id
stringlengths
1
7
text
stringlengths
6
1.03M
dataset_id
stringclasses
1 value
1783939
from clickatell import Transport class Http(Transport): """ Provides access to the Clickatell HTTP API """ def __init__(self, apiKey): """ Construct a new API instance with the auth key of the API :param str apiKey: The auth key """ self.apiKey = apiKey Transport.__init__(self) def request(self, action, data={}, headers={}, method='GET'): """ Append the user authentication details to every incoming request """ data = self.merge(data, {'apiKey': self.apiKey}) return Transport.request(self, action, data, headers, method) def sendMessage(self, to, message, extra={}): """ If the 'to' parameter is a single entry, we will parse it into a list. We will merge default values into the request data and the extra parameters provided by the user. """ to = to if isinstance(to, list) else [to] data = {'to': to, 'content': message} data = self.merge(data, extra) content = self.parseResponse(self.request('messages/http/send', data)) return content
StarcoderdataPython
3399199
from . import db from werkzeug.security import generate_password_hash, check_password_hash from flask_login import UserMixin from . import login_manager from datetime import datetime @login_manager.user_loader def load_user(user_id): return User.query.get(user_id) class User(UserMixin,db.Model): __tablename__ = 'users' id = db.Column(db.Integer,primary_key = True) username = db.Column(db.String(255),unique=True,) email = db.Column(db.String(255), unique=True, index=True) pass_secure = db.Column(db.String(255)) posts = db.relationship('Post', backref='user', lazy='dynamic') comment = db.relationship('Comment', backref='user', lazy='dynamic') bio = db.Column(db.String(255)) profile_pic_path = db.Column(db.String()) @property def password(self): raise AttributeError('You cannot read the password attribute') @password.setter def password(self, password): self.pass_secure = generate_password_hash(password) def verify_password(self,password): return check_password_hash(self.pass_secure,password) def save_user(self): db.session.add(self) db.session.commit() def __repr__(self): return f'User {self.username}' class Post(db.Model, UserMixin): __tablename__ = 'posts' id = db.Column(db.Integer, primary_key=True) user_id = db.Column(db.Integer, db.ForeignKey('users.id')) post = db.Column(db.Text, nullable=False) comment = db.relationship('Comment', backref='post', lazy='dynamic') category = db.Column(db.String, nullable=False) date_created = db.Column(db.DateTime, default=datetime.utcnow) author = db.Column(db.String) up_vote = db.relationship('Upvote', backref='post', lazy='dynamic') down_vote = db.relationship('Downvote', backref='post', lazy='dynamic') def save_post(self): db.session.add(self) db.session.commit() def delete_post(self): db.session.delete(self) db.session.commit() def __repr__(self): return f"Post Title: {self.title}" class Comment(db.Model): __tablename__ = 'comments' id = db.Column(db.Integer, primary_key=True) user_id = db.Column(db.Integer, db.ForeignKey('users.id')) post_id = db.Column(db.Integer, db.ForeignKey('posts.id')) comment = db.Column(db.Text(), nullable=False) def save(self): db.session.add(self) db.session.commit() @classmethod def get_comments(cls, post_id): comments = Comment.query.filter_by(post_id=post_id).all() return comments def delete(self): db.session.delete(self) db.session.commit() def __repr__(self): return f'Comments: {self.comment}' class Upvote(db.Model): __tablename__ = 'upvotes' id = db.Column(db.Integer, primary_key=True) upvote = db.Column(db.Integer, default=1) user_id = db.Column(db.Integer, db.ForeignKey('users.id')) post_id = db.Column(db.Integer, db.ForeignKey('posts.id')) def save(self): db.session.add(self) db.session.commit() def upvote(cls, id): upvote_post = Upvote(user=current_user, post_id=id) upvote_post.save() @classmethod def query_upvotes(cls, id): upvote = Upvote.query.filter_by(post_id=id).all() return upvote @classmethod def all_upvotes(cls): upvotes = Upvote.query.order_by('id').all() return upvotes def __repr__(self): return f'{self.user_id}:{self.post_id}' class Downvote(db.Model): __tablename__ = 'downvotes' id = db.Column(db.Integer, primary_key=True) downvote = db.Column(db.Integer, default=1) user_id = db.Column(db.Integer, db.ForeignKey('users.id')) post_id = db.Column(db.Integer, db.ForeignKey('posts.id')) def save(self): db.session.add(self) db.session.commit() def downvote(cls, id): downvote_post = Downvote(user=current_user, post_id=id) downvote_post.save() @classmethod def query_downvotes(cls, id): downvote = Downvote.query.filter_by(post_id=id).all() return downvote @classmethod def all_downvotes(cls): downvote = Downvote.query.order_by('id').all() return downvote def __repr__(self): return f'{self.user_id}:{self.post_id}'
StarcoderdataPython
1687446
<reponame>waleoyediran/django-starter from rest_framework import routers from demoproject.api import views api_router = routers.DefaultRouter() api_router.register(r'users', views.UserViewSet)
StarcoderdataPython
119090
#!/usr/bin/env python # Copyright 2014 The Chromium Authors. All rights reserved. # Use of this source code is governed by a BSD-style license that can be # found in the LICENSE file. """ Unit tests for the contents of device_temp_file.py. """ import logging import os import sys import unittest from pylib import constants from pylib.utils import device_temp_file sys.path.append(os.path.join( constants.DIR_SOURCE_ROOT, 'third_party', 'pymock')) import mock # pylint: disable=F0401 class DeviceTempFileTest(unittest.TestCase): def setUp(self): self.device_utils = mock.MagicMock() def testTempFileNameAlreadyExists(self): self.device_utils.GetExternalStoragePath.return_value = '/sdcard' self.device_utils.FileExists.side_effect = [True, True, True, False] tmpfile = device_temp_file.DeviceTempFile(self.device_utils) logging.debug('Temp file name: %s' % tmpfile.name) self.assertEqual(self.device_utils.FileExists.call_count, 4) self.device_utils.WriteFile.assert_called_with(tmpfile.name, '') def testTempFileLifecycle(self): self.device_utils.GetExternalStoragePath.return_value = '/sdcard' self.device_utils.FileExists.return_value = False with device_temp_file.DeviceTempFile(self.device_utils) as tmpfile: filename = tmpfile.name self.assertEqual(self.device_utils.WriteFile.call_count, 1) self.assertNotEqual(self.device_utils.RunShellCommand.call_args, mock.call(['rm', mock.ANY])) self.assertEqual(self.device_utils.RunShellCommand.call_args, mock.call(['rm', filename])) if __name__ == '__main__': logging.getLogger().setLevel(logging.DEBUG) unittest.main(verbosity=2)
StarcoderdataPython
186134
from http.client import HTTPConnection import sys, urllib.parse def stop_server (port): """send QUIT request to http server running on localhost:<port>""" conn = HTTPConnection("localhost:%d" % port) conn.request("PRINT", "/", "THIS IS IT PRINTING") resp = conn.getresponse() conn = HTTPConnection("localhost:%d" % port) conn.request("ERROR", "/", "THIS IS IT ERORRING") resp = conn.getresponse() conn = HTTPConnection("localhost:%d" % port) conn.request("QUIT", "/", "THIS IS IT QUITTING") resp = conn.getresponse() print(resp) assert len(sys.argv) > 1, "Error, correct usage: %s <port number>" % sys.argv[0] assert sys.argv[1].isdigit(), "invalid port %r" % sys.argv[1] port = int(sys.argv[1]) stop_server(port)
StarcoderdataPython
1641547
# -*- coding: utf-8 -*- """ Created on Thu Dec 9 00:35:02 2021 @author: loaner """ import numpy as np from matplotlib import pyplot as plt import os from scipy.interpolate import make_interp_spline Re_tau1 = [125, 180, 250, 550] sparese = [0.02, 0.05, 0.1] dummy_idx1 = 200 path = "raw_results/" SMALL_SIZE = 10 MEDIUM_SIZE = 12 BIGGER_SIZE = 14 plt.rc('font', size=BIGGER_SIZE) # controls default text sizes plt.rc('axes', titlesize=MEDIUM_SIZE) # fontsize of the axes title plt.rc('axes', labelsize=MEDIUM_SIZE) # fontsize of the x and y labels plt.rc('xtick', labelsize=SMALL_SIZE) # fontsize of the tick labels plt.rc('ytick', labelsize=SMALL_SIZE) # fontsize of the tick labels plt.rc('legend', fontsize=MEDIUM_SIZE) # legend fontsize plt.rc('figure', titlesize=MEDIUM_SIZE) # fontsize of the figure title err_U_sps = [] err_uv_sps = [] #for sprse in sparese: for Re_tau in Re_tau1: dummy_idx1 = 200 #dummy_idx2 = 70 """ Get DNS data and Spline fitting """ str1 = 'DNS_data/Couette_Retau'+np.str(Re_tau)+'.dat' data = np.loadtxt(str1) y_h, y_plus, U_plus, uv_plus = data[:,0], data[:,1], data[:,2], data[:,9] new_Re_tau = y_plus[-1]/2 spl_U = make_interp_spline(y_plus, U_plus) spl_uv = make_interp_spline(y_plus, uv_plus) idx = np.where(y_plus <new_Re_tau+0.01 ) plt.semilogx (y_plus[idx], U_plus[idx]*2/np.max(U_plus) , 'k--', label = r"$U_{dns}$") plt.semilogx (y_plus[idx].reshape((-1,1)), uv_plus[idx] , 'b--', label = r"$uv_{dns}$") #for Re_tau in Re_tau1: for sprse in sparese: #dummy_idx2 += 2 dummy_idx1 += 2 data_sparse = np.loadtxt('raw/Channel_Re_tau ='+np.str(Re_tau)+'_coeff-aux-pts='+np.str(dummy_idx1)+'_alpha_.txt') yp_sps, U_sps, uv_sps = data_sparse[:,0], data_sparse[:, 1], data_sparse[:,2] err_U_sps_loc = np.mean(np.absolute(spl_U(yp_sps) - U_sps) / np.absolute(spl_U(yp_sps) + 1e-5) ) err_uv_sps_loc = np.mean(np.absolute(spl_uv(yp_sps) - uv_sps)) err_U_sps.append(err_U_sps_loc*100) err_uv_sps.append(err_uv_sps_loc*100) plt.semilogx (yp_sps.reshape((-1,1)), 2*U_sps.reshape(-1)/np.max(U_plus), label = r"$U_{nn}$; data(%):"+np.str(sprse*100)) #plt.semilogx (y_plus, U_plus/np.max(U_plus) , 'k--', label = r"$U_{dns}$") #plt.semilogx (yp_sps.reshape((-1,1)), U_sps.reshape(-1)/np.max(U_plus), 'r', label = r"$U_{nn}$") plt.semilogx (yp_sps.reshape((-1,1)), uv_sps.reshape(-1), label = r"$uv_{nn}$; data(%):"+np.str(sprse*100)) plt.legend(bbox_to_anchor=(1.05, 1), loc='upper left', borderaxespad=0.) plt.xlabel(r"$y^+$") plt.ylabel("values") plt.title(r"Couette : Non Fickian low, $Re_{\tau}$ = "+np.str(Re_tau)) plt.tight_layout() plt.savefig('pics/spase_nf_couette_Re_'+np.str(Re_tau)+'.png', dpi=300) plt.show() #plt.close(fig) sparese = np.array(sparese)*100 plt.plot (sparese, err_U_sps[:3], label = r"$Re_{\tau}$ :" +np.str(Re_tau1[0])) plt.plot (sparese, err_U_sps[3:6], label = r"$Re_{\tau}$ :" +np.str(Re_tau1[1])) plt.plot (sparese, err_U_sps[6:9], label = r"$Re_{\tau}$ :" +np.str(Re_tau1[2])) plt.plot (sparese, err_U_sps[9:], label = r"$Re_{\tau}$ :" +np.str(Re_tau1[3])) plt.legend(bbox_to_anchor=(1.05, 1), loc='upper left', borderaxespad=0.) plt.xlabel(r"% of data") plt.ylabel(" U : Error (%)") plt.title(r"Couette : Non Fickian law, error in velocity") plt.tight_layout() plt.savefig('pics/cou_nf_u_err.png', dpi=300) plt.show() plt.plot (sparese, err_uv_sps[:3], label = r"$Re_{\tau}$ :" +np.str(Re_tau1[0])) plt.plot (sparese, err_uv_sps[3:6], label = r"$Re_{\tau}$ :" +np.str(Re_tau1[1])) plt.plot (sparese, err_uv_sps[6:9], label = r"$Re_{\tau}$ :" +np.str(Re_tau1[2])) plt.plot (sparese, err_uv_sps[9:], label = r"$Re_{\tau}$ :" +np.str(Re_tau1[3])) plt.legend(bbox_to_anchor=(1.05, 1), loc='upper left', borderaxespad=0.) plt.xlabel(r"% of data") plt.ylabel(" uv : Error (%)") plt.title(r"Couette : Non Fickian law, error in Reynolds Stress") plt.tight_layout() plt.savefig('pics/cou_nf_uv_err.png', dpi=300) plt.show()
StarcoderdataPython
1690069
<gh_stars>0 from Node import Node class LinkedList: def __init__(self): self.head = None self.tail = None def append(self, data): new_node = Node(data) if self.head is None: self.head = new_node self.tail = new_node else: new_node.prev = self.tail self.tail.next = new_node self.tail = new_node def prepend(self, data): new_node = Node(data) if self.head is None: self.head = new_node self.tail = new_node else: new_node.next = self.head self.head.prev = new_node self.head = new_node def insertAfter(self, node, data): given_node = self.search(node)['node'] new_node = Node(data) next_node = given_node.next next_node.prev = new_node new_node.next = next_node new_node.prev = given_node given_node.next = new_node def insertBefore(self, node, data): given_node = self.search(node)['node'] new_node = Node(data) prev_node = given_node.prev prev_node.next = new_node new_node.next = given_node new_node.prev = prev_node given_node.prev = new_node def delete(self, elements): index = -1 head = self.head while head is not None: index += 1 if index in elements: prev_node = head.prev next_node = head.next if prev_node is not None: prev_node.next = next_node if next_node is not None: next_node.prev = prev_node head = head.next def remove(self, key): if isinstance(key, list): self.delete(key) else: node_indexes = self.search(key)['indexes'] self.delete(node_indexes) def search(self, data): head = self.head current_index = -1 info = {'node': None, 'count': 0, 'indexes': []} while head is not None: current_index += 1 if head.data == data: info['node'] = head info['count'] += 1 info['indexes'].append(current_index) head = head.next if info['count'] == 0: return None else: return info def sort(self): current_node = self.head.next while current_node is not None: next_node = current_node.next search_node = current_node.prev while search_node is not None and search_node.data > current_node.data: search_node = search_node.prev self.remove(current_node.data) if search_node is None: current_node.prev = None self.prepend(current_node.data) else: self.insertAfter(search_node.data, current_node.data) current_node = next_node def print(self): output = "" head = self.head while head is not None: output += str(head.data) + " ---> " head = head.next if not len(output) > 0: output += "The list is empty!" return output[:-6]
StarcoderdataPython
31475
# -*- encoding: utf-8 -*- from __future__ import absolute_import, unicode_literals import re from addonpayments.utils import GenerationUtils class TestGenerationUtils: def test_generate_hash(self): """ Test Hash generation success case. """ test_string = '20120926112654.thestore.ORD453-11.00.Successful.3737468273643.79347' secret = 'mysecret' expected_result = '368df010076481d47a21e777871012b62b976339' result = GenerationUtils.generate_hash(test_string, secret) assert expected_result == result def test_generate_timestamp(self): """ Test timestamp generation. Hard to test this in a meaningful way. Checking length and valid characters. """ result = GenerationUtils().generate_timestamp() match = re.match(r'([0-9]{14})', result) assert match def test_generate_order_id(self): """ Test order Id generation. Hard to test this in a meaningful way. Checking length and valid characters. """ result = GenerationUtils().generate_order_id() match = re.match(r'[A-Za-z0-9-_]{32}', result) assert match
StarcoderdataPython
2140
<reponame>WAvdBeek/CoAPthon3 #!/usr/bin/env python import getopt import socket import sys import cbor #from cbor2 import dumps, loads import json import time import traceback from coapthon.client.helperclient import HelperClient from coapthon.utils import parse_uri from coapthon import defines client = None paths = {} paths_extend = {} my_base = "" def usage(): # pragma: no cover print("Command:\tknxcoapclient.py -o -p [-P]") print("Options:") print("\t-o, --operation=\tGET|GETNONE|PUT|POST|DELETE|DISCOVER|OBSERVE") print("\t-p, --path=\t\t\tPath of the request") print("\t-P, --payload=\t\tPayload of the request") print("\t-c, --contenttype=\t\tcontenttype of the request") print("\t-f, --payload-file=\t\tFile with payload of the request") def get_url(line): data = line.split(">") url = data[0] return url[1:] def get_ct(line): tagvalues = line.split(";") for tag in tagvalues: if tag.startswith("ct"): ct_value_all = tag.split("=") ct_value = ct_value_all[1].split(",") return ct_value[0] return "" def get_base(url): # python3 knxcoapclient.py -o GET -p coap://[fe80::6513:3050:71a7:5b98]:63914/a -c 50 my_url = url.replace("coap://","") mybase = my_url.split("/") return mybase[0] def get_base_from_link(payload): print("get_base_from_link\n") global paths global paths_extend lines = payload.splitlines() # add the if len(paths) == 0: my_base = get_base(get_url(lines[0])) return my_base def get_sn(my_base): print("Get SN :"); sn = execute_get("coap://"+my_base+"/dev/sn", 60) json_data = cbor.loads(sn.payload) #print ("SN : ", json_data) return json_data def install(my_base): sn = get_sn(my_base) print (" SN : ", sn) iid = "5" # installation id if "000001" == sn : # sensor, e.g sending print ("--------------------") print ("Installing SN: ", sn) content = { 2: "reset"} print("reset :", content); execute_post("coap://"+my_base+"/.well-known/knx", 60, 60, content) content = True print("set PM :", content); execute_put("coap://"+my_base+"/dev/pm", 60, 60, content) content = 1 print("set IA :", content); execute_put("coap://"+my_base+"/dev/ia", 60, 60, content) content = iid execute_put("coap://"+my_base+"/dev/iid", 60, 60, content) content = { 2: "startLoading"} print("lsm :", content); execute_post("coap://"+my_base+"/a/lsm", 60, 60, content) execute_get("coap://"+my_base+"/a/lsm", 60) # group object table # id (0)= 1 # url (11)= /p/light # ga (7 )= 1 # cflags (8) = ["r" ] ; read = 1, write = 2, transmit = 3 update = 4 content = [ {0: 1, 11: "p/push", 7:[1], 8: [2] } ] execute_post("coap://"+my_base+"/fp/g", 60, 60, content) execute_get("coap://"+my_base+"/fp/g", 40) # recipient table # id (0)= 1 # ia (12) # url (11)= .knx # ga (7 )= 1 # cflags (8) = ["r" ] ; read = 1, write = 2, transmit = 3 update = 4 content = [ {0: 1, 11: "/p/push", 7:[1], 12 :"blah.blah" } ] execute_post("coap://"+my_base+"/fp/r", 60, 60, content) content = False print("set PM :", content); execute_put("coap://"+my_base+"/dev/pm", 60, 60, content) content = { 2: "loadComplete"} print("lsm :", content); execute_post("coap://"+my_base+"/a/lsm", 60, 60, content) execute_get("coap://"+my_base+"/a/lsm", 60) if "000002" == sn : # actuator ==> receipient # should use /fp/r print ("--------------------") print ("installing SN: ", sn) content = True print("set PM :", content); execute_put("coap://"+my_base+"/dev/pm", 60, 60, content) content = 2 print("set IA :", content); execute_put("coap://"+my_base+"/dev/ia", 60, 60, content) content = iid execute_put("coap://"+my_base+"/dev/iid", 60, 60, content) content = { 2: "startLoading"} print("lsm :", content); execute_post("coap://"+my_base+"/a/lsm", 60, 60, content) execute_get("coap://"+my_base+"/a/lsm", 60) # group object table # id (0)= 1 # url (11)= /p/light # ga (7 )= 1 # cflags (8) = ["r" ] ; read = 1, write = 2, transmit = 3 update = 4 content = [ { 0: 1, 11: "/p/light", 7:[1], 8: [1] } ] execute_post("coap://"+my_base+"/fp/g", 60, 60, content) execute_get("coap://"+my_base+"/fp/g", 40) # publisher table # id (0)= 1 # ia (12) # url (11)= .knx # ga (7 )= 1 # cflags (8) = ["r" ] ; read = 1, write = 2, transmit = 3 update = 4 content = [ {0: 1, 11: ".knx", 7:[1], 12 :"blah.blah" } ] execute_post("coap://"+my_base+"/fp/p", 60, 60, content) content = False print("set PM :", content); execute_put("coap://"+my_base+"/dev/pm", 60, 60, content) content = { 2: "loadComplete"} print("lsm :", content); execute_post("coap://"+my_base+"/a/lsm", 60, 60, content) execute_get("coap://"+my_base+"/a/lsm", 60) # do a post content = {"sia": 5678, "st": 55, "ga": 1, "value": 100 } content = { 4: 5678, "st": 55, 7: 1, "value": 100 } # st ga value (1) #content = { 5: { 6: 1, 7: 1, 1: True } } #execute_post("coap://"+my_base+"/.knx", 60, 60, content) content = {4: 5678, 5: { 6: 1, 7: 1, 1: False } } #execute_post("coap://"+my_base+"/.knx", 60, 60, content) #execute_post("coap://[FF02::FD]:5683/.knx", 60, 60, content) # no json tags as strings def do_sequence_dev(my_base): print("===================") print("Get SN :"); sn = execute_get("coap://"+my_base+"/dev/sn", 60) sn = get_sn(my_base) print (" SN : ", sn) print("===================") print("Get HWT :"); execute_get("coap://"+my_base+"/dev/hwt", 60) print("===================") print("Get HWV :"); execute_get("coap://"+my_base+"/dev/hwv", 60) print("===================") print("Get FWV :"); execute_get("coap://"+my_base+"/dev/fwv", 60) print("===================") print("Get Model :"); execute_get("coap://"+my_base+"/dev/model", 60) print("===================") content = True print("set PM :", content); execute_put("coap://"+my_base+"/dev/pm", 60, 60, content) execute_get("coap://"+my_base+"/dev/pm", 60) content = False print("set PM :", content); execute_put("coap://"+my_base+"/dev/pm", 60, 60, content) execute_get("coap://"+my_base+"/dev/pm", 60) print("===================") content = 44 print("set IA :", content); execute_put("coap://"+my_base+"/dev/ia", 60, 60, content) execute_get("coap://"+my_base+"/dev/ia", 60) print("===================") content = "my host name" print("set hostname :", content); execute_put("coap://"+my_base+"/dev/hostname", 60, 60, content) execute_get("coap://"+my_base+"/dev/hostname", 60) print("===================") content = " iid xxx" print("set iid :", content); execute_put("coap://"+my_base+"/dev/iid", 60, 60, content) execute_get("coap://"+my_base+"/dev/iid", 60) # id ==> 0 # href ==> 11 # ga ==> 7 # cflag ==> 8 def do_sequence_fp_g_int(my_base): # url, content, accept, contents content = [ {0: 1, 11: "xxxx1", 8: [1,2,3,4,5], 7:[2222,3333]} ] execute_post("coap://"+my_base+"/fp/g", 60, 60, content) execute_get("coap://"+my_base+"/fp/g/1", 60) execute_get("coap://"+my_base+"/fp/g", 40) content = [ {0: 2, 11: "xxxxyyy2", 8: [1,4,5], 7:[44,55,33]}, {0: 3, 1: "xxxxyyy3", 8: [1,4,5], 7:[44,55,33]} ] execute_post("coap://"+my_base+"/fp/g", 60, 60, content) execute_get("coap://"+my_base+"/fp/g/2", 60) execute_get("coap://"+my_base+"/fp/g/3", 60) execute_get("coap://"+my_base+"/fp/g", 40) execute_del("coap://"+my_base+"/fp/g/3", 60) execute_get("coap://"+my_base+"/fp/g/3", 60) execute_get("coap://"+my_base+"/fp/g", 40) def do_sequence_fp_g(my_base): # url, content, accept, contents content = [ {"id": 1, "href": "xxxx1", "cflag": [1,2,3,4,5], "ga":[2222,3333]} ] execute_post("coap://"+my_base+"/fp/g", 60, 60, content) execute_get("coap://"+my_base+"/fp/g/1", 60) execute_get("coap://"+my_base+"/fp/g", 40) content = [ {"id": 2, "href": "xxxxyyy2", "cflag": [1,4,5], "ga":[44,55,33]}, {"id": 3, "href": "xxxxyyy3", "cflag": [1,4,5], "ga":[44,55,33]} ] execute_post("coap://"+my_base+"/fp/g", 60, 60, content) execute_get("coap://"+my_base+"/fp/g/2", 60) execute_get("coap://"+my_base+"/fp/g/3", 60) execute_get("coap://"+my_base+"/fp/g", 40) execute_del("coap://"+my_base+"/fp/g/3", 60) execute_get("coap://"+my_base+"/fp/g/3", 60) execute_get("coap://"+my_base+"/fp/g", 40) # id ==> 0 # ia ==> 12 # path ==> 112 # url ==> 10 # ga ==> 7 def do_sequence_fp_p_int(my_base): # url, content, accept, contents content = [ {0: 1, 12: "Ia.IA1", 112: "path1", 7:[2222,3333]} ] execute_post("coap://"+my_base+"/fp/p", 60, 60, content) execute_get("coap://"+my_base+"/fp/p/1", 60) # 40 == application-link format execute_get("coap://"+my_base+"/fp/p", 40) content = [ {0: 2, 12: "xxxxyyyia2", 112: "path2", 7:[44,55,33]}, {0: 3, 12: "xxxxyyyia3", 112: "path3", 7:[44,55,33]} ] execute_post("coap://"+my_base+"/fp/p", 60, 60, content) execute_get("coap://"+my_base+"/fp/p/2", 60) execute_get("coap://"+my_base+"/fp/p/3", 60) execute_get("coap://"+my_base+"/fp/p", 40) execute_del("coap://"+my_base+"/fp/p/3", 60) execute_get("coap://"+my_base+"/fp/p/3", 60) execute_get("coap://"+my_base+"/fp/p", 40) def do_sequence_fp_p(my_base): # url, content, accept, contents content = [ {"id": 1, "ia": "Ia.IA1", "path": "path1", "ga":[2222,3333]} ] execute_post("coap://"+my_base+"/fp/p", 60, 60, content) execute_get("coap://"+my_base+"/fp/p/1", 60) # 40 == application-link format execute_get("coap://"+my_base+"/fp/p", 40) content = [ {"id": 2, "ia": "xxxxyyyia2", "path": "path2","ga":[44,55,33]}, {"id": 3, "ia": "xxxxyyyia3", "path": "path3","ga":[44,55,33]} ] execute_post("coap://"+my_base+"/fp/p", 60, 60, content) execute_get("coap://"+my_base+"/fp/p/2", 60) execute_get("coap://"+my_base+"/fp/p/3", 60) execute_get("coap://"+my_base+"/fp/p", 40) execute_del("coap://"+my_base+"/fp/p/3", 60) execute_get("coap://"+my_base+"/fp/p/3", 60) execute_get("coap://"+my_base+"/fp/p", 40) # id ==> 0 # ia ==> 12 # path ==> 112 # url ==> 10 # ga ==> 7 def do_sequence_fp_r_int(my_base): # url, content, accept, contents content = [ { 0: 1, 12: "r-Ia.IA1", 112: "r-path1", 7:[2222,3333]} ] execute_post("coap://"+my_base+"/fp/r", 60, 60, content) execute_get("coap://"+my_base+"/fp/r/1", 60) execute_get("coap://"+my_base+"/fp/r", 40) content = [ { 0: 2, 12: "r-Ia.IA2", 10: "url2", 112: "r-path2", 7:[44,55,33]}, {0: 3, 12: "r-Ia.IA3", 112: "r-path3", 7:[44,55,33]} ] execute_post("coap://"+my_base+"/fp/r", 60, 60, content) execute_get("coap://"+my_base+"/fp/r/2", 60) execute_get("coap://"+my_base+"/fp/r/3", 60) execute_get("coap://"+my_base+"/fp/r", 40) execute_del("coap://"+my_base+"/fp/r/3", 60) execute_get("coap://"+my_base+"/fp/r/3", 60) execute_get("coap://"+my_base+"/fp/r", 40) def do_sequence_fp_r(my_base): # url, content, accept, contents content = [ {"id": 1, "ia": "r-Ia.IA1", "path": "r-path1", "ga":[2222,3333]} ] execute_post("coap://"+my_base+"/fp/r", 60, 60, content) execute_get("coap://"+my_base+"/fp/r/1", 60) execute_get("coap://"+my_base+"/fp/r", 40) content = [ {"id": 2, "ia": "r-Ia.IA2", "path": "r-path2", "ga":[44,55,33]}, {"id": 3, "ia": "r-Ia.IA3", "path": "r-path3", "ga":[44,55,33]} ] execute_post("coap://"+my_base+"/fp/r", 60, 60, content) execute_get("coap://"+my_base+"/fp/r/2", 60) execute_get("coap://"+my_base+"/fp/r/3", 60) execute_get("coap://"+my_base+"/fp/r", 40) execute_del("coap://"+my_base+"/fp/r/3", 60) execute_get("coap://"+my_base+"/fp/r/3", 60) execute_get("coap://"+my_base+"/fp/r", 40) # cmd ==> 2 def do_sequence_lsm_int(my_base): # url, content, accept, contents execute_get("coap://"+my_base+"/a/lsm", 60) content = {2 : "startLoading"} execute_post("coap://"+my_base+"/a/lsm", 60, 60, content) execute_get("coap://"+my_base+"/a/lsm", 60) content = {2 : "loadComplete"} execute_post("coap://"+my_base+"/a/lsm", 60, 60, content) execute_get("coap://"+my_base+"/a/lsm", 60) content = {2 : "unload"} execute_post("coap://"+my_base+"/a/lsm", 60, 60, content) execute_get("coap://"+my_base+"/a/lsm", 60) def do_sequence_lsm(my_base): # url, content, accept, contents execute_get("coap://"+my_base+"/a/lsm", 60) content = {"cmd": "startLoading"} execute_post("coap://"+my_base+"/a/lsm", 60, 60, content) execute_get("coap://"+my_base+"/a/lsm", 60) content = {"cmd": "loadComplete"} execute_post("coap://"+my_base+"/a/lsm", 60, 60, content) execute_get("coap://"+my_base+"/a/lsm", 60) content = {"cmd": "unload"} execute_post("coap://"+my_base+"/a/lsm", 60, 60, content) execute_get("coap://"+my_base+"/a/lsm", 60) # ./knx resource # sia ==> 4 # ga ==> 7 # st 6 def do_sequence_knx_knx_int(my_base): # url, content, accept, contents execute_get("coap://"+my_base+"/.knx", 60) content = {"value": { 4 : 5, 7: 7777 , 6 : "rp"}} execute_post("coap://"+my_base+"/.knx", 60, 60, content) execute_get("coap://"+my_base+"/.knx", 60) # ./knx resource def do_sequence_knx_knx(my_base): # url, content, accept, contents execute_get("coap://"+my_base+"/.knx", 60) content = {"value": { "sia" : 5, "ga": 7, "st": "rp"}} execute_post("coap://"+my_base+"/.knx", 60, 60, content) execute_get("coap://"+my_base+"/.knx", 60) def do_sequence_knx_spake(my_base): # url, content, accept, contents # sequence: # - parameter exchange: 15 (rnd)- return value # - credential exchange: 10 - return value # - pase verification exchange: 14 - no return value content = { 15: b"a-15-sdfsdred"} execute_post("coap://"+my_base+"/.well-known/knx/spake", 60, 60, content) # pa content = { 10: b"s10dfsdfsfs" } execute_post("coap://"+my_base+"/.well-known/knx/spake", 60, 60, content) # ca content = { 14: b"a15sdfsdred"} execute_post("coap://"+my_base+"/.well-known/knx/spake", 60, 60, content) # expecting return def do_sequence_knx_idevid(my_base): # url, content, accept, contents execute_get("coap://"+my_base+"/.well-known/knx/idevid", 282) def do_sequence_knx_ldevid(my_base): # url, content, accept, contents execute_get("coap://"+my_base+"/.well-known/knx/ldevid", 282) def do_sequence_knx_osn(my_base): # url, content, accept, contents execute_get("coap://"+my_base+"/.well-known/knx/osn", 60) def do_sequence_knx_crc(my_base): # url, content, accept, contents execute_get("coap://"+my_base+"/.well-known/knx/crc", 60) def do_sequence_oscore(my_base): # url, content, accept, contents execute_get("coap://"+my_base+"/f/oscore", 40) execute_get("coap://"+my_base+"/p/oscore/replwdo", 60) content = 105 execute_put("coap://"+my_base+"/p/oscore/replwdo", 60, 60, content) execute_get("coap://"+my_base+"/p/oscore/replwdo", 60) execute_get("coap://"+my_base+"/p/oscore/osndelay", 60) content = 1050 execute_put("coap://"+my_base+"/p/oscore/osndelay", 60, 60, content) execute_get("coap://"+my_base+"/p/oscore/osndelay", 60) def do_sequence_core_knx(my_base): # url, content, accept, contents execute_get("coap://"+my_base+"/.well-known/knx", 60) content = { 1 : 5, 2: "reset"} execute_post("coap://"+my_base+"/.well-known/knx", 60, 60, content) def do_sequence_a_sen(my_base): # url, content, accept, contents content = {2: "reset"} execute_post("coap://"+my_base+"/a/sen", 60, 60, content) def do_sequence_auth(my_base): # url, content, accept, contents execute_get("coap://"+my_base+"/auth", 40) def do_sequence_auth_at(my_base): # url, content, accept, contents execute_get("coap://"+my_base+"/auth/at", 40) # content = {0: b"id", 1 : 20, 2:b"ms",3:"hkdf", 4:"alg", 5:b"salt", 6:b"contextId"} execute_post("coap://"+my_base+"/auth/at", 60, 60, content) content = {0: b"id2", 1 : 20, 2:b"ms",3:"hkdf", 4:"alg", 5:b"salt", 6:b"contextId2"} execute_post("coap://"+my_base+"/auth/at", 60, 60, content) execute_get("coap://"+my_base+"/auth/at", 40) execute_get("coap://"+my_base+"/auth/at/id", 60) execute_del("coap://"+my_base+"/auth/at/id", 60) def do_sequence_f(my_base): # url, content, accept, contents execute_get("coap://"+my_base+"/f", 40) # note this one is a bit dirty hard coded... execute_get("coap://"+my_base+"/f/417", 40) execute_get("coap://"+my_base+"/.well-known/core", 40) def do_sequence(my_base): #sn = get_sn(my_base) install(my_base) return do_sequence_dev(my_base) #return do_sequence_fp_g_int(my_base) #do_sequence_fp_g(my_base) do_sequence_fp_p_int(my_base) #do_sequence_fp_p(my_base) do_sequence_fp_r_int(my_base) #do_sequence_fp_r(my_base) do_sequence_lsm_int(my_base) #do_sequence_lsm(my_base) do_sequence_lsm_int(my_base) # .knx do_sequence_knx_knx_int(my_base) #do_sequence_knx_knx(my_base) do_sequence_knx_spake(my_base) do_sequence_knx_idevid(my_base) do_sequence_knx_ldevid(my_base) do_sequence_knx_crc(my_base) do_sequence_knx_osn(my_base) do_sequence_oscore(my_base) do_sequence_core_knx(my_base) do_sequence_a_sen(my_base) do_sequence_auth(my_base) do_sequence_auth_at(my_base) do_sequence_f(my_base) def client_callback_discovery(response, checkdata=None): print(" --- Discovery Callback ---") global my_base if response is not None: print ("response code:",response.code) print ("response type:",response.content_type) if response.code > 100: print("+++returned error+++") return if response.content_type == defines.Content_types["application/link-format"]: print (response.payload.decode()) my_base = get_base_from_link(response.payload.decode()) do_sequence(my_base) def code2string(code): if code == 68: return "(Changed)" if code == 69: return "(Content)" if code == 132: return "(Not Found)" if code == 133: return "(METHOD_NOT_ALLOWED)" if code == 160: return "(INTERNAL_SERVER_ERROR)" return "" def client_callback(response, checkdata=None): print(" --- Callback ---") if response is not None: print ("response code:",response.code, code2string(response.code)) print ("response type:",response.content_type) if response.code > 100: print("+++returned error+++") return #print(response.pretty_print()) if response.content_type == defines.Content_types["text/plain"]: if response.payload is not None: print (type(response.payload), len(response.payload)) print ("=========") print (response.payload) print ("=========") else: print ("payload: none") elif response.content_type == defines.Content_types["application/cbor"]: print (type(response.payload), len(response.payload)) print ("=========") print (response.payload) print ("=========") #json_data = loads(response.payload) #print(json_data) #print ("=========") json_string = "" try: json_data = cbor.loads(response.payload) json_string = json.dumps(json_data, indent=2, sort_keys=True) except: print("error in cbor..") print (json_string) print ("===+++===") if checkdata is not None: check_data = cbor.loads(checkdata) check_string = json.dumps(check_data, indent=2, sort_keys=True) print(" check: ") print (check_string) if check_string == json_string: print(" =+++===> OK ") else: print(" =+++===> NOT OK ") print (json_string) elif response.content_type == defines.Content_types["application/vnd.ocf+cbor"]: print ("application/vnd.ocf+cbor") try: print (type(response.payload), len(response.payload)) print ("=========") print (response.payload) print ("=========") json_data = cbor.loads(response.payload) print (json_data) print ("---------") except: traceback.print_exc() json_string = json.dumps(json_data, indent=2, sort_keys=True) print (json_string) elif response.content_type == defines.Content_types["application/link-format"]: print (response.payload.decode()) else: if response.payload is not None: print ("type, len", type(response.payload), len(response.payload)) print (response.payload) #else: # print (" not handled: ", response) else: print (" Response : None") #check = True #while check: # chosen = eval(input("Stop observing? [y/N]: ")) # if chosen != "" and not (chosen == "n" or chosen == "N" or chosen == "y" or chosen == "Y"): # print("Unrecognized choose.") # continue def client_callback_observe(response): # pragma: no cover global client print("Callback_observe") check = True while check: chosen = eval(input("Stop observing? [y/N]: ")) if chosen != "" and not (chosen == "n" or chosen == "N" or chosen == "y" or chosen == "Y"): print("Unrecognized choose.") continue elif chosen == "y" or chosen == "Y": while True: rst = eval(input("Send RST message? [Y/n]: ")) if rst != "" and not (rst == "n" or rst == "N" or rst == "y" or rst == "Y"): print("Unrecognized choose.") continue elif rst == "" or rst == "y" or rst == "Y": client.cancel_observing(response, True) else: client.cancel_observing(response, False) check = False break else: break def execute_get(mypath, ct_value): print ("---------------------------") print ("execute_get: ", ct_value, mypath) print (type(mypath)) if (mypath is None or len(mypath) < 5): return if mypath.startswith("coap://") == False: print(" not executing: ", mypath); return; ct = {} ct['accept'] = ct_value host, port, path = parse_uri(mypath) try: tmp = socket.gethostbyname(host) host = tmp except socket.gaierror: pass nclient = HelperClient(server=(host, port)) response = nclient.get(path, None, None, **ct) client_callback(response) nclient.stop() return response def execute_del(mypath, ct_value): print ("---------------------------") print ("execute_del: ", ct_value, mypath) do_exit = False ct = {} ct['accept'] = ct_value ct['content_type'] = ct_value if mypath.startswith("coap://") == False: print(" not executing: ", mypath); return; host, port, path = parse_uri(mypath) try: tmp = socket.gethostbyname(host) host = tmp except socket.gaierror: pass nclient = HelperClient(server=(host, port)) nclientcheck = HelperClient(server=(host, port)) payload = 0 response = nclient.delete(path, None, None, **ct) client_callback(response) #nclient.stop() #sys.exit(2) print ("=======") def execute_put(mypath, ct_value, accept, content): print ("---------------------------") print ("execute_put: ", ct_value, mypath) do_exit = False ct = {} ct['accept'] = accept ct['content_type'] = ct_value if mypath.startswith("coap://") == False: print(" not executing: ", mypath); return host, port, path = parse_uri(mypath) try: tmp = socket.gethostbyname(host) host = tmp except socket.gaierror: pass nclient = HelperClient(server=(host, port)) nclientcheck = HelperClient(server=(host, port)) payload = 0 if accept == 60: payload = cbor.dumps(content) else: payload = content print ("payload: ", payload) response = nclient.put(path, payload, None, None , None, **ct) client_callback(response) nclient.stop() def execute_post(mypath, ct_value, accept, content): print ("---------------------------") print ("execute_post: ", ct_value, mypath) print (content) print (" ---------------------") do_exit = False ct = {} ct['accept'] = accept ct['content_type'] = ct_value if mypath.startswith("coap://") == False: print(" not executing: ", mypath); return host, port, path = parse_uri(mypath) try: tmp = socket.gethostbyname(host) host = tmp except socket.gaierror: pass nclient = HelperClient(server=(host, port)) #nclientcheck = HelperClient(server=(host, port)) payload = 0 if accept == 60: #print(" content :", content) payload = cbor.dumps(content) else: payload = content response = nclient.post(path, payload, None, None , None, **ct) client_callback(response) nclient.stop() def main(): # pragma: no cover global client op = None path = None payload = None content_type = None #ct = {'content_type': defines.Content_types["application/link-format"]} ct = {} ct['accept'] = 40 try: opts, args = getopt.getopt(sys.argv[1:], "ho:p:P:f:c:", ["help", "operation=", "path=", "payload=", "payload_file=","content-type"]) except getopt.GetoptError as err: # print help information and exit: print((str(err))) # will print something like "option -a not recognized" usage() sys.exit(2) for o, a in opts: if o in ("-o", "--operation"): op = a elif o in ("-p", "--path"): path = a elif o in ("-P", "--payload"): payload = a elif o in ("-c", "--content-type"): ct['accept'] = a print ("content type request : ", ct) elif o in ("-f", "--payload-file"): with open(a, 'r') as f: payload = f.read() elif o in ("-h", "--help"): usage() sys.exit() else: usage() sys.exit(2) if op is None: print("Operation must be specified") usage() sys.exit(2) if path is None: print("Path must be specified") usage() sys.exit(2) if not path.startswith("coap://"): print("Path must be conform to coap://host[:port]/path") usage() sys.exit(2) host, port, path = parse_uri(path) try: tmp = socket.gethostbyname(host) host = tmp except socket.gaierror: pass client = HelperClient(server=(host, port)) if op == "GET": if path is None: print("Path cannot be empty for a GET request") usage() sys.exit(2) response = client.get(path, None, None, **ct) print((response.pretty_print())) if response.content_type == defines.Content_types["application/json"]: json_data = json.loads(response.payload) json_string = json.dumps(json_data, indent=2, sort_keys=True) print ("JSON ::") print (json_string) if response.content_type == defines.Content_types["application/cbor"]: json_data = cbor.loads(response.payload) json_string = json.dumps(json_data, indent=2, sort_keys=True) print ("JSON ::") print (json_string) if response.content_type == defines.Content_types["application/link-format"]: #json_data = cbor.loads(response.payload) #json_string = json.dumps(json_data, indent=2, sort_keys=True) #print ("JSON ::") print (response.payload.decode()) print ("\n\n") if response.content_type == defines.Content_types["application/vnd.ocf+cbor"]: json_data = cbor.loads(response.payload) json_string = json.dumps(json_data, indent=2, sort_keys=True) print ("JSON ::") print (json_string) client.stop() elif op == "GETNONE": if path is None: print("Path cannot be empty for a GET-None request") usage() sys.exit(2) response = client.get_non(path, None, None, **ct) print((response.pretty_print())) if response.content_type == defines.Content_types["application/json"]: json_data = json.loads(response.payload) json_string = json.dumps(json_data, indent=2, sort_keys=True) print ("JSON ::") print (json_string) if response.content_type == defines.Content_types["application/cbor"]: json_data = cbor.loads(response.payload) json_string = json.dumps(json_data, indent=2, sort_keys=True) print ("JSON ::") print (json_string) if response.content_type == defines.Content_types["application/vnd.ocf+cbor"]: json_data = cbor.loads(response.payload) json_string = json.dumps(json_data, indent=2, sort_keys=True) print ("JSON ::") print (json_string) client.stop() elif op == "OBSERVE": if path is None: print("Path cannot be empty for a GET request") usage() sys.exit(2) client.observe(path, client_callback_observe) elif op == "DELETE": if path is None: print("Path cannot be empty for a DELETE request") usage() sys.exit(2) response = client.delete(path) print((response.pretty_print())) client.stop() elif op == "POST": if path is None: print("Path cannot be empty for a POST request") usage() sys.exit(2) if payload is None: print("Payload cannot be empty for a POST request") usage() sys.exit(2) print ( "payload for POST (ascii):", payload ) print (ct['accept'] ) if ct['accept'] == str(defines.Content_types["application/cbor"]): json_data = json.loads(payload) cbor_data = cbor.dumps(json_data) payload = bytes(cbor_data) if ct['accept'] == str(defines.Content_types["application/vnd.ocf+cbor"]): json_data = json.loads(payload) cbor_data = cbor.loads(json_data) payload = cbor_data response = client.post(path, payload, None, None, **ct) print((response.pretty_print())) if response.content_type == defines.Content_types["application/cbor"]: json_data = cbor.loads(response.payload) json_string = json.dumps(json_data, indent=2, sort_keys=True) print (json_string) if response.content_type == defines.Content_types["application/vnd.ocf+cbor"]: json_data = cbor.loads(response.payload) json_string = json.dumps(json_data, indent=2, sort_keys=True) print (json_string) client.stop() elif op == "PUT": if path is None: print("Path cannot be empty for a PUT request") usage() sys.exit(2) if payload is None: print("Payload cannot be empty for a PUT request") usage() sys.exit(2) response = client.put(path, payload) print((response.pretty_print())) client.stop() elif op == "DISCOVER": #response = client.discover( path, client_callback, None, **ct) response = client.discover( path, None, None, **ct) if response is not None: print(response.pretty_print()) if response.content_type == defines.Content_types["application/cbor"]: json_data = cbor.loads(response.payload) json_string = json.dumps(json_data, indent=2, sort_keys=True) print (json_string) if response.content_type == defines.Content_types["application/vnd.ocf+cbor"]: json_data = cbor.loads(response.payload) json_string = json.dumps(json_data, indent=2, sort_keys=True) print (json_string) if response.content_type == defines.Content_types["application/link-format"]: #json_data = cbor.loads(response.payload) #json_string = json.dumps(json_data, indent=2, sort_keys=True) print (response.payload.decode()) # do_get(response.payload.decode(), client) client_callback_discovery(response) counter = 2 try: while counter > 0: time.sleep(1) counter = counter - 1 #client.stop() except KeyboardInterrupt: print("Client Shutdown") #client.stop() #execute_list() client.stop() else: print("Operation not recognized") usage() sys.exit(2) if __name__ == '__main__': # pragma: no cover main()
StarcoderdataPython
153777
<reponame>nhtri2003gmail/ctf-write-ups #!/usr/bin/env python3 from pwn import * binary = context.binary = ELF('./outbackdoor') if args.REMOTE: p = remote('pwn-2021.duc.tf', 31921) else: p = process(binary.path) payload = b'' payload += 0x18 * b'A' payload += p64(binary.sym.outBackdoor+1) p.sendlineafter(b'song?\n', payload) p.interactive()
StarcoderdataPython
3371274
import struct import argparse def write_spdz(input_folder, data): f = open(input_folder + "/f0", 'w') for d in data[0]: sign = d < 0 output = struct.pack("?", sign) f.write(output) output = struct.pack("Q", abs(int(d))) f.write(output) f.close() f = open(input_folder + "/f1", 'w') for d in data[1]: sign = d < 0 output = struct.pack("?", sign) f.write(output) output = struct.pack("Q", abs(int(d))) f.write(output) f.close() def main(): parser = argparse.ArgumentParser(description="An MC2 input parser") parser.add_argument("input_folder", type=str) parser.add_argument("data_source", type=str) args = parser.parse_args() import importlib data = importlib.import_module(args.data_source).data write_spdz(args.input_folder, data) main()
StarcoderdataPython
135285
# File name: main.py # Copyright 2017 <NAME> # Licensed under the Apache License, Version 2.0 (the "License"); you may not use this file except in compliance with the # License. You may obtain a copy of the License at http://www.apache.org/licenses/LICENSE-2.0 from flask import Flask, current_app, request, jsonify import io import model import base64 import logging app = Flask(__name__) @app.route('/', methods=['POST']) def predict(): data = {} try: data = request.get_json()['data'] except Exception: return jsonify(status_code='400', msg='Bad Request'), 400 data = base64.b64decode(data) image = io.BytesIO(data) predictions = model.predict(image) current_app.logger.info('Predictions: %s', predictions) return jsonify(predictions=predictions) if __name__ == '__main__': app.run(host='0.0.0.0', port=8080, debug=True)
StarcoderdataPython
3358979
from flask import Flask, render_template app = Flask(__name__, template_folder='templates') @app.route("/") def index(): return render_template("index.html") # otro @app.route("/video") def video(): return render_template("video.html") # material @app.route("/material") def material(): return render_template("material.html") @app.route("/historia") def disclimer(): return render_template("historia.html")
StarcoderdataPython
3390342
<filename>t4.py<gh_stars>0 print("git session")
StarcoderdataPython
1644957
<gh_stars>0 # -*- coding: utf-8 -*- from __future__ import unicode_literals import modelcluster.fields import wagtail.wagtailcore.fields from django.db import migrations, models class Migration(migrations.Migration): dependencies = [ ('v1', '0004_auto_20160712_1531'), ('jobmanager', '0002_auto_20160809_1619'), ] operations = [ migrations.CreateModel( name='EmailApplicationLink', fields=[ ('id', models.AutoField(verbose_name='ID', serialize=False, auto_created=True, primary_key=True)), ('sort_order', models.IntegerField(null=True, editable=False, blank=True)), ('address', models.EmailField(max_length=254)), ('label', models.CharField(max_length=255)), ('description', models.TextField(null=True, blank=True)), ], options={ 'ordering': ['sort_order'], 'abstract': False, }, ), migrations.CreateModel( name='JobListingPage', fields=[ ('cfgovpage_ptr', models.OneToOneField(parent_link=True, auto_created=True, primary_key=True, serialize=False, to='v1.CFGOVPage')), ('description', wagtail.wagtailcore.fields.RichTextField(verbose_name=b'Description')), ('open_date', models.DateField(verbose_name=b'Open date')), ('close_date', models.DateField(verbose_name=b'Close date')), ('salary_min', models.DecimalField(verbose_name=b'Minimum salary', max_digits=11, decimal_places=2)), ('salary_max', models.DecimalField(verbose_name=b'Maximum salary', max_digits=11, decimal_places=2)), ], options={ 'abstract': False, }, bases=('v1.cfgovpage',), ), migrations.CreateModel( name='USAJobsApplicationLink', fields=[ ('id', models.AutoField(verbose_name='ID', serialize=False, auto_created=True, primary_key=True)), ('sort_order', models.IntegerField(null=True, editable=False, blank=True)), ('announcement_number', models.CharField(max_length=128)), ('url', models.URLField(max_length=255)), ('applicant_type', models.ForeignKey(related_name='usajobs_application_links', to='jobmanager.ApplicantType')), ('job_listing', modelcluster.fields.ParentalKey(related_name='usajobs_application_links', to='jobmanager.JobListingPage')), ], options={ 'ordering': ['sort_order'], 'abstract': False, }, ), migrations.AddField( model_name='emailapplicationlink', name='job_listing', field=modelcluster.fields.ParentalKey(related_name='email_application_links', to='jobmanager.JobListingPage'), ), ]
StarcoderdataPython
3204349
<gh_stars>1-10 from .builder import build_loss from .kld_loss import KLDLoss __all__ = [ 'build_loss', 'KLDLoss' ]
StarcoderdataPython
1783221
# Copyright 2021 Google LLC # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. """Tests for model_search.single_trainer.""" import os from absl import flags from absl.testing import absltest from model_search import constants from model_search import single_trainer from model_search.data import csv_data FLAGS = flags.FLAGS class SingleTrainerTest(absltest.TestCase): def test_try_models(self): # Test is source code is deployed in FLAGS.test_srcdir spec_path = os.path.join(FLAGS.test_srcdir, constants.DEFAULT_DNN) trainer = single_trainer.SingleTrainer( data=csv_data.Provider( label_index=0, logits_dimension=2, record_defaults=[0, 0, 0, 0], filename=os.path.join( FLAGS.test_srcdir, "model_search/model_search/data/testdata/" "csv_random_data.csv")), spec=spec_path) trainer.try_models( number_models=7, train_steps=10, eval_steps=10, root_dir=FLAGS.test_tmpdir, batch_size=2, experiment_name="test", experiment_owner="test") if __name__ == "__main__": absltest.main()
StarcoderdataPython
79933
<gh_stars>1-10 # Copyright 2019 DeepMind Technologies Ltd. All rights reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. """Tests for open_spiel.python.bots.bluechip_bridge_uncontested_bidding.""" from __future__ import absolute_import from __future__ import division from __future__ import print_function from absl.testing import absltest from open_spiel.python.bots import bluechip_bridge import pyspiel class BluechipBridgeWrapperTest(absltest.TestCase): def test_complete_deal_east(self): # Plays a complete deal, with the mock external bot playing East. # The deal is as follows: # # Vul: None # S AKJ8 # H 4 # D JT9532 # C 32 # S 3 S Q9 # H KQJ8762 H AT5 # D K4 D A87 # C KQ4 C AJT96 # S T76542 # H 93 # D Q6 # C 875 # # West North East South # Pass 1N Pass # 2D Pass 2H Pass # 3S Dbl 4C Pass # 4D Pass 4N Pass # 5D Pass 6H Pass # Pass Pass # # N E S W N E S # S7 S3 SK S9 # DJ D8 D6 DK # H2 H4 HT H9 # H5 H3 H6 C3 # C4 C2 CT C5 # C6 C7 CQ D2 # CK D3 CJ C8 # D4 D5 DA DQ # C9 S2 H7 S8 # HK SJ HA S4 # CA S5 H8 D9 # HQ DT D7 S6 # HJ SA SQ ST # # Declarer tricks: 12 game = pyspiel.load_game('bridge(use_double_dummy_result=false)') mock_client = absltest.mock.Mock( **{ 'read_line.side_effect': [ 'Connecting "WBridge5" as ANYPL using protocol version 18', 'EAST ready for teams', 'EAST ready to start', 'EAST ready for deal', 'EAST ready for cards', "EAST ready for NORTH's bid", 'EAST bids 1NT', "EAST ready for SOUTH's bid", "EAST ready for WEST's bid", "EAST ready for NORTH's bid", 'EAST bids 2H', "EAST ready for SOUTH's bid", "EAST ready for WEST's bid", "EAST ready for NORTH's bid", 'EAST bids 4C Alert.', "EAST ready for SOUTH's bid", "EAST ready for WEST's bid", "EAST ready for NORTH's bid", 'EAST bids 4NT', "EAST ready for SOUTH's bid", "EAST ready for WEST's bid", "EAST ready for NORTH's bid", 'EAST bids 6H', "EAST ready for SOUTH's bid", "EAST ready for WEST's bid", "EAST ready for NORTH's bid", "EAST ready for SOUTH's card to trick 1", 'EAST ready for dummy', 'WEST plays 3s', "EAST ready for NORTH's card to trick 1", 'EAST plays 9s', "EAST ready for NORTH's card to trick 2", 'EAST plays 8d', "EAST ready for SOUTH's card to trick 2", 'WEST plays kd', 'WEST plays 2h', "EAST ready for NORTH's card to trick 3", 'EAST plays th', "EAST ready for SOUTH's card to trick 3", 'EAST plays 5h', "EAST ready for SOUTH's card to trick 4", 'WEST plays 6h', "EAST ready for NORTH's card to trick 4", 'WEST plays 4c', "EAST ready for NORTH's card to trick 5", 'EAST plays tc', "EAST ready for SOUTH's card to trick 5", 'EAST plays 6c', "EAST ready for SOUTH's card to trick 6", 'WEST plays qc', "EAST ready for NORTH's card to trick 6", 'WEST plays kc', "EAST ready for NORTH's card to trick 7", 'EAST plays jc', "EAST ready for SOUTH's card to trick 7", 'WEST plays 4d', "EAST ready for NORTH's card to trick 8", 'EAST plays ad', "EAST ready for SOUTH's card to trick 8", 'EAST plays 9c', "EAST ready for SOUTH's card to trick 9", 'WEST plays 7h', "EAST ready for NORTH's card to trick 9", 'WEST plays kh', "EAST ready for NORTH's card to trick 10", 'EAST plays ah', "EAST ready for SOUTH's card to trick 10", 'EAST plays ac', "EAST ready for SOUTH's card to trick 11", 'WEST plays 8h', "EAST ready for NORTH's card to trick 11", 'WEST plays qh', "EAST ready for NORTH's card to trick 12", 'EAST plays 7d', "EAST ready for SOUTH's card to trick 12", 'WEST plays jh', "EAST ready for NORTH's card to trick 13", 'EAST plays qs', ] }) bot = bluechip_bridge.BlueChipBridgeBot(game, 1, mock_client) state = game.new_initial_state() history = [ 33, 25, 3, 44, 47, 28, 23, 46, 1, 43, 30, 26, 29, 48, 24, 42, 13, 21, 17, 8, 5, 34, 6, 7, 37, 49, 11, 38, 51, 32, 20, 9, 0, 14, 35, 22, 10, 50, 15, 45, 39, 16, 12, 18, 27, 31, 41, 40, 4, 36, 19, 2, 52, 59, 52, 61, 52, 62, 52, 68, 53, 70, 52, 71, 52, 74, 52, 76, 52, 82, 52, 52, 52, 23, 7, 47, 31, 37, 25, 17, 45, 2, 10, 34, 30, 14, 6, 18, 4, 8, 0, 32, 12, 16, 20, 40, 1, 44, 5, 36, 24, 9, 13, 49, 41, 28, 3, 22, 27, 46, 39, 50, 11, 48, 15, 26, 29, 42, 33, 21, 19, 38, 51, 43, 35 ] # Check the bot provides the expected actions for action in history: if state.current_player() == 1: bot_action = bot.step(state) self.assertEqual(action, bot_action) state.apply_action(action) # Check the session went as expected; send_line calls are us sending # data to the (mock) external bot. mock_client.assert_has_calls([ absltest.mock.call.start(), absltest.mock.call.read_line(), absltest.mock.call.send_line('EAST ("WBridge5") seated'), absltest.mock.call.read_line(), absltest.mock.call.send_line( 'Teams: N/S "north-south" E/W "east-west"'), absltest.mock.call.read_line(), absltest.mock.call.send_line('start of board'), absltest.mock.call.read_line(), absltest.mock.call.send_line( 'Board number 1. Dealer NORTH. Neither vulnerable.'), absltest.mock.call.read_line(), absltest.mock.call.send_line( "EAST's cards: C A J T 9 6. D A 8 7. H A T 5. S Q 9."), absltest.mock.call.read_line(), absltest.mock.call.send_line('NORTH PASSES'), absltest.mock.call.read_line(), absltest.mock.call.read_line(), absltest.mock.call.send_line('SOUTH PASSES'), absltest.mock.call.read_line(), absltest.mock.call.send_line('WEST bids 2D'), absltest.mock.call.read_line(), absltest.mock.call.send_line('NORTH PASSES'), absltest.mock.call.read_line(), absltest.mock.call.read_line(), absltest.mock.call.send_line('SOUTH PASSES'), absltest.mock.call.read_line(), absltest.mock.call.send_line('WEST bids 3S'), absltest.mock.call.read_line(), absltest.mock.call.send_line('NORTH DOUBLES'), absltest.mock.call.read_line(), absltest.mock.call.read_line(), absltest.mock.call.send_line('SOUTH PASSES'), absltest.mock.call.read_line(), absltest.mock.call.send_line('WEST bids 4D'), absltest.mock.call.read_line(), absltest.mock.call.send_line('NORTH PASSES'), absltest.mock.call.read_line(), absltest.mock.call.read_line(), absltest.mock.call.send_line('SOUTH PASSES'), absltest.mock.call.read_line(), absltest.mock.call.send_line('WEST bids 5D'), absltest.mock.call.read_line(), absltest.mock.call.send_line('NORTH PASSES'), absltest.mock.call.read_line(), absltest.mock.call.read_line(), absltest.mock.call.send_line('SOUTH PASSES'), absltest.mock.call.read_line(), absltest.mock.call.send_line('WEST PASSES'), absltest.mock.call.read_line(), absltest.mock.call.send_line('NORTH PASSES'), absltest.mock.call.read_line(), absltest.mock.call.send_line('SOUTH plays 7s'), absltest.mock.call.read_line(), absltest.mock.call.send_line( "Dummy's cards: C K Q 4. D K 4. H K Q J 8 7 6 2. S 3."), absltest.mock.call.read_line(), absltest.mock.call.read_line(), absltest.mock.call.send_line('NORTH plays ks'), absltest.mock.call.read_line(), absltest.mock.call.read_line(), absltest.mock.call.send_line('NORTH plays jd'), absltest.mock.call.read_line(), absltest.mock.call.read_line(), absltest.mock.call.send_line('SOUTH plays 6d'), absltest.mock.call.read_line(), absltest.mock.call.send_line('EAST to lead'), absltest.mock.call.read_line(), absltest.mock.call.read_line(), absltest.mock.call.send_line('NORTH plays 4h'), absltest.mock.call.read_line(), absltest.mock.call.read_line(), absltest.mock.call.send_line('SOUTH plays 9h'), absltest.mock.call.send_line('EAST to lead'), absltest.mock.call.read_line(), absltest.mock.call.read_line(), absltest.mock.call.send_line('SOUTH plays 3h'), absltest.mock.call.read_line(), absltest.mock.call.read_line(), absltest.mock.call.send_line('NORTH plays 3c'), absltest.mock.call.send_line('EAST to lead'), absltest.mock.call.read_line(), absltest.mock.call.read_line(), absltest.mock.call.send_line('NORTH plays 2c'), absltest.mock.call.read_line(), absltest.mock.call.read_line(), absltest.mock.call.send_line('SOUTH plays 5c'), absltest.mock.call.send_line('EAST to lead'), absltest.mock.call.read_line(), absltest.mock.call.read_line(), absltest.mock.call.send_line('SOUTH plays 7c'), absltest.mock.call.read_line(), absltest.mock.call.read_line(), absltest.mock.call.send_line('NORTH plays 2d'), absltest.mock.call.send_line('EAST to lead'), absltest.mock.call.read_line(), absltest.mock.call.read_line(), absltest.mock.call.send_line('NORTH plays 3d'), absltest.mock.call.read_line(), absltest.mock.call.read_line(), absltest.mock.call.send_line('SOUTH plays 8c'), absltest.mock.call.send_line('EAST to lead'), absltest.mock.call.read_line(), absltest.mock.call.read_line(), absltest.mock.call.send_line('NORTH plays 5d'), absltest.mock.call.read_line(), absltest.mock.call.read_line(), absltest.mock.call.send_line('SOUTH plays qd'), absltest.mock.call.send_line('EAST to lead'), absltest.mock.call.read_line(), absltest.mock.call.read_line(), absltest.mock.call.send_line('SOUTH plays 2s'), absltest.mock.call.read_line(), absltest.mock.call.read_line(), absltest.mock.call.send_line('NORTH plays 8s'), absltest.mock.call.send_line('EAST to lead'), absltest.mock.call.read_line(), absltest.mock.call.read_line(), absltest.mock.call.send_line('NORTH plays js'), absltest.mock.call.read_line(), absltest.mock.call.read_line(), absltest.mock.call.send_line('SOUTH plays 4s'), absltest.mock.call.send_line('EAST to lead'), absltest.mock.call.read_line(), absltest.mock.call.read_line(), absltest.mock.call.send_line('SOUTH plays 5s'), absltest.mock.call.read_line(), absltest.mock.call.read_line(), absltest.mock.call.send_line('NORTH plays 9d'), absltest.mock.call.send_line('EAST to lead'), absltest.mock.call.read_line(), absltest.mock.call.read_line(), absltest.mock.call.send_line('NORTH plays td'), absltest.mock.call.read_line(), absltest.mock.call.read_line(), absltest.mock.call.send_line('SOUTH plays 6s'), absltest.mock.call.send_line('EAST to lead'), absltest.mock.call.read_line(), absltest.mock.call.read_line(), absltest.mock.call.send_line('NORTH plays as'), absltest.mock.call.read_line(), ]) if __name__ == '__main__': absltest.main()
StarcoderdataPython
178231
( ( ( nu*(15*nu/2 - 5/2)*r(t)**3/c )*nHat*nHat*nHat*SigmaVec ) +( ( -5*delta*nu*r(t)**3/(2*c) )*nHat*nHat*nHat*S ) )
StarcoderdataPython
3227257
#!/usr/bin/env python3 # Copyright (C) 2021 The Android Open Source Project # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # This tool checks that every create (table|view) is prefixed by # drop (table|view). from __future__ import absolute_import from __future__ import division from __future__ import print_function import os import re import sys ROOT_DIR = os.path.dirname(os.path.dirname(os.path.abspath(__file__))) def check(path): with open(path) as f: lines = [l.strip() for l in f.readlines()] # Check that CREATE VIEW/TABLE has a matching DROP VIEW/TABLE before it. errors = 0 d_type, d_name = None, None for line in lines: m = re.match(r'^DROP (TABLE|VIEW) IF EXISTS (.*);$', line) if m is not None: d_type, d_name = m.group(1), m.group(2) continue m = re.match(r'^CREATE (?:VIRTUAL )?(TABLE|VIEW) (.*) (?:AS|USING).*', line) if m is None: continue type, name = m.group(1), m.group(2) if type != d_type or name != d_name: sys.stderr.write( ('Missing DROP %s before CREATE %s\n') % (d_type, d_type)) sys.stderr.write(('%s:\n"%s" vs %s %s\n') % (path, line, d_type, d_name)) errors += 1 d_type, d_name = None, None # Ban the use of LIKE in non-comment lines. for line in lines: if line.startswith('--'): continue if 'like' in line.casefold(): sys.stderr.write( 'LIKE is banned in trace processor metrics. Prefer GLOB instead.\n') sys.stderr.write('Offending file: %s\n' % path) errors += 1 return errors def main(): errors = 0 metrics_sources = os.path.join(ROOT_DIR, 'src', 'trace_processor', 'metrics', 'sql') for root, _, files in os.walk(metrics_sources, topdown=True): for f in files: path = os.path.join(root, f) if path.endswith('.sql'): errors += check(path) return 0 if errors == 0 else 1 if __name__ == '__main__': sys.exit(main())
StarcoderdataPython
1605951
<filename>itb-backup.py #!/usr/bin/env python3 # Into The Breach saves backuper/restorer # # MAYBE: do not save again the same save (calc files hashes) # TODO: remove external dependency (on pick) # TODO: add save name dialogue (save save's meta info like date) # TODO: config file/env vars support (where to save saves & etc) # TODO: do not override settings by default import argparse import datetime as dt import os import pathlib import shutil import sys # external dependency from pick import pick # TODO: pass cmd args homedir = os.environ['HOME'] game_save_dir = "Library/Application Support/IntoTheBreach" game_save_dir = os.path.join(homedir, game_save_dir) save_baks_dir = "Documents/GameSaves/IntoTheBreach" save_baks_dir = os.path.join(homedir, save_baks_dir) #/20181208_1 def copy_subdirs(srcdir, dstdir): src = os.listdir(srcdir) os.mkdir(dstdir) for f in src: src = os.path.join(srcdir, f) # dst = dstdir dst = os.path.join(dstdir, f) print("{} -> {}".format(src, dst)) if os.path.isfile(src): # print("copy {} {}".format(src, dst)) shutil.copy(src, dstdir) else: # print("copy -r {} {}".format(src, dst)) shutil.copytree(src, dst) def backup_cmd(args): dtime = dt.datetime.now() dtime_bak_subdir = dtime.strftime("%Y%m%d_%H%M") print("new backup:", dtime_bak_subdir) # return src = game_save_dir dst = os.path.join(save_baks_dir, dtime_bak_subdir) # print("{} -> {}".format(src, dst)) # TODO: check is dst dir exists copy_subdirs(src, dst) def _get_saves(): return sorted([ f for f in os.listdir(save_baks_dir) if os.path.isdir(os.path.join(save_baks_dir, f)) ], key=str.lower, reverse=True) def restore_cmd(args): saves = _get_saves() print("{}: {}".format(save_baks_dir, saves)) option, index = pick(["<< quit >>"] + saves, "available-saves") if index == 0: return restore_dir = os.path.join(save_baks_dir, option) print("restore save from dir:", restore_dir) orig_bak_dir = game_save_dir + ".bak" # print(f"shutil.rmtree({orig_bak_dir})", ) # print(f"shutil.move({game_save_dir}, {orig_bak_dir})") shutil.rmtree(orig_bak_dir, ignore_errors=True) shutil.move(game_save_dir, orig_bak_dir) try: # print(f"copy_subdirs({restore_dir}, {game_save_dir})") copy_subdirs(restore_dir, game_save_dir) except Exception as ex: print("failed to restore save dir") print(ex) print("try to restore removed original save") print(f"shutil.rmtree({game_save_dir})") print(f"shutil.move({orig_bak_dir}, {game_save_dir})") shutil.rmtree(game_save_dir, ignore_errors=True) shutil.move(orig_bak_dir, game_save_dir) def list_cmd(args): saves = _get_saves() print(f"Saves in {game_save_dir}:") for s in saves: print(s) def main(): parser = argparse.ArgumentParser() subparsers = parser.add_subparsers() parser_backup = subparsers.add_parser( "save", help="Save current ITB progress") parser_backup.set_defaults(func=backup_cmd) parser_restore = subparsers.add_parser( "load", help="Restore ITB save") parser_restore.set_defaults(func=restore_cmd) parser_list = subparsers.add_parser( "show", help="Show ITB saves") parser_list.set_defaults(func=list_cmd) args = parser.parse_args() args.func(args) main() # https://docs.python.org/3/library/datetime.html # https://docs.python.org/3/library/argparse.html
StarcoderdataPython
199074
"""Test the factory for classifiers""" import pytest from src.classification.classifier_factory import ClassifierFactory from src.classification.image import ( CrossAttentionNetworkClassifier, MultiTaskEfficientNetB2Classifier, VGG16Classifier, ) from src.classification.text import ( BertClassifier, DistilBertClassifier, NRCLexTextClassifier, ) def test_text_factory(): classifier = ClassifierFactory.get("text", "nrclex", {}) assert isinstance(classifier, NRCLexTextClassifier) classifier = ClassifierFactory.get("text", "bert", {"model_name": "123"}) assert isinstance(classifier, BertClassifier) assert classifier.model_name == "123" classifier = ClassifierFactory.get("text", "distilbert", {}) assert isinstance(classifier, DistilBertClassifier) with pytest.raises(ValueError): _ = ClassifierFactory.get("wrong", "bert", {}) with pytest.raises(ValueError): _ = ClassifierFactory.get("text", "wrong", {}) def test_image_factory(): classifier = ClassifierFactory.get("image", "vgg16", {}) assert isinstance(classifier, VGG16Classifier) classifier = ClassifierFactory.get( "image", "cross_attention", {"model_name": "123"} ) assert isinstance(classifier, CrossAttentionNetworkClassifier) assert classifier.parameters["model_name"] == "123" classifier = ClassifierFactory.get("image", "efficientnet", {}) assert isinstance(classifier, MultiTaskEfficientNetB2Classifier) with pytest.raises(ValueError): _ = ClassifierFactory.get("wrong", "efficientnet", {}) with pytest.raises(ValueError): _ = ClassifierFactory.get("image", "wrong", {})
StarcoderdataPython
3398356
<gh_stars>0 from .converter import FeatureConverter, MapFeatureConverter from .dataset import Dataset, MapDataset, map_dataset __all__ = [] __all__ += ['FeatureConverter', 'MapFeatureConverter'] __all__ += ['Dataset', 'MapDataset', 'map_dataset']
StarcoderdataPython
167977
""" Title | Project Author: <NAME> Contact: <<EMAIL>> Created: Updated: License: MIT License <https://github.com/cannlytics/cannlytics-ai/blob/main/LICENSE> """ # Initialize a Socrata client. # app_token = os.environ.get('APP_TOKEN', None) # client = Socrata('opendata.mass-cannabis-control.com', app_token) # # Get sales by product type. # products = client.get('xwf2-j7g9', limit=2000) # products_data = pd.DataFrame.from_records(products) # # Get licensees. # licensees = client.get("hmwt-yiqy", limit=2000) # licensees_data = pd.DataFrame.from_records(licensees) # # Get the monthly average price per ounce. # avg_price = client.get("rqtv-uenj", limit=2000) # avg_price_data = pd.DataFrame.from_records(avg_price) # # Get production stats (total employees, total plants, etc.) # production = client.get("j3q7-3usu", limit=2000, order='saledate DESC') # production_data = pd.DataFrame.from_records(production)
StarcoderdataPython
4829894
<filename>tools/nntool/quantization/multiplicative/quantizers/lstm_mult_ne16.py # Copyright (C) 2020 GreenWaves Technologies, SAS # This program is free software: you can redistribute it and/or modify # it under the terms of the GNU Affero General Public License as # published by the Free Software Foundation, either version 3 of the # License, or (at your option) any later version. # This program is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU Affero General Public License for more details. # You should have received a copy of the GNU Affero General Public License # along with this program. If not, see <https://www.gnu.org/licenses/>. import logging import math from copy import deepcopy import numpy as np from graph.types import LSTMParameters from quantization.multiplicative.quantizers.rnn_mult_ne16 import ( calculatate_weight_q, limit_input_precision, roundup) from quantization.multiplicative.scaling_qtypes import MultMulBiasScaleQType from quantization.new_qrec import QRec from quantization.qtype import QType from quantization.quantizer_options import * from quantization.unified_quantization_handler import (in_qs_constraint, option_constraint, options, out_qs_constraint, params_type) from utils.stats_funcs import calc_bits from .rnn_mult_ne16 import NE16RNNMultQuantizionHandler, calc_bias_offset, calc_weight_q LOG = logging.getLogger('nntool.' + __name__) def get_maxq_val(stats, scale): return np.ceil(np.maximum(np.abs(stats['min']), np.abs(stats['max'])) / scale) def get_max(stat): return np.maximum(np.abs(stat['min']), np.abs(stat['max'])) def get_max_or_one(stat): gate_max = np.maximum(np.abs(stat['min']), np.abs(stat['max'])) return np.where(gate_max == 0, 1.0, gate_max) @options( NE16_WEIGHT_BITS_OPTION, FORCE_EXTERNAL_SIZE_OPTION, NARROW_WEIGHTS_OPTION, USE_NE16_OPTION, NARROW_STATE_OPTION, MAX_PRECISION_LIMIT_OPTION ) class LSTMMultMultNE16Base(NE16RNNMultQuantizionHandler): @classmethod def _quantize_lstm(cls, params, in_qs, stats, input_bits, **kwargs): force_out_qs, out_dtype = cls.get_mult_opts(**kwargs) force_out_q = force_out_qs and force_out_qs[0] if force_out_qs and any(force_out_q is not None for force_out_q in force_out_qs): return None opts = kwargs.get('opts', {}) if input_bits == 16: in_out_dtype = np.uint16 else: in_out_dtype = np.uint8 if in_qs is None: return None in_qs = deepcopy(in_qs) G = kwargs['G'] in_q = in_qs[0] # if in_q.dtype != in_out_dtype: # cls.check_valid_ranges(params, stats, idx=0, dirs='in') # in_q = in_qs[0] = QType.from_min_max_sq( # min_val=stats['range_in'][0]['min'], # max_val=stats['range_in'][0]['max'], # dtype=in_out_dtype, # asymmetric=True) cls.check_valid_ranges(params, stats, idx=0, dirs='out') in_edges = G.indexed_in_edges(params.name) names = {val: idx for idx, val in enumerate( LSTMParameters.INPUT_NAMES)} o_q = in_qs[names['i_state']] = QType.from_min_max_sq( min_val=stats['range_out'][0]['min'], max_val=stats['range_out'][0]['max'], dtype=in_out_dtype, narrow_range=opts['narrow_state']) cell_range = stats.get('range_cell') if cell_range is None: raise ValueError( f'cell range not present in stats for {params.name}') # cell range in minimum 1.0 cell_stat = max(1.0, *[abs(cell_range[var]) for var in ['min', 'max']]) if params.cell_clip and not params.quant_c_state_with_stat: cell_max = params.cell_clip ratio_c = cell_max / cell_stat if not (ratio_c > 0.9 and ratio_c < 1.1): msg = (f"C state is forced to a range [-{cell_max}:{cell_max}] different to the one calulated " f"from the inference statistic [-{cell_stat}:{cell_stat}], consider using nodeoption {params.name} " "QUANT_C_STATE_WITH_STAT 1 to force it to be the one calculated") LOG.warning('%s', msg) else: cell_max = cell_stat # this limit is driven by the c_in * f + c * i calculation # c * i will be in Q24 and we want c_in * f to be scaled to the same # abs(f) will be <=1 so the cell int bits cannot exceed 31 - 1 (overflow) - 24 = 6 cell_limit = pow(2, 6) if cell_max > cell_limit: LOG.warning( 'Cell state exceeds %s and will be clipped', cell_limit) cell_max = cell_limit cell_int_bits = calc_bits(cell_max) # cell stays signed since it is used in a haddamard with the int32 streamout # in NE16 in_qs[names['c_state']] = QType.from_min_max_sq( -cell_max, cell_max, dtype=np.int16 if input_bits == 16 else np.int8) LOG.debug("cell bits %d max %d cell range %d", cell_int_bits, cell_max, in_qs[names['c_state']].range) # set weight qtypes int_num_inp = roundup(params.n_inputs, input_bits == 16) int_num_states = roundup(params.n_states, input_bits == 16) for gate in ['i', 'o', 'c', 'f']: i_idx = names[f'i_2_{gate}_w'] r_idx = names[f'r_2_{gate}_w'] in_qs[i_idx] = calc_weight_q( in_edges[i_idx].from_node, (params.n_states, params.n_inputs), (params.n_states, int_num_inp), opts['weight_bits'], opts.get('narrow_weights')) in_qs[r_idx] = calc_weight_q( in_edges[r_idx].from_node, (params.n_states, params.n_states), (params.n_states, int_num_states), opts['weight_bits'], opts.get('narrow_weights')) in_q = limit_input_precision( params, input_bits, in_q, int_num_inp, opts['narrow_weights'], opts['weight_bits'], opts.get('max_precision_limit', MAX_PRECISION_LIMIT_OPTION['default']), w_qs=[in_qs[names[f'i_2_{gate}_w']] for gate in ['i', 'o', 'c', 'f']], out_ranges=[stats.get(f'range_{gate}_gate_i') for gate in ['i', 'o', 'c', 'f']]) o_q = limit_input_precision( params, input_bits, o_q, int_num_states, opts['narrow_weights'], opts['weight_bits'], opts.get('max_precision_limit', MAX_PRECISION_LIMIT_OPTION['default']), extra_correction=-1 if opts.get('narrow_state') else 0, w_qs=[in_qs[names[f'r_2_{gate}_w']] for gate in ['i', 'o', 'c', 'f']], out_ranges=[stats.get(f'range_{gate}_gate_r') for gate in ['i', 'o', 'c', 'f']]) # setup zero offset bias adjustment woffs = {} for gate in ['i', 'o', 'c', 'f']: i_idx = names[f'i_2_{gate}_w'] r_idx = names[f'r_2_{gate}_w'] woffs[gate] = [ calc_bias_offset(in_edges[i_idx].from_node, in_qs[i_idx], in_q.zero_point), calc_bias_offset(in_edges[r_idx].from_node, in_qs[r_idx], o_q.zero_point), ] # get weight scales scale_pairs = {chan: ('i_2_%s_w' % chan, 'r_2_%s_w' % chan) for chan in ['i', 'o', 'c', 'f']} w_scales = [(in_qs[names[namei]].scale, in_qs[names[namer]].scale) for k, (namei, namer) in scale_pairs.items()] gate_sum_max = [ (get_max_or_one(stats[f'range_{gate}_gate_i']), get_max_or_one(stats[f'range_{gate}_gate_r'])) for gate in ['i', 'o', 'c', 'f'] ] gate_sum_max_bits = [ (np.ceil(np.log2(gsm_i / (in_qs[0].scale * i_w))), np.ceil(np.log2(gsm_r / (o_q.scale * r_w)))) for (gsm_i, gsm_r), (i_w, r_w) in zip(gate_sum_max, w_scales)] for gate, (max_i, max_r) in zip(['i', 'o', 'c', 'f'], gate_sum_max_bits): if np.max(max_i) > 30: LOG.warning( 'max bits in accumulation input %s gate %s - there may be errors', max_i, gate) if np.max(max_r) > 30: LOG.warning( 'max bits in accumulation state %s gate %s - there may be errors', max_i, gate) # LUT activations Q12 -> Q15 act_in_q = 12 act_out_q = 15 int_scale = math.pow(2, -act_in_q) out_tanh_sig_scale = math.pow(2, -act_out_q) scale_qtypes = {} r_pscales = {} i_pscales = {} scale_qtypes['r_pscales'] = r_pscales scale_qtypes['i_pscales'] = i_pscales for gate, w_scale, max_bits in zip(['i', 'o', 'c', 'f'], w_scales, gate_sum_max_bits): weight_scale_ratio = w_scale[0]/w_scale[1] # TODO - decide to scale weights equal i_pscales[gate] = w_scale[0] * in_q.scale r_pscales[gate] = w_scale[1] * o_q.scale if input_bits == 16: scale_qtypes[f"i_2_{gate}_q"] = qscale = MultMulBiasScaleQType( scale=i_pscales[gate] / int_scale ) else: scale_qtypes[f"i_2_{gate}_q"] = qscale = MultMulBiasScaleQType( scale=i_pscales[gate] / r_pscales[gate] ) if input_bits == 16: i_zp_b = woffs[gate][0] else: i_zp_b = woffs[gate][0] * qscale.qbiases.astype( np.int32) + (1 << (qscale.qnorms.astype(np.int32) - 1)) scale_qtypes[f"r_2_{gate}_q"] = qscale = MultMulBiasScaleQType( scale=r_pscales[gate] / int_scale ) if input_bits == 16: r_zp_b = woffs[gate][1] in_qs[names[f'{gate}_b']] = QType( dtype=np.int32, scale=r_pscales[gate], offset=r_zp_b, interleaved_values=[i_zp_b], quantized_dimension=0 ) else: r_zp_b = woffs[gate][1] * qscale.qbiases.astype( np.int32) + (1 << (qscale.qnorms.astype(np.int32) - 1)) in_qs[names[f'{gate}_b']] = QType( dtype=np.int32, scale=r_pscales[gate] / qscale.qbiases, offset=r_zp_b, interleaved_values=[i_zp_b], quantized_dimension=0 ) # NOTE - for 16 bit pre-normalize the scales to give us room but make sure it isn't negative if input_bits == 16: gate_prenorm = min(np.min([ np.min(scale_qtypes[f"{inp}_2_{gate}_q"].qnorms) for gate in ['i', 'o', 'c', 'f'] for inp in ['i', 'r'] ]), 8) for gate in ['i', 'o', 'c', 'f']: for inp in ['i', 'r']: scale_qtypes[f"{inp}_2_{gate}_q"].pre_normalization = gate_prenorm else: gate_prenorm = 0 r_pscales['state_out_scale'] = o_q.scale r_pscales['int_scale'] = int_scale # ct = c_in * f + c * i # c * i = Q15 * Q15 -> Q30 -> norm(18) -> Q12 # scale(c_in * f) = Qcell * Q15 (prenorm if 16bit) and scale -> Q12 # ((c_in * f) + (c * i)) in Q12 # scale -> cell_out # tan(ct) -> Q15 # o * tan(ct) -> Q30 # prenorm and scale # scale result of c_state_1 * f_gate -> Q15 cell_in_scale = (in_qs[names['c_state']].scale * out_tanh_sig_scale / out_tanh_sig_scale) # cell_out from Q15 -> Q7/Q15 scaled cell_out_scale = out_tanh_sig_scale / in_qs[names['c_state']].scale state_out_scale = out_tanh_sig_scale / o_q.scale r_pscales['act_out_scale'] = out_tanh_sig_scale r_pscales['c_before_scale'] = int_scale scale_qtypes['cell_in_q'] = MultMulBiasScaleQType(scale=cell_in_scale) # NOTE - for 16 bit pre-normalize the scales to give us room if input_bits == 16: scale_qtypes['cell_in_q'].pre_normalization = 8 scale_qtypes['cell_out_q'] = MultMulBiasScaleQType( scale=cell_out_scale) scale_qtypes['state_out_q'] = MultMulBiasScaleQType( scale=state_out_scale) scale_qtypes['i_qtype'] = QType(q=act_in_q, dtype=np.int32) if params.lstm_output_c_state: out_qs = [o_q, in_qs[names['c_state']]] else: out_qs = [o_q] return QRec.scaled( in_qs=in_qs, out_qs=out_qs, ne16=True, gate_prenorm=gate_prenorm, **scale_qtypes, ) @params_type(LSTMParameters) @in_qs_constraint({'dtype': np.uint8}) @out_qs_constraint({'dtype': np.uint8}) @option_constraint(force_external_size={8, None}, use_ne16=True) class LSTMMultMultNE16UInt8(LSTMMultMultNE16Base): @classmethod def _quantize(cls, params, in_qs, stats, **kwargs): return cls._quantize_lstm(params, in_qs, stats, 8, **kwargs) @params_type(LSTMParameters) @in_qs_constraint({'dtype': np.uint16}) @out_qs_constraint({'dtype': np.uint16}) @option_constraint(force_external_size=16, use_ne16=True) class LSTMMultMultNE16UInt16(LSTMMultMultNE16Base): @classmethod def _quantize(cls, params, in_qs, stats, **kwargs): return cls._quantize_lstm(params, in_qs, stats, 16, **kwargs)
StarcoderdataPython
102340
#!/usr/bin/env python # coding: utf-8 import argparse import tensorflow as tf import logging import os from nnrecsys.data.yoochoose.input import get_feature_columns, train_input_fn from nnrecsys.data.yoochoose import constants from nnrecsys.models.rnn import model_fn from nnrecsys.training.hooks import ValidationMetricHook from nnrecsys.utils import file_len logging.getLogger().setLevel(logging.INFO) dir_path = os.path.dirname(os.path.realpath(__file__)) def get_estimator(config): n_items = file_len(constants.VOCABULARY_FILE) return tf.estimator.Estimator( model_fn=model_fn, model_dir=os.path.join(dir_path, '../experiments', config['experiment']), params={ 'feature_columns': get_feature_columns(config), 'k': 20, 'n_items': n_items, **config }) def fit(config: dict, reporter=None) -> float: estimator = get_estimator(config) os.makedirs(estimator.eval_dir(), exist_ok=True) early_stopping = tf.contrib.estimator.stop_if_no_decrease_hook( estimator, metric_name='loss', max_steps_without_decrease=10_000_000 / config['batch_size'], min_steps=2_000_000 / config['batch_size']) eval_hooks = [ValidationMetricHook( estimator, lambda global_step, metrics: reporter(recall_at_k=metrics['recall_at_k'], neg_loss=-metrics['loss']))] if reporter else [] eval_result, export_result = tf.estimator.train_and_evaluate( estimator, train_spec=tf.estimator.TrainSpec(lambda: train_input_fn(constants.TRAIN_PATH, constants.VOCABULARY_FILE, config['batch_size']).repeat(), hooks=[early_stopping]), eval_spec=tf.estimator.EvalSpec(lambda: train_input_fn(constants.VAL_PATH, constants.VOCABULARY_FILE, config['batch_size']), hooks=eval_hooks)) return eval_result def evaluate(config): estimator = get_estimator(config) estimator.evaluate(lambda: train_input_fn(constants.TEST_PATH, constants.VOCABULARY_FILE, batch_size=config['batch_size'])) def parse_args(): parser = argparse.ArgumentParser(description='GRU4Rec args') parser.add_argument('--experiment', required=True, type=str) parser.add_argument('--evaluate', type=str) parser.add_argument('--batch_size', default=64, type=int) parser.add_argument('--rnn_layers', default=1, type=int) parser.add_argument('--rnn_units', default=100, type=int) parser.add_argument('--lr', default=0.01, type=float) parser.add_argument('--hidden_activation', default='relu', type=str) parser.add_argument('--dropout', default=1, type=float) return parser.parse_args() def main(): cli = parse_args() config = {'experiment': cli.experiment, 'batch_size': cli.batch_size, 'rnn_layers': cli.rnn_layers, 'rnn_units': cli.rnn_units, 'lr': cli.lr, 'hidden_activation': cli.hidden_activation, 'dropout': cli.dropout} if cli.evaluate: logging.info('Evaluating') evaluate(config) else: logging.info('Fitting') fit(config) if __name__ == '__main__': main()
StarcoderdataPython
1657521
# -*- coding: utf-8 -*- def get_unique_method_id(view_method, request): # todo: test me as UniqueMethodIdKeyBit return "%s|%s" % (view_method.__name__, request.path.replace('/', '|')) # return u'.'.join([ # view_instance.__module__, # view_instance.__class__.__name__, # view_method.__name__ # ]) def get_unique_method_id2(view_method, path): # todo: test me as UniqueMethodIdKeyBit return "%s|%s" % (view_method, path.replace('/', '|')) class KeyBitBase(object): def __init__(self, params=None): self.params = params def get_data(self, params, view_instance, view_method, request, args, kwargs): """ @rtype: dict """ raise NotImplementedError()
StarcoderdataPython
102455
from django import template from django.db.models import Model from django.http import Http404 from django.urls import reverse, resolve from formfactory import models register = template.Library() @register.tag() def render_form(parser, token): """{% render_form <form_slug> %}""" tokens = token.split_contents() if len(tokens) != 2: raise template.TemplateSyntaxError( "{% render_form <form_slug>/<object> %}" ) return RenderFormNode(variable=tokens[1]) class RenderFormNode(template.Node): def __init__(self, variable): self.variable = template.Variable(variable) def render(self, context): try: variable = self.variable.resolve(context) except template.VariableDoesNotExist: variable = self.variable.var default_msg = "No FormFactory Form matches the given query. %s" % self.variable # If the variable is a string type, attempt to find object based on # slug field, otherwise pass the object along directly. if not isinstance(variable, Model): try: form = models.Form.objects.get(slug=variable) except models.Form.DoesNotExist: raise Http404(default_msg) elif isinstance(variable, models.Form): form = variable else: raise Http404(default_msg) url = form.absolute_url view, args, kwargs = resolve(url) request = context["request"] # Store original request values. original_method = request.method original_path = request.path original_info = request.path_info # Assign new request values. request.method = "GET" request.path = url request.path_info = url # Call view to get result. kwargs["inclusion_tag"] = True result = view(request, *args, **kwargs) # Replace request values with originals. request.method = original_method request.path = original_path request.path_info = original_path # This does not expect anything other than a TemplateResponse here. result.render() html = result.rendered_content return html
StarcoderdataPython
3221351
import numpy as np import torch as th from torch import Tensor # Reference: https://github.com/aayushmnit/Deep_learning_explorations/blob/master/1_MLP_from_scratch/Building_neural_network_from_scratch.ipynb class Layer: """ A building block. Each layer is capable of performing two things: - Process input to get output: output = layer.forward(input) - Propagate gradients through itself: grad_input = layer.backward(input, grad_output) Some layers also have learnable parameters which they update during layer.backward. """ def __init__(self): """Here we can initialize layer parameters (if any) and auxiliary stuff.""" # A dummy layer does nothing pass def forward(self, input: Tensor) -> Tensor: """ Takes input data of shape [batch, input_units], returns output data [batch, output_units] """ # A dummy layer just returns whatever it gets as input. return input def backward(self, input: Tensor, grad_output: Tensor): """ Performs a backpropagation step through the layer, with respect to the given input. To compute loss gradients w.r.t input, we need to apply chain rule (backprop): d loss / d x = (d loss / d layer) * (d layer / d x) Luckily, we already receive d loss / d layer as input, so you only need to multiply it by d layer / d x. If our layer has parameters (e.g. dense layer), we also need to update them here using d loss / d layer """ # The gradient of a dummy layer is precisely grad_output, but we'll write it more explicitly num_units = input.shape[1] d_layer_d_input = th.eye(num_units) return th.dot(grad_output, d_layer_d_input) # chain rule
StarcoderdataPython
1723273
<filename>Chaos/logistic.py from manimlib.imports import * def logistic(r,x): return r*x*(1-x) r = 3.5 class logistic_map(MovingCameraScene): def func(self,t): return np.array([t,logistic(r,t),0]) def construct(self): s = Square(color=YELLOW) s.scale(0.5);s.move_to(np.array([0.5,0.5,0])) T = Title("Logistic Map");T.set_color(GREEN) self.play(Write(T)) self.wait(2) self.play(FadeOut(T)) x_axis = Line(np.array([-3,0.1,0]),np.array([3,0.1,0])) x_axis.set_color(GREEN);x_axis.set_stroke(None,3.1) self.play(self.camera_frame.set_width,s.get_width()*1.5,self.camera_frame.move_to,s) self.camera_frame.shift(0.015*UP) func=ParametricFunction(self.func, t_min=0,t_max=1, fill_opacity=0) func.set_color(RED) self.play(Write(x_axis)) self.play(Write(func)) X = []; Y = []; x0 = 0.1; for i in range(60): x = x0 y = logistic(r,x0) lin = Line(np.array([x,x,0]),np.array([x,y,0]),color=BLUE) lin1 = Line(np.array([x,y,0]),np.array([y,y,0]),color=BLUE) lin.set_stroke(None,1.8); lin1.set_stroke(None,1.8) D = Dot(radius=0.006,color=YELLOW) D.move_to(np.array([x,y,0])) self.play(Write(lin),run_time=0.2) self.play(Write(lin1),run_time=0.2) self.add(D) X.append(x);Y.append(y) x0 = y class bifurcation(MovingCameraScene): def construct(self): iterations=200000 r = np.linspace(2.5,4.0,200000) N = NumberPlane();self.add(N) s = Polygon(np.array([2.5,0,0]),np.array([4,0,0]),np.array([4,1,0]),np.array([2.5,1,0])) T = Title("Bifurcation Diagram");T.set_color(GREEN) self.play(Write(T)) self.wait(2) self.play(FadeOut(T)) self.play(self.camera_frame.set_width,s.get_width()*1.5,self.camera_frame.move_to,s) self.wait(); x = 0.00001; X=[];dot=[] for i in range(iterations): x = logistic(r[i],x) X.append(x) c = Dot(radius=0.00055,color=YELLOW) c.move_to(np.array([r[i],x,0])) dot.append(c) #for j in range(5000): # self.play(Write(dot[i]),run_time=0.005) q = VGroup(*[dot[i] for i in range(len(dot))]) self.add(q) self.wait(3)
StarcoderdataPython
1719001
#!/usr/bin/env python3 # <NAME> (bithack) # 111601008 # Question No. 2a # Here we are again. This time no bunny is floating in the middle of the ocean. # And no agent want to find the dirt. This time we will write a script to count the # number of the words in a file. import sys import os.path def main(argv): if len(argv) != 2: print("Usage: python3 counting_words.py filepath") sys.exit() else: try: word_count = 0 current_state = 0 filepath = sys.argv[1] if os.path.isfile(filepath): # if the filepath exists and is a file with open(filepath) as f: while True: ch = f.read(1) print(ch) if not ch: break if current_state==0: if ch != '\n' and ch != ' ' and ch !='\t': current_state=1 # print("incrementing") word_count+=1 else: if ch == '\n' or ch == ' ' or ch == '\t': current_state=0 print("Total Words: " , word_count) except: print("Something went wrong.") sys.exit() if __name__ == "__main__": main(sys.argv)
StarcoderdataPython
1772136
<filename>notebooks/data_generator.py<gh_stars>0 # Request Deps -----> import pandas as pd import requests import json import csv import time import datetime as dt import praw from psaw import PushshiftAPI # Request Deps -----> api = PushshiftAPI() def grabdata(iterations,outputs): runge = range(1,iterations) for i in runge: start_epoch = int(dt.datetime(2017, 1, 1).timestamp()) hello = list(api.search_submissions(after=start_epoch, # Dearest Eric: Uncomment this two to put in a "specific sub": # subreddit='secret', filter=['url', 'title', 'subreddit','selftext','score'], limit=outputs)) df = pd.DataFrame(hello) out = "Data/final_data" + str(i) print("Data Completed:") print(out) df.to_csv(out) print("output at:",out) grabdata(50,25000)
StarcoderdataPython
31294
from typing import Any, List, Mapping, Sequence import jsonschema from dataclasses import dataclass, field from sqlalchemy.orm import scoped_session from vardb.datamodel.jsonschemas.load_schema import load_schema from vardb.datamodel import annotation @dataclass class ConverterConfig: elements: Sequence[Mapping[str, Any]] @dataclass(init=False) class AnnotationImportConfig: name: str converter_config: ConverterConfig def __init__(self, name: str, converter_config: Mapping[str, Any]) -> None: self.name = name self.converter_config = ConverterConfig(**converter_config) @dataclass(init=False) class AnnotationConfig: deposit: Sequence[AnnotationImportConfig] view: List = field(default_factory=list) def __init__(self, deposit: Sequence[Mapping[str, Any]], view: List) -> None: self.view = view self.deposit = list() for sub_conf in deposit: self.deposit.append(AnnotationImportConfig(**sub_conf)) def deposit_annotationconfig( session: scoped_session, annotationconfig: Mapping[str, Any] ) -> annotation.AnnotationConfig: schema = load_schema("annotationconfig.json") jsonschema.validate(annotationconfig, schema) active_annotationconfig = ( session.query(annotation.AnnotationConfig) .order_by(annotation.AnnotationConfig.id.desc()) .limit(1) .one_or_none() ) # Check if annotation config is equal. Note that for deposit, we do not care about order or duplicity # Since the deposit is a list of dicts, we can not check set-equality (dicts are not hashable), # so we check that all items in incoming are in active, and vice versa. if ( active_annotationconfig and all(x in active_annotationconfig.deposit for x in annotationconfig["deposit"]) and all(x in annotationconfig["deposit"] for x in active_annotationconfig.deposit) and active_annotationconfig.view == annotationconfig["view"] ): raise RuntimeError("The annotation config matches the current active annotation config.") ac_obj = annotation.AnnotationConfig( deposit=annotationconfig["deposit"], view=annotationconfig["view"] ) session.add(ac_obj) session.flush() return ac_obj
StarcoderdataPython
3212865
<filename>ex25.py def break_words(stuff): """This function will break up words for us.""" words=stuff.split('') return words def sort_words(words): """Sorts the words.""" return sorted(words) def print_first_word(words): """Prints the first word after popping it off.""" word=words.pop(0) print(word) def print_last_word(words): """prints the last word after popping it off.""" word=ords.pop(-1) print(word) def sort_sentence(sentence): """Takes in a full sentence and returns the sorted words.""" words=break_words(sentence) return sort_words(words) def print_first_and_last(sentence): """Prints the first and last words of the sentence.""" words=break_words(sentence) print_first_word(words) print_last_word(words) def print_first_and_last_sorted(sentence): """Sorts the words then prints the first and last one.""" words=sort_sentence(sentence) print_first_word(words) print_last_word(words) import ex25 sentence="All good things come to those who wait." words=ex25.break_words(sentence) words sorted_words=ex25.sort_words(words) sorted_words es25.print_first_word(words) ex25.print_last_word(words) words ex25.print_first_word(sorted_words) ex25.print_last_word(sorted_words) sorted_words sorted_words=ex25.sort_sentence(sentence) sorted_words ex25.print_first_and_last(sentence) ex25.print_first_and_last_sorted(sentence)
StarcoderdataPython
3346249
<gh_stars>1-10 # -*- coding: utf-8 -*- from __future__ import unicode_literals from . import ElasticsearchTestCase class TestUnicode(ElasticsearchTestCase): def test_indices_analyze(self): self.client.indices.analyze(body='{"text": "привет"}')
StarcoderdataPython
56667
<gh_stars>0 import gin import librosa import numpy as np import tensorflow as tf import pretty_midi PHONEMES = ['sil', 'b','d','f','g','h','j','k','l','m','n','p','r','s','t','v','w','z','zh','ch','sh','th','dh','ng','y','ae','ei','e','ii','i','ai','a','ou','u','ao','uu','oi','au','eo','er','oo'] PHONEME2ID={} for i,p in enumerate(PHONEMES): PHONEME2ID[p] = i def load_midi(filename): midi_data = pretty_midi.PrettyMIDI(filename) if len(midi_data.instruments) > 1: raise AssertionError(f"More than 1 track detected in {filename}") return midi_data.instruments[0].notes def load_text(filename): text = open(filename).read() text = ' '.join(text.split()) graph = text.split(' ') if graph[-1] == '': graph = graph[:-1] return graph @gin.register def annotate_f0_and_phoneme(audio, sample_rate, midi_filename, phoneme_filename, frame_rate): """Parse Fundamental frequency (f0) annotations from midi_filename once per frame_rate, Also parse phoneme annotations from phoneme_filename once per frame_rate Args: audio: Numpy ndarray of single audio (16kHz) example. Shape [audio_length,]. sample_rate: Sample rate in Hz. midi_filename: path to MIDI file containing pitch annotations for audio. phoneme_filename: text file of syllables corresponding to notes in midi_filename frame_rate: Rate of f0 frames in Hz. Returns: f0_hz: Fundamental frequency in Hz. Shape [n_frames,]. phoneme_frames: Index of phonemes. Shape [n_frames,]. """ audio_len_sec = audio.shape[-1] / float(sample_rate) num_frames = int(audio_len_sec * frame_rate) f0_hz = np.zeros(num_frames, dtype=np.float32) phoneme_frames = np.zeros(num_frames, dtype=np.int64) midi_data = load_midi(midi_filename) phoneme_data = load_text(phoneme_filename) for i,m in enumerate(midi_data): start_frame = int(m.start * frame_rate) end_frame = int(m.send * frame_rate) f0_hz[start_frame:end_frame] = librosa.midi_to_hz(m.pitch) phonemes = phoneme_data[i].split("_") num_phonemes = len(phonemes) frames_per_phoneme = int((end_frame - start_frame) / num_phonemes) phoneme_frames[start_frame:end_frame] = PHONEME2ID[phonemes[-1]] #default to last phoneme to deal with rounding for p in range(num_phonemes): a = start_frame + (i * frames_per_phoneme) b = a + frames_per_phoneme phoneme_frames[a:b] = PHONEME2ID[phonemes[p]] return f0_hz, phoneme_frames
StarcoderdataPython
3352836
<filename>exampleread.py ############################################################################## ## This file is part of 'smurftestapps'. ## It is subject to the license terms in the LICENSE.txt file found in the ## top-level directory of this distribution and at: ## https://confluence.slac.stanford.edu/display/ppareg/LICENSE.html. ## No part of 'smurftestapps', including this file, ## may be copied, modified, propagated, or distributed except according to ## the terms contained in the LICENSE.txt file. ############################################################################## # example file read for data import numpy import matplotlib.pyplot as plt import sys if len(sys.argv) < 2: fn = '/data/smurf_stream/testout.txt' else: fn = sys.argv[1] dat = numpy.loadtxt(fn) print(dat.shape) tm = dat[:,0] for i in range(40,50): plt.figure() plt.plot(tm, dat[:,i], 'r-') plt.title('%i' % (i)) plt.show() plt.show()
StarcoderdataPython
1681725
""" Nomad Regions Endpoint Access """ from nomad.api import base class Regions(base.Endpoint): """Get information about the regions nomad knows about. This are generally very low level, and not really useful for clients. """ def list(self): """Returns the known region names :rtype: list """ return self._get_list()
StarcoderdataPython
3354686
import os import logging import log_wrapper import sys FILE_NAME = "./attributes.json" STRING_TO_FIND = '"x-id":' BASE = 140 OFFSET = 150 def renumber(argv): """ Read file and re-number all parameters/attributes. This should only be used during initial development. Once 'released' the x-id cannot change. Does not support commands being in the same file. """ logger = logging.getLogger('renumber') lst = [] count = OFFSET with open(FILE_NAME, 'r') as fin: logger.debug("Opened file " + FILE_NAME) for line in fin: default_append = True if STRING_TO_FIND in line: try: x_id, number = line.split() # Leave room for another (possibly incomplete) attribute list number = number.strip(',') if int(number) >= BASE: s = x_id + ' ' + str(count) + ',\n' lst.append(s) default_append = False count += 1 except: logger.debug(f"Couldn't parse: {line.strip()}") if default_append: lst.append(line) if len(lst) > 0: with open(FILE_NAME, 'w') as fout: fout.writelines(lst) logger.debug("Wrote file " + FILE_NAME) logger.info(f'{count - OFFSET} total attributes') if __name__ == "__main__": log_wrapper.setup(__file__, console_level=logging.DEBUG, file_mode='a') renumber(sys.argv)
StarcoderdataPython
62390
from Statistics.ZScore import zscore from Statistics.Mean import mean from Statistics.StandardDeviation import standard_deviation from Calculator.Subtraction import subtraction from Calculator.Division import division from Calculator.Multiplication import multiplication from Calculator.Addition import addition def population_correlation_coefficient(numbers, numbers1): m = zscore(numbers) n = zscore(numbers1) value = list(map(lambda a, b: a * b, m, n)) p = division(len(value), sum(value)) return p """ x = mean(numbers) y = mean(numbers1) m = [] n = [] t = 0 for i in numbers: zn = division(standard_deviation(numbers), subtraction(x, i)) m.append(zn) for i in numbers1: zm = division(standard_deviation(numbers1), subtraction(y, i)) n.append(zm) for i in range(len(numbers)): jk = multiplication(m[i], n[i]) t = addition(t, jk) res = division(subtraction(1, len(numbers), t)) return res """
StarcoderdataPython
192821
<reponame>ecoo-app/ecoo-backend # Generated by Django 3.1 on 2020-09-10 21:18 import django.core.validators from django.db import migrations, models class Migration(migrations.Migration): dependencies = [ ("profiles", "0005_userprofile_place_of_origin"), ] operations = [ migrations.AddField( model_name="companyprofile", name="phone_number", field=models.CharField( blank=True, max_length=128, validators=[ django.core.validators.RegexValidator( "/(\\b(0041|0)|\\B\\+41)(\\s?\\(0\\))?(\\s)?[1-9]{2}(\\s)?[0-9]{3}(\\s)?[0-9]{2}(\\s)?[0-9]{2}\\b/", "No valid swiss phone number", ) ], ), ), ]
StarcoderdataPython
3313808
class Module: name = "" info = "" options = dict() def run(): pass
StarcoderdataPython
3354732
<filename>vyperlogix/gds/man2c.py ''' Converts a text file into a C function called manpage that prints the indicated text to a stream. Copyright (C) 2002 GDS Software This program is free software; you can redistribute it and/or modify it under the terms of the GNU General Public License as published by the Free Software Foundation; either version 2 of the License, or (at your option) any later version. This program is distributed in the hope that it will be useful, but WITHOUT ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License for more details. You should have received a copy of the GNU General Public License along with this program; if not, write to the Free Software Foundation, Inc., 59 Temple Place, Suite 330, Boston, MA 02111-1307 USA See http://www.gnu.org/licenses/licenses.html for more details. ''' import sys, string __version__ = "$Id: man2c.py,v 1.4 2002/08/21 17:37:39 donp Exp $" def GetLines(): ifp = open(sys.argv[1]) lines = ifp.readlines() ifp.close() TransformLines(lines) return lines def PrintHeader(): print '''/* Automatically generated by man2c.py */\n #include <stdio.h> void manpage(FILE *ofp) { fprintf(ofp, ''' def PrintLines(lines): for line in lines: print line def PrintTrailer(): print " );" print "\n}\n" def TransformLines(lines): '''Escape the characters so that they printf OK. This includes double quotes, backslashes, tabs, and % characters.''' for ix in xrange(len(lines)): line = string.rstrip(lines[ix]) line = string.replace(line, "\\", r"\\") line = string.replace(line, "\"", r"\"") line = string.replace(line, "%", "%%") line = string.replace(line, "\t", r"\t") line = "\"" + line + "\\n\"" lines[ix] = line def main(): if (len(sys.argv) != 2): sys.stderr.write("Usage: man2c file\n") sys.exit(1) lines = GetLines() PrintHeader() PrintLines(lines) PrintTrailer() main()
StarcoderdataPython
1740368
<gh_stars>0 import socket import select import time from threading import Thread, Timer from typing import Dict, List, Tuple import packet from packet import MAX_PACKET_SIZE, Packet, SEQ_LIM, FINISHER_DATA def grouper(iterable, n, fillvalue=None): "Collect data into fixed-length chunks or blocks" # grouper('ABCDEFG', 3, 'x') --> ABC DEF Gxx" # from itertools import zip_longest # args = [iter(iterable)] * n # return (''.join(chr(i) for i in d if i is not None).encode() # for d in zip_longest(*args, fillvalue=fillvalue)) for i in range((len(iterable) + n - 1) // n): start = i * n yield iterable[start:start + n] class SirSocket: """Represents a socket for the SIR protocol.""" BUFFER_SIZE = 8192 TIMEOUT = 0.5 def __init__(self, address, start_seq): self._sock = socket.socket(socket.AF_INET, socket.SOCK_DGRAM) self._sock.connect(address) self.send_buf: Dict[int, bytes] = {} self.recv_buf: Dict[int, bytes] = {} self.acked_pkts = set() self.timers = {} self.next_seq = start_seq print(self._sock.getpeername()) print(self._sock.getblocking()) def _start_timer(self, seq_num): timer = Timer(self.TIMEOUT, self._handle_timeout, (seq_num, )) timer.start() self.timers[seq_num] = timer def _handle_timeout(self, seq_num): print(f"Timed out for {seq_num=}") try: self._sock.send(self.send_buf[seq_num]) except KeyError: print(f"{seq_num=} not in send buffer during timeout.") except (ConnectionRefusedError, ConnectionAbortedError): print(f"Connection closed {seq_num=}.") self.send_buf.clear() else: self._start_timer(seq_num) def _recv(self): while True: print("reading...") try: pack = self._sock.recv(MAX_PACKET_SIZE, socket.MSG_DONTWAIT) self._handle_pkt(pack) print("read 1 pack") except BlockingIOError: print("Breaking...") break except (ConnectionRefusedError, ConnectionAbortedError, OSError): print("Connection closed.") self.send_buf.clear() def _send_ack(self, seq_num): print(f"Sending ack for {seq_num=}") self._sock.send(packet.Packet(seq_num, True, False, b"").into_buf()) def _handle_pkt(self, pkt): try: packet = Packet.from_buf(pkt) print(f"Received: seq_no = {packet.seq_no} data = {packet.data}") except AssertionError: print("Corrupted packet received") return if packet.ack: # packet is an ACK try: self.timers[packet.seq_no].cancel() del self.timers[packet.seq_no] except KeyError: print("Got result") if packet.data == FINISHER_DATA: for i in self.timers: i.cancel() return self.timers[(packet.seq_no - 1) % SEQ_LIM].cancel() del self.timers[(packet.seq_no - 1) % SEQ_LIM] self.recv_buf[packet.seq_no] = packet.data elif packet.nak: if packet.seq_no in self.timers: self.timers[packet.seq_no].cancel() self._sock.send(self.send_buf[packet.seq_no]) self._start_timer(packet.seq_no) elif len(self.recv_buf) < self.BUFFER_SIZE: self._send_ack(packet.seq_no) self.recv_buf[packet.seq_no] = packet.data print(f"Received new packet with {packet.seq_no=}.") else: print(f"Buffer Full: {packet.seq_no=}") def read(self) -> List[Tuple[int, bytes]]: """Read the data sent via datagram by the connected socket. Max size of data will be 65841 bytes. If no data is available, it returns an empty string. """ self._recv() items = self.recv_buf.items() self.recv_buf.clear() return sorted(items) def write(self, data): """Send the data (of type bytes) to the connected socket. The data should be less than 65481 bytes long. """ left_space = packet.DATA_SIZE * (self.BUFFER_SIZE - len(self.send_buf)) print("in write", data) if left_space < len(data): print("in write1") raise ValueError(("Too much data.", left_space)) for data in grouper(data, packet.DATA_SIZE): print("in write2") pkt = packet.Packet(self.next_seq, False, False, data).into_buf() print('Sending packet: ', pkt) self.send_buf[self.next_seq] = pkt self._sock.sendall(pkt) self._start_timer(self.next_seq) self.next_seq = (self.next_seq + 1) % (packet.SEQ_LIM)
StarcoderdataPython
1742798
import datetime import enum import attr import six from dbnd._core.utils.timezone import make_aware, utcnow RESULT_PARAM = "result" CURRENT_DATETIME = utcnow() CURRENT_TIME_STR = CURRENT_DATETIME.strftime("%Y%m%d_%H%M%S") CURRENT_DATE = CURRENT_DATETIME.date() class EnvLabel(object): # env label dev = "dev" test = "test" staging = "stage" qa = "qa" prod = "prod" class CloudType(object): local = "local" gcp = "gcp" aws = "aws" azure = "azure" class TaskExecutorType(object): local = "local" class OutputMode(object): regular = "regular" prod_immutable = "prod_immutable" class _ConfigParamContainer(object): _type_config = True @classmethod def is_type_config(self, cls): # we can't use issubclass as there are "generic" types that will fail this check return getattr(cls, "_type_config", False) class _TaskParamContainer(object): pass class DescribeFormat(object): short = "short" long = "long" verbose = "verbose" # Compute Types class EnumWithAll(enum.Enum): @classmethod def all(cls): return list(cls) @classmethod def all_values(cls): return [x.value for x in cls] @classmethod def all_names(cls): return [x.name for x in cls] class SparkClusters(EnumWithAll): local = "local" dataproc = "dataproc" databricks = "databricks" emr = "emr" qubole = "qubole" class ApacheBeamClusterType(object): local = "local" dataflow = "dataflow" class ClusterPolicy(object): NONE = "none" CREATE = "create" KILL = "kill" EPHERMAL = "ephermal" ALL = [NONE, CREATE, KILL, EPHERMAL] class EmrClient(object): LIVY = "livy" STEP = "step" class TaskType(object): pipeline = "pipeline" python = "python" spark = "spark" pyspark = "pyspark" dataflow = "dataflow" docker = "docker" class TaskRunState(EnumWithAll): SCHEDULED = "scheduled" QUEUED = "queued" RUNNING = "running" SUCCESS = "success" FAILED = "failed" CANCELLED = "cancelled" SHUTDOWN = "shutdown" UPSTREAM_FAILED = "upstream_failed" SKIPPED = "skipped" UP_FOR_RETRY = "up_for_retry" @staticmethod def final_states(): return TaskRunState.finished_states() | { TaskRunState.UPSTREAM_FAILED, TaskRunState.SKIPPED, } @staticmethod def final_states_str(): return [s.value for s in TaskRunState.final_states()] @staticmethod def finished_states(): return {TaskRunState.SUCCESS, TaskRunState.FAILED, TaskRunState.CANCELLED} @staticmethod def direct_fail_states(): return {TaskRunState.FAILED, TaskRunState.CANCELLED} @staticmethod def fail_states(): return { TaskRunState.FAILED, TaskRunState.CANCELLED, TaskRunState.UPSTREAM_FAILED, } @staticmethod def states_lower_case(): return [state.name.lower() for state in TaskRunState] REUSED = "reused" class RunState(EnumWithAll): RUNNING = "running" SUCCESS = "success" FAILED = "failed" SHUTDOWN = "shutdown" CANCELLED = "cancelled" @staticmethod def finished_states_str(): return [ TaskRunState.SUCCESS.value, TaskRunState.FAILED.value, TaskRunState.CANCELLED.value, ] class AlertStatus(EnumWithAll): TRIGGERED = "TRIGGERED" RESOLVED = "RESOLVED" ACKNOWLEDGED = "ACKNOWLEDGED" class AlertErrorPolicy(object): none = "" all = "all" task_only = "task_only" class SystemTaskName(object): driver_submit = "dbnd_driver_submit" driver = "dbnd_driver" task_submit = "dbnd_task_submit" driver_and_submitter = {driver_submit, driver} @attr.s class _DbndDataClass(object): def asdict(self, filter=None): return attr.asdict(self, recurse=False, filter=filter) HEARTBEAT_DISABLED = make_aware(datetime.datetime.fromtimestamp(0)) class ParamValidation(EnumWithAll): warn = "warn" error = "error" disabled = "disabled" class DbndTargetOperationType(EnumWithAll): init = "init" read = "read" write = "write" reuse = "reuse" log = "log" log_hist = "log_hist" delete = "delete" class DbndTargetOperationStatus(EnumWithAll): OK = "OK" NOK = "NOK" class SystemMetrics(EnumWithAll): Duration = "Duration" TotalCpuTime = "Total CPU Time" TotalWallTime = "Total Wall Time" ColdTotalCpuTime = "Cold Total CPU Time" ColdTotalWallTime = "Cold Total Wall Time" @staticmethod def duration_metrics(): """Used to select metrics for removal during metrics re-generation""" return [ s.value for s in [ SystemMetrics.Duration, SystemMetrics.TotalCpuTime, SystemMetrics.TotalWallTime, SystemMetrics.ColdTotalCpuTime, SystemMetrics.ColdTotalWallTime, ] ] class UpdateSource(EnumWithAll): dbnd = "dbnd" airflow_monitor = "airflow_monitor" airflow_tracking = "airflow_tracking" azkaban_tracking = "azkaban_tracking" def __eq__(self, other): if isinstance(other, UpdateSource): return self.value == other.value elif isinstance(other, six.string_types): return str(self) == other or str(self.value) == other return False @classmethod def is_tracking(cls, source): return source in [UpdateSource.airflow_tracking, UpdateSource.azkaban_tracking] class MetricSource(object): user = "user" system = "system" histograms = "histograms" spark = "spark" @classmethod def all(cls): return [cls.user, cls.system, cls.histograms, cls.spark] @classmethod def default_sources(cls): return [cls.user, cls.system, cls.histograms, cls.spark] @classmethod def default_sources_str(cls): return ",".join(cls.default_sources()) AD_HOC_DAG_PREFIX = "DBND_RUN." class AlertSeverity(object): CRITICAL = "CRITICAL" HIGH = "HIGH" MEDIUM = "MEDIUM" LOW = "LOW" @classmethod def values(cls): return [cls.CRITICAL, cls.HIGH, cls.MEDIUM, cls.LOW] TASK_ESSENCE_ATTR = "task_essence" class TaskEssence(enum.Enum): ORCHESTRATION = "orchestration" TRACKING = "tracking" CONFIG = "config" @classmethod def is_task_cls(self, cls): return ( hasattr(cls, TASK_ESSENCE_ATTR) and getattr(cls, TASK_ESSENCE_ATTR) != self.CONFIG ) def is_instance(self, obj): """ Checks if the object is include in the essence group. >>> TaskEssence.TRACKING.is_instance(obj) """ return ( hasattr(obj, TASK_ESSENCE_ATTR) and getattr(obj, TASK_ESSENCE_ATTR) == self )
StarcoderdataPython
1656937
PRIMITIVE_TYPES = (int, str, float, bool) SEQUENCE_TYPES = (tuple, set, list) MAPPING_TYPES = dict ComponentName = str TargetName = str
StarcoderdataPython
1773400
<reponame>mgorzkowski/abn #!/usr/bin/env python from ctypes import * # Type definitions # _abn_unit must be the same type like abn_unit in abn/include/abn.h file one _abn_unit = c_uint32 # main type of ABN library class _abn_t(Structure): _fields_ = [("chain", POINTER(_abn_unit)), ("volume", c_uint)] # pointers _abn_t_p = POINTER(_abn_t) _abn_unit_p = POINTER(_abn_unit) # ABN Wrapper class ABN: """This class wraps ABN library""" def __init__(self, file): # Library loading self.lib = CDLL(file) self.abn_unit = _abn_unit self.abn_unit_p = _abn_unit_p self.abn_t = _abn_t self.abn_t_p = _abn_t_p self.completion_code = c_int self.completion_code_dictionary = {'SUCCESS': 0, 'ERROR': 0x80, 'ERROR_ARGUMENT_INVALID': 0x81} self.size_of_abn_unit = sizeof(_abn_unit) # Basic operations type settings self.lib.abn_create.argtypes = [c_uint] self.lib.abn_create.restype = self.abn_t_p self.lib.abn_create_copy.argtypes = [self.abn_t_p] self.lib.abn_create_copy.restype = self.abn_t_p self.lib.abn_create_from_string.argtypes = [c_char_p] self.lib.abn_create_from_string.restype = self.abn_t_p self.lib.abn_create_empty.argtypes = None self.lib.abn_create_empty.restype = self.abn_t_p self.lib.abn_free.argtypes = [self.abn_t_p] self.lib.abn_free.restype = None self.lib.abn_reset.argtypes = [self.abn_t_p] self.lib.abn_reset.restype = None self.lib.abn_clone.argtypes = [self.abn_t_p, self.abn_t_p] self.lib.abn_clone.restype = None self.lib.abn_copy.argtypes = [self.abn_t_p, self.abn_t_p] self.lib.abn_copy.restype = None self.lib.abn_is_empty.argtypes = [self.abn_t_p] self.lib.abn_is_empty.restype = c_bool self.lib.abn_are_equal.argtypes = [self.abn_t_p, self.abn_t_p] self.lib.abn_are_equal.restype = c_bool self.lib.abn_get_byte.argtypes = [self.abn_t_p, c_uint] self.lib.abn_get_byte.restype = c_byte self.lib.abn_set_byte.argtypes = [self.abn_t_p, c_byte, c_uint] self.lib.abn_set_byte.restype = None self.lib.abn_is_negative.argtypes = [self.abn_t_p] self.lib.abn_is_negative.restype = c_bool self.lib.abn_is_positive.argtypes = [self.abn_t_p] self.lib.abn_is_positive.restype = c_bool self.lib.abn_is_zero.argtypes = [self.abn_t_p] self.lib.abn_is_zero.restype = c_bool self.lib.abn_is_greater.argtypes = [self.abn_t_p, self.abn_t_p] self.lib.abn_is_greater.restype = c_bool self.lib.abn_is_less.argtypes = [self.abn_t_p, self.abn_t_p] self.lib.abn_is_less.restype = c_bool self.lib.abn_to_string.argtypes = [self.abn_t_p] self.lib.abn_to_string.restype = c_char_p self.lib.abn_unit_to_string.argtypes = [self.abn_unit] self.lib.abn_unit_to_string.restype = c_char_p # Arithmetic operations type settings self.lib.abn_add.argtypes = [self.abn_t_p, self.abn_t_p] self.lib.abn_add.restype = None self.lib.abn_adu.argtypes = [self.abn_t_p, self.abn_unit] self.lib.abn_adu.restype = None self.lib.abn_sub.argtypes = [self.abn_t_p, self.abn_t_p] self.lib.abn_sub.restype = None self.lib.abn_subu.argtypes = [self.abn_t_p, self.abn_unit] self.lib.abn_subu.restype = None self.lib.abn_inc.argtypes = [self.abn_t_p] self.lib.abn_inc.restype = None self.lib.abn_dec.argtypes = [self.abn_t_p] self.lib.abn_dec.restype = None self.lib.abn_neg.argtypes = [self.abn_t_p] self.lib.abn_neg.restype = None self.lib.abn_mul.argtypes = [self.abn_t_p, self.abn_t_p, self.abn_t_p] self.lib.abn_mul.restype = None self.lib.abn_mulu.argtypes = [self.abn_t_p, self.abn_t_p, self.abn_unit] self.lib.abn_mulu.restype = None self.lib.abn_smul.argtypes = [self.abn_t_p, self.abn_t_p, self.abn_t_p] self.lib.abn_smul.restype = None self.lib.abn_abs.argtypes = [self.abn_t_p] self.lib.abn_abs.restype = c_bool # Bit operations type settings self.lib.abn_not.argtypes = [self.abn_t_p] self.lib.abn_not.restype = None self.lib.abn_and.argtypes = [self.abn_t_p, self.abn_t_p, self.abn_t_p] self.lib.abn_and.restype = None self.lib.abn_or.argtypes = [self.abn_t_p, self.abn_t_p, self.abn_t_p] self.lib.abn_or.restype = None self.lib.abn_xor.argtypes = [self.abn_t_p, self.abn_t_p, self.abn_t_p] self.lib.abn_xor.restype = None self.lib.abn_nand.argtypes = [self.abn_t_p, self.abn_t_p, self.abn_t_p] self.lib.abn_nand.restype = None self.lib.abn_nor.argtypes = [self.abn_t_p, self.abn_t_p, self.abn_t_p] self.lib.abn_nor.restype = None self.lib.abn_shift_left.argtypes = [self.abn_t_p, c_uint] self.lib.abn_shift_left.restype = None self.lib.abn_shift_right.argtypes = [self.abn_t_p, c_uint] self.lib.abn_shift_right.restype = None self.lib.abn_rotate_left.argtypes = [self.abn_t_p, c_uint] self.lib.abn_rotate_left.restype = None self.lib.abn_rotate_right.argtypes = [self.abn_t_p, c_uint] self.lib.abn_rotate_right.restype = None # Wrap functions of basic operations def create(self, *params): return self.lib.abn_create(*params) def create_copy(self, *params): return self.lib.abn_create_copy(*params) def create_from_string(self, *params): newParams = (params[0].encode('ascii'),) return self.lib.abn_create_from_string(*newParams) def create_empty(self, *params): return self.lib.abn_create_empty(*params) def free(self, *params): return self.lib.abn_free(*params) def reset(self, *params): return self.lib.abn_reset(*params) def clone(self, *params): return self.lib.abn_clone(*params) def copy(self, *params): return self.lib.abn_copy(*params) def is_empty(self, *params): return self.lib.abn_is_empty(*params) def are_equal(self, *params): return self.lib.abn_are_equal(*params) def get_byte(self, *params): return self.lib.abn_get_byte(*params) def set_byte(self, *params): return self.lib.abn_set_byte(*params) def to_string(self, *params): retval = "" for byte in self.lib.abn_to_string(*params): retval += chr(byte) return retval def unit_to_string(self, *params): retval = chr(self.lib.abn_unit_to_string(*params)) return retval def is_negative(self, *params): return self.lib.abn_is_negative(*params) def is_positive(self, *params): return self.lib.abn_is_positive(*params) def is_zero(self, *params): return self.lib.abn_is_zero(*params) def is_greater(self, *params): return self.lib.abn_is_greater(*params) def is_less(self, *params): return self.lib.abn_is_less(*params) # Wrap functions of arithmetic operations def add(self, *params): return self.lib.abn_add(*params) def adu(self, *params): return self.lib.abn_adu(*params) def sub(self, *params): return self.lib.abn_sub(*params) def subu(self, *params): return self.lib.abn_subu(*params) def inc(self, *params): return self.lib.abn_inc(*params) def dec(self, *params): return self.lib.abn_dec(*params) def neg(self, *params): return self.lib.abn_neg(*params) def mul(self, *params): return self.lib.abn_mul(*params) def mulu(self, *params): return self.lib.abn_mulu(*params) def smul(self, *params): return self.lib.abn_smul(*params) def abs(self, *params): return self.lib.abn_abs(*params) # Wrap functions of bit operations def bit_not(self, *params): return self.lib.abn_not(*params) def bit_and(self, *params): return self.lib.abn_and(*params) def bit_or(self, *params): return self.lib.abn_or(*params) def bit_xor(self, *params): return self.lib.abn_xor(*params) def bit_nand(self, *params): return self.lib.abn_nand(*params) def bit_nor(self, *params): return self.lib.abn_nor(*params) def shift_left(self, *params): return self.lib.abn_shift_left(*params) def shift_right(self, *params): return self.lib.abn_shift_right(*params) def rotate_left(self, *params): return self.lib.abn_rotate_left(*params) def rotate_right(self, *params): return self.lib.abn_rotate_right(*params)
StarcoderdataPython
76801
import os import sys import collections import typing import re from json import JSONDecoder from typing import List import pandas as pd import requests from d3m.primitive_interfaces.transformer import TransformerPrimitiveBase from d3m.primitive_interfaces.base import CallResult from d3m import container, utils from d3m.metadata import hyperparams, base as metadata_base from d3m.container import DataFrame as d3m_DataFrame from d3m.container import List as d3m_List from ..utils.geocoding import check_geocoding_server __author__ = "Distil" __version__ = "1.0.8" __contact__ = "mailto:<EMAIL>" Inputs = container.pandas.DataFrame Outputs = container.pandas.DataFrame # LRU Cache helper class class LRUCache: def __init__(self, capacity): self.capacity = capacity self.cache = collections.OrderedDict() def get(self, key): try: value = self.cache.pop(key) self.cache[key] = value return value except KeyError: return -1 def set(self, key, value): try: self.cache.pop(key) except KeyError: if len(self.cache) >= self.capacity: self.cache.popitem(last=False) self.cache[key] = value class Hyperparams(hyperparams.Hyperparams): rampup_timeout = hyperparams.UniformInt( lower=1, upper=sys.maxsize, default=100, semantic_types=[ "https://metadata.datadrivendiscovery.org/types/TuningParameter" ], description="timeout, how much time to give elastic search database to startup, \ may vary based on infrastructure", ) target_columns = hyperparams.Set( elements=hyperparams.Hyperparameter[int](-1), default=(), semantic_types=[ "https://metadata.datadrivendiscovery.org/types/ControlParameter" ], description="indices of column with geolocation formatted as text that should be converted \ to lat,lon pairs", ) cache_size = hyperparams.UniformInt( lower=1, upper=sys.maxsize, default=2000, semantic_types=[ "https://metadata.datadrivendiscovery.org/types/TuningParameter" ], description="LRU cache size", ) class GoatForwardPrimitive(TransformerPrimitiveBase[Inputs, Outputs, Hyperparams]): """ This primitive geocodes location names in specified columns into longitude/latitude coordinates. """ metadata = metadata_base.PrimitiveMetadata( { "id": "c7c61da3-cf57-354e-8841-664853370106", "version": __version__, "name": "Goat_forward", "keywords": ["Geocoder"], "source": { "name": __author__, "contact": __contact__, "uris": ["https://github.com/kungfuai/d3m-primitives"], }, "installation": [ {"type": "PIP", "package": "cython", "version": "0.29.16"}, { "type": metadata_base.PrimitiveInstallationType.PIP, "package_uri": "git+https://github.com/kungfuai/d3m-primitives.git@{git_commit}#egg=kf-d3m-primitives".format( git_commit=utils.current_git_commit(os.path.dirname(__file__)), ), }, { "type": "UBUNTU", "package": "default-jre-headless", "version": "2:1.8-56ubuntu2", }, { "type": "TGZ", "key": "photon-db-latest", "file_uri": "http://public.datadrivendiscovery.org/photon.tar.gz", "file_digest": "d7e3d5c6ae795b5f53d31faa3a9af63a9691070782fa962dfcd0edf13e8f1eab", }, ], "python_path": "d3m.primitives.data_cleaning.geocoding.Goat_forward", "algorithm_types": [metadata_base.PrimitiveAlgorithmType.NUMERICAL_METHOD], "primitive_family": metadata_base.PrimitiveFamily.DATA_CLEANING, } ) def __init__( self, *, hyperparams: Hyperparams, random_seed: int = 0, volumes: typing.Dict[str, str] = None, ) -> None: super().__init__( hyperparams=hyperparams, random_seed=random_seed, volumes=volumes, ) self._decoder = JSONDecoder() self.volumes = volumes self.goat_cache = LRUCache(self.hyperparams["cache_size"]) def _is_geocoded(self, geocode_result) -> bool: # check if geocoding was successful or not if ( geocode_result["features"] and len(geocode_result["features"]) > 0 ): # make sure (sub-)dictionaries are non-empty if geocode_result["features"][0]["geometry"]: if geocode_result["features"][0]["geometry"]["coordinates"]: return True return False def produce( self, *, inputs: Inputs, timeout: float = None, iterations: int = None ) -> CallResult[Outputs]: """ Accept a set of location strings, processes it and returns a set of long/lat coordinates. Parameters ---------- inputs: D3M dataframe containing strings representing some geographic locations - (name, address, etc) - one location per row in the specified target column Returns ---------- Outputs: D3M dataframe, with a pair of 2 float columns -- [longitude, latitude] -- per original row/location column """ # confirm that server is responding before proceeding address = "http://localhost:2322/" PopenObj = check_geocoding_server( address, self.volumes, self.hyperparams["rampup_timeout"] ) # target columns are columns with location tag target_column_idxs = self.hyperparams["target_columns"] target_columns = [list(inputs)[idx] for idx in target_column_idxs] target_columns_long_lat = [ target_columns[i // 2] for i in range(len(target_columns) * 2) ] outputs = inputs.remove_columns(target_column_idxs) # geocode each requested location output_data = [] for i, ith_column in enumerate(target_columns): j = 0 target_columns_long_lat[2 * i] = ( target_columns_long_lat[2 * i] + "_longitude" ) target_columns_long_lat[2 * i + 1] = ( target_columns_long_lat[2 * i + 1] + "_latitude" ) # remove ampersand from strings inputs_cleaned = inputs[ith_column].apply( lambda val: re.sub(r"\s*&\s*", r" and ", val) ) for location in inputs_cleaned: cache_ret = self.goat_cache.get(location) row_data = [] if cache_ret == -1: r = requests.get(address + "api?q=" + location) tmp = self._decoder.decode(r.text) if self._is_geocoded(tmp): row_data = tmp["features"][0]["geometry"]["coordinates"] self.goat_cache.set(location, str(row_data)) else: self.goat_cache.set(location, "[float('nan'), float('nan')]") else: # cache_ret is [longitude, latitude] row_data = [eval(cache_ret)[0], eval(cache_ret)[1]] if len(output_data) <= j: output_data.append(row_data) else: output_data[j] = output_data[j] + row_data j = j + 1 # need to cleanup by closing the server when done... PopenObj.kill() # Build d3m-type dataframe out_df = pd.DataFrame( output_data, index=range(inputs.shape[0]), columns=target_columns_long_lat ) d3m_df = d3m_DataFrame(out_df) for i, ith_column in enumerate(target_columns_long_lat): # for every column col_dict = dict(d3m_df.metadata.query((metadata_base.ALL_ELEMENTS, i))) col_dict["structural_type"] = type(0.0) col_dict["semantic_types"] = ( "http://schema.org/Float", "https://metadata.datadrivendiscovery.org/types/Attribute", ) col_dict["name"] = target_columns_long_lat[i] d3m_df.metadata = d3m_df.metadata.update( (metadata_base.ALL_ELEMENTS, i), col_dict ) df_dict = dict(d3m_df.metadata.query((metadata_base.ALL_ELEMENTS,))) df_dict_1 = dict(d3m_df.metadata.query((metadata_base.ALL_ELEMENTS,))) df_dict["dimension"] = df_dict_1 df_dict_1["name"] = "columns" df_dict_1["semantic_types"] = ( "https://metadata.datadrivendiscovery.org/types/TabularColumn", ) df_dict_1["length"] = d3m_df.shape[1] d3m_df.metadata = d3m_df.metadata.update((metadata_base.ALL_ELEMENTS,), df_dict) return CallResult(outputs.append_columns(d3m_df))
StarcoderdataPython
3850
<filename>main.py import tensorflow as tf import os.path import warnings from distutils.version import LooseVersion import glob import helper import project_tests as tests #-------------------------- # USER-SPECIFIED DATA #-------------------------- # Tune these parameters NUMBER_OF_CLASSES = 2 IMAGE_SHAPE = (160, 576) EPOCHS = 20 BATCH_SIZE = 1 LEARNING_RATE = 0.0001 DROPOUT = 0.75 # Specify these directory paths DATA_DIRECTORY = './data' RUNS_DIRECTORY = './runs' TRAINING_DATA_DIRECTORY ='./data/data_road/training' NUMBER_OF_IMAGES = len(glob.glob('./data/data_road/training/calib/*.*')) VGG_PATH = './data/vgg' all_training_losses = [] # Used for plotting to visualize if our training is going well given parameters #-------------------------- # DEPENDENCY CHECK #-------------------------- # Check TensorFlow Version assert LooseVersion(tf.__version__) >= LooseVersion('1.0'), 'Please use TensorFlow version 1.0 or newer. You are using {}'.format(tf.__version__) print('TensorFlow Version: {}'.format(tf.__version__)) # Check for a GPU if not tf.test.gpu_device_name(): warnings.warn('No GPU found. Please use a GPU to train your neural network.') else: print('Default GPU Device: {}'.format(tf.test.gpu_device_name())) #-------------------------- # PLACEHOLDER TENSORS #-------------------------- correct_label = tf.placeholder(tf.float32, [None, IMAGE_SHAPE[0], IMAGE_SHAPE[1], NUMBER_OF_CLASSES]) learning_rate = tf.placeholder(tf.float32) keep_prob = tf.placeholder(tf.float32) #-------------------------- # FUNCTIONS #-------------------------- def load_vgg(sess, vgg_path): """ Load Pretrained VGG Model into TensorFlow. sess: TensorFlow Session vgg_path: Path to vgg folder, containing "variables/" and "saved_model.pb" return: Tuple of Tensors from VGG model (image_input, keep_prob, layer3, layer4, layer7) """ # load the model and weights model = tf.saved_model.loader.load(sess, ['vgg16'], vgg_path) # Get Tensors to be returned from graph graph = tf.get_default_graph() image_input = graph.get_tensor_by_name('image_input:0') keep_prob = graph.get_tensor_by_name('keep_prob:0') layer3 = graph.get_tensor_by_name('layer3_out:0') layer4 = graph.get_tensor_by_name('layer4_out:0') layer7 = graph.get_tensor_by_name('layer7_out:0') return image_input, keep_prob, layer3, layer4, layer7 def conv_1x1(layer, layer_name): """ Return the output of a 1x1 convolution of a layer """ return tf.layers.conv2d(inputs = layer, filters = NUMBER_OF_CLASSES, kernel_size = (1, 1), strides = (1, 1), name = layer_name) def upsample(layer, k, s, layer_name): """ Return the output of transpose convolution given kernel_size k and strides s """ return tf.layers.conv2d_transpose(inputs = layer, filters = NUMBER_OF_CLASSES, kernel_size = (k, k), strides = (s, s), padding = 'same', name = layer_name) def layers(vgg_layer3_out, vgg_layer4_out, vgg_layer7_out, num_classes = NUMBER_OF_CLASSES): """ Create the layers for a fully convolutional network. Build skip-layers using the vgg layers. vgg_layerX_out: TF Tensor for VGG Layer X output num_classes: Number of classes to classify return: The Tensor for the last layer of output """ # Use a shorter variable name for simplicity layer3, layer4, layer7 = vgg_layer3_out, vgg_layer4_out, vgg_layer7_out # Apply a 1x1 convolution to encoder layers layer3x = conv_1x1(layer = layer3, layer_name = "layer3conv1x1") layer4x = conv_1x1(layer = layer4, layer_name = "layer4conv1x1") layer7x = conv_1x1(layer = layer7, layer_name = "layer7conv1x1") # Add decoder layers to the network with skip connections and upsampling # Note: the kernel size and strides are the same as the example in Udacity Lectures # Semantic Segmentation Scene Understanding Lesson 10-9: FCN-8 - Decoder decoderlayer1 = upsample(layer = layer7x, k = 4, s = 2, layer_name = "decoderlayer1") decoderlayer2 = tf.add(decoderlayer1, layer4x, name = "decoderlayer2") decoderlayer3 = upsample(layer = decoderlayer2, k = 4, s = 2, layer_name = "decoderlayer3") decoderlayer4 = tf.add(decoderlayer3, layer3x, name = "decoderlayer4") decoderlayer_output = upsample(layer = decoderlayer4, k = 16, s = 8, layer_name = "decoderlayer_output") return decoderlayer_output def optimize(nn_last_layer, correct_label, learning_rate, num_classes = NUMBER_OF_CLASSES): """ Build the TensorFLow loss and optimizer operations. nn_last_layer: TF Tensor of the last layer in the neural network correct_label: TF Placeholder for the correct label image learning_rate: TF Placeholder for the learning rate num_classes: Number of classes to classify return: Tuple of (logits, train_op, cross_entropy_loss) """ # Reshape 4D tensors to 2D, each row represents a pixel, each column a class logits = tf.reshape(nn_last_layer, (-1, num_classes)) class_labels = tf.reshape(correct_label, (-1, num_classes)) # The cross_entropy_loss is the cost which we are trying to minimize to yield higher accuracy cross_entropy = tf.nn.softmax_cross_entropy_with_logits(logits = logits, labels = class_labels) cross_entropy_loss = tf.reduce_mean(cross_entropy) # The model implements this operation to find the weights/parameters that would yield correct pixel labels train_op = tf.train.AdamOptimizer(learning_rate).minimize(cross_entropy_loss) return logits, train_op, cross_entropy_loss def train_nn(sess, epochs, batch_size, get_batches_fn, train_op, cross_entropy_loss, input_image, correct_label, keep_prob, learning_rate): """ Train neural network and print out the loss during training. sess: TF Session epochs: Number of epochs batch_size: Batch size get_batches_fn: Function to get batches of training data. Call using get_batches_fn(batch_size) train_op: TF Operation to train the neural network cross_entropy_loss: TF Tensor for the amount of loss input_image: TF Placeholder for input images correct_label: TF Placeholder for label images keep_prob: TF Placeholder for dropout keep probability learning_rate: TF Placeholder for learning rate """ for epoch in range(EPOCHS): losses, i = [], 0 for images, labels in get_batches_fn(BATCH_SIZE): i += 1 feed = { input_image: images, correct_label: labels, keep_prob: DROPOUT, learning_rate: LEARNING_RATE } _, partial_loss = sess.run([train_op, cross_entropy_loss], feed_dict = feed) print("---> iteration: ", i, " partial loss:", partial_loss) losses.append(partial_loss) training_loss = sum(losses) / len(losses) all_training_losses.append(training_loss) print("------------------") print("epoch: ", epoch + 1, " of ", EPOCHS, "training loss: ", training_loss) print("------------------") def run_tests(): tests.test_layers(layers) tests.test_optimize(optimize) tests.test_for_kitti_dataset(DATA_DIRECTORY) tests.test_train_nn(train_nn) def run(): """ Run a train a model and save output images resulting from the test image fed on the trained model """ # Get vgg model if we can't find it where it should be helper.maybe_download_pretrained_vgg(DATA_DIRECTORY) # A function to get batches get_batches_fn = helper.gen_batch_function(TRAINING_DATA_DIRECTORY, IMAGE_SHAPE) with tf.Session() as session: # Returns the three layers, keep probability and input layer from the vgg architecture image_input, keep_prob, layer3, layer4, layer7 = load_vgg(session, VGG_PATH) # The resulting network architecture from adding a decoder on top of the given vgg model model_output = layers(layer3, layer4, layer7, NUMBER_OF_CLASSES) # Returns the output logits, training operation and cost operation to be used # - logits: each row represents a pixel, each column a class # - train_op: function used to get the right parameters to the model to correctly label the pixels # - cross_entropy_loss: function outputting the cost which we are minimizing, lower cost should yield higher accuracy logits, train_op, cross_entropy_loss = optimize(model_output, correct_label, learning_rate, NUMBER_OF_CLASSES) # Initialize all variables session.run(tf.global_variables_initializer()) session.run(tf.local_variables_initializer()) # Train the neural network train_nn(session, EPOCHS, BATCH_SIZE, get_batches_fn, train_op, cross_entropy_loss, image_input, correct_label, keep_prob, learning_rate) # Run the model with the test images and save each painted output image (roads painted green) helper.save_inference_samples(RUNS_DIRECTORY, DATA_DIRECTORY, session, IMAGE_SHAPE, logits, keep_prob, image_input) #-------------------------- # MAIN #-------------------------- if __name__ == "__main__": run_tests() run() # Run a train a model and save output images resulting from the test image fed on the trained model print(all_training_losses)
StarcoderdataPython
58615
import pathlib import typing import urllib.parse _PLUGIN_DIR = pathlib.Path(__file__).parent PLUGIN_DIR = str(_PLUGIN_DIR) CONFIGS_DIR = str(_PLUGIN_DIR.joinpath('configs')) SCRIPTS_DIR = str(_PLUGIN_DIR.joinpath('scripts')) def scan_sql_directory(root: str) -> typing.List[pathlib.Path]: return [ path for path in sorted(pathlib.Path(root).iterdir()) if path.is_file() and path.suffix == '.sql' ] def connstr_replace_dbname(connstr: str, dbname: str) -> str: """Replace dbname in existing connection string.""" if connstr.endswith(' dbname='): return connstr + dbname if connstr.startswith('postgresql://'): url = urllib.parse.urlparse(connstr) url = url._replace(path=dbname) # pylint: disable=protected-access return url.geturl() raise RuntimeError( f'Unsupported PostgreSQL connection string format {connstr!r}', )
StarcoderdataPython
1742095
#!/usr/bin/env python # stdlib imports import os.path # third party libraries from configobj import ConfigObj from validate import Validator, VdtTypeError def __getCustomValidator(): ''' Return a Validator object with the custom types we have defined here. Returns: Validator object with custom types embedded. ''' fdict = { 'file_type': __file_type, 'path_type': __path_type, } validator = Validator(fdict) return validator def __file_type(value): ''' Describes a file_type from the ShakeMap config spec. A file_type object is simply a string that must be a valid file on the system. Args: value (str): Path to a file on the local system. Returns: str: Input string, if a valid file name. ''' if not os.path.isfile(value): raise VdtTypeError(value) return value def __path_type(value): ''' Describes a path_type from the groundfailure config spec. A path_type object is simply a string that must be a valid file OR directory on the system. Args: value (str): Path to a file or directory on the local system. Returns: str: Input string, if a valid file/directory name. ''' if not os.path.isfile(value) and not os.path.isdir(value): raise VdtTypeError(value) return value def __filterResults(result): # TODO: this function has a problem where some error messages are # duplicated...? errormsg = '' for key, value in result.items(): if isinstance(value, dict): tmpmsg = __filterResults(value) errormsg += tmpmsg else: if not isinstance(value, bool): errormsg += ("Parameter %s failed with error '%s'\n" % (key, value.args)) else: if not value: errormsg += ("Parameter %s was not specified correctly.\n" % (key)) return errormsg def correct_config_filepaths(input_path, config): """ Takes an input filepath name and pre-pends it to all file locations within the config file. Individual locations are put into the config. Don't have to put entire filepath location for each layer. Works by looping over config dictionary and subdictionary to fine locations named 'file'. Args: input_path (str): Path that needs to be appended to the front of all the file names/paths in config. config (ConfigObj): Object defining the model and its inputs. Returns: config dictionary with complete file paths. """ # Pull all other filepaths that need editing for keys in config.keys(): outer_loop = keys for keys in config[outer_loop].keys(): second_loop = keys if hasattr(config[outer_loop][second_loop], 'keys') is False: if second_loop == 'slopefile' or second_loop == 'file': path_to_correct = config[outer_loop][second_loop] config[outer_loop][second_loop] = \ os.path.join(input_path, path_to_correct) else: for keys in config[outer_loop][second_loop].keys(): third_loop = keys if hasattr(config[outer_loop][second_loop][third_loop], 'keys') is False: if third_loop == 'file' or third_loop == 'filepath': path_to_correct = \ config[outer_loop][second_loop][third_loop] config[outer_loop][second_loop][third_loop] = \ os.path.join(input_path, path_to_correct) else: for keys in config[outer_loop][second_loop][third_loop].keys(): fourth_loop = keys if hasattr(config[outer_loop][second_loop][third_loop][fourth_loop], 'keys') is False: if fourth_loop == 'file' or fourth_loop == 'filepath': path_to_correct = config[outer_loop][second_loop][third_loop][fourth_loop] config[outer_loop][second_loop][third_loop][fourth_loop] = os.path.join( input_path, path_to_correct) else: for keys in config[outer_loop][second_loop][third_loop][fourth_loop].keys(): fifth_loop = keys if fifth_loop == 'file' or fifth_loop == 'filepath': path_to_correct = config[outer_loop][second_loop][third_loop][fourth_loop][fifth_loop] config[outer_loop][second_loop][third_loop][fourth_loop][fifth_loop] = os.path.join( input_path, path_to_correct) return config def validate(configfile, inputfilepath=None): ''' Return a validated config object. Args: configfile (str): Config file to validate. inputfilepath (str): Path to input file. Returns: A validated ConfigObj object or a dictionary of which section/parameters failed validation. ''' thispath = os.path.dirname(os.path.abspath(__file__)) configspec = os.path.join(thispath, 'configspec.ini') config = ConfigObj(configfile, configspec=configspec) if inputfilepath is not None: config = correct_config_filepaths(config) validator = __getCustomValidator() result = config.validate(validator, preserve_errors=True) if result is True: return config else: errormsg = __filterResults(result) raise VdtTypeError(errormsg) return config
StarcoderdataPython
1765077
<reponame>optik/minicms import time from selenium import webdriver from django.conf import settings from django.test import LiveServerTestCase class FrontendTestCase(LiveServerTestCase): fixtures = ['fixtures/content.yaml',] def setUp(self): self.browser = webdriver.Firefox() def tearDown(self): self.browser.quit() super().tearDown() def test_pages_navigation(self): # user navigates to site homepage self.browser.get(self.live_server_url) # user sees the proper page title self.assertIn('MiniCMS Example Project', self.browser.title) # user sees the homepage contents main_content_element = self.browser.find_element_by_id('main_container') self.assertIn('This is the content of the homepage', main_content_element.text) # user clicks contact page link contact_link = self.browser.find_element_by_id('contact_link') contact_link.click() # user notices URL change new_url = self.browser.current_url self.assertEqual(new_url, '/content/contact/') # user sees the proper page title self.assertIn('MiniCMS Example Project | Contact', self.browser.title) # user sees the homepage contents main_content_element = self.browser.find_element_by_id('main_container') self.assertIn('This is a page with some contact information', main_content_element.text)
StarcoderdataPython
3328731
<filename>env.py<gh_stars>1-10 # Copyright 2018 Google Inc. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # https://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. """App environment setup.""" import logging import os from google.appengine.api import app_identity APP_NAME = app_identity.get_application_id() SERVER_SOFTWARE = os.environ.get('SERVER_SOFTWARE', '') DFP_API_VERSION = os.environ.get('DFP_API_VERSION', 'v201711') DFP_APP_NAME = os.environ.get('DFP_APP_NAME', 'x5') ASSET_SIZE_LIMIT = os.environ.get('ASSET_SIZE_LIMIT', 1000000) DEBUG = False logger = logging.getLogger('x5.env') # Replace with your project id if APP_NAME == 'replace-with-your-project-id': # Put the client id for your production server here CLIENT_ID = ( 'replace-with-your-production-client-id.apps.googleusercontent.com' ) # In case you wish to enable Google Analytics usage tracking, # uncomment the following line and use your GA code # GA_UA = 'UA-XXXXXXXX-X' elif SERVER_SOFTWARE.startswith('Development'): # Put your development server credentials here DEBUG = bool(os.environ.get('DEBUG', True)) CLIENT_ID = ( 'replace-with-your-development-client-id.apps.googleusercontent.com' ) CLIENT_SECRET = 'replace-with-your-development-client-secret' else: CLIENT_ID = None logger.critical('Not in development and application id %s unknown.', APP_NAME)
StarcoderdataPython
71442
import numpy as np from scipy.signal import hilbert from PyEMD.compact import filt6, pade6 # Visualisation is an optional module. To minimise installation, `matplotlib` is not added # by default. Please install extras with `pip install -r requirement-extra.txt`. try: import pylab as plt except ImportError: pass class Visualisation(object): """Simple visualisation helper. This class is for quick and simple result visualisation. """ PLOT_WIDTH = 6 PLOT_HEIGHT_PER_IMF = 1.5 def __init__(self, emd_instance=None): self.emd_instance = emd_instance self.imfs = None self.residue = None if emd_instance is not None: self.imfs, self.residue = self.emd_instance.get_imfs_and_residue() def _check_imfs(self, imfs, residue, include_residue): """Checks for passed imfs and residue.""" imfs = imfs if imfs is not None else self.imfs residue = residue if residue is not None else self.residue if imfs is None: raise AttributeError("No imfs passed to plot") if include_residue and residue is None: raise AttributeError("Requested to plot residue but no residue provided") return imfs, residue def plot_imfs(self, imfs=None, residue=None, t=None, include_residue=True): """Plots and shows all IMFs. All parameters are optional since the `emd` object could have been passed when instantiating this object. The residual is an optional and can be excluded by setting `include_residue=False`. """ imfs, residue = self._check_imfs(imfs, residue, include_residue) num_rows, t_length = imfs.shape num_rows += include_residue is True t = t if t is not None else range(t_length) fig, axes = plt.subplots(num_rows, 1, figsize=(self.PLOT_WIDTH, num_rows * self.PLOT_HEIGHT_PER_IMF)) if num_rows == 1: axes = list(axes) axes[0].set_title("Time series") for num, imf in enumerate(imfs): ax = axes[num] ax.plot(t, imf) ax.set_ylabel("IMF " + str(num + 1)) if include_residue: ax = axes[-1] ax.plot(t, residue) ax.set_ylabel("Res") # Making the layout a bit more pleasant to the eye plt.tight_layout() def plot_instant_freq(self, t, imfs=None, order=False, alpha=None): """Plots and shows instantaneous frequencies for all provided imfs. The necessary parameter is `t` which is the time array used to compute the EMD. One should pass `imfs` if no `emd` instances is passed when creating the Visualisation object. Parameters ---------- order : bool (default: False) Represents whether the finite difference scheme is low-order (1st order forward scheme) or high-order (6th order compact scheme). The default value is False (low-order) alpha : float (default: None) Filter intensity. Default value is None, which is equivalent to `alpha` = 0.5, meaning that no filter is applied. The `alpha` values must be in between -0.5 (fully active) and 0.5 (no filter). """ if alpha is not None: assert -0.5 < alpha < 0.5, "`alpha` must be in between -0.5 and 0.5" imfs, _ = self._check_imfs(imfs, None, False) num_rows = imfs.shape[0] imfs_inst_freqs = self._calc_inst_freq(imfs, t, order=order, alpha=alpha) fig, axes = plt.subplots(num_rows, 1, figsize=(self.PLOT_WIDTH, num_rows * self.PLOT_HEIGHT_PER_IMF)) if num_rows == 1: axes = fig.axes axes[0].set_title("Instantaneous frequency") for num, imf_inst_freq in enumerate(imfs_inst_freqs): ax = axes[num] ax.plot(t, imf_inst_freq) ax.set_ylabel("IMF {} [Hz]".format(num + 1)) # Making the layout a bit more pleasant to the eye plt.tight_layout() def _calc_inst_phase(self, sig, alpha): """Extract analytical signal through the Hilbert Transform.""" analytic_signal = hilbert(sig) # Apply Hilbert transform to each row if alpha is not None: assert -0.5 < alpha < 0.5, "`alpha` must be in between -0.5 and 0.5" real_part = np.array([filt6(row.real, alpha) for row in analytic_signal]) imag_part = np.array([filt6(row.imag, alpha) for row in analytic_signal]) analytic_signal = real_part + 1j * imag_part phase = np.unwrap(np.angle(analytic_signal)) # Compute angle between img and real if alpha is not None: phase = np.array([filt6(row, alpha) for row in phase]) # Filter phase return phase def _calc_inst_freq(self, sig, t, order, alpha): """Extracts instantaneous frequency through the Hilbert Transform.""" inst_phase = self._calc_inst_phase(sig, alpha=alpha) if order is False: inst_freqs = np.diff(inst_phase) / (2 * np.pi * (t[1] - t[0])) inst_freqs = np.concatenate((inst_freqs, inst_freqs[:, -1].reshape(inst_freqs[:, -1].shape[0], 1)), axis=1) else: inst_freqs = [pade6(row, t[1] - t[0]) / (2.0 * np.pi) for row in inst_phase] if alpha is None: return np.array(inst_freqs) else: return np.array([filt6(row, alpha) for row in inst_freqs]) # Filter freqs def show(self): plt.show() if __name__ == "__main__": from PyEMD import EMD # Simple signal example t = np.arange(0, 3, 0.01) S = np.sin(13 * t + 0.2 * t ** 1.4) - np.cos(3 * t) emd = EMD() emd.emd(S) imfs, res = emd.get_imfs_and_residue() # Initiate visualisation with emd instance vis = Visualisation(emd) # Create a plot with all IMFs and residue vis.plot_imfs(imfs=imfs, residue=res, t=t, include_residue=True) # Create a plot with instantaneous frequency of all IMFs vis.plot_instant_freq(t, imfs=imfs) # Show both plots vis.show()
StarcoderdataPython
1696859
<reponame>mmaaz60/ssl_for_fgvc import sys class Model: """ This class initiates the specified model. """ def __init__(self, config): """ Constructor, select the model specified in the configuration file :param config: Configuration class object """ # Select the correct model if config.cfg["model"]["name"] == "torchvision": from model.torchvision import TorchVision as Model elif config.cfg["model"]["name"] == "fgvc_resnet": from model.fgvc_resnet import FGVCResnet as Model elif config.cfg["model"]["name"] == "torchvision_ssl_rotation": from model.torchvision_ssl_rotation import TorchvisionSSLRotation as Model elif config.cfg["model"]["name"] == "fgvc_ssl_rotation": from model.fgvc_ssl_rotation import FGVCSSLRotation as Model elif config.cfg["model"]["name"] == "torchvision_ssl_pirl": from model.torchvision_ssl_pirl import TorchVisionSSLPIRL as Model elif config.cfg["model"]["name"] == "dcl": from model.torchvision_ssl_dcl import TorchVisionSSLDCL as Model else: print(f"Please provide correct model to use in configuration. " f"Available options are ['torchvision', 'fgvc_resnet', " f"'torchvision_ssl_rotation', 'fgvc_ssl_rotation', 'torchvision_ssl_pirl', 'dcl']") sys.exit(1) # Initialize the selected DataLoader self.model = Model(config) def get_model(self): """ This function returns the selected model """ return self.model
StarcoderdataPython
1723178
DEFAULT_MOUNT_SHARE = "True" MAX_SHARES_PER_FPG = 16 def create_metadata(backend, cpg, fpg, share_name, size, readonly=False, nfs_options=None, comment='', fsMode=None, fsOwner=None): return { 'id': None, 'backend': backend, 'cpg': cpg, 'fpg': fpg, 'vfs': None, 'name': share_name, 'size': size, 'readonly': readonly, 'nfsOptions': nfs_options, 'protocol': 'nfs', 'clientIPs': [], 'comment': comment, 'fsMode': fsMode, 'fsOwner': fsOwner, }
StarcoderdataPython
1605869
# -*- coding: utf-8 -*- from pathlib import Path from setuptools import find_packages, setup README = (Path(__file__).parent / "README.md").read_text() REQUIRES = ["pluggy>=1.0,<1.1", "robotframework>=4.0,<5.0"] EXTRAS_REQUIRE = {"test": ["pytest>=5.2.2,<6.3.0" "black==21.12b0"]} def get_version(): global_vars = {} exec(Path("src/rf_network/version.py").read_text(), global_vars) return global_vars["__version__"] setup( name="rf-network", keywords=["rf-network", "robotframework", "network", "testing"], license="MIT license", version=get_version(), author="<NAME>", author_email="<EMAIL>", python_requires=">=3.7", classifiers=[ "Development Status :: 3 - Alpha", "Intended Audience :: Developers", "License :: OSI Approved :: MIT License", "Natural Language :: English", "Programming Language :: Python :: 3", "Programming Language :: Python :: 3.7", "Programming Language :: Python :: 3.8", "Programming Language :: Python :: 3.9", ], description=( "A pluggable multi-vendor network connection library for RobotFramework" ), long_description=README, long_description_content_type="text/markdown", url="https://github.com/ttafsir/rf-network", packages=find_packages("src", exclude=("tests",)), package_dir={"": "src"}, install_requires=REQUIRES, include_package_data=True, extras_require=EXTRAS_REQUIRE, tests_require=["rf-network[test]"], )
StarcoderdataPython
3285115
<gh_stars>10-100 # Copyright 2011 SRI International # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. ''' Created on Feb 23, 2011 @author: jklo ''' import unittest import logging from stemx.tests import Publish class ObtainTest(Publish): def __init__(self): self._log = logging.getLogger("ObtainTest"); self._server = None pass def setUp(self): super(ObtainTest, self).setUp() def tearDown(self): super(ObtainTest, self).tearDown() def testObtain(self): doc_ID = self.test_goodPublish() self._res if __name__ == "__main__": logging.basicConfig() #import sys;sys.argv = ['', 'ObtainTest.testObtain'] unittest.main()
StarcoderdataPython
53510
<reponame>fei-protocol/checkthechain from __future__ import annotations import math import typing if typing.TYPE_CHECKING: import aiohttp import toolstr url_template = 'https://api.coingecko.com/api/v3/coins/markets?vs_currency=usd&order=market_cap_desc&per_page=100&page={page}&sparkline=true&price_change_percentage=1h%2C24h%2C7d' token_url_template = 'https://www.coingecko.com/en/coins/{name}' async def async_get_market_data( n: int, ) -> typing.Sequence[typing.Mapping[typing.Any, typing.Any]]: import asyncio import aiohttp n_per_page = 100 n_pages = math.ceil(n / n_per_page) async with aiohttp.ClientSession() as session: coroutines = [async_get_page(session, p) for p in range(n_pages)] pages = await asyncio.gather(*coroutines) items = [item for page in pages for item in page] return items[:n] async def async_get_page( session: aiohttp.ClientSession, p: int ) -> typing.List[typing.Any]: url = url_template.format(page=p + 1) async with session.get(url) as response: page = await response.json() if not isinstance(page, list): raise Exception('bad page format') return page def color_polarity(value: int | float | None) -> str: if value is None: return '' if value > 0: return '#4eaf0a' elif value < 0: return '#e15241' else: return 'gray' def print_market_data( data: typing.Sequence[typing.Any], verbose: bool, include_links: bool = False, height: int | None = None, width: int | None = None, ) -> None: if width is None: width = 8 # create labels labels = ['token', 'price', 'Δ 1H', 'Δ 24H', 'Δ 7D', 'volume', 'mkt cap'] if verbose: labels.append('7D chart') # create rows rows: list[typing.Sequence[typing.Any]] = [] for item in data: row = [] row.append(item['symbol'].upper()) row.append(item['current_price']) # add price change cells for key in [ 'price_change_percentage_1h_in_currency', 'price_change_percentage_24h_in_currency', 'price_change_percentage_7d_in_currency', ]: change = item[key] row.append(change) row.append(item['total_volume']) row.append(item['market_cap']) # add sparkline if verbose: from toolstr.charts import braille sparkline = braille.create_braille_sparkline( data=item['sparkline_in_7d']['price'], # width=20, width=width, height=height, ) row.append(sparkline) rows.append(row) if height is None: height = 1 def get_row_color(r: int) -> str: if height is None: raise Exception('height not set') datum = data[int(r / height)] diff = ( datum['sparkline_in_7d']['price'][-1] - datum['sparkline_in_7d']['price'][0] ) return color_polarity(diff) # print table toolstr.print_multiline_table( rows, labels=labels, column_gap=1, # compact=True, add_row_index=True, separate_all_rows=False, # max_table_width=os.get_terminal_size().columns, vertical_justify='center', column_style={ 'Δ 1H': lambda context: 'bold ' + color_polarity(context['cell']), 'Δ 24H': lambda context: 'bold ' + color_polarity(context['cell']), 'Δ 7D': lambda context: 'bold ' + color_polarity(context['cell']), '7D chart': lambda context: 'bold ' + get_row_color(context['r']), }, column_format={ 'price': {'decimals': 2, 'trailing_zeros': True, 'prefix': '$'}, 'Δ 1H': { 'scientific': False, 'postfix': '%', 'decimals': 2, 'trailing_zeros': True, }, 'Δ 24H': { 'scientific': False, 'postfix': '%', 'decimals': 2, 'trailing_zeros': True, }, 'Δ 7D': { 'scientific': False, 'postfix': '%', 'decimals': 2, 'trailing_zeros': True, }, 'volume': { 'decimals': 1, 'trailing_zeros': True, 'prefix': '$', 'order_of_magnitude': True, }, 'mkt cap': { 'decimals': 1, 'trailing_zeros': True, 'prefix': '$', 'order_of_magnitude': True, }, }, )
StarcoderdataPython
1665336
import ChromaPy32 as Chroma # Import the Chroma Module from time import sleep Keyboard = Chroma.Keyboard() # Initialize a new Keyboard Instance RED = (255, 0, 0) # Initialize a new color by RGB (RED,GREEN,BLUE) GREEN = (0, 255, 0) for y in range(0, Keyboard.MaxRow): # Use Keyboard.MaxRow as an iteration border in a for-loop Keyboard.setbyGrid(3, y, RED) # sets the whole fourth column to green for x in range(0, Keyboard.MaxColumn): # Use Keyboard.MaxColumn as iteration border in a for-loop Keyboard.setbyGrid(x, 2, GREEN) # sets the whole third row to green Keyboard.applyGrid() # applies the Keyboard-Grid to the connected Keyboard sleep(5)
StarcoderdataPython
57169
<reponame>BLannoo/Advent-of-Code-2021 from pathlib import Path from day4.board import Board def silver(input_file_path: Path) -> int: number_sequence, boards = parse_input(input_file_path) for number in number_sequence: for board in boards: board.mark(number) if board.is_won(): return board.unmarked_sum() * number def gold(input_file_path: Path) -> int: number_sequence, boards = parse_input(input_file_path) for number in number_sequence: for board in boards.copy(): board.mark(number) if board.is_won(): if len(boards) == 1: return board.unmarked_sum() * number boards.remove(board) def parse_input(input_file_path): split = input_file_path.read_text().split("\n\n") number_sequence = [ int(number_str) for number_str in split[0].split(",") ] boards = [ Board.parse(board_description) for board_description in split[1:] ] return number_sequence, boards
StarcoderdataPython
1749776
from subprocess import Popen, PIPE, STDOUT import sys pomXml = """ <project xmlns="http://maven.apache.org/POM/4.0.0" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:schemaLocation="http://maven.apache.org/POM/4.0.0 http://maven.apache.org/xsd/maven-4.0.0.xsd"> <modelVersion>4.0.0</modelVersion> <groupId>de.zaunkoenigweg.eclipse</groupId> <artifactId>mirror-eclipse-site</artifactId> <version>1.0</version> <packaging>pom</packaging> <properties> <tycho.version>1.0.0</tycho.version> </properties> <repositories> <repository> <id>oxygen</id> <url>http://download.eclipse.org/releases/oxygen</url> <layout>p2</layout> </repository> </repositories> <build> <plugins> <plugin> <groupId>org.eclipse.tycho.extras</groupId> <artifactId>tycho-p2-extras-plugin</artifactId> <version>${tycho.version}</version> <executions> <execution> <id>mirror</id> <phase>prepare-package</phase> <goals> <goal>mirror</goal> </goals> <configuration> <source> <repository> <url>%(siteUrl)s</url> <layout>p2</layout> </repository> </source> <destination>${project.build.directory}/mirror/</destination> <ius> %(iuConfiguration)s </ius> </configuration> </execution> </executions> </plugin> <plugin> <artifactId>maven-assembly-plugin</artifactId> <version>2.4.1</version> <configuration> <descriptors> <descriptor>assembly.xml</descriptor> </descriptors> </configuration> <executions> <execution> <phase>package</phase> <goals> <goal>single</goal> </goals> </execution> </executions> </plugin> </plugins> </build> </project> """ assemblyXml="""<assembly xmlns="http://maven.apache.org/plugins/maven-assembly-plugin/assembly/1.1.2" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:schemaLocation="http://maven.apache.org/plugins/maven-assembly-plugin/assembly/1.1.2 http://maven.apache.org/xsd/assembly-1.1.2.xsd"> <id>mirror</id> <formats> <format>zip</format> </formats> <includeBaseDirectory>false</includeBaseDirectory> <fileSets> <fileSet> <directory>${project.build.directory}/mirror</directory> <outputDirectory>/</outputDirectory> </fileSet> </fileSets> </assembly>""" iusXml = """ <iu> <id>%(iu)s</id> <version>%(version)s</version> </iu> """ def execute(command, directory='.', verbose=False): p = Popen(command, shell=True, stdin=PIPE, stdout=PIPE, stderr=STDOUT, cwd=directory, close_fds=True) for c in iter(lambda: p.stdout.read(1), ''): if verbose: sys.stdout.write(c) rc = p.poll() if(rc and rc!=0): sys.exit(rc) def prompt(msg, allowEmpty=False): text = raw_input(msg) if(not allowEmpty): while(not text.strip()): text = raw_input(msg) return text.strip() print """ This mirroring tool helps you generating a zipped update site from a given site URL. It dynamically creates a Maven project and uses a tycho plugin to mirror the update site. You have to provide some params.""" print """ Site Name: ========== The site name is used as the name for the zip file that contains the mirrored update site. Example: "pmd" """ siteName = prompt("site name: ") print """ update site URL: ================ The URL of the update site. You usually obtain it from the plugin's website. Example: "https://dl.bintray.com/pmd/pmd-eclipse-plugin/updates/" """ siteUrl = prompt("update site URL: ") print """ IUs (installable units): ======================== An update site can consist of multiple installable units (usually Eclipse features). You can provide 0..n IU names. If you provide none, all available IUs will be mirrored, otherwise the given subset. Example: "net.sourceforge.pmd.eclipse.feature.group" """ ius = [] iu = prompt("IU # 1 (blank for all IUs): ", allowEmpty=True) while(iu.strip()): ius.append(iu) iu = prompt("IU # %d (blank to end list): " % (len(ius)+1), allowEmpty=True) versions = {} for iu in ius: version = prompt("Version for IU '%s' (blank for latest): " % iu, allowEmpty=True) versions[iu]=version print """ The script will now generate a Maven project in the subfolder mirror-eclipse-site and execute it to mirror and assemble the site. """ raw_input("ENTER") iuConfiguration = "" for iu in ius: iuConfiguration += (iusXml % {'iu':iu, 'version': versions[iu]}) execute("rm -rf mirror-eclipse-site/") execute("mkdir mirror-eclipse-site") data = {'siteName':siteName, 'siteUrl':siteUrl, 'iuConfiguration':iuConfiguration} with open("mirror-eclipse-site/pom.xml", "w") as pomFile: pomFile.write(pomXml % data) with open("mirror-eclipse-site/assembly.xml", "w") as pomFile: pomFile.write(assemblyXml) execute("cd mirror-eclipse-site") execute("mvn package", "mirror-eclipse-site", verbose=True) execute("cp mirror-eclipse-site/target/mirror-eclipse-site-1.0-mirror.zip %s.zip" % siteName) execute("rm -rf mirror-eclipse-site/") print """ If the Maven project was completed successfully, you find the update site in %s.zip. """ % siteName
StarcoderdataPython
3248198
<reponame>alexbarten/adventofcode2021<filename>src/december06/compute_fishschool_growth_smart.py def main(): fishschool = fishschool_to_dict("src/december06/fish.txt") grown_school = reduce_and_grow(fishschool, 256) number_of_fish = 0 for value in grown_school.values(): number_of_fish += value print("The number of fish is ", number_of_fish) def fishschool_to_dict(file): fishschoolfile = open(file, "r") fishschool_line = fishschoolfile.readline().replace("\n", "") fishschool = {0: 0, 1: 0, 2: 0, 3: 0, 4: 0, 5: 0, 6: 0, 7: 0, 8: 0} for fish in fishschool_line: if fish != ",": fishschool[int(fish)] += 1 return fishschool def reduce_and_grow(fishschool, days): for day in range(days): new_babies = fishschool[0] for i in range(8): fishschool[i] = fishschool[i + 1] fishschool[8] = new_babies fishschool[6] += new_babies return fishschool if __name__ == "__main__": main()
StarcoderdataPython
127033
""" --- Day 2: 1202 Program Alarm --- -- Part One -- An Intcode program is a list of integers separated by commas (like 1,0,0,3,99). To run one, start by looking at the first integer (called position 0). Here, you will find an opcode - either 1, 2, or 99. The opcode indicates what to do; for example, 99 means that the program is finished and should immediately halt. Encountering an unknown opcode means something went wrong. Opcode 1 adds together numbers read from two positions and stores the result in a third position. The three integers immediately after the opcode tell you these three positions - the first two indicate the positions from which you should read the input values, and the third indicates the position at which the output should be stored. For example, if your Intcode computer encounters 1,10,20,30, it should read the values at positions 10 and 20, add those values, and then overwrite the value at position 30 with their sum. Opcode 2 works exactly like opcode 1, except it multiplies the two inputs instead of adding them. Again, the three integers after the opcode indicate where the inputs and outputs are, not their values. (Opcode 99 halts the program.) Once you're done processing an opcode, move to the next one by stepping forward 4 positions. Once you have a working computer, the first step is to restore the gravity assist program (your puzzle input) to the "1202 program alarm" state it had just before the last computer caught fire. To do this, before running the program, replace position 1 with the value 12 and replace position 2 with the value 2. What value is left at position 0 after the program halts? -- Part Two -- "With terminology out of the way, we're ready to proceed. To complete the gravity assist, you need to determine what pair of inputs produces the output 19690720." The inputs should still be provided to the program by replacing the values at addresses 1 and 2, just like before. In this program, the value placed in address 1 is called the noun, and the value placed in address 2 is called the verb. Each of the two input values will be between 0 and 99, inclusive. Once the program has halted, its output is available at address 0, also just like before. Each time you try a pair of inputs, make sure you first reset the computer's memory to the values in the program (your puzzle input) - in other words, don't reuse memory from a previous attempt. Find the input noun and verb that cause the program to produce the output 19690720. What is 100 * noun + verb? (For example, if noun=12 and verb=2, the answer would be 1202.) """ def get_init(): a = open("intcode.txt", "r") b = (a.readline()).split(",") a.close() return b def opcode_one(arr, i): arr[int('%s'%(arr[i+3]))] = int(arr[int('%s'%(arr[i+1]))]) + int(arr[int('%s'%(arr[i+2]))]) def opcode_two(arr, i): arr[int('%s'%(arr[i+3]))] = int(arr[int('%s'%(arr[i+1]))]) * int(arr[int('%s'%(arr[i+2]))]) def part_one(): ics = get_init() i = 0 while i < (len(ics)): if ics[i] == "1": opcode_one(ics, i) i += 4 elif ics[i] == "2": opcode_two(ics, i) i += 4 elif ics[i] == "99": return ics[0] def part_two(): for k in range(0,100): for j in range(0, 100): ics = get_init() ics[1] = '%s'%(k) ics[2] = '%s'%(j) i = 0 while i < (len(ics)): if ics[i] == "1": opcode_one(ics, i) i += 4 elif ics[i] == "2": opcode_two(ics, i) i += 4 elif ics[i] == "99": break if ics[0] == 19690720: return(100*k + j) if __name__ == '__main__': print(part_one()) print(part_two())
StarcoderdataPython
80476
<reponame>yingcuhk/Distributed-and-Asynchronos-SGD<filename>src/LG.py mport gzip import os import sys import numpy as np import cPickle import tensorflow as tf class LogisticRegression(object): def __init__(self): self.X = tf.placeholder("float", [None, 784]) self.Y = tf.placeholder("float", [None, 10]) self.W = tf.Variable(tf.random_normal([28 * 28, 10], stddev=0.01)) self.b = tf.Variable(tf.zeros([10, ])) self.model = self.create_model(self.X, self.W, self.b) # logistic and cal error self.cost = tf.reduce_mean(tf.nn.softmax_cross_entropy_with_logits(self.model, self.Y)) # gradient descent method to minimize error self.train = tf.train.GradientDescentOptimizer(0.1).minimize(self.cost) # calculate the max pos each row self.predict = tf.argmax(self.model, 1) def create_model(self, X, w, b): # wx + b return tf.add(tf.matmul(X, w), b) def load_data(self): """ f = gzip.open('mnist.pkl.gz', 'rb') train_set, valid_set, test_set = cPickle.load(f) f.close() """ return train_set, valid_set, test_set def dense_to_one_hot(self, labels_dense, num_classes=10): # ont hot copy from https://github.com/nlintz/TensorFlow-Tutorials # also can use sklearn preprocessing OneHotEncoder() num_labels = labels_dense.shape[0] index_offset = np.arange(num_labels) * num_classes labels_one_hot = np.zeros((num_labels, num_classes)) labels_one_hot.flat[index_offset + labels_dense.ravel()] = 1 return labels_one_hot def run(self): train_set, valid_set, test_set = self.load_data() train_X, train_Y = train_set test_X, test_Y = test_set train_Y = self.dense_to_one_hot(train_Y) test_Y = self.dense_to_one_hot(test_Y) sess = tf.Session() init = tf.initialize_all_variables() sess.run(init) for i in range(100): for start, end in zip(range(0, len(train_X), 128), range(128, len(train_X), 128)): sess.run(self.train, feed_dict={self.X: train_X[start:end], self.Y: train_Y[start:end]}) print i, np.mean(np.argmax(test_Y, axis=1) == sess.run(self.predict, feed_dict={self.X: test_X, self.Y: test_Y})) sess.close() if __name__ == '__main__': lr_model = LogisticRegression() lr_model.run()
StarcoderdataPython
136232
import subprocess import json if __name__ == '__main__': filename ="/tmp/test.json" f = open(filename,"w") result = subprocess.check_output(['kubectl','get','pods','-o','json']).rstrip() f.write(result) f.close() # f = open(filename,"r") data = json.load(f) #print(data) print data['items'][0]['status']['conditions']
StarcoderdataPython
52234
<reponame>adger-me/you-get #!/usr/bin/env python ''' WIP def main(): script_main('you-get', any_download, any_download_playlist) if __name__ == "__main__": main() '''
StarcoderdataPython
82746
from DesignPatterns.Factory.Sedan import Sedan from DesignPatterns.Factory.SUV import SUV from DesignPatterns.Factory.Hatchback import Hatchback class VehicleFactory: def generate(self, vehicle_type): if vehicle_type is 'Sedan': return Sedan().produce_vehicle() elif vehicle_type is 'SUV': return SUV().produce_vehicle() elif vehicle_type is 'Hatchback': return Hatchback().produce_vehicle()
StarcoderdataPython
4804390
<gh_stars>0 import data_io import pandas as pd import requests from typing import List from debug_tools import * """ Function that takes as input a job title and returns a dataframe with the average salary by state for that job title. """ def scrape_salary_table_for_job_title(job_name: str) -> pd.DataFrame: if(job_name): query = job_name.replace(" ", "-") else: return False job_url = "https://ziprecruiter.com/Salaries/What-Is-the-Average-" + query + "-Salary-by-State" job_response = requests.get(job_url, timeout=10) dprint(job_response) if "ind=null" in job_response.url or "Moved Permanently" in job_response.url: return False elif job_response.status_code == 301: return False else: job_text: List[pd.DataFrame] = pd.read_html(job_response.text) if(len(job_text) > 0): job_table: pd.DataFrame = pd.concat(job_text) else: return False return job_table """ Static Function to pull Value of a Dollar table from patriotsoftware which we join and multiply on the salary by state to find dollar adjusted jobs * TODO: cache this somewhere """ def scrape_ppp_table() -> pd.DataFrame: ppp_url = "https://www.patriotsoftware.com/blog/accounting/average-cost-living-by-state/" ppp_response = requests.get(ppp_url, timeout=10) ppp_text: List[pd.DataFrame] = pd.read_html(ppp_response.text, header=0) ppp_table: pd.DataFrame = pd.concat(ppp_text) return ppp_table
StarcoderdataPython
54134
<filename>Chapter 08/Chap08_Example8.24.py class Student: def __init__(self): self.name = 'Mohan' self.age = 10 self.country = 'India' def mydelete(self): del self.age myobj1 = Student() print("Before deleting: ") print(myobj1.__dict__) del myobj1.country # deleting outside of the class print("After deleting outside of the class: ") print(myobj1.__dict__) print("After deleting from inside of the class") myobj1.mydelete() print(myobj1.__dict__)
StarcoderdataPython
3228012
<filename>Pointnet/pointnet_segmentation.py<gh_stars>0 from __future__ import print_function import torch import torch.nn as nn import torch.nn.parallel import torch.utils.data from torch.autograd import Variable import numpy as np import torch.nn.functional as F from Pointnet import PointNet class PointNetSeg(nn.Module): def __init__(self, k = 3,Feature_Transform = True ): super(PointNetCls,self).__init__() self.k = k self.pointnet = PointNet(global_feat = False, Feature_Transform= True) #bx1024 self.conv1 = torch.nn.Conv1d(1024,512,1) self.conv2 = torch.nn.Conv1d(512,256,1) self.conv3 = torch.nn.Conv1d(256,128,1) self.conv4 = torch.nn.Conv1d(128,self.k,1) #self.rl = nn.ReLU() self.bn1= nn.BatchNorm1d(512) self.bn2= nn.BatchNorm1d(256) self.bn3= nn.BatchNorm1d(128) self.dropout = nn.Dropout(p=0.3) self.logsoftmax = nn.LogSoftmax(dim=1) def forward(self,x): batchsize= x.size()[0] no_of_points = x.size()[2] x = self.pointnet(x) x= F.relu(self.bn1(self.conv1(x))) x= F.relu(self.bn2(self.conv2(x))) x= F.relu(self.bn3(self.conv3(x))) x= self.conv4(x) x = x.transpose(2,1).contiguous() x = F.log_softmax(x.view(-1,self.k), dim=-1) x = x.view(batchsize, no_of_points, self.k) return x
StarcoderdataPython
186223
# Definition for singly-linked list. # class ListNode: # def __init__(self, val=0, next=None): # self.val = val # self.next = next from queue import PriorityQueue class Solution: def mergeKLists(self, lists: List[ListNode]) -> ListNode: class Wrapper(): def __init__(self, node): self.node = node def __lt__(self, other): return self.node.val < other.node.val head = currentNode = ListNode(0) priorityQueue = PriorityQueue() for linkedList in lists: if linkedList: priorityQueue.put(Wrapper(linkedList)) while not priorityQueue.empty(): node = priorityQueue.get().node currentNode.next = node currentNode = currentNode.next node = node.next if node: priorityQueue.put(Wrapper(node)) return head.next
StarcoderdataPython
4824734
from optparse import OptionParser import pprint import pymongo def main(): parser = OptionParser() parser.add_option("-s", "--seconds-running", dest="seconds", default=None, help="search for current Ops where the secs_running is greater than or equal to this value") parser.add_option("-v", "--verbose", action="store_true", dest="verbose", default=False, help="verbose output on each operation found") parser.add_option("-q", "--quiet", action="store_true", dest="quiet", default=False, help="quiet ouput. only prints operation ID values.") parser.add_option("-o", "--opid", dest="opid", default=None, help="specific operation to get details on.") (options, args) = parser.parse_args() seconds = 0 verbose = False quiet = False opid = None if options.seconds is not None: seconds = options.seconds if options.verbose: verbose = True if options.quiet: quiet = True if options.opid is not None: opid = options.opid conn = pymongo.MongoClient() all_ops = conn['admin']['$cmd.sys.inprog'].find_one('inprog')['inprog'] sync_ops = [] active_ops = [] for op in all_ops: if op['op'] == "query": if op['query'].has_key('writebacklisten'): sync_ops.append(op) elif op.has_key('secs_running'): if op['ns'] != "local.oplog.rs": if int(op['secs_running']) >= int(seconds): if opid is not None: if opid == op['opid']: active_ops.append(op) else: active_ops.append(op) if verbose: print "SyncOps found: %d" % len(sync_ops) print "Operations found: %d" % len(active_ops) for op in active_ops: if options.verbose: pprint.pprint(op) elif quiet: print op['opid'] else: print "ID: %s" % op['opid'] print "\tSeconds Running: %s" % op['secs_running'] if __name__ == '__main__': main()
StarcoderdataPython
1704793
<gh_stars>0 """ graph -> InChI string conversion """ from ._to_inchi import with_atom_inchi_numbers __all__ = ['with_atom_inchi_numbers']
StarcoderdataPython
1689236
import redis class Config(object): """配置信息""" # 随机加密盐值,随机即可 # SECRET_KEY = "<KEY>" SECRET_KEY = "" AUTH_SALT = "sYjLRzKQG4vra" EXPIRES_IN = 3600 # 文件保存路径 UPLOAD_FOLDER = '/static' # 数据库 # SQLALCHEMY_DATABASE_URI = "mysql://root:sa123@192.168.126.131:3307/metaphysics" SQLALCHEMY_DATABASE_URI = "" SQLALCHEMY_TRACK_MODIFICATIONS = True # redis REDIS_HOST = "192.168.126.131" REDIS_PORT = "6379" # # # flask_session SESSION_TYPE = "redis" SESSION_REDIS = redis.StrictRedis(host=REDIS_HOST, port=REDIS_PORT) SESSION_USE_SIGNER = True # 对cookie中的session_id是否隐藏 PERMANENT_SESSION_LIFETIME = 86400 # 设置session过期的时间,单位s class DevelopmentConfig(Config): """开发模式的配置信息""" DEBUG = True class ProductionConfig(Config): """生产环境配置信息""" DEBUG = False config_map = { 'develop': DevelopmentConfig, 'product': ProductionConfig }
StarcoderdataPython
3296630
<reponame>RSB4760/apq8016_external_vixl<gh_stars>0 #!/usr/bin/env python2.7 # Copyright 2014, ARM Limited # All rights reserved. # # Redistribution and use in source and binary forms, with or without # modification, are permitted provided that the following conditions are met: # # * Redistributions of source code must retain the above copyright notice, # this list of conditions and the following disclaimer. # * Redistributions in binary form must reproduce the above copyright notice, # this list of conditions and the following disclaimer in the documentation # and/or other materials provided with the distribution. # * Neither the name of ARM Limited nor the names of its contributors may be # used to endorse or promote products derived from this software without # specific prior written permission. # # THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS CONTRIBUTORS "AS IS" AND # ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE IMPLIED # WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE # DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT OWNER OR CONTRIBUTORS BE LIABLE # FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL # DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR # SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER # CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, # OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE # OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. import os import sys import argparse import re import platform import subprocess import multiprocessing import time import util from printer import EnsureNewLine, Print, UpdateProgress def BuildOptions(): result = argparse.ArgumentParser( description = '''This tool runs each test reported by $TEST --list (and filtered as specified). A summary will be printed, and detailed test output will be stored in log/$TEST.''', # Print default values. formatter_class=argparse.ArgumentDefaultsHelpFormatter) result.add_argument('filters', metavar='filter', nargs='*', help='Run tests matching all of the (regexp) filters.') result.add_argument('--runner', action='store', required=True, help='The test executable to run.') result.add_argument('--coloured_trace', action='store_true', help='''Pass --coloured_trace to the test runner. This will put colour codes in the log files. The coloured output can be viewed by "less -R", for example.''') result.add_argument('--debugger', action='store_true', help='''Pass --debugger to test, so that the debugger is used instead of the simulator. This has no effect when running natively.''') result.add_argument('--verbose', action='store_true', help='Print verbose output.') result.add_argument('--jobs', '-j', metavar='N', type=int, nargs='?', default=1, const=multiprocessing.cpu_count(), help='''Runs the tests using N jobs. If the option is set but no value is provided, the script will use as many jobs as it thinks useful.''') sim_default = 'off' if platform.machine() == 'aarch64' else 'on' result.add_argument('--simulator', action='store', choices=['on', 'off'], default=sim_default, help='Explicitly enable or disable the simulator.') return result.parse_args() def VerbosePrint(verbose, string): if verbose: Print(string) # A class representing an individual test. class Test: def __init__(self, name, runner, debugger, coloured_trace, verbose): self.name = name self.runner = runner self.debugger = debugger self.coloured_trace = coloured_trace self.verbose = verbose self.logpath = os.path.join('log', os.path.basename(self.runner)) if self.debugger: basename = name + '_debugger' else: basename = name self.logout = os.path.join(self.logpath, basename + '.stdout') self.logerr = os.path.join(self.logpath, basename + '.stderr') if not os.path.exists(self.logpath): os.makedirs(self.logpath) # Run the test. # Use a thread to be able to control the test. def Run(self): command = \ [self.runner, '--trace_sim', '--trace_reg', '--trace_write', self.name] if self.coloured_trace: command.append('--coloured_trace') if self.debugger: command.append('--debugger') VerbosePrint(self.verbose, '==== Running ' + self.name + '... ====') sys.stdout.flush() process = subprocess.Popen(command, stdout=subprocess.PIPE, stderr=subprocess.PIPE) # Get the output and return status of the test. stdout, stderr = process.communicate() retcode = process.poll() # Write stdout and stderr to the log. with open(self.logout, 'w') as f: f.write(stdout) with open(self.logerr, 'w') as f: f.write(stderr) if retcode == 0: # Success. # We normally only print the command on failure, but with --verbose we # should also print it on success. VerbosePrint(self.verbose, 'COMMAND: ' + ' '.join(command)) VerbosePrint(self.verbose, 'LOG (stdout): ' + self.logout) VerbosePrint(self.verbose, 'LOG (stderr): ' + self.logerr + '\n') else: # Failure. Print('--- FAILED ' + self.name + ' ---') Print('COMMAND: ' + ' '.join(command)) Print('LOG (stdout): ' + self.logout) Print('LOG (stderr): ' + self.logerr + '\n') return retcode # Scan matching tests and return a test manifest. def ReadManifest(runner, filters = [], debugger = False, coloured_trace = False, verbose = False): status, output = util.getstatusoutput(runner + ' --list') if status != 0: util.abort('Failed to list all tests') names = output.split() for f in filters: names = filter(re.compile(f).search, names) return map(lambda x: Test(x, runner, debugger, coloured_trace, verbose), names) # Shared state for multiprocessing. Ideally the context should be passed with # arguments, but constraints from the multiprocessing module prevent us from # doing so: the shared variables (multiprocessing.Value) must be global, or no # work is started. So we abstract some additional state into global variables to # simplify the implementation. # Read-write variables for the workers. n_tests_passed = multiprocessing.Value('i', 0) n_tests_failed = multiprocessing.Value('i', 0) # Read-only for workers. n_tests = None start_time = None verbose_test_run = None test_suite_name = '' def RunTest(test): UpdateProgress(start_time, n_tests_passed.value, n_tests_failed.value, n_tests, verbose_test_run, test.name, test_suite_name) # Run the test and update the statistics. retcode = test.Run() if retcode == 0: with n_tests_passed.get_lock(): n_tests_passed.value += 1 else: with n_tests_failed.get_lock(): n_tests_failed.value += 1 # Run all tests in the manifest. # This function won't run in parallel due to constraints from the # multiprocessing module. __run_tests_lock__ = multiprocessing.Lock() def RunTests(manifest, jobs = 1, verbose = False, debugger = False, progress_prefix = ''): global n_tests global start_time global verbose_test_run global test_suite_name with __run_tests_lock__: # Reset the counters. n_tests_passed.value = 0 n_tests_failed.value = 0 verbose_test_run = verbose test_suite_name = progress_prefix n_tests = len(manifest) if n_tests == 0: Print('No tests to run.') return 0 VerbosePrint(verbose, 'Running %d tests...' % (n_tests)) start_time = time.time() pool = multiprocessing.Pool(jobs) # The '.get(9999999)' is workaround to allow killing the test script with # ctrl+C from the shell. This bug is documented at # http://bugs.python.org/issue8296. work = pool.map_async(RunTest, manifest).get(9999999) done_message = '== Done ==' UpdateProgress(start_time, n_tests_passed.value, n_tests_failed.value, n_tests, verbose, done_message, progress_prefix) return n_tests_failed.value # 0 indicates success if __name__ == '__main__': # $ROOT/tools/test.py root_dir = os.path.dirname(os.path.dirname(os.path.abspath(sys.argv[0]))) # Parse the arguments. args = BuildOptions() # Find a valid path to args.runner (in case it doesn't begin with './'). args.runner = os.path.join('.', args.runner) if not os.access(args.runner, os.X_OK): print "'" + args.test + "' is not executable or does not exist." sys.exit(1) # List all matching tests. manifest = ReadManifest(args.runner, args.filters, args.debugger, args.coloured_trace, args.verbose) # Run the tests. status = RunTests(manifest, jobs=args.jobs, verbose=args.verbose, debugger=args.debugger) EnsureNewLine() sys.exit(status)
StarcoderdataPython
1675011
""" builtin_bracket.py """ from __future__ import print_function from _devbuild.gen.id_kind_asdl import Id from _devbuild.gen.runtime_asdl import value, quote_e, quote_t from _devbuild.gen.syntax_asdl import ( word, word_e, word_t, word__String, bool_expr, ) from _devbuild.gen.types_asdl import lex_mode_e from asdl import runtime from core import error from core.pyerror import p_die, log from core import vm from frontend import match from osh import sh_expr_eval from osh import bool_parse from osh import word_parse from osh import word_eval _ = log from typing import cast, TYPE_CHECKING if TYPE_CHECKING: from _devbuild.gen.runtime_asdl import cmd_value__Argv, value__Str from _devbuild.gen.syntax_asdl import word__String, bool_expr_t from _devbuild.gen.types_asdl import lex_mode_t from core.ui import ErrorFormatter from core import optview from core import state class _StringWordEmitter(word_parse.WordEmitter): """For test/[, we need a word parser that returns String. The BoolParser calls word_.BoolId(w), and deals with Kind.BoolUnary, Kind.BoolBinary, etc. This is instead of Compound/Token (as in the [[ case. """ def __init__(self, cmd_val): # type: (cmd_value__Argv) -> None self.cmd_val = cmd_val self.i = 0 self.n = len(cmd_val.argv) def ReadWord(self, unused_lex_mode): # type: (lex_mode_t) -> word__String """Interface for bool_parse.py. TODO: This should probably be word_t """ if self.i == self.n: # Does it make sense to define Eof_Argv or something? # TODO: Add a way to show this location. Show 1 char past the right-most # spid of the last word? But we only have the left-most spid. w = word.String(Id.Eof_Real, '', runtime.NO_SPID) return w #log('ARGV %s i %d', self.argv, self.i) s = self.cmd_val.argv[self.i] left_spid = self.cmd_val.arg_spids[self.i] self.i += 1 # default is an operand word id_int = match.BracketUnary(s) if id_int == Id.Undefined_Tok: id_int = match.BracketBinary(s) if id_int == Id.Undefined_Tok: id_int = match.BracketOther(s) id_ = Id.Word_Compound if id_int == -1 else id_int # NOTE: We only have the left spid now. It might be useful to add the # right one. w = word.String(id_, s, left_spid) return w def Read(self): # type: () -> word__String """Interface used for special cases below.""" return self.ReadWord(lex_mode_e.ShCommand) def Peek(self, offset): # type: (int) -> str """For special cases.""" return self.cmd_val.argv[self.i + offset] def Rewind(self, offset): # type: (int) -> None """For special cases.""" self.i -= offset class _WordEvaluator(word_eval.StringWordEvaluator): def EvalWordToString(self, w, quote_kind=quote_e.Default): # type: (word_t, quote_t) -> value__Str # do_fnmatch: for the [[ == ]] semantics which we don't have! # I think I need another type of node # Maybe it should be BuiltinEqual and BuiltinDEqual? Parse it into a # different tree. assert w.tag_() == word_e.String string_word = cast(word__String, w) return value.Str(string_word.s) def _TwoArgs(w_parser): # type: (_StringWordEmitter) -> bool_expr_t """Returns an expression tree to be evaluated.""" w0 = w_parser.Read() w1 = w_parser.Read() if w0.s == '!': return bool_expr.LogicalNot(bool_expr.WordTest(w1)) unary_id = match.BracketUnary(w0.s) if unary_id == Id.Undefined_Tok: # TODO: # - separate lookup by unary p_die('Expected unary operator, got %r (2 args)', w0.s, word=w0) return bool_expr.Unary(unary_id, w1) def _ThreeArgs(w_parser): # type: (_StringWordEmitter) -> bool_expr_t """Returns an expression tree to be evaluated.""" w0 = w_parser.Read() w1 = w_parser.Read() w2 = w_parser.Read() # NOTE: Order is important here. binary_id = match.BracketBinary(w1.s) if binary_id != Id.Undefined_Tok: return bool_expr.Binary(binary_id, w0, w2) if w1.s == '-a': return bool_expr.LogicalAnd(bool_expr.WordTest(w0), bool_expr.WordTest(w2)) if w1.s == '-o': return bool_expr.LogicalOr(bool_expr.WordTest(w0), bool_expr.WordTest(w2)) if w0.s == '!': w_parser.Rewind(2) child = _TwoArgs(w_parser) return bool_expr.LogicalNot(child) if w0.s == '(' and w2.s == ')': return bool_expr.WordTest(w1) p_die('Expected binary operator, got %r (3 args)', w1.s, word=w1) class Test(vm._Builtin): def __init__(self, need_right_bracket, exec_opts, mem, errfmt): # type: (bool, optview.Exec, state.Mem, ErrorFormatter) -> None self.need_right_bracket = need_right_bracket self.exec_opts = exec_opts self.mem = mem self.errfmt = errfmt def Run(self, cmd_val): # type: (cmd_value__Argv) -> int """The test/[ builtin. The only difference between test and [ is that [ needs a matching ]. """ if self.need_right_bracket: # Preprocess right bracket strs = cmd_val.argv if not strs or strs[-1] != ']': self.errfmt.Print_('missing closing ]', span_id=cmd_val.arg_spids[0]) return 2 # Remove the right bracket cmd_val.argv.pop() cmd_val.arg_spids.pop() w_parser = _StringWordEmitter(cmd_val) w_parser.Read() # dummy: advance past argv[0] b_parser = bool_parse.BoolParser(w_parser) # There is a fundamental ambiguity due to poor language design, in cases like: # [ -z ] # [ -z -a ] # [ -z -a ] ] # # See posixtest() in bash's test.c: # "This is an implementation of a Posix.2 proposal by <NAME>." # It dispatches on expressions of length 0, 1, 2, 3, 4, and N args. We do # the same here. # # Another ambiguity: # -a is both a unary prefix operator and an infix operator. How to fix this # ambiguity? bool_node = None # type: bool_expr_t n = len(cmd_val.argv) - 1 try: if n == 0: return 1 # [ ] is False elif n == 1: w = w_parser.Read() bool_node = bool_expr.WordTest(w) elif n == 2: bool_node = _TwoArgs(w_parser) elif n == 3: bool_node = _ThreeArgs(w_parser) if n == 4: a0 = w_parser.Peek(0) if a0 == '!': w_parser.Read() # skip ! child = _ThreeArgs(w_parser) bool_node = bool_expr.LogicalNot(child) elif a0 == '(' and w_parser.Peek(3) == ')': w_parser.Read() # skip ')' bool_node = _TwoArgs(w_parser) else: pass # fallthrough if bool_node is None: bool_node = b_parser.ParseForBuiltin() except error.Parse as e: self.errfmt.PrettyPrintError(e, prefix='(test) ') return 2 # mem: Don't need it for BASH_REMATCH? Or I guess you could support it word_ev = _WordEvaluator() bool_ev = sh_expr_eval.BoolEvaluator(self.mem, self.exec_opts, None, self.errfmt) # We want [ a -eq a ] to always be an error, unlike [[ a -eq a ]]. This is a # weird case of [[ being less strict. bool_ev.Init_AlwaysStrict() bool_ev.word_ev = word_ev bool_ev.CheckCircularDeps() try: b = bool_ev.EvalB(bool_node) except error._ErrorWithLocation as e: # We want to catch e_die() and e_strict(). Those are both FatalRuntime # errors now, but it might not make sense later. # NOTE: This doesn't seem to happen. We have location info for all # errors that arise out of [. #if not e.HasLocation(): # raise self.errfmt.PrettyPrintError(e, prefix='(test) ') return 2 # 1 means 'false', and this usage error is like a parse error. status = 0 if b else 1 return status
StarcoderdataPython
1640553
<reponame>angad11121/red-eye-meme from flask import Flask, request, render_template, url_for, redirect from PIL import Image import numpy as np import os import cv2 from gaze_tracking import GazeTracking from werkzeug.utils import secure_filename ALLOWED_EXTENSIONS = {'jpg', 'jpeg', 'png'} DIRNAME = os.path.dirname(__file__) UPLOAD_FOLDER = os.path.join(DIRNAME,"source_img") # Flask instantiation app = Flask(__name__) app.config['UPLOAD_FOLDER'] = UPLOAD_FOLDER count = 0 def allowed_file(filename): return '.' in filename and filename.rsplit('.',1)[1].lower() in ALLOWED_EXTENSIONS def imagecov(photoname, relative_eye_size=1.5): global count ''' Keep the image in the folder source_image and put in the name of image in photoname ''' photoname = photoname sourcename = DIRNAME + '/source_img/' + photoname finalname = DIRNAME + '/static/' + str(count)+".jpg" ''' You can change the relative eye size to optimize the image further ''' # relative_eye_size = 1.5 gaze = GazeTracking() frame = cv2.imread(sourcename) # cv2.imshow("Demo1", frame) gaze.refresh(frame) frame = gaze.annotated_frame() left_pupil = gaze.pupil_left_coords() right_pupil = gaze.pupil_right_coords() try: distance = (left_pupil[0] - right_pupil[0]) * (left_pupil[0] - right_pupil[0]) + (left_pupil[1] - right_pupil[1]) * (left_pupil[1] - right_pupil[1]) except: return False distance = np.sqrt(distance) print(distance) face_image = Image.open(sourcename) eye_image = Image.open(DIRNAME + '/source_img/redeye.png') eye_image = eye_image.resize((int(distance*2*relative_eye_size),int(distance*relative_eye_size))) eye_image = eye_image.rotate(15) Image.Image.paste(face_image, eye_image,(left_pupil[0] - int(distance*relative_eye_size),left_pupil[1]-int(distance*relative_eye_size/2)), eye_image) Image.Image.paste(face_image, eye_image,(right_pupil[0] - int(distance*relative_eye_size),right_pupil[1]-int(distance*relative_eye_size/2)), eye_image) count+=1 # face_image.show() face_image.save(finalname) # eye_image.show() return True links = {} # Driver code @app.route("/failed") def failure(): return 'Program failed to find any eyes :(' @app.route("/", methods=['GET','POST']) def index(): global count if request.method=="POST": file = request.files['file'] if file: filename=secure_filename(file.filename) # print("hello "+os.path.join(app.config['UPLOAD_FOLDER'], filename)) file.save(os.path.join(app.config['UPLOAD_FOLDER'], filename)) print("hello "+ filename) if(imagecov(filename)): return redirect("static/"+str(count-1)+".jpg") else: return redirect(url_for('failure')) return render_template('index.html') if __name__ == "__main__": app.run(host="0.0.0.0", port=8000, debug=True)
StarcoderdataPython
1600014
# ______________________________________________________________________________ # ****************************************************************************** # # The simplest robot task: Just go and reach a point # # ______________________________________________________________________________ # ****************************************************************************** #----------------------------------------------------------------------------- #SET THE PATH TO THE URDF AND MESHES #Define robotName, urdfpath and initialConfig #Make sure talos_description is in the ROS_PACKAGE_PATH #from rospkg import RosPack #rospack = RosPack() #urdfPath = rospack.get_path('talos_description')+"/robots/talos_full_collision.urdf" #urdfDir = [rospack.get_path('talos_description')+"/../"] URDFPATH = "~/git/pyrene/talos-data"+"/robots/talos_reduced.urdf" URDFDIR = ["~/git/pyrene/talos-data"+"/../"] MOTION_SEQUENCE = "~/git/pyrene/pyrene-motions/grabHandrail15/stairs_15cm_handrail_grab_actuated" DISPLAY = True dt = 1e-3 robotName = 'TALOS' OperationalPointsMap = {'left-wrist' : 'arm_left_7_joint', 'right-wrist' : 'arm_right_7_joint', 'left-ankle' : 'leg_left_6_joint', 'right-ankle' : 'leg_right_6_joint', 'gaze' : 'head_2_joint', 'waist' : 'root_joint', 'chest' : 'torso_2_joint'} halfSitting = (0.0, 0.0, 1.018213, 0.00 , 0.0, 0.0, #Free flyer 0.0, 0.0, -0.411354, 0.859395, -0.448041, -0.001708, #Left Leg 0.0, 0.0, -0.411354, 0.859395, -0.448041, -0.001708, #Right Leg 0.0 , 0.006761, #Chest 0.25847 , 0.173046, -0.0002, -0.525366, 0.0, -0.0, 0.1, 0.1, #Left Arm -0.25847 , -0.173046, 0.0002 , -0.525366, 0.0, 0.0, 0.1, 0.1, #Right Arm 0., 0. #Head ) #----------------------------------------------------------------------------- #---- ROBOT SPECIFICATIONS---------------------------------------------------- #----------------------------------------------------------------------------- #----------------------------------------------------------------------------- #---- DYN -------------------------------------------------------------------- #----------------------------------------------------------------------------- from pinocchio.robot_wrapper import RobotWrapper import pinocchio as se3 from dynamic_graph.sot.dynamics_pinocchio import fromSotToPinocchio pinocchioRobot = RobotWrapper(URDFPATH, URDFDIR, se3.JointModelFreeFlyer()) pinocchioRobot.initDisplay(loadModel=DISPLAY) if DISPLAY: pinocchioRobot.display(fromSotToPinocchio(halfSitting)) from dynamic_graph.sot.dynamics_pinocchio.humanoid_robot import HumanoidRobot robot = HumanoidRobot(robotName, pinocchioRobot.model, pinocchioRobot.data, halfSitting, OperationalPointsMap) # ------------------------------------------------------------------------------ # ---- Kinematic Stack of Tasks (SoT) ----------------------------------------- # ------------------------------------------------------------------------------ from dynamic_graph import plug from dynamic_graph.sot.core import SOT sot = SOT('sot') sot.setSize(robot.dynamic.getDimension()) plug(sot.control,robot.device.control) # DEFINE POSTURE TASK from dynamic_graph.sot.core import Task, FeatureGeneric, GainAdaptive from dynamic_graph.sot.core.meta_tasks import setGain from dynamic_graph.sot.core.matrix_util import matrixToTuple from numpy import identity, hstack, zeros task_name = "posture_task" taskPosture = Task(task_name) taskPosture.dyn = robot.dynamic taskPosture.feature = FeatureGeneric('feature_'+task_name) taskPosture.featureDes = FeatureGeneric('feature_des_'+task_name) taskPosture.gain = GainAdaptive("gain_"+task_name) robotDim = robot.dynamic.getDimension() first_6 = zeros((32,6)) other_dof = identity(robotDim-6) jacobian_posture = hstack([first_6, other_dof]) taskPosture.feature.jacobianIN.value = matrixToTuple( jacobian_posture ) taskPosture.feature.setReference(taskPosture.featureDes.name) taskPosture.add(taskPosture.feature.name) #DEFINE SEQUENCE PLAYER from dynamic_graph.sot.tools import SimpleSeqPlay seqplay = SimpleSeqPlay("seq_play") seqplay.load(MOTION_SEQUENCE) #MAKE CONNECTIONS from dynamic_graph.sot.core import Selec_of_vector plug(seqplay.posture, taskPosture.featureDes.errorIN) getPostureValue = Selec_of_vector("current_posture") getPostureValue.selec(6,robotDim) plug(robot.dynamic.position, getPostureValue.sin) plug(getPostureValue.sout, taskPosture.feature.errorIN) plug(getPostureValue.sout, seqplay.currentPosture) setGain(taskPosture.gain,(4.9,0.9,0.01,0.9)) plug(taskPosture.gain.gain, taskPosture.controlGain) plug(taskPosture.error, taskPosture.gain.error) #START SEQUENCE PLAYER seqplay.start() taskPosture.featureDes.errorIN.recompute(0) #PUSH TO SOLVER sot.push(taskPosture.name) #------------------------------------------------------------------------------- #----- MAIN LOOP --------------------------------------------------------------- #------------------------------------------------------------------------------- def runner(n): for i in xrange(n): robot.device.increment(dt) pinocchioRobot.display(fromSotToPinocchio(robot.device.state.value)) runner(3000)
StarcoderdataPython
161926
import io import aiohttp from PIL import Image from plugin_system import Plugin plugin = Plugin('Зеркало', usage=["отзеркаль <прикреплённые фото> - отзеркаливает прикреплённое фото"]) FAIL_MSG = 'К сожалению, произошла какая-то ошибка :(' @plugin.on_command('отзеркаль') async def mirror(msg, args): photo = False for k, v in msg.brief_attaches.items(): if '_type' in k and v == "photo": photo = True break if not photo: return await msg.answer('Вы не прислали фото!') attach = (await msg.full_attaches)[0] if not attach.link: return await msg.answer('Вы не прислали фото!') async with aiohttp.ClientSession() as sess: async with sess.get(attach.link) as response: img = Image.open(io.BytesIO(await response.read())) if not img: return await msg.answer('К сожалению, ваше фото исчезло!') w, h = img.size part = img.crop((0, 0, w / 2, h)) part1 = part.transpose(Image.FLIP_LEFT_RIGHT) img.paste(part1, (round(w / 2), 0)) buffer = io.BytesIO() img.save(buffer, format='png') buffer.seek(0) result = await msg.vk.upload_photo(buffer) return await msg.answer('Держи', attachment=str(result))
StarcoderdataPython
1650786
import sys sys.path.append("..") from models.network import * from utils.utils import get_args from utils.config import process_config from utils.dirs import create_dirs from data_loader.data_generator import * from trainer.trainer import Trainer from utils.logger import Logger def main(): try: args = get_args() config = process_config(args.config) except: print("missing or invalid arguments") exit(0) create_dirs([config.summary_dir,config.checkpoint_dir]) dataset = DataGenerator(config) sess = tf.Session() logger = Logger(sess, config) net = YOLO2(config) trainer = Trainer(sess,net,dataset,config,logger) trainer.train() if __name__ == "__main__": main()
StarcoderdataPython
1740489
<reponame>DaleProctor/tscharts #(C) Copyright <NAME> 2017-2020 #(C) Copyright Thousand Smiles Foundation 2017-2020 # #Licensed under the Apache License, Version 2.0 (the "License"); #you may not use this file except in compliance with the License. # #You may obtain a copy of the License at #http://www.apache.org/licenses/LICENSE-2.0 # #Unless required by applicable law or agreed to in writing, software #distributed under the License is distributed on an "AS IS" BASIS, #WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. #See the License for the specific language governing permissions and #limitations under the License. ''' Unit tests for the category API. Assumes django server is up and running on the specified host and port ''' import unittest import getopt, sys import json from tschartslib.service.serviceapi import ServiceAPI from tschartslib.tscharts.tscharts import Login, Logout class CreateCategory(ServiceAPI): def __init__(self, host, port, token, payload): super(CreateCategory, self).__init__() self.setHttpMethod("POST") self.setHost(host) self.setPort(port) self.setToken(token) self.setPayload(payload) self.setURL("tscharts/v1/category/") class GetCategory(ServiceAPI): def makeURL(self): hasQArgs = False if not self._id == None: base = "tscharts/v1/category/{}/".format(self._id) else: base = "tscharts/v1/category/" if not self._name == None: if not hasQArgs: base += "?" else: base += "&" base += "name={}".format(self._name) hasQArgs = True self.setURL(base) def __init__(self, host, port, token): super(GetCategory, self).__init__() self.setHttpMethod("GET") self.setHost(host) self.setPort(port) self.setToken(token) self._name = None self._id = None self.makeURL(); def setId(self, id): self._id = id; self.makeURL() def setName(self,val): self._name = val self.makeURL() class DeleteCategory(ServiceAPI): def __init__(self, host, port, token, id): super(DeleteCategory, self).__init__() self.setHttpMethod("DELETE") self.setHost(host) self.setPort(port) self.setToken(token) self.setURL("tscharts/v1/category/{}/".format(id)) class TestTSCategory(unittest.TestCase): def setUp(self): login = Login(host, port, username, password) ret = login.send(timeout=30) self.assertEqual(ret[0], 200) self.assertTrue("token" in ret[1]) global token token = ret[1]["token"] def testCreateCategory(self): data = {} data["name"] = "Category 1" x = CreateCategory(host, port, token, data) ret = x.send(timeout = 30) self.assertEqual(ret[0], 200) id = int(ret[1]["id"]) x = GetCategory(host, port, token) x.setId(id) ret = x.send(timeout=30) self.assertEqual(ret[0], 200) ret = ret[1] self.assertEqual(ret['name'], "Category 1") x = CreateCategory(host, port, token, data) ret = x.send(timeout = 30) self.assertEqual(ret[0], 400) #bad request test uniqueness x = DeleteCategory(host, port, token, id) ret = x.send(timeout=30) self.assertEqual(ret[0], 200) x = GetCategory(host, port, token) x.setId(id) ret = x.send(timeout = 30) self.assertEqual(ret[0], 404) # not found data = {} x = CreateCategory(host, port, token, data) ret = x.send(timeout = 30) self.assertEqual(ret[0], 400) #bad request data["names"] = "Category 1" x = CreateCategory(host, port, token, data) ret = x.send(timeout = 30) self.assertEqual(ret[0], 400) #bad request data = {} data["name"] = "" x = CreateCategory(host, port, token, data) ret = x.send(timeout = 30) self.assertEqual(ret[0], 400) data = {} data["name"] = 123 x = CreateCategory(host, port, token, data) ret = x.send(timeout = 30) self.assertEqual(ret[0], 400) def testDeleteCategory(self): data = {} data["name"] = "Category 1" x = CreateCategory(host, port, token, data) ret = x.send(timeout=30) self.assertEqual(ret[0], 200) self.assertTrue("id" in ret[1]) id = int(ret[1]["id"]) x = GetCategory(host, port, token) x.setId(id) ret = x.send(timeout=30) self.assertEqual(ret[0], 200) ret = ret[1] self.assertEqual(ret["name"], "Category 1") self.assertEqual(ret["id"], id) x = DeleteCategory(host, port, token, id) ret = x.send(timeout=30) self.assertEqual(ret[0], 200) x = GetCategory(host, port, token) x.setId(id) ret = x.send(timeout=30) self.assertEqual(ret[0], 404) # not found x = DeleteCategory(host, port, token, id) ret = x.send(timeout=30) self.assertEqual(ret[0], 404) # not found def testGetCategory(self): data = {} data["name"] = "Category 1" x = CreateCategory(host, port, token, data) ret = x.send(timeout=30) self.assertEqual(ret[0], 200) self.assertTrue("id" in ret[1]) x = GetCategory(host, port, token); #test get a category by its id x.setId(int(ret[1]["id"])) ret = x.send(timeout=30) self.assertEqual(ret[0], 200) ret = ret[1] id = int(ret["id"]) self.assertTrue(ret["name"] == "Category 1") x = DeleteCategory(host, port, token, id) ret = x.send(timeout=30) self.assertEqual(ret[0], 200) x = GetCategory(host, port, token) x.setId(id) ret = x.send(timeout = 30) self.assertEqual(ret[0], 404) data = {} data["name"] = "Category 2" x = CreateCategory(host, port, token, data) ret = x.send(timeout=30) self.assertEqual(ret[0], 200) self.assertTrue("id" in ret[1]) id = ret[1]["id"] x = GetCategory(host, port, token) x.setName("Category 2") ret = x.send(timeout=30) self.assertEqual(ret[0], 200) self.assertTrue(ret[1]["name"] == "Category 2") x = GetCategory(host, port, token) x.setName("aaaa") ret = x.send(timeout = 30) self.assertEqual(ret[0], 404) #not found x = DeleteCategory(host, port, token, id) ret = x.send(timeout=30) self.assertEqual(ret[0], 200) namelist = ['b','bbc','ad','ac','aac'] copynamelist = ['b','bbc','ad','ac','aac'] idlist = [] for x in namelist: data = {} data["name"] = x x = CreateCategory(host, port, token, data) ret = x.send(timeout = 30) idlist.append(ret[1]["id"]) self.assertEqual(ret[0], 200) x = GetCategory(host, port, token) #test get a list of categories ret = x.send(timeout = 30) for name in ret[1]: self.assertTrue(name["name"] in namelist) copynamelist.remove(name["name"]) self.assertEqual(copynamelist, []) for id in idlist: x = DeleteCategory(host, port, token, id) ret = x.send(timeout=30) self.assertEqual(ret[0], 200) for id in idlist: x = GetCategory(host, port, token) x.setId(id) ret = x.send(timeout=30) self.assertEqual(ret[0], 404) #not found def usage(): print("category [-h host] [-p port] [-u username] [-w password]") def main(): try: opts, args = getopt.getopt(sys.argv[1:], "h:p:u:w:") except getopt.GetoptError as err: print(str(err)) usage() sys.exit(2) global host host = "127.0.0.1" global port port = 8000 global username username = None global password password = None for o, a in opts: if o == "-h": host = a elif o == "-p": port = int(a) elif o == "-u": username = a elif o == "-w": password = a else: assert False, "unhandled option" unittest.main(argv=[sys.argv[0]]) if __name__ == "__main__": main()
StarcoderdataPython
4840625
# -*- coding:utf-8 -*- # Copyright 2015 NEC Corporation. # # # # Licensed under the Apache License, Version 2.0 (the "License"); # # you may not use this file except in compliance with the License. # # You may obtain a copy of the License at # # # # http://www.apache.org/licenses/LICENSE-2.0 # # # # Unless required by applicable law or agreed to in writing, software # # distributed under the License is distributed on an "AS IS" BASIS, # # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # # See the License for the specific language governing permissions and # # limitations under the License. # from org.o3project.odenos.core.component.dummy_driver import DummyDriver from org.o3project.odenos.remoteobject.manager.system.component_connection_logic_and_network\ import ComponentConnectionLogicAndNetwork from org.o3project.odenos.remoteobject.manager.system.component_connection\ import ComponentConnection from org.o3project.odenos.core.util.system_manager_interface import ( SystemManagerInterface ) from org.o3project.odenos.core.component.network.packet.out_packet_added\ import OutPacketAdded from org.o3project.odenos.core.util.network_interface import NetworkInterface from org.o3project.odenos.core.component.network.flow.flow import Flow from org.o3project.odenos.remoteobject.message.event import Event from mock import Mock, patch import unittest from contextlib import nested class DummyDriverTest(unittest.TestCase): Dispatcher = Mock() Dispatcher.system_manager_id = "ObjectId1" Object_id = "ObjectId1" def setUp(self): self.target = DummyDriver(self.Object_id, self.Dispatcher) def tearDown(self): self.target = None def test_constructor(self): self.assertEqual(self.target._super_type, "Driver") self.assertEqual(self.target.dispatcher, self.Dispatcher) self.assertEqual(self.target.object_id, self.Object_id) self.assertEqual(self.target._DummyDriver__network_id, None) def test__connection_changed_added_pre_True(self): cclan = ComponentConnectionLogicAndNetwork("slicer1->network1", "original", "running", self.Object_id, "NetworkId") msg = Mock() msg.curr = cclan self.result = self.target._connection_changed_added_pre(msg) self.assertEqual(self.result, True) def test__connection_changed_delete_pre_True(self): cclan = ComponentConnectionLogicAndNetwork("slicer1->network1", "original", "running", self.Object_id, "NetworkId") msg = Mock() msg.prev = cclan self.result = self.target._connection_changed_delete_pre(msg) self.assertEqual(self.result, True) def test__connection_changed_added_pre_NotType_False(self): ComponentConnectioTmp = ComponentConnection("slicer1_network1", "original", "running") msg = Mock() msg.curr = ComponentConnectioTmp self.result = self.target._connection_changed_added_pre(msg) self.assertEqual(self.result, False) def test__connection_changed_delete_pre_NotType_False(self): ComponentConnectioTmp = ComponentConnection("slicer1_network1", "original", "running") msg = Mock() msg.prev = ComponentConnectioTmp self.result = self.target._connection_changed_delete_pre(msg) self.assertEqual(self.result, False) def test__connection_changed_added_pre_Notlogicid_False(self): cclan = ComponentConnectionLogicAndNetwork("slicer1->network1", "original", "running", "Logicid1", "NetworkId") msg = Mock() msg.curr = cclan self.result = self.target._connection_changed_added_pre(msg) self.assertEqual(self.result, False) def test__connection_changed_delete_pre_Notlogicid_False(self): cclan = ComponentConnectionLogicAndNetwork("slicer1->network1", "original", "running", "Logicid1", "NetworkId") msg = Mock() msg.prev = cclan self.result = self.target._connection_changed_delete_pre(msg) self.assertEqual(self.result, False) def test__connection_changed_added_pre_NotNoneNetworkid_False(self): cclan = ComponentConnectionLogicAndNetwork("slicer1->network1", "original", "running", self.Object_id, "NetworkId") msg = Mock() msg.curr = cclan self.target._DummyDriver__network_id = "NetworkId" with nested( patch('org.o3project.odenos.core.util.system_manager_interface.' 'SystemManagerInterface.put_connection' )) as m_put_connection: self.result = self.target._connection_changed_added_pre(msg) self.assertEqual(m_put_connection[0].call_count, 1) m_put_connection[0].assert_any_call(cclan) self.assertEqual(cclan.state, ComponentConnection.State.ERROR) self.assertEqual(self.result, False) def test_connection_changed_added(self): cclan = ComponentConnectionLogicAndNetwork("slicer1->network1", "original", "running", self.Object_id, "NetworkId") msg = Mock() msg.curr = cclan with nested( patch('org.o3project.odenos.core.component.dummy_driver.' 'DummyDriver._DummyDriver__subscribe_network_component' )) as m_subscribe_network_comp: self.assertEqual(self.target._DummyDriver__network_id, None) self.target._connection_changed_added(msg) self.assertEqual(self.target._DummyDriver__network_id, "NetworkId") self.assertEqual(m_subscribe_network_comp[0].call_count, 1) def test_connection_changed_delete(self): cclan = ComponentConnectionLogicAndNetwork("slicer1->network1", "original", "running", self.Object_id, "NetworkId") msg = Mock() msg.prev = cclan self.target._DummyDriver__network_id = "NetworkId" with nested( patch('org.o3project.odenos.core.util.system_manager_interface.' 'SystemManagerInterface.put_connection' ), patch('org.o3project.odenos.core.component.dummy_driver.' 'DummyDriver._DummyDriver__unsubscribe_network_component' )) as (m_put_connection, m_unsubscribe_network_comp): self.assertEqual(self.target._DummyDriver__network_id, "NetworkId") self.target._connection_changed_delete(msg) self.assertEqual(self.target._DummyDriver__network_id, None) self.assertEqual(m_unsubscribe_network_comp.call_count, 1) self.assertEqual(m_put_connection.call_count, 2) def test___subscribe_network_component(self): self.target._DummyDriver__network_id = "NetworkId" with nested( patch('org.o3project.odenos.core.component.logic.Logic.' '_add_event_subscription'), patch('org.o3project.odenos.core.component.logic.Logic.' '_update_event_subscription'), patch('org.o3project.odenos.remoteobject.remote_object.' 'RemoteObject._apply_event_subscription' )) as (m_add_event_subscription, m_update_event_subscription, m_apply_event_subscription): self.target._DummyDriver__subscribe_network_component() self.assertEqual(m_add_event_subscription.call_count, 2) m_add_event_subscription.assert_any_call("FlowChanged", "NetworkId") m_add_event_subscription.assert_any_call("OutPacketAdded", "NetworkId") self.assertEqual(m_update_event_subscription.call_count, 1) m_update_event_subscription.assert_any_call("FlowChanged", "NetworkId", attributes=[]) self.assertEqual(m_apply_event_subscription.call_count, 1) def test___unsubscribe_network_component(self): self.target._DummyDriver__network_id = "NetworkId" with nested( patch('org.o3project.odenos.core.component.logic.Logic.' '_remove_event_subscription'), patch('org.o3project.odenos.remoteobject.remote_object.' 'RemoteObject._apply_event_subscription' )) as (m_remove_event_subscription, m_apply_event_subscription): self.target._DummyDriver__unsubscribe_network_component() self.assertEqual(m_remove_event_subscription.call_count, 2) m_remove_event_subscription.assert_any_call("FlowChanged", "NetworkId") m_remove_event_subscription.assert_any_call("OutPacketAdded", "NetworkId") self.assertEqual(m_apply_event_subscription.call_count, 1) def test__on_flow_added_success(self): Dispatcher = Mock() Dispatcher.network_id = "NetworkId" Network_id = "NetworkId" flow_body1 = Flow("BasicFlow", "v01", "FlowId1", "Owner", True, 65535, "none", {}) flow_body2 = Flow("BasicFlow", "v01", "FlowId1", "Owner", True, 65535, "established", {}) self.target._network_interfaces["NetworkId"] =\ NetworkInterface(Dispatcher, Network_id) with nested( patch('org.o3project.odenos.core.util.network_interface.' 'NetworkInterface.get_flow', return_value=flow_body1), patch('org.o3project.odenos.core.util.network_interface.' 'NetworkInterface.put_flow' )) as (m_get_flow, m_put_flow): self.target._on_flow_added("NetworkId", flow_body2) self.assertEqual(m_get_flow.call_count, 2) m_get_flow.assert_any_call("FlowId1") self.assertEqual(m_put_flow.call_count, 2) m_put_flow.assert_any_call(flow_body1) self.assertEqual(flow_body1.status, "established") def test__on_flow_added_NotNetworkId(self): Dispatcher = Mock() Dispatcher.network_id = "NetworkId" Network_id = "NetworkId" flow_body1 = Flow("BasicFlow", "v01", "FlowId1", "Owner", True, 65535, "none", {}) flow_body2 = Flow("BasicFlow", "v01", "FlowId1", "Owner", True, 65535, "established", {}) self.target._network_interfaces["NetworkId"] =\ NetworkInterface(Dispatcher, Network_id) with nested( patch('org.o3project.odenos.core.util.network_interface.' 'NetworkInterface.get_flow', return_value=flow_body1), patch('org.o3project.odenos.core.util.network_interface.' 'NetworkInterface.put_flow' )) as (m_get_flow, m_put_flow): self.target._on_flow_added("NetworkId_dmy", flow_body2) self.assertEqual(m_get_flow.call_count, 0) self.assertEqual(m_put_flow.call_count, 0) self.assertEqual(flow_body1.status, "none") def test__on_flow_added_NoneTargetFlow(self): Dispatcher = Mock() Dispatcher.network_id = "NetworkId" Network_id = "NetworkId" flow_body1 = Flow("BasicFlow", "v01", "FlowId1", "Owner", True, 65535, "none", {}) flow_body2 = Flow("BasicFlow", "v01", "FlowId1", "Owner", True, 65535, "established", {}) self.target._network_interfaces["NetworkId"] =\ NetworkInterface(Dispatcher, Network_id) with nested( patch('org.o3project.odenos.core.util.network_interface.' 'NetworkInterface.get_flow', return_value=None), patch('org.o3project.odenos.core.util.network_interface.' 'NetworkInterface.put_flow' )) as (m_get_flow, m_put_flow): self.target._on_flow_added("NetworkId", flow_body2) self.assertEqual(m_get_flow.call_count, 1) m_get_flow.assert_any_call("FlowId1") self.assertEqual(m_put_flow.call_count, 0) self.assertEqual(flow_body1.status, "none") def test__on_flow_added_status_NotNone(self): Dispatcher = Mock() Dispatcher.network_id = "NetworkId" Network_id = "NetworkId" flow_body1 = Flow("BasicFlow", "v01", "FlowId1", "Owner", True, 65535, "establishing", {}) flow_body2 = Flow("BasicFlow", "v01", "FlowId1", "Owner", True, 65535, "established", {}) self.target._network_interfaces["NetworkId"] =\ NetworkInterface(Dispatcher, Network_id) with nested( patch('org.o3project.odenos.core.util.network_interface.' 'NetworkInterface.get_flow', return_value=flow_body1), patch('org.o3project.odenos.core.util.network_interface.' 'NetworkInterface.put_flow' )) as (m_get_flow, m_put_flow): self.target._on_flow_added("NetworkId", flow_body2) self.assertEqual(m_get_flow.call_count, 1) m_get_flow.assert_any_call("FlowId1") self.assertEqual(m_put_flow.call_count, 0) self.assertEqual(flow_body1.status, "establishing") def test__on_flow_added_enabled_False(self): Dispatcher = Mock() Dispatcher.network_id = "NetworkId" Network_id = "NetworkId" flow_body1 = Flow("BasicFlow", "v01", "FlowId1", "Owner", False, 65535, "none", {}) flow_body2 = Flow("BasicFlow", "v01", "FlowId1", "Owner", True, 65535, "established", {}) self.target._network_interfaces["NetworkId"] =\ NetworkInterface(Dispatcher, Network_id) with nested( patch('org.o3project.odenos.core.util.network_interface.' 'NetworkInterface.get_flow', return_value=flow_body1), patch('org.o3project.odenos.core.util.network_interface.' 'NetworkInterface.put_flow' )) as (m_get_flow, m_put_flow): self.target._on_flow_added("NetworkId", flow_body2) self.assertEqual(m_get_flow.call_count, 1) m_get_flow.assert_any_call("FlowId1") self.assertEqual(m_put_flow.call_count, 0) self.assertEqual(flow_body1.status, "none") def test__on_flow_update(self): Curr = Mock() Prev = Mock() Attrs = {} with nested( patch('org.o3project.odenos.core.component.dummy_driver.' 'DummyDriver._on_flow_added' )) as m_on_flow_added: self.target._on_flow_update("NetworkId", Prev, Curr, Attrs) self.assertEqual(m_on_flow_added[0].call_count, 1) m_on_flow_added[0].assert_any_call("NetworkId", Curr) def test__on_flow_delete_success(self): Dispatcher = Mock() Dispatcher.network_id = "NetworkId" Network_id = "NetworkId" flow_body1 = Flow("BasicFlow", "v01", "FlowId1", "Owner", True, 65535, "established", {}) flow_body2 = Flow("BasicFlow", "v01", "FlowId1", "Owner", True, 65535, "established", {}) self.target._network_interfaces["NetworkId"] =\ NetworkInterface(Dispatcher, Network_id) with nested( patch('org.o3project.odenos.core.util.network_interface.' 'NetworkInterface.get_flow', return_value=flow_body1), patch('org.o3project.odenos.core.util.network_interface.' 'NetworkInterface.put_flow' )) as (m_get_flow, m_put_flow): self.target._on_flow_delete("NetworkId", flow_body2) self.assertEqual(m_get_flow.call_count, 2) m_get_flow.assert_any_call("FlowId1") self.assertEqual(m_put_flow.call_count, 2) m_put_flow.assert_any_call(flow_body1) self.assertEqual(flow_body1.status, "none") def test__on_flow_delete_NotNetworkId(self): Dispatcher = Mock() Dispatcher.network_id = "NetworkId" Network_id = "NetworkId" flow_body1 = Flow("BasicFlow", "v01", "FlowId1", "Owner", True, 65535, "established", {}) flow_body2 = Flow("BasicFlow", "v01", "FlowId1", "Owner", True, 65535, "established", {}) self.target._network_interfaces["NetworkId"] =\ NetworkInterface(Dispatcher, Network_id) with nested( patch('org.o3project.odenos.core.util.network_interface.' 'NetworkInterface.get_flow', return_value=flow_body1), patch('org.o3project.odenos.core.util.network_interface.' 'NetworkInterface.put_flow' )) as (m_get_flow, m_put_flow): self.target._on_flow_delete("NetworkId_dmy", flow_body2) self.assertEqual(m_get_flow.call_count, 0) self.assertEqual(m_put_flow.call_count, 0) self.assertEqual(flow_body1.status, "established") def test__on_flow_delete_NoneTargetFlow(self): Dispatcher = Mock() Dispatcher.network_id = "NetworkId" Network_id = "NetworkId" flow_body1 = Flow("BasicFlow", "v01", "FlowId1", "Owner", True, 65535, "established", {}) flow_body2 = Flow("BasicFlow", "v01", "FlowId1", "Owner", True, 65535, "established", {}) self.target._network_interfaces["NetworkId"] =\ NetworkInterface(Dispatcher, Network_id) with nested( patch('org.o3project.odenos.core.util.network_interface.' 'NetworkInterface.get_flow', return_value=None), patch('org.o3project.odenos.core.util.network_interface.' 'NetworkInterface.put_flow' )) as (m_get_flow, m_put_flow): self.target._on_flow_delete("NetworkId", flow_body2) self.assertEqual(m_get_flow.call_count, 1) m_get_flow.assert_any_call("FlowId1") self.assertEqual(m_put_flow.call_count, 0) self.assertEqual(flow_body1.status, "established") def test__on_flow_delete_status_NotEstablished(self): Dispatcher = Mock() Dispatcher.network_id = "NetworkId" Network_id = "NetworkId" flow_body1 = Flow("BasicFlow", "v01", "FlowId1", "Owner", True, 65535, "none", {}) flow_body2 = Flow("BasicFlow", "v01", "FlowId1", "Owner", True, 65535, "established", {}) self.target._network_interfaces["NetworkId"] =\ NetworkInterface(Dispatcher, Network_id) with nested( patch('org.o3project.odenos.core.util.network_interface.' 'NetworkInterface.get_flow', return_value=flow_body1), patch('org.o3project.odenos.core.util.network_interface.' 'NetworkInterface.put_flow' )) as (m_get_flow, m_put_flow): self.target._on_flow_delete("NetworkId", flow_body2) self.assertEqual(m_get_flow.call_count, 1) m_get_flow.assert_any_call("FlowId1") self.assertEqual(m_put_flow.call_count, 0) self.assertEqual(flow_body1.status, "none") def test__on_flow_delete_enabled_False(self): Dispatcher = Mock() Dispatcher.network_id = "NetworkId" Network_id = "NetworkId" flow_body1 = Flow("BasicFlow", "v01", "FlowId1", "Owner", False, 65535, "none", {}) flow_body2 = Flow("BasicFlow", "v01", "FlowId1", "Owner", True, 65535, "established", {}) self.target._network_interfaces["NetworkId"] =\ NetworkInterface(Dispatcher, Network_id) with nested( patch('org.o3project.odenos.core.util.network_interface.' 'NetworkInterface.get_flow', return_value=flow_body1), patch('org.o3project.odenos.core.util.network_interface.' 'NetworkInterface.put_flow' )) as (m_get_flow, m_put_flow): self.target._on_flow_delete("NetworkId", flow_body2) self.assertEqual(m_get_flow.call_count, 1) m_get_flow.assert_any_call("FlowId1") self.assertEqual(m_put_flow.call_count, 0) self.assertEqual(flow_body1.status, "none") def test__do_event_outpacketadded_success(self): Dispatcher = Mock() Dispatcher.network_id = "NetworkId" Network_id = "NetworkId" Evbody = {"id": "OutPacketId1"} Event1 = Event("NetworkId", "OutPacketAdded", Evbody) Event_packed = OutPacketAdded.create_from_packed(Evbody) self.target._network_interfaces["NetworkId"] =\ NetworkInterface(Dispatcher, Network_id) with nested( patch('org.o3project.odenos.core.component.network.packet.' 'out_packet_added.OutPacketAdded.create_from_packed', return_value=Event_packed), patch('org.o3project.odenos.core.util.network_interface.' 'NetworkInterface.del_out_packet'), patch('logging.error' )) as (m_create_from_packed, m_del_out_packet, m_logerror): self.target._do_event_outpacketadded(Event1) self.assertEqual(m_create_from_packed.call_count, 1) m_create_from_packed.assert_any_call(Evbody) self.assertEqual(m_del_out_packet.call_count, 1) m_del_out_packet.assert_any_call("OutPacketId1") self.assertEqual(m_logerror.call_count, 0) def test__do_event_outpacketadded_create_from_packed_error(self): Dispatcher = Mock() Dispatcher.network_id = "NetworkId" Network_id = "NetworkId" Evbody = {"id": "OutPacketId1"} Event1 = Event("NetworkId", "OutPacketAdded", Evbody) self.target._network_interfaces["NetworkId"] =\ NetworkInterface(Dispatcher, Network_id) debug_log = "Receive Invalid OutPacketAdded Message"\ + " KeyError: " + "1" with nested( patch('org.o3project.odenos.core.component.network.packet.' 'out_packet_added.OutPacketAdded.create_from_packed', side_effect=KeyError(1)), patch('org.o3project.odenos.core.util.network_interface.' 'NetworkInterface.del_out_packet'), patch('logging.error' )) as (m_create_from_packed, m_del_out_packet, m_logerror): self.target._do_event_outpacketadded(Event1) self.assertEqual(m_create_from_packed.call_count, 1) m_create_from_packed.assert_any_call(Evbody) self.assertEqual(m_del_out_packet.call_count, 0) self.assertEqual(m_logerror.call_count, 1) m_logerror.assert_any_call(debug_log) def test__do_event_outpacketadded_NotNetworkId(self): Dispatcher = Mock() Dispatcher.network_id = "NetworkId" Network_id = "NetworkId" Evbody = {"id": "OutPacketId1"} Event1 = Event("NetworkId_dmy", "OutPacketAdded", Evbody) Event_packed = OutPacketAdded.create_from_packed(Evbody) self.target._network_interfaces[Network_id] =\ NetworkInterface(Dispatcher, Network_id) with nested( patch('org.o3project.odenos.core.component.network.packet.' 'out_packet_added.OutPacketAdded.create_from_packed', return_value=Event_packed), patch('org.o3project.odenos.core.util.network_interface.' 'NetworkInterface.del_out_packet'), patch('logging.error' )) as (m_create_from_packed, m_del_out_packet, m_logerror): self.target._do_event_outpacketadded(Event1) self.assertEqual(m_create_from_packed.call_count, 1) m_create_from_packed.assert_any_call(Evbody) self.assertEqual(m_del_out_packet.call_count, 0) self.assertEqual(m_logerror.call_count, 0) if __name__ == '__main__': unittest.main()
StarcoderdataPython
1791990
import smtplib import src.irulez.log as log import src.irulez.util as util from abc import ABC, abstractmethod logger = log.get_logger('mail_processor') class MailProcessor(ABC): @abstractmethod def send_mail(self, json_object) -> None: pass class AuthenticateSMTPProcessor(MailProcessor): def __init__(self, user: object, pwd: object, port: object, url: object): self.gmail_user = user self.gmail_pwd = <PASSWORD> self._from = user self.port = port self.url = url def send_mail(self, payload: str) -> None: json_object = util.deserialize_json(payload) recipient = json_object['mails'] to = recipient if type(recipient) is list else [recipient] subject = json_object['subject'] body = json_object['message'] # Prepare actual message message = """From: %s\nTo: %s\nSubject: %s\n\n%s """ % (self._from, ", ".join(to), subject, body) try: server = smtplib.SMTP(self.url, self.port) server.ehlo() server.starttls() server.login(self.gmail_user, self.gmail_pwd) server.sendmail(self._from, to, message) server.close() logger.info(f"successfully sent the mail") except: logger.warning(f"failed to send mail")
StarcoderdataPython
64120
from math import trunc numero = float(input('Digite um numero inteiro: ')) print('O valor digitado foi {} e a sua porção inteira é {}'.format(numero, trunc(numero))) ''' int (numero) => tambem funciona para estrair um inteiro '''
StarcoderdataPython
197820
<reponame>peanutbutter144/nixpkgs<gh_stars>100-1000 # Ugliest Python code I've ever written. -- aszlig import sys def get_plist(path): in_pack = False in_str = False current_key = None buf = "" packages = {} package_name = None package_attrs = {} with open(path, 'r') as setup: for line in setup: if in_str and line.rstrip().endswith('"'): package_attrs[current_key] = buf + line.rstrip()[:-1] in_str = False continue elif in_str: buf += line continue if line.startswith('@'): in_pack = True package_name = line[1:].strip() package_attrs = {} elif in_pack and ':' in line: key, value = line.split(':', 1) if value.lstrip().startswith('"'): if value.lstrip()[1:].rstrip().endswith('"'): value = value.strip().strip('"') else: in_str = True current_key = key.strip().lower() buf = value.lstrip()[1:] continue package_attrs[key.strip().lower()] = value.strip() elif in_pack: in_pack = False packages[package_name] = package_attrs return packages def main(): packages = get_plist(sys.argv[1]) to_include = set() def traverse(package): to_include.add(package) attrs = packages.get(package, {}) deps = attrs.get('requires', '').split() for new_dep in set(deps) - to_include: traverse(new_dep) map(traverse, sys.argv[2:]) sys.stdout.write('[\n') for package, attrs in packages.iteritems(): if package not in to_include: cats = [c.lower() for c in attrs.get('category', '').split()] if 'base' not in cats: continue install_line = attrs.get('install') if install_line is None: continue url, size, hash = install_line.split(' ', 2) pack = [ ' {', ' url = "{0}";'.format(url), ' hash = "{0}";'.format(hash), ' }', ]; sys.stdout.write('\n'.join(pack) + '\n') sys.stdout.write(']\n') if __name__ == '__main__': main()
StarcoderdataPython
3275213
<reponame>lanargh/FaceMaskDetection<filename>utils.py<gh_stars>0 import os import random from os.path import basename from shutil import copyfile from zipfile import ZipFile def genlabels(labels): f = open("labels.txt","w+") f.write("__ignore__\r\n") f.write("_background_\r\n") for label in labels: f.write(label + "\r\n") f.close() def splitdata(input_folder, output_folder, train_size = 0.8): if not os.path.exists(output_folder + '/train'): train_dir = output_folder + '/train' os.makedirs(train_dir) if not os.path.exists(output_folder + '/validation'): val_dir = output_folder + '/validation' os.makedirs(val_dir) train_counter = 0 validation_counter = 0 # Randomly assign an image to train or validation folder for filename in os.listdir(input_folder): if filename.endswith(".png"): filetypes = ["json", "png"] fileparts = filename.split('.') if random.uniform(0, 1) <= train_size: copyfile(os.path.join(input_folder, fileparts[0] + "." + filetypes[0]), os.path.join(train_dir, str(train_counter) + '.' + filetypes[0])) copyfile(os.path.join(input_folder, filename), os.path.join(train_dir, str(train_counter) + '.' + filetypes[1])) train_counter += 1 else: copyfile(os.path.join(input_folder, fileparts[0] + "." + filetypes[0]), os.path.join(val_dir, str(validation_counter) + '.' + filetypes[0])) copyfile(os.path.join(input_folder, filename), os.path.join(val_dir, str(validation_counter) + '.' + filetypes[1])) validation_counter += 1 print('Copied ' + str(train_counter) + ' images to ' + train_dir) print('Copied ' + str(validation_counter) + ' images to ' + val_dir) def compress(folder_name, zip_name): with ZipFile(zip_name + ".zip", "w") as zipObj: for folderName, subfolders, filenames in os.walk(folder_name): for filename in filenames: filePath = os.path.join(folderName, filename) zipObj.write(filePath, basename(filePath))
StarcoderdataPython
3202951
import os import pytest from intervaltree import Interval from viridian_workflow import self_qc, primers this_dir = os.path.dirname(os.path.abspath(__file__)) data_dir = os.path.join(this_dir, "data", "primers") class StatsTest: def __init__(self, fail): self.fail = fail self.log = [] self.config = self_qc.default_config def check_for_failure(self, **kwargs): return self.fail def test_cigar_tuple_construction(): ref = "AAA" query = "AAA" cigar = [ (3, 0), ] assert self_qc.cigar_to_alts(ref, query, cigar) == [(0, "A"), (1, "A"), (2, "A")] ref = "AAA" query = "ATTAA" cigar = [(1, 0), (2, 1), (2, 0)] assert self_qc.cigar_to_alts(ref, query, cigar) == [ (0, "A"), # (1, "TT"), (1, "A"), (2, "A"), ] ref = "ATTAA" query = "AAA" cigar = [(1, 0), (2, 2), (2, 0)] assert self_qc.cigar_to_alts(ref, query, cigar) == [ (0, "A"), (1, "-"), (2, "-"), (3, "A"), (4, "A"), ] ref = "ATTAA" query = "AAA" cigar = [(0, 1), (2, 2), (0, 2)] assert self_qc.cigar_to_alts(ref, query, cigar, pysam=True) == [ (0, "A"), (1, "-"), (2, "-"), (3, "A"), (4, "A"), ] ref = "AAAA" query = "GGGAAAA" cigar = [(3, 4), (4, 0)] assert self_qc.cigar_to_alts(ref, query, cigar, q_pos=3) == [ (0, "A"), (1, "A"), (2, "A"), (3, "A"), ] def test_mappy_cigar_liftover(): amplicon = primers.Amplicon("test_amplicon") seq = "CTTCAGGTGATGGCACAACAAGTCCTATTTGAACATAGACTCACGAGATTGCGGTTATACTTTCGAAAATGGGAATCTGGAGTAAAAGACTAAAGTTAGATACACAGTTGCTTCACTTCAGACTATTACCAGCTGTACTCAACTCAATTGAGTACAGACACTGGTGTTGAACATGTGCCATCTTCTTCATCTACAATAAAATTGTTGATGAGCCTGAAGAACATGGTCCAATTCACACAACGACGGTTCATCCGGAGTTGTTAATCCAGTAATGGAACCAATTTATGATGAACCGACGACGACTACTAGCGTGCCTTTGTGTTACTCAAGCTGATGAGTACGAACTTATGTACTCATTCGTTTCGGGAAGAGACAGGTACGTTAATAGTTAATAGCGTACTTCTTTTTCTTGCTTTCGT" cigar = [ (4, 32), (0, 29), (2, 2), (0, 7), (1, 1), (0, 4), (1, 1), (0, 8), (2, 1), (0, 11), (1, 3), (0, 1), (2, 1), (0, 26), (1, 1), (0, 8), (2, 1), (0, 76), (1, 2), (0, 46), (1, 1), (0, 4), (2, 1), (0, 11), (2, 1), (0, 77), (1, 2), (0, 5), (2, 1), (0, 40), (1, 1), (0, 54), (4, 70), ] self_qc.cigar_to_alts(seq, seq, cigar, pysam=True) def test_bias_test(): return True # TODO resolve assert not self_qc.test_bias(10, 100, threshold=0.3) assert not self_qc.test_bias(90, 100, threshold=0.3) assert self_qc.test_bias(40, 100, threshold=0.3) assert self_qc.test_bias(60, 100, threshold=0.3) def test_stat_evaluation(): return True # resolve fwd = self_qc.BaseProfile(False, True, "test_amplicon1") rev = self_qc.BaseProfile(False, False, "test_amplicon2") # 20% alt alleles pileup20 = ["A", "A", "C", "T", "A", "A", "A", "A", "A", "A"] # 0% alt alleles pileup0 = ["A", "A", "A", "A", "A", "A", "A", "A", "A", "A"] # 100% alt alleles pileup100 = ["T", "T", "T", "G", "G", "G", "T", "G", "C", "C"] stats = self_qc.Stats() for base in pileup20: if base != "A": stats.add_alt(fwd) stats.add_alt(rev) else: stats.add_ref(fwd) stats.add_ref(rev) assert stats.check_for_failure(bias_threshold=0.3) def test_masking(): fail = StatsTest(True) succeed = StatsTest(False) sequence = "ATCATC" stats = {0: succeed, 4: fail} masked, _ = self_qc.mask_sequence(sequence, stats) assert masked == "ATCANC" sequence = "ATCATC" stats = {0: fail, 4: fail} masked, _ = self_qc.mask_sequence(sequence, stats) assert masked == "NTCANC"
StarcoderdataPython
3317368
This is file3.
StarcoderdataPython
109387
from django.core.management.base import BaseCommand from account.utils import send_bulk_reminders class Command(BaseCommand): help = 'Send reminders to users who have not signed in today' def handle(self, *args, **options): self.stdout.write('Preparing to send reminder emails...') send_bulk_reminders() self.stdout.write('Successfully sent reminders')
StarcoderdataPython
1785362
<filename>projects/src/main/python/CodeJam/Y11R5P1/dennislissov/generated_py_bb93a4d1acf540c3b7c8dfd80359bd28.py import sys sys.path.append('/home/george2/Raise/ProgramRepair/CodeSeer/projects/src/main/python') from CodeJam.Y11R5P1.dennislissov.A import * def func_3ba6780ca418469a885da55554034725(y, x): area += (x - px) * (y + py) / 2 px, py = x, y return py def func_16bfa03b301e43139f8f644e5e7cbce6(y, x): area += (x - px) * (y + py) / 2 px, py = x, y return area def func_5726577868614ce7b084d034f2376af6(y, x): area += (x - px) * (y + py) / 2 px, py = x, y return px def func_dabbc99813184aeea69a2f2d636dea55(ax, px, py): y = py + (y - py) / (x - px) * (ax - px) x = ax return x def func_d0b5903d9cd747d2b4b964585933d19f(ax, px, py): y = py + (y - py) / (x - px) * (ax - px) x = ax return y def func_5e4c1430509d4af995186639565f815e(): px = 0 py = 0 return px def func_1ca08860d10b4cf8aedded11e9dffb1a(): px = 0 py = 0 return py def func_95288f9c7bff4bf682e6cf6ba68a8ba9(): py = 0 area = 0 return py def func_f0ab3dbecaef42e5be66cbfb734b7890(): py = 0 area = 0 return area def func_f2b586b319aa4cb98bfb783ddd7addcb(Y, X, ax): area = 0 for x, y in zip(X, Y): if x == px: px, py = x, y continue if ax < x: y = py + (y - py) / (x - px) * (ax - px) x = ax area += (x - px) * (y + py) / 2 px, py = x, y if x == ax: break return px def func_23ca7fa984f94fb3bfd7a107f4210e78(Y, X, ax): area = 0 for x, y in zip(X, Y): if x == px: px, py = x, y continue if ax < x: y = py + (y - py) / (x - px) * (ax - px) x = ax area += (x - px) * (y + py) / 2 px, py = x, y if x == ax: break return x def func_214e65bd98004678b3eeba446027da4f(Y, X, ax): area = 0 for x, y in zip(X, Y): if x == px: px, py = x, y continue if ax < x: y = py + (y - py) / (x - px) * (ax - px) x = ax area += (x - px) * (y + py) / 2 px, py = x, y if x == ax: break return y def func_daf1c94df0584af692b5f4bcea188648(Y, X, ax): area = 0 for x, y in zip(X, Y): if x == px: px, py = x, y continue if ax < x: y = py + (y - py) / (x - px) * (ax - px) x = ax area += (x - px) * (y + py) / 2 px, py = x, y if x == ax: break return area def func_b759ad0d09e94f0ca1ec6405fa944e58(Y, X, ax): area = 0 for x, y in zip(X, Y): if x == px: px, py = x, y continue if ax < x: y = py + (y - py) / (x - px) * (ax - px) x = ax area += (x - px) * (y + py) / 2 px, py = x, y if x == ax: break return py def func_9ed2c74c0e6244e4ab8a4f0968336c03(area, ax, px, py): if ax < x: y = py + (y - py) / (x - px) * (ax - px) x = ax return area def func_970a7c8ba3704e9491127e3947e0f97b(): px = 0 py = 0 area = 0 return px def func_92b324bab0d74577a806743dce7beb52(): px = 0 py = 0 area = 0 return area def func_e87e2a34f8cf4dd4aac49c50a0e53958(): px = 0 py = 0 area = 0 return py def func_0697bf4db790456998f4524105458519(Y, X, ax): py = 0 area = 0 for x, y in zip(X, Y): if x == px: px, py = x, y continue if ax < x: y = py + (y - py) / (x - px) * (ax - px) x = ax area += (x - px) * (y + py) / 2 px, py = x, y if x == ax: break return py def func_6f78f82a300f490c91a7d12da591655e(Y, X, ax): py = 0 area = 0 for x, y in zip(X, Y): if x == px: px, py = x, y continue if ax < x: y = py + (y - py) / (x - px) * (ax - px) x = ax area += (x - px) * (y + py) / 2 px, py = x, y if x == ax: break return x def func_9faf09f55d8547e697b03888eb6faad5(Y, X, ax): py = 0 area = 0 for x, y in zip(X, Y): if x == px: px, py = x, y continue if ax < x: y = py + (y - py) / (x - px) * (ax - px) x = ax area += (x - px) * (y + py) / 2 px, py = x, y if x == ax: break return y def func_8d0048a94dd640f9ae614473ce1fa916(Y, X, ax): py = 0 area = 0 for x, y in zip(X, Y): if x == px: px, py = x, y continue if ax < x: y = py + (y - py) / (x - px) * (ax - px) x = ax area += (x - px) * (y + py) / 2 px, py = x, y if x == ax: break return area def func_557dcb3fb31b4f728f8a7bdca9e3e339(Y, X, ax): py = 0 area = 0 for x, y in zip(X, Y): if x == px: px, py = x, y continue if ax < x: y = py + (y - py) / (x - px) * (ax - px) x = ax area += (x - px) * (y + py) / 2 px, py = x, y if x == ax: break return px def func_b00db3e3d55f476597b206c0f54ca686(Y, X, ax): px = 0 py = 0 area = 0 for x, y in zip(X, Y): if x == px: px, py = x, y continue if ax < x: y = py + (y - py) / (x - px) * (ax - px) x = ax area += (x - px) * (y + py) / 2 px, py = x, y if x == ax: break return py def func_9796002a7e484de685cf089d82775124(Y, X, ax): px = 0 py = 0 area = 0 for x, y in zip(X, Y): if x == px: px, py = x, y continue if ax < x: y = py + (y - py) / (x - px) * (ax - px) x = ax area += (x - px) * (y + py) / 2 px, py = x, y if x == ax: break return y def func_25a25b6a067440b8abb0cda23274198e(Y, X, ax): px = 0 py = 0 area = 0 for x, y in zip(X, Y): if x == px: px, py = x, y continue if ax < x: y = py + (y - py) / (x - px) * (ax - px) x = ax area += (x - px) * (y + py) / 2 px, py = x, y if x == ax: break return area def func_7b65d97fa3534bcdbedbcad451839552(Y, X, ax): px = 0 py = 0 area = 0 for x, y in zip(X, Y): if x == px: px, py = x, y continue if ax < x: y = py + (y - py) / (x - px) * (ax - px) x = ax area += (x - px) * (y + py) / 2 px, py = x, y if x == ax: break return x def func_f36584730d6b46698e631ec2eaf1e0f6(Y, X, ax): px = 0 py = 0 area = 0 for x, y in zip(X, Y): if x == px: px, py = x, y continue if ax < x: y = py + (y - py) / (x - px) * (ax - px) x = ax area += (x - px) * (y + py) / 2 px, py = x, y if x == ax: break return px def func_c8e909b1d8ef45bb81720100de8be90b(ncase, infile): print('Case #{nc}'.format(nc=ncase + 1)) W, L, U, G = (int(s) for s in infile.readline().split()) return W def func_9faea165cee94f6aa49cf54e20f95a12(ncase, infile): print('Case #{nc}'.format(nc=ncase + 1)) W, L, U, G = (int(s) for s in infile.readline().split()) return G def func_e80907eba6cf46c6a8137886b8e2c14c(ncase, infile): print('Case #{nc}'.format(nc=ncase + 1)) W, L, U, G = (int(s) for s in infile.readline().split()) return L def func_f75d55cd2b1b409db59d7afe7c13087f(ncase, infile): print('Case #{nc}'.format(nc=ncase + 1)) W, L, U, G = (int(s) for s in infile.readline().split()) return s def func_c9bb9573097a4c6aae46b4a2cc64276f(ncase, infile): print('Case #{nc}'.format(nc=ncase + 1)) W, L, U, G = (int(s) for s in infile.readline().split()) return U def func_9f3ec1b85566455a95126385cf4e1f6c(Lp, infile): W, L, U, G = (int(s) for s in infile.readline().split()) Lp = [[int(s) for s in infile.readline().split()] for i in xrange(L)] return i def func_36e0888b67d74a9399f251b686416a94(Lp, infile): W, L, U, G = (int(s) for s in infile.readline().split()) Lp = [[int(s) for s in infile.readline().split()] for i in xrange(L)] return G def func_d81dfa3ea87e4bd0993037f02057bfab(Lp, infile): W, L, U, G = (int(s) for s in infile.readline().split()) Lp = [[int(s) for s in infile.readline().split()] for i in xrange(L)] return U def func_c2dec506230345dd97211ee64cb98359(Lp, infile): W, L, U, G = (int(s) for s in infile.readline().split()) Lp = [[int(s) for s in infile.readline().split()] for i in xrange(L)] return L def func_7aac99e646d94133aa7e23ab7bf64166(Lp, infile): W, L, U, G = (int(s) for s in infile.readline().split()) Lp = [[int(s) for s in infile.readline().split()] for i in xrange(L)] return W def func_b5c4f36135cf44ed877f852a51ed28df(Lp, infile): W, L, U, G = (int(s) for s in infile.readline().split()) Lp = [[int(s) for s in infile.readline().split()] for i in xrange(L)] return s def func_3cf08fece0a440de9549151f95996078(Ly, Uy, X): Y = Uy - Ly area = sum((Y[1:] + Y[:-1]) / 2 * (X[1:] - X[:-1])) return area def func_2d7c562e9b0148198e7fde596a113ed2(Ly, Uy, X): Y = Uy - Ly area = sum((Y[1:] + Y[:-1]) / 2 * (X[1:] - X[:-1])) return Y def func_659622b0340743c88c95b497a41a557d(Y, X): area = sum((Y[1:] + Y[:-1]) / 2 * (X[1:] - X[:-1])) def cumul_area(ax): px = 0 py = 0 area = 0 for x, y in zip(X, Y): if x == px: px, py = x, y continue if ax < x: y = py + (y - py) / (x - px) * (ax - px) x = ax area += (x - px) * (y + py) / 2 px, py = x, y if x == ax: break return area return area def func_396e1081307e40ce8f745bd0f137bf1e(Y, X, G): def cumul_area(ax): px = 0 py = 0 area = 0 for x, y in zip(X, Y): if x == px: px, py = x, y continue if ax < x: y = py + (y - py) / (x - px) * (ax - px) x = ax area += (x - px) * (y + py) / 2 px, py = x, y if x == ax: break return area NAs = np.arange(1, G, dtype='float') * area / G return NAs def func_eb77d078893e4f8aa2e7bdbe0984a0d0(Y, X, G): def cumul_area(ax): px = 0 py = 0 area = 0 for x, y in zip(X, Y): if x == px: px, py = x, y continue if ax < x: y = py + (y - py) / (x - px) * (ax - px) x = ax area += (x - px) * (y + py) / 2 px, py = x, y if x == ax: break return area NAs = np.arange(1, G, dtype='float') * area / G return area def func_beb781dcbb554bf2aebc9aa2f7370eae(area, W, G): NAs = np.arange(1, G, dtype='float') * area / G points = [bisect(lambda x: cumul_area(x) - NA, 0, W) for NA in NAs] return NA def func_243ebc5672064a3f94074f635acf6021(area, W, G): NAs = np.arange(1, G, dtype='float') * area / G points = [bisect(lambda x: cumul_area(x) - NA, 0, W) for NA in NAs] return NAs def func_4df8196ffbfc4d768e65e55a8edab4eb(area, W, G): NAs = np.arange(1, G, dtype='float') * area / G points = [bisect(lambda x: cumul_area(x) - NA, 0, W) for NA in NAs] return points def func_f54dac81ea4543c2a1e561ea5ae647af(Lp, ncase, infile): print('Case #{nc}'.format(nc=ncase + 1)) W, L, U, G = (int(s) for s in infile.readline().split()) Lp = [[int(s) for s in infile.readline().split()] for i in xrange(L)] return W def func_03f0a47b81f54349894ae80e3df364cc(Lp, ncase, infile): print('Case #{nc}'.format(nc=ncase + 1)) W, L, U, G = (int(s) for s in infile.readline().split()) Lp = [[int(s) for s in infile.readline().split()] for i in xrange(L)] return U def func_c6a0c02b9aa94adcae8667d220d24ee3(Lp, ncase, infile): print('Case #{nc}'.format(nc=ncase + 1)) W, L, U, G = (int(s) for s in infile.readline().split()) Lp = [[int(s) for s in infile.readline().split()] for i in xrange(L)] return s def func_2114f611135a404083fa23b8de1119d5(Lp, ncase, infile): print('Case #{nc}'.format(nc=ncase + 1)) W, L, U, G = (int(s) for s in infile.readline().split()) Lp = [[int(s) for s in infile.readline().split()] for i in xrange(L)] return L def func_02054700d55544478b42e9b9e89ac0ca(Lp, ncase, infile): print('Case #{nc}'.format(nc=ncase + 1)) W, L, U, G = (int(s) for s in infile.readline().split()) Lp = [[int(s) for s in infile.readline().split()] for i in xrange(L)] return G def func_947c0533be5744958f4bfe8f064a2a61(Lp, ncase, infile): print('Case #{nc}'.format(nc=ncase + 1)) W, L, U, G = (int(s) for s in infile.readline().split()) Lp = [[int(s) for s in infile.readline().split()] for i in xrange(L)] return i def func_154098a41bec4dfdb03c4488e331d346(Ly, Uy, X): Y = Uy - Ly area = sum((Y[1:] + Y[:-1]) / 2 * (X[1:] - X[:-1])) def cumul_area(ax): px = 0 py = 0 area = 0 for x, y in zip(X, Y): if x == px: px, py = x, y continue if ax < x: y = py + (y - py) / (x - px) * (ax - px) x = ax area += (x - px) * (y + py) / 2 px, py = x, y if x == ax: break return area return area def func_119cdf377a34446489b65815cb8fa1b0(Ly, Uy, X): Y = Uy - Ly area = sum((Y[1:] + Y[:-1]) / 2 * (X[1:] - X[:-1])) def cumul_area(ax): px = 0 py = 0 area = 0 for x, y in zip(X, Y): if x == px: px, py = x, y continue if ax < x: y = py + (y - py) / (x - px) * (ax - px) x = ax area += (x - px) * (y + py) / 2 px, py = x, y if x == ax: break return area return Y def func_9e28664f45ad426ea5464abb2c10bdda(Y, X, G): area = sum((Y[1:] + Y[:-1]) / 2 * (X[1:] - X[:-1])) def cumul_area(ax): px = 0 py = 0 area = 0 for x, y in zip(X, Y): if x == px: px, py = x, y continue if ax < x: y = py + (y - py) / (x - px) * (ax - px) x = ax area += (x - px) * (y + py) / 2 px, py = x, y if x == ax: break return area NAs = np.arange(1, G, dtype='float') * area / G return NAs def func_83c5c4d9fce24768b443d8707779be7a(Y, X, G): area = sum((Y[1:] + Y[:-1]) / 2 * (X[1:] - X[:-1])) def cumul_area(ax): px = 0 py = 0 area = 0 for x, y in zip(X, Y): if x == px: px, py = x, y continue if ax < x: y = py + (y - py) / (x - px) * (ax - px) x = ax area += (x - px) * (y + py) / 2 px, py = x, y if x == ax: break return area NAs = np.arange(1, G, dtype='float') * area / G return area def func_b8d2303212d1411abe8f1b7731b8c215(Y, X, W, G): def cumul_area(ax): px = 0 py = 0 area = 0 for x, y in zip(X, Y): if x == px: px, py = x, y continue if ax < x: y = py + (y - py) / (x - px) * (ax - px) x = ax area += (x - px) * (y + py) / 2 px, py = x, y if x == ax: break return area NAs = np.arange(1, G, dtype='float') * area / G points = [bisect(lambda x: cumul_area(x) - NA, 0, W) for NA in NAs] return area def func_786c6689b60a439982c75bc980c41591(Y, X, W, G): def cumul_area(ax): px = 0 py = 0 area = 0 for x, y in zip(X, Y): if x == px: px, py = x, y continue if ax < x: y = py + (y - py) / (x - px) * (ax - px) x = ax area += (x - px) * (y + py) / 2 px, py = x, y if x == ax: break return area NAs = np.arange(1, G, dtype='float') * area / G points = [bisect(lambda x: cumul_area(x) - NA, 0, W) for NA in NAs] return points def func_2ca12634fb254c38be3999190921e11c(Y, X, W, G): def cumul_area(ax): px = 0 py = 0 area = 0 for x, y in zip(X, Y): if x == px: px, py = x, y continue if ax < x: y = py + (y - py) / (x - px) * (ax - px) x = ax area += (x - px) * (y + py) / 2 px, py = x, y if x == ax: break return area NAs = np.arange(1, G, dtype='float') * area / G points = [bisect(lambda x: cumul_area(x) - NA, 0, W) for NA in NAs] return NA def func_933ba58dabc946cab8d749e628cb13f8(Y, X, W, G): def cumul_area(ax): px = 0 py = 0 area = 0 for x, y in zip(X, Y): if x == px: px, py = x, y continue if ax < x: y = py + (y - py) / (x - px) * (ax - px) x = ax area += (x - px) * (y + py) / 2 px, py = x, y if x == ax: break return area NAs = np.arange(1, G, dtype='float') * area / G points = [bisect(lambda x: cumul_area(x) - NA, 0, W) for NA in NAs] return NAs def func_5032443b55fc49c386c19c4f27d8d31f(Ly, Uy, X, G): Y = Uy - Ly area = sum((Y[1:] + Y[:-1]) / 2 * (X[1:] - X[:-1])) def cumul_area(ax): px = 0 py = 0 area = 0 for x, y in zip(X, Y): if x == px: px, py = x, y continue if ax < x: y = py + (y - py) / (x - px) * (ax - px) x = ax area += (x - px) * (y + py) / 2 px, py = x, y if x == ax: break return area NAs = np.arange(1, G, dtype='float') * area / G return Y def func_56b85182ae2a432ebe43cc4137476bab(Ly, Uy, X, G): Y = Uy - Ly area = sum((Y[1:] + Y[:-1]) / 2 * (X[1:] - X[:-1])) def cumul_area(ax): px = 0 py = 0 area = 0 for x, y in zip(X, Y): if x == px: px, py = x, y continue if ax < x: y = py + (y - py) / (x - px) * (ax - px) x = ax area += (x - px) * (y + py) / 2 px, py = x, y if x == ax: break return area NAs = np.arange(1, G, dtype='float') * area / G return area def func_08eb2639638648dc8e6413685c237454(Ly, Uy, X, G): Y = Uy - Ly area = sum((Y[1:] + Y[:-1]) / 2 * (X[1:] - X[:-1])) def cumul_area(ax): px = 0 py = 0 area = 0 for x, y in zip(X, Y): if x == px: px, py = x, y continue if ax < x: y = py + (y - py) / (x - px) * (ax - px) x = ax area += (x - px) * (y + py) / 2 px, py = x, y if x == ax: break return area NAs = np.arange(1, G, dtype='float') * area / G return NAs def func_e1563650f1644cd8adc532a3cdb0e48c(Y, X, W, G): area = sum((Y[1:] + Y[:-1]) / 2 * (X[1:] - X[:-1])) def cumul_area(ax): px = 0 py = 0 area = 0 for x, y in zip(X, Y): if x == px: px, py = x, y continue if ax < x: y = py + (y - py) / (x - px) * (ax - px) x = ax area += (x - px) * (y + py) / 2 px, py = x, y if x == ax: break return area NAs = np.arange(1, G, dtype='float') * area / G points = [bisect(lambda x: cumul_area(x) - NA, 0, W) for NA in NAs] return points def func_16c3d286b53a4185a059acb7cdd941b7(Y, X, W, G): area = sum((Y[1:] + Y[:-1]) / 2 * (X[1:] - X[:-1])) def cumul_area(ax): px = 0 py = 0 area = 0 for x, y in zip(X, Y): if x == px: px, py = x, y continue if ax < x: y = py + (y - py) / (x - px) * (ax - px) x = ax area += (x - px) * (y + py) / 2 px, py = x, y if x == ax: break return area NAs = np.arange(1, G, dtype='float') * area / G points = [bisect(lambda x: cumul_area(x) - NA, 0, W) for NA in NAs] return area def func_1beea74415db416c8f122bf52ae540ce(Y, X, W, G): area = sum((Y[1:] + Y[:-1]) / 2 * (X[1:] - X[:-1])) def cumul_area(ax): px = 0 py = 0 area = 0 for x, y in zip(X, Y): if x == px: px, py = x, y continue if ax < x: y = py + (y - py) / (x - px) * (ax - px) x = ax area += (x - px) * (y + py) / 2 px, py = x, y if x == ax: break return area NAs = np.arange(1, G, dtype='float') * area / G points = [bisect(lambda x: cumul_area(x) - NA, 0, W) for NA in NAs] return NAs def func_83c47fbce0804f06bb936b2044fccb53(Y, X, W, G): area = sum((Y[1:] + Y[:-1]) / 2 * (X[1:] - X[:-1])) def cumul_area(ax): px = 0 py = 0 area = 0 for x, y in zip(X, Y): if x == px: px, py = x, y continue if ax < x: y = py + (y - py) / (x - px) * (ax - px) x = ax area += (x - px) * (y + py) / 2 px, py = x, y if x == ax: break return area NAs = np.arange(1, G, dtype='float') * area / G points = [bisect(lambda x: cumul_area(x) - NA, 0, W) for NA in NAs] return NA def func_f86ebe05fa1c4b76a19fe4214980a2e0(Ly, Uy, X, W, G): Y = Uy - Ly area = sum((Y[1:] + Y[:-1]) / 2 * (X[1:] - X[:-1])) def cumul_area(ax): px = 0 py = 0 area = 0 for x, y in zip(X, Y): if x == px: px, py = x, y continue if ax < x: y = py + (y - py) / (x - px) * (ax - px) x = ax area += (x - px) * (y + py) / 2 px, py = x, y if x == ax: break return area NAs = np.arange(1, G, dtype='float') * area / G points = [bisect(lambda x: cumul_area(x) - NA, 0, W) for NA in NAs] return Y def func_d474fb9112a84f449df6eccd94f0701a(Ly, Uy, X, W, G): Y = Uy - Ly area = sum((Y[1:] + Y[:-1]) / 2 * (X[1:] - X[:-1])) def cumul_area(ax): px = 0 py = 0 area = 0 for x, y in zip(X, Y): if x == px: px, py = x, y continue if ax < x: y = py + (y - py) / (x - px) * (ax - px) x = ax area += (x - px) * (y + py) / 2 px, py = x, y if x == ax: break return area NAs = np.arange(1, G, dtype='float') * area / G points = [bisect(lambda x: cumul_area(x) - NA, 0, W) for NA in NAs] return NAs def func_ec7540897fbc4859bba13c825191236c(Ly, Uy, X, W, G): Y = Uy - Ly area = sum((Y[1:] + Y[:-1]) / 2 * (X[1:] - X[:-1])) def cumul_area(ax): px = 0 py = 0 area = 0 for x, y in zip(X, Y): if x == px: px, py = x, y continue if ax < x: y = py + (y - py) / (x - px) * (ax - px) x = ax area += (x - px) * (y + py) / 2 px, py = x, y if x == ax: break return area NAs = np.arange(1, G, dtype='float') * area / G points = [bisect(lambda x: cumul_area(x) - NA, 0, W) for NA in NAs] return NA def func_617d4017aed54cd1a47436ee5f6a9c77(Ly, Uy, X, W, G): Y = Uy - Ly area = sum((Y[1:] + Y[:-1]) / 2 * (X[1:] - X[:-1])) def cumul_area(ax): px = 0 py = 0 area = 0 for x, y in zip(X, Y): if x == px: px, py = x, y continue if ax < x: y = py + (y - py) / (x - px) * (ax - px) x = ax area += (x - px) * (y + py) / 2 px, py = x, y if x == ax: break return area NAs = np.arange(1, G, dtype='float') * area / G points = [bisect(lambda x: cumul_area(x) - NA, 0, W) for NA in NAs] return area def func_9798caccb3644af2822a2f2778317aed(Ly, Uy, X, W, G): Y = Uy - Ly area = sum((Y[1:] + Y[:-1]) / 2 * (X[1:] - X[:-1])) def cumul_area(ax): px = 0 py = 0 area = 0 for x, y in zip(X, Y): if x == px: px, py = x, y continue if ax < x: y = py + (y - py) / (x - px) * (ax - px) x = ax area += (x - px) * (y + py) / 2 px, py = x, y if x == ax: break return area NAs = np.arange(1, G, dtype='float') * area / G points = [bisect(lambda x: cumul_area(x) - NA, 0, W) for NA in NAs] return points
StarcoderdataPython
3369777
# -*- coding: utf-8 -*- """ Created on Thu May 14 11:50:56 2020 @author: <NAME> """ # %% Import packages import os # %% Set the working directory # IMPORTNAT!! make sure to set the working directory to the path where you # stored the python files, including this script and the Data & Models folders. os.chdir('D:/OneDrive/school/1. Master/8. Machine Learning and Multivariate ' + 'Statistics/Assignment/CMAP_Drug_safety_Machine_learning') # Load local scripts from Data import init, feature_filter import Tree_prediction import SVM_prediction import ANN # %% Initialise the data X_train, Y_train, X_test, Y_test = init(file = 'p3-phh-camda2020.csv', label = 'DILI1', upsample = True, downsample = False) # %% Feature Selection important_feat_index = Tree_prediction.select_features(X_train, Y_train, threshold = 'top1000') # Filter all the data on the feature selection [X_train, X_test] = feature_filter([X_train, X_test], important_feat_index) # %% Random Forest forest_model = Tree_prediction.hyperparameter_tuning(X_train, Y_train, X_test, Y_test, score = 'roc_auc', save_name = 'forest_model') # %% Support Vector machine SVM_model = SVM_prediction.hyperparameter_tuning(X_train, Y_train, X_test, Y_test, save_name = 'SVM_model') # %% Artificial Neural Network ANN_model = ANN.hyperparameter_tuning(X_train, Y_train, X_test, Y_test, balance_class_weights = False)
StarcoderdataPython
4830722
<gh_stars>0 #Embedded file name: ACEStream\Core\DecentralizedTracking\pymdht\core\message_tools.pyo import sys import socket from socket import inet_ntoa, inet_aton import logging import bencode from identifier import Id, ID_SIZE_BYTES, IdError from node import Node logger = logging.getLogger('dht') IP4_SIZE = 4 IP6_SIZE = 16 ADDR4_SIZE = IP4_SIZE + 2 ADDR6_SIZE = IP6_SIZE + 2 C_NODE_SIZE = ID_SIZE_BYTES + ADDR4_SIZE C_NODE2_SIZE = ID_SIZE_BYTES + ADDR6_SIZE IP6_PADDING = '\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\xff\xff' class AddrError(Exception): pass def bin_to_int(bin_str): return ord(bin_str[0]) * 256 + ord(bin_str[1]) def int_to_bin(i): return chr(i / 256) + chr(i % 256) def compact_addr(addr): return ''.join((inet_aton(addr[0]), int_to_bin(addr[1]))) def uncompact_addr(c_addr): if len(c_addr) != ADDR4_SIZE: raise AddrError, 'invalid address size' if c_addr[0] == '\x7f' or c_addr[:2] == '\xc0\xa8': logger.warning('Got private address: %r' % c_addr) raise AddrError, 'private address' ip = inet_ntoa(c_addr[:-2]) port = bin_to_int(c_addr[-2:]) if port == 0: logger.warning('c_addr: %r > port is ZERO' % c_addr) raise AddrError return (ip, port) def compact_peers(peers): return [ compact_addr(peer) for peer in peers ] def uncompact_peers(c_peers): peers = [] for c_peer in c_peers: try: peers.append(uncompact_addr(c_peer)) except AddrError: pass return peers def compact_nodes(nodes): return ''.join([ node.id.bin_id + compact_addr(node.addr) for node in nodes ]) def uncompact_nodes(c_nodes): if len(c_nodes) % C_NODE_SIZE != 0: logger.info('invalid size (%d) %s' % (len(c_nodes), c_nodes)) return [] nodes = [] for begin in xrange(0, len(c_nodes), C_NODE_SIZE): node_id = Id(c_nodes[begin:begin + ID_SIZE_BYTES]) try: node_addr = uncompact_addr(c_nodes[begin + ID_SIZE_BYTES:begin + C_NODE_SIZE]) except AddrError: pass else: node = Node(node_addr, node_id) nodes.append(node) return nodes def compact_nodes2(nodes): return [ node.id.bin_id + compact_addr(node.addr) for node in nodes ] def uncompact_nodes2(c_nodes): nodes = [] for c_node in c_nodes: node_id = Id(c_node[:ID_SIZE_BYTES]) try: node_addr = uncompact_addr(c_node[ID_SIZE_BYTES:]) except AddrError: logger.warning('IPv6 addr in nodes2: %s' % c_node) else: node = Node(node_addr, node_id) nodes.append(node) return nodes
StarcoderdataPython
1763213
<filename>servo/system_config.py # Copyright (c) 2012 The Chromium OS Authors. All rights reserved. # Use of this source code is governed by a BSD-style license that can be # found in the LICENSE file. """System configuration module.""" import collections import glob import logging import os import re import xml.etree.ElementTree # valid tags in system config xml. Any others will be ignored MAP_TAG = 'map' CONTROL_TAG = 'control' SYSCFG_TAG_LIST = [MAP_TAG, CONTROL_TAG] ALLOWABLE_INPUT_TYPES = {'float': float, 'int': int, 'str': str} # pylint: disable=g-bad-exception-name # TODO(coconutruben): figure out if it's worth it to rename this so that it # removes the 'stutter' class SystemConfigError(Exception): """Error class for SystemConfig.""" class SystemConfig(object): """SystemConfig Class. System config files describe how to talk to various pieces on the device under test. The system config may be broken up into multiple file to make it easier to share configs among similar DUTs. This class has the support to take in multiple SystemConfig files and treat them as one unified structure SystemConfig files are written in xml and consist of four main elements 0. Include : Ability to include other config files <include> <name>servo_loc.xml</name> </include> NOTE, All includes in a file WILL be sourced prior to any other elements in the XML. 1. Map : Allow user-friendly naming for things to abstract certain things like on=0 for things that are assertive low on actual h/w <map> <name>onoff_i</name> <doc>assertive low map for on/off</doc> <params on="0" off="1"></params> </map> 2. Control : Bulk of the system file. These elements are typically gpios, adcs, dacs which allow either control or sampling of events on the h/w. Controls should have a 1to1 correspondence with hardware elements between control system and DUT. <control> <name>warm_reset</name> <doc>Reset the device warmly</doc> <params interface="1" drv="gpio" offset="5" map="onoff_i"></params> </control> TODO(tbroch) Implement sequence or deprecate 3. Sequence : List of control calls to create a desired configuration of h/w. These could certainly be done by writing simple scripts to send individual control calls to the server but encapsulating them into the system file should allow for tighter control of the sequence ... especially if timing of the sequence is paramount. <sequence> <name>i2c_mux_seq</name> <cmdlist>i2c_mux_en:off i2c_mux_add:__arg0__ i2c_mux_en:on</cmdlist> </sequence> Public Attributes: control_tags: a dictionary of each base control and their tags if any aliases: a dictionary of an alias mapped to its base control name syscfg_dict: 3-deep dictionary created when parsing system files. Its organized as [tag][name][type] where: tag: map | control | sequence name: string name of tag element type: data type of payload either, doc | get | set presently doc: string describing the map,control or sequence get: a dictionary for getting values from named control set: a dictionary for setting values to named control hwinit: list of control tuples (name, value) to be initialized in order Private Attributes: _loaded_xml_files: set of filenames already loaded to avoid sourcing XML multiple times. """ def __init__(self): """SystemConfig constructor.""" self._logger = logging.getLogger('SystemConfig') self._logger.debug('') self.control_tags = collections.defaultdict(list) self.aliases = {} self.syscfg_dict = collections.defaultdict(dict) self.hwinit = [] self._loaded_xml_files = [] self._board_cfg = None def find_cfg_file(self, filename): """Find the filename for a system XML config file. If the provided `filename` names a valid file, use that. Otherwise, `filename` must name a file in the 'data' subdirectory stored with this module. Returns the path selected as described above; if neither of the paths names a valid file, return `None`. Args: filename: string of path to system file ( xml ) Returns: string full path of |filename| if it exists, otherwise None """ if os.path.isfile(filename): return filename default_path = os.path.join(os.path.dirname(__file__), 'data') fullname = os.path.join(default_path, filename) if os.path.isfile(fullname): return fullname return None @staticmethod def tag_string_to_tags(tag_str): """Helper to split tag string into individual tags.""" return tag_str.split(',') def get_all_cfg_names(self): """Return all XML config file names. Returns: A list of file names. """ exclude_re = re.compile(r'servo_.*_overlay\.xml') pattern = os.path.join(os.path.dirname(__file__), 'data', '*.xml') cfg_names = [] for name in glob.glob(pattern): name = os.path.basename(name) if not exclude_re.match(name): cfg_names.append(name) return cfg_names def set_board_cfg(self, filename): """Save the filename for the board config.""" self._board_cfg = filename def get_board_cfg(self): """Return the board filename.""" return self._board_cfg def add_cfg_file(self, filename, name_prefix=None, interface_increment=0): """Add system config file to the system config object. Each design may rely on multiple system files so need to have the facility to parse them all. For example, we may have a: 1. default for all controls that are the same for each of the control systems 2. default for a particular DUT system's usage across the connector 3. specific one for particular version of DUT (evt,dvt,mp) 4. specific one for a one-off rework done to a system Special key parameters in config files: clobber_ok: signifies this control may _clobber_ an existing definition of the same name. Note, its value is ignored ( clobber_ok='' ) NOTE, method is recursive when parsing 'include' elements from XML. The arguments name_prefix and interface_increment are used to support multiple servo micros. The interfaces of the extra servo micros, like the one for hammer, are relocated to higher slots. The controls of this extra servo micros should be shifted their interface numbers. Adding the name prefix avoid conflict with the main servo micro. Args: filename: string of path to system file ( xml ) name_prefix: string to prepend to all control names interface_increment: number to add to all interfaces Raises: SystemConfigError: for schema violations, or file not found. """ cfgname = self.find_cfg_file(filename) if not cfgname: msg = 'Unable to find system file %s' % filename self._logger.error(msg) raise SystemConfigError(msg) filename = cfgname if (filename, name_prefix, interface_increment) in self._loaded_xml_files: self._logger.warn('Already sourced system file (%s, %s, %d).', filename, name_prefix, interface_increment) return self._loaded_xml_files.append((filename, name_prefix, interface_increment)) self._logger.info('Loading XML config (%s, %s, %d)', filename, name_prefix, interface_increment) root = xml.etree.ElementTree.parse(filename).getroot() for element in root.findall('include'): self.add_cfg_file( element.find('name').text, name_prefix, interface_increment) for tag in SYSCFG_TAG_LIST: for element in root.findall(tag): element_str = xml.etree.ElementTree.tostring(element) try: name = element.find('name').text if tag == CONTROL_TAG and name_prefix: name = name_prefix + name except AttributeError: # TODO(tbroch) would rather have lineno but dumping element seems # better than nothing. Utimately a DTD/XSD for the XML schema will # catch these anyways. raise SystemConfigError('%s: no name ... see XML\n%s' % (tag, element_str)) try: doc = ' '.join(element.find('doc').text.split()) except AttributeError: doc = 'undocumented' try: alias = element.find('alias').text except AttributeError: alias = None try: remap = element.find('remap').text except AttributeError: remap = None if remap: try: if name_prefix: remap = name_prefix + remap self.syscfg_dict[tag][remap] = self.syscfg_dict[tag][name] except KeyError: # Sometimes the remap control doesn't exist (e.g. fw_up in servo # v4). Just ignore it and continue on. pass continue get_dict = None set_dict = None clobber_ok = False params_list = element.findall('params') # Modify the interface attributes. for params in params_list: if 'interface' in params.attrib: if params.attrib['interface'] != 'servo': interface_id = int(params.attrib['interface']) params.attrib['interface'] = interface_id + interface_increment if len(params_list) == 2: assert tag != MAP_TAG, 'maps have only one params entry' for params in params_list: if 'cmd' not in params.attrib: raise SystemConfigError('%s %s multiple params but no cmd\n%s' % (tag, name, element_str)) cmd = params.attrib['cmd'] if cmd == 'get': if get_dict: raise SystemConfigError( '%s %s multiple get params defined\n%s' % (tag, name, element_str)) get_dict = params.attrib elif cmd == 'set': if set_dict: raise SystemConfigError( '%s %s multiple set params defined\n%s' % (tag, name, element_str)) set_dict = params.attrib else: raise SystemConfigError("%s %s cmd of 'get'|'set' not found\n%s" % (tag, name, element_str)) elif len(params_list) == 1: get_dict = params_list[0].attrib set_dict = get_dict else: raise SystemConfigError('%s %s has illegal number of params %d\n%s' % (tag, name, len(params_list), element_str)) # Save the control name to the params dicts, such that the driver can # refer to it. if tag == CONTROL_TAG: get_dict['control_name'] = name set_dict['control_name'] = name clobber_ok = ('clobber_ok' in set_dict or 'clobber_ok' in get_dict) if (tag == CONTROL_TAG and name in self.syscfg_dict[tag] and not clobber_ok): raise SystemConfigError( "Duplicate %s %s without 'clobber_ok' key\n%s" % (tag, name, element_str)) if tag == MAP_TAG: self.syscfg_dict[tag][name] = {'doc': doc, 'map_params': get_dict} if alias: raise SystemConfigError('No aliases for maps allowed') continue if 'init' in set_dict: hwinit_found = False # only allow one hwinit per control if clobber_ok: for i, (hwinit_name, _) in enumerate(self.hwinit): if hwinit_name == name: self.hwinit[i] = (name, set_dict['init']) hwinit_found = True break if not hwinit_found: self.hwinit.append((name, set_dict['init'])) if clobber_ok and name in self.syscfg_dict[tag]: # it's an existing control self.syscfg_dict[tag][name]['get_params'].update(get_dict) self.syscfg_dict[tag][name]['set_params'].update(set_dict) if doc != 'undocumented': self.syscfg_dict[tag][name]['doc'] = doc else: # it's a new control self.syscfg_dict[tag][name] = { 'doc': doc, 'get_params': get_dict, 'set_params': set_dict } if alias: for aliasname in (elem.strip() for elem in alias.split(',')): if name_prefix: aliasname = name_prefix + aliasname self.syscfg_dict[tag][aliasname] = self.syscfg_dict[tag][name] # Also store what the alias relationship self.aliases[aliasname] = name def finalize(self): """Finalize setup, Call this after no more config files will be added. Note: this can be called repeatedly, and will overwrite the previous results. - Sets up tags for each control, if provided """ self.control_tags.clear() # Tags are only stored for the primary control name, not their aliases. base_controls = [control for control in self.syscfg_dict[CONTROL_TAG] if control not in self.aliases] for control in base_controls: # Tags are only read out of the get dict for now. If a control defines # seperate get and set dicts, please make sure to define the tags in the # get dict. get_dict = self.syscfg_dict[CONTROL_TAG][control]['get_params'] if 'tags' in get_dict: tags = SystemConfig.tag_string_to_tags(get_dict['tags']) for tag in tags: self.control_tags[tag].append(control) def get_controls_for_tag(self, tag): """Get list of controls for a given tag. Args: tag: str, tag to query Returns: list of controls with that tag, or an empty list if no such tag, or controls under that tag """ # Checking here ensures that we do not generate an empty list (as it's a # default dict) if tag not in self.control_tags: self._logger.info('Tag %s unknown.', tag) return [] return self.control_tags[tag] def lookup_control_params(self, name, is_get=True): """Lookup & return control parameter dictionary. Note, controls must have either one or two set of parameters. In the case of two, the dictionary must contain k=v element of 'type':'get' or 'type':'set' Args: name: string of control name to lookup is_get: boolean of whether params should be for 'get' | 'set' Returns: control's parameter dictionary for approrpiate get or set Raises: NameError: if control name not found SystemConfigError: if error encountered identifying parameters """ if name not in self.syscfg_dict[CONTROL_TAG]: raise NameError('No control named %s. All controls:\n%s' % (name, ','.join(sorted(self.syscfg_dict[CONTROL_TAG])))) if is_get: return self.syscfg_dict[CONTROL_TAG][name]['get_params'] else: return self.syscfg_dict[CONTROL_TAG][name]['set_params'] def is_control(self, name): """Determine if name is a control or not. Args: name: string of control name to lookup Returns: boolean, True if name is control, False otherwise """ return name in self.syscfg_dict[CONTROL_TAG] def get_control_docstring(self, name): """Get controls doc string. Args: name: string of control name to lookup Returns: doc string of the control """ return self.syscfg_dict[CONTROL_TAG][name]['doc'] def _lookup(self, tag, name_str): """Lookup the tag name_str and return dictionary or None if not found. Args: tag: string of tag (from SYSCFG_TAG_LIST) to look for name_str under. name_str: string of name to lookup Returns: dictionary from syscfg_dict[tag][name_str] or None """ self._logger.debug('lookup of %s %s', tag, name_str) return self.syscfg_dict[tag].get(name_str) def resolve_val(self, params, map_vstr): """Resolve string value. Values to set the control to can be mapped to symbolic strings for better readability. For example, its difficult to remember assertion levels of various gpios. Maps allow things like 'reset:on'. Also provides abstraction so that assertion level doesn't have to be exposed. Args: params: parameters dictionary for control map_vstr: string thats acceptable values are: an int (can be "DECIMAL", "0xHEX", 0OCT", or "0bBINARY". a floating point value. an alphanumeric which is key in the corresponding map dictionary. Returns: Resolved value as float or int or str depending on mapping & input type Raises: SystemConfigError: mapping issues found """ # its a map err = 'Unknown error formatting input value.' if 'map' in params: map_dict = self._lookup(MAP_TAG, params['map']) if map_dict is None: raise SystemConfigError("Map %s isn't defined" % params['map']) try: map_vstr = map_dict['map_params'][map_vstr] except KeyError: # Do not raise error yet. This might just be that the input is not # using the map i.e. it's directly writing a raw mapped value. err = "Map '%s' doesn't contain key '%s'\n" % (params['map'], map_vstr) err += "Try one of -> '%s'" % "', '".join(map_dict['map_params']) if 'input_type' in params: if params['input_type'] in ALLOWABLE_INPUT_TYPES: try: input_type = ALLOWABLE_INPUT_TYPES[params['input_type']] return input_type(map_vstr) except ValueError: err += "\n%s Input should be 'int' or 'float'." % ('Or' if 'Map' in err else '') else: self._logger.error('Unrecognized input type.') # TODO(tbroch): deprecate below once all controls have input_type params try: return int(str(map_vstr), 0) except ValueError: pass try: return float(str(map_vstr)) except ValueError: # No we know that nothing worked, and there was an error. raise SystemConfigError(err) # pylint: disable=invalid-name # Naming convention to dynamically find methods based on config parameter def _Fmt_hex(self, int_val): """Format integer into hex. Args: int_val: integer to be formatted into hex string Returns: string of integer in hex format """ return hex(int_val) def reformat_val(self, params, value): """Reformat value. Formatting determined via: 1. if has map, then remap 2. else if has fmt param, use that function Args: params: parameter dictionary for control value: value to reformat Returns: formatted string value if reformatting needed value otherwise Raises: SystemConfigError: errors using formatting param """ # TODO(crbug.com/841097): revisit logic for value here once # resolution found on bug. if value is not None and 'map' not in params and 'fmt' not in params: return value reformat_value = str(value) if 'map' in params: map_dict = self._lookup(MAP_TAG, params['map']) if map_dict: for keyname, val in map_dict['map_params'].items(): if val == reformat_value: reformat_value = keyname break elif 'fmt' in params: fmt = params['fmt'] try: func = getattr(self, '_Fmt_%s' % fmt) except AttributeError: raise SystemConfigError('Unrecognized format %s' % fmt) try: reformat_value = func(value) except Exception: raise SystemConfigError('Problem executing format %s' % fmt) return reformat_value def display_config(self, tag=None, prefix=None): """Display human-readable values of map, control, or sequence. Args: tag : string of either 'map' | 'control' | 'sequence' or None for all prefix: prefix string to print infront of control tags Returns: string to be displayed. """ rsp = [] if tag is None: tag_list = SYSCFG_TAG_LIST else: tag_list = [tag] for tag in sorted(tag_list): prefix_str = '' if tag == CONTROL_TAG and prefix: prefix_str = '%s.' % prefix rsp.append('*************') rsp.append('* ' + tag.upper()) rsp.append('*************') max_len = max(len(name) for name in self.syscfg_dict[tag]) max_len += len(prefix_str) dashes = '-' * max_len for name in sorted(self.syscfg_dict[tag]): item_dict = self.syscfg_dict[tag][name] padded_name = '%-*s' % (max_len, '%s%s' % (prefix_str, name)) rsp.append('%s DOC: %s' % (padded_name, item_dict['doc'])) if tag == MAP_TAG: rsp.append('%s MAP: %s' % (dashes, str(item_dict['map_params']))) else: rsp.append('%s GET: %s' % (dashes, str(item_dict['get_params']))) rsp.append('%s SET: %s' % (dashes, str(item_dict['set_params']))) return '\n'.join(rsp) def test(): """Integration test. TODO(tbroch) Enhance integration test and add unittest (see mox) """ # pylint: disable=protected-access,raising-format-tuple,g-doc-exception # Test method that's likely to be removed as more unit-tests roll out. logging.basicConfig( level=logging.DEBUG, format='%(asctime)s - %(name)s - %(levelname)s - %(message)s') scfg = SystemConfig() # TODO(tbroch) make this a comprenhensive test xml file scfg.add_cfg_file(os.path.join('data', 'servo.xml')) scfg.display_config() control_dict = scfg._lookup('control', 'goog_rec_mode') # checking mapping functionality control_params = control_dict['get_params'] control_params = control_dict['set_params'] if 'map' in control_params: map_name = control_params['map'] map_dict = scfg._lookup('map', map_name) if not map_dict: raise Exception('Unable to find map %s', map_name) logging.info('') for keyname, val in map_dict['map_params'].items(): resolved_val = str(scfg.resolve_val(control_params, keyname)) if resolved_val != val: logging.error('resolve failed for %s -> %s != %s', keyname, val, resolved_val) # try re-mapping reformat_val = scfg.reformat_val(control_params, int(val)) reformat_val = scfg.reformat_val(control_params, val) if reformat_val != keyname: logging.error('reformat failed for %s -> %s != %s', val, keyname, reformat_val) if __name__ == '__main__': test()
StarcoderdataPython
1691552
<reponame>hmmartiny/LazyFunctions import numpy as np import matplotlib.pyplot as plt from matplotlib import gridspec as gridspec """ An attempt at making a class for drawing advanced dendrograms with Python.py Both linear and circular (polar) dendrograms. """ class Dendogram: """Inspired by https://stackoverflow.com/a/52517178/15704316""" def __init__(self, dendrogram, annotations): self.icoord = dendrogram['icoord'] self.dcoord = dendrogram['dcoord'] self.leave_labels = dendrogram['ivl'] self.leaves = dendrogram['leaves'] self.get_leave_coords() self.annotations = annotations def get_leave_coords(self): # flatten icoord_flattened = [item for sublist in self.icoord for item in sublist] dcoord_flattened = [item for sublist in self.dcoord for item in sublist] # extract leave_coords = [(x,y) for x,y in zip(icoord_flattened, dcoord_flattened) if y == 0] # get leave order in dendrogram leave_order = np.argsort([x for x, _ in leave_coords]) # map id to coordinates self.leaveid_to_coord = dict(zip( self.leaves, [leave_coords[idx] for idx in leave_order] )) self.coord_to_leave = {v: k for k, v in self.leaveid_to_coord.items()} # map id to label self.leaveid2leavelabel = {lid: ll for lid, ll in zip(self.leaves, self.leave_labels)} def _branches(self, ax, icoords, dcoords, color='black', lw=1, limit=None, plot_leaves=True, leaf_args={}): max_coord = 0 for i, (xs, ys) in enumerate(zip(icoords, dcoords)): ax.plot(xs, ys, color="black", lw=lw) if plot_leaves: self._leaf(ax, xs, ys, **leaf_args) if max(xs) > max_coord: max_coord = max(xs) if isinstance(limit, int) and i > limit: break ax.set_xlim(-.1, max_coord + 2) def get_leaf_formatting(self, node, column, default): try: nf = self.annotations.loc[self.annotations.node == node, column].item() except: nf = default return nf def _leaf(self, ax, xs, ys, leaf_shape=None, leaf_color=None, leaf_size=2): for x, y in zip(xs, ys): if y == 0: try: leaf_id = self.coord_to_leave[(x,y)] except: continue leaf_label = self.leaveid2leavelabel[leaf_id] shape = self.get_leaf_formatting(node=leaf_label, column=leaf_shape, default='o') color = self.get_leaf_formatting(node=leaf_label, column=leaf_color, default='black') ax.plot(x, y, shape, color=color, ms=leaf_size) def plot_linear(self, figsize, limit=None, plot_leaves=True, leaf_args = {}): fig = plt.figure(figsize=figsize) gs = gridspec.GridSpec(nrows=1, ncols=1)#, **gridspec_kw) ax = fig.add_subplot(gs[0]) #ax_leaf = fig.add_subplot(gs[1], sharex=ax) # plot branches and leaves self._branches(ax, self.icoord, self.dcoord, limit=limit, plot_leaves=plot_leaves, leaf_args=leaf_args) ax.get_xaxis().set_visible(False) ax.set_ylim(-.1, ax.get_ylim()[1] + .1) for spine in ['top', 'right']: ax.spines[spine].set_visible(False) plt.close(fig) return fig def polar_leaf(self, ax, x, y, xo, yo, leaf_shape=None, leaf_color=None, leaf_size=2): try: leaf_id = self.coord_to_leave[(xo, yo)] leaf_label = self.leaveid2leavelabel[leaf_id] shape = self.get_leaf_formatting(node=leaf_label, column=leaf_shape, default='o') color = self.get_leaf_formatting(node=leaf_label, column=leaf_color, default='black') except: shape, color = 'o', 'black' ax.plot(x, y, shape, color=color, ms=leaf_size) def plot_circular(self, figsize, limit=None, plot_leaves=True, leaf_args={}, lw=1): fig = plt.figure(figsize=figsize) gs = gridspec.GridSpec(nrows=1, ncols=1) ax = fig.add_subplot(gs[0], polar=True) dcoords = -np.log(np.asarray(self.dcoord) + 1) gap = .1 icoord = np.asarray(self.icoord) imax = icoord.max() imin = icoord.min() icoords = ((icoord - imin) / (imax - imin) * (1-gap) + gap / 2) * 2 * np.pi #self._branches(ax, icoords, dcoords, plot_leaves=plot_leaves) for i, (xs, ys) in enumerate(zip(icoords, dcoords)): if plot_leaves: for j, (x, y) in enumerate(zip(xs, ys)): if y == 0: xo, yo = (self.icoord[i][j], self.dcoord[i][j]) self.polar_leaf(ax, x, y, xo, yo, **leaf_args) xss = np.concatenate([[xs[0]], np.linspace(xs[1], xs[2], 100), [xs[3]]]) yss = np.concatenate([[ys[0]], np.linspace(ys[1], ys[2], 100), [ys[3]]]) ax.plot(xss, yss, color='black', lw=lw) if limit is not None and i > limit: break ax.spines['polar'].set_visible(False) ax.xaxis.grid(False) ax.set_xticklabels([]) plt.close(fig) return fig if __name__ == '__main__': dnd = Dendogram(dend, anno) leaf_args = {'leaf_color': 'gene_color', 'leaf_shape': 'shape','leaf_size': 2} dnd.plot_linear(figsize=(10, 10), plot_leaves=True, leaf_args=leaf_args, limit=10) dnd.plot_circular(figsize=(10, 10), plot_leaves=True, lw=.05, leaf_args=leaf_args, limit=10)
StarcoderdataPython
4812904
""" Constants module """ class Status(object): """ Utim status class """ STATUS_NEWBORN = 'STATUS_NEWBORN' STATUS_SRP = 'STATUS_SRP' STATUS_CONFIGURING = 'STATUS_CONFIGURING' STATUS_TESTING = 'STATUS_TESTING' STATUS_DONE = 'STATUS_DONE' STATUS_NO_CONFIG = 'STATUS_NO_CONFIG' STATUS_DED = 'STATUS_DED' class Flags(object): """ Utim flags object """ FLAG_NONE = 0 FLAG_RECONFIGURE = 1
StarcoderdataPython
3200656
<reponame>AdityaSidharta/shopee_data_science import math import torch def get_batch_info(dataloader): n_obs = len(dataloader.dataset) batch_size = dataloader.batch_size n_batch_per_epoch = math.ceil(n_obs / float(batch_size)) return n_obs, batch_size, n_batch_per_epoch def img2tensor(img_array, device): img_array = img_array.transpose((2, 0, 1)) return torch.from_numpy(img_array).float().to(device)
StarcoderdataPython
3320343
<gh_stars>1-10 # Copyright (c) 2017-present, Facebook, Inc. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. ############################################################################## """ @author: <NAME> network head for classification. The design is as follows: ... -> Feature Map -> MLP HEAD -> Classification loss """ from __future__ import absolute_import from __future__ import division from __future__ import print_function from __future__ import unicode_literals from detectron.core.config import cfg from detectron.utils.c2 import const_fill from detectron.utils.c2 import gauss_fill import detectron.utils.blob as blob_utils def add_mlp_outputs(model, blob_in, dim): """Add classification ops.""" model.FC( blob_in, 'logits', dim, model.num_classes, weight_init=gauss_fill(0.01), bias_init=const_fill(0.0) ) if not model.train: # == if test # Only add softmax when testing; during training the softmax is combined # with the label cross entropy loss for numerical stability model.Softmax('logits', 'cls_prob', engine='CUDNN') def add_mlp_losses(model): """Add losses for classification """ cls_prob, loss_cls = model.net.SoftmaxWithLoss( ['logits', 'labels_int32'], ['cls_prob', 'loss_cls'], scale=model.GetLossScale() ) loss_gradients = blob_utils.get_loss_gradients(model, [loss_cls]) model.Accuracy(['cls_prob', 'labels_int32'], 'accuracy_cls') model.AddLosses(['loss_cls']) model.AddMetrics('accuracy_cls') return loss_gradients def add_Xmlp_head(model, blob_in, dim_in): hidden_dims = cfg.CLASSIFICATION.MLP_HEADS_DIM avg_kernel = cfg.CLASSIFICATION.FINAL_AVG_KERNEL dropout_rate = cfg.CLASSIFICATION.DROPOUT_RATE is_test = False model.AveragePool( blob_in, 'final_avg', kernel=avg_kernel, stride=1, global_pooling=True, ) blob_in = 'final_avg' for i,hidden_dim in enumerate(hidden_dims): model.FC(blob_in, 'fc'+str(6+i), dim_in , hidden_dim) model.Relu('fc'+str(6+i), 'fc'+str(6+i)) if not model.train: is_test = True model.Dropout('fc'+str(6+i), 'drop_fc'+str(6+i), ratio=dropout_rate, is_test=is_test) blob_in = 'drop_fc'+str(6+i) dim_in = hidden_dim return blob_in, dim_in
StarcoderdataPython
179250
<filename>gdcv/db/base_match_state.py from sqlalchemy import Column, String, Integer, BigInteger, PrimaryKeyConstraint class BaseMatchState(object): __table_args__ = ( PrimaryKeyConstraint('event_key', 'match_id', 'wall_time'), ) event_key = Column(String(16), nullable=False) # Like 2017nyny match_id = Column(String(16), nullable=False) # Like qm1 play = Column(Integer, nullable=False) # Accounts for replays wall_time = Column(BigInteger, nullable=False) mode = Column(String(16)) # pre_match, auto, teleop, post_match time_remaining = Column(Integer) # Number of seconds remaining in mode red_score = Column(Integer) blue_score = Column(Integer)
StarcoderdataPython
1622160
<filename>tests/test_parser.py """Define tests for parser endpoints.""" import aiohttp import pytest from regenmaschine import Client from .common import TEST_HOST, TEST_PASSWORD, TEST_PORT, load_fixture @pytest.mark.asyncio async def test_parsers_current(aresponses, authenticated_local_client): """Test getting all current parsers.""" async with authenticated_local_client: authenticated_local_client.add( f"{TEST_HOST}:{TEST_PORT}", "/api/4/parser", "get", aresponses.Response(text=load_fixture("parser_response.json"), status=200), ) async with aiohttp.ClientSession() as session: client = Client(session=session) await client.load_local(TEST_HOST, TEST_PASSWORD, port=TEST_PORT, ssl=False) controller = next(iter(client.controllers.values())) data = await controller.parsers.current() assert len(data) == 1 assert data[0]["name"] == "NOAA Parser" @pytest.mark.asyncio async def test_parsers_post_data(aresponses, authenticated_local_client): """Test pushing data to parser.""" async with authenticated_local_client: authenticated_local_client.add( f"{TEST_HOST}:{TEST_PORT}", "/api/4/parser/data", "post", aresponses.Response( text=load_fixture("parser_post_data_response.json"), status=200 ), ) async with aiohttp.ClientSession() as session: client = Client(session=session) await client.load_local(TEST_HOST, TEST_PASSWORD, port=TEST_PORT, ssl=False) controller = next(iter(client.controllers.values())) payload = load_fixture("parser_post_data_payload.json") data = await controller.parsers.post_data(payload) assert len(data) == 2 assert data["message"] == "OK"
StarcoderdataPython