id
stringlengths
1
265
text
stringlengths
6
5.19M
dataset_id
stringclasses
7 values
177970
# implementing RNN and LSTM # %% import pandas as pd import numpy as np import nltk import sklearn import matplotlib.pyplot as plt import re import tqdm twitter_df = pd.read_csv('twitter_train.csv') twitter_df = twitter_df.fillna('0') twitter_df_test = pd.read_csv('twitter_test.csv') twitter_df_test = twitter_df_test.fillna('0') twitter_df = twitter_df.drop('location', axis = 1) import json """with open('contractions.json', "w") as f: json.dump(contractions, f)""" with open('abbrevations.json') as f: abbrevation = json.load(f) # importing required libraries for RNN import tensorflow as tf; from tensorflow.keras.preprocessing.text import Tokenizer from tensorflow.keras.preprocessing.sequence import pad_sequences from nltk.corpus import stopwords from nltk.stem import WordNetLemmatizer from nltk.stem import PorterStemmer # nltk.download('wordnet') print("Tensorflow version", tf.__version__) # preprocessing include lemmatizing, stemming, stopwords removal # tokenizing, pad_sequences # %% lemmatizer = WordNetLemmatizer() stop_words = stopwords.words('english') stemmer = PorterStemmer() from nltk import TweetTokenizer wt = TweetTokenizer() # Cleaning means to extract the useful information from the text data and removing those # data that does not contribute to the LSTM and RNN learnings. # The clean_text function lower cases the input text, removes the tags and mentions # expands the contractions, can deal with emojis, non alphabets. # It also removes the stop words and Lemmatizes the word to its root word. def text_clean(text, abbrevations=abbrevation, stemmer=False): # lower casing text = text.lower() for word in text.split(): # use the abbrevations dictionary to replace if word in abbrevations.keys(): text = text.replace(word, abbrevations[word]) # removing URL, tags, non-alphabets, new-lines text = re.sub(r'(https?://\S+|www\.\S+)', '', text) # removing http links text = re.sub(r'@([a-zA-Z0-9:_]+)\s', '', text) # removing the hash tags and mentions text = re.sub('[^\w\s]', ' ', text) # remove anything except words and spaces. text = re.sub('\d', ' ', text) # removing digits # text = re.sub('\b[a-z]{1,2}\b', ' ', text) # all words with 3 or less characters text = re.sub('\n', ' ', text) # new line phrase # Lemmatising and removing Stop_words extended_stop_words_re = stop_words + ['&amp;','rt','th','co', 're','ve','kim','daca','p.m.','retweet', 'ir'] if not stemmer: text = ' '.join([lemmatizer.lemmatize(word) for word in text.split() if (not word in extended_stop_words_re)]) else: text = ' '.join([stemmer.stem(word) for word in text.split() if (not word in extended_stop_words_re)]) emoji_pattern = re.compile("[" u"\U0001F600-\U0001F64F" # emoticons u"\U0001F300-\U0001F5FF" # symbols & pictographs u"\U0001F680-\U0001F6FF" # transport & map symbols u"\U0001F1E0-\U0001F1FF" # flags (iOS) u"\U00002702-\U000027B0" u"\U000024C2-\U0001F251" "]+", flags=re.UNICODE) text = emoji_pattern.sub(r'', text) return text # further cleaning is needed. # tekenization of the cleaned text. cleaned1 = lambda text: text_clean(text) cleaned2 = lambda text: re.sub('\s[a-z]{,3}\s', ' ', text) cleaned3 = lambda row: wt.tokenize(row) # tokenizing the row # escented characters # expanding contractions with the words in the contractions dictionary # stemming, lemmatizing # negated words can be used to get the sentiment # extra spaces shouls also be removed # %% # Cleaning the input text with help of utility functions twitter_df['cleaned_text'] = twitter_df['text'].apply(cleaned1) twitter_df['cleaned_text_'] = twitter_df['cleaned_text'].apply(cleaned2) twitter_df['tokenized_text'] = twitter_df['cleaned_text_'].apply(cleaned3) twitter_df_test['cleaned_text'] = twitter_df_test['text'].apply(cleaned1) twitter_df_test['cleaned_text_'] = twitter_df_test['cleaned_text'].apply(cleaned2) twitter_df_test['tokenized_text'] = twitter_df_test['cleaned_text_'].apply(cleaned3) # twitter_df[['id','text','cleaned_text','target']].iloc[50:110] length = [] length = twitter_df.cleaned_text.apply(lambda x: len(x.split())) np.max(length) train_text = twitter_df.cleaned_text train_label = twitter_df.target test_text = twitter_df_test.cleaned_text oov_tok = '<oov>' padding_type = 'post' trun_type = 'post' max_length = 25 # %% tokenizer = Tokenizer(num_words = 10000, oov_token = oov_tok) tokenizer.fit_on_texts(train_text) word_index = tokenizer.word_index train_sequences = tokenizer.texts_to_sequences(train_text) print("train sequences sample", train_sequences[10]) test_sequences = tokenizer.texts_to_sequences(test_text) print("test sequences sample", test_sequences[1]) train_padded = pad_sequences(train_sequences, maxlen=max_length, padding=padding_type, truncating=trun_type) test_padded = pad_sequences(test_sequences, maxlen=max_length, padding=padding_type, truncating=trun_type) vocab_size = len(word_index) + 1 # label_tokenizer = Tokenizer() # %% from gensim.models.word2vec import Word2Vec embedding_index = {} # for text in twitter_df: # embedding = model.infer_vector(text) # %% # utility function to return the string of a list of numbers. # this will be the input to the tokenizer methods def return_str(text): return text.apply(lambda x: str(x)) label_tokenizer.fit_on_texts(return_str(twitter_df.target)) train_label_seq = np.array(label_tokenizer.texts_to_sequences(return_str(train_label))) print(train_label_seq.shape) train_label_seq = train_label.values.reshape(-1,1) # trying to explore the original tweet and tweet after padding reverse_word_index = dict([(index, word) for word, index in word_index.items()]) def decode_article(text): return ' '.join([reverse_word_index.get(i, '?') for i in text]) print(decode_article(train_padded[10])) print('-----------------') print(train_text.iloc[10]) # %% from gensim.models.word2vec import Word2Vec vector_size = 100 wv = Word2Vec(sentences=twitter_df.tokenized_text,size = vector_size, iter = 50) from collections import Counter embedding_matrix = np.zeros((vocab_size, vector_size)) # word_index.pop("''") for word, index in word_index.items(): try: embedding_vector = wv[word] if embedding_vector is not None: embedding_matrix[index] = embedding_vector except: pass # %% embedding_dim = 100 # building the Model Architecture from tensorflow.keras import layers # importing Dense, Bidirectional, LSTM, Dropout, Embedding from tensorflow.keras.callbacks import EarlyStopping from tensorflow.keras.optimizers import Adam, SGD, Nadam # Word Embeddings are the inputs to the neural networks. def create_embeddings(vocab_size, embedding_dim,): return layers.Embedding(vocab_size, embedding_dim, embeddings_initializer='GlorotNormal', weights = [embedding_matrix]) # Utility function to get fully connected dense Layers def create_dense(in_dim = embedding_dim, activ_in = 'relu'): return layers.Dense(in_dim, activation = activ_in, use_bias = True) # Create LSTM layers def get_LSTM(embedding_dim, Bi_directional = True, dropout=0.2): if Bi_directional: layer = layers.Bidirectional(layers.LSTM(embedding_dim, recurrent_dropout = 0.3, dropout=dropout)) else: layer = LSTM(embedding_dim, recurrent_dropout = 0.3, dropout=dropout) return layer # Dropout can be represented as one of the core layers. # They handle overfitting of the neural networks by allowing all the nodes to learn the weights # Lot of fine tuning can be done to the Dropout layer. def drop_out(dropout_rate = 0.2): dp = layers.Dropout(dropout_rate) return dp def get_seq_model(in_dim = embedding_dim, out_class=2, optimizers_ = 'sgd', learning_rate = 0.000083, activ_out = 'softmax'): # frees up GPU memory everytime the code is run fresh tf.keras.backend.clear_session() model = tf.keras.Sequential([ # adding embedding layer, expecting input vocab size of 5000 create_embeddings(vocab_size, embedding_dim), # adding Dropout layer drop_out(0.3), # Bi-Directional LSTM get_LSTM(embedding_dim, dropout = 0.3), # Fully connected dense layers create_dense(embedding_dim), # adding Dropout layer drop_out(0.3), # Fully connected dense layers create_dense(embedding_dim), # adding Dropout layer drop_out(0.3), # the final output layer layers.Dense(out_class, activation = 'softmax', use_bias = True) ]) # Model fitting and defining callbacks if optimizers_.lower() == "adam": opt = Adam(lr=learning_rate) elif optimizers_.lower() == "sgd": opt = SGD(lr=learning_rate) else: opt = Nadam(lr=learning_rate) model.compile(loss='sparse_categorical_crossentropy', optimizer=opt, metrics=['accuracy']) return model # %% # creating the model num_epochs=30 model = get_seq_model(learning_rate=0.01) # printing model summary to console print(model.summary()) # callbacks stop the traiing after predefined patience early_stopping = EarlyStopping(monitor='val_accuracy', patience=2) # training the model result = model.fit(train_padded, train_label_seq, epochs=num_epochs, # callbacks = [early_stopping], verbose=2, validation_split=0.2 ) def plot_graphs(history, string, save = False): plt.plot(result.history[string]) plt.plot(result.history['val_'+string]) plt.xlabel("Epochs") plt.ylabel(string) plt.legend([string, 'val_'+string]) title = "Bi-LSTM " + string if save: plt.savefig(title) plt.show() plot_graphs(result, "accuracy") plot_graphs(result, "loss") # %% import csv id_1 = twitter_df_test.id def save_pred(model, id_ = id_1, name_ = "name_1.csv", vectors_ = test_padded): predict = model.predict_classes(vectors_) # checking if the predictions are correct format vector assert len(predict) == 3263 # the file is saved in the current folder with open(name_, 'w', newline='\n') as f: writer = csv.writer(f) writer.writerow(['id', 'target']) for id_, target in zip(id_, predict): writer.writerow([id_, target]) save_pred(model, id_=id_1,name_='rnn_bilstm_1.csv') # %%
StarcoderdataPython
1742575
<reponame>skimbrel/strowger<gh_stars>1-10 import re from mock import Mock, patch from nose.tools import assert_equal from nose.tools import assert_is_instance from unittest import TestCase from flask import request from twilio import twiml from strowger import switch TEST_TWILIO_REQUEST_DATA = { 'From': '+14155551234', 'To': '+14158675309', 'NumMedia': '0', 'MessageSid': 'MM{}'.format('a' * 34), 'AccountSid': 'AC{}'.format('a' * 34), } class SwitchTestCase(TestCase): def setUp(self): self.flask_patcher = patch('strowger.switch.Flask') self.m_flask = self.flask_patcher.start() self.map_patcher = patch('strowger.switch.Map') self.m_map_class = self.map_patcher.start() def tearDown(self): self.map_patcher.stop() self.flask_patcher.stop() def test_init(self): m_flask_app = Mock() self.m_flask.return_value = m_flask_app m_map = Mock() self.m_map_class.return_value = m_map s = switch.Switch(__name__) assert_equal(s.app, m_flask_app) m_flask_app.route.assert_called_with('/', methods=['GET', 'POST']) assert_equal(s.mapping, m_map) m_handler = Mock() s = switch.Switch(__name__, default_handler=m_handler) self.m_map_class.assert_called_with(default_handler=m_handler) class SwitchWithFlaskAppTestCase(TestCase): def setUp(self): self.s = switch.Switch(__name__) self.s.app.testing = True self.app = self.s.app.test_client() def test_basic_handler(self): @self.s.connect('foobar') def _verify_handler(request, response): assert_equal(request.from_number, '+14155551234') assert_equal(request.to_number, '+14158675309') assert_equal(request.message_body, 'foobarbaz') assert_equal(request.media_count, 0) assert_is_instance(response, twiml.Response) response.message(msg='quux') return response request_data = TEST_TWILIO_REQUEST_DATA.copy() request_data['Body'] = 'foobarbaz' response = self.app.post('/', data=request_data) assert_equal(response.status_code, 200) twiml_response = twiml.Response() twiml_response.message(msg='quux') assert_equal(response.get_data(), unicode(twiml_response)) def test_match_with_groups(self): @self.s.connect('(?P<first>\w+) (?P<second>\w+)') def _verify_handler(request, response, first, second): assert_equal(first, 'foo') assert_equal(second, 'bar') assert_equal(request.message_body, 'foo bar') return response request_data = TEST_TWILIO_REQUEST_DATA.copy() request_data['Body'] = 'foo bar' response = self.app.post('/', data=request_data) assert_equal(response.status_code, 200) twiml_response = twiml.Response() assert_equal(response.get_data(), unicode(twiml_response)) def test_twilio_message_request(self): request_data = TEST_TWILIO_REQUEST_DATA.copy() request_data.update( Body='foo bar', NumMedia=2, MediaContentType0='image/jpeg', MediaUrl0='http://example.com/image0', MediaContentType1='image/png', MediaUrl1='http://example.com/image1', FromCity='San Francisco', FromState='CA', ) with self.s.app.test_request_context('/', query_string=request_data): twilio_request = switch.TwilioMessageRequest(request) assert_equal(twilio_request.message_body, 'foo bar') assert_equal(twilio_request.from_number, '+14155551234') assert_equal(twilio_request.to_number, '+14158675309') assert_equal(twilio_request.message_sid, 'MM{}'.format('a' * 34)) assert_equal(twilio_request.account_sid, 'AC{}'.format('a' * 34)) assert_equal(twilio_request.media_count, 2) media_items = twilio_request.media_items assert_equal( media_items[0], switch.MediaItem('image/jpeg', 'http://example.com/image0'), ) assert_equal( media_items[1], switch.MediaItem('image/png', 'http://example.com/image1'), ) assert_equal(twilio_request.flask_request, request) assert_equal(twilio_request.raw_values, request.values)
StarcoderdataPython
86096
import pip_setup pip_setup.install("moviepy") pip_setup.install("pygame") import Menu import pygame from moviepy.editor import * import random from Settings import * from Sprites import * from Menu import * import time import numpy as np class GAME : def __init__(self): #GAME ~initialisation~ self.file = "highscore.txt" pygame.init() self.screen = pygame.display.set_mode((WIDTH,HEIGHT)) self.background = pygame.image.load("background.png").convert() pygame.display.set_caption(TITLE) self.clock = pygame.time.Clock() self.running = True self.game_music = pygame.mixer.Sound('bip_bip_bap_1.wav') self.menu_music = pygame.mixer.Sound('bip_bip_bop_V4.wav') self.gameover_music = pygame.mixer.Sound('bip_bip_bup.wav') self.menu_music.set_volume(0.5) self.game_music.set_volume(0.5) self.gameover_music.set_volume(0.5) def new_game(self): #GAME ~new_game~ self.wave = 1 self.shoot = False self.lastHitTimer = 0 self.lastHitTimer_e = 0 self.lastHitennemyTimer = 0 self.lastShootTimer = 0 self.last_boss_attack = 0 self.anim_jar = 0 self.last_jar_attack = 0 self.anim_player_attack = 0 self.anim_ennemi_attack = 0 self.boss_attack = False self.all_sprites = pygame.sprite.Group() self.platforms = pygame.sprite.Group() self.ennemis = pygame.sprite.Group() self.weapons = pygame.sprite.Group() self.skulls = pygame.sprite.Group() self.jars = pygame.sprite.Group() self.fires = pygame.sprite.Group() self.player = PLAYER(self) self.ennemy_list = [] self.all_sprites.add(self.player) self.ennemy_speed = 2 self.ennemy_range = 400 self.ennemy_attack = 30 self.life_multiplyer = 0.4 self.x_jar = round(PLATFORMS_LIST[0][0]) + 30 for nbr in range(3): self.jar = JAR(self.platforms,(self.x_jar+(50*nbr))) self.jars.add(self.jar) self.all_sprites.add(self.jar) for nbr in range(3): self.dynamic_difficulty() ennemi = ENNEMI(random.randrange(self.ennemy_speed-1,self.ennemy_speed+1), self.ennemy_range, self.ennemy_attack, self.platforms, 0.5 , 1) self.ennemis.add(ennemi) self.all_sprites.add(ennemi) self.ennemy_list.append(ennemi) for plat in PLATFORMS_LIST: p = PLATFORM(*plat) self.all_sprites.add(p) self.platforms.add(p) self.weapon = WEAPON(1) self.weapons.add(self.weapon) self.all_sprites.add(self.weapon) self.skull = WEAPON(2) self.skulls.add(self.skull) self.all_sprites.add(self.skull) self.fire = WEAPON(3) self.fires.add(self.fire) self.all_sprites.add(self.fire) self.player.right = False self.attacked = False self.run() def run(self): #GAME ~loop~ self.play = True while self.play: self.clock.tick(FPS) self.events() self.update() self.draw() def update(self): # GAME ~update~ self.all_sprites.update() #jar animation for self.jar in self.jars: if self.anim_jar < 8: self.jar.image = self.jar.sprites[int(self.anim_jar)] self.anim_jar = self.anim_jar + 0.05 else : self.anim_jar = 0 #management of the artificial intelligence of the ennemies for ennemi in self.ennemis: ennemi.AI(self.player.pos, self.platforms) #gestion of the collision of the platform if falling plat_hits = pygame.sprite.spritecollide(self.player , self.platforms , False) if self.player.vel.y > 0: if plat_hits : #if the player is under the platform self.player.pos.y = plat_hits[0].rect.top self.player.vel.y = 0 #gestion of the collision of the player and ennimies self.player_hits = pygame.sprite.spritecollide(self.player , self.ennemis , False) self.player_toutch = pygame.sprite.spritecollide(self.player , self.jars , False) self.player_toutch_fire = pygame.sprite.spritecollide(self.player , self.fires , False) if (pygame.time.get_ticks() < self.lastHitTimer + 1000): if self.player.right : self.player.image = self.player.sprites_attaqued[1] elif not self.player.right: self.player.image = self.player.sprites_attaqued[0] else: if self.player_hits or self.player_toutch or self.player_toutch_fire : if self.player.right : self.player.image = self.player.sprites_attaqued[1] elif not self.player.right: self.player.image = self.player.sprites_attaqued[0] self.lastHitTimer = pygame.time.get_ticks() self.player.life -= 1 self.player.pos.x -= 3 for ennemi in self.ennemis: ennemi_hit_together = pygame.sprite.collide_rect(self.player, ennemi) if ennemi.right: self.ennemi_looking_at = 1 else: self.ennemi_looking_at = -1 if ennemi_hit_together and ennemi.type_en == 1: if ennemi.attack_anim < 10 and self.ennemi_looking_at == 1: ennemi.image = ennemi.sprites_attack_right[int(ennemi.attack_anim)] ennemi.attack_anim = ennemi.attack_anim + 0.3 elif ennemi.attack_anim < 10 and self.ennemi_looking_at == -1: ennemi.image = ennemi.sprites_attack_left[int(ennemi.attack_anim)] ennemi.attack_anim = ennemi.attack_anim + 0.3 else : ennemi.attack_anim = 0 # #if ennemi_hit_together == 1 and (pygame.time.get_ticks() > self.lastHitennemyTimer + 100) and ennemi.isFalling == False: #ennemi.move(random.randint(-10, 10)) #self.lastHitennemyTimer = pygame.time.get_ticks() ennemi_hits = pygame.sprite.spritecollide(ennemi , self.weapons , False) ennemi.life_multiplyer = self.life_multiplyer if ennemi.type_en == 1 and not self.player_hits: if (pygame.time.get_ticks() < self.lastHitTimer_e + 500) and ennemi_hits : if ennemi.right : ennemi.image = ennemi.sprites_walk[2] elif not ennemi.right: ennemi.image = ennemi.sprites_walk[3] else: if ennemi.right : ennemi.image = ennemi.sprites_walk[0] elif not ennemi.right: ennemi.image = ennemi.sprites_walk[1] if ennemi_hits and self.player.pos.x > ennemi.rect.x and self.shoot : if ennemi.right : ennemi.image = ennemi.sprites_walk[2] elif not ennemi.right: ennemi.image = ennemi.sprites_walk[3] self.lastHitTimer_e = pygame.time.get_ticks() ennemi.life -= 1 if ennemi.isFalling == False: ennemi.rect.x -= 10 elif ennemi_hits and self.player.pos.x < ennemi.rect.x and self.shoot: if ennemi.right : ennemi.image = ennemi.sprites_walk[2] elif not ennemi.right: ennemi.image = ennemi.sprites_walk[3] self.lastHitTimer_e = pygame.time.get_ticks() ennemi.life -= 1 if ennemi.isFalling == False: ennemi.rect.x += 10 for ennemi in self.ennemis: if (pygame.time.get_ticks() > self.lastHitTimer_e + 500) : if ennemi_hits and self.shoot and ennemi.type_en == 2: if ennemi.right : ennemi.life -= 1 ennemi.image = ennemi.sprites_walk_right[5] self.lastHitTimer_e = pygame.time.get_ticks() elif not ennemi.right: ennemi.image = ennemi.sprites_walk_left[5] ennemi.life -= 1 self.lastHitTimer_e = pygame.time.get_ticks() if ennemi.life < 0 : ennemi.kill() self.player.score += 1 if len(self.ennemis) == 0: self.wave += 1 self.new_wave() if self.shoot and self.looking_at == -1 : if self.anim_player_attack < 9 : self.player.image = self.player.sprites_attack[int(self.anim_player_attack)] self.anim_player_attack = self.anim_player_attack + 0.3 if self.shoot and self.looking_at == 1 : if self.anim_player_attack < 9 : self.player.image = self.player.sprites_attack_r[int(self.anim_player_attack)] self.anim_player_attack = self.anim_player_attack + 0.3 #gestion of shoot or attack if self.shoot : if self.looking_at == -1 : if self.x < self.x_max : y = (-9.81 /( 2 * (self.v0 * self.v0) * (math.cos(self.alpha) * math.cos(self.alpha)) ) * (self.x*self.x)) + math.tan(self.alpha) * self.x + self.h self.weapon.rect.midbottom = (self.coord_x , self.h + (self.h - y)) self.x = self.x + 10 self.coord_x = self.coord_x - 20 else: self.shoot = False self.x = ( (self.v0*self.v0) * ( math.sin (2*self.alpha)) ) / (2*9.81) self.coord_x = 0 elif self.looking_at == 1 : if self.x < self.x_max : y = (-9.81 /( 2 * (self.v0 * self.v0) * (math.cos(self.alpha) * math.cos(self.alpha)) ) * (self.x*self.x)) + math.tan(self.alpha) * self.x + self.h self.weapon.rect.midbottom = (self.coord_x , self.h + (self.h - y) ) self.x = self.x + 10 self.coord_x = self.coord_x + 20 else : self.shoot = False self.x = ( (self.v0*self.v0) * ( math.sin (2*self.alpha)) ) / (2*9.81) self.coord_x = 0 else : #player have weapon self.weapon.rect.midbottom = (20000,20000) for ennemi in self.ennemis: if ennemi.type_en == 2 and pygame.time.get_ticks() > self.last_boss_attack + 5000: self.last_boss_attack = pygame.time.get_ticks() self.boss_h = float(ennemi.rect.y) + 30 self.boss_angle = 50.0 # en degres self.boss_alpha = float(self.boss_angle * 3.14 / 180.0) # conversion en radian self.boss_v0 = 40.0 self.boss_x_max = self.skull.shoot(self.boss_v0, self.boss_alpha, self.boss_h) self.boss_coord_x = ennemi.rect.x + 65 self.boss_x = ((self.boss_v0 * 0) * (math.sin(2 * self.boss_alpha))) / (9.81) self.boss_attack = True if ennemi.right: self.boss_looking_at = 1 else: self.boss_looking_at = -1 if self.boss_attack: if self.boss_looking_at == -1: if self.boss_x < self.boss_x_max: self.boss_y = (-9.81 / (2 * (self.boss_v0 * self.boss_v0) * (math.cos(self.boss_alpha) * math.cos(self.boss_alpha))) * ( self.boss_x * self.boss_x)) + math.tan( self.boss_alpha) * self.boss_x + self.boss_h self.skull.rect.midbottom = (self.boss_coord_x, self.boss_h + (self.boss_h - self.boss_y)) self.boss_x = self.boss_x + 10 self.boss_coord_x = self.boss_coord_x - 10 else: self.boss_attack = False self.anim_ennemi_attack = 0 self.boss_x = ((self.boss_v0 * self.boss_v0) * (math.sin(2 * self.boss_alpha))) / (2 * 9.81) self.boss_coord_x = 0 elif self.boss_looking_at == 1: if self.boss_x < self.boss_x_max: self.boss_y = (-9.81 / (2 * (self.boss_v0 * self.boss_v0) * ( math.cos(self.boss_alpha) * math.cos(self.boss_alpha))) * ( self.boss_x * self.boss_x)) + math.tan( self.boss_alpha) * self.boss_x + self.boss_h self.skull.rect.midbottom = (self.boss_coord_x, self.boss_h + (self.boss_h - self.boss_y)) self.boss_x = self.boss_x + 10 self.boss_coord_x = self.boss_coord_x + 10 else: self.boss_x = ((self.boss_v0 * self.boss_v0) * (math.sin(2 * self.boss_alpha))) / (2 * 9.81) self.boss_coord_x = 0 self.boss_attack = False self.anim_ennemi_attack = 0 else: # boss have skull self.skull.rect.midbottom = (20000, 20000) for ennemi in self.ennemis: if ennemi.right: self.boss_looking_at = 1 else: self.boss_looking_at = -1 if self.boss_attack and self.boss_looking_at == -1 and ennemi.type_en == 2: if self.anim_ennemi_attack < 7: ennemi.image = ennemi.sprites_attack_right[int(self.anim_ennemi_attack)] self.anim_ennemi_attack = self.anim_ennemi_attack + 0.3 if self.boss_attack and self.boss_looking_at == 1 and ennemi.type_en == 2: if self.anim_ennemi_attack < 7: ennemi.image = ennemi.sprites_attack_left[int(self.anim_ennemi_attack)] self.anim_ennemi_attack = self.anim_ennemi_attack + 0.3 ennemi_hit_together = pygame.sprite.collide_rect(self.player, ennemi) if ennemi_hit_together and ennemi.type_en == 2: if ennemi.attack_anim_boss < 10 and self.boss_looking_at == -1: ennemi.image = ennemi.sprites_boss_attack_right[int(ennemi.attack_anim_boss)] ennemi.attack_anim_boss = ennemi.attack_anim_boss + 0.3 elif ennemi.attack_anim_boss < 10 and self.boss_looking_at == 1: ennemi.image = ennemi.sprites_boss_attack_left[int(ennemi.attack_anim_boss)] ennemi.attack_anim_boss = ennemi.attack_anim_boss + 0.3 else: ennemi.attack_anim_boss = 0 for jar in self.jars: if pygame.time.get_ticks() > self.last_jar_attack + 3000 : self.last_jar_attack = pygame.time.get_ticks() self.jar_h = float(jar.rect.y) + 50 self.jar_angle = random.randint(7.0,11.0) # en degres self.jar_alpha = float(self.jar_angle * 3.14 / 180.0) #conversion en radian self.jar_v0 = random.randint(200,280) self.jar_x_max = self.skull.shoot(self.jar_v0, self.jar_alpha , self.jar_h) self.jar_coord_x = jar.rect.x + 65 self.jar_x = ( (self.jar_v0*0) * ( math.sin (2*self.jar_alpha)) ) / (9.81) self.jar_attack = True if self.jar_attack: for self.jar in self.jars: if self.jar_x < self.jar_x_max : self.jar_y = (-9.81 /( 2 * (self.jar_v0 * self.jar_v0) * (math.cos(self.jar_alpha) * math.cos(self.jar_alpha)) ) * (self.jar_x*self.jar_x)) + math.tan(self.jar_alpha) * self.jar_x + self.jar_h self.fire.rect.midbottom = (self.jar_coord_x , self.jar_h + (self.jar_h - self.jar_y) ) self.jar_x = self.jar_x + 10 self.jar_coord_x = self.jar_coord_x + 3 else : self.jar_x = ( (self.jar_v0*self.jar_v0) * ( math.sin (2*self.jar_alpha)) ) / (2*9.81) self.jar_coord_x = 0 self.jar_attack = False else : #jar have skull self.fire.rect.midbottom = (20000,20000) def events(self): # GAME ~events~ for event in pygame.event.get(): #check if windows closed or game loose if event.type == pygame.QUIT : pygame.quit() if self.player.life <= 0 : if self.play: self.play = False self.running = False #check if the player jump if event.type == pygame.KEYDOWN : if event.key == pygame.K_SPACE: self.player.jump() #shoot if event.type == pygame.KEYDOWN : if event.key == pygame.K_e and pygame.time.get_ticks() > self.lastShootTimer + 300: self.shoot = True self.anim_player_attack = 0 self.h = float(self.player.pos.y) if self.player.right: self.looking_at = 1 else: self.looking_at = -1 angle = 7.0 # en degres self.alpha = float(angle * 3.14 / 180.0) #conversion en radian self.v0 = 150.0 self.x_max = self.weapon.shoot(self.v0, self.alpha , self.h) self.coord_x = self.player.pos.x self.x = ( (self.v0*self.v0) * ( math.sin (2*self.alpha)) ) / (2*9.81) self.lastShootTimer = pygame.time.get_ticks() if event.key == pygame.K_r: self.attack = True def dynamic_difficulty(self): if pass_difficulty()==1: self.ennemy_speed=1 self.ennemy_range=300 self.ennemy_attack=25 self.player.speed_multiplyer = 1 self.life_multiplyer = 0.2 if pass_difficulty()==2: self.ennemy_speed=2 self.ennemy_range=400 self.ennemy_attack=30 self.life_multiplyer = 0.4 self.player.speed_multiplyer = 1.2 if pass_difficulty()==3: self.ennemy_speed=3 self.ennemy_range=450 self.ennemy_attack=4 self.life_multiplyer = 0.6 self.player.speed_multiplyer = 1.4 if pass_difficulty()==4: self.ennemy_speed=4 self.ennemy_range=600 self.ennemy_attack=50 self.life_multiplyer = 0.8 self.player.speed_multiplyer = 1.6 def new_wave(self): self.dynamic_difficulty() spawn_ennemi = 3 nbr_ennemi = ((spawn_ennemi * self.wave)//2) for nbr in range(nbr_ennemi): ennemi = ENNEMI(random.randrange(self.ennemy_speed-1,self.ennemy_speed+1), self.ennemy_range, self.ennemy_attack, self.platforms,self.life_multiplyer, 1 ) self.ennemis.add(ennemi) self.all_sprites.add(ennemi) self.ennemy_list.append(ennemi) if self.wave %3 == 0 : ennemi = ENNEMI(self.ennemy_speed//1.5, self.ennemy_range*3, self.ennemy_attack*2, self.platforms,self.life_multiplyer, 2 ) self.ennemis.add(ennemi) self.all_sprites.add(ennemi) self.ennemy_list.append(ennemi) def draw(self): #GAME ~draw~ self.screen.blit(self.background,(0,0)) self.all_sprites.draw(self.screen) self.draw_text(str(self.wave), 40, BLACK, WIDTH / 2, 15) self.draw_text(str(self.player.life), 40, BLACK, WIDTH / 3, 15) #after drawing flip the display pygame.display.flip() def translate_difficulty(self): def easy(): return "Easy" def normal(): return "Normal" def hard(): return "Hard" def nightmare(): return "Nightmare" case = {1: easy, 2: normal, 3: hard, 4: nightmare, } return case.get(pass_difficulty())() def add_data_to_highscore(self, f): with open(f, 'r') as file: # we open the files in "read" mode data = file.readlines() self.username = input("Input your name : ") data.append(str(self.wave) + str(" ") + str(self.player.score) + str(" ") + str(self.translate_difficulty()) + str(" ") + str(self.username) + "\n") return data def add_data_to_highscore_temp(self, f): data = [] data.append(str(self.wave) + str(" ") + str(self.player.score) + str(" ") + str(self.translate_difficulty()) + str(" ") + str(self.username) + "\n") return data def sort_highscore_data(self, f, data): l = len(data) - 1 x = 0 i = 0 max_values = [] index = 0 while x < l: # here i had to use a while as when the program deletes a line in data, the for wouldn't be updated and then the if would give an out of range error while data[x][i] != " ": i = i + 1 max_values.append(data[x][:i] + "\n") i = 0 x = x + 1 if len(max_values) > 10: min1 = max_values[0] for i in range(len(max_values)): if max_values[i] < min1: min1 = max_values[i] index = i del data[index] del data[index] l = len(data) x = 0 i = 0 max_values = [] index = 0 while x < l: # here i had to use a while as when the program deletes a line in data, the for wouldn't be updated and then the if would give an out of range error while data[x][i] != " ": i = i + 1 max_values.append(data[x][:i]) i = 0 x = x + 1 new_data = [] alrsorted = 0 len_values = len(max_values) while alrsorted < len_values: max = 0 for i in range(len(max_values)): if int(max_values[i]) > int(max): max = max_values[i] index = i new_data.append(data[index]) del max_values[index] del data[index] alrsorted = alrsorted + 1 return new_data def add_highscore(self, f, highscore): file = open(f, "w") file.writelines(highscore) def show_start_screen(self): # GAME ~menu screen~ self.menu_music.play(15,0,2500) menu(self) self.menu_music.set_volume(Menu.set_music()) self.game_music.set_volume(Menu.set_music()) self.gameover_music.set_volume(Menu.set_music()) self.menu_music.fadeout(2500) self.game_music.play(15,0,2500) def show_game_over_screen(self): # GAME ~game over~ self.add_highscore("highscore.txt",self.sort_highscore_data("highscore.txt", self.add_data_to_highscore("highscore.txt"))) self.add_highscore(("highscore_temp.txt"),self.add_data_to_highscore_temp("highscore_temp.txt")) self.gameover_music.play(15,0,2500) self.game_music.fadeout(2500) game_over(self) self.gameover_music.fadeout(2500) def draw_text(self, text, size, color, x, y): font = pygame.font.SysFont('Arial', size) text_surface = font.render(text, True, color) text_rect = text_surface.get_rect() text_rect.midtop = (x, y) self.screen.blit(text_surface, text_rect) movie = VideoFileClip("intro_v.2.3.mpg") pygame.display.set_caption(TITLE) screen = pygame.display.set_mode((WIDTH,HEIGHT)) smallfont = pygame.font.SysFont('Corbel', 35) text_loading = smallfont.render('Now loading...', True, WHITE) screen.blit(text_loading,(WIDTH/2,HEIGHT/2)) movie.preview() def launch_game(): g = GAME() g.show_start_screen() while g.running: g.new_game() g.show_game_over_screen() launch_game() launch_game()
StarcoderdataPython
3270093
<reponame>l3l3l/vulnman from vulnman.settings import BASE_DIR # Application definition INSTALLED_APPS = [ # keep before django.contrib.admin 'dal', 'dal_select2', 'queryset_sequence', 'dal_queryset_sequence', 'django.contrib.admin', 'django.contrib.auth', 'django.contrib.contenttypes', 'django.contrib.sessions', 'django.contrib.messages', 'django.contrib.staticfiles', 'widget_tweaks', 'django_tex', 'extra_views', 'rest_framework', 'dry_rest_permissions', 'crispy_forms', "crispy_bootstrap5", "guardian", "taggit", "split_settings", # apps 'apps.api.apps.ApiConfig', 'apps.account.apps.AccountConfig', 'apps.external_tools.apps.ExternalToolsConfig', 'apps.reporting.apps.ReportingConfig', 'apps.projects.apps.ProjectsConfig', 'apps.dashboard.apps.DashboardConfig', 'apps.networking.apps.NetworkingConfig', 'apps.methodologies.apps.MethodologiesConfig', 'apps.social.apps.SocialConfig', 'apps.findings.apps.FindingsConfig', 'apps.agents.apps.AgentsConfig', 'apps.commands.apps.CommandsConfig', 'apps.tagging.apps.TaggingConfig' ]
StarcoderdataPython
3363660
<filename>hive/__init__.py # -*- coding: utf-8 -*- from .hive import Hive __version__ = '0.10'
StarcoderdataPython
111671
<gh_stars>1-10 # -*- coding: utf-8 -*- from __future__ import absolute_import, division, print_function from ibeis import constants as const from ibeis.control.accessor_decors import (adder, getter_1to1, ider) import utool as ut from ibeis.control.controller_inject import make_ibs_register_decorator print, rrr, profile = ut.inject2(__name__) CLASS_INJECT_KEY, register_ibs_method = make_ibs_register_decorator(__name__) @register_ibs_method @ider def _get_all_known_lblannot_rowids(ibs, _lbltype): """ Returns: list_ (list): all nids of known animals (does not include unknown names) """ all_known_lblannot_rowids = ibs.db.get_all_rowids_where(const.LBLANNOT_TABLE, 'lbltype_rowid=?', (ibs.lbltype_ids[_lbltype],)) return all_known_lblannot_rowids @register_ibs_method @adder def add_lbltype(ibs, text_list, default_list): """ Adds a label type and its default value Should only be called at the begining of the program. """ params_iter = zip(text_list, default_list) colnames = ('lbltype_text', 'lbltype_default',) get_rowid_from_superkey = ibs.get_lbltype_rowid_from_text lbltype_rowid_list = ibs.db.add_cleanly(const.LBLTYPE_TABLE, colnames, params_iter, get_rowid_from_superkey) return lbltype_rowid_list # # GETTERS::LBLTYPE @register_ibs_method @getter_1to1 def get_lbltype_rowid_from_text(ibs, text_list): """ Returns: lbltype_rowid (list): lbltype_rowid where the lbltype_text is given """ # FIXME: MAKE SQL-METHOD FOR NON-ROWID GETTERS # FIXME: Use unique SUPERKEYS instead of specifying id_colname lbltype_rowid = ibs.db.get(const.LBLTYPE_TABLE, ('lbltype_rowid',), text_list, id_colname='lbltype_text') return lbltype_rowid @register_ibs_method @getter_1to1 def get_lbltype_default(ibs, lbltype_rowid_list): lbltype_default_list = ibs.db.get(const.LBLTYPE_TABLE, ('lbltype_default',), lbltype_rowid_list) return lbltype_default_list @register_ibs_method @getter_1to1 def get_lbltype_text(ibs, lbltype_rowid_list): lbltype_text_list = ibs.db.get(const.LBLTYPE_TABLE, ('lbltype_text',), lbltype_rowid_list) return lbltype_text_list if __name__ == '__main__': """ CommandLine: python -m ibeis.control.manual_lbltype_funcs python -m ibeis.control.manual_lbltype_funcs --allexamples python -m ibeis.control.manual_lbltype_funcs --allexamples --noface --nosrc """ import multiprocessing multiprocessing.freeze_support() # for win32 import utool as ut # NOQA ut.doctest_funcs()
StarcoderdataPython
90330
import sys import time import pygame from gen_new_updated_file import gen_file, format_prog registers = [0] * 128 main_reg = 0 where_in_regs = 0 should_replace = False replace_with = None with open('data.py', 'r') as f: commands_dict = eval(f.read()) pygame.init() screen = pygame.display.set_mode((512, 512)) with open(sys.argv[1], 'r') as f: txt = f.read() exe = list(map(str.split, txt.splitlines())) class UserProgramFailure(Exception): pass class Pygame_handler: '''WARNING: only make one instance''' def __init__(self): self.sxscval = -1 self.syscval = -1 def sxlc(self, value): self.sxscval = int(value, 2) def sylc(self, value): self.syscval = int(value, 2) def scol(self, color): rgb = str(color) self.r = int(rgb[:2], 2) * 127 self.g = int(rgb[2:4], 2) * 127 self.b = int(rgb[4:], 2) * 127 def draw(self): pygame.gfxdraw.pixel(screen, (self.r, self.g, self.b), [self.sxscval*2, self.syscval*2, 2, 2]) time.sleep(1) pygame.display.flip() class basic_handler(Pygame_handler): def jump(self, loc): global loop_num #print(f'jumping to line {loc}') loop_num = int(loc, 2) - 1 # minus one is because of the plus one at the bottom of the while loop def jpfz(self, loc): if main_reg == 0: self.jump(loc) def jfnz(self, loc): if main_reg != 0: self.jump(loc) def semr(self, input): global main_reg main_reg = int(input, 2) registers[where_in_regs] = main_reg def rpnx(self, reg): global should_replace global replace_with should_replace = True shortened_value = bin(registers[int(reg, 2)])[2:] replace_with = [shortened_value if not shortened_value.startswith('b') else '-' + shortened_value[1]] #print(replace_with) def log(self, input): # Doesn't count; only for testing. print('LOG:', input) def add(self, input): global main_reg main_reg += int(input, 2) registers[where_in_regs] = main_reg def sub(self, input): global main_reg main_reg -= int(input, 2) registers[where_in_regs] = main_reg def dump(self): # for testing print(self.dumpr()) def dumpr(self): # DO NOT USE IN SIM return f'''On line {loop_num}. The program is {len(exe)} lines long. The registers contain {registers},\nof which register {where_in_regs} is the main one. it contains {main_reg}.''' def swir(self, reg): reg = int(reg, 2) global main_reg global where_in_regs registers[where_in_regs] = main_reg main_reg = registers[reg] where_in_regs = reg def kill(self): # Doesn't count; only for testing. time.sleep(10) sys.exit() def abs(self): # can use boolean and instead in other implamentations global main_reg main_reg = abs(main_reg) registers[where_in_regs] = main_reg def band(self, value): global main_reg main_reg = main_reg & int(value, 2) registers[where_in_regs] = main_reg def rplz(self): global main_reg main_reg = 0 if main_reg < 0 else main_reg registers[where_in_regs] = main_reg def rein(self, instruction): exe[main_reg][0] = commands_dict[instruction.zfill(4)] def cont(self): pass get_all = basic_handler() loop_num = 0 while True: try: if exe[loop_num]: program, *value = exe[loop_num][:2] if not program.startswith('#'): if should_replace: value = replace_with should_replace = False if value and value[0].startswith('#'): # This shorts out if value is empty value = [] getattr(get_all, program)(*value) print('here') loop_num += 1 if loop_num == len(exe): break except TypeError as e: if type(e) == type(TypeError()): raise UserProgramFailure(f'ERROR: Too few arguments\n\ndebug status:\n{"-"*10}\n{get_all.dumpr()}\n{"-"*10}') except Exception: raise UserProgramFailure('unknown error') get_all.dump() input("prompt to end program...") gen_file(sys.argv[1], format_prog(exe))
StarcoderdataPython
4809265
<reponame>Dmunch04/SquareIt import json from Objects import Notification as Notif from Modding import Mod as ModObject class Loader: def __init__ (self): self.Mods = [] self.Data = {} def Load (self, _Mod): """ Prepare the mod """ with open (_Mod, 'r') as ModFile: ModData = json.loads (ModFile.read ()) if not ModData['Name'] in self.Mods: self.Mods.append (ModData['Name']) Name = ModData.get ('Name', 'Untitled') Version = ModData.get ('Version', '0.0.1') Author = ModData.get ('Author', 'Anonymous') Description = ModData.get ('Description', 'A Mod') Data = ModData.get ('Data', {}) if Data: self.Data[Name] = Data Mod = ModObject ( Name, Version, Author, Description, Data ) return Mod def Unload (self, _Mod): """ Remove the mod and it's data """ if _Mod in self.Mods: del self.Mods[self.Mods.index (_Mod)] self.Data[_Mod] = {} def SetData (self, _Object): """ Apply the mods data to the game """ NotificationsToAdd = {} for Mod in self.Data: Data = self.Data[Mod] if Data: WindowSettings = Data.get ('Window', {}) if WindowSettings: Color = WindowSettings.get ('Color', _Object.Window.BackgroundColor) _Object.Window.BackgroundColor = Color GameSettings = Data.get ('Game', {}) if GameSettings: Enemies = GameSettings.get ('Enemies', []) if Enemies: for Enemy in Enemies: X = Enemy.get ('X', 0) Y = Enemy.get ('Y', 0) Width = Enemy.get ('Width', 50) Height = Enemy.get ('Height', 50) _Object.AddEnemy ( X, Y, Width, Height ) Bombs = GameSettings.get ('Bombs', []) if Bombs: for Bomb in Bombs: X = Bomb.get ('X', 0) Y = Bomb.get ('Y', 0) Width = Bomb.get ('Width', 50) Height = Bomb.get ('Height', 50) _Object.AddBomb ( X, Y, Width, Height ) Notifications = GameSettings.get ('Notifications', []) if Notifications: for NotificationItem in Notifications: Text = NotificationItem.get ('Text', 'None') Duration = NotificationItem.get ('Duration', 1) NotificationsToAdd[str (len (NotificationsToAdd) + 1)] = Notif (Text, Duration) PlayerSettings = Data.get ('Player', {}) if PlayerSettings: X = PlayerSettings.get ('X', _Object.Player.X) Y = PlayerSettings.get ('Y', _Object.Player.Y) Width = PlayerSettings.get ('Width', _Object.Player.Width) Height = PlayerSettings.get ('Height', _Object.Player.Height) Speed = PlayerSettings.get ('Speed', _Object.Player.Speed) Color = PlayerSettings.get ('Color', _Object.Player.Color) _Object.Player.X = int (X) _Object.Player.Y = int (Y) _Object.Player.OriginalX = int (X) _Object.Player.OriginalY = int (Y) _Object.Player.Width = int (Width) _Object.Player.Height = int (Height) _Object.Player.Speed = int (Speed) _Object.Player.Color = Color MessagesSettings = Data.get ('Messages', {}) if MessagesSettings: for Message in MessagesSettings: if Message in _Object.Messages: _Object.Messages[Message] = MessagesSettings[Message] self.Unload (Mod) _Object.AddNotification ( # Text f'{Mod} has been loaded!', # Duration (Frames) 500 ) for Notification in NotificationsToAdd: Notification = NotificationsToAdd[Notification] _Object.AddNotification ( # Text str (Notification.Text), # Duration (Frames) int (Notification.Duration) )
StarcoderdataPython
1728262
from odd_models.models import DataEntity, DataSet, DataEntityType from oddrn_generator import SnowflakeGenerator from . import ( MetadataNamedtuple, _data_set_metadata_schema_url, _data_set_metadata_excluded_keys, ColumnMetadataNamedtuple, ) from .columns import map_column from .metadata import append_metadata_extension from .types import TABLE_TYPES_SQL_TO_ODD from .utils import transform_datetime from .views import extract_transformer_data def map_table( oddrn_generator: SnowflakeGenerator, tables: list[tuple], columns: list[tuple] ) -> list[DataEntity]: data_entities: list[DataEntity] = [] column_index: int = 0 for table in tables: metadata: MetadataNamedtuple = MetadataNamedtuple(*table) data_entity_type = TABLE_TYPES_SQL_TO_ODD.get( metadata.table_type, DataEntityType.UNKNOWN ) oddrn_path = "views" if data_entity_type == DataEntityType.VIEW else "tables" oddrn_generator.set_oddrn_paths( **{"schemas": metadata.table_schema, oddrn_path: metadata.table_name} ) # DataEntity data_entity: DataEntity = DataEntity( oddrn=oddrn_generator.get_oddrn_by_path(oddrn_path), name=metadata.table_name, type=data_entity_type, owner=metadata.table_owner, description=metadata.comment, metadata=[], updated_at=transform_datetime(metadata.last_altered), created_at=transform_datetime(metadata.created), ) data_entities.append(data_entity) append_metadata_extension( data_entity.metadata, _data_set_metadata_schema_url, metadata, _data_set_metadata_excluded_keys, ) data_entity.dataset = DataSet( rows_number=int(metadata.row_count) if metadata.row_count is not None else None, field_list=[], ) # DataTransformer if data_entity.type == DataEntityType.VIEW: data_entity.data_transformer = extract_transformer_data( metadata.view_definition, oddrn_generator ) # DatasetField while column_index < len(columns): column: tuple = columns[column_index] column_metadata: ColumnMetadataNamedtuple = ColumnMetadataNamedtuple( *column ) if ( column_metadata.table_schema == metadata.table_schema and column_metadata.table_name == metadata.table_name ): data_entity.dataset.field_list.append( map_column( column_metadata, oddrn_generator, data_entity.owner, oddrn_path ) ) column_index += 1 else: break return data_entities
StarcoderdataPython
3349298
# BSD Licence # Copyright (c) 2009, Science & Technology Facilities Council (STFC) # All rights reserved. # # See the LICENSE file in the source distribution of this software for # the full license text. # Copyright (C) 2007 STFC & NERC (Science and Technology Facilities Council). # This software may be distributed under the terms of the # Q Public License, version 1.0 or later. # http://ndg.nerc.ac.uk/public_docs/QPublic_license.txt """ Classes modelling the OWS Data Identification package v1.1.0. :author: <NAME> """ from cows.model.iso19115_subset import Keywords class Description(object): """ :ivar titles: :type titles: iterable of str or LanguageString :ivar abstracts: :type abstracts: iterable of str or LanguageString :ivar keywords: :type keywords: iterable or Keywords """ def __init__(self, titles=[], abstracts=[], keywords=Keywords()): self.titles = titles self.abstracts = abstracts self.keywords = keywords class BasicIdentification(Description): """ :ivar identifier: :type identifier: None or Code :ivar metadata: :type metadata: iterable of Metadata """ def __init__(self, identifier=None, metadata=[], **kwargs): super(BasicIdentification, self).__init__(**kwargs) self.identifier = identifier self.metadata = metadata class Identification(BasicIdentification): """ :ivar outputFormats: :type outputFormats: iterable of str :ivar availableCRSs: URIs of available coordinate reference systems :type availableCRSs: iterable of str :ivar boundingBoxes: :type boundingBoxes: iterable of BoundingBox """ def __init__(self, outputFormats=[], availableCRSs=[], boundingBoxes=[], **kwargs): super(Identification, self).__init__(**kwargs) self.outputFormats = outputFormats self.availableCRSs = availableCRSs self.boundingBoxes = boundingBoxes
StarcoderdataPython
1601618
import torch from .torchpoints import ball_query_partial_dense import numpy as np import numba from typing import List @numba.jit(nopython=True) def _grow_proximity_core(neighbours, min_cluster_size): num_points = int(neighbours.shape[0]) visited = np.zeros((num_points,), dtype=numba.types.bool_) clusters = [] for i in range(num_points): if visited[i]: continue cluster = [] queue = [] visited[i] = True queue.append(i) cluster.append(i) while len(queue): k = queue.pop() k_neighbours = neighbours[k] for nei in k_neighbours: if nei.item() == -1: break if not visited[nei]: visited[nei] = True queue.append(nei.item()) cluster.append(nei.item()) if len(cluster) >= min_cluster_size: clusters.append(cluster) return clusters def grow_proximity(pos, batch, nsample=16, radius=0.02, min_cluster_size=32): """Grow based on proximity only Neighbour search is done on device while the cluster assignement is done on cpu""" assert pos.shape[0] == batch.shape[0] neighbours = ball_query_partial_dense(radius, nsample, pos, pos, batch, batch)[0].cpu().numpy() return _grow_proximity_core(neighbours, min_cluster_size) def region_grow( pos, labels, batch, ignore_labels=[], nsample=16, radius=0.02, min_cluster_size=32 ) -> List[torch.Tensor]: """Region growing clustering algorithm proposed in PointGroup: Dual-Set Point Grouping for 3D Instance Segmentation https://arxiv.org/pdf/2004.01658.pdf for instance segmentation Parameters ---------- pos: torch.Tensor [N, 3] Location of the points labels: torch.Tensor [N,] labels of each point ignore_labels: Labels that should be ignored, no region growing will be performed on those nsample: maximum number of neighbours to consider radius: radius for the neighbour search min_cluster_size: Number of points above which a cluster is considered valid """ assert labels.dim() == 1 assert pos.dim() == 2 assert pos.shape[0] == labels.shape[0] unique_labels = torch.unique(labels) clusters = [] ind = torch.arange(0, pos.shape[0]) for l in unique_labels: if l in ignore_labels: continue # Build clusters for a given label (ignore other points) label_mask = labels == l local_ind = ind[label_mask] # Remap batch to a continuous sequence label_batch = batch[label_mask] unique_in_batch = torch.unique(label_batch) remaped_batch = torch.empty_like(label_batch) for new, old in enumerate(unique_in_batch): mask = label_batch == old remaped_batch[mask] = new # Cluster label_clusters = grow_proximity( pos[label_mask, :], remaped_batch, nsample=nsample, radius=radius, min_cluster_size=min_cluster_size, ) # Remap indices to original coordinates if len(label_clusters): for cluster in label_clusters: cluster = torch.tensor(cluster).to(pos.device) clusters.append(local_ind[cluster]) return clusters
StarcoderdataPython
3362128
<reponame>VisionSystemsTech/projects-time # -*- coding: utf-8 -*- import yaml from copy import deepcopy from pathlib import Path from easydict import EasyDict class SingletonMeta(type): _instances = {} def __call__(cls, *args, **kwargs): if cls not in cls._instances: instance = super().__call__(*args, **kwargs) cls._instances[cls] = instance return cls._instances[cls] class SingleConfig(metaclass=SingletonMeta): def __init__(self, user_source='config.yaml', default_source='config-default.yaml'): self._keys = list() self._user_source = user_source self._default_source = default_source self.reset() def __getattr__(self, name): if name in self.__dict__: return self.__dict__[name] else: raise AttributeError(name) def __getitem__(self, name): return getattr(self, name) def get_part(self, subconfig): partial_config = {} if self[subconfig] is None else deepcopy(self[subconfig]) partial_config.update(self['general']) return partial_config def reset(self): for key in self._keys: delattr(self, key) self._keys = list() d = EasyDict(self._load_config()) for k, v in d.items(): setattr(self, k, v) self._keys.append(k) def _load_config(self): config = self._read_config(self._default_source) user_config = dict() if Path(self._user_source).exists(): user_config = self._read_config(self._user_source) config_issues = list() is_valid = self._update_config(config, user_config, str_to_print=self._default_source, to_print=config_issues) if config_issues: print(f'Problem(s) with configs:\n{"".join(config_issues)}\n' f'Check and correct your {self._make_bold(self._default_source)} ' f'and {self._make_bold(self._user_source)}!') if not is_valid: exit(0) working_dir = Path(config['general']['working_dir']).absolute() resources_dir = Path(config['general']['resources_dir']).absolute() config['general']['working_dir'] = str(working_dir) self._set_absolute_paths(config, working_dir, resources_dir) return config @staticmethod def _read_config(source): if isinstance(source, str): with open(source, 'r') as stream: config = yaml.safe_load(stream) if config is None: print(f'{source} is empty. Fill it, please.') exit() else: raise TypeError('Unexpected source to load config') return config @staticmethod def _update_config(default_cfg, user_cfg, str_to_print, to_print): result = True if type(default_cfg) != type(user_cfg): to_print.append(f'{str_to_print} have different types: {type(default_cfg)} and {type(user_cfg)}\n') result = False elif isinstance(user_cfg, dict): for key, value in user_cfg.items(): if key not in default_cfg: to_print.append(f'No key in {str_to_print} ' f'{SingleConfig._get_delimiter_key()} ' f'{SingleConfig._make_bold(key)}\n') result = False elif isinstance(value, dict): new_str = f'{str_to_print} {SingleConfig._get_delimiter_key()} {key}' cfg1, cfg2 = default_cfg[key], value result = SingleConfig._update_config(cfg1, cfg2, new_str, to_print) and result else: default_cfg[key] = value return result @staticmethod def _set_absolute_paths(d, working_dir, resources_dir): for key, value in d.items(): if isinstance(d[key], dict): if key.strip() == 'resources': for sub_key, sub_value in value.items(): value[sub_key] = str(resources_dir.joinpath(sub_value)) else: SingleConfig._set_absolute_paths(d[key], working_dir, resources_dir) else: if value is not None: if 'path' in key: d[key] = working_dir.joinpath(value) elif 'location' in key: d[key] = resources_dir.joinpath(value) @staticmethod def _make_bold(s): bold = '\033[1m' end_bold = '\033[0m' return bold + s + end_bold @staticmethod def _get_delimiter_key(): return '->'
StarcoderdataPython
3368123
<reponame>mahmuuud/pip-accel # Extension of pip-accel that deals with dependencies on system packages. # # Author: <NAME> <<EMAIL>> # Last Change: October 31, 2015 # URL: https://github.com/paylogic/pip-accel """ System package dependency handling. The :mod:`pip_accel.deps` module is an extension of pip-accel that deals with dependencies on system packages. Currently only Debian Linux and derivative Linux distributions are supported by this extension but it should be fairly easy to add support for other platforms. The interface between pip-accel and :class:`SystemPackageManager` focuses on :func:`~SystemPackageManager.install_dependencies()` (the other methods are used internally). """ # Standard library modules. import logging import os import shlex import subprocess # Modules included in our package. from pip_accel.compat import WINDOWS, configparser from pip_accel.exceptions import DependencyInstallationFailed, DependencyInstallationRefused, SystemDependencyError from pip_accel.utils import is_root # External dependencies. from humanfriendly import Timer, concatenate, format, pluralize from humanfriendly.prompts import prompt_for_confirmation # Initialize a logger for this module. logger = logging.getLogger(__name__) class SystemPackageManager(object): """Interface to the system's package manager.""" def __init__(self, config): """ Initialize the system package dependency manager. :param config: The pip-accel configuration (a :class:`.Config` object). """ # Defaults for unsupported systems. self.list_command = 'true' self.install_command = 'true' self.dependencies = {} # Keep a reference to the pip-accel configuration. self.config = config # Initialize the platform specific package manager interface. directory = os.path.dirname(os.path.abspath(__file__)) for filename in sorted(os.listdir(directory)): pathname = os.path.join(directory, filename) if filename.endswith('.ini') and os.path.isfile(pathname): logger.debug("Loading configuration from %s ..", pathname) parser = configparser.RawConfigParser() parser.read(pathname) # Check if the package manager is supported. supported_command = parser.get('commands', 'supported') logger.debug("Checking if configuration is supported: %s", supported_command) with open(os.devnull, 'wb') as null_device: if subprocess.call(supported_command, shell=True, stdout=null_device, stderr=subprocess.STDOUT) == 0: logger.debug("System package manager configuration is supported!") # Get the commands to list and install system packages. self.list_command = parser.get('commands', 'list') self.install_command = parser.get('commands', 'install') # Get the known dependencies. self.dependencies = dict((n.lower(), v.split()) for n, v in parser.items('dependencies')) logger.debug("Loaded dependencies of %s: %s", pluralize(len(self.dependencies), "Python package"), concatenate(sorted(self.dependencies))) else: logger.debug("Command failed, assuming configuration doesn't apply ..") def install_dependencies(self, requirement): """ Install missing dependencies for the given requirement. :param requirement: A :class:`.Requirement` object. :returns: :data:`True` when missing system packages were installed, :data:`False` otherwise. :raises: :exc:`.DependencyInstallationRefused` when automatic installation is disabled or refused by the operator. :raises: :exc:`.DependencyInstallationFailed` when the installation of missing system packages fails. If `pip-accel` fails to build a binary distribution, it will call this method as a last chance to install missing dependencies. If this function does not raise an exception, `pip-accel` will retry the build once. """ install_timer = Timer() missing_dependencies = self.find_missing_dependencies(requirement) if missing_dependencies: # Compose the command line for the install command. install_command = shlex.split(self.install_command) + missing_dependencies # Prepend `sudo' to the command line? if not WINDOWS and not is_root(): # FIXME Ideally this should properly detect the presence of `sudo'. # Or maybe this should just be embedded in the *.ini files? install_command.insert(0, 'sudo') # Always suggest the installation command to the operator. logger.info("You seem to be missing %s: %s", pluralize(len(missing_dependencies), "dependency", "dependencies"), concatenate(missing_dependencies)) logger.info("You can install %s with this command: %s", "it" if len(missing_dependencies) == 1 else "them", " ".join(install_command)) if self.config.auto_install is False: # Refuse automatic installation and don't prompt the operator when the configuration says no. self.installation_refused(requirement, missing_dependencies, "automatic installation is disabled") # Get the operator's permission to install the missing package(s). if self.config.auto_install: logger.info("Got permission to install %s (via auto_install option).", pluralize(len(missing_dependencies), "dependency", "dependencies")) elif self.confirm_installation(requirement, missing_dependencies, install_command): logger.info("Got permission to install %s (via interactive prompt).", pluralize(len(missing_dependencies), "dependency", "dependencies")) else: logger.error("Refused installation of missing %s!", "dependency" if len(missing_dependencies) == 1 else "dependencies") self.installation_refused(requirement, missing_dependencies, "manual installation was refused") if subprocess.call(install_command) == 0: logger.info("Successfully installed %s in %s.", pluralize(len(missing_dependencies), "dependency", "dependencies"), install_timer) return True else: logger.error("Failed to install %s.", pluralize(len(missing_dependencies), "dependency", "dependencies")) msg = "Failed to install %s required by Python package %s! (%s)" raise DependencyInstallationFailed(msg % (pluralize(len(missing_dependencies), "system package", "system packages"), requirement.name, concatenate(missing_dependencies))) return False def find_missing_dependencies(self, requirement): """ Find missing dependencies of a Python package. :param requirement: A :class:`.Requirement` object. :returns: A list of strings with system package names. """ known_dependencies = self.find_known_dependencies(requirement) if known_dependencies: installed_packages = self.find_installed_packages() logger.debug("Checking for missing dependencies of %s ..", requirement.name) missing_dependencies = sorted(set(known_dependencies).difference(installed_packages)) if missing_dependencies: logger.debug("Found %s: %s", pluralize(len(missing_dependencies), "missing dependency", "missing dependencies"), concatenate(missing_dependencies)) else: logger.info("All known dependencies are already installed.") return missing_dependencies def find_known_dependencies(self, requirement): """ Find the known dependencies of a Python package. :param requirement: A :class:`.Requirement` object. :returns: A list of strings with system package names. """ logger.info("Checking for known dependencies of %s ..", requirement.name) known_dependencies = sorted(self.dependencies.get(requirement.name.lower(), [])) if known_dependencies: logger.info("Found %s: %s", pluralize(len(known_dependencies), "known dependency", "known dependencies"), concatenate(known_dependencies)) else: logger.info("No known dependencies... Maybe you have a suggestion?") return known_dependencies def find_installed_packages(self): """ Find the installed system packages. :returns: A list of strings with system package names. :raises: :exc:`.SystemDependencyError` when the command to list the installed system packages fails. """ list_command = subprocess.Popen(self.list_command, shell=True, stdout=subprocess.PIPE) stdout, stderr = list_command.communicate() if list_command.returncode != 0: raise SystemDependencyError("The command to list the installed system packages failed! ({command})", command=self.list_command) installed_packages = sorted(stdout.decode().split()) logger.debug("Found %i installed system package(s): %s", len(installed_packages), installed_packages) return installed_packages def installation_refused(self, requirement, missing_dependencies, reason): """ Raise :exc:`.DependencyInstallationRefused` with a user friendly message. :param requirement: A :class:`.Requirement` object. :param missing_dependencies: A list of strings with missing dependencies. :param reason: The reason why installation was refused (a string). """ msg = "Missing %s (%s) required by Python package %s (%s) but %s!" raise DependencyInstallationRefused( msg % (pluralize(len(missing_dependencies), "system package", "system packages"), concatenate(missing_dependencies), requirement.name, requirement.version, reason) ) def confirm_installation(self, requirement, missing_dependencies, install_command): """ Ask the operator's permission to install missing system packages. :param requirement: A :class:`.Requirement` object. :param missing_dependencies: A list of strings with missing dependencies. :param install_command: A list of strings with the command line needed to install the missing dependencies. :raises: :exc:`.DependencyInstallationRefused` when the operator refuses. """ try: return prompt_for_confirmation(format( "Do you want me to install %s %s?", "this" if len(missing_dependencies) == 1 else "these", "dependency" if len(missing_dependencies) == 1 else "dependencies", ), default=True) except KeyboardInterrupt: # Control-C is a negative response but doesn't # otherwise interrupt the program flow. return False
StarcoderdataPython
1751851
# -*- coding: utf-8 -*- def __len__(self): """Method to behave like a dict and the number of keys""" return self._statements.__len__()
StarcoderdataPython
3372024
<filename>backend/shared/shared/azure_adfs/urls.py from django.urls import include, path, re_path from shared.azure_adfs.views import HelsinkiOAuth2CallbackView urlpatterns = [ re_path(r"^callback$", HelsinkiOAuth2CallbackView.as_view(), name="callback"), path("", include("django_auth_adfs.urls")), ]
StarcoderdataPython
4823522
""" Дан список. Определите, является ли он монотонно возрастающим(то есть верно ли, что каждый элемент этого списка больше предыдущего).Выведите YES, если массив монотонно возрастает и NO в противном случае.Решение оформите в виде функции IsAscending(A).В данной функции должен быть один цикл while, не содержащий вложенных условий и циклов — используйте схему линейного поиска. """ def IsAscending(A): i = 1 while i < len(A) and A[i] > A[i - 1]: i += 1 print('YES') if i == len(A) else print('NO') intList = list(map(int, input().split())) IsAscending(intList)
StarcoderdataPython
194129
<filename>tests/test_4_delete_test_db.py import os db_path = 'tests/processed/test_db.sqlite' def test_delete_test_db(): #This should always be the last script run. This will delete the test db created to avoid appending onto it on future tests os.remove(db_path)
StarcoderdataPython
1765089
<reponame>acse-zh820/ci_acse1 import pytest from simple_functions import my_sum, factorial, average class TestSimpleFunctions(object): '''Class to test our simple functions are working correctly''' @pytest.mark.parametrize('iterable, expected', [ ([8, 7, 5], 20), ((10, -2, 5, -10, 1), 4) ]) def test_my_add(self, iterable, expected): '''Test our add function''' isum = my_sum(iterable) assert isum == expected @pytest.mark.parametrize('number, expected', [ (5, 120), (3, 6), (1, 1) ]) def test_factorial(self, number, expected): '''Test our factorial function''' answer = factorial(number) assert answer == expected @pytest.mark.parametrize('n, expected', [ ([1, 2, 3], 2), ([4, 6, 8], 6) ]) def test_average(self, n, expected): result = average(n) assert result == expected
StarcoderdataPython
4802326
from setuptools import setup, find_packages with open('README.md') as f: readme = f.read() with open('LICENSE') as f: license_ = f.read() setup( name='econ_watcher_reader', version='0.0.1', description='Web scraper to get economy watcher data from Cabinet Office of Japan.', long_description=readme, long_description_content_type="text/markdown", author='<NAME>', author_email='<EMAIL>', install_requires=['numpy', 'pandas', 'xlrd', 'requests', 'bs4'], url='https://github.com/si4141/scraper_for_economy_watcher', license=license_, packages=find_packages(exclude=('tests', 'docs')), classifiers=[ 'Programming Language :: Python :: 3.7', 'License :: OSI Approved :: MIT License', 'Development Status :: 4 - Beta', ] )
StarcoderdataPython
4823292
<gh_stars>10-100 import os import time import torch as T import numpy as np import json import queue import importlib import multiprocessing as mp from collections import namedtuple from .utils.plot import smoothed_plot from .utils.replay_buffer import ReplayBuffer, PrioritisedReplayBuffer from .utils.normalizer import Normalizer # T.multiprocessing.set_start_method('spawn') t = namedtuple("transition", ('state', 'action', 'next_state', 'reward', 'done')) def mkdir(paths): for path in paths: os.makedirs(path, exist_ok=True) class Agent(object): def __init__(self, algo_params, image_obs=False, action_type='continuous', path=None, seed=-1): # torch device self.device = T.device("cuda" if T.cuda.is_available() else "cpu") if 'cuda_device_id' in algo_params.keys(): self.device = T.device("cuda:%i" % algo_params['cuda_device_id']) # path & seeding T.manual_seed(seed) T.cuda.manual_seed_all(seed) # this has no effect if cuda is not available assert path is not None, 'please specify a project path to save files' self.path = path # path to save neural network check point self.ckpt_path = os.path.join(path, 'ckpts') # path to save statistics self.data_path = os.path.join(path, 'data') # create directories if not exist mkdir([self.path, self.ckpt_path, self.data_path]) # non-goal-conditioned args self.image_obs = image_obs self.action_type = action_type if self.image_obs: self.state_dim = 0 self.state_shape = algo_params['state_shape'] else: self.state_dim = algo_params['state_dim'] self.action_dim = algo_params['action_dim'] if self.action_type == 'continuous': self.action_max = algo_params['action_max'] self.action_scaling = algo_params['action_scaling'] # common args if not self.image_obs: # todo: observation in distributed training should be synced as well self.observation_normalization = algo_params['observation_normalization'] # if not using obs normalization, the normalizer is just a scale multiplier, returns inputs*scale self.normalizer = Normalizer(self.state_dim, algo_params['init_input_means'], algo_params['init_input_vars'], activated=self.observation_normalization) self.gamma = algo_params['discount_factor'] self.tau = algo_params['tau'] # network dict is filled in each specific agent self.network_dict = {} self.network_keys_to_save = None # algorithm-specific statistics are defined in each agent sub-class self.statistic_dict = { # use lowercase characters 'actor_loss': [], 'critic_loss': [], } def _soft_update(self, source, target, tau=None, from_params=False): if tau is None: tau = self.tau if not from_params: for target_param, param in zip(target.parameters(), source.parameters()): target_param.data.copy_( target_param.data * (1.0 - tau) + param.data * tau ) else: for target_param, param in zip(target.parameters(), source): target_param.data.copy_( target_param.data * (1.0 - tau) + T.tensor(param).float().to(self.device) * tau ) def _save_network(self, keys=None, ep=None): if ep is None: ep = '' else: ep = '_ep' + str(ep) if keys is None: keys = self.network_keys_to_save assert keys is not None for key in keys: T.save(self.network_dict[key].state_dict(), self.ckpt_path + '/ckpt_' + key + ep + '.pt') def _load_network(self, keys=None, ep=None): if not self.image_obs: self.normalizer.history_mean = np.load(os.path.join(self.data_path, 'input_means.npy')) self.normalizer.history_var = np.load(os.path.join(self.data_path, 'input_vars.npy')) if ep is None: ep = '' else: ep = '_ep' + str(ep) if keys is None: keys = self.network_keys_to_save assert keys is not None for key in keys: self.network_dict[key].load_state_dict(T.load(self.ckpt_path + '/ckpt_' + key + ep + '.pt')) def _save_statistics(self, keys=None): if not self.image_obs: np.save(os.path.join(self.data_path, 'input_means'), self.normalizer.history_mean) np.save(os.path.join(self.data_path, 'input_vars'), self.normalizer.history_var) if keys is None: keys = self.statistic_dict.keys() for key in keys: if len(self.statistic_dict[key]) == 0: continue # convert everything to a list before save via json if T.is_tensor(self.statistic_dict[key][0]): self.statistic_dict[key] = T.as_tensor(self.statistic_dict[key], device=self.device).cpu().numpy().tolist() else: self.statistic_dict[key] = np.array(self.statistic_dict[key]).tolist() json.dump(self.statistic_dict[key], open(os.path.join(self.data_path, key+'.json'), 'w')) def _plot_statistics(self, keys=None, x_labels=None, y_labels=None, window=5, save_to_file=True): if save_to_file: self._save_statistics(keys=keys) if y_labels is None: y_labels = {} for key in list(self.statistic_dict.keys()): if key not in y_labels.keys(): if 'loss' in key: label = 'Loss' elif 'return' in key: label = 'Return' elif 'success' in key: label = 'Success' else: label = key y_labels.update({key: label}) if x_labels is None: x_labels = {} for key in list(self.statistic_dict.keys()): if key not in x_labels.keys(): if ('loss' in key) or ('alpha' in key) or ('entropy' in key) or ('step' in key): label = 'Optimization step' elif 'cycle' in key: label = 'Cycle' elif 'epoch' in key: label = 'Epoch' else: label = 'Episode' x_labels.update({key: label}) if keys is None: for key in list(self.statistic_dict.keys()): smoothed_plot(os.path.join(self.path, key + '.png'), self.statistic_dict[key], x_label=x_labels[key], y_label=y_labels[key], window=window) else: for key in keys: smoothed_plot(os.path.join(self.path, key + '.png'), self.statistic_dict[key], x_label=x_labels[key], y_label=y_labels[key], window=window) class Worker(Agent): def __init__(self, algo_params, queues, path=None, seed=0, i=0): self.queues = queues self.worker_id = i self.worker_update_gap = algo_params['worker_update_gap'] # in episodes self.env_step_count = 0 super(Worker, self).__init__(algo_params, path=path, seed=seed) def run(self, render=False, test=False, load_network_ep=None, sleep=0): raise NotImplementedError def _interact(self, render=False, test=False, sleep=0): raise NotImplementedError def _select_action(self, obs, test=False): raise NotImplementedError def _remember(self, batch): try: self.queues['replay_queue'].put_nowait(batch) except queue.Full: pass def _download_actor_networks(self, keys, tau=1.0): try: source = self.queues['network_queue'].get_nowait() except queue.Empty: return False print("Worker No. %i downloading network" % self.worker_id) for key in keys: self._soft_update(source[key], self.network_dict[key], tau=tau, from_params=True) return True class Learner(Agent): def __init__(self, algo_params, queues, path=None, seed=0): self.queues = queues self.num_workers = algo_params['num_workers'] self.learner_steps = algo_params['learner_steps'] self.learner_upload_gap = algo_params['learner_upload_gap'] # in optimization steps self.actor_learning_rate = algo_params['actor_learning_rate'] self.critic_learning_rate = algo_params['critic_learning_rate'] self.discard_time_limit = algo_params['discard_time_limit'] self.batch_size = algo_params['batch_size'] self.prioritised = algo_params['prioritised'] self.optimizer_steps = algo_params['optimization_steps'] self.optim_step_count = 0 super(Learner, self).__init__(algo_params, path=path, seed=seed) def run(self): raise NotImplementedError def _learn(self, steps=None): raise NotImplementedError def _upload_learner_networks(self, keys): print("Learner uploading network") params = dict.fromkeys(keys) for key in keys: params[key] = [p.data.cpu().detach().numpy() for p in self.network_dict[key].parameters()] # delete an old net and upload a new one try: data = self.queues['network_queue'].get_nowait() del data except queue.Empty: pass try: self.queues['network_queue'].put(params) except queue.Full: pass class CentralProcessor(object): def __init__(self, algo_params, env_name, env_source, learner, worker, transition_tuple=None, path=None, worker_seeds=None, seed=0): self.algo_params = algo_params.copy() self.env_name = env_name assert env_source in ['gym', 'pybullet_envs', 'pybullet_multigoal_gym'], \ "unsupported env source: {}, " \ "only 3 env sources are supported: {}, " \ "for new env sources please modify the original code".format(env_source, ['gym', 'pybullet_envs', 'pybullet_multigoal_gym']) self.env_source = importlib.import_module(env_source) self.learner = learner self.worker = worker self.batch_size = algo_params['batch_size'] self.num_workers = algo_params['num_workers'] self.learner_steps = algo_params['learner_steps'] if worker_seeds is None: worker_seeds = np.random.randint(10, 1000, size=self.num_workers).tolist() else: assert len(worker_seeds) == self.num_workers, 'should assign seeds to every worker' self.worker_seeds = worker_seeds assert path is not None, 'please specify a project path to save files' self.path = path # create a random number generator and seed it self.rng = np.random.default_rng(seed=0) # multiprocessing queues self.queues = { 'replay_queue': mp.Queue(maxsize=algo_params['replay_queue_size']), 'batch_queue': mp.Queue(maxsize=algo_params['batch_queue_size']), 'network_queue': T.multiprocessing.Queue(maxsize=self.num_workers), 'learner_step_count': mp.Value('i', 0), 'global_episode_count': mp.Value('i', 0), } # setup replay buffer # prioritised replay self.prioritised = algo_params['prioritised'] self.store_with_given_priority = algo_params['store_with_given_priority'] # non-goal-conditioned replay buffer tr = transition_tuple if transition_tuple is None: tr = t if not self.prioritised: self.buffer = ReplayBuffer(algo_params['memory_capacity'], tr, seed=seed) else: self.queues.update({ 'priority_queue': mp.Queue(maxsize=algo_params['priority_queue_size']) }) self.buffer = PrioritisedReplayBuffer(algo_params['memory_capacity'], tr, rng=self.rng) def run(self): def worker_process(i, seed): env = self.env_source.make(self.env_name) path = os.path.join(self.path, "worker_%i" % i) worker = self.worker(self.algo_params, env, self.queues, path=path, seed=seed, i=i) worker.run() self.empty_queue('replay_queue') def learner_process(): env = self.env_source.make(self.env_name) path = os.path.join(self.path, "learner") learner = self.learner(self.algo_params, env, self.queues, path=path, seed=0) learner.run() if self.prioritised: self.empty_queue('priority_queue') self.empty_queue('network_queue') def update_buffer(): while self.queues['learner_step_count'].value < self.learner_steps: num_transitions_in_queue = self.queues['replay_queue'].qsize() for n in range(num_transitions_in_queue): data = self.queues['replay_queue'].get() if self.prioritised: if self.store_with_given_priority: self.buffer.store_experience_with_given_priority(data['priority'], *data['transition']) else: self.buffer.store_experience(*data) else: self.buffer.store_experience(*data) if self.batch_size > len(self.buffer): continue if self.prioritised: try: inds, priorities = self.queues['priority_queue'].get_nowait() self.buffer.update_priority(inds, priorities) except queue.Empty: pass try: batch, weights, inds = self.buffer.sample(batch_size=self.batch_size) state, action, next_state, reward, done = batch self.queues['batch_queue'].put_nowait((state, action, next_state, reward, done, weights, inds)) except queue.Full: continue else: try: batch = self.buffer.sample(batch_size=self.batch_size) state, action, next_state, reward, done = batch self.queues['batch_queue'].put_nowait((state, action, next_state, reward, done)) except queue.Full: time.sleep(0.1) continue self.empty_queue('batch_queue') processes = [] p = T.multiprocessing.Process(target=update_buffer) processes.append(p) p = T.multiprocessing.Process(target=learner_process) processes.append(p) for i in range(self.num_workers): p = T.multiprocessing.Process(target=worker_process, args=(i, self.worker_seeds[i])) processes.append(p) for p in processes: p.start() for p in processes: p.join() def empty_queue(self, queue_name): while True: try: data = self.queues[queue_name].get_nowait() del data except queue.Empty: break self.queues[queue_name].close()
StarcoderdataPython
1785093
<reponame>binhmuc/gluon-ts<filename>test/model/naive_predictors/test_r_code_compliance_of_naive_2.py<gh_stars>1-10 # Copyright 2018 Amazon.com, Inc. or its affiliates. All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"). # You may not use this file except in compliance with the License. # A copy of the License is located at # # http://www.apache.org/licenses/LICENSE-2.0 # # or in the "license" file accompanying this file. This file is distributed # on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either # express or implied. See the License for the specific language governing # permissions and limitations under the License. # Third-party imports import numpy as np import pandas as pd import os from pathlib import Path # First-party imports from gluonts.model.naive_2 import naive_2 # DISCLAIMER: # this script is only to test whether the R implementation # of naive_2 produces the same outputs as out python implementation R_INPUT_FILE = "r_naive_2_inputs.csv" R_OUTPUT_FILE = "r_naive_2_outputs.csv" def load_naive_2_data(): test_directory_path = Path(os.getenv("PYTEST_CURRENT_TEST")).parents[0] r_naive_2_inputs = pd.read_csv(test_directory_path / R_INPUT_FILE).values r_naive_2_outputs = pd.read_csv(test_directory_path / R_OUTPUT_FILE).values return r_naive_2_inputs, r_naive_2_outputs # To generate the above dataset use the following script: # https://github.com/Mcompetitions/M4-methods/blob/master/Benchmarks%20and%20Evaluation.R # and then paste the following code in as the first line: """ set.seed(1234567) """ # an the below code at the very end: """ for (i in 1:length(data_train)){ insample <- data_train[[i]] d <- insample[1:14] v <-paste(d, collapse=", ") cat(c("[",v,"],")) } print('\n') for (i in 1:length(data_train)){ insample <- data_train[[i]] forecasts <- Benchmarks(input=insample, fh=fh) f <- forecasts[[1]][1:6] v <-paste(f, collapse=", ") cat(c("[",v,"],")) } """ # R script variables: FH = 6 # The forecasting horizon examined FRQ = 1 # The frequency of the data def test_naive_2(prediction_length=FH, season_length=FRQ): r_naive_2_inputs, r_naive_2_outputs = load_naive_2_data() predictions = [] for i in range(len(r_naive_2_inputs)): predictions.append( naive_2( r_naive_2_inputs[i], prediction_length=prediction_length, season_length=season_length, ) ) predictions = np.array(predictions) assert np.allclose(r_naive_2_outputs, predictions)
StarcoderdataPython
1772715
import pandas as pd import matplotlib.pyplot as plt import seaborn as sns mean_sigma = pd.read_csv("mean_sigma.csv") sns.set(style='ticks', context='talk') plt.rcParams['font.family'] = 'serif' plt.rcParams['font.weight'] = 'normal' plt.rcParams['legend.title_fontsize'] = 24 groups = mean_sigma.groupby("algorithm") plt.figure(figsize=(10, 8)) sns.regplot(logx=True, scatter=False, data=groups.get_group("nn"), x="sigma", y="loss", label="neural network") sns.regplot(logx=True, scatter=False, data=groups.get_group("svd"), x="sigma", y="loss", label="svd") sns.regplot(logx=True, scatter=False, data=groups.get_group("q_method"), x="sigma", y="loss", label="q-method") sns.regplot(logx=True, scatter=False, data=groups.get_group("quest"), x="sigma", y="loss", label="quest") chart = sns.regplot(logx=True, scatter=False, data=groups.get_group("esoq2"), x="sigma", y="loss", label="esoq2") chart.set_yscale("log") chart.set_xscale("log") chart.grid(True, which="both", ls="--", c='gray', alpha=0.3) chart.set_ylabel("Wahba's error (log)", fontsize=30) chart.set_xlabel("Mean measurement noise (" + r'$\sf{\bar{\sigma}}$' + ")", fontsize=30) chart.tick_params(axis='both', which='major', labelsize=24) plt.tight_layout() plt.legend(prop={"size": 20}) plt.show()
StarcoderdataPython
1689215
<reponame>CiscoSystems/networking-cisco # Copyright 2015 Cisco Systems, Inc. All rights reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); you may # not use this file except in compliance with the License. You may obtain # a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, WITHOUT # WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the # License for the specific language governing permissions and limitations # under the License. from oslo_config import cfg from oslo_utils import uuidutils from neutron import context from neutron.extensions import l3 from networking_cisco.plugins.cisco.common import cisco_constants from networking_cisco.plugins.cisco.db.l3 import ha_db from networking_cisco.plugins.cisco.extensions import ha from networking_cisco.plugins.cisco.extensions import routerhostingdevice from networking_cisco.plugins.cisco.extensions import routerrole from networking_cisco.plugins.cisco.extensions import routertype from networking_cisco.plugins.cisco.extensions import routertypeawarescheduler from networking_cisco.tests.unit.cisco.l3 import ( test_ha_l3_router_appliance_plugin as cisco_ha_test) from networking_cisco.tests.unit.cisco.l3 import ( test_l3_routertype_aware_schedulers as cisco_test_case) _uuid = uuidutils.generate_uuid EXTERNAL_GW_INFO = l3.EXTERNAL_GW_INFO AGENT_TYPE_L3_CFG = cisco_constants.AGENT_TYPE_L3_CFG ROUTER_ROLE_GLOBAL = cisco_constants.ROUTER_ROLE_GLOBAL ROUTER_ROLE_LOGICAL_GLOBAL = cisco_constants.ROUTER_ROLE_LOGICAL_GLOBAL ROUTER_ROLE_HA_REDUNDANCY = cisco_constants.ROUTER_ROLE_HA_REDUNDANCY LOGICAL_ROUTER_ROLE_NAME = cisco_constants.LOGICAL_ROUTER_ROLE_NAME ROUTER_ROLE_ATTR = routerrole.ROUTER_ROLE_ATTR HOSTING_DEVICE_ATTR = routerhostingdevice.HOSTING_DEVICE_ATTR AUTO_SCHEDULE_ATTR = routertypeawarescheduler.AUTO_SCHEDULE_ATTR class Asr1kRouterTypeDriverTestCase( cisco_test_case.L3RoutertypeAwareHostingDeviceSchedulerTestCaseBase): # Nexus router type for ASR1k driver tests, why? # - Yes(!), it does not matter and there is only one hosting device for # that router type in the test setup which makes scheduling deterministic router_type = 'Nexus_ToR_Neutron_router' def _verify_created_routers(self, router_ids, hd_id): # tenant routers q_p = '%s=None' % ROUTER_ROLE_ATTR r_ids = {r['id'] for r in self._list( 'routers', query_params=q_p)['routers']} self.assertEqual(len(r_ids), len(router_ids)) for r_id in r_ids: self.assertIn(r_id, router_ids) # global router on hosting device q_p = '%s=%s' % (ROUTER_ROLE_ATTR, ROUTER_ROLE_GLOBAL) g_rtrs = self._list('routers', query_params=q_p)['routers'] self.assertEqual(len(g_rtrs), 1) g_rtr = g_rtrs[0] self.assertEqual(g_rtr['name'].endswith( hd_id[-cisco_constants.ROLE_ID_LEN:]), True) # logical global router for global routers HA q_p = '%s=%s' % (ROUTER_ROLE_ATTR, ROUTER_ROLE_LOGICAL_GLOBAL) g_l_rtrs = self._list('routers', query_params=q_p)['routers'] self.assertEqual(len(g_l_rtrs), 1) g_l_rtr = g_l_rtrs[0] self.assertEqual(g_l_rtr['name'], LOGICAL_ROUTER_ROLE_NAME) self.assertEqual(g_l_rtr[AUTO_SCHEDULE_ATTR], False) # ensure first routers_updated notification was for global router notifier = self.plugin.agent_notifiers[AGENT_TYPE_L3_CFG] notify_call = notifier.method_calls[0] self.assertEqual(notify_call[0], 'routers_updated') updated_routers = notify_call[1][1] self.assertEqual(len(updated_routers), 1) self.assertEqual(updated_routers[0]['id'], g_rtr['id']) # ensure *no* update notifications where sent for logical global router for call in notifier.method_calls: self.assertNotIn(call[1][1][0][ROUTER_ROLE_ATTR], [ROUTER_ROLE_LOGICAL_GLOBAL]) def _test_gw_router_create_adds_global_router(self, set_context=False): tenant_id = _uuid() with self.network(tenant_id=tenant_id) as n_external: res = self._create_subnet(self.fmt, n_external['network']['id'], cidr='10.0.1.0/24', tenant_id=tenant_id) s = self.deserialize(self.fmt, res) self._set_net_external(s['subnet']['network_id']) ext_gw = {'network_id': s['subnet']['network_id']} with self.router(tenant_id=tenant_id, external_gateway_info=ext_gw, set_context=set_context) as router1: r1 = router1['router'] self.plugin._process_backlogged_routers() r1_after = self._show('routers', r1['id'])['router'] hd_id = r1_after[HOSTING_DEVICE_ATTR] # should have one global router now self._verify_created_routers({r1['id']}, hd_id) with self.router(name='router2', tenant_id=tenant_id, external_gateway_info=ext_gw, set_context=set_context) as router2: r2 = router2['router'] self.plugin._process_backlogged_routers() # should still have only one global router self._verify_created_routers({r1['id'], r2['id']}, hd_id) def test_gw_router_create_adds_global_router(self): self._test_gw_router_create_adds_global_router() def test_gw_router_create_adds_global_router_non_admin(self): self._test_gw_router_create_adds_global_router(True) def _test_router_create_adds_no_global_router(self, set_context=False): with self.router(set_context=set_context) as router: r = router['router'] self.plugin._process_backlogged_routers() # tenant routers q_p = '%s=None' % ROUTER_ROLE_ATTR t_rtrs = self._list('routers', query_params=q_p)['routers'] self.assertEqual(len(t_rtrs), 1) t_rtr = t_rtrs[0] self.assertEqual(t_rtr['id'], r['id']) # global router q_p = '%s=%s' % (ROUTER_ROLE_ATTR, ROUTER_ROLE_GLOBAL) g_rtrs = self._list('routers', query_params=q_p)['routers'] self.assertEqual(len(g_rtrs), 0) # logical global router for global routers HA q_p = '%s=%s' % (ROUTER_ROLE_ATTR, ROUTER_ROLE_LOGICAL_GLOBAL) g_l_rtrs = self._list('routers', query_params=q_p)['routers'] self.assertEqual(len(g_l_rtrs), 0) notifier = self.plugin.agent_notifiers[AGENT_TYPE_L3_CFG] # ensure *no* update notifications where sent for global # router (as there should be none) or logical global router for call in notifier.method_calls: if call[0] != 'router_deleted': self.assertNotIn(call[1][1][0][ROUTER_ROLE_ATTR], [ROUTER_ROLE_GLOBAL, ROUTER_ROLE_LOGICAL_GLOBAL]) def test_router_create_adds_no_global_router(self): self._test_router_create_adds_no_global_router() def test_router_create_adds_no_global_router_non_admin(self): self._test_router_create_adds_no_global_router(True) def _verify_updated_routers(self, router_ids, hd_id=None, call_index=1): # tenant routers q_p = '%s=None' % ROUTER_ROLE_ATTR r_ids = {r['id'] for r in self._list( 'routers', query_params=q_p)['routers']} self.assertEqual(len(r_ids), len(router_ids)) for r_id in r_ids: self.assertIn(r_id, router_ids) # global routers q_p = '%s=%s' % (ROUTER_ROLE_ATTR, ROUTER_ROLE_GLOBAL) g_rtrs = self._list('routers', query_params=q_p)['routers'] # logical global router for global routers HA q_p = '%s=%s' % (ROUTER_ROLE_ATTR, ROUTER_ROLE_LOGICAL_GLOBAL) g_l_rtrs = self._list('routers', query_params=q_p)['routers'] notifier = self.plugin.agent_notifiers[AGENT_TYPE_L3_CFG] if hd_id: self.assertEqual(len(g_rtrs), 1) g_rtr = g_rtrs[0] self.assertEqual( g_rtr['name'].endswith(hd_id[-cisco_constants.ROLE_ID_LEN:]), True) self.assertEqual(len(g_l_rtrs), 1) g_l_rtr = g_l_rtrs[0] self.assertEqual(g_l_rtr['name'], LOGICAL_ROUTER_ROLE_NAME) self.assertEqual(g_l_rtr[AUTO_SCHEDULE_ATTR], False) # routers_updated notification call_index is for global router notify_call = notifier.method_calls[call_index] self.assertEqual(notify_call[0], 'routers_updated') updated_routers = notify_call[1][1] self.assertEqual(len(updated_routers), 1) self.assertEqual(updated_routers[0]['id'], g_rtr['id']) else: self.assertEqual(len(g_rtrs), 0) self.assertEqual(len(g_l_rtrs), 0) # ensure *no* update notifications where sent for logical global router for call in notifier.method_calls: if call[0] != 'router_deleted': self.assertNotIn(call[1][1][0][ROUTER_ROLE_ATTR], [ROUTER_ROLE_LOGICAL_GLOBAL]) def _test_router_update_set_gw_adds_global_router(self, set_context=False): tenant_id = _uuid() with self.network(tenant_id=tenant_id) as n_external: res = self._create_subnet(self.fmt, n_external['network']['id'], cidr='10.0.1.0/24', tenant_id=tenant_id) s = self.deserialize(self.fmt, res) self._set_net_external(s['subnet']['network_id']) with self.router(tenant_id=tenant_id, set_context=set_context) as router1,\ self.router(name='router2', tenant_id=tenant_id, set_context=set_context) as router2: r1 = router1['router'] r2 = router2['router'] # backlog processing will trigger one routers_updated # notification containing r1 and r2 self.plugin._process_backlogged_routers() # should have no global router yet r_ids = {r1['id'], r2['id']} self._verify_updated_routers(r_ids) ext_gw = {'network_id': s['subnet']['network_id']} r_spec = {'router': {l3.EXTERNAL_GW_INFO: ext_gw}} r1_after = self._update('routers', r1['id'], r_spec)['router'] hd_id = r1_after[HOSTING_DEVICE_ATTR] # should now have one global router self._verify_updated_routers(r_ids, hd_id) self._update('routers', r2['id'], r_spec) # should still have only one global router self._verify_updated_routers(r_ids, hd_id) def test_router_update_set_gw_adds_global_router(self): self._test_router_update_set_gw_adds_global_router() def test_router_update_set_gw_adds_global_router_non_admin(self): self._test_router_update_set_gw_adds_global_router(True) def _test_router_update_unset_gw_keeps_global_router(self, set_context=False): tenant_id = _uuid() with self.network(tenant_id=tenant_id) as n_external: res = self._create_subnet(self.fmt, n_external['network']['id'], cidr='10.0.1.0/24', tenant_id=tenant_id) s = self.deserialize(self.fmt, res) self._set_net_external(s['subnet']['network_id']) ext_gw = {'network_id': s['subnet']['network_id']} with self.router(tenant_id=tenant_id, external_gateway_info=ext_gw, set_context=set_context) as router1,\ self.router(name='router2', tenant_id=tenant_id, external_gateway_info=ext_gw, set_context=set_context) as router2: r1 = router1['router'] r2 = router2['router'] # backlog processing will trigger one routers_updated # notification containing r1 and r2 self.plugin._process_backlogged_routers() r1_after = self._show('routers', r1['id'])['router'] hd_id = r1_after[HOSTING_DEVICE_ATTR] r_ids = {r1['id'], r2['id']} # should have one global router now self._verify_updated_routers(r_ids, hd_id, 0) r_spec = {'router': {l3.EXTERNAL_GW_INFO: None}} self._update('routers', r1['id'], r_spec) # should still have one global router self._verify_updated_routers(r_ids, hd_id, 0) self._update('routers', r2['id'], r_spec) # should have no global router now self._verify_updated_routers(r_ids) def test_router_update_unset_gw_keeps_global_router(self): self._test_router_update_unset_gw_keeps_global_router() def test_router_update_unset_gw_keeps_global_router_non_admin(self): self._test_router_update_unset_gw_keeps_global_router(True) def _verify_deleted_routers(self, hd_id=None, id_global_router=None): # global routers q_p = '%s=%s' % (ROUTER_ROLE_ATTR, ROUTER_ROLE_GLOBAL) g_rtrs = self._list('routers', query_params=q_p)['routers'] if hd_id: self.assertEqual(len(g_rtrs), 1) g_rtr = g_rtrs[0] self.assertEqual(g_rtr['name'].endswith( hd_id[-cisco_constants.ROLE_ID_LEN:]), True) return g_rtrs[0]['id'] else: self.assertEqual(len(g_rtrs), 0) notifier = self.plugin.agent_notifiers[AGENT_TYPE_L3_CFG] # ensure last router_deleted notification was for global router notify_call = notifier.method_calls[-1] self.assertEqual(notify_call[0], 'router_deleted') deleted_router = notify_call[1][1] self.assertEqual(deleted_router['id'], id_global_router) def _test_gw_router_delete_removes_global_router(self, set_context=False): tenant_id = _uuid() with self.network(tenant_id=tenant_id) as n_external: res = self._create_subnet(self.fmt, n_external['network']['id'], cidr='10.0.1.0/24', tenant_id=tenant_id) s = self.deserialize(self.fmt, res) self._set_net_external(s['subnet']['network_id']) ext_gw = {'network_id': s['subnet']['network_id']} with self.router(tenant_id=tenant_id, external_gateway_info=ext_gw, set_context=set_context) as router1,\ self.router(name='router2', tenant_id=tenant_id, external_gateway_info=ext_gw, set_context=set_context) as router2: r1 = router1['router'] r2 = router2['router'] self.plugin._process_backlogged_routers() r1_after = self._show('routers', r1['id'])['router'] hd_id = r1_after[HOSTING_DEVICE_ATTR] self._delete('routers', r1['id']) # should still have the global router id_global_router = self._verify_deleted_routers(hd_id) self._delete('routers', r2['id']) # should be no global router now self._verify_deleted_routers(id_global_router=id_global_router) def test_gw_router_delete_removes_global_router(self): self._test_gw_router_delete_removes_global_router() def test_gw_router_delete_removes_global_router_non_admin(self): self._test_gw_router_delete_removes_global_router(True) def _test_router_delete_removes_no_global_router(self, set_context=False): tenant_id = _uuid() with self.network(tenant_id=tenant_id) as n_external: res = self._create_subnet(self.fmt, n_external['network']['id'], cidr='10.0.1.0/24', tenant_id=tenant_id) s = self.deserialize(self.fmt, res) self._set_net_external(s['subnet']['network_id']) ext_gw = {'network_id': s['subnet']['network_id']} with self.router(tenant_id=tenant_id, set_context=set_context) as router1,\ self.router(name='router2', tenant_id=tenant_id, external_gateway_info=ext_gw, set_context=set_context) as router2: r1 = router1['router'] r2 = router2['router'] self.plugin._process_backlogged_routers() r1_after = self._show('routers', r1['id'])['router'] hd_id = r1_after[HOSTING_DEVICE_ATTR] self._delete('routers', r1['id']) # should still have the global router id_global_router = self._verify_deleted_routers(hd_id) self._delete('routers', r2['id']) # should be no global router now self._verify_deleted_routers(id_global_router=id_global_router) def test_router_delete_removes_no_global_router(self): self._test_router_delete_removes_no_global_router() def test_router_delete_removes_no_global_router_non_admin(self): self._test_router_delete_removes_no_global_router(True) class Asr1kHARouterTypeDriverTestCase( Asr1kRouterTypeDriverTestCase, cisco_ha_test.HAL3RouterTestsMixin): # For the HA tests we need more than one hosting device router_type = 'ASR1k_Neutron_router' _is_ha_tests = True def setUp(self, core_plugin=None, l3_plugin=None, dm_plugin=None, ext_mgr=None): if l3_plugin is None: l3_plugin = cisco_test_case.HA_L3_PLUGIN_KLASS if ext_mgr is None: ext_mgr = (cisco_test_case. TestHASchedulingL3RouterApplianceExtensionManager()) cfg.CONF.set_override('default_ha_redundancy_level', 1, group='ha') super(Asr1kHARouterTypeDriverTestCase, self).setUp( l3_plugin=l3_plugin, ext_mgr=ext_mgr) def _verify_ha_created_routers(self, router_ids, num_redundancy=1, has_gw=None): if has_gw is None: has_gw = [True for r_id in router_ids] temp = {} for i in range(len(router_ids)): temp[router_ids[i]] = has_gw[i] has_gw = temp # tenant HA user_visible routers q_p = '%s=None' % ROUTER_ROLE_ATTR uv_routers = self._list('routers', query_params=q_p)['routers'] uv_r_ids = {r['id'] for r in uv_routers} self.assertEqual(len(uv_r_ids), len(router_ids)) for uv_r_id in uv_r_ids: self.assertIn(uv_r_id, router_ids) # tenant HA redundancy routers q_p = '%s=%s' % (ROUTER_ROLE_ATTR, ROUTER_ROLE_HA_REDUNDANCY) rr_id_to_rr = { r['id']: r for r in self._list('routers', query_params=q_p)['routers']} all_rr_ids = rr_id_to_rr.keys() num_rr_ids = 0 hd_ids = set() for uv_r in uv_routers: uv_r_hd_id = uv_r[HOSTING_DEVICE_ATTR] if has_gw[uv_r['id']] is True: self.assertIsNotNone(uv_r[EXTERNAL_GW_INFO]) hd_ids.add(uv_r_hd_id) else: self.assertIsNone(uv_r[EXTERNAL_GW_INFO]) rr_ids = [rr_info['id'] for rr_info in uv_r[ha.DETAILS][ha.REDUNDANCY_ROUTERS]] num = len(rr_ids) num_rr_ids += num self.assertEqual(num, num_redundancy) for rr_id in rr_ids: self.assertIn(rr_id, all_rr_ids) rr = rr_id_to_rr[rr_id] rr_hd_id = rr[HOSTING_DEVICE_ATTR] # redundancy router must not be hosted on same device as its # user visible router since that defeats HA self.assertFalse(uv_r_hd_id == rr_hd_id) if has_gw[uv_r['id']] is True: self.assertIsNotNone(rr[EXTERNAL_GW_INFO]) hd_ids.add(rr_hd_id) else: self.assertIsNone(rr[EXTERNAL_GW_INFO]) self.assertEqual(num_rr_ids, len(all_rr_ids)) # we should have a global router on all hosting devices that hosts # a router (user visible or redundancy router) with gateway set q_p = '%s=%s' % (ROUTER_ROLE_ATTR, ROUTER_ROLE_GLOBAL) g_rtrs = self._list('routers', query_params=q_p)['routers'] self.assertEqual(len(g_rtrs), len(hd_ids)) g_rtr_ids = set() for g_rtr in g_rtrs: self.assertIn(g_rtr[HOSTING_DEVICE_ATTR], hd_ids) g_rtr_ids.add(g_rtr['id']) # logical global router for global routers HA q_p = '%s=%s' % (ROUTER_ROLE_ATTR, ROUTER_ROLE_LOGICAL_GLOBAL) g_l_rtrs = self._list('routers', query_params=q_p)['routers'] if g_l_rtrs: self.assertEqual(len(g_l_rtrs), 1) g_l_rtr = g_l_rtrs[0] self.assertEqual(g_l_rtr['name'], LOGICAL_ROUTER_ROLE_NAME) self.assertEqual(g_l_rtr[AUTO_SCHEDULE_ATTR], False) else: self.assertEqual(len(g_l_rtrs), 0) notifier = self.plugin.agent_notifiers[AGENT_TYPE_L3_CFG] if g_l_rtrs: # ensure first routers_updated notifications were # for global routers for i in range(len(hd_ids)): notify_call = notifier.method_calls[i] self.assertEqual(notify_call[0], 'routers_updated') updated_routers = notify_call[1][1] self.assertEqual(len(updated_routers), 1) self.assertIn(updated_routers[0]['id'], g_rtr_ids) g_rtr_ids.remove(updated_routers[0]['id']) else: # ensure *no* update notifications where sent for global routers for call in notifier.method_calls: self.assertNotIn(call[1][1][0][ROUTER_ROLE_ATTR], [ROUTER_ROLE_GLOBAL]) # ensure *no* update notifications where sent for logical global router for call in notifier.method_calls: self.assertNotIn(call[1][1][0][ROUTER_ROLE_ATTR], [ROUTER_ROLE_LOGICAL_GLOBAL]) def _test_gw_router_create_adds_global_router(self, set_context=False): tenant_id = _uuid() with self.network(tenant_id=tenant_id) as n_external: res = self._create_subnet(self.fmt, n_external['network']['id'], cidr='10.0.1.0/24', tenant_id=tenant_id) s = self.deserialize(self.fmt, res) self._set_net_external(s['subnet']['network_id']) ext_gw = {'network_id': s['subnet']['network_id']} with self.router(tenant_id=tenant_id, external_gateway_info=ext_gw, set_context=set_context) as router1: r = router1['router'] self.plugin._process_backlogged_routers() # should now have one user-visible router, its single # redundancy router and two global routers (one for each of # the hosting devices of the aforementioned routers) self._verify_ha_created_routers([r['id']]) def _test_router_create_adds_no_global_router(self, set_context=False): with self.router(set_context=set_context) as router: r = router['router'] self.plugin._process_backlogged_routers() self._verify_ha_created_routers([r['id']], 1, has_gw=[False]) def _verify_ha_updated_router(self, router_id, hd_ids=None, call_index=1, num_redundancy=1, has_gw=True): # ids of hosting devices hosting routers with gateway set hd_ids = hd_ids or set() if router_id: # tenant router uv_r = self._show('routers', router_id)['router'] uv_r_hd_id = uv_r[HOSTING_DEVICE_ATTR] if has_gw is True: self.assertIsNotNone(uv_r[EXTERNAL_GW_INFO]) hd_ids.add(uv_r_hd_id) else: self.assertIsNone(uv_r[EXTERNAL_GW_INFO]) rr_ids = [rr_info['id'] for rr_info in uv_r[ha.DETAILS][ha.REDUNDANCY_ROUTERS]] # tenant HA redundancy routers q_p = '%s=%s' % (ROUTER_ROLE_ATTR, ROUTER_ROLE_HA_REDUNDANCY) rr_id_to_rr = { r['id']: r for r in self._list('routers', query_params=q_p)['routers']} all_rr_ids = rr_id_to_rr.keys() self.assertEqual(len(rr_ids), num_redundancy) for rr_id in rr_ids: self.assertIn(rr_id, all_rr_ids) rr = rr_id_to_rr[rr_id] rr_hd_id = rr[HOSTING_DEVICE_ATTR] # redundancy router must not be hosted on same device as its # user visible router since that defeats HA self.assertFalse(uv_r_hd_id == rr_hd_id) if has_gw is True: self.assertIsNotNone(rr[EXTERNAL_GW_INFO]) hd_ids.add(rr_hd_id) else: self.assertIsNone(rr[EXTERNAL_GW_INFO]) # we should have a global router on all hosting devices that hosts # a router (user visible or redundancy router) with gateway set num_devices_hosting_gateway_routers = len(hd_ids) q_p = '%s=%s' % (ROUTER_ROLE_ATTR, ROUTER_ROLE_GLOBAL) g_rtrs = self._list('routers', query_params=q_p)['routers'] self.assertEqual(len(g_rtrs), num_devices_hosting_gateway_routers) g_rtr_ids = set() for g_rtr in g_rtrs: self.assertIn(g_rtr[HOSTING_DEVICE_ATTR], hd_ids) g_rtr_ids.add(g_rtr['id']) # logical global router for global routers HA q_p = '%s=%s' % (ROUTER_ROLE_ATTR, ROUTER_ROLE_LOGICAL_GLOBAL) g_l_rtrs = self._list('routers', query_params=q_p)['routers'] if num_devices_hosting_gateway_routers > 0: self.assertEqual(len(g_l_rtrs), 1) g_l_rtr = g_l_rtrs[0] self.assertEqual(g_l_rtr['name'], LOGICAL_ROUTER_ROLE_NAME) self.assertEqual(g_l_rtr[AUTO_SCHEDULE_ATTR], False) else: self.assertEqual(len(g_l_rtrs), 0) # global routers notifier = self.plugin.agent_notifiers[AGENT_TYPE_L3_CFG] # routers_updated notification call_index is for global router notify_call = notifier.method_calls[call_index] self.assertEqual(notify_call[0], 'routers_updated') updated_routers = notify_call[1][1] self.assertEqual(len(updated_routers), 1) self.assertEqual(updated_routers[0][ROUTER_ROLE_ATTR], ROUTER_ROLE_GLOBAL) # ensure *no* update notifications where sent for logical global router for call in notifier.method_calls: if call[0] != 'router_deleted': self.assertNotIn(call[1][1][0][ROUTER_ROLE_ATTR], [ROUTER_ROLE_LOGICAL_GLOBAL]) return hd_ids def _test_router_update_set_gw_adds_global_router(self, set_context=False): tenant_id = _uuid() with self.network(tenant_id=tenant_id) as n_external: res = self._create_subnet(self.fmt, n_external['network']['id'], cidr='10.0.1.0/24', tenant_id=tenant_id) s = self.deserialize(self.fmt, res) self._set_net_external(s['subnet']['network_id']) with self.router(tenant_id=tenant_id, set_context=set_context) as router1,\ self.router(name='router2', tenant_id=tenant_id, set_context=set_context) as router2: r1 = router1['router'] r2 = router2['router'] # backlog processing to schedule the routers self.plugin._process_backlogged_routers() # should have no global router yet r_ids = [r1['id'], r2['id']] self._verify_ha_created_routers(r_ids, 1, has_gw=[False, False]) ext_gw = {'network_id': s['subnet']['network_id']} r_spec = {'router': {l3.EXTERNAL_GW_INFO: ext_gw}} self._update('routers', r1['id'], r_spec) # should now have two global routers, one for hosting device # of user visible router r1 and one for the hosting device r1's # redundancy router hd_ids = self._verify_ha_updated_router(r1['id']) self._update('routers', r2['id'], r_spec) self._verify_ha_updated_router(r2['id'], hd_ids) def _test_router_update_unset_gw_keeps_global_router(self, set_context=False): tenant_id = _uuid() with self.network(tenant_id=tenant_id) as n_external: res = self._create_subnet(self.fmt, n_external['network']['id'], cidr='10.0.1.0/24', tenant_id=tenant_id) s = self.deserialize(self.fmt, res) self._set_net_external(s['subnet']['network_id']) ext_gw = {'network_id': s['subnet']['network_id']} with self.router(tenant_id=tenant_id, external_gateway_info=ext_gw, set_context=set_context) as router1,\ self.router(name='router2', tenant_id=tenant_id, external_gateway_info=ext_gw, set_context=set_context) as router2: r1 = router1['router'] r2 = router2['router'] # make sure we have only two eligible hosting devices # in this test qp = "template_id=00000000-0000-0000-0000-000000000005" hds = self._list('hosting_devices', query_params=qp) self._delete('hosting_devices', hds['hosting_devices'][1]['id']) # backlog processing to schedule the routers self.plugin._process_backlogged_routers() self._verify_ha_created_routers([r1['id'], r2['id']]) r_spec = {'router': {l3.EXTERNAL_GW_INFO: None}} self._update('routers', r1['id'], r_spec) # should still have two global routers, we verify using r2 self._verify_ha_updated_router(r2['id']) self._update('routers', r2['id'], r_spec) # should have no global routers now, we verify using r1 self._verify_ha_updated_router(r2['id'], has_gw=False) def _test_gw_router_delete_removes_global_router(self, set_context=False): tenant_id = _uuid() with self.network(tenant_id=tenant_id) as n_external: res = self._create_subnet(self.fmt, n_external['network']['id'], cidr='10.0.1.0/24', tenant_id=tenant_id) s = self.deserialize(self.fmt, res) self._set_net_external(s['subnet']['network_id']) ext_gw = {'network_id': s['subnet']['network_id']} with self.router(tenant_id=tenant_id, external_gateway_info=ext_gw, set_context=set_context) as router1,\ self.router(name='router2', tenant_id=tenant_id, external_gateway_info=ext_gw, set_context=set_context) as router2: r1 = router1['router'] r2 = router2['router'] # make sure we have only two eligible hosting devices # in this test qp = "template_id=00000000-0000-0000-0000-000000000005" hds = self._list('hosting_devices', query_params=qp) self._delete('hosting_devices', hds['hosting_devices'][1]['id']) # backlog processing to schedule the routers self.plugin._process_backlogged_routers() self._verify_ha_created_routers([r1['id'], r2['id']]) self._delete('routers', r1['id']) # should still have two global routers, we verify using r2 self._verify_ha_updated_router(r2['id']) self._delete('routers', r2['id']) # should have no global routers now self._verify_ha_updated_router(None) def _test_router_delete_removes_no_global_router(self, set_context=False): tenant_id = _uuid() with self.network(tenant_id=tenant_id) as n_external: res = self._create_subnet(self.fmt, n_external['network']['id'], cidr='10.0.1.0/24', tenant_id=tenant_id) s = self.deserialize(self.fmt, res) self._set_net_external(s['subnet']['network_id']) ext_gw = {'network_id': s['subnet']['network_id']} with self.router(tenant_id=tenant_id, set_context=set_context) as router1,\ self.router(name='router2', tenant_id=tenant_id, external_gateway_info=ext_gw, set_context=set_context) as router2: r1 = router1['router'] r2 = router2['router'] # make sure we have only two eligible hosting devices # in this test qp = "template_id=00000000-0000-0000-0000-000000000005" hds = self._list('hosting_devices', query_params=qp) self._delete('hosting_devices', hds['hosting_devices'][1]['id']) self.plugin._process_backlogged_routers() self._verify_ha_created_routers([r1['id'], r2['id']], has_gw=[False, True]) self._delete('routers', r1['id']) # should still have two global routers, we verify using r2 self._verify_ha_updated_router(r2['id']) self._delete('routers', r2['id']) # should have no global routers now self._verify_ha_updated_router(None) class L3CfgAgentAsr1kRouterTypeDriverTestCase( cisco_test_case.L3RoutertypeAwareHostingDeviceSchedulerTestCaseBase, cisco_ha_test.HAL3RouterTestsMixin): _is_ha_tests = True def setUp(self, core_plugin=None, l3_plugin=None, dm_plugin=None, ext_mgr=None): if l3_plugin is None: l3_plugin = cisco_test_case.HA_L3_PLUGIN_KLASS if ext_mgr is None: ext_mgr = (cisco_test_case. TestHASchedulingL3RouterApplianceExtensionManager()) cfg.CONF.set_override('default_ha_redundancy_level', 1, group='ha') super(L3CfgAgentAsr1kRouterTypeDriverTestCase, self).setUp( l3_plugin=l3_plugin, ext_mgr=ext_mgr) self.orig_get_sync_data = self.plugin.get_sync_data self.plugin.get_sync_data = self.plugin.get_sync_data_ext def tearDown(self): self.plugin.get_sync_data = self.orig_get_sync_data super(L3CfgAgentAsr1kRouterTypeDriverTestCase, self).tearDown() def _verify_sync_data(self, context, ids_colocated_routers, g_l_rtr, g_l_rtr_rr_ids, ha_settings): routers = self.plugin.get_sync_data_ext(context, ids_colocated_routers) self.assertEqual(len(routers), 2) global_router = [r for r in routers if r[ROUTER_ROLE_ATTR] == ROUTER_ROLE_GLOBAL][0] # verify that global router has HA information from logical # global router, in particular VIP address for the gw port # comes from the gw port of the logical global router ha_info = global_router['gw_port']['ha_info'] ha_port_id = ha_info['ha_port']['id'] vip_address = g_l_rtr[l3.EXTERNAL_GW_INFO][ 'external_fixed_ips'][0]['ip_address'] self.assertEqual( ha_info['ha_port']['fixed_ips'][0]['ip_address'], vip_address) self.assertEqual(global_router['gw_port_id'] == ha_port_id, False) self._verify_ha_settings(global_router, ha_settings) rr_info_list = global_router[ha.DETAILS][ha.REDUNDANCY_ROUTERS] self.assertEqual(len(rr_info_list), len(g_l_rtr_rr_ids)) for rr_info in rr_info_list: self.assertIn(rr_info['id'], g_l_rtr_rr_ids) def test_l3_cfg_agent_query_global_router_info(self): with self.subnet(cidr='10.0.1.0/24') as s_ext: self._set_net_external(s_ext['subnet']['network_id']) ext_gw = {'network_id': s_ext['subnet']['network_id']} with self.router(external_gateway_info=ext_gw) as router: r = router['router'] self.plugin._process_backlogged_routers() r_after = self._show('routers', r['id'])['router'] hd_id = r_after[HOSTING_DEVICE_ATTR] id_r_ha_backup = r_after[ha.DETAILS][ ha.REDUNDANCY_ROUTERS][0]['id'] r_ha_backup_after = self._show('routers', id_r_ha_backup)['router'] ha_backup_hd_id = r_ha_backup_after[HOSTING_DEVICE_ATTR] # logical global router for global routers HA q_p = '%s=%s' % (ROUTER_ROLE_ATTR, ROUTER_ROLE_LOGICAL_GLOBAL) g_l_rtrs = self._list('routers', query_params=q_p)['routers'] # should be only one logical global router self.assertEqual(len(g_l_rtrs), 1) g_l_rtr = g_l_rtrs[0] g_l_rtr_rr_ids = {r_info['id'] for r_info in g_l_rtr[ ha.DETAILS][ha.REDUNDANCY_ROUTERS]} self.assertEqual(g_l_rtr[ha.ENABLED], True) self.assertEqual(g_l_rtr[routertype.TYPE_ATTR], r[routertype.TYPE_ATTR]) # no auto-scheduling to ensure logical global router is never # instantiated (unless an admin does some bad thing...) self.assertEqual(g_l_rtr[AUTO_SCHEDULE_ATTR], False) # global router on hosting devices q_p = '%s=%s' % (ROUTER_ROLE_ATTR, ROUTER_ROLE_GLOBAL) g_rtrs = {g_r[HOSTING_DEVICE_ATTR]: g_r for g_r in self._list( 'routers', query_params=q_p)['routers']} self.assertEqual(len(g_rtrs), 2) for g_r in g_rtrs.values(): self.assertEqual(g_r[routertype.TYPE_ATTR], r[routertype.TYPE_ATTR]) # global routers should have HA disabled in db self.assertEqual(g_r[ha.ENABLED], False) # global routers should never be auto-scheduled as that # can result in them being moved to another hosting device self.assertEqual(g_r[AUTO_SCHEDULE_ATTR], False) # global router should be redundancy router of the logical # global router for this router type self.assertIn(g_r['id'], g_l_rtr_rr_ids) e_context = context.get_admin_context() # global routers should here have HA setup information from # the logical global router ha_settings = self._get_ha_defaults( ha_type=cfg.CONF.ha.default_ha_mechanism, redundancy_level=2, priority=ha_db.DEFAULT_MASTER_PRIORITY) # verify global router co-located with the user visible router ids_colocated_routers = [r['id'], g_rtrs[hd_id]['id']] self._verify_sync_data(e_context, ids_colocated_routers, g_l_rtr, g_l_rtr_rr_ids, ha_settings) # verify global router co.located with the ha backup # router of the user visible router ids_colocated_routers = [r_ha_backup_after['id'], g_rtrs[ha_backup_hd_id]['id']] self._verify_sync_data(e_context, ids_colocated_routers, g_l_rtr, g_l_rtr_rr_ids, ha_settings)
StarcoderdataPython
3339183
<filename>core/migrations/0019_auto_20181106_2345.py # Generated by Django 2.1.3 on 2018-11-06 10:45 from django.db import migrations, models class Migration(migrations.Migration): dependencies = [ ('core', '0018_auto_20181106_2343'), ] operations = [ migrations.AddField( model_name='staff', name='nfc_dev_id', field=models.CharField(default='00 00 00 00', max_length=254), ), migrations.AddField( model_name='staff', name='password', field=models.CharField(max_length=254, null=True), ), ]
StarcoderdataPython
1778050
<filename>exercicio 031.py<gh_stars>1-10 #Desenvolva um programa que pergunte a distância de uma viagem em km. #Calcule o preço da passagem, cobrando R$0,50 por km rodado para viagens #de até 200km e R$0,45 para viagens mais longas. dist = float(input('Qual a distancia em km a percorrer? ')) d1 = dist * 0.50 if dist <= 200: print('O valor da passagem será R$ {}'.format(d1)) else: print('O valor da passagem será R${}'.format(dist*0.45))
StarcoderdataPython
905
from typing import Dict, Optional, List, Any import torch import torch.nn.functional as F from allennlp.data import Vocabulary from allennlp.models.model import Model from allennlp.modules import FeedForward, TextFieldEmbedder, Seq2SeqEncoder from allennlp.nn import InitializerApplicator, RegularizerApplicator from allennlp.nn import util from allennlp.training.metrics import CategoricalAccuracy, F1Measure from overrides import overrides @Model.register("text_classifier") class TextClassifier(Model): """ Implements a basic text classifier: 1) Embed tokens using `text_field_embedder` 2) Seq2SeqEncoder, e.g. BiLSTM 3) Append the first and last encoder states 4) Final feedforward layer Optimized with CrossEntropyLoss. Evaluated with CategoricalAccuracy & F1. """ def __init__(self, vocab: Vocabulary, text_field_embedder: TextFieldEmbedder, text_encoder: Seq2SeqEncoder, classifier_feedforward: FeedForward, verbose_metrics: False, initializer: InitializerApplicator = InitializerApplicator(), regularizer: Optional[RegularizerApplicator] = None, ) -> None: super(TextClassifier, self).__init__(vocab, regularizer) self.text_field_embedder = text_field_embedder self.num_classes = self.vocab.get_vocab_size("labels") self.text_encoder = text_encoder self.classifier_feedforward = classifier_feedforward self.prediction_layer = torch.nn.Linear(self.classifier_feedforward.get_output_dim() , self.num_classes) self.label_accuracy = CategoricalAccuracy() self.label_f1_metrics = {} self.verbose_metrics = verbose_metrics for i in range(self.num_classes): self.label_f1_metrics[vocab.get_token_from_index(index=i, namespace="labels")] = F1Measure(positive_label=i) self.loss = torch.nn.CrossEntropyLoss() self.pool = lambda text, mask: util.get_final_encoder_states(text, mask, bidirectional=True) initializer(self) @overrides def forward(self, text: Dict[str, torch.LongTensor], label: torch.IntTensor = None, metadata: List[Dict[str, Any]] = None) -> Dict[str, torch.Tensor]: """ Parameters ---------- text : Dict[str, torch.LongTensor] From a ``TextField`` label : torch.IntTensor, optional (default = None) From a ``LabelField`` metadata : ``List[Dict[str, Any]]``, optional, (default = None) Metadata containing the original tokenization of the premise and hypothesis with 'premise_tokens' and 'hypothesis_tokens' keys respectively. Returns ------- An output dictionary consisting of: label_logits : torch.FloatTensor A tensor of shape ``(batch_size, num_labels)`` representing unnormalised log probabilities of the label. label_probs : torch.FloatTensor A tensor of shape ``(batch_size, num_labels)`` representing probabilities of the label. loss : torch.FloatTensor, optional A scalar loss to be optimised. """ embedded_text = self.text_field_embedder(text) mask = util.get_text_field_mask(text) encoded_text = self.text_encoder(embedded_text, mask) pooled = self.pool(encoded_text, mask) ff_hidden = self.classifier_feedforward(pooled) logits = self.prediction_layer(ff_hidden) class_probs = F.softmax(logits, dim=1) output_dict = {"logits": logits} if label is not None: loss = self.loss(logits, label) output_dict["loss"] = loss # compute F1 per label for i in range(self.num_classes): metric = self.label_f1_metrics[self.vocab.get_token_from_index(index=i, namespace="labels")] metric(class_probs, label) self.label_accuracy(logits, label) return output_dict @overrides def decode(self, output_dict: Dict[str, torch.Tensor]) -> Dict[str, torch.Tensor]: class_probabilities = F.softmax(output_dict['logits'], dim=-1) output_dict['class_probs'] = class_probabilities return output_dict def get_metrics(self, reset: bool = False) -> Dict[str, float]: metric_dict = {} sum_f1 = 0.0 for name, metric in self.label_f1_metrics.items(): metric_val = metric.get_metric(reset) if self.verbose_metrics: metric_dict[name + '_P'] = metric_val[0] metric_dict[name + '_R'] = metric_val[1] metric_dict[name + '_F1'] = metric_val[2] sum_f1 += metric_val[2] names = list(self.label_f1_metrics.keys()) total_len = len(names) average_f1 = sum_f1 / total_len metric_dict['average_F1'] = average_f1 metric_dict['accuracy'] = self.label_accuracy.get_metric(reset) return metric_dict
StarcoderdataPython
80644
import json import os import time import urllib.parse import urllib.request import pandas as pd import pathlib #ルートディレクトリの設定(dataディレクトリ ) root_dir = pathlib.Path(__file__).parent.parent #都道府県一覧の取得 c = os.path.join(root_dir, 'codes/preflist.json') with open(c) as j: prefList = json.load(j) #市区町村一覧の取得 c = os.path.join(root_dir, 'codes/citylist.json') with open(c) as j: cityList = json.load(j) #環境変数からESRAT-APPIDを取得 from dotenv import load_dotenv load_dotenv() ESTAT_APPID = os.getenv('ESTAT_APPID') #estatAPIのパラメータセット(都道府県) def setEstatParams(params,type): #appIdの設定 p = {'appId':ESTAT_APPID} # params['appId']=ESTAT_APPID #cdAreaの設定 if type == 'prefecture' or type == 'prefectureRank': prefCodes = [d.get('prefCode') for d in prefList['result']] prefCodesStr = [f'{n:02}'+'000' for n in prefCodes] # print(prefCodesStr) p['cdArea'] = ','.join(prefCodesStr) if type == 'city' or type == 'cityRank': cityCodes = [d.get('cityCode') for d in cityList['result']] p['cdArea'] = ','.join(cityCodes) # print(cityCodes) #statsDataIdの設定 p['statsDataId'] = params['statsDataId'] if('cdCat01' in params): p['cdCat01'] = ','.join([d for d in params['cdCat01']]) return p #estatAPIのレスポンス取得 def getEstatAPIResponse(params): # print(params) url = 'http://api.e-stat.go.jp/rest/2.1/app/json/getStatsData?' url += urllib.parse.urlencode(params) # print(url) with urllib.request.urlopen(url) as response: return json.loads(response.read().decode()) def saveJson(data,downloadPath,**kwargs): print('...Saving ' + downloadPath) with open(downloadPath, 'w') as f: json.dump(data, f, **kwargs)
StarcoderdataPython
123845
import requests import os import json import pandas as pd os.chdir("D:\\SynologyDrive\Programming\AlpacaTradingBot") endpoint = "https://paper-api.alpaca.markets" headers = json.loads(open("key.txt", 'r').read()) # https://alpaca.markets/docs/api-documentation/api-v2/orders/ def market_order(symbol, quantity, side="buy", tif="day"): order_url = endpoint + "/v2/orders" params = {"symbol" : symbol, "qty" : quantity, # Number of shares to trade "side" : side, # 'buy' or 'sell' "type" : "market", # 'market', 'limit', 'stop', 'stop_limit', 'trailing_stop' "time_in_force" : tif # 'day', 'gtc', 'opg', 'cls', 'ioc' or 'fok' } r = requests.post(order_url, headers=headers, json=params) return r.json() def limit_order(symbol, quantity, limit_price, side="buy", tif="day"): order_url = endpoint + "/v2/orders" params = {"symbol" : symbol, "qty" : quantity, # Number of shares to trade "side" : side, # 'buy' or 'sell' "type" : "limit", # 'market', 'limit', 'stop', 'stop_limit', 'trailing_stop' "limit_price" : limit_price, # price to go in "time_in_force" : tif # 'day', 'gtc', 'opg', 'cls', 'ioc' or 'fok' } r = requests.post(order_url, headers=headers, json=params) return r.json() def stop_order(symbol, quantity, stop_price, side="buy", tif="day"): order_url = endpoint + "/v2/orders" params = {"symbol" : symbol, "qty" : quantity, # Number of shares to trade "side" : side, # 'buy' or 'sell' "type" : "stop", # 'market', 'limit', 'stop', 'stop_limit', 'trailing_stop' "stop_price" : stop_price, "time_in_force" : tif # 'day', 'gtc', 'opg', 'cls', 'ioc' or 'fok' } r = requests.post(order_url, headers=headers, json=params) return r.json() def stop_limit_order(symbol, quantity, stop_price, limit_price, side="buy", tif="day"): order_url = endpoint + "/v2/orders" params = {"symbol" : symbol, "qty" : quantity, # Number of shares to trade "side" : side, # 'buy' or 'sell' "type" : "stop_limit", # 'market', 'limit', 'stop', 'stop_limit', 'trailing_stop' "stop_price" : stop_price, "limit_price" : limit_price, "time_in_force" : tif # 'day', 'gtc', 'opg', 'cls', 'ioc' or 'fok' } r = requests.post(order_url, headers=headers, json=params) return r.json() def trail_stop_order(symbol, quantity, trail_price, side="buy", tif="day"): order_url = endpoint + "/v2/orders" params = {"symbol" : symbol, "qty" : quantity, # Number of shares to trade "side" : side, # 'buy' or 'sell' "type" : "trailing_stop", # 'market', 'limit', 'stop', 'stop_limit', 'trailing_stop' "trail_price" : trail_price, "time_in_force" : tif # 'day', 'gtc', 'opg', 'cls', 'ioc' or 'fok' } r = requests.post(order_url, headers=headers, json=params) return r.json() def bracket_order(symbol, quantity, tp_limit_price, sl_stop_price, sl_limit_price, side="buy", tif="day"): order_url = endpoint + "/v2/orders" params = {"symbol" : symbol, "qty" : quantity, # Number of shares to trade "side" : side, # 'buy' or 'sell' "type" : "market", # 'market', 'limit', 'stop', 'stop_limit', 'trailing_stop' "time_in_force" : tif, # 'day', 'gtc', 'opg', 'cls', 'ioc' or 'fok' "order_class" : "bracket", "take_profit" : {"limit_price": tp_limit_price}, "stop_loss" : {"stop_price" : sl_stop_price, "limit_price": sl_limit_price } } r = requests.post(order_url, headers=headers, json=params) return r.json() def order_list(status="open", limit=50): """ Retrieves a list of orders for the account, filtered by the supplied query parameters. """ order_list_url = endpoint + "/v2/orders" params = {"status": status} r = requests.get(order_list_url, headers=headers, params=params) data = r.json() return pd.DataFrame(data) def order_cancel(order_id=""): if len(order_id) > 1: # Cancel specific order order_cancel_url = endpoint + "/v2/orders/{}".format(order_id) else: # Cancel all order order_cancel_url = endpoint + "/v2/orders" r = requests.delete(order_cancel_url, headers=headers) return r.json() # order_df = order_list() # order_cancel(order_df[order_df["symbol"]=="CSCO"]["id"].to_list()[0]) def order_replace(order_id, params): order_cancel_url = endpoint + "/v2/orders/{}".format(order_id) r = requests.patch(order_cancel_url, headers=headers, json=params) return r.json() # order_replace(order_df[order_df["symbol"]=="CSCO"]["id"].to_list()[0], # {"qty": 10, "trail": 3})
StarcoderdataPython
3218919
# Generated by Django 3.2.7 on 2021-10-08 02:06 from django.conf import settings from django.db import migrations, models import django.db.models.deletion class Migration(migrations.Migration): dependencies = [ migrations.swappable_dependency(settings.AUTH_USER_MODEL), ('cryptkeeper', '0002_auto_20211008_0156'), ] operations = [ migrations.CreateModel( name='Transaction', fields=[ ('id', models.BigAutoField(auto_created=True, primary_key=True, serialize=False, verbose_name='ID')), ('transaction_type', models.CharField(choices=[('Buy', 'Buy'), ('Sell', 'Sell')], max_length=4)), ('asset_symbol', models.CharField(max_length=50)), ('usd_price_of_asset', models.DecimalField(decimal_places=8, max_digits=19)), ('datetime_of_transaction', models.DateTimeField()), ('quantity_of_transaction', models.DecimalField(decimal_places=8, max_digits=19)), ('user', models.ForeignKey(on_delete=django.db.models.deletion.CASCADE, to=settings.AUTH_USER_MODEL)), ], ), migrations.RemoveField( model_name='selltransaction', name='user', ), migrations.DeleteModel( name='BuyTransaction', ), migrations.DeleteModel( name='SellTransaction', ), ]
StarcoderdataPython
32581
<gh_stars>0 import numpy as np from collections import deque QLEN = 8 class Line(object): """ from #2.Tips and Tricks for the Project """ def __init__(self, yp=None, xp=None): self.ym_per_pix = yp self.xm_per_pix = xp # self.frame_shape = fs # was the line detected in the last iteration? self.detected = False # --- self.left_fitx & self.right_fitx # x values of the last n fits of the line # self.recent_xfitted = [] self.recent_xfitted = deque(maxlen=QLEN) #average x values of the fitted line over the last n iterations self.bestx = None # --- using polyfit self.lfit & self.rfit #polynomial coefficients averaged over the last n iterations self.best_fit = None self.best_fitQ = deque(maxlen=QLEN) #difference in fit coefficients between last and new fits self.diffs = np.array([0,0,0], dtype='float') self.diffs_prev = np.array([0,0,0], dtype='float') # --- values for a given frame, may not be used ---- # --- polyfit self.lfit & self.rfit #polynomial coefficients for the most recent fit self.current_fit = [np.array([False])] #radius of curvature of the line in some units self.radius_of_curvature = None # m #distance in meters of line from edge self.line_base_pos = None # --- leftx ? #x values for detected line pixels self.allx = None # --- lefty ? #y values for detected line pixels self.ally = None self.line_fitx = None # --- def add_all_pixels(self, ax, ay, warp_shape): self.allx = ax self.ally = ay # print("add_all_pixels-shape:{}".format(warp_shape)) if ((len(self.ally) == 0) or (len(self.allx) == 0)): self.detected = False else: self._fit_line_polynomial(warp_shape) def use_starting_values(self): """ Starting values are used for the first frame and to realign the values when a detected position goes off track """ self.detected = True self.recent_xfitted.append(self.line_fitx) self.bestx = self.line_fitx self.best_fit = self.current_fit self.best_fitQ.append(self.current_fit) # print("use_starting_values-best_fit:{}".format(self.best_fit)) def use_staged_values(self): """ Staged values are typically used for most frames. It takes the 'temporary' values calculated by _fit_line_polynomial() and updates the line deque's and the averaged values. """ # self.detected = True # self.detected = True self.recent_xfitted.append(self.line_fitx) if (len(self.recent_xfitted)> QLEN): self.recent_xfitted.popleft() # self.bestx = self.line_fitx self.bestx = np.mean(self.recent_xfitted, axis=0) self.best_fitQ.append(self.current_fit) if (len(self.best_fitQ)> QLEN): self.best_fitQ.popleft() self.best_fit = np.mean(self.best_fitQ, axis=0) # print("\n{:.2f}:current_fit:{}".format(self.line_base_pos, self.current_fit)) # print("{:.2f}:best_fit:{}".format(self.line_base_pos, self.best_fit)) a = self.best_fitQ[0] b = self.best_fitQ[-1] self.diff = np.polysub(a, b) self.diffs_prev = np.polysub(self.best_fitQ[-2], self.current_fit) # print("{:.2f}:diff:{}".format(self.line_base_pos, self.diff)) # print("len:{}".format(len(self.best_fitQ))) def discard_staged_values(self): self.detected = False def _fit_line_polynomial(self, frame_shape): """ from lesson 9.4 Combined the polyfit(), lines, curves and other calculations into this single method as all the necessary data was right here. """ # --- coefficients of line line_fit = np.polyfit(self.ally, self.allx, 2) _ploty = np.linspace(0, frame_shape[0]-1, frame_shape[0]) try: # x points of line line_fitx = line_fit[0]*_ploty**2 + line_fit[1]*_ploty + line_fit[2] x_intercept = line_fit[0]*frame_shape[0]**2 + line_fit[1]*frame_shape[0] + line_fit[2] except TypeError: line_fitx = 1*_ploty**2 + 1*_ploty x_intercept = 0 # --- curvature recalculate to convert from pixels to meters-- y_eval = np.max(_ploty)*self.ym_per_pix # convert from p to m line_fit_m = np.polyfit((self.ally*self.ym_per_pix), (self.allx*self.xm_per_pix), 2) # convert from p to m radius_curve = (np.sqrt (np.power((1+((2*line_fit_m[0]*y_eval)+(line_fit_m[1] ))**2), 3))) / abs(2*((line_fit_m[0]))) self.line_base_pos = x_intercept * self.xm_per_pix # np.max(line_fitx) # abs(((frame_shape[1]/2)-(np.max(line_fitx)))) * self.xm_per_pix self.current_fit = line_fit self.radius_of_curvature = radius_curve # (radius_curve * self.ym_per_pix) self.line_fitx = line_fitx
StarcoderdataPython
3336061
import pytest from distributed.protocol import serialize, deserialize import pandas as pd import numpy as np @pytest.mark.parametrize("collection", [tuple, dict, list]) @pytest.mark.parametrize( "y,y_serializer", [ (np.arange(50), "dask"), (pd.DataFrame({"C": ["a", "b", None], "D": [2.5, 3.5, 4.5]}), "pickle"), (None, "pickle"), ], ) def test_serialize_collection(collection, y, y_serializer): x = np.arange(100) if issubclass(collection, dict): header, frames = serialize({"x": x, "y": y}, serializers=("dask", "pickle")) else: header, frames = serialize(collection((x, y)), serializers=("dask", "pickle")) t = deserialize(header, frames, deserializers=("dask", "pickle", "error")) assert isinstance(t, collection) assert header["is-collection"] is True sub_headers = header["sub-headers"] if collection is not dict: assert sub_headers[0]["serializer"] == "dask" assert sub_headers[1]["serializer"] == y_serializer if collection is dict: assert (t["x"] == x).all() assert str(t["y"]) == str(y) else: assert (t[0] == x).all() assert str(t[1]) == str(y) def test_large_collections_serialize_simply(): header, frames = serialize(tuple(range(1000))) assert len(frames) == 1 def test_nested_types(): x = np.ones(5) header, frames = serialize([[[x]]]) assert "dask" in str(header) assert len(frames) == 1 assert x.data in frames
StarcoderdataPython
3381642
from django.apps import AppConfig default_app_config = 'leonardo_hijack.Config' LEONARDO_ORDERING = -500 LEONARDO_APPS = [ 'leonardo_hijack', "hijack", "hijack_admin", "compat" ] # LEONARDO_MIDDLEWARES = [ # 'django.contrib.auth.middleware.AuthenticationMiddleware', # 'hijack.middleware.HijackRemoteUserMiddleware', # 'django.contrib.auth.middleware.RemoteUserMiddleware', # ] LEONARDO_CSS_FILES = [ 'hijack/leonardo-hijack-styles.css' ] class Config(AppConfig): name = 'leonardo_hijack' verbose_name = "leonardo-hijack"
StarcoderdataPython
3265870
<gh_stars>0 import os import sys from math import exp from PIL import Image sys.path.append("../ocrd_typegroups_classifier") from ocrd_typegroups_classifier.typegroups_classifier import TypegroupsClassifier if len(sys.argv)!=2: print('Syntax: python3 %s input-textline.jpg' % sys.argv[0]) img = Image.open(input()) tgc = TypegroupsClassifier.load(os.path.join('ocrd_typegroups_classifier', 'models', 'classifier.tgc')) result = tgc.classify(img, 75, 64, False) esum = 0 for key in result: esum += exp(result[key]) for key in result: result[key] = exp(result[key]) / esum print(result)
StarcoderdataPython
26046
#!/usr/bin/env python # encoding: utf-8 # The MIT License # # Copyright (c) 2011 Wyss Institute at Harvard University # # Permission is hereby granted, free of charge, to any person obtaining a copy # of this software and associated documentation files (the "Software"), to deal # in the Software without restriction, including without limitation the rights # to use, copy, modify, merge, publish, distribute, sublicense, and/or sell # copies of the Software, and to permit persons to whom the Software is # furnished to do so, subject to the following conditions: # # The above copyright notice and this permission notice shall be included in # all copies or substantial portions of the Software. # # THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR # IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, # FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE # AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER # LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, # OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN # THE SOFTWARE. # # http://www.opensource.org/licenses/mit-license.php from urllib2 import Request, urlopen, URLError, HTTPError import sys from os.path import basename, dirname, splitext, exists import os import shutil import tarfile def fetchFile(filename, baseurl, filemode='b', filetype='gz', filepath=None): """ filepath - is optional file path location to store the fetched file """ # create the url and the request url = baseurl + '/' + filename request = Request(url) # Open the url try: f_url = urlopen(request) print "downloading " + url # Open our local file for writing f_dest = open(filename, "w" + filemode) # Write to our local file f_dest.write(f_url.read()) f_dest.close() # handle errors except HTTPError, e: print "HTTP Error:", e.code , url except URLError, e: print "URL Error:", e.reason , url filename_out = filename # unzip if possible if filetype == 'gz': # get the extracted folder name filename_out = splitext(filename)[0] temp = splitext(filename_out) if temp[1] == '.tar': filename_out = temp[0] # open the archive try: f_zip= tarfile.open(filename, mode='r') except tarfile.ReadError, e: print "unable to read archive", e.code print "extracting " + filename_out try: if filepath: # remove existing folder if os.path.exists(filepath + '/' + filename_out): print "file exists" shutil.rmtree(filepath + '/' + filename_out) else: print "file does not exist", filename_out f_zip.extractall(path=filepath) else: # remove existing folder if os.path.exists(filename_out): print "file exists" shutil.rmtree(filename_out) else: print "file does not exist", filename_out f_zip.extractall() except tarfile.ExtractError, e: print "unable to extract archive", e.code f_zip.close() # remove the archive print "removing the downloaded archive", filename os.remove(filename) print "done" return filename_out # end def if __name__ == '__main__': argv = sys.argv url = argv[1] filename = basename(url) base_url = dirname(url) fetchFile(filename, base_url)
StarcoderdataPython
4800433
# vim: tabstop=4 shiftwidth=4 softtabstop=4 # Copyright 2010 OpenStack LLC. # All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); you may # not use this file except in compliance with the License. You may obtain # a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, WITHOUT # WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the # License for the specific language governing permissions and limitations # under the License. from nova import exception def limited(items, req): """Return a slice of items according to requested offset and limit. items - a sliceable req - wobob.Request possibly containing offset and limit GET variables. offset is where to start in the list, and limit is the maximum number of items to return. If limit is not specified, 0, or > 1000, defaults to 1000. """ offset = int(req.GET.get('offset', 0)) limit = int(req.GET.get('limit', 0)) if not limit: limit = 1000 limit = min(1000, limit) range_end = offset + limit return items[offset:range_end] def get_image_id_from_image_hash(image_service, context, image_hash): """Given an Image ID Hash, return an objectstore Image ID. image_service - reference to objectstore compatible image service. context - security context for image service requests. image_hash - hash of the image ID. """ # FIX(sandy): This is terribly inefficient. It pulls all images # from objectstore in order to find the match. ObjectStore # should have a numeric counterpart to the string ID. try: items = image_service.detail(context) except NotImplementedError: items = image_service.index(context) for image in items: image_id = image['id'] if abs(hash(image_id)) == int(image_hash): return image_id raise exception.NotFound(image_hash)
StarcoderdataPython
91389
#!/usr/bin/env python # -*- coding: utf-8 -*- # # This software is licensed as described in the file LICENSE, which # you should have received as part of this distribution. import unittest2 as unittest import mock import os class CompressTest(unittest.TestCase): def test_compress_js(self): from couchapp.config import Config config = Config() config.conf['compress'] = {'js': {'foo':['shows/example-show.js']}} with mock.patch('couchapp.hooks.compress.default.compress', return_value='foo') as mock_compress: from couchapp.hooks.compress import Compress compress = Compress(os.path.join(os.path.dirname(__file__), 'testapp')) compress.conf = config with mock.patch('couchapp.util.write'): compress.run() self.assertTrue(mock_compress.called, 'Default compressor has been called') def test_our_jsmin_loading(self): orig_import = __import__ def import_mock(name, *args): if name == 'jsmin': raise ImportError() return orig_import(name, *args) with mock.patch('__builtin__.__import__', side_effect=import_mock): with mock.patch('couchapp.hooks.compress.jsmin.jsmin', return_value='foo'): from couchapp.hooks.compress import default result = default.compress('bar') self.assertEqual(result, 'foo', 'Our module is called when it is not installed in the system') def test_system_jsmin_loading(self): orig_import = __import__ def import_mock(name, *args): if name == 'couchapp.hooks.compress.jsmin': raise ImportError() return orig_import(name, *args) with mock.patch('__builtin__.__import__', side_effect=import_mock): with mock.patch('jsmin.jsmin', return_value='foo'): from couchapp.hooks.compress import default result = default.compress('bar') self.assertEqual(result, 'foo', 'The system module is called when it is installed') if __name__ == "__main__": # import sys;sys.argv = ['', 'Test.testName'] unittest.main()
StarcoderdataPython
1720358
from base import Base from sqlalchemy import Column, Integer, String, Boolean from sqlalchemy.orm import relationship class Run(Base): __tablename__ = 'run' id = Column(Integer, primary_key=True) # One-to-Many relationship to Samples contained in Run samples = relationship("Sample", cascade="delete") # sequencer type: e.g. 454, MiSeq, HiSeq type = Column(String) # collection of index tags used # TODO load midsets into DB? mid_set = Column(String) # Historically, we've referred to all our 454 sequencing as PlateX-Y, where: # X is our sequencing plate (numbered from 1 as we've submitted plates) # Y is the region on the 454 sequencing plate; a plate contains a minimum of 2 regions # TODO - needs to be more generic, perhaps "Run Alias" plate = Column(String) sequencing_notes = Column(String) def __repr__(self): return '<Run: %r>' % (self.plate)
StarcoderdataPython
1685926
""" Diagnostic Maps. Diagnostic to produce images of a map with coastlines from a cube. These plost show latitude vs longitude and the cube value is used as the colour scale. Note that this diagnostic assumes that the preprocessors do the bulk of the hard work, and that the cube received by this diagnostic (via the settings.yml and metadata.yml files) has no time component, a small number of depth layers, and a latitude and longitude coordinates. An approproate preprocessor for a 3D+time field would be: preprocessors: prep_map: extract_levels: levels: [100., ] scheme: linear_extrap time_average: This tool is part of the ocean diagnostic tools package in the ESMValTool. Author: <NAME> (PML) <EMAIL> """ import logging import os import sys from itertools import product import cartopy import iris import iris.quickplot as qplt import matplotlib import matplotlib.pyplot as plt import numpy as np import diagnostic_tools as diagtools from esmvaltool.diag_scripts.shared import run_diagnostic # This part sends debug statements to stdout logger = logging.getLogger(os.path.basename(__file__)) logging.getLogger().addHandler(logging.StreamHandler(sys.stdout)) def create_ice_cmap(threshold): """Create colour map with ocean blue below 15% and white above 15%.""" threshold = threshold / 100. ice_cmap_dict = {'red': ((0., 0.0313, 0.0313), (threshold, 0.0313, 1.), (1., 1., 1.)), 'green': ((0., 0.237, 0.237), (threshold, 0.237, 1.), (1., 1., 1.)), 'blue': ((0., 0.456, 0.456), (threshold, 0.456, 1.), (1., 1., 1.))} return matplotlib.colors.LinearSegmentedColormap('ice_cmap', ice_cmap_dict) def calculate_area_time_series(cube, plot_type, threshold): """ Calculate the area of unmasked cube cells. Requires a cube with two spacial dimensions. (no depth coordinate). Parameters ---------- cube: iris.cube.Cube Original data Returns ------- iris.cube.Cube collapsed cube, in units of m^2 """ data = [] times = diagtools.cube_time_to_float(cube) for time_itr, time in enumerate(times): icedata = cube[time_itr].data area = iris.analysis.cartography.area_weights(cube[time_itr]) if plot_type.lower() == 'ice extent': # Ice extend is the area with more than 15% ice cover. icedata = np.ma.masked_where(icedata < threshold, icedata) total_area = np.ma.masked_where(icedata.mask, area.data).sum() if plot_type.lower() == 'ice area': # Ice area is cover * cell area total_area = np.sum(icedata * area) logger.debug('Calculating time series area: %s, %s, %s,', time_itr, time, total_area) data.append(total_area) ###### # Create a small dummy output array data = np.array(data) return times, data def make_ts_plots( cfg, metadata, filename, ): """ Make a ice extent time series plot for an individual model. The cfg is the opened global config, metadata is the metadata dictionairy filename is the preprocessing model file. """ # Load cube and set up units cube = iris.load_cube(filename) cube = diagtools.bgc_units(cube, metadata['short_name']) cube = agregate_by_season(cube) # Is this data is a multi-model dataset? multi_model = metadata['dataset'].find('MultiModel') > -1 # Make a dict of cubes for each layer. cubes = diagtools.make_cube_layer_dict(cube) # Load image format extention image_extention = diagtools.get_image_format(cfg) # # Load threshold, pole, season. threshold = float(cfg['threshold']) pole = get_pole(cube) season = get_season(cube) # Making plots for each layer for plot_type in ['Ice Extent', 'Ice Area']: for layer_index, (layer, cube_layer) in enumerate(cubes.items()): layer = str(layer) times, data = calculate_area_time_series(cube_layer, plot_type, threshold) plt.plot(times, data) # Add title to plot title = ' '.join([metadata['dataset'], pole, 'hemisphere', season, plot_type]) if layer: title = ' '.join( [title, '(', layer, str(cube_layer.coords('depth')[0].units), ')']) plt.title(title) # y axis label: plt.ylabel(' '.join([plot_type, 'm^2'])) # Determine image filename: suffix = '_'.join(['ts', metadata['preprocessor'], season, pole, plot_type, str(layer_index)])\ + image_extention suffix = suffix.replace(' ', '') if multi_model: path = diagtools.folder( cfg['plot_dir']) + os.path.basename(filename) path = path.replace('.nc', suffix) else: path = diagtools.get_image_path( cfg, metadata, suffix=suffix, ) # Saving files: if cfg['write_plots']: logger.info('Saving plots to %s', path) plt.savefig(path) plt.close() def make_polar_map( cube, pole='North', cmap='Blues_r', ): """ Make a polar map plot. The cube is the opened cube (two dimensional), pole is the polar region (North/South) cmap is the colourmap, """ fig = plt.figure() fig.set_size_inches(7, 7) # #### # Set limits, based on https://nedbatchelder.com/blog/200806/pylint.html if pole not in ['North', 'South']: logger.fatal('make_polar_map: hemisphere not provided.') if pole == 'North': # North Hemisphere ax1 = plt.subplot(111, projection=cartopy.crs.NorthPolarStereo()) ax1.set_extent([-180, 180, 50, 90], cartopy.crs.PlateCarree()) if pole == 'South': # South Hemisphere ax1 = plt.subplot(111, projection=cartopy.crs.SouthPolarStereo()) ax1.set_extent([-180, 180, -90, -50], cartopy.crs.PlateCarree()) linrange = np.linspace(0., 100., 21.) qplt.contourf(cube, linrange, cmap=cmap, linewidth=0, rasterized=True) plt.tight_layout() ax1.add_feature(cartopy.feature.LAND, zorder=10, facecolor=[0.8, 0.8, 0.8], ) ax1.gridlines(linewidth=0.5, color='black', zorder=20, alpha=0.5, linestyle='--') try: plt.gca().coastlines() except AttributeError: logger.warning('make_polar_map: Not able to add coastlines') return fig, ax1 def get_pole(cube): """Return a hemisphere name as a string (Either North or South).""" margin = 5. if np.max(cube.coord('latitude').points) < 0. + margin: return 'South' if np.min(cube.coord('latitude').points) > 0. - margin: return 'North' logger.fatal('get_pole: Not able to determine hemisphere.') return False def get_time_string(cube): """Return a climatological season string in the format: "year season".""" season = cube.coord('clim_season').points year = cube.coord('year').points return str(int(year[0])) + ' ' + season[0].upper() def get_year(cube): """Return the cube year as a string.""" year = cube.coord('year').points return str(int(year)) def get_season(cube): """Return a climatological season time string.""" season = cube.coord('clim_season').points return season[0].upper() def make_map_plots( cfg, metadata, filename, ): """ Make a simple map plot for an individual model. The cfg is the opened global config, metadata is the metadata dictionairy filename is the preprocessing model file. """ # Load cube and set up units cube = iris.load_cube(filename) cube = diagtools.bgc_units(cube, metadata['short_name']) cube = agregate_by_season(cube) # Is this data is a multi-model dataset? multi_model = metadata['dataset'].find('MultiModel') > -1 # Make a dict of cubes for each layer. cubes = diagtools.make_cube_layer_dict(cube) # Load image format extention and threshold. image_extention = diagtools.get_image_format(cfg) threshold = float(cfg['threshold']) # Making plots for each layer plot_types = ['Fractional cover', 'Ice Extent'] plot_times = [0, -1] for plot_type, plot_time in product(plot_types, plot_times): for layer_index, (layer, cube_layer) in enumerate(cubes.items()): layer = str(layer) if plot_type == 'Fractional cover': cmap = 'Blues_r' if plot_type == 'Ice Extent': cmap = create_ice_cmap(threshold) cube = cube_layer[plot_time] # use cube to determine which hemisphere, season and year. pole = get_pole(cube) time_str = get_time_string(cube) # Make the polar map. fig, ax1 = make_polar_map(cube, pole=pole, cmap=cmap) # Add title to plot title = ' '.join([metadata['dataset'], plot_type, time_str]) if layer: title = ' '.join([title, '(', layer, str(cube_layer.coords('depth')[0].units), ')']) plt.title(title) # Determine image filename: suffix = '_'.join(['ortho_map', plot_type, time_str, str(layer_index)]) suffix = suffix.replace(' ', '') + image_extention if multi_model: path = diagtools.folder(cfg['plot_dir']) path = path + os.path.basename(filename) path = path.replace('.nc', suffix) else: path = diagtools.get_image_path( cfg, metadata, suffix=suffix, ) # Saving files: if cfg['write_plots']: logger.info('Saving plots to %s', path) plt.savefig(path) plt.close() def agregate_by_season(cube): """ Aggregate the cube into seasonal means. Note that it is not currently possible to do this in the preprocessor, as the seasonal mean changes the cube units. """ if not cube.coords('clim_season'): iris.coord_categorisation.add_season(cube, 'time', name='clim_season') if not cube.coords('season_year'): iris.coord_categorisation.add_season_year(cube, 'time', name='season_year') return cube.aggregated_by(['clim_season', 'season_year'], iris.analysis.MEAN) def make_map_extent_plots( cfg, metadata, filename, ): """ Make an extent map plot showing several times for an individual model. The cfg is the opened global config, metadata is the metadata dictionairy filename is the preprocessing model file. """ # Load cube and set up units cube = iris.load_cube(filename) cube = diagtools.bgc_units(cube, metadata['short_name']) cube = agregate_by_season(cube) # Is this data is a multi-model dataset? multi_model = metadata['dataset'].find('MultiModel') > -1 # Make a dict of cubes for each layer. cubes = diagtools.make_cube_layer_dict(cube) # Load image format extention image_extention = diagtools.get_image_format(cfg) # Load threshold, pole and season threshold = float(cfg['threshold']) pole = get_pole(cube) season = get_season(cube) # Start making figure for layer_index, (layer, cube_layer) in enumerate(cubes.items()): fig = plt.figure() fig.set_size_inches(7, 7) if pole == 'North': # North Hemisphere projection = cartopy.crs.NorthPolarStereo() ax1 = plt.subplot(111, projection=projection) ax1.set_extent([-180, 180, 50, 90], cartopy.crs.PlateCarree()) if pole == 'South': # South Hemisphere projection = cartopy.crs.SouthPolarStereo() ax1 = plt.subplot(111, projection=projection) ax1.set_extent([-180, 180, -90, -50], cartopy.crs.PlateCarree()) ax1.add_feature(cartopy.feature.LAND, zorder=10, facecolor=[0.8, 0.8, 0.8]) ax1.gridlines(linewidth=0.5, color='black', zorder=20, alpha=0.5, linestyle='--') try: plt.gca().coastlines() except AttributeError: logger.warning('make_polar_map: Not able to add coastlines') times = np.array(cube.coord('time').points.astype(float)) plot_desc = {} for time_itr, time in enumerate(times): cube = cube_layer[time_itr] line_width = 1 color = plt.cm.jet(float(time_itr) / float(len(times))) label = get_year(cube) plot_desc[time] = {'label': label, 'c': [color, ], 'lw': [line_width, ], 'ls': ['-', ]} layer = str(layer) qplt.contour(cube, [threshold, ], colors=plot_desc[time]['c'], linewidths=plot_desc[time]['lw'], linestyles=plot_desc[time]['ls'], rasterized=True) # Add legend legend_size = len(plot_desc.keys()) + 1 ncols = int(legend_size / 25) + 1 ax1.set_position([ax1.get_position().x0, ax1.get_position().y0, ax1.get_position().width * (1. - 0.1 * ncols), ax1.get_position().height]) fig.set_size_inches(7 + ncols * 1.2, 7) # Construct dummy plots. for i in sorted(plot_desc.keys()): plt.plot([], [], c=plot_desc[i]['c'][0], lw=plot_desc[i]['lw'][0], ls=plot_desc[i]['ls'][0], label=plot_desc[i]['label'],) legd = ax1.legend(loc='center left', ncol=ncols, prop={'size': 10}, bbox_to_anchor=(1., 0.5)) legd.draw_frame(False) legd.get_frame().set_alpha(0.) # Add title to plot title = ' '.join([metadata['dataset'], ]) if layer: title = ' '.join([title, '(', layer, str(cube_layer.coords('depth')[0].units), ')']) plt.title(title) # Determine image filename: suffix = '_'.join(['ortho_map', pole, season, str(layer_index)]) suffix = suffix.replace(' ', '') + image_extention if multi_model: path = diagtools.folder(cfg['plot_dir']) path = path + os.path.basename(filename) path = path.replace('.nc', suffix) else: path = diagtools.get_image_path( cfg, metadata, suffix=suffix, ) # Saving files: if cfg['write_plots']: logger.info('Saving plots to %s', path) plt.savefig(path) plt.close() def main(cfg): """ Load the config file, and send it to the plot maker. The cfg is the opened global config. """ for index, metadata_filename in enumerate(cfg['input_files']): logger.info( 'metadata filename:\t%s', metadata_filename, ) metadatas = diagtools.get_input_files(cfg, index=index) for filename in sorted(metadatas.keys()): logger.info('-----------------') logger.info( 'model filenames:\t%s', filename, ) ###### # extent maps plots of individual models make_map_extent_plots(cfg, metadatas[filename], filename) ###### # maps plots of individual models make_map_plots(cfg, metadatas[filename], filename) ###### # time series plots o make_ts_plots(cfg, metadatas[filename], filename) logger.info('Success') if __name__ == '__main__': with run_diagnostic() as config: main(config)
StarcoderdataPython
1734744
<gh_stars>10-100 from __future__ import absolute_import import sys try: __PKG_SETUP__ except NameError: __PKG_SETUP__ = False if __PKG_SETUP__: sys.stderr.write('Running from source directory.\n') else: from . import alg from . import bench from . import distutils from . import plotter __all__ = [] __all__.extend(['alg']) __all__.extend(['bench']) __all__.extend(['distutils']) __all__.extend(['plotter'])
StarcoderdataPython
193354
#!/usr/bin/env python3 import time from matrix_client.client import MatrixClient from matrix_client.api import MatrixRequestError from requests.exceptions import ConnectionError, Timeout import argparse import random from configparser import ConfigParser import re import traceback import urllib.parse import logging import os import sys import signal import queue import codecs from database import MarkovDatabaseBrain COMMANDS = [ '!rate' ] def sigterm_handler(_signo, _stack_frame): """Raises SystemExit(0), causing everything to cleanly shut down.""" sys.exit(0) class ConfigParser(ConfigParser): # allow case-sensitive option names # needed for saving per-room response rates optionxform = str class Backend(object): """Interface for chat backends.""" def __init__(self, brain_file): pass def train_file(self, filename): """Trains the chat backend on the given file.""" with codecs.open(filename, encoding='utf8') as train_file: for line in train_file: self.learn(line) def learn(self, line): """Updates the chat backend based on the given line of input.""" pass def save(self): """Saves the backend to disk, if needed.""" pass def reply(self, message): """Generates a reply to the given message.""" return "(dummy response)" class MarkovBackend(Backend): """Chat backend using markov chains.""" def __init__(self, brain_file): self.brain = MarkovDatabaseBrain(brain_file) def sanitize(self, word): """Removes any awkward whitespace characters from the given word. Removes '\n', '\r', and '\\u2028' (unicode newline character).""" return word.replace('\n', '').replace('\r', '').replace('\u2028', '') def train_file(self, filename): with codecs.open(filename, encoding='utf8') as train_file: for line in train_file: self.learn(line) self.save() def learn(self, line): line = line.strip() words = line.split(' ') words = [self.sanitize(word) for word in words] for i in range(len(words) - 2): prefix = words[i], words[i + 1] follow = words[i + 2] self.brain.add(prefix, follow) def save(self): self.brain.save() def get_random_next_link(self, word1, word2): """Gives a word that could come after the two provided. Words that follow the two given words are weighted by how frequently they appear after them. """ possibilities = self.brain.get_followers((word1, word2)) if not possibilities: return None total = 0 for p in possibilities: total += possibilities[p] num = random.randint(1, total) total = 0 for p in possibilities: total += possibilities[p] if total >= num: break return p def reply(self, message): if self.brain.is_empty(): return '' seed = None # try to seed reply from the message possible_seed_words = message.split() while seed is None and possible_seed_words: message_word = random.choice(possible_seed_words) seeds = list(self.brain.get_pairs_containing_word_ignoring_case( message_word)) if seeds: seed = random.choice(seeds) else: possible_seed_words.remove(message_word) # we couldn't seed the reply from the input # fall back to random seed if seed is None: seed = self.brain.get_three_random_words() words = list(seed) while self.brain.contains_pair((words[-2], words[-1])) and \ len(words) < 100: word = self.get_random_next_link(words[-2], words[-1]) words.append(word) return ' '.join(words) class Config(object): def __init__(self, cfgparser): self.backend = cfgparser.get('General', 'backend') self.display_name = cfgparser.get('General', 'display name') self.learning = cfgparser.getboolean('General', 'learning') self.username = cfgparser.get('Login', 'username') self.password = cfgparser.get('Login', 'password') self.server = cfgparser.get('Login', 'server') self.default_response_rate = cfgparser.getfloat( 'General', 'default response rate') self.response_rates = {} for room_id, rate in cfgparser.items('Response Rates'): room_id = room_id.replace('-colon-', ':') self.response_rates[room_id] = float(rate) def get_response_rate(self, room_id): """Returns our response rate for the room with the given room id.""" if room_id in self.response_rates: return self.response_rates[room_id] else: return self.default_response_rate def write(self): """Writes this config back to the file, with any changes reflected.""" cfgparser = ConfigParser() cfgparser.add_section('General') cfgparser.set('General', 'default response rate', str(self.default_response_rate)) cfgparser.set('General', 'backend', self.backend) cfgparser.set('General', 'display name', self.display_name) cfgparser.set('General', 'learning', str(self.learning)) cfgparser.add_section('Login') cfgparser.set('Login', 'username', self.username) cfgparser.set('Login', 'password', self.password) cfgparser.set('Login', 'server', self.server) cfgparser.add_section('Response Rates') for room_id, rate in list(self.response_rates.items()): # censor colons because they are a configparser special # character room_id = room_id.replace(':', '-colon-') cfgparser.set('Response Rates', room_id, str(rate)) with open('config.cfg', 'wt') as configfile: cfgparser.write(configfile) def get_default_configparser(): """Returns a ConfigParser object for the default config file.""" config = ConfigParser(allow_no_value=True) config.add_section('General') config.set('General', 'default response rate', "0.10") config.set('General', 'backend', 'markov') config.set('General', 'display name', 'Markov') config.set('General', 'learning', 'on') config.add_section('Login') config.set('Login', 'username', 'username') config.set('Login', 'password', 'password') config.set('Login', 'server', 'http://matrix.org') config.add_section('Response Rates') return config class Bot(object): """Handles everything that the bot does.""" def __init__(self, config, chat_backend): self.config = config self.client = None self.chat_backend = chat_backend self.event_queue = queue.Queue() self.invite_queue = queue.Queue() def login(self): """Logs onto the server.""" client = MatrixClient(self.config.server) client.login_with_password_no_sync( self.config.username, self.config.password) self.client = client def get_room(self, event): """Returns the room the given event took place in.""" return self.client.rooms[event['room_id']] def handle_command(self, event, command, args): """Handles the given command, possibly sending a reply to it.""" command = command.lower() if command == '!rate': if args: num = re.match(r'[0-9]*(\.[0-9]+)?(%|)', args[0]).group() if not num: self.reply(event, "Error: Could not parse number.") return if num[-1] == '%': rate = float(num[:-1]) / 100 else: rate = float(num) self.config.response_rates[event['room_id']] = rate self.reply(event, "Response rate set to %f." % rate) else: rate = self.config.get_response_rate(event['room_id']) self.reply( event, "Response rate set to %f in this room." % rate) def reply(self, event, message): """Replies to the given event with the provided message.""" room = self.get_room(event) logging.info("Reply: %s" % message) room.send_notice(message) def is_name_in_message(self, message): """Returns whether the message contains the bot's name. Considers both display name and username. """ regex = "({}|{})".format( self.config.display_name, self.config.username) return re.search(regex, message, flags=re.IGNORECASE) def handle_invite(self, room_id, invite_state): # join rooms if invited try: self.client.join_room(room_id) logging.info('Joined room: %s' % room_id) except MatrixRequestError as e: if e.code == 404: # room was deleted after invite or something; ignore it logging.info('invited to nonexistent room {}'.format(room_id)) elif e.code in range(500, 600): # synapse v0.99.1 500s if it cannot locate a room sometimes # (when there are federation issues) logging.warning('got 500 trying to join room we were invited to') else: raise(e) def handle_event(self, event): """Handles the given event. Joins a room if invited, learns from messages, and possibly responds to messages. """ if event['type'] == 'm.room.message': # only care about text messages by other people if event['sender'] != self.client.user_id and \ event['content']['msgtype'] == 'm.text': message = str(event['content']['body']) # lowercase message so we can search it # case-insensitively logging.info("Handling message: %s" % message) command_found = False for command in COMMANDS: match = re.search(command, message, flags=re.IGNORECASE) if match and (match.start() == 0 or self.is_name_in_message(message)): command_found = True args = message[match.start():].split(' ') self.handle_command(event, args[0], args[1:]) break if not command_found: room = self.get_room(event) response_rate = self.config.get_response_rate(room.room_id) if self.is_name_in_message(message) or \ random.random() < response_rate: # remove name from message and respond to it message_no_name = re.sub( ' *' + re.escape(self.get_display_name()) + ' *', ' ', message, flags=re.IGNORECASE) response = self.chat_backend.reply(message_no_name) self.reply(event, response) if self.config.learning: self.chat_backend.learn(message) self.send_read_receipt(event) def set_display_name(self, display_name): """Sets the bot's display name on the server.""" self.client.api.set_display_name(self.client.user_id, display_name) def get_display_name(self): """Gets the bot's display name from the server.""" return self.client.api.get_display_name(self.client.user_id) def run(self): """Indefinitely listens for messages and handles all that come.""" current_display_name = self.get_display_name() if current_display_name != self.config.display_name: self.set_display_name(self.config.display_name) last_save = time.time() # listen for invites, including initial sync invites self.client.add_invite_listener( lambda room_id, state: self.invite_queue.put((room_id, state))) # get rid of initial event sync logging.info("initial event stream") self.client.listen_for_events() # listen to events and add them all to the event queue # for handling in this thread self.client.add_listener(self.event_queue.put) def exception_handler(e): if isinstance(e, Timeout): logging.warning("listener thread timed out.") logging.error("exception in listener thread:") traceback.print_exc() # start listen thread logging.info("starting listener thread") self.client.start_listener_thread(exception_handler=exception_handler) try: while True: time.sleep(1) # handle any queued events while not self.event_queue.empty(): event = self.event_queue.get_nowait() self.handle_event(event) while not self.invite_queue.empty(): room_id, invite_state = self.invite_queue.get_nowait() self.handle_invite(room_id, invite_state) # save every 10 minutes or so if time.time() - last_save > 60 * 10: self.chat_backend.save() last_save = time.time() finally: logging.info("stopping listener thread") self.client.stop_listener_thread() def send_read_receipt(self, event): """Sends a read receipt for the given event.""" if "room_id" in event and "event_id" in event: room_id = urllib.parse.quote(event['room_id']) event_id = urllib.parse.quote(event['event_id']) self.client.api._send("POST", "/rooms/" + room_id + "/receipt/m.read/" + event_id, api_path="/_matrix/client/r0") def train(backend, train_file): """Trains the given chat backend on the given train_file & saves it.""" print("Training...") backend.train_file(train_file) print("Training complete!") backend.save() def main(): argparser = argparse.ArgumentParser( description="A chatbot for Matrix (matrix.org)") argparser.add_argument("--debug", help="Print out way more things.", action="store_true") argparser.add_argument("--train", metavar="train.txt", type=str, help="Train the bot with a file of text.") argparser.add_argument("--config", metavar="config.cfg", type=str, help="Bot's config file (must be read-writable)") argparser.add_argument("--brain", metavar="brain.db", type=str, help="Bot's brain file (must be read-writable)") args = vars(argparser.parse_args()) debug = args['debug'] # suppress logs of libraries logging.getLogger("requests").setLevel(logging.WARNING) logging.getLogger("urllib3").setLevel(logging.WARNING) log_level = logging.DEBUG if debug else logging.INFO logging.basicConfig(level=log_level, format='%(asctime)s %(name)s ' '%(levelname)s %(message)s') train_path = args['train'] config_path = args['config'] if args['config'] \ else os.getenv('MATRIX_CHATBOT_CONFIG', 'config.cfg') brain_path = args['brain'] if args['brain'] \ else os.getenv('MATRIX_CHATBOT_BRAIN', 'brain.db') cfgparser = ConfigParser() success = cfgparser.read(config_path) if not success: cfgparser = get_default_configparser() with open(config_path, 'wt') as configfile: cfgparser.write(configfile) print("A config has been generated. " "Please set your bot's username, password, and homeserver " "in " + config_path + " then run this again.") return config = Config(cfgparser) backends = {'markov': MarkovBackend} backend = backends[config.backend](brain_path) logging.info("loading brain") if train_path: train(backend, train_path) else: signal.signal(signal.SIGTERM, sigterm_handler) while True: try: bot = Bot(config, backend) bot.login() bot.run() except (MatrixRequestError, ConnectionError): traceback.print_exc() logging.warning("disconnected. Waiting a minute to see if" " the problem resolves itself...") time.sleep(60) finally: backend.save() logging.info('Saving config...') config.write() if __name__ == '__main__': main()
StarcoderdataPython
1677554
<filename>InvenTree/barcodes/plugins/inventree_barcode.py<gh_stars>1-10 """ The InvenTreeBarcodePlugin validates barcodes generated by InvenTree itself. It can be used as a template for developing third-party barcode plugins. The data format is very simple, and maps directly to database objects, via the "id" parameter. Parsing an InvenTree barcode simply involves validating that the references model objects actually exist in the database. """ # -*- coding: utf-8 -*- import json from barcodes.barcode import BarcodePlugin from stock.models import StockItem, StockLocation from part.models import Part from rest_framework.exceptions import ValidationError class InvenTreeBarcodePlugin(BarcodePlugin): PLUGIN_NAME = "InvenTreeBarcode" def validate(self): """ An "InvenTree" barcode must be a jsonnable-dict with the following tags: { 'tool': 'InvenTree', 'version': <anything> } """ # The data must either be dict or be able to dictified if type(self.data) is dict: pass elif type(self.data) is str: try: self.data = json.loads(self.data) if type(self.data) is not dict: return False except json.JSONDecodeError: return False else: return False # pragma: no cover # If any of the following keys are in the JSON data, # let's go ahead and assume that the code is a valid InvenTree one... for key in ['tool', 'version', 'InvenTree', 'stockitem', 'stocklocation', 'part']: if key in self.data.keys(): return True return True def getStockItem(self): for k in self.data.keys(): if k.lower() == 'stockitem': data = self.data[k] pk = None # Initially try casting to an integer try: pk = int(data) except (TypeError, ValueError): # pragma: no cover pk = None if pk is None: # pragma: no cover try: pk = self.data[k]['id'] except (AttributeError, KeyError): raise ValidationError({k: "id parameter not supplied"}) try: item = StockItem.objects.get(pk=pk) return item except (ValueError, StockItem.DoesNotExist): # pragma: no cover raise ValidationError({k, "Stock item does not exist"}) return None def getStockLocation(self): for k in self.data.keys(): if k.lower() == 'stocklocation': pk = None # First try simple integer lookup try: pk = int(self.data[k]) except (TypeError, ValueError): # pragma: no cover pk = None if pk is None: # pragma: no cover # Lookup by 'id' field try: pk = self.data[k]['id'] except (AttributeError, KeyError): raise ValidationError({k: "id parameter not supplied"}) try: loc = StockLocation.objects.get(pk=pk) return loc except (ValueError, StockLocation.DoesNotExist): # pragma: no cover raise ValidationError({k, "Stock location does not exist"}) return None def getPart(self): for k in self.data.keys(): if k.lower() == 'part': pk = None # Try integer lookup first try: pk = int(self.data[k]) except (TypeError, ValueError): # pragma: no cover pk = None if pk is None: # pragma: no cover try: pk = self.data[k]['id'] except (AttributeError, KeyError): raise ValidationError({k, 'id parameter not supplied'}) try: part = Part.objects.get(pk=pk) return part except (ValueError, Part.DoesNotExist): # pragma: no cover raise ValidationError({k, 'Part does not exist'}) return None
StarcoderdataPython
1764569
import glob import re import os import datetime import argparse as ap import matplotlib # Enables saving plots over ssh try: os.environ['DISPLAY'] except KeyError: matplotlib.use('Agg') import matplotlib.pyplot as plt from operator import itemgetter, attrgetter, methodcaller import numpy as np def main(): parser = ap.ArgumentParser(description="""Plots the minimum required basis terms to achieve a desired accuracy against an independent parameter""") parser.add_argument('path',type=str,help="Base directory path for the sorted sweep") parser.add_argument('-s','--show',action='store_true',default=False,help="""Show plots interactively""") args = parser.parse_args() path = args.path if not os.path.isdir(path): print("Specified path does not exist") quit() fields = ['default','jones','normal','no_vec'] #radii = ['nw_radius_0.075','nw_radius_0.06'] radii = ['nw_radius_0.06'] #periods = ['array_period_0.25','array_period_0.3'] periods = ['array_period_0.25'] systems = {'array_period_0.25':['nw_radius_0.075','nw_radius_0.06'], 'array_period_0.3':['nw_radius_0.075']} for period,radii in systems.items(): for radius in radii: fig, axes = plt.subplots(1,1) for field in fields: tglob = os.path.join(path,field,period+"*",radius,'frequency_3.2962*/time_scaling.dat') tlist = glob.glob(tglob) if tlist: tpath = tlist[0] else: print(tglob) quit() print(tpath) numbasis, tdata = np.loadtxt(tpath,unpack=True,skiprows=1,delimiter=',') axes.plot(numbasis,tdata,'-o',label=field) axes.legend(loc='best') axes.set_xlabel('Number of Basis Terms') axes.set_ylabel('Wall Clock Time (seconds)') #axes.set_title('%s, %s'%(period,radius)) mglob = os.path.join(path,field,period+"*",radius,'minimum_basis_terms_global_t0.1.dat') mlist = glob.glob(mglob) if mlist: mpath = mlist[0] else: print(mglob) quit() print(mpath) freq, mdata = np.loadtxt(mpath,unpack=True,skiprows=1,delimiter=',') #axes.plot(freq,mdata,'-o',label=field) #axes.legend(loc='best') #axes.set_ylabel('Number of Basis Terms') #axes.set_xlabel('Frequency (Hz)') #ymin,ymax = axes.get_ylim() #print(ymin) #print(ymax) #axes.set_ylim((ymin-10,ymax+30)) #axes.set_title('%s, %s, Threshold = .1'%(period,radius)) #fig.subplots_adjust(hspace=.35) plt.savefig(os.path.join(path,'%s_%s_vec_field_convergence_comparison.png'%(period,radius)),transparent=True) #plt.show() #fig, axes = plt.subplots(3,2) #counter = 0 #for period,radii in systems.items(): # for radius in radii: # for field in fields: # # fig, axes = plt.subplots(3,2) # tglob = os.path.join(path,field,period+"*",radius,'frequency_3.2962*/time_scaling.dat') # tlist = glob.glob(tglob) # if tlist: # tpath = tlist[0] # else: # print(tglob) # quit() # print(tpath) # numbasis, tdata = np.loadtxt(tpath,unpack=True,skiprows=1,delimiter=',') # axes[counter][0].plot(numbasis,tdata,'-o',label=field) # axes[counter][0].legend(loc='best') # axes[counter][0].set_xlabel('Number of Basis Terms') # axes[counter][0].set_ylabel('Wall Clock Time (seconds)') # axes[counter][0].set_title('%s, %s'%(period,radius)) # for field in fields: # mglob = os.path.join(path,field,period+"*",radius,'minimum_basis_terms_global_t0.05.dat') # mlist = glob.glob(mglob) # if mlist: # mpath = mlist[0] # else: # print(mglob) # quit() # print(mpath) # freq, mdata = np.loadtxt(mpath,unpack=True,skiprows=1,delimiter=',') # axes[counter][1].plot(freq,mdata,'-o',label=field) # axes[counter][1].legend(loc='best') # axes[counter][1].set_ylabel('Number of Basis Terms') # axes[counter][1].set_xlabel('Frequency (Hz)') # axes[counter][1].set_title('%s, %s, Threshold = .05'%(period,radius)) # counter += 1 #fig.subplots_adjust(hspace=.25) #plt.savefig(os.path.join(path,'vec_field_timescaling_comparison.pdf')) #plt.show() #time_glob = os.path.join(path,'**/frequency_3.2962*/**/time_scaling.dat') #print(time_glob) #time_files = glob.glob(time_glob,recursive=True) #print(time_files) #quit() #for time_file in time_files: # basis_terms, data = np.loadtxt(time_file,unpack=True) # if 'normal' in time_file: # normal = data # elif 'no_vec' in time_file: # no_vec = data # elif 'default' in time_file: # default = data # elif 'jones' in time_file: # jones = data # else: # print('Didnt find valid vec field config in path') #quit() #plt.figure() #excludes = [os.path.join(path,'comp_struct')] #print('Beginning global time scaling analysis for %s'%path) #for root,dirs,files in os.walk(path,topdown=False): # # If we haven't already analyzed this node in the directory tree # if os.path.split(root)[0] not in excludes: # # Find all error files in current directory # if 'timing.dat' in files: # # If we found an time file, go up one directory and perform the analysis # base = os.path.split(root)[0] # print('Computing time scaling for subdir %s'%base) # analyze(base,args.show) # # Add the level above the basis term sweep to the excludes list so we don't perform # # the analysis for every basis term dir we find an error file in # excludes.append(base) if __name__ == '__main__': main()
StarcoderdataPython
83164
<reponame>haikezegwaard/msg_parser # coding=utf-8 # autogenerated using ms_props_generator.py DATA_TYPE_MAP = { "0x0000": "PtypUnspecified", "0x0001": "PtypNull", "0x0002": "PtypInteger16", "0x0003": "PtypInteger32", "0x0004": "PtypFloating32", "0x0005": "PtypFloating64", "0x0006": "PtypCurrency", "0x0007": "PtypFloatingTime", "0x000A": "PtypErrorCode", "0x000B": "PtypBoolean", "0x000D": "PtypObject", "0x0014": "PtypInteger64", "0x001E": "PtypString8", "0x001F": "PtypString", "0x0040": "PtypTime", "0x0048": "PtypGuid", "0x00FB": "PtypServerId", "0x00FD": "PtypRestriction", "0x00FE": "PtypRuleAction", "0x0102": "PtypBinary", "0x1002": "PtypMultipleInteger16", "0x1003": "PtypMultipleInteger32", "0x1004": "PtypMultipleFloating32", "0x1005": "PtypMultipleFloating64", "0x1006": "PtypMultipleCurrency", "0x1007": "PtypMultipleFloatingTime", "0x1014": "PtypMultipleInteger64", "0x101F": "PtypMultipleString", "0x101E": "PtypMultipleString8", "0x1040": "PtypMultipleTime", "0x1048": "PtypMultipleGuid", "0x1102": "PtypMultipleBinary" }
StarcoderdataPython
1711192
# pyright: reportUndefinedVariable=false from sly import Lexer from ..exceptions import SyntaxError class ExpressionLexer(Lexer): # Set of token names. tokens = { VALUE, INT, FLOAT, BETWEEN, AND, OR, NOT, IN, EQ, NE, GT, GTE, LT, LTE, ATTRIBUTE_EXISTS, ATTRIBUTE_NOT_EXISTS, ATTRIBUTE_TYPE, BEGINS_WITH, CONTAINS, SIZE, FROM_JSON, KEYS, OLD_IMAGE, NEW_IMAGE, NAME, CHANGED, MATCH, IS_TYPE, FALSE, TRUE, } # Set of literal characters literals = {"(", ")", "[", "]", ",", "."} # String containing ignored characters ignore = " \t" # Regular expression rules for tokens OLD_IMAGE = r"\$OLD" NEW_IMAGE = r"\$NEW" AND = r"\&{1}" OR = r"\|{1}" NOT = "NOT" IN = "IN" BETWEEN = "BETWEEN" CHANGED = "has_changed" IS_TYPE = "is_type" ATTRIBUTE_EXISTS = "attribute_exists" ATTRIBUTE_NOT_EXISTS = "attribute_not_exists" ATTRIBUTE_TYPE = "attribute_type" BEGINS_WITH = "begins_with" CONTAINS = "contains" FROM_JSON = "from_json" SIZE = "size" TRUE = "True" FALSE = ("False",) """ NAME has to come AFTER any keywords above. NAME is used as a path within OLD_IMAGE/NEW_IMAGE and also Dynamodb types such as S, L, SS, NS, BOOL, etc... """ NAME = r"[a-zA-Z_][a-zA-Z0-9\-_]*" NE = "!=" GTE = ">=" LTE = "<=" EQ = "==" GT = ">" LT = "<" INT = "\d+" MATCH = "=~" FLOAT = "\d+\.\d+" VALUE = r""""([^"\\]*(\\.[^"\\]*)*)"|\'([^\'\\]*(\\.[^\'\\]*)*)\'""" # Line number tracking @_(r"\n+") def ignore_newline(self, t): self.lineno += t.value.count("\n") def error(self, t): if t.value[0] == "$": raise SyntaxError( f"Invalid base path {t.value.split(' ')[0].split('.')[0]}" ) else: raise SyntaxError( f"Bad character '{t.value[0]}' at line {self.lineno} character {self.index}" )
StarcoderdataPython
1652440
# Copyright 2015, 2016 OpenMarket Ltd # Copyright 2017 New Vector Ltd # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. import logging import re from typing import Any, Dict, List, Mapping, Optional, Pattern, Set, Tuple, Union from matrix_common.regex import glob_to_regex, to_word_pattern from synapse.events import EventBase from synapse.types import UserID from synapse.util.caches.lrucache import LruCache logger = logging.getLogger(__name__) GLOB_REGEX = re.compile(r"\\\[(\\\!|)(.*)\\\]") IS_GLOB = re.compile(r"[\?\*\[\]]") INEQUALITY_EXPR = re.compile("^([=<>]*)([0-9]*)$") def _room_member_count( ev: EventBase, condition: Dict[str, Any], room_member_count: int ) -> bool: return _test_ineq_condition(condition, room_member_count) def _sender_notification_permission( ev: EventBase, condition: Dict[str, Any], sender_power_level: int, power_levels: Dict[str, Union[int, Dict[str, int]]], ) -> bool: notif_level_key = condition.get("key") if notif_level_key is None: return False notif_levels = power_levels.get("notifications", {}) assert isinstance(notif_levels, dict) room_notif_level = notif_levels.get(notif_level_key, 50) return sender_power_level >= room_notif_level def _test_ineq_condition(condition: Dict[str, Any], number: int) -> bool: if "is" not in condition: return False m = INEQUALITY_EXPR.match(condition["is"]) if not m: return False ineq = m.group(1) rhs = m.group(2) if not rhs.isdigit(): return False rhs_int = int(rhs) if ineq == "" or ineq == "==": return number == rhs_int elif ineq == "<": return number < rhs_int elif ineq == ">": return number > rhs_int elif ineq == ">=": return number >= rhs_int elif ineq == "<=": return number <= rhs_int else: return False def tweaks_for_actions(actions: List[Union[str, Dict]]) -> Dict[str, Any]: """ Converts a list of actions into a `tweaks` dict (which can then be passed to the push gateway). This function ignores all actions other than `set_tweak` actions, and treats absent `value`s as `True`, which agrees with the only spec-defined treatment of absent `value`s (namely, for `highlight` tweaks). Args: actions: list of actions e.g. [ {"set_tweak": "a", "value": "AAA"}, {"set_tweak": "b", "value": "BBB"}, {"set_tweak": "highlight"}, "notify" ] Returns: dictionary of tweaks for those actions e.g. {"a": "AAA", "b": "BBB", "highlight": True} """ tweaks = {} for a in actions: if not isinstance(a, dict): continue if "set_tweak" in a: # value is allowed to be absent in which case the value assumed # should be True. tweaks[a["set_tweak"]] = a.get("value", True) return tweaks class PushRuleEvaluatorForEvent: def __init__( self, event: EventBase, room_member_count: int, sender_power_level: int, power_levels: Dict[str, Union[int, Dict[str, int]]], relations: Dict[str, Set[Tuple[str, str]]], relations_match_enabled: bool, ): self._event = event self._room_member_count = room_member_count self._sender_power_level = sender_power_level self._power_levels = power_levels self._relations = relations self._relations_match_enabled = relations_match_enabled # Maps strings of e.g. 'content.body' -> event["content"]["body"] self._value_cache = _flatten_dict(event) # Maps cache keys to final values. self._condition_cache: Dict[str, bool] = {} def check_conditions( self, conditions: List[dict], uid: str, display_name: Optional[str] ) -> bool: """ Returns true if a user's conditions/user ID/display name match the event. Args: conditions: The user's conditions to match. uid: The user's MXID. display_name: The display name. Returns: True if all conditions match the event, False otherwise. """ for cond in conditions: _cache_key = cond.get("_cache_key", None) if _cache_key: res = self._condition_cache.get(_cache_key, None) if res is False: return False elif res is True: continue res = self.matches(cond, uid, display_name) if _cache_key: self._condition_cache[_cache_key] = bool(res) if not res: return False return True def matches( self, condition: Dict[str, Any], user_id: str, display_name: Optional[str] ) -> bool: """ Returns true if a user's condition/user ID/display name match the event. Args: condition: The user's condition to match. uid: The user's MXID. display_name: The display name, or None if there is not one. Returns: True if the condition matches the event, False otherwise. """ if condition["kind"] == "event_match": return self._event_match(condition, user_id) elif condition["kind"] == "contains_display_name": return self._contains_display_name(display_name) elif condition["kind"] == "room_member_count": return _room_member_count(self._event, condition, self._room_member_count) elif condition["kind"] == "sender_notification_permission": return _sender_notification_permission( self._event, condition, self._sender_power_level, self._power_levels ) elif ( condition["kind"] == "org.matrix.msc3772.relation_match" and self._relations_match_enabled ): return self._relation_match(condition, user_id) else: # XXX This looks incorrect -- we have reached an unknown condition # kind and are unconditionally returning that it matches. Note # that it seems possible to provide a condition to the /pushrules # endpoint with an unknown kind, see _rule_tuple_from_request_object. return True def _event_match(self, condition: dict, user_id: str) -> bool: """ Check an "event_match" push rule condition. Args: condition: The "event_match" push rule condition to match. user_id: The user's MXID. Returns: True if the condition matches the event, False otherwise. """ pattern = condition.get("pattern", None) if not pattern: pattern_type = condition.get("pattern_type", None) if pattern_type == "user_id": pattern = user_id elif pattern_type == "user_localpart": pattern = UserID.from_string(user_id).localpart if not pattern: logger.warning("event_match condition with no pattern") return False # XXX: optimisation: cache our pattern regexps if condition["key"] == "content.body": body = self._event.content.get("body", None) if not body or not isinstance(body, str): return False return _glob_matches(pattern, body, word_boundary=True) else: haystack = self._value_cache.get(condition["key"], None) if haystack is None: return False return _glob_matches(pattern, haystack) def _contains_display_name(self, display_name: Optional[str]) -> bool: """ Check an "event_match" push rule condition. Args: display_name: The display name, or None if there is not one. Returns: True if the display name is found in the event body, False otherwise. """ if not display_name: return False body = self._event.content.get("body", None) if not body or not isinstance(body, str): return False # Similar to _glob_matches, but do not treat display_name as a glob. r = regex_cache.get((display_name, False, True), None) if not r: r1 = re.escape(display_name) r1 = to_word_pattern(r1) r = re.compile(r1, flags=re.IGNORECASE) regex_cache[(display_name, False, True)] = r return bool(r.search(body)) def _relation_match(self, condition: dict, user_id: str) -> bool: """ Check an "relation_match" push rule condition. Args: condition: The "event_match" push rule condition to match. user_id: The user's MXID. Returns: True if the condition matches the event, False otherwise. """ rel_type = condition.get("rel_type") if not rel_type: logger.warning("relation_match condition missing rel_type") return False sender_pattern = condition.get("sender") if sender_pattern is None: sender_type = condition.get("sender_type") if sender_type == "user_id": sender_pattern = user_id type_pattern = condition.get("type") # If any other relations matches, return True. for sender, event_type in self._relations.get(rel_type, ()): if sender_pattern and not _glob_matches(sender_pattern, sender): continue if type_pattern and not _glob_matches(type_pattern, event_type): continue # All values must have matched. return True # No relations matched. return False # Caches (string, is_glob, word_boundary) -> regex for push. See _glob_matches regex_cache: LruCache[Tuple[str, bool, bool], Pattern] = LruCache( 50000, "regex_push_cache" ) def _glob_matches(glob: str, value: str, word_boundary: bool = False) -> bool: """Tests if value matches glob. Args: glob value: String to test against glob. word_boundary: Whether to match against word boundaries or entire string. Defaults to False. """ try: r = regex_cache.get((glob, True, word_boundary), None) if not r: r = glob_to_regex(glob, word_boundary=word_boundary) regex_cache[(glob, True, word_boundary)] = r return bool(r.search(value)) except re.error: logger.warning("Failed to parse glob to regex: %r", glob) return False def _flatten_dict( d: Union[EventBase, Mapping[str, Any]], prefix: Optional[List[str]] = None, result: Optional[Dict[str, str]] = None, ) -> Dict[str, str]: if prefix is None: prefix = [] if result is None: result = {} for key, value in d.items(): if isinstance(value, str): result[".".join(prefix + [key])] = value.lower() elif isinstance(value, Mapping): _flatten_dict(value, prefix=(prefix + [key]), result=result) return result
StarcoderdataPython
1707192
import sys import os UTILS_DIR = os.path.join(os.path.abspath(os.path.dirname(__file__)), '..', 'utils') sys.path.insert(1, UTILS_DIR) from training import train, test if __name__ == '__main__': """ This assumes a pretrained actor at the actor-path. """ BREAK_EARLY = False BATCH_SIZE = 500 for data_subdir in ['ml-20m', 'netflix-prize', 'msd']: actor_path = "WMFVAE_ACTOR_TRAIN_{}".format(data_subdir) train( model_class='wmf_vae', data_subdir=data_subdir, n_epochs_pred_only=100, n_epochs_ac_only=0, n_epochs_pred_and_ac=0, max_kl=0.05, ac_reg_loss_scaler=0.0, actor_reg_loss_scaler=0.0001, evaluation_metric="NDCG", logging_frequency=50, batch_size=BATCH_SIZE, break_early=BREAK_EARLY, verbose=False, positive_weights=5.0, version_tag="FULL_RUN_ON_OTHER_DATASETS", path_to_save_actor=actor_path, log_critic_training_error=False, ) print("Now, hopefully on to testing...") test( model_class='wmf_vae', data_subdir=data_subdir, n_epochs_pred_only=100, n_epochs_ac_only=0, n_epochs_pred_and_ac=0, max_kl=0.05, ac_reg_loss_scaler=0.0, actor_reg_loss_scaler=0.0001, evaluation_metric="NDCG", batch_size=BATCH_SIZE, break_early=BREAK_EARLY, verbose=False, positive_weights=5.0, version_tag="FULL_RUN_ON_OTHER_DATASETS", ) print("On to round 2! Now we'll do the critic.") train( model_class='wmf_vae', data_subdir=data_subdir, n_epochs_pred_only=0, n_epochs_ac_only=50, n_epochs_pred_and_ac=50, max_kl=0.05, ac_reg_loss_scaler=0.0, actor_reg_loss_scaler=0.0001, evaluation_metric="NDCG", logging_frequency=50, batch_size=BATCH_SIZE, break_early=BREAK_EARLY, verbose=False, positive_weights=5.0, version_tag="FULL_RUN_ON_OTHER_DATASETS", restore_trained_actor_path=actor_path, ) print("Now, hopefully on to testing...") test( model_class='wmf_vae', data_subdir=data_subdir, n_epochs_pred_only=0, n_epochs_ac_only=50, n_epochs_pred_and_ac=50, max_kl=0.05, ac_reg_loss_scaler=0.0, actor_reg_loss_scaler=0.0001, evaluation_metric="NDCG", batch_size=BATCH_SIZE, break_early=BREAK_EARLY, verbose=False, positive_weights=5.0, version_tag="FULL_RUN_ON_OTHER_DATASETS", restore_trained_actor_path=actor_path, ) print("Bye bye") exit() # train( # # model_class="wmf", # # model_class='multi_dae', # model_class="wmf_vae", # # model_class='warp_encoder', # n_epochs_pred_only=200, # n_epochs_ac_only=0, # n_epochs_pred_and_ac=0, # # epochs_to_anneal_over=100, # # min_kl=0.0001, # max_kl=0.05, # # ac_reg_loss_scaler=0.0005, # ac_reg_loss_scaler=0.0, # # actor_reg_loss_scaler=0.00001, # # actor_reg_loss_scaler=0.01, # positive_weights=5.0, # # evaluation_metric='AP', # evaluation_metric="NDCG", # # logging_frequency=25, # # logging_frequency=50, # logging_frequency=50, # batch_size=500, # # batch_size=25, # break_early=False, # verbose=False, # # path_to_save_actor="best_ndcg_trained_150_epochs", # # path_to_save_last_actor="last_actor_after_150_trained_epochs", # version_tag="FULL_WMFVAE_RUN_JUST_ACTOR", # path_to_save_actor="200_EPOCHS_WMFVAE_AT_0.05_KL_JUST_ACTOR", # # path_to_save_last_actor="LAST_ACTOR_OF_200_epochs_HIS_KL_annealing", # # restore_trained_actor_path="200_epochs_HIS_DAE", # ) # train( # # model_class="wmf", # # model_class='multi_dae', # model_class="wmf_vae", # # model_class='warp_encoder', # n_epochs_pred_only=0, # n_epochs_ac_only=50, # n_epochs_pred_and_ac=100, # # epochs_to_anneal_over=100, # # min_kl=0.0001, # max_kl=0.05, # # ac_reg_loss_scaler=0.0005, # ac_reg_loss_scaler=0.0, # # actor_reg_loss_scaler=0.00001, # # actor_reg_loss_scaler=0.01, # positive_weights=5.0, # # evaluation_metric='AP', # evaluation_metric="NDCG", # # logging_frequency=25, # # logging_frequency=50, # logging_frequency=50, # batch_size=500, # # batch_size=25, # break_early=False, # verbose=False, # # path_to_save_actor="best_ndcg_trained_150_epochs", # # path_to_save_last_actor="last_actor_after_150_trained_epochs", # version_tag="FULL_WMFVAE_RUN_WITH_CRITIC", # # path_to_save_actor="200_EPOCHS_WMFVAE_AT_0.05_KL", # # path_to_save_last_actor="LAST_ACTOR_OF_200_epochs_HIS_KL_annealing", # restore_trained_actor_path="200_EPOCHS_WMFVAE_AT_0.05_KL_JUST_ACTOR", # ) # print("Now that we've done the thing we really care about, let's have some fun with hyperparameters") # for max_kl in [0.4, 0.2, 0.1, 0.01]: # train( # # model_class="wmf", # # model_class='multi_dae', # model_class="wmf_vae", # # model_class='warp_encoder', # n_epochs_pred_only=100, # n_epochs_ac_only=0, # n_epochs_pred_and_ac=0, # # epochs_to_anneal_over=100, # # min_kl=0.0001, # max_kl=max_kl, # # ac_reg_loss_scaler=0.0005, # ac_reg_loss_scaler=0.0, # # actor_reg_loss_scaler=0.00001, # actor_reg_loss_scaler=0.01, # positive_weights=5.0, # # evaluation_metric='AP', # evaluation_metric="NDCG", # # logging_frequency=25, # # logging_frequency=50, # logging_frequency=50, # batch_size=500, # # batch_size=25, # break_early=False, # verbose=False, # # path_to_save_actor="best_ndcg_trained_150_epochs", # # path_to_save_last_actor="last_actor_after_150_trained_epochs", # version_tag="TESTING_HYPERPARAMETERS", # # path_to_save_actor="200_epochs_HIS_DAE", # # path_to_save_last_actor="LAST_ACTOR_OF_200_epochs_HIS_KL_annealing", # # restore_trained_actor_path="200_epochs_HIS_DAE", # ) # print("On to the next one...") # exit() # print("Now, hopefully on to testing...") # test( # # model_class="wmf", # model_class='multi_dae', # # model_class='warp_encoder', # n_epochs_pred_only=10, # n_epochs_ac_only=0, # n_epochs_pred_and_ac=0, # # epochs_to_anneal_over=100, # # min_kl=0.0001, # # max_kl=0.2, # # ac_reg_loss_scaler=0.0, # # actor_reg_loss_scaler=0.01, # positive_weights=5.0, # # evaluation_metric='AP', # evaluation_metric="NDCG", # # logging_frequency=25, # # logging_frequency=50, # # logging_frequency=50, # batch_size=500, # # batch_size=25, # break_early=False, # verbose=False, # # path_to_save_actor="best_ndcg_trained_150_epochs", # # path_to_save_last_actor="last_actor_after_150_trained_epochs", # version_tag="TRAINING_DAE", # # path_to_save_actor="200_epochs_HIS_DAE", # # restore_trained_actor_path="200_epochs_HIS_DAE", # ) # print("On to round 2! Now we'll do the critic.") # train( # # model_class="wmf", # model_class='multi_dae', # # model_class='warp_encoder', # n_epochs_pred_only=0, # n_epochs_ac_only=50, # n_epochs_pred_and_ac=100, # # epochs_to_anneal_over=100, # # min_kl=0.0001, # max_kl=0.2, # # ac_reg_loss_scaler=0.0005, # ac_reg_loss_scaler=0.0, # # actor_reg_loss_scaler=0.00001, # actor_reg_loss_scaler=0.01, # # positive_weights=positive_weights, # # evaluation_metric='AP', # evaluation_metric="NDCG", # # logging_frequency=25, # # logging_frequency=50, # logging_frequency=50, # batch_size=500, # # batch_size=25, # break_early=False, # verbose=False, # # path_to_save_actor="best_ndcg_trained_150_epochs", # # path_to_save_last_actor="last_actor_after_150_trained_epochs", # version_tag="TRAINING_DAE", # # path_to_save_actor="200_epochs_HIS_DAE", # # path_to_save_last_actor="LAST_ACTOR_OF_200_epochs_HIS_KL_annealing", # restore_trained_actor_path="200_epochs_HIS_DAE", # ) # print("Now, hopefully on to testing...") # test( # # model_class="wmf", # model_class='multi_dae', # # model_class='warp_encoder', # n_epochs_pred_only=0, # n_epochs_ac_only=50, # n_epochs_pred_and_ac=100, # # epochs_to_anneal_over=100, # # min_kl=0.0001, # max_kl=0.2, # ac_reg_loss_scaler=0.0, # actor_reg_loss_scaler=0.01, # # positive_weights=positive_weights, # # evaluation_metric='AP', # evaluation_metric="NDCG", # # logging_frequency=25, # # logging_frequency=50, # # logging_frequency=50, # batch_size=500, # # batch_size=25, # break_early=False, # verbose=False, # # path_to_save_actor="best_ndcg_trained_150_epochs", # # path_to_save_last_actor="last_actor_after_150_trained_epochs", # version_tag="TRAINING_DAE", # # path_to_save_actor="200_epochs_HIS_DAE", # restore_trained_actor_path="200_epochs_HIS_DAE", # ) # print("Bye bye") # exit()
StarcoderdataPython
1714463
#!/usr/bin/python ''' Given a running machine with ssh, apply a configuration ''' import logging import os import sys from bellatrix.lib import bellatrix_util from bellatrix.lib import util import bellatrix.bewitch_ami class Provision(bellatrix.bewitch_ami.Bewitch): def __init__(self, key, sec, app_name, pk, reports): #we cheat on the pk so Bewitch doesn't complain bellatrix.bewitch_ami.Bewitch.__init__(self, key, sec, app_name, pk, reports) def _processConfig(self, config, commands, user, key_name, hostname): """execute a configuration, internal method of run""" errors = [] r, e = self.executeCommands(user, hostname, key_name, commands, config) self.saveReport(r, config) errors += e if len(e) > 0: logging.warning("There were errors while executing the commands. Not burning the instance...") return errors def getVal(self, cfg, module_name, key, local_value): logging.debug("getting value from module:%s key:%s local value:%s module data:%s" \ % (module_name, key, local_value, dir(cfg))) if local_value != None: return local_value else: key = "cfg." + module_name + "." + key if not hasattr(cfg,key) else "cfg." + key try: return eval(key) except: logging.error("Error getting value from module:%s key:%s local value:%s module data:%s" \ % (module_name, key, local_value, dir(cfg))) raise def provision(self, configuration, user, hostname, pk): """execute a configuration""" configs = os.path.splitext(configuration)[0] cfg = configs sys.path = [util.getCurDir()] + sys.path logging.info("processing: " + cfg + " in: " + os.getcwd()) module_name = os.path.basename(cfg) c = util.importModule(cfg) commands = self.getVal(c, module_name, self.CMDS, None) user = self.getVal(c, module_name, self.USER, user) key_name = self.getVal(c, module_name, self.KEY_NAME, pk) util.waitForSSHReady(user, key_name, hostname) errors = self._processConfig(str(configuration), commands, user, key_name, hostname) self.printErrors(errors) return 0 if len(errors)==0 else 1 def run(configuration, user, hostname, pk): r = Provision('', '', bellatrix.APP, __file__, bellatrix_util.getReportsDir()) exit_code = r.provision(configuration, user, hostname, pk) return exit_code if __name__ == '__main__': sys.exit(run(*sys.argv[1:]))
StarcoderdataPython
3201839
from ._NumExpr import NumExpr from ._Basic import AlwaysTrue, AlwaysFalse, And, Not, Or
StarcoderdataPython
123120
def change(img2_head_mask, img2, cv2, convexhull2, result): (x, y, w, h) = cv2.boundingRect(convexhull2) center_face2 = (int((x + x + w) / 2), int((y + y + h) / 2)) #can change it to Mix_clone seamlessclone = cv2.seamlessClone(result, img2, img2_head_mask, center_face2, cv2.NORMAL_CLONE) return seamlessclone
StarcoderdataPython
167709
<reponame>csc-training/geocomputing<filename>pouta/arcpy/test_data/my_arcpy_script.py import arcpy from arcpy.sa import * import os arcpy.env.overwriteOutput = True directory = "./output/" if not os.path.exists(directory): os.makedirs(directory) outFlowDirection = FlowDirection("./dem.tif", "NORMAL") outFlowDirection.save(directory+"flowdir.tif")
StarcoderdataPython
1744661
<reponame>CEHENKLE/opensearch-py<filename>test_opensearchpy/test_server/conftest.py # SPDX-License-Identifier: Apache-2.0 # # The OpenSearch Contributors require contributions made to # this file be licensed under the Apache-2.0 license or a # compatible open source license. # # Modifications Copyright OpenSearch Contributors. See # GitHub history for details. # # Licensed to Elasticsearch B.V. under one or more contributor # license agreements. See the NOTICE file distributed with # this work for additional information regarding copyright # ownership. Elasticsearch B.V. licenses this file to you under # the Apache License, Version 2.0 (the "License"); you may # not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, # software distributed under the License is distributed on an # "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY # KIND, either express or implied. See the License for the # specific language governing permissions and limitations # under the License. import os import time import pytest import opensearchpy from opensearchpy.helpers.test import CA_CERTS, OPENSEARCH_URL from ..utils import wipe_cluster # Information about the OpenSearch instance running, if any # Used for OPENSEARCH_VERSION = "" OPENSEARCH_BUILD_HASH = "" OPENSEARCH_REST_API_TESTS = [] @pytest.fixture(scope="session") def sync_client_factory(): client = None try: # Configure the client with certificates and optionally # an HTTP conn class depending on 'PYTHON_CONNECTION_CLASS' envvar kw = { "timeout": 3, "ca_certs": CA_CERTS, "headers": {"Authorization": "Basic ZWxhc3RpYzpjaGFuZ2VtZQ=="}, } if "PYTHON_CONNECTION_CLASS" in os.environ: from opensearchpy import connection kw["connection_class"] = getattr( connection, os.environ["PYTHON_CONNECTION_CLASS"] ) # We do this little dance with the URL to force # Requests to respect 'headers: None' within rest API spec tests. client = opensearchpy.OpenSearch( OPENSEARCH_URL.replace("elastic:changeme@", ""), **kw ) # Wait for the cluster to report a status of 'yellow' for _ in range(100): try: client.cluster.health(wait_for_status="yellow") break except ConnectionError: time.sleep(0.1) else: pytest.skip("OpenSearch wasn't running at %r" % (OPENSEARCH_URL,)) wipe_cluster(client) yield client finally: if client: client.close() @pytest.fixture(scope="function") def sync_client(sync_client_factory): try: yield sync_client_factory finally: wipe_cluster(sync_client_factory)
StarcoderdataPython
3385895
def to_hex(val): '''Return val as str of hex values concatenated by colons.''' if type(val) is int: return hex(val) try: # Python-2.x if type(val) is long: return hex(val) except NameError: pass # else: try: # Python-2.x return ":".join("{0:02x}".format(ord(char)) for char in val) except TypeError: # Python-3.x return ":".join("{0:02x}".format(char) for char in val) # http://stackoverflow.com/a/16891418 def string_without_prefix(prefix ,string): '''Return string without prefix. If string does not start with prefix, return string. ''' if string.startswith(prefix): return string[len(prefix):] return string def string_with_prefix(prefix, string): '''Return string with prefix prepended. If string already starts with prefix, return string. ''' return str(prefix) + string_without_prefix(str(prefix), str(string))
StarcoderdataPython
3292196
import sys from typing import NoReturn, Optional import click def default(message: str, exit_with_code: Optional[int] = None) -> None: click.echo(message) if exit_with_code: sys.exit(exit_with_code) def success(message: str) -> None: click.secho(message, fg="green") def error(message: str, exit_with_code: Optional[int] = None) -> None: click.secho(message, fg="red", bold=True) if exit_with_code is not None: sys.exit(exit_with_code) def fatal(message: str) -> NoReturn: # type: ignore error(message, exit_with_code=1)
StarcoderdataPython
1674872
<gh_stars>1-10 from __future__ import print_function from math import pi from bokeh.client import push_session from bokeh.document import Document from bokeh.models.glyphs import Line, HBar from bokeh.models import (Plot, ColumnDataSource, DataRange1d, FactorRange, LinearAxis, CategoricalAxis, Grid, Legend) from bokeh.sampledata.population import load_population from bokeh.models.widgets import Select from bokeh.models.layouts import WidgetBox, Column document = Document() session = push_session(document) df = load_population() revision = 2012 year, location = 2010, "World" years = [str(x) for x in sorted(df.Year.unique())] locations = sorted(df.Location.unique()) groups = [str(x) for x in df.AgeGrp.unique()] groups.remove('80+') # remove oddball group source_pyramid_m = ColumnDataSource(data=dict(value=[], group=[])) source_pyramid_f = ColumnDataSource(data=dict(value=[], group=[])) def pyramid(): xdr = DataRange1d() ydr = FactorRange(factors=groups) plot = Plot(x_range=xdr, y_range=ydr, plot_width=600, plot_height=500, toolbar_location=None) xaxis = LinearAxis() plot.add_layout(xaxis, 'below') plot.add_layout(CategoricalAxis(), 'left') plot.add_layout(Grid(dimension=0, ticker=xaxis.ticker)) m = HBar(left="value", right=0, y="group", height=1, fill_color="#3B8686") mglyph = plot.add_glyph(source_pyramid_m, m) f = HBar(left=0, right="value", y="group", height=1, fill_color="#CFF09E") fglyph = plot.add_glyph(source_pyramid_f, f) plot.add_layout(Legend(items=[("Male" , [mglyph]), ("Female" , [fglyph])])) return plot source_known = ColumnDataSource(data=dict(x=[], y=[])) source_predicted = ColumnDataSource(data=dict(x=[], y=[])) def population(): xdr = FactorRange(factors=years) ydr = DataRange1d() plot = Plot(x_range=xdr, y_range=ydr, plot_width=600, plot_height=150, toolbar_location=None) plot.add_layout(CategoricalAxis(major_label_orientation=pi / 4), 'below') known = Line(x="x", y="y", line_color="violet", line_width=2) known_glyph = plot.add_glyph(source_known, known) predicted = Line(x="x", y="y", line_color="violet", line_width=2, line_dash="dashed") predicted_glyph = plot.add_glyph(source_predicted, predicted) legend = Legend(location="bottom_right", items=[("known", [known_glyph]), ("predicted", [predicted_glyph])]) plot.add_layout(legend) return plot def update_pyramid(): pyramid = df[(df.Location == location) & (df.Year == year)] male = pyramid[pyramid.Sex == "Male"] female = pyramid[pyramid.Sex == "Female"] total = df.Value.sum() male_percent = -male.Value / total female_percent = female.Value / total source_pyramid_m.data = dict( group=[str(x) for x in male.AgeGrp.unique()], value=male_percent, ) source_pyramid_f.data = dict( group=[str(x) for x in female.AgeGrp.unique()], value=female_percent, ) def update_population(): population = df[df.Location == location].groupby(df.Year).Value.sum() aligned_revision = revision // 10 * 10 known = population[population.index <= aligned_revision] predicted = population[population.index >= aligned_revision] source_known.data = dict(x=known.index.map(str), y=known.values) source_predicted.data = dict(x=predicted.index.map(str), y=predicted.values) def update_data(): update_population() update_pyramid() def on_year_change(attr, old, new): global year year = int(new) update_data() def on_location_change(attr, old, new): global location location = new update_data() def create_layout(): year_select = Select(title="Year:", value="2010", options=years) location_select = Select(title="Location:", value="World", options=locations) year_select.on_change('value', on_year_change) location_select.on_change('value', on_location_change) controls = WidgetBox(children=[year_select, location_select], height=150, width=600) layout = Column(children=[controls, pyramid(), population()]) return layout layout = create_layout() update_data() document.add_root(layout) session.show(layout) if __name__ == "__main__": document.validate() print("\npress ctrl-C to exit") session.loop_until_closed()
StarcoderdataPython
3309226
""" Installs the vanilla distribution of kubeflow and validates FSx for Lustre integration by: - Installing the FSx CSI Driver from upstream - Creating the required IAM Policy, Role and Service Account - Creating the FSx for Lustre Volume - Creating a StorageClass, PersistentVolume and PersistentVolumeClaim using Static Provisioning """ import pytest import subprocess from e2e.utils.constants import DEFAULT_USER_NAMESPACE from e2e.utils.config import metadata from e2e.conftest import region from e2e.fixtures.cluster import cluster from e2e.fixtures.clients import account_id from e2e.fixtures.kustomize import kustomize, configure_manifests from e2e.fixtures.storage_fsx_dependencies import ( install_fsx_csi_driver, create_fsx_driver_sa, create_fsx_volume, static_provisioning, ) GENERIC_KUSTOMIZE_MANIFEST_PATH = "../../../../example" @pytest.fixture(scope="class") def kustomize_path(): return GENERIC_KUSTOMIZE_MANIFEST_PATH class TestFSx: @pytest.fixture(scope="class") def setup(self, metadata, static_provisioning): metadata_file = metadata.to_file() print(metadata.params) # These needed to be logged print("Created metadata file for TestSanity", metadata_file) def test_pvc_with_volume( self, metadata, account_id, setup, create_fsx_volume, static_provisioning, ): driver_list = subprocess.check_output("kubectl get csidriver".split()).decode() assert "fsx.csi.aws.com" in driver_list pod_list = subprocess.check_output("kubectl get pods -A".split()).decode() assert "fsx-csi-controller" in pod_list sa_account = subprocess.check_output( "kubectl describe -n kube-system serviceaccount fsx-csi-controller-sa".split() ).decode() assert f"arn:aws:iam::{account_id}:role" in sa_account fs_id = create_fsx_volume["file_system_id"] assert "fs-" in fs_id claim_name = static_provisioning["claim_name"] claim_list = subprocess.check_output("kubectl get pvc -A".split()).decode() assert claim_name in claim_list
StarcoderdataPython
72183
<reponame>nthparty/rbcl """Allow users to use classes directly.""" from rbcl.rbcl import\ crypto_scalarmult_ristretto255,\ crypto_scalarmult_ristretto255_BYTES,\ crypto_scalarmult_ristretto255_SCALARBYTES,\ crypto_scalarmult_ristretto255_base,\ crypto_core_ristretto255_BYTES,\ crypto_core_ristretto255_HASHBYTES,\ crypto_core_ristretto255_NONREDUCEDSCALARBYTES,\ crypto_core_ristretto255_SCALARBYTES,\ crypto_core_ristretto255_add,\ crypto_core_ristretto255_from_hash,\ crypto_core_ristretto255_is_valid_point,\ crypto_core_ristretto255_random,\ crypto_core_ristretto255_scalar_add,\ crypto_core_ristretto255_scalar_complement,\ crypto_core_ristretto255_scalar_invert,\ crypto_core_ristretto255_scalar_mul,\ crypto_core_ristretto255_scalar_negate,\ crypto_core_ristretto255_scalar_random,\ crypto_core_ristretto255_scalar_reduce,\ crypto_core_ristretto255_scalar_sub,\ crypto_core_ristretto255_sub,\ randombytes,\ randombytes_buf_deterministic
StarcoderdataPython
182693
"""This package contains infrastructure for solving differential equations within ``simframe``. The ``Integrator`` class is the basic class that advances the simulation from snapshot to snapshot by executing one integration ``Instruction`` at a time. Instructions contain a list of integration ``Scheme``. The ``schemes`` package contains pre-defined integration schemes that are ready to use in ``simframe``.""" from simframe.integration.instruction import Instruction from simframe.integration.integrator import Integrator from simframe.integration.scheme import Scheme import simframe.integration.schemes as schemes __all__ = ["Instruction", "Integrator", "Scheme", "schemes"]
StarcoderdataPython
3390222
import sys sys.setdefaultencoding('utf8')
StarcoderdataPython
1766777
"""Various kernels""" import abc import numpy as np from scipy import signal from fsic import util class Kernel(metaclass=abc.ABCMeta): """Abstract class for kernels""" @abc.abstractmethod def eval(self, X1, X2): """Evalute the kernel on data X1 and X2 """ class KHoPoly(Kernel): """Homogeneous polynomial kernel of the form (x.dot(y))**d""" def __init__(self, degree): if degree <= 0: raise ValueError("degree must be positive; found {}".format(degree)) self.degree = degree def eval(self, X1, X2): return X1.dot(X2.T) ** self.degree def __repr__(self): return "KHoPoly(degree={})".format(self.degree) class KLinear(Kernel): def eval(self, X1, X2): return X1.dot(X2.T) def __repr__(self): return "KLinear()" class KGauss(Kernel): def __init__(self, sigma2): if sigma2 <= 0: raise ValueError("sigma2 must be positive; found {}".format(sigma2)) self.sigma2 = sigma2 def eval(self, X1, X2): """ Evaluate the Gaussian kernel on the two 2d numpy arrays. Parameters ---------- X1 : n1 x d numpy array X2 : n2 x d numpy array Return ------ K : a n1 x n2 Gram matrix. """ d1 = X1.shape[1] d2 = X2.shape[1] if d1 != d2: raise ValueError( "The X1 dimensions (_, {}) do not match the X2 dimensions (_, {})".format( d1, d2 ) ) D2 = util.dist_matrix2(X1, X2) np.divide(D2, -self.sigma2, out=D2) return np.exp(D2) def __repr__(self): return "KGauss(sigma2={})".format(self.sigma2) class KTriangle(Kernel): """ A triangular kernel defined on 1D. k(x, y) = B_1((x-y)/width) where B_1 is the B-spline function of order 1 (i.e., triangular function). """ def __init__(self, width): if width <= 0: raise ValueError("width must be positive; found {}".format(width)) self.width = width def eval(self, X1, X2): """ Evaluate the triangular kernel on the two 2d numpy arrays. Parameters ---------- X1 : n1 x 1 numpy array X2 : n2 x 1 numpy array Return ------ K : a n1 x n2 Gram matrix. """ d1 = X1.shape[1] if d1 != 1: raise ValueError("The X1 dimension (_, {}) must be 1".format(d1)) d2 = X2.shape[1] if d2 != 1: raise ValueError("The X2 dimension (_, {}) must be 1".format(d2)) diff = X1 - X2.T np.divide(diff, self.width, out=diff) return signal.bspline(diff, 1) def __repr__(self): return "KTriangle(width={})".format(self.width)
StarcoderdataPython
1671104
# Generated by Django 2.2.19 on 2021-05-27 20:46 from django.db import migrations, models class Migration(migrations.Migration): dependencies = [ ('tax_calendar', '0001_initial'), ] operations = [ migrations.AddField( model_name='regulator', name='slug', field=models.SlugField(default='a'), ), ]
StarcoderdataPython
4827002
<gh_stars>10-100 """ Random generation of approval profiles """ import random from math import fabs, sqrt from abcvoting.preferences import Profile def random_profile(num_voters, num_cand, prob_distribution, committeesize=None, **kwargs): if prob_distribution == "IC": return random_IC_profile(num_cand, num_voters, **kwargs) elif prob_distribution.startswith("Mallows"): dispersion = float(prob_distribution[7:]) return random_mallows_profile(num_cand, num_voters, dispersion=dispersion, **kwargs) else: raise ValueError(f"Probability model {prob_distribution} unknown.") def random_urn_profile(num_cand, num_voters, setsize, replace): """Generate Polya Urn profile with fixed size approval sets.""" currsize = 1.0 approval_sets = [] replacedsets = {} for _ in range(num_voters): r = random.random() * currsize if r < 1.0: # base case: sample uniformly at random randset = random.sample(range(num_cand), setsize) approval_sets.append(randset) key = tuple(set(randset)) if key in replacedsets: replacedsets[key] += 1 else: replacedsets[key] = 1 currsize += replace else: # sample from one of the replaced ballots r = random.randint(0, sum(replacedsets.values())) for approval_set in replacedsets: count = replacedsets[approval_set] if r <= count: approval_sets.append(list(approval_set)) break else: r -= count profile = Profile(num_cand) profile.add_voters(approval_sets) return profile def random_urn_party_list_profile(num_cand, num_voters, num_parties, replace, uniform=False): """Generate Polya Urn profile from a number of parties. If uniform each party gets the same amount of candidates.""" currsize = 1.0 approval_sets = [] replacedsets = {} parties = list(range(num_parties)) party_cands = __distribute_candidates_to_parties(num_cand, parties, uniform=uniform) for _ in range(num_voters): r = random.random() * currsize if r < 1.0: # base case: sample uniformly at random party = random.choice(parties) randpartyset = list(party_cands[party]) approval_sets.append(randpartyset) if party in replacedsets: replacedsets[party] += 1 else: replacedsets[party] = 1 currsize += replace else: # sample from one of the parties r = random.randint(0, sum(replacedsets.values())) for party in replacedsets: count = replacedsets[party] if r <= count: approval_sets.append(list(party_cands[party])) break else: r -= count profile = Profile(num_cand) profile.add_voters(approval_sets) return profile def random_IC_profile(num_cand, num_voters, setsize): """Generates profile with random assignment of candidates to the fix size of setsize.""" approval_sets = [] for _ in range(num_voters): randset = random.sample(range(num_cand), setsize) approval_sets.append(randset) profile = Profile(num_cand) profile.add_voters(approval_sets) return profile def random_IC_party_list_profile(num_cand, num_voters, num_parties, uniform=False): """Generates profile with random assignment of parties. A party is a list of candidates. If uniform the number of candidates per party is the same, else at least 1.""" parties = list(range(num_parties)) party_cands = __distribute_candidates_to_parties(num_cand, parties, uniform=uniform) approval_sets = [] for _ in range(num_voters): approval_sets.append(party_cands[random.choice(parties)]) profile = Profile(num_cand) profile.add_voters(approval_sets) return profile def random_2d_points_profile( num_cand, num_voters, candpointmode, voterpointmode, sigma, approval_threshold ): """Generates profiles from randomly generated 2d points according to some distributions with the given sigma.""" voters = list(range(num_voters)) cands = list(range(num_cand)) voter_points = __generate_2d_points(voters, voterpointmode, sigma) cand_points = __generate_2d_points(cands, candpointmode, sigma) approval_sets = __get_profile_from_points( voters, cands, voter_points, cand_points, approval_threshold ) profile = Profile(num_cand) profile.add_voters(approval_sets) return profile def random_2d_points_party_list_profile( num_cand, num_voters, num_parties, partypointmode, voterpointmode, sigma, uniform=False ): """Generates profiles from randomly generated 2d points according to some distributions with the given sigma. This selects parties for each voter, the parties are either uniform (equal size) or randomly generated (at least 1) candidate lists.""" parties = list(range(num_parties)) party_cands = __distribute_candidates_to_parties(num_cand, parties, uniform=uniform) voters = list(range(num_voters)) voter_points = __generate_2d_points(voters, voterpointmode, sigma) party_points = __generate_2d_points(parties, partypointmode, sigma) party_sets = __get_profile_from_points(voters, parties, voter_points, party_points, 1.0) approval_sets = [] for p in party_sets: approval_sets.append(party_cands[p[0]]) profile = Profile(num_cand) profile.add_voters(approval_sets) return profile def random_mallows_profile(num_cand, num_voters, setsize, dispersion): """Generates a Mallows Profile after the definition for repeated insertion mode (RIM) in https://icml.cc/2011/papers/135_icmlpaper.pdf""" if not (0 < dispersion <= 1): raise Exception("Invalid dispersion, needs to be in (0, 1].") reference_ranking = list(range(num_cand)) random.shuffle(reference_ranking) insert_dist = __compute_mallows_insert_distributions(num_cand, dispersion) approval_sets = [] for _ in range(num_voters): vote = [] for i, distribution in enumerate(insert_dist): pos = __select_pos(distribution) vote.insert(pos, reference_ranking[i]) approval_sets.append(vote[:setsize]) profile = Profile(num_cand) profile.add_voters(approval_sets) return profile def __compute_mallows_insert_distributions(num_cand, dispersion): """Computes the insertion probability vectors for the dispersion and a given number of candidates""" distributions = [] denominator = 0 for i in range(num_cand): # compute the denominator = dispersion^0 + dispersion^1 # + ... dispersion^(i-1) denominator += pow(dispersion, i) dist = [] for j in range(i + 1): # 0..i dist.append(pow(dispersion, i - j) / denominator) distributions.append(dist) return distributions def __select_pos(distribution): """Returns a randomly selected value with the help of the distribution""" if round(sum(distribution), 10) != 1.0: raise Exception("Invalid Distribution", distribution, "sum:", sum(distribution)) r = round(random.random(), 10) # or random.uniform(0, 1) pos = -1 s = 0 for prob in distribution: pos += 1 s += prob if s >= r: return pos return pos # in case of rounding errors def __distribute_candidates_to_parties(num_cand, parties, uniform): """Distributes the candidates to the parties. Either uniformly distributed or randomly distributed with at least one candidate per party.""" if num_cand < len(parties): raise ValueError("Not enough candidates to split them between" + "the parties.") if uniform: if num_cand % len(parties) != 0: raise ValueError( "To uniformly distribute candidates " + "between parties the number of candidates" + " needs to be divisible by the number of" + " parties." ) party_cands = {} party_size = int(num_cand / len(parties)) cands = set(range(num_cand)) for i, party in enumerate(parties): # note: there is no guaranty about reproducibility because cands is a set appr = random.sample(tuple(cands), party_size) party_cands[party] = appr cands = cands - set(appr) return party_cands else: # not uniform num_parties = len(parties) party_cands = {} num_random_cands = num_cand - num_parties for i, party in enumerate(parties): party_cands[party] = [num_random_cands + i] for cand in range(num_random_cands): party = random.choice(parties) party_cands[party].append(cand) return party_cands def __generate_2d_points(agents, mode, sigma): """Generates a list of 2d coordinates subject to various distributions.""" points = {} # normal distribution, 1/3 of agents centered on (-0.5,-0.5), # 2/3 of agents on (0.5,0.5) if mode == "twogroups": for i in range(int(len(agents) // 3)): points[agents[i]] = (random.gauss(-0.5, sigma), random.gauss(-0.5, sigma)) for i in range(int(len(agents) // 3), len(agents)): points[agents[i]] = (random.gauss(0.5, sigma), random.gauss(0.5, sigma)) # normal distribution elif mode == "normal": for i in range(len(agents)): points[agents[i]] = (random.gauss(0.0, sigma), random.gauss(0.0, sigma)) elif mode == "uniform_square": for a in agents: points[a] = (random.uniform(-1, 1), random.uniform(-1, 1)) else: raise ValueError("mode", mode, "not known") return points def __euclidean(p1, p2): return sqrt(fabs(p1[0] - p2[0]) ** 2 + fabs(p1[1] - p2[1]) ** 2) def __get_profile_from_points(voters, cands, voter_points, cand_points, approval_threshold): """Generates a list of approval sets from 2d points according to approval_threshold.""" profile = {} for v in voters: distances = {cand: __euclidean(voter_points[v], cand_points[cand]) for cand in cands} mindist = min(distances.values()) profile[v] = [cand for cand in cands if distances[cand] <= mindist * approval_threshold] return list(profile.values())
StarcoderdataPython
1755359
<reponame>iashraful/survey-api """slug-added Revision ID: e4367957251b Revises: <PASSWORD> Create Date: 2021-09-18 07:59:48.356988 """ from alembic import op import sqlalchemy as sa # revision identifiers, used by Alembic. revision = '<KEY>' down_revision = '<PASSWORD>' branch_labels = None depends_on = None def upgrade(): # ### commands auto generated by Alembic - please adjust! ### op.add_column('survey_responses', sa.Column('slug', sa.String(), nullable=True)) op.create_unique_constraint(None, 'survey_responses', ['slug']) op.add_column('surveys', sa.Column('slug', sa.String(), nullable=True)) op.create_unique_constraint(None, 'surveys', ['slug']) # ### end Alembic commands ### def downgrade(): # ### commands auto generated by Alembic - please adjust! ### op.drop_constraint(None, 'surveys', type_='unique') op.drop_column('surveys', 'slug') op.drop_constraint(None, 'survey_responses', type_='unique') op.drop_column('survey_responses', 'slug') # ### end Alembic commands ###
StarcoderdataPython
95773
<reponame>megado123/azure-cosmosdb-python-function-app import json import os import uuid import docdb import platform print("Python == ", platform.python_version()) os.environ["DOCDB_HOST"] = 'https://cs489cosmossql.documents.azure.com:443/' os.environ["DOCDB_KEY"] = '<KEY> # request body (POST requests) is stored in a file # and the file path is exposed as an environment variable with open(os.environ["REQ"]) as req: details = json.loads(req.read()) # note that there's no init for functions, so this will be # executed everytime the function is triggered :( # see https://github.com/Azure/azure-webjobs-sdk-script/issues/586 repository = docdb.Repository(os.environ["DOCDB_HOST"], os.environ["DOCDB_KEY"]) print(details) print(uuid.uuid4()) # using email as partition key, so ensure that it exists, # even if it's made up :) #if not details.has_key("email"): # details["email"] = <EMAIL>" % uuid.uuid4() print ("Storing the contact details in Azure Document DB") doc = repository.insert(details) print ("Repository returned %s" % doc) #new stuff responsedata = {} responsedata['key'] = details['GID'] + "-" + details['Sample'] + "-" + details['Material'] json_data = json.dumps(responsedata) #response = json_data #response.write(json_data) #response.close() response = open(os.environ['resp'], 'w') response.write(json_data) response.close()
StarcoderdataPython
178331
<gh_stars>0 from enum import Enum class Side(Enum): """ Brain hemisphere side. """ LEFT = 'left' RIGHT = 'right'
StarcoderdataPython
3287527
# ************************************************************ # Copyright (c) 2020, <NAME> - All Rights Reserved. # You may use, distribute and modify this code under the # terms of the BSD-3 license. You should have received a copy # of the BSD-3 license with this file. # If not, visit: https://opensource.org/licenses/BSD-3-Clause # ************************************************************ from math import atan2 from networkx import Graph ## Convert and edge to a dart. # order of vertices is important. To get the dart in the other # direction swap order of nodes or use alpha function. def edge2dart(edge: tuple) -> str: return ",".join(map(str, edge)) ## Get edge corresponding to given dart. def dart2edge(dart: str) -> tuple: return tuple(map(int, dart.split(","))) ## Get node numbers associated with given boundary cycle. # No specific order is guaranteed. def cycle2nodes(cycle: tuple) -> list: return [int(dart2edge(dart)[0]) for dart in cycle] ## Find boundary cycle associated with given set of nodes. # WARNING: This function is unsafe to use since the cycle # associated with a set of nodes may be non-unique. Extra # checks should be in place. This function will return the # first cycle that is found with a matching set of nodes. def nodes2cycle(node_list: list, boundary_cycles: list) -> tuple: for cycle in boundary_cycles: if set(node_list) == set(cycle2nodes(cycle)): return cycle ## This class implements a combinatorial map. # A 2-dimensional combinatorial map (or 2-map) is a triplet M = (D, σ, α) such that: # # D is a finite set of darts; # σ is a permutation on D; # α is an involution on D with no fixed point. # # Intuitively, a 2-map corresponds to a planar graph where each edge is subdivided into two # darts (sometimes also called half-edges). The permutation σ gives, for each dart, the next # dart by turning around the vertex in the positive orientation; the other permutation α gives, # for each dart, the other dart of the same edge. # # α allows one to retrieve edges, and σ allows one to retrieve vertices. We define φ = σ o α # which gives, for each dart, the next dart of the same face. class CMap: ## Initialize combinatorial map with Graph and Points list. # You can optionally initialize with the rotation_data, meaning # that for each node, you provide the list of edges from that node # to each connected neighbor in counter-clockwise order. Leave # points empty if the feature is desired. Otherwise the rotation_data # will be computed from the point data. def __init__(self, graph: Graph, points: list = (), rotation_data: list = ()) -> None: self._sorted_darts = dict() self._boundary_cycles = [] if rotation_data: sorted_edges = rotation_data else: sorted_edges = get_rotational_data(graph, points) for node in graph.nodes(): self._sorted_darts[node] = [edge2dart((e2, e1)) for (e1, e2) in sorted_edges[node]] self.darts = [edge2dart((e1, e2)) for e1, e2 in graph.edges] self.darts.extend([edge2dart((e2, e1)) for e1, e2 in graph.edges]) self.set_boundary_cycles() ## Get next outgoing dart. # For a given outgoing dart, return the next outgoing dart in counter-clockwise # order. def sigma(self, dart: str) -> str: neighbor, node = dart2edge(dart) index = self._sorted_darts[node].index(dart) n_neigh = len(self._sorted_darts[node]) # Get next dart, wrap-around if out of range return self._sorted_darts[node][(index + 1) % n_neigh] ## Get other half edge. # for each dart, return the other dart associated with the same edge. @staticmethod def alpha(dart: str) -> str: return edge2dart(tuple(reversed(dart2edge(dart)))) ## Get next outgoing dart. # For a given incoming dart, return the next outgoing dart in counter-clockwise # direction. def phi(self, dart: str) -> str: return self.sigma(self.alpha(dart)) ## compute boundary cycles. # iterate on phi until all darts have been accounted for. # This will produce a list of boundary cycles. These cycles # are stored internally and should only be accessed through # the public member functions. def set_boundary_cycles(self) -> None: self._boundary_cycles = [] all_darts = self.darts.copy() while all_darts: cycle = [all_darts.pop()] next_dart = self.phi(cycle[0]) while next_dart != cycle[0]: all_darts.remove(next_dart) cycle.append(next_dart) next_dart = self.phi(next_dart) self._boundary_cycles.append(cycle) ## Get boundary cycle nodes. # The function returns the node numbers of each boundary cycle. The nodes # are left in cyclic order, used mostly for plotting. def boundary_cycle_nodes_ordered(self) -> list: return [tuple([dart2edge(dart)[0] for dart in cycle]) for cycle in self._boundary_cycles] ## Get Boundary Cycles. # This will access the boundary cycles, and return them with each boundary cycle's darts # in a sorted order for a unique representation. def get_boundary_cycles(self) -> list: return [tuple(sorted(cycle)) for cycle in self._boundary_cycles] ## Get Rotational Data from points. # This function is used to compute the rotational data from point data if not explicitly given. def get_rotational_data(graph, points) -> list: sorted_edges = [[] for _ in range(graph.order())] for node in graph.nodes(): neighbors = list(graph.neighbors(node)) # zip neighbors with associated coordinates for sorting neighbor_zip = list(zip(neighbors, [points[n] for n in neighbors])) anticlockwise, clockwise = False, True # sort w.r.t angle from x axis def theta(a, center): oa = (a[0] - center[0], a[1] - center[1]) return atan2(oa[1], oa[0]) # Sort sorted_zip = sorted(neighbor_zip, key=lambda pair: theta(pair[1], points[node]), reverse=anticlockwise) # Extract sorted edges sorted_edges[node] = [(node, n) for (n, _) in sorted_zip] return sorted_edges
StarcoderdataPython
1618374
class Solution: def minDistance(self, word1: str, word2: str) -> int: m = len(word1) n = len(word2) mat = [[0] * (n + 1) for _ in range(m + 1)] for i in range(m + 1): mat[i][0] = i for j in range(n + 1): mat[0][j] = j print(mat) for i in range(1,m+1): for j in range(1,n+1): if word1[i-1]==word2[j-1]: mat[i][j]=mat[i-1][j-1] else: x = min(mat[i][j-1],mat[i-1][j],mat[i-1][j-1]) mat[i][j]=x+1 return mat[-1][-1]
StarcoderdataPython
42750
<filename>awsrun/student/tasks.py import os import time from abc import ABC, abstractmethod, ABCMeta from common.commands import Compress, Upload, SendMsg, Download, Decompress from common.configuration import AWSConfig from common.protocol import IOTask, AWSMsg, AWSIDRegistration from common.resources import Folder, File, OSPath from multipledispatch import dispatch class Issuer(ABC): @abstractmethod def issue(self, task: AWSMsg): pass class AWSIssuer(Issuer): def __init__(self, awsconfig: AWSConfig): self._awsconfig = awsconfig @staticmethod def dependencies(task: IOTask): deps = [] cwd = Folder.cwd() deps.extend(map(lambda f: cwd.relative(f), map(lambda p: OSPath.new(p), filter(lambda arg: os.path.exists(arg), task.command.shell)))) deps.extend(map(lambda f: cwd.relative(f), task.command.deps)) return deps def _operands(self, task: IOTask): resources = Compress(task.workspace.input, *AWSIssuer.dependencies(task)).execute() uploaded = Upload(self._awsconfig.serverpath, self._awsconfig.bucketpath, resources).execute() # Echo status back to user. print("Resources {0} is transfered\n".format(uploaded.path)) time.sleep(1) def _operator(self, task: IOTask): return SendMsg(self._awsconfig.serverpath, self._awsconfig.taskpath, task).execute() def _clean_files(self, task: IOTask): os.remove(task.workspace.local_input) os.remove(task.workspace.local_output) def _output(self, task: IOTask): retrieved = Download(self._awsconfig.serverpath, self._awsconfig.bucketpath, task.workspace.output, task.command.timeout).execute() cwd = Folder(os.path.normpath(os.getcwd())) # files to extract stdout_report = File('stdout') stderr_report = File('stderr') target = Decompress(cwd, retrieved, stdout_report, stderr_report).execute() # report target.relative(stdout_report).content(header=" STDOUT ") target.relative(stderr_report).content(header=" STDERR ") # if task.perf_file: Decompress(task.lwd.relative(task.workspace.root).create(), task.workspace.local_input).execute() self._clean_files(task) @dispatch(IOTask) def issue(self, task): self._operands(task) self._operator(task) self._output(task) @dispatch(AWSIDRegistration) def issue(self, reg): SendMsg(self._awsconfig.serverpath, self._awsconfig.regpath, reg).execute()
StarcoderdataPython
3326452
<gh_stars>10-100 import falcon from .hello import HelloName from .root import Root def get_routes(app: falcon.App): app.add_route("/", Root()) app.add_route("/hello/{name}", HelloName())
StarcoderdataPython
152409
<filename>conftest.py import pytest import requests import shutil from pathlib import Path from typing import Generator from readimc import MCDFile, TXTFile _imc_test_data_asset_url = ( "https://github.com/BodenmillerGroup/TestData" "/releases/download/v1.0.7/210308_ImcTestData_raw.tar.gz" ) _imc_test_data_raw_dir = "datasets/210308_ImcTestData/raw" _imc_test_data_mcd_file = "20210305_NE_mockData1/20210305_NE_mockData1.mcd" _imc_test_data_txt_file = ( "20210305_NE_mockData1/20210305_NE_mockData1_ROI_001_1.txt" ) def _download_and_extract_asset(tmp_dir_path: Path, asset_url: str): asset_file_path = tmp_dir_path / "asset.tar.gz" response = requests.get(asset_url, stream=True) if response.status_code == 200: with asset_file_path.open(mode="wb") as f: f.write(response.raw.read()) shutil.unpack_archive(asset_file_path, tmp_dir_path) @pytest.fixture(scope="session") def imc_test_data_raw_path(tmp_path_factory) -> Generator[Path, None, None]: tmp_dir_path = tmp_path_factory.mktemp("raw") _download_and_extract_asset(tmp_dir_path, _imc_test_data_asset_url) yield tmp_dir_path / Path(_imc_test_data_raw_dir) shutil.rmtree(tmp_dir_path) @pytest.fixture def imc_test_data_mcd_file( imc_test_data_raw_path: Path, ) -> Generator[MCDFile, None, None]: path = imc_test_data_raw_path / Path(_imc_test_data_mcd_file) with MCDFile(path) as f: yield f @pytest.fixture def imc_test_data_txt_file( imc_test_data_raw_path: Path, ) -> Generator[TXTFile, None, None]: path = imc_test_data_raw_path / Path(_imc_test_data_txt_file) with TXTFile(path) as f: yield f
StarcoderdataPython
166824
import os import sys from plistlib import Plist from . import __version__ as bdist_mpkg_version from . import tools from .py3k import unicode, u, any_str_type def _major_minor(v): rval = [0, 0] try: for i, rev in enumerate(v.version): rval[i] = int(rev) except (TypeError, ValueError, IndexError): pass return rval def common_info(name, version): # Keys that can appear in any package name, version = unicode(name), tools.Version(version) major, minor = _major_minor(version) return dict( CFBundleGetInfoString=u('%s %s' % (name, version)), CFBundleIdentifier=u('org.pythonmac.%s' % (name,)), CFBundleName=name, CFBundleShortVersionString=unicode(version), IFMajorVersion=major, IFMinorRevision=minor, IFPkgFormatVersion=0.10000000149011612, IFRequirementDicts=[path_requirement(u('/'))], PythonInfoDict=dict( PythonLongVersion=unicode(sys.version), PythonShortVersion=unicode(sys.version[:3]), PythonExecutable=unicode(sys.executable), bdist_mpkg=dict( version=unicode(bdist_mpkg_version), ), ), ) def pkg_info(name, version): d = common_info(name, version) # Keys that can only appear in single packages d.update(dict( IFPkgFlagAllowBackRev=False, IFPkgFlagAuthorizationAction=u('AdminAuthorization'), #IFPkgFlagDefaultLocation=u'/Library/Python/2.3', IFPkgFlagFollowLinks=True, IFPkgFlagInstallFat=False, IFPkgFlagIsRequired=False, IFPkgFlagOverwritePermissions=False, IFPkgFlagRelocatable=False, IFPkgFlagRestartAction=u('NoRestart'), IFPkgFlagRootVolumeOnly=True, IFPkgFlagUpdateInstalledLangauges=False, )) return d def path_requirement(SpecArgument, Level=u('requires'), **kw): return dict( Level=Level, SpecType=u('file'), SpecArgument=tools.unicode_path(SpecArgument), SpecProperty=u('NSFileType'), TestOperator=u('eq'), TestObject=u('NSFileTypeDirectory'), **kw ) FRIENDLY_PREFIX = { os.path.expanduser(u('~/Library/Frameworks')) : u('User'), u('/System/Library/Frameworks') : u('Apple'), u('/Library/Frameworks') : u('python.org'), u('/opt/local') : u('DarwinPorts'), u('/usr/local') : u('Unix'), u('/sw') : u('Fink'), } def python_requirement(pkgname, prefix=None, version=None, **kw): if prefix is None: prefix = sys.prefix if version is None: version = sys.version[:3] prefix = os.path.realpath(prefix) fmwkprefix = os.path.dirname(os.path.dirname(prefix)) is_framework = fmwkprefix.endswith('.framework') if is_framework: dprefix = os.path.dirname(fmwkprefix) else: dprefix = prefix dprefix = tools.unicode_path(dprefix) name = u('%s Python %s' % (FRIENDLY_PREFIX.get(dprefix, dprefix), version)) kw.setdefault('LabelKey', name) title = u('%s requires %s to install.' % (pkgname, name,)) kw.setdefault('TitleKey', title) kw.setdefault('MessageKey', title) return path_requirement(prefix, **kw) def mpkg_info(name, version, packages=[]): d = common_info(name, version) # Keys that can appear only in metapackages npackages = [] for p in packages: items = getattr(p, 'items', None) if items is not None: p = dict(items()) else: if isinstance(p, any_str_type): p = [p] p = dict(zip( (u('IFPkgFlagPackageLocation'), u('IFPkgFlagPackageSelection')), p )) npackages.append(p) d.update(dict( IFPkgFlagComponentDirectory=u('./Contents/Packages'), IFPkgFlagPackageList=npackages, )) return d def checkpath_plugin(path): # This does not appear to be called in this codebase if not isinstance(path, unicode): path = unicode(path, encoding) # encoding not defined return dict( searchPlugin=u('CheckPath'), path=path, ) def common_description(name, version): name, version = unicode(name), tools.Version(version) return dict( IFPkgDescriptionTitle=name, IFPkgDescriptionVersion=unicode(version), ) def write(dct, path): p = Plist() p.update(dct) p.write(path)
StarcoderdataPython
157249
# Copyright (C) 2015 by <NAME> <<EMAIL>> # # muniments is freely distributable under the terms of an MIT-style license. # See COPYING or http://www.opensource.org/licenses/mit-license.php. from test_muniments.test_fixtures import register_fixture from test_muniments.test_integration.test_external.test_couchdb import CouchDbReadFixture from test_muniments.test_integration.test_external.test_couchdb import CouchDbWriteFixture from test_muniments.test_unit.test_scheduler.test_models import test_schedule for module in [ getattr(test_schedule, module_name) for module_name in dir(test_schedule) if module_name.startswith('model_') ]: register_fixture(globals(), ( CouchDbReadFixture, ), module.DATA) register_fixture(globals(), ( CouchDbWriteFixture, ), module.DATA)
StarcoderdataPython
4839375
<gh_stars>1-10 # -*- coding:UTF-8 -*- # Author:<NAME> # Date: Fri, 26 Feb 2021, 00:55 # Project Euler # 060 Prime pair sets #==================================================================Solution import os, sys BASE_DIR = os.path.dirname(os.path.abspath(__file__)) sys.path.append(BASE_DIR) sys.path.append(BASE_DIR.partition('P060')[0] + 'Utility Class') from prime_utility import * limit = 10000 prime_class = Prime(limit) prime_class._traverse() prime_list = prime_class._get_prime_list() def is_prime(p): if p == 1: return False if p == 2: return True for i in range(2, int(p ** 0.5) + 1): if p % i == 0: return False return True def is_prime_pair(p1, p2): if is_prime(int(str(p1) + str(p2))) == True and is_prime(int(str(p2) + str(p1))) == True: return True return False def is_prime_pair_set(prime_set): for p1 in range(len(prime_set) - 1): for p2 in range(p1 + 1, len(prime_set)): if is_prime_pair(prime_set[p1], prime_set[p2]) != True: return False return True def find_ans(): for i1 in range(len(prime_list) - 4): for i2 in range(i1 + 1, len(prime_list) - 3): if is_prime_pair_set([prime_list[i1], prime_list[i2]]) == True: for i3 in range(i2 + 1, len(prime_list) - 2): if is_prime_pair_set([prime_list[i1], prime_list[i2], prime_list[i3]]) == True: for i4 in range(i3 + 1, len(prime_list) - 1): if is_prime_pair_set([prime_list[i1], prime_list[i2], prime_list[i3], prime_list[i4]]) == True: for i5 in range(i4 + 1, len(prime_list)): if is_prime_pair_set([prime_list[i1], prime_list[i2], prime_list[i3], prime_list[i4], prime_list[i5]]) == True: return sum([prime_list[i1], prime_list[i2], prime_list[i3], prime_list[i4], prime_list[i5]]) print(find_ans())
StarcoderdataPython
1640605
# Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. from typing import Union, Sequence from .result_with_mhc_class import ResultWithMhcClass from .species import Species from .gene import Gene class Class2Locus(ResultWithMhcClass): def __init__( self, species : Species, name : str, mhc_class : str = "II", genes : Sequence[Gene] = [], raw_string : Union[str, None] = None): ResultWithMhcClass.__init__( self, species=species, mhc_class=mhc_class, raw_string=raw_string) self.name = name self.genes = genes @property def locus_name(self): return self.name @classmethod def eq_field_names(cls): return ("species", "name") @classmethod def str_field_names(cls): return ("species", "name") def to_string(self, include_species=True, use_old_species_prefix=False): species_string = self.species.to_string( include_species=include_species, use_old_species_prefix=use_old_species_prefix) return species_string + "-" + self.name def compact_string(self, include_species=False, use_old_species_prefix=False): return self.to_string( include_species=include_species, use_old_species_prefix=use_old_species_prefix) @property def gene_names(self): return [g.name for g in self.genes] @classmethod def endswith_ignore_digits(cls, s1, s2): while s1[-1].isdigit(): s1 = s1[:-1] return s1.endswith(s2) @property def alpha_chain_genes(self): results = [] for g in self.genes: name = g.name if self.endswith_ignore_digits(name.lower(), "a"): results.append(g) return results @property def beta_chain_genes(self): results = [] for g in self.genes: name = g.name if self.endswith_ignore_digits(name.lower(), "b"): results.append(g) return results @property def alpha_chain_gene_names(self): return [g.name for g in self.alpha_chain_genes] @property def beta_chain_gene_names(self): return [g.name for g in self.beta_chain_genes] @classmethod def get(cls, species_prefix, locus_name): if type(species_prefix) is Species: species = species_prefix else: species = Species.get(species_prefix) if species is None: return None raw_string = locus_name locus_name = species.find_matching_class2_locus_name(locus_name) if locus_name is None: return None gene_names = species.class2_locus_to_gene_names[locus_name] genes = [] for gene_name in gene_names: gene = Gene.get(species, gene_name) if gene is None: continue genes.append(gene) return Class2Locus( species=species, name=locus_name, genes=genes, raw_string=raw_string)
StarcoderdataPython
194385
# Generated by the protocol buffer compiler. DO NOT EDIT! # source: broker/dev/service_class.proto import sys _b=sys.version_info[0]<3 and (lambda x:x) or (lambda x:x.encode('latin1')) from google.protobuf import descriptor as _descriptor from google.protobuf import message as _message from google.protobuf import reflection as _reflection from google.protobuf import symbol_database as _symbol_database from google.protobuf import descriptor_pb2 # @@protoc_insertion_point(imports) _sym_db = _symbol_database.Default() DESCRIPTOR = _descriptor.FileDescriptor( name='broker/dev/service_class.proto', package='istio.broker.dev', syntax='proto3', serialized_pb=_b('\n\x1e\x62roker/dev/service_class.proto\x12\x10istio.broker.dev\"o\n\x0cServiceClass\x12\x30\n\ndeployment\x18\x01 \x01(\x0b\x32\x1c.istio.broker.dev.Deployment\x12-\n\x05\x65ntry\x18\x02 \x01(\x0b\x32\x1e.istio.broker.dev.CatalogEntry\"\x1e\n\nDeployment\x12\x10\n\x08instance\x18\x01 \x01(\t\"=\n\x0c\x43\x61talogEntry\x12\x0c\n\x04name\x18\x01 \x01(\t\x12\n\n\x02id\x18\x02 \x01(\t\x12\x13\n\x0b\x64\x65scription\x18\x03 \x01(\tB\x19Z\x17istio.io/api/broker/devb\x06proto3') ) _SERVICECLASS = _descriptor.Descriptor( name='ServiceClass', full_name='istio.broker.dev.ServiceClass', filename=None, file=DESCRIPTOR, containing_type=None, fields=[ _descriptor.FieldDescriptor( name='deployment', full_name='istio.broker.dev.ServiceClass.deployment', index=0, number=1, type=11, cpp_type=10, label=1, has_default_value=False, default_value=None, message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='entry', full_name='istio.broker.dev.ServiceClass.entry', index=1, number=2, type=11, cpp_type=10, label=1, has_default_value=False, default_value=None, message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, options=None, file=DESCRIPTOR), ], extensions=[ ], nested_types=[], enum_types=[ ], options=None, is_extendable=False, syntax='proto3', extension_ranges=[], oneofs=[ ], serialized_start=52, serialized_end=163, ) _DEPLOYMENT = _descriptor.Descriptor( name='Deployment', full_name='istio.broker.dev.Deployment', filename=None, file=DESCRIPTOR, containing_type=None, fields=[ _descriptor.FieldDescriptor( name='instance', full_name='istio.broker.dev.Deployment.instance', index=0, number=1, type=9, cpp_type=9, label=1, has_default_value=False, default_value=_b("").decode('utf-8'), message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, options=None, file=DESCRIPTOR), ], extensions=[ ], nested_types=[], enum_types=[ ], options=None, is_extendable=False, syntax='proto3', extension_ranges=[], oneofs=[ ], serialized_start=165, serialized_end=195, ) _CATALOGENTRY = _descriptor.Descriptor( name='CatalogEntry', full_name='istio.broker.dev.CatalogEntry', filename=None, file=DESCRIPTOR, containing_type=None, fields=[ _descriptor.FieldDescriptor( name='name', full_name='istio.broker.dev.CatalogEntry.name', index=0, number=1, type=9, cpp_type=9, label=1, has_default_value=False, default_value=_b("").decode('utf-8'), message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='id', full_name='istio.broker.dev.CatalogEntry.id', index=1, number=2, type=9, cpp_type=9, label=1, has_default_value=False, default_value=_b("").decode('utf-8'), message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, options=None, file=DESCRIPTOR), _descriptor.FieldDescriptor( name='description', full_name='istio.broker.dev.CatalogEntry.description', index=2, number=3, type=9, cpp_type=9, label=1, has_default_value=False, default_value=_b("").decode('utf-8'), message_type=None, enum_type=None, containing_type=None, is_extension=False, extension_scope=None, options=None, file=DESCRIPTOR), ], extensions=[ ], nested_types=[], enum_types=[ ], options=None, is_extendable=False, syntax='proto3', extension_ranges=[], oneofs=[ ], serialized_start=197, serialized_end=258, ) _SERVICECLASS.fields_by_name['deployment'].message_type = _DEPLOYMENT _SERVICECLASS.fields_by_name['entry'].message_type = _CATALOGENTRY DESCRIPTOR.message_types_by_name['ServiceClass'] = _SERVICECLASS DESCRIPTOR.message_types_by_name['Deployment'] = _DEPLOYMENT DESCRIPTOR.message_types_by_name['CatalogEntry'] = _CATALOGENTRY _sym_db.RegisterFileDescriptor(DESCRIPTOR) ServiceClass = _reflection.GeneratedProtocolMessageType('ServiceClass', (_message.Message,), dict( DESCRIPTOR = _SERVICECLASS, __module__ = 'broker.dev.service_class_pb2' # @@protoc_insertion_point(class_scope:istio.broker.dev.ServiceClass) )) _sym_db.RegisterMessage(ServiceClass) Deployment = _reflection.GeneratedProtocolMessageType('Deployment', (_message.Message,), dict( DESCRIPTOR = _DEPLOYMENT, __module__ = 'broker.dev.service_class_pb2' # @@protoc_insertion_point(class_scope:istio.broker.dev.Deployment) )) _sym_db.RegisterMessage(Deployment) CatalogEntry = _reflection.GeneratedProtocolMessageType('CatalogEntry', (_message.Message,), dict( DESCRIPTOR = _CATALOGENTRY, __module__ = 'broker.dev.service_class_pb2' # @@protoc_insertion_point(class_scope:istio.broker.dev.CatalogEntry) )) _sym_db.RegisterMessage(CatalogEntry) DESCRIPTOR.has_options = True DESCRIPTOR._options = _descriptor._ParseOptions(descriptor_pb2.FileOptions(), _b('Z\027istio.io/api/broker/dev')) # @@protoc_insertion_point(module_scope)
StarcoderdataPython
73375
<gh_stars>0 import pytest from graphapi.tests.utils import populate_db from openstates.data.models import Organization, Person, Membership from utils.common import pretty_url @pytest.mark.django_db def setup(): populate_db() house = Organization.objects.get( classification="lower", jurisdiction__name="Alaska" ) r = Organization.objects.create( name="Robots", classification="committee", parent=house, jurisdiction=house.jurisdiction, ) w = Organization.objects.create( name="Wizards", classification="committee", parent=house, jurisdiction=house.jurisdiction, ) # one robot p = Person.objects.get(name="<NAME>") Membership.objects.create(person=p, organization=r) # all are wizards for p in Person.objects.all()[:5]: Membership.objects.create(person=p, organization=w) @pytest.mark.skip("committees view is disabled for now") @pytest.mark.django_db def test_committees_view(client, django_assert_num_queries): with django_assert_num_queries(3): resp = client.get("/ak/committees/") assert resp.status_code == 200 assert resp.context["state"] == "ak" assert resp.context["state_nav"] == "committees" assert len(resp.context["chambers"]) == 2 assert len(resp.context["committees"]) == 2 # check member_counts one, two = resp.context["committees"] if one["name"] == "Robots": robots, wizards = one, two else: robots, wizards = two, one assert robots["member_count"] == 1 assert wizards["member_count"] == 5 @pytest.mark.django_db def test_committee_detail(client, django_assert_num_queries): o = Organization.objects.get(name="Wizards") with django_assert_num_queries(9): resp = client.get(pretty_url(o)) assert resp.status_code == 200 assert resp.context["state"] == "ak" assert resp.context["state_nav"] == "committees" org = resp.context["committee"] assert org.name == "Wizards" assert len(resp.context["memberships"]) == 5 @pytest.mark.django_db def test_canonicalize_committee(client): o = Organization.objects.get(name="Wizards") url = pretty_url(o).replace("wizards", "xyz") assert "xyz" in url resp = client.get(url) assert resp.status_code == 301 assert resp.url == pretty_url(o)
StarcoderdataPython
176996
# flake8: noqa from .about import __version__ from .candidate import Candidate from .ice import Connection
StarcoderdataPython
123240
<reponame>frenzylabs/ancilla ''' node.py ancilla Created by <NAME> (<EMAIL>) on 01/08/20 Copyright 2019 FrenzyLabs, LLC. ''' from .base import Event, State class NodeEvent(Event): key = "node" events = dict( services = "created", updated = "updated", deleted = "deleted", state = State )
StarcoderdataPython
1730965
<reponame>avmi/plato-research-dialogue-system<filename>plato/agent/component/dialogue_policy/reinforcement_learning/reward_function.py """ Copyright (c) 2019-2020 Uber Technologies, Inc. Licensed under the Apache License, Version 2.0 (the "License"); you may not use this file except in compliance with the License. You may obtain a copy of the License at http://www.apache.org/licenses/LICENSE-2.0 Unless required by applicable law or agreed to in writing, software distributed under the License is distributed on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the License for the specific language governing permissions and limitations under the License. """ __author__ = "<NAME>" from abc import ABC, abstractmethod from copy import deepcopy """ Reward is the parent abstract class for reward functions, primarily used for reinforcement learning. """ class Reward(ABC): @abstractmethod def initialize(self, **kwargs): """ Initialize internal parameters :param kwargs: :return: """ pass @abstractmethod def calculate(self, state, action): """ Calculate the reward to be assigned for taking action from state. :param state: the current state :param action: the action taken from the current state :return: the calculated reward """ pass class SlotFillingReward(Reward): def __init__(self): """ Set default values for turn penalty, success, and failure. """ self.goal = None self.turn_penalty = -0.05 self.failure_penalty = -1 self.success_reward = 20 def initialize(self, **kwargs): """ Initialize parameters for turn penalty, success, and failure. :param kwargs: turn penalty, failure penalty, and success reward :return: Nothing """ if 'turn_penalty' in kwargs: self.turn_penalty = kwargs['turn_penalty'] if 'failure_penalty' in kwargs: self.failure_penalty = kwargs['failure_penalty'] if 'success_reward' in kwargs: self.success_reward = kwargs['success_reward'] def calculate(self, state, actions, goal=None, force_terminal=False, agent_role='system'): """ Calculate the reward to be assigned for taking action from state. :param state: the current state :param actions: the action taken from the current state :param goal: the agent's goal, used to assess success :param force_terminal: force state to be terminal :param agent_role: the role of the agent :return: a number, representing the calculated reward """ reward = self.turn_penalty if goal is None: print('Warning: SlotFillingReward() called without a goal.') return 0, False, False else: dialogue_success = False if state.is_terminal() or force_terminal: # Check that an offer has actually been made if state.system_made_offer: dialogue_success = True # Check that the item offered meets the user's constraints for constr in goal.constraints: if goal.ground_truth: # Multi-agent case if goal.ground_truth[constr] != \ goal.constraints[constr].value and \ goal.constraints[constr].value != \ 'dontcare': reward += self.failure_penalty dialogue_success = False break elif state.item_in_focus: # Single-agent case if state.item_in_focus[constr] != \ goal.constraints[constr].value and \ goal.constraints[constr].value != \ 'dontcare': reward += self.failure_penalty dialogue_success = False break # Check that all requests have been addressed if dialogue_success: not_met = 0 if agent_role == 'system': # Check that the system has responded to all # requests (actually) made by the user for req in goal.actual_requests: if not goal.actual_requests[req].value: not_met += 1 elif agent_role == 'user': # Check that the user has provided all the # requests in the goal for req in goal.requests: if not goal.requests[req].value: not_met += 1 if not_met > 0: reward += self.failure_penalty dialogue_success = False else: reward = self.success_reward else: reward += self.failure_penalty dialogue_success = False # Liu & Lane ASRU 2017 Definition of task success task_success = None if agent_role == 'system': task_success = True # We don't care for slots that are not in the goal constraints for slot in goal.constraints: # If the system proactively informs about a slot the user has # not yet put a constraint upon, # the user's DState is updated accordingly and the user would # not need to put that constraint. if goal.ground_truth: if goal.ground_truth[slot] != \ goal.constraints[slot].value and \ goal.constraints[slot].value != 'dontcare': task_success = False break # Fall back to the noisier signal, that is the slots filled. elif state.slots_filled[slot] != \ goal.constraints[slot].value and \ goal.constraints[slot].value != 'dontcare': task_success = False break for req in goal.requests: if not goal.requests[req].value: task_success = False break return reward, dialogue_success, task_success class SlotFillingGoalAdvancementReward(Reward): def __init__(self): """ Initialize the internal structures. """ self.prev_state = None self.prev_goal = None self.failure_penalty = -1 self.success_reward = 1 def initialize(self, **kwargs): """ Initialize the failure penalty and success reward :param kwargs: dictionary containing failure penalty and success reward :return: Nothing """ if 'failure_penalty' in kwargs: self.failure_penalty = kwargs['failure_penalty'] if 'success_reward' in kwargs: self.success_reward = kwargs['success_reward'] if 'state' in kwargs: self.prev_state = deepcopy(kwargs['state']) else: self.prev_state = None if 'goal' in kwargs: self.prev_goal = deepcopy(kwargs['goal']) else: self.prev_goal = None def calculate(self, state, actions, goal=None, force_terminal=False, agent_role='system'): """ Calculate the reward based on whether the action taken advanced the goal or not. For example, if the action resulted in filling one more slot the conversation advanced towards the goal. :param state: the current state :param actions: the action taken from the current state :param goal: the agent's goal, used to assess success :param force_terminal: force state to be terminal :param agent_role: the role of the agent :return: a number, representing the calculated reward """ if goal is None: print('Warning: SlotFillingGoalAdvancementReward() called without ' 'a goal.') return -1, False, False elif self.prev_state is None or self.prev_goal is None: reward = 1 # Check if the goal has been advanced else: # If the new state has more slots filled than the old one if sum([1 if self.prev_state.slots_filled[s] else 0 for s in self.prev_state.slots_filled]) < \ sum([1 if state.slots_filled[s] else 0 for s in state.slots_filled]): reward = 1 # Or if the new state has more requests filled than the old one elif sum([1 if self.prev_goal.actual_requests[r] else 0 for r in self.prev_goal.actual_requests]) < \ sum([1 if goal.actual_requests[r] else 0 for r in goal.actual_requests]): reward = 1 # Or if the system made a request for an unfilled slot? else: reward = -1 success = False if state.is_terminal() or force_terminal: # Check that an offer has actually been made if state.system_made_offer: success = True # Check that the item offered meets the user's constraints for constr in goal.constraints: if goal.ground_truth: # Multi-agent case if goal.ground_truth[constr] != \ goal.constraints[constr].value: success = False break elif state.item_in_focus: # Single-agent case if state.item_in_focus[constr] != \ goal.constraints[constr].value: success = False break self.prev_state = deepcopy(state) self.prev_goal = deepcopy(goal) task_success = None if agent_role == 'system': task_success = True # We don't care for slots that are not in the goal constraints for slot in goal.constraints: # If the system proactively informs about a slot the user has # not yet put a constraint upon, # the user's DState is updated accordingly and the user would # not need to put that constraint. if goal.ground_truth: if goal.ground_truth[slot] != \ goal.constraints[slot].value and \ goal.constraints[slot].value != 'dontcare': task_success = False # Fall back to the noisier signal, that is the slots filled. elif state.slots_filled[slot] != \ goal.constraints[slot].value and \ goal.constraints[slot].value != 'dontcare': task_success = False for req in goal.requests: if not goal.requests[req].value: task_success = False return reward, success, task_success
StarcoderdataPython
60688
#! /usr/bin/env python3 # -*- coding: utf-8 -*- import os, json def main(): fp = 'vocab.json' with open(fp, 'r') as f: caption_token_to_idx = json.load(f)['question_token_to_idx'] caption_tokens = list(caption_token_to_idx.keys()) print(caption_tokens[5:]) with open("clevr-scene-nouns.txt", "w") as output: for row in caption_tokens[5:]: output.write(str(row) + '\n') if __name__ == '__main__': main()
StarcoderdataPython
3242460
# coding: utf-8 # In[1]: s = [15,17,13,20,19,17,25,10,18,40,21,35,11,25,30,29,35,34,25,18,27,45,36,22,28,38,46,47,24,11,14,16,27,61,52,33,35,48,16,27,26,48,51,50,60,62,54,58,25,27,35,42,47,45,55,38,70,61,47,44,34,36,35,61,65,70,53,54,54,56,47,11,21,22,24,53,52,53,70,62,61,21,18,11,21,18,27,24,25,26,22,12,11,22,23,33,35,41,18,11] # In[2]: len(s) # In[3]: s.sort() # In[4]: print(s) # In[5]: from collections import Counter from fractions import Fraction import operator from matplotlib import pyplot as plt import math d = Counter(s) d.keys() # In[7]: for i in d.keys(): print('{0}, {2}, {1}'.format(d[i], i, Fraction(d[i], 100))) # In[8]: print('Мода {0}, Медіана {1}, Розмах {2}'.format(max(d, key=d.get), (s[49]+s[50])/2, s[99]-s[0])) # In[9]: plt.figure(figsize=(20, 10)) plt.grid() plt.plot(d.keys(), d.values()) plt.xticks(s) # In[10]: plt.figure(figsize=(20, 10)) plt.bar(d.keys(), d.values()) plt.xticks(s) plt.show(s) # In[21]: interv = [] suma = 0 t = 10 for i in range(20,90,10): for j in d.keys(): if j < i and j >= t: suma += d[j] interv.append(((t,i),suma, Fraction(suma,100))) suma = 0 t = i # In[22]: interv # In[35]: ser = 0 for i in d.keys(): ser += i*d[i] print('Середнє вибіркове {0}'.format(ser/100)) # In[36]: ser = 0 for i in interv: ser+=(i[0][1]+i[0][0])/2 * i[1] ser_int = ser/100 print('Середнє вибіркове {0}'.format(ser_int)) # In[47]: dispersion = 0 for i in interv: dispersion += ((i[0][1]+i[0][0])/2)**2 * i[1] dispersion /= 100 dispersion -= ser_int**2 ser_quad = math.sqrt(dispersion) print('Дисперсія {0}, Середньоквадратичне відхилення {1}'.format(dispersion, ser_quad)) # In[48]: print('Коефіцієнт варіації {0}'.format(ser_quad/ser_int)) # In[49]: emp3 = 0 emp4 = 0 for i in interv: emp3 += ((i[0][1]+i[0][0])/2 - ser_int)**3 * i[1] emp4 += ((i[0][1]+i[0][0])/2 - ser_int)**4 * i[1] emp3 /= 100 emp4 /= 100 print('Центральні емпіричні моменти 3-го {0} і 4-го порядків {1}'.format(emp3, emp4)) # In[50]: print('Асиметрія {0} і Ексцес {1}'.format(emp3/(ser_quad**3), emp4/(ser_quad**4)-3))
StarcoderdataPython
3202568
<reponame>theomarzaki/TrafficOrchestrator # This script provides a way for the TO to predict the neighrest cars to the merging car to # provide a state space for the lane merge enviroment. Uses an LSTM Model to acheive this: # Sequential learning -> change to minibatch learning # multi variable classifir -> sequence to sequence regressor # @parameters input: Road state Tensor # @parameters output: LSTM Model to predict next car states (preceeding,merging,following) jit trace file # Created by: <NAME>(KCL) # -- BENCHMARK -- # # CONFIG : # sequence_length = 1 # input_size = 13 # hidden_size = 128 # num_layers = 2 # num_classes = 13 # batch_size = 32 # learning_rate = 1e-5 # # + [CPU-MODE] i7 6700K Stock + 16 Go DDR4 2166 Non-ECC RAM # |=> 0.12 Epoch/s # # + [CPU-MODE] i5 3570K Stock + 16 Go DDR3 1600 Non-ECC RAM # |=> 0.08 Epoch/s # # + [GPU-MODE] GTX 970 Stock + i5 3570K Stock + 16 Go DDR3 1333 Non-ECC RAM # |=> 0.58 Epoch/s | 52% + 1050MB uses with CPU bottleneck, so I think I can push a lot further. Maybe 1 Epoch/s # import time import torch import torch.utils import torch.utils.data import torch.nn as nn import matplotlib.pyplot as plt from csv_data import Data # Device configuration loader_batch_size = 128 view_rate = 128 dev_type = 'cpu' num_epochs = 5000 sequence_length = 1 input_size = 13 hidden_size = 128 num_layers = 2 num_classes = 13 batch_size = 3 learning_rate = 1e-7 if torch.cuda.is_available(): dev_type = 'cuda' view_rate /= 4 loader_batch_size *= 8 print("NVIDIA GPU detected and use !") else: print("/!\ No NVIDIA GPU detected, we stick to the CPU !") device = torch.device(dev_type) data_wrapper = Data() data = data_wrapper.get_data() featuresTrain,targetsTrain = data_wrapper.get_training_lstm_data() featuresTest, targetsTest = data_wrapper.get_testing_lstm_data() train = torch.utils.data.TensorDataset(featuresTrain,targetsTrain) test = torch.utils.data.TensorDataset(featuresTest,targetsTest) # Data loader train_loader = torch.utils.data.DataLoader(dataset=train,batch_size=loader_batch_size,shuffle=False, num_workers = 3, pin_memory=True) test_loader = torch.utils.data.DataLoader(dataset=test,batch_size=loader_batch_size,shuffle=False, num_workers = 3, pin_memory=True) # Recurrent neural network (many-to-one) class RNN(nn.Module): def __init__(self,train_loader,test_loader): super(RNN, self).__init__() self.train_loader = train_loader self.test_loader = test_loader self.lstm = nn.LSTM(input_size, hidden_size, num_layers, batch_first=True) self.fc = nn.Linear(hidden_size, num_classes) def init_hidden(self): # This is what we'll initialise our hidden state as return (torch.zeros(num_layers, batch_size, hidden_size), torch.zeros(num_layers, batch_size, hidden_size)) def init_hidden(self): # This is what we'll initialise our hidden state as return (torch.zeros(self.num_layers, self.batch_size, self.hidden_size), torch.zeros(self.num_layers, self.batch_size, self.hidden_size)) def forward(self, x): # Set initial hidden and cell states h0 = torch.zeros(num_layers, x.size(0), hidden_size).to(device) c0 = torch.zeros(num_layers, x.size(0), hidden_size).to(device) # Forward propagate LSTM out, _ = self.lstm(x, (h0, c0)) # out: tensor of shape (batch_size, seq_length, hidden_size) # Decode the hidden state of the last time step out = self.fc(out[:, -1, :]) return out def train(model): print("Go !") criterion = nn.MSELoss() current_time = time.time() optimizer = torch.optim.Adam(model.parameters(), lr=learning_rate) hist = [] total_step = len(model.train_loader) for epoch in range(num_epochs): model.zero_grad() # model.hidden = model.init_hidden() loss = None for i, (locations, labels) in enumerate(model.train_loader): locations = locations.reshape(-1, sequence_length, input_size).to(device) labels = labels.to(device) # Forward pass outputs = model(locations) loss = criterion(outputs, labels) hist.append(loss.item()) # Backward and optimize optimizer.zero_grad() loss.backward() optimizer.step() if (i+1) % view_rate == 0: print('Epoch [{}/{}], Step [{}/{}], Loss: {:.4f}'.format(epoch+1, num_epochs, i+1, total_step, loss.item())) bufftime = time.time() delta_time = bufftime - current_time print("+ "+str(delta_time)+" Secs") print("Perf: "+str(1/delta_time)+" Epoch/s\n") current_time = bufftime return hist def test(model): with torch.no_grad(): correct = 0 total = 0 for locations, labels in test_loader: locations = locations.reshape(-1, sequence_length, input_size).to(device) labels = labels.to(device) outputs = model(locations) _, predicted = torch.max(outputs.data, 1) total += 1 for idx, actual in enumerate(locations): if ((actual == outputs.data).all()): correct += 1 # correct += (predicted.long() == labels.long()).sum().item() print('Test Accuracy of the model of the model: {} %'.format(100 * correct / total)) def main(): model = RNN(train_loader,test_loader).to(device,non_blocking=True) hist = train(model) test(model) traced_script_module = torch.jit.trace(model, torch.rand(1,1,input_size).to(device)) traced_script_module.save("lstm_model.pt") plt.plot(hist) plt.show() if __name__ == '__main__': main()
StarcoderdataPython
4822101
""" @ Filename: Cluster.py @ Author: <NAME> @ Create Date: 2019-05-15 @ Update Date: 2019-05-20 @ Description: Implement Cluster """ import sys import numpy as np import preProcess import pickle import random import matplotlib.pyplot as plt class KMeans: def __init__(self, norm_type="Normalization", k=4, distance_type="Euclidean", cluster_type="KMeans++"): self.norm_type = norm_type self.k = k self.distance_type = distance_type self.cluster_type = cluster_type self.centers = None # cluster centers self.distances = None # distance between sample and cluster ''' Function: calcuateDistance Description: calcuate the distance between input vector and train data Input: x1 dataType: ndarray description: input vector x2 dataType: ndarray description: input vector Output: d dataType: float description: distance between input vectors ''' def calculateDistance(self, x1, x2): d = 0 if self.distance_type == "Euclidean": d = np.sqrt(np.power(np.sum(x1 - x2, axis=1), 2)) elif self.distance_type == "Cosine": d = np.dot(x1, x2)/(np.linalg.norm(x1)*np.linalg.norm(x2)) elif self.distance_type == "Manhattan": d = np.sum(x1 - x2) else: print("Error Type!") sys.exit() return d ''' Function: createCenter Description: create cluster center Input: train_data dataType: ndarray description: input vector Output: centers dataType: ndarray description: cluster centers ''' def createCenter(self, train_data): feature_dim = np.shape(train_data)[1] centers = np.zeros([self.k, feature_dim]) for i in range(feature_dim): min_value = np.min(train_data[:, i]) max_value = np.max(train_data[:, i]) temp = min_value + (max_value - min_value) * np.random.rand(self.k) centers[:, i] = temp # generate a cluster center return centers ''' Function: adjustCluster Description: adjust cluster when the cluster determined Input: centers dataType: ndarray description: cluster centers distances dataType: ndarray description: distance between sample and its corresponding cluster(cluster, distance) train_data dataType: ndarray description: train data k dataType: int description: the number of cluster Output: centers dataType: ndarray description: cluster centers distances dataType: ndarray description: distance between sample and its corresponding cluster(cluster, distance) ''' def adjustCluster(self, centers, distances, train_data, k): sample_num = len(train_data) flag = True # If True, update cluster_center while flag: flag = False d = np.zeros([sample_num, len(centers)]) for i in range(len(centers)): # calculate the distance between each sample and each cluster center d[:, i] = self.calculateDistance(train_data, centers[i]) # find the minimum distance between each sample and each cluster center old_label = distances[:, 0].copy() distances[:, 0] = np.argmin(d, axis=1) distances[:, 1] = np.min(d, axis=1) if np.sum(old_label - distances[:, 0]) != 0: flag = True # update cluster_center by calculating the mean of each cluster for j in range(k): current_cluster = train_data[distances[:, 0] == j] # find the samples belong to the j-th cluster center if len(current_cluster) != 0: centers[j, :] = np.mean(current_cluster, axis=0) return centers, distances ''' Function: kmeans Description: normal kmeans algorithm Input: train_data dataType: ndarray description: features Output: centers dataType: ndarray description: cluster centers distances dataType: ndarray description: distance between sample and its corresponding cluster(cluster, distance) ''' def kmeans(self, train_data, k): sample_num = len(train_data) distances = np.zeros([sample_num, 2]) # (index, distance) centers = self.createCenter(train_data) centers, distances = self.adjustCluster(centers, distances, train_data, self.k) return centers, distances ''' Function: biKmeans Description: binary kmeans algorithm Input: train_data dataType: ndarray description: features Output: centers dataType: ndarray description: cluster centers distances dataType: ndarray description: distance between sample and its corresponding cluster(cluster, distance) ''' def biKmeans(self, train_data): sample_num = len(train_data) distances = np.zeros([sample_num, 2]) # (index, distance) initial_center = np.mean(train_data, axis=0) # initial cluster #shape (1, feature_dim) centers = [initial_center] # cluster list # clustering with the initial cluster center distances[:, 1] = np.power(self.calculateDistance(train_data, initial_center), 2) # generate cluster centers while len(centers) < self.k: # print(len(centers)) min_SSE = np.inf best_index = None # index of cluster for best split best_centers = None # best the cluster center best_distances = None # the distance between samples and cluster center # find the best split for j in range(len(centers)): centerj_data = train_data[distances[:, 0] == j] # find the samples belong to the j-th center split_centers, split_distances = self.kmeans(centerj_data, 2) # clustering the samples belong to j-th center into two cluster split_SSE = np.sum(split_distances[:, 1]) ** 2 # calculate the distance for after clustering other_distances = distances[distances[:, 0] != j] # the samples don't belong to j-th center other_SSE = np.sum(other_distances[:, 1]) ** 2 # calculate the distance don't belong to j-th center # save the best split result if (split_SSE + other_SSE) < min_SSE: best_index = j # the best split index best_centers = split_centers # best cluster centers best_distances = split_distances # the corresponding distance min_SSE = split_SSE + other_SSE # save the spilt data best_distances[best_distances[:, 0] == 1, 0] = len(centers) # samples of cluster 1 denote as a new cluster best_distances[best_distances[:, 0] == 0, 0] = best_index # samples of cluster 0 denote as the split-index cluster centers[best_index] = best_centers[0, :] # update cluster centers.append(best_centers[1, :]) # add a new cluster distances[distances[:, 0] == best_index, :] = best_distances # save the distances centers = np.array(centers) # transform form list to array return centers, distances ''' Function: kmeansplusplus Description: kmeans++ algorithm Input: train_data dataType: ndarray description: features Output: centers dataType: ndarray description: cluster centers distances dataType: ndarray description: distance between sample and its corresponding cluster(cluster, distance) ''' def kmeansplusplus(self,train_data): sample_num = len(train_data) distances = np.zeros([sample_num, 2]) # (index, distance) # randomly select a sample as the initial cluster initial_center = train_data[np.random.randint(0, sample_num-1)] centers = [initial_center] while len(centers) < self.k: d = np.zeros([sample_num, len(centers)]) for i in range(len(centers)): # calculate the distance between each sample and each cluster center d[:, i] = self.calculateDistance(train_data, centers[i]) # find the minimum distance between each sample and each cluster center distances[:, 0] = np.argmin(d, axis=1) distances[:, 1] = np.min(d, axis=1) # Roulette Wheel Selection prob = np.power(distances[:, 1], 2)/np.sum(np.power(distances[:, 1], 2)) index = self.rouletteWheelSelection(prob, sample_num) new_center = train_data[index, :] centers.append(new_center) # adjust cluster centers = np.array(centers) # transform form list to array centers, distances = self.adjustCluster(centers, distances, train_data, self.k) return centers, distances ''' Function: rouletteWheelSelection Description: Roulette Wheel Selection Input: prob dataType: ndarray description: features Output: i dataType: ndarray description: the selected cluster ''' def rouletteWheelSelection(self, prob, sample_num): acc_prob = np.zeros(sample_num) acc_prob[0] = prob[0] p = random.uniform(0, 1) for i in range(1, len(prob)): acc_prob[i] = acc_prob[i-1] + prob[i] if acc_prob[i] > p: return i ''' Function: cluster Description: train the model Input: train_data dataType: ndarray description: features Output: centers dataType: ndarray description: cluster centers distances dataType: ndarray description: distance between sample and its corresponding cluster(cluster, distance) ''' def cluster(self, train_data, display="True"): if self.norm_type == "Standardization": train_data = preProcess.Standardization(train_data) else: train_data = preProcess.Normalization(train_data) if self.cluster_type == "KMeans": self.centers, self.distances = self.kmeans(train_data, self.k) elif self.cluster_type == "biKMeans": self.centers, self.distances = self.biKmeans(train_data) elif self.cluster_type == "KMeans++": self.centers, self.distances = self.kmeansplusplus(train_data) else: print("Wrong cluster type!") sys.exit() if display: self.plotResult(train_data) return self.distances[:, 0] ''' Function: plotResult Description: show the clustering result ''' def plotResult(self, train_data): plt.scatter(train_data[:, 0], train_data[:, 1], c=self.distances[:, 0]) plt.scatter(self.centers[:, 0], self.centers[:, 1], c=['b', 'b', 'b', 'b'], marker="+") if self.cluster_type == "KMeans": plt.title('KMeans') elif self.cluster_type == "biKMeans": plt.title('biKMeans') elif self.cluster_type == "KMeans++": plt.title('KMeans++') plt.show() ''' Function: save Description: save the model as pkl Input: filename dataType: str description: the path to save model ''' def save(self, filename): f = open(filename, 'w') model = {'centers': self.centers, 'distances': self.distances} pickle.dump(model, f) f.close() ''' Function: load Description: load the model Input: filename dataType: str description: the path to save model Output: self dataType: obj description: the trained model ''' def load(self, filename): f = open(filename) model = pickle.load(f) self.centers = model['centers'] self.distances = model['distances'] return self class DBSCAN: def __init__(self, norm_type="Normalization", distance_type="Euclidean", eps=0.5, m=5): self.norm_type = norm_type self.distance_type = distance_type self.eps = eps # neighbor self.m = m # the min number of sample in a neighbor self.label = None self.neighbor = None ''' Function: calcuateDistance Description: calcuate the distance between input vector and train data Input: x1 dataType: ndarray description: input vector x2 dataType: ndarray description: input vector Output: d dataType: float description: distance between input vectors ''' def calculateDistance(self, x1, x2): d = 0 if self.distance_type == "Euclidean": d = np.sqrt(np.power(np.sum(x1 - x2), 2)) elif self.distance_type == "Cosine": d = np.dot(x1, x2)/(np.linalg.norm(x1)*np.linalg.norm(x2)) elif self.distance_type == "Manhattan": d = np.sum(x1 - x2) else: print("Error Type!") sys.exit() return d ''' Function: neighborQuery Description: create neighbor, if the sample is not in a neighbor, add it to a neighbor Input: train_data dataType: ndarray description: features center dataType: ndarray description: the center points Output: neighbor dataType: ndarray description: the center's neighbors index dataType: ndarray description: the center's index ''' def neighborQuery(self, train_data, center): index = [] neighbor = [] sample_num = len(train_data) for i in range(sample_num): if self.calculateDistance(center, train_data[i, :]) <= self.eps: # the sample in center's neighbor neighbor.append(train_data[i, :]) index.append(i) return index, neighbor ''' Function: cluster Description: train the model Input: train_data dataType: ndarray description: features Output: centers dataType: ndarray description: cluster centers distances dataType: ndarray description: distance between sample and its corresponding cluster(cluster, distance) ''' def cluster(self, train_data, display="True"): if self.norm_type == "Standardization": train_data = preProcess.Standardization(train_data) else: train_data = preProcess.Normalization(train_data) sample_num = len(train_data) label = -np.ones([sample_num]) center_flag = np.zeros([sample_num]) # indicate samples which are cluster center center_index = [] # cluster center index C = 0 # start clustering for i in range(sample_num): temp_neighbor = [] if label[i] != -1: # if sample i has been clustered, stop this iteration continue index1, neighbor1 = self.neighborQuery(train_data, train_data[i, :]) if len(neighbor1) < self.m: label[i] = 0 # sample i is noise point continue # stop this iteration C = C + 1 label[i] = C center_flag[i] = 1 temp_neighbor.append(neighbor1) # all the samples in i-th neighbor belong to label C center_index = index1 j = 0 while j < len(center_index): loc = center_index[j] #print(center_index[j]) if center_flag[j] != 1: # samples in i-th sample's neighbor but not cluster center if label[loc] == 0: label[loc] = C if label[loc] != -1: j = j + 1 continue label[loc] = C index2, neighbor2 = self.neighborQuery(train_data, train_data[loc, :]) if len(neighbor2) >= self.m: center_index = list(set(index1).union(set(index2))) # merge the cluster centers which are directly reachable center_flag[loc] = 1 # if there are more than m samples in j-th neighbor, add j-th sample as a cluster center j = j + 1 self.label = label if display: self.plotResult(train_data) return label ''' Function: plotResult Description: show the clustering result ''' def plotResult(self, train_data): plt.scatter(train_data[:, 0], train_data[:, 1], c=self.label) plt.title('DBSCAN') plt.show() ''' Function: save Description: save the model as pkl Input: filename dataType: str description: the path to save model ''' def save(self, filename): f = open(filename, 'w') model = {'label': self.label, 'neighbor': self.neighbor} pickle.dump(model, f) f.close() ''' Function: load Description: load the model Input: filename dataType: str description: the path to save model Output: self dataType: obj description: the trained model ''' def load(self, filename): f = open(filename) model = pickle.load(f) self.label = model['label'] self.neighbor = model['neighbor'] return self
StarcoderdataPython
3559
#!/usr/bin/env python # -*- coding: utf-8 -*- """ test_orthoexon ---------------------------------- Tests for `orthoexon` module. """ import os import pytest @pytest.fixture def exon_id_with_quotes(): return "'ENSE00001229068.1'" @pytest.fixture def exon_id(): return "ENSE00001229068.1" def test_separate_with_quotes(exon_id_with_quotes): from orthoexon.util import separate test = separate(exon_id_with_quotes) true = "ENSE00001229068" assert test == true def test_separate(exon_id): from orthoexon.util import separate test = separate(exon_id) true = "ENSE00001229068" assert test == true @pytest.fixture def location(): return "chr20:10256140-10256211:+:0" def test_splitstart(location): from orthoexon.util import splitstart test = splitstart(location) true = '10256140' assert test == true def test_splitend(location): from orthoexon.util import splitend test = splitend(location) true = '10256211' assert test == true @pytest.fixture def human_gtf_filename(table_folder): return os.path.join(table_folder, 'humanrbfox2andfmr1andsnap25.gtf') @pytest.fixture def human_gtf_database(table_folder): return os.path.join(table_folder, 'humanrbfox2andfmr1andsnap25.gtf.db') @pytest.fixture def human_fasta(table_folder): return os.path.join(table_folder, 'GRCm38.p3.genome.fa') def test_translate(exon_id, human_fasta, human_gtf_database): from orthoexon.util import translate from orthoexon.util import separate for index, species1gene in enumerate(human_gtf_database.features_of_type('gene')): species1gffutilsgeneid = str(species1gene['gene_id']) species1geneid = separate(species1gffutilsgeneid) for exon in human_gtf_database.children(species1geneid, featuretype='CDS', order_by='start'): if exon_id == exon: test = translate(exon, human_fasta) break break true = 'MAEDADMRNELEEMQRRADQLADE' assert test == true # def test_getsequence(exon, human_gtf_database): # from orthoexon.util import getsequence # # test = getsequence(exon, human_gtf_database) # true = 'ATGGCCGAAGACGCAGACATGCGCAATGAGCTGGAGGAGATGCAGCGAAGGGCTGACCAGTT' \ # 'GGCTGATGAG' # # assert test == true # def test_make_sequence_array(finalsequencedf): # from orthoexon.util import make_sequence_array # # test = make_sequence_array(finalsequencedf) # true = ...... # # assert test == true
StarcoderdataPython
1672519
# -*- coding: utf-8 -*- import re from collections import defaultdict from .utils import u, get, dump try: import click except ImportError: print('Install this package with the [cli] extras to enable the CLI.') raise @click.group() def cli(): pass @cli.command() def update(): """ Update the homoglyph data files from https://www.unicode.org """ generate_categories() generate_confusables() def generate_categories(): """Generates the categories JSON data file from the unicode specification. :return: True for success, raises otherwise. :rtype: bool """ # inspired by https://gist.github.com/anonymous/2204527 code_points_ranges = [] iso_15924_aliases = [] categories = [] match = re.compile(r'([0-9A-F]+)(?:\.\.([0-9A-F]+))?\W+(\w+)\s*#\s*(\w+)', re.UNICODE) url = 'http://www.unicode.org/Public/UNIDATA/Scripts.txt' file = get(url) for line in file: p = re.findall(match, line) if p: code_point_range_from, code_point_range_to, alias, category = p[0] alias = u(alias.upper()) category = u(category) if alias not in iso_15924_aliases: iso_15924_aliases.append(alias) if category not in categories: categories.append(category) code_points_ranges.append(( int(code_point_range_from, 16), int(code_point_range_to or code_point_range_from, 16), iso_15924_aliases.index(alias), categories.index(category)) ) code_points_ranges.sort() categories_data = { 'iso_15924_aliases': iso_15924_aliases, 'categories': categories, 'code_points_ranges': code_points_ranges, } dump('categories.json', categories_data) def generate_confusables(): """Generates the confusables JSON data file from the unicode specification. :return: True for success, raises otherwise. :rtype: bool """ url = 'http://www.unicode.org/Public/security/latest/confusables.txt' file = get(url) confusables_matrix = defaultdict(list) match = re.compile(r'[0-9A-F ]+\s+;\s*[0-9A-F ]+\s+;\s*\w+\s*#' r'\*?\s*\( (.+) → (.+) \) (.+) → (.+)\t#', re.UNICODE) for line in file: p = re.findall(match, line) if p: char1, char2, name1, name2 = p[0] confusables_matrix[char1].append({ 'c': char2, 'n': name2, }) confusables_matrix[char2].append({ 'c': char1, 'n': name1, }) dump('confusables.json', dict(confusables_matrix))
StarcoderdataPython
3203581
""" launcher program for the music player """ import music_player.music_player as mp from RPi import GPIO def main(): try: music_player = mp.Music_player() music_player.start() except KeyboardInterrupt: GPIO.cleanup() if __name__ == "__main__": main()
StarcoderdataPython
87580
# coding=utf-8 # *** WARNING: this file was generated by the Pulumi Terraform Bridge (tfgen) Tool. *** # *** Do not edit by hand unless you're certain you know what you are doing! *** import json import warnings import pulumi import pulumi.runtime from . import utilities, tables class GetCallerIdentityResult: """ A collection of values returned by getCallerIdentity. """ def __init__(__self__, account_id=None, arn=None, user_id=None, id=None): if account_id and not isinstance(account_id, str): raise TypeError("Expected argument 'account_id' to be a str") __self__.account_id = account_id """ The AWS Account ID number of the account that owns or contains the calling entity. """ if arn and not isinstance(arn, str): raise TypeError("Expected argument 'arn' to be a str") __self__.arn = arn """ The AWS ARN associated with the calling entity. """ if user_id and not isinstance(user_id, str): raise TypeError("Expected argument 'user_id' to be a str") __self__.user_id = user_id """ The unique identifier of the calling entity. """ if id and not isinstance(id, str): raise TypeError("Expected argument 'id' to be a str") __self__.id = id """ id is the provider-assigned unique ID for this managed resource. """ async def get_caller_identity(opts=None): """ Use this data source to get the access to the effective Account ID, User ID, and ARN in which Terraform is authorized. """ __args__ = dict() __ret__ = await pulumi.runtime.invoke('aws:index/getCallerIdentity:getCallerIdentity', __args__, opts=opts) return GetCallerIdentityResult( account_id=__ret__.get('accountId'), arn=__ret__.get('arn'), user_id=__ret__.get('userId'), id=__ret__.get('id'))
StarcoderdataPython
3224339
<gh_stars>1000+ import argparse import pandas as pd if __name__ == '__main__': parser = argparse.ArgumentParser( description="Check for missing colors & locations", formatter_class=argparse.ArgumentDefaultsHelpFormatter ) parser.add_argument('--metadata', type=str, nargs='+', required=True, help="input region adjusted metadata") parser.add_argument('--colors', type=str, nargs='+', required=True, help="input region specific color file") parser.add_argument('--latlong', type=str, required=True, help="input lat-long file") args = parser.parse_args() things_to_exclude_orig = ['Africa', 'Asia', 'South America', 'Europe', 'North America', 'Oceania', 'Grand princess cruise ship', 'diamond princess'] things_to_exclude = [x.lower() for x in things_to_exclude_orig] all_metadatas = [pd.read_csv(met, delimiter='\t') for met in args.metadata] metadata = pd.concat(all_metadatas, sort=False) all_colors = [pd.read_csv(col, delimiter='\t', header=None) for col in args.colors] colors = pd.concat(all_colors, sort=False) latlong = pd.read_csv(args.latlong, delimiter='\t', header=None) for geo_value in ['location', 'division', 'country']: locs_w_color_orig = colors.loc[colors[0]==geo_value,1].values locs_w_color = [x.lower() for x in locs_w_color_orig] locs_w_latlong_orig = latlong.loc[latlong[0]==geo_value,1].values locs_w_latlong = [x.lower() for x in locs_w_latlong_orig] locs_in_meta_orig = [x for x in metadata[geo_value].unique() if not pd.isna(x)] locs_in_meta = [x.lower() for x in locs_in_meta_orig] missing_color_locs = [loc for loc in locs_in_meta if loc not in locs_w_color and loc not in things_to_exclude] if missing_color_locs: print("The following {} are missing colors:".format(geo_value)) print(missing_color_locs) print("\n") if geo_value != 'country': missing_latlong_locs = [loc for loc in locs_in_meta if loc not in locs_w_latlong and loc not in things_to_exclude] if missing_latlong_locs: print("The following {} are missing lat-long values:".format(geo_value)) print(missing_latlong_locs) print("\n") print("Please remember this does *not* check lat-longs for countries!!")
StarcoderdataPython
3213182
<reponame>izilly/izdvd<gh_stars>0 # -*- coding: utf-8 -*- # # Copyright (c) 2013 <NAME> # Distributed under the terms of the Modified BSD License. # The full license is in the file LICENSE, distributed with this software. PROG_NAME = 'izdvd' PROG_URL = 'https://github.com/izzilly/izdvd' VIDEO_PLAYER = 'mplayer' IMAGE_VIEWER = 'display' RE_PARTS_SEP = r'[ _.-]' RE_VOL_PREFIXES = r'cd|dvd|part|pt|disk|disc|d' RE_VOL_NUMS = r'[0-9]' RE_VOL_LETTERS = r'[a-d]' MODE_NAMES = {'dvd': 'izdvd', 'menu': 'izdvdmenu', 'bg': 'izdvdbg'}
StarcoderdataPython
3389549
"""Proof of concept for a federated digital data exchange.""" __version__ = '0.1.0-dev'
StarcoderdataPython
4842088
<filename>PythonTKinter/LayoutPackSide.py from tkinter import * janela = Tk() lb1 = Label(janela,text='RIGHT',bg='white') lb2 = Label(janela,text='BOTTOM',bg='white') lb3 = Label(janela,text='LEFT',bg='white') lb4 = Label(janela,text='TOP',bg='white') lb1.pack(side=RIGHT) lb2.pack(side=BOTTOM) lb3.pack(side=LEFT) lb4.pack(side=TOP) janela['bg'] = 'black' janela.geometry('400x300+200+200') janela.mainloop()
StarcoderdataPython
4832837
# Copyright 2018 The TensorFlow Authors. All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # ============================================================================== """TIFFIOTensor""" import tensorflow as tf from tensorflow_io.core.python.ops import io_tensor_ops from tensorflow_io.core.python.ops import core_ops class TIFFIOTensor( io_tensor_ops._CollectionIOTensor ): # pylint: disable=protected-access """TIFFIOTensor""" # ============================================================================= # Constructor (private) # ============================================================================= def __init__(self, filename, internal=False): with tf.name_scope("TIFFIOTensor"): # TIFF can fit into memory so load TIFF first data = tf.io.read_file(filename) shapes, dtypes = core_ops.io_decode_tiff_info(data) # NOTE: While shapes returned correctly handles 3 or 4 channels # we can only handle RGBA so fix shape as 4 for now, # until decode_tiff is updated. spec = tuple( [ tf.TensorSpec(tf.TensorShape(shape.tolist()[0:2] + [4]), dtype) for (shape, dtype) in zip(shapes.numpy(), dtypes.numpy()) ] ) columns = [i for i, _ in enumerate(spec)] elements = [ io_tensor_ops.TensorIOTensor( core_ops.io_decode_tiff(data, i), internal=internal ) for i in columns ] super().__init__(spec, columns, elements, internal=internal)
StarcoderdataPython
3202967
<gh_stars>0 import copy import warnings from mmcls.core import support, precision_recall_f1 from mmcls.datasets import BaseDataset, DATASETS import numpy as np import pyarrow as pa from mmcls.models import accuracy import csv @DATASETS.register_module() class GoogleLandmarkDataset(BaseDataset): def __init__(self, **kwargs): super(GoogleLandmarkDataset, self).__init__(**kwargs) self.unique_ids = np.load('configs/unique_landmark_ids.np.npy') # 81311 self.id_map = {self.unique_ids[i]: i for i in range(len(self.unique_ids))} def process_filename(self, x): return f'{x[0]}/{x[1]}/{x[2]}/{x}.jpg' def load_annotations(self): ann_file = self.ann_file with open(ann_file, 'r') as f: content = f.readlines() content = [x.strip().split(' ') for x in content] data_infos = [] for data in content: if len(data) == 1: data = (data[0], 1) data_infos.append(data) # filename, gt_label = data # gt_label = int(gt_label) # assert gt_label >= 1 # # info = {'img_prefix': self.data_prefix} # info = {} # info['img_info'] = {'filename': filename} # # info['gt_label'] = np.array(gt_label - 1, dtype=np.int64) # info['gt_label'] = self.id_map[gt_label] # data_infos.append(info) return pa.array(data_infos) # def __len__(self): # return 3000 def prepare_data(self, idx): data = copy.deepcopy(self.data_infos[idx].as_py()) filename = self.process_filename(data[0]) gt_label = self.id_map[int(data[1])] results = {} results['img_prefix'] = self.data_prefix results['gt_label'] = np.array(gt_label, dtype=np.int64) results['img_info'] = {'filename': filename} return self.pipeline(results) def format_results(self, results, thr): keys = [x['img_info']['filename'][6:-4] for x in self.data_infos] values = [(x[0][0], x[1][0]) for x in results] with open('submission.csv', 'w', newline='') as submission_csv: csv_writer = csv.DictWriter(submission_csv, fieldnames=['id', 'landmarks']) csv_writer.writeheader() for image_id, prediction in zip(keys, values): label = self.unique_ids[prediction[0]] score = prediction[1] if score >= thr: csv_writer.writerow({'id': image_id, 'landmarks': f'{label} {score}'}) else: csv_writer.writerow({'id': image_id, 'landmarks': ''}) # data_dict = dict(id=keys, landmarks=values) # data = pd.DataFrame(data_dict) # data.to_csv('submission.csv', index=False, quoting=csv.QUOTE_NONE, doublequote=False, escapechar=None, sep=',') def get_gt_labels(self): """Get all ground-truth labels (categories). Returns: list[int]: categories for all images. """ gt_labels = [self.id_map[int(x[1])] for x in self.data_infos] gt_labels = np.array(gt_labels) return gt_labels def evaluate(self, results, metric='accuracy', metric_options=None, logger=None): """Evaluate the dataset. Args: results (list): Testing results of the dataset. metric (str | list[str]): Metrics to be evaluated. Default value is `accuracy`. metric_options (dict, optional): Options for calculating metrics. Allowed keys are 'topk', 'thrs' and 'average_mode'. Defaults to None. logger (logging.Logger | str, optional): Logger used for printing related information during evaluation. Defaults to None. Returns: dict: evaluation results """ if metric_options is None: metric_options = {'topk': (1, 5)} if isinstance(metric, str): metrics = [metric] else: metrics = metric allowed_metrics = [ 'accuracy', 'precision', 'recall', 'f1_score', 'support' ] eval_results = {} results = np.vstack(results) gt_labels = self.get_gt_labels() num_imgs = len(results) // 2 if len(gt_labels) != num_imgs: warnings.warn('Clip the length of test images') gt_labels = gt_labels[:num_imgs] # assert len(gt_labels) == num_imgs, 'dataset testing results should ' \ # 'be of the same length as gt_labels.' invalid_metrics = set(metrics) - set(allowed_metrics) if len(invalid_metrics) != 0: raise ValueError(f'metirc {invalid_metrics} is not supported.') topk = metric_options.get('topk', (1, 5)) thrs = metric_options.get('thrs') average_mode = metric_options.get('average_mode', 'macro') if 'accuracy' in metrics: if thrs is not None: acc = accuracy(results, gt_labels, topk=topk, thrs=thrs) else: acc = accuracy(results, gt_labels, topk=topk) if isinstance(topk, tuple): eval_results_ = { f'accuracy_top-{k}': a for k, a in zip(topk, acc) } else: eval_results_ = {'accuracy': acc} if isinstance(thrs, tuple): for key, values in eval_results_.items(): eval_results.update({ f'{key}_thr_{thr:.2f}': value.item() for thr, value in zip(thrs, values) }) else: eval_results.update( {k: v.item() for k, v in eval_results_.items()}) if 'support' in metrics: support_value = support( results, gt_labels, average_mode=average_mode) eval_results['support'] = support_value precision_recall_f1_keys = ['precision', 'recall', 'f1_score'] if len(set(metrics) & set(precision_recall_f1_keys)) != 0: if thrs is not None: precision_recall_f1_values = precision_recall_f1( results, gt_labels, average_mode=average_mode, thrs=thrs) else: precision_recall_f1_values = precision_recall_f1( results, gt_labels, average_mode=average_mode) for key, values in zip(precision_recall_f1_keys, precision_recall_f1_values): if key in metrics: if isinstance(thrs, tuple): eval_results.update({ f'{key}_thr_{thr:.2f}': value for thr, value in zip(thrs, values) }) else: eval_results[key] = values return eval_results
StarcoderdataPython
3262264
import sys import random from test_base import * class TestStride2(TestBase): def generate(self): self.clear_tag() for x in range(1,13): stride = (2**x)-1 taddr = 0 while taddr < self.MAX_ADDR: self.send_sb(taddr) taddr += stride taddr = 0 while taddr < self.MAX_ADDR: self.send_lb(taddr) taddr += stride # done self.tg.done() # main() if __name__ == "__main__": t = TestStride2() t.generate()
StarcoderdataPython
48836
<gh_stars>1-10 from lixian_commands.util import * from lixian_cli_parser import * from lixian_encoding import default_encoding import lixian_help import lixian_query @command_line_parser(help=lixian_help.readd) @with_parser(parse_login) @with_parser(parse_logging) @command_line_option('deleted') @command_line_option('expired') @command_line_option('all') def readd_task(args): if args.deleted: status = 'deleted' elif args.expired: status = 'expired' else: raise NotImplementedError('Please use --expired or --deleted') client = create_client(args) if status == 'expired' and args.all: return client.readd_all_expired_tasks() to_readd = lixian_query.search_tasks(client, args) non_bt = [] bt = [] if not to_readd: return print "Below files are going to be re-added:" for x in to_readd: print x['name'].encode(default_encoding) if x['type'] == 'bt': bt.append((x['bt_hash'], x['id'])) else: non_bt.append((x['original_url'], x['id'])) if non_bt: urls, ids = zip(*non_bt) client.add_batch_tasks(urls, ids) for hash, id in bt: client.add_torrent_task_by_info_hash2(hash, id)
StarcoderdataPython
1646572
from flask import Flask, request import tensorflow as tf from correct_text import create_model, DefaultMovieDialogConfig, decode from text_corrector_data_readers import MovieDialogReader data_path = '/input/data/movie_dialog_train.txt' model_path = '/input/model' tfs = tf.Session() config = DefaultMovieDialogConfig() print('Loading model from path: %s' % model_path) model = create_model(tfs, True, model_path, config=config) print('Using data from path: %s' % data_path) data_reader = MovieDialogReader(config, data_path) app = Flask(__name__) @app.route('/', methods=['POST']) def correct_handler(): corrective_tokens = data_reader.read_tokens(data_path) request.get_data() decodings = decode(tfs, model=model, data_reader=data_reader, data_to_decode=[request.data.split()], corrective_tokens=corrective_tokens) return ' '.join(next(decodings)) if __name__ == '__main__': app.run(host='0.0.0.0')
StarcoderdataPython
3270183
''' This module will draw the national flag in inscape ''' from pyautogui import * from time import sleep def draw_rectangle(): press('s') click(568,300) location =[[775,-168,167,-775,568,534,"ff6600ff"],[775,-171,171,-775,568,705,"ffffff"],[775,-169,169,-775,568,300,"449900ff"]] click(568,367,duration=0.2) #locate press('p') for item in location: top,left,right,bottom,x,y, color = item sleep(0.5) drag(top,0,duration=1) # click() print("done top") drag(0, right,duration=1) # click() print("done right") drag(bottom,0,duration=1) # click() print("done bottom") drag(0, left,duration=1) print("done left") # click() # press('s') # click() sleep(1) #right click hotkey('shift','ctrl','f') sleep(1) #flat color click(1534,223) sleep(1) #color select click(1791,477,clicks=2) sleep(1) #type color name typewrite(color,interval=0.01) sleep(1) #exit the color pallet click(1829,143) #for the next rectangle click(x,y) def draw_outer_circle(): #draw outer circle press('e') mouseDown(911,561) sleep(1) drag(126,120) press('s') # click(955,570) #add color sleep(1) #enter color pallet hotkey('shift','ctrl','f') sleep(1) # flat color click(1517,181) sleep(1) click(1534,223) sleep(1) #color select click(1791,477,clicks=2) sleep(1) #type color name typewrite("ffffff",interval=0.01) sleep(1) #stroke - color click(1615,183) sleep(0.3) click(1534,223) sleep(1) #color select click(1791,477,clicks=2) sleep(1) #type color name typewrite("1128fffc",interval=0.01) sleep(1) #stroke click(1763,181) sleep(0.2) click(1596,225,clicks=2) hotkey('ctrl','a') typewrite('2.5') #exit the color pallet click(1829,143) sleep(1) print("outer circle - done") click(568,300) def draw_lines(): lines = [[(910,624),(1036,623)],[(919,594),(1027,651)],[(940,572),(1008,669)],[(974,562),(974,680)], [(1003,569),(945,674)],[(1025,589),(924,656)]] click(568,300) odd_index,even_index,count = 0,0,0 for line in lines: press('p') start,end = line x1,y1 = start x2,y2 = end sleep(1) move(x1,y1) sleep(1) click(x1,y1,duration=0.5) click(x2,y2,duration=0.4) # enter color pallet hotkey('shift','ctrl','f') sleep(1) # flat color click(1517,181) sleep(1) click(1534,223) sleep(1) #color select click(1791,477,clicks=2) sleep(1) #type color name typewrite("1128fffc",interval=0.01) sleep(1) #stroke - color click(1615,183) sleep(0.3) click(1534,223) sleep(1) #color select click(1791,477,clicks=2) sleep(1) #type color name typewrite("1128fffc",interval=0.01) sleep(1) # line - thickness click(1763,181) sleep(0.2) click(1596,225,clicks=2) hotkey('ctrl','a') typewrite('1.5') press('s') click(568,300) def draw_inner_circle(): # draw inner circle press('s') sleep(1) press('e') mouseDown(966,613) sleep(1) drag(18,17) press('s') # click(955,570) #add color sleep(0.51) #enter color pallet hotkey('shift','ctrl','f') sleep(1) #flat color click(1517,181) sleep(1) click(1534,223) sleep(1) #color select click(1791,477,clicks=2) sleep(1) #type color name typewrite("1128ffff",interval=0.01) sleep(1) # stroke - color click(1615,183) sleep(0.3) click(1534,223) sleep(1) #color select click(1791,477,clicks=2) sleep(1) #type color name typewrite("1128ffff",interval=0.01) sleep(1) #exit the color pallet click(1829,143) def main(): sleep(2) #open the terminal hotkey('winleft') sleep(2) typewrite("inkscape",interval=0.3) press('enter') sleep(2) hotkey('winleft','up') sleep(2) draw_rectangle() draw_outer_circle() draw_lines() draw_inner_circle() press('s') click(568,300) if __name__ == "__main__": print("Bot Started!!!") main() ''' Created By SanthoshGoku '''
StarcoderdataPython
1702986
from math import sin, cos, pi,tan, atan2,log import math from itertools import groupby from operator import itemgetter import tf import rospy import numpy as np from geometry_msgs.msg import TransformStamped from geometry_msgs.msg import PointStamped class distance_obj: def __init__(self,dis) self.distance[] = dis class localmap: def __init__(self, height, width, resolution,morigin): self.height=height self.width=width self.resolution=resolution self.punknown=-1.0 self.distancemap = [distance_obj]*int(self.width/self.resolution)*int(self.height/self.resolution) # self.localmap=[self.punknown]*int(self.width/self.resolution)*int(self.height/self.resolution) self.origin=int(math.ceil(morigin[0]/resolution))+int(math.ceil(width/resolution)*math.ceil(morigin[1]/resolution)) # self.pfree=log(0.3/0.7) # self.pocc=log(0.9/0.1) # self.prior=log(0.5/0.5) # self.max_logodd=100.0 # self.max_logodd_belief=10.0 # self.max_scan_range=1.0 self.map_origin=morigin def updatemap(self,dis,pose): x = pose[0] y = pose[1] self.distancemap[x][y] = dis
StarcoderdataPython
1736369
<reponame>hugmyndakassi/Facedancer # MAXUSBApp.py # # Contains class definition for MAXUSBApp. import time from ..core import FacedancerApp from ..USB import * from ..USBDevice import USBDeviceRequest class MAXUSBApp(FacedancerApp): reg_ep0_fifo = 0x00 reg_ep1_out_fifo = 0x01 reg_ep2_in_fifo = 0x02 reg_ep3_in_fifo = 0x03 reg_setup_data_fifo = 0x04 reg_ep0_byte_count = 0x05 reg_ep1_out_byte_count = 0x06 reg_ep2_in_byte_count = 0x07 reg_ep3_in_byte_count = 0x08 reg_ep_stalls = 0x09 reg_clr_togs = 0x0a reg_endpoint_irq = 0x0b reg_endpoint_interrupt_enable = 0x0c reg_usb_irq = 0x0d reg_usb_interrupt_enable = 0x0e reg_usb_control = 0x0f reg_cpu_control = 0x10 reg_pin_control = 0x11 reg_revision = 0x12 reg_function_address = 0x13 reg_io_pins = 0x14 # bitmask values for reg_endpoint_irq = 0x0b is_setup_data_avail = 0x20 # SUDAVIRQ is_in3_buffer_avail = 0x10 # IN3BAVIRQ is_in2_buffer_avail = 0x08 # IN2BAVIRQ is_out1_data_avail = 0x04 # OUT1DAVIRQ is_out0_data_avail = 0x02 # OUT0DAVIRQ is_in0_buffer_avail = 0x01 # IN0BAVIRQ # bitmask values for reg_usb_control = 0x0f usb_control_vbgate = 0x40 usb_control_connect = 0x08 # bitmask values for reg_pin_control = 0x11 interrupt_level = 0x08 full_duplex = 0x10 ep0_in_nak = (1 << 5) ep2_in_nak = (1 << 6) ep3_in_nak = (1 << 7) # TODO: Support a generic MaxUSB interface that doesn't # depend on any GoodFET details. @staticmethod def bytes_as_hex(b, delim=" "): return delim.join(["%02x" % x for x in b]) # HACK: but given the limitations of the MAX chips, it seems necessary def send_on_endpoint(self, ep_num, data, blocking=False): if ep_num == 0: fifo_reg = self.reg_ep0_fifo bc_reg = self.reg_ep0_byte_count elif ep_num == 2: fifo_reg = self.reg_ep2_in_fifo bc_reg = self.reg_ep2_in_byte_count elif ep_num == 3: fifo_reg = self.reg_ep3_in_fifo bc_reg = self.reg_ep3_in_byte_count else: raise ValueError('endpoint ' + str(ep_num) + ' not supported') # FIFO buffer is only 64 bytes, must loop while len(data) > 64: self.write_bytes(fifo_reg, data[:64]) self.write_register(bc_reg, 64, ack=True) data = data[64:] self.write_bytes(fifo_reg, data) self.write_register(bc_reg, len(data), ack=True) if self.verbose > 1: print(self.app_name, "wrote", self.bytes_as_hex(data), "to endpoint", ep_num) # HACK: but given the limitations of the MAX chips, it seems necessary def read_from_endpoint(self, ep_num): if ep_num != 1: return b'' byte_count = self.read_register(self.reg_ep1_out_byte_count) if byte_count == 0: return b'' data = self.read_bytes(self.reg_ep1_out_fifo, byte_count) if self.verbose > 1: print(self.app_name, "read", self.bytes_as_hex(data), "from endpoint", ep_num) return data def stall_endpoint(self, ep_number, direction=0): """ Stalls an arbitrary endpoint. ep_number: The endpoint number to be stalled direction: 0 for out, 1 for in """ if self.verbose > 0: print(self.app_name, "stalling endpoint {}".format(ep_number)) # TODO: Verify our behavior, here. The original facedancer code stalls # EP0 both _in_ and out, as well as uses the special STALL SETUP bit. # Is this really what we want? if ep_number == 0: self.write_register(self.reg_ep_stalls, 0x23) elif ep_number < 4: self.write_writer(self.reg_ep_stalls, 1 << (ep_num + 1)) else: raise ValueError("Invalid endpoint for MAXUSB device!") def stall_ep0(self): return self.stall_endpoint(0) def get_version(self): return self.read_register(self.reg_revision) def connect(self, usb_device, max_ep0_packet_size=64): if self.read_register(self.reg_usb_control) & self.usb_control_connect: self.write_register(self.reg_usb_control, self.usb_control_vbgate) time.sleep(.1) self.write_register(self.reg_usb_control, self.usb_control_vbgate | self.usb_control_connect) self.connected_device = usb_device if self.verbose > 0: print(self.app_name, "connected device", self.connected_device.name) def disconnect(self): self.write_register(self.reg_usb_control, self.usb_control_vbgate) if self.verbose > 0: print(self.app_name, "disconnected device", self.connected_device.name) self.connected_device = None def clear_irq_bit(self, reg, bit): self.write_register(reg, bit) def service_irqs(self): irq = self.read_register(self.reg_endpoint_irq) in_nak = self.read_register(self.reg_pin_control) if self.verbose > 3: print(self.app_name, "read endpoint irq: 0x%02x" % irq) print(self.app_name, "read pin control: 0x%02x" % in_nak) if self.verbose > 2: if irq & ~ (self.is_in0_buffer_avail \ | self.is_in2_buffer_avail | self.is_in3_buffer_avail): print(self.app_name, "notable irq: 0x%02x" % irq) if irq & self.is_setup_data_avail: self.clear_irq_bit(self.reg_endpoint_irq, self.is_setup_data_avail) b = self.read_bytes(self.reg_setup_data_fifo, 8) if (irq & self.is_out0_data_avail) and (b[0] & 0x80 == 0x00): data_bytes_len = b[6] + (b[7] << 8) b += self.read_bytes(self.reg_ep0_fifo, data_bytes_len) req = self.connected_device.create_request(b) self.connected_device.handle_request(req) if irq & self.is_out1_data_avail: data = self.read_from_endpoint(1) if data: self.connected_device.handle_data_available(1, data) self.clear_irq_bit(self.reg_endpoint_irq, self.is_out1_data_avail) if irq & self.is_in2_buffer_avail: self.connected_device.handle_buffer_available(2) if irq & self.is_in3_buffer_avail: self.connected_device.handle_buffer_available(3) # Check to see if we've NAK'd on either of our IN endpoints, # and generate the relevant events. if in_nak & self.ep2_in_nak: self.connected_device.handle_nak(2) self.clear_irq_bit(self.reg_pin_control, in_nak | self.ep2_in_nak) if in_nak & self.ep3_in_nak: self.connected_device.handle_nak(3) self.clear_irq_bit(self.reg_pin_control, in_nak | self.ep3_in_nak) def set_address(self, address, defer=False): """ Sets the device address of the Facedancer. Usually only used during initial configuration. address: The address that the Facedancer should assume. """ # The MAXUSB chip handles this for us, so we don't need to do anything. pass def configured(self, configuration): """ Callback that's issued when a USBDevice is configured, e.g. by the SET_CONFIGURATION request. Allows us to apply the new configuration. configuration: The configuration applied by the SET_CONFIG request. """ # For the MAXUSB case, we don't need to do anything, though it might # be nice to print a message or store the active configuration for # use by the USBDevice, etc. etc. pass
StarcoderdataPython
1626102
<gh_stars>0 # Copyright (C) 2020-2021 Intel Corporation # SPDX-License-Identifier: Apache-2.0 """FedCurv Aggregation function module.""" import numpy as np from .weighted_average import WeightedAverage class FedCurvWeightedAverage(WeightedAverage): """Aggregation function of FedCurv algorithm. Applies weighted average aggregation to all tensors except Fisher matrices variables (u_t, v_t). These variables are summed without weights. FedCurv paper: https://arxiv.org/pdf/1910.07796.pdf """ def call(self, local_tensors, db_iterator, tensor_name, fl_round, tags): """Apply aggregation.""" if ( tensor_name.endswith('_u') or tensor_name.endswith('_v') or tensor_name.endswith('_w') ): tensors = [local_tensor.tensor for local_tensor in local_tensors] agg_result = np.sum(tensors, axis=0) return agg_result return super().call(local_tensors)
StarcoderdataPython
146337
import unittest from itcc import ITCC import pandas as pd class TestITCC(unittest.TestCase): def test_itcc_ingest(self): i = ITCC() df = i.get_path_matrix() self.assertEqual(type(df), pd.DataFrame) print(df.describe()) print("=" * 80) def test_getCXY(self): i = ITCC() df = i.getCXY() print(df.head()) print(f"Shape: {df.shape}") print("=" * 80) def test_generate_artifact(self): i = ITCC() druggene_mappings = pd.read_csv( "/Users/mtaruno/Documents/DevZone/Stem-Away-group-5/data/artifacts/druggene_mappings.csv", index_col=0, ) path_mappings = pd.read_csv( "/Users/mtaruno/Documents/DevZone/Stem-Away-group-5/data/artifacts/path_mappings.csv", index_col=0, ) df = i.generate_artifact( druggene_mappings=druggene_mappings, path_mappings=path_mappings ) print(df.head()) df.to_csv( "/Users/mtaruno/Documents/DevZone/Stem-Away-group-5/data/artifacts/ebc_artifact.csv" ) print("=" * 80) unittest.main()
StarcoderdataPython