url stringlengths 15 1.48k | date timestamp[s] | file_path stringlengths 125 155 | language_score float64 0.65 1 | token_count int64 75 32.8k | dump stringclasses 96 values | global_id stringlengths 41 46 | lang stringclasses 1 value | text stringlengths 295 153k | domain stringclasses 67 values |
|---|---|---|---|---|---|---|---|---|---|
https://kfs.medizin.unibas.ch/en/projects/ | 2024-02-25T01:32:15 | s3://commoncrawl/crawl-data/CC-MAIN-2024-10/segments/1707947474573.20/warc/CC-MAIN-20240225003942-20240225033942-00257.warc.gz | 0.92926 | 642 | CC-MAIN-2024-10 | webtext-fineweb__CC-MAIN-2024-10__0__186777258 | en | Our research focuses on the effects of hallucinogens and entactogens in humans. More specifically, we are investigating the acute effects of LSD and MDMA (particularly neuronal correlates measured with fMRI) and potential therapeutic effects of LSD in anxiety and depression. Furthermore, we systematically assess the evidence for neurotoxic effects of MDMA.
We have been involved in several studies on the effects of MDMA, LSD, mescaline and psilocybin in healthy participants. All studies are conducted in close cooperation with the research group of Prof Matthias Liechti, Division of Clinical Pharmacology, University Hospital Basel. Outcomes of these studies included acute subjective effects, physiological effects, safety, and fMRI correlates of acute drug effects. Among others, this research demonstrated safety and feasibility, distinct (dose) profiles of subjective drugs effects and shed some light on neuronal correlates of acutely induced drug effects. We could also show that LSD induces long-lasting positive effects in healthy persons.
Currently, we aim to carry results of these phase-I-studies forward to clinical application: We have been involved in a phase-II-study investigating LSD as a treatment for anxiety associated with life-threatening diseases and generalized anxiety disorder . Furthermore, we are conducting a phase-II-study which investigates LSD as a treatment for patients suffering from major depression. The primary hypothesis is that two administrations of LSD can induce long-lasting symptom reductions in anxiety and depression.
- Psychological, physiological, endocrine, and pharmacokinetic effects of LSD in a controlled study (link)
- Effects of methylphenidate, modafinil, and MDMA on emotion-processing in humans: A pharmaco-fMRI study (link)
- Neuronal correlates of altered states of consciousness (link)
- LSD treatment in persons suffering from anxiety symptoms in severe somatic diseases or in psychiatric anxiety disorders (link)
- Role of dopamine, serotonin and 5HT2A receptors in emotion processing (link)
- Role of the serotonin 5HT2A receptor in LSD-induced altered states of consciousness (link)
- Direct comparison of altered states of consciousness induced by LSD and psilocybin (link)
- LSD therapy for persons suffering from major depression (link)
After the discovery of LSD by the Basel chemist Albert Hofmann in the 1940s, psychiatry placed high hopes on this compound, especially as possible treatment options for various mental diseases. Clinical studies showed evidence of positive long-term effects on depressive symptoms, anxiety, and substance use disorders. Similar effects were seen after administration of the related hallucinogenic agents psilocybin and mescaline. Interestingly, it was observed that limited administrations of these substances resulted in positive long-term effects in several mental diseases. Thus, this approach appeared to be fundamentally different from other known psychiatric medications that require administrations on a daily basis. Although psychiatry has progressed greatly during the twentieth century, there are still patients who do not respond well to established interventions and are therefore considered treatment-resistant. A few years ago, there was a worldwide resurgence in this area of research and our team has been on the forefront of this development.
Dr Albert Hofmann | chemistry |
https://klanz.co.uk/carpet-cleaning-in-hotels | 2022-05-28T00:05:45 | s3://commoncrawl/crawl-data/CC-MAIN-2022-21/segments/1652663011588.83/warc/CC-MAIN-20220528000300-20220528030300-00396.warc.gz | 0.938072 | 1,281 | CC-MAIN-2022-21 | webtext-fineweb__CC-MAIN-2022-21__0__214628058 | en | CARPET CLEANING SUPPLIES
CARPET CLEANING SUPPLIES
Klanz offer a range of carpet spot and stain removers to
keep your hotel carpets clean.
Products to help remove spots and stains from daily foot traffic, spills and accidents
Carpet maintenance is a very important task of the Housekeeping department since carpet and upholstery’s appearance ensure a splendid and magnificent atmosphere in hotel premises were both the guest and visitors can be attracted to the hotel services and the surroundings
The reasons why hotels pay attention to great detail in maintaining carpet and upholstery are:
It creates a positive impression
Promotes cleanliness within the premises
Make the best use of investment
To protect it from being soiled
To improve the air quality
There are certain soils which trigger the need for maintenance and refurbishment of carpet.
Soils are very dangerous for carpets because they affect heavy traffic areas of carpets.
Housekeeping must take initiative to remove the soils from carpets as one single soiled area can spoil the entire appearance of the hotel.
Since different soil requires different treatment, a complete understanding of these types of soil will ensure cost effective implementation of a carpet cleaning maintenance program.
Followings are the four types of soils that affect Carpet:
1. Dry Soils
Dry soil could be any type that lies in dry position and difficult to clean if they are mixed with any oily materials (since oily materials lead the dry soils to stick to the carpet fiver very strongly). Following are the certain basic types of dry soils:
Grit Ashes and other loose particles
Among all soils, carpets are mostly vulnerable to sand and grit. Sand and grit trigger excessive and rapid wear on the carpet fibres and the carpets backing material.
2. Water Based Spots and Stains
Water based soils affect the carpet through frequent corrosion of carpet appearance by sticking to the carpet fibres.
Spillages- coffee ,tea
Water based spot and stain removers that are formulated ,blended and mixed are very effective and useful for removing and cleaning the water soils.
3. Oil based Spots and Stains
There are several types of oily based materials that adhere with carpet fibres and responsible for carpet deterioration.
Detergent and solvent based spot and stain removers that are formulated, blended and mixed are very effective and useful for removing and cleaning the oily soils.
4. Stains, Discoloration and Odour
Stains and Discoloration include miscellaneous soils such as rust, water spots, food dyes. Using specialized blended, mixed and formulated carpet spotters are very helpful in eliminating these soils form the carpets.
Carpets are exposed to various unwanted odours over their life. Using the correct chemicals and equipment, Odours can be removed from carpets safely
Our aim is to simplify how in house teams clean carpets in your hotels, products having easy heading labels as to not confuse the operators. Product that include removers for : Red wine, tea, coffee, food dyes,
shoe polish, make up and more
Here is an explanation of the 4 Types of Carpet Cleaning Techniques that can be performed on your carpets. We hope this would help you understand what to expect every time you have your carpet cleaned.
Before any carpet cleaning is undertaken it is of vital importance that a thorough vacuum cleaning routine is carry out to remove as much dry soils as possible.
1.Hot Water Extraction (Deep Cleaning Method)
Hot water extraction involves a combination of high temperatures water that is mixed with various cleaning agents being injected into the carpet at high pressure to loosen the dirt,
stains and soil from its fibres.
A hot water extraction carpet cleaning machine usually has two tanks. A solution tank to hold the clean water and cleaning solution and a
recovery tank which is where all the dirty water is extracted to. Powerful vacuums extract the dirty water and debris from the carpet.
Hot Water Extraction is an effective deep-cleaning method
This method helps to remove dirt trapped way down into the carpet fibres.
2.Dry Powder Cleaning
Dry powder cleaning involves a technique where a soft, natural cleaning product is combined with a small amount of water, detergent, and a safe-to-use solvent.
This mixture is then brushed into the carpet, The powder acts like micro-sponges that dissolve and absorb dirt. Later, the product is vacuumed out to reveal a cleaner carpet surface.
This method is not considered as a deep-cleaning since it just removes dirt from the surface of a carpet. However, this is an appropriate maintenance cleaning technique for commercial use.
An encapsulation cleaning solution is applied via a sprayer
Afterwards, a rotary or cylindrical agitation machine with a brush is used brush the chemical into the carpet,
This allows the encapsulating chemical to penetrate, absorb and isolate the dirt on the carpet, allowing the isolated dirt to then be vacuumed way once dried
This cleaning process is fast and with minimum downtime, since this is a low-moisture system, carpets can be put back into use promptly.
This is also a great carpet maintenance-cleaning method for commercial use, perfect to maintain the surface of high foot traffic carpet.
4.Bonnet Mop Cleaning
A very low moisture cleaning method
Because only the surface of the carpet is treated, the carpet is usually dry in 15-30 minutes.
In Bonnet Cleaning, self-neutralising detergent is sprayed into the carpet and it’s then agitated with a rotary scrubber with a dry cotton bonnet pad attached.
This is an appropriate maintenance cleaning technique for commercial use, giving the surface of the carpet a clean appearance.
Klanz have over 25 years experience in the carpet cleaning industry and can recommend chemicals and machines that suit you needs - Contact us firstname.lastname@example.org | chemistry |
https://otc-daihen.com/company/news/automation-of-coronavirus-testing.html | 2024-04-18T05:10:53 | s3://commoncrawl/crawl-data/CC-MAIN-2024-18/segments/1712296817187.10/warc/CC-MAIN-20240418030928-20240418060928-00571.warc.gz | 0.953655 | 1,101 | CC-MAIN-2024-18 | webtext-fineweb__CC-MAIN-2024-18__0__57009673 | en | Always up to date
Safety and reliability are paramount in the evaluation of PCR test tubes. Femitec from Neusäß, a manufacturer for automated solutions, has developed a laboratory cell with two cooperating six-arm robots - a novelty in laboratory technology.
Tests for coronavirus (SARS-CoV-2) are performed everywhere and as a matter of course. A reliable method for detecting viruses is polymerase chain reaction (PCR); in this PCR test, known as a pathogen detection test, secretion from a swab of the nasopharynx and oral pharynx of the person tested is immersed in a plastic tube filled with buffer fluid. The sample is analyzed in a laboratory - with a repetitive handling procedure: remove the tube from the collection tray, shake it and perform the barcode identification. Now the cap of the tube is unscrewed and exactly 0.2 milliliters of sample material is taken with the pipette. Immediately after this, the cap is screwed back on and the test tube is placed back in the tray. Finally, the pipette contents are placed in the reagent substrate and sent for further laboratory evaluation. In this evaluation, genetic material of the SARS-CoV-2 virus can be detected, provided that the test person who gave the specific sample secretion is infected. Since this only becomes evident after completion of the analysis process, all test tubes including screw caps and pipettes must be assumed to be contaminated during sample handling. Nothing must go wrong here, nothing must fall off!
Zero error process is indispensable in the test procedure
Even if a laboratory were in a position in terms of personnel to handle, process and evaluate the daily tests manually, the "human factor of uncertainty" remains: On the one hand, two hands are hardly sufficient to safely manage sample handling without intermediate storage. On the other hand, the permanently repeated unscrewing and screwing on of the tube caps is unergonomic and mentally tiring. The screw caps, which were put on manually in the test centers, fit differently and can possibly be tilted. And finally, a person is probably not capable per se of delivering zero-defect performance over hours. But in the case of the Corona tests, this is absolutely necessary. On the one hand, to rule out procedural errors and thus false test results. On the other hand, to prevent any virus-contaminated material from being released into the laboratory environment under any circumstances. Both would have far-reaching consequences.
Fully automated test sequence - without example and "developed from scratch".
The key to solving this anything but trivial challenge is automation. The special machine builder Femitec in Neusäß near Augsburg has developed a robotic cell for a well-known laboratory company, which precisely maps this handling process in a customized manner and carries it out completely automatically. The automation cell can be flexibly expanded and converted and is suitable for continuous operation. Development started in December 2020, and the cell was delivered in April 2021. "We developed from scratch," says Raimund Geh, a member of the management team at Femitec. "There was no sample or example for this cell," he indicates. "After all, an automated PCR test analysis station didn't exist before, and it was clear from the start that the system had to work one hundred percent safely in every respect." It was also clear that the boundary conditions were challenging. This is because plastic tubes from different manufacturers come out of the test stations, in different sizes, often with different wall thicknesses. The material gives way when gripped, Raimund Geh points out. In addition, the tubes are screwed together manually, each with a different force. The plastic thread may also be damaged or uneven. The challenge was mastered by choosing a flexibly controllable gripper that is explicitly suitable for applications in laboratory automation.
Project development at top speed
After a total development time of only five months, the automation solution was delivered to the test laboratory. Since then, it has been working smoothly and is a novelty in terms of laboratory automation technology: One of the two installed FD-H5 six-axis jointed-arm robots from OTC DAIHEN picks up the plastic residual tubes in parallel from two trays - one on the right, one on the left - as they are delivered from the test center to the laboratory. Attendance is checked at a light barrier, the sample is mixed at a vibrating pad, and barcode entry, opening of the screw cap and holding of the cap are performed at two stations in parallel. Meanwhile, the second robot picks up a pipette, removes the precisely defined sample volume of 0.2 milliliters and feeds it very precisely to the reagent tray for diagnostics. The first robot puts the screw caps back on and places the test tubes back in the tray.
The two robots work cooperatively with each other and exchange all process information in real time. In addition, a total of five grippers are used - three handle the tubes, two grippers hold the screw cap, while a rotary unit unscrews or reseals the tube - non-stop.
"The cell has passed all contamination tests on the part of the laboratory: No material is carried away at any point during the process, and the suction system works perfectly," concludes Raimund Geh with satisfaction. | chemistry |
https://postwink.co.za/bacterrorist/ | 2020-04-05T01:07:33 | s3://commoncrawl/crawl-data/CC-MAIN-2020-16/segments/1585370526982.53/warc/CC-MAIN-20200404231315-20200405021315-00280.warc.gz | 0.935932 | 1,028 | CC-MAIN-2020-16 | webtext-fineweb__CC-MAIN-2020-16__0__53321987 | en | At Postwink, we love the idea of your company being truly environmentally-conscious.
This is why we promote all things which are planet-friendly – but which also works efficiently.
So since you are already doing your bit by recycling, why not clean your recycling bins and wheelie bins the planet-friendly way? The way nature intended? Postwink recommends a multi-purpose enzyme cleaner which is especially soft on your stainless steel, vinyls and branded recycling bins; and yet it is efficient in removing dirt and organic waste – for good.
This amazing product is called the BACTERRORIST.
Sounds dangerous? It is for dirt, but not for the environment as it cleans the way nature intended using enzyme cleaning technology.
“My team are loving the product – thank you and all the silver rails, interior of the lift etc were cleaned on Saturday using this product.”RobynVineyard Hotel, Cape Town
“One of the best products I’ve used!! The smell is also sublime.”Bernievia Postwink’s Facebook page
How to order?
Why is it cool that the BACTERRORIST has Enzymes?
In short – because stains and dirt are made of different types of molecules, and enzymes are very efficient at breaking down the basic components of these stains and dirt. For example, the Enzyme called Proteases break down proteins (e.g. meat, egg, gravy, etc..). Amylases break down starches, Lipases break down fats and grease and Xylanase break down plant cell walls.
What are Enzymes?
Enzymes are long-chain proteins created by living cells and found in all living matter. When added to organic materials like dirt, grease, and oil, enzymes accelerate the natural biodegrading, and immediately go to work breaking down the organic materials within these substances. When activated, enzymes attack, eat, or digest the amino and fatty acids that bond organic materials together. They also emulsify these materials so they can be completely removed from the surface.
Why using enzymes is more Sustainable than using Chemicals?
Small amounts of enzymes can offset larger amounts of conventional chemical ingredients. In other words, you will need less when cleaning using an enzyme cleaner. In addition to high cleaning performance, consumers also benefit with more-compact products, and therefore reduced environmental impact. Besides being an effective cleaning agent, the BACTERRORIST is biodegradable which helps protect our environment as compared to using conventional chemically produced detergents.
Through many years of testing, it has been proven that enzymes have a very safe toxicological profile, lending to their sustainability profile. They have no reproductive nor developmental toxicity, and have a low toxicity to aquatic systems. That said, enzymes may have the potential to cause inhalation allergy to certain hypersensitive individuals. Hence, avoid excessive inhalation and/or use a protective mask.
Dilute or not to Dilute
Your BACTERRORIST is a “ready-to-use” concentrated solution – which means that it is concentrated enough to allow for further dilution (1:1) to clean the home -from the floors to the sink. Yet, for tough cleaning – such as clogged drains and stubborn mildew in bathrooms – you should use it as is.
Whenever diluting the BACTERRORIST, you can dilute in warm or cold water – but not hot water which could kill off the enzymes. Furthermore, once diluted, the resulting mix must be used in the same day.
Furthermore, remember that the dirtier the area (or the worse the smell), the better it is to spray the BACTERRORIST onto the relevant surface – and to leave it to allow time for the enzymes to do their job. It is also not necessary to rinse it thereafter.
Did you know you can use the BACTERRORIST for the following uses?
The BACTERRORIST can be used in almost anywhere in your home – it especially works great for cleaning drains, floors, bathrooms. It also removes foul odours and deters insects in your home.
Here are some useful tips for using the BACTERRRORIST:
Pour undiluted solution into clogged drains. It is best to use the enzyme at night or over the weekends to give the enzyme several hours to do its job. Enzymes are not fast acting like acid-type products and they do require a few hours to work properly, but are much safer to use. Remember that strong chemical disinfectants can kill the living organisms of the enzymes – reducing the BACTERRORIST’s effectiveness.
Restrooms / Toilets:
When mopping, mix half of the BACTERRORIST with warm water (not hot water) and mop the floors. No need to rinse the floor, but let it air dry, allowing the enzymes time to react with the bacteria. | chemistry |
https://cassieeverett.com/magnesium-magical-mineral/ | 2023-12-06T06:48:05 | s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100583.31/warc/CC-MAIN-20231206063543-20231206093543-00498.warc.gz | 0.924659 | 852 | CC-MAIN-2023-50 | webtext-fineweb__CC-MAIN-2023-50__0__302805870 | en | Some of you may have heard me chat about the importance of magnesium. It’s so vital for the body and it’s been proven that most people are deficient which causes many health problems.
Here are some symptoms that would suggest your body is magnesium deficient:
- Muscle pain and spasms from feet cramps to chest pain (due to spasms in your heart muscle), and even restless leg syndrome
- Headaches and migraines
- Feeling constantly fatigued or weak
- Depression, anxiety and edginess
- Craving chocolate (cacao is high in magnesium)
- Quick exhaustion during exercise
- Insomnia and mid-night waking
Magnesium is also such an important mineral for hormone balance. Magnesium does the following wonderful things:
- It Improves the thyroid function
- Supports bad oestrogen detoxification
- Lowers blood sugar levels
- Lowers stress hormone levels in the body
- Supports testosterone production
- Increases serotonin levels (the happy hormone)
- Increases DHEA (a luxury hormone that can be converted into things like progesterone if needed).
If you’ve been into a health food shop lately you will see that there are SO many different types of magnesium.
How do you know which one is right for YOU?
Well here is my guide:
My 1st choice: Magnesium Bisglycinate (also known as magnesium chelate, magnesium di-glycinate, magnesium glycinate) it’s a highly absorbable form of magnesium chelated to two molecules of the amino acid glycine. Take 300mg a day but I would double up to 600mg, or even 800mg per day if very stressed, or traveling (also a form of stress).
“Chelated” forms of a mineral mean that an amino acid has been attached to them, making them a very stable form of magnesium that is less likely to cause gastrointestinal symptoms and reduces the laxative effect. Yet, it helps with PMS, fibrocystic breasts, sleep, anxiety, cravings, pains and cramps.
Magnesium Citrate is another chelated type of magnesium bound to citric acid. This form of magnesium is about 30% bioavailable, but it pulls water into the bowels giving it more of a laxative effect, which some may like if suffering from chronic constipation. If you feel depleted in magnesium (based on the symptoms) and struggle with chronic constipation, magnesium citrate is the one for you.
Magnesium Malate is a type of magnesium bound to malic acid. For those having issues with energy production, a magnesium malate supplement may be effective for helping with chronic fatigue syndrome and/or fibromyalgia. No surprise, this form may be too stimulating for some and may disrupt sleep, especially when taken at night.
Magnesium Threonate is a form of magnesium chelated to threonic acid, a metabolite of vitamin C. This form of magnesium in comparison to others was created to cross the blood-brain barrier – it may therefore improve learning and memory functions and maybe be especially beneficial for age-related cognitive decline. The suggested dose is 2,000 mg of magnesium threonate.
Magnesium oxide contains a lot of magnesium by weight but has a bioavailability of only 4%. This form is found in many magnesium supplements and should be avoided. If you are taking a multi-vitamin check if it contains this form of magnesium. If it does I would switch to a better quality supplement. Anything from boots or Holland and Barrett is generally rubbish! Go to an independent health food shop for the best brands.
Magnesium Chloride is a form of magnesium for topical use. The skin is a great way to increase magnesium levels and bypass using the gut – this is especially beneficial for people with IBS (or leaky gut) who suffer from malabsorption of nutrients. Many people report fantastic results using this form of magnesium; from pain reduction, feeling calmer and to deeper/longer sleep.
Any questions then please do drop me an email: firstname.lastname@example.org | chemistry |
http://www.hims-biocat.eu/hims-publications/asymmetric-biocatalytic-amination-of-ketones-at-the-expense-of-ammonia-and-molecular-hydrogen/ | 2019-04-21T17:03:05 | s3://commoncrawl/crawl-data/CC-MAIN-2019-18/segments/1555578531994.14/warc/CC-MAIN-20190421160020-20190421182020-00416.warc.gz | 0.813702 | 190 | CC-MAIN-2019-18 | webtext-fineweb__CC-MAIN-2019-18__0__101425129 | en | Asymmetric biocatalytic amination of ketones at the expense of ammonia and molecular hydrogen
Holzer, A.K.; Hiebler, K.; Mutti, F.G.; Simon, R.C.; Lauterbach, L.; Lenz, O.; Kroutil, W.;
Org. Lett., 2015, 17, 2431-2433. DOI: 10.1021/acs.orglett.5b01154
A biocatalytic system is presented for the stereoselective amination of ketones at the expense of NH3 and molecular hydrogen. By using a NAD+-reducing hydrogenase, an alanine dehydrogenase, and a suitable ω-transaminase, the R- as well as the S-enantiomer of various amines could be prepared with up to >99% ee and 98% conversion. | chemistry |
http://jobguide.thegoodguides.com.au/occupation/Chemist | 2013-12-09T00:49:49 | s3://commoncrawl/crawl-data/CC-MAIN-2013-48/segments/1386163837672/warc/CC-MAIN-20131204133037-00012-ip-10-33-133-15.ec2.internal.warc.gz | 0.886914 | 524 | CC-MAIN-2013-48 | webtext-fineweb__CC-MAIN-2013-48__0__49372763 | en | Chemists study the physical and chemical properties of materials to determine their composition. They use this information to develop new materials and products, to devise more efficient processes for making materials and to increase scientific knowledge.
Chemists should not be confused with pharmacists (see separate entry for Pharmacist).
Chemists may perform the following tasks:
- conduct experiments to identify chemical composition and study chemical changes that occur in natural substances and processed materials
- undertake research and analysis to develop and test theories, techniques and processes
- develop practical applications of experiments and research findings, including those combining new compounds for industrial, agricultural, veterinary and medical use
- test products and materials and prepare specifications and standards to ensure compliance with government health laws and quality standards
- undertake cost analysis, pricing and quality assurance exercises when developing new substances, processes and products
- take part in the marketing and financial management of substances, processes or products developed
- supervise and coordinate the work of technical support staff
- conduct routine analyses in a process environment.
An analytical chemist carries out tests and analyses to determine the compositions of substances and to detect the presence of impurities, residues and trace elements.
An environmental chemist monitors waste products from all sources, determines ways to neutralise any negative effects pollutants might have on the environment and devises industrial processes that are environmentally friendly.
A geochemist studies the chemistry of earth materials.
An industrial/production chemist designs, runs, troubleshoots and improves the processes of chemical and material production on an industrial scale.
An organic chemist studies the nature of organic compounds to develop new substances for use in the industrial, agricultural, veterinary and medical fields.
A physical chemist studies macroscopic, atomic, subatomic and particulate phenomena in chemical systems in terms of physical laws and concepts.
A research chemist provides innovative solutions to chemical problems and may be involved in pure or applied research.
Chemists may work alone or as part of a team of professionals and technicians. They work in laboratories, in the field or in chemical processing plants, offices and educational institutions.
Depending on the type of laboratory, chemists may have to handle dangerous or hazardous materials. Protective clothing and equipment are usually provided.
- enjoy scientific activities, including laboratory work, fieldwork and research
- able to think logically and creatively
- aptitude for accurate work
- patience, perseverance and an enquiring mind
- able to work individually or as part of a team.
Education and Training, Employment Opportunities and Additional Information
Select the State/Territory you are interested in: | chemistry |
https://upscorecard.org/methodology/ | 2022-01-18T06:34:32 | s3://commoncrawl/crawl-data/CC-MAIN-2022-05/segments/1642320300805.79/warc/CC-MAIN-20220118062411-20220118092411-00350.warc.gz | 0.923025 | 1,377 | CC-MAIN-2022-05 | webtext-fineweb__CC-MAIN-2022-05__0__187997580 | en | Methodology of the UP Scorecard
The UP Scorecard looks at six separate impact areas when assessing the human and environmental impacts of foodware and food packaging products. Learn more about each of these six areas below, and find more detailed information in the published methodology document.
The proliferation of plastic pollution has emerged as one of the greatest environmental threats of our time with troubling implications for food systems, fisheries, human health and the climate. By preventing unnecessary plastic use, we measurably reduce the cascade of ecological risks created when this material enters the environment. The UP Scorecard will show how foodware choices contribute to plastic pollution.
Indicator: grams of plastic leakage to the environment
The Plastic Pollution metric estimates the amount of plastic that enters the environment, including plastic pollution to land and aquatic ecosystems. Leakage from the following five life cycle stages is estimated:
- Loss during resin raw material manufacture, handling, and transport (e.g. as “nurdles”)
- Loss in the supply chain during conversion from resin to containers
- Loss as litter and plastic pollution during or after use of container
- Handling and management after use, including sorting and reclamation
- Loss during disposal
The UP Scorecard estimates plastic leakage rates at each stage and reports the aggregate contribution to plastic pollution in units of mass. Different plastic resins are assumed to leak at the same rate for a particular life cycle stage. As location-specific (e.g. state, county, or city) data representing litter and plastic pollution rates and waste management practices become more available, the estimates of plastic leakage can be updated to account for these data.
Chemicals of Concern
The presence of toxic chemicals in food packaging associated with harm to humans and the environment is well documented. Hundreds of different harmful substances can be present in the various types of materials used in food packaging and can leach out in different amounts and at different rates depending on many factors. The UP Scorecard helps to guide users in avoiding the most concerning substances in food packaging and moving towards healthier materials.
Indicator: scale from 1 (worst) – 100 (best) based on chemicals of concern and material inertness
The Chemicals of Concern (CoC) metric is intended to encourage suppliers to better understand the chemical impact of their products and to empower purchasers to eliminate chemicals of high concern from their portfolios and ask for safer ingredients. To provide a starting point and pathway to safer foodware and packaging, a matrixed approach was developed that calculates two separate scores to:
- Consider the avoidance of chemicals of concern based on a tiered list of chemicals and reward verification of claims and
- Consider the inertness of the food contact material, as a proxy for the propensity for any present chemicals of concern to migrate from the product into food and the environment.
These two scores are then combined to calculate a total CoC score for each food contact material on the UP Scorecard’s results page. Where only limited or highly uncertain data were available to inform the score, this is visually communicated to the user on the scorecard’s results page.
The carbon footprint from plastic manufacturing is expected to become increasingly important as this sector expands. But replacement materials often have larger greenhouse emissions. The UP Scorecard enables carbon-conscious consumers and professionals with the information they need to make informed product choices.
Indicator: grams CO2 equivalents (CO2e)
The Climate metric estimates the amount of carbon dioxide equivalent emissions of the product and is assessed using IPCC 2013 radiative forcing factors, as implemented by the Ecoinvent Centre. The implementation includes 45 substances characterized in terms of their relative radiative forcing potential in comparison to carbon dioxide.
Nearly one in five major cities around the world faces a high to very high risk of drought. While many of us are increasingly focused on water conservation, it’s not obvious to all that washing reusable containers usually saves water compared to using single-use container options. The UP Scorecard will show you which container system uses the least amount of water, even compared with washing reusables.
Indicator: liters of water consumed
To assess water use by the product system, the UP Scorecard follows the methodology of the Global Water Footprint Standard. It computes the “blue water footprint,” which reports consumptive use of surface and groundwater throughout the product supply chain, including actions that result in the transfer of water between reservoirs. The blue water footprint is reported as the total volume of water consumed; it does not account for regional differences in water scarcity. The blue water footprint does not include rain that falls on crops or forests.
Increasing the post-consumer recycled content in packaging materials avoids the need to extract virgin natural resources and also creates urgently needed market demand for recycling. For containers made from plant-based materials, the sustainability of the agricultural or forestry practices used to grow the plants have a huge impact on the overall sustainability of the container. The UP Scorecard combines these two critical issues into one Sustainable Sourcing metric.
Indicator: scale from 1 (worst) – 5 (best)
The Sustainable Sourcing metric is a qualitative assessment based on the percentage of post-consumer recycled content in the container and, for containers made from plant fiber, if the fiber production has earned one of several specified sustainability certifications. Because of the concern about chemical contamination from recovered materials, the Sustainable Sourcing metric only rewards recycled content in metals (aluminum and steel), glass, and PET bottles.
Waste is no longer a luxury we can afford on an ever-crowded, natural resource-constrained planet. We must retool our food system to reduce reliance on disposable and hard-to-recycle products and encourage packaging solutions with circularity in mind: Packaging that can be reused or truly recycled or composted to provide sustainable feedstock for future products or degrade safely into the natural environment. The UP Scorecard provides a recoverability ranking to demonstrate the circularity potential of each foodware product.
Indicator: scale from 1 (worst) – 5 (best)
The Recoverability metric is a qualitative rating that represents the potential for the material to be recovered for commercial use (i.e. reused, recycled, or composted) or converted into a beneficial material by nature. It considers compostability, packaging design for recyclability, and material persistence. All materials are ranked in one of five performance tiers: reusable, recoverable in both commerce and nature, recoverable in commerce only, recoverable in nature only, or not recoverable. The tiers were developed by the UP Scorecard project team and informed by interviews with additional experts. | chemistry |
https://evsmetal.com/2018/11/ferrous-vs-non-ferrous-metals.html | 2024-04-15T21:48:57 | s3://commoncrawl/crawl-data/CC-MAIN-2024-18/segments/1712296817033.56/warc/CC-MAIN-20240415205332-20240415235332-00065.warc.gz | 0.938912 | 786 | CC-MAIN-2024-18 | webtext-fineweb__CC-MAIN-2024-18__0__10323297 | en | Article Revised August 23rd, 2022
If you remember your high school chemistry class, you may recall that the symbol for iron on the periodic table is Fe. This is an abbreviation of the Latin word for iron, Ferrum, and the word from which we ultimately get the term “ferrous.” When comparing ferrous and non-ferrous metals, the key difference is that ferrous metals contain iron. As a precision metal fabricator, EVS manufactures products using both ferrous and non-ferrous metals like stainless steel and aluminum.
Ferrous vs. Non-Ferrous Metals: A Brief History
The use of non-ferrous metals has a much longer recorded history than ferrous metals. Take copper, for example, which has been used since the dawn of civilization. Its widespread use began around 3500 B.C. and lasted between 500-800 years, depending on the geographic location, known as the Chalcolithic (from the Greek word for copper) period. The Copper Age marked the end of the Stone Age and served as the buffer between the longer and much more commonly written about Bronze Age (an alloy of copper and tin), which began around 3000 B.C and ended in 1200 B.C. with the advent of the Iron Age.
Types and Characteristics of Ferrous Metals
There are a number of different types of ferrous metals, such as wrought iron, carbon steel (also sometimes referred to as “structural steel”), cast iron, alloy steel, and stainless steel. Ferrous metals are popular for their incredible strength and durability, which makes them excellent for applications like skyscrapers, cars, railroad tracks, and shipping containers. Ferrous metals are generally but not always magnetic.
The drawback of most ferrous metals is that they are generally not appropriate for wet or very humid conditions, as they are vulnerable to rust and corrosion. There are two excellent exceptions to this, however. Wrought iron is so pure that it is able to resist rust without the addition of extra elements, while the use of chromium in stainless steel — one of the most common metals from which EVS fabricates — makes it extremely rust resistant as well.
Types and Characteristics of Non-Ferrous Metals
As the name states, non-ferrous metals do not contain iron (Ferrum), and are generally more corrosion resistant than ferrous metals. They are also non-magnetic. Examples of common non-ferrous metals include lead, brass, copper, zinc, tin, gold, silver, and aluminum/aluminum alloys.
Non-ferrous metals tend to be softer, making them easier to mold, bend, and cut. While they can still rust or corrode, it’s much less common, and the process takes longer with these types of metals. They are excellent for outdoor use, such as outdoor traffic signs and roof gutters, and for applications where the look of the finished product is especially important, i.e., fine jewelry and musical instruments.
So which type of metal is better, ferrous or non-ferrous?
Ferrous metals and non-ferrous metals are both extremely important for metal fabricators. Their use depends not just on supply and overall availability but the intended use of the end product. Although ferrous metals like stainless steel tend to be less expensive than non-ferrous metals, the additional cost of a non-ferrous metal like aluminum is often more than justified, especially when corrosion resistance is a top priority. The verdict? Both ferrous and non-ferrous metals have their place in precision sheet metal fabrication.
Want to learn more about EVS’s ferrous and non-ferrous metal fabrication capabilities? Get a fabrication quote online, or call us at 1-888-9EVSMET. | chemistry |
http://nanosens.phys-iasi.ro/node/1 | 2024-04-20T22:09:17 | s3://commoncrawl/crawl-data/CC-MAIN-2024-18/segments/1712296817688.24/warc/CC-MAIN-20240420214757-20240421004757-00859.warc.gz | 0.897769 | 1,107 | CC-MAIN-2024-18 | webtext-fineweb__CC-MAIN-2024-18__0__97174898 | en | Project duration: From 2013-06-01 to 2016-11-30 Total cost: EUR 2 713 017 EU contribution: EUR 2 422 076 NIRDTP is currently investigating materials for medical sensing applications, such as acoustic microsensors based on nano- and microwires and implantable magnetic microsensors based on nanostructured magnetic materials, e.g. nanocrystalline microwires. Furthermore, NIRDTP is actively involved in the development of methods for measurement, analysis and operation at the nanoscale to develop biosensors for the detection of biomolecules and for applications in nanomedicine.
- Research Topic A: Microsensors for Medical Applications
- NIRDTP’s research capacity building activities will focus on two sub-topics of microsensors for medical applications: acoustic microsensors based on nano- and microwires for medical applications (A1) and implantable magnetic microsensors based on nanostructured materials for medical applications (A2).
- A1 Acoustic microsensors based on nano- and microwires for medical applications
- This sub-topic is a complex, multidisciplinary subject situated at the interface between physics, materials science, electrochemistry, electronics and medicine, which aims to develop acoustic microsensors based on nano- and microwires for use in cochlear implants. The magnetostrictive nano- and microwires represent the active element of the microsensor, to be activated by acoustic signals. Certain frequencies of acoustic signal determine the resonance of the nano/microwires which, at its turns, determine the generation of a localized magnetic field which is subsequently transformed/transduced into an electrical signal by some magnetoresistive sensors. The electrical signal generated by the acoustic microsensors depends on the length, diameter, density per area unit and composition of the nano- or microwires. A single microsensor or an array of microsensors can be used to reproduce as much as possible the cilia from the inner ear.
- A2 Implantable magnetic microsensors based on nanostructured materials for medical applications
- NIRDTP is deeply involved in the development of innovative microsensor prototypes employing nanostructured magnetic microwires as sensitive elements for biology and medical applications. Their innovative character arises from both the solution offered – the materials and operating principles (giant magneto-impedance effect, smart antenna) – as well as from the envisaged medical applications of the microsensors, e.g. detection of extremely low biomagnetic signals with applications in magneto-cardiography, and the detection and remote monitoring of mechanical stress and temperature from implants and organs.
- Research Topic B: Biosensors based on Nanoparticles and Barcode Nanowires
- NIRDTP’s research capacity building activities will focus on two sub-topics of biosensors: sensors based on nanosized detection elements (nanoparticles) for applications in nanomedicine (B1) and biosensors based on multilayered nanowires (barcode nanowires) for the detection of biomolecules (B2).
- B1 Sensors based on nanosized detection elements for applications in nanomedicine
Nanoparticles, having special particularities, present unique magnetic properties, which could be exploited for (bio)detection. The surface chemistry represents an important parameter for the control of the nanoparticles physical and chemical properties. Together with decreasing nanoparticle size, surface effects become very important thanks to the increase of the volume ratio of the surface atoms related to the entire particle. Understanding the magnetic behaviour versus surface chemical interactions is important for the development of biomedical techniques which use magnetic nanoparticles. The surface effects also have an impact onto developing the magnetic nanoparticles modified with a bio-ligand for biomedical applications. On the other hand, such small magnetic particles represents a big challenge for the sensing capacity because the magnetic moments of the particles are very low considering their limited volume, relatively large surface and significant thermal activation of their magnetic moments (the consequence is the superparamagnetic behaviour).
- B2 Biosensors based on multilayered nanowires for the detection of biomolecules
In the last years, many efforts were made to implement or to enhance the biodetection methods based on metallic nanowires. A number of nanowires, e.g. Au, Ag or Pt non-magnetic nanowires are currently tested for target biomolecules detection, mainly DNA and antibodies. The principle of working is based on optical detection. Recently, the investigations shown that it is possible to detect simultaneously by optical methods more target biomolecules at once using multilayered nanowires. Each layer composing the multilayered nanowires will act differently, acting as a specific code and being “read” by a specific technique, identical with the “bar-code” systems used for commercial products identification. If a number of sequences used in the multilayered nanowires will be magnetic, then they can be detected easily in the presence of a magnetic field and used for separation. We will also develop the magnetophoresis method and use it for biomolecules detection. | chemistry |
https://www.hotelsdirectbuy.com/importance-of-sulfate-and-paraben-free-hotel-amenities/ | 2023-09-22T09:31:55 | s3://commoncrawl/crawl-data/CC-MAIN-2023-40/segments/1695233506339.10/warc/CC-MAIN-20230922070214-20230922100214-00241.warc.gz | 0.95324 | 709 | CC-MAIN-2023-40 | webtext-fineweb__CC-MAIN-2023-40__0__296078724 | en | Importance of Sulfate- and Paraben-free Hotel Amenities
If you are a hotel owner, you can do anything to boost the reputation of your hotel and the best way to do it is to give the best to your clients. If the amenities you provide to your guests are the most helpful and pleasant for them, they will be certainly pleased and spread a word about your hotel. One such amenity you provide in your hotel is toiletry, cosmetics and beauty products, and it is very important that they should be natural, and free from sulfates and paraben, so that your guests will have a soothing, natural and delightful experience with them.
What are Sulfates and Parabens?
Sulfates are a popular ingredient of several cleaning and cosmetic products, including conditioners and shampoos. A shampoo typically contains 15% of sulfate. SLS (sodium lauryl sulfate) and SLES (sodium laureth sulfate) are the most commonly used sulfates.
Parabens are chemicals that are water soluble and serve as broad-spectrum anti-fungals and antimicrobials in a formulation’s water-continuous phase. They are the most used preservatives in cosmetic products. They are normally used as a combination of many or all of these parabens: ethyl-, methyl-, butyl- and/or propyl-paraben. Their job is to improve the efficiency of the preservatives in the product.
Parabens are roughly considered as cancerous, having been found in breast tumor samples; however, no direct connection of cancer to paraben has been found.
Typically, a product consists of as little as 0.15 to 0.3 percent of paraben.
Harmful Effects of Sulfates and Parabens
Sulfates like SLS and SLES are actually corrosive detergents and became popular because they produce heavy, thick lather. However, this very lather is harmful for your skin, hair and mouth because it strips away the valuable moisture and protective layers. It also makes cuticles of hair rough, making them look dry, dull and damaged. They are even connected to follicular damage and can possibly cause hair loss.
Sulfates are also used in toothpastes and they cause similar effects in mouth too stripping away the outer protective layer of skin cells and thereby irritating tissues. Sulfate-containing toothpastes are known to cause canker sores and other types of lesions.
Soaps and skin cleansing products that contain sulfates strip away the protective lipids too that encase the skin. They also disturb the moisture balance of skin and dry it out. Moreover they can also produce toxic by-products.
Parabens have been found to interfere with the endocrine system, glandular activity and hormone production. Ironically, while many beauty products, such as moisturizers and lotions, contain parabens, research shows that they actually speed up skin’s aging process. Methyl parabens have been found to make the skin sensitive and prone to sun damage.
So, if you want to give the best to your guests, offer them sulfate- and paraben-free products like the Luxury Natural Hotel Amenities from DA Aromatherapy Collection. DA Aromatherapy Collection provides natural hotel amenities with organic essential oils made in Hudson Valley, New York. | chemistry |
https://etxsprayfoaminsulation.com/brazos-county-tx-spray-foam-insulation.html | 2024-02-22T13:07:06 | s3://commoncrawl/crawl-data/CC-MAIN-2024-10/segments/1707947473819.62/warc/CC-MAIN-20240222125841-20240222155841-00040.warc.gz | 0.945167 | 959 | CC-MAIN-2024-10 | webtext-fineweb__CC-MAIN-2024-10__0__184225371 | en | Spray Foam Insulation Brazos County, TX
Spray foam insulation in Brazos County, TX is becoming a popular choice among both residential home owners as well as commercial industrialists because it has several advantages over traditional types of insulation. At East Texas Spray Foam Insulation, we specialize in spray foam insulation in Brazos County, TX utilizing only the best products and methods in the department of spray foam insulation.
What is Spray Foam Insulation?
Spray foam insulation is a newer, modern type of insulation that is being used in residential as well as commercial applications for the past 30 years. It is essentially a mixture of two compounds, polyol resin and isocyante, which reacts to form spray foam insulation. After it is sprayed, spray foam expands up to 30 to 60 times its total liquid volume. Spray foam is a type of insulation that is sprayed in place with the help of a gun. The two components come together at the tip of the gun.
It is great for using in areas where other types of insulation cannot reach. It has a high R-value and takes the shape of the space that it is sprayed into. Spray foam insulation has a wide application of uses.
We serve the following cities in Brazos County, Texas:
Spray Foam Insulation Off-Gassing and Dust
Spray foam insulation in Brazos County, TX takes between 24 and 72 hours to fully cure. During the installation process, spray foam gives off two toxic and poisonous matters; VOC’s and chemical dust. In order for the off-gassing to cease, the two components, that is polyol resin and isocyante must be mixed properly and under the right conditions. If the components are not properly mixed, and until the chemicals and not cured properly, the compounds in the spray foam will continue to off-gas. During the installation of spray foam insulation, the house or the building should be completely vacant.
The spray foam insulation contractors and their team too need to use specialized work-wear like full face and body coverings, with proper respiratory gear. Their outfit needs to be chemical resistant and they need to take full precautions when working with spray foam insulation in Brazos County, TX. If the basic guidelines are not followed properly, there can be very serious adverse effects. Curing takes time to complete and while curing is taking place; the area needs to be very well ventilated. Once the curing is complete, the spray foam will be non-reactive and inert, thus making it completely safe.
Have questions about your specific project?
Call us today to speak with our insulation contractors directly. We'll answer any questions you may have and get you a free, no-obligation estimate.
How Thick Does Spray Foam Insulation Need to be?
The thickness of spray foam insulation in Brazos County, TX is determined by many factors. Insulation is rated by its R-value, which means the ability of a material to resist the flow of heat. Cellulose, mineral wool and fiberglass have apparent R-values; however, the R-value of spray foam insulation depends on whether you are using open-cell spray foam or closed-cell spray foam insulation.
The R-value of open-cell foam insulation is about R-3.5 per inch; however, the R-value can differ based on the product itself. Open-cell spray foam is generally used in places that are hard to reach and in the interiors of pre-existing walls. The R-value of closed-cell spray foam insulation ranged from R-5 and can go as high as R-7. According to industry standards, insulation thickness should be according to:
How to Remove Spray Foam Insulation
Because spray foam insulation is so sticky, it will stick to a lot of other thinks in the vicinity like furniture, your clothing and walls. Some of the equipment that is required for removing spray foam is:
Sometimes this may damage the finish of the substrate and you will have to redo the finish. A rag moistened with acetone can be used to remove spray foam from the skin and clothing too. Always remember that water should never be used to remove spray foam insulation because it has a counter-effect and hardens the insulation instead of softening it.
Advantages of Spray Foam Insulation
Spray foam insulation in Brazos County, TX has several advantages over other types of insulation such as:
If you are looking for a spray foam insulation contractor in Brazos County, TX, feel free to contact us today. We will be happy to assist you with finding the perfect insulation solution for your home or commercial building. | chemistry |
http://www.zerohedge.com/category/tags/naked-capitalism | 2016-12-06T16:12:02 | s3://commoncrawl/crawl-data/CC-MAIN-2016-50/segments/1480698541910.39/warc/CC-MAIN-20161202170901-00029-ip-10-31-129-80.ec2.internal.warc.gz | 0.96994 | 146 | CC-MAIN-2016-50 | webtext-fineweb__CC-MAIN-2016-50__0__157276632 | en | "The combined levels of bullish optimism, lack of concern about a possible market correction (don't worry the Fed has the markets back), and rising levels of leverage in markets provide the 'ingredients' for a more severe market correction. However, it is important to understand that these ingredients by themselves are inert. It is because they are inert that they are quickly dismissed under the guise that 'this time is different.' Like a thermite reaction, when these relatively inert ingredients are ignited by a catalyst, they will burn extremely hot. Unfortunately, there is no way to know exactly what that catalyst will be or when it will occur. The problem for individuals is that they are trapped by the combustion an unable to extract themselves in time." | chemistry |
https://tingrilijust.firebaseapp.com/483.html | 2022-11-28T08:55:29 | s3://commoncrawl/crawl-data/CC-MAIN-2022-49/segments/1669446710488.2/warc/CC-MAIN-20221128070816-20221128100816-00604.warc.gz | 0.921096 | 3,484 | CC-MAIN-2022-49 | webtext-fineweb__CC-MAIN-2022-49__0__156152295 | en | Diagnosing phosphorus deficiency in wheat agriculture. Crops usually display no obvious symptoms of phosphorus deficiency other than a general stunting of the plant during early growth. It has a key position in the combustion processes of the cell, and in the total energy transfer of the plant. Nutrient deficiency symptoms of woody ornamental plants in. Expanding on nutrient management outline for greenhouse.
Under p deficiency, leaves are narrow, short, very erect, and develop if the variety has a tendency to produce anthocyanin. If you start to notice the symptoms of nitrogen deficiency with your marijuana plants, always act fast and you should recover within a week. Oxygen deficiency of root systems occurs frequently in nature kennedy et al. Leaves are often dark green and in the early stages abundant with foliage. Sodium deficiency does not appear to exhibit any symptoms since it is not an essential element. Pdf the diagnosis and correction of sulfur deficiency and the. Plant nutrient deficiency symptoms environmental science. The influence of phosphorus deficiency on growth and nitrogen. Under severe k deficiency, leaf tips are yellowish brown. Much of the information on this website describes diseases but this section is devoted to problems associated with either excess levels of nutrients in the soil which leads to toxicity, or a lack of nutrient within the soil which leads to deficiencies within plants.
Stems, petioles and lower leaf surfaces may turn purple. During phosphate pi deficiency, most plants including arabidopsis thaliana enhance the. Understand how to use a key for identifying deficiency symptoms. Symptoms of deficiencies and toxicities greentrees. Newly emerging leaves will not show the coloration. Reactive oxygen species in plant development the company of. May 16, 2014 phosphorus is a major plant nutrient, and is the p of npk and the roots of shootsrootsfruits. When p deficiency is severe, plants may not flower at all. Symptoms of phosphorus deficiency in wheat are usually nonspecific and difficult to diagnose in the field. Diagnosing nutrient deficiencies and toxicities diagnose nutrient deficiencies.
Phosphorus nutrient management mosaic crop nutrition. You still may have some time as phosphorus moves from the bottom of the plant to the top. During phosphate pi deficiency, most plants including arabidopsis thaliana enhance the development of lateral roots and root hairs, resulting. Phosphorus deficient potato plants are stunted, with dark green leaves. Its best to try and fix this soon, before it becomes a major problem. The biggest concentrations of phosphorus are also found in the selfdeveloping. Other effects of p deficiency include delayed maturity often by one week or more. Phosphorus plays a vital role in the plant for the transformation of energy within the plant body and it is very effective in early root growth and development chaudhary and singh 2018. Phosphorus is a vital nutrient required by cannabis plants that fulfills many important biological functions.
How do you control and treat phosphorus deficiency in tomatoes. There are numerous different signs of deficiency symptoms to look out for when it comes to this nutrient. Soil organisms use any nitrogen to break down carbon sources, making n unavailable to plants. Role of sodium and chloride in plant culture promix.
Diagnosing phosphorus deficiency in wheat agriculture and food. Symptoms of phosphorus deficiency plants with phosphorus deficiency are most likely to exhibit the following traits. When p deficiency is very severe, grain formation may not occur, and it will have. Nutrient deficiency symptoms of woody ornamental plants in south florida 3 will be greatly reduced in such plants and a reduction in leaf size will also be observed. Identification of nitrogen, phosphorus, and potassium. Plants that have small root systems and significant above ground growth require plentiful amounts of phosphorus fertilizer. Bromley, mercer county horticulturist 10 of all of the symptoms and signs of trouble in plants, possibly the most overlooked are nutrient deficiencies. Mycorrhizas can increase the amount of phosphorus uptaken by plants. Boron deficiency affects vegetative and reproductive growth of plants, resulting in inhibition of cell expansion, death of meristem, and reduced fertility. It is necessary that any gardener see to it that the phosphorus level on the soil remains sufficient otherwise.
Copper can influences growth, disease control and production in. Ideally, for healthy and productive soil you should aim for a phosphorus concentration of 20. All of the processes in the photosynthetic machinery influenced by p deficiency appear to be fully reversible and can be restored in less than 1 h after resupply of p to the leaf tissue. Sources, functions and deficiency symptoms of essential. Chloride deficiency can occur if there is consistently less than 2 ppm chloride in the growing medium and the symptoms appear as chlorotic blotches with necrotic spots located between the veins or on the margins of the younger leaves. Some strains of cannabis need more nitrogen than others, just the same and some are sensitive to nitrogen and need less. Before rock phosphate, ground bones mixed with dilute sulfuric acid provided plants with phosphorus. Pdf phosphorus p deficiency is a common nutritional factor limiting agricultural production around the globe. Ppi aps amimi ppi deficiency symptoms because p is needed in large quantities during the early stages of cell division, the initial overall symptom is slow, weak, and stunted growth. Aug 11, 2017 phosphorus deficiency in cannabis plants. The metabolic response of plants to oxygen deficiency. All plants require sufficient supplies of macronutrients for healthy growth, and nitrogen n is a nutrient that is commonly in limited supply.
In the field, roots can be subject to oxygen deficiency soon after strong rainfall, since the soil usually becomes flooded for a short or longer period depending. The most noticeable feature of phosphorus deficiency in wheat is reduced growth and vigour. Chlorosis will eventually spread throughout the plant. Plants grown for their seeds and fruits benefit from phosphorus, and the nutrient helps establish healthy root systems in young plants. Phosphorus is highly mobile in plant and essential for respiration and cell division. Phosphorous p fertilization is the major mineral nutrient yield determinant among legume crops. Caveats many nutrient deficiencies may look similar. Plant nutrient functions and deficiency and toxicity symptoms.
Phosphorus is a mineral needed by your body for strong bones and teeth and other body processes. Nutrient deficiencies and application injuries in field crops john sawyer department of agronomy. Nutrient deficiency symptoms that occur in irregular patterns in a field are probably due to a soil condition. It readily mobilizes and translocates in the plant.
Expanding on nutrient management for greenhouse crops neil mattson ph dneil mattson, ph. Diagnosis of nutritional disorders tnau agritech portal. Symptoms of deficiencies and toxicities by element. Guide to symptoms of plant nutrient deficiencies arizona.
Phosphorus deficiency guide phosphorus plays an important role for all living organisms and is an essential nutrient element for plants and animals. Balamohan department of fruit crops, horticultural college and research institute tamil nadu agricultural university, coimbatore 641 003 nutritional disorders are basically physiological disorders in the plants that affect productivity as well as the quality of fruits. Nov 26, 2014 under p deficiency, leaves are narrow, short, very erect, and develop if the variety has a tendency to produce anthocyanin. A wide variety of problems can effect plant growth and health. Plants are most likely to suffer from phosphorus deficiency when they are grown in compacted, poorly aerated soil that is low in organic matter. Phosphorus deficient plants are smaller and grow more slowly than do plants with adequate.
Objectives after reading this module, the reader should be able to. Plants are dark green with reddishpurplish leaf tips and margins on older leaves. Some soils are depleted of phosphorus and give rise to phosphorusdeficient produce. The influence of phosphorus deficiency on growth and. This reduces water quality and desirable fish and aquatic plants. P is relatively mobile in plants and can be transferred to sites of new growth. In severe cases the whole plant may take on a purple hue. Glutathione is the most important redox buffer in plants and. Key to nutrient deficiencies in corn and sorghum cropwatch.
This could be an issue with phosphorous deficiency going on within your marijuana plants. Phosphorus deficiency symptoms, diagnosis and treatment. Because n is a part of the chlorophyll molecule, a major deficiency symptom is chlorosis. Symptoms of deficiencies and toxicities greentrees hydroponics. Phosphorus deficiency is the most important nutritional disorder of crop plants, especially in the highly weathered acidic soils of the tropics that contain large quantities of al and fe oxides fageria and baligar, 1996. In intact plants, the amount of watersoluble boron fluctuates with the amount of boron supplied, while insoluble boron does not. Although sorghum plants use n more efficiently than most c 3type crops and are more tolerant to drought and high temperature stresses compared to corn young and long, 2000, n deficiency suppressed plant growth and dm accumulation and allocation. Many micronutrients are used by plants to process other nutrients or work together with other nutrients, so a deficiency of one may look like another for instance, molybdenum is required by legumes to complete the nitrogen fixation process. Phosphorus is a structural component of the plasma membrane of the cell. Assistant professor, horticulture cornell university outline brief overview of essential nutrients calcium iron forms of nitrogen organic fertilizers element symbol ppm percent relative number of atoms nitrogen n 15,000 1. The highest shoot formation occurred in plants grown in solution and with. Use the following key to help identify seven nutrient disorders observed in nebraska corn and sorghum. Plants contain boron both in a watersoluble and insoluble form. Detecting phosphorus deficiency can take multiple forms.
Slow growth and stunted plants lower protein, fewer leaves, and early maturity in corn yellowing begins at leaf tip and extends along midribs. Mild to moderate p deficiency is difficult to recognize in the field. If you suspect a nitrogen deficiency in the soil but are unsure how to correct it, you may be wondering why do plants need nitrogen anyway. Iron fe iron deficiency is common on trees and shrubs growing on alkaline or poorly drained soils. Nitrogen deficiency in plants can occur when organic matter with high carbon content, such as sawdust, is added to soil. The omission of nutrients both in simple and multiple forms affected plant development. Phosphorus p deficiency is usually visible on young corn plants. Identify and diagnose common plant nutrient deficiency and. The symptoms of phosphorus deficiency vary widely between species but most plants will show the following symptoms. The availability of phosphate is essential for young plants since approximately threequarters of the total amount of phosphorus absorbed by the plant occurs before it is a quarter of the way through its life cycle. Phosphorus deficiency an overview sciencedirect topics. Florida and north carolina produce the most rock phosphate in america.
By the time a visual deficiency is recognized, it may be too late to correct in annual. Induced phosphorus deficiency in seedlings can occur in very dry conditions, but is often transitory and plants recover when the topsoil rewets. Journal of plant nutrition phosphorus deficiency in. If plants fail to thrive, despite adequate soil preparation, watering and mulching, it may be a sign of a nutrient deficiency. Plants will exhibit lack of vigor as older leaves become yellow chlorotic from lack of chlorophyll. Identify and diagnose common plant nutrient deficiency and toxicity symptoms 2. Specifically, p deficiency is believed to affect co 2 assimilation by reducing the atpdependent regeneration of ribulose1,5. Zinc deficiency occurs when plant growth is limited because the plant cannot take up sufficient quantities of this essential micronutrient from its growing medium. Maize plants with severe zinc deficiency in the foreground, with healthier plants planted at the same time in the background. Identifying problems hallowrooted annual and perennial plants frequently have iron and zinc deficiencies caused by excessive phosphorus. Phosphorus is a fairly mobile element in plants so deficiency symptoms are more often seen on older leaves because the phosphorus from old leaves is more easily redirected to new leaves as theyre produced. Learn about the functions and sources of this major mineral, as well as what happens to your body. In some plants the leaf pigment change as a result of this process can turn leaves a dark purplish color. Plant nutrition is a difficult subject to understand completely, partially because of the variation between different plants and even between different species or individuals of a given clone.
Under k deficiency, darkgreen plants with yellowishbrown leaf margins or darkbrown necrotic spots first appear on the tips of older leaves. What are the symptoms of phosphorus deficiency in plants. Phosphorus deficiency in winter and early spring can be temporary, due to the decreased ability of plants to absorb phosphates in cold soil conditions. A preliminary detection method is a visual inspection of plants. Tomato roots growing in cold soil, either in the greenhouse or the field, take up phosphorus poorly.
It is the most widespread micronutrient deficiency around the world and causes large losses in crop production and crop quality. Also, acid loving plants grown in neutral to alkaline soils display symptoms of deficiencies. Spot nitrogen deficiency with marijuana and recover in a week. Phosphorus deficiency is most often manifested as purpling of the leaves, particularly the leaf veins. Phosphorus p is an essential macronutrient, and p deficiency limits plant productivity. Nutrient deficiencies and their symptoms in selected crops.
Reddyb a department of plant and soil sciences, mississippi state university, box 9555, mississippi state, ms 39762, usa. The aim here was to compare p uptake and translocation, biological nitrogen fixing ability and photosynthetic rate among mashbean vigna aconitifolia cv. Natural resources fact sheet plant nutrientsphosphorus. Greenyellow plants with dark yellow interveinal chlorosis advancing to rustbrown necrosis. Deficiency symptoms in plants types and its symptoms. Plant growth and physiological responses to nitrogen deficiency. Phosphorus deficiency alters nutrient accumulation patterns. Nutrient deficiencies and application injuries in field crops. Once the soil temperature warms, then tomato plants are able to absorb phosphorus and the problem fixes itself. Warm the soil with cloches and mulches, and also lime the soil which makes phosphorus more soluble and available to plants.
Elements present at low levels may cause deficiency symptoms, and toxicity is possible at levels that are too high. Boron deficiency is a common deficiency of the micronutrient boron in plants. S deficiency appears as yello wing of both upper and lower leaves. Phosphorus supports the transfer of energy in plants, which is a different role from other plant nutrients, such as nitrogen. It is important to know what a plant species looks like when it is healthy in order to recognize symptoms of distress, for example some plants were bred to have variegated patterns in the leaves when they are healthy.
The absence of any element necessary for the nourishment of that particular plant will lead to the morphological changes. Of course, if the deficient element is provided to the plant in good time, the symptoms of deficiency disappear. Fix the phosphorus deficiency in your marijuana plants. It is more likely to appear on young plants, especially on soils that are cold, wet, or too dry. We embody the universitys landgrant mission with a commitment to eliminate hunger, preserve our natural resources, improve quality of life, and empower the next generation through worldclass education. Darker green leaves and purplish or red pigment can indicate a deficiency in phosphorus. Phosphorus deficiency is more difficult to diagnose than a deficiency of nitrogen or potassium. The interrelationship between a nutrients availability and soil ph, air and soil temperature, available moisture, excesses. P influences many aspects of photosynthesis pdeficient plants typically remain green and do not develop leaf chlorosis and yet p starvation immediately affects co 2 assimilation. Zn, cu, and calcium ca concentrations were significantly higher in pdeficient plants, while grain magnesium mg.
Occasionally bronzecolored spots appear on the leaves. Eating a lot of foods lacking in nutrition junk foods can lead to phosphorus deficiency, as can inadequate phosphorus intake through food supplement intake. Many of the symptoms of nutrient deficiency are most easily detected without special equipment and without damaging or digging up a plant on the leaves of affected plants. Darker green leaves and purplish or red pigment can indicate a. Expanding on nutrient management outline for greenhouse crops. Understand how to use a key for identifying deficiency symptoms 4.665 1143 1249 99 714 570 822 89 1117 379 1011 944 563 1202 704 672 1304 1234 1033 756 312 1221 855 1304 1581 346 1566 833 966 389 1476 1270 873 1458 1458 1265 | chemistry |
http://lyprinol.com/index.php/about-lyprinol/what-is-lyprinol | 2020-04-10T05:21:30 | s3://commoncrawl/crawl-data/CC-MAIN-2020-16/segments/1585371886991.92/warc/CC-MAIN-20200410043735-20200410074235-00156.warc.gz | 0.939615 | 969 | CC-MAIN-2020-16 | webtext-fineweb__CC-MAIN-2020-16__0__47558107 | en | A stabilised natural marine lipid extract comprising a rare combination of lipid groups and unique Omega-3 polyunsaturated fatty acids known as PCSO-524™. Lyprinol® has been shown through clinical research to be an extremely potent anti-inflammatory.
Independent studies have shown Lyprinol® to be:
- 100 times more potent than EPA Max
- 125 times more potent than the original freeze dried mussel powder
- 175 times more potent than evening primrose oil
The unique grouping of fatty acids in Lyprinol has evolved as the most potent group of Omega-3 lipids in blocking the 5 - lipoxygenase metabolic pathway responsible for inflammation in the body.
Inflammopharmacology, Vol. 0, No. 0, pp. 1-17 (1999):Over the counter (OTC) oral remedies for arthritis and rheumatism: how effective are they? M.W. Whitehouse.
This unique marine product has been exposed to critical review by many research institutions world wide and is proven to have significant anti-inflammatory activity in vitro in inhibiting leukotriene synthesis and in vivo by markedly reducing the severity of adjuvant-induced poly arthritis in rat models. Various publications have been released confirming these results all of which are available on request. Leukotrienes are formed in the body via the lipoxygenase pathway and are responsible for initiating and extending the inflammatory process. The work carried out in The Queen Elizabeth Hospital and the University of Adelaide in Australia and the Charite University in Berlin, Germany has clearly demonstrated that the stabilised marine lipid Lyprinol® is a powerful modulator of the 5-lipoxygenase pathway, thus its ability to markedly reduce the damaging effects of persistent inflammation that one may find in various allergic reactions including arthritis and other inflammatory disorders including inflammation of the respiratory airways. Since many of the currently used anti-inflammatory drugs, in particular the non-steroid anti-inflammatory drugs (NSAID), function via the cyclo-oxygenase pathway, much recent international research and effort has gone into the development of modulators of the second major pathway, the lipoxygenase pathway.
There is little doubt that Lyprinol® can provide a potent means of controlling and inhibiting the damage caused by the excesses of the body's inflammatory responses. In vivo studies undertaken at The University of Queensland in Australia tested the anti-arthritic properties of Lyprinol®. Using the standard model for evaluating the potency of anti-arthritic drugs, Lyprinol® was measured against its ability to reduce the swelling which occurs in adjuvant induced poly arthritis in rats. Published in the Journal "Inflammopharmacology". The results were dramatic, with Lyprinol® reducing joint swelling by 93% compared with untreated controls. Following these outstanding findings The University of Queensland scientists set out to compare Lyprinol® with two widely used anti-arthritic drugs, namely Indomethacin & Ibuprofen. When given orally at the same dose rate (5mg/kg body wt./day) Lyprinol® outperformed the drugs Indomethacin & Ibuprofen by a factor of 2:1. This was a staggeringly successful outcome for Lyprinol®. More recently a double blind clinical trial conducted at the Hong Kong Poly Tech University has shown that the patients taking Lyprinol had greater improvement in the perception of pain as measured by the VAS, and patients’ global assessment of arthritis in those who took Lyprinol® when compared with controls from week 4 following adjustment for the change in the amount of paracetamol used between study visits. Patients who took Lyprinol® but not placebo also had improved scores in the CAIMS2-SF physical function and psychological status domains from week 4*. The results from this paper have been published in the journal ‘PROGRESS IN NUTRITION VOL. 6, N. 1, 17-31, 2004’
Lyprinol has also been trialed for the use in mild to moderate asthmatics as an adjuvant treatment. In a study conducted at the Pavlov Medical University St Petersburg, Russia there was a significant decrease in daytime wheeze, the concentration of exhaled H2O2 and an increase in morning PEF in the lipid extract group compared to the placebo group. The results of this clinical trial were published in ‘The European Respiratory Journal 2002; 20: 596–600’.
Note: Much more research has been conducted on Lyprinol over the past 25 years, all of which is available on request. | chemistry |
https://drtemt.at/product/eye-care/ | 2023-12-05T22:56:01 | s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100568.68/warc/CC-MAIN-20231205204654-20231205234654-00010.warc.gz | 0.844842 | 204 | CC-MAIN-2023-50 | webtext-fineweb__CC-MAIN-2023-50__0__83782758 | en | - Improves skin elasticity and firmness
- Reduces fine lines and wrinkles
- Evens tone and reduces discoloration
- Protects against further damage
- Improves skin hydration
This luxurious eye cream dramatically reduces fine line and wrinkles, and is specially formulated for the delicate skin area around the eyes. The restructuring action of this formula encourages cell renewal and the skin regains its elasticity. Leaves the eye area intensively revitalized and smooth.
Because of its very rich texture this product can also be used as a mask treatment. Active Ingredients: REGU®-AGE, SYN®-COLL, SYN®-AKE, Hydrolyzed Sodium Hyaluronate (Hyaluronic Acid), Vitamin F.A.C.E.-Complex, Ubiquinone (Coenzym Q 10), Retinyl Palmitate (Vitamin A Palmitat), Cera Alba (Beeswax), Lanolin, Squalane | chemistry |
https://customsnl-insight.nl/article/299152343 | 2021-11-27T21:21:56 | s3://commoncrawl/crawl-data/CC-MAIN-2021-49/segments/1637964358233.7/warc/CC-MAIN-20211127193525-20211127223525-00575.warc.gz | 0.922918 | 170 | CC-MAIN-2021-49 | webtext-fineweb__CC-MAIN-2021-49__0__71552090 | en | Sniffer dog Sasja has a good nose for tobacco and precursors – the raw products for synthetic drugs. The dog and its handler form an important link in the chain in the fight against smuggling in the Rotterdam seaport region.
“Sasja is a smart and enthusiastic Dutch shepherd. She’s able to detect all sorts of smoking materials and the constituents of amphetamines and designer drugs in trailers and containers. People sometimes ask me whether animals that sniff these substances can get addicted to them, but that’s not true. I can’t tell you much about the nature and amount of the catches that Sasja and I have been involved in. What I can say is that I’m proud of our fantastic partnership and the results we get.” | chemistry |
https://www.istones.com.au/product-category/sealers/ | 2019-04-23T04:33:19 | s3://commoncrawl/crawl-data/CC-MAIN-2019-18/segments/1555578586680.51/warc/CC-MAIN-20190423035013-20190423061013-00265.warc.gz | 0.92935 | 272 | CC-MAIN-2019-18 | webtext-fineweb__CC-MAIN-2019-18__0__58427639 | en | STAIN-PROOF Original™ is an impregnating, invisible and breathable sealer that provides premium long term protection for natural stone, tiles, pavers, concrete, brick and grout from water and oil based stains and damage caused by water and dissolved salts. Treated indoor and outdoor surfaces become easier to clean and keep looking good for longer.
STAIN-PROOF Original™ is suitable for a wide variety of indoor and outdoor applications in residential and commercial buildings, including: building facades, floors, walls, countertops, showers, swimming pool surrounds, patios, garages, kitchens and entertaining areas.
STAIN-PROOF Plus™ is an impregnating, invisible and breathable sealer that protects natural stone countertops from damage caused by water, salts and oil-based stains. Treated countertop surfaces become easier to clean, maintain, and keep looking good for longer. STAIN-PROOF Plus™ provides lasting protection for natural stone that comes with a 25 year warranty*.
*A 15 YEAR And 25-YEAR PERFORMANCE WARRANTY is offered when product applied by an Accredited Applicator following our written instructions and surface is maintained regularly using our written maintenance system, as outlined in our warranty document. Spills should still be cleaned up immediately to minimise absorption. | chemistry |
https://wineandshop.com/the-science-behind-aging-wine-how-time-enhances-flavors-and-complexity/ | 2023-12-01T16:59:48 | s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100290.24/warc/CC-MAIN-20231201151933-20231201181933-00217.warc.gz | 0.928399 | 1,408 | CC-MAIN-2023-50 | webtext-fineweb__CC-MAIN-2023-50__0__165493302 | en | HomeNewsThe Science Behind Aging Wine: How Time Enhances Flavors and Complexity
May 9, 2023
The Science Behind Aging Wine: How Time Enhances Flavors and Complexity
Wine has long been revered for its ability to evolve and improve with age, unlocking new dimensions of flavor and complexity. The process of aging wine is a delicate art that combines chemistry, biology, and patience. Through the interplay of various factors, including time, oxygen, and chemical reactions, wines can undergo remarkable transformations, leading to a heightened sensory experience. In this article, we will delve into the science behind aging wine, exploring the intricate mechanisms that contribute to the development of rich flavors, aromas, and textures. Join us on a journey through the vineyards and cellars as we unravel the mysteries of time and its effects on wine.
I. The Aging Process
A. The Foundation of Aging: Wine aging is a process that occurs after the production and bottling of wine. It involves allowing the wine to mature under specific conditions, such as temperature, humidity, and light exposure. During this time, chemical reactions take place within the wine, leading to the development of complex flavors and textures.
B. The Role of Oxygen: Oxygen plays a crucial role in the aging process. Controlled exposure to oxygen allows the wine to undergo oxidation, which softens harsh tannins, enhances aromatic compounds, and promotes the development of desirable characteristics. However, excessive oxygen exposure can lead to oxidation and spoilage, highlighting the importance of proper storage conditions.
II. Chemical Reactions in Wine Aging
A. Phenolic Compounds: Phenolic compounds, such as tannins and anthocyanins, are responsible for the color, structure, and mouthfeel of wine. Over time, these compounds undergo polymerization, resulting in the formation of larger and more complex molecules. This process contributes to the wine’s overall smoothness and aging potential.
B. Esters and Aldehydes: Esters and aldehydes are volatile compounds responsible for the fruity and floral aromas in wine. During aging, these compounds undergo chemical reactions, leading to the formation of new and more complex aromas. These transformations add layers of complexity and nuance to the wine’s bouquet.
C. Acid Hydrolysis: Acid hydrolysis is a chemical reaction that occurs between wine acids and water molecules. Over time, this reaction can reduce the wine’s acidity, resulting in a smoother and more balanced taste. The gradual breakdown of acidic compounds contributes to the overall harmony and integration of flavors.
D. Reduction and Sulfur Compounds: In some cases, the aging process can lead to reduction, a chemical reaction that occurs when wine lacks oxygen exposure. Reduction can result in the formation of sulfur compounds, which may contribute to off-flavors and aromas, often described as “reductive” or “stinky.” However, controlled levels of reduction can add complexity and depth to certain wine styles.
III. Factors Affecting Wine Aging
A. Grape Varieties: Different grape varieties possess varying levels of tannins, acidity, and sugar content, all of which influence their aging potential. Some grapes, such as Cabernet Sauvignon and Nebbiolo, are known for their ability to age gracefully, developing intricate flavors and textures over time.
B. Oak Aging: The use of oak barrels during the aging process can significantly impact the flavor profile of wine. Oak imparts flavors such as vanilla, spice, and toastiness through the extraction of compounds from the wood. Additionally, the micro-oxygenation that occurs when wine interacts with the oak barrel allows for controlled oxidation, enhancing the wine’s complexity.
C. Storage Conditions: Proper storage conditions are crucial for successful wine aging. Temperature, humidity, and light exposure can all affect the chemical reactions taking place within the wine. Ideally, wines should be stored in a cool, dark environment with stable humidity levels to prevent premature aging or spoilage.
D. Bottle Aging vs. Barrel Aging: While barrel aging is commonly associated with the aging process, wines can also age in the bottle. Barrel aging primarily contributes to the wine’s early development, while bottle aging allows for further evolution and integration of flavors over an extended period. Some wines are released only after undergoing significant bottle aging to ensure optimal enjoyment.
E. Aging Potential: Not all wines are suitable for aging. Factors such as grape variety, winemaking techniques, and vintage variation play a crucial role in determining a wine’s aging potential. Wines with higher levels of tannins, acidity, and sugar have a greater capacity to age and evolve positively over time.
IV. The Pleasure of Aged Wine
A. Flavor Development: As wine ages, its flavors become more complex and nuanced. Primary fruit flavors may give way to secondary and tertiary flavors, including earthy notes, dried fruits, leather, and tobacco. These evolving flavors provide a unique and captivating experience for wine enthusiasts.
B. Textural Changes: Aging can also lead to changes in the wine’s texture and mouthfeel. Tannins, which can initially be firm and astringent in young wines, gradually soften and integrate, resulting in a smoother and more velvety sensation on the palate. This evolution enhances the overall drinking experience.
C. Aromatics and Bouquet: The aging process enriches the wine’s aromatic profile, creating a more complex bouquet. The initial fruity and floral aromas may evolve into a symphony of layered scents, including spice, tobacco, and hints of oak. These enticing aromas contribute to the sensory pleasure of aged wine.
V. Enjoying Aged Wine
A. Cellar Selection: Building a cellar and selecting wines for aging requires careful consideration. Collecting wines with good aging potential from reputable producers and storing them under optimal conditions will yield the best results. Consulting with knowledgeable sommeliers or wine experts can provide valuable guidance.
B. Decanting and Serving: Aged wines often benefit from decanting, which allows them to breathe and open up, revealing their full potential. Additionally, serving aged wines at the appropriate temperature and using suitable glassware can enhance the overall tasting experience.
The science behind aging wine is a fascinating exploration of chemical reactions, oxygen exposure, and gradual transformations that result in the development of intricate flavors and textures. Understanding the factors influencing wine aging, such as grape varieties, oak aging, and storage conditions, allows wine enthusiasts to appreciate the true artistry and craftsmanship behind aged wines. So, next time you uncork a bottle of aged wine, savor the experience as you indulge in the culmination of time, patience, and the science that elevates wine to a whole new level. | chemistry |
https://yvm2020.authorea.com/inst/20904?page=3&sortby=Most+Recent&tag_filter=Soil+Sciences | 2024-04-13T12:35:15 | s3://commoncrawl/crawl-data/CC-MAIN-2024-18/segments/1712296816734.69/warc/CC-MAIN-20240413114018-20240413144018-00219.warc.gz | 0.92204 | 387 | CC-MAIN-2024-18 | webtext-fineweb__CC-MAIN-2024-18__0__191970151 | en | Eurasian permafrost soils contain large amounts of organic carbon (OC) and mercury (Hg), sequestered by vegetation during past and present interglacial periods. Lake sediment archives may help understand past OC and Hg dynamics and how they interact with climate-related variables. We investigated Hg accumulation, OC dynamics, and Hg and OC stable isotopes in a 14,000 year sediment record from lake Malaya Chabyda (Central Yakutia, Russia). Sediment Hg was correlated to OC (p value <0.01), with lower OC and Hg accumulation rates (OCAR, HgAR) during the cold Younger Dryas (YD, 12,900–11,700 cal BP), when the lake level was low. Elevated sediment Δ200Hg (0.05 ± 0.11‰), representing dominant HgII deposition, and low δ13C, indicates low lake primary productivity during the YD. During the early Holocene, Δ200Hg and Δ199Hg decreased, while δ13C, δ202Hg, OCAR, and HgAR increased, suggesting enhanced algal primary productivity, in deeper, more turbid waters. From 4,100 cal BP to present, Hg/OC ratios and HgAR increased at constant OCAR, indicating an additional Hg source to the lake. Analysis of Hg isotopes suggests enhanced direct Hg0 uptake into lake waters, driven by primary production and efficient Hg burial. Our observations suggest that the gradual climate warming since the Last Glacial Termination and into the late Holocene led to enhanced OC and Hg burial in northern lakes and watersheds. Early Holocene enhanced Hg burial, but not OC, is possibly related to a renewed increase in lake primary productivity. Continued global warming may lead to further Hg sequestration in northern aquatic ecosystems. | chemistry |
https://www.salixtesneni.cz/en/e-shop/oil-seals | 2022-08-13T02:57:24 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571869.23/warc/CC-MAIN-20220813021048-20220813051048-00184.warc.gz | 0.913388 | 493 | CC-MAIN-2022-33 | webtext-fineweb__CC-MAIN-2022-33__0__14368541 | en | Oil sealsJump to products
Oil seal in standard design referring to DIN 3760 with an elastomer outer sheath covering a metal insert as well as a spring-energised sealing lip.
Fields of application
Are touch seals designed to seal rotating machine parts. The degree of sealing ability depends on the operating conditions of the sealing component and the sealing life requirements.
Wiper seals maintain sealing contact to the piston rod when the equipment is stationary (static, no reciprocating motion of rod) and in use (dynamic, reciprocating rod), whereas the tolerance for the rod diameter d is determined by the rod seal. Without a wiper seal, the retracting piston rod could transport contaminants into the cylinder. The outside static sealing of the wiper seal within the housing is also important to avoid moisture or particles from entering around the outside of the wiper seal.
NBR - Good chemical resistance to mineral oils and greases, hydraulic oils H, HL, HLP, non-inflammable hydraulic pressure fluids HFA, HFB, HFC to approx. +50°C and water to max. +80°C
HNBR – HNBR is obtained by fully or partially hydrogenating NBR. It leads to considerable improvement in resistance to heat, ozone and ageing, and gives it very good mechanical properties, e.g. good resistance to wear. The media resistance compares to that of NBR. HNBR has a good resistance to some refrigerants. The temperature application range is from -30°C to +150°C.
MVQ – Good resistance to water (up to 100 °C), aliphatic engine and transmission oils, animal and plant oils and fats. VMQ is generally not resistant to fuels, aromatic mineral oils, steam (short term up to 120 °C possible), silicone oils and greases, acids and alkaline compounds.
FKM Viton – Good chemical resistance to mineral oils and greases, synthetic oils and greases, engine, transmission and ATF oils to approx. +150°C, fuels, non-flammable hydraulic pressure fluids HFD, aliphatic, aromatic and chlorinated hydrocarbons, water to max. +80°C, excellent resistance to weathering, ozone and ageing, very low gas permeability (and therefore excellent for vacuum application) and resistance to a wide range of chemicals. | chemistry |
https://arkgene.com/2017/10/19/primer-specificity-epcr/ | 2021-07-25T21:08:39 | s3://commoncrawl/crawl-data/CC-MAIN-2021-31/segments/1627046151866.98/warc/CC-MAIN-20210725205752-20210725235752-00079.warc.gz | 0.896098 | 544 | CC-MAIN-2021-31 | webtext-fineweb__CC-MAIN-2021-31__0__153182760 | en | October 19, 2017 | Use Case
Ensure your primer specificity with ePCR
Polymerase Chain Reaction (PCR), developed by Kary Mullis in 1983, is a molecular biology technique used to amplify and generate thousands to millions of copies of a particular DNA sequence in vitro. It has many research and practical applications, such as gene cloning, medical diagnostics and forensic analysis.
The key determinant of PCR success is the PCR primer, a short DNA sequence (usually 18-22 base pairs) which recognises the complementary site and binds to gene of interest in template DNA, initiates the DNA synthesis by DNA polymerase using the basic building block dNTPs. A primer may binds to a few different locations in DNA or cDNA template with complementary sequences. When the nucleotide sequence located at the 3′-end of the primer has a few mismatches (1-3) with the DNA/cDNA template at non-targeted sites, PCR extension may occurs and resulting in non-specific PCR amplification. Hence, primer design has becoming the most crucial step in DNA amplification.
Electronic PCR (ePCR), also known as in silico PCR, has been developed as a computational tool to calculate theoretical PCR amplification results using given sequence information on PCR primer and target DNA (e.g. specific gene in the genome or transcriptome). The outputs of ePCR help to predict the specificity of designed primer by providing a list of possible PCR products with their PCR product sizes, locations etc. It has been widely used to check the PCR specificity after the primer design, before the PCR sequences are sent to the service provider for oligonucleotide synthesis.
Arkgene integrated ePCR tool into its Microbes workbench, allowing users to check the primer specificity against their bacteria genomes or transcriptomes via an interactive graphical interface. This application requires an STS file containing the name of primer, forward and reverse sequences, PCR product size and name of the tool/algorithms, for example: “primer1 TTCACATGAGCCAGTCCACT AATGGAACGGTGACAAAGGG 50-3000 ePCR“. The users have to select the input (targeted sequences) file and output filename, as well as parameters such as number of gaps or INDEL (insertion or deletion of bases) allowed. The analysis results will be computed in a text file.
Troubleshooting the root cause of PCR failure is a common problem for molecular biologist. With Arkgene, you can seamlessly check your primer specificity on the bacteria genomes uploaded in cloud, to ensure a successful PCR in your experiment. | chemistry |
https://superqigong.com.my/2007/10/28/the-mystical-berries/ | 2023-12-05T15:40:10 | s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100551.2/warc/CC-MAIN-20231205140836-20231205170836-00199.warc.gz | 0.950933 | 2,392 | CC-MAIN-2023-50 | webtext-fineweb__CC-MAIN-2023-50__0__88881240 | en | FREE RADICALS & ANTIOXIDANTS
Ten years ago I imported the first urine test that measures excess free radicals in the urine, and I went around giving talks trying to educate the doctors and the public on the role of free radicals and antioxidants in ageing and the evolution of many diseases. However many doctors were skeptical and at one private hospital I was ridiculed for believing that free radicals are responsible for so much of the damage in the body.
Now the scenario is different as that fact is well established and even the lay person knows about free radicals and antioxidants, thanks to the interest in health and the many articles available in various media and the internet.
Free radicals are unstable molecules that require electrons to re-stabilize. They steal the electrons from other molecules, making the latter unstable, causing a chain-reaction. If this happens to the molecules which make up the wall, DNA or other components of the cell, then these structures become damaged. Accumulated free radical damage will lead to abnormal functioning, accelerated ageing, cancer or cell death.
Antioxidants are molecules which readily provide electrons to free radicals, thus sparing precious cell components from damage. Although the antioxidants themselves become free radicals, these are weak or relatively harmless free radicals. The chain is broken when water- soluble antioxidants which have become free radicals are excreted by the body. Thus it is good that vitamin C, which is the most common antioxidant supplement consumed, is excreted through the urine ( about 50% of ingested vitamin C is removed every 3 hours ). That way the body can neutralize a lot of free radicals, provided fresh antioxidants are made available all the time.
THE ORAC SCORE
The measurement of an antioxidant’s power to neutralize free radical damage at the cellular level is known as the Oxygen Radical Absorbance Capacity or ORAC score or value.
A sample of antioxidant in the form of food, drink, fruit, nutritional supplement, vitamin, or chemical substance (for example, orange juice, carrot, or vitamin C) is put in a test tube to see how well and how long it takes to destroy or neutralize a known quantity of free radicals.
The nutrient tested is then given an ORAC SCORE that reflects the power and speed with which it does its job as an antioxidant.
The Human Nutrition Research Center on Aging at Tufts University USA has established that 5000 ORAC units per day can prevent certain age-related diseases.
ORAC scores are given in units per liter, so when you are comparing the scores between different foods or nutrients, it must be between the same volume ( or for simplicity, even weight or amount ) of the substances being compared.
Below are the ORAC scores of some berries, and grapes, spinach and carrot for comparison.
|– Ningxia wolfberry
– Red grapes
THE CAROTENOID SCORE
One method of measuring antioxidants directly in the body is by using the Biophotoscan to measure the body’s carotenoid score. This measures the amount of carotenoids present, but not the other antioxidants. Carotenoids are the yellow-orange-red antioxidant pigments that are present in carrots, papaya, tomato, watermelon and many other fruits and veggies.
If you take a well-balanced diet consisting of a wide variety of fruits and veggies ( or a broad-spectrum supplement ), the carotenoid score can be used to estimate the adequacy of other antioxidants as well.
Although most antioxidants can be measured accurately through blood tests, this is not practical, and not even necessary.
OXIDATIVE STRESS & OXYSCORE
The most important score to know is one that tells you how much excess free radicals you have. Although taking high ORAC antioxidants is good insurance, and having a high carotenoid score is comforting, you are really healthy only if the antioxidants are sufficient to combat the free radicals lurking in you. Your free radical load may even be much higher than your high antioxidant score!
Everyday each cell is bombarded by over 10,000 free radicals. Our toxic environment adds so much more to that produced by our cell metabolism. Our immune cells produce free radicals and use them to fight bacteria. The free radical load in the body is so high that it is impossible for anyone not to have an excess of free radicals even after taking plenty of antioxidants. What separates the healthy from the unhealthy is how much excess free radicals.
The amount of excess free radicals can be accurately measured using the urine free radical test. The urine free radical score ( or Oxyscore ) is a reliable estimation of the excess free radicals that have damaged your cell walls.
SPECIFICITY OF ANTIOXIDANTS
While the ORAC score gives the free-radical scavenging power of the antioxidant nutrient when tested in the lab, it only indicates the potential when the nutrient is available at the proper site in the body. Different free radicals are neutralized by different antioxidants – and therefore the widest range of antioxidants must be present to protect the cells maximally.
Different antioxidants also have varying activity outside and inside the cell, and in different cell types. For example, different berries are beneficial for different cells/organs. So always get your antioxidants from a variety of fruits and veggies, or supplements containing a variety of them.
THE MYSTICAL BERRIES
Now let us discover the super foods with superb antioxidants – the mystical berries. Berries are the superstars of antioxidant-rich fruits. They contain special antioxidants called anthocyanins. They are also rich in vitamins, minerals and phytochemicals like ellagic acid, quercetin and catechins. Many studies have shown that berries have powerful anti-inflammatory, anti-aging, anti-diabetic and anti-cancer properties. Acai berry, wolfberry and blueberry consistently top the list of antioxidant-rich foods studied. For a long time it was thought that blueberries had the highest antioxidant content among them, as only the berries common in Western countries were studied. Acai berries of the Amazon were found to be twice stronger. Now it is known that Chinese Ningxia wolfberries are ten times stronger! When these berries are studied in greater detail, more magical benefits will unfold.
Berries are a large family of mostly edible fruits. We are most familiar with blackberries, blueberries, bilberries, cranberries, elderberries, gooseberries, raspberries, strawberries and wolfberries, but there are many more ( alaska wildberries, aronia or chokeberries, lingonberries, boysenberries, to name a few ). Did you know that botanically, grapes and blackcurrants are also berries? No wonder they all look similar (except for the colour), and are equally nutritious. Grape seed and grape skin contain powerful antioxidants like anthocyanins and resveratrol.
The different berries not only vary in their colours and tastes, but also in the type of anthocyanins, and therefore in their health benefits. All berries have deep or dark colours, and it is well known that the phytochemicals which give these colours are potent health-enhancing nutrients as well. Berries have very high ORAC scores (see table above), and are qi-enhancing, especially when taken fresh.
Many scientific studies have now validated what was expected from their known nutrient contents. A study by the founding president of the American Society of Holistic Medicine on a concoction of seven different berries ( including Acai and wolfberry ) blended with grapes, pomegranate and green tea showed that consuming it for 2-3 weeks reduced free radicals in the body by 43%.
From known scientific data about free radicals, if that reduction is maintained long term, it is estimated that life span may be increased by 20 years!
In another study, the anti-cancer effects are so strong that rats injected with carcinogens and then fed a berry-rich diet had 80 per cent fewer cancers compared to those without berries in their diet (study done in Ohio State University, USA).
Acai (pronounced ah-sigh-ee) berry is perhaps the crown jewel of the berries. I have mentioned it in a previous article (see www.superqigong.com/articles). It is consumed to improve circulation, increase energy and vitality, improve eyesight, and provide natural resistance to colds, flu, and disease. It is so vitalizing that it is called the “Fruit of Life”. Amazon legends accord it magical powers to enhance sexual desire.
It has ten times the antioxidant power of red grapes, thirty times that of red wine, and its seeds are also packed with antioxidants. It is rich in essential fatty acids, and has plenty of phytosterols which help to bring down bad cholesterol. It is also an excellent source of vitamins and fibre. Studies have shown it to be beneficial for the circulatory and digestive systems.
It is listed by the famous dermatologist Dr Nicholas Perricone as the top anti-aging superfood, and was even featured on the Oprah Winfrey Show.
Bilberries have been proven to be protective and reparative to the eyes, and are now standard recommendation for improving eyesight, and also preventing age-related eye diseases. Bilberries, blueberries and wolfberries can act synergistically to protect the eyes and many other organs, including the cardiovascular system.
Blueberries have been used to improve mental functions. In fact, in animal studies, blueberry extracts have been shown to be able to make nerve cells grow and significantly improve learning, memory and coordination.
Cranberries have long been known to be especially beneficial for preventing and treating urinary infection. Nutrients from cranberries prevent bacteria from sticking to the wall of the urinary tract. Cranberry juice and even extracts ( in tablets or capsules ) have been prescribed by doctors and naturopaths alike for this purpose, especially for women, who are at least 10 times more prone to urinary infections compared to men, simply because of our different anatomies. During pregnancy, that risk increases another ten-fold.
Elderberries and all the other berries improve the immune and cardiovascular systems through their antioxidant power.
Raspberries and strawberries were shown to be effective against many types of cancer, in studies done on rats and mice in The Medical University of South Carolina. Raspberries have also been shown to improve vision, memory and motor skills. These studies also showed that taking the individual phytochemicals (as supplements) was not as effective as taking the fruits themselves. Therefore, for supplementation, go for whole food extracts that retain all the nutrients.
Wolfberries were among the secrets behind the longevity of the Himalayan people, as well as the north-western Chinese. And the best wolfberries are those from Ningxia autonomous region of China. I discovered this through my Qigong sifu ( who is from Ningxia, China ) who shared with me (about 15 years ago) how wolfberries were used by his people to stay young and also fight tumours. I didn’t pay much attention then. Later, my interest in antioxidants and cancer led me to information which confirmed that Ningxia wolfberries have very potent anti-aging and anti-cancer nutrients. They help the function of many organs. They have an ORAC score of 25,000 which is over 10 times that of blueberries. Ningxia wolfberry is my “secret weapon” for health, aesthetics, anti-aging and preventing cancers.
Several types of “berries”
( References available on request ) | chemistry |
https://www.giamed.ca/shop/mini-hand-sanitizer-gel-60-ml/ | 2021-07-25T16:33:53 | s3://commoncrawl/crawl-data/CC-MAIN-2021-31/segments/1627046151699.95/warc/CC-MAIN-20210725143345-20210725173345-00138.warc.gz | 0.669126 | 152 | CC-MAIN-2021-31 | webtext-fineweb__CC-MAIN-2021-31__0__105147506 | en | Ethyl Alcohol ………… 70 %
Lavandula angustifolia (Lavender) Essential Oil, Eucalyptus Radiata Leaf/Stem Essential Oil, Polysorbate 20, Carbomer, Water
Cautions and Warnings
- Flammability warning. Keep away from open flame and sources of heat.
- For external use only.
- Supervise children when they use this product.
- Keep out of reach of children. If swallowed, call a poison control centre or get medical help right away.
- Stop use and ask/ consult a health care practitioner if irritation develops.
- When using this product avoid contact with eyes. If contact occurs, rinse thoroughly with water. | chemistry |
https://fantasyliterature.com/reviews/superheavy-making-and-breaking-the-periodic-table/ | 2024-02-21T19:25:34 | s3://commoncrawl/crawl-data/CC-MAIN-2024-10/segments/1707947473524.88/warc/CC-MAIN-20240221170215-20240221200215-00669.warc.gz | 0.971937 | 643 | CC-MAIN-2024-10 | webtext-fineweb__CC-MAIN-2024-10__0__194823516 | en | Superheavy: Making and Breaking the Periodic Table by Kit Chapman
In Superheavy: Making and Breaking the Periodic Table (2019), Kit Chapman goes on a scientific, chronological, and geographical tour of the mysterious upper reaches of the Periodic Table, taking his readers back in time to the beginning of nuclear physics/chemistry as well as from the United States to Russia to Germany and Japan and introducing his audience to the scientists who discovered (or not — there were more than few disputes) the “trans-uranium” elements beyond uranium’s atomic number 92. It’s both an engaging and informative read.
After covering the early discoveries necessary for further exploration of superheavy elements (fission, fusion, the makeup of the atom, etc.), Chapman moves into the increasingly difficult job of discovering, or creating, the upper elements. Most of the early heavy lifting was done by the lab in Berkeley, which had formed the perfect mix of high level equipment and high quality scientists and engineers, led by Nobel winner Glen Seaborg, who was involved in discovering ten new elements and was the first living scientist (and one of only two) honored by having an element name after him.
Those early elements were relatively easy to find — samples were large (in chemical terms), they stuck around for minutes, and detectors didn’t have to be all that sensitive. But as the explorers moved farther upward, all that changed. New technology had to be devised, samples were microscopic (to the nano degree) and they stuck around for seconds and then far, far less than a second. After Berkeley’s early success, other teams began to get into the game and even take the lead, particularly the Russians led for many years by Yuri Oganessian, the second person to have an element named after them. Teams in Sweden, Germany, and Japan also leapt into the race, and Chapman does a great job through interviews and research of conveying the competition, sometimes heated, sometimes petty, often tied to geopolitics (the Cold War) between the teams as he covers the push forward, innovations, embarrassments over mistaken claims, disputes over who was first (and the accompanying naming rights), and even outright fraud (once).
The interviews in particular are engaging, as are the many personal stories, such as the time one pair of scientists, raising the half-life clock on a sample, zoomed past a gate guard threatening to shoot if they didn’t stop. There are also several surprisingly moving moments, as Chapman never loses track of the personal in pursuit of the science. He also does an excellent job of highlighting the contributions of female scientists, such as Lise Meitner or Darleane Hoffman, who have too often been overlooked — passed over for a deserved Nobel Prize or, thanks to sexism, missing out on being credited for several element discoveries.
Superheavy is always informative, often entertaining, sometimes moving, and, as scientists edge nearer to discovering elements that due to their incredibly short existence serve no “useful” purpose, filled with the kind of wonder for wonder’s sake that is the best of science. | chemistry |
https://wftinc.com/laminated-sheet | 2024-03-01T21:47:04 | s3://commoncrawl/crawl-data/CC-MAIN-2024-10/segments/1707947475701.61/warc/CC-MAIN-20240301193300-20240301223300-00010.warc.gz | 0.885762 | 125 | CC-MAIN-2024-10 | webtext-fineweb__CC-MAIN-2024-10__0__208894687 | en | Laminated Sheet Products - WaveFront Technology Inc.
Laminated Sheet: Banner Content
Laminated Sheet: Rigid Lamination
When the substrate thickness requirement for a given product reaches a thickness that cannot be made roll to roll, we offer lamination to rigid sheet. Microstructures are replicated to thin PET film substrates on our R2R machines. This film is then bonded to acrylic, polycarbonate, or other substrates. The bonding agent is a UV cured polymer and has no outgassing. Rigid product can be laser cut into various shapes and sizes all in-house. | chemistry |
https://www.aplanteveryday.com/plant/how-do-i-make-my-soil-more-acidic-for-blueberries/ | 2023-09-26T22:56:50 | s3://commoncrawl/crawl-data/CC-MAIN-2023-40/segments/1695233510225.44/warc/CC-MAIN-20230926211344-20230927001344-00576.warc.gz | 0.889169 | 2,413 | CC-MAIN-2023-40 | webtext-fineweb__CC-MAIN-2023-40__0__171867164 | en | To make your soil more acidic for blueberries, you can take several steps to lower the soil’s pH level. Blueberries prefer acidic soil with a pH range of 4.5 to 5.5. Here are some methods to achieve the desired acidity:
- Soil Testing: Start by testing your soil’s current pH level to determine how much adjustment is needed. Soil testing kits are available at garden centers or through agricultural extension offices. This will give you a baseline for making the necessary changes.
- Add Sphagnum Peat Moss: Sphagnum peat moss is an excellent amendment for increasing soil acidity. Mix it into the top 6 to 12 inches (15 to 30 cm) of the soil. Peat moss not only lowers the pH but also improves soil structure and moisture retention.
- Use Elemental Sulfur: Elemental sulfur is a natural and effective way to lower soil pH gradually. It converts to sulfuric acid through microbial action in the soil. Follow the application rates recommended based on your soil test results, as excessive use can harm plants.
- Ammonium-Based Fertilizers: Fertilizers that contain ammonium sulfate or ammonium nitrate can help acidify the soil as the nitrogen in these compounds can contribute to lower pH levels. However, be cautious with over-fertilization, as it can lead to nutrient imbalances.
- Pine Needle Mulch: Mulching with pine needles can help maintain soil acidity over time. As the needles break down, they release organic acids that aid in soil acidification.
- Acidifying Agents: There are commercial acidifying agents available specifically for adjusting soil pH for acid-loving plants like blueberries. These products usually contain sulfur or other acidic components.
- Rainwater Irrigation: If you collect rainwater, it tends to be naturally slightly acidic, and using it for irrigation can help maintain soil acidity.
Remember that altering soil pH is not an immediate process. It may take several weeks or even months for the changes to take effect, especially in larger or more clay-heavy soil volumes. Monitor the soil pH periodically and adjust as needed to create the optimal growing conditions for your blueberries.
What is a good soil acidifier for blueberries?
A good soil acidifier for blueberries is elemental sulfur. Elemental sulfur is a natural and effective way to lower the pH of the soil, making it more acidic, which is ideal for blueberry plants that prefer a pH range of 4.5 to 5.5. When added to the soil, elemental sulfur undergoes a chemical reaction with soil bacteria to produce sulfuric acid, which lowers the pH over time.
Here are some key points to keep in mind when using elemental sulfur as a soil acidifier for blueberries:
- Use Finely Ground Elemental Sulfur: The finer the sulfur particles, the faster it will react with the soil and lower the pH. Look for finely ground elemental sulfur for more immediate results.
- Follow Soil Test Recommendations: Before applying any soil acidifier, it’s crucial to conduct a soil test to determine the current pH and the amount of sulfur needed for your specific soil conditions. Soil testing kits are available at garden centers or through agricultural extension offices.
- Application Rate: The application rate of elemental sulfur will depend on the soil’s current pH and the desired pH for blueberries. The soil test results will guide you on how much sulfur to add. Typically, applications of 1 to 2 pounds of sulfur per 100 square feet are common, but this can vary.
- Time and Patience: Lowering soil pH with elemental sulfur is not an instant process. It may take several weeks or even months for the full effect to be seen. Be patient and monitor the soil pH periodically.
- Incorporate Sulfur into the Soil: Mix the elemental sulfur thoroughly into the top 6 to 12 inches (15 to 30 cm) of the soil to ensure even distribution.
- Watering: After applying sulfur, water the soil well to help it dissolve and start the pH-lowering process.
Always follow the instructions on the product label and the soil test recommendations for the best results. Additionally, remember that soil pH is an ongoing aspect of gardening, and regular soil testing and maintenance may be necessary to ensure your blueberry plants continue to thrive in the acidic conditions they prefer.
How do you naturally acidify soil for blueberries?
You can naturally acidify the soil for blueberries using organic methods and materials. These methods may take some time to show results, but they are environmentally friendly and can create a suitable acidic environment for blueberry plants. Here are some natural ways to acidify soil for blueberries:
- Sphagnum Peat Moss: Mix sphagnum peat moss into the top 6 to 12 inches (15 to 30 cm) of the soil. Peat moss is acidic and will help lower the pH over time. It also improves soil structure and moisture retention.
- Pine Needle Mulch: Mulch around your blueberry plants with pine needles. As the pine needles decompose, they release organic acids into the soil, gradually making it more acidic.
- Coffee Grounds: Coffee grounds are slightly acidic and can be added to the soil around blueberry plants. You can save coffee grounds from your daily coffee brewing and spread them as a mulch.
- Oak Leaves: If you have oak trees nearby, collect fallen oak leaves and use them as mulch around your blueberries. Oak leaves naturally contain tannic acid, which can help acidify the soil.
- Compost: Use compost made from acidic materials like fruit and vegetable scraps, pine needles, and oak leaves. The decomposition of these materials will contribute to lowering the soil pH.
- Rainwater Irrigation: Use rainwater for watering your blueberries whenever possible. Rainwater tends to be naturally slightly acidic due to the presence of dissolved carbon dioxide.
- Acidic Fertilizers: Choose organic fertilizers that are slightly acidic, such as those with ammonium sulfate or cottonseed meal. These can contribute to lowering the soil pH over time.
Remember that natural methods of soil acidification may take some time to show significant results, especially in larger soil volumes or highly alkaline soils. Regular monitoring of the soil pH and continued use of these natural amendments will help maintain the desired acidic environment for your blueberry plants. Additionally, consider conducting a soil test to determine the current pH and to assess the effectiveness of the natural acidification methods you use. How to prepare blueberry soil? >>
What is the best soil mix for blueberries?
The best soil mix for blueberries should be acidic, well-draining, and nutrient-rich. Blueberries thrive in a specific soil pH range of 4.5 to 5.5, so it’s essential to create an environment that meets their specific requirements. Here’s a recommended soil mix for blueberries:
- Sphagnum Peat Moss: Sphagnum peat moss is the foundation of a good blueberry soil mix. It is highly acidic and helps lower the soil pH. It also improves soil structure and moisture retention. Aim to use about 50% to 70% peat moss in the mix.
- Perlite or Vermiculite: Add perlite or vermiculite to the mix to improve drainage. Blueberries prefer moist, well-draining soil, and these materials will prevent waterlogged conditions that can be harmful to the plants. Use about 20% to 30% perlite or vermiculite in the mix.
- Compost or Well-Rotted Pine Bark: Incorporate compost or well-rotted pine bark to provide essential nutrients to the plants. These organic materials contribute to the overall health of the blueberries. Aim for about 10% to 20% compost or pine bark in the mix.
- Sand (Optional): If your peat moss is coarse, you can add a small amount of sand (about 5%) to help improve the soil structure and drainage further.
Here’s a basic recipe for a blueberry soil mix:
- 60% Sphagnum peat moss
- 30% Perlite or vermiculite
- 10% Compost or well-rotted pine bark
Mix the ingredients thoroughly to ensure even distribution and use this mix when planting or repotting blueberries. Adjust the quantities based on your soil test results and the specific needs of your blueberry plants.
When growing blueberries in containers, use this soil mix to fill the pots or raised beds. If you’re planting blueberries directly in the ground, incorporate this mix into the planting hole and the surrounding area to create the ideal soil conditions for the plants.
Regularly monitor the soil pH, and if needed, supplement with organic soil amendments or natural acidifiers to maintain the desired acidity for your blueberries’ optimal growth and fruit production.
What is the best fertilizer for blueberries?
The best fertilizer for blueberries is one that provides essential nutrients while also helping to maintain the acidic soil conditions they prefer. Blueberries have specific nutrient requirements, and using the right fertilizer will promote healthy growth, strong root development, and abundant fruit production. Here are some key considerations when choosing the best fertilizer for blueberries:
- Acidic Formulation: Blueberries thrive in acidic soil with a pH range of 4.5 to 5.5. Therefore, it’s crucial to select a fertilizer specifically formulated for acid-loving plants or those labeled for use with blueberries. These fertilizers will help maintain the soil pH within the ideal range.
- Low in Phosphorus: Blueberries have relatively low phosphorus requirements, so it’s best to choose a fertilizer with a low or balanced N-P-K (Nitrogen-Phosphorus-Potassium) ratio. A fertilizer with a higher nitrogen (N) content and lower phosphorus (P) and potassium (K) content is preferable. For example, a ratio like 10-5-5 or 12-4-8 is suitable.
- Slow-Release Fertilizer: Consider using slow-release or controlled-release fertilizers. These types of fertilizers release nutrients gradually over time, providing a steady supply of essential elements to the blueberry plants. This approach is especially beneficial for container-grown blueberries.
- Organic Fertilizers: Organic fertilizers can be an excellent choice for blueberries, as they contribute to soil health and microbial activity. Look for organic fertilizers that are specifically formulated for acid-loving plants or those containing ingredients like cottonseed meal, feather meal, or fish meal.
- Avoid Lime-based Fertilizers: Lime raises soil pH and makes it less acidic, which is detrimental to blueberries. Ensure that the chosen fertilizer does not contain lime or any other alkaline materials.
- Application Timing: Fertilize blueberries in early spring before new growth starts. Avoid fertilizing in late summer or fall, as it may interfere with the plant’s hardening process for winter.
Before applying any fertilizer, it’s essential to conduct a soil test to determine the nutrient levels and pH of the soil. This will help you choose the right fertilizer and apply it at the appropriate rates. Soil testing will also prevent over-fertilization, which can be harmful to the plants and the environment.
Overall, a fertilizer specifically formulated for acid-loving plants or blueberries, with a low phosphorus content and a balanced N-P-K ratio, is the best choice to support the healthy growth and fruiting of your blueberry plants. | chemistry |
https://bluesupplycompany.com/product/detectable-tri-clamp-gaskets/ | 2023-06-05T14:46:05 | s3://commoncrawl/crawl-data/CC-MAIN-2023-23/segments/1685224652116.60/warc/CC-MAIN-20230605121635-20230605151635-00265.warc.gz | 0.886572 | 223 | CC-MAIN-2023-23 | webtext-fineweb__CC-MAIN-2023-23__0__241183743 | en | Metal Detectable Tri-Clamp Gaskets are designed to create strong, functioning joints in Food Manufacturing settings. Made from a durable EPDM rubber that includes a ferromagnetic additive and certain atomic elements that allows it to be detectable by both Metal Detection and X-Ray Visibility foreign body contaminant prevention systems. It's made from high-performance materials that are food grade, blue, and FDA approved. Seal fragments that are 5MM in size are capable of being detected (detection ability depends on system settings of course).
Dual Detectable by Metal Detection and X-Ray Visibility
Colored Blue for visual detection
EPDM Material is resitant to hydraulic oils, steam, and acids
Has Excellent resistance to weathering
Temperature Range: -40°C to 140°C (-40°F to 284°F)
FDA and EU Approved
A special ferromagnetic additive is evenly dispersed within the material to make it detectable by properly functioning Metal Detection Systems
Specific atomic elements have been evenly distributed within the material to make it visible to X-Ray systems. | chemistry |
http://sibbuy.com/en/beauty-and-health/face-body-hair/creams-and-masks/saniatem-gel | 2022-10-07T01:59:08 | s3://commoncrawl/crawl-data/CC-MAIN-2022-40/segments/1664030337906.7/warc/CC-MAIN-20221007014029-20221007044029-00174.warc.gz | 0.863568 | 516 | CC-MAIN-2022-40 | webtext-fineweb__CC-MAIN-2022-40__0__141596706 | en | Indications for use:
Gel for external use in the form of a homogeneous soft mass of white or white with a tint from pink to light gray. It is intended for use as the main or additional means of prevention and control against:
• blackheads, acne, pyoderma;
• dermatosis, eczema;
• herpes rashes;
• wounds, cuts, scratches;
• insect bites;
• mycoses of skin, nails;
• telangiectasia, hemorrhoids;
• trophic ulcers, necrosis, bedsores.
Hypoallergenic. It has an analgesic effect: it reduces pain within a few minutes after application. *** Contraindications : individual intolerance to the components. If individual intolerance to the components is detected, immediately stop using it and choose another remedy with a similar spectrum of action. No age restrictions.
How to use: To achieve the desired result, SANITATEM gel is applied to the problem area after its preliminary cleansing. The procedure is repeated 1-5 times a day until the problem disappears completely. Composition : water solution of silver, CMC. Storage conditions : store in a dark place at room temperature. Shelf life 24 months. Color from transparent to light yellow. It is not a medicinal product.
The main active ingredient of SANITATEM gel is silver of the highest standard (without impurities) in the form of nanoparticles. This ensured the maximum effectiveness of the product in 4 directions at an absolutely safe concentration of the noble metal included in the composition.
• Restoration of blood supply to problem areas. Activates the process of formation of new blood vessels and capillary network (angiogenesis).
• Accelerated regeneration of damaged tissues. With simultaneous protection against the formation of voluminous scars and large-scale scars.
• Suppression of vital activity of pathogens. Interferes with development of pathogenic microorganisms on the processed site.
• Blocking of inflammatory processes. Stops the production of inflammatory mediators - prostaglandins, reduces pain.
Accelerates the survival of transplanted skin, healing of surgical incisions. Reduces the depth of wrinkles (anti-aging effect). Stimulates recovery processes, improves metabolism.
Caution : Exposure to direct sunlight on the silver-treated area may cause unwanted reactions. To prevent, cover the area with sunscreen applied. | chemistry |
https://harpsicleharps.com/harp-accessories/harp-cleaning-kit | 2019-09-20T03:59:57 | s3://commoncrawl/crawl-data/CC-MAIN-2019-39/segments/1568514573827.2/warc/CC-MAIN-20190920030357-20190920052357-00210.warc.gz | 0.947731 | 476 | CC-MAIN-2019-39 | webtext-fineweb__CC-MAIN-2019-39__0__38525129 | en | Harp Cleaning Kit
Harp Cleaning Kit
A clean harp is a happy harp! Our Harp Cleaning Kit includes a bottle of specialized cleaning spray and a micro fiber towel. Harpo "No More Marks" Cleaning Spray is the first cleaning product exclusively developed for and tested on harps. It gently cleans and removes oil and grime build-up and has a soothing lavender scent. Harpo Harp Cleaning Spray was developed by John Clarke, an industrial chemist with more than 45 years experience, for his wife, professional harpist, Carol Thompson.
Cleaning spray directions:
First try the product on a small, inconspicuous area on your harp or other wooden instrument. (If you have a Rees Concert Line Harp or a Rees Harpsicle® brand Harp, we have already tested the spray on our finishes so you can just go ahead to the next step.) Spray onto the cloth provided. Do not spray directly onto the harp. Rub scratches using a gentle, circular motion. Do not scrub hard. After cleaning, apply a good quality furniture polish. We recommend Pledge Lemon Enhancing Polish.*
Harpo Harp Cleaning Spray is biodegradable and non-toxic.
*Our recommendation of Pledge Enhancing Polish is not random. A number of years ago Fine Woodworking magazine conducted a review of various furniture polishes and carnauba wax polish. They determined that if you have the time, carnauba wax is always the best but it is very difficult to apply. The surprise is that after carnauba and well above everything else on the list was Pledge Enhancing Polish (which, at that time, was called “Lemon Pledge with Real Wax”). Amazingly, Pledge actually does what the advertising says it does. It picks up dirt and oil and leaves behind a thin layer of wax which, unlike carnauba, does not cloud.
For harpers, the advantage of Pledge is that trying to get carnauba wax in between all the hardware on the arch and then to get it buffed is virtually impossible but doing the same with Pledge is vastly easier. As always with any cleaner or polish, apply Pledge to a cleaning cloth and then use the cloth to apply a thin layer of polish to your harp. | chemistry |
https://www.ftmmachine.com/products/products_7_1.html | 2024-04-21T02:59:49 | s3://commoncrawl/crawl-data/CC-MAIN-2024-18/segments/1712296817699.6/warc/CC-MAIN-20240421005612-20240421035612-00753.warc.gz | 0.880879 | 597 | CC-MAIN-2024-18 | webtext-fineweb__CC-MAIN-2024-18__0__171027181 | en | It can process non-flammable and non-explosive mineral materials with Moh's hardness below 9.3 and humidity below 7%, and the fineness of the finished products can be adjusted from 80 mesh to 1250 mesh.
Materials:iron ore, copper ore, limestone, nickel, manganese, calcium carbonate, gypsum, phosphates etc.
Gold ore processing plant is mainly composed of jaw crusher, ball mill, spiral classifier, Spiral chute, shaking table,etc.
According to the physical or chemical characteristics of the material,we can choose magnetic, flotation or gravity separation.
The whole plant consists of jaw crusher, ball mill, spiral classifier, magnetic separator, high-efficiency concentrator, bucket mixer and drum dryer.
The flotation plant consists of jaw crusher, ball mill, spiral classifier, flotation cell, high-efficiency concentrator, bucket mixer and drum dryer and other major equipment.
The whole ore beneficiation line consists of jaw crusher, ball mill, spiral classifier, flotation cell, magnetic separator high-efficiency concentrator, bucket mixer, drum dryer, vibrating screen and vibrating feeder.
Stone crushing production line refers to a complete set of equipment used to produce stones with all kinds of particle sizes.
The whole plant consists of vibrating feeder, jaw crusher, sand maker, vibrating screen, sand washer belt conveyor, centralized control and other equipment.
Milling process refers to the process that mainly uses grinding equipment to grind stone or other materials into the powdered materials that are suitable for use.
The whole active lime production plant consists of jaw crusher, ball mill, drum dryer, bucket elevator, dust collector, cooler preheater, rotary kiln.
The producing process of it :Raw material→Crushing and Pre-homogenizing→Preparing→Homogenizing→Preheating and Decomposing→Calcining→Grinding→Packa
The producing process of ceramsite production line: Raw material→Crushing→Mixing→Grinding→Pelleting →Calcining→Coolong→ Screening→Finished products→Package.
Dry mix mortar plant is mainly used in constructional engineering, which can evenly mix cement, sand, stone, limestone and other raw materials.
The ready mixed mortar refers to all kinds of mortar mixture produced by professional manufacturers in construction engineering, which is one kind of new building materials developed in recent years.
Dry mortar is a kind of mixed powdery materials, which has different composition according to actual situation. Generally speaking, composition of dry mortar includes quartz sand, cement, limestone, additive, etc.
The 500,000T/Y dry mix mortar plant is a kind of large mortar production line, which is also called ready-mixed mortar production line. | chemistry |
https://www.zstitan.com/Is-the-ultrasonic-aroma-diffuser-easy-to-use-id47618187.html | 2022-08-08T16:41:09 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882570868.47/warc/CC-MAIN-20220808152744-20220808182744-00759.warc.gz | 0.899342 | 1,183 | CC-MAIN-2022-33 | webtext-fineweb__CC-MAIN-2022-33__0__2027343 | en | Views: 0 Author: Site Editor Publish Time: 2022-03-06 Origin: Site
Aromatherapy is a kind of fashion, a kind of culture, and a way of spiritual sustenance for people who pursue high-quality life.
Here is the content list:
What is an ultrasonic aroma diffuser?
What are the benefits of an ultrasonic aroma diffuser?
According to the diffusion method, what types of aroma diffusers can be divided into?
Ultrasonic aroma diffuser uses the high-frequency vibration generated by the ultrasonic vibration equipment to decompose water molecules and dissolved plant essential oils into the nano-scale cold mist with a diameter of 0.1-5 microns, which is dispersed in the surrounding air, making the air full of fragrance.
After heating in winter, the indoor air is dry, and people will have dry lips, dry throat, dry mouth, cough, dry skin, nose bleeding, and other "heat dryness" symptoms. Ultrasonic aroma diffusers use various methods to atomize water and pure plant essential oils. Keep the room high humidity, and produce a certain amount of natural negative oxygen ions, purify the air, and achieve the effect of aromatherapy, which can assist in the treatment and alleviation of diseases such as influenza, hypertension, and bronchitis. The system and the body's metabolism play a protective role.
1. Ultrasonic aroma diffuser decomposes water molecules into the nano-scale cold fog with a diameter of 0.1-5 microns through the high-frequency electronic vibration generated by the ultrasonic vibration equipment;
2. Ultrasonic aroma diffuser produces a large number of active oxygen negative ions, which strongly react with harmful gas molecules in the air, comprehensively remove them, and eliminate the hazards of formaldehyde, benzene, ammonia, TVOC, etc.
3. The effect of using ultrasonic aroma diffuser with lavender and tea tree essential oil is more significant-the cold mist generated by ultrasonic vibration can emit 100% and maintain the active ingredients of essential oils so that essential oils are more easily absorbed by the human body to achieve maximum effect; 2 seconds Inside, you can feel the original ecological aromatherapy effect. It is fundamentally different from traditional heating and combustion hot mist methods. Its cold mist technology does not damage any components of essential oils, does not produce secondary pollution, and is safer to use.
4. Ultrasonic aroma diffuser is small in size, with a water volume of about 100ml. You only need to add 1-2 drops of essential oil in the water to achieve aromatherapy, which is in line with the use of essential oils, a precious product, and is economical. The humidifier has a large volume capacity, mostly around 1L.
5. The material of ordinary humidifiers has insufficient corrosion resistance, and it is prone to quality problems when used for aromatherapy.
1. Direct heating and evaporation aroma diffuser. This is a relatively primitive method, using an open flame or electric heating to heat, so that the essential oil molecules undergo violent movement, achieving the effect of diffused in a small area. Advantages: Simple operation and low price; Disadvantages: The spread of fragrance is unstable. The high temperature of open flame or electric heating will destroy the molecular activity in essential oils, causing them to lose the physiotherapy effect of essential oils. In addition, open flames or electric heating will also have higher safety risks. Products: There are two main types, one is a candle-type aroma diffuser, and the other is a plug-in aromatherapy lamp
2. Naturally volatile aroma diffuser. . The most common natural volatile aromatherapy is rattan aromatherapy. One end of the rattan is inserted into the bottle to inhale essential oils, and the other end is naturally volatilized in the air. It is only suitable for use in small areas. Advantages: simple operation, relatively cheap cost, no safety hazards; disadvantages: can not adjust the fragrance concentration; rattans need to be replaced frequently, which will be accompanied by a certain amount of waste of essential oils. Products: rattan aromatherapy, diffuser, etc.
3. Ultrasonic aroma diffuser. The common aroma diffusers on the market that need to add water and look like humidifiers use this technology. Its principle is to use ultrasonic high-frequency oscillation to disperse the molecular structure of essential oils through a ceramic atomizing sheet to produce a natural and elegant micro mist, which is quickly absorbed by the air. It can meet the needs of various areas by controlling the size of the fog. Advantages: quiet, fine mist, no heating required, effective protection of the activity of natural molecules of essential oils, good diffusion effect, controllable volatilization speed; disadvantages: only suitable for water-soluble essential oils; will produce a certain humidification effect, not suitable for the environment Places requiring high dryness. Products: All kinds of ultrasonic aroma diffusers.
Ultrasonic aroma diffuser is very convenient and simple to use. With a small bottle of essential oil, it can produce unparalleled effects. You no longer need to spend hundreds of thousands of money on fitness and health care like before. You only need a small aromatherapy machine to maintain your health. Guangdong Titan Smart Electrical Appliance Co., Ltd. has developed a variety of ultrasonic aroma diffusers and conducted a lot of tests before leaving the factory to ensure quality. If you are in the black ultrasonic aroma diffuser business, you can consider using our cost-effective products.
Copyright © 2021 Guangdong Titan Smart Electrical Appliance Co., Ltd. | chemistry |
https://stylestories.ebay.com/diy-rose-scented-bath-bombs/ | 2021-02-25T10:58:52 | s3://commoncrawl/crawl-data/CC-MAIN-2021-10/segments/1614178350942.3/warc/CC-MAIN-20210225095141-20210225125141-00523.warc.gz | 0.893675 | 240 | CC-MAIN-2021-10 | webtext-fineweb__CC-MAIN-2021-10__0__20519326 | en | This Valentine’s Day, I decided to make homemade gifts for all of my girlfriends. I know they love to take baths as a way to decompress and relieve stress, so DIY bath bombs were the first idea that came to mind. My friends will be able to pamper themselves with a spa night at home whenever they like!
- 1 cup baking soda
- ½ cup citric acid
- ½ cup Epsom salts
- ¾ tbsp. water
- 12 drops of essential oil (my favorites are rose and lavender)
- 1 tbsp. olive, almond, or coconut oil
- Food coloring
- Bath bomb mold
1. Mix dry ingredients in a bowl with a whisk.
2. Mix liquid ingredients in a separate bowl.
3. Then, slowly stir mixed liquids into the dry ingredient bowl. Stir thoroughly with whisk.
4. Fill 2 half molds with the mixture. Be sure to pack the mixture in really well.
5. Press the half molds together firmly. Let sit for about minute inside the mold before removing. Let fully dry for 24 hours before use.
For more DIY gift ideas, click here. | chemistry |
http://lib.icimod.org/record/31097 | 2017-04-28T21:44:30 | s3://commoncrawl/crawl-data/CC-MAIN-2017-17/segments/1492917123097.48/warc/CC-MAIN-20170423031203-00574-ip-10-145-167-34.ec2.internal.warc.gz | 0.916352 | 317 | CC-MAIN-2017-17 | webtext-fineweb__CC-MAIN-2017-17__0__300413787 | en | Despite the use of cerium oxide nanoparticles (nCe) in some regions as a diesel fuel additive, the physicochemical properties of the resulting exhaust particles in the ambient atmosphere are not well known. The mixing state of ceria with other exhaust particles is one such physicochemical property that has been shown to potentially affect ecosystem/human health. In this study, cerium-containing particles associated with an nCe additive were collected in the laboratory and in Newcastle-upon-Tyne, UK where the local bus fleet uses the Envirox nCe additive. Electron microscopy of laboratory-generated exhaust samples indicated both individual ceria and soot particles (external mixture) and ceria contained within soot agglomerations (internal mixture). Low ambient concentrations prevented quantification of the ceria particle mixing state in the atmosphere; therefore, a multicomponent sectional aerosol dynamic model was used to predict the size, chemical composition, and mixing state of ceria particles as a function of distance from an idealized roadway. Model simulations predicted that most ceria particles remain nonmixed in the ambient atmosphere (300 m downwind from the roadway) due to slow coagulation, with the mixing rate most sensitive to the ceria content of emitted nuclei-mode particles and the particle concentration upwind of the road. Although microscopy analysis showed both external and internal mixtures of ceria and soot in freshly emitted particles, the ambient mass concentration, and size distribution of ceria particles predicted by the model was insensitive to the emitted mixing state. | chemistry |
https://lifeat43degreessouth.com.au/collections/frontpage/products/tea-tree-white-tasmanian-sand-and-goats-milk-online-only-offer | 2020-10-25T19:36:26 | s3://commoncrawl/crawl-data/CC-MAIN-2020-45/segments/1603107889651.52/warc/CC-MAIN-20201025183844-20201025213844-00428.warc.gz | 0.903492 | 213 | CC-MAIN-2020-45 | webtext-fineweb__CC-MAIN-2020-45__0__188225104 | en | Tea Tree Oil, farm foraged eucalyptus powder, Tasmanian white sand, patchouli & lavender essential oil and plenty of magic 🌟.
Antiviral, antibacterial, soothing, gently exfoliating... and just magical.
Extra virgin olive oil, castor oil*, rice bran oil, virgin coconut oil*, shea butter*, sodium hydroxide (lye), raw goat's milk, organic/ farm foraged eucalyptus powder, Tasmanian white sand, tea tree essential oil, essential oil, sodium lactate, white kaolin clay, green french clay.
Approx net weight : 120 g
*Please note that when soap is made by natural methods, you MUST use sodium hydroxide. There just isn't really any other way to make a soap. Once the bars have been made and has cured for 4-6 weeks, sodium hydroxide is no longer found in them, due to the saponification, reaction it made with the oils to create soap. | chemistry |
https://thesmarttime.wordpress.com/2010/01/17/cotton-nylon-fabricyarn-dyeing/ | 2017-04-23T19:39:07 | s3://commoncrawl/crawl-data/CC-MAIN-2017-17/segments/1492917118743.41/warc/CC-MAIN-20170423031158-00552-ip-10-145-167-34.ec2.internal.warc.gz | 0.818029 | 546 | CC-MAIN-2017-17 | webtext-fineweb__CC-MAIN-2017-17__0__162886729 | en | Cotton-Nylon fabric/yarn dyeing
Cotton and Nylon blended fabrics may be dyed using the above process diagram. Machinery: (Cheese dyeing machine or Soft-flow machine)
- Set the dye bath with1.5 to 2.5 gpl acetic acid at room temperature.
- Add the total quantity of Glauber’s salt for reactive dyeing in two portions. This will function like a leveling agent for acid dyeing.
- Add the dyestuff mixture of acid and reactive dyes in two portions.
- Raise the temperature to 80°C @ 1°/minute.
- Hold at 80°C for 30 to 45 minutes according to the recipe/depth of nylon dyes (acid dyes).
- Then check the shade for nylon portion by carbonizing the cellulose in 70% Sulphuric acid.
- If not ok, make required additions and continue dyeing otherwise reduce the temperature to 60°C @ 2°/minute.
- At 60°C add alkali in two portions as mentioned above. Check pH. It should be 10.8 to 11.2.
- Continue dyeing for 45 to 90 minutes according to depth.
- Drop the bath.
- Cold wash twice for 10 minutes each.
- Neutralize with 1gpl of acetic acid at 40°C – Drain.
- Hot wash at 70°C – 10 minutes.
- I- Soaping with Sandopur RSK Liq – 2 gpl at 90°C
- II – Soaping with Sandopur RSK Liq – 1 gpl at 90°C
- Hot wash at 70°C
- Cold wash – twice for 10 minutes each.
- Acid wash with 1 gpl acetic acid at cold.
- Unload or take it for finishing.
Few suggestions for continuous dyeing are:
- Continuous Dyeing of Nylon and cotton blends may be done using disperse and reactive dyes in the same way we do for polyester and cotton. Thermosolling may be done at 80 to 90°C instead of 135 to 150°C. A bottleneck with disperse dyeing is, you can produce only light and medium shades only. With disperse dyestuff you may not get proper yield and washing fastness.
- With Clariant there is a dyestuff called ‘Forosols’ that can be used for dyeing both cotton and polyester for solid shades. You can make a lab trial in consultation with Clariant people and then finalize your process for continuous dyeing. | chemistry |
https://wastenotwantnotbridport.co.uk/product/fitpit-deodorant-orange-tea-tree-100ml/ | 2023-12-07T13:09:11 | s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100674.56/warc/CC-MAIN-20231207121942-20231207151942-00861.warc.gz | 0.777803 | 373 | CC-MAIN-2023-50 | webtext-fineweb__CC-MAIN-2023-50__0__47147756 | en | Our multi-award-winning* Fit Pit natural deodorant, scented with invigorating tea tree and mandarin orange essential oils. With a low bicarb formula that is light and gentle, suitable for delicate skin.
– All-day odour protection
– 100% organic natural ingredients
– Aluminium, paraben and BPA FREE
– Plastic FREE
– Cruelty FREE and vegan
Cream deodorant applied with fingertips, melts on contact with warm skin. No waiting to dry. No white stains. 100ml glass jar is reusable or recyclable and contains a 3-month supply.
VegFest Awards 2018, Real Eco awards 2019, Plastic Free home awards 2020.
How it works
Bicarbonate of Soda subtly alters your skins natural pH which prevents smell causing bacteria from thriving. The Coconut oil and Shea Butter, moisturise your skin. Unlike some deodorants it doesn’t merely mask bad smell, it prevents it. And unlike antiperspirants it doesn’t block your sweat glands, which means your body can still remove toxins, making it even healthier for you.
The result is beautifully soft and healthy underarms with a delicious fresh scent.
*Maranta arundinacea (Arrowroot) root powder, *Cocos nucifera (Coconut) oil, Sodium bicarbonate, *Butyrospermum parkii (Shea) butter, *Citrus nobilis (Mandarin orange) peel oil, *Melaleuca alternifolia (Tea tree) leaf oil, *Cupressus sempervirens (Cypress) oil, **Limonene, **Linalol.
*Organic ingredients. **Occurs naturally in essential oils. | chemistry |
https://www.portal.environment.arizona.edu/node/753 | 2019-05-24T07:25:40 | s3://commoncrawl/crawl-data/CC-MAIN-2019-22/segments/1558232257553.63/warc/CC-MAIN-20190524064354-20190524090354-00149.warc.gz | 0.79728 | 1,189 | CC-MAIN-2019-22 | webtext-fineweb__CC-MAIN-2019-22__0__187116259 | en | Dr. Brusseau is a Fellow of the American Geophysical Union, and a member of several professional societies. Dr. Brusseau's research is focused on developing a fundamental understanding of the factors and processes influencing the transport and fate of contaminants in the subsurface. He is also interested in the development and evaluation of innovative subsurface characterization and remediation technologies, and the evaluation of risks posed to human health by contamination. His research integrates mechanistic, laboratory-based experimentation, site-specific field-based investigation, and the development and application of mathematical modeling. His research projects span and integrate multiple spatial scales, from the pore scale to the basin scale. Dr. Brusseau has extensive experience in research translation and technology transfer activities. He is the originator and Director of the Research Translation Core for the University of Arizona Superfund Research Program. He has served on the technical advisory board for the Arizona WQARF (state Superfund) program, and for several federal and state Superfund sites. He is a member of the Broadway/Pantano WQARF Community Advisor Board (CAB), and has participated in numerous CAB meetings for other sites. He has conducted several international webinars and has participated in local/regional conferences and workshops to relay research results to environmental regulators, consultants, and the general public.
Brusseau, M.L., Carroll, K.C., Allen, T., Baker, J., DiGuiseppi, W., Hatton, J., Morrison, C., Russo, A., and Berkompas, J. 2011. The Impact of in-situ chemical oxidation on contaminant mass discharge: Linking source-zone and plume-scale characterizations of remediation performance. Environ. Sci. Technol., 45:5352-5358.
Brusseau, M.L., Russo, A.E., and Schnaar, G. 2012. Nonideal transport of contaminants in heterogeneous porous media: 9- Impact of contact time on desorption and elution tailing. Chemosphere, 89: 287-292.
Brusseau, M.L. and M. Narter. 2013. Assessing the Impact of Chlorinated-Solvent Sites on Metropolitan Groundwater Resources. Groundwater, 51(6): 828-832.
Miao, Z., K.C. Carroll, and M.L. Brusseau. 2013. Characterization and Quantification of Groundwater Sulfate Sources at a Mining Site in an Arid Climate: The Monument Valley Site in Arizona U.S.A. J. Hydrology, 504: 207-215.
Brusseau, M.L. and Zhilin Guo. 2014. Assessing contaminant-removal conditions and plume persistence through analysis of long-term pump-and-treat data. J. Contamin. Hydrol., 164: 16-24.
Miao, Z., C. Carreón-Diazconti, K.C. Carroll, and Mark L. Brusseau. 2014. The impact of biostimulation on the fate of sulfate and associated sulfur dynamics in groundwater. J. Contamin. Hydrol., 164: 240–250.
Ramirez-Andreotta, M.D., Brusseau, M.L., Maier, R.M., Artiola, J., Gandolfi, A.J. 2014. Environmental research translation: enhancing interactions with communities at contaminated sites. Sci. Total Environ., 497/498: 651–664.
Brusseau, M.L., El Ouni, A., Araujo, J.B., Zhong, H. 2015. Novel methods for measuring air-water interfacial area in unsaturated porous media. Chemosphere, 127: 208-213.
Mainhagu, J., Morrison, C., and Brusseau, M.L. 2015. Using vapor phase tomography to measure the spatial distribution of vapor concentrations and flux for vadose-zone VOC sources. J. Contam. Hydrol., 177/178: 54-63.
Brusseau, M.L., Mainhagu, J., Morrison, C., Carroll, K.C. 2015. The vapor-phase multi-stage CMD test for characterizing contaminant mass discharge associated with volatile organic contaminant sources in the vadose zone: Application to three sites in different lifecycle stages of SVE operations. J. Contam. Hydrol., 179: 55-64.
Zhong, H., Brusseau, M.L., Wang, Y., Yan, N., Quig, L., Johnson, G.R. 2015. In-situ activation of persulfate by iron filings and degradation of 1,4-dioxane. Water Research, 83:104-111.
Yan, N. Liu, F., Xue, Q., Brusseau, M.L., Liu, Y., Wang, J. 2015. Degradation of trichloroethene by siderite-catalyzed hydrogen peroxide and persulfate: Investigation of reaction mechanisms and degradation products. Chem. Eng. J., 274: 61-68.
Miao, Z., Gu, X., Lu, S., Brusseau, M.L., Zhang, X., Fu, X., Danish, M., Qiu, Z., Sui, Q. 2015. Enhancement effects of chelating agents on the degradation of tetrachloroethene in Fe(III) catalyzed percarbonate system. Chem. Eng. J., 281:286-294 | chemistry |
https://fenneclabs.net/index.php/2019/06/29/my-technique-for-pcb-etching/ | 2024-04-18T21:28:15 | s3://commoncrawl/crawl-data/CC-MAIN-2024-18/segments/1712296817239.30/warc/CC-MAIN-20240418191007-20240418221007-00517.warc.gz | 0.940157 | 440 | CC-MAIN-2024-18 | webtext-fineweb__CC-MAIN-2024-18__0__195425359 | en | This is a supplement to the blog post describing my PCB etching station. Here I explain my technique for etching boards for those who have not experienced with PCB etching.
The technique I use for PCB fabrication applies toner transfer alongside chemical etching. The first process relates to imprint of a protective mask onto the copper plating. The mask first printed on a thermal-transfer-paper with a toner printer (laser printer), and the paper is laid on the copper clad board and pressed with a hot iron. The paper is removed by soaking it together with the copper clad board in a water bath and peeling it while taking care not to peel the transferred toner as well.
To print the layout I use a high resolution 2400×600DPI Brother HL-L2310D, Though less accurate printers will do for less demanding layouts. The paper use is specialized for toner transfer, it is a paper laminated with a thin plastic layer which detaches when heated. The iron was set to the maximum possible temperature, measured to be ~150°C.
To clean the board I used steel wool together with acetone (ethanol is almost as effective), allowing the toner to adhere strongly. The steel wool removes the protective plastic layer the board is shipped with, or abrades the oxidized copper layer of an unprotected board. The acetone serves to remove oils and fats that may cover the board.
Once the toner mask is imprinted onto the board, I begin with the etching. This is where the PCB etching station I designed comes to play: a bath with an etching solution is heated to 50°C, the masked board is soaked in and left there until all of the copper is etched away, which typically takes 7-15 mins. The board is then extracted from the solution, rinsed in water to remove residual chemicals, and the toner is removed using acetone and toilet paper. That’s it! I have a PCB, all that is left is to drill the holes with a precision drill, such as a Dremel rotary tool. | chemistry |
https://palmbeachnutra.com/products/total-detox-pack | 2022-10-05T06:01:45 | s3://commoncrawl/crawl-data/CC-MAIN-2022-40/segments/1664030337537.25/warc/CC-MAIN-20221005042446-20221005072446-00637.warc.gz | 0.655743 | 609 | CC-MAIN-2022-40 | webtext-fineweb__CC-MAIN-2022-40__0__292487932 | en | AHA Cleanser: Wet face with warm water. Dispense AHA cleanser into your hand and massage onto your face in a circular motion, working into a lather. Use caution around eye area. Rinse thoroughly with warm water. Use morning and evening. Recommended for use on oily or problematic skin.
Detoxifying Charcoal Peel-Off Mask: Apply a medium-to-thick layer on desired area, making sure to avoid eyebrows, hairline, eye area and lips. Leave for 20-30 minutes until fully dry and peel-off, gently peeling starting from the bottom.
Resveratrol Peptide Cream: Apply to clean skin morning and evening.
AHA Cleanser: Purified Water (Aqua), Sodium Olivate, Glycolic Acid, Glycerin, Rosa Rubiginosa (Rose Hip) Seed Oil, Helianthus Annus (Sunflower) Seed Oil, Chamomilla Recutita Flower Oil, Citrus Paradisi (Grapefruit) Oil, Citrus Medica Limonum Fruit Oil, Calendula Officinalis Seed Oil, Chondrus Crispus (Seaweed) Extract, Eriobotrya Japonica Extract
Detoxifying Charcoal Peel-Off Mask: Water (Aqua), Polyvinyl Alcohol, Alcohol Denat., Glycerin, Charcoal Powder, Peg-12 Dimethicone, Glycereth-26, Isododecane, Dimethicone Crosspolymer-3, Laureth-4, Ceteth-10, Niacinamide, Squalane, Marrubium Vulgare Meristem Cell Culture, Xanthan Gum, Xylitylglucoside, Anhydroxylitol, Xylitol, Lepidium Sativum Sprout Extract, Phenoxyethanol, Ethylhexylglycerin
Resveratrol Peptide Cream: Water (Aqua), Simmondsia Chinensis (Jojoba) Seed Oil, Polyacrylamide, C13-14 Isoparaffin, Squalane, Laureth-7, Sodium Hyaluronate, Resveratrol, Glycerin, Acetyl Hexapeptide-8, Pentapeptide-18, Dipeptide Diaminobutyroyl Benzylamide Diacetate, Acetyl Octapeptide-3, Palmitoyl Tripeptide-1, Palmitoyl Tetrapeptide -7, Prunus Armeniaca (Apricot) Kernel Oil, Butylene Glycol, Carbomer, Polysorbate 20, Caprylyl Glycol, Potassium Sorbate, Phenoxyethanol, Ethylhexylglycerin
Not tested on animals. Please recycle.
Discontinue use if redness or irritation occurs. Do not ingest. | chemistry |
http://sites-top.ru/chemistry+help+carbon+14+dating/page-3488.html | 2017-12-17T10:11:21 | s3://commoncrawl/crawl-data/CC-MAIN-2017-51/segments/1512948595342.71/warc/CC-MAIN-20171217093816-20171217115816-00242.warc.gz | 0.91793 | 515 | CC-MAIN-2017-51 | webtext-fineweb__CC-MAIN-2017-51__0__181515604 | en | Chemistry help carbon 14 dating
Chemistry help carbon 14 dating - dating diego san service
They exist in equilibrium with the C14 concentration of the atmosphere, that is, the numbers of C14 atoms and non-radioactive carbon atoms stays approximately the same over time.As soon as a plant or animal dies, they cease the metabolic function of carbon uptake; there is no replenishment of radioactive carbon, only decay.
Today, there are over 130 radiocarbon dating laboratories around the world producing radiocarbon assays for the scientific community.
Carbon-14 has a relatively short half-life of 5,730 years, meaning that the fraction of carbon-14 in a sample is halved over the course of 5,730 years due to radioactive decay to nitrogen-14.
The carbon-14 isotope would vanish from Earth's atmosphere in less than a million years were it not for the constant influx of cosmic rays interacting with molecules of nitrogen (N) into organic compounds during photosynthesis, the resulting fraction of the isotope 14C in the plant tissue will match the fraction of the isotope in the atmosphere.
After plants die or are consumed by other organisms, the incorporation of all carbon isotopes, including 14C, stops.
Thereafter, the concentration (fraction) of 14C declines at a fixed exponential rate due to the radioactive decay of 14C. ) Comparing the remaining 14C fraction of a sample to that expected from atmospheric 14C allows us to estimate the age of the sample.
One of the most frequent uses of radiocarbon dating is to estimate the age of organic remains from archaeological sites.
The technique of radiocarbon dating was developed by Willard Libby and his colleagues at the University of Chicago in 1949.The radiocarbon method is based on the rate of decay of the radioactive or unstable carbon isotope 14 (14C), which is formed in the upper atmosphere through the effect of cosmic ray neutrons upon nitrogen 14.The reaction is: (Where n is a neutron and p is a proton).Emilio Segrè asserted in his autobiography that Enrico Fermi suggested the concept to Libby at a seminar in Chicago that year.Libby estimated that the steady-state radioactivity concentration of exchangeable carbon-14 would be about 14 disintegrations per minute (dpm) per gram.The 14C formed is rapidly oxidised to 14CO2 and enters the earth's plant and animal lifeways through photosynthesis and the food chain. | chemistry |
http://www.brauer.com.au/our-range/breastfeeding-support | 2021-07-28T04:58:32 | s3://commoncrawl/crawl-data/CC-MAIN-2021-31/segments/1627046153521.1/warc/CC-MAIN-20210728025548-20210728055548-00253.warc.gz | 0.828658 | 789 | CC-MAIN-2021-31 | webtext-fineweb__CC-MAIN-2021-31__0__277599266 | en | Brauer Breastfeeding Support is designed to support the increased nutritional requirements of breastfeeding. Each tablet is formulated with a combination of 18 vitamins and minerals, including a bioavailable form of folate as well as active forms of vitamin B2, B6 and B2.
Always read the label. Follow the directions for use. This product contains selenium which is toxic in high doses. A daily dose of 150 micrograms for adults of selenium from dietary supplements should not be exceeded. Vitamins and minerals can only be of assistance if dietary intake is inadequate. Advise your doctor of any medicine you take during pregnancy, particularly in your first trimester. If you are concerned about the health of yourself or your baby, please consult your healthcare practitioner.
Store below 25°C. Do not use if cap seal is broken.
Adult women: Take two capsules once daily with food, or as directed by your healthcare professional.
Each film-coated tablet contains:
Thiamine nitrate 864 micrograms (equiv. Thiamine (Vit B1) 700 micrograms), Riboflavin sodium phosphate 1.1mg (equiv. to Riboflavin (Vit B2) 800 micrograms), Nicotinamide 8.5mg, Calcium pantothenate 3.82mg (equiv. Pantothenic acid (Vit B5) 3.5mg), Pyridoxal 5-phosphate monohydrate 3.13mg (equiv. to Pyridoxine (Vit B6) 2mg), Levomefolate glucosamine 225 micrograms (equiv. to Levomefolic acid 125 micrograms), Biotin 17.5 micrograms, Ascorbic acid (Vit C) 30mg, Colecalciferol (Vit D 500IU) 12.5 micrograms, d-alpha-tocopheryl acid succinate (Vit E 6IU) 5mg, Mecobalamin (co-methylcobalamin) 10 micrograms, Calcium hydrogen phosphate dihydrate 538mg (equiv. to Calcium 125mg, equiv. to Phosphorus 97mg), Magnesium citrate 387mg (equiv. Magnesium 62.5mg), Ferrous fumarate 14.41mg (equiv. Iron 4.5mg), Choline bitartrate 122mg (equiv. Choline 50mg), Zinc glycinate 17.73mg (equiv. Zinc 5mg) Potassium iodide 177 micrograms (equiv. Iodine 135 micrograms), Sodium selenite 60 micrograms (equiv. Selenium 27.5 micrograms), Tagetes erecta flower ext. dry conc. stand. 10.86mg (From minimum fresh flower 7.66g, Standardised to contain Lutein esters calculated as Lutein 5.43mg and Zeaxanthin 1.09mg.
Breastfeeding can be a nutritionally demanding time and a busy mum's diet may not always be sufficient to maintain optimal nutrition and energy levels. Brauer's Breastfeeding Support is formulated to provide essential vitamins and nutrients during breastfeeding.
At Brauer, we are passionate about selecting the very best ingredients for new mums and their babies.
In our Breastfeeding Support, this includes:
✔ Quatrefolic® (Levomefolate glucosamine) a bioavailable form of folate
✔ Vitamins B2, B6, B9 & B12 in their more active forms
✔ Clinically researched Lutemax® 2020 - supports healthy eye development
✔ No galactagogue herbs which can change the taste of a mother's milk! | chemistry |
https://buildingmaterials.com.my/materials/brick-tiles | 2019-11-22T23:38:02 | s3://commoncrawl/crawl-data/CC-MAIN-2019-47/segments/1573496672170.93/warc/CC-MAIN-20191122222322-20191123011322-00230.warc.gz | 0.944156 | 701 | CC-MAIN-2019-47 | webtext-fineweb__CC-MAIN-2019-47__0__28180260 | en | Brick Tiles - Introduction
The term ‘brick’ refer to a solid unit composed of clay, formed into a rectangular prism and fired in a kiln. Two basic categories of bricks are fired and non-fired bricks.
Thin-fired clay units, commonly known as brick tiles were first developed in the 1950s as a way to replace existing construction but have since gained increasing popularity in the present building industry because they have the aesthetics of traditional bricks masonry with the economic benefits that are realized in using thinner tiles.
How are Brick Tiles Produced
Normally brick tiles are 50% - 60% by weight silica (sand), 20% - 30% by weight alumina (clay) and the remaining ingredients of lime, iron oxide and magnesia.
To manufacture the bricks, sand is added to raw clay to reduce shrinkage. The clay is first grounded and mixed with water to the desired consistency. The clay paste is then pressed into moulds with a hydraulic press or cut into desired thickness by a wall of wires .
The shaped tiles are then dried and fired at 900 to 1000 degrees centigrade to achieve strength , hardness and its final appearance. Although bricks come in many dimensions, brick tiles are generally only 11-13 mm in thickness.
Characteristics of Brick Tiles
The colours of a brick tile are influenced usually by the chemical and mineral contents of the raw materials, the firing temperature and the atmosphere in the kiln.
Bricks may be pink due to iron contents or yellow due to higher lime content. Most brick tiles will burn to various signature red hues as the temperature is increased.
Brick tinting to change the colours to blend in with the surrounding masonry may be performed as also glaze may be applied to make the tiles more impervious or to give them an ornamental surface.
The correct brick tile for a job can be selected from a choice of colours, surface texture, weight, density, absorption structure ,thermal & moisture characteristic and fire resistance.
Advantages of Brick Tiles
Some of the advantages of brick tiles when compared with other light-weighted cladding systems are as follows:
Light weight - Imparts lesser load to a building, giving foundation and more support for the finished structure. Installation is faster and easier with less labour needed.
Economical – They have great potential for space saving since their thickness is 1/3 of other brick walls.
Security - Brick’s superior chemical stability makes it flame retardant, smokeless, low-carbon, durable, weather and impact resistant such as abuse and vandalism .It is also acid proof and has anti bacterial qualities.
Comfort - Brick’s natural high thermal mass results in low temperature changes, making an enclosed area where it is used cool and well ventilated. It is both energy saving and environmentally friendly. It has excellent acoustic insulation, thus reducing noise.
Brick tiles are particularly suitable for interior and exterior wall decoration of family home, luxury apartments, office buildings, shops, restaurants, hospitals and especially for high-rise building.
They are in fact Nature’s best material to protect humans against Nature’s worst elements: the sun, rain and wind, at the same time retaining Nature’s rustic beauty’
Modern day brick tiles are produced in many shapes and colors as seen below to offer more variety to architecture and interior designs. | chemistry |
http://www.aimchemicals.com.au/d60-solvent/ | 2018-03-19T08:56:21 | s3://commoncrawl/crawl-data/CC-MAIN-2018-13/segments/1521257646636.25/warc/CC-MAIN-20180319081701-20180319101701-00445.warc.gz | 0.848621 | 271 | CC-MAIN-2018-13 | webtext-fineweb__CC-MAIN-2018-13__0__100537463 | en | D60 solvent is produced from petroleum-based raw materials which are treated with hydrogen in the
presence of a catalyst to produce a low odor, low aromatic hydrocarbon solvent.
The major components include normal paraffins, isoparaffins, and cycloparaffins.
CAS No.: 64742-47-8 Chemical Name: Distillates (petroleum), hydrotreated light
CAS No.: 64742-48-9 Chemical Name: Hydrocarbons, C10-C13, n-alkanes, isoalkanes, cyclics, <2% aromatics
Exxsol D60 Fluid is a solvent used in industrial and professional applications such as manufacturing process
solvent, metal working, and coatings. It is not sold directly to the public for general consumer uses. This
product may be an ingredient in consumer and commercial applications which may include:
Metal working solvents, Architectural, construction and traffic marking coatings
3. Physical / Chemical Properties
D60 solvent is a combustible material and should be handled only with adequate ventilation and in
areas without any ignition source present (e.g. no open flames, static electricity sources, or unprotected light
The flash point for this product is approximately 143ºF / 62ºC. | chemistry |
https://www.oppein.com.my/naf-board/ | 2024-02-23T00:40:55 | s3://commoncrawl/crawl-data/CC-MAIN-2024-10/segments/1707947473871.23/warc/CC-MAIN-20240222225655-20240223015655-00225.warc.gz | 0.935313 | 180 | CC-MAIN-2024-10 | webtext-fineweb__CC-MAIN-2024-10__0__30956154 | en | OPPEIN formaldehyde-free added substrate material has been awarded NAF formaldehyde-free added exemption certification by California Air Resources Board (CARB).
Earlier, OPPEIN has obtained NAF formaldehyde-free added exemption certification from the US Environmental Protection Agency (EPA). OPPEIN formaldehyde-free added substrate material has become one of the few environmentally friendly substrate material in the custom home industry that has obtained dual certification.
Tested by domestic authoritative institutions, the formaldehyde emission of OPPEIN aldehydefreeadded substrate material is less than 0.005mg/m³, which is close to zero, with the leading edge.
OPPEIN took the lead of the industry to comprehensively upgrade the environmental protection level of substrate material without aldehydes and reduced the terminal price. The era of the high environmental premium is gone. | chemistry |
https://watercolourwonders.in/what-is-watercolor-made-of/ | 2024-02-26T22:05:58 | s3://commoncrawl/crawl-data/CC-MAIN-2024-10/segments/1707947474663.47/warc/CC-MAIN-20240226194006-20240226224006-00010.warc.gz | 0.931893 | 2,861 | CC-MAIN-2024-10 | webtext-fineweb__CC-MAIN-2024-10__0__70865609 | en | Watercolor painting is a captivating art form that has captured the hearts of both amateur and professional artists alike. Known for its delicate yet vibrant hues and unique blending capabilities, watercolor continues to grow in popularity.
Watercolor paint is primarily composed of pigments, binders, and additives. Pigments provide color, binders (typically gum arabic) help the pigments adhere to the painting surface, and additives enhance the paint’s performance, such as improving flow, stability, or resistance to mold.
In this article, we aim to delve deeper into the world of watercolor by exploring its composition and manufacturing process. By understanding the ingredients and methods behind watercolor paints, you can further appreciate and elevate your own watercolor creations.
What is Watercolor Made Of? – Key Ingredients
Watercolor is a versatile and expressive medium, consisting primarily of three key components: pigments, binders, and additives.
Each of these components plays a crucial role in creating the unique characteristics of watercolor paints, and understanding their functions can enhance your artistic endeavors.
Pigments are the heart of watercolor paints, providing the rich, vibrant colors that bring life to any artwork.
Derived from natural sources, such as minerals or organic materials, or created synthetically in laboratories, pigments give watercolor its hue and tinting strength.
Some common examples of pigments include ultramarine blue (derived from the mineral lapis lazuli), burnt sienna (from natural iron oxide), and quinacridone (a synthetic organic pigment).
Pigments can vary widely in terms of color, transparency, and lightfastness (resistance to fading when exposed to light).
As a result, artists often choose pigments based on their specific needs and desired effects.
Binders are the second essential component of watercolor paints, responsible for holding the pigments together and allowing them to adhere to the painting surface.
The most common binder used in watercolor is gum arabic, a natural substance derived from the hardened sap of acacia trees.
Gum arabic is favored for its ability to create a transparent and water-soluble paint film that allows the pigments to shine through.
When mixed with water, gum arabic dissolves easily, enabling the artist to achieve smooth, flowing washes of color.
Moreover, gum arabic helps maintain the stability of the paint, preventing the pigments from separating or clumping together.
Additives, while not always present in watercolor paints, can be used to modify the paint’s properties and improve its performance.
Some additives are included to enhance the flow of the paint, allowing it to spread more smoothly on the paper.
These additives, known as wetting agents or surfactants, can also help the pigments to disperse evenly, resulting in a more uniform application of color.
Another type of additive, called humectants, helps to keep the paint moist and workable, preventing it from drying out too quickly.
This is particularly useful when working with watercolors in pans or half-pans, as it allows the paint to remain usable for longer periods.
Other additives, such as preservatives, may be added to prevent the growth of mold or bacteria, ensuring the longevity and quality of the paint.
Differences In Composition and Applications of Various Types of Watercolors
The world of watercolors is vast and diverse, with various types and formats catering to different artistic needs and preferences.
Each type of watercolor has its unique properties and applications, offering a wide range of creative possibilities.
I’ve written a whole article on What Is So Unique About Watercolors?. Do check it out!
a. Traditional or pan watercolors: These are the most common format, typically found in small, dry cakes housed in plastic or metal palettes. They have a high pigment concentration and are activated with water. Their portability and ease of use make them popular among artists of all levels.
b. Tube watercolors: They come in soft, moist form, and have a buttery consistency. They contain a higher amount of binder and are often favored by professional artists for their intense colors and easy mixing. Tube watercolors are great for creating large washes and can be easily re-wet if they dry on the palette.
c. Liquid watercolors: These are highly concentrated, fluid pigments that come in small bottles. They offer brilliant, transparent colors and can be easily diluted with water. Their fluid nature makes them perfect for calligraphy, illustration, and loose, expressive washes.
I recently wrote an article on whether liquid watercolors are good or not. You’ll dive deep into the world of liquid watercolors!
d. Watercolor pencils: They combine the precision of colored pencils with the versatility of watercolors. The water-soluble pigments are encased in a wooden barrel, and can be used dry or activated with water to create beautiful washes. They are ideal for detailed work and mixed media projects.
e. Watercolor markers: They have a water-based ink that can be blended and diluted with water, just like traditional watercolors. They offer the convenience of a marker and are perfect for quick sketches, urban sketching, and illustration.
f. Watercolor sheets: These are innovative, pre-saturated sheets of watercolor pigment that can be used by adding water. They are lightweight, portable, and perfect for artists on-the-go.
g. Watercolor sticks: These are solid sticks of pigment that can be used both wet and dry. They offer the same high-quality pigments as traditional watercolors, with the added benefit of a more tactile, expressive application.
h. Gouache: Gouache is an opaque watercolor medium, containing more pigment and a higher amount of binder. This results in a more matte, flat finish compared to the transparent, luminous quality of traditional watercolors. Gouache is popular for illustration and design work.
i. Inktense pencils: These have a unique, ink-like formula that becomes permanent when dry. They offer vibrant, intense colors that can be used on various surfaces, including fabric, making them versatile and popular among mixed media artists.
j. Water-soluble crayons: They have a soft, creamy texture and can be blended or diluted with water for a watercolor effect. They are perfect for expressive, mixed media work and can be used on a variety of surfaces.
k. Water-soluble oil pastels: They offer the buttery feel of traditional oil pastels with the added benefit of water solubility. They can be blended with water for a smooth, painterly effect and are ideal for artists looking to combine the richness of oil pastels with the versatility of watercolors.
l. Metallic watercolors: They contain special pigments that create a shimmering, reflective effect. They can be used to add a touch of sparkle to watercolor paintings and are popular for embellishing calligraphy, hand lettering, and illustration.
The Manufacturing Process of Watercolor Paints
The manufacturing process of watercolor paints involves a series of meticulous steps to ensure the production of high-quality, consistent, and vibrant colors.
This process can be divided into three main stages: pigment preparation, mixing and milling, and forming and packaging.
1. Pigment preparation
Pigment preparation is the first step in creating watercolor paints. Pigments are carefully selected based on their color, transparency, and lightfastness properties.
Natural pigments, derived from minerals or organic materials, are often ground into a fine powder. Synthetic pigments, created in laboratories, are also available in various hues and qualities.
Once the pigments are chosen, they must be processed to remove any impurities or unwanted substances.
This may involve washing, drying, and additional grinding to ensure a consistent, high-quality pigment powder.
2. Mixing and milling
The next stage in the manufacturing process is mixing and milling.
The finely ground pigments are combined with binders, typically gum arabic, which help the pigments adhere to the painting surface and maintain their structure.
Additives, such as wetting agents, humectants, or preservatives, may also be incorporated to enhance the paint’s performance and stability. The ingredients are mixed together to form a thick paste.
Once the ingredients are combined, the mixture is milled to disperse the pigments evenly and create a smooth, homogeneous paint.
Milling can be performed using traditional stone mills or modern steel roller mills.
During this process, the pigment particles are broken down further, ensuring even distribution and improving the paint’s overall consistency.
The milling process may be repeated several times to achieve the desired level of dispersion and smoothness.
3. Forming and packaging
The final stage in the production of watercolor paints is forming and packaging. The paint’s format—whether it be pan, tube, liquid, or another form—determines the specific procedures involved.
For pan watercolors, the milled paint is poured into individual pans or half-pans and allowed to air dry for several weeks. The drying process may be accelerated by using a low-temperature oven.
Once dry, the pans are inspected for quality, labeled, and packaged into sets or sold individually.
For tube watercolors, the milled paint is mixed with a small amount of humectant to maintain its moisture content.
The paint is then filled into collapsible metal or plastic tubes using specialized machinery. The tubes are sealed, labeled, and packaged for sale.
Liquid watercolors are bottled directly after milling, with the consistency adjusted as needed. The bottles are then sealed, labeled, and packaged.
Other formats, such as watercolor pencils, markers, or sticks, involve unique forming and packaging methods specific to their design.
The manufacturing process of watercolor paints requires careful attention to detail and stringent quality control measures to ensure a consistent, high-quality product.
From pigment preparation to forming and packaging, each step contributes to the creation of vibrant, expressive watercolors that enable artists to bring their visions to life.
Pigments Used in Watercolor
Watercolor paints owe their vibrant hues and diverse color palettes to the pigments used in their production. These pigments can be divided into two main categories: natural and synthetic.
Understanding the origins, properties, and performance of these pigments can help artists make informed decisions when selecting their watercolor paints.
Natural pigments have been used in artistic mediums for centuries, originating from various sources such as minerals, rocks, and plants.
These pigments often boast unique characteristics, making them highly sought after by artists. Some common natural pigments include:
- Ultramarine blue: which is derived from the semi-precious mineral lapis lazuli. This pigment produces a rich, deep blue color that has been prized by artists since ancient times.
- Burnt sienna: sourced from natural iron oxide, is a warm, reddish-brown pigment popular for its versatility in creating earthy tones and shadows.
- Raw umber: also derived from iron oxide, is a dark brown pigment with a subtle green undertone, commonly used for landscape paintings and deepening other colors.
While natural pigments have their appeal, many modern watercolor paints utilize synthetic pigments.
Developed in laboratories, synthetic pigments offer a broader range of colors, improved consistency, and often better lightfastness.
These pigments are designed to mimic the properties of natural pigments or create entirely new hues. Examples of synthetic pigments include:
- Quinacridone: a family of organic pigments known for their bright, transparent colors and excellent lightfastness. They are available in a range of shades, from magenta to gold.
- Phthalocyanine: a group of synthetic pigments that produce intense, transparent blues and greens. These pigments are valued for their high tinting strength and lightfastness.
- Hansa yellow: a synthetic organic pigment that offers a range of lightfast, semi-transparent yellows, from lemon to deep gold.
Lightfastness and permanence are crucial factors to consider when choosing pigments for watercolor painting. Lightfastness refers to a pigment’s ability to resist fading or discoloration when exposed to light.
Permanence, on the other hand, describes a pigment’s overall durability, including its resistance to fading, darkening, or other alterations over time.
Artists often prioritize pigments with high lightfastness and permanence ratings to ensure the longevity and vibrancy of their artwork.
Many watercolor manufacturers use rating systems, such as the American Society for Testing and Materials (ASTM) scale or the Blue Wool scale, to communicate the lightfastness and permanence of their pigments.
These ratings help artists make informed choices when selecting paints that will best suit their needs and preferences.
We delved into the composition of watercolor paints, exploring the roles of pigments, binders, and additives.
We also discussed the various types of watercolors, including traditional, tube, and unique formats, highlighting their unique properties and applications.
Furthermore, we examined the manufacturing process, the importance of pigment selection, and the significance of lightfastness and permanence.
The world of watercolor painting is vast and diverse, offering endless creative possibilities.
We encourage you to experiment with different types of watercolors and pigments, expanding your artistic horizons and discovering new ways to express yourself through this captivating medium. | chemistry |
https://www.glamupnails.com/shop/index.php?main_page=product_info&cPath=20_119&products_id=483 | 2019-12-07T06:53:20 | s3://commoncrawl/crawl-data/CC-MAIN-2019-51/segments/1575540496492.8/warc/CC-MAIN-20191207055244-20191207083244-00149.warc.gz | 0.90693 | 241 | CC-MAIN-2019-51 | webtext-fineweb__CC-MAIN-2019-51__0__170250739 | en | Tuff Enuff Nails Linkage Protein Bonder Linkage is a protein bonder designed with an incredible ability to link to the keratin (protein & amino acids) found in the natural nail plate. Linkage creates a bonding to the natural nail by means of “Uni-layer Molecular Coupling”, which in simple terms means a molecule that joins two things. The Linkage molecules bond to the organic Keratin molecules in the natural nail plate, putting a protective layer over the entire natural nail allowing the nails to grow out naturally and healthy. The other side of the molecule is bonding to the component, gel/acrylic. With Linkage lifting is virtually eliminated.It contains absolutely no acid or damaging chemicals, and actually improves the health of the nail. You will be amazed at the perfect bond, and how it virtually eliminates lifting when the nails are properly prepped Make sure to always store Linkage properly as it will harden if left open! Spare bottles should be stored in the fridge. The lid must be kept tightly on when not in use. Also, try not to get it on the threads of the bottle or the cap will be extremely hard to remove. | chemistry |
https://tralen.es/en/content/11-tantalum-applications | 2023-11-29T14:29:40 | s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100112.41/warc/CC-MAIN-20231129141108-20231129171108-00284.warc.gz | 0.779491 | 535 | CC-MAIN-2023-50 | webtext-fineweb__CC-MAIN-2023-50__0__122725425 | en | TECHNICAL ATTRIBUTES AND BENEFITS
1. Tantalum carbide
Cutting tools for industry and medicine.
2. Lithium tantalate.
Surface acoustic wave (SAW), filters in mobile phones, high-fidelity sound equipment and televisions.
Clearer audio electronic wave signal and sharper video output.
3. Tantalum oxide
Digital cameras and mobile phones.
High level of refraction.
They can be thinner and smaller.
X-ray exposure is reduced and image quality is improved.
4. Tantalum powder: Tantalum capacitors for electronic circuits
Medical devices: hearing aids and pacemakers.
Automotive components: ABS, airbag, engine management, GPS.
Electronic devices: Computers, mobile phones, video cameras.
Other equipment: DVD, flat screen televisions, video game consoles, battery chargers, electric rectifiers, telephone antennas, oil well probes.
The capacitors have characteristics of high reliability and low failure rate, can withstand temperature ranges between 55 to + 200 ° C, are highly resistant to strong vibrations, small in size and with great electrical storage capacity.
5. Tantalum in sheets, ingots and tantalum plates
Chemical process equipment: lining, tanks, valves.
Glass-like performance corrosion resistance.
Cathodic protection systems for steel structures in bridges, water tanks etc.
Corrosion resistant fasteners: screws, nuts, bolts.
Rows in synthetic textile manufacturing.
6. Tantalum in sheets, plates, bars, wire cable
Human prosthetics: Hip joints, plates, skull, mesh to repair bone removed after cancer damage, suture clips, blood vessel stents.
Attack by body fluids is non-existent.
High temperature furnace linings.
Melting point is 2996 ° C, in a protective atmosphere or high vacuum.
7. Tantalum in ingots
Whites of Spray.
Applications of thin tantalum coatings, tantalum oxide, or semiconductor nitride coatings to prevent copper migration.
High temperature alloys for air and ground based turbines, disk motors, blades and vanes.
Alloy compositions containing 311% resistance to tantalum supply to corrosion by hot gases, allow for higher operating temperatures and therefore fuel economy and efficiency.
Computer hard drives or portable drives.
An alloy containing 6% tantalum has memory properties.
Explosive shell formation for TOW 2 missiles.
Balance of density and conformability that allows a lighter and more efficient system. | chemistry |
https://whatyouneedforbeauty.com/are-expensive-skincare-products-better/ | 2021-06-19T20:55:51 | s3://commoncrawl/crawl-data/CC-MAIN-2021-25/segments/1623487649731.59/warc/CC-MAIN-20210619203250-20210619233250-00258.warc.gz | 0.948254 | 1,589 | CC-MAIN-2021-25 | webtext-fineweb__CC-MAIN-2021-25__0__150349098 | en | Have you ever wondered whether there is a difference between a high-end facial cream for $300 and a drugstore product for $30? Are expensive skincare products better and does it pay off to buy them?
I have done some research in this topic and I hope I can provide you with the answer to that question.
Are Expensive Skincare Products Better?
Some of the most expensive skincare products do contain really special ingredients like caviar but most of the ingredients that have anti-aging effects are same in both the cheap and the expensive products. Retinol, hyaluronic acid, vitamin E, squalene, matrixyl; those are proven ingredients and they are contained both in drugstore creams and in high-end skincare products.
What makes a big difference is the package. The expensive skincare products make an impression of luxury at first sight. The brand and skincare product name are in golden letters, packed and sealed meticulously and they look great.
Are There Different Ingredients?
Even big producers of cosmetic products admit that the difference between an expensive product and a cheaper one may be minimal. The biggest difference is usually the package. And good marketing. Watching a movie star promoting the product is a huge attracting factor because the perfect-looking woman makes us feel we will get the same look if we use that skincare product she promotes.
Regular Care Is What Counts Most
All dermatologist agree on one thing: regular care is what makes the difference between a good-looking complexion compared to skin that is not looked after. Regular skin care routine and the way you apply cosmetic products on your skin are essential. It is obvious: if you don’t use even the most expensive cream regularly, you are not going to see you any results.
When Does It Make Sense To Go For A High-end Product
In general, a luxury skincare product can make you feel special and that might make you want to use it more diligently on a regular basis. Then it is worth buying.
However, if you only look for the scientifically-based evidence regarding the ingredients, there is no need to go for a high-end product.
I would say there is equal chance that you will get a cream suitable for you from either category. I have tried many brands before I found one that seems to get along with my skin best. And it is at the low-end. I was really surprised that it was not more expensive regarding the fact it contained matrixyl, squalene, three essential oils and vitamin E, all very effective ingredients that help with the anti-aging battle. In addition, it’s hyper allergenic and fragrance free.
So if I were on a quest for a cream that would suit my skin best, I would search on the internet and look at the active ingredients in creams:
Vitamin E – it is an antioxidant. Its biochemical name is tocopherol so that’s what you should be looking for in the list of ingredients. A study with seventy-five adult Japanese volunteers with dark under-eye circles and wrinkles was performed applying a gel containing 2% phytonadione, 0.1% retinol, 0.1% vitamin C, and 0.1% vitamin E for 8 weeks. Results show fair or moderate reduction of dark under-eye circles and a slight improvement of wrinkles.
Squalane – an ingredient derived from plants such as olives and rice bran, amaranth seeds or wheat germ. Squalene with an “e” is produced by the body but our natural production of squalene slows after the age of 30. So it makes sense to add it to skincare products. What does squalane do? It seals moisture naturally. And that’s what we what, right? It also stimulates cells and promotes wound healing.
Matrixyl 3000 – is considered one of the most effective anti-aging ingredients. It contains an active ingredient known as Palmitoyl Pentapeptide which helps to stimulate new collagen growth, hyaluronic acid and elastin. Matrixyl 3000 is a peptide consisting of two proteins. It fights signs of aging helping your skin look more youthful.
Matrixyl 3000 also inhibits the damage caused by the effects of sugar on your skin and helps reverse the existing effects. So that’s definitely another ingredient you want to have in your skincare product!
Hyaluronic acid – also known as hyaluronan, this substance is naturally produced by your body and its natural property is to retain water. Hydrated skin reduces the appearance of wrinkles and it can also reduce redness and dermatitis. Reduction of wrinkles, that’s what you want! Moreover, it has inflammatory properties and promotes wound healing. So this is another ingredient you should look for in skincare products.
Retinol (vitamin A) – another ingredient that rewinds the signs of aging boosting collagen production and plumping out your skin. It also improves uneven tone and pigmentation. As a result, your skin is smoother, brighter and looks more youthful.
Retinol is the number one ingredient in skin care aimed at diminishing the signs of aging. Fine lines and wrinkles are significantly reduced with it. Fewer wrinkles, that’s what we all wish for!
Vitamin C – is a potent antioxidant that restores glow, evens out fine lines and acts as a barrier against stress – another powerful ingredient contributing to a more youthful complexion.
It protects against sun damage, pollution and environmental stress, as well as free radicals – damaged cells that contribute to aging on. Vitamin C, or ascorbic acid, protects the structure of your skin and promotes the production of collagen to keep it looking plump and firm. Another ingredient to look for when you are choosing your beauty product.
Niacinamide or vitamin B3 – is a water-soluble vitamin that works with the natural substances in your skin. According to Paula’s choice “helps visibly minimize enlarged pores, tighten lax pores, improve uneven complexion, soften fine lines and wrinkles, diminish dullness, and strengthen a weakened surface.”
When used in high concentration, niacinamide can cause redness or irritation but it is very rare. After all, you can be allergic to any ingredient and there is no other way than trying it out.
There are many more ingredients that could be named here but the ones described above are really very effective in everyday skin care and it pays off to look at the composition of the cream you are going to buy very carefully.
These ingredients can be found in low-end drugstore products as well. After all, every person is different and you might experience an allergic reaction to ANY skincare product. An expensive one or a cheap one. You have to try it out.
So Is It worth It To Spend A Lot Of Money On A Face Cream?
“In my opinion, you really don’t need to spend a lot of money on fancy moisturizers,” Dr. Samer Jaber, of Washington Square Dermatology in New York City.
“When you’re getting a fancy, expensive moisturizer, you’re really paying for a couple things,” he explains. “You’re paying for the packaging, you’re paying for marketing, and then sometimes [expensive creams] have some proprietary ingredients or chemicals that are more rare and a little more expensive.”
What is your experience with expensive skincare products? Did you experience such awesome results as claimed by the movie stars who promote them? | chemistry |
https://blog.biltrightturf.com/artificial-turf-types | 2024-04-14T14:28:33 | s3://commoncrawl/crawl-data/CC-MAIN-2024-18/segments/1712296816879.72/warc/CC-MAIN-20240414130604-20240414160604-00438.warc.gz | 0.927212 | 2,117 | CC-MAIN-2024-18 | webtext-fineweb__CC-MAIN-2024-18__0__49592038 | en | Which type of artificial grass fiber fits your home?
Jan 10, 2024 | Artificial Grass for Homes
Ever wonder whether luscious, green artificial lawns are made of the same stuff as the putting green at your local mini-golf course? Believe it or not, there are quite a few different types of artificial grass fibers, each with its own unique properties. This article will explore the most common synthetic grass fibers, their pros and cons, and help determine the best fit for your home.
The main artificial grass fibers used today are nylon, polyethylene, and polypropylene. Each has advantages and disadvantages depending on the application, traffic, and desired look and feel. While additional coatings and infill products help improve lifespan, odor resistance, and playability, the base fiber constitutes the bulk of the artificial turf product.
Let's take a closer look at each fiber type.
What is nylon fiber?
Nylon is a synthetic polymer that was first mass-produced in 1935. Nylon turf fibers are made through a process called polymerization. The nylon yarn consists of long chains of polyamides that give it a smooth, continuous filament. This material is then tufted into an artificial grass product with slit-film and monofilament manufacturing techniques.
What are the pros and cons of nylon for artificial grass?
Nylon artificial grass has several advantageous properties but also some distinct downsides.
On the positive side, nylon is highly resilient and can withstand a lot of foot traffic and activity. The nylon fibers bounce back upright after being stepped on or compressed. This ability to "spring back" minimizes the need for grooming or fluffing up flattened areas.
Nylon is also highly resistant to UV radiation from sunlight. It retains its color exceptionally well without fading or discoloration over time. This makes nylon a good choice for lawns in hot, sunny climates with high sun exposure.
However, there are some notable disadvantages to nylon grass. The stiffness of the fibers can cause "turf burn" abrasions to skin from sliding or activity on the lawn. Nylon is also semi-permeable, which allows it to absorb moisture and liquids to a certain degree. This can lead to odor issues from pet urine, spills, or excess rain.
Finally, nylon is one of the more expensive options for synthetic grass installation. While ideal for artificial grass putting green, nylon may not be the best choice for a lawn used by the family.
What is polyethylene?
Polyethylene is a synthetic plastic made from petroleum that has become a top choice for artificial grass blades.
This material has a soft, flexible texture that closely imitates real grass. Polyethylene blades have a natural curve and varied blade widths.
What are the pros and cons of polyethylene yarns?
Polyethylene is a top choice for artificial grass blades due to its many desirable properties.
This material has a soft, flexible texture that closely imitates the feel of real grass. Polyethylene blades have a natural curve and varied blade widths, giving the turf a realistic, lush appearance.
The result is synthetic grass that looks impressively like the real thing.
Polyethylene is also non-abrasive and gentle on the skin. Unlike stiff nylon fibers, polyethylene allows barefoot play and activity without irritation. Families with kids and pets will appreciate this comfort factor.
Additionally, polyethylene resists absorbing moisture, which helps control odors and bacterial growth from pets, spills, and rain. The non-porous nature prevents liquids from seeping and festering deep in the turf backing.
Its durability, vivid color tones, and true-to-life texture make it easy to see why polyethylene has become a top seller. Homeowners looking for artificial grass that mimics natural lawn grass will be pleased with the realistic aesthetics polyethylene offers.
While polyethylene has many benefits, it's not without flaws.
Polyethylene is susceptible to UV degradation when exposed to prolonged sunlight. The ultraviolet radiation can cause the fibers to become brittle and break down faster than more UV-resistant fibers. This can shorten the lifespan of a polyethylene grass installation.
In terms of resilience, polyethylene lacks the springiness of nylon turf. Under heavy foot traffic and activity, polyethylene blades will become matted down and compressed into a flattened, unnatural orientation. This requires more maintenance by brushing or fluffing the blades to restore their upright position. The matting and compaction will be especially noticeable in high-traffic areas.
So, while polyethylene closely replicates lush, natural grass, some homeowners may not want to deal with the extra care. This is where polypropylene steps in as a lower-cost, more carefree option.
What is polypropylene?
Polypropylene is a versatile synthetic plastic polymer that has become popular for manufacturing artificial grass blades.
Chemically, polypropylene consists of long-chain hydrocarbons made from the monomer propylene. The propylene molecules (C3H6) are assembled into a polypropylene polymer through chain-growth polymerization.
The result is a lightweight, flexible plastic material that can be produced in various grades and densities. During manufacturing, polypropylene pellets are melted and extruded into thin, grass-like fibers.
What are the pros and cons of polypropylene artificial grass?
Polypropylene as a synthetic turf fiber has some advantages, but also notable drawbacks.
On the positive side, polypropylene blades have a natural, soft, wispy texture that closely mimics real grass. The fibers are thin and flexible, providing a cushioned feel underfoot. Polypropylene is also highly resistant to absorbing moisture, which prevents issues with odors, bacteria, and damage from pet urine.
However, polypropylene lacks durability and resilience compared to other options. The soft fibers flatten readily under foot traffic and are slow to bounce back to their upright position. This can lead to matted, flattened areas that detract from the look of the lawn.
Polypropylene also degrades more quickly than nylon when exposed to sunlight and UV radiation. Unprotected polypropylene can become brittle and discolored after prolonged sun exposure. Manufacturers often add stabilizers to help, but polypropylene is still less UV-resistant overall.
Finally, while polypropylene is a very affordable synthetic grass fiber option, the lower cost comes with some performance tradeoffs. Homeowners need to weigh whether the softer feel and natural appearance outweigh the lack of resilience and shorter lifespan in areas of heavy activity.
So, in summary, polypropylene provides a lush, wispy texture at an economical price but requires care to maintain appearance.
How do nylon, polyethylene, and polypropylene artificial grass fibers compare?
When comparing nylon, polyethylene, and polypropylene turf fibers, there are some key differences in durability, appearance, feel, and cost.
In terms of durability, nylon is the longest-lasting fiber. The resilient nylon blades can bounce back from heavy foot traffic, pets, and play with minimal flattening or matting. This makes nylon a good choice for high traffic areas. Polyethylene is moderately durable, though not as crush-resistant as nylon. Polypropylene is the least durable option, as the soft thin blades flatten down more readily.
For a natural appearance, polyethylene looks the most like real grass, with its softness and varied blade widths. Nylon is stiffer and obviously artificial at a glance. Polypropylene can look quite realistic, though the thin blades may seem sparse in some products.
In terms of feel, polypropylene and polyethylene offer a much softer, more cushioned texture underfoot. Nylon is stiff and can be abrasive, causing "turf burn" rashes from activity. Polyethylene offers the most barefoot-friendly comfort.
UV and heat resistance also differ. Nylon withstands prolonged sun exposure and high temperatures best. Polypropylene degrades fastest in sunlight. Polyethylene falls in the middle for UV stability.
Finally, nylon is the most expensive material, requiring the highest investment upfront. Polypropylene is the most affordable while polyethylene lands in the mid-range for pricing.
Considering these differences can help you choose a suitable fiber.
How do you select the right synthetic turf fiber?
When selecting an artificial grass product for your home, remember your specific needs and priorities.
For high-traffic areas that will see a lot of foot traffic, playing, and activity, a very durable and resilient fiber is best. Nylon is the hardest, while polyethylene is a bit softer but handles moderate traffic well. Both bounce back to an upright position quickly after being stepped on or compressed.
In spaces used by pets, polyethylene or polypropylene are good choices to limit odors, as neither absorbs much moisture. Liquid waste drains through these fibers quickly rather than pooling on top. They are easy to clean and sanitize.
To mimic the look and feel of a lush, beautiful natural lawn, soft polyethylene is an ideal pick. The varied green blades and naturalistic textures perfectly resemble natural grass. The softness is also comfortable for kids and pets.
For homeowners on tight budgets, polypropylene is typically the most economical fiber option. The cost savings come with some tradeoffs in durability and resilience, but polypropylene still creates a decent-looking lawn. Expect to fluff or groom flattened areas occasionally.
Also, factor your local climate into the decision. For regions with very hot weather and intense sunlight, nylon and polyethylene with UV stabilizers will handle the sun exposure best. Polypropylene needs more shade in sweltering climates.
Finally, look at other factors like blade length and thatch density. But choosing the right base fiber starts your synthetic turf on the right foot.
With a range of synthetic fibers to choose from, you can find the perfect option to suit your home's unique needs and specifications.
Do your research, weigh the options, and make an informed artificial grass choice. Soon you’ll be hosting neighbors on your glamorous new lawn with pride. | chemistry |
http://indigohealthclinic.com/neurotransmitter-testing/ | 2018-05-24T23:31:10 | s3://commoncrawl/crawl-data/CC-MAIN-2018-22/segments/1526794866894.26/warc/CC-MAIN-20180524224941-20180525004941-00609.warc.gz | 0.877963 | 1,239 | CC-MAIN-2018-22 | webtext-fineweb__CC-MAIN-2018-22__0__47573912 | en | Over 40 million Americans suffer from debilitating mental illnesses like anxiety, depression, insomnia and addictions. Based upon the most recent data collected from testing over 25,000 subjects, approximately 84% of the U.S. population suffers from neurotransmitter imbalances. Pharmaceutical intervention is often the first choice of treatment for many of these conditions. While temporarily helping individuals with mental illness, pharmaceuticals don’t often cure the underlying biochemical or physiological imbalance taking place. To attempt to get to the root cause of your mental illness, naturopathic physicians run a specialized laboratory test called a neurotransmitter test.
Neurotransmitter testing is a very simple, one-time urine collection (and/or saliva depending on the test) that provides great information about chemical messengers found in your brain and nervous system that contribute to feelings of pleasure, happiness and calmness. When neurotransmitter levels are balanced, individuals also have better attention/focus, increased memory, decreased pain, less frequent headaches, less cravings and normal gastrointestinal functioning. Neurotransmitter testing is a great first step to determine which specific neurotransmitters are imbalanced.
NEUROTRANSMITTERS AFFECT THE ENTIRE HUMAN BEING MENTALLY, PHYSICALLY, AND EMOTIONALLY.
Metabolism and weight
FACTORS THAT AFFECT NEUROTRANSMITTERS:
Poor nutrition and chronic stress are the most important factors that lead to neurotransmitter imbalance. You need protein for proper amino acid development. A diet high in sugar and fast food does not provide the proper building blocks.
Our brain chemistry is directly dependent upon the nutrients we consume, the ability of our digestive tract to assimilate nutrients, the concentration of toxins consumed as well as the toxic metabolic byproducts of incomplete digestion. Our liver's ability to assemble biochemical building blocks required by the brain for its normal functionality is critical and may easily become undermined by carrying too high a toxic load.
Industrial cleaners, air and waste pollution and heavy metals are neurological toxins, which disrupt neurotransmission and destroy brain cells that contain the neurotransmitters.
There are different types of neurotransmitters, both excitatory and inhibitory. Excitatory neurotransmitters such as glutamate, epinephrine (adrenaline), norepinephrine and beta-phenylethylamine (PEA), stimulate the nervous system and send out signals that are energizing, motivating and provide focus.
The major excitatory neurotransmitter
Plays essential role in motor behavior and secretion of pituitary hormones
EPINEPHRINE (Epi; Adrenaline)
NT and hormone essential for metabolism
Increases free fatty acids in blood as well as decreases insulin excretion
Most active in the awake sate and supports focused attention
Contributes to anxiety and its turnover increases during stress
Lower levels are commonly seen in those with depression
Derived from amino acid phenylalanine
Found to increase mental acuity and elevate mood
Involved in depression, ADHD, Schizophrenia and psychopathic behavior
On the contrary, inhibitory neurotransmitters such as GABA, serotonin and glycine, slow down the nervous system and prevent signals from continuing, thus causing calming, relaxing and sleep inducing effects.
The major inhibitory neurotransmitter, occurring in 30-40% of all synapses
Deficiency is associated with anxiety and sleep-related problems
Synthesized from tryptophan and/or 5’-HTP
90% of serotonin is produced in the gut and exerts considerable influence on normal intestinal functionality
Involved in depression, compulsive disorders, anxiety, insomnia and migraines
Glutamine, dopamine and histamine are other neurotransmitter modulators.
Most prevalent amino acid in the body
Precursor to glutamate and GABA
Precursor to Epi and Norepi
Plays significant role in cognition and emotion
Has a role with cardiovascular, renal, CNS and hormones
Responsible for allergic reactions
Relevant in the control of sleep and wakefulness
Influences secretion of hormones from pituitary gland
SYMPTOMS LINKED TO NEUROTRANSMITTER IMBALANCES
Most common symptoms include…
Low serotonin levels, one or more elevated neurotransmitters and hormonal imbalances such as low melatonin or high cortisol are trends associated with sleep disturbances. For cases associated with insomnia, salivary cortisol will be tested in addition to neurotransmitters.
Neurotransmitters play a role in appetite control, fat storage, carbohydrate storage and metabolic rate
Overweight people are typically low in one or more of the following neurotransmitters: serotonin, epinephrine, norepinephrine and dopamine
Serotonin plays a big role in appetite control. Low serotonin levels cause carbohydrate cravings. People with healthy serotonin levels typically do not crave carbohydrates.
Epinephrine plays a big role in fat metabolism. Low epinephrine levels do not allow the body to burn fat efficiently. People with healthy epinephrine levels typically have plenty of energy and lower body fat percentages.
Neurotransmitters also play a big role in the body’s energy levels- motivation, enthusiasm, stamina and cognitive function.
People who have low energy levels, are constantly fatigued or do not have any motivation are typically low in epinephrine, norepinephrine, serotonin and PEA.
Epinephrine plays a big role in energy and motivation. Low epinephrine is typically found low in sedentary people and higher in athletes.
PEA plays a big role in cognitive function. Low PEA levels are associated with brain fog and unclear thinking whereas adequate PEA levels allow the brain to process information quickly.
Other symptoms include depression, migraines, PMS, fibromyalgia, Irritable Bowel Syndrome (IBS), ADD/ADHD, autism, anxiety, OCD and behavioral issues.
Please watch the following video if you will also be testing your neurotransmitters. | chemistry |
http://vs-bu-ret2011.blogspot.com/2011/08/what-we-did-last-week-lot-of-work.html | 2018-05-24T21:41:28 | s3://commoncrawl/crawl-data/CC-MAIN-2018-22/segments/1526794866870.92/warc/CC-MAIN-20180524205512-20180524225512-00120.warc.gz | 0.974733 | 276 | CC-MAIN-2018-22 | webtext-fineweb__CC-MAIN-2018-22__0__191496511 | en | Last week was very productive for our group. We prepared four sets of samples using different concentrations of thiol and different incubation times. Each set was analyzed using FTIR and ellipsometry. We finally felt ourselves comfortable with conducting FTIR measurements and analyzing obtained spectra. The obtained spectra confirmed the successful formation of SAMs on our gold substrates. I also spent about six hours on measuring thicknesses of the SAM layers with the ellipsometer and was fairly confident in the validity of my measurements. The thicknesses were still lower than those found in articles, but they were similar in magnitude to the measurements done by another member of the lab before us.
We also spent a good portion of time on working on our poster and PowerPoint presentation that had to combine all our results for the final presentation and poster sessions during the final week.
What are our plans for the final week? We will probably spend some time on polishing our final assignments and preparing our oral presentation. I wish we could do more measurements, but we do not have time enough to complete a new piece of research and add the new results to our presentations.
All in all, this program was tremendously effective for me in terms of learning about surface chemistry, photonics, and some important sides of scientific research. I would highly recommend participation in this program to anyone interested in how science is made. | chemistry |
https://mosauto-service.ru/2021/12/softeners-for-the-little-ones.html | 2022-09-29T20:28:03 | s3://commoncrawl/crawl-data/CC-MAIN-2022-40/segments/1664030335365.63/warc/CC-MAIN-20220929194230-20220929224230-00577.warc.gz | 0.959763 | 343 | CC-MAIN-2022-40 | webtext-fineweb__CC-MAIN-2022-40__0__137015568 | en | According to a study, Germany's daycare centers have above-average levels of hormonal pollutants. In the approximately 60 examined Kitas the quantity of the plasticizers is three times higher than in usual households, announced the federation for environment and nature protection Germany (BUND) on Tuesday in Berlin.
According to the information, the seven phthalates found can dramatically affect the endocrine system. In addition, the chemicals could cause infertility and increase the risk of breast and testicular cancer.
According to BUND, the reason for the high values is the frequent use of plasticizer products in daycare centers, including PVC floors, gym mats, plastic tablecloths or gymnastic balls. The 60 daycare centers nationwide had volunteered to analyze house dust. Two-thirds measured a higher overall burden than in normal households.
The phthalates DEHP and DINP were most frequently encountered. Not all daycare centers were affected to the same extent. While only 133 mg DEHP/kg were registered in the dust of the lowest-polluted daycare center, the total phthalate value in the highest-polluted daycare center was 21 mg DEHP/kg.700 mg/kg. According to the data, the intake of up to 0.05 mg DEHP per kilogram of body weight is safe. In one case, the value was 0.13. In total, this limit was exceeded in six Kitas.
The Federal Environment Agency generally advises against the use of phthalates in toys. Some of the substances are banned in principle in toys, including DEHP. Children are particularly at risk because their organs have not yet developed sufficiently, they said. | chemistry |
https://www.eft.com/technology/first-combined-hydrogen-and-petrol-stations-china-opened | 2020-07-14T11:07:43 | s3://commoncrawl/crawl-data/CC-MAIN-2020-29/segments/1593657149819.59/warc/CC-MAIN-20200714083206-20200714113206-00051.warc.gz | 0.943487 | 329 | CC-MAIN-2020-29 | webtext-fineweb__CC-MAIN-2020-29__0__18239282 | en | First combined hydrogen and petrol stations in China opened
Sinopec and Air Liquide have inaugurated two hydrogen stations in Shanghai
China Petroleum & Chemical and French company Air Liquide have opened two hydrogen stations. They are the West Shanghai Petrol and Hydrogen Fueling Station and Anzhi Gas and Hydrogen Fueling Station. According to the companies they are the first stations in China to provide combined commercial gas and hydrogen fuel services.
The two hydrogen stations are part of the first project jointly signed by Sinopec and Air Liquide.
Each is equipped with two gasoline tanks, two diesel tanks and four hydrogen tanks, as well as two 12-pump fuel dispensers, two four-pump 35MPa hydrogen dispensers and a reserved 70MPa hydrogen dispenser.
The stations have a daily capacity of 1,000 kilograms to serve public transportation, logistics and passenger vehicles. Each station can fuel 100 cars a day. A full tank can be provided in 4-6 minutes per vehicle, providing a driving distance of 300 to 400 kilometers (186.41-248.55 miles).
As with many projects in China, this is supported by the state, as part of the "Shanghai Fuel Cell Vehicle Development Plan," and the scheme to develop a 'Hydrogen Corridor' in this critical area for China’s economy. The goal of the city is to complete 50 hydrogen stations by 2025. To achieve this, Sinopec Shanghai Petrochemical will utilise the land from 580 existing gas stations to fast-track the introduction of a new generation national network of stations covering urban roads and highways. | chemistry |
http://thechallenge.dupont.com/interviewdrjk.html | 2013-06-20T03:51:18 | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368710274484/warc/CC-MAIN-20130516131754-00092-ip-10-60-113-184.ec2.internal.warc.gz | 0.948979 | 1,390 | CC-MAIN-2013-20 | webtext-fineweb__CC-MAIN-2013-20__0__98589976 | en | Dr. Joseph V. Kurian, Technology & Business Development Manager – DuPont Performance Materials/ABS/EP, is the scientist behind Sorona®, an amazing new polymer that can make our clothing, carpets and other everyday products much more effective—and environmentally friendly. He is also a strong supporter of science education and The DuPont Challenge.
How would you describe your job and the work you do at DuPont?
I am a polymer scientist and technology leader. My current job entails providing technology and leadership in renewably sourced materials. The goal is to prepare new high performance materials from renewable feed-stocks, make the world less dependent on petroleum and thereby provide a much cleaner environment.
What are some examples of fibers?
There are natural and synthetic fibers. Examples of natural fibers include cotton, wool and silk. Polyester, nylon and spandex are examples of synthetic fibers. Fibers are essential to our life and we see them everywhere (clothing, carpets, upholstery, car interior, toys, parachutes, tires, etc.). There are specifically engineered fibers for each applications and markets.
How would you describe a polymer?
Polymers are large molecules that play an essential role in our everyday life. Polymer molecules are connected by chemical bonds. Poly means “many” and mer means “repeating unit.”
DNA and proteins are examples of biopolymers. A variety of natural polymers exist, such as cellulose, which is the main component of wood and paper. Synthetic polymers include: polyethylene, polystyrene, PVC, neoprene and nylon. Different types of polymers can be found in famous DuPont products such as Kevlar®, Nomex®, Teflon®, Tyvek®, Butacite® and Sorona®.
How did the Sorona® Polymer come about?
The preparation and commercialization of Sorona® Polymer took several years of dedicated research and development. The process of making a polymer is called polymerization. In case of Sorona®, it is called condensation polymerization. Polymer scientists can tailor molecules in their lab to introduce desirable properties in fiber and fabric form. This can be called “macromolecular engineering.”
What makes Sorona® different from other materials?
Sorona® is a highly versatile polymer that boasts properties such as softness, stretch and recovery, comfort wear, easy dyeability for vibrant colors and stain resistance to most stains. It offers several new properties and possibilities for garment makers. For example, Sorona® containing garments are unusually soft, wrinkle-free, provides good comfort fit and easy to clean. Carpets made with Sorona® offers permanent stain resistance, softness, and resilience, all important attributes to the floor covering market.
What kinds of products has Sorona been made into? What advantages do Sorona products have over similar products?
Sorona® is in textiles and garments, carpets, automotive interiors, various molded plastics for engineering components and in cosmetic packaging. There are unique advantages in each of these markets. In engineering components Sorona® provides better dimensional stability and strength whereas in cosmetic packaging improved surface gloss, scratch resistance and excellent resistance to solvents and chemicals.
What makes Sorona “sustainable” and good for the environment?
Sorona® is an excellent example of a sustainable high-value polymer. It takes less energy to prepare the polymer, releases less carbon dioxide to the environment, is free of heavy metals, can be manufactured and processed in existing equipments, and is easily recyclable.
One of the key ingredients, bio-PDO, is made from a renewable feedstock, thereby reducing the use of petroleum. It is estimated that about 10 million gallons of gasoline per year can be saved from the production of 100 million pounds of bio-PDO.
What do you see in the future for Sorona?
I see significant growth potential for Sorona® in coming years. This will also lead into the development of a new family of environmentally sustainable renewably sourced materials with broad market applications and impact to the society.
How did you first become interested in science,
and how did you start working in science as a career?
I became curious and interested in science from my childhood, playing with rubber balls made of natural rubber latex, and trying to understand how things work. I pursued biology and chemistry in my college days in India and then got interested in polymers and polymer engineering. Coming to America and studying polymer science at the University of Akron was a huge turning point in my career. Synthesis and characterization of a new family of new polymers at Professor Kennedy's lab at the University of Akron gave me the confidence to pursue a career in science.
My early days at GE Plastics and then at DuPont Nylon gave me hands on experience in industrial chemistry, large-scale polymer manufacturing experience and familiarity with fiber science, technology, and engineering. There are several teachers and mentors who helped and guided me along the way in my career. Science is a learning process and I keep learning from my colleagues and friends every day.
What is your favorite part about your job?
The most favorite part of my job is being a scientist and inventor. Using my science skills, I see an opportunity to help people, create high paying jobs and improve the quality of life for many people around the world.
What would you say to a student who is thinking about working in a science-related
Have the passion and believe in yourself. Keep pursuing your scientific dreams and goals. Stay abreast and keep trying something new every day. Success will come.
What do you think of The DuPont Challenge essay competition?
I have very high value for The DuPont Challenge. This is an excellent opportunity for students to think differently and familiarize themselves with emerging areas of science, technology and engineering and propose novel solutions. Simple participation in The DuPont Challenge alone can open their minds to a whole new world of amazing possibilities.
Why do you think The DuPont Challenge is important?
Science, Technology, Engineering and Math will continue to play a huge role in our nation's future. Our quality of life depends on our success in this area. There will be increased competition from countries around the world and it is absolutely critical that we encourage more students to pursue careers in Science, Technology, Engineering and Math.
The DuPont Challenge is an excellent vehicle to introduce scientific concepts to a large number of students at an early age. We are instilling scientific ideas and curiosity in the minds of over 10,000 students each year through this Challenge alone.
DuPont is a Science Company and we understand the importance of Science to our future success.
Find more about: | chemistry |
https://2019.ieee-fleps.org/contact/kourosh-kalantar-zadeh | 2019-08-24T11:59:01 | s3://commoncrawl/crawl-data/CC-MAIN-2019-35/segments/1566027320734.85/warc/CC-MAIN-20190824105853-20190824131853-00206.warc.gz | 0.927358 | 223 | CC-MAIN-2019-35 | webtext-fineweb__CC-MAIN-2019-35__0__211943314 | en | Kourosh Kalantar-zadeh is a 2018 Australian Research Council (ARC) Laureate Fellow and a Professor of Chemical Engineering at UNSW, in Sydney. Formerly, he was a Distinguished Professor of Electronic Engineering at RMIT in Melbourne. Kalantar-zadeh is also the Director of the Centre for Advanced Solid and Liquid based Electronics and Optics (CASLEO) at UNSW. Kalantar-zadeh has coauthored nearly 400 research articles, reviews and books. He is a member of the editorial boards of journals including Applied Materials Today, ACS Applied Nano Materials, ACS Sensors, Advanced Materials Technologies, Nano-Micro Letters, and ACS Nano. Kalantar-zadeh is internationally recognised for his work on ingestible sensors, two dimensional semiconductors and liquid metals and has been awarded the 2017 IEEE Sensor Council Achievement Award and 2018 ACS Advances in Measurement Science Lectureship Award (Asia-Pacific region). Clarivate Analytics recognised Kalantar-zadeh as one of the most highly cited researchers in 2018. | chemistry |
http://www.refuel.com/fuel-tank-cleaning-services/ | 2017-12-15T04:09:12 | s3://commoncrawl/crawl-data/CC-MAIN-2017-51/segments/1512948563629.48/warc/CC-MAIN-20171215040629-20171215060629-00148.warc.gz | 0.929661 | 552 | CC-MAIN-2017-51 | webtext-fineweb__CC-MAIN-2017-51__0__167763862 | en | Fuel Tank Cleaning Services
Is your fuel contaminated?
Are clogged filters leading to customer complaints of slow fuel delivery? Are you losing customers and sales because of fuel quality and fuel pumping problems?
Clogged filters can be replaced, but are often an indication of a larger problem: contaminated fuel and contaminated fuel storage tanks.
Let Refuel inspect your fuel tanks and recommend the level of service right for your situation.
Are you getting a temporary fix?
Replacing the filters may temporarily to fix the problem–until you get another fuel drop. This will stir up the sediment and particulates that have settled at the bottom of tank and mix it with the new fuel. The newly dropped, and now contaminated fuel will soon clog your filters again.
Many companies simply filter or “polish” your fuel and return it to your tanks. We go one step further. By cleaning your fuel tank with our patent-pending process, you’ll not only have cleaner fuel immediately, but it will stay cleaner longer.
Is your fuel tank really being cleaned or has the fuel just been polished?
Your tanks & and fuel will be returned to optimal quality. In the over 11 years we’ve been cleaning fuel tanks, we’ve never had to re-clean a properly maintained fuel tank after our service! Refuel’s process eliminates:
Our Fuel Tank Washing Difference
If fuel tanks are contaminated with water, sludge or bacteria, simply filtering the fuel without cleaning fuel tanks can quickly lead to the fuel becoming re-contaminated.
Refuel Environmental Services combines the art of fuel tank cleaning with the science of fuel polishing and filtering to bring your fuel and and your fuel storage tanks back to original specifications.
The Refuel Fuel Tank Washing Process, is our patent-pending, all-in-one solution that brings fuel back to optimal quality and removes tank contaminants in only a few hours!
Refuel is the Midwest’s leader utilizing our patent pending tank cleaning process.
Fuel Tank Cleaning Service
• For UST & AST
• Average time to service a tank is 3 1/2 hours.
• Only the tank being cleaned will be out of service.
• Requires only 2-3″ tank openings.
• No excavation.
• Fuel is transferred from the tank prior to cleaning.
• The interior of the tank is thoroughly cleaned using high-pressure wash & rinse heads.
• Solids & water are vacuum extracted from your underground fuel tank.
• Fuel is filtered to original specifications.
• Only clean, dry fuel is returned to tank.
• Refuel handles the wash-water disposal. | chemistry |
https://wyld1.com/blogs/eco-friendly/thermal-drive | 2024-02-24T20:23:29 | s3://commoncrawl/crawl-data/CC-MAIN-2024-10/segments/1707947474544.15/warc/CC-MAIN-20240224180245-20240224210245-00591.warc.gz | 0.942448 | 443 | CC-MAIN-2024-10 | webtext-fineweb__CC-MAIN-2024-10__0__153967778 | en | Divine Graphene™ fabric is a performance blend of graphene and spandex for superior stretch and auto-thermal regulation. Graphene is allotrope of carbon consisting of a single layer of atoms arranged in a two-dimensional honeycomb lattice. Its an eco-friendly, sustainable solution found in WYLD1™ Quarter Zips.
Let's learn more about what makes Graphene a worthy SuperNatural Performance™ offering from WYLD1. Graphene is:
- The thinnest compound known at one atom thick
- The lightest material known
- The strongest material know
- The best conductor of heat at room temperature
- The best conductor of electricity
- Very flexible
Wow, thats a strong start! Carbon by mass, is one of the most abundant elements known in the universe. Its abundance makes it a potential great sustainable solution. However, it wasn't until 2012 that eco-friendly production of graphene was discovered by effectively separating graphene from a reusable metallic board which it is grown. This new process eliminated the toxic waste created from previous production options paving the pathway to sustainable Graphene applications.
There are also a variety of emerging eco-friendly Graphene production processes including using eucalyptus bark and tea leaves to extract in the synthesis of graphene sheets.
Graphene has huge potential to transform many areas due to versatility and superior properties. Significant global research is currently underway to understand how to utilize Graphene's power in batteries, water filters, energy, computers, DNA sequencing, electronic display screens, and textiles.
Enhanced Graphene textiles are just hitting the market and offer a number of incredible benefits including boosted thermal regulation, durability, self-cleaning, breathability, flexibility, protection, and tech integration. There is significant ongoing research and experimentation with Graphene use in textiles that will continue to push the boundaries on how this unique and all-powerful material could revolutionize future textiles.
We hope you are as excited as we were when learning about Graphene and now understand why it rightfully achieves Supernatural Performance™ standards for use in WYLD1™ gear. | chemistry |
https://mybestruns.com/Beet_juice_enhances_athletic_performance_giving_to_the_athletes_an.html | 2020-01-21T06:39:08 | s3://commoncrawl/crawl-data/CC-MAIN-2020-05/segments/1579250601615.66/warc/CC-MAIN-20200121044233-20200121073233-00398.warc.gz | 0.96536 | 616 | CC-MAIN-2020-05 | webtext-fineweb__CC-MAIN-2020-05__0__66217320 | en | Beet juice enhances athletic performance giving to the athletes an amount of nitrate in a natural food source
Runners have experimented with a broad array of aids in pursuit of a performance edge. A popular one today that seems safe and backed by solid data is the juice of beets, for the nitrates they contain.
Inorganic nitrate is added to cured and processed meats to extend their shelf life and give them their distinctive pink color. It’s also naturally found in spinach, arugula and beets. In the past decade, new evidence has suggested that the nitrate in these vegetables enhances athletic performance and may also increase cardiovascular health in old age.
The first clue came in 2007, when Swedish researchers reported that three days of sodium nitrate supplementation lowered the oxygen demand of nine cyclists and triathletes as they worked out, compared with a placebo of table salt. It also increased the blood plasma levels of nitrite, a byproduct of nitrate.
That study caught the eye of exercise physiologist Andrew Jones of the University of Exeter in England. Usually, the oxygen demand of exercise is fixed, he says, so for a short-term intervention to change that “was unusual.”
Although it wasn’t clear how nitrate was doing what it did, Jones knew that green leafy vegetables and beets were rich sources. So he conducted a study, reported in the Journal of Applied Physiology, giving eight men active in recreational sports an equivalent amount of nitrate in a natural food source like beet juice.
The volunteers consumed 500 ml (17 ounces) of beet juice every day for six days. Then, after a break of 10 days, the groups were switched around and drank another drink for an additional six days.
By the last three days of the six, nitrate concentration in the blood of those drinking beet juice was almost doubled and their systolic blood pressure (which measures the pressure in your blood vessels as your heart beats) fell by an average of 6 points. The oxygen cost — the amount of oxygen consumed — when they exercised on a stationary bicycle was reduced by 19 percent.
“When we asked them to continue to exercise to exhaustion, they were able to go longer,” recalls Jones, who co-wrote a review on dietary nitrates in the 2018 Annual Review of Nutrition.
From then on, research on beet juice, beet juice concentrates, whole beets and nitrate salts started to pour in.
Nitrate itself doesn’t do much in the body. It first has to be converted to nitric oxide, a gas with numerous physiological roles — in blood vessel dilation, muscle contraction and transmission of nerve signals, among others. People obtain that nitric oxide in two ways: either through the action of the enzyme nitric oxide synthase, which catalyzes the amino acid L-arginine to produce it, or from nitrate ingested in food.
posted Tuesday April 30th
by Rodrigo Pérez Ortega | chemistry |
http://meriden.patch.com/search?keywords=3M | 2014-07-23T09:52:53 | s3://commoncrawl/crawl-data/CC-MAIN-2014-23/segments/1405997877693.48/warc/CC-MAIN-20140722025757-00207-ip-10-33-131-23.ec2.internal.warc.gz | 0.97054 | 125 | CC-MAIN-2014-23 | webtext-fineweb__CC-MAIN-2014-23__0__181986374 | en | 3M Purification 400 Research Pky, Meriden, CT06450 3M Purification is a Meriden institution. The company designs and produces water and gas filtration and purification…More products for the health care and food and beverage industries as well as residential and industrial settings. Formerly known as Cuno, the company was founded by George Cuno in Meriden in 1912 and grew to international prominence in the water and gas filtration industry. Cuno was acquired by 3M in 2005. By joining forces, these two industrial giants are able to offer cutting-edge technology to clients worldwide. | chemistry |
https://www.realmcarthurpawpawproducts.com/shop/hyaluronic-acid-65-paw-paw-face-cream-50ml/FC50 | 2020-07-03T14:59:31 | s3://commoncrawl/crawl-data/CC-MAIN-2020-29/segments/1593655882051.19/warc/CC-MAIN-20200703122347-20200703152347-00347.warc.gz | 0.780399 | 551 | CC-MAIN-2020-29 | webtext-fineweb__CC-MAIN-2020-29__0__214089995 | en | REAL MCARTHUR PAW PAW , ALOE VERA LEAF JUICE, CONCENTRATE, CAMELIA OIL,COCONUT OIL, MACADAMIA OIL, SHEA BUTTER, QUANDONG
Hyaluronic Acid & 30% Paw Paw Face Cream - Natural and Organic Hydrating Face Cream
Our Unique Magnesium Face Cream may aid in the regulation of the activity of over 324 enzymes within the human body, reduce inflammation and help muscle function.
• Lightweight, luxurious moisturiser – ideal for use on all skin types and easily absorbed by the skin.
• Contains Real McArthur Paw Paw Extract providing beneficial enzymes which may help allow the skin to energise, repair and become smoother.
• The addition of Shea and Cocoa Butters adds extra moisturising abilities.
• Non-Irritating Cream with the soothing effects of Magnesium Chloride which may help stimulate the skin’s natural healing and regeneration.
• Contains Bio Hyaluronic Acid to help plump the skins elasticity with moisture allowing itself to repair also aiding with cell regeneration.
• Natural Aromatic Oils such as Ylang Ylang, Rose Geranium and Lavender are added to promote a sense of well-being and relaxation.
• Rich with antioxidants (Chamomile and Kakadu Plum Extracts).
• Rich with vitamin E.
100% Natural Ingredients:
*Aloe Vera Leaf Juice, Real McArthur Paw Paw Extract, *Camelia Oil, *Coconut Oil, Glyceryl Stearate Citrate, *Macadamia Oil, Cetearyl Alcohol, Stearic Acid, *Cocoa Butter, *Shea Butter, Sodium Levulinate/Sodium Anisate, Magnesium Chloride, Xanthan Gum, Hyaluronic Acid, Ylang Ylang Essential Oil, Rose Geranium Essential Oil, Vitamin E - Natural, Lavender Essential Oil, Kakadu Plum Extract, Lilly Pilly Extract, Citric Acid.
* Indicates Certified Organic Ingredients.
Our Hyaluronic Acid & 30% Paw Paw Face Cream - Natural and Organic Hydrating Face Cream may help soothe and rejuvenate the appearance of the skin. It may also help to relieve redness and dryness of the skin.
Contains no added fragrance.
Contains 100% natural ingredients.
Contains no petrochemicals, parabens or added sulphates.
For best results use daily.
Smooth gently onto your face and neck using upward and outward movements, avoid contact with eyes.
For external use only. | chemistry |
https://miamicenterfordermatology.com/acne-treatments-in-miami/ | 2023-09-23T21:28:02 | s3://commoncrawl/crawl-data/CC-MAIN-2023-40/segments/1695233506528.3/warc/CC-MAIN-20230923194908-20230923224908-00774.warc.gz | 0.908997 | 1,232 | CC-MAIN-2023-40 | webtext-fineweb__CC-MAIN-2023-40__0__68913888 | en | Figuring out what’s causing your acne and how to treat it can be difficult, discouraging, and take a long time. When deciding which acne treatments to start for your skin, it’s important to go straight to the right sources—dermatologists! Here’s the best advice about acne treatments, straight from our doctors.
How to Treat Acne
Because there are so many different root causes of acne, there are many different treatments that can improve your complexion and keep breakouts at bay. From laser treatments to facials to even hormonal birth control pills, acne treatments aren’t limited to over-the-counter skincare products. However, these products are one of the most accessible and effective acne treatments for people dealing with acne, both minor and severe. Here are the main types of anti-acne skincare products and ingredients we recommend.
There is so much variety in chemical exfoliants that it’s no wonder most dermatologists across the US recommend chemical exfoliation over manual/physical exfoliation for the majority of their patients. This variety of chemical exfoliants shows there’s a fit for virtually every skin type.
If your skin is extremely sensitive, polyhydroxy acids (PHAs) might be best for you, as they’re some of the most gentle chemical exfoliants out there. If your skin needs a more robust exfoliant, then AHAs like glycolic acid or BHA might be best for you.
What exactly are chemical exfoliants? Essentially, chemists extract these exfoliants from natural substances, usually fruits, or they produce synthetic versions. These exfoliants are able to slough away dead skin cells, oil, dirt, and debris from your skin to reduce existing breakouts and prevent new ones from forming.
Physical exfoliants, like salt crystals, ground up walnut shells, and microbeads, tend to be more abrasive and cause microtears in the skin. The abrasive nature of these exfoliants can smooth out the skin, but they are often too harsh for many sensitive skin types, causing irritation and weakening the skin’s barrier. The microtears often allow more bacteria and debris to find its way into your pores, causing more breakouts.
While a good scrub can feel relaxing and make your skin feel ultra-clean, dermatologists find the best acne treatments to contain chemical exfoliants instead. Here’s some of our favorite skincare products that contain chemical exfoliants.
What We Believe
With a holistic clinical approach, which involves first listening to patients concerns, we thoroughly diagnose and explain their individual treatment options.
Our Porefect Cleanser pairs 2% salicylic acid (BHA), and glycolic acid to gently unclog pores, remove impurities and even skin texture and tone—without stripping your skin. This unique combination of medical-grade, acne-fighting ingredients work to help regulate oil production and effectively clear problematic skin that is more sensitive to irritation. This gel formula is a great cleanser for oily complexions, but it doesn’t strip the natural ceramide barrier and dry out your skin.
Exfoliating your skin doesn’t have to be in the form of a cleanser, it can be in a leave-on treatment like a toner or serum. Our Gly/Sal Pads are similar to our Porefect Cleanser in that they also contain salicylic and glycolic acid, but the formula comes in convenient, easy-to-use pads to promote exfoliation, control oil, reduce breakouts and unclog pores. These pads help enhance skin clarity and are pH-balanced. Our Gly/Sal Pads also contain witch hazel for oil control as well as hydrating ingredients to nourish the skin barrier and prevent dryness from the exfoliants.
If you’re looking for something stronger, the Papaya Enzyme Peel from Doctor’s Daughter is a once-a-week acne treatment that deeply exfoliates the skin. While it helps with breakouts like the other products we mentioned, it goes above and beyond that to help your skin.
- Replaces dead skin cells with new, younger cells
- Evens out skin discoloration and texture
- Prevents signs of aging
- Brightens dull skin
- Unclogs pores
Like we mentioned before, acne has several different causes, so chemical exfoliation may not help depending on the root source of your acne. Perhaps a better acne treatment for you would be to target bacteria.
Unlike chemical exfoliants, benzoyl peroxide is a topical antiseptic that kills acne-causing bacteria. This ingredient works particularly well for inflammatory acne, which is characterized by red bumps that contain pus (pustules, papules, cysts, and nodules) rather than whiteheads and blackheads.
Like chemically exfoliating products, benzoyl peroxide comes in different strengths. If you’ve never used this ingredient before, start with the lowest percentage and then work your way up as needed. We have two different cleansers with this ingredient, one in 5% strength and one in 10% strength. Our Benzoyl Peroxide Acne Wash 5% provides antibacterial activity against Propionibacterium acnes. This powerful acne-fighting treatment dries up pimples and blemishes while keeping the skin’s moisture and pH levels at the normal level. Benzoyl peroxide keeps future blemishes from forming, resulting in clearer skin over time.
Acne Treatments in Miami | Miami Center for Dermatology
Our dermatologists are here to help you achieve the skin of your dreams. Take a look at our other skincare acne treatments, and book an appointment with us today for a personalized consultation about your acne. | chemistry |
https://www.aquivasurf.com.au/pages/surfboard-construction | 2024-02-24T23:49:24 | s3://commoncrawl/crawl-data/CC-MAIN-2024-10/segments/1707947474569.64/warc/CC-MAIN-20240224212113-20240225002113-00553.warc.gz | 0.94523 | 516 | CC-MAIN-2024-10 | webtext-fineweb__CC-MAIN-2024-10__0__79188306 | en | What is my surfboard made from?
Since the 1960’s surfboards have been constructed with one viable method, fiberglass, resin (PE) and foam (PU). This was adopted from the aviation sector but new materials have been explored over the last decade. Before fiberglass and foam surfboards were made from wood. Balsa wood being the easiest to work with but boards have been made from redwood and pine. The most popular surfboard construction on the market today is polystyrene resin, fiberglass and polyurethane blanks with a plywood stinger.
Here's a breakdown of the main materials used in surfboard construction:
- Foam Core: Most surfboards today use a foam core, which provides buoyancy and lightweight properties. The two main types of foam cores used are expanded polystyrene (EPS) and polyurethane (PU) foam. EPS foam is lighter and more buoyant, while PU foam is denser and has better flex properties.
- Fiberglass Cloth: Fiberglass is used to reinforce the foam core and provide strength to the surfboard. Fiberglass cloth is typically layered over the foam and laminated with resin. It comes in various weights and weaves, with heavier fiberglass providing more durability but adding weight to the board.
- Resin: Resin is used to bind the fiberglass layers together and create a hard shell around the foam core. Polyester resin and epoxy resin are the two main types used in surfboard construction. Polyester resin is more commonly used as it is less expensive, while epoxy resin offers higher strength and lighter weight.
- Stringer: A stringer is a thin strip of wood or composite material that runs through the center of the surfboard from nose to tail. It adds strength and helps control flex in the board.
- Fins: Fins are usually made of composite materials such as fiberglass, carbon fiber, or a combination of both. They are attached to the bottom of the surfboard and help with stability, maneuverability, and control.
It's worth noting that there are alternative materials and construction methods being explored in surfboard manufacturing, including bio-based foams, recycled materials, and sustainable resins, as the industry strives to reduce its environmental impact.
The use of carbon fiber, basalt and kevlar have been explored over this time and some shapers and manufacturers use these materials exclusively as a point of difference but also as they believe in the superiority of the product. | chemistry |
https://www.sgwasa.org/news/post/1488/ | 2020-09-26T20:43:23 | s3://commoncrawl/crawl-data/CC-MAIN-2020-40/segments/1600400245109.69/warc/CC-MAIN-20200926200523-20200926230523-00403.warc.gz | 0.891763 | 631 | CC-MAIN-2020-40 | webtext-fineweb__CC-MAIN-2020-40__0__6686222 | en | FOR IMMEDIATE RELEASE
Butner, NC. September 4, 2020 — Congratulations to SGWASA Executive Director Scott Schroyer, Utilities Operations Director Fred Dancy and the dedicated SGWASA water treatment facility employees for once again achieving success in meeting the North Carolina Drinking Water Standards for Disinfection By Products (DBP). This marks not only 3 years without a DBP violation, but also 3 years of being among the best in the area in terms of DBP results.
To give our customers an idea of how SGWASA rates with others in our area, below are the 3rd quarter 2020 compliance test results. These results are compiled from the NC Drinking Water Watch website (https://deq.nc.gov/about/divisions/water-resources/drinking-water/drinking-water-watch).
|Agency||Maximum Contaminant Level Allowed (MG/L)||3rd Quarter Value (MG/L)||Maximum Contaminant Level Allowed (MG/L)||3rd Quarter Value (MG/L)|
|City of Oxford||0.080||0.046||0.060||0.032|
|Kerr Lake Regional||0.080||0.054||0.060||0.038|
|City of Durham||0.080||0.041||0.060||0.031|
MG/L = Milligrams per Liter
What are DBP’s and TTHM’s?
DBP’s: Disinfection by-products (DBPs), also called trihalomethanes, are formed when chlorine and bromine interact with natural organic materials in water, such as in chlorinated drinking water and chlorine-treated swimming pools. DBPs can be found in the air during activities such as showering, bathing, dishwashing, and swimming. DBPs do not build up in the environment.
TTHM's: Trihalomethanes (THM) are a group of four chemicals that are formed along with other disinfection by products when chlorine or other disinfectants used to control microbial contaminants in drinking water react with naturally occurring organic and inorganic matter in water. The EPA regulates total trihalomethanes at a maximum allowable annual average level of 80 parts per billion (0.080 MG/L).
SGWASA Executive Director Schroyer commented, “Consistently achieving low values quarter after quarter for the past three years to be in compliance with the EPA is excellent in terms of SGWASA providing quality drinking water to its customers.”
Thank you to everyone involved for keeping SGWASA among the best in our area.
Jimmy Gooch, SGWASA Board Chairman
Please stay up to date on this topic and other news topics by monitoring our website: www.sgwasa.org
Issued: 9/4/20 by the South Granville Water and Sewer Authority
Scott N. Schroyer, Executive Director | chemistry |
https://www.honourhealth.co.uk/skin/spotlight-chemical-peels/ | 2021-12-06T09:09:41 | s3://commoncrawl/crawl-data/CC-MAIN-2021-49/segments/1637964363290.59/warc/CC-MAIN-20211206072825-20211206102825-00581.warc.gz | 0.919043 | 928 | CC-MAIN-2021-49 | webtext-fineweb__CC-MAIN-2021-49__0__1726315 | en | What is a Neostrata chemical peel?
At Honour Health, we use NeoStrata ProSystem – a highly effective, superficial peeling system that can only be used by medical skincare professionals, and that is clinically proven to achieve outstanding results in skincare.
The Neostrata ProSystem peeling system is a specific technique for skin renewal. It is used to help remove the top layer of damaged surface skin cells, revealing fresh skin cells that are smoother and brighter. The treatment also stimulates cell turnover and encourages collagen and elastin production in the deeper layers that plumps the skin.
Do Neostrata chemical peels hurt?
The biggest misconception about this treatment is that chemical peels will burn the skin, leaving it sore, red and painful. With Neostrata ProSystem peels, you only experience some tingling – nothing more. These rejuvenating superficial peels are even gentler than traditional scrubs.
What kind of acid is used?
The word ‘acid’ conjures up all sorts of images of burning skin – ouch! However, this is not the case with Neostrata chemical peels. They contain three alpha hydroxyl acids (AHAs), which are naturally occurring ‘fruit acids’ found in fruits and other foods:
- Glycolic Acid is found naturally in sugar cane
- Citric Acid is found naturally in citrus fruits
- Mandelic acid found naturally in almonds
Many common skin problems are associated with the excess build up of dead skin cells that make the skin thick and dull, and may cause clogged pores. These AHAs help to loosen and remove these dead surface layers to exfoliate and smooth the skin.
At Honour Health, we introduce our patients to chemical peels with a rejuvenating 20% glycolic acid peel – and then step up the glycolic acid concentrations up to 35%, depending on the results our patients would like to achieve.
We also offer two targeted benefit peels, depending on the specific skin concerns our patients would like to address:
- The Clarifying Peel combines glycolic acid with mandelic acid and is designed for oily, acne prone skin
- The Brightening Peel combines glycolic acid with citric acid to help control the signs of pigmentation and sun damage
What happens during the treatment?
Your skin will be cleansed and prepared, and the Neostrata chemical peel will then be applied. You may experience a ‘tingling’ sensation while the peel is on your skin. Following this, the peel will be neutralised and aftercare products will be applied. We will also advise you about skincare products to use at home.
How will I look afterwards?
Neostrata chemical peels are simple treatments with generally little or no downtime, and are often called ‘lunchtime treatments’ because patients can return straight to work afterwards with a healthy glow. Initially, your skin may appear red or a little ‘flushed’ and feel a little tight and sensitive. These are normal and expected results. You may notice that your skin feels rough over the next couple of days due to enhanced exfoliation, and it will be especially sensitive to UV light, so it is important to avoid sun exposure and use SPF factor 50 sun protection.
What are the results?
A chemical peel regimen can help to:
- Diminish the appearance of fine lines and wrinkles
- Even skin tone
- Reduce pore size
- Improve skin tone and texture
- Reduce the appearance of blemishes
- Reduce the appearance of oily skin
- Soften shallow acne scars
- Increase skin glow or radiance
- Help the skin appear healthier, plumper and firmer
How many peel treatments will I need?
Depending on your skin concerns, we recommend a series of up to six peels, administered once every four to six weeks. Improvements with acne prone skin can occur between one – three peels, whilst deeper textural changes usually occur between four – six peels. More severe skin issues can take longer to improve.
Find out more:
Book a free, no obligation skin consultation at our Jesmond, Ponteland and Stanley practices to share your skin concerns or talk about any of our treatments.
Claim a discount:
Our patients receive 10% off all of our skin treatments, including Neostrata chemical peels, when they become members of our Honour Health Club. | chemistry |
https://urbanaroma.com/what-is-decarboxylation-and-why-does-your-weed-need-it | 2024-04-24T03:24:40 | s3://commoncrawl/crawl-data/CC-MAIN-2024-18/segments/1712296818999.68/warc/CC-MAIN-20240424014618-20240424044618-00624.warc.gz | 0.932751 | 632 | CC-MAIN-2024-18 | webtext-fineweb__CC-MAIN-2024-18__0__141553589 | en | In its raw plant form, the cannabis plant will not get you high. Try as you might, if you nibbled on some leaves or gnawed on some raw buds, sure, you’d be getting some great fresh terpene expression and some cannabinoids, but you definitely won’t be getting high, and you would reap few of the plant’s medicinal benefits. So how do cannabinoids go from mostly inactive molecular compounds to the powerhouses we know and love? A chemical reaction called decarboxylation – decarbing for short, or just plain ol’ “activating” – is to thank, and it’s an essential step in everything from smoking your favorite flower to making infused foods at home. Before decarbing, cannabinoids are in what’s known as an acid form – THCA and CBDA, for example – and these cannabinoids interact very weakly at the CB1 and CB2 receptors throughout the body. THC, however, has a high affinity for reacting at these receptor sites (CBD to a lesser degree), making the decarbing process key to unlocking the high you’re seeking from your bud. As decarbing occurs, cannabinoids release a carbon atom from their chains, converting THCA to THC, and allowing the cannabinoids to bind to the CB1 receptors. All of that science aside, in practice, decarbing happens every time you light your bowl, as heat initiates the reaction. This reaction is instantaneous during smoking, and by the time the cannabinoids enter your bloodstream, they’ve been converted to their active forms. Vaping and dabbing also utilize heat to activate cannabinoids in concentrates, and need to be decarbed to be activated.
Tips and Tricks for Decarbing Your CannabisWhile decarbing during vaping or smoking takes little more than the touch of a button or the flick of a Bic, edibles production requires a more fine-tuned and precise approach. There are several different ways to decarb for your at-home infusions, and we’ll explore those below, but first, a few key things to note:
- You must decarb your weed before you make your infusion! Activating the CBD or THC in your flower before the infusion process is essential to make sure you’re getting the experience – and dosage – you expect. This goes for working with both flower and concentrates.
- Time and temperature matter! While there is a lot of conflicting data about the exact best practices for activating cannabinoids, the general consensus is a slow and low heating process. Also, cannabinoids decarb fully at different temperatures! If you’re working with a high-CBD strain, for example, you’ll want to decarb your cannabis at a lower temperature to activate the CBD. Time and temperature best practices are the same for flower and concentrates.
- Heating your cannabinoids too long will inactive the compounds and result in the oxidization into CBN, another cannabinoid we recognize as being sleep-inducing and from “old weed.” | chemistry |
http://www.platts.ru/price-assessments/petrochemicals/phenol-india | 2017-04-26T06:10:02 | s3://commoncrawl/crawl-data/CC-MAIN-2017-17/segments/1492917121165.73/warc/CC-MAIN-20170423031201-00295-ip-10-145-167-34.ec2.internal.warc.gz | 0.941997 | 894 | CC-MAIN-2017-17 | webtext-fineweb__CC-MAIN-2017-17__0__243783767 | en | We assess phenol-acetone assessments on a weekly basis. In Asia, both phenol and acetone were historically assessed on a CFR China and CFR Southeast Asia basis but prices will now also be assessed on a CFR India basis to capture higher spot market liquidity.
Phenol, also known as carbolic acid, is a white crystalline solid, which has been historically produced through the oxidation of 1-methylethylbenzene, commonly called cumene, which is made from benzene. Starting with benzene and propene, the whole process includes three steps, with the only other major product being 2-propanone or acetone. Derivatives of phenol include phenolic resins, bisphenol-A (BPA), caprolactam, adipic acid.
Acetone, also sometimes known as 2-propanone or dimethyl ketone is widely used as a chemical intermediate in the production of other chemicals. Acetone is primarily used in the production of commercial products such as acrylic plastics, which are used for glazing, signs, lighting fixtures and displays. Acetone is also used in conjunction with phenol in the production of BPA.
The Platts Phenol India assessment is available alongside other key global petrochemical prices in these services.
Weekly CFR India assessments are based on latest information sourced from the market up to the close of the assessment window at 4:30 pm Singapore time (0830 GMT) every Tuesday.
Platts considers trade and trade indications for phenol ASTM D2439-96, normalized to the Platts standard cargoes for assessment purposes.
Spot price assessments reflect a spot cargo size between 500 mt and 2,000 mt for delivery 15-30 days forward from date of publication, delivered to JNPT, Kandla and Hazira. Payment terms are by letter of credit 30-90 days, with applicable anti-dumping duty, or ADD, of up to $90/mt, normalized according to Platts standards.
Similarly Platts considers for assessment purposes acetone ASTMD329, normalized to the Platts standard.
Spot price assessments reflect a spot cargo size between 500 mt and 1,000 mt for delivery 15-30 days forward from date of publication to Mumbai, Kandla, Hazira and Vizag. Payment terms are by letter of credit 30-90 days, with applicable anti-dumping duty, or ADD, of up to $80/mt, normalized according to Platts standards.
The CFR China phenol and the CFR China acetone assessments were launched on 16 May 2006 as were the CFR Southeast Asia phenol and acetone assessments.
Over the last few years, India's demand for phenol has surged. However, domestic supply has not kept pace with India's rising solvents' consumption. Constraints over feedstock propylene, lack of adequate infrastructure and the fact that many mega-scale plants aren't integrated with downstream facilities has impeded the startup of new solvents plants in India. Just two solvents producers -- Hindustan Organic Chemicals and SI Group India-- operate in India at present.
But with domestic manufacturers owning a capacity well below the global scale, solvents imports have reached well over 80% of India's consumption, making it a prominent importer in the international market.
Meanwhile, China’s import dependency is already slowing and could slump further due to rising self-sufficiency on the back of new plants start ups in 2015. In 2015, Shanghai Sinopec Mitsui Chemicals, CEPSA Quimica and Formosa Chemicals & Fibre Corp. brought new plants online. The three plants, which have a combined phenol production capacity of 800,000 mt/year, have raised the country's total production capacity to around 2.5 million mt.
Increased supply amid steady domestic demand means that China is likely to increasingly target India due to lucrative prices in the Indian market.
Platts Phenol India assessment can be accessed in the following Platts services:
Mumbai Commodity Market Insights Forum
Seoul Commodity Market Insights Forum 2017
Aromatics Methodology Forum
7th Annual NGLs Conference and 5th Annual Petrochemical Seminar
Training & Events – Petrochemicals
Platts Market On Close Video | chemistry |
https://www.wenaikong.com/32696.html | 2020-04-08T11:37:47 | s3://commoncrawl/crawl-data/CC-MAIN-2020-16/segments/1585371813538.73/warc/CC-MAIN-20200408104113-20200408134613-00195.warc.gz | 0.763461 | 1,084 | CC-MAIN-2020-16 | webtext-fineweb__CC-MAIN-2020-16__0__124236688 | en | Some of the pictures used in this article are from the Internet
Access to clean water is crucial for every family. We all need water for drinking, cooking, and for other purposes such as bathing, brushing, and washing. Clean water not only makes life more comfortable. It likewise preserves human health.
Then, questions come:
Can the tap water we use in China meet our standard?
If not, how can we get acccess to clean water?
The tap water in China is considered relatively safe. In the past years, the water quality improved significantly due to several reasons.
Nonetheless,you might still have or notice some of the following symptoms about the tap water and naturally think that it’s not so clean.
Water looks yellow, smells bad or tastes weird.
Hair is discolored, brittle or losing volume after being washed by the tap water.
Skin is dry, itchy or even with eczema.
Eyes become itchy or red after showers or baths.
Well, for these syptoms, following points will explain.
Element No. 17 on the Periodic Table of Elements, has multiple applications. It is often used to kill bacteria and sanitize germs. Chlorine is globally used to disinfect water. But it’s more and heavily used here in China due to the severe pollution and government’s requirement. Excessive chlorine does the harm. Exposed to an excessive amount of Chlorine may affect your digestive system and may cause skin and hair problems.
Despite the fact that the quality of water source has improved, and treatments are adopted for the tap water. However, different levels of pollution still exist due to water transportation and other reasons. There mainly these kinds of pollutants in the tap water.
Particles, such as dust, dirt.
Bacteria, such as micro-organisms or germs
Hardness is another concern you need to pay attention to. It influences the shower experiences and affects the electrical appliances. The hard particles inside will stain the glasses and taps and also make the clothes cleaned not soft.
Plastic pipes are supposed to be a good alternative for the old rusty ones buried many years ago which causes part of the secondary pollution for the tap water. However, there are enough reports about the disqualified and poisonous PPR pipes which are just questionable.
Generally, the tap water in China is safe but can’t meet the standard of clean water. But the good news is that there are many options for clean water.
Due to the more advanced treatment techniques, bottled water is generally safer and much cleaner than boiled tap water. Even for some bottled water, some minerals are added, which makes the bottled water healthier and more palatable. Bottled water also comes in different volumes, like 500mL in small bottles and 19L in big jugs available to meet different needs. Bottled water has brought so much convenience and peaceful mind for consumers.
Despite the advantages mentioned, each of these choices also have their own negative points. many people are taking an issue about water bottles being environmental hazards because they are hard to recycle and they eventually end up stagnant in garbage areas. Many groups across the world are clamoring for a ban for bottled water products.
What’s more, bottled water just can cover your part of water supply for your family. When it comes to cleaning and showering, bottled water seems not so practical.
It’s basically the same water from your faucet but better and healthier.With the use of a good drinking water filtration system, water is purified by removing bacteria, pesticide, and other unnecessary elements without sacrificing quality. Many experts are hailing it as the better, healthier alternative to bottled water。
According to your different needs, different point of use filters can be added on your tap to make sure the water you use for drinking, cooking, bathing, brushing, and washing is always clean.
Advantages of Using Filtered Water
Save on water expenses
You get to save money since you wouldn’t have to buy expensive bottled water anymore.
Since your water is safer and your family is healthier, you will spend less on medicines prescribed for waterborne diseases.
You prevent 2100 various toxins that are likely present in dirty tap water from entering your body. Your kidneys will have more energy to function properly in detoxifying your body if you drink filtered tap water.
Be more attractive
Clean water will make you beautiful inside and out. Your hair will look shinier, your skin will be softer, and your nail will be healthier – all because of the absence of chlorine in your water.
The contaminants and other bacteria in unfiltered water may change the taste of your food. As you use clean water in washing and cooking your food, its natural taste is preserved.
Filtered water is definitely the right pick for the entire family. All these advantages are for you to grab so don’t even think twice. You will experience the big difference and the best thing here is that you wouldn’t have to spend a fortune for it.
You might also be interested in 读完本文你可能会感兴趣的文章: | chemistry |
https://manitounutrition.ca/how-to-fight-unhealthy-air-pollution-eat-your-broccoli/ | 2023-12-06T14:20:37 | s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100599.20/warc/CC-MAIN-20231206130723-20231206160723-00514.warc.gz | 0.939712 | 1,133 | CC-MAIN-2023-50 | webtext-fineweb__CC-MAIN-2023-50__0__134145400 | en | How to fight unhealthy air pollution? Eat your broccoli
If you live in a region with lots of air pollution, you might not always breathe easy. So it might help to sit back, relax and enjoy a helping or two of broccoli.
Better yet, have a stiff cup of broccoli-sprout tea.
It might not be the advice you expect to protect yourself from pollution.
But a study that Thomas Kensler and his team began at Johns Hopkins University and completed at the University of Pittsburgh School of Medicine found that a molecule generated during broccoli consumption, and with higher concentrations found in broccoli-sprout tea, helps purge the body of air-pollution toxins, including carcinogenic benzene. The molecule works rapidly and with staying power.
And neither a broccoli-laden diet nor a gallon of tea is necessary.
A daily cup of the sprout tea or two small helpings totaling 150 grams of broccoli can help rid toxic pollutants from the body, the study found. The vegetable from the cabbage family, often described as a superfood, provides fiber, vitamins K and C and other nutrients, such as the one that eliminates toxins from the body. That’s what makes it a widely recommended addition to any diet.
Benzene is a known human carcinogen and lung irritant, according to the study published online recently in the journal Cancer Prevention Research. “Thus, intervention with broccoli sprouts enhances (detoxification) of some airborne pollutants,” with expected reductions in health risks from pollution that raises the risk of lung cancer and cardiopulmonary diseases.
The study focuses on the molecule glucoraphanin in broccoli that, when chewed or crushed, produces sulforaphane, which is known to help prevent cancer. Glucoraphanin levels are significantly higher in broccoli stems and seeds than in the mature vegetable itself.
The International Agency for Research on Cancer recently classified air pollution and particulate matter from air pollution as carcinogenic to humans, with outdoor air-pollution levels in China among the world’s highest. The research team led by Kensler, who holds a Ph.D. in toxicology and serves as assistant professor at Pitt’s medical school, recruited 291 people from a rural area of Qidong in the Yangtze River delta region, 50 miles north of Shanghai, to participate in the study. That region “is the fastest growing economic development area of China,” the study says. Pollution levels there are steadily in the unhealthy range with fairly common surges into the very unhealthy and even hazardous range a pollution level that only rarely occurs nowadays in more polluted areas of the United States.
“Air pollution from expanding industrialization in this region masks the horizon on many days, especially during the winter months. Increases in fossil fuels use in China’s industry, transport and residential sectors have resulted in a steep increase in emissions,” the study states.
During the 12-week human clinical trial, those in the control group drank a beverage produced commercially for the study to guarantee dosage levels comprising bottled water, pineapple and lime juice while the beverage for the treatment group additionally included a dissolved freeze-dried powder made from broccoli sprouts that contained glucoraphanin and sulforaphane. Urine and blood samples collected throughout the trial were tested to measure and compare air-pollution toxin levels excreted from the bodies of study participants from both groups.
The research team found that those receiving the broccoli-sprout beverage experienced an excretion rate of benzene 61 percent higher than the control group did, beginning the first day of the trial and continuing throughout the 12-week period. The rate of excretion of another airborne pollutant, the nose and throat irritant acrolein, “rapidly and durably” increased 23 percent for the treatment group, compared with the control group, during the course of the trial.
Further analysis by investigators found that sulforaphane may be protective by activating a signaling molecule, NRF2, which elevates a cell’s capacity to adapt to and survive a broad range of environmental toxins. “This strategy may also be effective for some contaminants in water and food,” the study concludes.
Particulate matter poses significant health risks to the public, especially fine particulates known as PM 2.5, which are so small that they are inhaled deep into the lungs. But a recent European study found that particulate matter, irrespective of particle size, contributes to lung-cancer incidence. Such particles include heavy metals, carcinogenic hydrocarbons and volatile organic chemicals that include benzene and aldehydes, which increase the risk of lung cancer.
Based on the study, broccoli provides a “frugal, simple and safe means” to reduce long-term health risks associated with pollution, the study states. Next the team plans to evaluate optimal dosage levels and consumption frequency of the broccoli sprout beverage in the same region of China.
“Dr. Kensler is a superb scientist and he has strong evidence that broccoli’s constituents can help detoxify carcinogens and toxins and enhance their elimination from the body,” said Gary Stoner, a professor at the Medical College of Wisconsin whose research focus includes cancer prevention. “This is excellent science.”
(c)2014 Pittsburgh Post-Gazette
Visit the Pittsburgh Post-Gazette at http://www.post-gazette.com
Distributed by MCT Information Services | chemistry |
https://www.articsteel.com/ | 2023-03-27T22:53:55 | s3://commoncrawl/crawl-data/CC-MAIN-2023-14/segments/1679296948708.2/warc/CC-MAIN-20230327220742-20230328010742-00007.warc.gz | 0.891064 | 264 | CC-MAIN-2023-14 | webtext-fineweb__CC-MAIN-2023-14__0__230657545 | en | Artic Steel Industries
We manufactured flange, elbow, tee, reduction, reducers, caps, cross, stub end/lap joint, forged fitting materials for oil and natural gas pipelines, refinery and petrochemical facilities, nuclear power and electricity production plants, refinement and extrication plants, dams and hydroelectric power plants and shipbuilding industry.
Artic Steel Industries has a capacity of fulfilling all the demands of the sector through the manufacture of carbon steel, stainless steel, alloy steel, high nickel alloys, Inconel, Monel, alloy 20, copper-nickel and specific steel groups.
We ensure that the quality standards are met. Hence, as per customers requirement, we supply products of standard quality after going through various checking, testing, inspection & certification process.
All the material used for Manufacturing of fittings are tested for chemical & mechanical properties. They are identified & fully traceable from raw material stage to final product.
The system controls the quality of all incoming materials as per the raw material test certificate. Randomly checking in each size for chemical and physical properties at Government approved laboratory.
Artic Steel maintains strict dimensional standards by inspecting and testing equipmentwith strict adherence to the quality manual. All our finished material is inspected for quality after the first piece of a production. | chemistry |
https://saferef.in/welding-vs-brazing-understanding-the-crucial-differences/ | 2023-09-29T20:36:40 | s3://commoncrawl/crawl-data/CC-MAIN-2023-40/segments/1695233510528.86/warc/CC-MAIN-20230929190403-20230929220403-00557.warc.gz | 0.890083 | 479 | CC-MAIN-2023-40 | webtext-fineweb__CC-MAIN-2023-40__0__182630953 | en | Welding: Melting the Base Metal Welding is a fusion process that involves melting the base metal of the components being joined, along with the addition of a filler metal. This creates a strong and permanent bond by essentially merging the materials together. During welding, heat is applied to the base metals until they reach their melting points, allowing them to mix and form a solid joint.
Key Points about Welding:
- Requires high temperatures to melt base metals.
- Filler metal is added to strengthen the joint.
- Typically used for joining similar metals.
- High heat input may cause distortion in thin materials.
Brazing: Preserving the Base Metal Integrity Brazing, on the other hand, is a process that doesn’t involve melting the base metal. Instead, it relies on capillary action to draw a filler metal into the joint interface, creating a strong bond without compromising the integrity of the base materials. The base metals remain solid during brazing, allowing for less heat stress and distortion.
Key Points about Brazing:
- Lower temperatures than welding, preventing base metal melting.
- Capillary action draws filler metal into the joint.
- Ideal for joining dissimilar metals.
- Reduces heat-related distortion, making it suitable for delicate materials.
Choosing Between Welding and Brazing:
The decision to use welding or brazing depends on several factors, including the type of materials, joint strength requirements, and the intended application. Welding is often preferred for heavy-duty applications where maximum joint strength is essential, but it may not be suitable for delicate or dissimilar materials due to the higher heat input.
Brazing, on the other hand, is an excellent choice for situations where the base metals have different melting points, or when minimizing heat-related distortion is crucial. It’s commonly used for applications like HVAC&R systems, jewelry, and electronics manufacturing.
In the ongoing debate of welding versus brazing, the key differentiator lies in the way they join metal components. Welding involves melting the base metal, while brazing relies on capillary action to draw in the filler metal without melting the base materials. Understanding these distinctions empowers you to make informed decisions when selecting the right joining method for your specific project, ensuring optimal results and durability. | chemistry |
https://allaboutyeast.mystrikingly.com/blog/guides-for-selecting-the-best-yeast-strain | 2022-05-22T08:41:48 | s3://commoncrawl/crawl-data/CC-MAIN-2022-21/segments/1652662545090.44/warc/CC-MAIN-20220522063657-20220522093657-00197.warc.gz | 0.949322 | 495 | CC-MAIN-2022-21 | webtext-fineweb__CC-MAIN-2022-21__0__27888881 | en | Whatever you are brewing will determine the type of yeast you will choose. Most of these yeast strains are named according to the purpose they are meant for, and thus it can be somehow easy for one to get the yeast strain they want. But at the same time, you should not be fully dependent on the name of the yeast; there are indicators which you must also look into. The factors below should be considered when selecting yeast. Click on this link for more.
Check the attenuation of the yeast. Your preference will determine the attenuation levels of the yeast you want to buy. The attenuation refers to the sugars that the said yeast can ferment. Hydrometers are used to measure the attenuation levels of the yeast. One should know that their beer style affects the yeast type they want and its attenuation percentage.
There are yeast strains which always drop to the bottom of the fermenter after fermentation. The degree to which the yeast cells drop to the bottom after clumping together is called flocculation. There are yeast strains which do not form these chunks but remain in suspension which means they have low flocculation. Such strains bring the necessity of refrigerating the beer to separate the yeast from the beer. It is therefore advisable to buy yeast strain which flocculates appropriately to meet the needs of your beer.
There are conditions under which a certain type of yeast can work properly. Alcohol levels can affect the performance of the yeast and therefore the need to check the alcohol tolerance of the yeast. One must, therefore, know the alcohol levels and thus select the yeast strain which can survive beyond this estimated alcohol levels which will prevent straining of the yeast when preparing beer. Discover more on this article.
Yeast work under a certain pressure. The temperature range is, therefore, another factor to be looked into. Look at the temperature levels under which a certain strain can work well. But the results of fermentation can be affected by the temperatures under which your yeast is working. You should, therefore, know the temperature range under which the yeast can work well. Know that the temperature levels will affect the flavor profile of your beer. Go for the yeast which can achieve your needs.
Source your yeast from the right stores. Go for the stores which are known to avail quality products. This will affect the outcome of your beer. Learn more here: https://en.wikipedia.org/wiki/Baker%27s_yeast. | chemistry |
http://www.winter-creation.com/en/like-leather/micropore/micropore/ | 2013-05-22T01:39:43 | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368701063060/warc/CC-MAIN-20130516104423-00097-ip-10-60-113-184.ec2.internal.warc.gz | 0.825017 | 249 | CC-MAIN-2013-20 | webtext-fineweb__CC-MAIN-2013-20__0__145332840 | en | Probably one of the most authentic Leather-like product, based on PU, for interior design. Wonderfully soft to touch. This imitation leather offers warm and pleasant seating comfort. It is easy to clean, economical and flawless. Just feel the sample and you will instantly be impressed by the superb properties of micropore®, that is flame retardant and extremely hard wearing, withstanding over 100,000 abrasion cycles and offering a hydrolysis resistance of 10 years. This together with good light- and colour fastness as well as resistance to alcohol makes micropore® durable and easy to disinfect.
· Premium category imitation leather
· Easy and economical workability
· Custom made requirements (structure and colour) can be supplied from only 500 metres
· Suitable for upholstering chairs, armchairs, benches, sofa, etc.
· Resstance to hydrolysis 10 years
· Minimum width 137cm
All the above data represents average values. Subject to changes. Test certificates available upon request.
|Rolls in m|
|Width in cm|
|Resistance to rubbing (dry)|
|Resistance to rubbing (wet)|
|Classification flame retardent| | chemistry |
http://www.europeana.eu/portal/en/record/9200104/B0F0850D1DACE35BB957B40B9DA5452AAD90AE09.html | 2017-02-23T16:26:23 | s3://commoncrawl/crawl-data/CC-MAIN-2017-09/segments/1487501171176.3/warc/CC-MAIN-20170219104611-00046-ip-10-171-10-108.ec2.internal.warc.gz | 0.891963 | 204 | CC-MAIN-2017-09 | webtext-fineweb__CC-MAIN-2017-09__0__120596654 | en | - Photomicrograph of thin section of agate/quartz crystal. Agate is a type of quartz found in a variety of rock but characteristically associated with volcanic rock. Due to the way in which they were formed, agate rock often displays either an regimented banding pattern - formed from the layers of siliceous deposits, or a fluid pattern formed from water containing silica and filling cavities within the molten mass. Agate is often used in ornamental items but due to its hardness and resistance to acid it has also been used historically to make pestles and mortars to crush and mix chemicals. Vibrant colours result from imaging with crossed polars.
- Sept 2010
First published in Europeana:
Last updated in Europeana:
Additional rights information
- Spike Walker, Wellcome Images
- Copyrighted work available under Creative Commons by-nc-nd 4.0, see http://wellcomeimages.org/indexplus/page/Prices.html | chemistry |
http://pacificiaq.com/other-air-quality-services | 2013-05-25T02:06:18 | s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368705318091/warc/CC-MAIN-20130516115518-00083-ip-10-60-113-184.ec2.internal.warc.gz | 0.92297 | 566 | CC-MAIN-2013-20 | webtext-fineweb__CC-MAIN-2013-20__0__37913446 | en | Other Air Quality Services
Real Estate Investigations
There’s a huge difference between a home inspector and an environmental consultant. Home inspectors play an important role in the buying and selling process, but they generally don’t have the education, training or experience to evaluate a home for mold.
The real estate industry has been begging for a low cost microbial investigation that’s both comprehensive and quick. Pacific IAQ now offers a real estate package that includes the microbial investigation, where we inspect the property for visible evidence of water intrusion and microbial growth, as well as air sampling. The real estate package is identical to our standard mold investigation, without the remediation map or protocol. If at some point your buyer would like to have a protocol, we can provide everything they need.
Volatile Organic Compounds (VOC’s)
Indoor air quality (IAQ) professionals are challenged with selecting the appropriate indoor sampling and analysis methods. Indoor air can be very complex, with up to 300 individual volatile organic compounds (VOCs) comprising a typical indoor air sample. Many VOCs are typically found in indoor air and their sources include building materials, furnishings, floor coverings, wall coverings, paints and stains, copiers and printers, and outdoor air.
Pacific IAQ offers VOC analysis methods based on USEPA protocols. Using a mass spectral database of more than 120,000 individual compounds. Pacific IAQ can provide the following analysis:
- Total VOCs with All Individual VOCs
- Total VOCs with Top 20 Individual VOCs
- Microbial VOCs (MVOCs)
Mycologists traditionally rely on direct microscopic examination to quantify and identify mold in air and surface samples. Speciation of molds is a skilled and labor-intensive task, even for the most experienced mycologists, and the “human element” can be subjective.
The traditional spore-trap analysis provides quantitative and qualitative analysis to the genus level (ex. Fusarium sp.) but cannot distinguish between Aspergillus and Penicillium.
Research conducted at the US-EPA's National Exposure Research Laboratory has provided an alternative to traditional microscope-based analysis. Quantitative real-time PCR (qPCR) is a fast and accurate DNA-based analytical method for identifying and quantifying molds to the species level.
qPCR has a limit of detection (LOD) of one spore per sample, but can still accurately quantify millions of spores per sample. In the instance of water intrusion, accurate and rapid speciation and measurement are crucial to an effective risk assessment. qPCR analysis provides quantitative and qualitative analysis down to the species level (ex. Aspergillus niger). | chemistry |
https://www.heico-nails.com/en/news/details/improvement-of-the-corrosion-resistance-of-heico-lock-stainless-steel-wedge-lock-washers/ | 2023-12-03T16:26:20 | s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100508.42/warc/CC-MAIN-20231203161435-20231203191435-00559.warc.gz | 0.896631 | 141 | CC-MAIN-2023-50 | webtext-fineweb__CC-MAIN-2023-50__0__14376456 | en | Improvement of the corrosion resistance of HEICO-LOCK® stainless steel wedge lock washers
The corrosion resistance of HEICO-LOCK® Wedge Lock Washers made from stainless steel has been considerably increased by an optimization of our internal processes.
In neutral salt spray tests according to DIN EN ISO 9227, the HEICO-LOCK® stainless steel wedge lock washers withstood at least 1,200 hours.
A corrosion quick test as part of the incoming goods inspection process also ensures consistent, high delivery quality.
Coating systems with a corrosion resistance of at least 1,000 hours are also available on request for HEICO-LOCK® Wedge Lock Washers made from steel. | chemistry |
http://www.sgplywood.com/epoxy-fiberglass-cloth-customized-parts/57719020.html | 2020-10-21T18:49:33 | s3://commoncrawl/crawl-data/CC-MAIN-2020-45/segments/1603107877420.17/warc/CC-MAIN-20201021180646-20201021210646-00151.warc.gz | 0.88089 | 885 | CC-MAIN-2020-45 | webtext-fineweb__CC-MAIN-2020-45__0__180712274 | en | |Payment Type:||L/C,T/T,D/P,Paypal,Money Gram,Western Union|
|Terms of Trade:||FOB,CFR,CIF,EXW,FCA|
|Min. Order:||1000 Kilogram|
|Delivery Time:||15 Days|
|Place of Origin:||China|
|Supply Ability:||500 tons / year|
Epoxy Glass Cloth Insulation Sheet
Epoxy Fiberglass Part is woven fiberglass soaked in an epoxy resin and then compressed and baked. It is very dense, lightweight, and impervious to water. The advantages of this material:
Strong, stiff, tough and durable
Excellent dielectric strength
Heat and water resistant
Corrosion and chemical resistant
Good mechanical strength
Excellent wear properties
Good dimensional stability
Low moisture absorption
Excellent creep resistance
JY Machinery has sufficient stock of the fiberglass epoxy sheet due to its widely applications, to meet fast delivery for our clients
This product is a customized product, not a spot product. If you need a spot, please purchase this connection.
Regular thickness: 0.1mm--50mm, please contact me if you need other thickness or other dimensions (in addition, you can set the thickness of 50MM-150MM, you need to provide design drawings)
The 3240 epoxy laminate has a smooth surface, no air bubbles, no pits and wrinkles, but allows for other defects that do not affect the use, such as: scratches, indentations, stains and small spots. The edges should be cut neatly and the end faces must be free of delamination and cracks.
Executive standard: GB/T1303.1-1998.
Temperature rating: Class B
Color: natural (yellow), green, etc.
Characteristics: The cured epoxy resin system has excellent mechanical properties, high strength at medium temperature, and good electrical stability under high humidity.
Electrical: The cured epoxy resin system is an excellent insulating material with high dielectric properties, surface leakage resistance and arc resistance.
Uses: Suitable for mechanical, electrical, electronic, electrical and other fields. Also used for the processing of insulating parts, processing into various types of insulating parts and equipment insulation structural parts.
The reaction of the epoxy resin and the curing agent used is carried out by a direct addition reaction or a ring-opening polymerization reaction of an epoxy group in a resin molecule, without the release of water or other volatile by-products. They exhibit very low shrinkage (less than 2%) during curing compared to unsaturated polyester resins and phenolic resins.
Yingkou Dongyuan Electrical Insulation Wide Plate Co., Ltd. is located in China (Liaoning) Free Trade Pilot Zone. The factory covers an area of 17,000 square meters, with more than 100 employees and fixed assets of 40 million yuan. The company's main products are: Electrical Laminated Wood, insulation boards (3240 epoxy board, 3021 cardboard, 3025 cotton cloth board, 9309 low dielectric loss cardboard Etc.), laminated wood insulation parts (compression rings, clips, round rods, screw nuts, pads, pallets, support frames, fasteners and other finished products in various shapes) and other insulating materials. It owns 32 sets of main production equipment including 8000 ton press, 6000 ton press, 5000 ton press, gluing machine, etc. After many years of hard work, the company has completed the original accumulation and the equipment renovation, and has newly developed the nation's largest board ( 4000mm × 2000mm, 3000mm × 1500mm, 2700mm × 2700mm ...), filling the domestic gap and setting a record for the large format of the insulation board. Its products have passed the national ISO quality management system certification and have the only large-scale all-metal detector in China. The products are applied to various power distribution systems and components such as transformers, switch cabinets, and motors. The company adheres to the credibility of the first, quality first, continues to work on the development of insulation materials products, consolidate the leading position in the market, and strive to provide users with the best service. | chemistry |
http://www.vitaminworld.com/vitamin-c-hyaluronic-acid-0070040347.html?cgid=SHOPBYBRAND_WHITEEGRET | 2017-11-21T19:34:34 | s3://commoncrawl/crawl-data/CC-MAIN-2017-47/segments/1510934806422.29/warc/CC-MAIN-20171121185236-20171121205236-00738.warc.gz | 0.708069 | 372 | CC-MAIN-2017-47 | webtext-fineweb__CC-MAIN-2017-47__0__8656164 | en | Vitamin C Hyaluronic Acid
Vitamin C Hyaluronic Acid contains over 72 ionic sea minerals to firm, exfoliate, brighten and protect skin. Formulated with Vitamin C and sea minerals to hydrate and firm the skin's surface and beautify the skin. Apply over face and neck in the morning before applying makeup. Apply in upward motion until cream is absorbed into the skin.
GMO-free, paraben-free, gluten-free, sulfate-free, cruelty-free, and 100% vegan.
2 oz. cream.
Manufactured by: White Egret
Directions: Apply Vitamin C Hyaluronic Acid over face and neck in the morning before applying makeup. Apply in an upward circular motion until absorbed into the skin. Formulated with Vitamin C and sea minerals from ConcenTrace to hydrate and firm the skin's surface and beautify the skin.
Ingredients: Water (Aqua), Sodium Ascorbyl Phosphate (Vitamin C), Capric/Caprylic Triglyceride, Carthamus Tincotrius (Safflower) Oil, Cetyl Alcohol, Glycerin, Stearyl Alcohol, ConcenTrace Mineral Complex Blend, Xanthan Gum, Panthenol, Allantoin, Cetearyl Glucoside, Glyceryl Stearate, Glyceryl Stearate SE, Glyceryl Stearate Citrate, Tocopheryl Acetate (Vitamin E), Sodium Hyaluronate, Aloe Barbadensis Leaf Extract, Retinyl Palmitate (Vitamin A) Potassium Sorbate, Caramel, Phenoxyethanol, Ethylexylglycerin, Citrus Aurantifolia (Lime) Oil. | chemistry |
http://www.vulcorp.com/ | 2017-04-25T00:49:35 | s3://commoncrawl/crawl-data/CC-MAIN-2017-17/segments/1492917120001.0/warc/CC-MAIN-20170423031200-00037-ip-10-145-167-34.ec2.internal.warc.gz | 0.941705 | 118 | CC-MAIN-2017-17 | webtext-fineweb__CC-MAIN-2017-17__0__202088618 | en | Vulcan Corporation: Rubber and Foam Products
Vulcan Corporation is a rubber and foam manufacturing facility housing 272,000 square feet of manufacturing space with a total mixing capacity exceeding 50,000,000 pounds annually. Located in Clarksville, Tennessee, we are committed to product quality, on-time delivery, superior customer service and competitive pricing. Follow the links on the left to learn more about what we can do to meet your rubber and foam product needs.
Vulcan's on-site research and testing laboratory is a U.S. Government approved rubber testing facility. | chemistry |
https://www.genetrack.ca/estradiol/ | 2023-12-06T02:15:20 | s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100575.30/warc/CC-MAIN-20231206000253-20231206030253-00402.warc.gz | 0.808634 | 842 | CC-MAIN-2023-50 | webtext-fineweb__CC-MAIN-2023-50__0__313702152 | en | Test ID: A858
Estradiol (E2) is a hormone naturally produced in both genders, with much higher levels in females. Estradiol is essential for female reproductive health, and also plays important functions in the male reproductive system, skeletal system, skin health, nervous system, and cardiovascular system. Abnormal estradiol levels can affect fertility, sex drive, muscle and bone mass, growth, and skin health.
How to order a test
What is Included?
Measurement of estradiol levels by chemiluminescent microparticle immunoassay.
1 – 3 business days
The turnaround time is not guaranteed. The average turnaround time is 1 – 3 business days from the date that the sample arrives at the laboratory. Shipping time for the sample is not included. Additional time is required if the case requires confirmatory or reflex testing, or if the sample is insufficient, or if a recollection is required.
Additional Information and Resources
Fertility testing in females: Samples should be collected on the third day of the menstrual cycle (third day of menstruation) for optimum results.
Preparation Before Specimen Collection
50 μL in a microtainer
Microtainer (regular blood tube)
This test requires a blood sample from a finger prick. All supplies for sample collection are provided in the kit.
- First wash and dry hands. Warm hands aid in blood collection.
- Clean the finger prick site with the alcohol swab and allow to air dry.
- Use the provided lancet to puncture the skin in one quick, continuous and deliberate stroke.
- Wipe away the first drop of blood.
- Massage hand and finger to increase blood flow to the puncture site. Angle arm and hand downwards to facilitate blood collection on the fingertip.
- Drip blood into the microtainer tube.
- Dispose of all sharps safely and return sample to the laboratory in the provided prepaid return shipping envelope.
NOTES: Avoid squeezing or ‘milking’ the finger excessively. If more blood is required and blood flow stops, perform a second skin puncture on another finger. Do not touch the fingertip.
Maintain specimen at temperatures between 2°C and 30°C during storage and transport.
Blood samples can be refrigerated or kept at room temperature for up to 7 days.
Causes for Rejection
- Incorrect or incomplete patient identification
- Incorrect specimen collection
- Inappropriate storage and transport conditions
- Incorrect specimen volume
To measure estradiol levels in a blood sample to aid in the investigation of fertility and hormonal changes around menopause, for the support of in vitro fertilization, and to aid in the investigation of hormone levels in males.
- This report is not intended for use in medico-legal applications.
- These results should be interpreted in conjunction with other laboratory and clinical information.
- Correct specimen collection and handling is required for optimal assay performance.
- Assay interference may occur in specimens from individuals routinely exposed to animals or to animal serum products. Additional clinical or diagnostic information may be required for these specimens.
- Estradiol results obtained from different assay methods cannot be used interchangeably in serial testing.
- Estradiol levels fluctuate throughout each menstrual cycle in reproductive age females, so the timing of sample collection may influence the interpretation of the estradiol level.
Chemiluminescent microparticle immunoassay (Alinity i Estradiol assay)
Normal menstruating females
– Follicular phase: 20 – 350 pg/mL
– Mid-cycle: 150 – 750 pg/mL
– Luteal phase: 30 – 450 pg/mL
Postmenopausal females: ≤ 20 pg/mL
Males: 10 – 50 pg/mL
These reference ranges were obtained from Pagana KD, Pagana TJ, Pagana TN. Mosby’s Diagnostic & Laboratory Test Reference. 15th ed. St. Louis, Mo: Elsevier; 2021. | chemistry |
http://www.energyglobe.info/awards/details/awdid/7667/ | 2018-03-23T04:49:10 | s3://commoncrawl/crawl-data/CC-MAIN-2018-13/segments/1521257648178.42/warc/CC-MAIN-20180323044127-20180323064127-00243.warc.gz | 0.953224 | 269 | CC-MAIN-2018-13 | webtext-fineweb__CC-MAIN-2018-13__0__53805983 | en | Submitted by: Subsea Industries
Implemented country: Belgium
Title: Ecospeed coating for ship hulls
Ecospeed is an environmentally friendly, economically viable, non-toxic coating for ship hulls. Most ships in the world constantly leach poisons into the water from the paint that is applied to their hulls. This kills marine life and prevents it from attaching to the hull – so increasing the ship’s speed. However, it has untold consequences for the marine environment and as toxic paint quickly deteriorates it needs to be repainted every 2-5 years. Ecospeed is 100% environmentally friendly. The coating will last the lifetime of the vessel, around 25 years, and is guaranteed for 10. Repainting the ship’s hull every few years will be completely eliminated (and also prevent the toxic waste generated when old noxious paints are removed and new layers applied every few years). In addition, Ecospeed improves the ship’s hydrodynamic properties, which in turn cuts fuel consumption by up to 10% (and therefore also reduces CO2 and other atmospheric emissions). Furthermore, this coating provides a high level of corrosion protection and thus reduces expensive maintenance costs. Financial and ecological benefits go hand in hand making this a viable solution to a major problem in the shipping world. | chemistry |
https://garterblue.com.au/what-is-the-difference-bicarb-soda-baking-powder/ | 2021-06-13T19:52:06 | s3://commoncrawl/crawl-data/CC-MAIN-2021-25/segments/1623487610841.7/warc/CC-MAIN-20210613192529-20210613222529-00418.warc.gz | 0.945962 | 820 | CC-MAIN-2021-25 | webtext-fineweb__CC-MAIN-2021-25__0__96892833 | en | What are they and can I substitute one for the other?
You will often see Bicarb soda as an ingredient in baked products and often bakers wonder if it is the same as Baking Powder, Bicarbonate of Soda or Baking Soda. Let me shed a bit more light on this to reduce the confusion.
So what is Bicarb Soda?
It is the shortened nick-name for Sodium Bicarbonate and is also commonly known as Baking Soda, Sodium Bicarb, Bicarb and Bicarbonate of Soda. It is not the same as Baking Powder – I will discuss this further in this post.
It is known as Food additive E500.
Baking uses Bi Carb Soda:
Bi Carb Soda is widely used as a leavening agent when baking where it creates bubbles when it reacts with wet acidic ingredients. This causes the rising of cake, bread and pancake batters as carbon dioxide is released. The acidic ingredients that react with bicarb soda are lemon juice, vinegar, yoghurt, cream of tartar, cocoa, pumpkin, honey and buttermilk.
Bi carb soda also reacts to heat as a raising agent, producing carbon dioxide above 80°C (180°F) but when used in this way by itself, can create a soapy taste if too much is used and produce a yellow coloured product. Bi Carb soda creates a unique texture that cannot be achieved with baking powder so it has specific uses in certain types of recipes.
Always sift bicarb soda before adding to your recipe as it can difficult to measure exactly as it can become lumpy due to any exposure to moisture.
So what is Baking Powder?
Baking Powder is also a raising agent for baking. It contains approx. 30% bicarb soda and is combined with acids, cream of tartar and cornflour, which activated with water acts as a raising agent without further liquid acids being added to the recipe.
How do I make my own or substitute:
- Make your own Baking Powder – by mixing 2 parts cream of tartar with 1 part bicarb soda.
- Substitute 2 -3 teaspoons of baking powder for 1 teaspoon of Bicarb soda in recipes.
TIP: If you use this substitute for Baking Powder, it will activate as soon as it comes into contact with wet ingredients and will need to be mixed into your mixture immediately.
HOW DO I STORE IT?
Store both Bicarb Soda and Baking Powder in a dry, cool place. Bicarb can last for a very long time where as Baking powder last up to a year. Always check the use by dates on the containers before using.
HOW TO TEST IF THEY ARE STILL GOOD TO USE?
Bicarb Soda – Mix a little with vinegar and if it bubbles it is still fresh enough to use. Do this carefully over the sink as it can cause quite a foaming reaction.
Baking Powder – Mix with a little water. It will become foamy if fresh enough to use. Otherwise throw them out.
OTHER USES for Bi Carb Soda:
Bicarb soda is often used to tenderize meats and can be added to crumbing for fried foods to enhance crispiness and reduce the crumbs from cimg away from the meat in the frier.
I have used Bicarb soda for many years to clean and reduce musty smells as well as an emergency deodorant when I’ve run out or forgotten to use any.
There are so many other non cooking uses for bicarb soda such as unclogging drains, getting crayon marks off walls, scuff marks off floors, there are just too many to go through here. I will aim to do another post on those soon.
Sources for inspiration: Wikipedia; Best Recipes.com.au; realsimple.com; thespruceeats.com; ThoughtCo.com | chemistry |
https://nutrition10.com/2023/09/15/how-to-have-softer-towels-whiter-garments-and-better-smelling-vinegar/ | 2024-02-27T09:12:56 | s3://commoncrawl/crawl-data/CC-MAIN-2024-10/segments/1707947474674.35/warc/CC-MAIN-20240227085429-20240227115429-00199.warc.gz | 0.865809 | 439 | CC-MAIN-2024-10 | webtext-fineweb__CC-MAIN-2024-10__0__18748950 | en | The Amazing Benefits of Vinegar in Your Laundry:
Reviving Colors: Ever noticed how some clothes lose their vibrant look after a few washes? Vinegar dives deep into fabric fibers, removing the grime and making colors pop again.
Detergent’s Best Friend: Just a 100 ml addition of vinegar can amplify your detergent’s cleaning prowess.
Mother Nature’s Fabric Softener: Avoid the chemicals in store-bought softeners. Pour a bit of vinegar in your washing machine’s fabric softener compartment for soft-as-a-cloud clothes. And no, your clothes won’t smell like salad; they’ll have a fresh, light scent instead.
Banish Those Sweat Stains: Those pesky underarm stains on shirts? Vinegar’s acidity tackles them with ease. Soak affected garments in warm water with a glass of vinegar before a regular wash.
Goodbye, Residue: That annoying detergent build-up in your clothes and machine? A 150 ml splash of vinegar during your wash cycle keeps it at bay.
Smelly Clothes, No More: Vinegar acts as a natural deodorant for your garments, neutralizing unpleasant odors.
Tackling Tough Stains: For those challenging stains, let your clothes soak overnight in a warm water bath with 250 ml of white vinegar. Come morning, they’ll be ready for a regular wash and those stains? History!
Pet Lover’s Dream: Cuddling with pets is great until you’re covered in fur. Washing affected clothing with vinegar helps detach both lint and pet hair.
Plush Towels: Ditch the store softeners for your towels; they’ll just make them stiff. Instead, let vinegar soften them up while adding a fresh scent.
So, next time laundry day rolls around, let vinegar be your secret weapon. Whether it’s making colors vibrant, softening fabrics, or tackling stains, this natural powerhouse has got you covered. Your clothes (and the environment) will thank you! | chemistry |
https://ancestorsdreamapothecary.com/products/cloves | 2024-04-12T17:49:58 | s3://commoncrawl/crawl-data/CC-MAIN-2024-18/segments/1712296816045.47/warc/CC-MAIN-20240412163227-20240412193227-00190.warc.gz | 0.938579 | 155 | CC-MAIN-2024-18 | webtext-fineweb__CC-MAIN-2024-18__0__133269560 | en | Sale Sold out
Regular price $2.35 USD
Regular priceUnit price per
Clove is a spice obtained from the calyx of the undeveloped blossoms of a species of myrtle tree indigenous to the Indonesian Maluku Islands, also known as the Spice Islands. Along with cinnamon, nutmeg and other aromatic spices, clove is used to lend sweet and spicy flavor to various baked goods and beverages.
As a cosmetic ingredient, clove provides antiseptic and anti-inflammatory qualities due to the presence of a phenolic compound called eugenol. This compound is a common ingredient in many personal care products, including mouthwash, toothpaste and soap. | chemistry |
https://www.appliancesforhome.us/pools-hot-tubs-supplies/technichlor-110-combo-spa-saltwater-system-chlorine-generator-high-purity-pool-salt-seaklear-phosphate-remover-and-leisure-time-renew-non-chlorine-shock.html | 2021-05-16T13:12:56 | s3://commoncrawl/crawl-data/CC-MAIN-2021-21/segments/1620243991269.57/warc/CC-MAIN-20210516105746-20210516135746-00103.warc.gz | 0.873987 | 503 | CC-MAIN-2021-21 | webtext-fineweb__CC-MAIN-2021-21__0__59310007 | en | The TechniChlor 110 has been specifically designed as a spa chlorine generator and takes into account the higher water temperature and smaller water volume. The TechniChlor is portable and an easy to use electronic chlorine generator that automatically sanitizes spa and hot tub water by converting skin softening saltwater into sanitizing chlorine. This eliminates the time and need to store and pour traditional liquid or tablet sanitizing products. There are no buttons, no moving parts, no separate control boxes or timers. Simply program each model to one of ten chlorine generation power levels based on spa size and usage. Product installation is simple and requires no equipment modification.
SeaKlear Spa Phosphate Remover is an easy-to-use technology for clean and efficient phosphate removal. High phosphates in spas and hot tubs can interfere with the proper operation of chlorine and bromine generators.
Use 1.5 pounds of pool salt per 100 gallons of spa water to achieve a 2000 ppm salt level. All ControlOMatic spa chlorine generators recommend a 1500 to 2000 PPM salt level, that is about 5.5% the salt that is in the ocean.
The Insta-TEST 4 pool and spa strip measures Free Chlorine, Bromine, Total Alkalinity, pH, and Total Hardness. This test strip is a dip-n-read strip with instant results. Each bottle includes 50 test strips packaged in a waterproof PopTop bottle with a hinged cap. The Insta-TEST 4 strip is ideal for spa owners who need the most critical tests for perfect water balance.
Renew Spa Shock is a fast-dissolving granular non-chlorine shock treatment that works instantly, with only minutes of spa down time! Rids spa water of residual soaps, deodorants, natural oils and organic materials that can build up in spa water.
AquaChek White strips will give you a specific reading of the salt level in your water, includes 10 tests.
Spa and Hot Tub Chlorine Generator, Around The Clock Chlorine Production
10 Levels of Chlorine Production built in, no external timers needed!
Self Cleaning Reverse Polarity Technology, Lowers spa and hot tub maintenance
Includes 8 Pounds high purity pool salt, enough for 600 Gallon Spa and AquaChek salt test strips
Includes Chlorine free shock, phosphate remover and Taylor Insta-Test 4 with 50 tests | chemistry |
https://coinreport.net/ambrosus-trek-therapeutics-partner/ | 2024-02-25T11:00:15 | s3://commoncrawl/crawl-data/CC-MAIN-2024-10/segments/1707947474595.59/warc/CC-MAIN-20240225103506-20240225133506-00822.warc.gz | 0.92439 | 611 | CC-MAIN-2024-10 | webtext-fineweb__CC-MAIN-2024-10__0__202837765 | en | Ambrosus, Trek Therapeutics partner to track quality in pharmaceutical manufacturing via blockchain-powered method
Ambrosus, a Swiss-based blockchain ecosystem for global supply chains, and Trek Therapeutics, PBC (Trek), a US-based private, clinical stage public benefit corporation developing treatments for serious infections with the aim to make them affordable for global populations, announced in a joint press release CoinReport received a partnership under which Ambrosus will apply integrated sensors together with blockchain-based technology to pharmaceutical drug manufacturing in Trek’s clinical development program.
Uniting blockchain and high-tech sensors, and powered by smart contracts, Ambrosus is developing the world’s first publicly-verifiable, community-driven ecosystem to ensure the origins, safety and quality of vital products, such as food, medicine and commodities. Ambrosus will carry out pilot projects with Trek to monitor the integrity, safety and quality of all stages of the pharmaceutical manufacturing process.
“Currently the pharmaceutical manufacturing process is highly regulated by pharmaceutical manufacturers and by regulatory authorities in an extremely labor-intensive and expensive manner,” said Trek co-founder and CEO Dr. Ann Kwong in the press release we received. “We hope to partner with Ambrosus to create a continuous monitoring and tracking system that will be less labor intensive, less expensive, and more transparent to all parties with a stake in quality pharmaceutical manufacturing. Our goal is to develop a system that is robust enough that Trek can submit data to support our manufacturing application for regulatory approval of our drugs from the FDA and EMA authorities.”
She added, “Additionally, patients currently have no way to ascertain the quality of the medicines they ingest. Trek believes it is important to be able to demonstrate to patients that while our drugs are affordable, they’re also of the highest quality.”
Ambrosus co-founder and CEO Angel Versetti stated, “Following the successful implementation of the Ambrosus protocol in global food supply chains, we are delighted to now apply our blockchain protocol to help ensure the quality, safety and integrity of another vitally important product – pharmaceuticals.”
The pilot projects will involve Ambrosus’ protocol working to track and verify the whole manufacturing chain from the primary chemical starting materials through various stages of synthesis, purification and verification of the active pharmaceutical ingredient (API). This will be followed by formulation of the API into drug product; packaging, labeling, storage and shipping to clinical trial sites.
“Backed by a superb core team of developers, advisors, and researchers, Ambrosus’ protocol will provide the transparency necessary in our manufacturing process to help ensure the integrity of supply chains. With our commitment to providing affordable high quality medicine, we believe this partnership could revolutionize the pharmaceutical industry quality control of manufacturing at every stage from plant to patient,” Dr. Kwong said.
MA Avenue/Central Square – Lyo (CC BY-SA 3.0) | chemistry |
https://hempculture.com.au/products/langbenite | 2020-04-06T14:05:46 | s3://commoncrawl/crawl-data/CC-MAIN-2020-16/segments/1585371637684.76/warc/CC-MAIN-20200406133533-20200406164033-00042.warc.gz | 0.9449 | 318 | CC-MAIN-2020-16 | webtext-fineweb__CC-MAIN-2020-16__0__126823270 | en | Langbeinite is a fantastic addition to your nutrient teas, covering almost all soil cations when used in conjunction with our Oyster Shell Flour, as well as the perfect option to balance your soil mix if you are using heavy Nitrogen and Phosphorus amendments like guano and blood & bone.
What is Langbeinite?
Langbeinite is a naturally occurring crystalline mineral that contains three vital plant nutrients. It does not effect the acidity of the soil and is pH neutral.
Potassium is essential for the development of flowering plants, as well as for increases in the plants ability to uptake and utilize CO2, which is critical during stages of growth.
Magnesium is at the heart of every chlorophyll molecule, as well as vital for the shuttling of macronutrients around the plant with calcium. Plants often like a slow sustained source of magnesium and not large bursts (which can occur when using Cal-Mag solutions). Langbeinite is a great source of sustained magnesium release that won't cause lock out issues like dolomite can.
Sulfur is one of the most understated nutrients you need to be giving your plants. It aids in immune protection, enzyme synthesis, antioxidant generation and most importantly flavour and terpene production. The addition of extra sulfur through langbeinite is a perfect way to complement your garden from an already amazingly rounded product.
Langbeinite has an approximate N-P-K-S-Mg value of 0-0-22-22-18. | chemistry |
https://blog.wren.co/posts/what-does-global-warming-potential-tell-us-about-greenhouse-gases | 2023-12-09T04:45:48 | s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100800.25/warc/CC-MAIN-20231209040008-20231209070008-00339.warc.gz | 0.934483 | 1,483 | CC-MAIN-2023-50 | webtext-fineweb__CC-MAIN-2023-50__0__298270652 | en | Perfluorotributylamine, or PFTBA for short, is the main ingredient in fake blood, and is also used in certain refrigerants. Humans have been synthesizing this material for decades, but it was only in 2013 that scientists discovered PFTBA was a greenhouse gas. And not just any greenhouse gas. It is 7,000 times more potent than carbon dioxide.
That means PFTBA has incredibly high "global warming potential"—the highest of any known compound. This simple measure helps us compare, pound for pound, different gases and how they contribute to global warming. Because so much of climate change policy uses this measure, it's an important concept to understand.
📚 Jump to section:
What is global warming potential?
Global warming potential (GWP) is a measure of a gas's greenhouse effect. To understand GWP, then, you must first understand the greenhouse effect.
The earth is constantly emitting heat. Some escapes through the atmosphere into space. Some is absorbed by greenhouses gases, which re-broadcast the heat in all directions, thereby driving up the temperature on earth. (For a more complete explanation of the greenhouse effect, see our post on the topic.)
GWP considers how much heat each gas absorbs, which helps us understand its effect on global warming.
Global warming potential considers how much heat each gas absorbs. A gas's global warming potential is always expressed as a comparison to carbon dioxide, the most common greenhouse gas.
To give one example, the GWP of methane (also known by its chemical formula, CH4) is, in certain circumstances, 86. That means a pound of CH4 can absorb 86 times more heat than a pound of CO2.
Because CO2 is the baseline, its GWP is always 1. While it is possible to be a greenhouse gas that is less powerful than carbon dioxide—to have a GWP less than 1—almost every other greenhouse gas is worse than CO2 on a pound for pound basis. Fortunately, powerful gases like PFTBA make up on a very, very tiny portion of the atmosphere.
The importance of time
Gases vary not just in terms of how much heat they absorb, but also how long they stay in the air. CO2 persists as long as 200 years. CH4, on the other hand, disappears from the atmosphere after just 12 years. This, too, affects how much a gas contributes to global warming: Once it drops out of the atmosphere, a gas is no longer trapping heat.
It will help to make this concrete. Say that right now we emit one ton of CO2 and one ton of CH4. Over the next twelve years, the CH4 will do a lot of damage—but then it will react with other materials, breaking down, and therefore no longer be present to absorb heat. Meanwhile, most of the CO2 is still up there, steadily contributing to warming.
After 20 years, though the CH4 has disappeared, still in total it has absorbed 84 times more heat than the CO2. That means its GWP after 20 years (often expressed as GWP20) is 86. After a hundred years, the carbon dioxide has caught up slightly, though it is far from closing the gap. Methane's GWP over a 100-year time horizon (GWP100) is 34—that is, over that 100-year period, the ton of CH4 has absorbed 34 times more heat than the ton of CO2. It just did it all in the first 12 years!
What is carbon-climate feedback?
GWP gets even more complicated: as the temperature of the atmosphere changes, so too does each gas's effects.
This is due to the carbon cycle. The ocean is always removing some of the atmosphere's carbon, but as the world warms, the rate of removal decreases. This creates a feedback loop: more carbon means more heat, which means slower removal, which means more carbon sticks around, so there is more heat—and so on.
Every greenhouse gas adds to a feedback loop, which slows the rate of carbon removal. This, too, can be factored into GWP.
Other greenhouse gases add to this feedback loop, too. More methane means more heat—and so methane also slows down carbon removal. This is called "carbon-climate feedback." If you incorporate this effect into GWP, the numbers have to increase. You are accounting, basically, for the extra carbon that winds up staying the atmosphere due to your methane emission.
What are the GWPs of various common greenhouse gases?
The table below shows the GWP of five major greenhouse gases: methane, nitrous oxide (also known as laughing gas), and three common refrigerants. We've chosen to show just GWP100, since this is the figure most frequently used when setting climate-change policies.
"Lifetime" indicates how long each gas lasts in the atmosphere, measured in years. For each gas, we've first indicated the GWP without carbon-climate feedback. The second number, in red, includes carbon-climate feedback.
|Greenhouse gases||Lifetime||GWP100||GWP100 (w/ cc feedback)|
Calculating GWP requires some laboratory testing, and over time, with more studies, scientists refine the numbers. When it comes to policy, though, updates can be problematic: it's hard to update old laws each time a new number is calculated. For almost two decades beginning in 1997, despite scientific updates, the numbers included in the Intergovernmental Panel on Climate Change's second assessment report remained the standard for United Nations policy. Those numbers were officially updated in 2013. Today, the UN uses the above numbers, which are included in the IPCC's latest report.
What is carbon dioxide equivalent?
The point of GWP is to allow comparisons between gases. It allows us to determine how, say, 0.5 tons of CH4 compares to 10 tons of CO2.
Often, though, we are interested in not comparing but reporting emissions—and GWP allows us to report various kinds of emissions with one single number. To do so, we have to convert all emissions to what's called "carbon dioxide equivalent."
Often shortened to CO2e (or sometimes CO2eq or CO2-e), carbon dioxide equivalent captures the overall impact of a group of gases, expressed in terms of how much CO2 would have the same impact. The calculations are simple: you just multiple the weight of each gas by its GWP.
Once more, let's make this concrete. If we wanted to quantify the total impact of 0.5 tons of CH4 and 10 tons of CO2, we first need to convert the methane into tons of CO2e:
We already know 10 tons of CO2 is 10 tons of CO2e, so now we just need to add the two:
This is one kind of calculation that goes on behind the scenes in our own carbon footprint calculator! We consider many sources of emissions, and roll them into one number that allows you to more clearly understand your overall impact.
Read this next:
How does carbon capture work?
July 13, 2020 · Climate knowledge | chemistry |
https://austroads.com.au/webinars-and-events/webinar-properties-of-general-purpose-cement-with-increased-percentages-of-limestone | 2019-11-20T09:13:10 | s3://commoncrawl/crawl-data/CC-MAIN-2019-47/segments/1573496670535.9/warc/CC-MAIN-20191120083921-20191120111921-00432.warc.gz | 0.954912 | 574 | CC-MAIN-2019-47 | webtext-fineweb__CC-MAIN-2019-47__0__173434443 | en | Date: Tuesday, 15 October 2019
Location: Online, 12:30pm AEDT
This webinar will give you an overview of an Austroads project that investigated whether cements with elevated limestone content would perform satisfactorily in ambient-cured and precast concretes subjected to aggressive exposure conditions.
The project investigated whether the currently used Australian general-purpose (GP) cement which complies with AS 3972, and which may contain up to 7.5% limestone as a mineral addition, could be replaced with a cement proposed by the cement industry, which would contain 12% limestone, could be justified with respect to performance and durability.
Following a literature review, the project compared the properties of concretes made with a GP cement, containing 2.9% limestone with those of corresponding concretes incorporating the cement with 12% limestone. Both plain cement concretes and concretes incorporating cement blended with fly ash and slag were tested. As the cement industry declined to provide the cements required for this research, two equivalent cements were imported from Canada, designated general use (GU) cement, with 2.9% limestone content, and general use limestone (GUL) cement, with 10% limestone content (increased to 12% in the laboratory).
Physical, mechanical, chemical and microstructural aspects of both concretes were examined.
The study concluded that it would be highly inadvisable to entirely replace the currently used Australian GP cements, made to comply with AS 3972:2010 with up to 7.5% limestone, with the cement proposed by the industry that would contain 12% limestone, without the option of cements of lower limestone content being readily available in the in the market to all users.
Join in a live Q&A with our expert panel to have your questions answered.
Presented by Ahmad Shayan and Fred Andrews-Phaedonos
Dr Ahmad Shayan is the Director at Concrete Analytics Pty Ltd. He has 40 years of research and consulting experience, gained at CSIRO and ARRB, and has written over 200 published papers in the international scientific media, and 350 technical reports for clients. He previously chaired the Standards Australia Committee CE/12 for over 10 years. Ahmad’s areas of interest include concrete materials assessment and durability of concrete structures, for which he was awarded the prestigious Clunies Ross Medal in 2003. Ahmad was the author of the Austroads report.
Fred Andrews-Phaedonos is a Principal Engineer-Concrete Technology at Department of Transport, Victoria. He has over 40 years experience as a technical specialist in areas such as concrete technology, concrete durability and bridge construction, maintenance, rehabilitation and strengthening. Fred was the project manager of the Austroads project.
No charge but registration is essential. | chemistry |
https://ktul.com/news/nation-world/scientists-discover-molecular-velcro-guard-against-covid-coronavirus-health-immune-system-lrrc15-ace2-receptor | 2023-03-28T20:20:16 | s3://commoncrawl/crawl-data/CC-MAIN-2023-14/segments/1679296948871.42/warc/CC-MAIN-20230328201715-20230328231715-00029.warc.gz | 0.959834 | 759 | CC-MAIN-2023-14 | webtext-fineweb__CC-MAIN-2023-14__0__24382835 | en | (TND) — Scientists have discovered a protein in the lungs that appears to be a natural defense against the virus that causes COVID-19.
They say this opens up new areas of research and the potential for new treatments.
The protein, leucine-rich repeat-containing protein 15, or LRRC15, binds the virus without passing on the infection, according to researchers at the University of Sydney.
For me, as an immunologist, the fact that there's this natural immune receptor that we didn't know about, that's lining our lungs and blocks and controls virus, that's crazy interesting,” study lead Professor Greg Neely said in a university news release.
The Australian researchers noted that work with the LRRC15 protein has also been taking place at Oxford, Brown and Yale.
Virologist Paula Cannon, who was not involved with this research, says it holds exciting potential as a protection or treatment against COVID-19 and other lung infections.
“What's interesting is these different studies that use different methods and are looking at different things are all coalescing on this molecule as being important,” said Cannon, with the Keck School of Medicine of USC. “So, when you see that, when you see different approaches coming up with the same answer, it lends credibility to the role of this molecule.”
COVID-19 latches onto a receptor to infect us. The docking molecule it latches onto is a protein called the angiotensin-converting enzyme 2, or ACE2.
LRRC15, meanwhile, seems to be behaving like a natural “receptor decoy,” Cannon said.
“It binds to the spike protein. You remember the little red blobs? And when it's bound to the spike protein, it stops the spike protein being able to interact with its natural receptor ACE2,” she said.
Importantly, LRRC15 is a dead-end interaction for the virus, she said.
This natural protective barrier can prevent other vulnerable cells from becoming infected.
University of Sydney researchers called it “molecular Velcro.”
And LRRC15 can work both when it itself is on the surface of a cell, but more importantly, when it's kind of secreted, it's soluble, it's whizzing around in blood and mucous,” Cannon said. “It's there as the way to kind of catch the virus and inactivate it by putting these nonfunctional blocks or locks all over it.”
There’s another potentially important discovery, that LRRC15 could be used to suppress fibrosis, or the damaging scarring that can occur from serious lung infections.
And researchers say there’s evidence that LRRC15 levels may relate to how severe a person’s COVID infection will be. They said the body’s LRRC15 levels seem to increase when a virus is introduced.
The higher the levels, the more effective a person appears to be at fighting off the virus.
Cannon said LRRC15 levels could potentially be used to screen people most at risk for severe infections.
She called the medical uses for the LRRC15 protein “blue sky thinking,” because the science is just emerging. But there are real possibilities to help people, she said.
“There's a potential to develop it as a drug to protect us,” she said. “You could spray it in people's noses or with an inhaler if they're at risk of being infected, and you're giving them a molecule that is a natural antiviral defense.” | chemistry |
http://dbid.ca/water-quality-reports/ | 2022-08-13T14:22:28 | s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882571959.66/warc/CC-MAIN-20220813142020-20220813172020-00033.warc.gz | 0.950242 | 155 | CC-MAIN-2022-33 | webtext-fineweb__CC-MAIN-2022-33__0__108517774 | en | The Deep Bay Improvement District (DBID) is fortunate to have an excellent source of ground water that does not require any treatment. The DBID is required, as part of the operating permit, to test water samples regularly. There are four sample sites, identified by Vancouver Island Health Authority (VIHA), and each of the four sites is sampled on a monthly basis. Samples are delivered to Parksville for testing by VIHA.
Sample results as well as the VIHA Water System Inspection reports are available from the VIHA website – http://www.healthspace.ca/viha
DBID takes further samples from throughout the distribution system and sends these samples to an independent lab for additional chemical analysis. Results from our recent testings are available below. | chemistry |
http://www.steviafirst.com/news/news_releases/2014/06/stevia-first-corp.-provides-scale-up-data-for-reb-a-production-from-enzyme-enhancement | 2019-11-23T01:06:43 | s3://commoncrawl/crawl-data/CC-MAIN-2019-47/segments/1573496672313.95/warc/CC-MAIN-20191123005913-20191123034913-00018.warc.gz | 0.927776 | 1,282 | CC-MAIN-2019-47 | webtext-fineweb__CC-MAIN-2019-47__0__85789932 | en | Stevia First Corp. Provides Scale-Up Data for Reb A Production From Enzyme Enhancement
Jun 23, 2014
SACRAMENTO, CA--Stevia First Corp. (OTCQB: STVF) ("Stevia First" or the "Company"), an agricultural biotechnology company based in California's Central Valley growing region and focused on the industrial scale production of stevia, the all-natural zero-calorie sweetener that is rapidly transforming the food and beverage industry, is pleased to disclose industrial scale-up data for its purified Rebaudioside A ("Reb A") alternative sweetener products derived from an enzyme enhancement process.
In 2013, Stevia First achieved success in converting low-grade stevia extract directly into highly purified stevia extract using an enzyme enhancement process. Stevia First has filed new intellectual property related to this process and has been working extensively towards commercialization and implementation at an industrial scale.
Upon successful implementation, the Company intends to implement an annual minimum of 200 metric tons capacity for high purity Reb A through contract manufacturers or strategic partners. The process could enable Stevia First to directly convert low-grade stevia extract, which is commonly marketed for $40,000 per metric ton, into highly purified Reb A, which is often marketed for $100,000 per metric ton or more. The Company recently formed an alliance with Qualipride International in order to gain access to 1,500 metric tons of annual supply of low-grade stevia extract for use as starting material. For perspective on this capacity in the context of the stevia industry, Purecircle is a leading stevia supplier that disclosed as of 2013 a 2,800 metric ton capacity for highly purified stevia extract that could support annual sales of $250 to $300 million.
Stevia First's scale-up efforts to date have involved increasing reaction volumes by 25,000 times over initial laboratory conditions during production of food-grade stevia samples. The Company is now continuing to scale-up this process for pilot production and initial commercialization, with development to continue in mid-2014 directed at an initial production target of 400 kilograms per day of highly purified Reb A stevia extract. The Company estimates certain variable processing costs for initial production quantities to be less than $23,000 per ton, with additional costs related to enzyme production. Larger production runs could provide substantial economies of scale and greater margins. Stevia First is now reliably producing active Stevia enzymes at its facilities to be used within its enzyme enhancement process.
Dr. Brandon Zipp, Stevia First's Director of Research and Development, comments that, "We're finishing what the plant started, converting the most abundant steviol glycoside, stevioside, into the valuable Rebaudioside A and beyond."
Stevia First's CEO, Robert Brooke, adds that, "Since the 2003 discovery of this enzyme by our collaborator, this elegant approach to increasing global Reb A production has eluded the industry, but our team has employed its diverse experiences in handling Stevia UGT enzymes in a manner that has finally enabled a process that works. Discoveries in our lab made recently continue to set us apart, and position us ever closer to bringing our innovations to market."
About Stevia First Corp. (OTCQB: STVF)
Stevia First Corp. is an agricultural biotechnology company that has developed expertise for the production of stevia using fermentation and for improvement of traditional stevia farming and processing methods. The Company is also applying breakthrough technologies in software and the life sciences to develop product applications far beyond stevia and the food and beverage industry. For more information visit: www.steviafirst.com.
About the Stevia Industry
The market for all-natural, zero-calorie stevia sweeteners is expanding rapidly. The World Health Organization (WHO) estimates stevia intake could eventually replace 20-30% of all dietary sweeteners. The total global sweetener market was estimated at $58.3 billion in 2010. For more information visit: www.steviafirst.com.
Notice Regarding Forward-Looking Statements
This news release contains "forward-looking statements" as that term is defined in Section 27(a) of the United States Securities Act of 1933, as amended and Section 21(e) of the Securities Exchange Act of 1934, as amended. Statements in this press release which are not purely historical are forward-looking statements and include any statements regarding beliefs, plans, expectations or intentions regarding the future. Such forward-looking statements include, among other things, projections of worldwide sales of stevia products, growth of stevia production and global markets. Actual results could differ from those projected in any forward-looking statements due to numerous factors. Such factors include, among others, the inherent uncertainties associated with new projects and development stage companies. These forward-looking statements are made as of the date of this news release, and we assume no obligation to update the forward-looking statements, or to update the reasons why actual results could differ from those projected in the forward-looking statements. Although we believe that any beliefs, plans, expectations and intentions contained in this press release are reasonable, there can be no assurance that any such beliefs, plans, expectations or intentions will prove to be accurate. Investors should consult all of the information set forth herein and should also refer to the risk factors disclosure outlined in our annual report on Form 10-K for the most recent fiscal year, our quarterly reports on Form 10-Q and other periodic reports filed from time-to-time with the Securities and Exchange Commission.
This website contains historical and archived press releases, blogs and rekated reorts for Stevia First Corporation. The information in these releases, documents and articles is historical in nature, has not been updated, and is current only to the date indicated in each instance. This information may no longer be accurate and therefore you should not rely on the information contained in these documents. To the extent permitted by law, Stevia First Corporation and its employees, agents and consultants exclude all liability for any loss or damage arising from the use of, or reliance on, any such information, whether or not caused by any negligent act or omission. | chemistry |
http://nierocks.areavoices.com/2014/04/01/happy-snow-day-a-look-at-a-snowflakes-six-sides/ | 2018-05-25T20:10:13 | s3://commoncrawl/crawl-data/CC-MAIN-2018-22/segments/1526794867217.1/warc/CC-MAIN-20180525200131-20180525220131-00628.warc.gz | 0.928479 | 600 | CC-MAIN-2018-22 | webtext-fineweb__CC-MAIN-2018-22__0__3128236 | en | Here’s a look at a snowflake’s six sides from Bill Marvel at The Dallas Morning News and McClatchy Tribune.
Next time it snows, take a minute from sledding or skating or snowball fights to look closely at snowflakes. A dark piece of cloth, such as a wool mitten,and a magnifying glass will help.
Almost all snowflakes look like stars with six points,or flowers with six petals. But why six? Why not eight or five or for that matter, 20?
Four hundred years ago, a scientist named Johannes Kepler thought he knew the answer, and he wrote to a friend about it. Each snowflake, Kepler wrote, starts with a round droplet of frozen water. So far, so good. If you arrange pennies on a table and pack them as closely as possible, you will find that each penny touches exactly six other pennies. No more, no less. Thus, Kepler said,if you pack round droplets of ice closely together, each will be surrounded by exactly six other round droplets.
In the same way, he announced,each snowflake begins with a six-sided cluster of ice droplets,and it grows from there. Sort of like a bee honeycomb. Good guess, but Kepler was wrong.
Scientists discovered the real reason several centuries later. Snowflakes are six-sided because of the way atoms stick together. Each molecule of water is made up of one big oxygen atom and two little hydrogen atoms. Think of two little cherries stuck to a big apple, like ears.
The hydrogen atoms will stick to the oxygen atom, but they will not stick to another hydrogen atom.
As the temperature falls below freezing, water molecules in the air start sticking to one another, forming ice. Like people shaking hands, each oxygen atom grabs one of the hydrogen atoms of another molecule.That molecule, in turn,grabs the hydrogen atom of yet another molecule,until six of the molecules link together in a tiny six-sided crystal called a hexagon.
As that ice crystal falls through the air,it bumps against other molecules of water that stick to the corners of the hexagon and freeze. Pretty soon, the original crystal starts to grow six long arms. Meanwhile, the arms start to grow branches. Repeat the process often enough — say,about 10,000,000,000,000,000,000,000,000 times —and you get a snowflake just big enough to see.You could look at snowflakes all day during the thickest blizzard and never find two that perfectly match. You could look for the rest of your life ,in fact. That’s because, like people,each snowflake encounters different conditions as it goes through life — different air currents, different temperatures,different moisture — and so it forms differently. Like people, no two snowflakes are exactly alike. | chemistry |
https://www.bishopfamilydental.net/2017/07/14/but-it-is-only-water/ | 2019-08-24T03:30:33 | s3://commoncrawl/crawl-data/CC-MAIN-2019-35/segments/1566027319470.94/warc/CC-MAIN-20190824020840-20190824042840-00163.warc.gz | 0.954742 | 201 | CC-MAIN-2019-35 | webtext-fineweb__CC-MAIN-2019-35__0__57333529 | en | So you have removed soda out of your diet in order to be more healthy, but you still need the satisfaction of carbonation. Sparkling water has become a new “healthy” alternative for soda. That may be true for your overall health due to the no sugar factor, however carbonated water is also acidic because your mouth turns the carbon dioxide bubbles into carbonic acid. This is a problem because acid dissolves tooth enamel, which causes teeth to weaken and become more cavity-prone.
Suggestion to help protect your teeth:
Drink through a straw
Rinse with water after drinking to wash away acid
Wait at least 20 minutes before brushing to avoid scrubbing the acid into your enamel. Along with brushing, practice good dental habits including flossing and seeing your local Holladay City Cleaning Dentist to reduce your risk of cavities.
Both sparkling and flavored waters are not as acidic as sodas but with moderation you can still enjoy your favorite beverage. | chemistry |
https://en.yuquitania.com/post/the-salt-in-the-yuquitania | 2023-12-01T00:32:04 | s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100258.29/warc/CC-MAIN-20231130225634-20231201015634-00529.warc.gz | 0.937334 | 373 | CC-MAIN-2023-50 | webtext-fineweb__CC-MAIN-2023-50__0__124121519 | en | Salt is a fundamental ingredient in the preparation of the Yuquitania. Formerly salt was obtained from different processes of plant material obtained in the jungle. According to Juan Álvaro Echeverri, in his essay "La sal de monte", he establishes that the stories of the Spanish chroniclers speak of a type of salt that was used by indigenous groups. “It is a salt made from the combustion of bark, buds and stems of certain plant species. This type of plant-based salts have been used by many peoples of the Americas and other continents and continue to be used to this day by various Amazonian groups. Several indigenous groups make this type of salt, as an essential mixture for tobacco ambil, among others, and for ritual, medicinal and culinary use (Echeverri, 2011)”. In other words, the salt was obtained from the leaves and fruits of certain vegetables reduced to ashes. The historical records of the colony show that, for example, in the Negro River, salt was obtained from a plant that grows on the rocks in the rapids of the rivers, also called cachiveras. Another way to obtain salt was through trade with sub-Andean groups, who had access to large deposits in the high jungle of that region and traded it with the Amazonian peoples for dried fish, feathers, honey, skins and wood.
If you want to know more about obtaining and using salt in the Amazon regions and indigenous peoples:
La sal de monte: un ensayo de ‘halofitogenografía’ uitoto, January 2001, In book: Imani mundo. Estudios en la Amazonia colombiana, Publisher: Unibiblos, Editors: Franky, Carlos E. and Zárate, Carlos G. | chemistry |
https://www.tbg-i.com/ebl-eb-641581614-9v-600mah-6f22-rechargeable-li-ion-batteries-with-charger/ | 2022-05-26T20:30:32 | s3://commoncrawl/crawl-data/CC-MAIN-2022-21/segments/1652662625600.87/warc/CC-MAIN-20220526193923-20220526223923-00738.warc.gz | 0.803685 | 135 | CC-MAIN-2022-21 | webtext-fineweb__CC-MAIN-2022-21__0__220618540 | en | EBL EB-641581614 9V 600mAh 6F22 Rechargeable Li-ion Batteries with Charger
Catalogue Number: EB-641581614
- High quality 4 packs 6F22 9V 600mAh li-ion rechargeable batteries.
- Without memory effect, the batteries can be charged anytime.
- The highly improved low self discharge makes it still maintain 75% of capacity after 3 years of non-use.
- The pre-charged batteries can be recharged up to 1200 times.
- Widely used in smoke alarms, professional audio and medical devices etc. | chemistry |
https://healthchannel.hk/index.php?route=product/product&path=95_95&product_id=488 | 2018-05-26T17:45:20 | s3://commoncrawl/crawl-data/CC-MAIN-2018-22/segments/1526794867841.63/warc/CC-MAIN-20180526170654-20180526190654-00542.warc.gz | 0.905383 | 651 | CC-MAIN-2018-22 | webtext-fineweb__CC-MAIN-2018-22__0__5538227 | en | Redmond RealSalt Sea SPA Bath Salt is a natural mineral sea salt that comes from a sea bed dating back thousands of years. This prehistoric deposit has been tucked away, protected from modern-day pollution. We extract this salt from deep within the earth, and bring it to you in its pure, natural state–without any additives, chemicals, or heat processing. The result is an all natural sea salt, rich in trace minerals.
In Redmond RealSalt Sea SPA Bath Salt you will find an abundance of trace minerals that can help restore mineral-deficient bodies back to good health. Through osmosis, toxins are released from the body into the bath water, while trace minerals from the sea salt are absorbed through the skin.Benefits of Redmond Sea SPA Bath Salt
* Relax * Detoxify * Remineralize * Rejuvenate * Energize
Redmond Sea SPA Bath Salt is great for:
- Soothing Stiff, Sore & Aching Muscles
- Detoxification & Cleansing
- Improving Circulation
- Promoting Sound, Restful Sleep
- Remineralizing the Body
How does Redmond Bath Salt promote better health?
Due to the abundance of natural trace minerals in our salt, Redmond Bath Salt provides healing properties for the skin and body. Toxins are released from the body into the bath water through osmosis, while trace minerals from the sea salt are absorbed through the skin.
Are there any additives in Redmond Bath Salt?
All of the minerals in Redmond Bath Salt are naturally occurring. Most bath salts on the market today have oils and fragrances added to them (which may cause allergic reactions) and often times leave an oily residue around the rim of the tub. Our bath salt, on the other hand, is so natural, you can eat it!
How to Use Redmond Sea SPA Bath Salt
How much Redmond Bath Salt should I use?
Using 1/2 a cup of Redmond Bath Salt per bath can effectively draw out toxins and help remineralize the body. Some spa experts suggest using up to two cups of natural mineral salt per bath and soaking for 30 minutes.
Can I add my own essential oils to Redmond Bath Salt?
What makes Redmond Bath Salt unique to many bath salts on the market today, is the fact that it is a natural, unrefined product with no additives. It is difficult to find additive-free bath salts that are naturally loaded with trace minerals. While very effective without essential oils, some choose to customize their Redmond Bath Salt by adding drops of their favorite essential oils to the bath water.
Why is there reddish sediment in my tub after using Redmond Bath Salt?
In our Redmond Bath Salts you will find more than 60 natural trace minerals. The residue left on the floor of the tub comes from these natural minerals of which can be washed safely down the drain.
For Maximum Effect
The salt concentration has to be at least the same as the one of your body fluids (approximately 1%) to activate the osmotic exchange ratio. The formula for a 1% solution is 1.28 ounces of salt per gallon of water. | chemistry |
http://safejoint.net/?page_id=40 | 2017-12-11T18:41:35 | s3://commoncrawl/crawl-data/CC-MAIN-2017-51/segments/1512948513866.9/warc/CC-MAIN-20171211183649-20171211203649-00409.warc.gz | 0.845723 | 365 | CC-MAIN-2017-51 | webtext-fineweb__CC-MAIN-2017-51__0__51695493 | en | The work in this WP will undertake the manufacture of metal/metal composite joints and in particular dissimilar aluminium alloys and aluminium/magnesium alloys.
Task 3.1 – Manufacture of metal / metal joints using nanoparticle fillers
This task will undertake the manufacture of dissimilar metal joints through friction stir welding (FSW). The filler materials developed in WP1 will be used to produce the dissimilar metal welds.
Task 3.2 – Ceramic coatings for corrosion protection of dissimilar metal welds
One of the major issues of dissimilar material joining is the corrosion behaviour at the joint interface. This task will investigate the incorporation of ceramic coats in the form of encrusted films applied onto the metal alloys prior to FSW for improved corrosion protection properties of the joined metals .
The ceramic coatings will be applied on the metal alloys via the dip coating process. Inorganic, organic or organically surface modified inorganic nanocontainers, nanotubes or nanoparticles will be incorporated into the ceramic coatings. All the nanocontainers and nanotubes will be loaded with organic or inorganic corrosion inhibitors.
Task 3.3 – Hybrid Organic-Inorganic Layers for corrosion protection of dissimilar metal joints
The corrosion issue will also be addressed through FSW Hybrid Organic-Inorganic Layers Hybrid organic layers including nanocontainers loaded with corrosion inhibitors will be synthesized.
Task 3.4 – Development of Non Destructive Evaluation technique for dissimilar metal joints
This task will undertake the development of reliable NDE techniques for the dissimilar metal joints. The incorporation of carbon nanotubes and corrosion inhibitors combined with the differing metallurgical morphology of the joined dissimilar metals presents a challenge to the NDE methodology to be implemented. | chemistry |
https://www.moodyradio.org/stations/south-florida/community/community-calendar/2019/05/algae-bloom-remediation-workshop/ | 2023-12-01T10:10:22 | s3://commoncrawl/crawl-data/CC-MAIN-2023-50/segments/1700679100286.10/warc/CC-MAIN-20231201084429-20231201114429-00258.warc.gz | 0.874502 | 209 | CC-MAIN-2023-50 | webtext-fineweb__CC-MAIN-2023-50__0__81035626 | en | National Algae Association
8:00am - 5:00pm
Broward County Library Downtown - Auditorium
100 S. Andrews Ave, Ft. Lauderdale, FL 33301
The algae bloom situation is affecting tourism, fishing, real estate and local economies. While algae bloom research, testing and monitoring is ongoing within the State of Florida, collaboration and open communication is needed on fixing the continuous algae bloom and HAB problems. The National Algae Association is the first non-profit algae association to focus on research and commercial algae bloom technologies available in the US and throughout the world. NAA extends an invitation to all algae bloom stakeholders to attend the Algae Bloom Workshop, May 21-22, in Ft. Lauderdale, Florida. Join, collaborate and network with commercially-minded algae bloom researchers, remediation technology experts and equipment companies to discuss algae blooms and toxic blooms (HAB’s). Attendees will learn about the devastating algae bloom problems and potential commercial algae bloom remediation technologies that are scalable and economically viable. | chemistry |
https://shopsante.ca/en/products/hd-muscle-intra-hd-400g-1 | 2024-02-24T17:10:40 | s3://commoncrawl/crawl-data/CC-MAIN-2024-10/segments/1707947474541.96/warc/CC-MAIN-20240224144416-20240224174416-00079.warc.gz | 0.900797 | 167 | CC-MAIN-2024-10 | webtext-fineweb__CC-MAIN-2024-10__0__134060300 | en | HD Muscle - Intra HD 400g
INTRA-HD is an enhanced training product designed to improve muscle endurance and recovery, helping you to overcome your last performance and start your muscle recovery protocol. INTRA-HD's innovative formula combines key clinically validated ingredients in effective doses to give unparalleled results not found in other amino acid products on the market today. INTRA-HD contains ten grams of the nine essential amino acids, effectively providing your muscles with all the amino acids needed to maximize protein synthesis and improve muscle development and recovery.
INTRA-HD further improves your results and takes you beyond muscle recovery by :
- Increasing peak power and endurance
- Limiting free radical damage to improve recovery
- Promote efficient consumption of cellular oxygen
- Reduce muscle pain and inflammation
- Rehydrate and use electrolytes more efficiently | chemistry |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.