id
stringlengths
1
8
text
stringlengths
6
1.05M
dataset_id
stringclasses
1 value
4907621
<filename>moonleap/utils/join.py def join(prefix, infix, postfix=""): if infix: return prefix + infix + postfix return infix
StarcoderdataPython
1811862
<filename>index2.py def add_task(any_list): user_add_task = input("Enter a task you would like to add to the list: ") any_list.append(user_add_task) def delete_task(any_list): user_del_task = input("Enter a task you would like to delete from the list: ") if user_del_task in any_list: del_index = any_list.index(user_del_task) del any_list[del_index]
StarcoderdataPython
101294
import torch import shutil import numpy as np import matplotlib matplotlib.use('pdf') import matplotlib.pyplot as plt # import cv2 from skimage.transform import resize import torchvision.transforms as transforms from sklearn.metrics import precision_score, recall_score, f1_score, roc_auc_score class AverageMeter(object): """Computes and stores the average and current value""" def __init__(self): self.reset() def reset(self): self.val = 0 self.avg = 0 self.sum = 0 self.count = 0 def update(self, val, n=1): self.val = val self.sum += val * n self.count += n self.avg = self.sum / self.count def save_checkpoint(state, filename='checkpoint.pth.tar'): torch.save(state, filename) def adjust_learning_rate(optimizer, epoch, args, interval): """Sets the learning rate to the initial LR decayed by 10 every 100 epochs""" lr = args.lr if epoch < interval[0]: lr = args.lr elif epoch >= interval[0] and epoch < interval[1]: lr = args.lr * 0.1 else: lr = args.lr * 0.01 #lr = args.lr * (0.1 ** (epoch // 100)) for param_group in optimizer.param_groups: param_group['lr'] = lr return lr def accuracy(output, target, topk=(1,)): """Computes the precision@k for the specified values of k""" maxk = max(topk) batch_size = target.size(0) _, pred = output.topk(maxk, 1, True, True) pred = pred.t() correct = pred.eq(target.view(1, -1).expand_as(pred)) res = [] for k in topk: correct_k = correct[:k].view(-1).float().sum(0, keepdim=True) res.append(correct_k.mul_(100.0 / batch_size)) return res def multi_class_auc(all_target, all_output, num_c = None): from sklearn.preprocessing import label_binarize # all_output = np.stack(all_output) all_target = label_binarize(all_target, classes=list(range(0, num_c))) all_output = label_binarize(all_output, classes=list(range(0, num_c))) auc_sum = [] for num_class in range(0, num_c): try: auc = roc_auc_score(all_target[:, num_class], all_output[:, num_class]) auc_sum.append(auc) except ValueError: pass auc = sum(auc_sum) / (float(len(auc_sum))+1e-8) return auc def evaluation_metrics(label, pred, C): if C==2: auc = roc_auc_score(label, pred) else: auc = multi_class_auc(label, pred, num_c=C) corrects = np.equal(np.array(label), np.array(pred)) acc = float(sum(corrects)) / len(corrects) # mean class precision = precision_score(label, pred, average='macro') recall = recall_score(label, pred, average='macro') f1score = f1_score(label, pred, average='macro') return round(auc, 4), round(acc, 4), round(precision, 4), round(recall, 4), round(f1score, 4) def showfeature(x, savename): # trun to numpy x = x.data.cpu().numpy() print (x.shape) box = [] for item in range(0, x.shape[0]): x_patch = x[item, :, :] box.append(x_patch) x_patch = np.stack(box) x_patch = np.max(x_patch, axis=0) x_patch = resize(x_patch, (224, 224), order=3, mode='constant', cval=0, clip=True, preserve_range=True) x_patch = (x_patch - np.min(x_patch)) / (np.max(x_patch) - np.min(x_patch) + 1e-11) x_patch = x_patch * 255 x_patch = np.array(x_patch, dtype="uint8") plt.plot(1), plt.imshow(x_patch, cmap='jet') plt.axis('off') plt.savefig(savename, bbox_inches='tight', pad_inches=0) def showimage(x, savename): import torchvision.transforms as transforms mean=[0.485, 0.456, 0.406] std=[0.229, 0.224, 0.225] z = x * torch.tensor(std).view(3, 1, 1).cuda() z = z + torch.tensor(mean).view(3, 1, 1).cuda() z = z.cpu() z = z[[2,1,0], : ,:] img2 = transforms.ToPILImage()(z) img2.save(savename) def get_color_distortion(s=1.0): color_jitter = transforms.ColorJitter(0.8 * s, 0.8 * s, 0.8 * s, 0.2 * s) rnd_color_jitter = transforms.RandomApply([color_jitter], p=0.8) rnd_gray = transforms.RandomGrayscale(p=0.2) color_distort = transforms.Compose([rnd_color_jitter, rnd_gray]) return color_distort def gaussian_blur(x): from PIL.ImageFilter import GaussianBlur if np.random.randint(0, 2) == 1: x = x.filter(GaussianBlur(radius=np.random.uniform(0.1, 2.0))) return x
StarcoderdataPython
11332466
"""Adds user teams Revision ID: <KEY> Revises: 95d86da7b3c7 Create Date: 2020-08-19 14:20:57.539270 """ import sqlalchemy as sa from alembic import op # revision identifiers, used by Alembic. revision = "<KEY>" down_revision = "95d86da7b<PASSWORD>" branch_labels = None depends_on = None def upgrade(): op.create_table( "user_teams", sa.Column("user_xid", sa.BigInteger(), nullable=False), sa.Column("guild_xid", sa.BigInteger(), nullable=False), sa.Column("team_id", sa.Integer(), nullable=False), sa.ForeignKeyConstraint(["guild_xid"], ["servers.guild_xid"], ondelete="CASCADE"), sa.ForeignKeyConstraint(["team_id"], ["teams.id"], ondelete="CASCADE"), sa.ForeignKeyConstraint(["user_xid"], ["users.xid"], ondelete="CASCADE"), sa.PrimaryKeyConstraint("user_xid", "guild_xid"), ) def downgrade(): op.drop_table("user_teams")
StarcoderdataPython
9611175
# -*- coding: utf-8 -*- from django.conf.urls import url from django.views.generic import TemplateView from . import views app_name = 'oauth_clients' urlpatterns = [ url( regex="^Client/~create/$", view=views.ClientCreateView.as_view(), name='Client_create', ), url( regex="^Client/(?P<pk>\d+)/~delete/$", view=views.ClientDeleteView.as_view(), name='Client_delete', ), url( regex="^Client/(?P<pk>\d+)/$", view=views.ClientDetailView.as_view(), name='Client_detail', ), url( regex="^Client/(?P<pk>\d+)/~update/$", view=views.ClientUpdateView.as_view(), name='Client_update', ), url( regex="^Client/$", view=views.ClientListView.as_view(), name='Client_list', ), url( regex="^AccessToken/~create/$", view=views.AccessTokenCreateView.as_view(), name='AccessToken_create', ), url( regex="^AccessToken/(?P<pk>\d+)/~delete/$", view=views.AccessTokenDeleteView.as_view(), name='AccessToken_delete', ), url( regex="^AccessToken/(?P<pk>\d+)/$", view=views.AccessTokenDetailView.as_view(), name='AccessToken_detail', ), url( regex="^AccessToken/(?P<pk>\d+)/~update/$", view=views.AccessTokenUpdateView.as_view(), name='AccessToken_update', ), url( regex="^AccessToken/$", view=views.AccessTokenListView.as_view(), name='AccessToken_list', ), ]
StarcoderdataPython
3460483
# -*- coding: utf-8 -*- """ Created on Thu Sep 22 13:05:13 2016 @author: chyam """ #import matplotlib.pyplot as plt import pandas as pd import seaborn as sb import analyticutils as au import argparse def main(): argparser = argparse.ArgumentParser(description='This script will perform simple data analysis on a text classification dataset.') argparser.add_argument('-i', '--inFile', help='Input filename', required=True) argparser.add_argument('-o', '--outFile', help='Output filename', required=True) args = argparser.parse_args() # Load data #filename = "./data/clean-data-21092016.tsv" filename = args.inFile df = pd.read_csv(filename, delimiter='\t') # Unique samples per label; label_count is a series label_count = df['Label'].value_counts(); print(label_count) # Visualisation (Seaborn): sample count per label sb.set(style="whitegrid", color_codes=True) sb.countplot(x="Label", data=df) # Visualisation (plotly): pie au.draw_pie(label_count, args.outFile) # Just a message print("Data analysed .........") if __name__ == '__main__': main() #============================================================================== # # Visualisation(matplotlib): sample count per label # fig = plt.figure() # ax = fig.add_subplot(111) # ax.set_xlabel('Labels') # ax.set_ylabel('Counts for each label') # ax.set_title("Sample count per label") # label_count.plot(kind='bar') #==============================================================================
StarcoderdataPython
364127
# Date: 2020/11/05 # Author: <NAME> # Description: # ## # # def square(): #DEFINING EPSILON (MARGIN OF ERROR) epsilon = 0.01 #DEFINING STEP (HOW MUCH I CAN APPROXIMATE IN EACH STEP) step = epsilon**2 #DEFINFING ANSWER answer = 0.0 #DEFINING OBJECTIVE (TO CALCULATE SQUARE) objective = int(input(f"\nType an integer number.\nNumber: ")) print(f"\n") while ((abs(answer**2 - objective) >= epsilon) and (answer <= objective)): # print(f"abs(answer**2 - objective) = {abs(answer**2 - objective)}\nanswer = {answer}\n") answer += step if (abs(answer**2 - objective) >= epsilon): print(f"We didn't find the square of the number {objective}") else: print(f"The square of {objective} is {answer}") #RUN(): ON THIS FUNCTION WE'LL RUN OUR CODE def run(): square() #MAIN(): MAIN FUNCTION if __name__ == "__main__": run()
StarcoderdataPython
362716
#!/usr/bin/env python # encoding: utf-8 """ fields.py Created by <NAME> on 2013-09-23. Copyright (c) 2012 Multmeio [design+tecnologia]. All rights reserved. """ from django.db import models from django_orm.postgresql.hstore import HStoreManager from hstore_flattenfields.db.queryset import FlattenFieldsFilterQuerySet class FlattenFieldsFilterManager(HStoreManager): def get_query_set(self): return FlattenFieldsFilterQuerySet(model=self.model, using=self._db) def _insert(self, *args, **kwargs): def is_not_dynamic(field): return not field.db_type == 'dynamic_field' kwargs.update({ 'fields': filter(is_not_dynamic, kwargs.get('fields')) }) return super(FlattenFieldsFilterManager, self)._insert(*args, **kwargs)
StarcoderdataPython
6444923
#1. 首先创建100个Dog, 50个SheepDog, 50个PoliceDog #2. 每一轮游戏,随机选出2个Dog #3. dog1先攻击dog2,然后dog2攻击dog1 #3. 任何一方血量变为0就表明死亡!死亡的Dog退出游戏。 #4. 最后只有一个Dog了,游戏结束,胜利者可以吃鸡。 from dog import * import random #产生随机数字 import time #时间模块 #1.创建100条狗 for i in range(100): if(i%2==0): SheepDog(i+1) #创建1个牧羊犬 else: PoliceDog(i+1) #创建1个警犬 #2. 开始游戏循环 while(True): #判断是否只有1个Dog if(len(Dog.dogs) == 1): winner = Dog.dogs[0] print('🐔🐔🐔🐔🐔🐔🐔🐔') print('大吉大利,今晚吃鸡!') print(f'赢家是:{winner.dog_type()} {winner.name}') print('🐔🐔🐔🐔🐔🐔🐔🐔') break dog1, dog2 = random.sample(Dog.dogs, 2) dog1.attack(dog2) dog2.attack(dog1) time.sleep(0.02)
StarcoderdataPython
11355651
<reponame>haibeey/doclite import pydoclite #install pydoclite import os,glob def removeFiles(): for f in glob.glob("doclitetest.db*"): try: os.remove(f) except OSError: pass removeFiles() d = pydoclite.Doclite.Connect(b"doclitetest.db") baseCollection = d.Base() for i in range(10): baseCollection.Insert({"a":1}) baseCollection.FindOne(1) baseCollection.DeleteOne(2) print(baseCollection.Find({"a":1})) baseCollection.Delete({"a":1}) print(baseCollection.Find({"a":1})) d.Close() removeFiles()
StarcoderdataPython
3483467
<gh_stars>1-10 import json, _jsonnet with open('Tools/qns_gen/test.jsonnet') as f: data = f.read() data = _jsonnet.evaluate_snippet("snippet",data) # print(data) with open('Tools/qns_gen/_qns.json', 'w') as f : f.write(data)
StarcoderdataPython
373700
#!/usr/bin/python3 from datetime import datetime now = datetime.now() year = now.year day_of_year = now.timetuple().tm_yday hour = now.hour minute = now.minute second = now.second one_hour = 1 / 24 / 365 one_minute = one_hour / 60 one_second = one_minute / 60 exact_day = (day_of_year / 365) exact_hour = hour * one_hour exact_minute = now.minute * one_minute exact_second = now.second * one_second exact_decimal = exact_day + exact_hour + exact_minute + exact_second decimal = float('%.8f'%(exact_decimal)) #error = decimal * 365 - day_of_year - (hour / 24) #error_hours = error * 24 stardate = year + decimal #print("stardate for", year, day_of_year, hour) #print("error:", error, "in hours:", error_hours) print(stardate)
StarcoderdataPython
4908369
import numpy as np from gym import spaces from ..miniworld import MiniWorldEnv, Room from ..entity import Box, Agent from ..params import DEFAULT_PARAMS from ..math import * import random class HAWKMaze(MiniWorldEnv): """ HAWK-Maze zum Trainieren eines DDQ-Agents """ def __init__(self, **kwargs): "------Parameter-Einstellungen-------" max_steps = 800 domain_rand = False # Maze self.num_rows = 2 # Zeilen des HAWK-Mazes self.num_cols = 2 # Spalten des HAWK-Mazes self.room_size = 5 # Raumgröße self.gap_size = 0.25 # Wanddicke/Abstand zwischen 2 Räumen # Agent self.agent_groesse = 0.6 # Radius Agent (für Kollisionsmodell/Aufheben-Aktion) self.schritt_agent = 0.50 # Schrittweite self.schritt_toleranz = 0.02 # Schrittweite-Toleranz, wenn Domain-Rand. aktiviert self.phi_agent = 90 # Drehwinkel self.phi_tol = 0.0 # Drehwinkel-Toleranz, wenn Domain-Rand. aktiviert self.start_winkel = [0, 0.5*math.pi, math.pi, -0.5*math.pi] # mögl. Start-Winkel des Agents relativ zum Env # Objekte self.anzahl_objs = 20 # wenn None: Anzahl zufällig aus (min, max) self.anzahl_objs_min = 1 # untere Grenze für Anzahl zufälliger Objekte self.anzahl_objs_max = 4 # obere Grenze für Anzahl zufälliger objekte "------Setzen der Parameter------" params = DEFAULT_PARAMS.copy() params.set('forward_step', self.schritt_agent, self.schritt_agent - self.schritt_toleranz, self.schritt_agent + self.schritt_toleranz) params.set('turn_step', self.phi_agent, self.phi_agent - self.phi_tol, self.phi_agent + self.phi_tol) super().__init__( max_episode_steps=max_steps, domain_rand=domain_rand, params=params, **kwargs ) "------Reduzierung des Aktionsraumes------" # Mögliche Aktionen: # turn_left = 0 | turn_right = 1 | move_forward = 2 | move_back = 3 | pickup = 4 self.action_space = spaces.Discrete(self.actions.pickup+1) def _reward(self): #Ziel ist es, den Agent mit möglichst wenigen Aktionen alle verfügbaren... #...Objekte einsammeln zu lassen. Die Belohnung pro eingesammeltem Objekt... #...erhöht sich linear, da der Schwierigkeitsgrad mit weniger verbleibenden... #...Objekten zunimmt. Außerdem verringert jede ausgeführte Aktion die Belohnung... #...etwas, um die Wahl des kürzesten Weges anzustreben." #return 1.0 * self.num_picked_up - 0.2 * (self.step_count / self.max_episode_steps) # Konstante Belohnung für jedes eingesammelte Objekt. Abzug für Anzahl benötigter Aktionen if self.agent.carrying: return 1.0 else: return - 0.9 * (1 / self.max_episode_steps) #für jeden Schritt ohne Kiste wird ein der Reward etwas verringert def step(self, action): obs, reward, done, info = super().step(action) reward = self._reward() # Reward berechnen "Box einsammeln mit pick_up Aktion" if self.agent.carrying: self.entities.remove(self.agent.carrying) self.agent.carrying = None self.num_picked_up += 1 self.step_count = 0 # Timer nach erfolgreichem Aufsammeln zurücksetzen if self.num_picked_up == self.anzahl_objs: done = True # Episode beenden nach dem letzten Objekt return obs, reward, done, info def reset(self): """ Reset the simulation at the start of a new episode This also randomizes many environment parameters (domain randomization) """ # Step count since episode start self.step_count = 0 # Create the agent self.agent = Agent() self.agent.radius = self.agent_groesse # Anpassen der Agent-Größe # List of entities contained self.entities = [] # List of rooms in the world self.rooms = [] # Wall segments for collision detection # Shape is (N, 2, 3) self.wall_segs = [] # Generate the world self._gen_world() # Check if domain randomization is enabled or not rand = self.rand if self.domain_rand else None # Randomize elements of the world (domain randomization) self.params.sample_many(rand, self, [ 'sky_color', 'light_pos', 'light_color', 'light_ambient' ]) # Get the max forward step distance self.max_forward_step = self.params.get_max('forward_step') # Randomize parameters of the entities for ent in self.entities: ent.randomize(self.params, rand) # Compute the min and max x, z extents of the whole floorplan self.min_x = min([r.min_x for r in self.rooms]) self.max_x = max([r.max_x for r in self.rooms]) self.min_z = min([r.min_z for r in self.rooms]) self.max_z = max([r.max_z for r in self.rooms]) # Generate static data if len(self.wall_segs) == 0: self._gen_static_data() # Pre-compile static parts of the environment into a display list self._render_static() # Generate the first camera image obs = self.render_obs() # Return first observation return obs "------Erstellung des Raumes in MiniWorld------" def _gen_world(self): rows = [] # For each row for j in range(self.num_rows): row = [] # For each column for i in range(self.num_cols): min_x = i * (self.room_size + self.gap_size) max_x = min_x + self.room_size min_z = j * (self.room_size + self.gap_size) max_z = min_z + self.room_size room = self.add_rect_room( min_x=min_x, max_x=max_x, min_z=min_z, max_z=max_z, wall_tex='brick_wall', floor_tex='asphalt' ) row.append(room) rows.append(row) visited = set() 'Erstellung des Labyrinths und Plazierung der Objekte + Agent' def visit(i, j): """ Recursive backtracking maze construction algorithm Quelle: https://stackoverflow.com/questions/38502 """ 'Raumproportionen auslesen' room = rows[j][i] 'Wenn Nachbar schon bekannt wird Raum hinzugefügt' visited.add(room) 'Nachbar nach Zufallsprinzip festlegen' neighbors = self.rand.subset([(0, 1), (0, -1), (-1, 0), (1, 0)], 4) 'Für jeden möglichen Nachbarn ausführen' for dj, di in neighbors: ni = i + di nj = j + dj 'Befindet sich der Nachbar im definierten Raum, soll Algorithmus fortgeführt werden' if nj < 0 or nj >= self.num_rows: continue if ni < 0 or ni >= self.num_cols: continue 'Definition des Nachbarn an Zeite und Spalte orientieren' neighbor = rows[nj][ni] 'Ist der Nachbar schon bekannt, Algo fortführen' if neighbor in visited: continue 'Alle Nachbarn gesichtet -> Nachbarn werden verbunden zu einem Labyrinth' if di == 0: self.connect_rooms(room, neighbor, min_x=room.min_x, max_x=room.max_x) elif dj == 0: self.connect_rooms(room, neighbor, min_z=room.min_z, max_z=room.max_z) 'Rekursiever Aufruf der Funktion' visit(ni, nj) 'Backtracking-Algo aufrühren -> Startpunkt oben Links' visit(0, 0) 'Erstellen und plazieren der Objekte (Box)' 'Boxen werden horizontal ausgerichtet' if self.anzahl_objs == None: self.anzahl_objs = random.randint(self.anzahl_objs_min, self.anzahl_objs_max) for obj in range(self.anzahl_objs): self.box = self.place_entity(Box(color='red', size=0.9), dir=0) 'Zähler auf 0 setzen' self.num_picked_up = 0 'Plazieren des Agents' self.place_agent(dir=random.choice(self.start_winkel)) # rechtwinklige Ausrichtung des Agents am Maze
StarcoderdataPython
4872355
<reponame>Captmoonshot/pydango #!/usr/bin/env python3 import argparse from sqlalchemy import create_engine from pydango import ( cinephile, theater_owner, cinephile_sqlite, theater_owner_sqlite, ) from pydango.primary_func import ( create_session, create_sqlite_session, insert_account_data, insert_actor_data, insert_category_data, insert_director_data, insert_movie_data, insert_theater_data, ) from pydango.secondary_func import ( print_header, find_user_intent ) from pydango.tables import ( Base ) def get_args(): parser = argparse.ArgumentParser(description='Pydango Database') parser.add_argument('-d', '--database', metavar='database', default='postgresql', help='Provide a database type: (SQLite or PostgreSQL)') return parser.parse_args() def main(): args = get_args() if args.database == 'sqlite': # Option to use SQLite instead of PostgreSQL engine = create_engine('sqlite:///sqlite3.db') # sqlite session engine, session = create_sqlite_session(engine=engine) Base.metadata.create_all(engine) # Autoload some data without user/CLI interface insert_category_data(session=session) insert_director_data(session=session) insert_actor_data(session=session) insert_account_data(session=session) insert_movie_data(session=session) insert_theater_data(session=session) print_header() try: while True: if find_user_intent() == 'find': cinephile_sqlite.run() else: theater_owner_sqlite.run() except KeyboardInterrupt: return session.close() else: # postgresql session engine, session = create_session() Base.metadata.create_all(engine) # Autoload some data without user/CLI interface insert_category_data(session=session) insert_director_data(session=session) insert_actor_data(session=session) insert_account_data(session=session) insert_movie_data(session=session) insert_theater_data(session=session) print_header() try: while True: if find_user_intent() == 'find': cinephile.run() else: theater_owner.run() except KeyboardInterrupt: return session.close() if __name__ == '__main__': main()
StarcoderdataPython
4960869
<reponame>macodroid/strawberry_disease_classification import os import cv2 import numpy as np import shutil from bouding_box import get_all_points from data_utils import separate_files def extract_infected_area(image_name, json_file, path_to_file): image = cv2.imread(f'{path_to_file}/{image_name}') points = get_all_points(f'{path_to_file}/{json_file}') mask = np.zeros((image.shape[0], image.shape[1])) for p in points: cv2.fillConvexPoly(mask, np.asarray(p, dtype=np.int32), 1) mask = mask.astype(bool) out = np.zeros_like(image) out[mask] = image[mask] return out def main(): raw_data = 'data' root_dir = 'extract_dataset' data_type = ['train', 'test', 'val'] try: os.mkdir(root_dir) except: print('directory exists') shutil.rmtree(root_dir) os.mkdir(root_dir) for d_type in data_type: path_to_save = f'{root_dir}/{d_type}' path_to_file = f'{raw_data}/{d_type}' os.mkdir(path_to_save) image_name, json_name = separate_files(d_type) for i in range(len(image_name)): extracted_disease_img = extract_infected_area(image_name[i], json_name[i], path_to_file) cv2.imwrite(f'{path_to_save}/extract_{image_name[i]}', extracted_disease_img) main()
StarcoderdataPython
4943450
<filename>codes/structure3D.py #!/usr/local/bin/python import re f = open("structure3D.html", "w") f1 = open('Conformer3D_CID_89594.sdf') f2 = open('Conformer3D_CID_89594.sdf', encoding="utf-8") f3 = open('Conformer3D_CID_89594.sdf', encoding="utf-8") length = len(f3.readlines()) for j in range(length): feedback = re.search("\$\$\$\$", f2.readline()) if feedback: print(j) for i in range(j): S = f1.readline() if S != '\n': print(r"'"+S.rstrip('\n')+r'\n'+r"'"+' '+'+'+'\n',file=f) else: print(r"'"+r'\n'+r"'"+' '+'+'+'\n',file=f) print("'$$$$'\n", file=f) print("\n", file=f) print("</script>\n", file=f) print("<style>\n", file=f) print(" .hlong *{display:inline-block;vertical-align:middle}\n", file=f) print("</style>\n", file=f) print("""<div align="center" class="hlong">\n""", file=f) print("<div>\n", file=f) print("""<div style="width: 200px; height: 200px;">\n""", file=f) print("""<canvas id="render-canvas4" style="width: 200px; height: 200px; border: solid 1px #ccc;"></canvas>\n""", file=f) print("""</div>\n""", file=f) print("""</div>\n""", file=f) print("""</div>\n""", file=f) print("<script>\n", file=f) print(" if (PubChem3D_WebGL) {\n", file=f) print(" var M4 = new PubChem3D_WebGL.Molecule({\n", file=f) print(" canvas: document.getElementById('render-canvas4'),\n", file=f) print(" settings: {\n", file=f) print(" quality: 'High',\n", file=f) print(" backgroundColor: 'Transparent',\n", file=f) print(" model: 'Ball and Stick'\n", file=f) print(" }\n", file=f) print(" })\n", file=f) print(" setTimeout(function() {\n", file=f) print(" M4.addMain(sdf)\n", file=f) print(" M4.animate(true)\n", file=f) print(" },10)\n", file=f) print(" }\n", file=f) print("</script>\n", file=f) f.close() with open("structure3D.html", "r", encoding="utf-8") as f: length = len(f.readlines()) file = open("structure3D.html", "r", encoding="utf-8") with open("Struc3D.html", "w", encoding="utf-8") as f: f.write("""<script src="https://pubchem.ncbi.nlm.nih.gov/pcfe/structure-3d-webgl/structure-3d-webgl.min.js"></script>\n""") f.write("<script>\n") f.write("// example SDF\n") f.write("var sdf = ") for i in range(length): f.write(file.readline())
StarcoderdataPython
6594901
# coding:utf-8 import time import json import datetime import tornado from tornado.ioloop import IOLoop from tornado.web import RequestHandler from tornado.websocket import WebSocketHandler from tornado.concurrent import run_on_executor from tornado import gen from tornado.options import define, options, parse_command_line from collections import deque # 这个并发库在python3自带;在python2需要安装sudo pip install futures from concurrent.futures import ThreadPoolExecutor define("port", default=8888, type=int) settings = {"static_path": "template"} class just_now_router(RequestHandler): def get(self): self.write("i hope just now see you") class sleep_long_time_router(RequestHandler): def get(self): time.sleep(60) self.write("sleep 60s") class index_router(RequestHandler): def get(self): title1 = '' try: title1 = self.get_argument("text1") except: self.render("./templates/tailf_index.html", textDiv="") if title1: self.render("./templates/tailf_index.html", textDiv="textDiv") class sleep_async_router(RequestHandler): executor = ThreadPoolExecutor(2) def get(self): # 在执行add_callback方法后马上就会执行下一行代码,而callback函数将在下一轮事件循环中才调用,从而就能实现延迟任务。 # 当有一些耗时操作并不需要返回给请求方时,就可以采用延迟任务的形式,比如发送提醒邮件。 IOLoop.instance().add_callback(self.sleep) self.write("when i sleep") return @run_on_executor def sleep(self): print("sleep1 start", datetime.datetime.now()) time.sleep(5) print("sleep1 end", datetime.datetime.now()) class sleep_coroutine_router(RequestHandler): @tornado.gen.coroutine def get(self): print("sleep2 start", datetime.datetime.now()) tornado.gen.sleep(5) # sleep(5) self.write("after sleep, now I'm back %s" % time.strftime("%Y-%m-%d %H:%M:%S", time.localtime())) print("sleep2 end", datetime.datetime.now()) class sleep_router(RequestHandler): executor = ThreadPoolExecutor(10) @run_on_executor def get(self): print("sleep3 start", datetime.datetime.now()) time.sleep(5) self.write("after sleep, now I'm back %s" % time.strftime("%Y-%m-%d %H:%M:%S", time.localtime())) print("sleep3 end", datetime.datetime.now()) class wait_router(RequestHandler): executor = ThreadPoolExecutor(2) @tornado.gen.coroutine def get(self): result, m = yield tornado.gen.maybe_future(self.wait()) yield self.write({"result": result, "sum": m}) @run_on_executor def wait(self): time.sleep(5) return "success", (4, 5, 6) # 不要 yield 4,5,6 class chat_index_router(RequestHandler): def get(self): self.render("./templates/chat_index.html") class chat_room_router(WebSocketHandler): users = set() # 用来存放在线用户的容器 def open(self): self.users.add(self) # 建立连接后添加用户到容器中 for u in self.users: # 向已在线用户发送消息 u.write_message( u"[%s]-[%s]-进入聊天室" % (self.request.remote_ip, datetime.datetime.now().strftime("%Y-%m-%d %H:%M:%S"))) def on_message(self, message): for u in self.users: # 向在线用户广播消息 u.write_message(u"[%s]-[%s]-说:%s" % ( self.request.remote_ip, datetime.datetime.now().strftime("%Y-%m-%d %H:%M:%S"), message)) def on_close(self): self.users.remove(self) # 用户关闭连接后从容器中移除用户 for u in self.users: u.write_message( u"[%s]-[%s]-离开聊天室" % (self.request.remote_ip, datetime.datetime.now().strftime("%Y-%m-%d %H:%M:%S"))) def check_origin(self, origin): return True # 允许WebSocket的跨域请求 class tailf_router(WebSocketHandler): def open(self, *args): print("WebSocket opened") def on_message(self, message): def tail(filename, n=10): 'Return the last n lines of a file' while True: lines = '<br>'.join(list(deque(open(filename), n))) print("lines:", lines) self.write_message(lines) if lines: time.sleep(0.5) if "Control-C" in lines: self.close() break tail('ip.txt') def on_close(self): print("WebSocket closed") class send_router(WebSocketHandler): clients = set() def open(self): send_router.clients.add(self) self.write_message(json.dumps({'input': 'connected...'})) self.stream.set_nodelay(True) def on_message(self, message): message = json.loads(message) self.write_message(json.dumps({'input': 'response...'})) i = 0 while i <= 10: i += 1 self.write_message(json.dumps(message)) time.sleep(1) # 服务器主动关闭 self.close() send_router.clients.remove(self) def on_close(self): # 客户端主动关闭 send_router.clients.remove(self) app = tornado.web.Application([ (r'/', index_router), (r'/text1', index_router), (r"/justnow", just_now_router), (r"/sleep60", sleep_long_time_router), (r"/wait", wait_router), (r'/ws', tailf_router), (r'/sleep1', sleep_async_router), (r'/sleep2', sleep_coroutine_router), (r'/sleep3', sleep_router), (r'/send', send_router), (r'/into_chat', chat_index_router), (r'/chat', chat_room_router), ], **settings) if __name__ == '__main__': app.listen(options.port) IOLoop.instance().start() # 还是那句话:既然选择异步,那就全流程都得异步.
StarcoderdataPython
1935815
<reponame>lel352/Curso-Python<filename>aulapythonpoo/exercicio02/app.py from aulapythonpoo.exercicio02.classes.calcipv4 import CalcIPv4 def main(): """ Exemplos de Uso """ # Com prefixo calc_ipv4_1 = CalcIPv4(ip='192.168.0.128', prefixo=30) print(f'IP: {calc_ipv4_1.ip}') print(f'Máscara: {calc_ipv4_1.mascara}') print(f'Rede: {calc_ipv4_1.rede}') print(f'Broadcast: {calc_ipv4_1.broadcast}') print(f'Prefixo: {calc_ipv4_1.prefixo}') print(f'Número de IPs da rede: {calc_ipv4_1.numero_ips}') print('#' * 80) # Com máscara calc_ipv4_2 = CalcIPv4(ip='192.168.0.128', mascara='255.255.255.192') print(f'IP: {calc_ipv4_2.ip}') print(f'Máscara: {calc_ipv4_2.mascara}') print(f'Rede: {calc_ipv4_2.rede}') print(f'Broadcast: {calc_ipv4_2.broadcast}') print(f'Prefixo: {calc_ipv4_2.prefixo}') print(f'Número de IPs da rede: {calc_ipv4_2.numero_ips}') # if __name__ == '__main__': main()
StarcoderdataPython
1933404
<reponame>StrayRobots/stray import numpy as np from stray.scene import Scene import os import pickle import pycocotools.mask as mask_util import cv2 from stray import linalg MISSING_SEGMENTATIONS = 1 INCORRECT_NUMBER_OF_SEGMENTATIONS = 2 def validate_segmentations(scene): length = len(scene.get_image_filepaths()) for bbox_id in range(len(scene.bounding_boxes)): segmentation_path = os.path.join(scene.scene_path, "segmentation", f"instance_{bbox_id}") if not os.path.exists(segmentation_path): print(f"Missing segmentations at {segmentation_path}") exit(MISSING_SEGMENTATIONS) elif len([f for f in os.listdir(segmentation_path) if ".pickle" in f]) != length: print(f"Wrong number of segmentations at {segmentation_path}") exit(INCORRECT_NUMBER_OF_SEGMENTATIONS) def bbox_2d_from_mesh(camera, T_WC, object_mesh): T_CW = np.linalg.inv(T_WC) vertices = object_mesh.vertices image_points = camera.project(vertices, T_CW) upper_left = image_points.min(axis=0) lower_right = image_points.max(axis=0) return upper_left.tolist() + lower_right.tolist() def bbox_2d_from_pointcloud(camera, T_WC, pointcloud): # filter out points behind camera. T_CW = np.linalg.inv(T_WC) pc_local = linalg.transform_points(T_CW, pointcloud) pc = pointcloud[pc_local[:, 2] > 0.0] if pc.shape[0] == 0: return [0, 0, 0, 0] points2d = camera.project(pc, np.linalg.inv(T_WC)) upper_left = points2d.min(axis=0) image_size = np.array(camera.size) upper_left = np.maximum(points2d.min(axis=0), 0) upper_left = np.minimum(upper_left, image_size) lower_right = np.maximum(points2d.max(axis=0), 0) lower_right = np.minimum(lower_right, image_size) return upper_left.tolist() + lower_right.tolist() def get_bbox_3d_corners(camera, T_WC, bbox_3d): T_CW = np.linalg.inv(T_WC) size = bbox_3d.dimensions corners_world = [] for x_bbox in [-size[0]/2, size[0]/2]: for y_bbox in [-size[1]/2, size[1]/2]: for z_bbox in [-size[2]/2, size[2]/2]: corners_world.append(bbox_3d.position + bbox_3d.orientation.as_matrix()@np.array([x_bbox, y_bbox, z_bbox])) image_points = camera.project(np.array(corners_world), T_CW) return image_points def bbox_2d_from_bbox_3d(camera, T_WC, bbox_3d): image_points = get_bbox_3d_corners(camera, T_WC, bbox_3d) upper_left = image_points.min(axis=0) lower_right = image_points.max(axis=0) return upper_left.tolist() + lower_right.tolist() def bbox_2d_from_mask(scene, instance_id, i): with open(os.path.join(scene.scene_path, "segmentation", f"instance_{instance_id}", f"{i:06}.pickle"), 'rb') as handle: segmentation = pickle.load(handle) mask = mask_util.decode(segmentation) x,y,w,h = cv2.boundingRect(mask) return [x,y,x+w,y+h] def compute_instance_keypoints(camera, T_WC, instance, instance_keypoints, max_num_keypoints=0): T_CW = np.linalg.inv(T_WC) world_keypoints = [instance.position + instance.orientation.as_matrix()@np.multiply(np.array(kp),instance.dimensions/2) for kp in instance_keypoints] image_keypoints = camera.project(np.array(world_keypoints), T_CW) flat_keypoints = [] for image_point in image_keypoints: flat_keypoints.append(image_point[0]) flat_keypoints.append(image_point[1]) flat_keypoints.append(2) while len(flat_keypoints) < max_num_keypoints: flat_keypoints += [0, 0, 0] return flat_keypoints def get_scene_dataset_metadata(scene_paths): instance_categories = [] max_num_keypoints = 0 for scene_path in scene_paths: scene = Scene(scene_path) metadata = scene.metadata for bbox_id in scene.bbox_categories: if not bbox_id in instance_categories: instance_categories.append(bbox_id) if metadata: bbox_metadata_instance = [instance for instance in metadata["instances"] if instance["instance_id"] == bbox_id] if len(bbox_metadata_instance) > 0: num_keypoints = len(bbox_metadata_instance[0].get("keypoints", [])) max_num_keypoints = max(max_num_keypoints, num_keypoints) instance_category_mapping = {} for i, instance_id in enumerate(instance_categories): instance_category_mapping[f"instance_{instance_id}"] = i return { 'max_num_keypoints': max_num_keypoints, 'instance_category_mapping': instance_category_mapping, 'thing_classes': list(instance_category_mapping.keys()) } def get_detectron2_dataset_function(scene_paths, dataset_metadata, use_bbox_from_mask, use_segmentation): def inner(): examples = [] for scene_path in scene_paths: scene = Scene(scene_path) if use_segmentation: validate_segmentations(scene) width, height = scene.image_size() images = scene.get_image_filepaths() metadata = scene.metadata image_id = 0 max_num_keypoints = dataset_metadata["max_num_keypoints"] for image_path in images: filename = os.path.basename(image_path) image_idx = int(filename.split(".jpg")[0]) annotations = [] for bbox_id, bbox in enumerate(scene.bounding_boxes): if use_bbox_from_mask: bbox_flat = bbox_2d_from_mask(scene, bbox_id, image_idx) else: bbox_flat = bbox_2d_from_bbox_3d(scene.camera(), scene.poses[image_idx], bbox) annotation = { 'category_id': dataset_metadata['instance_category_mapping'][f"instance_{bbox.instance_id}"], 'bbox': bbox_flat, 'bbox_mode': 0 } if use_segmentation: with open(os.path.join(scene_path, "segmentation", f"instance_{bbox_id}", f"{image_idx:06}.pickle"), 'rb') as handle: segmentation = pickle.load(handle) annotation["segmentation"] = segmentation if metadata: bbox_metadata_instance = [instance for instance in metadata["instances"] if instance["instance_id"] == bbox.instance_id] bbox_keypoints = bbox_metadata_instance[0].get("keypoints", []) if len(bbox_metadata_instance) > 0 and len(bbox_keypoints) > 0: image_keypoints = compute_instance_keypoints(scene.camera(), scene.poses[image_idx], bbox, bbox_metadata_instance[0]["keypoints"], max_num_keypoints) annotation["keypoints"] = image_keypoints else: annotation["keypoints"] = [0 for _ in range(max_num_keypoints*3)] annotations.append(annotation) examples.append({ 'file_name': image_path, 'image_id': image_id, 'height': height, 'width': width, 'annotations': annotations }) image_id += 1 return examples return inner
StarcoderdataPython
1811474
from flask import Flask, jsonify, render_template, request from datasource.covid19 import Covid19 app = Flask(__name__) # Returns 200 ok. Used for "Test connection" on the datasource config page. @app.route('/', methods=['GET']) def index(): return render_template('index.html') # Used by the find metric options on the query tab in panels @app.route('/search', methods=['GET', 'POST']) def search(): covid19 = Covid19() return jsonify(covid19.metrics()) # Return metrics based on input @app.route('/query', methods=['POST']) def query(): covid19 = Covid19() series = [] for target in request.json["targets"]: series.append({ "target": target["target"], "datapoints": covid19.timeseries(target["target"]) }) return jsonify(series) # Returns annotations @app.route('/annotations') def annotations(): return jsonify([])
StarcoderdataPython
1615700
class Solution: def numDistinct(self, s: str, t: str) -> int: m = len(s) n = len(t) dp = [[0] * (n + 1) for _ in range(m + 1)] for i in range(m + 1): dp[i][0] = 1 for i in range(1, m + 1): for j in range(1, n + 1): if s[i - 1] == t[j - 1]: dp[i][j] = dp[i - 1][j - 1] + dp[i - 1][j] else: dp[i][j] = dp[i - 1][j] return dp[m][n]
StarcoderdataPython
6608363
<reponame>zefanyang/organseg_dags<filename>models/vnet/vnet.py import torch import torch.nn as nn import torch.nn.functional as F def passthrough(x, **kwargs): return x def non_linearity(elu, nchan): if elu: return nn.ELU(inplace=True) else: return nn.PReLU(nchan) class LUConv(nn.Module): def __init__(self, nchan, elu): super(LUConv, self).__init__() self.relu1 = non_linearity(elu, nchan) self.conv1 = nn.Conv3d(nchan, nchan, kernel_size=3, padding=1) self.bn1 = nn.BatchNorm3d(nchan) def forward(self, x): out = self.relu1(self.bn1(self.conv1(x))) return out def _make_nConv(nchan, depth, elu): layers = [] for _ in range(depth): layers.append(LUConv(nchan, elu)) return nn.Sequential(*layers) class InputTransition(nn.Module): def __init__(self, outChans, elu): super(InputTransition, self).__init__() self.conv1 = nn.Conv3d(1, 16, kernel_size=3, padding=1) self.bn1 = nn.BatchNorm3d(16) self.relu1 = non_linearity(elu, 16) def forward(self, x): # do we want a PRELU here as well? out = self.bn1(self.conv1(x)) # split input in to 16 channels x16 = torch.cat((x, x, x, x, x, x, x, x, x, x, x, x, x, x, x, x), 1) out = self.relu1(torch.add(out, x16)) return out class DownTransition(nn.Module): def __init__(self, inChans, nConvs, elu, dropout=False): super(DownTransition, self).__init__() outChans = 2*inChans self.down_conv = nn.Conv3d(inChans, outChans, kernel_size=2, stride=2) self.bn1 = nn.BatchNorm3d(outChans) self.do1 = passthrough self.relu1 = non_linearity(elu, outChans) self.relu2 = non_linearity(elu, outChans) if dropout: self.do1 = nn.Dropout3d() self.ops = _make_nConv(outChans, nConvs, elu) def forward(self, x): down = self.relu1(self.bn1(self.down_conv(x))) out = self.do1(down) out = self.ops(out) out = self.relu2(torch.add(out, down)) return out class UpTransition(nn.Module): def __init__(self, inChans, outChans, nConvs, elu, dropout=False): super(UpTransition, self).__init__() self.up_conv = nn.ConvTranspose3d(inChans, outChans // 2, kernel_size=2, stride=2) self.bn1 = nn.BatchNorm3d(outChans // 2) self.do1 = passthrough self.do2 = nn.Dropout3d() self.relu1 = non_linearity(elu, outChans // 2) self.relu2 = non_linearity(elu, outChans) if dropout: self.do1 = nn.Dropout3d() self.ops = _make_nConv(outChans, nConvs, elu) def forward(self, x, skipx): out = self.do1(x) skipxdo = self.do2(skipx) out = self.relu1(self.bn1(self.up_conv(out))) # double resolution, half channels, e.g., 256 -> 128 xcat = torch.cat((out, skipxdo), 1) # 128 cat 128 -> 256 out = self.ops(xcat) # 256 -> 256 out = self.relu2(torch.add(out, xcat)) # shortcut connection return out class OutputTransition(nn.Module): def __init__(self, inChans, elu): super(OutputTransition, self).__init__() self.conv1 = nn.Conv3d(inChans, 9, kernel_size=3, padding=1) self.bn1 = nn.BatchNorm3d(9) self.conv2 = nn.Conv3d(9, 9, kernel_size=1) self.relu1 = non_linearity(elu, 9) # if nll: # self.softmax = F.log_softmax # else: # self.softmax = F.softmax def forward(self, x): # convolve 32 down to 2 channels out = self.relu1(self.bn1(self.conv1(x))) out = self.conv2(out) # make channels the last axis # out = out.permute(0, 2, 3, 4, 1).contiguous() # flatten # out = out.view(out.numel() // 2, 2) # out = self.softmax(out) # treat channel 0 as the predicted output return out class VNetKnl3(nn.Module): # the number of convolutions in each layer corresponds # to what is in the actual prototxt, not the intent def __init__(self, elu=True): super(VNetKnl3, self).__init__() self.in_tr = InputTransition(16, elu) self.down_tr32 = DownTransition(16, 1, elu) self.down_tr64 = DownTransition(32, 2, elu) # The performance decreases when dropout is closed self.down_tr128 = DownTransition(64, 3, elu, dropout=True) self.down_tr256 = DownTransition(128, 2, elu, dropout=True) self.up_tr256 = UpTransition(256, 256, 2, elu, dropout=True) self.up_tr128 = UpTransition(256, 128, 2, elu, dropout=True) self.up_tr64 = UpTransition(128, 64, 1, elu) self.up_tr32 = UpTransition(64, 32, 1, elu) self.out_tr = OutputTransition(32, elu) def forward(self, x): out16 = self.in_tr(x) out32 = self.down_tr32(out16) out64 = self.down_tr64(out32) out128 = self.down_tr128(out64) out256 = self.down_tr256(out128) out = self.up_tr256(out256, out128) out = self.up_tr128(out, out64) out = self.up_tr64(out, out32) out = self.up_tr32(out, out16) out = self.out_tr(out) return out
StarcoderdataPython
9709855
<reponame>PyDataMadrid2016/Conference-Info from sklearn.linear_model import LogisticRegression logit = LogisticRegression() logit.fit(df[['age', 'distance']], df['attended']) def get_y(x): return -(logit.intercept_[0] + logit.coef_[0,1] * x) / logit.coef_[0,0] plot = base_plot() min_x, max_x = df['distance'].min(), df['distance'].max() plot.line(x=[min_x, max_x], y=[get_y(min_x), get_y(max_x)], line_color='black', line_width=2) _ = show(plot)
StarcoderdataPython
4931911
<reponame>iecedge/xos # Copyright 2017-present Open Networking Foundation # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. import unittest from mock import patch import mock import pdb import networkx as nx import os import sys test_path = os.path.abspath(os.path.dirname(os.path.realpath(__file__))) xos_dir = os.path.join(test_path, "..", "..", "..") class TestServices(unittest.TestCase): def setUp(self): self.sys_path_save = sys.path self.cwd_save = os.getcwd() sys.path.append(xos_dir) sys.path.append(os.path.join(xos_dir, "synchronizers", "new_base")) sys.path.append( os.path.join(xos_dir, "synchronizers", "new_base", "tests", "steps") ) config = os.path.join(test_path, "test_config.yaml") from xosconfig import Config Config.clear() Config.init(config, "synchronizer-config-schema.yaml") from synchronizers.new_base.mock_modelaccessor_build import ( build_mock_modelaccessor, ) build_mock_modelaccessor(xos_dir, services_dir=None, service_xprotos=[]) os.chdir(os.path.join(test_path, "..")) # config references tests/model-deps import event_loop reload(event_loop) import backend reload(backend) from modelaccessor import model_accessor # import all class names to globals for (k, v) in model_accessor.all_model_classes.items(): globals()[k] = v b = backend.Backend() steps_dir = Config.get("steps_dir") self.steps = b.load_sync_step_modules(steps_dir) self.synchronizer = event_loop.XOSObserver(self.steps) def tearDown(self): sys.path = self.sys_path_save os.chdir(self.cwd_save) def test_service_models(self): s = Service() a = ServiceInstance(owner=s) cohorts = self.synchronizer.compute_dependent_cohorts([a, s], False) self.assertIn([s, a], cohorts) cohorts = self.synchronizer.compute_dependent_cohorts([s, a], False) self.assertIn([s, a], cohorts) cohorts = self.synchronizer.compute_dependent_cohorts([a, s], True) self.assertIn([a, s], cohorts) cohorts = self.synchronizer.compute_dependent_cohorts([s, a], True) self.assertIn([a, s], cohorts) if __name__ == "__main__": unittest.main()
StarcoderdataPython
5068425
<reponame>joesingo/tom_education<filename>tom_education/utils.py def assert_valid_suffix(filename, allowed_suffixes): """ Check that `filename` has one of the strings in `allowed_suffixes` as a suffix. Raises an AssertionError if not. """ if not any(filename.endswith(suffix) for suffix in allowed_suffixes): err_msg = ( "File '{}' does not end an allowed filename suffix ({})" .format(filename, ', '.join(allowed_suffixes)) ) raise AssertionError(err_msg)
StarcoderdataPython
9619341
import numpy as np from hydroDL.utils import grid from hydroDL.post import axplot, figplot import os import rnnSMAP import matplotlib import matplotlib.pyplot as plt import matplotlib.gridspec as gridspec import imp imp.reload(rnnSMAP) rnnSMAP.reload() matplotlib.rcParams.update({'font.size': 14}) matplotlib.rcParams.update({'lines.linewidth': 2}) matplotlib.rcParams.update({'lines.markersize': 6}) # temporal test trainName = 'CONUSv2f1' testName = 'CONUSv2f2' out = trainName+'_y15_Forcing_dr60' rootDB = rnnSMAP.kPath['DB_L3_NA'] rootOut = rnnSMAP.kPath['Out_L3_NA'] predField = 'LSTM' targetField = 'SMAP' ds = rnnSMAP.classDB.DatasetPost( rootDB=rootDB, subsetName=testName, yrLst=[2015]) ds.readData(var='SMAP_AM', field='SMAP') ds.readPred(rootOut=rootOut, out=out, field='LSTM') statErr = ds.statCalError(predField='LSTM', targetField='SMAP') lat = ds.crd[:, 0] lon = ds.crd[:, 1] gridRMSE, uy, ux = grid.array2grid(statErr.RMSE, lat=lat, lon=lon) gridCorr, uy, ux = grid.array2grid(statErr.rho, lat=lat, lon=lon) fig, axes = plt.subplots(2, 1, figsize=(9, 10)) axplot.mapGrid(axes[0], uy, ux, gridRMSE, vRange=[0, 0.1], cmap=plt.cm.jet) axes[0].set_title('Spatial Test RMSE') axplot.mapGrid(axes[1], uy, ux, gridCorr, vRange=[0.5, 1], cmap=plt.cm.jet) axes[1].set_title('Spatial Test Correlation') fig.show() np.nanmean(statErr.RMSE) np.nanmean(statErr.rho)
StarcoderdataPython
73090
from pathlib import Path import json from django.core.management import call_command from django.core.files.uploadedfile import SimpleUploadedFile from django.urls import reverse import pytest from geocontrib.models.project import Project from geocontrib.models.user import UserLevelPermission from geocontrib.models.user import User def verify_or_create_json(filename, json_result): path = Path(filename) if path.exists(): with path.open() as fp: json_expected = json.load(fp) assert json_expected == json_result else: with path.open("w") as fp: json.dump(json_result, fp) @pytest.mark.skip(""" Test en echec : il faidrait lancer celery avec la conf de test ou regarder la doc celery pour le tester On peut lancer le test à la main comme ça curl --user admin:passpass 'http://localhost:8000/api/import-tasks/' -F 'feature_type_slug=1-dfsdfs' -F 'json_file=@api/tests/data/test_features_featuretype_admin.json' et ensuite controller qu'on a bien le même feature type via DRF : http://127.0.0.1:8000/api/features/?feature_type__slug=1-dfsdfs """) @pytest.mark.django_db @pytest.mark.freeze_time('2021-08-05') def test_import_post(api_client): # Given call_command("loaddata", "geocontrib/data/perm.json", verbosity=0) call_command("loaddata", "api/tests/data/test_import_tasks.json", verbosity=0) user = User.objects.get(username="admin") api_client.force_authenticate(user=user) # When importing some features # create task filename = 'export_projet.json' with open("api/tests/data/test_features_featuretype_admin.json", 'rb') as fp: simple_file = SimpleUploadedFile(filename, fp.read(), content_type='multipart/form-data') result = api_client.post('/api/import-tasks/', { "feature_type_slug": "1-dfsdfs", "json_file": simple_file, }) assert result.status_code == 200 # run task # Then Ensure admin feature type => get all published features of the feature type result = api_client.get('/api/features/?feature_type__slug=1-dfsdfs') assert result.status_code == 200 verify_or_create_json("api/tests/data/test_features_featuretype_admin.json", result.json())
StarcoderdataPython
4934854
<filename>cyder/core/system/migrations/0001_initial.py # -*- coding: utf-8 -*- import datetime from south.db import db from south.v2 import SchemaMigration from django.db import models class Migration(SchemaMigration): def forwards(self, orm): # Adding model 'System' db.create_table('system', ( ('id', self.gf('django.db.models.fields.AutoField')(primary_key=True)), ('created', self.gf('django.db.models.fields.DateTimeField')(auto_now_add=True, blank=True)), ('modified', self.gf('django.db.models.fields.DateTimeField')(auto_now=True, blank=True)), ('name', self.gf('django.db.models.fields.CharField')(max_length=255)), ('department', self.gf('django.db.models.fields.CharField')(max_length=255)), ('location', self.gf('django.db.models.fields.CharField')(max_length=255, null=True, blank=True)), )) db.send_create_signal('system', ['System']) # Adding unique constraint on 'System', fields ['name', 'location', 'department'] db.create_unique('system', ['name', 'location', 'department']) # Adding model 'SystemKeyValue' db.create_table('system_key_value', ( ('id', self.gf('django.db.models.fields.AutoField')(primary_key=True)), ('key', self.gf('django.db.models.fields.CharField')(max_length=255)), ('value', self.gf('django.db.models.fields.CharField')(max_length=255)), ('is_quoted', self.gf('django.db.models.fields.BooleanField')(default=False)), ('system', self.gf('django.db.models.fields.related.ForeignKey')(to=orm['system.System'])), )) db.send_create_signal('system', ['SystemKeyValue']) # Adding unique constraint on 'SystemKeyValue', fields ['key', 'value', 'system'] db.create_unique('system_key_value', ['key', 'value', 'system_id']) def backwards(self, orm): # Removing unique constraint on 'SystemKeyValue', fields ['key', 'value', 'system'] db.delete_unique('system_key_value', ['key', 'value', 'system_id']) # Removing unique constraint on 'System', fields ['name', 'location', 'department'] db.delete_unique('system', ['name', 'location', 'department']) # Deleting model 'System' db.delete_table('system') # Deleting model 'SystemKeyValue' db.delete_table('system_key_value') models = { 'system.system': { 'Meta': {'unique_together': "(('name', 'location', 'department'),)", 'object_name': 'System', 'db_table': "'system'"}, 'created': ('django.db.models.fields.DateTimeField', [], {'auto_now_add': 'True', 'blank': 'True'}), 'department': ('django.db.models.fields.CharField', [], {'max_length': '255'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'location': ('django.db.models.fields.CharField', [], {'max_length': '255', 'null': 'True', 'blank': 'True'}), 'modified': ('django.db.models.fields.DateTimeField', [], {'auto_now': 'True', 'blank': 'True'}), 'name': ('django.db.models.fields.CharField', [], {'max_length': '255'}) }, 'system.systemkeyvalue': { 'Meta': {'unique_together': "(('key', 'value', 'system'),)", 'object_name': 'SystemKeyValue', 'db_table': "'system_key_value'"}, 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'is_quoted': ('django.db.models.fields.BooleanField', [], {'default': 'False'}), 'key': ('django.db.models.fields.CharField', [], {'max_length': '255'}), 'system': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['system.System']"}), 'value': ('django.db.models.fields.CharField', [], {'max_length': '255'}) } } complete_apps = ['system']
StarcoderdataPython
8100588
import pytest from starlette.applications import Starlette from starlette.exceptions import HTTPException from starlette.testclient import TestClient import layaberr.starlette @pytest.fixture def client(): app = Starlette(exception_handlers=layaberr.starlette.exception_handlers) @app.route("/bad_request") def bad_request(request): raise HTTPException(400) @app.route("/bad_request_detail") def bad_request(request): raise HTTPException(400, detail="Error message") @app.route("/default_error") def default_error(request): raise Exception return TestClient(app, raise_server_exceptions=False) def test_bad_request(client): response = client.get("/bad_request") assert response.status_code == 400 assert response.text == "Bad Request" def test_bad_request_detail(client): response = client.get("/bad_request_detail") assert response.status_code == 400 assert response.text == "Error message" def test_default(client): response = client.get("/default_error") assert response.status_code == 500 assert response.json() == ""
StarcoderdataPython
3217253
<filename>parkstay/cron.py from datetime import date, timedelta from django_cron import CronJobBase, Schedule from parkstay.models import Booking from parkstay.reports import outstanding_bookings from parkstay.emails import send_booking_confirmation from parkstay.utils import oracle_integration class UnpaidBookingsReportCronJob(CronJobBase): RUN_AT_TIMES = ['01:00'] schedule = Schedule(run_at_times=RUN_AT_TIMES) code = 'parkstay.unpaid_bookings_report' def do(self): outstanding_bookings() class OracleIntegrationCronJob(CronJobBase): RUN_AT_TIMES = ['01:00'] schedule = Schedule(run_at_times=RUN_AT_TIMES) code = 'parkstay.oracle_integration' def do(self): oracle_integration(str(date.today() - timedelta(days=1)), False) class SendBookingsConfirmationCronJob(CronJobBase): RUN_EVERY_MINS = 5 schedule = Schedule(run_at_times=RUN_EVERY_MINS) code = 'parkstay.send_booking_confirmations' def do(self): try: # Update confirmation_status for b in Booking.objects.all(): if not b.paid and b.confirmation_sent: b.confirmation_sent = False b.save() unconfirmed = Booking.objects.filter(confirmation_sent=False) if unconfirmed: for b in unconfirmed: if b.paid: send_booking_confirmation(b) except: raise
StarcoderdataPython
1661644
<filename>website/forms.py<gh_stars>1-10 from flask_wtf import Form from wtforms import StringField, BooleanField, PasswordField, HiddenField, validators from wtforms.validators import DataRequired search_validator = validators.Regexp('^[a-zA-Z0-9\. ]*$', message="Search contains invalid characters.") class SearchForm(Form): keywords = StringField("keywords", validators=[search_validator, validators.Length(max=100, message="Search too long.")])
StarcoderdataPython
9720439
<reponame>mrmonkington/gaphor from __future__ import annotations import ast from dataclasses import replace from math import atan2 import gaphas from gaphas.aspect.connector import ConnectionSink from gaphas.aspect.connector import Connector as ConnectorAspect from gaphas.connector import Handle from gaphas.geometry import Rectangle, distance_rectangle_point from gaphas.solver.constraint import BaseConstraint from gaphor.core.modeling.diagram import Diagram from gaphor.core.modeling.event import RevertibeEvent from gaphor.core.modeling.presentation import Presentation, S from gaphor.core.modeling.properties import attribute from gaphor.core.styling import Style, merge_styles from gaphor.diagram.shapes import stroke from gaphor.diagram.text import TextAlign, text_point_at_line class Named: """Marker for any NamedElement presentations.""" class Classified(Named): """Marker for Classifier presentations.""" def from_package_str(item): """Display name space info when it is different, then diagram's or parent's namespace.""" subject = item.subject diagram = item.diagram if not (subject and diagram): return False namespace = subject.namespace parent = item.parent # if there is a parent (i.e. interaction) if parent and parent.subject and parent.subject.namespace is not namespace: return False return f"(from {namespace.name})" if namespace is not item.diagram.owner else "" def postload_connect(item: gaphas.Item, handle: gaphas.Handle, target: gaphas.Item): """Helper function: when loading a model, handles should be connected as part of the `postload` step. This function finds a suitable spot on the `target` item to connect the handle to. """ connector = ConnectorAspect(item, handle, item.diagram.connections) sink = ConnectionSink(target, distance=1e4) connector.connect(sink) class HandlePositionEvent(RevertibeEvent): requires_transaction = False def __init__(self, element, index, old_value): super().__init__(element) self.index = index self.old_value = old_value def revert(self, target): target.handles()[self.index].pos = self.old_value target.request_update() class HandlePositionUpdate: def watch_handle(self, handle): handle.pos.add_handler(self._on_handle_position_update) def remove_watch_handle(self, handle): handle.pos.remove_handler(self._on_handle_position_update) def _on_handle_position_update(self, position, old): for index, handle in enumerate(self.handles()): # type: ignore[attr-defined] if handle.pos is position: break else: return self.handle(HandlePositionEvent(self, index, old)) # type: ignore[attr-defined] # Note: the official documentation is using the terms "Shape" and "Edge" for element and line. class ElementPresentation(gaphas.Element, HandlePositionUpdate, Presentation[S]): """Presentation for Gaphas Element (box-like) items. To create a shape (boxes, text), assign a shape to `self.shape`. If the shape can change, for example, because styling needs to change, implement the method `update_shapes()` and set self.shape there. """ _port_sides = ("top", "right", "bottom", "left") def __init__(self, diagram: Diagram, id=None, shape=None, width=100, height=50): super().__init__(connections=diagram.connections, diagram=diagram, id=id, width=width, height=height) # type: ignore[call-arg] self._shape = shape for handle in self.handles(): self.watch_handle(handle) diagram.connections.add_constraint( self, MinimalValueConstraint(self.min_width, width) ) diagram.connections.add_constraint( self, MinimalValueConstraint(self.min_height, height) ) def port_side(self, port): return self._port_sides[self._ports.index(port)] def _set_shape(self, shape): self._shape = shape self.request_update() shape = property(lambda s: s._shape, _set_shape) def update_shapes(self, event=None): """Updating the shape configuration, e.g. when extra elements have to be drawn or when styling changes.""" def update(self, context): if not self.shape: self.update_shapes() if self.shape: self.min_width, self.min_height = self.shape.size(context) def draw(self, context): x, y = self.handles()[0].pos cairo = context.cairo cairo.translate(x, y) self._shape.draw( context, Rectangle(0, 0, self.width, self.height), ) def save(self, save_func): save_func("matrix", tuple(self.matrix)) save_func("width", self.width) save_func("height", self.height) super().save(save_func) def load(self, name, value): if name == "width": self.width = ast.literal_eval(value) elif name == "height": self.height = ast.literal_eval(value) else: super().load(name, value) def postload(self): super().postload() self.update_shapes() class MinimalValueConstraint(BaseConstraint): def __init__(self, var, min): super().__init__(var) self._min = min def solve_for(self, var): min = self._min if var is min: return var.value = max(var.value, min) class LinePresentation(gaphas.Line, HandlePositionUpdate, Presentation[S]): def __init__( self, diagram: Diagram, id=None, style: Style = {}, shape_head=None, shape_middle=None, shape_tail=None, ): super().__init__(connections=diagram.connections, diagram=diagram, id=id) # type: ignore[call-arg] self.style = style self.shape_head = shape_head self.shape_middle = shape_middle self.shape_tail = shape_tail self.fuzziness = 2 self._shape_head_rect = None self._shape_middle_rect = None self._shape_tail_rect = None self.watch("orthogonal", self._on_orthogonal).watch( "horizontal", self._on_horizontal ) self.watch_handle(self.head) self.watch_handle(self.tail) head = property(lambda self: self._handles[0]) tail = property(lambda self: self._handles[-1]) orthogonal: attribute[int] = attribute("orthogonal", int, 0) horizontal: attribute[int] = attribute("horizontal", int, 0) @property def middle_shape_size(self) -> Rectangle: return self._shape_middle_rect def insert_handle(self, index: int, handle: Handle) -> None: super().insert_handle(index, handle) self.watch_handle(handle) def remove_handle(self, handle: Handle) -> None: self.remove_watch_handle(handle) super().remove_handle(handle) def update_shape_bounds(self, context): def shape_bounds(shape, align): if shape: size = shape.size(context) x, y = text_point_at_line(points, size, align) return Rectangle(x, y, *size) points = [h.pos for h in self.handles()] self._shape_head_rect = shape_bounds(self.shape_head, TextAlign.LEFT) self._shape_middle_rect = shape_bounds(self.shape_middle, TextAlign.CENTER) self._shape_tail_rect = shape_bounds(self.shape_tail, TextAlign.RIGHT) def point(self, x, y): """Given a point (x, y) return the distance to the diagram item.""" d0 = super().point(x, y) ds = [ distance_rectangle_point(shape, (x, y)) for shape in ( self._shape_head_rect, self._shape_middle_rect, self._shape_tail_rect, ) if shape ] return min(d0, *ds) if ds else d0 def draw(self, context): def draw_line_end(end_handle, second_handle, draw): pos, p1 = end_handle.pos, second_handle.pos angle = atan2(p1.y - pos.y, p1.x - pos.x) cr.save() try: cr.translate(*pos) cr.rotate(angle) draw(context) finally: cr.restore() style = merge_styles(context.style, self.style) context = replace(context, style=style) self.update_shape_bounds(context) cr = context.cairo handles = self._handles draw_line_end(handles[0], handles[1], self.draw_head) for h in self._handles[1:-1]: cr.line_to(*h.pos) draw_line_end(handles[-1], handles[-2], self.draw_tail) stroke(context) for shape, rect in ( (self.shape_head, self._shape_head_rect), (self.shape_middle, self._shape_middle_rect), (self.shape_tail, self._shape_tail_rect), ): if shape: shape.draw(context, rect) def save(self, save_func): def save_connection(name, handle): c = self._connections.get_connection(handle) if c: save_func(name, c.connected) super().save(save_func) save_func("matrix", tuple(self.matrix)) points = [tuple(map(float, h.pos)) for h in self.handles()] save_func("points", points) save_connection("head-connection", self.head) save_connection("tail-connection", self.tail) def load(self, name, value): if name == "points": points = ast.literal_eval(value) for _ in range(len(points) - 2): h = Handle((0, 0)) self._handles.insert(1, h) self.watch_handle(h) for i, p in enumerate(points): self.handles()[i].pos = p self._update_ports() elif name in ("head_connection", "head-connection"): self._load_head_connection = value elif name in ("tail_connection", "tail-connection"): self._load_tail_connection = value else: super().load(name, value) def postload(self): super().postload() if self.orthogonal: self._set_orthogonal(self.orthogonal) if hasattr(self, "_load_head_connection"): postload_connect(self, self.head, self._load_head_connection) assert self._connections.get_connection(self.head) del self._load_head_connection if hasattr(self, "_load_tail_connection"): postload_connect(self, self.tail, self._load_tail_connection) assert self._connections.get_connection(self.tail) del self._load_tail_connection def _on_orthogonal(self, event): self._set_orthogonal(event.new_value) def _on_horizontal(self, event): self._set_horizontal(event.new_value)
StarcoderdataPython
6606272
<reponame>Gianfra45/Proyecto---Programacion def estCondicional01(): #Definir variables y otros print("Ejemplo estructura Condicional en Python") montoP=0 #Datos de entrada cantidadX=int(input("Ingrese la cantidad de lapices:")) #Proceso if cantidadX>=1000: montoP=cantidadX*0.80 else: montoP=cantidadX*0.90 #Datos de salida print("El monto a pagar es:", montoP) def muestramenoredad(): #Definir variables y otros pnombre="" pedad=0 #Datos de entrada p1nombre=input("Ingrese nombre de 1era persona:") p1edad=int(input("Ingrese edad de 1era persona:")) p2nombre=input("Ingrese nombre de 2era persona:") p2edad=int(input("Ingrese edad de 2era persona:")) p3nombre=input("Ingrese nombre de 3era persona:") p3edad=int(input("Ingrese edad de 3era persona:")) #Proceso if p1edad<p2edad and p1edad<p3edad: pnombre=p1nombre pedad=p1edad elif p2edad<p1edad and p2edad<p3edad: pnombre=p2nombre pedad=p2edad elif p3edad<p1edad and p3edad<p2edad: pnombre=p3nombre pedad=p3edad elif p1edad==p2edad and p1edad==p3edad: pnombre=p1nombre+", "+p2nombre+" y "+p3nombre pedad=p1edad elif p1edad==p2edad: pnombre=p1nombre+" y "+p2nombre pedad=p2edad else: pnombre=p2nombre+" y "+p3nombre pedad=p3edad #Datos de Salida print("La(s):persona(s)", pnombre, "tiene(n):", pedad) estCondicional() muestramenoredad()
StarcoderdataPython
9786727
# Copyright (c) 2020 <NAME> # # Permission is hereby granted, free of charge, to any person obtaining a copy # of this software and associated documentation files (the "Software"), to deal # in the Software without restriction, including without limitation the rights # to use, copy, modify, merge, publish, distribute, sublicense, and/or sell # copies of the Software, and to permit persons to whom the Software is # furnished to do so, subject to the following conditions: # # The above copyright notice and this permission notice shall be included in all # copies or substantial portions of the Software. # # THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR # IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, # FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE # AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER # LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, # OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE # SOFTWARE. import os import random from tqdm import tqdm def main(): train_numbers = random.sample(range(1000, 10000), 5000) train_numbers += random.sample(range(1000, 10000), 5000) train_numbers += random.sample(range(1000, 10000), 5000) train_numbers += random.sample(range(10000, 100000), 5000) train_numbers += random.sample(range(100000, 1000000), 5000) for idx in range(1, 16): train_numbers += random.sample(range(0, 1000), 1000) test_numbers = random.sample(range(0, 1000), 1000) test_numbers += random.sample(range(0, 1000), 1000) test_numbers += random.sample(range(0, 10000), 1000) test_numbers += random.sample(range(0, 100000), 500) test_numbers += random.sample(range(0, 1000000), 500) random.shuffle(train_numbers) random.shuffle(test_numbers) os.makedirs(os.path.join("data", "amount"), exist_ok=True) for phase, numbers in [("train", train_numbers), ("valid", test_numbers)]: with open(os.path.join("data", "amount", "{}.tsv".format(phase)), "w") as fp: for number in tqdm(numbers, total=len(numbers)): if random.sample(range(1, 10000), 1)[0] % 20 == 0: if random.sample(range(1, 10000), 1)[0] % 10 == 0: fp.write(str(number) + "\t" + str(number) + ",00" + "\n") else: exp = "{}".format(random.sample(range(0, 100), 1)[0]) if len(exp) == 1: exp = "0" + exp fp.write(str(number) + "." + exp + "\t" + str(number) + "," + exp + "\n") else: fnum = str(number) # if len(fnum) > 3: # fnum = fnum[:-3] + "," + fnum[-3:] # if len(fnum) == 7: # if random.sample(range(1, 10000), 1)[0] % 2 == 0: # fnum = fnum[0] + ',' + fnum[1:] if random.sample(range(1, 10000), 1)[0] % 20 == 0: fp.write(fnum + "\t" + str(number) + ",00" + "\n") else: exp = "{}".format(random.sample(range(0, 100), 1)[0]) if len(exp) == 1: exp = "0" + exp fp.write(fnum + "," + exp + "\t" + str(number) + "," + exp + "\n") if __name__ == '__main__': main()
StarcoderdataPython
6411973
#!/usr/bin/env python3 import os import sys # Add the boundfield_renderer app to the PYTHONPATH sys.path.append(os.path.dirname(os.path.dirname(os.path.realpath(__file__)))) if __name__ == "__main__": os.environ.setdefault("DJANGO_SETTINGS_MODULE", "settings") try: from django.core.management import execute_from_command_line except ImportError as exc: raise ImportError( "Couldn't import Django. Are you sure it's installed and " "available on your PYTHONPATH environment variable? Did you " "forget to activate a virtual environment?" ) from exc execute_from_command_line(sys.argv)
StarcoderdataPython
3459951
import requests from bs4 import BeautifulSoup import csv page = requests.get('https://www.census.gov/programs-surveys/popest.html') print(page.status_code) soup = BeautifulSoup(page.text, 'html.parser') link_set = set() for link in soup.find_all('a'): web_links = link.get("href") print(web_links) link_set.add(web_links) csvfile = open('code_python.csv', 'w+', newline='') writer = csv.writer(csvfile) writer.writerow(['Links']) for link in link_set: writer.writerow([link]) csvfile.close()
StarcoderdataPython
11365144
"""Diagnostics support for RainMachine.""" from __future__ import annotations from typing import Any from regenmaschine.controller import Controller from homeassistant.components.diagnostics import async_redact_data from homeassistant.config_entries import ConfigEntry from homeassistant.const import CONF_LATITUDE, CONF_LONGITUDE, CONF_PASSWORD from homeassistant.core import HomeAssistant from homeassistant.helpers.update_coordinator import DataUpdateCoordinator from .const import DATA_CONTROLLER, DATA_COORDINATOR, DOMAIN TO_REDACT = { CONF_LATITUDE, CONF_LONGITUDE, CONF_PASSWORD, } async def async_get_config_entry_diagnostics( hass: HomeAssistant, entry: ConfigEntry ) -> dict[str, Any]: """Return diagnostics for a config entry.""" data = hass.data[DOMAIN][entry.entry_id] coordinators: dict[str, DataUpdateCoordinator] = data[DATA_COORDINATOR] controller: Controller = data[DATA_CONTROLLER] return { "entry": { "title": entry.title, "data": async_redact_data(entry.data, TO_REDACT), "options": dict(entry.options), }, "data": { "coordinator": async_redact_data( { api_category: controller.data for api_category, controller in coordinators.items() }, TO_REDACT, ), "controller": { "api_version": controller.api_version, "hardware_version": controller.hardware_version, "name": controller.name, "software_version": controller.software_version, }, }, }
StarcoderdataPython
9620636
""" Functions to access node data from the Osmo database """ import dateutil import pandas as pd import pytz import sqlalchemy import textwrap from getpass import getpass from osmo_jupyter import timezone def configure_database(): """ Configure a database object for read-only technician access to Osmo data. Requires user input to collect database password. Returns: sqlalchemy Engine object which can be used with other functions in this module. Raises: ValueError: if connection can't be made, usually because password is incorrect """ print("Enter database password: (if you don't know it, ask someone who does)") db_engine = sqlalchemy.create_engine( "mysql+pymysql://{user}:{password}@{host}/{dbname}".format( user="technician", password=getpass(), # Ask user for the password to avoid checking it in. dbname="osmobot", host="osmobot-db2.cxvkrr48hefm.us-west-2.rds.amazonaws.com", ) ) try: connection = db_engine.connect() except sqlalchemy.exc.OperationalError as e: raise ValueError( textwrap.dedent( f"""Couldn't connect to the database - most likely you typed the password incorrectly. Please try again.\n Original error: {e} """ ) ) else: connection.close() return db_engine SQL_TIME_FORMAT = "%Y-%m-%d %H:%M:%S" # Time format favored by mysql def _to_aware(local_time): """ get a timezone-aware object from local time string(s). Internal function, used only in DB access. Args: local_time: string of local time in any valid non-timezone-aware ISO format Time should be in Osmo HQ local time. eg. ('2012-01-01 12:00:00', '2012-01-01 12:00', '2012-01-01') Returns: timezone-aware datetime object """ time = dateutil.parser.isoparse(local_time) return timezone.OSMO_HQ_TIMEZONE.localize(time) def _to_utc_string(local_time): """ Convert a local time string to a string in UTC that can be passed to the database Internal function, used only in DB access. Args: local_time: string of local time in any valid non-timezone-aware ISO format Time should be in Osmo HQ local time. eg. ('2012-01-01 12:00:00', '2012-01-01 12:00', '2012-01-01') Returns: UTC time string that can be used, for instance, for database queries """ aware_datetime = _to_aware(local_time) return aware_datetime.astimezone(pytz.utc).strftime(SQL_TIME_FORMAT) def _get_calculation_details_query( node_ids, start_time_local, end_time_local, include_hub_id=False, downsample_factor=None, ): """ Provide a SQL query to download calculation details. Internal function Args: node_ids: iterable of node IDs to get data for start_time_local: string of ISO-formatted start datetime in local time, inclusive end_time_local: string of ISO-formatted end datetime in local time, inclusive include_hub_id: if True, the output will include a 'hub_id' column. Default False because the request including hub_id takes extra time. downsample_factor: if this is a number, it will be used to select fewer rows. You should get *roughly* n / downsample_factor samples. If None, no downsampling will occur. Returns: SQL query that can be used to get the desired data """ start_utc_string = _to_utc_string(start_time_local) end_utc_string = _to_utc_string(end_time_local) downsample_clause = ( f"AND MOD(calculation_detail.reading_id, {downsample_factor}) = 0" if downsample_factor is not None else "" ) select_clause = ( "calculation_detail.*, reading.hub_id" if include_hub_id else "calculation_detail.*" ) source_table = ( "calculation_detail join reading on reading.reading_id = calculation_detail.reading_id" if include_hub_id else "calculation_detail" ) nodes_selector = "({})".format(", ".join(str(n) for n in node_ids)) return f""" SELECT {select_clause} FROM ({source_table}) WHERE calculation_detail.node_id IN {nodes_selector} AND calculation_detail.create_date BETWEEN "{start_utc_string}" AND "{end_utc_string}" {downsample_clause} ORDER BY calculation_detail.create_date """ def load_calculation_details( db_engine, node_ids, start_time_local, end_time_local, include_hub_id=False, downsample_factor=None, ): """ Load node data from the calculation_details table, optionally with hub ID included from the readings table Args: db_engine: database engine created using `connect_to_db` node_ids: iterable of node IDs to get data for start_time_local: string of ISO-formatted start datetime in local time, inclusive end_time_local: string of ISO-formatted end datetime in local time, inclusive include_hub_id: if True, the output will include a 'hub_id' column. Default False because the request including hub_id takes extra time. downsample_factor: if this is a number, it will be used to select fewer rows. You should get *roughly* n / downsample_factor samples. Returns: a pandas.DataFrame of data from the node IDs provided. Raises: sqlalchemy.OperationalError: database connection is not working This is often due to a network disconnect. In this case, a good debugging step is to reconnect to the database. """ connection = db_engine.connect() calculation_details = pd.read_sql( _get_calculation_details_query( node_ids, start_time_local, end_time_local, include_hub_id, downsample_factor, ), db_engine, ) connection.close() return calculation_details def get_node_temperature_data( start_time_local, end_time_local, node_id, downsample_factor=1 ): """ Load node temperature data only from the calculation_details table Args: start_time_local: string of ISO-formatted start datetime in local time, inclusive end_time_local: string of ISO-formatted end datetime in local time, inclusive node_id: node ID to get data from downsample_factor: if this is a number, it will be used to select fewer rows. You should get *roughly* n / downsample_factor samples. Returns: a pandas.DataFrame of temperature data (°C) in local time from the node IDs provided. """ db_engine = configure_database() raw_node_data = load_calculation_details( db_engine, [node_id], start_time_local, end_time_local, downsample_factor ) print(f"{len(raw_node_data)} rows retrieved.") temperature_data = raw_node_data[ raw_node_data["calculation_dimension"] == "temperature" ] temperature_data_only = pd.DataFrame( { "timestamp": timezone.utc_series_to_local(temperature_data["create_date"]), "temperature": temperature_data["calculated_value"], } ).reset_index(drop=True) return temperature_data_only
StarcoderdataPython
12813869
from __future__ import unicode_literals, absolute_import import re from lxml import etree import six class Attributes(object): def __init__(self, data, attributes): self.data = data self.attributes = attributes def __pytoxml__(self, structure, element, name, pytoxml): for key, value in self.attributes.items(): element.set(key, value) if self.data: if isinstance(self.data, dict): pytoxml.type_builder_dict(self.data, element, name, pytoxml) else: element.text = self.data class CData(object): def __init__(self, string): self.string = string def __pytoxml__(self, structure, element, name, pytoxml): element.text = etree.CDATA(self.string) class PyToXml(object): """Class which allows you convert a deeply nested python structure into an XML representation.""" def __init__(self, root_name, structure, encoding="UTF-8", xml_declaration=False, root_attributes={}, escape_illegal_chars=False): self.root = etree.Element(root_name, root_attributes) self.root_name = root_name self.structure = structure self.encoding = encoding self.xml_declaration = xml_declaration self.escape_illegal_chars = escape_illegal_chars self._flat_type_map = self.build_flat_type_map(self.type_map()) def build_flat_type_map(self, type_func_map): """Flatten the types so we can access them as quickly as possible.""" type_list = {} for typ, outputter in type_func_map.items(): # there might be tuples thanks to things like StringTypes if isinstance(typ, tuple): for subtype in typ: type_list[subtype] = outputter else: type_list[typ] = outputter return type_list def pluralisation(self, plural): """Returns a string that is suitable for elements of a list. Intended to be overridden for more complex pluralisation logic.""" return "item" def type_builder_list(self, structure, element, name, pytoxml): for value in structure: sub = etree.SubElement(element, self.pluralisation(name)) self.traverse(value, sub, name) def type_builder_string(self, structure, element, name, pytoxml): if self.escape_illegal_chars: try: element.text = structure except ValueError: element.text = escape_xml_illegal_chars(structure) else: element.text = structure def type_builder_dict(self, structure, element, name, pytoxml): for key, value in six.iteritems(structure): sub = etree.SubElement(element, key) self.traverse(value, sub, key) def type_builder_number(self, structure, element, name, pytoxml): element.text = str(structure) def type_builder_bool(self, structure, element, name, pytoxml): element.text = str(structure).lower() def add_type_handler(self, typ, handler=None): new_map = { } new_map[typ] = handler self._flat_type_map = dict(list(self._flat_type_map.items()) + list(self.build_flat_type_map(new_map).items())) def type_map(self): type_map = { # lists list: self.type_builder_list, tuple: self.type_builder_list, # numerical float: self.type_builder_number, # other str: self.type_builder_string, type(u""): self.type_builder_string, dict: self.type_builder_dict, bool: self.type_builder_bool, } # Support v2.x and 3.x integer types for six_type in six.integer_types: type_map[six_type] = self.type_builder_number return type_map def traverse(self, structure, element, name): """Loop over the structure, convert to an etree style element and apply to element. The argument `name` is the element name of the parent.""" typ = type(structure) processor = self._flat_type_map.get(typ) if not processor: # if we find a __pytoxml__ then use that if hasattr(structure, "__pytoxml__"): processor = structure.__pytoxml__ else: raise TypeError("Don't know how to serialise %s." % typ) return processor(structure, element, name, self) def encode(self): """Encode the structure passed into the constructor as XML. This method must be called before this object is output as a string.""" self.traverse(self.structure, self.root, self.root_name) return self def __str__(self): """Output the XML.""" st = etree.tostring(self.root, encoding=self.encoding, xml_declaration=self.xml_declaration) return st.decode(self.encoding) _illegal_xml_chars_RE = re.compile( u'[\xad\xc2\x00-\x08\x0b\x0c\x0e-\x1F\uD800-\uDFFF\uFFFE\uFFFF]') def escape_xml_illegal_chars(val, replacement=''): return _illegal_xml_chars_RE.sub(replacement, val)
StarcoderdataPython
3438140
<filename>archive_code/kah.py<gh_stars>0 #!/usr/bin/env python # -*- mode: python; python-indent-tabs-mode: nil; python-indent-level: 4; tab-width: 4 -*- ### ### python wrapper for calling kpsapihelper, which is part of tbxsosd-config right now ### ### sucks... import sys import os import tempfile import subprocess import uuid # kpython from kout import * ### create new identity, return id def kah_get_new_id_act(): try: tf = TmpWorkFile() kah_proc(["kpsapihelper", "get_new_id_act", tf.name]) id = tf.read() tf.close() return id except Exception, e: err(str(e)) return False ### get kar def kah_get_kar_act(id, admin_name, admin_email, country, state, location, org, org_unit, domain, email): s = "" s = s + "[main]\n" s = s + "admin_name=%s\n" % ( str(admin_name) ) s = s + "admin_email=%s\n" % ( str(admin_email) ) s = s + "[csr]\n" s = s + "country=%s\n" % ( str(country) ) s = s + "state=%s\n" % ( str(state) ) s = s + "location=%s\n" % ( str(location) ) s = s + "org=%s\n" % ( str(org) ) s = s + "org_unit=%s\n" % ( str(org_unit) ) s = s + "domain=%s\n" % ( str(domain) ) s = s + "email=%s\n" % ( str(email) ) try: tf_config = TmpWorkFile() tf_kar = TmpWorkFile() tf_config.write(s) tf_config.flush() kah_proc(["kpsapihelper", "get_kar_act", id, tf_config.name, tf_kar.name]) kar = tf_kar.read() tf_config.close() tf_kar.close() return kar except Exception, e: err(str(e)) return False ### activate def kah_set_kap_act(id, kap): try: tf = TmpWorkFile() tf.write(kap) tf.flush() kah_proc(["kpsapihelper", "set_kap_act", id, tf.name]) return True except Exception, e: err(str(e)) return False ### add group def kah_add_group(org_id, group_name): try: tf = TmpWorkFile() kah_proc(["kpsapihelper", "add_group", str(org_id), group_name, tf.name]) group_id = int(tf.read()) tf.close() return group_id except Exception, e: err(str(e)) return False ### get a backup of database and kps config def kah_backup(): try: tf = TmpWorkFile() kah_proc(["kpsapihelper", "backup", tf.name]) backup = tf.read() tf.close() return backup except Exception, e: err(str(e)) return None # yeah.. # had problems using tempfile.NamedTemporaryFile() when trying to read a file after it has been written by another proc # IS NOT A COMPATIBLE FILE OBJECT # you must call close() if you want the file to be removed! class TmpWorkFile: def __init__(self): self.name = "/tmp/kah_" + str(uuid.uuid4()) def read(self): try: f = open(self.name, "r") data = f.read() f.close() return data except: return None def write(self, data): try: f = open(self.name, "w") f.write(data) f.close() return True except: return False def flush(self): pass # not used def close(self): try: if os.access(self.name, os.W_OK): os.remove(self.name) except: pass ### restore from a backup def kah_restore(data): try: tf = TmpWorkFile() tf.write(data) tf.flush() kah_proc(["kpsapihelper", "restore", tf.name]) tf.close() return True except Exception, e: err(str(e)) return False ### run program, log data if it fails def kah_proc(cmd): try: proc = subprocess.Popen(cmd, stdin=subprocess.PIPE, stdout=subprocess.PIPE, stderr=subprocess.PIPE) strout, strerr = proc.communicate("") ret = proc.returncode if ret != 0: err("kpsapihelper command: " + " ".join(cmd)) for s in strout.split("\n"): err("kpsapihelper stdout: " + s) for s in strerr.split("\n"): err("kpsapihelper stderr: " + s) raise Exception("kpsapihelper return code: %d" % ( ret ) ) except Exception, e: err("kah_proc: " + str(e)) raise Exception("kah_proc: " + str(e)) ### BEGIN_TESTS ### def kah_tests(): print "BEGIN" if 0: id = kah_get_new_id_act() print "NEW ID: " + id + "\n" print "\n\n" kar = kah_get_kar_act(id, "admin_name", "admin_email", "country", "state", "location", "org", "org_unit", "domain", "email") print "KAR IS:\n" print kar print "\n\n" ### can't be tested easily right now #status = kah_set_kap_act("0001", "/tmp/kap.bin") #print "KAP installed: " + str(status) + "\n" #print "\n\n" if 1: backup = kah_backup() print "BACKUP: LEN=" + str(len(backup)) + "\n" print "END" if __name__ == "__main__": kah_tests() ### END_TESTS ###
StarcoderdataPython
5181682
<reponame>EncryptEx/myhackupc from __future__ import print_function import csv import sys from django.core.management.base import BaseCommand from app import slack from app.slack import SlackInvitationException def slack_invite(email): try: slack.send_slack_invite(email) print('Slack invite sent to ' + email + '.') except SlackInvitationException as e: print('Slack error: ' + str(e)) class Command(BaseCommand): """ Format CSV: email """ help = 'Invites volunteers to Slack' def add_arguments(self, parser): parser.add_argument('csv_filename', default=False, help='csv filename') def handle(self, *args, **options): with open(options['csv_filename']) as csv_f: for row in csv.reader(csv_f): email = row[0] try: print('Inviting user {0}.'.format(email)) slack_invite(email) except Exception: print('There was a problem inviting the user: {0}. Error: {1}.' .format(email, sys.exc_info()[1]))
StarcoderdataPython
3212282
from __future__ import print_function import os import sys import multiprocessing import time import json import uuid import functools import gzip import vcr import vcr.cassette import vcr.errors import vcr.serialize import vcr.request from flowy import restart from flowy import wait from flowy import TaskError from flowy import SWFActivityConfig from flowy import SWFActivityWorker from flowy import SWFClient from flowy import SWFWorkflowConfig from flowy import SWFWorkflowStarter from flowy import SWFWorkflowWorker VERSION = 2 HERE = os.path.dirname(os.path.realpath(__file__)) A_CASSETTE = os.path.join(HERE, 'cassettes/a.yml.gz') W_CASSETTE = os.path.join(HERE, 'cassettes/w.yml.gz') DOMAIN = 'FlowyIntegrationTest' # a domain where you have access TASKLIST = 'tl' IDENTITY = 'test' RECORDING = False exit_event = multiprocessing.Event() wf_finished_event = multiprocessing.Event() # Patch vcr to use gzip files def load_cassette(cassette_path, serializer): f = gzip.open(cassette_path, 'rb') cassette_content = f.read() cassette = vcr.serialize.deserialize(cassette_content, serializer) f.close() return cassette def save_cassette(cassette_path, cassette_dict, serializer): data = vcr.serialize.serialize(cassette_dict, serializer) dirname, _ = os.path.split(cassette_path) if dirname and not os.path.exists(dirname): os.makedirs(dirname) f = gzip.open(cassette_path, 'wb') f.write(data) f.close() vcr.cassette.load_cassette = load_cassette vcr.cassette.save_cassette = save_cassette # Patch requests_match in cassette for speed-up def requests_match(r1, r2, matchers): """Skip logging and speed-up maching.""" return all(m(r1, r2) for m in matchers) vcr.cassette.requests_match = requests_match # Patch urpalse to speed-up for python3 try: from functools import lru_cache from urllib.parse import urlparse vcr.request.urlparse = lru_cache(maxsize=None)(urlparse) except ImportError: pass # patch uuid4 for consistent keys def fake_uuid4(): x = 0 while 1: yield 'fakeuuid-%s-' % x x += 1 uuid.uuid4 = functools.partial(next, fake_uuid4()) def break_loop(self): return exit_event.is_set() class TestSWFWorkflowWorker(SWFWorkflowWorker): break_loop = break_loop class TestSWFActivityWorker(SWFActivityWorker): break_loop = break_loop class BaseWorkflow(object): def __call__(self, *args, **kwargs): r = self.call(*args, **kwargs) wait(r) wf_finished_event.set() return r def call(self, *args, **kwargs): raise NotImplementedError a_conf = SWFActivityConfig(default_task_list=TASKLIST, default_schedule_to_start=30, default_schedule_to_close=60, default_start_to_close=15, default_heartbeat=10) @a_conf(version=VERSION) def tactivity(hb, a=None, b=None, sleep=None, heartbeat=False, err=None): result = None if a is not None and b is not None: result = a + b elif a is not None: result = a * a if sleep is not None and RECORDING: time.sleep(sleep) if heartbeat: hb() if err is not None: raise RuntimeError(err) return result empty_conf = SWFWorkflowConfig(default_task_list=TASKLIST, default_decision_duration=10, default_workflow_duration=20, default_child_policy='TERMINATE', ) empty_conf.conf_activity('activity', VERSION, 'tactivity') @empty_conf(version=VERSION) class TWorkflow(object): def __init__(self, activity): pass def __call__(self, a=None, b=None, sleep=None, heartbeat=False, err=None): dummy_heartbeat = lambda: True return tactivity(dummy_heartbeat, a, b, sleep, heartbeat, err) conf_use_activities = SWFWorkflowConfig(default_task_list=TASKLIST, default_decision_duration=10, default_workflow_duration=60, default_child_policy='TERMINATE') conf_use_activities.conf_activity('task', VERSION, 'tactivity') conf_use_activities.conf_activity('short_task', VERSION, 'tactivity', schedule_to_close=1, retry=(0, )) conf_use_activities.conf_activity('delayed_task', VERSION, 'tactivity', retry=(3, )) conf_use_activities.conf_activity('non_existing_task', 1, 'xxx') conf_use_workflow = SWFWorkflowConfig(default_task_list=TASKLIST, default_decision_duration=10, default_workflow_duration=60, default_child_policy='TERMINATE') conf_use_workflow.conf_workflow('task', VERSION, 'TWorkflow') conf_use_workflow.conf_workflow('short_task', VERSION, 'TWorkflow', workflow_duration=1, retry=(0, )) conf_use_workflow.conf_workflow('delayed_task', VERSION, 'TWorkflow', retry=(3, )) conf_use_workflow.conf_workflow('non_existing_task', 1, 'xxx') @conf_use_activities(version=VERSION) @conf_use_workflow(version=VERSION, name='TestWorkflowW') class TestWorkflow(BaseWorkflow): def __init__(self, task, short_task, delayed_task, non_existing_task): self.task = task self.short_task = short_task self.delayed_task = delayed_task self.non_existing_task = non_existing_task def call(self): tasks = [self.task(10), self.task(err=u'Error!'), self.task(heartbeat=True), self.short_task(sleep=3), self.delayed_task(20), self.non_existing_task(), ] last = self.task(1, 1) # Make the history longer, to have pages for _ in range(20): last = self.task(last, 1) tasks.append(last) for t in tasks: try: wait(t) except TaskError: pass @empty_conf(version=VERSION) class RestartWorkflow(BaseWorkflow): def __init__(self, activity): pass def call(self, should_restart=True): if should_restart: return restart(should_restart=False) return 1 @empty_conf(version=VERSION) class ExitWorkflow(object): def __init__(self, activity): exit_event.set() wait(activity()) # wake the activity thread def __call__(self): pass wworker = TestSWFWorkflowWorker() wworker.scan(package=sys.modules[__name__]) aworker = TestSWFActivityWorker() aworker.scan(package=sys.modules[__name__]) body_cache = {} def body_as_dict(r1, r2): if r1 not in body_cache: r1b = r1.body if isinstance(r1.body, str) else r1.body.decode('utf-8') body_cache[r1] = json.loads(r1b) if r2 not in body_cache: r2b = r2.body if isinstance(r2.body, str) else r2.body.decode('utf-8') body_cache[r2] = json.loads(r2b) return body_cache[r1] == body_cache[r2] def escaped_headers(r1, r2): import urllib r1h = dict((h, urllib.unquote(v)) for h, v in r1.headers.items()) r2h = dict((h, urllib.unquote(v)) for h, v in r1.headers.items()) return r1 == r2 vcr.default_vcr.register_matcher('dict_body', body_as_dict) vcr.default_vcr.register_matcher('esc_headers', body_as_dict) cassette_args = { 'match_on': ['dict_body', 'esc_headers', 'query', 'method', 'uri', 'host', 'port', 'path'], 'filter_headers': ['authorization', 'x-amz-date', 'content-length', 'user-agent'] } def test_activity_integration(): with vcr.use_cassette(A_CASSETTE, record_mode='none', **cassette_args) as cass: try: cl = SWFClient(kwargs={'aws_access_key_id': 'x', 'aws_secret_access_key': 'x', 'region_name': 'us-east-1'}) aworker.run_forever(DOMAIN, TASKLIST, identity=IDENTITY, swf_client=cl, setup_log=False) except vcr.errors.CannotOverwriteExistingCassetteException: pass assert cass.all_played def test_workflow_integration(): with vcr.use_cassette(W_CASSETTE, record_mode='none', **cassette_args) as cass: try: cl = SWFClient(kwargs={'aws_access_key_id': 'x', 'aws_secret_access_key': 'x', 'region_name': 'us-east-1'}) wworker.run_forever(DOMAIN, TASKLIST, identity=IDENTITY, swf_client=cl, setup_log=False) except vcr.errors.CannotOverwriteExistingCassetteException: pass assert cass.all_played def start_activity_worker(): with vcr.use_cassette(A_CASSETTE, record_mode='all', **cassette_args) as cass: try: aworker.run_forever(DOMAIN, TASKLIST, identity=IDENTITY) except vcr.errors.CannotOverwriteExistingCassetteException: pass def start_workflow_worker(): with vcr.use_cassette(W_CASSETTE, record_mode='all', **cassette_args) as cass: try: wworker.run_forever(DOMAIN, TASKLIST, identity=IDENTITY) except vcr.errors.CannotOverwriteExistingCassetteException: pass if __name__ == '__main__': RECORDING = True try: os.remove(A_CASSETTE) except: pass try: os.remove(W_CASSETTE) except: pass a_worker = multiprocessing.Process(target=start_activity_worker) w_worker = multiprocessing.Process(target=start_workflow_worker) a_worker.start() w_worker.start() time.sleep(5) # Wait for registration wfs = ['TestWorkflow', 'TestWorkflowW', 'RestartWorkflow'] for wf in wfs: print('Starting', wf) SWFWorkflowStarter(DOMAIN, wf, VERSION)() wf_finished_event.wait() wf_finished_event.clear() # Must be the last one print('Prepare to exit') SWFWorkflowStarter(DOMAIN, 'ExitWorkflow', VERSION)() a_worker.join() w_worker.join()
StarcoderdataPython
3223811
#!/usr/bin/env python from functools import reduce from google.cloud.monitoring_v3 import MetricServiceClient from google.cloud.monitoring_v3.types import LabelDescriptor, MetricDescriptor, TimeSeries from os import environ import psutil as ps import requests from signal import signal, SIGTERM from sys import stderr from time import sleep, time def get_metadata(key): return requests.get( 'http://metadata.google.internal/computeMetadata/v1/instance/' + key, headers={'Metadata-Flavor': 'Google'} ).text def reset(): global memory_used, disk_used, disk_reads, disk_writes, report_time # Explicitly reset the CPU counter, because the first call of this method always reports 0 ps.cpu_percent() memory_used = 0 disk_used = 0 disk_reads = disk_io('read_count') disk_writes = disk_io('write_count') report_time = 0 def measure(): global memory_used, disk_used, report_time memory_used = max(memory_used, MEMORY_SIZE - mem_usage('available')) disk_used = max(disk_used, disk_usage('used')) report_time += MEASUREMENT_TIME_SEC sleep(MEASUREMENT_TIME_SEC) def mem_usage(param): return getattr(ps.virtual_memory(), param) def disk_usage(param): return reduce( lambda usage, mount: usage + getattr(ps.disk_usage(mount), param), DISK_MOUNTS, 0, ) def disk_io(param): return getattr(ps.disk_io_counters(), param) def format_gb(value_bytes): return '%.1f' % round(value_bytes / 2**30, 1) def get_metric(key, value_type, unit, description): return client.create_metric_descriptor(PROJECT_NAME, MetricDescriptor( type='/'.join(['custom.googleapis.com', METRIC_ROOT, key]), description=description, metric_kind='GAUGE', value_type=value_type, unit=unit, labels=LABEL_DESCRIPTORS, )) def create_time_series(series): client.create_time_series(PROJECT_NAME, series) def get_time_series(metric_descriptor, value): series = TimeSeries() series.metric.type = metric_descriptor.type labels = series.metric.labels labels['workflow_id'] = WORKFLOW_ID labels['task_call_name'] = TASK_CALL_NAME labels['task_call_index'] = TASK_CALL_INDEX labels['task_call_attempt'] = TASK_CALL_ATTEMPT labels['cpu_count'] = CPU_COUNT_LABEL labels['mem_size'] = MEMORY_SIZE_LABEL labels['disk_size'] = DISK_SIZE_LABEL series.resource.type = 'gce_instance' series.resource.labels['zone'] = ZONE series.resource.labels['instance_id'] = INSTANCE point = series.points.add(value=value) point.interval.end_time.seconds = int(time()) return series def report(): create_time_series([ get_time_series(CPU_UTILIZATION_METRIC, { 'double_value': ps.cpu_percent() }), get_time_series(MEMORY_UTILIZATION_METRIC, { 'double_value': memory_used / MEMORY_SIZE * 100 }), get_time_series(DISK_UTILIZATION_METRIC, { 'double_value': disk_used / DISK_SIZE * 100 }), get_time_series(DISK_READS_METRIC, { 'double_value': (disk_io('read_count') - disk_reads) / report_time }), get_time_series(DISK_WRITES_METRIC, { 'double_value': (disk_io('write_count') - disk_writes) / report_time }), ]) ### Define constants # Cromwell variables passed to the container # through environmental variables WORKFLOW_ID = environ['WORKFLOW_ID'] TASK_CALL_NAME = environ['TASK_CALL_NAME'] TASK_CALL_INDEX = environ['TASK_CALL_INDEX'] TASK_CALL_ATTEMPT = environ['TASK_CALL_ATTEMPT'] DISK_MOUNTS = environ['DISK_MOUNTS'].split() # GCP instance name, zone and project # from instance introspection API INSTANCE = get_metadata('name') _, PROJECT, _, ZONE = get_metadata('zone').split('/') client = MetricServiceClient() PROJECT_NAME = client.project_path(PROJECT) METRIC_ROOT = 'wdl_task' MEASUREMENT_TIME_SEC = 1 REPORT_TIME_SEC = 60 LABEL_DESCRIPTORS = [ LabelDescriptor( key='workflow_id', description='Cromwell workflow ID', ), LabelDescriptor( key='task_call_name', description='Cromwell task call name', ), LabelDescriptor( key='task_call_index', description='Cromwell task call index', ), LabelDescriptor( key='task_call_attempt', description='Cromwell task call attempt', ), LabelDescriptor( key='cpu_count', description='Number of virtual cores', ), LabelDescriptor( key='mem_size', description='Total memory size, GB', ), LabelDescriptor( key='disk_size', description='Total disk size, GB', ), ] CPU_COUNT = ps.cpu_count() CPU_COUNT_LABEL = str(CPU_COUNT) MEMORY_SIZE = mem_usage('total') MEMORY_SIZE_LABEL = format_gb(MEMORY_SIZE) DISK_SIZE = disk_usage('total') DISK_SIZE_LABEL = format_gb(DISK_SIZE) CPU_UTILIZATION_METRIC = get_metric( 'cpu_utilization', 'DOUBLE', '%', '% of CPU utilized in a Cromwell task call', ) MEMORY_UTILIZATION_METRIC = get_metric( 'mem_utilization', 'DOUBLE', '%', '% of memory utilized in a Cromwell task call', ) DISK_UTILIZATION_METRIC = get_metric( 'disk_utilization', 'DOUBLE', '%', '% of disk utilized in a Cromwell task call', ) DISK_READS_METRIC = get_metric( 'disk_reads', 'DOUBLE', '{reads}/s', 'Disk read IOPS in a Cromwell task call', ) DISK_WRITES_METRIC = get_metric( 'disk_writes', 'DOUBLE', '{writes}/s', 'Disk write IOPS in a Cromwell task call', ) ### Detect container termination def signal_handler(signum, frame): global running running = False running = True signal(SIGTERM, signal_handler) ### Main loop # # It continuously measures runtime metrics every MEASUREMENT_TIME_SEC, # and reports them to Stackdriver Monitoring API every REPORT_TIME_SEC. # # However, if it detects a container termination signal, # it *should* report the final metric # right after the current measurement, and then exit normally. reset() while running: measure() if not running or report_time >= REPORT_TIME_SEC: report() reset() exit(0)
StarcoderdataPython
254191
import os import getpass from fabric import Connection from invoke import task sudo_pass = getpass.getpass() GIT_REPO = "https://github.com/xuhaer/Django_Blog" con = Connection('har@192.168.127.12:22') @task def deploy(con): source_folder = '~/sites/blog.xuhaer.com/Django_Blog/' # con.run('cd {} && git pull'.format(source_folder), pty=True) con.run(""" cd {} && source /home/har/sites/blog.xuhaer.com/venv/bin/activate && pip install -r requirements.txt && python manage.py migrate && gunicorn blogproject.wsgi:application -c ./blogproject/gunicorn_conf.py """.format(source_folder), pty=True)
StarcoderdataPython
56575
import sys import json import time import random import datetime from pytz import timezone import requests # Settings url = 'https://hooks.slack.com/services/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' exercises = { 'Plank': {'range': (20, 50), 'unit': 'second'}, 'Wall Sit': {'range': (40, 90), 'unit': 'second'}, 'Push Ups': {'range': (5, 15), 'unit': None}, 'Calf Raises': {'range': (25, 50), 'unit': None}, 'Crunches': {'range': (15, 25), 'unit': None}, 'Stretch': {'range': (60, 120), 'unit': 'second'}, 'Lunges': {'range': (10, 25), 'unit': None} } message_timezone = 'MST' next = (50, 75) night = 18 def generate_message(minutes_to_next=None): """ Using the list of exercises, this function generates a new exercise message. Optionally it takes a minutes_to_next parameter which it uses to add an indication of when the next exercise will take place. """ # Randomly select an exercise and a number of repetitions exercise, data = random.choice(exercises.items()) repetitions = random.randint(*data['range']) # Prepare the message string unit_string = ' ' + data['unit'] if data['unit'] else '' text = '{}{} {} RIGHT NOW!'.format(repetitions, prefix, exercise) # Add the next exercise indication if minutes_to_next is not None: current_time = datetime.datetime.now(timezone('UTC')) next_time = (now.astimezone(timezone(message_timezone)) + datetime.timedelta(minutes=minutes_to_next)) next_text = 'NEXT EXERCISE AT {}'.format(time.strftime('%H:%M')) text += '\n' + next_text return text def postMessage(): exercise = random.choice(exercises.keys()) properties = exercises[exercise] number = random.randint(properties['range'][0], properties['range'][1]) prefix = '' if not properties['unit'] else ' {}'.format(properties['unit']) wait = random.randint(next[0], next[1]) now = datetime.datetime.now(timezone('UTC')) time = (now.astimezone(timezone('MST')) + datetime.timedelta(minutes=wait)) text = '<!channel> {}{} {} RIGHT NOW!'.format(number, prefix, exercise) if time.hour < night: text += '\nNEXT THING AT {}'.format(time.strftime('%H:%M')) #print "Posting {}".format(text) payload = {'text': text} r = requests.post(url, data=json.dumps(payload)) #if r.status_code != 200: #print r.content return wait def startLoop(): while True: # Post a new message wait = postMessage() assert wait > 5 #Heartbeat every 60 seconds to prevent program from terminating for _ in xrange(wait): time.sleep(60) sys.stdout.write('/\\_') sys.stdout.write('\n') #Stop at Night now = datetime.datetime.now(timezone('UTC')) if now.astimezone(timezone('MST')).hour >= night: text = 'I\'m out. PEACE Y\'ALL' #print "Posting {}".format(text) payload = {'text': text} r = requests.post(url, data=json.dumps(payload)) exit() if __name__ == '__main__': generate_message() #startLoop()
StarcoderdataPython
1977022
<gh_stars>0 nome = str(input('Qual é o seu nome?')) if nome == 'Daniel': print('Que nome lindo você tem!') print('Bom dia {} '.format(nome)) # Não precisou do "ELSE" (estrutura condicional simples) n1 = float(input('Digite a primeira nota: ')) n2 = float(input('Digite a segunda nota: ')) m = (n1 + n2)/2 print('A sua média foi {:.1f}'.format(m)) if m >= 6: print('Sua média foi boa! PARABÉNS!') else: print('Sua média foi ruim!') print('Parabéns' if m >= 6 else 'ESTUDE MAIS!')
StarcoderdataPython
361760
<reponame>xp4ck/api-client-python<filename>gophish/api/webhooks.py from gophish.models import Webhook from gophish.api import APIEndpoint class API(APIEndpoint): def __init__(self, api, endpoint='api/webhooks/'): super(API, self).__init__(api, endpoint=endpoint, cls=Webhook) def get(self, webhook_id=None): """Gets one or more webhooks Keyword Arguments: webhook_id {int} -- The ID of the Webhook (optional, default: {None}) """ return super(API, self).get(resource_id=webhook_id) def post(self, webhook): """Creates a new webhook Arguments: webhook {gophish.models.Webhook} -- The webhook to create """ return super(API, self).post(webhook) def put(self, webhook): """Edits a webhook Arguments: webhook {gophish.models.Webhook} -- The updated webhook details """ return super(API, self).put(webhook) def delete(self, webhook_id): """Deletes a webhook by ID Arguments: webhook_id {int} -- The ID of the webhook to delete """ return super(API, self).delete(webhook_id) def validate(self, webhook_id): """Sends a validation payload to the webhook specified by the given ID Arguments: webhook_id {int} -- The ID of the webhook to validate """ return self.request("POST", resource_id=webhook_id, resource_action='validate', resource_cls=Webhook, single_resource=True)
StarcoderdataPython
8196842
from django.contrib import admin # Register your models here. from .models import Journal admin.site.register(Journal)
StarcoderdataPython
4861839
<gh_stars>0 from django.shortcuts import redirect, get_object_or_404 from django.views.generic import TemplateView, UpdateView from imager_images.models import Photo, Album from .models import ImagerProfile from django.contrib.auth.mixins import LoginRequiredMixin from django.urls import reverse_lazy from .forms import ProfileEditForm from random import sample class ProfileView(LoginRequiredMixin, TemplateView): template_name = 'imager_profile/user.html' context_object_name = 'profile' login_url = reverse_lazy('auth_login') success_url = reverse_lazy('profile') def get_context_data(self, *args, **kwargs): context = super().get_context_data(**kwargs) profile = get_object_or_404(ImagerProfile, user__username=self.username) albums = Album.objects.filter(user__username=self.username) photos = Photo.objects.filter(album__user__username=self.username) context['profile'] = profile context['albums'] = albums context['photos'] = photos context['background'] = sample(list(Photo.objects.filter(published="PUBLIC")) + [None], 1)[0] return context def get(self, request, *args, username=None, **kwargs): """Get function.""" username = request.user.get_username() if not username: return redirect('home') self.username = username return super().get(request, *args, username=username, **kwargs) class ProfileEditView(LoginRequiredMixin, UpdateView): template_name = 'imager_profile/profile_edit.html' model = ImagerProfile form_class = ProfileEditForm login_url = reverse_lazy('auth_login') success_url = reverse_lazy('profile') slug_url_kwarg = 'username' slug_field = 'user__username' def get(self, *args, **kwargs): self.kwargs['username'] = self.request.user.get_username() return super().get(*args, **kwargs) def post(self, *args, **kwargs): self.kwargs['username'] = self.request.user.get_username() return super().post(*args, **kwargs) def get_form_kwargs(self): kwargs = super().get_form_kwargs() kwargs.update({'username': self.request.user.get_username()}) return kwargs def form_valid(self, form): form.instance.user.email = form.data['email'] form.instance.user.first_name = form.data['first_name'] form.instance.user.last_name = form.data['last_name'] form.instance.user.save() return super().form_valid(form)
StarcoderdataPython
6455771
<gh_stars>0 from collections import defaultdict def text2count(body): freq = defaultdict(int) for word in body: freq[word] += 1 return freq def lexical_overlaps(title, body, idf): features = [] words_in_body = text2count(body) words_in_title = text2count(title) maximum, maximum_cnt = 0.0, 0.0 # for (word, cnt_title) in words_in_title.iteritems(): for (word, cnt_title) in words_in_title.items(): # NOTE: Changed for python3. maximum += cnt_title * idf[word] maximum_cnt += cnt_title overlaps, overlap_cnt = 0, 0 # for (word, cnt_title) in words_in_title.iteritems(): for (word, cnt_title) in words_in_title.items(): # NOTE: Changed for python3. if word in words_in_body: tf = min(cnt_title, words_in_body[word]) overlap_cnt += tf overlaps += tf * idf[word] features += [overlaps, overlaps / maximum, overlap_cnt, overlap_cnt / maximum_cnt] words_in_body = text2count(body[:len(title) * 4]) overlaps, overlap_cnt = 0, 0 # for (word, cnt_title) in words_in_title.iteritems(): for (word, cnt_title) in words_in_title.items(): # NOTE: Changed for python3. if word in words_in_body: tf = min(cnt_title, words_in_body[word]) overlap_cnt += tf overlaps += tf * idf[word] features += [overlaps, overlaps / maximum, overlap_cnt, overlap_cnt / maximum_cnt] return features import numpy as np def title2vector(title, word2vec, idf): vector = np.array([0.0] * 300) cnt = 0 for word in title: if word in word2vec: vector += word2vec[word] cnt += 1 if cnt > 0: vector /= cnt vector /= np.linalg.norm(vector) return vector def compute_overlap(title, body_sentence, idf): words_in_body = text2count(body_sentence) words_in_title = text2count(title) maximum, maximum_cnt = 0.0, 0.0 # for (word, cnt_title) in words_in_title.iteritems(): for (word, cnt_title) in words_in_title.items(): # NOTE: Changed for python3. maximum += cnt_title * idf[word] maximum_cnt += cnt_title overlaps, overlap_cnt = 0, 0 # for (word, cnt_title) in words_in_title.iteritems(): for (word, cnt_title) in words_in_title.items(): # NOTE: Changed for python3. if word in words_in_body: tf = min(cnt_title, words_in_body[word]) overlap_cnt += tf overlaps += tf * idf[word] return overlaps / maximum, overlap_cnt / maximum_cnt def semantic_similarities(title, body_sentences, word2vec, idf): max_overlap, max_overlap_cnt = 0, 0 title_vector = title2vector(title, word2vec, idf) max_sim = -1 best_vector = np.array([0.0] * 300) supports = [] for sub_body in body_sentences: sub_body_vector = title2vector(sub_body, word2vec, idf) cur_overlap, cur_overlap_cnt = compute_overlap(title, sub_body, idf) max_overlap = max(max_overlap, cur_overlap) max_overlap_cnt = max(max_overlap_cnt, cur_overlap_cnt) similarity = 0 # for i in xrange(300): for i in range(300): similarity += title_vector[i] * sub_body_vector[i] if similarity > max_sim: max_sim = similarity best_vector = sub_body_vector supports.append(similarity) features = [max_overlap, max_overlap_cnt, max(supports), min(supports)] #for v in title_vector - best_vector: # features.append(v) for v in best_vector: features.append(v) for v in title_vector: features.append(v) return features def extract_features(title, body, body_sentences, idf, word2vec): return lexical_overlaps(title, body, idf) + semantic_similarities(title, body_sentences, word2vec, idf)
StarcoderdataPython
5026085
<filename>pyrival/__init__.py import os as _os from .version import version as __version__ for _s in ('algebra', 'combinatorics', 'data_structures', 'geometry', 'graphs', 'linear_algebra', 'numerical', 'strings', 'misc', 'tools'): __path__.append(_os.path.join(_os.path.dirname(__file__), _s))
StarcoderdataPython
4985903
# -*- coding: utf-8 -*- from rest_framework.generics import GenericAPIView from rest_framework.permissions import AllowAny from rest_framework.response import Response from rest_framework.exceptions import NotFound from modules.statistics.serializers.user_stats import UserStatsSerializer from users.models import EndWorker class UserStatsView(GenericAPIView): serializer_class = UserStatsSerializer authentication_classes = [] permission_classes = (AllowAny,) def get(self, request, user_id, *args, **kwargs): user = EndWorker.objects.filter(id=user_id).first() if user: user.stats.update() user.stats.update_agreement_ranking() serializer = self.serializer_class(user.stats) return Response(serializer.data) return NotFound("No User find for given id.")
StarcoderdataPython
3296509
from typing import Any, Dict, Optional, Tuple from starkware.cairo.lang.vm.builtin_runner import BuiltinVerifier, SimpleBuiltinRunner from starkware.cairo.lang.vm.relocatable import RelocatableValue from starkware.python.math_utils import safe_div class RangeCheckBuiltinRunner(SimpleBuiltinRunner): def __init__(self, included: bool, ratio, inner_rc_bound, n_parts): super().__init__('range_check', included, ratio) self.inner_rc_bound = inner_rc_bound self.bound = inner_rc_bound ** n_parts self.n_parts = n_parts def add_validation_rules(self, runner): def rule(memory, addr): value = memory[addr] # The range check builtin asserts that 0 <= value < BOUND. # For example, if the layout uses 8 16-bit range-checks per instance, # bound will be 2**(16 * 8) = 2**128. assert 0 <= value < self.bound, \ f'Value {value}, in range check builtin {addr - self.base}, is out of range ' \ f'[0, {self.bound}).' return {addr} runner.vm.add_validation_rule(self.base.segment_index, rule) def air_private_input(self, runner) -> Dict[str, Any]: assert self.base is not None, 'Uninitialized self.base.' res: Dict[int, Any] = {} for addr, val in runner.vm_memory.items(): if not isinstance(addr, RelocatableValue) or \ addr.segment_index != self.base.segment_index: continue idx = addr.offset assert isinstance(val, int) res[idx] = {'index': idx, 'value': hex(val)} return {'range_check': sorted(res.values(), key=lambda item: item['index'])} def get_range_check_usage(self, runner) -> Optional[Tuple[int, int]]: assert self.base is not None, 'Uninitialized self.base.' rc_min = None rc_max = None for addr, val in runner.vm_memory.items(): if not isinstance(addr, RelocatableValue) or \ addr.segment_index != self.base.segment_index: continue # Split val into n_parts parts. for _ in range(self.n_parts): part_val = val % self.inner_rc_bound if rc_min is None: rc_min = rc_max = part_val else: rc_min = min(rc_min, part_val) rc_max = max(rc_max, part_val) val //= self.inner_rc_bound if rc_min is None or rc_max is None: return None return rc_min, rc_max def get_used_perm_range_check_units(self, runner) -> int: used_cells, _ = self.get_used_cells_and_allocated_size(runner) # Each cell in the range check segment requires n_parts range check units. return used_cells * self.n_parts class RangeCheckBuiltinVerifier(BuiltinVerifier): def __init__(self, included: bool, ratio): self.included = included self.ratio = ratio def expected_stack(self, public_input): if not self.included: return [], [] addresses = public_input.memory_segments['range_check'] max_size = safe_div(public_input.n_steps, self.ratio) assert 0 <= addresses.begin_addr <= addresses.stop_ptr <= \ addresses.begin_addr + max_size < 2**64 return [addresses.begin_addr], [addresses.stop_ptr]
StarcoderdataPython
8006633
from abc import abstractmethod class _BaseRedBlueFastq(object): """Base class for fastg to redbluegraphs Warning: This class should not be used directly. Use derived classes instead. """ @abstractmethod def fit(self): """ Placeholder for fit this should be implemetned by sub-method""" def condition_graph(self, cond): """ get each condition after fitting""" if cond not in self.cond_graphs.keys(): raise ValueError('Condition is not in input ', 'conditions: must be one of ' + ' '.join(self.conditions)) return self.cond_graphs[cond] def leftout_rest_graph(self, cond): """ return a RedBlueDiGraph """ return self.rest_leftout[cond] def node_map(self): """ return a node labels in fatsa type format """ return {y: x for x, y in self.nodes.items()}
StarcoderdataPython
6519817
<reponame>JHP4911/e-learning_app # -*- coding: utf-8 -*- # Generated by Django 1.9.5 on 2016-04-15 21:08 from __future__ import unicode_literals from django.conf import settings from django.db import migrations, models import django.db.models.deletion class Migration(migrations.Migration): dependencies = [ migrations.swappable_dependency(settings.AUTH_USER_MODEL), ('courses', '0001_initial'), ] operations = [ migrations.CreateModel( name='DeleteChapter', fields=[ ('id', models.AutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')), ('chapter_name', models.CharField(max_length=50)), ], ), migrations.CreateModel( name='DeleteCourse', fields=[ ('id', models.AutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')), ('course_name', models.CharField(max_length=50)), ], ), migrations.RenameField( model_name='chapter', old_name='created_date', new_name='chapter_created_date', ), migrations.RenameField( model_name='chapter', old_name='course_fk', new_name='course', ), migrations.RenameField( model_name='course', old_name='created_date', new_name='course_created_date', ), migrations.RenameField( model_name='textblock', old_name='text_area_fk', new_name='text_block_fk', ), migrations.RenameField( model_name='ytlink', old_name='youtube_fk', new_name='yt_link_fk', ), migrations.RemoveField( model_name='course', name='course_link', ), migrations.RemoveField( model_name='course', name='user_fk', ), migrations.AddField( model_name='course', name='user', field=models.ForeignKey(default=1, on_delete=django.db.models.deletion.CASCADE, to=settings.AUTH_USER_MODEL), ), migrations.AlterField( model_name='course', name='course_name', field=models.CharField(max_length=50, unique=True), ), migrations.AlterField( model_name='textblock', name='chapter_description', field=models.TextField(), ), migrations.AlterField( model_name='ytlink', name='link', field=models.URLField(default='', unique=True), ), ]
StarcoderdataPython
3439116
<gh_stars>0 from django.db import models from django.contrib.auth.models import User from .games.games import games from datetime import time import random class BoardManager(models.Manager): def create(self, game_id): code = hex(random.randint(0, 1048575))[2:].zfill(5).upper() state = State.objects.create(game_id=game_id, turn=1) board = super().create(game_id=game_id, code=code, state=state) game = games[game_id] for x in range(0, game.width): for y in range(0, game.height): type, owner_id = board.game().initial(x, y) if type: Piece.objects.create( state=state, type_id=type.id, owner_id=owner_id, x=x, y=y) return board class Board(models.Model): game_id = models.IntegerField() code = models.CharField(max_length=5) state = models.ForeignKey('State', on_delete=models.SET_NULL, null=True, blank=True) stage = models.IntegerField(default=0) time = models.DateTimeField(auto_now_add=True) class Meta: ordering = ['-time'] def __str__(self): return self.code + " " + self.game().name boards = BoardManager() def place_piece(self, player_id, x, y, type=None): if not type: type = self.game().types[0] if self.game().place_valid(self.state, self.state.pieces(), type, player_id, x, y): self.state = self.state.next() self.game().place_piece(self.state, self.state.pieces(), type, player_id, x, y) if self.state.outcome != -1: self.stage = 2 self.state.save() self.save() return True else: return False def move_piece(self, x_from, y_from, x_to, y_to): if self.game().move_valid(self.state, self.state.pieces(), x_from, y_from, x_to, y_to): self.state = self.state.next() self.game().move_piece(self.state, self.state.pieces(), x_from, y_from, x_to, y_to) if self.state.outcome != -1: self.stage = 2 self.state.save() self.save() return True else: return False def remove_piece(self, x, y): if self.game().remove_valid(self.state, self.state.pieces(), x, y): self.state = self.state.next() self.game().remove_piece(self.state, self.state.pieces(), x, y) if self.state.outcome != -1: self.stage = 2 self.state.save() self.save() return True else: return False def selectable(self, x, y): return self.game().selectable(self.state, self.state.pieces(), x, y) def current(self, player): return player and player.order == self.state.turn def players(self): return Player.objects.filter(board=self) def player(self, user): return self.players().filter(user=user).first()\ if user.is_authenticated else None def game(self): return games[self.game_id] def messages(self): return Message.objects.filter(board=self) def users(self): return map(lambda p: p.user, self.players()) def join(self, user): Player.objects.create(user=user, board=self, order=self.players().count()+1) def start(self): self.stage = 1 self.save() def to_dictionary(self): return { 'game': self.game(), 'code': self.code, 'state': self.state, 'players': self.players(), 'stage': self.stage, 'time': self.time, 'messages': self.messages() } class Player(models.Model): user = models.ForeignKey(User, on_delete=models.SET_NULL, null=True) board = models.ForeignKey(Board, on_delete=models.CASCADE) order = models.IntegerField() score = models.IntegerField(default=0) leader = models.BooleanField(default=False) time = models.TimeField(default=time(0, 0, 0)) class Meta: ordering = ['board', 'order'] def __str__(self): return self.board.code + " " + self.user.username def leave(self): for player in self.board.players().filter(order__gt=self.order): player.order -= 1 player.save() self.delete() if self.leader: other_player = self.board.players().first() if other_player: other_player.leader = True other_player.save() else: self.board.delete() def promote(self): other_player = self.board.players().get(order=self.order-1) other_player.order += 1 other_player.save() self.order -= 1 self.save() def demote(self): other_player = self.board.players().get(order=self.order+1) other_player.order -= 1 other_player.save() self.order += 1 self.save() def transfer(self): other_player = self.board.players().get(leader=True) other_player.leader = False other_player.save() self.leader = True self.save() class State(models.Model): game_id = models.IntegerField() turn = models.IntegerField(default=1) stage = models.IntegerField(default=0) ply = models.IntegerField(default=0) previous = models.ForeignKey('State', on_delete=models.CASCADE, null=True) outcome = models.IntegerField(default=-1) def next(self): state = State.objects.create( game_id=self.game_id, turn=self.turn, stage=self.stage, ply=self.ply, previous=self, outcome=self.outcome ) for row in self.pieces(): for piece in row: if piece: piece.next(state) return state def end_stage(self, skip=1): self.stage = self.stage + skip self.save() def end_turn(self, skip=1): self.turn = self.turn % self.game().players + skip self.ply = self.ply + 1 self.stage = 0 self.save() def end_game(self, winner=0): self.outcome = winner self.save() def set_piece(self, type_id, owner_id, x, y): Piece.objects.filter(state=self, x=x, y=y).delete() if type_id != -1: Piece.objects.create( state=self, type_id=type_id, x=x, y=y, owner_id=owner_id ) Change.objects.create(state=self, x=x, y=y) def place_piece(self, type, owner_id, x, y): self.set_piece(type.id, owner_id, x, y) def move_piece(self, x_from, y_from, x_to, y_to): piece = Piece.objects.filter(state=self, x=x_from, y=y_from).get() self.set_piece(-1, 0, x_from, y_from) self.set_piece(piece.type_id, piece.owner_id, x_to, y_to) def remove_piece(self, x, y): self.set_piece(-1, 0, x, y) def game(self): return games[self.game_id] def pieces(self): piece_set = Piece.objects.filter(state=self) pieces = [] for x in range(0, self.game().width): col_set = piece_set.filter(x=x) col = [] for y in range(0, self.game().height): col.append(col_set.filter(y=y).first()) pieces.append(col) return pieces def changes(self): return Change.objects.filter(state=self, state__ply=self.ply) def modified(self, x, y): return any(map(lambda c: c.x == x and c.y == y, self.changes())) def to_dictionary(self): return { 'game': self.game(), 'turn': self.turn, 'stage': self.stage, 'previous': self.previous, 'number': self.number, 'outcome': self.outcome, 'pieces': self.pieces() } class Change(models.Model): state = models.ForeignKey(State, on_delete=models.CASCADE) x = models.IntegerField() y = models.IntegerField() class Piece(models.Model): state = models.ForeignKey(State, on_delete=models.CASCADE) type_id = models.IntegerField() owner_id = models.IntegerField() x = models.IntegerField() y = models.IntegerField() class Meta: ordering = ['state'] def __str__(self): return self.state.board.code + ":"\ + str(self.state.number) + ":" + str(self.id) def next(self, state): return Piece.objects.create( state=state, type_id=self.type_id, owner_id=self.owner_id, x=self.x, y=self.y ) def type(self): return self.state.game().types[self.type_id] def texture(self): return self.type().texture(self.owner_id) def owner(self, board): return board.players()[self.owner_id-1] def to_dictionary(self): return { 'state': self.state, 'type': self.type(), 'owner_id': self.owner_id, 'x': self.x, 'y': self.y, 'texture': self.texture() } class Message(models.Model): user = models.ForeignKey(User, on_delete=models.CASCADE) message = models.CharField(max_length=500) board = models.ForeignKey(Board, on_delete=models.CASCADE) time = models.DateTimeField(auto_now=True) class Meta: ordering = ['board', '-time'] def __str__(self): return self.board.code + ":" + str(self.id)
StarcoderdataPython
4860738
<filename>bigsi/matrix/bitmatrix.py from bitarray import bitarray NUM_ROWS_KEY = "number_of_rows" NUM_COLS_KEY = "number_of_cols" class BitMatrix(object): """ Manages the gets and sets of the bitmatrix to the various storage backends. Does not know the concept of a kmer. """ def __init__(self, storage): self.storage = storage self.num_rows = self.storage.get_integer(NUM_ROWS_KEY) self.num_cols = self.storage.get_integer(NUM_COLS_KEY) @classmethod def create(cls, storage, rows, num_rows, num_cols): storage.set_bitarrays(range(num_rows), rows) storage.set_integer(NUM_ROWS_KEY, num_rows) storage.set_integer(NUM_COLS_KEY, num_cols) storage.sync() return cls(storage) def get_row(self, row_index): return self.storage.get_bitarray(row_index)[: self.num_cols] def get_rows(self, row_indexes, remove_trailing_zeros=True): ## Only need to slice for merging (it's a lot slower) # Takes advantage of batching in storage engine if available bitarrays=self.storage.get_bitarrays(row_indexes) if remove_trailing_zeros: return (ba[: self.num_cols] for ba in bitarrays) else: return bitarrays def set_row(self, row_index, bitarray): return self.storage.set_bitarray(row_index, bitarray) def set_rows(self, row_indexes, bitarrays): # Takes advantage of batching in storage engine if available return self.storage.set_bitarrays(row_indexes, bitarrays) def set_num_cols(self, num_cols): self.num_cols = num_cols self.storage.set_integer(NUM_COLS_KEY, self.num_cols) def get_column(self, column_index): ## This is very slow, as we index row-wise. Need to know the number of rows, so must be done elsewhere return bitarray( "".join( [ str(int(i)) for i in self.storage.get_bits( list(range(self.num_rows)), [column_index] * self.num_rows ) ] ) ) def get_columns(self, column_indexes): for column_index in column_indexes: yield self.get_column(column_index) def insert_column(self, bitarray, column_index): ## This is very slow, as we index row-wise self.storage.set_bits( list(range(len(bitarray))), [column_index] * len(bitarray), bitarray.tolist(), ) if column_index >= self.num_cols: self.set_num_cols(self.num_cols + 1)
StarcoderdataPython
4944215
import pymongo import bson from datetime import datetime, timedelta, date from pytz import timezone import pytz mdb_client = pymongo.MongoClient("mongodb://localhost:27017/") database_name = 'juice' def setter_juice(setter_dict={}): database = mdb_client[database_name] cursor_object = database['comments'] if bool(setter_dict): return_obj = cursor_object.insert_one(setter_dict) return return_obj.inserted_id else: return 0 def getter_juice(finder_dict = {}, projection_dict = {}): database = mdb_client[database_name] cursor_object = database['comments'] projection_dict['_id'] = False cursor_result = cursor_object.find(finder_dict, projection = projection_dict) return list(cursor_result) def del_comments_all(): database = mdb_client[database_name] cursor_object = database['comments'] cursor_object.drop()
StarcoderdataPython
9627259
# -*- coding: utf-8 -*- """ Created on Tue Feb 20 12:17:22 2018 @author: eemeg An example of the ICASAR software with synthetic data """ #%% Imports import numpy as np import matplotlib.pyplot as plt import pickle # used for opening synthetic data from pathlib import Path import icasar from icasar.icasar_funcs import ICASAR from icasar.aux import col_to_ma, r2_to_r3 #%% Things to set ICASAR_settings = {"n_comp" : 5, # number of components to recover with ICA (ie the number of PCA sources to keep) "bootstrapping_param" : (200, 0), # (number of runs with bootstrapping, number of runs without bootstrapping) "hdbscan_param" : (35, 10), # (min_cluster_size, min_samples) "tsne_param" : (30, 12), # (perplexity, early_exaggeration) "ica_param" : (1e-2, 150), # (tolerance, max iterations) "hdbscan_param" : (35,10), # (min_cluster_size, min_samples) Discussed in more detail in Mcinnes et al. (2017). min_cluster_size sets the smallest collection of points that can be considered a cluster. min_samples sets how conservative the clustering is. With larger values, more points will be considered noise. "out_folder" : Path('example_spatial_01_outputs'), # outputs will be saved here "figures" : "png+window"} # if png, saved in a folder as .png. If window, open as interactive matplotlib figures, # if 'png+window', both. # default is "window" as 03_clustering_and_manifold is interactive. #%% Import the data with open('synthetic_data.pkl', 'rb') as f: A_dc = pickle.load(f) # these are the time courses and are column vectors. They control the strength through time of each of the synthetic sources. S_synth = pickle.load(f) # these are the synthetic (spatial) sources and are row vectors. N_dc = pickle.load(f) # these are the noise for each interferogarm. pixel_mask = pickle.load(f) # this is the same shape as an interferogram, True for pixels that are masked lons = pickle.load(f) # the longitudes of the lower left corner of each pixel (i.e. a rank 2 array) lats = pickle.load(f) # the latitues of the lower left corner of each pixel. #%% Make synthetic time series and view it X_dc = A_dc @ S_synth + N_dc # do the mixing phUnw = X_dc # mixtures are the unwrapped phase fig1, axes = plt.subplots(2,3) # plot the synthetic sources for i in range(3): axes[0,i].imshow(col_to_ma(S_synth[i,:], pixel_mask)) axes[1,i].plot(range(A_dc.shape[0]), A_dc[:,i]) axes[1,i].axhline(0) fig1.suptitle('Synthetic sources and time courses') fig1.canvas.set_window_title("Synthetic sources and time courses") fig2, axes = plt.subplots(2,5) # plot the synthetic interferograms for i, ax in enumerate(np.ravel(axes[:])): ax.imshow(col_to_ma(phUnw[i,:], pixel_mask)) fig2.suptitle('Mixtures (intererograms)') fig2.canvas.set_window_title("Mixtures (intererograms)") fig3, axes = plt.subplots(1,3, figsize = (11,4)) # plot a schematic of how the data are organised axes[0].imshow(X_dc, aspect = 500) axes[0].set_title('Data matix') axes[1].imshow(pixel_mask) axes[1].set_title('Mask') axes[2].imshow(col_to_ma(X_dc[0,:], pixel_mask)) axes[2].set_title('Interferogram 1') fig3.canvas.set_window_title("Interferograms as row vectors and a mask") #%% do ICA with ICSAR function spatial_data = {'mixtures_r2' : phUnw, 'mask' : pixel_mask, 'lons' : lons, # for the simplest case, these aren't needed 'lats' : lats} # for the simplest case, these aren't needed S_best, time_courses, x_train_residual_ts, Iq, n_clusters, S_all_info, phUnw_mean = ICASAR(spatial_data = spatial_data, **ICASAR_settings) #%% We can reconstruct the data using the sources and timecourses, but don't forget that ICA returns mean centered sources X_dc_reconstructed = (time_courses @ S_best) + phUnw_mean # here we add the mean back X_dc_reconstructed_source0 = (time_courses[:,0:1] @ S_best[0:1,:]) + phUnw_mean # and remake the entire time series using only IC0 ifg_n = 0 # choose an ifg to plot fig4, axes = plt.subplots(1,3, figsize = (11,4)) # plot a schematic of how the data are organised im1 = axes[0].imshow(col_to_ma(X_dc[ifg_n,], pixel_mask)) axes[0].set_title('Original Ifg.') fig4.colorbar(im1, ax = axes[0]) im2 = axes[1].imshow(col_to_ma(X_dc_reconstructed[ifg_n,], pixel_mask)) axes[1].set_title('Reconstructed Ifg.') fig4.colorbar(im2, ax = axes[1]) im3 = axes[2].imshow(col_to_ma(X_dc_reconstructed_source0[ifg_n,], pixel_mask)) axes[2].set_title('Reconstructed Ifg. \n (IC0 only)') fig4.colorbar(im2, ax = axes[2]) fig4.canvas.set_window_title("Reconstructed Data") #%% Note that the amount of bootstrapping done by ICASAR can also be controlled, and seen in the clustering and 2d manifold plot: ICASAR_settings["bootstrapping_param"] = (100, 100) # (number of runs with bootstrapping, number of runs without bootstrapping) ICASAR_settings['out_folder'] = 'example_spatial_01_outputs_part2' spatial_data = {'mixtures_r2' : phUnw, 'mask' : pixel_mask, 'lons' : lons, 'lats' : lats} S_best, time_courses, x_train_residual_ts, Iq, n_clusters, S_all_info, phUnw_mean = ICASAR(spatial_data = spatial_data, **ICASAR_settings)
StarcoderdataPython
1687457
<reponame>cpgoncalves/gameplayer # <NAME> (2015), Game Theory with Python # Game Theory and Applied A.I. Classes # Instituto Superior de Ciências Sociais e Políticas (ISCSP) # University of Lisbon # <EMAIL> # # Three Person's Prisonners' Dilemma Game # # For more details see the user manual that comes with the package: # Gonçalves, C.P. (2015) "Game Player User Manual - A Game Theory Analyzer With Python", # https://sites.google.com/site/autonomouscomputingsystems/game-player import gamep config = [] gamep.addAlternative(["Cooperate","Cooperate","Cooperate"],[2,2,2],config) gamep.addAlternative(["Cooperate","Cooperate","Defect"],[2.5,2.5,1],config) gamep.addAlternative(["Cooperate","Defect","Cooperate"],[2.5,1,2.5],config) gamep.addAlternative(["Cooperate","Defect","Defect"],[0,2,2],config) gamep.addAlternative(["Defect","Cooperate","Cooperate"],[1,2.5,2.5],config) gamep.addAlternative(["Defect","Cooperate","Defect"],[2,0,2],config) gamep.addAlternative(["Defect","Defect","Cooperate"],[2,2,0],config) gamep.addAlternative(["Defect","Defect","Defect"],[1,1,1],config) gamep.analyzeGame(config,True)
StarcoderdataPython
124835
"""empty message Revision ID: 09d3732eef24 Revises: <PASSWORD> Create Date: 2020-03-12 15:13:32.832239 """ from alembic import op import sqlalchemy as sa # revision identifiers, used by Alembic. revision = '09d3732eef24' down_revision = '<PASSWORD>' branch_labels = None depends_on = None def upgrade(): # ### commands auto generated by Alembic - please adjust! ### op.create_table('task', sa.Column('id', sa.String(length=50), nullable=False), sa.Column('amount', sa.Numeric(precision=10, scale=2), nullable=True), sa.Column('trigger', sa.String(length=10), nullable=True), sa.Column('category', sa.String(length=100), nullable=True), sa.Column('type', sa.String(length=20), nullable=True), sa.Column('name', sa.String(length=100), nullable=True), sa.Column('trigger_kwargs', sa.String(length=200), nullable=True), sa.Column('user_id', sa.Integer(), nullable=True), sa.ForeignKeyConstraint(['user_id'], ['user.id'], ), sa.PrimaryKeyConstraint('id') ) # ### end Alembic commands ### def downgrade(): # ### commands auto generated by Alembic - please adjust! ### op.drop_table('task') # ### end Alembic commands ###
StarcoderdataPython
11375522
<reponame>theRealNonso/dappertask<filename>dappertask/api/urls.py from django.conf.urls import url from django.urls import include from rest_framework import routers from rest_framework.documentation import include_docs_urls from rest_framework.routers import DefaultRouter import api.views as dv router = DefaultRouter(trailing_slash=False) app_router = routers.DefaultRouter() urlpatterns = [ # documentation url(r'^docs/', include_docs_urls(title='Dappertask Backend API', public=True)), # url(r'^auth/', include('rest_framework_social_oauth2.urls')), # User management and registration urls url('accounts/', include('rest_registration.api.urls')), # tontine urls url(r'^api/', include(app_router.urls)), # url(regex=r'^tontine/addmember/$',view=tv.AddMemberAndTontine.as_view(),name='addmember'), ]
StarcoderdataPython
9642764
<filename>wsgi/static/wsgi/static/wsgi/static/wsgi/static/wsgi/static/wsgi/static/posts/templatetags/getProfile.py from django import template from profiles.models import Profile from django.contrib.auth.models import User from django.http import HttpResponseRedirect register= template.Library() @register.filter def getProfile(user): try: profile=Profile.objects.get(user=user) return profile.id except: return HttpResponseRedirect('/')
StarcoderdataPython
1788887
"""Everything related to O2 power. Hoooo baby.""" import math import numpy as np import pandas as pd from . import util def o2_power_ss(speed_series, grade_series=None): """Calculates steady-state oxygen consumption in the moderate domain. For more info, see `heartandsole_local/heartandsole/powerutils.py`. """ if grade_series is None: grade_series = pd.Series([0 for i in range(len(speed_series))]) c_i_series = grade_series.apply(cost_of_inclined_treadmill_running) c_aero_series = speed_series.apply(cost_of_wind_running) # Combine the two components that contribute to the metabolic cost of # running. c_r_series = c_i_series + c_aero_series # Instantaneous running power (W/kg) is simply cost of running # (J/kg/m) multiplied by speed (m/s). power_series = (c_i_series + c_aero_series) * speed_series # Updated to account for the fact that the horizontal speed is # measured, but cost of running relates to the distance along the # incline. power_series = power_series / np.cos(np.arctan(grade_series)) return power_series def o2_power(speed_series, grade_series=None, time_series=None, tau=20): """Calculate O2 consumption in the moderate domain as a time series. Args: tau: Time constant for the exponentially-weighted moving average. According to (Poole and Jones, 2012), this constant can vary from 10s to over 100s. It decreases with training, reflecting a more responsive cardiovascular system. Default 20. Note: * In the heavy domain, the slow component of O2 consumption kicks in, steady-state O2 consumption is higher than predicted by this algorithm, and the steady state does not occur for up to 20 minutes (longer than this algorithm predicts.) * In the severe domain, the critical power has been exceeded, and O2 consumption will reach VO2 max. The slow component may play a role, but this role diminishes as the work rate increases. In the extreme case, VO2max is barely reached before fatigue sets in - slow component likely has no role in oxygen kinetics here. * In the extreme (?) domain, the work rate is so high that fatigue sets in before VO2max can be attained. """ if time_series is None: time_series = pd.Series([i for i in range(len(speed_series))]) # Calculate the theoretical steady-state power associated with the # speed and grade value at each timestep. power_inst = o2_power_ss(speed_series, grade_series=grade_series) halflife = tau * math.log(2) # Even if we have uniform 1-second samples, I would still need this # util function. It makes the average start at 0 and trend up, rather # than letting the first value have all the weight. return util.ewma( power_inst, halflife, time_series=time_series, ) def run_power(speed, grade=0.0): return run_cost(speed, grade=grade) * speed / math.cos(math.atan(grade)) def run_cost(speed, grade=0.0): """Calculates the metabolic cost of running. See the documentation for powerutils.o2_power_ss for information on the scientific basis for this calculation. Args: speed (float): Running speed in meters per second. grade (float): Decimal grade, i.e. 45% = 0.45. Returns: float: Cost of running on an incline in still air, in Joules/kg/m, with distance measured along the incline slope. """ # grade = grade or 0.0 # Use that Minetti curve. c_i = cost_of_inclined_treadmill_running(grade) # Pugh and <NAME> tell us the cost of resisting wind. c_aero = cost_of_wind_running(speed) return c_i + c_aero def cost_of_inclined_treadmill_running(grade): """Calculates the cost of inclined running according to Minetti. This is how much metabolic energy it costs (J) to move a unit body mass (kg) a unit distance (m) along a treadmill belt surface at a steady-state (after running on this treadmill for 4 minutes). This metabolic energy cost is estimated based on the amount of oxygen you are consuming, and assumes a specific type of fuel is being used (mostly carbohydrate, with a dash of fat, and no protein). This gives an estimate of 20.9 kJ of energy per liter of oxygen consumed. For more info, see `heartandsole_local/heartandsole/powerutils.py`, specifically the documentation for `o2_power_tendency`. Args: grade (float): Decimal grade, i.e. 20% = 0.20. Returns: float: Cost of running, in Joules/kg/m according to Minetti curve. """ # Clip the grade value so we don't use the curve outside its limits # of applicability. # TODO: Find a better way to handle the shittiness of the Minetti # curve. Maybe find a way to extrapolate for steeper grades based # on an assumed efficiency of lifting/lowering...0.25?? grade = max(-0.45, min(grade, 0.45)) # Calculate metabolic cost of running (neglecting air resistance), # in Joules per meter traveled per kg of body weight, as a function of # decimal grade (on a treadmill, technically). From (Minetti, 2002). # Valid for grades shallower than 45% (0.45 in decimal form). c_i = 155.4 * grade ** 5 - 30.4 * grade ** 4 - 43.3 * grade ** 3 \ + 46.3 * grade ** 2 + 19.5 * grade + 3.6 return c_i def cost_of_wind_running(speed): """Calculate metabolic cost of running against wind resistance. Assumes zero wind speed. From (Pugh, 1971) & (<NAME>, 1993). eta_aero is the efficiency of conversion of metabolic energy into mechanical energy when working against a headwind. k is the air friction coefficient, in J s^2 m^-3 kg^-1, which makes inherent assumptions about the local air density and the runner's projected area and body weight. Args: speed (float): Running speed in meters per second. Returns: float: Aerodynamic cost of running, in Joules per meter traveled per kg of body weight, as a function TODO: * Revisit whether 0.5 is an appropriate efficiency value... I recall it might have something to do with the speed at which the work is being done. """ eta_aero = 0.5 k = 0.01 c_aero = k * speed ** 2 / eta_aero return c_aero
StarcoderdataPython
199237
<reponame>pygaur/gsshop<gh_stars>1-10 from django.apps import AppConfig class GsShippingConfig(AppConfig): name = 'gs_shipping'
StarcoderdataPython
9736255
# This code is part of the Biopython distribution and governed by its # license. Please see the LICENSE file that should have been included # as part of this package. """Tests of the transcription and translation methods of Seq objects.""" import unittest from Bio import Seq from Bio import Alphabet from Bio.Alphabet import IUPAC class TestTranscriptionTranslation(unittest.TestCase): def test_transcription(self): s = "ATA" dna = Seq.Seq(s, IUPAC.unambiguous_dna) rna = dna.transcribe() self.assertEqual(str(rna), "AUA") s = "GAAAATTCATTTTCTTTGGACTTTCTCTGAAATCCGAGTCCTAGGAAAGATGCGTGAGATTCTTCATATT" dna = Seq.Seq(s, IUPAC.unambiguous_dna) rna = dna.transcribe() self.assertEqual( str(rna), "GAAAAUUCAUUUUCUUUGGACUUUCUCUGAAAUCCGAGUCCUAGGAAAGAUGCGUGAGAUUCUUCAUAUU", ) s = "GAAAAUUCAUUUUCUUUGGACUUUCUCUGAAAUCCGAGUCCUAGGAAAGAUGCGUGAGAUUCUUCAUAUU" rna = Seq.Seq(s, IUPAC.unambiguous_rna) dna = rna.back_transcribe() self.assertEqual( str(dna), "GAAAATTCATTTTCTTTGGACTTTCTCTGAAATCCGAGTCCTAGGAAAGATGCGTGAGATTCTTCATATT", ) def test_translation(self): s = "" dna = Seq.Seq(s, IUPAC.unambiguous_dna) protein = dna.translate(to_stop=True) self.assertEqual(str(protein), "") s = "TAA" dna = Seq.Seq(s, IUPAC.unambiguous_dna) protein = dna.translate(to_stop=True) self.assertEqual(str(protein), "") s = "GAAAATTCATTTTCTTTGGACTTTCTCTGAAATCCGAGTCCTAGGAAAGATGCGTGAGATTCTTCA" dna = Seq.Seq(s, IUPAC.unambiguous_dna) protein = dna.translate(to_stop=True) self.assertEqual(str(protein), "ENSFSLDFL") s = "GAA" dna = Seq.Seq(s, IUPAC.unambiguous_dna) protein = dna.translate(15, to_stop=True) self.assertEqual(str(protein), "E") s = "ATA" dna = Seq.Seq(s, IUPAC.unambiguous_dna) protein = dna.translate("Vertebrate Mitochondrial", to_stop=True) self.assertEqual(str(protein), "M") s = "GAAAATTCATTTTCTTTGGACTTTCTCTGAAATCCGAGTCCTAGGAAAGATGCGTGAGATTCTTCATAT" dna = Seq.Seq(s, IUPAC.unambiguous_dna) protein = dna.translate("SGC8", to_stop=True) self.assertEqual(str(protein), "ENSFSLDFLWNPSPSNDAWDSSY") def test_dna_rna_translation(self): s = "TCAAAAAGGTGCATCTAGATG" dna = Seq.Seq(s, IUPAC.unambiguous_dna) protein = dna.translate(to_stop=True) self.assertIsInstance(protein.alphabet, IUPAC.IUPACProtein) self.assertEqual(str(protein), "SKRCI") gapped_protein = dna.translate() self.assertIsInstance(gapped_protein.alphabet, Alphabet.HasStopCodon) self.assertEqual(str(gapped_protein), "SKRCI*M") # The table used here has "AGG" as a stop codon: p2 = dna.translate(table=2, to_stop=True) self.assertEqual(str(p2), "SK") p2 = dna.translate(table=2) self.assertEqual(str(p2), "SK*CI*M") p2 = dna.translate(table=2, stop_symbol="+") self.assertEqual(str(p2), "SK+CI+M") r = s.replace("T", "U") rna = Seq.Seq(r, IUPAC.unambiguous_rna) protein = rna.translate(to_stop=True) self.assertIsInstance(protein.alphabet, IUPAC.IUPACProtein) self.assertEqual(str(protein), "SKRCI") gapped_protein = rna.translate() self.assertEqual(str(gapped_protein), "SKRCI*M") def test_ambiguous(self): s = "RATGATTARAATYTA" dna = Seq.Seq(s, IUPAC.ambiguous_dna) protein = dna.translate("Vertebrate Mitochondrial") self.assertEqual(str(protein), "BD*NL") stop_protein = dna.translate("SGC1", to_stop=True) self.assertEqual(str(stop_protein), "BD") if __name__ == "__main__": runner = unittest.TextTestRunner(verbosity=2) unittest.main(testRunner=runner)
StarcoderdataPython
9680675
# coding: utf-8 import os import io import pytest import tarfile import tempfile from mock import patch, Mock, MagicMock import requests from spacy_lefff import Downloader from spacy_lefff.melt_tagger import URL_MODEL def test_url_model(): assert requests.get(URL_MODEL).status_code == 200 def _mock_response( status=200, content="CONTENT", json_data=None, headers=None, raise_for_status=None, iter_content=None): ''' Mocking get requests response. ''' mock_resp = Mock() # mock raise_for_status call w/optional error mock_resp.raise_for_status = Mock() if raise_for_status: mock_resp.raise_for_status.side_effect = raise_for_status # set status code and content mock_resp.status_code = status mock_resp.content = content mock_resp.headers = headers mock_resp.iter_content = MagicMock() mock_resp.iter_content.__iter__.return_value = iter_content # add json data if provided if json_data: mock_resp.json = Mock( return_value=json_data ) return mock_resp @pytest.fixture(scope='session') def _tmp_dir(tmpdir_factory): ''' Creating a tar file from a test file in a tmp folder. ''' dirtmp = tmpdir_factory.mktemp('models') tmpfile = dirtmp.join('model') tmpfile.write('TEST') tar = tarfile.open(os.path.join(dirtmp.strpath, "model.tar.gz"), "w:gz") tar.add(tmpfile.strpath, 'model') tar.close() os.remove(tmpfile.strpath) return dirtmp @patch('spacy_lefff.downloader.requests.get') @patch('spacy_lefff.downloader.tarfile') def test_downloader(mock_tarfile, mock_get, _tmp_dir): content_disposition = 'attachment; filename="model.tar.gz"; filename*=UTF-8''model.tar.gz' model_tarfile = tarfile.open(os.path.join(_tmp_dir.strpath, 'model.tar.gz'), 'r:gz') headers = {'content-disposition': content_disposition, 'content-length': 100000} mock_resp = _mock_response(headers=headers) mock_get.return_value = mock_resp mock_tarfile.open.return_value = model_tarfile d = Downloader('test', download_dir=_tmp_dir.strpath, url=URL_MODEL) test_folder = os.path.join(_tmp_dir.strpath, 'test') m = os.path.join(test_folder, 'model') assert len(_tmp_dir.listdir()) == 2 #test folder, temp model tar f = io.open(m, mode='r', encoding='utf-8') #checking if untar model is the same as the one in _tmp_dir tar file assert str(f.read()) == 'TEST' @patch('spacy_lefff.downloader.requests.get') def test_downloader_failed(mock_get, _tmp_dir): mock_resp = _mock_response() mock_get.return_value = mock_resp with pytest.raises(Exception) as e_info: d = Downloader('test', download_dir=_tmp_dir.strpath, url='') assert e_info.value.message == "Couldn't fetch model data." def test_downloader_data_already_set_up(_tmp_dir, caplog): ''' Testing if data is already set up, meaning folder named 'test' already in download_dir ''' if not os.path.exists(os.path.join(_tmp_dir.strpath, 'test')): os.mkdir(os.path.join(_tmp_dir.strpath, 'test')) d = Downloader('test', download_dir=_tmp_dir.strpath, url=URL_MODEL) assert caplog.records[0].levelname == 'INFO' assert 'data already set up' in caplog.text
StarcoderdataPython
8006330
from .builder import build_dataloader from .collate import default_collate
StarcoderdataPython
5089021
from abc import ABC, abstractmethod import pathlib from sklearn import base import _pickle as cPickle import numpy as np import pandas as pd import os from enum import Enum from typing import Tuple from py_neuromodulation import \ (nm_projection, nm_rereference, nm_run_analysis, nm_features, nm_resample, nm_define_nmchannels, nm_IO, nm_plots, nm_test_settings) from py_neuromodulation import nm_notch_filter class GRIDS(Enum): """Definition of possible projection grid types""" CORTEX="cortex" SUBCORTEX="subcortex" class PNStream(ABC): resample: nm_resample.Resample features: nm_features.Features run_analysis: nm_run_analysis.Run rereference: nm_rereference.RT_rereference notch_filter : nm_notch_filter.NotchFilter projection: nm_projection.Projection settings: dict nm_channels: pd.DataFrame coords: dict = {} fs: float line_noise: float VERBOSE: bool PATH_SETTINGS: str PATH_NM_CHANNELS: str = str() PATH_OUT: str = str() PATH_GRIDS: str = str() feature_arr: pd.DataFrame = pd.DataFrame() CH_NAMES_USED: list CH_TYPES_USED: list FEATURE_IDX: list LABEL_IDX: list grid_cortex: np.array grid_subcortex: np.array sess_right: bool = None feature_add: pd.DataFrame model: base.BaseEstimator @abstractmethod def __init__(self, PATH_SETTINGS=os.path.join(pathlib.Path(__file__).parent.resolve(),\ "nm_settings.json"), PATH_NM_CHANNELS:str = str(), PATH_OUT:str = os.getcwd(), PATH_GRIDS:str = pathlib.Path(__file__).parent.resolve(), VERBOSE:bool = True) -> None: self.PATH_SETTINGS = PATH_SETTINGS self.PATH_NM_CHANNELS = PATH_NM_CHANNELS self.PATH_OUT = PATH_OUT self.VERBOSE = VERBOSE self.settings = nm_IO.read_settings(self.PATH_SETTINGS) nm_test_settings.test_settings(self.settings) if True in [self.settings["methods"]["project_cortex"], self.settings["methods"]["project_subcortex"]]: self.grid_cortex, self.grid_subcortex = self.get_grids( self.settings, self.PATH_GRIDS, GRIDS ) @abstractmethod def _add_coordinates(self) -> None: """Write self.coords either from bids or from separate file This method is implemented differently for BIDS and real time data anylsis """ pass @abstractmethod def get_data(self, ) -> np.array: """Get new data batch from acquisition device or from BIDS""" pass @abstractmethod def run(self, ): """In this function data is first acquied iteratively 1. self.get_data() 2. data processing is called: self.run_analysis.process_data(data) to calculate features 3. optional postprocessing e.g. plotting, ML estimation is done """ pass @abstractmethod def _add_timestamp(self, feature_series: pd.Series, idx:int=None) -> pd.Series: """Add to feature_series "time" keyword For Bids specify with fs_features, for real time analysis with current time stamp """ pass def load_model(self, model_name: str): """Load sklearn model, that utilizes predict""" with open(model_name, 'rb') as fid: self.model = cPickle.load(fid) def _set_run(self): """Initialize preprocessing, and feature estimation modules """ self.CH_NAMES_USED, self.CH_TYPES_USED, self.FEATURE_IDX, self.LABEL_IDX = \ self._get_ch_info(self.nm_channels) self.features = self._set_features(self.settings, self.CH_NAMES_USED, self.fs, self.line_noise, self.VERBOSE ) self.resample = self._set_resampling(self.settings, self.fs) self.rereference, self.nm_channels = self._set_rereference( self.settings, self.nm_channels ) self.notch_filter = self._set_notch_filer( settings = self.settings, fs = self.fs if self.settings["methods"]["raw_resampling"] is False else self.settings["raw_resampling_settings"]["resample_freq"], line_noise = self.line_noise ) self.projection = self._get_projection(self.settings, self.nm_channels) if self.projection is not None: self.sess_right = self._get_sess_lat(self.coords) else: self.sess_right = None self.run_analysis = nm_run_analysis.Run( features=self.features, settings=self.settings, reference=self.rereference, projection=self.projection, resample=self.resample, notch_filter=self.notch_filter, verbose=self.VERBOSE, feature_idx=self.FEATURE_IDX ) def _set_features(self, settings:dict, CH_NAMES_USED: list, fs: int, line_noise: int, VERBOSE:bool) -> None: """initialize feature class from settings""" return nm_features.Features( settings, CH_NAMES_USED, fs, line_noise, VERBOSE ) def set_fs(self, fs: int) -> None: self.fs = fs def _set_rereference( self, settings:dict, nm_channels:pd.DataFrame ) -> tuple[nm_rereference.RT_rereference, pd.DataFrame]: """Initialize nm_rereference and update nm_channels nm_channels are updated if no rereferencing is specified Parameters ---------- settings : dict [description] nm_channels : pd.DataFrame [description] Returns ------- Tuple nm_rereference object, updated nm_channels DataFrame """ if settings["methods"]["re_referencing"] is True: rereference = nm_rereference.RT_rereference( nm_channels, split_data=False) else: rereference = None # reset nm_channels from default values nm_channels["rereference"] = None nm_channels["new_name"] = nm_channels["name"] return rereference, nm_channels def _set_resampling(self, settings:dict, fs: int) -> nm_resample.Resample: """Initialize Resampling Parameters ---------- settings : dict fs : int Returns ------- nm_resample.Resample """ if settings["methods"]["raw_resampling"] is True: resample = nm_resample.Resample(settings, fs) else: resample = None return resample def _set_notch_filer(self, settings : dict, fs : int, line_noise : int, notch_widths : int = 3, trans_bandwidth : int = 15 ) -> nm_notch_filter.NotchFilter: if settings["methods"]["notch_filter"] is True: notch_filter = nm_notch_filter.NotchFilter( fs=fs, line_noise=line_noise, notch_widths=notch_widths, trans_bandwidth=trans_bandwidth ) else: notch_filter = None return notch_filter def set_linenoise(self, line_noise: int) -> None: self.line_noise = line_noise @staticmethod def get_grids( settings: dict(), PATH_GRIDS: str, GRID_TYPE: GRIDS ) -> Tuple: """Read settings specified grids Parameters ---------- settings : dict PATH_GRIDS : str GRID_TYPE : GRIDS Returns ------- Tuple grid_cortex, grid_subcortex, might be None if not specified in settings """ if settings["methods"]["project_cortex"] is True: grid_cortex = nm_IO.read_grid(PATH_GRIDS, GRID_TYPE.CORTEX) else: grid_cortex = None if settings["methods"]["project_subcortex"] is True: grid_subcortex = nm_IO.read_grid(PATH_GRIDS, GRID_TYPE.SUBCORTEX) else: grid_subcortex = None return grid_cortex, grid_subcortex def _get_projection( self, settings: dict, nm_channels: pd.DataFrame ) -> nm_projection.Projection: """Return projection of used coordinated and grids""" if any((settings["methods"]["project_cortex"], settings["methods"]["project_subcortex"])): projection = nm_projection.Projection( settings=settings, grid_cortex=self.grid_cortex, grid_subcortex=self.grid_subcortex, coords=self.coords, nm_channels=nm_channels, plot_projection=False ) else: projection = None return projection @staticmethod def _get_ch_info(nm_channels: pd.DataFrame): """Get used feature and label info from nm_channels""" CH_NAMES_USED = nm_channels[nm_channels["used"] == 1]["new_name"].tolist() CH_TYPES_USED = nm_channels[nm_channels["used"] == 1]["type"].tolist() # used channels for feature estimation FEATURE_IDX = np.where(nm_channels["used"] & ~nm_channels["target"])[0].tolist() # If multiple targets exist, select only the first LABEL_IDX = np.where(nm_channels["target"] == 1)[0] return CH_NAMES_USED, CH_TYPES_USED, FEATURE_IDX, LABEL_IDX @staticmethod def _get_nm_channels(PATH_NM_CHANNELS:str, **kwargs) -> None: """Read nm_channels from path or specify via BIDS arguments. Nexessary parameters are then ch_names (list), ch_types (list), bads (list) ECOG_Only (bool)""" if PATH_NM_CHANNELS and os.path.isfile(PATH_NM_CHANNELS): nm_channels = pd.read_csv(PATH_NM_CHANNELS) elif None not in [kwargs.get('ch_names', None), kwargs.get('ch_types', None), kwargs.get('bads', None), kwargs.get('ECOG_ONLY', None)]: nm_channels = nm_define_nmchannels.set_channels_by_bids( ch_names=kwargs.get('ch_names'), ch_types=kwargs.get('ch_types'), bads=kwargs.get('bads'), ECOG_ONLY=kwargs.get('ECOG_ONLY')) return nm_channels @staticmethod def _get_sess_lat(coords): if len(coords["cortex_left"]["positions"]) == 0: sess_right = True elif len(coords["cortex_right"]["positions"]) == 0: sess_right = False return sess_right def save_sidecar(self, folder_name: str): """Save sidecar incuding fs, line_noise, coords, sess_right to PATH_OUT and subfolder 'folder_name'""" sidecar = { "fs" : self.fs, "line_noise" : self.line_noise, "coords" : self.coords, "sess_right" : self.sess_right } if self.settings["methods"]["project_cortex"]: sidecar["grid_cortex"] = self.grid_cortex sidecar["proj_matrix_cortex"] = \ self.projection.proj_matrix_cortex if self.settings["methods"]["project_subcortex"]: sidecar["grid_subcortex"] = self.grid_subcortex sidecar["proj_matrix_subcortex"] = \ self.projection.proj_matrix_subcortex nm_IO.save_sidecar(sidecar, self.PATH_OUT, folder_name) def save_settings(self, folder_name: str): nm_IO.save_settings(self.settings, self.PATH_OUT, folder_name) def save_nm_channels(self, folder_name: str): nm_IO.save_nmchannels(self.nm_channels, self.PATH_OUT, folder_name) def save_features(self, folder_name: str): nm_IO.save_features(self.feature_arr, self.PATH_OUT, folder_name) def save_after_stream(self, folder_name:str) -> None: """Save features, settings, nm_channels and sidecar after run""" # create derivate folder_name output folder if doesn't exist if os.path.exists(os.path.join(self.PATH_OUT, folder_name)) is False: os.makedirs(os.path.join(self.PATH_OUT, folder_name)) self.save_sidecar(folder_name) self.save_features(folder_name) self.save_settings(folder_name) self.save_nm_channels(folder_name) def plot_cortical_projection(self): """plot projection of cortical grid electrodes on cortex""" nmplotter = nm_plots.NM_Plot(ecog_strip=self.projection.ecog_strip, grid_cortex=self.projection.grid_cortex, sess_right=self.sess_right) nmplotter.plot_cortex()
StarcoderdataPython
5058418
""" Tests for barbante.maintenance.product_templates_tfidf.py. """ import nose.tools import datetime as dt import barbante.maintenance.product_templates_tfidf as pttfidf import barbante.maintenance.tasks as maintenance from barbante.maintenance.tests.fixtures.MaintenanceFixture import MaintenanceFixture import barbante.tests.dummy_data_populator as dp import barbante.tests as tests ACCEPTABLE_ON_THE_FLY_VS_FROM_SCRATCH_DEVIATION = 0.05 """ Since the DF of terms is dynamically updated, and we do not want to cope with a strength update for each and every pair of products affected by a tiny modification of some term's DF, we allow for a subtle variation between on-the-fly and from-scratch values, by design. """ class TestProductTemplatesTfidf(MaintenanceFixture): """ Test class for product templates based on tfidf similarity. """ def setup(self): super().setup() pttfidf.generate_templates(self.session_context) def _find_language(self, product_id): product = self.session_context.data_proxy.fetch_products([product_id], ["language"]).get(product_id) if product is None: raise AttributeError("invalid product_id") return product.get("language", "unknown") def test_templates(self): """ Tests the product templates (tfidf) that are computed and saved in the db. """ # Economia for i in range(1, dp.N_PROD_ECONOMIA + 1): target = "p_eco_" + str(i) templates = pttfidf.get_product_templates_tfidf(self.session_context, [target]).get(target, {}) language = self._find_language(target) nose.tools.ok_(language not in [None, "unknown"], "Could not retrieve the language correctly") if language == "portuguese": nose.tools.ok_(len(templates) > 0, "No templates were generated for product " + target) nose.tools.eq_(templates[0][1][:6], "p_eco_", "A questionable template order was obtained " + "for product %s: %s" % (target, templates)) for _, template_id in templates: nose.tools.ok_("expired" not in template_id, "An expired template was obtained") # Esportes for i in range(1, dp.N_PROD_ESPORTES + 1): target = "p_esp_" + str(i) templates = pttfidf.get_product_templates_tfidf(self.session_context, [target]).get(target, {}) language = self._find_language(target) nose.tools.ok_(language not in [None, "unknown"], "Could not retrieve the language correctly") if language == "portuguese": nose.tools.ok_(len(templates) > 0, "No templates were generated for product " + target) nose.tools.eq_(templates[0][1][:6], "p_esp_", "A questionable template order was obtained " + "for product %s: %s" % (target, templates)) for _, template_id in templates: nose.tools.ok_("expired" not in template_id, "An expired template was obtained") # Musica for i in range(1, dp.N_PROD_MUSICA + 1): target = "p_mus_" + str(i) templates = pttfidf.get_product_templates_tfidf(self.session_context, [target]).get(target, {}) language = self._find_language(target) nose.tools.ok_(language not in [None, "unknown"], "Could not retrieve the language correctly") if language == "portuguese": nose.tools.ok_(len(templates) > 0, "No templates were generated for product " + target) nose.tools.eq_(templates[0][1][:6], "p_mus_", "A questionable template order was obtained " + "for product %s: %s" % (target, templates)) # Tecnologia for i in range(1, dp.N_PROD_TECNOLOGIA + 1): target = "p_tec_" + str(i) templates = pttfidf.get_product_templates_tfidf(self.session_context, [target]).get(target, {}) language = self._find_language(target) nose.tools.ok_(language not in [None, "unknown"], "Could not retrieve the language correctly") if language == "portuguese": nose.tools.ok_(len(templates) > 0, "No templates were generated for product " + target) nose.tools.eq_(templates[0][1][:6], "p_tec_", "A questionable template order was obtained " + "for product %s: %s" % (target, templates)) def test_templates_avoiding_almost_identical_products(self): """ Tests whether nearly identical products are NOT templates of one another. """ for i in range(1, dp.N_PROD_NONSENSE): target = "p_nonsense_" + str(i) templates = pttfidf.get_product_templates_tfidf(self.session_context, [target]).get(target, {}) nose.tools.ok_(len(templates) > 0, "No templates were generated for product " + target) template_products = [t[1] for t in templates] way_too_similar = "p_nonsense_" + str(i + 1) nose.tools.ok_(way_too_similar not in template_products, "Nearly identical templates!") def test_product_product_strengths_tfidf_from_scratch_versus_incremental(self): """ Tests whether the product x product strengths (TFIDF) generated on a step-by-step basis match exactly those created from scratch. """ # inner method to compare strengths def compare_strengths(pair_of_products): strength1 = strengths_incremental.get(pair_of_products, 0.0) strength2 = strengths_from_scratch[pair_of_products] nose.tools.ok_( "Strengths do not match for product pair (%s, %s): " % (pair_of_products[0], pair_of_products[1]) + "[incremental --> %.6f] [from scratch --> %.6f]" % (strength1, strength2), abs(strength1 - strength2) < ACCEPTABLE_ON_THE_FLY_VS_FROM_SCRATCH_DEVIATION) # --- # inner method to compare templates tfidf def compare_templates(product): templates1 = templates_incremental.get(product, (None, [])) templates2 = templates_from_scratch.get(product, (None, [])) nose.tools.eq_(len(templates1[1]), len(templates2[1]), "Numbers of incremental and from-scratch templates do not match") for idx in range(len(templates1[1])): strength_incremental = templates1[1][idx][0] strength_from_scratch = templates2[1][idx][0] nose.tools.ok_( abs(strength_incremental - strength_from_scratch) < ACCEPTABLE_ON_THE_FLY_VS_FROM_SCRATCH_DEVIATION, "Templates do not approximately match for product %s: " % product + "[incremental --> %s] [from scratch --> %s]" % (str(templates1), str(templates2))) # --- all_products = list(self.db_proxy.fetch_all_product_ids()) sentence = " produto para teste de atualização de similaridade via tfidf" products = [{"external_id": product[0], "resources": {"title": product[0]}, "date": self.session_context.get_present_date(), "expiration_date": self.session_context.get_present_date() + dt.timedelta(days=30), "full_content": product[1], "language": "portuguese"} for product in [("p_new_1", "Primeiro" + sentence), ("p_new_2", "Segundo" + sentence), ("p_new_3", "Terceiro" + sentence), ("p_new_4", "Quarto" + sentence)]] # updates strengths after each new product for product in products: self.db_proxy.insert_product(product) maintenance.process_product(self.session_context, product["external_id"]) # saves locally the strengths and the templates that were obtained incrementally strengths_incremental = self.db_proxy.fetch_product_product_strengths_tfidf() templates_incremental = self.db_proxy.fetch_product_templates(all_products) # regenerates all strengths from scratch pttfidf.generate_templates(self.session_context) # saves locally the strengths and the templates that were obtained from scratch strengths_from_scratch = self.db_proxy.fetch_product_product_strengths_tfidf() templates_from_scratch = self.db_proxy.fetch_product_templates(all_products) nose.tools.eq_(len(strengths_incremental), len(strengths_from_scratch), "Number of non-zero strengths tfidf do not match") for product_pair in strengths_from_scratch: compare_strengths(product_pair) for product_pair in strengths_incremental: compare_strengths(product_pair) for product in all_products: compare_templates(product) def test_multi_attribute_similarity(self): """ Tests whether the product-product similarities respect the customer-defined weights and filters. WARNING: This test relies heavily on the attributes' weight distribution below: - full_content: 0.6 (TEXT - non-persistent) - resources.title: 0.1 (TEXT - persistent) - category: 0.1 (FIXED) - source: 0.1 (LIST) - price: 0.1 (NUMERIC) The 'language' attribute is the only attribute configured to be used as filter. Changing these settings in config/barbante_UnitTest.yml is a sure way to break the present test. """ product = "p_empty" strengths = self.db_proxy.fetch_product_product_strengths_tfidf() other_product = "p_empty_with_disjoint_title" nose.tools.ok_(abs(strengths[(product, other_product)] - 0.9) < tests.FLOAT_DELTA, "Wrong similarity (%s, %s)" % (product, other_product)) other_product = "p_empty_with_two_thirds_of_source_list" nose.tools.ok_(abs(strengths[(product, other_product)] - (0.9 + 0.1 * 2/3)) < tests.FLOAT_DELTA, "Wrong similarity (%s, %s)" % (product, other_product)) nose.tools.ok_(abs(strengths[(other_product, product)] - 1) < tests.FLOAT_DELTA, "Wrong similarity (%s, %s)" % (other_product, product)) other_product = "p_empty_with_different_language" nose.tools.ok_((product, other_product) not in strengths, "Wrong similarity (%s, %s)" % (product, other_product)) other_product = "p_empty_with_different_category" nose.tools.ok_(abs(strengths[(product, other_product)] - 0.9) < tests.FLOAT_DELTA, "Wrong similarity (%s, %s)" % (product, other_product)) other_product = "p_empty_with_missing_category" nose.tools.ok_(abs(strengths[(product, other_product)] - 0.9) < tests.FLOAT_DELTA, "Wrong similarity (%s, %s)" % (product, other_product)) other_product = "p_empty_with_half_price" nose.tools.ok_(abs(strengths[(product, other_product)] - 0.95) < tests.FLOAT_DELTA, "Wrong similarity (%s, %s)" % (product, other_product)) nose.tools.ok_(abs(strengths[(other_product, product)] - 0.95) < tests.FLOAT_DELTA, "Wrong similarity (%s, %s)" % (other_product, product)) # TODO (Vinicius) We are missing a test using a date-type attribute here other_product = "p_empty_with_many_differences" nose.tools.ok_(abs(strengths[(product, other_product)] - (0.6 + 0.1 * 2/3 + 0.1 * 0.5)) < tests.FLOAT_DELTA, "Wrong similarity (%s, %s)" % (product, other_product)) nose.tools.ok_(abs(strengths[(other_product, product)] - (0.7 + 0.1 * 0.5)) < tests.FLOAT_DELTA, "Wrong similarity (%s, %s)" % (other_product, product))
StarcoderdataPython
9772722
<reponame>arosen93/jobflow<filename>tests/utils/test_enum.py def test_value_enum(): from jobflow.utils import ValueEnum class TempEnum(ValueEnum): A = "A" B = "B" assert str(TempEnum.A) == "A" assert str(TempEnum.B) == "B" assert TempEnum.A == "A" assert TempEnum.B == "B" assert TempEnum.A.as_dict() == "A" assert TempEnum.B.as_dict() == "B"
StarcoderdataPython
204964
<reponame>troswell/pynet_terry print "hello world" print "something else" for i in range(7): print i
StarcoderdataPython
3288813
<gh_stars>100-1000 # Modified Bessel function I_n(z) in the complex plane cplot(lambda z: besseli(1,z), [-8,8], [-8,8], points=50000)
StarcoderdataPython
5132440
from ..src.test import conftest
StarcoderdataPython
6673621
from elasticsearch_dsl.query import MultiMatch from ..documents import TaskDocument, SkillDocument, UserDocument def _search_skills(phrase): prod_query = MultiMatch( fields=['name', 'title', 'description'], query=phrase, type='cross_fields') return SkillDocument.search().query(prod_query).sort('_score').source( False) def _search_users(phrase): user_query = MultiMatch( fields=['user', 'email', 'first_name', 'last_name'], query=phrase, type='cross_fields', operator='and') return UserDocument.search().query(user_query).source(False) def _search_orders(phrase): task_query = MultiMatch( fields=['user', 'first_name', 'last_name', 'discount_name'], query=phrase) return TaskDocument.search().query(task_query).source(False) def get_search_queries(phrase): """Return querysets to lookup different types of objects. Args: phrase (str): searched phrase """ return { 'skills': _search_skills(phrase), 'users': _search_users(phrase), 'tasks': _search_orders(phrase)} def search(phrase): """Return all matching objects for dashboard views. Composes independent search querysets into a single dictionary. Args: phrase (str): searched phrase """ return {k: s.to_queryset() for k, s in get_search_queries(phrase).items()}
StarcoderdataPython
1685969
from errbot import BotPlugin, botcmd from jenkinsapi.jenkins import Jenkins from config import JENKINS_URL, JENKINS_USERNAME, JENKINS_PASSWORD class Jenkinsbot(BotPlugin): def connect_server(self): server = Jenkins(JENKINS_URL, JENKINS_USERNAME, JENKINS_PASSWORD) return server @botcmd def get_jenkins_version(self, mess, args): return self.connect_server().version @botcmd def get_running_jobs(self, mess, args): jobs = self.connect_server().get_jobs() self.log.debug(jobs) if jobs is None: return "No running job!" job_list = " " for job_name, job_instance in jobs: job_list += " *Job Name: " + job_instance.name + " Job Description: " + job_instance.get_description() + " Is Job running:"+ str(job_instance.is_running()) + " Is Job enabled:"+ str(job_instance.is_enabled()) +"*\n\n" self.send_card(title='Current Jenkins Job Details', body=job_list, color='red', in_reply_to=mess) @botcmd def get_jenkins_plugins(self, mess, args): plugin_list = "" for plugin in self.connect_server().get_plugins().values(): plugin_list +=" Short Name:" + plugin.shortName + " Long Name: " + plugin.longName + " Version: " + plugin.version + " URL: " + plugin.url + " Active: " + str(plugin.active) + " Enabled: " + str(plugin.enabled) + "\n\n" self.send_card(title='Jenkins Plugins Status', body=plugin_list, color='red', in_reply_to=mess) @botcmd(split_args_with=None, admin_only=True) def start_build(self, mess, args): jobname = args.pop(0) params = dict([(k, v) for k,v in zip (args[::2], args[1::2])]) self.connect_server().build_job(jobname, params) self.send_card(title='Build Status?', body='Triggered', color='red', in_reply_to=mess)
StarcoderdataPython
4974651
<filename>vectortween/ParametricAnimation.py from functools import lru_cache from sympy import Symbol from sympy.parsing.sympy_parser import parse_expr from vectortween.Animation import Animation from vectortween.Tween import Tween class ParametricAnimation(Animation): """ class to animate the value of a number between startframe and stopframe tweening optionally can be applied (default is None, which means linear animation) """ def __init__(self, equation="t", tween=None, noise_fn=None): """ :param equation: parametric equation written as a string, expressed in terms of parameter "t". :param tween: optional tweening specification :param noise_fn: 2d function accepting a value ( equation(0) <= value <= equation(1)) and a time (0 <= t <= 1). By accepting and using t, the noise is animated in time. By accepting but ignoring t, the noise is only spatial. """ if tween is None: tween = ['linear'] if not equation: equation = "t" self.tween = tween self.T = Tween(*tween) self.noise_fn = noise_fn self.equation = parse_expr(equation) t = Symbol('t') frm = self.equation.evalf(subs={t: 0}) to = self.equation.evalf(subs={t: 1}) super().__init__(frm, to) def delayed_version(self, delay): t = Symbol("t") new_equation = self.equation.subs(t, t - delay) def new_noise_fn(value, t): return self.noise_fn(value, t - delay) return ParametricAnimation(equation="{}".format(new_equation), tween=self.tween, noise_fn=new_noise_fn if self.noise_fn else None) def speedup_version(self, factor): t = Symbol("t") new_equation = self.equation.subs(t, t * factor) def new_noise_fn(value, t): return self.noise_fn(value, t * factor) return ParametricAnimation(equation="{}".format(new_equation), tween=self.tween, noise_fn=new_noise_fn if self.noise_fn else None) def translated_version(self, amount): new_equation = self.equation + amount def new_noise_fn(value, t): return self.noise_fn(value + amount, t) return ParametricAnimation(equation="{}".format(new_equation), tween=self.tween, noise_fn=new_noise_fn if self.noise_fn else None) def scaled_version(self, amount): new_equation = self.equation * amount def new_noise_fn(value, t): return self.noise_fn(value * amount, t) return ParametricAnimation(equation="{}".format(new_equation), tween=self.tween, noise_fn=new_noise_fn if self.noise_fn else None) def scaled_translate_version(self, scale, offset): new_equation = self.equation * scale + offset def new_noise_fn(value, t): return self.noise_fn(value * scale + offset, t) return ParametricAnimation(equation="{}".format(new_equation), tween=self.tween, noise_fn=new_noise_fn if self.noise_fn else None) def timereversed_version(self): t = Symbol("t") new_equation = self.equation.subs(t, 1 - t) def new_noise_fn(value, t): return self.noise_fn(value, 1 - t) return ParametricAnimation(equation="{}".format(new_equation), tween=self.tween, noise_fn=new_noise_fn if self.noise_fn else None) #@lru_cache(maxsize=1000) def make_frame(self, frame, birthframe, startframe, stopframe, deathframe, noiseframe=None): """ animation happens between startframe and stopframe the value is None before aliveframe, and after deathframe * if aliveframe is not specified it defaults to startframe * if deathframe is not specified it defaults to stopframe initial value is held from aliveframe to startframe final value is held from stopfrome to deathframe """ if birthframe is None: birthframe = startframe if deathframe is None: deathframe = stopframe if frame < birthframe: return None if frame > deathframe: return None if frame < startframe: return self.frm if frame > stopframe: return self.to parameter_value = self.T.tween2(frame, startframe, stopframe) t = Symbol('t') if self.noise_fn is not None: if noiseframe is not None: nf = noiseframe else: nf = parameter_value noise_value = self.noise_fn(frame, nf) else: noise_value = 0 return self.equation.evalf(subs={t: parameter_value}) + noise_value
StarcoderdataPython
8001905
from distutils.core import setup setup( name = 'cayenneLPP', packages = ['cayenneLPP'], version = '0.1', description = 'A module for the Cayenne Low Power Packet format', author = '<NAME>', author_email = '<EMAIL>', url = 'https://github.com/jojo-/py-cayenne-lpp', # use the URL to the github repo download_url = 'https://github.com/jojo-/py-cayenne-lpp/archive/0.4.tar.gz', keywords = ['Cayenne', 'LPP', 'LoRa', 'Pycom'], classifiers = [], )
StarcoderdataPython
1785982
#credits?? I even don't know ... everyone changed owner section so if you need credits pm me. #And Thanks To The Creator Of Autopic This Script Was Made from Snippets From That Script import requests , re , random import urllib , os from telethon.tl import functions from datetime import datetime from PIL import Image, ImageDraw, ImageFont from userbot.events import register import asyncio from time import sleep COLLECTION_STRING = [ "Gravity Falls HD Wallpaper", "4k-sci-fi-wallpaper", "Anime Cat Girl Wallpaper", "To the Moon Wallpaper", "Fantasy Forest Wallpaper" ] async def animepp(): os.system("rm -rf donot.jpg") rnd = random.randint(0, len(COLLECTION_STRING) - 1) pack = COLLECTION_STRING[rnd] pc = requests.get("http://getwallpapers.com/collection/" + pack).text f = re.compile('/\w+/full.+.jpg') f = f.findall(pc) fy = "http://getwallpapers.com"+random.choice(f) print(fy) if not os.path.exists("f.ttf"): urllib.request.urlretrieve("https://github.com/rebel6969/mym/raw/master/Rebel-robot-Regular.ttf","f.ttf") urllib.request.urlretrieve(fy,"donottouch.jpg") @register(outgoing=True, pattern="^.randpp(?: |$)(.*)") async def main(event): await event.edit("**Changing random profile pic. Check after 10 secs**") while True: await animepp() file = await event.client.upload_file("donottouch.jpg") await event.client(functions.photos.UploadProfilePhotoRequest( file)) os.system("rm -rf donottouch.jpg") await asyncio.sleep(7200) #Edit this to your required needs
StarcoderdataPython
5098977
<filename>examples/subscription_mgmt.py<gh_stars>0 """This is the demo script to show how administrator can manage subscriptions and schedules. This script will not work without replacing parameters with real values. Its basic goal is to present what can be done with this module and to ease its usage. """ from mstrio.connection import Connection from mstrio.admin.subscription.subscription import Subscription, EmailSubscription from mstrio.admin.subscription.content import Content from mstrio.admin.subscription.subscription_manager import SubscriptionManager, list_subscriptions from mstrio.admin.schedule import Schedule, ScheduleManager base_url = "https://<>/MicroStrategyLibrary/api" username = "some_username" password = "<PASSWORD>" conn = Connection(base_url, username, password, login_mode=1) # create manager for subscriptions on a chosen application sub_mngr = SubscriptionManager(connection=conn, application_name='MicroStrategy Tutorial') # get all subscriptions from the given application (it is possible in two ways) all_subs = list_subscriptions(connection=conn, application_name='MicroStrategy Tutorial') all_subs = sub_mngr.list_subscriptions() # execute/delete subscriptions by passing theirs ids or Subscription objects sub_mngr.execute(['11223344556677889900AABBCCDDEEFF', 'FFEEDDCCBBAA00998877665544332211']) sub_mngr.delete(['11223344556677889900AABBCCDDEEFF', 'FFEEDDCCBBAA00998877665544332211']) # list available recipients of the subscription for the given content (default delivery type is an email) sub_mngr.available_recipients(content_id='11112222333344445555666677778888', content_type='DOCUMENT') # get a single subscription sub = Subscription(connection=conn, subscription_id='AA11BB22CC33DD44EE55FF6677889900', application_id='00FF99EE88DD77CC66BB55AA44332211') # list all recipients of the given subscription and all available for this subscription sub.recipients sub.available_recipients() # add/remove recipient(s) with given id(s) sub.add_recipient(recipients=['1234567890A1234567890A1234567890', '98765432198765432198765432198765']) sub.remove_recipient(recipients=['1234567890A1234567890A1234567890', '98765432198765432198765432198765']) # execute a given subscription sub.execute() # replace a user with an admin in all of its subscriptions (e.g. when user exits company) for s in sub_mngr.list_subscriptions(to_dictionary=False): if '9871239871298712413241235643132A' in [r['id'] for r in s.recipients]: s.add_recipient(recipients='11111111111111111111111111111111') s.remove_recipient(recipients='9871239871298712413241235643132A') # create an email subscription EmailSubscription.create( connection=conn, name="New Email Subscription for a Report", application_name="MicroStrategy Tutorial", contents=Content(id='ABC123ABC123ABC123ABC123ABC12345', type=Content.Type.REPORT), schedules_ids=['ABC123ABC123ABC123ABC123ABC12345'], recipients=['ABC123ABC123ABC123ABC123ABC12345']) # get list of schedules (you can filter them by for example name, id or description) schdl_mngr = ScheduleManager(connection=conn) all_schdls = schdl_mngr.list_schedules() # get a single schedule by its id or name and then its properties schdl = Schedule(connection=conn, name='Some shedule which runs daily') schdl.list_properties()
StarcoderdataPython
4996785
'''Preprocessing of data for training and prediction. ''' import re def prepare_input(name): '''Prepares the name of a file for classification or prediction. ''' # Remove commas name = name.replace(',', '') # Lowercase filename name = name.lower() # Remove paths name = name.split('/')[-1] # Normalize word separators for char in '._-[]+': name = name.replace(char, ' ') # Replace ampersand with and name = name.replace('&', ' and ') # Remove any remaining punctuation and non word characters for char in '\'\"`~!@#$%^*()=|;:<>,/?{}': name = name.replace(char, '') # Split season and episode numbers name = split_season_episode(name) # Remove duplicate spaces name = ' '.join(name.split()) return name def split_season_episode(name): '''Splits combined season and episodes numbers into separate words. ''' patterns = [ [r'(?P<sid>s\d+)(?P<eid>e\d+)', '{sid} {eid}'], #s01e01 [r'(?P<sid>\d+)x(?P<eid>\d+)', 's{sid} e{eid}'], #01x01 [r's(?P<sid>\d+) ep(?P<eid>\d+)', 's{sid} e{eid}'] #S1 Ep1 ] for pattern in patterns: match = re.search(pattern[0], name, re.IGNORECASE) if match is not None: name = name.replace( match.group(0), pattern[1].format( sid=match.group('sid'), eid=match.group('eid'))) return name
StarcoderdataPython
4867078
<filename>mp-tests/test_cap_reading.py import unittest import os, sys import json # add module dirs to path # sys.path.append("../") sys.path.append(os.path.join(os.path.dirname(os.path.abspath(__file__)), '..' , 'micropython')) sys.path.append(os.path.join(os.path.dirname(os.path.abspath(__file__)), '..', 'micropython', 'lib')) sys.path.append(os.path.join(os.path.dirname(os.path.abspath(__file__)), 'stubs')) # map python modules to micropython names import binascii, os, socket, struct, time sys.modules['ubinascii'] = binascii # sys.modules['uos'] = os sys.modules['usocket'] = socket sys.modules['ustruct'] = struct sys.modules['utime'] = time import _config sys.modules['config'] = _config # import file to test import cap_reading class Test_CapReadingMQTTCb(unittest.TestCase): ''' test mqtt_cb callback function ''' def setUp(self): ''' ''' # set initial settings cap_reading.led_blink = False cap_reading.led_blink_count = 10 cap_reading.settings = { 'led_status_blink': True, 'poll_interval': 5, # time in minutes 'polling_hours' : { # hour of day 'start': 8, 'end': 20 }, 'location': "nowhere" } def test_led_control(self): ''' test led control messages are parsed states checked: - on -> on - on -> off - off -> on - off -> off - nonsense message -> no state change ''' topic = cap_reading.SUBSCRIBE_TOPIC[:-1] + b"led" cap_reading.led_blink = False cap_reading.led_blink_count = 10 # test status led on/off start_values = [True, False] for start_value in start_values: with self.subTest('on'): cap_reading.settings['led_status_blink'] = start_value message = b"on" cap_reading.mqtt_cb(topic, message) self.assertTrue(cap_reading.settings['led_status_blink']) self.assertFalse(cap_reading.led_blink) with self.subTest('off'): cap_reading.settings['led_status_blink'] = start_value message = b"off" cap_reading.mqtt_cb(topic, message) self.assertFalse(cap_reading.settings['led_status_blink']) self.assertFalse(cap_reading.led_blink) with self.subTest('nonsense'): cap_reading.settings['led_status_blink'] = start_value message = b"nonsense" cap_reading.mqtt_cb(topic, message) self.assertEqual(cap_reading.settings['led_status_blink'], start_value) self.assertFalse(cap_reading.led_blink) # test blink parsing messages = [b"blink", b"blink:nonsense", b"blink:5.3"] for message in messages: with self.subTest(message): cap_reading.led_blink = False cap_reading.led_blink_count = 10 # message = b"blink" cap_reading.mqtt_cb(topic, message) self.assertTrue(cap_reading.led_blink) self.assertEqual(cap_reading.led_blink_count, 10) self.assertFalse(cap_reading.settings['led_status_blink']) for i in range(1, 21): with self.subTest('blink:'+str(i)): cap_reading.led_blink = False cap_reading.led_blink_count = 10 message = b"blink:" + str(i).encode() cap_reading.mqtt_cb(topic, message) self.assertTrue(cap_reading.led_blink) self.assertEqual(cap_reading.led_blink_count, i) self.assertFalse(cap_reading.settings['led_status_blink']) def test_location_setting(self): ''' test location messages set location ''' topic = cap_reading.SUBSCRIBE_TOPIC[:-1] + b"location" locations = ['somewhere', 'not here', 'over there', '123456'] for location in locations: cap_reading.settings['location'] = 'nowhere' # reset location message = location.encode() cap_reading.mqtt_cb(topic, message) with self.subTest(location): self.assertEqual(cap_reading.settings['location'], location) def test_pollinterval_setting(self): ''' test poll-interval messages set the polling interval ''' topic = cap_reading.SUBSCRIBE_TOPIC[:-1] + b"poll-interval" # test int intervals for i in range(1, 60): cap_reading.settings['poll_interval'] = 5 # reset interval cap_reading.mqtt_cb(topic, i) with self.subTest(i): self.assertEqual(cap_reading.settings['poll_interval'], i) # test not intervals intervals = ['nan', b'nonsense', 4.4, 4.8, 5.3, 7.8] for interval in intervals: cap_reading.settings['poll_interval'] = 5 # reset interval cap_reading.mqtt_cb(topic, interval) with self.subTest(interval): self.assertEqual(cap_reading.settings['poll_interval'], 5) def test_pollinghours_setting(self): ''' test polling-hours messages set the polling hours ''' topic = cap_reading.SUBSCRIBE_TOPIC[:-1] + b"polling-hours" cap_reading.settings['polling_hours'] = { # hour of day 'start': 8, 'end': 20 } # test changing one key at a time for k in cap_reading.settings['polling_hours'].keys(): for i in range(0,24): cap_reading.settings['polling_hours'] = { # reset 'start': 8, 'end': 20 } message = {k: i} cap_reading.mqtt_cb(topic, json.dumps(message)) with self.subTest(k+str(i)): self.assertEqual(cap_reading.settings['polling_hours'][k], i) # test changing both keys at a time for i in range(0,24): for j in range(0,24): cap_reading.settings['polling_hours'] = { # reset 'start': 8, 'end': 20 } message = { 'start': i, 'end': j } cap_reading.mqtt_cb(topic, json.dumps(message)) with self.subTest(str(i)+':'+str(j)): self.assertEqual(cap_reading.settings['polling_hours']['start'], i) self.assertEqual(cap_reading.settings['polling_hours']['end'], j)
StarcoderdataPython
12864089
<reponame>sphinx-contrib/zopeext """ From https://github.com/brechtm/rinohtype/blob/master/noxutil.py https://github.com/cjolowicz/nox-poetry/discussions/289 """ import json from collections.abc import Iterable from pathlib import Path from typing import Optional from urllib.request import urlopen, Request from poetry.core.factory import Factory from poetry.core.semver import parse_single_constraint as parse_version VERSION_PARTS = ("major", "minor", "patch") def get_versions( dependency: str, granularity: str = "minor", # ascending: bool = False, limit: Optional[int] = None, # allow_prerelease: bool = False, ) -> Iterable[str]: """Yield all versions of `dependency` considering version constraints Args: dependency: the name of the dependency granularity: yield only the newest patch version of each major/minor release ascending: count backwards from latest version, by default (not much use without the 'limit' arg) limit: maximum number of entries to return allow_prerelease: whether to include pre-release versions Yields: All versions of `dependency` that match the version constraints defined and in this project's pyproject.toml and the given `granularity`. """ package = Factory().create_poetry(Path(__file__).parent).package for requirement in package.requires: if requirement.name == dependency: break else: raise ValueError(f"{package.name} has no dependency '{dependency}'") filtered_versions = [ version for version in all_versions(dependency) if requirement.constraint.allows(version) ] parts = VERSION_PARTS[: VERSION_PARTS.index(granularity) + 1] result = {} for version in filtered_versions: key = tuple(getattr(version, part) for part in parts) result[key] = max((result[key], version)) if key in result else version return [str(version) for version in result.values()] def all_versions(dependency): request = Request(f"https://pypi.org/pypi/{dependency}/json") response = urlopen(request) json_string = response.read().decode("utf8") json_data = json.loads(json_string) yield from (parse_version(version) for version in json_data["releases"])
StarcoderdataPython
5002093
<reponame>enthought/etsproxy # proxy module from pyface.preference.preference_dialog import *
StarcoderdataPython
12847371
from data_module.get_source_file import * import numpy as np class DataCleaner(object): def __init__(self): # 图1数据源 self.data_LD = [] self.data_I = [] self.data_LU = [] self.data_T = [] # 图2数据源 self.data_RD = [] self.data_RU = [] # 图3数据源 self.data_K_R = [] self.data_K_L = [] self.data_J = [] # 图4数据源 self.data_LU_LD = [] self.data_RD_RU = [] self.data_Q = [] # 图5数据源 self.data_K = [] self.data_P = [] self.data_R = [] self.data_S = [] # 读文件 self.read_data() def single_line_cleaning(self, one_line): end = one_line.index(" 0D 0A") start = 1 line_result = one_line[start:end] item_data_list = line_result.split(" ") # print(item_data_list) return self.__get_datas(item_data_list) def get_item_data(self, data, i): """ 需要计算的单数据生成 :param data: :param i: :return: """ return ((int(data[i], 16) << 8) + int(data[i + 1], 16)) / 100 def get_item_single_data(self, data, i): """ 简单的单数据生成 :param i: :return: """ return int(data[i], 16) def __get_datas(self, data): """ 多种单数据生成 :param data: :return: """ LD = self.get_item_data(data, 0) LU = self.get_item_data(data, 2) RD = self.get_item_data(data, 4) RU = self.get_item_data(data, 6) K_R = self.get_item_data(data, 10) K_L = self.get_item_data(data, 12) I = self.get_item_single_data(data, 8) T = self.get_item_single_data(data, 19) J = self.get_item_single_data(data, 9) Q = self.get_item_single_data(data, 16) / 50 K = self.get_item_single_data(data, 16) P = self.get_item_single_data(data, 16) / 10 R = self.get_item_single_data(data, 17) S = self.get_item_single_data(data, 18) return LD, LU, RD, RU, K_R, K_L, I, T, J, Q, K, P, R, S def read_data(self): source_data = file_read_lines() for line_str in source_data: cleaned_data = self.single_line_cleaning(line_str) # print(cleaned_data) # LD, LU, RD, RU, K_R, K_L, I, T, J, Q, K, P, R, S self.data_LD.append(cleaned_data[0]) self.data_LU.append(cleaned_data[1]) self.data_RD.append(cleaned_data[2]) self.data_RU.append(cleaned_data[3]) self.data_K_R.append(cleaned_data[4]) self.data_K_L.append(cleaned_data[5]) self.data_I.append(cleaned_data[6]) self.data_T.append(cleaned_data[7]) self.data_J.append(cleaned_data[8]) self.data_Q.append(cleaned_data[9]) self.data_K.append(cleaned_data[10]) self.data_P.append(cleaned_data[11]) self.data_R.append(cleaned_data[12]) self.data_S.append(cleaned_data[13]) self.data_LU_LD.append(round(cleaned_data[1] - cleaned_data[0], 2)) self.data_RD_RU.append(round(cleaned_data[2] - cleaned_data[3], 2)) def get_chart_data(self, chart_num): # print("data_LD:%s" % self.data_LD) # print("data_LU:%s" % self.data_LU) # print("data_RD:%s" % self.data_RD) # print("data_K_R:%s" % self.data_K_R) # print("data_K_L:%s" % self.data_K_L) # print("data_I:%s" % self.data_I) # print("data_T:%s" % self.data_T) # print("data_J:%s" % self.data_J) # print("data_Q:%s" % self.data_Q) # print("data_K:%s" % self.data_K) # print("data_P:%s" % self.data_P) # print("data_R:%s" % self.data_R) # print("data_S:%s" % self.data_S) if chart_num == '1': # 返回图1 所有需要的数据 return {'data_LD': self.data_LD, 'data_I': self.data_I, 'data_LU': self.data_LU, 'data_T': self.data_T, } elif chart_num == '2': # 返回图2 所有需要的数据 return {'data_RD': self.data_RD, 'data_I': self.data_I, 'data_RU': self.data_RU, 'data_T': self.data_T, } elif chart_num == '3': return {'data_RD': self.data_K_R, 'data_K_L': self.data_K_L, 'data_I': self.data_I, 'data_T': self.data_T, 'data_J': self.data_J, } elif chart_num == '4': return {'data_LU_LD': self.data_LU_LD, 'data_RD_RU': self.data_RD_RU, 'data_K_R': self.data_K_R, 'data_K_L': self.data_K_L, 'data_I': self.data_I, 'data_T': self.data_T, 'data_J': self.data_J, 'data_Q': self.data_Q, } elif chart_num == '5': return {'data_K': self.data_K, 'data_P': self.data_P, 'data_R': self.data_R, 'data_S': self.data_S, } if __name__ == '__main__': dc = DataCleaner() m = dc.get_chart_data("1") for key in m: print(key + ':' + m[key].__str__())
StarcoderdataPython
12836323
<gh_stars>0 # # VScodeで入力をテキストから読み込んで標準入力に渡す import sys import os f=open(r'.\D\D_input.txt', 'r', encoding="utf-8") # inputをフルパスで指定 # win10でファイルを作るとs-jisで保存されるため、読み込みをutf-8へエンコードする必要あり # VScodeでinput file開くとutf8になってるんだけど中身は結局s-jisになっているらしい sys.stdin=f # # 入力スニペット # num = int(input()) # num_list = [int(item) for item in input().split()] # num_list = [input() for _ in range(3)] ################################## # # 以下ペースト可 # start 21:14 a, b = [int(item) for item in input().split()] # 素因数リスト import math def factor(num): divisor_list = [1] divisor = 2 max_prime = int(math.sqrt(num)) while max_prime >= divisor: if num % divisor == 0: divisor_list.append(divisor) num //= divisor else: divisor += 1 divisor_list.append(num) return divisor_list # 最大公約数 def gcd(a, b): while b > 1: a, b = b, a & b return a cd_list = set(factor(gcd(a, b))) print(len(cd_list))
StarcoderdataPython
6435455
# -*- coding: utf-8 -*- # Copyright 2017, A10 Networks # Author: <NAME>: @mike @t @<EMAIL> import socket from struct import * # checksum functions needed for calculation checksum def checksum(msg): s = 0 # loop taking 2 characters at a time for i in range(0, len(msg), 2): try: w = ord(msg[i]) + (ord(msg[i + 1]) << 8) except: w = ord(msg[i]) s = s + w s = (s >> 16) + (s & 0xffff) s = s + (s >> 16) # complement and mask to 4 byte short s = ~s & 0xffff return s class tcp_packet(): def __init__(self, tcp_seq, tcp_ack_seq, tcp_sport, tcp_dport, src_addr, dst_addr, userdata): # tcp header fields self.user_data = userdata self.tcp_source = tcp_sport # source port self.tcp_dest = tcp_dport # destination port self.tcp_seq = tcp_seq self.tcp_ack_seq = tcp_ack_seq self.tcp_doff = 5 # 4 bit field, size of tcp header, 5 * 4 = 20 bytes # tcp flags self.tcp_fin = 0 self.tcp_syn = 0 self.tcp_rst = 0 self.tcp_psh = 0 self.tcp_ack = 0 self.tcp_urg = 0 self.tcp_window = socket.htons(65534) # maximum allowed window size self.tcp_check = 0 self.tcp_urg_ptr = 0 # create a raw socket try: self.s = socket.socket(socket.AF_INET, socket.SOCK_RAW, socket.IPPROTO_RAW) except socket.error, msg: print 'Socket could not be created. Error Code : ' + str(msg[0]) + ' Message ' + msg[1] sys.exit() self.s.setsockopt(socket.IPPROTO_IP, socket.IP_HDRINCL, 1) # now start constructing the packet self.packet = ''; self.source_ip = src_addr self.dest_ip = dst_addr # or socket.gethostbyname('www.google.com') # ip header fields self.ip_ihl = 5 self.ip_ver = 4 # Set tos bit to map to IPtables match class to permit resets. self.ip_tos = 160 self.ip_tot_len = 0 # kernel will fill the correct total length self.ip_id = 0 # Id of this packet self.ip_frag_off = 0 self.ip_ttl = 128 # choice([255, 128, 64]) self.ip_proto = socket.IPPROTO_TCP self.ip_check = 0 # kernel will fill the correct checksum self.ip_saddr = socket.inet_aton(self.source_ip) # Spoof the source ip address if you want to self.ip_daddr = socket.inet_aton(self.dest_ip) self.ip_ihl_ver = (self.ip_ver << 4) + self.ip_ihl # tcp header fields def pack(self): """Need to add TCP Options RFC 1392 and other cools stuff like SACK and stuff. However, time is never on my side. Maybe a community project... This all needs to be ported to C once the DPDK Driver is completed. """ self.ip_header = pack('!BBHHHBBH4s4s', self.ip_ihl_ver, self.ip_tos, self.ip_tot_len, self.ip_id, self.ip_frag_off, self.ip_ttl, self.ip_proto, self.ip_check, self.ip_saddr, self.ip_daddr) self.tcp_offset_res = (self.tcp_doff << 4) + 0 self.tcp_flags = self.tcp_fin + (self.tcp_syn << 1) \ + (self.tcp_rst << 2) + (self.tcp_psh << 3) + (self.tcp_ack << 4) + (self.tcp_urg << 5) # print (self.tcp_source, self.tcp_dest, self.tcp_seq, self.tcp_ack_seq, # self.tcp_offset_res, self.tcp_flags, self.tcp_window, self.tcp_check, self.tcp_urg_ptr) # the ! in the pack format string means network order self.tcp_header = pack('!HHLLBBHHH', self.tcp_source, self.tcp_dest, self.tcp_seq, self.tcp_ack_seq, \ self.tcp_offset_res, self.tcp_flags, self.tcp_window, self.tcp_check, self.tcp_urg_ptr) # self.user_data = '' # pseudo header fields self.source_address = socket.inet_aton(self.source_ip) self.dest_address = socket.inet_aton(self.dest_ip) self.placeholder = 0 self.protocol = socket.IPPROTO_TCP self.tcp_length = len(self.tcp_header) + len(self.user_data) self.psh = pack('!4s4sBBH', self.source_address, self.dest_address, self.placeholder, self.protocol, self.tcp_length) self.psh = self.psh + self.tcp_header + str(self.user_data) self.tcp_check = checksum(self.psh) self.tcp_header = pack('!HHLLBBH', self.tcp_source, self.tcp_dest, self.tcp_seq, self.tcp_ack_seq, self.tcp_offset_res, \ self.tcp_flags, self.tcp_window) + pack('H', self.tcp_check) + pack('!H', self.tcp_urg_ptr) self.packet = self.ip_header + self.tcp_header + self.user_data def sendto(self): self.s.sendto(self.packet, (self.dest_ip, 0)) if __name__ == "__main__": x = tcp_packet()
StarcoderdataPython
11262525
<filename>100-Testes/threadTeste.py<gh_stars>0 from threading import Thread import sys import numpy as np #documentação https://docs.python.org/release/2.5.2/lib/thread-objects.html values = {0: [1]*100000000, 1: [3, 2]} sequential_total = 0 threaded_total = 0 threads = [] class Th(Thread): def __init__(self, num): sys.stdout.write("Criando Thread numero " + str(num + 1) + "\n") sys.stdout.flush() Thread.__init__(self) self.num = num self.subtotal = 0 def run(self): self.subtotal = np.sum(values[self.num]) sys.stdout.write("Subtotal: " + str(self.get_subtotal()) + "\n") sys.stdout.flush() def get_subtotal(self): return self.subtotal #### O programa comeca aqui ##### for thread_number in range(2): threads.insert(thread_number, Th(thread_number)) threads[thread_number].start() threaded_total += threads[0].get_subtotal() threaded_total += threads[1].get_subtotal() print("Total: " + str(threaded_total)) ''' threads[thread_number].join(0) print(thread_number) '''
StarcoderdataPython
169019
<gh_stars>0 import unittest from tests.templates.rectangle_world import ( example_wiki_ccl, example_simple_different_regions, ) from dekespo_ai_sdk.algorithms.connected_component_labelling import ( ConnectedComponentLabelling, ) from dekespo_ai_sdk.core.graph import Graph from dekespo_ai_sdk.core.shapes import Shape2DType from dekespo_ai_sdk.core.dimensions import Dim2D from dekespo_ai_sdk.core.raw_data_handler import RawDataHandler from dekespo_ai_sdk.core.neighbour import NeighbourType class ConnectedComponentLabellingTest(unittest.TestCase): def test_wiki_example(self): raw_data_handler = RawDataHandler(example_wiki_ccl()) graph = Graph(raw_data_handler, Shape2DType.RECTANGLE, blocking_values=[0]) labeller = ConnectedComponentLabelling(graph, NeighbourType.CONNECTIVITY_EIGHT) labeller.first_pass() first_pass_data = [ [0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0], [0, 0, 1, 1, 0, 0, 2, 2, 0, 0, 3, 3, 0, 0, 4, 4, 0], [0, 1, 1, 1, 1, 1, 1, 1, 1, 0, 0, 3, 3, 3, 3, 0, 0], [0, 0, 0, 1, 1, 1, 1, 0, 0, 0, 3, 3, 3, 3, 0, 0, 0], [0, 0, 1, 1, 1, 1, 0, 0, 0, 3, 3, 3, 0, 0, 3, 3, 0], [0, 1, 1, 1, 0, 0, 1, 1, 0, 0, 0, 3, 3, 3, 0, 0, 0], [0, 0, 1, 1, 0, 0, 0, 0, 0, 5, 3, 0, 0, 0, 3, 3, 0], [0, 0, 0, 0, 0, 0, 6, 6, 5, 3, 0, 0, 7, 3, 3, 3, 0], [0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0], ] self.assertEqual(labeller.get_labels_graph(), first_pass_data) labeller.second_pass() second_pass_data = [ [0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0], [0, 0, 2, 2, 0, 0, 2, 2, 0, 0, 4, 4, 0, 0, 4, 4, 0], [0, 2, 2, 2, 2, 2, 2, 2, 2, 0, 0, 4, 4, 4, 4, 0, 0], [0, 0, 0, 2, 2, 2, 2, 0, 0, 0, 4, 4, 4, 4, 0, 0, 0], [0, 0, 2, 2, 2, 2, 0, 0, 0, 4, 4, 4, 0, 0, 4, 4, 0], [0, 2, 2, 2, 0, 0, 2, 2, 0, 0, 0, 4, 4, 4, 0, 0, 0], [0, 0, 2, 2, 0, 0, 0, 0, 0, 4, 4, 0, 0, 0, 4, 4, 0], [0, 0, 0, 0, 0, 0, 4, 4, 4, 4, 0, 0, 4, 4, 4, 4, 0], [0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0], ] self.assertEqual(labeller.get_labels_graph(), second_pass_data) regions = labeller.get_regions() self.assertEqual(len(regions), 3) self.assertTrue(Dim2D(0, 0) in regions[0]) self.assertTrue(Dim2D(8, 3) in regions[0]) self.assertTrue(Dim2D(11, 6) in regions[0]) self.assertTrue(Dim2D(1, 2) in regions[2]) self.assertTrue(Dim2D(4, 4) in regions[2]) self.assertTrue(Dim2D(15, 1) in regions[4]) self.assertTrue(Dim2D(13, 5) in regions[4]) def test_different_regions_8_connectivity(self): raw_data_handler = RawDataHandler(example_simple_different_regions()) graph = Graph(raw_data_handler, Shape2DType.RECTANGLE, blocking_values=[1]) labeller = ConnectedComponentLabelling(graph, NeighbourType.CONNECTIVITY_EIGHT) labeller.first_pass() labeller.second_pass() regions = labeller.get_regions() self.assertEqual(len(regions), 3) self.assertTrue(Dim2D(0, 1) in regions[0]) self.assertTrue(Dim2D(2, 1) in regions[0]) self.assertTrue(Dim2D(5, 4) in regions[0]) self.assertTrue(Dim2D(0, 0) in regions[2]) self.assertTrue(Dim2D(0, 4) in regions[2]) self.assertTrue(Dim2D(6, 0) in regions[2]) self.assertTrue(Dim2D(6, 4) in regions[2]) self.assertTrue(Dim2D(3, 0) in regions[2]) self.assertTrue(Dim2D(3, 4) in regions[2]) self.assertTrue(Dim2D(1, 2) in regions[2]) self.assertTrue(Dim2D(5, 2) in regions[2]) self.assertTrue(Dim2D(3, 2) in regions[4]) def test_different_regions_4_connectivity(self): raw_data_handler = RawDataHandler(example_simple_different_regions()) graph = Graph(raw_data_handler, Shape2DType.RECTANGLE, blocking_values=[1]) labeller = ConnectedComponentLabelling(graph, NeighbourType.CONNECTIVITY_FOUR) labeller.first_pass() labeller.second_pass() regions = labeller.get_regions() self.assertEqual(len(regions), 10) self.assertTrue(Dim2D(0, 1) in regions[0]) self.assertTrue(Dim2D(2, 1) in regions[0]) self.assertTrue(Dim2D(5, 4) in regions[0]) self.assertTrue(Dim2D(0, 0) in regions[1]) self.assertTrue(Dim2D(0, 4) in regions[7]) self.assertTrue(Dim2D(6, 0) in regions[3]) self.assertTrue(Dim2D(6, 4) in regions[9]) self.assertTrue(Dim2D(3, 2) in regions[6]) self.assertTrue(Dim2D(3, 0) in regions[2]) self.assertTrue(Dim2D(3, 4) in regions[8]) self.assertTrue(Dim2D(1, 2) in regions[4]) self.assertTrue(Dim2D(5, 2) in regions[5]) if __name__ == "__main__": unittest.main()
StarcoderdataPython
1645019
<reponame>asimonia/pricing-alerts import uuid from common.database import Database import models.stores.constants as StoreConstants import models.stores.errors as StoreErrors class Store: def __init__(self, name, url_prefix, tag_name, query, _id=None): self.name = name self.url_prefix = url_prefix self.tag_name = tag_name self.query = query self._id = uuid.uuid4().hex if _id is None else _id def __repr__(self): return "<Store {}>".format(self.name) def json(self): return { "_id": self._id, "name": self.name, "url_prefix": self.url_prefix, "tag_name": self.tag_name, "query": self.query } @classmethod def get_by_id(cls, id): """Get the store by id""" return cls(**Database.find_one(StoreConstants.COLLECTION, {"_id": id})) def save_to_mongo(self): """Update a record in db""" Database.update(StoreConstants.COLLECTION, {"_id": self._id}, self.json()) @classmethod def get_by_name(cls, store_name): return cls(**Database.find_one(StoreConstants.COLLECTION, {"name": store_name})) @classmethod def get_by_url_prefix(cls, url_prefix): """Allow users to give the item url.""" return cls(**Database.find_one(StoreConstants.COLLECTION, {"url_prefix": {"$regex": '^{}'.format(url_prefix)}})) @classmethod def find_by_url(cls, url): """ Try to find and return a store from a url, if there isn't anything, return None """ for i in range(0, len(url) + 1): try: store = cls.get_by_url_prefix(url[:i]) return store except: raise StoreErrors.StoreNotFoundException("The URL prefix did not give us any results.") @classmethod def all(cls): """Return all items from the Database collection""" return [cls(**elem) for elem in Database.find(StoreConstants.COLLECTION, {})] def delete(self): Database.remove(StoreConstants.COLLECTION, {'_id': self._id})
StarcoderdataPython
9747182
<filename>tensorflow/python/autograph/pyct/static_analysis/reaching_fndefs.py # Copyright 2018 The TensorFlow Authors. All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # ============================================================================== """An analysis that determines the reach of a function definition. A function definition is said to reach a statement if that function may exist (and therefore may be called) when that statement executes. """ from __future__ import absolute_import from __future__ import division from __future__ import print_function import gast from tensorflow.python.autograph.pyct import anno from tensorflow.python.autograph.pyct import cfg from tensorflow.python.autograph.pyct import transformer class Definition(object): """Definition objects describe a unique definition of a function.""" def __init__(self, def_node): self.def_node = def_node class _NodeState(object): """Abstraction for the state of the CFG walk for reaching definition analysis. This is a value type. Only implements the strictly necessary operators. Attributes: value: Dict[qual_names.QN, Set[Definition, ...]], the defined symbols and their possible definitions """ def __init__(self, init_from=None): if init_from: self.value = set(init_from) else: self.value = set() def __eq__(self, other): return self.value == other.value def __ne__(self, other): return self.value != other.value def __or__(self, other): assert isinstance(other, _NodeState) result = _NodeState(self.value) result.value.update(other.value) return result def __add__(self, value): result = _NodeState(self.value) result.value.add(value) return result def __repr__(self): return 'NodeState[%s]=%s' % (id(self), repr(self.value)) class Analyzer(cfg.GraphVisitor): """CFG visitor that determines reaching definitions at statement level.""" def __init__(self, graph, external_defs): super(Analyzer, self).__init__(graph) # This allows communicating that nodes have extra reaching definitions, # e.g. those that a function closes over. self.external_defs = external_defs def init_state(self, _): return _NodeState() def visit_node(self, node): prev_defs_out = self.out[node] if node is self.graph.entry: defs_in = _NodeState(self.external_defs) else: defs_in = prev_defs_out for n in node.prev: defs_in |= self.out[n] defs_out = defs_in if isinstance(node.ast_node, (gast.Lambda, gast.FunctionDef)): defs_out += node.ast_node self.in_[node] = defs_in self.out[node] = defs_out return prev_defs_out != defs_out class TreeAnnotator(transformer.Base): """AST visitor that annotates each symbol name with its reaching definitions. Simultaneously, the visitor runs the dataflow analysis on each function node, accounting for the effect of closures. For example: def foo(): def f(): pass def g(): # `def f` reaches here """ def __init__(self, source_info, graphs): super(TreeAnnotator, self).__init__(source_info) self.graphs = graphs self.allow_skips = False self.current_analyzer = None def _proces_function(self, node): parent_analyzer = self.current_analyzer subgraph = self.graphs[node] if (self.current_analyzer is not None and node in self.current_analyzer.graph.index): cfg_node = self.current_analyzer.graph.index[node] defined_in = self.current_analyzer.in_[cfg_node].value else: defined_in = () analyzer = Analyzer(subgraph, defined_in) analyzer.visit_forward() self.current_analyzer = analyzer node = self.generic_visit(node) self.current_analyzer = parent_analyzer return node def visit_FunctionDef(self, node): return self._proces_function(node) def visit_Lambda(self, node): return self._proces_function(node) def visit(self, node): # This can happen before entering the top level function if (self.current_analyzer is not None and node in self.current_analyzer.graph.index): cfg_node = self.current_analyzer.graph.index[node] anno.setanno(node, anno.Static.DEFINED_FNS_IN, self.current_analyzer.in_[cfg_node].value) extra_node = anno.getanno(node, anno.Basic.EXTRA_LOOP_TEST, default=None) if extra_node is not None: cfg_node = self.current_analyzer.graph.index[extra_node] anno.setanno(extra_node, anno.Static.DEFINED_FNS_IN, self.current_analyzer.in_[cfg_node].value) return super(TreeAnnotator, self).visit(node) def resolve(node, source_info, graphs): """Resolves reaching definitions for each symbol. Args: node: ast.AST source_info: transformer.SourceInfo graphs: Dict[ast.FunctionDef, cfg.Graph] Returns: ast.AST """ visitor = TreeAnnotator(source_info, graphs) node = visitor.visit(node) return node
StarcoderdataPython
9738425
# Copyright 2020 EraO Prosopagnosia Helper Dev Team, <NAME>, <NAME>, <NAME>, <NAME>, <NAME> # # Supervised by Prof. <NAME> (http://www.eecg.toronto.edu/~mann/) # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. import datetime import re import time from app.api.HttpResponse import http_response from flask import request from flask_bcrypt import Bcrypt from werkzeug.exceptions import RequestEntityTooLarge from werkzeug.utils import secure_filename from app import webapp from app.AccountManagment import validUsernameChar, get_database from app.FileUploader import UPLOAD_FOLDER from app.S3Helper import get_file_path_by_key, store_file @webapp.route('/api/register', methods=['POST']) def user_register_api(): ''' This function takes POST http request with a URL of "/api/register". It firstly reads the user submitted username and password. It then connects to the database to check if there is already an existing username in the database. The function also checks whether the user provided all the necessary information; whether the format of the username and password are correct. If any of the above conditions failed, the function will return user with a formatted Json string including the error code and error message. If all the condition check passed, the function will create a new entry in the dataset and return a Json string with code 200 indicating request processed successfully. :return: Json string with status code and information string ''' bcrypt = Bcrypt(webapp) # need to trim the user name username = request.form.get('username', "") password = request.form.get('password', "") # connect to database cnx = get_database() cursor = cnx.cursor() query = "SELECT COUNT(username) FROM user_info WHERE username = %s " cursor.execute(query, (username,)) results = cursor.fetchall() numberOfExistUser = results[0][0] if numberOfExistUser != 0: return http_response(409, "Error: User name already exist!") if username == "" or password == "": return http_response(400, "Error: All fields are required!") if re.findall(r'\s+', username) != []: return http_response(400, "Error: No space allowed in user name!") if (len(username) > 20 or len(username) < 1) or not all(c in validUsernameChar for c in username): return http_response(400, "Error: Username violation, username must have length between 1 to 20, only letters and numbers allowed") if len(password) > 16 or len(password) < 1: return http_response(400, "Error: Password length violation") ts = time.time() timestamp = datetime.datetime.fromtimestamp(ts).strftime('%Y-%m-%d %H:%M:%S') password = bcrypt.generate_password_hash(password).decode("utf-8") query = ''' INSERT INTO user_info (username,password,create_date,active,upload_counter) VALUES (%s,%s, %s,1,0) ''' cursor.execute(query, (username, password, timestamp)) cnx.commit() # Add error catch here for sql return http_response(200, "Registration succeed for the user: " + username) ALLOWED_EXTENSIONS = set(['png', 'jpg', 'jpeg']) webapp.config['UPLOAD_FOLDER'] = UPLOAD_FOLDER def allowed_file(filename): return '.' in filename and filename.rsplit('.', 1)[1].lower() in ALLOWED_EXTENSIONS # after user click the upload button @webapp.route('/api/upload', methods=['POST']) def upload_file_api(): ''' This function provides users with an api to upload an image together with given username and password. The function will first check if the user info is correct and if it's correct, the function will keep a record of the image and an OpenCV-processed image in the database, with the proper naming scheme. The function can raise exceptions if there are any of the following problems: no file selected; filename too long; wrong extension type; file too large. If the uploaded is valid then we will connect to the database and create a record. First, we assign systematic names to the image and its processed image depending on the user id and their upload counter. Second, we save the image to the cloud, process it through OpenCV and then save the processed image to the cloud. Third, we gather all information and update our file name table in the database. Last we increase the upload counter by 1 and update it. :return: Json string with status code and information string ''' bcrypt = Bcrypt(webapp) try: username = request.form['username'] password = request.form['password'] if request.method == 'POST': # check if the post request has the file part if 'file' not in request.files: return http_response(404, "No file upload in the request!") try: file = request.files['file'] except RequestEntityTooLarge: return http_response(413, "Image too large, file cannot larger than 5mb") # if user does not select file, browser also # submit an empty part without filename if file.filename == '': return http_response(404, "No file selected!") if len(file.filename) >= 50: return http_response(400, "File name too long") if file and allowed_file(file.filename): # ===================================================# # ======Till this step the file is good to process===# # ===================================================# # rename the upload img as: userpid_useruploadcounter_imagename.extention userFileName = secure_filename(file.filename) # example: example.jpg # connect to database cnx = get_database() cursor = cnx.cursor() query1 = "SELECT password, uid, upload_counter FROM user_info WHERE username = %s and active = 1" cursor.execute(query1, (username,)) results = cursor.fetchall() if len(results) != 1: return http_response(400, "Invalid username or password") correctPwd = bcrypt.check_password_hash(results[0][0], password) if correctPwd: uid = results[0][1] upload_counter = results[0][2] cloudSaveFilename = str(uid) + "_" + str( upload_counter) + "_" + userFileName # example: 12_1_example.jpg cloudProcessedFileName = "p_" + cloudSaveFilename userDownloadFileName = "processed_" + userFileName # save uploaded img to cloud drive # file.save(os.path.join(webapp.config['UPLOAD_FOLDER'], cloudSaveFilename)) store_file(cloudSaveFilename, file) new_file = get_file_path_by_key(cloudSaveFilename) # process the img from cloud drive, it will process the img in (img_path) and save processed img in same path Opencv.imageProcess(cloudProcessedFileName, new_file) # prepare for values for sql fileName = userFileName processedFileName = "processed_" + userFileName uploadImagePath = UPLOAD_FOLDER + cloudSaveFilename processedImagePath = UPLOAD_FOLDER + cloudProcessedFileName ts = time.time() timeStamp = datetime.datetime.fromtimestamp(ts).strftime('%Y-%m-%d %H:%M:%S') # update file_name table query2 = "INSERT INTO file_info (uid, file_name, upload_image_path, cloud_image_name, processed_image_path, cloud_processed_image_name, create_time) VALUES (%s, %s, %s, %s, %s , %s, %s)" data = ( uid, fileName, uploadImagePath, cloudSaveFilename, processedImagePath, cloudProcessedFileName, timeStamp) cursor.execute(query2, data) cnx.commit() # get the newest user upload counter for database query3 = "SELECT upload_counter FROM user_info WHERE username = %s and active = 1" cursor.execute(query3, (username,)) results = cursor.fetchall() upload_counter = results[0][0] # update user_table query4 = "UPDATE user_info SET upload_counter = %s WHERE uid = %s" cursor.execute(query4, (upload_counter + 1, uid)) cnx.commit() print("==>process succeed") # get the image path for both image_before and image_after return http_response(200, "Image Successfully Processed!") else: return http_response(400, "Invalid username or password") else: return http_response(400, "Not a Correct File Type!" + str( file and allowed_file(file.filename)) + "|" + file.filename) return http_response(123, "Unsupported method!") except Exception as ex: if '413' in str(ex): return http_response(413, "Image too large, file cannot larger than 5mb") return http_response(400, str(ex))
StarcoderdataPython
3359326
<filename>Practice/divisibility.py<gh_stars>0 n = int(input()) cases = [0 for j in range(n)] for i in range(n): line = [int(k) for k in input().split()] if(line[0]%line[1] == 0): cases[i] = 0 else: cases[i] = line[1] - line[0]%line[1] for j in cases: print(str(j))
StarcoderdataPython
11356717
<filename>emiproc/country_code.py # constants country_codes = { "ALB": 1, "AUT": 2, "BEL": 3, "BGR": 4, "DNK": 6, "FIN": 7, "FRA": 8, "SMR": 8, #HJM "FGD": 9, "FFR": 10, "GRC": 11, "HUN": 12, "IRL": 14, "ITA": 15, "LUX": 16, "NLD": 17, "NOR": 18, "POL": 19, "PRT": 20, "ROM": 21, "ROU": 21, "ESP": 22, "AND": 22, # Andora -> ESP "SWE": 23, "CHE": 24, "TUR": 25, "GBR": 27, "IMN": 27, # Isle of Man -> GBR "GGY": 27, # Guernsey -> GBR "JEY": 27, # Jursey -> GBR "BLR": 39, "UKR": 40, "MKD": 41, "MDA": 42, "EST": 43, "LVA": 44, "LTU": 45, "CZE": 46, "SVK": 47, "SVN": 48, "HRV": 49, "BIH": 50, "YUG": 51, "GEO": 54, "MLT": 57, "DEU": 60, "RUS": 61, "ARM": 56, "AZE": 58, "CYP": 55, "ISL": 18, # added for AQMEII, assumed to be same as Norway # ISO 2 (from EMEP site) "AL": 1, # Albania "AT": 2, # Austria "BE": 3, # Belgium "BG": 4, # Bulgaria "FCS": 5, # Former Czechoslovakia "DK": 6, # Denmark "FI": 7, # Finland "ALD": 7, # Aland, part of Finland "FR": 8, # France "FGD": 9, # Former German Democratic Republic "FFR": 10, # Former Federal Republic of Germany "GR": 11, # Greece "WSB": 11, # Akrotiri/Santorini (Assigned to Greece) "HU": 12, # Hungary "IS": 13, # Iceland "IE": 14, # Ireland "IT": 15, # Italy "LU": 16, # Luxembourg "NL": 17, # Netherlands "NO": 18, # Norway "PL": 19, # Poland "PT": 20, # Portugal "RO": 21, # Romania "ES": 22, # Spain "SMR": 22, # San Marino (assigned to Spain) "AD": 22, # Andorra (assigned to Spain) "GIB": 22, # Gibraltar (assigned to Spain) "SE": 23, # Sweden "CH": 24, # Switzerland "TR": 25, # Turkey "FSU": 26, # Former USSR "GB": 27, # United Kingdom "FRO": 27, # Faroe Island (assigned to United Kingdom) "VOL": 28, # Volcanic emissions "REM": 29, # Remaining land Areas "BAS": 30, # Baltic Sea "NOS": 31, # North Sea "ATL": 32, # Remaining North-East Atlantic Ocean "MED": 33, # Mediterranean Sea "BLS": 34, # Black Sea "NAT": 35, # Natural marine emissions "RUO": 36, # Kola & Karelia "RUP": 37, # St.Petersburg & Novgorod-Pskov "RUA": 38, # Kaliningrad "BY": 39, # Belarus "UA": 40, # Ukraine "MD": 41, # Republic of Moldova "RUR": 42, # Rest of the Russian Federation "EE": 43, # Estonia "LV": 44, # Latvia "LT": 45, # Lithuania "CZ": 46, # Czech Republic "SK": 47, # Slovakia "SI": 48, # Slovenia "HR": 49, # Croatia "BA": 50, # Bosnia and Herzegovina "CS": 51, # Serbia and Montenegro "MK": 52, # The former Yugoslav Republic of Macedonia "KZ": 53, # Kazakhstan in the former official EMEP domain "GE": 54, # Georgia "CY": 55, # Cyprus "CYN": 55, # Cyprus (alternate code) "CNM": 55, # Cyprus (alternate code) "ESB": 55, # Dhekelia Cantonment (assigned to Cyprus) "AM": 56, # Armenia "MT": 57, # Malta "ASI": 58, # Remaining Asian areas "LI": 59, # Liechtenstein, "LIE": 59, # Liechtenstein (alternate code) "DE": 60, # Germany "RU": 61, # Russian Federation in the former official EMEP domain "MC": 62, # Monaco "MCO": 62, # Monaco "NOA": 63, # North Africa "MAR": 63, # Maroko (assigned to NOA) "TUN": 63, # Tunisia (assigned to NOA) "DZA": 63, # Algeria (assigned to NOA) "SYR": 63, # Syria (assigned to NOA) "EU": 64, # European Community "US": 65, # United States "CA": 66, # Canada "BIC": 67, # Boundary and Initial Conditions "KG": 68, # Kyrgyzstan "AZ": 69, # Azerbaijan "ATX": 70, # EMEP-external Remaining North-East Atlantic Ocean "RUX": 71, # EMEP-external part of Russian Federation "RS": 72, # Serbia "SRB": 72, # Serbia (alternate code) "KOS": 72, # Kosovo (assigned to SRB) "ME": 73, # Montenegro "MNE": 73, # Montenegro (alternate code) "RFE": 74, # Rest of Russian Federation in the extended EMEP domain "KZE": 75, # Rest of Kazakhstan in the extended EMEP domain "UZO": 76, # Uzbekistan in the former official EMEP domain "TMO": 77, # Turkmenistan in the former official EMEP domain "UZE": 78, # Rest of Uzbekistan in the extended EMEP domain "TME": 79, # Rest of Turkmenistan in the extended EMEP domain "CAS": 80, # Caspian Sea "TJ": 81, # Tajikistan "ARO": 82, # Aral Lake in the former official EMEP domain "ARE": 83, # Rest of Aral Lake in the extended EMEP domain "ASM": 84, # Modified Remaining Asian Areas in the former official EMEP domain "ASE": 85, # Remaining Asian Areas in the extended EMEP domain "AOE": 86, # Arctic Ocean in the extended EMEP domain "RFX": 87, # Extended EMEP External Part of Russian Federation "ASX": 88, # Extended EMEP External Part of Asia "PAX": 89, # Extended EMEP External Part of Pacific Ocean "AOX": 90, # Extended EMEP External Part of Arctic Ocean "NAX": 91, # Extended EMEP External Part of North Africa "KZT": 92, # Kazakhstan "RUE": 93, # Russian Federation in the extended EMEP domain (RU+RFE+RUX) "UZ": 94, # Uzbekistan "TM": 95, # Turkmenistan "AST": 96, # Asian areas in the extended EMEP domain (ASM+ASE+ARO+ARE+CAS) "FYU": 99, # Former Yugoslavia "BEF": 301, # Belgium (Flanders) "BA2": 302, # Baltic Sea EU Cargo o12m "BA3": 303, # Baltic Sea ROW Cargo o12m "BA4": 304, # Baltic Sea EU Cargo i12m "BA5": 305, # Baltic Sea ROW Cargo i12m "BA6": 306, # Baltic Sea EU Ferry o12m "BA7": 307, # Baltic Sea ROW Ferry o12m "BA8": 308, # Baltic Sea EU Ferry i12m "BA9": 309, # Baltic Sea ROW Ferry i12m "NO2": 312, # North Sea EU Cargo o12m "NO3": 313, # North Sea ROW Cargo o12m "NO4": 314, # North Sea EU Cargo i12m "NO5": 315, # North Sea ROW Cargo i12m "NO6": 316, # North Sea EU Ferry o12m "NO7": 317, # North Sea ROW Ferry o12m "NO8": 318, # North Sea EU Ferry i12m "NO9": 319, # North Sea ROW Ferry i12m "AT2": 322, # Remaining North-East Atlantic Ocean EU Cargo 'o1': 2 # m "AT3": 323, # Remaining North-East Atlantic Ocean ROW Cargo 'o1': 2 # m "AT4": 324, # Remaining North-East Atlantic Ocean EU Cargo 'i1': 2 # m "AT5": 325, # Remaining North-East Atlantic Ocean ROW Cargo 'i1': 2 # m "AT6": 326, # Remaining North-East Atlantic Ocean EU Ferry 'o1': 2 # m "AT7": 327, # Remaining North-East Atlantic Ocean ROW Ferry 'o1': 2 # m "AT8": 328, # Remaining North-East Atlantic Ocean EU Ferry 'i1': 2 # m "AT9": 329, # Remaining North-East Atlantic Ocean ROW Ferry 'i1': 2 # m "ME2": 332, # Mediterranean Sea EU Cargo o12m "ME3": 333, # Mediterranean Sea ROW Cargo o12m "ME4": 334, # Mediterranean Sea EU Cargo i12m "ME5": 335, # Mediterranean Sea ROW Cargo i12m "ME6": 336, # Mediterranean Sea EU Ferry o12m "ME7": 337, # Mediterranean Sea ROW Ferry o12m "ME8": 338, # Mediterranean Sea EU Ferry i12m "ME9": 339, # Mediterranean Sea ROW Ferry i12m "BL2": 342, # Black Sea EU Cargo o12m "BL3": 343, # Black Sea ROW Cargo o12m "BL4": 344, # Black Sea EU Cargo i12m "BL5": 345, # Black Sea ROW Cargo i12m "BL6": 346, # Black Sea EU Ferry o12m "BL7": 347, # Black Sea ROW Ferry o12m "BL8": 348, # Black Sea EU Ferry i12m "BL9": 349, # Black Sea ROW Ferry i12m "GL": 601, # Greenland }
StarcoderdataPython
5068574
import numpy as np import matplotlib.pyplot as plt import cv2 import gin import typing import torch import imutils from scipy.stats import multivariate_normal import xml.etree.ElementTree as ET from soccer_robot_perception.utils.constants import CLASS_MAPPING_DETECTION from soccer_robot_perception.utils.metrics import total_variation_loss def read_xml_file(xml_file: str): tree = ET.parse(xml_file) root = tree.getroot() bb_list = [] class_list = [] for boxes in root.iter("object"): filename = root.find("filename").text class_list.append(CLASS_MAPPING_DETECTION[boxes.find("name").text]) ymin = int(boxes.find("bndbox/ymin").text) xmin = int(boxes.find("bndbox/xmin").text) ymax = int(boxes.find("bndbox/ymax").text) xmax = int(boxes.find("bndbox/xmax").text) bb_list.append([xmin, ymin, xmax, ymax]) return class_list, bb_list @gin.configurable def det_label_preprocessor( input_width, input_height, channels, bb, class_name, small_variance=6, large_variance=12, scale=4, visualize_label_masks=False, ): label_mask_shrinked = np.zeros( (channels, int(input_height / scale), int(input_width / scale)) ) robot_map = np.ones((int(input_height / scale), int(input_width / scale))) ball_map = np.ones((int(input_height / scale), int(input_width / scale))) goalpost_map = np.ones((int(input_height / scale), int(input_width / scale))) blob_centers = [] for box, name in zip(bb, class_name): box = [x / scale for x in box] if name == CLASS_MAPPING_DETECTION["ball"]: ball_heatmap = np.dstack( np.mgrid[ 0 : int(input_height / scale) : 1, 0 : int(input_width / scale) : 1 ] ) point_x = (box[0] + box[2]) / 2 point_y = (box[1] + box[3]) / 2 start_x = int(point_x) start_y = int(point_y) rv = multivariate_normal(mean=[start_y, start_x], cov=small_variance) ball_map = ball_map + rv.pdf(ball_heatmap) blob_centers.append((start_y, start_x, name)) elif name == CLASS_MAPPING_DETECTION["robot"]: robot_heatmap = np.dstack( np.mgrid[ 0 : int(input_height / scale) : 1, 0 : int(input_width / scale) : 1 ] ) point_x = (box[0] + box[2]) / 2 point_y = box[3] start_x = int(point_x) start_y = int(point_y) rv = multivariate_normal(mean=[start_y, start_x], cov=large_variance) robot_map = robot_map + rv.pdf(robot_heatmap) blob_centers.append((start_y, start_x, name)) elif name == CLASS_MAPPING_DETECTION["goalpost"]: goalpost_heatmap = np.dstack( np.mgrid[ 0 : int(input_height / scale) : 1, 0 : int(input_width / scale) : 1 ] ) point_x = box[0] point_y = box[3] start_x = int(point_x) start_y = int(point_y) rv = multivariate_normal(mean=[start_y, start_x], cov=small_variance) goalpost_map = goalpost_map + rv.pdf(goalpost_heatmap) blob_centers.append((start_y, start_x, name)) goalpost_heatmap = np.dstack( np.mgrid[ 0 : int(input_height / scale) : 1, 0 : int(input_width / scale) : 1 ] ) point_x = box[2] point_y = box[3] start_x = int(point_x) start_y = int(point_y) rv = multivariate_normal(mean=[start_y, start_x], cov=small_variance) goalpost_map = goalpost_map + rv.pdf(goalpost_heatmap) blob_centers.append((start_y, start_x, name)) if visualize_label_masks: plt.imshow(label_mask_shrinked) plt.show() label_mask_shrinked[0] = ball_map label_mask_shrinked[1] = robot_map label_mask_shrinked[2] = goalpost_map label_mask_shrinked = torch.tensor(label_mask_shrinked, dtype=torch.float) return label_mask_shrinked, blob_centers def center_of_shape(image: np.ndarray, threshold, name: int): """ To find centers of the contours in the input image. :param image: Image to find the contours. :param name: Integer denoting the classes - 1: ball, 2: robot, 3: goalpost :return: out_centers: All contour centers in the input image. """ centers = [] image = (image * 255).astype(np.uint8) blurred = cv2.GaussianBlur(image, (3, 3), 0) thresh, im_bw = cv2.threshold(blurred, threshold, 255, cv2.THRESH_BINARY) cnts = cv2.findContours( im_bw.copy(), cv2.RETR_EXTERNAL, cv2.CHAIN_APPROX_SIMPLE ) cnts = imutils.grab_contours(cnts) for c in cnts: M = cv2.moments(c) if M["m00"] > 0: cX = int(M["m10"] / M["m00"]) cY = int(M["m01"] / M["m00"]) centers.append((cY, cX, name)) return centers def plot_blobs(points: typing.List, variance: float): """ Function to plot blobs predicted and preprocessed by the network. :param points: :param variance: :return: """ blob_map = np.ones((120, 160)) for i in points: blob_point = [i[0], i[1]] pos = np.dstack(np.mgrid[0:120:1, 0:160:1]) rv = multivariate_normal(mean=blob_point, cov=variance) blob_map = blob_map + rv.pdf(pos) return blob_map def compute_total_variation_loss_det(img, weight: float = 0.0001): tv_loss = total_variation_loss(img, weight) return tv_loss def det_image_processor_wandb(input_image, model_det_out, target): fig = plt.figure() plt.subplot(131) new_image = cv2.resize(input_image.permute(1, 2, 0).numpy(), (160, 120), interpolation=cv2.INTER_NEAREST) plt.imshow(new_image) plt.title('Input') plt.subplot(132) plt.imshow((model_det_out.permute(1, 2, 0).numpy() * 255).astype(np.uint8)) plt.title('Det out') plt.subplot(133) plt.imshow((target.permute(1, 2, 0).numpy() * 255).astype(np.uint8)) plt.title('Target') plt.close() return fig
StarcoderdataPython
6445741
# Generated by Django 4.0.2 on 2022-02-23 11:48 from django.conf import settings from django.db import migrations, models import django.db.models.deletion import django.utils.timezone class Migration(migrations.Migration): initial = True dependencies = [ migrations.swappable_dependency(settings.AUTH_USER_MODEL), ] operations = [ migrations.CreateModel( name='Measurement', fields=[ ('id', models.BigAutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')), ('pub_date', models.DateTimeField(default=django.utils.timezone.now, verbose_name='date published')), ('chest', models.DecimalField(decimal_places=2, max_digits=5)), ('waist', models.DecimalField(decimal_places=2, max_digits=5)), ('hips', models.DecimalField(decimal_places=2, max_digits=5)), ('weight', models.DecimalField(decimal_places=2, max_digits=5)), ('user', models.ForeignKey(on_delete=django.db.models.deletion.CASCADE, to=settings.AUTH_USER_MODEL)), ], ), ]
StarcoderdataPython
5153628
""" Pet Steps Steps file for Pet.feature """ import os import json import requests from behave import * from compare import expect, ensure from selenium.webdriver.common.by import By from selenium.webdriver.support.ui import WebDriverWait from selenium.webdriver.support import expected_conditions if 'VCAP_SERVICES' in os.environ or 'BINDING_CLOUDANT' in os.environ: WAIT_SECONDS = 30 else: WAIT_SECONDS = 5 @given('the following pets') def step_impl(context): """ Delete all Pets and load new ones """ headers = {'Content-Type': 'application/json'} context.resp = requests.delete(context.base_url + '/customers/reset', headers=headers) expect(context.resp.status_code).to_equal(204) create_url = context.base_url + '/customers' for row in context.table: data = { "id": row['id'], "first_name": row['first_name'], "last_name": row['last_name'], "address": row['address'], "email": row['email'], "username": row['username'], "password": row['password'], "phone_number": row['phone_number'], "active": row['active'] in ['True', 'true', '1'] } payload = json.dumps(data) context.resp = requests.post(create_url, data=payload, headers=headers) expect(context.resp.status_code).to_equal(201) @when('I visit the "home page"') def step_impl(context): """ Make a call to the base URL """ context.driver.get(context.base_url) @then('I should see "{message}" in the title') def step_impl(context, message): """ Check the document title for a message """ expect(context.driver.title).to_contain(message) @then('I should not see "{message}"') def step_impl(context, message): error_msg = "I should not see '%s' in '%s'" % (message, context.resp.text) ensure(message in context.resp.text, False, error_msg) @when('I set the "{element_name}" to "{text_string}"') def step_impl(context, element_name, text_string): element_id = element_name.lower() element = context.driver.find_element_by_id(element_id) element.clear() if element_name == "id": headers = {'Content-Type': 'application/json'} resp = requests.get(context.base_url +'/customers') customer_lists = resp.json() # it's list of dictionary # search a particular customer by its id customers = filter(lambda data: data.get('id', 0) == int(text_string), customer_lists) if customers: text_string = customers[0]['_id'] element.send_keys(text_string) ################################################################## # This code works because of the following naming convention: # The buttons have an id in the html hat is the button text # in lowercase followed by '-btn' so the Clean button has an id of # id='clear-btn'. That allows us to lowercase the name and add '-btn' # to get the element id of any button ################################################################## @when('I select the "{checkbox}" option') def step_impl(context, checkbox): print(checkbox) select_id = checkbox.lower() context.driver.find_element_by_id(select_id).click() @when('I press the "{button}" button') def step_impl(context, button): button_id = button.lower() + '-btn' context.driver.find_element_by_id(button_id).click() @then('I should see "{name}" in the results') def step_impl(context, name): found = WebDriverWait(context.driver, WAIT_SECONDS).until( expected_conditions.text_to_be_present_in_element( (By.ID, 'search_results'), name ) ) expect(found).to_be(True) @then('I should not see "{name}" in the results') def step_impl(context, name): element = context.driver.find_element_by_id('search_results') error_msg = "I should not see '%s' in '%s'" % (name, element.text) ensure(name in element.text, False, error_msg) @then('I should see the message "{message}"') def step_impl(context, message): found = WebDriverWait(context.driver, WAIT_SECONDS).until( expected_conditions.text_to_be_present_in_element( (By.ID, 'flash_message'), message ) ) expect(found).to_be(True) ################################################################## # This code works because of the following naming convention: # The id field for text input in the html is the element name # prefixed by 'pet_' so the Name field has an id='pet_name' # We can then lowercase the name and prefix with pet_ to get the id ################################################################## @then('I should see "{text_string}" in the "{element_name}" field') def step_impl(context, text_string, element_name): element_id = element_name.lower() found = WebDriverWait(context.driver, WAIT_SECONDS).until( expected_conditions.text_to_be_present_in_element_value( (By.ID, element_id), text_string ) ) expect(found).to_be(True) @when('I change "{element_name}" to "{text_string}"') def step_impl(context, element_name, text_string): element_id = element_name.lower() element = WebDriverWait(context.driver, WAIT_SECONDS).until( expected_conditions.presence_of_element_located((By.ID, element_id)) ) element.clear() element.send_keys(text_string)
StarcoderdataPython
9659743
<gh_stars>0 # Copyright (c) Microsoft. All rights reserved. # Licensed under the MIT license. See LICENSE.md file in the project root # for full license information. # ============================================================================== from __future__ import print_function import os import math import argparse import numpy as np import cntk import _cntk_py from cntk.utils import * from cntk.training_session import * from cntk.ops import * from cntk.distributed import * from cntk.io import ImageDeserializer, MinibatchSource, StreamDef, StreamDefs, FULL_DATA_SWEEP import cntk.io.transforms as xforms from cntk.layers import Placeholder, Convolution2D, Activation, MaxPooling, Dense, Dropout, default_options, Sequential from cntk.initializer import normal # default Paths relative to current python file. abs_path = os.path.dirname(os.path.abspath(__file__)) model_path = os.path.join(abs_path, "Models") log_dir = None # model dimensions image_height = 227 image_width = 227 num_channels = 3 # RGB num_classes = 1000 model_name = "AlexNet.model" # Create a minibatch source. def create_image_mb_source(map_file, is_training, total_number_of_samples): if not os.path.exists(map_file): raise RuntimeError("File '%s' does not exist." %map_file) # transformation pipeline for the features has jitter/crop only when training transforms = [] if is_training: transforms += [ xforms.crop(crop_type='randomside', side_ratio=0.88671875, jitter_type='uniratio') # train uses jitter ] else: transforms += [ xforms.crop(crop_type='center', side_ratio=0.88671875) # test has no jitter ] transforms += [ xforms.scale(width=image_width, height=image_height, channels=num_channels, interpolations='linear'), ] # deserializer return MinibatchSource( ImageDeserializer(map_file, StreamDefs( features = StreamDef(field='image', transforms=transforms), # first column in map file is referred to as 'image' labels = StreamDef(field='label', shape=num_classes))), # and second as 'label' randomize = is_training, epoch_size=total_number_of_samples, multithreaded_deserializer = True) # Local Response Normalization layer. See Section 3.3 of the paper: # https://papers.nips.cc/paper/4824-imagenet-classification-with-deep-convolutional-neural-networks.pdf # The mathematical equation is: # b_{x,y}^i=a_{x,y}^i/(k+\alpha\sum_{j=max(0,i-n)}^{min(N-1, i+n)}(a_{x,y}^j)^2)^\beta # where a_{x,y}^i is the activity of a neuron comoputed by applying kernel i at position (x,y) # N is the total number of kernals, n is half normalization width. def LocalResponseNormalization(k, n, alpha, beta, name=''): x = cntk.blocks.Placeholder(name='lrn_arg') x2 = cntk.ops.square(x) # reshape to insert a fake singleton reduction dimension after the 3th axis (channel axis). Note Python axis order and BrainScript are reversed. x2s = cntk.ops.reshape(x2, (1, cntk.InferredDimension), 0, 1) W = cntk.ops.constant(alpha/(2*n+1), (1,2*n+1,1,1), name='W') # 3D convolution with a filter that has a non 1-size only in the 3rd axis, and does not reduce since the reduction dimension is fake and 1 y = cntk.ops.convolution (W, x2s) # reshape back to remove the fake singleton reduction dimension b = cntk.ops.reshape(y, cntk.InferredDimension, 0, 2) den = cntk.ops.exp(beta * cntk.ops.log(k + b)) apply_x = cntk.ops.element_divide(x, den) return apply_x # Create the network. def create_alexnet(): # Input variables denoting the features and label data feature_var = input_variable((num_channels, image_height, image_width)) label_var = input_variable((num_classes)) # apply model to input # remove mean value input = minus(feature_var, constant(114), name='mean_removed_input') with default_options(activation=None, pad=True, bias=True): z = Sequential([ # we separate Convolution and ReLU to name the output for feature extraction (usually before ReLU) Convolution2D((11,11), 96, init=normal(0.01), pad=False, strides=(4,4), name='conv1'), Activation(activation=relu, name='relu1'), LocalResponseNormalization(1.0, 2, 0.0001, 0.75, name='norm1'), MaxPooling((3,3), (2,2), name='pool1'), Convolution2D((5,5), 192, init=normal(0.01), init_bias=0.1, name='conv2'), Activation(activation=relu, name='relu2'), LocalResponseNormalization(1.0, 2, 0.0001, 0.75, name='norm2'), MaxPooling((3,3), (2,2), name='pool2'), Convolution2D((3,3), 384, init=normal(0.01), name='conv3'), Activation(activation=relu, name='relu3'), Convolution2D((3,3), 384, init=normal(0.01), init_bias=0.1, name='conv4'), Activation(activation=relu, name='relu4'), Convolution2D((3,3), 256, init=normal(0.01), init_bias=0.1, name='conv5'), Activation(activation=relu, name='relu5'), MaxPooling((3,3), (2,2), name='pool5'), Dense(4096, init=normal(0.005), init_bias=0.1, name='fc6'), Activation(activation=relu, name='relu6'), Dropout(0.5, name='drop6'), Dense(4096, init=normal(0.005), init_bias=0.1, name='fc7'), Activation(activation=relu, name='relu7'), Dropout(0.5, name='drop7'), Dense(num_classes, init=normal(0.01), name='fc8') ])(input) # loss and metric ce = cross_entropy_with_softmax(z, label_var) pe = classification_error(z, label_var) pe5 = classification_error(z, label_var, topN=5) log_number_of_parameters(z) ; print() return { 'feature': feature_var, 'label': label_var, 'ce' : ce, 'pe' : pe, 'pe5': pe5, 'output': z } # Create trainer def create_trainer(network, epoch_size, num_quantization_bits, printer, block_size, warm_up): # Set learning parameters lr_per_mb = [0.01]*25 + [0.001]*25 + [0.0001]*25 + [0.00001]*25 + [0.000001] lr_schedule = cntk.learning_rate_schedule(lr_per_mb, unit=cntk.learner.UnitType.minibatch, epoch_size=epoch_size) mm_schedule = cntk.learner.momentum_schedule(0.9) l2_reg_weight = 0.0005 # CNTK L2 regularization is per sample, thus same as Caffe if block_size != None and num_quantization_bits != 32: raise RuntimeError("Block momentum cannot be used with quantization, please remove quantized_bits option.") # Create learner local_learner = cntk.learner.momentum_sgd(network['output'].parameters, lr_schedule, mm_schedule, unit_gain=False, l2_regularization_weight=l2_reg_weight) # Since we reuse parameter settings (learning rate, momentum) from Caffe, we set unit_gain to False to ensure consistency # Create trainer if block_size != None: parameter_learner = block_momentum_distributed_learner(local_learner, block_size=block_size) else: parameter_learner = data_parallel_distributed_learner(local_learner, num_quantization_bits=num_quantization_bits, distributed_after=warm_up) return cntk.Trainer(network['output'], (network['ce'], network['pe']), parameter_learner, printer) # Train and test def train_and_test(network, trainer, train_source, test_source, minibatch_size, epoch_size, restore): # define mapping from intput streams to network inputs input_map = { network['feature']: train_source.streams.features, network['label']: train_source.streams.labels } # Train all minibatches training_session( trainer=trainer, mb_source = train_source, var_to_stream = input_map, mb_size = minibatch_size, progress_frequency=epoch_size, checkpoint_config = CheckpointConfig(filename=os.path.join(model_path, model_name), restore=restore), cv_config= CrossValidationConfig(source=test_source, mb_size=minibatch_size) ).train() # Train and evaluate the network. def alexnet_train_and_eval(train_data, test_data, num_quantization_bits=32, block_size=3200, warm_up=0, minibatch_size=256, epoch_size = 1281167, max_epochs=112, restore=True, log_to_file=None, num_mbs_per_log=None, gen_heartbeat=True): _cntk_py.set_computation_network_trace_level(0) progress_printer = ProgressPrinter( freq=num_mbs_per_log, tag='Training', log_to_file=log_to_file, rank=Communicator.rank(), gen_heartbeat=gen_heartbeat, num_epochs=max_epochs) network = create_alexnet() trainer = create_trainer(network, epoch_size, num_quantization_bits, progress_printer, block_size, warm_up) train_source = create_image_mb_source(train_data, True, total_number_of_samples=max_epochs * epoch_size) test_source = create_image_mb_source(test_data, False, total_number_of_samples=FULL_DATA_SWEEP) train_and_test(network, trainer, train_source, test_source, minibatch_size, epoch_size, restore) if __name__=='__main__': parser = argparse.ArgumentParser() data_path = os.path.join(abs_path, "..", "..", "..", "DataSets", "ImageNet") parser.add_argument('-datadir', '--datadir', help='Data directory where the ImageNet dataset is located', required=False, default=data_path) parser.add_argument('-outputdir', '--outputdir', help='Output directory for checkpoints and models', required=False, default=None) parser.add_argument('-logdir', '--logdir', help='Log file', required=False, default=None) parser.add_argument('-n', '--num_epochs', help='Total number of epochs to train', type=int, required=False, default='112') parser.add_argument('-m', '--minibatch_size', help='Minibatch size', type=int, required=False, default='256') parser.add_argument('-e', '--epoch_size', help='Epoch size', type=int, required=False, default='1281167') parser.add_argument('-q', '--quantized_bits', help='Number of quantized bits used for gradient aggregation', type=int, required=False, default='32') parser.add_argument('-r', '--restart', help='Indicating whether to restart from scratch (instead of restart from checkpoint file by default)', action='store_true') parser.add_argument('-device', '--device', type=int, help="Force to run the script on a specified device", required=False, default=None) parser.add_argument('-b', '--block_samples', type=int, help="Number of samples per block for block momentum (BM) distributed learner (if 0 BM learner is not used)", required=False, default=None) parser.add_argument('-a', '--distributed_after', help='Number of samples to train with before running distributed', type=int, required=False, default='0') args = vars(parser.parse_args()) if args['outputdir'] is not None: model_path = args['outputdir'] + "/models" if args['logdir'] is not None: log_dir = args['logdir'] if args['device'] is not None: # Setting one worker on GPU and one worker on CPU. Otherwise memory consumption is too high for a single GPU. if Communicator.rank() == 0: cntk.device.set_default_device(cntk.device.gpu(args['device'])) else: cntk.device.set_default_device(cntk.device.cpu()) data_path = args['datadir'] if not os.path.isdir(data_path): raise RuntimeError("Directory %s does not exist" % data_path) train_data = os.path.join(data_path, 'train_map.txt') test_data = os.path.join(data_path, 'val_map.txt') try: alexnet_train_and_eval(train_data, test_data, max_epochs=args['num_epochs'], restore=not args['restart'], log_to_file=args['logdir'], num_mbs_per_log=200, num_quantization_bits=args['quantized_bits'], block_size=args['block_samples'], warm_up=args['distributed_after'], minibatch_size=args['minibatch_size'], epoch_size=args['epoch_size'], gen_heartbeat=True) finally: cntk.distributed.Communicator.finalize()
StarcoderdataPython
6533277
import pygame from pygame.locals import * from pygame import mixer import os import time import random import sys def resource_path(relative_path): try: # PyInstaller creates a temp folder and stores path in _MEIPASS base_path = sys._MEIPASS except Exception: base_path = os.path.abspath(".") return os.path.join(base_path, relative_path) pygame.font.init() WIDTH, HEIGHT = 500, 500 WINDOW = pygame.display.set_mode((WIDTH, HEIGHT)) pygame.display.set_caption("1D Shooter") # Loading the images simon_url = resource_path(os.path.join("assets", "simon_face.png")) SIMON_FACE = pygame.image.load(simon_url) #boosts images album_covers = [] album_files = ["uan.jpg", "tmh.png", "mm.png", "mitam.png", "four.png"] for album_file in album_files: album_url = resource_path(os.path.join("assets", album_file)) album_image = pygame.image.load(album_url) album_image = pygame.transform.scale(album_image, (50, 50)) album_covers.append(album_image) # PLAYER SHIP ONED_PLAYER_url = resource_path(os.path.join("assets", "1d_player.png")) ONED_PLAYER = pygame.image.load(ONED_PLAYER_url) # LASERS # ONED_LASER = pygame.image.load(os.path.join("assets", "1d_logo.png")) ONED_LASER_url = resource_path(os.path.join("assets", "1d_logo.png")) ONED_LASER = pygame.image.load(ONED_LASER_url) ONED_LASER_NEW = pygame.transform.scale(ONED_LASER, (50, 40)) CROSS_LASER_url = resource_path(os.path.join("assets", "cross.png")) CROSS_LASER = pygame.image.load(CROSS_LASER_url) # background # BG = pygame.transform.scale(pygame.image.load(os.path.join("assets", "background_main.jpg")), (WIDTH, HEIGHT)) BG_url = resource_path(os.path.join("assets", "background_main.jpg")) BG = pygame.transform.scale(pygame.image.load(BG_url), (WIDTH, HEIGHT)) # HELP = pygame.image.load(os.path.join("assets", "help_icon.png")) HELP_url = resource_path(os.path.join("assets", "help_icon.png")) HELP = pygame.image.load(HELP_url).convert_alpha() HELP_NEW = pygame.transform.scale(HELP, (30, 30)) mixer.init() start_sound = pygame.mixer.Sound(os.path.join("assets", "1d_start.mp3")) game_sound = pygame.mixer.Sound(os.path.join("assets", "1d_music.ogg")) buzzer_sound = pygame.mixer.Sound(os.path.join("assets", "buzzer.mp3")) start_channel = pygame.mixer.Channel(0) run_channel = pygame.mixer.Channel(1) buzzer_channel = pygame.mixer.Channel(2) class Button: def __init__(self, x, y, img, WIN): self.img = img self.rect = self.img.get_rect() self.rect.topleft = (x, y) self.clicked = False self.WIN = WIN def hover(self): is_hovering = False pos = pygame.mouse.get_pos() if self.rect.collidepoint(pos): is_hovering = True return is_hovering def draw(self): action = False pos = pygame.mouse.get_pos() if self.hover(): if pygame.mouse.get_pressed()[0] == 1 and self.clicked == False: self.clicked = True action = True if pygame.mouse.get_pressed()[0] == 0: self.clicked = False self.WIN.blit(self.img, (self.rect.x, self.rect.y)) return action class Laser: def __init__(self, x, y, img): self.x = x self.y = y self.img = img self.mask = pygame.mask.from_surface(self.img) def draw(self, window): window.blit(self.img, (self.x, self.y)) def move(self, vel): self.y += vel def off_screen(self, height): return not(self.y <= height and self.y >= 0) def collision(self, obj): return collide(self, obj) class Ship: COOLDOWN = 30 def __init__(self, x, y, health=100): self.x = x self.y = y self.health = health self.ship_img = None # draw ship self.laser_img = None # draw lasers self.lasers = [] self.cool_down_counter = 0 # how long to wait till you shoot again def draw(self, window): window.blit(self.ship_img, (self.x, self.y)) for laser in self.lasers: laser.draw(window) def move_lasers(self, vel, obj): self.cooldown() did_a_hit = False for laser in self.lasers: laser.move(vel) if laser.off_screen(HEIGHT): self.lasers.remove(laser) elif laser.collision(obj): did_a_hit = True obj.health -= 10 self.lasers.remove(laser) return did_a_hit def cooldown(self): if self.cool_down_counter >= self.COOLDOWN: self.cool_down_counter = 0 elif self.cool_down_counter > 0: self.cool_down_counter += 1 def shoot(self): if self.cool_down_counter == 0: laser = Laser(self.x, self.y, self.laser_img) self.lasers.append(laser) self.cool_down_counter = 1 def get_width(self): return self.ship_img.get_width() def get_height(self): return self.ship_img.get_height() class Player(Ship): def __init__(self, x, y, health=50): super().__init__(x, y, health) self.ship_img = ONED_PLAYER self.laser_img = ONED_LASER_NEW self.mask = pygame.mask.from_surface(self.ship_img) self.max_health = health self.score = 0 def move_lasers(self, vel, objs): self.cooldown() for laser in self.lasers: laser.move(vel) if laser.off_screen(HEIGHT): self.lasers.remove(laser) else: for obj in objs: if laser.collision(obj): self.score += 1 objs.remove(obj) if laser in self.lasers: self.lasers.remove(laser) def draw(self, window): super().draw(window) self.healthbar(window) def healthbar(self, window): pygame.draw.rect(window, (255, 0, 0), (self.x, self.y + self.ship_img.get_height() + 10, self.ship_img.get_width(), 10)) pygame.draw.rect(window, (0, 255, 0), (self.x, self.y + self.ship_img.get_height() + 10, self.ship_img.get_width() * (1-((self.max_health-self.health)/self.max_health)), 10)) class Enemy(Ship): def __init__(self, x, y, health=100): super().__init__(x, y, health) self.ship_img = SIMON_FACE self.laser_img = CROSS_LASER self.mask = pygame.mask.from_surface(self.ship_img) self.attack = 10 def move(self, vel): self.y += vel def shoot(self): if self.cool_down_counter == 0: laser = Laser(self.x + 10, self.y, self.laser_img) self.lasers.append(laser) self.cool_down_counter = 1 class Boost(Ship): def __init__(self, x, y): super().__init__(x, y) self.ship_img = random.choice(album_covers) self.mask = pygame.mask.from_surface(self.ship_img) self.attack = 10 def move(self, vel): self.y += vel def collide(obj1, obj2): offset_x = obj2.x - obj1.x offset_y = obj2.y - obj1.y return obj1.mask.overlap(obj2.mask, (offset_x, offset_y)) != None class Game: def __init__(self, WIN): self.pause = False self.helping = False self.score = 0 self.run = False self.FPS = 60 # frames per second self.level = 0 self.main_font = pygame.font.SysFont("arial", 30) self.click = pygame.mouse.get_pressed() self.WIN = WIN self.enemies = [] self.boosts = [] self.wave_length = 5 self.enemy_vel = 1 self.enemy_vel = 2 self.player_vel = 5 self.laser_vel = 5 self.player = Player(WIDTH/2 - ONED_PLAYER.get_width()/2, 300) self.clock = pygame.time.Clock() self.lost = False self.lost_count = 0 def redraw_window(self): self.mouse_pointer() self.WIN.blit(BG, (0, 0)) # redraws image # draw text score_label = self.main_font.render( f"Score: {self.player.score}", 1, (255, 255, 255)) level_label = self.main_font.render( f"Level: {self.level}", 1, (255, 255, 255)) self.WIN.blit(score_label, (10, 10)) self.WIN.blit(level_label, (WIDTH - level_label.get_width() - 10, 10)) for enemy in self.enemies: enemy.draw(self.WIN) for boost in self.boosts: boost.draw(self.WIN) self.player.draw(self.WIN) if self.lost: self.run = False self.score = self.player.score self.lost_page() self.display_mouse() pygame.display.update() def game_loop(self): # when the program is running start_channel.stop() run_channel.play(game_sound, loops=-1, fade_ms=1000) self.lost = False self.level = 0 self.enemies = [] self.wave_length = 5 self.enemy_vel = 1 self.boost_vel = 3 self.player_vel = 7 self.laser_vel = 4 self.player = Player(WIDTH/2 - ONED_PLAYER.get_width()/2, 300) while self.run: self.clock.tick(self.FPS) self.redraw_window() if self.player.health <= 0: self.lost = True self.lost_count += 1 if len(self.enemies) == 0: self.level += 1 self.wave_length += 5 for i in range(self.wave_length): enemy = Enemy(random.randrange(50, WIDTH - 100), random.randrange(-1500, -100)) self.enemies.append(enemy) if random.random() < 0.00167: boost = Boost(random.randrange(50, WIDTH - 50), random.randrange(-1500, -100)) self.boosts.append(boost) for event in pygame.event.get(): if event.type == pygame.QUIT: # if press X button quit() self.controls() got_hit = False for enemy in self.enemies: enemy.move(self.enemy_vel) if enemy.move_lasers(self.laser_vel, self.player): got_hit = True if random.randrange(0, 2*60) == 1: enemy.shoot() if collide(enemy, self.player): self.player.health -= enemy.attack self.enemies.remove(enemy) elif enemy.y + enemy.get_height() > HEIGHT: self.score -= 1 self.enemies.remove(enemy) if got_hit: buzzer_channel.play(buzzer_sound) for boost in self.boosts: boost.move(self.boost_vel) if collide(boost, self.player): self.player.health = min(self.player.health + boost.attack, self.player.max_health) self.boosts.remove(boost) elif boost.y + boost.get_height() > HEIGHT: self.boosts.remove(boost) self.player.move_lasers(-self.laser_vel, self.enemies) def controls(self): keys = pygame.key.get_pressed() if keys[pygame.K_LEFT] and self.player.x - self.player_vel > 0: # left self.player.x -= self.player_vel if keys[pygame.K_RIGHT] and self.player.x + self.player_vel + self.player.get_width() < WIDTH: self.player.x += self.player_vel if keys[pygame.K_UP] and self.player.y - self.player_vel > 0: self.player.y -= self.player_vel if keys[pygame.K_DOWN] and self.player.y + self.player_vel + self.player.get_height() + 15 < HEIGHT: self.player.y += self.player_vel if keys[pygame.K_SPACE]: self.player.shoot() if keys[pygame.K_ESCAPE]: self.paused() def unpaused(self): self.pause = False run_channel.unpause() buzzer_channel.unpause() def paused(self): self.pause = True run_channel.pause() buzzer_channel.pause() self.PAUSE_font = pygame.font.SysFont("arial", 30) mouse = pygame.mouse.get_pos() while self.pause: self.WIN.blit(BG, (0, 0)) self.PAUSE_label = self.PAUSE_font.render( "Game is Paused. Click to Continue", 1, (255, 255, 255)) self.WIN.blit(self.PAUSE_label, (WIDTH/2 - self.PAUSE_label.get_width()/2, 200)) self.mouse_pointer() button_y = HEIGHT/2 + 100 self.button("MAIN MENU", WIDTH/2 - 150, button_y, 100, 50, (255, 0, 0), (200, 0, 0), "new_game", True) self.button("RESUME", WIDTH/2, button_y, 100, 50, (255, 0, 0), (200, 0, 0), "resume", True) self.button("QUIT", WIDTH/2 + 150, button_y, 100, 50, (255, 0, 0), (200, 0, 0), "quit", True) self.display_mouse() pygame.display.update() for event in pygame.event.get(): if event.type == pygame.QUIT: pygame.quit() def mouse_pointer(self): self.cursor = pygame.cursors.Cursor(pygame.SYSTEM_CURSOR_ARROW) def mouse_hand(self): self.cursor = pygame.cursors.Cursor(pygame.SYSTEM_CURSOR_HAND) def display_mouse(self): pygame.mouse.set_cursor(*self.cursor) def button(self, msg: str, x: int, y: int, w: int, h: int, ic, ac, action=None, centered=False): """ Add a button """ mouse = pygame.mouse.get_pos() click = pygame.mouse.get_pressed() button_font = pygame.font.SysFont("arial", 20) button_label = button_font.render(msg, 1, (255, 255, 255)) text_w = button_label.get_width() text_h = button_label.get_height() center_x = x + w/2 center_y = x + h/2 w = max(w, text_w) h = max(h, text_h) if centered: x = x - w/2 y = y - h/2 mouse_is_released = (click[0] == 1) # mouse_is_released = pygame.MOUSEBUTTONUP in [event.type for event in pygame.event.get()] if x+w > mouse[0] > x and y+h > mouse[1] > y: pygame.draw.rect(self.WIN, ac, (x, y, w, h)) self.mouse_hand() if mouse_is_released and action != None: if action == "start": start_channel.pause() self.game_loop() if action == "resume": self.unpaused() if action == "quit": quit() if action == "help": self.help_menu() if action == "main": self.main_menu() if action == "new_game": self.new_game() else: pygame.draw.rect(self.WIN, ic, (x, y, w, h)) self.WIN.blit(button_label, (x + (w - text_w)/2, y + (h - text_h)/2)) def help_menu(self): helping = True self.help_font = pygame.font.SysFont("arial", 30) mouse = pygame.mouse.get_pos() while helping: self.WIN.blit(BG, (0, 0)) help_label = self.help_font.render( "Kill <NAME>!! Use your arrow keys", 1, (255, 255, 255)) help_label2 = self.help_font.render( "to move 1D and shoot with SpaceBar", 1, (255, 255, 255)) self.WIN.blit( help_label, (WIDTH/2 - help_label.get_width()/2, 100)) self.WIN.blit( help_label2, (WIDTH/2 - help_label2.get_width()/2, 150)) self.mouse_pointer() self.button("BACK TO MAIN MENU", WIDTH/2, HEIGHT/2 + 25, 100, 50, (255, 0, 0), (200, 0, 0), "main", True) self.button("QUIT", WIDTH/2, HEIGHT/2 + 100, 100, 50, (255, 0, 0), (200, 0, 0), "quit", True) self.display_mouse() pygame.display.update() for event in pygame.event.get(): if event.type == pygame.QUIT: pygame.quit() pygame.quit() def lost_page(self): self.run = True run_channel.stop() buzzer_channel.stop() self.WIN.blit(BG, (0, 0)) self.lost_font = pygame.font.SysFont("arial", 30) self.lost_label = self.lost_font.render( "Game Over!! Your score was: " + str(self.score), 1, (255, 255, 255)) self.WIN.blit(self.lost_label, (WIDTH/2 - self.lost_label.get_width()/2, 100)) self.mouse_pointer() button_y = HEIGHT/2 self.button("MAIN MENU", WIDTH/2 - 150, button_y, 100, 50, (255, 0, 0), (200, 0, 0), "new_game", True) self.button("RESTART", WIDTH/2, button_y, 100, 50, (255, 0, 0), (200, 0, 0), "start", True) self.button("QUIT", WIDTH/2 + 150, button_y, 100, 50, (255, 0, 0), (200, 0, 0), "quit", True) self.display_mouse() def new_game(self): start_channel.stop() run_channel.stop() buzzer_channel.stop() start_channel.play(start_sound, loops=-1, fade_ms=5000) self.main_menu() def main_menu(self): self.title_font = pygame.font.SysFont("arial", 30) self.run = True while self.run: self.WIN.blit(BG, (0, 0)) self.WIN.blit(HELP_NEW, (0, 0)) self.title_label = self.title_font.render( "Press the button to begin...", 1, (255, 255, 255)) self.WIN.blit(self.title_label, (WIDTH/2 - self.title_label.get_width()/2, 200)) self.mouse_pointer() self.button("START", WIDTH/2, HEIGHT/2 + 100, 100, 50, (255, 0, 0), (200, 0, 0), "start", True) help_button = Button(0, 0, HELP_NEW, self.WIN) if help_button.hover(): self.mouse_hand() self.display_mouse() if help_button.draw(): self.help_menu() pygame.display.update() for event in pygame.event.get(): if event.type == pygame.QUIT: self.run = False pygame.quit() if __name__ == "__main__": mixer.init() start_channel.play(start_sound, loops=-1, fade_ms=5000) game = Game(WINDOW) game.main_menu()
StarcoderdataPython
4841447
<gh_stars>1-10 import tensorflow as tf from tensorflow import keras from tensorflow.keras import Sequential import tensorflow.keras.layers as layers from tensorflow.keras.regularizers import L2 from tensorflow.keras.applications import VGG16 from .custom_layers import L2Normalization from models import registry WEIGHTS_PATH_NO_TOP = ('https://github.com/fchollet/deep-learning-models/' 'releases/download/v0.1/' 'vgg16_weights_tf_dim_ordering_tf_kernels_notop.h5') def vgg16(pretrained=True): inputs = layers.Input(shape=[None, None, 3]) block1_conv1 = layers.Conv2D(64, 3, padding='same', activation='relu', name='block1_conv1')(inputs) block1_conv2 = layers.Conv2D(64, 3, padding='same', activation='relu', name='block1_conv2')(block1_conv1) block1_pool = layers.MaxPool2D(2, 2, padding='same', name='block1_pool')(block1_conv2) block2_conv1 = layers.Conv2D(128, 3, padding='same', activation='relu', name='block2_conv1')(block1_pool) block2_conv2 = layers.Conv2D(128, 3, padding='same', activation='relu', name='block2_conv2')(block2_conv1) block2_pool = layers.MaxPool2D(2, 2, padding='same', name='block2_pool')(block2_conv2) block3_conv1 = layers.Conv2D(256, 3, padding='same', activation='relu', name='block3_conv1')(block2_pool) block3_conv2 = layers.Conv2D(256, 3, padding='same', activation='relu', name='block3_conv2')(block3_conv1) block3_conv3 = layers.Conv2D(256, 3, padding='same', activation='relu', name='block3_conv3')(block3_conv2) block3_pool = layers.MaxPool2D(2, 2, padding='same', name='block3_pool')(block3_conv3) block4_conv1 = layers.Conv2D(512, 3, padding='same', activation='relu', name='block4_conv1')(block3_pool) block4_conv2 = layers.Conv2D(512, 3, padding='same', activation='relu', name='block4_conv2')(block4_conv1) block4_conv3 = layers.Conv2D(512, 3, padding='same', activation='relu', name='block4_conv3')(block4_conv2) block4_pool = layers.MaxPool2D(2, 2, padding='same', name='block4_pool')(block4_conv3) block5_conv1 = layers.Conv2D(512, 3, padding='same', activation='relu', name='block5_conv1')(block4_pool) block5_conv2 = layers.Conv2D(512, 3, padding='same', activation='relu', name='block5_conv2')(block5_conv1) block5_conv3 = layers.Conv2D(512, 3, padding='same', activation='relu', name='block5_conv3')(block5_conv2) vgg16 = tf.keras.models.Model(inputs = inputs, outputs=[block4_conv3, block5_conv3]) if pretrained: print("Using pretrained weights of VGG16!!!") pretrained_weight = tf.keras.utils.get_file('vgg16', WEIGHTS_PATH_NO_TOP) vgg16.load_weights(pretrained_weight, by_name=True) return vgg16 def VGG16(vgg16): block4_conv3, block5_conv3 = vgg16.outputs block4_conv3 = L2Normalization(gamma_init=20)(block4_conv3) pool5 = layers.MaxPool2D(3, 1, padding='same')(block5_conv3) conv6 = layers.Conv2D(1024, 3, padding='same', dilation_rate=6, activation='relu')(pool5) conv7 = layers.Conv2D(1024, 1, padding='same', activation='relu')(conv6) model = tf.keras.models.Model(inputs=vgg16.inputs, outputs=[block4_conv3, conv7]) return model def create_extra_layers(VGG16): out_38x38, out_19x19 = VGG16.outputs conv8_1 = layers.Conv2D(256, 1, activation='relu', padding='same')(out_19x19) conv8_pad = layers.ZeroPadding2D(padding=((1, 1), (1, 1)))(conv8_1) conv8_2 = layers.Conv2D(512, 3, strides=2, padding='valid', activation='relu')(conv8_pad) conv9_1 = layers.Conv2D(128, 1, activation='relu', padding='same')(conv8_2) conv9_pad = layers.ZeroPadding2D(padding=((1, 1), (1, 1)))(conv9_1) conv9_2 = layers.Conv2D(256, 3, strides=2, padding='valid', activation='relu')(conv9_pad) conv10_1 = layers.Conv2D(128, 1, activation='relu', padding='same')(conv9_2) conv10_2 = layers.Conv2D(256, 3, activation='relu', padding='valid')(conv10_1) conv11_1 = layers.Conv2D(128, 1, activation='relu', padding='same')(conv10_2) conv11_2 = layers.Conv2D(256, 3, activation='relu', padding='valid')(conv11_1) model = tf.keras.models.Model(inputs= VGG16.inputs, outputs=[out_38x38, out_19x19, conv8_2, conv9_2, conv10_2, conv11_2]) return model class VGG(tf.keras.layers.Layer): def __init__(self, cfg=None, pretrained=True): super(VGG, self).__init__() vgg = vgg16(pretrained) fcs = VGG16(vgg) self.model = create_extra_layers(fcs) def call(self, x): outputs = self.model(x) return outputs @registry.BACKBONES.register('vgg') def vgg(cfg, pretrained=True): model = VGG(cfg, pretrained) return model if __name__ == '__main__': import numpy as np vgg = VGG(pretrained=True) rand_inp = tf.random.normal([4, 300, 300, 3]) outpus = vgg(rand_inp) for out in outpus: print(out.shape)
StarcoderdataPython