcodes by genome. Args: genomes (list of str): Genome names. filtered_barcodes_csv (str): Path to CSV file. Returns: dict of (str, set): Map genome to list of cell-assoc barcodes. Empty-string key is for all genomes.""" cell_bcs = {} for genome in genomes: # Get all cell-assoc barcodes (ignoring genome) for the "" (blank) genome string cell_bcs[genome] = cr_utils.get_cell_associated_barcode_set(filtered_barcodes_csv, genome) # All cell-associated barcodes cell_bcs[''] = reduce(lambda x,y: x | y, cell_bcs.itervalues(), set()) return cell_bcs def split(args): # Get required info from the mol info mc = MoleculeCounter.open(args.molecule_info, 'r') genomes = sorted(set(f.tags.get('genome', '') for f in mc.feature_reference.feature_defs)) cell_bcs_by_genome = get_cell_associated_barcodes(genomes, args.filtered_barcodes) # Get cell counts per gem group n_cells_per_gg = defaultdict(int) for bc in cell_bcs_by_genome['']: _, gem_group = cr_utils.split_barcode_seq(bc) n_cells_per_gg[gem_group] += 1 # Assign gem group cell counts to their constituent libraries # TODO FIXME: Need to allow for per-library cell counts # because some feature types might only have a subset of the GEX cell-assoc barcodes. n_cells_per_lib = np.zeros(len(mc.library_info), dtype=int) for lib_idx, lib in enumerate(mc.library_info): n_cells_per_lib[lib_idx] = n_cells_per_gg[lib['gem_group']] if n_cells_per_lib.sum() == 0: return {'chunks': []} library_info = mc.library_info raw_count_per_lib = np.array(mc.get_raw_read_pairs_per_library()) raw_rppc_per_lib = raw_count_per_lib.astype(float) / n_cells_per_lib usable_count_per_lib = np.array(mc.get_usable_read_pairs_per_library()) subsamplings = list() # track subsample info definitions library_types = sorted(set(lib['library_type'] for lib in library_info)) for library_type in library_types: # All libraries w/ this type lib_indexes = np.array([i for i,lib in enumerate(library_info) if lib['library_type'] == library_type]) # For plotting, we want a series of target depths that exist for all # libraries w/ the same library type. When there's a single library # per type (the common case), this is trivial - split it into deciles. # But if there are multiple libraries with different depths, (e.g., # because gem-group-aggregation was used to increase cell numbers), # we need to find depths that are achievable for all libraries. # For now, let the lowest-depth library for a given type dictate this. min_raw_rppc = np.min(raw_rppc_per_lib[lib_indexes]) # Use deciles of the raw read pairs per cell. deciles = np.arange(0.1, 1.1, 0.1) plot_targets = map(round, min_raw_rppc * deciles) # TODO: separate this work (internal + non) raw_targets = cr_constants.SUBSAMPLE_READS_PER_CELL + \ plot_targets # TODO: separate this work (internal + non) usable_targets = cr_constants.SUBSAMPLE_READS_PER_CELL + \ plot_targets for targets, depth_type in \ ((raw_targets, cr_constants.RAW_SUBSAMPLE_TYPE), \ ((usable_targets, cr_constants.MAPPED_SUBSAMPLE_TYPE)),): targets = sorted(list(set(map(int, targets)))) for target_rppc in targets: if depth_type == cr_constants.RAW_SUBSAMPLE_TYPE: # Infer the usable depth required to achieve this raw depth usable_read_fracs = usable_count_per_lib.astype(float) / raw_count_per_lib target_usable_counts = target_rppc * n_cells_per_lib * usable_read_fracs else: target_usable_counts = target_rppc * n_cells_per_lib # Zero out libraries of the other types rates = np.zeros(len(library_info), dtype=float) rates[lib_indexes] = target_usable_counts[lib_indexes].astype(float) \ / usable_count_per_lib[lib_indexes] # Clamp rates that are close to 1 to 1 rates[np.absolute(rates - 1) < 1e-3] = 1 # Zero out the libraries for which we have fewer reads than the target rates[rates > 1] = 0.0 enough_data = np.any((rates > 0) & (rates <= 1)) if not enough_data: rates = np.zeros(len(rates)) subsamplings.append({ 'library_type': library_type, 'subsample_type': depth_type, 'target_read_pairs_per_cell': int(target_rppc), 'library_subsample_rates': list(map(float, rates)), }) # Each chunk needs to store a piece of the mol info h5 tgt_chunk_len = cr_constants.NUM_MOLECULE_INFO_ENTRIES_PER_CHUNK # Split the molecule info h5 into equi-RAM chunks chunks = [] for chunk_start, chunk_len in mc.get_chunks(tgt_chunk_len, preserve_boundaries=True): chunks.append({ 'chunk_start': chunk_start, 'chunk_len': chunk_len, 'subsample_info': subsamplings, # The estimate_mem_gb only count the memory usage for the MoleculeCounter object, which is # under-estimated the actual memory usage. # Based on memory profiling with test case fuzzer_114, actual memory usageis ~4x more # than estimate_mem_gb (without cap), here set scale = 6. '__mem_gb': MoleculeCounter.estimate_mem_gb(chunk_len, scale=6), }) join = { '__mem_gb': 6, } mc.close() # TODO: is this really necessary w/ martian 3 if len(chunks) == 0: chunks.append({ 'chunk_start': str(0), 'chunk_len': str(0), 'subsample_info': [], }) return {'chunks': chunks, 'join': join} def main(args, outs): np.random.seed(0) mc = MoleculeCounter.open(args.molecule_info, 'r') # Get cell-associated barcodes genomes = sorted(set(f.tags.get('genome', '') for f in mc.feature_reference.feature_defs)) cell_bcs_by_genome = get_cell_associated_barcodes(genomes, args.filtered_barcodes) # Load chunk of relevant data from the mol_info chunk = slice(int(args.chunk_start), int(args.chunk_start) + int(args.chunk_len)) mol_library_idx = mc.get_column_lazy('library_idx')[chunk] mol_read_pairs = mc.get_column_lazy('count')[chunk] mol_gem_group = mc.get_column_lazy('gem_group')[chunk] mol_barcode_idx = mc.get_column_lazy('barcode_idx')[chunk] mol_feature_idx = mc.get_column_lazy('feature_idx')[chunk] barcodes = mc.get_ref_column('barcodes') # Give each cell-associated barcode an integer index cell_bcs = sorted(list(cell_bcs_by_genome[''])) cell_bc_to_int = {bc: i for i, bc in enumerate(cell_bcs)} # Give each genome an integer index genome_to_int = {g: i for i, g in enumerate(genomes)} feature_int_to_genome_int = np.fromiter((genome_to_int[f.tags.get('genome', '')] for f in mc.feature_reference.feature_defs), dtype=int) mol_genome_idx = feature_int_to_genome_int[mol_feature_idx] # determine which (library type, genome) pairs have any associated reads lib_types = sorted(set(lib['library_type'] for lib in mc.library_info)) lib_type_to_int = {l: i for i, l in enumerate(lib_types)} lib_idx_to_lib_type_idx = np.fromiter((lib_type_to_int[lib['library_type']] for lib in mc.library_info), dtype=np.int) lib_type_genome_any_reads = np.zeros((len(lib_types), len(genomes)), dtype=np.bool) lib_genome_idx_pairs = set(izip(mol_library_idx[mol_read_pairs > 0], mol_genome_idx[mol_read_pairs > 0])) for (lib_idx, genome_idx) in lib_genome_idx_pairs: lib_type_idx = lib_idx_to_lib_type_idx[lib_idx] lib_type_genome_any_reads[lib_type_idx, genome_idx] = True # Run each subsampling task on this chunk of data n_tasks = len(args.subsample_info) n_genomes = len(genomes) n_cells = len(cell_bcs) umis_per_bc = np.zeros((n_tasks, n_genomes, n_cells)) features_det_per_bc = np.zeros((n_tasks, n_genomes, n_cells)) read_pairs_per_task = np.zeros((n_tasks, n_genomes)) umis_per_task = np.zeros((n_tasks, n_genomes)) for task_idx, task in enumerate(args.subsample_info): # Per-library subsampling rates rates_per_library = np.array(task['library_subsample_rates'], dtype=float) if np.count_nonzero(rates_per_library) == 0: continue mol_rate = rates_per_library[mol_library_idx] # Subsampled read pairs per molecule new_read_pairs = np.random.binomial(mol_read_pairs, mol_rate) # Compute tallies for each barcode group_keys = (mol_gem_group, mol_barcode_idx) group_values = (mol_feature_idx, mol_genome_idx, new_read_pairs) for (gg, bc_idx), (feature_idx, genome_idx, read_pairs) in \ cr_utils.numpy_groupby(group_values, group_keys): barcode = cr_utils.format_barcode_seq(barcodes[bc_idx], gg) cell_idx = cell_bc_to_int.get(barcode) for this_genome_idx in xrange(len(genomes)): umis = np.flatnonzero((read_pairs > 0) & (genome_idx == this_genome_idx)) this_genome_read_pairs = np.sum(read_pairs[genome_idx == this_genome_idx]) # Tally UMIs and median features detected if barcode in cell_bcs_by_genome[genomes[this_genome_idx]]: # This is a cell-associated barcode for this genome umis_per_bc[task_idx, this_genome_idx, cell_idx] = len(umis) features_det_per_bc[task_idx, this_genome_idx, cell_idx] = np.count_nonzero(np.bincount(feature_idx[umis])) # Tally numbers for duplicate fraction read_pairs_per_task[task_idx, this_genome_idx] += np.sum(this_genome_read_pairs) umis_per_task[task_idx, this_genome_idx] += len(umis) with open(outs.metrics, 'w') as f: data = { 'umis_per_bc': umis_per_bc, 'features_det_per_bc': features_det_per_bc, 'read_pairs': read_pairs_per_task, 'umis': umis_per_task, 'lib_type_genome_any_reads': lib_type_genome_any_reads, } cPickle.dump(data, f, protocol = cPickle.HIGHEST_PROTOCOL) def make_metric_name(name, library_type, genome, ss_type, ss_depth): lt_prefix = rna_library.get_library_type_metric_prefix(library_type) return '%s%s_%s_%s_%s' % (lt_prefix, genome, ss_type, ss_depth, name) def compute_dup_frac(read_pairs, umis): return tk_stats.robust_divide(read_pairs - umis, read_pairs) if read_pairs > 0 else 0.0 def join(args, outs, chunk_defs, chunk_outs): # Merge tallies data = None for chunk in chunk_outs: with open(chunk.metrics) as f: chunk_data = cPickle.load(f) if data is None: data = chunk_data else: for k,v in data.iteritems(): data[k] += chunk_data[k] # Compute metrics for each subsampling rate summary = {} with MoleculeCounter.open(args.molecule_info, 'r') as mc: genomes = sorted(set(f.tags.get('genome', '') for f in mc.feature_reference.feature_defs)) lib_types = sorted(set(lib['library_type'] for lib in mc.library_info)) lib_type_map = dict((lt, idx) for (idx, lt) in enumerate(lib_types)) cell_bcs_by_genome = get_cell_associated_barcodes(genomes, args.filtered_barcodes) # Give each cell-associated barcode an integer index cell_bcs = sorted(list(cell_bcs_by_genome[''])) cell_bc_to_int = {bc: i for i, bc in enumerate(cell_bcs)} subsample_info = chunk_defs[0].subsample_info if len(chunk_defs) > 0 else [] for i, task in enumerate(subsample_info): lib_type = task['library_type'] lib_type_idx = lib_type_map[lib_type] ss_type = task['subsample_type'] ss_depth = task['target_read_pairs_per_cell'] if rna_library.has_genomes(lib_type): genome_ints = list(range(data['umis_per_bc'].shape[1])) else: genome_ints = [0] # Per-genome metrics for g in genome_ints: if not data['lib_type_genome_any_reads'][lib_type_idx, g]: continue genome = genomes[g] # Only compute on cell-associated barcodes for this genome. # This only matters when there are multiple genomes present. cell_inds = np.array(sorted(cell_bc_to_int[bc] for bc in cell_bcs_by_genome[genome])) median_umis_per_cell = np.median(data['umis_per_bc'][i,g,cell_inds]) summary[make_metric_name('subsampled_filtered_bcs_median_counts', lib_type, genome, ss_type, ss_depth)] = median_umis_per_cell median_features_per_cell = np.median(data['features_det_per_bc'][i,g,cell_inds]) summary[make_metric_name('subsampled_filtered_bcs_median_unique_genes_detected', lib_type, genome, ss_type, ss_depth)] = median_features_per_cell dup_frac = compute_dup_frac(data['read_pairs'][i,g], data['umis'][i,g]) summary[make_metric_name('subsampled_duplication_frac', lib_type, genome, ss_type, ss_depth)] = dup_frac # Whole-dataset duplication frac all_read_pairs = np.sum(data['read_pairs'][i,:]) all_umis = np.sum(data['umis'][i,:]) dup_frac = compute_dup_frac(all_read_pairs, all_umis) summary[make_metric_name('subsampled_duplication_frac', lib_type, lib_constants.MULTI_REFS_PREFIX, ss_type, ss_depth)] = dup_frac with open(outs.summary, 'w') as f: json.dump(tk_safe_json.json_sanitize(summary), f, indent=4, sort_keys=True)
[ "numpy.absolute", "numpy.random.seed", "numpy.sum", "cPickle.load", "collections.defaultdict", "cellranger.molecule_counter.MoleculeCounter.estimate_mem_gb", "numpy.arange", "numpy.fromiter", "cellranger.molecule_counter.MoleculeCounter.open", "cellranger.rna.library.get_library_type_metric_prefix", "cellranger.utils.numpy_groupby", "numpy.bincount", "tenkit.stats.robust_divide", "cellranger.utils.format_barcode_seq", "numpy.random.binomial", "numpy.median", "cellranger.utils.get_cell_associated_barcode_set", "numpy.min", "tenkit.safe_json.json_sanitize", "numpy.count_nonzero", "cellranger.utils.split_barcode_seq", "numpy.flatnonzero", "numpy.zeros", "numpy.any", "cPickle.dump", "cellranger.rna.library.has_genomes", "numpy.array", "itertools.izip" ]
[((1651, 1696), 'cellranger.molecule_counter.MoleculeCounter.open', 'MoleculeCounter.open', (['args.molecule_info', '"""r"""'], {}), "(args.molecule_info, 'r')\n", (1671, 1696), False, 'from cellranger.molecule_counter import MoleculeCounter\n'), ((1938, 1954), 'collections.defaultdict', 'defaultdict', (['int'], {}), '(int)\n', (1949, 1954), False, 'from collections import defaultdict\n'), ((7077, 7094), 'numpy.random.seed', 'np.random.seed', (['(0)'], {}), '(0)\n', (7091, 7094), True, 'import numpy as np\n'), ((7105, 7150), 'cellranger.molecule_counter.MoleculeCounter.open', 'MoleculeCounter.open', (['args.molecule_info', '"""r"""'], {}), "(args.molecule_info, 'r')\n", (7125, 7150), False, 'from cellranger.molecule_counter import MoleculeCounter\n'), ((8627, 8724), 'numpy.fromiter', 'np.fromiter', (["(lib_type_to_int[lib['library_type']] for lib in mc.library_info)"], {'dtype': 'np.int'}), "((lib_type_to_int[lib['library_type']] for lib in mc.\n library_info), dtype=np.int)\n", (8638, 8724), True, 'import numpy as np\n'), ((9346, 9385), 'numpy.zeros', 'np.zeros', (['(n_tasks, n_genomes, n_cells)'], {}), '((n_tasks, n_genomes, n_cells))\n', (9354, 9385), True, 'import numpy as np\n'), ((9412, 9451), 'numpy.zeros', 'np.zeros', (['(n_tasks, n_genomes, n_cells)'], {}), '((n_tasks, n_genomes, n_cells))\n', (9420, 9451), True, 'import numpy as np\n'), ((9478, 9508), 'numpy.zeros', 'np.zeros', (['(n_tasks, n_genomes)'], {}), '((n_tasks, n_genomes))\n', (9486, 9508), True, 'import numpy as np\n'), ((9529, 9559), 'numpy.zeros', 'np.zeros', (['(n_tasks, n_genomes)'], {}), '((n_tasks, n_genomes))\n', (9537, 9559), True, 'import numpy as np\n'), ((11760, 11816), 'cellranger.rna.library.get_library_type_metric_prefix', 'rna_library.get_library_type_metric_prefix', (['library_type'], {}), '(library_type)\n', (11802, 11816), True, 'import cellranger.rna.library as rna_library\n'), ((1312, 1383), 'cellranger.utils.get_cell_associated_barcode_set', 'cr_utils.get_cell_associated_barcode_set', (['filtered_barcodes_csv', 'genome'], {}), '(filtered_barcodes_csv, genome)\n', (1352, 1383), True, 'import cellranger.utils as cr_utils\n'), ((2016, 2046), 'cellranger.utils.split_barcode_seq', 'cr_utils.split_barcode_seq', (['bc'], {}), '(bc)\n', (2042, 2046), True, 'import cellranger.utils as cr_utils\n'), ((3710, 3747), 'numpy.min', 'np.min', (['raw_rppc_per_lib[lib_indexes]'], {}), '(raw_rppc_per_lib[lib_indexes])\n', (3716, 3747), True, 'import numpy as np\n'), ((3821, 3845), 'numpy.arange', 'np.arange', (['(0.1)', '(1.1)', '(0.1)'], {}), '(0.1, 1.1, 0.1)\n', (3830, 3845), True, 'import numpy as np\n'), ((8882, 8959), 'itertools.izip', 'izip', (['mol_library_idx[mol_read_pairs > 0]', 'mol_genome_idx[mol_read_pairs > 0]'], {}), '(mol_library_idx[mol_read_pairs > 0], mol_genome_idx[mol_read_pairs > 0])\n', (8886, 8959), False, 'from itertools import izip\n'), ((9687, 9741), 'numpy.array', 'np.array', (["task['library_subsample_rates']"], {'dtype': 'float'}), "(task['library_subsample_rates'], dtype=float)\n", (9695, 9741), True, 'import numpy as np\n'), ((9943, 9987), 'numpy.random.binomial', 'np.random.binomial', (['mol_read_pairs', 'mol_rate'], {}), '(mol_read_pairs, mol_rate)\n', (9961, 9987), True, 'import numpy as np\n'), ((10240, 10288), 'cellranger.utils.numpy_groupby', 'cr_utils.numpy_groupby', (['group_values', 'group_keys'], {}), '(group_values, group_keys)\n', (10262, 10288), True, 'import cellranger.utils as cr_utils\n'), ((11614, 11670), 'cPickle.dump', 'cPickle.dump', (['data', 'f'], {'protocol': 'cPickle.HIGHEST_PROTOCOL'}), '(data, f, protocol=cPickle.HIGHEST_PROTOCOL)\n', (11626, 11670), False, 'import cPickle\n'), ((11943, 11996), 'tenkit.stats.robust_divide', 'tk_stats.robust_divide', (['(read_pairs - umis)', 'read_pairs'], {}), '(read_pairs - umis, read_pairs)\n', (11965, 11996), True, 'import tenkit.stats as tk_stats\n'), ((12443, 12488), 'cellranger.molecule_counter.MoleculeCounter.open', 'MoleculeCounter.open', (['args.molecule_info', '"""r"""'], {}), "(args.molecule_info, 'r')\n", (12463, 12488), False, 'from cellranger.molecule_counter import MoleculeCounter\n'), ((13333, 13366), 'cellranger.rna.library.has_genomes', 'rna_library.has_genomes', (['lib_type'], {}), '(lib_type)\n', (13356, 13366), True, 'import cellranger.rna.library as rna_library\n'), ((14766, 14798), 'numpy.sum', 'np.sum', (["data['read_pairs'][i, :]"], {}), "(data['read_pairs'][i, :])\n", (14772, 14798), True, 'import numpy as np\n'), ((14817, 14843), 'numpy.sum', 'np.sum', (["data['umis'][i, :]"], {}), "(data['umis'][i, :])\n", (14823, 14843), True, 'import numpy as np\n'), ((9754, 9789), 'numpy.count_nonzero', 'np.count_nonzero', (['rates_per_library'], {}), '(rates_per_library)\n', (9770, 9789), True, 'import numpy as np\n'), ((10313, 10362), 'cellranger.utils.format_barcode_seq', 'cr_utils.format_barcode_seq', (['barcodes[bc_idx]', 'gg'], {}), '(barcodes[bc_idx], gg)\n', (10340, 10362), True, 'import cellranger.utils as cr_utils\n'), ((12200, 12215), 'cPickle.load', 'cPickle.load', (['f'], {}), '(f)\n', (12212, 12215), False, 'import cPickle\n'), ((13948, 13995), 'numpy.median', 'np.median', (["data['umis_per_bc'][i, g, cell_inds]"], {}), "(data['umis_per_bc'][i, g, cell_inds])\n", (13957, 13995), True, 'import numpy as np\n'), ((14210, 14265), 'numpy.median', 'np.median', (["data['features_det_per_bc'][i, g, cell_inds]"], {}), "(data['features_det_per_bc'][i, g, cell_inds])\n", (14219, 14265), True, 'import numpy as np\n'), ((15135, 15170), 'tenkit.safe_json.json_sanitize', 'tk_safe_json.json_sanitize', (['summary'], {}), '(summary)\n', (15161, 15170), True, 'import tenkit.safe_json as tk_safe_json\n'), ((5467, 5501), 'numpy.any', 'np.any', (['((rates > 0) & (rates <= 1))'], {}), '((rates > 0) & (rates <= 1))\n', (5473, 5501), True, 'import numpy as np\n'), ((6669, 6720), 'cellranger.molecule_counter.MoleculeCounter.estimate_mem_gb', 'MoleculeCounter.estimate_mem_gb', (['chunk_len'], {'scale': '(6)'}), '(chunk_len, scale=6)\n', (6700, 6720), False, 'from cellranger.molecule_counter import MoleculeCounter\n'), ((10496, 10562), 'numpy.flatnonzero', 'np.flatnonzero', (['((read_pairs > 0) & (genome_idx == this_genome_idx))'], {}), '((read_pairs > 0) & (genome_idx == this_genome_idx))\n', (10510, 10562), True, 'import numpy as np\n'), ((10604, 10653), 'numpy.sum', 'np.sum', (['read_pairs[genome_idx == this_genome_idx]'], {}), '(read_pairs[genome_idx == this_genome_idx])\n', (10610, 10653), True, 'import numpy as np\n'), ((11192, 11222), 'numpy.sum', 'np.sum', (['this_genome_read_pairs'], {}), '(this_genome_read_pairs)\n', (11198, 11222), True, 'import numpy as np\n'), ((5274, 5296), 'numpy.absolute', 'np.absolute', (['(rates - 1)'], {}), '(rates - 1)\n', (5285, 5296), True, 'import numpy as np\n'), ((11038, 11068), 'numpy.bincount', 'np.bincount', (['feature_idx[umis]'], {}), '(feature_idx[umis])\n', (11049, 11068), True, 'import numpy as np\n')]
import contextlib import logging import requests from os.path import join, isfile from django.apps import apps from django.conf import settings from django.db.models import Q from django.http import Http404 from django.template.response import TemplateResponse from django.utils.translation import get_language import bs4 from apps.summary.renderers.approaches_2015 import Approaches2015FullSummaryRenderer from apps.summary.renderers.technologies_2015 import \ Technology2015FullSummaryRenderer from apps.summary.renderers.technologies_2018 import \ Technology2018FullSummaryRenderer from wkhtmltopdf.views import PDFTemplateView, PDFTemplateResponse from apps.questionnaire.models import Questionnaire from apps.questionnaire.utils import get_query_status_filter, \ get_questionnaire_data_in_single_language logger = logging.getLogger(__name__) class CachedPDFTemplateResponse(PDFTemplateResponse): """ Creating the pdf includes two resource-heavy processes: - extracting the json to markup (frontend) - call to wkhtmltopdf (backend) Therefore, the content is created only once per filename (which should distinguish between new questionnaire edits). This only works with reasonably precise file names! """ @property def file_path(self): return join(settings.SUMMARY_PDF_PATH, self.filename) def get_rendered_content(self): return super().rendered_content def content_with_file_cache(self): if isfile(self.file_path): # Catch any exception, worst case is that the pdf is created from # scratch again with contextlib.suppress(Exception) as e: return open(self.file_path, 'rb').read() content = self.get_rendered_content() with contextlib.suppress(Exception) as e: open(self.file_path, 'wb').write(content) return content @property def rendered_content(self): if settings.DEBUG: return self.get_rendered_content() else: return self.content_with_file_cache() class RawTemplateResponse(TemplateResponse): """ Create HTML with the default template response, cast the markup to a table. """ def rows_to_tr(self): """ Prepend a row with 12 elements, forcing 'proper' width of following rows """ for row in self.soup.select('.row'): table = self.soup.new_tag('table') table.attrs['width'] = '100%' row.wrap(table) grid_12_columns = '<tr>' for i in range(0, 12): grid_12_columns += '<td width="8.3%"></td>' grid_12_columns += '</tr>' row.insert_before(bs4.BeautifulSoup(grid_12_columns, 'lxml')) if 'range' not in row.attrs['class']: row.unwrap() def columns_to_td(self): """ Use columns-width as colspan. """ for column in self.soup.select('.columns'): column.name = 'td' for i, class_name in enumerate(column.attrs['class']): if class_name.startswith('small'): # Use number of grid rows for colspan column.attrs['colspan'] = class_name[6:] del column.attrs['class'][i] def highlight_list_to_bold(self): """ CSS highlights can not be seen in word, make them bold. """ for highlight in self.soup.select('.highlights_list > .true'): highlight.wrap(self.soup.new_tag('strong')) def header_image_to_foreground(self): """ Copy the background-image to the front, so it is copied automatically. """ header = self.soup.select('div.header-img') if header: style_tag = header[0].attrs['style'] url = style_tag[style_tag.index('(') + 1:-1] image = self.soup.new_tag('img', src=url, **{'class': 'header-img'}) header[0].attrs['style'] = '' header[0].insert(0, image) def range_to_table(self): """ Cast the 'ranges' to a more basic format: wrap the parent container with a table, and cast the divs to tds. """ for range_min in self.soup.select('.range_min'): range_container = range_min.parent.parent range_table = self.soup.new_tag('table') range_container.insert(0, range_table) for i, div in enumerate(range_container.select('div')): div.name = 'td' extracted = div.extract() range_table.insert(i, extracted) for selected in self.soup.select('.range_true'): selected.insert(0, bs4.NavigableString('x')) def normalize_rotated_range(self): """ Normalize 'rotated' ranges, indicated by the class 'vertical-title' """ for container in self.soup.select('.vertical-title'): # Extract the labels from the header. for header_labels in container.select('.rotate'): labels = [] header_labels.wrap(self.soup.new_tag('table')) for div in header_labels.select('div'): labels.append(div.text) # Fill in the checked value as text, remove all ranges. for sibling in container.find_next_siblings('div'): squares = sibling.select('.range_square') if squares: # Get the position of the selected element for i, square in enumerate(squares[0].parent.select('div')): if 'range_true' in square.get('class', []): # Print the text-label squares[0].parent.parent.insert(0, bs4.NavigableString(labels[i])) # Remove the squares. squares[0].parent.decompose() # Remove the header row. container.decompose() # Remove the additional lines with 'hr' tags. for inline_comment in self.soup.select('.inline-comment'): for hr in inline_comment.select('hr'): hr.parent.decompose() def approach_flow_chart_header(self): """ Move chart to bottom of the text. """ flow_chart_container = self.soup.select('.approach-flow-chart') if flow_chart_container: image = flow_chart_container[0].select('.img_in_text') if image: flow_chart_container[0].insert(-1, image[0].extract()) def html_to_table(self, html: str) -> str: """ Cast the 'fluid' markup to a table so the word-document looks as expected by the researchers. """ self.soup = bs4.BeautifulSoup(html, 'lxml') css = self.soup.find('link') # Cache busting is only done with respect to 'summary.css', so in case # changes on the summary_raw.css are made, also change a blank in # 'summary.css'. css.attrs['href'] = css.attrs['href'].replace( 'summary.css', 'summary_raw.css' ) self.header_image_to_foreground() self.approach_flow_chart_header() self.highlight_list_to_bold() self.columns_to_td() self.range_to_table() self.normalize_rotated_range() self.rows_to_tr() return str(self.soup) @property def rendered_content(self): return self.html_to_table(super().rendered_content) class SummaryPDFCreateView(PDFTemplateView): """ Put the questionnaire data to the context and return the rendered pdf. """ response_class = CachedPDFTemplateResponse doc_response_class = RawTemplateResponse summary_type = 'full' # Only one summary type is available right now base_template_path = 'summary/' http_method_names = ['get'] render_classes = { 'technologies_2018': {'full': Technology2018FullSummaryRenderer}, 'technologies_2015': {'full': Technology2015FullSummaryRenderer}, 'approaches_2015': {'full': Approaches2015FullSummaryRenderer} } footer_template = '{}layout/footer.html'.format(base_template_path) # see: http://wkhtmltopdf.org/usage/wkhtmltopdf.txt cmd_options = { 'dpi': '96', 'margin-top': '1cm', 'margin-bottom': '1cm', } default_quality = 'screen' @property def is_doc_file(self): return self.request.GET.get('as', '') == 'doc' @property def css_class(self): return f'is-{self.questionnaire.configuration.code}' def get(self, request, *args, **kwargs): self.questionnaire = self.get_object(questionnaire_id=self.kwargs['id']) self.quality = self.request.GET.get('quality', self.default_quality) # filename is set withing render_to_response, this is too late as it's # used for caching. self.filename = self.get_filename() if self.is_doc_file: self.response_class = self.doc_response_class self.track_request() return super().get(request, *args, **kwargs) def get_template_names(self): template = self.request.GET.get('template', 'base') return '{}/layout/{}.html'.format(self.base_template_path, template) def get_filename(self) -> str: """ The filename is specific enough to be used as 'pseudo cache-key' in the CachedPDFTemplateResponse. """ return 'wocat-{identifier}-{edition}-{language}-{summary_type}-' \ '{quality}-{update}.pdf'.format( identifier=self.questionnaire.id, edition=self.questionnaire.configuration.id, language=get_language(), summary_type=self.summary_type, quality=self.quality, update=self.questionnaire.updated.strftime('%Y-%m-%d-%H-%M') ) def get_object(self, questionnaire_id: int) -> Questionnaire: """ Get questionnaire and check status / permissions. """ status_filter = get_query_status_filter(self.request) status_filter &= Q(id=questionnaire_id) obj = Questionnaire.with_status.not_deleted().filter( Q(id=questionnaire_id), status_filter ).distinct() if not obj.exists() or obj.count() != 1: raise Http404 return obj.first() def get_summary_data(self, **data): """ Get summary data from renderer according to configuration. """ identifier = f'{self.questionnaire.configuration.code}_' \ f'{self.questionnaire.configuration.edition}' try: renderer = self.render_classes[identifier][self.summary_type] except KeyError: raise Http404 return renderer( config=self.questionnaire.configuration_object, questionnaire=self.questionnaire, quality=self.quality, base_url=self.request.build_absolute_uri('/'), **data ).render() def get_prepared_data(self, questionnaire: Questionnaire) -> dict: """ Load the prepared JSON for given object in the current language. """ data = get_questionnaire_data_in_single_language( questionnaire_data=questionnaire.data, locale=get_language(), original_locale=questionnaire.original_locale ) return self.get_summary_data(**data) def get_footer_context(self) -> dict: """ Provide variables used in the footer template. """ name = self.questionnaire.get_name() if len(name) > 70: name = '{}...'.format(name[:67]) return { 'footer_name': name, 'footer_config': self.questionnaire.configuration.code.title() } def get_context_data(self, **kwargs): context = super().get_context_data(**kwargs) context['css_file_hash'] = apps.get_app_config('summary').css_file_hash context['css_class'] = self.css_class context['sections'] = self.get_prepared_data(self.questionnaire) context.update(self.get_footer_context()) # For languages with no spaces between words (e.g. Lao, Khmer), add CSS # line break rule if either the questionnaire or its original version is # in one of these languages. if self.questionnaire.original_locale in settings.WORD_WRAP_LANGUAGES \ or self.request.LANGUAGE_CODE in settings.WORD_WRAP_LANGUAGES: context['break_words'] = True return context def track_request(self): """ Submit a summary-download event to matomo. """ if settings.PIWIK_SITE_ID: # Downloads are not properly registered for relative urls, so build the complete url. url = f'{self.request.scheme}://{self.request.META["HTTP_HOST"]}{self.request.path}' payload = dict( idsite=settings.PIWIK_SITE_ID, token_auth=settings.PIWIK_AUTH_TOKEN, rec=1, apiv=1, url=url, download=url ) if self.request.user.is_authenticated(): payload['_id'] = self.request.user.id if settings.DEBUG: # Also see https://developer.matomo.org/api-reference/tracking-api > # Debugging the Tracker payload['debug'] = 1 try: requests.get(f'{settings.PIWIK_URL}matomo.php', params=payload) except Exception: # Don't raise any kind of exception for failed tracking. logger.error( f'Cannot track summary download for url %s (%s)', f'{settings.PIWIK_URL}matomo.php', payload )
[ "bs4.NavigableString", "django.db.models.Q", "contextlib.suppress", "apps.questionnaire.models.Questionnaire.with_status.not_deleted", "os.path.isfile", "django.apps.apps.get_app_config", "requests.get", "apps.questionnaire.utils.get_query_status_filter", "bs4.BeautifulSoup", "django.utils.translation.get_language", "os.path.join", "logging.getLogger" ]
[((836, 863), 'logging.getLogger', 'logging.getLogger', (['__name__'], {}), '(__name__)\n', (853, 863), False, 'import logging\n'), ((1315, 1361), 'os.path.join', 'join', (['settings.SUMMARY_PDF_PATH', 'self.filename'], {}), '(settings.SUMMARY_PDF_PATH, self.filename)\n', (1319, 1361), False, 'from os.path import join, isfile\n'), ((1490, 1512), 'os.path.isfile', 'isfile', (['self.file_path'], {}), '(self.file_path)\n', (1496, 1512), False, 'from os.path import join, isfile\n'), ((6836, 6867), 'bs4.BeautifulSoup', 'bs4.BeautifulSoup', (['html', '"""lxml"""'], {}), "(html, 'lxml')\n", (6853, 6867), False, 'import bs4\n'), ((10129, 10166), 'apps.questionnaire.utils.get_query_status_filter', 'get_query_status_filter', (['self.request'], {}), '(self.request)\n', (10152, 10166), False, 'from apps.questionnaire.utils import get_query_status_filter, get_questionnaire_data_in_single_language\n'), ((10192, 10214), 'django.db.models.Q', 'Q', ([], {'id': 'questionnaire_id'}), '(id=questionnaire_id)\n', (10193, 10214), False, 'from django.db.models import Q\n'), ((1791, 1821), 'contextlib.suppress', 'contextlib.suppress', (['Exception'], {}), '(Exception)\n', (1810, 1821), False, 'import contextlib\n'), ((12035, 12065), 'django.apps.apps.get_app_config', 'apps.get_app_config', (['"""summary"""'], {}), "('summary')\n", (12054, 12065), False, 'from django.apps import apps\n'), ((1637, 1667), 'contextlib.suppress', 'contextlib.suppress', (['Exception'], {}), '(Exception)\n', (1656, 1667), False, 'import contextlib\n'), ((2729, 2771), 'bs4.BeautifulSoup', 'bs4.BeautifulSoup', (['grid_12_columns', '"""lxml"""'], {}), "(grid_12_columns, 'lxml')\n", (2746, 2771), False, 'import bs4\n'), ((4730, 4754), 'bs4.NavigableString', 'bs4.NavigableString', (['"""x"""'], {}), "('x')\n", (4749, 4754), False, 'import bs4\n'), ((9779, 9793), 'django.utils.translation.get_language', 'get_language', ([], {}), '()\n', (9791, 9793), False, 'from django.utils.translation import get_language\n'), ((11401, 11415), 'django.utils.translation.get_language', 'get_language', ([], {}), '()\n', (11413, 11415), False, 'from django.utils.translation import get_language\n'), ((13586, 13649), 'requests.get', 'requests.get', (['f"""{settings.PIWIK_URL}matomo.php"""'], {'params': 'payload'}), "(f'{settings.PIWIK_URL}matomo.php', params=payload)\n", (13598, 13649), False, 'import requests\n'), ((10289, 10311), 'django.db.models.Q', 'Q', ([], {'id': 'questionnaire_id'}), '(id=questionnaire_id)\n', (10290, 10311), False, 'from django.db.models import Q\n'), ((10229, 10268), 'apps.questionnaire.models.Questionnaire.with_status.not_deleted', 'Questionnaire.with_status.not_deleted', ([], {}), '()\n', (10266, 10268), False, 'from apps.questionnaire.models import Questionnaire\n'), ((5843, 5873), 'bs4.NavigableString', 'bs4.NavigableString', (['labels[i]'], {}), '(labels[i])\n', (5862, 5873), False, 'import bs4\n')]
# Copyright (c) 2003, 2004 <NAME> # contributions by <NAME> # contributions by <NAME> import sys import types import os import hashlib import dparser_swigc class user_pyobjectsPtr: def __init__(self, this): self.this = this def __setattr__(self, name, value): if name == "t": self.this.__setattr__(name, value) return self.__dict__[name] = value def __getattr__(self, name): if name == "t": return self.this.__getattr__(name) raise AttributeError(name) def __repr__(self): return "<C user_pyobjects instance>" class d_loc_tPtr: def __init__(self, this, d_parser): self.this = this self.d_parser = d_parser def __setattr__(self, name, value): if name == "s": dparser_swigc.my_d_loc_t_s_set(self.this, self.d_parser, value) elif name in ["pathname", "previous_col", "col", "line", "ws"]: self.this.__setattr__(name, value) else: self.__dict__[name] = value def __getattr__(self, name): if name == "s": return dparser_swigc.my_d_loc_t_s_get(self.this, self.d_parser) elif name in ["pathname", "previous_col", "col", "line", "ws"]: return self.this.__getattr__(name) raise AttributeError(name) def __repr__(self): return "<C d_loc_t instance>" class d_loc_t(d_loc_tPtr): def __init__(self, this, d_parser, buf): d_loc_tPtr.__init__(self, this, d_parser) self.buf = buf class D_ParseNodePtr: def __init__(self, this): self.this = this def __setattr__(self, name, value): if name == "end_skip": dparser_swigc.my_D_ParseNode_end_skip_set(self.this, self.d_parser, value) elif name == "end": dparser_swigc.my_D_ParseNode_end_set(self.this, self.d_parser, value) elif name in ["start_loc", "globals", "user"]: self.this.__setattr__(name, value) else: self.__dict__[name] = value def __getattr__(self, name): if name == "symbol": return dparser_swigc.my_D_ParseNode_symbol_get( self.this, self.d_parser).decode('string_escape') elif name == "end": return dparser_swigc.my_D_ParseNode_end_get( self.this, self.d_parser) elif name == "end_skip": return dparser_swigc.my_D_ParseNode_end_skip_get( self.this, self.d_parser) elif name == "globals": return self.this.__getattr__(name) elif name == "number_of_children": return dparser_swigc.d_get_number_of_children(self.this) elif name == "user": return user_pyobjectsPtr(self.this.__getattr__(name)) elif name == "start_loc": val = self.__dict__.get(name) if not val: val = self.__dict__[name] = d_loc_t( self.this.start_loc, self.d_parser, self.buf) return val elif name == "c": children = self.__dict__.get(name, None) if not children: dparser_swigc.d_get_number_of_children(self.this) children = [] for i in xrange(dparser_swigc.d_get_number_off_children( self.this)): children.append( D_ParseNode(dparser_swigc.d_get_child(self.this, i), self.d_parser, self.buf) ) self.__dict__[name] = children return children raise AttributeError(name) def __repr__(self): return "<C D_ParseNode instance>" class D_ParseNode(D_ParseNodePtr): def __init__(self, this, d_parser, buf): D_ParseNodePtr.__init__(self, this) self.d_parser = d_parser self.buf = buf dparser_swigc.add_parse_tree_viewer(self.d_parser) def __del__(self): dparser_swigc.remove_parse_tree_viewer(self.d_parser) class Reject: pass class SyntaxErr(Exception): pass class AmbiguityException(Exception): pass def my_syntax_error_func(loc): ee = '...' be = '...' width = 25 mn = loc.s - width if mn < 0: mn = 0 be = '' mx = loc.s + 25 if mx > len(loc.buf): mx = len(loc.buf) ee = '' begin = loc.buf[mn:loc.s].decode('utf-8') end = loc.buf[loc.s:mx].decode('utf-8') s = ('\n\nsyntax error, line:' + str(loc.line) + '\n\n' + be + begin + '[syntax error]' + end + ee + '\n') raise SyntaxErr(s) def my_ambiguity_func(nodes): raise AmbiguityException("\nunresolved ambiguity. Symbols:\n" + '\n'.join([node.symbol for node in nodes])) class Tables: def __init__(self): self.sig = hashlib.md5(u'1.31'.encode('utf-8')) self.tables = None def __del__(self): if self.tables: dparser_swigc.unload_parser_tables(self.tables) def update(self, data): self.sig.update(data.encode('utf-8')) def sig_changed(self, filename): filename = filename + '.md5' if os.path.exists(filename): with open(filename, 'rb') as fh: return fh.read() != self.sig.digest() return True def load_tables(self, grammar_str, filename, make_grammar_file): if make_grammar_file: with open(filename, 'wb') as fh: fh.write(grammar_str) if self.sig_changed(filename): dparser_swigc.make_tables(grammar_str, filename.encode()) with open(filename + '.md5', 'wb') as fh: fh.write(self.sig.digest()) if self.tables: dparser_swigc.unload_parser_tables(self.tables) self.tables = dparser_swigc.load_parser_tables( (filename + ".d_parser.dat").encode('utf-8')) def getTables(self): return self.tables class ParsingException(Exception): pass class NoActionsFound(Exception): pass class Parser: def __init__(self, modules=None, parser_folder=None, file_prefix="d_parser_mach_gen", make_grammar_file=False): self.tables = Tables() self.actions = [] if not modules: try: raise RuntimeError except RuntimeError: traceback = sys.exc_info()[2] dicts = [traceback.tb_frame.f_back.f_globals] else: if isinstance(modules, list): dicts = [module.__dict__ for module in modules] elif isinstance(modules, dict): dicts = [modules] else: dicts = [modules.__dict__] functions = [] for dictionary in dicts: f = [val for name, val in dictionary.items() if (isinstance(val, types.FunctionType)) and name[0:2] == 'd_'] f = sorted(f, key=lambda x: (x.__code__.co_filename, x.__code__.co_firstlineno)) functions.extend(f) if len(functions) == 0: raise "\nno actions found. Action names must start with 'd_'" if parser_folder is None: parser_folder = os.path.dirname(sys.argv[0]) if len(parser_folder) == 0: parser_folder = os.getcwd() parser_folder = parser_folder.replace('\\', '/') self.filename = os.path.join(parser_folder, file_prefix + ".g") grammar_str = [] self.takes_strings = 0 self.takes_globals = 0 for f in functions: if f.__doc__: grammar_str.append(f.__doc__) self.tables.update(f.__doc__) else: raise "\naction missing doc string:\n\t" + f.__name__ grammar_str.append(" ${action};\n") if f.__code__.co_argcount == 0: raise ("\naction " + f.__name__ + " must take at least one argument\n") speculative = 0 arg_types = [0] for i in range(1, f.__code__.co_argcount): var = f.__code__.co_varnames[i] if var == 'spec': arg_types.append(1) speculative = 1 elif var == 'g': arg_types.append(2) self.takes_globals = 1 elif var == 's': arg_types.append(3) self.takes_strings = 1 elif var == 'nodes': arg_types.append(4) elif var == 'this': arg_types.append(5) elif var == 'spec_only': arg_types.append(6) speculative = -1 elif var == 'parser': arg_types.append(7) else: raise ("\nunknown argument name:\n\t" + var + "\nin function:\n\t" + f.__name__) self.actions.append((f, arg_types, speculative)) grammar_str = ''.join(grammar_str).encode() self.tables.load_tables(grammar_str, self.filename, make_grammar_file) def parse(self, buf, buf_offset=0, initial_skip_space_fn=None, syntax_error_fn=my_syntax_error_func, ambiguity_fn=my_ambiguity_func, make_token=None, dont_fixup_internal_productions=False, fixup_EBNF_productions=False, dont_merge_epsilon_trees=False, commit_actions_interval=100, error_recovery=False, print_debug_info=False, partial_parses=False, dont_compare_stacks=False, dont_use_greediness_for_disambiguation=False, dont_use_height_for_disambiguation=False, start_symbol=''): # workaround python3/2 t = str try: t = basestring except NameError: pass if not isinstance(buf, t): raise ParsingException( "Message to parse is not a string: %r" % buf) # dparser works with bytes buf = buf.encode('utf-8') parser = dparser_swigc.make_parser( self.tables.getTables(), self, Reject, make_token, d_loc_t, D_ParseNode, self.actions, initial_skip_space_fn, syntax_error_fn, ambiguity_fn, dont_fixup_internal_productions, fixup_EBNF_productions, dont_merge_epsilon_trees, commit_actions_interval, error_recovery, print_debug_info, partial_parses, dont_compare_stacks, dont_use_greediness_for_disambiguation, dont_use_height_for_disambiguation, start_symbol.encode('utf-8'), self.takes_strings, self.takes_globals ) result = dparser_swigc.run_parser(parser, buf, buf_offset) return ParsedStructure(result) class ParsedStructure: def __init__(self, result): self.string_left = "" self.structure = None self.top_node = None if result: if len(result) == 3: self.string_left = result[2] node = result[1] # D_ParseNode(node.this, node.d_parser, node.buf) self.top_node = node self.structure = result[0] def getStructure(self): return self.structure def getStringLeft(self): return self.string_left
[ "dparser_swigc.d_get_child", "dparser_swigc.my_D_ParseNode_end_skip_get", "dparser_swigc.my_D_ParseNode_symbol_get", "sys.exc_info", "os.path.join", "dparser_swigc.d_get_number_of_children", "dparser_swigc.my_D_ParseNode_end_set", "os.path.dirname", "os.path.exists", "dparser_swigc.my_d_loc_t_s_get", "dparser_swigc.unload_parser_tables", "dparser_swigc.add_parse_tree_viewer", "dparser_swigc.remove_parse_tree_viewer", "dparser_swigc.run_parser", "dparser_swigc.d_get_number_off_children", "dparser_swigc.my_D_ParseNode_end_skip_set", "os.getcwd", "dparser_swigc.my_D_ParseNode_end_get", "dparser_swigc.my_d_loc_t_s_set" ]
[((4036, 4086), 'dparser_swigc.add_parse_tree_viewer', 'dparser_swigc.add_parse_tree_viewer', (['self.d_parser'], {}), '(self.d_parser)\n', (4071, 4086), False, 'import dparser_swigc\n'), ((4119, 4172), 'dparser_swigc.remove_parse_tree_viewer', 'dparser_swigc.remove_parse_tree_viewer', (['self.d_parser'], {}), '(self.d_parser)\n', (4157, 4172), False, 'import dparser_swigc\n'), ((5319, 5343), 'os.path.exists', 'os.path.exists', (['filename'], {}), '(filename)\n', (5333, 5343), False, 'import os\n'), ((7634, 7681), 'os.path.join', 'os.path.join', (['parser_folder', "(file_prefix + '.g')"], {}), "(parser_folder, file_prefix + '.g')\n", (7646, 7681), False, 'import os\n'), ((11080, 11129), 'dparser_swigc.run_parser', 'dparser_swigc.run_parser', (['parser', 'buf', 'buf_offset'], {}), '(parser, buf, buf_offset)\n', (11104, 11129), False, 'import dparser_swigc\n'), ((811, 874), 'dparser_swigc.my_d_loc_t_s_set', 'dparser_swigc.my_d_loc_t_s_set', (['self.this', 'self.d_parser', 'value'], {}), '(self.this, self.d_parser, value)\n', (841, 874), False, 'import dparser_swigc\n'), ((1125, 1181), 'dparser_swigc.my_d_loc_t_s_get', 'dparser_swigc.my_d_loc_t_s_get', (['self.this', 'self.d_parser'], {}), '(self.this, self.d_parser)\n', (1155, 1181), False, 'import dparser_swigc\n'), ((1709, 1783), 'dparser_swigc.my_D_ParseNode_end_skip_set', 'dparser_swigc.my_D_ParseNode_end_skip_set', (['self.this', 'self.d_parser', 'value'], {}), '(self.this, self.d_parser, value)\n', (1750, 1783), False, 'import dparser_swigc\n'), ((5110, 5157), 'dparser_swigc.unload_parser_tables', 'dparser_swigc.unload_parser_tables', (['self.tables'], {}), '(self.tables)\n', (5144, 5157), False, 'import dparser_swigc\n'), ((5892, 5939), 'dparser_swigc.unload_parser_tables', 'dparser_swigc.unload_parser_tables', (['self.tables'], {}), '(self.tables)\n', (5926, 5939), False, 'import dparser_swigc\n'), ((7431, 7459), 'os.path.dirname', 'os.path.dirname', (['sys.argv[0]'], {}), '(sys.argv[0])\n', (7446, 7459), False, 'import os\n'), ((1878, 1947), 'dparser_swigc.my_D_ParseNode_end_set', 'dparser_swigc.my_D_ParseNode_end_set', (['self.this', 'self.d_parser', 'value'], {}), '(self.this, self.d_parser, value)\n', (1914, 1947), False, 'import dparser_swigc\n'), ((2393, 2455), 'dparser_swigc.my_D_ParseNode_end_get', 'dparser_swigc.my_D_ParseNode_end_get', (['self.this', 'self.d_parser'], {}), '(self.this, self.d_parser)\n', (2429, 2455), False, 'import dparser_swigc\n'), ((7532, 7543), 'os.getcwd', 'os.getcwd', ([], {}), '()\n', (7541, 7543), False, 'import os\n'), ((2235, 2300), 'dparser_swigc.my_D_ParseNode_symbol_get', 'dparser_swigc.my_D_ParseNode_symbol_get', (['self.this', 'self.d_parser'], {}), '(self.this, self.d_parser)\n', (2274, 2300), False, 'import dparser_swigc\n'), ((2529, 2596), 'dparser_swigc.my_D_ParseNode_end_skip_get', 'dparser_swigc.my_D_ParseNode_end_skip_get', (['self.this', 'self.d_parser'], {}), '(self.this, self.d_parser)\n', (2570, 2596), False, 'import dparser_swigc\n'), ((6544, 6558), 'sys.exc_info', 'sys.exc_info', ([], {}), '()\n', (6556, 6558), False, 'import sys\n'), ((2759, 2808), 'dparser_swigc.d_get_number_of_children', 'dparser_swigc.d_get_number_of_children', (['self.this'], {}), '(self.this)\n', (2797, 2808), False, 'import dparser_swigc\n'), ((3274, 3323), 'dparser_swigc.d_get_number_of_children', 'dparser_swigc.d_get_number_of_children', (['self.this'], {}), '(self.this)\n', (3312, 3323), False, 'import dparser_swigc\n'), ((3386, 3436), 'dparser_swigc.d_get_number_off_children', 'dparser_swigc.d_get_number_off_children', (['self.this'], {}), '(self.this)\n', (3425, 3436), False, 'import dparser_swigc\n'), ((3545, 3584), 'dparser_swigc.d_get_child', 'dparser_swigc.d_get_child', (['self.this', 'i'], {}), '(self.this, i)\n', (3570, 3584), False, 'import dparser_swigc\n')]
from __future__ import unicode_literals from django.contrib import admin from djangoapps.features.models import Feature class FeatureAdmin(admin.ModelAdmin): list_display = ('id', 'active', 'feature_en', 'feature_es', 'description_en', 'description_es', 'created_at') search_fields = ('feature_es',) ordering = ('-created_at',) admin.site.register(Feature, FeatureAdmin)
[ "django.contrib.admin.site.register" ]
[((350, 392), 'django.contrib.admin.site.register', 'admin.site.register', (['Feature', 'FeatureAdmin'], {}), '(Feature, FeatureAdmin)\n', (369, 392), False, 'from django.contrib import admin\n')]
# -*- coding: utf-8 -*- # @Author: <NAME> # @Date: 2018-09-18 13:25:04 # @Last Modified by: <NAME> # @Last Modified time: 2018-09-18 13:35:04 """ CUSTOM ESTIMATOR AS DECORATORS for Scikit-Learn Pipelines """ from sklearn.base import BaseEstimator, TransformerMixin, ClassifierMixin import pandas as pd class SKTransform(BaseEstimator, TransformerMixin): """Sklearn Custom Transformer Decorator""" def __init__(self, f): self.transform_func = f def __call__(self, X): return self.transform_func(X) def __iter__(self): return (i for i in [self.transform_func.__name__, self]) def __getitem__(self, i): return [self.transform_func.__name__, self][i] def fit(self, X, y=None): return self def transform(self, X): if isinstance(X, pd.DataFrame): return self.transform_func(X.values) return self.transform_func(X) class SKClassify(BaseEstimator, ClassifierMixin): """Sklearn Custom Classifier Decorator""" def __init__(self, f): self.predict_func = f def __call__(self, X): return self.predict_func(X) def __iter__(self): return (i for i in [self.predict_func.__name__, self]) def __getitem__(self, i): return [self.predict_func.__name__, self][i] def fit(self, X, y=None): return self def fit_predict(self, X, y=None): return self.predict(X) def predict(self, X, y=None): if isinstance(X, pd.DataFrame): return self.predict_func(X.values) return self.predict_func(X) if __name__ == '__main__': from sklearn.pipeline import Pipeline import numpy as np @SKTransform def power2(x): return x**2 @SKClassify def lessThan50(x): return x < 50 ppl = Pipeline([ power2, lessThan50, ]) print('Prediction:\n', ppl.predict(np.array([3, 6, 8, 10])))
[ "sklearn.pipeline.Pipeline", "numpy.array" ]
[((1813, 1843), 'sklearn.pipeline.Pipeline', 'Pipeline', (['[power2, lessThan50]'], {}), '([power2, lessThan50])\n', (1821, 1843), False, 'from sklearn.pipeline import Pipeline\n'), ((1906, 1929), 'numpy.array', 'np.array', (['[3, 6, 8, 10]'], {}), '([3, 6, 8, 10])\n', (1914, 1929), True, 'import numpy as np\n')]
import os import urllib import datetime from google.appengine.api import users from google.appengine.ext import ndb import jinja2 import webapp2 JINJA_ENVIRONMENT = jinja2.Environment( loader=jinja2.FileSystemLoader(os.path.dirname(__file__)), extensions=['jinja2.ext.autoescape'], autoescape=True) #Models # file and directory # Classes and Functions class MainPage(webapp2.RequestHandler): def get(self): user = users.get_current_user() if user: nickname = user.nickname() url = users.create_logout_url(self.request.uri) url_linktext = 'Logout' else: url = users.create_login_url(self.request.uri) url_linktext = 'Login' if url_linktext == "Login" : template_values = { 'user': user, 'url': url, 'url_linktext': url_linktext, } template = JINJA_ENVIRONMENT.get_template('login.html') self.response.write(template.render(template_values)) else: template_values = { 'path': path, 'user': user, 'url': url, 'url_linktext': url_linktext, } template = JINJA_ENVIRONMENT.get_template('main.html') self.response.write(template.render(template_values)) app = webapp2.WSGIApplication([ ('/', MainPage), ], debug=True)
[ "google.appengine.api.users.get_current_user", "os.path.dirname", "webapp2.WSGIApplication", "google.appengine.api.users.create_login_url", "google.appengine.api.users.create_logout_url" ]
[((1346, 1400), 'webapp2.WSGIApplication', 'webapp2.WSGIApplication', (["[('/', MainPage)]"], {'debug': '(True)'}), "([('/', MainPage)], debug=True)\n", (1369, 1400), False, 'import webapp2\n'), ((442, 466), 'google.appengine.api.users.get_current_user', 'users.get_current_user', ([], {}), '()\n', (464, 466), False, 'from google.appengine.api import users\n'), ((222, 247), 'os.path.dirname', 'os.path.dirname', (['__file__'], {}), '(__file__)\n', (237, 247), False, 'import os\n'), ((541, 582), 'google.appengine.api.users.create_logout_url', 'users.create_logout_url', (['self.request.uri'], {}), '(self.request.uri)\n', (564, 582), False, 'from google.appengine.api import users\n'), ((651, 691), 'google.appengine.api.users.create_login_url', 'users.create_login_url', (['self.request.uri'], {}), '(self.request.uri)\n', (673, 691), False, 'from google.appengine.api import users\n')]
from jina import Executor, Document, DocumentArray, requests from transformers import ( AutoTokenizer, AutoModelForQuestionAnswering, pipeline, ) class Generator(Executor): answer_model_name = "deepset/roberta-base-squad2" answer_model = AutoModelForQuestionAnswering.from_pretrained(answer_model_name) answer_tokenizer = AutoTokenizer.from_pretrained(answer_model_name) nlp = pipeline( "question-answering", model=answer_model, tokenizer=answer_tokenizer ) @requests def generate(self, docs: DocumentArray, **kwargs) -> DocumentArray: for doc in docs.traverse_flat(('r',)): context = " ".join([match.text for match in doc.matches]) qa_input = {"question": doc.text, "context": context} result = self.nlp(qa_input) result = DocumentArray(Document(result)) return result
[ "transformers.AutoTokenizer.from_pretrained", "jina.Document", "transformers.AutoModelForQuestionAnswering.from_pretrained", "transformers.pipeline" ]
[((260, 324), 'transformers.AutoModelForQuestionAnswering.from_pretrained', 'AutoModelForQuestionAnswering.from_pretrained', (['answer_model_name'], {}), '(answer_model_name)\n', (305, 324), False, 'from transformers import AutoTokenizer, AutoModelForQuestionAnswering, pipeline\n'), ((348, 396), 'transformers.AutoTokenizer.from_pretrained', 'AutoTokenizer.from_pretrained', (['answer_model_name'], {}), '(answer_model_name)\n', (377, 396), False, 'from transformers import AutoTokenizer, AutoModelForQuestionAnswering, pipeline\n'), ((407, 485), 'transformers.pipeline', 'pipeline', (['"""question-answering"""'], {'model': 'answer_model', 'tokenizer': 'answer_tokenizer'}), "('question-answering', model=answer_model, tokenizer=answer_tokenizer)\n", (415, 485), False, 'from transformers import AutoTokenizer, AutoModelForQuestionAnswering, pipeline\n'), ((845, 861), 'jina.Document', 'Document', (['result'], {}), '(result)\n', (853, 861), False, 'from jina import Executor, Document, DocumentArray, requests\n')]
import logging from .s3_base_url import S3BaseUrl from ..base import BaseDirectoryUrl, BaseFileUrl from typing import IO, List, Optional import threading from time import sleep from s3_concat import S3Concat from smart_open.s3 import open as s3_open logger = logging.getLogger(__name__) class S3FileUrl(S3BaseUrl, BaseFileUrl): def __str__(self) -> str: return self.url def filename(self) -> str: return self.url[self.url.rfind("/")+1:] def directory_in_this_directory(self, directory_name: str) -> BaseDirectoryUrl: directory = self.containing_directory() return self._directory(f"{directory.url}{directory_name}/") def file_in_this_directory(self, filename: str) -> 'S3FileUrl': return self._file(self.containing_directory().url + filename) def upload_fileobj(self, fileobj: IO[bytes], mode: str = 'wb') -> int: # https://github.com/boto/boto3/blob/b2affa81c9b55ebcb9cb3af6e928f4f5acf22cb9/docs/source/guide/s3-uploading-files.rst if mode != 'wb': # use the single-threaded method that handles all modes return super().upload_fileobj(fileobj, mode=mode) class _S3ProgressTracker: def __init__(self) -> None: self.length = 0 self._lock = threading.Lock() def __call__(self, bytes_amount: int) -> None: with self._lock: self.length += bytes_amount callback = _S3ProgressTracker() self.s3_client.upload_fileobj(Fileobj=fileobj, Bucket=self.bucket, Key=self.key, Callback=callback) return callback.length def open(self, mode: str = "rb") -> IO[bytes]: try: return s3_open(bucket_id=self.bucket, key_id=self.key, mode=mode, session=self._boto3_session) except ValueError as e: # Example: ValueError: 'b0KD9AkG7XA/_manifest' does not # exist in the bucket 'vince-scratch', or is forbidden # for access # # smart-open version: 1.8.x if 'does not exist in the bucket' in str(e): raise FileNotFoundError(f"{self} not found") else: raise e except OSError as e: # Example: OSError: unable to access bucket: # 'vince-scratch' key: 'Mv0o7H_YejI/_manifest' version: # None error: An error occurred (NoSuchKey) when calling # the GetObject operation: The specified key does not # exist. # # smart-open version: 2.0 if 'NoSuchKey' in str(e): raise FileNotFoundError(f"{self} not found") else: raise e def download_fileobj(self, fileobj: IO[bytes]) -> None: self.s3_client.download_fileobj(Fileobj=fileobj, Bucket=self.bucket, Key=self.key) def store_string(self, contents: str) -> None: self.s3_resource.Object(self.bucket, self.key).put(Body=contents) def rename_to(self, new: 'BaseFileUrl') -> 'S3FileUrl': if not isinstance(new, S3FileUrl): raise TypeError(f'Can only rename to same type, not {new}') # https://stackoverflow.com/questions/32501995/boto3-s3-renaming-an-object-using-copy-object copy_source = {'Bucket': self.bucket, 'Key': self.key} self.s3_resource.Object(new.bucket, new.key).copy_from(CopySource=copy_source) self.s3_resource.Object(self.bucket, self.key).delete() logger.info("Renamed {old_url} to {new_url}".format(old_url=self.url, new_url=new.url)) return new def delete(self) -> None: self.s3_resource.Object(self.bucket, self.key).delete() def wait_to_exist(self) -> None: while True: try: with self.open(): return except FileNotFoundError: logger.info(f"Waiting for {self.url} to appear...") fifty_milliseconds = 0.05 sleep(fifty_milliseconds) def size(self) -> int: response = self.s3_client.head_object(Bucket=self.bucket, Key=self.key) return response['ContentLength'] def concatenate_from(self, other_locs: List['BaseFileUrl']) -> Optional[int]: if not all([isinstance(loc, S3FileUrl) and loc.bucket == self.bucket for loc in other_locs]): logger.warning("Concatenating data locally - this may be slow for large data sets") return super().concatenate_from(other_locs) job = S3Concat(self.bucket, self.key, session=self._boto3_session, # We want one file the end--S3Concat's other # job in life is concatting small log files # into larger ones, where a minimum file size # is a hint for when to stop combining files # together. min_file_size=None) for loc in other_locs: assert isinstance(loc, S3FileUrl) # keep mypy happy # Add files, can call multiple times to add files from other directories job.add_file(loc.key) out = job.concat() assert len(out) == 1 # with above arg, this should provide only a single output file return None
[ "time.sleep", "threading.Lock", "smart_open.s3.open", "s3_concat.S3Concat", "logging.getLogger" ]
[((261, 288), 'logging.getLogger', 'logging.getLogger', (['__name__'], {}), '(__name__)\n', (278, 288), False, 'import logging\n'), ((4743, 4828), 's3_concat.S3Concat', 'S3Concat', (['self.bucket', 'self.key'], {'session': 'self._boto3_session', 'min_file_size': 'None'}), '(self.bucket, self.key, session=self._boto3_session, min_file_size=None\n )\n', (4751, 4828), False, 'from s3_concat import S3Concat\n'), ((1838, 1930), 'smart_open.s3.open', 's3_open', ([], {'bucket_id': 'self.bucket', 'key_id': 'self.key', 'mode': 'mode', 'session': 'self._boto3_session'}), '(bucket_id=self.bucket, key_id=self.key, mode=mode, session=self.\n _boto3_session)\n', (1845, 1930), True, 'from smart_open.s3 import open as s3_open\n'), ((1300, 1316), 'threading.Lock', 'threading.Lock', ([], {}), '()\n', (1314, 1316), False, 'import threading\n'), ((4197, 4222), 'time.sleep', 'sleep', (['fifty_milliseconds'], {}), '(fifty_milliseconds)\n', (4202, 4222), False, 'from time import sleep\n')]
# -*- coding: utf-8 -*- from datetime import datetime from peewee import Model, ForeignKeyField, CharField, DateTimeField class VisitorModel(Model): class Meta: table_name = 'visitor' indexes = ( (('name', 'ip_addr'), True), ) name = CharField() ip_addr = CharField() location = CharField(null=True) class VisitModel(Model): class Meta: table_name = 'visit' created_on = DateTimeField(default=datetime.now) message = CharField(null=False) visitor = ForeignKeyField(VisitorModel) @classmethod def extended(cls, *fields): return cls.select(VisitModel, VisitorModel, *fields).join(VisitorModel)
[ "peewee.CharField", "peewee.DateTimeField", "peewee.ForeignKeyField" ]
[((282, 293), 'peewee.CharField', 'CharField', ([], {}), '()\n', (291, 293), False, 'from peewee import Model, ForeignKeyField, CharField, DateTimeField\n'), ((308, 319), 'peewee.CharField', 'CharField', ([], {}), '()\n', (317, 319), False, 'from peewee import Model, ForeignKeyField, CharField, DateTimeField\n'), ((335, 355), 'peewee.CharField', 'CharField', ([], {'null': '(True)'}), '(null=True)\n', (344, 355), False, 'from peewee import Model, ForeignKeyField, CharField, DateTimeField\n'), ((446, 481), 'peewee.DateTimeField', 'DateTimeField', ([], {'default': 'datetime.now'}), '(default=datetime.now)\n', (459, 481), False, 'from peewee import Model, ForeignKeyField, CharField, DateTimeField\n'), ((496, 517), 'peewee.CharField', 'CharField', ([], {'null': '(False)'}), '(null=False)\n', (505, 517), False, 'from peewee import Model, ForeignKeyField, CharField, DateTimeField\n'), ((532, 561), 'peewee.ForeignKeyField', 'ForeignKeyField', (['VisitorModel'], {}), '(VisitorModel)\n', (547, 561), False, 'from peewee import Model, ForeignKeyField, CharField, DateTimeField\n')]
# Copyright (C) 2010 Google Inc. All rights reserved. # # Redistribution and use in source and binary forms, with or without # modification, are permitted provided that the following conditions are # met: # # * Redistributions of source code must retain the above copyright # notice, this list of conditions and the following disclaimer. # * Redistributions in binary form must reproduce the above # copyright notice, this list of conditions and the following disclaimer # in the documentation and/or other materials provided with the # distribution. # * Neither the name of Google Inc. nor the names of its # contributors may be used to endorse or promote products derived from # this software without specific prior written permission. # # THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS # "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT # LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR # A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT # OWNER OR CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, # SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT # LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, # DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY # THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT # (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE # OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. import logging from webkitpy.layout_tests.breakpad.dump_reader_multipart import DumpReaderLinux from webkitpy.layout_tests.port import base from webkitpy.layout_tests.port import win _log = logging.getLogger(__name__) class LinuxPort(base.Port): port_name = 'linux' SUPPORTED_VERSIONS = ('precise', 'trusty') FALLBACK_PATHS = {} FALLBACK_PATHS['trusty'] = ['linux'] + win.WinPort.latest_platform_fallback_path() FALLBACK_PATHS['precise'] = ['linux-precise'] + FALLBACK_PATHS['trusty'] DEFAULT_BUILD_DIRECTORIES = ('out',) BUILD_REQUIREMENTS_URL = 'https://chromium.googlesource.com/chromium/src/+/master/docs/linux_build_instructions.md' @classmethod def determine_full_port_name(cls, host, options, port_name): if port_name.endswith('linux'): assert host.platform.is_linux() version = host.platform.os_version return port_name + '-' + version return port_name def __init__(self, host, port_name, **kwargs): super(LinuxPort, self).__init__(host, port_name, **kwargs) self._version = port_name[port_name.index('linux-') + len('linux-'):] self._architecture = "x86_64" assert self._version in self.SUPPORTED_VERSIONS if not self.get_option('disable_breakpad'): self._dump_reader = DumpReaderLinux(host, self._build_path()) self._original_home = None def additional_driver_flag(self): flags = super(LinuxPort, self).additional_driver_flag() if not self.get_option('disable_breakpad'): flags += ['--enable-crash-reporter', '--crash-dumps-dir=%s' % self._dump_reader.crash_dumps_directory()] return flags def check_build(self, needs_http, printer): result = super(LinuxPort, self).check_build(needs_http, printer) if result: _log.error('For complete Linux build requirements, please see:') _log.error('') _log.error(' https://chromium.googlesource.com/chromium/src/+/master/docs/linux_build_instructions.md') return result def look_for_new_crash_logs(self, crashed_processes, start_time): if self.get_option('disable_breakpad'): return None return self._dump_reader.look_for_new_crash_logs(crashed_processes, start_time) def clobber_old_port_specific_results(self): if not self.get_option('disable_breakpad'): self._dump_reader.clobber_old_results() def operating_system(self): return 'linux' def path_to_apache(self): # The Apache binary path can vary depending on OS and distribution # See http://wiki.apache.org/httpd/DistrosDefaultLayout for path in ["/usr/sbin/httpd", "/usr/sbin/apache2"]: if self._filesystem.exists(path): return path _log.error("Could not find apache. Not installed or unknown path.") return None def setup_test_run(self): super(LinuxPort, self).setup_test_run() self._setup_dummy_home_dir() def clean_up_test_run(self): super(LinuxPort, self).clean_up_test_run() self._clean_up_dummy_home_dir() # # PROTECTED METHODS # def _setup_dummy_home_dir(self): """Creates a dummy home directory for running the test. This is a workaround for crbug.com/595504; see crbug.com/612730. If crbug.com/612730 is resolved in another way, then this may be unnecessary. """ self._original_home = self.host.environ.get('HOME') dummy_home = str(self._filesystem.mkdtemp()) self.host.environ['HOME'] = dummy_home self._copy_files_to_dummy_home_dir(dummy_home) def _copy_files_to_dummy_home_dir(self, dummy_home): # Note: This may be unnecessary. fs = self._filesystem for filename in ['.Xauthority']: original_path = fs.join(self._original_home, filename) if not fs.exists(original_path): continue fs.copyfile(original_path, fs.join(dummy_home, filename)) def _clean_up_dummy_home_dir(self): """Cleans up the dummy dir and resets the HOME environment variable.""" dummy_home = self.host.environ['HOME'] assert dummy_home != self._original_home self._filesystem.rmtree(dummy_home) self.host.environ['HOME'] = self._original_home def _check_apache_install(self): result = self._check_file_exists(self.path_to_apache(), "apache2") result = self._check_file_exists(self.path_to_apache_config_file(), "apache2 config file") and result if not result: _log.error(' Please install using: "sudo apt-get install apache2 libapache2-mod-php5"') _log.error('') return result def _wdiff_missing_message(self): return 'wdiff is not installed; please install using "sudo apt-get install wdiff"' def _path_to_driver(self, target=None): binary_name = self.driver_name() return self._build_path_with_target(target, binary_name)
[ "webkitpy.layout_tests.port.win.WinPort.latest_platform_fallback_path", "logging.getLogger" ]
[((1723, 1750), 'logging.getLogger', 'logging.getLogger', (['__name__'], {}), '(__name__)\n', (1740, 1750), False, 'import logging\n'), ((1921, 1964), 'webkitpy.layout_tests.port.win.WinPort.latest_platform_fallback_path', 'win.WinPort.latest_platform_fallback_path', ([], {}), '()\n', (1962, 1964), False, 'from webkitpy.layout_tests.port import win\n')]
import os import sys sys.path.insert(0, os.path.abspath('../..')) from hq.output import convert_results_to_output_text from hq.soup_util import make_soup from hq.hquery.hquery_processor import HqueryProcessor from ..common_test_util import expected_result from test.hquery.hquery_test_util import query_html_doc def test_absolute_location_path_should_find_multiple_grandchildren(): actual = query_html_doc('<div>one</div><p>not a div</p><div>two</div>', '/html/body/div') assert actual == expected_result(""" <div> one </div> <div> two </div>""") def test_path_to_root_tag_succeeds_despite_other_root_level_objects(): html = """ <!DOCTYPE html> <!-- outside --> <html> <!-- inside --> </html>""" raw_result = HqueryProcessor('/*').query(make_soup(html)) actual = convert_results_to_output_text(raw_result) assert actual == expected_result(""" <html> <!-- inside --> </html>""") def test_relative_location_path_as_predicate(): html_body = """ <div> <span>one</span> </div> <div> <p>two</p> </div> <div> <span>three</span> </div>""" actual = query_html_doc(html_body, '/html/body/div[span]') assert actual == expected_result(""" <div> <span> one </span> </div> <div> <span> three </span> </div>""") def test_abbreviated_context_node_works_in_path(): html_body = """ <div> <p>one</p> </div> <p>two</p> <div> <p>three</p> </div>""" actual = query_html_doc(html_body, '/html/body/div/./p') assert actual == expected_result(""" <p> one </p> <p> three </p>""") def test_abbreviated_context_node_works_in_predicate(): html_body = """ <div> <p>one</p> </div> <p>two</p> <div> three </div> <div> <p>four</p> </div> """ actual = query_html_doc(html_body, '/html/body/node()[./p]') assert actual == expected_result(""" <div> <p> one </p> </div> <div> <p> four </p> </div>""") def test_abbreviated_parent_node_works_in_path(): html_body = """ <p> <span>one</span> </p> <p> <br/> <span>two</span> </p>""" actual = query_html_doc(html_body, '//p/br/../span') assert actual == expected_result(""" <span> two </span>""") def test_abbreviated_parent_node_works_in_predicate(): html_body = """ <p> <br/> <span>one</span> </p> <p> <span>two</span> </p> <p> <br/> <span>three</span> </p>""" actual = query_html_doc(html_body, '//span[../br]') assert actual == expected_result(""" <span> one </span> <span> three </span>""") def test_double_slash_works_within_path(): html_body = """ <section> <p>moe</p> <div> <div> <p>larry</p> </div> <p>curly</p> </div> </section> <p><NAME></p> <section> <p>shemp</p> </section>""" assert query_html_doc(html_body, '//section//p') == expected_result(""" <p> moe </p> <p> larry </p> <p> curly </p> <p> shemp </p>""") def test_predicate_can_be_applied_to_variable_containing_node_set(): html_body = """ <p>not selected</p> <p id="foo">selected</p>""" assert query_html_doc(html_body, 'let $x := //p return $x[@id="foo"]') == expected_result(""" <p id="foo"> selected </p>""") def test_no_space_between_text_runs_crossing_element_boundaries_in_element_string_value_if_there_was_none_in_doc(): html_body = """<p>"<span>so-called</span>" Klingon </p>""" assert query_html_doc(html_body, 'string(//p)') == '"so-called" Klingon' assert query_html_doc('<p>one <span>two</span></p>', 'string(//p)') == 'one two'
[ "hq.soup_util.make_soup", "os.path.abspath", "hq.output.convert_results_to_output_text", "hq.hquery.hquery_processor.HqueryProcessor", "test.hquery.hquery_test_util.query_html_doc" ]
[((41, 65), 'os.path.abspath', 'os.path.abspath', (['"""../.."""'], {}), "('../..')\n", (56, 65), False, 'import os\n'), ((400, 485), 'test.hquery.hquery_test_util.query_html_doc', 'query_html_doc', (['"""<div>one</div><p>not a div</p><div>two</div>"""', '"""/html/body/div"""'], {}), "('<div>one</div><p>not a div</p><div>two</div>', '/html/body/div'\n )\n", (414, 485), False, 'from test.hquery.hquery_test_util import query_html_doc\n'), ((840, 882), 'hq.output.convert_results_to_output_text', 'convert_results_to_output_text', (['raw_result'], {}), '(raw_result)\n', (870, 882), False, 'from hq.output import convert_results_to_output_text\n'), ((1192, 1241), 'test.hquery.hquery_test_util.query_html_doc', 'query_html_doc', (['html_body', '"""/html/body/div[span]"""'], {}), "(html_body, '/html/body/div[span]')\n", (1206, 1241), False, 'from test.hquery.hquery_test_util import query_html_doc\n'), ((1587, 1634), 'test.hquery.hquery_test_util.query_html_doc', 'query_html_doc', (['html_body', '"""/html/body/div/./p"""'], {}), "(html_body, '/html/body/div/./p')\n", (1601, 1634), False, 'from test.hquery.hquery_test_util import query_html_doc\n'), ((1964, 2015), 'test.hquery.hquery_test_util.query_html_doc', 'query_html_doc', (['html_body', '"""/html/body/node()[./p]"""'], {}), "(html_body, '/html/body/node()[./p]')\n", (1978, 2015), False, 'from test.hquery.hquery_test_util import query_html_doc\n'), ((2348, 2391), 'test.hquery.hquery_test_util.query_html_doc', 'query_html_doc', (['html_body', '"""//p/br/../span"""'], {}), "(html_body, '//p/br/../span')\n", (2362, 2391), False, 'from test.hquery.hquery_test_util import query_html_doc\n'), ((2718, 2760), 'test.hquery.hquery_test_util.query_html_doc', 'query_html_doc', (['html_body', '"""//span[../br]"""'], {}), "(html_body, '//span[../br]')\n", (2732, 2760), False, 'from test.hquery.hquery_test_util import query_html_doc\n'), ((810, 825), 'hq.soup_util.make_soup', 'make_soup', (['html'], {}), '(html)\n', (819, 825), False, 'from hq.soup_util import make_soup\n'), ((3187, 3228), 'test.hquery.hquery_test_util.query_html_doc', 'query_html_doc', (['html_body', '"""//section//p"""'], {}), "(html_body, '//section//p')\n", (3201, 3228), False, 'from test.hquery.hquery_test_util import query_html_doc\n'), ((3524, 3587), 'test.hquery.hquery_test_util.query_html_doc', 'query_html_doc', (['html_body', '"""let $x := //p return $x[@id="foo"]"""'], {}), '(html_body, \'let $x := //p return $x[@id="foo"]\')\n', (3538, 3587), False, 'from test.hquery.hquery_test_util import query_html_doc\n'), ((3848, 3888), 'test.hquery.hquery_test_util.query_html_doc', 'query_html_doc', (['html_body', '"""string(//p)"""'], {}), "(html_body, 'string(//p)')\n", (3862, 3888), False, 'from test.hquery.hquery_test_util import query_html_doc\n'), ((3925, 3985), 'test.hquery.hquery_test_util.query_html_doc', 'query_html_doc', (['"""<p>one <span>two</span></p>"""', '"""string(//p)"""'], {}), "('<p>one <span>two</span></p>', 'string(//p)')\n", (3939, 3985), False, 'from test.hquery.hquery_test_util import query_html_doc\n'), ((782, 803), 'hq.hquery.hquery_processor.HqueryProcessor', 'HqueryProcessor', (['"""/*"""'], {}), "('/*')\n", (797, 803), False, 'from hq.hquery.hquery_processor import HqueryProcessor\n')]
from setuptools import find_packages, setup with open('README.rst') as f: readme = f.read() with open('LICENSE.txt') as f: license = f.read() setup( name = 'unhashlib', version = '0.1.0', description = 'A string class enhancement', long_description = readme, #license = license, packages=find_packages(exclude=('tests', 'docs')), author = '<NAME>', author_email = '<EMAIL>', url = 'https://github.com/reale/unhashlib', keywords = [ ], install_requires = ['hashlib', 'requests'], test_suite = 'nose.collector', tests_require = ['nose'], ) # vim: tabstop=8 expandtab shiftwidth=4 softtabstop=4
[ "setuptools.find_packages" ]
[((323, 363), 'setuptools.find_packages', 'find_packages', ([], {'exclude': "('tests', 'docs')"}), "(exclude=('tests', 'docs'))\n", (336, 363), False, 'from setuptools import find_packages, setup\n')]
""" Helper functions file for working with object buckets """ import logging import os import shlex from uuid import uuid4 import boto3 from botocore.handlers import disable_signing from ocs_ci.framework import config from ocs_ci.ocs import constants from ocs_ci.ocs.exceptions import TimeoutExpiredError, UnexpectedBehaviour from ocs_ci.utility import templating from ocs_ci.utility.ssl_certs import get_root_ca_cert from ocs_ci.utility.utils import TimeoutSampler, run_cmd from ocs_ci.helpers.helpers import create_resource logger = logging.getLogger(__name__) def craft_s3_command(cmd, mcg_obj=None, api=False, signed_request_creds=None): """ Crafts the AWS CLI S3 command including the login credentials and command to be ran Args: mcg_obj: An MCG class instance cmd: The AWSCLI command to run api: True if the call is for s3api, false if s3 signed_request_creds: a dictionary containing AWS S3 creds for a signed request Returns: str: The crafted command, ready to be executed on the pod """ api = "api" if api else "" if mcg_obj: if mcg_obj.region: region = f"AWS_DEFAULT_REGION={mcg_obj.region} " else: region = "" base_command = ( f'sh -c "AWS_CA_BUNDLE={constants.SERVICE_CA_CRT_AWSCLI_PATH} ' f"AWS_ACCESS_KEY_ID={mcg_obj.access_key_id} " f"AWS_SECRET_ACCESS_KEY={mcg_obj.access_key} " f"{region}" f"aws s3{api} " f"--endpoint={mcg_obj.s3_internal_endpoint} " ) string_wrapper = '"' elif signed_request_creds: if signed_request_creds.get("region"): region = f'AWS_DEFAULT_REGION={signed_request_creds.get("region")} ' else: region = "" base_command = ( f'sh -c "AWS_ACCESS_KEY_ID={signed_request_creds.get("access_key_id")} ' f'AWS_SECRET_ACCESS_KEY={signed_request_creds.get("access_key")} ' f"{region}" f"aws s3{api} " f'--endpoint={signed_request_creds.get("endpoint")} ' ) string_wrapper = '"' else: base_command = f"aws s3{api} --no-sign-request " string_wrapper = "" return f"{base_command}{cmd}{string_wrapper}" def verify_s3_object_integrity(original_object_path, result_object_path, awscli_pod): """ Verifies checksum between original object and result object on an awscli pod Args: original_object_path (str): The Object that is uploaded to the s3 bucket result_object_path (str): The Object that is downloaded from the s3 bucket awscli_pod (pod): A pod running the AWSCLI tools Returns: bool: True if checksum matches, False otherwise """ md5sum = shlex.split( awscli_pod.exec_cmd_on_pod( command=f"md5sum {original_object_path} {result_object_path}" ) ) if md5sum[0] == md5sum[2]: logger.info( f"Passed: MD5 comparison for {original_object_path} and {result_object_path}" ) return True else: logger.error( f"Failed: MD5 comparison of {original_object_path} and {result_object_path} - " f"{md5sum[0]} ≠ {md5sum[2]}" ) return False def retrieve_test_objects_to_pod(podobj, target_dir): """ Downloads all the test objects to a given directory in a given pod. Args: podobj (OCS): The pod object to download the objects to target_dir: The fully qualified path of the download target folder Returns: list: A list of the downloaded objects' names """ sync_object_directory(podobj, f"s3://{constants.TEST_FILES_BUCKET}", target_dir) downloaded_objects = podobj.exec_cmd_on_pod(f"ls -A1 {target_dir}").split(" ") logger.info(f"Downloaded objects: {downloaded_objects}") return downloaded_objects def retrieve_anon_s3_resource(): """ Returns an anonymous boto3 S3 resource by creating one and disabling signing Disabling signing isn't documented anywhere, and this solution is based on a comment by an AWS developer: https://github.com/boto/boto3/issues/134#issuecomment-116766812 Returns: boto3.resource(): An anonymous S3 resource """ anon_s3_resource = boto3.resource("s3") anon_s3_resource.meta.client.meta.events.register( "choose-signer.s3.*", disable_signing ) return anon_s3_resource def sync_object_directory(podobj, src, target, s3_obj=None, signed_request_creds=None): """ Syncs objects between a target and source directories Args: podobj (OCS): The pod on which to execute the commands and download the objects to src (str): Fully qualified object source path target (str): Fully qualified object target path s3_obj (MCG, optional): The MCG object to use in case the target or source are in an MCG signed_request_creds (dictionary, optional): the access_key, secret_key, endpoint and region to use when willing to send signed aws s3 requests """ logger.info(f"Syncing all objects and directories from {src} to {target}") retrieve_cmd = f"sync {src} {target}" if s3_obj: secrets = [s3_obj.access_key_id, s3_obj.access_key, s3_obj.s3_internal_endpoint] elif signed_request_creds: secrets = [ signed_request_creds.get("access_key_id"), signed_request_creds.get("access_key"), signed_request_creds.get("endpoint"), ] else: secrets = None podobj.exec_cmd_on_pod( command=craft_s3_command( retrieve_cmd, s3_obj, signed_request_creds=signed_request_creds ), out_yaml_format=False, secrets=secrets, ), "Failed to sync objects" # Todo: check that all objects were synced successfully def rm_object_recursive(podobj, target, mcg_obj, option=""): """ Remove bucket objects with --recursive option Args: podobj (OCS): The pod on which to execute the commands and download the objects to target (str): Fully qualified bucket target path mcg_obj (MCG, optional): The MCG object to use in case the target or source are in an MCG option (str): Extra s3 remove command option """ rm_command = f"rm s3://{target} --recursive {option}" podobj.exec_cmd_on_pod( command=craft_s3_command(rm_command, mcg_obj), out_yaml_format=False, secrets=[ mcg_obj.access_key_id, mcg_obj.access_key, mcg_obj.s3_internal_endpoint, ], ) def get_rgw_restart_counts(): """ Gets the restart count of the RGW pods Returns: list: restart counts of RGW pods """ # Internal import in order to avoid circular import from ocs_ci.ocs.resources.pod import get_rgw_pods rgw_pods = get_rgw_pods() return [rgw_pod.restart_count for rgw_pod in rgw_pods] def write_individual_s3_objects( mcg_obj, awscli_pod, bucket_factory, downloaded_files, target_dir, bucket_name=None ): """ Writes objects one by one to an s3 bucket Args: mcg_obj (obj): An MCG object containing the MCG S3 connection credentials awscli_pod (pod): A pod running the AWSCLI tools bucket_factory: Calling this fixture creates a new bucket(s) downloaded_files (list): List of downloaded object keys target_dir (str): The fully qualified path of the download target folder bucket_name (str): Name of the bucket (default: none) """ bucketname = bucket_name or bucket_factory(1)[0].name logger.info("Writing objects to bucket") for obj_name in downloaded_files: full_object_path = f"s3://{bucketname}/{obj_name}" copycommand = f"cp {target_dir}{obj_name} {full_object_path}" assert "Completed" in awscli_pod.exec_cmd_on_pod( command=craft_s3_command(copycommand, mcg_obj), out_yaml_format=False, secrets=[ mcg_obj.access_key_id, mcg_obj.access_key, mcg_obj.s3_internal_endpoint, ], ) def upload_parts( mcg_obj, awscli_pod, bucketname, object_key, body_path, upload_id, uploaded_parts ): """ Uploads individual parts to a bucket Args: mcg_obj (obj): An MCG object containing the MCG S3 connection credentials awscli_pod (pod): A pod running the AWSCLI tools bucketname (str): Name of the bucket to upload parts on object_key (list): Unique object Identifier body_path (str): Path of the directory on the aws pod which contains the parts to be uploaded upload_id (str): Multipart Upload-ID uploaded_parts (list): list containing the name of the parts to be uploaded Returns: list: List containing the ETag of the parts """ parts = [] secrets = [mcg_obj.access_key_id, mcg_obj.access_key, mcg_obj.s3_internal_endpoint] for count, part in enumerate(uploaded_parts, 1): upload_cmd = ( f"upload-part --bucket {bucketname} --key {object_key}" f" --part-number {count} --body {body_path}/{part}" f" --upload-id {upload_id}" ) # upload_cmd will return ETag, upload_id etc which is then split to get just the ETag part = ( awscli_pod.exec_cmd_on_pod( command=craft_s3_command(upload_cmd, mcg_obj, api=True), out_yaml_format=False, secrets=secrets, ) .split('"')[-3] .split("\\")[0] ) parts.append({"PartNumber": count, "ETag": f'"{part}"'}) return parts def oc_create_aws_backingstore(cld_mgr, backingstore_name, uls_name, region): """ Create a new backingstore with aws underlying storage using oc create command Args: cld_mgr (CloudManager): holds secret for backingstore creation backingstore_name (str): backingstore name uls_name (str): underlying storage name region (str): which region to create backingstore (should be the same as uls) """ bs_data = templating.load_yaml(constants.MCG_BACKINGSTORE_YAML) bs_data["metadata"]["name"] = backingstore_name bs_data["metadata"]["namespace"] = config.ENV_DATA["cluster_namespace"] bs_data["spec"] = { "type": "aws-s3", "awsS3": { "targetBucket": uls_name, "region": region, "secret": {"name": cld_mgr.aws_client.secret.name}, }, } create_resource(**bs_data) def cli_create_aws_backingstore(mcg_obj, cld_mgr, backingstore_name, uls_name, region): """ Create a new backingstore with aws underlying storage using noobaa cli command Args: mcg_obj (MCG): Used for execution for the NooBaa CLI command cld_mgr (CloudManager): holds secret for backingstore creation backingstore_name (str): backingstore name uls_name (str): underlying storage name region (str): which region to create backingstore (should be the same as uls) """ mcg_obj.exec_mcg_cmd( f"backingstore create aws-s3 {backingstore_name} " f"--access-key {cld_mgr.aws_client.access_key} " f"--secret-key {cld_mgr.aws_client.secret_key} " f"--target-bucket {uls_name} --region {region}" ) def oc_create_google_backingstore(cld_mgr, backingstore_name, uls_name, region): """ Create a new backingstore with GCP underlying storage using oc create command Args: cld_mgr (CloudManager): holds secret for backingstore creation backingstore_name (str): backingstore name uls_name (str): underlying storage name region (str): which region to create backingstore (should be the same as uls) """ bs_data = templating.load_yaml(constants.MCG_BACKINGSTORE_YAML) bs_data["metadata"]["name"] = backingstore_name bs_data["spec"] = { "type": constants.BACKINGSTORE_TYPE_GOOGLE, "googleCloudStorage": { "targetBucket": uls_name, "secret": {"name": cld_mgr.gcp_client.secret.name}, }, } create_resource(**bs_data) def cli_create_google_backingstore( mcg_obj, cld_mgr, backingstore_name, uls_name, region ): """ Create a new backingstore with GCP underlying storage using a NooBaa CLI command Args: mcg_obj (MCG): Used for execution for the NooBaa CLI command cld_mgr (CloudManager): holds secret for backingstore creation backingstore_name (str): backingstore name uls_name (str): underlying storage name region (str): which region to create backingstore (should be the same as uls) """ mcg_obj.exec_mcg_cmd( f"backingstore create google-cloud-storage {backingstore_name} " f"--private-key-json-file {constants.GOOGLE_CREDS_JSON_PATH} " f"--target-bucket {uls_name}" ) def oc_create_azure_backingstore(cld_mgr, backingstore_name, uls_name, region): """ Create a new backingstore with Azure underlying storage using oc create command Args: cld_mgr (CloudManager): holds secret for backingstore creation backingstore_name (str): backingstore name uls_name (str): underlying storage name region (str): which region to create backingstore (should be the same as uls) """ bs_data = templating.load_yaml(constants.MCG_BACKINGSTORE_YAML) bs_data["metadata"]["name"] = backingstore_name bs_data["spec"] = { "type": constants.BACKINGSTORE_TYPE_AZURE, "azureBlob": { "targetBlobContainer": uls_name, "secret": {"name": cld_mgr.azure_client.secret.name}, }, } create_resource(**bs_data) def cli_create_azure_backingstore( mcg_obj, cld_mgr, backingstore_name, uls_name, region ): """ Create a new backingstore with aws underlying storage using noobaa cli command Args: cld_mgr (CloudManager): holds secret for backingstore creation backingstore_name (str): backingstore name uls_name (str): underlying storage name region (str): which region to create backingstore (should be the same as uls) """ mcg_obj.exec_mcg_cmd( f"backingstore create azure-blob {backingstore_name} " f"--account-key {cld_mgr.azure_client.credential} " f"--account-name {cld_mgr.azure_client.account_name} " f"--target-blob-container {uls_name}" ) def oc_create_ibmcos_backingstore(cld_mgr, backingstore_name, uls_name, region): """ Create a new backingstore with IBM COS underlying storage using oc create command Args: cld_mgr (CloudManager): holds secret for backingstore creation backingstore_name (str): backingstore name uls_name (str): underlying storage name region (str): which region to create backingstore (should be the same as uls) """ bs_data = templating.load_yaml(constants.MCG_BACKINGSTORE_YAML) bs_data["metadata"]["name"] = backingstore_name bs_data["metadata"]["namespace"] = config.ENV_DATA["cluster_namespace"] bs_data["spec"] = { "type": "ibm-cos", "ibmCos": { "targetBucket": uls_name, "signatureVersion": "v2", "endpoint": constants.IBM_COS_GEO_ENDPOINT_TEMPLATE.format( cld_mgr.ibmcos_client.region.lower() ), "secret": {"name": cld_mgr.ibmcos_client.secret.name}, }, } create_resource(**bs_data) def cli_create_ibmcos_backingstore( mcg_obj, cld_mgr, backingstore_name, uls_name, region ): """ Create a new backingstore with IBM COS underlying storage using a NooBaa CLI command Args: cld_mgr (CloudManager): holds secret for backingstore creation backingstore_name (str): backingstore name uls_name (str): underlying storage name region (str): which region to create backingstore (should be the same as uls) """ mcg_obj.exec_mcg_cmd( f"backingstore create ibm-cos {backingstore_name} " f"--access-key {cld_mgr.ibmcos_client.access_key} " f"--secret-key {cld_mgr.ibmcos_client.secret_key} " f"""--endpoint { constants.IBM_COS_GEO_ENDPOINT_TEMPLATE.format( cld_mgr.ibmcos_client.region.lower() ) } """ f"--target-bucket {uls_name}" ) def oc_create_s3comp_backingstore(cld_mgr, backingstore_name, uls_name, region): pass def cli_create_s3comp_backingstore(cld_mgr, backingstore_name, uls_name, region): pass def oc_create_pv_backingstore(backingstore_name, vol_num, size, storage_class): """ Create a new backingstore with pv underlying storage using oc create command Args: backingstore_name (str): backingstore name vol_num (int): number of pv volumes size (int): each volume size in GB storage_class (str): which storage class to use """ bs_data = templating.load_yaml(constants.PV_BACKINGSTORE_YAML) bs_data["metadata"]["name"] = backingstore_name bs_data["metadata"]["namespace"] = config.ENV_DATA["cluster_namespace"] bs_data["spec"]["pvPool"]["resources"]["requests"]["storage"] = str(size) + "Gi" bs_data["spec"]["pvPool"]["numVolumes"] = vol_num bs_data["spec"]["pvPool"]["storageClass"] = storage_class create_resource(**bs_data) wait_for_pv_backingstore(backingstore_name, config.ENV_DATA["cluster_namespace"]) def cli_create_pv_backingstore( mcg_obj, backingstore_name, vol_num, size, storage_class ): """ Create a new backingstore with pv underlying storage using noobaa cli command Args: backingstore_name (str): backingstore name vol_num (int): number of pv volumes size (int): each volume size in GB storage_class (str): which storage class to use """ mcg_obj.exec_mcg_cmd( f"backingstore create pv-pool {backingstore_name} --num-volumes " f"{vol_num} --pv-size-gb {size} --storage-class {storage_class}" ) wait_for_pv_backingstore(backingstore_name, config.ENV_DATA["cluster_namespace"]) def wait_for_pv_backingstore(backingstore_name, namespace=None): """ wait for existing pv backing store to reach OPTIMAL state Args: backingstore_name (str): backingstore name namespace (str): backing store's namespace """ namespace = namespace or config.ENV_DATA["cluster_namespace"] sample = TimeoutSampler( timeout=240, sleep=15, func=check_pv_backingstore_status, backingstore_name=backingstore_name, namespace=namespace, ) if not sample.wait_for_func_status(result=True): logger.error(f"Backing Store {backingstore_name} never reached OPTIMAL state") raise TimeoutExpiredError else: logger.info(f"Backing Store {backingstore_name} created successfully") def check_pv_backingstore_status( backingstore_name, namespace=None, desired_status=constants.HEALTHY_PV_BS ): """ check if existing pv backing store is in OPTIMAL state Args: backingstore_name (str): backingstore name namespace (str): backing store's namespace desired_status (str): desired state for the backing store, if None is given then desired is the Healthy status Returns: bool: True if backing store is in the desired state """ kubeconfig = os.getenv("KUBECONFIG") kubeconfig = f"--kubeconfig {kubeconfig}" if kubeconfig else "" namespace = namespace or config.ENV_DATA["cluster_namespace"] cmd = ( f"oc get backingstore -n {namespace} {kubeconfig} {backingstore_name} " "-o=jsonpath=`{.status.mode.modeCode}`" ) res = run_cmd(cmd=cmd) return True if res in desired_status else False def create_multipart_upload(s3_obj, bucketname, object_key): """ Initiates Multipart Upload Args: s3_obj (obj): MCG or OBC object bucketname (str): Name of the bucket on which multipart upload to be initiated on object_key (str): Unique object Identifier Returns: str : Multipart Upload-ID """ mpu = s3_obj.s3_client.create_multipart_upload(Bucket=bucketname, Key=object_key) upload_id = mpu["UploadId"] return upload_id def list_multipart_upload(s3_obj, bucketname): """ Lists the multipart upload details on a bucket Args: s3_obj (obj): MCG or OBC object bucketname (str): Name of the bucket Returns: dict : Dictionary containing the multipart upload details """ return s3_obj.s3_client.list_multipart_uploads(Bucket=bucketname) def list_uploaded_parts(s3_obj, bucketname, object_key, upload_id): """ Lists uploaded parts and their ETags Args: s3_obj (obj): MCG or OBC object bucketname (str): Name of the bucket object_key (str): Unique object Identifier upload_id (str): Multipart Upload-ID Returns: dict : Dictionary containing the multipart upload details """ return s3_obj.s3_client.list_parts( Bucket=bucketname, Key=object_key, UploadId=upload_id ) def complete_multipart_upload(s3_obj, bucketname, object_key, upload_id, parts): """ Completes the Multipart Upload Args: s3_obj (obj): MCG or OBC object bucketname (str): Name of the bucket object_key (str): Unique object Identifier upload_id (str): Multipart Upload-ID parts (list): List containing the uploaded parts which includes ETag and part number Returns: dict : Dictionary containing the completed multipart upload details """ result = s3_obj.s3_client.complete_multipart_upload( Bucket=bucketname, Key=object_key, UploadId=upload_id, MultipartUpload={"Parts": parts}, ) return result def abort_all_multipart_upload(s3_obj, bucketname, object_key): """ Abort all Multipart Uploads for this Bucket Args: s3_obj (obj): MCG or OBC object bucketname (str): Name of the bucket object_key (str): Unique object Identifier Returns: list : List of aborted upload ids """ multipart_list = s3_obj.s3_client.list_multipart_uploads(Bucket=bucketname) logger.info(f"Aborting{len(multipart_list)} uploads") if "Uploads" in multipart_list: return [ s3_obj.s3_client.abort_multipart_upload( Bucket=bucketname, Key=object_key, UploadId=upload["UploadId"] ) for upload in multipart_list["Uploads"] ] else: return None def abort_multipart(s3_obj, bucketname, object_key, upload_id): """ Aborts a Multipart Upload for this Bucket Args: s3_obj (obj): MCG or OBC object bucketname (str): Name of the bucket object_key (str): Unique object Identifier upload_id (str): Multipart Upload-ID Returns: str : aborted upload id """ return s3_obj.s3_client.abort_multipart_upload( Bucket=bucketname, Key=object_key, UploadId=upload_id ) def put_bucket_policy(s3_obj, bucketname, policy): """ Adds bucket policy to a bucket Args: s3_obj (obj): MCG or OBC object bucketname (str): Name of the bucket policy (str): Bucket policy in Json format Returns: dict : Bucket policy response """ return s3_obj.s3_client.put_bucket_policy(Bucket=bucketname, Policy=policy) def get_bucket_policy(s3_obj, bucketname): """ Gets bucket policy from a bucket Args: s3_obj (obj): MCG or OBC object bucketname (str): Name of the bucket Returns: dict : Get Bucket policy response """ return s3_obj.s3_client.get_bucket_policy(Bucket=bucketname) def delete_bucket_policy(s3_obj, bucketname): """ Deletes bucket policy Args: s3_obj (obj): MCG or OBC object bucketname (str): Name of the bucket Returns: dict : Delete Bucket policy response """ return s3_obj.s3_client.delete_bucket_policy(Bucket=bucketname) def s3_put_object(s3_obj, bucketname, object_key, data, content_type=""): """ Simple Boto3 client based Put object Args: s3_obj (obj): MCG or OBC object bucketname (str): Name of the bucket object_key (str): Unique object Identifier data (str): string content to write to a new S3 object content_type (str): Type of object data. eg: html, txt etc, Returns: dict : Put object response """ return s3_obj.s3_client.put_object( Bucket=bucketname, Key=object_key, Body=data, ContentType=content_type ) def s3_get_object(s3_obj, bucketname, object_key, versionid=""): """ Simple Boto3 client based Get object Args: s3_obj (obj): MCG or OBC object bucketname (str): Name of the bucket object_key (str): Unique object Identifier versionid (str): Unique version number of an object Returns: dict : Get object response """ return s3_obj.s3_client.get_object( Bucket=bucketname, Key=object_key, VersionId=versionid ) def s3_delete_object(s3_obj, bucketname, object_key, versionid=None): """ Simple Boto3 client based Delete object Args: s3_obj (obj): MCG or OBC object bucketname (str): Name of the bucket object_key (str): Unique object Identifier versionid (str): Unique version number of an object Returns: dict : Delete object response """ if versionid: return s3_obj.s3_client.delete_object( Bucket=bucketname, Key=object_key, VersionId=versionid ) else: return s3_obj.s3_client.delete_object(Bucket=bucketname, Key=object_key) def s3_put_bucket_website(s3_obj, bucketname, website_config): """ Boto3 client based Put bucket website function Args: s3_obj (obj): MCG or OBC object bucketname (str): Name of the bucket website_config (dict): Website configuration info Returns: dict : PutBucketWebsite response """ return s3_obj.s3_client.put_bucket_website( Bucket=bucketname, WebsiteConfiguration=website_config ) def s3_get_bucket_website(s3_obj, bucketname): """ Boto3 client based Get bucket website function Args: s3_obj (obj): MCG or OBC object bucketname (str): Name of the bucket Returns: dict : GetBucketWebsite response """ return s3_obj.s3_client.get_bucket_website(Bucket=bucketname) def s3_delete_bucket_website(s3_obj, bucketname): """ Boto3 client based Delete bucket website function Args: s3_obj (obj): MCG or OBC object bucketname (str): Name of the bucket Returns: dict : DeleteBucketWebsite response """ return s3_obj.s3_client.delete_bucket_website(Bucket=bucketname) def s3_put_bucket_versioning(s3_obj, bucketname, status="Enabled", s3_client=None): """ Boto3 client based Put Bucket Versioning function Args: s3_obj (obj): MCG or OBC object bucketname (str): Name of the bucket status (str): 'Enabled' or 'Suspended'. Default 'Enabled' s3_client : Any s3 client resource Returns: dict : PutBucketVersioning response """ if s3_client: return s3_client.put_bucket_versioning( Bucket=bucketname, VersioningConfiguration={"Status": status} ) else: return s3_obj.s3_client.put_bucket_versioning( Bucket=bucketname, VersioningConfiguration={"Status": status} ) def s3_get_bucket_versioning(s3_obj, bucketname, s3_client=None): """ Boto3 client based Get Bucket Versioning function Args: s3_obj (obj): MCG or OBC object bucketname (str): Name of the bucket s3_client: Any s3 client resource Returns: dict : GetBucketVersioning response """ if s3_client: return s3_client.get_bucket_versioning(Bucket=bucketname) else: return s3_obj.s3_client.get_bucket_versioning(Bucket=bucketname) def s3_list_object_versions(s3_obj, bucketname, prefix=""): """ Boto3 client based list object Versionfunction Args: s3_obj (obj): MCG or OBC object bucketname (str): Name of the bucket prefix (str): Object key prefix Returns: dict : List object version response """ return s3_obj.s3_client.list_object_versions(Bucket=bucketname, Prefix=prefix) def s3_io_create_delete(mcg_obj, awscli_pod, bucket_factory): """ Running IOs on s3 bucket Args: mcg_obj (obj): An MCG object containing the MCG S3 connection credentials awscli_pod (pod): A pod running the AWSCLI tools bucket_factory: Calling this fixture creates a new bucket(s) """ target_dir = "/aws/" + uuid4().hex + "_original/" downloaded_files = retrieve_test_objects_to_pod(awscli_pod, target_dir) bucketname = bucket_factory(1)[0].name uploaded_objects_paths = get_full_path_object(downloaded_files, bucketname) write_individual_s3_objects( mcg_obj, awscli_pod, bucket_factory, downloaded_files, target_dir, bucket_name=bucketname, ) del_objects(uploaded_objects_paths, awscli_pod, mcg_obj) awscli_pod.exec_cmd_on_pod(command=f"rm -rf {target_dir}") def del_objects(uploaded_objects_paths, awscli_pod, mcg_obj): """ Deleting objects from bucket Args: uploaded_objects_paths (list): List of object paths awscli_pod (pod): A pod running the AWSCLI tools mcg_obj (obj): An MCG object containing the MCG S3 connection credentials """ for uploaded_filename in uploaded_objects_paths: logger.info(f"Deleting object {uploaded_filename}") awscli_pod.exec_cmd_on_pod( command=craft_s3_command(mcg_obj, "rm " + uploaded_filename), secrets=[ mcg_obj.access_key_id, mcg_obj.access_key, mcg_obj.s3_internal_endpoint, ], ) def get_full_path_object(downloaded_files, bucket_name): """ Getting full of object in the bucket Args: downloaded_files (list): List of downloaded files bucket_name (str): Name of the bucket Returns: uploaded_objects_paths (list) : List of full paths of objects """ uploaded_objects_paths = [] for uploaded_filename in downloaded_files: uploaded_objects_paths.append(f"s3://{bucket_name}/{uploaded_filename}") return uploaded_objects_paths def obc_io_create_delete(mcg_obj, awscli_pod, bucket_factory): """ Running IOs on OBC interface Args: mcg_obj (obj): An MCG object containing the MCG S3 connection credentials awscli_pod (pod): A pod running the AWSCLI tools bucket_factory: Calling this fixture creates a new bucket(s) """ dir = "/aws/" + uuid4().hex + "_original/" downloaded_files = retrieve_test_objects_to_pod(awscli_pod, dir) bucket_name = bucket_factory(amount=1, interface="OC")[0].name mcg_bucket_path = f"s3://{bucket_name}/" uploaded_objects_paths = get_full_path_object(downloaded_files, bucket_name) sync_object_directory(awscli_pod, dir, mcg_bucket_path, mcg_obj) del_objects(uploaded_objects_paths, awscli_pod, mcg_obj) awscli_pod.exec_cmd_on_pod(command=f"rm -rf {dir}") def retrieve_verification_mode(): if config.ENV_DATA["platform"].lower() == "ibm_cloud": verify = True elif config.DEPLOYMENT.get("use_custom_ingress_ssl_cert"): verify = get_root_ca_cert() else: verify = constants.DEFAULT_INGRESS_CRT_LOCAL_PATH logger.debug(f"verification: '{verify}'") return verify def namespace_bucket_update(mcg_obj, bucket_name, read_resource, write_resource): """ Edits MCG namespace bucket resources Args: mcg_obj (obj): An MCG object containing the MCG S3 connection credentials bucket_name (str): Name of the bucket read_resource (list): Resource names to provide read access write_resource (str): Resource name to provide write access """ mcg_obj.send_rpc_query( "bucket_api", "update_bucket", { "name": bucket_name, "namespace": { "read_resources": read_resource, "write_resource": write_resource, }, }, ) def write_random_objects_in_pod(io_pod, file_dir, amount, pattern="ObjKey"): """ Uses /dev/urandom to create and write random files in a given directory in a pod Args: io_pod (ocs_ci.ocs.ocp.OCP): The pod object in which the files should be generated and written file_dir (str): A string describing the path in which to write the files to amount (int): The amount of files to generate pattern (str): The file name pattern to use Returns: list: A list with the names of all written objects """ obj_lst = [] for i in range(amount): object_key = pattern + "-{}".format(i) obj_lst.append(object_key) io_pod.exec_cmd_on_pod( f"dd if=/dev/urandom of={file_dir}/{object_key} bs=1M count=1 status=none" ) return obj_lst def setup_base_objects(awscli_pod, original_dir, result_dir, amount=2): """ Prepares two directories and populate one of them with objects Args: awscli_pod (Pod): A pod running the AWS CLI tools original_dir (str): original directory name result_dir (str): result directory name amount (Int): Number of test objects to create """ awscli_pod.exec_cmd_on_pod(command=f"mkdir {original_dir} {result_dir}") write_random_objects_in_pod(awscli_pod, original_dir, amount) def check_cached_objects_by_name(mcg_obj, bucket_name, expected_objects_names=None): """ Check if the names of cached objects in a cache bucket are as expected using rpc call Args: mcg_obj (MCG): An MCG object containing the MCG S3 connection credentials bucket_name (str): Name of the cache bucket expected_objects_names (list): Expected objects to be cached Returns: bool: True if all the objects exist in the cache as expected, False otherwise """ res = mcg_obj.send_rpc_query( "object_api", "list_objects", { "bucket": bucket_name, }, ).json() list_objects_res = [name["key"] for name in res.get("reply").get("objects")] if not expected_objects_names: expected_objects_names = [] if set(expected_objects_names) == set(list_objects_res): logger.info("Files cached as expected") return True logger.warning( "Objects did not cache properly, \n" f"Expected: [{expected_objects_names}]\n" f"Cached: [{list_objects_res}]" ) return False def wait_for_cache(mcg_obj, bucket_name, expected_objects_names=None): """ wait for existing cache bucket to cache all required objects Args: mcg_obj (MCG): An MCG object containing the MCG S3 connection credentials bucket_name (str): Name of the cache bucket expected_objects_names (list): Expected objects to be cached """ sample = TimeoutSampler( timeout=60, sleep=10, func=check_cached_objects_by_name, mcg_obj=mcg_obj, bucket_name=bucket_name, expected_objects_names=expected_objects_names, ) if not sample.wait_for_func_status(result=True): logger.error("Objects were not able to cache properly") raise UnexpectedBehaviour def compare_directory(awscli_pod, original_dir, result_dir, amount=2): """ Compares object checksums on original and result directories Args: awscli_pod (pod): A pod running the AWS CLI tools original_dir (str): original directory name result_dir (str): result directory name amount (int): Number of test objects to create """ for i in range(amount): file_name = f"ObjKey-{i}" assert verify_s3_object_integrity( original_object_path=f"{original_dir}/{file_name}", result_object_path=f"{result_dir}/{file_name}", awscli_pod=awscli_pod, ), "Checksum comparision between original and result object failed" def s3_copy_object(s3_obj, bucketname, source, object_key): """ Boto3 client based copy object Args: s3_obj (obj): MCG or OBC object bucketname (str): Name of the bucket source (str): Source object key. eg: '<bucket>/<key> object_key (str): Unique object Identifier for copied object Returns: dict : Copy object response """ return s3_obj.s3_client.copy_object( Bucket=bucketname, CopySource=source, Key=object_key ) def s3_upload_part_copy( s3_obj, bucketname, copy_source, object_key, part_number, upload_id ): """ Boto3 client based upload_part_copy operation Args: s3_obj (obj): MCG or OBC object bucketname (str): Name of the bucket copy_source (str): Name of the source bucket and key name. {bucket}/{key} part_number (int): Part number upload_id (str): Upload Id object_key (str): Unique object Identifier for copied object Returns: dict : upload_part_copy response """ return s3_obj.s3_client.upload_part_copy( Bucket=bucketname, CopySource=copy_source, Key=object_key, PartNumber=part_number, UploadId=upload_id, ) def s3_get_object_acl(s3_obj, bucketname, object_key): """ Boto3 client based get_object_acl operation Args: s3_obj (obj): MCG or OBC object bucketname (str): Name of the bucket object_key (str): Unique object Identifier for copied object Returns: dict : get object acl response """ return s3_obj.s3_client.get_object_acl(Bucket=bucketname, Key=object_key) def s3_head_object(s3_obj, bucketname, object_key, if_match=None): """ Boto3 client based head_object operation to retrieve only metadata Args: s3_obj (obj): MCG or OBC object bucketname (str): Name of the bucket object_key (str): Unique object Identifier for copied object if_match (str): Return the object only if its entity tag (ETag) is the same as the one specified, Returns: dict : head object response """ if if_match: return s3_obj.s3_client.head_object( Bucket=bucketname, Key=object_key, IfMatch=if_match ) else: return s3_obj.s3_client.head_object(Bucket=bucketname, Key=object_key) def s3_list_objects_v1( s3_obj, bucketname, prefix="", delimiter="", max_keys=1000, marker="" ): """ Boto3 client based list object version1 Args: s3_obj (obj): MCG or OBC object bucketname (str): Name of the bucket prefix (str): Limits the response to keys that begin with the specified prefix. delimiter (str): Character used to group keys. max_keys (int): Maximum number of keys returned in the response. Default 1,000 keys. marker (str): key to start with when listing objects in a bucket. Returns: dict : list object v1 response """ return s3_obj.s3_client.list_objects( Bucket=bucketname, Prefix=prefix, Delimiter=delimiter, MaxKeys=max_keys, Marker=marker, ) def s3_list_objects_v2( s3_obj, bucketname, prefix="", delimiter="", max_keys=1000, con_token="", fetch_owner=False, ): """ Boto3 client based list object version2 Args: s3_obj (obj): MCG or OBC object bucketname (str): Name of the bucket prefix (str): Limits the response to keys that begin with the specified prefix. delimiter (str): Character used to group keys. max_keys (int): Maximum number of keys returned in the response. Default 1,000 keys. con_token (str): Token used to continue the list fetch_owner (bool): Unique object Identifier Returns: dict : list object v2 response """ return s3_obj.s3_client.list_objects_v2( Bucket=bucketname, Prefix=prefix, Delimiter=delimiter, MaxKeys=max_keys, ContinuationToken=con_token, FetchOwner=fetch_owner, ) def s3_delete_objects(s3_obj, bucketname, object_keys): """ Boto3 client based delete objects Args: s3_obj (obj): MCG or OBC object bucketname (str): Name of the bucket object_keys (list): The objects to delete. Format: {'Key': 'object_key', 'VersionId': ''} Returns: dict : delete objects response """ return s3_obj.s3_client.delete_objects( Bucket=bucketname, Delete={"Objects": object_keys} ) def bucket_read_api(mcg_obj, bucket_name): """ Fetches the bucket metadata like size, tiers etc Args: mcg_obj (obj): MCG object bucket_name (str): Name of the bucket Returns: dict : Bucket policy response """ resp = mcg_obj.send_rpc_query( "bucket_api", "read_bucket", params={"name": bucket_name} ) bucket_read_resp = resp.json().get("reply") return bucket_read_resp def get_bucket_available_size(mcg_obj, bucket_name): """ Function to get the bucket available size Args: mcg_obj (obj): MCG object bucket_name (str): Name of the bucket Returns: int : Available size in the bucket """ resp = bucket_read_api(mcg_obj, bucket_name) bucket_size = resp["storage"]["values"]["free"] return bucket_size def compare_bucket_object_list(mcg_obj, first_bucket_name, second_bucket_name): """ Compares the object lists of two given buckets Args: mcg_obj (MCG): An initialized MCG object first_bucket_name (str): The name of the first bucket to compare second_bucket_name (str): The name of the second bucket to compare Returns: bool: True if both buckets contain the same object names in all objects, False otherwise """ def _comparison_logic(): first_bucket_object_set = { obj.key for obj in mcg_obj.s3_list_all_objects_in_bucket(first_bucket_name) } second_bucket_object_set = { obj.key for obj in mcg_obj.s3_list_all_objects_in_bucket(second_bucket_name) } if first_bucket_object_set == second_bucket_object_set: logger.info("Objects in both buckets are identical") return True else: logger.warning( f"""Buckets {first_bucket_name} and {second_bucket_name} do not contain the same objects. {first_bucket_name} objects: {first_bucket_object_set} {second_bucket_name} objects: {second_bucket_object_set} """ ) return False try: for comparison_result in TimeoutSampler(600, 30, _comparison_logic): if comparison_result: return True except TimeoutExpiredError: logger.error( "The compared buckets did not contain the same set of objects after ten minutes" ) return False def write_random_test_objects_to_bucket( io_pod, bucket_to_write, file_dir, amount=1, mcg_obj=None, s3_creds=None, ): """ Write files generated by /dev/urandom to a bucket Args: io_pod (ocs_ci.ocs.ocp.OCP): The pod which should handle all needed IO operations bucket_to_write (str): The bucket name to write the random files to file_dir (str): The path to the folder where all random files will be generated and copied from amount (int, optional): The amount of random objects to write. Defaults to 1. mcg_obj (MCG, optional): An MCG class instance s3_creds (dict, optional): A dictionary containing S3-compatible credentials for writing objects directly to buckets outside of the MCG. Defaults to None. Returns: list: A list containing the names of the random files that were written """ full_object_path = f"s3://{bucket_to_write}" obj_lst = write_random_objects_in_pod(io_pod, file_dir, amount) sync_object_directory( io_pod, file_dir, full_object_path, s3_obj=mcg_obj, signed_request_creds=s3_creds, ) return obj_lst
[ "uuid.uuid4", "ocs_ci.utility.ssl_certs.get_root_ca_cert", "ocs_ci.utility.utils.run_cmd", "ocs_ci.framework.config.DEPLOYMENT.get", "ocs_ci.utility.templating.load_yaml", "ocs_ci.helpers.helpers.create_resource", "ocs_ci.ocs.resources.pod.get_rgw_pods", "boto3.resource", "os.getenv", "logging.getLogger", "ocs_ci.utility.utils.TimeoutSampler" ]
[((538, 565), 'logging.getLogger', 'logging.getLogger', (['__name__'], {}), '(__name__)\n', (555, 565), False, 'import logging\n'), ((4334, 4354), 'boto3.resource', 'boto3.resource', (['"""s3"""'], {}), "('s3')\n", (4348, 4354), False, 'import boto3\n'), ((7020, 7034), 'ocs_ci.ocs.resources.pod.get_rgw_pods', 'get_rgw_pods', ([], {}), '()\n', (7032, 7034), False, 'from ocs_ci.ocs.resources.pod import get_rgw_pods\n'), ((10321, 10374), 'ocs_ci.utility.templating.load_yaml', 'templating.load_yaml', (['constants.MCG_BACKINGSTORE_YAML'], {}), '(constants.MCG_BACKINGSTORE_YAML)\n', (10341, 10374), False, 'from ocs_ci.utility import templating\n'), ((10725, 10751), 'ocs_ci.helpers.helpers.create_resource', 'create_resource', ([], {}), '(**bs_data)\n', (10740, 10751), False, 'from ocs_ci.helpers.helpers import create_resource\n'), ((12002, 12055), 'ocs_ci.utility.templating.load_yaml', 'templating.load_yaml', (['constants.MCG_BACKINGSTORE_YAML'], {}), '(constants.MCG_BACKINGSTORE_YAML)\n', (12022, 12055), False, 'from ocs_ci.utility import templating\n'), ((12339, 12365), 'ocs_ci.helpers.helpers.create_resource', 'create_resource', ([], {}), '(**bs_data)\n', (12354, 12365), False, 'from ocs_ci.helpers.helpers import create_resource\n'), ((13581, 13634), 'ocs_ci.utility.templating.load_yaml', 'templating.load_yaml', (['constants.MCG_BACKINGSTORE_YAML'], {}), '(constants.MCG_BACKINGSTORE_YAML)\n', (13601, 13634), False, 'from ocs_ci.utility import templating\n'), ((13917, 13943), 'ocs_ci.helpers.helpers.create_resource', 'create_resource', ([], {}), '(**bs_data)\n', (13932, 13943), False, 'from ocs_ci.helpers.helpers import create_resource\n'), ((15140, 15193), 'ocs_ci.utility.templating.load_yaml', 'templating.load_yaml', (['constants.MCG_BACKINGSTORE_YAML'], {}), '(constants.MCG_BACKINGSTORE_YAML)\n', (15160, 15193), False, 'from ocs_ci.utility import templating\n'), ((15697, 15723), 'ocs_ci.helpers.helpers.create_resource', 'create_resource', ([], {}), '(**bs_data)\n', (15712, 15723), False, 'from ocs_ci.helpers.helpers import create_resource\n'), ((17196, 17248), 'ocs_ci.utility.templating.load_yaml', 'templating.load_yaml', (['constants.PV_BACKINGSTORE_YAML'], {}), '(constants.PV_BACKINGSTORE_YAML)\n', (17216, 17248), False, 'from ocs_ci.utility import templating\n'), ((17582, 17608), 'ocs_ci.helpers.helpers.create_resource', 'create_resource', ([], {}), '(**bs_data)\n', (17597, 17608), False, 'from ocs_ci.helpers.helpers import create_resource\n'), ((18701, 18835), 'ocs_ci.utility.utils.TimeoutSampler', 'TimeoutSampler', ([], {'timeout': '(240)', 'sleep': '(15)', 'func': 'check_pv_backingstore_status', 'backingstore_name': 'backingstore_name', 'namespace': 'namespace'}), '(timeout=240, sleep=15, func=check_pv_backingstore_status,\n backingstore_name=backingstore_name, namespace=namespace)\n', (18715, 18835), False, 'from ocs_ci.utility.utils import TimeoutSampler, run_cmd\n'), ((19666, 19689), 'os.getenv', 'os.getenv', (['"""KUBECONFIG"""'], {}), "('KUBECONFIG')\n", (19675, 19689), False, 'import os\n'), ((19981, 19997), 'ocs_ci.utility.utils.run_cmd', 'run_cmd', ([], {'cmd': 'cmd'}), '(cmd=cmd)\n', (19988, 19997), False, 'from ocs_ci.utility.utils import TimeoutSampler, run_cmd\n'), ((35705, 35874), 'ocs_ci.utility.utils.TimeoutSampler', 'TimeoutSampler', ([], {'timeout': '(60)', 'sleep': '(10)', 'func': 'check_cached_objects_by_name', 'mcg_obj': 'mcg_obj', 'bucket_name': 'bucket_name', 'expected_objects_names': 'expected_objects_names'}), '(timeout=60, sleep=10, func=check_cached_objects_by_name,\n mcg_obj=mcg_obj, bucket_name=bucket_name, expected_objects_names=\n expected_objects_names)\n', (35719, 35874), False, 'from ocs_ci.utility.utils import TimeoutSampler, run_cmd\n'), ((31912, 31964), 'ocs_ci.framework.config.DEPLOYMENT.get', 'config.DEPLOYMENT.get', (['"""use_custom_ingress_ssl_cert"""'], {}), "('use_custom_ingress_ssl_cert')\n", (31933, 31964), False, 'from ocs_ci.framework import config\n'), ((43581, 43623), 'ocs_ci.utility.utils.TimeoutSampler', 'TimeoutSampler', (['(600)', '(30)', '_comparison_logic'], {}), '(600, 30, _comparison_logic)\n', (43595, 43623), False, 'from ocs_ci.utility.utils import TimeoutSampler, run_cmd\n'), ((31983, 32001), 'ocs_ci.utility.ssl_certs.get_root_ca_cert', 'get_root_ca_cert', ([], {}), '()\n', (31999, 32001), False, 'from ocs_ci.utility.ssl_certs import get_root_ca_cert\n'), ((29204, 29211), 'uuid.uuid4', 'uuid4', ([], {}), '()\n', (29209, 29211), False, 'from uuid import uuid4\n'), ((31311, 31318), 'uuid.uuid4', 'uuid4', ([], {}), '()\n', (31316, 31318), False, 'from uuid import uuid4\n')]
#!/usr/bin/env python # from __future__ import print_function import argparse import struct import sys class bcolors: HEADER = '\033[95m' OKBLUE = '\033[94m' OKGREEN = '\033[92m' WARNING = '\033[93m' FAIL = '\033[91m' ENDC = '\033[0m' BOLD = '\033[1m' UNDERLINE = '\033[4m' def main(): ESP32_TRACE_BLOCK_HDR_SZ = 8 ESP32_TRACE_BLOCK_TASK_IDX = 0 ESP32_TRACE_BLOCK_TS_IDX = 1 ESP32_TRACE_BLOCK_DATA_IDX = 2 parser = argparse.ArgumentParser(description='ESP32 App Trace Parse Tool') parser.add_argument('file', help='Path to app trace file', type=str) parser.add_argument('--print-tasks', '-p', help='Print tasks', action='store_true') parser.add_argument('--print-details', '-d', help='Print detailed stats', action='store_true') parser.add_argument('--no-errors', '-n', help='Do not print errors', action='store_true') parser.add_argument('--block-len', '-b', help='Block length', type=int, default=1024) args = parser.parse_args() print("====================================================================") try: ftrc = open(args.file, 'rb') except IOError as e: print("Failed to open trace file (%s)!" % e) sys.exit(2) passed = True off = 0 data_stats = {} last_ts = None tot_discont = 0 while True: # ftrc.seek(off) task = None ts = 0 trc_buf = ftrc.read(args.block_len) if len(trc_buf) == 0: # print('EOF') break trc_data = struct.unpack('<LL%sB' % (len(trc_buf) - ESP32_TRACE_BLOCK_HDR_SZ), trc_buf) if len(trc_data): # print("%x %x, len %d" % (trc_data[0], trc_data[1], len(trc_data) - 2)) # print(trc_data[2:]) # sys.exit(0) task = trc_data[ESP32_TRACE_BLOCK_TASK_IDX] ts = trc_data[ESP32_TRACE_BLOCK_TS_IDX] # print(ts) if last_ts and last_ts >= ts: # print("Global TS discontinuity %x -> %x, task %x, stamp %x at %x" % (last_ts, ts, task, # data_stats[task]['stamp'], off)) if args.print_details: print("Global TS discontinuity %x -> %x, task %x at %x" % (last_ts, ts, task, off)) # tot_discont += 1 # passed = False last_ts = ts if task not in data_stats: print("%x: NEW TASK" % task) data_stats[task] = {'stamp': trc_data[ESP32_TRACE_BLOCK_DATA_IDX], 'last_ts': ts, 'count': 1, 'discont_offs': [], 'inv_stamps_offs': []} else: if data_stats[task]['last_ts'] == ts: print("Task TS discontinuity %x -> %x, task %x, stamp %x at %x" % (last_ts, ts, task, data_stats[task]['stamp'], off)) data_stats[task]['discont_offs'].append(off) tot_discont += 1 passed = False data_stats[task]['last_ts'] = ts data_stats[task]['count'] += 1 if len(trc_data) > ESP32_TRACE_BLOCK_DATA_IDX: # print("DATA = %x %x %x %x" % (trc_data[-4], trc_data[-3], trc_data[-2], trc_data[-1])) if args.print_tasks: print("Task[%d] %x, ts %08x, stamp %x" % (off / args.block_len, task, ts, trc_data[ESP32_TRACE_BLOCK_DATA_IDX])) else: print("%x: NO DATA" % task) else: print("Failed to unpack data!") sys.exit(2) # check data for i in range(ESP32_TRACE_BLOCK_DATA_IDX, len(trc_data)): if trc_data[i] != data_stats[task]['stamp']: if not args.no_errors: print("Invalid stamp %x->%x at %x, task %x" % (data_stats[task]['stamp'], trc_data[i], off + ESP32_TRACE_BLOCK_HDR_SZ + i, task)) passed = False data_stats[task]['stamp'] = trc_data[i] data_stats[task]['inv_stamps_offs'].append(off) # break if len(trc_buf) < args.block_len: print('Last block (not full)') break if data_stats[task]['stamp'] is not None: data_stats[task]['stamp'] = (data_stats[task]['stamp'] + 1) & 0xFF # print("stamp=%x" % data_stats[task][ESP32_TRACE_STAMP_IDX]) off += args.block_len ftrc.close() print("====================================================================") print("Trace size %d bytes, discont %d\n" % (off, tot_discont)) for t in data_stats: print("Task %x. Total count %d. Inv stamps %d. TS Discontinuities %d." % (t, data_stats[t]['count'], len(data_stats[t]['inv_stamps_offs']), len(data_stats[t]['discont_offs']))) if args.print_details: print('Invalid stamps offs: [{}]'.format(', '.join(hex(x) for x in data_stats[t]['inv_stamps_offs']))) print('TS Discontinuities offs: [{}]'.format(', '.join(hex(x) for x in data_stats[t]['discont_offs']))) print("\n") if passed: print("Data - OK") else: print("Data - FAILED!") if __name__ == '__main__': main()
[ "argparse.ArgumentParser", "sys.exit" ]
[((499, 564), 'argparse.ArgumentParser', 'argparse.ArgumentParser', ([], {'description': '"""ESP32 App Trace Parse Tool"""'}), "(description='ESP32 App Trace Parse Tool')\n", (522, 564), False, 'import argparse\n'), ((1272, 1283), 'sys.exit', 'sys.exit', (['(2)'], {}), '(2)\n', (1280, 1283), False, 'import sys\n'), ((3609, 3620), 'sys.exit', 'sys.exit', (['(2)'], {}), '(2)\n', (3617, 3620), False, 'import sys\n')]
from django.db import models CONTENT_TYPE=( ('html','html'), ('text','text') ) class Newsletter(models.Model): title=models.CharField(max_length=500) content_type=models.CharField(choices=CONTENT_TYPE,max_length=30) content=models.TextField() subscribers=models.ManyToManyField('Subcriber',blank=True) created=models.DateTimeField(auto_now_add=True) class Subcriber(models.Model): name=models.CharField(max_length=300) email=models.EmailField(max_length=500)
[ "django.db.models.TextField", "django.db.models.ManyToManyField", "django.db.models.CharField", "django.db.models.EmailField", "django.db.models.DateTimeField" ]
[((131, 163), 'django.db.models.CharField', 'models.CharField', ([], {'max_length': '(500)'}), '(max_length=500)\n', (147, 163), False, 'from django.db import models\n'), ((181, 234), 'django.db.models.CharField', 'models.CharField', ([], {'choices': 'CONTENT_TYPE', 'max_length': '(30)'}), '(choices=CONTENT_TYPE, max_length=30)\n', (197, 234), False, 'from django.db import models\n'), ((246, 264), 'django.db.models.TextField', 'models.TextField', ([], {}), '()\n', (262, 264), False, 'from django.db import models\n'), ((281, 328), 'django.db.models.ManyToManyField', 'models.ManyToManyField', (['"""Subcriber"""'], {'blank': '(True)'}), "('Subcriber', blank=True)\n", (303, 328), False, 'from django.db import models\n'), ((340, 379), 'django.db.models.DateTimeField', 'models.DateTimeField', ([], {'auto_now_add': '(True)'}), '(auto_now_add=True)\n', (360, 379), False, 'from django.db import models\n'), ((422, 454), 'django.db.models.CharField', 'models.CharField', ([], {'max_length': '(300)'}), '(max_length=300)\n', (438, 454), False, 'from django.db import models\n'), ((465, 498), 'django.db.models.EmailField', 'models.EmailField', ([], {'max_length': '(500)'}), '(max_length=500)\n', (482, 498), False, 'from django.db import models\n')]
"""Global fixtures for Porsche Connect integration.""" from typing import Any from unittest.mock import patch import pytest from pyporscheconnectapi.exceptions import WrongCredentials # from unittest.mock import Mock pytest_plugins = "pytest_homeassistant_custom_component" # This fixture is used to prevent HomeAssistant from attempting to create and dismiss persistent # notifications. These calls would fail without this fixture since the persistent_notification # integration is never loaded during a test. @pytest.fixture(name="skip_notifications", autouse=True) def skip_notifications_fixture(): """Skip notification calls.""" with patch("homeassistant.components.persistent_notification.async_create"), patch( "homeassistant.components.persistent_notification.async_dismiss" ): yield @pytest.fixture(name="auto_enable_custom_integrations", autouse=True) def auto_enable_custom_integrations( hass: Any, enable_custom_integrations: Any # noqa: F811 ) -> None: """Enable custom integrations defined in the test dir.""" # This fixture, when used, will result in calls to async_get_data to return None. To have the call # return a value, we would add the `return_value=<VALUE_TO_RETURN>` parameter to the patch call. @pytest.fixture(name="bypass_connection_connect") def bypass_connection_connect_fixture(): """Skip calls to get data from API.""" with patch("pyporscheconnectapi.connection.Connection._login"), patch( "pyporscheconnectapi.connection.Connection.getAllTokens" ): yield # In this fixture, we are forcing calls to async_get_data to raise an Exception. This is useful # for exception handling. @pytest.fixture(name="error_connection_connect") def error_connection_connect_fixture(): """Simulate error when retrieving data from API.""" with patch( "pyporscheconnectapi.connection.Connection._login", side_effect=WrongCredentials, ), patch("pyporscheconnectapi.connection.Connection.getAllTokens"): yield # This fixture, when used, will result in calls to async_get_data to return None. To have the call # return a value, we would add the `return_value=<VALUE_TO_RETURN>` parameter to the patch call. @pytest.fixture(name="bypass_get_data") def bypass_get_data_fixture(): """Skip calls to get data from API.""" with patch( "custom_components.porscheconnect.PorscheConnectApiClient.async_get_data" ): yield # In this fixture, we are forcing calls to async_get_data to raise an Exception. This is useful # for exception handling. @pytest.fixture(name="error_on_get_data") def error_get_data_fixture(): """Simulate error when retrieving data from API.""" with patch( "custom_components.porscheconnect.PorscheConnectApiClient.async_get_data", side_effect=Exception, ): yield
[ "unittest.mock.patch", "pytest.fixture" ]
[((517, 572), 'pytest.fixture', 'pytest.fixture', ([], {'name': '"""skip_notifications"""', 'autouse': '(True)'}), "(name='skip_notifications', autouse=True)\n", (531, 572), False, 'import pytest\n'), ((827, 895), 'pytest.fixture', 'pytest.fixture', ([], {'name': '"""auto_enable_custom_integrations"""', 'autouse': '(True)'}), "(name='auto_enable_custom_integrations', autouse=True)\n", (841, 895), False, 'import pytest\n'), ((1266, 1314), 'pytest.fixture', 'pytest.fixture', ([], {'name': '"""bypass_connection_connect"""'}), "(name='bypass_connection_connect')\n", (1280, 1314), False, 'import pytest\n'), ((1685, 1732), 'pytest.fixture', 'pytest.fixture', ([], {'name': '"""error_connection_connect"""'}), "(name='error_connection_connect')\n", (1699, 1732), False, 'import pytest\n'), ((2228, 2266), 'pytest.fixture', 'pytest.fixture', ([], {'name': '"""bypass_get_data"""'}), "(name='bypass_get_data')\n", (2242, 2266), False, 'import pytest\n'), ((2585, 2625), 'pytest.fixture', 'pytest.fixture', ([], {'name': '"""error_on_get_data"""'}), "(name='error_on_get_data')\n", (2599, 2625), False, 'import pytest\n'), ((651, 721), 'unittest.mock.patch', 'patch', (['"""homeassistant.components.persistent_notification.async_create"""'], {}), "('homeassistant.components.persistent_notification.async_create')\n", (656, 721), False, 'from unittest.mock import patch\n'), ((723, 794), 'unittest.mock.patch', 'patch', (['"""homeassistant.components.persistent_notification.async_dismiss"""'], {}), "('homeassistant.components.persistent_notification.async_dismiss')\n", (728, 794), False, 'from unittest.mock import patch\n'), ((1408, 1465), 'unittest.mock.patch', 'patch', (['"""pyporscheconnectapi.connection.Connection._login"""'], {}), "('pyporscheconnectapi.connection.Connection._login')\n", (1413, 1465), False, 'from unittest.mock import patch\n'), ((1467, 1530), 'unittest.mock.patch', 'patch', (['"""pyporscheconnectapi.connection.Connection.getAllTokens"""'], {}), "('pyporscheconnectapi.connection.Connection.getAllTokens')\n", (1472, 1530), False, 'from unittest.mock import patch\n'), ((1838, 1930), 'unittest.mock.patch', 'patch', (['"""pyporscheconnectapi.connection.Connection._login"""'], {'side_effect': 'WrongCredentials'}), "('pyporscheconnectapi.connection.Connection._login', side_effect=\n WrongCredentials)\n", (1843, 1930), False, 'from unittest.mock import patch\n'), ((1950, 2013), 'unittest.mock.patch', 'patch', (['"""pyporscheconnectapi.connection.Connection.getAllTokens"""'], {}), "('pyporscheconnectapi.connection.Connection.getAllTokens')\n", (1955, 2013), False, 'from unittest.mock import patch\n'), ((2350, 2435), 'unittest.mock.patch', 'patch', (['"""custom_components.porscheconnect.PorscheConnectApiClient.async_get_data"""'], {}), "('custom_components.porscheconnect.PorscheConnectApiClient.async_get_data'\n )\n", (2355, 2435), False, 'from unittest.mock import patch\n'), ((2721, 2829), 'unittest.mock.patch', 'patch', (['"""custom_components.porscheconnect.PorscheConnectApiClient.async_get_data"""'], {'side_effect': 'Exception'}), "('custom_components.porscheconnect.PorscheConnectApiClient.async_get_data'\n , side_effect=Exception)\n", (2726, 2829), False, 'from unittest.mock import patch\n')]
# vim: expandtab:ts=4:sw=4 from __future__ import absolute_import import numpy as np import pdb from . import kf_2d, kf_3d, double_measurement_kf, imm from . import linear_assignment from . import iou_matching from .track import Track from . import JPDA_matching from . import tracking_utils import math from nn_matching import NearestNeighborDistanceMetric import cv2 class Tracker: """ This is the multi-target tracker. Parameters ---------- metric : nn_matching.NearestNeighborDistanceMetric A distance metric for measurement-to-track association. max_age : int Maximum number of missed misses before a track is deleted. n_init : int Number of consecutive detections before the track is confirmed. The track state is set to `Deleted` if a miss occurs within the first `n_init` frames. Attributes ---------- metric : nn_matching.NearestNeighborDistanceMetric The distance metric used for measurement to track association. max_age : int Maximum number of missed misses before a track is deleted. n_init : int Number of frames that a track remains in initialization phase. kf : EKF.KalmanFilter A Kalman filter to filter target trajectories in image space. tracks : List[Track] The list of active tracks at the current time step. """ def __init__(self, max_age=5, n_init=3, JPDA=False, m_best_sol=1, assn_thresh=0.0, matching_strategy=None, kf_appearance_feature=None, gate_full_state=False, lstm = None, cuda = False, appearance_model = None, calib = None, kf_vel_params=(1./20, 1./160, 1, 1, 2), dummy_node_cost_iou=0.4, dummy_node_cost_app=0.2, nn_budget = None, use_imm=False, kf_walk_params=(1./20, 1./160, 1, 1, 2), markov=(0.9, 0.7), uncertainty_limit=1.8, optical_flow=False, gate_limit=400): self.max_age = max_age self.n_init = n_init self.metric = NearestNeighborDistanceMetric("euclidean", nn_budget) if not use_imm: self.kf = kf_2d.KalmanFilter2D(*kf_vel_params, gate_limit) self.use_imm = False else: self.kf = imm.IMMFilter2D(kf_vel_params, kf_walk_params, markov=markov) self.use_imm = True self.tracks = [] self._next_id = 1 self.JPDA = JPDA self.m_best_sol = m_best_sol self.assn_thresh = assn_thresh self.matching_strategy = matching_strategy self.kf_appearance_feature = kf_appearance_feature self.gate_only_position = not gate_full_state self.lstm = lstm self.cuda = cuda self.dummy_node_cost_app = dummy_node_cost_app self.dummy_node_cost_iou = dummy_node_cost_iou self.appearance_model = appearance_model self.prev_frame = None self.uncertainty_limit = uncertainty_limit self.optical_flow = optical_flow # @profile def gated_metric(self, tracks, dets, track_indices, detection_indices, compare_2d = False): targets = np.array([tracks[i].track_id for i in track_indices]) if not compare_2d and self.metric.check_samples(targets): compare_2d = True if compare_2d: features = np.array([dets[i].appearance_feature for i in detection_indices]) else: features = np.array([dets[i].feature for i in detection_indices]) #cost_matrix = self.metric.distance(features, targets, compare_2d) cost_matrix_appearance = self.metric.distance_torch(features, targets, compare_2d) cost_matrix_iou = iou_matching.iou_cost(tracks, dets, track_indices, detection_indices) gate_mask = linear_assignment.gate_cost_matrix( self.kf, tracks, dets, track_indices, detection_indices, only_position=self.gate_only_position) cost_matrix = np.dstack((cost_matrix_appearance, cost_matrix_iou)) return cost_matrix, gate_mask def predict(self): """Propagate track state distributions one time step forward. This function should be called once every time step, before `update`. """ for track in self.tracks: track.predict(self.kf) # @profile def update(self, cur_frame, detections, compare_2d = False): """Perform measurement update and track management. Parameters ---------- detections : List[deep_sort.detection.Detection] A list of detections at the current time step. """ self.cur_frame = cv2.cvtColor((255*cur_frame).permute(1,2,0).cpu().numpy(), cv2.COLOR_BGR2GRAY) matches, unmatched_tracks, unmatched_detections = \ self._match(detections, compare_2d) # update filter for each assigned track # Only do this for non-JPDA because in JPDA the kf states are updated # during the matching process if not self.JPDA: # Map matched tracks to detections track_detection_map = {t:d for (t,d) in matches} # Map unmatched tracks to -1 for no detection for t in unmatched_tracks: track_detection_map[t] = -1 for track_idx, detection_idx in matches: self.tracks[track_idx].update(self.kf, detections, detection_idx=detection_idx, JPDA=self.JPDA, cur_frame = self.cur_frame, appearance_model = self.appearance_model, lstm = self.lstm) # update track state for unmatched tracks for track_idx in unmatched_tracks: self.tracks[track_idx].mark_missed() # create new tracks self.prune_tracks() flow = None if unmatched_detections: if self.optical_flow and self.prev_frame is not None: flow = cv2.calcOpticalFlowFarneback(self.prev_frame, self.cur_frame, None, 0.5, 3, 15, 3, 5, 1.2, 0) for detection_idx in unmatched_detections: self._initiate_track(detections[detection_idx], flow) # Update distance metric. active_targets = [t.track_id for t in self.tracks] features, features_2d, targets, targets_2d = [], [], [], [] for track in self.tracks: features += track.features features_2d += track.features_2d targets += [track.track_id for _ in track.features] targets_2d += [track.track_id for _ in track.features_2d] track.features = [] track.features_2d = [] self.metric.partial_fit( np.asarray(features), np.asarray(features_2d), np.asarray(targets), np.asarray(targets_2d), active_targets) self.prev_frame = self.cur_frame # @profile def _match(self, detections, compare_2d): # Associate all tracks using combined cost matrices. if self.JPDA: # Run JPDA on all tracks marginalizations = \ linear_assignment.JPDA(self.gated_metric, self.dummy_node_cost_app, self.dummy_node_cost_iou, self.tracks, \ detections, m=self.m_best_sol, compare_2d = compare_2d) # for track in self.tracks: #TODO: REMOVE # print(track.track_id) # print(marginalizations) jpda_matcher = JPDA_matching.Matcher( detections, marginalizations, range(len(self.tracks)), self.matching_strategy, assignment_threshold=self.assn_thresh) matches_a, unmatched_tracks_a, unmatched_detections = jpda_matcher.match() # Map matched tracks to detections # Map matched tracks to detections track_detection_map = {t:d for (t,d) in matches_a} # Map unmatched tracks to -1 for no detection for t in unmatched_tracks_a: track_detection_map[t] = -1 # update Kalman state if marginalizations.shape[0] > 0: for i in range(len(self.tracks)): self.tracks[i].update(self.kf, detections, marginalization=marginalizations[i,:], detection_idx=track_detection_map[i], JPDA=self.JPDA, cur_frame = self.cur_frame, appearance_model = self.appearance_model, lstm = self.lstm) else: confirmed_tracks = [i for i, t in enumerate(self.tracks) if t.is_confirmed()] matches_a, unmatched_tracks_a, unmatched_detections = \ linear_assignment.matching_cascade( self.gated_metric, self.dummy_node_cost_iou, self.max_age, self.tracks, detections, confirmed_tracks, compare_2d = compare_2d) return matches_a, unmatched_tracks_a, unmatched_detections def _initiate_track(self, detection, flow=None): if self.use_imm: mean, covariance, model_probabilities = self.kf.initiate(detection.to_xywh(), flow) else: mean, covariance = self.kf.initiate(detection.to_xywh(), flow) model_probabilities = None self.tracks.append(Track( mean, covariance, model_probabilities, self._next_id, self.n_init, self.max_age, kf_appearance_feature = self.kf_appearance_feature, feature=detection.feature, appearance_feature = detection.appearance_feature, cuda = self.cuda, lstm = self.lstm, last_det = detection)) self._next_id += 1 def prune_tracks(self): h, w = self.cur_frame.shape for track in self.tracks: # Check if track is leaving if self.use_imm: predicted_mean, predicted_cov = self.kf.combine_states(track.mean, track.covariance, track.model_probabilities) #TODO: This doesn't predict. Mean should def predict else: predicted_mean = self.kf.predict_mean(track.mean) predicted_cov = track.covariance predicted_pos = predicted_mean[:2] predicted_vel = predicted_mean[4:6] predicted_pos[0] -= w/2 predicted_pos[1] -= h/2 cos_theta = np.dot(predicted_pos, predicted_vel)/(np.linalg.norm(predicted_pos)* np.linalg.norm(predicted_vel) + 1e-6) predicted_pos[0] += w/2 predicted_pos[1] += h/2 # Thresholds for deciding whether track is outside image BORDER_VALUE = 0 if (cos_theta > 0 and (predicted_pos[0] - track.mean[2]/2<= BORDER_VALUE or predicted_pos[0] + track.mean[2]/2 >= w - BORDER_VALUE)): if track.is_exiting() and not track.matched: track.delete_track() else: track.mark_exiting() # Check if track is too uncertain # cov_axis,_ = np.linalg.eigh(predicted_cov) # if np.abs(np.sqrt(cov_axis[-1]))*6 > self.uncertainty_limit*np.linalg.norm(predicted_mean[2:4]): # track.delete_track() self.tracks = [t for t in self.tracks if not t.is_deleted()]
[ "numpy.dstack", "nn_matching.NearestNeighborDistanceMetric", "numpy.asarray", "numpy.array", "numpy.linalg.norm", "cv2.calcOpticalFlowFarneback", "numpy.dot" ]
[((2036, 2089), 'nn_matching.NearestNeighborDistanceMetric', 'NearestNeighborDistanceMetric', (['"""euclidean"""', 'nn_budget'], {}), "('euclidean', nn_budget)\n", (2065, 2089), False, 'from nn_matching import NearestNeighborDistanceMetric\n'), ((3126, 3179), 'numpy.array', 'np.array', (['[tracks[i].track_id for i in track_indices]'], {}), '([tracks[i].track_id for i in track_indices])\n', (3134, 3179), True, 'import numpy as np\n'), ((3941, 3993), 'numpy.dstack', 'np.dstack', (['(cost_matrix_appearance, cost_matrix_iou)'], {}), '((cost_matrix_appearance, cost_matrix_iou))\n', (3950, 3993), True, 'import numpy as np\n'), ((3322, 3387), 'numpy.array', 'np.array', (['[dets[i].appearance_feature for i in detection_indices]'], {}), '([dets[i].appearance_feature for i in detection_indices])\n', (3330, 3387), True, 'import numpy as np\n'), ((3425, 3479), 'numpy.array', 'np.array', (['[dets[i].feature for i in detection_indices]'], {}), '([dets[i].feature for i in detection_indices])\n', (3433, 3479), True, 'import numpy as np\n'), ((6679, 6699), 'numpy.asarray', 'np.asarray', (['features'], {}), '(features)\n', (6689, 6699), True, 'import numpy as np\n'), ((6701, 6724), 'numpy.asarray', 'np.asarray', (['features_2d'], {}), '(features_2d)\n', (6711, 6724), True, 'import numpy as np\n'), ((6726, 6745), 'numpy.asarray', 'np.asarray', (['targets'], {}), '(targets)\n', (6736, 6745), True, 'import numpy as np\n'), ((6747, 6769), 'numpy.asarray', 'np.asarray', (['targets_2d'], {}), '(targets_2d)\n', (6757, 6769), True, 'import numpy as np\n'), ((5940, 6037), 'cv2.calcOpticalFlowFarneback', 'cv2.calcOpticalFlowFarneback', (['self.prev_frame', 'self.cur_frame', 'None', '(0.5)', '(3)', '(15)', '(3)', '(5)', '(1.2)', '(0)'], {}), '(self.prev_frame, self.cur_frame, None, 0.5, 3,\n 15, 3, 5, 1.2, 0)\n', (5968, 6037), False, 'import cv2\n'), ((10200, 10236), 'numpy.dot', 'np.dot', (['predicted_pos', 'predicted_vel'], {}), '(predicted_pos, predicted_vel)\n', (10206, 10236), True, 'import numpy as np\n'), ((10238, 10267), 'numpy.linalg.norm', 'np.linalg.norm', (['predicted_pos'], {}), '(predicted_pos)\n', (10252, 10267), True, 'import numpy as np\n'), ((10321, 10350), 'numpy.linalg.norm', 'np.linalg.norm', (['predicted_vel'], {}), '(predicted_vel)\n', (10335, 10350), True, 'import numpy as np\n')]
from os.path import join as pjoin from glob import glob import os from tinydb import TinyDB def pk(doc, pk_extra): pk_doc = {"path": tuple(doc["path"]), "gold": doc["gold"]} if "opts" in doc: pk_doc.update(doc["opts"]) if pk_extra is not None: pk_doc.update(pk_extra(doc)) return freeze(pk_doc) def freeze(tree): if isinstance(tree, dict): return tuple(((k, freeze(v)) for k, v in sorted(tree.items()))) elif isinstance(tree, list): return tuple((freeze(v) for v in tree)) else: return tree def all_docs(dbs): for db in dbs: for doc in db.all(): yield doc def all_recent(dbs, pk_extra): recents = {} for doc in all_docs(dbs): if "time" not in doc: continue key = pk(doc, pk_extra) if key not in recents or doc["time"] > recents[key]["time"]: recents[key] = doc return recents.values() def expand_db_paths(db_paths): prev_db = None def close_prev(): if prev_db is not None: prev_db.close() def open_db(path): nonlocal prev_db close_prev() db = TinyDB(path) prev_db = db return db.table("results") for db_path in db_paths: if os.path.isdir(db_path): for sub_path in glob(pjoin(db_path, "**", "*.db"), recursive=True): yield open_db(sub_path) else: yield open_db(db_path) close_prev() def all_docs_from_dbs(db_paths, pk_extra): return all_recent(expand_db_paths(db_paths), pk_extra)
[ "os.path.isdir", "tinydb.TinyDB", "os.path.join" ]
[((1163, 1175), 'tinydb.TinyDB', 'TinyDB', (['path'], {}), '(path)\n', (1169, 1175), False, 'from tinydb import TinyDB\n'), ((1273, 1295), 'os.path.isdir', 'os.path.isdir', (['db_path'], {}), '(db_path)\n', (1286, 1295), False, 'import os\n'), ((1330, 1358), 'os.path.join', 'pjoin', (['db_path', '"""**"""', '"""*.db"""'], {}), "(db_path, '**', '*.db')\n", (1335, 1358), True, 'from os.path import join as pjoin\n')]
from setuptools import setup with open('README.md', 'r') as f: long_description = f.read() setup( name='s3-tar', packages=['s3_tar'], version='0.1.13', description='Tar (and compress) files in s3', long_description=long_description, long_description_content_type='text/markdown', author='<NAME>', author_email="<EMAIL>", url="https://github.com/xtream1101/s3-tar", license='MIT', classifiers=[ "Programming Language :: Python :: 3", "Operating System :: OS Independent", "Topic :: Software Development :: Libraries :: Python Modules", "Topic :: Utilities", ], entry_points={ 'console_scripts': [ 's3-tar=s3_tar.cli:cli', ], }, install_requires=[ 'boto3', ], )
[ "setuptools.setup" ]
[((98, 685), 'setuptools.setup', 'setup', ([], {'name': '"""s3-tar"""', 'packages': "['s3_tar']", 'version': '"""0.1.13"""', 'description': '"""Tar (and compress) files in s3"""', 'long_description': 'long_description', 'long_description_content_type': '"""text/markdown"""', 'author': '"""<NAME>"""', 'author_email': '"""<EMAIL>"""', 'url': '"""https://github.com/xtream1101/s3-tar"""', 'license': '"""MIT"""', 'classifiers': "['Programming Language :: Python :: 3',\n 'Operating System :: OS Independent',\n 'Topic :: Software Development :: Libraries :: Python Modules',\n 'Topic :: Utilities']", 'entry_points': "{'console_scripts': ['s3-tar=s3_tar.cli:cli']}", 'install_requires': "['boto3']"}), "(name='s3-tar', packages=['s3_tar'], version='0.1.13', description=\n 'Tar (and compress) files in s3', long_description=long_description,\n long_description_content_type='text/markdown', author='<NAME>',\n author_email='<EMAIL>', url='https://github.com/xtream1101/s3-tar',\n license='MIT', classifiers=['Programming Language :: Python :: 3',\n 'Operating System :: OS Independent',\n 'Topic :: Software Development :: Libraries :: Python Modules',\n 'Topic :: Utilities'], entry_points={'console_scripts': [\n 's3-tar=s3_tar.cli:cli']}, install_requires=['boto3'])\n", (103, 685), False, 'from setuptools import setup\n')]
# coding: utf-8 import re import six from huaweicloudsdkcore.sdk_response import SdkResponse from huaweicloudsdkcore.utils.http_utils import sanitize_for_serialization class ShowJobResponse(SdkResponse): """ Attributes: openapi_types (dict): The key is attribute name and the value is attribute type. attribute_map (dict): The key is attribute name and the value is json key in definition. """ sensitive_list = [] openapi_types = { 'begin_time': 'str', 'code': 'str', 'end_time': 'str', 'entities': 'JobEntities', 'error_code': 'str', 'fail_reason': 'str', 'job_id': 'str', 'job_type': 'str', 'message': 'str', 'status': 'str' } attribute_map = { 'begin_time': 'begin_time', 'code': 'code', 'end_time': 'end_time', 'entities': 'entities', 'error_code': 'error_code', 'fail_reason': 'fail_reason', 'job_id': 'job_id', 'job_type': 'job_type', 'message': 'message', 'status': 'status' } def __init__(self, begin_time=None, code=None, end_time=None, entities=None, error_code=None, fail_reason=None, job_id=None, job_type=None, message=None, status=None): """ShowJobResponse - a model defined in huaweicloud sdk""" super(ShowJobResponse, self).__init__() self._begin_time = None self._code = None self._end_time = None self._entities = None self._error_code = None self._fail_reason = None self._job_id = None self._job_type = None self._message = None self._status = None self.discriminator = None if begin_time is not None: self.begin_time = begin_time if code is not None: self.code = code if end_time is not None: self.end_time = end_time if entities is not None: self.entities = entities if error_code is not None: self.error_code = error_code if fail_reason is not None: self.fail_reason = fail_reason if job_id is not None: self.job_id = job_id if job_type is not None: self.job_type = job_type if message is not None: self.message = message if status is not None: self.status = status @property def begin_time(self): """Gets the begin_time of this ShowJobResponse. 开始时间。 :return: The begin_time of this ShowJobResponse. :rtype: str """ return self._begin_time @begin_time.setter def begin_time(self, begin_time): """Sets the begin_time of this ShowJobResponse. 开始时间。 :param begin_time: The begin_time of this ShowJobResponse. :type: str """ self._begin_time = begin_time @property def code(self): """Gets the code of this ShowJobResponse. 查询Job的API请求出现错误时,返回的错误码。 :return: The code of this ShowJobResponse. :rtype: str """ return self._code @code.setter def code(self, code): """Sets the code of this ShowJobResponse. 查询Job的API请求出现错误时,返回的错误码。 :param code: The code of this ShowJobResponse. :type: str """ self._code = code @property def end_time(self): """Gets the end_time of this ShowJobResponse. 结束时间。 :return: The end_time of this ShowJobResponse. :rtype: str """ return self._end_time @end_time.setter def end_time(self, end_time): """Sets the end_time of this ShowJobResponse. 结束时间。 :param end_time: The end_time of this ShowJobResponse. :type: str """ self._end_time = end_time @property def entities(self): """Gets the entities of this ShowJobResponse. :return: The entities of this ShowJobResponse. :rtype: JobEntities """ return self._entities @entities.setter def entities(self, entities): """Sets the entities of this ShowJobResponse. :param entities: The entities of this ShowJobResponse. :type: JobEntities """ self._entities = entities @property def error_code(self): """Gets the error_code of this ShowJobResponse. Job执行失败时的错误码。 Job执行成功后,该值为null。 :return: The error_code of this ShowJobResponse. :rtype: str """ return self._error_code @error_code.setter def error_code(self, error_code): """Sets the error_code of this ShowJobResponse. Job执行失败时的错误码。 Job执行成功后,该值为null。 :param error_code: The error_code of this ShowJobResponse. :type: str """ self._error_code = error_code @property def fail_reason(self): """Gets the fail_reason of this ShowJobResponse. Job执行失败时的错误原因。 Job执行成功后,该值为null。 :return: The fail_reason of this ShowJobResponse. :rtype: str """ return self._fail_reason @fail_reason.setter def fail_reason(self, fail_reason): """Sets the fail_reason of this ShowJobResponse. Job执行失败时的错误原因。 Job执行成功后,该值为null。 :param fail_reason: The fail_reason of this ShowJobResponse. :type: str """ self._fail_reason = fail_reason @property def job_id(self): """Gets the job_id of this ShowJobResponse. 异步请求的任务ID。 :return: The job_id of this ShowJobResponse. :rtype: str """ return self._job_id @job_id.setter def job_id(self, job_id): """Sets the job_id of this ShowJobResponse. 异步请求的任务ID。 :param job_id: The job_id of this ShowJobResponse. :type: str """ self._job_id = job_id @property def job_type(self): """Gets the job_type of this ShowJobResponse. 异步请求的任务类型。 :return: The job_type of this ShowJobResponse. :rtype: str """ return self._job_type @job_type.setter def job_type(self, job_type): """Sets the job_type of this ShowJobResponse. 异步请求的任务类型。 :param job_type: The job_type of this ShowJobResponse. :type: str """ self._job_type = job_type @property def message(self): """Gets the message of this ShowJobResponse. 查询Job的API请求出现错误时,返回的错误消息。 :return: The message of this ShowJobResponse. :rtype: str """ return self._message @message.setter def message(self, message): """Sets the message of this ShowJobResponse. 查询Job的API请求出现错误时,返回的错误消息。 :param message: The message of this ShowJobResponse. :type: str """ self._message = message @property def status(self): """Gets the status of this ShowJobResponse. Job的状态。 - SUCCESS:成功。 - RUNNING:运行中。 - FAIL:失败。 - INIT:正在初始化。 :return: The status of this ShowJobResponse. :rtype: str """ return self._status @status.setter def status(self, status): """Sets the status of this ShowJobResponse. Job的状态。 - SUCCESS:成功。 - RUNNING:运行中。 - FAIL:失败。 - INIT:正在初始化。 :param status: The status of this ShowJobResponse. :type: str """ self._status = status def to_dict(self): """Returns the model properties as a dict""" result = {} for attr, _ in six.iteritems(self.openapi_types): value = getattr(self, attr) if isinstance(value, list): result[attr] = list(map( lambda x: x.to_dict() if hasattr(x, "to_dict") else x, value )) elif hasattr(value, "to_dict"): result[attr] = value.to_dict() elif isinstance(value, dict): result[attr] = dict(map( lambda item: (item[0], item[1].to_dict()) if hasattr(item[1], "to_dict") else item, value.items() )) else: if attr in self.sensitive_list: result[attr] = "****" else: result[attr] = value return result def to_str(self): """Returns the string representation of the model""" import simplejson as json if six.PY2: import sys reload(sys) sys.setdefaultencoding("utf-8") return json.dumps(sanitize_for_serialization(self), ensure_ascii=False) def __repr__(self): """For `print`""" return self.to_str() def __eq__(self, other): """Returns true if both objects are equal""" if not isinstance(other, ShowJobResponse): return False return self.__dict__ == other.__dict__ def __ne__(self, other): """Returns true if both objects are not equal""" return not self == other
[ "huaweicloudsdkcore.utils.http_utils.sanitize_for_serialization", "six.iteritems", "sys.setdefaultencoding" ]
[((7692, 7725), 'six.iteritems', 'six.iteritems', (['self.openapi_types'], {}), '(self.openapi_types)\n', (7705, 7725), False, 'import six\n'), ((8710, 8741), 'sys.setdefaultencoding', 'sys.setdefaultencoding', (['"""utf-8"""'], {}), "('utf-8')\n", (8732, 8741), False, 'import sys\n'), ((8768, 8800), 'huaweicloudsdkcore.utils.http_utils.sanitize_for_serialization', 'sanitize_for_serialization', (['self'], {}), '(self)\n', (8794, 8800), False, 'from huaweicloudsdkcore.utils.http_utils import sanitize_for_serialization\n')]
import numcodecs import pytest import zarr from zarr.util import InfoReporter @pytest.mark.parametrize('array_size', [10, 15000]) def test_info(array_size): # setup g = zarr.group(store=dict(), chunk_store=dict(), synchronizer=zarr.ThreadSynchronizer()) g.create_group('foo') z = g.zeros('bar', shape=array_size, filters=[numcodecs.Adler32()]) # test group info items = g.info_items() keys = sorted([k for k, _ in items]) expected_keys = sorted([ 'Type', 'Read-only', 'Synchronizer type', 'Store type', 'Chunk store type', 'No. members', 'No. arrays', 'No. groups', 'Arrays', 'Groups', 'Name' ]) assert expected_keys == keys # can also get a string representation of info via the info attribute assert isinstance(g.info, InfoReporter) assert "Type" in repr(g.info) # test array info items = z.info_items() keys = sorted([k for k, _ in items]) expected_keys = sorted([ 'Type', 'Data type', 'Shape', 'Chunk shape', 'Order', 'Read-only', 'Filter [0]', 'Compressor', 'Synchronizer type', 'Store type', 'Chunk store type', 'No. bytes', 'No. bytes stored', 'Storage ratio', 'Chunks initialized', 'Name' ]) assert expected_keys == keys # can also get a string representation of info via the info attribute assert isinstance(z.info, InfoReporter) assert "Type" in repr(z.info)
[ "numcodecs.Adler32", "pytest.mark.parametrize", "zarr.ThreadSynchronizer" ]
[((82, 132), 'pytest.mark.parametrize', 'pytest.mark.parametrize', (['"""array_size"""', '[10, 15000]'], {}), "('array_size', [10, 15000])\n", (105, 132), False, 'import pytest\n'), ((258, 283), 'zarr.ThreadSynchronizer', 'zarr.ThreadSynchronizer', ([], {}), '()\n', (281, 283), False, 'import zarr\n'), ((361, 380), 'numcodecs.Adler32', 'numcodecs.Adler32', ([], {}), '()\n', (378, 380), False, 'import numcodecs\n')]
#!/usr/bin/env python """ Script that goes through all the users in a DB and renames their names with random ones. """ import sqlalchemy import zeeguu from faker import Faker fake = Faker() from zeeguu.model import User session = zeeguu.db.session for user in User.query.all(): for _ in range(0,13): try: user.name = fake.name() user.email = fake.email() user.password = "" session.add(user) session.commit() print (f"added {user.name}") break except sqlalchemy.exc.IntegrityError as e: print (f"retrying...") continue
[ "zeeguu.model.User.query.all", "faker.Faker" ]
[((192, 199), 'faker.Faker', 'Faker', ([], {}), '()\n', (197, 199), False, 'from faker import Faker\n'), ((272, 288), 'zeeguu.model.User.query.all', 'User.query.all', ([], {}), '()\n', (286, 288), False, 'from zeeguu.model import User\n')]
#!/usr/bin/env python """The setup script.""" from setuptools import setup, find_packages with open("README.rst") as readme_file: readme = readme_file.read() with open("CHANGELOG.rst") as history_file: history = history_file.read() # requirements = ['Click>=7.0', ] requirements = list(map(str.strip, open("requirements.txt").readlines())) setup_requirements = [] test_requirements = [] setup( author="<NAME>", author_email="<EMAIL>", python_requires=">=3.6", classifiers=[ "Development Status :: 2 - Pre-Alpha", "Intended Audience :: Developers", "License :: OSI Approved :: Apache Software License", "Natural Language :: English", "Programming Language :: Python :: 3", "Programming Language :: Python :: 3.6", "Programming Language :: Python :: 3.7", "Programming Language :: Python :: 3.8", ], description="Virtual Finance API provides access to data from financial " "sites as if it was a REST-API.", entry_points={"console_scripts": ["vfapi=virtual_finance_api.cli:main"]}, install_requires=requirements, license="Apache Software License 2.0", long_description=readme + "\n\n" + history, long_description_content_type="text/markdown", include_package_data=True, keywords="virtual_finance_api", name="virtual_finance_api", packages=find_packages(include=["virtual_finance_api", "virtual_finance_api.*"]), setup_requires=requirements, test_suite="tests", tests_require=test_requirements, url="https://github.com/hootnot/virtual-finance-API", version="0.6.0", zip_safe=False, )
[ "setuptools.find_packages" ]
[((1381, 1452), 'setuptools.find_packages', 'find_packages', ([], {'include': "['virtual_finance_api', 'virtual_finance_api.*']"}), "(include=['virtual_finance_api', 'virtual_finance_api.*'])\n", (1394, 1452), False, 'from setuptools import setup, find_packages\n')]
# mbedRPC.py - mbed RPC interface for Python # # Copyright (c) 2010 ARM Ltd # # Permission is hereby granted, free of charge, to any person obtaining a copy # of this software and associated documentation files (the "Software"), to deal # in the Software without restriction, including without limitation the rights # to use, copy, modify, merge, publish, distribute, sublicense, and/or sell # copies of the Software, and to permit persons to whom the Software is # furnished to do so, subject to the following conditions: # # The above copyright notice and this permission notice shall be included in # all copies or substantial portions of the Software. # # THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR # IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, # FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE # AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER # LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, # OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN # THE SOFTWARE. # # Example: #>from mbedRPC import* #>mbed = SerialRPC("COM5",9600); #>myled = DigitalOut(LED1); #>myled.write(1) #> import serial import urllib2 import time class pin(): def __init__(self, id): self.name = id LED1 = pin("LED1") LED2 = pin("LED2") LED3 = pin("LED3") LED4 = pin("LED4") p5 = pin("p5") p6 = pin("p6") p7 = pin("p7") p8 = pin("p8") p9 = pin("p9") p10 = pin("p10") p11 = pin("p11") p12 = pin("p12") p13 = pin("p13") p14 = pin("p14") p15 = pin("p15") p16 = pin("p16") p17 = pin("p17") p18 = pin("p18") p19 = pin("p19") p20 = pin("p20") p21 = pin("p21") p22 = pin("p22") p23 = pin("p23") p24 = pin("p24") p25 = pin("p25") p26 = pin("p26") p27 = pin("p27") p28 = pin("p28") p29 = pin("p29") p30 = pin("p30") # mbed super class class mbed: def __init__(self): print("This will work as a demo but no transport mechanism has been selected") def rpc(self, name, method, args): print("Superclass method not overridden") # Transport mechanisms, derived from mbed class SerialRPC(mbed): def __init__(self, port, baud): self.ser = serial.Serial(port) self.ser.setBaudrate(baud) def rpc(self, name, method, args): self.ser.write("/" + name + "/" + method + " " + " ".join(args) + "\n") return self.ser.readline().strip() class HTTPRPC(mbed): def __init__(self, ip): self.host = "http://" + ip def rpc(self, name, method, args): response = urllib2.urlopen(self.host + "/rpc/" + name + "/" + method + "," + ",".join(args)) return response.read().strip() # mbed Interfaces class DigitalOut(): def __init__(self, this_mbed, mpin): self.mbed = this_mbed if isinstance(mpin, str): self.name = mpin elif isinstance(mpin, pin): self.name = self.mbed.rpc("DigitalOut", "new", [mpin.name]) def __del__(self): r = self.mbed.rpc(self.name, "delete", []) def write(self, value): r = self.mbed.rpc(self.name, "write", [str(value)]) def read(self): r = self.mbed.rpc(self.name, "read", []) return int(r) class AnalogIn(): def __init__(self, this_mbed, mpin): self.mbed = this_mbed if isinstance(mpin, str): self.name = mpin elif isinstance(mpin, pin): self.name = self.mbed.rpc("AnalogIn", "new", [mpin.name]) def __del__(self): r = self.mbed.rpc(self.name, "delete", []) def read(self): r = self.mbed.rpc(self.name, "read", []) return float(r) def read_u16(self): r = self.mbed.rpc(self.name, "read_u16", []) return int(r) class AnalogOut(): def __init__(self, this_mbed, mpin): self.mbed = this_mbed if isinstance(mpin, str): self.name = mpin elif isinstance(mpin, pin): self.name = self.mbed.rpc("AnalogOut", "new", [mpin.name]) def __del__(self): r = self.mbed.rpc(self.name, "delete", []) def write(self, value): r = self.mbed.rpc(self.name, "write", [str(value)]) def write_u16(self, value): r = self.mbed.rpc(self.name, "write_u16", [str(value)]) def read(self): r = self.mbed.rpc(self.name, "read", []) return float(r) class DigitalIn(): def __init__(self, this_mbed, mpin): self.mbed = this_mbed if isinstance(mpin, str): self.name = mpin elif isinstance(mpin, pin): self.name = self.mbed.rpc("DigitalIn", "new", [mpin.name]) def __del__(self): r = self.mbed.rpc(self.name, "delete", []) def read(self): r = self.mbed.rpc(self.name, "read", []) return int(r) class PwmOut(): def __init__(self, this_mbed, mpin): self.mbed = this_mbed if isinstance(mpin, str): self.name = mpin elif isinstance(mpin, pin): self.name = self.mbed.rpc("PwmOut", "new", [mpin.name]) def __del__(self): r = self.mbed.rpc(self.name, "delete", []) def write(self, value): r = self.mbed.rpc(self.name, "write", [str(value)]) def read(self): r = self.mbed.rpc(self.name, "read", []) return float(r) def period(self, value): r = self.mbed.rpc(self.name, "period", [str(value)]) def period_ms(self, value): r = self.mbed.rpc(self.name, "period_ms", [str(value)]) def period_us(self, value): r = self.mbed.rpc(self.name, "period_us", [str(value)]) def puslewidth(self, value): r = self.mbed.rpc(self.name, "pulsewidth", [str(value)]) def puslewidth_ms(self, value): r = self.mbed.rpc(self.name, "pulsewidth_ms", [str(value)]) def puslewidth_us(self, value): r = self.mbed.rpc(self.name, "pulsewidth_us", [str(value)]) class Serial(): def __init__(self, this_mbed, tx, rx=""): self.mbed = this_mbed if isinstance(tx, str): self.name = mpin elif isinstance(mpin, pin): self.name = self.mbed.rpc("Serial", "new", [tx.name, rx.name]) def __del__(self): r = self.mbed.rpc(self.name, "delete", []) def putc(self, value): r = self.mbed.rpc(self.name, "putc", [str(value)]) def puts(self, value): r = self.mbed.rpc(self.name, "puts", ["\"" + str(value) + "\""]) def getc(self): r = self.mbed.rpc(self.name, "getc", []) return int(r) class RPCFunction(): def __init__(self, this_mbed, name): self.mbed = this_mbed if isinstance(name, str): self.name = name def __del__(self): r = self.mbed.rpc(self.name, "delete", []) def read(self): r = self.mbed.rpc(self.name, "read", []) return int(r) def run(self, input): r = self.mbed.rpc(self.name, "run", [input]) return r class RPCVariable(): def __init__(self, this_mbed, name): self.mbed = this_mbed if isinstance(name, str): self.name = name def __del__(self): r = self.mbed.rpc(self.name, "delete", []) def write(self, value): self.mbed.rpc(self.name, "write", [str(value)]) def read(self): r = self.mbed.rpc(self.name, "read", []) return r def wait(s): time.sleep(s)
[ "serial.Serial", "time.sleep" ]
[((7735, 7748), 'time.sleep', 'time.sleep', (['s'], {}), '(s)\n', (7745, 7748), False, 'import time\n'), ((2335, 2354), 'serial.Serial', 'serial.Serial', (['port'], {}), '(port)\n', (2348, 2354), False, 'import serial\n')]
"""PhoSim Instance Catalog""" from __future__ import absolute_import, division, print_function import numpy as np from lsst.sims.catUtils.exampleCatalogDefinitions import (PhoSimCatalogZPoint, PhoSimCatalogPoint, PhoSimCatalogSersic2D, PhoSimCatalogSN) from .twinklesVariabilityMixins import VariabilityTwinkles from lsst.sims.catUtils.mixins import VariabilityAGN, PhotometryGalaxies from lsst.sims.catUtils.exampleCatalogDefinitions.phoSimCatalogExamples import PhoSimSpecMap as psmp from lsst.sims.catalogs.definitions import CompoundInstanceCatalog from lsst.sims.catalogs.db import CompoundCatalogDBObject #__all__ = ['TwinklesCatalogZPoint', 'TwinklesPhoSimCatalogSN'] __all__ = ["TwinklesCatalogPoint", "TwinklesCatalogSersic2D", "TwinklesCatalogZPoint", "TwinklesCatalogSN", "TwinklesCompoundInstanceCatalog"] twinkles_sn_sed_dir = 'spectra_files' twinkles_spec_map = psmp twinkles_spec_map.subdir_map['(^specFile_)'] = twinkles_sn_sed_dir class TwinklesCatalogPoint(PhoSimCatalogPoint): specFileMap = twinkles_spec_map class TwinklesCatalogSersic2D(PhoSimCatalogSersic2D): specFileMap = twinkles_spec_map class TwinklesCatalogZPoint(PhoSimCatalogZPoint, VariabilityTwinkles, VariabilityAGN): """ PhoSim Instance Catalog Class for strongly lensed (and therefore time-delayed) AGN """ specFileMap = twinkles_spec_map catalog_type = 'twinkles_catalog_ZPOINT' class TwinklesCatalogSN(PhoSimCatalogSN): """ Modification of the PhoSimCatalogSN mixin to provide shorter sedFileNames by leaving out the parts of the directory name """ def get_shorterFileNames(self): fnames = self.column_by_name('sedFilepath') sep = 'spectra_files/specFile_' split_names = [] for fname in fnames: if 'None' not in fname: fname = sep + fname.split(sep)[-1] else: fname = 'None' split_names.append(fname) return np.array(split_names) # column_outputs = PhoSimCatalogSN.column_outputs # column_outputs[PhoSimCatalogSN.column_outputs.index('sedFilepath')] = \ # 'shorterFileNames' column_outputs = ['prefix', 'uniqueId', 'raPhoSim', 'decPhoSim', 'phoSimMagNorm', 'shorterFileNames', 'redshift', 'gamma1', 'gamma2', 'kappa', 'raOffset', 'decOffset', 'spatialmodel', 'internalExtinctionModel', 'galacticExtinctionModel', 'galacticAv', 'galacticRv'] cannot_be_null = ['x0', 't0', 'z', 'shorterFileNames'] class TwinklesCompoundInstanceCatalog(CompoundInstanceCatalog): use_spec_map = twinkles_spec_map def write_catalog(self, filename, chunk_size=None, write_header=True, write_mode='w'): """ Write the stored list of InstanceCatalogs to a single ASCII output catalog. @param [in] filename is the name of the file to be written @param [in] chunk_size is an optional parameter telling the CompoundInstanceCatalog to query the database in manageable chunks (in case returning the whole catalog takes too much memory) @param [in] write_header a boolean specifying whether or not to add a header to the output catalog (Note: only one header will be written; there will not be a header for each InstanceCatalog in the CompoundInstanceCatalog; default True) @param [in] write_mode is 'w' if you want to overwrite the output file or 'a' if you want to append to an existing output file (default: 'w') """ instantiated_ic_list = [None]*len(self._ic_list) # first, loop over all of the InstanceCatalog and CatalogDBObject classes, pre-processing # them (i.e. verifying that they have access to all of the columns they need) for ix, (icClass, dboClass) in enumerate(zip(self._ic_list, self._dbo_list)): dbo = dboClass() ic = icClass(dbo, obs_metadata=self._obs_metadata) # assign all non-private member variables of the CompoundInstanceCatalog # to the instantiated InstanceCatalogs for kk in self.__dict__: if kk[0] != '_' and not hasattr(self.__dict__[kk], '__call__'): setattr(ic, kk, self.__dict__[kk]) for kk in self.__class__.__dict__: if kk[0] != '_' and not hasattr(self.__class__.__dict__[kk], '__call__'): setattr(ic, kk, self.__class__.__dict__[kk]) ic._write_pre_process() instantiated_ic_list[ix] = ic for row in self._dbObjectGroupList: if len(row) == 1: ic = instantiated_ic_list[row[0]] ic._query_and_write(filename, chunk_size=chunk_size, write_header=write_header, write_mode=write_mode, obs_metadata=self._obs_metadata, constraint=self._constraint) write_mode = 'a' write_header = False default_compound_dbo = None if self._compoundDBclass is not None: if not hasattr(self._compoundDBclass, '__getitem__'): default_compound_dbo = CompoundCatalogDBObject else: for dbo in self._compoundDBclass: if dbo._table_restriction is None: default_compound_dbo = dbo break if default_compound_dbo is None: default_compound_dbo is CompoundCatalogDBObject for row in self._dbObjectGroupList: if len(row) > 1: dbObjClassList = [self._dbo_list[ix] for ix in row] catList = [instantiated_ic_list[ix] for ix in row] for cat in catList: cat._pre_screen = True if self._compoundDBclass is None: compound_dbo = CompoundCatalogDBObject(dbObjClassList) elif not hasattr(self._compoundDBclass, '__getitem__'): # if self._compoundDBclass is not a list try: compound_dbo = self._compoundDBclass(dbObjClassList) except: compound_dbo = default_compound_dbo(dbObjClassList) else: compound_dbo = None for candidate in self._compoundDBclass: use_it = True if False in [candidate._table_restriction is not None and dbo.tableid in candidate._table_restriction for dbo in dbObjClassList]: use_it = False if use_it: compound_dbo = candidate(dbObjClassList) break if compound_dbo is None: compound_dbo = default_compound_dbo(dbObjClassList) compound_dbo.mjd = self._obs_metadata.mjd.TAI compound_dbo.specFileMap = self.use_spec_map self._write_compound(catList, compound_dbo, filename, chunk_size=chunk_size, write_header=write_header, write_mode=write_mode) write_mode = 'a' write_header = False
[ "lsst.sims.catalogs.db.CompoundCatalogDBObject", "numpy.array" ]
[((2155, 2176), 'numpy.array', 'np.array', (['split_names'], {}), '(split_names)\n', (2163, 2176), True, 'import numpy as np\n'), ((6160, 6199), 'lsst.sims.catalogs.db.CompoundCatalogDBObject', 'CompoundCatalogDBObject', (['dbObjClassList'], {}), '(dbObjClassList)\n', (6183, 6199), False, 'from lsst.sims.catalogs.db import CompoundCatalogDBObject\n')]
""" :maintainer: <NAME> <<EMAIL>> :maturity: new :depends: None :platform: Linux .. versionadded:: 3004 """ import logging import re import salt.exceptions log = logging.getLogger(__name__) def __virtual__(): """rebootmgrctl command is required.""" if __utils__["path.which"]("rebootmgrctl") is not None: return True else: return (False, "Module rebootmgt requires the command rebootmgrctl") def _cmd(cmd, retcode=False): """Utility function to run commands.""" result = __salt__["cmd.run_all"](cmd) if retcode: return result["retcode"] if result["retcode"]: raise salt.exceptions.CommandExecutionError(result["stderr"]) return result["stdout"] def version(): """Return the version of rebootmgrd CLI Example: .. code-block:: bash salt microos rebootmgr version """ cmd = ["rebootmgrctl", "--version"] return _cmd(cmd).split()[-1] def is_active(): """Check if the rebootmgrd is running and active or not. CLI Example: .. code-block:: bash salt microos rebootmgr is_active """ cmd = ["rebootmgrctl", "is_active", "--quiet"] return _cmd(cmd, retcode=True) == 0 def reboot(order=None): """Tells rebootmgr to schedule a reboot. With the [now] option, a forced reboot is done, no lock from etcd is requested and a set maintenance window is ignored. With the [fast] option, a lock from etcd is requested if needed, but a defined maintenance window is ignored. order If specified, can be "now" or "fast" CLI Example: .. code-block:: bash salt microos rebootmgr reboot salt microos rebootmgt reboot order=now """ if order and order not in ("now", "fast"): raise salt.exceptions.CommandExecutionError( "Order parameter, if specified, must be 'now' or 'fast'" ) cmd = ["rebootmgrctl", "reboot"] if order: cmd.append(order) return _cmd(cmd) def cancel(): """Cancels an already running reboot. CLI Example: .. code-block:: bash salt microos rebootmgr cancel """ cmd = ["rebootmgrctl", "cancel"] return _cmd(cmd) def status(): """Returns the current status of rebootmgrd. Valid returned values are: 0 - No reboot requested 1 - Reboot requested 2 - Reboot requested, waiting for maintenance window 3 - Reboot requested, waiting for etcd lock. CLI Example: .. code-block:: bash salt microos rebootmgr status """ cmd = ["rebootmgrctl", "status", "--quiet"] return _cmd(cmd, retcode=True) def set_strategy(strategy=None): """A new strategy to reboot the machine is set and written into /etc/rebootmgr.conf. strategy If specified, must be one of those options: best-effort - This is the default strategy. If etcd is running, etcd-lock is used. If no etcd is running, but a maintenance window is specified, the strategy will be maint-window. If no maintenance window is specified, the machine is immediately rebooted (instantly). etcd-lock - A lock at etcd for the specified lock-group will be acquired before reboot. If a maintenance window is specified, the lock is only acquired during this window. maint-window - Reboot does happen only during a specified maintenance window. If no window is specified, the instantly strategy is followed. instantly - Other services will be informed that a reboot will happen. Reboot will be done without getting any locks or waiting for a maintenance window. off - Reboot requests are temporary ignored. /etc/rebootmgr.conf is not modified. CLI Example: .. code-block:: bash salt microos rebootmgr set_strategy stragegy=off """ if strategy and strategy not in ( "best-effort", "etcd-lock", "maint-window", "instantly", "off", ): raise salt.exceptions.CommandExecutionError("Strategy parameter not valid") cmd = ["rebootmgrctl", "set-strategy"] if strategy: cmd.append(strategy) return _cmd(cmd) def get_strategy(): """The currently used reboot strategy of rebootmgrd will be printed. CLI Example: .. code-block:: bash salt microos rebootmgr get_strategy """ cmd = ["rebootmgrctl", "get-strategy"] return _cmd(cmd).split(":")[-1].strip() def set_window(time, duration): """Set's the maintenance window. time The format of time is the same as described in systemd.time(7). duration The format of duration is "[XXh][YYm]". CLI Example: .. code-block:: bash salt microos rebootmgr set_window time="Thu,Fri 2020-*-1,5 11:12:13" duration=1h """ cmd = ["rebootmgrctl", "set-window", time, duration] return _cmd(cmd) def get_window(): """The currently set maintenance window will be printed. CLI Example: .. code-block:: bash salt microos rebootmgr get_window """ cmd = ["rebootmgrctl", "get-window"] window = _cmd(cmd) return dict( zip( ("time", "duration"), re.search( r"Maintenance window is set to (.*), lasting (.*).", window ).groups(), ) ) def set_group(group): """Set the group, to which this machine belongs to get a reboot lock from etcd. group Group name CLI Example: .. code-block:: bash salt microos rebootmgr set_group group=group_1 """ cmd = ["rebootmgrctl", "set-group", group] return _cmd(cmd) def get_group(): """The currently set lock group for etcd. CLI Example: .. code-block:: bash salt microos rebootmgr get_group """ cmd = ["rebootmgrctl", "get-group"] group = _cmd(cmd) return re.search(r"Etcd lock group is set to (.*)", group).groups()[0] def set_max(max_locks, group=None): """Set the maximal number of hosts in a group, which are allowed to reboot at the same time. number Maximal number of hosts in a group group Group name CLI Example: .. code-block:: bash salt microos rebootmgr set_max 4 """ cmd = ["rebootmgrctl", "set-max"] if group: cmd.extend(["--group", group]) cmd.append(max_locks) return _cmd(cmd) def lock(machine_id=None, group=None): """Lock a machine. If no group is specified, the local default group will be used. If no machine-id is specified, the local machine will be locked. machine_id The machine-id is a network wide, unique ID. Per default the ID from /etc/machine-id is used. group Group name CLI Example: .. code-block:: bash salt microos rebootmgr lock group=group1 """ cmd = ["rebootmgrctl", "lock"] if group: cmd.extend(["--group", group]) if machine_id: cmd.append(machine_id) return _cmd(cmd) def unlock(machine_id=None, group=None): """Unlock a machine. If no group is specified, the local default group will be used. If no machine-id is specified, the local machine will be locked. machine_id The machine-id is a network wide, unique ID. Per default the ID from /etc/machine-id is used. group Group name CLI Example: .. code-block:: bash salt microos rebootmgr unlock group=group1 """ cmd = ["rebootmgrctl", "unlock"] if group: cmd.extend(["--group", group]) if machine_id: cmd.append(machine_id) return _cmd(cmd)
[ "re.search", "logging.getLogger" ]
[((185, 212), 'logging.getLogger', 'logging.getLogger', (['__name__'], {}), '(__name__)\n', (202, 212), False, 'import logging\n'), ((6044, 6094), 're.search', 're.search', (['"""Etcd lock group is set to (.*)"""', 'group'], {}), "('Etcd lock group is set to (.*)', group)\n", (6053, 6094), False, 'import re\n'), ((5360, 5429), 're.search', 're.search', (['"""Maintenance window is set to (.*), lasting (.*)."""', 'window'], {}), "('Maintenance window is set to (.*), lasting (.*).', window)\n", (5369, 5429), False, 'import re\n')]
# coding=utf-8 """ The NfsCollector collects nfs utilization metrics using /proc/net/rpc/nfs. #### Dependencies * /proc/net/rpc/nfs """ import diamond.collector import os class NfsCollector(diamond.collector.Collector): PROC = '/proc/net/rpc/nfs' def get_default_config_help(self): config_help = super(NfsCollector, self).get_default_config_help() config_help.update({ }) return config_help def get_default_config(self): """ Returns the default collector settings """ config = super(NfsCollector, self).get_default_config() config.update({ 'enabled': False, 'path': 'nfs' }) return config def collect(self): """ Collect stats """ if os.access(self.PROC, os.R_OK): results = {} # Open file file = open(self.PROC) for line in file: line = line.split() if line[0] == 'net': results['net.packets'] = line[1] results['net.udpcnt'] = line[2] results['net.tcpcnt'] = line[3] results['net.tcpconn'] = line[4] elif line[0] == 'rpc': results['rpc.calls'] = line[1] results['rpc.retrans'] = line[2] results['rpc.authrefrsh'] = line[3] elif line[0] == 'proc2': line.pop(1) # remove column-cnt field results['v2.null'] = line[1] results['v2.getattr'] = line[2] results['v2.setattr'] = line[3] results['v2.root'] = line[4] results['v2.lookup'] = line[5] results['v2.readlink'] = line[6] results['v2.read'] = line[7] results['v2.wrcache'] = line[8] results['v2.write'] = line[9] results['v2.create'] = line[10] results['v2.remove'] = line[11] results['v2.rename'] = line[12] results['v2.link'] = line[13] results['v2.symlink'] = line[14] results['v2.mkdir'] = line[15] results['v2.rmdir'] = line[16] results['v2.readdir'] = line[17] results['v2.fsstat'] = line[18] elif line[0] == 'proc3': line.pop(1) # remove column-cnt field results['v3.null'] = line[1] results['v3.getattr'] = line[2] results['v3.setattr'] = line[3] results['v3.lookup'] = line[4] results['v3.access'] = line[5] results['v3.readlink'] = line[6] results['v3.read'] = line[7] results['v3.write'] = line[8] results['v3.create'] = line[9] results['v3.mkdir'] = line[10] results['v3.symlink'] = line[11] results['v3.mknod'] = line[12] results['v3.remove'] = line[13] results['v3.rmdir'] = line[14] results['v3.rename'] = line[15] results['v3.link'] = line[16] results['v3.readdir'] = line[17] results['v3.readdirplus'] = line[18] results['v3.fsstat'] = line[19] results['v3.fsinfo'] = line[20] results['v3.pathconf'] = line[21] results['v3.commit'] = line[22] elif line[0] == 'proc4': line.pop(1) # remove column-cnt field results['v4.null'] = line[1] results['v4.read'] = line[2] results['v4.write'] = line[3] results['v4.commit'] = line[4] results['v4.open'] = line[5] results['v4.open_conf'] = line[6] results['v4.open_noat'] = line[7] results['v4.open_dgrd'] = line[8] results['v4.close'] = line[9] results['v4.setattr'] = line[10] results['v4.fsinfo'] = line[11] results['v4.renew'] = line[12] results['v4.setclntid'] = line[13] results['v4.confirm'] = line[14] results['v4.lock'] = line[15] results['v4.lockt'] = line[16] results['v4.locku'] = line[17] results['v4.access'] = line[18] results['v4.getattr'] = line[19] results['v4.lookup'] = line[20] results['v4.lookup_root'] = line[21] results['v4.remove'] = line[22] results['v4.rename'] = line[23] results['v4.link'] = line[24] results['v4.symlink'] = line[25] results['v4.create'] = line[26] results['v4.pathconf'] = line[27] results['v4.statfs'] = line[28] results['v4.readlink'] = line[29] results['v4.readdir'] = line[30] try: results['v4.server_caps'] = line[31] except IndexError: pass try: results['v4.delegreturn'] = line[32] except IndexError: pass try: results['v4.getacl'] = line[33] except IndexError: pass try: results['v4.setacl'] = line[34] except IndexError: pass try: results['v4.fs_locations'] = line[35] except IndexError: pass try: results['v4.rel_lkowner'] = line[36] except IndexError: pass try: results['v4.exchange_id'] = line[37] except IndexError: pass try: results['v4.create_ses'] = line[38] except IndexError: pass try: results['v4.destroy_ses'] = line[39] except IndexError: pass try: results['v4.sequence'] = line[40] except IndexError: pass try: results['v4.get_lease_t'] = line[41] except IndexError: pass try: results['v4.reclaim_comp'] = line[42] except IndexError: pass try: results['v4.layoutget'] = line[43] except IndexError: pass try: results['v4.layoutcommit'] = line[44] except IndexError: pass try: results['v4.layoutreturn'] = line[45] except IndexError: pass try: results['v4.getdevlist'] = line[46] except IndexError: pass try: results['v4.getdevinfo'] = line[47] except IndexError: pass try: results['v4.ds_write'] = line[48] except IndexError: pass try: results['v4.ds_commit'] = line[49] except IndexError: pass try: results['v4.getdevlist'] = line[50] except IndexError: pass # Close File file.close() for stat in results.keys(): metric_name = stat metric_value = long(float(results[stat])) metric_value = self.derivative(metric_name, metric_value) self.publish(metric_name, metric_value) return True return False
[ "os.access" ]
[((810, 839), 'os.access', 'os.access', (['self.PROC', 'os.R_OK'], {}), '(self.PROC, os.R_OK)\n', (819, 839), False, 'import os\n')]
import datetime from pytest_cases import THIS_MODULE, parametrize_with_cases from statue.cli import statue_cli from tests.util import evaluation_mock def case_empty_history(): additional_flags = [] evaluations = [] output = "No previous evaluations.\n" return additional_flags, evaluations, output def case_one_successful_evaluation(): total_commands = 4 timestamp1 = datetime.datetime( year=2020, month=4, day=15, hour=12, minute=7, second=42 ) additional_flags = [] evaluations = [ evaluation_mock( timestamp=timestamp1, successful_commands=total_commands, total_commands=total_commands, total_execution_duration=0.234, ) ] output = "1) 04/15/2020, 12:07:42 - Success (4/4 successful, 0.23 seconds)\n" return additional_flags, evaluations, output def case_one_failed_evaluation(): additional_flags = [] timestamp1 = datetime.datetime( year=2020, month=5, day=12, hour=14, minute=8, second=23 ) evaluations = [ evaluation_mock( timestamp=timestamp1, successful_commands=3, total_commands=4, total_execution_duration=0.591, ) ] output = "1) 05/12/2020, 14:08:23 - Failure (3/4 successful, 0.59 seconds)\n" return additional_flags, evaluations, output def case_two_successful_evaluations(): total_commands1, total_commands2 = 4, 7 additional_flags = [] timestamp1, timestamp2 = ( datetime.datetime(year=2020, month=4, day=15, hour=12, minute=7, second=42), datetime.datetime(year=2020, month=4, day=14, hour=18, minute=59, second=11), ) evaluations = [ evaluation_mock( timestamp=timestamp1, successful_commands=total_commands1, total_commands=total_commands1, total_execution_duration=0.234, ), evaluation_mock( timestamp=timestamp2, successful_commands=total_commands2, total_commands=total_commands2, total_execution_duration=0.189, ), ] output = ( "1) 04/15/2020, 12:07:42 - Success (4/4 successful, 0.23 seconds)\n" "2) 04/14/2020, 18:59:11 - Success (7/7 successful, 0.19 seconds)\n" ) return additional_flags, evaluations, output def case_one_failed_and_one_successful(): total_commands = 4 additional_flags = [] timestamp1, timestamp2 = ( datetime.datetime(year=2020, month=4, day=15, hour=12, minute=7, second=42), datetime.datetime(year=2020, month=4, day=14, hour=18, minute=59, second=11), ) evaluations = [ evaluation_mock( timestamp=timestamp1, successful_commands=total_commands, total_commands=total_commands, total_execution_duration=0.234, ), evaluation_mock( timestamp=timestamp2, successful_commands=3, total_commands=7, total_execution_duration=0.189, ), ] output = ( "1) 04/15/2020, 12:07:42 - Success (4/4 successful, 0.23 seconds)\n" "2) 04/14/2020, 18:59:11 - Failure (3/7 successful, 0.19 seconds)\n" ) return additional_flags, evaluations, output def case_three_evaluations(): total_commands1, total_commands2 = 4, 10 additional_flags = [] timestamp1, timestamp2, timestamp3 = ( datetime.datetime(year=2020, month=4, day=15, hour=12, minute=7, second=42), datetime.datetime(year=2020, month=4, day=14, hour=18, minute=59, second=11), datetime.datetime(year=2020, month=4, day=14, hour=11, minute=31, second=22), ) evaluations = [ evaluation_mock( timestamp=timestamp1, successful_commands=total_commands1, total_commands=total_commands1, total_execution_duration=0.234, ), evaluation_mock( timestamp=timestamp2, successful_commands=3, total_commands=7, total_execution_duration=0.189, ), evaluation_mock( timestamp=timestamp3, successful_commands=total_commands2, total_commands=total_commands2, total_execution_duration=0.03, ), ] output = ( "1) 04/15/2020, 12:07:42 - Success (4/4 successful, 0.23 seconds)\n" "2) 04/14/2020, 18:59:11 - Failure (3/7 successful, 0.19 seconds)\n" "3) 04/14/2020, 11:31:22 - Success (10/10 successful, 0.03 seconds)\n" ) return additional_flags, evaluations, output def case_head_flag(): total_commands1, total_commands2 = 4, 10 additional_flags = ["--head=2"] timestamp1, timestamp2, timestamp3 = ( datetime.datetime(year=2020, month=4, day=15, hour=12, minute=7, second=42), datetime.datetime(year=2020, month=4, day=14, hour=18, minute=59, second=11), datetime.datetime(year=2020, month=4, day=14, hour=11, minute=31, second=22), ) evaluations = [ evaluation_mock( timestamp=timestamp1, successful_commands=total_commands1, total_commands=total_commands1, total_execution_duration=0.234, ), evaluation_mock( timestamp=timestamp2, successful_commands=3, total_commands=7, total_execution_duration=0.189, ), evaluation_mock( timestamp=timestamp3, successful_commands=total_commands2, total_commands=total_commands2, total_execution_duration=0.03, ), ] output = ( "1) 04/15/2020, 12:07:42 - Success (4/4 successful, 0.23 seconds)\n" "2) 04/14/2020, 18:59:11 - Failure (3/7 successful, 0.19 seconds)\n" ) return additional_flags, evaluations, output @parametrize_with_cases( argnames=["additional_flags", "evaluations", "output"], cases=THIS_MODULE, ) def test_history_list( additional_flags, evaluations, output, cli_runner, mock_build_configuration_from_file, ): configuration = mock_build_configuration_from_file.return_value configuration.cache.all_evaluations = evaluations result = cli_runner.invoke(statue_cli, ["history", "list", *additional_flags]) assert ( result.exit_code == 0 ), f"Execution failed with the following error: '{result.exception}'" assert result.output == output
[ "pytest_cases.parametrize_with_cases", "tests.util.evaluation_mock", "datetime.datetime" ]
[((5888, 5989), 'pytest_cases.parametrize_with_cases', 'parametrize_with_cases', ([], {'argnames': "['additional_flags', 'evaluations', 'output']", 'cases': 'THIS_MODULE'}), "(argnames=['additional_flags', 'evaluations',\n 'output'], cases=THIS_MODULE)\n", (5910, 5989), False, 'from pytest_cases import THIS_MODULE, parametrize_with_cases\n'), ((398, 473), 'datetime.datetime', 'datetime.datetime', ([], {'year': '(2020)', 'month': '(4)', 'day': '(15)', 'hour': '(12)', 'minute': '(7)', 'second': '(42)'}), '(year=2020, month=4, day=15, hour=12, minute=7, second=42)\n', (415, 473), False, 'import datetime\n'), ((955, 1030), 'datetime.datetime', 'datetime.datetime', ([], {'year': '(2020)', 'month': '(5)', 'day': '(12)', 'hour': '(14)', 'minute': '(8)', 'second': '(23)'}), '(year=2020, month=5, day=12, hour=14, minute=8, second=23)\n', (972, 1030), False, 'import datetime\n'), ((543, 683), 'tests.util.evaluation_mock', 'evaluation_mock', ([], {'timestamp': 'timestamp1', 'successful_commands': 'total_commands', 'total_commands': 'total_commands', 'total_execution_duration': '(0.234)'}), '(timestamp=timestamp1, successful_commands=total_commands,\n total_commands=total_commands, total_execution_duration=0.234)\n', (558, 683), False, 'from tests.util import evaluation_mock\n'), ((1073, 1188), 'tests.util.evaluation_mock', 'evaluation_mock', ([], {'timestamp': 'timestamp1', 'successful_commands': '(3)', 'total_commands': '(4)', 'total_execution_duration': '(0.591)'}), '(timestamp=timestamp1, successful_commands=3, total_commands\n =4, total_execution_duration=0.591)\n', (1088, 1188), False, 'from tests.util import evaluation_mock\n'), ((1531, 1606), 'datetime.datetime', 'datetime.datetime', ([], {'year': '(2020)', 'month': '(4)', 'day': '(15)', 'hour': '(12)', 'minute': '(7)', 'second': '(42)'}), '(year=2020, month=4, day=15, hour=12, minute=7, second=42)\n', (1548, 1606), False, 'import datetime\n'), ((1616, 1692), 'datetime.datetime', 'datetime.datetime', ([], {'year': '(2020)', 'month': '(4)', 'day': '(14)', 'hour': '(18)', 'minute': '(59)', 'second': '(11)'}), '(year=2020, month=4, day=14, hour=18, minute=59, second=11)\n', (1633, 1692), False, 'import datetime\n'), ((1728, 1870), 'tests.util.evaluation_mock', 'evaluation_mock', ([], {'timestamp': 'timestamp1', 'successful_commands': 'total_commands1', 'total_commands': 'total_commands1', 'total_execution_duration': '(0.234)'}), '(timestamp=timestamp1, successful_commands=total_commands1,\n total_commands=total_commands1, total_execution_duration=0.234)\n', (1743, 1870), False, 'from tests.util import evaluation_mock\n'), ((1935, 2077), 'tests.util.evaluation_mock', 'evaluation_mock', ([], {'timestamp': 'timestamp2', 'successful_commands': 'total_commands2', 'total_commands': 'total_commands2', 'total_execution_duration': '(0.189)'}), '(timestamp=timestamp2, successful_commands=total_commands2,\n total_commands=total_commands2, total_execution_duration=0.189)\n', (1950, 2077), False, 'from tests.util import evaluation_mock\n'), ((2497, 2572), 'datetime.datetime', 'datetime.datetime', ([], {'year': '(2020)', 'month': '(4)', 'day': '(15)', 'hour': '(12)', 'minute': '(7)', 'second': '(42)'}), '(year=2020, month=4, day=15, hour=12, minute=7, second=42)\n', (2514, 2572), False, 'import datetime\n'), ((2582, 2658), 'datetime.datetime', 'datetime.datetime', ([], {'year': '(2020)', 'month': '(4)', 'day': '(14)', 'hour': '(18)', 'minute': '(59)', 'second': '(11)'}), '(year=2020, month=4, day=14, hour=18, minute=59, second=11)\n', (2599, 2658), False, 'import datetime\n'), ((2694, 2834), 'tests.util.evaluation_mock', 'evaluation_mock', ([], {'timestamp': 'timestamp1', 'successful_commands': 'total_commands', 'total_commands': 'total_commands', 'total_execution_duration': '(0.234)'}), '(timestamp=timestamp1, successful_commands=total_commands,\n total_commands=total_commands, total_execution_duration=0.234)\n', (2709, 2834), False, 'from tests.util import evaluation_mock\n'), ((2899, 3014), 'tests.util.evaluation_mock', 'evaluation_mock', ([], {'timestamp': 'timestamp2', 'successful_commands': '(3)', 'total_commands': '(7)', 'total_execution_duration': '(0.189)'}), '(timestamp=timestamp2, successful_commands=3, total_commands\n =7, total_execution_duration=0.189)\n', (2914, 3014), False, 'from tests.util import evaluation_mock\n'), ((3455, 3530), 'datetime.datetime', 'datetime.datetime', ([], {'year': '(2020)', 'month': '(4)', 'day': '(15)', 'hour': '(12)', 'minute': '(7)', 'second': '(42)'}), '(year=2020, month=4, day=15, hour=12, minute=7, second=42)\n', (3472, 3530), False, 'import datetime\n'), ((3540, 3616), 'datetime.datetime', 'datetime.datetime', ([], {'year': '(2020)', 'month': '(4)', 'day': '(14)', 'hour': '(18)', 'minute': '(59)', 'second': '(11)'}), '(year=2020, month=4, day=14, hour=18, minute=59, second=11)\n', (3557, 3616), False, 'import datetime\n'), ((3626, 3702), 'datetime.datetime', 'datetime.datetime', ([], {'year': '(2020)', 'month': '(4)', 'day': '(14)', 'hour': '(11)', 'minute': '(31)', 'second': '(22)'}), '(year=2020, month=4, day=14, hour=11, minute=31, second=22)\n', (3643, 3702), False, 'import datetime\n'), ((3738, 3880), 'tests.util.evaluation_mock', 'evaluation_mock', ([], {'timestamp': 'timestamp1', 'successful_commands': 'total_commands1', 'total_commands': 'total_commands1', 'total_execution_duration': '(0.234)'}), '(timestamp=timestamp1, successful_commands=total_commands1,\n total_commands=total_commands1, total_execution_duration=0.234)\n', (3753, 3880), False, 'from tests.util import evaluation_mock\n'), ((3945, 4060), 'tests.util.evaluation_mock', 'evaluation_mock', ([], {'timestamp': 'timestamp2', 'successful_commands': '(3)', 'total_commands': '(7)', 'total_execution_duration': '(0.189)'}), '(timestamp=timestamp2, successful_commands=3, total_commands\n =7, total_execution_duration=0.189)\n', (3960, 4060), False, 'from tests.util import evaluation_mock\n'), ((4124, 4265), 'tests.util.evaluation_mock', 'evaluation_mock', ([], {'timestamp': 'timestamp3', 'successful_commands': 'total_commands2', 'total_commands': 'total_commands2', 'total_execution_duration': '(0.03)'}), '(timestamp=timestamp3, successful_commands=total_commands2,\n total_commands=total_commands2, total_execution_duration=0.03)\n', (4139, 4265), False, 'from tests.util import evaluation_mock\n'), ((4788, 4863), 'datetime.datetime', 'datetime.datetime', ([], {'year': '(2020)', 'month': '(4)', 'day': '(15)', 'hour': '(12)', 'minute': '(7)', 'second': '(42)'}), '(year=2020, month=4, day=15, hour=12, minute=7, second=42)\n', (4805, 4863), False, 'import datetime\n'), ((4873, 4949), 'datetime.datetime', 'datetime.datetime', ([], {'year': '(2020)', 'month': '(4)', 'day': '(14)', 'hour': '(18)', 'minute': '(59)', 'second': '(11)'}), '(year=2020, month=4, day=14, hour=18, minute=59, second=11)\n', (4890, 4949), False, 'import datetime\n'), ((4959, 5035), 'datetime.datetime', 'datetime.datetime', ([], {'year': '(2020)', 'month': '(4)', 'day': '(14)', 'hour': '(11)', 'minute': '(31)', 'second': '(22)'}), '(year=2020, month=4, day=14, hour=11, minute=31, second=22)\n', (4976, 5035), False, 'import datetime\n'), ((5071, 5213), 'tests.util.evaluation_mock', 'evaluation_mock', ([], {'timestamp': 'timestamp1', 'successful_commands': 'total_commands1', 'total_commands': 'total_commands1', 'total_execution_duration': '(0.234)'}), '(timestamp=timestamp1, successful_commands=total_commands1,\n total_commands=total_commands1, total_execution_duration=0.234)\n', (5086, 5213), False, 'from tests.util import evaluation_mock\n'), ((5278, 5393), 'tests.util.evaluation_mock', 'evaluation_mock', ([], {'timestamp': 'timestamp2', 'successful_commands': '(3)', 'total_commands': '(7)', 'total_execution_duration': '(0.189)'}), '(timestamp=timestamp2, successful_commands=3, total_commands\n =7, total_execution_duration=0.189)\n', (5293, 5393), False, 'from tests.util import evaluation_mock\n'), ((5457, 5598), 'tests.util.evaluation_mock', 'evaluation_mock', ([], {'timestamp': 'timestamp3', 'successful_commands': 'total_commands2', 'total_commands': 'total_commands2', 'total_execution_duration': '(0.03)'}), '(timestamp=timestamp3, successful_commands=total_commands2,\n total_commands=total_commands2, total_execution_duration=0.03)\n', (5472, 5598), False, 'from tests.util import evaluation_mock\n')]
from __future__ import annotations from typing import NamedTuple class Fold(NamedTuple): dim: str val: int class Paper: def __init__(self, marks: list[list[bool]]) -> None: self.marks = marks self.height, self.width = len(marks), len(marks[0]) def mark(self, i: int, j: int) -> None: self.marks[i][j] = True def fold(self, fold: Fold) -> None: if fold.dim == "x": bf, af = fold.val - 1, fold.val + 1 while bf >= 0 and af <= self.width: for i in range(self.height): self.marks[i][bf] |= self.marks[i][af] bf -= 1 af += 1 for i in range(self.height): self.marks[i] = self.marks[i][: fold.val] else: bf, af = fold.val - 1, fold.val + 1 while bf >= 0 and af < self.height: for j in range(self.width): self.marks[bf][j] |= self.marks[af][j] bf -= 1 af += 1 self.marks = self.marks[: fold.val] self.height, self.width = len(self.marks), len(self.marks[0]) def __str__(self) -> str: return "\n".join("".join("#" if m else "." for m in row) for row in self.marks) def parse(filename: str) -> tuple[Paper, list[Fold]]: with open(filename) as f: coords, raw_folds = f.read().split("\n\n") xs, ys = [], [] for line in coords.splitlines(): x, _, y = line.partition(",") xs.append(int(x)) ys.append(int(y)) paper = Paper([[False] * (max(xs) + 1) for _ in range(max(ys) + 1)]) for j, i in zip(xs, ys): paper.mark(i, j) folds = [] for line in raw_folds.splitlines(): raw_dim, _, raw_val = line.partition("=") dim, val = raw_dim[-1], int(raw_val) folds.append(Fold(dim, val)) return paper, folds def part1(filename: str) -> int: paper, folds = parse(filename) paper.fold(folds[0]) return sum(m for row in paper.marks for m in row) def part2(filename: str) -> int: paper, folds = parse(filename) for fold in folds: paper.fold(fold) print(paper) return -1 if __name__ == "__main__": from _common import main raise SystemExit(main(part1, part2))
[ "_common.main" ]
[((2282, 2300), '_common.main', 'main', (['part1', 'part2'], {}), '(part1, part2)\n', (2286, 2300), False, 'from _common import main\n')]
# MODULE: TypeRig / Core / Collection (Functions) # ----------------------------------------------------------- # (C) <NAME>, 2017-2021 (http://www.kateliev.com) # (C) Karandash Type Foundry (http://www.karandash.eu) #------------------------------------------------------------ # www.typerig.com # No warranties. By using this you agree # that you use it at your own risk! # - Dependencies ------------------------ from __future__ import absolute_import, print_function, division from itertools import islice # - Init -------------------------------- __version__ = '0.26.7' # - Functions --------------------------- # -- Dictionary ------------------------- def mergeDicts(d1, d2, merge = lambda x, y : y): ''' Merges two dictionaries [d1, d2], combining values on duplicate keys as defined by the optional [merge] function. -------- Example: merge(d1, d2, lambda x,y: x+y) -> {'a': 2, 'c': 6, 'b': 4} ''' mergeDict = dict(d1) for key, value in d2.items(): if key in mergeDict: mergeDict[key] = merge(mergeDict[key], value) else: mergeDict[key] = value return mergeDict # -- Lists ------------------------------ def flatten(listItems): ''' Unpacks all items form [listItems] containing other lists, sets and etc. ''' from itertools import chain return list(chain(*listItems)) def group_recurring(listItems): ''' Combines recurring items in [listItems] and returns a list containing sets of grouped items ''' temp = [set(item) for item in listItems if item] for indexA, valueA in enumerate(temp) : for indexB, valueB in enumerate(temp[indexA + 1 :], indexA + 1): if valueA & valueB: temp[indexA] = valueA.union(temp.pop(indexB)) return group_recurring(temp) return [tuple(item) for item in temp] def group_consecutive(listItems, step = 1): ''' Build a list of lists containig consecutive numbers from [listItems] (number list) within [step] ''' tempList = [] groupList = [tempList] expectedValue = None for value in listItems: if (value == expectedValue) or (expectedValue is None): tempList.append(value) else: tempList = [value] groupList.append(tempList) expectedValue = value + step return groupList def group_conditional(iterable, condition): '''Takes a sorted iterable and groups items according to condition and operator given Args: iterable list() or tuple(): Any iterable object condition lambda x: A function to check condition Returns: generator object Example: l = [123, 124, 128, 160, 167, 213, 215, 230, 245, 255, 257, 400, 401, 402, 430] g = grouper(l, lambda x: x <= 15) dict(enumerate(g)) >>> {1: [123, 124, 128], 2: [160, 167], 3: [213, 215, 230, 245, 255, 257],....} ''' prev = None group = [] for item in iterable: if prev is None or condition(abs(item - prev)): group.append(item) else: yield group group = [item] prev = item if group: yield group def sliding_window(sequence, window_size=2): '''Returns a sliding window (of window_size) over data from the iterable. Example: s -> (s0, s1, ... s[n-1]), (s1, s2, ... , sn), ... ''' iterator = iter(sequence) result = tuple(islice(iterator, window_size)) if len(result) == window_size: yield result for element in iterator: result = result[1:] + (element,) yield result if __name__ == '__main__': d1 = {i:i+3 for i in range(10)} d2 = {i:i*3 for i in range(10)} print(mergeDicts(d1, d2, merge = lambda x, y : '%s+%s'%(x,y))) a = ((3, 4), (4, 5), (67, 12), (899, 234, 2345, 2, 3), (4, 5, 7)) b = [123, 124, 128, 160, 167, 213, 215, 230, 245, 255, 257, 400, 401, 402, 430] print(flatten(a)) print(group_recurring(a)) print(group_consecutive(flatten(a), step = 1)) print(list(sliding_window(flatten(a), window_size=2))) print(list(group_conditional(b, lambda x: x <= 15)))
[ "itertools.chain", "itertools.islice" ]
[((1288, 1305), 'itertools.chain', 'chain', (['*listItems'], {}), '(*listItems)\n', (1293, 1305), False, 'from itertools import chain\n'), ((3126, 3155), 'itertools.islice', 'islice', (['iterator', 'window_size'], {}), '(iterator, window_size)\n', (3132, 3155), False, 'from itertools import islice\n')]
from typing import List, Dict, Any, Optional import logging from collections import Counter from reval.dataset_utils import train_val_split from reval.probing_task_example import ProbingTaskExample logger = logging.getLogger(__name__) def generate_task_examples( data: List[Dict[str, Any]], argument: str, position: str, pos2idx: [Dict[str, int]], keep_tags: List[str], split: str, ) -> List[ProbingTaskExample]: probing_examples = [] for example in data: entity_start, entity_end = example[argument] pos = example["pos"] if position == "left": # no POS to the left of the entity if entity_start == 0: continue pos_tag = pos[entity_start - 1] else: if entity_end == (len(pos) - 1): continue # TODO: make sure this holds for all datasets (end index inclusive) pos_tag = pos[entity_end + 1] if keep_tags and pos_tag not in keep_tags: continue probing_examples.append( ProbingTaskExample( tokens=example["tokens"], label=pos2idx[pos_tag], split=split, head=example["head"], tail=example["tail"], ner=example["ner"], pos=example["pos"], dep=example["dep"], dep_head=example["dep_head"], id=example["id"], ) ) return probing_examples def generate( train_data: List[Dict[str, Any]], test_data: List[Dict[str, Any]], argument: str, position: str, validation_size: float = 0.1, validation_data: Optional[List[Dict[str, Any]]] = None, keep_tags: Optional[List[str]] = None, ) -> List[ProbingTaskExample]: logger.info( "Generating dataset for probing task: " + f"PosTag{argument.capitalize()}{position.capitalize()}" ) if argument not in ["head", "tail"]: raise ValueError(f"'{argument}' is not a valid argument.") if position not in ["left", "right"]: raise ValueError(f"'{position}' is not a valid position.") if validation_data is None: train_data, validation_data = train_val_split(train_data, validation_size) logger.info(f"Argument: {argument}") logger.info(f"Position: {position}") logger.info(f"Num train examples: {len(train_data)}") logger.info(f"Num validation examples: {len(validation_data)}") logger.info(f"Num test examples: {len(test_data)}") all_pos_tags = Counter() for data in [train_data, validation_data, test_data]: for example in data: all_pos_tags.update(example["pos"]) logger.info(f"Label distribution: {all_pos_tags}") pos2idx = {pos_tag: i for i, pos_tag in enumerate(list(all_pos_tags))} task_examples = [] train_task_examples = generate_task_examples( train_data, argument, position, pos2idx, keep_tags, split="tr" ) task_examples.extend(train_task_examples) idx2pos = {v: k for k, v in pos2idx.items()} class_distribution = Counter( [idx2pos[example.label] for example in train_task_examples] ) logger.info(f"CT: {class_distribution}") validation_task_examples = generate_task_examples( validation_data, argument, position, pos2idx, keep_tags, split="va" ) task_examples.extend(validation_task_examples) test_task_examples = generate_task_examples( test_data, argument, position, pos2idx, keep_tags, split="te" ) task_examples.extend(test_task_examples) logger.info(f"Num train task examples: {len(train_task_examples)}") logger.info(f"Num validation task examples: {len(validation_task_examples)}") logger.info(f"Num test task examples: {len(test_task_examples)}") return task_examples
[ "collections.Counter", "reval.dataset_utils.train_val_split", "reval.probing_task_example.ProbingTaskExample", "logging.getLogger" ]
[((209, 236), 'logging.getLogger', 'logging.getLogger', (['__name__'], {}), '(__name__)\n', (226, 236), False, 'import logging\n'), ((2583, 2592), 'collections.Counter', 'Counter', ([], {}), '()\n', (2590, 2592), False, 'from collections import Counter\n'), ((3133, 3201), 'collections.Counter', 'Counter', (['[idx2pos[example.label] for example in train_task_examples]'], {}), '([idx2pos[example.label] for example in train_task_examples])\n', (3140, 3201), False, 'from collections import Counter\n'), ((2253, 2297), 'reval.dataset_utils.train_val_split', 'train_val_split', (['train_data', 'validation_size'], {}), '(train_data, validation_size)\n', (2268, 2297), False, 'from reval.dataset_utils import train_val_split\n'), ((1082, 1328), 'reval.probing_task_example.ProbingTaskExample', 'ProbingTaskExample', ([], {'tokens': "example['tokens']", 'label': 'pos2idx[pos_tag]', 'split': 'split', 'head': "example['head']", 'tail': "example['tail']", 'ner': "example['ner']", 'pos': "example['pos']", 'dep': "example['dep']", 'dep_head': "example['dep_head']", 'id': "example['id']"}), "(tokens=example['tokens'], label=pos2idx[pos_tag], split=\n split, head=example['head'], tail=example['tail'], ner=example['ner'],\n pos=example['pos'], dep=example['dep'], dep_head=example['dep_head'],\n id=example['id'])\n", (1100, 1328), False, 'from reval.probing_task_example import ProbingTaskExample\n')]
#!/usr/bin/env python # imports import json # weather data import time # time data import urllib # fixing urls from includes import epd2in13b # e ink library import Image # Image manipulation import ImageFont # Text Writing import ImageDraw # Image drawing import os # for relative path try: import requests # needed for getting data except ImportError: exit("This script requires the requests module\nInstall with: sudo pip install requests") # statc vars COLORED = 1 UNCOLORED = 0 CITY = "Minneapolis" COUNTRYCODE = "US" # Weather code taken from inky-phat example code # Python 2 vs 3 breaking changes def encode(qs): val = "" try: val = urllib.urlencode(qs).replace("+", "%20") except AttributeError: val = urllib.parse.urlencode(qs).replace("+", "%20") return val # Query the Yahoo weather API to get current weather data def get_weather(address): base = "https://query.yahooapis.com/v1/public/yql?" query = "select * from weather.forecast where woeid in (select woeid from geo.places(1) where text=\"{}\")".format(address) qs = {"q": query, "format": "json", "env": "store://datatables.org/alltableswithkeys"} uri = base + encode(qs) res = requests.get(uri) if res.status_code == 200: json_data = json.loads(res.text) return json_data return {} ############################################################################## ############################################################################## # Start of main program ############################################################################## ############################################################################## # startup display disp=epd2in13b.EPD() disp.init() # image frames to be drawn frame_black = [0xFF] * (disp.width * disp.height / 8) frame_yellow = [0xFF] * (disp.width * disp.height / 8) # fonts to be used fontBold = ImageFont.truetype('/usr/share/fonts/truetype/freefont/FreeSansBold.ttf', 35) font = ImageFont.truetype('/usr/share/fonts/truetype/freefont/FreeSans.ttf', 35) fontBoldBIG = ImageFont.truetype('/usr/share/fonts/truetype/freefont/FreeSansBold.ttf', 40) fontBIG = ImageFont.truetype('/usr/share/fonts/truetype/freefont/FreeSans.ttf', 40) # Get the weather data for the given location location_string = "{city}, {countrycode}".format(city=CITY, countrycode=COUNTRYCODE) weather = get_weather(location_string) # This maps the weather codes from the Yahoo weather API # to the appropriate weather icons icon_map = { "snow": [5, 6, 7, 13, 14, 15, 16, 17, 18, 41, 42, 43, 46], "rain": [8, 9, 10, 11, 12, 35, 40], "cloud": [19, 20, 21, 22, 25, 26, 27, 28, 44], "pcloud": [30, 44], "pcloudnight": [29], "night": [31,33], "sun": [32, 34, 36], "storm": [0, 1, 2, 3, 4, 37, 38, 39, 45, 47], "wind": [23, 24] } # Placeholder variables highT = 0 lowT =0 weather_icon = None # Pull out the appropriate values from the weather data if "channel" in weather["query"]["results"]: results = weather["query"]["results"]["channel"] highT = int(results["item"]["forecast"][0]["high"]) lowT = int(results["item"]["forecast"][0]["low"]) code = int(results["item"]["forecast"][0]["code"]) for icon in icon_map: if code in icon_map[icon]: weather_icon = icon break else: print("Warning, no weather information found!") # get date info weekday=time.strftime('%a') month=time.strftime('%b') date=time.strftime('%d') ## draw images first # black part icon_file='' if weather_icon == "snow": icon_file='images/black/snow.bmp' elif weather_icon == "rain": icon_file='images/black/rain.bmp' elif weather_icon == "storm": icon_file='images/black/storm.bmp' elif weather_icon == "wind": icon_file='images/black/windy.bmp' elif weather_icon=="cloud" or weather_icon=="pcloud" or weather_icon=="pcloudnight": icon_file='images/black/cloudy.bmp' # make sure we should be drawing the black image and do it if icon_file != "": dir = os.path.dirname(__file__) file_path=os.path.join(dir,icon_file) frame_black= disp.get_frame_buffer(Image.open(file_path)) # yellow part icon_file_yellow='' if weather_icon == "pcloud": icon_file_yellow='images/yellow/pcloudysun.bmp' elif weather_icon == "pcloudnight": icon_file_yellow='images/yellow/pcloudymoon.bmp' elif weather_icon == "storm": icon_file_yellow='images/yellow/storm.bmp' elif weather_icon == "sun": icon_file_yellow='images/yellow/sun.bmp' elif weather_icon=="night": icon_file_yellow='images/yellow/moon.bmp' # make sure we should be drawing the yellow image and do it if icon_file_yellow != "": dir = os.path.dirname(__file__) file_path=os.path.join(dir,icon_file_yellow) frame_yellow = disp.get_frame_buffer(Image.open(file_path)) ## draw Text disp.set_rotate(1) # date disp.draw_string_at(frame_black, 15, 5, weekday, fontBold, COLORED) disp.draw_string_at(frame_black, 85, 5, month, font, COLORED) disp.draw_string_at(frame_black, 160, 5, date, fontBold, COLORED) # weather disp.draw_string_at(frame_yellow, 90, 55, str(highT), fontBoldBIG, COLORED) disp.draw_filled_rectangle(frame_black, 140, 55, 144, 100, COLORED) disp.draw_string_at(frame_black, 150, 55, str(lowT), fontBIG, COLORED) # display it disp.display_frame(frame_black,frame_yellow)
[ "json.loads", "urllib.parse.urlencode", "includes.epd2in13b.EPD", "os.path.dirname", "Image.open", "time.strftime", "ImageFont.truetype", "requests.get", "urllib.urlencode", "os.path.join" ]
[((1817, 1832), 'includes.epd2in13b.EPD', 'epd2in13b.EPD', ([], {}), '()\n', (1830, 1832), False, 'from includes import epd2in13b\n'), ((2013, 2090), 'ImageFont.truetype', 'ImageFont.truetype', (['"""/usr/share/fonts/truetype/freefont/FreeSansBold.ttf"""', '(35)'], {}), "('/usr/share/fonts/truetype/freefont/FreeSansBold.ttf', 35)\n", (2031, 2090), False, 'import ImageFont\n'), ((2098, 2171), 'ImageFont.truetype', 'ImageFont.truetype', (['"""/usr/share/fonts/truetype/freefont/FreeSans.ttf"""', '(35)'], {}), "('/usr/share/fonts/truetype/freefont/FreeSans.ttf', 35)\n", (2116, 2171), False, 'import ImageFont\n'), ((2186, 2263), 'ImageFont.truetype', 'ImageFont.truetype', (['"""/usr/share/fonts/truetype/freefont/FreeSansBold.ttf"""', '(40)'], {}), "('/usr/share/fonts/truetype/freefont/FreeSansBold.ttf', 40)\n", (2204, 2263), False, 'import ImageFont\n'), ((2274, 2347), 'ImageFont.truetype', 'ImageFont.truetype', (['"""/usr/share/fonts/truetype/freefont/FreeSans.ttf"""', '(40)'], {}), "('/usr/share/fonts/truetype/freefont/FreeSans.ttf', 40)\n", (2292, 2347), False, 'import ImageFont\n'), ((3526, 3545), 'time.strftime', 'time.strftime', (['"""%a"""'], {}), "('%a')\n", (3539, 3545), False, 'import time\n'), ((3552, 3571), 'time.strftime', 'time.strftime', (['"""%b"""'], {}), "('%b')\n", (3565, 3571), False, 'import time\n'), ((3577, 3596), 'time.strftime', 'time.strftime', (['"""%d"""'], {}), "('%d')\n", (3590, 3596), False, 'import time\n'), ((1321, 1338), 'requests.get', 'requests.get', (['uri'], {}), '(uri)\n', (1333, 1338), False, 'import requests\n'), ((4130, 4155), 'os.path.dirname', 'os.path.dirname', (['__file__'], {}), '(__file__)\n', (4145, 4155), False, 'import os\n'), ((4170, 4198), 'os.path.join', 'os.path.join', (['dir', 'icon_file'], {}), '(dir, icon_file)\n', (4182, 4198), False, 'import os\n'), ((4792, 4817), 'os.path.dirname', 'os.path.dirname', (['__file__'], {}), '(__file__)\n', (4807, 4817), False, 'import os\n'), ((4832, 4867), 'os.path.join', 'os.path.join', (['dir', 'icon_file_yellow'], {}), '(dir, icon_file_yellow)\n', (4844, 4867), False, 'import os\n'), ((1390, 1410), 'json.loads', 'json.loads', (['res.text'], {}), '(res.text)\n', (1400, 1410), False, 'import json\n'), ((4237, 4258), 'Image.open', 'Image.open', (['file_path'], {}), '(file_path)\n', (4247, 4258), False, 'import Image\n'), ((4908, 4929), 'Image.open', 'Image.open', (['file_path'], {}), '(file_path)\n', (4918, 4929), False, 'import Image\n'), ((777, 797), 'urllib.urlencode', 'urllib.urlencode', (['qs'], {}), '(qs)\n', (793, 797), False, 'import urllib\n'), ((859, 885), 'urllib.parse.urlencode', 'urllib.parse.urlencode', (['qs'], {}), '(qs)\n', (881, 885), False, 'import urllib\n')]
# coding: utf-8 from __future__ import print_function, division, absolute_import import pytest from cutadapt.seqio import Sequence from cutadapt.adapters import (Adapter, Match, ColorspaceAdapter, FRONT, BACK, parse_braces, LinkedAdapter, AdapterStatistics, AdapterParser) def test_issue_52(): adapter = Adapter( sequence='GAACTCCAGTCACNNNNN', where=BACK, max_error_rate=0.12, min_overlap=5, read_wildcards=False, adapter_wildcards=True) read = Sequence(name="abc", sequence='CCCCAGAACTACAGTCCCGGC') am = Match(astart=0, astop=17, rstart=5, rstop=21, matches=15, errors=2, remove_before=False, adapter=adapter, read=read) assert am.wildcards() == 'GGC' """ The result above should actually be 'CGGC' since the correct alignment is this one: adapter GAACTCCAGTCACNNNNN mismatches X X read CCCCAGAACTACAGTC-CCGGC Since we do not keep the alignment, guessing 'GGC' is the best we can currently do. """ def test_issue_80(): # This issue turned out to not be an actual issue with the alignment # algorithm. The following alignment is found because it has more matches # than the 'obvious' one: # # TCGTATGCCGTCTTC # =========X==XX= # TCGTATGCCCTC--C # # This is correct, albeit a little surprising, since an alignment without # indels would have only two errors. adapter = Adapter( sequence="TCGTATGCCGTCTTC", where=BACK, max_error_rate=0.2, min_overlap=3, read_wildcards=False, adapter_wildcards=False) read = Sequence(name="seq2", sequence="TCGTATGCCCTCC") result = adapter.match_to(read) assert result.errors == 3, result assert result.astart == 0, result assert result.astop == 15, result def test_str(): a = Adapter('ACGT', where=BACK, max_error_rate=0.1) str(a) str(a.match_to(Sequence(name='seq', sequence='TTACGT'))) ca = ColorspaceAdapter('0123', where=BACK, max_error_rate=0.1) str(ca) def test_color(): with pytest.raises(ValueError): ColorspaceAdapter('0123', where=FRONT, max_error_rate=0.1) def test_parse_braces(): assert parse_braces('') == '' assert parse_braces('A') == 'A' assert parse_braces('A{0}') == '' assert parse_braces('A{1}') == 'A' assert parse_braces('A{2}') == 'AA' assert parse_braces('A{2}C') == 'AAC' assert parse_braces('ACGTN{3}TGACCC') == 'ACGTNNNTGACCC' assert parse_braces('ACGTN{10}TGACCC') == 'ACGTNNNNNNNNNNTGACCC' assert parse_braces('ACGTN{3}TGA{4}CCC') == 'ACGTNNNTGAAAACCC' assert parse_braces('ACGTN{0}TGA{4}CCC') == 'ACGTTGAAAACCC' def test_parse_braces_fail(): for expression in ['{', '}', '{}', '{5', '{1}', 'A{-7}', 'A{', 'A{1', 'N{7', 'AN{7', 'A{4{}', 'A{4}{3}', 'A{b}', 'A{6X}', 'A{X6}']: with pytest.raises(ValueError): parse_braces(expression) def test_linked_adapter(): linked_adapter = LinkedAdapter('AAAA', 'TTTT', min_overlap=4) assert linked_adapter.front_adapter.min_overlap == 4 assert linked_adapter.back_adapter.min_overlap == 4 sequence = Sequence(name='seq', sequence='AAAACCCCCTTTT') trimmed = linked_adapter.match_to(sequence).trimmed() assert trimmed.name == 'seq' assert trimmed.sequence == 'CCCCC' def test_info_record(): adapter = Adapter( sequence='GAACTCCAGTCACNNNNN', where=BACK, max_error_rate=0.12, min_overlap=5, read_wildcards=False, adapter_wildcards=True, name="Foo") read = Sequence(name="abc", sequence='CCCCAGAACTACAGTCCCGGC') am = Match(astart=0, astop=17, rstart=5, rstop=21, matches=15, errors=2, remove_before=False, adapter=adapter, read=read) assert am.get_info_record() == ( "abc", 2, 5, 21, 'CCCCA', 'GAACTACAGTCCCGGC', '', 'Foo', '', '', '' ) def test_random_match_probabilities(): a = Adapter('A', where=BACK, max_error_rate=0.1).create_statistics() assert a.back.random_match_probabilities(0.5) == [1, 0.25] assert a.back.random_match_probabilities(0.2) == [1, 0.4] for s in ('ACTG', 'XMWH'): a = Adapter(s, where=BACK, max_error_rate=0.1).create_statistics() assert a.back.random_match_probabilities(0.5) == [1, 0.25, 0.25**2, 0.25**3, 0.25**4] assert a.back.random_match_probabilities(0.2) == [1, 0.4, 0.4*0.1, 0.4*0.1*0.4, 0.4*0.1*0.4*0.1] a = Adapter('GTCA', where=FRONT, max_error_rate=0.1).create_statistics() assert a.front.random_match_probabilities(0.5) == [1, 0.25, 0.25**2, 0.25**3, 0.25**4] assert a.front.random_match_probabilities(0.2) == [1, 0.4, 0.4*0.1, 0.4*0.1*0.4, 0.4*0.1*0.4*0.1] def test_add_adapter_statistics(): stats = Adapter('A', name='name', where=BACK, max_error_rate=0.1).create_statistics() end_stats = stats.back end_stats.adjacent_bases['A'] = 7 end_stats.adjacent_bases['C'] = 19 end_stats.adjacent_bases['G'] = 23 end_stats.adjacent_bases['T'] = 42 end_stats.adjacent_bases[''] = 45 end_stats.errors[10][0] = 100 end_stats.errors[10][1] = 11 end_stats.errors[10][2] = 3 end_stats.errors[20][0] = 600 end_stats.errors[20][1] = 66 end_stats.errors[20][2] = 6 stats2 = Adapter('A', name='name', where=BACK, max_error_rate=0.1).create_statistics() end_stats2 = stats2.back end_stats2.adjacent_bases['A'] = 43 end_stats2.adjacent_bases['C'] = 31 end_stats2.adjacent_bases['G'] = 27 end_stats2.adjacent_bases['T'] = 8 end_stats2.adjacent_bases[''] = 5 end_stats2.errors[10][0] = 234 end_stats2.errors[10][1] = 14 end_stats2.errors[10][3] = 5 end_stats2.errors[15][0] = 90 end_stats2.errors[15][1] = 17 end_stats2.errors[15][2] = 2 stats += stats2 r = stats.back assert r.adjacent_bases == {'A': 50, 'C': 50, 'G': 50, 'T': 50, '': 50} assert r.errors == { 10: {0: 334, 1: 25, 2: 3, 3: 5}, 15: {0: 90, 1: 17, 2: 2}, 20: {0: 600, 1: 66, 2: 6}, } def test_issue_265(): """Crash when accessing the matches property of non-anchored linked adapters""" s = Sequence('name', 'AAAATTTT') la = LinkedAdapter('GGG', 'TTT', front_restriction=None, back_restriction=None) assert la.match_to(s).matches == 3 def test_parse_not_linked(): p = AdapterParser._parse_not_linked assert p('A', 'front') == (None, 'A', None) assert p('A', 'back') == (None, 'A', None) assert p('A', 'anywhere') == (None, 'A', None) assert p('^A', 'front') == ('anchored', 'A', None) assert p('XXXA', 'front') == ('noninternal', 'A', None) assert p('A$', 'back') == (None, 'A', 'anchored') assert p('AXXXX', 'back') == (None, 'A', 'noninternal')
[ "cutadapt.adapters.Adapter", "cutadapt.adapters.ColorspaceAdapter", "cutadapt.adapters.parse_braces", "cutadapt.adapters.Match", "cutadapt.seqio.Sequence", "pytest.raises", "cutadapt.adapters.LinkedAdapter" ]
[((309, 445), 'cutadapt.adapters.Adapter', 'Adapter', ([], {'sequence': '"""GAACTCCAGTCACNNNNN"""', 'where': 'BACK', 'max_error_rate': '(0.12)', 'min_overlap': '(5)', 'read_wildcards': '(False)', 'adapter_wildcards': '(True)'}), "(sequence='GAACTCCAGTCACNNNNN', where=BACK, max_error_rate=0.12,\n min_overlap=5, read_wildcards=False, adapter_wildcards=True)\n", (316, 445), False, 'from cutadapt.adapters import Adapter, Match, ColorspaceAdapter, FRONT, BACK, parse_braces, LinkedAdapter, AdapterStatistics, AdapterParser\n'), ((463, 517), 'cutadapt.seqio.Sequence', 'Sequence', ([], {'name': '"""abc"""', 'sequence': '"""CCCCAGAACTACAGTCCCGGC"""'}), "(name='abc', sequence='CCCCAGAACTACAGTCCCGGC')\n", (471, 517), False, 'from cutadapt.seqio import Sequence\n'), ((524, 644), 'cutadapt.adapters.Match', 'Match', ([], {'astart': '(0)', 'astop': '(17)', 'rstart': '(5)', 'rstop': '(21)', 'matches': '(15)', 'errors': '(2)', 'remove_before': '(False)', 'adapter': 'adapter', 'read': 'read'}), '(astart=0, astop=17, rstart=5, rstop=21, matches=15, errors=2,\n remove_before=False, adapter=adapter, read=read)\n', (529, 644), False, 'from cutadapt.adapters import Adapter, Match, ColorspaceAdapter, FRONT, BACK, parse_braces, LinkedAdapter, AdapterStatistics, AdapterParser\n'), ((1343, 1476), 'cutadapt.adapters.Adapter', 'Adapter', ([], {'sequence': '"""TCGTATGCCGTCTTC"""', 'where': 'BACK', 'max_error_rate': '(0.2)', 'min_overlap': '(3)', 'read_wildcards': '(False)', 'adapter_wildcards': '(False)'}), "(sequence='TCGTATGCCGTCTTC', where=BACK, max_error_rate=0.2,\n min_overlap=3, read_wildcards=False, adapter_wildcards=False)\n", (1350, 1476), False, 'from cutadapt.adapters import Adapter, Match, ColorspaceAdapter, FRONT, BACK, parse_braces, LinkedAdapter, AdapterStatistics, AdapterParser\n'), ((1494, 1541), 'cutadapt.seqio.Sequence', 'Sequence', ([], {'name': '"""seq2"""', 'sequence': '"""TCGTATGCCCTCC"""'}), "(name='seq2', sequence='TCGTATGCCCTCC')\n", (1502, 1541), False, 'from cutadapt.seqio import Sequence\n'), ((1703, 1750), 'cutadapt.adapters.Adapter', 'Adapter', (['"""ACGT"""'], {'where': 'BACK', 'max_error_rate': '(0.1)'}), "('ACGT', where=BACK, max_error_rate=0.1)\n", (1710, 1750), False, 'from cutadapt.adapters import Adapter, Match, ColorspaceAdapter, FRONT, BACK, parse_braces, LinkedAdapter, AdapterStatistics, AdapterParser\n'), ((1823, 1880), 'cutadapt.adapters.ColorspaceAdapter', 'ColorspaceAdapter', (['"""0123"""'], {'where': 'BACK', 'max_error_rate': '(0.1)'}), "('0123', where=BACK, max_error_rate=0.1)\n", (1840, 1880), False, 'from cutadapt.adapters import Adapter, Match, ColorspaceAdapter, FRONT, BACK, parse_braces, LinkedAdapter, AdapterStatistics, AdapterParser\n'), ((2768, 2812), 'cutadapt.adapters.LinkedAdapter', 'LinkedAdapter', (['"""AAAA"""', '"""TTTT"""'], {'min_overlap': '(4)'}), "('AAAA', 'TTTT', min_overlap=4)\n", (2781, 2812), False, 'from cutadapt.adapters import Adapter, Match, ColorspaceAdapter, FRONT, BACK, parse_braces, LinkedAdapter, AdapterStatistics, AdapterParser\n'), ((2933, 2979), 'cutadapt.seqio.Sequence', 'Sequence', ([], {'name': '"""seq"""', 'sequence': '"""AAAACCCCCTTTT"""'}), "(name='seq', sequence='AAAACCCCCTTTT')\n", (2941, 2979), False, 'from cutadapt.seqio import Sequence\n'), ((3138, 3286), 'cutadapt.adapters.Adapter', 'Adapter', ([], {'sequence': '"""GAACTCCAGTCACNNNNN"""', 'where': 'BACK', 'max_error_rate': '(0.12)', 'min_overlap': '(5)', 'read_wildcards': '(False)', 'adapter_wildcards': '(True)', 'name': '"""Foo"""'}), "(sequence='GAACTCCAGTCACNNNNN', where=BACK, max_error_rate=0.12,\n min_overlap=5, read_wildcards=False, adapter_wildcards=True, name='Foo')\n", (3145, 3286), False, 'from cutadapt.adapters import Adapter, Match, ColorspaceAdapter, FRONT, BACK, parse_braces, LinkedAdapter, AdapterStatistics, AdapterParser\n'), ((3306, 3360), 'cutadapt.seqio.Sequence', 'Sequence', ([], {'name': '"""abc"""', 'sequence': '"""CCCCAGAACTACAGTCCCGGC"""'}), "(name='abc', sequence='CCCCAGAACTACAGTCCCGGC')\n", (3314, 3360), False, 'from cutadapt.seqio import Sequence\n'), ((3367, 3487), 'cutadapt.adapters.Match', 'Match', ([], {'astart': '(0)', 'astop': '(17)', 'rstart': '(5)', 'rstop': '(21)', 'matches': '(15)', 'errors': '(2)', 'remove_before': '(False)', 'adapter': 'adapter', 'read': 'read'}), '(astart=0, astop=17, rstart=5, rstop=21, matches=15, errors=2,\n remove_before=False, adapter=adapter, read=read)\n', (3372, 3487), False, 'from cutadapt.adapters import Adapter, Match, ColorspaceAdapter, FRONT, BACK, parse_braces, LinkedAdapter, AdapterStatistics, AdapterParser\n'), ((5716, 5744), 'cutadapt.seqio.Sequence', 'Sequence', (['"""name"""', '"""AAAATTTT"""'], {}), "('name', 'AAAATTTT')\n", (5724, 5744), False, 'from cutadapt.seqio import Sequence\n'), ((5751, 5825), 'cutadapt.adapters.LinkedAdapter', 'LinkedAdapter', (['"""GGG"""', '"""TTT"""'], {'front_restriction': 'None', 'back_restriction': 'None'}), "('GGG', 'TTT', front_restriction=None, back_restriction=None)\n", (5764, 5825), False, 'from cutadapt.adapters import Adapter, Match, ColorspaceAdapter, FRONT, BACK, parse_braces, LinkedAdapter, AdapterStatistics, AdapterParser\n'), ((1916, 1941), 'pytest.raises', 'pytest.raises', (['ValueError'], {}), '(ValueError)\n', (1929, 1941), False, 'import pytest\n'), ((1945, 2003), 'cutadapt.adapters.ColorspaceAdapter', 'ColorspaceAdapter', (['"""0123"""'], {'where': 'FRONT', 'max_error_rate': '(0.1)'}), "('0123', where=FRONT, max_error_rate=0.1)\n", (1962, 2003), False, 'from cutadapt.adapters import Adapter, Match, ColorspaceAdapter, FRONT, BACK, parse_braces, LinkedAdapter, AdapterStatistics, AdapterParser\n'), ((2039, 2055), 'cutadapt.adapters.parse_braces', 'parse_braces', (['""""""'], {}), "('')\n", (2051, 2055), False, 'from cutadapt.adapters import Adapter, Match, ColorspaceAdapter, FRONT, BACK, parse_braces, LinkedAdapter, AdapterStatistics, AdapterParser\n'), ((2070, 2087), 'cutadapt.adapters.parse_braces', 'parse_braces', (['"""A"""'], {}), "('A')\n", (2082, 2087), False, 'from cutadapt.adapters import Adapter, Match, ColorspaceAdapter, FRONT, BACK, parse_braces, LinkedAdapter, AdapterStatistics, AdapterParser\n'), ((2103, 2123), 'cutadapt.adapters.parse_braces', 'parse_braces', (['"""A{0}"""'], {}), "('A{0}')\n", (2115, 2123), False, 'from cutadapt.adapters import Adapter, Match, ColorspaceAdapter, FRONT, BACK, parse_braces, LinkedAdapter, AdapterStatistics, AdapterParser\n'), ((2138, 2158), 'cutadapt.adapters.parse_braces', 'parse_braces', (['"""A{1}"""'], {}), "('A{1}')\n", (2150, 2158), False, 'from cutadapt.adapters import Adapter, Match, ColorspaceAdapter, FRONT, BACK, parse_braces, LinkedAdapter, AdapterStatistics, AdapterParser\n'), ((2174, 2194), 'cutadapt.adapters.parse_braces', 'parse_braces', (['"""A{2}"""'], {}), "('A{2}')\n", (2186, 2194), False, 'from cutadapt.adapters import Adapter, Match, ColorspaceAdapter, FRONT, BACK, parse_braces, LinkedAdapter, AdapterStatistics, AdapterParser\n'), ((2211, 2232), 'cutadapt.adapters.parse_braces', 'parse_braces', (['"""A{2}C"""'], {}), "('A{2}C')\n", (2223, 2232), False, 'from cutadapt.adapters import Adapter, Match, ColorspaceAdapter, FRONT, BACK, parse_braces, LinkedAdapter, AdapterStatistics, AdapterParser\n'), ((2250, 2280), 'cutadapt.adapters.parse_braces', 'parse_braces', (['"""ACGTN{3}TGACCC"""'], {}), "('ACGTN{3}TGACCC')\n", (2262, 2280), False, 'from cutadapt.adapters import Adapter, Match, ColorspaceAdapter, FRONT, BACK, parse_braces, LinkedAdapter, AdapterStatistics, AdapterParser\n'), ((2308, 2339), 'cutadapt.adapters.parse_braces', 'parse_braces', (['"""ACGTN{10}TGACCC"""'], {}), "('ACGTN{10}TGACCC')\n", (2320, 2339), False, 'from cutadapt.adapters import Adapter, Match, ColorspaceAdapter, FRONT, BACK, parse_braces, LinkedAdapter, AdapterStatistics, AdapterParser\n'), ((2374, 2407), 'cutadapt.adapters.parse_braces', 'parse_braces', (['"""ACGTN{3}TGA{4}CCC"""'], {}), "('ACGTN{3}TGA{4}CCC')\n", (2386, 2407), False, 'from cutadapt.adapters import Adapter, Match, ColorspaceAdapter, FRONT, BACK, parse_braces, LinkedAdapter, AdapterStatistics, AdapterParser\n'), ((2438, 2471), 'cutadapt.adapters.parse_braces', 'parse_braces', (['"""ACGTN{0}TGA{4}CCC"""'], {}), "('ACGTN{0}TGA{4}CCC')\n", (2450, 2471), False, 'from cutadapt.adapters import Adapter, Match, ColorspaceAdapter, FRONT, BACK, parse_braces, LinkedAdapter, AdapterStatistics, AdapterParser\n'), ((1775, 1814), 'cutadapt.seqio.Sequence', 'Sequence', ([], {'name': '"""seq"""', 'sequence': '"""TTACGT"""'}), "(name='seq', sequence='TTACGT')\n", (1783, 1814), False, 'from cutadapt.seqio import Sequence\n'), ((2666, 2691), 'pytest.raises', 'pytest.raises', (['ValueError'], {}), '(ValueError)\n', (2679, 2691), False, 'import pytest\n'), ((2696, 2720), 'cutadapt.adapters.parse_braces', 'parse_braces', (['expression'], {}), '(expression)\n', (2708, 2720), False, 'from cutadapt.adapters import Adapter, Match, ColorspaceAdapter, FRONT, BACK, parse_braces, LinkedAdapter, AdapterStatistics, AdapterParser\n'), ((3661, 3705), 'cutadapt.adapters.Adapter', 'Adapter', (['"""A"""'], {'where': 'BACK', 'max_error_rate': '(0.1)'}), "('A', where=BACK, max_error_rate=0.1)\n", (3668, 3705), False, 'from cutadapt.adapters import Adapter, Match, ColorspaceAdapter, FRONT, BACK, parse_braces, LinkedAdapter, AdapterStatistics, AdapterParser\n'), ((4136, 4184), 'cutadapt.adapters.Adapter', 'Adapter', (['"""GTCA"""'], {'where': 'FRONT', 'max_error_rate': '(0.1)'}), "('GTCA', where=FRONT, max_error_rate=0.1)\n", (4143, 4184), False, 'from cutadapt.adapters import Adapter, Match, ColorspaceAdapter, FRONT, BACK, parse_braces, LinkedAdapter, AdapterStatistics, AdapterParser\n'), ((4438, 4495), 'cutadapt.adapters.Adapter', 'Adapter', (['"""A"""'], {'name': '"""name"""', 'where': 'BACK', 'max_error_rate': '(0.1)'}), "('A', name='name', where=BACK, max_error_rate=0.1)\n", (4445, 4495), False, 'from cutadapt.adapters import Adapter, Match, ColorspaceAdapter, FRONT, BACK, parse_braces, LinkedAdapter, AdapterStatistics, AdapterParser\n'), ((4910, 4967), 'cutadapt.adapters.Adapter', 'Adapter', (['"""A"""'], {'name': '"""name"""', 'where': 'BACK', 'max_error_rate': '(0.1)'}), "('A', name='name', where=BACK, max_error_rate=0.1)\n", (4917, 4967), False, 'from cutadapt.adapters import Adapter, Match, ColorspaceAdapter, FRONT, BACK, parse_braces, LinkedAdapter, AdapterStatistics, AdapterParser\n'), ((3880, 3922), 'cutadapt.adapters.Adapter', 'Adapter', (['s'], {'where': 'BACK', 'max_error_rate': '(0.1)'}), '(s, where=BACK, max_error_rate=0.1)\n', (3887, 3922), False, 'from cutadapt.adapters import Adapter, Match, ColorspaceAdapter, FRONT, BACK, parse_braces, LinkedAdapter, AdapterStatistics, AdapterParser\n')]
#!/usr/bin/python # Copyright (c) Microsoft Corporation # All rights reserved. # # MIT License # # Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated # documentation files (the "Software"), to deal in the Software without restriction, including without limitation # the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and # to permit persons to whom the Software is furnished to do so, subject to the following conditions: # The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software. # # THE SOFTWARE IS PROVIDED *AS IS*, WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING # BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, FITNESS FOR A PARTICULAR PURPOSE AND # NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, # DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, # OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE. import json import os import subprocess import sys import time import traceback from xml.dom import minidom def check_ready_to_run(): if sys.platform == 'win32': pgrep_output = subprocess.check_output( 'wmic process where "CommandLine like \'%nni_gpu_tool.gpu_metrics_collector%\' and name like \'%python%\'" get processId') pidList = pgrep_output.decode("utf-8").strip().split() pidList.pop(0) # remove the key word 'ProcessId' pidList = list(map(int, pidList)) pidList.remove(os.getpid()) return not pidList else: pgrep_output = subprocess.check_output('pgrep -fx \'python3 -m nni_gpu_tool.gpu_metrics_collector\'', shell=True) pidList = [] for pid in pgrep_output.splitlines(): pidList.append(int(pid)) pidList.remove(os.getpid()) return not pidList def main(argv): metrics_output_dir = os.environ['METRIC_OUTPUT_DIR'] if check_ready_to_run() == False: # GPU metrics collector is already running. Exit exit(2) cmd = 'nvidia-smi -q -x'.split() while(True): try: smi_output = subprocess.check_output(cmd) except Exception: traceback.print_exc() gen_empty_gpu_metric(metrics_output_dir) break parse_nvidia_smi_result(smi_output, metrics_output_dir) # TODO: change to sleep time configurable via arguments time.sleep(5) def parse_nvidia_smi_result(smi, outputDir): try: old_umask = os.umask(0) xmldoc = minidom.parseString(smi) gpuList = xmldoc.getElementsByTagName('gpu') with open(os.path.join(outputDir, "gpu_metrics"), 'a') as outputFile: outPut = {} outPut["Timestamp"] = time.asctime(time.localtime()) outPut["gpuCount"] = len(gpuList) outPut["gpuInfos"] = [] for gpuIndex, gpu in enumerate(gpuList): gpuInfo = {} gpuInfo['index'] = gpuIndex gpuInfo['gpuUtil'] = gpu.getElementsByTagName('utilization')[0]\ .getElementsByTagName('gpu_util')[0]\ .childNodes[0].data.replace("%", "").strip() gpuInfo['gpuMemUtil'] = gpu.getElementsByTagName('utilization')[0]\ .getElementsByTagName('memory_util')[0]\ .childNodes[0].data.replace("%", "").strip() processes = gpu.getElementsByTagName('processes') runningProNumber = len(processes[0].getElementsByTagName('process_info')) gpuInfo['activeProcessNum'] = runningProNumber outPut["gpuInfos"].append(gpuInfo) print(outPut) outputFile.write("{}\n".format(json.dumps(outPut, sort_keys=True))) outputFile.flush(); except: # e_info = sys.exc_info() print('xmldoc paring error') finally: os.umask(old_umask) def gen_empty_gpu_metric(outputDir): try: old_umask = os.umask(0) with open(os.path.join(outputDir, "gpu_metrics"), 'a') as outputFile: outPut = {} outPut["Timestamp"] = time.asctime(time.localtime()) outPut["gpuCount"] = 0 outPut["gpuInfos"] = [] print(outPut) outputFile.write("{}\n".format(json.dumps(outPut, sort_keys=True))) outputFile.flush() except Exception: traceback.print_exc() finally: os.umask(old_umask) if __name__ == "__main__": main(sys.argv[1:])
[ "traceback.print_exc", "os.getpid", "xml.dom.minidom.parseString", "subprocess.check_output", "json.dumps", "time.sleep", "os.umask", "os.path.join", "time.localtime" ]
[((1332, 1488), 'subprocess.check_output', 'subprocess.check_output', (['"""wmic process where "CommandLine like \'%nni_gpu_tool.gpu_metrics_collector%\' and name like \'%python%\'" get processId"""'], {}), '(\n \'wmic process where "CommandLine like \\\'%nni_gpu_tool.gpu_metrics_collector%\\\' and name like \\\'%python%\\\'" get processId\'\n )\n', (1355, 1488), False, 'import subprocess\n'), ((1750, 1851), 'subprocess.check_output', 'subprocess.check_output', (['"""pgrep -fx \'python3 -m nni_gpu_tool.gpu_metrics_collector\'"""'], {'shell': '(True)'}), '(\n "pgrep -fx \'python3 -m nni_gpu_tool.gpu_metrics_collector\'", shell=True)\n', (1773, 1851), False, 'import subprocess\n'), ((2589, 2602), 'time.sleep', 'time.sleep', (['(5)'], {}), '(5)\n', (2599, 2602), False, 'import time\n'), ((2678, 2689), 'os.umask', 'os.umask', (['(0)'], {}), '(0)\n', (2686, 2689), False, 'import os\n'), ((2707, 2731), 'xml.dom.minidom.parseString', 'minidom.parseString', (['smi'], {}), '(smi)\n', (2726, 2731), False, 'from xml.dom import minidom\n'), ((4087, 4106), 'os.umask', 'os.umask', (['old_umask'], {}), '(old_umask)\n', (4095, 4106), False, 'import os\n'), ((4174, 4185), 'os.umask', 'os.umask', (['(0)'], {}), '(0)\n', (4182, 4185), False, 'import os\n'), ((4634, 4653), 'os.umask', 'os.umask', (['old_umask'], {}), '(old_umask)\n', (4642, 4653), False, 'import os\n'), ((1677, 1688), 'os.getpid', 'os.getpid', ([], {}), '()\n', (1686, 1688), False, 'import os\n'), ((1976, 1987), 'os.getpid', 'os.getpid', ([], {}), '()\n', (1985, 1987), False, 'import os\n'), ((2293, 2321), 'subprocess.check_output', 'subprocess.check_output', (['cmd'], {}), '(cmd)\n', (2316, 2321), False, 'import subprocess\n'), ((4591, 4612), 'traceback.print_exc', 'traceback.print_exc', ([], {}), '()\n', (4610, 4612), False, 'import traceback\n'), ((2360, 2381), 'traceback.print_exc', 'traceback.print_exc', ([], {}), '()\n', (2379, 2381), False, 'import traceback\n'), ((2803, 2841), 'os.path.join', 'os.path.join', (['outputDir', '"""gpu_metrics"""'], {}), "(outputDir, 'gpu_metrics')\n", (2815, 2841), False, 'import os\n'), ((2934, 2950), 'time.localtime', 'time.localtime', ([], {}), '()\n', (2948, 2950), False, 'import time\n'), ((4204, 4242), 'os.path.join', 'os.path.join', (['outputDir', '"""gpu_metrics"""'], {}), "(outputDir, 'gpu_metrics')\n", (4216, 4242), False, 'import os\n'), ((4335, 4351), 'time.localtime', 'time.localtime', ([], {}), '()\n', (4349, 4351), False, 'import time\n'), ((3914, 3948), 'json.dumps', 'json.dumps', (['outPut'], {'sort_keys': '(True)'}), '(outPut, sort_keys=True)\n', (3924, 3948), False, 'import json\n'), ((4493, 4527), 'json.dumps', 'json.dumps', (['outPut'], {'sort_keys': '(True)'}), '(outPut, sort_keys=True)\n', (4503, 4527), False, 'import json\n')]
#!/usr/bin/env python # Licensed to Cloudera, Inc. under one # or more contributor license agreements. See the NOTICE file # distributed with this work for additional information # regarding copyright ownership. Cloudera, Inc. licenses this file # to you under the Apache License, Version 2.0 (the # "License"); you may not use this file except in compliance # with the License. You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. import json from desktop.lib.django_util import render from libsentry.sentry_site import get_hive_sentry_provider, get_sentry_server_admin_groups def hive(request): return render("hive.mako", request, { 'initial': json.dumps({ 'user': request.user.username, 'sentry_provider': get_hive_sentry_provider(), 'is_sentry_admin': request.user.groups.filter(name__in=get_sentry_server_admin_groups()).exists() }), 'has_impersonation_perm': _has_impersonation_perm(request.user), }) def hive2(request): return _sentry(request, component='hive') def solr(request): return _sentry(request, component='solr') def _sentry(request, component): return render("sentry.mako", request, { 'initial': json.dumps({ 'component': component, 'user': request.user.username, 'sentry_provider': get_hive_sentry_provider(), 'is_sentry_admin': request.user.groups.filter(name__in=get_sentry_server_admin_groups()).exists() }), 'has_impersonation_perm': _has_impersonation_perm(request.user) and component == 'hive', 'component': component }) def hdfs(request): return render("hdfs.mako", request, { 'initial': json.dumps({'user': request.user.username}), 'has_impersonation_perm': _has_impersonation_perm(request.user) }) def _has_impersonation_perm(user): return user.is_superuser or user.has_hue_permission(action="impersonate", app="security")
[ "libsentry.sentry_site.get_sentry_server_admin_groups", "json.dumps", "libsentry.sentry_site.get_hive_sentry_provider" ]
[((2020, 2063), 'json.dumps', 'json.dumps', (["{'user': request.user.username}"], {}), "({'user': request.user.username})\n", (2030, 2063), False, 'import json\n'), ((1102, 1128), 'libsentry.sentry_site.get_hive_sentry_provider', 'get_hive_sentry_provider', ([], {}), '()\n', (1126, 1128), False, 'from libsentry.sentry_site import get_hive_sentry_provider, get_sentry_server_admin_groups\n'), ((1666, 1692), 'libsentry.sentry_site.get_hive_sentry_provider', 'get_hive_sentry_provider', ([], {}), '()\n', (1690, 1692), False, 'from libsentry.sentry_site import get_hive_sentry_provider, get_sentry_server_admin_groups\n'), ((1195, 1227), 'libsentry.sentry_site.get_sentry_server_admin_groups', 'get_sentry_server_admin_groups', ([], {}), '()\n', (1225, 1227), False, 'from libsentry.sentry_site import get_hive_sentry_provider, get_sentry_server_admin_groups\n'), ((1759, 1791), 'libsentry.sentry_site.get_sentry_server_admin_groups', 'get_sentry_server_admin_groups', ([], {}), '()\n', (1789, 1791), False, 'from libsentry.sentry_site import get_hive_sentry_provider, get_sentry_server_admin_groups\n')]
# https://leetcode.com/problems/merge-two-sorted-lists/ import sys class ListNode(object): def __init__(self, x): self.val = x self.next = None class Solution(object): def mergeTwoLists(self, l1, l2): head = last = None def append(node): nonlocal head, last if not head: head = last = node else: last.next = node last = node while l1 or l2: if l1 and l2: if l1.val < l2.val: append(l1) l1 = l1.next else: append(l2) l2 = l2.next elif l1: append(l1) l1 = l1.next else: append(l2) l2 = l2.next return head def read_list(): values = list(map(int, sys.stdin.readline().strip().split())) head = last = None for val in values: if not last: head = last = ListNode(val) else: last.next = ListNode(val) last = last.next return head def print_list(l): ptr = l values = [] while ptr: values.append(ptr.val) ptr = ptr.next print(' '.join(map(str, values))) if __name__ == '__main__': sol = Solution() num_problems = int(sys.stdin.readline()) for _ in range(num_problems): l1, l2 = read_list(), read_list() res = sol.mergeTwoLists(l1, l2) print_list(res)
[ "sys.stdin.readline" ]
[((1393, 1413), 'sys.stdin.readline', 'sys.stdin.readline', ([], {}), '()\n', (1411, 1413), False, 'import sys\n'), ((921, 941), 'sys.stdin.readline', 'sys.stdin.readline', ([], {}), '()\n', (939, 941), False, 'import sys\n')]
""" Defines a rule set using one of the standard Iguanas representations. This rule set can then be reformatted into the other standard Iguanas representations using the class methods. """ from iguanas.rules._convert_rule_dicts_to_rule_strings import _ConvertRuleDictsToRuleStrings from iguanas.rules._convert_rule_strings_to_rule_dicts import _ConvertRuleStringsToRuleDicts from iguanas.rules._convert_rule_dicts_to_rule_lambdas import _ConvertRuleDictsToRuleLambdas from iguanas.rules._convert_rule_lambdas_to_rule_strings import _ConvertRuleLambdasToRuleStrings from iguanas.rules._get_rule_attributes import _GetRuleFeatures from iguanas.rule_application import RuleApplier from iguanas.utils.typing import KoalasDataFrameType, PandasDataFrameType from typing import List, Dict, Callable, Union class Rules(RuleApplier): """ Defines a set of rules using the following representations: string, dictionary, lambda expression. One of the above formats must be provided to define the rule set. The rules can then be reformatted into one of the other representations. Parameters ---------- rule_dicts : Dict[str, dict] Set of rules defined using thestandard Iguanas dictionary format (values) and their names (keys). Defaults to `None`. rule_strings : Dict[str, str] Set of rules defined using the standard Iguanas string format (values) and their names (keys). Defaults to `None`. rule_lambdas : Dict[str, Callable[[dict], str]] Set of rules defined using the standard Iguanas lambda expression format (values) and their names (keys). Must be given in conjunction with either `lambda_kwargs` or `lambda_args`. Defaults to `None`. lambda_kwargs : Dict[str, dict] For each rule (keys), a dictionary containing the features used in the rule (keys) and the current values (values). Only populates when `.as_lambda()` is used with the keyword argument `with_kwargs=True`. Defaults to `None`. lambda_args : Dict[str, list] For each rule (keys), a list containing the current values used in the rule. Only populates when `.as_lambda()` is used with the keyword argument `with_kwargs=False`. Defaults to `None`. Attributes ---------- rule_dicts : Dict[str, dict] Set of rules defined using the standard Iguanas dictionary format (values) and their names (keys). rule_strings : Dict[str, str] Set of rules defined using the standard Iguanas string format (values) and their names (keys). rule_lambdas : Dict[str, Callable[[dict], str]] Set of rules defined using the standard Iguanas lambda expression format (values) and their names (keys). lambda_kwargs : Dict[str, dict] For each rule (keys), a dictionary containing the features used in the rule (keys) and the current values (values). lambda_args : Dict[str, list] For each rule (keys), a list containing the current values used in the rule. rule_features : Dict[str, set] For each rule (keys), a set containing the features used in the rule (only populates when the `.get_rules_features()` method is used). """ def __init__(self, rule_dicts=None, rule_strings=None, rule_lambdas=None, lambda_kwargs=None, lambda_args=None): if rule_dicts is None and rule_strings is None and rule_lambdas is None: raise ValueError( '`rule_dicts`, `rule_strings` or `rule_lambdas` must be given') if rule_lambdas is not None and lambda_kwargs is None and \ lambda_args is None: raise ValueError( '`lambda_kwargs` or `lambda_args` must be given when `rule_lambdas` is provided') self.rule_dicts = {} if rule_dicts is None else rule_dicts self.rule_strings = {} if rule_strings is None else rule_strings self.rule_lambdas = {} if rule_lambdas is None else rule_lambdas self.lambda_kwargs = {} if lambda_kwargs is None else lambda_kwargs self.lambda_args = {} if lambda_args is None else lambda_args self.rule_features = {} RuleApplier.__init__( self, rule_strings=self.rule_strings, ) def __repr__(self): rules_lens = [ len(self.rule_dicts), len(self.rule_strings), len(self.rule_lambdas) ] return f'Rules object containing {max(rules_lens)} rules' def as_rule_dicts(self) -> Dict[str, dict]: """ Converts rules into the standard Iguanas dictionary format. Returns ------- Dict[str, dict] Rules in the standard Iguanas dictionary format. """ if self.rule_strings != {}: self._rule_strings_to_rule_dicts() elif self.rule_lambdas != {}: self._rule_lambdas_to_rule_strings() self._rule_strings_to_rule_dicts() return self.rule_dicts def as_rule_strings(self, as_numpy: bool) -> Dict[str, str]: """ Converts rules into the standard Iguanas string format. Parameters ---------- as_numpy : bool If `True`, the conditions in the string format will uses Numpy rather than Pandas. These rules are generally evaluated more quickly on larger dataset stored as Pandas DataFrames. Returns ------- Dict[str, str] Rules in the standard Iguanas string format. """ if self.rule_strings != {}: self._rule_strings_to_rule_dicts() elif self.rule_lambdas != {}: self._rule_lambdas_to_rule_strings() self._rule_strings_to_rule_dicts() self._rule_dicts_to_rule_strings(as_numpy=as_numpy) return self.rule_strings def as_rule_lambdas(self, as_numpy: bool, with_kwargs: bool) -> Dict[str, Callable[[dict], str]]: """ Converts rules into the standard Iguanas lambda expression format. Parameters ---------- as_numpy : bool If `True`, the conditions in the string format will uses Numpy rather than Pandas. These rules are generally evaluated more quickly on larger dataset stored as Pandas DataFrames. with_kwargs : bool If `True`, the string in the lambda expression is created such that the inputs are keyword arguments. If `False`, the inputs are positional arguments. Returns ------- Dict[str, Callable[[dict], str]] Rules in the standard Iguanas lambda expression format. """ if self.rule_lambdas != {}: self._rule_lambdas_to_rule_strings() self._rule_strings_to_rule_dicts() elif self.rule_strings != {}: self._rule_strings_to_rule_dicts() self._rule_dicts_to_rule_lambdas( as_numpy=as_numpy, with_kwargs=with_kwargs) return self.rule_lambdas def transform(self, X: Union[PandasDataFrameType, KoalasDataFrameType]) -> Union[PandasDataFrameType, KoalasDataFrameType]: """ Applies the set of rules to a dataset, `X`. Parameters ---------- X : Union[PandasDataFrameType, KoalasDataFrameType] The feature set on which the rules should be applied. Returns ------- Union[PandasDataFrameType, KoalasDataFrameType] The binary columns of the rules. """ if self.rule_strings == {}: self.rule_strings = self.as_rule_strings(as_numpy=False) X_rules = RuleApplier.transform(self, X=X) return X_rules def filter_rules(self, include=None, exclude=None) -> None: """ Filters the rules by their names. Parameters ---------- include : List[str], optional The list of rule names to keep. Defaults to `None`. exclude : List[str], optional The list of rule names to drop. Defaults to `None`. Raises ------ Exception `include` and `exclude` cannot contain similar values. """ if include is not None and exclude is not None: intersected = set.intersection(set(include), set(exclude)) if len(intersected) > 0: raise Exception( '`include` and `exclude` contain similar values') for d in [self.rule_strings, self.rule_dicts, self.rule_lambdas]: if d != {}: rule_names = list(d.keys()) break for rule_name in rule_names: if (include is not None and rule_name not in include) or \ (exclude is not None and rule_name in exclude): self.rule_strings.pop(rule_name, None) self.rule_dicts.pop(rule_name, None) self.rule_lambdas.pop(rule_name, None) self.lambda_kwargs.pop(rule_name, None) self.lambda_args.pop(rule_name, None) self.rule_features.pop(rule_name, None) def get_rule_features(self) -> Dict[str, set]: """ Returns the set of unique features present in each rule. Returns ------- Dict[str, set] Set of unique features (values) in each rule (keys). """ if self.rule_dicts == {}: _ = self.as_rule_dicts() grf = _GetRuleFeatures(rule_dicts=self.rule_dicts) self.rule_feature_set = grf.get() return self.rule_feature_set def _rule_dicts_to_rule_strings(self, as_numpy: bool) -> None: """ Converts the rules (each being represented in the standard Iguanas dictionary format) into the standard Iguanas string format. """ if self.rule_dicts == {}: raise ValueError('`rule_dicts` must be given') converter = _ConvertRuleDictsToRuleStrings( rule_dicts=self.rule_dicts) self.rule_strings = converter.convert(as_numpy=as_numpy) def _rule_strings_to_rule_dicts(self) -> None: """ Converts the rules (each being represented in the standard Iguanas string format) into the standard Iguanas dictionary format. """ if self.rule_strings == {}: raise ValueError('`rule_strings` must be given') converter = _ConvertRuleStringsToRuleDicts( rule_strings=self.rule_strings) self.rule_dicts = converter.convert() def _rule_dicts_to_rule_lambdas(self, as_numpy: bool, with_kwargs: bool) -> None: """ Converts the rules (each being represented in the standard Iguanas dictionary format) into the standard Iguanas lambda expression format. This is useful for optimising rules. """ if self.rule_dicts == {}: raise ValueError('`rule_dicts` must be given') converter = _ConvertRuleDictsToRuleLambdas(rule_dicts=self.rule_dicts) self.rule_lambdas = converter.convert( as_numpy=as_numpy, with_kwargs=with_kwargs) self.lambda_kwargs = converter.lambda_kwargs self.lambda_args = converter.lambda_args self.rule_features = converter.rule_features def _rule_lambdas_to_rule_strings(self) -> None: """ Converts the rules (each being represented in the standard Iguanas lambda expression format) into the standard Iguanas string format. """ if self.rule_lambdas == {}: raise ValueError('`rule_lambdas` must be given') if self.lambda_kwargs == {} and self.lambda_args == {}: raise ValueError('`lambda_kwargs` or `lambda_args` must be given') converter = _ConvertRuleLambdasToRuleStrings( rule_lambdas=self.rule_lambdas, lambda_kwargs=self.lambda_kwargs, lambda_args=self.lambda_args) self.rule_strings = converter.convert()
[ "iguanas.rule_application.RuleApplier.__init__", "iguanas.rules._convert_rule_dicts_to_rule_strings._ConvertRuleDictsToRuleStrings", "iguanas.rules._get_rule_attributes._GetRuleFeatures", "iguanas.rules._convert_rule_strings_to_rule_dicts._ConvertRuleStringsToRuleDicts", "iguanas.rules._convert_rule_lambdas_to_rule_strings._ConvertRuleLambdasToRuleStrings", "iguanas.rules._convert_rule_dicts_to_rule_lambdas._ConvertRuleDictsToRuleLambdas", "iguanas.rule_application.RuleApplier.transform" ]
[((4245, 4303), 'iguanas.rule_application.RuleApplier.__init__', 'RuleApplier.__init__', (['self'], {'rule_strings': 'self.rule_strings'}), '(self, rule_strings=self.rule_strings)\n', (4265, 4303), False, 'from iguanas.rule_application import RuleApplier\n'), ((7803, 7835), 'iguanas.rule_application.RuleApplier.transform', 'RuleApplier.transform', (['self'], {'X': 'X'}), '(self, X=X)\n', (7824, 7835), False, 'from iguanas.rule_application import RuleApplier\n'), ((9634, 9678), 'iguanas.rules._get_rule_attributes._GetRuleFeatures', '_GetRuleFeatures', ([], {'rule_dicts': 'self.rule_dicts'}), '(rule_dicts=self.rule_dicts)\n', (9650, 9678), False, 'from iguanas.rules._get_rule_attributes import _GetRuleFeatures\n'), ((10107, 10165), 'iguanas.rules._convert_rule_dicts_to_rule_strings._ConvertRuleDictsToRuleStrings', '_ConvertRuleDictsToRuleStrings', ([], {'rule_dicts': 'self.rule_dicts'}), '(rule_dicts=self.rule_dicts)\n', (10137, 10165), False, 'from iguanas.rules._convert_rule_dicts_to_rule_strings import _ConvertRuleDictsToRuleStrings\n'), ((10581, 10643), 'iguanas.rules._convert_rule_strings_to_rule_dicts._ConvertRuleStringsToRuleDicts', '_ConvertRuleStringsToRuleDicts', ([], {'rule_strings': 'self.rule_strings'}), '(rule_strings=self.rule_strings)\n', (10611, 10643), False, 'from iguanas.rules._convert_rule_strings_to_rule_dicts import _ConvertRuleStringsToRuleDicts\n'), ((11162, 11220), 'iguanas.rules._convert_rule_dicts_to_rule_lambdas._ConvertRuleDictsToRuleLambdas', '_ConvertRuleDictsToRuleLambdas', ([], {'rule_dicts': 'self.rule_dicts'}), '(rule_dicts=self.rule_dicts)\n', (11192, 11220), False, 'from iguanas.rules._convert_rule_dicts_to_rule_lambdas import _ConvertRuleDictsToRuleLambdas\n'), ((11967, 12099), 'iguanas.rules._convert_rule_lambdas_to_rule_strings._ConvertRuleLambdasToRuleStrings', '_ConvertRuleLambdasToRuleStrings', ([], {'rule_lambdas': 'self.rule_lambdas', 'lambda_kwargs': 'self.lambda_kwargs', 'lambda_args': 'self.lambda_args'}), '(rule_lambdas=self.rule_lambdas,\n lambda_kwargs=self.lambda_kwargs, lambda_args=self.lambda_args)\n', (11999, 12099), False, 'from iguanas.rules._convert_rule_lambdas_to_rule_strings import _ConvertRuleLambdasToRuleStrings\n')]
from __future__ import print_function import os import glob def NameFile(filepath): if os.path.exists(filepath): newname = FindLatestFilename(filepath) else: newname = filepath print('Saving file as...', newname) return newname def FindLatestFilename(filepath): if len(filepath.rsplit('/', 1)) == 2: foldername = filepath.rsplit('/', 1)[0] # Split out folder path filename = filepath.rsplit('/', 1)[-1] # retrieve filename filelist = glob.glob((foldername + '/' + filename.rsplit('.', 1)[0] + '*.' + filename.rsplit('.')[-1])) # find list of files within folder nums = [] lastfile = None for filen in filelist: if filen.rsplit('.', 1)[-2].rsplit('-', 1)[-1].isdigit(): # if the filename ends in -digit... nums.append(int(filen.rsplit('.', 1)[-2].rsplit('-', 1)[-1])) # append the number to the list lastnum = max(nums) # find maximum number lastfile = filen.rsplit('.', 1)[-2].rsplit('-', 1)[-2] + '-' + str(lastnum) + '.' + filen.rsplit('.', 1)[-1] elif lastfile is not None: lastfile = lastfile else: lastfile = filen.rsplit('.', 1)[-2] + '.' + filen.rsplit('.', 1)[-1] newfilename = NumberFileNames(lastfile) else: foldername = '' filename = filepath newfilename = NumberFileNames(filename) return newfilename def NumberFileNames(filepath): if len(filepath.rsplit('/', 1)) == 2: # If the input filepath has a folder path included foldername = filepath.rsplit('/', 1)[0] filename = filepath.rsplit('/', 1)[-1] else: foldername = '' filename = filepath if filename.rsplit('-',1)[-1].rsplit('.', 1)[0].isdigit(): filename = filename.rsplit('-', 1)[0] + '-' + str(1+int(filename.rsplit('-', 1)[-1].rsplit('.', 1)[0])) + '.' + filename.rsplit('.', 1)[-1] else: filename = filename.rsplit('.', 1)[-2] + '-1' + '.' + filename.rsplit('.', 1)[-1] filepath = os.path.join(foldername, filename) return filepath
[ "os.path.exists", "os.path.join" ]
[((89, 113), 'os.path.exists', 'os.path.exists', (['filepath'], {}), '(filepath)\n', (103, 113), False, 'import os\n'), ((1836, 1870), 'os.path.join', 'os.path.join', (['foldername', 'filename'], {}), '(foldername, filename)\n', (1848, 1870), False, 'import os\n')]
from sqlalchemy.orm import relationship, backref from sqlalchemy import ( Column, String, ForeignKey, Float, Integer, DateTime, Boolean ) from sqlalchemy.orm import relationship from libs.database import Base from apps.account.models import Account, AccountPosition from apps.model.models import Model, ModelPosition from apps.portfolio.models import Portfolio from apps.trade.models import Trade, TradeRequest class RolesUsers(Base): '''M-to-M relation between roles and users''' __tablename__ = 'roles_users' id = Column(Integer(), primary_key=True) user_id = Column('user_id', Integer(), ForeignKey('users.id')) role_id = Column('role_id', Integer(), ForeignKey('roles.id')) class Role(Base): __tablename__ = 'roles' id = Column(Integer(), primary_key=True) name = Column(String(80), unique=True) description = Column(String(255)) class User(Base): '''User table''' __tablename__ = 'users' id = Column(Integer, primary_key=True) email = Column(String(255), unique=True) username = Column(String(255)) password = Column(String(255)) access = Column(String(255)) last_login_at = Column(DateTime()) current_login_at = Column(DateTime()) last_login_ip = Column(String(100)) current_login_ip = Column(String(100)) login_count = Column(Integer) active = Column(Boolean()) confirmed_at = Column(DateTime()) quovo_user_id = Column(String) tradeshop_id = Column(String) first_name = Column(String) last_name = Column(String) company = Column(String) phone_number = Column(String) business = relationship('Business', back_populates='user', uselist=False) roles = relationship( 'Role', secondary='roles_users', backref=backref('users', lazy='dynamic') ) def as_dict(self): return { 'id': self.id, 'email': self.email, 'username': self.username, 'company': self.company, 'first_name': self.first_name, 'last_name': self.last_name, 'phone_number': self.phone_number, } class Business(Base): '''User business''' __tablename__ = 'businesses' id = Column(Integer, primary_key=True) user_id = Column(Integer, ForeignKey('users.id'), nullable=False) models = relationship("Model", back_populates="business", cascade="all, delete, delete-orphan") portfolios = relationship( "Portfolio", back_populates="business", cascade="all, delete, delete-orphan") trades = relationship("Trade", back_populates="business", cascade="all, delete, delete-orphan") accounts = relationship( "Account", back_populates="business", cascade="all, delete, delete-orphan") user = relationship('User', back_populates='business', single_parent=True, cascade="all, delete, delete-orphan") def as_dict(self): return ({'id': self.id, 'user_id': self.user_id}) class TradePortfolio(Base): __tablename__ = 'trade_portfolios' id = Column(Integer, primary_key=True) trade_id = Column(Integer, ForeignKey('trades.id')) portfolio_id = Column(Integer, ForeignKey('portfolios.id'), nullable=False) trade = relationship("Trade", back_populates="portfolios") portfolio = relationship("Portfolio", back_populates="trades") def as_dict(self): result = {'id': self.id, 'trade_id': self.trade_id, 'portfolio_id': self.portfolio_id} return result class Price(Base): __tablename__ = 'prices' id = Column(Integer, primary_key=True) account_position_id = Column(Integer, ForeignKey('account_positions.id')) model_position_id = Column(Integer, ForeignKey('model_positions.id')) trade_id = Column(Integer, ForeignKey('trades.id')) symbol = Column(String, nullable=False) price = Column(Float) trade = relationship("Trade", back_populates="prices") model_position = relationship( "ModelPosition", back_populates="trade_prices") account_position = relationship( "AccountPosition", back_populates="trade_prices") def as_dict(self): return {'id': self.id, 'trade_id': self.trade_id, 'symbol': self.symbol, 'price': str(self.price)}
[ "sqlalchemy.DateTime", "sqlalchemy.ForeignKey", "sqlalchemy.orm.relationship", "sqlalchemy.Boolean", "sqlalchemy.Column", "sqlalchemy.String", "sqlalchemy.orm.backref", "sqlalchemy.Integer" ]
[((1030, 1063), 'sqlalchemy.Column', 'Column', (['Integer'], {'primary_key': '(True)'}), '(Integer, primary_key=True)\n', (1036, 1063), False, 'from sqlalchemy import Column, String, ForeignKey, Float, Integer, DateTime, Boolean\n'), ((1403, 1418), 'sqlalchemy.Column', 'Column', (['Integer'], {}), '(Integer)\n', (1409, 1418), False, 'from sqlalchemy import Column, String, ForeignKey, Float, Integer, DateTime, Boolean\n'), ((1511, 1525), 'sqlalchemy.Column', 'Column', (['String'], {}), '(String)\n', (1517, 1525), False, 'from sqlalchemy import Column, String, ForeignKey, Float, Integer, DateTime, Boolean\n'), ((1546, 1560), 'sqlalchemy.Column', 'Column', (['String'], {}), '(String)\n', (1552, 1560), False, 'from sqlalchemy import Column, String, ForeignKey, Float, Integer, DateTime, Boolean\n'), ((1579, 1593), 'sqlalchemy.Column', 'Column', (['String'], {}), '(String)\n', (1585, 1593), False, 'from sqlalchemy import Column, String, ForeignKey, Float, Integer, DateTime, Boolean\n'), ((1611, 1625), 'sqlalchemy.Column', 'Column', (['String'], {}), '(String)\n', (1617, 1625), False, 'from sqlalchemy import Column, String, ForeignKey, Float, Integer, DateTime, Boolean\n'), ((1641, 1655), 'sqlalchemy.Column', 'Column', (['String'], {}), '(String)\n', (1647, 1655), False, 'from sqlalchemy import Column, String, ForeignKey, Float, Integer, DateTime, Boolean\n'), ((1676, 1690), 'sqlalchemy.Column', 'Column', (['String'], {}), '(String)\n', (1682, 1690), False, 'from sqlalchemy import Column, String, ForeignKey, Float, Integer, DateTime, Boolean\n'), ((1707, 1769), 'sqlalchemy.orm.relationship', 'relationship', (['"""Business"""'], {'back_populates': '"""user"""', 'uselist': '(False)'}), "('Business', back_populates='user', uselist=False)\n", (1719, 1769), False, 'from sqlalchemy.orm import relationship\n'), ((2325, 2358), 'sqlalchemy.Column', 'Column', (['Integer'], {'primary_key': '(True)'}), '(Integer, primary_key=True)\n', (2331, 2358), False, 'from sqlalchemy import Column, String, ForeignKey, Float, Integer, DateTime, Boolean\n'), ((2444, 2535), 'sqlalchemy.orm.relationship', 'relationship', (['"""Model"""'], {'back_populates': '"""business"""', 'cascade': '"""all, delete, delete-orphan"""'}), "('Model', back_populates='business', cascade=\n 'all, delete, delete-orphan')\n", (2456, 2535), False, 'from sqlalchemy.orm import relationship\n'), ((2576, 2671), 'sqlalchemy.orm.relationship', 'relationship', (['"""Portfolio"""'], {'back_populates': '"""business"""', 'cascade': '"""all, delete, delete-orphan"""'}), "('Portfolio', back_populates='business', cascade=\n 'all, delete, delete-orphan')\n", (2588, 2671), False, 'from sqlalchemy.orm import relationship\n'), ((2691, 2782), 'sqlalchemy.orm.relationship', 'relationship', (['"""Trade"""'], {'back_populates': '"""business"""', 'cascade': '"""all, delete, delete-orphan"""'}), "('Trade', back_populates='business', cascade=\n 'all, delete, delete-orphan')\n", (2703, 2782), False, 'from sqlalchemy.orm import relationship\n'), ((2821, 2914), 'sqlalchemy.orm.relationship', 'relationship', (['"""Account"""'], {'back_populates': '"""business"""', 'cascade': '"""all, delete, delete-orphan"""'}), "('Account', back_populates='business', cascade=\n 'all, delete, delete-orphan')\n", (2833, 2914), False, 'from sqlalchemy.orm import relationship\n'), ((2932, 3042), 'sqlalchemy.orm.relationship', 'relationship', (['"""User"""'], {'back_populates': '"""business"""', 'single_parent': '(True)', 'cascade': '"""all, delete, delete-orphan"""'}), "('User', back_populates='business', single_parent=True, cascade\n ='all, delete, delete-orphan')\n", (2944, 3042), False, 'from sqlalchemy.orm import relationship\n'), ((3231, 3264), 'sqlalchemy.Column', 'Column', (['Integer'], {'primary_key': '(True)'}), '(Integer, primary_key=True)\n', (3237, 3264), False, 'from sqlalchemy import Column, String, ForeignKey, Float, Integer, DateTime, Boolean\n'), ((3416, 3466), 'sqlalchemy.orm.relationship', 'relationship', (['"""Trade"""'], {'back_populates': '"""portfolios"""'}), "('Trade', back_populates='portfolios')\n", (3428, 3466), False, 'from sqlalchemy.orm import relationship\n'), ((3484, 3534), 'sqlalchemy.orm.relationship', 'relationship', (['"""Portfolio"""'], {'back_populates': '"""trades"""'}), "('Portfolio', back_populates='trades')\n", (3496, 3534), False, 'from sqlalchemy.orm import relationship\n'), ((3744, 3777), 'sqlalchemy.Column', 'Column', (['Integer'], {'primary_key': '(True)'}), '(Integer, primary_key=True)\n', (3750, 3777), False, 'from sqlalchemy import Column, String, ForeignKey, Float, Integer, DateTime, Boolean\n'), ((4003, 4033), 'sqlalchemy.Column', 'Column', (['String'], {'nullable': '(False)'}), '(String, nullable=False)\n', (4009, 4033), False, 'from sqlalchemy import Column, String, ForeignKey, Float, Integer, DateTime, Boolean\n'), ((4047, 4060), 'sqlalchemy.Column', 'Column', (['Float'], {}), '(Float)\n', (4053, 4060), False, 'from sqlalchemy import Column, String, ForeignKey, Float, Integer, DateTime, Boolean\n'), ((4074, 4120), 'sqlalchemy.orm.relationship', 'relationship', (['"""Trade"""'], {'back_populates': '"""prices"""'}), "('Trade', back_populates='prices')\n", (4086, 4120), False, 'from sqlalchemy.orm import relationship\n'), ((4143, 4203), 'sqlalchemy.orm.relationship', 'relationship', (['"""ModelPosition"""'], {'back_populates': '"""trade_prices"""'}), "('ModelPosition', back_populates='trade_prices')\n", (4155, 4203), False, 'from sqlalchemy.orm import relationship\n'), ((4238, 4300), 'sqlalchemy.orm.relationship', 'relationship', (['"""AccountPosition"""'], {'back_populates': '"""trade_prices"""'}), "('AccountPosition', back_populates='trade_prices')\n", (4250, 4300), False, 'from sqlalchemy.orm import relationship\n'), ((592, 601), 'sqlalchemy.Integer', 'Integer', ([], {}), '()\n', (599, 601), False, 'from sqlalchemy import Column, String, ForeignKey, Float, Integer, DateTime, Boolean\n'), ((654, 663), 'sqlalchemy.Integer', 'Integer', ([], {}), '()\n', (661, 663), False, 'from sqlalchemy import Column, String, ForeignKey, Float, Integer, DateTime, Boolean\n'), ((665, 687), 'sqlalchemy.ForeignKey', 'ForeignKey', (['"""users.id"""'], {}), "('users.id')\n", (675, 687), False, 'from sqlalchemy import Column, String, ForeignKey, Float, Integer, DateTime, Boolean\n'), ((722, 731), 'sqlalchemy.Integer', 'Integer', ([], {}), '()\n', (729, 731), False, 'from sqlalchemy import Column, String, ForeignKey, Float, Integer, DateTime, Boolean\n'), ((733, 755), 'sqlalchemy.ForeignKey', 'ForeignKey', (['"""roles.id"""'], {}), "('roles.id')\n", (743, 755), False, 'from sqlalchemy import Column, String, ForeignKey, Float, Integer, DateTime, Boolean\n'), ((830, 839), 'sqlalchemy.Integer', 'Integer', ([], {}), '()\n', (837, 839), False, 'from sqlalchemy import Column, String, ForeignKey, Float, Integer, DateTime, Boolean\n'), ((878, 888), 'sqlalchemy.String', 'String', (['(80)'], {}), '(80)\n', (884, 888), False, 'from sqlalchemy import Column, String, ForeignKey, Float, Integer, DateTime, Boolean\n'), ((929, 940), 'sqlalchemy.String', 'String', (['(255)'], {}), '(255)\n', (935, 940), False, 'from sqlalchemy import Column, String, ForeignKey, Float, Integer, DateTime, Boolean\n'), ((1084, 1095), 'sqlalchemy.String', 'String', (['(255)'], {}), '(255)\n', (1090, 1095), False, 'from sqlalchemy import Column, String, ForeignKey, Float, Integer, DateTime, Boolean\n'), ((1133, 1144), 'sqlalchemy.String', 'String', (['(255)'], {}), '(255)\n', (1139, 1144), False, 'from sqlalchemy import Column, String, ForeignKey, Float, Integer, DateTime, Boolean\n'), ((1169, 1180), 'sqlalchemy.String', 'String', (['(255)'], {}), '(255)\n', (1175, 1180), False, 'from sqlalchemy import Column, String, ForeignKey, Float, Integer, DateTime, Boolean\n'), ((1203, 1214), 'sqlalchemy.String', 'String', (['(255)'], {}), '(255)\n', (1209, 1214), False, 'from sqlalchemy import Column, String, ForeignKey, Float, Integer, DateTime, Boolean\n'), ((1244, 1254), 'sqlalchemy.DateTime', 'DateTime', ([], {}), '()\n', (1252, 1254), False, 'from sqlalchemy import Column, String, ForeignKey, Float, Integer, DateTime, Boolean\n'), ((1287, 1297), 'sqlalchemy.DateTime', 'DateTime', ([], {}), '()\n', (1295, 1297), False, 'from sqlalchemy import Column, String, ForeignKey, Float, Integer, DateTime, Boolean\n'), ((1327, 1338), 'sqlalchemy.String', 'String', (['(100)'], {}), '(100)\n', (1333, 1338), False, 'from sqlalchemy import Column, String, ForeignKey, Float, Integer, DateTime, Boolean\n'), ((1371, 1382), 'sqlalchemy.String', 'String', (['(100)'], {}), '(100)\n', (1377, 1382), False, 'from sqlalchemy import Column, String, ForeignKey, Float, Integer, DateTime, Boolean\n'), ((1440, 1449), 'sqlalchemy.Boolean', 'Boolean', ([], {}), '()\n', (1447, 1449), False, 'from sqlalchemy import Column, String, ForeignKey, Float, Integer, DateTime, Boolean\n'), ((1478, 1488), 'sqlalchemy.DateTime', 'DateTime', ([], {}), '()\n', (1486, 1488), False, 'from sqlalchemy import Column, String, ForeignKey, Float, Integer, DateTime, Boolean\n'), ((2390, 2412), 'sqlalchemy.ForeignKey', 'ForeignKey', (['"""users.id"""'], {}), "('users.id')\n", (2400, 2412), False, 'from sqlalchemy import Column, String, ForeignKey, Float, Integer, DateTime, Boolean\n'), ((3297, 3320), 'sqlalchemy.ForeignKey', 'ForeignKey', (['"""trades.id"""'], {}), "('trades.id')\n", (3307, 3320), False, 'from sqlalchemy import Column, String, ForeignKey, Float, Integer, DateTime, Boolean\n'), ((3358, 3385), 'sqlalchemy.ForeignKey', 'ForeignKey', (['"""portfolios.id"""'], {}), "('portfolios.id')\n", (3368, 3385), False, 'from sqlalchemy import Column, String, ForeignKey, Float, Integer, DateTime, Boolean\n'), ((3821, 3855), 'sqlalchemy.ForeignKey', 'ForeignKey', (['"""account_positions.id"""'], {}), "('account_positions.id')\n", (3831, 3855), False, 'from sqlalchemy import Column, String, ForeignKey, Float, Integer, DateTime, Boolean\n'), ((3898, 3930), 'sqlalchemy.ForeignKey', 'ForeignKey', (['"""model_positions.id"""'], {}), "('model_positions.id')\n", (3908, 3930), False, 'from sqlalchemy import Column, String, ForeignKey, Float, Integer, DateTime, Boolean\n'), ((3964, 3987), 'sqlalchemy.ForeignKey', 'ForeignKey', (['"""trades.id"""'], {}), "('trades.id')\n", (3974, 3987), False, 'from sqlalchemy import Column, String, ForeignKey, Float, Integer, DateTime, Boolean\n'), ((1856, 1888), 'sqlalchemy.orm.backref', 'backref', (['"""users"""'], {'lazy': '"""dynamic"""'}), "('users', lazy='dynamic')\n", (1863, 1888), False, 'from sqlalchemy.orm import relationship, backref\n')]
import FWCore.ParameterSet.Config as cms from Configuration.Eras.Modifier_run2_common_cff import run2_common from Configuration.Eras.Modifier_run2_25ns_specific_cff import run2_25ns_specific from Configuration.Eras.Modifier_stage2L1Trigger_cff import stage2L1Trigger from Configuration.Eras.Modifier_ctpps_2016_cff import ctpps_2016 from Configuration.Eras.Modifier_run2_jme_2016_cff import run2_jme_2016 Run2_2016 = cms.ModifierChain(run2_common, run2_25ns_specific, stage2L1Trigger, ctpps_2016, run2_jme_2016)
[ "FWCore.ParameterSet.Config.ModifierChain" ]
[((419, 517), 'FWCore.ParameterSet.Config.ModifierChain', 'cms.ModifierChain', (['run2_common', 'run2_25ns_specific', 'stage2L1Trigger', 'ctpps_2016', 'run2_jme_2016'], {}), '(run2_common, run2_25ns_specific, stage2L1Trigger,\n ctpps_2016, run2_jme_2016)\n', (436, 517), True, 'import FWCore.ParameterSet.Config as cms\n')]
from threading import Thread, Event from .stream import StreamIO from ..buffers import SortingRingBuffer from ..compat import queue class SegmentedStreamWorker(Thread): """The general worker thread. This thread is responsible for queueing up segments in the writer thread. """ def __init__(self, reader): self.closed = False self.reader = reader self.writer = reader.writer self.stream = reader.stream self.session = reader.stream.session self.logger = reader.logger self._last = 0 self._total_threads = self.session.get_option("hls-download-threads") self._wait = None Thread.__init__(self) self.daemon = True def close(self): """Shuts down the thread.""" if not self.closed: self.logger.debug("Closing worker thread") self.closed = True if self._wait: self._wait.set() def wait(self, time): """Pauses the thread for a specified time. Returns False if interrupted by another thread and True if the time runs out normally. """ self._wait = Event() return not self._wait.wait(time) def iter_segments(self): """The iterator that generates segments for the worker thread. Should be overridden by the inheriting class. """ return yield def _distribute_segment(self, segment): # Simple segment delivery to each thread, # a None segment would mean shutdown. if segment is None: for thread in self.writer: thread.put(segment) return self.writer[self._last].put(segment) if self._last == (self._total_threads - 1): self._last = 0 else: self._last += 1 def run(self): for segment in self.iter_segments(): self._distribute_segment(segment) # End of stream, tells the writer to exit self._distribute_segment(None) self.close() class SegmentedStreamWriter(Thread): """The writer thread. This thread is responsible for fetching segments, processing them and finally writing the data to the buffer. """ def __init__(self, reader, size=10): self.closed = False self.queue = queue.Queue(size) self.reader = reader self.stream = reader.stream self.session = reader.stream.session self.logger = reader.logger Thread.__init__(self) self.daemon = True def close(self): """Shuts down the thread.""" if not self.closed: self.logger.debug("Closing writer thread") self.closed = True self.reader.buffer.close() def put(self, segment): """Add a segment to the queue.""" while not self.closed: try: self.queue.put(segment, block=True, timeout=1) break except queue.Full: continue def write(self, segment): """Write the segment to the buffer. Should be overridden by the inheriting class. """ pass def run(self): while not self.closed: try: segment = self.queue.get(block=True, timeout=0.5) except queue.Empty: continue if segment is not None: self.write(segment) else: break self.close() class SegmentedStreamReader(StreamIO): __worker__ = SegmentedStreamWorker __writer__ = SegmentedStreamWriter def __init__(self, stream, timeout=60): StreamIO.__init__(self) self.session = stream.session self.stream = stream self.timeout = timeout self.writer = [] def open(self): buffer_size = self.session.get_option("ringbuffer-size") downloader_threads = self.session.get_option("hls-download-threads") self.buffer = SortingRingBuffer(buffer_size) for i in range(downloader_threads): self.writer.append(self.__writer__(self)) self.worker = self.__worker__(self) for thread in self.writer: thread.start() self.worker.start() def close(self): self.worker.close() for thread in self.writer: thread.close() for thread in [self.worker] + self.writer: if thread.is_alive(): thread.join() self.buffer.close() def _any_alive(self): # return is_alive() for any writer thread that's still running. alive = False for thread in self.writer: if not alive: alive = thread.is_alive() return alive def read(self, size): if not self.buffer: return b"" return self.buffer.read(size, block=self._any_alive(), timeout=self.timeout)
[ "threading.Thread.__init__", "threading.Event" ]
[((678, 699), 'threading.Thread.__init__', 'Thread.__init__', (['self'], {}), '(self)\n', (693, 699), False, 'from threading import Thread, Event\n'), ((1164, 1171), 'threading.Event', 'Event', ([], {}), '()\n', (1169, 1171), False, 'from threading import Thread, Event\n'), ((2518, 2539), 'threading.Thread.__init__', 'Thread.__init__', (['self'], {}), '(self)\n', (2533, 2539), False, 'from threading import Thread, Event\n')]
#!/usr/bin/env python3 import itertools from docs import εὕρηκα def render_graph(𝛹): color_palette = ["#72e5ef", "#fb2076", "#69ef7b", "#f365e7", "#54a32f", "#bf9fff", "#c0e15c", "#753fc2", "#e78607", "#8a0458", "#1c5e39", "#e46981", "#509f87", "#db3c18", "#18519b", "#f2d174"] def hex_format(𝑎): return f"{𝑎:02x}" def render_node(𝑎): color = color_palette[𝛹.index(𝑎)] print(f'"{hex_format(𝑎)}" [style="filled" fillcolor="{color}" color="{color}" fontcolor="{color}"]') def render_edge(𝑎, 𝑏): color = color_palette[𝛹.index(𝑎)] print(f'"{hex_format(𝑎)}" -> "{hex_format(𝑏)}" [arrowsize=0.4 color="{color}"];') print('strict digraph {') print('layout=circo pad=0.2 mindist=1.8') for 𝑥 in 𝛹: render_node(𝑥) for 𝑎, 𝑏, 𝑐 in itertools.product(𝛹, repeat=3): 𝑥 = 𝑎 ^ 𝑏 ^ 𝑐 render_edge(𝑎, 𝑥) render_edge(𝑏, 𝑥) render_edge(𝑐, 𝑥) print('}') if __name__ == "__main__": 𝛹 = εὕρηκα.get_magic_numbers() render_graph(𝛹)
[ "docs.εὕρηκα.get_magic_numbers", "itertools.product" ]
[((878, 908), 'itertools.product', 'itertools.product', (['Ψ'], {'repeat': '(3)'}), '(Ψ, repeat=3)\n', (895, 908), False, 'import itertools\n'), ((1056, 1082), 'docs.εὕρηκα.get_magic_numbers', 'εὕρηκα.get_magic_numbers', ([], {}), '()\n', (1080, 1082), False, 'from docs import εὕρηκα\n')]
import shutil import pytest # noqa from pytest_factoryboy import register from atv.tests.conftest import * # noqa from services.tests.conftest import * # noqa from users.tests.conftest import * # noqa from .factories import AttachmentFactory, DocumentFactory @pytest.fixture(autouse=True) def custom_media_dir_for_files(settings, request): settings.MEDIA_ROOT = "test_media" # Teardown to remove the uploaded test files from the system def remove_uploaded_files(): shutil.rmtree("test_media", ignore_errors=True) request.addfinalizer(remove_uploaded_files) register(DocumentFactory) register(AttachmentFactory)
[ "shutil.rmtree", "pytest.fixture", "pytest_factoryboy.register" ]
[((269, 297), 'pytest.fixture', 'pytest.fixture', ([], {'autouse': '(True)'}), '(autouse=True)\n', (283, 297), False, 'import pytest\n'), ((594, 619), 'pytest_factoryboy.register', 'register', (['DocumentFactory'], {}), '(DocumentFactory)\n', (602, 619), False, 'from pytest_factoryboy import register\n'), ((620, 647), 'pytest_factoryboy.register', 'register', (['AttachmentFactory'], {}), '(AttachmentFactory)\n', (628, 647), False, 'from pytest_factoryboy import register\n'), ((495, 542), 'shutil.rmtree', 'shutil.rmtree', (['"""test_media"""'], {'ignore_errors': '(True)'}), "('test_media', ignore_errors=True)\n", (508, 542), False, 'import shutil\n')]
import math from torch.optim.lr_scheduler import _LRScheduler class CosineAnnealingWithRestartsLR(_LRScheduler): """Set the learning rate of each parameter group using a cosine annealing schedule, where :math:`\eta_{max}` is set to the initial lr and :math:`T_{cur}` is the number of epochs since the last restart in SGDR: .. math:: \eta_t = \eta_{min} + \frac{1}{2}(\eta_{max} - \eta_{min})(1 + \cos(\frac{T_{cur}}{T_{max}}\pi)) When last_epoch=-1, sets initial lr as lr. It has been proposed in `SGDR: Stochastic Gradient Descent with Warm Restarts`_. This implements the cosine annealing part of SGDR, the restarts and number of iterations multiplier. Args: optimizer (Optimizer): Wrapped optimizer. T_max (int): Maximum number of iterations. T_mult (float): Multiply T_max by this number after each restart. Default: 1. eta_min (float): Minimum learning rate. Default: 0. last_epoch (int): The index of last epoch. Default: -1. .. _SGDR\: Stochastic Gradient Descent with Warm Restarts: https://arxiv.org/abs/1608.03983 """ def __init__(self, optimizer, T_max, eta_min=0, last_epoch=-1, T_mult=1): self.T_max = T_max self.T_mult = T_mult self.restart_every = T_max self.eta_min = eta_min self.restarts = 0 self.restarted_at = 0 super().__init__(optimizer, last_epoch) def restart(self): self.restart_every *= self.T_mult self.restarted_at = self.last_epoch def cosine(self, base_lr): return self.eta_min + (base_lr - self.eta_min) * (1 + math.cos(math.pi * self.step_n / self.restart_every)) / 2 @property def step_n(self): return self.last_epoch - self.restarted_at def get_lr(self): if self.step_n >= self.restart_every: self.restart() return [self.cosine(base_lr) for base_lr in self.base_lrs] def get_weight_decay(self): return [self.cosine(base_weight_decay) if base_weight_decay else None for base_weight_decay in self.base_weight_decays]
[ "math.cos" ]
[((1648, 1700), 'math.cos', 'math.cos', (['(math.pi * self.step_n / self.restart_every)'], {}), '(math.pi * self.step_n / self.restart_every)\n', (1656, 1700), False, 'import math\n')]
from layered_vision.utils.dist import get_required_and_extras class TestGetRequiredAndExtras: def test_should_group_single_requirement(self): assert get_required_and_extras( [('req1==1.2.3', ['group1'])] ) == ( [], {'group1': ['req1==1.2.3'], 'all': ['req1==1.2.3']} ) def test_should_fallback_to_default(self): assert get_required_and_extras( [('req1==1.2.3', [None])] ) == ( ['req1==1.2.3'], {'all': ['req1==1.2.3']} ) def test_should_group_multiple_requirement(self): assert get_required_and_extras( [('req1==1.2.3', ['group1']), ('req2==1.2.3', ['group2']), ('req3==1.2.3', [None])] ) == ( ['req3==1.2.3'], { 'group1': ['req1==1.2.3'], 'group2': ['req2==1.2.3'], 'all': ['req1==1.2.3', 'req2==1.2.3', 'req3==1.2.3'] } )
[ "layered_vision.utils.dist.get_required_and_extras" ]
[((163, 217), 'layered_vision.utils.dist.get_required_and_extras', 'get_required_and_extras', (["[('req1==1.2.3', ['group1'])]"], {}), "([('req1==1.2.3', ['group1'])])\n", (186, 217), False, 'from layered_vision.utils.dist import get_required_and_extras\n'), ((398, 448), 'layered_vision.utils.dist.get_required_and_extras', 'get_required_and_extras', (["[('req1==1.2.3', [None])]"], {}), "([('req1==1.2.3', [None])])\n", (421, 448), False, 'from layered_vision.utils.dist import get_required_and_extras\n'), ((622, 735), 'layered_vision.utils.dist.get_required_and_extras', 'get_required_and_extras', (["[('req1==1.2.3', ['group1']), ('req2==1.2.3', ['group2']), ('req3==1.2.3',\n [None])]"], {}), "([('req1==1.2.3', ['group1']), ('req2==1.2.3', [\n 'group2']), ('req3==1.2.3', [None])])\n", (645, 735), False, 'from layered_vision.utils.dist import get_required_and_extras\n')]
# more or less the same simulation, but split up in to chunks that fit into memory # for large states (CA, IA, KS, OK, TX) # chunks of size 2000 (2000 locations in one part calculated and create temporary file) location_chunk = 2000 import argparse import datetime import glob import math import numpy as np import os import rasterio import statsmodels.api as sm import pandas as pd import statsmodels.api as sm import time import xarray as xr import sys sys.path.append('../') from functools import reduce from matplotlib import pyplot as plt from scipy.interpolate import interp1d from utils import windpower_simulation_era5_large from dask.diagnostics import ProgressBar ProgressBar().register() from paths_usa import * # get state and GWA version parser = argparse.ArgumentParser(description='Insert state and optionally GWA') parser.add_argument('-state') parser.add_argument('-GWA') args = parser.parse_args() state = args.state if(args.GWA == None): GWA = "3" else: GWA = args.GWA if GWA == "2": results_path = results_path + '/results_GWA2' if not os.path.exists(results_path): os.mkdir(results_path) startGWA = '1987' endGWA = '2016' else: startGWA = '2008' endGWA = '2017' # define start date for simulation startyearmonth = '2000-12' outfile = results_path + '/windpower_??_ERA5_GWA.nc' if results_path + '/windpower_' + state + '_ERA5_GWA.nc' not in glob.glob(outfile): wind = xr.open_mfdataset(era_path + "/eff_ws/era5_wind_USA_*.nc", chunks = {'time': 38}) alpha = xr.open_mfdataset(era_path + "/eff_ws/era5_alpha_USA_*.nc", chunks = {'time': 38}) # with GWA turbine_data_era_gwa = pd.read_csv(usa_path + '/turbine_data_era_gwa' + GWA + '.csv', parse_dates=['commissioning']) if GWA == "3": if state == 'PR': GWA = xr.open_rasterio(usa_path+'/GWA/GWA3_PR100m.tif') else: GWA = xr.open_rasterio(usa_path+'/GWA/GWA3_USA100m.tif') else: if state == 'AK': GWA = xr.open_rasterio(usa_path+'/GWA/GWA_AK100m.tif') elif state == 'HI': GWA = xr.open_rasterio(usa_path+'/GWA/GWA_HI100m.tif') elif state == 'PR': GWA = xr.open_rasterio(usa_path+'/GWA/GWA_PR100m.tif') else: GWA = xr.open_rasterio(usa_path+'/GWA/GWA_USA100m.tif') ind = turbine_data_era_gwa.state == state print('calculating ERA5 ' + state + ' GWA') t1 = time.time() # number of locations in state dat_len = sum(ind) numit = round(dat_len/location_chunk+0.5) # number of necessary iterations i1 = 0 i2 = i1 + location_chunk for it in range(numit): outfile_temp = results_path + "/wp_"+state+"_ERA5_GWA_temp" + str(it+1) +".nc" if i2 > dat_len: i2 = dat_len if outfile_temp not in glob.glob(results_path + "/wp_"+state+"_ERA5_GWA_temp*.nc"): wps = windpower_simulation_era5_large(wind.wh100, alpha.alpha, turbine_data_era_gwa.height[ind].values[i1:i2], turbine_data_era_gwa.capacity[ind].values[i1:i2], turbine_data_era_gwa.sp[ind].values[i1:i2], turbine_data_era_gwa.lon[ind].values[i1:i2], turbine_data_era_gwa.lat[ind].values[i1:i2], pd.to_datetime(turbine_data_era_gwa.commissioning[ind].values[i1:i2]).year.values, startyearmonth, GWA, startGWA, endGWA) # adapt numbers of locations in dataset wps = wps.assign_coords(location = np.arange(i1,i2)) # save temporary file print('saving to '+results_path + "/wp_"+state+"_ERA5_GWA_temp" + str(it+1) +".nc") wps.to_dataset(name='wp').to_netcdf(results_path + "/wp_"+state+"_ERA5_GWA_temp" + str(it+1) +".nc") print('saved to '+results_path + "/wp_"+state+"_ERA5_GWA_temp" + str(it+1) +".nc") wps.close() del(wps) i1 = i2 i2 = i2 + location_chunk print(round(i1/dat_len,3)*100,'% done in ',state) # merge and delete temporary files wps = xr.open_mfdataset(results_path + "/wp_"+state+"_ERA5_GWA_temp*.nc", chunks = {'time': 100}) print('saving to'+results_path + "/windpower_"+state+"_ERA5_GWA.nc") wps.drop(['x','y']).to_netcdf(results_path + "/windpower_"+state+"_ERA5_GWA.nc") print('saved to '+results_path + "/windpower_"+state+"_ERA5_GWA.nc") t2 = time.time() # remove temporary files for file in glob.glob(results_path + "/wp_"+state+"_ERA5_GWA_temp*.nc"): os.remove(file) print(t2-t1)
[ "sys.path.append", "os.mkdir", "os.remove", "argparse.ArgumentParser", "pandas.read_csv", "xarray.open_rasterio", "os.path.exists", "time.time", "dask.diagnostics.ProgressBar", "numpy.arange", "pandas.to_datetime", "glob.glob", "xarray.open_mfdataset" ]
[((457, 479), 'sys.path.append', 'sys.path.append', (['"""../"""'], {}), "('../')\n", (472, 479), False, 'import sys\n'), ((766, 836), 'argparse.ArgumentParser', 'argparse.ArgumentParser', ([], {'description': '"""Insert state and optionally GWA"""'}), "(description='Insert state and optionally GWA')\n", (789, 836), False, 'import argparse\n'), ((1410, 1428), 'glob.glob', 'glob.glob', (['outfile'], {}), '(outfile)\n', (1419, 1428), False, 'import glob\n'), ((1442, 1521), 'xarray.open_mfdataset', 'xr.open_mfdataset', (["(era_path + '/eff_ws/era5_wind_USA_*.nc')"], {'chunks': "{'time': 38}"}), "(era_path + '/eff_ws/era5_wind_USA_*.nc', chunks={'time': 38})\n", (1459, 1521), True, 'import xarray as xr\n'), ((1536, 1621), 'xarray.open_mfdataset', 'xr.open_mfdataset', (["(era_path + '/eff_ws/era5_alpha_USA_*.nc')"], {'chunks': "{'time': 38}"}), "(era_path + '/eff_ws/era5_alpha_USA_*.nc', chunks={'time': 38}\n )\n", (1553, 1621), True, 'import xarray as xr\n'), ((1661, 1759), 'pandas.read_csv', 'pd.read_csv', (["(usa_path + '/turbine_data_era_gwa' + GWA + '.csv')"], {'parse_dates': "['commissioning']"}), "(usa_path + '/turbine_data_era_gwa' + GWA + '.csv', parse_dates=\n ['commissioning'])\n", (1672, 1759), True, 'import pandas as pd\n'), ((2431, 2442), 'time.time', 'time.time', ([], {}), '()\n', (2440, 2442), False, 'import time\n'), ((4574, 4671), 'xarray.open_mfdataset', 'xr.open_mfdataset', (["(results_path + '/wp_' + state + '_ERA5_GWA_temp*.nc')"], {'chunks': "{'time': 100}"}), "(results_path + '/wp_' + state + '_ERA5_GWA_temp*.nc',\n chunks={'time': 100})\n", (4591, 4671), True, 'import xarray as xr\n'), ((4926, 4937), 'time.time', 'time.time', ([], {}), '()\n', (4935, 4937), False, 'import time\n'), ((4988, 5051), 'glob.glob', 'glob.glob', (["(results_path + '/wp_' + state + '_ERA5_GWA_temp*.nc')"], {}), "(results_path + '/wp_' + state + '_ERA5_GWA_temp*.nc')\n", (4997, 5051), False, 'import glob\n'), ((678, 691), 'dask.diagnostics.ProgressBar', 'ProgressBar', ([], {}), '()\n', (689, 691), False, 'from dask.diagnostics import ProgressBar\n'), ((1079, 1107), 'os.path.exists', 'os.path.exists', (['results_path'], {}), '(results_path)\n', (1093, 1107), False, 'import os\n'), ((1117, 1139), 'os.mkdir', 'os.mkdir', (['results_path'], {}), '(results_path)\n', (1125, 1139), False, 'import os\n'), ((5057, 5072), 'os.remove', 'os.remove', (['file'], {}), '(file)\n', (5066, 5072), False, 'import os\n'), ((1818, 1869), 'xarray.open_rasterio', 'xr.open_rasterio', (["(usa_path + '/GWA/GWA3_PR100m.tif')"], {}), "(usa_path + '/GWA/GWA3_PR100m.tif')\n", (1834, 1869), True, 'import xarray as xr\n'), ((1900, 1952), 'xarray.open_rasterio', 'xr.open_rasterio', (["(usa_path + '/GWA/GWA3_USA100m.tif')"], {}), "(usa_path + '/GWA/GWA3_USA100m.tif')\n", (1916, 1952), True, 'import xarray as xr\n'), ((2005, 2055), 'xarray.open_rasterio', 'xr.open_rasterio', (["(usa_path + '/GWA/GWA_AK100m.tif')"], {}), "(usa_path + '/GWA/GWA_AK100m.tif')\n", (2021, 2055), True, 'import xarray as xr\n'), ((2816, 2879), 'glob.glob', 'glob.glob', (["(results_path + '/wp_' + state + '_ERA5_GWA_temp*.nc')"], {}), "(results_path + '/wp_' + state + '_ERA5_GWA_temp*.nc')\n", (2825, 2879), False, 'import glob\n'), ((2100, 2150), 'xarray.open_rasterio', 'xr.open_rasterio', (["(usa_path + '/GWA/GWA_HI100m.tif')"], {}), "(usa_path + '/GWA/GWA_HI100m.tif')\n", (2116, 2150), True, 'import xarray as xr\n'), ((2195, 2245), 'xarray.open_rasterio', 'xr.open_rasterio', (["(usa_path + '/GWA/GWA_PR100m.tif')"], {}), "(usa_path + '/GWA/GWA_PR100m.tif')\n", (2211, 2245), True, 'import xarray as xr\n'), ((2276, 2327), 'xarray.open_rasterio', 'xr.open_rasterio', (["(usa_path + '/GWA/GWA_USA100m.tif')"], {}), "(usa_path + '/GWA/GWA_USA100m.tif')\n", (2292, 2327), True, 'import xarray as xr\n'), ((3955, 3972), 'numpy.arange', 'np.arange', (['i1', 'i2'], {}), '(i1, i2)\n', (3964, 3972), True, 'import numpy as np\n'), ((3534, 3603), 'pandas.to_datetime', 'pd.to_datetime', (['turbine_data_era_gwa.commissioning[ind].values[i1:i2]'], {}), '(turbine_data_era_gwa.commissioning[ind].values[i1:i2])\n', (3548, 3603), True, 'import pandas as pd\n')]
""" tcp连接接收数据 """ # TCPclient.py import socket class TcpClient: def __init__(self): self.target_host = "192.168.3.11" # 服务器端地址 self.target_port = 3389 # 必须与服务器的端口号一致 def start(self): while True: client = socket.socket(socket.AF_INET,socket.SOCK_STREAM) client.connect((self.target_host,self.target_port)) data = input(">") if not data: break client.send(data.encode()) response = client.recv(1024) print(response) client.close() if __name__ == '__main__': obj = TcpClient() obj.start() # # # import socket # import threading # client_list = [] # def read_server(client_socket): # while True: # content = client_socket.recv(2048).decode('UTF-8') # if content is not None: # print("content:",content) # # client_socket = socket.socket(socket.AF_INET,socket.SOCK_STREAM) # ## 绑定USR-K7 开启的IP地址和端口号 # client_socket.connect(('192.168.0.7',23)) # threading.Thread(target=read_server,args=(client_socket,)).start() # while True: # line = input('') # if line is None or line =='exit': # break # client_socket.send(line.encode("UTF-8"))
[ "socket.socket" ]
[((256, 305), 'socket.socket', 'socket.socket', (['socket.AF_INET', 'socket.SOCK_STREAM'], {}), '(socket.AF_INET, socket.SOCK_STREAM)\n', (269, 305), False, 'import socket\n')]
from django.contrib import admin from django.urls import path, include from . import views urlpatterns = [ path('', views.home, name='home'), path('news', views.news, name='flash_info'), path('login', views.login_view, name='login'), path('logout', views.logout_view, name='logout'), path('articles/<int:id>', views.article), # path('qui', views.qui, name='qui'), # path('pourquoi', views.pourquoi, name='pourquoi'), ]
[ "django.urls.path" ]
[((114, 147), 'django.urls.path', 'path', (['""""""', 'views.home'], {'name': '"""home"""'}), "('', views.home, name='home')\n", (118, 147), False, 'from django.urls import path, include\n'), ((153, 196), 'django.urls.path', 'path', (['"""news"""', 'views.news'], {'name': '"""flash_info"""'}), "('news', views.news, name='flash_info')\n", (157, 196), False, 'from django.urls import path, include\n'), ((202, 247), 'django.urls.path', 'path', (['"""login"""', 'views.login_view'], {'name': '"""login"""'}), "('login', views.login_view, name='login')\n", (206, 247), False, 'from django.urls import path, include\n'), ((253, 301), 'django.urls.path', 'path', (['"""logout"""', 'views.logout_view'], {'name': '"""logout"""'}), "('logout', views.logout_view, name='logout')\n", (257, 301), False, 'from django.urls import path, include\n'), ((307, 347), 'django.urls.path', 'path', (['"""articles/<int:id>"""', 'views.article'], {}), "('articles/<int:id>', views.article)\n", (311, 347), False, 'from django.urls import path, include\n')]
"""OVK learning, unit tests. The :mod:`sklearn.tests.test_semisuo` tests semisup module. """ import operalib as ovk import numpy as np def test_semisup_linop(): """Test ovk.semisup.SemisupLinop.""" np.random.seed() n = 100 p = 5 lbda2 = .1 # supervised indices B = np.random.randint(2, size=(n)).astype(np.bool) # Graph Laplacian n_unsup = np.sum(~B) L = np.random.randn(n_unsup, n_unsup) L = np.dot(L, L.T) U, J = ovk.ridge._SemisupLinop(lbda2, B, L, p).gen() y = np.random.randn(n, p) # lbda2 * np.dot(L, y[~B, :]).ravel() # print(np.concatenate((y[B, :].ravel(), # lbda2 * np.dot(L, y[~B, :]).ravel()))) res = np.empty((n, p)) res[B, :] = y[B, :] res[~B] = 0 assert np.allclose(J * y.ravel(), res.ravel()) res = np.empty((n, p)) res[B, :] = y[B, :] res[~B] = lbda2 * np.dot(L, y[~B, :]) assert np.allclose(U * y.ravel(), res.ravel())
[ "numpy.random.seed", "numpy.sum", "numpy.random.randn", "numpy.empty", "numpy.random.randint", "numpy.dot", "operalib.ridge._SemisupLinop" ]
[((210, 226), 'numpy.random.seed', 'np.random.seed', ([], {}), '()\n', (224, 226), True, 'import numpy as np\n'), ((383, 393), 'numpy.sum', 'np.sum', (['(~B)'], {}), '(~B)\n', (389, 393), True, 'import numpy as np\n'), ((402, 435), 'numpy.random.randn', 'np.random.randn', (['n_unsup', 'n_unsup'], {}), '(n_unsup, n_unsup)\n', (417, 435), True, 'import numpy as np\n'), ((444, 458), 'numpy.dot', 'np.dot', (['L', 'L.T'], {}), '(L, L.T)\n', (450, 458), True, 'import numpy as np\n'), ((526, 547), 'numpy.random.randn', 'np.random.randn', (['n', 'p'], {}), '(n, p)\n', (541, 547), True, 'import numpy as np\n'), ((713, 729), 'numpy.empty', 'np.empty', (['(n, p)'], {}), '((n, p))\n', (721, 729), True, 'import numpy as np\n'), ((832, 848), 'numpy.empty', 'np.empty', (['(n, p)'], {}), '((n, p))\n', (840, 848), True, 'import numpy as np\n'), ((895, 914), 'numpy.dot', 'np.dot', (['L', 'y[~B, :]'], {}), '(L, y[~B, :])\n', (901, 914), True, 'import numpy as np\n'), ((299, 327), 'numpy.random.randint', 'np.random.randint', (['(2)'], {'size': 'n'}), '(2, size=n)\n', (316, 327), True, 'import numpy as np\n'), ((471, 510), 'operalib.ridge._SemisupLinop', 'ovk.ridge._SemisupLinop', (['lbda2', 'B', 'L', 'p'], {}), '(lbda2, B, L, p)\n', (494, 510), True, 'import operalib as ovk\n')]
import canmatrix.formats from canmatrix.canmatrix import CanId def list_pgn(db): """ :param db: :return: pgn and id """ id = [x.Id for x in db.frames] r = [CanId(t).tuples() for t in id] return [t[1] for t in r], id def ids_sharing_same_pgn(id_x, pgn_x, id_y, pgn_y): for idx, pgnx in zip(id_x, pgn_x): for idy, pgny in zip(id_y, pgn_y): if pgnx == pgny: yield (idx, idy) def join_frame_by_signal_startbit(files): targetDb = next(iter(canmatrix.formats.loadp(files.pop(0)).values())) pgn_x, id_x = list_pgn(db=targetDb) for f in files: sourceDb = next(iter(canmatrix.formats.loadp(f).values())) pgn_y, id_y = list_pgn(db=sourceDb) same_pgn = ids_sharing_same_pgn(id_x, pgn_x, id_y, pgn_y) for idx, idy in same_pgn: # print("{0:#x} {1:#x}".format(idx, idy)) targetFr = targetDb.frameById(idx) sourceFr = sourceDb.frameById(idy) to_add = [] for sig_t in targetFr.signals: for sig_s in sourceFr.signals: # print(sig.name) if sig_t.startbit == sig_s.startbit: # print("\t{0} {1}".format(sig_t.name, sig_s.name)) to_add.append(sig_s) for s in to_add: targetFr.addSignal(s) return targetDb def renameFrameWithID(sourceDb): for frameSc in sourceDb.frames: _, pgn, sa = CanId(frameSc.Id).tuples() exten = "__{pgn:#04X}_{sa:#02X}_{sa:03d}d".format(pgn=pgn, sa=sa) new_name = frameSc.name + exten # print(new_name) frameSc.name = new_name def renameFrameWithSAEacronyme(sourceDb, targetDb): pgn_x, id_x = list_pgn(db=targetDb) pgn_y, id_y = list_pgn(db=sourceDb) same_pgn = ids_sharing_same_pgn(id_x, pgn_x, id_y, pgn_y) for idx, idy in same_pgn: targetFr = targetDb.frameById(idx) sourceFr = sourceDb.frameById(idy) new_name = sourceFr.name + "__" + targetFr.name targetFr.name = new_name def join_frame_for_manufacturer(db, files): #targetDb = next(iter(im.importany(files.pop(0)).values())) pgn_x, id_x = list_pgn(db=db) for f in files: sourceDb = next(iter(canmatrix.formats.loadp(f).values())) pgn_y, id_y = list_pgn(db=sourceDb) same_pgn = ids_sharing_same_pgn(id_x, pgn_x, id_y, pgn_y) for idx, idy in same_pgn: # print("{0:#x} {1:#x}".format(idx, idy)) targetFr = db.frameById(idx) sourceFr = sourceDb.frameById(idy) _, pgn, sa = CanId(targetFr.Id).tuples() if(sa < 128): print('less', targetFr.name) to_add = [] for sig_s in sourceFr.signals: new_name = "{name}_{pgn:#04x}_{sa:03}".format( name=sig_s.name, pgn=pgn, sa=sa) sig_s.name = new_name to_add.append(sig_s) for s in to_add: targetFr.addSignal(s)
[ "canmatrix.canmatrix.CanId" ]
[((183, 191), 'canmatrix.canmatrix.CanId', 'CanId', (['t'], {}), '(t)\n', (188, 191), False, 'from canmatrix.canmatrix import CanId\n'), ((1497, 1514), 'canmatrix.canmatrix.CanId', 'CanId', (['frameSc.Id'], {}), '(frameSc.Id)\n', (1502, 1514), False, 'from canmatrix.canmatrix import CanId\n'), ((2647, 2665), 'canmatrix.canmatrix.CanId', 'CanId', (['targetFr.Id'], {}), '(targetFr.Id)\n', (2652, 2665), False, 'from canmatrix.canmatrix import CanId\n')]
# /usr/bin/env python3 import numpy as np def operadores(): a=np.random.randint(3,10,size=10) b=np.random.randint(4,78,size=10) print(np.add(a,b)) print(np.subtract(b,a)) print(np.negative(a,b)) print(np.multiply(a,b)) print(np.divide(a,b)) print(np.floor_divide(b,a)) print(np.power(b,a)) print(np.mod(b,a)) #funion abs #abs() : integrada en python #np.abs() o np.absolute() : integrada en numpy if __name__=="__main__": operadores()
[ "numpy.divide", "numpy.multiply", "numpy.subtract", "numpy.floor_divide", "numpy.power", "numpy.negative", "numpy.mod", "numpy.random.randint", "numpy.add" ]
[((69, 102), 'numpy.random.randint', 'np.random.randint', (['(3)', '(10)'], {'size': '(10)'}), '(3, 10, size=10)\n', (86, 102), True, 'import numpy as np\n'), ((108, 141), 'numpy.random.randint', 'np.random.randint', (['(4)', '(78)'], {'size': '(10)'}), '(4, 78, size=10)\n', (125, 141), True, 'import numpy as np\n'), ((151, 163), 'numpy.add', 'np.add', (['a', 'b'], {}), '(a, b)\n', (157, 163), True, 'import numpy as np\n'), ((175, 192), 'numpy.subtract', 'np.subtract', (['b', 'a'], {}), '(b, a)\n', (186, 192), True, 'import numpy as np\n'), ((204, 221), 'numpy.negative', 'np.negative', (['a', 'b'], {}), '(a, b)\n', (215, 221), True, 'import numpy as np\n'), ((233, 250), 'numpy.multiply', 'np.multiply', (['a', 'b'], {}), '(a, b)\n', (244, 250), True, 'import numpy as np\n'), ((262, 277), 'numpy.divide', 'np.divide', (['a', 'b'], {}), '(a, b)\n', (271, 277), True, 'import numpy as np\n'), ((289, 310), 'numpy.floor_divide', 'np.floor_divide', (['b', 'a'], {}), '(b, a)\n', (304, 310), True, 'import numpy as np\n'), ((322, 336), 'numpy.power', 'np.power', (['b', 'a'], {}), '(b, a)\n', (330, 336), True, 'import numpy as np\n'), ((348, 360), 'numpy.mod', 'np.mod', (['b', 'a'], {}), '(b, a)\n', (354, 360), True, 'import numpy as np\n')]
from django.urls import path from . import views urlpatterns = [ path('rt_value', views.get_rt_value), path('generate_json',views.generate_json), path('latest_rt_value', views.latest_rt), path('before_15_rt', views.before_15_rt), path('doubling_growth_value', views.doubling_growth_data), path('latest_doubling_value', views.latest_doubling_value), path('get_percentages', views.get_percentages), path('get_comparison_doubling', views.get_comparison_doubling), path('get_comparison_growth', views.get_comparison_growth), ]
[ "django.urls.path" ]
[((71, 107), 'django.urls.path', 'path', (['"""rt_value"""', 'views.get_rt_value'], {}), "('rt_value', views.get_rt_value)\n", (75, 107), False, 'from django.urls import path\n'), ((113, 155), 'django.urls.path', 'path', (['"""generate_json"""', 'views.generate_json'], {}), "('generate_json', views.generate_json)\n", (117, 155), False, 'from django.urls import path\n'), ((160, 200), 'django.urls.path', 'path', (['"""latest_rt_value"""', 'views.latest_rt'], {}), "('latest_rt_value', views.latest_rt)\n", (164, 200), False, 'from django.urls import path\n'), ((206, 246), 'django.urls.path', 'path', (['"""before_15_rt"""', 'views.before_15_rt'], {}), "('before_15_rt', views.before_15_rt)\n", (210, 246), False, 'from django.urls import path\n'), ((252, 309), 'django.urls.path', 'path', (['"""doubling_growth_value"""', 'views.doubling_growth_data'], {}), "('doubling_growth_value', views.doubling_growth_data)\n", (256, 309), False, 'from django.urls import path\n'), ((315, 373), 'django.urls.path', 'path', (['"""latest_doubling_value"""', 'views.latest_doubling_value'], {}), "('latest_doubling_value', views.latest_doubling_value)\n", (319, 373), False, 'from django.urls import path\n'), ((379, 425), 'django.urls.path', 'path', (['"""get_percentages"""', 'views.get_percentages'], {}), "('get_percentages', views.get_percentages)\n", (383, 425), False, 'from django.urls import path\n'), ((431, 493), 'django.urls.path', 'path', (['"""get_comparison_doubling"""', 'views.get_comparison_doubling'], {}), "('get_comparison_doubling', views.get_comparison_doubling)\n", (435, 493), False, 'from django.urls import path\n'), ((499, 557), 'django.urls.path', 'path', (['"""get_comparison_growth"""', 'views.get_comparison_growth'], {}), "('get_comparison_growth', views.get_comparison_growth)\n", (503, 557), False, 'from django.urls import path\n')]
# coding:utf8 import json import os import re import requests STOCK_CODE_PATH = 'stock_codes.conf' def update_stock_codes(): """获取所有股票 ID 到 all_stock_code 目录下""" all_stock_codes_url = 'http://www.shdjt.com/js/lib/astock.js' grep_stock_codes = re.compile('~(\d+)`') response = requests.get(all_stock_codes_url) all_stock_codes = grep_stock_codes.findall(response.text) with open(stock_code_path(), 'w') as f: f.write(json.dumps(dict(stock=all_stock_codes))) def get_stock_codes(realtime=False): """获取所有股票 ID 到 all_stock_code 目录下""" if realtime: all_stock_codes_url = 'http://www.shdjt.com/js/lib/astock.js' grep_stock_codes = re.compile('~(\d+)`') response = requests.get(all_stock_codes_url) stock_codes = grep_stock_codes.findall(response.text) with open(stock_code_path(), 'w') as f: f.write(json.dumps(dict(stock=stock_codes))) return stock_codes else: with open(stock_code_path()) as f: return json.load(f)['stock'] def stock_code_path(): return os.path.join(os.path.dirname(__file__), STOCK_CODE_PATH)
[ "os.path.dirname", "json.load", "requests.get", "re.compile" ]
[((259, 281), 're.compile', 're.compile', (['"""~(\\\\d+)`"""'], {}), "('~(\\\\d+)`')\n", (269, 281), False, 'import re\n'), ((296, 329), 'requests.get', 'requests.get', (['all_stock_codes_url'], {}), '(all_stock_codes_url)\n', (308, 329), False, 'import requests\n'), ((692, 714), 're.compile', 're.compile', (['"""~(\\\\d+)`"""'], {}), "('~(\\\\d+)`')\n", (702, 714), False, 'import re\n'), ((733, 766), 'requests.get', 'requests.get', (['all_stock_codes_url'], {}), '(all_stock_codes_url)\n', (745, 766), False, 'import requests\n'), ((1122, 1147), 'os.path.dirname', 'os.path.dirname', (['__file__'], {}), '(__file__)\n', (1137, 1147), False, 'import os\n'), ((1051, 1063), 'json.load', 'json.load', (['f'], {}), '(f)\n', (1060, 1063), False, 'import json\n')]
# coding: utf-8 import struct from common.constDefine import * from logger.log import logger def send(cmd, proto, session, table=None): result = proto.SerializeToString() fmt = ">iib{0}s".format(len(result)) data = struct.pack(fmt, len(result)+9, cmd, COMMUNICATION_TYPE, result) try: session.transport.write(data) except Exception as e: logger.error(e)
[ "logger.log.logger.error" ]
[((377, 392), 'logger.log.logger.error', 'logger.error', (['e'], {}), '(e)\n', (389, 392), False, 'from logger.log import logger\n')]
import os from pathlib import Path class Config: _10x_eula_cookie_key = "sw-eula-full" @property def ten_x_eula_cookie_key(self) -> str: return type(self)._10x_eula_cookie_key def __init__(self): self.path_home = os.path.join(Path.home(), ".scing") self.path_10x_eula_cfg = os.path.join(self.path_home, "10x-eula.cfg") os.makedirs(self.path_home, exist_ok=True) def write_10x_eula_cookie(self, value: str): with open(self.path_10x_eula_cfg, "wt") as fout: print(value, file=fout) def read_10x_eula_cookie(self) -> str: with open(self.path_10x_eula_cfg, "rt") as fout: value = fout.read().strip() cookies = dict() cookies[self._10x_eula_cookie_key] = value return cookies def has_10x_eula_cookie(self) -> bool: return os.path.exists(self.path_10x_eula_cfg)
[ "pathlib.Path.home", "os.path.join", "os.makedirs", "os.path.exists" ]
[((319, 363), 'os.path.join', 'os.path.join', (['self.path_home', '"""10x-eula.cfg"""'], {}), "(self.path_home, '10x-eula.cfg')\n", (331, 363), False, 'import os\n'), ((372, 414), 'os.makedirs', 'os.makedirs', (['self.path_home'], {'exist_ok': '(True)'}), '(self.path_home, exist_ok=True)\n', (383, 414), False, 'import os\n'), ((869, 907), 'os.path.exists', 'os.path.exists', (['self.path_10x_eula_cfg'], {}), '(self.path_10x_eula_cfg)\n', (883, 907), False, 'import os\n'), ((263, 274), 'pathlib.Path.home', 'Path.home', ([], {}), '()\n', (272, 274), False, 'from pathlib import Path\n')]
import CONFIG import torch import torch.nn as nn class LSTMModel(nn.Module): def __init__( self, vocab_size, embed_dims, hidden_dims, num_layers, dropout, bidirectional, num_pos_class, num_tag_class ): super(LSTMModel, self).__init__() self.embedding = nn.Embedding(vocab_size, embed_dims) self.rnn = nn.GRU( embed_dims, hidden_dims, num_layers=num_layers, batch_first=True, dropout=dropout, bidirectional=bidirectional ) self.dropout = nn.Dropout(dropout) self.hidden_out = hidden_dims*2 if bidirectional else hidden_dims self.pos_out = nn.Linear(self.hidden_out, num_pos_class) self.tag_out = nn.Linear(self.hidden_out, num_tag_class) def forward(self, x): x = self.dropout(self.embedding(x)) x, _ = self.rnn(x) x = self.dropout(x) pos_out = self.pos_out(x) tag_out = self.tag_out(x) return pos_out, tag_out
[ "torch.nn.Dropout", "torch.nn.GRU", "torch.nn.Embedding", "torch.nn.Linear" ]
[((352, 388), 'torch.nn.Embedding', 'nn.Embedding', (['vocab_size', 'embed_dims'], {}), '(vocab_size, embed_dims)\n', (364, 388), True, 'import torch.nn as nn\n'), ((408, 530), 'torch.nn.GRU', 'nn.GRU', (['embed_dims', 'hidden_dims'], {'num_layers': 'num_layers', 'batch_first': '(True)', 'dropout': 'dropout', 'bidirectional': 'bidirectional'}), '(embed_dims, hidden_dims, num_layers=num_layers, batch_first=True,\n dropout=dropout, bidirectional=bidirectional)\n', (414, 530), True, 'import torch.nn as nn\n'), ((632, 651), 'torch.nn.Dropout', 'nn.Dropout', (['dropout'], {}), '(dropout)\n', (642, 651), True, 'import torch.nn as nn\n'), ((749, 790), 'torch.nn.Linear', 'nn.Linear', (['self.hidden_out', 'num_pos_class'], {}), '(self.hidden_out, num_pos_class)\n', (758, 790), True, 'import torch.nn as nn\n'), ((814, 855), 'torch.nn.Linear', 'nn.Linear', (['self.hidden_out', 'num_tag_class'], {}), '(self.hidden_out, num_tag_class)\n', (823, 855), True, 'import torch.nn as nn\n')]
#!/usr/bin/python3 import io import utils from block import Block, BlockHeader with open('../../../usb-decrypted/bitcoin/blocks/blk00001.dat', 'rb') as block_reader: block_reader.seek(0, io.SEEK_END) fSize = block_reader.tell() - 80 block_reader.seek(0, io.SEEK_SET) block = Block(block_reader) block.transactions[1].stdout() print(block.transactions[1].get_bytes().hex()) raw_bytes = block.transactions[1].get_bytes() # The following cryptic code implements this step-to-step guide on # transaction verification: # https://bitcoin.stackexchange.com/questions/72657/signature-verification-in-python-using-compressed-public-key part_one = 4 + 1 + 32 + 4 # 4: Version # 1: Input Count # 32: Prev. hash # 4: Output Index target_bytes = raw_bytes[:part_one] print(f"target_bytes.hex(): {target_bytes.hex()}") target_bytes += bytes.fromhex('1976a914b0d7b19af5aee9a07ef6a147a0ec6a4e1fdf9e7188ac') print(f"target_bytes.hex(): {target_bytes.hex()}") target_bytes += raw_bytes[part_one + 1 + raw_bytes[part_one]:] print(f"target_bytes.hex(): {target_bytes.hex()}") target_bytes += bytes.fromhex('01000000') import hashlib import binascii hashval = binascii.hexlify(hashlib.sha256(target_bytes).digest()) txn_sha256 = bytes.decode(hashval) print("txn_sha256 = %s" % (txn_sha256)) import ecdsa sig_b = bytes.fromhex(block.transactions[1].inputs[0].signature) txn_sha256_b = bytes.fromhex(txn_sha256) vk = ecdsa.VerifyingKey.from_string(bytes.fromhex(block.transactions[1].inputs[0].pubkey),curve=ecdsa.SECP256k1) if vk.verify(sig_b, txn_sha256_b, hashlib.sha256) == True: # True print("Signature is Valid") else: print("Signature is not Valid") #0100000001959af1e21ddcb1fe07a2c8de6c28a1645a3d586c8aa4541b697791f27548ffa3000000001976a914b0d7b19af5aee9a07ef6a147a0ec6a4e1fdf9e7188acffffffff02809dc29c000000001976a9148fb7de32f84e119f6d4d75ecb9ad53dfae51b3a488acc0e27b0e000000001976a9140635412d152fe80abbdf71e73ba569abe28dd92288ac00000000 #0100000001959af1e21ddcb1fe07a2c8de6c28a1645a3d586c8aa4541b697791f27548ffa3000000001976a914b0d7b19af5aee9a07ef6a147a0ec6a4e1fdf9e7188acffffffff02809dc29c000000001976a9148fb7de32f84e119f6d4d75ecb9ad53dfae51b3a488acc0e27b0e000000001976a9140635412d152fe80abbdf71e73ba569abe28dd92288ac0000000001000000
[ "hashlib.sha256", "block.Block" ]
[((287, 306), 'block.Block', 'Block', (['block_reader'], {}), '(block_reader)\n', (292, 306), False, 'from block import Block, BlockHeader\n'), ((1174, 1202), 'hashlib.sha256', 'hashlib.sha256', (['target_bytes'], {}), '(target_bytes)\n', (1188, 1202), False, 'import hashlib\n')]
# -*- coding: utf-8 -*- from collections import OrderedDict from gluon import current from gluon.storage import Storage def config(settings): """ Settings for UCCE: User-Centred Community Engagement A project for Oxfam & Save the Children run with Eclipse Experience """ T = current.T settings.base.system_name = T("User-Centred Community Engagement") settings.base.system_name_short = T("UCCE") # PrePopulate data settings.base.prepopulate.append("UCCE") settings.base.prepopulate_demo.append("UCCE/Demo") # Theme (folder to use for views/layout.html) settings.base.theme = "UCCE" # Custom Logo settings.ui.menu_logo = "/%s/static/themes/UCCE/img/ee_logo.png" % current.request.application # Authentication settings # Should users be allowed to register themselves? #settings.security.self_registration = False # Do new users need to verify their email address? settings.auth.registration_requires_verification = True # Do new users need to be approved by an administrator prior to being able to login? settings.auth.registration_requires_approval = True settings.auth.registration_requests_organisation = True # Required for access to default realm permissions settings.auth.registration_link_user_to = ["staff"] settings.auth.registration_link_user_to_default = ["staff"] # Allow master key login settings.auth.masterkey = True # Filter mobile forms by master key settings.mobile.masterkey_filter = True # Approval emails get sent to all admins settings.mail.approver = "ADMIN" # Uncomment to display the Map Legend as a floating DIV settings.gis.legend = "float" # Security Policy # http://eden.sahanafoundation.org/wiki/S3AAA#System-widePolicy # 1: Simple (default): Global as Reader, Authenticated as Editor # 2: Editor role required for Update/Delete, unless record owned by session # 3: Apply Controller ACLs # 4: Apply both Controller & Function ACLs # 5: Apply Controller, Function & Table ACLs # 6: Apply Controller, Function, Table ACLs and Entity Realm # 7: Apply Controller, Function, Table ACLs and Entity Realm + Hierarchy settings.security.policy = 6 # Controller, Function, Table ACLs and Entity Realm # L10n settings # Languages used in the deployment (used for Language Toolbar, GIS Locations, etc) # http://www.loc.gov/standards/iso639-2/php/code_list.php settings.L10n.languages = OrderedDict([ ("en-gb", "English"), ("es", "Spanish"), ("so", "Somali"), ]) # Default language for Language Toolbar (& GIS Locations in future) settings.L10n.default_language = "en-gb" l10n_options = {"es": "Spanish", "so": "Somali", } # Pass to controllers.py (not a real deployment_setting) settings.L10n.survey_languages = l10n_options settings.dc.likert_options = {1: ["Very appropriate", "Somewhat appropriate", "Neither appropriate nor inappropriate", "Somewhat inappropriate", "Very inappropriate", ], 2: ["Extremely confident", "Very confident", "Moderately confident", "Slightly confident", "Not confident at all", ], 3: ["Always", "Often", "Occasionally", "Rarely", "Never", ], 4: ["Extremely safe", "Very safe", "Moderately safe", "Slightly safe", "Not safe at all", ], 5: ["Very satisfied", "Somewhat satisfied", "Neither satisfied nor dissatisfied", "Somewhat dissatisfied", "Very dissatisfied", ], 6: ["smiley-1", "smiley-2", "smiley-3", "smiley-4", "smiley-6", ], 7: ["smiley-3", "smiley-4", "smiley-5", ], } # ------------------------------------------------------------------------- # Comment/uncomment modules here to disable/enable them # Modules menu is defined in modules/eden/menu.py settings.modules = OrderedDict([ # Core modules which shouldn't be disabled ("default", Storage( name_nice = T("Home"), restricted = False, # Use ACLs to control access to this module access = None, # All Users (inc Anonymous) can see this module in the default menu & access the controller module_type = None # This item is not shown in the menu )), ("admin", Storage( name_nice = T("Administration"), #description = "Site Administration", restricted = True, access = "|1|", # Only Administrators can see this module in the default menu & access the controller module_type = None # This item is handled separately for the menu )), ("appadmin", Storage( name_nice = T("Administration"), #description = "Site Administration", restricted = True, module_type = None # No Menu )), ("errors", Storage( name_nice = T("Ticket Viewer"), #description = "Needed for Breadcrumbs", restricted = False, module_type = None # No Menu )), #("sync", Storage( # name_nice = T("Synchronization"), # #description = "Synchronization", # restricted = True, # access = "|1|", # Only Administrators can see this module in the default menu & access the controller # module_type = None # This item is handled separately for the menu #)), #("translate", Storage( # name_nice = T("Translation Functionality"), # #description = "Selective translation of strings based on module.", # module_type = None, #)), ("gis", Storage( name_nice = T("Map"), #description = "Situation Awareness & Geospatial Analysis", restricted = True, module_type = 6, # 6th item in the menu )), ("pr", Storage( name_nice = T("Person Registry"), #description = "Central point to record details on People", restricted = True, access = "|1|", # Only Administrators can see this module in the default menu (access to controller is possible to all still) module_type = 10 )), ("org", Storage( name_nice = T("Organizations"), #description = 'Lists "who is doing what & where". Allows relief agencies to coordinate their activities', restricted = True, module_type = 1 )), # Needed for default realm permissions # Currently-needed for Profile link: ("hrm", Storage( name_nice = T("Staff"), #description = "Human Resources Management", restricted = True, module_type = 2, )), ("cms", Storage( name_nice = T("Content Management"), #description = "Content Management System", restricted = True, module_type = 10, )), ("doc", Storage( name_nice = T("Documents"), #description = "A library of digital resources, such as photos, documents and reports", restricted = True, module_type = 10, )), ("dc", Storage( name_nice = T("Assessments"), #description = "Data collection tool", restricted = True, module_type = 5 )), ("project", Storage( name_nice = T("Projects"), restricted = True, module_type = 5 )), #("stats", Storage( # name_nice = T("Statistics"), # #description = "Manages statistics", # restricted = True, # module_type = None, #)), ]) settings.ui.filter_clear = False settings.search.filter_manager = False settings.ui.custom_icons = { "_base": "ucce", #"attachment": "ucce-", # Will fallback "bar-chart": "ucce-reports", "comment-alt": "ucce-textbox", "copy": "ucce-duplicate", "delete": "ucce-delete", "edit": "ucce-edit", "export": "ucce-export", "eye": "ucce-survey-preview", "file-text-alt": "ucce-guides", "folder-alt": "ucce-projects", "hashtag": "ucce-number-question", "info-circle": "ucce-info", "instructions": "ucce-instructions", "list": "ucce-mcq", "minus": "ucce-minus", "picture": "ucce-heatmap", "plus": "ucce-plus", "reports": "ucce-reports", "section-break": "ucce-section-break", "survey-copy": "ucce-survey-duplicate", "survey-delete": "ucce-survey-delete", "survey-edit": "ucce-survey-edit", "survey-export": "ucce-survey-export", "tasks": "ucce-likert-scale", "upload": "ucce-survey-import", } # Use Status in Assessment Targets settings.dc.target_status = True # Fill-out Assessments on EdenMobile-only #settings.dc.response_mobile = False settings.dc.response_web = False # ------------------------------------------------------------------------- def ucce_realm_entity(table, row): """ Assign a Realm Entity to records """ if table._tablename in ("dc_target", "dc_template", ): s3db = current.s3db ltable = s3db.project_project_target ptable = s3db.project_project if table._tablename == "dc_target": query = (ltable.target_id == row.id) & \ (ltable.project_id == ptable.id) else: ttable = s3db.dc_target query = (ttable.template_id == row.id) & \ (ltable.target_id == ttable.id) & \ (ltable.project_id == ptable.id) project = current.db(query).select(ptable.realm_entity, limitby = (0, 1) ).first() try: return project.realm_entity except AttributeError: pass # Use default rules return 0 settings.auth.realm_entity = ucce_realm_entity # ------------------------------------------------------------------------- def ucce_rheader(r): """ Custom rheaders """ if r.representation != "html": # RHeaders only used in interactive views return None # Need to use this format as otherwise req_match?viewing=org_office.x # doesn't have an rheader from core import s3_rheader_resource, s3_rheader_tabs tablename, record = s3_rheader_resource(r) if record is None: # List or Create form: rheader makes no sense here return None from gluon import A, DIV, TABLE, TR, TH, URL if tablename == "dc_template": #tabs = [(T("Basic Details"), None), # (T("Participants"), "participant"), # ] #rheader_tabs = s3_rheader_tabs(r, tabs) db = current.db s3db = current.s3db ttable = s3db.dc_target target = db(ttable.template_id == record.id).select(ttable.id, ttable.status, limitby = (0, 1) ).first() try: target_id = target.id target_status = target.status except AttributeError: target_id = None target_status = None if not target_status: # No Target linked...something odd happening button = "" elif target_status == 2: # Active button = A(T("Deactivate"), _href=URL(c="dc", f="target", args=[target_id, "deactivate.popup"], ), _class="action-btn s3_modal", _title=T("Deactivate Survey"), ) else: # Draft / Deactivated button = A(T("Activate"), _href=URL(c="dc", f="target", args=[target_id, "activate.popup"], ), _class="action-btn s3_modal", _title=T("Activate Survey"), ) ptable = s3db.project_project ltable = s3db.project_project_target query = (ltable.target_id == target_id) & \ (ltable.project_id == ptable.id) project = db(query).select(ptable.name, limitby = (0, 1) ).first() try: project_name = project.name except AttributeError: project_name = "" #table = r.table rheader = DIV(TABLE(TR(# @ToDo: make this editable TH("%s: " % T("Survey name")), record.name, TH("%s: " % T("Project")), project_name, button, )), #rheader_tabs, ) return rheader # ------------------------------------------------------------------------- def ucce_masterkey_context(masterkey): """ Provide context information for a masterkey (populates session in mobile app when linking to this masterkey) @param masterkey: the auth_masterkey Row @returns: a JSON-serializable dict with the context data """ db = current.db s3db = current.s3db context = {} # Look up the project linked to the master key ptable = s3db.project_project ltable = s3db.project_project_masterkey query = (ltable.id == masterkey.id) & \ (ltable.deleted == False) & \ (ptable.id == ltable.project_id) & \ (ptable.deleted == False) project = db(query).select(ptable.id, ptable.name, limitby = (0, 1), ).first() if project: # Provide the project title context["projectTitle"] = project.name # Provide a list of available translations in this project languages = [] # Use translated language names from core import IS_ISO639_2_LANGUAGE_CODE, s3_str represent = IS_ISO639_2_LANGUAGE_CODE.represent_local # Look up the languages ttable = s3db.project_project_target l10ntable = s3db.dc_target_l10n query = (ttable.project_id == project.id) & \ (ttable.deleted == False) & \ (ttable.target_id == l10ntable.target_id) & \ (l10ntable.language != None) # Build the language list rows = db(query).select(l10ntable.language) seen = set() for row in rows: code = row.language if code not in seen: languages.append((code, s3_str(represent(code)))) seen.add(code) context["surveyLanguages"] = languages return context settings.auth.masterkey_context = ucce_masterkey_context # ------------------------------------------------------------------------- def customise_dc_question_resource(r, tablename): from gluon import IS_IN_SET from core import S3Represent, S3SQLCustomForm crud_form = S3SQLCustomForm((T("Type"), "field_type"), (T("Question"), "name"), (T("Make question mandatory"), "require_not_empty"), (T("Choices"), "options"), (T("Add graphic"), "file"), ) type_opts = {1: T("Text box"), 2: T("Number question"), 6: T("Multiple choice question"), 12: T("Likert-scale"), 13: T("Heatmap"), } s3db = current.s3db table = s3db.dc_question table.field_type.represent = S3Represent(options=type_opts) table.field_type.requires = IS_IN_SET(type_opts) table.require_not_empty.comment = None s3db.configure("dc_question", crud_form = crud_form, list_fields = [(T("Type"), "field_type"), (T("Question"), "name"), (T("Mandatory"), "require_not_empty"), ] ) settings.customise_dc_question_resource = customise_dc_question_resource # ----------------------------------------------------------------------------- def customise_dc_question_controller(**attr): # Custom Methods from templates.UCCE.controllers import dc_QuestionCreate from templates.UCCE.controllers import dc_QuestionImageDelete from templates.UCCE.controllers import dc_QuestionImageUpload from templates.UCCE.controllers import dc_QuestionSave set_method = current.s3db.set_method set_method("dc_question", method = "create_json", action = dc_QuestionCreate()) set_method("dc_question", method = "image_delete", action = dc_QuestionImageDelete()) set_method("dc_question", method = "image_upload", action = dc_QuestionImageUpload()) set_method("dc_question", method = "update_json", action = dc_QuestionSave()) return attr settings.customise_dc_question_controller = customise_dc_question_controller # ------------------------------------------------------------------------- def dc_target_postprocess(form): """ Create a Template with the same name as the Target Copy the masterkey to the s3_table Link the Target to this new Template """ form_vars_get = form.vars.get template_id = form_vars_get("template_id") if template_id: # We already have a template, e.g. prepop return db = current.db s3db = current.s3db target_id = form_vars_get("id") name = form_vars_get("name") # Create Template template = {"name": name} tetable = s3db.dc_template template_id = tetable.insert(**template) template["id"] = template_id onaccept = s3db.get_config("dc_template", "create_onaccept") onaccept(Storage(vars = template)) ltable = s3db.dc_target_l10n l10n = db(ltable.target_id == target_id).select(ltable.language, limitby = (0, 1) ).first() if l10n: # Create Template_l10n template = {"template_id": template_id, "language": l10n.language, } ltable = s3db.dc_template_l10n ltable.insert(**template) # Link Target to Template tatable = s3db.dc_target db(tatable.id == target_id).update(template_id = template_id) # Disable mobile_form in Dynamic Table new_vars = {"mobile_form": False} # Link Dynamic Table to Masterkey ltable = s3db.project_project_target pmtable = s3db.project_project_masterkey query = (ltable.target_id == target_id) & \ (ltable.project_id == pmtable.project_id) link = db(query).select(pmtable.masterkey_id, limitby = (0, 1) ).first() if link: new_vars["masterkey_id"] = link.masterkey_id # Update Dynamic Table query = (tatable.id == target_id) & \ (tetable.id == tatable.template_id) template = db(query).select(tetable.table_id, limitby = (0, 1) ).first() db(s3db.s3_table.id == template.table_id).update(**new_vars) # ------------------------------------------------------------------------- def dc_target_ondelete(form): """ Delete the associated Template """ db = current.db s3db = current.s3db target_id = form.id table = s3db.dc_target record = db(table.id == target_id).select(table.deleted_fk, limitby = (0, 1), ).first() if record: import json deleted_fks = json.loads(record.deleted_fk) template_id = deleted_fks.get("template_id") resource = s3db.resource("dc_template", filter=(s3db.dc_template.id == template_id)) resource.delete() # ------------------------------------------------------------------------- def customise_dc_target_resource(r, tablename): from gluon import IS_EMPTY_OR, URL from core import IS_ISO639_2_LANGUAGE_CODE, S3SQLCustomForm, S3TextFilter from templates.UCCE.controllers import dc_target_list_layout from templates.UCCE.controllers import text_filter_formstyle current.response.s3.crud_strings[tablename] = Storage( label_create = T("Create Survey"), title_display = T("Survey Details"), #title_list = T("Surveys"), title_list = "", title_update = T("Edit Survey"), #title_upload = T("Import Surveys"), label_list_button = T("List Surveys"), label_delete_button = T("Delete Survey"), msg_record_created = T("Survey added"), msg_record_modified = T("Survey updated"), msg_record_deleted = T("Survey deleted"), msg_list_empty = T("No Surveys currently registered")) s3db = current.s3db # Lift mandatory link to template so that we can create the template onaccept #s3db.dc_target.template_id.requires s3db.dc_target_l10n.language.requires = IS_EMPTY_OR(IS_ISO639_2_LANGUAGE_CODE(select = l10n_options, sort = True, translate = False, zero = "", )) # Custom Component s3db.add_components("dc_target", dc_target_l10n = {"joinby": "target_id", "multiple": False, }, ) s3db.configure("dc_target", create_next = URL(c="dc", f="template", vars={"target_id": "[id]"}), crud_form = S3SQLCustomForm((T("Survey name"), "name"), (T("Translation"), "target_l10n.language"), postprocess = dc_target_postprocess, ), listadd = False, list_fields = ["name", #"status", "project_target.project_id", ], list_layout = dc_target_list_layout, ondelete = dc_target_ondelete, filter_widgets = [S3TextFilter(["name", "project.name", ], formstyle = text_filter_formstyle, label = "", _placeholder = T("Search project or survey"), ), ], ) settings.customise_dc_target_resource = customise_dc_target_resource # ----------------------------------------------------------------------------- def customise_dc_target_controller(**attr): # Custom Methods from templates.UCCE.controllers import dc_TargetActivate from templates.UCCE.controllers import dc_TargetDeactivate from templates.UCCE.controllers import dc_TargetDelete from templates.UCCE.controllers import dc_TargetEdit from templates.UCCE.controllers import dc_TargetName from templates.UCCE.controllers import dc_TargetL10n from templates.UCCE.controllers import dc_TargetReport from templates.UCCE.controllers import dc_TargetReportFilters set_method = current.s3db.set_method set_method("dc_target", method = "activate", action = dc_TargetActivate()) set_method("dc_target", method = "deactivate", action = dc_TargetDeactivate()) set_method("dc_target", method = "delete_confirm", action = dc_TargetDelete()) set_method("dc_target", method = "edit_confirm", action = dc_TargetEdit()) set_method("dc_target", method = "name", action = dc_TargetName()) set_method("dc_target", method = "l10n", action = dc_TargetL10n()) set_method("dc_target", method = "report_custom", action = dc_TargetReport()) set_method("dc_target", method = "report_filters", action = dc_TargetReportFilters()) s3 = current.response.s3 # Custom prep standard_prep = s3.prep def prep(r): # Call standard prep if callable(standard_prep): result = standard_prep(r) else: result = True if r.method == "datalist": # Filter out Draft Surveys from core import FS r.resource.add_filter(FS("status") != 1) return result s3.prep = prep s3.dl_no_header = True attr["dl_rowsize"] = 4 attr["rheader"] = None return attr settings.customise_dc_target_controller = customise_dc_target_controller # ------------------------------------------------------------------------- def dc_template_update_onaccept(form): """ Ensure that the Survey using this Template has the same name as the Template @ToDo: Language? (Depends on UI) """ s3db = current.s3db form_vars_get = form.vars.get template_id = form_vars_get("id") name = form_vars_get("name") current.db(s3db.dc_target.template_id == template_id).update(name = name) # ------------------------------------------------------------------------- def customise_dc_template_resource(r, tablename): current.response.s3.crud_strings[tablename].title_display = T("Editor") s3db = current.s3db # Custom Component #s3db.add_components("dc_template", # dc_template_l10n = {"joinby": "template_id", # "multiple": False, # }, # ) s3db.configure("dc_template", update_onaccept = dc_template_update_onaccept ) settings.customise_dc_template_resource = customise_dc_template_resource # ----------------------------------------------------------------------------- def customise_dc_template_controller(**attr): s3db = current.s3db target_id = current.request.get_vars.get("target_id") if target_id: # Find the Template for this Target ttable = s3db.dc_target target = current.db(ttable.id == target_id).select(ttable.template_id, limitby = (0, 1), ).first() if target: from gluon import redirect, URL redirect(URL(c="dc", f="template", args=[target.template_id, "editor"])) # Custom Methods from templates.UCCE.controllers import dc_TemplateEditor from templates.UCCE.controllers import dc_TemplateExportL10n from templates.UCCE.controllers import dc_TemplateImportL10n from templates.UCCE.controllers import dc_TemplateSave set_method = s3db.set_method set_method("dc_template", method = "editor", action = dc_TemplateEditor()) set_method("dc_template", method = "export_l10n", action = dc_TemplateExportL10n()) set_method("dc_template", method = "upload_l10n", action = dc_TemplateImportL10n()) set_method("dc_template", method = "update_json", action = dc_TemplateSave()) attr["rheader"] = ucce_rheader return attr settings.customise_dc_template_controller = customise_dc_template_controller # ------------------------------------------------------------------------- def default_table_onaccept(form, tablename): """ Set the response_id NB We don't actually use this in UCCE since 1 Target == 1 Template & we can't actually use this method for cases where this isn't the case either! """ record_id = form.vars.get("id") if not record_id: current.log.error("Submitting to dynamic table...cannot find record_id") return db = current.db s3db = current.s3db # Read the Table dtable = s3db.s3_table table = db(dtable.name == tablename).select(dtable.id, limitby = (0, 1) ).first() try: table_id = table.id except AttributeError: current.log.error("Submitting to dynamic table...cannot find table_id") return # Find the Template tetable = s3db.dc_template template = db(tetable.table_id == table_id).select(tetable.id, limitby = (0, 1) ).first() try: template_id = template.id except AttributeError: current.log.error("Submitting to dynamic table...cannot find template_id") return # Find the Target ttable = s3db.dc_target target = db(ttable.template_id == template_id).select(ttable.id, limitby = (0, 1) ).first() try: target_id = target.id except AttributeError: current.log.error("Submitting to dynamic table...cannot find target_id") return # Create a Response response_id = s3db.dc_response.insert(target_id = target_id, template_id = template_id, # @ToDo? #language = language, ) # Update the row in the Dynamic Table with this response_id dtable = s3db.table(tablename) db(dtable.id == record_id).update(response_id = response_id) # ------------------------------------------------------------------------- def customise_default_table_controller(**attr): s3 = current.response.s3 standard_prep = s3.prep def custom_prep(r): # Call standard prep if callable(standard_prep): if not standard_prep(r): return False tablename = r.tablename r.resource.configure(onaccept = lambda form: default_table_onaccept(form, tablename)) return True s3.prep = custom_prep return attr settings.customise_default_table_controller = customise_default_table_controller # ------------------------------------------------------------------------- def customise_doc_document_resource(r, tablename): from gluon import URL from core import S3SQLCustomForm, S3TextFilter from templates.UCCE.controllers import doc_document_list_layout from templates.UCCE.controllers import text_filter_formstyle current.response.s3.crud_strings[tablename] = Storage( label_create = T("New guide"), title_display = T("Guide Details"), #title_list = T("Guides"), title_list = "", title_update = T("Edit Guide"), #title_upload = T("Import Guides"), label_list_button = T("List Guides"), label_delete_button = T("Delete Guide"), msg_record_created = T("Guide added"), msg_record_modified = T("Guide updated"), msg_record_deleted = T("Guide deleted"), msg_list_empty = T("No Guides currently registered") ) s3db = current.s3db f = s3db.doc_document.comments f.comment = None s3db.configure("doc_document", create_next = URL(args="datalist"), crud_form = S3SQLCustomForm("name", "file", "comments", ), list_fields = ["name", "file", "comments", ], list_layout = doc_document_list_layout, filter_widgets = [S3TextFilter(["name", ], formstyle = text_filter_formstyle, label = "", _placeholder = T("Search guides"), ), ], ) settings.customise_doc_document_resource = customise_doc_document_resource # ----------------------------------------------------------------------------- def customise_doc_document_controller(**attr): s3 = current.response.s3 # Custom postp standard_postp = s3.postp def postp(r, output): # Call standard postp if callable(standard_postp): output = standard_postp(r, output) if r.method == "datalist": if "showadd_btn" in output: from gluon import A, SPAN, URL from core import ICON output["showadd_btn"] = A(ICON("plus"), SPAN(T("New guide")), _class = "add-btn no-link s3_modal", _href = URL(c="doc", f="document", args = "create.popup", vars = {"refresh": "datalist"}, ), ) return output s3.postp = postp s3.dl_no_header = True attr["dl_rowsize"] = 2 return attr settings.customise_doc_document_controller = customise_doc_document_controller # ------------------------------------------------------------------------- def project_project_onaccept(form): """ Create & link the Master Key """ from random import randint db = current.db s3db = current.s3db table = s3db.auth_masterkey not_unique = True while not_unique: masterkey = "%s-%s-%s" % (str(randint(0,999)).zfill(3), str(randint(0,999)).zfill(3), str(randint(0,999)).zfill(3), ) exists = db(table.name == masterkey).select(table.id, limitby = (0, 1) ) if not exists: not_unique = False utable = db.auth_user user = db(utable.email == "<EMAIL>").select(utable.id, limitby = (0, 1) ).first() masterkey_id = table.insert(name = masterkey, user_id = user.id, ) s3db.project_project_masterkey.insert(masterkey_id = masterkey_id, project_id = form.vars.get("id"), ) # ------------------------------------------------------------------------- def project_project_ondelete(form): """ Delete the associated Targets & Templates """ import json db = current.db s3db = current.s3db project_id = form.id target_ids = [] template_ids = [] ltable = s3db.project_project_target rows = db(ltable.deleted == True).select(ltable.deleted_fk) for row in rows: deleted_fks = json.loads(row.deleted_fk) if deleted_fks.get("project_id") == project_id: target_id = deleted_fks.get("target_id") target_ids.append(target_id) if not target_ids: return table = s3db.dc_target targets = db(table.id.belongs(target_ids)).select(table.template_id) for target in targets: template_ids.append(target.template_id) resource = s3db.resource("dc_template", filter=(s3db.dc_template.id.belongs(template_ids))) resource.delete() # ondelete CASCADE will clear these: #resource = s3db.resource("dc_target", # filter=(s3db.dc_target.id.belongs(target_ids))) #resource.delete() # ------------------------------------------------------------------------- def project_project_target_create_onaccept(form): """ Copy the masterkey to the s3_table - used during prepop """ form_vars_get = form.vars.get project_id = form_vars_get("project_id") target_id = form_vars_get("target_id") db = current.db s3db = current.s3db pmtable = s3db.project_project_masterkey link = db(pmtable.project_id == project_id).select(pmtable.masterkey_id, limitby = (0, 1) ).first() tatable = s3db.dc_target tetable = s3db.dc_template query = (tatable.id == target_id) & \ (tetable.id == tatable.template_id) template = db(query).select(tetable.table_id, limitby = (0, 1) ).first() if template: db(s3db.s3_table.id == template.table_id).update(masterkey_id = link.masterkey_id) # ------------------------------------------------------------------------- def customise_project_project_resource(r, tablename): from gluon import IS_EMPTY_OR, URL from core import IS_ISO639_2_LANGUAGE_CODE, S3SQLCustomForm, S3TextFilter from templates.UCCE.controllers import project_project_list_layout from templates.UCCE.controllers import text_filter_formstyle s3db = current.s3db current.response.s3.crud_strings[tablename] = Storage( label_create = T("New project"), #title_display = T("Project Details"), # Only used in /target/create? title_display = T("Editor"), #title_list = T("Projects"), title_list = "", title_update = T("Edit project name"), #title_upload = T("Import Projects"), label_list_button = T("List Projects"), label_delete_button = T("Delete Projects"), msg_record_created = T("Project added"), msg_record_modified = T("Project updated"), msg_record_deleted = T("Project deleted"), msg_list_empty = T("No Projects currently registered") ) user = current.auth.user organisation_id = user and user.organisation_id if organisation_id: f = s3db.project_project.organisation_id f.default = organisation_id f.readable = f.writable = False s3db.configure("project_project", create_next = URL(args="datalist"), # No need to chain as default one not relevant for this usecase: create_onaccept = project_project_onaccept, crud_form = S3SQLCustomForm((T("Organization"), "organisation_id"), (T("New project name"), "name"), (T("Default Translation"), "l10n.language"), ), # Ignored here as set in Prep in default controller #list_fields = ["name", # "project_target.target_id", # ], list_layout = project_project_list_layout, ondelete = project_project_ondelete, filter_widgets = [S3TextFilter(["name", "target.name", ], formstyle = text_filter_formstyle, label = "", _placeholder = T("Search project or survey"), ), ], ) s3db.configure("project_project_target", create_onaccept = project_project_target_create_onaccept, ) settings.customise_project_project_resource = customise_project_project_resource # ----------------------------------------------------------------------------- def customise_project_project_controller(**attr): # Custom Method from templates.UCCE.controllers import dc_ProjectDelete s3db = current.s3db s3db.set_method("project_project", method = "delete_confirm", action = dc_ProjectDelete()) s3 = current.response.s3 # Custom prep standard_prep = s3.prep def prep(r): # Call standard prep if callable(standard_prep): result = standard_prep(r) else: result = True if r.id and not r.component and r.representation == "xls": # Custom XLS Exporter to include all Responses. r.custom_action = s3db.dc_TargetXLS elif r.method == "datalist": # Over-ride list_fields set in default prep s3db.configure("project_project", list_fields = ["name", "project_target.target_id", "masterkey.name", ], ) # Inject JS to handle Switches & deletion of Inner cards if s3.debug: s3.scripts.append("/%s/static/themes/UCCE/js/projects.js" % r.application) else: s3.scripts.append("/%s/static/themes/UCCE/js/projects.min.js" % r.application) return result s3.prep = prep # Custom postp standard_postp = s3.postp def postp(r, output): # Call standard postp if callable(standard_postp): output = standard_postp(r, output) if r.method == "datalist": if "showadd_btn" in output: from gluon import A, SPAN, URL from core import ICON output["showadd_btn"] = A(ICON("plus"), SPAN(T("New project")), _class = "add-btn no-link s3_modal", _href = URL(c="project", f="project", args = "create.popup", vars = {"refresh": "datalist"}, ), ) return output s3.postp = postp s3.dl_no_header = True attr["rheader"] = None return attr settings.customise_project_project_controller = customise_project_project_controller # END =========================================================================
[ "gluon.IS_IN_SET", "templates.UCCE.controllers.dc_TargetReport", "templates.UCCE.controllers.dc_TargetL10n", "templates.UCCE.controllers.dc_QuestionImageUpload", "core.S3SQLCustomForm", "templates.UCCE.controllers.dc_TemplateImportL10n", "core.IS_ISO639_2_LANGUAGE_CODE", "templates.UCCE.controllers.dc_TargetReportFilters", "gluon.current.db", "templates.UCCE.controllers.dc_TemplateExportL10n", "json.loads", "random.randint", "templates.UCCE.controllers.dc_TemplateEditor", "core.s3_rheader_resource", "templates.UCCE.controllers.dc_TargetDelete", "core.S3Represent", "templates.UCCE.controllers.dc_QuestionCreate", "core.FS", "templates.UCCE.controllers.dc_TargetDeactivate", "templates.UCCE.controllers.dc_TargetEdit", "templates.UCCE.controllers.dc_ProjectDelete", "templates.UCCE.controllers.dc_TargetActivate", "templates.UCCE.controllers.dc_QuestionSave", "gluon.current.request.get_vars.get", "templates.UCCE.controllers.dc_TemplateSave", "templates.UCCE.controllers.dc_TargetName", "gluon.storage.Storage", "core.ICON", "templates.UCCE.controllers.dc_QuestionImageDelete", "collections.OrderedDict", "gluon.current.log.error", "gluon.URL" ]
[((2513, 2585), 'collections.OrderedDict', 'OrderedDict', (["[('en-gb', 'English'), ('es', 'Spanish'), ('so', 'Somali')]"], {}), "([('en-gb', 'English'), ('es', 'Spanish'), ('so', 'Somali')])\n", (2524, 2585), False, 'from collections import OrderedDict\n'), ((12230, 12252), 'core.s3_rheader_resource', 's3_rheader_resource', (['r'], {}), '(r)\n', (12249, 12252), False, 'from core import s3_rheader_resource, s3_rheader_tabs\n'), ((18348, 18378), 'core.S3Represent', 'S3Represent', ([], {'options': 'type_opts'}), '(options=type_opts)\n', (18359, 18378), False, 'from core import S3Represent, S3SQLCustomForm\n'), ((18415, 18435), 'gluon.IS_IN_SET', 'IS_IN_SET', (['type_opts'], {}), '(type_opts)\n', (18424, 18435), False, 'from gluon import IS_IN_SET\n'), ((30574, 30615), 'gluon.current.request.get_vars.get', 'current.request.get_vars.get', (['"""target_id"""'], {}), "('target_id')\n", (30602, 30615), False, 'from gluon import current\n'), ((20898, 20920), 'gluon.storage.Storage', 'Storage', ([], {'vars': 'template'}), '(vars=template)\n', (20905, 20920), False, 'from gluon.storage import Storage\n'), ((23043, 23072), 'json.loads', 'json.loads', (['record.deleted_fk'], {}), '(record.deleted_fk)\n', (23053, 23072), False, 'import json\n'), ((24570, 24657), 'core.IS_ISO639_2_LANGUAGE_CODE', 'IS_ISO639_2_LANGUAGE_CODE', ([], {'select': 'l10n_options', 'sort': '(True)', 'translate': '(False)', 'zero': '""""""'}), "(select=l10n_options, sort=True, translate=False,\n zero='')\n", (24595, 24657), False, 'from core import IS_ISO639_2_LANGUAGE_CODE, s3_str\n'), ((32537, 32609), 'gluon.current.log.error', 'current.log.error', (['"""Submitting to dynamic table...cannot find record_id"""'], {}), "('Submitting to dynamic table...cannot find record_id')\n", (32554, 32609), False, 'from gluon import current\n'), ((40843, 40869), 'json.loads', 'json.loads', (['row.deleted_fk'], {}), '(row.deleted_fk)\n', (40853, 40869), False, 'import json\n'), ((19496, 19515), 'templates.UCCE.controllers.dc_QuestionCreate', 'dc_QuestionCreate', ([], {}), '()\n', (19513, 19515), False, 'from templates.UCCE.controllers import dc_QuestionCreate\n'), ((19623, 19647), 'templates.UCCE.controllers.dc_QuestionImageDelete', 'dc_QuestionImageDelete', ([], {}), '()\n', (19645, 19647), False, 'from templates.UCCE.controllers import dc_QuestionImageDelete\n'), ((19755, 19779), 'templates.UCCE.controllers.dc_QuestionImageUpload', 'dc_QuestionImageUpload', ([], {}), '()\n', (19777, 19779), False, 'from templates.UCCE.controllers import dc_QuestionImageUpload\n'), ((19886, 19903), 'templates.UCCE.controllers.dc_QuestionSave', 'dc_QuestionSave', ([], {}), '()\n', (19901, 19903), False, 'from templates.UCCE.controllers import dc_QuestionSave\n'), ((25365, 25418), 'gluon.URL', 'URL', ([], {'c': '"""dc"""', 'f': '"""template"""', 'vars': "{'target_id': '[id]'}"}), "(c='dc', f='template', vars={'target_id': '[id]'})\n", (25368, 25418), False, 'from gluon import A, SPAN, URL\n'), ((27556, 27575), 'templates.UCCE.controllers.dc_TargetActivate', 'dc_TargetActivate', ([], {}), '()\n', (27573, 27575), False, 'from templates.UCCE.controllers import dc_TargetActivate\n'), ((27679, 27700), 'templates.UCCE.controllers.dc_TargetDeactivate', 'dc_TargetDeactivate', ([], {}), '()\n', (27698, 27700), False, 'from templates.UCCE.controllers import dc_TargetDeactivate\n'), ((27808, 27825), 'templates.UCCE.controllers.dc_TargetDelete', 'dc_TargetDelete', ([], {}), '()\n', (27823, 27825), False, 'from templates.UCCE.controllers import dc_TargetDelete\n'), ((27931, 27946), 'templates.UCCE.controllers.dc_TargetEdit', 'dc_TargetEdit', ([], {}), '()\n', (27944, 27946), False, 'from templates.UCCE.controllers import dc_TargetEdit\n'), ((28044, 28059), 'templates.UCCE.controllers.dc_TargetName', 'dc_TargetName', ([], {}), '()\n', (28057, 28059), False, 'from templates.UCCE.controllers import dc_TargetName\n'), ((28157, 28172), 'templates.UCCE.controllers.dc_TargetL10n', 'dc_TargetL10n', ([], {}), '()\n', (28170, 28172), False, 'from templates.UCCE.controllers import dc_TargetL10n\n'), ((28279, 28296), 'templates.UCCE.controllers.dc_TargetReport', 'dc_TargetReport', ([], {}), '()\n', (28294, 28296), False, 'from templates.UCCE.controllers import dc_TargetReport\n'), ((28404, 28428), 'templates.UCCE.controllers.dc_TargetReportFilters', 'dc_TargetReportFilters', ([], {}), '()\n', (28426, 28428), False, 'from templates.UCCE.controllers import dc_TargetReportFilters\n'), ((29561, 29614), 'gluon.current.db', 'current.db', (['(s3db.dc_target.template_id == template_id)'], {}), '(s3db.dc_target.template_id == template_id)\n', (29571, 29614), False, 'from gluon import current\n'), ((31549, 31568), 'templates.UCCE.controllers.dc_TemplateEditor', 'dc_TemplateEditor', ([], {}), '()\n', (31566, 31568), False, 'from templates.UCCE.controllers import dc_TemplateEditor\n'), ((31676, 31699), 'templates.UCCE.controllers.dc_TemplateExportL10n', 'dc_TemplateExportL10n', ([], {}), '()\n', (31697, 31699), False, 'from templates.UCCE.controllers import dc_TemplateExportL10n\n'), ((31807, 31830), 'templates.UCCE.controllers.dc_TemplateImportL10n', 'dc_TemplateImportL10n', ([], {}), '()\n', (31828, 31830), False, 'from templates.UCCE.controllers import dc_TemplateImportL10n\n'), ((31938, 31955), 'templates.UCCE.controllers.dc_TemplateSave', 'dc_TemplateSave', ([], {}), '()\n', (31953, 31955), False, 'from templates.UCCE.controllers import dc_TemplateSave\n'), ((33021, 33092), 'gluon.current.log.error', 'current.log.error', (['"""Submitting to dynamic table...cannot find table_id"""'], {}), "('Submitting to dynamic table...cannot find table_id')\n", (33038, 33092), False, 'from gluon import current\n'), ((33486, 33560), 'gluon.current.log.error', 'current.log.error', (['"""Submitting to dynamic table...cannot find template_id"""'], {}), "('Submitting to dynamic table...cannot find template_id')\n", (33503, 33560), False, 'from gluon import current\n'), ((33953, 34025), 'gluon.current.log.error', 'current.log.error', (['"""Submitting to dynamic table...cannot find target_id"""'], {}), "('Submitting to dynamic table...cannot find target_id')\n", (33970, 34025), False, 'from gluon import current\n'), ((36421, 36441), 'gluon.URL', 'URL', ([], {'args': '"""datalist"""'}), "(args='datalist')\n", (36424, 36441), False, 'from gluon import A, SPAN, URL\n'), ((36478, 36521), 'core.S3SQLCustomForm', 'S3SQLCustomForm', (['"""name"""', '"""file"""', '"""comments"""'], {}), "('name', 'file', 'comments')\n", (36493, 36521), False, 'from core import IS_ISO639_2_LANGUAGE_CODE, S3SQLCustomForm, S3TextFilter\n'), ((44309, 44329), 'gluon.URL', 'URL', ([], {'args': '"""datalist"""'}), "(args='datalist')\n", (44312, 44329), False, 'from gluon import A, SPAN, URL\n'), ((46366, 46384), 'templates.UCCE.controllers.dc_ProjectDelete', 'dc_ProjectDelete', ([], {}), '()\n', (46382, 46384), False, 'from templates.UCCE.controllers import dc_ProjectDelete\n'), ((31055, 31117), 'gluon.URL', 'URL', ([], {'c': '"""dc"""', 'f': '"""template"""', 'args': "[target.template_id, 'editor']"}), "(c='dc', f='template', args=[target.template_id, 'editor'])\n", (31058, 31117), False, 'from gluon import A, SPAN, URL\n'), ((28860, 28872), 'core.FS', 'FS', (['"""status"""'], {}), "('status')\n", (28862, 28872), False, 'from core import FS\n'), ((38102, 38114), 'core.ICON', 'ICON', (['"""plus"""'], {}), "('plus')\n", (38106, 38114), False, 'from core import ICON\n'), ((48077, 48089), 'core.ICON', 'ICON', (['"""plus"""'], {}), "('plus')\n", (48081, 48089), False, 'from core import ICON\n'), ((11368, 11385), 'gluon.current.db', 'current.db', (['query'], {}), '(query)\n', (11378, 11385), False, 'from gluon import current\n'), ((13521, 13582), 'gluon.URL', 'URL', ([], {'c': '"""dc"""', 'f': '"""target"""', 'args': "[target_id, 'deactivate.popup']"}), "(c='dc', f='target', args=[target_id, 'deactivate.popup'])\n", (13524, 13582), False, 'from gluon import A, SPAN, URL\n'), ((13935, 13994), 'gluon.URL', 'URL', ([], {'c': '"""dc"""', 'f': '"""target"""', 'args': "[target_id, 'activate.popup']"}), "(c='dc', f='target', args=[target_id, 'activate.popup'])\n", (13938, 13994), False, 'from gluon import A, SPAN, URL\n'), ((30743, 30777), 'gluon.current.db', 'current.db', (['(ttable.id == target_id)'], {}), '(ttable.id == target_id)\n', (30753, 30777), False, 'from gluon import current\n'), ((38321, 38398), 'gluon.URL', 'URL', ([], {'c': '"""doc"""', 'f': '"""document"""', 'args': '"""create.popup"""', 'vars': "{'refresh': 'datalist'}"}), "(c='doc', f='document', args='create.popup', vars={'refresh': 'datalist'})\n", (38324, 38398), False, 'from gluon import A, SPAN, URL\n'), ((48298, 48383), 'gluon.URL', 'URL', ([], {'c': '"""project"""', 'f': '"""project"""', 'args': '"""create.popup"""', 'vars': "{'refresh': 'datalist'}"}), "(c='project', f='project', args='create.popup', vars={'refresh': 'datalist'}\n )\n", (48301, 48383), False, 'from gluon import A, SPAN, URL\n'), ((39254, 39269), 'random.randint', 'randint', (['(0)', '(999)'], {}), '(0, 999)\n', (39261, 39269), False, 'from random import randint\n'), ((39322, 39337), 'random.randint', 'randint', (['(0)', '(999)'], {}), '(0, 999)\n', (39329, 39337), False, 'from random import randint\n'), ((39390, 39405), 'random.randint', 'randint', (['(0)', '(999)'], {}), '(0, 999)\n', (39397, 39405), False, 'from random import randint\n')]
"""This module creates a new dataframe with a movie id and its corresponding mean sentiment score. Mean sentiment score is computed by taking the average of the sentiment scores for all the movie's comments """ from os import listdir import os.path as op import pandas as pd import numpy as np from .analyze_comments_tblob import analyze_comments import movie_analysis as mv data_path = op.join(mv.__path__[0], 'data/movie_comments') def get_sentiment_score(): """This function makes a new df with the movie_id and sentiment score as columns """ final_df = pd.DataFrame(columns=['movie_id', 'sentiment_score']) filenames2 = find_csv_filenames(data_path) for name in filenames2: new_name = data_path+"/"+name df = pd.read_csv(new_name, encoding='latin1') sentiment_df = pd.DataFrame(data=df) sentiment_df.columns = ["comment"] if not sentiment_df.empty: sentiment_df = analyze_comments(sentiment_df) if name.endswith('.csv'): name = name[:-4] sentiment_score = np.asarray(sentiment_df.iloc[:, 1], dtype=np.float).mean() final_df = add_row(name, sentiment_score, final_df) # final_df.to_csv("sentiment_scores.csv", encoding='latin1') return final_df def find_csv_filenames(path_to_dir, suffix=".csv"): """This function returns a list of all the filenames that end with '.csv' """ filenames = listdir(path_to_dir) return [filename for filename in filenames if filename.endswith(suffix)] def add_row(movie_id, mean_score, final_df): """This function adds a row to the data frame with the movie_id and corresponding sentiment_score values """ df2 = pd.DataFrame([[movie_id, mean_score]], columns=['movie_id', 'sentiment_score']) final_df = final_df.append(df2, ignore_index=True) return final_df
[ "pandas.DataFrame", "pandas.read_csv", "numpy.asarray", "os.path.join", "os.listdir" ]
[((389, 435), 'os.path.join', 'op.join', (['mv.__path__[0]', '"""data/movie_comments"""'], {}), "(mv.__path__[0], 'data/movie_comments')\n", (396, 435), True, 'import os.path as op\n'), ((577, 630), 'pandas.DataFrame', 'pd.DataFrame', ([], {'columns': "['movie_id', 'sentiment_score']"}), "(columns=['movie_id', 'sentiment_score'])\n", (589, 630), True, 'import pandas as pd\n'), ((1444, 1464), 'os.listdir', 'listdir', (['path_to_dir'], {}), '(path_to_dir)\n', (1451, 1464), False, 'from os import listdir\n'), ((1720, 1799), 'pandas.DataFrame', 'pd.DataFrame', (['[[movie_id, mean_score]]'], {'columns': "['movie_id', 'sentiment_score']"}), "([[movie_id, mean_score]], columns=['movie_id', 'sentiment_score'])\n", (1732, 1799), True, 'import pandas as pd\n'), ((757, 797), 'pandas.read_csv', 'pd.read_csv', (['new_name'], {'encoding': '"""latin1"""'}), "(new_name, encoding='latin1')\n", (768, 797), True, 'import pandas as pd\n'), ((821, 842), 'pandas.DataFrame', 'pd.DataFrame', ([], {'data': 'df'}), '(data=df)\n', (833, 842), True, 'import pandas as pd\n'), ((1080, 1131), 'numpy.asarray', 'np.asarray', (['sentiment_df.iloc[:, 1]'], {'dtype': 'np.float'}), '(sentiment_df.iloc[:, 1], dtype=np.float)\n', (1090, 1131), True, 'import numpy as np\n')]
#!/usr/bin/env python3 # -*- coding: utf-8 -*- """ Created on Thu Jul 19 10:51:10 2018 @author: shlomi """ import platform from pathlib import Path path = Path().cwd() if platform.system() == 'Linux': if platform.node() == 'ziskin-XPS-8700': work_path = Path('/home/ziskin/Work_Files/') work_yuval = work_path / 'PW_yuval' work_chaim = work_path / 'Chaim_Stratosphere_Data' work_david = work_path / 'David_migration' cwd = Path().cwd() geo_path = Path('/home/ziskin/geo_ariel_home/') adams_path = Path('/home/ziskin/adams_home/') data11_path = Path('/home/ziskin/data11/') savefig_path = Path('/home/ziskin/Pictures') elif platform.node() == 'shlomipc': work_path = Path('/mnt/DATA/Work_Files/') work_yuval = work_path / 'PW_yuval' work_chaim = work_path / 'Chaim_Stratosphere_Data' work_david = work_path / 'David_migration' cwd = Path().cwd() geo_path = Path('/home/shlomi/geo_ariel_home/') adams_path = Path('/home/shlomi/adams_home/') data11_path = Path('/home/shlomi/data11/') savefig_path = Path('/home/shlomi/Pictures') elif platform.node() == 'geophysics1.yosh.ac.il': work_path = Path('/home/ziskin/Work_Files/') work_yuval = work_path / 'PW_yuval' work_chaim = work_path / 'Chaim_Stratosphere_Data' work_david = work_path / 'David_migration' cwd = Path().cwd() geo_path = Path('/home/ziskin/') savefig_path = Path().cwd() # geo_path = Path('/home/ziskin/geo_ariel_home/') # adams_path = Path('/home/ziskin/adams_home/') # data11_path = Path('/home/ziskin/data11/') else: work_path = Path('/home/ziskin/Work_Files/') work_yuval = work_path / 'PW_yuval' work_chaim = work_path / 'Chaim_Stratosphere_Data' work_david = work_path / 'David_migration' cwd = Path().cwd() elif platform.system() == 'Darwin': if platform.node() == 'Venus': work_path = Path('/Users/shlomi/Documents/') work_yuval = work_path / 'PW_yuval' work_chaim = work_path / 'Chaim_Stratosphere_Data' work_david = work_path / 'David_migration' cwd = Path().cwd() geo_path = Path('/Users/shlomi/geo_ariel_home/') adams_path = Path('/Users/shlomi/adams_home/') data11_path = Path('/Users/shlomi/data11/') savefig_path = Path('/Users/shlomi/Pictures')
[ "platform.system", "pathlib.Path", "platform.node" ]
[((172, 189), 'platform.system', 'platform.system', ([], {}), '()\n', (187, 189), False, 'import platform\n'), ((156, 162), 'pathlib.Path', 'Path', ([], {}), '()\n', (160, 162), False, 'from pathlib import Path\n'), ((209, 224), 'platform.node', 'platform.node', ([], {}), '()\n', (222, 224), False, 'import platform\n'), ((267, 299), 'pathlib.Path', 'Path', (['"""/home/ziskin/Work_Files/"""'], {}), "('/home/ziskin/Work_Files/')\n", (271, 299), False, 'from pathlib import Path\n'), ((500, 536), 'pathlib.Path', 'Path', (['"""/home/ziskin/geo_ariel_home/"""'], {}), "('/home/ziskin/geo_ariel_home/')\n", (504, 536), False, 'from pathlib import Path\n'), ((558, 590), 'pathlib.Path', 'Path', (['"""/home/ziskin/adams_home/"""'], {}), "('/home/ziskin/adams_home/')\n", (562, 590), False, 'from pathlib import Path\n'), ((613, 641), 'pathlib.Path', 'Path', (['"""/home/ziskin/data11/"""'], {}), "('/home/ziskin/data11/')\n", (617, 641), False, 'from pathlib import Path\n'), ((665, 694), 'pathlib.Path', 'Path', (['"""/home/ziskin/Pictures"""'], {}), "('/home/ziskin/Pictures')\n", (669, 694), False, 'from pathlib import Path\n'), ((1961, 1978), 'platform.system', 'platform.system', ([], {}), '()\n', (1976, 1978), False, 'import platform\n'), ((704, 719), 'platform.node', 'platform.node', ([], {}), '()\n', (717, 719), False, 'import platform\n'), ((755, 784), 'pathlib.Path', 'Path', (['"""/mnt/DATA/Work_Files/"""'], {}), "('/mnt/DATA/Work_Files/')\n", (759, 784), False, 'from pathlib import Path\n'), ((985, 1021), 'pathlib.Path', 'Path', (['"""/home/shlomi/geo_ariel_home/"""'], {}), "('/home/shlomi/geo_ariel_home/')\n", (989, 1021), False, 'from pathlib import Path\n'), ((1043, 1075), 'pathlib.Path', 'Path', (['"""/home/shlomi/adams_home/"""'], {}), "('/home/shlomi/adams_home/')\n", (1047, 1075), False, 'from pathlib import Path\n'), ((1098, 1126), 'pathlib.Path', 'Path', (['"""/home/shlomi/data11/"""'], {}), "('/home/shlomi/data11/')\n", (1102, 1126), False, 'from pathlib import Path\n'), ((1150, 1179), 'pathlib.Path', 'Path', (['"""/home/shlomi/Pictures"""'], {}), "('/home/shlomi/Pictures')\n", (1154, 1179), False, 'from pathlib import Path\n'), ((1999, 2014), 'platform.node', 'platform.node', ([], {}), '()\n', (2012, 2014), False, 'import platform\n'), ((2047, 2079), 'pathlib.Path', 'Path', (['"""/Users/shlomi/Documents/"""'], {}), "('/Users/shlomi/Documents/')\n", (2051, 2079), False, 'from pathlib import Path\n'), ((2280, 2317), 'pathlib.Path', 'Path', (['"""/Users/shlomi/geo_ariel_home/"""'], {}), "('/Users/shlomi/geo_ariel_home/')\n", (2284, 2317), False, 'from pathlib import Path\n'), ((2339, 2372), 'pathlib.Path', 'Path', (['"""/Users/shlomi/adams_home/"""'], {}), "('/Users/shlomi/adams_home/')\n", (2343, 2372), False, 'from pathlib import Path\n'), ((2395, 2424), 'pathlib.Path', 'Path', (['"""/Users/shlomi/data11/"""'], {}), "('/Users/shlomi/data11/')\n", (2399, 2424), False, 'from pathlib import Path\n'), ((2448, 2478), 'pathlib.Path', 'Path', (['"""/Users/shlomi/Pictures"""'], {}), "('/Users/shlomi/Pictures')\n", (2452, 2478), False, 'from pathlib import Path\n'), ((468, 474), 'pathlib.Path', 'Path', ([], {}), '()\n', (472, 474), False, 'from pathlib import Path\n'), ((1189, 1204), 'platform.node', 'platform.node', ([], {}), '()\n', (1202, 1204), False, 'import platform\n'), ((1254, 1286), 'pathlib.Path', 'Path', (['"""/home/ziskin/Work_Files/"""'], {}), "('/home/ziskin/Work_Files/')\n", (1258, 1286), False, 'from pathlib import Path\n'), ((1487, 1508), 'pathlib.Path', 'Path', (['"""/home/ziskin/"""'], {}), "('/home/ziskin/')\n", (1491, 1508), False, 'from pathlib import Path\n'), ((1742, 1774), 'pathlib.Path', 'Path', (['"""/home/ziskin/Work_Files/"""'], {}), "('/home/ziskin/Work_Files/')\n", (1746, 1774), False, 'from pathlib import Path\n'), ((953, 959), 'pathlib.Path', 'Path', ([], {}), '()\n', (957, 959), False, 'from pathlib import Path\n'), ((2248, 2254), 'pathlib.Path', 'Path', ([], {}), '()\n', (2252, 2254), False, 'from pathlib import Path\n'), ((1455, 1461), 'pathlib.Path', 'Path', ([], {}), '()\n', (1459, 1461), False, 'from pathlib import Path\n'), ((1532, 1538), 'pathlib.Path', 'Path', ([], {}), '()\n', (1536, 1538), False, 'from pathlib import Path\n'), ((1943, 1949), 'pathlib.Path', 'Path', ([], {}), '()\n', (1947, 1949), False, 'from pathlib import Path\n')]
from maggma.api.query_operator import PaginationQuery, SparseFieldsQuery from maggma.api.resource import ReadOnlyResource from emmet.core.phonon import PhononBSDOSDoc def phonon_bsdos_resource(phonon_bs_store): resource = ReadOnlyResource( phonon_bs_store, PhononBSDOSDoc, query_operators=[ PaginationQuery(), SparseFieldsQuery( PhononBSDOSDoc, default_fields=["task_id", "last_updated"] ), ], tags=["Phonon"], enable_default_search=False, disable_validation=True, ) return resource
[ "maggma.api.query_operator.SparseFieldsQuery", "maggma.api.query_operator.PaginationQuery" ]
[((334, 351), 'maggma.api.query_operator.PaginationQuery', 'PaginationQuery', ([], {}), '()\n', (349, 351), False, 'from maggma.api.query_operator import PaginationQuery, SparseFieldsQuery\n'), ((365, 442), 'maggma.api.query_operator.SparseFieldsQuery', 'SparseFieldsQuery', (['PhononBSDOSDoc'], {'default_fields': "['task_id', 'last_updated']"}), "(PhononBSDOSDoc, default_fields=['task_id', 'last_updated'])\n", (382, 442), False, 'from maggma.api.query_operator import PaginationQuery, SparseFieldsQuery\n')]
from datetime import datetime import numpy as np import warnings __author__ = '<NAME>' __email__ = '<EMAIL>' __created__ = datetime(2008, 8, 15) __modified__ = datetime(2015, 7, 25) __version__ = "1.5" __status__ = "Development" ''' Various vertical coordinates Presently, only ocean s-coordinates are supported. Future plans will be to include all of the vertical coordinate systems defined by the CF conventions. vgrid.py function copied from https://github.com/kshedstrom/pyroms (Frederic Castruccio) ''' def calculateVgrid(self): print(("--->Setting up vertical coordinates using self.vtransform: %s self.vstretching: %s"%(self.vtransform,self.vstretching))) if self.vtransform == 1: vgrid = s_coordinate(self.h, self.theta_b, self.theta_s, self.tcline, self.nlevels, self.vtransform, self.vstretching, zeta=None) elif self.vtransform == 2 and self.vstretching == 2: vgrid = s_coordinate_2(self.h, self.theta_b, self.theta_s, self.tcline, self.nlevels, self.vtransform, self.vstretching, zeta=None) elif self.vtransform == 2 and self.vstretching == 4: vgrid = s_coordinate_4(self.h, self.theta_b, self.theta_s, self.tcline, self.nlevels, self.vtransform, self.vstretching, zeta=None) else: raise Warning('Unknow vertical transformation Vtrans') self.z_r = vgrid.z_r[0,:] self.z_w = vgrid.z_w[0,:] self.Cs_rho = vgrid.Cs_r self.Cs_w = vgrid.Cs_w self.s_rho = vgrid.s_rho self.s_w = vgrid.s_w class s_coordinate(object): """ Song and Haidvogel (1994) vertical coordinate transformation (Vtransform=1) and stretching functions (Vstretching=1). return an object that can be indexed to return depths s = s_coordinate(h, theta_b, theta_s, Tcline, N) """ def __init__(self, h, theta_b, theta_s, tcline, N, vtransform, vstretching, zeta=None): self.h = np.asarray(h) self.hmin = h.min() self.theta_b = theta_b self.theta_s = theta_s self.tcline = tcline self.N = int(N) self.Np = self.N+1 self.vtransform = vtransform self.vstretching = vstretching self.hc = min(self.hmin, self.tcline) self.Vtrans = 1 if self.vtransform==1: if (self.tcline > self.hmin): warnings.warn('Vertical transformation parameters are not defined correctly in either gridid.txt or in the history files: \n Tcline = %d and hmin = %d. \n You need to make sure that Tcline <= hmin when using transformation 1.' %(self.Tcline,self.hmin)) self.c1 = 1.0 self.c2 = 2.0 self.p5 = 0.5 if zeta is None: self.zeta = np.zeros(h.shape) else: self.zeta = zeta self._get_s_rho() self._get_s_w() self._get_Cs_r() self._get_Cs_w() self.z_r = z_r(self.h, self.hc, self.N, self.s_rho, self.Cs_r, self.zeta, self.Vtrans) self.z_w = z_w(self.h, self.hc, self.Np, self.s_w, self.Cs_w, self.zeta, self.Vtrans) def _get_s_rho(self): lev = np.arange(1,self.N+1,1) ds = 1.0 / self.N self.s_rho = -self.c1 + (lev - self.p5) * ds def _get_s_w(self): lev = np.arange(0,self.Np,1) ds = 1.0 / (self.Np-1) self.s_w = -self.c1 + lev * ds def _get_Cs_r(self): if (self.theta_s >= 0): Ptheta = np.sinh(self.theta_s * self.s_rho) / np.sinh(self.theta_s) Rtheta = np.tanh(self.theta_s * (self.s_rho + self.p5)) / \ (self.c2 * np.tanh(self.p5 * self.theta_s)) - self.p5 self.Cs_r = (self.c1 - self.theta_b) * Ptheta + self.theta_b * Rtheta else: self.Cs_r = self.s_rho def _get_Cs_w(self): if (self.theta_s >= 0): Ptheta = np.sinh(self.theta_s * self.s_w) / np.sinh(self.theta_s) Rtheta = np.tanh(self.theta_s * (self.s_w + self.p5)) / \ (self.c2 * np.tanh(self.p5 * self.theta_s)) - self.p5 self.Cs_w = (self.c1 - self.theta_b) * Ptheta + self.theta_b * Rtheta else: self.Cs_w = self.s_w class s_coordinate_2(s_coordinate): """ <NAME> (2005) UCLA-ROMS vertical coordinate transformation (Vtransform=2) and stretching functions (Vstretching=2). return an object that can be indexed to return depths s = s_coordinate_2(h, theta_b, theta_s, Tcline, N) """ def __init__(self, h, theta_b, theta_s, tcline, N, vtransform, vstretching, zeta=None): self.h = np.asarray(h) self.hmin = h.min() self.theta_b = theta_b self.theta_s = theta_s self.tcline = tcline self.N = int(N) self.Np = self.N+1 self.vtransform = vtransform self.vstretching = vstretching self.hc = self.tcline self.Vtrans = 2 self.Aweight = 1.0 self.Bweight = 1.0 self.c1 = 1.0 self.c2 = 2.0 self.p5 = 0.5 if zeta is None: self.zeta = np.zeros(h.shape) else: self.zeta = zeta self._get_s_rho() self._get_s_w() self._get_Cs_r() self._get_Cs_w() self.z_r = z_r(self.h, self.hc, self.N, self.s_rho, self.Cs_r, self.zeta, self.Vtrans) self.z_w = z_w(self.h, self.hc, self.Np, self.s_w, self.Cs_w, self.zeta, self.Vtrans) def _get_s_rho(self): super(s_coordinate_2, self)._get_s_rho() def _get_s_w(self): super(s_coordinate_2, self)._get_s_w() def _get_Cs_r(self): if (self.theta_s >= 0): Csur = (self.c1 - np.cosh(self.theta_s * self.s_rho)) / \ (np.cosh(self.theta_s) - self.c1) if (self.theta_b >= 0): Cbot = np.sinh(self.theta_b * (self.s_rho + self.c1)) / \ np.sinh(self.theta_b) - self.c1 Cweight = (self.s_rho + self.c1)**self.Aweight * \ (self.c1 + (self.Aweight / self.Bweight) * \ (self.c1 - (self.s_rho + self.c1)**self.Bweight)) self.Cs_r = Cweight * Csur + (self.c1 - Cweight) * Cbot else: self.Cs_r = Csur else: self.Cs_r = self.s_rho def _get_Cs_w(self): if (self.theta_s >= 0): Csur = (self.c1 - np.cosh(self.theta_s * self.s_w)) / \ (np.cosh(self.theta_s) - self.c1) if (self.theta_b >= 0): Cbot = np.sinh(self.theta_b * (self.s_w + self.c1)) / \ np.sinh(self.theta_b) - self.c1 Cweight = (self.s_w + self.c1)**self.Aweight * \ (self.c1 + (self.Aweight / self.Bweight) * \ (self.c1 - (self.s_w + self.c1)**self.Bweight)) self.Cs_w = Cweight * Csur + (self.c1 - Cweight) * Cbot else: self.Cs_w = Csur else: self.Cs_w = self.s_w class s_coordinate_4(s_coordinate): """ <NAME> (2005) UCLA-ROMS vertical coordinate transformation (Vtransform=2) and stretching functions (Vstretching=4). return an object that can be indexed to return depths s = s_coordinate_4(h, theta_b, theta_s, Tcline, N) """ def __init__(self, h, theta_b, theta_s, tcline, N, vtransform, vstretching, zeta=None): self.h = np.asarray(h) self.hmin = h.min() self.theta_b = theta_b self.theta_s = theta_s self.tcline = tcline self.N = int(N) self.Np = self.N+1 self.vtransform = vtransform self.vstretching = vstretching self.hc = self.tcline self.Vtrans = 4 self.c1 = 1.0 self.c2 = 2.0 self.p5 = 0.5 if zeta is None: self.zeta = np.zeros(h.shape) else: self.zeta = zeta self._get_s_rho() self._get_s_w() self._get_Cs_r() self._get_Cs_w() self.z_r = z_r(self.h, self.hc, self.N, self.s_rho, self.Cs_r, self.zeta, self.Vtrans) self.z_w = z_w(self.h, self.hc, self.Np, self.s_w, self.Cs_w, self.zeta, self.Vtrans) def _get_s_rho(self): super(s_coordinate_4, self)._get_s_rho() def _get_s_w(self): super(s_coordinate_4, self)._get_s_w() def _get_Cs_r(self): if (self.theta_s > 0): Csur = (self.c1 - np.cosh(self.theta_s * self.s_rho)) / \ (np.cosh(self.theta_s) - self.c1) else: Csur = -self.s_rho**2 if (self.theta_b > 0): Cbot = (np.exp(self.theta_b * Csur) - self.c1 ) / \ (self.c1 - np.exp(-self.theta_b)) self.Cs_r = Cbot else: self.Cs_r = Csur def _get_Cs_w(self): if (self.theta_s > 0): Csur = (self.c1 - np.cosh(self.theta_s * self.s_w)) / \ (np.cosh(self.theta_s) - self.c1) else: Csur = -self.s_w**2 if (self.theta_b > 0): Cbot = (np.exp(self.theta_b * Csur) - self.c1 ) / \ ( self.c1 - np.exp(-self.theta_b) ) self.Cs_w = Cbot else: self.Cs_w = Csur class z_r(object): """ return an object that can be indexed to return depths of rho point z_r = z_r(h, hc, N, s_rho, Cs_r, zeta, Vtrans) """ def __init__(self, h, hc, N, s_rho, Cs_r, zeta, Vtrans): self.h = h self.hc = hc self.N = N self.s_rho = s_rho self.Cs_r = Cs_r self.zeta = zeta self.Vtrans = Vtrans def __getitem__(self, key): if isinstance(key, tuple) and len(self.zeta.shape) > len(self.h.shape): zeta = self.zeta[key[0]] res_index = (slice(None),) + key[1:] elif len(self.zeta.shape) > len(self.h.shape): zeta = self.zeta[key] res_index = slice(None) else: zeta = self.zeta res_index = key if self.h.ndim == zeta.ndim: # Assure a time-dimension exists zeta = zeta[np.newaxis, :] ti = zeta.shape[0] z_r = np.empty((ti, self.N) + self.h.shape, 'd') if self.Vtrans == 1: for n in range(ti): for k in range(self.N): z0 = self.hc * self.s_rho[k] + (self.h - self.hc) * self.Cs_r[k] z_r[n,k,:] = z0 + zeta[n,:] * (1.0 + z0 / self.h) elif self.Vtrans == 2 or self.Vtrans == 4: for n in range(ti): for k in range(self.N): z0 = (self.hc * self.s_rho[k] + self.h * self.Cs_r[k]) / \ (self.hc + self.h) z_r[n,k,:] = zeta[n,:] + (zeta[n,:] + self.h) * z0 return np.squeeze(z_r[res_index]) class z_w(object): """ return an object that can be indexed to return depths of w point z_w = z_w(h, hc, Np, s_w, Cs_w, zeta, Vtrans) """ def __init__(self, h, hc, Np, s_w, Cs_w, zeta, Vtrans): self.h = h self.hc = hc self.Np = Np self.s_w = s_w self.Cs_w = Cs_w self.zeta = zeta self.Vtrans = Vtrans def __getitem__(self, key): if isinstance(key, tuple) and len(self.zeta.shape) > len(self.h.shape): zeta = self.zeta[key[0]] res_index = (slice(None),) + key[1:] elif len(self.zeta.shape) > len(self.h.shape): zeta = self.zeta[key] res_index = slice(None) else: zeta = self.zeta res_index = key if self.h.ndim == zeta.ndim: # Assure a time-dimension exists zeta = zeta[np.newaxis, :] ti = zeta.shape[0] z_w = np.empty((ti, self.Np) + self.h.shape, 'd') if self.Vtrans == 1: for n in range(ti): for k in range(self.Np): z0 = self.hc * self.s_w[k] + (self.h - self.hc) * self.Cs_w[k] z_w[n,k,:] = z0 + zeta[n,:] * (1.0 + z0 / self.h) elif self.Vtrans == 2 or self.Vtrans == 4: for n in range(ti): for k in range(self.Np): z0 = (self.hc * self.s_w[k] + self.h * self.Cs_w[k]) / \ (self.hc + self.h) z_w[n,k,:] = zeta[n,:] + (zeta[n,:] + self.h) * z0 return np.squeeze(z_w[res_index]) def get_z_levels(self): """ Get a list of all the variables contained in netCDF file "filename" """ self.z_r=-self.h if len(self.z_r)==0: print(("No depth matrix found in file %s"%(self.selffilename)))
[ "numpy.tanh", "numpy.empty", "numpy.asarray", "numpy.zeros", "datetime.datetime", "numpy.arange", "numpy.exp", "numpy.squeeze", "warnings.warn", "numpy.cosh", "numpy.sinh" ]
[((131, 152), 'datetime.datetime', 'datetime', (['(2008)', '(8)', '(15)'], {}), '(2008, 8, 15)\n', (139, 152), False, 'from datetime import datetime\n'), ((168, 189), 'datetime.datetime', 'datetime', (['(2015)', '(7)', '(25)'], {}), '(2015, 7, 25)\n', (176, 189), False, 'from datetime import datetime\n'), ((1891, 1904), 'numpy.asarray', 'np.asarray', (['h'], {}), '(h)\n', (1901, 1904), True, 'import numpy as np\n'), ((3091, 3118), 'numpy.arange', 'np.arange', (['(1)', '(self.N + 1)', '(1)'], {}), '(1, self.N + 1, 1)\n', (3100, 3118), True, 'import numpy as np\n'), ((3233, 3257), 'numpy.arange', 'np.arange', (['(0)', 'self.Np', '(1)'], {}), '(0, self.Np, 1)\n', (3242, 3257), True, 'import numpy as np\n'), ((4563, 4576), 'numpy.asarray', 'np.asarray', (['h'], {}), '(h)\n', (4573, 4576), True, 'import numpy as np\n'), ((7425, 7438), 'numpy.asarray', 'np.asarray', (['h'], {}), '(h)\n', (7435, 7438), True, 'import numpy as np\n'), ((10228, 10270), 'numpy.empty', 'np.empty', (['((ti, self.N) + self.h.shape)', '"""d"""'], {}), "((ti, self.N) + self.h.shape, 'd')\n", (10236, 10270), True, 'import numpy as np\n'), ((10863, 10889), 'numpy.squeeze', 'np.squeeze', (['z_r[res_index]'], {}), '(z_r[res_index])\n', (10873, 10889), True, 'import numpy as np\n'), ((11836, 11879), 'numpy.empty', 'np.empty', (['((ti, self.Np) + self.h.shape)', '"""d"""'], {}), "((ti, self.Np) + self.h.shape, 'd')\n", (11844, 11879), True, 'import numpy as np\n'), ((12470, 12496), 'numpy.squeeze', 'np.squeeze', (['z_w[res_index]'], {}), '(z_w[res_index])\n', (12480, 12496), True, 'import numpy as np\n'), ((2689, 2706), 'numpy.zeros', 'np.zeros', (['h.shape'], {}), '(h.shape)\n', (2697, 2706), True, 'import numpy as np\n'), ((5051, 5068), 'numpy.zeros', 'np.zeros', (['h.shape'], {}), '(h.shape)\n', (5059, 5068), True, 'import numpy as np\n'), ((7858, 7875), 'numpy.zeros', 'np.zeros', (['h.shape'], {}), '(h.shape)\n', (7866, 7875), True, 'import numpy as np\n'), ((2312, 2578), 'warnings.warn', 'warnings.warn', (['("""Vertical transformation parameters are not defined correctly in either gridid.txt or in the history files: \n Tcline = %d and hmin = %d. \n You need to make sure that Tcline <= hmin when using transformation 1."""\n % (self.Tcline, self.hmin))'], {}), '(\n """Vertical transformation parameters are not defined correctly in either gridid.txt or in the history files: \n Tcline = %d and hmin = %d. \n You need to make sure that Tcline <= hmin when using transformation 1."""\n % (self.Tcline, self.hmin))\n', (2325, 2578), False, 'import warnings\n'), ((3405, 3439), 'numpy.sinh', 'np.sinh', (['(self.theta_s * self.s_rho)'], {}), '(self.theta_s * self.s_rho)\n', (3412, 3439), True, 'import numpy as np\n'), ((3442, 3463), 'numpy.sinh', 'np.sinh', (['self.theta_s'], {}), '(self.theta_s)\n', (3449, 3463), True, 'import numpy as np\n'), ((3822, 3854), 'numpy.sinh', 'np.sinh', (['(self.theta_s * self.s_w)'], {}), '(self.theta_s * self.s_w)\n', (3829, 3854), True, 'import numpy as np\n'), ((3857, 3878), 'numpy.sinh', 'np.sinh', (['self.theta_s'], {}), '(self.theta_s)\n', (3864, 3878), True, 'import numpy as np\n'), ((3485, 3531), 'numpy.tanh', 'np.tanh', (['(self.theta_s * (self.s_rho + self.p5))'], {}), '(self.theta_s * (self.s_rho + self.p5))\n', (3492, 3531), True, 'import numpy as np\n'), ((3900, 3944), 'numpy.tanh', 'np.tanh', (['(self.theta_s * (self.s_w + self.p5))'], {}), '(self.theta_s * (self.s_w + self.p5))\n', (3907, 3944), True, 'import numpy as np\n'), ((5640, 5674), 'numpy.cosh', 'np.cosh', (['(self.theta_s * self.s_rho)'], {}), '(self.theta_s * self.s_rho)\n', (5647, 5674), True, 'import numpy as np\n'), ((5702, 5723), 'numpy.cosh', 'np.cosh', (['self.theta_s'], {}), '(self.theta_s)\n', (5709, 5723), True, 'import numpy as np\n'), ((6381, 6413), 'numpy.cosh', 'np.cosh', (['(self.theta_s * self.s_w)'], {}), '(self.theta_s * self.s_w)\n', (6388, 6413), True, 'import numpy as np\n'), ((6441, 6462), 'numpy.cosh', 'np.cosh', (['self.theta_s'], {}), '(self.theta_s)\n', (6448, 6462), True, 'import numpy as np\n'), ((8454, 8488), 'numpy.cosh', 'np.cosh', (['(self.theta_s * self.s_rho)'], {}), '(self.theta_s * self.s_rho)\n', (8461, 8488), True, 'import numpy as np\n'), ((8516, 8537), 'numpy.cosh', 'np.cosh', (['self.theta_s'], {}), '(self.theta_s)\n', (8523, 8537), True, 'import numpy as np\n'), ((8648, 8675), 'numpy.exp', 'np.exp', (['(self.theta_b * Csur)'], {}), '(self.theta_b * Csur)\n', (8654, 8675), True, 'import numpy as np\n'), ((8722, 8743), 'numpy.exp', 'np.exp', (['(-self.theta_b)'], {}), '(-self.theta_b)\n', (8728, 8743), True, 'import numpy as np\n'), ((8913, 8945), 'numpy.cosh', 'np.cosh', (['(self.theta_s * self.s_w)'], {}), '(self.theta_s * self.s_w)\n', (8920, 8945), True, 'import numpy as np\n'), ((8973, 8994), 'numpy.cosh', 'np.cosh', (['self.theta_s'], {}), '(self.theta_s)\n', (8980, 8994), True, 'import numpy as np\n'), ((9103, 9130), 'numpy.exp', 'np.exp', (['(self.theta_b * Csur)'], {}), '(self.theta_b * Csur)\n', (9109, 9130), True, 'import numpy as np\n'), ((9178, 9199), 'numpy.exp', 'np.exp', (['(-self.theta_b)'], {}), '(-self.theta_b)\n', (9184, 9199), True, 'import numpy as np\n'), ((3569, 3600), 'numpy.tanh', 'np.tanh', (['(self.p5 * self.theta_s)'], {}), '(self.p5 * self.theta_s)\n', (3576, 3600), True, 'import numpy as np\n'), ((3982, 4013), 'numpy.tanh', 'np.tanh', (['(self.p5 * self.theta_s)'], {}), '(self.p5 * self.theta_s)\n', (3989, 4013), True, 'import numpy as np\n'), ((5794, 5840), 'numpy.sinh', 'np.sinh', (['(self.theta_b * (self.s_rho + self.c1))'], {}), '(self.theta_b * (self.s_rho + self.c1))\n', (5801, 5840), True, 'import numpy as np\n'), ((5868, 5889), 'numpy.sinh', 'np.sinh', (['self.theta_b'], {}), '(self.theta_b)\n', (5875, 5889), True, 'import numpy as np\n'), ((6533, 6577), 'numpy.sinh', 'np.sinh', (['(self.theta_b * (self.s_w + self.c1))'], {}), '(self.theta_b * (self.s_w + self.c1))\n', (6540, 6577), True, 'import numpy as np\n'), ((6605, 6626), 'numpy.sinh', 'np.sinh', (['self.theta_b'], {}), '(self.theta_b)\n', (6612, 6626), True, 'import numpy as np\n')]
import sys import pytest import numpy as np from numpy.testing import assert_array_equal, IS_PYPY class TestDLPack: @pytest.mark.skipif(IS_PYPY, reason="PyPy can't get refcounts.") def test_dunder_dlpack_refcount(self): x = np.arange(5) y = x.__dlpack__() assert sys.getrefcount(x) == 3 del y assert sys.getrefcount(x) == 2 def test_dunder_dlpack_stream(self): x = np.arange(5) x.__dlpack__(stream=None) with pytest.raises(RuntimeError): x.__dlpack__(stream=1) def test_strides_not_multiple_of_itemsize(self): dt = np.dtype([('int', np.int32), ('char', np.int8)]) y = np.zeros((5,), dtype=dt) z = y['int'] with pytest.raises(RuntimeError): np._from_dlpack(z) @pytest.mark.skipif(IS_PYPY, reason="PyPy can't get refcounts.") def test_from_dlpack_refcount(self): x = np.arange(5) y = np._from_dlpack(x) assert sys.getrefcount(x) == 3 del y assert sys.getrefcount(x) == 2 @pytest.mark.parametrize("dtype", [ np.int8, np.int16, np.int32, np.int64, np.uint8, np.uint16, np.uint32, np.uint64, np.float16, np.float32, np.float64, np.complex64, np.complex128 ]) def test_dtype_passthrough(self, dtype): x = np.arange(5, dtype=dtype) y = np._from_dlpack(x) assert y.dtype == x.dtype assert_array_equal(x, y) def test_invalid_dtype(self): x = np.asarray(np.datetime64('2021-05-27')) with pytest.raises(TypeError): np._from_dlpack(x) def test_invalid_byte_swapping(self): dt = np.dtype('=i8').newbyteorder() x = np.arange(5, dtype=dt) with pytest.raises(TypeError): np._from_dlpack(x) def test_non_contiguous(self): x = np.arange(25).reshape((5, 5)) y1 = x[0] assert_array_equal(y1, np._from_dlpack(y1)) y2 = x[:, 0] assert_array_equal(y2, np._from_dlpack(y2)) y3 = x[1, :] assert_array_equal(y3, np._from_dlpack(y3)) y4 = x[1] assert_array_equal(y4, np._from_dlpack(y4)) y5 = np.diagonal(x).copy() assert_array_equal(y5, np._from_dlpack(y5)) @pytest.mark.parametrize("ndim", range(33)) def test_higher_dims(self, ndim): shape = (1,) * ndim x = np.zeros(shape, dtype=np.float64) assert shape == np._from_dlpack(x).shape def test_dlpack_device(self): x = np.arange(5) assert x.__dlpack_device__() == (1, 0) y = np._from_dlpack(x) assert y.__dlpack_device__() == (1, 0) z = y[::2] assert z.__dlpack_device__() == (1, 0) def dlpack_deleter_exception(self): x = np.arange(5) _ = x.__dlpack__() raise RuntimeError def test_dlpack_destructor_exception(self): with pytest.raises(RuntimeError): self.dlpack_deleter_exception() def test_readonly(self): x = np.arange(5) x.flags.writeable = False with pytest.raises(TypeError): x.__dlpack__() def test_ndim0(self): x = np.array(1.0) y = np._from_dlpack(x) assert_array_equal(x, y) def test_size1dims_arrays(self): x = np.ndarray(dtype='f8', shape=(10, 5, 1), strides=(8, 80, 4), buffer=np.ones(1000, dtype=np.uint8), order='F') y = np._from_dlpack(x) assert_array_equal(x, y)
[ "numpy.datetime64", "numpy.testing.assert_array_equal", "numpy.dtype", "numpy.zeros", "numpy.ones", "sys.getrefcount", "pytest.raises", "pytest.mark.skipif", "numpy.arange", "numpy._from_dlpack", "numpy.array", "pytest.mark.parametrize", "numpy.diagonal" ]
[((124, 187), 'pytest.mark.skipif', 'pytest.mark.skipif', (['IS_PYPY'], {'reason': '"""PyPy can\'t get refcounts."""'}), '(IS_PYPY, reason="PyPy can\'t get refcounts.")\n', (142, 187), False, 'import pytest\n'), ((808, 871), 'pytest.mark.skipif', 'pytest.mark.skipif', (['IS_PYPY'], {'reason': '"""PyPy can\'t get refcounts."""'}), '(IS_PYPY, reason="PyPy can\'t get refcounts.")\n', (826, 871), False, 'import pytest\n'), ((1067, 1258), 'pytest.mark.parametrize', 'pytest.mark.parametrize', (['"""dtype"""', '[np.int8, np.int16, np.int32, np.int64, np.uint8, np.uint16, np.uint32, np.\n uint64, np.float16, np.float32, np.float64, np.complex64, np.complex128]'], {}), "('dtype', [np.int8, np.int16, np.int32, np.int64, np\n .uint8, np.uint16, np.uint32, np.uint64, np.float16, np.float32, np.\n float64, np.complex64, np.complex128])\n", (1090, 1258), False, 'import pytest\n'), ((243, 255), 'numpy.arange', 'np.arange', (['(5)'], {}), '(5)\n', (252, 255), True, 'import numpy as np\n'), ((429, 441), 'numpy.arange', 'np.arange', (['(5)'], {}), '(5)\n', (438, 441), True, 'import numpy as np\n'), ((621, 669), 'numpy.dtype', 'np.dtype', (["[('int', np.int32), ('char', np.int8)]"], {}), "([('int', np.int32), ('char', np.int8)])\n", (629, 669), True, 'import numpy as np\n'), ((682, 706), 'numpy.zeros', 'np.zeros', (['(5,)'], {'dtype': 'dt'}), '((5,), dtype=dt)\n', (690, 706), True, 'import numpy as np\n'), ((925, 937), 'numpy.arange', 'np.arange', (['(5)'], {}), '(5)\n', (934, 937), True, 'import numpy as np\n'), ((950, 968), 'numpy._from_dlpack', 'np._from_dlpack', (['x'], {}), '(x)\n', (965, 968), True, 'import numpy as np\n'), ((1344, 1369), 'numpy.arange', 'np.arange', (['(5)'], {'dtype': 'dtype'}), '(5, dtype=dtype)\n', (1353, 1369), True, 'import numpy as np\n'), ((1382, 1400), 'numpy._from_dlpack', 'np._from_dlpack', (['x'], {}), '(x)\n', (1397, 1400), True, 'import numpy as np\n'), ((1444, 1468), 'numpy.testing.assert_array_equal', 'assert_array_equal', (['x', 'y'], {}), '(x, y)\n', (1462, 1468), False, 'from numpy.testing import assert_array_equal, IS_PYPY\n'), ((1726, 1748), 'numpy.arange', 'np.arange', (['(5)'], {'dtype': 'dt'}), '(5, dtype=dt)\n', (1735, 1748), True, 'import numpy as np\n'), ((2403, 2436), 'numpy.zeros', 'np.zeros', (['shape'], {'dtype': 'np.float64'}), '(shape, dtype=np.float64)\n', (2411, 2436), True, 'import numpy as np\n'), ((2534, 2546), 'numpy.arange', 'np.arange', (['(5)'], {}), '(5)\n', (2543, 2546), True, 'import numpy as np\n'), ((2606, 2624), 'numpy._from_dlpack', 'np._from_dlpack', (['x'], {}), '(x)\n', (2621, 2624), True, 'import numpy as np\n'), ((2791, 2803), 'numpy.arange', 'np.arange', (['(5)'], {}), '(5)\n', (2800, 2803), True, 'import numpy as np\n'), ((3039, 3051), 'numpy.arange', 'np.arange', (['(5)'], {}), '(5)\n', (3048, 3051), True, 'import numpy as np\n'), ((3191, 3204), 'numpy.array', 'np.array', (['(1.0)'], {}), '(1.0)\n', (3199, 3204), True, 'import numpy as np\n'), ((3217, 3235), 'numpy._from_dlpack', 'np._from_dlpack', (['x'], {}), '(x)\n', (3232, 3235), True, 'import numpy as np\n'), ((3244, 3268), 'numpy.testing.assert_array_equal', 'assert_array_equal', (['x', 'y'], {}), '(x, y)\n', (3262, 3268), False, 'from numpy.testing import assert_array_equal, IS_PYPY\n'), ((3464, 3482), 'numpy._from_dlpack', 'np._from_dlpack', (['x'], {}), '(x)\n', (3479, 3482), True, 'import numpy as np\n'), ((3491, 3515), 'numpy.testing.assert_array_equal', 'assert_array_equal', (['x', 'y'], {}), '(x, y)\n', (3509, 3515), False, 'from numpy.testing import assert_array_equal, IS_PYPY\n'), ((298, 316), 'sys.getrefcount', 'sys.getrefcount', (['x'], {}), '(x)\n', (313, 316), False, 'import sys\n'), ((351, 369), 'sys.getrefcount', 'sys.getrefcount', (['x'], {}), '(x)\n', (366, 369), False, 'import sys\n'), ((490, 517), 'pytest.raises', 'pytest.raises', (['RuntimeError'], {}), '(RuntimeError)\n', (503, 517), False, 'import pytest\n'), ((742, 769), 'pytest.raises', 'pytest.raises', (['RuntimeError'], {}), '(RuntimeError)\n', (755, 769), False, 'import pytest\n'), ((783, 801), 'numpy._from_dlpack', 'np._from_dlpack', (['z'], {}), '(z)\n', (798, 801), True, 'import numpy as np\n'), ((984, 1002), 'sys.getrefcount', 'sys.getrefcount', (['x'], {}), '(x)\n', (999, 1002), False, 'import sys\n'), ((1037, 1055), 'sys.getrefcount', 'sys.getrefcount', (['x'], {}), '(x)\n', (1052, 1055), False, 'import sys\n'), ((1527, 1554), 'numpy.datetime64', 'np.datetime64', (['"""2021-05-27"""'], {}), "('2021-05-27')\n", (1540, 1554), True, 'import numpy as np\n'), ((1570, 1594), 'pytest.raises', 'pytest.raises', (['TypeError'], {}), '(TypeError)\n', (1583, 1594), False, 'import pytest\n'), ((1608, 1626), 'numpy._from_dlpack', 'np._from_dlpack', (['x'], {}), '(x)\n', (1623, 1626), True, 'import numpy as np\n'), ((1763, 1787), 'pytest.raises', 'pytest.raises', (['TypeError'], {}), '(TypeError)\n', (1776, 1787), False, 'import pytest\n'), ((1801, 1819), 'numpy._from_dlpack', 'np._from_dlpack', (['x'], {}), '(x)\n', (1816, 1819), True, 'import numpy as np\n'), ((1948, 1967), 'numpy._from_dlpack', 'np._from_dlpack', (['y1'], {}), '(y1)\n', (1963, 1967), True, 'import numpy as np\n'), ((2022, 2041), 'numpy._from_dlpack', 'np._from_dlpack', (['y2'], {}), '(y2)\n', (2037, 2041), True, 'import numpy as np\n'), ((2096, 2115), 'numpy._from_dlpack', 'np._from_dlpack', (['y3'], {}), '(y3)\n', (2111, 2115), True, 'import numpy as np\n'), ((2167, 2186), 'numpy._from_dlpack', 'np._from_dlpack', (['y4'], {}), '(y4)\n', (2182, 2186), True, 'import numpy as np\n'), ((2255, 2274), 'numpy._from_dlpack', 'np._from_dlpack', (['y5'], {}), '(y5)\n', (2270, 2274), True, 'import numpy as np\n'), ((2924, 2951), 'pytest.raises', 'pytest.raises', (['RuntimeError'], {}), '(RuntimeError)\n', (2937, 2951), False, 'import pytest\n'), ((3099, 3123), 'pytest.raises', 'pytest.raises', (['TypeError'], {}), '(TypeError)\n', (3112, 3123), False, 'import pytest\n'), ((1683, 1698), 'numpy.dtype', 'np.dtype', (['"""=i8"""'], {}), "('=i8')\n", (1691, 1698), True, 'import numpy as np\n'), ((1868, 1881), 'numpy.arange', 'np.arange', (['(25)'], {}), '(25)\n', (1877, 1881), True, 'import numpy as np\n'), ((2202, 2216), 'numpy.diagonal', 'np.diagonal', (['x'], {}), '(x)\n', (2213, 2216), True, 'import numpy as np\n'), ((2462, 2480), 'numpy._from_dlpack', 'np._from_dlpack', (['x'], {}), '(x)\n', (2477, 2480), True, 'import numpy as np\n'), ((3410, 3439), 'numpy.ones', 'np.ones', (['(1000)'], {'dtype': 'np.uint8'}), '(1000, dtype=np.uint8)\n', (3417, 3439), True, 'import numpy as np\n')]
# Copyright 2012 <NAME> # Copyright 2008 (C) Nicira, Inc. # # This file is part of POX. # # POX is free software: you can redistribute it and/or modify # it under the terms of the GNU General Public License as published by # the Free Software Foundation, either version 3 of the License, or # (at your option) any later version. # # POX is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU General Public License for more details. # # You should have received a copy of the GNU General Public License # along with POX. If not, see <http://www.gnu.org/licenses/>. # This file is derived from the packet library in NOX, which was # developed by Nicira, Inc. #====================================================================== # # IGMP v1/v2 # # 1 1 1 1 1 1 1 1 1 1 2 2 2 2 2 2 2 2 2 2 3 3 # 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 0 1 # +-+-+-+-+-+-+-+-+-+-+-+-+-+-+-+-+-+-+-+-+-+-+-+-+-+-+-+-+-+-+-+-+ # | Ver * | Type | MRT/Unused ** | Checksum | # +-------+-------+---------------+-------------------------------+ # | Group Address | # +-------------------------------+-------------------------------+ # # * In v2, there is no Version field, and Type is the whole 8 bits # ** Max Response Time in v2 only # #====================================================================== #TODO: Support for IGMP v3 import struct from packet_utils import * from packet_base import packet_base from pox.lib.addresses import * MEMBERSHIP_QUERY = 0x11 MEMBERSHIP_REPORT = 0x12 MEMBERSHIP_REPORT_V2 = 0x16 LEAVE_GROUP_V2 = 0x17 # IGMP multicast address IGMP_ADDRESS = IPAddr("172.16.31.10") # IGMP IP protocol IGMP_PROTOCOL = 2 class igmp (packet_base): """ IGMP Message """ MIN_LEN = 8 IGMP_ADDRESS = IGMP_ADDRESS IGMP_PROTOCOL = IGMP_PROTOCOL MEMBERSHIP_QUERY = MEMBERSHIP_QUERY MEMBERSHIP_REPORT = MEMBERSHIP_REPORT MEMBERSHIP_REPORT_V2 = MEMBERSHIP_REPORT_V2 LEAVE_GROUP_V2 = LEAVE_GROUP_V2 def __init__(self, raw=None, prev=None, **kw): packet_base.__init__(self) self.prev = prev self.ver_and_type = 0 self.max_response_time = 0 self.csum = 0 self.address = None self.extra = b'' if raw is not None: self.parse(raw) self._init(kw) def hdr (self, payload): s = struct.pack("!BBHi", self.ver_and_type, self.max_response_time, 0, self.address.toSigned(networkOrder=False)) s += self.extra self.csum = checksum(s) s = struct.pack("!BBHi", self.ver_and_type, self.max_response_time, self.csum, self.address.toSigned(networkOrder=False)) s += self.extra return s def parse (self, raw): assert isinstance(raw, bytes) self.raw = raw dlen = len(raw) if dlen < self.MIN_LEN: self.msg('packet data too short to parse') return None self.ver_and_type, self.max_response_time, self.csum, ip = \ struct.unpack("!BBHi", raw[:self.MIN_LEN]) self.extra = raw[self.MIN_LEN:] self.address = IPAddr(ip, networkOrder = False) s = struct.pack("!BBHi", self.ver_and_type, self.max_response_time, 0, self.address.toSigned(networkOrder=False)) s += self.extra csum = checksum(s) if csum != self.csum: self.err("IGMP hecksums don't match") else: self.parsed = True def __str__ (self): s = "[IGMP " s += "vt:%02x %s" % (self.ver_and_type, self.address) return s + "]"
[ "packet_base.packet_base.__init__", "struct.unpack" ]
[((2286, 2312), 'packet_base.packet_base.__init__', 'packet_base.__init__', (['self'], {}), '(self)\n', (2306, 2312), False, 'from packet_base import packet_base\n'), ((3184, 3226), 'struct.unpack', 'struct.unpack', (['"""!BBHi"""', 'raw[:self.MIN_LEN]'], {}), "('!BBHi', raw[:self.MIN_LEN])\n", (3197, 3226), False, 'import struct\n')]
#! /usr/bin/env python # -*- coding: utf-8 -*- """ Python objects for modeling Consumer Price Index (CPI) data structures. """ import collections from datetime import date from pandas import json_normalize # CPI tools from .errors import CPIObjectDoesNotExist from .defaults import DEFAULTS_SERIES_ATTRS # Logging import logging logger = logging.getLogger(__name__) logger.addHandler(logging.NullHandler()) class MappingList(list): """ A custom list that allows for lookups by attribute. """ def __init__(self): self._id_dict = {} self._name_dict = {} def get_by_id(self, value): try: return self._id_dict[value] except KeyError: raise CPIObjectDoesNotExist("Object with id {} could not be found".format(value)) def get_by_name(self, value): try: return self._name_dict[value] except KeyError: raise CPIObjectDoesNotExist("Object with id {} could not be found".format(value)) def append(self, item): """ Override to default append method that allows dictionary-style lookups """ # Add to dictionary lookup self._id_dict[item.id] = item self._name_dict[item.name] = item # Append to list super(MappingList, self).append(item) class SeriesList(list): """ A custom list of indexes in a series. """ SURVEYS = { 'All urban consumers': 'CU', 'Urban wage earners and clerical workers': 'CW' } SEASONALITIES = { True: 'S', False: 'U' } def __init__(self, periodicities, areas, items): self.periodicities = periodicities self.areas = areas self.items = items self._dict = {} def to_dataframe(self): """ Returns the list as a pandas DataFrame. """ dict_list = [obj.__dict__() for obj in self] return json_normalize(dict_list, sep="_") def append(self, item): """ Override to default append method that allows validation and dictionary-style lookups """ # Valid item type if not isinstance(item, Series): raise TypeError("Only Series objects can be added to this list.") # Add to dictionary lookup self._dict[item.id] = item # Append to list super(SeriesList, self).append(item) def get_by_id(self, value): """ Returns the CPI series object with the provided identifier code. """ logger.debug("Retrieving series with id {}".format(value)) try: return self._dict[value] except KeyError: raise CPIObjectDoesNotExist("Object with id {} could not be found".format(value)) def get( self, survey=DEFAULTS_SERIES_ATTRS['survey'], seasonally_adjusted=DEFAULTS_SERIES_ATTRS['seasonally_adjusted'], periodicity=DEFAULTS_SERIES_ATTRS['periodicity'], area=DEFAULTS_SERIES_ATTRS['area'], items=DEFAULTS_SERIES_ATTRS['items'] ): """ Returns a single CPI Series object based on the input. The default series is returned if not configuration is made to the keyword arguments. """ # Get all the codes for these humanized input. try: survey_code = self.SURVEYS[survey] except KeyError: raise CPIObjectDoesNotExist("Survey with the name {} does not exist".format(survey)) try: seasonality_code = self.SEASONALITIES[seasonally_adjusted] except KeyError: raise CPIObjectDoesNotExist("Seasonality {} does not exist".format(seasonally_adjusted)) # Generate the series id series_id = "{}{}{}{}{}".format( survey_code, seasonality_code, self.periodicities.get_by_name(periodicity).code, self.areas.get_by_name(area).code, self.items.get_by_name(items).code ) # Pull the series return self.get_by_id(series_id) class BaseObject(object): """ An abstract base class for all the models. """ def __repr__(self): return "<{}: {}>".format(self.__class__.__name__, self.__str__()) def __eq__(self, other): return self.id == other.id def __str__(self): return self.name class Area(BaseObject): """ A geographical area where prices are gathered monthly. """ def __init__(self, code, name): self.id = code self.code = code self.name = name def __dict__(self): return { "id": self.id, "code": self.code, "name": self.name } class Item(BaseObject): """ A consumer item that has its price tracked. """ def __init__(self, code, name): self.id = code self.code = code self.name = name def __dict__(self): return { "id": self.id, "code": self.code, "name": self.name } class Period(BaseObject): """ A time period tracked by the CPI. """ def __init__(self, code, abbreviation, name): self.id = code self.code = code self.abbreviation = abbreviation self.name = name def __dict__(self): return { "id": self.id, "code": self.code, "abbreviation": self.abbreviation, "name": self.name, "month": self.month, "type": self.type } @property def month(self): """ Returns the month integer for the period. """ if self.id in ["M13", "S01", "S03"]: return 1 elif self.id == "S02": return 7 else: return int(self.id.replace("M", "")) @property def type(self): """ Returns a string classifying the period. """ if self.id in ["M13", "S03"]: return "annual" elif self.id in ["S01", "S02"]: return "semiannual" else: return "monthly" class Periodicity(BaseObject): """ A time interval tracked by the CPI. """ def __init__(self, code, name): self.id = code self.code = code self.name = name def __dict__(self): return { "id": self.id, "code": self.code, "name": self.name } class Series(BaseObject): """ A set of CPI data observed over an extended period of time over consistent time intervals ranging from a specific consumer item in a specific geographical area whose price is gathered monthly to a category of worker in a specific industry whose employment rate is being recorded monthly, etc. Yes, that's the offical government definition. I'm not kidding. """ def __init__( self, id, title, survey, seasonally_adjusted, periodicity, area, items ): self.id = id self.title = title self.survey = survey self.seasonally_adjusted = seasonally_adjusted self.periodicity = periodicity self.area = area self.items = items self._indexes = { 'annual': collections.OrderedDict(), 'monthly': collections.OrderedDict(), 'semiannual': collections.OrderedDict(), } def __str__(self): return "{}: {}".format(self.id, self.title) def __dict__(self): return { "id": self.id, "title": self.title, "survey": self.survey, "seasonally_adjusted": self.seasonally_adjusted, "periodicity": self.periodicity.__dict__(), "area": self.area.__dict__(), "items": self.items.__dict__() } def to_dataframe(self): """ Returns this series and all its indexes as a pandas DataFrame. """ dict_list = [obj.__dict__() for obj in self.indexes] return json_normalize(dict_list, sep="_") @property def indexes(self): flat = [] for obj in self._indexes.values(): flat.extend(obj.values()) return flat @property def latest_month(self): if not self._indexes['monthly']: return None return max([i.date for i in self._indexes['monthly'].values()]) @property def latest_year(self): if not self._indexes['annual']: return None return max([i.year for i in self._indexes['annual'].values()]) def get_index_by_date(self, date, period_type='annual'): try: return self._indexes[period_type][date] except KeyError: raise CPIObjectDoesNotExist("Index of {} type for {} does not exist".format(period_type, date)) class Index(BaseObject): """ A Consumer Price Index value generated by the Bureau of Labor Statistics. """ def __init__(self, series, year, period, value): self.series = series self.year = year self.period = period self.value = value def __str__(self): return "{} ({}): {}".format(self.date, self.period, self.value) def __eq__(self, other): return ( self.value == other.value and self.series == other.series and self.year == other.year and self.period == other.period ) def __dict__(self): return { "series": self.series.__dict__(), "year": self.year, "date": str(self.date), "period": self.period.__dict__(), "value": self.value } @property def date(self): """ Accepts a row from the raw BLS data. Returns a Python date object based on its period. """ return date(self.year, self.period.month, 1)
[ "pandas.json_normalize", "datetime.date", "logging.NullHandler", "collections.OrderedDict", "logging.getLogger" ]
[((340, 367), 'logging.getLogger', 'logging.getLogger', (['__name__'], {}), '(__name__)\n', (357, 367), False, 'import logging\n'), ((386, 407), 'logging.NullHandler', 'logging.NullHandler', ([], {}), '()\n', (405, 407), False, 'import logging\n'), ((1930, 1964), 'pandas.json_normalize', 'json_normalize', (['dict_list'], {'sep': '"""_"""'}), "(dict_list, sep='_')\n", (1944, 1964), False, 'from pandas import json_normalize\n'), ((8084, 8118), 'pandas.json_normalize', 'json_normalize', (['dict_list'], {'sep': '"""_"""'}), "(dict_list, sep='_')\n", (8098, 8118), False, 'from pandas import json_normalize\n'), ((9908, 9945), 'datetime.date', 'date', (['self.year', 'self.period.month', '(1)'], {}), '(self.year, self.period.month, 1)\n', (9912, 9945), False, 'from datetime import date\n'), ((7319, 7344), 'collections.OrderedDict', 'collections.OrderedDict', ([], {}), '()\n', (7342, 7344), False, 'import collections\n'), ((7369, 7394), 'collections.OrderedDict', 'collections.OrderedDict', ([], {}), '()\n', (7392, 7394), False, 'import collections\n'), ((7422, 7447), 'collections.OrderedDict', 'collections.OrderedDict', ([], {}), '()\n', (7445, 7447), False, 'import collections\n')]
import logging from monai.apps.deepgrow.interaction import Interaction from monai.apps.deepgrow.transforms import ( AddGuidanceSignald, AddInitialSeedPointd, AddRandomGuidanced, FindAllValidSlicesd, FindDiscrepancyRegionsd, SpatialCropForegroundd, ) from monai.inferers import SimpleInferer from monai.losses import DiceLoss from monai.transforms import ( Activationsd, AddChanneld, AsChannelFirstd, AsDiscreted, Compose, LoadImaged, NormalizeIntensityd, Orientationd, Resized, Spacingd, ToNumpyd, ToTensord, ) from monailabel.utils.train.basic_train import BasicTrainTask from .handler import DeepgrowStatsHandler from .transforms import Random2DSlice logger = logging.getLogger(__name__) class TrainDeepgrow(BasicTrainTask): def __init__( self, output_dir, train_datalist, val_datalist, network, dimension, roi_size, model_size, max_train_interactions, max_val_interactions, **kwargs, ): super().__init__(output_dir, train_datalist, val_datalist, network, **kwargs) self.dimension = dimension self.roi_size = roi_size self.model_size = model_size self.max_train_interactions = max_train_interactions self.max_val_interactions = max_val_interactions def get_click_transforms(self): return Compose( [ Activationsd(keys="pred", sigmoid=True), ToNumpyd(keys=("image", "label", "pred", "probability", "guidance")), FindDiscrepancyRegionsd(label="label", pred="pred", discrepancy="discrepancy"), AddRandomGuidanced(guidance="guidance", discrepancy="discrepancy", probability="probability"), AddGuidanceSignald(image="image", guidance="guidance", batched=True), ToTensord(keys=("image", "label")), ] ) def loss_function(self): return DiceLoss(sigmoid=True, squared_pred=True) def train_pre_transforms(self): # Dataset preparation t = [ LoadImaged(keys=("image", "label")), AsChannelFirstd(keys=("image", "label")), Spacingd(keys=("image", "label"), pixdim=(1.0, 1.0, 1.0), mode=("bilinear", "nearest")), Orientationd(keys=("image", "label"), axcodes="RAS"), ] # Pick random slice (run more epochs to cover max slices for 2D training) if self.dimension == 2: t.append(Random2DSlice(image="image", label="label")) # Training t.extend( [ AddChanneld(keys=("image", "label")), SpatialCropForegroundd(keys=("image", "label"), source_key="label", spatial_size=self.roi_size), Resized(keys=("image", "label"), spatial_size=self.model_size, mode=("area", "nearest")), NormalizeIntensityd(keys="image"), ] ) if self.dimension == 3: t.append(FindAllValidSlicesd(label="label", sids="sids")) t.extend( [ AddInitialSeedPointd(label="label", guidance="guidance", sids="sids"), AddGuidanceSignald(image="image", guidance="guidance"), ToTensord(keys=("image", "label")), ] ) return Compose(t) def train_post_transforms(self): return Compose( [ Activationsd(keys="pred", sigmoid=True), AsDiscreted(keys="pred", threshold_values=True, logit_thresh=0.5), ] ) def train_handlers(self): handlers = super().train_handlers() handlers.append(DeepgrowStatsHandler(log_dir=self.output_dir, tag_name="val_dice", image_interval=1)) return handlers def val_pre_transforms(self): return self.train_pre_transforms() def val_inferer(self): return SimpleInferer() def train_iteration_update(self): return Interaction( transforms=self.get_click_transforms(), max_interactions=self.max_train_interactions, key_probability="probability", train=True, ) def val_iteration_update(self): return Interaction( transforms=self.get_click_transforms(), max_interactions=self.max_val_interactions, key_probability="probability", train=False, )
[ "monai.transforms.AddChanneld", "monai.transforms.ToNumpyd", "monai.apps.deepgrow.transforms.AddGuidanceSignald", "monai.transforms.LoadImaged", "monai.transforms.AsChannelFirstd", "monai.transforms.Orientationd", "monai.inferers.SimpleInferer", "monai.transforms.NormalizeIntensityd", "monai.apps.deepgrow.transforms.AddInitialSeedPointd", "monai.losses.DiceLoss", "monai.transforms.Activationsd", "monai.apps.deepgrow.transforms.AddRandomGuidanced", "monai.apps.deepgrow.transforms.FindAllValidSlicesd", "monai.transforms.Resized", "monai.transforms.AsDiscreted", "monai.transforms.ToTensord", "monai.transforms.Spacingd", "monai.transforms.Compose", "monai.apps.deepgrow.transforms.SpatialCropForegroundd", "monai.apps.deepgrow.transforms.FindDiscrepancyRegionsd", "logging.getLogger" ]
[((738, 765), 'logging.getLogger', 'logging.getLogger', (['__name__'], {}), '(__name__)\n', (755, 765), False, 'import logging\n'), ((2006, 2047), 'monai.losses.DiceLoss', 'DiceLoss', ([], {'sigmoid': '(True)', 'squared_pred': '(True)'}), '(sigmoid=True, squared_pred=True)\n', (2014, 2047), False, 'from monai.losses import DiceLoss\n'), ((3375, 3385), 'monai.transforms.Compose', 'Compose', (['t'], {}), '(t)\n', (3382, 3385), False, 'from monai.transforms import Activationsd, AddChanneld, AsChannelFirstd, AsDiscreted, Compose, LoadImaged, NormalizeIntensityd, Orientationd, Resized, Spacingd, ToNumpyd, ToTensord\n'), ((3956, 3971), 'monai.inferers.SimpleInferer', 'SimpleInferer', ([], {}), '()\n', (3969, 3971), False, 'from monai.inferers import SimpleInferer\n'), ((2141, 2176), 'monai.transforms.LoadImaged', 'LoadImaged', ([], {'keys': "('image', 'label')"}), "(keys=('image', 'label'))\n", (2151, 2176), False, 'from monai.transforms import Activationsd, AddChanneld, AsChannelFirstd, AsDiscreted, Compose, LoadImaged, NormalizeIntensityd, Orientationd, Resized, Spacingd, ToNumpyd, ToTensord\n'), ((2190, 2230), 'monai.transforms.AsChannelFirstd', 'AsChannelFirstd', ([], {'keys': "('image', 'label')"}), "(keys=('image', 'label'))\n", (2205, 2230), False, 'from monai.transforms import Activationsd, AddChanneld, AsChannelFirstd, AsDiscreted, Compose, LoadImaged, NormalizeIntensityd, Orientationd, Resized, Spacingd, ToNumpyd, ToTensord\n'), ((2244, 2335), 'monai.transforms.Spacingd', 'Spacingd', ([], {'keys': "('image', 'label')", 'pixdim': '(1.0, 1.0, 1.0)', 'mode': "('bilinear', 'nearest')"}), "(keys=('image', 'label'), pixdim=(1.0, 1.0, 1.0), mode=('bilinear',\n 'nearest'))\n", (2252, 2335), False, 'from monai.transforms import Activationsd, AddChanneld, AsChannelFirstd, AsDiscreted, Compose, LoadImaged, NormalizeIntensityd, Orientationd, Resized, Spacingd, ToNumpyd, ToTensord\n'), ((2345, 2397), 'monai.transforms.Orientationd', 'Orientationd', ([], {'keys': "('image', 'label')", 'axcodes': '"""RAS"""'}), "(keys=('image', 'label'), axcodes='RAS')\n", (2357, 2397), False, 'from monai.transforms import Activationsd, AddChanneld, AsChannelFirstd, AsDiscreted, Compose, LoadImaged, NormalizeIntensityd, Orientationd, Resized, Spacingd, ToNumpyd, ToTensord\n'), ((1465, 1504), 'monai.transforms.Activationsd', 'Activationsd', ([], {'keys': '"""pred"""', 'sigmoid': '(True)'}), "(keys='pred', sigmoid=True)\n", (1477, 1504), False, 'from monai.transforms import Activationsd, AddChanneld, AsChannelFirstd, AsDiscreted, Compose, LoadImaged, NormalizeIntensityd, Orientationd, Resized, Spacingd, ToNumpyd, ToTensord\n'), ((1522, 1590), 'monai.transforms.ToNumpyd', 'ToNumpyd', ([], {'keys': "('image', 'label', 'pred', 'probability', 'guidance')"}), "(keys=('image', 'label', 'pred', 'probability', 'guidance'))\n", (1530, 1590), False, 'from monai.transforms import Activationsd, AddChanneld, AsChannelFirstd, AsDiscreted, Compose, LoadImaged, NormalizeIntensityd, Orientationd, Resized, Spacingd, ToNumpyd, ToTensord\n'), ((1608, 1686), 'monai.apps.deepgrow.transforms.FindDiscrepancyRegionsd', 'FindDiscrepancyRegionsd', ([], {'label': '"""label"""', 'pred': '"""pred"""', 'discrepancy': '"""discrepancy"""'}), "(label='label', pred='pred', discrepancy='discrepancy')\n", (1631, 1686), False, 'from monai.apps.deepgrow.transforms import AddGuidanceSignald, AddInitialSeedPointd, AddRandomGuidanced, FindAllValidSlicesd, FindDiscrepancyRegionsd, SpatialCropForegroundd\n'), ((1704, 1801), 'monai.apps.deepgrow.transforms.AddRandomGuidanced', 'AddRandomGuidanced', ([], {'guidance': '"""guidance"""', 'discrepancy': '"""discrepancy"""', 'probability': '"""probability"""'}), "(guidance='guidance', discrepancy='discrepancy',\n probability='probability')\n", (1722, 1801), False, 'from monai.apps.deepgrow.transforms import AddGuidanceSignald, AddInitialSeedPointd, AddRandomGuidanced, FindAllValidSlicesd, FindDiscrepancyRegionsd, SpatialCropForegroundd\n'), ((1815, 1883), 'monai.apps.deepgrow.transforms.AddGuidanceSignald', 'AddGuidanceSignald', ([], {'image': '"""image"""', 'guidance': '"""guidance"""', 'batched': '(True)'}), "(image='image', guidance='guidance', batched=True)\n", (1833, 1883), False, 'from monai.apps.deepgrow.transforms import AddGuidanceSignald, AddInitialSeedPointd, AddRandomGuidanced, FindAllValidSlicesd, FindDiscrepancyRegionsd, SpatialCropForegroundd\n'), ((1901, 1935), 'monai.transforms.ToTensord', 'ToTensord', ([], {'keys': "('image', 'label')"}), "(keys=('image', 'label'))\n", (1910, 1935), False, 'from monai.transforms import Activationsd, AddChanneld, AsChannelFirstd, AsDiscreted, Compose, LoadImaged, NormalizeIntensityd, Orientationd, Resized, Spacingd, ToNumpyd, ToTensord\n'), ((2658, 2694), 'monai.transforms.AddChanneld', 'AddChanneld', ([], {'keys': "('image', 'label')"}), "(keys=('image', 'label'))\n", (2669, 2694), False, 'from monai.transforms import Activationsd, AddChanneld, AsChannelFirstd, AsDiscreted, Compose, LoadImaged, NormalizeIntensityd, Orientationd, Resized, Spacingd, ToNumpyd, ToTensord\n'), ((2712, 2811), 'monai.apps.deepgrow.transforms.SpatialCropForegroundd', 'SpatialCropForegroundd', ([], {'keys': "('image', 'label')", 'source_key': '"""label"""', 'spatial_size': 'self.roi_size'}), "(keys=('image', 'label'), source_key='label',\n spatial_size=self.roi_size)\n", (2734, 2811), False, 'from monai.apps.deepgrow.transforms import AddGuidanceSignald, AddInitialSeedPointd, AddRandomGuidanced, FindAllValidSlicesd, FindDiscrepancyRegionsd, SpatialCropForegroundd\n'), ((2825, 2917), 'monai.transforms.Resized', 'Resized', ([], {'keys': "('image', 'label')", 'spatial_size': 'self.model_size', 'mode': "('area', 'nearest')"}), "(keys=('image', 'label'), spatial_size=self.model_size, mode=('area',\n 'nearest'))\n", (2832, 2917), False, 'from monai.transforms import Activationsd, AddChanneld, AsChannelFirstd, AsDiscreted, Compose, LoadImaged, NormalizeIntensityd, Orientationd, Resized, Spacingd, ToNumpyd, ToTensord\n'), ((2931, 2964), 'monai.transforms.NormalizeIntensityd', 'NormalizeIntensityd', ([], {'keys': '"""image"""'}), "(keys='image')\n", (2950, 2964), False, 'from monai.transforms import Activationsd, AddChanneld, AsChannelFirstd, AsDiscreted, Compose, LoadImaged, NormalizeIntensityd, Orientationd, Resized, Spacingd, ToNumpyd, ToTensord\n'), ((3043, 3090), 'monai.apps.deepgrow.transforms.FindAllValidSlicesd', 'FindAllValidSlicesd', ([], {'label': '"""label"""', 'sids': '"""sids"""'}), "(label='label', sids='sids')\n", (3062, 3090), False, 'from monai.apps.deepgrow.transforms import AddGuidanceSignald, AddInitialSeedPointd, AddRandomGuidanced, FindAllValidSlicesd, FindDiscrepancyRegionsd, SpatialCropForegroundd\n'), ((3140, 3209), 'monai.apps.deepgrow.transforms.AddInitialSeedPointd', 'AddInitialSeedPointd', ([], {'label': '"""label"""', 'guidance': '"""guidance"""', 'sids': '"""sids"""'}), "(label='label', guidance='guidance', sids='sids')\n", (3160, 3209), False, 'from monai.apps.deepgrow.transforms import AddGuidanceSignald, AddInitialSeedPointd, AddRandomGuidanced, FindAllValidSlicesd, FindDiscrepancyRegionsd, SpatialCropForegroundd\n'), ((3227, 3281), 'monai.apps.deepgrow.transforms.AddGuidanceSignald', 'AddGuidanceSignald', ([], {'image': '"""image"""', 'guidance': '"""guidance"""'}), "(image='image', guidance='guidance')\n", (3245, 3281), False, 'from monai.apps.deepgrow.transforms import AddGuidanceSignald, AddInitialSeedPointd, AddRandomGuidanced, FindAllValidSlicesd, FindDiscrepancyRegionsd, SpatialCropForegroundd\n'), ((3299, 3333), 'monai.transforms.ToTensord', 'ToTensord', ([], {'keys': "('image', 'label')"}), "(keys=('image', 'label'))\n", (3308, 3333), False, 'from monai.transforms import Activationsd, AddChanneld, AsChannelFirstd, AsDiscreted, Compose, LoadImaged, NormalizeIntensityd, Orientationd, Resized, Spacingd, ToNumpyd, ToTensord\n'), ((3478, 3517), 'monai.transforms.Activationsd', 'Activationsd', ([], {'keys': '"""pred"""', 'sigmoid': '(True)'}), "(keys='pred', sigmoid=True)\n", (3490, 3517), False, 'from monai.transforms import Activationsd, AddChanneld, AsChannelFirstd, AsDiscreted, Compose, LoadImaged, NormalizeIntensityd, Orientationd, Resized, Spacingd, ToNumpyd, ToTensord\n'), ((3535, 3600), 'monai.transforms.AsDiscreted', 'AsDiscreted', ([], {'keys': '"""pred"""', 'threshold_values': '(True)', 'logit_thresh': '(0.5)'}), "(keys='pred', threshold_values=True, logit_thresh=0.5)\n", (3546, 3600), False, 'from monai.transforms import Activationsd, AddChanneld, AsChannelFirstd, AsDiscreted, Compose, LoadImaged, NormalizeIntensityd, Orientationd, Resized, Spacingd, ToNumpyd, ToTensord\n')]
# -*- coding: utf-8 -*- """ Created on Sat Apr 4 07:10:55 2020 @author: sj """ import numpy as np # left corner as (0,0), US in West and Asia in East # only validated in Asia, North and East #x as latitude (180), y as longitude (360), # x = 114288 # latitude, filepath # y = 214078 # longitude, filename # z = zoom level # x,y,z = 114288,214078,18 def g2latlng(x,y,z=18,vbs=0): x,y = x+0.5,y+0.5 # to center n = np.power(2,z) lng = y / n * 360.0 - 180.0 lat_rad = np.arctan(np.sinh(np.pi * (1 - 2 * x / n))) lat = lat_rad * 180.0 / np.pi if vbs: print(x,lat,y,lng) return lat,lng def to60(lat,lng,vbs=0): lat0 = np.floor(lat) tmp = (lat - lat0) * 60 lat1 = np.floor(tmp) lat2 = (tmp - lat1) * 60 lat = int(lat0),int(lat1),lat2 lng0 = np.floor(lng) tmp = (lng - lng0) * 60 lng1 = np.floor(tmp) lng2 = (tmp - lng1) * 60 lng = int(lng0),int(lng1),lng2 if vbs: print(lat,lng) return lat,lng if __name__ == '__main__': if True: x,y,z = 114453,213769,18 lat,lng = g2latlng(x,y,z,vbs=1) to60(lat,lng,vbs=1)
[ "numpy.power", "numpy.floor", "numpy.sinh" ]
[((444, 458), 'numpy.power', 'np.power', (['(2)', 'z'], {}), '(2, z)\n', (452, 458), True, 'import numpy as np\n'), ((686, 699), 'numpy.floor', 'np.floor', (['lat'], {}), '(lat)\n', (694, 699), True, 'import numpy as np\n'), ((741, 754), 'numpy.floor', 'np.floor', (['tmp'], {}), '(tmp)\n', (749, 754), True, 'import numpy as np\n'), ((843, 856), 'numpy.floor', 'np.floor', (['lng'], {}), '(lng)\n', (851, 856), True, 'import numpy as np\n'), ((898, 911), 'numpy.floor', 'np.floor', (['tmp'], {}), '(tmp)\n', (906, 911), True, 'import numpy as np\n'), ((516, 548), 'numpy.sinh', 'np.sinh', (['(np.pi * (1 - 2 * x / n))'], {}), '(np.pi * (1 - 2 * x / n))\n', (523, 548), True, 'import numpy as np\n')]
# Licensed to the Apache Software Foundation (ASF) under one # or more contributor license agreements. See the NOTICE file # distributed with this work for additional information # regarding copyright ownership. The ASF licenses this file # to you under the Apache License, Version 2.0 (the # "License"); you may not use this file except in compliance # with the License. You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, # software distributed under the License is distributed on an # "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY # KIND, either express or implied. See the License for the # specific language governing permissions and limitations # under the License. import os from unittest import mock from airflow.providers.google.cloud.transfers.gdrive_to_gcs import GoogleDriveToGCSOperator FOLDER_ID = os.environ.get("GCP_GDRIVE_FOLDER_ID", "abcd1234") DRIVE_ID = os.environ.get("GCP_GDRIVE_DRIVE_ID", "abcd1234") FILE_NAME = os.environ.get("GCP_GDRIVE_TO_GCS_FILE_NAME", "gdrive_to_gcs_file.txt") BUCKET = os.environ.get("GCP_GDRIVE_TO_GCS_BUCKET", "gdrive-to-gcs-bucket") OBJECT = "prefix/test.txt" GCP_CONN_ID = "google_cloud_default" IMPERSONATION_CHAIN = ["ACCOUNT_1", "ACCOUNT_2", "ACCOUNT_3"] class TestGoogleDriveToGCSOperator: @mock.patch("airflow.providers.google.cloud.transfers.gdrive_to_gcs.GCSHook") @mock.patch("airflow.providers.google.cloud.transfers.gdrive_to_gcs.GoogleDriveHook") def test_execute(self, mock_gdrive_hook, mock_gcs_hook): context = {} op = GoogleDriveToGCSOperator( task_id="test_task", folder_id=FOLDER_ID, file_name=FILE_NAME, drive_id=DRIVE_ID, bucket_name=BUCKET, object_name=OBJECT, gcp_conn_id=GCP_CONN_ID, impersonation_chain=IMPERSONATION_CHAIN, ) meta = {"id": "123xyz"} mock_gdrive_hook.return_value.get_file_id.return_value = meta op.execute(context) mock_gdrive_hook.return_value.get_file_id.assert_called_once_with( folder_id=FOLDER_ID, file_name=FILE_NAME, drive_id=DRIVE_ID ) mock_gdrive_hook.return_value.download_file.assert_called_once_with( file_id=meta["id"], file_handle=mock.ANY ) mock_gcs_hook.return_value.provide_file_and_upload.assert_called_once_with( bucket_name=BUCKET, object_name=OBJECT ) assert op.dry_run() is None
[ "os.environ.get", "airflow.providers.google.cloud.transfers.gdrive_to_gcs.GoogleDriveToGCSOperator", "unittest.mock.patch" ]
[((928, 978), 'os.environ.get', 'os.environ.get', (['"""GCP_GDRIVE_FOLDER_ID"""', '"""abcd1234"""'], {}), "('GCP_GDRIVE_FOLDER_ID', 'abcd1234')\n", (942, 978), False, 'import os\n'), ((990, 1039), 'os.environ.get', 'os.environ.get', (['"""GCP_GDRIVE_DRIVE_ID"""', '"""abcd1234"""'], {}), "('GCP_GDRIVE_DRIVE_ID', 'abcd1234')\n", (1004, 1039), False, 'import os\n'), ((1052, 1123), 'os.environ.get', 'os.environ.get', (['"""GCP_GDRIVE_TO_GCS_FILE_NAME"""', '"""gdrive_to_gcs_file.txt"""'], {}), "('GCP_GDRIVE_TO_GCS_FILE_NAME', 'gdrive_to_gcs_file.txt')\n", (1066, 1123), False, 'import os\n'), ((1133, 1199), 'os.environ.get', 'os.environ.get', (['"""GCP_GDRIVE_TO_GCS_BUCKET"""', '"""gdrive-to-gcs-bucket"""'], {}), "('GCP_GDRIVE_TO_GCS_BUCKET', 'gdrive-to-gcs-bucket')\n", (1147, 1199), False, 'import os\n'), ((1369, 1445), 'unittest.mock.patch', 'mock.patch', (['"""airflow.providers.google.cloud.transfers.gdrive_to_gcs.GCSHook"""'], {}), "('airflow.providers.google.cloud.transfers.gdrive_to_gcs.GCSHook')\n", (1379, 1445), False, 'from unittest import mock\n'), ((1451, 1540), 'unittest.mock.patch', 'mock.patch', (['"""airflow.providers.google.cloud.transfers.gdrive_to_gcs.GoogleDriveHook"""'], {}), "(\n 'airflow.providers.google.cloud.transfers.gdrive_to_gcs.GoogleDriveHook')\n", (1461, 1540), False, 'from unittest import mock\n'), ((1631, 1852), 'airflow.providers.google.cloud.transfers.gdrive_to_gcs.GoogleDriveToGCSOperator', 'GoogleDriveToGCSOperator', ([], {'task_id': '"""test_task"""', 'folder_id': 'FOLDER_ID', 'file_name': 'FILE_NAME', 'drive_id': 'DRIVE_ID', 'bucket_name': 'BUCKET', 'object_name': 'OBJECT', 'gcp_conn_id': 'GCP_CONN_ID', 'impersonation_chain': 'IMPERSONATION_CHAIN'}), "(task_id='test_task', folder_id=FOLDER_ID,\n file_name=FILE_NAME, drive_id=DRIVE_ID, bucket_name=BUCKET, object_name\n =OBJECT, gcp_conn_id=GCP_CONN_ID, impersonation_chain=IMPERSONATION_CHAIN)\n", (1655, 1852), False, 'from airflow.providers.google.cloud.transfers.gdrive_to_gcs import GoogleDriveToGCSOperator\n')]
from PIL import Image import numpy as np import sys, os from progress_bar import ProgressBar def get_bit(pos, img): # avoids modifying thumbnail size = img.shape[0]*img.shape[1] - 4096 rgb = pos//size if rgb > 2: raise IndexError("Position is too large") pos = pos % size + 4096 x,y = pos // img.shape[1], pos % img.shape[1] return img[x][y][rgb] & 1 with Image.open(sys.argv[1]) as img: with open(sys.argv[2], "w+") as out: arrimg = np.array(img) pos = 0 cur_char = '' size_str = "" while cur_char != "|": ord_chr = 0 for i in range(8): bit = get_bit(pos, arrimg) pos += 1 ord_chr = ord_chr | bit << i cur_char = chr(ord_chr) size_str += cur_char size = int(size_str[:-1]) pb = ProgressBar(size) pb.begin() for i in range(size): ord_chr = 0 for i in range(8): bit = get_bit(pos, arrimg) pos += 1 ord_chr = ord_chr | bit << i out.write(chr(ord_chr)) pb.add_progress()
[ "progress_bar.ProgressBar", "numpy.array", "PIL.Image.open" ]
[((395, 418), 'PIL.Image.open', 'Image.open', (['sys.argv[1]'], {}), '(sys.argv[1])\n', (405, 418), False, 'from PIL import Image\n'), ((485, 498), 'numpy.array', 'np.array', (['img'], {}), '(img)\n', (493, 498), True, 'import numpy as np\n'), ((874, 891), 'progress_bar.ProgressBar', 'ProgressBar', (['size'], {}), '(size)\n', (885, 891), False, 'from progress_bar import ProgressBar\n')]
from share.transform.chain import ChainTransformer, Parser, Delegate, RunPython, ParseDate, ParseName, Map, ctx, Try, Subjects, IRI, Concat class Subject(Parser): name = ctx class ThroughSubjects(Parser): subject = Delegate(Subject, ctx) class Tag(Parser): name = ctx class ThroughTags(Parser): tag = Delegate(Tag, ctx) class Organization(Parser): name = ctx class Publisher(Parser): agent = Delegate(Organization, ctx) class Person(Parser): given_name = ParseName(ctx).first family_name = ParseName(ctx).last class Creator(Parser): agent = Delegate(Person, ctx) cited_as = ctx order_cited = ctx('index') class WorkIdentifier(Parser): uri = IRI(ctx) class Article(Parser): title = ctx.title description = Try(ctx.description) language = ctx.language date_published = ParseDate(ctx.date) date_updated = ParseDate(ctx.date) identifiers = Map( Delegate(WorkIdentifier), ctx.doi, ctx.pdf_url, ctx.fulltext_html_url, RunPython(lambda x: 'https://www.ncbi.nlm.nih.gov/pubmed/{}'.format(x) if x else None, Try(ctx.identifiers.pubmed)), RunPython(lambda x: 'https://www.ncbi.nlm.nih.gov/pmc/articles/{}'.format(x) if x else None, Try(ctx.identifiers.pmc)), ) subjects = Map(Delegate(ThroughSubjects), Subjects(ctx.subjects)) tags = Map(Delegate(ThroughTags), Try(ctx.keywords), Try(ctx.subjects)) related_agents = Concat( Map(Delegate(Creator), ctx.author), Map(Delegate(Publisher), ctx.publisher), ) class Extra: volume = Try(ctx.volume) journal_title = Try(ctx.journal_title) journal_abbrev = Try(ctx.journal_abbrev) description_html = Try(ctx['description-html']) issn = Try(ctx.issn) class Preprint(Article): class Extra: modified = ParseDate(ctx.date) subjects = ctx.subjects identifiers = Try(ctx.identifiers) emails = Try(ctx.author_email) description_html = Try(ctx['description-html']) class PeerJTransformer(ChainTransformer): VERSION = 1 def get_root_parser(self, unwrapped, emitted_type=None, **kwargs): if emitted_type == 'preprint': return Preprint return Article
[ "share.transform.chain.Subjects", "share.transform.chain.ParseDate", "share.transform.chain.ctx", "share.transform.chain.IRI", "share.transform.chain.Try", "share.transform.chain.Delegate", "share.transform.chain.ParseName" ]
[((227, 249), 'share.transform.chain.Delegate', 'Delegate', (['Subject', 'ctx'], {}), '(Subject, ctx)\n', (235, 249), False, 'from share.transform.chain import ChainTransformer, Parser, Delegate, RunPython, ParseDate, ParseName, Map, ctx, Try, Subjects, IRI, Concat\n'), ((325, 343), 'share.transform.chain.Delegate', 'Delegate', (['Tag', 'ctx'], {}), '(Tag, ctx)\n', (333, 343), False, 'from share.transform.chain import ChainTransformer, Parser, Delegate, RunPython, ParseDate, ParseName, Map, ctx, Try, Subjects, IRI, Concat\n'), ((428, 455), 'share.transform.chain.Delegate', 'Delegate', (['Organization', 'ctx'], {}), '(Organization, ctx)\n', (436, 455), False, 'from share.transform.chain import ChainTransformer, Parser, Delegate, RunPython, ParseDate, ParseName, Map, ctx, Try, Subjects, IRI, Concat\n'), ((593, 614), 'share.transform.chain.Delegate', 'Delegate', (['Person', 'ctx'], {}), '(Person, ctx)\n', (601, 614), False, 'from share.transform.chain import ChainTransformer, Parser, Delegate, RunPython, ParseDate, ParseName, Map, ctx, Try, Subjects, IRI, Concat\n'), ((652, 664), 'share.transform.chain.ctx', 'ctx', (['"""index"""'], {}), "('index')\n", (655, 664), False, 'from share.transform.chain import ChainTransformer, Parser, Delegate, RunPython, ParseDate, ParseName, Map, ctx, Try, Subjects, IRI, Concat\n'), ((707, 715), 'share.transform.chain.IRI', 'IRI', (['ctx'], {}), '(ctx)\n', (710, 715), False, 'from share.transform.chain import ChainTransformer, Parser, Delegate, RunPython, ParseDate, ParseName, Map, ctx, Try, Subjects, IRI, Concat\n'), ((781, 801), 'share.transform.chain.Try', 'Try', (['ctx.description'], {}), '(ctx.description)\n', (784, 801), False, 'from share.transform.chain import ChainTransformer, Parser, Delegate, RunPython, ParseDate, ParseName, Map, ctx, Try, Subjects, IRI, Concat\n'), ((851, 870), 'share.transform.chain.ParseDate', 'ParseDate', (['ctx.date'], {}), '(ctx.date)\n', (860, 870), False, 'from share.transform.chain import ChainTransformer, Parser, Delegate, RunPython, ParseDate, ParseName, Map, ctx, Try, Subjects, IRI, Concat\n'), ((890, 909), 'share.transform.chain.ParseDate', 'ParseDate', (['ctx.date'], {}), '(ctx.date)\n', (899, 909), False, 'from share.transform.chain import ChainTransformer, Parser, Delegate, RunPython, ParseDate, ParseName, Map, ctx, Try, Subjects, IRI, Concat\n'), ((497, 511), 'share.transform.chain.ParseName', 'ParseName', (['ctx'], {}), '(ctx)\n', (506, 511), False, 'from share.transform.chain import ChainTransformer, Parser, Delegate, RunPython, ParseDate, ParseName, Map, ctx, Try, Subjects, IRI, Concat\n'), ((536, 550), 'share.transform.chain.ParseName', 'ParseName', (['ctx'], {}), '(ctx)\n', (545, 550), False, 'from share.transform.chain import ChainTransformer, Parser, Delegate, RunPython, ParseDate, ParseName, Map, ctx, Try, Subjects, IRI, Concat\n'), ((942, 966), 'share.transform.chain.Delegate', 'Delegate', (['WorkIdentifier'], {}), '(WorkIdentifier)\n', (950, 966), False, 'from share.transform.chain import ChainTransformer, Parser, Delegate, RunPython, ParseDate, ParseName, Map, ctx, Try, Subjects, IRI, Concat\n'), ((1316, 1341), 'share.transform.chain.Delegate', 'Delegate', (['ThroughSubjects'], {}), '(ThroughSubjects)\n', (1324, 1341), False, 'from share.transform.chain import ChainTransformer, Parser, Delegate, RunPython, ParseDate, ParseName, Map, ctx, Try, Subjects, IRI, Concat\n'), ((1343, 1365), 'share.transform.chain.Subjects', 'Subjects', (['ctx.subjects'], {}), '(ctx.subjects)\n', (1351, 1365), False, 'from share.transform.chain import ChainTransformer, Parser, Delegate, RunPython, ParseDate, ParseName, Map, ctx, Try, Subjects, IRI, Concat\n'), ((1382, 1403), 'share.transform.chain.Delegate', 'Delegate', (['ThroughTags'], {}), '(ThroughTags)\n', (1390, 1403), False, 'from share.transform.chain import ChainTransformer, Parser, Delegate, RunPython, ParseDate, ParseName, Map, ctx, Try, Subjects, IRI, Concat\n'), ((1405, 1422), 'share.transform.chain.Try', 'Try', (['ctx.keywords'], {}), '(ctx.keywords)\n', (1408, 1422), False, 'from share.transform.chain import ChainTransformer, Parser, Delegate, RunPython, ParseDate, ParseName, Map, ctx, Try, Subjects, IRI, Concat\n'), ((1424, 1441), 'share.transform.chain.Try', 'Try', (['ctx.subjects'], {}), '(ctx.subjects)\n', (1427, 1441), False, 'from share.transform.chain import ChainTransformer, Parser, Delegate, RunPython, ParseDate, ParseName, Map, ctx, Try, Subjects, IRI, Concat\n'), ((1607, 1622), 'share.transform.chain.Try', 'Try', (['ctx.volume'], {}), '(ctx.volume)\n', (1610, 1622), False, 'from share.transform.chain import ChainTransformer, Parser, Delegate, RunPython, ParseDate, ParseName, Map, ctx, Try, Subjects, IRI, Concat\n'), ((1647, 1669), 'share.transform.chain.Try', 'Try', (['ctx.journal_title'], {}), '(ctx.journal_title)\n', (1650, 1669), False, 'from share.transform.chain import ChainTransformer, Parser, Delegate, RunPython, ParseDate, ParseName, Map, ctx, Try, Subjects, IRI, Concat\n'), ((1695, 1718), 'share.transform.chain.Try', 'Try', (['ctx.journal_abbrev'], {}), '(ctx.journal_abbrev)\n', (1698, 1718), False, 'from share.transform.chain import ChainTransformer, Parser, Delegate, RunPython, ParseDate, ParseName, Map, ctx, Try, Subjects, IRI, Concat\n'), ((1746, 1774), 'share.transform.chain.Try', 'Try', (["ctx['description-html']"], {}), "(ctx['description-html'])\n", (1749, 1774), False, 'from share.transform.chain import ChainTransformer, Parser, Delegate, RunPython, ParseDate, ParseName, Map, ctx, Try, Subjects, IRI, Concat\n'), ((1790, 1803), 'share.transform.chain.Try', 'Try', (['ctx.issn'], {}), '(ctx.issn)\n', (1793, 1803), False, 'from share.transform.chain import ChainTransformer, Parser, Delegate, RunPython, ParseDate, ParseName, Map, ctx, Try, Subjects, IRI, Concat\n'), ((1868, 1887), 'share.transform.chain.ParseDate', 'ParseDate', (['ctx.date'], {}), '(ctx.date)\n', (1877, 1887), False, 'from share.transform.chain import ChainTransformer, Parser, Delegate, RunPython, ParseDate, ParseName, Map, ctx, Try, Subjects, IRI, Concat\n'), ((1942, 1962), 'share.transform.chain.Try', 'Try', (['ctx.identifiers'], {}), '(ctx.identifiers)\n', (1945, 1962), False, 'from share.transform.chain import ChainTransformer, Parser, Delegate, RunPython, ParseDate, ParseName, Map, ctx, Try, Subjects, IRI, Concat\n'), ((1980, 2001), 'share.transform.chain.Try', 'Try', (['ctx.author_email'], {}), '(ctx.author_email)\n', (1983, 2001), False, 'from share.transform.chain import ChainTransformer, Parser, Delegate, RunPython, ParseDate, ParseName, Map, ctx, Try, Subjects, IRI, Concat\n'), ((2029, 2057), 'share.transform.chain.Try', 'Try', (["ctx['description-html']"], {}), "(ctx['description-html'])\n", (2032, 2057), False, 'from share.transform.chain import ChainTransformer, Parser, Delegate, RunPython, ParseDate, ParseName, Map, ctx, Try, Subjects, IRI, Concat\n'), ((1132, 1159), 'share.transform.chain.Try', 'Try', (['ctx.identifiers.pubmed'], {}), '(ctx.identifiers.pubmed)\n', (1135, 1159), False, 'from share.transform.chain import ChainTransformer, Parser, Delegate, RunPython, ParseDate, ParseName, Map, ctx, Try, Subjects, IRI, Concat\n'), ((1263, 1287), 'share.transform.chain.Try', 'Try', (['ctx.identifiers.pmc'], {}), '(ctx.identifiers.pmc)\n', (1266, 1287), False, 'from share.transform.chain import ChainTransformer, Parser, Delegate, RunPython, ParseDate, ParseName, Map, ctx, Try, Subjects, IRI, Concat\n'), ((1485, 1502), 'share.transform.chain.Delegate', 'Delegate', (['Creator'], {}), '(Creator)\n', (1493, 1502), False, 'from share.transform.chain import ChainTransformer, Parser, Delegate, RunPython, ParseDate, ParseName, Map, ctx, Try, Subjects, IRI, Concat\n'), ((1529, 1548), 'share.transform.chain.Delegate', 'Delegate', (['Publisher'], {}), '(Publisher)\n', (1537, 1548), False, 'from share.transform.chain import ChainTransformer, Parser, Delegate, RunPython, ParseDate, ParseName, Map, ctx, Try, Subjects, IRI, Concat\n')]
from jinja2 import FileSystemLoader, StrictUndefined from jinja2.environment import Environment from netmiko import ConnectHandler from mydevices import nxos1, nxos2 from pprint import pprint import textfsm import time import re from colorama import Fore, Back, Style env = Environment(undefined=StrictUndefined) env.loader = FileSystemLoader("./templates/") template_file = "question2.j2" interface = "1" nxos1_vars = { "device_name": "nxos1", "local_as": 22, "interface": interface, "ip_address": "10.1.100.1", "netmask": "24" } nxos2_vars = { "device_name": "nxos2", "local_as": 22, "interface": interface, "ip_address": "10.1.100.2", "netmask": "24" } nxos1_vars["peer_ip"] = nxos2_vars["ip_address"] nxos2_vars["peer_ip"] = nxos1_vars["ip_address"] # Add Jinja2 vars to be included in the Netmiko device dictionary nxos1["j2_vars"] = nxos1_vars nxos2["j2_vars"] = nxos2_vars template = env.get_template(template_file) def config(): for device in [nxos1,nxos2]: ### Pop the device dict 'j2_vars' to 'device_var', ### leaving 'device' with just the netmiko parameters device_var = device.pop('j2_vars') cfg = template.render(**device_var) Node = { "host": device['host'], "username": device['username'], "password": device['password'], "device_type": device['device_type'] } net_connect = ConnectHandler(**Node) print(f"Updating {device['host']} ".center(80, "#")) output = net_connect.send_config_set(cfg) print('Completed' + '\n') def verify(): for device in [nxos1,nxos2]: Node = { "host": device['host'], "username": device['username'], "password": device['password'], "device_type": device['device_type'] } net_connect = ConnectHandler(**Node) raw_text_data = net_connect.send_command('show ip bgp sum') net_connect.disconnect() textfsm_file = "templates/question3.template" textfsm_template = open(textfsm_file) # with open("show_ip_bgp_sum.txt") as f: # raw_text_data = f.read() # The argument 'template' is a file handle and 'raw_text_data' is a string. re_table = textfsm.TextFSM(textfsm_template) bgp_status = re_table.ParseText(raw_text_data)[0][0] bgp_state = re_table.ParseText(raw_text_data)[0][1] textfsm_template.close() ### Regular expressions to match the bgp variables above regex_status = re.compile(r'[0-9]{1,2}:[0-9]{1,2}:[0-9]{1,2}') regex_state = re.compile(r'\d+') if regex_status.match(bgp_status) and regex_state.match(bgp_state): ''' These two conditions are to match - Whether or not there is an time counter - Whether or not the bgp state is a number, and NOT a building bgp state ''' print(f"BGP has been established on: {device['host']}") else: print(f"The current BGP State of {device['host']} is: {bgp_state}. Please review") def run(): config() time.sleep(15) verify() if __name__ == "__main__": run()
[ "re.compile", "jinja2.environment.Environment", "time.sleep", "jinja2.FileSystemLoader", "netmiko.ConnectHandler", "textfsm.TextFSM" ]
[((275, 313), 'jinja2.environment.Environment', 'Environment', ([], {'undefined': 'StrictUndefined'}), '(undefined=StrictUndefined)\n', (286, 313), False, 'from jinja2.environment import Environment\n'), ((327, 359), 'jinja2.FileSystemLoader', 'FileSystemLoader', (['"""./templates/"""'], {}), "('./templates/')\n", (343, 359), False, 'from jinja2 import FileSystemLoader, StrictUndefined\n'), ((3133, 3147), 'time.sleep', 'time.sleep', (['(15)'], {}), '(15)\n', (3143, 3147), False, 'import time\n'), ((1433, 1455), 'netmiko.ConnectHandler', 'ConnectHandler', ([], {}), '(**Node)\n', (1447, 1455), False, 'from netmiko import ConnectHandler\n'), ((1855, 1877), 'netmiko.ConnectHandler', 'ConnectHandler', ([], {}), '(**Node)\n', (1869, 1877), False, 'from netmiko import ConnectHandler\n'), ((2271, 2304), 'textfsm.TextFSM', 'textfsm.TextFSM', (['textfsm_template'], {}), '(textfsm_template)\n', (2286, 2304), False, 'import textfsm\n'), ((2548, 2594), 're.compile', 're.compile', (['"""[0-9]{1,2}:[0-9]{1,2}:[0-9]{1,2}"""'], {}), "('[0-9]{1,2}:[0-9]{1,2}:[0-9]{1,2}')\n", (2558, 2594), False, 'import re\n'), ((2618, 2636), 're.compile', 're.compile', (['"""\\\\d+"""'], {}), "('\\\\d+')\n", (2628, 2636), False, 'import re\n')]
from typing import Text from aiogram import types from aiogram.dispatcher.filters.builtin import Text from aiogram.dispatcher import FSMContext from keyboards.default.admin_panel import admin_panel_kb from middlewares.states.admin_panel_states import check_user from utils.db_api import sql from loader import dp ''' data = {"username": "", "telegram_id": "", # int "phone": "", "data_add": ""} ''' @dp.message_handler(text="/cancel", state="*") async def back(message: types.Message, state: FSMContext): await message.answer("Действие отменено!", reply_markup=admin_panel_kb) await state.finish() @dp.message_handler(state=check_user.step1) async def first_step(message: types.Message, state: FSMContext): data = {"telegram_id": int(message.text)} res = await sql.check(data) if res == "not in base": await message.answer("Пользователя нет в базе") await state.finish() elif res == "is in base": await message.answer("Пользователь есть в базе") await state.finish()
[ "utils.db_api.sql.check", "loader.dp.message_handler" ]
[((428, 473), 'loader.dp.message_handler', 'dp.message_handler', ([], {'text': '"""/cancel"""', 'state': '"""*"""'}), "(text='/cancel', state='*')\n", (446, 473), False, 'from loader import dp\n'), ((636, 678), 'loader.dp.message_handler', 'dp.message_handler', ([], {'state': 'check_user.step1'}), '(state=check_user.step1)\n', (654, 678), False, 'from loader import dp\n'), ((806, 821), 'utils.db_api.sql.check', 'sql.check', (['data'], {}), '(data)\n', (815, 821), False, 'from utils.db_api import sql\n')]
import requests from threading import Thread from six.moves.queue import Queue def flatten_kwargs(index, **kwargs): kwargs = dict(kwargs) for arg in kwargs: if isinstance(kwargs[arg], list): kwargs[arg] = kwargs[arg][index] return kwargs class WebRunner: resp_queue = None def __init__(self): self.resp_queue = Queue() def request(self, index, url, **kwargs): kwargs = flatten_kwargs(index, **kwargs) try: method = kwargs.pop('method', 'GET') self.resp_queue.put( (index, requests.request(method=method, url=url, **kwargs)) ) except Exception as e: self.resp_queue.put((index, None)) print('Failed to download %s because %s.' % (url, e)) def runner(self, **kwargs): while True: index, url = self.work_queue.get() if 'http://' not in url and 'https://' not in url: url = 'http://' + url self.request(index, url, **kwargs) self.work_queue.task_done() def run(self, urls, concurrency=4, **kwargs): self.work_queue = Queue() for url in enumerate(urls): self.work_queue.put(url) for i in range(concurrency): t = Thread(target=self.runner, kwargs=kwargs) t.daemon = True t.start() self.work_queue.join() responses = list(self.resp_queue.queue) responses = sorted(responses, key=lambda x: x[0]) return [r[1] for r in responses]
[ "threading.Thread", "requests.request", "six.moves.queue.Queue" ]
[((365, 372), 'six.moves.queue.Queue', 'Queue', ([], {}), '()\n', (370, 372), False, 'from six.moves.queue import Queue\n'), ((1165, 1172), 'six.moves.queue.Queue', 'Queue', ([], {}), '()\n', (1170, 1172), False, 'from six.moves.queue import Queue\n'), ((1299, 1340), 'threading.Thread', 'Thread', ([], {'target': 'self.runner', 'kwargs': 'kwargs'}), '(target=self.runner, kwargs=kwargs)\n', (1305, 1340), False, 'from threading import Thread\n'), ((588, 638), 'requests.request', 'requests.request', ([], {'method': 'method', 'url': 'url'}), '(method=method, url=url, **kwargs)\n', (604, 638), False, 'import requests\n')]
import ast print(ast) source = """ def foo(): print('bar') pass """ n = ast.parse(source) print(n) print(n.body) print(n.body[0].name) assert n.body[0].name == 'foo' foo = n.body[0] assert foo.lineno == 2 print(foo.body) assert len(foo.body) == 2 print(foo.body[0]) print(foo.body[0].value.func.id) assert foo.body[0].value.func.id == 'print' assert foo.body[0].lineno == 3 assert foo.body[1].lineno == 4
[ "ast.parse" ]
[((82, 99), 'ast.parse', 'ast.parse', (['source'], {}), '(source)\n', (91, 99), False, 'import ast\n')]
from woodwork.column_schema import ColumnSchema from featuretools.primitives.base import AggregationPrimitive class CustomMean(AggregationPrimitive): name = "custom_mean" input_types = [ColumnSchema(semantic_tags={"numeric"})] return_type = ColumnSchema(semantic_tags={"numeric"})
[ "woodwork.column_schema.ColumnSchema" ]
[((256, 295), 'woodwork.column_schema.ColumnSchema', 'ColumnSchema', ([], {'semantic_tags': "{'numeric'}"}), "(semantic_tags={'numeric'})\n", (268, 295), False, 'from woodwork.column_schema import ColumnSchema\n'), ((197, 236), 'woodwork.column_schema.ColumnSchema', 'ColumnSchema', ([], {'semantic_tags': "{'numeric'}"}), "(semantic_tags={'numeric'})\n", (209, 236), False, 'from woodwork.column_schema import ColumnSchema\n')]
import statistics target_root_path = r"G:\GE\skin_12_data" print("Region", end='') for i in range(5): print("\t\tAverage\tMedian\t%", end='') print() cell_types = ['all', 'CD68', 'T-Helper', 'T-Killer', 'T-Reg'] region_list = [11, 3, 8, 9, 1, 12, 5, 4, 2, 10, 7] for region_id in region_list: target_file_path = target_root_path + rf"\region_{region_id}\nuclei.csv" cell_file = open(target_file_path, 'r') cell_file.readline() cell_lines = cell_file.readlines() distances = {'all': []} for line in cell_lines: content = line.split(',') type = content[4] distance = content[5] if type in cell_types: if type not in distances: distances[type] = [] else: distances[type].append(float(distance)) distances['all'].append(float(distance)) # print("Region ", region_id) # for key in distances: # print("\t", key) # print("\t\tAverage Distance: ", statistics.mean(distances[key])) # print("\t\tMedian Distance: ", statistics.median(distances[key])) print(region_id, end='') for key in cell_types: print("\t", key, end='') if key in distances: dis_mean = statistics.mean(distances[key]) dis_median = statistics.median(distances[key]) percentage = len(distances[key]) / len(distances['all']) else: dis_mean = 0 dis_median = 0 percentage = 0 print(f"\t{dis_mean}", end='') print(f"\t{dis_median}", end='') print(f"\t{percentage}", end='') print() # # distances = {'all': []} # for region_id in [1, 3, 6, 8, 9, 11]: # target_file_path = target_root_path + rf"\region_{region_id}\nuclei.csv" # # cell_file = open(target_file_path, 'r') # cell_file.readline() # cell_lines = cell_file.readlines() # # for line in cell_lines: # content = line.split(',') # type = content[4] # distance = content[5] # if type not in distances: # distances[type] = [] # else: # distances[type].append(float(distance)) # distances['all'].append(float(distance)) # # print("Sun", end='') # for key in ['all', 'CD68', 'T-Reg', 'T-Helper']: # print("\t", key, end='') # print(f"\t{statistics.mean(distances[key])}", end='') # print(f"\t{statistics.median(distances[key])}", end='') # print(f"\t{len(distances[key]) / len(distances['all'])}", end='') # print() # # distances = {'all': []} # for region_id in [2, 4, 5, 7, 10, 12]: # target_file_path = target_root_path + rf"\region_{region_id}\nuclei.csv" # # cell_file = open(target_file_path, 'r') # cell_file.readline() # cell_lines = cell_file.readlines() # # for line in cell_lines: # content = line.split(',') # type = content[4] # distance = content[5] # if type not in distances: # distances[type] = [] # else: # distances[type].append(float(distance)) # distances['all'].append(float(distance)) # # print("Non-sun", end='') # for key in ['all', 'CD68', 'T-Reg', 'T-Helper']: # print("\t", key, end='') # print(f"\t{statistics.mean(distances[key])}", end='') # print(f"\t{statistics.median(distances[key])}", end='') # print(f"\t{len(distances[key]) / len(distances['all'])}", end='') # print() # # distances = {'all': []} # for region_id in region_list: # target_file_path = target_root_path + rf"\region_{region_id}\nuclei.csv" # # cell_file = open(target_file_path, 'r') # cell_file.readline() # cell_lines = cell_file.readlines() # # for line in cell_lines: # content = line.split(',') # type = content[4] # distance = content[5] # if type in cell_types: # if type not in distances: # distances[type] = [] # else: # distances[type].append(float(distance)) # distances['all'].append(float(distance)) # # print("All ", end='') # for key in cell_types: # print("\t", key, end='') # print(f"\t{statistics.mean(distances[key])}", end='') # print(f"\t{statistics.median(distances[key])}", end='') # print(f"\t{len(distances[key]) / len(distances['all'])}", end='') # print()
[ "statistics.median", "statistics.mean" ]
[((1254, 1285), 'statistics.mean', 'statistics.mean', (['distances[key]'], {}), '(distances[key])\n', (1269, 1285), False, 'import statistics\n'), ((1311, 1344), 'statistics.median', 'statistics.median', (['distances[key]'], {}), '(distances[key])\n', (1328, 1344), False, 'import statistics\n')]
# Iterative Conway's game of life in Python / CUDA C # this version is meant to illustrate the use of shared kernel memory in CUDA. # written by <NAME> for "Hands on GPU Programming with Python and CUDA" import pycuda.autoinit import pycuda.driver as drv from pycuda import gpuarray from pycuda.compiler import SourceModule import numpy as np import matplotlib.pyplot as plt from time import time shared_ker = SourceModule(""" #define _iters 1000000 #define _X ( threadIdx.x + blockIdx.x * blockDim.x ) #define _Y ( threadIdx.y + blockIdx.y * blockDim.y ) #define _WIDTH ( blockDim.x * gridDim.x ) #define _HEIGHT ( blockDim.y * gridDim.y ) #define _XM(x) ( (x + _WIDTH) % _WIDTH ) #define _YM(y) ( (y + _HEIGHT) % _HEIGHT ) #define _INDEX(x,y) ( _XM(x) + _YM(y) * _WIDTH ) // return the number of living neighbors for a given cell __device__ int nbrs(int x, int y, int * in) { return ( in[ _INDEX(x -1, y+1) ] + in[ _INDEX(x-1, y) ] + in[ _INDEX(x-1, y-1) ] \ + in[ _INDEX(x, y+1)] + in[_INDEX(x, y - 1)] \ + in[ _INDEX(x+1, y+1) ] + in[ _INDEX(x+1, y) ] + in[ _INDEX(x+1, y-1) ] ); } // p_lattice will now be the pointer to the global lattice, lattice to the shared __global__ void conway_ker_shared(int * p_lattice, int iters) { // x, y are the appropriate values for the cell covered by this thread int x = _X, y = _Y; __shared__ int lattice[32*32]; lattice[_INDEX(x,y)] = p_lattice[_INDEX(x,y)]; __syncthreads(); // each thread copies its own value into the shared lattice, we need to wait for them to finisch for (int i = 0; i < iters; i++) { // count the number of neighbors around the current cell int n = nbrs(x, y, lattice); int cell_value; // if the current cell is alive, then determine if it lives or dies for the next generation. if ( lattice[_INDEX(x,y)] == 1) switch(n) { // if the cell is alive: it remains alive only if it has 2 or 3 neighbors. case 2: case 3: cell_value = 1; break; default: cell_value = 0; } else if( lattice[_INDEX(x,y)] == 0 ) switch(n) { // a dead cell comes to life only if it has 3 neighbors that are alive. case 3: cell_value = 1; break; default: cell_value = 0; } __syncthreads(); lattice[_INDEX(x,y)] = cell_value; __syncthreads(); } __syncthreads(); p_lattice[_INDEX(x,y)] = lattice[_INDEX(x,y)]; __syncthreads(); } """) conway_ker_shared = shared_ker.get_function("conway_ker_shared") if __name__ == '__main__': # set lattice size N = 32 lattice = np.int32( np.random.choice([1,0], N*N, p=[0.25, 0.75]).reshape(N, N) ) lattice_gpu = gpuarray.to_gpu(lattice) time1 = time() conway_ker_shared(lattice_gpu, np.int32(1e6), grid=(1,1,1), block=(32,32,1)) print("calc needed", (time() - time1)*1000, "ms") fig = plt.figure(1) plt.imshow(lattice_gpu.get()) plt.show()
[ "numpy.random.choice", "pycuda.compiler.SourceModule", "matplotlib.pyplot.show", "time.time", "matplotlib.pyplot.figure", "numpy.int32", "pycuda.gpuarray.to_gpu" ]
[((417, 2837), 'pycuda.compiler.SourceModule', 'SourceModule', (['""" \n#define _iters 1000000 \n\n#define _X ( threadIdx.x + blockIdx.x * blockDim.x )\n#define _Y ( threadIdx.y + blockIdx.y * blockDim.y )\n\n#define _WIDTH ( blockDim.x * gridDim.x )\n#define _HEIGHT ( blockDim.y * gridDim.y )\n\n#define _XM(x) ( (x + _WIDTH) % _WIDTH )\n#define _YM(y) ( (y + _HEIGHT) % _HEIGHT )\n\n#define _INDEX(x,y) ( _XM(x) + _YM(y) * _WIDTH )\n\n// return the number of living neighbors for a given cell \n__device__ int nbrs(int x, int y, int * in)\n{\n return ( in[ _INDEX(x -1, y+1) ] + in[ _INDEX(x-1, y) ] + in[ _INDEX(x-1, y-1) ] + in[ _INDEX(x, y+1)] + in[_INDEX(x, y - 1)] + in[ _INDEX(x+1, y+1) ] + in[ _INDEX(x+1, y) ] + in[ _INDEX(x+1, y-1) ] );\n}\n\n// p_lattice will now be the pointer to the global lattice, lattice to the shared\n__global__ void conway_ker_shared(int * p_lattice, int iters)\n{\n // x, y are the appropriate values for the cell covered by this thread\n int x = _X, y = _Y;\n __shared__ int lattice[32*32];\n \n \n lattice[_INDEX(x,y)] = p_lattice[_INDEX(x,y)];\n __syncthreads(); // each thread copies its own value into the shared lattice, we need to wait for them to finisch\n\n for (int i = 0; i < iters; i++)\n {\n \n // count the number of neighbors around the current cell\n int n = nbrs(x, y, lattice);\n \n int cell_value;\n \n \n // if the current cell is alive, then determine if it lives or dies for the next generation.\n if ( lattice[_INDEX(x,y)] == 1)\n switch(n)\n {\n // if the cell is alive: it remains alive only if it has 2 or 3 neighbors.\n case 2:\n case 3: cell_value = 1;\n break;\n default: cell_value = 0; \n }\n else if( lattice[_INDEX(x,y)] == 0 )\n switch(n)\n {\n // a dead cell comes to life only if it has 3 neighbors that are alive.\n case 3: cell_value = 1;\n break;\n default: cell_value = 0; \n }\n \n __syncthreads();\n lattice[_INDEX(x,y)] = cell_value;\n __syncthreads();\n \n }\n \n __syncthreads();\n p_lattice[_INDEX(x,y)] = lattice[_INDEX(x,y)];\n __syncthreads();\n \n}\n"""'], {}), '(\n """ \n#define _iters 1000000 \n\n#define _X ( threadIdx.x + blockIdx.x * blockDim.x )\n#define _Y ( threadIdx.y + blockIdx.y * blockDim.y )\n\n#define _WIDTH ( blockDim.x * gridDim.x )\n#define _HEIGHT ( blockDim.y * gridDim.y )\n\n#define _XM(x) ( (x + _WIDTH) % _WIDTH )\n#define _YM(y) ( (y + _HEIGHT) % _HEIGHT )\n\n#define _INDEX(x,y) ( _XM(x) + _YM(y) * _WIDTH )\n\n// return the number of living neighbors for a given cell \n__device__ int nbrs(int x, int y, int * in)\n{\n return ( in[ _INDEX(x -1, y+1) ] + in[ _INDEX(x-1, y) ] + in[ _INDEX(x-1, y-1) ] + in[ _INDEX(x, y+1)] + in[_INDEX(x, y - 1)] + in[ _INDEX(x+1, y+1) ] + in[ _INDEX(x+1, y) ] + in[ _INDEX(x+1, y-1) ] );\n}\n\n// p_lattice will now be the pointer to the global lattice, lattice to the shared\n__global__ void conway_ker_shared(int * p_lattice, int iters)\n{\n // x, y are the appropriate values for the cell covered by this thread\n int x = _X, y = _Y;\n __shared__ int lattice[32*32];\n \n \n lattice[_INDEX(x,y)] = p_lattice[_INDEX(x,y)];\n __syncthreads(); // each thread copies its own value into the shared lattice, we need to wait for them to finisch\n\n for (int i = 0; i < iters; i++)\n {\n \n // count the number of neighbors around the current cell\n int n = nbrs(x, y, lattice);\n \n int cell_value;\n \n \n // if the current cell is alive, then determine if it lives or dies for the next generation.\n if ( lattice[_INDEX(x,y)] == 1)\n switch(n)\n {\n // if the cell is alive: it remains alive only if it has 2 or 3 neighbors.\n case 2:\n case 3: cell_value = 1;\n break;\n default: cell_value = 0; \n }\n else if( lattice[_INDEX(x,y)] == 0 )\n switch(n)\n {\n // a dead cell comes to life only if it has 3 neighbors that are alive.\n case 3: cell_value = 1;\n break;\n default: cell_value = 0; \n }\n \n __syncthreads();\n lattice[_INDEX(x,y)] = cell_value;\n __syncthreads();\n \n }\n \n __syncthreads();\n p_lattice[_INDEX(x,y)] = lattice[_INDEX(x,y)];\n __syncthreads();\n \n}\n"""\n )\n', (429, 2837), False, 'from pycuda.compiler import SourceModule\n'), ((3074, 3098), 'pycuda.gpuarray.to_gpu', 'gpuarray.to_gpu', (['lattice'], {}), '(lattice)\n', (3089, 3098), False, 'from pycuda import gpuarray\n'), ((3120, 3126), 'time.time', 'time', ([], {}), '()\n', (3124, 3126), False, 'from time import time\n'), ((3281, 3294), 'matplotlib.pyplot.figure', 'plt.figure', (['(1)'], {}), '(1)\n', (3291, 3294), True, 'import matplotlib.pyplot as plt\n'), ((3333, 3343), 'matplotlib.pyplot.show', 'plt.show', ([], {}), '()\n', (3341, 3343), True, 'import matplotlib.pyplot as plt\n'), ((3162, 3181), 'numpy.int32', 'np.int32', (['(1000000.0)'], {}), '(1000000.0)\n', (3170, 3181), True, 'import numpy as np\n'), ((2995, 3042), 'numpy.random.choice', 'np.random.choice', (['[1, 0]', '(N * N)'], {'p': '[0.25, 0.75]'}), '([1, 0], N * N, p=[0.25, 0.75])\n', (3011, 3042), True, 'import numpy as np\n'), ((3234, 3240), 'time.time', 'time', ([], {}), '()\n', (3238, 3240), False, 'from time import time\n')]
#!/usr/bin/python3 """ File containing the class BaseModel """ from datetime import datetime import models import uuid class BaseModel: """a class that defines all common attributes/methods for other classes""" def __init__(self, *args, **kwargs): """Function for initializing the base model""" if kwargs is None or len(kwargs) < 1: self.id = str(uuid.uuid4()) self.created_at = datetime.now() self.updated_at = datetime.now() models.storage.new(self) else: for key, value in kwargs.items(): if key != "__class__": if key == "created_at" or key == "updated_at": value = datetime.strptime( value, '%Y-%m-%dT%H:%M:%S.%f') setattr(self, key, value) def __str__(self,): """String representation of the BaseModel class""" x = "[{}] ({}) {}".format(self.__class__.__name__, self.id, self.__dict__) return x def save(self): """updates the class with the current time""" self.updated_at = datetime.now() models.storage.new(self) models.storage.save() def to_dict(self): """returns a dictionary containing all key-value pairs""" dic_n = self.__dict__.copy() dic_n['created_at'] = self.created_at.isoformat() dic_n['updated_at'] = self.updated_at.isoformat() dic_n['__class__'] = self.__class__.__name__ return dic_n
[ "uuid.uuid4", "datetime.datetime.strptime", "models.storage.save", "datetime.datetime.now", "models.storage.new" ]
[((1168, 1182), 'datetime.datetime.now', 'datetime.now', ([], {}), '()\n', (1180, 1182), False, 'from datetime import datetime\n'), ((1191, 1215), 'models.storage.new', 'models.storage.new', (['self'], {}), '(self)\n', (1209, 1215), False, 'import models\n'), ((1224, 1245), 'models.storage.save', 'models.storage.save', ([], {}), '()\n', (1243, 1245), False, 'import models\n'), ((430, 444), 'datetime.datetime.now', 'datetime.now', ([], {}), '()\n', (442, 444), False, 'from datetime import datetime\n'), ((475, 489), 'datetime.datetime.now', 'datetime.now', ([], {}), '()\n', (487, 489), False, 'from datetime import datetime\n'), ((502, 526), 'models.storage.new', 'models.storage.new', (['self'], {}), '(self)\n', (520, 526), False, 'import models\n'), ((386, 398), 'uuid.uuid4', 'uuid.uuid4', ([], {}), '()\n', (396, 398), False, 'import uuid\n'), ((725, 773), 'datetime.datetime.strptime', 'datetime.strptime', (['value', '"""%Y-%m-%dT%H:%M:%S.%f"""'], {}), "(value, '%Y-%m-%dT%H:%M:%S.%f')\n", (742, 773), False, 'from datetime import datetime\n')]
import random import pyodbc import pickle import cv2 import time from RaspberryPi.CollectingTrainingData.Commands import Commands from imgaug import augmenters as iaa # server = 'amaanrobotics.database.windows.net' # database = 'AmaanRoboticsCloudDB' # username = '' # password = '' # driver= '{ODBC Driver 13 for SQL Server}' # cnxn = pyodbc.connect('DRIVER='+driver+';PORT=1433;SERVER='+server+';PORT=1443;DATABASE='+database+';UID='+username+';PWD='+ password) def parseCommand(cmd): if cmd == Commands.NO_CMD.value: return "NO_CMD" elif cmd == Commands.LEFT.value: return "LEFT" elif cmd == Commands.RIGHT.value: return 'RIGHT' elif cmd == Commands.FORWARD.value: return 'FORWARD' elif cmd == Commands.BACK.value: return 'BACK' elif cmd == Commands.STOP_ALL_MOTORS.value: return 'STOP ALL MOTORS' elif cmd == Commands.BACK_MOTOR_STOP.value: return 'BACK_MOTOR_STOP' elif cmd == Commands.RESET_STEER.value: return 'RESET_STEER' else: return None def applyAdaptiveThreshold(imgs): threshImgs = [] for img in imgs: thresh = cv2.cvtColor(img, cv2.COLOR_RGB2GRAY) thresh = cv2.medianBlur(thresh, 5) #5 - kernel size thresh = cv2.adaptiveThreshold(thresh, 255, cv2.ADAPTIVE_THRESH_MEAN_C, cv2.THRESH_BINARY, 11, 2) threshImgs.append(thresh) return threshImgs def applyOtsuThreshold(imgs): threshImgs = [] for img in imgs: thresh = cv2.cvtColor(img, cv2.COLOR_RGB2GRAY) thresh = cv2.GaussianBlur(thresh, (3,3), 0) #apply guassian blur ret3, thresh = cv2.threshold(thresh, 0, 255, cv2.THRESH_BINARY+cv2.THRESH_OTSU) threshImgs.append(thresh) return threshImgs def getTrainingData(cursor): ''' :param cursor: pyodbc cursor cnxn :return: the imgList and cmdList ''' # master_list = [] #contains all framelets imgList = [] cmdList = [] noCmdCount = 0 cursor.execute("Select X.* From (SELECT *,Row_Number() over (Order by FileName) as RN from poc.TrainingData) As X where X.Evaluation='Good' and X.Id < 20") row = cursor.fetchone() #fetch one row while row is not None: currentFramelet_list= pickle.loads(row.ImageByteArray) #a video clip of framelets for framelet in currentFramelet_list: # master_list.append(framelet) if(framelet.cmd != Commands.NO_CMD.value): imgList.append(framelet.frame[120:240]) #flatten the 3-d array into 1-d --> -1 means 1 dimensional flatten AND take lower half of image cmdList.append(framelet.cmd[0:4]) #TODO: THIS IS TEMPERORARY, IT SHOULD ACTUALLY RETURN ME THE WHOLE CMD else: noCmdCount += 1 row = cursor.fetchone() print("noCmdCount = {}".format(noCmdCount)) return imgList #TODO: returns list not numpy array, Do we need numpy array instead? server = '' database = '' username = '' password = '' driver= '{ODBC Driver 13 for SQL Server}' cnxn = pyodbc.connect('DRIVER='+driver+';SERVER='+server+';DATABASE='+database+';UID='+username+';PWD='+ password) cursor = cnxn.cursor() query1 ="Select X.* From (SELECT *,Row_Number() over (Order by FileName) as RN from poc.TrainingData) As X where X.RN BETWEEN 7 and 11 " query2 = "Select X.* From (SELECT *,Row_Number() over (Order by FileName) as RN from poc.TrainingData) As X where X.Evaluation='Good'" query3 = "SELECT * FROM [AmaanRoboticsDB].[].[TrainingData] where Id between 5 and 14" seq = iaa.Sequential([ # iaa.Sometimes(0.2, iaa.PerspectiveTransform(scale=(0.005, 0.05))), #20% of time do this # iaa.Sometimes(1, iaa.GaussianBlur(sigma=(0,9))), #30% of time do this iaa.Sometimes(0.20, iaa.OneOf([ #do one of these 2, and do that 30% of time iaa.ContrastNormalization((0.75, 1.5)), #increase/decrease contrast iaa.Multiply((0.5, 1.5)) #brightness ])) ]) cursor.execute("SELECT TOP 10 * FROM trainData.SteeringAngleData order by 1 desc") row = cursor.fetchone() #fetch all rows while row is not None: print(row.Id) p = pickle.loads(row.ImageByteArray) for framelet in p: img = cv2.resize(framelet.frame[112:228],(288,116)) img = seq.augment_image(img) cv2.imshow('i', img) # print(parseCommand(framelet.cmd)) # time.sleep() if cv2.waitKey(1) & 0xFF == ord("q"): break time.sleep(0.1) # time.sleep row = cursor.fetchone() #show shuffled # cursor.execute("Select X.* From (SELECT *,Row_Number() over (Order by FileName) as RN from poc.TrainingData) As X where X.Evaluation='Good' and Id < 50") # imgs = getTrainingData(cursor) # # # for img in imgs: # print(img.shape) # cv2.imshow('i', img) # if cv2.waitKey(1) & 0xFF == ord("q"): # break # time.sleep(0.01)
[ "pickle.loads", "cv2.GaussianBlur", "cv2.medianBlur", "cv2.cvtColor", "cv2.waitKey", "cv2.threshold", "cv2.adaptiveThreshold", "time.sleep", "imgaug.augmenters.ContrastNormalization", "imgaug.augmenters.Multiply", "pyodbc.connect", "cv2.imshow", "cv2.resize" ]
[((3039, 3167), 'pyodbc.connect', 'pyodbc.connect', (["('DRIVER=' + driver + ';SERVER=' + server + ';DATABASE=' + database +\n ';UID=' + username + ';PWD=' + password)"], {}), "('DRIVER=' + driver + ';SERVER=' + server + ';DATABASE=' +\n database + ';UID=' + username + ';PWD=' + password)\n", (3053, 3167), False, 'import pyodbc\n'), ((4167, 4199), 'pickle.loads', 'pickle.loads', (['row.ImageByteArray'], {}), '(row.ImageByteArray)\n', (4179, 4199), False, 'import pickle\n'), ((1153, 1190), 'cv2.cvtColor', 'cv2.cvtColor', (['img', 'cv2.COLOR_RGB2GRAY'], {}), '(img, cv2.COLOR_RGB2GRAY)\n', (1165, 1190), False, 'import cv2\n'), ((1208, 1233), 'cv2.medianBlur', 'cv2.medianBlur', (['thresh', '(5)'], {}), '(thresh, 5)\n', (1222, 1233), False, 'import cv2\n'), ((1268, 1361), 'cv2.adaptiveThreshold', 'cv2.adaptiveThreshold', (['thresh', '(255)', 'cv2.ADAPTIVE_THRESH_MEAN_C', 'cv2.THRESH_BINARY', '(11)', '(2)'], {}), '(thresh, 255, cv2.ADAPTIVE_THRESH_MEAN_C, cv2.\n THRESH_BINARY, 11, 2)\n', (1289, 1361), False, 'import cv2\n'), ((1502, 1539), 'cv2.cvtColor', 'cv2.cvtColor', (['img', 'cv2.COLOR_RGB2GRAY'], {}), '(img, cv2.COLOR_RGB2GRAY)\n', (1514, 1539), False, 'import cv2\n'), ((1557, 1592), 'cv2.GaussianBlur', 'cv2.GaussianBlur', (['thresh', '(3, 3)', '(0)'], {}), '(thresh, (3, 3), 0)\n', (1573, 1592), False, 'import cv2\n'), ((1636, 1702), 'cv2.threshold', 'cv2.threshold', (['thresh', '(0)', '(255)', '(cv2.THRESH_BINARY + cv2.THRESH_OTSU)'], {}), '(thresh, 0, 255, cv2.THRESH_BINARY + cv2.THRESH_OTSU)\n', (1649, 1702), False, 'import cv2\n'), ((2238, 2270), 'pickle.loads', 'pickle.loads', (['row.ImageByteArray'], {}), '(row.ImageByteArray)\n', (2250, 2270), False, 'import pickle\n'), ((4237, 4284), 'cv2.resize', 'cv2.resize', (['framelet.frame[112:228]', '(288, 116)'], {}), '(framelet.frame[112:228], (288, 116))\n', (4247, 4284), False, 'import cv2\n'), ((4328, 4348), 'cv2.imshow', 'cv2.imshow', (['"""i"""', 'img'], {}), "('i', img)\n", (4338, 4348), False, 'import cv2\n'), ((4488, 4503), 'time.sleep', 'time.sleep', (['(0.1)'], {}), '(0.1)\n', (4498, 4503), False, 'import time\n'), ((4427, 4441), 'cv2.waitKey', 'cv2.waitKey', (['(1)'], {}), '(1)\n', (4438, 4441), False, 'import cv2\n'), ((3844, 3882), 'imgaug.augmenters.ContrastNormalization', 'iaa.ContrastNormalization', (['(0.75, 1.5)'], {}), '((0.75, 1.5))\n', (3869, 3882), True, 'from imgaug import augmenters as iaa\n'), ((3928, 3952), 'imgaug.augmenters.Multiply', 'iaa.Multiply', (['(0.5, 1.5)'], {}), '((0.5, 1.5))\n', (3940, 3952), True, 'from imgaug import augmenters as iaa\n')]
# -*- coding: utf-8 -*- import datetime from decimal import Decimal, ROUND_HALF_UP import logging import time import xlrd from datapro.framework.util import to_utc logger = logging.getLogger(__name__) class Validator(object): def __init__(self, level='warn'): self._level = level self._message_template = None self.properties = None self.valid = None self.reset() def _check_null(self, key, value, blank_is_null, nulls_ok, level, message_template): if value is None: if nulls_ok: self.properties[key] = value else: self._fail(key, level, 'Nulls are not allowed', message_template) return False elif isinstance(value, str) and value == '': if blank_is_null: if nulls_ok: self.properties[key] = None else: self._fail(key, level, 'Blank strings are not allowed', message_template) return False return True def _fail(self, key, level, message, message_template): self.valid = False if not level: level = self._level if not message_template: message_template = self._message_template # print(key) # print(message_template) # # print(message_template.format(**{'key': key, 'message': message}) # exit() # getattr(logger, level)(message_template.format(**{'key': key, 'message': message})) getattr(logger, level)(message_template.format(key=key, message=message)) def reset(self, mesage_template=None): if mesage_template: self._message_template = mesage_template self.properties = {} self.valid = True def date(self, key, value, format, nulls_ok=False, level=None, message_template=None): if self._check_null(key, value, True, nulls_ok, level, message_template): if isinstance(format, str): try: self.properties[key] = datetime.date(*(time.strptime(value, format)[:3])) except: self._fail(key, level, '"{0}" could not be converted to a date'.format(value), message_template) else: try: self.properties[key] = datetime.date(*(xlrd.xldate_as_tuple(value, format)[:3])) except: self._fail(key, level, '"{0}" could not be converted to a date'.format(value), message_template) def datetime(self, key, value, format, tz=None, nulls_ok=False, level=None, message_template=None): if self._check_null(key, value, True, nulls_ok, level, message_template): if isinstance(format, str): try: dt = datetime.datetime(*(time.strptime(value, format)[:6])) except: self._fail(key, level, '"{0}" could not be converted to a date and time'.format(value), message_template) return else: try: dt = datetime.datetime(*(xlrd.xldate_as_tuple(value, format)[:6])) except: self._fail(key, level, '"{0}" could not be converted to a date and time'.format(value), message_template) return if tz is not None: dt = to_utc(dt, tz) self.properties[key] = dt def decimal(self, key, value, precision, nulls_ok=False, level=None, message_template=None): if self._check_null(key, value, True, nulls_ok, level, message_template): qp = '1.{places}'.format(places='0'*precision) try: self.properties[key] = Decimal(value).quantize(Decimal(qp), rounding=ROUND_HALF_UP) except: self._fail(key, level, '"{0}" could not be converted to a number'.format(value), message_template) def int(self, key, value, nulls_ok=False, level=None, message_template=None): if self._check_null(key, value, True, nulls_ok, level, message_template): try: self.properties[key] = int(value) except: self._fail(key, level, '"{0}" could not be converted to an integer'.format(value), message_template) def string(self, key, value, blanks_ok=False, convert_nulls_to_blank=False, max_length=0, nulls_ok=False, level=None, message_template=None): if value is None: if convert_nulls_to_blank: if blanks_ok: self.properties[key] = '' else: self._fail(key, level, 'Interpreted null as blank, but blank strings are not allowed', message_template) elif not nulls_ok: self._fail(key, level, 'Nulls are not allowed', message_template) elif value == '' and not blanks_ok: self._fail(key, level, 'Blank strings are not allowed', message_template) else: if 0 < max_length < len(value): self._fail( key, level, '"{0}" is {1} characters long, but the maximum allowed length is {2}'.format( value, len(value), max_length ), message_template ) else: self.properties[key] = value
[ "decimal.Decimal", "datapro.framework.util.to_utc", "xlrd.xldate_as_tuple", "time.strptime", "logging.getLogger" ]
[((176, 203), 'logging.getLogger', 'logging.getLogger', (['__name__'], {}), '(__name__)\n', (193, 203), False, 'import logging\n'), ((3401, 3415), 'datapro.framework.util.to_utc', 'to_utc', (['dt', 'tz'], {}), '(dt, tz)\n', (3407, 3415), False, 'from datapro.framework.util import to_utc\n'), ((3773, 3784), 'decimal.Decimal', 'Decimal', (['qp'], {}), '(qp)\n', (3780, 3784), False, 'from decimal import Decimal, ROUND_HALF_UP\n'), ((3749, 3763), 'decimal.Decimal', 'Decimal', (['value'], {}), '(value)\n', (3756, 3763), False, 'from decimal import Decimal, ROUND_HALF_UP\n'), ((2083, 2111), 'time.strptime', 'time.strptime', (['value', 'format'], {}), '(value, format)\n', (2096, 2111), False, 'import time\n'), ((2357, 2392), 'xlrd.xldate_as_tuple', 'xlrd.xldate_as_tuple', (['value', 'format'], {}), '(value, format)\n', (2377, 2392), False, 'import xlrd\n'), ((2833, 2861), 'time.strptime', 'time.strptime', (['value', 'format'], {}), '(value, format)\n', (2846, 2861), False, 'import time\n'), ((3129, 3164), 'xlrd.xldate_as_tuple', 'xlrd.xldate_as_tuple', (['value', 'format'], {}), '(value, format)\n', (3149, 3164), False, 'import xlrd\n')]
#!/usr/bin/env python '''====================================================== Created by: <NAME> and <NAME> Last updated: March 2015 File name: DF_Plots.py Organization: RISC Lab, Utah State University ======================================================''' import roslib; roslib.load_manifest('risc_msgs') import rospy import numpy as np import matplotlib as mpl from mpl_toolkits.mplot3d import Axes3D import pylab as p import matplotlib.pyplot as plt import time #=======================# # Messages Needed # #=======================# from risc_msgs.msg import * # states,controls,trajectory from sensor_msgs.msg import Joy #========================# # Globals # #========================# rate = 20 # Hz states = Cortex() traj = Trajectories() ctrl = Controls() start_time = 0 euler_max = 45*np.pi/180 Button_pushed = False plot_button = 3 #===================================# # Plotting Variables # #===================================# states_of_interest = 16 storage_mat = np.asmatrix(np.zeros((1,states_of_interest))) index = [0] name = ['Initial'] #==================# # Get States # #==================# def GetStates(I): global states states = I #=========================# # Get Joystick Data # #=========================# def GetJoy(I): global Button_pushed Button_pushed = I.buttons[plot_button] #======================# # Get Trajectory # #======================# def GetTrajectory(I): global traj traj = I #====================# # Get Controls # #====================# def GetControls(I): global ctrl ctrl = I def Plots(): global storage_mat, index, name if len(index) > 2: for i in range(len(index)-1): # assign data vectors f = index[i+1] if i+2 == len(index): b = -1 else: b = index[i+2] x_act = storage_mat[f:b,0] y_act = storage_mat[f:b,1] z_act = storage_mat[f:b,2] x_des = storage_mat[f:b,3] y_des = storage_mat[f:b,4] z_des = storage_mat[f:b,5] phi_des = storage_mat[f:b,6] theta_des = storage_mat[f:b,7] psi_des = storage_mat[f:b,8] phi_act = storage_mat[f:b,9] theta_act = storage_mat[f:b,10] psi_act = storage_mat[f:b,11] xdot_err = storage_mat[f:b,12] ydot_err = storage_mat[f:b,13] zdot_err = storage_mat[f:b,14] t = storage_mat[f:b,15] # 3d plot plot3d(name[i+1],x_act,y_act,z_act,x_des,y_des,z_des) # Roll plot2d(name[i+1] + ' Roll',phi_act,phi_des,t,'Time (s)','Angle (Deg)') # Pitch plot2d(name[i+1] + ' Pitch',theta_act,theta_des,t,'Time (s)','Angle (Deg)') # Errors plot3err(name[i+1] + ' Position Errors',x_des-x_act,y_des-y_act,z_des-z_act,t,'Time (s)', 'Error (m)', 'x', 'y', 'z') plot3err(name[i+1] + ' Velocity Errors',xdot_err,ydot_err,zdot_err,t,'Time (s)', 'Error (m/s)', 'xdot', 'ydot', 'zdot') plt.show(block=False) else: rospy.loginfo("insufficient data") #==========================# # Plotting Functions # #==========================# def plot3d(Traj_name,x_act,y_act,z_act,x_des,y_des,z_des): x_act=list(np.array(x_act).reshape(-1)) y_act=list(np.array(y_act).reshape(-1)) z_act=list(np.array(z_act).reshape(-1)) x_des=list(np.array(x_des).reshape(-1)) y_des=list(np.array(y_des).reshape(-1)) z_des=list(np.array(z_des).reshape(-1)) fig = plt.figure(Traj_name) ax = fig.gca(projection='3d') ax.plot(x_act, y_act, z_act,'k-', label='Actual') ax.plot(x_des, y_des, z_des,'r-', label='Desired') ax.legend() ax.set_title(Traj_name + ' Trajectory', fontsize=16) ax.set_xlabel(r'X (m)', fontsize=14) ax.set_ylabel(r'Y (m)', fontsize=14) ax.set_zlabel(r'Z (m)', fontsize=14) ax.set_xlim([-2, 2]) ax.set_ylim([-2, 2]) ax.set_zlim([0, 2]) def plot3err(plot_name,err1,err2,err3,time,xaxis_label, yaxis_label,label1, label2, label3): Err1 = list(np.array(err1).reshape(-1)) Err2 = list(np.array(err2).reshape(-1)) Err3 = list(np.array(err3).reshape(-1)) time = list(np.array(time).reshape(-1)) fig = plt.figure(plot_name) plt.plot(time, Err1,'b-', label=label1) plt.plot(time, Err2,'k-', label=label2) plt.plot(time, Err3,'r-', label=label3) plt.legend() plt.title(plot_name, fontsize=16) plt.xlabel(xaxis_label, fontsize=14) plt.ylabel(yaxis_label, fontsize=14) plt.xlim((time[0],time[-1])) y_min = min([min(Err1),min(Err2),min(Err3)]) y_min = y_min - .2*abs(y_min) y_max = max([max(Err1),max(Err2),max(Err3)]) y_max = y_max + .2*abs(y_max) plt.ylim((y_min,y_max)) def plot2d(plot_name,actual_data,commanded_data,time,xaxis_label, yaxis_label): actual_data = list(np.array(actual_data).reshape(-1)) commanded_data = list(np.array(commanded_data).reshape(-1)) time = list(np.array(time).reshape(-1)) fig = plt.figure(plot_name) plt.plot(time, actual_data, 'b-', label='actual') plt.plot(time, commanded_data,'r:', label='Commanded') plt.legend() plt.title(plot_name, fontsize=16) plt.xlabel(xaxis_label, fontsize=14) plt.ylabel(yaxis_label, fontsize=14) plt.xlim((time[0],time[-1])) y_min = min([min(actual_data),min(commanded_data)]) y_min = y_min - .2*abs(y_min) y_max = max([max(actual_data),max(commanded_data)]) y_max = y_max + .2*abs(y_max) plt.ylim((y_min,y_max)) #==================# # Datalogger # #==================# def Datalogger(): global start_time,states,ctrl, traj, euler_max #======================================================# # If all states of interest are present log data # #======================================================# if len(traj.Obj) > 0 and len(states.Obj) > 0 and len(ctrl.Obj) > 0: global storage_mat rospy.loginfo("logging data...") x_act = states.Obj[0].x y_act = states.Obj[0].y z_act = states.Obj[0].z x_des = traj.Obj[0].x y_des = traj.Obj[0].y z_des = traj.Obj[0].z phi_traj = ctrl.Obj[0].phi*euler_max*180/np.pi theta_traj = ctrl.Obj[0].theta*euler_max*180/np.pi psi_traj = traj.Obj[0].psi*180/np.pi phi_cort = states.Obj[0].phi theta_cort = states.Obj[0].theta psi_cort = states.Obj[0].psi u_cort_err = traj.Obj[0].xdot - states.Obj[0].u v_cort_err = traj.Obj[0].ydot - states.Obj[0].v w_cort_err = traj.Obj[0].zdot - states.Obj[0].w t = float(rospy.get_time() - start_time) new_stack = np.asmatrix(np.array([x_act, y_act, z_act, z_des, y_des, z_des,\ phi_traj, theta_traj, psi_traj, phi_cort, theta_cort, psi_cort,\ u_cort_err, v_cort_err, w_cort_err,t])) storage_mat = np.append(storage_mat,new_stack,0) #==========================================================================# # If there is a new trajectory store the index and trajectory name # #==========================================================================# global storage_mat, states_of_interest,name,index if len(traj.Obj) > 0 and name[-1] != traj.Obj[0].name: name.append(traj.Obj[0].name) index.append(storage_mat.shape[0] -1) start_time = rospy.get_time() #===================# # Main # #===================# if __name__=='__main__': rospy.init_node('DF_Plotter') start_time = rospy.get_time() euler_max = float(rospy.get_param("euler_angle_max", ".78537")) #in radians plot_button = int(rospy.get_param("plot_button", "3")) #=====================================# # Set up Publish/Subscribe Loop # #=====================================# r = rospy.Rate(rate) while not rospy.is_shutdown(): sub_states = rospy.Subscriber('/cortex_raw' , Cortex, GetStates) sub_traj = rospy.Subscriber('/trajectory',Trajectories, GetTrajectory) sub_cntrl = rospy.Subscriber('/controls' , Controls, GetControls) sub_joy = rospy.Subscriber('/joy' , Joy, GetJoy) Datalogger() if Button_pushed: Plots() answer = raw_input('Erase plots and reset datalogger?') if answer == 'y' or answer == 'yes' or answer == 'I guess' or answer == 'sure': rospy.loginfo("Resetting datalogger and erasing plots...") plt.clf() start_time = rospy.get_time() storage_mat = np.asmatrix(np.zeros((1,states_of_interest))) plt.close('all') else: plt.clf() plt.close('all') rospy.signal_shutdown(0) r.sleep()
[ "matplotlib.pyplot.title", "rospy.Subscriber", "matplotlib.pyplot.clf", "matplotlib.pyplot.figure", "roslib.load_manifest", "matplotlib.pyplot.close", "rospy.Rate", "rospy.signal_shutdown", "numpy.append", "rospy.is_shutdown", "rospy.init_node", "rospy.get_time", "matplotlib.pyplot.show", "matplotlib.pyplot.ylim", "matplotlib.pyplot.legend", "rospy.loginfo", "matplotlib.pyplot.ylabel", "matplotlib.pyplot.xlim", "matplotlib.pyplot.plot", "numpy.zeros", "rospy.get_param", "numpy.array", "matplotlib.pyplot.xlabel" ]
[((301, 334), 'roslib.load_manifest', 'roslib.load_manifest', (['"""risc_msgs"""'], {}), "('risc_msgs')\n", (321, 334), False, 'import roslib\n'), ((1180, 1213), 'numpy.zeros', 'np.zeros', (['(1, states_of_interest)'], {}), '((1, states_of_interest))\n', (1188, 1213), True, 'import numpy as np\n'), ((3923, 3944), 'matplotlib.pyplot.figure', 'plt.figure', (['Traj_name'], {}), '(Traj_name)\n', (3933, 3944), True, 'import matplotlib.pyplot as plt\n'), ((4651, 4672), 'matplotlib.pyplot.figure', 'plt.figure', (['plot_name'], {}), '(plot_name)\n', (4661, 4672), True, 'import matplotlib.pyplot as plt\n'), ((4677, 4717), 'matplotlib.pyplot.plot', 'plt.plot', (['time', 'Err1', '"""b-"""'], {'label': 'label1'}), "(time, Err1, 'b-', label=label1)\n", (4685, 4717), True, 'import matplotlib.pyplot as plt\n'), ((4721, 4761), 'matplotlib.pyplot.plot', 'plt.plot', (['time', 'Err2', '"""k-"""'], {'label': 'label2'}), "(time, Err2, 'k-', label=label2)\n", (4729, 4761), True, 'import matplotlib.pyplot as plt\n'), ((4765, 4805), 'matplotlib.pyplot.plot', 'plt.plot', (['time', 'Err3', '"""r-"""'], {'label': 'label3'}), "(time, Err3, 'r-', label=label3)\n", (4773, 4805), True, 'import matplotlib.pyplot as plt\n'), ((4809, 4821), 'matplotlib.pyplot.legend', 'plt.legend', ([], {}), '()\n', (4819, 4821), True, 'import matplotlib.pyplot as plt\n'), ((4826, 4859), 'matplotlib.pyplot.title', 'plt.title', (['plot_name'], {'fontsize': '(16)'}), '(plot_name, fontsize=16)\n', (4835, 4859), True, 'import matplotlib.pyplot as plt\n'), ((4864, 4900), 'matplotlib.pyplot.xlabel', 'plt.xlabel', (['xaxis_label'], {'fontsize': '(14)'}), '(xaxis_label, fontsize=14)\n', (4874, 4900), True, 'import matplotlib.pyplot as plt\n'), ((4905, 4941), 'matplotlib.pyplot.ylabel', 'plt.ylabel', (['yaxis_label'], {'fontsize': '(14)'}), '(yaxis_label, fontsize=14)\n', (4915, 4941), True, 'import matplotlib.pyplot as plt\n'), ((4946, 4975), 'matplotlib.pyplot.xlim', 'plt.xlim', (['(time[0], time[-1])'], {}), '((time[0], time[-1]))\n', (4954, 4975), True, 'import matplotlib.pyplot as plt\n'), ((5146, 5170), 'matplotlib.pyplot.ylim', 'plt.ylim', (['(y_min, y_max)'], {}), '((y_min, y_max))\n', (5154, 5170), True, 'import matplotlib.pyplot as plt\n'), ((5441, 5462), 'matplotlib.pyplot.figure', 'plt.figure', (['plot_name'], {}), '(plot_name)\n', (5451, 5462), True, 'import matplotlib.pyplot as plt\n'), ((5467, 5516), 'matplotlib.pyplot.plot', 'plt.plot', (['time', 'actual_data', '"""b-"""'], {'label': '"""actual"""'}), "(time, actual_data, 'b-', label='actual')\n", (5475, 5516), True, 'import matplotlib.pyplot as plt\n'), ((5521, 5576), 'matplotlib.pyplot.plot', 'plt.plot', (['time', 'commanded_data', '"""r:"""'], {'label': '"""Commanded"""'}), "(time, commanded_data, 'r:', label='Commanded')\n", (5529, 5576), True, 'import matplotlib.pyplot as plt\n'), ((5580, 5592), 'matplotlib.pyplot.legend', 'plt.legend', ([], {}), '()\n', (5590, 5592), True, 'import matplotlib.pyplot as plt\n'), ((5597, 5630), 'matplotlib.pyplot.title', 'plt.title', (['plot_name'], {'fontsize': '(16)'}), '(plot_name, fontsize=16)\n', (5606, 5630), True, 'import matplotlib.pyplot as plt\n'), ((5635, 5671), 'matplotlib.pyplot.xlabel', 'plt.xlabel', (['xaxis_label'], {'fontsize': '(14)'}), '(xaxis_label, fontsize=14)\n', (5645, 5671), True, 'import matplotlib.pyplot as plt\n'), ((5676, 5712), 'matplotlib.pyplot.ylabel', 'plt.ylabel', (['yaxis_label'], {'fontsize': '(14)'}), '(yaxis_label, fontsize=14)\n', (5686, 5712), True, 'import matplotlib.pyplot as plt\n'), ((5717, 5746), 'matplotlib.pyplot.xlim', 'plt.xlim', (['(time[0], time[-1])'], {}), '((time[0], time[-1]))\n', (5725, 5746), True, 'import matplotlib.pyplot as plt\n'), ((5931, 5955), 'matplotlib.pyplot.ylim', 'plt.ylim', (['(y_min, y_max)'], {}), '((y_min, y_max))\n', (5939, 5955), True, 'import matplotlib.pyplot as plt\n'), ((8031, 8060), 'rospy.init_node', 'rospy.init_node', (['"""DF_Plotter"""'], {}), "('DF_Plotter')\n", (8046, 8060), False, 'import rospy\n'), ((8078, 8094), 'rospy.get_time', 'rospy.get_time', ([], {}), '()\n', (8092, 8094), False, 'import rospy\n'), ((8379, 8395), 'rospy.Rate', 'rospy.Rate', (['rate'], {}), '(rate)\n', (8389, 8395), False, 'import rospy\n'), ((3441, 3475), 'rospy.loginfo', 'rospy.loginfo', (['"""insufficient data"""'], {}), "('insufficient data')\n", (3454, 3475), False, 'import rospy\n'), ((6395, 6427), 'rospy.loginfo', 'rospy.loginfo', (['"""logging data..."""'], {}), "('logging data...')\n", (6408, 6427), False, 'import rospy\n'), ((7407, 7443), 'numpy.append', 'np.append', (['storage_mat', 'new_stack', '(0)'], {}), '(storage_mat, new_stack, 0)\n', (7416, 7443), True, 'import numpy as np\n'), ((7905, 7921), 'rospy.get_time', 'rospy.get_time', ([], {}), '()\n', (7919, 7921), False, 'import rospy\n'), ((8120, 8164), 'rospy.get_param', 'rospy.get_param', (['"""euler_angle_max"""', '""".78537"""'], {}), "('euler_angle_max', '.78537')\n", (8135, 8164), False, 'import rospy\n'), ((8201, 8236), 'rospy.get_param', 'rospy.get_param', (['"""plot_button"""', '"""3"""'], {}), "('plot_button', '3')\n", (8216, 8236), False, 'import rospy\n'), ((8410, 8429), 'rospy.is_shutdown', 'rospy.is_shutdown', ([], {}), '()\n', (8427, 8429), False, 'import rospy\n'), ((8453, 8503), 'rospy.Subscriber', 'rospy.Subscriber', (['"""/cortex_raw"""', 'Cortex', 'GetStates'], {}), "('/cortex_raw', Cortex, GetStates)\n", (8469, 8503), False, 'import rospy\n'), ((8527, 8587), 'rospy.Subscriber', 'rospy.Subscriber', (['"""/trajectory"""', 'Trajectories', 'GetTrajectory'], {}), "('/trajectory', Trajectories, GetTrajectory)\n", (8543, 8587), False, 'import rospy\n'), ((8609, 8661), 'rospy.Subscriber', 'rospy.Subscriber', (['"""/controls"""', 'Controls', 'GetControls'], {}), "('/controls', Controls, GetControls)\n", (8625, 8661), False, 'import rospy\n'), ((8685, 8722), 'rospy.Subscriber', 'rospy.Subscriber', (['"""/joy"""', 'Joy', 'GetJoy'], {}), "('/joy', Joy, GetJoy)\n", (8701, 8722), False, 'import rospy\n'), ((3401, 3422), 'matplotlib.pyplot.show', 'plt.show', ([], {'block': '(False)'}), '(block=False)\n', (3409, 3422), True, 'import matplotlib.pyplot as plt\n'), ((7184, 7347), 'numpy.array', 'np.array', (['[x_act, y_act, z_act, z_des, y_des, z_des, phi_traj, theta_traj, psi_traj,\n phi_cort, theta_cort, psi_cort, u_cort_err, v_cort_err, w_cort_err, t]'], {}), '([x_act, y_act, z_act, z_des, y_des, z_des, phi_traj, theta_traj,\n psi_traj, phi_cort, theta_cort, psi_cort, u_cort_err, v_cort_err,\n w_cort_err, t])\n', (7192, 7347), True, 'import numpy as np\n'), ((3663, 3678), 'numpy.array', 'np.array', (['x_act'], {}), '(x_act)\n', (3671, 3678), True, 'import numpy as np\n'), ((3707, 3722), 'numpy.array', 'np.array', (['y_act'], {}), '(y_act)\n', (3715, 3722), True, 'import numpy as np\n'), ((3751, 3766), 'numpy.array', 'np.array', (['z_act'], {}), '(z_act)\n', (3759, 3766), True, 'import numpy as np\n'), ((3795, 3810), 'numpy.array', 'np.array', (['x_des'], {}), '(x_des)\n', (3803, 3810), True, 'import numpy as np\n'), ((3839, 3854), 'numpy.array', 'np.array', (['y_des'], {}), '(y_des)\n', (3847, 3854), True, 'import numpy as np\n'), ((3883, 3898), 'numpy.array', 'np.array', (['z_des'], {}), '(z_des)\n', (3891, 3898), True, 'import numpy as np\n'), ((4471, 4485), 'numpy.array', 'np.array', (['err1'], {}), '(err1)\n', (4479, 4485), True, 'import numpy as np\n'), ((4518, 4532), 'numpy.array', 'np.array', (['err2'], {}), '(err2)\n', (4526, 4532), True, 'import numpy as np\n'), ((4565, 4579), 'numpy.array', 'np.array', (['err3'], {}), '(err3)\n', (4573, 4579), True, 'import numpy as np\n'), ((4612, 4626), 'numpy.array', 'np.array', (['time'], {}), '(time)\n', (4620, 4626), True, 'import numpy as np\n'), ((5277, 5298), 'numpy.array', 'np.array', (['actual_data'], {}), '(actual_data)\n', (5285, 5298), True, 'import numpy as np\n'), ((5338, 5362), 'numpy.array', 'np.array', (['commanded_data'], {}), '(commanded_data)\n', (5346, 5362), True, 'import numpy as np\n'), ((5402, 5416), 'numpy.array', 'np.array', (['time'], {}), '(time)\n', (5410, 5416), True, 'import numpy as np\n'), ((7121, 7137), 'rospy.get_time', 'rospy.get_time', ([], {}), '()\n', (7135, 7137), False, 'import rospy\n'), ((8973, 9031), 'rospy.loginfo', 'rospy.loginfo', (['"""Resetting datalogger and erasing plots..."""'], {}), "('Resetting datalogger and erasing plots...')\n", (8986, 9031), False, 'import rospy\n'), ((9049, 9058), 'matplotlib.pyplot.clf', 'plt.clf', ([], {}), '()\n', (9056, 9058), True, 'import matplotlib.pyplot as plt\n'), ((9089, 9105), 'rospy.get_time', 'rospy.get_time', ([], {}), '()\n', (9103, 9105), False, 'import rospy\n'), ((9200, 9216), 'matplotlib.pyplot.close', 'plt.close', (['"""all"""'], {}), "('all')\n", (9209, 9216), True, 'import matplotlib.pyplot as plt\n'), ((9253, 9262), 'matplotlib.pyplot.clf', 'plt.clf', ([], {}), '()\n', (9260, 9262), True, 'import matplotlib.pyplot as plt\n'), ((9280, 9296), 'matplotlib.pyplot.close', 'plt.close', (['"""all"""'], {}), "('all')\n", (9289, 9296), True, 'import matplotlib.pyplot as plt\n'), ((9314, 9338), 'rospy.signal_shutdown', 'rospy.signal_shutdown', (['(0)'], {}), '(0)\n', (9335, 9338), False, 'import rospy\n'), ((9149, 9182), 'numpy.zeros', 'np.zeros', (['(1, states_of_interest)'], {}), '((1, states_of_interest))\n', (9157, 9182), True, 'import numpy as np\n')]
import numpy as np import anndata as ad # ------------------------------------------------------------------------------- # Some test data # ------------------------------------------------------------------------------- X_list = [ # data matrix of shape n_obs x n_vars [1, 2, 3], [4, 5, 6], [7, 8, 9]] obs_dict = { # annotation of observations / rows 'row_names': ['name1', 'name2', 'name3'], # row annotation 'oanno1': ['cat1', 'cat2', 'cat2'], # categorical annotation 'oanno2': ['o1', 'o2', 'o3'], # string annotation 'oanno3': [2.1, 2.2, 2.3]} # float annotation var_dict = { # annotation of variables / columns 'vanno1': [3.1, 3.2, 3.3]} uns_dict = { # unstructured annotation 'oanno1_colors': ['#000000', '#FFFFFF'], 'uns2': ['some annotation']} # ------------------------------------------------------------------------------- # The test functions # ------------------------------------------------------------------------------- def test_views(): X = np.array(X_list) adata = ad.AnnData(X, obs=obs_dict, var=var_dict, uns=uns_dict, dtype='int32') assert adata[:, 0].isview assert adata[:, 0].X.tolist() == [1, 4, 7] adata[:2, 0].X = [0, 0] assert adata[:, 0].X.tolist() == [0, 0, 7] adata_subset = adata[:2, [0, 1]] assert adata_subset.isview # now transition to actual object adata_subset.obs['foo'] = range(2) assert not adata_subset.isview assert adata_subset.obs['foo'].tolist() == list(range(2)) def test_slice_copy(): adata = ad.AnnData(np.empty((100, 100))) adata.obsm['o'] = np.empty((100, 50)) adata = adata[:50] adata.obsm['o'] = np.ones((50, 20))
[ "anndata.AnnData", "numpy.empty", "numpy.array", "numpy.ones" ]
[((1049, 1065), 'numpy.array', 'np.array', (['X_list'], {}), '(X_list)\n', (1057, 1065), True, 'import numpy as np\n'), ((1078, 1148), 'anndata.AnnData', 'ad.AnnData', (['X'], {'obs': 'obs_dict', 'var': 'var_dict', 'uns': 'uns_dict', 'dtype': '"""int32"""'}), "(X, obs=obs_dict, var=var_dict, uns=uns_dict, dtype='int32')\n", (1088, 1148), True, 'import anndata as ad\n'), ((1641, 1660), 'numpy.empty', 'np.empty', (['(100, 50)'], {}), '((100, 50))\n', (1649, 1660), True, 'import numpy as np\n'), ((1707, 1724), 'numpy.ones', 'np.ones', (['(50, 20)'], {}), '((50, 20))\n', (1714, 1724), True, 'import numpy as np\n'), ((1597, 1617), 'numpy.empty', 'np.empty', (['(100, 100)'], {}), '((100, 100))\n', (1605, 1617), True, 'import numpy as np\n')]
from django.db import models class Author(models.Model): name = models.CharField('Name', null=True, blank=True, max_length=255) class Meta: ordering = ['name'] def __str__(self): return self.name def __unicode__(self): return self.name class SortableBook(models.Model): title = models.CharField('Title', null=True, blank=True, max_length=255) my_order = models.PositiveIntegerField(default=0, blank=False, null=False) author = models.ForeignKey(Author, null=True, on_delete=models.CASCADE) class Meta(object): ordering = ['my_order'] def __str__(self): return self.title def __unicode__(self): return self.title class Chapter(models.Model): title = models.CharField('Title', null=True, blank=True, max_length=255) book = models.ForeignKey(SortableBook, null=True, on_delete=models.CASCADE) my_order = models.PositiveIntegerField(blank=False, null=False) class Meta(object): ordering = ['my_order'] def __str__(self): return 'Chapter: {0}'.format(self.title) def __unicode__(self): return 'Chapter: {0}'.format(self.title) class Notes(models.Model): note = models.CharField('Note', null=True, blank=True, max_length=255) book = models.ForeignKey(SortableBook, null=True, on_delete=models.CASCADE) def __str__(self): return 'Note: {0}'.format(self.note) def __unicode__(self): return 'Note: {0}'.format(self.note)
[ "django.db.models.CharField", "django.db.models.PositiveIntegerField", "django.db.models.ForeignKey" ]
[((70, 133), 'django.db.models.CharField', 'models.CharField', (['"""Name"""'], {'null': '(True)', 'blank': '(True)', 'max_length': '(255)'}), "('Name', null=True, blank=True, max_length=255)\n", (86, 133), False, 'from django.db import models\n'), ((329, 393), 'django.db.models.CharField', 'models.CharField', (['"""Title"""'], {'null': '(True)', 'blank': '(True)', 'max_length': '(255)'}), "('Title', null=True, blank=True, max_length=255)\n", (345, 393), False, 'from django.db import models\n'), ((409, 472), 'django.db.models.PositiveIntegerField', 'models.PositiveIntegerField', ([], {'default': '(0)', 'blank': '(False)', 'null': '(False)'}), '(default=0, blank=False, null=False)\n', (436, 472), False, 'from django.db import models\n'), ((486, 548), 'django.db.models.ForeignKey', 'models.ForeignKey', (['Author'], {'null': '(True)', 'on_delete': 'models.CASCADE'}), '(Author, null=True, on_delete=models.CASCADE)\n', (503, 548), False, 'from django.db import models\n'), ((753, 817), 'django.db.models.CharField', 'models.CharField', (['"""Title"""'], {'null': '(True)', 'blank': '(True)', 'max_length': '(255)'}), "('Title', null=True, blank=True, max_length=255)\n", (769, 817), False, 'from django.db import models\n'), ((829, 897), 'django.db.models.ForeignKey', 'models.ForeignKey', (['SortableBook'], {'null': '(True)', 'on_delete': 'models.CASCADE'}), '(SortableBook, null=True, on_delete=models.CASCADE)\n', (846, 897), False, 'from django.db import models\n'), ((913, 965), 'django.db.models.PositiveIntegerField', 'models.PositiveIntegerField', ([], {'blank': '(False)', 'null': '(False)'}), '(blank=False, null=False)\n', (940, 965), False, 'from django.db import models\n'), ((1213, 1276), 'django.db.models.CharField', 'models.CharField', (['"""Note"""'], {'null': '(True)', 'blank': '(True)', 'max_length': '(255)'}), "('Note', null=True, blank=True, max_length=255)\n", (1229, 1276), False, 'from django.db import models\n'), ((1288, 1356), 'django.db.models.ForeignKey', 'models.ForeignKey', (['SortableBook'], {'null': '(True)', 'on_delete': 'models.CASCADE'}), '(SortableBook, null=True, on_delete=models.CASCADE)\n', (1305, 1356), False, 'from django.db import models\n')]
from scivision_plankton_models import resnet50 import PIL import torch import torchvision X = PIL.Image.open('Pia1.2017-10-12.0711+N00207451_hc.tif') X = torchvision.transforms.ToTensor()(X) X = torchvision.transforms.Resize((256,256))(X) X = torch.unsqueeze(X, 0) model = resnet50() y = model.predict(X) _, preds = torch.max(y, 1) print(preds)
[ "PIL.Image.open", "scivision_plankton_models.resnet50", "torch.max", "torch.unsqueeze", "torchvision.transforms.Resize", "torchvision.transforms.ToTensor" ]
[((95, 150), 'PIL.Image.open', 'PIL.Image.open', (['"""Pia1.2017-10-12.0711+N00207451_hc.tif"""'], {}), "('Pia1.2017-10-12.0711+N00207451_hc.tif')\n", (109, 150), False, 'import PIL\n'), ((245, 266), 'torch.unsqueeze', 'torch.unsqueeze', (['X', '(0)'], {}), '(X, 0)\n', (260, 266), False, 'import torch\n'), ((276, 286), 'scivision_plankton_models.resnet50', 'resnet50', ([], {}), '()\n', (284, 286), False, 'from scivision_plankton_models import resnet50\n'), ((319, 334), 'torch.max', 'torch.max', (['y', '(1)'], {}), '(y, 1)\n', (328, 334), False, 'import torch\n'), ((156, 189), 'torchvision.transforms.ToTensor', 'torchvision.transforms.ToTensor', ([], {}), '()\n', (187, 189), False, 'import torchvision\n'), ((197, 238), 'torchvision.transforms.Resize', 'torchvision.transforms.Resize', (['(256, 256)'], {}), '((256, 256))\n', (226, 238), False, 'import torchvision\n')]